<%BANNER%>

Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2011-12-31.

Permanent Link: http://ufdc.ufl.edu/UFE0041152/00001

Material Information

Title: Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2011-12-31.
Physical Description: Book
Language: english
Creator: Qi, Yanfei
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: Pharmacodynamics -- Dissertations, Academic -- UF
Genre: Pharmaceutical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Statement of Responsibility: by Yanfei Qi.
Thesis: Thesis (Ph.D.)--University of Florida, 2009.
Local: Adviser: Katovich, Michael J.
Electronic Access: INACCESSIBLE UNTIL 2011-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0041152:00001

Permanent Link: http://ufdc.ufl.edu/UFE0041152/00001

Material Information

Title: Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2011-12-31.
Physical Description: Book
Language: english
Creator: Qi, Yanfei
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: Pharmacodynamics -- Dissertations, Academic -- UF
Genre: Pharmaceutical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Statement of Responsibility: by Yanfei Qi.
Thesis: Thesis (Ph.D.)--University of Florida, 2009.
Local: Adviser: Katovich, Michael J.
Electronic Access: INACCESSIBLE UNTIL 2011-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0041152:00001


This item has the following downloads:


Full Text

PAGE 1

1 OVEREXPRESSION OF ANG (1 7) OR CARDIACSELECTIVE OVEREXPRESSION OF ANGIOTENSIN TYPE 2 RECEPTOR IMPROVES CARDIAC FUNCTION AND ATTENUATES LEFT VENTRICULAR REMODELING By YANFEI QI A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2009

PAGE 2

2 2009 Yanfei Qi

PAGE 3

3 I dedicate this work to my parents Xiangqian Qi and Yuanli Deng and my husband, Xuan Liu

PAGE 4

4 ACKNOWLEDGMENTS I would first like to thank my mentor, Dr Michael J. Katovich, for his guidance, encouragement, and precious advice over the last four years. I was honored to be one of his graduate students. Along with my graduate mentor, I woul d like to thank my m aster s degree mentor, Dr Xilin Ren His guidance and friendship are the primary reasons for my interest in doing biomedical research Next, I would like to thank my graduate committee members, Drs. Colin Sumners Joanna Peris Maureen Keller Wood, and Sihong Song. They have provided me their kind support, invaluable advice and knowledge. I would like to thank Dr M ohan K. Raizada for his support and his enthusiasm for scientific research. I would also like to thank Adam Mecca, Drs Hongwei Li, Peng Shi and Jiang Nan from Dr Colin Sumners lab, and Dr s. Zhiyin Shan, Lihui Yuan, Fan Lin from Dr Mohan K. Raizadas lab for their generous heart s and smart advice They taught me s o many new and useful skills and techniques My special th anks go to Dr Hongwei Li, who helped me solve so many research problems and motivated me to continue my project I also extend my appreciation to my friends and coworkers in Dr. Katovichs laboratory for their help and friendship, e specially Vinayak Shenoy who has been pursuing his Ph.D. at the same time but is always willing to help me. I would also like to thank my English teacher, Enid Corbin, for her unconditional support. I would like to thank my parents, Xiangqian Qi and Y u anli Deng, for their u nconditional love and continuous support. They provided me all assistance so that I can follow my dreams

PAGE 5

5 Finally, I want to express my appreciation to my husband, Xuan Liu, for his support, inspiration, and encouragement. I will never forget all those ni ghts he spent with me when I was working late in my lab. I am looking forward to shar ing the rest of my life with him.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS .................................................................................................. 4 LIST OF TABLES ............................................................................................................ 9 LIST OF FIGURES ........................................................................................................ 10 ABSTRACT ................................................................................................................... 11 CHAPTER 1 GENERAL INTRODUCTION .................................................................................. 14 Myocardial Infarction ............................................................................................... 14 Heart Failure ........................................................................................................... 1 4 Cardiac Remodeling Post Myocardial Infarction ..................................................... 15 The Renin Angiotensin System ............................................................................... 20 Ang (1 7) .......................................................................................................... 24 Formation of Ang (1 7) .............................................................................. 24 Receptors for Ang(1 7) ............................................................................. 25 Role of Ang (1 7) in cardiovascular system ............................................... 26 Angiotensin Type 2 Receptor ........................................................................... 27 Distribution of AT2Rs ................................................................................. 27 AT2Rs Signaling and functions .................................................................. 30 Actions of AT2Rs in cardiac vascular diseases ......................................... 33 2 OVEREXPRESSION OF ANG (1 7) IMPROVES CARDIAC FUNC TION AND ATTENUATES LEFT VENTRICULAR REMODELING ........................................... 39 Abstract ................................................................................................................... 39 Introduction ............................................................................................................. 41 Material and Methods ............................................................................................. 42 Characterization of Ang(1 7) in Lentiviral Vector ............................................. 42 Lenti Ang (1 7) Administration .......................................................................... 43 Myocardial Infarction ........................................................................................ 43 Echocardiography ............................................................................................ 44 Hemodynamic Measurem ents .......................................................................... 44 Histological Analysis ......................................................................................... 45 Rat Neonatal Cardiac Myocytes: Isolation and Culture .................................... 46 Hypoxia/reoxygenation model and LDH viability assay ................................... 46 RNA Isolation and Real Time RT PCR ............................................................. 47 Statistic al Analysis ............................................................................................ 48 Results .................................................................................................................... 48 Lenti viral Vector Mediated Overexpression of Ang(1 7) in Rat Hearts ........... 48 Effects of Ang(1 7) Overexpression on Cardiac Function Post MI .................. 48

PAGE 7

7 Effects of Ang(1 7) Overexpression on Ventricular Remodeling Post MI ........ 49 Ang (1 7) mediated protection post MI is associated with restoration balance between ACE AngII AT1R axis and ACE2 Ang(1 7) Mas axis. ...... 49 Ang (1 7 ) Increases the Viability of RNCM after Hypoxia Exposure. ................ 50 Discussion .............................................................................................................. 51 3 S ELECTIVE TROPISM OF THE RECOMBINANT A DENO ASSOCIAT ED VIRUS 9 SEROTYPE FOR RAT CARDIAC T ISSUE .............................................. 65 Abstract ................................................................................................................... 65 Introduction ............................................................................................................. 66 Material and Methods ............................................................................................. 69 Rat Neonatal Cardiac Myocytes and Rat Neonatal Cardiac Fibroblasts: Isolation and Culture ..................................................................................... 69 I mmunostaining ................................................................................................ 70 In Vitro Transduction of RNCM and RNCF ....................................................... 71 In Vivo Transduction of rAAV in Rats ............................................................... 71 Visualization of GFP ......................................................................................... 73 Total RNA Extraction and Quantitative Real Time Polymerase Chain Reaction (RTPCR) Analyses ........................................................................ 74 Statistical Analysis ............................................................................................ 75 Results .................................................................................................................... 75 Evaluation of In Vitro Gene Transfer by rAAV Serotypes in RNCM and RNCF ............................................................................................................ 75 Evaluation of In Vivo Gene Transfer by rAAV Serotypes in Rat at One Month Post injection ...................................................................................... 75 Evaluation of In Vivo Gene Transfer by rAAV Serotypes in Rat at Two Months Post injection .................................................................................... 76 Dose Response and Biodistribution of Transgene Expression Following rAAV8 and rAAV9 Transduction in Rat ......................................................... 77 Discussion .............................................................................................................. 78 4 CARDIACSELECTIVE OVEREXPRESSION OF ANGIOTENSIN TYPE 2 RECEPTOR IMPROVES CARDIAC FUNCTION AND ATTENUATES LEFT VENTRICULAR REMODELING ............................................................................. 90 Abstract ................................................................................................................... 90 Introduction ............................................................................................................. 91 Materails and Methods ............................................................................................ 93 Characterization of rAAV9GFP and rAAV9 AT2R Viral Vectors ...................... 93 Coronary Artery Ligation ................................................................................... 93 rAAV9 GFP and rAAV9AT2R Administration .................................................. 94 Echocardiography ............................................................................................ 94 Hemodynamic Measurements .......................................................................... 95 Histological Analysis ......................................................................................... 95 Quantification mRNA Levels ............................................................................. 96 Statistical Analysis ............................................................................................ 97

PAGE 8

8 Results .................................................................................................................... 97 rAAV9 Mediated Cardiac Selective Overexpression of AT2R in Rat Hearts .... 97 Effects of AT2R Overexpression on Cardiac Function Post MI ........................ 97 Effects of AT2R Overexpression on Ventricular Remodeling Post MI .............. 98 AT2R mediated Protective Mechanism Post MI ............................................... 98 Discussion .............................................................................................................. 99 5 OVERALL DISCUSSIONS AND CONCLUSIONS ................................................ 111 LIST OF REFERENCES ............................................................................................. 117 BIOGRAPHICAL SKETCH .......................................................................................... 141

PAGE 9

9 LIST OF TABLES Table page 2 1 Hemodynamic data 4 weeks after CAL surgery .................................................. 59 2 2 Quantitative Real Time PCR data ....................................................................... 62 2 3 Quantitative Real Time PCR data for in vitro experiment ................................... 64 4 1 Hemodynamic data at 4 weeks post MI ............................................................ 107 4 2 Quantitati ve Real Time PCR data ..................................................................... 110

PAGE 10

10 LIST OF FIGURES Figure page 1 1 The Renin Angiotensin System .......................................................................... 23 2 1 Schematic representation of study protocol. ...................................................... 56 2 2 Transduction efficiency of Lenti Ang (1 7) in rat hearts. ..................................... 57 2 3 Effect of Ang(1 7) and myocardial infarction on ventricular function ................. 58 2 4 Effect of Ang(1 7) on ventricular hypertrophy. ................................................... 60 2 5 Effect of Ang(1 7) on ventricular fibrosis. ........................................................ 61 2 6 Ang (1 7) effects in cell viability assay. ............................................................... 63 3 1 Immunostaining of R at Neonatal Cardiac Myocytes (RNCM) ............................. 82 3 2 rAAVs mediated gene transfer into RNCM in vitro. .......................................... 83 3 3 rAAVs mediated gene transfer into RNCF in vitro. ............................................. 84 3 4 GFP expression in rat tissues at 1month post injection.. ................................... 85 3 5 GFP expression in rat tissues at 2month post injection. .................................... 86 3 6 Quantitative analyses of GFP mRNA expression in rat tissues. ......................... 87 3 7 Dose responses of transgene ex pression following rAAV8 and rAAV9 transduction. ....................................................................................................... 88 3 8 Biodistribution of transgene expression following rAAV8 and rAAV9 transduction. ....................................................................................................... 89 4 1 Schematic representation of study protocol. ..................................................... 104 4 2 Quantification of AT2R mRNA level in heart tissues. ........................................ 105 4 3 E ffect of AT2R gene transfer and myocardial infarction on ventricular function. ............................................................................................................ 106 4 4 Effects of AT2R on ventricular hypertrophy. ..................................................... 108 4 5 Effect of AT2R gene transfer on ventricular fibrosis. ........................................ 109

PAGE 11

11 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy OVEREXPRESSION OF ANG (1 7) OR CARDIACSELECTIVE OVEREXPRESSION OF ANGIOTENSIN TYPE 2 RECEPTOR IMPROVES CARDIAC FUNCTION AND ATTENUATES LEFT VENTRICULAR REMODELING By Yanfei Qi December 2009 Chair: Michael J. Katovich Ma jor: Pharmaceutical S cience s Despite the significant advances in pharmacological and interventional therapies for acute myocardial infarction, myocardial infarction is still one of the most debilitating cardiovascular diseases with tremendous economic impacts on society. It is well established that intricate regulation of the cardiac renin angiotensin system (RAS) is critical in normal heart functions, and an aberrant activity of the RAS is associated with deterioration of heart function and pathological c ardiac remodeling post myocardial infarction. Angiotensin(1 7) ( Ang (1 7) ) has been implicated to play a cardioprotective role in cardiovascular diseases. Ang(1 7) decrease s incidence and duration of ischemiareperfusion arrhythmias and improvement of the postischemic contractile. I nvestigations into the mechanisms of action of ACE inhibitors and angiotensin II type 1 receptor (AT 1 R) antagonists in cardiovascular disease have revealed that both of these treatments cause increased circulating levels of Ang (1 7). Infusion of Ang(1 7) has been shown to improve endothelial aortic function and coronary artery perfusion and preserved cardiac function in rats with heart failure. Agonist for the Ang (1 7) receptor

PAGE 12

12 Mas ( AVE0991 ) attenuates post ischemic heart fail ure in rats. There are two distinct arms of the RAS, the ACE2 Ang(1 7) Mas axis and the ACE AngII AT1R axis. The ACEAngII AT1R axis has been implicated in pathological cardiac remodeling, vasoconstriction, salt and water reabsorption, and inflammatory and proliferative affects of components of the cardiovascular system. The ACE2Ang (1 7) Mas axis on the other hand has been hypothesized to work in opposition to the ACE AngII AT1R axis. In addition to the AT1R there is also a corresponding receptor that, when stimulated, acts in opposition to that of AT1R activation. The role of this angiotensin II type 2 receptor (AT2R) in cardiovascular disease remains elusive, despite recent advances in understanding the RAS. I t is widely accepted that AT2R counteracts AT1R mediated actions, which is beneficial for the organism. It has been speculated that AT2R contributes to the beneficial effects of AT1R blockade because AT1R blockade causes Angiotensin II to bind unopposed to the AT2R. However, role of the AT2R in myo cardial infarction is controversial. Although most studies claim that AT2R improves postinfarct cardiac function, others report either no effect on the outcome or even deter ior ation. The present studies were designed to characterize the cardioprotective actions of Ang (1 7) and AT2R in a rat myocardial infarction model Ang (1 7) was overexpressed by the l enti viral vector. AT2R was overexpressed by cardiac selective recombinant a deno a ssociated virus serotype 9 (rAAV9). The results of studies indicate that the both Ang(1 7) and AT2R play a cardioprotective role in myocardial infarction. Overexpression of either Ang (1 7) or AT2R in the heart attenuates the development of cardiac hypertrophy and heart failure

PAGE 13

13 in rat myocardial infarction model The cardioprotective effects of Ang(1 7) were mediated through restoring the balance between ACEAngII AT1R axis and ACE2 Ang(1 7) Mas axis, and upregulating protective factors (BKR2 and IL10) The cardioprotective effects of AT2R were also mediated through restor ing the ACE/ ACE2 balance, reducing the TGF, Collagen I, and Collagen III expression, and upregulating Mas and BKR2 receptor levels Our results indicate that both Ang (1 7) and AT2R may represent a new class of targets for pharmacological intervention post myocardial infarction and during progression of heart failure.

PAGE 14

14 CHAPTER 1 GENERAL INTRODUCTION Myocardial Infarction Myocardial infarction (MI), commonly known as a heart attack, a disorder that causes damage and potential death of heart tissue as a result of a lack of supply of oxygen and other nutrients causing by the sudden blockage of a coronary artery. The blockage is mostly due to occlusion of a coronary artery following the disruption of an atherosclerotic plaque. R isk factors include previous history of vascular disease ( such as atherosclerosis ) angina, a previous heart attack or stroke and age ( especially men over 40 and women over 50 years ) According to a report from the American Heart Association Statistics Committee, an estimated 785 000 Americans will have a new heart attack and about 470 000 will have a recurrent attack in their lifetime (Lloyd Jones et al., 2009) (Rosamond et al., 2007) Prompt recognition and treatment is critical for preventi ng further damage to the myocardium. Heart Failure Heart failure is a condition when the heart can not pump enough blood to meet the bodys demand. The most common cause for the heart failure is ischemic heart diseases myocardial infarction. More than 60% of the heart failure that occurs in the US may be attributable to ischemic heart diseases (He et al., 2001) Other causes include hereditary cardiomyopathies, valvular malfunctions and congenital aberrations. H eart failure is a growing healthcare problem all over the world. In the United States, heart failure currently afflicts > 5 millions patients, with another 550,000 new cases diagnosed annually (Thom et al., 2006) After myocardial i nfarction a viable myocardium needs to

PAGE 15

15 compensate the function of the dys functional myoca rdium Local and systemic compensating mechanisms are triggered to cope with the sustained bodys demand. Cardiac Remodeling Post Myocardial Infarction Following an M I, characteristic morphological and pathophysiological changes occur, namely cardiac remodeling (Pfeffer and Braunwald, 1990) (Patten et al., 1998) T his remodeling process i ncludes cardiac fibrosis (Weber and Brilla, 1992) left ventricular (LV) dilation caused by an expansion of the infarct zone and the development of an eccentric hypertrophy in the noninfarcted area (McKay et al., 1986) Cardiac remodeling post myocardial infarction, which is characterized by cardiac hypertrophy and reactive fibrosis results in wall stiffness and diminished cardiac performance. Myocardial infarct size, followed by adverse left ventricular (LV) remodeling (dilation and fibrosis) and cardiac dysfunction are major determinants in the pathogenesis of cardiac diseases. Therefore, to improve clinical outcomes among patients with MI, it is essential to develop therapies that effectively modulate the post MI LV remodeling. Ventricular remodeling is strongly correlated with improvement in other heart failure outcomes. The impact of myocardial infarction(MI) on ventricular geometry and function in an animal model of coronary artery ligation was described by Pfeffer et al. in 1985 (Pfeffer et al., 1985) who demonstrated a strong relationship between the size of the myocardial injury and degree of left ventricular (LV) remodeling and mortality. Pfeffer et al. also showed a beneficial reduction in LV enddiastolic volume index in rats treated with the angiotensincovn erting enzyme inhibit or (ACEi) c aptopril. Others have confirmed the relationship between myocardial injury, activation of neurohormonal pathways, and the pathologic cardiac phenotype associated with heart failure

PAGE 16

16 (Sadoshima et al., 1993) (McKay et al., 1986) (Katada et al., 2005) (Francis et al., 1990) Further more it has been demonstrated that treatment strategies resu lting in preventing the progression of pathologic remodeling typically also reduce heart failure mortality, whereas therapies with adverse impact on survival have minimal or no effect on ventricular remodeling (Cohn et al., 1991) (Greenberg et al., 1995) (Metra et al., 2003) (Wong et al., 2004) (Cintron et al., 1993) C ardiac fibrosis is a hallmark for pathological cardiac remodeling in cardiovascular diseases. Reactive cardiac fibrosis interferes with the normal function and structure of the myocardium (Brilla et al., 1991) (Weber, 2000) Increased deposition of collagen in cardiac tissue results in an increase in cardiac tissue stiffness.This remodeling predisposes the patient to an increased risk of adverse cardiac events, including myocardi al ischemia, infarction, arrhythmias and sudden cardiac death (Weber, 2000) Thus, prevention and reversal of cardiac fibrosis are essential to preserve heart function and prevent pathological cardiac remodeling in cardiovascular disease. It is well established that cardiac renin angiotensin system (RAS) is critical in regulating normal heart functions, and aberrant activity of the RAS is associated with pathological cardiac remodeling post myocardial infarction. Rem odeling and functional impairment of myocardial contractility have been associated with high intramyocardial levels of angiotensin, norepinephrine, and aldosterone (Cohn et al., 2000) Thus, pharmacological inhibition of dysregulated RAS might play an important role in stabilization or reversal of pathological remodeling and improve clinical outcomes. The inhibition for the R AS provides not only a proof for the role of RAS in cardiovascular pathophysiology but also ther apeutic treatments for heart failure patients. As noted

PAGE 17

17 above, addition of an ACEi following MI attenuated the remodeling process and reduced mortality in animal model (Pfeffer et al., 1985) The effects of enalapri l (an ACEi) were examined in the patients with clinical heart failure (Anonymous 1991) E nalapril treated patients experienced significantly fewer deaths, primarily as a result of reduction in progressive heart failure, and fewer hospitalizations. An echocardiography substudy examining the impact of enalapril on LV function and geometry revealed that patients in the placebo arm had progressive LV dilation, whereas those treated with enalapril had sustained reductions in LV dimensions (Konstam et al., 1992) (Konstam et al., 1993) Captopril and ramipril (Anonymous 1993) demonstrated similar effects as enalapril, which proves that ACEi exhibits reversing ventricular remodeling and reducing mortality. Blockade of the effects of the renin angiotensin system utilizing angiotensin receptor blockers (ARBs) also appears to be linked to reverse ventricular remodeling and mortality benefit. Patients intolerant of ACEi treated with valsartan benefited from reduction in morbidity and mortality compared with those treated with placebo. Furthermore, patients in the valsartan group demonstrated improvement in remodeli ng exhibits a significantly smaller mean LV internal diastolic dimension index than patients randomized to placebo (Maggioni et al., 2002) Treatment with candesartan also showed similar reduction in morbidity and mortality in a study that assessed the benefits of candesartan in patients intolerant of ACEi (Granger et al., 2003) Moreover, ACEi is reported to increase cardiac ACE2 mRNA level (Ferrario et al., 2005) ARB treatment has been shown to result in a significant upregulation of ACE2 mRNA level in the viable myocardium in the myocardial infarction model (Ishiyama et al., 2004b) ARB trea tment has been reported to increase cardaic ACE2 mRNA level and cardiac ACE2 activity;

PAGE 18

18 and a combination of ARB and ACEi exerted similar effects (Ferrario et al., 2005) ACEi and ARB thus may provide LV protective effects by not only inhibiting ACE AngII AT1R pathway but also increasing ACE2Ang (1 7) Mas pathway. It has been also speculated that AT2R contributes to the beneficial effects of AT1R blockade because AT1R blockade causes Angiotensin II to bind unopposed to the AT2R. A variety of cytokines are activated and are wellestablished mediators for cardiac remodeling during a number of cardiac pathophysiological conditions including MI, ischemia/reperfusion injury, and heart failure. The inflammatory response ul timately leads to healing and repair of the injured territory. Thus, the molecular signals induced post MI may mediate suppression of tissue injury and regulate scar formation. The increased cytokine gene expression during acute phase of inflammation evoke s a secondary, self sustaining autocrine and paracrine growth factor and cytokine expression. P roinflammatory cytokines (e. g tumor necrosis factor [TNF], interleukin [IL] 1, and IL6 ), anti inflammatory cytokine (e.g. IL 10) and cytokines having both proand anti inflammatory effects ( e.g. transforming growth factor [TGF ]) play a critical role in mediating homeostasis within the heart in response to cardiac injury. TNF extensively investigated after cardiac injury. TNF RNA and protei n is elevated in patients and in animal models with advanced heart failure (Testa et al., 1996) (TorreAmione et al., 1996) TNF eart failure with cardiac specific overexpression of TNF (Kubota et al., 1997) (Bryant et al., 1998) Systemic infusion of recombinant TNFinto rats depressed left ventricular function and caused left ventricular dilation

PAGE 19

19 patients with advanced heart failure (Bozkurt et al., 1998) Another proinflammatory cytokine is IL 1 involving in progression of myocardial infarction. Expression levels of IL in blood and/or myocardial tissues are increased also in patients with coronary artery disease (Hasdai et al., 1996) acute MI (Guillen et al., 1995) dilated cardiomyopathy (Han et al., 1991) (Francis et al., 1990) and in patients and animal models of congestive heart failure (Testa et al., 1996) IL 1 knockout mice exhibited less development of adverse left ventricular remodeling after MI and decrease in myofibroblast infiltration and collagen deposition (Bujak et al., 2008) Necrosis and apoptosis are both occurring post myocardial infarction and involving in inflammatory response. In contrast to necrosis that triggers an inflammatory response, apoptotic cells lead to the production of anti inflammatory cytokines such as IL 10. IL 10, a potent anti inflammatory cytokine, is a strong deactivator for monocytes and suppressor of various proinflammatory mediators (Frangogiannis et al., 2000) (Yao et al., 2008) IL 10 suppresses the inflammatory responses through inhibiting the production proinflammatory cytokines such as IL1, TNF 6 and IL8 (Yang et al., 2000) IL 10 also modulates expression of metalloproteinases and their inhibitors, so that IL 10 may have a significant role in extracelluar matrix formation (Lacraz et al., 1995) IL 10 level in the plasma was prominently elevated in patients with myocardial ischemia/reperfusion (Shibata et al., 1997) (Seghaye et al., 1996) The potential role of IL 10 in experimental myocardial infarction has recently been investigation. IL 10 d eficient mice exhibited an enhanced inflammatory response, as demonstrated by increased neutrophil recruitment, elevated plasma level of TNF, and high mortality following myocardial infarction (Yang et al., 2000) IL 10 mRNA and protein upregulation

PAGE 20

20 was demonstrated in the reperfused infarcted myocardium using a canine model of myocardial infarction (Frangogiannis et al., 2000) Thus, IL10 may have a protective role after myocardial ischemia/reperfusion through the suppression of the acute inflammatory process. TGFis a locally generated cytokine and is likely to affect multiple pathways in the healing infarct, serving to suppress inflammatory signals, but also to induce fibrous tissue deposition in the infarct and to stabilize the extracellular matrix. Thus, TGFsignaling may be crucial for resolution of inflammation preventing injury (Lefer et al., 1990) (Lefer et al., 1993) but may also promote fibrous tissue deposition in the remodeling myocardium increasing dysfunction. Understanding the respective signaling pathways involved in each of its distinct actions will be critical in order to design therapeutic interventions that target specific TGFmediated effects. TGFexpression is increased in the ischemic as well as hyper trophied hearts (Deten et al., 2001) (Kuwahara et al., 2002) TGFor healing after MI as it stimulates fibroblast proliferation and extracellu l ar matrix production (Rosenkranz, 2004) AntiTGFtreatment in the first days after coronary artery ligation increases mortality and wors ens left ventricular remodeling in mice with MI due to alteration in the extracellular matrix (Frantz et al., 2008) The Renin Angiotensin System Discovery of the renin angiotensin system (RAS) started when a link bet ween renal disease and left ventricular hypertrophy was observed in 1836 by Richard Bright. This link was also reported by two other research groups in 1868 and 1872 respectively (Basso and Terragno, 2001) Tigerstedt and Bergman i n 1898 found a pressor compound in rabbit renal extracts that they named renin (Phillips and Schmidt Ott, 1999) They also reported the role of renin in association between renal disease and

PAGE 21

21 cardiac hyp ertrophy. After the discovery of renin, two independent research groups simultaneously discovered and described another pressor substance that would later become known as angiotensin (Basso and Terragno, 2001) Many com ponents of the RAS and their functions have been discovered over past years However, n ew components and functions of the reninangiotensin system are still being uncovered. D etailed examination of the RAS is given later in the text The RAS system present s both systemically in the circulating system locally in the tissues exerting autocrine and paracrine functions and intracellularly exerting intracrine functions The systemic RAS is seen as a regulator of systemic volume and electrolyte balance, and of blood pressure homeostasis Local tissue RAS have effects involving proliferation, growth, protein synthesis and organ functions, e.g. in kidney, heart, brain, reproductive organs and pancreas (Paul et al., 2006) (Leung, 2007) The role of intracellular RAS is presently unclear, though the existence of complete and functional intracellular RAS has been reported in several tissues (De Mello, 2004) (Re and Cook, 2006) Intracellular RAS is reported to mediate changes in Ca2+ fluxes and activation of genes (Haller et al., 1996) Intracellular upregulation of cardiac Ang II has been attributed to cardiac hypertrophy in vivo in mice (Baker et al., 2004) In the systemic RAS, angiotensinogen, which is largely produced in the liver, is converted to the decapeptide angiotensin I (AngI) by the proteolytic enzyme renin that is produced mainly in the kidney. Angiotensin I is then cleaved by a second proteolytic enzyme, mainly produced in the lungs, angiotensin converting enzyme (ACE), to generate the physiologically active hormone angiotensin II (AngII). AngII elicits most of biological actions of the RAS by binding to either the angiotensin II type 1 receptor

PAGE 22

22 (AT1R) or the angiotensin II type 2 receptor (AT2R). In general, AngII binding to the Angiotensin type I receptor s ( AT1Rs ) is associated w ith the development of cardiovascular pathophysiologies, while binding to the Angiotensin type II receptor ( AT2Rs ) is thought to counteract the AT1R and elicit cardioprotective effects. AngII has approximately the same binding affinity to these receptors (Carey and Siragy, 2003) AT1Rs the best elucidated receptor, account for the majority of hemodynamic effects such as vasoconstriction, aldosterone secretion, sodium retention and nonhaemodynamic effects, like cardi ac and vascular cell proliferation (Carey et al., 2000) A ngiotensin converting enzyme 2 (ACE2 ) generates Ang 1 7 from Ang II. Ang 1 7 may also be generated from Ang I or Ang II by other peptidases. Ang (1 7) was found to have actions opposing those of Ang II, namely vasodilation and antitrophic effects and amplification of vasodilation caused by bradykinin. A more detailed examination of Ang (1 7) and AT2R is discussed later in the text Figure 11 summarizes the presently recognized components of the RAS.

PAGE 23

23 Figure 11 The Renin Angiotensin System and its physiological effects mediated by corresponding peptides and receptors. ACE, angiotensinconverting enzyme; ACE2, angiotensinconverting enzyme 2; Mas, Ang(1 7) re ceptor ; AT2R, angiotensin type 2 receptor; AT1R, angiotensin type 1 receptor ; AT4R, Ang IV receptor ; ADH MCP1 antidiuretichormone; monocyte chemotactic protein1 ; ICAM 1, Inter Cellular Adhesion Molecule 1 ; SNS, sympathetic nervous system ; NO, nitric ox ide Taking into account all the new components discovered in the RAS, t he ACEAngII AT1R axis mainly regulates vasoconstriction, salt and water reabsorption, oxidative stress, fibrosis, proliferation, and hypertr ophic and proliferative effects (Ferrario et al., 1997) (Ferreira et al., 2007) ; while AT2R binding counteracts actions

PAGE 24

24 mediated by AT1R. The ACE2Ang (1 7) Mas axis also counter regulates the ACEAngII AT1R axis (Ferrario et al., 1997) (Ferreira et al., 2007) A proper balance between regulating and counter regulating factors of the RAS appears quite important in maintaining normal physiological functions of many organs. Ang (1 7) Ang (1 7) was first discovered more than 30 years ago (Semple et al., 1976a) (Semple et al., 1976b) (Semple and Morton, 1976) Ang (1 7) was thought for a long time to be devoid of biological functions despite early reports on its biological effects (le Tran and Forster, 1997) The importance of Ang( 1 7 ) was emphasized by the relatively recent discovery of a 'new' ACE2 and since then physiological functions of Ang ( 1 7 ) has been widely investigated. Ang (1 7) was found to have actions counteract those of Ang II namely vasodilation, antitrophic and antifibrotic effects and amplification of vasodilation caused by bradykinin (Schiavone et al., 1988) (Santos et al., 2000) (Schmai er, 2003) Thus, Ang(1 7 ) is an excellent target for experimental and pharmacological research for cardiovascular diseases Formation of Ang (1 7) Ang (1 7) can be formed from several routes as indicated in Figure 11. Ang II is hydrolyzed by ACE2 to fo rm Ang (1 7) (Tipnis et al., 2000) (Donoghue et al., 2000) (Vickers et al., 2002a) This route is not very favorable because the affinity of Ang II for its receptors is much higher than that for ACE2 (Reudelhuber, 2006) The route of formation from AngII to Ang(1 7) by the enzymatic action of ACE2 is responsible for most of the angiotensin(1 7) formed from angiotensin II (Trask et al., 2007) Other

PAGE 25

25 enzymes, including prolylendopeptidase and prolylcarboxypeptidase can also mediate this route to form Ang(1 7) from AngII (Tan et al., 1993) Another route to obtain Ang(1 7) is from hydroysis AngI and requires both ACE and ACE2. Ang I is first hydrolyzed by ACE2 to form Ang(1 9) which might function as an endogenous ACE inhibitior in the heart (Donoghue et al., 2000) T hen Ang (1 9) is converted to Ang(1 7) by ACE or endopeptidase (Rice et al., 2004) This route of generating Ang (1 7) was shown to be activated in failing human heart and in macro phages from chronic heart failure patients (Zisman et al., 2003b) In addition, a direct conversion of Ang I to Ang(1 7) was shown to be mediated by several enzymes such as: prolylendopeptidase in vascular endothel ial cells neutral endopeptidase (neprilysin) in the circulation or kidney, and thimet oligopeptidase in vascular smooth muscle cell (Santos et al., 1992) (Yamamoto et al., 1992) Receptors for Ang (1 7) It was first shown that Ang (1 7) effects are mediated through AT1R and AT2R (Jaiswal et al., 1992) (Jaiswal et al., 1993) (Muthalif et al., 1998) (Rowe et al., 1995) (Tallant et al., 1997) Ang (1 7) binds to the AT1R (Gironacci et al., 1999) and leads to the downregulation of a subtype of AT1R (Clark et al., 2001) In addition, Ang (1 7) seems to be involve d in stimulation of the AT2R as Ang (1 7) mediates prostaglandin release from vascular smooth mu scle cells and endothelial cells (Jaiswal et al., 1992) (Muthalif et al., 1998) This pathway is probably involved in the noncompetitive antagonism of AngII induced vasoconst riction (Roks et al., 2004) and inhibition of proliferation of vascular smooth muscle cells (Brogelli et al., 2002) When a specific antagonist of Ang (1 7) [ d Ala7angiotensin(1 7) (A779) ] was identified, other receptors for Ang (1 7) other than the AT1R and AT2R were

PAGE 26

26 specultated to exist (Silva et al., 2007) T he existence of a receptor for Ang (1 7) that is different from AT1R and AT2R was first demonstrated by using A779 (Santos et al., 1994) A779 blockage induces the following effects : upregulation of AT1R (Neves et al., 2000) inhibition of angiogenesis (Cardini et al., 1988) interaction with insulin signal transduction (Giani et al., 2007) and the antithrombotic effect of Ang (1 7 ) (FragaSilva et al., 2008) (Kucharewicz et al., 2002) The Mas receptor was recently identified as a receptor mediating angiotensin(1 7) effects and its activation is sensitive to A779 (Santos et al., 2003) It was also confirmed that AVE 0991 is an agonist of the Mas receptor as it can mimic some of the effects of angiotensin(1 7) (Wiemer et al., 2002) (Pinheiro et al., 2004) The in vivo role of the Mas receptor has been studied in Mas receptor knockout mice. I t has been shown that this receptor is crucial for heart function, as Mas receptor knockout mice exhibit a severely impaired heart function, with lower systolic tension and increased dimensions of the left ventricle (Santos et al., 2006) and a slower post ischemic cardiac recovery (Santos et al., 2006) (Castro et al., 2006) This underscores the importance of Mas receptors in cardiovascular physiology. Role of Ang(1 7) in cardiovascular system Counteraction of Ang (1 7) to AngII initiates from the moment of Ang (1 7) g eneration. As described above, Ang (1 7) was generated through routes that either bypass the formation of Ang II or utilize AngII as a main substrate to generate Ang (1 7) Both routes will result in reduction of AngII in the circulation system and/or tiss ue level. This might partially explains the beneficial effects of Ang (1 7) in cardiovascular system. Established effects of angiotensin(1 7) are regulation of blood pressure, cardiac functions, and smooth muscle and myocardial cell growth. Several studi es

PAGE 27

27 demonstrated the antihypertensive action of Ang(1 7) (Dobruch et al., 2003) (Schiavone et al., 1988) This vasorelaxative effects was endothelium dependent (Santos et al., 2003) Cardioprotective effects mediated by Ang(1 7) are demonstrated by several studies. Ang (1 7) reduces the incidence and the duration of reperfusion arrhythmias (Ferre ira et al., 2001) (De Mello, 2004) Ang (1 7) has been shown to preserve cardiac function, coronary perfusion, and aortic endothelial function in a rat model for heart failure (Loot et al., 2002) Ang (1 7) also effective ly prevent ed the cardiac myocardial and perivascular fibrosis in the DOCA salt hypertensive rat model (Grobe et al., 2006) Angiotensin T ype 2 Receptor Despite recent adva nces in understanding AT2R mediated actions, the functions of AT2Rs in cardiovascular diseases still remains elusive. Generally, AT2Rs have been described as having opposite effects to AT1Rs. For example, AT2R s inhibit cell growth and has vasodilating acti on (Carey et al., 2000) (Carey and Siragy, 2003) A better understanding of AT2R mediated effects could elucidate both AT2R functions in the RAS and their therapeutic implication s for cardiac disease s. Distribution of AT2Rs Although t he identification date of AT2Rs can be retrieved back to 1989, their functions are less studied because they are only ubiquitously expressed at high level in the fetus (Grady et al., 1991) A fter birth, their e xpression declines to low levels in the healthy adult. Moreover, their expression pattern in normal adults has tissue specific propert ies The expression is limited in certain cell types and certain tissues such as vascular endothelial cells, the adrenal, selected renal selected cardiac structures ovaries and certain brain areas (de Gasparo et al., 2000) However, AT2Rs are

PAGE 28

28 upregulated under pathophysiological condi tions such as myocardial infarction and mechanical injury (Gallinat et al., 1998) (Nio et al., 1995) Even though the expression level decrease s to low level, AT2Rs can still be det ected and measured in selected tissues in the healthy adults, such as in the adrenal, ovary kidney heart, and brain (de Gasparo et al., 2000) Cardiovascular system AT2Rs are found in many different kind of vesse ls such as aorta (Chang and Lotti, 1991) mesenteric (Matrougui et al., 1999) (Touyz et al., 1999) and uterine arteries (McMullen et al., 1999) They are abundantly expressed in both vascular endothelium and the muscular layers of blood vessels (Utsunomiya et al., 2005) In the heart AT2Rs are present in v entricular and atrial myocardium, and coronary arteries (Wang et al., 1998) For the myocytes and fibroblast in the adult rat heart AT2Rs have less expression level than AT1R as AT1Rs account for 35% of the total Ang II binding sites and less than 5% of the binding sites for AT2R (Villarreal et al., 1993) AT2R s are upregulated about 153% in the heart of the cardiomyopathic hamster (Ohkubo et al., 1997) In the human, AT2Rs are increased about 3 fold in dilatedcardiomyopathy patients (Tsutsumi et al., 1998) In addition, AT2Rs are the dominant receptors in the human end stage failing heart. They acc ount for 69% of the total AngII binding sites, while AT1R s only comprise about 33 % of the binding sites (Regitz Zagrosek et al., 1995) Although both of these receptors are downregulated at this heart failure stage, the extent of downregulation for AT1R s is more severe than AT2R s. The selective and reversible expression of AT2Rs in cardiac vascular system indicates that AT2Rs are important regulators in physiological conditions as well as in pathological condi tions.

PAGE 29

29 Kidney Since the renin (a major component in the RAS) is produced in the kidney the expression of AT2Rs in this organ will be discussed here too. AT2Rs are distributed through tubular and vascular segments of the renal cortex and medulla (Ozono et al., 1997) They may participate in regulating glomerular blood flow as they are mainly found in interlobular arteries and afferent arterioles (Carey et al., 2000) Moreover, AT2R s, found in the juxtaglomerular cells in the afferent arterioles, play a role in regulating the RAS activity AT2Rs in juxtaglomerular cells inhibit renin biosynthesis and secretion (Ichihara et al., 2003) (Ishiyama et al., 2004a) (Siragy et al., 2005) This inhibition effects may be mediated by cGMP, which is a known inhibitor for renin secretion and key second messenger in one of the thr ee AT2R mediated signaling pathways. In vivo studies have complicated conditions caused by cellular, circulating, and paracrine factors to hinder the actual AT2R effects. The in vitro studies could better demonstrate the AT2R effects as they exclude these influence factors. Primary cells and cell line s, expressing AT2Rs, are used to investigate signaling mechanism and functional significance of the AT2R s. The primary cells include neuronal cells from neonatal hypothalamus, neonatal rat cardiomyocytes and adult rat cardiac microvascular endothelial cells, and rat fetal fibroblasts (Steckelings et al., 2005) Researchers also use cell lines to study AT2Rs including PC12W (Steckelings et al., 2005) (Speth and Kim, 1990) R3T3 (Dudley et al., 1991) NG10815 (Buisson et al., 1992) and Neuro2a (Hoffmann and Cool, 2003) The PC12W cell line expresses only

PAGE 30

30 AT2Rs and is widely used to study AT2Rs signaling pathways because it unveils the AT2Rs mediated actions by abolishing AT1Rs mediated actions. AT2Rs Signaling and f unctions AT2Rs act as a modulator of complex biological programs involved in embryonic development, cell differentiation, apoptosis, regulation of renal function and blood pressure. They are also play a role in pathophysiological processes such as cardiova scular remodeling after myocardial infarction, hypertension, heart failure and stroke. Though intracellular signaling pathways of AT2Rs have been extensively studied, confusions about their actions still exist. The confusions are due to many unconventional signaling cascades involved in AT2R signaling pathways and some AT2R signaling mechanisms cannot be clearly attributed to AT2Rs functions. Yet, it is generally recognized that AT2R signaling pathways are completely different from AT1R coupled signaling pathways To date, at least three pathways and other nontraditional signaling transudation mechanisms are involved in AT2Rs signaling. A ctivation of Phosphatase Growth factors promote growth and proliferation of cells by tyrosinekinase receptors and sever al kinase driven phosphorylation steps in signaling cascades. Among these signaling cascades, extracellular regulated kinase (ERK)1/2 plays an important role in these phosphorylation cascades. AT2R mediated actions could activate phosphatases and then dephosphorylate ERK. This may explain why AT2Rs stimulation has anti growth and anti proliferation effects. AT2Rs play a pivotal role in directly inhibiting the protein kinase pathways activated by AT1R or growth factors (Horiuchi et al., 1999) Activation of various protein phosphatases by s timulati ng A T2R works to prevent undesired growth of normal tissues.

PAGE 31

31 Up to now, there are t hree phosphatases have been identified: m itogenactivated protein kinase phosphastase (MKP 1), SH2 domaincontaining phosphatase 1 (SHP1), and protein phosphotase 2A (PP2A). MKP1 is vanadatesensitive, dual specificity tyrosine/threonine phosphatase (Tsuzuki et al., 1996) (Yamada et al., 1996) SHP1 is vanadatesensitive tyrosine phosphatase (Bedecs et al., 1997) and PP2A okadaic acidsensitive serine/threonine phosphatase (Huang et al., 1996) Activation of Kinin /NO/cGMP It has been confirmed that AT2Rs have vasodilatory actions (Brede et al., 2003) T he AT2R mediated vasodilation is related to bradykinin ( BK) nitric oxide ( NO ) and cGMP. The indirect evidence is that the AT2R antagonist (PD123319) induced vasoconstriction is duplicated by the BK B2 receptor antagonist and NO synthase inhibitor (Brede et al., 2003) Whereas, the direct evidence demonstrates that stimula tion of AT2Rs in vascular smooth muscle cells increases BK production by activating kininogenase in transgenic mice (Kurisu et al., 2003) Researchers also found that the AT2R s possess constitutive activity, because ov erexpressing AT2Rs in vascular smooth muscle cells activates the vascular kinin system and causes vasodilation in transgenic mice (Tsutsumi et al., 1999) AT2R stimulation may also lead to changes in Na+/H+ exchange activity, causing acidification of the intracellular environment, then stimulat ing kininogenase. The consequent increase in bradykinin (BK) synthesis and nitric oxide (NO) accumulation leads to enhance cyclic guanosine monophosphate (cGMP) production (Tsutsumi et al., 1999) The kini n /NO/cGMP signaling pathway is also suggested in attenuating perivascular fibrosis (Brede et al., 2003)

PAGE 32

32 Phospolipase A2 In phospolipase A2 pathway, A T2R mediated activation is coupled to kinase instead of phosphatase activation. AT2R stimulation activates membraneassociated phospholipase A2 (PLA2) in renal proximal tubule epithelial cells (Dulin et al., 1998) (Alexander et al., 2004) Activated PLA2 induces the release of arachidonic acid (AA). Then PLA2 dependent release of AA regulates, with/without its cytochrome P450dependent metabolites, phosphorylation of MAPK and additional kinases activation further downstream the RAS signaling pathway (Dulin et al., 1998) Ceramides and caspase Ceramides are intracellular lipid second messengers, which have been implicated as an important mediator of programmed cell death. AT2R stimulation leads to the generation of ceramides (Gallinat et al., 1999) As a proapoptotic signal ceramides can induce apoptosis in many cell types. This pathway is further co nfirmed in that blockading sphingolipid synthesis abolishes AT2R mediated programmed cell death (Dimmeler et al., 1997) Since AT2R stimulation mediated apoptosis is associated with the activation of caspase 3, ceram ides may induce apoptosis via activating caspase 3, a central downstream effector of the caspase cascade (Lehtonen et al., 1999) Promyelocytic Zinc finger protein AT2Rs are not only involved in apoptosis and vasodilation, but they also play a pivotal role in development and regeneration. T he development and regeneration effects mediated by AT2R are associated with a zinc finger homoeodomain enhancer binding protein gene ( Zfhep), which is induced by AT2R mediated ac tivation in cells of neuronal and vascular origin (Stoll et al., 2002) Zfhep is required for differentiation of

PAGE 33

33 the central nervous system and regulates cell fate (Lai et al., 1993) It is highly expressed in the heart and encodes for a transcription factor regulating cellular differentiation and protein synthesis. Actions of AT2Rs in cardiacvascular diseases Since AT2Rs were found, studies have been done to elucidate their roles in the cardiovascular diseases. Conclusive evidence during the late 1990s through 2003 indicates that AT2Rs mediate vasodilation. During that time AT2Rs were simply thought to antagonize AT1R mediated actions. With ongoing research on AT2Rs more effects of AT2R s are uncovered, such as AT2R s induction of apoptosis and neuron differentiation. Generally, AT2Rs are considered to have cardiac protective effects. AT2Rs mediated effects in hypertension and in cardiac remodeling after myocardial infarction are di scussed below Role in hypertension The AT2R mediated vasodilation has been confirmed. F rom the first evidence in 1992, this effect has been documented by AT2R antagonist blockade of the vasodilation action of AT1R antagonist (Buisson et al., 1992) This effect is also supported by experiments, demonstrating that AT2R knockout mice have a slight but significant increase in blood pressure and increased constrictor response (Hein et al. 1995) (Ichiki et al., 1995) Pharmacological studies show that the blood pressure decrease observed in the SHR (spontaneously hypertensive rats) by administration of AT1R antagonist is enhanced in combination with t he AT2R agonist CGP42112 and abolished by AT2R antagonist PD 123319 (Barber et al., 1999) Knockdownof AT2R by using antisense gene transfer technology significantly elevated systolic blood pressure and the pressor response to AngII in norm o tensive SpragueDawley (SD) rats (Wang et al., 2004)

PAGE 34

34 Peripheral overexpression of AT2R also has been reported to potentiate the antihypertensive action of losartan (Li et al., 2007) AT2R mediated actions are critical when considering its potential physiological and therapeutic roles in the antihypertensive effects of AT1R antagonists. AT1R blockade markedly increases circulating and tissue levels of AngII around 20 30 fold (Ford et al., 2000) The accumulated AngII can then work as an AT2R agonist leading to a vasodilator response (Ford et al., 2000) In addition, the expression level o f the AT2Rs is relatively low in the adult but the expression of AT2Rs is upregulated under pathological conditions. Therefore, we may speculate that AT2R mediated anti hypertensive effects are more apparent in pathological states (Tsutsumi et al., 1999) (Bautista et al., 2001) (Schuijt et al., 2001) This hypothesis is further confirmed in a study showing that AT2R mediated vasodilatati on only occurred in SHR but not in WKY rats (Barber et al., 1999) The results of this study is consistent with investigation that AT2R mediated increases in vascular cGMP production occurred in SHRSP (Gohlke et al., 1998) but not in WKY rats (Moores et al., 2003) Moreover, female SHR rats have lower blood pressure ( BP) than the male SHR rats and their AT2Rs are expressed at higher level t han the AT1R s (Silva Antonialli et al., 2004) In sum mary AT2Rs work with AT1Rs in regulating blood vessel tension. Their selective expression in the arteries and upregulated expression under pathological conditions may indicate their therapeutic application in treating hypertension. Role in cardiac remodeling

PAGE 35

35 P athological conditions, such as hypertension, cardiomyopathy and myocardial infarction, induce cardiac remodeling, which results in left ventricula r hypertrophy (LVH) and fibrosis. These cardiac structural changes compensate hemodynamic performance but ultimately lead to an increased incidence of heart failure. As mentioned above, the expression level of AT2Rs changes after MI. Thus, it is necessary to understand the roles of AT2Rs in this process. Although AT2R mediated actions are generally thought as counteracting AT1R mediated effects in hypertension, the pathophysiological relevance of AT2R for cardiac remodeling has not yet been firmly understood. Most studies are consistent with the hypothesis that AT2R mediates cardiac protective effects post MI. Overexpression of AT2Rs in the mouse is associated with improved LV function at baseline and heart function during post MI remodeling (Yang et al., 2002) AT2R knock out mice develop more cardiac remodeling, LV dysfunction and mortality than WT mice (Oishi et al., 2003) Furthermore, studies show that the AT2Rs may interact with AT1R in post MI mice and AT2R overexpression in attenuating post MI remodeling is equal ly as effective as A T1R blockade treatment (Voros et al., 2006) R ole in cardiac hypertrophy LVH is an adaptive response for maintaining cardiac output and tissue perfusion when the heart is under high workload. Under high persistent workload, the LVH will finally be associated with interstitial fibrosis and apoptosis and increased heart rate. These changes indicate the heart is in a decompensating state. At this time, LVH is recognized as a risk factor for cardiovascular mortality (Levy et al., 1990) Otherw ise exercise induced hypertrophy is a compensative response to maintain cardiac output.

PAGE 36

36 This point is important to help us to understand the controversial AT2R mediated effects on hypertrophy. Since the AT2Rs have anti growth properties as stated above AT2Rs are proposed to be anti hypertrophic in the heart. However, it is controversial how AT2R mediated effects modulate the hypertrophic condition. In vivo studies, using AT2null mice have yielded mixed results. Overexpression of AT2Rs have been shown to inhibit LVH, prevent the increase in LV wall thickness and reduce the heart: body weight ratio (Metcalfe et al., 2004b) (Sugino et al., 2001) However, other studies have demonstrated that AT2Rs have no effects on hypertrophy (Kur isu et al., 2003) (Sugino et al., 2001) Moreover AT2Rs may have constitutive activities and might be required for hypertrophy. In some in vivo studies, utilizing the AT2R knockout mice S e nbonmatsu et al (Senbonmatsu et al., 2000) reported that AT2Rs are required for the development of pressureoverloadinduced cardiac hypertrophy Over expression of AT2Rs in the ventricular myocytes fail to demonstrate an antihypertrophic action (Yan et al., 2003) AT2R blockade by its specific antagonist PD123319 does not prevent the cardiac hypertrophy but decreases right ventricular and pulmonary to body mass ratios in the proartrial natriuretic peptide (ANP) gene disrupted mouse treated with high dietary salt (Angelis et al., 2006) The signaling pathways regulating the AT2R mediated effects on hypertrophy are also controversial. Two signaling pathways have been pr oposed to explain the AT2R mediated action in LVH. The most commonly known and studied pathway is kinin/NO pathway, which exerts anti hypertrophic effects of AT2Rs. As AT2Rstimulation results in increased production of NO, AT2R knock out mice have decreas ed eNOS and

PAGE 37

37 blockade of NOS abolishes the antihypertrophic effects on cardiomyocytes (Brede et al., 2003) Zfhep signaling pathway may explain the AT2R mediated hypertrophic effects. Nuclear Zfhep binds to and activates phosphatidylinositol 3 kinase p85 subunit (p85 PI3K) gene. Activation of p85 PI3K gene leads to subsequent activation of protein synthesis (Senbonmatsu et al., 2003) It is not clearly established which signalin g pathway is dominant or if these two pathways regulate AT2R mediated anti hypertrophic or hypertrophic effects. The discrepancies about AT2R mediated effects on hypertrophy can be explained by both contradictory signaling pathways and the inconsistency am ong the experimental approaches. A lot of researchers use AT2R knockout mice or AT2R transgenic mice to study the effects mediated by AT2Rs. There may be compensatory mechanisms that take place in AT2R knock out or transgenic mice. Role in fibrosis During cardiac remodeling, there is an increase in fibrosis. AT2R actions in fibrosis are not as controversial as in cardiac hypertrophy. AT2Rs serve as cardiac protective receptors as they reduce fibrosis during cardiac remodeling process A m ajority of studies show that AT2Rs have anti fibrotic actions (Widdop et al., 1992) AT2R stimulation reduces extracellular matrix formation (de Gasparo et al., 2000) Selectively overexpress ing AT2R in cardiac myocytes also demonstrates that AT2R activation reduces perivascular fibrosis and interstitial fibrosis (Kurisu et al., 2003) (Metcalfe et al., 2004b) As m entioned in the AT2R mediated signaling pathway, pharmacological experiments indicate that AT2R mediated anti fibrotic action might be regulated via kinin/NO signaling pathway.

PAGE 38

38 Conclusions The AT2Rs are now clearly established as vasodilator receptor via the kinin/ NO/cGMP signaling pathway. There is increasing certainty to believe that AT2Rs are cardioprotective under pathological conditions. Functional studies prove that AT2Rs provide cardiac protective effects through inhibiting detrimental cardiac remodeling after MI and reducing mortality. However, AT2R mediated actions in cardiac hypertrophy have been controversial for a long time. There may be some underlying unknown signaling pathways exist ing which are mediated by AT2Rs and other receptors that al so may participate in the cardiac remodeli ng process Although the cardiac remodeling mechanism s mediated by AT2Rs are not completely understood it is clear that AT2R mediated actions can have obvious therapeutic implications. AT1R antagoni sts are more ef fective in hypertension patients, since the AT1R antagonist s cause unbound AngII bind to the upregulated AT2Rs, which may enhance or amplify the favorable effects of AT1R antagonist. More experiments need to be done in order to elucidate AT2R functions and find out whether the activation of these receptors can be an effective treatment for human cardiac vascular diseases.

PAGE 39

39 CHAPTER 2 OVEREXPRESSION OF ANG (1 7) IMPROVES CARDIAC FUNCTION AND ATTENUATES LEFT VENT RICULAR REMODELING Abstract OBJECTIVES: We as sessed the hypothesis that the overexpression of the Angiotensin(1 7) [ Ang (1 7) ] may protect the myocardium following ischemia injury in the rat myocardial infarction model BACKGROUND: M yocardial ischemia causes significant myocardial damage, including myocyte death, fibrosis, and local wall thinning, leading to impaired ventricular function and cardiac failure. The reninangiotensin system (RAS) plays a critical role in modulating heart functions following a myocardial infarction. Ang (1 7 ), a component of the RAS has been shown to provide cardiac protective effects in various models of hypertension. Furthermore, it has been suggested that Ang (1 7) may play a part in the beneficial effects attributed to angiotensinconverting enzyme inhibitors (ACEi) and Angiotensin type 1 receptor blocker (ARB) in cardiovascular disease. METHODS: Over expression of Ang (1 7) mediated by lenti viral vector was used to investigate the role of Ang(1 7) in cardiac function and remodeling after myocardial infarction. A sin gle bolus of 3 0 x108 transfection units of lenti Ang (1 7) was injected into the left ventricle chamber of the heart in 5day old male SpragueDawley rats. Six weeks after viral administration, either a left anterior descending coronary artery ligation (CAL) or sham surgery was performed. Four weeks after the surgery, echocardiography and hemodynamic parameters were measured to assess the cardiac function. Heart tissues were collected to histological assessment and subsequent mRNA determination. Lenti viral transduction efficiency was determined by measure the viral vector expression in the rat heart using PCR after reverse transcriptin of RNA and SYBR

PAGE 40

40 Green Realtime PCR. A parrellel i n vitro hypoxia experiment was also carried out to test the effects of Ang(1 7) on rat neonatal cardiac myocytes (RNCM) exposed to 1 h hypoxia. Myocytes were isolated from 5 day old SpragueDawley rat heart ventricles RESULTS: Lenti viral vector significantly increased transgene expression in the rat heart tissues. Four weeks after the myocardial infarction a significant decrease in ejection fraction, deterioration of left ventricular systolic pressure, reduction in dp/dt, and an increase in left ventricular end diastolic pressure (LVEDP) and ventricular hypertrophy was oberved. Overexpression of Ang (1 7) attenuated these impairment s to a nonsignificant level, markedly illustrated by a significant reduction in LVEDP and ventricular hypertrophy. O verexpression of Ang (1 7) prevent ed my ocardial wall thinning and tended to decrease the infarction area. Furthermore, myocardial infarction caused an upregulation of ACE mRNA expression but tended to downregulat e of ACE2 mRNA expression. Overexpression of Ang (1 7) prevented these changes and also upregulated Bradykinin B2 receptor, a speculated cardiac protective factor In the in vitro study, Ang (1 7) protected RNCM from hypoxia induced cell death and mediated upregulation of speculated protective factors (ACE2, BKR2 and IL10) and downregulation of inflammatory cytokines (TNFand IL6) CONCLUSIONS: Cardiac overexpression of Ang(1 7) exerts protective influence on the heart function post myocardial infarction injury by persevering cardiac function, and attenuating cardiac remodeling post MI The effects of Ang(1 7) may be m ediated through restoring the ACE/ ACE2 balance and upregulating protective factors (BKR2 and IL10).

PAGE 41

41 Introduction It has well been established that components of the RAS plays a detrimental role in progression of heart failure. Pharmacotherapeutic interventions in patients as well as in experimental animal models provide support for this concept. Clinical t reatment of cardiovascular diseases with either a ngiotensinconverting enzyme inhibitors (ACEi) (Anonymous 1993) or Angiotensin type 1 receptor blocker s (ARB) (Thurmann et al., 1998) provide significant protection for patients from myocardial infarction and heart failure Animal studies have also demonstrated that ACE i and ARB prevent cardiovascular injury (Jalil et al., 1991) (Stier et al., 1991) The ACEi not only reduce s the formation and actions of Ang II, but also causes a significant elevation of angiotensin (1 7) (Ang(1 7)) levels (Keidar et al., 2007) A ng(1 7) has been implicated in protecting cardiac functions and preventing pathological cardiac remodeling (Sant os et al., 2004) Several investigators have demonstrated various cardioprotective actions of Ang (1 7). For instance, Ang (1 7) reduces the incidence and the duration of postischemic reperfusion arrhythmias in isolated rat heart (Ferreira et al., 2001) (De Mello, 2004) Ang (1 7) has also been shown to improve contractile function in rat hearts after intravenous infusion of Ang(1 7) (Sampaio et al., 2003) Chronic infusion of Ang(1 7) has been shown to preserve cardiac function, and improves coronary perfusion and endothelial function in a rat model for heart failure (Loot et al., 2002) AVE099 1, a nonpeptide agonist for Mas receptor, has been shown to significantly improve cardiac function in isolated perfused rat hearts (Ferreira et al., 2007) Using an Ang(1 7) transgenic rat model that overproduces Ang (1 7), Ang(1 7) reduced cardiac hypertrophy induced by isoproterenol (Santos et al., 2004) Ang (1 7) significantly attenuated myocyte

PAGE 42

42 hypertrophy and interstitial fibrosis induced by Ang II (Grobe et al., 2007b) In the DOCA salt hypertensive rat model, chronic administration of Ang (1 7) effectively prevented the myocardial and perivascular fibrosis (Grobe et al., 2006) Tallant et al. (Tallant et al., 2005) presented evidence for Mas mediated antihypertrophic effect of Ang (1 7) in rat cardiomyocytes. We and others (Ferrario et al., 1997) (Ferreira et al., 2007) have proposed that there are two axes of the RAS, the ACE AngII AT1R axis and ACE2Ang (1 7) Mas axis with opposing actions. The ACE2Ang (1 7) Mas axis has been shown to be involved in vasodilatory, anti h ypertrophic and antiproliferative effects, in contrast to the vasoconstrictive, hypertrophic effects mediated by the ACEAngII ATIR axis. Preservation of cardiac function requires maintenance of this balance between these two axes. In the present study we used a gene therapy approach in an attempt to overexpress cardiac Ang(1 7) to evaluate any cardioprotective effects of this peptide in a rodent model of myocardial infarction. The present study was also designed to to evaluate potential cardioprotective mechanisms modulated by Ang(1 7). We hypothesized that Ang(1 7) may restore the balance between the ACEAngII AT1R axis and the ACE2 Ang (1 7) Mas axis in the RAS, and possibly have anti inflammatory actions to thereby produce cardioprotection in respons e to myocardial infarction injury. Material and Methods Characterization of Ang(1 7) in Lentiviral Vector Lenti viral vectors were created as previously described (Coleman et al., 2003) Lenti viral vectors contai ning Ang(1 7) was driven by elongation factor Ang (1 7), Lenti Ang (1 7)). The Lenti Ang (1 7) vectors were tittered using the HIV 1

PAGE 43

43 p24 antigen ELISA assay (Beckman Coulter) kit following the manufacturers instructions. Lenti Ang (1 7) Administration All of the animal protocols wer e approved by the institutional animal care and use committee (IACUC) and conducted according to National Institutes of Health guidelines. Five day old male SpragueDawley rats received a single intraventricular injection of 3.5x108 transfection units of l enti Ang (1 7) in 30 L 1x PBS, as described previously (Metcalfe et al., 2004a) This method of gene transfer by our lentiviral vector provides a close to 100% animal survival rate and has been established to produce efficient and longterm transduction of the heart. After viral administration, animals were returned to their mothers until weaning. Myocardial Infarction At 6 weeks of age, rats were separated into 4 experimental groups (control sham, MI, Ang (1 7), and MI+Ang(1 7); N=4 7 per group) and subjected to either coronary artery ligation surgery or mock surgery. Myocardial infarction was induced by ligation of the left anterior descending coronary artery. At the time of operation, rats were anesthetized with isoflurane (2.0 2.5% in oxygen), after which rats were intubated with an 18gauge intravenous catheter and mechanically ventilated with this isofluraneoxyg en mixture using a Harvard ventilator (model 683, Harvard Apparatus, Holliston, Mass). After the chest was cleaned and shaved, rats were underwent a left lateral thoracotomy. The thorax was entered via the left fourth intercostal space and the pericardium incised to expose the heart. The heart was exposed, and ligated at the proximal left anterior descending coronary artery 2 3 mm from its origin between the pulmonary artery conus and the left atrium with a 7 0 polypropylene suture. Successful

PAGE 44

44 cessation of blood flow was indicated by elevation of ST segment on electrocardiogram and cyanosis of anterior LV wall; if necessary the procedure was repeated by placement of a second or third ligature. The heart was returned to its normal position, and the thorax ev acuated of fluid and air and sutured closed. All of the animals received buprenorphine hydrochloride (Buprenex, 0.02 mg/kg q12 IM, Reckitt and Colman Pharmaceuticals) and were closely monitored for signs of discomfort. Sham operated rats underwent the identical surgical procedure as described above except that the suture was not tightened around the coronary artery. In the present study, the operationrelated mortality was approximately 25% 24 h after operation. Echocardiography Cardiac function was eva luated using a Hewlett Packard Sonos Model 5500 with a 12Hz transducer at 4 weeks after coronary artery ligation surgery. Rats were anesthetized with isofluorane for echocardiographic examinations. Images were obtained from the parasternal short axis. All measurements were based on the average of three consecutive cardiac cycles. Measurements obtained by echocardiography include left ventricular end diastolic diameter (LVED), left ventricular end systolic diameter (LVES ) and l eft ventricular posterior wal l thickness (LVPW) The ejection fraction was calculated as follows: (LVED vLVESv)/LVED v x 1/100. Hemodynamic Measurements Rats were anesthetized with ketamine/xylazine/ acepromazine rodent cocktail ( 3 0 mg/ 6 mg /1mg /kg, i.m. ) The rats were placed in supine position and the body temperature was maintained at 37oC by a heated pad throughout the experiment. The left ventricular function was measured using a 22 Gauge needle filled with heparin saline (20 IU/ml) inserted into the left ventricular chamber. The data was recorded after

PAGE 45

45 stabilization of the tracing using a liquid pressure transducer, which was interfaced to a PowerLab (ADInstruments, Colorado Springs, CO, USA) signal transduction unit. Data were analyzed by using the Chart program that was supplied w ith the PowerLab system.The parameters measured include a peak systolic pressure of left ventricle (LVSP), a maximal positive and negative rate of rise in left ventricular pressure (dP/dtmax and dP/dtmin), heart rate ( HR) and left ventricular end diastoli c pressure(LVEDP) Histological Analysis Following the hemodynamic measurement, the hearts were harvested. T he ventricles were separated from atria and rinsed in PBS. The ventricles were weighed and cut into 3 thick sections made perpendicular to the long axis. The basal and apex section was snap frozen in liquid nitrogen and stored at 80C for subsequent Quantitative Real time PCR measurements The middle section was used to measure infarct size and cardiac remodeling parameters. Cardiac remodeling was determined by ventricular hypertrophy and cardiac fibrosis. Ventricular hypertrophy was determined by measuring wet weights of rat heart ventricles normalized to body mass. Cross sections of the ventricles were then fixed in 10% neutral buffered formalin, em bedded in paraffin, sectioned at 4 m. Ventricular sections were stained with H & E (hematoxylin and eosin) to determine myocyte diameter or with PicroSirius Red to me a sure interstitial fibrosis. Myocyte diameter was determined at 40 x magnification, using the ImageJ program from National Institutes of Health as previously described (Grobe et al., 2006) Quantification of cardiomyocyte diameters was carried out by an individual who was blinded to the treatments. 20 se parate images from different (nonoverlapping) regions of the left ventricle free wall only were examined. Left ventricular (LV) wall thickness was

PAGE 46

46 also measured by the ImageJ program and represented as a percentage of control LV wall thickness. Rat Neonat al Cardiac Myocytes: Isolation and Culture Rat Neonatal Cardiac M yocytes (RNCM) and were isolated from the ventricles of 5 day old SpragueDawley rats according to the method adapted from Zhang et al (Zhang et al., 2001) Briefly, rat ventricles were dissociated by mechanical disaggregating and enzymatic digestion with 1% collagenase II (Worthington Biochem. Corp., Freehold, New Jersey). Next cells were pre plated in the presence of 5% fetal bovine serum (FBS) in order to separate RNCM from noncardiomyo cytes. After 1 hour of preplating, the suspended cells, comprising mostly of RNCM, were remo ved from the attached noncardiomyo cyt es, counted by hemocytometer, diluted to 2 x 106 viable cells/ml in culture medium with 10%FBS and plated in gelatincoated culture plates. RNCM were grown in DMEM (Dulbecco's modified Eagle's medium)/F12 supplemented with 1% penicillin/streptomycin, 10 mM HEPES ,10 g/ml insulin, 10 g/ml transferrin and 10% (v/v) FBS (fetal bovine serum) Ce lls were plated in gelatin [0.1% v/v]coated culture dishes containing the same media/sera, and were grown in a 5% CO 2 /95% air humidified incubator 100 M bromodeoxyuridine was also added to the media in order to inhibit fibroblast growth. Spontaneous beat ing was observed in over 95% of cells after 2 days in culture, indicating that the isolated cells were indeed myocytes. This was further confirmed by positive staining of these cells for immunoreactive alphasa rc omeric actin antibody (Figure 3 1). Hypoxia/ re oxygenation model and LDH viability assay Culture medium to grow RNCM was changed every 24 hours. 48 h later after culturing, Ang(1 7) was added into the medium to reach 10 m final concentration. Ang-

PAGE 47

47 (1 7) was added 1 h before exposing cells to a 95% N2/5% CO2 mixture (or normoxic control) Following hypoxic exposure to 1 h, cells were returned to normoxic conditions. 24 h later, culture media was collected to detect lactate dehydrogenase (LDH) level and cells were collected to detect mRNA levels for di fferent genes. LDH level was analyzed ac cording to the manufacturers specifications (Roche Applied Science, Indianapolis,USA) The assay is based on the measurement of LDH released into the culture media when the integrity of the cell membrane is lost. RNA Isolation and PCR Tissues or cells were homogenized and total RNA was isolated using RNAqu e ous 4 polymerase chain reaction (PCR) kit (Ambion, Foster City, CA, USA) according to the manufacturer's instructions. 200ng RNA was reverse transcribed with iScri pt cDNA Synthesis kit (Bio Rad, Hercules, CA, USA). Transducing efficacy of Lenti Ang (1 7) in rat myocardium was examined by testing the expression of lenti viral vector. PCR and SYBR green realtime RT PCR was used to quantify the lenti viral vector expr ession. For lenti Ang (1 7), the forward primer (5 CATCACCCATCGAGAAACC 3) was located in IgG fragment and the reverse primer (5 GGACCAAGCCTGGCCATGTCC 3) was located in the human prorenin fragment of the transgene. GAPDH p rimers were : forward primer: ( 5 GCCAGCCTCGTCTCATAGACA3 ) reverse primer: ( 3 GTCCGATACGGCCAAATCC 5 ) A 450bp fragment was amplified by PCR using 59 C as annealing temperature and 30 cycles. The SYBR green real time PCR assays for each target gene were performed on cDNA samples The AT1R, AT2R, Collagen I, Collagen III, TGFbeta, TNFalpha, ACE2, ACE, IL 1, IL 10, and IL6 were analyzed by quantitative real time PCR using Taqman probe

PAGE 48

48 (Applied Biosystems). Real time PCR was run using ABI Prism 7000 sequence detection system. All cDNA samples were assayed in triplicate. Data were normalized to GAPDH m RNA level Statistical Analysis Results are expressed as meanSE. Data were analyzed by one way analysis of variance ( ANOVA) with Bonferroni correction for multiple comparisons. Values of P<0.05 were considered statistically significant. All of the data were analyzed using GraphPad Prism 5 software (Graphpad Prism Institute Inc). Results Lenti viral Vector Mediated Overexpression of Ang (1 7) in Rat Hearts Figure 21 a summarized the experimental protocol. The Lenti Ang (1 7) was injected into the left ventricular chamber of 5day old SD rats. 6 weeks after gene delivery, the chest was opened and a suture was placed around the left anterior descending coronary artery (CAL). Myocardial infarction was confirmed by the STsegment elevation as determined by electrocardiogram (ECG), and a representing tracing is shown in Figure 21 b Lenti viral gene expression was determined by PCR and Realtime RT PCR for all groups. Lenti viral vector mRNA level was significantly increased for Lenti Ang (1 7) and MI+Lenti Ang (1 7) groups, and undetectable for control and MI, as shown in figure 22. Effects of Ang(1 7) O verexpression on C ardiac Function Post MI Echocardiographic analyses performed at 4 weeks post myocardial infarction surgery. Myocardial infarction caused a significant reduction in Ejection Fraction in the MI group relative to control, Lenti Ang (1 7). Ang(1 7) overexpression was able to attenuate the decrease in ejection fraction induced by myocardial infarction, as shown in

PAGE 49

49 Figure 23. Left ventricular systolic pressure, maximum dp/dt, and minimum dp/dt were significantly decreased in MI group, relative to control and Lenti Ang(1 7) (Table 21). L eft ventricular end diastolic pressure w as significantly increased in the MI group compared to control and Lenti Ang (1 7). Neonatal Ang (1 7) treatment was able to attenuate these changes (Table 21). Heart rate was not significantly different among groups although there was a trend for an inc rease in the untreated MI group (Table 21). Effects of Ang(1 7) O verexpression on V entricular R emodeling Post MI Lenti viral vector mediated Ang (1 7) overexpression attenuated MI induced cardiac hypertrophy as evaluated by both the ventricular weight t o body weight ratio and measurement of cardiomyocyte diameter, as shown in Figure 24. Body weights were not significantly different among the groups (Figure 24c) Wall thinning and fibrosis were observed in MI group. Ang(1 7) overexpression prevented the wall thinning and tended to decrease infarction area, as shown in Figure 25. Ang (1 7) mediated protection post MI is associated with restoration balance between ACE AngII AT1R axis and ACE2Ang (1 7) Mas axis. To determine possible cardioprotective mechanism mediated by Ang(1 7) overexpression, the left ventricular tissue was harvested to measure the genes involving in the RAS and cardiac remodeling. As showing in Table 22, ACE level was significantly increased in MI group compared to control and Lenti Ang (1 7) groups. The overexpression of Ang (1 7) prevented this increase in the MI+ Lenti Ang (1 7) group. In contrast, ACE2 and Mas receptor levels tended to decrease in MI group compared to control and Lenti Ang (1 7) treated animals; however, overexpression Ang(1 7) in the MI group led to an increase in cardiac ACE2 and Mas receptor levels after MI.

PAGE 50

50 Overexpression of Ang(1 7) also increased bradykinin receptor B2 (BKR) in MI+Lenti Ang (1 7) group. Ang (1 7) overexpression tended to reduce the inc rease in the expression of AT1R, TGF, Collagen I, and Collagen III expression mediated by MI. IL 1, IL 6, IL 10, and AT2R mRNA level were very low and undetectable (dat a not shown in the Table). Ang (1 7) Increases the Viability of RNCM after Hypoxia Exposure. Lactase dehydrogenase (LDH) l evel in the culture medium a marker for cell death, is increased when cell membrane is damaged. When cells undergo necrosis or apoptos is, the cell membrane is damaged and leaks Thereby, LDH is released from intracellular compartment to extracellular medi a LDH level in the media is used as an indicator for cell viability. LDH level in the media is negatively correlated with the cell viability. Rat neonatal cardiac myocyte (RNCM) cells were exposed to hypoxia for 1 h and then cultured under normoxia condit ions.24 h after the hypoxia exposure, LDH level in the RNCM culture medium was significantly increased following hypoxia exposure and Ang(1 7) treatment was able to completely prevent the LDH release, indicating Ang (1 7) provides some protection to RNCM cells from hypoxia induced cell death (Figure 26). Twenty four h after the hypoxic exposure, g ene expression was analyzed in all cell cultures Ang (1 7) treatment mediated significant increase in AT2R, ACE2, IL10 expression levels (Table 23). Inflammatory cytokines (TNF and IL6) were significantly increased in the hypoxic RNCM. Ang (1 7) prevented hypoxiainduced increase.

PAGE 51

51 Discussion In the present study, the effects of Ang(1 7) overexpression mediated by lenti viral vector on cardiac function and ventricular remodeling were examined in a rat coronary artery ligation model. We found that overexpression of Ang (1 7) provides significant protection against left ventricular dysfunction caused by myocardial infarction, as shown by preserving ejection fr action, and preventing the dysfunctional changes in dp/dt and left ventricular end diastolic pressure. Moreover, Ang (1 7) significantly attenuated ventricular hypertrophy and tended to prevent wall thinning and ventricular fibrosis. Left ventricular remodeling characterized by hypertrophy and fibrosis are risk factors for heart failure following myocardial infarction. The cardioprotective effects ( antihypertrophy and antifibrosis) of Ang(1 7) are consistent with previous findings by us and others. Ang (1 7) transgenic animals showed less ventricular hypertrophy and fibrosis in the AngII hypertensive rat model (Mercure et al., 2008) Ang (1 7) also prevents ventricular hypertrophy induced isoproterenol in Ang(1 7) tra nsgenic animals (Santos et al., 2004) Ang (1 7) administered via osmotic minipumps also was effective in preventing the myocardial and perivascular fibrosis i n the DOCA salt hypertensive rat model (Grobe et al., 2006) Ang (1 7) has been speculated to mediate part of the cardioprotecti ve effects attributed to ACEi and ARB, since Ang (1 7) level s are elevated with these two treatments (Fer rario et al., 2005) The Ang(1 7) elevation in the plasma can be explained by an increase in ACE2 levels after ACEi and/or ARB treatme nt and ACE 2 exhibits a high catalytic efficiency for the generation of Ang(1 7) from Ang II (Vickers et al., 2002b) ACEi is reported to increase cardiac ACE2 mRNA level (Ferrario et al.,

PAGE 52

52 2005) ARB treatment has been shown to result in a significant upregulation of ACE2 mRNA level in the vi able myocardium in the myocardial infarction model (Ishiyama et al., 2004b) ARB treatment also has been reported to increase cardaic ACE2 mRNA level and cardiac ACE2 activity ; and a combination of ARB and ACEi exert ed similar effects (Ferrario et al., 2005) Previous studies from our lab have shown that overexpression of ACE2 renders protective effects against ischemia induced left ventricular dysfunction (Der Sarkissian et al., 2008) Results from the current study elucidate possible mechanisms for the cardioprotective effects of Ang(1 7). After myocardial infarction, ACE expression level was significantly upregulated in the hear t and AT1R tended to upregulate, but ACE2 and Mas expression was downregulated. All these changes following myocardial infarction indicate the disrupted balance between ACEAngII AT1R axis and ACE2 Ang (1 7) Mas axis for the RAS in the heart The activity of the ACEAngII AT1R axis is increased and the activity of the ACE2 Ang (1 7) Mas axis is decreased Ang (1 7) expression restores the balance by decreasing the ACEAngII AT1R axis by preventing the upregulation of AT1R induced by myocardial infarction, and by activating ACE2 Ang (1 7) Mas axis through upregulating ACE2 and Mas receptor. M yocardial infarction causes local hypoxia in the infarct zone. Cardiac myocytes die during the hypoxic phase of a myocardial infarction. The i n vitro hypoxia and reoxyge nation mimics this hypoxic phase of myocardial infarction. The i n vitro hypoxia study may provide some evidence to support a cardioprotective role of Ang(1 7) for the cardiac myocytes. In the in vitro experiment Ang (1 7) treatment protected cardiac myoc ytes from hypoxia induced cell death. The protective effects of Ang(1 7) treatment

PAGE 53

53 was associated with an upregulation of ACE2, AT2R IL 10 (anti inflammatory cytokine), and downregulation of inflammatory cytokines (IL6 and TNF) in the RNCM. The cardioprotective effects of Ang(1 7) may be explained by the alteration of these mediators. The ACE2 upregulation is consistent with our in vivo findings. AT2R upregulation provides supports for the cardioprotective role for AT2R and possible interaction among ACE2, Ang (1 7) and AT2R. Zisman et al (Zisman et al., 2003a) has shown a direct correlation between Ang(1 7) forming activity and AT2R density in the hearts from primary pulmonary hyper tensive patients. Evidence for cardioprotective role of AT2R from the current study is consistent with others too. Direct AT2R stimulation improves post myocardial infarction systolic and diastolic function (Kaschina et al., 2008) and AT2R have been resported to functionally interact with Ang (1 7) through its Mas receptor (Castro et al., 2005) P roinflammatory cytokines (e.g., tumor necrosis factor [TNF]and IL6) anti inflammatory cytokine (e.g. IL10) and cytokines having proand anti inflammatory activities (e.g. transforming growth factor [TGF 1 ] ) play a critical role in mediating homeostasis within the heart in response to cardiac injury. IL6 and TNF marker for heart failure. IL 6 plays an important role in the pathophysiology of congestive heart failure patients, as IL 6 has been shown to increase in the plasma of these patients (Tsutamoto et al., 1998) TNF RNA and protein is also elevated in patients and in animal models with advanced heart failure (Testa et al., 1996) (TorreAmione et al., 1996) ACEi significantly attenuated MIinduced increase in the expression of cardiac cytokines (TNF and TGF1) (Blais et al., 2002) Antiinflammatory therapy is also being investigated for the treatment of myocardial

PAGE 54

54 infarction. A recent report has shown that treatment with rhIL 10 significantly improved LV function in rats with heart failure after experimental MI (Stumpf et al., 2008) C onsistent with these reports, IL 6 and TNFto hypoxia in this study. Ang(1 7) treatment was obser ved to elevate IL10 level s and to prevent the increase in IL6 and TNFin hypoxic RNCM However, observations summarized from in vitro study were not exact ly the same for the in vivo study. For the in vivo study IL 6 and TNFand IL 10 and AT2R expression in the hearts were undetectable. However, for the in vitro study, Ang(1 7) upregulated IL 10 and AT2R and prevent ed the increase in IL6 and TNFin the RNCM exposed to hypoxia. The inconsistency between in vivo and in vitro resul ts could be explai ned as total RNA was isolated from several cell types in the heart (including cardiomyocytes, cardiofibroblasts, and endothelial cells ) It is possible that the changes observed in cardiac myocytes were masked by the contributions from t he noncardiomyocyte cells The half life for Ang(1 7) is very short and dependent on species. In rodents, Ang(1 7) has a very short half life (approx imately 20 s) following i ntravenously administration (Iusuf et al., 2008) In humans, Ang(1 7) half life varies by the route of administration. Following intravenously administ rat ion, the half life for Ang (1 7) was approximately 30 min in humans (Kono et al., 1986) U pon repeated subcutaneous administration, the half life was 29 min (Rodgers et al., 2006) Considering the short half life for Ang (1 7), it is quite difficult to maintain a therapeutic level for Ang(1 7) when Ang (1 7) peptide is administrated into patients or rodents by intravenous infusion or subcutaneous injection. Without achieving certain level of Ang(1 7) in the plasma or tissues, Ang(1 7) may not exert its cardioprotective effects. Therefore a gene therapy

PAGE 55

55 approach, like the one described here, could be used to mediate longterm Ang (1 7) production after single administration of viral vector containing Ang(1 7). Viral vector can elicit efficient transduction and longterm expression Therefore, daily regimens can be eliminated. Moreover, v iral vectors can be directed to specific target tissues, which could reduce unwanted side ef fects. We have recently demonstrated that use of an rAAV9 serotype is not only cardiospecific but target preferentially the myocytes (Qi et al., 2009) Utilization with such a specific viral vector to target the heart may even enhance the effects ob served in the present study However in the current study we cannot specify if there is any cell specificity with the lentiviral vector In summary, our data demonstrate that overexpression of Ang(1 7) preserves cardiac functi on and attenuates cardiac remodeling post myocardial infarction. These beneficial effects involve restoration of the RAS balance and upregulation of anti inflammatory cytokine. Taken together, all these studies indicate that targeting of the ACE2 Ang(1 7) Mas axis could hold novel therapeutic strategy in the treatment of myocardial infarction and its associated complications.

PAGE 56

56 Figure 2 1 Schematic representation of study protocol. ( a ) Illustration of the experimental protocol for myocardial infarcti on. Lenti (Ang17) was administered into left ventricular chamber of 5day age SD pups. Coronary artery ligation (CAL) was performed when SD rats were 6 weeks old. 4 weeks after the surgery, animals were subjected to echocardiography followed by hemodynami c heart function assessment and tissues harvest ; N=4 7 per group. (b ) Representative electrocardiogram (ECG) at basal showing normal tracing and showing an elevation in STsegment following CAL, as indicated by arrow. n=4 7 / group

PAGE 57

57 Figure 2 2 Transduction efficiency of Lenti Ang (1 7) in rat hearts ( N=4 7 per group) Graph shows s emi quantitative Real Time RTPCR to detect the expression Lenti Ang (1 7) viral vector Lenti viral vector expression in the heart was also detected by agarose gel electrophoresis Lane1: negative control, lane 2: positive control, lane 3: control sham, lane 4: lenti Ang (1 7), lane 5: MI, lane 6: MI+lenti Ang (1 7). P<0.001 Lenti Ang (1 7) and MI+Lenti Ang (1 7) vs control and MI ; n=47 / group.

PAGE 58

58 Figure 2 3 Effect of Ang(1 7) gene transfer and myocardial infarction on ventricular function ( N=4 7 per group) (A) Echocardiogrphic analyses of rat myocardium 4 weeks after the CAL demonstrates significant improvement in ejection fraction in Lenti Ang(17) treated animals as compared to MI group.(* MI vs. all other groups p<0.05, n=47 / group)

PAGE 59

59 Table 2 1 Hemodynamic data 4 weeks after CAL surgery Control Lenti Ang (1 7) MI MI+Lenti Ang (1 7) LVSP 108.6 4.2 91.2 2.9 83.6 6.9* 110.7 4.6 HR 260.8 15.3 247 14.8 336.1 29.6 262.9 11.3 dp/dt max 8417.1 337.4 7188.1 1329.0 4479.4 1419.3* 7154.5 1369.2 dp/dt min 5166.2 453.9 4768.0 1260.0 3115.6 441.9* 4690.5 816.8 LVMP 35.6 2.4 36.9 4.6 45.2 2.1 43.6 0.6 LVEDP 4.0 1.3 0.8 1.3 12.5 2.7* 4.9 0.7 HR( heart rate), beats per minute; LVSP (left ventricular systolic pressure) millimeters of mercury; Max dp/dt and Min dp/dt (maximal and minimal peak rate of left ventricular pressure), millimeters of mercury per second; LVMP(left ventricle mean pressure), millimeters of mercury; LVEDP(left ventricle end-diastolic pressure), m illimeters of mercury. (* MI vs all other groups ; N=4 -7 per group).

PAGE 60

60 Figure 2 4 Effect of Ang(1 7) gene transfer on ventricular hypertrophy ( N=4 7 per group) Lentiviral delivery of Ang(1 7) attenuates MI induced cardiac hypertrophy as evaluated by the ventricular weight(g) to body weight(Kg) ratio (a) measurement of myocyte diameter in the LV fr ee wall peri infarct area (b) Body weight was not significantly different among groups (c). n=4 7 / group

PAGE 61

61 Figure 25 Effect s of Ang(1 7) gene transfer on ventricular fibrosis and LV wall thickness ( N=4 7 per group) (a ) Picro Sirius Red staining s hows significant anterior wall thinning and collagen deposition at 4 weeks after CAL surgery in MI animals Ang (1 7) overexpression tended to attenuate fibrosis induced by MI. ( b ) Quantification of the LV wall thickness as a percentage of control left ventricula r wall thickness. MI significantly induced a reduction in LV wall thickness and Ang(1 7) attenuated the LV wall thinning. (* MI vs control, Lenti Ang (1 7), and MI+Lenti Ang (1 7); ** MI+Lenti Ang (1 7) vs control, Lenti Ang (1 7)) ; n=47 / group.

PAGE 62

62 Table 22 Quanti tative Real Time PCR data Control (N=7) Lenti-Ang -(1 -7) (N=4) MI (N=6) MI+ Lenti-Ang-(1 -7) (N=6) AT1R 1.00 0. 33 0.73 0.10 1. 6 0. 21 0.8 1 0.1 0 TGF 0.59 0.21 0.57 0.24 0.98 0.01 0.83 0.04 BKR 0.33 0.08 0.33 0.07 0.28 0.02 0.74 0.11* ACE2 0.7 6 0.03 0.56 0.0 5 0. 43 0. 2 1 1.17 0.2 2 # ACE 1.64 0.29 0.98 0.07 3.48 0.62& 1.62 0.34 MAS 0.99 0.40 1.0 6 0.12 0.29 0.04 0. 85 0. 31 TNF 0.64 0.09 0.82 0.06 0.67 0.09 1.00 0. 08 COLI 0.2 7 0.0 8 0. 39 0. 17 0. 95 0. 22** 0.53 0.24 COLIII 0.45 0. 08 0.88 0.06 1. 13 0. 17** 0.71 0.0 7 P<0.05, # MI+lenti Ang (1 7) vs Lenti Ang (1 7) and MI MI+lent i Ang (1 7) vs all other groups & MI vs all other groups ; ** MI vs control Data are depicted as mRNA fold changes relative to GAPDH mRNA calculated using the expression 2^ and expressed as a mean fold change SEM.

PAGE 63

63 Figure 26 Ang (1 7) effects in cell viability assay. 10 m Ang (1 7) was added 1hour before hypoxia study. Cell viability was tested by LDH kit. Bar graphs are means S.E. M., N = 6 P<0.05, Ang(1 7) treated hypoxia cells vs corresponding control ; n=47 / group.

PAGE 64

64 Table 23 Quantitative Real Time PCR data for in vitro experiment Normoxia Hypoxia Nomorxia+Ang1 7 Hypoxia+Ang1 7 AT1R 1.19 0.26 1.41 0.32 0.83 0. 18 1.04 0.20 AT2R 0.89 0.10 1.17 0.07 0.97 0.24 1.42 0.18 # ACE 0.97 0.05 1.00 0.04 0.96 0.08 0.99 0.05 ACE2 0.42 0.13 0.29 0.10 0.28 0.16 0.95 0.20* MAS 0.91 0.05 1.23 0.04 1.36 0.24 1.12 0.04 BKR 0.76 0.13 0.92 0. 14 0.52 0.10 0.51 0.12 TGF 1.34 0.27 1.21 0.14 1.16 0.27 1.24 0.24 COLI 0.99 0.03 1.16 0.08 1.28 0.13 1.12 0.03 COLIII 0.96 0.05 0.91 0.02 0.67 0.09 0.88 0.05 IL 10 0.03 0.004 0.01 0.001 1.05 0.14** 1.30 0.23* TNF 0.44 0.08 1.67 0.26 & 0.18 0.05 0.40 0.05 IL 6 0.97 0.04 1.35 0.04 & 0.75 0.12 0.88 0.05 P<0.05, # Hypoxia+Ang(1 7) vs Normoxia and Normoxia+Ang (1 7), Hypoxia+Ang (1 7) vs all other groups; ** Nomorxia+Ang (1 7) and Hypoxi a+Ang (1 7) vs corresponding controls; & hypoxia vs all other groups; IL1 level was undetectable and not shown in this table. N = 6. Data are depicted as mRNA fold changes relative to GAPDH mRNA calculated using the expression 2^ and expressed as a m ean fold change SEM.

PAGE 65

65 CHAPTER 3 SELECTIVE TROPISM OF THE RECOMBINANT ADENO ASSOCIATED VIRUS 9 SEROTYPE FOR RAT CARDIAC TISSUE Note: This chapter has already been published in the Journal of Gene Medicine: Qi YF Liu X Li HW, Shenoy V Li QH, William W, Sumners C and Katovich MJ. Selective tropism of the recombinant adeno associated virus 9 serotype for rat cardiac tissue. Journal of Gene Medicine. [Epub ahead of print], 2009 Abstract Cardiac gene transfer may serve as a novel therapeutic approach for heart disease. Numerous serotypes of rAAV have been identified with variable tropisms to cardiac tissue. Both in vitro and in vivo experiments were undertaken to compare cardiac tropisms of rAAV 2, 5, 7, 8, and 9. For the in vitro studies, 107 vector genome (vg) of rAAV 2, 5, 7, 8, or 9 were used to transduce both rat neonatal cardiac myocytes (RNCM) and fibroblasts (RNCF). For the in vivo studies, 4x1010 vg of rAAV2, 5, 7, 8, or 9, and 4x1011 vg of rAAV8 or 9 were administered in 5day old rats via a relatively noninvasive intracardiac injection. 1 and 2 months post administration, GFP expression in tissues was visualized and GFP mRNA was quantified by Real Time PCR. At 3 days post viral transduction, rAAV9 and rAAV2 produced the highest transducing efficiency in RNCM. Only AAV2 elicited any transduction in the RNCF. The in vivo results indicated that the order for transduction efficiency in the heart was: rAAV9>rAAV8>rAAV7>rAAV2=rAAV5. The transduction efficiency order in the liver was: rAAV2>rAAV5>rAAV7>rAAV8>AAV9. Injection of a higher dose (4x1011 vg) of rAAV9 provided more widespread and highly cardiac selective GFP expression in the heart than rAAV8. Zero to minimal expression of GFP was found in the lung and kidney for both doses of all rAAV serotypes utilized. Collectively, these results suggest that rAAV9 provide the most selective and stable transduction efficiency in cardiac tissue, and this expression was primarily exhi bited in the cardiac myocytes.

PAGE 66

66 Introduction Cardiac gene therapy is considered as a promising therapeutic tool for the treatment of cardiac diseases (Yla Herttuala and Alitalo, 2003) (Markkanen et al., 2005) However, development of vectors that produce efficient and optimal gene transfer in the heart has not yet met expectations, as several clinical trials related to cardiac gene therapy have failed. Most failures have been attributed to the lack of clinical and physiological efficacy, which co uld be due to the low efficiency of myocardial gene transfer and/or limited duration of transgene expression (Bekeredjian and Shohet, 2004) (Muller et al., 2007) Thus, in order to facilitate longterm gene transduction of the heart in both animal studies and clinical trials, selection of vector type and route of vector delivery are crucial factors influencing the success of cardiac gene therapy. R ecombinant adenoassociated virus (rAAV), derived from members of Parvoviridae family of nonpathogenic viruses, are emerging as one of the most promising vector systems for cardiac gene transfer. rAAV has exhibited highly efficient transduction and capacity with longterm gene express ion and is associated with low immunogenicity (Wright et al., 2001) (Vandendriessche et al., 2007) and lack of apparent cytotoxicity in tissues such as skeletal muscle (Arruda et al., 2005) liver (Snyder et al., 1997) heart (Woo et al., 2005a) (Chu et al., 2003) (Vassalli et al., 2003) and arteries (Vassalli et al., 2003) At least 12 different r AAV serotypes have been identified, including r AAV1 through r AAV12 ( Romano, 2005) Different r AAV serotypes have variable transduction efficiency and differential tropism to various tissues in the body. The available data concerning transduction efficiency of r AAV serotypes in cardiac tissue are divergent and difficult to interpret due to differences in viral vector doses, promoters composed within the viral

PAGE 67

67 vectors, animal species, and/or route of administration. Among the currently used rAAV serotypes, rAAV2 is the best characterized and best documented AAV serotype in research studies and clinical trials. r AAV2 has been reported to elicit high levels of myocardial transduction when compared to rAAV1, 3, 4 and 5, after intramyocardial ly inject ion into the left ventricular wall in adult Balb/C mice (Du et al., 2004) Similar results were observed with intravenous administration via the tail vein in adult mice (Muller et al., 2006) ; or with intracoronary perfusion in adult Sprague Dawley rats (Muller et al., 2006) However, these observations are not universally consistent. When AAV5 was compared to r AAV2 the rAAV5 demonstrated dramatically enhanced transduction efficiency in vitro in differentiated myocytes (>500 fold ) (Duan et al., 2001) A more recent study revealed that rAAV8, along with rAAV 1 and 6 showed preferable tropism for transducing adult rat myocardium, compared to rAAV2, 3, 4, 5, and 7 when AAV1 though 8 were intramyocardially administered into the left ventricular apex of adult SpragueDawley rats (Palomeque et al., 2007) Subsequent studies demonstrated that both rAAV7 and rAAV9 exerted rapidonset and high transgene express ion in cardiac tissue, when intravenously injected via tail vein in adult mice (Zincarelli et al., 2008) When compared to rAAV8, rAAV9 provided widespread myocardium transduction in adult mice, following administr ation of the virus by the same intravenous route (Vandendriessche et al., 2007) When rAAV1, 6, 7, 8 and 9 were compared together, rAAV9 provided global cardiac gene transfer both in the mouse after intraperica rdial injection into neonatal mice, and high transduction in the rat heart after direct intramyocardial injection into adult myocardium (Bish et al., 2008) Therefore,rAAV2,rAAV5,rAAV7,rAAV8 and rAAV9 can all serve as a possible vector

PAGE 68

68 candidate for targeting the rat heart and should be comprehensively compared, side by side. The route of rAAV vector administration may substantially determine transduction efficiency and viral tropisms in vivo since rAAV vectors can nonspecifically infect a variety of tissues The ideal route of administration of viral vectors to animals should have two important characteristics: providing transduction exclusively localized to the target organ and being easy to apply in vivo An intramyo cardial injection directly into the myocardium can mediate localized transgene expression with much less possibility of transducing other vital organs such as the liver, lung, and kidney. However, this method required thoracotomy surgery and transduction i nside the myocardium would also be very limited to the area surrounding the injection sites. An intravenous injection is another commonly applied option to administer viral vectors, but it requires larger viral vector dose and transduction is not limited t o the target organ. Intracoronary artery perfusion is another choice to deliver a transgene to the heart, but it is also a difficult technique. Considering, the pros and cons of possible administration routes, injecting rAAV vector directly into left ventr icle cavity of rat neonatal pups could be the most applicable and least technically difficult method for delivering a transgene into myocardium. This is a novel and not extensively used method in comparing AAVs tropism studies. The hearts of neonatal rats are nearly visible under their transparent skin and the injection into the left ventricular cavity would only require a single injection and small volume. Rat pups recover within minutes after the injection and, with experience; nearly 100% of them survive the process (Falcon et al., 2004) The viral

PAGE 69

69 dose used in neonatal rat pups would also be considerably lower than that used in adult rats. In the present study, we performed a comprehensive sideby side in vitro and in vivo analysis using rAAV2, rAAV5, rAAV7, rAAV8 and rAAV9 to characterize their tissue tropism, especially cardiac transduction, in the rat. For the in vitro studies neonatal cardiac myocytes and fibroblasts were utilized. For the in vivo experiments, rA AV serotypes 2,5,7,8 and 9 were injected into the left cardiac ventricular cavity of 5day old SD neonatal rats, in order to maximize the transgene expression in the rat heart. Transgene expression in the tissues was examined at onemonth and twomonth pos t viral injection both by observing GFP under fluorescence microscope and by quantifying GFP mRNA through quantitative Real Time PCR. We also sought to identify the dose required for global transgene delivery in rats. Histological and molecular analyses were performed to reveal the tissue tropism for each rAAV serotypes. Material and Methods Rat Neonatal Cardiac Myocytes and Rat Neonatal Cardiac Fibroblasts: Isolation and Culture Rat Neonatal Cardiac M yocytes (RNCM) and Rat Neonatal Cardiac Fibroblasts (RNCF) were isolated from the ventricles of 5day old SpragueDawley rats according to the method adapted from Zhang et al (Zhang et al., 2001) Briefly, rat ventricles were dissociated by mechanical disaggregating and enzym atic digestion with 1% collagenase II (Worthington Biochem. Corp., Freehold, New Jersey). Next cells were pre plated in the presence of 5% fetal bovine serum (FBS) in order to separate RNCM from noncardiomyo cy tes. After 1 hour of pre plating, the suspended cells, comprising mostly of RNCM, were remo ved from the attached non cardiomyo cyt es, counted by

PAGE 70

70 hemocytometer, diluted to 2 x 106 viable cells/ml in culture medium with 10%FBS and plated in gelatincoated culture plates. RNCM were grown in DMEM (Dulbecc o's modified Eagle's medium)/F12 supplemented with 1% penicillin/streptomycin, 10 mM HEPES ,10 g/ml insulin, 10 g/ml transferrin and 10% (v/v) FBS (fetal bovine serum) Cells were plated in gelatin [0.1% v/v] coated culture dishes containing the same me dia/sera, and were grown in a 5% CO 2 /95% air humidified incubator. 100 M bromodeoxyuridine was also added to the media in order to inhibit fibroblast growth. Spontaneous beating was observed in over 95% of cells after 2 days in culture, indicating that the isolated cells were indeed myocytes. This was further confirmed by positive staining of these cells for immunoreactive alphasa rc omeric actin antibody (Figure1). The attached cells on the preplating dish were mainly RNCF, which were cultured in 10% FBS medium [DMEM supplemented with 10% (v/v) FBS, 1% penicillin/streptomycin and 50 g/ml ascorbic acid]. Greater than 95% of cultured cells were RNCF, as determined by positive immunostaining for vimentin (Grobe et al., 2 007a) Fibroblasts cultures were produced by dissociating RNCF cultures using t r ypsin/EDTA ( this also eliminate any residual myocytes ) and placing the dissociated cells in fibroblast culturing medium for 24 hours before their use. All animal procedures were approved by the University of Florida Institutional Care and Use Committee. Immunostaining RNCM cultures were washed three times with 1x PBS and fixed in 4% (v/v) paraformaldehyde (5 minutes, room temperature). Following permeabilization with 0.3% (v /v) Triton X 100 and 0.1% NP40 (10 min, room temperature), non specific binding was blocked with 1% (w/v) bovine serum albumin (BSA) in 0.3% (v/v) Triton X 100 (10 min,

PAGE 71

71 room temperature). Antibodies against alpha sa rc omeric actin (ab28052, Abcam, MA, US) w ere diluted (1:100) in 1% (w/v) BSA and incubated with RNCM at 4C overnight in a humidified chamber. RNCM were then washed three times in 1x PBS. A goat antimouse secondary antibody ( A11032, Invitrogen, Carlsbad, CA ,US) was incubated for 1 hour at room t emperature. After three successive washing with 1x PBS, the cells were mounted using fluorescent mounting medium containing DAPI (H1200, Vector Laboratories CA, US) and viewed by fluorescence microscopy. In Vitro Transduction of RNCM and RNCF RNCM and RNCF were plated in 24well plates at a density of 2x105 cells per well and grown for 48 hours After the culture media was removed and replaced with fresh media containing 107 vg of either rAAV2, rAAV5, rAAV7, rAAV8 or rAAV9. At 3 days post transduction, G FP expression in RNCM and RNCF was visualized using a fluorescence microscope. T otal RNA was extracted from these cells to quantify GFP gene expression using real time RTPCR. For in vitro transduction efficiency evaluation, four separate experiments for each rAAV serotype and each experiments was tested in quadruplicate for same time point on both cell types In Vivo Transduction of rAAV in Rats rAAV 5, 7, 8, and 9 were pseudotyped and cross packaged vectors, containing the AAV2 inverted terminal repeats (ITRs) and the capsid genes of AAV5, 7, 8 and 9. P seudotyped vectors containing AAV2 ITR was used because of the existence of the safety profile of AAV2ITR in animal models and humans. The rAAV2, 5, 7, 8 and 9 constructs were engineered to carry a ubiqui tous chickenactin promoter and green fluorescence protein (GFP) as the reporter gene. All of the rAAV constructs were made by the V iral V ector C ore at University of Florida. The rAAV vectors production, harvest,

PAGE 72

72 purification, and testing were carried out as previously described (Zolotukhin et al., 2002) rAAV vectors were purified by idodixanol gradient centrifugation and anionexchange (Q sepharose) chromatography. The purity of viral vector was tested by silver staining following electrophoresis on 10% SDS polyacrylamide gels on representative preparations. The physical titer of rAAV vector genome was determined by Real Time polymerase chain reaction (PCR). The production and purification methods generated 99% pure vector stocks with titers of 1x 1012 to 1x 1013 vector genome/ml. Wildtype AAV and replicationcompetent AAV contamination was at an undetectable level in the vector stock prepared using this method. Five day old male Sprague Dawley rats (n=36) were delivered by pregnant rats purchased from Charles River Laboratories (MA US). At 5 days of age, they were lightly anesthetized with isoflurane (PittmanMoore, Washington Crossing, NJ US), and injected intracardiacally with 4x1010 or 4x1011 vector genome (vg) of rAAVs CBAGFP (30ul) or the same volume of 1x DPBS as a control, as described previously (Du et al., 2004) (Qing et al., 1999) In previous studies using a lenti viral vector we have shown that this method of gene transfer results in 100% survival rate (Falcon et al., 2004) After viral administration, the pups were returned to their mother until weaning and were maintained under specific pathogenfree (SPF) conditions. After weaning, rats were housed 2 rats/cage under SPF conditions and used for experiments at either 1 month of age ( 170 g body wt) or 2 m onths of age ( 2 80 g body wt). All animal procedures were reviewed and approved by the Institutional Animal Care and Use Committee. At either f our weeks or eight weeks of age, rats were injected intraperitoneally with 400 IU heparin, and deeply anesthetized with a rodent cocktail containing ketamine,

PAGE 73

73 xylazine, and acepromazine (30, 6, and 1mg/kg, res pectively, subcutaneously). C hests were open ed to expose the heart and a 16gauge needle was inserted into the cavity of the left ventricle in order to perfuse the whole body with 1x PBS containing 2IU /ml heparin for 20 min. Heparin, an anticoagulant was used in this report was to prevent clot formation and to help remove blood cells from the tissues during perfusion. Any excess of blood cells left in the tissues can generate artificial fluorescence. Even though heparin has been reported to inhibit AAV2 transduction by competing with AAV2 to bind its main receptor on cell s urface ( heparan sulfate proteoglycan) (Summerford and Samulski, 1998) in the current study it was only used at the termination of the study, four or eight weeks post viral administration. Thus it is highly unlikely that the use of heparin in the current protocol would interfere with the transduction of AAV2 or any other AAV viral vector in vivo Samples of liver, lung, kidney and heart were collected respectively. A portion of each tissues was dissected and was preserved in 4% Paraformaldehyde and then embedded in Sakura TissueTek Oct Compound (4583 O.C.T. Compound, Sakura Finetek U.S.A. Inc. ) sections for the determination of GFP expression in each tissue by fluorescence microscopy. The remaining tissues were snapfrozen for the analysis of GFP mRNA. Visualization of GFP sections of heart, liver, lung, and kidney were directly imaged on an Olympus Model BX41 fluorescent microscope. Images were captured and imported into a DP controller. Images from the heart were captured at two different magnifications (2x and 10x) while all other tissues were captured only at 10x magnification. All fluorescent images were collected using an identical exposure time. Quantification of GFP positive cells was carried out by two individuals who were blinded

PAGE 74

74 to the treatments. GFP p ositive cel ls were counted in 35 different regions of the heart and liver sections using the ImageJ program. The results for each animal were then averaged for subsequent statistical analysis. Total RNA Extraction a nd Quantitative Real Time Polymerase Chain Reaction ( RT PCR) Analyses Total RNA was isolated using RNAqueous 4PCR kit s (AM1914, Ambion, Texas, USA). RNA concentration was quantified by UV spectrum at 260nm, and reverse transcribed using iScript cDNA synthesis kit s (Bio Rad) according to the manufacturer s i nstructions. Synthesized cDNA corresponding to 100ng of total RNA, was used for real time PCR. Specific p rimers for the GFP and glyceraldehyde 3phosphate dehydrogenase ( GAPDH; internal control ) genes were designed using Primer Express Software (PE Applied Biosystems) for use in real time reverse transcriptionpolymerase chain reaction (RTPCR) analysis. All primers were purchased from IDTDNA ( I ntegrated DNA technologies, USA). The primers used were as follows: GAPDH, forward primer: 5 GCCAGCCTCGTCTCATAGACA 3 GTCCGATACGGCCAAATCC 5 CCTCTCCGCTGAGAGAAAATTT 3 TGGTCCCAATTCTCGTGGAA 5 time PCR assays for each target gene were performed on cDNA samples using an ABI Prism 7000 Detection system (PE Applied Biosystems). GAPDH assays were run in parallel for each sample. Amplication was carried out in optical 96well reaction plates (Applied Biosystems) with each well containing 1.5 l cDNA template, 0.5 l sense primer ( 0.1 5 M), 0.5 l antisense primer (0.15 M), 5ul SYBR Green PCR Master Mix (Invitrogen) and DEPC treated

PAGE 75

75 water 2.5 l. The PCR conditions for two step PCR were one cycle of 95oC for 10min, followed by 40 cycles of 60oC for 1min and then 95oC for 15s. Statistical Analysis Experimental values are expressed as mean standard error (SE). One way and two way ANOVA were used to compare the mean values between experimental and control groups depending on the specific study A Bonferroni's multiple comparison test was used to determine the significant differences between groups. A p value of <0.05 was considered statistically significant. Results Evaluation o f In Vitro Gene Transfer b y rAAV Seroty pes i n RNCM a nd R NCF RNCM and RNCF were transduced with 107 vector genome ( vg ) of either rAAV2, rAAV5, rAAV7, rAAV8, or rAAV9 and 72 hours later GFP expression was analyzed by visualizing green fluorescence. All serotypes of rAAV were capable of producing gene transfer to RNCM as demonstrated by fluorescence imaging (Figure 2a). Quantitative r eal time PCR (Fig ure 2 b ) demonstrated that rAAV2 and rAAV9 were the most effective serotypes for transducing RNCM. rAAV7 induced moderate levels of GFP gene trans fer compared to rAAV2 and rAAV9, and GFP expression following rAAV5 and rAAV8 treatment was relatively low. With the exception of rAAV2, none of the vectors produced significant GFP expression in RNCF (Figure 3). Evaluation of I n V ivo G ene T ransfer E licite d by rAAV S erotypes in R at at O ne M onth P ost Injection A t otal of 4x1010vg of rAAV2, rAAV5, rAAV7, rAAV8, or rAAV9, each in 30l 1x D PBS, was injected into the left ventricular cavity of 5 day old SD rat pups (3 animals for each AAV serotype) in order t o analyze the transducing capacity and tissu e tropism

PAGE 76

76 of these viral serotypes in vivo Three control animals received an equivalent volume of 1x DPBS. One month post injection, animals were sacrificed to evaluate GFP transduction and gene expression using fl uorescence microscopy and real time RT PCR. As shown in Fig ures 4 a and summarized in 4 b rAAV9 produced the highest level of cardiac transduction of the GFP gene. In contrast, rAAV2 provided a high level gene transfer in the rat liver, while transduction c apacity elicited by the other rAAV serotypes was significantly lower (Fig ures 4 a and 4c). Transgene mRNA expression in the heart and liver (Figure 4d) corresponded with the histological results ( Fig ure 4 a, b and c) GFP expression in the l ung and kidney wa s barely detect able as tested by Real time RT PCR (Fig ure 4d). Evaluation of I n V ivo G ene T ransfer by rAAV S erotypes in R at at T wo M onths P ost Injection To determine if rAAV9 would continue to provide a high level of cardiac specific gene transfer, rats were treated with the same doses of rAAV vectors as described above (3 animals per AAV serotype), and sacrificed at two months post viral injection The rAAV9 serotype continued to provide highly efficient, global transgene expression to the rat heart (Fig ur es 5 a 5b, and 5d), while expression was significantly lower with the other AAV serotypes. The transgene expression level in the liver was minimal for all other serotypes (Figure 5a and 5c ), while rAAV2 serotype still provided some level of transduction (Fig ures 5 a 5c and 5d) in the liver. Transgene expression in the lungs and kidney was still barely detectable (Figure 5d). Transgene expression in the rat heart (Fig ure 6 a ) and liver (Figure 6 b ) was not statistically different between one month and two mont hs post transduction, although there was a trend for an increase expression in the heart, and a decrease in expression in the liver, over time.

PAGE 77

77 Dose R esponse and B iodistribution of T ransgene E xpression F ollowing rAAV8 and rAAV9 Injection in R at Since rAAV8 and rAAV9 were the most cardiac selective rAAVs amongst the 5 serotypes used, we intracardially injected a higher dose ( 4x1011vg ) of rAAV8 and rAAV9 into 5 day old rat pups in order to determine the biodistribution of these two serotypes Rats were sacri ficed at 1 month of age and biodistribution analysis was performed to compare the extent of GFP expression in noncardiac tissues in the high dose group treated with rAAV8 and rAAV9. rAAV9 treatment elicited widespread gene transfer in rat hearts at both dose s, and GFP expression was much lower in the hearts of rats treated with rAAV8 (Fig ure 7). When the GFP positive cells in the rat hearts were checked under high magnification, these GFP cells exhibited cross striations, characteristic of cardiomyocytes (Figure 8a) A minimal number of GFP positive cells were detected in the liver, and expression was virtually absent in other tissues examined (Figure 8 b ) further suggesting that these serotypes, with our method of in vivo administration, is primarily cardioselective.

PAGE 78

78 Discussion The aim of the present study was to compare five serotypes of rAAV with respect to gene transfer efficiency and relative cardiac tropisms using both an in vitro approach and a relatively noninvasive in vivo approach (administering the rAAV into left cardiac ventricular cavity of rat neonatal pups) To our knowledge, we are the first group to perform comprehensive comparisons of rAAV9 with other serotypes using both an intracardiac viral administration in the rat and two in vitro ca rdiac cell types. The ultimate goal of this study is to develop a clinically relevant gene therapy approach for specifically targeting the heart with rAAV, without the use of a tissue specific promoter. In vitro screening of the rAAV serotype (pseudotype) that is most suitable for cardiac gene therapy is desirable It can allow for the subsequent studies detailing the molecular mechanism s responsible for tissue tropism of each r AAV serotype. Different serotypes of rAAV have their own distinct tissue tropism which is determined by whether the rAAV is able to enter cells and affect different intracellular molecular mechanisms. Viral receptors at the target cell surface play a key role in the transduction process since they represent the first biological barri er to be overcome during viral infection. For rAAV2, its transduction efficiency and tissue tropism are dependent on a primary receptor [ heparin sulfate progetoglycan] (Summerford and Samulski, 1998) (Summerford et al., 1999) and on co receptors [ integrin and human fibroblast growth factor receptor ] (Qing et al., 1999) (Summerford et al., 1999) rAAV5 utilize s a sialic acid (Kaludov et al., 2001) and platelet derived growth factor receptor (Di Pasquale et al., 2003) for cellular transduction. Lamini receptors may also m ediate the actions of rAAV2, 8, and 9 (Akache et al., 2006) The tropism and receptors used by rAAV7, 8 and 9 are unknown or not well understood. Based on our in vitro studies

PAGE 79

79 rAAV2, 5, 7, 8 and 9 are all capable of tr ansducing primary rat neonatal cardiac myocytes (RNCM), suggesting the RNCM may have receptors to bind to all five serotypes of rAAV. Both rAAV2 and rAAV9 mediate a significantly higher transgene expression in primary RNCM, compared to AAV5, 7 and 8. However, there is a distinct difference observed between cardiac fibroblasts and myocytes. O nly AAV2 efficiently transduced primary rat neonatal cardiac fibroblasts (RNCF). The fibroblast growth factor receptor in RNCF may provide AAV2 with the ability to transfect RNCF, in comparison to rAAV5, 7, 8 and 9. Although the data obtained in the current study can allow for further characterization of the intracellular mechanisms among the various serotypes of rAAV, it was not the primary goal of this investigation. W e were more focused on which of the various serotypes would be the most selective for subsequent gene delivery experiments to target genes for the cardiac myocytes. The r at models for study ing cardiac vascular diseases are well established in the literatur e, such as models of myocardial infarction induced by coronary artery ligation or aortic banding induced pressure overload cardiomyopathy. These models offer the opportunity to assess potentially therapeutic genes in established disease models. However, rodent cardiac tropism of rAAV serotypes has been mostly determined by comparing the effects of rAAV vectors in mice. Only few papers report comparing the cardiac tropisms of rAAV vectors in rats, by using intramyocardial injection (Palomeque et al., 2007) (Bish et al., 2008) or ex vivo perfusion (Miyagi et al., 2008) In rat hearts, it is extremely important to find out which rAAV serotype mediat es efficient cardiac tropic transgene expression by using a relative noninvasive route of administration However, based on the size of the animal, the rat model requires more viral vector to be delivered

PAGE 80

80 compared with the mouse model, in order to achieve a therapeutic level of transgene expression. Administration of a large amount of viral vector at one time could cause cytotoxicity due to nonspecific transgene expression in untargeted tissues or cells. Thus, t he use of a cardiac selective rAAV and a single injection of a small volume of rAAV into neonatal SD rats may be an answer for this dilemma, without having to develop a more tissue specific promoter Our in vivo results suggest that rAAV9 provides highly efficient and long lasting gene transfer to r at hearts following a single intracardiac inject ion of 30 l of rAAV into the left ventricular chamber of 5 day old SD rats. Both fluorescent and mRNA determination demonstrated that transgene (GFP) expression in the rat hearts was generally restricted to the heart, maintained for at least two months post viral administration and tended to increase with time. rAAV9 mediated the most efficient transgene expression in the rat heart, which is consistent with results found in mice after systemic vector admini stration (Vandendriessche et al., 2007) (Zincarelli et al., 2008) (Bish et al., 2008) (Pacak et al., 2006) (Inagaki et al., 2006) (Fechner et al., 2008) (Yang et al., 2009) and in the rat after direct intra myocardi al injection (Palomeque et al., 2007) (Bish et al., 2008) or after coronary artery ex vivo perfusion (Miyagi et al., 2008) or after intravenous injection (Suckau et al., 2009) Moreover, unlike intravenous administration of rAAV9 in mice (Inagaki et al., 2006) or in rats (Suckau et al., 2009) the rAAV9 in this current study produced very low GFP expression in the rat liver. Even when high dose of rAAV9 was administered, GFP expression was not substantially increased in the rat liver. GFP expression in the rat heart was widespread and increased compared to G FP expression at low dose administration. These results prove

PAGE 81

81 that our viral administration method selectively mediates widespread transgene expression in the rat heart and limits transduction in the rat liver or other organs. Furthermore; our viral admini stration method is simple and less damaging to the heart tissue, as it only required a single injection of small volume of viral vectors when compared to other methods. Also, the route of administration applied in the current paper does not require any ext ensive surgical maneuvers and could be viewed relatively noninvasive compared to coronary artery ex vivo perfusion (Miyagi et al., 2008) or multiple i ntramyocardial injections (Bish et al., 2008) For both rAAV8 and rAAV9, in vivo results show that GFP positive cells in the rat heart exhibit striations, a characteristic of cardiac myocytes. This shows consistency with the in vitro results, in which both rAAV8 and rAAV9 preferably transduce rat neonatal cardiac myocytes, without any transduction in the cardiac fibroblast. rAAV9 mediated more efficient GFP expression than rAAV8 with same titer of viral vector. Different ability to transduce cardiac myocytes may be attributed to differ ent receptor affinities on the cell membrane, differential viral internalization and nuclear uncoating (Sipo et al., 2007) F urther investigation is necessary to determine whether the rAAV9 receptors and the molecular mechanisms beyond the receptor s are responsible for producing a cardiac selective transgene expression by rAAV9 rAAV2 mediated more efficient transgene expression in the liver than either rAAV5, 7, 8 or 9 However, rAAV2 was less efficient in transducing the heart tissue Our findings on the t ransduction ability of rAAV2, 7 and 9 in liver tissue were not consistent with the findings of other studies (Zincarelli et al., 2008) as rAAV7 and 9 have been reported to mediate more efficient transgene expression in the mouse liver than AAV2 after systemic

PAGE 82

82 administration. This disparity may be due to species differences or the different kind of promoter s used in the two studies Collectively, our results suggest that rAA V9 preferably transduces cardiac myocytes in vitro and efficiently transduces the rat cardiac myocytes in vivo and as such, may represent an important viral vector for cardiac gene therapy. rAAV9 appears to be the most cardiotropic serotype in the rat and may be used in investigations for cardiac gene therapy. These in vitro and in vivo studies suggest that systemic administration of rAVV9 would be selective for the heart, and more specific for the cardiac myocytes than the fibroblasts, and thus experiments targeting gene transfer to myocytes would be best attained by using rAAV9 over other serotypes. Cardiac selectivity of rAAV9 in the rodents can be further enhanced by retargeting the rAAV capsids (Li et al., 2008) or tra nscriptional and/or transductional targeting of vectors (Muller et al., 2007) (Muller et al., 2006) Figure 31 Immunostaining of Rat Neonatal Cardiac Myocytes (RNCM) with al phasarcomeric actin. Fluorescence micrographs showing alpha sarcomeric actin immunostaining in cultured RNCM (red fluorescence). Nuclei were counterstained with DAPI (blue fluorescence). a: RNCM at 10x magnification. Scale bar=100m. b: RNCM at 40x magnif ication. Scale bar=20m

PAGE 83

83 Figure 3 2 rAAVs mediated gene transfer into RNCM in vitro. RNCM were grown in tissue culture plates and incubated with 107vg of rAAV2, rAAV5, rAAV7, rAAV8 or rAAV9 for 72 hours. a: Representative phase and the corresponding f luorescence micrographs showing GFP fluorescence under each treatment condition. b: Level of GFP mRNA in the RNCM was quantified by Real time PCR and normalized to GAPDH mRNA. Bar graphs are means S.E.M., N = 4. # P<0.001 (rAAV2, 5, 7, 8 and 9 vs control); P < 0.05 and *** P <0.05 (rAAV2 and rAAV9 > rAAV5, rAAV7 and rAAV8); ** P < 0.05 (rAAV7 > rAAV5 and rAAV8).

PAGE 84

84 Figure 3 3 rAAVs mediated gene transfer into RNCF in vitro. RNCF were grown in tissue culture plates and incubated with 107vg of rAAV2, rAAV5, rAAV7, rAAV8 or rAAV9 for 72 hours. a: Representative phase and the corresponding fluorescence micrographs showing GFP fluorescence under each treatment condition. b: Level of GFP mRNA in the RNCF was quantified by Real time PCR and normalized to G APDH mRNA. Bar graphs are means S.E.M., N = 4. P < 0.05 (rAAV2 showed higher GFP level in RNCF than controls and other serotypes of rAAVs.)

PAGE 85

85 Figure 3 4 GFP expression in rat tissues at 1month post injection. a: Representative fluorescence microgr aphs of sections taken from rat heart (at 2x magnification scale bar =500m and 10x magnification scale bar = 100m) and liver (at 10x magnification, scale bar =100m) 1 month following intracardiac injection of 30l 1xDPBS containing 4x1010vg of rAAVCBAGFP of the indicated serotype. b: Quantification of the number of GFP positive cells from hearts following each treatment condition (Means SE ,N=3). P<0.001(rAAV9>rAAV2,rAAV5,rAAV7 and rAAV8) c: Quantification of the number of GFP positive cells from livers following each treatment condition (Means SE ,N=3). P<0.01(rAAV2> control, rAAV8 and rAAV9). d: Quantification of GFP mRNA expression level in the heart, liver, kidney and lung tissues at one month post transduction, normalized to GAPDH (Mean SE, N=3). *P<0.05 ( rAAV8 >rAAV2, and 7 but rAAV2, 5,7 and 8) ; *** P<0.001(rAAV2 >rAAV5, 7, 8 and 9).

PAGE 86

86 Figure 3 5 GFP expression in rat tissues at 2month post injection.a: Representative fluorescence micrographs of secti ons taken from rat heart (at 2x magnification scale bar:500m and 10x magnification scale bar: 100m) and liver (at 10x magnification, scale bar: 100m) 2 month following intracardiac injection of 30l 1xDPBS containing 4x1010vg of rAAVCBAGFP of the indi cated serotype. b: Quantification of the number of GFP positive cells from hearts following each treatment condition (Means SE ,N=3). P<0.001(rAAV9>control, rAAV2, 5,7 and 8), ** P<0.01 (rAAV8> control, rAAV2 and rAAV5, control, rAAV5,7, 8 and 9). d: Quantification of GFP mRNA expression level in the heart, liver, kidney and lung at 2 month post transduction ,normalized to GAPDH (Mean SE, N=3). *P<0.05(rAAV8 >rAAV2 and 5, but rAAV2,5,7 and 8). *** P<0.05(rAAV2>rAAV5,7,8 and 9.)

PAGE 87

87 Figure 3 6 Quantitative analyses of GFP mRNA expression in rat tissues.a: Comparison of GFP mRNA expre ssion level in the heart between one month and two months post injection. The GFP level in the heart is not statistically different between one month and two months. b: Comparison of GFP gene level in the liver between one month and two months post injecti on. The GFP level in the liver is not statistically different between one month and two months.

PAGE 88

88 Figure 3 7 Dose responses of transgene expression following rAAV8 and rAAV9 transduction. GFP expression in rat hearts was examined at one month post inje ction of 4x1010 vg (low dose) or 4x1011 vg (high dose) of rAAV8or rAAV9 CBAGFP.Scale bar: 500m. Images were taken at 2x magnification and merged using Photoshop11.0. The upper row shows GFP expression in rat hearts following rAAV8 injection. The Lower row shows GFP expression in rat hearts following rAAV9 injection.

PAGE 89

89 Figure 3 8 Biodistribution of transgene expression following rAAV8 and rAAV9 transduction. a: GFP expression in rat cardiac myocytes was examined at one month after intracardiacly adm inistrating high dose of rAAV8 or rAAV9. Representative images were taken at high magnification. Scale bar: 50m. b: GFP expression in heart, liver, kidney, lung and skeletal muscle were examined at one month post intracardiac injection of 4x1011 vg (high dose) of either rAAV8 or rAAV9. First and third rows are images taken in Bright Field and the second and fourth rows are corresponding fluorescence micrographs. Each column represents one type of tissue. rAAV8High ( high dose) is shown in the first and se cond rows and rAAV9High( high dose) in the third and fourth rows. Scale bar: 50m.

PAGE 90

90 CHAPTER 4 CARDIACSELECTIVE OVEREXPRESSION OF ANGIOTENSIN TYPE 2 RECEPTOR IMPROVES CARDIAC FUNCTION AND ATTENUATES LEFT VENTRICULAR REMODELING Abstract OBJECTIVES: The aim of this study was to examine the effect of cardiac selective overexpression angiotensin type 2 receptor ( AT2R ) on left ventricular (LV) dysfunction and remodeling in a rat coronary artery ligation (CAL) model. BACKGROUND: Myocardial ischemia can result in significant myocardial damage, including myocyte death, fibrosis, and wall thinning, leading to impaired ventricular function and cardiac failure. The reninangiotensin system (RAS) plays an important role in cardiac remodeling post myocardial infarcti on. METHODS: Both prevention and reversal studies were performed. For the prevention study, 4x1010 vector genome (vg) of rAAV9CBAAT2R was injected into the left ventricle chamber of the heart in 5day old rats. Six weeks after viral administration, the left anterior descending coronary arteries were ligated. For the reversal study, 4x1010 vg of rAAV9 CBAAT2R was administrated to the periphery of the infracted myocardium area immediately after coronary artery ligation (CAL) surgery. In both studies, hem odynamic measurements were performed via echocardiography and intracardiac catheter 4 weeks after CAL surgery for Control (n=6), MI (n=6), rAAV9GFP (n=3), MI+rAAV9 AT2R (prevention, n=4) and MI+rAAV9AT2R (reversal, n=4) groups. Cardiac tissues were analy zed for inflammation and cardiac remodeling markers with real time reverse transcription PCR. RESULTS: Myocardial infarction resulted in a significant decrease in ejection fraction, deterioration of left ventricular systolic pressure, dp/dt, and increase in left

PAGE 91

91 ventricular end diastolic pressure (LVEDP) and ventricular hypertrophy. Overexpression of AT2R attenuated this impairment to a nonsignificant level, markedly illustrated by a significant reduction in LVEDP and ventricular hypertrophy. O verexpressi on of AT2R also prevent ed my ocardial wall thinning and tended to decrease the infarction area. Furthermore, myocardial infarction caused a an upregulation of AT1R, TGF, ACE, Collagen I and Collagen III mRNA expression. The AT2R overexpression prevented these changes and also upregulated the other speculated cardiac protective factor Mas receptors and Bradykinin B2 receptor levels. CONCLUSIONS: Cardiac selective overexpression of AT2R exerts beneficial effects on the heart function post myocardial infarction by preserving cardiac function and attenuating cardiac remodeling post MI. The protective effects of AT2R may be attributed to its antihypertrophic and antifibrotic effects. Introduction Myocardial infarction (MI), commonly known as a heart attack occurs when the blood supply to a part of the hear t is interrupted. The resulting ischemia causes irreversible damage to the heart tissue (Williams and Benjamin, 2000) The damage after myocardial infarction res ults in left ventricular (LV) remodeling, representing by molecular, cellular and interstitial changes. LV remodeling is manifested as adverse alterations in the size, shape and function of the ventricle, often leading to left ventricular dysfunction, dilated cardiomyopathy and heart failure (Tiyyagura and Pinney, 2006) (Pfeffer and Braunwald, 1990) Evidence shows that the adverse alteration in the heart after a MI is assoc iated with a marked increase in cardiovascular morbidity and mortality (Anavekar and Solomon, 2005)

PAGE 92

92 Growing evidence implies that the Renin Angiotensin System (RAS) contributes to the progression of myocardial infarction. It is well documented that angiotensin II (AngII) plays a critical role in the development of post MI LV remodeling (Anavekar and Solomon, 2005) AngII has two major receptor subtypes, type 1 (AT1R) and type 2 receptors (AT2R), both of which are expressed in the heart (Ozono et al., 2000) and play a crucial role in cardiovascular physiology and disease. Numerous experimental findings have demonstrated that the AT2R is upregulated under pathological conditions like heart failure (Tsutsumi et al., 1998) (Regitz Zagrosek et al., 1995) AT1R signaling contributes to the deterioration of M I by mediating vasoconstriction, cardiomyocyte hypertrophy, fibroblast proliferation, and interstitial collagen deposition (Matsubara, 1998) (Weber and Brilla, 1991) In contrast, the AT2R is generally thought to exert an opposing effect to AT1R in the cardiovascular system. It is also suggested that part of protective effects of Angiotensin receptor blockers (ARBs) are possibly mediated through AT2R (Matsubara, 1998) since unbounded AngII stimulates AT2R. However, some investigators have reported that the AT2R may cause hypertrophy (D'Amore et al., 2005) dilated cardiomyopathy and heart failure in transgenic mice (Yan et al., 2003) and chronic AT2R expression depresses myocardial contractility in TG mice with overexpression of AT2R (Nakayama et al., 2005) Therefore the effects of the AT2R on cardiac remodeling is controversial and yet to be resolved. This study intends to help clarify the functions of AT2R post MI in protecting the heart from further damage and restoring part of cardiac function. To date, there are no published reports studying effects of AT2R in myocardial infarction model with the use of viral vectors.

PAGE 93

93 The present study was designed to determine whether cardiac selective over expression of AT2R prevents cardiac dysfunction in rat myocardial infarction m odel, and to evaluate potential cardioprotective mechanisms modulated by AT2R Materails and Methods Characterization of rAAV9 GFP and rAAV9AT2R V iral V ectors Production and characterization and rAAV9GFP and rAAV9 AT2R were performed according to same methods, as described in methods section in chapter 3. Coronary A rtery L igation Myocardial infarction was induced by ligation of the left anterior descending coronary artery. At the time of operation, rats were anesthetized with isoflurane (2.0 2.5% in ox ygen), after which rats were intubated with an 18gauge intravenous catheter and mechanically ventilated with this isofluraneoxygen mixture using a Harvard ventilator (model 683, Harvard Apparatus, Holliston, Mass). After the chest was cleaned and shaved, rats were underwent a left lateral thoracotomy. The thorax was entered via the left fourth intercostal space and the pericardium incised to expose the heart. The heart was exposed, and ligated at the proximal left anterior descending coronary artery 2 3 m m from its origin between the pulmonary artery conus and the left atrium with a 7 0 polypropylene suture. Successful cessation of blood flow was indicated by elevation of ST segment on electrocardiogram and cyanosis of anterior LV wall; if necessary the pr ocedure was repeated by placement of a second or third ligature. The heart was returned to its normal position, and the thorax was evacuated of fluid and air and closed. All of the animals received buprenorphine hydrochloride (Buprenex, 0.02 mg/kg q12 IM Reckitt and Colman Pharmaceuticals) and were closely monitored for signs of discomfort. Sham operated rats underwent the identical surgical procedure as

PAGE 94

94 described above except that the suture was not tightened around the coronary artery. In the present study, the operationrelated mortality was approximately 25% 24 h after operation. rAAV9 GFP and rAAV9 AT2R Administration All of the animal protocols were approved by the institutional animal care and use committee (IACUC) and conducted according to National Institutes of Health guidelines. For the reversal study, 4x1010 vg of rAAV9 vectors in 100 L 1x DPBS was injected into multiple sites of myocardium around infarct area immediately after coronary artery ligation surgery using a 0.5 ml insulin syringe, before the chest cavity was sutured closed. For the prevention study, f ive day old male SpragueDawley rats received a single intraventricular injection of 4 x1010 vector genome of rAAV 9 GFP or rAAV9 AT2R viral vectors in 30 L 1x DPBS, as described in chapter 3. This method of gene transfer by rAAV vector provides a 100% animal survival rate and has been established to produce efficient cardiac selective and longterm transduction of the heart. After viral administration, animals were returned to their mothers until weaning. At 6 weeks of age, rats were separated into 4 experimental groups (control sham, MI, rAAV9 GFP and MI+ rAAVAT2R ; N=4 7 per group) and subjected to either coronary artery ligation surgery or mock surgery. Echocardiography Cardiac function was evaluated using a Hewlett Packard Sonos Model 5500 with a 12Hz transducer at 4 weeks after coronary artery ligation surgery. Rats were anesthet ized with isofluorane for echocardiographic examinations. Images were

PAGE 95

95 obtained from the parasternal short axis. All measurements were based on the average of three consecutive cardiac cycles. Measurements obtained by echocardiography include left ventricul ar end diastolic diameter (LVED), left ventricular end systolic diameter (LVES ) and l eft ventricular posterior wall thickness (LVPW) The ejection fraction was calculated as follows: (LVED vLVESv)/LVED v x 1/100. Hemodynamic Measurements Rats were anesthet ized with ketamine/xylazine/ acepromazine rodent cocktail ( 3 0 mg/ 6 mg /1mg /kg, i.m.). The rats were placed in supine position and the body temperature was maintained at 37 oC by a heated pad throughout the experiment. The left ventricular function was measu red using a 22 Gauge needle filled with heparin saline (20 IU/ml) inserted into the left ventricle chamber. The data was recorded after stabilization of the tracing using a liquid pressure transducer, which was interfaced to a PowerLab (ADInstruments, Colorado Springs, CO, USA) signal transduction unit. Data were analyzed by using the Chart program that was supplied with the PowerLab system.The parameters include a peak systolic pressure of left ventricle (LVSP), a maximal positive and negative rate of rise in left ventricular pressure (LVdP/dtmax), HR, and mean artery pressure (MAP). Histological Analysis Following the hemodynamic measurement, the hearts were harvested. Hearts were removed, and the ventricles were separated from atria and rinsed in PBS. The ventricles were weighed and cut into 3 thick sections made perpendicular to the long axis. The basal and apex section was snap frozen in liquid nitrogen and stored at 80C to do westernblot analysis and Quantitative Real time PCR. The middle section was used to measure infarct size and cardiac remodeling parameters. Cardiac remodeling

PAGE 96

96 was determined by ventricular hypertrophy and cardiac fibrosis. Ventricular hypertrophy was determined by measuring wet weights of rat heart ventricles normalized to tibia l length. Cardiac hypertrophy can be more accurately quanified by relative heart weight to tibial length than to body weight as tibial length is a reliable reference to normalize heart weight in conditions in which body weight changes (Yin et al., 1982) Cross sections of the ventricles were then fixed in 10% neutral buffered formalin, embedded in paraffin, sectioned at 4 m. Ventricular sections were stained with H & E (hematoxylin and eosin) to determine myocyte diameter or with Picro Sirius Red to mesure interstitial fibrosis. Myocyte diameter was determined at 40x magnification, using the ImageJ program from National Institutes of Health as previously described (Grobe et al., 2007c) 20 separate images from different (nonoverlapping) regions of the left ventricle free wall only were examined. Left ventricular (LV) wall thickness was examined using ImageJ program too. Quantification of myocyte diameters and left ventricular wall t hickness were carried out by an individual who was blinded to the treatments. Quantification mRNA L evels Tissues was homogenized and total RNA was isolated using RNAquous 4 polymerase chain reaction (PCR) kit (Ambion, Foster City, CA, USA) according to the manufacturer's instructions. 200ng RNA was reverse transcribed with iScript cDNA Synthesis kit (Bio Rad, Hercules, CA, USA). The AT1R, AT2R, Collagen I, Collagen III, TGFbeta, TNFalpha, BKRB2, ACE2, ACE, IL 10 and IL6 were analyzed by quantitative real time PCR using Taqman probe (Applied Biosystems). Real time PCR was run using ABI Prism 7000 sequence detection system. All cDNA samples were assayed in triplicate. Data were normalized to GAPDH RNA.

PAGE 97

97 Statistical Analysis Results are expressed as meanSE Data were analyzed by ANOVA with Bonferroni correction for multiple comparisons. Values of P<0.05 were considered statistically significant. All of the data were analyzed using GraphPad Prism 5 software (Graphpad Prism Institute Inc). Results rAAV9 M ediated C ardiacS elective O verexpression of AT2R in R at H earts For the reversal and prevention studies, left anterior descending coronary artery ligation (CAL) was performed on 6 week age rat s. Myocardial infarction was confirmed by the ST segement elevation as determined by electrocardiogram (ECG), and a representing tracing is shown in Figure 4 1. rAAV9 AT2R mediated overexpression of AT2R was determined by semi quantitative Realtime PCR. AT2R expression level was significantly increased in both the reversal study and prevention study, but the AT2R level in the reversal study was lower than the prevention study (Figure 42). Effects of AT2R O verexpression on C ardiac F unction Post MI Echocardiographic analyses were performed at 4 weeks post myocardial infarct ion surgery. Myocardial infarction caused a significant reduction in e jection f raction in the MI group relative to the control and rAAV9 GFP AT2R overexpression was able to restore e jection f raction, as shown in Figure 4 3. M inimum dp/dt was significantly decrea sed in MI group, relative to other groups (Table 41). Left ventricular end diastolic pressure was significantly increased in the MI group compared to control and rAAV9 GFP (Table 4 1). In both the reversal and prevention studies, overexpression of AT2R was able to attenuate these changes ( Table 4 1). Heart rate was not significantly different among

PAGE 98

98 groups ( Table 4 1) although there was a tendency for the MI group to display a higher heart rate. Effects of AT2R O verexpression on V entricular R emodeli ng P ost MI AT2R overexpression mediated by rAAV9 attenuated MI induced cardiac hypertrophy as evaluated by both the ventricular weight to tibial length ratio and measurement of myocyt e diameter, as shown in Figure 44. MI induced significantly decrease in the left ventricular wall thickness. AT2R overexpression significantly attenuated left ventricular wall thinning caused by myocardial infarction. AT2R overexpression also tended to decrease infarction area and significantly attenuated the thining of the ve ntricular wall as shown in Figure 4 5. AT2R mediated P rot ective Mechanism P ost MI To determine the mechanism of cardioprotection by AT2R overexpression, the left ventricular tissue was har vested and measured the levels of genes involving in t he RAS and c ardiac remodeling. As show n in Table 4 2, there was a significant increase in levels of compon ents of the ACEAng IIAT1R axis e.g. upregulation of ACE and AT1R in the MI group. Additionally, in the MI group, TGF beta, Collagen I, and Collagen III level we re also upregulated. Overexpression of AT2R was able to decrease these changes. Overexpression of AT2R also induced an upregulation of Bradykinin B2 receptor and Mas receptor level s. AT2R mediated protection post myocardial infarction is associated with restoration of the balance in the RAS and a decrease in mediators of cardiac fibrosis. It is of interest to note that these positive effects of AT2R overexpression were similar whether the overexpression of the transgene occurred in the neonatal animals well before CAL or immediately after the CAL procedure.

PAGE 99

99 Discussion In the present study, the effects of cardiac selective overexpression of AT2R mediated by rAAV9 vector on the cardiac function and ventricular remodeling were examined in a rat coronary artery ligation model. We found that cardiac selective overexpression of AT2R provides significant protection against left ventricular dysfunction caused by myocardial infarction, as shown b y a preserved ejection fraction and dp/ dt, and a reduction in left ventr icular end diastolic pressure back towards control values Moreover, ventricular hypertrophy and wall thinning was attenuated by cardiac selective overexpression of AT2R The majority of the myocardial infarction studies performed with either AT2R knockout animals or transgenic overexpressions of AT2R in animals demonstrated that AT2R has antihypertrophic effects, or mediates part of the protective effects of AT1R antagonists. Yet, several investigators reported that transgenic overexpression of AT2R in car diomyocytes in vivo resulted in enhanced hypertrophy and dilated cardiomyopathy. Part of these discrepancies may be due to both compensatory mechanisms in vivo and difficulty in controlling expression level of trans gene in the transgenic AT2R knockout or overexpression mouse model. We have recently reported (chapter 3 data) that use of rAAV9 to transduce our transgene, results in significant and selective transduction into the heart during the time course reported in the current study. Unfortunately we di d not assess the time course for incorporation of the transgene for the reversal study. Previous reports suggest that transgene expression can occur as early as 1 day after the direct intracardiac injection (Su et al., 2006) and as long as 1 year after after the intracardiac injection by a transdiaphragmatic approach (Woo et al., 2005b) Thus in the current study we have demonstrated that, in contrast to transgenic

PAGE 100

100 models of AT2R over/ under expression, selective delivery of AT2R in vivo by rAAV9 viral vector may avoid some of the potential discrepancies reported in the literature, and may be a better tool for investigating the more precise role s of AT2R in LV cardiac remodeling that occ urs after MI. It is also not established how AT2R mediates its protective effects. Most of the studies have been done on transgenic animals in which the AT2R has already been overexpressed at birth before myocardial infarction and as the AT2R has been implicated in the developmental process, does this early overexpression lead to yet to be determined compensatory changes that cloud the interpretation of the findings It is intriguing to investigate whether AT2R mediated effects are working through preventi ng and/or reversing the adverse remodeling process. AT2R is re expressed and/or upregulated under pathophysiological conditions such as MI (Nio et al., 1995) and mechanical injury (Tiyyagura and Pinney, 2006) This re expression of AT2R may act to offset the trophic/proliferative effects of Ang II via AT1R (Stroth and Unger, 1999) Numerous experimental findings demonstrate that an increase in cardiac AT2R in heart failure may provide beneficial effects in the heart. All these studies indicate that AT2R requires being upregulated in the heart following myocardial infarction. The endogenous level of upregulation of AT2R may not be adequate to exert any significant beneficial effects. This study used recombinant adeno associated viral vector serotype 9 to deliver AT2R into the myocardium. Our group has reported that administration of rAAV9 into rat heart mediates efficient and cardiac selective expression in the rats. The collected results demonstrate that an overexpression of AT2R in the heart, shortly after birth or immediately after the cardiac

PAGE 101

101 ischemic insult, does provide beneficial effects on cardiac function and structure. Yet to be determ ined is to what level of expression of AT2R is a threshold to mediate these changes or if any greater increases in receptor number would produce more pronounced protective effects. Angiotensin receptor blockers (ARBs) reduce cardiovascular mortality and mo rbidity in patients with heart failure after MI (Jugdutt and Menon, 2004) Selectively blockade of AT1R with ARBs results in an elevation of the levels of circulating AngII which can then stimula te the unopposed AT2 R. Thus, it is hypothesized that the beneficial effects of ARBs may be mediated at least in part, through AT2R activation. Furthermore, administration of ARB is associated with an upregulation of cardiac ACE2 and Ang(1 7) levels (Ishiyama et al., 2004a) (Trask and Ferrario, 2007) ACE2 and Ang (1 7) each have reported cardioprotecti ve effects against heart failure and cardiac hypertrophy C ardiac overexpression of ACE2 mediated by Lenti viral ve ctor preserved cardiac function and attenuated left ventricular wall thinning following myocardial infarction (Der Sarkissian et al., 2008) C hronic Ang(1 7) treatment not only attenuated the development of heart failure in the MI model (Ishiyama et al., 2004a) but also prevented cardiac hypertrophy and fibrosis in rats (Iwata et al., 2005) (Wang et al., 2005) (Grobe et al., 2007c) ACE2 activity or Ang (1 7) forming activity has been shown to be directly correlated with AT2R density (Zisman et al., 2003a) Also a s shown i n chapter 2, Ang(1 7) overexpression preserved cardiac function and upregulated both ACE2 and AT2 R expression, which provided evidence for the interaction among ACE2, Ang (1 7) and AT2R. Taken together, it is hypothesized that AT2R exerts its protective effects on the heart post MI through interacting with ACE2 Ang (1 7) Mas axis. In the

PAGE 102

102 current study, Mas receptor level was significantly upregulat ed. AT2R overexpression and also reduced the upregulated AT1R induced by myocardial inf arction, in both the prevention and reversal studies All these results support the hypothesis that AT2R exerts its protective effects on the heart following MI possibly through antagonizing ACEAngII AT1R and stimulating the ACE2 Ang (1 7) mas axis. In th e MI group, Collagen I, Collagen III, and TGFwere significantly increased in the heart tissure post myocardial infarction. Cardiac selective overexpression of AT2R prevents this increase and brings back towards control values I n cardiac hypertrophy and heart failure, expression of TGFin the myocardium is reported to be increased (Weber, 1997) This increase in TGFis consistent with the result from the current study. This increase in TGFpression may directly participate in the progressive remodeling process in heart failure. Treatment with ARBs also markedly decreased TGF(Ju et al., 1997) suggesting that TGFhe remodeling myocardium is in part mediated through AngII signaling. TGFremodeling, because of its important role in regulating fibrous tissue deposition, composition of the extracellular matrix, and cardiac hypertrophy (Lim and Zhu, 2006) Thus, it is possible that AT2R reduces LV cardiac remodeling post MI by interacting with TGFIn summary, our data demonstrate that overexpression of AT2R preserves cardiac function and attenuates cardiac remodeling post myocardial infarction. These beneficial effects involve restoration of the RAS balance and prevention of the upregulation of fibrotic factors (TGF Collagen I and Collagen III ) Taken together, all these studies

PAGE 103

103 indicate that targeting of the AT2R could hold novel therapeutic strategy in the treatment of myocardial infarction and its associated complications.

PAGE 104

104 Figure 4 1 Schematic representation of study protocol. ( a ) Illustra tion of the experimental protocol. For the preventative study, rAAV9AT2R was administered into left ventricular chamber of 5day age SD pups. Coronary artery ligation (CAL) was performed when SD rats were 6 weeks old. For the reversal study, rAAV9 AT2R wa s administrated onto the left ventricular myocardium around infarction area right after the CAL surgery. 4 weeks after the surgery, animals were subjected to echocardiography followed by hemodynamic heart function assessment and tissues harvest. ( b ) Repres entative electrocardiogram ( ECG) at basal showing normal tracing and showing an elevation in STsegment following CAL, as indicated by arrow.

PAGE 105

105 Figure 4 2 ( a ) Schematic representation of structural components of the rAAV9GFP or rAAV9 AT2R viral vector (b ) S emi quantitative Real Time RT PCR detection of AT2R mRNA level presented in heart tissues. (* p<0.05 MI+rAAV9AT2R(R) and MI+rAAV9 AT2R(P) vs control and rAAV9 GFP, ** p<0.05 MI+rAAV AT2R(P) vs MI+rAAV9 AT2R(R) ; N=4 6/group).

PAGE 106

106 Figure 4 3 Effect of AT2R gene transfer and myocardial infarction on ventricular function. Echocardiography analyses of rat myocardium 4 weeks after the CAL demonstrates significant improvement in ejection fraction in rAAV9AT2R treated animals as compared to MI group. (* MI vs. control, rAAV9GFP, MI+rAVV9 AT2R(R), and MI + rAAV9 AT2R(P) ; N=4 6/group).

PAGE 107

107 Table 41 H emodynamic data at 4 weeks post MI Control rAAV9 GFP MI MI+rAAV9 AT2R(R) MI+rAAV9 AT2R(P) LVSP 112.6 4.5 108.1 5.3 89.5 8.8 105.5 8.1 109.5 10.0 HR 279.9 18.0 324.3 20.4 359.2 28.8 333.4 54.6 353.4 48.6 dp/dt max 4194.0 179.1 3867.8 167.0 3220.5 486.6 3614.3 140.5 4398.9 168.9 dp/dt min 3765.3 204.4 3394.2 138.8 3023.3 19.3 3275.0 149 .9 3848.2 90.5 LVMP 41.2 2.8 45.2 2.2 45.2 2.1 51.9 0.8 47.1 3.4 LVEDP 4.0 1.5 1.6 1.1 12.5 2.7** 3.9 0.1 4.2 2.3 HR( heart rate), beats per minute; LVSP (left ventricular systolic pressure) millimeters of mercury; +dp/dt and d p/dt (maximal and minimal peak rate of left ventricular pressure), millimeters of mercury per second; LVMP(left ventricle mean pressure), millimeters of mercury; LVEDP(left ventricle end-diastolic pressure), millimeters of mercury. (* MI vs. contro, rAAV9 GFP and MI + rAAV9 -AT2R(P), ** MI vs all other groups ; N=4-6/group).

PAGE 108

108 Figure 44 Effect s of AT2R on ventricular hypertrophy. Overexpression of AT2R attenuates MI induced cardiac hypertrophy as evaluated by the ventricular weight(g) to tibia length(mm) ratio (A) and measurement of myocyte diameter (B). (* MI vs. control, rAAV9 GFP, MI+rAVV9 AT2R(R), and MI + rAAV9 AT2R(P) ; N=4 6/group).

PAGE 109

109 Figure 4 5 Effect of AT2R gene transfer on ventricular fibrosis and left ventricular wall thinning. (a ) Picro Sirius Red staining shows anterior wall thinning and collagen deposition in MI, MI+AT2R(R), and MI+AT2R(P) animals. ( b ) Quantification of the left ventricular wall thickness as a percentage of left ventricular wall thickness of control. MI significantly decreased left ventricular wall thickness. In both reversal and prevention studies, overexpression of AT2R attenuated the thinning of the left ventricul ar wall. MI, MI+rAAV9 AT2R(R), MI+rAAV9 AT2R(P) vs control and rAAV9GFP; # MI+rAAV9 AT2R(R) and MI+rAAV9 AT2R(P) vs MI N=4 6/group.

PAGE 110

110 Table 42 Quantitative Real Time PCR data Control (N=6) rAAV9 GFP (N=4) MI (N=6) MI+rAAV9 AT2R(R) (N=5) MI+rAAV9 AT2R(P) (N=4) AT1R 0.42 0. 16 0. 42 0. 08 1. 78 0.2 2 & 0. 63 0. 1 8 0.65 0. 1 7 TGF 0.47 0.15 0.29 0.08 1.19 0.23 & 0.70 0.08 0.43 0.04 ACE 1.19 0.35 1.31 0.19 3.00 0.36 & 1.15 0.22 1.23 0.15 COLI 0.22 0.10 0.13 0.06 1.31 0.39 & 0.53 0.15 0.44 0.04 COLIII 0.32 0.09 0.32 0.08 0.95 0.08 & 0.39 0.03 0.46 0.15 BKR 0.23 0.07 0.45 0.08 0.28 0.03 0.99 0.28 ** 1.16 0.08 ** ACE2 0.76 0.03 0.75 0.13 0.43 0.21 0.82 0.21 1.11 0.22 MAS 0.30 0.08 0.41 0.07 0.34 0.07 0.88 0.16 ** 1.03 0.23 ** & MI vs all other groups; ** MI+rAAV9AT2R(R) and MI+rAAV9 AT2R(P) vs control, rAVV9 GFP, and MI ; $ MI+rAAV9 AT2R(R) vs control ; # MI+rAAV9 AT2R(P) vs all other groups Data are depicted as mRNA fold changes relative to GAPDH mRNA calculated using the expre ssion 2^ and expressed as a mean fold change SEM.

PAGE 111

111 CHAPTER 5 OVERALL DISCUSSIONS AND CONCLUSIONS R esults presented here indicate that Ang (1 7) and AT2R play a cardioprotective role in cardiovascular diseases and the se components of the RAS may int eract with e ach other to contribute to the observed cardioprotective effects (1) Lentiviral mediated Ang (1 7) overexpression preserves cardiac function and prevents the development of cardiac hypertrophy in a rat myocardial infarction model (2) rAAV9 me diates efficient cardiac selective transgene expression in the rat heart compared to other recombinant adeno associated viral vectors. (3) rAAV9 AT2R viral vectors mediate cardiac selective AT2R overexpression in the heart when the viral vector were admini stered before CAL (prevention study) and at the time of CAL (the reversal study) Cardiac selective overexpression AT2R preserves cardiac function and prevents the development of cardiac remodeling in rat myocardial infarction model, for both the reversal study and the prevention study 1. Ang (1 7) Preserves Cardiac Function and Prevents Cardiac Remodeling The study p resented in Chapter 2 provides strong evidence that Ang (1 7) overexpression preserves the cardiac function and attenuates ventricular remodel ing in a rat model of coronary occlusion O verexpression of Ang(1 7) provides significant protection against left ventricular dysfunction caused by myocardial infarction, as shown by preserv ation of ejection fraction and rest oration of dp/ dt, and left ventricular end diastolic pressure. Moreover, ventricular hypertrophy and wall thinning tended to be attenuated by overexpression of Ang(1 7). Ang (1 7) overexpression appears to restore the balance between the ACEAngII AT1R axis and the ACE2 AngII Mas of the RAS, by preventing the upregulation of ACE and AT1R following the MI and increasing ACE2

PAGE 112

112 and Mas receptor expression that were downregulated by myocardial infarction. Ang (1 7) also resulted in an upregulation of the bradykinin B2 receptor in the hear t. The finding that Ang (1 7) treatment increased AT2R level in the rat neonatal cardiac myocyte cells after hypoxia exposure suggests evidence for possible interaction between ACE2, Ang(1 7), and AT2R. These observations parallel the association between ACE2 activity and AT2R levels in hearts of pulmonary hypertension patients reported by Zisman (2004). The possible pitfalls and future experiments for th e Ang (1 7) project 1) It is quite difficult to achieve therapeutic concentration by infusion Ang(1 7) peptide into the body; because of the short half life for Ang (1 7). Using viral vector to deliver Ang (1 7) can elevate Ang(1 7) level to reach therapeutic concentrations. It would be better to deliver the viral vector containing Ang (1 7) to patients at high risk of heart attack prior to the occurance of a heart attack. The ideal viral vector would mediate conditional and cardiac selective over expression of therapeutic gene. Lenti viral vector containing Ang(1 7) was the only availabe resource to use w hen I started this project. 2) A 779 is a potent and selective Ang(1 7) antagonist. A 779 antagoni zes several action of Ang(1 7) The cardioprotective effects of Ang(1 7) could be further confirmed by using its antagonist (A779) to block the protectiv e effects in the myocardial infarction model Two more groups should be added to this project: one group using only A779 and the other group using A779 and Lenti Ang (1 7) to overexpress Ang(1 7) at same time. 3) In the current project, possible mediators for the cardioprotective effects of Ang (1 7) are only examined by measuring changes in mRNA level. ACE2 activity and protein level for ACE2, Mas, AT1R, AT2R, and BKR should be examined to

PAGE 113

1 13 further confirm the changes observed by Realtime PCR. 4) Cardia c functions are examined by echocardiography and catheterization. Both of these two techniques have their drawbacks. Echocardiography is a noninvasive examination technique, but it requires experienced technician to perform and it has large marginal error for the examination of cardiac function. Catheterization is done by inserting a needle into left ventricle chamber to measure the pressure changes. It is an invasive method and t he needle puncture itself could induce changes in cardiac functions. Magnetic resonance imaging (MRI) is a noninvasive technique to examine the structure and function of the heart. MRI provides better spatial resolution than echocardiography 5) Ang (1 7) level in the serum and in the heart tissue are not measured. The future experiments will be designed to quantify the Ang(1 7) level in the heart tissues and serum by a comm ercially available ELISA kit 2 rAAV9 Mediated Cardiac Selective Transgene Expression In The Rat Heart The study presented in Chapter 3 provides strong evidence that rAAV9 produces the most selective and stable transduction efficiency in cardiac tissue, and this expression was primarily exhibited in the cardiac myocytes. This study was to compare five serotypes of rAAV with respect to gene transfer efficiency and relative cardiac tropisms using both an in vitro approach and a relatively noninvasive in vivo approach (administering the rAAV into left cardiac ventricular cavity of rat neonat al pups) The ultimate goal of this study was to develop a clinically relevant gene therapy approach for specifically targeting the heart with rAAV, without the use of a tissue specific promoter. The possible pitfalls and future experiments for th e rAAVs p roject

PAGE 114

114 1) The viral vector administration method in this project is relatively noninvasive. It requires experienced hands to perform the injection into the the heart. 2) In this rAAVs project, a time course study was not performed to determine when the vi ral vectors first start to mediate transgene expression and how long the transduction would last. Also, t ransduction efficiency in vivo was examined by histological methods after the animal were sacrificed. There is an in vivo live imaging system available at the University of Florida. Live imaging system could provide timecourse information for the viral vector transduction in the animals. 3. AT2R Preserves Cardiac Function and Attenuates Cardiac Remodeling In Chapter 3, rAAV9 was confirmed to mediate more cardiac selective transgene expression than rAAV2, 5, 7, and 8. Chapter 4 provided strong evidence that the cardiac selective overexpression AT2R mediated by rAAV9 vector can preserve cardiac function and attenuate ventricular remodeling in a rat coronary artery ligation model. Cardiac selective overexpression of AT2R provides significant protection against left ventricular dysfunction caused by myocardial infarction, as shown by preserving ejection fraction and dp/dt, and reducing left ventricular end diastolic pressure back to control level s. Moreover, ventricular hypertrophy and wall thinning tended to decreased with cardiac selective overexpression of AT2R. Overexpression of the AT2R significantly upregulated the bradykinin B2 receptor and Mas receptor level in both the prevention and reversal studies Overexpression of AT2R also prevented the MI induced gene upregulation, including AT1R, TGF, ACE, Collagen I, and C ollagen III. All these results support the hypothesis that AT2R exerts its protective effects on the

PAGE 115

115 heart following a MI, by antagonizing ACEAngII AT1R axis and by increasing the ACE2 Ang(1 7) Mas axis and restoring balance in the RAS. The possible pitfalls and future experiments for th e AT2R project 1) AT2R protein level was not examined by westernblot because there was no good and commercially available AT2R antibody to use Also the change in AT2R level s following myocar dial infarction was not examined in a time course manner. It has been reported that AT2R expression is upregulated following myocardial infarction. No one has performed any experiments to trace the change for AT2R expression; or h ow long the re expresssion or upregulation would last 2) The cardioprotective effects of AT2R could be further confirmed by using an AT2R selective antagonist ( PD123319). Two more groups should be added to this project: one group using only PD123319 and the other group using PD123319 and rAAV9 AT2R to overexpress AT2R at same time. 3) In the current project, possible mediators for the cardioprotective effects of AT2R were only examined by measuring changes in mRNA level. Cytokine levels, ACE2 activity and protein level for ACE2, Mas, AT1R, a nd BKR should be examined by ELISA, activity assay or westernblot to further confirm the changes observed by Realtime PCR. 4) Cardiac functions would be better evaluated by MRI as stated above. 4 ) The effects of AT2R overexpression in the rat neonatal cardiac myocytes (RNCM) were tested (data not shown in this chapter). Overexpression of AT2R mediated by adeno viral vector induced apotosis in RNCM. To study this AT2R induced apoptosis in RNCM, a range of AT2R expression (from low expression to high expression) in RNCM was done. Expression of AT2R at low level in RNCM did not induce apoptosis. But

PAGE 116

116 experiments desgined to test the protective effects of AT2R at low expression level in the hypoxic RNCM still needs to be determined.

PAGE 117

117 LIST OF REFERENCES Effect of ramipril on mortality and morbidity of survivors of acute myocardial infarction with clinical evidence of heart failure. The Acute Infarction Ramipril Efficacy (AIRE) Study Investigators. 1993. Lancet 342, 821828. Effect of e nalapril on survival in patients with reduced left ventricular ejection fractions and congestive heart failure. The SOLVD Investigators. 1991. N. Engl. J. Med. 325, 293302. Akache, B., Grimm, D., Pandey, K., Yant, S.R., Xu, H., Kay, M.A., 2006. The 37/67 kilodalton laminin receptor is a receptor for adenoassociated virus serotypes 8, 2, 3, and 9. J. Virol. 80, 98319836 doi: 10.1128/JVI.0087806. Alexander, L.D., Alagarsamy, S., Douglas, J.G., 2004. Cyclic stretch induced cPLA2 mediates ERK 1/2 signaling in rabbit proximal tubule cells. Kidney Int. 65, 551563 doi: 10.1111/j.15231755.2004.00405.x. Anavekar, N.S., Solomon, S.D., 2005. Angiotensin II receptor blockade and ventricular remodelling. J. Renin Angiotensin Aldosterone Syst. 6, 4348 doi: 10.3317/jraas.2005.006. Angelis, E., Tse, M.Y., Adams, M.A., Pang, S.C., 2006. Effect of AT2 blockade on cardiac hypertrophy as induced by high dietary salt in the proatrial natriuretic peptide (ANP) gene disrupted mouse. Can. J. Physiol. Pharmacol. 84, 625634 doi: 10.1139/y06016. Arruda, V.R., Stedman, H.H., Nichols, T.C., Haskins, M.E., Nicholson, M., Herzog, R.W., Couto, L.B., High, K.A., 2005. Regional intravascular delivery of AAV 2 F.IX to skeletal muscle achieves longterm correction of hemophilia B i n a large animal model. Blood 105, 34583464 doi: 10.1182/blood2004072908. Baker, K.M., Chernin, M.I., Schreiber, T., Sanghi, S., Haiderzaidi, S., Booz, G.W., Dostal, D.E., Kumar, R., 2004. Evidence of a novel intracrine mechanism in angiotensin IIind uced cardiac hypertrophy. Regul. Pept. 120, 513 doi: 10.1016/j.regpep.2004.04.004. Barber, M.N., Sampey, D.B., Widdop, R.E., 1999. AT(2) receptor stimulation enhances antihypertensive effect of AT(1) receptor antagonist in hypertensive rats. Hypertension 34, 11121116. Basso, N., Terragno, N.A., 2001. History about the discovery of the reninangiotensin system. Hypertension 38, 12461249.

PAGE 118

118 Bautista, R., Sanchez, A., Hernandez, J., Oyekan, A., Escalante, B., 2001. Angiotensin II type AT(2) receptor mRNA e xpression and renal vasodilatation are increased in renal failure. Hypertension 38, 669673. Bedecs, K., Elbaz, N., Sutren, M., Masson, M., Susini, C., Strosberg, A.D., Nahmias, C., 1997. Angiotensin II type 2 receptors mediate inhibition of mitogenactiv ated protein kinase cascade and functional activation of SHP 1 tyrosine phosphatase. Biochem. J. 325 ( Pt 2), 449454. Bekeredjian, R., Shohet, R.V., 2004. Cardiovascular gene therapy: angiogenesis and beyond. Am. J. Med. Sci. 327, 139148. Bish, L.T., Morine, K., Sleeper, M.M., Sanmiguel, J., Wu, D., Gao, G., Wilson, J.M., Sweeney, L., 2008. AAV9 Provides Global Cardiac Gene Transfer Superior to AAV1, AAV6, AAV7, and AAV8 in the Mouse and Rat. Hum. Gene Ther. doi: 10.1089/hgt.2008.123. Blais, C.,Jr, Lap ointe, N., Rouleau, J.L., Clement, R., Bachvarov, D.R., Adam, A., 2002. Effects of captopril and omapatrilat on early post myocardial infarction survival and cardiac hemodynamics in rats: interaction with cardiac cytokine expression. Can. J. Physiol. Pharm acol. 80, 4858. Bozkurt, B., Kribbs, S.B., Clubb, F.J.,Jr, Michael, L.H., Didenko, V.V., Hornsby, P.J., Seta, Y., Oral, H., Spinale, F.G., Mann, D.L., 1998. Pathophysiologically relevant concentrations of tumor necrosis factor alpha promote progressive l eft ventricular dysfunction and remodeling in rats. Circulation 97, 13821391. Brede, M., Roell, W., Ritter, O., Wiesmann, F., Jahns, R., Haase, A., Fleischmann, B.K., Hein, L., 2003. Cardiac hypertrophy is associated with decreased eNOS expression in angiotensin AT2 receptor deficient mice. Hypertension 42, 11771182 doi: 10.1161/01.HYP.0000100445.80029.8E. Brilla, C.G., Janicki, J.S., Weber, K.T., 1991. Impaired diastolic function and coronary reserve in genetic hypertension. Role of interstitial fibros is and medial thickening of intramyocardial coronary arteries. Circ. Res. 69, 107115. Brogelli, L., Parenti, A., Ledda, F., 2002. Inhibition of vascular smooth muscle cell growth by angiotensin type 2 receptor stimulation for in vitro organ culture model J. Cardiovasc. Pharmacol. 39, 739745. Bryant, D., Becker, L., Richardson, J., Shelton, J., Franco, F., Peshock, R., Thompson, M., Giroir, B., 1998. Cardiac failure in transgenic mice with myocardial expression of tumor necrosis factor alpha. Circulation 97, 13751381.

PAGE 119

119 Buisson, B., Bottari, S.P., de Gasparo, M., GalloPayet, N., Payet, M.D., 1992. The angiotensin AT2 receptor modulates Ttype calcium current in nondifferentiated NG10815 cells. FEBS Lett. 309, 161164. Bujak, M., Dobaczewski, M., Chat ila, K., Mendoza, L.H., Li, N., Reddy, A., Frangogiannis, N.G., 2008. Interleukin1 receptor type I signaling critically regulates infarct healing and cardiac remodeling. Am. J. Pathol. 173, 5767 doi: 10.2353/ajpath.2008.070974. Cardini, J.F., Santos, R.A., Martins, A.S., Machado, R.P., Alzamora, F., 1988. Site of entry of kininase II into renal tubular fluid. Hypertension 11, I668. Carey, R.M., Siragy, H.M., 2003. Newly recognized components of the reninangiotensin system: potential roles in cardiovas cular and renal regulation. Endocr. Rev. 24, 261271. Carey, R.M., Wang, Z.Q., Siragy, H.M., 2000. Role of the angiotensin type 2 receptor in the regulation of blood pressure and renal function. Hypertension 35, 155163. Castro, C.H., Santos, R.A., Ferre ira, A.J., Bader, M., Alenina, N., Almeida, A.P., 2006. Effects of genetic deletion of angiotensin(1 7) receptor Mas on cardiac function during ischemia/reperfusion in the isolated perfused mouse heart. Life Sci. 80, 264268 doi: 10.1016/j.lfs.2006.09.007. Castro, C.H., Santos, R.A., Ferreira, A.J., Bader, M., Alenina, N., Almeida, A.P., 2005. Evidence for a functional interaction of the angiotensin(1 7) receptor Mas with AT1 and AT2 receptors in the mouse heart. Hypertension 46, 937942 doi: 10.1161/01. HYP.0000175813.04375.8a. Chang, R.S., Lotti, V.J., 1991. Angiotensin receptor subtypes in rat, rabbit and monkey tissues: relative distribution and species dependency. Life Sci. 49, 14851490. Chu, D., Sullivan, C.C., Weitzman, M.D., Du, L., Wolf, P.L., Jamieson, S.W., Thistlethwaite, P.A., 2003. Direct comparison of efficiency and stability of gene transfer into the mammalian heart using adenoassociated virus versus adenovirus vectors. J. Thorac. Cardiovasc. Surg. 126, 671679. Cintron, G., Johnson, G. Francis, G., Cobb, F., Cohn, J.N., 1993. Prognostic significance of serial changes in left ventricular ejection fraction in patients with congestive heart failure. The V HeFT VA Cooperative Studies Group. Circulation 87, VI17 23. Clark, M.A., Tallant, E .A., Diz, D.I., 2001. Downregulation of the AT1A receptor by pharmacologic concentrations of Angiotensin(1 7). J. Cardiovasc. Pharmacol. 37, 437448.

PAGE 120

120 Cohn, J.N., Ferrari, R., Sharpe, N., 2000. Cardiac remodeling--concepts and clinical implications: a consensus paper from an international forum on cardiac remodeling. Behalf of an International Forum on Cardiac Remodeling. J. Am. Coll. Cardiol. 35, 569582. Cohn, J.N., Johnson, G., Ziesche, S., Cobb, F., Francis, G., Tristani, F., Smith, R., Dunkman, W.B., Loeb, H., Wong, M., 1991. A comparison of enalapril with hydralazineisosorbide dinitrate in the treatment of chronic congestive heart failure. N. Engl. J. Med. 325, 303310. Coleman, J.E., Huentelman, M.J., Kasparov, S., Metcalfe, B.L., Paton, J.F., Katovich, M.J., Semple Rowland, S.L., Raizada, M.K., 2003. Efficient largescale production and concentration of HIV 1 based lentiviral vectors for use in vivo. Physiol. Genomics 12, 221228 doi: 10.1152/physiolgenomics.00135.2002. D'Amore, A., Black, M.J., Thomas, W.G., 2005. The angiotensin II type 2 receptor causes constitutive growth of cardiomyocytes and does not antagonize angiotensin II type 1 receptor mediated hypertrophy. Hypertension 46, 13471354 doi: 10.1161/01.HYP.0000193504.51489.cf. de Gasparo, M., Catt, K.J., Inagami, T., Wright, J.W., Unger, T., 2000. International union of pharmacology. XXIII. The angiotensin II receptors. Pharmacol. Rev. 52, 415472. De Mello, W.C., 2004. Angiotensin (17) re establishes impulse conduction in cardiac muscl e during ischaemiareperfusion. The role of the sodium pump. J. Renin Angiotensin Aldosterone Syst. 5, 203208 doi: 10.3317/jraas.2004.041. Der Sarkissian, S., Grobe, J.L., Yuan, L., Narielwala, D.R., Walter, G.A., Katovich, M.J., Raizada, M.K., 2008. Car diac overexpression of angiotensin converting enzyme 2 protects the heart from ischemiainduced pathophysiology. Hypertension 51, 712718 doi: 10.1161/HYPERTENSIONAHA.107.100693. Deten, A., Holzl, A., Leicht, M., Barth, W., Zimmer, H.G., 2001. Changes in extracellular matrix and in transforming growth factor beta isoforms after coronary artery ligation in rats. J. Mol. Cell. Cardiol. 33, 11911207 doi: 10.1006/jmcc.2001.1383. Di Pasquale, G., Davidson, B.L., Stein, C.S., Martins, I., Scudiero, D., Monks, A., Chiorini, J.A., 2003. Identification of PDGFR as a receptor for AAV 5 transduction. Nat. Med. 9, 13061312 doi: 10.1038/nm929. Dimmeler, S., Rippmann, V., Weiland, U., Haendeler, J., Zeiher, A.M., 1997. Angiotensin II induces apoptosis of human endothelial cells. Protective effect of nitric oxide. Circ. Res. 81, 970976.

PAGE 121

121 Dobruch, J., Paczwa, P., Lon, S., Khosla, M.C., Szczepanska Sadowska, E., 2003. Hypotensive function of the brain angiotensin(1 7) in Sprague Dawley and renin transgenic rats. J. Phy siol. Pharmacol. 54, 371381. Donoghue, M., Hsieh, F., Baronas, E., Godbout, K., Gosselin, M., Stagliano, N., Donovan, M., Woolf, B., Robison, K., Jeyaseelan, R., Breitbart, R.E., Acton, S., 2000. A novel angiotensinconverting enzymerelated carboxypepti dase (ACE2) converts angiotensin I to angiotensin 19. Circ. Res. 87, E1 9. Du, L., Kido, M., Lee, D.V., Rabinowitz, J.E., Samulski, R.J., Jamieson, S.W., Weitzman, M.D., Thistlethwaite, P.A., 2004. Differential myocardial gene delivery by recombinant ser otype specific adenoassociated viral vectors. Mol. Ther. 10, 604608 doi: 10.1016/j.ymthe.2004.06.110. Duan, D., Yan, Z., Yue, Y., Ding, W., Engelhardt, J.F., 2001. Enhancement of muscle gene delivery with pseudotyped adenoassociated virus type 5 correl ates with myoblast differentiation. J. Virol. 75, 76627671 doi: 10.1128/JVI.75.16.76627671.2001. Dudley, D.T., Hubbell, S.E., Summerfelt, R.M., 1991. Characterization of angiotensin II (AT2) binding sites in R3T3 cells. Mol. Pharmacol. 40, 360367. Dul in, N.O., Alexander, L.D., Harwalkar, S., Falck, J.R., Douglas, J.G., 1998. Phospholipase A2mediated activation of mitogenactivated protein kinase by angiotensin II. Proc. Natl. Acad. Sci. U. S. A. 95, 80988102. Falcon, B.L., Stewart, J.M., Bourassa, E ., Katovich, M.J., Walter, G., Speth, R.C., Sumners, C., Raizada, M.K., 2004. Angiotensin II type 2 receptor gene transfer elicits cardioprotective effects in an angiotensin II infusion rat model of hypertension. Physiol. Genomics 19, 255261 doi: 10.1152/ physiolgenomics.00170.2004. Fechner, H., Sipo, I., Westermann, D., Pinkert, S., Wang, X., Suckau, L., Kurreck, J., Zeichhardt, H., Muller, O., Vetter, R., Erdmann, V., Tschope, C., Poller, W., 2008. Cardiac targeted RNA interference mediated by an AAV9 ve ctor improves cardiac function in coxsackievirus B3 cardiomyopathy. J. Mol. Med. 86, 987997 doi: 10.1007/s001090080363x. Ferrario, C.M., Jessup, J., Chappell, M.C., Averill, D.B., Brosnihan, K.B., Tallant, E.A., Diz, D.I., Gallagher, P.E., 2005. Effec t of angiotensinconverting enzyme inhibition and angiotensin II receptor blockers on cardiac angiotensinconverting enzyme 2. Circulation 111, 26052610 doi: 10.1161/CIRCULATIONAHA.104.510461. Ferrario, C.M., Chappell, M.C., Tallant, E.A., Brosnihan, K.B ., Diz, D.I., 1997. Counterregulatory actions of angiotensin(1 7). Hypertension 30, 535541.

PAGE 122

122 Ferreira, A.J., Jacoby, B.A., Araujo, C.A., Macedo, F.A., Silva, G.A., Almeida, A.P., Caliari, M.V., Santos, R.A., 2007. The nonpeptide angiotensin(1 7) receptor Mas agonist AVE 0991 attenuates heart failure induced by myocardial infarction. Am. J. Physiol. Heart Circ. Physiol. 292, H1113 9 doi: 10.1152/ajpheart.00828.2006. Ferreira, A.J., Santos, R.A., Almeida, A.P., 2001. Angiotensin(1 7): cardioprotective ef fect in myocardial ischemia/reperfusion. Hypertension 38, 665668. Ford, W.R., Clanachan, A.S., Jugdutt, B.I., 2000. Characterization of cardioprotection mediated by AT2 receptor antagonism after ischemiareperfusion in isolated working rat hearts. J. Car diovasc. Pharmacol. Ther. 5, 211221. FragaSilva, R.A., Pinheiro, S.V., Goncalves, A.C., Alenina, N., Bader, M., Santos, R.A., 2008. The antithrombotic effect of angiotensin(1 7) involves mas mediated NO release from platelets. Mol. Med. 14, 2835 doi: 10.2119/200700073.FragaSilva. Francis, G.S., Benedict, C., Johnstone, D.E., Kirlin, P.C., Nicklas, J., Liang, C.S., Kubo, S.H., Rudin Toretsky, E., Yusuf, S., 1990. Comparison of neuroendocrine activation in patients with left ventricular dysfunction wi th and without congestive heart failure. A substudy of the Studies of Left Ventricular Dysfunction (SOLVD). Circulation 82, 17241729. Frangogiannis, N.G., Mendoza, L.H., Lindsey, M.L., Ballantyne, C.M., Michael, L.H., Smith, C.W., Entman, M.L., 2000. IL 10 is induced in the reperfused myocardium and may modulate the reaction to injury. J. Immunol. 165, 27982808. Frantz, S., Hu, K., Adamek, A., Wolf, J., Sallam, A., Maier, S.K., Lonning, S., Ling, H., Ertl, G., Bauersachs, J., 2008. Transforming growth f actor beta inhibition increases mortality and left ventricular dilatation after myocardial infarction. Basic Res. Cardiol. 103, 485492 doi: 10.1007/s0039500807397. Gallinat, S., Busche, S., Schutze, S., Kronke, M., Unger, T., 1999. AT2 receptor stimul ation induces generation of ceramides in PC12W cells. FEBS Lett. 443, 7579. Gallinat, S., Yu, M., Dorst, A., Unger, T., Herdegen, T., 1998. Sciatic nerve transection evokes lasting upregulation of angiotensin AT2 and AT1 receptor mRNA in adult rat dorsa l root ganglia and sciatic nerves. Brain Res. Mol. Brain Res. 57, 111122. Giani, J.F., Gironacci, M.M., Munoz, M.C., Pena, C., Turyn, D., Dominici, F.P., 2007. Angiotensin(1 7) stimulates the phosphorylation of JAK2, IRS 1 and Akt in rat heart in vivo: role of the AT1 and Mas receptors. Am. J. Physiol. Heart Circ. Physiol. 293, H115463 doi: 10.1152/ajpheart.01395.2006. Gironacci, M.M., Coba, M.P., Pena, C., 1999. Angiotensin (1 7) binds at the type 1 angiotensin II receptors in rat renal cortex. Regul. Pept. 84, 5154.

PAGE 123

123 Gohlke, P., Pees, C., Unger, T., 1998. AT2 receptor stimulation increases aortic cyclic GMP in SHRSP by a kinin dependent mechanism. Hypertension 31, 349355. Grady, E.F., Sechi, L.A., Griffin, C.A., Schambelan, M., Kalinyak, J.E., 1991 Expression of AT2 receptors in the developing rat fetus. J. Clin. Invest. 88, 921933 doi: 10.1172/JCI115395. Granger, C.B., McMurray, J.J., Yusuf, S., Held, P., Michelson, E.L., Olofsson, B., Ostergren, J., Pfeffer, M.A., Swedberg, K., CHARM Investigators and Committees, 2003. Effects of candesartan in patients with chronic heart failure and reduced left ventricular systolic function intolerant to angiotensinconvertingenzyme inhibitors: the CHARM Alternative trial. Lancet 362, 772776 doi: 10.1016/S01 40 6736(03)142845. Greenberg, B., Quinones, M.A., Koilpillai, C., Limacher, M., Shindler, D., Benedict, C., Shelton, B., 1995. Effects of longterm enalapril therapy on cardiac structure and function in patients with left ventricular dysfunction. Results of the SOLVD echocardiography substudy. Circulation 91, 25732581. Grobe, J.L., Der Sarkissian, S., Stewart, J.M., Meszaros, J.G., Raizada, M.K., Katovich, M.J., 2007a. ACE2 overexpression inhibits hypoxiainduced collagen production by cardiac fibroblas ts. Clin. Sci. (Lond) 113, 357364 doi: 10.1042/CS20070160. Grobe, J.L., Mecca, A.P., Lingis, M., Shenoy, V., Bolton, T.A., Machado, J.M., Speth, R.C., Raizada, M.K., Katovich, M.J., 2007b. Prevention of angiotensin II induced cardiac remodeling by angiot ensin(1 7). Am. J. Physiol. Heart Circ. Physiol. 292, H73642 doi: 10.1152/ajpheart.00937.2006. Grobe, J.L., Mecca, A.P., Lingis, M., Shenoy, V., Bolton, T.A., Machado, J.M., Speth, R.C., Raizada, M.K., Katovich, M.J., 2007c. Prevention of angiotensin II induced cardiac remodeling by angiotensin(1 7). Am. J. Physiol. Heart Circ. Physiol. 292, H73642 doi: 10.1152/ajpheart.00937.2006. Grobe, J.L., Mecca, A.P., Mao, H., Katovich, M.J., 2006. Chronic angiotensin(1 7) prevents cardiac fibrosis in DOCA salt model of hypertension. Am. J. Physiol. Heart Circ. Physiol. 290, H241723 doi: 10.1152/ajpheart.01170.2005. Guillen, I., Blanes, M., Gomez Lechon, M.J., Castell, J.V., 1995. Cytokine signaling during myocardial infarction: sequential appearance of IL1 beta and IL6. Am. J. Physiol. 269, R22935. Haller, H., Lindschau, C., Erdmann, B., Quass, P., Luft, F.C., 1996. Effects of intracellular angiotensin II in vascular smooth muscle cells. Circ. Res. 79, 765772. Han, R.O., Ray, P.E., Baughman, K.L., Feldman, A.M., 1991. Detection of interleukin and interleukinreceptor mRNA in human heart by polymerase chain reaction. Biochem. Biophys. Res. Commun. 181, 520523.

PAGE 124

124 Hasdai, D., Scheinowitz, M., Leibovitz, E., Sclarovsky, S., Eldar, M., Barak, V., 1996. Increas ed serum concentrations of interleukin1 beta in patients with coronary artery disease. Heart 76, 2428. He, J., Ogden, L.G., Bazzano, L.A., Vupputuri, S., Loria, C., Whelton, P.K., 2001. Risk factors for congestive heart failure in US men and women: NHAN ES I epidemiologic followup study. Arch. Intern. Med. 161, 9961002. Hein, L., Barsh, G.S., Pratt, R.E., Dzau, V.J., Kobilka, B.K., 1995. Behavioural and cardiovascular effects of disrupting the angiotensin II type2 receptor in mice. Nature 377, 744747 doi: 10.1038/377744a0. Hoffmann, A., Cool, D.R., 2003. Angiotensin II receptor types 1A, 1B, and 2 in murine neuroblastoma Neuro2a cells. J. Recept. Signal Transduct. Res. 23, 111121 doi: 10.1081/RRS 120018764. Horiuchi, M., Akishita, M., Dzau, V.J., 1999. Recent progress in angiotensin II type 2 receptor research in the cardiovascular system. Hypertension 33, 613621. Huang, X.C., Richards, E.M., Sumners, C., 1996. Mitogenactivated protein kinases in rat brain neuronal cultures are activated by angi otensin II type 1 receptors and inhibited by angiotensin II type 2 receptors. J. Biol. Chem. 271, 1563515641. Ichihara, A., Hayashi, M., Hirota, N., Okada, H., Koura, Y., Tada, Y., Kaneshiro, Y., Tsuganezawa, H., Saruta, T., 2003. Angiotensin II type 2 r eceptor inhibits prorenin processing in juxtaglomerular cells. Hypertens. Res. 26, 915921. Ichiki, T., Labosky, P.A., Shiota, C., Okuyama, S., Imagawa, Y., Fogo, A., Niimura, F., Ichikawa, I., Hogan, B.L., Inagami, T., 1995. Effects on blood pressure and exploratory behaviour of mice lacking angiotensin II type2 receptor. Nature 377, 748750 doi: 10.1038/377748a0. Inagaki, K., Fuess, S., Storm, T.A., Gibson, G.A., Mctiernan, C.F., Kay, M.A., Nakai, H., 2006. Robust systemic transduction with AAV9 vector s in mice: efficient global cardiac gene transfer superior to that of AAV8. Mol. Ther. 14, 4553 doi: 10.1016/j.ymthe.2006.03.014. Ishiyama, Y., Gallagher, P.E., Averill, D.B., Tallant, E.A., Brosnihan, K.B., Ferrario, C.M., 2004a. Upregulation of angiotensinconverting enzyme 2 after myocardial infarction by blockade of angiotensin II receptors. Hypertension 43, 970976 doi: 10.1161/01.HYP.0000124667.34652.1a. Ishiyama, Y., Gallagher, P.E., Averill, D.B., Tallant, E.A., Brosnihan, K.B., Ferrario, C.M., 2 004b. Upregulation of angiotensinconverting enzyme 2 after myocardial infarction by blockade of angiotensin II receptors. Hypertension 43, 970976 doi: 10.1161/01.HYP.0000124667.34652.1a.

PAGE 125

125 Iusuf, D., Henning, R.H., van Gilst, W.H., Roks, A.J., 2008. Angio tensin(1 7): pharmacological properties and pharmacotherapeutic perspectives. Eur. J. Pharmacol. 585, 303312 doi: 10.1016/j.ejphar.2008.02.090. Iwata, M., Cowling, R.T., Gurantz, D., Moore, C., Zhang, S., Yuan, J.X., Greenberg, B.H., 2005. Angiotensin( 1 7) binds to specific receptors on cardiac fibroblasts to initiate antifibrotic and antitrophic effects. Am. J. Physiol. Heart Circ. Physiol. 289, H235663 doi: 10.1152/ajpheart.00317.2005. Jaiswal, N., Tallant, E.A., Jaiswal, R.K., Diz, D.I., Ferrario, C.M., 1993. Differential regulation of prostaglandin synthesis by angiotensin peptides in porcine aortic smooth muscle cells: subtypes of angiotensin receptors involved. J. Pharmacol. Exp. Ther. 265, 664673. Jaiswal, N., Diz, D.I., Chappell, M.C., Khosla M.C., Ferrario, C.M., 1992. Stimulation of endothelial cell prostaglandin production by angiotensin peptides. Characterization of receptors. Hypertension 19, II4955. Jalil, J.E., Janicki, J.S., Pick, R., Weber, K.T., 1991. Coronary vascular remodeling and myocardial fibrosis in the rat with renovascular hypertension. Response to captopril. Am. J. Hypertens. 4, 5155. Ju, H., Zhao, S., Jassal, D.S., Dixon, I.M., 1997. Effect of AT1 receptor blockade on cardiac collagen remodeling after myocardial infarc tion. Cardiovasc. Res. 35, 223232. Jugdutt, B.I., Menon, V., 2004. AT1 receptor blockade limits myocardial injury and upregulates AT2 receptors during reperfused myocardial infarction. Mol. Cell. Biochem. 260, 111118. Kaludov, N., Brown, K.E., Walters, R.W., Zabner, J., Chiorini, J.A., 2001. Adenoassociated virus serotype 4 (AAV4) and AAV5 both require sialic acid binding for hemagglutination and efficient transduction but differ in sialic acid linkage specificity. J. Virol. 75, 68846893 doi: 10.1128/ JVI.75.15.68846893.2001. Kaschina, E., Grzesiak, A., Li, J., Foryst Ludwig, A., Timm, M., Rompe, F., Sommerfeld, M., Kemnitz, U.R., Curato, C., Namsolleck, P., Tschope, C., Hallberg, A., Alterman, M., Hucko, T., Paetsch, I., Dietrich, T., Schnackenburg, B., Graf, K., Dahlof, B., Kintscher, U., Unger, T., Steckelings, U.M., 2008. Angiotensin II type 2 receptor stimulation: a novel option of therapeutic interference with the reninangiotensin system in myocardial infarction? Circulation 118, 25232532 doi: 10.1161/CIRCULATIONAHA.108.784868. Katada, J., Meguro, T., Saito, H., Ohashi, A., Anzai, T., Ogawa, S., Yoshikawa, T., 2005. Persistent cardiac aldosterone synthesis in angiotensin II type 1A receptor knockout mice after myocardial infarction. Circulation 111, 21572164 doi: 10.1161/01.CIR.0000163562.82134.8E.

PAGE 126

126 Keidar, S., Kaplan, M., Gamliel Lazarovich, A., 2007. ACE2 of the heart: From angiotensin I to angiotensin (17). Cardiovasc. Res. 73, 463469 doi: 10.1016/j.cardiores.2006.09.006. Kono, T., Taniguchi, A., Imura, H., Oseko, F., Khosla, M.C., 1986. Biological activities of angiotensin II (1 6) hexapeptide and angiotensin II (1 7) heptapeptide in man. Life Sci. 38, 15151519. Konstam, M.A., Kronenberg, M.W., Rousseau, M.F., Udelson, J.E., Melin, J., Stewart, D., Dolan, N., Edens, T.R., Ahn, S., Kinan, D., 1993. Effects of the angiotensin converting enzyme inhibitor enalapril on the longterm progression of left ventricular dilatation in patients with asymptomatic systolic dysfunction. SOLVD (Studies of Left Ventricular Dysfunction) Investigators. Circulation 88, 22772283. Konstam, M.A., Rousseau, M.F., Kronenberg, M.W., Udelson, J.E., Melin, J., Stewart, D., Dolan, N., Edens, T.R., Ahn, S., Kinan, D., 1992. Effects of the angiotensin converting enzym e inhibitor enalapril on the longterm progression of left ventricular dysfunction in patients with heart failure. SOLVD Investigators. Circulation 86, 431438. Kubota, T., McTiernan, C.F., Frye, C.S., Slawson, S.E., Lemster, B.H., Koretsky, A.P., Demetri s, A.J., Feldman, A.M., 1997. Dilated cardiomyopathy in transgenic mice with cardiac specific overexpression of tumor necrosis factor alpha. Circ. Res. 81, 627635. Kucharewicz, I., Pawlak, R., Matys, T., Pawlak, D., Buczko, W., 2002. Antithrombotic effec t of captopril and losartan is mediated by angiotensin(1 7). Hypertension 40, 774779. Kurisu, S., Ozono, R., Oshima, T., Kambe, M., Ishida, T., Sugino, H., Matsuura, H., Chayama, K., Teranishi, Y., Iba, O., Amano, K., Matsubara, H., 2003. Cardiac angiot ensin II type 2 receptor activates the kinin/NO system and inhibits fibrosis. Hypertension 41, 99107. Kuwahara, F., Kai, H., Tokuda, K., Kai, M., Takeshita, A., Egashira, K., Imaizumi, T., 2002. Transforming growth factor beta function blocking prevents myocardial fibrosis and diastolic dysfunction in pressureoverloaded rats. Circulation 106, 130135. Lacraz, S., Nicod, L.P., Chicheportiche, R., Welgus, H.G., Dayer, J.M., 1995. IL10 inhibits metalloproteinase and stimulates TIMP 1 production in human m ononuclear phagocytes. J. Clin. Invest. 96, 23042310 doi: 10.1172/JCI118286. Lai, Z.C., Rushton, E., Bate, M., Rubin, G.M., 1993. Loss of function of the Drosophila zfh 1 gene results in abnormal development of mesodermally derived tissues. Proc. Natl. Acad. Sci. U. S. A. 90, 41224126. le Tran, Y., Forster, C., 1997. Angiotensin(1 7) and the rat aorta: modulation by the endothelium. J. Cardiovasc. Pharmacol. 30, 676682.

PAGE 127

127 Lefer, A.M., Ma, X.L., Weyrich, A.S., Scalia, R., 1993. Mechanism of the cardiopr otective effect of transforming growth factor beta 1 in feline myocardial ischemia and reperfusion. Proc. Natl. Acad. Sci. U. S. A. 90, 10181022. Lefer, A.M., Tsao, P., Aoki, N., Palladino, M.A.,Jr, 1990. Mediation of cardioprotection by transforming growth factor beta. Science 249, 6164. Lehtonen, J.Y., Horiuchi, M., Daviet, L., Akishita, M., Dzau, V.J., 1999. Activation of the de novo biosynthesis of sphingolipids mediates angiotensin II type 2 receptor induced apoptosis. J. Biol. Chem. 274, 1690116906. Leung, P.S., 2007. The physiology of a local reninangiotensin system in the pancreas. J. Physiol. 580, 3137 doi: 10.1113/jphysiol.2006.126193. Levy, D., Garrison, R.J., Savage, D.D., Kannel, W.B., Castelli, W.P., 1990. Prognostic implications of ec hocardiographically determined left ventricular mass in the Framingham Heart Study. N. Engl. J. Med. 322, 15611566. Li, H., Gao, Y., Grobe, J.L., Raizada, M.K., Katovich, M.J., Sumners, C., 2007. Potentiation of the antihypertensive action of losartan by peripheral overexpression of the ANG II type 2 receptor. Am. J. Physiol. Heart Circ. Physiol. 292, H72735 doi: 10.1152/ajpheart.00938.2006. Li, W., Asokan, A., Wu, Z., Van Dyke, T., DiPrimio, N., Johnson, J.S., Govindaswamy, L., AgbandjeMcKenna, M., Leichtle, S., Redmond, D.E.,Jr, McCown, T.J., Petermann, K.B., Sharpless, N.E., Samulski, R.J., 2008. Engineering and selection of shuffled AAV genomes: a new strategy for producing targeted biological nanoparticles. Mol. Ther. 16, 12521260 doi: 10.1038/mt. 2008.100. Lim, H., Zhu, Y.Z., 2006. Role of transforming growth factor beta in the progression of heart failure. Cell Mol. Life Sci. 63, 25842596 doi: 10.1007/s0001800660858. Lloyd Jones, D., Adams, R., Carnethon, M., De Simone, G., Ferguson, T.B., Flegal, K., Ford, E., Furie, K., Go, A., Greenlund, K., Haase, N., Hailpern, S., Ho, M., Howard, V., Kissela, B., Kittner, S., Lackland, D., Lisabeth, L., Marelli, A., McDermott, M., Meigs, J., Mozaffarian, D., Nichol, G., O'Donnell, C., Roger, V., Rosamond, W., Sacco, R., Sorlie, P., Stafford, R., Steinberger, J., Thom, T., Wasserthiel Smoller, S., Wong, N., Wylie Rosett, J., Hong, Y., American Heart Association Statistics Committee and Stroke Statistics Subcommittee, 2009. Heart disease and stroke statisti cs--2009 update: a report from the American Heart Association Statistics Committee and Stroke Statistics Subcommittee. Circulation 119, 480486 doi: 10.1161/CIRCULATIONAHA.108.191259. Loot, A.E., Roks, A.J., Henning, R.H., Tio, R.A., Suurmeijer, A.J., Boo msma, F., van Gilst, W.H., 2002. Angiotensin(1 7) attenuates the development of heart failure after myocardial infarction in rats. Circulation 105, 15481550.

PAGE 128

128 Maggioni, A.P., Anand, I., Gottlieb, S.O., Latini, R., Tognoni, G., Cohn, J.N., Val HeFT Invest igators (Valsartan Heart Failure Trial), 2002. Effects of valsartan on morbidity and mortality in patients with heart failure not receiving angiotensinconverting enzyme inhibitors. J. Am. Coll. Cardiol. 40, 14141421. Markkanen, J.E., Rissanen, T.T., Kiv ela, A., Yla Herttuala, S., 2005. Growth factor induced therapeutic angiogenesis and arteriogenesis in the heart --gene therapy. Cardiovasc. Res. 65, 656664 doi: 10.1016/j.cardiores.2004.10.030. Matrougui, K., Loufrani, L., Heymes, C., Levy, B.I., Henrion, D., 1999. Activation of AT(2) receptors by endogenous angiotensin II is involved in flow induced dilation in rat resistance arteries. Hypertension 34, 659665. Matsubara, H., 1998. Pathophysiological role of angiotensin II type 2 receptor in cardiovascular and renal diseases. Circ. Res. 83, 11821191. McKay, R.G., Pfeffer, M.A., Pasternak, R.C., Markis, J.E., Come, P.C., Nakao, S., Alderman, J.D., Ferguson, J.J., Safian, R.D., Grossman, W., 1986. Left ventricular remodeling after myocardial infarction: a corollary to infarct expansion. Circulation 74, 693702. McMullen, J.R., Gibson, K.J., Lumbers, E.R., Burrell, J.H., Wu, J., 1999. Interactions between AT1 and AT2 receptors in uterine arteries from pregnant ewes. Eur. J. Pharmacol. 378, 195202. Mercu re, C., Yogi, A., Callera, G.E., Aranha, A.B., Bader, M., Ferreira, A.J., Santos, R.A., Walther, T., Touyz, R.M., Reudelhuber, T.L., 2008. Angiotensin(17) blunts hypertensive cardiac remodeling by a direct effect on the heart. Circ. Res. 103, 13191326 doi: 10.1161/CIRCRESAHA.108.184911. Metcalfe, B.L., Huentelman, M.J., Parilak, L.D., Taylor, D.G., Katovich, M.J., Knot, H.J., Sumners, C., Raizada, M.K., 2004a. Prevention of cardiac hypertrophy by angiotensin II type2 receptor gene transfer. Hypertension 43, 12331238 doi: 10.1161/01.HYP.0000127563.14064.FD. Metcalfe, B.L., Huentelman, M.J., Parilak, L.D., Taylor, D.G., Katovich, M.J., Knot, H.J., Sumners, C., Raizada, M.K., 2004b. Prevention of cardiac hypertrophy by angiotensin II type2 receptor gene transfer. Hypertension 43, 12331238 doi: 10.1161/01.HYP.0000127563.14064.FD. Metra, M., Nodari, S., Parrinello, G., Giubbini, R., Manca, C., Dei Cas, L., 2003. Marked improvement in left ventricular ejection fraction during longterm beta blockade in pat ients with chronic heart failure: clinical correlates and prognostic significance. Am. Heart J. 145, 292299 doi: 10.1067/mhj.2003.105.

PAGE 129

129 Miyagi, N., Rao, V.P., Ricci, D., Du, Z., Byrne, G.W., Bailey, K.R., Nakai, H., Russell, S.J., McGregor, C.G., 2008. Efficient and durable gene transfer to transplanted heart using adenoassociated virus 9 vector. J. Heart Lung Transplant. 27, 554560 doi: 10.1016/j.healun.2008.01.025. Moores, C.A., Hekmat Nejad, M., Sakowicz, R., Milligan, R.A., 2003. Regulation of KinI kinesin ATPase activity by binding to the microtubule lattice. J. Cell Biol. 163, 963971 doi: 10.1083/jcb.200304034. Muller, O.J., Katus, H.A., Bekeredjian, R., 2007. Targeting the heart with gene therapy optimized gene delivery methods. Cardiovasc. Res. 73, 453462 doi: 10.1016/j.cardiores.2006.09.021. Muller, O.J., Leuchs, B., Pleger, S.T., Grimm, D., Franz, W.M., Katus, H.A., Kleinschmidt, J.A., 2006. Improved cardiac gene transfer by transcriptional and transductional targeting of adenoassociated viral vectors. Cardiovasc. Res. 70, 7078 doi: 10.1016/j.cardiores.2005.12.017. Muthalif, M.M., Benter, I.F., Uddin, M.R., Harper, J.L., Malik, K.U., 1998. Signal transduction mechanisms involved in angiotensin(1 7) stimulated arachidonic acid release and prostanoid synthesis in rabbit aortic smooth muscle cells. J. Pharmacol. Exp. Ther. 284, 388398. Nakayama, M., Yan, X., Price, R.L., Borg, T.K., Ito, K., Sanbe, A., Robbins, J., Lorell, B.H., 2005. Chronic ventricular myocytespecific overexpression of angiotensin II type 2 receptor results in intrinsic myocyte contractile dysfunction. Am. J. Physiol. Heart Circ. Physiol. 288, H31727 doi: 10.1152/ajpheart.00957.2003. Neves, L.A., Santos, R.A., Khosla, M.C., Milsted, A., 2000. Angiotensin(1 7) regulates the levels of angiotensin II receptor subtype AT1 mRNA differentially in a strainspecific fashion. Regul. Pept. 95, 99107. Nio, Y., Matsubara, H., Murasawa, S., Kanasaki, M., Inada, M., 1995. Regulation of gene transcription of angiotensin II receptor subtypes in myocardial infarction. J. Clin. Invest. 95, 4654 doi: 10.1172/JCI117675. Ohkubo, N., Matsubara, H., Nozawa, Y., Mori, Y., Murasawa, S., Kijima, K., Maruyama, K., Masaki, H., Tsutumi, Y., Shibazaki, Y., Iwasaka, T., Inada, M., 1997. Angiotensin type 2 receptors are reexpressed by cardiac fibroblasts from failing myopathic hamster hearts and inhibit cell growth and fibrillar collagen metabolism. Circulation 96, 39543962. Oishi, Y., Ozono, R., Yano, Y., Teranishi, Y., Akishita, M., Horiuchi, M., Oshima, T., Kambe, M., 2003. Cardioprotective role of AT2 receptor in postinfarction left ventricular remodeling. Hypertension 41, 814 818 doi: 10.1161/01.HYP.0000048340.53100.43.

PAGE 130

130 Ozono, R., Matsumoto, T., Shingu, T., Oshima, T., Teranishi, Y., Kambe, M ., Matsuura, H., Kajiyama, G., Wang, Z.Q., Moore, A.F., Carey, R.M., 2000. Expression and localization of angiotensin subtype receptor proteins in the hypertensive rat heart. Am. J. Physiol. Regul. Integr. Comp. Physiol. 278, R7819. Ozono, R., Wang, Z.Q. Moore, A.F., Inagami, T., Siragy, H.M., Carey, R.M., 1997. Expression of the subtype 2 angiotensin (AT2) receptor protein in rat kidney. Hypertension 30, 12381246. Pacak, C.A., Mah, C.S., Thattaliyath, B.D., Conlon, T.J., Lewis, M.A., Cloutier, D.E., Z olotukhin, I., Tarantal, A.F., Byrne, B.J., 2006. Recombinant adeno associated virus serotype 9 leads to preferential cardiac transduction in vivo. Circ. Res. 99, e39 doi: 10.1161/01.RES.0000237661.18885.f6. Palomeque, J., Chemaly, E.R., Colosi, P., Wellman, J.A., Zhou, S., Del Monte, F., Hajjar, R.J., 2007. Efficiency of eight different AAV serotypes in transducing rat myocardium in vivo. Gene Ther. 14, 989997 doi: 10.1038/sj.gt.3302895. Patten, R.D., Udelson, J.E., Konstam, M.A., 1998. Ventricular remodeling and its prevention in the treatment of heart failure. Curr. Opin. Cardiol. 13, 162167. Paul, M., Poyan Mehr, A., Kreutz, R., 2006. Physiology of local reninangiotensin systems. Physiol. Rev. 86, 747803 doi: 10.1152/physrev.00036.2005. Pfeffer, J.M., Pfeffer, M.A., Braunwald, E., 1985. Influence of chronic captopril therapy on the infarcted left ventricle of the rat. Circ. Res. 57, 8495. Pfeffer, M.A., Braunwald, E., 1990. Ventricular remodeling after myocardial infarction. Experimental observ ations and clinical implications. Circulation 81, 11611172. Phillips, M.I., Schmidt Ott, K.M., 1999. The Discovery of Renin 100 Years Ago. News Physiol. Sci. 14, 271 274. Pinheiro, S.V., Simoes e Silva, A.C., Sampaio, W.O., de Paula, R.D., Mendes, E.P., Bontempo, E.D., Pesquero, J.B., Walther, T., Alenina, N., Bader, M., Bleich, M., Santos, R.A., 2004. Nonpeptide AVE 0991 is an angiotensin(1 7) receptor Mas agonist in the mouse kidney. Hypertension 44, 490496 doi: 10.1161/01.HYP.0000141438.64887.42. Q i, Y., Liu, X., Li, H., Shenoy, V., Li, Q., Hauswirth, W.W., Sumners, C., Katovich, M.J., 2009. Selective tropism of the recombinant adenoassociated virus 9 serotype for rat cardiac tissue. J. Gene Med. doi: 10.1002/jgm.1404. Qing, K., Mah, C., Hansen, J ., Zhou, S., Dwarki, V., Srivastava, A., 1999. Human fibroblast growth factor receptor 1 is a co receptor for infection by adenoassociated virus 2. Nat. Med. 5, 7177 doi: 10.1038/4758.

PAGE 131

131 Re, R.N., Cook, J.L., 2006. The intracrine hypothesis: an update. Regul. Pept. 133, 19 doi: 10.1016/j.regpep.2005.09.012. Regitz Zagrosek, V., Friedel, N., Heymann, A., Bauer, P., Neuss, M., Rolfs, A., Steffen, C., Hildebrandt, A., Hetzer, R., Fleck, E., 1995. Regulation, chamber localization, and subtype distribution of angiotensin II receptors in human hearts. Circulation 91, 14611471. Reudelhuber, T.L., 2006. A place in our hearts for the lowly angiotensin 17 peptide? Hypertension 47, 811815 doi: 10.1161/01.HYP.0000209020.69734.73. Rice, G.I., Thomas, D.A., Grant, P.J., Turner, A.J., Hooper, N.M., 2004. Evaluation of angiotensin converting enzyme (ACE), its homologue ACE2 and neprilysin in angiotensin peptide metabolism. Biochem. J. 383, 4551 doi: 10.1042/BJ20040634. Rodgers, K.E., Ellefson, D.D., Espinoza, T., H su, Y.H., diZerega, G.S., Mehrian Shai, R., 2006. Expression of intracellular filament, collagen, and collagenase genes in diabetic and normal skin after injury. Wound Repair Regen. 14, 298305 doi: 10.1111/j.17436109.2006.00124.x. Roks, A.J., Nijholt, J ., van Buiten, A., van Gilst, W.H., de Zeeuw, D., Henning, R.H., 2004. Low sodium diet inhibits the local counter regulator effect of angiotensin(1 7) on angiotensin II. J. Hypertens. 22, 23552361. Romano, G., 2005. Current development of adenoassociat ed viral vectors. Drug News. Perspect. 18, 311316 doi: 10.1358/dnp.2005.18.5.917326. Rosamond, W., Flegal, K., Friday, G., Furie, K., Go, A., Greenlund, K., Haase, N., Ho, M., Howard, V., Kissela, B., Kittner, S., Lloyd Jones, D., McDermott, M., Meigs, J ., Moy, C., Nichol, G., O'Donnell, C.J., Roger, V., Rumsfeld, J., Sorlie, P., Steinberger, J., Thom, T., Wasserthiel Smoller, S., Hong, Y., American Heart Association Statistics Committee and Stroke Statistics Subcommittee, 2007. Heart disease and stroke statistics --2007 update: a report from the American Heart Association Statistics Committee and Stroke Statistics Subcommittee. Circulation 115, e69171 doi: 10.1161/CIRCULATIONAHA.106.179918. Rosenkranz, S., 2004. TGFbeta1 and angiotensin networking in ca rdiac remodeling. Cardiovasc. Res. 63, 423432 doi: 10.1016/j.cardiores.2004.04.030. Rowe, B.P., Saylor, D.L., Speth, R.C., Absher, D.R., 1995. Angiotensin(1 7) binding at angiotensin II receptors in the rat brain. Regul. Pept. 56, 139146. Sadoshima, J ., Xu, Y., Slayter, H.S., Izumo, S., 1993. Autocrine release of angiotensin II mediates stretch induced hypertrophy of cardiac myocytes in vitro. Cell 75, 977984.

PAGE 132

132 Sampaio, W.O., Nascimento, A.A., Santos, R.A., 2003. Systemic and regional hemodynamic effects of angiotensin(1 7) in rats. Am. J. Physiol. Heart Circ. Physiol. 284, H198594 doi: 10.1152/ajpheart.01145.2002. Santos, R.A., Castro, C.H., Gava, E., Pinheiro, S.V., Almeida, A.P., Paula, R.D., Cruz, J.S., Ramos, A.S., Rosa, K.T., Irigoyen, M.C., B ader, M., Alenina, N., Kitten, G.T., Ferreira, A.J., 2006. Impairment of in vitro and in vivo heart function in angiotensin(1 7) receptor MAS knockout mice. Hypertension 47, 9961002 doi: 10.1161/01.HYP.0000215289.51180.5c. Santos, R.A., Ferreira, A.J., Nadu, A.P., Braga, A.N., de Almeida, A.P., CampagnoleSantos, M.J., Baltatu, O., Iliescu, R., Reudelhuber, T.L., Bader, M., 2004. Expression of an angiotensin(1 7) producing fusion protein produces cardioprotective effects in rats. Physiol. Genomics 17, 292299 doi: 10.1152/physiolgenomics.00227.2003. Santos, R.A., Simoes e Silva, A.C., Maric, C., Silva, D.M., Machado, R.P., de Buhr, I., Heringer Walther, S., Pinheiro, S.V., Lopes, M.T., Bader, M., Mendes, E.P., Lemos, V.S., CampagnoleSantos, M.J., Schul theiss, H.P., Speth, R., Walther, T., 2003. Angiotensin(1 7) is an endogenous ligand for the G proteincoupled receptor Mas. Proc. Natl. Acad. Sci. U. S. A. 100, 8258 8263 doi: 10.1073/pnas.1432869100. Santos, R.A., CampagnoleSantos, M.J., Andrade, S.P. 2000. Angiotensin(1 7): an update. Regul. Pept. 91, 4562. Santos, R.A., CampagnoleSantos, M.J., Baracho, N.C., Fontes, M.A., Silva, L.C., Neves, L.A., Oliveira, D.R., Caligiorne, S.M., Rodrigues, A.R., Gropen Junior, C., 1994. Characterization of a new angiotensin antagonist selective for angiotensin(1 7): evidence that the actions of angiotensin(1 7) are mediated by specific angiotensin receptors. Brain Res. Bull. 35, 293298. Santos, R.A., Brosnihan, K.B., Jacobsen, D.W., DiCorleto, P.E., Ferrari o, C.M., 1992. Production of angiotensin(1 7) by human vascular endothelium. Hypertension 19, II5661. Schiavone, M.T., Santos, R.A., Brosnihan, K.B., Khosla, M.C., Ferrario, C.M., 1988. Release of vasopressin from the rat hypothalamoneurohypophysial sy stem by angiotensin (1 7) heptapeptide. Proc. Natl. Acad. Sci. U. S. A. 85, 40954098. Schmaier, A.H., 2003. The kallikreinkinin and the reninangiotensin systems have a multilayered interaction. Am. J. Physiol. Regul. Integr. Comp. Physiol. 285, R113 doi: 10.1152/ajpregu.00535.2002. Schuijt, M.P., Basdew, M., van Veghel, R., de Vries, R., Saxena, P.R., Schoemaker, R.G., Danser, A.H., 2001. AT(2) receptor mediated vasodilation in the heart: effect of myocardial infarction. Am. J. Physiol. Heart Circ. Ph ysiol. 281, H25906.

PAGE 133

133 Seghaye, M., Duchateau, J., Bruniaux, J., Demontoux, S., Bosson, C., Serraf, A., Lecronier, G., Mokhfi, E., Planche, C., 1996. Interleukin10 release related to cardiopulmonary bypass in infants undergoing cardiac operations. J. Thorac. Cardiovasc. Surg. 111, 545553. Semple, P.F., Boyd, A.S., Dawes, P.M., Morton, J.J., 1976a. Angiotensin II and its heptapeptide (28), hexapeptide (38), and pentapeptide (48) metabolites in arterial and venous blood of man. Circ. Res. 39, 671678. S emple, P.F., Brown, J.J., Lever, A.F., MacGregor, J., Morton, J.J., Powell Jackson, J.D., Robertson, J.I., 1976b. Renin, angiotensin II and III in acute renal failure: note on the measurement of of angiotensin II and III in rat blood. Kidney Int. Suppl. 6, S16976. Semple, P.F., Morton, J.J., 1976. Angiotensin II and angiotensin III in rat blood. Circ. Res. 38, 122126. Senbonmatsu, T., Saito, T., Landon, E.J., Watanabe, O., Price, E.,Jr, Roberts, R.L., Imboden, H., Fitzgerald, T.G., Gaffney, F.A., Inagam i, T., 2003. A novel angiotensin II type 2 receptor signaling pathway: possible role in cardiac hypertrophy. EMBO J. 22, 64716482 doi: 10.1093/emboj/cdg637. Senbonmatsu, T., Ichihara, S., Price, E.,Jr, Gaffney, F.A., Inagami, T., 2000. Evidence for angiotensin II type 2 receptor mediated cardiac myocyte enlargement during in vivo pressure overload. J. Clin. Invest. 106, R15. Shibata, M., Endo, S., Inada, K., Kuriki, S., Harada, M., Takino, T., Sato, N., Arakawa, N., Suzuki, T., Aoki, H., Suzuki, T., Hir amori, K., 1997. Elevated plasma levels of interleukin1 receptor antagonist and interleukin10 in patients with acute myocardial infarction. J. Interferon Cytokine Res. 17, 145150. Silva, D.M., Vianna, H.R., Cortes, S.F., Campagnole Santos, M.J., Santos R.A., Lemos, V.S., 2007. Evidence for a new angiotensin(1 7) receptor subtype in the aorta of SpragueDawley rats. Peptides 28, 702707 doi: 10.1016/j.peptides.2006.10.007. Silva Antonialli, M.M., Tostes, R.C., Fernandes, L., Fior Chadi, D.R., Akamine, E.H., Carvalho, M.H., Fortes, Z.B., Nigro, D., 2004. A lower ratio of AT1/AT2 receptors of angiotensin II is found in female than in male spontaneously hypertensive rats. Cardiovasc. Res. 62, 587593 doi: 10.1016/j.cardiores.2004.01.020. Sipo, I., Fechner, H., Pinkert, S., Suckau, L., Wang, X., Weger, S., Poller, W., 2007. Differential internalization and nuclear uncoating of self complementary adenoassociated virus pseudotype vectors as determinants of cardiac cell transduction. Gene Ther. 14, 13191329 doi: 10.1038/sj.gt.3302987.

PAGE 134

134 Siragy, H.M., Xue, C., Abadir, P., Carey, R.M., 2005. Angiotensin subtype2 receptors inhibit renin biosynthesis and angiotensin II formation. Hypertension 45, 133137 doi: 10.1161/01.HYP.0000149105.75125.2a. Snyder, R.O., Mi ao, C.H., Patijn, G.A., Spratt, S.K., Danos, O., Nagy, D., Gown, A.M., Winther, B., Meuse, L., Cohen, L.K., Thompson, A.R., Kay, M.A., 1997. Persistent and therapeutic concentrations of human factor IX in mice after hepatic gene transfer of recombinant AAV vectors. Nat. Genet. 16, 270276 doi: 10.1038/ng0797270. Speth, R.C., Kim, K.H., 1990. Discrimination of two angiotensin II receptor subtypes with a selective agonist analogue of angiotensin II, paminophenylalanine6 angiotensin II. Biochem. Biophys. Res. Commun. 169, 9971006. Steckelings, U.M., Kaschina, E., Unger, T., 2005. The AT2 receptor --a matter of love and hate. Peptides 26, 14011409 doi: 10.1016/j.peptides.2005.03.010. Stier, C.T.,Jr, Chander, P., Gutstein, W.H., Levine, S., Itskovitz, H.D., 1991. Therapeutic benefit of captopril in salt loaded stroke prone spontaneously hypertensive rats is independent of hypotensive effect. Am. J. Hypertens. 4, 680687. Stoll, M., Hahn, A.W., Jonas, U., Zhao, Y., Schieffer, B., Fischer, J.W., Unger, T., 20 02. Identification of a zinc finger homoeodomain enhancer protein after AT(2) receptor stimulation by differential mRNA display. Arterioscler. Thromb. Vasc. Biol. 22, 231237. Stroth, U., Unger, T., 1999. The reninangiotensin system and its receptors. J. Cardiovasc. Pharmacol. 33 Suppl 1, S218; discussion S413. Stumpf, C., Seybold, K., Petzi, S., Wasmeier, G., Raaz, D., Yilmaz, A., Anger, T., Daniel, W.G., Garlichs, C.D., 2008. Interleukin10 improves left ventricular function in rats with heart failur e subsequent to myocardial infarction. Eur. J. Heart Fail. 10, 733739 doi: 10.1016/j.ejheart.2008.06.007. Su, H., Huang, Y., Takagawa, J., Barcena, A., ArakawaHoyt, J., Ye, J., Grossman, W., Kan, Y.W., 2006. AAV serotype1 mediates early onset of gene expression in mouse hearts and results in better therapeutic effect. Gene Ther. 13, 14951502 doi: 10.1038/sj.gt.3302787. Suckau, L., Fechner, H., Chemaly, E., Krohn, S., Hadri, L., Kockskamper, J., Westermann, D., Bisping, E., Ly, H., Wang, X., Kawase, Y., Chen, J., Liang, L., Sipo, I., Vetter, R., Weger, S., Kurreck, J., Erdmann, V., Tschope, C., Pieske, B., Lebeche, D., Schultheiss, H.P., Hajjar, R.J., Poller, W.C., 2009. Long Term Cardiac Targeted RNA Interference for the Treatment of Heart Failure Rest ores Cardiac Function and Reduces Pathological Hypertrophy. Circulation doi: 10.1161/CIRCULATIONAHA.108.783852.

PAGE 135

135 Sugino, H., Ozono, R., Kurisu, S., Matsuura, H., Ishida, M., Oshima, T., Kambe, M., Teranishi, Y., Masaki, H., Matsubara, H., 2001. Apoptosis i s not increased in myocardium overexpressing type 2 angiotensin II receptor in transgenic mice. Hypertension 37, 13941398. Summerford, C., Bartlett, J.S., Samulski, R.J., 1999. AlphaVbeta5 integrin: a co receptor for adenoassociated virus type 2 infecti on. Nat. Med. 5, 7882 doi: 10.1038/4768. Summerford, C., Samulski, R.J., 1998. Membraneassociated heparan sulfate proteoglycan is a receptor for adenoassociated virus type 2 virions. J. Virol. 72, 14381445. Tallant, E.A., Ferrario, C.M., Gallagher, P .E., 2005. Angiotensin(1 7) inhibits growth of cardiac myocytes through activation of the mas receptor. Am. J. Physiol. Heart Circ. Physiol. 289, H15606 doi: 10.1152/ajpheart.00941.2004. Tallant, E.A., Lu, X., Weiss, R.B., Chappell, M.C., Ferrario, C.M. 1997. Bovine aortic endothelial cells contain an angiotensin(1 7) receptor. Hypertension 29, 388393. Tan, F., Morris, P.W., Skidgel, R.A., Erdos, E.G., 1993. Sequencing and cloning of human prolylcarboxypeptidase (angiotensinase C). Similarity to both serine carboxypeptidase and prolylendopeptidase families. J. Biol. Chem. 268, 1663116638. Testa, M., Yeh, M., Lee, P., Fanelli, R., Loperfido, F., Berman, J.W., LeJemtel, T.H., 1996. Circulating levels of cytokines and their endogenous modulators in pat ients with mild to severe congestive heart failure due to coronary artery disease or hypertension. J. Am. Coll. Cardiol. 28, 964 971. Thom, T., Haase, N., Rosamond, W., Howard, V.J., Rumsfeld, J., Manolio, T., Zheng, Z.J., Flegal, K., O'Donnell, C., Kittner, S., Lloyd Jones, D., Goff, D.C.,Jr, Hong, Y., Adams, R., Friday, G., Furie, K., Gorelick, P., Kissela, B., Marler, J., Meigs, J., Roger, V., Sidney, S., Sorlie, P., Steinberger, J., Wasserthiel Smoller, S., Wilson, M., Wolf, P., American Heart Association Statistics Committee and Stroke Statistics Subcommittee, 2006. Heart disease and stroke statistics --2006 update: a report fro m the American Heart Association Statistics Committee and Stroke Statistics Subcommittee. Circulation 113, e85151 doi: 10.1161/CIRCULATIONAHA.105.171600. Thurmann, P.A., Kenedi, P., Schmidt, A., Harder, S., Rietbrock, N., 1998. Influence of the angiotens in II antagonist valsartan on left ventricular hypertrophy in patients with essential hypertension. Circulation 98, 20372042. Tipnis, S.R., Hooper, N.M., Hyde, R., Karran, E., Christie, G., Turner, A.J., 2000. A human homolog of angiotensinconverting enzyme. Cloning and functional expression as a captopril insensitive carboxypeptidase. J. Biol. Chem. 275, 3323833243 doi: 10.1074/jbc.M002615200.

PAGE 136

136 Tiyyagura, S.R., Pinney, S.P., 2006. Left ventricular remodeling after myocardial infarction: past, present, and future. Mt. Sinai J. Med. 73, 840851. TorreAmione, G., Kapadia, S., Benedict, C., Oral, H., Young, J.B., Mann, D.L., 1996. Proinflammatory cytokine levels in patients with depressed left ventricular ejection fraction: a report from the Studies of Left Ventricular Dysfunction (SOLVD). J. Am. Coll. Cardiol. 27, 12011206 doi: 10.1016/07351097(95)005897. Touyz, R.M., Endemann, D., He, G., Li, J.S., Schiffrin, E.L., 1999. Role of AT2 receptors in angiotensin II stimulated contraction of small mesenter ic arteries in young SHR. Hypertension 33, 366372. Trask, A.J., Averill, D.B., Ganten, D., Chappell, M.C., Ferrario, C.M., 2007. Primary role of angiotensinconverting enzyme2 in cardiac production of angiotensin(1 7) in transgenic Ren2 hypertensive r ats. Am. J. Physiol. Heart Circ. Physiol. 292, H3019 24 doi: 10.1152/ajpheart.01198.2006. Trask, A.J., Ferrario, C.M., 2007. Angiotensin(1 7): pharmacology and new perspectives in cardiovascular treatments. Cardiovasc. Drug Rev. 25, 162174 doi: 10.1111/ j.15273466.2007.00012.x. Tsutamoto, T., Hisanaga, T., Wada, A., Maeda, K., Ohnishi, M., Fukai, D., Mabuchi, N., Sawaki, M., Kinoshita, M., 1998. Interleukin6 spillover in the peripheral circulation increases with the severity of heart failure, and the high plasma level of interleukin6 is an important prognostic predictor in patients with congestive heart failure. J. Am. Coll. Cardiol. 31, 391398. Tsutsumi, Y., Matsubara, H., Masaki, H., Kurihara, H., Murasawa, S., Takai, S., Miyazaki, M., Nozawa, Y., Ozono, R., Nakagawa, K., Miwa, T., Kawada, N., Mori, Y., Shibasaki, Y., Tanaka, Y., Fujiyama, S., Koyama, Y., Fujiyama, A., Takahashi, H., Iwasaka, T., 1999. Angiotensin II type 2 receptor overexpression activates the vascular kinin system and causes vasodilation. J. Clin. Invest. 104, 925935 doi: 10.1172/JCI7886. Tsutsumi, Y., Matsubara, H., Ohkubo, N., Mori, Y., Nozawa, Y., Murasawa, S., Kijima, K., Maruyama, K., Masaki, H., Moriguchi, Y., Shibasaki, Y., Kamihata, H., Inada, M., Iwasaka, T., 1998. Angiotensin II type 2 receptor is upregulated in human heart with interstitial fibrosis, and cardiac fibroblasts are the major cell type for its expression. Circ. Res. 83, 10351046. Tsuzuki, S., Matoba, T., Eguchi, S., Inagami, T., 1996. Angiotensin II type 2 receptor inhibits cell proliferation and activates tyrosine phosphatase. Hypertension 28, 916918. Utsunomiya, H., Nakamura, M., Kakudo, K., Inagami, T., Tamura, M., 2005. Angiotensin II AT2 receptor localization in cardiovascular tissues by its antibody developed in AT2 genedeleted mice. Regul. Pept. 126, 155161 doi: 10.1016/j.regpep.2004.09.004.

PAGE 137

137 Vandendriessche, T., Thorrez, L., AcostaSanchez, A., Petrus, I., Wang, L., Ma, L., DE Waele, L., Iwasaki, Y., Gillijns, V., Wilson, J.M., Collen, D., Chuah, M.K., 2007. Efficacy and safety of adenoassociated viral vectors based on serotype 8 and 9 vs. lentiviral vectors for hemophilia B gene therapy. J. Thromb. Haemost. 5, 16 24 doi: 10.1111/j.15387836.2006.02220.x. Vassalli, G., Bueler, H., Dudler, J., vo n Segesser, L.K., Kappenberger, L., 2003. Adenoassociated virus (AAV) vectors achieve prolonged transgene expression in mouse myocardium and arteries in vivo: a comparative study with adenovirus vectors. Int. J. Cardiol. 90, 229238. Vickers, C., Hales, P., Kaushik, V., Dick, L., Gavin, J., Tang, J., Godbout, K., Parsons, T., Baronas, E., Hsieh, F., Acton, S., Patane, M., Nichols, A., Tummino, P., 2002a. Hydrolysis of biological peptides by human angiotensinconverting enzymerelated carboxypeptidase. J. Biol. Chem. 277, 1483814843 doi: 10.1074/jbc.M200581200. Vickers, C., Hales, P., Kaushik, V., Dick, L., Gavin, J., Tang, J., Godbout, K., Parsons, T., Baronas, E., Hsieh, F., Acton, S., Patane, M., Nichols, A., Tummino, P., 2002b. Hydrolysis of biologica l peptides by human angiotensinconverting enzymerelated carboxypeptidase. J. Biol. Chem. 277, 1483814843 doi: 10.1074/jbc.M200581200. Villarreal, F.J., Kim, N.N., Ungab, G.D., Printz, M.P., Dillmann, W.H., 1993. Identification of functional angiotensin II receptors on rat cardiac fibroblasts. Circulation 88, 28492861. Voros, S., Yang, Z., Bove, C.M., Gilson, W.D., Epstein, F.H., French, B.A., Berr, S.S., Bishop, S.P., Conaway, M.R., Matsubara, H., Carey, R.M., Kramer, C.M., 2006. Interaction between A T1 and AT2 receptors during postinfarction left ventricular remodeling. Am. J. Physiol. Heart Circ. Physiol. 290, H100410 doi: 10.1152/ajpheart.00886.2005. Wang, H., Gallinat, S., Li, H.W., Sumners, C., Raizada, M.K., Katovich, M.J., 2004. Elevated blood pressure in normotensive rats produced by 'knockdown' of the angiotensin type 2 receptor. Exp. Physiol. 89, 313322 doi: 10.1113/expphysiol.2004.027359. Wang, L.J., He, J.G., Ma, H., Cai, Y.M., Liao, X.X., Zeng, W.T., Liu, J., Wang, L.C., 2005. Chronic administration of angiotensin(1 7) attenuates pressureoverload left ventricular hypertrophy and fibrosis in rats. Di Yi Jun Yi Da Xue Xue Bao 25, 481487. Wang, Z.Q., Moore, A.F., Ozono, R., Siragy, H.M., Carey, R.M., 1998. Immunolocalization of subtype 2 angiotensin II (AT2) receptor protein in rat heart. Hypertension 32, 7883. Weber, K.T., 2000. Fibrosis and hypertensive heart disease. Curr. Opin. Cardiol. 15, 264272.

PAGE 138

138 Weber, K.T., 1997. Extracellular matrix remodeling in heart failure: a role for de novo angiotensin II generation. Circulation 96, 40654082. Weber, K.T., Brilla, C.G., 1992. Factors associated with reactive and reparative fibrosis of the myocardium. Basic Res. Cardiol. 87 Suppl 1, 291 301. Weber, K.T., Brilla, C.G., 1991. Pathologica l hypertrophy and cardiac interstitium. Fibrosis and reninangiotensinaldosterone system. Circulation 83, 18491865. Widdop, R.E., Gardiner, S.M., Kemp, P.A., Bennett, T., 1992. Inhibition of the haemodynamic effects of angiotensin II in conscious rats by AT2 receptor antagonists given after the AT1receptor antagonist, EXP 3174. Br. J. Pharmacol. 107, 873880. Wiemer, G., Dobrucki, L.W., Louka, F.R., Malinski, T., Heitsch, H., 2002. AVE 0991, a nonpeptide mimic of the effects of angiotensin(1 7) on the endothelium. Hypertension 40, 847852. Williams, R.S., Benjamin, I.J., 2000. Protective responses in the ischemic myocardium. J. Clin. Invest. 106, 813818 doi: 10.1172/JCI11205. Wong, M., Staszewsky, L., Latini, R., Barlera, S., Glazer, R., Aknay, N., Hester, A., Anand, I., Cohn, J.N., 2004. Severity of left ventricular remodeling defines outcomes and response to therapy in heart failure: Valsartan heart failure trial (Val HeFT) echocardiographic data. J. Am. Coll. Cardiol. 43, 20222027 doi: 10.1016/j. jacc.2003.12.053. Woo, Y.J., Zhang, J.C., Taylor, M.D., Cohen, J.E., Hsu, V.M., Sweeney, H.L., 2005a. One year transgene expression with adeno associated virus cardiac gene transfer. Int. J. Cardiol. 100, 421426 doi: 10.1016/j.ijcard.2004.09.003. Woo, Y .J., Zhang, J.C., Taylor, M.D., Cohen, J.E., Hsu, V.M., Sweeney, H.L., 2005b. One year transgene expression with adeno associated virus cardiac gene transfer. Int. J. Cardiol. 100, 421426 doi: 10.1016/j.ijcard.2004.09.003. Wright, M.J., Wightman, L.M., L illey, C., de Alwis, M., Hart, S.L., Miller, A., Coffin, R.S., Thrasher, A., Latchman, D.S., Marber, M.S., 2001. In vivo myocardial gene transfer: optimization, evaluation and direct comparison of gene transfer vectors. Basic Res. Cardiol. 96, 227236. Ya mada, T., Horiuchi, M., Dzau, V.J., 1996. Angiotensin II type 2 receptor mediates programmed cell death. Proc. Natl. Acad. Sci. U. S. A. 93, 156160. Yamamoto, K., Chappell, M.C., Brosnihan, K.B., Ferrario, C.M., 1992. In vivo metabolism of angiotensin I by neutral endopeptidase (EC 3.4.24.11) in spontaneously hypertensive rats. Hypertension 19, 692696.

PAGE 139

139 Yan, X., Price, R.L., Nakayama, M., Ito, K., Schuldt, A.J., Manning, W.J., Sanbe, A., Borg, T.K., Robbins, J., Lorell, B.H., 2003. Ventricular specific e xpression of angiotensin II type 2 receptors causes dilated cardiomyopathy and heart failure in transgenic mice. Am. J. Physiol. Heart Circ. Physiol. 285, H217987 doi: 10.1152/ajpheart.00361.2003. Yang, L., Jiang, J., Drouin, L.M., AgbandjeMcKenna, M., Chen, C., Qiao, C., Pu, D., Hu, X., Wang, D.Z., Li, J., Xiao, X., 2009. A myocardium tropic adenoassociated virus (AAV) evolved by DNA shuffling and in vivo selection. Proc. Natl. Acad. Sci. U. S. A. doi: 10.1073/pnas.0813207106. Yang, Z., Bove, C.M., Fr ench, B.A., Epstein, F.H., Berr, S.S., DiMaria, J.M., Gibson, J.J., Carey, R.M., Kramer, C.M., 2002. Angiotensin II type 2 receptor overexpression preserves left ventricular function after myocardial infarction. Circulation 106, 106111. Yang, Z., Zingarelli, B., Szabo, C., 2000. Crucial role of endogenous interleukin10 production in myocardial ischemia/reperfusion injury. Circulation 101, 10191026. Yao, L., Huang, K., Huang, D., Wang, J., Guo, H., Liao, Y., 2008. Acute myocardial infarction induced inc reases in plasma tumor necrosis factor alpha and interleukin10 are associated with the activation of poly(ADP ribose) polymerase of circulating mononuclear cell. Int. J. Cardiol. 123, 366368 doi: 10.1016/j.ijcard.2007.06.069. Yin, F.C., Spurgeon, H.A., Rakusan, K., Weisfeldt, M.L., Lakatta, E.G., 1982. Use of tibial length to quantify cardiac hypertrophy: application in the aging rat. Am. J. Physiol. 243, H9417. Yla Herttuala, S., Alitalo, K., 2003. Gene transfer as a tool to induce therapeutic vascula r growth. Nat. Med. 9, 694 701 doi: 10.1038/nm0603694. Zhang, X., Azhar, G., Nagano, K., Wei, J.Y., 2001. Differential vulnerability to oxidative stress in rat cardiac myocytes versus fibroblasts. J. Am. Coll. Cardiol. 38, 20552062. Zincarelli, C., Soltys, S., Rengo, G., Rabinowitz, J.E., 2008. Analysis of AAV serotypes 1 9 mediated gene expression and tropism in mice after systemic injection. Mol. Ther. 16, 10731080 doi: 10.1038/mt.2008.76. Zisman, L.S., Keller, R.S., Weaver, B., Lin, Q., Speth, R., Bristow, M.R., Canver, C.C., 2003a. Increased angiotensin(1 7) forming activity in failing human heart ventricles: evidence for upregulation of the angiotensinconverting enzyme Homologue ACE2. Circulation 108, 17071712 doi: 10.1161/01.CIR.0000094734.679 90.99. Zisman, L.S., Meixell, G.E., Bristow, M.R., Canver, C.C., 2003b. Angiotensin (1 7) formation in the intact human heart: in vivo dependence on angiotensin II as substrate. Circulation 108, 16791681 doi: 10.1161/01.CIR.0000094733.61689.D4.

PAGE 140

140 Zolotukh in, S., Potter, M., Zolotukhin, I., Sakai, Y., Loiler, S., Fraites, T.J.,Jr, Chiodo, V.A., Phillipsberg, T., Muzyczka, N., Hauswirth, W.W., Flotte, T.R., Byrne, B.J., Snyder, R.O., 2002. Production and purification of serotype 1, 2, and 5 recombinant adenoassociated viral vectors. Methods 28, 158167.

PAGE 141

141 BIOGRAPHICAL SKETCH Yanfei Qi was born and grew up in the small town of Guizhou province, China. Yanfei received her Doctor of Medicine at Guiyang Medical College in July 2002. During the internship in the hospital, Yanfei discovered her interest in biomedical research. She decided to pursue her science career at Guiyang Medical College. Under the guidance of Dr Xilin Ren, she worked on a project to study an association between Alzheimers disease and gene polymorphism of the alpha 4 nicotinic receptor in Alzheimer patients. During the process of studying the project, Dr Ren advised her to pursue her interest in biomedical research and apply to graduate school at the University of Florida in the United States. In 2005, Yanfei began her graduate school in the graduate program in Department of Pharmacodynamics at the University of Florida. Under the supervision of Dr. Michael J. Katovich, she has been studying the role of angiotension type 2 receptor and A ng(1 7) in cardiovascular function.