<%BANNER%>

Development of a Transfection System for Genetic Manipulation of Babesia Bovis

Permanent Link: http://ufdc.ufl.edu/UFE0041150/00001

Material Information

Title: Development of a Transfection System for Genetic Manipulation of Babesia Bovis
Physical Description: 1 online resource (111 p.)
Language: english
Creator: Wang, Xinyi
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: babesia, bovis, lat, promoter, transfection, ves
Immunology and Microbiology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Babesia bovis is an intraerythrocytic parasite which establishes and maintains a persistent infection in its bovine host by at least two mechanisms: cytoadhesion and antigenic variation. In the past few years, a transfection system has been initiated in B. bovis, providing a useful genetic tool for studying the biology of the parasite. Here I present further development and extension of transfection methodology for B. bovis, as a technical basis for targeted genetic manipulation of this parasite. I have determined that B. bovis parasites are adequately susceptible to puromycin, blasticidin-S and pyrimethamine to provide for positive selection, using introduction of an exogenous gene imparting resistance, making stable transformation feasible. In developing this approach, I have established a transient transfection system employing firefly luciferase expression to compare promoter activities, and have demonstrated that the IGr s of the LAT and two transcriptionally silent ves donor gene pairs all display very strong promoter activities, at levels comparable to promoter from the housekeeping gene calmodulin. Taking advantage of this technology to gain insights into the gene regulation in the unique intergenic region of LAT, I have also identified a cluster of promoters within the 434 bp sequences as well as possible enhancing activities embedded in the flanking exonic or intronic sequences. Interestingly, one inverted intron has resulted in significant reduction in promoter activities, suggesting possible DNA binding motifs in that region. Besides, transient expression of enhanced green fluorescent protein whose expression is driven by a ves promoter has revealed there is no strict ves promoter counting in the parasite when only promoter sequences are present. Thus, ves gene expression from the LAT was unaffected while the episomal vector expressing EGFP was replicating and transcriptionally active extrachromosomally. Stable transfection of the parasite has also been achieved, revealing a non-targeted integration event with stable expression of gfp-bsd protein in the transfectants, which suggests it may be difficult to reproducibly achieve the specific genetic alterations desired. These observations provide key background knowledge and reagents for deliberate genetic manipulation of B. bovis.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Xinyi Wang.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Allred, David R.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-04-30

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0041150:00001

Permanent Link: http://ufdc.ufl.edu/UFE0041150/00001

Material Information

Title: Development of a Transfection System for Genetic Manipulation of Babesia Bovis
Physical Description: 1 online resource (111 p.)
Language: english
Creator: Wang, Xinyi
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: babesia, bovis, lat, promoter, transfection, ves
Immunology and Microbiology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Babesia bovis is an intraerythrocytic parasite which establishes and maintains a persistent infection in its bovine host by at least two mechanisms: cytoadhesion and antigenic variation. In the past few years, a transfection system has been initiated in B. bovis, providing a useful genetic tool for studying the biology of the parasite. Here I present further development and extension of transfection methodology for B. bovis, as a technical basis for targeted genetic manipulation of this parasite. I have determined that B. bovis parasites are adequately susceptible to puromycin, blasticidin-S and pyrimethamine to provide for positive selection, using introduction of an exogenous gene imparting resistance, making stable transformation feasible. In developing this approach, I have established a transient transfection system employing firefly luciferase expression to compare promoter activities, and have demonstrated that the IGr s of the LAT and two transcriptionally silent ves donor gene pairs all display very strong promoter activities, at levels comparable to promoter from the housekeeping gene calmodulin. Taking advantage of this technology to gain insights into the gene regulation in the unique intergenic region of LAT, I have also identified a cluster of promoters within the 434 bp sequences as well as possible enhancing activities embedded in the flanking exonic or intronic sequences. Interestingly, one inverted intron has resulted in significant reduction in promoter activities, suggesting possible DNA binding motifs in that region. Besides, transient expression of enhanced green fluorescent protein whose expression is driven by a ves promoter has revealed there is no strict ves promoter counting in the parasite when only promoter sequences are present. Thus, ves gene expression from the LAT was unaffected while the episomal vector expressing EGFP was replicating and transcriptionally active extrachromosomally. Stable transfection of the parasite has also been achieved, revealing a non-targeted integration event with stable expression of gfp-bsd protein in the transfectants, which suggests it may be difficult to reproducibly achieve the specific genetic alterations desired. These observations provide key background knowledge and reagents for deliberate genetic manipulation of B. bovis.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Xinyi Wang.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Allred, David R.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-04-30

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0041150:00001


This item has the following downloads:


Full Text

PAGE 1

1 DEVELOPMENT OF A TRANSFECTION SYSTEM FOR GENETIC MANIPULATION OF BABESIA BOVIS By XINYI WANG A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE D EGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2010

PAGE 2

2 2010 X inyi W ang

PAGE 3

3 To my parents; my husband, Zheng Xia; and my dear son, Chase Qianchi Xia

PAGE 4

4 ACKNOWLEDGMENTS First of all, my utmost gratitude goes to my PhD advisor, also my committee chair, Professor David R. Allred. Im deeply grateful to him for allowing me to join his lab, and for his excellent expertise, his continuous patience as well as his persistent help in guiding my work throughout the five years. He is really amazing in his excitement in research as well as in teaching an impossible student like me. This dissertation work would never be possible without his immense support. Although I was not and may never become his best student, he is fore ver the best advisor in my eye. I am also greatly indebted to my committee members, Dr Anthony Barbet, Dr Linda Bloom, Dr Shouguang Jin, and Dr Ayalew Mergia. This work was tremendously improved by lots of discussion during the numerous committee meeti ngs, esp. during the last year. Their valuable suggestions really helped a lot. I also appreciate the extensive technical support from my labmates, who also volunteered their time to review and critique my work, Yingling Huang, Yuping Xiao, Erin Mack, Ann e Bouchut, Agata Zupanska, Basima Al Khedery, Danielle Swetnam, Alexia Berg, Allison Vansickle etc; especially Yingling and Yuping, for their continuous presence whenever a discussion is needed and their encouragement throughout the years. I really had a w onderful time with all of them in the lab. My big thanks also go to Dr. Carlos Suarez for generously providing transfection tips, detailed protocols and very efficient plasmids, which helped my dissertation work through the most difficult time. Im thankful to Tonya Bonilla and Fred Bonilla for their readiness to provide plasmodium plasmids and protocols as reference. I also thank Dr. Jeffrey Abbott for allowing me to use the MicroBeta Scintillation Counter in his lab, on which most of my data were generated.

PAGE 5

5 And then there are other people who have made Gainesville a very special place over these years. They are Xiaomin Lu, Liqun Xu, Chao Cao, Jun Liu, Jianlin Li, Lu Ma, Zhenzhen Zhang, Kun Chen, Yingyan Lou, Mingzhen Bao and many equally important others. Also Ill never forget to thank my cousins, Haichen Zhu in Louisiana, Jean Wu in California, as well as my best friend, Yan Lai in Ireland. Finally, I would like to thank my parents and parents in law, whose love is boundless; especially my mom, for travel ing across the Pacific back and forth, always on my side. She sacrificed her job and salary, came to support me by all means and took good care of my son while he is in Shanghai. My most special thanks go to my husband, Zheng Xia, who is forever on my side showing understanding for my sacrifice of family time, accompanying me to work during the weekends however late it was and helping me through the most difficult time when I was alone in Gainesville; My forever love goes to my dearest adorable baby, Chase, for giving me courage and joy every day and night. I owe them too much, especially to baby Chase. I hope he would forgive me in the future for leaving him in Shanghai without saying goodbye, for having to miss the most beautiful days in his life, not be ing able to see him standing up or talking for the first time. To my precious family, I dedicate this dissertation.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS ...............................................................................................................4 LIST OF TABLES ...........................................................................................................................8 LIST OF FIGURES .........................................................................................................................9 LIST OF ABBREVIATIONS ........................................................................................................11 AB STRACT ...................................................................................................................................12 CHAPTER 1 INTRODUCTION ..................................................................................................................14 Background and Significance .................................................................................................14 Babesiosis and Babesia bovis ..........................................................................................14 Life Cycle of B. bovis ......................................................................................................15 Strategies of Immune Evasion by B. bovis and their Major Components ..............................16 Mechanisms of Antigenic Variation in Other Similar Organisms ..........................................17 Mechanisms of Antigenic Variation in B. bovis .....................................................................18 Unique Structure of ves gene Pair and Intergenic Region ......................................................20 Transfection System ...............................................................................................................21 Mechanism Underlying Electroporation .................................................................................23 Promoter Structure ..................................................................................................................24 Hypothesis ..............................................................................................................................24 2 FURTHER DEVELOPMENT OF A TRANSFECTION SYSTEM FOR THE GENETIC MANIPULATION OF BABESIA BOVIS .............................................................26 Abstract ...................................................................................................................................26 I ntroduction .............................................................................................................................27 Materials and Methods ...........................................................................................................28 Parasite Culture ...............................................................................................................28 Prep aration of Bovine Serum and Erythrocytes and B. bovis Immune Serum ................28 Luciferase Plasmid DNA Construction ...........................................................................29 EGFP Plasmid DNA Co nstruction ..................................................................................30 Detailed Procedures for Transient Transfection ..............................................................31 Preparation of plasmid DNA for transient transfection of Lucifer ase construct ................................................................................................................31 Electroporation and transient transfection of parasites ............................................31 Post transfection maintenance and sample preparation ............................................32 Dual Luciferase reporter assay (Promega) ...............................................................33 Biostatistical Analysis of Promoter Activities ................................................................35 Transient Tranfection of EGFP Constructs and Live Cell IFA .......................................35

PAGE 7

7 Antibiotic Sensitivity Assay ............................................................................................35 Stable Transfection and Drug Selection ..........................................................................36 Western Blot Analysis .....................................................................................................37 Southern Blot Analysis ....................................................................................................37 Fluorescence microscopy ................................................................................................38 Experimental Results ..............................................................................................................38 Expression of Luciferase and Comparison of Heter ologous Promoter Activity ........................................................................................................................38 Transfection Methodology ..............................................................................................40 Coexpression of EGFP and VESA1 ................................................................................42 Antibiotic Sensitivity Assay for Developing Stable Transfection in B. bovis ................43 Drug selection and Stable Expression of GFP BSD Fusion Protein ...............................45 Characterization of Genomic Locus of the Integrated gfpbsd Gene ...............................47 Discussion ...............................................................................................................................48 3 D ISSECTION OF THE BIDIRECTIONAL PROMOTER STRUCTURE EMPLOYED IN THE BABESIA BOVIS VES MULTIGENE FAMILY ...............................71 Abstract ...................................................................................................................................71 Introduction .............................................................................................................................71 Material and Methods .............................................................................................................73 Parasites ...........................................................................................................................73 Cloning of Constructs w ith LAT Intergenic Region Regulatory Sequences ...................73 Cloning of Constructs with Additional Exons and/or Introns from the Apposing Gene .............................................................................................................75 Cloning of Constructs with Intronic Sequences Inverted ................................................76 Cloning of Intergenic Regions from Two Other ves Donor Loci ....................................76 Transient Transfection and Luciferase Assay .................................................................77 Biostatistical Analysis of Promoter Activities ................................................................78 Results .....................................................................................................................................79 Analysis of ves Igr Sequences .........................................................................................79 Analysis of ves Igr Flanking Sequences on Promoter Function ......................................80 Effects of Intronic Sequences Inversion ..........................................................................81 Comparison of Promoter Activities of S equence Donor Loci with the LAT ..................82 Discussion and Conclusions ...................................................................................................83 4 CONCLUSION .......................................................................................................................98 APPENDIX A PRIMERS USED IN STUDY ..............................................................................................100 B STABILITY OF TRANSFORMABLE DNA ......................................................................102 LIST OF REFERENCES .............................................................................................................103 BIOGRAPHICAL SKETCH .......................................................................................................111

PAGE 8

8 LIST OF TABLES Table page 21 Statistical ana lysis of promoter activities of calmodulin 5 and ves 1 5sequences ........................................................................................................................56 31 Statistical analysis of promoter activities in Igr of LAT ....................................................88 32 Statistical analysis of promoter activitie s in Igr of LAT with additional exon(s) and intron(s). .........................................................................................................89 33 Statistical analysis of promoter activities affected by intron inversion .............................90 34 Statistical analysis of promoter activities of Igrs from LAT as well as non transcribed ves loci .............................................................................................................91 A 1 Primers used in this study ................................................................................................100

PAGE 9

9 LIST OF FIGURES Figure page 21 Cloning of regulatory sequences into pGEM LUC and control constructs .......................57 22 Scaled schematic r epresentation of luciferase constructs for transient transfection .........................................................................................................................58 23 Comparison of promoter activiti es using transient transfection ........................................59 24 Comparison of lysis methods for detection of luciferase activity in B. bovis extracts ...............................................................................................................................60 25 Time course of luciferase expression in B. bovis parasites transfected with plasmid p LAT_ ..........................................................................................................61 26 Expression of EGFP in B. bovis C9.1 parasites transfected with pTubulin 5 EGFP .......................................................................................................62 27 Live cell IFA o f B. bovis EGFP ...........................63 28 In vitro growth inhibition of B. bovis parasites as a function of various drug concentrations, as assessed by tritiated hypoxanthin e incorporation .................................65 29 Schematic representation of the proposed strategy ............................................................66 210 Schematic representation of the original ef locus before integration ...........................67 211 Expression of GFP BSD fusion protein .............................................................................68 212 Southern blot analysis using pBluescript and GFP B SD probes .......................................69 213 Southern blot analysis using rap1 and ef 1a probes ..........................................................70 31 A cluster of promoters are r evealed in the IG region of LAT ..........................................92 32 Enhancing activities are revealed in the individual exon or intron sequences of the apposing genes .........................................................................................................93 33 Effect s on luciferase expressions when introns are reversely inserted ..............................94 34 Comparable promoter activities revealed in donor ves IG region with LAT ....................95 35 Alignment of sequences of ves ......................................................................................96 36 Illustration of a possible in situ switching of transcription activity event in B.bovis ................................................................................................................................97

PAGE 10

10 B 1 Transformed E. coli recovery as a function of hours post transfection of bovine RBCs with transformable DNA ...........................................................................102

PAGE 11

11 LIST OF ABBREVIATIONS IFA Immunofluorescence assay gDNA Genomic DNA IC50 IC H alf maximal inhibitory concentration 9 0 Igr Intergenic region 90% of maximal inhibitory concentration IRBC I nfected red blood cell LAT Locus of active transcription PBS Phosphate buffered saline PCR Polymerase chain reaction PCV Packed cell volume PPE Percent par asitized erythrocytes RBC R ed blood cell RLM RACE RNA ligase mediated Rapid Amplification of cDNA ends RT Room temperature RT PCR Reverse transcription polymerase chain reaction SDS Sodium dodecyl sulfate UTR U ntranslated region UV Ultraviolet ves Variant erythrocyte surface gene VESA1 Variant erythrocyte surface antigen 1 VYMs Vega Y Martinez solution

PAGE 12

12 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy DEVELOPMENT OF A TRANSFECTION SYSTEM FOR GENETIC MANIPULATION OF BABESIA BOVIS By Xinyi Wang May 2010 Chair: David R. Allred Major: Medical Sciences Immunology and Micr obiology B abesia bovis is an intraerythrocytic parasite which establishes and maintains a persistent infection in its bovine host by at least two mechanisms: cytoadhesion and antigenic variation. In the past few years, a transfection system has been initi ated in B. bovis providing a useful genetic tool for study ing the biology of the parasite. Here I present further development and extension of transfection methodology for B. bovis as a technical basis for targeted genetic manipulation of this parasite. I have determined that B. bovis parasites are adequately susceptible to puromycin, blasticidinS and pyrimethamine to provide for positive selection using introduction of an exogenous gene imparting resistance, making stable transformation feasible. In de ve loping this approach, I have established a transient transfection system employing firefly luciferase expression to compare promoter activities, and have demonstrated that the IGrs of the LAT and two transcriptionally silent ves donor gene pairs all dis play very strong promoter activities, a t levels comparable to promoter from the housekeeping gene calmodulin. Taking advantage of this technology to gain insights into the gene regulation in the unique intergenic region of LAT, I have also identified a cluster of promoters within the 434 bp sequences as well as possible enhancing activities embedded in the flanking exonic or

PAGE 13

13 intronic sequences. Interestingly, one inverted intron has resulted in significant reduction in promoter activities, suggesting possib le DNA binding motifs in that region. Besides, t ransient expression of enhanced green fluorescent protein whose expression is driven by a ves promoter has revealed there is no strict ves promoter counting in the parasite when only promoter sequences are pr esent Thus, ves gene expression from the LAT was unaffected while the episomal vector expressing EGFP was replicating and transcriptionally active extrachromoso mally. Stable transfection of the parasite has also been achieved, revealing a nontargeted int egration event with stable expression of gfp bsd protein in the transfectants which s uggest s it may be difficult to reproducibly achieve the specific genetic alterations desired. These observations provide key background knowledge and reagents for deliber ate genetic manipulation of B. bovis

PAGE 14

14 CHAPTER 1 INTRODUCTION Background and S ignificance Babesiosis and B abesia bovis Babesiosis is an emerging world wide vector borne disease. It is so named because it is caused by protozoan parasites of the genus Babes ia which was in turn named after the bacteriologist Victor Babe s who first described the parasite (Babes, 1888). Nowadays, babesiosis has a great impact on the health of a wide range of domestic and wild animals in tropical and sub tropical regions (McCos ker, 1981) The major impact is on worldwide livestock production, to which huge loss has already been caused, so the research into the disease carries great economic importance. Human babesiosis is uncommon, but is a potential ly fatal parasitic disease. T he distribution of human babesiosis cases tends to be focused in the U.S. Northeast and parts of Western Europe (Kjemtrup and Conrad, 2000) In recent years, however, increasing cases have been reported in other areas because of expanded medical awareness (Hunfeld et al., 2008) B ovine babesiosis may be caused by B abesia bovis Babesia divergens, Babesia bigemina or Babesia major. The genus Babesia belongs to the phylum Apicomplexa, class Aconoidasida order Eucoccidiorida, suborder Piroplasmorina and famil y Babesiidae (Allsopp et al., 1994; Levine, 1971, 1985) The main vectors of Babesia are Boophilus spp. ticks. Boophilus microplus is the most important and widespread vector affecting domestic species like cattle and buffalo (Bock et al., 2004) The paras ites can establish persistent infection in the mammalian host. Infection of the bovine host results in the extensive destruction of erythrocytes, causing severe anemia and sometimes a fatal cerebral form of babesiosis (Aikawa et al., 1992)

PAGE 15

15 L ife C ycle of B bovis Before description of the immune evasion strategies of the parasite that are used to maintain persistent infection, the life cycle of B. bovis is briefly introduced here. B. bovis has two major phases in its life cycle (Bock et al., 2004) One is i n the invertebrate host (ticks) and the other is in the vertebrate host (the cattle). In the first phase, w hen a competent Boophilus spp. tick takes a blood meal from an infected host babesial parasites in red blood cells are ingested In the midgut of t he tick, some of the parasites undergo sexual development, forming micro and macrogametocytes. Two populations of ray bodies are developed from the gametocytes and undergo further multiplication. Large aggregations of multinucleated ray bodies form, but once division is complete, single nucleated ray bodies that are now haploid and assumed to be gametes (Mackenstedt et al., 1995) emerge from the aggregates and then fuse together in pairs (Gough et al., 1998) to form a spherical cell (zygote) The zygote invades and forms a tissue schizont in intestinal cells, releasing kinetes which leave the intestine, migrate through the hemolymph, and penetrate various other organs, such as fat body cells, nephrocytes, ovaries or salivary glands. Primary asexual reproduc tion may occur in the ovaries of adult female ticks, resulting in infected ova, and ultimately infected larvae. This is referred to as transovarial transmission. Within the larvae, the parasite undergoes s porogony, producing up to 100,000 sporozoites, some of which successfully migrate to the salivary glands. At this point the parasite is ready to be transmitted to a new vertebrate host In the second phase, when an infected tick feeds, babesial sporozoites are deposited at the feeding site and find their way into the blood stream of the new host near the site of the bite There, the sporozoites invade the erythrocytes, where they undergo development and division through the ring, trophozoite, and meront stages. Mature merozoites are then

PAGE 16

16 released from inf ected erythrocytes and invade other red blood cells (Bock et al., 2004) This asexual reproduction, also called merogony, is the portion of the life cycle in which this study takes place. Strategies of I mmune E vasion by B. bovis and their M ajor C omponents At least two strategies are employed by B. bovis to survive immune defense s (Allred and Al Khedery, 2004) of the host and promote long term persistent infection (Allred et al., 1994; Calder et al., 1996; Callow, 1963.; Mahoney et al., 1973) One strategy is the capability of B. bovis infected erythrocytes to cytoadhere to bovine endothelial cells and sequester in capillaries and post capillary venules (Callow, 1963.; Wright, 1972; Wright and Goodger, 1979) T he B. bovis IRBC surface Ag called variant eryth rocyte surface Ag 1 ( VESA1 ) has been linked to cytoadhesion in B. bovis and may serve the role of parasite ligand (O'Connor and Allred, 2000) The other significant strategy is the capability of the parasite to undergo antigenic variation a pro cess of co ntinually changing biochemical, immunological, and structural properties of parasite components on the IRBC surface, thus alter ing their immunological appearance. This strategy enables the parasites to e vade host immune response s and allows variant parasit es to persist. As the parasites mature, various i solate specific epitopes are exported and expressed on the surface of the infected erythrocytes The host responds to parasite antigens by producing antibodies when the population reaches a sufficient level to trigger immune defense s. Minor parasite populations expressing variant antigen forms are not bound by antibody and may continue development. The variant parasite population may thrive until it, too, reaches levels sufficient to elicit an immune response New antibodies may target the novel antigen forms expressed on the membrane surface (Allred et al., 1994) With regard to the components of antigenic variation,

PAGE 17

17 previous work has clearly identified VESA1, a size polymorphic, parasite derived protein doublet expressed on the IRBC surface as a key component of clonal antigenic variation (Allred et al., 1994; O'Connor et al., 1997) Therefore, both strategies employed by the parasites to establish persistent infection and evade host immune defense are linke d in B. bovis by VESA1. Mechanisms of A n tigen ic V ariation in O ther S imilar O rganisms With regard to the study of mechanisms underlying antigenic variation, evidence in other protozoa l parasites like Plasmodium spp. and T rypanosom a spp. may provide a framew ork to think about what is happening in B bovis Take Trypanosoma brucei for example. I t achieves antigenic variation by constantly changing its surface coat consisting of variant surface glycoprotein ( VSG ) This is accomplished primarily by replacing t he actively transcribed VSG genes in the a ctive telomeric expression site by a complete VSG gene or with segments from different VSG gene s or by switching among the approximately 20 potentially available expression sites (Borst and Ulbert, 2001) There ar e four demonstrated switch mechanisms used by T. brucei : duplicative transposition of a nontelomeric gene, telomere conversion, telomere exchange and in situ switch (Borst et al., 1998) In the first case, the VSG gene can be replaced by a duplicated nontelomeric gene. In the second case, the whole telomere containing the VSG gene may be replaced by the duplication of another telomere. In the third one, the telomere containing the VSG gene can be exchanged with another telomere. With all of these gene con version mechanisms working in T. brucei it can still achieve in situ switching as well, which involves the epigenetic switching of transcription of one VSG expression site to another expression site in situ without any associated DNA

PAGE 18

18 rearrangements (Borst et al., 1998) The variety of mechanisms employed in T. brucei suggested the possibility that B. bovis may also employ more than one mechanism. In the case of the human malarial parasite, Plasmodium falciparum the multicopy var gene family is responsibl e for encoding the antigenically variant erythrocyte membraneprotein 1 (PfEMP 1) (Baruch et al., 1995; Smith et al., 1995; Su et al., 1995) Each haploid parasite has about 60 var genes within its genome (Gardner et al., 2002) Antigenic variation is ach ieved by in situ switching of the var gene to be expressed and each time only a single complete gene is expressed while all the others are kept silent (Scherf et al., 1998) In situ switching involve s neither modification of the gene or its loss upon swit ching So the variant genes remain intact, and within a clonal population the repertoire of variant PfEMP1 molecules can be as many as the number of var genes (Allred and Al Khedery, 2004) I n situ switching in P. falciparum appears to be somewhat dependen t of var gene chromosom al location (Chen et al., 1998) and individual var genes have widely differing switch rates that would affect their frequency of expression (Frank et al., 2007; Horrocks et al., 2004) Mechanisms of A ntigenic V ariation in B. bovis It has been found that both cytoadhesion and antigenic variation in B. bovis are linked through VESA1 protein. This size polymorphic, heterodimeric protein is encoded by a large polymorphic ves multigene family (Allred et al., 2000) It is estimated from the analysis of genomic sequences that there are approximately 150 ves genes in the genome of B. bovis (Brayton et al., 2007) From evidence collected so far, only a single ves locus appears to be transcriptionally active at one time (Zupanska et al., 2009) This locus is referred to as the locus of active ves transcrip tion (LAT). The genomic organization of

PAGE 19

19 the current LAT is described here, which may facilitate the understanding of the mechanism underlying variation of VESA1 protein. The LAT has been cha racterized as a quasi palindromic structure containing two closely related but structurally different head to head ves genes. It is located in the B. bovis chromosome 1 in the C9.1 clonal line (Allred and Al Khedery, 2006) One gene within the LAT is a ves 1 gene which is known to encod e the VESA1a subunit VESA1a contains a cysteine and lysine rich domain(CKRD), a variant domain conserved sequences (VDCS) domain, C terminal cysteine rich (CTC) domain, and a pair of predicted coiledcoil domains (All red and Al Khedery, 2006; Allred et al., 2000) The apposing sequences encode a ves 1 gene, containing 12 introns. It has recently been identified to encode VESA1b polypeptides of the VESA1 protein doublet (Xiao, Y and Allred, DR; unpublished data). The VE SA1b polypeptide has a CKRD domain, a CTC domain, and a low complexity variant domain (LCV) which is typically absent from ves 1 gene s. The two genes are in a closely juxtaposed, divergently arranged orientation with a short intergenic region of only 433 bp (Allred and Al Khedery, 2006) I n B. bovis one established mechanism of antigenic variation for which demonstrative evidence is available, is segmental gene conversion. It is similar to a major mechanism in T. brucei (Borst and Ulbert, 2001) Trypanosoma e quiperdum (Roth et al., 1989) Anaplasma marginale (Kamper and Barbet, 1992) and many other organisms Through the duplication of short gene segments from ves donor genes to an actively transcribed ves 1 gene the current LAT pro gr essively becomes a complicate d mosaic comprised of a variety of short sequences from many other ves gene copies (Al Khedery and Allred, 2006) These gene conversion events likely are occurring during replication,

PAGE 20

20 although this has not been established. Thus the repertoire of potential ves gene products that may be expressed is efficiently expanded by mosaic gene formation without further expansion of the gene family. As in Trypanosom a spp., employment of a gene conversion mechanism does not rule out the possibility of other mechanisms contribut ing to antigenic variation. B ased on similarities between B. bovis and P falciparum it would not be unreasonable to postulate that similar mechanisms would operate in both species Given the high degree of overall similarity between the LAT and some sequence donor gene pairs in B. bovis it is likely that an in situ switching mechanism may also be used, although unlike P falciparum where in situ switching of intact gene copies occurs as the primary mechanism (Chen et al., 1998; Scherf et al., 1998; Smith et al., 1995) the frequency is likely to be low. Unique Structure of ves gene Pair and Intergenic Region Evidence collected so far suggests that many ves genes share structure s and orga nization s similar to that of the tightly juxtaposed quasipalindromic ves / ves pair of the current LAT (Al Khedery and Allred, 2006) Analysis of the available genome sequences of B. bovi s revealed 119 ves ad ditional ves genes of unknown types predicted to be missing in a chromosome 1 contig gap of about 150 kb. Among known ves genes, 24 loci are similar in their organizations to the current LAT, with paired ves / ves genes. 9 loci have paired ves / ves (B rayton et al., 2007) As to which ves genes may become the new LAT, the choices may be limited The analysis of bulk RNA from in vitro grown C9.1 line parasites detected only one single transcript species, which suggests that transcription among ves genes is mutually exclusive, with silencing of all but one gene copy (Zupanska et al., 2009)

PAGE 21

21 Alignment of the intergenic regions located between 6 of those paired ves genes including the LAT site, has revealed that th eir 400 450 bp intergenic regions are highly conserved in structure, organization and much of their sequence (Al Khedery and Allred, 2006) This region is a quasi palindrome, with each half containing two inverted repeats organized in an asymmetric pattern in each segment. A variety of evidence is available for the uniqueness of this Igr. W hen ves and ves transcripts derived from the LAT were analyzed several years ago t he putative transcriptional start site was identified by a cap independent 5 rapid amplification of cDNA ends (5' RACE) method (Allred et al., 2000) Native ves ves 1 tr anscripts have also been observed by 5' RACE to initiate within the LAT Igr from a variety of different start sites (AlKhedery B, Allred DR; unpublished data) The transcripts are heavily overlapping, suggesting that ves promoter activity is near the v es gene coding sequences, and vice versa Based on the facts that ves ves genes have overlapping 5' UTRs, and transcription start sites have been mapped to both halves of the IGr for both genes, its not unreasonable to expect some regulatory elements embedded within this region. In order to further study this region and gain insight into the regulation of ves gene expression, a transfection technology will be employed to serve the purpose to identify some possible regulatory elements within the I gr. Transfection System Transfection indicates the introduction of exogenous DNA into cells, often with a change of phenotype. This is most commonly achieved by the use of calcium phosphate electroporation or nucleofection to get DNAs across the cells p lasma membrane (Graham and van der Eb, 1973; Maasho et al., 2004; Neumann et al., 1982) It has been proven to be a robust genetic tool for unde rstanding gene function in several parasites

PAGE 22

22 including malarial parasites which share the intraerythrocytic lif estyle Transient transfection has provided t he opportunity to rapidly examine control of gene expression in malaria parasites and understand how gene expression is developmentally controlled (Crabb and Cowman, 1996; Goonewardene et al., 1993; Wu et al., 1996) Stable transfection provides the opportunity to express transgenes in parasites as well as to understand the functions of proteins by disrupting, modifying, or replacing the genes encoding them (Crabb and Cowman, 1996; van Dijk et al., 1996) Previo us work in the Plasmodium spp. demonstrated the feasibility of testing promoter activity of exogenous genes in intraerythrocytic parasites transfected by electroporation (Crabb et al., 1997; Crabb and Cowman, 1996; de Koning Ward et al., 2000) T he experience in malaria l parasites may shed light on setting up a transfection system in B. bovis but the latter will have its own distinctions and needs for further development. The development of a transfection system in B. bovis was still in the initial stage w hen this project started. It was first reported in 2004 when a group at Washington State University used transient transfection to test the hypothesis that the B. bovis rap1 IG region could promote extra chromosomal gene expression in vivo (Suarez et al., 2004) Recently, the same group has demonstrated another much stronger constitutive promoter: the intergenic region of elongation factor 1 alpha ( ef ) which is useful in transient transfection to enhance expression level of exogenous genes (Suarez et al., 2006) Besides conventional electroporation methods, nucleofection has also been demonstrated to work efficiently in B. bovis (Suarez and McElwain, 2008) The development of the

PAGE 23

23 transfection technology for both transient and stable expression of exogenous genes was recently reviewed (Suarez and McElwain, 2009b) This background of information provides a good start for the development of a stable transfection system in B. bovis for which additional efficient constitutive promoters are required. The init ial development of stable transfection system as well as preliminary characterization work was published to reveal that integration in the ef locus had occurred (Suarez and McElwain, 2009a) However, other recombination events were also noticed but furt her characterization was not performed, and our understanding of the process is highly inadequate. Therefore, further development of an integrationdependent transfection system for genetic manipulation of B. bovis is entailed. Among the several methods of transfection I mentioned electroporation is a widely used technology to get DNAs across the cells plasma membrane in the study of hemoparasites. Next, Ill give a brief introduction about electroporation. Mechanism Underlying Electroporation Electropor ation is a membrane phenomenon which involves fundamental behavior of cell and artificial bilayer membranes. Electropermeabilization of cells mainly involves the interaction of the electric field with the lipid portions of the cell membrane (Weaver, 1993) The transient aqueous pore theory describes the features of electropermeabilization. The elevated transmembrane voltage creates pores and provides a local driving force for molecular transport of charged molecules (Kinosita and Tsong, 1977) This is the m ajor technology used in my study to load red blood cells with exogenous DNAs.

PAGE 24

24 Promoter Structure Eu karyotic promoters are diverse and difficult to characterize. They typically lie upstream of the gene and can have regulatory elements several kilobases away from the transcriptional start site (Nelson and Cox, 2008) C ore promoters for RNA polymerase II were originally thought to be invariant, however, they have been found to be considerably str ucturally and functionally diverse, and the diversity makes an im portant contribution to the combinatorial regulation of gene expression (Butler and Kadonaga, 2002) Bidirectional promoter is p romoter sequences between divergently transcribed neighbouring gene pairs that initiate transcription in both directions Comput ational analysis of human genome sequences and full length cDNA libraries has identified gene pairs that are arranged head to head on opposite strands with less than 1000 base pairs separating their transcription start sites (Adachi and Lieber, 2002) A bi directional promoter regulates the transcription of a gene pair whose levels may need to be coordinately expressed (Hansen et al., 2003; Maxson et al., 1983; Schmidt et al., 1993) The technology of transient transfection has made it possible to investiga te the control of gene expression. Take Plasmodium spp. for instance. Several promoter regions of P. falciparum have been dissected, including those from the HSP86, HRP3, DHFR TS, and calmodulin (CAM) (Crabb and Cowman, 1996; de Koning Ward et al., 1999; Wu et al., 1996) Hypothesis Expanding upon evidence collected in the past, we proposed the hypothesis that in B bovis antigenic variation may occur by in situ switching of transcriptional activity from the current LAT to another previously silent gene pair. This project was aimed at

PAGE 25

25 providing a test of that hypothesis. To achieve this goal, a transfection system was proposed in B. bovis to be used to manipulate the expression of ves genes. Functional and mechanistic analysis of the parasite genes was pr oposed to be accomplished by using positive selection for maintenance of circular plasmids carrying drug selectable markers. Specifically, I attempted to induce a switching of the LAT by positive selection for the activation of a different ves locus. Given the mutually exclusive transcription of ves locus, I hypothesized that such a switch would be accompanied by the silencing of the current LAT. For success in this strategy, it would be necessary to be able to achieve integration dependent stable transform ation of B. bovis As no technology existed to achieve this goal at the time this project was started, I first initiated the development of this technology for B. bovis In addition, I proposed to take advantage of transient transfection to study the trans criptional regulation of B. bovis ves genes by pursuing another specific hypothesis: regulatory elements are embedded within the uniquely organized compact Igr of LAT.

PAGE 26

26 CHAPTER 2 FURTHER DEVELOPMENT OF A TRANSFECTION SYSTEM FOR THE GENETIC MANIPULATION OF BABESIA BOVIS Abstract Babesia bovis is an intraerythrocytic parasite which establishes and maintains a persistent infection in its bovine host by at least two mechanisms: cytoadhesion and antigenic variation. In order to facilitate the study of genetic m echanisms, I further developed a transfection system in B. bovis as a technical basis for targeted genetic manipulation of this parasite. I have determined that B. bovis parasites are adequately susceptible to puromycin, blasticidinS and pyrimethamine pr oviding the possibility of positive selection and maintenance of transfected parasites and making stable transformation feasible In developing this approach I have established a transient transfection system employing firefly luciferase expression to compare promoter activities, and have demonstrated that the I grs of the LAT and two transcriptionally silent ves donor gene pairs all display very strong promoter activities, a t levels comparable to promoter from the housekeeping gene calmodulin. Transient ex pression of enhanced green fluorescent protein whose expression is driven by a ves promoter has revealed there is no strict ves promoter counting in the parasite when only promoter sequences are present. Thus, ves gene expression from the LAT was unaffected while the episomal vector expressing EGFP was replicating and transcriptionally active extrachromoso mally. Stable transfection of the parasite has also been achieved, revealing a nontargeted integration event with stable expression of gfp bsd protein in the transfectants which s uggest s it may be difficult to reproducibly achieve the specific genetic alterations desired. These observations provide key background knowledge and reagents for deliberate genetic manipulation of B. bovis

PAGE 27

27 Introduction Babesios is is an emerging zoonotic disease which has a great impact on the health of a wide range of domestic and wild animals, mainly in tropical and subtropical regions (Gray et al., 2002) The bovine hemoparasite, B abesia bovis causes huge losses of livestock on a worldwide basis. Therefore, research into the disease carries the potential for having considerable economic impact. In the past few years, a transfection system has been initiated in B. bovis in order to obtain insight into the function of parasite genes. T ransient transfection of B. bovis was first reported when the rhoptry associated protein1 ( rap1) intergenic region was used to promote transient gene expression (Suarez et al., 2004) However, rap1 promoter was relatively weak, when compared to t he intergenic region of ef 1 ( Elongation Factor 1 ) genes. The ef 1 gene was found to contain strong promoters able to promote expression of foreign genes efficiently in transiently transfected parasites (Suarez et al., 2006) Taking advantage of this e f 1 IG region, stable transfection was then attempted. Stable integration of the chimeric gfpbsd gene, encoding a Green Fluorescent Protein and blasticidin deaminase fusion protein, into the B. bovis genome was recently achieved. In this study, ef 1 IG region was able to drive the expression of gfpbsd, which was integrated mostly through double crossover recombination (Suarez and McElwain, 2009a) However, there was sign of additional nonhomologous site of integration revealed using one of the probes, together with evidence of double crossover recombination. This indicated the occurrence of other re arrangements involving the ef 1 locus. During my attempt of stable transfection using the same construct, I found it hard to reproducibly achieve these specific genetic alterations in B. bovis Moreover, in

PAGE 28

28 order to explore more biologically significant questions, theres a need for additional promoters and more efficient regulatory sequences, so as to determine if the ves multigene family could be targeted. Here, I present additional promoters, including a ves promoter, all of which are able to drive the transcription of firefly lucife rase efficiently. These compliment those already available and may broaden the possible applications as a result. The development of both transient and stab le transfection technologies, together with the release of the full genome sequence of the T2Bo isol ate of B. bovis (Brayton et al., 2007) will greatly improve the opportunities for genetic manipulation of the parasite and significantly contribute to our understanding of its biology. Material s and Methods Parasite Culture B. bovis parasites of the C9.1 clonal line were cu ltivated in vitro under microaerophilous conditions, as described before (Allred et al., 1994) Briefly, parasites were cultured in a settled layer of bovine erythrocytes at 10% packed cell volume (PCV) in M199 supplemented with 40% adult bovine serum and 26 mM sodium bicarbonate (M199) under an atmosphere of 5% CO2, 5% O2, and 90% N2 Preparation of Bovine Serum and Erythrocytes and B. bovis Immune Serum at 37 C. Culture volumes well plates. Cultures were maintained at a parasitaemia between 1% and 5% by daily dilution with uninfected e rythrocytes in culture medium. Blood collected from a normal bovine donor was defibrinated by shaking with glass beads, followed by centrifugation for 30 min at 4 C at 4000x g to pell et erythrocytes. Serum was centrifuged again to remove remaining particulates, frozen at

PAGE 29

29 20 C, and stored until use. Erythrocytes were washed four times in VYMs buffer, kept at 4 C and used for maximally 45 days. Luciferase Plasmid DNA Construction A nu mber of different plasmids were used in the transient transfection experiments. A promoterless pGEM LUC reporter vector was purchased from Promega (Madison, tubulin gene were amplified by PCR from genomic DNA of B. bovis C9.1 clonal line using oligonucleotides (XW23: 5 C[GAGCTC]ACATAGTATAACCTTATTGCATAAGTTCAC 3) and (XW24: 5 C[GAGCTC]AGAAGCGTGAATATGCCTTG 3). The resulting PCR product was digested with Sac I and cloned into the Sac I site downstream of lucife rase coding sequences in pGEM tubulin 3termination sequences was denoted as pLUC T3 (Figure 21D; Figure 2 2B). It was used as a promoterless negative control, as well as the template for all pLUC constructs. For the construction of plasmids using the 5 regulatory sequences of housekeeping genes, the 1397 bp of 5 sequences of calmodulin was amplified using (XW17: 5 CC[AAGCTT]TACCGAGAAGAGCCTGCAAC 3) and (XW18: 5 CC[AAGCTT]GTATTTAATAATATTAAATTGCTAATACTG3). Th e resulting amplicons were digested with Hind III, and cloned to the corresponding site in pLUC T3 to yield plasmids pC5 LUC. For the construction of plasmid using ves gene 5 sequences, the 678 bp upstream of start codon of ves phagemid 61, as described previously (Allred and Al Khedery, 2006) using oligonucleotides (XW25: 5 GC[AAGCTT]GGAATCATACAGTAGGTCCTTC 3) and (XW26: 5 GC[AAGCTT]TGTCAGTGCTTCTAGGAGTACTCAG3). The resulting PCR product wa s digested with Hind III, and cloned into the Hind III site of pLUC T3 to

PAGE 30

30 1 and intron 1 of ves 1 The orientation of insertion was determined by digestion mapping. Plasmids with correctly inserted 5 sequences were used as major constructs. Plasmids with reversely inserted 5 sequences served as reverse promoter controls. The resulting constucts were designated as pC5F LUC, pC5R Calmodulin, V : v es 1; F: forward orientation, R: reverse orientation). Figure 21A and B as well as Figure 2 2 A show these plasmids. Figure 21C shows the positive control IG, which is a gift from Dr Carlos Suarez. It has previously been shown to cont ain a strong promoter (Suarez et al., 2006) For the construction of an internal control plasmid, a fragment of 2726 bp tubulin 3 sequences were removed from pC5F LUC construct by digestion with BamH I and Sac I. Consequently, this was replaced by a fragment of 1595 bp containing 933 bp of R. reniformis luciferase gene plus 662 bp of polyadenylation sequences from P. falciparum calmodulin This fragment was obtained by digestion of pPfrluc plasmid DNA with Bam H I and Sac I. pPfrluc was a gift from Dr Diane Wirth (Militello et al., 2004; Militello and Wirth, 2003) and provided to us by Dr. Tonya Bonilla. The resulting plasmid was named pC5 Renilla C3 as shown in Figure 2 1E and Figure 22C. EGFP Plasmid DNA Con struction tubulin were amplified by PCR from genomic DNA extracted from B. bovis clonal line C9.1, using oligonucleotides (XW21: 5 CC[AAGCTT]GAAACTCGCATCGCTCTAAAC 3) and (XW22: 5 CC[AAGCTT]CTATTGTTACACTACAGAAT GTAACATGAAC 3). This was cloned

PAGE 31

31 into the Hind III site of pEGFP 1 ( BD Biosciences Clontech San Jose, CA). A similar construct was created with the 678 bp of 5 upstream sequences from the ves fragment described earlier. Figure 2 6A shows these tw o plasmids. All plasmids described above were confirmed by restriction mapping. The inserts were confirmed for proper construction by DNA sequencing. All constructs maintain the start codon of the firefly luciferase gene. Detailed Procedures for Transient Transfection Preparation of p lasmid DNA for t ransient t ransfection of Luciferase c onstruct P lasmid DNA s were prepared using EndoFree Plasmid Purification Mega Kit (Qiagen) or Maxi Kit (Qiagen) following manufacturers instructions. Plasmid DNA was dissolved in 0.5ml endotoxinfree Buffer TE To determin e yields, DNA concentrations were measured by UV spectrometry and quantitative agarose gel s were also run to confirm concentrations by comparison with standard marker s Before each tran sfection, isolated pl asmid DNA wa s diluted in cytomix (120 mM KCl, 0.15 mM CaCl2, 10 mM K2HPO4/KH2PO4 pH 7.6, 25 mM HEPES pH 7.6, 2 mM EGTA, 5 mM MgCl2Electroporation and t ransient transfection of parasites final pH 7.6) and stored at 4 C The day before transfection, smear s were made and stained with a Giemsalike quick stain to determine the percent parasitized erythrocytes ( ppe ). C ulture s were adjusted by feeding appropriate amount of RBC and media to give 6 15% ppe the next day. For transfecting IRBCs, parasite culture s were harvested into sterile 15ml conical tube s and centrifuged at 4000x g for 10 min at 4 C. T he supernatant was discarded and the cell pellet was washed two times with excess cytomix to remove any antibiotics,

PAGE 32

32 which may reduce transfection efficiency. For each transfection, 100 l packed infe cted RBCs (ppe: approx. 10%) were electroporated with 11.5 pmol of transfection construct DNA and 3.8 or 7.7 pmol of pC5 Renilla C3 mixed together in approx. 150 l DNA/VYM suspension at 1.25 kV 25 F capacitance, an d 200 resistance in a 2mm gap cuvette (Fisher Biotech) Transfected cells were then transferred into 6 well plate s containing 3ml complete medium containing uni nfected erythrocytes at 2.5% PCV (Packed Cell V olume) An attempt was also made to pre load erythr ocytes with transfection constructs to determine whether parasites may be passively transfected. For the RBC pre loading method, 200 l packed RBCs wer e transfected with 1 1.5 pmol DNA and 7.7 pmol pC5 Reni lla C3 in approx. 200 l DNA/VYM suspension at 0.31 kV 1.07 mf (maximum) capacitance 200 resistance in a 2 mm gap cuvette and transferred into one well in a 6 well plate containing 3 ml complete medium. Then, 2 ml infecte d RBCs with 10% pcv and over 5% ppe were added into each well to allow parasites to take up DNA spontaneously. Post trans fection mai ntenance and sample preparation On the day following transfection the medi um wa s changed and 50l of packed RBC s were added into each well. At the desired time point post transfection, RBCs wer e collected into 2ml microcentrifuge tubes and sedi mented by c entrifugation at 4000x g for 10 min, followed by two washes under the same conditions, with 1x VYM. Parasites wer e then released by NH4Cl Tris lysis (Martin et al., 1971) A 0.8% (w/v) ammonium chloride solution was prepared using deioni z ed water To each 90 ml of this solution 10 ml of 0.17 M Tris buffer (pH 7.65) were added, and the final pH of the buffered ammonium chloride solution was adjusted to 7.4 at room temperature. The solution was

PAGE 33

33 warmed to 37 C prior to use. The microcentrifuge tubes were i nvert ed gently about 70 times, then incubate d on ice f or 10 min. T he lysates were verified visually to be translucent before they were c entrifu ge d at 12000xg for 10 min. Parasites were pelleted and washed with 1xVYM two times under the same conditions, then lysed with 100 l freshly prepared Passive Lysis Buffer (Promega Madison, WI) for 25 min. Dual Luci ferase reporter assay (Promega) T he required volume of P assive Lysis Buffer working stock was prepared immediately before use by adding 1 volume of 5x Passive Lysis Buffer to 4 volumes of distilled water. After each use, 400l was saved for buffer control According to the manufacturers protocol, the Firefly and Renilla luciferases contained in the cell lysates prepared with PLB are stable for at least 6 hours at RT, and up to 16 hours on ice, up to one month at 20 C or long term storage at 70 C Luciferase Assay Reagent II (LAR II) was prepared by resuspending the provided lyophilized Luciferase Assay Substrate in 10 ml of the supplied Luci ferase Assay Buffer II (Promega). According to the manufacturers instructions, aliquots of LAR II reagent are stable for one month at 20 C or for one year when stored at 80 C according to manufactures manual Accordingly, LARII was stored for a maximum of one month at 20 C prior to use. T he required volume of Stop&Glo Reagent (Promega) was prepared right before each assay by adding 1 volume of 50x Stop&Glo Substrate to 49 volumes of Stop&Glo Buffer. According to manufacturers instructions, aliquots may b e sto red at 20 C for up to 15 days. Both Firefly and Renilla luciferase activities were quantified with a MicroBeta Jet scintillation spectrometer (PerkinElmer San Jose, CA ) A twenty four well white plate

PAGE 34

34 counting protocol wa s set up to perform a 10se cond measurement for each reporter assay without any pre measurement delay or mixing. Ly sates from the same triplicate group were carefully laid out in the manner they were to be assayed so as to be read simultaneously No samples were positioned immediately next to each other to avoid crosstalk between wells. To enhance accuracy and minimize background, readings were performed in several steps. First, the white 24well plate support f rames 1450102 (PerkinElmer) were cleaned by ethanol and luminescence wa s measured for the empty support frames. The frame with the lowest background wa s chosen. Secondly, the 24 well sample plates 1450 402 (Wallac Oy Finland ) we re inserted into this support fram e one by one, and luminescence was measured for each sample plat e. Thirdl y, thawed or freshly prepared lysates were centrifuged for 2 min at 12000 xg at room temperature. The 100 l of cleared extracts were dispensed into the wells. Background liquid luminescence was recorded three consecutive times. The average readin g of each well from the last step was then subtracted from luciferase activity measurement s taken from the same well Before starting luciferase assay procedures, both reagents were warmed to room temperature. A multichannel pipette r and reagent reservoir s were used to dispense 100l LAR II to all wells to ensure simultaneous reaction of luciferin substrate and firefly luciferas e. Firefly luciferase activity was measured, immediately followed by the add ition of 100l Stop&Glo reagent to all wells by multich annel pipetting. Renilla luciferase reading s were then taken. Readings from mock transfected parasite lysates were subtracted from all renilla luciferase readings. After the measurement and processing of all renilla luciferase activity, t he level of firefl y luciferase activity was normalized to the

PAGE 35

35 level of Renilla reniformis luciferase activity. Triplicate experiments were repeated at least three different times. Biostatistical Analysis of Promoter Activities The normal ized luciferase activities were plott ed using Microsoft Excel as the mean standard deviation, calculated from the triplicate samples. Differences in promoter activities were determ ined by twosided two sample t test, usin g SPSS program (SPSS, Chicago, IL) T he calculated P values are listed in Table 2 1. If the P value is below the threshold value chosen for statistical significance (P = 0.05 for this study), the two promoter activities are considered significantly different. Transient Tranfection of EGFP Constructs and Live Cell IFA Similar ly to the luciferase constructs, 11.5 pmol of EGFP constructs were transfected into B. bovis C9.1 IRBCs to allow uptake of the DNAs and expression in vivo as described in the previous sections. Expression of green fluorescent protein was detected by fluorescence microscopy. Livecell immunofluorescence assays (liveIFA) were performed essentially as described (Allred et al., 1993) using polyclonal antibody R6a v1 765 as primary antibody. Bound antibody was localized with Chicken anti rabbit IgG Alexa594, and the signal was visualized by fluorescence microscopy Antibiotic Sensitivity Assay The sensitivity of B. bovis to various antibiotics was performed by measuri ng the inhibition of h ypoxanthine incorporation, as described in (Desjardins, 1979) Briefly, C9.1 parasites were cultured to a parasitemia of 0.5%. Drug powder was initially dissolved in distilled water to make a 10mg/ml stock. VYM s (1x) was used to make two fold serial dilution s ranging from 1mg /ml to 1g/ml for puromycin, threefold dilutions ranging from 12mg/ml to 0.2 g /ml for pyrimethamine and fourfold dilutions ranging

PAGE 36

36 from 64mg/ml to 1 g /ml for blasticidin. A constant volume of 225l of the para sitized e rythrocyte suspension and 25l of drug solution were distributed into the wells of a 96 well plate, using a multichannel p ipette r Therefore, t he final drug concentration in the well was 1/10 that of the working stock. The first row in each colum n contained no drug, serving as a parasites only negative control The last row in each column served as non parasitized erythrocyte control, without drug or parasites. After a 24h incubation period, 25l of [3H]hypoxanthine in culture medium (0.5Ci) was added to each well. After an additional 18h of incubation, parasites were harvested, using an automatic cell harvester following manufacturers instructions. Scintillation counting was performed on a MicroBeta Jet scintillation spectrometer (Perkin Elmer) Each compound is present in tri plicate columns. D ata were averaged in Origin Pro 8 IC50 and IC90Stable Transfection and Drug Selection values were determined by fitting a sigmoidal inhibition curve to the data points. OriginPro 8 (Originlab; Northampton, MA) was used to perform analysis and plotting of the data. Electroporation procedures for stable transfection were performed in the same way as described in the previous sections, except that the plasmids were linearized by adding restriction enzyme in the electroporation cuvette first. Four hours post transfection, the cells were placed under selection with 6.25, 12.5 or 25g/ml of blasticidin, and monitored for up to 6 weeks for surviving parasites. Fresh drug in fresh complete medium was replaced on a daily basis. Fresh RBCs were supplied every 3 days at 2.5% PCV in complete medium. Ten days post transfection, drug pressure was removed for 11 days, but was resumed at the original concentration as soon as parasites became detectable by light microscopy. Parasites expressing GFP blasticidin s deaminase fusion protein were detected by fluorescence microscopy. Drug pressure was increased up to

PAGE 37

37 50g/ml (108.8M) which was lethal to wild type parasites. Maintenance of the transfected parasites is normally per formed at 25g/ml (54.4M) of blasticidin. Western Blot Analysis To confirm the expression of GFP BSD fusion protein, stably transfected parasites were subjected to SDS PAGE and analyzed by Western blot, as described previously (Allred et al., 2000) Antig en was detected with anti GFP antibody (Roche, Indianapolis, IN) at a dilution of 1:2000. The immunoblots were developed with goat anti mouse HRP antibody and detected with SuperSignal (ThermoPierce; Rockford, IL). Southern Blot Analysis Genomic DNA was e xtracted by a classic sodium dodecylsulfate and proteinase K, phenol chloroform procedure essentially as described (Tripp et al., 1989) with the modification that most hemoglobin had been released by treating C9.1 IRBCs with 0.05% saponin in PBS. The para site pellet was then lysed in 0.5ml TE buffer containing 1% Sodium dodecylsulfate (SDS). Lysates were then treated by 100g/ml proteinase K for 2 hours and 40g/ml RNaseA for an additional 1 hour. Digestions were followed by phenol and chloroform extractions, and ethanol preci pitation. To prepare blots, 1.5 g gDNA and 0.5 ng plasmid DNAs were digested with Not I and Bgl II for 3 hours. Digested DNAs were fractionated on 0.8% agarose gels in TAE buffer at 70V for 4~5 hours. Gels were exposed to intense UV lig ht for 5 minutes to nick DNA to increase transfer efficiency. The locations of size standard markers were spotted on the gel before the gel was rinsed briefly in distilled water. DNAs were then denatured with denaturing solution (1.5M NaCl, 0.5 N NaOH) in two 15min incubation. The gel was neutralized in neutralization buffer (1 M Tris HCl, 1.5 M NaCl, pH 7.45) for 30 min, followed by 10x SSC (3 M NaCl, 0.3 M Na citrate, pH 7.0) for 10 min. DNA was then transfered onto Hybond N+

PAGE 38

38 membranes (GE healthcare; Pi scataway, NJ) in 10x SSC overnight following standard procedures (Sambrook, 2001) To fix the DNA on the membrane, the blots were subjected to UV crosslinking in a Stratalinker 2400 UV Crosslinker (Stratagene; La Jolla, CA) at 120mJ. Probes were labeled wi [32P]dCTP by random priming extension with Klenow polymerase, following manufacturers instructions (DECAprimeTMII Random Priming DNA Labeling Kt; Ambion). The blots were incubated in prehybridization solution supplemented with denatured 50 g/ml salmon sperm DNA for at least 3 hours at 55C. ( 1 liter pre hybridization solution was made by mixing 250 ml 1M NaH2PO4, pH 6.0, 300 ml 20 SSC, 15g Na4P2O7Fluorescence microscopy 10 H2O, 200 ml 50 x Denhardts solution, 25ml 20% SDS and 225 ml distilled water, 0.45 m filter ster ilized) Blots were then hybridized overnight with probe in 5ml hybridization solution (same recipe as pre hybridization solution) at 65 C. The blots were washed stringently three times for 20 min. each with 0.2XSSC/0.5%SDS at 60 C. Finally, the membrane was exposed to film (Hyperfilm MP; GE Healthcare) at 80 C for 8 to 24 hours before developing. The fluorescence was detected on an Olympus BX50 microscope fitted with a 100x oil immersion (NA 1.3) phase contrast objective. Images were captured with a Retiga 1300B cooled CCD camera (QImaging; Surrey, BC). Images were processed using IP Lab (Scanalytics, Inc.; Rockville, MD) and ImageJ version 1.8.2 (http://rsb.info.nih.gov/ij/) software. Experimental Results Expression of Luciferas e and C omparison of Heterologous Promoter Activity In order to determine whether regulatory elements could be detected in the 5 sequences of housekeeping genes or the ves

PAGE 39

39 sequences from both gene classes, in both orientations, into the luciferase expression vector, upstream of the luciferase coding sequences (Figure 2 1A B ; Figure 2 2A). The abilities of these sequences to drive the transcription of exogenous genes in vivo by transient transfection were then tested tubulin and calmodulin were chosen as they are likely to be transcribed throughout development in B. bovis and with minimal fluctuation. The results are shown in Figure 2 3 and P values calculated from t test are shown in Table 21. Calmodulin 5 sequences generated significant amounts of firefly luciferase activity compared to promoterless control when introduced into B. bovis parasites (P=0.0063), indicating a promoter embedded in this region. Reversely inserted upstream sequen ces of calmodulin gene did not effect expression of the marker gene; the amount of luciferase activity was not significantly different from the promoterless; negative control (P=0.3974). Surprisingly, ves promote a very high level of luciferase activity when the promoter sequences tested were placed in their normal orientation relative to coding sequences (P=0.0156). Firefly luciferase luminescence values, normalized with the Re nilla luciferase values from the same samples, were almost twice as high as those of the positive control containing the demonstrated strong promoter, ef IG fragment B (Suarez et al., 2006) (P=0.0364). This result indicates that this region contains a very strong promoter. The cloned upstream sequences of the ves not only the 434 bp shared intergenic region of the LAT ves gene pair, but also exon 1 and intron 1 of the apposing ves oriented controls did not display much promoter activity (P=0.0743). When inserted in the reverse orientation, the exon 1 and intron 1 sequences would lie between ves 5

PAGE 40

40 sequences and the start codon of the luciferase gene, resulting in interference with normal folding of protein structure. The coding sequences of the ves correct folding and stability of luciferase protein. Transfection Methodology While working out the transient transfection system, a series of experiments aimed at optimizing transfection conditions wer e performed, as well as alternative strategies for loading DNA. In P. falciparum successful transient transfection has been achieved without even exposing the parasites to electric current, i .e, by preloading red blood cells with exogenous DNA and allowing parasites to invade afterwards (Deitsch et al., 2001) It was determined previously that, using the condition of 150 V, 1000 F, and 70 transfect, it is possible to load bovine RBCs with exogenous DNA which is degraded exponentially, with a t1/2 of approximately 10.25 hours (Appendix Figure B 1). However, from numerous trials using various electroporation conditions, I have found tha t preloading bovine erythrocytes with exogenous DNA to facilitate transfection of B. bovis parasites does not result in the transfection of B. bovis at detectable levels. Another distinct difference in the sample preparation of transiently transfected B. b ovis in contrast to Plasmodium spp., is that saponin lysis does not work well in B. bovis in contrast to Plasmodium spp. Saponin lysis is widely used in Plasmodium spp to release extra hemoglobin before lysis of the parasite. However, the use of saponin on B. bovis IRBC resulted in the extensive loss of luciferase protein together with the release of hemoglobin (Figure 2 4). The luciferase expression is not significantly different from mock transfected parasites (P>0.05 data not shown). This loss did not occur when IRBCs were lysed by the NH4CL Tris lysis method (Martin et al., 1971) It is apparent that each of the

PAGE 41

41 different species presents distinct advantages as well as disadvantages for investigating parasite biology. Transient DNA stability in transfe cted red blood cells may be confirmed by a zap twice strategy. Bovine erythrocytes were preloaded with exogenous DNA first under low voltage/ high capacitance conditions 150 V, 1.07 mf, 200 allowed to invade the loaded erythrocytes i mmediately. Four hours later, erythrocytes were collected from the wells, washed three times with 1x VYM to remove residual DNA from the medium. The parasitized erythrocytes were put back into an electroporation cuvette and electroporated again under high voltage low capacitance conditions. This was followed by standard procedures of parasites culture, sample preparation and luciferase assay. Among the numerous tests in preliminary experiments, I detected luciferase expression at an appreciable level only once (data not shown), and at a much lower level than the luminescence signals recovered from parasites loaded by the standard method. Therefore, this approach is yet to be optimized before any conclusion about feasibility could be drawn. Besides the loadin g strategy, I also tested the kinetics of luciferase expression after transfection with expression vector with ves promoter, in an attempt to optimize the time point to collect transfected parasites for luciferase assay. T he time course of luciferase expression after transfection with p 5 plasmid was determined with samplings at 1, 2, 3, 4, 9, 12, 24, 48, 72 and 96 h (Figure 2 5) Of the time points examined, detectable luciferase signal was observed as early as 1h after transfection Importantly, th e peak signal appeared at 24 h after transfection with easily quantifiable luciferase expression from 8 h to 24 h post transfection. However, when it has passed the time point

PAGE 42

42 of 24 h, the expression declined afterwards in an almost linear fashion. The pat tern of Renilla luciferase expression was a little different from that of Firefly luciferase expression. This is not surprising as these two reporter genes were regulated by different promoters. In this experiment, Firefly luciferase was driven by the ves promoter (including exon1 and intron 1 of the apposing ves 1 gene), whereas Renilla luciferase was driven by the calmodulin promoter. The time point of peak signals for Firefly luciferase expression with ves promoter was 824 hours, consistent with previous observation of luciferase expression driven by ef IG B promoter (Suarez and McElwain, 2008) The peak signal for Renilla luciferase expression appeared even earlier at 8 hour post transfectionwith a slow decrease after that. Luciferase activities were still considerable at 48 and 72 h, indicating that a significant fraction of transfected paras ites expressing luciferase remain viable and able to infect erythrocytes. The ratio of Firefly luciferase expression over Renilla luciferase expression start ed to rise at 1h, forming a pl ateau from 4 to 7 hours, then started rising again until it reached a peak at 24 hour followed by a gradual drop. Therefore, the time point we chose to collect and assay all the samples was set at 24 hours post transfection. C oexpression of EGFP and VESA1 In addition to transient expression with the luciferase gene, a second reporter gene encoding enhanced green fluorescent protein, EGFP, was also tested. EGFP is a red shifted enhanced fluorescence yield mutant form of Aequorea vitoria green fluorescent protein. The 5 sequences of tubulin and v es were subcloned into the promoterless vector pEGFP 1. Green fluorescence could be detected within a small proportion of the parasites at 24h post transfection, as shown in Figure 26. Immediately following that, a live cell immunofluores cence assay was performed on the parasites transfected with

PAGE 43

43 plasmid containing v es promoter, which was able to provide information on the developmental timing of EGFP expression and its correlation with VESA1 protein expression on the IRBC surface. Polyc lonal antibody R6 and monoclonal antibody 4D9.1G1were used to recognize VESA1b antigen and VESA1a antigen, respectively, on the surface of red blood cells (Y Xiao and D.R. Allred, submitted data). Significantly, as shown in Figure 27, this assay revealed red fluorescent I RBC s, which labeled parasites expressing from LAT, harbor ing parasites of both the trophozoite and merozoite stage s which also demonstrated green fluorescence. B. bovis parasites continue to express ves genes from the LAT while an episomal vector driven by LAT ves promoter sequences is maintained extrachromosmally in an active state. Antibiotic Sensitivity Assay for Developing Stable Transfection in B. bovis Besides the further development of the transient transfection system, we also worke d on the stable transfection system, with characterization of the stably transfected parasites. In order to develop an integrationdependent transfection system, with the employment of a transfection vector carrying a selectable marker, it is essential to use well characterized susceptible and resistant strains of the parasite in the genetic manipulation of the genome. The antibiotic sensitivity assay provided quantitative measurements of the competence of compounds to inhibit parasite growth, based on the inhibition of incorporation of a radiolabeled nucleic acid precursor by the parasites during short term cultures in microtitration plates. Based on p revious work in the lab as well as experience from P lasmodium spp. (Mamoun et al., 1999) I chose to test t he following drugs: blasticidin S, hygromycin, puromycin, pyrimethamine As shown in Figure 2 8, puromycin and blasticidin S were

PAGE 44

44 both found to be effective and to provide adequate selection for the two day assay. B. bovis was found to be very sensitive to puromycin at co ncentration s as low as 2.1 M after only 5 cycles of reproductive replication. The IC50 for puromycin was found to be 0.74 M and the IC90 8.9 M. Transfection constructs carrying the pac ( Puro mycin N Acetyltransferase) gene will encode resistance to puromycin (de Koning Ward et al., 2000) The bsd gene encodes a deaminase that converts the potent inhibitor blasticidinS into a nontoxic deaminohydroxy derivative (Yamaguchi et al., 1975) B. bovis C9.1 parasites were found to be susceptible to blasticidin S with an IC50 of approximately 8.7 M and IC90 of about 58.8 M. B. bovis is sensitive to pyrimethamine at 59.5 M, with an IC50 of approximately 1.73 M but IC90 over 764 M. Pyrimethamine was found to be most effective after an extended p eriod of incubation (data not shown). However, pyrimethamine may be more prone to the selection of naturally drug resistant mutants, and spontaneous mutations in the DHFR TS gene may easily be selected, as has occurred in malaria parasites (Gatton et al., 2004) This could potentially be overcome by the use of WR99210, which also inhibits parasite DHFR TS (dihydrofolate reductasethymidylate synthase) but is less prone to the de velopment of natural resistance. Data points were fitted to hill curves, which is an analytic method frequently used in pharmacology to describe the r esponse of an organism as a function of drug concentration (Heidel and Maloney, 1999) Each of the three drugs was considered to be use able in stable transfection of B. bovis to provide strong selection of transfected cells However, to avoid potential problems, I chose to avoid the use of pyrimethamine in favor of blasticidin s or puromycin. In contrast, neomycin, hygromycin, and chloramphenicol were all found to be without effect in B. bovis (data not shown).

PAGE 45

45 Drug selection and Stable Expression of GFP BSD Fusion Protein With a functional promoter and suitable selection conditions, the transfection system can be applied to more complicated project s Bovine erythrocytes infected with B. bovis C9.1 parasites were chosen as the target cells for introduction of DNA and development of stable transfection. To select transgenic parasites, constructs harboring a bsd gene that could impart blasticidin resistance were tested. For the two constructs tested, as shown in Figure 29A and B, the bsd gene was flanked by the 434 bp of 5 sequences of ves tubulin and the cell differential family protein coding sequences. One construct, pDS BSD (kindly constructed by Daniele Swetnam), additionally possessed 1 kb of sequences from the 5 end of a ves like gene 1.8 kb downstream of the LAT (Figure 29A). It was intended to target the plasmid into the parasites genome by single crossover homologous recombination. Fi gure 2 9B shows a second form of the plasmid carrying truncated targeting sequences, which was included in an attempt to enable essentially random targeting to nearly any ves Igr. The schematic representation of how pDS BSD is anticipated to target the gen ome is given in Figure 29C. Plasmid pgfp bsdef, which was a gift from Dr Carlos Suarez and had previously been shown to stably transform B. bovis (Suarez and McElwain, 2009a) was used as a positive control. A schematic representation of this vector, the expected integration site, as well as how the genomic locus would be anticipated to look after integration are given in Figure 2 10, which is adapted from (Suarez and McElwain, 2009a) Parasitized erythrocytes were transfected with the constructs in linearized form. This was done because linearization increases the frequency of recombination as linear DNA ends appear more recombinogenic (Cruz and Beverley, 1990; Lee and Van der Ploeg, 1990;

PAGE 46

46 Nunes et al., 1999; ten Asbroek et al., 1990) Four hours after tr ansfection, the parasites were exposed to 13.6 M or 27.3 M blasticidin S. Drug pressure was removed 11 days post transfection, but resumed at original concentration as soon as parasites became detectable again under microscope. Initially, drug selection at lower concentrations was attempted, but only spontaneously resistant parasites were selected (data not shown). Following selection at the higher concentrations of drug, drug resistant parasites in the well transfected with the positive control plasmid, pgfp bsdef first showed up around 20 days post transfection. The parasites grew very well under high drug pressure up to 54.5 M, which was lethal to routinely cultured normal C9.1 parasites, as well as to mocktransfected parasites. Expression of green fluorescence protein was consistently detected by routine fluorescent microscopy analysis (Figure 211A). Expression of a GFP fusion protein was demonstrated by Western blot analysis of the stably transfected parasite line using monoclonal rabbit antibody against GFP. As shown in Figure 211B, mouse anti GFP antibodies bound a protein of ~39 kD, compatible with the expected size of the GFP bsd fusion protein. Anti GFP antibody did not react with any protein in wild type C9.1 strain parasites trials. Nothing grew from wells containing parasites transfected with constructs driven by ves promoters during the first 3 attempts. The LAT sequences present in the transfection constructs may have been silenced immediately after transfection during these failures. However, in a most recent attempt to transfect parasites with pDS BSD linearized with EcoR I under continuous drug selection at 27.3 M of blasticidin highly drugresistant parasites suddenly expanded 17 days after transfection in the well. However, I did not

PAGE 47

47 have time to characterize the newly expanded drug resistant transfectants. Only those transfected with pgfpbsd ef, which came u p months earlier, were further studied. Characterization of Genomic Locus of the Integrated gfpbsd Gene Southern blot analysis using pBluescript ef 1 A5, rap13 and gfpbsd specific [32As shown in Figure 2 12, gfpbsd probe detected a single band of ~12 kb in the digested gDNAs without showing any sign of residual episomal DNA. This observation suggests suc cessful integration of the plasmid construct into the genome. The 3 kb pBluescript backbone plasmid detected only faintly a band of 3 kb. This may result from the integration of a concatemer into the genome, or could suggest a small amount of residual epis omal DNA replicating extrachromosomally. As shown in Figure 213, the rap13 probe also detected a single band of ~12 kb in addition to the wild type 8.6 kb band. However, the rap1 locus does not appear to have been disrupted. A confusing result was obser ved on the blot probed with ef P] labeled probes was used to determine whether the gfp bsd gene wa s integrated into the genome of the B. bovis transfectants, whether episomal or integrated plasmid was still present in the tranfected parasite cell line, or where the gfp bsd gene targeted in the genome. Genomic DNA was extracted from stably transfected p arasites as well as the original, nontransfected C9.1 parasites. Genomic DNAs, 1.5 g each, and 5 ng each of transfection plasmids pgfp bsdef or pBluescript, were doubly digested with Bgl II and Not I (+), or left undigested ( ) then analyzed by agarose g el electroporesis Bgl II cuts two times outside the ef 1 locus and rap1 locus, but not within the ef IGB gfp bsdrap1 3 cassette. Not I cuts twice in the flanking pBluescript backbone of the pgfpbsdef construct, but not within rap1 or ef locus sequenc es. These cut sites and the sizes of expected fragments are shown in Figure 2 10.

PAGE 48

48 a band of the same size as expected in wild type C9.1, which was also around 12 kb in length, suggesting that the ef locus was also not disrupted. However, the probe additionally detected two smaller bands of com parable signal intensity. This suggested that either some episomal plasmid persisted extranchromosomally or the construct integrated into the genome as a concatomer. Therefore, initial characterization of the stably transfected parasite lines revealed that successful integration of the construct into the genome had been achieved. However, it appears that the construct may have targeted to an ectopic location within the genome. Discussion The ability to transfect B. bovis will provide an invaluable means to elucidate the mechanism of antigenic variation and gain insights into some important babesial processes that are specific to cattle infections. Previous work provided groundwork for establishing the transfection system (Suarez and McElwain, 2009a; Suarez e t al., 2006; Suarez et al., 2004) but required further optimizationsomething recognized by the authors as well (Suarez et al., 2007) Through the results provided herein, the conditions for transient transfection system are now better established and se veral additional suitable promoters t o drive transgene expression have been identified. When the co nstructs were transfected into B. bovis IRBCs to allow uptake of the DNAs and expression in vivo the 5 sequences of calmodulin and tubulin all displayed si gnificant competence in directing the expression of exogenous genes (Figure 2 3; Figure 26). The direct comparison of our pLUC T3 series constructs with pEF LUC rap3) construct provided here is not completely appropriate, as different termination sequences were used which may result in differences in the regulation of gene expression in vivo

PAGE 49

49 However, it is clear that significant promoter activity has been detected from these transfection constructs. The type of promoter used to drive transgene expression needs to be carefully chosen for transfection because the promoter may influence the timing of expression as well as the subcellular localization of the encoded protein. For instance, in Plasmodium spp., the stagespecific P. berghei AMA1 promoter limited expression of the apical membrane antigen 1 of P. falciparum (Pf83/AMA 1) AMA 1 to the rhoptries in mature schizonts, but the constitutive P. berghei PbDHFR TS promoter led to aberrant expression of the protein throughout schizogony as well as in gametocytes (Kocken et al., 1999) Another example in the expression study with PBS21 as the transgene has shown that truncation of the promoter region can le ad to loss of stage specific expression of the PBS21 gene such that constitutive gene expression was observed in the asexual blood stages of the parasite (Margos et al., 1998) Here, I have provided a range of promoters to choose from, for different purpos es such as driving the transcription of several marker genes in one construct or targeting different positions in the genome of B. bovis Previous efforts at comparing relative promoter activities suffered from a lack of any means of data normalization (Su arez et al., 2006) Significantly, promoter activities are now more convincingly quantifiable through the inclusion of an internal control, using R. r eniformis luciferas e. This is a significant improvement of the transient transfection system in B. bovis as without normalization of transfection conditions, it is not possible to directly compare samples. With normalization, as provided herein, the assumptions introduced when making comparisons can be minimized. In Plasmodium spp., it was reported several ye ars ago that s imultaneous e xpression of both Firefly and

PAGE 50

50 Renilla luciferase genes provided an opportunity to standardize experimental samples in co transfection experiments using Renilla luciferase as a transfection efficiency control (Militello et al., 2 004; Militello and Wirth, 2003) Now, using a Renilla control construct driven by B. bovis calmodulin 5 regulatory sequences together with Firefly luciferase constructs, we have found equivalent levels of expression of both luciferases, even though the tw o constructs possess differ ent 3 termination sequences. The optimize d amount of experimental and control reporter plasmid is at a 3:2 molar ratio however, the Renilla luciferase standard control is highly sensitive and reliable, even at 3:1 molar ratio. To save plasmids, this ratio is used in Figure 23. Besides its use for transient transfection experiments, this Renilla luciferase gene could also be integrated into the genome in order to study transcriptional regulation of a number of genes in B. bovis such as testing the bidirectional promoter function of the intergenic region of ves gene pair by flanking the regulatory sequences with both Firefly and Renilla luciferase genes. There is one point I want to make about how to ensure consistency in efficie ncy of plasmid DNAs from experiment to experiment. Plasmid DNAs should be either freshly prepared or aliquoted after each DNA preparation. Multiple freezethaw cycles should be avoided to lower the chance of sheering of circular dsDNA, which may result in variation in the amount of circular DNA loaded, and hence, making the actual molar ratio of Firefly to Renilla luciferase plasmid DNA constant. Another important finding was that the 5 regulatory sequences of ves majority part of which is derived from t he intergenic region (Igr) of the LAT drives significant expression of both of the exogenous marker gene s used here, luciferase and EGFP, when replicated in the parasite episomally Interestingly this was a chieved

PAGE 51

51 without apparent e ffect on VESA1 expression, suggesting that there may be no strict promoter counting system in B. bovis controlling transcription of the ves multigene family as described for VSG genes in Trypanosoma brucei (Navarro and Gull, 2001) However, it is not possible to draw a firm conclusion in this regard, as only ves 5 regulatory sequences were present, and monoparalogous transcription may depend upon the presence of 3 or internal sequences. We had anticipated that ves Igr containi ng constructs would rapidly become silenced by the machinery silencing the rest of the ves gene repertoire. But this did not happen, which strongly suggests that the episomal ves promoter sequences fail ed to be recruited to the silencing mechanism. Transcr iptional activity of the LAT may involve association of the LAT Igr with sequence segments from other ves genes (A. Bouchut and D.R. Allred, unpublished data) This may provide a framework to dissect maintenance of transcriptional activity at the LAT and s ilencing of the remainder of the ves multigene family, as well as insights into what may be a unique mechanism of transcriptional control. As babesial parasites spend essentially all moments of their life cycle intracellularly, the ability to successfully target DNA across cell membranes to the parasite nucleus while maintaining the integrity of the host cell is impressive. Besides conventional electroporation as was used here, nucleofection has also been used to transfect B. bovis successfully. Nucleofecti on was more efficient than electroporation for transfecting smaller amounts of DNA (less than 20 g; (Suarez and McElwain, 2008) ). This was not attempted in this study due to a lack of available equipment, but could be a useful method to reduce costs in tr ansfection/transformation studies. On the other hand, alternative strategies for loading DNA into parasites which could be performed with more

PAGE 52

52 commonly available equipment were tested here. The strategy of preloading RBCs did not appear to achieve transfec tion of B. bovis although it is useful for P. falciparum However, the ZAP twice method may be an alternative. Preliminary results showed that if the first electroporation is performed under low voltage/high capacitance conditions and the second electroporation under high voltage/low capacitance conditions, an appreciable level of luciferase expression can be achieved. According to the time course of expression of Firefly and Renilla luciferases, different patterns of luciferase expression may result fro m a series of influences, one of which is the promoter involved. In the experiements described here, firefly luciferase was driven by a ves promoter, Renilla luciferase was driven by calmodulin promoter. The promoter driving expression of a gene may influe nce the timing as well as the overall level of expression. Consequently, there can be significant differences in the developmental control of two reporter genes. This effect was evident in this study, as seen in Figure 2 5. Interestingly these kinetics we re similar to those of the EF1aIG promoter (Suarez et al., 2007; Suarez and McElwain, 2008) but in contrast with those of the rap1 promoter (Suarez et al., 2004), in which luciferase expression by transfected parasites was still very limited at 24h, reac hing a peak at 48 h after electroporation. This dissimilarity can also be explained by different mechanisms involved in regulation of expression of rap1 and ves The success of EGFP constructs in transient transfection has shown great significance. As this reporter can be visualized in live individual cells, it has many potential applications in dissecting different aspects of cell biological processes of B. bovis Individual parasites that express EGFP can be counted and sorted from non-

PAGE 53

53 fluorescent cells by fluorescenceactivated cell sorting (FACS), so as to select a particular population of the parasites. EGFP, when fused to a marker gene, will find good application in stable transfection to observe transgenic parasites. A good example is T. gondii where GFP has been utilized to localize proteins to different organelles (de Koning Ward et al., 2000) I have determined that B. bovis parasites are adequately susceptible to puromycin, blasticidin S and pyrimethamine to provide for positive selection and maintenance of transfected parasites. Puromycin inhibits protein synthesis by interacting with the A site of the large ribosomal subunit of eukaryotic ribosomes (Vazquez, 1979) whereas Blasticidin s blocks peptide bond formation by the ribosome (Barbacid et al., 1975) Pyrimethamine interferes with folic acid synthesis by inhibiting the enzyme dihydrofolate reductase. Among these drugs, puromycin has particul arly high potency, but blasticidinS was the first one demonstrated for successful selection and integration in B. bovis (Suarez and McElwain, 2009a) We chose to clone the bsd gene in the transfection vector. During the first three trials, I used lower dr ug concentrations of 6.8 M or 13.6 M for selection, and ended up selecting spontaneously resistant parasites only. In the most recent trial, I raised the initial drug selection concentration to 27.3 M. Parasites expanded suddenly on Day 17 post transfection and survived very w ell in 54.5 M, which is lethal to wild type parasites. However, it is yet to be determined if the parasites are naturally resistant or not. Therefore, it could be a better choice to use a more potent drug like puromycin, which may provide a more stringent condition and render the possibility of selecting spontaneously resistant parasites less likely.

PAGE 54

54 W e have initiated a stable tranfection strategy in an attempt to induce transcriptiona l switching from the LAT by integration at another ves locus, using a t ransfection vector carrying a selectable marker driven by LAT Igr sequences The parasites were administered drug 4h post transfection, in an attempt to select integrated parasites before the integrated sequences were silenced. G rowth of parasites with sel ection through many generations for blasticidin resistance might have yield ed stably maintained though probably episomal plasmids with assembled chromatin structure However, it is likely that such episomes would be lost when drug pressure was removed. Ad vantage has been taken of this behavior in an onoff selection strategy to facilitate the recovery of parasites in which episomes have integrated (Crabb and Cowman, 1996; Fidock et al., 1998; Wu et al., 1996) Using this strategy, we have achieved stable integration of the same pgfp bsdef construct reported by Suarez and McElwain (Suarez and McElwain, 2009a) The following observations are consistent with s table integration of the gfpbsd gene into the B. bovis genome: A) sustained growth in culture medi a containing concentrations of blasticidin that are otherwise inhibitory for wild type parasites; B) identification of expression of a gfp bsd fusion protein in transfected merozoites by western blot s ; C) detection of fluorescence in transfected parasites more than 5 months post electroporation; and D) evidence of integration into the genome in Southern blots although possibly not at the expected locus. Gene targeting in P. falciparum was first achieved with circular constructs, while integration into P. berghei genome occurred if the incoming DNA is linearized (Nunes et al., 1999) In B. bovis it was claimed that integration can be achieved by both circular and linearized constructs (Suarez and McElwain, 2009a) We have confirmed the ability

PAGE 55

55 to achieve s table integration using a linearized construct. Circular constructs may also work, although it didnt work for me during the first trials. These developments have provided the groundwork for future studies, such as stable transfections targeting loci of interest, including ves loci, and may facilitate future strategies involving targeted insertional mutagenesis of B. bovis Of particular interest to this laboratory, the stable transfection system offers the potential to further our understanding of the swi tching nature of LATs, and the molecular mechanisms used to vary the structure and antigenicity of VESA1 polypeptides subunits. Ultimately, this technology will facilitate the study of parasite biology, including the functions of cellular components, vacci ne development, and the development of chemotherapeutic strategies to control B. bovis and other related parasites.

PAGE 56

56 Table 2 1. Statistical analysis of promoter activities in calmodulin 5 and ves 1 5sequences Type1 Type2 P_value 1 Calmodulin5'Fwd 2 Calmodulin5' Rev 0.0103 1 Calmodulin5'Fwd 3 LAT_V 5 Fwd 0.0175 3 LAT_V5 Fwd 4 LAT_V5 Rev 0.0162 1 Calmodulin5'Fwd 5 EF1aIG 0.0018 3 LAT_V 5 Fwd 5 EF1aIG 0.0364 1 Calmodulin5'Fwd 6 Pro ( ) 0.0063 2 Calmodulin5' Rev 6 Pro( ) 0.3974 3 LAT_V5 Fwd 6 Pro( ) 0.0156 4 LAT_V 5 Rev 6 Pro( ) 0.0743 5 EF1aIG 6 Pro( ) 0.0122

PAGE 57

57 Figure 2 1. Cl oning of regulatory sequences into pG EM LUC and control constructs. A) Major constructs with Calmodulin 5 or LAT ves 1 5 sequences; B) Reverse promoter control constructs with reversely inserted Calmodulin 5 or LAT ves 1 5 sequences ; C) Positive control with demonstrated ef fragment B promoter; D) Promoterless control construct with Tubulin 3 sequences only; E) Internal Renilla control with Calmodulin 5 and Plasmodium faciparum Calmodulin 3 sequences

PAGE 58

58 Figure 22. Scaled s chematic representation of luciferase constr ucts for transient transfection. A) Major constructs pC5 LUC pLAT_V 5 with calmodulin 5 or ves sequences. B) P romoterless negativ e control construct pLUC T3 Tubulin 3 sequences only; C) I nternal control construct pC5 Renilla C3 with Renilla driven by B. bovis calmodulin 5 sequences with Plasmodium faciparum calmoduli n 3 sequences.

PAGE 59

59 Fig ure 23. Comparison of promoter activities using transient transfection. Luciferase expression is driven by 5 reg ulatory sequences of calmodulin or ves gene at LAT in both orientations. The plasmid constructs are compared with a promoterless control as well as pEF1 IG containing a demonstrated promoter EF1 IG Fragment B Firefly luciferase activi ty was normalized to the level of Renilla luciferase activity obtained b y co transfection of a Renilla internal control construct pC5 Renilla C3 at a m olar ratio of 3:1. Error bars represent standard devi ation of triplicative samples. The experiment and result is repeated at least 3 times. The analysis of va riance is given in Table 2 1.

PAGE 60

60 Figure 2 4. Comparison of lysis methods for detection of luciferase activity in B. bovis extracts. B. bovis C9.1 parasites are transfected with pC5F LUC and pC5 Renilla C3 at a molar ratio of 3:2. Equal amount of transf ected parasites from a single electroporation is lysed with either NH4Cl Tris or saponin lysis for comparison. Luciferase activity is measured and compared with the same amount of mock transfected parasites lysed with NH4 Cl Tris method. Error bars represen t standard devi ation of triplicative samples.

PAGE 61

61 1h 2h 3h 4h 5h 6h 7h 8h 10h 24h 48h 72h 96h Pro(-)10h Pro(-)24h0 20000 40000 60000 80000 100000 Luminescence/min Firefly Renilla1h 2h 3h 4h 5h 6h 7h 8h 10h 24h 48h 72h 96h Pro(-)10h Pro(-)24h0 2 4 6 8 10 12 14 16 18 20 Firefly/Renilla Figure 2 5. Time course of luciferase expression in B. bovis parasites transfected with B. bovis C9.1 parasites were transfected with 11.5 pmol of firefly luciferase repor sequences. Luciferase activity was determined at 1, 2, 3, 4, 5, 6, 7, 8, 10, 24, 48, 72, 96 h after transfect ion. Firefly luciferase activity in parasite extracts was measured and normalized to the level of R. reniformis luciferase activity obtained by co transfection of 7.7 pmol of pC5 Renilla C3 Upper panel shows luminescence values of Firefly and Renilla re spectively. Lower panel shows the ratio of Firefly to Renilla luminescence. Error bars represent standard devi ation of triplicative samples.

PAGE 62

62 Figure 2 6. Expression of EGFP in B. bovis C9.1 parasites transfected with pTubulin 5 EGFP or pV tubulin and ves B. Detection of EGFP by fluorescence microscopy Upper panel: pTubulin5 EGFP; Lower panel: pV 5 EGFP. From left to right: phase contrast, fluor escence, and merge of the two images.

PAGE 63

63 Figure 2 7. Live cell IFA of B. bovis EGFP. A) Illustration and detailed structure of ves Immunofluorescent detection of antigens on the surface of B. bo vis infected erythrocyte s by live cell IFA using R6a v1765 and Chicken anti rabbit IgG Alexa594 From left to right: phase contrast, fluorescence (red or green channel), and merge of the previous images. Arrowheads are used to indicate infected erythrocyt es.

PAGE 64

64

PAGE 65

65 Figure 2 8. In vitro growth inhibition of B. bovis parasites as a function of various drug concentrations as assessed by tritiated hypoxanthine incorporation. From upper to lower: Puromycin, Blasticidin and Pyrimethamine. Each compound was present in triplicate columns. Data was processed in Origin Pro 8 The averaged data were then fitted through nonlinear regression with a sigmoidal inhibition curve (nHill=1; bottom asymptote fixed at 0)

PAGE 66

66 Fig ure 2 9. Schematic representation of the strate gy propose d to demonstrate induced switching from the LAT to another ves locus, and thus the capacity for in situ switching Schematic representation of A) pDS BSD and what the genomic locus look like before transfection; B) pBSD Promiscous ta rgeting trans fection construct C) Expected integration in the genomic locus after successful pDS BSD integration.

PAGE 67

67 Fig ure 2 10. Schematic representation of the original ef pgfpbsd ef with size of fragments B); and what the genomic lo cus looks l ike after expected integration C).

PAGE 68

68 Figure 2 11. Expression of GFP BSD fusion protein. A) Parasites growing wel l at 22.2M of blasticidin are able to glow green fluorescence constantly. B) Western blot analysis of lysates of the stably trans fected parasite line, control nonselected C9.1parasites using mouse anti gfp serum as indicated at the bottom. Size markers in kD, are indicated on the left.

PAGE 69

69 Figure 2 12. Southern blot analysis on the Stably Transfected parasite genomic DNA (STF); C9. 1 genomic DNA, transfection plasmid pGFP BSD and plasmid pBluescript. The DNAs are double digested with Bgl II and Not I (+), or undigested ( ). The Southern blots were hybridized with [32P ] labeled pGFP BSD and pBluescript probes.

PAGE 70

70 Fig ure 2 13. Southern blot analysis on the Stably Transfected parasite genomic DNA (STF); C9.1 genomic DNA, transfection plasmid pGFP BSD and plasmid pBluescript. A) The DNAs are double digested with Bgl II and Not I (+), or undigested ( ). The Southern blots were hybridized wit h 32 P] labeled rap13 or ef 5 probes. B). Schematic representation of rap1 locus and ef

PAGE 71

71 CHAPTER 3 DISSECTION OF THE BIDIRECTIONAL PROMOTER STRUCTURE EMPLOYED IN THE BABESIA BOVIS VES MULTIGENE FAMILY Abstract B abesia bovis is a n intraerythrocytic protozoa l parasite that maintains persistent infection in its vertebrate host by at le ast two mechanisms: cytoadhesion a nd antigenic variation. Both phenomena are mediated by variant erythrocyte surface antigen 1(VESA1) protein, which is encoded by the ves multigene family. The ves genes have been found to be organized largely as closely juxtaposed, divergently oriented gene pairs. T he similar organization and the presence of a highly c onserved intergenic region (Igr) structure among all the ves genes identified suggested some biological significance of the 434 bp Igr. Because of our need to understand functional control of the Igr, we took advantage of the newly established t ransient tr ansfection system for B. bovis to characterize the LAT Igr. We have identified a cluster of promoter s within the 434 bp Igr and revealed possible enhancing activity embedded with in the exon/introns of the apposing gene. Preliminary results showed the inve rsion of certain intron element greatly reduced the promoter activity of regulatory sequences it lies in. T he Igr of two transcriptionally silent donor ves gene pairs were found to display strong promoter activities when driving exogenous genes episomally, at level s comparable to t hat of the LAT Igr T hese observation s provide the first information available regarding the structure of babesial promoters, and provide additional evidence for the potential of silent ves gene pairs to become transcriptionally a ctivated, becoming the new LAT. Introduction At least two strategies are employed by B. bovis to survive immune defense s (Allred and Al Khedery, 2004) of the host and promote long term persistent infection (Allred et al., 1994; Calder et al., 1996; Callow, 1963.; Mahoney et al., 1973) One strategy is the adhesion of B.

PAGE 72

72 bovis infected erythrocytes to bovine endothelial cells resulting in sequestration of mature parasites in capillaries and post capillary venules (Callow, 1963.; Wright, 1972; Wright and Goo dger, 1979) The second significant strategy is the capability of the parasite to undergo clonal antigenic variation Both of these two phenotypes are embodied within the VESA1 protein, a size polymorphic, parasite derived protein doublet variant erythroc yte surface Ag 1 expressed on the surface of infected red blood cells. VESA1 has been identified as a key component for both cytoadhesion and antigenic variation (Allred et al., 1994; O'Connor et al., 1997) Our understanding of the mechanisms underlying antigenic variation of VESA1 protein in B. bovis has benefited from the characterization of the genomic locus of active ves transcription (LAT). The LAT is organized as a quasi palindromic structure containing two closely related but structurally different ves genes encoding the VESA1a and 1b subunits (Al Khedery and Allred, 2006; Allred et al., 2000) The two genes are in a closely juxtaposed, divergent orientation, with a short intergenic region (Igr) of only 433 bp (Allred and Al Khedery, 2006) Because of this uniquely compact structure th e ves 1 ves 1 It is therefore not unreasonable to propose that there are regulatory elements embedded within the intergenic region. Evidence supporting this idea comes from the identif ication of the transcription start site for the ves 1 gene embedded within the Igr (Allred et al., 2000) Evidence collected so far suggests that a majority of ves genes share st ructure and organization similar to that of the tightly juxtaposed quasipalindromic ves gene pair of the current LAT. Alignment of the intergenic regions located between several ves genes has revealed that th e se 400450 bp intergenic regions are highly conserved in organization and much of their sequence (Allred and Al Khedery, 2006 ) This suggest s equivalent potential of intergenic upstream sequences in each of these gene pair s to function as a promoter. As to which ves genes

PAGE 73

73 may become the LAT, the choices may be limited When a bulk parasite population was analyzed by RT PCR using universal primers flanking a highly variable region (Zupanska et al., 2009) 78 out of 84 sequences analyzed strongly support that a single ves locus is transcriptionally active at one time, which was the known LAT. One was a match for another gDNA locus. The rest did not match any known genomic locus. This suggested the possibility that in situ switching of transcription could occur from LAT to a different gDNA locus. However, this question still remains to be answered. So far, nothing is known regarding promoter structure in Babesia spp. parasites The most straightforward approach to perform an initial dissection of p romoter structure is to determine the abil ity of various portions of 5 sequences to drive the transcription of exogenous reporter genes in vivo Recently, we have developed the ability to transfect parasites transiently in a robust and reproducible manner, with exogenous gene s Taking advantage of this technique to observe the promoter activities of a variety of Igr and nearby sequences we have i dentified a cluster of promoter activities within the 434 bp Igr of the LAT. Possible cis enhancing activity has been observed. These observations provided the first information available on promoter structure in a babesial parasite. Material and Met hods Parasites B. bovis parasites of the c lonal line C9.1, were maintained in vitro under microaerophilous conditions, as described (Allred et al., 1994) Cloning of Constructs with LAT Intergenic Region Regulatory Sequences A total of 6 plasmid construct s were constructed in this group. Plasmid pLUC T3, which was described in the previous section, was used as template. Without adding regulatory sequences pLUC T3 was also used as a promoterless negative control. The 434 bp LAT

PAGE 74

74 intergenic region was amplif ied by PCR from phagemid 61 (Allred and Al Khedery, 2006) using oligonucleotides (XW79: 5 CG[GGATCC]TATGTTACCACCCCTTGTTT 3) and (XW80: 5 CG[GGATCC]TGTCAGTGCTTCTAGGAGTACT 3). The resulting PCR product was digested by BamH I, and cloned into the BamH I si te of pLUC T3. As only plasmid with Apa I restriction site was then engineered into 5 end of the insert using (XW95: 5 AGG[GGGCCC]TATGTTACCACCCCTTGTTT 3). This facilitated th e strategy of oriented insertion of the digested PCR product into pLUC T3 doubly digested with Apa I plus BamH I to get the plasmid with 5 sequences inserted in forward direction. This construct was consequently 1). Fragments co creation of an Apa I site at the 5 end and BamH I site at the 3 end. The amplicon was again digested and cloned into pLUC T3 doubly digested with Apa I plus BamH I, by directional insertion. Sequences to create the 233 bp of pLAT_halfIg#1 were amplified from (XW106: 5 AGG[GGGCCC]AGATTCCGTATAAGC AATTC ) and (XW80: 5 CG [ GGATCC ] TGTCAGTGCTTCTAGGAGTACT 3). Sequences for the 200 bp 5 using (XW95: 5 AGG[ GGGCCC ] TATGTTACCACCCCTTGTTT3) and (XW107: 5 CG [ GGATCC ] TACTGGATAATCCATATTATTCTAC 3). The 200 bp of pLAT half Ig#3 was amplified AGG[GGGCCC] TACTGGATAATCCATATTATTCTAC 3) and (XW79: 5 CG[GGATC C] TATGTTACCACCCCTTGTTT3). Finally, the 233 bp of pLAT half Ig#4 was AGG[ GGGCCC ] TGTCAGTGCTTCTAGGAGTACT 3) and (XW110: 5

PAGE 75

75 CGC [ GGATCC ] AGATTCCGTATAAGCAATTC 3). Again, digested PCR products were inserted in to Apa I plus BamH I doubly digested pLUC T3. The position of each relative to the full Igr, and its orientation relative to the luciferase gene upon insertion, are shown in Figure 3 1. Cloning of Constructs with Additional Exons and/or Introns from the Appo sing Gene A total of 9 plasmid constructs were included in this group. pLAT_ the previous section The 239 bp of coding sequence of actin housekeeping gene, which are presumably nonregulatory, were amplified from genomic DNA with (XW127: 5 CC[AAGCTT]CTATCCAGGCTGTGCTTT C 3) and (XW128: 5 CC[AAGCTT]TTCCTTAATGTCACGCACAATC 3). The resulting amplicon was digested with Hind III and added to the Hind control plasmid pActin_Ig_V Sequences for the creation of other plasmids were a mplified from phagemid 321 (Allred and Al Khedery, 2006) The 584 bp used to create AG[ GGGCCC ] GGGGGCCAGAGTCCTTGTTTG3) and (XW80: 5 CG [ GGATCC ] TGTCAGTGCTTCTAGGAGTACT 3). The 3 antisense primer used in all v es 5 constructs was (XW79: 5 CG [ GGATCC ] TATGTTACCACCCCTTGTTT3). It was paired with (XW125: 5 AG[ GGGCCC ] CACCATCACCCAGCTTTTTAC3) for the 557 bp of AG[ GGGCCC ] CTGTATCAGAGTGAATTCCATAG3) for the 670 bp of the construct; with (XW126: 5 AG[ GGGCCC ] CATGGTACTCCAGTTGTACTG3) for the 734 toE2 fragment; and with (XW112: 5 AG[ GGGCCC ] CTTGTTTTGAGAACTGTCAGconstruct. Consequently, PCR products were doubly digested with Apa I plus BamH I and inserted into similarly digested pLUC T3 plasmid. These constructs are shown in Figure 32.

PAGE 76

76 Cloning of Constructs with Intronic Sequences Inverted Three plasmid constructs were made in this group. The 43 bp of inverted intron 1 sequences of ves 1 XW135: 5 CC[ AAGCTT ] GTAAGTCAATAGCACTAAC 3) and ( XW136: 5 CCA [ ATGCAT ] CTGTATAGCCATGTAAGAG3). Similarly, the 111 bp of inverted intron 1 sequences of ves CC[AAGCTT ]GTACGTTGGCATAGAC 3) and (XW138: 5 CCA[ATGCAT]CTGTATCAGAGTGAATTC 3). Finally, the 72 bp of inverted intron 2 sequences of ves CC[AAGCTT]GTAAGTACCTAGTAGTGGAG3) and (XW141: 5 CCA[ATGCAT]CTATAGGACACCATGAG3). Consequently, PCR products were doubly digested with Hind III plus Nsi I and inserted into similarly digested pLUC T3 plasmid. These constructs are and shown in Figure 3 3. Clonin g of Intergenic Regions from Two Other ves Donor Loci The 669 bp of the 5 sequences of the ves gene was amplified from cosmid 1E10 (Allred and Al Khedery, 2006) by PCR, using primers (XW77: 5 CGC[GGATCC]TCCTTGGCGTCATACAGTAG3) and (XW78: 5 CGC[GGAT CC]TGTCAGTGCCTTTAGGAGTACTC 3), with creation of BamH I restriction sites on both ends. The amplicon was inserted into pLUC T3, and correctly inserted plasmid was named p1E10. Another 658 bp of 5 sequences of ves 1 A was amplified from cosmid S621(Allred an d Al Khedery, 2006) with (XW92: 5 AGG[GGGCCC]TGTACAGGGGTGAGTCTATG3) and

PAGE 77

77 (XW76: 5 ACGTCGC[GGATCC]TATCAGTGCTTCTAGGAGTACTCAG3). The amplicon was inserted into pLUC T3, and the construct was named pS621. All plasmids were confirmed by digestion mapping and sequencing. DNA plasmids were prepared using Endotoxinfree Plasmid Purification Maxi Kit (Qiagen), following the manufacturers instructions. Transient Transfection and Luciferase Assay Transient transfection was performed as described (Suarez et al., 2004) with minor modifications. Briefly, B. bovis C9.1 parasites were cultivated to a ppe of 5 ~ 15%. For each transfection, 150 l packed infected RBCs were electroporated with 1 1.5 pmol DNA in 250 l DNA/ cytomix (120 mM KCl, 0.15 mM CaCl2, 10 mM K2HPO4/ KH2PO4 pH 7.6, 25 mM HEPES pH 7.6, 2 mM EGTA, 5 mM MgCl2, final pH 7.6) suspension at 1.25 kV/ 1.07 mF at 200 ( Gene Pulser II, BioRad Hercules CA) in a 2 mm gap cuvette (Fisher Biotech, Subiaco, WA). Parasites were transfected with each construct in three separate cuvettes. Each individual transfection also included 7.7 pmol pC5 Renilla C3 a plasmid express ing Renilla reniformis luciferase using B. bovis calmodulin 5 and P. falciparum calmodulin 3 flanking sequences as transfection efficiency and recovery control. Transfected RBCs were then diluted into 3 ml complete culture medium at a packed cell volume of 2.5%. DNA concentration in the cuvette was approximately 0.25 g/l. Time constants recorded were limited within the range from 0.26 ms to 0.38 ms. The medium was changed daily and 50 l of packed RBCs were added the next day to support the growth of t he parasites. At 24 h post transfection, RBCs were collected and lysed by NH4The luciferase assay was performed according to the manufacturers instructions (Promega, Madison, WI). Both Firefly and R enilla reniformis luciferase activities in 100 l of Cl Tris lysis as described in (Suarez et al., 2004) P arasites were washed 2X with 1xVYM, and lysed in 100 l passive lysis buffer (Promega Madison, WI ).

PAGE 78

78 cleared extract were quantified on a MicroBeta Jet scintillation spectrometer following the manufacturer s protocol (PerkinElmer; Waltham, MA). Briefly, a 24well white plate protocol was set up to perform a 10 second measurement period for each reporter assay without setting premeasurement delay and mixing. Lysates from the same triplicative group were carefully laid out in the manner they were to be assayed simultaneously. Background lysate liquid luminescence was recorded three times, and the average reading in each well was subtracted from firefly luciferase activities to correct for this background. LARI I reagent (100 l) was dispensed by multichannel pipette to ensure simultaneous reaction of luciferin substrate with firefly luciferase and minimum time delay before measurement. After the first reading, 100 l Stop&Glo reagent was added immediately, followed by a second measurement. Renilla luciferase reading from mock transfected parasite lysates was subtracted from all Re nilla luciferase readings. The level of firefly luciferase activity was normalized as a ratio the level of Renilla luciferase activity. These experiments with triplicate samples were repeated at least four times each, except those performed with inverted intron constructs, which were performed twice only. B iostatistical Analysis of Promoter Activities The normal ized luciferase activities were plotted using Microsoft Excel as the mean standard deviation, calculated from the triplicate samples. Differences in promoter activities are determ ined by twosided two sample t test, using SPSS program (SPSS, Chicago, IL) Comparison and the calcul ated P values are listed in Table 3 1 to Table 3 4. If the P value is below the threshold value chosen for statistical significance ( P=0.05), the two promoter activities are considered significantly different.

PAGE 79

79 Results Analysis of ves Igr Sequences The Igr sequences of the LAT were examined for their ability to drive expression of exogenous gene. Template construct pLUC T3 was previously made with 3 tubulin flanking sequence cloned downstream of firefly luciferase (LUC) gene to provide the relevant transcription termination signals (X Wang, D.R Allred; unpublished data). New plasmids were constructed by insertion of the 434 bp Igr sequence in both directions upstream of the LUC gene in pLUC T3. In order to test the minimal region necessary for functional promoter activity, expression plasmids possessing truncated Igr sequence were prepared to identify the minimal 5' sequences that retained promoter activity. Four half Igr fragments were amplified from the 434 bp Igr and cloned to pLUC T3. These six plasmids were introduced into B. bovis C9.1 parasites by electroporation and firefly luciferase activity was measured 24 h post transfection. To normalize the inherent vari ation in transfection efficiency, the level of firefly luciferase activity was normalized to the level of Renilla reniformis luciferase obtained by co transfection of parasites with the plasmid pC5 Renilla C3 as described in the previous section As shown in Figure 3 1 and Table 31, upon transfection, each of the six plasmids, containing a complete or half Igr respectively, produced luciferase activity regardless of insert orientation (Figure 31) (P<0.001). Transfection with pLAT_ Ig_ V construct produced the significant luciferase activity among the six sequences analyzed (P=0.0001) This construct contained complete LAT Igr sequence, inserted in the ves sequences on the same side of the Igr as the ves Placement of both the 5 and the 3 half alone immediately upstream of th e LUC gene produced significant LUC activity when expressed in vivo (P<=0.0001). When the three fragments were inserted in ves 1 orientation, i.e. with the LUC sequences on the same side of the Igr as the ves 1 gene would

PAGE 80

80 normally be, there not much distinct differences in the levels of LUC expression were observed 5' (P>0.05) The lucife rase signals produced from each of the six plasmids were significantly different from those produced by pLUC T3, (P<0.001), with which luciferase levels indistinguishable from background were detected. Analysis of ves Igr Flanking Sequences on Promoter Fu nction In order to explore more of the promoter activities of ves genes, additional sequences were in cluded in the construct to identify possible transcriptional control elements by examining for increases or reductions in expression levels The pLAT_ used to compare with pLAT_Ig_ construct containing full length Igr. On the apposing side, t he v es 1 5 regulatory sequences through intron 1 of ves as well as v es 1 5 regulatory sequences through intron 2 of ves were amplified an d cloned to pLUC 1 As shown in Figure 3 2 and Table 32, upon transfection, the presence of ves 1 exon 1 an d intron 1 reproducibly resulted in 1.5 fold higher luciferase expression (P=0.0015). On the apposing side, the presence of the exon1/intron1 pair of ves resul ted in significant increase in luciferase expression (P=0.0054), however, the presence of exon2/intron2 did not result in significant increase when compared with full length Igr or with e xon1/intron1 pair only (P>0.05). Again, the luciferase signals produced from each of the five plasmids were significantly different from those produced by pLUC T3, (P<0.05). In order to test which part of the exon/intron pair resulted in the increase of luciferase 1 was prepared, containing ves 5 regulatory sequences through exon1 only of v es 1 On the other side, t he v es 1 5 regulatory sequences through exon1 of ves as well as v es 1 5 regulatory sequences through exon2 of ves were amplified and cloned to pLUC T3 to create

PAGE 81

81 1 and pLAT_V oE2. To control for any nonspecific effects due to the length of apposing sequences, a size control construct was a lso assembled. Actin coding sequences 239 bp in length was added immediately upstream of Igr sequences of pLAT_Igr_ to form construct pActin_Ig_V This control construct has a size comparable to that of d with the full length Igr constructs, as well as those containing exon/intron pairs. As shown in Figure 32 and Table 3 2, upon transfection, the presence of actin coding sequences in a position 5' of the pLAT_ Ig Igr sequences did not alter the level of LUC activity with respect to the parental plasmid 1 were lower than from pLAT_Ig_ (P=0.0354). On the apposing side, inclusion of sequences up to exon 1 of ves doubled the level of LUC expression with respect to the full length Igr (P=0.0354), but addition of intron 1 of ves did not result in any further incr eases in LUC expression (P=0.1117). Similarly, inclusion of Exon 2 did not substantia lly 1 (P=0.848). A ddition of intron 2 of ves did not result in significant increase either, (P=0.9664). Overall, the luciferase signal produced by each of the nine plasmids was significantly di fferent from that produced from the promoterless pLUC T3 control (P<0.05). Effects of Intronic Sequences Inversion Three more constructs were made in order to test for any effects that inversion of intronic sequences might have. These new constructs were compared with those constructs without introns and those with introns in their normal orientation. As shown in Figure 33 and Table 3 3, inversion of intron 1 of ves 1 did not result in significant change in LUC expression when compared to pLAT_V 5toE 1 (P=0.8978). The luciferase expression is not significantly different from pLAT_V 5 either (P=0.0719). On the apposing side, inversion of intron 1 of

PAGE 82

82 v es 1 did not result in significant change in LUC expression when compared to pLAT_V 5toE 1 (P=0.7553) or pLAT_V 5toI1 (P=0.2490). However, inversion of intron 2 of v es 1 resulted in a substantial decrease in LUC expression when compared to both pLAT_V 5toE2 and pLAT_V 5 toI2 (P=0.0031; P=0.0006) Int riguing ly, the normalized luminescence is also significantly different from any of the other plasmids (P<0.01). Overall, the luciferase signal produced by each of these plasmids was significantly different from that produced f rom the pLUC T3 control (P<0.01). Comparison of Promoter Activities of S equence Donor Loci with the LAT In order to determine the competence of Igr sequences from sequence donor sites to serve a promoter function under in vivo conditions, the 658 bp of ves 1 A 5 sequences from cosmid S621, which is an / pair, as well as the 669 bp of ves 1 C 5 sequences from cosmid 1E10, which is an pair, were amplified from corresponding cosmid template DNAs. These two sites are similar in size and organization to th e 678 bp of ves 1 gene 5 sequences from the LAT, and are known sequence donors for observed segmental gene conversion events (Al Khedery and Allred, 2006. The Igr sequences from 1E10 are similar to V 5 from the LAT in both the nature and composition of s equences apposing the reporter gene, as both are presumed ves 1 promoters and both contain an exon 1/ intron 1 pair of an apposing ves 1 gene Alternatively, the Igr sequences from S621 are comparable to those from LAT in that both are ves 1 promoters, but different in the composition of the sequences apposing the luciferase gene, as the S621 5 sequences contains an exon1/intron 1 pair from a ves 1 As shown in Figure 3 4 and Table 34, LUC expression from Igr of 1E10 was roughly half that of LAT V 5 (P=0.0124), whereas LUC expression from Igr of S621 was about half that of LAT 5 (P=0.0077). However, all were

PAGE 83

83 significantly greater than the promoterless control p LUC T3 and drove appreciable levels of luciferase expression (P<0.05). Discussion and Conclusions Prior to this work, there was not much information available regarding gene regulatory sequences in B. bovis Because of our interest in cytoadhesion and anti genic variation, both of which are mediated by the ves multi gene family (Allred et al., 2000) T he newly developed transient transfection system was utilized to identify regulatory elements within this family Finer dissection of the intergenic region of the LAT revealed a cluster of minimal promoters embedded within the short 434 bp intergenic region of the LAT wh ereas the efficiency of the full length Igr was not significantly different from the two half fragments in the same orientation in driving the expression of LUC gene The Igr drive s significant luciferase activity when present in vivo as an episome. There is no marked dependence on orientation. Previously, when ves transcripts derived from the LAT were analyzed, t he putative transcriptional start site was identified by a cap in dependent 5' rapid amplification of cDNA ends (5' RACE) method. The site of transcription in itiation of the p9.6.2 cDNA mapped to the firs t base 3 of an upstream pair of predicted hairpin/cruciform sequences in the ves side of the Igr (Allred et al., 2000) The presence of heavily overlapping 5 UTR sequences on ves 1 transcripts was confirmed by the use of a 5 cap dependent RACE proced ure, and was also the case for C9.1 ves Khedery and D. R. Allred, unpublished data). Based on these data, the 5 of the apposing genes may overlap by 110 bp or more This organization and overlapping transfection start sites sugg ested that coordinate control of the transcription of both genes may occur. However, the results of live cell immunofluorescence, performed with VESA1a and 1bspecific antibodies, suggest that co localization of VESA1a and the VESA1b is not absolute, and m ostly occurred in reactions with mature parasitized erythrocytes. Therefore, the temporal expression of

PAGE 84

84 the two subunits is not necessarily equivalent, and the expression may not be tightly coregulated (Y Xiao and D.R. Allred, submitted data). Besides di ssecting the promoter activity derived from Igr only sequences, I also analyzed ves promoter activities with the inclusion of exon/intron pair (s). The experiments in Figure 32 revealed potential enhancing activity residing in the exon/intron pair in the opposing gene that may serve to regulate ves gene expression To exclude a trivial explanation for the increased expression of LUC as being due simply to the increased template length, I inserted 239 bp of presumably nonregulatory actin coding sequences upstream of the Igr promoter of the expression of LUC gene (Figure 32, Table 3 2). Therefore, I conclude that the increase of LUC expre imparted by the exon/intron pair. Possible roles of the introns included in the constructs were analyzed by truncating the fragments at the distal end of each exon relative to Igr sequences. The results provided in Fig ure 32 suggested that there are possible enhancing activities embedded in intronic sequences of ves 1 (P=0.0095) and in exon 1 of ves As potential enhancers should be orientation dependent, each sequence w as clone d i n the reverse direction to determine whether this will result in elimination of enhancing activity. When ves 1 intron 1 was reversely inserted, no change was observed in the luciferase expression, consistent with a potential enhancer function. I n contrast, reversal of the ves (approximately half) in luciferase expression (P=0.0031) Several potential expla nations exist for this result. Firstly, it may be that normal promoter structure was disrupted b y reversing sequences in the intron 2 of ves ves genes is long, extending far beyond the intergenic region. Unfortunately, the effects of

PAGE 85

85 inversion of intron 1 of ves It caused reduction in one experiment, but didnt change much in LUC expression in the other. When the data from two experiments are pooled, it did not result in significant change (P=0.7553).Further analysis is needed to draw any conclusion. Intriguingl y, despite the clear overall symmetry of the Igr, the complete promoter structure may be asymmetric, with minimal promoters centrally located, an auto enhancer on one side, and accessory elements on the other. The function(s) of any such accessory elements is not clear. An alternative explanation is that a separate promoter activity resides in intron 2 which, when reversed, drives transcription of antisense transcripts. Such antisense transcripts may interfere with ves promoter activity or with translation of transcripts containing ves 5 UTR sequences. These possibilities remain to be explored. In B. bovis few regulatory elements sufficient to drive gene expression have been characterized, and no information is available regarding their cognate DNA binding proteins. Most transcription factors common to higher eukaryotes are not found in the Apicomplexan genome. However, an amplified family of Apicomplexan specific AP2 (ApiAP2) transcription factors has been identified by bioinformatic means as the primary DNAbinding domain present in all Apicomplexan parasites sequenced to date (Balaji et al., 2005) It has been shown that the DNAbinding domain sequences, and potentially their binding specificities, of orthologous pairs of AP2 domains are fundamentally conserved in six P lasmodium spp. and six other Apicomplexan species, including B. bovi s (De Silva et al., 2008) DNA motifs specifically bound by AP2 domains of the PF14_0633 gene were predicted using protein binding microarray and FIRE algorithm computation al analysis (De Silva et al., 2008; Elemento et al., 2007) The core nucleotides were determined to be CATGC or CGTGC. Interestingly, CGTGC was found in the exon 1 of ves 1 It is possible that transcription factors are recruited to this region and involved in regulation of the locus. The alignment of 25 intron 1 sequences from ves

PAGE 86

86 highly conserved DNA motifs within this short region. As shown in Figure 35, one motif is GTTACTGTAGACAT at the beginning of the intron 1. The second motif is GCGCGCC, located close to the 3 end of the intron 1. The GCGCGCC sequence is a motif known as a GC box (Ohme Takagi and Shinshi, 1995) and is found in both the Igr and intron 1 sequences, and may be recognized by AP2 transcription factors. This is consistent with the facilitated promoter activity observed in constructs containing these sequences in addition to Igr sequences. No clear DNAbinding protein motifs were ide ntified in the ves 1 intron 2. In P. falciparum silencing of var genes is associated with transcriptional activity of a second intronassociated promoter found in each var gene, and silencing seems to depend upon a pairing of the two (Calderwood et al., 2003; Frank et al., 2006) However, more recent evidence suggests the intronic promoter may serve primarily to maintain silencing imposed upon the gene by sequences in the 3 regulatory region (Muhle et al., 2009) The last experiment showed all the 3 dif ferent ves loci ( representing the LAT, S621, and 1E10 loci) are capable of driving comparable levels of luciferase expression, reveal ing the potential for this gene family to undergo in situ switching Figure 3 6 illustrates a hypothetical in situ switching event, which shows t hat silencing of the current LAT may be accompanied by the activation of a different ves locus, which would become the new LAT site. The overall similarities of the intergenic r egions of the known transcribed LAT gene copy and the sequence donor gene copie s do reflect functional similarities. There are 119 annotated ves genes in the B. bovis genome, over half of which are organized as divergent gene pairs (Brayton et al., 2007) Yet, analysis of ves transcripts in the C9.1 line paras ite population strongly suggests that ves transcription occurs only at the known LAT and is mutually exclusive, with silencing of all ves loci but one (ie. the LAT) (Zupanska et al., 2009) It is possible that the LAT is the only ves locus with an operational promoter. However, our data showed that Igr sequences from non-

PAGE 87

87 transcribed ves loci also display transcriptional competence, indicating that other loci have the potential to be transcribed in situ The mechanism underlying this exclusion is not known. Previously, w e anticipat ed that ves Igr containing constructs upon insertion into parasites, would rapidly become silenced by the machinery silencing the rest of the ves gene repertoire. However, the Igr from the LAT can driv e significant expression of the EGFP gene when replicating in the parasite episomally without any apparent effect s on VESA1 expression (X Wang; D.R. Allred, unpublished data). This result indicated that the episomal ves promoter sequences fail ed to be recruited into or affected by the silencing mechanism. I n conclusion, our results demonstrated that the ves Igr is a true bidirectional promoter. A cluster of minimal promoter activities are embedded within this area and the capacity to express exogenous gene s in vivo is enhanced by regulatory elements embedded within flanking exo nic or intronic sequences. It is unclear what effect these sequences might have on the gene being transcribed. ves Igr from nontranscribed loci also showed promoter ac tivity when inserted episomally, and thus their potential to be transcribed in situ This result renders less likely a situation in which there exists only one or a few sites competent for transcription. This would open new avenues to study the mechanism of antigenic variation by disrupting or replacing the current LAT, a nd revealed potential for in situ switching of LAT.

PAGE 88

88 Table 3 1. Statistical analysis of promoter activities in Igr of LAT Type1 Type2 P_value 1 LAT_Ig_ 5' 2 LAT_halfIg #1 0.4079 1 LAT_Ig_ 5' 3 LAT_halfIg #2 0.0005 2 LAT_halfIg #1 3 LAT_halfIg #2 0 1 LAT_Ig_ 5' 4 LAT_halfIg #3 0.0137 2 LAT_halfIg #1 4 LAT_halfIg #3 0.0056 3 LAT_halfIg #2 4 LAT_halfIg #3 0.0004 1 LAT_Ig_ 5' 5 LAT_halfIg #4 0. 0084 2 LAT_halfIg #1 5 LAT_halfIg #4 0.0049 3 LAT_halfIg #2 5 LAT_halfIg #4 0.0049 4 LAT_halfIg #3 5 LAT_halfIg #4 0.1822 1 LAT_Ig_ 5' 6 LAT_Ig_ 5' 0.0036 2 LAT_halfIg #1 6 LAT_Ig_ 5' 0.0006 3 LAT_halfIg #2 6 LAT_Ig_ 5' 0.0003 4 LAT_halfIg # 3 6 LAT_Ig_ 5' 0.0408 5 LAT_halfIg #4 6 LAT_Ig_ 5' 0.8211 1 LAT_Ig_ 5' 7 Pro ( ) 0.0001 2 LAT_halfIg #1 7 Pro ( ) 0 3 LAT_halfIg #2 7 Pro ( ) 0.0001 4 LAT_halfIg #3 7 Pro ( ) 0 5 LAT_halfIg #4 7 Pro ( ) 0.0002 6 LAT_Ig_ 5' 7 Pro ( ) 0

PAGE 89

89 Table 3 2. Statistical analysis of promoter activities in Igr of LAT with additional exon(s) and intron(s). Type1 Type2 P_value 1 Actin Ig 5' 2 LAT_ 5 0.0054 1 Actin Ig 5' 3 LAT_ 5toE1 0.2384 2 L AT_ 5 3 LAT_ 5toE1 0.0095 1 Actin Ig 5' 4 LAT_Ig 5' 0.4092 2 LAT_ 5 4 LAT_Ig 5' 0.0015 3 LAT_ 5toE1 4 LAT_Ig 5' 0.0354 4 LAT_Ig 5' 5 LAT_Ig 5' 0.0263 5 LAT_Ig 5' 6 LAT_ 5'toE1 0.0327 5 LAT_Ig 5' 7 LAT_ 5 'toI1 0.0054 6 LAT_ 5'toE1 7 LAT_ 5'toI1 0.1117 5 LAT_Ig 5' 8 LAT_ 5'toE2 0.0086 6 LAT_ 5'toE1 8 LAT_ 5'toE2 0.1521 7 LAT_ 5'toI1 8 LAT_ 5'toE2 0.848 5 LAT_Ig 5' 9 LAT_ 5'toI2 0.1048 6 LAT_ 5'toE1 9 LAT_ 5'toI2 0.5198 7 LAT_ 5 'toI1 9 LAT_ 5'toI2 0.9216 8 LAT_ 5'toE2 9 LAT_ 5'toI2 0.9664 1 Actin _Ig 5' 10 Pro( ) 0.0008 2 LAT_ 5 10 Pro( ) 0.0001 3 LAT_ 5toE1 10 Pro( ) 0.0049 4 LAT_Ig 5' 10 Pro( ) 0 5 LAT_Ig 5' 10 Pro( ) 0.044 6 6 LAT_ 5'toE1 10 Pro( ) 0.0004 7 LAT_ 5'toI1 10 Pro( ) 0 8 LAT_ 5'toE2 10 Pro( ) 0.0001 9 LAT_ 5'toI2 10 Pro( ) 0.0177

PAGE 90

90 Table 3 3. Statistical analysis of promoter activities affected by intron inversion Type1 Type2 P_v alue 1 LAT_ 5' 2 LAT_ 5'toE1+revI1 0.0719 1 LAT_ 5' 3 LAT_ 5'toE1 0.0551 2 LAT_ 5'toE1+revI1 3 LAT_ 5'toE1 0.8978 1 LAT_ 5' 4 LAT_Ig_ 5' 0.0001 2 LAT_ 5'toE1+revI1 4 LAT_Ig_ 5' 0.1675 3 LAT_ 5'toE1 4 LAT_Ig_ 5' 0.0946 4 LAT_Ig_ 5' 5 LAT_Ig_ 5' 0.0366 5 LAT_Ig_ 5' 6 LAT_ 5'toE1 0.0876 5 LAT_Ig_ 5' 7 LAT_ 5'toE1+revI1 0.1443 6 LAT_ 5'toE1 7 LAT_ 5'toE1+r evI1 0.7553 5 LAT_Ig_ 5' 8 LAT_ 5'toI1 0.0196 6 LAT_ 5'toE1 8 LAT_ 5'toI1 0.5489 7 LAT_ 5'toE1+revI1 8 LAT_ 5'toI1 0.249 5 LAT_Ig_ 5' 9 LAT_ 5'toE2 0.0352 6 LAT_ 5'toE1 9 LAT_ 5'toE 2 0.4736 7 LAT_ 5'toE1+revI1 9 LAT_ 5'toE2 0.3609 8 LAT_ 5'toI1 9 LAT_ 5'toE2 0.8536 1 LAT_ 5' 10 LAT_ 5'toE2+revI2 0 2 LAT_ 5'toE1+revI1 10 LAT_ 5'toE2+revI2 0.0016 3 LAT_ 5'toE1 10 LAT_ 5'toE 2+revI2 0.0009 4 LAT_Ig_ 5' 10 LAT_ 5'toE2+revI2 0.0003 5 LAT_Ig_ 5' 10 LAT_ 5'toE2+revI2 0.0089 6 LAT_ 5'toE1 10 LAT_ 5'toE2+revI2 0.0052 7 LAT_ 5'toE1+revI1 10 LAT_ 5'toE2+revI2 0.0036 8 LAT_ 5'toI1 10 LAT_ 5'toE2+revI2 0.0008 9 LAT_ 5'toE2 10 LAT_ 5'toE2+revI2 0.0031 5 LAT_Ig_ 5' 11 LAT_ 5'toI2 0.005 6 LAT_ 5'toE1 11 LAT_ 5'toI2 0.0713 7 LAT_ 5'toE1+revI1 11 LAT_ 5'toI2 0.0125 8 LAT_ 5'toI1 11 LAT_ 5'toI2 0.0992 9 LAT_ 5'toE2 11 LAT_ 5'toI2 0.1672 10 LAT_ 5'toE2+revI2 11 LAT_ 5'toI2 0.0006 1 LAT_ 5' 12 Pro( ) 0 2 LAT_ 5'toE1+revI1 12 Pro( ) 0.0002 3 LAT_ 5'toE1 12 Pro( ) 0.0001 4 LAT_Ig_ 5' 12 Pro( ) 0 5 LAT_Ig_ 5' 12 Pro( ) 0.0003 6 LAT_ 5'toE1 12 Pro( ) 0.0006 7 LAT_ 5'toE1+revI1 12 Pro( ) 0.0002 8 LAT_ 5'toI1 12 Pro( ) 0.0001 9 LAT_ 5'toE2 12 Pro( ) 0.0005 10 LAT_ 5'toE2+revI2 12 Pro( ) 0.0006 11 LAT_ 5'toI2 12 Pro( ) 0.0001

PAGE 91

91 Table 3 4. Statistical analysis of promoter activities of Igrs from LAT as we ll as nontranscribed ves loci Type1 Type2 P_value 1 LAT_ 5' 2 1E 10 0.0124 1 LAT_ 5' 3 S621 0.0077 2 1E 10 3 S621 0.2538 1 LAT_ 5' 4 LAT_ 5'toI1 0.1691 2 1E 10 4 LAT_ 5'toI1 0.0707 3 S621 4 LAT_ 5'toI1 0.0349 1 LAT_ 5' 5 Pro( ) 0.0156 2 1E 10 5 Pro( ) 0.0101 3 S621 5 Pro( ) 0.0009 4 LAT_ 5'toI1 5 Pro( ) 0.0032

PAGE 92

92 Figure 3 1. A cluster of promoters are revealed in the IG region of LAT. B. bovis C9.1 parasites were transfected with 11.5pmol of firefly luciferase reporter plasmids containing a series of LATIG sequences. At 24h post transfection, firefly luciferase activity in parasite extracts was measured and normalized to the level of R. reniformis luciferase activity obtained by co transfection of 7.7pmol of pC5' Renilla C3. Error bars represent standard devi ation of triplicative samples. The lower panel illustrates the LATIG and LAT halfIG series sequences, which wer e cloned into 5 of LUC gene in pLUC T3 template as shown on the right The experiment and result is repeated at least 3 times. Independent two sample t tests were performed and the calculated P values are given in Table 3 1.

PAGE 93

93 Figure 3 2. E nhancing activities are reveal ed in the individual exon or intron sequences of the apposing genes. B. bovis C9.1 parasites were transfected with 11.5 pmol of firefly luciferase reporter plasmids cont aining a series of LAT regulatory sequences. At 24 h post transfection, firefly lucifer ase activity in parasite extracts was measured and normalized to the level of R. reniformis luciferase activity ob tained by co transfection of 3.8 pmol of pC5 Renilla C3. Error bars represent standard devi ation of triplicative samples. The lower panel il lustrates the series of LAT ves 5 sequences, which wer e cloned into 5 of LUC gene in pLUC T3 template. The experiment and result is repeated at least 3 times. Independent two sample t tests were performed and the calculated P values are given in Table 32.

PAGE 94

94 Figure 3 3. Effects on luciferase expressions when introns are reversely inserted. B. bovis C9.1 parasites were transfected with 11.5 pmol of firefly luciferase reporter plasmids cont aining a series of LAT regulatory sequences. At 24 h post transfe ction, firefly luciferase activity in parasite extracts was measured and normalized to the level of R. reniformis luciferase activity obtained by co transfection of 7.7 pmol of pC5 Renilla C3. Error bars represent standard devi ation of triplicative samples except for the bar labeled #7, which represents standard deviation of six samples in one experiments The lower panel i llustrates the series of LAT ves 5 sequences, which wer e cloned into 5 of LUC gene in pLUC T3 template The experiment and result is repeated two times. Independent two sample t tests were performed and the calculated P values are given in Table 33.

PAGE 95

95 Figure 3 4. Comparable promoter activities revealed in donor ves IG region with LAT A. B. bovis C9.1 parasites were transfected with 11.5pmol of firefly luciferase repor ter plasmids containing ves 5 sequences of 1E10 and S621 nontranscribed loci At 48h post transfection, firefly luciferase activity in parasite extracts was measured and normalized to the level of R. reniformis lu ciferase activity obtained by co transfection of 3.8 pmol of pC5 Renilla C3 Error bars represent standard deviation of trip licative samples. B. I llustration of Igr sequences of 1E10 and S621, which were cloned into 5 of LUC gene in pLUC T3 template. Th e data shown is from one experiment with triplicative samples. The experiment and result is repeated at least three times. Independent two sample t tests were performed and the calculated P values are given in Table 34.

PAGE 96

96 F i gure 3 5. Alignment of sequen ces of ves (accession number: DQ267461) from B. bovis C9.1 line, and 24 donor loci from the T2Bo isolate revealed two highly conserved DNA motifs (red bar)

PAGE 97

97 Figure 3 6. Illustration of a possible in situ switching of transcription activity event in B bovis

PAGE 98

98 CHAPTER 4 CONCLUSION With this body of work in addition to published studies, the ability to transiently transfect B. bovis has been well established. This technology now provides the opportunity to determine how gene expression is developmental ly controlled in B. bovis as well as to identify important genetic elements for gene regulation. Several promoters are now available to drive transgene expression efficiently, and parameters for introducing DNA into the parasites have been improved. Promoter activity is now convincingly quantifiable with an efficient internal control, and is also visualized with the employment of a second reporter, EGFP. Stable transfection has now been achieved in B. bovis a second time, previously reported by Suarez et al (Suarez and McElwain, 2009a) confirming the feasibility of this approach to the genetic manipulation of this parasite. Several selectable markers for B. bovis have been identified to provide tools for efficient selection and maintenance of the transfect ants. Successful integration of the exogenous fusion gene has been confirmed, although gene targeting is not yet reproducible. Further investigation into the parameters for optimal gene targeting may provide the opportunity for functional analysis of prote ins by gene disruption and gene replacement. Hence, the in situ switching mechanism behind antigenic variation of B. bovis may be addressed. Stable transfection will ultimately serve as a great tool to assist in dissecting and understanding the biology of how B. bovis mediates the phenotypic variation of surface protein to accomplish sequestration and immune evasion. Investigation of promoter activity embodied in LAT sequences by transient transfection revealed a cluster of promoters embedded within the int ergenic region, as well as possible enhancing activities residing in both exonic and intronic sequences in the opposing gene. At least two predicted DNA motifs specifically bound by AP2 domains were found to be located within

PAGE 99

99 this region, and conserved sequences in intron 1 of the ves 1 gene were identified Further investigation is now possible to understand the regulation of the ves multigene family. In addition, investigation of promoter activity of ves Igr from other nontranscribed loci also showed the ir potential to be transcribed in situ This allowed discrimination from a situation with only one or a few sites competent for transcription. Now, t he development of both transient and stab le transfection technologies has been facilitated by the release o f the full genome sequence of the Texas T2Bo isolate of B. bovis (Brayton et al., 2007) With the genomic sequences accessible to all, elucidation of the function of many other proteins and identification and validation of candidates that are most suitable for vaccine and drug target development may be accelerated by the application of this genetic tool. All the work that has been done, as well as the additional development of the genetic tools, will greatly improve the genetic manipulation of B. bovis and significantly contribute to our understanding of the biology of the parasite.

PAGE 100

100 APPENDIX A PRIMERS USED IN STUDY Table A 1. Primers used in this study Name Sequence (Restriction sites are shown in brackets) Accession Number and sequence number XW17: calm odulin 5_5HindIII CC[AAGCTT]TACCGAGAAGAGCCTGCAAC AAXT01000005: 583125583144 XW18: calmodulin 5_3HindIII CC|AAGCTT|GTATTTAATAATATTAAATTGC TAATACTG AAXT01000005: 584492584521 XW21: tubulin 5_5HindIII CC[AAGCTT]GAAACTCGCATCGCTCTAAAC AAXT01000001: 10316721031692 XW22: tubulin 5_3HindIII CC[AAGCTT]CTATTGTTACACTACAGAATGT AACATGAAC AAXT01000001: 10333071033277 XW23: tubulin 3_5SacI C[GAGCTC]ACATAGTATAACCTTATTGCATA AGTTCAC AAXT01000001: 10348131034842 XW24: tubulin 3_3SacI C[GAGCTC]AGAAGCGT GAATATGCCTTG AAXT01000001: 10357861035805 XW25: ves IG_5HindIII GC[AAGCTT]GGAATCATACAGTAGGTCCTTC DQ267461: 8048 8069 XW26: ves IG_3HindIII GC[AAGCTT]TGTCAGTGCTTCTAGGAGTACT CAG DQ267461: 8701 8725 XW75: S621 IG_5BamHI ATCG[GGATCC]TGTACAGGGGTGAGTC TAT G AY279554: 3964 3983 XW92: S621 IG_5ApaI AGG[GGGCCC]TGTACAGGGGTGAGTCTATG AY279554: 3964 3983 XW76: S621 IG_3BamHI ACGTCGC[GGATCC]TATCAGTGCTTCTAGGA GTACTCAG AY279554: 4621 4597 XW77: 1E10 IG_5BamHI CGC[GGATCC]TCCTTGGCGTCATACAGTAG AY279553: 5166 5185 XW78: 1E10 IG_3BamHI CGC[GGATCC]TGTCAGTGCCTTTAGGAGTAC TC AY279553: 5834 5812 XW79: LAT_IG5_BamHI CG[GGATCC]TATGTTACCACCCCTTGTTT DQ267461: 8292 8311 XW95: LAT_IG5_ApaI AGG[GGGCCC]TATGTTACCACCCCTTGTTT DQ267461: 8292 8311 XW80: LAT_IG3_BamHI C G[GGATCC]TGTCAGTGCTTCTAGGAGTACT DQ267461: 8704 8725 XW106: LAT_halfIG#1_ApaI AGG [GGG CCC]AGATTCCGTATAAGCAATTC DQ267461: 8498 8517 XW107: LAT_halfIG#2_BamHI CG[GGATCC]TACTGGATAATCCATATTATTC TAC DQ267461: 8468 8492

PAGE 101

101 Table A 1. Continued Name Sequence (Restriction sites are shown in brackets) Accession Number and sequence number XW108: LAT_halfIG#3_ApaI AGG[GGGCCC]TACTGGATAATCCATATTATT CTAC DQ267461: 8468 8492 XW109: LAT_halfIG#4_ApaI AGG[GGGCCC]TGTCAGTGCTTCTAGGAGTA CT DQ267461: 8704 8725 XW110: LAT _halfIG#4_BamHI CGC [GGATCC]AGATTCCGTATAAGCAATTC DQ267461: 8498 8517 XW111: LAT_ ves AG[GGGCCC]CTGTATCAGAGTGAATTCCAT AG DQ267461: 8960 8938 XW112: LAT_ ves AG[GGGCCC]CTTGTTTTGAGAACTGTCAG DQ267461: 9142 9123 XW124: LAT_ ves AG[GGGCCC]GGGGGCCAGAGTCCTTGTTTG DQ267461: 8141 8161 XW125: LAT_ ves 1_ApaI AG[GGGCCC]CACCATCACCCAGCTTTTTAC DQ267461: 8849 8829 XW126: LAT_ ves AG[GGGCCC]CATGGTACTCCAGTTGTACTG DQ267461: 9006 9026 XW127: actinCDS_5HindIII CC[AAGCTT]CTATCCAGGCTGTGCTTTC AAXT01000006: 8958789605 XW128: actinCDS_3HindIII CC [AAGCTT]TTCCTTAATGTCACGCACAAT AAXT01000006: 8936789388 XW135: ves CC[AAGCTT]GTAAGTCAATAGCACTAAC DQ267461: 8140 8122 XW136: ves CCA[ATGCAT]CTGTATAGCCATGTAAGAG DQ267461: 8098 8116 XW137: vesHindIII CC[AAGCTT]GTACGTTGGCATAGAC DQ267461: 8850 8865 XW138: ves CCA[ATGCAT]CTGTATCAGAGTGAATTC DQ267461: 8960 8943 XW140: ves CC[AAGCTT]GTAAGTACCTAGTAGTGGAG DQ267461: 9027 9046 XW141: ves siI CCA[ATGCAT]CTATAGGACACCATGAG DQ267461: 9098 9082

PAGE 102

102 APPENDIX B STABILITY OF TRANSFORMABLE DNA The stability of exogenously inserted DNA in bovine erythrocytes was previously tested (excellent technical support provided by Jeanne Blackwell). This was done by examination of the ability to recover circular, transformable DNA, and quantified based on the ability to transform E. coli R ecovery was quantified as the number of antibiotic resistant colonies as a function of hours post transfection It was de termined that, using the condition of 150 V, 1000 F, and 70 it is possible to load bovine RBCs with exogenous DNA with minimal loss of parasite viability. The half life (t1/2) of transformable DNA in RBCs was approximately 10 hours 15 min, according to the exponential curve that fitted to the data points (R2 = 0.997). Figure B 1. Transformed E. coli recovery as a function of hours post transfection of bovine RBCs with transformable DNA. DNAs were loaded into bovine erythrocytes at the condition of 150 V, 1000 F, and 70 DNAs were collected from wells at 24h, 48h, 72h time points post transfection and used to transform E.Coli by electroporation. (Experiment by Jeanne Blackwell)

PAGE 103

103 LIST OF REFERENCES Adachi, N., and Lieber, M.R. (2002). Bidirectional gene organization: a common architectural feature of the human genome. Cell 109, 807809. Aikawa, M., Pongponratn, E., Tegoshi, T., Nakamura, K., Nagatake, T., Cochrane, A., and Ozaki, L.S. (1992). A study on the pathogenesis of human cerebral malaria and cerebral babesiosis. Mem Inst Oswaldo Cruz 87 Suppl 3, 297301. Al Khedery, B., and Allred, D.R. (2006). Antigenic variation in Babesia bovis occurs through segmental gene conversion of the ves multigene family, within a bidirectional locus of active transcription. Molecular M icrobiology 59, 402414. Allred, D.R., and Al Khedery, B. (2004). Antigenic variation and cytoadhesion in Babesia bovis and Plasmodium falciparum : different logics achieve the same goal. Molecular and Biochemical Parasitology 134, 2735. Allred, D.R., and Al Khedery, B. (2006). Antigenic variation as an exploitable weakness of babesial parasites. Veterinary Parasitology 138, 5060. Allred, D.R., Carlton, J.M.R., Satcher, R.L., Long, J.A., Brown, W.C., Patterson, P.E., O'Connor, R.M., and Stroup, S.E. (2000) The ves multigene family of Babesia bovis encodes components of rapid antigenic variation at the infected erythrocyte surface. Molecular Cell 5, 153162. Allred, D.R., Cinque, R.M., Lane, T.J., and Ahrens, K.P. (1994). Antigenic variation of parasiteder ived antigens on the surface of Babesia bovis infected erythrocytes Infection and Immunity 62, 91 98. Allred, D.R., Hines, S.A., and Ahrens, K.P. (1993). Isolate specific parasite antigens of the Babesiabovis infected erythrocyte surface. Molecular and B iochemical Parasitology 60, 121132. Allsopp, M.T.E.P., Cavaliersmith, T., Dewaal, D.T., and Allsopp, B.A. (1994). Phylogeny and evolution of the piroplasms Parasitology 108, 147152. Babes, V. (1888). Sur lhemoglobinurie bacterienne du boeuf. CR Acad Sci Paris 107, 692694. Balaji, S., Babu, M.M., Iyer, L.M., and Aravind, L. (2005). Discovery of the principal specific transcription factors of Apicomplexa and their implication for the evolution of the AP2integrase DNA binding domains. Nucleic Acids Res 33, 39944006. Barbacid, M., Fresno, M., and Vazquez, D. (1975). Inhibitors of polypeptide elongation on yeast polysomes. J Antibiot (Tokyo) 28, 453 462.

PAGE 104

104 Baruch, D.I., Pasloske, B.L., Singh, H.B., Bi, X.H., Ma, X.C., Feldman, M., Taraschi, T.F., and Howar d, R.J. (1995). Cloning the Plasmodium falciparum gene encoding Pfemp1, a malarial variant antigen and adherence receptor on the surface of parasitized human erythrocytes Cell 82, 7787. Bock, R., Jackson, L., de Vos, A., and Jorgensen, W. (2004). Babesiosis of cattle. Parasitology 129 Suppl S247269. Borst, P., Bitter, W., Blundell, P.A., Chaves, I., Cross, M., Gerrits, H., van Leeuwen, F., McCulloch, R., Taylor, M., and Rudenko, G. (1998). Control of VSG gene expression sites in Trypanosoma brucei Mol Biochem Parasitol 91 6776. Borst, P., and Ulbert, S. (2001). Control of VSG gene expression sites. Molecular and Biochemical Parasitology 114, 1727. Brayton, K.A., Lau, A.O.T., Herndon, D.R., Hannick, L., Kappmeyer, L.S., Berens, S.J., Bidwell, S.L., Br own, W.C., Crabtree, J., Fadrosh, D., et al. (2007). Genome sequence of B abesia bovis and comparative analysis of apicomplexan hemoprotozoa. Plos Pathogens 3, 14011413. Butler, J.E., and Kadonaga, J.T. (2002). The RNA polymerase II core promoter: a key co mponent in the regulation of gene expression. Genes Dev 16, 25832592. Calder, J.A.M., Reddy, G.R., Chieves, L., Courtney, C.H., Littell, R., Livengood, J.R., Norval, R.A.I., Smith, C., and Dame, J.B. (1996). Monitoring Babesia bovis infections in cattle b y using PCR based tests. Journal of Clinical Microbiology 34, 27482755. Calderwood, M.S., GannounZaki, L., Wellems, T.E., and Deitsch, K.W. (2003). Plasmodium falciparum var genes are regulated by two regions with separate promoters, one upstream of the coding region and a second within the intron. Journal of Biological Chemistry 278, 3412534132. Callow, L.a.M.M. (1963.). Cerebral babesiosis due to Babesia argentina. Aust Vet J 39, p. 1521. Chen, Q.J., Fernandez, V., Sundstrom, A., Schlichtherle, M., Da tta, S., Hagblom, P., and Wahlgren, M. (1998). Developmental selection of var gene expression in Plasmodium falciparum Nature 394, 392395. Crabb, B.S., Cooke, B.M., Reeder, J.C., Waller, R.F., Caruana, S.R., Davern, K.M., Wickham, M.E., Brown, G.V., Coppel, R.L., and Cowman, A.F. (1997). Targeted gene disruption shows that knobs enable malaria infected red cells to cytoadhere under physiological shear stress. Cell 89, 287296. Crabb, B.S., and Cowman, A.F. (1996). Characterization of promoters and stable transfection by homologous and nonhomologous recombination in Plasmodium falciparum Proc Natl Acad Sci U S A 93, 7289 7294.

PAGE 105

105 Cruz, A., and Beverley, S.M. (1990). Gene replacement in parasitic protozoa. Nature 348, 171173. de KoningWard, T.F., Janse, C.J., and Waters, A.P. (2000). The development of genetic tools for dissecting the biology of malaria parasites. Annu Rev Microbiol 54, 157185. de KoningWard, T.F., Speranca, M.A., Waters, A.P., and Janse, C.J. (1999). Analysis of stage specificity of promot ers in Plasmodium berghei using luciferase as a reporter. Mol Biochem Parasitol 100, 141146. De Silva, E.K., Gehrke, A.R., Olszewski, K., Leon, I., Chahal, J.S., Bulyk, M.L., and Llinas, M. (2008). Specific DNA binding by apicomplexan AP2 transcription fa ctors. Proc Natl Acad Sci U S A 105, 83938398. Deitsch, K., Driskill, C., and Wellems, T. (2001). Transformation of malaria parasites by the spontaneous uptake and expression of DNA from human erythrocytes. Nucleic Acids Res 29, 850853. Desjardins, R.E., Canfield C. J., Haynes J. D., and Chulay J. D. (1979). Quantitative assessment of antimalarial activity in vitro by a semiautomated microdilution technique Antimicrobial Agents and Chemotherapy 16, 710718. Elemento, O., Slonim, N., and Tavazoie, S. ( 2007). A universal framework for regulatory element discovery across all genomes and data types. Mol Cell 28, 337350. Fidock, D.A., Nomura, T., and Wellems, T.E. (1998). Cycloguanil and its parent compound proguanil demonstrate distinct activities against Plasmodium falciparum malaria parasites transformed with human dihydrofolate reductase. Mol Pharmacol 54, 11401147. Frank, M., Dzikowski, R., Amulic, B., and Deitsch, K. (2007). Variable switching rates of malaria virulence genes are associated with chro mosomal position. Molecular Microbiology 64, 14861498. Frank, M., Dzikowski, R., Costantini, D., Amulic, B., Berdougo, E., and Deitsch, K. (2006). Strict pairing of var promoters and introns is required for var gene silencing in the malaria parasite Plasm odium falciparum Journal of Biological Chemistry 281, 99429952. Gardner, M.J., Hall, N., Fung, E., White, O., Berriman, M., Hyman, R.W., Carlton, J.M., Pain, A., Nelson, K.E., Bowman, S., et al. (2002). Genome sequence of the human malaria parasite Plasm odium falciparum Nature 419, 498511. Gatton, M.L., Martin, L.B., and Cheng, Q. (2004). Evolution of resistance to sulfadoxine pyrimethamine in Plasmodium falciparum Antimicrob Agents Chemother 48, 21162123. Goonewardene, R., Daily, J., Kaslow, D., Sull ivan, T.J., Duffy, P., Carter, R., Mendis, K., and Wirth, D. (1993). Transfection of the malaria parasite and expression of firefly luciferase. Proc Natl Acad Sci U S A 90, 52345236.

PAGE 106

106 Gough, J.M., Jorgensen, W.K., and Kemp, D.H. (1998). Development of tick gut forms of Babesia bigemina in vitro Journal of Eukaryotic Microbiology 45, 298306. Graham, F.L., and van der Eb, A.J. (1973). A new technique for the assay of infectivity of human adenovirus 5 DNA. Virology 52, 456 467. Gray, J., von Stedingk, L.V., and Granstrom, M. (2002). Zoonotic babesiosis. International Journal of Medical Microbiology 291, 108111. Hansen, J.J., Bross, P., Westergaard, M., Nielsen, M.N., Eiberg, H., Borglum, A.D., Mogensen, J., Kristiansen, K., Bolund, L., and Gregersen, N. (2003). Genomic structure of the human mitochondrial chaperonin genes: HSP60 and HSP10 are localised head to head on chromosome 2 separated by a bidirectional promoter. Hum Genet 112, 7177. Heidel, J., and Maloney, J. (1999). When can sigmoidal data be fit to a Hill curve? Journal of the Australian Mathematical Society Series B Applied Mathematics 41, 8392. Horrocks, P., Pinches, R., Christodoulou, Z., Kyes, S.A., and Newbold, C.I. (2004). Variable var transition rates underlie antigenic variation in malaria. Proceedings of the National Academy of Sciences of the United States of America 101, 1112911134. Hunfeld, K.P., Hildebrandt, A., and Gray, J.S. (2008). Babesiosis: Recent insights into an ancient disease. International Journal for Parasitology 38, 12191237. Kamper, S.M., and Barbet, A.F. (1992). Surface epitope variation via mosaic gene formation is potential key to long term survival of Trypanosoma brucei Molecular and Biochemical Parasitology 53, 3344. Kinosita, K., Jr., and Tsong, T.Y. (1977). Forma tion and resealing of pores of controlled sizes in human erythrocyte membrane. Nature 268, 438 441. Kjemtrup, A.M., and Conrad, P.A. (2000). Human babesiosis: an emerging tickborne disease. Int J Parasitol 30, 13231337. Kocken, C.H., van der Wel, A., and Thomas, A.W. (1999). Plasmodium cynomolgi : transfection of bloodstage parasites using heterologous DNA constructs. Exp Parasitol 93, 5860. Lee, M.G., and Van der Ploeg, L.H. (1990). Homologous recombination and stable transfection in the parasitic proto zoan Trypanosoma brucei Science 250, 15831587. Levine, N.D. (1971). Taxonomy of piroplasms Transactions of the American Microscopical Society 90, 28. Levine, N.D. (1985). Veterinary Protozoology. Ames, Iowa State University Press. Maasho, K., Marusina, A., Reynolds, N.M., Coligan, J.E., and Borrego, F. (2004). Efficient gene transfer into the human natural killer cell line, NKL, using the Amaxa nucleofection system (TM). Journal of Immunological Methods 284, 133140.

PAGE 107

107 Mackenstedt, U., Gauer, M., Fuchs, P ., Zapf, F., Schein, E., and Mehlhorn, H. (1995). DNA measurements reveal differences in the lifecycles of Babesia bigemina and B canis 2 Typical Members of the Genus Babesia. Parasitology Research 81, 595604. Mahoney, D.F., Wright, I.G., and Mirre, G.B. (1973). Bovine babesiasis persistence of immunity to Babesia argentina and Babesi a bigemina in calves (bos taurus) after naturally acquired infection Annals of Tropical Medicine and Parasitology 67, 197203. Mamoun, C.B., Gluzman, I.Y., Goyard, S., B everley, S.M., and Goldberg, D.E. (1999). A set of independent selectable markers for transfection of the human malaria parasite Plasmodium falciparum Proc Natl Acad Sci U S A 96, 87168720. Margos, G., van Dijk, M.R., Ramesar, J., Janse, C.J., Waters, A.P., and Sinden, R.E. (1998). Transgenic expression of a mosquitostage malarial protein, Pbs21, in blood stages of transformed Plasmodium berghei and induction of an immune response upon infection. Infect Immun 66, 38843891. Martin, W.J., Finerty, J., and Rosenthal, A. (1971). Isolation of Plasmodium berghei (malaria) parasites by ammonium chloride lysis of infected erythrocytes. Nat New Biol 233, 260261. Maxson, R., Cohn, R., Kedes, L., and Mohun, T. (1983). Expression and organization of histone genes. Annu Rev Genet 17, 239277. McCosker, P.J., ed. (1981). The Global Importance of Babesiosis (New York, AcademicPress Inc.). Militello, K.T., Dodge, M., Bethke, L., and Wirth, D.F. (2004). Identification of regulatory elements in the Plasmodium falciparum genome. Mol Biochem Parasitol 134, 7588. Militello, K.T., and Wirth, D.F. (2003). A new reporter gene for transient transfection of Plasmodium falciparum Parasitol Res 89, 154157. Muhle, R.A ., Adjalley, S., Falkard, B., Nkrumah, L.J., Muhle, M.E., and Fidock, D.A. (2009). A var gene promoter implicated in severe malaria nucleates silencing and is regulated by 3 untranslated region and intronic cis elements. International Journal for Parasit ology 39, 14251439. Navarro, M., and Gull, K. (2001). A pol I transcriptional body associated with VSG monoallelic expression in Trypanosoma brucei Nature 414, 759763. Nelson, D.L., and Cox, M.M. (2008). Lehninger Principles of Biochemistry, 5th edn (N ew York NY, W. H. Freeman and Company). Neumann, E., Schaeferridder, M., Wang, Y., and Hofschneider, P.H. (1982). Gene transfer into mouse lyoma cells by electroporation in high electric fields Embo Journal 1, 841845.

PAGE 108

108 Nunes, A., Thathy, V., Bruderer, T., Sultan, A.A., Nussenzweig, R.S., and Menard, R. (1999). Subtle mutagenesis by ends in recombination in malaria parasites. Mol Cell Biol 19, 28952902. O'Connor, R.M., and Allred, D.R. (2000). Selection of Babesia bovis infected erythrocytes for adhesion t o endothelial cells coselects for altered variant erythrocyte surface antigen isoforms. Journal of Immunology 164, 20372045. O'Connor R.M., Lane, T.J., Stroup, S.E., and Allred, D.R. (1997). Characterization of a variant erythrocyte surface antigen (VESA 1) expressed by Babesia bovis during antigenic variation. Molecular and Biochemical Parasitology 89, 259270. Ohme Takagi, M., and Shinshi, H. (1995). Ethylene inducible DNA binding proteins that interact with an ethylene responsive element. Plant Cell 7, 173182. Roth, C., Bringaud, F., Layden, R.E., Baltz, T., and Eisen, H. (1989). Active late appearing variable surfaceantigen genes in T rypanosoma equiperdum are constructed entirely from pseudogenes Proceedings of the National Academy of Sciences of the United States of America 86, 9375 9379. Sambrook, J., and Russell, D.W., ed. (2001). Molecular Cloning: A Laboratory Manual, 3rd edn edn (Cold Spring Harbor, NewYork:Cold Spring Harbor Laboratory Press). Scherf, A., Hernandez Rivas, R., Buffet, P., Bottius, E., Benatar, C., Pouvelle, B., Gysin, J., and Lanzer, M. (1998). Antigenic variation in malaria: in situ switching, relaxed and mutually exclusive transcription of var genes during intra erythrocytic development in Plasmodium falciparum Embo Journal 17, 54185426. Schmidt, C., Fischer, G., Kadner, H., Genersch, E., Kuhn, K., and Poschl, E. (1993). Differential effects of DNA binding proteins on bidirectional transcription from the common promoter region of human collagen type IV genes COL4A1 and COL4A2. Biochim Biophys Acta 1174, 110. Smith, J.D., Chitnis, C.E., Craig, A.G., Roberts, D.J., Hudsontaylor, D.E., Peterson, D.S., Pinches, R., Newbold, C.I., and Miller, L.H. (1995). Switches in expression of Plasmodium falciparum var genes correlate with chan ges in antigenic and cytoadherent phenotypes of infested erythrocytes Cell 82, 101110. Su, X.Z., Heatwole, V.M., Wertheimer, S.P., Guinet, F., Herrfeldt, J.A., Peterson, D.S., Ravetch, J.A., and Wellems, T.E. (1995). The large diverse gene family var encodes proteins involved in cytoadherence and antigenic variation of Plasmodium falciparum infected erythrocytes Cell 82, 89100. Suarez, C.E., Lacy, P., Laughery, J., Gonzalez, M.G., and McElwain, T. (2007). Optimization of Babesia bovis transfection metho ds. Parassitologia 49 Suppl 1, 6770. Suarez, C.E., and McElwain, T.F. (2008). Transient transfection of purified Babesia bovis merozoites. Exp Parasitol 118, 498504.

PAGE 109

109 Suarez, C.E., and McElwain, T.F. (2009a). Stable expression of a GFP BSD fusion protein in Babesia bovis merozoites. Int J Parasitol 39, 289297. Suarez, C.E., and McElwain, T.F. (2009b). Transfection systems for Babesia bovis : A review of methods for the transient and stable expression of exogenous genes. Vet Parasitol. Suarez, C.E., Norimine, J., Lacy, P., and McElwain, T.F. (2006). Characterization and gene expression of Babesia bovis elongation factor 1 alpha. International Journal for Parasitology 36, 965973. Suarez, C.E., Palmer, G.H., LeRoith, T., FlorinChristensen, M., Crabb, B., and McElwain, T.F. (2004). Intergenic regions in the rhoptry associated protein1 ( rap1) locus promote exogenous gene expression in Babesia bovis International Journal for Parasitology 34, 11771184. ten Asbroek, A.L., Ouellette, M., and Borst, P. (1990). T argeted insertion of the neomycin phosphotransferase gene into the tubulin gene cluster of Trypanosoma brucei Nature 348, 174175. Tripp, C.A., Wagner, G.G., and Rice Ficht, A.C. (1989). Babesia bovis : gene isolation and characterization using a mung bean nucleasederived expression library. Exp Parasitol 69, 211225. van Dijk, M.R., Janse, C.J., and Waters, A.P. (1996). Expression of a Plasmodium gene introduced into subtelomeric regions of Plasmodium berghei chromosomes. Science 271, 662665. Vazquez, D. (1979). Inhibitors of protein biosynthesis. Mol Biol Biochem Biophys 30, i x, 1312. Weaver, J.C. (1993). Electroporation a general phenomenon for manipulating cells and tissues Journal of Cellular Biochemistry 51, 426435. Wright, I.G. (1972). An elec tron microscopic study of intravascular agglutination in the cerebral cortex due to Babesia argentina infection. Int J Parasitol 2, 209215. Wright, I.G., and Goodger, B.V. (1979). Acute Babesia bovis infections: renal involvement in the hypotensive syndrome. Z Parasitenkd 59, 115119. Wu, Y., Kirkman, L.A., and Wellems, T.E. (1996). Transformation of Plasmodium falciparum malaria parasites by homologous integration of plasmids that confer resistance to pyrimethamine. Proc Natl Acad Sci U S A 93, 11301134. Yamaguchi, I., Shibata, H., Seto, H., and Misato, T. (1975). Isolation and purification of blasticidin S deaminase from Aspergillus terreus. J Antibiot (Tokyo) 28, 714.

PAGE 110

110 Zupanska, A.K., Drummond, P.B., Swetnam, D.M., Al Khedery, B., and Allred, D.R. (2009). Universal primers suitable to assess population dynamics reveal apparent mutually exclusive transcription of the Babesia bovis ves 1 alpha gene. Molecular and Biochemical Parasitology 166, 4753.

PAGE 111

111 BIOGRAPHICAL SKETCH Xinyi Wang was born in 1982 in Shanghai. She was brought up in the vicinity of Fudan University, one of the most prestigious universities in China, and had a happy childhood. In 2000, she was admitted to Fudan University for her undergraduate education. 4 years later, Xinyi Wang earned her B.S. degree in Life Sciences Department from Fudan University, and left Shanghai for the first time. She came to the United States to continue her graduate study in the Interdisciplinary Program at College of Medicine of the University of Florida in 2004. While taking classes, she worked as a Research Assistant in a lab of the Department of Infectious Diseases under the supervision of Professor David R. Allred. She quite enjoyed the time she spent in the lab, working on transfection and genetic manipulati on of Babesia bovis Her research focused on the mechanism of antigenic variation in B bovis