<%BANNER%>

The Role of the Macrophage in Canine Influenza Pathogenesis

Permanent Link: http://ufdc.ufl.edu/UFE0041011/00001

Material Information

Title: The Role of the Macrophage in Canine Influenza Pathogenesis
Physical Description: 1 online resource (149 p.)
Language: english
Creator: Powe, Joshua
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: canine, factor, h3n8, influenza, macrophage, necrosis, tnf, tumor, virus
Veterinary Medicine -- Dissertations, Academic -- UF
Genre: Veterinary Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Canine influenza virus (CIV) is an important emerging pathogen that causes highly contagious respiratory disease in dogs. Secondary bacterial pneumonia is a leading complication of CIV infection. Initial characterizations of CIV-induced respiratory disease suggested alveolar macrophages may be susceptible to virus infection. Studies using other influenza viruses have revealed that alveolar macrophages may play an important role in influenza pathogenesis, and that prior infection of alveolar macrophages with influenza virus augments the cytokine response to bacterial products. The hypothesis for these studies was that CIV induces severe respiratory disease in dogs by infecting pulmonary macrophages and inducing high levels of pro-inflammatory cytokines such as TNF-alpha and that CIV infection of macrophages induces dysregulated cytokine responses in macrophages when they are subsequently exposed to bacterial pathogens. Infection of alveolar macrophages with CIV was demonstrated by production of virus in macrophage cultures, expression of virus matrix mRNA, and expression of virus antigen in inoculated macrophages. Infection of alveolar macrophages with CIV led to cell death via both necrosis and apoptosis. Following inoculation with CIV, alveolar macrophages produced TNF-alpha to a similar extent as to when exposed to lipopolysaccharide. This TNF-alpha production was host-strain specific as inoculation with alveolar macrophages with a genetically related equine influenza virus yielded similar virus matrix mRNA expression yet significantly (p < 0.05) less TNF-alpha production. Prior infection of alveolar macrophages primed them for an exaggerated TNF-alpha response to lipopolysaccharide, but not to other bacterial products such as lipoteichoic acid, flagellin or unmethylated CpG DNA. This effect was mediated by a much larger accumulation of TNF-alpha mRNA following LPS exposure in CIV-infected macrophages than in macrophages exposed only to LPS or virus. The mechanism for the increased mRNA remains poorly defined and does not appear to be explained by altered mRNA degradation alone. In conclusion, CIV infects alveolar macrophages and induces TNF-alpha expression and cell death. Prior infection of alveolar macrophages with CIV augments the TNF-alpha response to LPS, and this effect is mediated at least in part by increased amounts of TNF-alpha mRNA.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Joshua Powe.
Thesis: Thesis (Ph.D.)--University of Florida, 2009.
Local: Adviser: Castleman, William L.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0041011:00001

Permanent Link: http://ufdc.ufl.edu/UFE0041011/00001

Material Information

Title: The Role of the Macrophage in Canine Influenza Pathogenesis
Physical Description: 1 online resource (149 p.)
Language: english
Creator: Powe, Joshua
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: canine, factor, h3n8, influenza, macrophage, necrosis, tnf, tumor, virus
Veterinary Medicine -- Dissertations, Academic -- UF
Genre: Veterinary Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Canine influenza virus (CIV) is an important emerging pathogen that causes highly contagious respiratory disease in dogs. Secondary bacterial pneumonia is a leading complication of CIV infection. Initial characterizations of CIV-induced respiratory disease suggested alveolar macrophages may be susceptible to virus infection. Studies using other influenza viruses have revealed that alveolar macrophages may play an important role in influenza pathogenesis, and that prior infection of alveolar macrophages with influenza virus augments the cytokine response to bacterial products. The hypothesis for these studies was that CIV induces severe respiratory disease in dogs by infecting pulmonary macrophages and inducing high levels of pro-inflammatory cytokines such as TNF-alpha and that CIV infection of macrophages induces dysregulated cytokine responses in macrophages when they are subsequently exposed to bacterial pathogens. Infection of alveolar macrophages with CIV was demonstrated by production of virus in macrophage cultures, expression of virus matrix mRNA, and expression of virus antigen in inoculated macrophages. Infection of alveolar macrophages with CIV led to cell death via both necrosis and apoptosis. Following inoculation with CIV, alveolar macrophages produced TNF-alpha to a similar extent as to when exposed to lipopolysaccharide. This TNF-alpha production was host-strain specific as inoculation with alveolar macrophages with a genetically related equine influenza virus yielded similar virus matrix mRNA expression yet significantly (p < 0.05) less TNF-alpha production. Prior infection of alveolar macrophages primed them for an exaggerated TNF-alpha response to lipopolysaccharide, but not to other bacterial products such as lipoteichoic acid, flagellin or unmethylated CpG DNA. This effect was mediated by a much larger accumulation of TNF-alpha mRNA following LPS exposure in CIV-infected macrophages than in macrophages exposed only to LPS or virus. The mechanism for the increased mRNA remains poorly defined and does not appear to be explained by altered mRNA degradation alone. In conclusion, CIV infects alveolar macrophages and induces TNF-alpha expression and cell death. Prior infection of alveolar macrophages with CIV augments the TNF-alpha response to LPS, and this effect is mediated at least in part by increased amounts of TNF-alpha mRNA.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Joshua Powe.
Thesis: Thesis (Ph.D.)--University of Florida, 2009.
Local: Adviser: Castleman, William L.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0041011:00001


This item has the following downloads:


Full Text

PAGE 1

1 THE ROLE OF THE MACROPHAGE IN CANINE INFLUENZA PATHOGENESIS By JOSHUA RICHARD POWE A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORID A IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2009

PAGE 2

2 2009 Joshua R. Powe

PAGE 3

3 To my parents, Brian and Judi Powe

PAGE 4

4 ACKNOWLEDGMENTS The obstacle of sourcing alveolar macr ophages for this study would have been insurmountable without the help of Dr Ellis Grieners laboratory staff, in particular Jennifer Baker Burroughs, Brittany Sears and Kristin James. Much gratitude and thanks goes to my patient and graceful coworker, D eepa Mukhtyar, for helping me find my feet in the laboratory and establis hing protocols for many of the experiments presented in this dissertation. I thank the members of my supervisory committee, Cynda Crawford, Paul Gibbs, and Laurence Morel, for their time, ideas and assistance. A very special thanks goes to my Chair, Bill Castleman, who provided me with the opportunity to perform this work. His expert supervision, mentorship and wealth of experience kept me focused, and my work on track, and his enthusiasm (that us ually exceeded mine) provided invaluable motivation. I hope to one-day come close to matching the example set by Bill as a scientist and pathologist. In finalizing the work presented here, I w ant to thank my close friend and mentor, Allan Kessell, who several years ago helped me get started on the career path I have chosen. The wisdom, friendshi p and mentorship he gave (and continues to give) helped me keep the big picture in mind thr oughout my pathology training and graduate school experience. Last, I want to express my deep gratitude to my parents, Brian and Judi Powe. Without the sacrifices they made to give me every opportunity to achieve my best, none of this would have been possible.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDG MENTS..................................................................................................4 LIST OF TABLES............................................................................................................9 LIST OF FIGURE S........................................................................................................10 ABSTRACT...................................................................................................................13 CHAPTER 1 LITERATURE REVIEW..........................................................................................15 Influenza Vi ruses....................................................................................................15 Canine H3N8 In fluenza Vi rus..................................................................................17 Influenza A Viruses and Bacterial Pneumon ia........................................................19 Pathogenesis of Bacterial Pneumonia Secondary to Infl uenza Infection................20 Influenza Virus Infection Enhances the Pathogenesis of Subsequent Bacterial Infection...............................................................................................................25 2 RESEARCH PLAN AND PROT OCOL....................................................................29 Introduc tion.............................................................................................................29 Hypothesis and S pecific Aims.................................................................................29 Specific Aim 1: To Determine whether Canine Influenza Virus Replicates in Canine Macrophages and I nduces Cell Death..............................................30 Specific Aim 2: To Characterize Alte rations in Cytokine Production Induced by Canine Influenza Virus in Macrophages ...................................................30 Specific aim 3: To Determine whet her Bacterial TLR Agonist-Induced Cytokine Production by Macrophages is Enhanced by Prior Infection with Canine Influenz a Virus..................................................................................30 Specific Aim 4: To Identify the Mec hanism by which Canine Influenza Virus Augments Macrophage TNFResponse to LPS.........................................31 Experiment 1...........................................................................................................31 Specific Aim 1...................................................................................................31 Object ives.........................................................................................................31 Rationa le..........................................................................................................31 Experimental Desi gn and Me thods...................................................................32 Isolation of alve olar ma crophages.............................................................33 Virus and mock inocul a..............................................................................34 Macrophage inoc ulation.............................................................................34 Determination of virus ti ters.......................................................................34 H3 antigen staining in alveolar macrophages............................................34 Real-time RT-PCR.....................................................................................35 Trypan blue assay......................................................................................35

PAGE 6

6 Caspase-3/ 7 assay....................................................................................36 Annexin-V/Propidium i odide flow cytometry...............................................36 Data anal ysis.............................................................................................37 Experiment 2...........................................................................................................37 Specific Aim 2...................................................................................................37 Object ives.........................................................................................................37 Rationa le..........................................................................................................37 Experimental Desi gn and Me thods...................................................................39 Real-time RT-PCR fo r cytoki ne m RNA......................................................39 Enzyme-linked immunosor bent assay (ELISA)..........................................39 Data anal ysis.............................................................................................39 Experiment 3...........................................................................................................40 Specific Aim 3...................................................................................................40 Objective..........................................................................................................40 Rationa le..........................................................................................................40 Experimental Desi gn and Me thods...................................................................40 Toll-like rec eptor agoni sts..........................................................................41 Experiment 4...........................................................................................................42 Specific Aim 4...................................................................................................42 Objective..........................................................................................................42 Rationa le..........................................................................................................42 Experimental Design........................................................................................43 Real-time RT-P CR.....................................................................................44 Actinomycin D inhibition of mRNA synthesis..............................................44 3 CANINE INFLUENZA VIRUS REPLIC ATES IN ALVEOLAR MACROPHAGES AND INDUCES TNF............................................................................................46 Abstract...................................................................................................................46 Introduc tion.............................................................................................................46 Materials and Methods............................................................................................49 Alveolar Macr ophage Isolat ion.........................................................................49 Virus and Viru s Titers.......................................................................................52 Macrophage Inoc ulation...................................................................................52 Real-Time RT-PCR..........................................................................................53 Cytokine Protein Quantific ation........................................................................54 Macrophage Vi ability........................................................................................55 H3 Antigen Staining in Alveolar Macrophages.................................................55 Results....................................................................................................................56 Virus Repl ication..............................................................................................56 Loss of Macr ophage Viabi lity............................................................................57 Cytokine Pr oduction.........................................................................................57 Discuss ion..............................................................................................................58 4 CANINE H3N8 INFLUENZA VIRUS AUGMENTS ALVEOLAR MACROPHAGE TNFRESPONSE TO LIPO POLYSAC CHARIDE................................................69

PAGE 7

7 Abstract...................................................................................................................69 Introduc tion.............................................................................................................70 Methods..................................................................................................................72 Macrophage Isolati on and Cult ure....................................................................72 Virus and Mock Inocula....................................................................................73 Macrophage Inoc ulation...................................................................................74 Real-Time RT-PCR..........................................................................................76 TNFELISA....................................................................................................77 Data A nalysis...................................................................................................77 Results....................................................................................................................78 TNFResponse to LPS in CIVInfected Alveol ar Ma crophages.....................78 TNFResponse to Other Bacterial TLR Ag onists in CIV-Infected Alveolar Macrophages................................................................................................79 Augmented TNFResponse to LPS is Mediated by Increased mRNA Levels............................................................................................................80 Discuss ion..............................................................................................................81 5 CANINE H3N8 INFLUENZA VIRUS I NDUCES HOST STRAIN-SPECIFIC TNFEXPRESSION AND APOPTOSIS IN ALVEOLAR MACROPHAGES.................92 Abstract...................................................................................................................92 Introduc tion.............................................................................................................93 Materials and Methods............................................................................................95 Macrophage Isolati on and Cult ure....................................................................95 Virus and Mock Inocula....................................................................................96 Macrophage Inoculation with Canine and Equi ne Viru ses...............................97 Real-Time RT-PCR..........................................................................................98 TNFELISA....................................................................................................99 Caspase-3/ 7 Assay..........................................................................................99 Annexin-V/Propidium I odide Flow Cy tometry.................................................100 Data A nalysis.................................................................................................100 Results..................................................................................................................101 Equine Influenza Matrix Gene Expressi on is Similar to Canine Influenza Matrix Gene Expression in I noculated Alveol ar Macrophages....................101 Canine Influenza Virus Induces Greater TNFProduction than Equine Influenza Virus............................................................................................101 Increased TNFProduction Seen with CIV Inoculation is Associated with Greater TNFmRNA Level s......................................................................102 Inoculation with CIV Induces Apop tosis in Alveol ar Macrophages.................102 Discuss ion............................................................................................................103 6 SUMMARY AND CO NCLUS IONS........................................................................111 Specific Aim 1.......................................................................................................111 To Determine whether Canine Influenza Virus Replicates in Canine Macrophages and Induces Cell Death........................................................111

PAGE 8

8 Specific Aim 2.......................................................................................................111 To Characterize Alterations in Cytokine Production Induced by Canine Influenza Virus in Macr ophages. .................................................................111 Specific Aim 3.......................................................................................................112 To Determine whether Bacterial TLR Agonist-Induced Cytokine Production by Macrophages is Enhanced by Prior Infection with Canine Influenza Virus............................................................................................................112 Specific Aim 4.......................................................................................................112 To Identify the Mechanism by whic h Canine Influenza Virus Augments Macrophage TNFResponse to LPS........................................................112 Conclusi ons..........................................................................................................112 APPENDIX A VIRUS INOCULATION OF ALVEOLAR MACROPHAGES FROM LABORATORY MAINTAIN ED BEAGLE DOGS...................................................114 Experimental Desi gn and Me thods.......................................................................114 Results and Conclu sions......................................................................................115 B VIRUS INOCULATION STUDIES ON PERIPHERAL BLOOD MONOCYTE DERIVED MA CROPHAG ES.................................................................................119 Experimental Desi gn and Me thods.......................................................................119 Results and Conclu sions......................................................................................121 C CYTOKINE EXPRESSION IN ALVEO LAR MACROPHAGES INOCULATED WITH UV-INACTIV ATED VIRUS..........................................................................125 Experimental Desi gn and Me thods.......................................................................125 Results and Conclu sions......................................................................................125 D TNFEXPRESSION IN DH82 CELLS FOLLOWING CANINE INFLUENZA VIRUS INOCULATION AND EXPOSURE TO LIPOPOLYSACCHARIDE AND LIPOTEICH OIC ACID...........................................................................................128 Experimental Desi gn and Me thods.......................................................................128 Results and Conclu sions......................................................................................129 LIST OF RE FERENCES.............................................................................................134 BIOGRAPHICAL SKETCH..........................................................................................149

PAGE 9

9 LIST OF TABLES Table page 2-1 Virus used for assays at ti me points after inoculat ion.........................................452-2 Primer and probe sequenc es..............................................................................453-1 Primer and probe sequenc es..............................................................................634-1 Primer and probe sequenc es..............................................................................865-1 Primer and probe sequenc es............................................................................107

PAGE 10

10 LIST OF FIGURES Figure page 3-1 Infectious virus titers in al veolar macrophage cult ure supernatant.....................64 3-2 Infectious virus titers in viable and freeze-thaw killed alveolar macrophage culture s upernatant.............................................................................................64 3-3 Virus matrix gene expressi on in alveolar macr ophages. ....................................65 3-4 Canine alveol ar macr ophages. ...........................................................................65 3-5 Trypan blue exclusion assay on virusand mock-inoculated alveolar macrophag es......................................................................................................66 3-6 TNFmRNA in virus-inoculat ed alveolar macrophages....................................66 3-7 TNFprotein concentration in alveol ar macrophage culture supernatant.........67 3-8 IL-10 mRNA in virus-i noculated alveol ar macr ophages......................................67 3-9 IL-10 protein concentration in al veolar macrophage culture supernatant...........68 4-1 TNFprotein concentration in alveol ar macrophage supernatant inoculated with CIV or mock-inoculum and inc ubated with LPS (1-1000ng/ml) from immediately afte r inocul ation..............................................................................87 4-2 TNFprotein concentration in alveol ar macrophage supernatant inoculated with mock-inoculum or CIV and incubat ed with LPS (1ng/m l) from 3 hours after inoc ulation..................................................................................................88 4-3 TNFprotein concentration in alveol ar macrophage supernatant inoculated with mock-inoculum or CIV and incubat ed with LPS (1ng/m l) from 6 hours after inocul ation..................................................................................................88 4-4 TNFprotein concentration in supernatant of alveolar macrophage cultures inoculated with CIV or mock-inoculum and incubated with LTA (1000ng/ml) from immediately, 3 hours or 6 hours after inoculat ion.......................................89 4-5 TNFprotein concentration in supernat ant of alveolar macrophages inoculated with mock-inoculum or CIV and incubated with flagellin (2 g/ml) from immediately, 3 hours or 6 hours after inoculat ion.......................................89 4-6 TNFprotein concentration in supernat ant of alveolar macrophages inoculated with mock-inoculum or CIV and incubated with CpG DNA (5 M) from immediately, 3 hours or 6 hours after inoculat ion.......................................90

PAGE 11

11 4-7 TNFmRNA in virusand mock-inoc ulated macrophages, exposed to LPS (1ng/ml) from 3 hours after inoc ulati on...............................................................90 4-8 TNFmRNA expression in virusand mock-inoculated alveolar macrophages incubated with LPS (1ng/ml ) from 3 hours after inoculation.........91 5-1 Influenza virus matrix gene expr ession in alveol ar macrophages.....................108 5-2 TNFprotein concentration in alv eolar macrophage cult ure media................108 5-3 TNFmRNA in virus i noculated ma crophages...............................................109 5-4 Caspase 3/7 activity in CIV-inoculat ed macro phages.......................................109 5-5 Annexin-V and propidium iodide labeling in alv eolar ma crophages..................110 A-1 Matrix mRNA expression in alve olar macrophages from beagle 1 inoculated with CI V............................................................................................................117 A-2 TNFand IL-10 mRNA in virus inoc ulated alveolar macrophages from beagle 1............................................................................................................117 A-3 TNFand IL-10 mRNA in virus inoc ulated alveolar macrophages from beagle 2............................................................................................................118 B-1 Virus matrix gene expression in peripheral blood monocyte-derived macrophages....................................................................................................123 B-2 TNFmRNA in virus inoculated peripheral blood monocyte-derived macrophages....................................................................................................123 B-3 IL-10 mRNA in virus inoculat ed peripheral blood monocyte-derived macrophages....................................................................................................124 C-1 TNFmRNA expression in alveolar macrophages inoculated with UVinactiva ted........................................................................................................127 C-2 IL-10 mRNA expression in alve olar macrophages inoculated with UVinactiva ted........................................................................................................127 D-1 TNFproduction from Canine/FL/04and mockinoculated DH82 cells, 1ng/ml lipopolysaccharide (LPS) added 3 hours after i noculation....................131 D-2 TNFproduction from Canine/FL/04and mockinoculated DH82 cells, 10ng/ml LPS added 3 hours a fter inocul ation...................................................131 D-3 TNFproduction from Canine/FL/04and mockinoculated DH82 cells, 100ng/ml LPS added 3 hours af ter inocul ation.................................................132

PAGE 12

12 D-4 TNFproduction from Canine/FL/04and mockinoculated DH82 cells, 100ng/ml lipoteichoic acid (LTA) added 3 hours after i noculation.....................132 D-5 TNFproduction from Canine/FL/04and mockinoculated DH82 cells, 1000ng/ml LTA added 3 hours af ter inocul ation...............................................133

PAGE 13

13 Abstract of Dissertation Pr esented to the Graduate School of the University of Florida in Partial Fulf illment of the Requirements for t he Degree of Doctor of Philosophy THE ROLE OF THE MACROPHAGE IN CANINE INFLUENZA PATHOGENESIS By Joshua Richard Powe December 2009 Chair: William L. Castleman Major: Veterinary Medical Sciences Canine influenza virus (CIV) is an import ant emerging pathogen that causes highly contagious respiratory disease in dogs. Se condary bacterial pneumonia is a leading complication of CIV infection. Initial characterizations of CIV-induced respiratory disease suggested alveolar macrophages may be susceptib le to virus infection. Studies using other influenza viruses have revealed that alveolar macrophages may play an important role in influenza pathogenesis, and that pr ior infection of alveolar macrophages with influenza virus augments the cytokine response to bacterial products. The hypothesis for these studies was that CIV induces severe respiratory disease in dogs by infecting pulmonary macrophages and inducing high levels of pro-inflammatory cytokines such as TNFand that CIV infection of macr ophages induces dysregulated cytokine responses in macrophages when they ar e subsequently exposed to bacterial pathogens. Infection of alveolar macrophages with CIV was demonstrated by production of virus in macrophage cultur es, expression of virus matr ix mRNA, and expression of virus antigen in inoculated macrophages. In fection of alveolar macrophages with CIV led to cell death via both necrosis and apopt osis. Following inoculation with CIV, alveolar macrophages produced TNFto a similar extent as to when exposed to

PAGE 14

14 lipopolysaccharide. This TNFproduction was host-strain specific as inoculation with alveolar macrophages with a genetically relat ed equine influenza virus yielded similar virus matrix mRNA expression yet significantly (p<0.05) less TNFproduction. Prior infection of alveolar macrophages pr imed them for an exaggerated TNFresponse to lipopolysaccharide, but not to other bacterial products such as lipoteichoic acid, flagellin or unmethylated CpG DNA. This effect was m ediated by a much larger accumulation of TNFmRNA following LPS exposure in CIV-infected macrophages than in macrophages exposed only to LPS or virus. The mechanism for the increased mRNA remains poorly defined and does not appear to be explained by altered mRNA degradation alone. In conclusion, CIV infe cts alveolar macrophages and induces TNFexpression and cell deat h. Prior infection of alveol ar macrophages wit h CIV augments the TNFresponse to LPS, and this effect is mediated at least in part by increased amounts of TNFmRNA.

PAGE 15

15 CHAPTER 1 LITERATURE REVIEW Influenza Viruses Influenza viruses are enveloped, s egmented, single str anded, negative-sense RNA viruses belonging to t he family Orthomyxoviridae.111 Within this family are three types of influenza viruses, namely influenza A, influenza B and influenza C viruses. The B type of influenza primarily causes resp iratory disease in humans, and influenza C viruses cause only mild sporadic disease in humans. Influenza A viruses are of most interest due to their role in pandemic and epidemic outbreaks of disease in a wide variety of mammalian and avian species. Structurally, influenza A viruses compri se an outer lipid membrane of host-cell origin, and an inner ribonucleopr otein core containing eight segments of single stranded negative sense RNA. Virus particles ar e roughly spheroidal to pleomorphic and approximate 100nm in diameter The eight genomic segments encode eleven functional proteins, utilizing alternate open reading frames and splicing.28 A twelfth protein of unknown function has recently been described.165 Embedded in the outer lipid membrane are two major vira l glycoproteins, the hemagglut inin (HA) and neuraminidase (NA), as well as the M2 proton channel. The M1 matrix protein lies subjacent to the outer lipid membrane envelope. The ribonucleoprotein core comprises vi ral RNA complexed with nucleoprotein (NP), polymerase proteins (PB1, PB2 and PA ), and small amounts of nuclear export protein/nonstructural proteins (NEP/NS2).103 Two other viral proteins, the NS1 and PB2F2 proteins, are expressed in sign ificant amounts only in infected cells.25,54

PAGE 16

16 Within the influenza A viruses, there are 16 known antigenically distinct HA types and 9 NA types, which form the basis of cl assification of the viruses. The current nomenclature system for influenza A viruse s includes the host of origin, geographic location of first isolation, strain number and year of isolation. The HA and NA subtype of influenza A viruses is specified in parent heses, e.g. Equine/Kentucky/1/94 (H3N8).1 Aquatic birds are thought to be the reserv oir of all influenza viruses in other species.161 Stable host-adapted lineages of influenza viruses occur in a variety of mammals including humans, swine, and horses.161 Other mammalian species such as seals, whales, mink, ferrets, felids and dogs have been naturally infected with influenza viruses, although definitive evidence of hor izontal virus transmission and establishment of stable viral lineages in these species has not been demonstrated.12,34,140-142,161,167 A recently emergent H3N8 influenza virus has been demonstrated to exist as a new stable lineage within the US dog population.41 In mammals, influenza A infection is typi cally limited to the respiratory tract, however systemic spread can occur.51,166 The virus primarily targets and replicates in respiratory epithelium by first binding surf ace glycoproteins and glycolipids terminated by sialic acid residues on host cells with the viral HA. Virus uptake occurs primarily by clathrin-mediated endocytosis, however internalization of virus also may occur via caveolae, nonclathrin and noncaveolae pathw ays, and by macropinocytosis.111 Fusion of the virus particle with endosomal membranes and uncoating of viral ribonucleoprotein is pH-dependent and mediated by the HA and M2 proteins. Viral ribonucleoprotein is actively transported to the nucleus wher e transcription of viral mRNA, cRNA and replication of vRNA is mediated by the het erotrimeric viral polymerase (PB1, PB2 and

PAGE 17

17 PA), NP as well host-derived components.28,111 Ribonucleoprotei n complexes are formed in the nucleus, and are exported to th e cytoplasm under the in fluence of the M1 and NEP/NS2 proteins.111 The M1 protein is likely t he primary mediator of virus assembly and budding from the host cell pl asma membrane, although other viral and host factors are likely involved.103 Release of viral particles requires the glycoprotein NA that cleaves surface sialic acid residues fr om the host cell and viru s particle, preventing the HA from binding to the host cell or agglutinating with other viral particles.77,103 Canine H3N8 Influenza Virus Canine H3N8 influenza virus (CIV) was firs t characterized following isolation from racing greyhounds during an outbreak of seve re respiratory disease at a Florida racetrack in January of 2004.32 Molecular and antigenic analys is of the first CIV isolate showed a close phylogenetic relationship to contemporaneous equine H3N8 influenza viruses, with greater than 96% shared sequence identity.32 The similarity of all CIV genes to equine H3N8 viruses indicated an in terspecies transfer of a whole influenza virus, from horses to dogs. In the initial outbreak of respiratory di sease, affected animals most commonly (14/22 affected dogs) presented with fever followed by a cough persisting for 10-14 days, with subsequent recovery. A smaller s ubset (8/22) of affected animals died peracutely with a severe hemorrhagic pneumoni a accompanied by tracheitis, bronchitis, bronchiolitis and suppurative bronchopneumonia. Subsequent serological surveys of asymptomatic contact animals revealed up to 95% seroconversion to the virus, indicating high rates of subclinical infection as well as a very high transmissibility of the virus. A similar outbreak of respiratory di sease in greyhounds occurred previously in

PAGE 18

18 Florida in March of 2003, from which a very closely related H3N8 influenza virus was subsequently isolated. Serologic evidence suggests the virus was present in the racing greyhound population as early as 2000.41 Since the discovery of CIV, serologic and virologic evidence indicates the virus has spread withi n the racing greyhound population, as well as in other non-racing dogs throughout the United States.41,112 In addition to greyhound racetracks, CIV has been implicated in outbrea ks of respiratory disease in shelters, boarding facilities and veterinary clinics. Clinical disease associated with CIV typicall y is observed within 5 days of infection and is characterized by anorexia, lethargy, fe ver and serous to purulent nasal discharge as well as by nonproductive cough t hat may persist for several weeks.41 A subset of infected dogs develop pneumonia which is complic ated by secondary ba cterial infection, and it is in these animals that mortalit y associated with CIV is most commonly seen.41 A more severe form of disease continues to be seen in a minority of infected racing greyhounds that die peracutely with severe hemorrhagic pneumonia characterized by extensive pulmonary, medias tinal and pleural hemorrhage.32,168 Of the 13 greyhound mortalities associated with influenza outbrea ks where necropsies have been performed at the College of Veterinary Medicine, UF, all had a hemo rrhagic pneumonia, and 12 (92%) had evidence of bacterial involvement either histologically or from culture. Similarly, of 8 pet and shelter dogs necropsied at UF that were PCR positive for canine influenza virus, 4 (50%) had bronchopneumonia with evidence of bacterial involvement. In necropsies where tissue was cultured, Streptococcus equi subsp zooepidemicus ( S.

PAGE 19

19 zooepidemicus ) was the most common isolate (53%), with a spectrum of gram-positive and gram-negative organisms is olated in other cases. Histologic evaluation of naturally and experimentally infected animals revealed neutrophilic to lymphohistiocytic tracheitis an d bronchitis, with necrosis and hyperplasia of surface and glandular epi thelium. Bronchopneumonia, when it occurs, is typically neutrophilic to histiocytic, with inters titial edema and minimal to extensive hemorrhage.32,41,112 Immunohistochemical studies on infected animals revealed influenza antigen (H3) in the cytoplasm of bronchial surface and glandular epithelium, bronchiolar epithelium, and macrophages in airway lumens and alveolar spaces.32 Influenza A Viruses and Bacterial Pneumonia The mechanism by which canine influenza virus predisposes to bacterial pneumonia in dogs is not known. The link between influenza and the increased morbidity and mortality associated with bac terial pneumonia in humans is well established, and was first noted during the 1918 influenza pandemic, well before the discovery of influenza virus.18,92,94,100 To this day, even in the absence of highly virulent pandemic influenza virus, bacterial pneumonia, especially caused by Streptococcus pneumonia Staphylococcus aureus Streptococcus pyogenes and Haemophilus influenzae remains a significant cause of influenza-associated morbidity and mortality in humans.18,52,109,136,137,150 A similar situation exists in pigs and horses naturally infected with influenza virus.75,85,159,164 Studies in vitro and experimental in vivo work have elucidated several potential mechanisms by which influenza virus may predispose to bacterial pneumonia and enhance t he morbidity and mortality of influenza infection.

PAGE 20

20 Pathogenesis of Bacterial Pneumonia Secondary to Influenza Infection For many years, the higher incidence of bacterial pneumonia following influenza infection was attributed to the destruct ion of airway epithelium, which exposes underlying connective tissue element s to which bacteria can adhere.36,60,122,155 Studies have also demonstrated increased adherence of bacteria to basal epithelium on the damaged mucosa of infected animals122 and regenerating epithelium.121 However, as reported by McCullers92 the respiratory toxicant 4ipomeanol, known to induce lung epithelial injury, did not enhance the occu rrence of secondary bacterial pneumonia experimentally. Also, there is marked variatio n in the virulence of influenza viruses, and it has been demonstrated t hat those viruses that induce mi nimal pathology of the airway epithelium can allow persistence of bacteri a in the lungs for prolonged periods or predispose to bacterial superinfection.105,133 These findings indicate that adherence to damaged respiratory mucosa is not the sole cause of the predisp osition to secondary bacterial pneumonia followin g influenza infection. Influenza virus may alter tracheal f unction and suppress normal mucociliary mechanisms responsible for clearance of bacteri a from the lung. In mice, prior influenza infection has been shown to delay clearanc e of staphylococci from the trachea (independent of increased adherence) and increase the fr equency of spontaneous tracheal colonization of gram-negative bacteria.108 In mice and an ex vivo mouse tracheal model, influenza virus reduced clearance of S. pneumoniae and decreased mucociliary velocity, independent of increased bacterial adherence.120 Other studies have shown decreased mucus clearance in the trachea of infected humans,83 and decreased ciliary function in a ferret m odel and chinchilla eustachian tube epithelium.63 In horses, influenza infection has been s hown to depress tracheal clearance rates.163

PAGE 21

21 Other viral factors may infl uence the adhesion of bacterial pathogens to respiratory epithelial cells. Some respiratory bacterial pathogens, in particular S. pneumoniae rely on intrinsic neuraminidase function to cleav e sialic acid from host cell surface glycoproteins to expose molecules used for adherence.152 The influenza NA protein has been shown to alter binding abilities of S. pneumoniae to epithelial cells in vitro, and those viruses with the greatest NA acti vity have been shown to have a greater propensity to predispose to bacterial pneumonia.93,115,116 Viral neuraminidase may also play a role in decreasing the function of neutrophils exposed to influenza virus.38 Recent studies have indicated a possible role of the platelet activating factor receptor (PAF-R) in the adhesion of S. pneumoniae to epithelium in post-influenza pneumonia. PAF-R has been shown to be upregulated under the influence of inflammatory cytokines33 and during viral infection.65 Phosphorylcholine in the cell wall of S. pneumoniae can adhere to PAF-R.33 Studies using competitive inhibitors of PAF-R failed to demonstrate a role of the receptor in the development of bacterial pneumonia secondary to influenza infection,95 however PAF-R knockout mice showed reduced bacterial outgrowth in lungs, a diminis hed dissemination of the infection, and a prolonged survival after inoculation with S. pneumoniae 14 days after influenza infection.157 Although most commonly associated with S. pneumoniae and Staphylococcus aureus bacterial pneumonia following influenza infection in humans is due to a wide variety of bacteria. In dogs infected with ca nine influenza, several bacterial species have been associated with secon dary bacterial pneumonia. This suggests influenza incites a more generalized defect in the cl earance of bacteria fr om the lung or the

PAGE 22

22 effectiveness of the inflammatory response to bacteria, or the i nduction of a pulmonary environment more conducive to bacterial outg rowth. Much work has been performed on the impact of influenza virus on the innate immune response to bacterial infection of the lung, focusing on both ma crophages and neutrophils. Neutrophil function and survival are in fluenced by influenza virus. Influenza infection of neutrophils is likely abortive22 and UV-inactivated virus is capable of detrimentally affecting neutr ophil phagocytosis and chemotaxis.38 However, neutrophil chemotaxis,3,4,78 oxidative function,3,8 endocytosis,9 phagocytosis,38 phagosomelysosome fusion6 and bactericidal activity8 have been shown to be diminished in response to secondary stimuli after influenz a virus exposure. The virus binding to surface receptors may mediate some of these effects.5,21,55,56 Additionally, influenza virus has been shown to decrease the lifespan of neutrophils by inducing apoptosis, either alone or in combination with bacteria.29,42,43 This effect may be influenced largely by the respiratory burst.42,43 Much of this work has been performed in vitro however in vivo work has demonstrated decreased neutroph il phagocytosis and oxidative function in response to S. pneumoniae from lungs of mice infected with influenza for 3 and 6 days.98 The effect of influenza virus on alveol ar macrophages is perhaps more crucial due to their role as the primary initial def ense against colonizing bacteria, as well as their importance in modulating inflamma tory changes in the lung and recruiting additional inflammatory cells following activation.17,35,96 Alveolar macrophages are also likely key in controlling influenza infect ion prior to an adaptive immune response.71,154 Influenza virus has been shown to infect macrophages/monocytes in a variety of

PAGE 23

23 species.62,88,126-128,134 In vitro, infection of macrophages is usually abortive127 or produces very small amounts of virus,16,102 however patent infections of macrophages have been reported.134 Virus yield from human macrophages has been shown to be increased by pre-inc ubation with GM-CSF.15 The origin of the in vitro macrophage may be important as mous e peritoneal macrophages have been shown to be less susceptible to influenza infe ction than pulmonary macrophages.127 Many of the effects of influenza virus on macrophages are simila r to those in neutrophils, such as diminished chemotaxis,73,129 phagocytosis,66,105 oxidative function and bactericidal capacity.8,160 Some studies have failed to demonstrate a direct effect of influenza virus on macrophage function in vitro, suggesting that the functional defect arises indirectly after influenza lung infection.106,107,128 Furthermore, pulmonary bactericidal defects following influenza infection can be ame liorated by immune depletion in mice.66,67 Even after resolution of influenza infection, alveolar macrophages display a diminished cytokine and chemokine response to tolllike receptor agonists lipopolysaccharide, lipoteichoic acid and flagellin.40 Influenza virus is known to induce apoptosis in macrophages.46,82,86,87,97,99 Not all strains of influenza virus induce apoptosis ho wever, and there is also variation between strains in the rate at which apoptosis is induced.99,134 Mechanisms by which influenza virus induces apoptosis have been reviewed.19,86 In macrophages, influenza viruses induce apoptosis by several mechanisms. The NS1 protein may promote caspase 1 activation, leading to activation of executioner caspases and apoptosis.145 Activation of caspases 3 and 8 have also been implicated in influenza virus-induced apoptosis in macrophages.99 The PB1-F2 protein is pro-apoptotic protein expressed only by some

PAGE 24

24 strains of influenza as a result of an alternate open reading fr ame in the PB1 gene.25,170 This protein specifically targets ma crophages, and is thought to be an important virulence determinant in some strains of influenza virus.14,30,91 The PB1-F2 protein induces apoptosis by associating with and in creasing the permeability of mitochondrial membranes, facilitating the release of mitoc hondrial products such as cytochrome c that trigger apoptosis.169 Numerous studies have demonstrated the production of cytokines from macrophages following infection with influenza virus,62,68,144 and these cytokines likely play a role in primary influenza pneumonia or the development of an adaptive immune response. In response to influenza infection, macrophages have been shown to produce a wide array of cytokines and chemokines, including TNF, IL-1 IL-6, IFN / MCP-1/CCL2,68 MIP-1 / RANTES/CCL5, and IL-12 p40.27,62,68,90 The cytokine response of macrophages to influenza viru s may have a prominent role in the development of a primary viral pneumonia, as recently evidenced by humans fatally infected with avian H5N1 viruses.27,37,151 In particular, macrophage TNFand cyclooxygenase-2 (COX-2) production has been shown to be significantly elevated following infection with highly pat hogenic H5N1 influenza A virus.27,81 The upregulation of TNFexpression is dependent on activation of the p38 mitogen-ac tivated protein kinase (MAPK) signaling pathway, and at least partially dependent on interferon regulatory factor-3 (IRF3).64,79 Individual viral genes play a role in the differential induction of inflammatory cytokines.27,134,145

PAGE 25

25 Influenza Virus Infection Enhances the Pathogenesis of Subsequent Bacterial Infection Studies have demonstrated a synergistic effect on the severity of pneumonia caused by influenza virus infection and subsequent bacterial challenge.95,132,158 In these reports, challenge of influenza infected mice with S. pneumoniae up to 10 days after virus infection led to dramatic increases in mortality. Increased mortality was associated with elevated levels of inflammatory cytokines such as TNFand IL-6, as well as increased activation of toll-lik e receptor signaling pathways.132 Bacteria are recognized by the innate immune system through toll-like receptors. The bacterial components known to act as a gonists for toll-like rec eptors include lipid mediators such as lipopolysaccharide (LPS, TLR4 agonist), glycolipids such as lipoteichoic acid (LTA, TLR2 agonist), pr oteins such as flagellin (TLR5 agonist), and bacterial DNA (unmethylalted CpG containing DNA, TLR9 agonist).11 These bacterial products have been shown to induce TNFproduction in macrophages.26,143,149 Several studies have shown that influenza A viruses act to prime macrophages for an exaggerated cytokine response to bacteria or their components.16,50,82,102,118 Much of the research in the literature has focus ed on the effects of the TLR4 agonist LPS on TNFproduction. The mechanism by which influenza virus primes macrophages for excessive TNFproduction subsequent to LPS expos ure has been partially elucidated in experiments using the mouse adapted influenza A virus, A/PR8 and mouse macrophage cell line PU5-1.8.16,50,102 Northern blots were used to demonstrate a dramatic accumulation of TNFmRNA following influenza infe ction, in excess of that produced in response to low concentrations of LPS (10ng/ml) alone. TNFmRNA levels were only mildly potentiated followi ng subsequent LPS exposure of influenza-

PAGE 26

26 infected macrophages.50,102 In contrast, ELISA demonstrated small to moderate amounts of TNFproduction following only influenza or LPS (10ng/ml) exposure, but excessive release of the cytokine from influenza infected macrophages co-cultured with LPS.50,102 Western blots on super natants and washed cell-lysa tes demonstrated that TNFproduction was not due to the LPS-stimul ated release of intracellular stores.50 To determine the mechanism by which A/PR8 increased TNFmRNA levels, a nuclear run-on transcription assay was used to dem onstrate increased transcription of TNFmRNA following A/PR8 infection.50 In addition, increased stability of TNFmRNA following A/PR8 infection was demonstrated by sequential Northern blots from infected cells wherein actinomycin D was used to halt new gene transcription.50 A/PR8-infected human monocytes showed similar potentiation of TNF, IL-6 and IL-1 secretion following LPS exposure.16,118 In summary, these experiments demonstrated that influenza virus primes macr ophages for an excessive TNFresponse to LPS by increasing transcription and stability of TNFmRNA. Subsequent LPS exposure causes excessive translation and secr etion of bioactive protein. The mechanism by which LPS augment s translation of cytokine mRNA in influenza-infected macrophages is not understood. Potentially, the additional stimulus provided by LPS may overcome some infl uenza-mediated inhibition of cytokine translation. The augmented production of pro-in flammatory cytokines in response to bacterial products may contribute signific antly to the inflammation and pathological changes that occur in response to bacterial challenge in the influenza-infected lung. Cytokines such as TNFand IL-1 have important roles in activating endothelium and

PAGE 27

27 recruiting leukocytes, as well as promoting the activation of leukocytes and secretion of additional cytokines and chemokines. Recent studies have shown that previous infection with influenza virus markedly potentiates the production of proinflammatory and anti-inflammatory cytokines in the lungs of mice exposed to pneumococcus. In particular, the excessive production of IL10 in lungs of such mice has led to spec ulation regarding the role of such antiinflammatory cytokines in the development of post-influenza pneumonia.158 IL-10 has been shown to impair host response to S. pneumoniae pneumonia in mice,156 as well as having a role in the development of bac terial pneumonia concomitant with sepsis.146 The source of these cytokines is currently unknown, but may be produced by T-cells or macrophages.31,147 Given the strong evidence for a potentia ting effect of bacterial products on the cytokine production of influenza infected ma crophages, it is possible that alveolar macrophages contribute to t he morbidity and mortality associated with bacterial pneumonia following influenza infection. Whet her macrophages simply increase the severity of the inflammation associated with secondary bacterial invaders, or macrophage products directly impede normal hos t defenses is unclear. The effect of canine influenza virus on canine macrophages in not known, and the response of the cells to viral infection may well contribute to the increased incidence of morbidity and mortality associated with secondar y bacterial superinfection. Investigation of the contribution of the canine macrophage to both primary viral pneumonia and secondary bacterial pneumoni a associated with canine influenza infection will contribute to the existing body of knowledge regarding the response of

PAGE 28

28 macrophages to influenza infection in a vari ety of species. As well as providing important information on the pathogenesis of influenza pneumonia in dogs, understanding of this interaction may pave the way for the development of interventionist strategies aimed at in terrupting the production of cytokines, and diminishing the disease resulting from in fluenza infection. Additionally, understanding the response of the influenza-infected ma crophages to bacterial components may allow the development of preventative approaches to minimizing the incidence of bacterial pneumonia secondary to influenza infection, as well as minimizing pathology in individuals affected by influenza-associated bacterial pneumonia. The canine is a new model for human disease, and unlike experi ments in the mouse, also represents a model for naturally occurring infection. Comparison of the response of canine macrophages to canine influenza virus and equi ne influenza virus may elucidate some of the mechanisms by which the virus has adapted to a new host, allowing it to cause disease. Further studies using recombinant viruses could be used to investigate the genetic basis for this.

PAGE 29

29 CHAPTER 2 RESEARCH PLAN AND PROTOCOL Introduction The following hypothesis, specific aims and research plan were initially approved by the supervisory committee on 29 January 2007 with subsequent approvals to revise on 29 October 2007 and 15 December 2008. The document has been c hanged from the original future tense of what was going to be done to past tense of what was done with few other changes except as noted. Hypothesis and Specific Aims Canine influenza virus infection in dogs has been identified as a newly emerged respiratory disease that is often fatal in racing greyhound dogs as well as pet and shelter-housed dogs. The most important mechanisms cont ributing to severe, fatal respiratory disease induced by this virus in dogs are unknown. Postmortem studies implicate concurrent respiratory bacterial infection as a frequent component in fatal cases. Influenza pathogenesis studies using ot her influenza virus-host models indicate that influenza virus infection of macrophages c an play an important role in markedly up regulating pro-inflammatory cytokines that can worsen respiratory disease during primary infection.27,62 Other studies have shown that influenza virus infection of macrophages can markedly enhance the releas e of pro-inflammatory cytokines when those macrophages are subsequently exposed to bacterial components such as endotoxin.16,50,102 The hypothesis for these studies was that canine influenza virus induces severe respiratory disease in dogs by infect ing pulmonary macrophages and inducing high levels of pro-inflammatory cytokines such as TNFand that influenza virus infection of

PAGE 30

30 macrophages induces dysregulated cytokine re sponses in macrophages when they are subsequently exposed to bacterial pathogens. There were four specific aims: Specific Aim 1: To Determine whether Ca nine Influenza Virus Replicates in Canine Macrophages and Induces Cell Death. Primary alveolar macrophages were i noculated with Canine/FL/04 and virus replication was measured by quantitative RT-PCR, infectious plaque assay and immunoperoxidase staining for hemagglutin in protein. Virus gene expression of Canine/FL/04 was compared to the equine vi rus, Equine/KY/91 by quantitative RT-PCR. Viability and apoptosis of macrophages fo llowing Canine/FL/04 inoculation was assessed by dye exclusion and annexi n V/ propidium iodide assay. Specific Aim 2: To Characterize Alterati ons in Cytokine Production Induced by Canine Influenza Virus in Macrophages. Canine influenza virus induced alterations in macrophage production of TNFand IL-10 mRNA levels were determined with quantitative RT-PCR. ELISA was used to determine protein levels of TNFand IL-10. Expression of TNFfollowing Canine/FL/04 inoculation was compared to that following Equine/KY/91 to determine if the TNFresponse was virus-specific. Specific aim 3: To Determine whether B acterial TLR Agonist-Induced Cytokine Production by Macrophages is Enhanced by Prior Infection with Canine Influenza Virus. Canine/FL/04-inoculated macrophages were challenged with lipopolysaccharide, lipoteichoic acid, flagellin and CpG unmethy lated DNA, and cytokine mRNA and protein levels were determined as in specific aim 2.

PAGE 31

31 Specific Aim 4: To Identify the Mechan ism by which Canine Influenza Virus Augments Macrophage TNFResponse to LPS. Quantitative RT-PCR was used to determi ne levels of mRNA in Canine/FL/04inoculated macrophages exposed to LPS. Actinomycin was used to halt mRNA transcription, and quantitative RT-PCR wa s used to assess mRNA stability. Experiment 1 Specific Aim 1 To determine whether canine influenza virus replicates in canine macrophages and induces cell death. Objectives Determine the extent of Canine/FL/04 r eplication in primary canine alveolar macrophages. Compare the ability of Canine/FL/04 and E Q/KY/91 to replicate in canine alveolar macrophages. Determine the effect of virus infection on the survival of canine blood monocyte derived macrophages Rationale Influenza viruses vary in their ability to infect and replicate in macrophages. The ability of Canine/FL/04 to infect and reproduce in canine macrophages has not been investigated. Infection may cause rapid deat h of the cell, either by necrosis or apoptosis, which may lead to initial depletion of important primar y pulmonary defenses. Loss of pulmonary macrophages may dull t he innate immune response to virus and slow the development of an adaptive imm une response. Addi tionally, decreased numbers of pulmonary macrophages may reduce clearance of bacteria in the lung, paving the way for secondary bacterial pneumonia.

PAGE 32

32 Infection of macrophages may lead to r eplication of the virus, providing an additional source of virus apart from resp iratory epithelium for further spread within pulmonary tissue. There appears to be marked variation across influenza virus strains and host species in the capacity for replication in macrophages. To determine if the effects of Canine/ FL/04 on macrophages are specific to the virus or represent a change representative of all influenza viruses, a H3N8 equine influenza virus of a similar lineage but genet ically distant to the canine isolate will be used to compare macrophage response to inoc ulation with virus. Presumably, some degree of host adaptation of the canine virus has taken place to allow replication and spread within a new host, and this may be evi dent in the degree to which the virus can replicate in canine cells. Experimental Design and Methods In preliminary studies, the suitability of dog macrophages from three sources for studies on canine influenza virus replication and cytokine expression were assessed: 1) Macrophages lavaged from lungs of laboratory-maintained beagle dogs; 2) Macrophages lavaged from eutha nized (cadaver) dogs at a local community animal shelter; and 3) Macrophages derived in vitro from peripheral blood monocytes. Initial viral replication and TNFinduction studies on lavage d macrophages from beagle dogs and cadaver dogs yielded comparable result s (Appendix A). However, only small numbers of macrophages were recoverable by pulmonary lavage from normal beagle dogs. Macrophages derived from peripheral blood monocytes had poor survival in culture using several culture methods,20,61,124 and only minimal TNFproduction in response to virus inoculation was found in blood-derived macrophages compared to primary alveolar macrophages (Appendix B). All subsequent studies were performed

PAGE 33

33 on macrophages lavaged from mixed breed, male and female dogs from a local shelter within 30 minutes to 90 minutes following euthanasia with sodium pentobarbital. Purified canine alveolar macrophages were inoculated with Canine/FL/04 or Equine/KY/91 and studied up to 48 hours after inoc ulation. Time points after inoculation that each assay was performed are listed in Table 2-1. For experiments comparing equine and canine viruses, replicate inocul ations for each virus were performed on alveolar macrophages sourced from the sa me animal. Mock-inoculated macrophages were used as negative controls for each experiment. Isolation of al veolar macrophages Alveolar macrophage isolation methods via pulmonary lavage were adapted from previously published reports.20,61,135 Lungs of cadaver dogs were lavaged twice with cold Dulbeccos phosphate buffered saline (D-PBS). Lavaged cells were pelleted by centrifugation, washed twic e with D-PBS, and suspended in Minimum Essential Medium Alpha Medium (MEM Gibco, Grand Island, NY) suppl emented with 10% FBS and 1% Antibiotic-Antimycotic (Sigma Aldrich, St Louis, MO). Macrophages were purified by adhesion by culturing overnight followed by washing with MEM Adherent macrophages were eluted from culture flasks via trypsinization. Macrophage concentration in the resulting suspension wa s determined by total and differential cell counts. Morphological i dentification of macrophages was confirmed with CD68 immunnoperoxidase staining. Macrophages were seeded into 12or 24-well tissue culture plates at a concentration of 5x105 per well and cultured overnight prior to inoculation studies.

PAGE 34

34 Virus and mock inocula Viruses were propogated in MDCK cells. The Equine/KY/91 virus used in experiments was passaged twice, and Canine/F L/04 was passaged 3 times. Infectivity of stock virus was assessed by plaque assay, adapted from previous reports57,131 as cytopathic effect on confluent cultures of MDCK cells with a 0.5% agarose overlay. Mock inocula comprised a lysate of MDCK cells prepared as per virus stock without seed virus added. Suitability of mock inocul a was validated by comparing alveolar macrophage responses to mock-inocula a nd UV-inactivated virus (Appendix C). Macrophage inoculation Media was removed from macrophages, 0. 5 ml of virus inoculum was added to the cells at a concentration of 2x106 PFU/ml (MOI=2) unless otherwise stated. Cells were incubated with virus for one hour. The inoculum was then discarded and replaced with supplemented MEM In all experiments, the point immediately after the 1 hour incubation period is referred to as the hour time point. Determination of virus titers Culture media was collected at each time point and frozen at -70 C. Samples were later thawed on ice, and titers were measured by infectious plaque assay on confluent layers of MDCK cells with 0.5% agarose over lay. Virus titers were reported as plaque forming units (PFU) per milliliter of supernatant. H3 antigen staining in alveolar macrophages Alveolar macrophages were inoculated with vi rus or mock inoculated at an MOI of 4 in order to assure that a large num ber of macrophages being sampled would be successfully infected. Twelve hours after virus i noculation, cytospin preparations were made of combined trypsiniz ed and non-adherent macrophages. Cells were fixed in 10%

PAGE 35

35 neutral buffered formalin for 1 hour. Air-dried slides were stained for H3 influenza A antigen using a H3 mouse anti-influenza A monoclonal antibody (Chemicon-Millipore, Temecula, CA). Bound antibody was detec ted using a STAT-Q 3-step peroxidase staining system (Innovex Biosciencs, Richm ond, CA), and slides were counter stained with hematoxylin. Real-time RT-PCR Total RNA was isolated from inoculated macrophages at each time point using the RNeasy Mini Kit (Qiagen, Valencia, CA ) including DNase treatment. cDNA was synthesized from mRNA with oligo(dT) pr imers using the Advantage RT for PCR kit (Clonetech, Mountain View CA). Canine G3 PDH and Matrix mRNA were quantified by real-time PCR using TaqMan Universal PCR master mix and TAMRA FAM probes (Applied Biosystems, Branc hburg, NJ) in the DNA engine Opticon II system (MJ Research/Bio-Rad Laboratories, Hercules, CA). Primer and probe sequences are listed in Table 2-2. Primer efficiency and mRNA quant ification calculations were performed as described by Pfaffl.119 EIV matrix mRNA expression wa s corrected relative to 0h CIV matrix mRNA expression as comparisons of 0h expression revealed approximately 6fold greater expression of EI V matrix mRNA than CIV matr ix mRNA. All mRNA levels were normalized to G3PDH mRNA expression. Results were expressed as a ratio to the matrix mRNA expression immediatel y after the inoculation period. Trypan blue assay At the specified times, macrophages were eluted by trypsinization and combined with non-adherent cells in cu lture media. Cell counts and trypan blue exclusion assays were performed on the resulting cell suspension using a hemocytometer.

PAGE 36

36 Caspase-3/7 assay Purified alveolar macrophages were seeded into wells of a Nunc FluoroNunc 96-well plate (Sigma Aldr ich) at a rate of 5x104 per well. Macrophages were inoculated with virusor mock-inoculum (MOI=2), and for two experiments, an additional negative control using virus-inoculum inactivated by exposure to UV light for 2 hours was used to control for caspase activity in the virus i noculum. After the inoculation period, inocula were removed and fresh warm supplemented MEM was added to each well. Staurosporine (Sigma Aldrich, S6942) was used to induce apoptosis in positive control wells. After 12 hours incubation, caspase3/7 activity was measured using the ApoONE homogenous caspase-3/7 assay (Promega, Madison, WI). Plates were read using the Synergy HT microplate reader (Bio-tek Instruments Inc.). Annexin-V/Propidium iodide flow cytometry Apoptosis was detected usi ng flow cytometry and the TACS Annexin-V FITC apoptosis detection kit (R&D Systems). Al veolar macrophages were seeded into a 24well plate at a concentration of 2x106 macrophages per well and inoculated at an MOI of 2 with CIV or mock-inoculum. Positive cont rol wells were incubated with supplemented MEM media. After the 1-hour incubation period, the inocula were removed, and 1ml fresh supplemented media was added to the wells. Staurosporine was used to induce apoptosis in positive control wells. After 12 hours trypsinized and non-adherent cells were combined, processed as per manufac turers directions and analyzed by flow cytometry using a FACSort flow cytometer (BD Biosciences, San Jose, CA).

PAGE 37

37 Data analysis Data were expressed as mean standar d deviation, derived from the total number of experiments performe d for each variable. Logarithm ic transformation of data was performed if required to obtain normalit y or equal variance between groups. Means were compared using a one-way analysis of variance (ANOVA) or t-test if only two variables were examined. In the event of unequal group variances that were not corrected by logarithmic transformation, nonp arametric methods were used to compare groups (e.g., Kruskal-Wallis analysis). A P value <0.05 indicated a significant difference between compared groups. Stat istical analysis was performed using Sigmastat 3.5 software (Systat Software, Inc, Richmond, CA). Experiment 2 Specific Aim 2 To characterize alterations in cytoki ne production induced by canine influenza virus in macrophages. Objectives Measure the canine macrophage TNF, and IL-10 response to Canine/FL/04 Compare the TNFresponse of canine macrophages to Canine/FL/04 and Equine/KY/91 viruses. Rationale The degree to which viral infection c an induce the production of inflammatory cytokines has a large impact on the outcome of infection. Inflammatory mediators such as cytokines greatly influence the type and degree of inflammation and thus the extent of pathology associated with viral infection. Much of the early cytokine response comes from the primary target of influenza virus; infected re spiratory epithelial cells.23 However,

PAGE 38

38 different influenza viruses vary in their capac ity to incite a strong cytokine response in macrophages, and this likely contributes to th e extent of pathology, and thus primary viral pneumonia seen in the lungs of infected hosts.27,134 TNFplays an important role in the in itiation and amplification of an inflammatory response by activating endothelia l cells to express adhesion molecules for the migration of inflammatory cells, in creasing vascular permeability, and activating leukocytes for increased killing ability and cytokine/chemokine synthesis. Additionally, TNF is an important mediator of the acute phase response and in itiation of fever. IL-10 is a potent anti-inflammatory cytokine able to diminish the functional capacity of macrophages and neutrophils.10 Additionally, the production of certain cytokines such TNF may play a role in the resistance of cells to vira l infection or replication.125 The degree to which canine influenza virus is able to induce a TNFresponse may be a factor contributing to the ability of canine influenza virus to infect dogs, differentiating it from earlier equine strains. The evolution of the distantly relat ed Equine/KY/91 to the recent Canine/FL/04 virus presumably involved some degree of hos t adaptation, allowing the canine virus to cause disease and become transmissible with in a new host. That adaptation may be evident in the degree to which the viruses are able to induce the production of cytokines, which play an important role in th e initiation and manifestation of disease. Also, by comparing the equine and canine viruse s, some measurement of the specificity of the macrophage response to individual influenza viruses may be discernable.

PAGE 39

39 Experimental Design and Methods Alveolar macrophages were inoculated with Canine/FL/04, Equi ne/KY/91, or mock inoculum, as described in Experiment 1. To initially characterize the cytokine response to Canine/FL/04, TNFand IL-10 mRNA and protein levels were determined at 0, 3, 6, 12, and 24 hours after virus inocul ation. To compare the TNFresponse to canine and equine viruses, mRNA was quantified at 0, 3, 6, 9, 12 and 24 hours after inoculation. TNFprotein quantification for equine and c anine comparative studies was performed at 12 hours after inoculation only. Real-time RT-PCR for cytokine mRNA Methodology was described in experiment 1. Primer and probe sequences for TNFand IL-10 are listed in Table 2-2. Result s were expressed as a ratio to the TNFor IL-10 mRNA expression in mock-i noculated cells at each time point. Enzyme-linked immunosorbent assay (ELISA) Canine TNFand IL-10 protein in culture media was quantified using a commercial ELISA (R&D Systems, Mineapolis MN). Media were collected from macrophage cultures at the specified times a fter the inoculation period, centrifuged to remove cells, and stored at -70 C until further processing as per the manufacturers instructions. Plate absorbance readings were determined using the Synergy HT microplate reader (Bio-tek Inst ruments Inc., Winooski, VT). Data analysis Analysis of data was performed as described in experiment 1.

PAGE 40

40 Experiment 3 Specific Aim 3 To determine whether Toll-like receptor agonist-induced cytokine production by macrophages is enhanced by prior infection with canine influenza virus Objective Determine the effect of prior influenza infection on the macrophage TNFresponse to the bacterial toll-like re ceptor agonists lipopolysaccharide (LPS), lipoteichoic acid (LTA), flagellin and CpG unmethylated DNA. Rationale Previous studies have demonstrated the potentiating effect of influenza virus infection on TNFproduction in a mouse macrophage cell line and human monocytes exposed to LPS 16,50,102. These studies showed that mRNA levels and protein expression were not correlated, and that the excessive TNFrelease was due to increased translation of mRNA present before LPS exposure Overproduction of TNFin response to bacterial components may pl ay an important role in increasing the severity of bacterial pneum onia following influenza infection by excessively activating pulmonary vascular endothelium, increasing vascular permeability and recruiting leukocytes. Experimental Design and Methods Alveolar macrophages were inoculated wit h Canine/FL/04 or mock-inoculum as described in experiment 1. At 0, 3, and 6 hours after inoculation, a variety of concentrations of each TLR agonist were added to the culture media. Culture media was then collected at 0, 3, 6, 12 and 24 hours after virus inoculation and TNFprotein levels were determined by ELISA as described in experiment 2.

PAGE 41

41 Toll-like receptor agonists Lipopolysaccharide experiments : LPS from Salmonella enterica serotype typhimurium (Sigma Aldrich, L6143) was used for all experiments. Initially, alveolar macrophages were exposed to 1-1000ng LPS per milliliter culture media immediately after the virus inoculati on period. One well of macrophages was used for each time point for both mockand virus-inoculated gr oups. Culture medium from each well was used for TNFELISA. In subsequent experiment s, alveolar macrophages were exposed to 1ng/ml LPS at 3 or 6 hours a fter the virus inoculation period, and 170 l of culture medium was sampled at each measur ement time point, and replaced with 170 l fresh medium. Lipoteichoic Acid experiments : LTA from Streptococcus pyogenes (Sigma Aldrich L3140) was used. Virusand mockinoculated macrophages were exposed to 1000ng LTA/ml culture medium at 0, 3, and 6 hours after the vi rus inoculation period. At 6 and 12 hours after virus inoculation, 170 l of medium from eac h well was sampled and replaced with 170 l fresh medium. As peak levels of TNFwere measured 12 hours after virus inoculation in the LPS ex periments, only the 12-hour sample was used for these studies. Flagellin experiments : Purified flagellin from Salmonella enterica serotype typhimurium (InvivoGen San Diego, CA ST-F LA) was used. Virusand mock-inoculated macrophages were exposed to 2 g flagellin/ml culture medium at 0, 3 and 6 hours after the virus inoculation peri od. At 6 and 12 hours afte r virus inoculation, 170 l of medium from each well was sampled and replaced with 170 l fresh medium. Only the 12-hour sample was used for these studies.

PAGE 42

42 CpG experiments : Type C CpG oligonucleotide (InvivoGen, ODN 2395) was used. At 0, 3 or 6 hours a fter the virus inoculation per iod CpG unmethylated DNA was added to culture media at a concentration of 5 M. At 6 and 12 hou rs after virus inoculation, 170 l of medium from each well wa s sampled and replaced with 170 l fresh medium. Only the 12-hour sample was used for these studies. Experiment 4 Specific Aim 4 To identify the mechanism by which c anine influenza virus augments macrophage TNFresponse to LPS. Objective Determine the cellular mechanism by wh ich canine influenza virus augments the cytokine response to LPS by canine macrophages. Rationale An increased cytokine response to LPS in macrophages infected with canine influenza virus could result from a number of mechanisms. The combination of canine influenza virus and LPS could lead to a net in crease in the rate or amount of cytokine mRNA transcription. This may occur thr ough an overlap or synergism of signaling pathways such as the mitogen-activa ted protein kinase (MAPK) or NFB related pathways, initiated by the virus and bacterial product.79 Additionally, influenza virus infection alone or in combination with LPS may stabilize mRNA such that the half-life of mRNA is increased, leading to a greater pool of cytokine mRNA available for translation. Alternately, influenza A infect ion of macrophages may lead to suppression of translation of cytokine mRNA through such mechanisms as dsRNA initiated pathways mediated by Protein kinase R (PKR),49 or by cap-snatching from host mRNAs for viral

PAGE 43

43 mRNA translation.77 A secondary stimulus such as LP S may overcome these inhibitions on host mRNA translation, leading to increased cytokine production. Canine influenza alone may lead to translati on of bioactive protein that is not secreted from infected macrophages. A secondar y stimulus such as LPS may trigger release of preformed cytokine. Additionally, increased levels of protein may arise due to increased rates of translation of mRNA after secondary stimulus with LPS. Experimental Design Because many of the techniques used to assess molecular mechanisms such as rate of transcription require large numbers of cells not a ttainable by lung lavage, the canine macrophage cell line, DH-82 cells was inve stigated as a model of the alveolar macrophage (Appendix D). TNFexpression in Canine/FL/04-inoculated DH82 cells exposed to LPS or LTA 3 hours after inoculat ion revealed a response very different from that seen from alveolar macrophages. This model was not pursued further, and limited studies using alveolar macr ophages were instead performed. Quantitative RT-PCR was used to determi ne levels of mRNA in Canine/FL/04inoculated alveolar macrophages exposed to LPS at 3 hours after virus inoculation. mRNA levels were measured at 0, 3, 6, 9, and 12 hours after virus inoculation. To assess TNFmRNA stability, actinomycin D was used to halt mRNA transcription in virus and mock-inoculated macrophages exposed to LPS at 3 hours after inoculation. Quantitative RT-PCR was used to assess mRNA stability at 30-minute intervals after actinomycin D administration.

PAGE 44

44 Real-time RT-PCR. Methodology was as described in experimen t 1. Cells were virusor mock inoculated, and exposed to LPS (1ng/ml) from 3 hours after inoculation. Negative controls were virusand mock-inoculated cells not exposed to LPS. Total RNA was collected from the 4 groups of cells (from t he same animal) at eac h time point. Results were expressed as a ratio to the TNFmRNA expression in mock-inoculated cells at each time point. Actinomycin D inhibition of mRNA synthesis To determine the stability of cytokine m RNA within the cell, transcription was halted with actinomycin D. LPS was added to virusand mock-inoculated wells 3 hours after the inoculation period. Thirty minutes after addition of LPS, actinomycin D (Sigma Aldrich) solubilized in ster ile DMSO was added to culture media at a concentration of 5 g/ml media. Total RNA was harvested imm ediately as well as 30 minutes, 1 hour, 1.5 hours and 2 hours after actinomycin D admin istration. mRNA quantitation was performed as described above.

PAGE 45

45 Table 2-1. Virus used for assays at time points after inoculation. Experiment 0 hrs 3 hrs 6 hrs 9 hrs 12 hrs 24 hrs 48 hrs Titer CIV CIV CIV CIV CIV CIV H3 immuno-peroxidase staining. CIV Matrix real-time RT-PCR CIV EIV CIV EIV CIV EIV CIV EIV CIV EIV CIV EIV CIV Trypan blue exclusion assays CIV CIV CIV CIV Annexin-V/Propidium iodide, caspase assay CIV For all experiments, mock-inoculated cells were also used as controls. CIV = Canine/FL/04, EIV = Equine/KY/91. Table 2-2. Primer and probe sequences. Primer set Primer sequences (5`-3`) Probe sequence (5`-3`) Matrix Fwd: TGATCTTCTTGAAAAATTTGCAG Rev: CCGTAGCAGGCCCTCTTTTCA ATGCAGCGATTCAAGTGATCCTCTCGTT G3PDH113 Fwd: TCAACGGATTTGGCCGTATTGG Rev: TGAAGGGGTCATTGATGGCG CAGGGCTGCTTTTAACTCTGGCAAAGTGGA TNF48 Fwd: GAGCCGACGTGCCAATG Rev: CAACCCATCTGACGGCACTA CGTGGAGCTGACAGACAACCAGCTG IL-10113 Fwd: CGACCCAGACATCAAGAACC Rev: CACAGGGAAGAAATCGGT TCCCTGGGAGAGAAGCTCAAGACCC

PAGE 46

46 CHAPTER 3 CANINE INFLUENZA VIRUS REPLICAT ES IN ALVEOLAR MACROPHAGES AND INDUCES TNFAbstract Canine influenza virus (CIV) is a rec ently emergent pathogen of dogs that has caused highly contagious respiratory di sease in racing greyhounds, pet dogs and shelter animals. Initial characterizations of CIV induced respiratory disease suggested alveolar macrophages may be susceptible to viru s infection. To investigate the role of the alveolar macrophage in the pathogenesis of canine influenza virus infection, primary alveolar macrophages were inoculated with CI V and studied from 0 to 48 hours later. Virus titers in alveolar macrophage culture supernatants increased si gnificantly (p<0.05, n=7) from 3 to 24 hours following virus inoc ulation. Virus matrix gene expression was significantly increased (p<0.05, n=14) at 3, 6 and 12 hours after inoculation, peaking at 6445-fold the level of RNA detectable imme diately following inoculation. Virusinoculated macrophages demonstrated significant ly (p<0.05, n=5) decreased viability (30% trypan blue positive) by 12 hours afte r inoculation compared to mock-inoculated cells (5% trypan blue positive). By 12 hours after inoculation, TNFand IL-10 mRNA levels were significantly (p<0.05, n=11) increased over those immediately following inoculation. Only TNFprotein levels were significantly increased (p<0.05, n=11) at 12 hours after inoculation. In conclusion, the resu lts indicate that CIV replicates in canine alveolar macrophages, induces TNFexpression and induces cell death. Introduction Influenza A viruses are enveloped, s egmented, single stranded, negative-sense RNA viruses belonging to t he family Orthomyxoviridae.77 Canine influenza virus (CIV) was first isolated in 2004 duri ng the investigation of an outbreak of respiratory disease

PAGE 47

47 in greyhounds in Florida.32 CIV is an influenza A virus closely related genetically to contemporary H3N8 equine influenza viruses.32 Serologic evidence suggests the virus was present in the racing grey hound population as early as 2000.41 Since the discovery of CIV, serologic and virologic evidence indi cates the virus has spread within the racing greyhound population, as well as in other non-racing dogs throughout the United States.41,112 Clinical disease associated with CIV typicall y is observed within 5 days of infection and is characterized by anorexia, lethargy, fe ver and serous to purulent nasal discharge as well as by nonproductive cough t hat may persist for several weeks.41 A subset of infected dogs develop pneumonia which is complic ated by secondary ba cterial infection, and it is in these animals that mortalit y associated with CIV is most commonly seen.41 A more severe form of disease has been seen in a minority of infected racing greyhounds that die peracutely with severe hemorr hagic pneumonia characterized by extensive pulmonary, mediastinal and pleural hemorrhage.32 The disease is highly transmissible, with seroconversion rates of up to 95% in groups of exposed animals.32 Histologic evaluation of nat urally and experimentally infected animals revealed neutrophilic to lymphohistiocytic tracheitis an d bronchitis, with necrosis and hyperplasia of surface and glandular epi thelium. Bronchopneumonia, when it occurs, is typically neutrophilic to histiocytic, with inters titial edema and minimal to extensive hemorrhage.32,41,112 Immunohistochemical studies on infected animals revealed influenza antigen (H3) in the cytoplasm of bronchial surface and glandular epithelium, bronchiolar epithelium, and macrophages in airway lumens and alveolar spaces.32

PAGE 48

48 Alveolar macrophages play an important role in the pat hogenesis of influenza virus infection. Cytokines produced by macrophages in the lung are important in establishing an innate immune response, as well as in determining the magnitude of the inflammatory response to influenza infe ction. Tumor necrosis factor (TNF), an important pro-inflammatory cytokine produced by macrophages, is pivotal in the establishment of an acute inflammatory response through its actions of activating endothelium and leukocytes and induction of increased vascular permeability, which in the lung may lead to increased pulmonary recrui tment of inflammatory cells as well as the development of pulmonar y edema and hemorrhage. Various influenza viruses have been shown to differentially i nduce the expression of TNFin macrophages.27,134 The degree to which specific influenza viruses induce TNFexpression has been shown to be strain dependent and influenced by viral genes such as HA and NA.27,134 IL-10 is a functionally co mplex cytokine with an import ant role in increasing susceptibility to bacterial pneum onia following influenza infection.158 IL-10 has been shown to impair host response to Streptococcus pneumoniae pneumonia in mice,156 as well as to have a role in the developm ent of bacterial pneum onia concomitant with sepsis.146 The source of IL-10 in the pulmonary environment during and after influenza infection is currently poorly defined, but may be from both T-cells and/or macrophages. It is important to know if CIV induces IL -10 in macrophages since IL-10 may predispose virus infected dogs to develop se condary bacterial pneumonia. Influenza viruses induce cell death in macrophages through either apoptosis or necrosis, in a strain dependent manner.99,134 Several studies have shown that alveolar macrophages play a role in limiting dis ease severity following influenza virus

PAGE 49

49 infection.71,154 Furthermore, loss of alveolar ma crophage viability or function after influenza infection could potentially diminish innate immunity to bacterial challenge, and thus contribute to the development of secondary bacterial pneumonia.8,105,129 The objectives of this study were to determine if canine alveolar macrophages support replication of canine influenza virus and, if so, to determine if virus replication induces high levels of pro-infl ammatory cytokines such as TNFas well as macrophage death. Materials and Methods Alveolar Macrophage Isolation In preliminary studies, the suitability of dog macrophages from three sources for studies on canine influenza virus replicatio n and cytokine expression was assessed: 1) Macrophages lavaged from lungs of laboratory-maintained beagle dogs; 2) Macrophages lavaged from eutha nized (cadaver) dogs at a local community animal shelter; and 3) Macrophages derived in vitro from peripheral blood monocytes. Initial viral replication and TNFinduction studies on lavage d macrophages from beagle dogs and cadaver dogs yielded comparable result s. However, only small numbers of macrophages were recoverable by pulmona ry lavage from normal beagle dogs. Macrophages derived from perip heral blood monocytes had poor survival in culture using several culture methods,20,61,124 and only minimal TNFproduction in response to virus inoculation was found in blood-derived macrophages comp ared to primary alveolar macrophages. All subsequent studies were performed on macrophages lavaged from mixed breed, male and female dogs from a lo cal shelter within 30 minutes to 90 minutes following euthanasia with sodium pentobarbital. Dogs were excluded from the study if they had any of the following abnormalitie s: 1) gross evi dence of pneumonia or

PAGE 50

50 pulmonary hemorrhage; 2) greater than 10% neutrophils in t heir pulmonary lavage fluid; or 3) positive culture of lavage fluid for mycoplasma (on SP-4 agar) or greater than 5 bacterial colonies on sheep blood agar (SBA). Approximately two th irds of the total dogs studied were positive for Dirofilaria immitis infestation based upon antemortem serologic testing and upon identification of adul t nematodes in the heart at necropsy. Alveolar macrophage isolation methods vi a pulmonary lavage were adapted from previously published reports.61,135,139 The trachea was dissected and isolated in the midcervical region, and an incision made th rough which lavage tubing was passed to the level of the thoracic inlet. String was used to create a seal between the trachea and tubing, and 700-1000ml of co ld Dulbeccos phosphate buffered saline (D-PBS) was introduced through the tubing and into the lungs under approx imately 25 cm H2O pressure. Fluid was drained from the lung into a sterile flask, and a second similar wash was performed. Lavage fluid was cultured for bacteria and mycoplasma on sheep blood agar (SBA) and SP-4 agar respectively, at 37C in 5% CO2. Tryptic soy broth was also inoculated with 0.1-0.2ml lav age fluid and similarly cultured to screen for trace bacterial contamination. SBA plates and tryptic so y broth were read at 24-48 hours after inoculation. SP-4 plates were read at 5 days after inoculation. Washings were filtered through a single layer of sterile gauze, and c entrifuged for 10 minut es at 4C, 500xg. Supernatants were removed, and the cell pe llets resuspended in a small amount of DPBS and transferred to 50ml conical centrifuge tubes. Tubes were filled to the 50ml mark with D-PBS, and then centri fuged for 5 minutes at 4C, 500xg. Cell pellets were again resuspended in 50ml sterile D-PBS and cent rifuged. The resulting cell pellet was resuspended in 10ml of cold MEM (Gibco, Grand Island, NY ) supplemented with 10%

PAGE 51

51 fetal bovine serum (Sigma-Aldrich, S t. Louis, MO), 100 IU /ml penicillin, 100 g/ml streptomycin and 0.25 g/ml actinomycin (Sigma-Aldrich, St. Louis, MO). 0.1 ml of cell suspension was diluted 1:100 and 1:1000 for nucleated cell counts (using a hemacytometer) and for manual cell differential counts (cyt ospin preparations, WrightGiemsa staining), respectively. Macrophages were purified by adhesi on. The cell suspension was divided between two 150cm2 tissue culture flasks (Corning, Lo well, MA), and diluted to 25ml (per flask) with supplemented MEM medium. Cells were incubated for 2-4 hours at 37C in 5% CO2. The flasks were gently rocked at hourly intervals during incubation. Non-adherent cells were then gently resuspended by rocking the flasks, and the suspension was removed leaving adherent cells. 15ml of warm supplemented MEM medium was added, and incubated overnight at 37C in 5% CO2. The following day, the cells were washed 3-4 times with 5-10ml warm MEM to remove any loosely adherent or non-adherent cells. Adherent cells were elut ed from the tissue culture flasks by first washing once with warm D-PBS, followed by two 1-3 minute incubations with 37C 10x Trypsin-EDTA solution (Sigma -Aldrich, St. Louis, MO) dilu ted 1:10 in D-PBS, with gentle agitation of the flasks. The trypsinized ce lls were collected into equal volumes of supplemented MEM medium. The resulting cell su spension was centrifuged for 5 minutes at 4C, 500xg, and t he cell pellet was resuspended in cold medium and placed on ice until further processing. 0.1ml of the cell suspension was diluted 1:10 and 1:100 for trypan blue exclusion assay (for cell viabi lity), cell counting, and differential counts. The cell suspension was then seeded into 24-w ell plates at a concentration of 5x105

PAGE 52

52 viable macrophages per well, and inc ubated overnight at 37C in 5% CO2, prior to viral inoculation studies. Macrophage purity was assessed by cytology after Wright-Giemsa staining in each experiment and agreed well with immunocyt ochemical staining for CD68 (Biocare, Concord, CA). Macrophage purity was typica lly >85%, with remaining cells consisting almost entirely of small mononuclear cells consistent with either immature macrophages / monocytes or lymphocytes. Virus and Virus Titers. Virus used in all studies was a second or third passage influenza A/Canine/FL/04 virus, propagated in MDCK cells from a sto ck kindly provided by Dr Ed Dubovi (Cornell University). Infectivity of stock and s upernatant in macrophage cultures was assessed by plaque assay, adapted from previous reports57,131 as cytopathic effect on confluent cultures of MDCK cells wit h a 0.5% agarose overlay. Macrophage Inoculation Alveolar macrophages were inoculated wit h virus diluted in 1ml cold MEM at a multiplicity of infection (MOI) of 2 unless otherwise noted. Cells were incubated with virus for 1 hour at 37C in 5% CO2. Mock inoculated cells were incubated with MDCK cell lysate prepared as per virus stock wit hout seed virus added. The MDCK lysate was diluted identically to the virus inoculum in cold MEM At the end of the 1 hour inoculation period, the inoculum was removed and replaced with 1ml warm supplemented MEM The time point referred to as 0 hour in all graphs is thus 1 hour after virus or mock inoculation. In a second set of experiments to dete rmine whether there was persistence of virus inoculum that was being detected at the 3 hour time point, macrophages were

PAGE 53

53 inoculated at MOI of 0.1 and 0.01. For the MOI of 0.1 experiment, two wells, in separate 24-well plates, were seeded with 2x106 macrophages. Prior to inoculation, culture medium was removed fr om one of the wells and the cells were frozen at -80C for 30 minutes. Each of the wells were inoculated with 2x105 PFU of 3rd passage Influenza A/Canine/FL/04 (MOI = 0.1) suspended in 0.5ml MEM and incubated at 37C for 1 hour. The inoculum was removed and placed in a centrifuge tube. The wells were washed once with 2ml of warm MEM The wash was collected and added to the centrifuge tube containing the in oculum. Half a milliliter of warm fresh supplemented medium was added to the wells. The combined wash and inoculum was centrifuged for 5 minutes at 500xg to collect any su spended macrophages. The cell pellet was resuspended in 5ml of warm MEM and centrifuged for 5 minutes. The resulting cell pellet was then resuspended in 0.5ml warm supplemented medium, and returned to the well from which it originated. At 3, 12 and 24 hours after the inoculation period, 0.5ml of culture medium was collected and stor ed at -70C, and 0. 5ml of warm fresh supplemented medium was replaced into we lls. Titers were measured by standard infectious plaque assay. A third well was tested at MOI of 0.01 in a similar manner except the well with viable macr ophages was inoculated with 2x104 PFU of canine influenza virus. Real-Time RT-PCR Total RNA was isolated from inoculated and mock inoculated macrophages at the specified time points using the RNeasy Mini Kit (Qiagen, Valencia, CA, USA). Supernatants were removed from macrophage cultures, centrifuged at 10,000 rpm for 5 minutes, and cell pellet collected. Lysate buffer was added to adherent cells in wells, and then transferred to cell pellet from the supernatant. Lysates were stored at -70C

PAGE 54

54 until processed further as per manufacturers instructions Total RNA was measured by optical density at 260nm. cDNA was synthes ized using the Advantage RT for PCR kit (Clontech, Mountain View, CA). Viral gene, G3PDH and cytokine mRNA was quantified by real-time PCR using the DNA engine Opticon II system (MJ Research/Bio-Rad Laboratories, Hercules, CA) at conditions of 95C for 10 min, and 95C for 15 s, 60C for 1 min (40 cycles). Primer and pr obe sequences for canine G3PDH, TNFand IL-10 were obtained from the literature, and are listed in Tabl e 3-1. Virus matrix gene primer sequences were kindly provided by R. Donis (C enters for Disease Control, Atlanta, GA). Virus probe sequences were generated using Primer Express Software for Real-Time PCR, version 3.0 (Applied Biosystems, Foster City, CA) from the NCBI influenza virus resource. Viral matrix gene and cytokine m RNA levels were normalized to G3PDH mRNA expression. As a positive control fo r cytokine expression, alveolar macrophages were incubated with lipopolysaccharide (LPS ) at concentrations ranging from 1-1000 ng/ml culture supernatant (n=7). Maximal TNFmRNA expression occurred at 6 hours after inoculation, averaging 32-fold the level of expression in mock-inoculated macrophages. Maximal IL-10 mRNA expres sion also occurred at 6 hours after inoculation, averaging 5-fold the level of expression in mock-inoculated cells. As a negative control, alveolar macrophages were incubated with UV-inactivated virus (n=3). At 12 hours after inoculation, macrophages in cubated with inactivated virus averaged 1.2-fold the level of TNFexpression, and 0.9-fold the le vel of IL-10 expression in mock-inoculated cells. Cytokine Protein Quantification Canine TNFand IL-10 were quantified by EL ISA (R&D Systems, Minneapolis, MN). Supernatants were collected from macr ophage cultures at the sp ecified times after

PAGE 55

55 the inoculation period, and stored at -70C until further processing as per the manufacturers instructions. As a positive c ontrol, alveolar macrophages were incubated with LPS at concentrations ranging from 1-1000ng/ml (n=7). Average TNFprotein levels peaked at 368 pg/ml supernatant by 6 hours after LPS exposure. Average IL-10 protein levels peaked at 226 pg/ml supernat ant by 12 hours after LPS exposure. Macrophage Viability To assess virus effects on viability, al veolar macrophages were inoculated as described above, and cultured in 0.5ml supplemented MEM medium. At the specified time, the culture medium was collected. To remove adherent macrophages, 0.5ml of 1x Trypsin/EDTA was added to the well, and repeatedly resuspended over the cells. The resulting cell suspension was added to t he medium, and cell counts and trypan blue exclusion assay were perform ed using a hemocytometer. H3 Antigen Staining in Alveolar Macrophages Alveolar macrophages were inoculated with vi rus or mock inoculated at an MOI of 4 in order to assure that a large num ber of macrophages being sampled would be successfully infected. The efficiency of infect ion was uncertain. Cells were incubated with inoculum for 1 hour. The inoculum was removed and replaced with fresh supplemented MEM and further incubated at 37C in 5% CO2 for 12 hours. The medium was collected, and adherent cells were trypsinized and added to the collected medium. Cytospin preparations were then made on glass slides, and the slides were fixed in 10% neutral buffered formalin for 1 hour. Air dried slides were stained for H3 influenza A antigen using a H3 mouse antiinfluenza A monoclonal antibody (ChemiconMillipore, Temecula, CA). Bound antibody was detected using a STAT-Q 3-step

PAGE 56

56 peroxidase staining system (Innovex Biosci encs, Richmond, CA), and slides were counter stained with hematoxylin. Results Virus Replication Culture supernatants from 7 experiment s were titrated by plaque assay for infectious virus. Average virus titer in cu lture supernatant from 7 experiments increased 15-fold by 24 hours after the 1-hour inocul ation period (time 0 on all graphs), and thereafter declined (Fig. 3-1). The 3, 6, 12 and 24-hour titers were significantly (p<0.05) increased over the average titer immediately a fter inoculation. By comparison, titers from virus incubated with freeze-thaw killed macrophages rapidly declined to undetectable levels by 6 hours. Because increased titers of virus were not ed in wells with virus-inoculated viable cells as early as 3 hours, it was possible t he virus initially bound to viable cells and then was subsequently released into culture medium at early time points. Additional studies at multiplicities of infecti on of 0.1 and 0.01 were performed (Fig. 3-2). Productive virus replication was not detectable at MOI of 0.01. Data at MO I of 0.1 are c onsistent with there being initial binding of inoculum virus to viable cells and subsequent release of virus into medium at 3 hours. Free vi rus appears to degrade rapidly under the culture conditions without viable cells. Inoculated virus binding and then release into medium cannot account for the steady-state level of virus assayed at 12 and 24 hours after inoculation. Virus matrix gene expression detected in cell lysates significantly increased beyond that immediately after inoculation at the 3, 6 and 12 hour time points (Fig. 3-3. p<0.05). Matrix gene expression was maximal at 6 hours after inoculation, averaging

PAGE 57

57 6445-fold the matrix gene RNA level immediately after the inoculation period. Matrix gene expression was not detectabl e in mock inoculated cells. Influenza A H3 antigen was evident using immunocytochemistry in virus inoculated cells. Approximately 70% of macrophages inoculated with virus (MOI = 4) showed diffuse or peripheral cytoplasmic staining fo r H3 antigen (Fig. 3-4) at 12 hours after inoculation. Mock inoculated cells uniforml y stained negatively for H3 antigen at 12 hours. Loss of Macrophage Viability Virus inoculation resulted in decreased macrophage viability by 12 hours after inoculation as measured by trypan blue exclusion assay (Fig. 3-5, p<0.05). Mockinoculated cells averaged greater than 95% trypan blue negative at all time points, whereas virus inoculated cells averaged less than 70% trypan blue negative from 12 hours after inoculation onwards. Cell c ounts of trypan blue negative cells were significantly less (p<0.05) in virus-inocul ated cells compared with mock-inoculated cells at 24 hours after inoculation. Viable cell counts from virus inoculated wells averaged 135,475 cells (27% of the or iginal macrophages seeded into wells) compared to 295,708 cells (59%) in mo ck inoculated wells. Cytokine Production TNFmRNA levels in virus-inoculated cell s were significantly increased at 12 hours after inoculation, averaging 28-fold hi gher than mock-inoculated cells (Fig. 3-6. p<0.05). TNFprotein concentrations in supernat ants from virus-inoculated cells differed significantly from mock-inoculated ce lls at 12 hours after inoculation, averaging 154 pg/ml supernatant compared to 4 pg/ml supernatant for mo ck inoculated cells at the same time point (Fig. 3-7. p< 0.05). By comparis on, IL-10 mRNA levels were marginally

PAGE 58

58 but significantly increased at both 6 and 12 hour s after inoculation (p<0.05) peaking at 1.7-fold the level in mock-inoculated cells by 6 hours after inoculation (Fig. 3-8). IL-10 protein levels in virus-inoculated supernat ants did not increase significantly above mock-inoculated levels at corresponding time points (Fig. 3-9). Discussion Canine influenza virus is an important emerging pathogen of dogs that causes highly transmissible respiratory disease. Inve stigations into the initial outbreaks of disease associated with CIV showed that alveolar macrophages were positive for influenza virus antigen by immunohistochemistr y. However, it was unclear whether the cytoplasmic antigen was secondary to phagocytosis of debris from other infected cells or associated with active replic ation of the virus in macrophages.32 Studies using other influenza viruses, including H5N1 viruses, have shown that infection of macrophages with influenza viruses may lead to excessive cytokine production.27 It has been postulated that this cytokine induction, particularly of TNF, may play an important role in the severity of disease in human H5N1 influenza virus infection.27,79 Results from this study are consistent with the conclusion that canine alveolar macrophages support both virus RNA synthesis and production of viral protein and infecti ous viral particles at a low level. Macrophages also respond to virus infection with TNFproduction. The level of productive viral replication by canine influenza virus in macrophages appears to be very low since the viral growth curve shown in Figure 3-1 remains flat out to 12 or 24 hours after inoculation. The vi rus rapidly degrades in media without viable cells present. If there were not synthesis and release of at least small numbers of new infectious virus particles into the medium the slope of the virus curve in Figure 3-1

PAGE 59

59 would be expected to point dow nward from 6 to 24 hours afte r inoculation. While the combination of data of diffuse viral hem agglutinin protein staining in macrophage cytoplasm, matrix gene expre ssion in macrophages and prolonged release of infectious particles in macrophage culture medium su pport the conclusion that canine influenza virus replicates in canine alveolar macrophages the level of productive virus replication remains undefined. Influenza virus has been shown to infect mo nocytes or macrophages in a variety of species, including mice, swine and humans.62,88,126-128,134 Viral infection of macrophages in vitro may be abortive or productive, and when productive usually only results in small numbers of infectious virions.16,102,127,134 Canine influenza virus replication kinetics were comparable to those from experiments in mice macrophage cell lines,16,102 where maximal virus production occu rred at approximately 24 hours after inoculation. In dog macrophages, production of virus RNA was intercurrent with cytokine mRNA and protein production. Canine influenza virus infection resulted in increased death of isolated pulmonary macrophages over 12 to 24 hours after inocul ation as indicted by the trypan blue staining and viable cell counts. The studies in this report provide no insight into the question of whether virus-induced cell deat h resulted from apoptosis or necrosis. However, several studies indicate that infl uenza A virus induces apoptosis in monocytes or macrophages from humans and mice.46,87 A study in swine could not demonstrate apoptotic processes in influenza-a ssociated cell death of macrophages.134 Recently, a novel viral protein, PB1-F2, has been shown to be instrumental in the induction of apoptosis in cells of the monocytic lineage, including human monocytes.25 Not all

PAGE 60

60 influenza viruses harbor intact PB1-F2 protei ns, and the presence of the protein is now considered to be a virulence determinant of some strains of influenza viruses.30 CIV is thought to contain an intact PB1-F2 protein. However the PB1 gene belongs to a novel phylogenetic clade which may influenc e the function of PB1-F2 protein.170 Further investigations into the role of CIV PB1-F2 protein in al veolar macrophage apoptosis are required. Macrophage death induced by CIV could co ntribute to depression of pulmonary bacterial defense mechanisms and increase susceptibility to bacterial infection. However, the level of virus-induced macrophage death could be offset by increased recruitment of monocytes into t he lung with differentiation to functional macrophages during the pulmonary infl ammatory response to virus. Canine influenza virus induced di fferential expression of TNFand IL-10 in alveolar macrophages. TNFwas strongly induced with 28-fold increases in mRNA associated with 39-fold increases in released protein. In contrast, there was only a 1.7fold increase in IL-10 mRNA following virus inoculation, and protein levels increased 4 fold from control levels. Influenza virus can induce TNFexpression through several transcription factormediated mechanisms69 including activation of nuclear factor kappa B (NFB), activating protein (AP)-1, and signal transducer s and activators of transcription (STATs), although NFB is recognized as one of the mo st important mechanisms in macrophages. Influenza A viruses differ in their capacity to induce TNFin macrophages. Hyperinduction of TNF expre ssion in human macrophages following H5N1 influenza virus infection has been shown to be p38 mitogen-activated protein (MAP) kinase dependent.79 Hyperinduction of pulmonary TNFcan contribute to

PAGE 61

61 disease pathogenesis through at least several mechanisms27,59,101 acting in the local tissue environment on endothelial cells, epithelial cells and leukocytes to induce increased vascular permeability, edema and hemorrhage as well as to induce increased leukocyte-mediated tissue injury and secondar y waves of cytokine release that can have massive systemic effects. There was considerable variati on in influenza virus-induced TNFexpression in alveolar macrophages that were recovered from cadaver dogs. Mean levels of TNFmRNA expressed by CIV-infected macrophages were in a similar range to those seen with macrophages exposed to 1-1000 ng/ml li popolysaccharide used as a positive control (see methods section). Both antemor tem disease and husbandry events as well as postmortem handling of the dogs used in this study undoubtedly induced variability into macrophage function assays. Nevertheless, dog-to-dog variability in the assays for TNFprobably reflect, at least in part, genet ically-controlled variations in TNFresponse among dogs. Humans have c onsiderable variation in TNFtranscriptional response that is under control of TNFpromoter polymorphisms, and variations in TNFexpression have been linked to disease susceptibility and severity.2 Although it was highly desirable to get a uniform popul ation of primary dog alveolar macrophages for these studies, logistical problems in obtaining large enough numbers of cells for the studies from laboratory housed dogs required the use of macrophages recovered from cadavers. Studies focused on differences in macrophage TNFproduction among dog breeds could provide important information re levant to genetically determined disease susceptibility. These studies could be parti cularly insightful if focused on greyhound

PAGE 62

62 dogs that are highly susceptible to fatal di sease associated with canine influenza virus infection.32 IL-10 responses to canine influenza virus infection were considerably lower than those found for TNF. IL-10 is produced by regulator y T-cells, macrophages, dendritic cells and other myeloid and lymphoid cells, and it plays an important immunoregulatory role in host response to infectious agents.31 Stimulators of IL-10 in macrophages include LPS and CpG from bacteria, many prot ozoa and fungi. These stimuli act through activation of toll-like receptor (TLR)-2 and TL R-4 mechanisms, Fc receptor ligation by immune complexes, and CD40 ligation.24,31 Increased IL-10 expression in the lung following influenza infection may be more the result of production by T-cells than by macrophages.31,158 The small increase in IL -10 produced by dog macrophages inoculated with canine influenza virus could be a secondary effect of virus-induced type I interferon, rather than a direct effect of virus.24 CIV infection studies in immunocompetent dogs would be required to crit ically assess the roll of IL-10 from both T-cells and macrophages in pulmonary pat hogenesis and impaired host response to bacteria.156 In conclusion, the data from this study indicate that canine influenza virus can replicate in canine alveol ar macrophages and induce TNFproduction that may be important in respiratory disease pathogenesis. IL-10 is stimulated to a lesser extent, and virus inoculation results in a decrease in macrophage viability.

PAGE 63

63 Table 3-1. Primer and probe sequences. Primer set Primer sequences (5`-3`) Probe sequence (5`-3`) Matrix gene Fwd: TGATCTTCTTGAAAAATTTGCAG Rev: CCGTAGCAGGCCCTCTTTTCA ATGCAGCGATTCAAGTGATCCTCTCGTT G3PDH113 Fwd: TCAACGGATTTGGCCGTATTGG Rev: TGAAGGGGTCATTGATGGCG CAGGGCTGCTTTTAACTCTGGCAAAGTGGA TNF48 Fwd: GAGCCGACGTGCCAATG Rev: CAACCCATCTGACGGCACTA CGTGGAGCTGACAGACAACCAGCTG IL-10113 Fwd: CGACCCAGACATCAAGAACC Rev: CACAGGGAAGAAATCGGT TCCCTGGGAGAGAAGCTCAAGACCC

PAGE 64

64 Figure 3-1. Infectious virus titers in alveolar macrophage culture supernatant. Supernatant from alveolar macrophage cultures inoculated with canine influenza virus was titrated by plaque assa y at the times indicated after the inoculation period. PFU = plaque forming units, n=7 for 0 to 12 hours after inoculation, n=5 for 24 and 48 hours after i noculation. = significantly different to 0 hour titer, p<0.05, ANOVA, St udent-Newman-Keuls method of pairwise multiple comparisons. Virus titer followin g inoculation of fr eeze-thaw killed macrophages was undetectable at 6 hours after inoculation. Figure 3-2. Infectious virus titers in vi able and freeze-thaw killed alveolar macrophage culture supernatant. Supernatant from 2x106 alveolar macrophage cultures inoculated with CIV at a MOI of 0.1 and 0. 01 was titrated by plaque assay at the times indicated after the inoculat ion period. PFU = plaque forming units.

PAGE 65

65 Figure 3-3. Virus matrix gene expression in alveolar macrophages. Viral matrix RNA levels as determined by real-time RT -PCR are expressed as fold-increase over the levels present immediately a fter the inoculation period. n=14 for 0 and 12 hours, n=12 for 6 hours, n=11 for 3 hours, n=8 for 24 hours, n=6 for 48 hours. = significantly different fr om 0 hour expression, p<0.05, KruskalWallis one way ANOVA, Dunns Method of pairwise multiple comparisons. Figure 3-4. Canine alveolar macrophages Cultured alveolar macrophages are immunocytochemically positive (brown ) for H3 hemagglut inin protein. Immunoperoxidase with hematoxylin counterstain.

PAGE 66

66 Figure 3-5. Trypan blue exclusion assay on virusand mock-inoculated alveolar macrophages. Results are expressed as percentage trypan blue negative, an indicator of cell viability. Cells were inoc ulated at a multiplicity of 2. n=4 for 6 hour time point, n=5 for 0, 12 and 24 hour time points. = significantly different from corresponding mock-inoc ulated time point, p<0.05, KruskalWallis One-way ANOVA on ranks, Dunn s method of pairwise multiple comparisons, arcsine square root transformed data. Figure 3-6. TNFmRNA in virus-inoculated al veolar macrophages. Results are expressed as a ratio to TNFmRNA levels in mock-inoculated cells at each time point. TNFmRNA levels were normalized to G3PDH mRNA expression. n=11 for 0 and 12 hour time poi nts, n=9 for 6 hour time point. = significantly different fr om ratio immediately afte r the inoculation period, p<0.05, Kruskal-Wallis One-way ANOVA on ranks, Dunns method of pairwise multiple comparisons.

PAGE 67

67 Figure 3-7. TNFprotein concentration in alv eolar macrophage culture supernatant. Concentration of TNFprotein, as determined by ELISA, is expressed as pg/ml of culture supernatant. n=11 for 0 and 12 hour time points, n=9 for 6 hour time point. = significantly differ ent from mock-inocul ated cells at the same time point, p<0.05, Kruskal-Wa llis One-way ANOVA on ranks, Dunns method of pairwise multiple comparisons. Figure 3-8. IL-10 mRNA in virus-inoc ulated alveolar macr ophages. Results are expressed as a ratio to IL-10 mRNA le vels in mock-inoculated cells at each time point. IL-10 mRNA levels were normalized to G3PDH mRNA expression. n=11 for 0 and 12 hour time points, n=9 fo r 6 hour time point. = significantly different from ratio immediately after the inoculation period, p<0.05, One-way ANOVA, Dunns Student-N ewman-Keuls method of pairwise multiple comparisons.

PAGE 68

68 Figure 3-9. IL-10 protein concentration in alveolar macrophage culture supernatant. Concentration of IL-10 prot ein, as determined by EL ISA, is expressed as pg/ml of culture supernatant. n=11 for 0 and 12 hour time points, n=9 for 6 hour time point. There are no significant differences among data from virusand mock-inoculated macrophages at each of the time points. The 12 hour value for virus inoculated cells differed significantly from the virusand mockinoculated 0 hour values (p<0.05), Kr uskal-Wallis One Way ANOVA on ranks, Dunns method of multiple comparisons.

PAGE 69

69 CHAPTER 4 CANINE H3N8 INFLUENZA VIRUS AU GMENTS ALVEOLAR MACROPHAGE TNFRESPONSE TO LIPOPOLYSACCHARIDE Abstract Previous research has shown that H3N8 canine influenza virus (CIV) can infect canine alveolar macrophages and that it induces TNFproduction. Because bacterial infection is a common complication of in fluenza virus infection in dogs and because studies in mice have shown that in fluenza virus infected macrophages produced significantly augmented levels of TNFwhen subsequently exposed to lipopolysaccharide (LPS), canine alveolar macrophages were tested for their TNFresponse to LPS after infection with CIV. Macrophages exposed to LPS 3 hours after CIV inoculation produced 3.8-fold higher concentrations of TNFprotein (p< 0.05) than mock-inoculated macrophages exposed to LPS alo ne. Other bacterial toll-like receptor agonists were tested in a similar manner. Li poteichoic acid (LTA) stimulation 3 hours after CIV-inoculation of macrophages induced mildly higher (1.9 -fold, p<0.05) TNFprotein production compared to that followi ng LTA stimulation of mock-inoculated macrophages. Prior CIV inoculation did not significantly increase TNFprotein release in response to either flagellin or unmethyla ted CpG DNA. The marked effect of CIV infection on LPS-stimulated TNFprotein release from ma crophages was associated with over a 13-fold increase (p < 0.05) in TNFmRNA above levels stimulated by LPS in mock-inoculated macrophages at 7.5 hours a fter virus inoculation. Studies with actinomycin D to block transcription suggested that the increase in TNFmRNA resulting from sequential CIV inoculation and LPS stimulation could not be explained solely by virus-induced inhibition of m RNA degradation. In conclusion, the results

PAGE 70

70 indicate that CIV infection augments the TNFprotein response of alveolar macrophages to LPS at least in part by increasing TNFmRNA levels. Introduction Canine influenza virus (CIV) is an H3N8 infl uenza A virus that wa s first identified in 2004 as the cause of an outbreak of severe respiratory disease in racing greyhounds in Florida.32 Characterization of the virus reveal ed a close phylogenetic relationship to contemporaneous equine H3 N8 influenza viruses. Since its discovery, serologic and virologic evidence indicates the virus has spread within racing greyhounds and the nonracing dog population throughout mu ch of the United States.41 In naturally infected dogs, CIV most co mmonly causes self-limiting disease characterized by fever, anorexia, lethargy serous to purulent nasal discharge and a persistent nonproductive cough.41,112 In greyhounds, CIV also causes a severe hemorrhagic pneumonia and per acute death in low numbers of infected dogs.32 Regardless of breed, death asso ciated with CIV infection occurs in the minority of cases and is usually associated with pneumonia complicated by secondary bacterial infection.41,168 Bacterial pneumonia is a common complication of influenza virus infection in most mammals.18,75,85,159 Secondary bacterial pneumonia has been the most important contributor to mortality in influenza pandem ics including that seen with the 1918-1919 Spanish flu H1N1 human virus.94,100 Proposed mechanisms by which influenza viruses predispose to bacterial pneumonia include des truction of respirat ory epithelium with increased bacterial adherence to exposed connec tive tissue and basal or regenerating epithelium, altered mucociliary clearanc e, neuraminidase-mediated exposure of

PAGE 71

71 molecules for bacterial adherence, altered leuk ocyte function, suppressive effects of the adaptive immune response, and induction of macrophage apoptosis.7,30,105,116,120,122,129,148,158 Alveolar macrophages play an important role in the pat hogenesis of influenza virus infection. Highly pathogenic influenza viru ses have been shown to induce excessive accumulation of macrophages in the lung, and this has been linked to decreased survival.89,117 In contrast, alveolar macrophages are also important for controlling influenza infection, highlight ing the importance of a me asured macrophage response to infection.71 Excessive production of proinfla mmatory cytokines such as TNFand other inflammatory mediators by pulmonary macro phages in response to influenza virus have been proposed as mechanisms for the enhanced pathogenicity of some strains of influenza virus.27,81 Exposure of influenza-infected ma crophages to the bacterial product and Toll-like receptor (TLR) agonist lipopol ysaccharide (LPS) has been shown to augment the production of TNFabove that seen with virus or LPS alone.82 In this way, the synergistic effect of influenza and bacterial products may act to produce an exaggerated inflammatory res ponse that worsens the seve rity of bacterial pneumonia seen secondary to influenza infection. It is not known if bacterial TLR agonists other than LPS augment TNFproduction in influenza-infected macrophages. Previously, we have shown that CIV r eplicates in primary canine alveolar macrophages, and induces TNFexpression.123 The objectives of this study were to determine if prior infection of alv eolar macrophages with CIV augments TNFproduction in response to the bacterial TL R agonists LPS, lipoteichoic acid (LTA),

PAGE 72

72 flagellin, and unmethylated CpG DNA, and if so, to investigate the molecular mechanisms leading to augmented TNFproduction. Methods Macrophage Isolation and Culture Macrophages were isolated as described previously.123 Briefly, euthanized (cadaver) male and female mixed-breed dogs from a local community animal shelter were used as the source of alveolar macr ophages. Many of the dogs were positive for Dirofilaria immitis infestation as determined by antemortem serologic testing and identification of adult nematodes in the heart at necropsy. On ly dogs over 25 kilograms and with grossly normal lungs were used for alveolar macrophage isolation. Alveolar macrophages were isolated by l ung lavage. The trachea was isolated by dissection and incised just anterior to the th oracic inlet. Tubing was introduced and tied in place. The lungs were washed twice with 700-1000ml of sterile PBS per wash, and drained into a sterile collection flask. A small aliq uot of the wash was processed for cell differential count (cytospin preparation, Wright-Giemsa stain), and cultured on sheep blood agar and SP-4 agar to detect bacterial and mycoplasmal contamination. Washes with positive culture or neutr ophil counts greater than 10% were not used. Washings were filtered through sterile gauze, and centrifuged for 10 minutes at 500x g and 4 C. Supernatant was discarded, and the cell pellet washed twice in cold PBS. Cells were then suspended in cold Minimum Ess ential Medium Al pha Medium (MEM Gibco, Grand Island, NY) supplemented with 10% F BS and 1% Antibiotic-Antimycotic (Sigma Aldrich, St. Louis, MO) and incubated at 37 C and 5% CO2 for 2-4 hours in two 150cm2 culture flasks (Corning, Lowell NY). N on-adherent cells were removed by gently

PAGE 73

73 washing 1-3 times with warm MEM The remaining adherent cells were incubated for a further 12-24 hours at 37 C and 5% CO2 in supplemented MEM After overnight incubation, adherent cells were gently washed 3 times with warm MEM To remove adherent cells, 5ml of warm PBS was first added to each flask. The flasks were gently agitated, and the PBS was tr ansferred to a collection centrifuge tube containing supplemented MEM placed on ice. Warm 1xTryp sin/EDTA (Sigma Aldrich) was then added to each flask, and incubated at 37 C for 3 minutes with occasional gentle agitation. The trypsin/EDTA was repeatedly resuspended over the cells by pipetting, collected into the centrifuge t ube and a second incubation with trypsin/EDTA was performed. Any remaining adherent ce lls were removed with a cell scraper, collected with a small volume of supplemented MEM and added to the collection centrifuge tube. The resulting cell suspens ion was then centrifuged for 5 minutes at 500x g and 4 C. The supernatant was removed and discarded and the resulting cell pellet was resuspended in cold supplemented MEM and placed on ice. Cell counts, cell differentials and try pan blue exclusion assays were performed on the resulting cell suspension to determi ne the concentration of viable macrophages. Macrophage purity greater than 90% was typical with remaining cells resembling small mononuclear cells typical of lymphocytes Macrophages were then placed into 24-well tissue culture plates at a concentration of 500,000 per well, and cultured overnight at 37 C and 5% CO2. Virus and Mock Inocula The canine influenza virus (CIV), Influenz a A/Canine/FL/04, was kindly provided by Dr Ed Dubovi (Cornell University, Ithaca, NY), and passaged three times in MDCK

PAGE 74

74 cells prior to use to achieve suitable titers for these experiments. Infectivity of stock virus was assessed by plaque assay, adapted from previous reports57,131 as cytopathic effect on confluent cultures of MDCK cells with a 0.5% agar ose overlay. Mock inocula comprised a lysate of MDCK cells prepared as per virus stock without seed virus added. For experimental use, the virus stock wa s diluted to a concentration of 2x106 plaque forming units per milliliter in cold MEM The mock inoculum was diluted in cold MEM to the same extent as the virus. Macrophage Inoculation Purified macrophages were seeded into 24-we ll plates at a concentration of 5x105 per well and incubated overnight at 37 C and 5% CO2. The following day, media was removed from the wells, and groups of wells we re inoculated at a MOI of 2 with CIV or mock inoculum. The cells were incubat ed with the inoculum for 1 hour at 37 C and 5% CO2. In all experiments, the point immediately after the 1 hour incubation period is referred to as the hour time point. T he inocula were removed at the end of the incubation period, and 1ml of fresh warm supplemented MEM was added to each well. For each replicate in all experiments, ma crophages from the same animal were used in both virusand mock-inoculated groups. Lipopolysaccharide experiments : LPS from Salmonella enterica serotype typhimurium (Sigma Aldrich, L6143) was used for all experiments. An initial study was performed to determine the responsiveness of alveolar macrophages to different concentrations of LPS (Fig. 4-1). In thes e experiments, alveolar macrophages were exposed to 1-1000ng LPS per milliliter cultur e media immediately after the incubation period. Because these experiments r equired harvesting total RNA, 1 well of

PAGE 75

75 macrophages was used for each time point fo r both mockand virus-inoculated groups. Culture medium from each well was used for TNFELISA. In subsequent experiments, alveolar macrophages were exposed to 1ng/ml LPS at 3 or 6 hour s after the virus inoculation period (Figures 4-2, 4-3, 4-7 & 4-8). For the TNFELISA experiments, 170 l of culture medium was sampled at each time point, and replaced with 170 l fresh medium. For real-time RT-PCR assays, 1 well was used for each time point. Lipoteichoic Acid experiments : LTA from Streptococcus pyogenes (Sigma Aldrich L3140) was used. Pilot studies usin g concentrations of 10, 100 and 1000ng LTA per milliliter of medium revealed that mock-inoculated macrophages responded with increased TNFproduction only at the highest conc entration (1000ng LTA/ml media). Only this concentration was used in furt her experiments. Virusand mockinoculated macrophages were exposed to 1000ng LTA/ml cu lture medium at 0, 3, and 6 hours after the virus inoculation period. At 6 and 12 hours after virus inoculation, 170 l of medium from each well was sampled and replaced with 170 l fresh medium. As peak levels of TNFwere measured 12 hours after virus in oculation in the LPS experiments, only the 12-hour sample was used for these studies. Flagellin experiments : Purified flagellin from Salmonella enterica serotype typhimurium (InvivoGen San Diego, CA ST-F LA) was used. Pilot studies using 0.1, 1 and 2 g flagellin per milliliter of medium indicated that alveolar macrophage TNFresponse was minimal to even the highest c oncentration of flage llin. Subsequent experiments used 2 g flagellin per milliliter of medi um. Virusand mock-inoculated macrophages were exposed to 2 g flagellin/ml culture medium at 0, 3 and 6 hours after the virus inoculation peri od. At 6 and 12 hours afte r virus inoculation, 170 l of medium

PAGE 76

76 from each well was sampled and replaced with 170 l fresh medium. Only the 12-hour sample was used for these studies. CpG experiments : Type C CpG oligonucleotide (InvivoGen, ODN 2395) was used. Concentrations of 0.5, 1 and 5 M of CpG DNA were added at 0, 3 or 6 hours after the virus inoculation period. TNFproduction in mock-inoculated macrophages was most consistent in response to a concentration of 5 M of CpG DNA in the media, and this concentration was used for these ex periments. At 6 and 12 hours after virus inoculation, 170 l of medium from each well wa s sampled and replaced with 170 l fresh medium. Only the 12-hour sample was used for these studies. Actinomycin D experiments : LPS was added to virusand mock-inoculated wells 3 hours after the inoc ulation period. Thirty minut es after addition of LPS, actinomycin D (Sigma Aldrich) solubilized in sterile DMSO was added to culture media at a concentration of 5 g/ml media. Total RNA was harvested immediately as well as 30 minutes, 1 hour, 1.5 hours and 2 hours a fter actinomycin D administration. Real-Time RT-PCR Total RNA was isolated from inoculated macrophages at each time point using the RNeasy Mini Kit (Qiagen, Valencia, CA) in corporating DNase tr eatment. Media from each well was transferred to microcentrifuge tubes and centrifuged at 10,000 rpm for 5 minutes in an Eppendorf centrifuge to co llect non-adherent cells. The supernatant was removed and stored at -70 C for cytokine protein quantific ation. Lysate buffer was added to the well, mixed by resuspending with a pipette, and then transferred to the cell pellet in the microcentrifuge tube. The sample was briefly vortexed and then stored at 70 C prior to further processing as per manu facturers instructions. The cDNA was

PAGE 77

77 synthesized from mRNA with oligo(dT) pr imers using the Advantage RT for PCR kit (Clonetech, Mountain View CA). Canine G3PDH and TNFmRNA were quantified by real-time PCR using TaqMan Universal PCR master mix and TAMRA FAM probes (Applied Biosystems, Branc hburg, NJ) in the DNA engine Opticon II system (MJ Research/Bio-Rad Laboratories, Hercules, CA). Primer and probe sequences for canine G3PDH and TNFwere obtained from the literature (Table 4-1). Primer efficiency and mRNA quantification calc ulations were performed as described by Pfaffl.119 TNFmRNA levels were normalized to G3PDH mRNA expression. TNFELISA Canine TNFprotein was quantified using a commercial ELISA (R&D Systems, Minneapolis, MN). Media were collected from macrophage cu ltures at the specified times after the inoculation period and stored at -70 C until further processing as per the manufacturers instructions. Plate absor bance readings were determined using the Synergy HT microplate reader (Bio-tek Instruments Inc., Winooski, VT). Data Analysis Data were expressed as mean standar d deviation, derived from the total number of experiments performe d for each variable. Logarithm ic transformation of data was performed if required to obtain normalit y or equal variance between groups. Means were compared using a one-way analysis of va riance (ANOVA) or paired t-test if only two variables were examined. In the event of unequal group variances that were not corrected by logarithmic transformation, nonp arametric methods were used to compare groups. A P value <0.05 indicated a significant difference between compared groups.

PAGE 78

78 Statistical analysis was performed using Sigmastat 3.5 software (Systat Software, Inc, Richmond, CA). Results TNFResponse to LPS in CIV-Infected Alveolar Macrophages In virus-inoculated cells exposed to 1-1000ng/ml LPS immediately after virus inoculation, 12-hour TNFprotein concentration in cult ure media averaged 516 pg/ml, compared to 326 pg/ml in mock-inoculated ce lls, a 1.6 fold increase (Fig. 4-1). TNFproduction was more prolonged in LPS-ex posed virus-inoculated macrophages than LPS-exposed mock-inoculated macrophages. In comparison, 12 hours after virus inoculation, TNFconcentration in culture media of macrophages not exposed to LPS averaged 154 pg/ml media, and only 4 pg/ ml media in mock-inoculated cells. When LPS was added to culture media at a concentration of 1 ng/ml 3 hours after virus inoculation, virus-inoculated macrophages produced sign ificantly (p<0.05) greater amounts of TNFthan mock-inoculated macrophages at all time points after LPS addition (Fig. 4-2). TNFproduction peaked by 12 hours in LPS-exposed virusinoculated macrophages, averaging 1143 pg/ml media. By comparison, at 12 hours, LPS-exposed mock-inoculated macrophages averaged 301 pg TNF/ml media, or 26% of that produced by virus-inoculated macr ophages exposed to LPS. Virus-inoculated macrophages not exposed to LPS averaged 242 pg TNF/ml media. Expressed another way, LPS-exposed virus-inoculat ed macrophages produced 2.1 fold greater TNFprotein than the combined protein pr oduction of LPS-exposed mock-inoculated macrophages and virus-inoculated macrophages not exposed to LPS.

PAGE 79

79 Similarly, when LPS was added to culture media 6 hours after virus inoculation, virus-inoculated macrophages pr oduced significantly (p<0. 05) greater amounts of TNFthan mock-inoculated macrophages at all ti me points after LPS addition (Fig. 4-3). The concentration of TNFin culture media was great est in virus-inoculated macrophages exposed to LPS, with peak c oncentration occurring 12 hours after virus inoculation at 1011 pg/ml. This represents a 2.3 fold increase over LPS-exposed mockinoculated macrophages that had a maximum average TNFproduction of 435 pg/ml media. TNFResponse to Other Bacterial TLR A gonists in CIV-Infected Alveolar Macrophages Adding LTA to culture media at 0 or 6 hour s after virus inoculation did not result in significant increases in average TNFproduction above that seen with LTAexposure alone (Fig. 4-4). The greatest effect was seen when LTA was added 3 hours after virus inoculation. In this case, TNFconcentration in virus-inoculated macrophages averaged 913 pg/ml media, co mpared to 489 pg/ml media from mockinoculated macrophages. These values were significantly different (p<0.05) when compared using a paired t-test. When flagellin was added to culture media 0, 3 or 6 hours after virus or mock inoculation there was a mild but statistically insign ificant augmentation of TNFproduction in virus inoculated cells over that seen in cells inoculated with virus only (Fig. 4-5). Mock-inoculated cells responded minimally to flagellin regardless of when it was added to the culture media. Addition of CpG DNA to culture media failed to increase TNFconcentration in culture media in any group above that seen in macrophages inoculated with virus alone

PAGE 80

80 (Fig. 4-6). Mock-inoculated macrophages responded minimally to CpG DNA, with maximal response seen when the agonist was added immediately after virus inoculation (24 pg/ml media). Augmented TNFResponse to LPS is Mediated by Increased mRNA Levels To investigate the mechanism by which prior infection with canine influenza virus augments the TNFresponse of alveolar macrophages to LPS, TNFmRNA levels in virus and mock-inoculated macrophages expos ed to LPS were assessed. LPS was added at 3 hours after virus inoculation as this time point provided the greatest augmentation of TNFproduction in culture (Fig. 4-2). When LPS was added to cultur e media at 3 hours after virus inoculation, it elicited a sharp increase in TNFmRNA in virus-inoculat ed cells, peaking at 161-fold the level of mock-inoculated control cells (F ig. 4-7) by 7.5 hours post-inoculation. In contrast, TNFmRNA levels in mock-inoculated macrophages exposed to LPS peaked at 6 hours after inoculation at 24-fold the le vel of mock-inoculated control cells. By 7.5 hours after inoculation, TNFmRNA levels in mock-inoculated cells exposed to LPS declined to 12-fold mock expression. In an attempt to discern if the increase in LPS-induced TNFmRNA levels was due to increased mRNA stability in virus-inoc ulated cells, we halted mRNA synthesis in macrophages 30 minutes after LPS exposure by adding actinomycin D to the culture media. TNFmRNA levels in LPS-exposed viru s-inoculated cells remained stable for 30 minutes, thereafter declining to a minimum av erage of 57% of the in itial levels after 1.5 hours and then stabilizing by 2 hour s (Fig. 4-8). In contrast, TNFmRNA levels in LPS-exposed mock-inoculated cells rapidly declin ed to a minimum of 14% of the initial

PAGE 81

81 levels within 1.5 hours. In macrophages i noculated with virus alone, mRNA degradation was intermediate between that of the LPS-treated groups. Discussion Canine influenza virus is an important pat hogen of dogs that continues to cause outbreaks of highly contagious re spiratory disease in the US. As in other mammals that are hosts to stable lineages of influenza vi rus, secondary bacterial pneumonia is a leading complication of CIV infection, and also a common cause of mortality following influenza infection.41 Many studies in the past have addressed the mechanisms by which influenza virus predisposes to bacterial pneumonia.18,92 Among those are studies that demonstrate that infe ction of macrophages with in fluenza virus augments their cytokine response to LPS.16,82,102 More recently, the emergence of highly pathogenic avian H5N1 influenza virus as a threat to hu mans has resulted in studies that outlined a role of the alveolar macrophage in the pat hogenesis of influenza virus infection as a critical source of proinflamma tory cytokines such as TNF. Hypercytokinemia has been implicated as playing a role in the death of those infected with some highly pathogenic viruses.27,37,80 Results from this study demonstrate t hat prior infection of primary canine alveolar macrophages with CIV influenza virus augments the LPS-induced TNFresponse above that seen with CIV or LPS alone. This effect was mediated at the mRNA level, and possibly involved increased stability of TNFmRNA in influenza infected cells. The regulation of TNFexpression is complex and stimulus specific, and occurs through both transcriptional and po st-transcriptional mechanisms.44,138 The mechanisms by which influenza viruses induce TNFexpression are not we ll understood, but are

PAGE 82

82 likely mediated, at least in part, by the tr anscription factors nuclear factor kappa B (NFB), activating protein (AP)-1 and signal tr ansducers and activators of transcription (STATs), although NFB is recognized as one of the more important mechanisms in macrophages.69 The degree to which influenza viruses induce TNFexpression is strain specific. Hyperinduction of TNFexpression in human macrophages following H5N1 influenza infection has been shown to be p38 mitogen-activated protein (MAP) kinase dependent, a characteristic that different iates H5N1 viruses from less pathogenic influenza viruses.64,79 In response to LPS, TNFexpression is dependent on regulation of transcription, message splicing, mRNA stability, and translation.39,110,138,153 The NFB transcription factor is critically involved in LPS stimulation of TNFtranscription, however a variety of other transcr iption factors are also involved.53,153 Posttranscriptional regulati on of LPS-induced TNFexpression operates largely through the cis -element, AU-rich element (ARE) in the 3-untranslated region of the mRNA.39,74,138 Previous studies examining the inte raction of influenza virus and LPS in macrophage cultures utilized t he laboratory influenza strain A/Puerto Rico/8 (H1N1) and either human monocytes, a mouse ma crophage cell line or rat alveolar macrophages.16,102 These studies determined that influenza virus infection of macrophages induced a large accumulation of TNFmRNA above that seen with LPS and similar to that seen with combined virus and LPS. Addition of LPS was required for increased translation of TNFmRNA into bioactive protein.82 In contrast, our studies determined that the combi nation of CIV and LPS caused a large increase in TNFmRNA above that seen with virus or LPS alone (Fig. 4-7). Peak mRNA accumulation

PAGE 83

83 preceded by approximately 4.5 hours peak TNFprotein release, which is consistent with the interpretation that the mRNA was translated without any obvious inhibition. Thus, prior infection of alveolar macr ophages with CIV increased the net abundance of TNFmRNA in response to LPS. This could be mediated through a number of mechanisms including increased rates of tran scription and increased mRNA stability. To try to differentiate these possibiliti es, we halted transcription following LPS administration using actinomycin D, and measured rates of TNFmRNA degradation in cells treated with virus, L PS or both (Fig. 4-8). By 1. 5 hours after actinomycin D addition, the virusand mock-inoculated cells treated with LPS differed by 43% in the levels of TNFmRNA remaining, indicating t hat CIV infection may have a mild stabilizing effect on TNFmRNA. Increased TNFmRNA may also be due to increased transcription. Nuclear run-on assays would be one method of analyzing transcription rates.58 However, the ability to measure ra tes of transcription in alveolar macrophages using a nuclear run-on assay is lim ited by the relatively small numbers of macrophages that can be isolated from cadaver dogs. These studies may be more reasonably completed in the future with continuous cell lines. When canine alveolar macrophages inoculated with CIV were exposed to TLR agonists other than LPS, less dramatic effect s were observed. LTA, a component of gram-positive bacterial cell walls, increased the TNFresponse of CIV-inoculated macrophages above that seen with virus or LTA alone. However the effect appeared additive, unlike that seen with LPS. Flagel lin itself was a poor inducer of TNF. The presence of flagellin mildly increased the TNFresponse of macrophages to CIV, however the effect was statistically insignificant. The maximal TNFresponse of CIV-

PAGE 84

84 inoculated macrophages incubated with flage llin was less than half of the maximal response seen with similar LPS studies des pite a 2000-fold difference in agonist concentration. As the TNFresponse of CIV-inoculated macrophages to LPS was greatest among the TLR agonists studied, further efforts to mechanistically investigate the interactions of CIV and bacterial agonist s in alveolar macrophages focused on LPS. When unmethylated CpG DNA was added to culture media of CIV-inoculated macrophages, the TNFresponse varied considerably, but did not exceed that seen with macrophages inoculated with virus alon e. Mock-inoculated cells had a modest TNFresponse to CpG DNA, averaging 17 pg/ml media. The diminished TNFresponse of CpG DNA-exposed macrophages to CIV unique among the TLR agonists studied here. The TLR for CpG DNA (TLR 9) di ffers from the other agonist TLRs studied here in that it is expressed on endol ysosomal membranes rather than the cell surface.13,76 Stimulation of TLR 9 resu lts activation of AP-1 and NFB transcription factors, similar to that seen with influenza virus.72 Potentially, TLR 9 stimulation may interfere with post-transcrip tional regulation of TNFexpression resulting from CIV infection. Our in vitro results may not be representative of the in vivo alveolar macrophage response. There is likely a very comp lex and nuanced influenc e of the pulmonary environment and adaptive immune response on the function and responsiveness of alveolar macrophages.147,148,158 Nevertheless, our results ar e likely represent ative of the acute stages of influenza infection, befor e an adaptive immune response has occurred. Investigations into the initial outbreaks of CIV showed that alveolar macrophages were positive for influenza virus antigen by immu nohistochemistry, and we have previously

PAGE 85

85 shown that CIV replicates in primary alveolar macrophages.32,123 Other studies have shown that influenza infection can lead to diminished bacterial clearance from the respiratory tract within 2 hours.120 Taken together, these findings indicate that infection of alveolar macrophages with CIV may o ccur simultaneously with an increasing bacterial burden in the respiratory tract early in the course of viral infection. This coinfection may lead excessive release of proinflammatory cytokines such as TNF, well above that seen with virus or bacterial infection alone.45 In conclusion, the data from this st udy indicate that CIV augments the TNFresponse of alveolar macrophages to LPS. This effect is mediated at the mRNA level, where prior infection of alveolar macrophage s causes a much larger accumulation of TNFmRNA than in macrophages exposed to LPS or virus alone. The mechanism for the increased mRNA remains poorly defined and does not appear to be explained by altered mRNA degradation alone.

PAGE 86

86 Table 4-1. Primer and probe sequences. Primer set Primer sequences (5`-3`) Probe sequence (5`-3`) G3PDH113 Fwd: TCAACGGATTTGGCCGTATTGG Rev: TGAAGGGGTCATTGATGGCG CAGGGCTGCTTTTAACTCTGGCAAAGTGGA TNF48 Fwd: GAGCCGACGTGCCAATG Rev: CAACCCATCTGACGGCACTA CGTGGAGCTGACAGACAACCAGCTG

PAGE 87

87 Figure 4-1. TNFprotein concentration in alveol ar macrophage supernatant inoculated with CIV or mock-inoculum and incubat ed with LPS (1-1000ng/ml) from immediately after inoculati on. Concentration of TNFprotein, as determined by ELISA, is expressed as pg/ml of culture supernatant. For LPS treated groups, n=7 for 0, 6 and 12 hour time points and n=4 for 24 hour time point. For groups not treated with LPS, n=11 for 0 and 12 hour time points, n=9 for 6 hour time points, and n=6 for 24 hour time points. There are no significant differences among data from LPS-tr eated virusand mock-inoculated macrophages at each of t he time points (Kruskal-Wallis one way ANOVA on ranks).

PAGE 88

88 Figure 4-2. TNFprotein concentration in alveol ar macrophage supernatant inoculated with mock-inoculum or CIV and incubat ed with LPS (1ng/m l) from 3 hours after inoculation. Concentration of TNFprotein, as determined by ELISA, is expressed as pg/ml of culture super natant. n=4 for LPS-treated groups, n=3 for groups not treated with LPS. = significantly different from mockinoculated macrophages treated with LPS (6-24 hour groups) at the corresponding time point, p<0.05, one way ANOVA, Tukey test for all pairwise multiple comparisons, log transformed data. Figure 4-3. TNFprotein concentration in alveol ar macrophage supernatant inoculated with mock-inoculum or CIV and incubat ed with LPS (1ng/m l) from 6 hours after inoculation. Concentration of TNFprotein, as determined by ELISA, is expressed as pg/ml of culture super natant. n=5 for LPS-treated groups, n=3 for groups not treated with LPS. = significantly different from mockinoculated macrophages treated with L PS (12 & 24 hour groups) at the corresponding time point, p<0.05, one way ANOVA, Student-Newman-Keuls Method for all pairwise multiple comparisons.

PAGE 89

89 Figure 4-4. TNFprotein concentration in s upernatant of alveolar macrophage cultures inoculated with CIV or mock-inoculum, and incubated with LTA (1000ng/ml) from immediately, 3 hour s or 6 hours after inoculation. Concentration of TNFprotein, as measured by ELISA, was determined at 12 hours after inoculation and is express ed as pg/ml of culture supernatant. n=5 when LTA not added and when added after 3 hours, n=3 when LTA added after 0 and 6 hours. = virus-inoculat ed differs significantly from mockinoculated within treatment gr oup, p<0.05, paired t-test. Figure 4-5. TNFprotein concentration in super natant of alveolar macrophages inoculated with mock-inoculum or CIV and incubated with flagellin (2 g/ml) from immediately, 3 hours or 6 hours a fter inoculation. Concentration of TNFprotein, as measured by ELIS A, was determined at 12 hours after inoculation and is expressed as pg/ml of culture supernatant. n=4 for all groups. Virus-treated groups did not di ffer significantly (one-way ANOVA). Mock-treated groups did not differ signi ficantly (repeated measures one-way ANOVA).

PAGE 90

90 Figure 4-6. TNFprotein concentration in super natant of alveolar macrophages inoculated with mock-inoculum or CIV and incubated with CpG DNA (5 M) from immediately, 3 hours or 6 hours a fter inoculation. Concentration of TNFprotein, as measured by ELISA, was determined at 12 hours after inoculation and is expressed as pg/ml of culture supernatant. n=2 for all groups. Figure 4-7. TNFmRNA in virusand mock-inoc ulated macrophages, exposed to LPS (1ng/ml) from 3 hours after inoculation. Results are expressed as a ratio to TNFmRNA levels in mock-inoculated cells (not exposed to LPS) at each time point. TNFmRNA levels were normalized to G3PDH mRNA expression. n=4 for 6-12 hours, n=3 for 3h, n=2 for 0h. = significantly different from mock-inoculated cells exposed to LPS (6-12 hour groups), p<0.05, one way ANOVA, Tukey test fo r all pairwise multiple comparisons, log transformed data.

PAGE 91

91 Figure 4-8. TNFmRNA expression in virusand mock-inoculated alveolar macrophages incubated with LPS (1ng/ml ) from 3 hours after inoculation. Actinomycin D was added to cells 30 minutes after LPS addition. Results are expressed as a ratio to TNFmRNA levels at the time of actinomycin D addition. TNFmRNA levels were normalized to G3PDH mRNA expression. n=5 for all groups.

PAGE 92

92 CHAPTER 5 CANINE H3N8 INFLUENZA VIRUS I NDUCES HOST STRAIN-SPECIFIC TNFEXPRESSION AND APOPTOSIS IN ALVEOLAR MACROPHAGES Abstract Canine H3N8 influenza virus (CIV) wa s first recognized as a respiratory pathogen of dogs in 2004. Characterization of initial virus isolates revealed a close phylogenetic relationship to contemporaneous equine H3N8 viruses, indicating a likely origin from a single interspecies virus trans fer. We previously demonstrated that CIV induces TNFproduction and cell death in primary canine alveolar macrophages. To investigate the specific ity of the role of CIV in causi ng respiratory disease in dogs, we inoculated primary canine alveolar macroph ages with CIV (A/Canine/Florida/04) and a genetically distant equine H3N8 influenza virus (EIV A/Equine/Kentucky/91), and compared virus gene expression and TNFproduction. To examine the mechanism of CIV-induced cell death, we assessed cas pase activation and annexin-V labeling 12 hours after virus inoculation. The kinetics of virus matrix gene expression was similar for both CIV and EIV, with peak expression occurring 6 hours after virus inoculation. Matrix gene expression was greater for cells inoculated with EIV at all time points examined except at 3 hours after inoculation. At twelve hours after virus inoculation, CIVinoculated macrophage culture media contained significantly (p<0.05, n=4) greater TNF(206 pg/ml media) than media from EIV-inoculated macrophages (11pg/ml media). By 9 hours after virus inoculation, TNFmRNA levels in CIV-inoculated macrophages averaged 91-fold the level seen in mock inoculated cells, whereas EIVinoculated macrophages averaged only 10-fold the level seen in mock-inoculated cells. Activation of the executioner caspases 3/7 was significantly (p<0.05) greater in CIV-

PAGE 93

93 inoculated cells than in mock-inoculated ce lls (n=8) or cells inoculated with UVinactivated virus (n=2). Flow cytometric analysis of annexin-v and propidium iodide labeling indicated CIV-inoc ulated macrophages undergo both apoptosis and necrosis at greater levels than mock-inoculated ce lls. In conclusion, CIV induces TNFexpression in alveolar macrophages to a greater extent than related H3N8 equine viruses in an mRNA-mediated fashion, and CIV-induced cell death of macrophages occurs via apoptosis and necrosis. Introduction Canine H3N8 influenza virus (CIV) was fi rst characterized following isolation from racing greyhounds during an outbreak of severe respiratory disease in 2004.32 The virus has since been implicated in outbreaks of re spiratory disease in racing greyhounds and the non-racing dog population th roughout much of the US.41,112 Molecular analysis of the first CIV isolate showed a close rela tionship to contemporaneous equine H3N8 influenza viruses, with greater th an 96% shared sequence identity.32 The similarity of all CIV genes to equine H3N8 viruses indicat ed an interspecies transfer of a whole influenza virus from horses to dogs. The interspecies transmission of a whol e influenza virus from one mammalian host to another is relatively uncommon. Infecti on of dogs with equine H3N8 viruses has been reported in natural and experimental settings,34,41,167 although horizontal transmission between dogs was not documented with these infe ctions. The establishment of a canine H3N8 influenza virus as a stable lineage wit hin the dog population indicates sufficient changes occurred in the parent equine virus to allow efficient transmission in the new host. Potential viral factors influencing trans missibility and virulence of influenza viruses

PAGE 94

94 between species include hemagglu tinin (HA) receptor-binding specificity, polymerasemediated replication efficiency, neuraminidas e (NA) mediated release of virus from infected cells, non-structural protein (NS-1) mediated inhi bition of host cell antiviral mechanisms, induction of apoptosis, and hyperinduction of pro-inflammatory cytokines.104,130 We previously showed tumor necrosis factor (TNF), a potent proinflammatory cytokine, is induced in alveolar macrophages when infected with CIV.123 The level of TNFproduced following CIV infection was sim ilar to that following exposure to lipopolysaccharide. It has been pr oposed that hyperinduction of cytokines such as TNFmay provide the basis for increased pathogeni city of some strains of influenza virus such as highly pathogenic H5N1 influenza virus and the 1918 H1N1 spanish flu influenza virus.27,37,84,114 The induction of apoptosis in influenz a-infected macrophages has been proposed as a possible virulence determinant.30,91 Not all influenza viruses are capable of inducing apoptosis.134 The presence of the PB1-F2 protein encoded by a +1 alternate reading frame in the PB1 gene has been linked to t he ability of some strains of influenza to induce apoptosis.25,170 We previously showed that CI V infection of canine alveolar macrophages induces cell death.123 The mechanism by which CIV induces cell death in alveolar macrophages is not known. The objectives of this study were to co mpare the abilities of CIV and a distant genetic predecessor H3N8 equine influenza virus to induce TNFproduction, and to determine the method by which CIV induces cell death.

PAGE 95

95 Materials and Methods Macrophage Isolation and Culture Macrophages were isolated as described previously.123 Briefly, euthanized (cadaver) male and female mixed-breed dogs from a local community animal shelter were used as the source of alveolar macr ophages. Each of the dogs was positive for Dirofilaria immitis infestation as determined by antemortem serologic testing and identification of adult nematodes in the heart at necropsy. On ly dogs over 25 kilograms and with grossly normal lungs were used for alveolar macrophage isolation. Alveolar macrophages were collected by whole lung lavage. The trachea was isolated by dissection and incised just anter ior to the thoracic inlet. Tubing was introduced and tied in place. The lungs were washed twice with 700 -1000ml of sterile PBS per wash, and drained into a sterile collect ion flask. A small aliquot of the wash was processed for cell differential count ( cytospin preparation, Wr ight-Giemsa stain), and cultured on sheep blood agar and SP-4 agar to detect bacterial and mycoplasmal contamination. Washes with positive bacteri al or mycoplasmal culture, or neutrophil counts greater than 10% were not used. Wash ings were filtered th rough sterile gauze, and centrifuged for 10 minutes at 500x g and 4 C. Supernatant was discarded, and the cell pellet washed twice in cold PBS. Cells were then suspended in cold Minimum Essential Medium Alpha Medium (MEM Gibco, Grand Island, NY) supplemented with 10% FBS and 1% Antibiotic-Antimycotic (S igma Aldrich, St. Louis, MO) and incubated at 37 C and 5% CO2 for 2-4 hours in two 150cm2 culture flasks (Corning, Lowell NY). Non-adherent cells were removed by gently washing 1-3 times with warm MEM The

PAGE 96

96 remaining adherent cells were incubat ed for a further 12-24 hours at 37 C and 5% CO2 in supplemented MEM After overnight incubation, adherent cells were gently washed 3 times with warm MEM To remove adherent cells, 5ml of warm PBS was first added to each flask. The flasks were gently agitated, and the PBS was tr ansferred to a collection centrifuge tube containing supplemented MEM placed on ice. Warm 1xTryp sin/EDTA (Sigma Aldrich) was then added to each flask, and incubated at 37 C for 3 minutes with occasional gentle agitation. The trypsin/EDTA was repeatedly resuspended over the cells by pipetting, collected into the centrifuge t ube and a second incubation with trypsin/EDTA was performed. Any remaining adherent ce lls were removed with a cell scraper, collected with a small volume of supplemented MEM and added to the collection centrifuge tube. The resulting cell suspens ion was then centrifuged for 5 minutes at 500x g and 4 C. The supernatant was removed and discarded and the resulting cell pellet was resuspended in cold supplemented MEM and placed on ice. Total cell counts, differential cell count s and trypan blue exclusion assays were performed on the resulting cell suspension to determine the concentration of viable macrophages. Macrophages were then placed into 24-well tissue culture plates at a concentration of 500,000 per well, and cultured overnight at 37 C and 5% CO2. Virus and Mock Inocula Equine influenza virus, Influenza A/Equi ne/KY/91, was kindly provided by Dr Ruben Donis (Centers for Disease Control and Prevention, Atlanta, GA), and passaged twice in MDCK cells to obtain a titer suit able for these inoculation studies. The canine virus, Influenza A/Canine/FL/04, was kind ly provided by Dr Ed Dubovi (Cornell

PAGE 97

97 University, NY), and passaged three times in M DCK cells prior to use. Infectivity of stock virus was assessed by plaque a ssay, adapted from previous reports57,131 as cytopathic effect on confluent cultures of MDCK cells with a 0.5% agarose overlay. Infectivity of virus stocks used for exper iments comparing equine and canine viruses was determined by immuno-plaque assay, performed as above with plaques stained with primary antibody directed against H3 antigen (Chemicon/Millipore, Billerica, MA) and peroxidase-conjugated secondar y goat anti-mouse IgG (Sigma Aldrich). This was required due to the poor plaque-forming properti es of the equine virus in culture. Mock inocula comprised a lysate of MDCK cell s prepared as per virus stock without seed virus added. For experimental use, each i noculum was diluted to a concentration of 2x106 plaque forming units per m illiliter in cold MEM For experiments incorporating equine virus, mock inoculum was diluted to t he same concentration as the equine virus as the equine virus stock had the lower titer and thus required less dilution. In other experiments, mock-inoculum was diluted to the same extent as the canine virus. Macrophage Inoculation with Canine and Equine Viruses Purified macrophages were seeded into 24-we ll plates at a concentration of 5x105 per well and incubated overnight at 37 C and 5% CO2. The following day, media was removed from the wells, and groups of 6 we lls were inoculated at a MOI of 2 with equine virus, canine virus or mock inocul um. The cells were incubated with the inoculum for 1 hour at 37 C and 5% CO2. In all experiments, the point immediately after the 1 hour incubation period is referred to as the hour time point. The inocula were removed at the end of the incubation period, and 1ml of fresh warm supplemented MEM was added to each well.

PAGE 98

98 Real-Time RT-PCR Total RNA was isolated from inoculated macrophages at each time point using the RNeasy Mini Kit (Qiagen, Valencia, CA) in cluding DNase treatment. Media from each well was transferred to microcentrifuge tubes and centrifuged at 10,000 rpm for 5 minutes in an Eppendorf centrifuge to co llect non-adherent cells. The supernatant was removed and stored at -70 C for cytokine protein quantific ation. Lysate buffer was added to the well, mixed by pipetting, and then transferred the cell pellet in the microcentrifuge tube. The sample was briefly vortexed and then stored at -70 C prior to further processing as per manufacturers inst ructions. The cDNA was synthesized from mRNA with oligo(dT) primers using the Adv antage RT for PCR kit (Clonetech, Mountain View CA). Canine G3PDH and TNFmRNA were quantified by real-time PCR using TaqMan Universal PCR ma ster mix and TAMRA FAM probes (Applied Biosystems, Branchburg, NJ) in the DNA engine Opti con II system (MJ Research/Bio-Rad Laboratories, Hercules, CA). Primer and probe sequences for canine G3PDH and TNFwere obtained from the liter ature. Virus matrix primer sequences common to both CIV and EIV were kindly provided by Dr Ruben Donis (Centers for Disease Control and Pevention, Atlanta, GA). Virus matrix probe sequence was generated using Primer Express Software for Real-time PCR version 3.0 (Applied Biosystems, Foster City, CA) and the NCBI influenza virus resource. Prim er and probe sequences are listed in Table 5-1. Primer efficiency and mRNA quantific ation calculations were performed as described by Pfaffl.119 For matrix mRNA gene expression EIV matrix mRNA expression was corrected relative to 0h CIV matrix mRNA expression because calculations comparing EIV and CIV matrix expression rev ealed the 0-hour expression of EIV matrix

PAGE 99

99 gene was approximately 6.8-fold that of CIV. The matrix pr imer efficiencies detecting EIV and CIV differed slightly, so comparisons of matrix expression are approximate. All mRNA levels were normalized to G3PDH mRNA expression. TNFELISA Canine TNFprotein in culture medium was quantified using a commercial ELISA (R&D Systems, Mineapolis, MN). Media were collected from macroph age cultures at the specified times after the inoculation period, centrifuged to remove cells, and stored at 70 C until further processing as per the manu facturers instructions. Plate absorbance readings were determined using the Synergy HT microplate reader (B io-tek Instruments Inc., Winooski, VT). Caspase-3/7 Assay Purified alveolar macrophages were seeded into wells in a Nunc FluoroNunc 96-well plate (Sigma Aldr ich) at a rate of 5x104 per well and cultured overnight at 37 C and 5% CO2. The following day, culture media was removed and 3 wells each were incubated for 1 hour with virusor mockinoculum (MOI=2), or supplemented MEM for positive control wells (see below). For tw o experiments, an additi onal negative control using virus-inoculum inactivated by exposure to UV light for 2 hours was used to control for caspase activity in the virus inoculum (Fig. 5-4). After the incubation period, the inoculum was removed and 50ul of fresh warm supplemented MEM was added to each well. To induce apoptosis in positive c ontrol wells, staurosporine (Sigma Aldrich, S6942) was added to positive control wells at a concentration of 1 M. Macrophages were then incubated at 37 C and 5% CO2. After 12 hours, caspase-3/7 activity was measured using the Apo-ONE homogenous caspase-3/7 assay (Promega, Madison,

PAGE 100

100 WI). Cells were treated as per the manuf acturers instructions and incubated for 3 hours. Plates were read using the Synergy HT microplate reader (B io-tek Instruments Inc.) at an excitation wavelength of 485 20nm and an emission wavelength of 528 20nm. Sensitivity of the readings wa s the same for each experiment. Annexin-V/Propidium Iodide Flow Cytometry To detect apoptosis and necrosis usi ng flow cytometry, we used the TACS Annexin-V FITC apoptosis detection kit (R&D Systems). Alveolar macrophages were seeded into a 24-well plate at a concentration of 2x106 macrophages per well, and incubated overnight at 37 C and 5% CO2. The following day, macrophages were inoculated at an MOI of 2 with CIV or mock-i noculum and incubated for 1 hour. Positive control wells were inc ubated with supplemented MEM media. After the 1-hour incubation period, the inocula were remo ved, and 1ml fresh supplemented media was added to the wells. To induce apoptosis in positive control wells, 1 M staurosporine was added. The cells were incubated for 12 hour s. After 12 hours culture media was collected. Cells were eluted from wells by trypsinization and then added to the collected media. As per the kit directions, cells were pelleted by centrifugation and washed twice with PBS containing calcium, and then inc ubated with the AnnexinV FITC/propidium iodide reagent. Binding buffer was then added and the cells were analyzed by flow cytometry using a FACSort flow cytometer (BD Biosciences, San Jose, CA). Data Analysis Data were expressed as mean standar d deviation, derived from the total number of experiments performe d for each variable. Logarithm ic transformation of data was performed if required to obtain normalit y or equal variance between groups. Means

PAGE 101

101 were compared using a repeated-measures one-way analysis of variance (ANOVA) or paired t-test if only two variables were examined. In the event of unequal group variances that were not corrected by logar ithmic transformation, nonparametric methods were used to compare groups. A P value <0.05 indicated a significant difference between compared groups. Stat istical analysis was performed using Sigmastat 3.5 software (Systat Software, Inc, Richmond, CA). Results Equine Influenza Matrix Gene Expression is Similar to Canine Influenza Matrix Gene Expression in Inoculated Alveolar Macrophages When alveolar macrophages were inoculat ed with either CIV or EIV, matrix gene expression was similar (Fig. 51). Immediately after inoculat ion, equine influenza virus matrix mRNA expression was 6.8 fold hi gher than that seen with CIV. When gene expression was corrected for the difference in expression between the viruses found immediately after inoculation and exam ined based on the increase from 0-hour expression, the kinetics of matrix gene expressi on was very similar for both EIV and CIV. For both viruses, peak matrix mRNA expression was seen at seen 6 hours after inoculation. Peak EIV matrix expression (11 11-fold 0h CIV expression) was 1.9-fold that seen with CIV (574-fold 0h expr ession). There was no statisti cally significant difference in matrix gene expression at any time point. Canine Influenza Virus Induces Greater TNFProduction than Equine Influenza Virus. We determined TNFprotein concentration in alv eolar macrophage culture media 12 hours after inoculation with either CIV or EIV. Inoculation of macrophages with CIV resulted in significantly (p<0.05, n=4, Fig. 5-2) greater production of TNFthan with

PAGE 102

102 mock-inoculation or inoc ulation with EIV. TNFproduction following CIV inoculation averaged 206 pg/ml media, 19-fold the level TNFseen following EIV inoculation. EIV induced an average TNFproduction of 11pg/ml media. Mock-inoculated cells averaged less than 0.03 pg TNF/ml media. Increased TNFProduction Seen with CIV Inoculat ion is Associated with Greater TNFmRNA Levels. Following CIV-inoculation, TNFmRNA levels in alveolar macrophages peaked at 9 hours following the inocul ation period, averaging 91-fol d the levels seen in mock inoculated macrophages (Fig. 5-3). In c ontrast, EIV-inoculate macrophages also showed peak mRNA levels by 9 hours, howev er this maximal response averaged only 10-fold the level seen in mock-inoculated macrophages. Inoculation with CIV Induces Apoptosis in Alveolar Macrophages. To determine if apoptosis is induced in macrophages inocul ated with CIV, we determined the level of caspase 3/7 activity in cultures of macrophages incubated for 12 hours following virus inoculation. Virus inoculated macrophage cultures exhibited significantly higher caspase activity than mo ck-inoculated cells (Fig. 5-4, p<0.05, n=8). Fluorescence measured from CIV-inoc ulated macrophage cultures averaged 3033 RFU, compared to 151 RFU for mock-inoc ulated macrophage cultures. The average fluorescence measured from CIV-inoculated macrophage cultures was similar to that measured from macrophages incubated with 1 M staurosporine, a potent inducer of apoptosis. Mock-inoculated macrophages exhibited si milar levels of caspase 3/7 activity to cultures inoculated with UV-inactivated viru s, indicating there was no caspase activity in virus inoculum.

PAGE 103

103 To investigate the differential indu ction of apoptosis and necrosis in CIVinoculated macrophages, we anal yzed Annexin-V FITC/ propi dium iodide staining with flow cytometry. After inoculation with CI V, the proportion of macrophages staining negative for both annexin-V and propidium iodide (considered viable cells) averaged 35.2%. This was significantly less than mock-i noculated cells (p<0.05, n=3) in which the proportion of macrophages staining negative fo r both annexin-V and propidium iodide was 89.5% (Fig. 5-5). Macrophages stai ning positive for anne xin-V and negative for propidium iodide (consistent with apoptosis) averaged 23.2% of cells in CIV-inoculated wells, and only 5.6% of cells in mock-inoc ulated wells. Macrophages staining positive for both annexin-V and propidium iodide (ce lls undergoing late-apoptosis or necrosis) averaged 18.3% when inoculated with CIV, and 2.8% when mock inoculated. The average proportion of macrophages staining positive only for propidium iodide (considered necrotic) were also greates t in CIV-inoculated macrophages, averaging 23.3%, compared to only 2.1% in mock-inoculated macrophages. Discussion Canine influenza virus is an important respiratory pathogen that continues to cause highly transmissible respiratory di sease in dogs throughout the US. Molecular analysis of CIV following its discovery s howed a close phylogenetic relationship to contemporaneous equine influenza viruses, indicating a likely transmission of a whole influenza virus from one mammalian specie s to another, and establ ishment of a new stable lineage in dogs.32 We previously showed that in canine alveolar macrophages, CIV induces TNFexpression of similar magnit ude to that seen following LPS exposure.123 It was unclear whether the TNFexpression seen after CIV-inoculation

PAGE 104

104 was specific to the canine isolate or repr esented a response to influenza viruses in general. Previous studie s have shown that TNFexpression in macrophages is strain specific and may contribute to the differ ences in pathogenicity seen between influenza viruses.27,79,114 We also previously demonstrated that inoculation of alveolar macrophages with CIV induced cell death, however it was unclear if the cells were dying via necrosis or apoptosis.123 Disruption of alveolar macrophages by influenza virus has been proposed as a mechanism by which influenza viruses may predispose to secondary bacterial pneumonia.30 Results from this study indicate that CIV and EIV matrix gene expression in al veolar macrophages is similar, yet CIV induces a greater TNFresponse. Furthermore, CIV induces ce ll death in alveolar macrophages through both necrosis and apoptosis. To compare the alveolar macrophage TNFresponse to CIV and EIV, we chose to use a relatively distant genetic prec ursor of CIV: infl uenza A/EQ/Kentucky/91. Presumably, some genetic change has occurr ed in CIV to allow efficient transmission within a new host. By choosing a distant genetic precursor, we hoped to capture a clear distinction between the equi ne and canine lineage. EIV matrix gene expression in alveolar macrophages was very si milar to that of CIV, with slightly increased expression at all measured time points other than 3 hours. Although we did not measure virus replication, we previously s howed that CIV replic ation is closely tied to matrix gene expression in alveolar macrophages.123 Despite the similarity of the extent and ki netics of matrix gene ex pression, alveolar macrophage TNFproduction was significantly greater in response to CIV compared to EIV. This effect was mediated at the mRNA level. The mechanisms by which influenza

PAGE 105

105 viruses induce TNFmRNA expression in macrophages are incompletely understood, and vary between virus strains. The activation of NFB (nuclear factor kappa B), p38 MAPK (mitogen-activated protein kinase) and IR F-3 (IFN regulatory factor 3) are at least partially involved in the transcription of TNF.64,69,80 The significantly greater TNFresponse of alveolar macrophages after CIV infection compared to EIV in fection may also play a role in the pathogenesis of CIV infection. Dogs exposed to EIV-infe cted horses showed seroconversion and virus shedding, yet did not develop a fever or show clinical signs of infection.167 TNFis a potent mediator of the acute inflammatory response follo wing influenza infection, as well as being a key inducer of pyrexia in t he acute phase reaction following infection.70 The lack of clinical signs (including fever) in dogs exposed to EIV may indicate that infection in these animals did not elicit a significant TNFresponse. Infection of alveolar macrophages with CIV strongly induced activity of the executioner caspases 3 and 7, indicating that apoptosis is a feature of CIV infection in macrophages. CIV infection also induced necr osis as evidenced by the presence of propidium iodide permissible cells not staini ng with annexin-V. Not all influenza viruses are capable of inducing apoptosis.134 The ability of some influenza viruses to induce apoptosis in macrophages has been proposed as a vi rulence factor that contributes to influenza-related disease by decreasing pulmonary bacterial defense mechanisms and increasing susceptibility to virus infection.30 The PB1-F2 protein, encoded by a +1 alternate open reading frame of the PB1 gene, has been pr oposed as conferring the ability to some influenza viruses to induce apoptosis in macrophages,25 and has also been linked to the increased pathogenicity of specific strains of influenza.91 Not all

PAGE 106

106 influenza viruses encode an intact PB1-F2 pr otein. Equine and canine H3N8 viruses encode intact PB1-F2 proteins, however t he PB1 genes form a distinct phylogenetic clade which may influence the function of the PB1-F2 protein.170 Further investigations into the role of the PB1-F2 protein in CIV-induced macrophage apoptos is are required. In conclusion, the data from this study suggest that the TNFresponse of canine alveolar macrophages to CIV may be unique to the canine-adapted virus, and greatly exceeds the response to a genetically distant equine H3N8 virus. The decreased viability of macrophages infect ed with CIV is due to the comb ined effects of necrosis and apoptosis induced by the virus.

PAGE 107

107 Table 5-1. Primer and probe sequences. Primer set Primer sequences (5`-3`) Probe sequence (5`-3`) Matrix gene Fwd: TGATCTTCTTGAAAAATTTGCAG Rev: CCGTAGCAGGCCCTCTTTTCA ATGCAGCGATTCAAGTGATCCTCTCGTT G3PDH113 Fwd: TCAACGGATTTGGCCGTATTGG Rev: TGAAGGGGTCATTGATGGCG CAGGGCTGCTTTTAACTCTGGCAAAGTGGA TNF48 Fwd: GAGCCGACGTGCCAATG Rev: CAACCCATCTGACGGCACTA CGTGGAGCTGACAGACAACCAGCTG

PAGE 108

108 Figure 5-1. Influenza virus matrix gene expression in alveolar macrophages. Virus matrix mRNA levels as determined by real-time RT-PCR are expressed as fold increase over the levels of CIV matrix mRNA presen t immediately after the inoculation period. Matrix mRNA levels were normalized to G3PDH mRNA expression. Equine influenza virus matrix mRNA expression was normalized to the 0h canine influenza vi rus matrix mRNA. n=4 for all time points. There was no statistically signifi cant difference between groups at any time point (Friedman-repeated measures ANOVA on Ranks, log-transformed data). Figure 5-2. TNFprotein concentration in alv eolar macrophage culture media. Concentration of TNFprotein, as determined by ELISA at 12-hours after virus inoculation, is expressed as pg/ml of culture media. n=4 for each group. = significantly different from EIV-inoculated and mock-inoculated macrophages, p<0.05, one way repeated measures ANOVA, Holm-Sidak method of all pairwise multip le comparison procedures.

PAGE 109

109 Figure 5-3. TNFmRNA in virus inoculated macrophages. Results are expressed as a ratio to TNFmRNA levels in mock-inoculated cells at each time point. TNFmRNA levels were normalized to G3PDH mRNA expression. n=4 at all time points for each group. There was no si gnificant difference between groups at any time point (one way repeated measur es ANOVA, Holm-Sidak method of all pairwise multiple comparison pr ocedures, log-transformed data). 9-hour and 12-hour CIV treated groups differed si gnificantly from the corresponding EIV treated group (pai red ttest). Figure 5-4. Caspase 3/7 activity in CI V-inoculated macrophages. Caspase 3/7 activity in macrophage cultures, as determined by fluorometric assay at 12 hours after inoculation, is expressed in rela tive fluorescence uni ts. n=8 for the mockinoculated, virus-inoculated and staur osporine treated groups. n=2 for UV inactivated virus group. = significant ly different from mock-inoculated and inactivated virus-inoculated groups p<0.05, one way repeated measures ANOVA, Holm-Sidak method of all pairwise multiple comparison procedures, log-transformed data.

PAGE 110

110 Figure 5-5. Annexin-V and propidium iodide labeling in alveolar macrophages. Results are expressed as the proportion (%) of cells staining in each group, as measured by flow cytometry 12 hours afte r virus inoculation. A= Annexin-V negative, A+ = Annexin-V positive, P= propidium iodide negative, P+ = propidium iodide positive. n= 3 for all groups. = significantly different values for mockand virus-inoculated cells within group, p<0.05, paired t-test, arcsine square root transformed data.

PAGE 111

111 CHAPTER 6 SUMMARY AND CONCLUSIONS The goal of this research was to invest igate the role of the macrophage in the pathogenesis of canine influenza. The hypothes is for these studies was that canine influenza virus (CIV) induces severe respirat ory disease in dogs by infecting pulmonary macrophages and inducing high levels of proinflammatory cytokines such as TNFand that influenza virus infection of ma crophages induces dysregulated cytokine responses in macrophages when they ar e subsequently exposed to bacterial pathogens. This hypothesis was tested with ex periments guided by 4 specific aims. Specific Aim 1 To Determine whether Canine Influenza Virus Replicates in Canine Macrophages and Induces Cell Death. CIV replicates in alveolar macrophages, as demonstrated by expression of virus matrix gene, detection of virus H3 antigen, and production of infectious virus in alveolar macrophage cultures. Infection of canine al veolar macrophages leads to cell death via both apoptosis and necrosis. Specific Aim 2 To Characterize Alterations in Cytokine Production Induced by Canine Influenza Virus in Macrophages. When infected with CIV, canine al veolar macrophages produce the proinflammatory cytokine TNFin amounts similar to that produced in response to lipopolysaccharide (LPS). This effect appears to be host strain-specific, as infection of macrophages with a genetically related equine influenza virus induced similar matrix mRNA expression, yet signifi cantly (p<0.05) less TNFproduction. Expression of TNFprotein in canine alveolar macrophages is related to increased levels of TNF

PAGE 112

112 mRNA. IL-10 is not produced in signific ant amounts by alveolar macrophages in response to CIV. Specific Aim 3 To Determine whether Bacterial TLR A gonist-Induced Cytokine Production by Macrophages is Enhanced by Prior Infe ction with Canine Influenza Virus. CIV infection of alveolar macrophages primed them for an exaggerated TNFresponse to subsequent exposure to LPS. A lesser effect was seen with lipoteichoic acid. Flagellin and unmethylated Cp G DNA were poor inducers of TNFin alveolar macrophages. Specific Aim 4 To Identify the Mechanism by which Canine Influenza Virus Augments Macrophage TNFResponse to LPS. Prior infection of alveolar macroph ages with CIV causes a much larger accumulation of TNFmRNA following LPS exposure than in macrophages exposed only to LPS or virus. The mechanism for the increased m RNA remains poorly defined and does not appear to be explained by altered mRNA degradation alone. Conclusions Canine alveolar macrophages may play an im portant role in the pathogenesis of CIV infection. Infection of alveol ar macrophages leads to increased TNFproduction, indicating that alveolar macrophages are an important source of pro-inflammatory cytokines mediating primary viral pneumonia. Virus production from infected alveolar macrophages is unlikely to be a significant sour ce of virus shedding in infected animals. The model presented in these studies s uggests that the alveolar macrophage may play an important role in increasing the se verity of bacterial pneumonia secondary to CIV infection. CIV primes alveolar macrophages for an exaggerated response to

PAGE 113

113 subsequent exposure to bacterial products Also, CIV induces cell death through both necrosis and apoptosis of alveolar macr ophages, and this effect may diminish the innate immune barrier provided by senti nel alveolar macrophages in the lung.

PAGE 114

114 APPENDIX A VIRUS INOCULATION OF ALVEOLAR MACROPHAGES FROM LABORATORY MAINTAINED BEAGLE DOGS Experimental Design and Methods The purpose of this study was to va lidate results seen from cadaver dogs obtained from a local animal shelter by per forming similar experiments in laboratorymaintained beagle dogs of known history. One of the major disadvantages of using cadaver dogs obtained from a local shelter is the lack of any known history of the dogs, as well as the lack of control of respirator y infectious disease that are often found in such facilities. As such, screening of animals obtained from a shelter for use in virus inoculation studies could only be performed post-mortem by gross examination of the lungs, as well as culture and differential cell counts on lavage fluid. Two laboratory-maintained beagle dogs we re used for this study. Due to the small size of the dogs (12 and 15 kg respective ly), relatively low numbers of alveolar macrophages were obtained by lung lavage, and thus the scope of these experiments was limited. In both cases, ther e were insufficient cells to run mock-inoculated controls, so only virus-inoculated cells were exami ned. Only mRNA levels were determined in these studies. Lung lavage, alveolar macrophage isolatio n and culture conditions, inoculation protocol and real-tim e RT-PCR methods were described in experiment 1 (Chapter 2). For the first dog (beagle 1), a total of 1.31x106 macrophages were purified. These cells were split between 3 wells in a 24-well plate at a concentration of 4.4x105 cells per well. For the second dog (beagle 2), only 1.96x105 total macrophages were purified. These were split between 2 wells in a 24-well plate at a concentration of 9.8x104 macrophages per well. Macrophages were inoculated at an MOI of 2. For beagle 1, total RNA was

PAGE 115

115 harvested at 0, 6 and 12 hours after virus in oculation. For beagle 2, total RNA was harvested at 0 and 12 hours after virus inoculation. Results and Conclusions In macrophages from beagl e 1, matrix mRNA expr ession was maximal by 6 hours after virus inoculation at 1497-fold t he level immediately after the inoculation period (Fig. A-1). By 12 hours, the expr ession had waned to 195-fold the level immediately after inoculation. In compar ison, matrix mRNA expression in cadaver alveolar macrophages was also maximal at 6 hours after virus inoculation, averaging 6445-fold the level immediately after inocul ation, with a range from 16-fold to over 53,000-fold the level immediately after inocul ation (Chapter 3). Due to the very small numbers of cells obtained from beagle 2, only small amounts of RNA were recoverable. Determination of matrix mRNA expression was not performed in this animal as no matrix mRNA was detectable by real-time RT-PCR at 0h, and thus no comparison could be made from the 12 hour samples. As we were unable to use a mock-inoculated control group in either beagle to express cytokine mRNA expression in viru s-inoculated groups, t he results here are expressed as a ratio to 0-hour expression, in the same manner as matrix mRNA expression. In beagle 1, TNF expression was ma ximal at 6 hours after virus inoculation, peaking at 18-fold the level se en at 0-hour. IL-10 mRNA only fluctuated mildly from the levels seen at 0h (Fig. A-2) In macrophages from beagle 2, only modest increases in both TNFand IL-10 mRNA expression from the level immediately after inoculation were noted (Fig. A-3).

PAGE 116

116 Based on results from other animals, it is likely that peaks in TNFmRNA production occur close to 9 hours after virus i noculation. Beagle 1, showed kinetics of mRNA expression similar to that seen in macrophages obtained from cadaver dogs from shelters. The small numbers of macrophages obtained from beagle 2 likely impacted the results reported here by severely limiting the amount of RNA recoverable, and yielded results not comparable with those from experiments utilizing much greater numbers of cells.

PAGE 117

117 Figure A-1. Matrix mRNA expression in al veolar macrophages from beagle 1 inoculated with CIV. Virus matrix mRNA levels as determined by real-time RT-PCR are expressed as fold increase over the levels of CIV matrix mRNA present immediately after the i noculation period. n=1 Figure A-2. TNFand IL-10 mRNA in virus inoculated alveolar macrophages from beagle 1. Results are expressed as fold increase over the levels of cytokine mRNA present immediately after inoculation. n=1.

PAGE 118

118 Figure A-3. TNFand IL-10 mRNA in virus inoculated alveolar macrophages from beagle 2. Results are expressed as fold increase over the levels of cytokine mRNA present immediately after inoculation. n=1

PAGE 119

119 APPENDIX B VIRUS INOCULATION STUDIES ON PERIP HERAL BLOOD MONOCYTE DERIVED MACROPHAGES Experimental Design and Methods. We assessed a variety of models of canine macrophages to use in canine influenza virus inoculation studies. We in itially planned to perform most studies on peripheral blood monocyte-derived macrophages (PBMDMs) obtained from laboratorymaintained beagle dogs. The advantage of this approach would have been a relatively uniform source of cells that were certain to be free of pathogens. Circulating monocytes are functionally immature, and when cultured require time to develop the phenotype of a macrophage, somewhere in the vicinity of 10 days culture. We faced significant difficulties in maintaining cells adherent to culture flasks for any longer than 3 days, despite trialing several methods. As outli ned here, 3-day old PBMDMs performed as a poor model of alveolar macrophages when inoculated with CIV. Methodology for PBMDM isolation was adapted from published work in humans47 and ponies.124 Adult male beagles were sedated with Domitor (Pfizer, PA) at the dose recommended by the manufacturer. 10ml pe r kilogram body weight of blood was collected via jugular venipuncture into heparinized 60ml syringes. The blood was centrifuged at room temperat ure for 30 minutes at 700xg to separate the whole blood into red cell pellet, buffy coat and plas ma components. A portion of plasma was removed and saved for preparation of fla sks for monocyte culture. The remaining plasma and buffy coat was resuspended in 2-3 volumes of Dulbeccos PBS (D-PBS). To separate peripheral blood m ononuclear cells from polymorphonuclear cells and erythrocytes, the resulting cell suspension was underlaid wit h 10ml of Ficoll-Paque Plus (GE Healthcare, Uppsala, Sweden) and centri fuged at room temperature for 20 minutes

PAGE 120

120 at 800xg. Cells collected from the interf ace of supernatant and Ficoll solution were resuspended in D-PBS and centri fuged at room temperature for 10 minutes at 600xg. To minimize platelet contamination, the resulting pellet was repeatedly resuspended in D-PBS and centrifuged at room temperat ure for 15 minutes at 300xg until the supernatant was clear. Cell pellets were fina lly resuspended in 10ml room temperature MEM Eagle HEPES modification (Sigma-Ald rich, St Louis, MO) supplemented with 10% fetal bovine serum (Sigma-Aldri ch), 100 IU/ml penicillin and 100 g/ml streptomycin (PBMDM media). To retard adherence, the resulting cell suspension was placed on ice until further processing. 0.1ml of the cell suspension was diluted 1:100 and 1:1000. The 1:100 dilution was used to determine nucleat ed cell counts using a hemacytometer, and the 1:1000 dilution was used fo r a cytospin preparation for cell differential counts. Peripheral blood monocytes were purifi ed by adherence to gelatin/plasma-coated tissue culture flasks. Culture flasks (150cm2, Corning) were prepared by incubating 10ml of 2% gelatin (Sigma Aldrich) at 37C with 5% CO2 for at least 2 hours. The gelatin was then removed and the flasks were left to dry. Flasks were then incubated with 1015ml of autologous plasma for a minimum of 30 minutes. The plasma was removed and the flasks were washed 3 time s with D-PBS, with the third wash being left in place until just prior to use. Blood mononuclear cells were seeded into the gelatin/plasma coated flasks in 25ml supplemented MEM, at a concentration of 5-15 106 cells per ml. The cell suspension was incubated for 18 hours at 37C with 5% CO2, with occasional gentle rocking of the tissue culture flasks. Followi ng incubation, the non-adherent and loosely adherent cells were removed by gently re suspending the media over the cells. The

PAGE 121

121 adherent cells were then gently washed four times with 10ml of warm MEM. Adherent cells were eluted from the tissue culture fl asks by two 1-3 minute incubations with 37C 10x Trypsin-EDTA solution (Sig ma-Aldrich) diluted 1:10 in D-PBS, followed by agitation of the flasks. The trypsinize d cells were collected into equal volumes of supplemented MEM. The resulting cell suspension was ce ntrifuged for 5 minutes at 4C, 500xg, and the cell pellet was resuspended in cold supplemented MEM and placed on ice until further processing. 0.1ml of the cell susp ension was diluted 1:10, 1:100 and 1:1000 for trypan blue exclusion assay (for cell viabil ity), cell counting and differential cell counts, respectively. The cell suspension was then seeded into 12-well plates at a concentration of 5x105 viable monocyte/macrophages per well. The cells were further incubated for 3 days at 37C and 5% CO2, prior to inoculation studies. After 3 days incubation, macrophages were inoculated with CIV or mock inoculum as described in experiment 1 (chapter 2) Total RNA was collected for real-time RTPCR at 0, 3, 6 and 12 hours after virus inoc ulation, as described in experiment 1 (chapter 2). Results and Conclusions Matrix mRNA expression in PBMDMs was much less than that seen in CIVinoculated alveolar macrophages (Fig. B-1) Maximal matrix mRNA expression in alveolar macrophages was typically seen 6 hour s after virus inoculation, and averaged over 6000-fold the level seen immediately a fter the inoculation period. In contrast, maximal matrix mRNA expression in PBMDM s was seen 12 hours after the inoculation period, and averaged only 28-fold the level s een immediately after virus inoculation.

PAGE 122

122 PBMDMs responded minimally to CIV inoculation with TNFmRNA expression. Only a mild increased in expression (1.9 -fold the level in mock-inoculated PBMDMs) occurred 3 hours after virus inoculation (F ig. B-2). In contrast, alveolar macrophage TNFmRNA averaged 28-fold the level seen in mock-inoculated macrophages by 12 hours after inoculation (chapter 3). IL-10 mRNA expression in PBMDMs follo wing CIV-inoculation did not exceed 2fold the level seen in mock inoculated PBMDMDs (Fig. B-3) In conclusion, inoculation of PBM DMs differed markedly from alveolar macrophages in the lack of matrix gene expressi on. This is likely linked to the minimal cytokine response of the cells to the viru s. These results suggest that CIV does not replicate well in PBMDMs cultured for 3 days prior to inoculation.

PAGE 123

123 Figure B-1. Virus matrix gene expre ssion in peripheral blood monocyte-derived macrophages. Viral matrix RNA levels as determined by real-time RT-PCR are expressed as fold-increase over t he levels present immediately after the inoculation period. n=3 Figure B-2. TNFmRNA in virus inoculated peripheral blood monocyte-derived macrophages. Results are expressed as a ratio to TNFmRNA levels in mock-inoculated cells at each time point. TNFmRNA levels were normalized to G3PDH m RNA expression. n=2

PAGE 124

124 Figure B-3. IL-10 mRNA in virus i noculated peripheral blood monocyte-derived macrophages. Results are expressed as a ratio to IL-10 mRNA levels in mock-inoculated cells at each time point. TNFmRNA levels were normalized to G3PDH mRNA expressi on. n=2 for 0, 6 and 12 hour time points, n=1 for 3 hour time point.

PAGE 125

125 APPENDIX C CYTOKINE EXPRESSION IN ALVEOLAR MACROPHAGES IN OCULATED WITH UVINACTIVATED VIRUS Experimental Design and Methods The purpose of this experiment was to investigate the appropriateness of the mock-inoculum used in studies as a negativ e control for virus inoculation studies. Although great care was taken to prepare mo ckand virus-inocula stocks in the same manner (mock-inoculum stock differed onl y in not having virus seed added to MDCK cells during virus culture), the nature of a virus infection during virus propogation may have potentially led to the pr oduction of compounds either from MDCK cells (eg, type I interferons) or other cellular products rel eased during death of MDCK cells, that may activate alveolar macrophages independent of the pr esence of virus. As such, it was felt that by UV-inactivating virus stock, the effe cts of virus replication could be removed and any other substances in the inoculum w ould be detected as having an influence on alveolar macrophage cytokine production. Thawed Canine/FL/04 virus stock was inac tivated by incubation on ice, directly under a UV-lamp, for 2 hours. This inacti vated stock was aliquoted and re-frozen for later use in these experiments. Alveol ar macrophages were inoculated with mockinoculum or UV-inactivated virus inoculum as outlined for virus inoculation in experiment 1 (chapter 2). After inoculatio n, cells were incubated at 37 C and 5% CO2 for 12 hours. Total RNA for real-time RT-PCR was harvest ed as described in experiment 1 (chapter 2) at 0 and 12 hours after inoculation. Results and Conclusions Both TNFand IL-10 mRNA expression in alveolar macrophages inoculated with UV-inactivated virus was similar to t he expression in response to mock-inoculum

PAGE 126

126 (Fig. C-1 and C-2). In similar experiments, virus-inoculated macrophages averaged 28fold the level of TNFmRNA in mock inoculated cells by 12 hours after virus inoculation (chapter 3). Real -time RT-PCR using primers and probes for virus matrix mRNA were negative for all samples, confirmi ng inactivation of the stock by UV-light exposure. This confirms that there was no substances in the virus inoculum that alone would cause increased TNFor IL-10 expression. Thus, t he mock-inoculum used in these studies was a suitable negative control.

PAGE 127

127 Figure C-1. TNFmRNA expression in alveolar macrophages inoculated with UVinactivated. Results are expressed as a ratio to TNFmRNA levels in mockinoculated cells at each time point. TNFmRNA levels were normalized to G3PDH mRNA expression. n=3. Figure C-2. IL-10 mRNA expression in alveolar macrophages inoculated with UVinactivated. Results are expressed as a ratio to IL-10 mRNA levels in mockinoculated cells at each time point. IL -10 mRNA levels were normalized to G3PDH mRNA expression. n=3.

PAGE 128

128 APPENDIX D TNFEXPRESSION IN DH82 CELLS FOLLO WING CANINE INFLUENZA VIRUS INOCULATION AND EXPOSURE TO LIPO POLYSACCHARIDE AND LIPOTEICHOIC ACID Experimental Design and Methods The purpose of this experiment was to a ssess the suitability of the canine DH82 macrophage cell line as a model for the alv eolar macrophage in the investigation of canine influenza pathogenesis. The cell line originated from a dog with malignant histiocytosis, a systemic prolifer ation of malignant histiocytes.162 DH82 cells were cultured in Eagl es minimum essential media (MEM) supplemented with 15% fetal bovine serum, 1% antibiotic/antimycotic solution, 1% sodium pyruvate, 1% glutamat e, and 1% essential amino acid s (Sigma Aldrich). Fourth passage cells were used for this experiment. DH82 cells were seeded into a 24-well plate at a concentration of 5x105 trypanblue negative cells per well. T he cells were incubated at 37 C and 5% CO2 for 3 hours to allow adherence to the plate. Cells were in oculated at a multiplicity of infection of 2 with Canine/FL/04 influenza virus (CIV) or mo ck inoculum as described in experiment 1 for alveolar macrophage inoculation. After th e 1-hour inoculation per iod, the inoculum was removed and replaced with warm fresh supplemented MEM. The cells were incubated a further 3 hours at 37 C and 5% CO2. At 3 hours after inoculation, wells of DH82 cells were exposed to ei ther lipopolysaccharide (LPS) or lipoteichoic acid (LTA) at a variety of concentrations. LPS was added at concentrations of 1, 10 or 100ng/ml media, and LTA was added at concentrations of 100 or 1000 g/ml media. At 0, 3, 6, 17 and 25 hours after inoculation, 170 l of culture media was sampled, and replaced with 170 l of fresh media.

PAGE 129

129 TNFconcentration in culture media was determined using a commercial ELISA kit as described in experiment 2. Results and Conclusions DH82 cells responded to CIV with less TNFthan alveolar macrophages. Peak TNFproduction of DH82 cells was 95 pg/ml m edia, occurring at 25 hours after virus inoculation. In similar experiments usi ng alveolar macrophages (Chapter 4), average peak TNFproduction was 242 pg/ml, occurring at 12 hours after virus inoculation. CIV inoculation of DH82 cells did not augment TNFproduction. CIVand mockinoculated DH82 cells exposed to LPS 3 hours after inoculation displayed similar TNFproduction at all concentrations (Fig. D-1 D-3). Peak production occurred at 17 hours after inoculation when LPS was added at 1ng/ml. At this LPS concentration, CIVinoculated DH82 cells produced 339 pg/ml TNF, and mock-inoculated DH82 cells produced 309 pg/ml TNF. This response was similar to mock-inoculated alveolar macrophages exposed to LPS in similar experiments that averaged a maximal TNFproduction of 317 pg/ml at 6 hours after virus inoculation (Chapter 4). At higher concentrations of LPS, DH82 cells became less responsive in TNFresponse. The response of DH82 cells to LTA was simi lar to that of alv eolar macrophages. In similar experiments, mock-inocul ated macrophages exposed to 1000ng/ml LTA produced 489 pg TNF/ml media by 12 hours after inoculation. Mock-inoculated DH82 cells exposed to LTA at a concentra tion of 1000ng/ml produced 309 pg TNF/ml media. In contrast to the response of CIVinoculated alveolar macrophages, CIVinoculation of DH82 augmented TNFproduction in response to LTA above that of an

PAGE 130

130 additive effect of LTA and virus. This effect was most pronounced when 100ng/ml of LTA was added (Fig. D-4 & D-5). In conclusion, DH82 cells we re a poor model of the TNFresponse of alveolar macrophages to CIV, and also of the TNFresponse of CIV-inoculated alveolar macrophages to both LPS and LTA. Based on t hese results, we opted not to further pursue the use of DH82 cells in experimen ts delineating the molecular mechanisms behind the augmented response of CIV-inoc ulated alveolar macrophages to LPS.

PAGE 131

131 Figure D-1. TNFproduction from Canine/FL/04and mockinoculated DH82 cells, 1ng/ml lipopolysaccharide (LPS) added 3 ho urs after inoculation. DH82 cells were virusor mock inoculated. After 3 hours, 1 replicate each of virusand mock-inoculated cells were exposed to 1ng/ml LPS. n=1 for each group. Figure D-2. TNFproduction from Canine/FL/04and mockinoculated DH82 cells, 10ng/ml LPS added 3 hours after inoculation. DH82 cells were virusor mock inoculated. After 3 hours, 1 replicate each of virusand mock-inoculated cells were exposed to 10ng/ml LPS. n=1 for each group.

PAGE 132

132 Figure D-3. TNFproduction from Canine/FL/04and mockinoculated DH82 cells, 100ng/ml LPS added 3 hours after inoculati on. DH82 cells were virusor mock inoculated. After 3 hours, 1 replic ate each of virusand mock-inoculated cells were exposed to 100ng/ml LPS. n=1 for each group. Figure D-4. TNFproduction from Canine/FL/04and mockinoculated DH82 cells, 100ng/ml lipoteichoic acid (LTA) added 3 ho urs after inoculation. DH82 cells were virusor mock inoculated. After 3 hours, 1 replicate each of virusand mock-inoculated cells were exposed to 100ng/ml LTA. n=1 for each group.

PAGE 133

133 Figure D-5. TNFproduction from Canine/FL/04and mockinoculated DH82 cells, 1000ng/ml LTA added 3 hours after inoculat ion. DH82 cells were virusor mock inoculated. After 3 hours, 1 replic ate each of virusand mock-inoculated cells were exposed to 1000ng/ml LTA. n=1 for each group.

PAGE 134

134 LIST OF REFERENCES 1 A revision of the system of nomenclature for influenza viruses: a WHO memorandum. Bull World Health Organ 58: 585-591, 1980 2 Abraham LJ, Kroeger KM: Impact of t he -308 TNF promoter polymorphism on the transcriptional regulation of the TNF gene: relevance to disease. J Leukoc Biol 66: 562-566, 1999 3 Abramson JS, Giebink GS, Mills EL, Quie PG: Polymorphonuclear leukocyte dysfunction during influenza virus infect ion in chinchillas. J Infect Dis 143: 836845, 1981 4 Abramson JS, Giebink GS Quie PG: Influenza A viru s-induced polymorphonuclear leukocyte dysfunction in the pathogenesis of experimental pneumococcal otitis media. Infect Immun 36: 289-296, 1982 5 Abramson JS, Hudnor HR: Role of the si alophorin (CD43) receptor in mediating influenza A virus-induced polymorphonuclear leukocyte dysfunction. Blood 85: 1615-1619, 1995 6 Abramson JS, Lewis JC, Lyles DS, Heller KA, Mills EL, Bass DA: Inhibition of neutrophil lysosome-phagosome fusion associated with influenza virus infection in vitro. Role in depressed bactericidal activity. J Clin Invest 69: 1393-1397, 1982 7 Abramson JS, Mills EL: Depression of neutrophil function induced by viruses and its role in secondary microbial infections. Rev Infect Dis 10: 326-341, 1988 8 Abramson JS, Mills EL, Giebink GS, Quie PG: Depression of monocyte and polymorphonuclear leukocyt e oxidative metabolism and bactericidal capacity by influenza A virus. Infect Immun 35: 350-355, 1982 9 Abramson JS, Wheeler JG, Parce JW, Ro we MJ, Lyles DS, Seeds M, Bass DA: Suppression of endocytosis in neutrophils by influenza A virus in vitro. J Infect Dis 154: 456-463, 1986 10 Ackermann MR: Acute Inflammation. In : Pathologic Basis of Veterinary Disease, eds. McGavin MDZachary JF, 4th ed., pp. 101-152. Mosby Elsevier, St Louis, 2007 11 Akira S, Uematsu S, Takeuchi O: Pa thogen recognition and innate immunity. Cell 124: 783-801, 2006

PAGE 135

135 12 Amonsin A, Payungporn S, Theamboonlers A, Thanawongnuwech R, Suradhat S, Pariyothorn N, Tantilertcharoen R, Damrongwantanapokin S, Buranathai C, Chaisingh A, Songserm T, Poovorawan Y: Genetic characterization of H5N1 influenza A viruses isolated from zoo tigers in Thailand. Virology 344: 480-491, 2006 13 Barton GM, Kagan JC: A cell biological view of Toll-like receptor function: regulation through compartmentalization. Nat Rev Immunol, 2009 14 Basler CF, Aguilar PV: Progress in i dentifying virulence determinants of the 1918 H1N1 and the Southeast Asian H5N1 influenza A viruses. Antiviral Res 79: 166178, 2008 15 Bender A, Amann U, Jager R, Nain M, Gemsa D: Effect of granulocyte/macrophage colony-stimulating factor on human monocyt es infected with influenza A virus. Enhancement of virus replication, cytoki ne release, and cytotoxicity. J Immunol 151: 5416-5424, 1993 16 Bender A, Sprenger H, Gong JH, Henke A, Bolte G, Spengler HP, Nain M, Gemsa D: The potentiating effect of LPS on tumo r necrosis factor-alpha production by influenza A virus-infected macrophages. Immunobiology 187: 357-371, 1993 17 Bilyk N, Holt PG: Cytokine modulat ion of the immunosuppr essive phenotype of pulmonary alveolar macr ophage populations. Immunology 86: 231-237, 1995 18 Brundage JF: Interactions between influe nza and bacterial respiratory pathogens: implications for pandemic pr eparedness. Lancet Infect Dis 6: 303-312, 2006 19 Brydon EW, Morris SJ, Sweet C: Role of apoptosis and cytokines in influenza virus morbidity. FEMS Microbiol Rev 29: 837-850, 2005 20 Bueno R, Mello MN, Menezes CA, Dutra WO, Santos RL: Phenotypic, functional, and quantitative characterization of c anine peripheral blood monocyte-derived macrophages. Mem Inst Oswaldo Cruz 100: 521-524, 2005 21 Cassidy LF, Lyles DS, Abramson JS: Depression of polymorphonuclear leukocyte functions by purified influenz a virus hemagglutinin and sialic acid-binding lectins. J Immunol 142: 4401-4406, 1989 22 Cassidy LF, Lyles DS, Abramson JS: Synthesis of viral proteins in polymorphonuclear leukocytes infected wit h influenza A virus. J Clin Microbiol 26: 1267-1270, 1988 23 Chan MC, Cheung CY, Chui WH, Tsao SW Nicholls JM, Chan YO, Chan RW, Long HT, Poon LL, Guan Y, Peiris JS: Proinf lammatory cytokine responses induced by influenza A (H5N1) viruses in primary hum an alveolar and bronchial epithelial cells. Respir Res 6: 135, 2005

PAGE 136

136 24 Chang EY, Guo B, Doyle SE, Cheng G: Cutti ng edge: involvement of the type I IFN production and signaling pathway in lipopolysaccharide-induced IL-10 production. J Immunol 178: 6705-6709, 2007 25 Chen W, Calvo PA, Malide D, Gibbs J, Schubert U, Bacik I, Basta S, O'Neill R, Schickli J, Palese P, Henklein P, B ennink JR, Yewdell JW: A novel influenza A virus mitochondrial protein that induces cell death. Nat Med 7: 1306-1312, 2001 26 Chen YL, Chen YS, Lin HH, Chan CW, Chen SC, Chen CH: Immunostimulatory flagellin from Burkholderia ps eudomallei effects on an incr ease in the intracellular calcium concentration and up-regulation of TNF-alpha by mononuclear cells. Microbiol Immunol 51: 81-86, 2007 27 Cheung CY, Poon LL, Lau AS, Luk W, Lau YL, Shortridge KF, Gordon S, Guan Y, Peiris JS: Induction of proinflammatory cytokines in human macrophages by influenza A (H5N1) viruses: a mechani sm for the unusual severity of human disease? Lancet 360: 1831-1837, 2002 28 Cheung TK, Poon LL: Biology of influenza a virus. Ann N Y Acad Sci 1102: 1-25, 2007 29 Colamussi ML, White MR, Crouch E, Ha rtshorn KL: Influenza A virus accelerates neutrophil apoptosis and markedl y potentiates apoptotic effe cts of bacteria. Blood 93: 2395-2403, 1999 30 Coleman JR: The PB1-F2 protein of Infl uenza A virus: increasing pathogenicity by disrupting alveolar macrophages. Virol J 4: 9, 2007 31 Couper KN, Blount DG, Riley EM: IL-10: the master regulator of immunity to infection. J Immunol 180: 5771-5777, 2008 32 Crawford PC, Dubovi EJ, Castleman WL Stephenson I, Gibbs EP, Chen L, Smith C, Hill RC, Ferro P, Pompey J, Bright RA, Medina MJ, Johnson CM, Olsen CW, Cox NJ, Klimov AI, Katz JM, Donis RO: Transmission of equine influenza virus to dogs. Science 310: 482-485, 2005 33 Cundell DR, Gerard NP, Gerard C, Idanpaan-Heikkila I, Tuomanen EI: Streptococcus pneumoniae anchor to activa ted human cells by the receptor for platelet-activating factor. Nature 377: 435-438, 1995 34 Daly JM, Blunden AS, Macrae S, Miller J, Bowman SJ, Kolodziejek J, Nowotny N, Smith KC: Transmission of equine influenza virus to English foxhounds. Emerg Infect Dis 14: 461-464, 2008 35 Dawson TC, Beck MA, Kuziel WA, Hender son F, Maeda N: Contrasting effects of CCR5 and CCR2 deficiency in the pulmonary inflammatory response to influenza A virus. Am J Pathol 156: 1951-1959, 2000

PAGE 137

137 36 de Bentzmann S, Plotkowski C, Puchel le E: Receptors in the Pseudomonas aeruginosa adherence to injured and repairing ai rway epithelium. Am J Respir Crit Care Med 154: S155-162, 1996 37 de Jong MD, Simmons CP, Thanh TT, Hien VM, Smith GJ, Chau TN, Hoang DM, Van Vinh Chau N, Khanh TH, Dong VC, Qu i PT, Van Cam B, Ha do Q, Guan Y, Peiris JS, Chinh NT, Hien TT, Farrar J: Fatal outcome of human influenza A (H5N1) is associated with high vira l load and hypercytokinemia. Nat Med 12: 1203-1207, 2006 38 Debets-Ossenkopp Y, Mills EL, van Dijk WC, Verbrugh HA, Verhoef J: Effect of influenza virus on phagocytic cells. Eur J Clin Microbiol 1: 171-177, 1982 39 Deleault KM, Skinner SJ, Brooks SA: Tristetraprolin regulates TNF TNF-alpha mRNA stability via a proteasome dependent mechanism involving the combined action of the ERK and p38 pathways. Mol Immunol 45: 13-24, 2008 40 Didierlaurent A, Goulding J, Patel S, Snelgrove R, Low L, Bebien M, Lawrence T, van Rijt LS, Lambrecht BN, Sirard JC, Hussell T: Sustained desensitization to bacterial Toll-like receptor ligands after re solution of respiratory influenza infection. J Exp Med, 2008 41 Dubovi EJ, Njaa BL: Canine influenza. Vet Clin North Am Small Anim Pract 38: 827835, 2008 42 Engelich G, White M, Hartshorn KL: N eutrophil survival is markedly reduced by incubation with influenza virus and Streptoc occus pneumoniae: role of respiratory burst. J Leukoc Biol 69: 50-56, 2001 43 Engelich G, White M, Hartshorn KL: Role of the respiratory burst in co-operative reduction in neutrophil survival by infl uenza A virus and Escherichia coli. J Med Microbiol 51: 484-490, 2002 44 Falvo JV, Uglialoro AM, Brinkman BM, Me rika M, Parekh BS, Tsai EY, King HC, Morielli AD, Peralta EG, Maniatis T, T hanos D, Goldfeld AE: Stimulus-specific assembly of enhancer complexes on the tumor necrosis factor alpha gene promoter. Mol Cell Biol 20: 2239-2247, 2000 45 Fedson DS: Was bacterial pneumonia the predominant cause of death in the 19181919 influenza pandemic? J Infect Dis 199: 1408-1409; author reply 1409-1410, 2009 46 Fesq H, Bacher M, Nain M, Gemsa D: Programmed cell death (apoptosis) in human monocytes infected by influenza A virus. Immunobiology 190: 175-182, 1994 47 Freundlich B, Avdalovic N: Use of gelat in/plasma coated flasks for isolating human peripheral blood monocytes. J Immunol Methods 62: 31-37, 1983

PAGE 138

138 48 Fujiwara S, Yasunaga S, Iwabuchi S, Ma suda K, Ohno K, Tsujimoto H: Cytokine profiles of peripheral blood mo nonuclear cells from dogs experimentally sensitized to Japanese cedar pollen. Vet Immunol Immunopathol 93: 9-20, 2003 49 Garcia MA, Gil J, Ventos o I, Guerra S, Domingo E, Rivas C, Esteban M: Impact of Protein Kinase PKR in Cell Biology: from Antiviral to Antiproliferative Action. Microbiol Mol Biol Rev 70: 1032-1060, 2006 50 Gong JH, Sprenger H, Hinder F, Bender A, Schmidt A, Horch S, Nain M, Gemsa D: Influenza A virus infection of macrophages Enhanced tumor necrosis factor-alpha (TNF-alpha) gene expression and lipopolysa ccharide-triggered TNF-alpha release. J Immunol 147: 3507-3513, 1991 51 Govorkova EA, Rehg JE, Krauss S, Yen HL, Guan Y, Peiris M, Nguyen TD, Hanh TH, Puthavathana P, Long HT, Buranathai C, Lim W, Webster RG, Hoffmann E: Lethality to ferrets of H5N1 influenza viruses isolated from humans and poultry in 2004. J Virol 79: 2191-2198, 2005 52 Guarner J, Paddock CD, Shieh WJ, Pack ard MM, Patel M, Montague JL, Uyeki TM, Bhat N, Balish A, Lindstrom S, K limov A, Zaki SR: Histopathologic and immunohistochemical features of fatal infl uenza virus infection in children during the 2003-2004 season. Clin Infect Dis 43: 132-140, 2006 53 Hacker H, Karin M: Regulation and function of IKK and IKK-related kinases. Sci STKE 2006: re13, 2006 54 Hale BG, Randall RE, Ortin J, Jackson D: The multifunctional NS1 protein of influenza A viruses. J Gen Virol 89: 2359-2376, 2008 55 Hartshorn KL, Daigneault DE, White MR, Tauber AI: Anom alous features of human neutrophil activation by influenza A virus ar e shared by related viruses and sialic acid-binding lectins. J Leukoc Biol 51: 230-236, 1992 56 Hartshorn KL, Liou LS, White MR, Kaz hdan MM, Tauber JL, Tauber AI: Neutrophil deactivation by influenza A virus. Role of hemagglutinin binding to specific sialic acid-bearing cellular proteins. J Immunol 154: 3952-3960, 1995 57 Hawthorne JD, Albrecht P: Sensitive plaque neutraliza tion assay for parainfluenza virus types 1, 2, and 3 and respirator y syncytial virus. J Clin Microbiol 13: 730-737, 1981 58 Hayes MP, Freeman SL, Donnelly RP: IF N-gamma priming of monocytes enhances LPS-induced TNF production by augment ing both transcription and MRNA stability. Cytokine 7: 427-435, 1995 59 Headley AS, Tolley E, Meduri GU: Infect ions and the inflammatory response in acute respiratory distress syndrome. Chest 111: 1306-1321, 1997

PAGE 139

139 60 Hers JF, Masurel N, Mulder J: Bacter iology and histopathology of the respiratory tract and lungs in fatal Asian influenza. Lancet 2: 1141-1143, 1958 61 Ho CK, Babiuk LA: Long-term culture of c anine peripheral blood monocytes in vitro. Can J Comp Med 43: 223-228, 1979 62 Hofmann P, Sprenger H, Kaufmann A, Bender A, Hasse C, Nain M, Gemsa D: Susceptibility of mononuclear phagocytes to influenza A virus infection and possible role in the antiviral response. J Leukoc Biol 61: 408-414, 1997 63 Hoke CH, Jr., Hopkins JA, Meiklejohn G, Mostow SR: Comparison of several wildtype influenza viruses in the ferret tr acheal organ culture system. Rev Infect Dis 1: 946-954, 1979 64 Hui KP, Lee SM, Cheung CY, Ng IH, Poon LL, Guan Y, Ip NY, Lau AS, Peiris JS: Induction of proinflammatory cytokines in primary human macrophages by influenza A virus (H5N1) is selectively regulated by IFN regulatory factor 3 and p38 MAPK. J Immunol 182: 1088-1098, 2009 65 Ishizuka S, Yamaya M, Suzuki T, Takahas hi H, Ida S, Sasaki T, Inoue D, Sekizawa K, Nishimura H, Sasaki H: Effects of rhinovirus infection on the adherence of Streptococcus pneumoniae to cultured human ai rway epithelial cells. J Infect Dis 188: 1928-1939, 2003 66 Jakab GJ: Immune impairment of alveolar macrophage phagocytosis during influenza virus pneumonia. Am Rev Respir Dis 126: 778-782, 1982 67 Jakab GJ, Warr GA: The participation of antiviral immune mechanisms in alveolar macrophage dysfunction during viral pneumoni a. Bull Eur Physiopathol Respir 19: 173-178, 1983 68 Julkunen I, Melen K, Nyqvist M, Pirhonen J, Sareneva T, Matikainen S: Inflammatory responses in infl uenza A virus infection. Vaccine 19 Suppl 1: S3237, 2000 69 Julkunen I, Sareneva T, Pirhonen J, Ronni T, Melen K, Matikainen S: Molecular pathogenesis of influenza A virus infection and virus-induced regulation of cytokine gene expression. Cytokine Growth Factor Rev 12: 171-180, 2001 70 Kim B, Ahn KK, Ha Y, Lee YH, Kim D, Lim JH, Kim SH, Ki m MY, Cho KD, Lee BH, Chae C: Association of tumor necrosis factor-alpha with fever and pulmonary lesion score in pigs experimentally in fected with swine influenza virus subtype H1N2. J Vet Med Sci 71: 611-616, 2009 71 Kim HM, Lee YW, Lee KJ, Kim HS, Cho SW, van Rooijen N, Guan Y, Seo SH: Alveolar macrophages are indispensable for controlling influenza viruses in lungs of pigs. J Virol, 2008

PAGE 140

140 72 Kindrachuk J, Potter J, Wilson HL, Gri ebel P, Babiuk LA, Napper S: Activation and regulation of toll-like re ceptor 9: CpGs and beyond. Mini Rev Med Chem 8: 590600, 2008 73 Kleinerman ES, Daniels CA, Polisson RP, Sn yderman R: Effect of virus infection on the inflammatory response. Depression of macrophage accumulation in influenzainfected mice. Am J Pathol 85: 373-382, 1976 74 Kontoyiannis D, Pasparakis M, Pizarro TT, Cominelli F, Kollias G: Impaired on/off regulation of TNF biosynthesis in mice lacking TNF AU-rich elements: implications for joint and gut-associated i mmunopathologies. Immunity 10: 387-398, 1999 75 Kothalawala H, Toussaint MJ, Gruys E: An overview of swine influenza. Vet Q 28: 46-53, 2006 76 Krishnan J, Selvarajoo K, Tsuchiya M, Lee G, Choi S: Toll-like receptor signal transduction. Exp Mol Med 39: 421-438, 2007 77 Lamb R, Krug RM: Orthom yxoviridae: the viruses and their replication. In : Fields Virology, eds. Knipe D, Howley P, DE G, La mb R, Martin M, Roizman BStraus SE, 4th ed., pp. 1487-1531. Lippincott Williams & Wilkins, Philadelphia, 2001 78 Larson HE, Parry RP, Tyrrell DA: Impaired polymorphonuclear leucocyte chemotaxis after influenza virus infection. Br J Dis Chest 74: 56-62, 1980 79 Lee DC, Cheung CY, Law AH, Mok CK, Pe iris M, Lau AS: p38 mitogen-activated protein kinase-dependent hyperinducti on of tumor necrosis factor alpha expression in response to avian influenza virus H5N1. J Virol 79: 10147-10154, 2005 80 Lee N, Wong CK, Chan PK, Lun SW, Lui G, Wong B, Hui DS, Lam CW, Cockram CS, Choi KW, Yeung AC, Tang JW, Sung JJ: Hypercytokinemia and hyperactivation of phospho-p38 mitogen-activated protein kinase in severe human influenza A virus infection. Clin Infect Dis 45: 723-731, 2007 81 Lee SM, Cheung CY, Nicholls JM, Hui KP, Leung CY, Uiprasertkul M, Tipoe GL, Lau YL, Poon LL, Ip NY, Guan Y, Peiris JS: Hyperinduction of cyclooxygenase-2mediated proinflammatory cascade: a me chanism for the pathogenesis of avian influenza H5N1 infection. J Infect Dis 198: 525-535, 2008 82 Lehmann C, Sprenger H, Nain M, Bacher M, Gemsa D: Infection of macrophages by influenza A virus: characteristics of tu mour necrosis factor-alpha (TNF alpha) gene expression. Res Virol 147: 123-130, 1996 83 Levandowski RA, Gerrity TR, Garrard CS: Modifi cations of lung clearance mechanisms by acute influenza A infection. J Lab Clin Med 106: 428-432, 1985

PAGE 141

141 84 Loo YM, Gale M, Jr.: Influenza: fata l immunity and the 1918 virus. Nature 445: 267268, 2007 85 Lopez A: Respiratory system. In : Pathologic Basis of Veterinary Disease, eds. McGavin MDZachary JF, 4 ed., p. 470. Mosby Elsevier, Missouri, 2006 86 Lowy RJ: Influenza virus induction of apoptosis by intrinsic and extrinsic mechanisms. Int Rev Immunol 22: 425-449, 2003 87 Lowy RJ, Dimitrov DS: Characterization of influenza virus-induced death of J774.1 macrophages. Exp Cell Res 234: 249-258, 1997 88 Lyon JA, Hinshaw VS: Replication of influenza A viruses in an avian macrophage cell line. J Gen Virol 72 ( Pt 8): 2011-2013, 1991 89 Maines TR, Szretter KJ, Perrone L, Belser JA, Bright RA, Zeng H, Tumpey TM, Katz JM: Pathogenesis of emerging avian infl uenza viruses in mammals and the host innate immune response. Immunol Rev 225: 68-84, 2008 90 Matikainen S, Pirhonen J, Miettinen M, Lehtonen A, Govenius-Vintola C, Sareneva T, Julkunen I: Influenza A and sendai vi ruses induce differential chemokine gene expression and transcription factor acti vation in human macrophages. Virology 276: 138-147, 2000 91 McAuley JL, Hornung F, Boyd KL, Smit h AM, McKeon R, Bennink J, Yewdell JW, McCullers JA: Expression of the 1918 in fluenza A virus PB1-F2 enhances the pathogenesis of viral and secondary bacteri al pneumonia. Cell Host Microbe 2: 240-249, 2007 92 McCullers JA: Insights into the interaction between influenza virus and pneumococcus. Clin Microbiol Rev 19: 571-582, 2006 93 McCullers JA, Bartmess KC: Role of neuraminidase in lethal synergism between influenza virus and Streptococcus pneumoniae. J Infect Dis 187: 1000-1009, 2003 94 McCullers JA, English BK: Improving ther apeutic strategies for secondary bacterial pneumonia following influenza. Future Microbiol 3: 397-404, 2008 95 McCullers JA, Rehg JE: Lethal synergism between influenza virus and Streptococcus pneumoniae: characterization of a mouse model and the role of platelet-activating factor receptor. J Infect Dis 186: 341-350, 2002 96 McGill J, Heusel JW, Legge KL: Innate immune control and regulation of influenza virus infections. J Leukoc Biol, 2009

PAGE 142

142 97 McKinney LC, Galliger SJ, Lowy RJ: Active and inactive influenza virus induction of tumor necrosis factor-alpha and nitric oxide in J774.1 murine macrophages: modulation by interferon-gamma and fa ilure to induce apoptosis. Virus Res 97: 117-126, 2003 98 McNamee LA, Harmsen AG: Both infl uenza-induced neutrophil dysfunction and neutrophil-independent mechanism s contribute to increased susceptibility to a secondary Streptococcus pneumoniae in fection. Infect Immun, 2006 99 Mok CK, Lee DC, Cheung CY, Peiris M, Lau AS: Differential onset of apoptosis in influenza A virus H5N1and H1N1-infected human blood macrophages. J Gen Virol 88: 1275-1280, 2007 100 Morens DM, Taubenberger JK, Fauci AS: Predominant role of bacterial pneumonia as a cause of death in pandemic influenza: implications for pandemic influenza preparedness. J Infect Dis 198: 962-970, 2008 101 Mukhopadhyay S, Hoidal JR, Mukherj ee TK: Role of TNFalpha in pulmonary pathophysiology. Respir Res 7: 125, 2006 102 Nain M, Hinder F, Gong JH, Schmidt A, Bender A, Sprenger H, Gemsa D: Tumor necrosis factor-alpha production of in fluenza A virus-infected macrophages and potentiating effect of lipopolysaccharides. J Immunol 145: 1921-1928, 1990 103 Nayak DP, Balogun RA, Yamada H, Zhou ZH, Barman S: Influenza virus morphogenesis and budding. Virus Res, 2009 104 Neumann G, Kawaoka Y: Host range restrict ion and pathogenicity in the context of influenza pandemic. Emerg Infect Dis 12: 881-886, 2006 105 Nickerson CL, Jakab GJ: Pulmonary antibacte rial defenses during mild and severe influenza virus infection. Infect Immun 58: 2809-2814, 1990 106 Nugent KM, Pesanti EL: Effect of influenza infection on the phagocytic and bactericidal activities of pul monary macrophages. Infect Immun 26: 651-657, 1979 107 Nugent KM, Pesanti EL: Staphylococcal clearance and pulmonary macrophage function during influenza in fection. Infect Immun 38: 1256-1262, 1982 108 Nugent KM, Pesanti EL: Tracheal func tion during influenza infections. Infect Immun 42: 1102-1108, 1983 109 O'Brien KL, Walters MI, Sellman J, Quin lisk P, Regnery H, Schw artz B, Dowell SF: Severe pneumococcal pneumonia in previ ously healthy children: the role of preceding influenza infection. Clin Infect Dis 30: 784-789, 2000

PAGE 143

143 110 Osman F, Jarrous N, Ben-Asouli Y, Kaem pfer R: A cis-acting element in the 3'untranslated region of hum an TNF-alpha mRNA renders splicing dependent on the activation of protein kinase PKR. Genes Dev 13: 3280-3293, 1999 111 Palese P, Shaw ML: Orthomyxoviridae : The Viruses and Their Replication. In : Fields Virology, eds. Knipe DHowley P, 5th ed., pp. 1647-1689. Lippincott Williams & Wilkins, Philadelphia, 2007 112 Payungporn S, Crawford PC, Kouo TS Chen LM, Pompey J, Castleman WL, Dubovi EJ, Katz JM, Donis RO: Influenza A virus (H3N8) in dogs with respiratory disease, Florida. Emerg Infect Dis 14: 902-908, 2008 113 Peeters D, Peters IR, Farnir F, Clerc x C, Day MJ: Real-tim e RT-PCR quantification of mRNA encoding cytokines and chemokin es in histologically normal canine nasal, bronchial and pulmonary ti ssue. Vet Immunol Immunopathol 104: 195-204, 2005 114 Peiris JS, Poon LM, Nicholls JM, G uan Y: The role of influenza virus gene constellation and viral morphology on cytokine induction, pathogenesis, and viral virulence. Hong Kong Med J 15: 21-23, 2009 115 Peltola VT, McCullers JA: Respiratory vi ruses predisposing to bacterial infections: role of neuraminidase. Pediatr Infect Dis J 23: S87-97, 2004 116 Peltola VT, Murti KG, McCullers JA: In fluenza virus neuraminidase contributes to secondary bacterial pneumonia. J Infect Dis 192: 249-257, 2005 117 Perrone LA, Plowden JK, Garcia-Sastre A, Katz JM, Tumpey TM: H5N1 and 1918 pandemic influenza virus infection results in early and excessive infiltration of macrophages and neutrophils in the lungs of mice. PLoS Pathog 4: e1000115, 2008 118 Peschke T, Bender A, Nain M, Gems a D: Role of macrophage cytokines in influenza A virus infe ctions. Immunobiology 189: 340-355, 1993 119 Pfaffl MW: A new mathematical model fo r relative quantification in real-time RTPCR. Nucleic Acids Res 29: e45, 2001 120 Pittet LA, Hall-Stoodley L, Rutkowski MR, Harmsen AG: Influenza Virus Infection Decreases Tracheal Mucociliary Velo city and Clearance of Streptococcus Pneumoniae. Am J Resp ir Cell Mol Biol, 2009 121 Plotkowski MC, Bajolet-Laudinat O, Puchelle E: Cellular and molecular mechanisms of bacterial adhesion to respiratory mucosa. Eur Respir J 6: 903-916, 1993

PAGE 144

144 122 Plotkowski MC, Puchelle E, Beck G, Jacquot J, Hannoun C: Adherence of type I Streptococcus pneumoniae to tracheal epithe lium of mice infected with influenza A/PR8 virus. Am Rev Respir Dis 134: 1040-1044, 1986 123 Powe JR, Castleman WL: Canine infl uenza virus replicates in alveolar macrophages and induces TNF-alpha. Vet Pathol Accepted for publication 2009 124 Raabe MR, Issel CJ, Montelaro RC: Equine monocyte-derived macrophage cultures and their applications for infect ivity and neutralization studies of equine infectious anemia virus. J Virol Methods 71: 87-104, 1998 125 Rahman MM, McFadden G: Modulation of tu mor necrosis factor by microbial pathogens. PLoS Pathog 2: e4, 2006 126 Reading PC, Miller JL, Anders EM: In volvement of the m annose receptor in infection of macrophages by influenza virus. J Virol 74: 5190-5197, 2000 127 Rodgers B, Mims CA: Interaction of influenza virus with mouse macrophages. Infect Immun 31: 751-757, 1981 128 Rodgers BC, Mims CA: Influenza virus r eplication in human alveolar macrophages. J Med Virol 9: 177-184, 1982 129 Salentin R, Gemsa D, Sprenger H, K aufmann A: Chemokine receptor expression and chemotactic responsiveness of human monocytes after influenza A virus infection. J Leukoc Biol 74: 252-259, 2003 130 Salomon R, Webster RG: The influenza virus enigma. Cell 136: 402-410, 2009 131 Scheid A, Choppin PW: Protease activati on mutants of sendai virus. Activation of biological properties by specific proteases. Virology 69: 265-277, 1976 132 Seki M, Yanagihara K, Higashiyama Y, Fukuda Y, Kaneko Y, Ohno H, Miyazaki Y, Hirakata Y, Tomono K, Kadota J, Tashiro T, Kohno S: Immunokinetics in severe pneumonia due to influenza virus and bacteria coinfection in mice. Eur Respir J 24: 143-149, 2004 133 Sellers TF, Jr., Schulman J, Bouvier C, Mc CR, Kilbourne ED: The influence of influenza virus infection on exoge nous staphylococcal and endogenous murine bacterial infection of the bronchopul monary tissues of mice. J Exp Med 114: 237256, 1961 134 Seo SH, Webby R, Webster RG: No ap optotic deaths and different levels of inductions of inflammatory cytokines in alveolar macrophages infected with influenza viruses. Virology 329: 270-279, 2004

PAGE 145

145 135 Shaw SE, Anderson NV: Isolation and f unctional analysis of normal canine blood monocytes and resident alveol ar macrophages. Am J Vet Res 45: 87-90, 1984 136 Simonsen L: The global impact of infl uenza on morbidity and mortality. Vaccine 17 Suppl 1: S3-10, 1999 137 Simonsen L, Clarke MJ, Williamson GD, Stroup DF, Arden NH, Schonberger LB: The impact of influenza epidemics on mortalit y: introducing a severity index. Am J Public Health 87: 1944-1950, 1997 138 Skinner SJ, Deleault KM, Fecteau R, Brooks SA: Extracellular signal-regulated kinase regulation of tumor necrosis fa ctor-alpha mRNA nucleocytoplasmic transport requires TAP-NxT1 binding and the AU-rich element. J Biol Chem 283: 3191-3199, 2008 139 Soergel SA, MacEwen EG, Vail DM, Potter DM, Sondel PM, Helfand SC: The immunotherapeutic potential of activa ted canine alveolar macrophages and antitumor monoclonal antibodies in metastatic c anine melanoma. J Immunother 22: 443-453, 1999 140 Song D, Kang B, Lee C, Jung K, Ha G, Kang D, Park S, Park B, Oh J: Transmission of avian influenza virus (H3N2) to dogs. Emerg Infect Dis 14: 741746, 2008 141 Songsermn T, Amonsin A, Jam-on R, S ae-Heng N, Meemak N, Pariyothorn N, Payungporn S, Theamboonlers A, Poovor awan Y: Avian influenza H5N1 in naturally infected domestic cat. Emerg Infect Dis 12: 681-683, 2006 142 Songsermn T, Amonsin A, Jam-on R, S ae-Heng N, Pariyothorn N, Payungporn S, Theamboonlers A, Chutinimitku S, T hanawongnuwech R, Poov orawan Y: Fatal Avian Influenza A H5N1 in a Dog. Emerg Infect Dis 12: 1744-1747, 2006 143 Sparwasser T, Miethke T, Lipford G, Erdmann A, Hacker H, Heeg K, Wagner H: Macrophages sense pathogens via DNA motifs : induction of tumo r necrosis factoralpha-mediated shock. Eur J Immunol 27: 1671-1679, 1997 144 Sprenger H, Meyer RG, Kaufmann A, Bussfeld D, Rischkowsky E, Gemsa D: Selective induction of monocyte and not neutrophil-attracting chemokines after influenza A virus infection. J Exp Med 184: 1191-1196, 1996 145 Stasakova J, Ferko B, Kittel C, Serein ig S, Romanova J, Katinger H, Egorov A: Influenza A mutant viruses with altered NS1 protein function provoke caspase-1 activation in primary human macrophages, re sulting in fast apoptosis and release of high levels of interleuk ins 1beta and 18. J Gen Virol 86: 185-195, 2005 146 Steinhauser ML, Hogaboam CM, Kunkel SL, Lukacs NW, Strieter RM, Standiford TJ: IL-10 is a major mediat or of sepsis-induced impairm ent in lung antibacterial host defense. J Immunol 162: 392-399, 1999

PAGE 146

146 147 Sun J, Madan R, Karp CL, Braciale TJ: Effector T cells control lung inflammation during acute influenza virus infection by producing IL-10. Nat Med 15: 277-284, 2009 148 Sun K, Metzger DW: Inhibition of pul monary antibacterial defense by interferongamma during recovery from influenza infection. Nat Med 14: 558-564, 2008 149 Takeuchi O, Hoshino K, Kawai T, Sanj o H, Takada H, Ogawa T, Takeda K, Akira S: Differential roles of TLR2 and TLR4 in recognition of gram-negative and grampositive bacterial cell wa ll components. Immunity 11: 443-451, 1999 150 Thompson WW, Shay DK, Weintraub E, Br ammer L, Cox N, Anderson LJ, Fukuda K: Mortality associated wit h influenza and respiratory sy ncytial virus in the United States. Jama 289: 179-186, 2003 151 To KF, Chan PK, Chan KF, Lee WK, Lam WY, Wong KF, Tang NL, Tsang DN, Sung RY, Buckley TA, Tam JS, Cheng AF: Pathology of fatal human infection associated with avian influenza A H5N1 virus. J Med Virol 63: 242-246, 2001 152 Tong HH, McIver MA, Fisher LM, DeMari a TF: Effect of lacto-N-neotetraose, asialoganglioside-GM1 and neuraminidase on adherence of otitis mediaassociated serotypes of Streptoco ccus pneumoniae to chinchilla tracheal epithelium. Microb Pathog 26: 111-119, 1999 153 Tsai EY, Falvo JV, Tsytsykova AV, Bar czak AK, Reimold AM, Glimcher LH, Fenton MJ, Gordon DC, Dunn IF, Goldfeld AE: A lipopolysaccharide-specific enhancer complex involving Ets, El k-1, Sp1, and CREB binding pr otein and p300 is recruited to the tumor necrosis factor alpha promoter in vivo. Mol Cell Biol 20: 6084-6094, 2000 154 Tumpey TM, Garcia-Sastre A, Taubenber ger JK, Palese P, Swayne DE, PantinJackwood MJ, Schultz-Cherry S, Solorzano A, Van Rooijen N, Katz JM, Basler CF: Pathogenicity of influenza viruses with genes from the 1918 pandemic virus: functional roles of alveolar macrophages and neutrophils in limiting virus replication and mortality in mice. J Virol 79: 14933-14944, 2005 155 van der Flier M, Chhun N, Wizemann TM, Min J, McCarthy JB, Tuomanen EI: Adherence of Streptococcus pneumoniae to immobilized fibronectin. Infect Immun 63: 4317-4322, 1995 156 van der Poll T, Marchant A, Keogh CV Goldman M, Lowry SF: Interleukin-10 impairs host defense in murine pneumococcal pneumonia. J Infect Dis 174: 9941000, 1996

PAGE 147

147 157 van der Sluijs KF, van Elden LJ, Nijhui s M, Schuurman R, Florquin S, Shimizu T, Ishii S, Jansen HM, Lutter R, van der Poll T: Involvement of the platelet-activating factor receptor in host defense agai nst Streptococcus pneumoniae during postinfluenza pneumonia. Am J Physiol Lung Cell Mol Physiol 290: L194-199, 2006 158 van der Sluijs KF, van Elden LJ, Nijhui s M, Schuurman R, Pater JM, Florquin S, Goldman M, Jansen HM, Lutter R, van der Poll T: IL-10 is an important mediator of the enhanced susceptibility to pneumococca l pneumonia after influenza infection. J Immunol 172: 7603-7609, 2004 159 van Maanen C, Cullinane A: Equine infl uenza virus infections: an update. Vet Q 24: 79-94, 2002 160 Warshauer D, Goldstein E, Akers T, Lipper t W, Kim M: Effect of influenza viral infection on the ingestion and killing of bacteria by alveolar macrophages. Am Rev Respir Dis 115: 269-277, 1977 161 Webster RG, Bean WJ, Gorman OT, C hambers TM, Kawaoka Y: Evolution and ecology of influenza A viruses. Microbiol Rev 56: 152-179, 1992 162 Wellman ML, Krakowka S, Jacobs RM, Kociba GJ: A macrophage-monocyte cell line from a dog with malignant histiocyt osis. In Vitro Cell Dev Biol 24: 223-229, 1988 163 Willoughby R, Ecker G, McKee S, Riddolls L, Vernaillen C, Dubovi E, Lein D, Mahony JB, Chernesky M, Nagy E, et al .: The effects of equine rhinovirus, influenza virus and herpesvirus infection on tr acheal clearance rate in horses. Can J Vet Res 56: 115-121, 1992 164 Wilson WD: Equine influenza. Vet Clin North Am Equine Pract 9: 257-282, 1993 165 Wise HM, Foeglein A, Sun J, Dalton RM, Patel S, Howard W, Anderson EC, Barclay WS, Digard P: A complicated me ssage: identification of a novel PB1related protein translated from infl uenza A segment 2 mRNA. J Virol, 2009 166 Wright PF, Neumann G, Kawaoka Y: Orthomyxoviruses. In : Fields Virology, ed. Knipe D, Howley, PM, 5th ed., pp. 16911740. Lippincott Williams & Wilkins, Philadelphia, 2007 167 Yamanaka T, Nemoto M, Tsujimura K, Kondo T, Matsumura T: Interspecies transmission of equine influenza virus (H 3N8) to dogs by close contact with experimentally infected horses. Vet Microbiol : doi:10.1016/j.vetm ic.2009.1006.1015, 2009 168 Yoon KJ, Cooper VL, Schwartz KJ, Harmon KM, Kim WI, Janke BH, Strohbehn J, Butts D, Troutman J: Influenza virus infe ction in racing greyhounds. Emerg Infect Dis 11: 1974-1976, 2005

PAGE 148

148 169 Zamarin D, Garcia-Sastre A, Xiao X, Wang R, Palese P: Influenza virus PB1-F2 protein induces cell death through mitoc hondrial ANT3 and VDAC1. PLoS Pathog 1: e4, 2005 170 Zell R, Krumbholz A, Eitner A, Krieg R, Halbhuber KJ, Wutzle r P: Prevalence of PB1-F2 of influenza A viruses. J Gen Virol 88: 536-546, 2007

PAGE 149

149 BIOGRAPHICAL SKETCH Joshua Powe was born and raised in Sydne y, Australia. He earned his veterinary degree from the University of Sydney, graduating in 1998. After working for 3 years as a mixed practice veterinarian in rural Victor ia and New South Wales, Joshua returned to the University of Sydney in 2002 to earn his Master of Veterinary Studies degree, majoring in Veterinary Pathology. He cont inued his pathology training in the residency program at the University of Florida, College of Vete rinary Medicine beginning mid 2003. He became a Diplomate of the American College of Ve terinary Pathologists in 2006.