<%BANNER%>

Post-Transcriptional Regulation of Myelin Genes by MicroRNAs

Permanent Link: http://ufdc.ufl.edu/UFE0041022/00001

Material Information

Title: Post-Transcriptional Regulation of Myelin Genes by MicroRNAs
Physical Description: 1 online resource (145 p.)
Language: english
Creator: Verrier, Jonathan
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: dicer, microrna, myelin, myelination, schwann
Neuroscience (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: The conduction of electrical signals along axons of the nerves is aided by the lipid-rich membrane, myelin, which is synthesized by glial cells. Myelination in the peripheral and central nervous systems is an elaborate process that requires the precise regulation of gene expression and protein translation. Myelin genes have been shown to be regulated at both the transcriptional and post-transcriptional levels. The loss of myelin has been linked to several disease states, including multiple sclerosis and inherited peripheral neuropathies. Even the altered expression of individual myelin proteins has been linked to demyelinating diseases which reinforces the requirement for precise regulation of these genes. MicroRNAs (miRNAs) are endogenous regulatory RNA molecules that modulate gene expression at a post-transcriptional level. Regulation by miRNAs has been implicated in both developmental and disease processes. The work here details the expression profile of miRNAs during cellular differentiation in the myelinating cells of the central (Chapter 3) and peripheral nervous system (Chapter 4). In addition, we demonstrate that a disease-linked myelin gene, peripheral myelin protein 22, is subjected to miRNA regulation in the myelinating cells of both divisions of the nervous system. Finally, we reveal a critical role for Schwann cell miRNAs during myelination whereas inhibiting their formation impairs the cells ability to differentiate and myelinate axons in vitro (Chapter 5). These experiments demonstrate a previously uncharacterized level of myelin gene regulation and provide insight into the complex process of myelination by oligodendrocytes and Schwann cells.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Jonathan Verrier.
Thesis: Thesis (Ph.D.)--University of Florida, 2009.
Local: Adviser: Notterpek, Lucia.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0041022:00001

Permanent Link: http://ufdc.ufl.edu/UFE0041022/00001

Material Information

Title: Post-Transcriptional Regulation of Myelin Genes by MicroRNAs
Physical Description: 1 online resource (145 p.)
Language: english
Creator: Verrier, Jonathan
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: dicer, microrna, myelin, myelination, schwann
Neuroscience (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: The conduction of electrical signals along axons of the nerves is aided by the lipid-rich membrane, myelin, which is synthesized by glial cells. Myelination in the peripheral and central nervous systems is an elaborate process that requires the precise regulation of gene expression and protein translation. Myelin genes have been shown to be regulated at both the transcriptional and post-transcriptional levels. The loss of myelin has been linked to several disease states, including multiple sclerosis and inherited peripheral neuropathies. Even the altered expression of individual myelin proteins has been linked to demyelinating diseases which reinforces the requirement for precise regulation of these genes. MicroRNAs (miRNAs) are endogenous regulatory RNA molecules that modulate gene expression at a post-transcriptional level. Regulation by miRNAs has been implicated in both developmental and disease processes. The work here details the expression profile of miRNAs during cellular differentiation in the myelinating cells of the central (Chapter 3) and peripheral nervous system (Chapter 4). In addition, we demonstrate that a disease-linked myelin gene, peripheral myelin protein 22, is subjected to miRNA regulation in the myelinating cells of both divisions of the nervous system. Finally, we reveal a critical role for Schwann cell miRNAs during myelination whereas inhibiting their formation impairs the cells ability to differentiate and myelinate axons in vitro (Chapter 5). These experiments demonstrate a previously uncharacterized level of myelin gene regulation and provide insight into the complex process of myelination by oligodendrocytes and Schwann cells.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Jonathan Verrier.
Thesis: Thesis (Ph.D.)--University of Florida, 2009.
Local: Adviser: Notterpek, Lucia.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0041022:00001


This item has the following downloads:


Full Text

PAGE 1

1 POST-TRANSCRIPTIONAL REGULA TION OF MYELIN GENES BY MICRORNAS By JONATHAN DAW VERRIER A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORID A IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2009

PAGE 2

2 2009 Jonathan Daw Verrier

PAGE 3

3 To those who have supported, taught and encouraged me, thank you

PAGE 4

4 ACKNOWLEDGMENTS I would like to thank my previous and curr ent mentors: Dr. Ant hony Moreilli, Dr. JoEllen Murphy, Dr. Timothy Maher and Dr. Lu cia Notterpek for their invaluable advice and encouragement. I would also like to t hank my family: William and Leslie Verrier, Robert and Susan Hicks, and Megan Reardon fo r their continued support without which the completion of this dissertat ion would not have been possible.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDG MENTS .................................................................................................. 4LIST OF TABLES ............................................................................................................ 8LIST OF FIGURES .......................................................................................................... 9LIST OF ABBR EVIATIONS ........................................................................................... 11ABSTRACT ................................................................................................................... 12 CHA PTER 1 INTRODUC TION .................................................................................................... 14Constituents of Myelin............................................................................................. 15Myelin-Associa ted Diseas es ................................................................................... 17Myelination in the Cent ral Nervous System ............................................................ 19Myelination in the Peri pheral Nervous System ....................................................... 21Peripheral Myelin Protei n 22 ................................................................................... 25PMP22 Expression and Gene Regulation ............................................................... 26MicroRNAs and Gene Regulati on ........................................................................... 282 MATERIALS A ND METHODS ................................................................................ 31Plasmids and miRNA Precursors and I nhibito rs ..................................................... 31Cell Culture and Transfect ion ................................................................................. 32Myelinating Co-cultures of Schwann Cell s and Dorsal Root Ganglion Neurons ..... 33Lentiviral Packaging ................................................................................................ 34Schwann Cell Tr ansduct ion .................................................................................... 34Fluorescent Automated Cell Sorting of Oligodendrocytes ....................................... 35Microarrays and Bioinformatics A nalysis ................................................................ 35Primary An tibodies .................................................................................................. 36Immunoblo tting ....................................................................................................... 37Immunostaining of Schwann Cells and Co-cultures ................................................ 38Immunoprecip itation................................................................................................ 38RNA Expression Analysis ....................................................................................... 39MiRNA Expressi on Analysis ................................................................................... 40Bioinformatics for miRNA Target Prediction ............................................................ 41Luciferase and Gel Shift A ssays ............................................................................. 41Sciatic Nerve Cr ush Injury ...................................................................................... 42Real-time PCR Analysis of Oligodendro cyte Message ........................................... 43Northern Blot ........................................................................................................... 43Bromodeoxyuridi ne Assay ...................................................................................... 44Statis tics ................................................................................................................. 45

PAGE 6

6 3 MIR-9 REPRESSES PMP22 TRANSLATION IN DEVEL OPING AND MATURE OLIGODENDRO CYTES ......................................................................................... 46Introduc tion ............................................................................................................. 46Results .................................................................................................................... 48Characterization of MiRNAs Expr essed by Olig odendrocytes .......................... 48Target Bias Analysis of MiRNAs in Oli godendrocyt es ...................................... 49PMP22 mRNA is not Translated into Protein in Oli godendrocytes ................... 51MiR-9 Down-Regulates PMP22 Protein Ex pression ......................................... 52Discuss ion .............................................................................................................. 53Profiling MiRNAs in Oligodendroc ytes .............................................................. 53MiRNAs and the Control of Myelin Gene Ex pression ....................................... 544 PERIPERHAL MYELIN PROTEIN IS REGULATED POSTTRANSCRIPTIONALLY BY MIR-29A IN SCHW ANN CE LLS ................................. 66Introduc tion ............................................................................................................. 66PMP22 Associat ed Diseas es ........................................................................... 67PMP22 Expression a nd Gene Regul ation ........................................................ 67MicroRNAs and Gene Regulati on .................................................................... 69Results .................................................................................................................... 71PMP22 Levels Inversely Correlate with GW-Body Formation and Dicer Expressi on .................................................................................................... 71MicroRNAs are Differentially Expressed in Schwann Cells Upon Growth Condit ion ....................................................................................................... 74MicroRNA-29a Specifically Regulates PMP22 Reporte r Expression ................ 75Endogenous Schwann Ce ll PMP22 is Regulated by MiR-29a .......................... 77PMP22 and MiR-29 Expression are Inversely Correlated In Vivo .................... 78Discuss ion .............................................................................................................. 805 REDUCTION OF DICER IMPAIRS SCHWANN CELL DIFFERENTIATION AND MYELINAT ION ....................................................................................................... 97Introduc tion ............................................................................................................. 97Results .................................................................................................................... 99Inhibition of Dicer Levels in Sc hwann Cells Usi ng Dicer shRNA ................ 99Dicer Knock-Down Impairs Sc hwann Cell Diffe rentia tion ........................... 99Inhibition of miRNA Biogenesis Im pairs Schwann Cell Myelination ......... 100Discuss ion ............................................................................................................ 1026 CONCLUSIONS AND SIGNIFICANCE ................................................................. 113Overview of Findings ............................................................................................ 113Unresolved Issues and Future Studies ................................................................. 120APPENDIX: SUPPLEMENTAR Y DATA ...................................................................... 125

PAGE 7

7 LIST OF RE FERENCES ............................................................................................. 127BIOGRAPHICAL SKETCH .......................................................................................... 145

PAGE 8

8 LIST OF TABLES Table page 3-1 Top miRNAs expressed by oligodendrocyte li neage cell s. ................................. 65

PAGE 9

9 LIST OF FIGURES Figure page 3-1 miRNA expression in oligodendr ocytes. ............................................................. 573-2 Target bias reversal of a s ubset of miRNAs during oligodendrocyte different iati on ...................................................................................................... 583-3 PMP22 mRNA expression in O4+ Oli godendrocyt es.......................................... 593-4 PMP22 is not translate d in oligode ndrocytes ...................................................... 603-5 miR-9 interacts with the 3UTR of PMP 22 in Vi tro .............................................. 613-6 miR-9 binding sites withi n the 3UTR of PMP22 ................................................. 623-7 miR-9 down-regulat es PMP22 levels in Schwann cells ...................................... 633-8 miR-9 is a br ain-enriched miRNA ....................................................................... 644-1 GW body formation and Dicer expression are enhanced in activelyproliferating Sc hwann cells ................................................................................. 884-2 Suppression of Dicer increases PMP 22 levels ................................................... 894-3 The binding and regulat ory ability of predicted PMP22 targeting miRNAs ......... 904-4 Growth conditions alter the miRNA expression profile of Schwann cells.. .......... 914-5 miR-29a regulates PMP22 3UTR-luciferase reporter expression through one specific bind ing site ............................................................................................ 924-6 Endogenous PMP22 RNA associates with Ago2 and the interaction is enhanced by miR-29a over-expre ssion .............................................................. 934-7 miR-29a regulates endogenous PMP22 levels in Schw ann cells ....................... 944-8 PMP22 and miR-29 expr ession are inversely correlated in developing rat sciatic nerve ........................................................................................................ 954-9 Nerve crush injury reduces PMP22 ex pression and elevates miR-29 levels ...... 965-1 Lentiviral transduction of Dicer shRNA reduces steady-state Dicer levels ....... 1085-2 Suppression of Dicer levels resu lts in increased proliferation and reduced expression of Schwann cell differentiati on markers .......................................... 109

PAGE 10

10 5-3 MPZ protein levels are reduced in myelinating co-cultures containing Schwann cells ex pres sing Dicer shRNA ........................................................... 1105-4 Dicer shRNA transduced Schwann ce lls show impaired myelination in Schwann cell / DRG co-cul tures ....................................................................... 1115-5 Reduction in Schwann cell Dicer levels results in increased Sox2 expression 112A-1 Schwann cells transduced with GW182 shRNA show reduced myelin formation in vitro ............................................................................................... 125A-2 Egr2/Krox20 reporter expression may be modulated be a dynamically regulated miRNA in Sc hwann cells ............................................................... 126

PAGE 11

11 LIST OF ABBREVIATIONS 3UT R 3untranslated region cAMP cyclic adenosine monophosphate CMT Charcot-Marie-Tooth disease CNS central nervous system DRG dorsal root ganglion E embryonic day FACS fluorescent automated cell sorting GAPDH glyceraldehyde-3-phosphate dehydrogenase GWB GW-bodies / processing bodies kDa kilodalton MAG myelin associated glycoprotein MBP myelin basic protein MPZ myelin protein zero miRNA microRNA OPC oligodendrocyte precursor cells P postnatal day PLP proteolipid protein PMP22 peripheral myelin protein 22 PNS peripheral nervous system RSC rat Schwann cell shRNA short hairpin RNA

PAGE 12

12 Abstract of Dissertation Pr esented to the Graduate School of the University of Florida in Partial Fulf illment of the Requirements for t he Degree of Doctor of Philosophy POST-TRANSCRIPTIONAL REGULA TION OF MYELIN GENES BY MICRORNAS By Jonathan Daw Verrier December 2009 Chair: Lucia Notterpek Major: Medical Sciences The conduction of electrical signals along axons of the nerves is aided by the lipid-rich membrane, myelin, which is synthes ized by glial cells. Myelination in the peripheral and central nervous systems is an elaborate process that requires the precise regulation of gene expression and protei n translation. Myelin genes have been shown to be regulated at bot h the transcriptional and post-t ranscriptional levels. The loss of myelin has been linked to several dis ease states, including multiple sclerosis and inherited peripheral neuropathies. Even the altered expression of individual myelin proteins has been linked to demyelinating diseases which reinforces the requirement for precise regulation of thes e genes. MicroRNAs (miRNAs ) are endogenous regulatory RNA molecules that modulate gene expression at a post-transcriptional level. Regulation by miRNAs has been implicat ed in both developmental and disease processes. The work here details the ex pression profile of miRNAs during cellular differentiation in the myelinating cells of the central (Chapter 3) and peripheral nervous system (Chapter 4). In addition, we demons trate that a disease-linked myelin gene, peripheral myelin protein 22, is subjected to miRNA regulation in the myelinating cells of both divisions of the nervous system. Finally, we reveal a critical role for Schwann cell

PAGE 13

13 miRNAs during myelination whereas inhibiting t heir formation impairs the cells ability to differentiate and myelinate axons in vitro (Chapter 5). Thes e experiments demonstrate a previously uncharacterized level of myelin gene regulation and provide insight into the complex process of myelination by oligodendrocytes and Schwann cells.

PAGE 14

14 CHAPTER 1 INTRODUCTION The ability for neurons to communicate r apid electrical signals, called action potentials, along their axons is an essentia l process for neuronal function and vertebrate life. Condu ction of the action potentials is fac ilitated by myelin, a lipid-rich sheath that is deposited in segments, called internodes, along the axons by specialized cell types. The unmyelinated areas of the axons between the internodes are referred to as the nodes of Ravier. These nodes contain the elements, including voltage-gated sodium channels for example, that make action pot ential propagation possibl e. Myelin itself provides a high resistance and low capacitance to the axonal membrane allowing the action potential to jump from one node of Ravier to the next in a process referred to as saltatory conduction (Garbay et al. 2000). This mode of conduction greatly increases the speed and efficiency at which the action pot entials travel along the axons to their target. The loss of the myelin sheath is associated with slowed nerve conduction velocity and axonal damage and is a pathol ogical feature in dis eases ranging from multiple sclerosis to hereditary peripher al neuropathies (Simons and Trotter 2007). Myelin is synthesized by different specia lized cell types in each division of the nervous system, with oligodendro cytes providing the myelin to the central nervous system (CNS) and the Schwann cell myelinati ng the peripheral nervous system (PNS). Myelination is an elaborate process that invo lves the synthesis of proteins and lipids, incorporation of these consti tuents into the membrane, and the wrapping of the axon to form a mature internode. Although these cell types do share common functions, there are many distinct differences between ol igodendrocytes and Schwann cells. In the CNS, each oligodendrocyte is able to myelinate multiple axons whereas a Schwann cell

PAGE 15

15 only myelinates one axon thus defining only one internode (Simons and Trotter 2007). Myelin in the CNS and PNS serves similar functions, however there are differences in which proteins and lipids constitute the my elin in each system, as well as in the synthesis and signals governing the establishment of the myelin sheath. Constituents of Myelin Myelin is a continuation of the glial cells plasma membrane and its production requires an increase in the ra te of synthesis of both lipid s and proteins. Approximately 70-80% of the myelin dry weight is com posed of lipids and the remaining 20-30% is proteins (Wegner 2000b). The lipids that compose the myelin include predominantly galactosphingolipids and saturated long-chain fatty acids (Mugnaini 1982). Cholesterol is an essential component of myelin being responsible for around 20-30% of total lipid content. Although there are no myelin lipids specific to either division of the nervous system, the myelin of the PNS has far more sphingomyelin than present in the CNS, ~25% vs. 5% respectively (Norton and Cammer 1984). However, the myelin synthesized by the oligodendrocytes contains more monoglactosphingolipids with cerebrosides (Gal-c) and sulfat ides (SGal-C) than that made by the Schwann cells. The critical role for SGal-C in t he structural integrity of myelin in the CNS has recently been demonstrated. Mice unable to synthesize Ga l-C displayed progre ssive dysmyelination and altered paranodal structures (Fewou et al. 2009). Proper lipid syntheses is essential for both Schwann cells and oligod endrocytes to synthesis and maintain myelin. In contrast to the r oughly similar lipid profiles, the proteins in the myelin differ between the two branches of the nervous system. The myelinating cells of the PNS and CNS utiliz e proteins that are specific to their division of the nervous system but also use shared proteins to compose the myelin. In

PAGE 16

16 the PNS, approximately 20-30% of the dry mass of myelin is protein, and the majority (approximately 60%) is estimated to be gl ycoproteins. On the other hand, the CNS myelin only has a minor amount of glycopr oteins, although the significance of the different abundances of glycoproteins has yet to be fully explained. Basic proteins are also highly abundant in the PNS myelin co mprising around 30% of the total protein content. In brief, the three most abundant proteins in the PNS compact myelin are the glycoproteins myelin protein zero (MPZ) and peripheral myelin protein 22 (PMP22) and the basic protein, myelin basic protein (M BP). In the PNS, t he glycoproteins MPZ and PMP22 are believed to be essential for the formation of compact myelin and reduction in the expression of either protein inhibits the myelination process (Quarles 2002). The glycoproteins, as well as MBP, interact with extracellular matx rix molecules and are proposed to facilitate wrapping of the axon (Simons and Trotter 2007). There exists additional myelin specific, or myelin enriched, prot eins present at lower levels, including 2-cyclic AMP phosphodiesterase (CNP) and myelin associated glycoprotein (MAG). The most abundant proteins in CNS myelin are MBP, proteolipid protein (PLP), and myelin-associated oligodendrocytic basic pr otein (MOBP). The CNS myelin also contains CNP, yet its function remains elusiv e in the CNS as well as in the PNS. Besides the differences in protein conten t, neurotrophins can also exert contrasting effects on Schwann cells and oligodendrocytes Nerve growth factor (NGF) for example, is a myelination stimulating agent on Schwann cells, but inhibitory on oligodendrocytes (Chan et al. 2004). In addition to its direct actions on the glial cell, it has been proposed that NGF may act on the axon affecting the diameter thus influencing myelination. The precise mechani sms by which the glial cells chose which

PAGE 17

17 axons to myelinate is not completely defied, but an axonal caliber of at least 1 um appears to be the minimum, as well as spec ific neuregulin isoform ( NGR1 type3) expression (Michailov et al. 2004; Mirsky and Jessen 1999). It is suggested that adding myelin to an axon of lesser diameter would not significantly increase the action potential conduction. Regardless, although myelin serves similar functions in the CNS and PNS and there are shared and unique constituents, abnormal myelin formation and the loss of myelin are linked to disease states. Myelin-Associated Diseases The progressive loss of myelin, referred to as demyelination, in either the CNS or PNS is ass ociated with a number of diseases of varying etiologies. In the CNS, demyelinating diseases primarily arise from genetic abnormalit ies, as is the case in leukodystrophies, and inflammatory damage to the myelinating oligodendrocytes (Franklin and Ffrench-Constant 2008). However the most widely recognized CNS demyelinating disease is mult iple sclerosis, which is believed to arise from an autoimmunity to several of the proteins in the myelin (Franklin and Ffrench-Constant 2008). Analyses of serum from patients wit h multiple sclerosis have revealed antibodies against MBP, CNP, PLP and additiona l myelin proteins (Grau-Lopez et al. 2009). The canonical belief is that the loss of myelin leads to slower nerve conduction through the redistribution of sodiu m-channels and increased axonal membrane capacitance. While these phenomenon are observed, the loss of myelin in the CNS is also associated with damage to the axons and even neuron cell loss. Interestingly, axonal damage in these diseases is primar ily observed after the loss of the myelin, suggesting a protective and possibly trophic role for the myelin in the CNS (Dutta and Trapp 2007). In support of this hypothesis, there are recent studies that demonstrate

PAGE 18

18 that changes in protein expression in the CNS myelin are associated with axonal loss in the absence of myelin deficits (Garbern et al. 2002; Lappe-Siefke et al. 2003). Patients lacking the PLP gene are associated with dia gnosis of Pelizaeus-Merzbacher disease (Garbern et al. 2002) and the loss of Cnp1 in mice are associated with axonal loss despite no observable demyelination (Lappe-Sief ke et al. 2003). These finding suggest that loss of conduction may not be the onl y underling mechanism for myelin associated diseases but loss of trophic and mechanical s upport also contributing factors. Also, abnormal wrapping and formation of the myelin sh eath, referred to as dysmyelination, is a hallmark of several disease states in t he PNS and CNS. In t hese patients, proper compact myelin is never formed usually du e to genetic abnormalities. In the CNS, dysmyelination is seen in mental retardati on, a subset of leukodystrophies and other developmental diseases (Karim et al. 2007; Koeppen and Robita ille 2002; Schiffmann and van der Knaap 2004). In the PNS, demyelinating disorders can present in several clinical manifestations, including Charcot-Ma rie-Tooth (CMT) disease and autoimmune inflammatory neuropathies (Scherer 1997). Similar to multiple sclerosis in the CNS, autoimmunity to myelin proteins may also contribute to demyelinating neuropathies in the PNS. In CMT1 and CMT2, antibodies to PMP22 are detected in the patients serum, suggesting an immune component to the disease (Ritz et al. 2000). Whether this is causative or an effect after demyelination occurs remains undefined. An autoimmune response to MAG has also been linked to demyelination neuropathies (Gabriel et al. 1996). In addition, Guillain-Barr syndr ome is associated with autoimmunity to ganglioside in the peripheral ner ve and is a rare disease (Vucic et al. 2009). However,

PAGE 19

19 the majority of demyelinating diseases that are associated with PNS myelin are members of the family of i nherited peripheral neur opathies. The most common is CMT, which is linked to several genes in the PNS, including PMP22, MPZ, and Egr2/Krox20 (Young and Suter 2003). These progressive neurological disorders are linked to genetic abnormalities of the Schw ann cells that lead to demyelination, usually starting in the second or third decade of life (Lupski and Garcia 1992). Disorders of the PNS myelin can arise from glial gene mutation, duplication or depl etion, additionally there are neuropathies that are axo nal in origin. Extensive invest igation has clearly demonstrated that both divisions of the nervous system are susceptible to diseases of the myelin sheath. An increased understating of how the mechanisms of myelination and the protein profile of the CNS and PNS differ may shed light on new therapeutics for these diseases. Myelination in the Central Nervous System Oligodendrocytes arise from the neural tube and migrate as progenitor cells into the developing brain. This migration is dependent on platelet-deriv ed growth factor(PDGF ) and fibroblast growth factor 2 while loss of these signaling pathway s impairs oligodendrocyte precursor migrat ion (Osterhout et al. 1997). The transcription factors Sox9 and Sox10 are res ponsible for driving ex pression of the recept or for these growth factors in oligodendrocytes (Finzsch et al 2008). Signaling through the non-receptor tyrosine kinase FYN, which is activated by PDGF receptor, drives the formation of lamellipodia at the leading edge allowing precursor ce ll migration (Takenawa and Suetsugu 2007). These cells extend and contract processes as they migrate until they reach their final location and differentiate into mature myelinating cells. Since oligodendrocytes can myelinate up to 40 differ ent axonal segments, their differentiation

PAGE 20

20 requires the extension of many processes and the response to signals from the axon (Simons and Trotter 2007). For oligodendrocytes to differentiate, it is critical the RhoA activity be decreased with increased acti vation of Rac1 and Cdc42 promoting MBP expression. Inactivation of RhoA appear s to be dependent on extracellular matrix molecules and Beta-1 integrin expression as well as factors released by neurons (Liang et al. 2004). After the ext ension of the cells multiple processes, mechanisms for transport of myelin assembly must be est ablished. Although the precise steps on how the myelin components are transported rema in undefined, at least two mechanisms have been suggested. First, there may be dire ct or indirect transport through the transGolgi network via an endosomal compartmen t. Second, it has been proposed that myelin protein may be inserted into the plasma membrane firs t, then internalized and transported via endosomes to the myelin in a process called transcytosis (Maier et al. 2008). Neurons have been demonstrated to rel ease a soluble factor that signals for myelin protein incorporation in to the membrane (Kippert et al. 2007). Induction of oligodendrocyte differentiation is still poor ly understood, however, adenosine, insulinlike growth factor 1, and neuregulin are all po sitive regulators of CNS myelination (Kim et al. 2003; Stevens et al. 2002; Ye et al. 2002). Although oligodendrocytes do not synthesize a basal lamina, extracellular matrix cues are still essential for the process. Specifically, CNS myelination is modulated by laminins with the laminin receptor alpha6beta1 integrin promoting cell survival and maturation (Colognato et al. 2002). The transcription factor profile of developing oligodendrocytes is co mplex, with Nkx2.2, Sox10, and the bHLH proteins Olig1/2 all being required for proper maturation (Fu et al. 2002; Kuhlbrodt et al. 1998; Lu et al. 2000). Olig1 has been shown to negatively

PAGE 21

21 regulate the expression of an oligodendrocyt e specific g-protein coupled receptor, Grp17, which appears to involved the timing of myelination and remyelination in the CNS (Chen et al. 2009). However, it appear s that only the recently characterized Myelin Gene Regulatory Factor (MRF) is a master transcriptional regulator of CNS myelination. Deletion of MRF in knock-out mi ce is shown to result in oligodendrocytes being halted at the premyelinat ing stage of differentiation. Reduced transcription and synthesis of the myelin genes are also obs erved, and death resulting from seizures occurs by three weeks after birth (Emery et al. 2009). Although much remains unknown regarding oligodendrocyte diffe rentiation and myelination, the signals and mechanisms employed by Schwann cells to myelinate the PNS are more completely defined. Myelination in the Peripheral Nervous System Schwann cells, the myelin synthesizing ce lls of the PNS, ar e derived from neural crest cells. In the mature ner ve, the Schwann cells can exist in either a myelinating or non-myelinating phenotype and retain the ability to transition between the two states. Axonal contact has been shown to trigger Schwann cell proliferat ion as well as damage to the axon. Although their primary function is to provide myelin to the axon, other essential roles have to be contributed the Schwann cells. These additional functions include but are not limited to the secretion of neurotrophic factor s, synthesis of progesterone, modulation of extracellular po tassium, and the transfer of molecules to the axon (Maier et al. 2002; Scherer 1997). It is becoming increasing apparent that myelinating glial cells also promote axonal survival, as evidence by axonal damage present in multiple sclerosis and peripher al demyelinating dis eases. In these demyelinating disease states, axonal damage is observed afte r the loss of the myelin implying a protective and supportive role of the myelin on the axon.

PAGE 22

22 During development, the Schwann cell pr ecursors proliferate throughout development and form a one to one relation ship with the axon through radial sorting resulting with many cells myelinating one ax on. Radial sorting continues postnatally and similar to what is observed in olig odendrocytes, the sorting is dependent on Beta1integrin recognition of extrac ellular matrix signals (Feltri et al. 2002). Once sorted, the Schwann cells will either initiate myelinati on or engulf a number of small diameter axons to form a Remak fiber (Cafferty et al. 2009). Several factors may influence Schwann fate during cell sorting, including the fact ors NRG1, IGFs, NT3, and BDNF (Cheng et al. 2000; Meintanis et al. 2001; Ya mauchi et al. 2004). The transforming growth factorBeta (TGF-beta) pathway and the extracellu lar matrix protein laminin have been shown to control the number of Schwann cells in vi vo (Parkinson et al. 2001; Yang et al. 2005; Yu et al. 2005). Schwann cells express the tyrosine receptor kinases ErbB2/3 and the axonally secreted, neuregulin (NRG1 type III) promotes migr ation, proliferation and differentiation of the cells(Jessen and Mirsky 2005). Activation of the ErbB receptors leads to increased PI3K/AKT activation, whic h is associated with myelination in both the CNS and PNS. Inhibition of this pathway during development is associated with impaired myelination by oligod endrocytes which is believed to be the result of impaired differentiations (Narayanan et al. 2009). Al so the NRG1/ErbB signaling pathway has been demonstrated to induce cholesterol synthes is in Schwann cells, a requirement for myelin formation (Pertusa et al. 2007). Diffe rentiation of Schwann cells also involves the suppression of the c-Jun (N)-terminal kinase pathway (JNK) which is required developmentally for both NGR1 and TGF-Beta pathways. c-Jun is inactivated by Egr2/Krox20 during differentiation (Parkinson et al. 2004) and the prevention of this

PAGE 23

23 inactivation results in loss of myelin gene ex pression. Notch signaling also induces Schwann cell proliferation and is reduced upon axonal contact and cellular differentiation. In addition to c-Jun, the transcription fact ors PAX3 and SOX2 have also been shown to be negative regulat ors of myelination in Sc hwann cell and failure to actively down-regulate their expression prev ents myelin formation (Kioussi et al. 1995; Le et al. 2005). These studies help to defi ne the profile of an immature Schwann cell, while the identificati on of pro-myelin transcription fa ctors and signaling pathways such as Krox20/Egr2, octamer-binding transcripti on factor 6 (OCT6), brain 2 class III POUdomain protein (BRN2), and phosphatidylinosit ol 3-kinase (PI3K) signaling aid in defining the markers of mature Schwann cells (Le et al. 2005; Maurel and Salzer 2000; Wegner 2000b). Protein kinase A (PKA) and cyclic adenosine monophosphate (cAMP) signaling appears to be the most critical pathway for Schw ann cell differentiation (Monje et al. 2009) where elevated intracellular cA MP levels are critical for myelin gene expression and myelination. Although the key players in Schwann cell differentiation are becoming more apparent, the regulation and signaling in this process is still unclear and thus poorly characterized. The process of wrapping the axon with the myelin membrane is similar between the two divisions of the nervous system. A fter the cells recognize and attach to the axon, they increase their secretory pathways to allow transport of the newly synthesized membrane to the myelin sheath. The majority of the lipid component s of the myelin are synthesized in the endoplasmic reticulum (ER) where some of the myelin proteins can associate with cholesterol, for example, and form a complex to be transported to the myelin sheath. After processing in the Go lgi apparatus, transport vesicles are sent to

PAGE 24

24 the membrane by unidentified mechanisms. However, not all myelin proteins are transported by this lipid-protein complex pr ocess. For instance, the message for MBP in Schwann cells and oligodendrocytes, is transported as RNA-protein granules for localized protein synthesis (Barbarese et al. 1999; Court et al. 2004). MOBP message has also been demonstrated to be transported for local synthesis in oligodendrocytes (Barbarese et al. 1999). The mRNA binding protein, hnRNP A2 has been shown to be involved in transport of the messages to t he myelin but how the message is released and locally translated remains undefined. Regardless, it is know that these mRNA granules are actively transported along micr otubules through channels in the myelin sheath, called Cajal bands, to the membrane for synthesis. In light of these finding, RNA transport and post-transcriptional gene r egulation appears to be a critical factor during myelination. Although the precise mechanism governing the induction of myelination in the PNS remains elusive, it has been establishe d that neuregulin-ErbB signaling is essential for Schwann cell differentiation and developmen t. Extreme examples of misregulation include the ErbB3 deficient animals whic h are completely void of Schwann cells (Riethmacher et al. 1997) and haploinsuffi ciency of the neuregulin 1 gene leads to thinner myelin (Michailov et al. 2004). Brai n derived neurotrophic factor acting through its receptor p75 also increases myelin thick ness (Tolwani et al. 2004). Interestingly, Schwann cells have been shown to synthes ize progesterone which has a stimulatory effect of myelin gene expression and appear to have an autocrine effect (Koenig et al. 1995; Melcangi et al. 1998). As the Schwann cells sort and elonga te, they secrete a basal lamina that encompasses the Schwa nn cell / axon which is required for the

PAGE 25

25 Schwann cell to continue myelination (B unge and Bunge 1986). As the Schwann cells differentiate, myelin gene expression increases through transcriptional mechanisms with increases in Egr2/Krox20 being associated with the induction the myelin genes MPZ and PMP22 (Topilko et al. 1994). Interestingl y, PMP22 is not a direct target of Egr2/Krox20 regulation, yet MPZ, MBP and myelin associated glycoprotein (MAG) are all directly transcribed by this factor in Schwann cells (Jang et al. 2006). These studies suggest multiple levels of gene regulat ion during the myelination process. Peripheral Myelin Protein 22 PMP22 is a 22 kDa tetraspan glyc oprotein t hat is predominantly expressed by the myelinating Schwann cells of the peripheral nervous system (Snipes et al. 1992). PMP22 was first identified as growth a rrest-specific gene 3 (gas-3) in NIH 3T3 fibroblasts (Schneider et al. 1988) and its ex pression increases as cells reach densitydependant inhibition (confluency) (Manfioletti et al. 1990; Zoidl et al. 1995). The significance of the growth arrest-specific expression is still undetermined. Although PMP22 protein expression is highly restrict ed, PMP22 mRNA is present ubiquitously throughout the body, including the centra l nervous system, kidney, heart, muscle and lung (Amici et al. 2006; Baechner et al. 1995; Ohsawa et al. 2006; Parmantier et al. 1995; Suter et al. 1994). PMP22 protein is detected in Schwann cells at epithelial and endothelial cell junctions, and in specific motor and sensory neurons (Baechner et al. 1995; Maier et al. 2003; Notterpek et al. 200 1; Roux et al. 2004). In developing rat sciatic nerve, PMP22 message steadily incr eases and reaches maximal expression at approximately post-natal day 21 which correlate s with the completion of myelination and Schwann cell differentiation st ate (Garbay et al. 2000). In mature sciatic nerve it represents only 2-5% of the PNS myelin proteins. In addition, PMP22 levels drop

PAGE 26

26 significantly post-nerve crush injury (Sni pes et al. 1992) which correlates with the dedifferentiation state of the Schwann cells. These findings suggest the involvement of post-transcriptional mechanisms in cont rolling PMP22 expression which may be dependent upon both the cell type and differentiation state. Although PMP22 represents only a relatively minor constituent of the PNS myelin, point mutations, duplication, and deletion of the gene are asso ciated with demyelinating neuropathies (Lupski and Garcia 1992). Ch arcot-Marie-Tooth disease type 1A (CMT1A) is the most common form of i nherited peripheral neuropathy with a prevalence of 1 in 2500 live births (Lupski and Garcia 1992). CMT1A has been linked with a duplication of a 1.5 Mb region on chromosome 17p11.2 (Patel et al. 1992; Roa et al. 1991) which includes the PMP22 gene. T he phenotypes are proposed to be the result of altered gene dosage (Adlkofer et al. 1995; Hu xley et al. 1996). The Schwann cells in neuropathic models and in patients show an impaired ability to myelinate (Nobbio et al. 2004). PMP22 levels must be tightly controlle d as it is estimated that a 50% reduction in expression will result in HNPP, while a 50% increase leads to CMT1A (Maier et al. 2002). Recent data suggest that the PMP22 tr anscript is misregulated in a number of neurological diseases, including schizophr enia and depression (Aston et al. 2005; Dracheva et al. 2006) and also in cancer (van Dartel and Hulsebos 2004). These findings may imply leaky transcription and a requirement to regulate undesired message at a post-transcriptional level. PMP22 Expression and Gene Regulation In studies specifically exam ining the regulation of the P MP22 gene, the majority of the work has focused on the 5-UTR regulat ory elements. There are two characterized transcripts of the PMP22 gene that differ only in the inclusion of UTRs, primarily

PAGE 27

27 untranslated exon 1. Two promot ers initially characterized, P1 and P2, appear to have tissue specific functions (Maier et al. 2003; Suter et al. 1994). Transcription via promoter P1 results in the inclusion of exon 1A, is preferentially used during myelination, and is mostly Schwann cell specific (Saberan-Djoneidi et al. 2000). P1 is under the control of a CREB-dependant silencing elem ent and a cAMP silencing element which, in the absence of cAMP, prevents PMP22 expression. This is cAMP regulatory element is common in many of the myelin protein genes. Also the PM P22 promoter region possesses many common features of ma mmalian promoters, including TATA and CAAT boxes (Wegner 2000a; W egner 2000b). Promoter P2 however, appears to lack the common promoter element s found in P1 and is used ubiquitously throughout the body. The resulting transcript differs only in t he inclusion of exon 1B and is is important to note that all of the transcripts encode the same protein sequence. Investigations for other regulatory regions in the PMP22 gene have revealed t hat both the 5'and 3-UTRs play critical roles in the expression and stabi lity of the RNA transcr ipts (Bosse et al. 1999). The 3UTR of PMP22 exerts a negative effect on RNA translati on. In addition to the role promoter regions and UTRs have in PMP22 regulati on, applicable transcription factors have also been examined. Severa l transcription factors that have been implicated in myelination are expressed in Schwann cells and have predicted binding regions in the PMP22 5 promoter region (Ma ier et al. 2003). For example, Krox20 (Egr2) and Oct6 (SCIP) are required for Schwann cells to initiate myelination, although their precise roles are different. Oct6 appears to be primarily involved in the timing of myelination (Jaegle et al. 1996). While in Krox20/Egr2 knockouts Schwann cells, myelin fails to be synthesized altogether (Topilko et al. 1994). Although Krox20/Egr2

PAGE 28

28 does directly target MPZ, MBP, and MAG in Schwann cells, PM P22 is not a direct target of this essential myelin transcription fact or (Jang et al. 2006). These results suggest that there must be elaborate post-transcriptional regulation of myelin genes, including PMP22. MicroRNAs and Gene Regulation It has been established that in addition to the changes in the transcription factor profile, there are several post-transcriptional r egulatory mechanisms that influence myelination (Zearfoss et al. 2008). RNA bindi ng proteins such as Quaking have been shown to control both Schwann cell and o ligodendrocyte differentiation (Chen et al. 2007; Larocque et al. 2009). In addition, the transport of MBP mRNA and local synthesis is essential for myelin formati on (Barbarese et al. 1999). However another recently elucidated mechanism of post-trans criptional gene control that involves the 3UTR is repression via microRNAs (m iRNAs). MiRNAs are small, non-coding regulatory RNA molecules that bind to t he 3UTR of target genes based upon reverse complementarity and prevent t heir translation (Grimson et al. 2007; He et al. 2005; Valencia-Sanchez et al. 2006). MiRNAs are transcribed via RNA polymerase II, cleaved by Drosha, actively exported into the cytoplasm by Exportin 5, and then processed by the endoribonuclease Dicer to form the mature miRNA. The complex regulation of each of these steps has rec ently begun to be elucidated (Davis and Hata 2009; Winter et al. 2009). The binding of t he miRNA to the target site on mRNA can either signal for the degradation via the RNA induced sil encing complex (RISC), which contains the Argonaute protei ns, or repress translati on without degradation through other less defined mechanisms (Bagga et al. 2005; Pillai et al. 2005). The RISC has been localized to structures termed processi ng bodies (P-bodies) or GW bodies (GWB).

PAGE 29

29 These cytoplasmic foci contain the RNA-binding protein GW182 and serve as the sites where miRNAs are believed to exert the majo rity of their function (Ding and Han 2007; Liu et al. 2005). MiRNAs have been revealed to be involved in numerous cellular processes including cell differentiation, cell cycle, and cell death (Miska 2005). Mutations creating or deleting miRNA target sites can result in abnormal phenotypes in vivo (Clop et al. 2006). Although no direct relation has establish for the role of miRNAs in the process of myelination, it has been pr oposed that miRNA are involv ed in the translational repression of myelin mRNAs during transport until loca l synthesis can occur (Kim et al. 2004). Loss of miRNA biogenesis by reduction of Dicer expression has been shown to affect oligodendrocyte matura tion (Kawase-Koga et al. 2009). Genes that affect oligodendrocyte myelination have been shown to be subjected to miRNA mediated gene regulation (Lehotzky et al. 2 009; Lin and Fu 2009). Also recently it was reported that autoimmunity to the GW-bodies is asso ciated with motor and sensory neuropathy in humans (Bhanji et al. 2007) al though the histopathology re mains undefined. Ongoing research is revealing that miRNA are likely to be involved in most cellular processes and they are likely to exert an influence on mye lin gene expression in both the CNS and PNS. The disparities between the localizati on of PMP22 mRNA and detectable PMP22 protein suggest that there is post-transcriptional regulat ion of the gene. It has been hypothesized that PMP22 mRNA may be re gulated post-transcriptionally by a nontranscribed RNA molecule (Manfioletti et al 1990). The mechanism of how the 3-UTR of PMP22 negatively regulates expression of the message has yet to be determined

PAGE 30

30 (Bosse et al. 1999). Recently, the 3UTR r egion of the PMP22 gene in medaka fish was demonstrated to possess regulatory domains again implicating this region in modulating gene expression (Itou et al. 2009). This di ssertation addresses the overall hypothesis that miRNA-mediated gene regul ation modulates PMP22 ex pression and the miRNA pathway is essential for Schwann cell myelinat ion. In these studi es we examine the miRNA expression profile (miRNAome) of oligodendrocytes and Schwann cells in response to different growth conditions or di fferentiation states. In addition, we show evidence that PMP22 is regulated in bot h the CNS and PNS by miRNAs, albeit by different miRNAs. We show that the expression of mature miRNAs is essential for proper Schwann cell myelination and differentiation. Taken together these studies demonstrate additional levels of myelin ge ne regulation previously uncharacterized. The elucidation of the mechanism of post-tr anscriptional regulatio n of PMP22 provides novel insight into the etiology of mye lin-associated diseases and may provide new therapeutic targets in contro lling myelin gene regulation.

PAGE 31

31 CHAPTER 2 MATERIALS AND METHODS Plasmids and miRNA Precursors and Inhibitors The psicheck2 luciferase vector (Promega, Madison, WI) was used for the luciferase assays. The 3UTR of PMP22 was inserted using the Xho1/ Not1 sites. Site directed deletion of the miR-29a seed regi on was performed using the GenetailorTM site directed Mutagenesis System (Invitrogen, Carlsbad, CA) with specific primers design ed using the PrimerX program (http: //www.bioinformatics.org/primerx/). The mutagenesis primers used were 5' -ACAAGCAATCTGTGAAAATAGATTTACCAT-3' and 5-TTTCACAGATTGCTTGTCTCTGACGTCT-3. The c-myc-Ago2 plasmid was a kind gift from Dr. Hannon's Laboratory (Cold Springs Harbor, NY) (Karginov et al. 2007). Pre-miRNA precursors and antimiRNA inhibitors were obtained from Ambion (Austin, TX) and used at the indicated concentrations. The PMP22 3UTR fragments for the miR-9 luciferases were constructed by cloning the Xho I Not I fragm ent of pGEM-T 3UTR-PMP22 containing the full length 3UTR of PMP22 into the psiCHECK2 r eporter plasmid (Promega). Three other fragments derived from the 3UT R of PMP22 were obtained by PCR using the following primers: For the fragment 1: 5-GACTCGAGGGAGGAA GGAAACCAGAAAAC-3 and 5GAGCGGCCGCAATCCCCACTCAACTGTGTTCTG-3 For the fragment 2: 5GACTCGAGTGTCGATTGAAGATGTATAT-3 and 5GAGCGGCCGCTCACTGGGTCACCCATAGTG3. For the fragment 3: 5GACTCGAGATTTAGCAGGAATAATCCGC-3 and 5GTCGACGCGGCCGCGAGTTACTCTGA TGTTTATTTTAATGCATC-3.

PAGE 32

32 Fragments of the 3UTR of PMP22 used in assessing miR-29a biding were obtained by PCR using the rat PMP22 cDNA as template. For PMP400, the primers were 5-AGGCCTCTCGAGGCGCCCGACGCACCATCCGTCTAGGC-3 and 5GAGCGGCCGCTGAGCAAAACAAAAAGATGA-3. Fo r PMP800, the primers were 5AGGCCTCTCGAGGCGCCCGACGCACCATCCGTCTAGGC-3 and 5GAGCGGCCGCTAAAACTGTTAATTGAGTT-3. PCR products were digested by Xho I/Not I and cloned into the psicheck2 plasmid (Promega). Cell Culture and Transfection Primary Schwann cell cu ltures were establish ed from newborn rat pups (Ryan et al. 2002). Schwann cells were grown in Dulb eccos modified Eagles medium (DMEM) containing 10% fetal calf serum (FCS) (Hyclone, Logan, UT), 5 M forskolin (Calbiochem, La Jolla, CA) and 10 g/ml bovine pituitary extract (Biomedical Technologies Inc, Stoughton, MA). To analyze proliferating Schwann cells, the cell were harvested at ~75% confluency. To st imulate differentiation, the cells were subjected to 0.5% FCS/DMEM for 72 h prior to collection (Yang et al. 2004). Alternatively, the cultures were switched to a defined medium (DMEM-F12, 100 U/ml Penicillin, 100 g/ml Streptomycin, 100 g/ml BSA, N2 supplement, 38 ng/ml dexamethasone, 50 ng/ml thyroxine, 50 ng/ml tri-iodothyronine) for 48 h to promote growth-arrest and differentiation (Cheng and Mudge 1996). Schwann cells cultured under these conditions have been shown to be pr imarily non-dividing, as determined by bromodeoxyuridine incorporation (Cheng and Mudge 1996). The HeLa cell line was grown in DMEM (Invitrogen) containing 10% FBS and 50 g/ml gentamycin. For transient transfecti on, HeLa cells were transfected using Lipofectamine 2000 (Invitrogen), 200 ng of eac h reporter plasmid an d 10 nM of the

PAGE 33

33 miRNA precursor (Ambion, Austin, TX). Lucif erase activities were measured using the Dual Luciferase Reporter Assay System (Prom ega, Madison, WI) 48h after transfection. Transient transfections of Schwann cells were performed using Lipofectamine 2000 (Invitrogen) according to the manufacturers protocol. In brief, the cells were split the day before transfection and allowed to grow overnight. The cells were then transfected with either RNA and/or DNA at the indicated concentra tions. To express miR-9 in primary rat Schw ann cells transient transfect ion using 4 g of pcDNA6.2GW/miR-Neg plasmid (Invitr ogen) or 4 g of pcDNA6.2-GW /EmGFP-miR-9. mir-9 was cloned according to manufacturers instru ctions using the following sequence : 5TGCTGTCTTTGGTTATCTAGCTGTATGAGTTTTGGCCACTGACTGACTCATACAGAG ATAACCAA-3. Schwann cells were harvested either 24h (for Northern blot) or 48h/72h (for Western blot) after transfection. Transfection efficiency for the plasmids was approximately 30%, as judged by the expression of a plasmid encoding enhanced gr een fluorescent protein (EmGFP). RNA transfection efficiency was over 90% as determined using a fluor ochrome-conjugated scrambled miRNA (Ambion). Cells were ha rvested for RNA analysis using TRIzol (Invitrogen). Protein samples were obtained by harvesting cells in gel sample buffer and protein concentrations were determined usin g the BCA protein assay kit (Pierce, Rockford, IL). Myelinating Co-cultures of Schwann Ce lls and Dorsal Root Ganglion Neurons Dissoc iated neuronal cultures from rats we re established as described (Notterpek et al. 1999b). Dorsal root ganglia (DRG) were collected from embr yonic day 15 rats, digested with 0.25% trypsin (Gibco, Rockville, MD, USA), mechanically dissociated and either plated on rat tail collagen-coated (B iomedical Technologies, Inc., Stoughton, MA,

PAGE 34

34 USA) 12 mm glass coverslips for immunolab eling or on collagen-co ated tissue culture plastic for biochemical studies. Cultures were maintained in minimum essential medium (Gibco) supplemented with 10% FCS, 0.3% gl ucose (Sigma-Aldrich, St. Louis, MO), 10 mM HEPES and 100 ng/mL nerve growth factor (Harlan Bioproducts for Science, Madison, WI, USA) and grown at 37C and 5% CO2. The following day, the cultures were treated with fl uorodeoxyuridine (10 M) for three cycles to enrich the neuronal population. Co-cultures of Schwann cells-DRG neur ons were established as described (Einheber et al. 1993). Schwann cells were added to DRG cultures 1 week after the third fluorodeoxyuridine cycle and allowed to proliferate for 10 days. To initiate myelination, the culture medium was supplemented with ascorbic acid (50 g/mL; Sigma-Aldrich) and the cultures were main tained for an additional 10 days. Samples were then processed for either biochem ical or immunocytochemistry analysis. Lentiviral Packaging A lentiviral pGIPZ shRNA vector encoding shRNA targeting Dicer and a negative, non-targeting shRNA control (Neg.) vector, both of which also enc ode GFP as a reporter protein, were obtained from comme rcial providers (Open Biosystems). Using HEK 293FT cells, the pGIPZ and Neg. shRNA lentivectors were packaged into concentrated lentiviruses using a thr ee plasmid transfection procedure (SempleRowland et al. 2007). Viral titers were esti mated using a Lenti-X qR T-PCR kit (Millipore, Billerica, MA) and typically averaged 2 x 1012 viral genomes per ml. Schwann Cell Transduction Primary rat Schwann cells were transduced with pGIPZ shRNA lentivirus as described (Bolis et al. 2009). In brief, approximately 1 x 105 cells were plated on a 6 cm

PAGE 35

35 dish 24 h prior to transduction. Schwann ce lls were transduced at a multiplicity of infection (MOI) of 5. The Schwann cell cultures were incubated in 1 ml DMEM containing the virus for 4 h. After 4 h, 1 ml of 2X rat Schwann cell media was added and the cultures were then incubated for an additional 48 h. Transduction efficiency was determined to be greater than 90% by direct visualization of GFP expression. The transduced cells were selected by adding 2 g /ml puromycin to the Schwann cell media. After 3-5 d in culture, the cells were seeded onto purif ied DRG neurons. Fluorescent Automated Cell Sorting of Oligodendrocytes Sprague-Dawley rats (Taconic, Hudson, NY) were handled in accordance with NIH guidelines and as approved by the NINDS ACUC Committee. P7 rat brain cells were separated on a 15% Percoll gradient. After staining with the A2B5 mouse monoclonal IgM antibody and GalC rabbit polyclonal antibody (Millipore, Billerica, MA), A2B5+ cells (OPCs) and GalC+ cells (OLs) were sorted using a FACSVantageSE flow cytometer (Becton Dicki nson, Franklin Lakes, NJ) (Cohen et al. 2003). Microarrays and Bioinformatics Analysis Four biological replicates of A2B5+ and GalC+ cells were used for hybridization onto Rat Expression 230 Microarrays (Affyme trix Santa Clara, CA). The microarray data were analyzed using Genespring 7.0 software (Silicon Genetics, Redwood City, CA). The data was processed using RMA and a global normalization was performed using Genespring per chip normalization (normalized to the 50th percentile) and per gene normalization (normaliz ed to the median). Total RNA from A2B5+ and GalC+ cells were purified using the mirVana miRNA Isolation Kit (Ambion) and used for hybridiz ation with miRNA microarrays (LC Sciences, Houston, TX). Slides were scanned using an Axon GenePix 4000B microarray scanner

PAGE 36

36 (Axon Instruments, Union City, CA). The microarray images were background substracted using a local r egression method and normalized to the statistical mean of all detectable miRNAs. Target bias analysis was conducted using TargetScan 4.0 (www.targetscan.org) in conjunction with the Fisher's Exact Test function (fisher.te st) found in the R language for statistical computing and graphics (www.r-p roject.org). For each miRNA and each defined window of genes ("Top", "Middle", "Bo ttom"), four values were determined: the number of genes in the window the miRNA targets, the number of genes in the window, the number of genes the miRNA can target regardless of window, and the number of genes assayed. The values were then used to generate a p-value for each miRNA in the three defined window of genes using a right-tailed condition ("enrichment"). Hierarchical clustering of miRNAs was done using GenePattern 2.0 (Reich et al. 2006). Primary Antibodies A previously characterized mouse monoclo nal antibody (Millipore, Billerica, MA), (Notterpek et al. 1999a) was used to detect PMP22 in the immunolabeling experiments. For the PMP22 Western blots, we utilized a rabbit polyclonal antibody raised against synthetic peptide of the rat PMP22 (amino ac ids 117-132) (Pareek et al. 1993). We used a human anti-GWB antibody (Eystathioy et al. 2002) to detect GW Bodies in cells (kind gift from the Chan lab, Gainesville, FL) and a mouse anti-GW182 antibody (Abcam, Cambridge, MA) for the Western bl ot. Antibodies against c-myc (Santa Cruz, CA), phospho-histone H3 (Ser10) (Upstate, Temecula, CA), Dicer (Santa Cruz, CA) and GAPDH (Encor Technologies, Alachua, FL) were obtained from the indicated suppliers. NF-M was detected using a mouse monoclonal antibody and Myelin protein zero (MPZ) was detected using a chicken polyclonal ant ibody (Encor). CC1 was detected with a

PAGE 37

37 polyclonal antibody (Oncogene). Egr2/Krox 20 was probed for using a rabbit polyclonal antibody (Covance, Princeton, NJ). cJun and Sox2 were detected using rabbit polyclonal antibodies (Santa Cr uz). Oct6 was detected using a rabbit polyclonal antibody (Abcam, Cambridge, MA). M BP was probed for using rabbit polyclonal antibodies (Millipore, Bi llerica, MA). Immunoblotting Equal amounts of protein lysates (40 g per sample cells or 5 g per sample nerve) were separated on sodium dodecyl sulf ate gels and transferred to nitrocellulose membranes. Endoglycosidase digestion with PNGa se F (New England Biolabs, Beverly, MA) was performed overnight at 37 C prior to Western blot (Pareek et al. 1997). After transfer, the membranes were blocked in 5% nonfat milk/phosphate buffered saline (PBS) for one hour and then incubated with prim ary antibody in 5% nonfat milk/PBS or 5% FCS/PBS overnight at 4 C on a shaker. The membranes were washed three times with PBS, and then incubated with secondary ant ibody in 5% milk/PBS for two h at room temperature. Afte r incubation with anti-rabbit, anti-chicken or anti-mouse horseradish peroxidase (HRP) conjugated secondary antibodies (Sigma, St. Louis, MO), bound antibodies were detected wit h an enhanced chemiluminescent substrate (Perkin Elmer, Boston, MA). Films were digitally imaged using a GS-800 densitometer (Bio-Rad Laboratories, Hercules, CA) and figures assembled using Adobe Photoshop 5.5. Quantification of We stern blot data was performed using Scion Image (Frederick, MD). The specific band intensities were obtained and the data was normalized for GAPDH to obtain relative protein expression levels.

PAGE 38

38 Immunostaining of Schwann Cells and Co-cultures Immunofluorescence experiments were per formed as described (Notterpek et al. 1999a). In brief, Schwann cells cultured on glass coverslips were fixed with 4% paraformaldehyde for 10 min and post-fixed permeabilized with cold 100% methanol for 5 min at -20C. After blocking with 10% normal goat serum for one hour at room temperature, the samples were incubated with the indicated primary antibodies overnight at 4C. Bound antibodies were detected using Alexa Fluor 594 (red) antimouse and Alexa Fluor 488 (green) anti-hum an antibodies (Molecular Probes, Eugene, OR; Zymed, San Francisco, CA). For PMP 22 immunofluorescence in the CNS, P7 rat brain sections were incubated with mouse monoclonal CC1 (Oncogene, San Diego, CA) and rabbit anti-PMP22 antibodies Staining was revealed using anti-mouse IgG-Alexa Fluor 488 and anti-rabbit IgG-Alexa Fluor 594. Nuclei were stained using DAPI (Molecular Probes) or Hoechst dye (10 g/ml Molecular Probes) was included in the secondary antibody solution to visualize nuc lei where indicated. Control samples without primary antibodies were pr ocessed in parallel. Additi onal proteins were probed for using the previously mentioned primary an tibodies. Samples were then mounted on slides using the Prolong Anti-fade kit (Molecu lar Probes). Images were acquired with a SPOT digital camera (Diagnostic Instrumentals, Sterling Heights, MI) attached to a Nikon Eclipse E800 microscope (Tokyo, Japan). Immunoprecipitation For the c-myc-Ago2 immunoprecipitation ex periments, rat Schwann cells wer e transfected with the c-myc-Ago2 plasmid and either the negative (Neg.) scrambled miR or miR-29a (Karginov et al. 2007). Two days pos t-transfection, the cells were incubated in lysis buffer (10 mM Tris, pH 7.5, 10 mM KCl, 2 mM MgCl2, 5 mM DTT) supplemented

PAGE 39

39 with a mixture of protease inhibitors (Complete; Roche, Indianapolis, IN) for 15 min on ice and lysed by pipetting. Five-fold concentrated ATP depletion mix (4 units/ml RNaseIn (Promega), 100 mM glucose, 0.5 units /ml hexokinase (Sigma), 1 mg/ml yeast tRNA (Invitrogen), 450 mM KCl) was added to the cell lysates (to obtain a 1X concentration) and centrifuged at 16,000xg for 30 min at 4C. Prior to the immunoprecipitation, anti-c-myc beads (Sig ma, St. Louis, MO) were preblocked for 30 min in wash buffer (0.5% Nonidet P-40, 150 mM NaCl, 2 mM MgCl2, 2 mM CaCl2, 20 mM Tris, pH 7.5, 5 mM DTT, with EDTA-fr ee protease inhibitors) containing 1 mg/ml yeast tRNA and 1 mg/ml BSA. Wash buffer was added to the lysates and samples were incubated and agitated with the beads for 4 h at 4C. The bead s were washed first in wash buffer and then with wash buffer cont aining 650 mM NaCl two times. Next, the slurry was transferred to a fresh tube and bound RNA was extracted with TRIzol (Invitrogen) and the RNA concen trations were determined. RNA Expression Analysis Real-time reverse-transcriptase PCR was pe rformed as described (Notterpek et al. 2001). At 48 or 72 h posttransfection, RNA was is olated from Schwann cells transfected with the indicated pla smid, miRNA -precursor or inhibitor, using TRIzol (Invitrogen). QuantiTech primer s specific for PMP22 RNA were obtained from Qiagen (catalog number QT00175938). To ensure equal loading of RNA, control primers for GAPDH (Qiagen QuantiTech assay catalog number QT00199633) were included. Each sample was analyzed in triplicate (0.2 g of RNA per reaction ) using the Applied Biosystems 7300 real-time PCR system. Th e SYBR green QuantiTech kit was obtained from Qiagen. Data was normalized to GAPDH using the 2CT method (Livak and Schmittgen 2001).

PAGE 40

40 MiRNA Expression Analysis Expression of mature miR-29a was verifi ed using real-time PCR and normalized to miR-125a, using the 2CT method (Livak and Schmittgen 2001). MiR-125a is equally expressed in Schwann cells harvested from proliferating and non-pro liferating c ells (see data in Figure 4). Total RNA was reve rse transcribed using the Taqman Reverse Transcription Kit (Applied Biosystems, Fost er City, CA) and PCR was performed in triplicate using Taqman primers specif ic for miR-29a and miR-125a (Applied Biosystems). To analyze RNA levels in rat and mouse sciatic nerve, the animals were sacrificed according to approved IACUC prot ocols and the sciatic nerves were removed and immediately frozen in liquid nitrogen. To obtain an adequate yield of total RNA, nerves from at least two animals were pooled from each treatment condition (ten crush sites were pooled for the mouse nerve analysis). The nerves were crushed under liquid nitrogen and total RNA was isolated using either the TRIzol (Invitrogen) or the mirVana miRNA Isolation kit (Ambion) according to the manufacturers instructions. For quantitative RT-PCR analysis, 0.1 g of RNA per reaction was employed with the Quantitech SYBR Green RT-PCR kit (Qi agen) and primers specific for PMP22 (Qiagen). For nerve miRNA analysis, the NCODE miRNA fi rst-strand cDNA synthesis and qRT-PCR kit (Invitrogen) wa s used with primers specific for miR-29a, miR-29b, and miR-24. Each sample was repeated in trip licate and the results were normalized using primers to GAPDH (Qiagen, for PMP22) or miR-24 (Invitr ogen, for miRNA analysis) MiR-24 was used to control for equal RNA input because its ex pression was not affected by either Schwann cell differentiati on or crush nerve injury. The relative expression of each message was determined using the 2CT method.

PAGE 41

41 MiRNA microarrays were performed by isolat ing total RNA from Schwann cells in proliferating and defined media (triplicate samples per condition), purified using the mirVana miRNA Isolation Kit (Ambion, Au stin, TX) and analyzed with an Agilent 2100 bioanalyzer (Agilent Technologies, Santa Clara, CA). Total RNA (5 g) was labeled with a Cy3-conjugated RNA-lin ker and hybridized to Locked Nucleic Acid (LNA) based miRCURYTM arrays (Exiqon, Woburn, MA). Images were acquired using an Axon scanner (4000B) and processed with Genepix 6 (Molecular Devices, Sunnyvale, CA). Bioinformatics for mi RNA Targ et Prediction Bioinformatic scans of the rat 3UTR of PMP22 were conducted using three web based miRNA target prediction programs (T argetscan (http://www. targetscan.org/), miRbase (http://microrna.sanger.ac.uk/targets/v5/), and Pictar (http://pictar.bio.nyu.edu/). MiRNAs were chosen based upon their prediction by more than one program, conservation of the bindi ng region, and the stre ngth of predicted interaction. Luciferase and Gel Shift Assays Luciferase assays were performed using the Dual-Lucif erase assay kit (Promega). In brief, Schwann cells were co-transfect ed in 24-well plates with the indicated psicheck2 luciferase construct (0.4 g/well) and miRNA precursor (10 nM). After 48 h, the cells were harvested in passive lysis buffer and luciferase activities were determined using a Bio-Tek Synergy HT luminometer (Bio -Tek Instruments Inc, Winooski, VT). The luciferase data is expressed as a ratio of Renilla Luciferase (RL) to Firefly Luciferase (FL) to normalize for transfection variability between samples. Luciferase experiments were repeated at least three independent times, in triplicate or greater, as indicated. The Hela cell line was used with the indicat ed psicheck2 plasmid and miRs to assess

PAGE 42

42 miR-9 binding, Schwann cells were used fo r all additional lucifease assays where denoted. The full length 3UTR of PMP22 was clon ed from rat sciatic nerves by PCR using the primers 5-AGGCCTCT CGAGGCGCCCGACGCACCATCCGTCTAGGC-3 and 5GTCGACGCGGCCGCGAGTTACTCTGATG TTTATTTTAATGCATC-3. The PCR fragment was inserted into pGEM-T easy (Promega) and used for in vitro transcription (Promega). Gel shift assays were perfo rmed with in vitro transcribed PMP22 RNA using a T7 in vitro transcription kit (Pro mega). The RNA was incubated for two hours with biotin-labeled miRNAs (1 pmol) at 42 C. The samples were separated on 3% agarose gels, transferred to a nylon membrane, and the complexes revealed using a nucleic acid detection kit HRP-streptavidin substrate (Pierce). Total RNA loading was monitored using SYBR Gold (Inv itrogen) staining of the gel. Sciatic Nerve Crush Injury Experiments were performed on 8-weeks old male CD1 mice obtained from Charles River Laboratories (Wilmington, MA, USA) as described (Islamov et al. 2004). Animals were housed one per cage under standar d laboratory conditions, wit h 12 h light/dark schedule and unlimit ed access to food and water. Animal protocol was approved by Animal Care and Use Committee of East Carolina University, an AAALACaccredited Facility. Animals were anesthetized with ketamine (18 mg/ml) xylazine (2 mg/ml) anesthesia (0.5 ml/10 g of body wt, i.p.). An incision was made on the right thigh; the right sciatic nerve was exposed and crushed at the level of the sci atic notch for 15 sec with a fine hemostat. The wound was closed and the animals were allowed to recover for 4 or 5 days. After specified time peri ods animals were euthanized and sciatic nerves

PAGE 43

43 were quickly dissected out, snap frozen in liquid nitrogen and stor ed at -80C. The control sample (nave nerve) was taken from the contralateral side (sciatic nerve from left leg). The excised crush sample was t he injury site plus ~ 4mm up and 4mm down from the point of injury. Real-time PCR Analysis of Olig odendrocyte Message Total RNA (150 ng) from A2B5+ and GalC+ cells were treated with Turbo DNase (Ambion) for 10 min at 37C. First strand synthesis was conducted using the Taqman Reverse Transcription Kit (Applied Biosystems, Foster City, CA). Real-time PCR was performed using a Taqman Array microRNA P anel v1.0 (Applied Biosystems). PCR was performed on Applied Biosystems 7900HT Fast Real-Time PCR Systems using the Taqman 2X Universal PCR Master Mix. A geometric averaging on multiple miRNAs was performed to determine miR-203 as reference for normalization. Real-time PCR of PMP22 was conducted using the LightCycler FastStart DNA MasterPlus SYBR Green I (Roche, Indianapolis, IN) and the following primers: 5TCCTCATCTGTGAGCGAATG-3 and 5-ACA GACCAGCAAGGATTTGG-3. The betaactin primers used for normalization were : 5-TGTCACCAACTGGGACGATA-3 and 5GGGGTGTTGAAGGTCTCAAA-3. Northern Blot miRNAs from adult tissues (Ambion) were separated by electrophor esis through a 15% TBEurea gel (Invitrogen). After transfe r to a GeneScreen Plus nylon membrane (Perkin-Elmer, Wellesley, MA), membrane was incubated overnight at 42C with 10 pmol of biotinylated Locked Nucleic Acid (b iot-LNA, IDTDNA Technologies, Coralville, IA) in ULTRAhyb Oligo Hybridization buffer (Ambion). The biot-LNA probe sequence for miR-9 was 55Biot-TCA+TAC+AGC+TAG+ ATA+ACC+AAAGA-3 (Biot = biotin and +

PAGE 44

44 denotes a LNA substitution). After inc ubation, membrane was washed twice in NorthernMax Low Stringency Wash Solution and in NorthernMax High Stringency Wash Solution (Ambion). Detection was conducted using the Chemiluminescent DNA Detection Kit (Pierce, Rockford, IL). Blot s were stripped and probed for U6 small nuclear RNA with the U6 biot-LNA 5-5Biot -GAA+TTT+GCG+TGT+CAT+CCT+TGC+GCA-3. Total RNA from rat Schwann cells ( 10g/lane) was separated on denaturing agarose gel and transferred overnight to a nylon membrane (Hybond). After UVcrosslink, the membranes were inc ubated with 32P-labelled (Random Prime kit, Amersham) PMP22 and 18S ribosomal probes. The blot was washed twice in 2XSSPE, 0.1% SDS at room temper ature and once in 1XSSPE, 0.1% SDS at 65C before exposure to film. Bromodeoxyuridine Assay To investigate the effects of Dicer sh RNA on Schwann cell pr oliferation, equal numbers of infected cells (4 104 viable cells per well, n = 6) were maintained in culture for 24 hr prior to incubation with bromodeoxyu ridine (BrdU; Roche BrdU labeling and detection kit, Roche, Nutley, NJ) as previously described (Johnson et al. 2005). After 8 hr of BrdU incorporation, the cells were fixed, permeabilized, and processed, according to the manufacturer's instructions. BrdUpositive cells in six random fields (0.8 mm2) were counted and divided by the total number of cells in the fields, which was determined by counting nuclei using Hoechst dye (Invitrogen, Carlsbad, CA). As a second measure of cell division, we analyzed the cultures using a BrdU-based cell proliferation ELISA kit (Roche) accord ing to the manufactures instructions.

PAGE 45

45 Statistics Data from multiple independent experiments were anal y zed using Microsoft Excel 2007 and Graphpad Prism v5.0. For analysis of two independent groups, Students ttest was used with significance at p<0.05. For determination of significance between three or more groups, one-wa y ANOVA and post-hoc Tukeys t-tests were utilized with significance at p<0.05. All graphs represent the means and the error bars represent the standard deviation of the mean. For correlati on studies, a linear regression analysis was performed and the r2 and p-values were calculated using Graphpad Prism v5.0.

PAGE 46

46 CHAPTER 3 MIR-9 REPRESSES PMP22 TRANSLATION IN DEVEL OPING AND MATURE OLIGODENDROCYTES Introduction Oligode ndrocytes are glial cells of the CNS that synthesize myelin, and facilitate saltatory conduction of neuronal acti on potentials. In the mammalian CNS, oligodendrocyte progenitor cells (OPCs) arise in multiple ventral and dorsal locations of the forebrain through three independent proliferative wave s during late embryogenesis and early postnatal periods (Kessaris et al 2006). Oligodendrocyte differentiation has been shown to be influenced by both intracellu lar and extracellular cues, yet how the myelin genes are regulated and messages transported is still undefined. Elucidating the molecular mechanisms that control oli godendrocyte maturation requires examining stage-specific changes at both transcripti onal and posttranscriptional levels, as oligodendrocyte lineage cells differentiate from immature OPCs into premyelinating cells (OLs). MiRNAs are (22 nt) noncoding RNAs and are now recognized as integral components of the post-transcriptional silencing machinery. It is currently estimated that around 70% of miRNAs are processed from non-proteincoding units, whereas the less abundant intronic miRNAs are found within the introns of coding mRNAs and are usually coordinately expressed with their host genes (Saini et al., 2007). MiRNAs are initially transcribed as long primary transcr ipts (pri-miRNAs) and processed to mature functional molecules by two specific cleavage steps. First the enzyme Drosha cleaves the transcript, yielding the pr ecursor miRNAs (pre-miRNAs) which are short stem-loop RNA molecules. Then, the pre-miRNAs are ac tively exported from the nucleus to the cytoplasm by Exportin 5 (Stefani and Sl ack 2008). After an additional selective

PAGE 47

47 processing by the RNase III type enzyme Dicer, a small double-stranded RNA is produced. One of the strands in then incorporated into the RISC as the mature miRNA while the other stand is quickly degraded. MiRNAs act to either catalyze mRNA degradation or repress translati on through base pairing within t he 3' untranslated region (3'UTR) of mRNA targets (Valencia-Sanche z et al. 2006). The target genes of the miRNAs are currently being elucidated (Ambro s 2004), and the search of mRNA targets mainly relies on bioinformatic analyses that are based on the phylogenetically conserved base pair complementarity between the targets and miRNAs. The characteristics of validated miRNA target sites have recently been described (Grimson et al. 2007). MiRNAs were first discovered as regulators of developmental processes in C. elegans (Lee et al. 1993) but their importance in mammalian cellular biology is now being revealed. A recent study showed that disruption of the Dicer gene in mouse Purkinje cells led to a size reduction of forebrain (Schaefer et al. 2007), in agreement with the important role of m iRNAs during neuronal cell specif ication (Lai et al. 2005). The systematic cloning of miRNAs revealed t he presence of several hundred distinct miRNAs in the rat (Miska et al. 2004), mous e, and human brain (Sempere et al. 2004). There are organ specific miRNAs, however many are also expressed ubiquitously in the body with approximately sixty percent of known miRNAs being found in the brain. Among those, few are preferentially expressed in the brain, and these include miR-9, miR-124, and miR-128. In these experiments we identify 98 miRNAs expressed by postnatal oligodendrocyte lineage cells. We also show that 37 of these miRNAs display a mRNA target bias and that the expr ession level of the predict ed targets of 13 miRNAs is

PAGE 48

48 dynamically regulated during oligodendrocyte differentiation. Additionally, we document the miRNA mediated repression of PMP22 by miR-9 in developing and mature oligodendrocytes. Results Characterization of MiRNAs Expressed by Oligodendrocytes In vivo miRNA expression profiles of defi ned neural populations have not been reported yet. To address this issue, two stage-specific populations of oligodendrocytes were obtained from postnatal rat brains: OPCs that express the A2B5 ganglioside (A2B5+ cells) and OLs that are positive for th e galactocerebroside marker (GalC+ cells) (Fig. 3-1A). We performed miRNA expression profiling for these two glial populations using miRNA microarrays. The presence of 98 miRNAs was reproduc ibly detected by miRNA microarrays and further validated by real-time PCR (Fig. 3-1B). The 20 miRNAs with the highest expre ssion levels in oligodendrocytes are shown in Table 3-1. miR-9 has the highest expression level in OPCs. The class of abundantly expressed miRNAs in OPCs also includes many described brain-enriched miRNAs such as miR-26a, miR-124a, m iR-125b, miR-181b and the let-7 family encompassing let-7a, let-7b, let-7c, let-7d and le t-7f members. In contrast to the let-7 family whose expression is remarkably st able during differentiation, 23 miRNAs are down-regulated (with fold changes >2) and include miR-9 and miR-124a (Fig. 3-2B). Twenty miRNAs are up-regulated and some were previously identified from rat brain tissues: miR-21, miR-152, miR-142-5p and -3p, miR-338, miR-339 and miR-378 (Landgraf et al. 2007). Notably, miR-219 shows strong expression in OLs, consistent with its tight association with glial cells in the zebrafish brain (Kapsimali et al. 2007).

PAGE 49

49 The fold changes from miRNA microarra ys and real-time PCR are essentially similar (r=0.99, Pearson correlation) (data not shown). The miRNA microarray data was further validated by verifying the co-expre ssion of intronic miRNAs and their host genes. Among the 98 validated miRNAs, 38 intronic miRNAs derive from 34 host genes. The Affymetrix microarray analysis of GalC+ cells confirmed the expr ession of 30 host genes (with a Normalized Expression Value (NEV) >0.9), while 4 others (MCM7, SLIT2, SMC4L1 and an uncharacterized RIKEN sequence) were not (NEV<0.9) (Table 2). Only RIMB1 was not conclusive due to the abs ence of RIMB1 probes. The Affymetrix microarray analysis of A2B5+ cells shows that the 4 genes not detected in GalC+ cells are indeed expressed at detect able levels in OPCs (data not shown). Overall, the comparison of expression levels of in tronic miRNAs and their mRNA counterparts shows tight co-expression of 33 host genes with their intronic miRNAs during oligodendrocyte differentiation. Target Bias Analysis of MiRNAs in Oligodendrocytes To delin eate miRNAs with import ant biological functions in oligodendrocytes, we conducted a target bias analysis (Tsang et al 2007). In principle, if a miRNA is coexpressed with a significant num ber of its predicted targets, this positive correlation signature (positive target bias) would enrich fo r functional targets. Similarly, if one finds that a miRNA is negatively correlated with the expression of its predicted targets, this negative correlation signature (negat ive target bias) would also lead to enrichment of functional targets. To explore target bias in GalC+ cells, rat Affymetrix microarrays were used to establish a rank order list of mRNAs based on their Normalized Expression Values (NEV) (GEO, accession number GSE11218). Th is list was further examined for the

PAGE 50

50 distribution of predicted tar gets for each of the 98 validat ed miRNAs. Predicted targets were compiled from TargetScan 4.0 algorithm (Grimson et al. 2007). The Fisher's Exact Test was employed to determine whether the top tenth, middle tenth, or bottom tenth percentile windows of the list of mRNAs co ntain more predicted targets than expected by chance. Interestingly, 30 of 98 miRNAs show target bias in either in the top tenth percentile or bottom tenth percent ile (Fig. 3-2A). In total, 28 of 30 correlation signatures are negative (Fig. 3-2B). In contrast, only two miRNAs (miR-9 and miR-124a) predicted targets give a positive correlation signature. This cellular prevalence of negative correlation signatures is in line with other genome-wide studies showing that predicted targets are expressed at lower levels in ti ssues where the miRNA is present compared to other tissues where the miRNA is absent (Grimson et al. 2007). However, closer examination of the 30 miRNAs revealed six miRNAs am ong which miR-34c, miR-137, miR-146, miR-186, miR218 and miR-449 were previous ly reported with positive correlation signatures in neuronal cells (Tsang et al. 2007). To determine whether these fluctuations in correlation signatures were dependent not only on cell types (neuronal versus glial ce lls) but also on stages of differentiation, the set of predicted targets of these 30 miRNAs were compar ed to a rank order list of mRNAs expressed by A2B5+ cells (GEO, accession number GSE11218). This analysis shows an inversion of the correlation signatures for 13 of 30 miRNAs. There are two classes of inversions: the first is defined by a switch from positive to negative correlations for miR-34c, m iR-146, miR-218 and miR-449 (Fig 3-2C) and the second is defined by a reversal from negative to positive correlations for miR-9 and miR-124a (Fig. 3-2C). miRNAs in the first class are in line with studies showing before

PAGE 51

51 differentiation, expression levels of predi cted targets were generally higher, and some miRNAs dampen the output of t he transcriptionally down-regul ated mRNAs to facilitate a faster transition in gene expression (Sta rk et al. 2005). miRNAs in the second class may serve as buffers to silence the genetic noise of unwanted transcripts arising from leaky transcription (Hornstein and Shomr on 2006) and such a role has been attributed to miR-9 (Li et al. 2006). PMP22 mRNA is not Translated in to Protein in Oligodendroc ytes To determine a functional target of miR-9, we examined the predicted targets found in the bottom tenth percent ile of OPCs and in the top tenth percentile of OLs. A subsequent Gene Ontology (GO) query reveal ed that demyelination of sciatic nerves was ranked as a top category (P<2.0 E-5) and PMP22 was found in this category. PMP22 mRNA is transcribed in oligodendr ocytes (Fig. 3-4A). Real-time PCR quantification revealed an increase of ~2 fold during the transition from A2B5+ to GalC+ cells (Fig. 3-43B). To investigate if oli godendrocytes translate the PMP22 RNA into protein, frozen sections were proce ssed for double immunol abeling. Postnatal oligodendrocytes in the corpus callosum of rat brains were labeled with the CC1 antibody, however there was no co-staining with the PMP22 antibody (Fig. 3-4C). As positive control, the PMP22 ant ibody clearly stains neuroepith elial junctions in adjacent sections (Fig. 3-4D) (Roux et al. 2004). Altogether, the in vivo experiments show that PMP22 is transcribed in oli godendrocytes, however no protei n is synthesized. A similar situation also exists in vitro, since PMP22 mRNA and other myelin gene messages are found in the cultured primary OPCs and O4+ cells (Fig. 3-3A), suggesting the involvement of post-transcriptional mechanism s in the control of PMP22 expression.

PAGE 52

52 MiR-9 Down-Regulates PM P22 Protein Expression A direct interaction between miR-9 and t he 3UTR of PMP22 was detected using in vitro binding assays (Fig. 3-5). To further dem onstrate a functional interaction, miR-9 was co-transfected with luciferase expression vectors containing the 3UTR of PMP22 (r3UTR) (Fig. 3-6A). A ~50% repression of lu ciferase activity is observed with the fulllength r3UTR in the presence of miR-9 (p<0.01, Students t -test, compared to cotransfection with scrambled miRNA) (Fig. 3-6B ). To delineate the positions of the binding sites of miR-9 in the 3UTR of PMP22, we employed three luciferase constructs that contain fragments of t he 3UTR (Fig. 3-6A). Only fragment 1 (positions 1-157 relative to stop codon) and fragment 2 (pos itions 158-498) support the down-regulation by miR-9 (p<0.01 for fr agments 1 and 2, Students t -test), while fragment 3 (positions 499-1127) does not. This data supports the ex istence of miR-9 binding sites between positions 1-498 of t he 3UTR of PMP22. We also analyzed the down-regulation of PMP22 after transfection of miR-9 in cultured Schwann cells. Norther n blot shows the absence of miR-9 in Schwann cells (Fig. 3-8A), as compared with the specific enr ichment of miR-9 in the rat brain (Fig. 38B). Northern blot analysis of PMP22 expr ession reveals a reduction in PMP22 mRNA levels after transfection of miR-9 (Fig. 37A). Quantification from three independent experiments, after normalizat ion with 18S ribosomal RNA, shows a ~30% reduction in steady-state PMP22 mRNA (p<0.05, Students t -test, compared to co-transfection with the empty vector). The reduc tion of PMP22 mRNA is a ccompanied by a comparable reduction at the protein level as determi ned by Western blot (p<0.05, Students t -test) (Fig. 3-7B). The down-regulation of PMP22 was also demonstrated by immunofluorescence. Schw ann cells transfected with t he miR-Neg plasmid show

PAGE 53

53 stronger PMP22-like pattern of immunoreactivity, as compared to cells transfected with a miR-9 expression plasmid (Fig. 3-7C). Al together, these results show that miR-9 down-regulates PMP22 in vitro by binding to its 3UTR. Discussion Profiling MiRNAs in Oligodendrocytes Althoug h the spatio-temporal miRNA ex pression pattern is proposed to be dynamically regulated during brain devel opment (Kim et al 2004), the miRNA expression profiles of specific neural populations (neurons, oligodendrocytes and astrocytes) have not been fully addressed. Mammalian neurons are by far the bestcharacterized in vitro model (Kye et al. 2007; Lee et al 2004). We report in this study the presence of 98 miRNAs in oligodendrocyt es. The expression levels of 43 miRNAs are dynamically regulated during differentiation, consistent with the actual spatiotemporal model of miRNA expression profile s in the brain. A comparison with miRNAs expressed by cortical neuronal cells shows a small overlap with 58 of 98 miRNAs (data not shown), and three miRNAs (miR-23, miR-26 and miR-29) enr iched in astrocytes are also expressed by oligodendrocytes (Smirnova et al. 2005). This analysis thus suggests that neural cells may have in co mmon a large number of miRNAs. Modulation of the expression level of i ndividual miRNAs may be crucial for their proper functions in the appropriate ce llular context. For example, neurons and oligodendrocytes share several miRNAs such as miR-34c, miR-137, miR-146, miR-186, miR-218 and miR-449. Interestingly, these six miRNAs show negative target bias in the oligodendrocyte lineage but possess signific ant positive correlation signatures in neuronal cells. The contrast between neuronal and glial bias suggests that miRNAs have diverse roles that are cell-dependent. We speculate that the primary function of

PAGE 54

54 these six miRNAs might be to buffer noise in gene expression, or regulate local translation in neurons. In comparison, the pr evalence of negative correlation signatures in oligodendrocytes supports a modulatory ro le in the reinforcement of pre-existing transcriptional silencing mechanisms. MiRNAs and the Control of Myelin Gene Expressio n Aside from regulating gene expression in normal physiological conditions, miRNAs have been implicated in pathological conditi ons such as Alzheimers disease, schizophrenia and glioblastoma (Chan et al. 2005; Chen et al. 2008; Perkins et al. 2007). Of note, miR-21 was strongly expre ssed in glioblastoma cell lines and knockdown of miR-21 led to increased apoptosis. T he anti-apoptotic effe ct of miR-21 was counteracted by miR-335 in a model of neural survival after ethanol exposure (Sathyan et al. 2007). During oligodendrocyte different iation, miR-335 was down-regulated while miR-21 was strongly up-regulat ed, in line with the antagonist ic action of miR-335 to miR-21. miR-9 is another m iRNA whose expression has been well-characterized in human brain and oligodendroglioma (Nelson et al. 2006). The expression of miR-9 is very high in neuroblasts and glioblasts of fe tal brain. The maturation of neuroblasts is associated with a decrease in the expression level of miR-9, and its down-regulation during the course of oligodendr ocyte development is consist ent with a function of miR-9 in proliferating neural cells of the brain. What are the functions of miR-9 during oligodendrocyt e maturation? In human oligodendroglioma, miR-9 expression is in creased compared to normal adult brain, suggesting a potential role in neoplasia. miR-9 is a brain-enr iched miRNA and is conserved during evolution, supporting important functions in neural cells. In human and rodents, there are three copies of mir-9 and only two are functional (Kim et al. 2004).

PAGE 55

55 This study shows that PMP22 is a target of miR-9. PMP22 m RNA is detected in oligodendrocytes but not the protein. Of note, three studies also support the transcription of PMP22 in olig odendrocytes (Emery et al. 2009; Lau et al. 2008; Sohn et al. 2006). Interestingly, the CNP-EGFP+ mouse cells showed variable levels of expression of PMP22 mRNA between P2 and P30 (Sohn et al. 2006). Similarly, we observed an ~2-fold increase of PMP22 mRNA during the transition from A2B5+ to GalC+ cells, supporting a dynamic regulation of PMP22 during glial differentiation. Moreover, we also found by RT-PCR the pr esence of PMP22 mRNAs in premyelinating O4+ cells and rat Affymetrix microarray anal ysis confirmed an ~2-fold increase during transition from OPCs to O4+ cells (Fig. 3-3). The pres ence of PMP22 mRNAs in oligodendrocytes is also supported by in situ hybridization studies showing PMP22 transcripts in the CNS (Parmantier et al. 1995). The absence of PMP22 protein in oligodendrocytes is consistent with previ ous proteomic studies that extensively characterized proteins of CNS myelin and did not identify PMP22 (Taylor et al. 2004). More globally, the restricted expression of PMP22 protein in comparison to the broad distribution of its message furt her supports a post-transcriptional repression (Amici et al. 2006). Our results now point to a role for miRNAs in PMP22 regulation. Oligodendrocytes and Schwann cells synthesize myelin in the CNS and the peripheral nervous system (PNS), respectively. Although the prot ein composition of their myelin sheaths is widely divergent, bot h cell types exert tight control over the relative abundance of the specific myelin prot eins. Myelin gene dosage is primordial, as an increase of PLP in the CNS causes Pelizaeus-Merzbacher disease (PMD) (Cohen et al. 2003). Similarly, the PMP22 gene is sensitive to copy number since duplication is

PAGE 56

56 found in the autosomal domi nant Charcot-Marie Tooth type I disease and deletion is linked to autosomal dominant hereditary neuropathy with liability to pressure palsies (Patel et al. 1992), (Chance et al. 1993). It is thus tempti ng to speculate that miRNAs reinforce the control of genes sensitive to gene dosage. To support this hypothesis, the recent description of characteristics shared by dose sensitive genes includes the presence of long 3UTRs, the target region of miRNAs (Vavouri et al. 2009). Adding an additional mechanism of regulat ion, might protect against pr otein aggregation or other consequences of increased levels of steady-state protein. Overall, this work provides an important step toward the functi onal identification of miRNAs and how they interact with their targ ets to control oligodendrocyte identity. The significance of this work is illustrated here by attributing a role fo r miRNAs in the posttranscriptional regulation of PMP22. Future functional studies aimed at understanding how individual miRNAs contribute to the diff erences in myelin protein composition will underscore the critical importance of these small non-coding RNAs as guardians of the glial transcriptome. Note The work presented in this chapter was published in The Journal of Neuroscience November 5, 2008, 28(45):1172011730. Pierre Lau, Jonathan D. Verrier, Joseph A. Nielsen and Kory R. Johnson planned and performed the experiments. Lucia Notterpek and Lynn D. Hudson aided in planning the experiments and edited the manuscript.

PAGE 57

57 Figure 3-1. miRNA expression in olig odendrocytes A) FACS isolation of oligodendrocytes. Live brain cells are obtained by excluding dead cells (DAPI positive) and cell debris (low Forward Scatter Characteristics (FSC, size)). The R1 gate is used to purify oligodendrocytes. OPCs are labeled with the A2B5 antibody (Gate R2) and OLs are detected using a GalC antibody (Gate R3). B) miRNA expression in oli godendrocytes. Up-regulated miRNAs (red) are those with increased expression levels during oligodendrocyte maturation while down-regulated miRNAs (green) are clustered on the opposite side.

PAGE 58

58 Figure 3-2. Target bias reversal of a subset of miRNAs during oligodendrocyte differentiation A) Target bias analysi s in OLs. Thirty of 98 miRNAs are associated with a target bias. Notably, a negative target bias is predominant (28 miRNAs in the green line above 1.3, corresponding to p<0.05, right-tailed Fishers Exact Test) while only 2 m iRNAs are found with positive target bias (red line above the 1.3 va lue). As negative control, the middle window shows no target bias (blue line below 1.3 for a ll miRNAs). B) Targeting bias in OLs. The heatmap shows the significance va lues calculated for 30 miRNAs with target bias within each window (Top, Mi ddle, Bottom). C) Targeting bias in OPCs. The 30 miRNAs with a target bias in OLs are re-analyzed using the top, middle and bottom windows obtained from the OPC rank list. This analysis reveals that 13 of 30 miRNAs ar e associated with target bias in OPCs (shown by arrows).

PAGE 59

59 Figure 3-3. PMP22 mRNA expression in O4 + Oligodendrocytes A) Expression of PMP22 mRNA in OPCs and O4+ oligodendrocytes. OPCs and O4+ expressing oligodendrocytes were obtained from FACS from postnatal rat brains and RT-PCR was used to assess t he presence of PMP22. Beta-actin is shown for control. B) PMP22 mRNA level is dynamically regulated during differentiation. Microarray and RT-PCR experiments reveal MBP and FYN were highly expressed myelin genes during the O4+ stage and were used to assess the RNA quality. MPZ was also detected by microarrays and PCR. Fold differences represented the fold increase when the cells progressed from A2B5+ to O4+ stage. Error bars r epresent the s.e.m. n=3 for the RTPCR and n=4 for the micr oarray experiments.

PAGE 60

60 Figure 3-4. PMP22 is not translated in oligodendrocytes A) PMP22 mRNA in oligodendrocytes. RT-PCR shows the presence of PMP22 in OPCs and OLs. B) Quantification of PMP22 mRNA. The PMP22 PCR product from OLs (OL PMP22) appears one PCR cycle before t he one obtained from OPCs (OPC PMP22). C) The CC1+ oligodendrocytes in the corpus callosum (Cc) are not immunoreactive for PMP22. Sagittal sect ions of postnatal rat brains are processed with a rabbit anti-PMP 22 antibody (c) and the CC1 mouse antibody is used to label oligodendrocytes (b). Nuclei are visualized with DAPI (a). d, Merge picture. Scale bar, 100 m. D) PMP22 protein is present in neuroepithelial cells. The CC1 + oligodendrocytes (f) in the cingulate cortex (Cg2 area) do not express PMP22 (g). A clear signal for PMP22 is obtained in neuroepithelial cells surrounding the ventricle. Nuclei are visualized with DAPI (e). h, Merge picture. Scale bar, 100 m.

PAGE 61

61 Figure 3-5. miR-9 interacts with the 3UTR of PMP22 in Vitro The 3UTR of PMP22 was transcribed in vitro and incubated with labeled miR9. The RNA-miRNA complexes were separated from free miRNA (miRNA only) by native gel electrophoresis. A specific retardati on was observed with miR-9 and not with miR-124a. The negative control corresponde d to the incubation of the 3UTR of PMP22 in the absence of any miRNA. As control, SYBR Green I gel staining before gel transfer showed the presence of 3UTR in the three lanes (lower panel).

PAGE 62

62 Figure 3-6. miR-9 binding site s within the 3UTR of PMP22 A) Luciferase constructs containing regions of PMP22 3UTR. N on-overlapping regions of the 3UTR of PMP22 are used to delineate the locati on of miR-9 binding sites. The r3UTR construct contains the full length 3UTR. The remaining constructs fragment 1 (nts 1-157), fragment 2 (nts 158-498) and fragment 3 (nts 499-1127) are partitions of the full length 3UTR. B) Determination of miR-9 effects on 3UTR constructs. The plasmids are co-trans fected with either miR-9 or Neg, a scramble miRNA. miR-9 has no effect on lu ciferase activity of either the empty vector or plasmid containing fragment 3 (Frag. 3). However, miR-9 does significantly reduce luciferase activi ty of constructs containing either the full length of PMP22 (r3UTR), fragment 1 (Frag. 1) or fragment 2 (Frag. 2) (**p<0.01, Students t-test as compared to Neg).

PAGE 63

63 Figure 3-7. miR-9 down-regulates PMP22 levels in Schwann cells A) Schwann cells transiently transfected wit h miR-9 contain reduced steady-state levels of PMP22 mRNA, (*p<0.05, Students t-test versus Neg, transfection with an empty plasmid, n=3). 18S RNA was used for normalization. Error bars represents the s.d. B) Western blot analysis afte r miR-9 transfection. A down-regulation of PMP22 protein is observed after tran sfection of miR-9 (*p<0.05, Students t-test, versus Neg, n=3). N-glycosidase (PNGase) treated cell lysate is shown as a control for PMP22. PMP22 specif ic bands are shown by arrows. NS: Non-Specific band. Error bars represents the s.d. C) Immunofluorescence analysis after miR-9 transfection. Transfected Schwann cells are detected by EmGFP (green, arrows). Nuclei are visualized by Hoechst staining. Scale bar, 10 m.

PAGE 64

64 Figure 3-8. miR-9 is a brain-enriched miRNA A) Absenc e of miR-9 expression in Schwann cells. Rat Schwann cells were gr own in three different conditions: as growing cells, arrested by confluen cy or in a defined media to promote PMP22 expression. Northern blot for m iR-9 showed that across all conditions, no detectable expression level of matu re miR-9 can be seen. As control, human brain sample was run and revealed the presence of mature miR-9. As positive control, membranes were st ripped and probed for U6 small nuclear RNA. (B) Tissue distribution of miR-9. A panel of nine tissues was obtained from P7 rats and analyzed for miR-9 ex pression. Membranes were stripped and probed for U6 small nuclear RNA for control.

PAGE 65

65 Table 3-1. Top miRNAs expressed by oligodendrocyte lineage cells.

PAGE 66

66 CHAPTER 4 PERIPERHAL MYELIN PROTEIN IS REGU LATE D POST-TRANSCRIPTIONALLY BY MIR-29A IN SCHWANN CELLS Introduction PMP22 is a 22 kDa tetraspan glyc oprotein t hat is predominantly expressed by the myelinating Schwann cells of the peripheral nervous system (Snipes et al. 1992). PMP22 was first identified as growth a rrest-specific gene 3 (gas-3) in NIH 3T3 fibroblasts (Schneider et al. 1988) and its ex pression increases as cells reach densitydependant inhibition (confluency) (Manfioletti et al. 1990; Zoidl et al. 1995). The significance of the growth arrest-specific expression is still undetermined. Although PMP22 protein expression is highly restrict ed, PMP22 mRNA is present ubiquitously throughout the body, including the central nervous system, kidney, heart, muscle and lung (Amici et al. 2006; Baechner et al. 1995; Ohsawa et al. 2006; Parmantier et al. 1995; Suter et al. 1994). PMP22 protein is detected in Schwann cells at epithelial and endothelial cell junctions, and in specific motor and sensory neurons (Baechner et al. 1995; Maier et al. 2003; Notterpek et al. 200 1; Roux et al. 2004). In developing rat sciatic nerve, PMP22 message steadily incr eases and reaches maximal expression at approximately post-natal day 21 which correlate s with the completion of myelination and Schwann cell differentiation st ate (Garbay et al. 2000). In mature sciatic nerve it represents only approximately 25% of the PNS myelin prot eins. In addition, PMP22 levels drop significantly post-nerve crush in jury (Snipes et al. 1992) which correlates with the de-differentiation st ate of the Schwann cells. These findings suggest the involvement of post-transcriptional mechanism s in controlling PMP22 expression which may be dependant upon both the cell ty pe and differentiation state.

PAGE 67

67 PMP22 Associated Diseases Although PMP22 represents only a relatively minor constituent of the PNS myelin, point mutations, duplication, and deletion of the gene are asso ciated with demyelinating neuropathies (Lupski and Garcia 1992). Ch arcot-Marie-Tooth disease type 1A (CMT1A) is the most common form of i nherited peripheral neuropathy with a prevalence of 1 in 2500 live births (Lupski and Garcia 1992). CMT1A has been linked with a duplication of a 1.5 Mb region on chromosome 17p11.2 (Patel et al. 1992; Roa et al. 1991) which includes the PMP22 gene. Sinc e the PMP22 gene does not suffer a loss of function with the duplicati on, the phenotypes are likely the result of altered gene dosage (Adlkofer et al. 1995; Huxley et al. 1996). In hereditary neuropathy pressure palsies (HNPP), one copy of the PMP22 gene is deleted (Chance et al. 1993). The Schwann cells in neuropathic models and in patients show an impaired ability to myelinate (Nobbio et al. 2004). Therefore, PM P22 levels must be tightly controlled as it is estimated that a 50% reduction in expr ession will result in HNPP, while a 50% increase leads to CMT1A (Maier et al. 2002) Recent data suggest that the PMP22 transcript is misregulated in a number of ne urological diseases, in cluding schizophrenia and depression (Aston et al. 2005; Dracheva et al 2006) and also in cancer (van Dartel and Hulsebos 2004). These findings may impl y leaky transcription and a requirement to regulate undesired message at a post-transcriptional level. PMP22 Expression and Gene Regulation In studies examining the regulation of the PMP22 gene, th e vast majority of the work has focused on the 5-UTR regulator y elements. There are two characterized transcripts of the PMP 22 gene that differ only in the inclusion of UTRs, primarily untranslated exon 1. Two promot ers initially characterized, P1 and P2, appear to have

PAGE 68

68 tissue specific functions (Maier et al. 2003; Su ter et al. 1994). Transcription via promoter P1 results in the inclusion of exon 1A, is preferentially used during myelination, and is mostly Schwann cell specific (Saberan-Djoneidi et al. 2000). P1 is under the control of a CREB-dependant silencing elem ent and a cAMP silencing element which, in the absence of cAMP, prevents PMP22 expression. This promoter possesses many common features of mammali an promoters, including TA TA and CAAT boxes (Wegner 2000a; Wegner 2000b). Promoter P2, which contains exon 1B, appears to lack the common promoter elements foun d in P1 and is used ubiquit ously throughout the body. It is important to note that all of the transcripts encode the same protein and differ only in the inclusion of UTRs. Investigations for other regulatory regi ons in the PMP22 gene have revealed that both the 5'and 3-UTRs pl ay critical roles in the expression and stability of the RNA transcripts (Bosse et al. 1999). The 3UTR of PMP22 exerts a negative effect on RNA translation which is observed even after the three AU-rich elements have been removed (Bosse et al. 1999) In addition to the role promoter regions and UTRs have in PM P22 regulation, applicable tran scription factors have also been examined. Several transcription factors that have been implicat ed in myelination are expressed in Schwann cells and have predi cted binding regions in the PMP22 5 promoter region (Maier et al 2003). For example, Krox20 (Egr-2) and Oct6 (SCIP) are required for Schwann cells to initiate mye lination, although their precise roles are different. Oct6 appears to be primarily involved in the timing of myelination (Jaegle et al. 1996). While in Krox20 knockouts, myelin fa ils to form altogether (Topilko et al. 1994). Although Krox20 does directly target MPZ, MBP, and MAG in Schw ann cells, PMP22 is not a direct target of this essential myelin transcription factor (J ang et al. 2006). When

PAGE 69

69 Schwann cells establish their one-to-one re lationship with an axon and begin the myelination process, the mRNAs for the myelin proteins, including PMP22, are upregulated. Once the process of wrapping has been completed, the mRNAs for the myelin proteins are reduced to approximat ely 20% of their peak values through undefined mechanisms (Garbay et al. 2000; Scherer and Chance 1995). These results suggest that there must be elaborate post-tr anscriptional regulation of myelin genes, including PMP22. MicroRNAs and Gene Regulation It has been established that there are several post-trans criptional processes that control myelinaiton (Zearfoss et al. 2008). RNA binding proteins such as Quaking have been shown to control both Schwann cell and oligodendrocyte diff erentiation (Chen et al. 2007; Larocque et al. 2009). In addition, the transport of MBP mRNA and local synthesis is essential for myelin formati on (Barbarese et al. 1999). However another recently elucidated mechanism of post-trans criptional gene control that involves the 3UTR is repression via microRNAs (m iRNAs). MiRNAs are small, non-coding regulatory RNA molecules that bind to t he 3UTR of target genes based upon reverse complementarity and prevent t heir translation (Grimson et al. 2007; He et al. 2005; Valencia-Sanchez et al. 2006). MiRNAs are transcribed via RNA polymerase II, cleaved by Drosha, actively exported into the cytoplasm by Exportin 5, and then processed by the endoribonuclease Dicer to fo rm the mature miRNA. The binding of the miRNA to the target site on mRNA can either signal for the degradation via the RNA induced silencing complex (RISC), which c ontains the Argonaute proteins, or repress translation without degradation through other less defined mechanisms (Bagga et al. 2005; Pillai et al. 2005). The RISC has been localized to structures termed processing

PAGE 70

70 bodies (P-bodies) or GW bodies (GWB). These cytoplasmic foci contain the RNAbinding protein GW182 and serve as the sites where miRNAs are believed to exert the majority of their function (Ding and Han 2007; Liu et al. 2005). MiRNAs have been revealed to be involved in numerous cellular processes including cell differentiation, cell cycle, and cell death. Mutations creating or deleting miRNA target sites can result in abnormal phenotypes in vivo (Clop et al. 2006). Although no direct relation has established the roles of miRNAs in the process of myelination, it has been pr oposed that miRNA are involv ed in the translational repression of myelin mRNAs during transport until loca l synthesis can occur (Kim et al. 2004). Also recently it was r eported that autoimmunity to the GW-bodies is associated with motor and sensory neuropathy in hum ans (Bhanji et al. 2007) although the histopathology remains undefined. Ongoing research is revealing t hat miRNA are likely to be involved in most cellular processes and they are likely to exert an influence on myelin gene expression in both the CNS and PNS. The disparities between the localizati on of PMP22 mRNA and detectable PMP22 protein suggest that there is post-transcriptional regulation of the gene. It has been hypothesized that PMP22 mRNA may be re gulated post-transcriptionally by a nontranscribed RNA molecule (Manfioletti et al 1990). The mechanism of how the 3-UTR of PMP22 negatively regulates expression of the message has yet to be determined (Bosse et al. 1999). Recently, the 3UTR region of the PMP22 gene in Medaka fish was demonstrated to possess regulatory domains agai n implicating this region in modulating gene expression (Itou et al. 2009) In these studies we ex amine the miRNA expression profile (miRNAome) of olig odendrocytes and Schwann cells in response to different

PAGE 71

71 growth conditions or differentiation state. In addition, we show evidence that PMP22 is regulated in both the CNS and PNS by microRNAs, albeit by different a miRNA dependent upon the cell type. In addition, we show that the expression of mature microRNAs is essential for proper Schwann cell myelination and differentiation. Taken together these studies demonstrat e additional levels of myelin gene regulation previouls un characterized. The elucid ation of the mechanism of pos t-transcriptional regulation of PMP22 provides novel insight into the etio logy of myelin-associated diseases and may identify new therapeutic targets in controlling myelin gene regulation. Results PMP22 Levels Inversely Correlate with GW-Bod y Formation and Dicer Expression To investigate whether PMP22 is regul ated by miRNAs, we first determined the formation of GW-bodies (GWBs) during differ ent growth conditions in rat Schwann cells, where PMP22 is most expressed (Pareek et al. 1997). GWBs are cytoplasmic foci in the cell where miRNA repression is believed to occur (Rehwinkel et al. 2005) and their formation has been shown to correlate with cell cycle progression (Yang et al. 2004). Schwann cells were subjected to growth-arr est by serum starvation, and then stimulated to proliferate by the addition of 10% serum (Z oidl et al. 1995). At the indicated time points, the cells were fixed and proce ssed for immunostaining using an anti-GWB antibody (Fig. 4-1A). Increases in both the size and abundance of GWBs occur in a time dependent manner upon release of the cells from growth-arrest. Western blot analysis on whole cell lysates demonstrates greater GW182 prot ein expression in actively proliferating, when compared to nonproliferating, differ entiated Schwann cells (Fig. 4-1B). In addition, we investigated another miRNA associated protein, Dicer, which is required for mature miRNA biogenes is for differential expression (Valencia-

PAGE 72

72 Sanchez et al. 2006). Similar to GW182, we observe the highest expression of Dicer when the cells are actively growing. The reduction in the steady-state levels of phosphohistone H3, a mitotic marker, in samples from the defined m edium confirms that there are fewer cells in division (Fig. 4-1B). In comparison to the miRNA pathway associated proteins, the expression of PMP22 is low in proliferating and hi gh in differentiating Schwann cells (Fig. 4-1C). To demonstr ate that the detect ed heterogeneous bands at around ~22 kDa are differentially glycosylat ed forms of PMP22, we performed Nglycosidase reactions (Pareek et al. 1997). Upon incubation of the cell lysates with PNGase F, which completely removes the carbohydrate moiety of PMP22, all the detected bands, except t he top band, shift to the core 18 kDa protein (Pareek et al. 1993). Quantification of t he PMP22 protein bands in th ree independent experiments reveals that PMP22 expression is significantly (**p<0.01) elevated in non-proliferating, differentiated cells when compared to prolif erating Schwann cells (Fig. 4-1D). This finding is consistent with previous results (Zoidl et al. 1995). In comparison, Dicer expression is high in proliferating, as com pared to differentiating Schwann cells (Fig. 41E). Taken together, these data indicate that the expression of PMP22 inversely correlates with both Dicer and GW182, two ess ential proteins for miRNA biogenesis. To further establish a functional re lationship between PMP22 levels and Dicer, we inhibited Dicer expression in Schwann ce lls using siRNA (Fig. 4-2A). We used a negative (Neg.) scrambled siRNA to control for any non-specific effects of transfection. In the Dicer inhibited cells, we observe an increase in PMP22 protein levels at 72 h post-transfection (Fig. 4-2A), as compar ed to the Neg. siRNA transfected cells. Densitometric analysis of three independent experiments indicates an ~60 % increase

PAGE 73

73 in PMP22 protein upon the suppr ession of Dicer (*p<0.05, Fig. 4-2B). The biochemical results were reinforced by immunostaining Schwann cells transfected with either the Neg. or Dicer siRNA (Fig. 4-2C). Cells wi th Dicer expression inhibited show less Dicerlike immunoreactivity (green), but demonstr ate an increase in PMP22-like staining (red)(Notterpek et al. 1999a). Therefore, the inhibition of Dicer enhances PMP22 levels and indicates that mature miRNAs are regul ating PMP22 expression in Schwann cells. MicroRNAs are predicted to target PMP22 and regulate reporter expression Bioinformatic scans are the in silico standard for assembling a list of candidate miRNAs predicted to target the 3UTR of a given RNA. We used three programs (Targetscan, miRbase and Pictar) to generate a list of ten miRNAs with high probability to bind to the 3UTR of PMP22. A schematic of where these miRNA s are predicted to bind is shown (Fig. 4-3A). Since RNA is known to have significant secondary structure and this can affect miRNA binding (Kertesz et al. 2007), we evaluated the binding ability of the predicted miRNAs to the 3UTR of PMP22 using a gel shift assay (Fig. 4-3B). This assay is a qualitative measure of binding ability where biotin-labeled miRNAs were incubated with PMP22 RNA, separated on an agarose gel, and transferred to a membrane. The presence of intact RNA and re lative loading in each lane is confirmed using SYBR gold staining of the gel prior to transfer. The miRNA/RNA complexes were resolved using a HRP-conjugated streptavid in and the membranes were exposed to film. MiR-29a-c, -381, and -9 all demonstrate strong binding ability, with miRs-199a, 140*, and -322/424 showing weaker binding. MiR-450 does not possess any detectable binding (Fig. 4-3B). MiR124a is not predicted to target the 3UTR of PMP22 and is

PAGE 74

74 used as a negative control. RNA alone l ane only contains t he PMP22 RNA with no labeled miRNA probe. To investigate which miRNAs may be r egulating PMP22 expression in Schwann cells, we established a PMP22 3UTR-lucife rase construct with the 3UTR of PMP22 inserted downstream and in fram e with the Renilla Luciferase (RL) gene. This construct allows us to quickly and quantitatively evaluate miRNA effects on the 3UTR of PMP22. We utilized the psicheck2 dual luciferase vector that contains a separate Firefly Luciferase (FL) gene to normalize for transfect ion efficiency. The 3UTR-luciferase construct was co-transfected in Schwann ce lls with 10 nM miRNAs and the cells were harvested at 48 h post-transfect ion. MiR-29a, miR-29b, m iR-29c, miR-9, and miR-381 all significantly (*p<0.05) reduce lucifera se activity when compared to the Neg. scrambled miRNA, while miR-322/424 and miR140* do not (Fig. 4-3C). As miR-381 and miR-29a are expressed endogenously in Schw ann cells (see below in Fig. 4A), we examined if co-transfection of these two miRs may have an additive effect on reporter expression. As shown in Figure 4-3C, the co -transfection of miR381 with miR-29a does not significantly enhance the inhibitory activity of miR-29a. MiR-124a serves as a nonPMP22 targeting control to ensure that activation of the miRNA pathway alone is not affecting our PMP22 3UTR-luciferase r eporter expression. These data demonstrate that specific PMP22 target ing miRNAs reduce reporter expression in Schwann cells. MicroRNAs are Differentially Expressed in Schw ann Cells Upon Growth Condition To substantiate the potential functional significance of PMP22 targeting miRNAs, we next determined the miRNA expression profile (microRNAome) of actively proliferating compared to non-proliferating Schwann cells. Several miRNAs demonstrate differential expression based u pon growth condition (Fig. 4-4A). In

PAGE 75

75 addition, miRNAs predicted to target PMP22 ar e expressed by Schwann cells, including miR-29a, miR-381 and miR140* (Fig. 4-3A). The relative expression of these particular miRNAs is consistent among t he independent triplicate sample s (Fig. 4-4B). MiR-9 was not detected in this microarray, nor was it found to be expressed in Schwann cells by RT-PCR or Northern blot indica ting that this miRNA likely to regulate PMP22 expression in other cell types. We validated the microarray data for miR-29a, miR-381 and miR140* using RT-PCR (Fig. 4-4C). MiR-124a is included as a negative control since it was not detected by the microa rray, or by RT-PCR. In agreement with the microarray data, the RT-PCR demonstrates that miR-29a is significant ly (*p<0.05) down-regulated when the cells are promoted to differentiate. We observed a similar repression of miR29a when Schwann cells are cultured in a r educed serum medium (d ata not shown). Based on the observed inverse correlation of miR-29a and PMP22, we decided to further characterize this specific miRNA in Schwann cells. MicroRNA-29a Specifically Regu lates PMP22 Repor ter Expression To demonstrate that t he endogenous Schwann cell miR-29a is regulating the expression of PMP22, we employed miRNA inhibitors (ant i-miRs). As shown before (Fig. 4-3C), luciferase assays were perfo rmed with the 3UTR-luciferase construct where miR-29a reduces reporter expression (Fig. 4-5A). More importantly, the anti-miR29a relieves the repression by the endogenous miR-29a, as comp ared to the Neg. control. In comparison, inhibition of ot her predicted PMP22 targeting miRNAs, including miR-381, miR-322/424, and miR-140*, does not relieve the repression of the reporter (Fig. 4-5B). These results indicate t hat although both miR-29a and miR-381 can reduce luciferase signal when their levels are elev ated via transfection, only endogenous miR29a is actively repressing PMP22 expression.

PAGE 76

76 To locate binding sites for miR-29a in the 3UTR of PMP22 and demonstrate the specificity of the interaction, two approache s were taken. First, constructs were established that contained truncations of t he PMP22 3UTR with or without the predicted binding site at 0.66 kb past the stop codon (F ig. 4-5C). Mir-29a and the Neg. miRNA were transfected with the base psicheck2 vect or which did not contain the 3UTR of PMP22. Under these conditi ons, miR-29a does not reduce reporter signal thus eliminating off-target effects. However, in agreement with previous studies (Bosse et al. 1999), the 3UTR of PMP22 does instill a sign ificant reduction (**p<0.01) on reporter activity compared to the base vector. W hen the PMP800 construct, which contains the predicted miR-29a site, is co-transfected with miR-29a, a further reduction in luciferase activity is seen (***p<0.001). In compar ison, the PMP400 construct, in which the predicted miR-29a site is removed, demonstrates significantly greater (*p<0.05) luciferase activity than the full length 3UTR construct (Fig. 4-5D). These data indicate that the endogenous Schwann cell miR-29a regulates PMP22 expression. Since the 3UTR of PMP22 contains other regulatory elements which may have been deleted in the truncations, we employ ed a second approach to demonstrate the specificity of miR-29a on the 3UTR of PMP22, using site-directed mutagenesis. We deleted the 7 nt seed region in the predicted miR-29a binding site (Fig. 4-5E), which eliminated the reduction in luciferase activity (Fig. 4-5F). However, experiments with the non-mutated 3UTR performed in parallel still retain the miR-29a associated repression of reporter signal (Fig. 4-5F). These results validate the s pecificity of the interaction between miR-29a and the 3UTR of PMP22.

PAGE 77

77 Endogenous Schwann Cell PMP22 is Regulated by MiR-29a A recently developed biochemical approach to determine miRNA targets (Karginov et al. 2007) utilizes the knowledge that the Argonaute proteins of the RISC complex bind to target RNAs to exert repre ssion (Meister et al. 2004). Thus if the Argonaute (Ago2 in these experiments) protein is immunopr ecipitated primed with exogenous miRNA, the precipitated protein should show an enhanced association with the PMP22 RNA. To determine if increasing miR-29a levels in Schwann cells has an influence on the association of PMP22 RNA wit h Ago2, we co-transfected a c-myc-Ago2 construct with miR-29a, or the scrambled Ne g. miRNA. Western blot analysis with antic-myc antibody shows efficient and specific immunoprecipitation (IP) of the c-myc-Ago2, as compared to beads conjugated to non-specif ic rabbit IgG (Fig. 4-6A). The same experiments performed with non-tr ansfected cells is shown on the right, and serves as a negative control. Next, RNA was isolated from all the IP fractions, including input, IP beads, and post-precipitation supernatant (Sup) and semi-quantitative RT-PCR was performed on equal amounts of RNA. In the input samples, co -transfection of miR-29a and c-myc-Ago2 significantly reduces (*p<0.05 ) the levels of steady-state PMP22 RNA when compared to the Neg. m iRNA (Fig. 4-6B). In addition, cells with c-myc-Ago2 primed with miR-29a contain the majority of the PMP22 RNA asso ciated with the Ago2 protein, pulled down in the c-myc IP fraction (***p<0.001, Fig. 4-6B). Non-specific rabbit IgG conjugated beads do not precipitate any detectable PMP22 RNA, which remained in the post-precipitation Sup fraction. Thes e data indicate that even in the Neg. miRNA transfected cells, endogenous PMP22 RNA is associated with Ago2. Significantly, when the abundance of miR-29a is elevated, t he amount of PMP22 in complex with Ago2 further increases. Therefore, t he endogenous PMP22 RNA is regulated via the

PAGE 78

78 RISC complex in Schwann cells and when t he levels of miR-29a are increased, this interaction is enhanced. To further show that miR-29a regu lates endogenous PMP22 in Schwann cells, we transfected the cells with miR-29a, anti-miR-29a, and Neg. miR, followed by protein analysis 72 h later (Fig. 4-7A). Transfe ction of miR-29a reduces steady-state PMP22 protein levels in Schwann cells when compar ed to the Neg. miRNA control. However, when endogenous miR-29a is inhibited via tr ansfection of anti-miR-29a, the steadystate levels of PMP22 protein are greater than in Neg. cont rol miRNA cells (Fig. 4-7A). Quantification of four indepen dent experiments reveals t hat miR-29a reduces PMP22 protein levels by approximately 45%, when compared to Neg. controls (*p<0.05). Furthermore, inhibition of endogenous miR-29a results in a significant increase in steady-state PMP22 protein levels (**p<0.01, n=4) (Fig. 4-7B). Since miRNA-mediated gene regulation can ultimately reduce the steady -state levels of the target RNA (Wu and Belasco 2008), we used real-time RT-PCR to determine the effect of miR-29a on PMP22 RNA. In cells with elevated miR-29a, the levels of PMP22 message are reduced, as compared to control (Fig. 4-7C ). In comparison, when endogenous miR29a is inhibited, the steady-state levels of PMP22 RNA are significantly (*p<0.05) elevated. Taken together, these results demonstrate that miR-29a actively modulates PMP22 expression within Schwann cells, which can be detected bot h at the protein and RNA levels. PMP22 and MiR-29 Expression are Inversely Correlated In Viv o PMP22, both RNA and protein, expression increases as the nerve develops and as the Schwann cells differentiate and synthesis myelin (Garbay et al. 2000; Snipes et al. 1992). To investigate an in vivo corre lation between PMP22 and miR-29a levels in

PAGE 79

79 rat sciatic nerve, animals were sacrificed at post-natal day 2, 4, 8, 16, and 21 and their sciatic nerves were collected. In rats, the pr ocess of myelination occurs post-natally and is believed to be completed by P21 (Garbay et al. 2000), justifying the time-points for these experiments. To obtai n adequate RNA for these experim ents at least two animals were pooled per sample and three independent samples were analyzed for each timepoint. Total RNA, containing small RNA mo lecules including miRNAs, was isolated from the nerves. Q uantitative RT-PCR reveals that PM P22 RNA expression in sciatic nerve steadily increases with age reaching a maximal level at P16 (Fig. 4-8A). The same samples were analyzed for miR-29a ex pression using RT-PCR and it is shown that miR-29a levels are the highest at P2, but by P4 its expression has been significantly reduced and remains low at the la ter time points (***p<0.001, Fig. 4-8B). To determine a correlational relationship between PMP22 and miR-29a levels, a linear regression analysis was performed (Fig. 4-8C). There is a significant correlation between the two expression levels with incr eased miR-29a levels being associated with decreased PMP22 expression (r2=0.78, p< 0.05). These data reveal an inverse relationship between PMP22 and miR-29a levels in vivo supporting that Schwann cell differentiation state affects the miRNA profile expression during sciatic nerve development. To further investigate a functional re lationship between PMP 22 and miR-29, RNA and protein from mice subjected to sciatic ner ve crush injury were analyzed. It is establish that post-crush injury, Schwann cell s de-differentiate and proliferate allowing the axon to heal (Jessen and Mirsky 2008). The myelin genes, including PMP22, are down regulated rapidly post-injury (Bosse et al. 2006; Snipes et al. 1992). MiRNA

PAGE 80

80 microarray analysis of control and crush injured nerves revealed that miR-29b to be the predominate form of miR-29 expressed in res ponse to nerve injury. MiR-29 levels were low in mature myelinated nerve and there wa s an approximately 2-fold increase in miR29b expression at 4 d post-injury, as detected by microarray (data not shown). MiR-29a and miR-29b have identical bind ing regions and are located in the same miRNA cluster in the mouse, rat, and human genome. MiR-29b has the same predicted binding site in the 3UTR of PMP22 as miR-29a and it is possible that mice preferentially use the miR29b form over the miR-29a that is used in rat. In addition as shown in Fig. 4-3C, both miR-29a and miR-29b had simila r effects on the PMP22 3UTR-luciferast reporter expression. We show here that PMP22 RNA (Fig. 4-9A) and protein (Fig 4-9B) are reduced post-injury when compared to control, in agreement with the current literature (Bosse et al. 2006; Snipes et al. 1992). To validate the microa rray results, miR-29b levels were determined using quantitativ e RT-PCR on RNA isolated from crush and control nerves. In agreement with the microarray data, m iR-29b levels are elevated in nerve subjected to crush injury when compared to control (*p<0.05, Fig. 4-9C). These data provide additional support to the hypothesis of a func tional relationship between miR-29 and PMP22 in sciatic nerve as we ll as implicate the miRNA pathway in peripheral nerve repair. Discussion Myelin gene expression is regulated by transcriptional and post-transcriptiona l events (Svaren and Meijer 2008; Wegner 2000b) and here we show that functional RNA molecules within glia are involved in this process. Specifically, we found differential miRNA expression profiles bas ed upon Schwann cell phenotype, which also correlates with an induction of Dicer and GWB formation. The expression of PMP22

PAGE 81

81 inversely correlates with Dicer, and steady-state PMP22 levels can be increased by the inhibition of Dicer. In addition, we dem onstrate that several miRNAs present in Schwann cells bind to the 3UTR of PMP22 and are able to reduce the expression of a luciferase reporter. Although a number of miRNAs had negative effects on reporter expression, only the inhibition of endogenous miR-29a relieved the miRNA-mediated repression, supporting a functional rela tionship between miR29a and PMP22. In agreement, miR-29a specifically interacts with the 3'UTR of PM P22 regulating the expression of the endogenous PMP22 protein and RNA and the expression of miR-29 and PMP22 are inversely correlated in vivo. GWBs are the main sites of miRNA-medi ated gene regulation in the cell (Ding and Han 2007; Liu et al. 2005) and the formation of these structures appears to be regulated with the cell cycle (Lian et al. 2006; Yang et al. 2004). We detect ed GWBs in Schwann cells, and in agreement with previous reports (Yang et al. 2004), their formation is increased when cellular division is stimulat ed (Fig. 4-1). These data indicate that although GWBs are present in non-prolifer ating Schwann cells, they may be more important during cellular division. It will be of interest to determine if Schwann cells require GWBs and/or miRNA regulation to retain their mitotic ability in the mature peripheral nerve, which is necessary for r epair upon axonal injury (Clemence et al. 1989). An impairment of miRNA processing may reduce the abilit y of the cells to divide and remyelinate post-injury. Dicer, an essentia l miRNA biogenesis prot ein, is required for developmental processes and has been implicated in disease states, including retinal degeneration, abnormal neuronal spine length, heart failure, and skeletal muscle development (Chen et al. 2008; Damiani et al 2008; Davis et al. 2008; O'Rourke et al.

PAGE 82

82 2007). The data presented in this report indica te that Dicer expression in Schwann cells is differentially regulated depend ing on the growth condition. These findings are in accord with the observations that miRNA regu lation appears to be important in cell cycle control (Carleton et al. 2007; Vasudevan et al. 2008). In agreement with the growth regulatory activity of PMP22 (Zoidl et al 1995), Dicer and PMP22 pr otein levels have an inverse relationship in Schwann cells, which can be utilized to modify PMP22 expression (Figs. 4-1 & 4-2). Our data suggest that loss of Dicer expression or function could be detrimental to Schwann cell biology by leading to alteration in PMP22 levels. Using biochemical and molecular approac hes, we have identified miR-29a as a regulator of PMP22 in Schwann cells. We employed current prediction programs to assemble a list of potential PMP22-tar geting miRNAs (Fig. 4-3) and compared their relative expression to PMP22 levels usi ng microarrays (Fig. 4-4). MiR-29a expression inversely correlates with the levels of PMP22, which may signal a functional relationship. Although three miRNAs are abl e to down regulate the 3UTR-luciferase reporter (Fig. 4-3C), miR-29a is the only tested endogenous miRNA that when inhibited in rat Schwann cells, leads to increased lucifera se activity (Fig. 4-5B). While miR-381 is also expressed in Schwann cells and can repr ess reporter expression when transfected (Figs. 4-3 and 4-4), inhibition of endogenous miR-381 does not relieve the repression of the reporter (Fig. 4-5B). Therefore, mere binding ability alone does not necessarily dictate functionality in vitro. The de-r epression observed with miR-29a anti-miRNA and the maximal effect on the luciferase assa ys identifies endogenous m iR-29a as a critical miRNA governing PMP22 expression in Schw ann cells. In addition, we demonstrate that miR-29a represses the luciferase reporter by binding at one specific region on the

PAGE 83

83 3UTR of PMP22 (Fig. 4-5F). The deleti on of the predicted binding site, which is conserved between rat, mouse, human, and chicken (http://www.targetscan.org/), abolishes the miR-29a dependent repression. However, since the miR-29a seed deletion construct did not have greater luciferase signal then the intact 3UTR in presence of the Neg. miR (Fig. 4-5F), we cannot eliminate the c ontribution of other regulatory domains in the 3 UTR of PMP22. AU-rich el ements have been implicated in miRNA-mediated repression (Jing et al. 2005) and the 3UTR of PMP22 contains three such regions (Bosse et al. 1999), one in clos e proximity to the pr edicted miR-29a seed target site. In support of a functional role of miR-29a in regulating endogenous PMP22, we co-immunoprecipitated Argonaute 2(Ago2), the catalyti c component of the RISC, primed with exogenous miR29a, and PMP22 RNA (Fig. 4-6). This result is a powerful qualitative measure to confirm PMP22 as a ta rget RNA for miR-29a. Future studies will examine if other myelin gene RNAs are asso ciated with this complex in Schwann cells. Schwann cells exist in at least two different phenotypes in the adult nervous system, myelinating and non-mye linating, and can transition between the two states upon injury (Garbay et al. 2000; Jessen and Mirsky 2008). Both of these processes, namely myelination and cellula r division, require a rapid and extensive change in gene expression (Scherer and Chance 1995). Here we characterize the miRNAome of actively-dividing Schwann cells and compare it to non-proliferating cells cultured in defined media (Cheng and Mudge 1996). There is unique expression of miRNAs based upon growth condition (Fig. 4-4), suggesting there are different subsets of genes that are post-transcriptionally r egulated depending on the cells phenotype. It is also possible that certain genes are preferent ially regulated by miRNAs in one of these

PAGE 84

84 growth conditions. Our data suggest that PM P22 is regulated by miRNAs primarily in proliferating cells where the expression of miR-29a is highest (Fig. 4-4). Other PMP22 binding miRNAs that did not change their relative expression levels might be implicated in conferring cellular identity and controlling leaky transcription (Mattick and Makunin 2005). Such mechanism would support the detection of PMP 22 RNA throughout the body and the restricted distribut ion of the protein (Amici et al. 2006; Baechner et al. 1995). Therefore, PMP22 is likely regulated by miR-29, and additional miRNAs in nonneural tissues, as well. Our examination of miR-29 expression during rat sciatic nerve development (Fig. 4-8) suppor ts our hypothesis that the miRNA expression profile of Schwann cells is dependant on the different iation state. The inverse relationship between miR-29a and PMP22 levels not only supports a function role for miR-29 expression in vivo but also implicates t he miRNA pathway in nerve development. It will be of interest to determine t he target messages of the additi onal differentially regulated miRNAs in Schwann cells and search for thei r possible roles in neuropathic states or developmental abnormalities as well as det ermine the axonal verses Schwann cell contribution to miRNA expression during development. MiRNAs have been implicated in several disease phenotypes, including Alzheimers disease, cancer and heart dis ease (Blenkiron and Miska 2007; Hebert et al. 2008; van Rooij and Olson 2007). Not only has misexpression of miRNAs been associated with diseases, but novel therapeu tic approaches utilizing artificial miRNAs for treatment have recently been described (Hammond 2006; McBride et al. 2008). Although no reports have directly associat ed miRNA regulation with peripheral nerve health, recent observation have shown that PN S axons in vivo and in vitro contain

PAGE 85

85 functional effector complexes (Murashov et al. 2007) as transfection with siRNAs into distal axons selectively downregulated the target and abolished Sema3A-dependent growth cone collapse (Hengst et al. 2006). Since siRNA and miRNA pathways share common effector proteins, these observations indicate that peripheral nerve function may be regulated by the miRNA biosynthet ic pathway. In addition, the recent identification of patients with auto-immunity to GWBs su ggests such a role for miRNA process in peripheral nerve health (Bhanji et al. 2007). Clinical studi es indicate that these patients most often present with motor and sensory peripheral neuropathy. Although it is not known whether the resulting neuropathy is axonal or glial in origin, it is tempting to hypothesize that any impairment in the miRNA machinery in Schwann cells may alter myelin gene expression and lead to neuropathy. Since certain myelin genes, including PMP22, are dose-sensitive (Berger et al. 2006), loss of a required regulatory process could result in abnormal gene dosages, a mechanism known to lead to disease (Roa et al. 1991). The elevated levels of miR-29 in response to sciatic nerve crush injury and the inverse relationship to PMP22 (Fig. 4-9) suggest that the miRNA pathway responds to nerve injury and may be involved in the regulation of the demyelination process as well as the developmental regul ation of myelin genes. Future studies will further elucidate and characterize the m iRNA response to nerve crush injury and determine the axonal and Sc hwann cell contributions. Recent studies detected miR-29a repressed in lung canc er (Fabbri et al. 2007), and to target Mcl-1 expression (Mott et al. 2007), as wells as Tcl1 levels (Pekarsky et al. 2006). In the central nervous system, the expr ession of MiR-29a is high in astrocytes (Smirnova et al. 2005), although the functional significance of this finding is

PAGE 86

86 undetermined. The linkage of miR-29a to th ese different paradigms support the hypothesis that each miRNA can regulate many genes (Valencia-Sanchez et al. 2006). MiRNAs have been shown to exert their f unction by either signaling for mRNA degradation via siRNA-like mec hanisms, or inhibiting translation (Bagga et al. 2005; Pillai et al. 2005). We provide evidence t hat miR-29a ultimately does lead to reduced steady-state PMP22 RNA levels (Fig. 4-7C). It is currently unknown if other myelin genes, such as myelin basic protein or my elin protein zero, are co-regulated by the same miRNAs. Myelin basic protein message has been shown to be translationally repressed and transported for local synthesis in oligodendrocytes (Gould et al. 2000), a mechanism that may involve miRNAs. Nevertheless, it appear s that the miRNA regulation of PMP22 may be cell-type specific. Related studies in oligodendrocytes indicate that additional brai n-enriched miRNAs target PMP22 in the central nervous system (Lau et al. 2008). Together, these da ta show that the individual miRNAome of the cell may contribute to refining the genet ic profile, whereas more than one miRNA may target a specific RNA dependent on cell type. In conclusion, here we demonstrate that a disease-associated peripheral myelin gene is regulated by miRNAs. Elucidating this pathway will provide novel insights to the understanding of the molecula r signals and mechanisms required for myelination. In addition, miRNAs may be therapeutic tools fo r diseases associated with altered gene dose in glial cells, such as in demyelinati ng neuropathies. Future studies will seek to further characterize the role of miRNAs in the myelination process, sciatic nerve development and in peripheral nerve injury. Note

PAGE 87

87 The work presented in this chapter was published in Glia 2009 Sep;57(12):126579. Jonathan D. Verrier and Pierre Lau plan ned and performed all ex periments. Lynn D Hudson, Alaxander Murashov, Rolf Ren ne and Lucia Notterpek aided in planning the experiments, provided critical reagents and edited the manuscript.

PAGE 88

88 Figure 4-1. GW body formation and Dicer expression are enhanced in activelyproliferating Schwann cells. A) Rat Schw ann cells were subjected to growth arrest and then induced to divide. Cell s were fixed and labeled with a human anti-GWB antibody. Hoechst dye is used to visualize nuclei. The inset in the upper right corner represents a no primary antibody control. Scale bar, 10 m. B) Western blot a nalysis on total lysates of proliferating and nonproliferating (non-prolif.) cells are shown using the indicated antibodies. Phospho-Histone H3 (pH-H3) serves as a mitotic marker. C) Upon incubation of the cell lysates with PNGase F (N), the indicated ~22 kDa PMP22 bands shift to the core 18 kDa core protein (*). C: no enzym e control. (B, C) GAPDH serves as a loading control. D) Q uantification reveal s increased PMP22 expression in non-prolifer ating cells (n=3,**p<0. 01). E) Quantification demonstrates that Dicer expression is upregulated in proliferating cells (n=3,*p<0.05). (D, E)

PAGE 89

89 Figure 4-2. Suppression of Dicer increases PMP 22 levels. A) In whole cell lysates the suppression of Dicer by siRNA is c onfirmed using an anti-Dicer antibody. Increased PMP22 protein is observed in cells transfected with Dicer siRNA. B) Quantification reveals that inhibi tion of Dicer expression results in an increase in PMP22 protein levels, as compared cells transfected with Neg. siRNA (n=3,*p<0.05) C) Dicer suppression is conf irmed by immunolabeling using an anti-Dicer antibody (green). Incr eased PMP22 protein in cells treated with Dicer siRNA is detected using an anti-PMP22 antibody (red). Hoechst dye is used to visualize nuclei. Scale bar, 10 m.

PAGE 90

90 Figure 4-3. The binding and r egulatory ability of predicted PMP22 targeting miRNAs. A) MiRNAs that are predicted to bind to t he 3UTR of PMP22 and the location of the binding sites are shown. B) Bindi ng of candidate miRNAs are detected as miRNA/PMP22 RNA complexes by a gel shift assay. C) Luciferase assays were performed after co-transfection of the PMP22 3UTR luciferase reporter construct and the indicated miRNA-precur sors. All three isoforms of miR-29 (a, b and c), miR-381 and miR-9 show repression of luciferase signal compared to the Neg. miR (*p<0.05, n=3)

PAGE 91

91 Figure 4-4. Growth conditions alter the miRNA expression profile of Schwann cells. A) The miRNA expression profiles of Schw ann cells grown in serum-containing (proliferating) or defined medium (nonproliferating) were determined using an Exiqon microarray (n=3 for each conditi on, color scale bar indicates foldchange). B) Three miRNAs predicted to target the 3UT R of PMP22 are expressed in Schwann cells and show unique profiles upon growth condition. C) The expression of predicted PMP 22 regulating miRNAs was validated using RT-PCR. MiR-29a and miR-381, but not miR-140*, are reduced in proliferating, as compared to non-proliferating Schwann cells (*p<0.05, n=3). MiR-124a serves as a negative control.

PAGE 92

92 Figure 4-5. miR-29a regulates PMP22 3UTR-luciferase reporter expression through one specific binding site. A) Co-trans fection with the reporter construct and miR-29a, or anti-miR-29a, leads to a r eduction or increase in luciferase activity, respectively (**p<0.01, n=4) B) Inhibition of miR-322/424, miR-381, and miR-140* does not significantly increase PMP22 3UTR reporter expression when compared to Neg. cont rol (n=3, p>0.05). C) Schematic representation of PMP22 3UTR truncation constructs The predicted miR-29a binding site is indicated at 0.66 kb after the stop codon (g rey line). D). MiR29a has no effect on the empty psicheck2 vector, but significant (**p<0.01) repression is observed with the PM P22 3UTR construct. The PMP400 fragment demonstrates greater lucifera se activity (*p<0.05), whereas the PMP800 construct has less compared to the 3UTR + Neg. control (***p<0.001, n=4). E) A schematic depict ing the deletion of the predicted 7 nt seed region for the miR-29a binding site.(F) Luciferase assays were performed after transfecting either the full length or the 29a seed Del PMP22 3UTR construct in the presence of miR-29a. The intact construct demonstrates a reduction in luciferase activity in the presence of miR-29a (*p<0.05), which is ab olished in the deleti on mutant (n=3).

PAGE 93

93 Figure 4-6. Endogenous PMP22 RNA associates with Ago2 and the interaction is enhanced by miR-29a over-expression. (A) C-myc-Ago2 transfected and nontransfected Schwann cells were process ed for immunoprecipitation (IP) using either a non-specific rabbit IgG (Rbt Ig G) or rabbit anti-c-myc conjugated (cmyc IP) agarose beads. West ern blot using an anti-c-myc antibody shows enrichment of c-myc-Ago2 in the IP fraction compared to the input, with no enrichment in the control Rbt IgG IP sa mple. (B) RNA was isolated from total cell lysates (input), IP fractions (IP) and post-immunoprecipitation supernatants (Sup), from the samples anal yzed in panel A. Semi-quantitative RT-PCR was performed using primers specific for PMP22 RNA. The cells transfected with miR-29a show less to tal PMP22 RNA compared to Neg. control (n=4, *p<0.05). There is an approximately 4-fold increase in the PMP22 bound to Ago2 when the cells are co-transfected with miR-29a compared to the Neg. m iRNA (n=4, ***p<0.001).

PAGE 94

94 Figure 4-7. miR-29a regulat es endogenous PMP22 levels in Schwann cells. A) Schwann cells were transfected with N eg. miR, miR-29a, or anti-miR-29a and harvested for protein analysis. The increase of miR-29a reduces PMP22 protein, while the anti-miR-29a results in elevated steady-state PMP22 levels. B) Quantification reveals that transfection of miR-29a reduces steady-state PMP22 levels (n=4,*p<0.05), while inhibition of endogenous miR-29a relieves the miRNA-mediated repression (**p<0.01) PMP22 levels were normalized to GAPDH. C) Quantificat ion of real-time RT-PCR experiments on RNA from Schwann cells transfected with Neg. m iR, miR-29a, or anti-miR-29a (n=4). PMP22 RNA levels in cell transfected with miR-29a are significantly reduced as compared to Neg. control (***p<0. 001). Inhibition of miR-29a increases the steady-state levels of PMP22 RNA (*p<0.05).

PAGE 95

95 Figure 4-8. PMP22 and miR-29 expression are inversely correlated in developing rat sciatic nerve. A) Total RNA was isol ated from rat sciatic nerves at the indicated time points (in days). Rela tive quantitative RT-PCR reveals the expression of PMP22 RNA increases as the animals age increases. GAPDH was used to normalize for equal loading of RNA and relative change in expression (n=3, p<0.05, *** p<0.001). B) RT-PCR on the same RNA samples determines the expression of miR-29a in sciatic nerve during development (Fig. 4A) (n=3, p<0. 05, *** p<0.001). C) The relative expression levels of PMP22 (x-axis) and miR-29a (y-axis) as determined in panels A and B are plotted together. Linear regression analysis reveals that expression of PMP22 and miR-29a in developing rat nerve is highly correlated (p<0.05, r2 = 0.078).

PAGE 96

96 Figure 4-9. Nerve crush injury reduces PMP2 2 expression and elevates miR-29 levels. A) Total RNA was isolated from both c ontrol or crush injured mouse sciatic nerve. Relative expression of PMP22 was determined using quantitative RTPCR analysis. Sciatic nerve crush injury results in decreased PMP22 RNA expression at 4 d post-injury when com pared to control (each sample was run in triplicate and is a pool of 10 crush or control nerves, *** p<0.001). B) Western blot analysis of total nerve lysa tes reveals that PMP22 protein levels are reduced at 5 d post-crush injury to the nerve. C) Relative quantitative RTPCR reveals that miR-29b le vels are elevated at 4 d post-injury in mouse nerves (each sample was run in triplicate and is a pool of 10 crush or control nerves, p<0.05).

PAGE 97

97 CHAPTER 5 REDUCTION OF DICER IMPAIRS SCHWANN CELL DIFFERENTIATION AND MYELINAT ION Introduction Myelination in the peripheral nervous system (PNS) by Schwann cells permits rapid saltatory conduction of action potentials along axons. Myelin defects in the PNS are associated with diseases including inherited peripheral neuropathies, which can result from altered myelin gene dosage (Lupski and Garcia 1992; Scherer 1997; Vucic et al. 2009). For Schwann cells to initiate myelination, they need to exit the cell cycle and increase the expression of myelin-associated genes in a coordinated fashion, which is associated with significant changes in the transcriptional profile of these cells (Svaren and Meijer 2008). The transcription factors early growth response 2 (Egr2/Krox20), SRY-box containing gene 10 (S ox10), POU domain class 3 transcription factor 1 (Oct6/Scip) and POU domain class 3 transcription factor 2 (BRN2) have all been shown to be positive regulators of myelination, while c-Jun and SRY-box containing gene 2 (Sox2) promote a non-myelinating Schwann cell phenotype (Le et al. 2005; Parkinson et al. 2008; Parkinson et al. 2004; Wegner 2000b). Expression of Egr2/Krox20 is required for Schwann cells to myelinate and the myelin genes, myelin basic protein (MBP), myelin protein zero (MPZ) and myelin-associated glycoprotein (MAG) are direct targets of this critical transcription fa ctor (Svaren and Meij er 2008). In addition to transcriptional regulation, there is increas ing evidence that post-transcr iptional mechanisms involving RNA binding proteins and miRNAs play key ro les during the process of myelination in both the CNS and PNS (Lau et al. 2008; Verrie r et al. 2009; Zearfoss et al. 2008). Post-transcriptional regul ation of myelination wa s first demonstrated in oligodendrocytes. Analyses of the RNA-binding protein Quaking (QKI ) revealed that it

PAGE 98

98 interacted with the MBP mRNA and the deletion of the QK I gene reduced steady-state MBP mRNA levels (Li et al. 2000). The rela ted RNA binding proteins, QKI-6 and QKI-7, have been shown to block Schwann cell pro liferation and to promote myelination (Larocque et al. 2009). Recent studies show t hat miRNAs also play a role in regulating myelination (Kawase-Koga et al. 2009; Lau et al. 2008; Lin and Fu 2009; Verrier et al. 2009). The molecular mechanisms underlying the biogenesis of miRNA in mammalian cells has been described extensively (ValenciaSanchez et al. 2006). In brief, mature miRNAs are derived from RNA molecules t hat are selectively cleaved by the ribonuclease Drosha, exported in to the cytoplasm, and cleaved again by Dicer (Provost et al. 2002). Our understanding of the impac t of miRNAs on cellular processes, including the development of skelet al muscle, hippocampus and lung have been enhanced by studies of conditional Dicer knockout mice (Davis et al. 2008; Harris et al. 2006; O'Rourke et al. 2007). However, the ro les that miRNAs have in peripheral nerve development and on Schwann cell differentiation and myelination have not been examined. In these experim ents, we utilized an in vitro model of Schwann cell myelination and Dicer knock-down techniques to examine t he effects of miRNAs on myelination. We demonstrate that loss of m iRNA biogenesis leads to decreased steady-state levels of pro-myelination differentiation factor s in Schwann cells and an impairment of myelination. Our findings suggest that ma ture miRNAs are required for Schwann cells to switch from a proliferating, non-different iated state to a mature myelin forming cell.

PAGE 99

99 Results Inhibition of Dicer L evels in Schw ann Cells Using Dicer shRNA To determine if Dicer expression is r equired for Schwann cell differentiation and myelination we transduced primary rat Schwann cells with lentivirus carrying shRNA targeting Dicer. We chose this approach because lentiviral shRNA-mediated knockdown of gene expression is efficient in Schwann cells (Hu et al. 2005), and reducing steady-state Dicer levels can efficiently in hibit the formation of mature miRNAs (Asada et al. 2008). Cells were transduced at an MOI of 5 and then cultured in puromycin selection media for three to five days. Ef ficient selection and establishment of pure, transduced Schwann cell populations was confirm ed by direct visualization of GFP (Fig. 5-1A). The steady-state levels of Dicer protein were reduced in the Dicer shRNA Schwann cells when compared to Neg. shRNA transduced cells, as evaluated by Western blot analyses (Fig. 5-1B). Q uantification of i ndependent transductions revealed that the steady-state levels of Dic er were reduced by ~60% in the Schwann cells expressing Dicer shRNA, relative to c ontrol cells (Fig. 5-1C, n=4, ** p<0.01). These data show that it is possible to ef ficiently transduce primary rat Schwann cells with lentivirus and to reduce expression of Dicer protein using the shRNA approach. Dicer Knock-Down Impairs Sc hw ann Cell Differentiation The loss of Dicer expression has been show n to affect cellular division and differentiation (Bu et al. 2009; Carleton et al 2007). To evaluate t he effect of Dicer suppression on Schwann cell proliferation, we analyzed primary rat Schwann cells transduced with either Neg. shRNA or Dicer shRNA using a bromodeoxyuridine (BrdU) incorporation assay. After 8 hours of in cubation, BrdU incorporation was evaluated using immunostaining and colorimetric me asurements. As shown on the graph,

PAGE 100

100 suppression of Dicer levels by shRNA lead to increased Schwann cell proliferation as determined from direct cell counting (Fig. 5-2A, n=6, *p<0.05). Analyses of similarly treated cultures using an ELISA-based colo rimetric assay confirmed the increased uptake of BrdU by Dicer shRNA cells (Fig. 52B, n=6, **p<0.01). Since proliferating, undifferentiated Schwann cells are a non-mye linating phenotype (Woodhoo et al. 2009), these data suggest that under normal conditions, Dicer and likely mature miRNAs are necessary for Schwann cell differentiation. To examine the effects of Dicer shRNA on the expression levels of known Schwann cell transcription and di fferentiation factors, we analyzed total protein lysates of cultures that had been trans duced with Dicer shRNA virus (Fig. 5-2C). Dicer levels remained reduced when compared to Neg. shRNA control cells at two weeks posttransduction and selection in puromycin, indicati ng that the expression and functionality of the shRNA was maintained. The inhibiti on of Dicer expression reduced steady-state levels of the pro-myelination transcription fa ctors, Oct6 and Egr2/Kro x20, and the myelin protein MPZ. Dicer shRNA transduction also resulted in increased c-Jun expression as compared to Neg. control shRNA. Quantification of independent transductions revealed a significant decrease in Egr2 protein levels in the Dicer shRNA cells (Fig. 5-2D, n=4, **p<0.01). These data suggest that reduction of Dicer levels is associated with impairment in pro-myelin transcription factor and MPZ expression in cultured Schwann cells. Inhibition of miRNA Bi ogenesi s Impairs Schwann Cell Myelination To further examine the effects of reduced Dicer protei n levels on myelin gene expression, we examined myelin formation in Schwann cell/DRG co-cultures. Pure populations of Schwann cells expressing the Dicer shRNA transgene were obtained

PAGE 101

101 using puromycin selection (see Fig. 5-1) and were seeded onto DRG neuron cultures. Schwann cells were allowed to proliferate through radial sorting along the axons. After two weeks of culture in mye lination promoting medium, the cells were either fixed for immunofluorescence or harvested for Wester n blot analysis. Prio r to harvesting the cells, we confirmed that the Dicer shRNA transgene was being expressed by monitoring direct GFP fluorescence in live cells (Fig. 53A). The myelination capacity of the Dicer shRNA Schwann cells was evaluated by examining MPZ protein levels in Schwann cell/DRG co-cultures that had been maintained in myelinating conditions for 2 weeks (Fig. 5-3). MPZ-like immunoreactivity was reduced in DRG cultures seeded with Schwann cells expressing Dicer shRNA compared to those expressing the Neg. shRNA (Fig. 5-3A). Western blot analyses of the myelinating Sc hwann cell/DRG co-cultures confirmed that expression of Dicer shRNA se verely reduced MPZ protein levels (Fig. 53B). Each Western blot lane represent s an independent co-culture to demonstrate reproducibility of the observed phenotype. In comparison, the level of neurofilament medium chain (NF-M) was similar in the sa mples. These observations support our hypothesis that Dicer and miRNA s plays a role in triggering Schwann cell differentiation and myelination. We also examined the effects of r educed Dicer expression on Schwann cell myelination by monitoring the levels of MBP, a component of compact myelin (Fig. 5-4). The expression of Neg. shRNA vector alone di d not affect the ability of Schwann cell to form mature myelin (Fig. 5-4A ). Schwann cells expressi ng MBP and GFP were readily detected in myelinating co-cultures (arro ws). Non-transduced Schwann cells (GFP negative) in the cultures were also positiv e for MBP (arrowheads) and represented only

PAGE 102

102 a small fraction of the total myelin observed. Western blot analyses of Schwann cell/DRG co-cultures grown under myelinat ing conditions seeded with cells expressing Dicer shRNA revealed a reducti on in the steady-state ex pression of MBP, while the levels of NF-M remained constant (Fig. 54B). GAPDH expres sion confirmed equal protein loading. Myelination formation was also evaluated by immunostaining the cultures for MBP (red, Fi g. 5-4C). Dicer shRNA cells exhibit less MBP-like immunoreactivity when compared to the Neg. control shRNA samples. To control for the presence of axons in the field of view we also probed from NF-M as a neuronal marker (blue). Similar results were obtained when Schwann cells transduced with shRNA targeting GW182, a protein require d for miRNA function, were seeded onto DRGs (Fig. A-1). To determine if reducing Dicer levels affe cts the expression of negative regulators of myelination, we analyzed myelinating co-cultures for Sox2 (Wegner 2000b). While Sox2 normally would be down-re gulated upon the initiation of myelination, it remained elevated when Dicer was suppressed (Fig. 5-5A ). Quantification of these experiments reveals a significant increase in the steady -state levels of Sox2 upon Dicer shRNA transduction when compared to control (Fig. 5-5B, n=3, p<0.05). These data support the hypothesis that loss of miRNA biogenesis impairs the ability of Schwann cells to differentiate and myelinate axons. Discussion Post-transcriptional re gulat ion of gene expression by miRNAs is important in a wide variety of cellular process (Ambros 2004) Here we investigate the effect of reducing the miRNA biogenesis protein, Dicer, on Schwann cell myelination and differentiation. We demonstr ate that inhibition of Dicer expression results in an

PAGE 103

103 increased proliferation rate in primary rat Schwann cells. In addition, the cells fail to produce myelin and maintain low levels of known Schwann cell differentiation markers (Figs. 5-2, 5-4). These ex periments reveal an essential role for miRNA regulation during Schwann cell differentiation and myelination. The correct level of Dicer expression is critical for cellular and organismal function. Dicer protein is essential for embryonic development since Dicer null animals fail to develop past E7.5 (Bernstein et al. 2003). Loss of Dicer function alters the differentiation of T-cells, embryonic stem ce lls, pancreatic islet cells, oocyte maturation, and cardiac muscle function (Muljo et al. 2005, Kanellopoulou et al 2005, Murchison et al. 2007, Lynn et al. 2007, Chen et al. 2008). Conditional deletion of Dicer in forebrain excitatory neurons leads to reduced dendritic branching and microcephaly (Davis et al. 2008). Patients with autoimmunity to the RNA -induced silencing complex associated protein GW182 often present with motor and s ensory neuropathies indicating a role in the PNS (Eystathioy et al. 2003). Recently it was shown that Dicer and Argonaute protein expression is maintained during cell ular differentiation of neurons and Schwann cells, suggesting a role for miRNA function in Schwann cell development (Potenza et al. 2009). Also we have shown that transient re duction of Dicer in Schwann cells leads to altered PMP22 expression (Verrier et al. 2009). These data implic ate miRNAs in a wide variety of developmental and disease processes, including glial differentiation. MiRNAs have been shown to be involved in cellular differentiation at both the in vitro and in vivo (Harris et al. 2006; Miska 2005). Spec ifically, in studies of myelinating glial cells, miR-23 has been shown to influence lamin B1 expression in oligodendrocytes and to modulate their development and myelin gene expression (Lin and Fu 2009).

PAGE 104

104 Also tubulin polymerization-promoting protein, which is required for oligodendrocyte myelination, has been shown to be regulated by a miRNA (Lehotzky et al. 2009). Here we reduce Dicer levels by shRNA specifical ly in Schwann cells allowing us to address the role of glial miRNAs in myelination and differentiati on (Fig 5-1). We observed decrease in Egr2/Krox20, which is in agreem ent with the reduction or apparent failure to up-regulate myelin genes when cultured with DRG neurons (Figs. 5-3 and 5-4). We also demonstrated that the known negative regulator of myelination, c-J un and Sox2, remain elevated in the Dicer shRNA cells. Thes e data imply that loss of mature miRNAs inhibits Schwann cells differentiation, a phenot ype observed in other cell types (Kapinas et al. 2009; Kawase-Koga et al. 2009). Rec ent studies in the developing CNS have revealed Dicer deletion to drastically r educe oligodendrocyte maturation (Kawase-Koga et al. 2009). These finding, in conj unction with our results, suggest a shared requirement for miRNA regulation for differentia tion of the myelinating glial cells in both the CNS and PNS. We previously demonstrated that PMP 22 expression is subject to miRNA regulation in the PNS and CNS (Lau et al. 2008; Verrier et al. 2009). In comparison, MPZ is apparently not a direct target of mi RNA repression in Schwann cells, at least under the employed in vitro conditions (Fig. 5-2). The reduction of steady-state MPZ upon transduction of Dicer shRNA is consistent with the observed effect on Egr2/Krox20 levels, which transcriptionaly controls MPZ (Jang et al. 2006; Jang and Svaren 2009). Preliminary data indicate t hat Egr2/Krox20 itself is subjected to miRNA-mediated repression in Schwann cells (Fig. A-2). It is interesting to note that PMP22 has not

PAGE 105

105 been shown to be a direct target of Egr2/K rox20, suggesting a distinct regulatory mechanism for this myelin gene. In addition to myelin gene expression, exit from cell cycle is also a marker of Schwann cell differentiation (Berger et al. 2006; Scherer 1997). Here we demonstrate that the loss of Dicer leads to increased cellular division, a characteristic of an undifferentiated Schwann cell (Fig. 2). Loss of Dicer has been associated with altered proliferation and appears to be cell type dependant. For example, cancer cell lines demonstrate reduction of cellular proliferation with miRNA depletion (Zhang et al. 2009), while others such as gliomas increase their division upon loss of specific miRNAs (Kumar et al. 2007). These findings, together with our obser vation of impaired myelin formation in Schwann cells expressing Dicer shRNA, support the hypothesis that mature miRNAs are required for Schwann ce lls to switch from a dividing, nonmyelinating cell to a differentiated, myelinating phenotype. We demonstrate that when Dice r is suppressed via shRNA, the steady-state levels of the transcription factor Sox2 is increas ed (Fig. 5-5). Sox2, along with c-Jun, are negative regulators of myeli nation and markers of immature non-myelinating Schwann cells (Jessen and Mirsky 2008; Parkinson et al 2008). The increase of Sox2 observed in Schwann cells with Dicer shRNA is in ag reement with the current literature examining miRNAs in regulating different iation (Card et al. 2008; Xu et al. 2009). Previous investigations into miRNA repression of differentiation related transcription factors has revealed Sox2 to be a direct miRNA target in several cell types (Tay et al. 2008; Xu et al. 2009). In addition to being target by miRNA s, in human embryonic stem cells, Sox2 has been shown to transcribe miR-302 which in turn regulates the ex pression of several

PAGE 106

106 proteins that are involved in cell-cycle regul ation (Card et al. 2008). Sox2 transcription of miR-302 was shown to increase the proporti on of cells in S-phase and loss of Sox2 abolished the effect. It remains unclear if Sox regulates transcription of miR-302 or cellular proliferation-inducing miRNAs in Schwann cells. In addition to Sox2, we also demonstrated elevated levels of c-Jun in re sponse to Dicer shRNA (Fig. 5-2). c-Jun was previously demonstrated to regulate specific miRNA expression in karatinocytes affecting their differentiation (S onkoly et al. 2009). Whether c-Jun is directly controlling the expression of certain miRNAs in Schwa nn cells has yet to be determined. However, in addition to Sox2 and c-Jun, there are likely to be other genes that contribute to the cells failure to differentiate and myelinate. The data presented here sugges t that inhibition of the miRNA pathway in Schwann cells may lead to demyelination or dysmyelinati on (Fig. 5-2, 5-3, 5-4). It is a tempting hypothesis that this may be a contributing me chanism for the etiology of the clinical manifestations observed with autoimmunity to RISC proteins (Bhanji et al. 2007; Eystathioy et al. 2002). However, why the peripheral nerve is preferentially targeted or particularity susceptible to these phenomenon still warrants further investigation. The data presented here support additional investi gations into the signaling mechanisms that regulate specific miRNA expression. Cu rrently, targeting gene therapy specifically to the Schwann cells presents technical hur dles, including cell specific delivery, elucidating which signaling pathways regulate specific miRNA expression may be a more feasible approach. The ability to contro l an individual miRNA is a critical step to utilize specific miRNAs for t herapeutic purposes. It has been shown that both Schwann cells and oligodendrocytes display dynamic miRNA profiles during differentiation (Lau et

PAGE 107

107 al. 2008; Verrier et al. 2009). Further exper iments will investigate if axonal signals may govern the expression of m iRNAs in Schwann cells and ul timately affect their myelination. The elucidation of post-transcriptional myelin gene regulation contributes to the understanding the underlying mechanisms of myelination. The experiments discussed here suggest that mature miRNAs are ess ential for Schwann cell differentiation and the initiation of myelination. Further disse ction of the observed phenotype and molecular profile of miRNA depleted Schwann cells will provide novel in sight into which essential differentiation factors/pathways are under miRNA mediated regulation. These results will be important to understanding both the development and disease related biology of Schwann cells and how we can potentially m odulate their miRNA profile for therapeutic potential.

PAGE 108

108 Figure 5-1. Lentiviral transduction of Dicer shRNA reduces steady-state Dicer levels. (A) Schwann cell cultures were transduced with either contro l or Dicer shRNA lentiviral particles. GF P fluorescence (left panel) and phase contrast (right panel) images of live cultures are shown. Scale bar, 10 m. (B) Western blot analyses of whole cell lysates of Schw ann cells transduced with Dicer shRNA or Neg. shRNA. Molecular mass, kDa. (C) Quantification of Dicer protein levels after normalizing to GAPDH, rev eals that expression of Dicer shRNA leads to a significant reduction in the steady-state levels of Dicer protein (n=4, ** p<0.01).

PAGE 109

109 Figure 5-2. Suppression of Dicer levels results in increased proliferation and reduced expression of Schwann cell differentiation markers. ( A ) Quantification of BrdU incorporation reveals an increase in the number of labeled cells in cultures treated with Dicer shRNA, as compared to those treated with Neg. shRNA (n=6 field of view per condition, *p<0.05). ( B ) An ELISA based colorimetric BrdU incorporation assay shows a significant increase in BrdU uptake in Schwann cells treated with Dic er shRNA cells, as compared to those treated with Neg. control shRNA (n=6, ** p<0.01). ( C ) Western blot analyses of Schwann cells expressing Dicer shRNA (30 g/lane). The steady-state levels of Dicer, Oct6, Egr2 /Krox20, c-Jun and MPZ are shown. GAPDH is shown as a loading c ontrol. Molecular mass, kDa. ( D ) Quantification of independent experiments reveals that expression of Dicer shRNA leads to a significant reduction in the steady-state levels of Egr2/Krox20 protein (n=4, **p<0.01).

PAGE 110

110 Figure 5-3. MPZ protein le vels are reduced in myelinating co-cultures containing Schwann cells expressing Dicer shRNA. ( A ) Transduced Schwann cells were analyzed for MPZ expression using an anti-MPZ antibody (red). NF-M is detected (blue) to identify axons. GF P (green) indicates transduced cells. Scale bar, 20 m. (B ) Western blot analyses of NF-M and MPZ expression in Schwann cell/DRG co-cultures after two weeks in myelinating conditions. GAPDH is shown as a protein load ing control and each lane represents an independent co-culture. Molecular mass, kDa.

PAGE 111

111 Figure 5-4: Dicer shRNA transduced Schwann cells show impaired myelination in Schwann cell / DRG co-cultures. ( A ) Lentiviral Neg. shRNA transduced Schwann cells retain myelination c apacity (arrows indicate transduced myelinating cells, arrowhead denote residual non-trans duced cells). Mature myelin is detected using an anti-M BP antibody (red). GFP expression denotes transduced cells (green) and Hoechs t dye is used to visualize nuclei (blue). Scale bar, 10 m. ( B ) Western blot analysis of Schwann cell/DRG cocultures grown under myelinating conditi ons for 2 weeks reveals that Dicer shRNA impairs the production of mye lin. GAPDH is shown as a loading control. Molecular mass, kDa. ( C ) The myelination capac ity of the Schwann cells was determined using an antibody for MBP (red, left panels). The Dicer shRNA Schwann cells (bottom panels) produced fewer MBP tracts than the Neg. shRNA transduced cells (top panel s). The axonal marker NF-M is shown to demonstrate the presence of neurons (blue, right panels). Scale bar, 20 m.

PAGE 112

112 Figure 5-5. Reduction in Schwann cell Dic er levels results in increased Sox2 expression. ( A ) Western blot analysis of myelinating Schwann cell/DRG cocultures is shown using an anti-Sox2 antibody. NF-M is shown as a marker for neuronal content. GAPDH is shown as a loading control. Molecular mass, kDa. (B ) Quantification of independent experiments re veals a significant increase in the levels of Sox2 in th e Schwann cells transduced with the Dicer shRNA, as compared to the Neg. sh RNA controls (n=3, p<0.05).

PAGE 113

113 CHAPTER 6 CONCLUSIONS AND SIGNIFICANCE Overview of Findings Elegant studies have detailed the mo lecular and transcriptional machinery required for myelination (Svar en and Meijer 2008). Onl y recent ly has the contribution of post-transcriptional mechanisms governing myelin gene regulat ion been appreciated (Verrier et al. 2009; Zearfoss et al. 2008). The data presented in this dissertation reveal an essential role for miRNA-mediated gene r egulation during the process of Schwann cell myelination. We demonstr ate that not only is an indi vidual myelin gene, PMP22, regulated in both the CNS and PNS by specif ic miRNAs (Chapter 2 and 3), we show inhibition of miRNA biogenesis by Dicer reduction severely impairs Schwann cell myelination (Chapter 5). These data reveal a critical function for miRNAs in the biology of the peripheral nervous syst em and contributes to the under standing of the intricate process of myelination. Abnormal expression of myelin genes is associated with neuropathic phenotypes in humans (Lupski and Garcia 1992). Specif ically, the misexpression of PMP22 has been extensively studied and linked to a family of hereditary peripheral neuropathies (Young and Suter 2003). However, the prec ise mechanisms governing the levels of PMP22 expression have remained elusive. The regulation of this dose-sensitive, disease-linked gene by miRNAs provides novel insight into how PMP22 levels are controlled. Recent descriptions of the s hared characteristics of dose-sensitive genes include a short half-life, co mplex 3UTR and a propensity to aggregate (Vavouri et al. 2009). PMP22 possesses each of these characteristics. For example, abnormal expression or mutations in the gene are asso ciated with the formati on of intracellular

PAGE 114

114 protein aggregates (Ryan et al. 2002). In addition, the majority of PMP22 normally presents with a half-life of less than an hour (Pareek et al. 1997). To address each of these issues, approaches utilizing the Sc hwann cells endogenous protein homeostatic mechanisms have been employed (Fortun et al. 2003; Rangaraju et al. 2008). However, the experiments described in this dissertation address the functional role the 3UTR in regulating PMP22 expression. The results presented here demonstrate posttranscriptional regulation of PMP22 by m iRNAs targeting the 3UTR in both the CNS and PNS (Chapters 3 and 4). These data provi de an additional appr oach to modulate PMP22 expression, a desirable effect in pe ripheral neuropathies associated with altered PMP22 levels. PMP22 message has been shown to be regulat ed at the post-transcriptional level. While the 3UTR of PMP22 has been demonstrated to contribute a negative influence on gene expression (Bosse et al. 1999) and the message was shown to be regulated post-transcriptionally (Manfioletti et al 1990), the underlying mechanism remained undefined. Also PMP22 message has been det ected rather ubiquitously in the body, yet the protein is restricted in its expre ssion (Amici et al. 2006). In the CNS, PMP22 message is detectable in most cell types ye t the protein is only expressed at the neuroepithelial junctions (Lau et al. 2008; Parmantier et al. 1995; Taylor et al. 2004). This dissertation reveals that PMP22 transla tion in the CNS is repressed by miR-9 in developing and mature oligodendrocytes (Chapter 3). The presence of PMP22 message in oligodendrocytes is an interest ing observation since the protein is not utilized in the myelin made by the cell (Ish ii et al. 2009). The precise functions of PMP22, particularly in the CNS, still remain undefined, although its roles in myelin and

PAGE 115

115 junction formation has been demonstrated (Notter pek et al. 2001; Pareek et al. 1997). PMP22s association with the cell cycle and cellular growth lacks mechanism and remain correlational (Zoidl et al. 1995). Experiments in this dissertation confirm PMP22 message expression in the CNS, specifically in oligodendrocytes, with the lack of detectable protein, however for the first time we also show that miRNA mediated repression at least contri butes to this phenomenon. PMP22 protein is most highly expressed in the myelinating Schwann cells of the PNS (Snipes et al. 1992). The molecula r mechanisms dictating its expression in Schwann cells only partially explain the observed message and protein levels. The two transcripts found differ only in untranslated regions (Suter et al. 1994). However, their expression has not been linked to the known myelination inducing transcription factors and only correlates with cAMP levels, cell cycle and initiation of myelination (Jang et al. 2006; Wegner 2000b). The data presented here contributes to the understanding of how PMP22 expression is regulated in Schwann cells and olig odendrocytes. We demonstrate that the Schwann cells miRNA profile dy namically changes with the growth/differentiation state of the cell (Fig. 44). These data imply t hat a different subset of miRNAs is required during proliferation than is needed during differentiation. A subpopulation of these miRNAs are upregulat ed in differentiated Schwann cells, a phenomenon that we propose to be cr itical for myelination to occur (Chapter 5). It is shown here, and in recent published studies, that Schwann cells retain Dicer expression throughout differentiation (Chapter 3 and 5) (Potenza et al. 2009). It is tempting to hypothesize that some miRNAs involved in Sc hwann cell differentiation and myelination are directly regulated by cAMP levels, since this second messenger molecule is

PAGE 116

116 required for myelination. To support this hypothesis, miR-142-3p has been shown to regulate cAMP levels in T cells by tar geting adenylyl cyclase 9 (Huang et al. 2009) and miR-132 has been shown to be directly transcr ibed by CREB (Vo et al. 2005). Since Schwann cell differentiation is dependent on elevated cAMP levels, it would be of interest to investigate which miRNAs in Schwann cells are implicated in the cAMP pathway and which genes they regulate. In addition, it would be useful to determine which miRNAs themselves are elevated by increased cAMP levels in Schwann cells and if their target genes may be involved in the cells differentiation and myelination processes. Here we show that miR-29a actively modulated PMP22 mRNA and protein levels in Schwann cells (Chapter 4). In agreement with t he literature on PMP22 levels and cell cycle, miR-29a is highest in growing cells and lower in growth arrested/differentiated cells. The expression levels are inversely correlated with PMP22 and may help define the mechanism by whic h the message and protein are elevated upon growth arrest (Schneider et al. 1988). It is interesting to note that mature miR-9, the miRNA demonstrated to regulate PMP22 in the CNS, is not expressed in Schwann cells (Fig. 3-8). Recent work has detaile d the molecular machinery involved in the processing of the pre-miRNA into the mature active form (Davis and Hata 2009). Characterization of the precise mechanisms governing which miRNAs are expressed in Schwann cells aids in utilizing this pathway for therapeutic potential. The miRNA expression prof iles of both Schwann cells and oligodendrocytes are dynamic during their differentiation and matu ration. This dissertation extensively characterizes the miRNA expression prof iles of developing oligodendrocytes and Schwann cells (Chapters 3 and 4). The miRNA pathway has been show to be essential

PAGE 117

117 for both cellular differentiation and embryogenes is (Bernstein et al. 2003). Here we demonstrate that the miRNA ome of these glial cells is plas tic where there are significant changes throughout differentiation. Inte restingly in oligodendrocytes, miR-9s expression levels only change slig htly during differentiation but its target bias is greatly refined indicating an increase repression of ta rget RNAs in mature cells (Fig. 3-2). These data imply that mere expression of the miRNA is not the only contributing factor in denoting functionality. In Schwann cells, we have identified several subpopulations of miRNAs whose expression is dependent on the growth and differentiation state of the cell. The identification of these populations of miRNAs provides insight into which specific miRNAs are essential for normal Schwann cell biology. The loss of miRNA function is essential fo r life and specific organ targeted deletion of miRNAs has demonstrated dev elopmental roles in many tissues (Bernstein et al. 2003; Muljo et al. 2005; Murchison et al. 2007) We provide data here suggesting that the miRNA pathway may be essential for Schwann cells to differentiate into myelinating cells (Chapter 5). It is establish that miRNA s are involved in the differentiation process of many cell types (Ambros 2004; Miska 2005; Stefani and Slack 2008) yet there has been limited investigation into what genes and processes miRNAs modulate in the myelinating glial cells (Lau et al. 2008; Lin an d Fu 2009; Verrier et al. 2009). Recently it was shown that deletion of Dicer in oligoden drocytes greatly impairs the maturation of OPCs and ultimately affects myelination (Kaw ase-Koga et al. 2009). Here we inhibited Schwann cell Dicer expression, thus reducing miRNA levels in these cells and proceeded to induce differentiati on and myelination. The Dicer shRNA cells displayed a transcription factor profile of an immature undifferentiated Schwann cells, with reduced

PAGE 118

118 Egr2/Krox20 and Oct6 expression and enhanced c-Jun levels (Fig. 6-2). These results are strikingly similar to what has been r eported when Schwann cells are forced to remain undifferentiated (Parkinson et al. 2008) Myelination was greatly impaired in the Dicer shRNA cells when compared to control, indicating a role for mature miRNAs in differentiation and myelination of Schwann ce lls. These findings are translationally relevant whereas patients with autoimmunity to a protein required for miRNA function present with peripheral neuropathies, albeit of unk nown origin or etiology (Bhanji et al. 2007). Additionally, an antibody isolated fr om plama from a human patient with neuropathy recognized the miRNA processing bodies of Schwann cells. Data provided in this dissertation indicate that the loss of miRNA function in Schwann cells results in impaired myelination. The studies here describe the modulation of myelin gene expression and myelination by miRNAs. The further el ucidation of which particular miRNAs are implicated in Schwann cell differentiation and myelination will identify new therapeutic avenues for myelin-associated diseases. The expanded understanding of miRNAs and the elucidation of their targets will provide new ways to modulate gene expression. The miRNA pathway is an attractive avenue because the modulation of endogenous pathways is a more feasible option fo r gene regulation than the introduction of exogenous material to the genome. The introduction of artificial shRNAs in vivo has been associated with cellular toxicity and may limit their therapeutic potential (McBride et al. 2008). The observed toxicity is proposed to be due to interference with, even possible saturation, of t he endogenous miRNA pathway (Gri mm et al. 2006). These

PAGE 119

119 issues are being addressed by limiting transgene expression (John et al. 2007) and further clinical trials utilizing gene therapy are curr ently underway. Recent reviews have highlighted the potent ial ways to utilize the miRNA pathway for treatment of disease (Brown and Naldini 2009). As miRNA focused research expands, the precise signaling mechanisms governing individual m iRNA expression is beginning to be revealed. For example, recent ly it was shown in osteoblasts that miR29 is regulated through canonical WNT signalin g (Kapinas et al. 2009). MiR-29 has been shown to regulate osteoblast differentiation and extracellular matrix molecule secretion (Li et al. 2009b). The combined knowledge of these experiments presents a logical hypothesis that modulation of WNT signaling will affect miR-29 levels and thus osteoblast differentiation. Estrog en and progesterone have been shown to have opposing influences on miRNA expression in smooth muscle cells (Pan et al. 2008) suggesting a previously unappreciated conse quence of hormone replacement therapy. Also Src tyrosine kinase has been shown to influence miRNA expression in cancer cells (Li et al. 2009a), again targeting this activi ty of this kinase will have additional global effects by altering miRNA expression. These data suggest that the miRNA pathway may be influenced by currently used therapeutics in several diseases and may contribute to side effects. Continuing re search defining the signaling mechanisms governing individual miRNA ex pression will allow targeted expression/repression of desired miRNAs and enhance thei r therapeutic potential. It is predicted that 60% of human genes cont ain miRNA target sites in their 3UTR (Davis and Hata 2009). A large percentage of these sites are highly conserved throughout different species. The evolutiona ry retention of thes e regulatory regions

PAGE 120

120 implies a significant, essential role for miRN As in many cellular process, including the maintenance of vertebrate life (Bernste in et al. 2003). T he data presented here implicate miRNA-mediated gene regulation in glial biology and differentiation. Unresolved Issues and Future Studies The experiments present in this dissertati on provide novel and exc iting insight into miRNA mediated myelin gene regulation. Howe ver, the results pres ented here highlight some unresolved issues that can be address ed in future studies. The most obvious questions that arise from our findings is to determine what other genes are regulated by miRNAs in both developing and myelinating Sc hwann cells and oligodendrocytes. Also the elucidation of which miRNAs are the most critical to the process of myelination is an important issue raised by the data pres ented in the dissertat ion. Finally, the characterization of the precise mechanism by which the inhibition of Dicer leads to such a severe phenotype in Schwann cells is another major unanswered question. In these experiments, we provide microarray profiles of Schwann cells and oligodendrocytes (Chapter 3 and 4) These data sets provi de the foundation for further investigation into the genes in both cell ty pes regulated by miRNAs. Recently these data were used to demonstrate that a gene r equired for oligodendrocyte differentiation is under regulation by a miRNA (Lehotzky et al. 2009). To elucidate additional miRNA targets, gene expression arrays can be per formed on cell populations and co-cultures grown in the same conditions as the sa mples using in the described experiments (Chapters 4 and 5). The two data sets can then be employed for correlational target bias analysis bioinformatics. These experim ents would aid in narrowing the search for miRNA target genes in these cell types. Further delineation of miRNA regulated genes in myelinating glial cells would require furt her 3UTR luciferase assays followed by point

PAGE 121

121 mutagenesis to ensure specificity (as per formed in Chapters 3 and 4). Finally, overexpression and inhibition of the miRNA in the cell type of interest would demonstrate endogenous regulatory functionality. As our knowledge base increases on what factors determine a functional miRNA ta rget (Grimson et al 2007), our prediction and validation of miRNA targeted gene relationships will accelerate. The continued demonstration of functional miRNA targets w ill contribute to the understanding of glial biology and may shed light on di seases of unknown etiology. Although we obtained a drastic phenotype d ue to the inhibition of Dicer in Schwann cells, and it is logical to assume that it was due to t he alteration of miRNA biogenesis, the precise mechanism remains undefined. Reduction of Dicer was associated with impaired myelination by Schw ann cells (Chapter 5) and we propose that this may be due to impaired differentiation of the cells. Recently is was shown that Dicer and Argonaute levels are maintained during Schwann cell differentiation implicating miRNA regulation in glial cell development (Potenza et al. 2009). These data imply a requirement for maintained miRNA mediated regulation is all phases of Schwann cell development. Also it was show n that timed deletion of Dicer in OPCs leads to the inhibition of oligodendrocyte maturation, again suggesting miRNAs are required for glial cell differentiation (Kaw ase-Koga et al. 2009). To support this hypothesis in the PNS, we demonstrate t hat the Dicer shRNA Schwann cells have increased proliferation, impaired myelination and elevated le vels of markers of immature cells (Chapter 5). In addi tion to further suggest that loss of miRNAs is affecting Schwann cell differentiation, a wide variety of differentiation markers were evaluated. As expected the Schwann cells had reduced Egr2/Krox20 levels upon Dicer knock-

PAGE 122

122 down (Fig. 5-7). Although t hese data support our hypothesis, these experiments need to be performed in myelinating Schwann cell/ DRG co-cultures and the precise mechanism behind these observations remain undefined. For example, is the lack of myelin formation a result from the retained expressi on of negative regulators of myelination or from the inabi lity to respond to promyelinati ng cues from the axons? After this extended characterization of the effect of Dicer reduction in Schwann cells, experiments to match the reduced miRNAs to the factors controlling differentiation would need to be performed. As described earlier, these experiments would rely heavily on bioinformatics and laborious transfe ction and mutational analyses. Since not all of the signals and factors governing Schw ann cell myelination are known, one may need to characterize additional regulators of mye lination prior to search for the effect of miRNAs on the pathway. For example, only recently has an orphan g-protein coupled receptor been shown to regulate the intracel lular levels of cAMP in Schwann cells (Monk et al. 2009). It has been de monstrated that activation of this receptor is required for Schwann cell myelination. As the pr ecise mechanisms controlling Schwann cell differentiation and myelination become better defined, they will provide new molecular targets for miRNA rela ted investigation. One lingering hypothesis deriv ed from this dissertation, as well as years of previous studies examining PMP22 message in different tissues, is that PMP22 message itself encodes a functional RNA. PMP22 is conserved across the animal kingdom and particular regions of the message are shown to be very highly conserved (Itou et al. 2009). Bioinformatical analysis ( www.esembl.org) predicts a non-coding RNA gene, snoU13, to be located in the firs t intron of the PMP22 gene and a region that

PAGE 123

123 is highly conserved (Itou et al. 2009). S noRNAs are small functi on molecules that are not translated to protein and help guide modi fication to RNA transcripts (Kawaji and Hayashizaki 2008). Only recently has it been appreciated that snoRNA can be processed into functional mature miRNAs (Ender et al. 2008; Scott et al. 2009; Taft et al. 2009). In support of this hypothesis, rec ent estimates are that approximately 40% of known miRNAs are derived from the introns of coding genes (Winter et al. 2009). The hypothesis that the PMP22 gene does encode for a small functional RNA molecule is tempting as it would help to explain the apparent disconnect between PMP22 message and protein expression. To obtain the snoRNA/miRNA from the PMP22 gene, only transcription and not translation would be needed. It is further tempting to speculate that in CMT1A, the increased gene dos age of hypothesized RNA molecule may contribute to the observed cellular phenotypes Finally, since PMP22 expression is ubiquitously detected in tissues yet the protein expression is restricted, could other miRNAs be involved in repressing PMP22 message in these cell types? Experiments similar to those describe in this dissert ation (Chapters 3 and 4) could be utilized to determine which miRNAs silence PMP22 expre ssion in tissues such as cartilage, lung and gut. These speculations and hypotheses will need to be experimentally tested and verified. In summary, the work described here details the regulation of PMP22 by miRNAs in the myelinating glial cells of both divisions of the ner vous system. Additionally, the process of myelination in the PNS is severe ly impaired by selective inhibition of miRNA biogenesis in Schwann cells, indicating an e ssential role for the miRNA pathway in myelination. Therefore, this dissertation pr ovides the groundwork for future studies of

PAGE 124

124 the functions that individual miRNAs play in governing the onset and maintenance of myelination. The miRNA pathway, specifica lly PMP22 targeting m iRNAs, could provide new therapeutic avenues for PMP22-associ ated diseases and help determine the cause of peripheral neuropathies of unknown etiology. Ultimately, these findings expand the knowledge of glial biology, regulation of PMP22 and miRNAs in the control of PNS myelination ad differentiation.

PAGE 125

125 APPENDIX SUPPLEMENTARY DATA Figure A-1. Schwann cells transduced with GW182 shRNA show reduced myelin formation in vitro. Schwann cell trans duced with either Neg. shRNA or GW182 shRNA were seeded ont o pur e DRG neurons and allowed to myelinate for 2 weeks. Myelin formation is shown using an anti-MBP antibody (red) and less MBP-like immunoreactiviy is seen in the GW182 shRNA cultures when compared to the Neg. shRNA. Equal neuronal content is shown using an anti-NF-M antibody (blue) and GFP is shown as a marker for transduced cells (green).

PAGE 126

126 Figure A-2. Egr2/Krox20 reporter expr ession may be modulated be a dynamically regulated miRNA in Schwann cells. A) Microarray experiments performed on primary SCs subjected to either proliferation or differentiation (non-prolif) media for 48 h prior to harvest rev eals miR-140 and miR-140* expression to be dynamically regulated. B) Primary rat Schwann cells were co-transfected with an Egr2-Lucifease reporter construct and either a Neg. (non-coding) miR, miR-140 or anti-miR-140 for 48 h and then harvested for luciferase assay. MiR-140 reduced luciferase signal whil e anti-miR-140 resulted in increased signal when compared to control.

PAGE 127

127 LIST OF REFERENCES Adlkofer K, Martini R, Aguzzi A, Z ielasek J, Toyka KV, Suter U. 1995. Hypermyelination and demyelinating peripheral neuropathy in Pmp22-deficient mice. Nat Genet 11(3):274-280. Ambros V. 2004. The functions of ani mal microRNAs. Nature 431(7006):350-355. Amici SA, Dunn WA, Jr., Murphy AJ, Adams NC, Gale NW, Valenzuela DM, Yancopoulos GD, Notterpek L. 2006. Periph eral myelin protein 22 is in complex with alpha6beta4 integrin, and its absence alters the Schwann cell basal lamina. J Neurosci 26(4):1179-1189. Asada S, Takahashi T, Isodono K, Adachi A, Imoto H, Ogata T, Ueyama T, Matsubara H, Oh H. 2008. Downregulation of Dic er expression by serum withdrawal sensitizes human endot helial cells to apoptosis. Am J Physiol Heart Circ Physiol 295(6):H2512-2521. Aston C, Jiang L, Sokolov BP. 2005. Tran scriptional profiling reveals evidence for signaling and oligodendroglial abnormalities in the tempor al cortex from patients with major depressive disorder. Mol Psychiatry 10(3):309-322. Baechner D, Liehr T, Hameis ter H, Altenberger H, Grehl H, Suter U, Rautenstrauss B. 1995. Widespread expression of the peripher al myelin protein-22 gene (PMP22) in neural and non-neural tissues during murine development. J Neurosci Res 42(6):733-741. Bagga S, Bracht J, Hunter S, Massirer K, Holtz J, Eachus R, Pasquinelli AE. 2005. Regulation by let-7 and lin-4 miRNAs resu lts in target mRNA degradation. Cell 122(4):553-563. Barbarese E, Brumwell C, Kw on S, Cui H, Carson JH. 1999. RNA on the road to myelin. J Neurocytol 28(4-5):263-270. Berger P, Niemann A, Suter U. 2006. Sc hwann cells and the pathogenesis of inherited motor and sensory neuropathies (Charcot-Ma rie-Tooth disease). Glia 54(4):243257. Bernstein E, Kim SY, Carmell MA, Murchison EP, Alcorn H, Li MZ, Mills AA, Elledge SJ, Anderson KV, Hannon GJ. 2003. Dicer is essential for mouse development. Nat Genet 35(3):215-217. Bhanji RA, Eystathioy T, Chan EK, Bloch DB, Fritzler MJ. 2007. Clini cal and serological features of patients with autoantibodies to GW/P bodies. Clin Immunol 125(3):247-256. Blenkiron C, Miska EA. 2007. miRNAs in cancer: approaches, aetiology, diagnostics and therapy. Hum Mol Genet 16 Spec No 1:R106-113.

PAGE 128

128 Bolis A, Coviello S, Visigalli I, Taveggia C, Bachi A, Chisht i AH, Hanada T, Quattrini A, Previtali SC, Biffi A, Bolino A. 2009. Dlg1, Sec8, and Mtmr2 regulate membrane homeostasis in Schwann cell myelinat ion. J Neurosci 29(27):8858-8870. Bosse F, Brodbeck J, Muller HW. 1999. Post-tr anscriptional regulatio n of the peripheral myelin protein gene PMP22/gas3. J Neurosci Res 55(2):164-177. Bosse F, Hasenpusch-Theil K, Kury P, Muller HW. 2006. Gene expression profiling reveals that peripheral nerve regeneration is a consequ ence of both novel injurydependent and reactivated developmental pr ocesses. J Neurochem 96(5):14411457. Brown BD, Naldini L. 2009. Exploiting and antagonizing microRNA regulation for therapeutic and experimental applications. Nat Rev Genet 10(8):578-585. Bu Y, Lu C, Bian C, Wang J, Li J, Zhang B, Li Z, Brewer G, Zhao RC. 2009. Knockdown of Dicer in MCF-7 human breast carci noma cells results in G1 arrest and increased sensitivity to cispla tin. Oncol Rep 21(1):13-17. Bunge MB, Bunge RP. 1986. Linkage between Sc hwann cell extracellular matrix production and ensheathment function. Ann N Y Acad Sci 486:241-247. Cafferty P, Xie X, Browne K, Auld VJ. 2009. Live imaging of glial cell migration in the Drosophila eye imaginal disc. J Vis Exp(29). Card DA, Hebbar PB, Li L, Trotter KW, Komatsu Y, Mishina Y, Archer TK. 2008. Oct4/Sox2-regulated miR-302 targets cyclin D1 in human embryonic stem cells. Mol Cell Biol 28(20):6426-6438. Carleton M, Cleary MA, Linsley PS. 2007. MicroRNAs and cell cycle regulation. Cell Cycle 6(17):2127-2132. Chan JA, Krichevsky AM, Kosik KS. 2005. MicroRNA-21 is an antiapoptotic factor in human glioblastoma cells. Cancer Res 65(14):6029-6033. Chan JR, Watkins TA, Cosgaya JM, Zhang C, Chen L, Reichardt LF, Shooter EM, Barres BA. 2004. NGF controls axonal rec eptivity to myelination by Schwann cells or oligodendrocytes Neuron 43(2):183-191. Chance PF, Alderson MK, Leppig KA, Lensch MW, Matsunami N, Smith B, Swanson PD, Odelberg SJ, Disteche CM, Bird TD. 1993. DNA deletion associated with hereditary neuropathy with liability to pressure palsies. Cell 72(1):143-151. Chen JF, Murchison EP, Tang R, Callis TE, Tatsuguchi M, Deng Z, Rojas M, Hammond SM, Schneider MD, Selzman CH, Meiss ner G, Patterson C, Hannon GJ, Wang DZ. 2008. Targeted deletion of Dicer in t he heart leads to dilated cardiomyopathy and heart failure. Proc Natl Ac ad Sci U S A 105(6):2111-2116.

PAGE 129

129 Chen Y, Tian D, Ku L, Osterhout DJ, Feng Y. 2007. The selective RNA-binding protein quaking I (QKI) is necessary and suffici ent for promoting oligodendroglia differentiation. J Biol Chem 282(32):23553-23560. Chen Y, Wu H, Wang S, Koito H, Li J, Ye F, Hoang J, E scobar SS, Gow A, Arnett HA, Trapp BD, Karandikar NJ, Hsieh J, Lu QR 2009. The oligodendrocyte-specific G protein-coupled receptor GPR17 is a ce ll-intrinsic timer of myelination. Nat Neurosci 12(11):1398-1406. Cheng HL, Steinway M, Delaney CL, Frank e TF, Feldman EL. 2000. IGF-I promotes Schwann cell motility and survival via activation of Akt. Mol Cell Endocrinol 170(1-2):211-215. Cheng L, Mudge AW. 1996. Cultured Schwann cells constitutively express the myelin protein P0. Neuron 16(2):309-319. Clemence A, Mirsky R, Jessen KR. 1989. Non -myelin-forming Schwann cells proliferate rapidly during Wallerian degeneration in the rat sciatic nerve. J Neurocytol 18(2):185-192. Clop A, Marcq F, Takeda H, Pirottin D, Tordoi r X, Bibe B, Bouix J, Caiment F, Elsen JM, Eychenne F, Larzul C, Laville E, Meish F, Milenkovic D, Tobin J, Charlier C, Georges M. 2006. A mutation creating a pot ential illegitimate microRNA target site in the myostatin gene affects muscula rity in sheep. Nat Genet 38(7):813-818. Cohen RI, Rottkamp DM, Maric D, Barker JL Hudson LD. 2003. A role for semaphorins and neuropilins in oligodendrocyte guidanc e. J Neurochem 85(5):1262-1278. Colognato H, Baron W, Avellana-Adalid V, Relvas JB, Baron-Van Evercooren A, Georges-Labouesse E, ffrenchConstant C. 2002. CNS integrins switch growth factor signalling to promote target-depende nt survival. Nat Cell Biol 4(11):833841. Court FA, Sherman DL, Pratt T, Garry EM, Ribchester RR, Cottrell DF, FleetwoodWalker SM, Brophy PJ. 2004. Restricted growth of Schwann cells lacking Cajal bands slows conduction in myelinated nerves. Nature 431(7005):191-195. Damiani D, Alexander JJ, O' Rourke JR, McManus M, Jadhav AP, Cepko CL, Hauswirth WW, Harfe BD, Strettoi E. 2008. Dicer inactivation leads to progressive functional and structural degeneration of the mous e retina. J Neurosci 28(19):4878-4887. Davis BN, Hata A. 2009. Regulation of Micr oRNA Biogenesis: A miRiad of mechanisms. Cell Commun Signal 7:18. Davis TH, Cuellar TL, Koch SM, Barker AJ, Harfe BD, McManus MT, Ullian EM. 2008. Conditional loss of Dicer di srupts cellular and tissue mo rphogenesis in the cortex and hippocampus. J Neurosci 28(17):4322-4330.

PAGE 130

130 Ding L, Han M. 2007. GW182 fa mily proteins are crucia l for microRNA-mediated gene silencing. Trends Ce ll Biol 17(8):411-416. Dracheva S, Davis KL, Chin B, Woo DA, Sc hmeidler J, Haroutunian V. 2006. Myelinassociated mRNA and protein expression defi cits in the anterior cingulate cortex and hippocampus in elderly schizophrenia patients. Neurobiol Dis 21(3):531-540. Dutta R, Trapp BD. 2007. Pathogenesis of axonal and neuronal damage in multiple sclerosis. Neurology 68(22 Suppl 3):S22-31; discussion S43-54. Einheber S, Milner TA, Giancotti F, Salzer JL. 1993. Axonal regulation of Schwann cell integrin expression suggests a role for al pha 6 beta 4 in myelination. J Cell Biol 123(5):1223-1236. Emery B, Agalliu D, Cahoy JD, Watkins TA, Dugas JC, Mulinyawe SB, Ibrahim A, Ligon KL, Rowitch DH, Barres BA. 2009. Myelin gene regulatory factor is a critical transcriptional regulator required for CNS myelination. Cell 138(1):172-185. Ender C, Krek A, Friedland er MR, Beitzinger M, Weinmann L, Chen W, Pfeffer S, Rajewsky N, Meister G. 2008. A human sno RNA with microRNA-like functions. Mol Cell 32(4):519-528. Eystathioy T, Chan EK, Tenenbaum SA, Keene JD, Griffith K, Fr itzler MJ. 2002. A phosphorylated cytoplasmic autoantigen, GW182, associates with a unique population of human mRNAs within novel cytoplasmic speckles. Mol Biol Cell 13(4):1338-1351. Fabbri M, Garzon R, Cimmino A, Li u Z, Zanesi N, Callegari E, Liu S, Alder H, Costinean S, Fernandez-Cymering C, Volinia S, Guler G, Morrison CD, Chan KK, Marcucci G, Calin GA, Huebner K, Croce CM. 2007. MicroRNA-29 family reverts aberrant methylation in lung cancer by targeting DNA methyltransferases 3A and 3B. Proc Natl Acad Sci U S A 104(40):15805-15810. Feltri ML, Graus Porta D, Previtali SC, Noda ri A, Migliavacca B, Cassetti A, LittlewoodEvans A, Reichardt LF, Messing A, Quat trini A, Mueller U, Wrabetz L. 2002. Conditional disruption of bet a 1 integrin in Schwann cells impedes interactions with axons. J Cell Biol 156(1):199-209. Fewou SN, Fernandes A, Stockdale K, Franc one VP, Dupree JL, Rosenbluth J, Bansal R, Pfeiffer SE. 2009. Myelin protein composition is altered in mice lacking either sulfated or both sulfat ed and non-sulfated galactolipids. J Neurochem. Finzsch M, Stolt CC, Lommes P, Wegner M. 2008. Sox9 and Sox10 influence survival and migration of oligodendrocyte precursors in the spinal cord by regulating PDGF receptor alpha expression. Development 135(4):637-646. Fortun J, Dunn WA, Jr., Joy S, Li J, Notte rpek L. 2003. Emerging role for autophagy in the removal of aggresomes in Schwann cells. J Neurosci 23(33):10672-10680.

PAGE 131

131 Franklin RJ, Ffrench-Constant C. 2008. Remyelination in the CNS: from biology to therapy. Nat Rev Neurosci 9(11):839-855. Fu H, Qi Y, Tan M, Cai J, Takebayashi H, Nakafuku M, Richardson W, Qiu M. 2002. Dual origin of spinal oligodendroc yte progenitors and evidence for the cooperative role of Olig2 and Nkx2.2 in the control of oligodendrocyte differentiation. Deve lopment 129(3):681-693. Gabriel JM, Erne B, Miescher GC, Miller SL, Vital A, Vital C, Steck AJ. 1996. Selective loss of myelin-associated glycoprotein from myelin correlates with anti-MAG antibody titre in demyelinat ing paraproteinaemic polyneu ropathy. Brain 119 ( Pt 3):775-787. Garbay B, Heape AM, Sargueil F, Cassagne C. 2000. Myelin synthesis in the peripheral nervous system. Prog N eurobiol 61(3):267-304. Garbern JY, Yool DA, Moore GJ, Wild s IB, Faulk MW, Klugmann M, Nave KA, Sistermans EA, van der Knaap MS, Bird TD, Shy ME, Kamholz JA, Griffiths IR. 2002. Patients lacking the major CNS myel in protein, proteolipid protein 1, develop length-dependent axonal degenerati on in the absence of demyelination and inflammation. Brain 125(Pt 3):551-561. Gould RM, Freund CM, Palmer F, Feinst ein DL. 2000. Messenger RNAs located in myelin sheath assembly site s. J Neurochem 75(5):1834-1844. Grau-Lopez L, Raich D, Ramo-Tello C, Naranjo-Gomez M, Davalos A, Pujol-Borrell R, Borras FE, Martinez-Caceres E. 2009. My elin peptides in multiple sclerosis. Autoimmun Rev 8(8):650-653. Grimm D, Streetz KL, Jopling CL, Storm TA, Pandey K, Davis CR, Marion P, Salazar F, Kay MA. 2006. Fatality in mice due to over saturation of cellular microRNA/short hairpin RNA pathways. Nature 441(7092):537-541. Grimson A, Farh KK, Johnston WK, Garre tt-Engele P, Lim LP, Bartel DP. 2007. MicroRNA targeting specificity in mammals: determinants beyond seed pairing. Mol Cell 27(1):91-105. Hammond SM. 2006. MicroRNA t herapeutics: a new niche for antisense nucleic acids. Trends Mol Med 12(3):99-101. Harris KS, Zhang Z, McManus MT, Harfe BD, S un X. 2006. Dicer function is essential for lung epithelium morphogenesis. Proc Natl Acad Sci U S A 103(7):2208-2213. He H, Jazdzewski K, Li W, Liyanarachchi S, Nagy R, Volinia S, Calin GA, Liu CG, Franssila K, Suster S, Kloos RT, Croce CM de la Chapelle A. 2005. The role of microRNA genes in papillary thyroid ca rcinoma. Proc Natl Acad Sci U S A 102(52):19075-19080.

PAGE 132

132 Hebert SS, Horre K, Nicolai L, Papadopoulou AS, Mandemakers W, Silahtaroglu AN, Kauppinen S, Delacourte A, De Strooper B. 2008. Loss of microRNA cluster miR29a/b-1 in sporadic Alzheimer's diseas e correlates with increased BACE1/betasecretase expression. Proc Natl Acad Sci U S A 105(17):6415-6420. Hengst U, Cox LJ, Macosko EZ, Jaffrey SR. 2006. Functional and selective RNA interference in developing axons and gr owth cones. J Neurosci 26(21):57275732. Hornstein E, Shomron N. 2006. Canalization of development by microRNAs. Nat Genet 38 Suppl 1:S20-24. Hu Y, Leaver SG, Plant GW, Hendriks WT, Niclou SP, Verhaagen J, Harvey AR, Cui Q. 2005. Lentiviral-mediated transfer of CNTF to schwann cells within reconstructed peripheral nerve grafts enhances adult reti nal ganglion cell survival and axonal regeneration. Mol T her 11(6):906-915. Huang B, Zhao J, Lei Z, Shen S, Li D, Shen GX, Zhang GM, Feng ZH. 2009. miR-1423p restricts cAMP production in CD4+C D25T cells and CD4+CD25+ TREG cells by targeting AC9 m RNA. EMBO Rep 10(2):180-185. Huxley C, Passage E, Manson A, Putzu G, Fi garella-Branger D, Pellissier JF, Fontes M. 1996. Construction of a mouse model of Charcot-Marie-Tooth disease type 1A by pronuclear injection of human YAC DNA. Hum Mol Genet 5(5):563-569. Ishii A, Dutta R, Wark GM, Hwang SI, H an DK, Trapp BD, Pfeiffer SE, Bansal R. 2009. Human myelin proteome and comparative analysis with mouse myelin. Proc Natl Acad Sci U S A 106(34):14605-14610. Itou J, Suyama M, Imamura Y, Deguchi T, Fujimori K, Yuba S, Kawarabayasi Y, Kawasaki T. 2009. Functional and com parative genomics analyses of pmp22 in medaka fish. BMC Neurosci 10:60. Jaegle M, Mandemakers W, Broos L, Zwart R, Karis A, Visser P, Grosveld F, Meijer D. 1996. The POU factor Oct-6 and Schw ann cell differentiation. Science 273(5274):507-510. Jang SW, LeBlanc SE, Roopra A, Wrabetz L, Sv aren J. 2006. In vivo detection of Egr2 binding to target genes during peripheral nerve myelination. J Neurochem 98(5):1678-1687. Jang SW, Svaren J. 2009. Induction of myelin protein zero by early growth response 2 through upstream and intragenic element s. J Biol Chem 284(30):20111-20120. Jessen KR, Mirsky R. 2005. The origin and dev elopment of glial cells in peripheral nerves. Nat Rev Neurosci 6(9):671-682.

PAGE 133

133 Jessen KR, Mirsky R. 2008. Negative regul ation of myelination: relevance for development, injury, and demyelinati ng disease. Glia 56(14):1552-1565. Jing Q, Huang S, Guth S, Zarubin T, Motoya ma A, Chen J, Di Padova F, Lin SC, Gram H, Han J. 2005. Involvem ent of microRNA in AU-ri ch element-mediated mRNA instability. Cell 120(5):623-634. John M, Constien R, Akinc A, Goldberg M, Moon YA, Spranger M, Hadwiger P, Soutschek J, Vornlocher HP, Manoharan M, Stoffel M, Langer R, Anderson DG, Horton JD, Koteliansky V, Bumcrot D. 2007. Effective RNAi-mediated gene silencing without interruption of t he endogenous microRNA pathway. Nature 449(7163):745-747. Johnson JS, Roux KJ, Fletcher BS, Fortun J, Notterpek L. 2005. Molecular alterations resulting from frameshift mutations in peripheral myelin protein 22: implications for neuropathy severity. J Neurosci Res 82(6):743-752. Kapinas K, Kessler CB, Delany AM. 2009. miR-29 suppression of osteonectin in osteoblasts: Regulation during differentia tion and by canonical Wnt signaling. J Cell Biochem 108(1):216-224. Kapsimali M, Kloosterman WP, de Bruijn E, Rosa F, Plasterk RH, Wilson SW. 2007. MicroRNAs show a wide diversity of expression profiles in the developing and mature central nervous system. Genome Biol 8(8):R173. Karginov FV, Conaco C, Xuan Z, Schmidt BH, Parker JS, Mandel G, Hannon GJ. 2007. A biochemical approach to identifying micro RNA targets. Proc Natl Acad Sci U S A 104(49):19291-19296. Karim SA, Barrie JA, McCulloch MC, Montague P, Edgar JM, Kirkham D, Anderson TJ, Nave KA, Griffiths IR, McLaughlin M. 2007. PLP overexpression perturbs myelin protein composition and myelination in a mouse model of Pelizaeus-Merzbacher disease. Glia 55(4):341-351. Kawaji H, Hayashizaki Y. 2008. Explorati on of small RNAs. PLoS Genet 4(1):e22. Kawase-Koga Y, Otaegi G, Sun T. 2009. Diffe rent timings of di cer deletion affect neurogenesis and gliogenesis in the develop ing mouse central nervous system. Dev Dyn. Kertesz M, Iovino N, Unnerstall U, Gaul U, Segal E. 2007. T he role of site accessibility in microRNA target recogni tion. Nat Genet 39(10):1278-1284. Kessaris N, Fogarty M, Iannarelli P, Gr ist M, Wegner M, Richardson WD. 2006. Competing waves of oligodendr ocytes in the forebrain and postnatal elimination of an embryonic lineage. Nat Neurosci 9(2):173-179.

PAGE 134

134 Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G. 2004. Identification of many mi croRNAs that copurify with polyribosomes in mammalian neurons. Proc Natl Acad Sci U S A 101(1):360-365. Kim JY, Sun Q, Oglesbee M, Yoon SO. 2003. T he role of ErbB2 signaling in the onset of terminal differentiation of oligodendr ocytes in vivo. J Neurosci 23(13):55615571. Kioussi C, Gross MK, Gruss P. 1995. Pax3 : a paired domain gene as a regulator in PNS myelination. Neuron 15(3):553-562. Kippert A, Trajkovic K, Raj endran L, Ries J, Simons M. 2007. Rho regulates membrane transport in the endocytic pathway to cont rol plasma membrane specialization in oligodendroglial cells. J Neurosci 27(13):3560-3570. Koenig HL, Schumacher M, Ferzaz B, Thi AN, Ressouches A, Guennoun R, JungTestas I, Robel P, Akwa Y, Baul ieu EE. 1995. Progesterone synthesis and myelin formation by Schwann cells. Science 268(5216):1500-1503. Koeppen AH, Robitaille Y. 2002. Pelizaeus-M erzbacher disease. J Neuropathol Exp Neurol 61(9):747-759. Kuhlbrodt K, Herbarth B, Sock E, Hermans -Borgmeyer I, Wegner M. 1998. Sox10, a novel transcriptional modulator in g lial cells. J Neurosci 18(1):237-250. Kumar MS, Lu J, Mercer KL, Golub TR, Ja cks T. 2007. Impaired microRNA processing enhances cellular transformation and tumo rigenesis. Nat Genet 39(5):673-677. Kye MJ, Liu T, Levy SF, Xu NL, Groves BB, Bonneau R, Lao K, Kosik KS. 2007. Somatodendritic microRNAs identified by laser capt ure and multiplex RT-PCR. RNA 13(8):1224-1234. Lai EC, Tam B, Rubin GM. 2005. Pervasive r egulation of Drosophila Notch target genes by GY-box-, Brd-box-, and K-box-class microRNA s. Genes Dev 19(9):10671080. Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Weir DB, C hoksi R, De Vita G, Frezzetti D, Trompeter HI, Hornung V, Teng G, Hartma nn G, Palkovits M, Di Lauro R, Wernet P, Macino G, Rogler CE, Nagle JW, Ju J, Papavasiliou FN, Benzing T, Lichter P, Tam W, Brownstein MJ, Bosio A, Borkhar dt A, Russo JJ, Sander C, Zavolan M, Tuschl T. 2007. A mammalian microRNA expression atlas based on small RNA library sequencing. Cell 129(7):1401-1414.

PAGE 135

135 Lappe-Siefke C, Goebbels S, Gravel M, Nicksch E, Lee J, Braun PE, Griffiths IR, Nave KA. 2003. Disruption of Cnp1 uncouples ol igodendroglial functions in axonal support and myelination. Nat Genet 33(3):366-374. Larocque D, Fragoso G, Huang J, Mushynsk i WE, Loignon M, Richard S, Almazan G. 2009. The QKI-6 and QKI-7 RNA binding proteins block proliferation and promote Schwann cell myelination. PLoS One 4(6):e5867. Lau P, Verrier JD, Nielsen JA, Johnson KR, Notterpek L, Hudson LD. 2008. Identification of dynamic ally regulated microRNA and mRNA networks in developing oligodendrocytes. J Neurosci 28(45):11720-11730. Le N, Nagarajan R, Wang JY, Araki T, Schmidt RE, Milbrandt J. 2005. Analysis of congenital hypomyelinating Egr2Lo/Lo nerves identifies Sox2 as an inhibitor of Schwann cell differentiation and myeli nation. Proc Natl Acad Sci U S A 102(7):2596-2601. Lee RC, Feinbaum RL, Ambros V. 1993. T he C. elegans heterochronic gene lin-4 encodes small RNAs with antisense comple mentarity to lin14. Cell 75(5):843854. Lee YS, Nakahara K, Pham JW Kim K, He Z, Sontheime r EJ, Carthew RW. 2004. Distinct roles for Drosophila Dicer-1 and Dicer-2 in the siRNA/miRNA silencing pathways. Cell 117(1):69-81. Lehotzky A, Lau P, Tokesi N, Muja N, Hudson LD, Ovadi J. 2009. Tubulin polymerization-promoting pr otein (TPPP/p25) is critical for oligodendrocyte differentiation. Glia. Li X, Shen Y, Ichikawa H, Antes T, Goldberg GS. 2009a. Regulation of miRNA expression by Src and contact normalizati on: effects on nonanchored cell growth and migration. Oncogene. Li Y, Wang F, Lee JA, Gao FB. 2006. MicroRNA -9a ensures the precise specification of sensory organ precursors in Drosophi la. Genes Dev 20(20):2793-2805. Li Z, Hassan MQ, Jafferji M, Aqeilan RI, Ga rzon R, Croce CM, van Wijnen AJ, Stein JL, Stein GS, Lian JB. 2009b. Biological functi ons of miR-29b contribute to positive regulation of osteoblast differentia tion. J Biol Chem 284(23):15676-15684. Lian S, Jakymiw A, Eystathioy T, Hamel JC, Fritzler MJ Chan EK. 2006. GW bodies, microRNAs and the cell cycle. Cell Cycle 5(3):242-245. Liang X, Draghi NA, Resh MD. 2004. Signaling from integrins to Fyn to Rho family GTPases regulates morphologic different iation of oligodendrocytes. J Neurosci 24(32):7140-7149.

PAGE 136

136 Lin ST, Fu YH. 2009. miR-23 regulation of lamin B1 is crucial for oligodendrocyte development and myelination. Dis Model Mech 2(3-4):178-188. Liu J, Valencia-Sanchez MA, Hannon GJ, Parker R. 2005. MicroRNA-dependent localization of targeted mRNAs to ma mmalian P-bodies. Nat Cell Biol 7(7):719723. Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25(4):402408. Lu QR, Yuk D, Alberta JA, Zhu Z, Pawlitzky I, Chan J, McMahon AP, Stiles CD, Rowitch DH. 2000. Sonic hedgehog--r egulated oligodendrocyte lineage genes encoding bHLH proteins in the mammalian central nervous system. Neuron 25(2):317-329. Lupski JR, Garcia CA. 1992. Molecular gen etics and neuropathology of Charcot-MarieTooth disease type 1A. Br ain Pathol 2(4):337-349. Maier M, Berger P, Suter U. 2002. Under standing Schwann cell-neurone interactions: the key to Charcot-Marie-Tooth disease? J Anat 200(4):357-366. Maier M, Castagner F, Berger P, Suter U. 2003. Distinct elements of the peripheral myelin protein 22 (PMP22) promoter regul ate expression in Schwann cells and sensory neurons. Mol Cell Neurosci 24(3):803-817. Maier O, Hoekstra D, Baron W. 2008. Pola rity development in oligodendrocytes: sorting and trafficking of myelin component s. J Mol Neurosci 35(1):35-53. Manfioletti G, Ruaro ME, Del Sal G, Philips on L, Schneider C. 1990. A growth arrestspecific (gas) gene codes for a membrane protein. Mol Cell Biol 10(6):29242930. Mattick JS, Makunin IV. 2005. Small regulat ory RNAs in mammals. Hum Mol Genet 14 Spec No 1:R121-132. Maurel P, Salzer JL. 2000. Ax onal regulation of Schwann cell proliferation and survival and the initial events of myelination requires PI 3-ki nase activity. J Neurosci 20(12):4635-4645. McBride JL, Boudreau RL, Harper SQ, Staber PD, Monteys AM, Martins I, Gilmore BL, Burstein H, Peluso RW, Polisky B, Carter BJ, Davidson BL. 2008. Artificial miRNAs mitigate shRNA-mediated toxicity in the brain: implications for the therapeutic development of RNAi. Proc Natl Acad Sci U S A 105(15):5868-5873. Meintanis S, Thomaidou D, Jessen KR, Mirsky R, Matsas R. 2001. The neuron-glia signal beta-neuregulin promotes Schwan n cell motility via the MAPK pathway. Glia 34(1):39-51.

PAGE 137

137 Meister G, Landthaler M, Patkaniowska A, Dorsett Y, Teng G, Tuschl T. 2004. Human Argonaute2 mediates RNA cleavage tar geted by miRNAs and siRNAs. Mol Cell 15(2):185-197. Melcangi RC, Magnaghi V, Cavarre tta I, Riva MA, Piva F, Ma rtini L. 1998. Effects of steroid hormones on gene expression of glial markers in the central and peripheral nervous system: variations induced by aging. Exp Gerontol 33(78):827-836. Michailov GV, Sereda MW, Brinkmann BG, Fischer TM, Haug B, Birchmeier C, Role L, Lai C, Schwab MH, Nave KA. 2004. Axonal neuregulin-1 regulates myelin sheath thickness. Science 304(5671):700-703. Mirsky R, Jessen KR. 1999. The neurobiology of Schwann cells. Brain Pathol 9(2):293311. Miska EA. 2005. How microRNAs control ce ll division, differentiation and death. Curr Opin Genet Dev 15(5):563-568. Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR. 2004. Microarray analysis of microRNA expression in the developing mammali an brain. Genome Biol 5(9):R68. Monje PV, Rendon S, Athauda G, Bates M, Wood PM, Bunge MB. 2009. Nonantagonistic relationship between mitogenic factors and cAMP in adult Schwann cell re-differentiation. Glia 57(9):947-961. Monk KR, Naylor SG, Glenn TD, Mercurio S, Perlin JR, Dominguez C, Moens CB, Talbot WS. 2009. A G protein-coupled rec eptor is essential for Schwann cells to initiate myelination. Science 325(5946):1402-1405. Mott JL, Kobayashi S, Bronk SF, Gores GJ. 2007. mir-29 regula tes Mcl-1 protein expression and apoptosis. Oncogene 26(42):6133-6140. Muljo SA, Ansel KM, Kanellopoulou C, Li vingston DM, Rao A, Rajewsky K. 2005. Aberrant T cell differentiation in the abs ence of Dicer. J Exp Med 202(2):261-269. Murashov AK, Chintalgattu V, Islamov RR, Lever TE, Pak ES, Sierpinski PL, Katwa LC, Van Scott MR. 2007. RNAi pathway is f unctional in peripheral nerve axons. Faseb J 21(3):656-670. Murchison EP, Stein P, Xuan Z, Pan H, Zhang MQ, Schultz RM, Hannon GJ. 2007. Critical roles for Dicer in the fema le germline. Genes Dev 21(6):682-693. Narayanan SP, Flores AI, Wang F, Ma cklin WB. 2009. Akt signals through the mammalian target of rapamycin pathwa y to regulate CNS myelination. J Neurosci 29(21):6860-6870.

PAGE 138

138 Nelson PT, Baldwin DA, Kloosterman WP, K auppinen S, Plasterk RH, Mourelatos Z. 2006. RAKE and LNA-ISH reveal micro RNA expression and localization in archival human brai n. Rna 12(2):187-191. Nobbio L, Vigo T, Abbruzzese M, Levi G, Brancolini C, M antero S, Grandis M, Benedetti L, Mancardi G, Schenone A. 2004. Impairment of PMP22 transgenic Schwann cells differentiation in culture: implicat ions for Charcot-Marie-Tooth type 1A disease. Neurobiol Dis 16(1):263-273. Notterpek L, Roux KJ, Amici SA, Yaz danpour A, Rahner C, Fletcher BS. 2001. Peripheral myelin protein 22 is a constituent of intercellular junctions in epithelia. Proc Natl Acad Sci U S A 98(25):14404-14409. Notterpek L, Ryan MC, Tobler AR, S hooter EM. 1999a. PMP22 accumulation in aggresomes: implications for CMT1A pat hology. Neurobiol Dis 6(5):450-460. Notterpek L, Snipes GJ, Shooter EM. 1999b. Te mporal expression pattern of peripheral myelin protein 22 during in vivo and in vitro myelination. Glia 25(4):358-369. O'Rourke JR, Georges SA, Seay HR, Tapscott SJ, McManus MT, Goldhamer DJ, Swanson MS, Harfe BD. 2007. Essential role for Dicer during skeletal muscle development. Dev Biol 311(2):359-368. Ohsawa Y, Murakami T, Miyazaki Y, Sh irabe T, Sunada Y. 2006. Peripheral myelin protein 22 is expressed in human c entral nervous system. J Neurol Sci 247(1):11-15. Osterhout DJ, Ebner S, Xu J, Orni tz DM, Zazanis GA, McKinnon RD. 1997. Transplanted oligodendrocyte progenitor ce lls expressing a dominant-negative FGF receptor transgene fail to migrate in vivo. J Neurosci 17(23):9122-9132. Pan Q, Luo X, Chegini N. 2008. Differential expression of microRNAs in myometrium and leiomyomas and regulation by ovarian steroids. J Cell Mol Med 12(1):227240. Pareek S, Notterpek L, Snipes GJ, Naef R, Sossin W, Laliberte J, Iacampo S, Suter U, Shooter EM, Murphy RA. 1997. Neurons promote the translocation of peripheral myelin protein 22 into myelin. J Neurosci 17(20):7754-7762. Pareek S, Suter U, Snipes GJ, Welcher AA, Shooter EM, Murphy RA. 1993. Detection and processing of peripheral myelin prot ein PMP22 in cultured Schwann cells. J Biol Chem 268(14):10372-10379. Parkinson DB, Bhaskaran A, Arthur-Farra j P, Noon LA, Woodhoo A, Lloyd AC, Feltri ML, Wrabetz L, Behrens A, Mirsky R, Jessen KR. 2008. c-Jun is a negative regulator of myelination. J Cell Biol 181(4):625-637.

PAGE 139

139 Parkinson DB, Bhaskaran A, Droggiti A, Dickinson S, D'Antonio M, Mirsky R, Jessen KR. 2004. Krox-20 inhibits Jun-NH2-termi nal kinase/c-Jun to control Schwann cell proliferation and death. J Cell Biol 164(3):385-394. Parkinson DB, Dong Z, Bunting H, Whitfield J, Meier C, Marie H, Mirsky R, Jessen KR. 2001. Transforming growth factor beta (TGFbeta) mediates Schwann cell death in vitro and in vivo: examination of c-J un activation, interactions with survival signals, and the relationship of TG Fbeta-mediated death to Schwann cell differentiation. J N eurosci 21(21):8572-8585. Parmantier E, Cabon F, Braun C, D'Urso D, Muller HW, Zalc B. 1995. Peripheral myelin protein-22 is expressed in rat and mouse brain and spinal cord motoneurons. Eur J Neurosci 7(5):1080-1088. Patel PI, Roa BB, Welcher AA, Schoener-Scott R, Trask BJ, Pentao L, Snipes GJ, Garcia CA, Francke U, Shooter EM, Lup ski JR, Suter U. 1992. The gene for the peripheral myelin protein PMP-22 is a candidate for Charcot-Marie-Tooth disease type 1A. Nat Genet 1(3):159-165. Pekarsky Y, Santanam U, Cimmino A, Palamarc huk A, Efanov A, Maximov V, Volinia S, Alder H, Liu CG, Rassenti L, Calin GA Hagan JP, Kipps T, Croce CM. 2006. Tcl1 expression in chronic lymphocytic leukemia is regulat ed by miR-29 and miR181. Cancer Res 66(24):11590-11593. Perkins DO, Jeffries CD, Jarskog LF, Thom son JM, Woods K, Newman MA, Parker JS, Jin J, Hammond SM. 2007. microRNA expre ssion in the prefrontal cortex of individuals with schizophrenia and schiz oaffective disorder. Genome Biol 8(2):R27. Pertusa M, Morenilla-Palao C, Carteron C, Viana F, C abedo H. 2007. Transcriptional control of cholesterol biosynthesis in Schwann cells by axonal neuregulin 1. J Biol Chem 282(39):28768-28778. Pillai RS, Bhattacharyya SN Artus CG, Zoller T, Cougot N, Basyuk E, Bertrand E, Filipowicz W. 2005. Inhibiti on of translational initiation by Let-7 MicroRNA in human cells. Science 309(5740):1573-1576. Potenza N, Papa U, Russo A. 2009. Diffe rential expression of Dicer and Argonaute genes during the differentiation of human neuroblastoma cells. Cell Biol Int 33(7):734-738. Provost P, Dishart D, Douc et J, Frendewey D, Samuel sson B, Radmark O. 2002. Ribonuclease activity and RNA binding of recombinant human Dicer. Embo J 21(21):5864-5874. Quarles RH. 2002. Myelin sheaths: glyc oproteins involved in their formation, maintenance and degeneration. Cell Mol Life Sci 59(11):1851-1871.

PAGE 140

140 Rangaraju S, Madorsky I, Pileggi JG, Kama l A, Notterpek L. 2008. Pharmacological induction of the heat shock response improves myelination in a neuropathic model. Neurobiol Dis 32(1):105-115. Rehwinkel J, Behm-Ansmant I, Gatfield D, Izaurralde E. 2005. A crucial role for GW182 and the DCP1:DCP2 decapping complex in miRNA-mediated gene silencing. Rna 11(11):1640-1647. Reich M, Liefeld T, Gould J, Lerner J, Ta mayo P, Mesirov JP. 2006. GenePattern 2.0. Nat Genet 38(5):500-501. Riethmacher D, Sonnenberg-Riethmacher E, Brinkmann V, Yamaai T, Lewin GR, Birchmeier C. 1997. Severe neuropathies in mice with targeted mutations in the ErbB3 receptor. Nature 389(6652):725-730. Ritz MF, Lechner-Scott J, Scott RJ, Fuhr P, Malik N, Erne B, Taylor V, Suter U, Schaeren-Wiemers N, Steck AJ. 2000. Characterisation of autoantibodies to peripheral myelin protein 22 in pa tients with hereditary and acquired neuropathies. J Neuroimmunol 104(2):155-163. Roa BB, Garcia CA, Lupski JR. 1991. Charcot -Marie-Tooth disease type 1A: molecular mechanisms of gene dosage and point muta tion underlying a common inherited peripheral neuropathy. Int J Neurol 25-26:97-107. Roux KJ, Amici SA, Notterpek L. 2004. The temporospatial expression of peripheral myelin protein 22 at the developing blood-nerve and blo od-brain barriers. J Comp Neurol 474(4):578-588. Ryan MC, Shooter EM, Notterpek L. 2002. Aggresome formation in neuropathy models based on peripheral myelin protein 22 mutations. Neurobiol Dis 10(2):109-118. Saberan-Djoneidi D, Sanguedolce V, Assouline Z, Levy N, Passage E, Fontes M. 2000. Molecular dissection of the Schwann cell specific promoter of the PMP22 gene. Gene 248(1-2):223-231. Sathyan P, Golden HB, Miranda RC. 2007. Co mpeting interactions between microRNAs determine neural progenitor surviv al and proliferation after ethanol exposure: evidence from an ex vivo m odel of the fetal cerebral cortical neuroepithelium. J Neur osci 27(32):8546-8557. Schaefer A, O'Carroll D, Tan CL, Hillman D, Sugimori M, Llinas R, Greengard P. 2007. Cerebellar neurodegeneration in the absence of microRNAs. J Exp Med 204(7):1553-1558. Scherer SS. 1997. The biology and pathobiology of Schwann cells. Curr Opin Neurol 10(5):386-397.

PAGE 141

141 Scherer SS, Chance PF. 1995. Myelin ge nes: getting the dosage right. Nat Genet 11(3):226-228. Schiffmann R, van der Knaap MS. 2004. The latest on leukodystrophies. Curr Opin Neurol 17(2):187-192. Schneider C, King RM, Philipson L. 1988. Genes s pecifically expressed at growth arrest of mammalian cells. Cell 54(6):787-793. Scott MS, Avolio F, Ono M, Lamond AI, Barton GJ. 2009. Human miRNA precursors with box H/ACA snoRNA features. PLoS Comput Biol 5(9):e1000507. Sempere LF, Freemantle S, Pitha-Rowe I, Moss E, Dmitrovsky E, Ambros V. 2004. Expression profiling of mammalian micr oRNAs uncovers a subset of brainexpressed microRNAs with possible ro les in murine and human neuronal differentiation. Genome Biol 5(3):R13. Semple-Rowland SL, Eccles KS, Humberstone EJ. 2007. Targeted expression of two proteins in neural retina using self-inac tivating, insulated lentiviral vectors carrying two internal independent promoters. Mol Vis 13:2001-2011. Simons M, Trotter J. 2007. Wrapping it up: the cell biology of myelination. Curr Opin Neurobiol 17(5):533-540. Smirnova L, Grafe A, Seiler A, Schumacher S, Nitsch R, Wulczyn FG. 2005. Regulation of miRNA expression during neural cell spec ification. Eur J Neurosci 21(6):14691477. Snipes GJ, Suter U, Welcher AA, Shooter EM. 1992. Characterization of a novel peripheral nervous system myelin pr otein (PMP-22/SR13). J Cell Biol 117(1):225-238. Sohn J, Natale J, Chew LJ, Belachew S, Cheng Y, Aguirre A, Lytle J, Nait-Oumesmar B, Kerninon C, Kanai-Azuma M, Kanai Y, Gallo V. 2006. Ident ification of Sox17 as a transcription factor t hat regulates oligodendrocyt e development. J Neurosci 26(38):9722-9735. Sonkoly E, Wei T, Pavez Lorie E, Suzuki H, Kato M, Torma H, Stahle M, Pivarcsi A. 2009. Protein Kinase C-D ependent Upregulation of miR-203 Induces the Differentiation of Human Kerati nocytes. J Invest Dermatol. Stark A, Brennecke J, Bushati N, Russe ll RB, Cohen SM. 2005. Animal MicroRNAs confer robustness to gene expression and have a significant impact on 3'UTR evolution. Cell 123(6):1133-1146. Stefani G, Slack FJ. 2008. Small non-coding RNAs in animal development. Nat Rev Mol Cell Biol 9(3):219-230.

PAGE 142

142 Stevens B, Porta S, Haak LL, Gallo V, Fields RD. 2002. Adenosine: a neuron-glial transmitter promoting myelination in t he CNS in response to action potentials. Neuron 36(5):855-868. Suter U, Snipes GJ, Schoener-Scott R, Welc her AA, Pareek S, Lupski JR, Murphy RA, Shooter EM, Patel PI. 1994. Regulation of tissue-specific expression of alternative peripheral myelin protei n-22 (PMP22) gene transcripts by two promoters. J Biol Chem 269(41):25795-25808. Svaren J, Meijer D. 2008. The molecular machinery of myelin gene transcription in Schwann cells. Glia 56(14):1541-1551. Taft RJ, Glazov EA, Lassmann T, Hayashizaki Y, Carninci P, Mattick JS. 2009. Small RNAs derived from snoRNA s. Rna 15(7):1233-1240. Takenawa T, Suetsugu S. 2007. The WASP-WAVE protein network: connecting the membrane to the cytoskeleton. Nat Rev Mol Cell Biol 8(1):37-48. Tay Y, Zhang J, Thomson AM, Lim B, Rigout sos I. 2008. MicroRNAs to Nanog, Oct4 and Sox2 coding regions modulate embryoni c stem cell differentiation. Nature 455(7216):1124-1128. Taylor CM, Marta CB, Claycomb RJ, Han DK Rasband MN, Coetzee T, Pfeiffer SE. 2004. Proteomic mapping provides powerful insights into functional myelin biology. Proc Natl Acad Sci U S A 101(13):4643-4648. Tolwani RJ, Cosgaya JM, Varma S, Jac ob R, Kuo LE, Shooter EM. 2004. BDNF overexpression produces a long-term incr ease in myelin formation in the peripheral nervous system. J Neurosci Res 77(5):662-669. Topilko P, Schneider-Maunoury S, Levi G, Baron-Van Everc ooren A, Chennoufi AB, Seitanidou T, Babinet C, C harnay P. 1994. Krox-20 cont rols myelination in the peripheral nervous system Nature 371(6500):796-799. Tsang J, Zhu J, van Oudenaarden A. 2007. MicroRNA-mediated feedback and feedforward loops are recurrent network motifs in mammals. Mol Cell 26(5):753767. Valencia-Sanchez MA, Liu J, Hannon GJ, Park er R. 2006. Control of translation and mRNA degradation by miRNAs and siRNAs. Genes Dev 20(5):515-524. van Dartel M, Hulsebos TJ. 2004. Char acterization of PMP22 expression in osteosarcoma. Cancer Genet Cytogenet 152(2):113-118. van Rooij E, Olson EN. 2007. MicroRNAs: po werful new regulators of heart disease and provocative therapeutic targets. J Clin Invest 117(9):2369-2376.

PAGE 143

143 Vasudevan S, Tong Y, Steitz JA. 2008. Ce ll-cycle control of microRNA-mediated translation regulation. Cell Cycle 7(11). Vavouri T, Semple JI, Garcia-Verdugo R, Lehner B. 2009. Intrinsic protein disorder and interaction promiscuity are widely a ssociated with dosage sensitivity. Cell 138(1):198-208. Verrier JD, Lau P, Hudson L, Murashov AK, Renne R, Notterpek L. 2009. Peripheral myelin protein 22 is regulated post-t ranscriptionally by miRNA-29a. Glia 57(12):1265-1279. Vo N, Klein ME, Varlamova O, Keller DM, Yamamoto T, Goodman RH, Impey S. 2005. A cAMP-response element binding proteininduced microRNA regulates neuronal morphogenesis. Proc Natl Ac ad Sci U S A 102(45):16426-16431. Vucic S, Kiernan MC, Cornbl ath DR. 2009. Guillain-Barre syndrome: an update. J Clin Neurosci 16(6):733-741. Wegner M. 2000a. Transcriptional control in my elinating glia: flavors and spices. Glia 31(1):1-14. Wegner M. 2000b. Transcriptional control in my elinating glia: the basic recipe. Glia 29(2):118-123. Winter J, Jung S, Keller S, Gregory RI, Diederichs S. 2009. Many roads to maturity: microRNA biogenesis pathwa ys and their regulation. Na t Cell Biol 11(3):228-234. Woodhoo A, Alonso MB, Droggiti A, Turmaine M, D'Antonio M, Parkinson DB, Wilton DK, Al-Shawi R, Simons P, Shen J, Guillemo t F, Radtke F, Meijer D, Feltri ML, Wrabetz L, Mirsky R, Jessen KR. 2009. No tch controls embryonic Schwann cell differentiation, postnatal myelination and adult plasticity. Nat Neurosci 12(7):839847. Xu N, Papagiannakopoulos T, Pan G, T homson JA, Kosik KS. 2009. MicroRNA-145 regulates OCT4, SOX2, and KLF4 and represses pluripotency in human embryonic stem cells Cell 137(4):647-658. Yamauchi J, Chan JR, Shooter EM. 2004. Neurotrophins regulate Schwann cell migration by activating divergent signaling pathways dependent on Rho GTPases. Proc Natl Acad Sci U S A 101(23):8774-8779. Yang D, Bierman J, Tarumi YS, Zhong YP, Rangwala R, Proctor TM, Miyagoe-Suzuki Y, Takeda S, Miner JH, Sherman LS, Gold BG, Patton BL. 2005. Coordinate control of axon defasciculation and myeli nation by laminin-2 and -8. J Cell Biol 168(4):655-666.

PAGE 144

144 Yang Z, Jakymiw A, Wood MR, Eystathioy T, Rubin RL, Fritzler MJ, Chan EK. 2004. GW182 is critical for the stability of GW bodies expressed during the cell cycle and cell proliferation. J Ce ll Sci 117(Pt 23):5567-5578. Ye P, Li L, Richards RG, DiAugustine RP, D'Er cole AJ. 2002. Myelination is altered in insulin-like growth factor-I null mu tant mice. J Neurosci 22(14):6041-6051. Young P, Suter U. 2003. The causes of Char cot-Marie-Tooth disease. Cell Mol Life Sci 60(12):2547-2560. Yu WM, Feltri ML, Wrabetz L, Strickland S, Chen ZL 2005. Schwann cell-specific ablation of laminin gamma1 causes apopt osis and prevents proliferation. J Neurosci 25(18):4463-4472. Zearfoss NR, Farley BM, Ryder SP. 2008. Po st-transcriptional regulation of myelin formation. Biochim Bioph ys Acta 1779(8):486-494. Zhang C, Kang C, You Y, Pu P, Yang W, Z hao P, Wang G, Zhang A, Jia Z, Han L, Jiang H. 2009. Co-suppression of miR-221/222 cluster suppresses human glioma cell growth by targeting p27k ip1 in vitro and in vivo. Int J Oncol 34(6):1653-1660. Zoidl G, Blass-Kampmann S, D'Urso D, Sc hmalenbach C, Muller HW 1995. Retroviralmediated gene transfer of t he peripheral myelin protei n PMP22 in Schwann cells: modulation of cell grow th. Embo J 14(6):1122-1128.

PAGE 145

145 BIOGRAPHICAL SKETCH Jonathan Verrier was born in Newbury port, Massachusetts, in 1980 to William and Leslie Verrier and raised in the nearby town of Byfield. After graduating from Triton Regional High School in 1998, he attended The University of Vermont and obtained a Bachelor of Science in biology, with a concentration in neurobiology, in 2002. After graduation he moved to Boston, Massachusetts and worked as a laboratory technician for a year under the supervision of Dr. Jo-E llen Murphy at the Ha rvard Institute of Medicine at Brigham and Womens Hospital. While residing in Boston, he next obtained a Master of Science in pharmacology from the Massachusetts College of Pharmacy while under the supervision of Dr. Timothy Maher in 2005. He then moved to Gainesville, Florida to begin his studies in the Interdisciplinary Program for Biomedical Research at the University of Florida. He joined the laboratory of Dr. Lucia Notterpek in 2006.