<%BANNER%>

Engineering Multifunctional Nucleic Acid Probes/Nanomaterials for Cancer Studies

Permanent Link: http://ufdc.ufl.edu/UFE0041094/00001

Material Information

Title: Engineering Multifunctional Nucleic Acid Probes/Nanomaterials for Cancer Studies
Physical Description: 1 online resource (146 p.)
Language: english
Creator: Wu, Yanrong
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: acid, cancer, design, detection, multifunctional, nanomaterial, nucleic, probe, therapy
Chemistry -- Dissertations, Academic -- UF
Genre: Chemistry thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Essential cancer research studies include diagnosis of early-stage cancer and elucidation of the disease processes, with the hope of finding efficient anti-cancer therapy systems. Among the various types of molecular tools, multifunctional nucleic acid probes serve versatile roles via rational selection and construction processes (e.g., use as sensors, catalytic enzymes, drugs, and aptamers). My doctoral research has focused exclusively on the sensor and aptamer functions, in particular the engineering of multifunctional nucleic acid probes or nanomaterials for detection and analysis of cancer cells. My most recent work has involved the construction of an aptamer-micelle as an efficient detection and delivery vehicle toward cancer cells. An aptamer, which can specifically bind to a broad spectrum of targets, including small molecules, proteins, and even disease cells, is a single-stranded DNA or RNA molecule isolated from combinational libraries by a process termed SELEX (Systematic Evolution of Ligands by Exponential enrichment). The Tan research group has developed a whole-cell-SELEX strategy to generate a panel of aptamers for specific diseased cells without any prior knowledge about the target molecules. Although aptamers have shown great promise in molecular recognition toward specific cancer cells, the relatively weak binding affinities of some aptamers at physiological temperatures has hampered cell targeting and applications to targeted therapy. To solve this problem, an aptamer-micelle strategy was implemented by attaching lipid tails onto the ends of low-affinity aptamers. This resulted in several beneficial and innovative properties, such as greatly enhanced binding ability, extremely low dissociation rates, additional internalization pathways, as well as sensitive and rapid cancer detection. Cancer originates from mutations in human genes and genetic alterations which cause molecular changes to cell structure that ultimately result in morphological and physiological abnormalities. Consequentially, my research has also focused on designing molecular sensors to detect such changes via intracellular mRNA monitoring. The monitoring of oncogene expression or spatial localization allows cellular events and disease pathogenesis to be more accurately understood. Besides serving as genetic information housekeepers, nucleic acids can also be built into various sensors based on Watson-Crick base-pairing and diverse signal transduction mechanisms. However, the complex nature of living cells poses challenges to the design of such sensors by the susceptibility of nucleic acids to enzyme digestion and inefficient self-delivery into the cells. Two methods were tested to address these limitations: introduction of locked nucleic acid bases into the sensor design and modification of sensors with single-walled carbon nanotubes. These two methodologies have yielded robust probes, thus permitting more reliable intracellular gene studies at the single-cell level. Results of my doctoral research demonstrate that multifunctional nucleic acids can be utilized as key building blocks to fulfill the various goals in cancer research.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Yanrong Wu.
Thesis: Thesis (Ph.D.)--University of Florida, 2009.
Local: Adviser: Tan, Weihong.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-06-30

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0041094:00001

Permanent Link: http://ufdc.ufl.edu/UFE0041094/00001

Material Information

Title: Engineering Multifunctional Nucleic Acid Probes/Nanomaterials for Cancer Studies
Physical Description: 1 online resource (146 p.)
Language: english
Creator: Wu, Yanrong
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: acid, cancer, design, detection, multifunctional, nanomaterial, nucleic, probe, therapy
Chemistry -- Dissertations, Academic -- UF
Genre: Chemistry thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Essential cancer research studies include diagnosis of early-stage cancer and elucidation of the disease processes, with the hope of finding efficient anti-cancer therapy systems. Among the various types of molecular tools, multifunctional nucleic acid probes serve versatile roles via rational selection and construction processes (e.g., use as sensors, catalytic enzymes, drugs, and aptamers). My doctoral research has focused exclusively on the sensor and aptamer functions, in particular the engineering of multifunctional nucleic acid probes or nanomaterials for detection and analysis of cancer cells. My most recent work has involved the construction of an aptamer-micelle as an efficient detection and delivery vehicle toward cancer cells. An aptamer, which can specifically bind to a broad spectrum of targets, including small molecules, proteins, and even disease cells, is a single-stranded DNA or RNA molecule isolated from combinational libraries by a process termed SELEX (Systematic Evolution of Ligands by Exponential enrichment). The Tan research group has developed a whole-cell-SELEX strategy to generate a panel of aptamers for specific diseased cells without any prior knowledge about the target molecules. Although aptamers have shown great promise in molecular recognition toward specific cancer cells, the relatively weak binding affinities of some aptamers at physiological temperatures has hampered cell targeting and applications to targeted therapy. To solve this problem, an aptamer-micelle strategy was implemented by attaching lipid tails onto the ends of low-affinity aptamers. This resulted in several beneficial and innovative properties, such as greatly enhanced binding ability, extremely low dissociation rates, additional internalization pathways, as well as sensitive and rapid cancer detection. Cancer originates from mutations in human genes and genetic alterations which cause molecular changes to cell structure that ultimately result in morphological and physiological abnormalities. Consequentially, my research has also focused on designing molecular sensors to detect such changes via intracellular mRNA monitoring. The monitoring of oncogene expression or spatial localization allows cellular events and disease pathogenesis to be more accurately understood. Besides serving as genetic information housekeepers, nucleic acids can also be built into various sensors based on Watson-Crick base-pairing and diverse signal transduction mechanisms. However, the complex nature of living cells poses challenges to the design of such sensors by the susceptibility of nucleic acids to enzyme digestion and inefficient self-delivery into the cells. Two methods were tested to address these limitations: introduction of locked nucleic acid bases into the sensor design and modification of sensors with single-walled carbon nanotubes. These two methodologies have yielded robust probes, thus permitting more reliable intracellular gene studies at the single-cell level. Results of my doctoral research demonstrate that multifunctional nucleic acids can be utilized as key building blocks to fulfill the various goals in cancer research.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Yanrong Wu.
Thesis: Thesis (Ph.D.)--University of Florida, 2009.
Local: Adviser: Tan, Weihong.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-06-30

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0041094:00001


This item has the following downloads:


Full Text

PAGE 1

1 ENGINEERING MULTIFUNCTIONAL NUCLEIC ACID PROBES /NANOMATERIALS FOR CANCER STUDIES By YANRONG WU A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR TH E DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2009

PAGE 2

2 2009 Yanrong Wu

PAGE 3

3 To my parents and my husband Jianguo Mei

PAGE 4

4 ACKNOWLEDGMENTS I am deeply indebted to a long list of people, without whom thi s dissertation would not be possible. First, I want to express my gratitude to my research advisor, Dr. Weihong Tan. I thank Dr. Tan for offering me a lot of freedom and support to pursue my research interests. Without his advice and suggestions, my projec ts would not have been accomplished successfully. Under his guidance, I have kept challenging myself to be a better scientist and become more mature. I also thank Dr. Ri chard A. Yost, Dr. Kirk S. Schanze, Dr. Gail E. Fanucci and Dr. Christopher Batich for being my committee members. I greatly appreciate their advice, helpful discussion, encouragement and assistance during the past years. This dissertation work has received valuable help from a group of people in different research areas. I am very thankful to Dr. Gail Fanucci, Dr. Rolf Renne, Dr. Dietmann W. Siemann, Dr. Glenn A. Walter, Dr. Art Edison and Dr. Leonid Moroz for their insightful suggestions about my research projects. I greatly appreciate Dr. David Powell, Dr. Jodie Johnson, Dr. Hong Yu, Li T an and Basri Gulbakan for their helpful discussions about mass spectrometry. I would like to thank Dr. Yiider Tseng and his student Pei hsu Wu for interesting comments and assistan ce in the particle bombard ment project. I am especially grateful to Mr. Mike Ruler for providing me unconditional help with the microinjection technique. I would like to thank Dr. Chaoyong James Yang and Hui Lin for helping me start my very first research project. I would like to thank Dr. Joseph Phillips, Dalia Lopez Colon, Tao C hen and Lu Peng for providing me kind help to film a video for the carbon nanotube project. I thank Dr. Zunyi Yang for his critical comments and helpful discussion about ion exchange HPLC and radioisotope test. I thank Jianguo Mei and Dr. Ruowen Wang for offering me organic synthesis help. I thank Meghan B. ODonoghue for assistance in several techniques and interesting discussion, Dr. Jinlin Yan for gold nanoparticle synthesis assistance, Dr. Ye Xu and Rahul R. Kamath for flow

PAGE 5

5 microfluidic channel preparat ion help Kwame Sefah for experimental help, and Jennifer Meek el for writing suggestions. I am thankful to Li Bo and Patrick Colon for their research assistance and nice friendship. The Tan research group is a big family. I am very thankful for helpful di scussion and kind encouragements from Dr. Colin Medley, Dr. Joshua Smith, Dr. Prabodhika Mallikaratchy, Dr. Lin Wang, Dr. Dihua Shangguan and Dr. Lisa Hilliard. I would also like to thank the following family members for creating my unforgettable memor ies in beautiful Gainesville and their nice and special friendship: Dr. Kathryn Williams, Dr. Xiaoling Zhang, Dr. Xiaolan Chen, Dr. Huanghao Yang, Dr. Ronghua Yang, Dr. Huimin Li, Dr. Tianfu Liu, Dr. Julia Xiaojun Zhao, Dr. Charles Lofton, Dr. Gang Yao, Dr. Tm othy Drake, Dr. Marie Vicens, Dr. Alina Munteanu, Dr. Shelly John, Dr. Hong Wang, Dr. Zhiwen Tang, Dr. Yufen Huang, Dr. Carmen Maria Estevez Dr. Haipeng Liu, Dr. Wenjun Zhao, Dr. Zeyu Xiao, Dr. Karen Martinez, Dr. Hui Chen, Dr. Youngmi Sohn, Dr. Kelong W ang, Dr. Liu Yang, Dr. Shukoor Ibrahim, Dr. Quan Yuan, Parag Parekh, Kwame Sefah, Dosung Sohn, Huaizhi Kang, Meng Ling, Yan Chen, Pinpin Sheng, Jennifer Martin, Zhi Zhu, Hui Wang, Suwussa Bamrungsap, Dimitri Simaeys Van Elizabeth Jimenez, Xiangling Xiong Guizhi Zhu, Mingxu You, Jin Huang, Tahir Bayrac, Pu Ying, Eunjung Lee, Sewon Bae, Michael Donovan, Michael Mavros and Yunfei Zhang. I am deeply indebted to my parents for their unconditional love, and my elder sister for taking care of my parents for me during the past years I am extremely grateful to my husband, Jianguo Mei, for always being there for me as my wonderful friend, helpful colleague and supportive spouse. Without his love, patience, encouragement and assistance, I could not reach this far. The marriage with him is my biggest achievement during my past years in the USA.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS .................................................................................................................... 4 LIST OF TABLES ................................................................................................................................ 9 LIST OF FIGURES ............................................................................................................................ 10 LIST OF ABBREVIATIONS ............................................................................................................ 13 ABSTRACT ........................................................................................................................................ 14 CHAPTER 1 INTRODUCTION ....................................................................................................................... 16 Nucleic Acids for Cancer Research ........................................................................................... 16 Properties of Nucleic Ac ids ................................................................................................ 17 Multifunctional nucleic acids ...................................................................................... 20 Nucleic Acids for Cancer Detection ................................................................................... 21 Nucleic Acids for Cancer Therapy ..................................................................................... 25 Nucleic Acids for Cancer Intracellular mRNA Study ....................................................... 32 Other Dissertation -Relate d Subjects .......................................................................................... 37 Nucleic Acid ........................................................................................................................ 37 Chemical synthesis of nucleic acids ............................................................................ 37 Locked nucleic acids .................................................................................................... 41 Nucleic Acid Aptamers ....................................................................................................... 44 Systematic evolution of ligands by exponential enrichment (SELEX) .................... 44 Aptamers and antibodies .............................................................................................. 47 Micelles ................................................................................................................................ 48 Flow -Cytometric Analysis of Ap tamer Binding with Cells .............................................. 51 Fluorescence Methods for Signal Transduction ................................................................ 53 Scope of This Research ............................................................................................................... 57 2 DYNAMIC APTAMER -MICELLE WITH ENHANCED SELECTIVITY AS AN EFFICIENT DETECTION/DELIVERY VEHICHLE TOWARD CANCER CELLS .......... 58 Introduction ................................................................................................................................. 58 Experimental Section .................................................................................................................. 59 Materials ............................................................................................................................... 59 Synthesis of Lipid Tail Phosphoramidite. .......................................................................... 60 Synthesis of Aptamer Lipid Sequence ............................................................................... 61 Preparation of TDO5 -Micelles with Different Aptamer Densities ................................... 62 Micelle Characterization ..................................................................................................... 62

PAGE 7

7 Flow Cytometric Analysis ................................................................................................... 62 Preparation of Au NP TDO5/library Conjugates .............................................................. 63 Preparation of SWNT/TDO5 Lipid or SWNT/Library -Lipid Complexes ....................... 6 3 Preparation of Biotin TDO5 Micelles Doped with D yes ................................................. 64 Preparation of NBD -Labeled Liposome ............................................................................. 64 Determination of CMC of Aptamer -Micelle ..................................................................... 64 Cytotoxicity Assays ............................................................................................................. 64 Confocal Imaging ................................................................................................................ 65 Flow Channel Device Preparation and Incubation under Continu ous Flow .................... 65 Results and Discussion ............................................................................................................... 66 Aptamer Micelle Construction ........................................................................................... 66 Enhanced Binding at Physiological Temperature .............................................................. 68 Extremely Low koff .............................................................................................................. 70 TDO5 Micelle Helps Cell Internalization .......................................................................... 74 Rapid Identification with High Sensitivity ........................................................................ 76 Trace Cell Detection in Whole Blood Sample ................................................................... 77 Aptamer Micelle Targeting in a Flow Channel under a Continuous Flow ...................... 80 CMC Determination of TDO5 Micelle by Pinacyanol Chloride ...................................... 84 Effect of Aptamer Density on the Selective Binding of Aptamer -Micelles .................... 86 Hypothesized Mechanism about the Interaction Between Aptamer -Micelle and Cells .................................................................................................................................. 87 Conclusions ................................................................................................................................. 91 3 NUCLEIC ACID BEACONS FOR LONG TERM REAL TIME INTRACELLULAR MONITORING ........................................................................................................................... 93 Introduction ................................................................................................................................. 93 Experimental Section .................................................................................................................. 94 Chemicals and Reagents ...................................................................................................... 94 Equipments ........................................................................................................................... 94 Molecular Beacon Synthesis ............................................................................................... 95 Hybridization Kinetics Study .............................................................................................. 95 DNase I Sensitivity .............................................................................................................. 96 RNase H Sensitivity ............................................................................................................. 96 Protein Binding Study ......................................................................................................... 96 Cell Lysate Preparation ....................................................................................................... 96 Biostability Study with Cell Lysate .................................................................................... 97 Imaging and Data Collection .............................................................................................. 97 Results and Discussion ............................................................................................................... 98 MB Design and in vitro Characterization .......................................................................... 98 MB in vitro Testing with Cellular Samples ..................................................................... 100 Long Term Monitoring Inside Living Cells .................................................................... 101 Long Term Stability of MBs ............................................................................................. 104 Conclusions ............................................................................................................................... 105

PAGE 8

8 4 CARBON NANOTUBES PROTECT DNA STRANDS DURING CELLULAR DELIVERY ............................................................................................................................... 107 Introduction ............................................................................................................................... 107 Experimental Section ................................................................................................................ 108 Materials and Instruments ................................................................................................. 108 Synthesis of Molecular Probes .......................................................................................... 108 Synthesis of GT/SWNT ..................................................................................................... 109 Synthesis of MnSOD Probe/SWNTs ................................................................................ 109 Cellular Experimental Procedures .................................................................................... 110 Results and Discussion ............................................................................................................. 110 Pro tection in GT/SWNT .................................................................................................... 110 Design and Characterization of MnSOD/SWNTs ........................................................... 112 Protection Test in Buffer ................................................................................................... 113 Protection Test in a Cellular Environment ....................................................................... 115 Possible Mechanisms for the Protection .......................................................................... 118 Oth er Benefits this SWNT Modification Brings to DNA Molecular Probes ................ 119 Conclusions ............................................................................................................................... 119 5 SUMMARY AND FUTURE WORK ..................................................................................... 121 Engineering Nucleic Acid Probes/Nanomaterials for Cancer Studies ................................... 121 Future Directions ....................................................................................................................... 123 Aptamer Micelle for Targeted Gene Therapy ................................................................. 123 Aptamer Based Drug Delivery Systems for Selective Deliverer of Drugs to Multidrug Resistant Cancer Cells ................................................................................. 126 Aptamer Micelle as a Sensitive Biomarker MRI Sensor ................................................ 127 SWNT/Aptamer Complex for Targeted Therapy ............................................................ 127 LIST OF REFERENCES ................................................................................................................. 129 BIOGRAPHICAL SKETCH ........................................................................................................... 146

PAGE 9

9 LIST OF TABLES Table page 1 1 Aptamers in the clinical pipeline ........................................................................................... 28 1 2 Comparison between DNA and RNA aptamers ................................................................... 29 1 3 Comparison of apt amer and antib odys properties ............................................................. 48 1 4 The relationship between the molecular packing shape, packing parameter and lipid aggregation structures ............................................................................................................ 50 2 1 List of all oligonucleotides used in this work ....................................................................... 92 3 1 Optimized LNA -MBs for Intracellular Experiments ........................................................... 94 4 1 Probes and Oligonucleotides Used in This Work .............................................................. 109

PAGE 10

10 LIST OF FIGURES Figure page 1 1 General structure of nucleic acids. ........................................................................................ 18 1 2 DNA double helix structure and nitrogeneous bases. .......................................................... 19 1 3 Working principle of MBs. .................................................................................................... 33 1 4 Typic al structures of a protected phosphoramidite and four protected nitrogeneous bases. ....................................................................................................................................... 38 1 5 Automated oligonucleotide synthesis process by phosphoramidite chemistry. ................. 39 1 6 Chemical structure of LNA family. ...................................................................................... 42 1 8 Molecular structure of phosphatidyl choline. ....................................................................... 49 1 9 A typical flow cytometer setup. ............................................................................................ 52 1 10 Jablonski diagram for fluorescence mechanism and characteristic times of various processes. ................................................................................................................................ 55 2 1 Schematic illustration of aptamer -lipid formation and flow cytometric assay to monitor the binding selectivity. ............................................................................................. 67 2 2 TEM image (A) and Dynamic light scattering histogram (B) of TDO5 -micelles. ............ 68 2 3 Effect of the length of oligonucleotide on the nonspecific interactions between DNA lipids and different cell lines. ................................................................................................ 68 2 4 Flow cytometry to determine the binding affinity ............................................................... 69 2 5 Flow cytometric assay to monitor the binding of KK lipid and KB lipid .......................... 70 2 6 Competetion studies of TDO5 and TDO5 lipid with nonlabelled TDO5 ......................... 71 2 7 Competetion studies of KB lipid, KK lipid, TDO5 -Au NP and TDO5/SWNTs with correspending nonlabelled aptamers .................................................................................... 72 2 8 The binding selectivity test of TDO5 lipid in human whole blood sample ....................... 74 2 9 Images of internalizat ion study of TDO5-lipid .................................................................... 75 2 10 The effects of incubation time and concentrations of TDO5-lipid on its binding selectivity in blood samples. ................................................................................................. 76 2 11 Trace cell detection in human blood samples ....................................................................... 78

PAGE 11

11 2 12 Control experiments about binding selectivity in human whole blood samples. .............. 78 2 13 The effect of incubation times on the binding selectivity in a buffer solution ................... 79 2 14 Simplified flow channel response to cell staining assay in blood samples.. ...................... 81 2 15. Simplified flow channel response to cell staining assay in buffer solution........................ 82 2 16 CMC determination ................................................................................................................ 85 2 17 Cell viability test .................................................................................................................... 85 2 18 Binding selectivity test by heterogeneous aptamer -micelles ............................................... 86 2 19 Binding selectivity test of two other types of nanomaterial aptamer conjugates/complexes ........................................................................................................... 87 2 20 Scheme depicting the hypothesized interaction between dye -doped aptamer -micelle and cells. ................................................................................................................................. 88 2 21 Fusion study by NBD PC: POPC liposome. ........................................................................ 90 3 1 Representative in vitro biostability experiments of the optimized LNA MBs. ................. 99 3 2 In vitro hybridization kinetics of the optimized LNA MBs. ............................................. 100 3 3 Normalized representative fluoresce nce intensity changes of DNA MB and LNA MB with cytosolic and nuclear fractions from MDA -MB 231 cell lysate. ...................... 101 3 4 Representative microinjection experiments for the real -time monitoring of M nSOD mRNA expression level change .. ...................................................................................... 103 3 5 In vivo hybridization kinetics of the optimized control LNA MB and actin MB ........ 104 3 6 Time -lapse fluorescence images after microinjection of excess cDNA into the same cell which has been injected by the optimized control MB after 24 h. ............................. 105 4 1 Polyacrylamide gel electrophor esis of free GT sequence and GT/SWNT complexes .... 111 4 2 (A) Possible interaction between MnSOD probes, the SWNTs, and target mRNA; (B) TEM image; (C) absorption spectrum of the probe in H2O. ...................................... 112 4 3 Emission fluorescence spectrum of MnSOD probe/SWNTs in the presence and absence of 10 -fold excess target cDNA. ............................................................................. 113 4 4 Fl uorescence signal enhancements of both free MnSOD probes and MnSOD probe/SWNTs upon the addition of 1U DNase I and SSB respectively ........................... 1 14

PAGE 12

12 4 5 Bright field and fluorescent images of MnSOD probes/ SWNT complexes inside MDA -MB 231 cells without and with LPS stimulation respectively ............................... 115 4 6 Bright field and fluorescent images of free MnSOD probes inside MDA -MB 231 cells without and with LPS stimulation respectively ......................................................... 116 4 7 The avoidance of nucleus accumulation of probes by MB/SWNTs. ................................ 116 5 1 Scheme of SPIO NP -doped cross -linked aptamer -micelle for anti -gene drug delivery (including miRNA antogamir and siRNA or antisense). ................................................... 124 5 2 Working principle of the SPIO NP -doped cross -linked aptamer -micelle for ma gnatic narvigated therapy. ............................................................................................................... 124

PAGE 13

13 LIST OF ABBREVIATIONS VEGF Vascular Endothelial Growth Factor AMD Age related Macular Degeneration CABG Coronary Artery Bypass Grafting NF Nuclear Factor kappa B AML Acute Myeloid Leukemia FIX Factor IX PCI Percutaneous Coronary Intervention TMA Thrombotic Microangiopathies TTP Thrombotic Thrombocytopenic Purpura CEA Carotid Endarterectomy PDGF -B Platelet Derived Growth Factor B MCP 1 Monocy te Chemotactic Protein 1 SDF 1 Strom al Cell -Derived Factor 1

PAGE 14

14 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Ph ilosophy ENGINEERING MULTIFUNCTIONAL NUCLEIC ACID PROBES/NANOMATERIALS FOR CANCER STUDIES By Yanrong Wu December 2009 Chair: Weihong Tan Major: Chemistry Essential cancer research studies include diagnosis of early-stage cancer and elucidation of the d isease processes, with the hope of finding efficient anti -cancer therapy systems. Among the various types of molecular tools, multifunctional nucleic acid probes serve versatile roles via rational selection and construction processes (e.g., use as sensors, catalytic enzymes, drugs and aptamers). My doctoral research has focused exclusively on the sensor and aptamer functions, in particular the engineering of multifunctional nucleic acid probes or nanomaterials for detection and analysis of cancer cells. My most recent work has involved the construction of an aptamer -micelle as an efficient detection and delivery vehicle toward cancer cells. An a ptamer, which can specifically bind to a broad spectrum of targets including small molecules, proteins, and even disease cells, is a single -stranded DNA or RNA molecule isolated from combinational libraries by a process termed SELEX (Systematic Evolution of Ligands by Exponential enrichment). The Tan research group has developed a whole -cell -SELEX strategy to generat e a panel of aptamers for specific disease d cells without any prior knowledge about the target molecules. Although aptamers have shown great promise in molecular recognition toward specific cancer cells, the relative ly weak binding affinities of some aptam ers at physiological temperatures has hampered cell targeting

PAGE 15

15 and applications to targeted therapy. To solve this problem, an aptamer -micelle strategy was implemented by attaching lipid tails onto the ends of low affinity aptamers. This resulted in several beneficial and innovative properties, such as greatly enhanced binding ability, extrem ely low dissociation rates, additional internalization pathways, as well as sensitive and rapid cancer detection. Cancer originates from mutations in human genes and genetic alterations which cause molecular changes to cell structure that ultimately result in morphological and physiological abnormalities. Consequentially, my research has also focused on designing molecular sensors to detect such changes via intracellular mRNA monitoring. The monitoring of oncogene expression or spatial localization allows cellular events and disease pathogenesis to be more accurately understood. Besides serving as genetic information housekeepers, nucleic acids can also be built into various sensors based on Watson Crick base -pairing and diverse signal transduction mechanisms. However, the complex nature of living cells poses challenges to the design of such sensors by the susceptibility of nucleic acids to enzyme digestion and inefficient self -delivery into the cells. Two methods were tested to address these limitations: introduction of locked nucleic acid bases into the sensor design and modification of sensors with single -walled carbon nanotubes. These two methodologies have yielded robus t probes, thus permitting more reliable intracellular gene studies at the single cell level. Results of my doctoral research demonstrate that multifunctional nucleic acids can be utilized as key building blocks to fulfill the various goals in cancer resear ch.

PAGE 16

16 CHAPTER 1 INTRODUCTION Cancer remains the second leading cause of death in the United States [1], al lthough the survival rate for many types of canc er has improved in recent years. The 2003 World Cancer Reports prediction that cancer rates may increase by 50% to 15 million new cases in the year 2020 has compelled scientists in many areas to become involved in cancer research. Essential cancer research include s diagnosis of early -stage cancer and elucidation of the disease processes, with the hope of finding efficient anti -cancer therapy systems. In an attempt to creat e molecular tools for the above -mentioned major cancer research areas, this doctoral research was undertaken to utilize nucleic acid as the key component to construct various probes This dissertation has focused on the construction of nanomaterials based on nucleic acid aptamers evolved from the whole -cell SELEX methodology for cancer detection with potential p romise in targeted therapy, as well as two types of molecular probe designs for intracellular gene monitoring. In order to set the foundation of these objectives, t he following sections will review some critical properties of nucleic acids and their appli cations in cancer diagnosis, cancer t herapy and cancer intracellular biomolecular study Additional key subjects involved in this dissertation will be introduced separately: structure and chemical synthesis of nucleic acid s locked nucleic acid s nucleic a cid aptamer s micelle s flow cytometric analysis of aptamer binding ability with cells, and fluorescence measurement for signal transduction F inally, a summary of the overall scope of this dissertation will be outlined. Nucleic Acids for Cancer Research Completion of the human genome project has revolutionized fundamental understanding of biological processes. Increasing emphasis on molecular level understanding of bio logical

PAGE 17

17 organisms has allowed certain di seases to be redefined in terms of their underlyi ng molecular characteristics It is well accepted that c ancer originates from mutations of genes, either inherited from parent (s) or genetically influenced with resulting changes in cell morphology and physiology [2]. To decipher the underlying cancer process es and facilitate cancer diagnosis with the promise of efficient cancer treatment, nucleic acid ha s become an ideal building block for its widespread utilization in bioanalytical and biomedical research fields. The popularity of nucleic acid mainly results from its specific recognition ability towa rd a wide spectrum of targets, including another piece of nucleic acids small molecul e s protein s or even diseased cell s Additionally, the automated oligonucleotide synthesis and easy modification make nucleic acids attractive molecular tools with which to work. Properties of Nucleic A cids To appreciate their applications in cancer research, the biological functions of nucleic acid s and their structural properties must be understood As described in the c entral d ogma of m olecular b iology, every life form develops from hundreds of thousands of types of cells. Inside one single cell, an equal amount of proteins carry out all our daily functions. To synthesize those proteins, an enormous amount of information is requ ired to assemble peptides piece-by -piece ba sed on exact instructions. This information, detailing every single proteins specific structure, is stored in an array of biomolecules called nucleic acids. Nucleic acids carry genetic information from parent cell to daughter cell; therefore, genetic trai ts can be passed along to offspring. These unique genetic traits provide an intrinsic avenue to understand life ; and therefore represent attractive targets for cancer research. Since it contains the essence of genetic material, the significance of nucleic acid is greatly enhanced by an understanding of its intrinsic structures. Nucleic acids are largely divided into two groups deoxyribonucleic acid ( DNA) and ribonucleic acid (RNA), of which s hare the same

PAGE 18

18 general structure s Nucleic acids can be regarded a s the polymerization product of nucleotides. As presented in Figure 1 1, the monomer unit, or nucleotide, consists of three components: the sugar ring, phosphate group and a nucleotide base In the famous DNA double helix structure (shown in Figure 1 2 ) pr oposed by James D. Watson and Francis Crick in 1953 [3], the outer layer of the helix is the helix bac kbone made by the sugar and phosph ate group s Because of the presence of phosphate groups, nucleic acid is highly negatively charged In contrast, nitrogenous bases are paired and preserved inside the helix. Although only four types of different nucleotide bases can occur in a nucleic acid, each nucleic acid contains millions of bases bonded to it. The order in which these nucle otides appear is the genetic code for a certain proteins In other word s nucleotide bases serve as a genetic alphabet by which the structure of each protein is encoded. Figure 1 1. General structure of nucleic acids. The structures of the nucleotide b ases shown in Figure 1 2, enable their roles as the informational molecules. The hydrogen atoms of amino groups provide hydrogen bond donors, whereas the carboxyl oxygens and ring nitrogens provide hydrogen bond acceptors. The different positions of hydro gen bonds give the bases their unique structural identities ; that is adenine can specifically hydrogen bond to thymine (in DNA or uracil in RNA) and cyto s ine can specifically

PAGE 19

19 hydrogen bond to guanine a process which allow them to serve as the genetic info rmation. Since the aromatic rings are rigid planar molecules, the bases can stack within the helix. This stacking help s protect the chemical identity of the bases as well as improve thermal stability of the helix Figure 1 2. DNA double helix structure and nitrogeneous bases However, it is the very structure of nucleic acid that, paradoxically, defines the challenge it confronts in cancer research. For example, RNase H cleaves RNA only at sites where the 2 position of the sugar ring is not modified (2 OH) [4]; therefore, blocking the 2 cleavage site becomes a popular way to achieve good biostable bases. Locked nucleic acid which will be introduced later, is one such example. Additionally, nucleic acid s are polar. However, the cell membrane is composed of a lipid bilayer structure with a hydrophilic head outside and a hydrophobic tail inside, which prevents polar solutes, such as nucleic acid from diffusing across the membrane. Moreover, phospholipid, which have a negative charge, form the major component of cell membrane s Therefore, this negative ly charged cell membrane creates an extra barrier to the same negatively charged nucleic acid molecules to mov e through it Thus, an

PAGE 20

20 additional challenge is how to design the efficient delivery of nucleic acids to and through the cell membrane. Multifunctional n ucleic a cids There are three main reasons why nucleic acids are believed to play multifunctional roles First, automated synthesis allows easy incorporation of molecules with various functional groups into a nucleic acid sequence For example, if a fluorescence dye molecule is bonded, the nucleic acid can function as a detection probe to determine its analyte Also, by introducing cytotoxic drug molecules, the corresponding nucleic acid can act as a delivery vehicle towards its specific target. Moreover, with conjugated functional groups, nucleic acids can self -assemble into a certain nanostructure or be conjugated onto some nanomaterials to achieve unique prop erties. Second, nucleic acids have great capability for selective recognition against a wide range of targets, including other nucleic acid molecules by specific base pairings, small molecules, proteins, or even whole disease d cell s N ucleic acids which ca n recognize non -nucleic acid targets are terme d aptamer s which will be detailed in the following section. Third, as found recently, nucleic acids not only play a main role in storing genetic information but also perform several other functions. For insta nce, small RNAs and mi cro RNAs regulate gene activitity [5,6] ; DNA with nonmethylated CpG sequences exert an immunostimulating effect [7,8] ; and ribozymes and d eoxyriboz ymes can have interesting enzymatic catalytic functions [9,10] Thus, molecular engineering of multifunctional nucleic acids sparks numerous applicati ons in biological studies especially cancer research In the following section, three major applications of nucleic acids in cancer rese arch ( cancer detection cancer therapy and intracellular biomolecular study ) will be briefly reviewed.

PAGE 21

21 Nucleic Acids fo r Cancer Detection The survival rate of any form of cancer depends on how early and what stage it is detected. Thus, the highest survival rates correlate to the earliest stages of detection. For example, colon cancer is one of the most curable cancers when detected in the early stages. Based on the data from the National Cancer Institute, the overall survival rate for colon cancer in the United States is as high as 93% at stage 1 and 85% at stage 2A, but it will dramatically drop to 8% at stage 4 [11] Several methods are currently utilized for cancer detection, including biopsy, magnetic resonance imaging (MRI) polymerase chain reaction ( PCR ) microarray and immuno logical assays Biopsy is typically used as a diagnostic method to histologically identify whether a previously detected tumor, lesion, or other abnormal tissue is cancerous H owever, it is an invasive method with potential damage, especially when it is targeting brain tissue MRI as a noninvasive met hod, has been shown to be useful for staging cancers and deciding on treatment avenues, but it is considered too costly for routine detection. T he increasing emphasis on molecular level understanding of bio-organisms especially with the completion of the human genome, has allowed diseases to be re -defined in terms of underlying molecular level abnormalities rather than pathological differences. Cancers are known to originate from mutations of human genes; therefore, biomarker gene detection and profiling has become one of the most popular ways to correlate the unique molecular signature of tumors for identifying subsets of patients and tailoring treatment regimes to achieve more personalized medical therapies. G ene expression microarray and PCR are two com monly used technique s to analyze biological differences between tumors that account for variations in morphology and clinical behaviors. Microarray provides a powerful tool for massive parallel analysis of the RNA /DNA expression level of thousands of genes The genomic gains or losses

PAGE 22

22 can be analyzed for complete genomes in a single experiment, thus creating new opportunities for deciphering distinct chromosomal changes in the development of cancer [12,13] Using microarrays, investigators have developed gene expression -based classifications for many malignancies, such as lymphoma [14] leukemia [15] breast [16] and lung carcinoma [17] These molecular classifications are clinically significant because they correlate tumor characteristics with patient outcome and explain the variability seen in the natural course of cert ain tumors with the same anatomic diagnosis [14 17] Besid es microarra y, PCR -based methods have proven to be highly sensitive diagnostic techniques for cellular recognition However, amplification of gene products has been reported to have variable sensitivities, which can lead to false positive or false negative results [18] Besides DNA/RNA, the protein itself can be a cancer biomarker Traditional methods are immunological assays such as enzyme linked immunoabsorbant assays (ELISA) and immu nophenotyping by flow cytometry. These techniques largely rely on the selectivity of antibodies and can be limited by tedious production, instability and difficult modification of the antibodies. Fortunately, the discovery of aptamer selection in 1990 [19,20] especially the proposed whole -cell -SELEX strategy [21] has brought an antibody mimic in the form of a nucleic acid aptamer into the research field of protein expression -based cancer diagnosis Aptamers have rivaled antibo dies in various cancer research, including cancer diagnosis, as a result of various merits, such as stability, the speed of probe discovery, and the ease and reproducibility of their synthesis and modification [22 24] Many examples have demonstrated how aptamer s can be effective substitute s for antibodies. One such example is an aptamer -based new diagnosis technique, so -called enzyme linked oligonucleotide assay (ELONA) developed in 1996, which compet e with traditional

PAGE 23

23 antibody based ELISA [25] In this ELONA meth od, the capture reagent remains a monoclonal antibody, while the detect ion antibody is replaced with a fluorescein tag ged hVEGF binding aptamer. Measure s of precision, accuracy, interference, and specificity showed that this aptamer based assay was equivalent to a typical sandwich ELISA assay. Later on, the aptamer was also shown to be a surrogate for the capture antibody [26] In addition, aptamers, as recognition elements substituting for antibodies, are widely applied in flow cytometry [27], microscope studies [28] microarray s [29] and biosensors [30] Aptamer s can also be superior to antibodies in some cases. As mentioned above, even within the same categories, multiple subsets of cancer with different clinical outcomes exist. Apart from gene profiling as a means of explo ring differences at the molecular level, protein profiling can also help delineate unique fingerprints of tumor cells, especially considering the fact that it is the protein not the gene, wh ich eventually execute s the cellular activities. The systematic p roduction of a panel of antibodies for molecular profiling of cancer cells with unknown biomarkers has proved to be very difficult. Cell -based selection of aptamers, however, is able to generate multiple molecular probes for cancer cell identification and subcategorizatio n [31 34] Six aptamers, which were originally selected against two types of le ukemia cells respectively, produced distinct binding patterns for different tumor cells. The differential binding of these aptamers among the T -ALL patient samples showed the ability of aptamers to distinguish molecular differences among patients with the same diagnosis by current technology [35] Ready synthesis and easy site -specific chemical modificat ion of nucleic acid aptamer s facilitate the integration of aptamer chemistry an d nanotechnology into cancer research including cancer detection. Some cancer cells, especially those in the early stages of disease,

PAGE 24

24 may have a low density of biomarker target on the cell surface available for recognition. Therefore, to enhance the binding affinity and amplify the signal, multivalent binding, instead of single aptamer binding, is usually considered to be an effective approach. Owing to the large surface area an d variable sizes, nanomaterials are particularly advantageous as multivalent ligand scaffolds. For example, one single Au -Ag nanorod (NR) 12 nm 56 nm in size can incorporate up to 80 fluorophore labeled sgc8 aptamers on the surface, leading to a 26-fold higher affinity and over 300-fold higher fluorescence signal [36] Additionally, by virtue of the significant color change of gold nanoparticles resulting from overlapped surface plasmon resonances when they are in close promixity, a colorimetric assay for sensitive cancer cell detection was developed using aptamers conjugated with 50 nm gold nanoparticles [37] This assay allows 1000 target cells to be readily de tected by the naked eye. Detection of cancer in the body fluids usually requires an enrichment step since the malignant cells are present at very low abundance in the body fluids To meet this need a novel aptamer -based two nanoparticle assay was develop ed for the rapid collection and detection of leukemia cells from complex mixtures including whole blood samples [38] In this assay, aptamer -modified iron oxide -doped silica nanoparticles provide enhanced extraction capability while fluorescent dye -doped silica nanoparticles offer amplified signal intensity. Compared to immunophenotype and PCR methods, which usually take hours to complete, this assay was relatively fast (less than 1 hour). Furthermore, to realize the enrichment in the flow system and meet the potential goal for online targeted biological analysis, an aptamer -modified microfluidi c device was developed to capture rare cells from a large amount of background cells without any need for sample pretreatment [39] E ven though antibody -coated microfluidic devices have been demonstrated for cancer cell enrichment [40] this aptamer -based microfluidic device is

PAGE 25

25 envisioned to be a more manageable system because DNA -based devices can be stored for a long period of time and can be easily handled in clinical settings Nucleic Acids for Cancer Therapy The application of nucleic acids in cancer therapy largely involves cancer gene therapy and anti -cancer treatment modalities. Most cancers are characterized by abnormal gene expression Modulation of the se abnormal genes, either by initiating or silencing gene expression, appears to be a rational approach to cancer therapy Since the first human in vivo gene transfer study in 1989 [41] over 900 clinical trials involving gene transfer have been approved by regulatory bodies worldwide [42,43] Given the complex nature of cancer, many therapeutic strategies have been developed for cancer treatment These strategies can be categorized into tw o main avenues: immunologic al and molecular [44] Cancer is immunogenic in nature; therefore, it can be t argeted on the immunological level. Boosting the immun e response against cancerous cells is usually achieved via genes encoding for immune stimulating molecules such as cytokines [45] Intensive res earch has focused on transfection with the interleukin 12 (IL 12) gene, which was demonstrated to play an important role in the induction of cellular immune responses. Complete tumor regression in rat animal models was observed in hepatocellular carcinoma and a denocarcinoma after successful IL 12 gene transfection in the cancer cells [46,47] As an alternative approach molecular targeted gene therapy aims to efficiently upregulate or downregulate the genes involved in th e development of cancerous cell [44]. Two main gene groups a re oncogene s and tumor suppressor gene s T umor repressor gene s are growth inhibiting; however, the growth-suppressive function is general ly lost with mutation. Thus, introducing wild -type tumor suppressor gene s to the cancer cells is one of the most widely used methods in

PAGE 26

26 cancer treatment [48] Besides suppressing cancer development and progression, wild-type p53 further confers chemo-sensitivity and radio -sensitivity upon tumor cells [49] The combination of an adenovirus -carrying wild type p53 gene (Ad-p53) and chemotherapy (Cisplatin) [50] or radiation [51] was report ed to have promising clinical outcomes. Ad p53 has been commercialized by Introgen Therapeutics, Inc. and has been approved as an orphan drug by the U.S. Food and Drug Administration. It is the first successfully approved tumor suppressor gene therapy [52] On the other hand, oligonucleotides, which bind and subsequently inhibit oncogenes (i.e. anti -onc ogenes), can also be utilized in cancer therapy. Of the strategies available, the anti mRNA gene silencing approach has attracted much attention [53] This strategy includes three types of agents: (1) single -stranded antisense oligonucleotides through Watson -Crick base pairing to inhibit the translation step of the protein synthesis [54] ; (2) catalytically active oligonucleotides, such as ribozymes, and DNAzymes that posses s inherent RNA cleaving activity [55] and (3) small interfering RNA (siRNA) molecules that induce RNA interference (RNAi) [5]. As mentioned above, the structure of nucleic acid is antithetic to the properties of the cell membra ne, thereby reducing the efficiency of nucleic acids self -delivery into the cell. To remedy this shortcoming, the use of viral or nonviral vectors or micro -/nano -particles is required [56] In this concept, the therapeutic gene is either encapsulat ed inside the vehicle or complexed onto cationic particles which pass through the cell membrane barrier Besides modulating gene activity, nucleic acid can also modulate the activity of proteins. This type of nucleic acid is again the province of aptamers The concept that nucleic acid ligands could modulate the activity of proteins emerged from basic science studies of viruses and early

PAGE 27

27 work in the field of gene therapy [57] The observation that viruses use RNA ligands for their ends suggested that RNA ligands might also be useful for therapeutic purposes After two groundbreaking studies [19,20] several RNA aptamers and, subsequently, some DNA aptamers were identified as therapeutic agents. Currently, several aptamers are no w being evaluated in clinical trials, which are detailed in Table 1 1 Table 1 2 is provided to to help understand the differences between DNA and RNA aptamers. Despite being discovered less than two decades ago, an aptamer -based drug known as Macugen (o r pegapta n ib ) has already received U.S. FDA approval for the treatment of age related macular degeneration [58,59] Among various therapeutic DNA aptamer agents, G rich quadruplex -forming oligonucleotides particularly stand out. Nuclease susceptibility and inefficient cellular uptake have proved to be universal hurdles in the development of therapeutic oligonucleotides. However, G rich quadruplex -forming oligonucleotides have demonstrated outstanding biostability and cellular uptake. Some aptamers were never developed from SELEX, but have earned that name because of their activ ities arising from binding to protein targets via shape -specific recognition. This type of aptamer is also coined as decoy. One of successful DNA aptamer is AS1411, formally AGRO 100, the first nucleic acid -based aptamer tested for cancer treatment in hum an s was subject ed to phase II studies for the treatment of AML i n 2007 and renal cell carcinoma in 2008 [60] To explain the tumor -selectivity of AS1411, the proposed binding target, nucleolin, was reported to be selectively expressed in cancer cells compared to norm al cells ; therefore AS1411 can specifically target cancer cells [61] More recently, AS1411 has served as a template for the synthesis of sta ble PbS and FeO nanocrystals, while retaining selective recognition and

PAGE 28

28 therapeutic targeting to cancer cells with 3 4 times enhanced efficacy in proliferation reduction of MCF 7 breast cancer cells compared with DNA aptamers without nanocrystals [62] Table 1 1. Aptamers in the clinical pipeline (sum marized from corresponding developer company websites) Aptamer candidate Target/indication Developer Clinical phase Type Macugen (pegaptanib) VEGF/AMD Eyetech(Cedar Knolls, JN, USA) FDA approved RNA Edifoligide(E2F decoy) E2F/CABG surgery Anesi va (formerly Corgentech, San Francisco, CA, USA) No better than placebo in Phase III RNA Avrina( NF decoy) NF Anesiva (formerly Corgentech, San Francisco, CA, USA) Phase III ds DNA AS1411 Nucleolin/anticancer (AML, renal cell carcinoma) Antisoma (Lodon, UK) Phase II DNA REG1 FIX/arterial thrombosis Regado Bioscienc es (Durham, NC, USA) Phase II RNA REG2 FIX/venous thrombosis Regado Biosciences (Durham, NC, USA) Phase I RNA ARC 1779 (TMA/TTP) Vwf/TMA, TTP, CEA Archemix (Cambridge, MA, USA) Phase II DNA/RNA ARC183 Thrombin/ anticoagulati on Archemix (Cambridge, MA, USA) Phase I completed, not in development DNA NU172 (ARC2172) Thrombin/anticoagulation (PCI, CABG) Nuvelo/Archemix (San Carlos, CA/Cambridge, MA, USA) Commence a Phase II study DNA E10030 PDGF B/wet AMD Op hthotech (Princeton, NJ, USA) Phase I DNA ARC1905 C5/ wet and dry AMD Ophthotech (Princeton, NJ, USA) Phase I RNA NOX E36 MCP 1/ chronic inflammation NOXXON (Berlin, Germany) Phase I L RNA NOX E12 SDF 1/autologous stem cell transplan tation NOXXON (Berlin, Germany) Commence a phase I study L RNA

PAGE 29

29 Table 1 2 Comparison between DNA and RNA aptamers Properties DNA aptamer RNA aptamer Degradation susceptibility Moderate High Easy synthesis and modification Yes No Directl y used in in vivo Possible No Storage Easy Hard Steps in one SELEX cycle Moderate Long Cost of SELEX procedure Moderate High Cost of bulk production Moderate High Applied to whole cell SELEX Yes No Diversity of 3D structure and fun ctionality Moderate High Possibility to be expressed by cell No Yes Binding affinity Comparable Comparable Immunogenicity and toxicity Not observed Not observed Another type of emerging application of nucleic acids in anti -cancer therapy re sults from the utility of nucleic acid aptamers as targeting ligands for disease d cells. This means that aptamers function only as recognition ligands to cancer cells This is especially significant in relation to the whole -cell -SELEX strategy proposed by the Tan group in 2006 [31] Since that time, the group has generated a pool of DNA aptamers for various types of cancer cells, including lymphocytic leukemia, myeloid leukemia, liver cancer, small cell lung cancer and nonsmall cell lu ng cancer [32 35,63,64] Additionally, using a simi lar strategy, DNA aptamers for stem cells [65] and live bacteria cells [66] have been developed in other lab oratorie s ove r the past year. DNA aptamers can be easily conjugated with therapeutic molecules and applied to targeted drug delivery by virtue of the aptamers excellent targeting ability. For instance, covalent linkage of the anti tumor drug doxorubicin (Dox) to aptam er sgc8c can kill the target CCRF CEM (T cell acute lymphoblastic leukemia (T -ALL)) cells, yet with minimal toxicity towards nontarget cells [67] The results demonstrated that the sgc8c Dox conjugate possesses many of the properties of the sgc8c aptamer, including high binding affinity and the capability to be

PAGE 30

30 efficiently internalized to endosome s by target cells. Moreover, the adopted conjugation method allows an acid labile linkage connecting the sgc8c Dox conjugate, to be cleaved inside the acidic end osome. Th is further facilitates released Dox for rapid t ransport to the nucleus to interrupt the growth of target cells. It is noteworthy that nonspecific uptake of membrane -permeable Dox to non target cell lines could also be inhibited by linking the drug with the aptamer. With a growing numbers of selected ap tamers, we foresee that this drug aptamer conjugation strategy will have broad implications for targeted drug delivery. Additionally, aptamers have been reported to delivery phototherapeutic drugs [68,69] and lysosomal enzymes [70] to the target cells in a selective manner. More recently, aptamers have begun to find applications at the interface of nanotechnology and medicine in the form of aptamer -nanoparticle conjugates. On one hand, the high surface areas of nanoparticles offer excellent platforms for multiple aptamer conjugation. On the other hand, empty interiors render excellent places to house high amounts of drug molecules for enha nced loading efficiency. R esearch progress in the integration of RNA aptamers with nanotechnology (e.g. PSMA aptamer integrated with PLGA nanoparticle s) has been summarized in a recent review [71] Thus, only DNA aptamer -nanoparticle conjugates for cancer treatment will be e xamined here Nanoparticle s can be utilized as a platform for the immobilization of multiple aptamers to generate a multivalent nanoconjugate. For example, we once constructed an aptamer nanoconjugate using Au -Ag nanorods (NRs) [36,72] These aptamer NR conjugates were then used as effective therapeutic agents for targeted photothermal cancer cell destruction [72] Either in a mixed -cell suspension or in a solid tumor, target cells are severely damaged when exposed to near infra red laser light with specific intensity and duration Another interesting vehicle

PAGE 31

31 constructed recently is a viral capsid DNA aptamer conjugate [73] By a chemoselective oxidative coupling reaction, up to 60 sgc8c aptamer strands can be attached to each viral capsid. However, since this system has been tested only with a strong binder, sgc8c, it remains unknown whether this nanomaterial can enha nce the binding affini ty of low affinity aptamers. The utility of its interior for loading anti -cancer drugs is under investigation In addition to enhanced binding affinity, hollow nanoparticles are envisioned to be beneficial for efficient drug loading. Among various drug del ivery systems, the liposome -based system is one of the most established technologies particularly due to its well document ed low cytotoxicity. Although a number of liposome based systems have been approved by the U.S. Food and Drug Administration for clin ical use [74] it was not until early this year that the successful application of aptamers with a liposome delivery system was first published by Lu group [75] Tests in culture cells yielded promising results Four days after cells were exposed to the drug delivery system, 59.5 percent of the cancer cells had died, while less than 12 percent of can cer cells treated with cisplatin alone had died. AS1411, a therapeutic aptamer described above, was their adopted aptamer. Even though it was reported to be directly cytotoxic toward [61] only its cancer recognition ability was utilized for this aptamer liposome system since much lower aptamer concentration was used. Under experimental conditions, it was claimed that the aptamer -liposomes conta ining no cisplatin showed no noticeable cell death, with a viability of about 97.8% a t day 4. Even more interesting simply by adding a piece of complementary DNA (cDNA) to this G -quadruplex aptamer as the antidote, the aptamers targeting capability was r eversed and, as a result, drug delivery was terminated Although studies have been ongoing for less than two decades, the results obtained for aptamers, combined with intrinsic properties and diversified selection protocols, have been

PAGE 32

32 promising, particula rly in the field of anticancer therapy. The emerging integration of aptamers and nanotechnology is envisioned to open up a huge potential for numerous clinical applications. A this time, the potential of aptamers as targeting ligands for both disease diag nosis and treatment is yet to be fully appreciated, but the new aptamer select ion protocols, especially whole -cell SELEX which can generate ligands to distinguish disease d from normal cells without prior knowledge of target molecules, is expected to produ ce more versatile target -specific molecules The availability of new aptamers will further stimulate new diagnostic and therapeutic nanotechnologies in the near future. Meanwhile, we should collectively realize that aptamer research, compared with antibod y studies, is still in its infancy. Nonetheless, aptamers have already met several challenges, such as development of techniques for reducing the cost of modified aptamers for large -scale production, target molecule identification, biological function stud y and biomarker validation. Nucleic Acids for Cancer Intracellular mRNA Study Messenger RNA (mRNA) encodes the gene information from DNA and then decodes it into protein. The ability to detect and visualize target mRNA in living cells in real -time can of fer tremendous opportunities for medical diagnostics, disease studies and drug discovery. Currently there are many traditional methods available for mRNA measurement, including reverse t ranscriptase p olymerase c hain r eaction (RT PCR ) [76] gene chip s [77] n orthern b lot analysi s [78] and fluorescence in s itu h ybridization (FISH ) [79] All of the above methods require destruction of the cells which poses a hindrance to re al time tracking in living cells. Therefore, new analytical approaches to identify and quantify cellular mRNA in real time are highly desired. Molecular beacons (MBs) have offered a promising approach to intracellular biomolecular monitoring. MBs, developed in 1996 [80] are short hairpin oligonucleotide probes with one

PAGE 33

33 fluorophore and on e quencher flanking at each end as shown in Figure 1 3. The loop sequence is designed for the target recognition and two stems are arranged t o bring two chromophore moieties in to close proximity. In the absence of target, the MB is closed, causing the quenching of fluorophore by energy transfer Upon hybridization with its target, MB restores its fluorophore signal due to the increased space s eparation resulting from the spontaneous conformation change Figure 1 3 Working principle of MBs. Basically MBs integrate the recognition component for detection with the signal transduction component for readout When designing M B s for intracellula r mRNA monitoring, the selection of an appropriate region in mRNA as the target is the first critical step. To be accessible to the probe, the target sequence can not lie within a tight secondary structure or be bound to proteins Additionally, the target region must have a unique sequence in order to guarantee the selectivity of the probe to this particular target mRNA To achieve low probe background with the absence of the target, it is necessary to obtain a stable close d form. Thus, two stems, usually f our to seven base pairs long and with high GC content (usually higher than 65%), are required to flank at each end of the loop portion. The unique structural and thermodynamic properties of molecular beacons endow them with two important advantages for th e intracellular monitoring. First, the light switching signal

PAGE 34

34 transduction method allows MBs to detect intracellular targets without any further separation requirement, whi ch is extremely useful for real time detection. Second, MBs have an excellent capabi lity to differentiate perfectly matched targets from those with single -base mi smatch es These two properties make MBs promising tools for real -time intracellular mRNA monitoring. However, the use of MBs for intracellular monitoring still has several limita tions mostly arising from the issues of signal and background, the two fundamental problems for intracellular biomolecular detection. One of the biggest challenges is biostability. Free DNA degrades after only 1545 minutes in the cellular environment [81] Besides tha t, DNA probe s can be structurally disrupted by nonspecific protein binding [82] As a consequence, MBs can yield false -positive signal s. Another cha llenge is low sensitivity. Alt hough it has been reported that MBs can detect as low as 10 copies of mRNA sequences [83] mos t bi o molecular targets are mainly highly expressed biomolecules or some stimulated biomolecules resulting from several factors [84,85] To address these problems for intracellular application, several modifications and new approaches have been developed In terms of biostability, some nuclease resistant buildi ng blocks were attempted in MB design, such as phosphorathioate [86,87] 2 -O -methy l RNA bases [88] and peptide nucleic acids (PNAs) [89] However, p hosphorathioate oligonucleotides have toxicity problems [90] Also, 2 O -methyl MB s can open up nonspecific ally in cells as a result of protein binding thus slightly reducing target specificity [91] PNA containing oligonucleotides tend to aggregate and fold in a way that interferes with duplex formation by their neutral charges [92] On the other hand, l ocked nucleic acid (LNA) MBs demonstrate a promising candidate s for intracellular detection [93] The m ethylene bridge connecting the 2 -oxygen and the 4 -carbon of the ribose makes the structure of LNAs more rigid than DNA bases. This endows fully modified

PAGE 35

35 LNA MB s with many advantages, including resistance to nuclease degradation, immunity to nonspecific protein binding and excellent specificity. However, fully modified LNA MB s LNAs suffer from extremely slow hybridization rates, posing an obstacle to real -time detection [93] Therefore the design of MBs using non-standard bases has not yielded practical molecul ar probes for intracellular monitoring. Chapter Three in this dissertation will describe the proposed solution later. Additionally, the use of gold nanoparticle s was reported to greatly decrease the degradation o f DNA MB modified on their surface [94] However, the relevant protection mechanism was not discussed. A recent study reported that q ua ntum d ot (QD) -conjugated MBs demonstrated better resistance to nonspecific interaction s with both single -stranded DNA binding (SSB) proteins and endonucleases than free MB s while free MB s shared the same immunity to the digestion from exonucleases [95] Thus, the aut hors claimed that SSB proteins and endonucleases could both be responsible for generating false -positive signals. Although SSB proteins and nucleases also present in the cytoplasm, there are fewer DNA -protein interactions in the cytoplasm than in the nucleus [87] This report indicates that preventing nucleus accumulat ion by nanomaterials could be an alternative way to avoid false positive signals and improve the signal to -background ratio, especially considering that the background yielded from the active non specific interactions inside the nucleus accounts for a signi ficant portion of high background intensity. In terms of sensitivity, dual fluorescence resonance energy tra nsfer (FRET) molecular beacons were designed so that two beacons bind side -by-side with a donor dye and an acceptor dye in close proximity These ca n substantially redu ce the background signal caus ed by nonspecific binding and degradation [96] M odified quenched auto-ligation probe s (QUAL) using a universal linker amplified the signal and reduced the background susceptib ility to

PAGE 36

36 nonspecific signals. Wit h this probe, nearly 100 signals per target were observed [97] Superquencher MBs with multiple quenchers greatly suppressed the background as a result of the more efficient quenching [98] ; however, their sensitivity inside living cells is yet to determined. QD, as a semiconductor nanoparticle which can emi t very intense light was once pursued by a group o f people as a means to achieve high sensitivity of MBs. However, based on the data from current ly reporte d Q D -conjugated MBs, this goal would not be easy to realize because of incomplete quenching of the Q D in the close d form of MB [95,99] In addition to these two limitations, extremely low self -delivery efficiency into the cells is another pressing challenge for MBs To ensure that enough probes perform their functions inside cells an efficient delivery method is necessary There are c urrently several delivery methods available for MBs, including use of microinjection, cell penetration peptide, streptolysin O and ele c troporation, but they all have limitations [100] Microinjection is the most popular method [101] bu t it demands high skills and is tedious, inefficient and impractical for high -throughput gene analysis. Cell penetration peptide can also deliver MBs into various types of cells efficientl y [102] but its usage is limited by high cost. Streptolysin O permeabilizes cells by reversibly forming pores on the cell surface [96] but it is a toxin and would be harmful to the cells. A less popular method, eletrophoration, applies an electric field to generate transient permeabilization of the plasma membrane, but it suffers from low cell viability Therefore, a delivery system which can realize high -throughput gene analysis, as well as provide protection to DNA-MBs during an entire delivery process, would be useful.

PAGE 37

37 Other Dissertation -R elated Subjects Nucleic Acid In order to help further understand the properties and related applications of nucleic acids, the chemical synthesis of nucleic acids and one nonstandard base, lo cked nucleic acid, are reviewed in the following section. Chemi cal synthesis of nucleic a cids The discovery of the double helix structure of DNA by Watson and Crick [3] provided the impetus to attempt the challenging synthesis of oligonucleotides, which are nucleic acids with defined sequences. Since the first attempt in 1955 [103] the procedures for oligonucleotide synthesis have been continuously developed and optimized. Instead of a difficult and tedious task for only the most dedicated chemist, the current oligonucleotide synthesis is as easy as simply pressing a few buttons. By virtue of this automated oligonucleotide synthesis and easy modification, nucleic acid, with its inherent recognition ability, has become an ideal building block for a broad spectrum of applications With its high capability to synthesize long oligonucleotide strands wit h various modifications in high yields, the phosphoramidite method is the most commonly used synthesis method [104] To appreciate phosphoramidite chemistry, it is necessary to understand the two key components that ensure successful synthesis : solid -phase support s and functional groups. The ideal solid -phase support used to anchor synthesized oligonucleotides 1) should have a uniform surface structure with pores large enough to contain the desired oligonucleotide, 2) should not possesss any surface functionality that may produce unwanted side products, and 3) should be ava ilable as uniform particles [105] A solid controlled -pored glass (CPG) support is currently the most suitable and most widely used for oligonucleotide synthesis. To achieve rapid and highly efficient coupling reactions, functional groups on the phospho ramidites have been

PAGE 38

38 careful ly designed [106] As illustrated in Figure 1 4 one typical phosphoramidite is composed of several different protection groups. The first and most critical functional group is a diisopropyl phosphoramidite group attached to the 3 -hy droxyl of a nucleoside, resulting in a nucleoside phosphoramidite, which ensures efficient coupling. To prevent side reactions during synthesis, primary amines of nucleotide bases are blocked by specific protection groups which are basic sensitive (as show n in Figure 1 4 ), s o that they can be effectively removed by strong bases. On the other hand, the 5 -o xygen of the deoxyribose is capped by a dimethoxytrityl (DMT) group, which is acid labile and can selectively activate the 5 -hydroxyl under acid ic condit ion s Additionally, the phosphate group is protected by a base -labile 2 -cyanoethyl group. Although different modifier phosphoramidites, like fluorophore and spacer, may recruit slightly different protection groups for a certain moiety, they all share simi lar design strategy. This strat egy is also applied to the home made phosphoramidites [107] Figure 1 4. Typical s tructure s of a protected p hosphoramidite and four protected nitrogeneous bases Unlike enzymatically controlled synthesis, DNA chemical synthesis starts from 3 to 5. The synthesis cycle starts with a column containing a CPG support where the 3 -hydroxyl of the

PAGE 39

39 first nucleoside is attached through a long spacer arm. This support allows excess reagents to be removed by filtration and elimi nates the need for purification steps during the synthesis process. The synthesis cycle involves four chemical reaction steps: detritylation, coupling, capping and oxidization (Figure 15 ). For each repetition of the phosphoramidite cycle, one new base/mod ifier is added to the growing sequence until the desired sequence has been completed Figure 1 5. Automated oligonucleotide synthesis process by phosphoramidite chemistry. In step 1, detritylation, the DMT group is remov ed to activate the 5 -hydroxyl at the end of a glowing oligonucleotide chain attached to the CPG by flushing with a dilute acid solution,

PAGE 40

40 either dichloroacetic acid (DCA) or trichloroacetic acid (TCA) in dichloromethane (DCM), through the reaction column. After washing away the excess acid, the 2nd step, coupling, takes place in which a phosphoramidite derivative of the next nucleotide is added to the column together with a weak acid, tetrazole. In this step, the diisopropylamine group on the 3 phosphorou s in the coming nucleotide is protonated by tetrazole, resulting in a ve ry good leaving group, which subsequently undergoes nucleophilic attack by the activated 5 hydroxyl group to form a phosphite triester linkage. Upon the completion of the coupling rea ction, the column is washed to remove any unbound reagent and by -product s and then capping (step 3) is required. Since every coupling yield c an not reach 100%, there is always a sm all percentage of unreacted 5 -hydroxyl groups remaining on the support Thi s must be permanently blocked from further chain elongation to prevent formation of oligonucleotides with an internal base deletion. Capping is accomplished by acetylation of the bare 5 -hydroxyl group using a mixture of acetic anhydride and 1 -methylimidaz ole. The capping step is followed by oxidation step (step 4) in which the newly formed phosphite triester is converted to a more stable pentavalent phosphate trimester, using iodine and water in the presence of a weak base, like pyridine. After this four -s tep cycle, the product is extended with a new base and is ready for a new round of conjugation. After the synthesis is complete, the fully protected oligonucleotide product must be cleaved from the solid support and deprotected. The deprotection method var ies according to the combination of function al groups involved during the whole synthesis. Meanwhile, the deprotection method is also required to be compatible with the intended following purification techniques. For example, reverse phase HPLC is commonly used to separate the desired product. For this technique, the terminal 5 DMT group can serve as a hydrophobic handle to facilitate the separation, so that the selected deprotection condition should be able to retain the DMT at the

PAGE 41

41 end of the sequence whi le remov ing all the protection groups in the other moieties. In this case, basic conditions are usually used. By converting into appropriate phosphoramidite derivatives, various specie s like fluorophores, quenchers, functional groups and linkers can be i ntroduced into any desired position in an oligonucleotide sequence. Moreover, post -synthesis coupling can always be an alternative option for labile molecules which cannot survive the DNA synthesis process. This freedom to assemble different blocks into a nucleic acid sequence makes nucleic acid a superior building block to construct interesting tools for cancer research. Locked n ucleic a cids The t hree components of a nucleotide (a nucleobase, a sugar, and a phosphodiester linkage) have been prime targets for chemists to modify the natural nucleic acids [108,109] The object is to overcome the limitations of natural nucleic acids, thereby facilitating the ease of processing oligo synthesis, en hancing affinity and selectivity, increasing nuclease resistance, improving thermodynamic properties, and furnishing the ability to cross biological m embranes [110] Locked n ucleic a cid ( LNA ) is one such product resulting from the modification of the sugar In 1997, an LNA, a ribonucleotide derivative with conformationally locked C3-endo sugar conformation, was synthesized [111,112] The first LNA monomer was based on the 2 O CH2 4 bicyclic structure which is now called the oxy LNA ( later termed LNA). Right after the discovery of the oxy LNA, the bicyclic furanosidic structure was chemically modified then the 2 S -CH2 4 (thio LNA) and the 2 NH CH2 4 (amino LNA) bicyclic analogues [113,114] finally a series of LNA diastereoisomers [115122] were prepared. All those LNA analog ue s are grouped into LNA family ( F igure 1 6 ). While this work focuses on the structures of LNA which

PAGE 42

42 have been mostly studied, several recent reviews of LNA [122125] will provide more comprehensive coverage. Figure 1 6 Chemical structure of LNA family [110] According to the strict definition, an LNA is an oligonucleotide that contains one or more LNA monomer(s) [2 O, 4 C -methylene D ribofuranosyl monomer (s)]. The LNA monomer is bicyclic where a ribonucleoside is linke d between the 2 -oxygen and the 4 -carbon atom with a methylene unit [111,112] Molecular modeling has predicted that bicyclic LNA nucleoside monomers should be favorabl y preorganized in an N -type conformation lead to the possible formation of entropically favored with complementary DNA and R NA. X ray crystallographic stud ies and NMR investigations conf i rmed that the LNA monomers adopt N type sugar puckers with C3 endo (3E, P =170) conformation [111,112,126] Thus, LNA is an RNA mimic, which, so far, has the highest affinity towards RNA

PAGE 43

43 Because the structures of LNA s are close t o those of native nucleic acids, their characteristics are also similar. LNA duplexes display the features in common with those of their native nucleic acid anologues: Watson Crick base pairing, nucleobases in the anti orientation, base stacking, and a rig ht -handed helical conformation. Additionally LNA s are soluble in water making it possible f o r biological applications. Furthermore, LNA oligonucleotides can be synthesized using conventional phosphoramidite chemistry, thus allow ing automated synthesis (P roligo http://www.proligo.com ; Exiqon A/S http://www.exiqon.com ). Moreover, LNA/DNA, LNA/RNA, LNA/phosphorothioate, LNA/2 O -Me RNA chimera can also be synthesized in an automa ted manner. Finally, because of their charged phosphate backbon e LNAs can be delivered into cells using cationic transfection vectors [127,128] The LNAs locked ring also overcomes some limitations of native nucleic acids. For e xample, LNA oligonucleotides are stable toward degradation by 3 -exonuclease [129] Besides that, LNA s were demonstra ted to have unprecedented thermal stabilities towards complement ary DNA and RNA m/modification = +3 to +5 0C towards DNA and +4 to +8 0C towards RNA) [118,130] Both properties indicate considerable promise in diagnostic and therapeutic applications. The e xceptional stability of the LNA -modified duplexes is a function of the quenching of concerted local backbone motions (preorganization) by the LNA nucleotides in ssLNA as a result, the entropy loss on duplex formation is reduced and the stacking of the nucleobases is more efficient [131] Moreover, such analogues are typically more resistant to biodegradation and can therefore be used advantageous ly as tools in antisense or siRNA research [132] Additionally, unlike some other sugar -modified oligonucleotide analogues, such as p RNA or homo DNA, LNA s can communicate with natural nucleic acids. These char acteristics offer LNAs widespread applications in bioanalytical and biomedical research [123]

PAGE 44

44 Nucleic Acid Aptamers As decribed above, a ptamers are single -stranded oligonucleotides that fold into unique three dimensional structures, allowing them to bind specifically to a broad spectrum of target molecules. As mimics of antibodies, aptamers are able to recognize targets with high specificity and are able to carry therapeutic agents directly to solid tumor masses or individual cells. Since their discovery in the early 1990s [19,20] apt amer s have been hailed as novel biological molecule s capable of slowly replac ing antibodies. Besides recognition ability, aptamers are potentially useful as pharmace utical agents du e to their ability to modulate the activities of proteins implicated in pa thological conditions. Numerous aptamers have been developed as therapeutic agents [57,133,134] Despite being discovered less than two decades ago, an aptamer -based drug known as Macugen or pegaptanib has already received U.S. FDA approval for the treatment of age related macular degeneration [58,135] Up to now, aptamers have been used for numerous applications, including sensing, separation, diagnostics and therapeutics [22 24] S ystematic e volution of l igands by e xponential enrichment (SELEX ) The method by w hich aptamers are selected, Systematic Evolution of Ligands by Exponential enrichment (SELEX), was independently introduced by the Gold [19] and Szostak [20] groups. In general, SELEX is a combination of in vitro evolution and combinatorial chemistry, involving a series of steps, including incubation partitioning and amplification The process starts with the design of a large nucleic acid library pool created by solid phase technology. It is essential that this pool contain at least a few molecules having the unique conformations required to facilitate selective binding with the target. T o accomplish this, the initial library sequence is randomized from 22 to 100 nucleotides in length (1015 different

PAGE 45

45 oligonucleotide molecules for 40 random nucleotides), flanked at either side by pre defined primer binding sites for polymerase chain reactio n amplification (PCR). In a typical round of SELEX, the first step involves incubating the library with the target under a defined buffer condition. During incubation, some sequences of the library will bind to the target molecule tightly, but other sequen ces will only bind weakly and a majority of the initial sequences do not bind to their target at all. A second step is therefore required to physically separate the binder: target complexes from unbound or weakly bound sequences, partitioning true binders from the others. The success of the entire process depends on this step, since separation results in the differentiation of different binders. Therefore, if the technique can eliminate most of the weak or non -binding aptamer molecules, while retaining thos e tightly binding to their target, then PCR will amplify mainly the tight binders. As a consequence, the enrichment process can be achieved rapidly with fewer rounds of selection. After separation, the high affinity sequences are eluted from the target mol ecules and then enzymatically amplified by PCR to generate a new DNA pool for the next round of SELEX. To speed up the selection process and ensure that the successful aptamer sequences are, in fact, high affinity binders, the stringency of the binding con ditions ( e.g. shorter incubation time, lower concentration of DNA pool ) and/or elution conditions is generally increased during the later rounds. If, however, the conditions are too harsh, there is a risk of losing binders in the earlier rounds, which will result in failure of selection Typically, it takes around 20 rounds of SELEX to obtain aptamer sequences with good affinity (for protein selection, the process would be shorter, generally around 10 rounds). After selection, the resulting oligonucleotides are subjected to DNA sequencing. The sequences corresponding to the initially variable region of the library are screened for conserved sequences and structural elements indicative of potential binding sites. Finally, the binding

PAGE 46

46 potency of the aptamer ca ndidates is verified. Despite it has been almost 20 years away from the first aptamer discovery, most aptamers are still selected by this traditional methodology. However, the involved technologies can vary from traditional capillary electrophoresis, flow cytometry to most recent microfluidic channel [136] The overall goal for various selection approaches remain t he same, that is to increase the selection efficiency with reduced time and process while fishing for ligands which bind to targets with high specificity and affinity. Figure 1 7. Schematic presentation of a typical whole-cell SELEX process. Based on thi s process, the Tan group recently developed a whole-cell SELEX strategy to generate a panel of aptamers for specific disease d cells [31] The cell -SELEX process, which is illustrated in Figure 1 7 can be performed without any prior kno wledge about the target. Similar to the SELEX method, as outlined above, cell -SELEX also involves the same series of steps, including incubation, elution and amplification. However, cell -based SELEX differs in that a counter selection is introduced after a positive selection by performing similar incubation steps,

PAGE 47

47 but with a negative cell line. By doing so, the common binders for regular receptors on the cell membrane are subtracted away from the resulting pools. Thus, the probability of recognizing unique molecules exclusively expressed in the target cancer cells is greatly enhanced. As discussed above, cancers originate from mutations of human genes and these genetic alterations cause molecular changes to diseased cells, resulting in changes in cell morphology and physiology. As such, the rational selection of aptamers must take into consideration the identification of molecular differences between normal and tumor cells, and discriminate among tumor cells of different classifications, at different diseas e stages, or from different patients. This blind selection strategy is, moreover, an interesting method by which potential disease biomarkers can be discovered by identification of the aptamers binding targets [137,138] Aptamers and a ntibodies As described above, nucleic acid based aptamers can perform as specific recognition molecule s just like antibodies. Howev er, compared to antibodies, aptamers possess several inherent advantages [139141] A s listed in T able 1 3 aptame rs can be selected within two months by virtue of the automated synthesis and in vitro SELEX process, while antibody selection requires a time -consuming in vivo process involving animal models. This, in turn, requires that antibodies be generated under physiological condition, limiting their targets to extraceullar molecules which cannot be toxic to the host animal. On the contrary, versatile artificial conditions can be used in aptamer selection, and both extracellular and intracellular molecules can be it s targets without any additional toxicity concerns Although the binding specificity and affinity of aptamers are comparable to those of antibodies, aptamers have much higher inhibitory potential and much lower immunogenicity and toxicity when compared to antibodies. Unlike antibodies, aptamers are smaller in size and molecular weight, allowing higher penetration to the tissue and, as a consequence, allowing the delivery of therapeutic agents

PAGE 48

48 to the tumor sites more efficiently. The aptamers small size als o allows rapid renal clearance from the system, thus reducing toxicity to healthy tissues. Automated synthesis permits aptamers to be easily reproduced with little variation, and further modification can be performed for various applications or, in the alt ernative, simple adjustments to the kinetic parameters can be made. Finally, aptamers are stable and chemically robust, enabling them to retain their activity, even after exposure to heat and denaturants. Table 1 3. Comparison of aptamer and antibodys p roperties [139141] Features Aptamer Antibody Production < 8 weeks (automated, in vitro) > 10 weeks (in vivo) Selection conditions V e rsatile Only physiological condition Target space Extra and intracellular proteins Extracellular proteins Selection toward toxic subjects No Yes Immunogenicity and toxicity None observed Immune reactions observed Molecular weight 5 25 kDa 150 kDa Batch to bacth variation No Yes Convenient chemical modification Yes No Kinetic parameters (on/off rate) Can be changed Can not be changed Inhibitory potential High Low, 1 out of 200 Shelf life Long Short Physicochemical sta bility Stable Labile Binding affinity High High Given that aptamers mimic and extend many of the features of antibodies, a similar or faster development of commercial applications of aptamers in the coming few years is certain Micelles Versatil e nanomaterials have been successfully integrated into different aspects of cancer research and micelle are one such interesting nanomaterial [142] The usages of micelles in cancer research can be largely divided into two areas: separation [143] and delivery [144146] In this section some basic knowledge of micelle s will be present ed

PAGE 49

49 Figure 1 8 Molecular s tructure of phosphatidyl choline A micelle is a dynamic species consisting of aggregated surfactant molecules in a liquid c olloid. Surfactants are am phi philic molecules which contain both hydrophilic (water attracting) and hydrophobic (water -repelling) portions. Figure 17 illustrates one example of phospholipids (the most common cell membrane lipid s ), phosphatidyl choline. Based on the charge characteristics of their hydrophilic head groups, surfactants are generally classified into three type s: cationic, anionic and zwitterionic surfactants. The hydrophobic tail portion of the surfactant can be a linear or branched hydrocarbon chain (seven to twentyo ne carbons), or even an aromatic ring structure Amphi philic surfactant molecules ex ist as discrete monomer s in a very dilut e solution, and they will not aggregate into micelle s until the concentration reaches a breaking point called the

PAGE 50

50 c ritical m icelle c oncentration (CMC). It is not uncommon to obtain slightly different CMC values if different measurement method s are adopted [147] Additionally some factors, such as temperature and the presence of salt and organic molecules, can change the CMC value of the micell es through the interaction with water [148] Table 1 4. The relationship between the molecular packing shape, packing parameter and lipid aggregation structures (modified from ref 149). Critical packing shape Packing parameter Aggregation structure Cone < Shperical micelle Trucated cone Wormlike micelle Cylinder 1 Bilayer, vesicles Inverted (tracated) cone >1 Inverted micelle A s presented in Table 1 4 the geometry of a micelle can vary from bilayer to spher e depending mainly on the packing parameter P defined as follows [149] : in which V is the volume of the hydrocarbon part of the lipid, l is the chain length of the lipid t ail, and S0 is the mean cross -sectional surface area of the head g roup. When P is smaller than the lipids aggregate into spherical micelles; when P is between and the aggregation will form wormlike micelles. A P value between and 1 indicates the formation of a bilayer, while inverted micelle s form when P is lar ger than 1 (see T able 1 4 ). However, regardless of

PAGE 51

51 which structure the lipids adopt, nonpolar hydrocarbon portions of each lipid are aggregated while the polar head groups are in contact with water. The hydrophobic force is demonstrated to be the major the rmodynamic driving force to stabilize the hydrated lipid aggregate [149] while the van der Waals forces between hydrocarbon chains and hydrogen bonding between the polar head groups also play a role. Flow Cytometric Analysis of Aptamer Binding with Cells The abnormal growth of cancer cells may interfere with the natural expression of the c ell surface markers, resulting in an over -expression or under -expression of some markers. To distinguish among diseased cells and healthy cells, flow cytometry is the popular technique to use for immunophenotyping. It is unsurprising that flow cytometry ca n also be applied to evaluate the binding ability of fluorophore -labeled aptamers to the cells by virtue of their antibody mimic properties. Chapter Two in this dissertation presents the utilization of flow cytometry in the aptamer related research. To hel p illustrate the data, the instrumental principles of flow cytometer and related data interpretation are discussed in the following. Basically, flow cytometers use hydrodynamic focusing principle to generate individual particles (cells in our case) to pass through the laser zone (or other light excitation source) and then measure physical and chemical properties of the individual particles simultaneously. As illustrated in Figure 1 9 the fluidics system has a central channel (through which the sample is i njected) enclosed by an outer sheath that contains faster -flowing fluid. As the sheath fluid moves, the injected suspended cells are hydrodynamically focused, resulting in one cell at a time passing through the focused laser zone. As the cells intercept the light source, cells scatter light based on the sizes and shapes. A lens known as the forward scatter channel (FSC) collects the light scattered forward (typically up to 20o offset from the laser beams axis) The FSCs intensity roughly represents the pa rticles size; thus, it can be used to distinguish between

PAGE 52

52 Figure 1 9.A typical flow cytometer setup. Cells are hydrodynamically injected into the fluidics system and with the aid of the sheath flow, one cell at a time passed through the optical path. As the cells intercept the laser, scattered light (forward and side) is collected. If the cells are stained with a fluorescence tags, the emitted fluorescence is collected and converted finally into a digital data set for the computer analysis and display (modified from Figure A 1 in the PhD dissertation of Prabodhika Mallikaratchy at University of Florida). cellular debris and living cells. In contrast, another parameter, side scatter, was measured approximately at a 90o to the excitation line. Unlike FSC, the side scatter channel (SSC) provides information about the granular content within a particle, such as the shape of the nucleus, the amount and type of cytoplasmic granules, or the membrane roughness. Every type of particle has its unique FSC and SSC values; therefore, a combination of these two parameters may be used to differentiate different cell types in heterogeneous samples. For instance, since dead cells have lower forward scatter and higher side scatter than living cells, we can distinguish betw een those two types of cells based on both FSC and SSC parameters. Additionally, if the cells are stained

PAGE 53

53 with a fluorophore labeled probe, the fluorescence signal will be collected to indicate which cells are tagged with the probe. Subsequently, both scat ter and fluorescence signals from each cell are converted into analog electric signals through the photo-multiplier tube (PMT) detectors, and then further transformed into digital electric signals by analog to digital convertors (ADCs). At this point, the collected data are finally ready for the analysis by the computer. To display and interpret data, a single parameter histogram is commonly used. Typically, a single measurement parameter (such as forward scatter, side scatter or fluorescence) is on the x a xis while the number of events (cell counts) is on the yaxis. In this dissertation, a histogram with the events plotted as the function of fluorescence signal is used for the data analysis ( Figure 2 5B for instance). After incubating target cells with aptamers and random library sequences respectively, the fluorescence intensities of cells are compared. Since the average intensity from the red curve (aptamer signal) is much higher than the one from green curve (library signal), the histograms indicate stro ng binding ability of aptamers. Ideally, flow cytometry will produce a single distinct peak that can be interpreted as the positive dataset. However, in many situations, flow analysis is performed on a mixed population of cells, resulting in several peaks on the histogram. In order to identify the positive dataset, negative and/or positive control should be run on the same machine with the same conditions. For instance, to identify target cells in the human whole blood sample in Chapter Two, several contro l experiments are required. Fluorescence Methods for Signal Transduction Fluorescence measurements have been widely used for a broad spectrum of investigations in cancer research because of high sensitivity, nondestructive nature and multiplexing capabilit ies. Fluorescence-based nucleic acid probes may rely on the changes of emission

PAGE 54

54 intensity, excitation or emission wavelength, lifetime, or fluorescence anisotropy to monitor a molecular recognition event. Fluorescence results from a process that occurs when fluorophore molecules absorb light. When a population of these molecules absorbs the energy of the incident light, electrons of these molecules can be excited to the excited singlet states. Returning the electrons to the ground state is accompanied by an emission of photos, which results in fluorescence. This process is illustrated by the Jablonski diagram in Figure 1 10 [150,151] In which, S0 stands for the singlet (all electrons are paired) ground state, S1 and S2 are singlet excited states, while T1 and T2 refer to the triplet (unpaired electrons) excited state. Upon light radiation, the energy of a photon is absorbed by a fluorophore and creates an excited unstabl e electronic singlet state (S1 or S2, the transition of the molecule from S0 state to S2 state is usually presented as a second peak at the shorter wavelength). Subsequently, the excited molecule falls to the ground vibrational level of S1 via internal conversion and/or vibratio nal relaxation. When the electron returns from an excited state to the ground state S0, there is an emission of light at a characteristic wavelength (the fluorescence process). Since the lifetime of the excited state S1 (1010 107 s) is longer than the vibrational relaxation time (10 12-1010 s) as shown in Figure 1 10, vibrational relaxation usually happens before fluorescence happens, which results in a certain energy loss. Thus, the fluorescence emission spectrum is located at hi gher wavelengths (lower energy) than the excitation spectrum. The difference in wavelength between the maximum emission and absorption peak is known as the Stokes shift. Besides the fluorescence emission, several other pathways can also allow electrons ret uring from the excited singlet state to the ground state, including nonradiative decays (such as thermal relaxation) and phosphorescence (intersystem crossing to a triplet excited state).

PAGE 55

55 Figure 1 10. Jablonski diagram for fluorescence mechanism and ch aracteristic times of various processes. There are a variety of ways to quench (decrease) the fluorescence emission of a fluorophore. Two major quenching mechanisms are involved: collisional (or dynamic) quenching and static quenching. During collisional quenching, the excited molecule will experience nonradiative energy loss when colliding with other molecules (including solvent molecules) in the solution Many molecules can be a collisional quencher, such as oxygen, halogens, amines, and acrylamide Cons equently, the excited molecule will return to the ground state without any emission of photons. The decrease in fluorescence intensity caused by collisional quenching can be described by the following Stern-Volmer equation:

PAGE 56

56 Based on the above equation, i n aqueous solutions at room temperature with a fluorophore having 1ns fluorescence lifetime, to ensure the decreased fluorescence caused by collisional quenching is negligible, the quencher concentration should be below 1 mM. However, if two molecules are brought together by linkers, the collision rate is greatly increased and no longer controlled by diffusion rate; thus, the resulting quenching might be significant. Unlike collisional quenching, static quenching involves the formation of a non-fluorescent complex (dark complex) between the quencher and the fluorophore in the ground state. The decrease in fluorescence intensity can be described by the following quation: There are two simple methods available to distinguish two quenching mechanisms. The fir st method is to check the lifetime change. In static quenching, the lifetime does not change as the only observed fluorescence is from the uncomplexed fluorophore; therefore, the fluorophores lifetime remains the same after quenching. In contrast, for dyn amic quenching, the lifetime shows the same order of decrease as the intensity. The second method to differentiate two quenching mechanisms is to identify the effect of temperature on the quenching efficiency. In static quenching, higher temperature leads to the decreased quenching efficiency due to the

PAGE 57

57 dissociation of the weakly bound complex. However, in dynamic quenching, higher temperature causes faster diffusion, thus results in more quenching. Static quenching has been actively incorporated into the molecular probes design to study molecular recognitions. The molecular beacon, which is used in this dissertation, is one such example [152] Scope of This Research The scope of the research work presented here is to engineer molecular probes or nanomaterials for cancer detection with the potential of cancer treatment and intracellular mRNA studies. First, a unique aptamer -micelle was constructed as an efficient detection/delivery vehicle toward cancer cells with enhanced selectivity. The binding ability of low affinity aptamers at physiological temperatures was greatly restored and several beneficial properties have been achieved. In a second project, a universal strategy to build practical molecular beacons for long -term real time intracellular mRNA monitoring was proposed and c omple te d. In this project, the designed probes demonstrated excellent biostability and good hybridization kinetics. Finally, the us e of single -walled carbon nanotube s to modify nuclease -vulnerable molecular beacons was demonstrated to be an efficient way t o overcome several major limitations for intracellular applications, including nonspecific interaction with nucleases and DNA binding proteins, low self -delivery efficiency and nucleus accumulation.

PAGE 58

58 CHAPTER 2 DYNAMIC APTAMER -MICELLE WITH ENHANCE D SELEC TIVITY AS AN EFFICIE NT DETECTION/DELIVERY V EHICHLE TOWARD CANCE R CELLS Introduction This chapter discusses the construction of the aptamer -micelle based on spontaneous molecular self assembly to perform efficient detection/delivery toward cancer cells with enhanced selectivity. Molecular self assembly has contributed to the formation of various interesting nanomaterials, either natural or artificial, to achieve unique functions. In nature, the apoptosome [153] is one such example. Indi vidual apaf 1 protein does not itself have a biological function; however, when forming a complex with cytochrome c, several individual proteins self assemble into a wheel structure called an apoptosome. Once formed, the apoptosome can then recruit and act ivate the otherwise inactive pro caspase 9, which can then activate other caspases and trigger a cascade of events leading to apoptosis. Learning from nature, chemists have created various artificial nanostructures. Micelles represent one such example. Pol ymeric micelles, functioning as drug so lu bilizers and carriers, have been subjected to extensive studies in the field of drug delivery [154] More recently, a micelle constructed as a hybrid from hydrophilic oligonucleotide and hydrophobic polymer [155,156] has drawn close attention. In aqueous solutions, this type of amphiphilic block copolymer can self assemble into a threedimensional spherical micelle structure or a nanorod -like micelle structure [157] This type of micelle has been s hown to efficiently carry a variety of cargos to cells, includin g antisense oligonucleotides [158] and drug molecules [159] To perform efficient targeted delivery, folic acid, a type of cancer cell recognition molecule modified on a piece of short complementary DNA, was clicked onto micelle s based on Watson Crick base pairing [159] Aside from WatsonCrick base pairing, single -stranded oligonucleotides can recognize other target molecules based on noncovalent interactions, such as hydrophobic interaction and

PAGE 59

59 hydrogen bonding. This type of oligonucleotide ligand is known as an aptamer, which can tightly bind to specific target molecules, such as small molecules, proteins, and even cancer cells [19,20,31] Compared to antibodies, aptamers possess a few critical advantages, such as small size, lack of immunogenicity, and ease of synthesis and modification [160,161] We believe that attaching a hydrophobic tail to the end of an aptamer should re sult in a highly ordered micelle like structure. In this type of aptamer assembly, the aptamer strand would not only act as the building block for the nanostructure, but also perform a recognition function to its specific target. Furthermore, densely packi ng aptamers on such an assembly could create a multivalent effect, leading to greatly improved binding affinity of the aptamers. Engineering this type of aptamer micelle can be simple and could result in enhanced binding capability to its specific targets. Micelles are also considered to be dynamic and soft materials. Since the cell membrane is basically a dynamic lipid bilayer, a soft nanomaterial might produce some interesting interactions with it, particularly where such interactions involve cell perme ability and drug delivery. In fact, we have generated a pool of aptamers specifically targeting various cancer cell s [31 33] thus paving the way for the construction of aptamer -micelles with applications in diagnosis and targeted therapy. Experimental Section Materials Unless specified, chemicals were purchased from Sigma -Aldrich (St Louis, MO) and used without further purification. DNA synthesis reagents were purchased from Glen Research (Sterling, VA). The single -walled carbon nanotubes (SWNTs) were purchased from Unidym, Inc. with <5wt% ash content (CAS number: 7782425). CellTra ckerTM Green BODIPY (C2102) and Qdot 705 streptavidin conjugate (Q10161MP) were purchased from Invitrogen. All flow cytometry data were acquired with a FACScan cytometer (Becton Dickinson Immunocytometry

PAGE 60

60 Systems, San Jose, CA). Ramos (CRL 1596, B -cell line human Burkitt`s Lymphoma), CCRF CEM (CCL 119, T cell line, human Acute Lymphoblastic Leukemia), K562 (CCL 243, chronic myelogenous leukemia (CML), and HL60 (CCL 240, acute promyelocytic leukemia) were obtained from ATCC. The NB4 cell line was kindly prov ided by Shands Hospital. All cell lines were cultured in RPMI 1640 medium (ATCC) supplemented with 10% fetal bovine serum (FBS) (heat inactivated, GIBCO) and 100 IU/mL penicillin streptomycin (Cellgro). The wash buffer contained 4.5 g/L glucose and 5 mM Mg Cl2 in Dulbeccos PBS (Sigma). Binding buffer used for the aptamer binding assays was prepared by adding yeast tRNA (0.1 mg/mL) (Sigma) and BSA (1 mg/mL) (Fisher) into the wash buffer to reduce background binding. Synthesis of L ipid T ail P hosphoramidite. Synthesis of compound 1 : A solution of stearoyl chloride (6.789 g) in ClCH2CH2Cl (50 ml) was slowly added to a solution of 1,3 -diamino 2 -dydroxypropane (1.0 g) in ClCH2CH2Cl (100 ml) and TEA (2.896 g). The reaction mixture was stirred for 2 hours at room t emperature and then heated up to 70 C overnight. The solution was then cooled down to room temperature, filtered, and the solid was washed with CH2Cl2, CH3OH, 5% NaHCO3 and ethyl ether. After drying under vacuum, the solid turned to white ( compound 1, yie ld: 90%). Synthesis of compound 2 : Compound 1 (5.8 g) was dissolved in anhydrous CH2Cl2 (100 ml), and DIEA (8.6 ml) was injected into it The solution was cooled on an ice bath, and 2 Cyanoethyl N,N -diisopropylchlorophosphoramidite (4.2 mL, 16.72 mmol) wa s added under dry nitrogen. After stirring at room temperature for 1 hour, the solution was heated to 60 C for 90 minutes. After cooling to room temperature the solution was washed with 5% NaHCO3 and brine, dried over Na2SO4 and concentrated by vacuum. T he product was purified by precipitation

PAGE 61

61 from concentrated CH2Cl2 into CH3CN to afford compound 2 (4g, 55% yield) as white solids. 31P NMR (CDCl3) 154 ppm Synthesis of Aptamer -Lipid Sequence An ABI3400 DNA/RNA synthesizer (Applied Biosystems, Foster Cit y, CA) was used for the preparation of all DNA sequences. All oligonucleotides were synthesized based on solid -state phosphoramidite chemistry at a 1 mol scale. The aptamer lipid sequences listed in T able 2 1 were synthesized in controlled -pore glass colu mns with a 3 (6 FAM), TAMR or biotin TEG covalently linked to the CPG substrate. The complete aptamer -lipid sequences were then deprotected in AMA solution (concentrated ammonia hydroxide:methylamine = 1:1) at 65 0C for 15 minutes for FAM/biotin labeling or a solution of methnol: tert -butylamine: water (1:1:2) at 65 0C for 3 hours for TMR labeling. A ProStar HPLC (Varian, Walnut Creek, CA) with a C8 column (from Alltech, Deerfield, IL) was used for probe purification. Deprotected sequences were purified wi th a linear elution gradient with TEAA (triethylammonium acetate) in acetonitrile changing from 20% to 70% over a 30 min period. The collection from the first HPLC separation was then vacu um dried Spacer phosporamidite 18 was used as the linker between DNA and lipid tail. Lipid tail phosphoramidite dissolved in methylene chloride was directly coupled onto the sequence by the synthesizer. The synthesis of lipid tail phos phoramidite is

PAGE 62

62 described in the above section. A Cary Bio 300 UV spectrometer (Varian, W alnut Creek, CA) was used to measure absorbance for probe quantification. Preparation of TDO5 -Micelles with D ifferent Aptamer Densities Aqueous TDO5 lipid /library -lipid solution and aqueous PEG lipid solution were diluted in different centrifuge tubes by a ddition of at least 5 -fold volume of acetone. Subsequently, the two solutions were mixed well together and put in a vacuum drier to evaporate away the acetone leaving only an aqueous solution. By adjusting different molar ratios of TDO5 lipid /library lipid and PEG -lipid solutions at this first step, TDO5 -micelles /library -micelles with different aptamer /library densities could be achieved Micelle Characterization TEM images were obtained after negative staining with 1% aqueous Uranyl Acetate using a trans mission microscope ( Hitachi H 7000). The TEM samples were dropped onto standard holey carbon -coated copper grids. Dynamic Light Scattering measurements were carried out at room temperature using a Brookhaven ZetaPALS analyzer Aptamer -lipids were dissolved in PBS buffer. using a transmission microscope (Hitachi H 700). Flow Cytometric Analysis To demonstrate the cell -specific targeting capabilities of aptamer lipids, fluorescence measurements were made using a FACScan cytometer (Becton Dickinson Immunocytometry Systems, San Jose CA). The binding was performed by the following procedure 250 nM aptamer -lipid/library lipid in binding buffer was added to about 1 million cells in the individual flow tubes. The prewarmed mixture was incubated at 37 0C in a cell incubator for various time periods. After incubation, the cells were immediately washed twice with cold washing buffer. The fluorescence was determined by counting 15,000 events.

PAGE 63

63 Competition assays to measure the off rate of the aptamer -cell interacton ( Koff) were performed as follows. An aptamer concentration of 250nM was incubated with cells for 20 minutes at 4 oC for 20 minutes to allow the aptamer to bind to the target in the cell membrane After the incubation, the cells were washed to remove unbound aptamer. Finally, the labeled cells were incubated with 2.5 uM unlabeled aptamer at 4 oC for various incubation times. The mean fluorescence intensity was measured at different incubation time s after a brief vortexing of the cell mixture. Koff was obtaine d by fitting the dependence of the binding percentage over time to the equation Y = Y0 + Aexp ( KoffX) where Y is binding percentage and X is time. The fluorescence intensity before the displacement was normalized to 100% binding. Additionally, the equilibr ium dissociation constants (Kd) of the aptamer -cell interactions were obtained by fitting the dependence of fluorescence intensity of specific binding on the concentration of the aptamers to the equation Y= BmaxX/(Kd + X) by SigmaPlot (Jandel, San Rafael, CA). Preparation of Au NP -TDO5/library Conjugates Gold nanoparticles (Au NP, 13 nm) were prepared [162] and modified with Neutravidin by the reported method. Then either an excess of biotin and Cy5 co -labe led TDO5 aptamer or library was mixed with the Neutravidin -modified Au NP, and the complexes were rocked at room temperature for at least half an hour. After removal of unbound DNA by centrifugation, the conjugates were directly used in cell binding studie s. Preparation of SWNT/TDO5 -Lipid or SWNT/ LibraryLipid Complexes SWNTs were ultrasonicated (Fisher Scientific, Model 100) for 1 hour. Then about 60 mg/L SWNT was mixed with 5 M TDO5 lipid or library lipid aqueous solution. The mixture was ultrasonicated for another 30 minutes. Then the probe/nanotube solution was centrifuged at 20,000 g for 15 minutes. The pellet, comprising impurities and large aggregates of nanotubes at the bottom of the centrifuge tube, was discarded and the supernatant was dialyzed ag ainst 1.5L

PAGE 64

64 water (Spectra/MWCO1MDa) for 3 days. The water was changed 6 times during the dialysis period. The resulting solution was stored at 4 oC. Preparation of Biotin -TDO5 -M icelles D oped with D yes Dye doped aptamer -micelles were prepared by the precipi tation and membrane dialysis method. 15 pmol of dry biotin TDO5 lipid was dissolved in 20 L ethanol, and then mixed well with 6.74 nmol CellTrackerTM Green BODIPY. The solution was then added dropwise into 100 L deionized water while stirring. After stir ring for about 3 hours to evaporate the ethanol, the aqueous solution was dialyzed against 1.5 L water (Spectra/MWCO3500) for 2 days. The water was changed 5 times during the dialysis period. Finally, the solution was filtered through a 0.22 um filter to r emove any undesirable aggregates and stored at 4 oC. Preparation of NBD -L abeled L iposome 27.4 M POPC (Avanti) and 1.3426 mM NBD -PC (Avanti) (2% NBD -PC in the lipid mixture) were mixed in a chloroform solution, the solvent was evaporated by a stream of ni trogen and vacuum, and the lipids were allowed to hydrate in PBS buffer. The resulting multilammellar vesicles were put through five freeze -thaw cycles and then extruded through a polycarbonate filter with p ore diameter of 100 nm (Whatman) Determination o f CMC of Aptamer -M icelle 10 M of pinacyanol chloride solution in distilled water was mixed with TDO5 -micelles with various concentrations from 0.2 nM to 150 nM. The solutions were left to sit for hours before taking the pictures. Cytotoxicity Assays Cellu lar toxicity of DNA -lipid was assessed using the CellTiter 96 Cell Proliferation Assay (Promega, Madison WI), according to the manufacturers instructions. Cells were cultured in 96 well microtiter plates in complete growth medium with various library -lipi d or library

PAGE 65

65 concentrations for 2 days, with 500,000 cells/mL as the starting cell density As a positive control, 10% DMSO was incubated under the same conditions. Confocal Imaging Cell images were made with a confocal microscope setup consisting of a L eica TCS SP5 Laser Scanning Confocal Microscope. For real time monitoring, the fluorescent images were taken every minute at a fixed depth. 2 uM cell tracker dye and/or about 4.5 uM aptamer -lipid were/was incubated with the cells in complete cell medium at 37 oC. For the colocalization experiment, cells were incubated with TMR TDO5 lipid (250nM) in RPMI -1640 complete medium at 37 oC for 3 hours, and then AF633transferrin (60nM) was added 30 minutes before the termination of incubation. Incubation was stopped by placing the cell on ice immediately after washing with cold washing buffer. Flow Channel Device Preparation and Incubation under Continuous Flow For micelle buffer incubation, a PDMS flow channel was used. PDMS devices were fabricated using a proces s similar to what is described in the literature [39,163] The layout of the device was designed in AutoCAD and printed on a transparency using a high resolution printer. The pattern on the transparency was transferred to a silicon wafer via photoli thography. The silicon wafer was etched to a depth of 25 m in a deep reactive ion etching machine. The resulting silicon wafer with the desired pattern served as a mold to fabricate a number of PDMS devices. Sylgard 184 (Corning) reagents were prepared and thoroughly mixed by following the manufacturers instructions. After being degassed to remove bubbles, the mixture was cast on top of the silicon mold. After being cured at room temperature, the PDMS layer was peeled off the silicon mold. Two wells at both ends of the channe l and one well in the middle of the channel were created by punching holes in the PDMS. The PDMS slice was reversibly attached to a clean 50 45 mm cover glass (Fisher) to form a device. Avidin and

PAGE 66

66 biotin aptamer solutions were added to the wells at both ends of the channel (sgc8 aptamer for CCRF -CEM on the left side; TDO5 aptamer for TDO5 on the right side) and were sucked through channels by applying a vacuum to the middle well of the channel Then the corresponding cell solutions were put to the corresp onding end -wells, sucked slowly through the entire channel by applying a vacuum to one of end -wells, and incubated at 37 oC for 5 minutes. After washing, the DNA-micelles diluted in binding buffer were continuously flushed through the channel at 300 nL/s f or 5 minutes by connecting a m icrosyringe pump (World Precision Instruments, Inc.) to the end -well of the channel (dynamic incubation). The channel was ready for confocal imaging after three washing steps. In between experiments, the PDMS devices were clea ned by sequential sonication in 20% bleach with 0.1 M NaCl and then 50:1 water:versaclean (Fisher) at 40 oC, followed by rinsing in deionized H2O and drying under N2. For micelle blood incubation, a simplified flow channel made from double glass slides gl ued together by a double sided tape Instead of a microsyringe pump, a piece of filter paper was used to suck the solutions through the channel with average flow rate of about 300 nL/s. Results and Discussion Aptamer -Micelle Constructio n As indicated in the scheme ( Figure 2 1A), we have attached a simple lipid tail phosphomidite with diacyl chains onto the end of an aptamer inserted with a PEG linker. This amphiphilic unit self assembled into a spherical micelle structure, as demonstrated in the TEM image (Figure 2 2 A). The aptamer used in this case is called TDO5. As shown in Figure 2 2A the TDO5 -micelle has an average diameter of 6813nm, which is consistent with the hydrodynamic diameter measured by Dynamic Light Scattering of 67.22nm ( Figure 2 2 B). Wh en optimizing our selective aptamer -micelles, we found that the hybrid from lipid tails plus a short length of DNA (short DNA -lipid) can result in nonspecific binding with cells within

PAGE 67

67 a short time period. As shown in Figure 2 3, only after 30 minutes, str ong fluorescence signals were observed. However, this nonspecific interaction problem can be greatly reduced by simply elongating the DNA by inserting more random DNA bases. The hybrid from the lipid and a total 89mer DNA length demonstrated the least nons pecific binding within 2 hours of incubation with cells. To facilitate DNA synthesis pursuant to the construction of aptamer -micelles for further studies, we replaced the random DNA bases by a PEG linker of similar length using a spacer phospho ra midite 18. In this case, 24 units of PEG were inserted between a TDO5 aptamer sequence and lipid tail (Figure 2 1A). Figure 2 1.A) Schematic illustration of aptamer lipid formation. All the related sequences are listed in Table 2 1. B). Flow cytometric assay to monitor the binding of free TDO5 (250nM) and TDO5 lipid (250nM) with Ramos cells (target cells) and HL60 (control cells) at 37 0C for 5 minutes. The blue and black curves represent the background binding of unselected DNA library and TDO5 lipid respective ly. The purple and red curves represent the binding of TDO5 and TDO5-lipid r espectively.

PAGE 68

68 Figure 2 2. TEM image after negative staining by 1% aqueous Uranyl Acetate (A) and Dynamic light scattering histogram (B) of TDO5 -micelles. Figure 2 3. Effect of the length of oligonucleotide on the nonspecific interactions between DNA lipids and different cell lines, including Ramos (A) and CCRF -CEM (B). The green, blue and purple curves represent the hybrids from lipid tails with oligonucleotides of about 89, 30, and 22 base pairs, respectively. Enhanced B inding at P hysiological Temperature Interestingly and surprisingly, the formation of an aptamer -micelle was found to enhance the binding capability of otherwise low affinity aptamers at physiological temperature. TDO5 is such an aptamer and was selected specific to Ramos cells (a B -cell lymphoma cell line) [32] At

PAGE 69

69 4 C TDO5 showed high affinity and selectivity for its target protein, immunoglobulin heavy mu chain (IG HM ) receptor on the cell surface [138] which indicates that this surface cell membrane protein has an upregulated expression in Ramos cells. On the other hand, TDO5 did not bind with Ramos cells at 37 C (Figure 2 1B), a condition which could seriously hinder its potentia l in vivo applications. However, when TD05 is used for micelle formation, the TDO5 -micelle was also found to have excellent binding selectivity at 37 0C. As shown in Figure 2 1 B, when binding with target cells, about 80-fold enhancement in fluorescence int ensity was observed for TDO5lipid, while no binding shift was found with control cells. Figure 2 4. Flow cytometry to determine the binding affinity of free FITC TDO5 aptamer (A) and FITC TDO5 lipid (B) to target cells (Ramos cells). The nonspecific bin ding was measured by using fluorescein (FITC) labeled unselected library DNA or library DNA-lipid. The mean fluorescence intensity of target cells was obtained by subtracting the mean fluorescence intensity of nonspecific binding. Although the dissociation rate of aptamer -lipid is similar to that of free aptamer if based on aptamer -lipid unit concentration, the dissociat ion rate of aptamer -micelle s is much smaller if assuming 1000 DNA lipid units per micelle particle The dissociation constants of the apta mer -micelles were also investigated. Since a similar size of polymer micelle (60nm) was estimated to have 1000 copies of units [164] one TDO5 -

PAGE 70

70 micelle (68nm) is assumed to have the same estimated unit numbers. As shown in Figure 2 4 the TD05 micelle has a Kd of 116 nM. I f one TDO5 -micelle has 1000 copies of DNA -lipid units, the dissociation constant after constructing the micelle structure would be greatly decreased from 88 nM (for free TDO5) to 0.116 nM (for TDO5-micelle). This approximate 750 fold increase in binding a ffinity might be ascribed to the multivalent effect from multiple aptamer binding. Based on these findings, the lipid tail plus linker modification can be a universal strategy to promote the binding abilities of low affinity aptamers, as demonstrated by t he improved binding behaviors observed after attaching lipid tails onto the end of two other low affinity aptamers, KK and KB (Figure 2 5 ). Figure 2 5. Flow cytometric assay to monitor the binding of free aptamer (250 nM) and aptamer lipid (250nM) with ta rget cells (K562) at 37 0C for 5 minutes. FITC-KK (A) and FITC -KB (C) aptamers either bind weakly or do not bind at all to the target cells. However, FITC -KK-lipid (B) and FITC-KB lipid (D) show increased binding to the target cells. Extremely L ow koff Ge nerally, a low off rate tends to indicate that the binding is strong and difficult to be replaced. Therefore, the koff rate of our aptamer lipid was examined by a competition experiment,

PAGE 71

71 which was designed to test the micelles binding strength in compari son to single aptamers. As shown in Figure 2 6 after one day of competition with unlabeled TDO5 aptamer, almost all the bound labeled TDO5 was replaced. Plotting the competition data of free TDO5 showed an exponential decay with a koff of 4.4 105 S1 (R2 = 0.93844). In contrast, after the same competition time, a very low percentage of bound TDO5-micelles was replaced by free TDO5 with a koff of 1.5 106 S1 (R2 = 0.23481). We noticed that the coefficient for the data fitting in the TDO5 -micelle case is quite low, which indicates that the off rate pattern of TDO5 -micelle might not be the same as the exponential pattern. Similar low off rates and low R2 were observed for the other two aptamer -micelles based on KK and KB aptamers (Figure 2 7 A ). Figure 2 6. Time course of displacement of FITC TDO5 (A) or FITCTDO5 lipid (B) bound onto the target cells by competition with an excess of nonlabeled TDO5. Cells were incubated with binding buffer containing 250 nM FITC labeled probes for 20 minutes at 4 oC. The n 2.5 M non -labeled TDO5 was added to the cells, and flow cytometric measurements were carried out at times as shown in the x axis. The fluorescence intensity before the displacement was normalized to 100% binding. The fluorescence intensity of each data point was normalized to the binding percentage

PAGE 72

72 Figure 2 7. Time course of displacement of FAM -KKlipid (A), FAM -KB lipid (B) and Cy5 TDO5 Au NP conjugate (C) bound onto the target cells (K562 for A and B; Ramos for C) by largely excess of nonlabeled corr esponding aptamers (KK for A, KB for B, TDO5 for C). Cells were incubated with binding buffer containing 250 nM FAM labeled probes for 20 minutes at 4oC. Then, 2.5 M nonlabeled TDO5 was added to the cells, and flow cytometric measurements were carried ou t at times as shown in the x axis. The fluorescence intensity before the displacement was normalized to 100% binding. The fluorescence intensity of each data point was normalized to the binding percentage as well. The graphs show that the dissociation rat es of the aptamer nanomaterial complexes are all much slower than those of corresponding aptamers. Based on these extremely low off rates, and considering the fact that both aptamer lipid and cell membrane have hydrophobic and hydrophilic portions, we hypo thesize that the integration of aptamer lipid into the cell membrane can be facilitated by the lipid tail and that the preferred thermal stability does not allow such aptamer lipid to easily diffuse out In order to determine whether our aptamer -micelles could fuse with cell membrane, we doped TDO5micelles with a special dye that only fluoresces inside cells (CellTracker) (see scheme in

PAGE 73

73 Figure 2 8A ). As shown in Figure 2 8 B and 2 8 C, after incubating the cells with free cell tracker for 12 hours, a strong fluorescence signal was observed inside the cells, while a very weak fluorescence signal was present after 2 hours of incubation. In contrast, it was only after an incubation lasting more than 2 hours with dye -doped TDO5-micelles that most of the cells pr oduced a strong fluorescence signal (Figure 2 8 D). To determine whether some or all the aptamer -micelles remained on the cell surface, we post incubated streptavidin quantum dots 705 (QD705) with the cells after binding biotin labeled TDO5 lipid to the cel ls. Figure 2 8 E shows a strong red fluorescence signal around the cell membrane, which indicates that at least some of the aptamer -lipid remained bound to the cell membrane after the dye was released. Exposing the cells to strong UV illumination for a long time leads to cell apoptosis and the leakage of activated fluorescent cell tracker dyes into the incubation buffer. As shown in Figure 2 8 E, a strong green fluorescent signal was observed outside the apoptotic cells while a clear QD705 halo remained wher e the cell membrane would have been, indicating the integration of the aptamer -lipid into the membrane (Figure 2 8 E inset). Based on our real -time monitoring of the fluorescence from the cell tracker at room temperature (Figure 2 8 F), fusion of the micelle s with the cell membranes occurs within minutes. The above experiments reveal the potential fusion between aptamer -micelles and the cell membrane. Thus, the interaction process between aptamer -micelles and cells is proposed to be fluidic in nature involv ing specific interaction induced nonspecific insertion (see the related information for detailed hypothesized mechanism and related experiments at the end of this section).

PAGE 74

74 Figure 2 8 Flow cytometric assay to monitor the binding of FITC TDO5 lipid o r FITC library lipid with human whole blood sample (male, single donor human whole blood in Na Heparin, Innovative Research ) at 37 0C for various time periods. The black green and red curves represent the fluorescence intensities from blood cells only, u nselected DNA library -lipid and TDO5 lipid r espectively. TDO5 -M icelle H elps C ell I nternalization Although some of the aptamers by themselves lack an internalization pathway, the introduction of this novel nanostructure formation allows the aptamer -lipids to ultimately penetrate the cells they target. As shown in Figure 2 9, while most of the micelles remained on the cell surface after long incubation, a clear fluorescence signal inside the cells, which was confirmed by optical imaging with confocal Z axis depth scanning, was observed. Since TDO5

PAGE 75

75 alone does not internalize, we reasoned that another mechanism, possibly related to membrane recycling, and might be contributing to this phenomenon. To investigate the intracellular distribution of TDO5 -lipid, we co -stained the cells with Alexa633 -labeled transferrin, which is commonly used to identify the location of endosomes [165] The co -localization of the aptamer lipid with transferrin indicated that the internalized aptamer lipids were inside endosomes (Figure 2 9 ). This interesting internalization pathway created by the attachment of the lipid tail, as detailed above, can widen aptamer applications in therapy requiring drug delivery inside the cells. The signal from outer cell membrane should be from the ones which have bound onto the cell membrane but not entered cell yet or have bee n recycled out to the cell membrane after going inside. Figure 2 9. T he enlarged fluorescence image (A), bright field image (B), and stack image after Z depth scanning (C) of Ramos cells after incubation with TMR TDO5 lipid in complete cell medium at 37 0C for 2 hours. The cross marked in image C indicates that the brightest fluorescence signal comes from inside the cell. (D) Co localization of TMR TDO5 lipid (red) and AF633 -transferrin (blue) in endosomes.

PAGE 76

76 Rapid I dentification with H igh S ensitivity F igure 2 10. Flow cytometric assay to monitor the binding of 250nM TDO5 lipid or library -lipid with Ramos cells (target cells) and HL60 (control cells) at 37 0C for various incubation times (A), or various concentrations of TDO5lipid/ library lipid with ta rget cells at 37 0C for 5 minutes (B). The green and red curves represent the background binding of unselected DNA library -lipid and TDO5 lipid respectivel y.

PAGE 77

77 This TDO5 -micelle demonstrated extremely rapid recognition of the target cells. As shown in Figur e 2 10 A, after an incubation of only 30 sec at 37 0C, a 45 -fold enhancement in fluorescence intensity was observed for TDO5lipid upon binding with target cells. Again, no significant binding was observed for the control cells. Although a targeting time shorter than 30 seconds might be possible, we did not attempt it because of experimental difficulties. Since every piece of DNA lipid is labeled with one single FITC dye at the 3 end, one recognition event from one aptamer lipid can induce multiple -dye stai ning to target cells. Therefore, this aptamer micelle structure is suggested to provide an additional signal enhancement. We varied TDO5 lipid/library -lipid concentrations from 250 nM to 1 nM and incubated them with one million cells, respectively. As show n in Figure 2 10B, even at about 0.005 nM (or 5 nM, based on DNA lipid concentration), noticeable fluorescence shift was still observed upon binding with target cells. Trace Cell D etection in Whole Blood S ample To evaluate the detection ability of TDO5 -m icelle in a complex environment, we spiked one million target cells/control cells directly in 50 uL human whole blood sample (about 310 million cells) and then incubated the DNA -micelles with the cell mixture at 37 0C for 5 minutes. Based on the flow data shown in Figure 2 11, obvious binding shift was observed when binding to the target cells, but no significant binding shift happened in the control cell mixture. Similar to control, no binding shifts happened in the absence of spiked target cells in whole blood sample (see Figure 2 12). These flow data prove that the aptamer -micelle can detect trace target cells selectively, even in a complex environment. Meanwhile, when we lengthened the incubation time from 5 minutes to 2 hours, smaller binding shifts wer e observed (Figure 2 12). It is suggested that the instability of nucleic acid in

PAGE 78

78 Figure 2 11. Flow cytometric assay to monitor the binding of 250nM TDO5 lipid or library -lipid with trace Ramos (target cells A ) and CCRF CEM (control cells B ) in human w hole blood sample at 37 0C for 5 minutes. By mixing 1 million cells with 25 uL male whole blood (about 155 million blood cells), 1 million cells with 50 uL male whole blood (about 310 million blood cells), 1 million cells with 100 uL male whole blood (abou t 620 million blood cells), and 0.5 million cells with 100 uL male whole blood (about 620 million blood cells), the cell percentages were adjusted to 0.64%, 0.32%, 0.16% and 0.08%, respectively. The green and red curves represent the binding of unselected DNA library -lipid and TDO5 lipid respectivel y. Figure 2 12. Flow cytometric assay to monitor the binding of FITC TDO5 -lipid or FITC -library lipid with human whole blood sample (male, single donor human whole blood in Na Heparin, Innovative Research ) at 37 0C for various time periods. The black green and red curves represent the fluorescence intensities from blood cells only, unselected DNA library -lipid and TDO5 lipid r espectively.

PAGE 79

79 plasma at 37 0C after long incubation is the main reason for the redu ced binding shifts [166] It can therefore be concluded that the pr esence of fewer intact aptamer -lipids lead s to lower binding signals. Figure 2 13. Flow cytometric assay to monitor the binding of FITC TDO5 lipid (250nM) with target cells (Ramos) (A) or control cells (HL60) (B) at 37 0C for different time periods. We do not believe that the higher nonspecific binding of DNA -micelles after long incubation in this complex environment causes the smaller binding shifts. As shown in Figure 2 12, the nearly identical fluorescence intensities of library l ipid were observe d irrespective of the incubation time with whole blood cell mixture. Comparing the increased nonspecific bindings with increased incubation time in pure buffer sample, as shown in Figure 2 -13, we think that the difference in total cell numbers in these two different cases may well lead to different nonspecific interaction patterns. Since the total cell number is extremely high per whole blood cell mixture sample (about 311 million cells), but much lower for the pure buffer incubation

PAGE 80

80 (only 1 million cells), the micelle concentration per cell should be extremely low. This leads to the absence of significant nonspecific binding, even after 2 hours of incubation for whole blood cell mixture. Aptamer -M icelle T argeting in a F low C hannel under a Continuous F low To investigate whether aptamer -micelles can be used for selective targeting under the dynamic fluid conditions of blood circulation, a simplified flow channel was used to mimic the circulatory environment. While we understand there is a significant differe nce between the fluidic channel and the blood vessel, we believe that this flow dynamic study will give us hint about future possibilities in using this micelle system as a detection/delivery system with dynamic specificity. As shown in the scheme in Figur e 2 14A two biotin -labeled aptamers (biotin -sgc8 and biotin TDO5) were individually immobilized onto either side of a glass channel using avidin -biotin interactions. Following this step, their corresponding target cells (CCRF CEM for sgc8 and Ramos for TD O5) were flowed through and captured by the immobilized aptamers. In this way, two different cell zones were established in the flow channel: CCRF CEM in the control cell zone and Ramos in the target cell zone for TDO5 aptamer. As the first step, the targe ting ability of aptamer -micelle spiked in a simple pure binding buffer system at 37 0C inside the flow channel under continuous flushing was evaluated. For micelle -buffer incubation, either FITC TDO5 -micelle or FITC library -micelle diluted in binding buffe r was continuously flushed through the two cell zones sequentially at 37 0C for 5 minutes at 300 nL/s. The same results were observed irrespective of which direction the DNA -micelle was sucked through the two types of cell zones. A representative result a fter micelle -buffer incubation with FITC TDO5 lipid is presented in Figure 2 1 5A In this case, strong fluorescence signal was seen from the target cell zone, but no noticeable fluorescence signal from the control cell zone. In contrast, no fluorescence si gnal was observed in either cell zone after incubating

PAGE 81

81 with a control FITC library -micelle or free FITC TDO5 aptamer at 37 0C (Figure 2 1 5BC), which indicates that TDO5 -micelle enhances TDO5 aptamers binding ability at 37 0C. Figure 2 14. Simplified fl ow channel response to cell staining assay. (A). Stepwise immobilization scheme of the flow channel. Representative images of the bright field and fluorescent images of control cells (CCRF CEM) and target cells (Ramos) captured on the flow channel surface incubated with FITC TDO5 -micelle (B), or FITC -library -micelle (C) or free FITC TDO5 (D) spiked in human whole blood sample under continuous flow at 300nL/s at 37 oC for 5 minutes. All the scale bars are 100 m.

PAGE 82

82 Figure 2 15.Representative images of the bright field and fluorescent images of control cells (CCRF -CEM) and target cells (Ramos) captured on the flow channel surface incubated with FITC TDO5 -micelle (A), or FITC library -micelle (B) or free FITC TDO5 (C) spiked in pure buffer solution under conti nuous flow at 300 nL/s at 37 oC for 5 minutes. All the scale bars are 100 m.

PAGE 83

83 As the second step, blood circulation in living systems was mimicked to further test the targe t ting ability of aptamer -micelle in complex human whole blood sample. This was accomplished inside the flow channel under continuous flushing at 37 0C. To avoid cleaning difficulties, a simplified flow channel made of double glass slides was preferred over a PDMS flow channel for micelle blood incubation. Representative results after micelle -blood incubation are presented in Figure 2 14B As in the micelle -b uffer incubation system, strong fluorescence signal was seen from the target cell zone after incubation with TDO5 -micelle spiked in whole blood sample, but no noticeable fluorescence signal from control cell zone was seen. In contrast, no fluorescence sign al was observed in either cell zone after incubating with a control FITC library -micelle spiked in whole blood sample. Circulation velocity in living systems might be much faster than 300 nl/s in most locations [167] Nonetheless, we still expect that aptamer -micelles would be capable of recognizing target cells to a degree at least equal to, if not better than that which is shown in this dynamic incubation channel with a faster circulation rate. Based on our in vitro study of the effect of the incubation time on cell recognition ability using fixed cell numbers (Figure 2 13), increasing incubation time resulted in a decrease of selectivity; thus, a shorter incubation time might either have no effect at all, or might even lead to better binding selectivity, especially considering the rapid identification ability of aptamer -micelles. These results indicate that the aptamer -micelle can perform s elective recognition in a complex environment that mimics [167] blood circulation. Moreover, this aptamer -micelle was found to have low CMC and low cytotoxicity to the cells (Figure 2 16, Figure 2 17). As such, this type of aptamer -micelle is proposed to be an efficient drug delivery vehicle for target cells without the need for internalization of the aptamers target molecule. Instead, apta mer -lipids can simply interact with the cell membrane

PAGE 84

84 and quickly release the doped hydrophobic molecules into the cells. Meanwhile, however, through membrane replacement, aptamer lipids can permeate cells by a process of endocytosis. Thus, this type of ap tamer -micelle offers two kinds of drug delivery pathways: direct releasing of doped drug and internalization by direct drug aptamer lipid conjugation. Finally, by replacing PEG lipid with therapeutic aptamer drug -lipid, the heterogeneous aptamer -micelle can specifically deliver aptamer drugs around the target cell surface. For instance, by lipid tail plus linker modification, we can construct a lipid molecule from Macugen, an FDA approved aptamer selected against vascular endothelial growth factor (VEGF). By replacing PEG lipid in Figure 2 18 with Macugen -lipid, we expect that this aptamer -micelle will be able to draw all the Macugen lipids to a specific tumor cell surface, which would greatly increase the localized drug concentration to enhance inhibition potency. CMC D etermination of TDO5 -M icelle by P inacyanol C hloride In the present study, pinacyanol chloride, a well known useful dye for determining the critical micelle concentration of anionic surfactants, was used. As in previous reports [168170] the color change of pinacyanol chloride from red to blue occurs in a concentration range not very far from the CMC of the anionic surfactant. The blue color above the CMC is characterize d by -bands at 607 and 562 nm, and the red color below the CMC, by band results from the aggregate formed by the dye, while the -bands are attributable to the solubilization of the dye into the micelle. Therefore, the estimated CMC of TDO5 -micelle can be assigned to the concentration range where the blue color begins to fade into red. As shown in Figure 2 16, the estimated CMC of TDO5 -micelle could be around 20 nM (based on TDO5 lipid un it concentration).

PAGE 85

85 Figure 2 16. The determination of estimated CMC of TDO5 -micelle by the color change of pinacyanol chloride. The red numbers on the top or the bottom of the centrifuge tubes are the concentration of TDO5lipid mixed with 1105 M pina cyanol chloride (based on TDO5 lipid unit concentration; concentration unit is nM). From left to right, top to bottom, from tube 1 to tube 24, the TDO5lipid concentrations are 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150 nM, respectively. Figure 2 17.T he cell viability affected by library lipid with various concentrations which was determined by CellTiter 96 AQueous One Solution Reagent on a plate reader As one type of positive control fo r MTT assay, 10% DMSO was added to cells. The total incubation time is 2 days.

PAGE 86

86 Effect of A ptamer D ensity on the S elective Binding of A ptamer -M icelles The effect of aptamer density on selective binding was investigated by mixing FITC TDO5 lipid with FITC P EG lipid in different molar ratios: 0:1, 1:1 and 10:1 (PEG -lipid versus TDO5 lipid). As shown in Figure 2 18, even at an aptamer density of 9% (10:1 molar ratio of PEG lipid/TDO5 lipid), the aptamer -micelles still demonstrate selective binding ability at 3 7 0C after incubation with cells for 5 minutes. As aptamer density decreases, the binding shift is observed to become smaller. First, this indicates that a certain aptamer density is required to preserve target cell recognition at physiological temperature s for this type of aptamer -micelle. Second, a certain amount of multivalent binding might also be important. Figure 2 18. Flow cytometric assay to monitor the binding of TDO5 lipid or library lipid with Ramos cells (target cells, A) and HL60 (control cell s, B) at 37 0C for 5 minutes after mixing with different ratios of PEG lipid. The molar ratios between FAM DNAlipids and FAM -PEG -lipid are 1:0, 1:1, and 10:1. The black and red curves represent the background binding of unselected DNA library -lipid and TD O5 lipid respectively.

PAGE 87

87 Hypothesized M echanism about the I nteraction Between A ptamer -M icelle and C ells All aptamer -micelles (TDO5 -micelle, KK -micelle, KB -micelle) show improved binding abilities. Similar improvement in binding ability should be expected by conjugation of single aptamer to other types of solid nanomaterials. However, when TDO5 was conjugated or complexed with 13nm Au NPs and SWNTs (single -walled carbon nanotubes), the complex did not show restored binding when temperature was raised to 37 0C (Figure 2 19 ). Figure 2 19. Flow cytometric assay to monitor the binding of two other types of nanomaterial aptamer conjugates/complexes, including gold nanoparticles TDO5 (A, B) and single -walled carbon nanotubes (SWNTs) complexed with FITC TDO5 li pid (C, D), with target cells at 4 0C for 20 minutes and 37 0C for 10 minutes. In fact, both kinds of nanomaterials (soft nanoparticles (micelle) and solid nanomaterials (Au NPs and SWNTs)) showed completely opposite binding behaviors to the target cel ls at 37 0C, although they presented similar binding abilities at 4 0C. These differences might be ascribed to two possible mechanisms, including the multivalent effect by the presence

PAGE 88

88 of multiple aptamers on the nanomaterial surface, or the fluidic nature of the aptamer -micelles. T o explain these interesting observations the two mechanisms are under investigation. Since both types of nanomaterials have greatly improved dissociation constants at 40C, multivalent effect should exist for both of them. This would not, however, explain why the two types of nanomaterials would have different binding patterns at physiological temperature. Thus, we believe that multivalent effect would not be the main reason for these interesting observations. Figure 2 20. Sc heme depicting the hypothesized interaction between dye doped aptamer -micelle and cells. (A) At the first step, one or two aptamers on the aptamer -micelle surface have weak interactions with target proteins on the cell membrane. (B) At the second step, the fluidic nature of the aptamer -micelle leads to the rearrangement of aptamer lipid units to make more and stronger interactions with multiple target proteins on the cell membrane ; meanwhile, the aptamer -micelle is drawn closer to the cell membrane. (C) At the third step, the aptamer -micelle fuses with cell membrane and releases the doped dye. (D) After multiple processes, some of the aptamer lipids localize in the endosome inside the cells, while the others remain on the cell membrane. However, since the st ructure of hydrophobic lipid tails pointing toward aqueous solution is not favored, most of the bound aptamer -lipids flip and insert into the cell membrane with or without weak interaction between aptamer heads and target proteins.

PAGE 89

89 Instead, we believe that the fluidic nature of aptamer -micelles plays an important role in preserving the binding ability of the otherwise low affinity aptamers. Similar to the lipid bilayers in the cell membrane [171] aptamer lipids are in constant motion in the aptamer -micelle, although the micelle itself is relatively stable. We therefore hypothesize that a four -stage process occurs when aptamer -micelles are incubated with cells (see scheme in Figure 2 20). We assign these stages to each of four steps: A through D. In step A, when the temperature is raised to 37 0C, TDO5 undergoes a conformational change, which leads to the weak binding with target protein, wherein the Kon rate is slow, while the Koff rate is fast, resulting in an insig nificant apparent binding shift of free TDO5. This occurs during step A, when only a couple of individual aptamer -lipids have weak interactions with a couple of receptor proteins. At step B, however, the lipid units rearrange their relative position to som e extent, leading to more individual aptamer lipids having a better fit into the binding pockets of more target proteins. Because the aptamer micelle has localized multiple aptamers, the binding interactions between the TDO5 ligands and the target proteins have an additive effect, increasing the binding ability of the aptamer -micelle. This step is critical, and it is speculated to be the main reason for a difference in binding ability. TDO5/SWNTs are unable to retain their binding affinity at 37 0C, presuma bly because the aptamer moieties are fixed onto the surface of the SWNT. Therefore, although it might also have localized multiple weak interactions by the presence of the multiple aptamers, its binding status could not be favored under the dynamic binding equilibrium. By contrast, in step B, the whole micelle is drawn much closer to the cell membrane as a result of the weak, but additive, interactions. Additionally, for the same reason, the local concentration of aptamer -micelle is greatly increased, which further increases the possibility of interaction between micelle and cells. In step C, because the micelle is in close proximity to the cell membrane, it disintegrates and

PAGE 90

90 fuses with the cell membrane. After multiple cellular processes, some aptamer lipid s that have fused with the cell membrane will further permeate the cell during a process of membrane recycling, while others remain on the cell membrane. This is step D. Some aptamer -lipids, which originally bind to the target proteins, might flip and ins ert into the cell membrane with or without any interaction with proteins since the structure with hydrophobic tail pointing into aqueous solution would not be thermodynamically favored. In this proposed mechanism, the kinetic trap which favors a long live of whole micelle structure near the cells to ensure aptamers function as a specific recognition ligand is critical and previous step for nonspecific disintegration of micelle into the cell membrane Figure 2 21.Fluorescence emission spectra of NBD -PC: POPC, TMR DNA-lipid and mixture (NBD PC: POPC in the presence of TMR TDO5 -lipid) in PBS buffer (pH7.4): NBD PC: POPC (blue curve), TMR TDO5 lipid (red curve), mixture (light green curve), mixture after adding Triton (purple curve). Instead of TMR TDO5 lipi d, TMR DNA (inserted upper graph) and no dye labeled TDO5lipid (inserted bottom graph) were mixed with NBD PC: POPC with or without the presence of Triton, respectively.

PAGE 91

91 To investigate the possibility of fusion in step C, we first utilized liposomes to mi mic the cell membrane lipid bilayer. By mixing NBD -labeled liposomes (NBD -PC: POPC) and TMR labeled DNA lipid, we monitored lipid bilayer DNA lipid interactions by Fluorescence Resonance Energy Transfer (FRET). As shown in Figure 2 21, the blue curve repre sents the NBD emission spectrum from NBD liposome only, and the red curve represents the TMR emission spectrum from TMR -micelle only. After the two materials were gently mixed, an increase in TMR emission and a decrease in NBD emission were observed by exc iting NBD labeled liposome, indicating that FRET had occurred between the two probes. By further adding Triton X 100, which was reported to induce complete loss of FRET (100% membrane fusion) [172] further increase in TMR emission was observed, indicating that FRET was indeed caused by the fusion of DNA -micelle with liposome lipid bilayer. Control experiment by mixing NBD liposome with TMR -DNA shows no occurrence of FRET, nor did FRET occur in the absence of mixing dye labeled liposome with DNA lipid. These findings indicate that TMR -micelle can fuse with cell membrane mimic liposome. These buffer experiments, combined with the observations mentioned in the main text (extremely low off rate and fast release of doped dye into the cells), indicate that the micelle can disintegrate and fuse with the cell membrane (described in step C). This process is a specific binding from multiple aptamers induc ing nonspecific insertion. As mentioned in the main text, the results shown in Figure 2 9 demo nstrate the possibility of internalization in step D. Conclusions In summary, we have developed an aptamer -micelle assembly for efficient detection/delivery targeting specific cancer cells. This aptamer -micelle enhances the binding ability of the aptamer m oiety at physiological temperature, even though the corresponding free

PAGE 92

92 aptamer loses its binding ability under the same condition. The merits of aptamer -micelles include greatly improved binding affinity, low Koff once on the cell membrane, rapid targeting ability, high sensitivity, low CMC values, and the creation of a dual drug delivery pathway. Most importantly, the aptamer -micelles show great dynamic specificity in flow channel systems that mimic drug delivery in the blood system. All of these advantage s endow this unique assembly with the capacity to function as an efficient detection/delivery vehicle in the biological living system. Table 2 1. List of a ll oligonucleotides used in this work Name Sequence aptamer lipids and library lipid FAM TDO5 lip id 5` lipid tail (CH 2 CH 2 O) 24 AAC ACC GGG AGG ATA GTT CGG TGG CTG TTC AGG GTC TCC TCC CGG TGA FAM 3` Biotin TDO5 lipid 5` lipid tail (CH 2 CH 2 O) 24 AAC ACC GGG AGG ATA GTT CGG TGG CTG TTC AGG GTC TCC TCC CGG TGA biotin 3` TMR TDO5 lipid 5` lipid tail (CH 2 CH 2 O) 24 AAC ACC GGG AGG ATA GTT CGG TGG CTG TTC AGG GTC TCC TCC CGG TGA TMR 3` KK lipid 5` lipid tail (CH 2 CH 2 O) 24 ATC CAG AGT GAC GCA GCA GAT CAG TCT ATC TTC TCC TGA TGG GTT CCT AGT TAT AGG TGA AGC TGG ACA CGG TGG CTT AGT FAM 3` KB lipid 5' lip id tai l (CH 2 CH 2 O) 24 ACA GCA GAT CAG TCT ATC TTC TCC TGA TGG GTT CCT ATT TAT AGG TGA AGC TGT FAM 3' Library lipid 5' lip id tail (CH 2 CH 2 O) 24 (N)n FAM 3' A ptamers and library FAM TDO5 5` AAC ACC GGG AGG ATA GTT CGG TGG CTG TTC AGG GTC TCC TCC CGG TGA FAM 3` FAM KK 5` ATC CAG AGT GAC GCA GCA GAT CAG TCT ATC TTC TCC TGA TGG GTT CCT AGT TAT AGG TGA AGC TGG ACA CGG TGG CTT AGT FAM 3` FAM KB 5` ACA GCA GAT CAG TCT ATC TTC TCC TGA TGG GTT CCT ATT TAT AGG TGA AGC TGT FAM 3' FAM library 5` NNN NNN NNN NNN NNN NNN NNN NNN NNN NNN NNN NNN NNN NNN NNN NNNFAM 3' TDO5 for Au NP 5` Cy5 AAC ACC GGG AGG ATA GTT CGG TGG CTG TTC AGG GTC TCC TCC CGG TGA TTT TTT TTT TTT TTT biotin 3` Library for Au NP 5` Cy5 NNN NNN NNN NNN NNN NNN NNN NNN NNN NNN NNN NNN NNN NNN NNN NNN TTT TTT TTT TTT TTT biotin 3` Biotin TDO5 for flow channel 5` AAC ACC GGG AGG ATA GTT CGG TGG CTG TTC AGG GTC TCC TCC CGG TGA TTT TTT TTT T biotin 3` Biotin sgc8 for flow channel 5` ATC TAA CTG CTG CGC CGC CGG GAA AAT ACT GTA CGG TTA GA T TTT TTT TTT biotin 3` *N is random base, and n is equal to the base number of corresponding aptamers.

PAGE 93

93 CHAPTER 3 NUCLEIC ACID BEACONS FOR LONG TERM REAL TIME INTRACELLULAR MONITORING Introduction Advanced cancer research, especially disease process study as well as drug discovery protocols presuppose the need for superstable molecular probes for use in longterm real -time gene monitoring inside living cells, as well as in vivo monitoring inside animals. Such probes should be able to resist nuclease digestion and avoid cellular protein binding. One probe, the molecular beacon (MB) [96,173177] promises to meet these requirements. The MB is a short hai rpin oligonucleotide probe which produces a fluorescence signal upon hybridizing to specific nucleic acids. Although MBs have been used for real -time intracellular detection, DNA -MBs are known to yield false positive signals. This results from multiple int racellular interactions that degrade DNA -MBs, or change their conformation, through processes such as endogenous nuclease degradation and/or stem loop structure disruption by nucleic acid binding proteins [85] Consequently, a biostability problem arises which has been addressed by incorporating nuclease resistant building blocks, such as phosphorothioat e [86] 2 O -methyl RNA bases [88] peptide nucleic acids [89] and locked nucleic acids (LNA) [93] into MB designs. Among these candidat es, MBs with LNA bases have demo nstrated adequate biostability in vitro [93,178] Nevertheless, the overall effectiveness of fully modified LNA MB is compromised by extremely slow hybridization rates. A practical LNA based MB for long term real -time mRNA monitoring inside the living cells is yet to realize. In this chaper we report the design of effective MBs and evaluate their pratical applications inside the living cells

PAGE 94

94 Experimental Section Chemicals and Reagents The MBs prepared are listed in Table 3 1. DNA and LNA synthesis reagents were purchased from Glen Research (Sterling, VA). Deoxynuclease I, ribonuclease H, and single stranded binding protein were purchased from Fisher. Table 3 1. Optimized LNA -MBs for Intracell ular Experiments optimized LNA MBs Sequence actin MB 5 Cy3 C A G T C G AGGAAGGAAGGCTGGAAGAG C G A C T G BHQ2 3 MnSOD MB 5 Cy3 C C T A G C CAGTTACATTCTCCCAGTTGATT G C T A G G BHQ2 3 control MB 5 AF488 C T A G C T C T A A A T C A C T A T G G T C G C G C T A G BHQ1 3 Note: Italic letters represent LNA bases, and underlined letters are bases for the MB stem. Equipments An ABI3400 DNA/RNA synthesizer (Applied Biosystems, Foster City, CA) was used for all MB probes and DNA target preparation. A ProStar HPLC (Varian, Walnut Creek, CA) with a C18 column 4.6 mm) from Alltech (Deerfield, IL) was used for probe purification. A Cary Bio 300 UV spectrometer (Varian, Walnut Creek, CA) was used to measure absorbance for probe quantitation. Fluorescence measurements were performed on a Flu orologTau 3 spectrofluorometer (Jobin Yvon, Inc., Edison, NJ). The protein concentrations in the cell lysate were determined with Bio Rad protein assay dye reagent concentrate (Bio -Rad Laboratories Inc.) by comparing with a bovine serum albumin (BSA) cali bration curve. Cell images were taken with a confocal microscope setup consisting of an Olympus IX 81 inverted microscope with an Olympus FluoView 500 confocal scanning system and tunable argon ion laser (458 nm, 488 nm, 514 nm) and a green HeNe laser (543 nm) with two separate photomultiplier tubes (PMT) for detection. A 40 0.6 NA air objective was used. A Leiden microincubator with a TC 202A temperature controller (Harvard Apparatus, Holliston, MA) was used to keep the cells at 37 C during injection and monitoring. An EXFO Burleigh PCS 6000-

PAGE 95

95 150 m icromanipulator was used for positioning the injector tip. An Eppendorf Femtojet and analysis were conducted with the FluoView software. Molecular Beacon Synth esis All oligonucleotides were synthesized based on solid -state phosphoramidite chemistry at a -pore glass columns with a 3 Dabcyl molecule covalently linked to the CPG substrate. FA M phosphoramidite was used to couple to the 5 end of the sequence. The complete MB sequences were then deprotected in concentrated ammonia hydroxide at 65o C overnight and further purified with reverse phase high -pressure liquid chromatography (HPLC) on a C 18 column and ion exchange HPLC (Dionex DNAPacTM PA 100 column (40 250 mm, or semipreparative), 30% 70%, 45 min gradient 1 M NaCl/20 mM NaOH, pH 12). For the MBs labeled with Cyanine 3(Cy3), FAM phosphoramidite was replaced by Cy3 phosphoramidite and 3 Dabcyl CPG was replaced by 3 Blackhole Quencher 2 (BHQ2) CPG. For the MBs labeled with AF488, off column synthesis was required. The synthesis began with 3 Blackhole Quencher 1 (BHQ1) CPG and ended with 5 amino -modifier C6 phosphoramidite After tha t, the sequence was purified and deprotected by 2% acetic acid to activate the amino group. Then, off -column synthesis was conducted in sodium carbonate buffer (pH=9) with Alexa Fluor 488 carboxylic acid succinimidyl ester (Invitrogen) with 10-fold higher concentrations. Hybridization K inetics S tudy Hybridization experiments were obtained using 100 nM of MBs and 500 nM targets in a total volume of HCl (pH 7.5) containing 5 mM MgCl 2 and 50 mM NaCl. The fluorescence inte nsities were measured as a function of time.

PAGE 96

96 DNase I S ensitivity To test the nuclease sensitivity of MBs, the fluorescence of a 150 ul solution containing 20 mM Tris HCl (pH 7.5), 5 mM MgCl 2 50 mM NaCl and 100 nM MBs was monitored as a function of time at room temperature. Two units of ribonuclease -free DNase I were added and any subsequent fluorescence change was recorded RNase H S ensitivity To test the susceptibility of molecular beacon target mRNA hybrids to the digestion of ribonuclease H, 100 nM of M Bs were incubated with the same concentration of RNA target as indicated in the above buffer. After the hybridization reached equilibrium, 12 units of ribonuclease H were added, and the subsequent change in fluorescence was monitored as a function of time. Protein Binding Study Gel electrophoresis was performed to study the interactions between Single -Stranded DNA Binding Protein (SSB) and MBs. In the buffer containing 20 mM Tri s HCl (pH 7.5), 5 mM MgCl 2 and 50 mM NaCl, 5 After one hour, the solution was analyzed in a 3% agarose gel at 100V in TBE buffer for 50 minutes. The gel was then stained by Coomassie blue G 250 stain solution (BioRad) for one hour and was hed with de -ionized water for 30 minutes. The image of the resulting gel was achieved by scanning on a regular scanner. Cell Lysate Preparation A 75 cm2 flask of 95% confluent MDA -MB 231 was washed with serum -free medium (Leibovitz's L 15 medium with l glutamine, ATCC) for 1 h in the incubator. After removal of the serum -free medium (SFM), the cell cultures were suspended in 3 mL of ice -cold detergent -free buffer (50 mM Tris H Cl, pH 7.4, 1 mM EDTA, 2 mM EGTA, 0.33 M sucrose, 1 mM

PAGE 97

97 dithiothreitol) containing a broad -range protease inhibitor cocktail (Roche Molecular Biochemicals, Indianapolis, IN). The cells were then scraped off the flask using a plastic cell scraper and passed five times through a 27 1/2 gauge needle. The samples were fractionated by centrifuge at 1000g for 10 min at 4 C to isolate the nuclei, and the supernatant was the cytosolic fraction. After one more washing with the detergent -free buffer, the nuclei pellet was resuspended in a lysis buffer (20 mM HEPES, 1 mM EDTA, 2 mM EGTA, 150 mM NaCl, 0.1% sodium dodecyl sulfate (SDS), 1% Igepal, and 0.5% deoxycholic acid, pH 7.5) containing a broad range protease inhibitor cocktail (Roche Molecular Biochemicals) and mi xed for 90 min at 4 C to ensure full membrane lysis. After centrifugation at 1000g the supernatant was the nuclear fraction. Each fraction's protein concentration was determined, using the Bradford protein assay, and was stored at Biostability Study with Cell Lysate With the fluorometer, the fluorescence intensity change of MBs was monitored upon the c fraction) into the 100 nM MB solutions. The buffer used was 20 mM Tris HCl (pH 7.5) containing 5 mM MgCl2 and 50 mM NaCl. Imaging and Data Collection All the cellular fluorescent images were collected by the confocal microscope using laser excitation. Th e control MB with AF488 was excited at 488 nm and collected at 520 nm. The actin MB with Cy3 was excited at 543 nm and collected at 570 nm. The Tris, 50 mM NaCl, and 5 mM MgCl2 buffer. Images were taken every minute or every other minute. The microscope shutter was opened only long enough to allow the laser to illuminate the injected cells while a fluorescence image was collected at each of the required t ime points to

PAGE 98

98 avoid unnecessary dye photobleaching and any damage to the cells. A region surrounding each of the injected cells was used to determine the average fluorescence intensity for each channel at each time point. These average intensities for each cell at each time point were recorded and plotted against the time frame. For long -time imaging, some cells might change their shapes or move slightly. The signal region for analysis was accordingly adjusted to achieve more accurate data. The data collect ion was stopped when the injected cell changed its shape, a circumstance which raised some concerns about cell viability. The relative fluorescence intensities were calculated by directly comparing the current intensity with its intensity at the beginning state for each case. For data given in Figure 2c, the relative fluorescence intensity ratios were calculated by the average ratios from the final five points divided by the monitoring starting point (for the cases without LPS treatment) or by the data points right before LPS treatment (for the cases with LPS treatment). The error bars re present the standard deviation from the calculated five data points for each case. Results and Discussion MB Design and in vitro Characterization We demonstrated that MBs made entirely of LNA improves biostability and sequence selectivity greatly in vitro [93] However, we discovered that the overall effectiveness of fully modified LNA -MBs can be compromised by extremely slow hybridization rates. To overcome the limitations of MBs in intracellular measurements, we made design modifications by mixing LNA and DNA bases in both the stem and loop of a MB, resulting in MBs that can effectively measure intracellular e vents with extremely high biostability (Table 3 1). As shown in in vitro testing (Figure 3 1), these MBs combine long-term stability with excellent sensitivity, selectivity, and fast hybridization kinetics.

PAGE 99

99 Figure 3 1. Representative in vitro biostabi lity experiments of the optimized LNA -MBs. (a) Gel electrophoresis of SSB solutions containing no MBs (lane 1); the optimized LNA MBs (lane 2). Under the experimental conditions, SSB migrates significantly slower than the negatively charged MB and will onl y migrate when it is in complex with the MB. Thus, the representative gel electrophoresis result for an optimized LNA -MB showed little SSB binding. (b) Fluorescence signal change of LNA and DNA -MB upon the addition of ribonuclease -free DNase I. In the DNase I assay, the fluorescence intensity increases as the DNA MB is digested by DNase I, which nonspecifically cleaves phosphodiester bonds. On the other hand, LNA MBs had no response to the addition of excess DNase I. (c) Fluorescence signal change of LNA MB upon the addition of RNase H. The RNase H assay mimics false negative results that can occur when target mRNA is degraded once it is hybridized with the DNA MB. RNase H specifically cleaves RNA strands that are hybridized with DNA, thereby decreasing the target concentration and allowing the MB to reform the hairpin structure. No noticeable signal decrease was observed when RNase H was added to the duplex of RNA: LNA MB. Our design strategy consisted of two steps. First, in order to maintain the fast hybr idization rate, the MB stem was consistently composed of 50% LNA in an alternating fashion. Such optimized LNA -MBs would then have a fast response to excess complementary target DNA (Figure 3 2). When compared to DNA MBs, it is precisely this hybridization behavior which makes it possible to use these LNA -MBs to track gene expression levels in real time Second, we gradually increased the LNA percentage in the loop starting from 50% until the LNA -MB satisfied the biostability screening criteria (Figure 3 1)

PAGE 100

100 Figure 3 2. In vitro hybridization kinetics of the optimized LNA -MBs. Ten -fold excess cDNAs (CTCTTCCAGCCTTCCTTCCT ; AATCAACTGGGAGAATGT AACTG ; GCGACCATAGTGATTTAGA) were added to all three optimized LNA MBs The hybridization experiments were performed a t room temperature in 20 mM Tris HCl (pH 7.5) buffer containing 5 mM MgCl2 and 50 mM NaCl. The biostability screening criteria are to test LNA -MBs with various amounts of LNA by three types of experiments: single -stranded DNA binding protein (SSB) intera ction, DNase I, and ribonuclease H (RNase H) digestion. The in vitro biostable LNA -MBs which passed all three in vitro biostability tests were termed optimized LNA -MBs as listed in Table 3 1, and they were then used for further study inside living cells MB in vitro Testing with Cellular Samples Before we attempted to use the LNA -MBs for intracellular measurements, we tested them with cytosolic and nuclear fractions of MDA -MB 231 cells. DNA -MB was used for a comparison, and the results are shown in Figure 4 3. When the cell lysate was added to the DNA-MB solution, we saw a significant fluorescence increase over time. In contrast, there was no such fluorescence increase for any of the optimized LNA -MBs, clearly demonstrating that the LNA -MB can sustain biost ability for a long period of time, even with cell lysate samples. This finding enabled us to test the feasibility of the LNA MB as a long -term molecular probe for

PAGE 101

101 mRNA monitoring inside living cells. To accomplish this, the LNA MB was microinjected into living cells and their hybridization with nucleic acid targets was monitored through fluorescence by confocal microscopy. The LNA sequences showed little nucleus accumulation problem inside MDA -MB 231 cancer cells; therefore, the average fluorescence intens ities around the injected cells were determined for data analysis. Figure 3 3. Normalized representative fluorescence intensity changes of DNA -MB and LNA MB with cytosolic and nuclear fractions from MDA -MB 231 cell lysate. The DNA MBs had a significant fluorescence increase over time, while the LNA -MBs had no significant fluorescence changes. Long -Term Monitoring Inside Living Cells The LNA MB was observed to monitor mRNA expression inside a living cell for more than 5 h. To further evaluate the biostabi lity and mRNA detection ability of LNA -MBs in living cells, we used LNA bases to synthesize both control MB and MnSOD MB, which were co injected into MDA MB 231 cancer cells. The control LNA -MB and MnSOD LNA -MB were made with donor fluorophores (Alexa Fluor (AF488) and Cyanine (Cy3), respectively). Because their excitation and emission wavelengths do not overlap, both beacons could be imaged simultaneously in our confocal system [179] In this experiment, lipopolysaccharide (LPS) was

PAGE 102

102 used to stimulate MnSOD mRNA expression inside living cells [180] The control LNA MB had no complement inside the cells. Therefore, we determined that the signal fr om the control LNA -MB would be stable, as long as the MB was not degraded by nucleases or nonspecifically opened by protein binding. As shown in Figure 3 4a,b, the fluorescence signal of the control MB did not change noticeably, even after 5.5 h (1.5 h bef ore LPS treatment plus another 4 h after treatment). At the same time, the MnSOD LNA -MB was effective in monitoring MnSOD mRNA expression over a 5.5 h period. Also as shown in Figure 3 4a, there is a slow fluorescence increase in the MnSOD LNA -MB before L PS induction, whereas the fluorescence stays flat for the control MB. As the basal level of MnSOD is very low inside the cell, the number of newly formed hybrids caused by hybridization is slowly increased over time. We tested multiple cells, which showed the same trend as that discussed above, and the relative fluorescence signal changes from the injected cells are plotted in Figure 3 4c. Overall, these results showed that the basal MnSOD expression level in MDA -MB 231 cells was low, but that MnSOD mRNA co uld be highly expressed with LPS treatment. In addition, the hybridization kinetics of LNA MBs inside the cells (with either synthetic complement DNA or native mRNA, Figure 3 2, 3 5) was within minutes. The prolonged signal increase as seen in Figure 3 4a suggests a continuously induced mRNA expression Because the signal for the control MB inside the living cells during the same time period was not changed, the long term stability of the LNA MBs was further confirmed. The small fluctuation of signal enha ncement ratios among these cells only reflects a cellto -cell gene expression variation. These cell -to -cell differences might have been a consequence of some membrane ruffling and cell morphology changes during the monitoring period, as indicated in the ti me -lapse images shown in Figure 3 -4b.

PAGE 103

103 Figure 3 4 Representative microinjection experiments. (a) Relative fluorescence signal changes of control MB and MnSOD MB during 1.5 h without LPS treatment and during 4 h with LPS treatment. The y axis represents t he signal changes relative to the initial fluorescence signal directly after microinjection (Supporting Information). ( b ) Time lapse of control MB (green) and MnSOD MB (red) inside a MDA -MB 231 cell. The control MB fluorescence did not change over time, but that for MnSOD changed significantly as the gene expression was stimulated by LPS. ( c ) Histograms of relative fluorescence signal change of MnSOD MBs (no pattern) and control MB (cross hatched pattern) without LPS and with LPS treatments within different cells.

PAGE 104

104 Figure 3 5 In v iv o hybridization kinetics of the optimized control LNA -MB and actin MB. (a) The first segment represents two typical time course measurements of the fluorescence intensity of two cells after optimized LNA control MB is injecte d into the cells. The second segment illustrates the hybridization kinetics of control MB with excess cDNA (GCGACCATAGTGATTTAGA) introduced into the same cells (b) T ime course fluorescence intensity measurements of the optimized LNA actin MB with native mRNA in two living cells. Long -Term Stability of MBs The LNA MBs are also shown to be effective for nucleic acid monitoring, even after 24 h inside living cells. To demonstrate this, the control LNA -MB was injected into a cell and incubated for 24 h bef ore the cell was used for nucleic acid hybridization studies. A target complementary DNA solution was injected into the cell 24 h after the original control LNA MB injection. Time lapse fluorescence images (Figure 3 6) show that the control LNA -MB remains functional, even after incubating inside the cells for 1 full day. We also tested the enhancement of the LNA MB by adding cDNA for the LNA MB, both immediately after MB injection and 24 h later. The signal enhancements in both cases are about the same, 2.2 6 for immediate second injection (standard deviation is 32.9%) and 2.02 for delayed secondinjection (standard deviation

PAGE 105

105 is 4.24%). The fact that the LNA MB showed the same response to complementary DNA after 24 h of incubation inside a living cell proves that the LNA -MB s can be used for longterm monitoring of gene expression inside living systems. Figure 3 6 Timelapse fluorescence images after microinjection of excess cDNA into the same cell which has been injected by the optimized control MB after 24 h. Conclusions We have created LNA -MBs that have superior resistance to enzymatic cleavage and protein binding and that retain their functions inside cells, even after 24 h of incubation. To put this into perspective, DNA -MBs degrade after about 15 45 min utes in the cellular environment [81] In contrast, the newly designed LNA MBs provide outstanding biostability which extends their application to long -term real time intracellular gene monitoring and possible in vivo monitoring inside living animals. In particular, we will be able to study gene expression levels within a single cell, making it possible to carry out experiments in which specific cells within a tissue or tumor can be monitored over long time periods. Examples include (1) following gene expression in a single cell as it differentiates, (2) observing specific cells during development, (3) measuring cellular responses to drugs, and (4) studying specific cellular reorganization processes in cancer, i.e., tumor cell migration and angiogenesis. The superstabi lity of the newly designed

PAGE 106

106 LNA -MBs makes them an effective tool for many in vivo studies and monitoring where stability of the molecular probe is needed for a protracted period of time.

PAGE 107

107 CHAPTER 4 CARBON NANOTUBES PRO TECT DNA STRANDS DURING CELLU LAR DEL IVERY Introduction As noted in Chapter One for efficient intracellular mRNA monitoring, an ideal molecular probe should not only have an adequate biostability, but also should overcome two other major problems : extremely low self delivery efficiency of nu cleic acids into the cell and serious nucleus accumulation Insterestingly, by the DNA probe/SWNT (single -walled carbon nanotube) complexes all three problems have been simultaneously addressed. Although SWNTs have been intensively studied for 18 years, t his is the first report about SWNTs protection ability for their DNA cargos from nonspecific intracellular interactions. Thus, this chapter focuses on the protection ability SWNTs have endowed to their DNA cargos, while introducing other benefits SWNTs br ing to DNA probes for their applications in intracellular mRNA monitoring. Bioanalytical and biomedical applications to cancer cells, particularly those which involve probe delivery for intracellular gene monitoring and targeted drug delivery, depend upon uninhibited transport of DNA, RNA, or drug molecules into living cells. However, some cargos, such as DNA, are easily degraded by cellular enzymes or digested by cellular nucleases. This problem is compounded by the fact that most delivery systems take se veral hours to transport cargos into cells ; t herefore, a delivery system which can provide protection for DNA cargos during prolonged transport would be useful. To this end, inorganic nanomaterials, including nanoparticles, nanotubes, and nanowires, have e xhibited promising physical properties which make them useful as molecular transporters [142,181189] To date, however, only a few nanomaterials, such as silica nanoparticles [181] silica nanotubes [187] and gold nanoparticles [94] offer viabl e protection properties. Aside from these, the most promising of all may be single -walled carbon nanotubes (SWNTs) which have been shown to shuttle various types of

PAGE 108

108 cargos into a wide range of cell types. These include the biologically and medically more relevant T cells and primary cells, which are difficult to transfect by traditional delivery methods [190,191] Therefore, this research investigates whether SWNTs can, additi onally, provide protective properties similar to silica or gold nanoparticles, thus ultimately shielding bound DNA sequences from cleavage during in vivo cellular delivery. By evaluating biostabilities using DNA molecular beacon as the model system, other benefits which this SWNT modification method endows to DNA p robe are investigated as well Experimental Section Materials and Instruments The sequences of DNA and RNA oligonucleotides prepared are listed in Table 4 1 DNA synthesis reagents were purchased from Glen Research (Sterling, VA). The SWNTs were purchased from Unidym, Inc. with <5 wt % ash content (CAS number: 7782 42 5). An ABI3400 DNA/RNA synthesizer (Applied Biosystmes, Foster City, CA) was used for all MB probes and DNA target preparation. A Pr oStar HPLC (Varian, Walnut Creek, CA) with a C18 column 4.6 mm) from Alltech (Deerfield, IL) was used for probe purification. A Cary Bio 300 UV spectrometer (Varian, Walnut Creek, CA) was used to measure absorbance for probe quantita tion. Fluorescence measurements were performed on a FluorologTau 3 spectrofluorometer (Jobin Yvon, Inc., Edison, NJ). Cell images were conducted with a confocal microscope setup consisting of an Olympus IX 81 inverted microscope with an Olympus FluoView 500 confocal scanning system. A 40 0.6 NA air objective was used. Synthesis of Molecular Probes All oligonucleotides were synthesized based on solid -state phosphoramidite chemistry at a Table 4 1 were synthesized with controlled -pore glass columns with a 3 Black Hole Quencher 2 molecule (BHQ2) covalently linked to the CPG

PAGE 109

109 substrate. The complete MB sequences were then deprotected in concentrated ammonia hydroxid e at room temperature overnight and further purified with reverse phase high-pressure liquid chromatography (HPLC) on a C18 column with a linear elution gradient with TEAA (triethylammonium acetate) in acetonitrile changing from 20 to 70% over a 30 min per iod. The collection from the first HPLC separation was then vaccuum -dried before the second round of HPLC. The HPLC was performed on a ProStar HPLC Station (Varian, CA) equipped with a fluorescent and a photodiode array detector. Table 4 1. Probes and Oligonucleotides Used in This Work name Sequence MnSOD probe 5 TTTTTTTTTTTTTTTTTTTT(CH2CH2O) 36 Cy3 CGAGCCAGTTACATTCTCCCAGTTGATTGCTCGG R andom DNA pro be 5 Cy3 CCTAGCTCTAAATCACTATGGTCGCGCTAGG BHQ2 MnSOD cDNA 5 AATCAACTGGGAGAATGTAACTG GT 5 GTGTGTGTGTGTGTGTGTGTGTGTGTGTGT 3 Synthesis of GT/SWNT Because of radioactive safety concerns and laboratory facility limitations, the SWNTs were cut befor e complexing with radioisotope labeled GT sequence. The SWNTs were treated with a strong acid mixture (nitric acid/sulfic acid = 3:1) and sonicated for 24 h. After washing with 32P a t room temperature and rocked for 24 h. The resulting complex was directly used for the digestion test. Synthesis of MnSOD P robe/SWNTs Since neutral SWNTs are the popular form for cellular application, we wanted to investigate its protection ability during cellular delivery. The SWNTs were ultrasonicated by sonic dismembrator (Fisher Sc ientific, Model 100) for 1 h. Then about 200 mg/L SWNT was The mixture was sonicated for another 45 min to 1 hour. Afterwards, the probe/nanotube solution was centrifuged at 22 000 g for 6 h. The

PAGE 110

110 pellet comprising impurities and aggregates of nanotubes at the bottom of the centrifuge tube was discarded, and the supernatant was collected and ultrac entrifuged for another 6 h at 22 000 g The supernatant is the MnSOD probe/SWNTs, which turned out to be soluble. After dialysis, the comple x was stored at 4 C. The solubilized SWNTs are not well -dispersed individual nanotubes, but a mixture of nanotube bundles and individual nanotubes Cellular Experimental Procedures MDA -MB 231 cells (ATCC, HTB 26) were cultured in Leibovitzs L 15 medium w ith 2 mM l -glutamine supplemented with 10% fetal bovine serum (all reagents from Invitrogen). Cells were plated into chambered coverslides 1 day before the experiments so that cells would be about 90% confluence during the experiments. The concentrated MnS OD probe/SWNTs were added to each well at a final concentration of about 25 mg/L. The incubations were carried out at 37 C air atmosphere for 12 h. After incubation, the cell medium was decanted from the well, and the cells were washed thoroughly. To stim ulate MnSOD mRNA expression, cells were E. coli serotype 055:B5 (Sigma) for 4 h prior to cellular imaging. The control experiments were conducted under the same conditions, but without LPS stimulation. Results and Discussion P rotection in GT/SWNT To investigate the protective properties of SWNTs, a 30-base -paired single -stranded DNA (ssDNA) oligonucleotide with repeating G This sequence has been demonstrated to wrap onto the SWNT surface [192,193] Radioisotopic labeling and denaturing PAGE gel were then used to monitor the digestion of DNA by DNase I, which can nonspecifically cleave ssDNA and dsDNA. The efficacy of the method was first tested to determine whe ther SWNTs could affect the mobility of bound DNA. To accomplish

PAGE 111

111 this, both GT/SWNT complex and free DNA were treated with DNase I, and aliquots were collected at 5, 15, and 60 min time points. Aliquots were heated at 95 C for 5 min before running the den aturing PAGE gel. As shown in Figure 4 1 the mobility of both GT and GT/SWNT sequences remains the same (lane s 1 and 2), which demonstrates that SWNTs do not inherently affect the mobility of their bound DNA. Having determined the viability of the method for monitoring digestion in the GT/SWNT complex cases, the same model and protocol were used to determine the effect of cleavage. Accordingly, the results of the cleavage assay show increased digestion of GT as a function of time, but no digestion for GT/SWNT, even after 60 min of digestion ( F igure 4 1 lanes 3 demonstrate that GT DNA is protected from DNase I cleavage when it is in complex with the SWNTs. Although protection from enzymatic cleavage is a useful property for DNA delivery into cells, it is also important that DNA probes be functional when in complex with SWNTs. Figure 4 1. Polyacrylamide gel electrophoresis (PAGE) of free GT sequence and GT/SWNT complexes by 15% gel. Lanes 1 and 2 are the intact GT sequence and GT/SWNT complexes; lanes 3 and 1 h; lanes 6 15 min, and 1 h; lane 9 is the 10 base pair DNA marker. The gel band intensity for each lane is plotted in the upper left corner graph.

PAGE 112

112 Design and Characterization of MnSOD/SWNTs Figure 4 2 (A) Possible interaction between MnSOD probes, the SWNTs, and target mRNA; (B) TEM image of MnSOD probe/SWNTs (the scale bar represents 100 nm); (C) absorption spectrum of the probe in H2O. In order to demonstrate that SWNTs can protect functional DNA probes from enzymatic cleavage, a specific DNA probe was first modified and complexed with the SWNTs (possible interaction is shown in Figure 4 2 A). This DNA probe, which showed increased fluorescence upon binding manganese superoxide dismutase (MnSOD) mRNA [179] was further modified with polyT [193] to increase binding to the SWNT. In the absence of target cDNA (cDNA), our previous study [194] demonstrated that the designed probe forms a hairpin structure and adsorbs onto the SWNTs at room temperature, resulting in low signal intensity from the MnSOD probe/SWNTs. Th is low signal intensity was mainly a consequence of quenching from the Black Hole Quencher 2 (BHQ2), but it could have also been the result of quenching from the SWNTs

PAGE 113

113 [195] On the other hand, in the presence of target cDNA, the hybridization event separated the fluorophore from the quencher, or SWNTs, thus causing the signal enhancement shown in Fi gure 4 3 This demonstrates that the MnSOD probe/SWNTs could still respond to the target cDNA and that, consequently, the bound DNA was still functional. Figure 4 3 Emission flu orescence spectrum of MnSOD probe/SWNTs in the presence and absence of 10 -fold excess target cDNA. Protection Test in Buffer Since the functional sensitivity of the MnSOD probe/SWNTs could be retained, we next tested its ability to resist nuclease cleavage in pure buffer. First, a fluorescencebased assay was performed as follows. One unit of DNase I endonuclease was added to separate solutions of 50 nM free MnSOD probes and probe/SWNTs. In this assay, if the probe is digested by DNase I, the fluorescence i ntensity will increase because the donor dye molecule will separate from the quenchers. Experiments for both free MnSOD probes and MnSOD probe/SWNTs were

PAGE 114

114 performed under identical conditions. As shown in Figure 4 4 left, probe/SWNTs showed little degradation and, correspondingly, little fluorescence, while the free MnSOD probes showed a significant fluorescence in crease, indicating increased degradation. These preliminary results therefore demonstrate that MnSOD probe/SWNTs could be immune to cleavage by DNase I. Next, the interactions of free MnSOD probes and probe/SWNTs with single -stranded DNA binding protein (S SB) were investigated. This was necessary because, intracellularly, DNA probes are subject to nonspecific binding by proteins, which can produce false positive signals. One such protein is the ubiquitous single -stranded DNA binding protein [82]. As shown in Figure 3 4 right, free probes had a 6-fold increase of fluorescent signal compared to MnSOD probe/SWNTs when incubated with SSB. Since the probe/SWNT complex showed little response to excess SSB, these results demonstrate that it may well be protected fr om this form of interference during intracellular experiments. Figure 4 4 (Left) Fluorescence signal enhancements of both free MnSOD probes and MnSOD probe/SWNTs upon the addition of 1U DNase I. (Right) Fluorescence signal enhancements of both probes upon the addition of SSB. Final concentration ratio of probe/SSB = 1:5.

PAGE 115

115 Protection Test in a Cellular Environment Figure 4 5 Bright field and fluorescent images of MnSOD probes/SWNT complexes inside MDA -MB 231 cells, (A) without LPS stimulation and (B) with LPS stimulation. All In the context of their promising DNA protective properties, as demonstrated by these two in vitro experiments, probe/SWNT complexes show improved biostability when compared to the fr ee probe. However, to further confirm these protection properties, the natural ability of SWNTs to be internalized was used to test the probe/SWNTs in a cellular environment. In this assay, the probe/SWNTs are delivered by simply incubating the complexes w ith MDA -MB 231 breast carcinoma cells. Under normal culture conditions, this cell line has a low MnSOD expression level; however, when exposed to lipopolysaccharide (LPS), an inflammatory mediator involved in Escherichia coli bacterial sepsis, MnSOD mRNA expression levels increase substantially [179,196] As a result of the resistance of probe/SWNTs to enzymatic cleavage and no nspecific opening, the probe/SWNTs complexes should show lower fluorescence background compared to

PAGE 116

116 the free probes before the cells are stimulated with LPS. Following LPS stimulation, if the probe/SWNTs are still functional after long intracellular incubation times, hybridization with target mRNA sequences will produce a fluorescent signal that can be detected by confocal microscopy. Figure 4 6 Bright field and fluorescent images of free MnSOD probes inside MDA -MB 231 cells, (A) without LPS stimulation and (B) with LPS stimulation. All the scale bars Figure 4 7 Fluorescence image of one single cell labeled by DAPI (or 4`,6 -diamidino 2 phenylindole, a nucleus indicator, encoded in blue) and MnSOD MB/SWNTs (encoded in re d). It shows MB/SWNTs stay outside the nucleus.

PAGE 117

117 and centrifuged. The pellet comprising the nanotube impurities and aggregates was discarded, and the supernatant was colle cted as the probe/SWNTs, which turned out to be soluble. The probe/SWNTs were then incubated with MDA -MB 231 breast carcinoma cells at a final concentration of about 25 mg/L for 12 h. Subsequently, the cells were washed and treated with or LPS for another 4 h before imaging. As shown in Figure 4 -5 a high fluorescence signal was observed for most o f the cells after LPS stimulation, which indicated the up -regulated MnSOD mRNA expression. Control experiments without LPS stimulation were carried out under the same conditions, and little fluorescence was observed compared to the LPS -stimulated cells. Th is experiment was repeated, and it was further demonstrated that probe/SWNT complexes produce a few false positive signals. For comparison, free MnSOD probes were incubated with cells under the same conditions, and low fluorescence signal was observed with and without LPS stimulation ( Figure 4 6 ). The background for the free probe without LPS stimulation was highe r than that of the complexes without LPS stimulation. This might have been the result of digestion and the nonspecific opening of very few MnSOD probes that were inefficiently self delivered into the cells after a long incubation time, leading to a false p ositive signal. It might have also been caused by some probes being trapped between the cells. If these probes had been digested or disrupted, they would have had no ability to detect the different gene expression levels, causing the same fluorescence intensity to be observed with LPS stimulation. To confirm this explanation, another free random DNA probe with no complement inside the cells was tested under the same conditions, and results identical to those of the free MnSOD were obtained, as expected. Thu s, the single -walled carbon nanotubes do protect probes from digestion and disruption which ensures that the DNA probes can

PAGE 118

118 successfully distinguish different gene expression levels free from the types of interference examined here Possible Mechanisms for the Protection These two sets of experiments, both in buffer and in cell culture, have demonstrated improved biostability of probe/SWNTs over the free probes. Specifically, the in vitro experiments showed that probe/SWNTs have much better resistance to nu clease digestion and nucleic acid binding protein disruption. Furthermore, the intracellular experiments showed that probe/SWNTs complexes are functional, even after a total incubation of 16 h. In contrast, free DNA degrades after only 15 lular environment [81] As a consequence of reduced nonspecific opening events, lower background improved the detection sensitivity of probe/SWNT complexes. Therefore, this investigation proves that SWNTs have the ability to protect bound DNA cargos from enzymatic cleavage and DNA binding proteins both during and after delivery into cells. As noted above, different nanomaterials exhibit various degrees of DNA protection, but the mechanisms of protection are not yet well understood. For example, silica nanoparticles exhibit protection of plasmid DNA It has been proposed that the positive charges on the silica nanoparticle surface can exclude Mg2+ and that the DNA conformational change that results from binding onto this nanoparticle surface prevents digestion [181] In the case of silica nanotubes, the authors hypothesized that the nanotubes act as a physical shield that protects the loaded materials from environm ental damage [187] To dat e, no reasoning has been provided to explain the efficacy of gold nanoparticles [94] The protective properties of SWNTs, on the other hand, may be explained in several ways. First, the probes could be embedded inside small bundles of nanotubes such that the nucleases/proteins cannot physically access the DNA. Second, although the surface of the SWNT has been modified with hydrophilic groups fr om the

PAGE 119

119 DNA probes, some hydrophobic regions may still remain exposed and cause inhibitory effects on proteins that come into close proximity. Finally, the interaction between DNA and SWNTs [193] may cause the secondary structure of the DNA to be unrecognizable to enzyme bin ding pockets. Obviously, further investigation is required to address these causal issues to conclusively determine the mechanisms underlying the protective properties of probe/SWNTs complexes. Oth er Benefits t his SWNT Modification Brings to DNA Molecular Probes Besides biostability, SWNTs modification to DNA molecular probes brought other benefits for intracellular mRNA monitoring as well. As indicated in Figure 4 5, almosted all the cells show ed strong fluorescence signals after four hours drug stimulati on, which indicated that this SWNT modification method provides an efficient high throughput delivery of MB into the cells. This definitely avoids the need of traditional tedious microinjection method or costy newly developed peptide conjugation. In addit ion, DNA probes usually spontaneously accumulate inside the nucleus after injection, which greatly hinders the sensitive detection of intracellular mRNA in the cytoplasm in living cells. Howver, this MB/SWNT method interestingly solved this problem. As dem onstrated in Figure 4 7, the fluorescence signals from MB/SWNTs were not co localized with the signals from DAPI (a traditional nucleus indicator); this indicated that MB/SWNTs prevent the nucleus accumulation, thus they are able to stay in the cytoplasm. The possible reason should be ascribed to the big size of SWNT and rather small pores on the nucleus membrane [191] Due to the immunity to nucleus accumulation the interference from nucleus background signal is dramatically decreased, resulting rather sensitive detection of mRNA in the cytoplasm. Conclusions In summary, when bound to SWNTs, DNA probes are protected from enzymatic cleavage and interference from nucleic acid binding proteins. These protective properties are particularly

PAGE 120

120 important for applications in which DNA probes are used for intracellular measurements. Our study shows that a SWNT -modified DNA probe, which targets a specific mRNA inside living cells, has increas ed self -delivery capability and intracellular biostability to nucleus accumulation when compared to free DNA probes. Therefore, this novel material provides significant advantages for basic genomic studies in which DNA probes are used to monitor intracellular levels of molecules and ions. Additionally, for cytoplasmic gene detection by DNA probes, nucleus sequestration is a major cause of reduced sensitivity [197] The DNA/SWNT complexes, however, stay within the cytoplasm, enabling cytoplasmic mRNAs to be detected and imaged. Furthermore, DNA/SWNT complexes should prove useful as therapeutic agents since they exhibit excellent self delivery properties t hat could allow DNA -based drugs to exert their therapeutic presence for longer time before being degraded by cells.

PAGE 121

121 CHAPTER 5 SUMMARY AND FUTURE WORK Engineering Nucleic Acid Probes/Nanomaterials for Cancer Studies The high risk of cancer has compelle d researchers from various backgrounds to direct their efforts toward cancer research The major cancer studies include cancer diagnosis cancer treatment and intracellular biomolecular studies. As ideal building block s multifunctional nucleic acid s ha ve been investigated in this dissertation as a means of designing various molecular probes and probe -nanomaterial conjugates for cancer studies In C hapter T wo in order to enhance the binding capability of otherwise low affinity aptamers at physiological te mperature, an aptamer -micelle was constructed by attaching a lipid tail on the end of the aptamer. Enhanced specific recognition ability is directly bui l t into the nanostructures. Interestingly, the attachment of the lipid tail additionally endows the apta mer micelles with internalization pathways, thus allowing cell permeability for drug delivery applications. The aptamer -micelle demonstrates several other beneficial properti es, including extremely low off rate once bound to target cells, rapid recognitio n ablity with enhanced sensitivity, low critical micelle concentration values, no cytotoxicity As noted above, the potential of dual drug delivery pathways is created by encapsulating the drug molecules inside the aptamer -micelle or by directly conjugatin g the drug onto the other end of an aptamer via an acid labile linker. Sensitive and specific trace cell detection in the human whole blood sample indicates the promising application of this aptamer -micelle strategy in cancer diagnosis. Furthermore we mimicked a tumor site in the blood stream by immobilizing tumor cells onto the surface of a flow channel device. Flushing the aptamer -micelles through the channel demonstrated their selective recognition ability under flow circulation in a human whole blood s ample. T he aptamer -micelles show great dynamic specificity in flow channel systems mimicing

PAGE 122

122 drug delivery in the blood system. When applying the same lipid tail modification strategy to the other low affinity aptamers, a similarly enhanced binding capabili ty was observed, indicating that this modification strategy can be a universal method to promote the utilization of aptamers in living systems. Although the exact underlying mechanism is yet to be understood fluid nature of the micelle was proposed to be a possible explanation to this interesting phenomenon based on our preliminary investigations Overall, our DNA aptamer -micelle assembly has shown high potential for cancer cell recognition and for in vivo drug delivery applications in the blood stream. In Chapter T hree to develop a molecular tool for longterm real -time intracellular mRNA monitoring inside the living cells, locked nucleic acid s (LNA s ) were used to engineer novel molecular beacons. A strandard design strategy was proposed and complemented to design several LNA and DNA chimeric probes, which demonstrated excellent nuclease immunity and avoidance of nonspecific DNA binding protein disruption, as well as reasonable hybridization kinetics. Besides buffer system studies, the new beacons were tes ted with MDA -MB 231 brea s t cancer cells and used to monitor changes in the expression of MnSOD mRNA upon LPS stimulation for up to 5 hours. After 24 hours inside living cells, the designed MBs were still able to response to their targets, demonstrating a g reatly enhanced stability. Considering the fact that DNA-MBs degrade after 1545 minutes in the cellular environment, the outstanding biostability of the newly designed MBs, while remaining reasonable hybridization kinetics, extends their application to ma ny in vivo studies and intracellular monitoring where stability of the molecular probe is needed for a protracted period of time. Chapter Four investigated the vulnerability of MBs to nuclease digestion and nonspecific disruption. However, when bound to s ingle -walled carbon nanotubes (SWNTs), it was found that DNA probes are protected from enzymatic cleavage and interference from nucleic acid

PAGE 123

123 binding proteins. These protective properties are particularly important for applications in which DNA probes are u sed for intracellular measurements. With the use of SWNTs, an excellent nanocarrier for a variety of cells, DNA -MBs can enter the cells efficiently in a high throughput manner. After SWNT modification, the DNA -MBs were found to retain their functional resp onse to the target, either outside or inside the cells. Without the target, the fluorophore from MB was quenched by both the flanked quencher and SWNT. Upon hybridization with its target, the MB modified on the SWNT surface changed its conformation, result ing in the restoration of fluorescence signal. Interestingly, as noted above, SWNTs were demonstrated to provide protection to its DNA MB cargos from nuclease digestion and nonspecific disruption with DNA binding proteins during cellular delivery. After ab out 16 hours of incubation with cells, the SWNT/MB complex was still able to detect the stimulated MnSOD mRNA expression upon the LPS stimulation. In addition, because of the large size of SWNTs, SWNT/MB complexes avoid the probes nucleus accumulation and further enhance their detection sensitivity Future Directions Aptamer -M icelle for T argeted G ene T herapy Modulation of cancer related genes has become a popular cancer treatment. To deliver therapeutic agents efficiently across the plasma membrane of th e cells in vivo various delivery systems have been developed, including cationic lipids, viral or nonviral vectors, nanoparticles [56] or direct modification of the therapeutic oligonucleotides (e.g. chemical, prot e in lipid ) [198200] However, most of the approaches can only deliver therapeutic agents to the cells nonspecifically. T he ideal delive ry system should be able to deliver therapeutic agents to t arget cancer cells in a specific manner; because, i n this way, the required dosage and quantity of therapeutic agents for the treatment can be greatly reduced, as well as the cost and the possibili ty of the side effects

PAGE 124

124 Figure 5 1 Scheme of SPIO NP doped cross linked aptamer -micelle for anti -gene drug delivery (including miRNA antogamir and siRNA or antisense). Figure 5 2 Working principle of the SPIO NP -doped cross linked aptamer -micelle for magnatic narvigated therapy. To realize targeted gene therapy, a few approaches have been attempted. For example, iron binding protein transferrin has been used to target colloids composed of siRNA and

PAGE 125

125 cyclodextrincontaining polycations and to trans fer them to receptor -expressing tumor cells [201] Antibodies that bind cell -type specific cell surf ace receptors were fused with protamine and used for tissue -specific delivery of siRNA [202] More recently, two independent groups have reported an approach that simultaneously executes these two strategies; i.e., using an RNA aptamer (PSMA aptamer) conjugated with siRNA for targeted delivery [203,204] One group directly appli ed an aptamer -siRNA chimeric RNA [203] while the other group utilized streptavidin to assemble a biotin -m odified aptamer and siRNA complex [204] These reagents were reported to inhibit tumor growth specifically and mediate tumor regression in a xenograft model of prostat e cancer. The above results demonstrated the promising applications of aptamer s in targeted gene therapy. However, the ratios between the therapeutic agent (siRNA) and the targeting ligand (aptamer) in the above two cases were limited to 1 or at most 3. T o maximize the therapeutic effect, it is necessary to further increase the loading efficiency of therapeutic agents. To this end nanotechnology is envisioned to be a promising approach [205] Chapter T wo describes an aptamer -micelle built from an amphiphilic unit (a hydrophilic DNA plus a hydrophobic lipid tail). Results demonstrated that both a homogeneous aptamer micelle and a heterogeneous aptamer -micelle can be made by mixing two different types of DNA-lipid. By simply replacing one DNA lipid with a therapeutic oligonucleotide lipid (such as miRNA antagomir lipid, siRNA -lipid, antisense lipid or CpG -lipid ), a micelle which is composed of aptamer and therapeutic agents can be made. Based on the resu l ts shown in Figure 2 18, even with 9% density of aptamer, the heterogeneous micelle can still bind target cancer cells specifically. This indicates that by this approach, one aptamer sequence can deliver at least 10 therapeutic oligonucleotide sequences sp ecifically into the cells. By s imply cross linking the

PAGE 126

126 micelle [206,207] it is expected that the therapeutic oligonucleotides (TO) integrated into the nanoparticle can be delivered into the specific cancer cells and then released in the cytop lasm to modulate the target mRNA. Furthermore, since a superparamagnetic iron oxide (SPIO) nanoparticle is usually coated with one layer of hydrophobic compounds [208] it would be easy to dope such hydrophobic nanoparticle inside the aptamer -micelle by the precipitation and membrane dialysis me thod [164] to cr eate an aptamer/therapeutic oligonucleotide micelle (A/TO micelle). It is expected that this SPIO -A/TO micelle would then be a promising targeted therapy vehicle in vivo After injection into the blood stream, the S P IO -A/TO micelle can be navigated to the tumor site facilitated by an external magnetic field [209] Around the tumor mass, the aptamer then directs the whole particle to enter the specif ic cancer cells. On one hand, once inside the target cancer cells, the TO can modulate the tumor related mRNA ; on the other hand, by applying an AC magnetic field of sufficient strength and frequency, the encapsulated iron oxide nanoparticles can function as a hyperthermia agent to release heat around the diseased tissue By this combinational therapy, the therapeutic index of this micelle can be greatly enhanced, while leaving the surrounding healthy tissue intact. Aptamer -B ased D rug D elivery S ystems for S elective D eliverer of D rugs to M ultidrug R esistant C ancer C ells Two main obstacles to successful cancer chemotherapy are selective targeting and multidrug resistance (MDR). Aptamers, one of the most popular molecular recognition ligands, have been utilize d in various carriers for delivering chemotherapy drug molecules to target cancer cells specifically [67] However, un til now, no aptamer -based delivery vehicle has been demonstrated to overcome MDR while retaining targeted therapy. Traditional methods used to overcome MDR are still limited to the co administration of inhibitors of P glycoprotein [210] which has been reported to be high ly associated with the development of MDR in cancer cells.

PAGE 127

127 Here, we hypothesize that an aptamer based drug delivery system could be used as an alternative approach to overcome MDR, based on the fact that an aptamer based delivery system can penetrate targe t cells by receptor -mediated endocytosis, which allows it to bypass the P glycoprotein To test the hypothesis, an aptamer -drug conjugate will be synthesized. To investigate whether the nanoparticle construction can further enhance the killing efficiency t o drug resistant cell lines, an aptamer -micelle drug carrier will be synthesized for comparison. In both case s doxorubicin will be the conjugated drug and an acid labile linkage will be inserted between the drug and the aptamer sequence. The result s in Ch apter T wo demonstrated that the aptamer -micelle s displays about 700-fold increase in binding affinity, which indicates the greatly improved drug loading efficiency in the micelle system thus enhancing the therapeutic index offered by the aptamer -micelle a s a drug carrier. Aptamer -M icelle as a S ensitive Biomarker MRI Sensor Chapter Two demonstrates how aptamer -micelles allow sensitive cancer detection. Such sensitivity is achieved because just one aptamer recognition event draws the entire micelle particle containing thousands of flouorescence dyes to the target cells and will do so in a highly selective manner. By simply replacing the fluorescence dye with a Gadolilium complex or a 19F containing molecule [211] aptamer -micelles can function as sensitive MRI sensors. Then, by utilizing automated oligonucleotide synthesis and ready modification, the required replacement will be easily complemented SWNT/Aptamer C omplex for Targeted Therapy Chapter F our describes a way to attach nucleic acid molecular beacons onto the surface of SWNT. The attached nucleic acid probe can still respond to its target mRNA, resulting in increased fluorescence signal. By simply replacing the nucleic acid pr obe with a nucleic acid aptamer, a SWNT/aptamer complex can be made. Again, by virtue of the dedicated design of the

PAGE 128

128 linker inserted between the polyT sequence and aptamer sequence, the aptamer is expected to be able to interact with its target protein, ju st like molecular beacons discussed in Chapter Four. Therefore, this SWNT/aptamer can become a specific cancer targeting delivery vehicle. SWNT s ha ve been reported to ablate tumor s by releasing heat after it absorbs energy from near infrared (NIR) light [191,212] Thus, with the assistance of an aptamer, the SWNT/aptamer can be selectively delivered into the target cancer cells. By using similar NIR triggering, the targeted tumor cell should be killed. By simple physical hydrophobic stacking a chemotherapy drug, doxorubicin, can be loaded onto t he SWNT [213] This combination chemotherapy will potent ially increase the killing efficiency while doing no harm to healthy tissue.

PAGE 129

129 LIST OF REFERENCES 1. Jemal A, Siegel R, Ward E, Hao YP, Xu JQ, Thun MJ: Cancer Statistics, 2009 Ca -a Cancer Journal for Clinicians 2009, 59:225 249. 2. Zaridze DG: Molecular epidemiology of cancer Biochemistry -Moscow 2008, 73:532542. 3. Watson JD, Crick FH: Molecular structure of nucleic acids; a structure for deoxyribose nucleic acid Nature 1953, 171:737 738. 4. Zhao XL, Yu YT: Detection and quantitation of RNA base modi fications Rna -a Publication of the Rna Society 2004, 10:9961002. 5. Castanotto D, Rossi JJ: The promises and pitfalls of RNA interference -based therapeutics Nature 2009, 457:426 433. 6. Chi SW, Zang JB, Mele A, Darnell RB: Argonaute HITS -CLIP decodes microRNAmRNA interaction maps Nature 2009, 460:479 486. 7. Krieg AM: Mechanisms and applications of immune stimulatory CpG oligodeoxynucleotides Biochimica Et Biophysica Acta -Gene Structure and Expression 1999, 1489:107 116. 8. Krieg AM, Kline JN: Imm une effects and therapeutic applications of CpG motifs in bacterial DNA Immunopharmacology 2000, 48:303 305. 9. Sioud M, Iversen PO: Ribozymes, DNAzymes and small interfering RNAs as therapeutics Current Drug Targets 2005, 6 :647653. 10. Schubert S, Kurreck J: Ribozyme and deoxyribozyme -strategies for medical applications Current Drug Targets 2004, 5 :667681. 11. O'Connell JB, Maggard MA, Ko CY: Colon cancer survival rates with the new American Joint Committee on cancer sixth edition staging Journal of the National Cancer Institute 2004, 96:14201425. 12. Eisen MB, Spellman PT, Brown PO, Botstein D: Cluster analysis and display of genome wide expression patterns Proceedings of the National Academy of Sciences of the United States of America 1998, 9 5 :1486314868. 13. Hughes TR, Marton MJ, Jones AR, Roberts CJ, Stoughton R, Armour CD, Bennett HA, Coffey E, Dai HY, He YDD, et al.: Functional discovery via a compendium of expression profiles Cell 2000, 102:109126. 14. Alizadeh AA, Eisen MB, Davis RE Ma C, Lossos IS, Rosenwald A, Boldrick JG, Sabet H, Tran T, Yu X, et al.: Distinct types of diffuse large B -cell lymphoma identified by gene expression profiling Nature 2000, 403:503511.

PAGE 130

130 15. Golub TR, Slonim DK, Tamayo P, Huard C, Gaasenbeek M, Mesiro v JP, Coller H, Loh ML, Downing JR, Caligiuri MA, et al.: Molecular classification of cancer: Class discovery and class prediction by gene expression monitoring Science 1999, 286:531 537. 16 Sorlie T, Perou CM, Tibshirani R, Aas T, Geisler S, Johnsen H, H astie T, Eisen MB, van de Rijn M, Jeffrey SS, et al.: Gene expression patterns of breast carcinomas distinguish tumor subclasses with clinical implications Proceedings of the National Academy of Sciences of the United States of America 2001, 98:108691087 4. 17. Garber ME, Troyanskaya OG, Schluens K, Petersen S, Thaesler Z, Pacyna -Gengelbach M, van de Rijn M, Rosen GD, Perou CM, Whyte RI, et al.: Diversity of gene expression in adenocarcinoma of the lung Proceedings of the National Academy of Sciences of the United States of America 2001, 98:1378413789. 18. Koch I, Slotta Huspenina J, Hollweckt R, Anastasov N, Hofler H, Quintanilla -Martinez L, Fend F: Real -time quantitative RTPCR shows variable, assay -dependent sensitivity to formalin fixation: Implicat ions for direct comparison of transcript levels in paraffin -embedded tissues Diagnostic Molecular Pathology 2006, 15:149156. 19. Tuerk C, Gold L: Systematic Evolution of Ligands by Exponential Enrichment Rna Ligands to Bacteriophage -T4 DNA Polymerase Science 1990, 249 :505 510. 20. Ellington AD, Szostak JW: Invitro Selection of R NA Molecules That Bind Specific Ligands Nature 1990, 346:818 822. 21. Shangguan D, Li Y, Tang Z, Cao ZC, Chen HW, Mallikaratchy P, Sefah K, Yang CJ, Tan W: From the Cover: A ptamers evolved from live cells as effective molecular probes for cancer study Proceedings of the National Academy of Sciences of the United States of America 2006, 103:11838 11843. 22. Proske D, Blank M, Buhmann R, Resch A: Aptamers basic research, dr ug development, and clinical applications Applied Microbiology and Biotechnology 2005, 69:367374. 23. Missailidis S, Perkins A: Aptamers as novel radiopharmaceuticals: Their applications and future prospects in diagnosis and therapy Cancer Biotherapy a nd Radiopharmaceuticals 2007, 22:453 468. 24. Perkins AC, Missailidis S: Radiolabelled aptamers for tumour imaging and therapy. Quarterly Journal of Nuclear Medicine and Molecular Imaging 2007, 51:292 296. 25. Drolet DW, MoonMcDermott L, Romig TS: An enz yme -linked oligonucleotide assay Nature Biotechnology 1996, 14:10211025.

PAGE 131

131 26. Vivekananda J, Kiel JL: Anti Francisella tularensis DNA aptamers detect tularemia antigen from different subspecies by aptamer-linked immobilized sorbent assay Laboratory Inve stigation 2006, 86:610 618. 27. Blank M, Weinschenk T, Priemer M, Schluesener H: Systematic evolution of a DNA aptamer binding to rat brain tumor microvessels Selective targeting of endothelial regulatory protein pigpen. Journal of Biological Chemistry 2001, 276:1646416468. 28. Li W, Yang XH, Wang KM, Tan WH, He Y, Guo QP, Tang HX, Liu JB: Real -time imaging of protein internalization using aptamer conjugates Analytical Chemistry 2008, 80:50025008. 29. Bock C, Coleman M, Collins B, Davis J, Foulds G, Gold L, Greef C, Heil J, Heilig JS, Hicke B, et al.: Photoaptamer arrays applied to multiplexed proteomic analysis Proteomics 2004, 4 :609618. 30. Yang CJ, Jockusch S, Vicens M, Turro NJ, Tan WH: Light -switching excimer probes for rapid protein monitori ng in complex biological fluids Proceedings of the National Academy of Sciences of the United States of America 2005, 102:17278 17283. 31. Shangguan D, Li Y, Tang ZW, Cao ZHC, Chen HW, Mallikaratchy P, Sefah K, Yang CYJ, Tan WH: Aptamers evolved from liv e cells as effective molecular probes for cancer study Proceedings of the National Academy of Sciences of the United States of America 2006, 103:1183811843. 32. Tang ZW, Shangguan D, Wang KM, Shi H, Sefah K, Mallikratchy P, Chen HW, Li Y, Tan WH: Select ion of aptamers for molecular recognition and characterization of cancer cells Analytical Chemistry 2007, 79:49004907. 33. Sefah K, Tang ZW, Shangguan DH, Chen H, Lopez Colon D, Li Y, Parekh P, Martin J, Meng L, Phillips JA, et al.: Molecular recognitio n of acute myeloid leukemia using aptamers Leukemia 2009, 23:235244. 34. Tang ZW, Parekh P, Turner P, Moyer RW, Tan WH: Generating Aptamers for Recognition of Virus -Infected Cells Clinical Chemistry 2009, 55:813 822. 35. Shangguan DH, Cao ZHC, Li Y, T an WH: Aptamers evolved from cultured cancer cells reveal molecular differences of cancer cells in patient samples Clinical Chemistry 2007, 53:11531155. 36. Huang YF, Chang HT, Tan WH: Cancer cell targeting using multiple aptamers conjugated on nanorods Analytical Chemistry 2008, 80:567572. 37. Medley CD, Smith JE, Tang Z, Wu Y, Bamrungsap S, Tan WH: Gold nanoparticle based colorimetric assay for the direct detection of cancerous cells Analytical Chemistry 2008, 80:10671072.

PAGE 132

132 38. Herr JK, Smith JE, Medley CD, Shangguan DH, Tan WH: Aptamer -conjugated nanoparticles for selective collection and detection of cancer cells Analytical Chemistry 2006, 78:29182924. 39. Phillips JA, Xu Y, Xia Z, Fan ZH, Tan WH: Enrichment of Cancer Cells Using Aptamers Immo bilized on a Microfluidic Channel. Analytical Chemistry 2009, 81:10331039. 40. Nagrath S, Sequist LV, Maheswaran S, Bell DW, Irimia D, Ulkus L, Smith MR, Kwak EL, Digumarthy S, Muzikansky A, et al.: Isolation of rare circulating tumour cells in cancer pa tients by microchip technology Nature 2007, 450:1235U1210. 41. Rosenberg SA, Aebersold P, Cornetta K, Kasid A, Morgan RA, Moen R, Karson EM, Lotze MT, Yang JC, Topalian SL, et al.: Gene -Transfer into Humans Immunotherapy of Patients with Advanced Mela noma, Using Tumor -Infiltrating Lymphocytes Modified by Retroviral Gene Transduction New England Journal of Medicine 1990, 323:570 578. 42. Brannon Peppas L, Ghosn B, Roy K, Cornetta K: Encapsulation of nucleic acids and opportunities for cancer treatment Pharmaceutical Research 2007, 24:618 627. 43. Gleave ME, Monia BP: Antisense therapy for cancer. Nature Reviews Cancer 2005, 5 :468479. 44. El -Aneed A: Current strategies in cancer gene therapy European Journal of Pharmacology 2004, 498:1 8. 45. Nish itani MA, Sakai T, Kanayama HO, Himeno K, Kagawa S: Cytokine gene therapy for cancer with naked DNA Molecular Urology 2000, 4 :47 50. 46. Shi FS, Rakhmilevich AL, Heise CP, Oshikawa K, Sondel PM, Yang NS, Mahvi DM: Intratumoral injection of interleukin -12 plasmid DNA, either naked or in complex with cationic lipid, results in similar tumor regression in a murine model Molecular Cancer Therapeutics 2002, 1 :949957. 47. Barajas M, Mazzolini G, Schmitz V, Narvaiza I, Bilbao R, Genove G, Zabala M, Sangro B, Melero I, Qian C: Gene therapy of orthotopic hepatocellular carcinoma in rats using adenovirus coding for interleukin-12 (IL -12) Journal of Hepatology 2001, 34:221221. 48. Vattemi E, Claudio PP: Tumor suppressor genes as cancer therapeutics Drug News & Perspectives 2007, 20:511520. 49. Lu C, El Deiry W: Targeting p53 for enhanced radio and chemo -sensitivity Apoptosis 2009, 14:597606.

PAGE 133

133 50. Nemunaitis J, Swisher SG, Timmons T, Connors D, Mack M, Doerksen L, Weill D, Wait J, Lawrence DD, Kemp BL, et al.: Adenovirus mediated p53 gene transfer in sequence with cisplatin to tumors of patients with non-small -cell lung cancer. Journal of Clinical Oncology 2000, 18:609622. 51. Swisher SG, Roth JA, Komaki R, Gu J, Lee JJ, Hicks M, Ro JY, Hong WK, Merritt J A, Ahrar K, et al.: Induction of p53 -regulated genes and tumor regression in lung cancer patients after intratumoral delivery of adenoviral p53 (INGN 201) and radiation therapy. Clinical Cancer Research 2003, 9 :93 101. 52. Wilson JM: Gendicine: The first commercial gene therapy product Human Gene Therapy 2005, 16:10141014. 53. Nakata Y, Kim TK, Shetzline S, Gewirtz AM: Nucleic acid modulation of gene expression: Approaches for nucleic acid therapeutics against cancer Critical Reviews in Eukaryotic Gene Expression 2005, 15:163 182. 54. Stahel RA, Zangemeister -Wittke U: Antisense oligonucleotides for cancer therapy an overview Lung Cancer 2003, 41:S81 S88. 55. Dass CR, Choong PFM, Khachigian LM: DNAzyme technology and cancer therapy: cleave and let d ie Molecular Cancer Therapeutics 2008, 7 :243 251. 56. Anderson WF: Human gene therapy Nature 1998, 392:25 30. 57. Dollins CM, Nair S, Sullenger BA: Aptamers in immunotherapy Human Gene Therapy 2008, 19:443 450. 58. Lee JH, Canny MD, De Erkenez A, Kri lleke D, Ng YS, Shima DT, Pardi A, Jucker F: A therapeutic aptamer inhibits angiogenesis by specifically targeting the heparin binding domain of VEGF165 Proc Natl Acad Sci U S A 2005, 102:18902 -18907. 59. Fraunfelder FW: Pegaptanib for wet macular degeneration Drugs Today (Barc) 2005, 41:703709. 60. Bates PJ, Laber DA, Miller DM, Thomas SD, Trent JO: Discovery and development of the G -rich oligonucleotide AS1411 as a novel treatment for cancer. Experimental and Molecular Pathology 2009, 86:151 164. 61. Soundararajan S, Chen WW, Spicer EK, Courtenay Luck N, Fernandes DJ: The nucleolin targeting aptamer AS1411 destabilizes bcl -2 messenger RNA in human breast cancer cells Cancer Research 2008, 68:23582365. 62. Choi JH, Chen KH, Han JH, Chaffee AM, Stra no MS: DNA Aptamer -Passivated Nanocrystal Synthesis: A Facile Approach for Nanoparticle -Based Cancer Cell Growth Inhibition Small 2009, 5 :672675.

PAGE 134

134 63. Zhao ZL, Xu L, Shi XL, Tan WH, Fang XH, Shangguan DH: Recognition of subtype non-small cell lung cancer by DNA aptamers selected from living cells Analyst 2009, 134:18081814. 64. Chen HW, Medley CD, Sefah K, Shangguan D, Tang ZW, Meng L, Smith JE, Tan WH: Molecular recognition of small -cell lung cancer cells using aptamers Chemmedchem 2008, 3 :991 1001. 65. oshioka N, Wang L, Kishimoto K, Tsuji T, Hu G -f: A therapeutic target for prostate cancer based on angiogenin -stimulated angiogenesis and cancer cell proliferation Proceedings of the National Academy of Sciences of the United States of America 2006, 103:1451914524. 66. Hamula CLA, Zhang HQ, Guan LL, Li XF, Le XC: Selection of aptamers against live bacterial cells Analytical Chemistry 2008, 80:78127819. 67. Huang YF, Shangguan DH, Liu HP, Phillips JA, Zhang XL, Chen Y, Tan WH: Molecular Assembly of an Aptamer -Drug Conjugate for Targeted Drug Delivery to Tumor Cells Chembiochem 2009, 10:862 868. 68. Ferreira CSM, Cheung MC, Missailidis S, Bisland S, Gariepy J: Phototoxic aptamers selectively enter and kill epithelial cancer cells Nucleic Acids Rese arch 2009, 37:866 876. 69. Mallikaratchy P, Tang ZW, Tan WH: Cell specific aptamerphotosensitizer conjugates as a molecular tool in photodynamic therapy. Chemmedchem 2008, 3 :425 428. 70. Chen CHB, Dellamaggiore KR, Ouellette CP, Seclano CD, Lizadjohry M, Chernis GA, Gonzales M, Baltasar FE, Fan AL, Myerowitz R, et al.: Aptamer -based endocytosis of a lysosomal enzyme Proceedings of the National Academy of Sciences of the United States of America 2008, 105:15908 15913. 71. Levy -Nissenbaum E, Radovic -Moreno AF, Wang AZ, Langer R, Farokhzad OC: Nanotechnology and aptamers: applications in drug delivery Trends in Biotechnology 2008, 26:442449. 72. Huang YF, Sefah K, Bamrungsap S, Chang HT, Tan W: Selective Photothermal Therapy for Mixed Cancer Cells Using Apt amer -Conjugated Nanorods Langmuir 2008, 24:11860 11865. 73. Tong GJ, Hsiao SC, Carrico ZM, Francis MB: Viral Capsid DNA Aptamer Conjugates as Multivalent CellTargeting Vehicles Journal of the American Chemical Society 2009, 131 :1117411178. 74. Wagner A Platzgummer M, Kreismayr G, Quendler H, Stiegler G, Ferko B, Vecera G, Vorauer -Uhl K, Prof HK: GMP production of liposomes A new industrial approach Journal of Liposome Research 2006, 16:311 319.

PAGE 135

135 75. Cao Z, Tong R, Mishra A, Xu W, Wong GC, Cheng J, Lu Y: Reversible cell -specific drug delivery with aptamer-functionalized liposomes Angew Chem Int Ed Engl 2009, 48:64946498. 76. Wong ML, Medrano JF: Real -time PCR for mRNA quantitation Biotechniques 2005, 39:75 85. 77. Schena M: Genome analysis with gene expression microarrays Bioessays 1996, 18:427431. 78. Raval P: Qualitative and Quantitative -Determination of Messenger -Rna Journal of Pharmacological and Toxicological Methods 1994, 32:125127. 79. McNicol AM, Farquharson MA: In situ hybridization and its diagnostic applications in pathology Journal of Pathology 1997, 182 :250261. 80. Tyagi S, Kramer FR: Molecular beacons: Probes that fluoresce upon hybridization Nature Biotechnology 1996, 14:303308. 81. Uchiyama H, Hirano K, Kashiwasake -Jibu M, Tair a K: Detection of undegraded oligonucleotides in vivo by fluorescence resonance energy transfer. Nuclease activities in living sea urchin eggs the Journal of Biological Chemistry 1996, 271:380 384. 82. Li JWJ, Fang XH, Schuster SM, Tan WH: Molecular beac ons: A novel approach to detect protein DNA interactions Angewandte Chemie -International Edition 2000, 39:1049+. 83. Sokol DL, Zhang X, Lu P, Gewirtz AM: Real time detection of DNARNA hybridization in living cells Proceedings of the National Academy of Sciences of the United States of America 1998, 95:1153811543. 84. Peng X H, Cao Z H, Xia J T, Carlson GW, Lewis MM, Wood WC, Yang L: Real -time Detection of Gene Expression in Cancer Cells Using Molecular Beacon Imaging: New Strategies for Cancer Research Cancer Res earch 2005, 65:19091917. 85. Dirks RW, Molenaar C, Tanke HJ: Methods for visualizing RNA processing and transport pathways in living cells Histochemistry and Cell Biology 2001, 115:3 11. 86. Vijayanathan V, Thomas T, Sigal LH, Thomas TJ: Di rect measurement of the association constant of HER2/neu antisense oligonucleotide to its target RNA sequence using a molecular beacon Antisense & Nucleic Acid Drug Development 2002, 12:225 233. 87. Fisher TL, Terhorst T, Cao XD, Wagner RW: Intracellular Disposition and Metabolism of Fluorescently -Labeled Unmodified and Modified Oligonucleotides Microinjected into Mammalian -Cells Nucleic Acids Research 1993, 21:38573865.

PAGE 136

136 88. Tsourkas A, Behlke MA, Bao G: Hybridization of 2 -O methyl and 2 -deoxy molecu lar beacons to RNA and DNA targets. Nucleic Acids Research 2002, 30:51685174. 89. Kuhn H, Demidov VV, Coull JM, Fiandaca MJ, Gildea BD, Frank -Kamenetskii MD: Hybridization of DNA and PNA molecular beacons to single -stranded and double stranded DNA targets Journal of the American Chemical Society 2002, 124 :10971103. 90. Braasch DA, Corey DR: Locked nucleic acid (LNA): fine -tuning the recognition of DNA and RNA Chem ical Biology 2001, 8 :1 7. 91. Molenaar C, Marras SA, Slats JCM, Truffert JC, Lemaitre M, Ra ap AK, Dirks RW, Tanke HJ: Linear 2 O -Methyl RNA probes for the visualization of RNA in living cells Nucleic Acids Research 2001, 29:art. no. -e89. 92. Egholm M, Buchardt O, Nielsen PE, Berg RH: Peptide Nucleic -Acids (Pna) Oligonucleotide Analogs with an Achiral Peptide Backbone Journal of the American Chemical Society 1992, 114:18951897. 93. Wang L, Yang CYJ, Medley CD, Benner SA, Tan WH: Locked nucleic acid molecular beacons Journal of the American Chemical Society 2005, 127:15664 15665. 94. Sefero s DS, Giljohann DA, Hill HD, Prigodich AE, Mirkin CA: Nano -flares: probes for transfection and mRNA detection in living cells Journal of the American Chemical Society 2007, 129:15477 15479. 95. Chen AK, Behlke MA, Tsourkas A: Avoiding false -positive signa ls with nuclease vulnerable molecular beacons in single living cells Nucleic Acids Res 2007, 35:e105. 96. Santangelo PJ, Nix B, Tsourkas A, Bao G: Dual FRET molecular beacons for mRNA detection in living cells Nucleic Acids Research 2004, 32: 97. Sando S, Abe H, Kool ET: Quenched auto -ligating DNAs: Multicolor identification of nucleic acids at single nucleotide resolution Journal of the American Chemical Society 2004, 126 :10811087. 98. Yang CJ, Lin H, Tan W: Molecular Assembly of Superquenchers in Si gnaling Molecular Interactions Journal of the American Chemical Society 2005, 127 :1277212773. 99. Kim JH, Morikis D, Ozkan M: Adaptation of inorganic quantum dots for stable molecular beacons Sensors and Actuators B -Chemical 2004, 102:315 319. 100. Chen AK, Behlke MA, Tsourkas A: Efficient cytosolic delivery of molecular beacon conjugates and flow cytometric analysis of target RNA Nucleic Acids Research 2008, 36:

PAGE 137

137 101. Medley CD, Drake TJ, Tomasini JM, Rogers RJ, Tan W: Simultaneous Monitoring of the E xpression of Multiple Genes Inside of Single Breast Carcinoma Cells Anal ytical Chem istry 2005, 77:47134718. 102. Nitin N, Santangelo PJ, Kim G, Nie SM, Bao G: Peptide -linked molecular beacons for efficient delivery and rapid mRNA detection in living cell s Nucleic Acids Research 2004, 32: 103. Michelson AM, Todd AR: Nucleotides .32. Synthesis of a Dithymidine Dinucleotide Containing a 3' -5' -Internucleotidic Linkage. Journal of the Chemical Society 1955:26322638. 104. Verma S, Eckstein F: Modified oligo nucleotides: Synthesis and strategy for users Annual Review of Biochemistry 1998, 67:99 134. 105. Pon RT: Protocols for oligonucleotides and analogs: synthesis and properties vol 20; 1993. 106. Beaucage SL, Iyer RP: Advances in the Synthesis of Oligonucl eotides by the Phosphoramidite Approach Tetrahedron 1992, 48:22232311. 107. Beaucage SL, Iyer RP: The Functionalization of Oligonucleotides Via Phosphoramidite Derivatives Tetrahedron 1993, 49:19251963. 108. Freier SM, Altmann KH: The ups and downs of nucleic acid duplex stability: structure-stability studies on chemically -modified DNA:RNA duplexes Nucleic Acids Research 1997, 25:44294443. 109. Uhlmann E, Peyman A: Antisense Oligonucleotides a New Therapeutic Principle. Chemical Reviews 1990, 90:543 584. 110. Koch T: Locked nucleic acids: a family of high affinity nucleic acid probes Journal of Physics -Condensed Matter 2003, 15:S1861S1871. 111. Singh SK, Nielsen P, Koshkin AA, Wengel J: LNA (locked nucleic acids): synthesis and highaffinity nuclei c acid recognition Chemical Communications 1998:455456. 112. Koshkin AA, Singh SK, Nielsen P, Rajwanshi VK, Kumar R, Meldgaard M, Olsen CE, Wengel J: LNA (Locked Nucleic Acids): Synthesis of the adenine, cytosine, guanine, 5 -methylcytosine, thymine and u racil bicyclonucleoside monomers, oligomerisation, and unprecedented nucleic acid recognition Tetrahedron 1998, 54:36073630. 113. Kumar R, Singh SK, Koshkin AA, Rajwanshi VK, Meldgaard M, Wengel J: The first analogues of LNA (Locked Nucleic Acids): Phosphorothioate -LNA and 2 -thio LNA Bioorganic & Medicinal Chemistry Letters 1998, 8 :22192222.

PAGE 138

138 114. Singh SK, Kumar R, Wengel J: Synthesis of Novel Bicyclo[2.2.1] Ribonucleosides: 2' Amino and 2' -Thio -LNA Monomeric Nucleosides The J ournal of Org anic Chem i stry 1998, 63:60786079. 115. Hakansson AE, Wengel J: The adenine derivative of alpha -L -LNA (alpha -L-ribo configured locked nucleic acid): Synthesis and highaffinity hybridization towards DNA, RNA, LNA and alpha -L -LNA complementary sequences Bioorganic & Medicinal Chemistry Letters 2001, 11:935938. 116. Nielsen P, Wengel J: A new synthetic approach towards alpha and beta LNA (Locked Nucleic Acids) Nucleosides & Nucleotides 1999, 18:701 702. 117. Nielsen P, Dalskov JK: alpha-LNA, locked nucleic acid wit h alpha -D -configuration Chemical Communications 2000:11791180. 118. Rajwanshi VK, Hakansson AE, Kumar R, Wengel J: High affinity nucleic acid recognition using 'LNA' (locked nucleic acid, beta -D -ribo configured LNA), 'xylo LNA' (beta -D xylo configured LN A) or 'alpha -L-LNA' (alpha -L-ribo configured LNA) Chemical Communications 1999:20732074. 119. Rajwanshi VK, Kumar R, KofodHansen M, Wengel J: Synthesis and restricted furanose conformations of three novel bicyclic thymine nucleosides: a xylo -LNA nucleos ide, a 3 -O,5 -C methylene linked nucleoside, and a 2 -O,5 -C methylene linked nucleoside Journal of the Chemical Society -Perkin Transactions 1 1999:14071414. 120. Rajwanshi VK, Hakansson AE, Dahl BM, Wengel J: LNA stereoisomers: xylo -LNA (beta -D xyl o configured locked nucleic acid) and alpha -L-LNA (alpha L-ribo configured locked nucleic acid) Chemical Communications 1999:13951396. 121. Rajwanshi VK, Hakansson AE, Sorensen MD, Pitsch S, Singh SK, Kumar R, Nielsen P, Wengel J: The eight stereoisomers of LNA (Locked nucleic acid): A remarkable family of strong RNA binding molecules Angewandte Chemie -International Edition 2000, 39:1656+. 122. Petersen M, Wengel J: LNA: a versatile tool for therapeutics and genomics Trends in Biotechnology 2003, 21:74 81. 123. Jepsen JS, Sorensen MD, Wengel J: Locked nucleic acid: A potent nucleic acid analog in therapeutics and biotechnology Oligonucleotides 2004, 14:130 146. 124. Vester B, Wengel J: LNA (Locked nucleic acid): High affinity targeting of complementary RNA and DNA. Biochemistry 2004, 43:13233 13241. 125. Karkare S, Bhatnagar D: Promising nucleic acid analogs and mimics: characteristic features and applications of PNA, LNA, and morpholino Applied Microbiology and Biotechnology 2006, 71:575586.

PAGE 139

139 126. Obi ka S, Nanbu D, Hari Y, Morio K, In Y, Ishida T, Imanishi T: Synthesis of 2' -O,4' -C methyleneuridine and -cytidine. Novel bicyclic nucleosides having a fixed C -3, -endo sugar puckering Tetrahedron Letters 1997, 38:87358738. 127. Wahlestedt C, Salmi P, Good L, Kela J, Johnsson T, Hokfelt T, Broberger C, Porreca F, Lai J, Ren K, et al.: Potent and nontoxic antisense oligonucleotides containing locked nucleic acids Proceedings of the National Academy of Sciences of the United States of America 2000, 97:56335 638. 128. Arzumanov A, Walsh AP, Rajwanshi VK, Kumar R, Wengel J, Gait MJ: Inhibition of HIV -1 Tat dependent trans activation by steric block chimeric 2 -O methyl/LNA oligoribonucleotides Biochemistry 2001, 40:1464514654. 129. Frieden M, Hansen HF, Koch T: Nuclease stability of LNA oligonucleotides and LNA DNA chimeras. Nucleosides Nucleotides & Nucleic Acids 2003, 22:10411043. 130. Kvaerno L, Wengel J: Investigation of restricted backbone conformations as an explanation for the exceptional thermal stab ilities of duplexes involving LNA (locked nucleic acid): synthesis and evaluation of abasic LNA Chemical Communications 1999:657658. 131. Petersen M, Nielsen CB, Nielsen KE, Jensen GA, Bondensgaard K, Singh SK, Rajwanshi VK, Koshkin AA, Dahl BM, Wengel J et al.: The conformations of locked nucleic acids (LNA). Journal of Molecular Recognition 2000, 13:44 53. 132. Frieden M, Orum H: Locked nucleic acid holds promise in the treatment of cancer Current Pharmaceutical Design 2008, 14:11381142. 133. Que Gewirth NS, Sullenger BA: Gene therapy progress and prospects: RNA aptamers Gene Therapy 2007, 14:283 291. 134. Cerchia L, Hamm J, Libri D, Tavitian B, de Franciscis V: Nucleic acid aptamers in cancer medicine. Febs Letters 2002, 528:12 16. 135. Fraunfelder FW: Pegaptanib for wet macular degeneration Drugs of Today 2005, 41:703709. 136. Lou XH, Qian JR, Xiao Y, Viel L, Gerdon AE, Lagally ET, Atzberger P, Tarasow TM, Heeger AJ, Soh HT: Micromagnetic selection of aptamers in microfluidic channels Proceedings of the National Academy of Sciences of the United States of America 2009, 106:29892994. 137. Shangguan D, Cao ZH, Meng L, Mallikaratchy P, Sefah K, Wang H, Li Y, Tan WH: Cell-specific aptamer probes for membrane protein elucidation in cancer cells Journ al of Proteome Research 2008, 7 :21332139.

PAGE 140

140 138. Mallikaratchy P, Tang ZW, Kwame S, Meng L, Shangguan DH, Tan WH: Aptamer directly evolved from live cells recognizes membrane bound immunoglobin heavy mu chain in Burkitt's lymphoma cells Molecular & Cellular Proteomics 2007, 6 :22302238. 139. Bunka DHJ, Stockley PG: Aptamers come of age at last Nature Reviews Microbiology 2006, 4 :588596. 140. O'Sullivan CK: Aptasensors the future of biosensing Analytical and Bioanalytical Chemistry 2002, 372:44 48. 1 41. Nimjee SM, Rusconi CP, Sullenger BA: Aptamers: An emerging class of therapeutics Annual Review of Medicine 2005, 56:555+. 142. Sokolova V, Epple M: Inorganic nanoparticles as carriers of nucleic acids into cells Angewandte Chemie -International Edition 2008, 47:13821395. 143. Seddon AA, Curnow P, Booth PJ: Membrane proteins, lipids and detergents: not just a soap opera Biochimica Et Biophysica Acta -Biomembranes 2004, 1666:105 117. 144. Torchilin VP: Micellar nanocarriers: Pharmaceutical perspectives Pharmaceutical Research 2007, 24:1 16. 145. Sutton D, Nasongkla N, Blanco E, Gao JM: Functionalized micellar systems for cancer targeted drug delivery Pharmaceutical Research 2007, 24:10291046. 146. Torchilin VP: PEG based micelles as carriers of contrast agents for different imaging modalities Advanced Drug Delivery Reviews 2002, 54:235252. 147. Hait SK, Moulik SP: Determination of critical micelle concentration (CMC) of nonionic surfactants by donor acceptor interaction with iodine and correlation o f CMC with hydrophile -lipophile balance and other parameters of the surfactants Journal of Surfactants and Detergents 2001, 4 :303309. 148. Blute I, Jansson M, Oh SG, Shah DO: The Molecular Mechanism for Destabilization of Foams by Organic Ions Journal of the American Oil Chemists Society 1994, 71:41 46. 149. Gennis RB: biomembranes: molecular structure and function: Springer; 1989. 150 Valeur B: Molecular Fluorescence: Principles and Applications. : Wiley -VCH Verlag GmbH; 2001. 151. Lakowicz JR: Principle s of Fluorescent Spectroscopy : Kluwer Academic/Plenum Publishers, New York; 1999. 152. Tyagi S, Bratu DP, Kramer FR: Multicolor molecular beacons for allele discrimination Na t ure Biotechnol ogy 1998, 16:49 53.

PAGE 141

141 153. Bao Q, Shi Y: Apoptosome: a platform for the activation of initiator caspases Cell Death and Differentiation 2007, 14:56 65. 154. Mikhail AS, Allen C: Block copolymer micelles for delivery of cancer therapy: Transport at the whole body, tissue and cellular levels Journal of Controlled Release 2 009, 138 :214223. 155. Ding K, Alemdaroglu FE, Borsch M, Berger R, Herrmann A: Engineering the structural properties of DNA block copolymer micelles by molecular recognition Angewandte Chemie -International Edition 2007, 46:11721175. 156. Alemdaroglu FE, Alemdaroglu NC, Langguth P, Herrmann A: Cellular uptake of DNA block copolymer micelles with different shapes Macromolecular Rapid Communications 2008, 29:326 329. 157. Alemdaroglu FE, Ding K, Berger R, Herrmann A: DNA -templated synthesis in three dimensions: Introducing a micellar scaffold for organic reactions Angewandte Chemie -International Edition 2006, 45:42064210. 158. Jeong JH, Park TG: Novel polymer -DNA hybrid polymeric micelles composed of hydrophobic poly(D,L -lactic -co -glycolic acid) and hydrophilic oligonucleotides Bioconjugate Chemistry 2001, 12:917 923. 159. Alemdaroglu FE, Alemdaroglu NC, Langguth P, Herrmann A: DNA block copolymer micelles A combinatorial tool for cancer Nanotechnology Advanced Materials 2008, 20:899+. 160. Liu JW, Lu Y: Fast colorimetric sensing of adenosine and cocaine based on a general sensor design involving aptamers and nanoparticles Angewandte Chemie International Edition 2006, 45:90 94. 161. Yang HH, Liu HP, Kang HZ, Tan WH: Engineering target -r esponsive hydrogels based on aptamer Target interactions Journal of the American Chemical Society 2008, 130:6320+. 162. Grabar KC, Freeman RG, Hommer MB, Natan MJ: Preparation and Characterization of Au Colloid Monolayers Analytical Chemistry 1995, 67:735743. 163. Duffy DC, McDonald JC, Schueller OJA, Whitesides GM: Rapid prototyping of microfluidic systems in poly(dimethylsiloxane) Analytical Chemistry 1998, 70:49744984. 164. Chen HT, Kim SW, Li L, Wang SY, Park K, Cheng JX: Release of hydrophobic molecules from polymer micelles into cell membranes revealed by Forster resonance energy transfer imaging Proceedings of the National Academy of Sciences of the United States of America 2008, 105:65966601.

PAGE 142

142 165. Dautry -Varsat A, Ciechanover A, Lodish HF: pH and the recycling of transferrin during receptor-mediated endocytosis Proceedings of the National Academy of Sciences of the United States of America 1983, 80:22582262. 166. Tsui NBY, Ng EKO, Lo YMD: Stability of endogenous and added RNA in blood spec imens, serum, and plasma. Clinical Chemistry 2002, 48:16471653. 167. Jain RK: Determinants of Tumor Blood -Flow a Review Cancer Research 1988, 48:26412658. 168. Klevens HB: Solubilization Chemical Reviews 1950, 47:1 74. 169. Mukerjee P, Mysels KJ: A Re -Evaluation of the Spectral Change Method of Determining Critical Micelle Concentration Journal of the American Chemical Society 1955, 77:29372943. 170. Takeda K, Ohtawa T, Hachiya K, Aoki K: Kinetics of the Solubilization of Pinacyanol Chloride into a Complex between Bovine Serum Albumin and Sodium Dodecyl Sulfate Bulletin of the Chemical Society of Japan 1987, 60:11741176. 171. Lehninger AL, Nelson DL, Cox MM: Lehninger principles of biochemistry edn 4th. New York: W.H. Freeman; 2005. 172. Yao Y, Gho sh K, Epand RF, Epand RM, Ghosh HP: Membrane fusion activity of vesicular stomatitis virus glycoprotein G is induced by low pH but not by heat or denaturant Virology 2003, 310 :319 332. 173. Tyagi S, Kramer FR: Molecular Beacons: Probes that Fluoresce upon Hybridization Nat ure Biotech nology 1996, 14:303308. 174. Sokol DL, Zhang XL, Lu PZ, Gewitz AM: Proceedings of the National Academy of Sciences of the United States of America 1998, 95:1153811543. 175 Perlette J, Tan WH: Real -time monitoring of intracel lular mRNA hybridization inside single living cells Analytical Chemistry 2001, 73:55445550. 176. Bratu DP, Cha BJ, Mhlanga MM, Kramer FR, Tyagi S: Visualizing the distribution and transport of mRNAs in living cells Proceedings of the National Academy of Sciences of the United States of America 2003, 100:13308 13313. 177. Drake TJ, Medley CD, Sen A, Rogers RJ, Tan WH: Stochasticity of manganese superoxide dismutase mRNA expression in breast carcinoma cells by molecular beacon imaging Chembiochem 2005, 6 : 20412047. 178. Yang CJ, Wang L, Wu Y, Kim Y, Medley CD, Lin H, Tan W: Synthesis and investigation of deoxyribonucleic acid/locked nucleic acid chimeric molecular beacons Nucl eic Acids Res earch 2007, 35:40304041.

PAGE 143

143 179. Medley CD, Drake TJ, Tomasini JM, Ro gers RJ, Tan WH: Simultaneous monitoring of the expression of multiple genes inside of single breast carcinoma cells Analytical Chemistry 2005, 77:47134718. 180. Visner GA, Dougall WC, Wilson JM, Burr IA, Nick HS: Regulation of Manganese Superoxide -Dismu tase by Lipopolysaccharide, Interleukin -1, and Tumor Necrosis Factor Role in the Acute Inflammatory Response Journal of Biological Chemistry 1990, 265 :28562864. 181. He XX, Wang KM, Tan WH, Liu B, Lin X, He CM, Li D, Huang SS, Li J: Bioconjugated nanop articles for DNA protection from cleavage Journal of the American Chemical Society 2003, 125:71687169. 182. Martin CR, Kohli P: The emerging field of nanotube biotechnology Nature Reviews Drug Discovery 2003, 2 :29 37. 183. Cui XJ, Yu SH, Li LL, Li K, Yu B: Fabrication of Ag2SiO3/SiO2 composite nanotubes using a one -step sacrificial templating solution approach Advanced Materials 2004, 16:1109+. 184. Pantarotto D, Briand JP, Prato M, Bianco A: Translocation of bioactive peptides across cell membranes by carbon nanotubes Chemical Communications 2004:1617. 185. Pantarotto D, Singh R, McCarthy D, Erhardt M, Briand JP, Prato M, Kostarelos K, Bianco A: Functionalized carbon nanotubes for plasmid DNA gene delivery Angewandte Chemie -International Edition 200 4, 43:52425246. 186. Cai D, Mataraza JM, Qin ZH, Huang ZP, Huang JY, Chiles TC, Carnahan D, Kempa K, Ren ZF: Highly efficient molecular delivery into mammalian cells using carbon nanotube spearing Nature Methods 2005, 2 :449454. 187. Chen CC, Liu YC, Wu CH, Yeh CC, Su MT, Wu YC: Preparation of fluorescent silica nanotubes and their application in gene delivery Advanced Materials 2005, 17:404+. 188. Kwon NH, Beaux MF, Ebert C, Wang L, Lassiter BE, Park YH, Mciiroy DN, Hovde CJ, Bohach GA: Nanowire -based delivery of Escherichia coli O157 Shiga toxin 1 A subunit into human and bovine cells Nano Letters 2007, 7 :27182723. 189. Hampton T: Nanowire DNA delivery Jama -Journal of the American Medical Association 2007, 298 :505 505. 190. Liu Z, Winters M, Holodni y M, Dai HJ: siRNA delivery into human T cells and primary cells with carbon -nanotube transporters Angewandte Chemie -International Edition 2007, 46:20232027.

PAGE 144

144 191. Kam NWS, O'Connell M, Wisdom JA, Dai HJ: Carbon nanotubes as multifunctional biological tr ansporters and near infrared agents for selective cancer cell destruction Proceedings of the National Academy of Sciences of the United States of America 2005, 102:1160011605. 192. Heller DA, Jeng ES, Yeung TK, Martinez BM, Moll AE, Gastala JB, Strano MS : Optical detection of DNA conformational polymorphism on single walled carbon nanotubes Science 2006, 311 :508511. 193. Zheng M, Jagota A, Semke ED, Diner BA, Mclean RS, Lustig SR, Richardson RE, Tassi NG: DNA assisted dispersion and separation of carbon nanotubes Nature Materials 2003, 2 :338 342. 194. Yang RH, Jin JY, Chen Y, Shao N, Kang HZ, Xiao Z, Tang ZW, Wu YR, Zhu Z, Tan WH: Carbon nanotube quenched fluorescent oligonucleotides: Probes that fluoresce upon hybridization Journal of the American Che mical Society 2008, 130:83518358. 195. Nakayama Ratchford N, Bangsaruntip S, Sun X, Welsher K, Dai H: Noncovalent functionalization of carbon nanotubes by fluorescein-polyethylene glycol: supramolecular conjugates with pH dependent absorbance and fluoresc ence. Journal of the American Chemical Society 2007, 129:24482449. 196. Wu YR, Yang CJ, Moroz LL, Tan WH: Nucleic acid beacons for long -term real -time intracellular monitoring Analytical Chemistry 2008, 80:30253028. 197. Tyagi S, Alsmadi O: Imaging nati ve beta -actin mRNA in motile fibroblasts Biophysical Journal 2004, 87:41534162. 198. Soutschek J, Akinc A, Bramlage B, Charisse K, Constien R, Donoghue M, Elbashir S, Geick A, Hadwiger P, Harborth J, et al.: Therapeutic silencing of an endogenous gene by systemic administration of modified siRNAs Nature 2004, 432:173 178. 199. Takeshita F, Minakuchi Y, Nagahara S, Honma K, Sasaki H, Hirai K, Teratani T, Namatame N, Yamamoto Y, Hanai K, et al.: Efficient delivery of small interfering RNA to bone metastati c tumors by using atelocollagen in vivo. Proceedings of the National Academy of Sciences of the United States of America 2005, 102:12177 12182. 200. Lorenz C, Hadwiger P, John M, Vornlocher HP, Unverzagt C: Steroid and lipid conjugates of siRNAs to enhance cellular uptake and gene silencing in liver cells Bioorganic & Medicinal Chemistry Letters 2004, 14:49754977. 201. Hu Lieskovan S, Heidel JD, Bartlett DW, Davis ME, Triche TJ: Sequence -specific knockdown of EWSFLI1 by targeted, nonviral delivery of sma ll interfering RNA inhibits tumor growth in a murine model of metastatic Ewing's sarcoma Cancer Research 2005, 65:89848992.

PAGE 145

145 202. Song EW, Zhu PC, Lee SK, Chowdhury D, Kussman S, Dykxhoorn DM, Feng Y, Palliser D, Weiner DB, Shankar P, et al.: Antibody med iated in vivo delivery of small interfering RNAs via cell -surface receptors Nature Biotechnology 2005, 23:709717. 203. McNamara JO, 2nd, Andrechek ER, Wang Y, Viles KD, Rempel RE, Gilboa E, Sullenger BA, Giangrande PH: Cell type -specific delivery of siRN As with aptamer -siRNA chimeras Nat ure Biotechnol ogy 2006, 24:10051015. 204. Chu TC, Twu KY, Ellington AD, Levy M: Aptamer mediated siRNA delivery Nucleic Acids Res earch 2006, 34:e73. 205. Rosi NL, Giljohann DA, Thaxton CS, Lytton Jean AKR, Han MS, Mirki n CA: Oligonucleotide modified gold nanoparticles for intracellular gene regulation Science 2006, 312 :10271030. 206. Hao J, Kwissa M, Pulendran B, Murthy N: Peptide crosslinked micelles: a new strategy for the design and synthesis of peptide vaccines In ternational Journal of Nanomedicine 2006, 1 :97 103. 207. Koo AN, Lee HJ, Kim SE, Chang JH, Park C, Kim C, Park JH, Lee SC: Disulfide -cross linked PEG -poly(amino acid)s copolymer micelles for glutathione -mediated intracellular drug delivery Chemical Communications 2008:65706572. 208. Park J, An KJ, Hwang YS, Park JG, Noh HJ, Kim JY, Park JH, Hwang NM, Hyeon T: Ultra -large -scale syntheses of monodisperse nanocrystals Nature Materials 2004, 3 :891895. 209. Berry CC, Curtis ASG: Functionalisation of magnetic nanoparticles for applications in biomedicine Journal of Physics D -Applied Physics 2003, 36:R198R206. 210. Baumert C, Hilgeroth A: Recent Advances in the Development of P -gp Inhibitors Anti-Cancer Agents in Medicinal Chemistry 2009, 9 :415436. 211. Miz ukami S, Takikawa R, Sugihara F, Hori Y, Tochio H, Walchli M, Shirakawa M, Kikuchi K: Paramagnetic relaxation based 19f MRI probe to detect protease activity Journal of the American Chemical Society 2008, 130 :794795. 212. Chakravarty P, Marches R, Zimmer man NS, Swafford AD, Bajaj P, Musselman IH, Pantano P, Draper RK, Vitetta ES: Thermal ablation of tumor cells with antibody functionalized single walled carbon nanotubes Proceedings of the National Academy of Sciences of the United States of America 2008, 105 :86978702. 213. Liu Z, Fan AC, Rakhra K, Sherlock S, Goodwin A, Chen XY, Yang QW, Felsher DW, Dai HJ: Supramolecular Stacking of Doxorubicin on Carbon Nanotubes for In Vivo Cancer Therapy Angewandte Chemie -International Edition 2009, 48:7668 7672.

PAGE 146

146 BIOGRAPHICAL SKETCH Yanrong Wu was born at Fujian Province in China PRC in October, 1978. She joined Huaqiao University in 1997 to study chemistry, and then went to Xiamen University in 2001 to pursue an MS degree in inorganic chemistry under Dr. Lansun Zheng. Inspired by one project related to the origin of life during her masters research, she became strong ly interested in life science. Therefore, she moved to University of Florida in the USA and joined Dr. Weihong Tan s group to pursue a PhD degree.