<%BANNER%>

Optimizing Adeno-Associated Virus as a Gene Therapy Vector for Treating Arthritis

Permanent Link: http://ufdc.ufl.edu/UFE0041183/00001

Material Information

Title: Optimizing Adeno-Associated Virus as a Gene Therapy Vector for Treating Arthritis
Physical Description: 1 online resource (105 p.)
Language: english
Creator: Kay, Jesse
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: aav, arthritis, gene, orthopedics, therapy
Biochemistry and Molecular Biology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Gene-based therapies offer enormous potential for the treatment of chronic joint conditions, presenting the capacity to directly change the biology of diseased or damaged tissues. Adeno-associated virus (AAV), a parvovirus with a single stranded DNA genome, has emerged as the most favorable viral vector for use in human clinical applications, due primarily to its safety profile. However, many challenges still face AAV-based gene therapy technology, as AAV is completely dependent on cellular mechanisms for entry, nuclear trafficking, and second strand synthesis of its genome. The recent development of self-complementary (sc) vectors, which bypass the need for second strand synthesis, and the capacity to cross-package the AAV2 vector into different capsid serotypes have expanded both the efficacy and versatility of this system. Determining the effectiveness of scAAV was the first step of our study. To accurately compare conventional single-stranded AAV (ssAAV) and scAAV vectors, identical expression cassettes were inserted into both viral genome types, and were packaged in serotype 2 capsids for use in vitro and in vivo. These two viral genome types were used for infection of cells in culture and for intra-articular injections of rabbits. Measurements of transgene expression in vitro verified an earlier onset and higher levels of gene expression when using scAAV. The gene for the anti-inflammatory interleukin-1 receptor antagonist (IL-1Ra) was used as the transgene for animal experiments, and therapeutic results were achieved with the self-complementary vector. Another step for optimization of AAV based gene transfer is selecting the most effective capsid serotype for the target tissue. Various joint tissues from rat, horse, and human were used to screen a battery of AAV serotypes. The outcomes of these screens showed that types 2 and 5 were most effective overall, but also that equine tissues were highly receptive to any AAV transduction with any serotype. When scAAV.IL-1Ra was injected into equine joints, the result was transgene expression levels matching the therapeutic levels seen in the rabbit study. Further enhancement of AAV transduction can be achieved through mutations of the capsid that inhibit intracellular degradation. These data continue to support the viability of AAV as a safe and effective gene therapy vector for treatment of joint diseases.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Jesse Kay.
Thesis: Thesis (Ph.D.)--University of Florida, 2009.
Local: Adviser: Ghivizzani, Steven.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0041183:00001

Permanent Link: http://ufdc.ufl.edu/UFE0041183/00001

Material Information

Title: Optimizing Adeno-Associated Virus as a Gene Therapy Vector for Treating Arthritis
Physical Description: 1 online resource (105 p.)
Language: english
Creator: Kay, Jesse
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: aav, arthritis, gene, orthopedics, therapy
Biochemistry and Molecular Biology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Gene-based therapies offer enormous potential for the treatment of chronic joint conditions, presenting the capacity to directly change the biology of diseased or damaged tissues. Adeno-associated virus (AAV), a parvovirus with a single stranded DNA genome, has emerged as the most favorable viral vector for use in human clinical applications, due primarily to its safety profile. However, many challenges still face AAV-based gene therapy technology, as AAV is completely dependent on cellular mechanisms for entry, nuclear trafficking, and second strand synthesis of its genome. The recent development of self-complementary (sc) vectors, which bypass the need for second strand synthesis, and the capacity to cross-package the AAV2 vector into different capsid serotypes have expanded both the efficacy and versatility of this system. Determining the effectiveness of scAAV was the first step of our study. To accurately compare conventional single-stranded AAV (ssAAV) and scAAV vectors, identical expression cassettes were inserted into both viral genome types, and were packaged in serotype 2 capsids for use in vitro and in vivo. These two viral genome types were used for infection of cells in culture and for intra-articular injections of rabbits. Measurements of transgene expression in vitro verified an earlier onset and higher levels of gene expression when using scAAV. The gene for the anti-inflammatory interleukin-1 receptor antagonist (IL-1Ra) was used as the transgene for animal experiments, and therapeutic results were achieved with the self-complementary vector. Another step for optimization of AAV based gene transfer is selecting the most effective capsid serotype for the target tissue. Various joint tissues from rat, horse, and human were used to screen a battery of AAV serotypes. The outcomes of these screens showed that types 2 and 5 were most effective overall, but also that equine tissues were highly receptive to any AAV transduction with any serotype. When scAAV.IL-1Ra was injected into equine joints, the result was transgene expression levels matching the therapeutic levels seen in the rabbit study. Further enhancement of AAV transduction can be achieved through mutations of the capsid that inhibit intracellular degradation. These data continue to support the viability of AAV as a safe and effective gene therapy vector for treatment of joint diseases.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Jesse Kay.
Thesis: Thesis (Ph.D.)--University of Florida, 2009.
Local: Adviser: Ghivizzani, Steven.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0041183:00001


This item has the following downloads:


Full Text

PAGE 1

OPTIMIZING ADENO-ASSOCIATED VIRU S AS A GENE THERAPY VECTOR FOR TREATING ARTHRITIS By JESSE DOUGLAS KAY A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORID A IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2009 1

PAGE 2

2009 Jesse Douglas Kay 2

PAGE 3

To my parents, Thomas and Linda Kay 3

PAGE 4

ACKNOWLEDGMENTS I would like to thank Dr. Steve C. Ghivi zzani for the opportunity and freedom to learn in his lab. My commi ttee members, Dr. Gregory Schul tz, Dr. Arun Srivastava, and Dr. William Hauswirth, support and suggestions were also of great help. I could not have done anything without my lab: Marsha, Rachael, Paddy, Anthony, Celine, and former members Dr. Jean-Noel Gouze, Dr. Elvire Gouze, Dr. Jeet-Paul Saran, and Tommy Currie. My first real taste of research was in the lab of Dr. John S. Penn at Vanderbilt University, and Im grateful for the time and patience he had with me at the beginning. The rest of the Penn Lab, Dr. Gary W McCollum, Dr. Xiang Xi Werdich, Kathy, Cynthia, and Josh were all great labmat es whom I havent forgotten. I would not have even thought of becoming a scientist without the firm push in that direction from my high school teacher Mr. Koorstad. He convinced me to spend a summer at an HHMI funded summer camp in Iowa, and until then, I did not know how much fun DNA could be. Saving the best for last, I w ould like to acknowledge my parents, my brother, my fiance, and all my friends who have loved and supported me more than I could ever thank them. 4

PAGE 5

TABLE OF CONTENTS page ACKNOWLEDGMENTS ..................................................................................................4 LIST OF TABLES ............................................................................................................7 LIST OF FIGURES ..........................................................................................................8 ABSTRACT ...................................................................................................................12 CHAPTER 1 INTRODUC TION....................................................................................................14 Arthritis ....................................................................................................................14 Joint Structure ..................................................................................................14 Rheumatoid Arthritis .........................................................................................16 Osteoarthritis ....................................................................................................16 Treatments for Arthritis ...........................................................................................19 Biologics ...........................................................................................................19 IL-1Ra ...............................................................................................................20 TNFInhibitors ................................................................................................21 Gene Therapy Vectors ............................................................................................23 Nonviral ............................................................................................................23 Retrovirus and Lentivirus ..................................................................................24 Adenovirus .......................................................................................................24 Adeno-Associated Virus ...................................................................................26 AAV Biology ............................................................................................................26 Genome and Replication ..................................................................................26 Entry and Trafficking ........................................................................................27 Tropism and Receptors ....................................................................................28 Immune Response ...........................................................................................29 Optimizing AAV Transduction for Gene Therapy ..............................................31 Self-complementary genomes ...................................................................31 Capsid modification ....................................................................................31 Proteasome inhibition ................................................................................33 2 INTRA-ARTICULAR GENE DELIVERY AND EXPRESSION OF IL-1RA MEDIATED BY SELF-COMPLEMENTAR Y ADENO-ASSOCIATED VIRUS..........36 Introduction .............................................................................................................36 Materials and Methods ............................................................................................39 Construction and Generation of AAV Vectors ..................................................39 Isolation and Infection of Primary Articular Fibroblasts .....................................40 Quantitation of Viral Genomes in Cy toplasmic and Nuclear Cell Fractions ......41 Animal Models ..................................................................................................42 5

PAGE 6

Statistical Analysis ............................................................................................43 Results ....................................................................................................................43 scAAV Transduces Rabbit Synovial Fibroblasts with High Efficiency ...............43 Intra-Articular Expression of AAV.IL -1Ra in Normal and Arthritic Rabbit Knee Joints ...................................................................................................45 Repeat Dose of AAV.IL-1Ra does not Restore Transgene Expression ............47 Discussion ..............................................................................................................48 3 SELF-COMPLEMENTARY ADENO-ASSOCIATED VIRUS MEDIATED DELIVERY TO RAT AND EQ UINE JOINT TISSUES .............................................56 Introduction .............................................................................................................56 Materials and Methods ............................................................................................58 scAAV Vector Production .................................................................................58 Equine Tissue Collection ..................................................................................59 In Vitro Viral Infections .....................................................................................60 Cell Fractionation and Quantif ication of Viral Genomes ...................................61 Neuraminidase Treatment ................................................................................61 In Vivo scAAV Delivery .....................................................................................62 Results ....................................................................................................................62 Equine Cells are Highly Receptive to AAV Transduction .................................62 Transduction Patterns Vary by Species ...........................................................64 AAV2 and AAV5 Transgene Expression in Equine Synovial Fibroblasts .........64 Sialic Acid is Primarily Responsible for AAV5 Transduction of Equine Synovial Cells ................................................................................................65 Intra-Articular Delivery of scAAV Sero types 5 and 8 to the Rat Knee Joint ......65 Equine Joints Express High Lev els of AAV2 and AAV5 Delivered Transgene .....................................................................................................67 Capsid Modifications of Tyrosine to Phenylalanine Enhances Effectiveness ...68 Discussion ..............................................................................................................68 scAAV Differentially Transduces Joint Cells from Different Species ................69 scAAV Transduction of Equine Synovial Cells .................................................70 Capsid Modification of AAV5 Enhances Transduction .....................................71 scAAV Mediated Gene Transfer to Rat and Equine Joints ...............................72 Implications from Animal Models ......................................................................73 4 SUMMARY AND FUT URE DIRECTIONS..............................................................86 LIST OF REFERENCES ...............................................................................................89 BIOGRAPHICAL SKETCH ..........................................................................................105 6

PAGE 7

LIST OF TABLES Table page 1-1 Known receptors for several AAV serotypes ......................................................34 7

PAGE 8

LIST OF FIGURES Figure page 1-1 The organization of ssAAV and scAAV. .............................................................35 2-1 scAAV-mediated gene transfer to rabbi t articular fibroblasts in vitro. .................52 2-2 Infection of primary synovial fibrobl asts with scAAV.IL-1Ra results in high level expression of the transgene. ......................................................................53 2-3 Intra-articular expression of scAAV.IL-1 Ra after direct injection into normal and inflamed rabbit knee joints. ..........................................................................54 2-4 Repeat injection of scAAV.IL-1Ra does not result in rescue of transgene expression. .........................................................................................................55 3-1 Differential transducibility across sero types and cell types of the equine joint. ...75 3-2 Differential transducibility across sero types and cell types of the human joint. ..76 3-3 Differential transducibility across se rotypes and cell types of the rat joint. .........77 3-4 Transduction of equine and human synovial fibroblasts with scAAV. .................78 3-5 Transgene expression following infecti on of equine synovial cells with AAV viruses encoding human IL-1Ra. ........................................................................79 3-6 Viral genomes detected in equine and human cell fractions 24 hours post infection with scAAV5. ........................................................................................80 3-7 Viral genomes detected in equine and human cell fractions 30 minutes, 2 hours, and 24 hours post infection with scAAV2. ................................................81 3-8 Neuraminidase treatment inhibits AAV5 transduction of equine fibroblasts. .......82 3-9 Fluorescence images of rat joint tissues five days after intra-articular injection with scAAV.GFP vectors. ...................................................................................83 3-10 scAAV-mediated gene delivery to the joints of horses. .......................................84 3-11 AAV5 Y719F capsid mutation increases transduction efficiency in equine synovium derived fibroblasts. ...........................................................................85 8

PAGE 9

LIST OF ABBREVIATIONS AAV adeno-associated virus C degrees centigrade CaPO 4 calcium phosphate CAR coxsackie-adenovirus receptor CDC Centers for Disease Control cDNA complementary DNA CMV cytomegalovirus CO 2 carbon dioxide DMARD disease modifying anti-rheumatic drug DMEM Delbeccos modified Eagles medium DNA deoxyribonucleic acid DRP DNAse resistant particle EDTA ethylenediaminet etraacetic acid EGFR-PTK epidermal growth factor receptor protein tyrosine kinase ELISA enzyme-linked immunosorbant assay FBS fetal bovine serum FGFR-1 fibroblast growth factor receptor 1 FKBP52 FK506 binding protein FPLC fast protein liquid chromatography GBSS Greys balanced salt solution GFP green fluorescent protein HGFR human growth factor receptor HIV human immunodeficiency virus HSPG heparin sulfate proteoglycan 9

PAGE 10

hr hour HSV herpes simplex virus IL-1 interleukin-1 beta IL-1Ra Interleukin-1 receptor antagonist ITRs inverted terminal repeats LLnL N-acetyl-L-leucyl-L -leucyl-L-norleucine kg kilogram mg milligram mL milliliter mM millimolar MMPs matrix metalloproteases NAB neutralizing antibody ng nanogram nm nanometer NO nitric oxide NSAID non steroidal anti-inflammatory drug OA osteoarthritis pg picogram PBS phosphate buffered solution PCR polymerase chain reaction PDGFR platelet derived growth factor receptor alpha RA rheumatoid arthritis rAAV recombinant adeno-associated virus RBE rep binding element RNA ribonucleic acid 10

PAGE 11

sc self-complementary SD standard deviation SDS-PAGE sodium dodecyl sulfatepolyacrylamide gel electrophoresis scAAV self-complementary adeno-associated virus ssAAV single-stranded aden o-associated virus TNFtumor necrosis factor alpha trs terminal resolution site U units UV ultraviolet vg vector genome Vp virus particle VSV-G vesicular stomatitis virus G protein zLLL carbobenzoxy-L-leucyl-L-leucyl-L-leucinal 11

PAGE 12

Abstract of Dissertation Pr esented to the Graduate School of the University of Florida in Partial Fulf illment of the Requirements for t he Degree of Doctor of Philosophy ADENO-ASSOCIATED VIRUS AS A GE NE THERAPY VECTOR F OR TREATING ARTHRITIS By Jesse Douglas Kay December 2009 Chair: Steven C. Ghivizzani Major: Medical Sciences Biochemistry and Molecular Biology Gene-based therapies offer enormous potentia l for the treatment of chronic joint conditions, presenting the capacity to dire ctly change the biology of diseased or damaged tissues. Adeno-associat ed virus ( AAV), a parvovirus with a single stranded DNA genome, has emerged as the most favorable viral vector for use in human clinical applications, due primarily to its safety profile. However, many challenges still face AAVbased gene therapy technology, as AAV is completely dependent on cellular mechanisms for entry, nuclear trafficking, and second strand synthesis of its genome. The recent development of self-complementar y (sc) vectors, which bypass the need for second strand synthesis, and the capacity to cross-package the AAV2 vector into different capsid serotypes have expanded bo th the efficacy and versatility of this system. Determining the effectiveness of scAAV was the first step of our study. To accurately compare conventional single-stranded AAV (ssAAV) and scAAV vectors, identical expression cassettes were insert ed into both viral genome types, and were packaged in serotype 2 capsids for use in vitro and in vivo. These two viral genome 12

PAGE 13

types were used for infection of cells in culture and for intra-articular injections of rabbits. Measurements of transgene expres sion in vitro verified an earlier onset and higher levels of gene expression when using scAAV. The gene for the antiinflammatory interleukin-1 receptor antagoni st (IL-1Ra) was used as the transgene for animal experiments, and therapeutic results were achieved with the self-complementary vector. Another step for optimization of AAV based gene transfer is selecting the most effective capsid serotype for the target tissue. Various joint tissues from rat, horse, and human were used to screen a battery of AAV serotypes. The outcomes of these screens showed that types 2 and 5 were most ef fective overall, but also that equine tissues were highly receptive to any AAV transduction with any serotype. When scAAV.IL-1Ra was injected into equine jo ints, the result was transgene expression levels matching the therapeutic levels seen in the rabbit study. Further enhancement of AAV transduction can be achieved through mutations of the capsid that inhibit intracellular degradation. These data continue to support the viabilit y of AAV as a safe and effective gene therapy vector for treatm ent of joint diseases. 13

PAGE 14

CHAPTER 1 INTRODUCTION Arthritis Joint inflammation is the general definition of arthritis, but this simple explanation masks the enormous complexity that exists in diseases of the joint. There are two major forms of arthriti s: rheumatoid arthritis (RA) and os teoarthritis (OA). Although they have different causes, mechanisms of ac tions, and many different symptoms, both forms of arthritis ultimately degrade the ca rtilage that is necessary for proper joint function. Joint Structure Articular cartilage covers and protects the ends of the bones at sites of articulation. It must provide an effective cushion and be very durable to withstand the mechanical stress of motion, and also very smooth, to provide frictionless and effortless movement. The nature and structure of articular cart ilage impart these properties. Cartilage is made mostly of collagen and proteoglycans with many other minor components with similar properties. Collagen II is the most co mmon type of collagen in cartilage, making up 80-90% of the collagen content. 1 It forms an intricate, cross-linked network together with collagens types IX and XI, giving shap e and tensile strength to the cartilage. Proteoglycans make up the majority of the remaining dry mass of cartilage. These molecules, made of highly sulfated aggrecan attached to hyaluronic acid, bind water, which accounts for most of the physiol ogical mass of cartilage. When under compression, the collagens, due to their strength, retain the shape of the cartilage and hinder the expansion of the proteoglycans. 2,3 This architecture constricts the flow of 14

PAGE 15

water out of the cartilage when it is under mechanical stress, thereby cushioning the joint. 4,5 Chondrocytes are the cells specific to t he cartilage that are responsible for its maintenance. They sparsely populate the cartilage tissue and continuously remodel the matrix by simultaneously degrading and synthes izing cartilage matrix components. Chondrocytes are long-lived cells of mes enchymal origin, but their lifecycle is unconfirmed. It is possible that they are post mitotic, and r eplaced by infiltration of new cells from the subchondral bone, 6 or that a small populati on of progenitor cells also exists within the cartilage. 7 Cartilage is also unique in that it cont ains no blood vessels, nerve fibers, nor lymphatics. 8 Due to the lack of vascularity, th e chondrocytes receive nutrients and have their waste removed by the flow of synovia l fluid. The compression and subsequent decompression of the cartilage from norma l movement and joint loading provides sufficient force to drive this flow. While the ends of the bone are covered by cartilage, the whole structure is contained within a joint capsule of fibrous tissue. Several ligaments hold the bones together to maintain joint alignment, while tendons attach the bones to the muscles to allow movement. Together, the ligaments and tendons facilitate smooth joint function, while being critical to the biomechanical stability of the joint. Most proximal to the bones and cartilage is the synovium, a thin layer of cells of two types: type A, macrophage-like, and type B, fibroblast-like. Type B synoviocytes make up more than two-thirds of the synovium and are responsible for maintainin g the synovial fluid, the liquid that surrounds, lubricates, and nourishes the joint space. 9 Both the volume and viscosity of 15

PAGE 16

the fluid can be regulated by secretion of hyaluronan and other simila r factors, with the mechanical stresses of expanded fluid volume acting as a negative feedback mechanism. Rheumatoid Arthritis Rheumatoid arthritis (RA) is a systemic inflammatory disease where an immune response is mounted against several of the bodys organs including the joints. Approximately 1.5 million Americans have RA, although the prevalence is decreasing, according to the CDC. RA is characterized by the formation of a pannus, an aggressive hyperplasic tissue of synovium which in vades and destroys the cartilage, due to increased production of metalloproteinas es, serine proteases, and aggrecanses. 10 The pannus is unique to RA, almost tumor-like in its growth, and causes destruction of the joint. While anti-inflammato ry drugs such as non steroi dal anti-inflammatory drugs (NSAIDs) and glucocorticoids can provide pa in relief, what is desired are disease modifying agents of rheumatic disease (D MARDs) which can both treat the symptoms and halt the joint destruction. Small mole cules such as methotrexate have some effectiveness, but the state of the art has moved towards biologics such as soluble TNF receptors and interleukin-1 rec eptor antagonist pr otein (IL-1Ra). 11 New biologics under clinical investigation include antibodies against CD20, which is present on B cells, and soluble receptors to IL-6 as well as CD28, which are present on T cells. 12 Osteoarthritis Osteoarthritis (OA) is a painful condition in joints that arises from degeneration of articular cartilage. OA affe cts nearly 40 million individuals in America, and these numbers are expected to rise to as m any as 60 million as the population ages. 13 OA is generally associated with aging, but can occur in younger people following joint injury. 16

PAGE 17

Once onset occurs, OA typically progresse s until there is great pain and loss of joint mobility, although the rate of pr ogression is highly variable among individuals. OA is not only incurable and its treatment inadequate, but it is also very debilitating, leading to physical impairment, reduction in qual ity of life and lost working days. 13 Both age and injury contribute to the degr adation of cartilage, but the continued synthesis of inflammatory cytokines by t he synoviocytes and chondrocytes is thought to drive the progression of disease. As the body ages, chondrocyte numbers decrease, they are less able to respond to mitogenic si gnals from growth factors, and cellular metabolism and proliferation are reduced. 14-16 Cartilage wear leads to the generalized loss of cartilage across the articulating su rfaces. When damage occurs to ligaments and tendons, joints can become misaligned, causing unnatural movement. This pathologic articulation is sensed by the chondrocytes whose biology becomes skewed, leading cells to degrade the matrix faster than it is synthesized, leading to gradual loss of cartilage and OA. 17,18 Pain is the presenting sympt om of OA, but as there ar e no nerves in cartilage, the early stages of the disease are not felt. This lack of pain in the early stages may result in the continuation of behaviors that caused the initial damage. Although the original injury may in itself be moderate, the loss of structural soundness can lead to a progressive, often irreversible cycle of joint deterioration. 19 Articular cartilage is also avascular, which li mits its ability for self repair. In most other tissues, injuries lead to the ruptur e of blood vessels, releasing platelets and associated factors which form a clot. Progeni tor cells are recruited, and differentiate into the local cellular phenotype or synthesize repair tissues. 20,21 In contrast, there is no 17

PAGE 18

bleeding in a cartilage injury, and repair is lim ited to the local chondrocytes. They may respond by enhanced matrix synthesis, but they cannot fill a large void. Therefore, focal, chondral lesions usually remain for life. 22,23 When injuries extend deep enough into the chondral layer and reach the subchondral bone and underlying vasculature, local bleeding and clot formation lead to the generation of space filling repair tissue. This repair tissue only somewhat resembles the native cartilage: it contains a high amount of type 1 collagen. This fibrocartilaginous scar tissue does not have the same architecture and composition as original cart ilage, nor the same st ructural properties, and can degenerate over time. 20,24,25 There are many hypotheses about how mechanical stress or damage is transmitted to the chondrocytes but what is clear is t hat they up-regulate their production of aggrecanase, which degrades proteoglycans and collagenase destroying collagens. 26 There is also new evidence that cat hepsin K in particular is responsible for degrading collagen II. 27 It is believed that an increase in fibril fragments within the joint irritate the synovial membrane and activate an inflammatory response Interleukin-1 (IL1) and tumor necrosis factor alpha (TNF ) are the primary mediators of inflammation that accelerate matrix destruction pathw ays while inhibiting matrix synthesis. 28,29 Synthesized within the joint, IL-1 stimul ates chondrocytes to produce matrix metalloproteases (MMPs) and aggrecanases, as well as other factors associated with OA such as nitric oxide (NO) and prostaglandin E2. IL-1 is also responsible for upregulation of TNF expression, which in turn enhances IL-1 expression. 30 18

PAGE 19

Treatments for Arthritis Most drugs that are taken for OA are analgesic, which do nothing to stop or reverse the progression of the disease. Until adverse side effects were reported, cyclooxygenase inhibitors were the primary cl ass of drugs prescribed to those with OA, but now NSAIDS such as ibuprofen and naprox en are most prevalently taken. Other treatment options are intra-articu lar injection of corticosteroids. 31 Although commonly advertised, oral supplementations of gluc osamine, hyaluronan, and other nutraceuticals have not been found to significantly affect outcomes of arthritis. 32 Surgical options, such as arthroscopic lavage, debridement, a nd osteotomy, can be performed to aid patients with late stages of OA. These procedures can provide symptomatic relief, though they are generally viewed as tactics that delay joint replacement, the final option for treatment. For th is, the entire joint is surgical ly removed and replaced with a prosthesis. This removes the joint and t he source of the inflammatory pain, but prosthetics have limits to their function and tend to wear out over several years and need replacement themselves. Biologics Although immune suppressants such as methotrexate act as DMARDs, more desirable outcomes can be achieved with biol ogics. Recombinant forms of IL-1Ra (anakinra) along with TNF inhibitors (etaner cept, infliximab, adalimumab) are currently available for treatment of RA. Their method of action is more rational than analgesic drugs, and they are far less invasive than sur gery, but they are not ideal solutions. They are costly to manufacture and theref ore expensive for patients to buy: $13-15,000 annually. They must also be administered systemically with high frequency: anakinra must be injected daily to be effective, while most TNF inhibitors must be given weekly. 19

PAGE 20

The short half-life of these proteins and t heir frequent systemic administration makes them less than ideal for treatment of OA bec ause OA is restricted to one or a limited number of joints. However, frequent intra-articular inject ions are neither safe nor feasible. IL-1Ra Interleukin-1 is an inflammatory cytokine found in elevated levels in the synovial fluid of arthritic joints. 30 IL-1Ra is a naturally occurri ng competitive inhibitor of IL-1 signaling. It is closely related to IL-1, but does not activate the receptor upon binding. 33 While both IL-1 and IL-1Ra bind with about the same affinity to the receptor there is a strong spare receptor effect so a 100-fold molar excess of IL -1Ra is necessary before a 50% inhibition can be seen. 30 A clinical formulation of IL-1Ra as a recombinant protein, anakinra (r-metHuIL1ra), has proven safe and effective for treating RA, even in combination with methotrexate. 34-36 However, daily subcutaneous injections are needed daily to achieve therapeutic benefit. 37 Experimentally, full length human IL-1Ra has been successfully delivered to joints with a variety of gene transfer modalities. In rodent models of induced inflammatory arthritis, IL-1Ra was successfully transfe rred to rodent joint tissues with herpesvirus, 38 retrovirus, 39 adenovirus 40,41 and AAV vectors, 42,43 with measurable therapeutic benefit. The use of ex vivo approaches has also been under investigation. Reintroduction of synoviocytes, transduced with retrovirus to ov erexpress IL-1Ra, to the joints of rats significantly reduced the severity of arthritis symptoms and attenuated cartilage erosion. 44 It was estimated that the local IL-1Ra production was 40-fold more effective than when given systemically. This approach was taken into two clinical trials for 20

PAGE 21

patients with severe RA. 45,46 Autologous, retrovirally transduced synoviocytes were injected into certain metacarpophalangeal join ts, as well as control cells. The studies lasted a few weeks, as at t hat point the joints underwent synovectomy, but no adverse effects were recorded, and reductions in pa in and swelling were observed. Although no long term studies have been completed, sustai ned local production of IL-1Ra appears to be beneficial. TNFInhibitors TNFis another cytokine that is present in highly elevated levels in arthritic joints, 47 and is the target of a number of biol ogic therapies. The drugs infliximab and adalimumab are human monoclonal antibodies against TNFand are currently used clinically to treat RA and many other infl ammatory diseases. Etanercept is a fusion protein consisting of the TNF receptor 2 and the Fc region of human IgG1. The antibody fragment generates a bi valent fragment and gives the construct a greater halflife in vivo than the soluble receptor. It is also approved clinically to treat a large number of inflammatory conditions. 48 However, for effective treatment of RA, subcutaneous injections are required biweekly. A gene therapy method to deliver TNFinhibitors would give the advantages of many fewer injections and localization of the transgene to the target area. Similar results were seen using intra-articular deliveries of AAV 49 and retrovirus 50 in mouse models. When adenovirus was used to deliver a soluble TNF receptor:IgG fusion gene directly to the knees of rabbits with antigen-induced arthritis, moderate reductions in leukocyte infiltration were seen. 40 However, when that vector was given simultaneously with one expressing IL-1 rec eptor:IgG fusion a synergistic effect was seen, with greater inhibition of leukocyte infiltration and protection from cartilage 21

PAGE 22

breakdown. Also, anti-arthritic effects were observed in the contralateral control knees, indicating that intra-articula r delivery, while theoretically local, can be effective at treating joints distal to the injection site. AAV has also been used in a clinical trial by Targeted Genetics Inc. to deliver the cDNA that encodes etanercept to the joints of RA patients. 51 Serotype 2 capsid was used to package the vector. A phase 1 study was completed in which doses up to 10 11 DNAse resistant particles (DRP) were inje cted without serious adverse side effects. During the subsequent phase1/2 in whic h doses were increased to up to 10 13 DRP, a woman unfortunately died after receiving a second dose of viral vector. Although the cause of death was linked to histoplasmosis associated with long term use of immune suppressants, the tria l was halted until investigations we re completed. The patients final illness began occurring immediately after the second dose, im plicating a humoral response to the AAV capsid; however the autopsy revealed no signs of pathology around the injection site. A cell-mediated immune response can not be ruled out as appropriate samples were not kept. Any conclusions about the patients immune response are complicated by the immunosuppre ssant therapy the patient was taking. Spread of the vector was not a likely sc enario as no co-infection of adenovirus or herpesvirus was detected, and large numbers of AAV genomes outside the injection site were also not found. Although it is also un likely that the gene produ ct played a role in the pathology, conclusions in this aspect ar e difficult to make because the company had no reliable or accurate way to measure transgenic etanercept over any other TNF binding agents. Although the timing of vector treatm ent and appearance of complications appear to link gene transfer to the patients deat h, no convincing, detailed 22

PAGE 23

scenario can be identified. The FDA has al lowed the study to continue, albeit with stricter guidelines on patient eligibility and increased monitoring of blood cell counts, blood chemistry, vector DNA, TNFR:Fc prot ein and potential T-cell responses to AAV capsid. Gene Therapy Vectors Delivery of protein-based drugs to specific organs faces many difficulties including effective dosage, side effects, and high rate of turnover. 52 Many of these difficulties could be removed with an effective, targeted gene therapy. By delivering the cDNA for therapeutic proteins to the site of disease or injury, loca l cells could be turned into factories to produce the treatment. As arth ritic diseases are chronic in nature, the treatment must likewise have the ability to be long-lived and continuously effective. Advances in gene delivery technology are bri nging such a treatment closer to becoming practical. Nonviral Nonviral DNA vectors, usually plasmid DNA, are not as efficient as viral vectors, however they are easier and cheaper to produce and have fewer safety issues. 53 Uptake of naked DNA can be improved by using liposomes, nanoparticles, or other synthetic agents. 54-56 Muscle cells are particularl y receptive to nonviral DNA transfection, and this can be further enhanced by using electroporation. 57 However, major barriers still exist with intracellular transport to the nucl eus, a step that is inefficient and rate-limiting. 58 Naked DNA is also immunost imulatory and inflammatory. Moreover, immune response is elevated when bacterially produced plasmids are used, as the DNA methylation is easily re cognized by the innate immune system. Inflammation from nonviral DNA vectors is prevalent when injected into the joint 23

PAGE 24

space. 59,60 As a large, polyanionic molecule, plasmid DNA has little chance of penetrating the cartilage, which is also filled with anionic residues. Retrovirus and Lentivirus Retroviruses are enveloped viruses that deliver an RNA based genome to a cell along with the machinery to reverse tran scribe the viral genome into DNA and then integrate that genome into the cells chro mosomes. As gene ther apy vectors, these viruses provide the advantage that after the initial infection, the transgene will continue to be expressed in all the daughter cells. Th e major disadvantage they face for use in gene therapy is the possibility of insertional mutagensis leading to carcinogenesis. 61 This limits their potential for use as a therapy for arthritis, as mutagenesis is a risky side effect for treating a nonfatal disease. 62 Experimentally, retroviruses have been useful Moloney murine leukemia virus, commonly referred to as retrovirus, in fects dividing mammalian cells with high efficiency. 63 Nondividing cells are not infected by retrovirus as it has no mechanism to actively penetrate the nuclear membrane. Retrovirus has been used for many ex vivo studies, some leading to clinical trials. 64 A more useful retr oviral vector has been lentivirus, an HIV based virus pseudotyped wi th vesicular somatitis virus (VSV) G protein, 65 which infects both dividing and nondividing cells. Apart from its ex vivo uses, lentivirus has been found to infe ct synovial cells in culture, 66 as well synoviocytes after injection into rats 67 and mice. 68 Adenovirus Adenovirus is a double stranded DNA, pr otein encapsidated virus, with an approximately 36 kb genome encoding thirty vira l proteins. It can infect both dividing and nondividing cells, provided they express the coxsackie-adenovirus receptor (CAR). 24

PAGE 25

Wild type adenovirus is also known to cause upper respiratory tract infections in humans. Many serotypes of adenovirus exist, but type 5 is by far the most common for use as a vector. First generation recombin ant adenovirus is made replication defective by deletion of the E1 and E3 genes and placi ng an expression cassette in the place of E1. 69 One function of the E3 product is to suppress MHC presentation of intracellular proteins. When missing E3, low levels of viral gene expression promote immune recognition and elimination of infected cells This led to the development of second generation adenoviral vectors where E3 is retained while E1 and E4 are deleted. 70 This change still does not eliminate viral protein expression and immunogenicity, 71 and highcapacity adenoviruses, in which all coding re gions are deleted were developed as a result. 72 These high capacity vectors are difficult to produce and have reduced transduction efficiency. Although first and second generation vectors are very efficient for gene transfer, antigenicity and the high prevalence of pre-existing immunity limit their effectiveness as gene therapy vectors. 73 In one survey, neutralizing antibodies (NABs) to adenovirus were found in the synovial flui d of 70% of RA patients tested. 74 Extensive studies have been conducted using adenovirus to deliver genes to the joint, with most studies reporting inflamma tory responses and short-lived transgene expression, although initial transg ene expression levels were high. 75 Furthermore, synoviocytes have poor expression of CAR, but modifying the adenoviral capsid has led to increased transduction of synoviocytes. 76,77 Although easy to produce and valuable for experimental study, the inflammation in duced by adenovirus in vivo limits its potential for use to treat already inflamed joints. 25

PAGE 26

Adeno-Associated Virus AAV is a member of the parvovirus fam ily, is a small, non-enveloped singlestranded DNA viruses. It is naturally replic ation defective, requiring a helper virus to complete its lifecycle: commonly adenovirus or herpes virus. AAV infects both dividing and non-dividing cells and is not associated wit h any known human disease. With a 4.7 kb genome and only two genes, gutless vector s are standard; they retain only the small terminal elements of original viral DNA. With no native vira l gene expression, low relative immunogenicity, and long term expression of transgenes, AAV vectors are currently the safest choice for viral gene therapy. AAV Biology Genome and Replication The AAV genome is ~4.7 kb with 145 bp inverted terminal repeats (ITRs). The ITRs are the only cis elements on the viral genome required for replication and packaging. The first 125 nucleotides of t he ITR are inverted repeats of nucleotide sequence which folds back onto itself, forming a hairpin structure. The D sequence makes up the remainder of the ITR and remain s single-stranded. The ITR is the origin of replication for the viral genome. The first round of DNA synthesis produces a doublestranded genome, called the replicating form monomer. After a second round of DNA synthesis, a replicating form dimer is produc ed. This entity is then processed into a single-stranded DNA used for packagi ng and a double-stranded DNA used for transcription. 78 Also contained in the ITR ar e rep-binding elements (RBE) and a terminal resolution site (TRS) which are critical for proper DNA processing. Two viral genes, Rep and Cap are encoded on the genome. Four Rep proteins are necessary for viral replication: Rep78, Rep68, Rep52 and Rep40. Two promoters 26

PAGE 27

and alternative splicing are responsible for cr eating the four polypeptides from just the one rep gene. The larger Rep proteins are responsible for DNA binding and processing, while the smaller Rep proteins are used for packaging the genome into the capsid. Three capsid viral proteins (VP1, VP2 and VP3) are synthesized from the cap gene but differ because of alternative splicing and an alternative start codon. To make a complete capsid, sixty capsid proteins combine in a ratio of 1:1:20 of VP1, VP2, and VP3, respectively. The VPs have nearly identic al structure, differing only at their N terminus. At the amino end, VP1 has a phos pholipase A2 domain that is required for infectivity. 79 Entry and Trafficking The wild type viral life cycle begins when a particle attaches to a cellular receptor and is internalized by endocytosis via clathrin coated pits. 80 Particles make their way towards the nucleus through early and then late endosomes. Endosomal escape is mediated in part by the phospholipase domains on VP1, 81,82 while low pH 83 and the presence of cysteine proteases 84 are also important. While in the cytoplasm, the viral capsid can become a target of ubiquitination and eventual proteasomal degradation. This pr ocess is mediated by epidermal growth factor receptor protein tyrosine kinase (E GFR-PTK), through phosphorylation of tyrosine residues on surface of the capsid. 85 The capsid is only ubiquitinated if the surface tyrosines are phosphorylated, making every step of this process a potential target for increasing vector efficiency. It is unclear whether uncoating oc curs before entering the nucleus, 86 but once inside, second strand synthesis must be in itiated. AAV does not have its own DNA 27

PAGE 28

polymerase so it must rely upon the cell for initial creation of dupl ex DNA. EGFR-PTK again enters the lifecyle of AAV at this step. FK506 binding protei n (FKBP52) binds to the D sequence of the AAV genome and inhibits second-strand synthesis, but only when phosphorylated, a modification for which EGFR-PTK is responsible. 85 Once Rep proteins are present, they fac ilitate stabilization of the viral genome and possible integration into chromosomal DNA Recombinant AAV vectors lack Rep, and therefore have no active integration mechanism. 87 When an AAV infected cell becomes co-infected with adenovirus or herpesvirus, Rep assists in viral replication and packaging. Wild type viral genomes may also integrate into human chromosome 19 in a loosely site-specific manner, 88 the exact mechanism of which remains unknown. 78 Tropism and Receptors Identified by differences in capsid sequence, up to 110 different capsid variants of AAV have been found in primates, 89 although serotypes 1-11 are the most commonly studied. AAV2 is the prototype for most gene transfer research, as it is wellcharacterized. Different serotypes have different tropisms within a species. This has been highlighted by work in the brain, 90-92 but this holds true for other tissues as well. 93 For gene therapy purposes, it is impo rtant to identify the serotype most likely to infect the cells that are desired to be modified. There can also be differences in tissue tropism between individuals of the same species. This is best exemplified by the variation in results that several groups obtained while working with AAV2 in human CD34+ hematopoietic progenitor cells. 94 Although the donor cells under inquiry shared the CD34+ phenotype, they varied in expressi ng the surface recept ors and co-receptors necessary for efficient transduction. Be sides the differences one can see within a 28

PAGE 29

species, it has been documented that the tropism of a single serotype can vary across species. AAV2 and AAV5 showed equivalent transgene expression in human airway epithelial cells, but with mouse cells, trans gene expression from AAV5 infected cells was much higher than from AAV2. 95 Species differences in AAV transduction demonstrate that knowledge gained from animal models may not be directly applicable to humans. This has implications for prec linical research, as humans are the final target. The tropisms of AAV serotypes are the re sult of expression of cell surface receptors (Table 1-1). Many AAV serotypes require multiple receptors for efficient infection. The receptors for AAV have only been partially characterized. Immune Response Although AAV is not known to cause any disease in humans, up to 80% of people worldwide carry antibodies against AAV2. 96 Antibody levels against other serotypes vary, but AAV appears endemic to human populat ions worldwide. The consequences of this for gene therapy are not clear. Recombinant forms of AAV lack viral open reading frames, and when an immune compat ible transgene is used, any immune response should be directed solely against the capsid. There is some evidence that tolerance to foreign transgenes can be induced if hepatocytes are transduced, 97-99 while a systemic injection will likely generate anti-caps id antibodies. 100 In animal models, the immune response varies by location and load of vector. Several studies have looked at the immune response to AAV vectors in the brain, which is relatively immune privileged. 101 When injected into the brain, low doses of AAV avoided any detectable immune response, and re-administrat ion with the same vector was possible. 102,103 However, high doses of AAV caused inflammation, as measured by 29

PAGE 30

the increased presence of glial fibrillary acidic protein. 104 The presence of pre-existing immunity, when animal serum is positive for NABs, also inhibits transduction of brain tissue, 105 even in the absence of infiltrati on of immune cells into the brain. 106 The eye also represents an immune priv ileged organ, but some response can be seen depending on methods of delivery. In travitreal delivery induces a humoral response to the capsid, 107 while reports on subretinal delivery have shown both no response 107 or the induction of NABs. 108 While methodology between the experiments could account for the differences, both studies agree that readministration of the vector after subretinal delivery is still feasible. Furthermore, transducti on after a subretinal delivery in one eye is not affected by a prev ious intravitreal delivery in the other eye, 109 meaning the subretinal space is immune privileged, and can be transduced independent of prior immunity. Virally infected cells containing viral prot eins in the cytoplasm are normally cleared by the CD8+ T-cell mechanism. In a recent c linical trial of AAV2 to deliver the gene for factor IX to the liver, this cell-mediated immune reaction was found to be responsible for clearance of transduced cells. 110 In a patient with low levels of NABs to AAV2 capsid, transgene expression was maintained in the liver at therapeutic levels for four weeks, but then fell to baseline. This eliminat ion of gene expression was determined to be caused by CD8+ T cells, 111 which were also shown to be cytotoxic against AAV2 infected cells in culture. 112 Methods to avoid immune responses to AAV capsids are complicated by the lack of a suitable animal model. Generation of a T cell response to AAV capsids in mice has been difficult, and when successful, the CD8+ cells failed to clear AAV transduced 30

PAGE 31

hepatocytes in vivo. 113-115 Several strategies for avoiding T cell responses are reviewed by Mingozzi and High, 116 and the most promising solution is to have a low vector dose, which necessitates highly effective vectors. Optimizing AAV Transduction for Gene Therapy Throughout the lifecycle of AAV, the virus faces several hurdles to its successful replication, and in the wild, it depends on the help of other viruses. Recombinant viruses used for gene therapy face the same hurdles, yet they are designed not to replicate, and using helper viruses is not prac tical. Cell entry, intracellular trafficking, double stranded DNA synthesis, and gene expr ession must still occur, and occur efficiently, for optimal gene therapy. Im provements to the virus have been made to assist at each step of the process. Self-complementary genomes To bypass the inefficiency of sec ond-strand synthesis, which limits AAV transduction in certain cell types, McCarty created a self-complementary AAV vector. 117 This virus has had the terminal resolution site (trs) deleted from one of the two ITRs of its genome. Deleting one trs will lead to defec tive genome replication whereby the Rep protein will cleave at every other trs position, making a double length, inverted repeat AAV genome (Figure 1-1). To package this sc AAV DNA inside a capsid, it is necessary for the genome to be only half length, < 2.5 kb. Between functional ITRs, this virus will be wild type length when singlestranded. When it anneals upon itself, this virus will be half length, but fully competent for transcription. Capsid modification The AAV capsid is responsible for both t he binding of cellular receptors and for contact with the immune system. Modifications of the capsid can be made to alter the 31

PAGE 32

tropism, target or avoid specific tissue types avoid immune reactions including antibody neutralization, or to enhance in tracellular trafficking. Changes to the AAV capsid have been made by rational design or via a directed evolution procedure, w here a large fragmented library of capsid genes are randomly reassorted and the resulting viruses are scr eened for transduction efficiency. The engineering of capsid proteins is done generally to solve a specific problem such as adding heparin affinity or re moving known antibody epitopes. 118 Specific mutations have been made to the AAV2 capsid to enhance transduction in neurons 119 and muscle cells, 120 whereas directed evolution approaches have created novel viral capsids that infect cells as diverse as airway epithelia, 121 and glial Mller cells of the retina. 122 By inserting a fragment of protein A into the AAV2 capsid, it is possible to link antibodies to allow specific cell targeting. 123 Conjugating biotin to the capsid allows for avidin linked proteins to have target ing functions as well. 124 Polyethylene glycol (PEG) can also be conjugated to the AAV capsid and within a specific window of polymer size and PEG:lysine conjugation ratio, this protec ts from antibody recognition, while not decreasing transduction efficiency. 125 Another type of capsid mutation has nothing to do with cellular binding, but instead helps intracellular trafficking. By replaci ng certain tyrosine residues on the capsid with phenylalanine, potential sites of ubiquitinat ion are removed without affecting capsid structure or cellular binding. 126 This reduction in intracellular degradation of AAV2 led to a 10-fold increase in transduction of HeLa ce lls, and a 30-fold increase in transduction of hepatocytes in vivo, at a log lower dos e. Tyrosine to phenylalanine mutations in 32

PAGE 33

capsids for serotypes 2, 8, and 9 increased vi ral transduction to many cell types of the retina after subretinal or intravitreal injection. 127 Proteasome inhibition After viral entry, as AAV particles are engaged in the intracellular trafficking machinery, many of the virions can be ubi quitinated, which leads to proteasomal degradation of the virus. The presence of proteasome inhibitors during infection has been shown to decrease the loss of virus due to this form of degradat ion; the inhibitors are not effective when given several hours after infection. 128 Several different proteasome inhibitors including N-acetyl-L-leucyl-L-leucyl-Lnorleucine (LLnL), carbobenzoxy-L-leucyl-L-leu cyl-L-leucinal (zLLL), bortezomib, and doxorubicin have shown effectiveness in incr easing rAAV transduction in several cell systems. An increase in vi ral genomes accumulated in the nucleus was measured in airway epithelial cells 129 and endothelial cells 130 following treatment with LLnL or zLLL and viral infection. This held across serotypes 2, 5, and 7. Various intestinal epithelial cell lines also showed increased transducti on by AAV2 vectors when pretreated with LLnL. 131 When the inhibitors are given systemically, as when liver tissue is targeted for transduction, 132 or directly onto the lung airway epithelia 133 in mice, increased transduction is also seen. 33

PAGE 34

Table 1-1. Known receptors for several AAV serotypes Receptors AAV Serotypes HSPG, v 5 integrin, FGFR-1, HGFR 134-137 2 PDGFR 138 5 Laminin Receptor 139 2,3,8,9 2,3 N-linked sialic acid 140,141 1,5,6 2,6 N-linked sialic acid 140 1,6 2,3 O-linked sialic acid 142 4 34

PAGE 35

Figure 1-1. The organization of ssAAV and scAAV. A half size AAV genome missing the D sequence on one ITR will make a self-complementary double stranded DNA genome. ITR D 2.3 kb D ITR 2.3 kb ITR D ITR D ITR D Plasmid Virus ITR D 2.3 kb D ITR 2.3.kb D ITR D 2.3 kb D ITR ITR D 2.3 kb D ITR 35

PAGE 36

CHAPTER 2 INTRA-ARTICULAR GENE DELIVERY AND EXP RESSION OF IL-1RA MEDIATED BY SELF-COMPLEMENTARY ADENO-ASSOCIATED VIRUS Introduction Gene transfer has been proposed as a m eans to improve tr eatment of the arthritides. 143 By delivering cDNAs encoding anti-arth ritic proteins to the cells in the capsular lining of joints, the gene products may be expressed and secreted locally into the joint space and neighboring tissues. Persistent expression of therapeutic gene products may provide long-term benefit in the tr eatment of chronic joint diseases. Initial studies of the feasibility of this concept employed an ex vivo gene transfer approach. 144,46 While effective, the expense and labor have led to the exploration of methods for delivering exogenous genes directly to joint lining cells in situ. Studies using adenovirus, 145-149 and herpes simplex virus 149,38 as vectors for gene transfer have demonstrated that direct intra-articular gene delivery is feasible. Moreover, ensuing expression of certain therapeutic transgenes is sufficient to i nhibit arthritic changes in certain animal models. 148,38,40,150-152 While both vector systems are highly efficient, gene expression from either is transient, in general persisting for no longer than two to three weeks. The loss of transgene expression is frequently accompanied by the onset of an inflammatory response due, at least in part, to the expression of viral proteins that remain encoded by these vector systems. 153 More recent work by Gouze has shown that direct intra-articular injection of VSV-G pseudotyped, HIV based lentiviral vectors into the knees of rats results in expression of homologous transgene products at relevant levels for greater than six months. 154,155 This demonstrates that cert ain populations of cells within the synovium and joint capsule are capable of maintaining an exogenous transgene for periods of time 36

PAGE 37

sufficient to treat chronic articular diseas e. Although lentiviral vectors encode no viral proteins and are powerful gene delivery tools, there may be considerable safety and psychological impediments to the use of HIV-based vectors for in vivo gene delivery for non-fatal articular diseases. AAV has certain characteristics that may ma ke it more suitable for gene delivery to joint tissues. 156-158 Wild type AAV is non-pathogenic, and recombinant AAV vectors have been engineered that encode no viral proteins. Since the vector infects a variety of dividing and non-dividing cells, in many applicati ons it can achieve significant levels of cellular transduction following delivery in vivo. Advancements in AAV technology, including the capacity to cross-package the vector in alternate capsid serotypes and methods for generating large-scale, hightiter, adenovirus-free preparations, 159,160 have brought wider interest to the use of this vect or system including its potential for use in treating the arthritides. In previous studies, we evaluated c onventional, single-stranded AAV2 vectors and found them significantly less effective than herpes simplex virus (HSV), adenovirus or lentivirus for intra-articular gene deliver y. The onset of tr ansgenic expression was significantly slower, requiring at least one to two weeks, and the resulting levels of expression were low in cultur e and borderline detectable followi ng specific intra-articular injection in the knee joints of rats and r abbits (unpublished observations). Despite our poor results, there are literature reports of beneficial effects following local AAVmediated delivery of anti-ar thritic transgenes in the ank les and paws of rodents with experimental arthritis. 161-168 Unfortunately the inflammatory pathology in models such as collagen-induced arthritis and str eptococcal-wall induced ar thritis, occurs almost 37

PAGE 38

exclusively in the ankles and paws. In rodents these arthrodial, or gliding joints, are extraordinarily small and architecturally comple x without a readily identifiable joint space and cannot be reliably targeted for intra-articular injection. Interestingly, consistent with our findings, several studies from independe nt laboratories indi cate that murine and human synovial fibroblasts are inherently re sistant to transduction with conventional AAV based vectors. 156,169,170 Indeed, work by Cottard 162 indicates that the primary site of AAV2 transduction following injection in the ankle region is extra-articular muscle. Several groups have shown that certain stimu li, such as UV radiation which increases the production of endogenous DNA repair and syn thesis proteins, can significantly enhance intra-articular transgene expressi on from conventional AAV vectors. 156,169,170 This indirectly indicates that second-str and DNA synthesis is rate-limiting in AAV transduction of joint tissues. The recent development of double st randed, self-complem entary AAV vectors bypasses the need for single strand to double strand genome conversion and has shown dramatically increased transduction efficiency in many tissues compared to conventional AAV vectors. 117,171, scAAV vectors can be produced either by generation of vector plasmids that are ~half-genome sized combined with selective purification of the infectious double stranded form, 171 or through the use of half-genome sized vector plasmids containing a mutation in one of th e terminal resolution sequences of the AAV ITRs. 117 Both strategies generate + and strand viral genomes that are covalently linked at one terminal repeat. Because the genomes of scAAV are half wild type size (~2.5 kb) the resulting 2x viral construc t (~5 kb) can be packaged into the normal AAV capsid. 38

PAGE 39

In the present study, we tested the hypothesis that scAAV vectors provide improved transduction of articular fibroblasts over conventional AAV vectors to enable rapid expression of functional levels of transgene expression in joint tissues. Materials and Methods Construction and Generation of AAV Vectors The cDNA encoding GFP was cloned into the conventional AA V packaging vector pTRUF2 as a Not 1-Sal 1 fragment. For gener ation of scAAV vector plasmids, the cDNAs for GFP and human IL-1Ra were directional ly inserted into the Sac II, Not 1 sites of pHpa-trs-SK plasmid. 117 For all AAV vector constructs transcription was driven by the CMV promoter/enhancer. AAV vectors were propagated using an adenovir us-free, two plasmid transfection system. Using 10 layer cell factories (Nunc), the respective AAV vector plasmids were co-transfected into 293 cells by CaPO 4 precipitation with the pDG packaging/helper plasmid. 160 The pDG plasmid contains t he rep and cap genes from AAV2 and complementing adenoviral functions require d for amplification and packaging of the AAV genome. Sixty hours post-transfection, cells were harvested with PBS containing 10mM EDTA, pelleted, resuspended in low salt buffer and lysed by three rounds of freeze-thaw. Cellular nucleic acids were digested by incubation with Benzonase (Sigma). Purification of AAV from the cr ude lysate was performed using iodixanol gradients followed by FPLC affinity chroma tography over mono-Q column. The eluate was desalted and concentrated with a Millipore Biomax 100 K filter, aliquotted and stored at -80C. Viral titers were dete rmined by quantitative co mpetitive PCR assay relative to well-characterized AAV viral re ference standards. Each viral preparation was examined for purity by resolution of the viral proteins by SDS PAGE and silver stain. 39

PAGE 40

Vectors were produced in the laboratories of Dr. Steve Ghivizzani and Dr. William Hauswirth. Isolation and Infection of Primary Articular Fibroblasts Over the course of our in vitro experiment s, four New Zealand white rabbits were euthanized and the capsular tissues from both knee joints were harvested. To isolate fibroblastic cells for experimentation, the non-collagenous soft tissues including the synovial lining and subsynovium were scraped from the dense supporting fibrous tendon and ligamentous tissue of the capsule us ing a scalpel. Under aseptic conditions, the fresh isolates of rabbit synovial/capsular (articular) tissue were minced with a razor blade and digested in ~30 mL saline solu tion with 0.2% colla genase for 2hr at 37 o C with constant stirring. Afterward, the sus pension was passed through a nylon mesh to remove undigested tissue. The cells in the filt rate were then pelleted, washed in saline and plated in DMEM supplem ented with 10% FBS with 1% penicillin/streptomycin. Twenty-four hours later, t he cultures were washed to remove non-adherent cells and debris; the medium was repl aced, and the cultures returned to the incubator. For viral infection, unless otherwise indicat ed, cells were plated in 12 well plates and grown to ~70% confluence. Prior to in fection, cells were washed two times with serum free media (DMEM). AAV ve ctor from stock solutions was mixed with serum free media to produce working solutions contai ning appropriate DNAse resistant viral genomes/per cell and placed on cell cultures For experiments involving the GFP transgene and intracellular trafficking, viral doses of 10 4 viral genomes per cell were used. For those involving IL-1Ra, viral doses ranged from 10 3 -10 5 viral genomes per cell. After incubation with virus for 2 hrs, complete media was added to each well and the cells returned to the incubator. For quantitat ion of IL-1Ra, at 24 hr intervals following 40

PAGE 41

infection, the media from each well were harvested, and replac ed with fresh media. Harvested media from select ed days was stored frozen at o C. Each viral dose was added to four individual wells and supernatant from each well was tested individually by ELISA (R & D Systems). Quantitation of Viral Genomes in Cytoplasmic and Nuclear Cell Fractions Viral DNA from fractionated cells was isolated from a pr ocedure adapted from Zhao et al. 172 Briefly, lapine articular fibroblasts were seeded at 10 5 cells per well of a 6well dish, allowed to attach, and then infe cted with either single stranded or scAAV at 10 4 viral genomes/cell as described above. A fter 24 hours, the cells were trypsinized, incubated in hypotonic buffer for 5 minutes on ice, and lysed in non-ionic detergent. Centrifugation of the lysate allowed the nuclear fraction to be collected as the pellet, while the supernatant was reserved as the cy toplasmic fraction. Low molecular weight DNA from each fraction was isolated by Hirt extraction 173 and then used for quantitative PCR. The Hirt extraction is performed by fi rst adding 2 volumes of Hirts solution (0.6% SDS, 10mM EDTA), mixing, then adding o ne quarter volume of 150 mL NaCl and incubating overnight at 4C. Following centrifugation for 1 hr at 15,000 x g, the supernatant is retained and DNA is extracted by ethanol precipitation. Primer pairs (forward 5-CACGCTGTTTTGACCTCC ATAGAAGACACCGGG, reverse 5TTCTTTGATTTGCACCACCACCGGATCCGGG) were designed to anneal to sequences within the CMV pr omoter sequence. Viral genomes were detected using SYBR Green dye in an Eppendorf Mastercycler Realplex2. The results were standardized to a dilution series of vector plasmid DNA of known copy number. Three independent experiments were per formed, yielding similar results. Values were then expressed as the mean of these experiments. 41

PAGE 42

Animal Models All animal experiments were conducted a ccording to protocols approved by the University of Florida Instit utional Animal Care and Use Committee. All efforts were made to minimize animal suffering. Rabbits used in the study were housed separately in metal cages and maintained on commercial food and water ad libitum. The cages were kept at a constant tem perature (22-25C) and rela tive humidity (50-55%). A retroviral vector, DFG-hIL-1 -neo encoding both the matu re form of human IL1 fused to the secretory polypeptide sequ ence from human parathy roid hormone, and the neomycin phosphotransferase genes 174 was used to transduce HIG-82 cells. Following infection, transduced cells were positively selected by culture in DMEM containing 10% FBS and 0.5 mg/mL G418. After selection, this cell line was found to produce over 200 ng of IL-1 per 10 6 cells per 48 hrs. To induce arthritis in the rabbit knee, the HIG-82-IL-1 + cells were first trypsinized from culture plates, washed twice in Geys balanced salts solution (GBSS) and counted using a haemocytometer. Approximately 5 x 10 4 of the cells were resuspended in GBSS in a 0.25 ml volume and injected via the parapatellar approach into both knees of 3-4 kg New Zealand White rabbits. Joint lavage was utilized to monitor intra-articular transgene expression and leukocytic infiltration. For this proc edure, rabbits were first anesthetized by subcutaneous injection with a cocktail of xylazine, ketamine and acepromazine. The rabbit knee joints were then lavaged, first by direct intra-articula r injection of 1 mL GBSS. The joints were then put through seve ral ranges of motion. The needle was reinserted, and the fluid aspirated using the syr inge. Leukocytes in recovered fluids were counted using a haemocytometer. Lavage fluids were centrifuged to pellet cells and 42

PAGE 43

debris, and the supernatant was aliquotted and stored at C. For sacrifice of the animals, the rabbits were anesthetized by subcutaneous injection with the xylazine, ketamine, acepromazine cocktail as abov e followed by intr avenous overdose of Nembutal via the ear vein. IL-1Ra levels in recovered fluids were measured using an ELISA kit from R & D S ystems as directed. Statistical Analysis A pooled two-sample t-test was used to determine the significance of the differences in leukocytic infiltration in in flamed knees that were injected with scAAV.IL1Ra and untreated controls. Values of p<0.05 were considered statistically significant. Results scAAV Transduces Rabbit Synovial Fi broblasts with High Efficiency To determine the relative transduction effi ciency in articular fibroblasts of the double stranded, self-complementary (sc) AAV vector and the conventional single stranded form, we first inserted the cDNA fo r green fluorescent protein (GFP) into the respective vector plasmids and packaged each into AAV capsid serotype 2. Articular fibroblasts isolated from synovial and capsular tissues of the joints of rabbits were cultured in multi-well plates and infected with ~10 4 viral genomes per cell of either AAV.GFP or scAAV.GFP. At periodic intervals post infection individual cultures were analyzed by microscopy and flow cytometry fo r numbers of GFP+ cells and the levels of fluorescence. As shown in Figure 2-1 A and B, the scAAV.GFP vector provided ~25-fold greater transduction than the conventional single-stranded ve ctor, with onset of GFP expression within 24 hours. Fl uorescence was noted to diminish somewhat by day 7; however, this was attributed to the loss of the episomal AAV genomes from the cells of the rapidly dividing line in culture. 43

PAGE 44

To determine if the enhanced transduction of the scAAV vector might be partially attributable to variation in intracellular tra fficking and nuclear entry, we infected parallel cultures of cells and with both vector types and determined the viral genomes present in the cytoplasmic and nuclear fractions using quant itative PCR. As shown in Figure 2-1C, no significant differences were observed between the different AAV vector types; both entered the cells with similar efficiency, and si milar proportions of viral DNA entered the nucleus (~18% and 14% for conventional and scAAV, respectively). These data indicate that at least within this cell type, there are no appreciable differences between the two vectors with regard to viral ent ry into the cell, as well as entrance into the nucleus. Consistent with previous repor ts, these results show that transduction of articular fibroblasts with conventional AAV vectors is severely limited by the inability of these cells to effectively achieve second strand DNA synthesis. To determine the levels of therapeutic pr otein synthesis provided by the scAAV vector, the cDNA for human interleuk in-1 receptor antagonist (IL-1Ra) 175 was inserted into the pHpa-trs-SK, scAAV ve ctor (scAAV.hIL-1Ra) and packaged into AAV serotype 2. IL-1Ra is a secreted protein that serves as a competitive inhibito r of interleukin-1 (IL1) by binding to available type I IL-1 re ceptors and preventing s ubsequent interaction with IL-1 ligand and IL-1 receptor accessory protein. 176 IL-1Ra is useful as a reporter gene because it has no known agonist activity and can be measured in biological fluids by ELISA that distinguishes between the human form and the endogenous IL-1Ra of the experimental animal. Cultures of primary rabbit articular fibroblasts were infected with increasing amounts of scAAV.IL-1Ra ranging from 10 3 to 10 5 particles per cell. To follow the 44

PAGE 45

pattern of gene expression over time, the media were collected every 24 hrs postinfection, the cells washed and fresh culture media added. IL-1Ra levels in the media collected at days 1, 3 and 7 post-infection were measured by ELISA. As shown in Figure 2-2, the lapine articular fibrobl asts were amenable to transduction with scAAV.hIL-1Ra, and expressed the transgene in a dose-dependent manner. Interestingly, for all doses the greatest le vel of expression was measured at 24 hrs post infection. As with expression of GFP, we noted that IL-1Ra production gradually diminished over the week-long experiment, wh ich is consistent with the loss of the episomal viral genomes from cell division. Altogether the results above demonstrated that the scAAV.IL-1Ra vector was infectious for rabbit articular fibroblasts and thus suitable for evaluation in the rabbit knee in vivo. The levels of hIL-1Ra synthesis were comparable to those achieved previously with recombinant adenovir al and lentiviral vectors. Intra-Articular Expression of AAV.IL-1Ra in Normal and Arthritic Rabbit Knee Joints Having established that the scAAV.IL-1Ra ve ctor was able to efficiently transduce articular cells in culture, we wanted to determine and compare t he patterns of intraarticular gene expression after injection of the vector into normal and inflamed joints. To establish an inflammatory environment in the rabbit knee, approximately 5 x10 4 cells of a rabbit synovial fibroblast line retrovirally transduced to constitutively express human IL-1 (HIG-82-IL-1 -neo) were injected into both k nees of 10 rabbits. This procedure has been shown to induce an acute inflammatory response in the joint that mimics many of the pathologies associated with rheumatoid arthritis in humans and persists for about 10-14 days. 174 Three days after delivery of the IL-1 + cells, approximately 5 x10 11 45

PAGE 46

particles of scAAV.hIL-1Ra were injected into both knees of 5 rabbits receiving the IL-1+ cells and into both knees of 5 normal rabbits. For negative controls, an equivalent volume of saline solution was injected into bot h knees of the remaining IL-1+ rabbits as well as 5 additional normal rabbits. The knees of all four groups of rabbits were initially lavaged at 3 and 7 days post-in jection of the vector and then weekly thereafter for 28 days. Recovered lavage fluids from each knee were analyzed individually for levels of human IL-1Ra by ELISA as well as for numbers of infiltrating leukocytes. As shown in Figure 2-3 A, scAAV.IL-1 Ra-mediated intra-articular gene delivery resulted in approximately the same level and duration of IL-1Ra expression for both inflamed and nave joints. At days 3 and 7, mean levels of about 1 ng of IL-1Ra per ml of recovered lavage fluid were detected in both inflamed and normal joints. By day 14, mean IL-1Ra levels had decreased by 60-80%, and by day 21 human IL-1Ra was undetectable in lavage fluids of any animals IL-1Ra expression was not detected in the normal and inflamed control rabbits bey ond normal background levels for this procedure. A significant decrease in leukocytosis of the synovial fluid was observed at days 3 and 7 in the arthritic (inflamed) joints rece iving the scAAV.IL-1Ra, relative to the salineinjected arthritic controls (p<0.05) (Figure 2-3 B). This is consistent with previously observed anti-inflammatory effects asso ciated with intra-articular delivery and overexpression of the IL-1Ra cDNA in this model system. 38 Different from the intraarticular injection of adenoviral vectors, no detectable increase in leukocyte levels in synovial fluids was observed in the normal rabbits receiving the scAAV vector at any time point during the four week experiment (Figure 2-3 B). 46

PAGE 47

To determine if the onset of a second in flammatory response would re-stimulate intra-articular IL-1Ra transgene expression, HIG-82-IL-1-neo cells were injected into the knees of the previously inflamed and normal rabbits that had received the AAV.IL1Ra five weeks earlier. The knees of the rabbits were then lavaged 3 days later and again, following sacrifice, at day 7. The recovered fluids were analyzed individually for IL-1Ra levels by ELISA. In contrast to previous reports indicating that once extinguished, AAV-mediated transgene expr ession could be re-established by a subsequent inflammatory stimulus 42,177 no IL-1Ra was detected in lavage fluids from animals of either group. PCR analyses of re covered synovial tissues did not detect the presence of scAAV.IL-1Ra genomes (data not shown). Repeat Dose of AAV.IL-1Ra does not Restore Transgene Expression Having found no difference in levels of IL-1Ra expression following AAV-mediated gene delivery between normal and inflamed join ts, patterns of tr ansgene expression were determined following repea t dosing. As above, 5 x 10 4 HIG-82-IL-1 + cells were injected into both knees of 10 rabbits Three days later, approximately 5x10 11 particles of scAAV.IL-1Ra were injected into both knees of 5 of the rabbits rece iving the IL-1 cells and into both knees of 5 normal rabbits. The knees of all rabbits were lavaged weekly until IL-1Ra expression had completely diminis hed. As shown in Figure 2-4, similar to the results of the previous experiment, both normal and infl amed joints injected with the scAAV.IL-1Ra expressed approximately 1 ng of IL-1Ra per ml of recovered lavage fluid at day 7, and IL-1Ra production gradually di minished thereafter. Somewhat different from the results obtai ned in Figure 2-3, at day 21 one rabbit each from the inflamed and the normal groups still expressed IL-1Ra above background levels in both joints. By day 28, IL-1Ra expression persisted only in the k nees of one animal in the inflamed group. 47

PAGE 48

At day 35, no IL-1Ra was presen t in the joints of any of t he rabbits. Two weeks after IL1Ra expression was undetectable in all the animals, a second dose of AAV.IL-1Ra was injected intra-articularly. Lavage fluids re covered at day 3 and 7 following the second injection showed no significant IL-1Ra expression at either time point. Discussion In this study we evaluated patterns of transgene expression in articular cells following infection with scAAV vectors, first in vitro, and then in vivo in normal and inflamed joints. We found that in culture the scAAV vector represented a significant technical advance over conventional sing le-stranded vectors with regard to cellular transduction, providing ~25-fold enhanc ement in transgenic expression. The comparatively poor performance of the conventional vector indicates that second-strand DNA synthesis can be a major impediment to effective transduction of joint tissues. Concerning normal and inflamed articula r environments, we found no significant difference in the levels or duration of expression of the IL-1Ra transgene following delivery of the self-complementary vector. Generally, following in jection of about 5 x 10 11 particles, sufficient levels of IL-1Ra transgene product were generated to cause a reduction in the leukocytic infiltration in join ts inflamed by constitutive IL-1 production. Despite published repor ts to the contrary, 42,177 we found that following the loss of IL-1Ra transgene expression, neither re-injection of the scAAV.IL-1Ra vector nor the induction of a second inflammatory response coul d generate detectable levels of IL-1Ra expression intra-articularly. In animal studies of intra-articula r transgene expression we found several advantages to the rabbit knee as a model syst em. Being approximately the same size as the metacarpophalangeal join ts of the human hand, a frequent site of RA, it offers a 48

PAGE 49

reasonable simulation of the process of gene de livery in the treatment of human joint disease. Given that the studies publis hed to date have been performed in rats and mice 156,161-168,178,179 with joints 1-2 log orders smalle r than those in humans, we believe the data here are among the fi rst to report intra-articula r transgene expression from an AAV vector in articular tissues on a clinica lly size-relevant scale. As shown by the ability of the IL-1Ra expression to alleviate leukocytosis in inflamed joints of rabbits, the efficiency of scAAV-mediated gene delivery and ensuing expression is sufficient to induce a beneficial bi ological response in this context. The patterns of transgene expression obs erved with the self-complementary vector in rabbits differ somew hat from those observed in the joints of mice injected with conventional AAV. In the murine system, AAV mediated transgene expression was found to initiate significantly earlier in arth ritic joints, and levels of expression were greater than in normal joints. 156 This was primarily attributed to differences in the synthesis of the second DNA strand of t he AAV vector within the infected cell, and increased production of DNA synt hesis/repair enzymes in cells receiving inflammatory stimuli. With the self-complementary ve ctor, AAV-mediated trans gene expression from normal rabbit synovial fibroblasts in culture as well as in vivo in normal joints had a rapid onset, with no evidence of delay relative to ar thritic joints. Thus, t he self-complementary vector bypasses the variability associated with conventional AAV vectors in the arthritic environment and, thereby, provides a mo re predictable gene delivery reagent. The observation that cells within both normal and inflamed joints of the rabbit are equally capable of being transduced by an scAAV-based vector indicates that this system may have application in a spectrum of articular ailments. Th ese include inflammatory 49

PAGE 50

conditions, such as RA, as well as t hose not directly associated with chronic inflammation, such as osteoar thritis, and repair of joint ti ssues such as meniscus and ligament. Although intra-articular gene transfer a ccompanied by limited inflammation has been previously reported with AA V, the capacity of this ve ctor to enable persistent transgenic expression in joint tissues has yet to be fully assessed. In the present report, we found that within the rabbit knee, expression of the human IL-1Ra transgene was gradually lost over a period of a few weeks and that re-adminis tration of the vector could not restore expression. Unfortunately, t he human IL-1Ra transgene product used in these experiments, while extrem ely useful as a secretable marker, is at the same time immunogenic when administered across specie s boundaries to the joints of normal, immunocompetent animals. 154 We have found similar patterns of abbreviated intraarticular expression following the use of other xenogenic transg ene products, regardless of whether they are se creted or intracellular. 37 Recent experiments have shown that in the absence of specific T-cell mediated immunity directed against non-self proteins of transgenic or viral vector origin, cells within fibrous tissues of the joint can support longterm (>6 months) tr ansgenic expression. 154,155 The capacity with which AAV vectors can infect and transduce these particular cell types is currently unknown, but is an area of ongoing study within our group, as well as others. AAV-mediated transduction of the target ce ll involves several key steps that broadly include, viral attachment and entry, 134,135 intracellular trafficking to the nucleus, 180-182 nuclear entry and uncoating, 183,184 and conversion of the single-stranded genome into a double stranded form. 185,186 In attempting to improve the efficiency of 50

PAGE 51

AAV transduction, the developm ent of methods to crosspackage vector genomes in alternate capsid serotypes has dramatically expanded the host cell range of the widelyused, AAV serotype 2-based vectors. Furt her, the development of scAAV vectors bypasses the limitations a ssociated with second-strand DNA synthesis. As shown here and by others, important barri ers to transduction of articu lar fibroblasts appear to still remain at the level of intracellular trafficking. 170,187,188 Relative to other viral vectors, high numbers of viral particles are required to achieve transduction of human, rat and rabbit synovial fibroblasts in cult ure, typically in the range of 10 4 -10 5 viral particles per cell, and as shown here only between 10-20 % of AAV genomes enter the nucleus. Several lines of evidence implicate the ubiquitin-proteasome pathway as a key hurdle to efficient intracellular trafficking by AAV2based vectors and other serotypes. Jennings et al. showed that the addition of proteasome inhibitors, such as carbobenzoxy-l-leucyl-lleucyl-l-leucinal (zLLL), dramatically enhanced nuclear uptake of AAV genomes in human synovial fibroblasts and was acco mpanied by a proportional increase in transgenic expression. 188 More recently, Zhong dem onstrated that cellular phosphorylation of specific tyrosine resi dues on the AAV capsid surface led to increased ubiquitination of the viral particle and enhanced proteasome degradation. 189 Site directed mutagenesis of these tyrosi nes to phenylalanine blocked ubiquitination and led to ~10-fold enhancement of transduction efficiency. 190 The relative utility of these modified capsids in articular cells has not been investigated, but like the selfcomplementary vectors they hav e the potential to significantly enhance the efficiency of AAV-mediated gene transfer. 51

PAGE 52

Figure 2-1. scAAV-mediated gene transfer to rabbit articular fibroblasts in vitro. Cultures of primary articular fibroblasts isolated from the joints of rabbits were infected with 104 viral genomes per cell of either conventional AAV.GFP or double-stranded, self-complementary AAV (scAAV.GFP). Parallel cultures of uninfected cells (Naive) were used as negative controls. Both vectors were packaged in AAV serotype 2 capsid. (A) Th ree days later, the cultures were examined visually by fluorescence microscopy.(B) Fluorescence was then quantified using flow cytometry. In these assays, scAAV provided an approximately 25-fold greater transduc tion than the conventional AAV vector. For each scatter plot shown on the left, le vels of fluorescence are represented on the horizontal axes, and cell size is indicated on the vertical axes. For graphs on the right, fluorescence is i ndicated on the horizontal axes and cell number on the vertical axes. (C) To tra ck the intracellular migration of the respective viral genomes, cultures of rabbit fibroblasts were infected with either AAV.GFP or scAAV.GFP. Twentyfour hours later, the cells were harvested, and the nuclear and cytoplasmi c fractions were isolated. Viral genomes in the respective fractions were determined using quantitative PCR. Values plotted for each vector and com partment represents t he means of four replicates. Error bars represent one st andard deviation. For both types of vectors, less than 20% of the viral genomes entered t he nucleus at 24 h postinfection. For the cytoplasm and nucl ear fractions, separate two-sample t tests were conducted; using p < 0.05, there was no significant difference between the respective samples in each group 52

PAGE 53

Figure 2-2. Infection of pr imary synovial fibroblasts with scAAV.IL-1Ra results in high level expression of the transgene. To test the function of the scAAV.IL-1Ra, cultures of primary, lapi ne, articular fibroblasts were plated and allowed to grow to approximately 70% confluence. The cells were then incubated with increasing amounts of the scAAV.IL-1Ra vect or as indicated. At 24-h intervals post-infection, the culture media were removed and stored. The cells were washed with saline and the media replaced. IL-1Ra levels in culture supernatants from days 1, 3 and 7 were determined using ELISA. Each viral dose was tested in quadruplicate, and the bars represent the mean SD. For observations made on days 1, 3 and 7, IL-1Ra levels and scAAV.Il-1Ra doses were transformed using a base-10 logarit hm, and a simple linear regression was fit to the transformed data. Using p < 0.05 for each test, a significant trend was detected for days 1, 3 and 7. 53

PAGE 54

Figure 2-3. Intra-articular expression of sc AAV.IL-1Ra after direct injection into normal and inflamed rabbit knee joints. Ten rabbi ts were initially injected in both knees with 5 10 4 HIG-82-IL-1 -neo cells, which stimul ates an immediate, persistent inflammatory state. Three days later, 5 10 11 particles of scAAV.IL-1Ra were injected into both knees of five of the rabbits with inflamed knees and five normal rabbits. An equivalent volume of saline was injected into the remaining five infl amed rabbits and an additional five normal rabbits. (A) Periodically, the knees of all rabbits were lavaged with saline and the IL-1Ra content in recovered fluids measured by ELISA. Data are shown as the mean SD. For rabbits receiving scAAV-IL-1Ra, using a two-sample ttest and p < 0.05, no significant differ ences were observed between inflamed and normal knees for all days post-injec tion. The same test conducted for rabbits injected with saline showed no si gnificant differences between normal and inflamed as well. (B) Infiltrating leuko cytes in lavage fluids recovered at days 3 and 7 for each group were quantif ied using a hemocytometer. Data are shown as the mean SD. A pooled two-sample t-test was used to determine the significance of the differenc es in leukocytic infiltration in inflamed knees that were injected with scAAV.IL-1Ra and untreated controls. p < 0.05 54

PAGE 55

Figure 2-4. Repeat injection of scAAV.IL-1Ra does not result in rescue of transgene expression. Similar to the procedure descr ibed in Figure 2-3, five rabbits were injected in both knees with HIG-82-IL-1 -neo cells to establish an inflammatory state. Three days later, the inflamed rabbits and five normal rabbits were then injected with scAAV.IL-1Ra in both knees. At weekly intervals, the knees of the rabbits were lavaged with saline, and IL-1Ra levels measured using ELISA. At 49 days after the initial scAAV.IL-1Ra injection and 14 days after IL-1Ra expression had dimi nished in all joints, a second intraarticular injection of scAAV.IL-1Ra wa s administered to all rabbit knees (indicated by an arrow). The knees of a ll rabbits were lavaged at 3 and 7 days after the second vector injection. Valu es shown are the mean SD IL-1Ra levels at specific time points. A twosample t-test was c onducted for IL-1Ra levels between groups for each day post-injection; using p < 0.05, the only significant difference detected wa s at day 14 post-injection. 55

PAGE 56

CHAPTER 3 SELF-COMPLEMENTARY ADENO-ASSOCIATED VIRUS MEDIATED DELIVERY TO RAT AND EQUINE JOINT TISSUES Introduction The degenerate joint disease osteoarthri tis affects humans and many large mammals alike, severely decreasing quality of life. Inflammatory events trigger an imbalance between the anabolic and catabolic pr ocesses that maintain cartilage health which favors degradation of cartilage over promotion of new ca rtilage growth. The inflammation is associated with an increase in the expression of cytokines such as IL-1 and TNF Until recently, treatment of these conditions has been most ly palliative, either with analgesics or anti-inflammatory corticosteroids. However, novel biologically active agents such as interleukin-1 receptor ant agonist (IL-1Ra) and a soluble form of the TNF receptor have been tested and shown to be effective at treating the underlying inflammation and damage of the cartilage. These emerging biologics have created a new therapeutic potential, but they also hav e a unique set of drawbacks. As proteins, these agents are inherently more unstable than pharmaceutical compounds and are subject to any number of processes pres ent in mammals that eliminate or degrade protein products. Anakinra, a formulation of the anti-inflammatory protein IL-1Ra, for example, has an in vivo half-life of six hours. Although its activity is very desirable as a treatment option, its delivery, requiri ng daily injections, is not ideal. One solution to this lack of persistence is gene transfer. By introducing the gene or cDNA for the therapeutic protein to a loca l population of cells near the target of treatment, these cells could manufacture a continuous supply of the therapeutic protein. Local production of the protein also has the benefit of keeping the concentrations higher 56

PAGE 57

where their action is desired, therefore reducing the potential for off target effects. Delivery of the genetic material to the cells is not without it s difficulties or dangers. Viral gene delivery to joints has been attempted numerous times, with some satisfactory results. 148,38,155,163-165,43,44 Recombinant adenovirus constr ucted to overexpress Il-1Ra has been used in equine joints, but immune reacti on to the virus limited the duration of expression. 40 Adeno-associated virus (AAV) vectors may be better suited towards these needs. AAV has a favorable safety profile, compared to other viral vector systems, and several recent advances have considerably increased its value as a vector, namely the introduction of the self complementary genome 117 which effectively makes the viral genome double stranded, incr easing the levels of tr ansgene production with a more rapid onset of gene expression. 171 Effective gene delivery approaches to treating arthritic conditions have been met with several challenges, including suitable vector and model system s. Rodent models, including mouse, rat, and rabbit have been used in dozens of published experiments, but all use some form of induced arthritis, ei ther by injection of collagen or adjuvant, or by delivering cells that hav e been genetically modified to ov erexpress an inflammatory agent. These models produce an induced arthritis that is characterized by a rapid onset and severe inflammation, which is more akin to rheumatoid arthritis than osteoarthritis. However, many of these studies have produced encouraging results, namely that several vectors can effectively deliver a vari ety of transgenes that can positively affect the arthritic condition. For instance, our group has successfully used self 57

PAGE 58

complementary AAV (scAAV) to deliver IL-1Ra to the knee joints of rabbit with the result of reducing measurable symptom s of an induced arthritis. To move beyond the rodent systems, it is necessary to use a model with more clinical relevance to the eventual human pat ient. In this regard the horse offers considerable potential. Horses naturally develop osteoarthritis through traumatic injury or repetitive athletic stress, much like humans. Furthermore, the size and architecture of equine limb joints are similar to human knees both being encased in large quantities of connective tissue as a necessity of being used frequently for load bearing movement, and are both common sites of OA. In this study we begin to explore the utility of the equine syst em as a model for gene delivery to joints in humans. Materials and Methods scAAV Vector Production For generation of scAAV vector plasmids the cDNAs encoding green fluorescent protein (GFP) and human interleukin (IL)-1 re ceptor antagonist (Ra) were directionally inserted into the SacII and NotI sites of pHpa-trs-SK plasmid. For all AAV vector constructs, transcription was driven by t he cytomegalovirus (CMV) promoter/enhancer. AAV vectors were propagated using an adenov irus-free, two or three plasmid transfection system. Using ten-layer, cell fa ctories (Nunc, Rochester, NY, USA), the respective AAV vector plasmids were co-trans fected into 293 cells by polyethyleneimine with a packaging/helper plasmid(s). For normal capsid production, the helper plasmid based on pDG-2 contained the AAV2 rep gene and cap gene for each serotype needed, as well as complementing aden oviral functions required fo r amplification and packaging of the AAV genome. The AAV5 Y719F capsid viruses were produced from pACG2R5C58

PAGE 59

Y719F (created by Li Zhong, University of Florida) which contains the necessary mutations for the AAV5 capsid as well as rep from AAV2, and was complemented with pXX6 which contains the adenovirus helper genes Sixty hours post-transfection, cells were harvested with phosphate-bu ffered saline containing 10 mM ethylenediaminetetraacetic ac id (EDTA), pelleted, resuspended in low salt buffer and lysed by three rounds of freeze-thaw. Cellular nucleic acids were digested by incubation with Benzonase (Sigma, St Louis, MO, USA). Pu rification of AAV from the crude lysate was performed using iodixanol gradients follow ed by fast protein liquid chromatography affinity chromatography over a mono-Q column. The eluate was desalted and concentrated with a Millipor e Biomax 100K filter (Millipore, Billerica, MA, USA), aliquotted and stored at -80C. Viral titers were determined by quantitative competitive polymerase chain reaction (PCR) assay relative to well-characterized AAV viral reference standards. Each vira l preparation was examined for purity by resolution of the viral proteins by sodium dodecyl sulfate-pol yacrylamide gel electrophoresis and silver stain. Equine Tissue Collection Thoroughbred horses were eutha nized and tissues from diarthroidal joints of the forelimb were isolated. To isolate fibroblasti c synovial cells for experimentation, the soft tissues, including the synovial lining and su bsynovium, were scraped from the dense supporting fibrous tendon and ligamentous tissue of the capsule using a scalpel. Fragments of ligament and t endon tissues were harvested separately. Cartilage fragments were obtained by shaving with a scalpel. Under as eptic conditions, the fresh isolates of equine articular tissue were minced with a razor blade and digested in approximately 30 mL of saline solution wi th 0.2% collagenase for 2 h at 37C with 59

PAGE 60

constant stirring. Afterward, the sus pension was passed through a nylon mesh to remove undigested tissue. The cells in the filt rate were then pelleted, washed in saline and plated in complete medium (Dulbecco 's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS) with 1% penici llin/streptomycin). Twenty-four hours later, t he cultures were washed to remove non-adherent cells and debris; the medium was replac ed, and the cultures retur ned to the incubator. The cartilage derived cells were isolated much like the other cells, ex cept that minced, enzymatically digested cartilage was placed directly on culture plates without passing through a screen. Human cell cultures, derived from tissue surrounding the ankle, were isolated in the same manner as those from the horse. Human ti ssue was taken in a manner approved by the University of Florida Institutional Review Board, IRB# 59-03. In Vitro Viral Infections Unless otherwise indicated, cells were plated in 12-well plates and grown to approximately 70% confluence. Prior to infe ction, cells were washed two times with serum free media (DMEM). AAV ve ctor from stock solutions was mixed with serum free media to produce working solutions contai ning appropriate DNAse resistant viral genomes per cell and placed on cell cultures For experiments involving the GFP transgene and intracellular trafficking, viral doses of 10 4 viral genomes per cell were used. For those involving IL-1Ra, viral doses ranged from 10 3 to 10 5 viral genomes per cell. After incubation with virus for 2 hours, complete media was added to each well and the cells returned to the incubator. For quantific ation of IL-1Ra, at 24 h intervals after infection, the media from each well was harvested, and replaced with fresh media. Harvested media from selected days was stor ed frozen at -80C. Each viral dose was 60

PAGE 61

added to four individual wells and supernatant from each well was tested individually by an enzyme-linked immunosorbent assay (ELISA) (R&D Systems, Minneapolis, MN, USA). Cell Fractionation and Quantification of Viral Genomes Viral DNA from fractionated cells was is olated according to a procedure adapted from Zhao. 172 Briefly, cells were seeded at a 10 5 cells per well of a six-well dish, allowed to attach, and then infected with virus at 10 4 viral genomes/cell. After 24 hours, the cells were trypsinized, incubated in hy potonic buffer for 5 min on ice, and lysed in a non-ionic detergent. Centrifugat ion of the lysate allowed the nuclear fraction to be collected as the pellet whereas the super natant was reserved as the cytoplasmic fraction. Low molecular weight DNA from ea ch fraction was isolated by Hirt extraction and then used for quantitative PCR. Primer pairs (forward 5CACGCTGTTTTGACCTCCATAGAAG ACACCGGG, reverse 5TTCTTTGATTTGCACCACCACCGGATCCGGG) were designed to anneal to sequences within the CMV prom oter sequence. Viral genomes were detected using SYBR Green dye in an Eppendorf Mastercycler Realplex2 (Hamburg, Germany). The results were quantified by comparison to a well characterized viral reference standard. Neuraminidase Treatment Sialic acid residues on cells in culture were removed with neuraminidase to test AAV dependence on them for infectivity. E quine synovial fibroblasts were incubated with serum free medium cont aining 50mU/mL neuraminidas e (Sigma) for 2 hours at 37C. The medium was changed three time s to remove the enzyme and was replaced with serum free medium containing eit her type 2 or type 5 scAAV.GFP at 10 4 viral genomes per cell. Cells were incubated with virus for 1 hour, followed by another three 61

PAGE 62

washes, and then the addition of complete m edium. Cells were trypsinized after five days and fluorescence was measured by flow cytometry. In Vivo scAAV Delivery 1x10 12 vg of scAAV.hIL-1Ra packaged in type 2 and type 5 capsids were directly injected into four carpal and metacar pophalangeal (fetlock) joints of thoroughbred racehorses. At days 7, 21 and 35 post inje ction, synovial fluid was collected by arthrocentesis and analyzed for hIL-1Ra by ELISA. Self-complementary AAV vect ors with GFP or hIL-1Ra cDNAs were packaged into type 2 and type 5 capsids. A mixture of recombinant viruses with each transgene and of the same titer, 2.5x10 9 vg, and serotype were injected intra-articularly into both knee joint of two Wistar rats for each serotypes, with 4 joints to tal per serotype. Five days post injection, the rats were sacrificed, and the knees were removed, dissected, and placed under an inverted fluorescent microsc ope to view the presence of GFP. The dissected joints were then placed into individual wells of a 12-well tissue culture plate. 1 mL of serum free DMEM was added, and the ti ssue was incubated in a humidified cell culture chamber at 37C and 5% CO 2 for 24 hours. The medium was then used for a hIL-1Ra ELISA. Results Equine Cells are Highly Receptive to AAV Transduction Multiple serotypes of AAV are available for use in producing recombinant viruses for gene transfer, and each serotype can have a di fferent tropism which is cell type and species dependent. The first step to determine AAVs viability in a horse model was to test the tropism of several available serotypes by infecting cells in culture. 62

PAGE 63

scAAV.GFP packaged in serotypes 2,3,5, and 8 was used to transduce primary equine cells derived from synovium, cartilage, tendon, and ligament at 10 3 vg/cell. A composite of fluorescent micrographs taken 5 days post infection (Figure 3-1) illustrate the differences in serotype tropism. C hondrocytes were not highly receptive to transduction by any of the serotypes tested, nor was serotype 8 effective at transducing any of the cell types. The synovium derived fibroblasts, however, were transduced by the remaining serotypes, with serotype 5 tr ansducing the remaining three cell types: synovium, tendon, and ligament derived cells. This correlates with published observations that rodent joints are also highly receptive to serotype 5 infections. 163,179 To quantify positively transduced cells, flow cytometry was performed on synovium derived cells infected with serotypes 2 or 5. Three days post infection, over 98% of cells were positive (Figure 3-4, A and B). Transduced equine synovial cells were furt her examined for their capacity to secrete a therapeutic transgene. Another compilation of scAAV packaged in capsids 2,5, and 8 containing a transgene cassette fo r IL-1Ra was used to infect synovium derived fibroblasts at 10 4 vg/cell. IL-1Ra ELISA was performed on medium collected from the infected cells at da ys 3, 7, 14, and 21 (Figure 3-3) Cells infected with types 2 or 5 remained positive for the transgene pr otein product over the course of the experiment, with onset occurring at day 3 and peaking at day 7. Cells infected with serotypes 7 and 8 did not produce measurable transgene product after day 3. In summary, through all tests, serotypes 2 and 5 consistently expressed the highest levels of hIL-1Ra. 63

PAGE 64

Transduction Patterns Vary by Species Cells derived from rat and human joint tissues were also tested for their transducibility by several AAV vector serotypes. scAAV.GFP packaged into serotypes 1, 2, 5, and 8 were used to infect isolat ed primary cells from rat and human synovium, cartilage, tendon, and ligamen t. Fluorescence micrographs recorded GFP expression while flow cytometry was used to quantify the number of transduced cells. Three days post-infection, many rat cell types show mi nimal GFP expression (Figure 3-3), although the chondrocytes seem receptive across all serotypes tested, with 13-67% of the cells being GFP positive as measured by flow cytom etry. In contrast, the human cells show a quite different transduction pattern (Figur e 3-4), with no one cell type being dominantly receptive, but all tested cell types are mo st receptive to AAV2 transduction. These results indicate that between species, AAV re ceptor expression, or other factors, can vary by cell type. AAV2 and AAV5 Transgene Expression in Equine Synovial Fibroblasts The high level of transduction with AAV2 and AAV5 in equine cells warranted further investigation. Com parable infections of human der ived synovial fibroblasts with scAAV5.GFP showed a maximum of 30% of ce lls positively transduced (Figure 3-2 C). To investigate the mechanistic difference, equine and human synovial fibroblasts were infected with 10 4 vg/cell of either scAAV2.GFP or scAAV5.GFP and incubated for 24 hours. Cells were fractionated into cyt oplasmic and nuclear components and small DNA molecules were isolated with a Hirt extr action. These samples were used for a qPCR using primers that reside in the CMV promoter region of the vect or. The results of the qPCR were used to directly compare the number genomes detected in each fraction (Figure 3-6 and 3-7). In the type 5 infected cells, roughly 10-fold more viral 64

PAGE 65

genomes were detected from the equine samp les than the human, although the relative ratios of DNA in the nuclear and cytoplasmi c fractions remained the same. A similar pattern was seen with serotype 2 vectors. Th is indicates that cell entry, rather any intracellular localization process is res ponsible for the enhanced transduction of the equine cells. Also of note is that in both experiments, the vast ma jority of viral genomes were detected in the cytoplasm, even after 24 hours. Although entry into equine cells appears to be an efficient process, intrace llular trafficking could be limiting step. Sialic Acid is Primarily Responsible for AAV5 Transd uction of Equine Synovial Cells Sialic acid is a known receptor fo r AAV5 and its enzymatic removal with neuraminidase would inhibit AAV5 in fection, if it is the only mechanism available for cell entry. Low passage equine synovial cells we re treated with 50U/m L of neuraminidase for two hours and then infected with 10 4 vg/cell of scAAV5.GFP. Fluorescent micrographs were taken on days 1, 3 and 5 post-transfection and followed by flow cytometry to monitor GFP expr ession. Neuraminidase treatm ent had a drastic effect on transduction. Five days post infection, only 6. 8% of equine synovial cells were positive for GFP transgene expression, compared to 92.8% of control untreated equine cells (Figure 3-8). Neuraminidas e treatment showed no effect on AAV2 infectivity, as expected (data not shown). Therefore the enhanced transduc tion displayed by AAV5 on equine cells, it appears to be dependent on the presence of sialic acid. Intra-Articular Delivery of scAAV Serotypes 5 and 8 to the Rat Knee Joint The tissues that make up a joint are parti cularly fibrous and the cells of some tissues, especially the cartilage, are embedded in a thick extracellular matrix. Delivery of the virus directly to these tissues is necessary to determine if transduction patterns 65

PAGE 66

observed in vitro are relevant in vivo To determine the identity of transduced tissues, a GFP reporter was used, and to determine if these tissues could support secreted protein production, hIL-1Ra was used as a reporter. Prelim inary experiments determined that vectors containing eac h of these transgenes could be injected simultaneously with now adverse effects on expression of ei ther reporter. In this manner, both reporter cassettes were packaged into either AAV serotypes 5 or 8 and injected intra-articularly to the knee join ts of Wistar rats, with a dose of 2.5x10 9 vg of each reporter gene, giving total load of 5x10 9 AAV vector genomes injected per joint per serotype. After five days, the knee joints were harvested, dissected, and examined under a fluorescent microscope for GFP expressi on (Figure 3-9). Cont rary to what the above cell culture results would indicate, no GFP was observed in the cartilage or the adjacent synovium. Weak GFP expression was seen in the fat pad, a tissue that contains adipocytes and some synovial ce lls. Most surprising was the high GFP expression seen in the extra articular muscle. This indicates that the AAV vectors left the synovial space either due to diffusion or some unknown transport mechanism. This data contrasts with previous work where adenoviral and lentiviral vectors only transduced tissue immediately adj acent to the synovial space. After examination, knee joints were plac ed in 12-well tissue culture plates and incubated overnight in 1 mL of serum free DMEM in a cell culture incubator. The medium from this explant cu lture was used in an ELISA to test for hIL-1Ra expression, which resulted in over 20 ng/mL for tissue from both AAV5 and AAV8 injections. Although it is unknown how much of this transgene product would enter the synovial 66

PAGE 67

fluid, these results would indicate that the muscle surrounding the joint is extremely capable of supporting therapeutic protein production. Equine Joints Express High Levels of AAV2 and AAV5 Delivered Transgene The rat knee joint is much smaller than a human knee joint, and it does not bear as much proportional body weight as a hum an knee. These differences are further exemplified in the architec ture of the joint, with the human knee joint containing proportionately much denser fibrous tissue. This could contribute to the transduction patterns of AAV vectors as well as the potential of the virus to escape the joint space after intra-articular delivery. The forelim bs of a horse are much more analogous to human knees, both in size, function, and arch itecture, and were se lected for further in vivo testing. Based on in vitro data above, serotypes 2 and 5 were selected for use in vivo as they had the most potential for high levels of transgene expression. CMV-hIL-1Ra expression cassettes were used instead of a GFP reporter. The secreted transgene allows for measurements to be taken from synovial fluids, and the due to the large size of the equine joint and small amount of fl uid needed, the same joint can be repeatedly sampled. Using a human cDNA as opposed to an autologous horse cDNA will allow for accurate detection of transgene in the presence of the native proteins. Either vector was directly injected into the carpal and midcarpal joints of thoroughbred race horses at a dose of 1x10 12 vg. These joints are frequently the site of equine osteoarthritis and are homologous to human knees for the impact of athletic activity. Synovial fluid was collected periodically fr om each treated joint for five weeks and analyzed by ELISA to detect hIL-1Ra (Fi gure 3-10). Transgenic human IL-1Ra was 67

PAGE 68

detectable at measurable levels for the entire length of the five week study, with synovial fluid from type 5 infected join ts averaging 1.5 ng/mL and type 2 joints averaging 0.5 ng/mL. Capsid Modifications of Tyrosine to Phenylalanine Enhances Effectiveness Newly generated tyrosine to phenylalanine capsid mutants of AAV vectors allow for enhanced gene expression thr ough bypassing some of the ubiquitination/proteasom e degradation pathway that can i nhibit a large fraction of AAV virions from ever reaching the nucleus. 74 When these mutations are in place, intracellular trafficking to the nucleus is enhanced, leading to increased levels of transduction. An AAV5 based capsid mutant, Y719F, was used to generate new scAAV.GFP vectors. These Y719F capsid vi ruses then used to infect equine synovial fibroblasts at three different log doses: 10 4 10 3 and 10 2 vg/cell. The experiment was replicated with wild type AAV5 encapsidated vectors for comparison. The cells were monitored for GFP expression, as captur ed by fluorescent photomicrographs, and quantified on days 1, 3, and 5 postinfection by flow cytometry. The results at day 3 are shown in Figure 3-11. No di fference between the capsid types is seen at the standard dose of 10 4 vg/cell, but as the dose is lowered, the Y719F mutant supports a much higher transduction le vel. At the 10 2 vg/cell dose, 56% of Y719F cells are GFP positive while this is true for only 7% of standar d AAV5 infected cells. This indicates 10 4 vg/cell is a saturating dose of virus on equine cells, and Y719F vectors remain quite effective at lower doses. Discussion In the present study, we evaluated AAV as a gene therapy vector for use in equine models. AAV has established itself as the viral gene therapy vector of choice due to its 68

PAGE 69

unmatched safety profile, although much basic research still remains to be done, especially for use in non-human systems. The virus is naturally replication defective and has no known link to any human disease. Recombinant AAV vectors are made even safer as nearly the entire viral genome c an be replaced by an expression cassette. Advances in AAV technology, such as devel opment of self complementary vector genomes, are beginning to bring its efficacy in line with its safety. Further advances, such as the tyrosine to phenylalanine replacements on the viral capsid, are increasing efficacy even more. We believe that AAV is reaching a point where it can be successfully adapted for use in gene therapy based medicine for joint diseases. Osteoarthritis is a particularly good disease candidate for gene therapy. Palliative treatments can reduce pain and inflammation, but offer no chance to halt progression or reverse damage already incurred. Biologic agents can affect these changes, and local, sustained expression of these proteins is t he first step towards a working therapy. To further develop this therapy, rational models are needed, ones that closely mimic the human condition so treatment optimization can be undertaken. The equine joint provides just such a model. Weight bea ring and encapsulated with strong connective tissue and muscle, it is by far a better match in structure and function to the human knee than t hat of any rodent joint. Athletic horses also develop osteoarthritis themselves, and could potentia lly benefit from of any therapy being developed for humans. scAAV Differentially Transduces Jo int Cells from Different Species This study contains the first survey of t he transducibility of joint cells by various AAV serotypes. Cells from two model species, rats and horses, were compared to cells from humans to both collect expression dat a and to ascertain the usefulness of the 69

PAGE 70

models. As to expression patterns, differenc es between species are clearly present. In culture, only the cartilage derived cells of the rats appeared to be receptive to AAV transduction, while the human cells were only re ceptive to AAV type 2. In contrast, the equine cells were extremely receptive to mu ltiple serotypes. Taken alone, this data offers a difficult interpretation of how dat a from the animal models can be related to humans. The rat data suggest a completely di fferent transduction pattern from humans, while a model using the equine data could le ad to over-optimistic expectations of performance in human tissues. scAAV Transduction of Equine Synovial Cells Synovium is often the target of gene delivery to the joint, and we have found that equine synovium derived cells are highly receptive to several serotypes of AAV, especially types 2 and 5, as measured by ex pression either of GFP or the secreted gene product IL-1Ra. In ce ll culture, a dose of 10 4 viral genomes per cell was sufficient to transduce nearly 98% of cells. For com parison, in our hands, when AAV2 was used to infect 293 cells only 55% transduction occurred. Though not quantitatively measured, AAV5 also showed a high degree of transduction in ligament and tendon cells. Further investigations into the particu larly effective combination of AAV5 and equine synovial cells revealed that nearly 10fold more virus was entering equine cells than those of comparable hum an synovium-derived fibroblasts. However, even within these cells, a vast majority of the virus remained in the cytoplasm and was not trafficked to the nucleus. This was true when AAV2 vectors were used as well. It appears that surface receptors, namely sialic acid, on equine cells facilitate efficient viral entry. AAV5 vector entry appears to be primarily mediated through sialic 70

PAGE 71

acid residues, as enzymatic removal of si alic acid drastically curtailed transduction levels, thus reducing the likelihood of an alte rnative receptor for AAV in this setting. This interpretation would mean that AAV5 transduction of joint tissues is dependent on available sialic acid surface residues, and si nce receptor density appears to vary among species, being much greater in horses t han in humans, it remains to be determined whether there will be a more effective se rotype than AAV5 for transducing human synovial cells. Capsid Modification of AAV5 Enhances Transduction The idea of capsid modification of viral vectors has been researched for years, and one particular type of enhancement is now avail able for AAV is particularly promising. A paper by Zhong initially showed that r eplacement of tyrosine residues with phenylalanine on the surface of the AAV capsid removes a site of ubiquitination, which targets the virus for degr adation in the proteasome. 190 By removing some of the intracellular degradation which normally occurs in AAV infections, these minor capsid changes serve to enhance nuclear trafficking of the virus, leading to higher transgene production without affecting the tr opism or other viral functions. As noted above, much of the viral genomes detected after subcellu lar fractionation following infection were found to be in the cytoplasm, rather than t he nucleus. Improving trafficking to the nucleus could improve overa ll transduction efficiency. Us ing a single amino acid mutation on the AAV5 capsid, Y719F, we found lower doses of virus would work more efficiently than the conventional AAV5 capsid The highest dose we routinely give to cells in culture, 10 4 vg/cell, appears to be saturating and no improvements were seen. Significantly, the Y719F capsid appears to be less affected by dose reduction than wild type AAV5 capsid. For each ten-fold reducti on in dose, the Y719F capsid only loses 71

PAGE 72

roughly a quarter of its transduction ability, while the wild type capsid loses threequarters or more. Tyrosine to phenylalani ne AAV capsid mutants will add a greater degree of efficiency as AAV gene therapy progresses. scAAV Mediated Gene Transfer to Rat and Equine Joints A survey of AAV vectors was completed on ce lls in culture; however conditions in the joint could affect these transduction patte rns. The cellular density and much great amounts of extracellular matrix, especially in the cartilage, could affect AAVs infectivity when delivered into the joint space. The knee joints of rats are the largest a ccessible joint of the rodent that can be reliably used for intra-articular delivery of viral vectors. scAAV.GFP packaged in serotypes 5 and 8 were injected into the knees of rats. Upon exam ination of the joint tissues, the bulk of GFP expression was not seen in the immediate synovial space, the site of the injection, but in the muscles su rrounding the joint. This would suggest that the AAV particles are able to leave the join t space, although the mechanism for this remains unresolved. It is possible that t he small size of the AAV capsid, 20 nm, allows it to diffuse out through the jo int capsule. Active transpor t through the synovial cell layer or the lymphatic system are al so possibilities. This hi gh mobility of AAV after intraarticular injection has not been observed befo re, and is not seen with other viral vectors such as adenovirus or lentivirus. As the surrounding muscle was shown to be capable of supporting a high level of therapeutic protei n secretion, intra-articular delivery may still be a suitable choice for AAV delivery. However, alternative delivery techniques, such as delivering the virus directly to t he extra-articular muscl e should be investigated as it may offer equal effectiveness with fewer co mplications. Infection at injection sites 72

PAGE 73

is a possible side effect of any gene delivery method, and an intra-articular infection of an arthritic joint in a human would be detrimental. Transduction of equine joints differs could di ffer greatly from thos e of a rat. The increased size and thickness structural co mponents could impact AAV transduction. The large volume of the equine synovial fluid also allows for taking of fluid for direct measurement of transgenic pr oteins, whereas no such m easurements are reliable in rodents. When scAAV5.IL-1Ra was injected into the joints of horses, transgene product in the synovium was measured to be near 1 ng/mL for five weeks. Th is concentration of IL1-Ra to is remarkable; in view of the above rabbit study in which 1 ng/mL of IL-1Ra was the threshold for significant reduction in meas urable arthritic markers. To test if this level is therapeutic in horses, experiments will need to be conducted on arthritic horses, with improvements in swelling and lamene ss being markers for improvement. Direct measurement of inflammatory markers in the synovial fluid will also be possible in a horse model, and could be compared to transgene production over time. Implications from Animal Models After 5 weeks, the study was curta iled, but the transgene level was on a decreasing trend. The transgene was of human or igin and thus we expect that immune incompatibly may be responsible for the loss of transgene expressi on. Further tests using homologous transgenes that are immune co mpatible, but still allow for differential detection over endogenous gene ex pression would be needed to cl arify the impact of the immune systems elimin ation of transduced cells. Of equal importance to immune compatibilit y is the longevity of the transduced cells. When an integrating lentivirus was inje cted into rat knee joints, the synovial cells surrounding the joint cavity were lost ov er several weeks and were not replaced by 73

PAGE 74

mitotic division, while transduction of the co nnective tissue was stable over the life of the animal. 154 Since recombinant AAV is generally maintained as an episome, its productive transduction longevity will be diluted by cell division as well as cell loss. Further investigation into the location of the transduced cells in the equine joint is needed for these issues to be addressed. Th is aspect of the equine model should be directly translatable for any proposed AAV ba sed gene therapy to large human joints, as the joint architecture and injection methods wil l be similar. However, the in vitro data suggest that AAV transduction between species can be highly variable, and must be taken into account before any translation into a human system can take place. We believe this study provides solid ev idence of the utility of scAAV to deliver therapeutic transgenes to t he joints of horses. 74

PAGE 75

Figure 3-1. Differential transducibility across serotypes and cell types of the equine joint. Cells derived from equine joint tissue were cultured and infected with 10 3 vg/cell of scAAV.eGFP vectors. Fl uorescence photomicrographs are from day 5 post infection cells. 75

PAGE 76

Figure 3-2. Differential transducibility across serotypes and cell types of the human joint. Primary cells derived from human jo int tissue were cultured and infected with 10 4 vg/cell of scAAV.eGFP vectors. Fluorescence photomicrographs are from day 3 post infection cells. 76

PAGE 77

Figure 3-3. Differential transducibility acro ss serotypes and cell types of the rat joint. Cells derived from rat joint tiss ue were cultured and infected with 10 4 vg/cell of scAAV.eGFP vectors. Fluorescence phot omicrographs are from day 5 post infection cells. 77

PAGE 78

Figure 3-4. Transduction of equine and hum an synovial fibroblasts with scAAV. Low passage equine and human cells were infected with 1x10 4 vg/cell of scAAV2.GFP or scAAV5.GFP and incubated 3 days before fluorescence was measured with flow cytomet ry. Gated against uninfected controls, GFP was detected in 98-99% of equine cells (A and B) and 30.2% of human cells (C). 78

PAGE 79

Figure 3-5. Transgene expression following in fection of equine synovial cells with AAV viruses encoding human IL-1Ra. Following isolation of the cells from equine synovium, cells were grown in monolayer and infected with 3x10 9 vg of AAV2, 5, or 8 encoding hIL-1Ra. At day 2, 6, 13 and 20, medium was replaced by 1 mL of fresh medium. Tw enty-four hours later, conditioned media were harvested and hIL-1Ra content s measured by specific ELISA. Results are expressed in pg/mL. 79

PAGE 80

Figure 3-6. Viral genomes detected in equine and human cell fractions 24 hours post infection with scAAV5. In order to track intracellular migration of AAV genomes in equine and human cells, fractions of each cell type were taken 24 hours after infection with 10 4 vg/cell. Quantitative real time PCR was performed to determine the number of viral genomes in each sample. Results were corrected for dilution; the mean of three replicates are presented. 80

PAGE 81

Figure 3-7. Viral genomes detected in equi ne and human cell fractions 30 minutes, 2 hours, and 24 hours post infection with scAAV2. In order to track intracellular migration of AAV genomes in equine and hu man cells, fractions of each cell type were taken 24 hours after infection with 10 4 vg/cell. Quantitative real time PCR was performed to determine the number of viral genomes in each sample. Results were corrected for diluti on; the mean of th ree replicates are presented. 81

PAGE 82

Figure 3-8. Neuraminidase treatment inhibits AAV5 transduction of equine fibroblasts. To determine if sialic acid was responsible for increased AAV5 transduction efficiency, neuraminidase was used to re move sialic acid residues from the cell surface. Cells were treated with 50 U/mL of neuraminidase for 2 hours, washed 3 times, and then infected with 10 vg/cell scAAV.GFP. Fluorescence photomicrographs and flow 4 cytometry was performed 24 hours later. The percent of GFP-positive cells is indicated 82

PAGE 83

83 Figure 3-9. Fluorescence images of rat joint tiss ues five days after intra-articular injection with scAAV.GFP vectors. 2.5x10 9 vg of scAAV.GFP packaged in serotypes 5 or 8 capsids were injected di rectly into the synovial space of the rat knee. Images are repr esentative views of dissected tissues adjacent to the joint space.

PAGE 84

84 A. A. B. B. Day 0 Day 7 Day 21 Day 35 2500 2000 1500 1000 AAV Serotype 5 500 0 AAV Serotype 2pg/mLhIL-1RaC.Day 0 Day 7 Day 21 Day 35 2500 2000 1500 1000 AAV Serotype 5 500 0 AAV Serotype 2pg/mLhIL-1RaDay 0 Day 7 Day 21 Day 35 2500 2000 1500 1000 AAV Serotype 5 500 0 AAV Serotype 2 Day 0 Day 7 Day 21 Day 35 2500 2000 1500 1000 AAV Serotype 5 500 0 AAV Serotype 2pg/mLhIL-1RaC. Figure 3-10. scAAV-mediated gene delivery to the joints of horses. Intra-articu lar injection of scAAV-IL-1Ra into the carpal joint of a thoroughbred horse (A). Aspiration of sy novial fluid from the metaca rpophalangeal joint (fetlock) (B). Mean expression levels over ti me of hIL-1Ra in the joints of hor ses following injection of scAAV-IL-1Ra packaged in serotype 5 or serotype 2. Expression is shown as pg/mL of synovial fluid aspirate (C).

PAGE 85

Figure 3-11. AAV5 Y719F capsid mutation increases transduction efficiency in equine synovium derived fibroblasts. Self-complementary AAV genomes with identical CMV-GFP expression cassettes were packaged in either wild type AAV5 capsid or Y719F capsid and used to infect equine synovial cells at 10 4 10 3 or 10 2 vg/cell. After 72 hours, fluore scent micrographs were taken and GFP expressing cells were counted by flow cytometry. The percentage of GFP positive cells indicated in each panel. 85

PAGE 86

CHAPTER 4 SUMMARY AND FUTURE DIRECTIONS Tens of millions of Americans are currently suffering from inflammatory joint diseases known collectively as arthritis. Th e pain, restriction of motion, and reduction in quality of life costs are not only personal, but co st society tens of billions of dollars in medical care and lost wages. 13 These costs, and the attendant pain and suffering of individuals, will rise as our population ages. Pr evention of these condi tions is not likely as they are a function of normal activity and aging. Current common treatments are only palliative and make no headway against the underlying causes of the painful inflammation. Gene therapy provides an opportunity to directly affect these debilitating aspects of arthritis by modifying local cells of the joint to become a source of anti-inflammatory proteins. In the case of OA, a sustained, long term s uppression of inflammation would give the joint tissues an opportunity for self repair, which may ultimately reduce the cause of inflammation. Nonviral vector s have been shown to be highly inflammatory when introduced into the joint and are not suitable for use. Likewise, adenovirus, although highly effective at transducing hu man joint tissues, can not evade immune stimulation and subsequent elimination. Integrating retrovir uses are not suitable to treat arthritis as any risk of oncogenesis is pr esently unknown and potentially finite. Adenoassociated virus has none of the drawbacks of these other possible vectors, save that transduction efficiency has yet to be optimized. Self-complementary AAV vectors is shown here to have improved gene expression to the point where therapeutic levels of transgenic protein can be obtained in a model of inflammatory arthritis in rabbits. Knowledge gained in rodent models will not 86

PAGE 87

necessarily transfer to human syst ems, so investigations us ing equine tissues and joints have been initiated. Arthritic horses can pr ovide necessary data which is unattainable in rodent models. The size, structure, and disease progression of OA in humans and horses are a very close match, and these sim ilarities are what is needed for accurate predictions of how AAV will react when eventually used in human joints. However, differences in the levels of viral infection may overestimate the ef ficiency of treatment. Thus the validity of animal models of gene therapy remains a challenge. Once effective vectors are established, these can be used to answer remaining questions that stand between AAV and a useful clinical treatm ent: longevity and readministration. In mitoti c cells, episomal AAV genomes will be lost through dilution. Transduction of long-lived cells is desirable, although these cells appear to reside in the tendons and muscles surrounding the joint, and it is unknown if this will reduce the therapeutic efficacy of the transgene compar ed to transduction of synoviocytes. If re-administration becomes necessary, it is unknown what, if any, immune response would be mounted against the vector. Pre-existing immunity is also a factor as up to 80% of people globally are seropostive for antibodies against AAV2. 96 Interestingly, that same study indicates that some individual s had been infected with multiple serotypes, presumably at different times, meaning that antibodies to one serotype may not confer protection from another In a gene therapy situation, this may appear to be useful, as a different seroty pe could be used for each treatment, however this may not be practical in the near te rm. There are no mo re than a dozen well characterized serotypes that could be easily modified and used in vector production, although this could change. Mo re importantly, the tropism of the virus is dependent on 87

PAGE 88

its capsid protein, which determines the sero type. Changing the serotype of the vector would potentially alter the transduction pattern and efficacy of the treatment, which may or may not be desirable. Lower ing the titer of the vector used would seem to solve these problems, but again, this will necessita te the use of highly efficient vectors and our study here of Y-F mutant capsid vectors is a start in this direction. There are numerous Y-F mutant capsid vectors ava ilable on several serotypes, and they would need to be evaluated alone and in combi nation to test their efficacy. Overall, this work lays down a solid foundation for these future investigations. There are many challenges that face AAV before it will be ready for use as a gene therapy vector, but many of the basic questions have been answered. Selfcomplementary vectors with current expr ession cassettes are sufficient to produce therapeutic amounts of prot ein, contingent on infection of joint tissues. The longevity of transgene expression ultimately depends on what cells are infected, and what immune response occurs. Highly sensitive assays need to be developed to test these conditions concurrently, as they are tightly linked. The state of the art for AAV vectors is improving month after month, and the challenges of transduction longevity and re-adm inistration will not remain unsolved for long. 88

PAGE 89

LIST OF REFERENCES 1. Cremer, M.A., Rosloniec, E.F. & Kang, A.H. The cart ilage collagens: a review of their structure, organization, and role in the pathogenesis of ex perimental arthritis in animals and in human rheumatic disease. J. Mol. Med 76, 275-288 (1998). 2. Buckwalter, J.A. & Mankin, H.J. Articu lar cartilage: tissue design and chondrocytematrix interactions. Instr Course Lect 47, 477-486 (1998). 3. Buschmann, M.D. & Grodzinsky, A.J. A molecular model of proteoglycanassociated electrostatic forces in cartilage mechanics. J Biomech Eng 117 179192 (1995). 4. Goldring, M.B. Update on the biology of the chondrocyte and new approaches to treating cartilage diseases. Best Pract Res Clin Rheumatol 20, 1003-1025 (2006). 5. Aigner, T., Sachse, A., Gebhard, P.M. & Roac h, H.I. Osteoarth ritis: pathobiologytargets and ways for therapeutic intervention. Adv. Drug Deliv. Rev 58, 128-149 (2006). 6. Simkin, P.A. Rethinking the Ph ysiology of Articular Cartilage. JCR: Journal of Clinical Rheumatology 15, 260-263 (2009). 7. Grogan, S.P., Miyaki, S., Asahara, H., D'Lima, D.D. & Lotz, M.K. Mesenchymal progenitor cell markers in human articu lar cartilage: normal distribution and changes in osteoarthritis. Arthritis Res. Ther 11, R85 (2009). 8. Kuettner, K.E. Biochemistry of ar ticular cartilage in health and disease. Clin. Biochem 25 155-163 (1992). 9. Mor, A., Abramson, S.B. & Pillinger, M.H. The fibroblast-like synovial cell in rheumatoid arthritis: a key player in inflammation and joint destruction. Clin. Immunol 115 118-128 (2005). 10. Firestein, G.S. Evolving concepts of rheumatoid arthritis. Nature 423 356-361 (2003). 11. Smolen, J.S. & Steiner, G. Therapeutic strategies for rheumatoid arthritis. Nat Rev Drug Discov 2 473-488 (2003). 12. Smolen, J.S., Aletaha, D., Koeller, M., Weisman, M.H. & Emery, P. New therapies for treatment of r heumatoid arthritis. Lancet 370 1861-1874 (2007). 13. Elders, M.J. The increasing im pact of arthritis on public health. J Rheumatol Suppl 60, 6-8 (2000). 89

PAGE 90

14. Buckwalter, J.A. et al. Soft-tiss ue aging and musculoskeletal function. J Bone Joint Surg Am 75 1533-1548 (1993). 15. Hamerman, D. Biology of the aging joint. Clin. Geriatr. Med 14, 417-433 (1998). 16. Mankin, H.J. The effect of aging on articular cartilage. Bull N Y Acad Med 44, 545552 (1968). 17. Newman, A.P. Arti cular cartilage repair. Am J Sports Med 26, 309-324 (1998). 18. Goldring, M.B. The role of cytokines as inflammatory mediators in osteoarthritis: lessons from animal models. Connect. Tissue Res 40, 1-11 (1999). 19. Buckwalter, J.A. & Lane, N.E. Athletics and osteoarthritis. Am J Sports Med 25 873-881 (1997). 20. DePalma, A.F., McKeever C.D. & Subin, D.K. Proc ess of repair of articular cartilage demonstrated by histology and aut oradiography with trit iated thymidine. Clin. Orthop. Relat. Res 48, 229-242 (1966). 21. Shapiro, F., Koide, S. & Glimcher, M.J. Cell origin and differentiation in the repair of full-thickness defects of articular cartilage. J Bone Joint Surg Am 75 532-553 (1993). 22. Mankin, H.J. The response of arti cular cartilage to mechanical injury. J Bone Joint Surg Am 64 460-466 (1982). 23. Fuller, J.A. & Ghadially, F.N. Ultrastructural observat ions on surgically produced partial-thickness defects in articular cartilage. Clin. Orthop. Relat. Res 86, 193-205 (1972). 24. Coletti, J.M., Akeson, W.H. & Woo, S. L. A comparison of the physical behavior of normal articular cartilage and the arthroplasty surface. J Bone Joint Surg Am 54, 147-160 (1972). 25. Furukawa, T., Eyre, D.R., Koide, S. & G limcher, M.J. Biochemical studies on repair cartilage resurfacing experimental defects in the rabbit knee. J Bone Joint Surg Am 62, 79-89 (1980). 26. Goldring, M.B. & Goldri ng, S.R. Osteoarthritis. J. Cell. Physiol. 213 626-634 (2007). 27. Vinardell, T. et al. Evidence to suggest that cathepsin K degrades articular cartilage in naturally occurring equine osteoarthritis. Osteoarthr. Cartil 17, 375-383 (2009). 90

PAGE 91

28. Feldmann, M., Brennan, F.M. & Maini, R.N. Role of cytokines in rheumatoid arthritis. Annu. Rev. Immunol 14, 397-440 (1996). 29. Malemud, C.J., Islam, N. & Haqqi, T.M. Pathophysiological Mechanisms in Osteoarthritis Lead to Novel Therapeutic Strategies. Cells Tissues Organs 174 3448 (2003). 30. Kay, J. & Calabrese, L. The role of interleukin-1 in the pathogenesis of rheumatoid arthritis. Rheumatology (Oxford) 43 Suppl 3 iii2-iii9 (2004). 31. Richmond, J. et al. Treatment of ost eoarthritis of the knee (nonarthroplasty). J Am Acad Orthop Surg 17, 591-600 (2009). 32. Samson, D.J. et al. Treat ment of primary and secondary osteoarthritis of the knee. Evid Rep Technol Assess (Full Rep) 1-157 (2007). 33. Dripps, D.J., Brandhuber, B.J., Thompson, R.C. & Eisenberg, S.P. Interleukin-1 (IL1) receptor antagonist binds to the 80-kDa IL-1 receptor but does not initiate IL-1 signal transduction. Journal of Biological Chemistry 266 10331-10336 (1991). 34. Campion, G.V., Lebsack, M.E., Lookabaugh, J., Gordon, G. & Catalano, M. Doserange and dose-frequency study of recombi nant human interleukin-1 receptor antagonist in patients with rheum atoid arthritis. The IL-1Ra Arthritis Study Group. Arthritis Rheum 39, 1092-1101 (1996). 35. Bresnihan, B. Treatment of rheumatoid arthritis wit h interleukin 1 receptor antagonist. Ann. Rheum. Dis 58 Suppl 1 I96-98 (1999). 36. Cohen, S. et al. Treatm ent of rheumatoid arthritis with anakinra, a recombinant human interleukin-1 receptor antagonist, in combination with methotrexate: results of a twenty-four-week, mult icenter, randomized, double-blin d, placebo-controlled trial. Arthritis Rheum 46 614-624 (2002). 37. Jiang, Y. et al. A multicenter, double-blind, dose-ranging, randomized, placebocontrolled study of recombinant human inte rleukin-1 receptor antagonist in patients with rheumatoid arthritis: radiologic progression and correlation of Genant and Larsen scores. Arthritis Rheum 43 1001-1009 (2000). 38. Oligino, T. et al. Intr a-articular delivery of a herpes simplex virus IL-1Ra gene vector reduces inflammation in a rabbit model of arthritis. Gene Ther 6 1713-1720 (1999). 39. Otani, K. et al. Suppression of antigen-in duced arthritis in rabbits by ex vivo gene therapy. J. Immunol 156 3558-3562 (1996). 91

PAGE 92

40. Ghivizzani, S.C. et al. Direct adenov irus-mediated gene transfer of interleukin 1 and tumor necrosis factor alpha soluble rec eptors to rabbit knees with experimental arthritis has local and distal anti-arthritic effects. Proc. Natl. Acad. Sci. U.S.A 95, 4613-4618 (1998). 41. Hur, W. et al. Adenoviral delivery of IL-1 receptor antagonist abrogates disease activity during the development of autoimmu ne arthritis in IL-1 receptor antagonistdeficient mice. Immunol. Lett 106 154-162 (2006). 42. Pan, R.Y. et al. Therapy and prevent ion of arthritis by recombinant adenoassociated virus vector with delivery of interleukin-1 receptor antagonist. Arthritis Rheum 43 289-297 (2000). 43. Kay, J.D. et al. Intraarticular gene delivery and expression of interleukin-1Ra mediated by self-complement ary adeno-associated virus. J Gene Med 11, 605-614 (2009). 44. Makarov, S.S. et al. Suppression of experimental arthritis by gene transfer of interleukin 1 receptor antagonist cDNA. Proc. Natl. Acad. Sci. U.S.A 93, 402-406 (1996). 45. Wehling, P. et al. Clinical responses to gene therapy in joints of two subjects with rheumatoid arthritis. Hum. Gene Ther (2008) 46. Evans, C.H. et al. Clinical trial to a ssess the safety, feasibility, and efficacy of transferring a potentially anti-arthri tic cytokine gene to human joints with rheumatoid arthritis. Hum. Gene Ther 7 1261-1280 (1996). 47. Tak, P.P. et al. Analysis of the synovial cell infiltrate in early rheumatoid synovial tissue in relation to local disease activity. Arthritis Rheum 40 217-225 (1997). 48. Saag, K.G. et al. American College of Rheumatology 2008 recommendations for the use of nonbiologic and biologic dis ease-modifying antirheumatic drugs in rheumatoid arthritis. Arthritis Rheum 59 762-784 (2008). 49. Zhang, H.G. et al. Adeno-associated vi rus production of soluble tumor necrosis factor receptor neutralizes tumor necrosi s factor alpha and reduces arthritis. Hum. Gene Ther 11, 2431-2442 (2000). 50. Mukherjee, P. et al. TNF receptor gene therapy results in suppression of IgG2a anticollagen antibody in co llagen induced arthritis. Ann. Rheum. Dis 62, 707-714 (2003). 51. Evans, C.H., Ghivizzani, S. C. & Robbins, P.D. Arthriti s gene therapy's first death. Arthritis Res Ther 10, 110 (2008). 92

PAGE 93

52. Ghivizzani, S.C. et al. Perspectives on the use of gene therapy for chronic joint diseases. Curr Gene Ther 8 273-286 (2008). 53. Glover, D.J., Lipps, H.J. & Jans, D.A. Towards safe, non-viral therapeutic gene expression in humans. Nat. Rev. Genet 6 299-310 (2005). 54. Tranchant, I., Thompson, B., Nicola zzi, C., Mignet, N. & Scherman, D. Physicochemical optimisation of pl asmid delivery by cationic lipids. J Gene Med 6 Suppl 1 S24-35 (2004). 55. Ravi Kumar, M., Helle rmann, G., Lockey, R.F. & Mohapatra, S.S. Nanoparticlemediated gene delivery: state of the art. Expert Opin Biol Ther 4 1213-1224 (2004). 56. Thomas, M. & Klibanov, A.M. Non-viral gene ther apy: polycation-mediated DNA delivery. Appl. Microbiol. Biotechnol 62, 27-34 (2003). 57. Mir, L.M. et al. High-e fficiency gene transfer into skeletal muscle mediated by electric pulses. Proc. Natl. Acad. Sci. U.S.A 96, 4262-4267 (1999). 58. Lechardeur, D. & Lukacs, G.L. Intracellular barriers to non-viral gene transfer. Curr Gene Ther 2 183-194 (2002). 59. Sato, Y. et al. Imm unostimulatory DNA sequence s necessary for effective intradermal gene immunization. Science 273 352-354 (1996). 60. Ghivizzani, S., Oligino, T., Glorioso, J., Robbins, P. & Evans, C. Direct gene delivery strategies for the treat ment of rheumat oid arthritis. Drug Discov. Today 6 259-267 (2001). 61. Hacein-Bey-Abina, S. et al. LMO2-asso ciated clonal T cell proliferation in two patients after gene therapy for SCID-X1. Science 302 415-419 (2003). 62. Fuller, M. & Anson, D.S. Can the use of HIV-1 derived gene transfer vectors for clinical applicat ion be justified? Curr Gene Ther 4 65-77 (2004). 63. Cone, R.D. & Mulligan, R.C. High-e fficiency gene transfer into mammalian cells: generation of helper-free recombinant retr ovirus with broad mammalian host range. Proc. Natl. Acad. Sci. U.S.A 81, 6349-6353 (1984). 64. Gelse, K. & Schneider, H. Ex vivo gene therapy approaches to cartilage repair. Advanced Drug Delivery Reviews 58, 259-284 (2006). 93

PAGE 94

65. Aiken, C. Pseudotypin g human immunodeficiency virus type 1 (HIV-1) by the glycoprotein of vesicular stomatitis vi rus targets HIV-1 entry to an endocytic pathway and suppresses both the requirem ent for Nef and the sensitivity to cyclosporin A. J. Virol 71, 5871-5877 (1997). 66. Gouze, E. et al. Lent iviral-mediated gene delivery to synovium: potent intraarticular expression with amp lification by inflammation. Mol. Ther 7 460-466 (2003). 67. Gouze, E. et al. In vivo gene deliver y to synovium by lentiviral vectors. Mol. Ther 5 397-404 (2002). 68. Yin, G. et al. Endostatin gene trans fer inhibits joint angiogenesis and pannus formation in inflammatory arthritis. Mol. Ther 5 547-554 (2002). 69. Ng, P. & Graham, F.L. Construction of first-generation ad enoviral vectors. Methods Mol. Med 69 389-414 (2002). 70. Brough, D.E., Lizonova, A. Hsu, C., Kulesa, V.A. & Kovesdi, I. A gene transfer vector-cell line system for complete func tional complementation of adenovirus early regions E1 and E4. J. Virol 70, 6497-6501 (1996). 71. Wen, S. et al. Secondgeneration adenoviral vectors do not prevent rapid loss of transgene expression and vector DNA from the arterial wall. Arterioscler. Thromb. Vasc. Biol 20, 1452-1458 (2000). 72. Kochanek, S., Schiedner, G. & Volper s, C. High-capacity 'gutless' adenoviral vectors. Curr. Opin. Mol. Ther 3 454-463 (2001). 73. Lowenstein, P.R. & Castro M.G. Inflammation and adapti ve immune responses to adenoviral vectors injected into the br ain: peculiarities, mechanisms, and consequences. Gene Ther 10, 946-954 (2003). 74. Goossens, P.H. et al. The influenc e of synovial fluid on adenovirus-mediated gene transfer to the synovial tissue. Arthritis Rheum 44 48-52 (2001). 75. Evans, C., Gouze, E., G ouze, J., Robbins, P. & Gh ivizzani, S. Gene therapeutic approaches--transfer in vivo. Advanced Drug Delivery Reviews 58 243-258 (2006). 76. Goossens, P.H. et al. Infection effici ency of type 5 adenoviral vectors in synovial tissue can be enhanced with a type 16 fiber. Arthritis Rheum 44, 570-577 (2001). 77. Toh, M. et al. Enhancement of adenov irus-mediated gene deliv ery to rheumatoid arthritis synoviocytes and synovium by fiber modifications: role of arginine-glycineaspartic acid (RGD)and nonRGD-binding integrins. J. Immunol 175 7687-7698 (2005). 94

PAGE 95

78. Daya, S. & Berns, K.I. Gene Therapy Using Adeno-Associated Virus Vectors. Clinical Microbiology Reviews 21, 583-593 (2008). 79. Girod, A. et al. The VP1 capsid prot ein of adeno-associated virus type 2 is carrying a phospholipase A2 domain required for virus infectivity. J. Gen. Virol 83, 973-978 (2002). 80. Duan, D. et al. Dynamin is required fo r recombinant adeno-associated virus type 2 infection. J. Virol 73, 10371-10376 (1999). 81. Bleker, S., Sonntag, F. & Kleinschmidt, J.A. Mutational analysis of narrow pores at the fivefold symmetry axes of adeno-associ ated virus type 2 capsids reveals a dual role in genome packaging and activation of phospholipase A2 activity. J. Virol 79, 2528-2540 (2005). 82. Girod, A. et al. The VP1 capsid prot ein of adeno-associated virus type 2 is carrying a phospholipase A2 domain required for virus infectivity. J. Gen. Virol 83, 973-978 (2002). 83. Bartlett, J.S., Wilcher, R. & Samulski R.J. Infectious entry pathway of adenoassociated virus and adeno-asso ciated virus vectors. J. Virol 74, 2777-2785 (2000). 84. Akache, B. et al. A two-hybrid screen identifies cathepsins B and L as uncoating factors for adeno-associ ated virus 2 and 8. Mol. Ther 15 330-339 (2007). 85. Zhong, L. et al. A Dual Role of EG FR Protein Tyrosine Kinase Signaling in Ubiquitination of AAV2 Capsids and Viral Second-strand DNA Synthesis. Mol Ther 15, 1323-1330 (2007). 86. Knipe, D.M. & Howley, P.M. Fields Virology (Lippincott Williams & Wilkins: 2001). 87. Smith, R.H. Adeno-asso ciated virus integration: virus versus vector. Gene Ther 15, 817-822 (2008). 88. Giraud, C., Winocour, E. & Berns, K.I. Site-specific integration by adeno-associated virus is directed by a cellular DNA sequence. Proc. Natl. Acad. Sci. U.S.A 91, 10039-10043 (1994). 89. Gao, G., Vandenberghe, L. H. & Wilson, J.M. New re combinant serotypes of AAV vectors. Curr Gene Ther 5 285-297 (2005). 90. Burger, C. et al. Recombinant AAV vi ral vectors pseudotyped with viral capsids from serotypes 1, 2, and 5 display differential efficiency and cell tropism after delivery to different regions of the central nervous system. Mol. Ther 10, 302-317 (2004). 95

PAGE 96

91. Zabner, J. et al. Adeno-associated viru s type 5 (AAV5) but not AAV2 binds to the apical surfaces of airway epithelia and facilitates gene transfer. J. Virol 74, 38523858 (2000). 92. Nomoto, T. et al. Distinct patterns of gene transfer to gerbil hippocampus with recombinant adeno-associated virus type 2 and 5. Neurosci. Lett 340 153-157 (2003). 93. Handa, A., Muramatsu, S., Qiu, J., Mizu kami, H. & Brown, K.E. Adeno-associated virus (AAV)-3-based vectors transduce haematopoietic cells not susceptible to transduction with AAV-2-based vectors. J. Gen. Virol 81 2077-2084 (2000). 94. Srivastava, A. Hematopoietic st em cell transduction by recombinant adenoassociated virus vectors: problems and solutions. Hum. Gene Ther 16, 792-798 (2005). 95. Liu, X. et al. Spliceosome-mediated RNA trans-splicing with recombinant adenoassociated virus partially restores cyst ic fibrosis transmembrane conductance regulator function to polar ized human cystic fibrosis airway epithelial cells. Hum. Gene Ther 16, 1116-1123 (2005). 96. Erles, K., Sebkov, P. & Schlehofer, J.R. Update on the prevalence of serum antibodies (IgG and IgM) to adeno-associated virus (AAV). J. Med. Virol 59, 406411 (1999). 97. Mingozzi, F. et al. Induction of immune to lerance to coagulation factor IX antigen by in vivo hepatic gene transfer. J. Clin. Invest 111 1347-1356 (2003). 98. Mount, J.D. et al. Sustained phenotyp ic correction of hemophilia B dogs with a factor IX null mutation by liver-directed gene therapy. Blood 99, 2670-2676 (2002). 99. Li, H. et al. Pre-existing AAV capsid-s pecific CD8+ T cells are unable to eliminate AAV-transduced hepatocytes. Mol. Ther 15, 792-800 (2007). 100. Xiao, W. et al. Route of administrati on determines induction of T-cell-independent humoral responses to adeno-associated virus vectors. Mol. Ther 1 323-329 (2000). 101. Lowenstein, P.R., Mandel, R.J., Xiong, W., Kroeger, K. & Castro, M.G. Immune responses to adenovirus and adeno-associat ed vectors used for gene therapy of brain diseases: the role of immunological synapses in understanding the cell biology of neuroimmune interactions. Curr Gene Ther 7 347-360 (2007). 102. Lo, W.D. et al. Adeno-associated vi rus-mediated gene transfer to the brain: duration and modulati on of expression. Hum. Gene Ther 10, 201-213 (1999). 96

PAGE 97

103. Mastakov, M.Y. et al. Immunological aspects of recombinant adeno-associated virus delivery to the mammalian brain. J. Virol 76, 8446-8454 (2002). 104. Reimsnider, S., Manfredsson, F.P., Muzycz ka, N. & Mandel, R.J. Time course of transgene expression after intrastriatal pseudotyped rAAV2/1, rAAV2/2, rAAV2/5, and rAAV2/8 transduction in the rat. Mol. Ther 15, 1504-1511 (2007). 105. Peden, C.S., Burger, C ., Muzyczka, N. & Mandel, R.J. Circulating anti-wild-type adeno-associated virus type 2 (AAV2) antibodies inhibit recombinant AAV2 (rAAV2)-mediated, but not rAAV5-mediat ed, gene transfer in the brain. J. Virol 78, 6344-6359 (2004). 106. Sanftner, L.M. et al. Striatal deliv ery of rAAV-hAADC to rats with preexisting immunity to AAV. Mol. Ther 9 403-409 (2004). 107. Li, Q. et al. Intraocul ar route of AAV2 vector adm inistration defines humoral immune response and t herapeutic potential. Mol. Vis 14, 1760-1769 (2008). 108. Anand, V., Chirmule, N., Fersh, M., Maguire, A.M. & Bennett, J. Additional transduction events after subretinal r eadministration of recombinant adenoassociated virus. Hum. Gene Ther 11, 449-457 (2000). 109. Li, W. et al. Gene therapy following subretinal AAV5 vector delivery is not affected by a previous intravitreal AAV5 vect or administration in the partner eye. Mol. Vis 15, 267-275 (2009). 110. Manno, C.S. et al. Successful transducti on of liver in hemophilia by AAV-Factor IX and limitations imposed by the host immune response. Nat. Med 12 342-347 (2006). 111. Mingozzi, F. et al. CD8(+) T-cell res ponses to adeno-associated virus capsid in humans. Nat. Med 13, 419-422 (2007). 112. Pien, G.C. et al. Capsid antigen presentation flags human hepatocytes for destruction after transduction by adeno-associated viral vectors. J. Clin. Invest 119 1688-1695 (2009). 113. Li, H. et al. Pre-existing AAV capsid-s pecific CD8+ T cells are unable to eliminate AAV-transduced hepatocytes. Mol. Ther 15, 792-800 (2007). 114. Li, C. et al. Adeno-asso ciated virus type 2 (AAV2) capsid-specific cytotoxic T lymphocytes eliminate only vector-transduc ed cells coexpressing the AAV2 capsid in vivo. J. Virol 81, 7540-7547 (2007). 97

PAGE 98

115. Wang, L., Figueredo, J., Ca lcedo, R., Lin, J. & Wilson, J.M. Cross-presentation of adeno-associated virus serotype 2 capsids ac tivates cytotoxic T cells but does not render hepatocytes effectiv e cytolytic targets. Hum. Gene Ther 18, 185-194 (2007). 116. Mingozzi, F. & High, K.A. Immune responses to AAV in clinical trials. Curr Gene Ther 7 316-324 (2007). 117. McCarty, D.M. et al. Adeno-associated virus terminal repeat (T R) mutant generates self-complementary vectors to overcome the rate-limiting step to transduction in vivo. Gene Ther 10, 2112-2118 (2003). 118. Maheshri, N., Koerber, J.T., Kaspar, B.K. & Schaffer, D.V. Directed evolution of adeno-associated virus yields enhanced gene delivery vectors. Nat Biotech 24, 198-204 (2006). 119. Xu, J., Ma, C., Bass, C. & Terwilliger, E.F. A combination of mutations enhances the neurotropism of AAV-2. Virology 341 203-214 (2005). 120. Yu, C. et al. A muscle-targeting peptide displayed on AAV2 improves muscle tropism on systemic delivery. Gene Ther 16, 953-962 (2009). 121. Li, W. et al. Generation of Novel AAV Va riants by Directed Evolution for Improved CFTR Delivery to Human Ciliated Airway Epithelium. Mol. Ther (2009). 122. Klimczak, R.R., Koerber, J.T., Dalkara, D., Flannery, J.G. & Schaffer, D.V. A novel adeno-associated viral variant for efficient and selective intravitreal transduction of rat Mller cells. PLoS ONE 4 e7467 (2009). 123. Gigout, L. et al. Altering AAV tr opism with mosaic viral capsids. Mol. Ther 11 856865 (2005). 124. Ponnazhagan, S., Mahendra, G., Kumar, S., Thompson, J.A. & Castillas, M. Conjugate-based targeting of recombinant adeno-associated virus type 2 vectors by using avidin-linked ligands. J. Virol 76, 12900-12907 (2002). 125. Lee, G.K., Maheshri, N., Kaspar, B. & Schaffer, D.V. PEG conjugation moderately protects adeno-associated viral vect ors against antibody neutralization. Biotechnol. Bioeng 92, 24-34 (2005). 126. Zhong, L. et al. Next generation of adeno-associated virus 2 vectors: Point mutations in tyrosines lead to high -efficiency transduction at lower doses. Proceedings of the Nationa l Academy of Sciences 105 7827-7832 (2008). 127. Petrs-Silva, H. et al. High-efficiency Transduction of the Mouse Retina by Tyrosinemutant AAV Serotype Vectors. Mol Ther 17, 463-471 (2008). 98

PAGE 99

128. Douar, A., Poulard, K., Stockholm, D. & Danos, O. Intracellular Trafficking of Adeno-Associated Virus Vectors: Routi ng to the Late Endosomal Compartment and Proteasome Degradation. J. Virol. 75, 1824-1833 (2001). 129. Zhang, L.N. et al. Dual therapeutic utility of proteasome modulating agents for pharmaco-gene therapy of the cystic fibrosis airway. Mol. Ther 10, 990-1002 (2004). 130. Denby, L., Nicklin, S.A. & Baker, A.H. Adeno-associated virus (AAV)-7 and -8 poorly transduce vascular endothelial cells and are sensitive to proteasomal degradation. Gene Ther 12, 1534-1538 (2005). 131. Tang, S., Sambanis, A. & Sibley, E. Proteasome modulating agents induce rAAV2mediated transgene expression in human intestinal epithelial cells. Biochem. Biophys. Res. Commun 331 1392-1400 (2005). 132. Nathwani, A.C. et al. Enhancing transduc tion of the liver by adeno-associated viral vectors. Gene Ther 16, 60-69 (2009). 133. Yan, Z. et al. Distinct classes of proteasome-modulati ng agents cooperatively augment recombinant adeno-associated vi rus type 2 and type 5-mediated transduction from the apical surfac es of human airway epithelia. J. Virol 78, 28632874 (2004). 134. Qing, K. et al. Human fibroblast growth factor receptor 1 is a co-receptor for infection by adeno-associated virus 2. Nat. Med 5 71-77 (1999). 135. Summerford, C. & Samulski, R.J. Membrane-associated heparan sulfate proteoglycan is a receptor for adenoassociated virus type 2 virions. J. Virol 72, 1438-1445 (1998). 136. Summerford, C., Bartlett, J.S. & Samulski, R.J. AlphaV beta5 integrin: a co-receptor for adeno-associated virus type 2 infection. Nat. Med 5 78-82 (1999). 137. Kashiwakura, Y. et al. Hepatocyte growth factor receptor is a coreceptor for adenoassociated virus type 2 infection. J. Virol 79, 609-614 (2005). 138. Di Pasquale, G. et al. Identificat ion of PDGFR as a receptor for AAV-5 transduction. Nat. Med 9 1306-1312 (2003). 139. Akache, B. et al. The 37/67-kilodalton laminin recept or is a receptor for adenoassociated virus serotypes 8, 2, 3, and 9. J. Virol 80, 9831-9836 (2006). 140. Wu, Z., Miller, E., Agbandje-McKenna, M. & Samulski, R.J. Alpha2,3 and alpha2,6 N-linked sialic acids facilitate effi cient binding and transduction by adenoassociated virus types 1 and 6. J. Virol 80, 9093-9103 (2006). 99

PAGE 100

141. Walters, R.W. et al. Binding of adeno-a ssociated virus type 5 to 2,3-linked sialic acid is required for gene transfer. J. Biol. Chem 276 20610-20616 (2001). 142. Kaludov, N., Brown, K.E., Walters, R.W., Zabner, J. & Ch iorini, J.A. Adenoassociated virus serotype 4 (AAV4) and AAV5 both require sialic acid binding for hemagglutination and efficient transduction but differ in sialic acid linkage specificity. J. Virol 75, 6884-6893 (2001). 143. Evans, C.H., Ghivizzani, S. C. & Robbins, P.D. Gene therapy for arthritis: what next? Arthritis Rheum 54, 1714-1729 (2006). 144. Bandara, G. et al. Intraarticular expre ssion of biologically active interleukin 1receptor-antagonist protein by ex vivo gene transfer. Proc. Natl. Acad. Sci. U.S.A 90, 10764-10768 (1993). 145. Adriaansen, J. et al. Intraarticula r interferon-beta gene therapy ameliorates adjuvant arthritis in rats. Hum. Gene Ther 17, 985-996 (2006). 146. Lechman, E.R. et al. The contralatera l effect conferred by intra-articular adenovirus-mediated gene transfer of viral IL -10 is specific to the immunizing antigen. Gene Ther 10, 2029-2035 (2003). 147. Evans, C.H., Ghivizzani, S.C., Oligi no, T.A. & Robbins, P.D. Future of adenoviruses in the gene therapy of arthritis. Arthritis Res 3 142-146 (2001). 148. Lubberts, E. et al. Adenoviral vector-medi ated overexpression of IL-4 in the knee joint of mice with collagen-induced ar thritis prevents cartilage destruction. J. Immunol 163 4546-4556 (1999). 149. Nita, I. et al. Direct gene delivery to synov ium. An evaluation of potential vectors in vitro and in vivo. Arthritis Rheum 39, 820-828 (1996). 150. Zhang, H., Gao, G., Clay burne, G. & Schumacher, H.R. Elimination of rheumatoid synovium in situ using a Fas ligand 'gene scalpel'. Arthritis Res. Ther 7 R12351243 (2005). 151. Lechman, E.R. et al. Direc t adenoviral gene transfer of viral IL-10 to rabbit knees with experimental arthritis ameliorates di sease in both injected and contralateral control knees. J. Immunol 163 2202-2208 (1999). 152. Ijima, K. et al. Succe ssful gene therapy via intraarticular injection of adenovirus vector containing CTLA4IgG in a murine m odel of type II collagen-induced arthritis. Hum. Gene Ther 12, 1063-1077 (2001). 100

PAGE 101

153. Ghivizzani, S., Oligino, T., Glorioso, J., Robbins, P. & Evans, C. Direct gene delivery strategies for the treat ment of rheumat oid arthritis. Drug Discov. Today 6 259-267 (2001). 154. Gouze, E. et al. Trans gene persistence and cell turnover in the diarthrodial joint: implications for gene therapy of chronic joint diseases. Mol. Ther 15 1114-1120 (2007). 155. Gouze, E. et al. Lentiviral-mediated gene delivery to synovium: potent intraarticular expression with amp lification by inflammation. Mol. Ther 7 460-466 (2003). 156. Goater, J. et al. Empi rical advantages of adeno associated viral vectors in vivo gene therapy for arthritis. J. Rheumatol 27, 983-989 (2000). 157. Wu, Z., Asokan, A. & Samulski, R.J. Adeno-associated virus serotypes: vector toolkit for human gene therapy. Mol. Ther 14, 316-327 (2006). 158. Li, C., Bowles, D.E., van Dyke, T. & Sa mulski, R.J. Adeno-associated virus vectors: potential applications for cancer gene therapy. Cancer Gene Ther 12, 913-925 (2005). 159. Xiao, X., Li, J. & Samulski, R.J. Production of high-titer recombinant adenoassociated virus vectors in the absence of helper adenovirus. J. Virol 72, 22242232 (1998). 160. Grimm, D., Kern, A., Ritt ner, K. & Kleinschmidt, J.A. Novel tools for production and purification of recombinant adenoassociated virus vectors. Hum. Gene Ther 9 2745-2760 (1998). 161. Adriaansen, J., Fallaux, F.J., de Cortie C.J., Vervoordeldonk, M.J. & Tak, P.P. Local delivery of beta inte rferon using an adeno-associat ed virus type 5 effectively inhibits adjuvant arthritis in rats. J. Gen. Virol 88, 1717-1721 (2007). 162. Cottard, V. et al. Adeno-associated vi rus-mediated delivery of IL-4 prevents collagen-induced arthritis. Gene Ther 7 1930-1939 (2000). 163. Adriaansen, J. et al. Reduction of arthriti s following intra-articu lar administration of an adeno-associated virus serotype 5 expressi ng a disease-inducible TNF-blocking agent. Ann. Rheum. Dis 66, 1143-1150 (2007). 164. Adriaansen, J. et al. Enhanced gene transfer to arthritic joints using adenoassociated virus type 5: implicatio ns for intra-articular gene therapy. Ann. Rheum. Dis 64, 1677-1684 (2005). 101

PAGE 102

165. Chan, J.M.K. et al. Intraarticu lar gene transfer of TNFR:Fc suppresses experimental arthritis wit h reduced systemic distri bution of the gene product. Mol. Ther 6 727-736 (2002). 166. Khoury, M. et al. Infl ammation-inducible anti-TNF gene expression mediated by intra-articular injection of serotype 5 adeno-associated virus reduces arthritis. J Gene Med 9 596-604 (2007). 167. Takahashi, H. et al. Adeno-associated virus vector-mediated anti-angiogenic gene therapy for collagen-induced arthritis in mice. Clin. Exp. Rheumatol 23, 455-461 (2005). 168. Tas, S.W. et al. Amelioration of arthriti s by intraarticular domi nant negative Ikk beta gene therapy using adeno-associated virus type 5. Hum. Gene Ther 17, 821-832 (2006). 169. Ulrich-Vinther, M. et al. In vivo gene de livery to articular chondrocytes mediated by an adeno-associated virus vector. J. Orthop. Res 22, 726-734 (2004). 170. Katakura, S. et al. Recombinant adeno-associated virus pref erentially transduces human, compared to mouse, synovium: implications for arthritis therapy. Mod Rheumatol 14, 18-24 (2004). 171. McCarty, D.M., Monahan, P. E. & Samulski, R.J. Self -complementary recombinant adeno-associated virus (scAAV) vector s promote efficient transduction independently of DNA synthesis. Gene Ther 8 1248-1254 (2001). 172. Zhao, W. et al. Role of cellular FKBP 52 protein in intracellular trafficking of recombinant adeno-associated virus 2 vectors. Virology 353 283-293 (2006). 173. Hirt, B. Selective extraction of polyoma DNA from infected mouse cell cultures. J. Mol. Biol 26 365-369 (1967). 174. Ghivizzani, S.C. et al. C onstitutive intra-articular ex pression of human IL-1 beta following gene transfer to rabbit synovium produces all major pathologies of human rheumatoid arthritis. J. Immunol 159 3604-3612 (1997). 175. Arend, W.P. & Gabay, C. Physiologic role of interleukin-1 receptor antagonist. Arthritis Res 2 245-248 (2000). 176. Arend, W.P., Malyak, M., Guthridge, C. J. & Gabay, C. Interleukin-1 receptor antagonist: role in biology. Annu. Rev. Immunol 16, 27-55 (1998). 177. Pan, R.Y. et al. Disease-inducible transgene expression from a recombinant adeno-associated virus vector in a rat arthritis model. J. Virol 73, 3410-3417 (1999). 102

PAGE 103

178. Zhang, H.G. et al. Adeno-associated viru s production of soluble tumor necrosis factor receptor neutralizes tumor necrosi s factor alpha and reduces arthritis. Hum. Gene Ther 11, 2431-2442 (2000). 179. Apparailly, F. et al. Adeno-associated virus pseudotyp e 5 vector improves gene transfer in arthritic joints. Hum. Gene Ther 16, 426-434 (2005). 180. Douar, A.M., Poulard, K., Stockholm, D. & Danos, O. Intracel lular trafficking of adeno-associated virus vectors: routing to the late endosomal compartment and proteasome degradation. J. Virol 75, 1824-1833 (2001). 181. Hansen, J., Qing, K., Kwon, H.J., Mah, C. & Srivastava A. Impaired intracellular trafficking of adeno-associated virus type 2 ve ctors limits efficient transduction of murine fibroblasts. J. Virol 74, 992-996 (2000). 182. Hansen, J., Qing, K. & Srivastava, A. Adeno-associated virus type 2-mediated gene transfer: altered endocytic processi ng enhances transduction efficiency in murine fibroblasts. J. Virol 75, 4080-4090 (2001). 183. Thomas, C.E., Storm, T. A., Huang, Z. & Kay, M.A. Rapid uncoating of vector genomes is the key to efficient liv er transduction with pseudotyped adenoassociated virus vectors. J. Virol 78, 3110-3122 (2004). 184. Zhong, L. et al. Impair ed nuclear transport and uncoati ng limit recombinant adenoassociated virus 2 vector-mediated transduc tion of primary mu rine hematopoietic cells. Hum. Gene Ther 15, 1207-1218 (2004). 185. Ferrari, F.K., Samulski, T., Shenk, T. & Samulski, R.J. Second-strand synthesis is a rate-limiting step for efficient trans duction by recombinant adeno-associated virus vectors. J. Virol 70, 3227-3234 (1996). 186. Fisher, K.J. et al. Transduction with recombinant adeno-associated virus for gene therapy is limited by leading-strand synthesis. J. Virol 70, 520-532 (1996). 187. Traister, R.S., Fabre, S ., Wang, Z., Xiao, X. & Hirsch R. Inflammatory cytokine regulation of transgene expressi on in human fibroblast-like synoviocytes infected with adeno-associated virus. Arthritis Rheum 54, 2119-2126 (2006). 188. Jennings, K. et al. Proteasome inhibition enhances AAV-mediated transgene expression in human synoviocytes in vitro and in vivo. Mol. Ther 11, 600-607 (2005). 189. Zhong, L. et al. A dual role of EGFR protein tyrosine kinase signaling in ubiquitination of AAV2 capsids and viral second-strand DNA synthesis. Mol. Ther 15, 1323-1330 (2007). 103

PAGE 104

190. Zhong, L. et al. Next generation of adeno-associated virus 2 vectors: point mutations in tyrosines lead to high -efficiency transduction at lower doses. Proc. Natl. Acad. Sci. U.S.A 105 7827-7832 (2008). 104

PAGE 105

BIOGRAPHICAL SKETCH Jesse Douglas Kay was born on Fort Lewis, Washington, outside of Tacoma. He graduated valedictorian of Jacksonville Hig h Schools class of 1999 in the city Jacksonville, Arkansas. His undergraduate studies began the following fall at Vanderbilt University, Nashville, Tennessee, where he ma jored in biological sciences. During his junior year, Jesse began working as a research assistant in the lab of Dr. John S. Penn, where he contributed to the understanding a nd treatment of t he retinopathy of prematurity. After re ceiving his Bachelor of Science in May 2003, he continued to work for Dr. Penn as a research assistant until joining the Interdisciplinary Research Program at the University of Florida, College of Medicine in Augu st of 2004. In May of 2005, Jesse joined the lab of Dr. Steven C. Gh ivizzani, where he investigated the use of gene therapy applications for orthopaedic condition s and received his Ph.D. in the fall of 2009. 105