<%BANNER%>

Floral Fragrance Production Is a Specialized Process

Permanent Link: http://ufdc.ufl.edu/UFE0025170/00001

Material Information

Title: Floral Fragrance Production Is a Specialized Process
Physical Description: 1 online resource (113 p.)
Language: english
Creator: Colquhoun, Thomas
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: benzenoid, chorismate, flower, myb, petunia, phenylalanine, phenylpropanoid, regulation, transcription, volatile
Plant Molecular and Cellular Biology -- Dissertations, Academic -- UF
Genre: Plant Molecular and Cellular Biology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy FLORAL FRAGRANCE PRODUCTION IS A SPECIALIZED PROCESS By Thomas Angus Colquhoun December 2009 Chair: David G. Clark Major: Plant Molecular and Cellular Biology (PMCB) Floral fragrance is an integral factor for many angiosperm species interacting with an environment. Individual fragrant flowering species emit specific mixtures and combinations of volatile organic compounds, which can function in various aspects of plant biology. Petunia x hybrida cv Mitchell Diploid (MD) has large white flowers that emit floral volatile benzenoid/phenylpropanoid (FVBP) compounds in a controlled manner. FVBP emission is confined to the corolla limb tissue, from anthesis to senescence, in a rhythmic pattern where peak FVBP emission is nocturnal. The object of this study was to investigate molecular, biochemical, and metabolic aspects of regulation committed to FVBP production in petunia. Therefore, seven MD genes previously identified as necessary for differential aspects of FVBP production were assayed for coordinate transcriptional regulation. The transcript accumulation assay resulted in similar transcript accumulation profiles for all FVBP genes examined in three out of four categories. Together with previous characterizations, these results indicate that the FVBP genes are a part of a specific group, which is involved in a specific enterprise. Utilizing the transcript accumulation screen and focusing further research on candidate genes whose transcript profiles were similar to known FVBP profiles, PhCM1 and PhMYB5d8 were identified. PhCM1 encodes a plastid localized CHORISMATE MUTASE (CM) isoform that catalyzes the initial committed step in phenylalanine biosynthesis and is the major CM isoform involved in FVBP production. While characterizing PhCM1, PhCM2 was identified as a cytosolic CM isoform, but the transcript accumulation profile was not consistent with FVBP gene profiles and the cytosolic localization separated PhCM2 from pathway proteins and metabolites. Lastly, PhMYB5d8 encodes an R2R3-MYB transcriptional regulator that contains a C-terminal EAR-domain. A reverse genetic approach suggests that PhMYB5d8 negatively regulates CINNAMATE-4-HYDROXYLASE transcript accumulation in the corollas of open petunia flowers. In short, a simple and cost-effective molecular screen was designed to assay candidate genes for a possible involvement in FVBP production. Two genes were identified and empirically shown to be involved in FVBP production. That is, a biosynthetic enzyme which directs metabolite flux to phenylalanine production and a transcriptional regulator managing transcript levels of a biosynthetic enzyme downstream of phenylalanine.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Thomas Colquhoun.
Thesis: Thesis (Ph.D.)--University of Florida, 2009.
Local: Adviser: Clark, David G.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0025170:00001

Permanent Link: http://ufdc.ufl.edu/UFE0025170/00001

Material Information

Title: Floral Fragrance Production Is a Specialized Process
Physical Description: 1 online resource (113 p.)
Language: english
Creator: Colquhoun, Thomas
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: benzenoid, chorismate, flower, myb, petunia, phenylalanine, phenylpropanoid, regulation, transcription, volatile
Plant Molecular and Cellular Biology -- Dissertations, Academic -- UF
Genre: Plant Molecular and Cellular Biology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy FLORAL FRAGRANCE PRODUCTION IS A SPECIALIZED PROCESS By Thomas Angus Colquhoun December 2009 Chair: David G. Clark Major: Plant Molecular and Cellular Biology (PMCB) Floral fragrance is an integral factor for many angiosperm species interacting with an environment. Individual fragrant flowering species emit specific mixtures and combinations of volatile organic compounds, which can function in various aspects of plant biology. Petunia x hybrida cv Mitchell Diploid (MD) has large white flowers that emit floral volatile benzenoid/phenylpropanoid (FVBP) compounds in a controlled manner. FVBP emission is confined to the corolla limb tissue, from anthesis to senescence, in a rhythmic pattern where peak FVBP emission is nocturnal. The object of this study was to investigate molecular, biochemical, and metabolic aspects of regulation committed to FVBP production in petunia. Therefore, seven MD genes previously identified as necessary for differential aspects of FVBP production were assayed for coordinate transcriptional regulation. The transcript accumulation assay resulted in similar transcript accumulation profiles for all FVBP genes examined in three out of four categories. Together with previous characterizations, these results indicate that the FVBP genes are a part of a specific group, which is involved in a specific enterprise. Utilizing the transcript accumulation screen and focusing further research on candidate genes whose transcript profiles were similar to known FVBP profiles, PhCM1 and PhMYB5d8 were identified. PhCM1 encodes a plastid localized CHORISMATE MUTASE (CM) isoform that catalyzes the initial committed step in phenylalanine biosynthesis and is the major CM isoform involved in FVBP production. While characterizing PhCM1, PhCM2 was identified as a cytosolic CM isoform, but the transcript accumulation profile was not consistent with FVBP gene profiles and the cytosolic localization separated PhCM2 from pathway proteins and metabolites. Lastly, PhMYB5d8 encodes an R2R3-MYB transcriptional regulator that contains a C-terminal EAR-domain. A reverse genetic approach suggests that PhMYB5d8 negatively regulates CINNAMATE-4-HYDROXYLASE transcript accumulation in the corollas of open petunia flowers. In short, a simple and cost-effective molecular screen was designed to assay candidate genes for a possible involvement in FVBP production. Two genes were identified and empirically shown to be involved in FVBP production. That is, a biosynthetic enzyme which directs metabolite flux to phenylalanine production and a transcriptional regulator managing transcript levels of a biosynthetic enzyme downstream of phenylalanine.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Thomas Colquhoun.
Thesis: Thesis (Ph.D.)--University of Florida, 2009.
Local: Adviser: Clark, David G.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0025170:00001


This item has the following downloads:


Full Text

PAGE 1

1 FLORAL FRAGRANCE PRODUCTION IS A SPECIALIZED PROCESS By THOMAS ANGUS COLQUHOUN A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2009

PAGE 2

2 2009 Thomas Angus Colquhoun

PAGE 3

3 To everyone who believed this work possible

PAGE 4

4 ACKNOWLEDGEMENTS I would like to thank my Ph.D. Committee for their patience and guidance. Special appreciation goes to my advisor, Dr. David Clark, for his ability to see past an occasional display of youthful exuberance. Dr. Harry Klee is recognized for his critical reviews of written work prior to peer reviewed journal submissions. Additionally, unique gratitude goes to Dr. Kenneth Cline for his interest in and assistance with a particular section of study presented in this work.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGEMENTS ................................................................................................ 4 LIST OF TABLES ............................................................................................................. 7 LIST OF FIGURES ........................................................................................................... 8 CHAPTER 1 INTRODUCTION AND LITERATURE REVIEW ...................................................... 12 Introduction .............................................................................................................. 12 Floral Fragrance ........................................................................................................ 13 Chemical Composition of Floral Fragrance .................................................................. 15 Petunia x hybrida cv Mitchell Diploid ...................................................................... 16 MD FVBPs ............................................................................................................... 17 Regulation of FVBP Emission in MD .......................................................................... 18 Ethylene Signaling Pathway ....................................................................................... 18 FVBP Genetics and Biochemistry ............................................................................... 21 CHORISMATE MUTASE ......................................................................................... 24 R2R3 MYB Transcriptional Regulators ....................................................................... 26 Research Objectives .................................................................................................. 27 2 PETUNIA FLORAL VOLATILE BENZENOID/PHENYLPROPANOID GENES ARE REGULATED IN A SIMILAR MANNER .................................................................. 29 Preface ..................................................................................................................... 29 I ntroduction .............................................................................................................. 29 Results ..................................................................................................................... 32 Spatial FVBP G ene E xpression A nalysis in MD P lants ........................................... 32 Developmental FVBP G ene E xpression A nalysis in MD and 44568 F lowers ............ 33 Volatile E mission t hroughout D evelopment F rom MD and 44568 F lowers ............... 34 Ethylene D ependent D own R egulation of FVBP G ene E xpression ........................... 35 Volatile E mission a fter E xogenous E thylene T reatment .......................................... 35 Rhythmic R egulation of FVBP G ene E xpression in MD F l owers ............................. 36 PhPAAS A ctivity in MD F lowers ......................................................................... 37 Discussion ................................................................................................................ 37 Experimental Procedures ............................................................................................ 42 Plant M aterials .................................................................................................... 42 Expression S eries C onstruction ............................................................................ 43 Gene E xpression A nalysis .................................................................................... 44 Floral V olatile E xperiments and E mitted V olatile Q uantification ............................. 45 Determination of PAAS Activity in Limb Crude Protein Extract .............................. 46 Floral L ongevity S ubsequent to E thylene A pplication in MD and 44568 F lowers ...... 47

PAGE 6

6 Acknowledgements ................................................................................................... 47 3 A SPECIALIZED CHORISMATE MUTASE IN THE FLOWER OF PETUNIA X HYBRIDA ............................................................................................................... 57 Preface ..................................................................................................................... 57 Introduction .............................................................................................................. 57 Results ..................................................................................................................... 59 I dentification of T wo D istinct CM cDNAs ............................................................ 59 Chloroplast I mport A ssay .................................................................................... 60 PhCM1 and PhCM2 T ranscript A bundance A nalysis .............................................. 61 Total CM A ctivity in P etunia F l owers ................................................................... 62 Functional C omplementation and R ecombinant E nzyme A ctivity of PhCM1 and PhCM2 ........................................................................................................... 62 Suppression of PhCM1 by RNAi .......................................................................... 63 Discussion ................................................................................................................ 65 Experimental Procedures ............................................................................................ 69 Plant M aterials .................................................................................................... 69 cDNA I solation ................................................................................................... 69 Transcript A ccumulation A nalysis ........................................................................ 70 Protein E xtraction, O verproduction, and P urification .............................................. 71 Chorismate Mutase E nzyme A ctivity A ssays ......................................................... 72 Chloroplast I mport A ssay .................................................................................... 72 Volatile E mission ................................................................................................ 73 Generation of PhCM1 RNAi T ransgenic P etun ia .................................................... 73 Acknowledgements ................................................................................................... 73 4 PhMYB5D8 EFFECTS PhC4H TRANSCRIPTION IN THE PETUNIA COROLLA ....... 88 Introduction .............................................................................................................. 88 Results ..................................................................................................................... 90 Identification of PhMYB5d8 ................................................................................. 90 PhMYB5d8 T ranscript A bundance A nalysis .......................................................... 91 Suppression of PhMYB5d8 by RNAi ..................................................................... 92 Discussion ................................................................................................................ 93 Experimental Procedures ............................................................................................ 96 Plant M aterials .................................................................................................... 96 Generation of PhMYB5d8 RNAi T ransge nic P etunia .............................................. 96 Transcript A ccumulation A nalysis ........................................................................ 96 Volatile E mission ................................................................................................ 98 Acknowledgements ................................................................................................... 98 LIST OF REFERENCES ................................................................................................ 104 BIOGRAPHICAL SKETCH ........................................................................................... 113

PAGE 7

7 LIST OF TABLES Tabl e page 31 Functional complementation of CM deficient E. coli KA12/pKIMP UAUC.. .................75 32 Gene specific primers used for t he transcript accumulation analyses. ..............................76

PAGE 8

8 LIST OF FIGURES Figure page 11 The floral volatile benzenoid/phenylpropanoid pathway.. ................................................28 21 Tissue specific transcript accumulation analysis of seven FVBP genes in MD. ...............48 22 Picture of floral stages used for the developmental studi es in MD and 44568.. ................49 23 Developmental transcript accumulation analysis of seven FVBP genes in MD and 44568..................................................................................................................................50 24 qRT PCR t ranscript accumulation analysis of PhPAAS and PhCFAT in petunia.. ...........51 25 Developmental floral emission analysis of major volatile compounds from MD and 44568 flowers. ....................................................................................................................53 26 Transcript accumulation analysis of seven FVBP genes in MD flowers and 44568 flowers.. ..............................................................................................................................53 27 Picture of MD and 44568 flowers 32 hours after the i nitial treatments of ethylene. .........54 28 Emission analysis of major volatile compounds from MD and 44568 flowers subsequent to differential durations of ethylene exposure .................................................55 29 Rhythmic transcript accumulation analysis of seven FVBP genes in MD.. ......................56 210 Rhythmic analysis of PhPAAS activity in corolla limb tissue of MD f lowers. .................56 31 Aromatic amino acid biosynthesis pathway. .....................................................................77 32 PhCM1 and PhCM2 CDS alignment .................................................................................78 33 Predicted peptide sequence alignment and an unrooted neighbor joining phylogenetic tree of CM proteins from various species.. ..................................................79 34 Plastid import assay. ..........................................................................................................80 35 sqRT PCR transcript accumulation analysis of PhCM1 and PhCM2 in petunia.. .............81 36 qRT PCR transcript accumulation analysis of PhCM1 and PhCM2 in petunia. ...............82 37 Total CM activity in desalted crude protein extracts from MD whole corollas ................83 38 Enzyme activity of and effects of aromatic amino acids on petunia CMs. ........................83 39 Schematic representation and nucleotide comparison of RNAi region used for the production of petunia PhCM1 RNAi transgen ic lines.. .....................................................83

PAGE 9

9 310 sqRT PCR transcript accumulation analysis in floral tissues of three independent T1 PhCM1 RNAi lines. ...........................................................................................................84 311 Floral volatile emission analysis from three independent T1 PhCM1 RNAi lines ............85 312 sqRT PCR transcript accumulation analysis in floral tissues of two independent, homozygous T2 PhCM1 RNAi l ines. .................................................................................85 313 Comparative transcript analysis and total CM activity between MD and representative individuals from independent homozygous T2 PhCM1 RNAi lines ..........86 314 Physiological comparison between MD and representative independent T2 PhCM1 homozygous RNAi lines ....................................................................................................87 315 Stem cross sections (between 7 8 node from apica l meristem) from 9 week old petunias stained with Phlorogucinol.. ................................................................................87 41 Predicted peptide sequence alignment of homologous R2R3MYB proteins from various species. ..................................................................................................................99 42 An unrooted neighbor joining phylogenetic tree of homologous R2R3MYB proteins from various species.. ......................................................................................................100 43 PhMYB5d8 transcript accumulation analys is (sqRT PCR).. ...........................................101 44 PhMYB5d8 cDNA model with the RNAi region used for the production of petunia PhMYB5d8 RNAi transgenic lines.. .................................................................................101 45 sqRT PCR transcript accumulation analysis in floral tissues of independent T0 PhMYB5d8RNAi lines and MD plants. ..........................................................................101 46 Floral volatile emission analysis from five independent T0 PhMYB5d8 RNAi lines .....102 47 Schematic model of the FVBP pathway in petunia. ........................................................103

PAGE 10

10 Abstract of Dissertation Presented to the Graduate School of the Unive rsity of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy FLORAL FRAGRANCE PRODUCTION IS A SPECIALIZED PROCESS By Thomas Angus Colquhoun December 2009 Chair: David G. Clark Major : Plant Molecular and C ellular Biology (PMCB) Floral fragrance is an integral factor for many angiosperm species interacting with an environment. Individual fragrant flowering species emit specific mixtures and combinations of volatile organic compounds, which can function in various aspects of plant biology. Petunia x hybrida cv Mitchell Diploid (MD) has large white flowers that emit floral volatile benzenoid/phenylpropanoid (FVBP) compounds in a controlled manner. FVBP emission is confined to the corolla limb tissue, from anthesis to senescence, in a rhythmic pattern where peak FVBP emission is nocturnal. The object of this study was to investigate molecular, biochemical, and metabolic aspects of regulation committed to FVBP production in petunia. Therefore, seven MD genes previously identified as necessary for differential aspects of FVBP production were assayed for coordinate transcriptional regulation. The transcript accumulation assay resulted in similar transcript accumulation profiles for all FVBP genes examined in thr ee out of four categories. Together with previous characterizations, these results indicate that the FVBP genes are a part of a specific group, which is involved in a specific enterprise. Utilizing the transcript accumulation screen and focusing further re search on candidate genes whose transcript profiles were similar to known FVBP profiles, PhCM1 and PhMYB5d8 were identified. PhCM1 encodes a plastid localized CHORISMATE MUTASE (CM) isoform that catalyzes the initial committed

PAGE 11

11 step in phenylalanine biosynt hesis and is the major CM isoform involved in FVBP production. While characterizing PhCM1 PhCM2 was identified as a cytosolic CM isoform, but the transcript accumulation profile was not consistent with FVBP gene profiles and the cytosolic localization sep arated PhCM2 from pathway proteins and metabolites. Lastly, PhMYB5d8 encodes an R2R3MYB transcriptional regulator that contains a C terminal EAR domain. A reverse genetic approach suggests that PhMYB5d8 negatively regulates CINNAMATE 4HYDROXYLASE transcr ipt accumulation in the corollas of open petunia flowers. In short, a simple and cost effective molecular screen was designed to assay candidate genes for a possible involvement in FVBP production. Two genes were identified and empirically shown to be involved in FVBP production. That is, a biosynthetic enzyme which directs metabolite flux to phenylalanine production and a transcriptional regulator managing transcript levels of a biosynthetic enzyme downstream of phenylalanine.

PAGE 12

12 CHAPTER 1 INTRODUCTION AND LITERATURE REVIE W Introduction Floral fragrance is a mixture of volatile organic compounds (VOCs) synthesized and emitted by many angiosperm species. The precise composition of volatile compounds emitted is particular to an individual species and is commonly referred to as a scent bouquet. Floral volatile compounds serve multiple roles in the reproductive strategy of many angiosperms. Many fragrant angiosperm species commit to large metabolic expenditures in the production of floral volatile compounds; thus, a specific and complex regulation imparted upon overall volatile production may be common. Therefore, the fundamental goal of this research was to achieve a deeper understanding of the regulation imparted upon the production of FVBPs in order to aid in the successful genetic engineering of a favorable floral fragrance for the commercial market. Here we examined the detailed transcript accumulation profiles of known petunia floral volatile benzenoid/phenylpropanoid (FVBP) genes, which allowed the grouping of these genes into a floral volatile network based on similar transcript accumulation profiles and related protein functions. For example, the effect of ethylene on transcript accumulation of the FVBP gene network was coordinate and reversible in a ti me dependent manner. We then utilized the similar transcript profiles of the FVBP genes to compare and infer possible functions of unknown petunia genes, which resulted in two candidate genes with similar transcript accumulation profiles, PhCM1 and PhMYB5d 8. Through molecular, biochemical, and metabolic approaches data was generated that suggest both novel petunia genes are involved in FVBP production. PhCM1 encodes a plastid localized CHORISMATE MUTASE (CM) isoform that catalyzes the initial committed step in phenylalanine biosynthesis. PhCM1 is the principal CM involved in FVBP synthesis in petunia flowers. PhMYB5d8 encodes an R2R3MYB transcriptional regulator

PAGE 13

13 that contains a C terminal EAR domain and is highly similar to AtMYB4. PhMYB5d8 negatively regul ates CINNAMATE 4HYDROXYLASE transcript abundance and indirectly regulates a subset of FVBP emission in petunia. In conclusion, this study produced a transcript accumulation screen for new petunia genes possibly involved in FVBP synthesis and/or regulation the identification of two novel genes involved in FVBP production, and numerous insights into FVBP biosynthesis regulation in conjunction with new aspects of regulatory control capable of genetic manipulation. Floral Fragrance In a natural environment, all of biology is governed by selective pressures to maximize reproductive successes. Floral VOCs can serve multiple and diverse roles in the reproductive strategy of many angiosperms; such as, antifeedant, antimicrobial, antifungal, and pollinator attract ion (reviewed in Dudareva et al., 2006). The latter role (pollinator attraction) can consist of a signal (floral fragrance) and a reward (nectar and/or pollen), and is an attribute of a pollination syndrome. A pollination syndrome is characterized in part by flower morphology, color, fragrance, and nectar production with a result in an increased specialization of the floral phenotype aimed at the attraction of potential pollinators (Fenster et al., 2004) Thus, a mechanism to attract a functional pollinator can equip a sessile plant species with a means to improve the nonself pollen grain to stigma interaction in the appropriate environment. The pollina tion syndrome does not imply a specific species of pollinator exclusively visits a specific species of plant; instead, pollinators are divided into functional groups or types such as by size, mode of nectar intake, and/or activity. Therefore, the perpetual evolution of the pollination syndrome can be molded by those pollinators that visit the flower most frequently and effectively in a region where the plant is evolving (Fenster et al., 2004).

PAGE 14

14 As a straightforward example, Petunia axillaris and Petunia inte grifolia flower morphology and biochemistry are consistent with a pollination syndrome hypothesis. P. axillaris has slender, white flowers and initiates the production of floral VOCs at dusk coinciding with the visitation of hawk moths ( Manduca sexta ) duri ng the night (Hoballah et al., 2005) In contrast, P. integrifolia has broadbased, purple flowers, which do not produce floral volatiles, and are visited throughout the day primarily by bees. Meanwhile, they grow together in nature yet generally do not produce hybrids even though they are fully cross compatible (Ando et al., 2001) In contrast to the simple example above, pollinator attraction by floral fragrance can be a complex associative process. Numerous variables underlie the association between a signal and a reward, to reference a few: distance, temporal factors, competitors, perception of the signal, quantity of signal produced, quality of signal, impact of reward, and availability of reward. Therefore, until basic science can empirically test all attributes of pollinator attraction individually, additively, and across numerous genetic bac kgrounds the general focus will remain identifying a single feature of pollinator attraction. However, floral fragrance is not only important to biological organisms in a natural environment, but flowers themselves are treasured by humans for the beauti ful colors, structures, and fragrances. In fact for 2005, wholesale value of floriculture crops topped 5.4 billion US dollars in 36 states surveyed (USDA NASS, 2006: www.nass.usda.gov). Floriculture crops comprise cut flowers, cut cultivated greens, foliage plants, bedding and garden plants, flowering plants, and propagative materials. Societal examples of the demand for flowering plants and their VOCs are perfumes (e.g. Coco Chanel, Bvlgari, and Versace) and the many psychological

PAGE 15

15 effects of receiving bouq uet of flowers as a present (e.g. a dozen cut red roses for Valentines Day or a mix of carnations, lilies, and daisies for an anniversary). As solitary compounds the phenylpropanoids, eugenol and isoeugenol significantly limit colony forming abilities of a number of bacteria including Campylobacter jejuni Escherichia coli Listeria monocytogenes Salmonella enteric, Salmonella typhimurium (Friedman et al., 2002). At relatively low concentrations, eugenol added to medium reduced fungal growth of Botrytis fabae by approximately 73 % (Oxenham et al., 2005). Multiple floral VOCs have been implicated in plant defense; however, the biological importance of these compounds with respect to plant defense is still unclear since a direct relationship has yet to be e stablished between a volatile compound emitted from floral tissue and a reduction of microorganismal growth on floral tissue. For a short review refer to Pichersky and Gershenzon, 2002. Chemical Composition of Floral Fragrance Fragrance is defined as the q uality of hav ing a sweet and pleasant scent (www.dictionary.com). The classic example is that of a rose. By typing scent AND rose into the Google search engine, over five million results are available. Conceptualizing fragrance may be relatively easy, but when each aspect of fragrance is investigated further, a very complex and dynamic association is revealed. Fragrant angiosperm species may emit from one to 100 individual VOCs (Knudsen and Gershenzon, 2006). To begin, floral fragrance is composed of VOCs, which are generally lipophilic liquids with high vapor pressures and low molecular weights (Pichersky and Dudareva, 2000). When no barriers to diffusion exist, nonconjugated forms of VOCs can cross biological membranes freely (Dudareva et al., 2004). The floral VOC s are commonly separated into three main categories: benzenoids/phenylpropanoids, fatty acid derivatives, and terpenoids. Additionally, carotenoid derivative, nitrogen containing and sulfur containing floral VOCs have been identified (Knudsen et al., 1993; Simkin et al., 2004).

PAGE 16

16 Phenylpropanoids represent the largest pool of secondary metabolites (Peters, 2007), and more than 7000 phenylpropanoid compounds have been documented in plants (Wink, 2003). For obvious reasons, FVBP compounds define a large class of structurally diverse VOCs (ex. methyl benzoate and isoeugenol). FVBP compounds are putatively derived from the aromatic amino acid L phenylalanine (Phe) [Boatright et al., 2004], which is synthesized in the plastid from metabolites originating in the shi kimate pathway (Rippert et al., 2009). The characteristic benzene ring (derived from Phe) can be modified and adorned with multiple and varying side groups. Specifically, benzenoids and phenylpropanoids have carbon side chains consisting of one to three ca rbon molecules (C6C1, C6C2, and C6C3). Fatty acid derived VOCs are saturated and unsaturated hydrocarbons. Volatile fatty acid derivatives are produced from the breakdown of C18 unsaturated fatty acids, primarily linolenic and linoleic acids, and include an assorted group of volatiles including green leaf volatiles and methyl jasmonate (Wasternack et al., 2002; Matsui, 2006). Fatty acid derived VOCs appear to be synthesized in membranous structures of plant cells (Hudak and Thompson, 1997). Terpenoids are derived from isopentyl diphosphate and dimethylallyl diphosphate. Terpenoids are produced through two alternative pathways, the cytosolic mevalonic acid pathway and the plastidic methyl erythritol pathway (Newman and Chappell, 1999; Rohmer et al., 1999). Terpenoids are subdivided into five classes based on structure: hemiterpenes (C5), monoterpenes (C10), sesquiterpenes (C15), homoterpenes (C11C16), and diterpenes (C20). Petunia x hybrida cv Mitchell Diploid Petunia is a Solanaceae family member an d the genus consists of approximately 30 species. Petunia has been used as a model system for a number of varying topics, like flavonoid synthesis, floral development, transposons, epigenetics, VOCs, and senescence (Gerats and Vandenbussche, 2005). Within the last decade, P. x hybrida cv Mitchell Diploid (MD) has

PAGE 17

17 become an indispensable model system for floral volatile studies. MD was identified from an individual haploid plant with high regeneration potential derived from a plant selected among the proge ny of a P. axillaris x ( P. axillaris x P. hybrida Rose du Ciel) backcross (Mitchell et al., 1980). W hen this haploid plant was grown in tissue culture, doubling of the chromosomes was observed and resulted in a fertile, homozygous diploid line with no va riation observed between the two sets of chromosomes ( Griesbach and Kamo, 1996). MD was used in many of the fundamental experiments in plant transformation (Fraley et al., 1983; Horsch et al., 1985; Deroles and Gardner, 1988a, b) and subsequently, a well e stablished transformation protocol exists ( Jorgenson et al., 1996) Additionally, MD has a relatively short lifecycle, produces large quantities of floral VOCs, develops numerous large flowers per plant, has a vigorous growth habit, participates in ethylen e induced floral senescence, and an ethylene insensitive transgenic petunia line 44568 ( CaMV 35S :etr1 1) is available (Wilkinson et al., 1997). MD FVBPs Benzenoids and phenylpropanoids constitute the majority of the VOCs emitted by the MD flower (Kolosova et al., 2001a; Verdonk et al., 2003; Boatright et al., 2004; U nderwood et al., 2005; Verdonk et al., 2005; Koeduka et al., 2006) In MD the FVBP compounds are putatively synthesized de novo (Pare and Tumlinson, 1997; Verdonk et al., 2003; Pichersky et al., 2006) and subsequent to synthesis, these compounds are emitted from epidermal cells of the corolla limb (Kolosova et al., 2001b; Underwood et al., 2005; Verdonk et al., 2005) MD flowers predominantly emit 13 FVBPs: benzaldehyde (Bald), benzyl acetate (BeAc) benzyl alcohol (BOH), benzyl benzoate (BeBA), methyl benzoate (MeBA), methyl salicylate (MeSA), phenylacetaldehyde (PAA), 2 phenylethyl acetate (2 PhAc), phenylethyl alcohol (2POH), phenylethyl benzoate (PhBA), eugenol (EG), isoeugenol (IE), and vanilli n (Figure 1 1) [Kolosova et al., 2001a; Verdonk et al., 2003; Boatright et al., 2004; Verdonk et al., 2005;

PAGE 18

18 Koeduka et al., 2006] Minor components of MD total floral VOCs include two sesquiterpenes (germacene D and cadina 3,9diene), two aliphatic aldehydes (decanal and dodecanal), an ionone), and two fatty acid derivati ves ( cis 3hexenal and trans 2hexanal) [Verdonk et al., 2003; Boatright et al., 2004; Simkin et al., 2004]. Regulation of FVBP Emission in MD The production of floral VOCs could be a metabolically expensive enterprise for angiosperm species. The biosynthesis of FVBP compounds requires proteins, metabolites, energy, and multiple cofactors. Therefore, a complex regulation imparted upon FVBP production, to possibly optimize the ratio between physical cost and reproductive benefit, is evolutionarily straightf orward. Substantial emission of MD FVBPs is confined to the corolla limb tissue during open flower stages of development, which coincides with the presentation of the reproductive organs (Verdonk et al., 2003; Underwood et al., 2005). MD FVBP internal meta bolite pool accumulation and emission is nocturnal with the highest level detected between 22:00 and 1:00 h (Kolo sova et al., 2001a; Verdonk et al., 2003; Underwood et al., 2005; Verdonk et al., 2005; Orlova et al., 2006) FVBP emission is greatly reduced following a successful pollination/fertilization event or exogenous treatment with ethylene (Hoekstra and Weges, 1986; Negre et al., 2003; Underwood et al., 2005) In short, four dimensions of regulation have been identified: tiss ue type, floral development, daily time course, and hormone action. Ethylene Signaling Pathway Of the classic phytohormones, ethylene has been empirically shown to have a regulatory role in the production of floral VOCs in petunia (Negre et al., 2003; Underwood et al., 2005; Dexter et al., 2007; Dexter et al., 2008). For example, exposure to exogenous ethylene for 10 h results in a large reduction in FVBP emission, and a successful pollination and fertilization event, which generates endogenous ethylene, r esults in a severe reduction in FVBPs after 36 to

PAGE 19

1 9 48 h, all in MD (Negre et al., 2003; Underwood et al., 2005). Subsequent to fertilization, the biological function of the petunia floral organ shifts from pollinator attractant to seed development. Therefor e, a reduction in pollinator attractions such as floral fragrance is biologically efficient. The gaseous phytohormone ethylene regulates an assortment of developmental process es and stress responses such as: germination, cell elongation, sex determination flower & leaf senescence, and fruit ripening. Endogenous ethylene synthesis and the ethylene signal transduction pathway has been investigated extensively with a significant proportion identified in Arabidopsis thaliana through mutant analysis (reviewed in Chen et al., 2005). Ethylene is an unsaturated hydrocarbon with the chemical formula C2H4 and is the simplest alkene. The biosynthesis of ethylene begins with conversion of the amino acid methionine to S adenosyl L methionine (SAM) by the enzyme SAM SYNTHETASE (Bleeker and Kende, 2000). SAM is then converted to 1 aminocyclopropane 1carboxylicacid (ACC) by the enzyme ACC SYNTHASE (ACS). The activity of ACS is the rate limiting step in ethylene production, and therefore, regulation of ACS is crucial for ethylene biosynthesis. Oxygen is required for the last step, which involves the action of the enzyme ACC OXIDASE (ACO) [Wang et al., 2002]. Subsequent to synthesis, ethylene is distributed by way of a gaseous state and perceived through the ethylene signal ing pathway. Additionally, ethylene biosynthesis can be induced by endogenous or exogenous ethylene and is therefore autocatalytic (Guo and Ecker, 2004). The ethylene signaling pathway can involve a transmembrane protein dimer complex (receptor), a kinase cascade (signal transduction), membrane bound intermediate proteins (mediator), and transcriptional regulators (response factors). The first gene encoding an ethylene receptor was cloned from Arabidopsis thaliana ( AtETR1 ) [Chang et al., 1993], followed by a

PAGE 20

20 cloned gene in Solanum lycopersicum NEVER RIPE (Wilkinson et al., 1995). In Arabidopsis the ethylene signal is perceived by a small family of five proteins, comprised of AtETR1, AtETR2, AtEIN4, AtERS1 and AtERS2 (Schaller and Bleecker, 1995; Hua and Me yerowitz, 1998; Hua et al., 1998; Sakai et al., 1998; Hall et al., 2000), while the tomato ethylene receptor family of proteins consists of at least six individuals. AtETR1 can form a dimer complex through a disulfide linkage between the respective monomer s (Schaller et al., 1995). AtETR1 has an ethylenebinding domain in the three N terminal hydrophobic trans membrane domains (Schaller and Bleecker, 1995). The chemical element, copper can act as a cofactor to enhance AtETR1 and ethylene binding activity (R odriguez et al., 1999). The C terminus of AtETR1 displays high similarity to bacterial two component regulators, which contain a histidine kinase domain and a receiver domain (Chang et al., 1993). The histidine kinase domain putatively interacts with the N terminus of a Raf1 like kinase, AtCTR1 (Clark et al., 1998). Without ethylene bound to the AtETR1 receptor, AtCTR1 is in an activated form and suppresses ethylene signaling transduction. However, when ethylene is bound to the AtETR1 receptor, AtCTR1 is i n an inactive form and suppression on downstream signaling components is relieved (reviewed in Zhu and Guo, 2008). AtEIN3 is a plant specific transcriptional regulator that functions downstream of the signaling pathway leading from AtCTR1 (Chao et al., 1997; Alonso et al., 1999). AtEIN3 binds to the promoter and induces transcription of AtERF1 (Solano et al., 1998). AtERF1 is part of a large protein family called ethylene responsive element binding proteins (EREBPs). EREBPs bind to a conserved promoter ele ment, a GCC box (Solano et al., 1998). In planta, ethylene synthesis is promoted by numerous environmental stimuli including pollination and fertilization. Pollination followed by increased ethylene production precede floral

PAGE 21

21 senescence as the flower tran sitions from being a pollinator attractor to supporting seed development in petunia (Hoekstra and Weges, 1986; Negre et al., 2003; Underwood et al., 2005) Upon pollination of the MD flower, ethylene is rapidly produced in the stigma and style resulting in an increased ethylene production around 12 hours after pollination and peaking after approximately 24 hours in the ovary (Tang and Woodson, 1996) Subsequently, ethylene production is induced in the corolla tissue between 24 and 36 hours after pollination (Jones et al., 2003).The eth ylene production in the corolla tissue is presumed to induce corolla senescence (Hoekstra and Weges, 1986). The creation of the ethylene insensitive ( CaMV 35S:: etr1 1) transgenic petunia line, 44568 (Wilkinson et al., 1997) has been indispensible for comparative ethylene studies such as adventitious root formation (Clark et al., 1999) and floral VOC production (Negre et al., 2003; Underwood et al., 2005; Dexter et al., 2007; Dexter et al., 2008). In short, the Arabidopsis etr1 1 mutant is a missense mutation in the ethylene binding domain of the protein. The missense mutation generates a protein that is unable to perceive ethylene that results in a constitutively suppressed ethylene signal transduction (Schaller and Bleeker, 1995). Heterologous expression of Atetr1 1 under a constitutive promoter in the MD genetic background resulted in a single homozygous transgenic line (44568) with severely reduce d ethylene perception (Wilkinson et al., 1997; Shibuya et al., 2004). FVBP Genetics and Biochemistry FVBP compounds are derived from the aromatic amino acid L phenylalanine (Phe). Phe is derived from metabolites originating from primary metabolism (shikimate pathway). The plastid localized shikimate pathway begins with the condensation of erythrose 4phosphate and phosphoenolpyruvate, and ends in the formation of chorismic acid (CA) through a total of seven enzymatic reactions (reviewed in Herrmann and Weaver, 1999 ). CA can be enzymatically

PAGE 22

22 rearranged to prephenic acid by a protein called CHORISMATE MUTASE Prephenic acid can then be dehydrated to pheylpyruvic acid by an enzyme called PREPHENATE DEHYDRATASE Phenylpyruvic acid is transaminated to produce Phe. Phe is presumed to be exported from the pla stid into the cytosol where the phenylpropanoid pathway is localized (Achnine et al., 2004). As the gateway to secondary metabolism, the phenylpropanoid pathway begins with the deamination of Phe by PHENYLALANINE AMMONIA LYASE (PAL) to form trans cinnamic acid (reviewed in Boudet, 2007). Next, trans cinnamic acid is converted to paracoumaric acid through hydroxylation by an endomembrane bound enzyme, CINNAMATE 4HYDROXYLASE (C4H) [Achnine et al., 2004]. A series of reactions can convert paracoumaric acid to ferulic acid through multiple enzymatic steps (reviewed in Yu and Jez, 2008). Metabolites for FVBP synthesis branch from the phenylpropanoid pathway at Phe, trans cinnamic acid, and ferulic acid (Figure 1 1). To date, seven genes involved in the direct biosynthesis of FVBP compounds or intermediate metabolites have been emperically identified in petunia: SADENOSYL L METHIONINE:BENZOIC ACID/SALICYLIC ACID CARBOXYL METHYLTRANSFERASE 1 and 2 ( PhBSMT1 and PhBSMT2 ) [ AY233465 and AY233466] BENZOYL COA:BENZY L ALCOHOL/PHENYLETHANOL BENZOYLTRANSFERASE ( PhBPBT ) [ AY611496] PHENYLACETALDEHYDE SYNTHASE ( PhPAAS ) [ DQ243784] CONIFERYL ALCOHOL ACYLTRANSFERASE ( PhCFAT ) [ DQ767969] EUGENOL SYNTHASE 1 ( PhEGS1 ) [EF467241], and ISOEUGENOL SYNTHASE 1 ( PhIGS1) [DQ372813]; F igure 11. PhBSMT1 and PhBSMT2 encode enzymes that catalyze the synthesis of MeBA and MeSA from benzoic acid and salicylic acid respectively (Negre et al., 2003; Underwood et al., 2005). PhBPBT encodes an enzyme that catalyzes synthesis of BeBA and PhBA fr om benzoyl CoA and BOH or

PAGE 23

23 2POH respectively (Boatright et al., 2004; Orlova et al., 2006; Dexter et al., 2008) PhIGS1 encodes an enzyme that catalyzes the formation of IE from coniferyl acetate (Koeduka et al., 2006) while PhEGS1 encodes an enzyme responsible for the conversion of coniferyl acetate to eugenol (Koeduka et al., 2008). PhPAAS encodes a bifunctional decarboxylase/amine oxidase that catalyzes synthesis of PAA from phenylalanine (Kaminaga et al., 2006) PhCFAT encodes an enzyme that catalyzes the formation of coniferyl acetate (substrate for PhIGS1 ) from coniferyl alcohol and acetyl CoA (Dexter et al., 2007) The seven petunia genes mentioned above have all been characterized in different ways, but a common transcript accumulation profile seems to be emerging. PhBSMT1 and PhBSMT2 mRNA transcripts accumulate to high levels in petunia corolla limb tissue, peak transcript accumulation is detected at mid day, and transcript accumulat ion is greatly reduced after a successful pollination/fertilization event and/or exogenous ethylene exposure (Negre et al., 2003; Underwood et al., 2005). PhBPBT transcripts accumulate to high levels in petunia corolla limb tissue, peak transcript accumula tion is detected at mid day, and PhBPBT transcript accumulation is reduced after a successful pollination/fertilization event and/or exposure to exogenous ethylene (Boatright et al., 2004; Dexter et al., 2008). PhIGS1 transcripts accumulate to high levels in both corolla tube and limb tissues of petunia (Koeduka et al., 2006). PhEGS1 transcript accumulation is relatively high in corolla limb tissue, but PhEGS1 transcripts accumulate to approximately 33 % of PhIGS1 transcript accumulation in petunia corolla limb tissue (Koeduka et al., 2008). PhPAAS transcript accumulation is relatively high in corolla limb and ovary tissue of the petunia flower. PhPAAS transcript accumulation is only observed post anthesis and peak transcript accumulation is detected at mid day (Orlova et al., 2006). PhCFAT transcript accumulation is relatively high in the corolla limb tissue postanthesis and peak transcript

PAGE 24

24 abundance appears in the evening. Additionally, PhCFAT transcript accumulation is greatly reduced after a successful p ollination/fertilization event and/or exogenous ethylene exposure (Dexter et al., 2007). To summarize, none of the previously reported MD FVBP genes have been transcriptionally profiled alike, however, high levels of all these gene transcripts seem to be c onfined to the petunia corolla limb tissue, which corresponds to the spatial location of FVBP emission. A single transcriptional regulator involved in the production of FVBPs has been identified from petunia. ODORANT 1 ( PhODO1 ) [AY705977] is a R2R3MY B transcriptional regulator that functions to regulate gene expression in the shikimate pathway (Verdonk et al., 2005) The accumulation of the shikimate pathway gene transcripts upon anthesis elevates levels of precursors, as deduced from benzoic acid levels, available for the FVBP biosynthesis pathways. PhODO1 transcript accumulation is relatively high in the corolla limb tissue from anthesis to senescence, and peak transcript abundance is observed in the evening (Verdonk et al., 2005) CHORISMATE MUTASE CA is the last primary metabolite shared for production of the phenylpropanoid secondary metabolites. CM is the initial committed step in Phe biosynthesis in plant s. Specifically, CM catalyzes an intramolecular, [3,3] sigmatropic rearrangement of chorismic acid to prephenic acid, formerly a Claisen rearrangement (Haslem, 1993). Three CM genes have been identified in Arabidopsis thaliana, and each gene encodes a diff erent isoform of the CM protein. All AtCM s have been cloned, transcriptionally profiled, and biochemically characterized in selected Arabidopsis tissue, but all the conclusions regarding subcellular localization are putative concepts based upon predicted a mino acid sequence features (chloroplast transit peptide, cTP) and have not been tested directly. AtCM1 and AtCM3 are predicted to be plastid localized

PAGE 25

25 isoforms, respective transcripts accumulate differentially, and AtCM1 is induced upon pathogen attack (E berhard et al., 1993; Eberhard et al., 1996b; Mobley et al., 1999). In addition, both isoforms are allosterically up regulated by tryptophan and downregulated by Phe and tyrosine. Of the two putative plastidic CM isoforms, recombinant AtCM3 has the lowest apparent Km value for CA when expressed in a eukaryotic system (Mobley et al., 1999). AtCM2 predicted localization is the cytosol due to a lack of a cTP, it has the lowest apparent Km value for chorismic acid of all three isoforms, and is allosterically u naffected by the three aromatic amino acids (Eberhard et al., 1996b; Mobley et al., 1999). The identification and characterization of all three CM isoforms in Arabidopsis consisted of multiple manuscripts culminating in the authors of the final manuscript to speculate that the differential properties of AtCMs suggested each isoform fulfilled distinct physiological roles. Additionally, the authors point out that a loss of function mutation for each CM gene was required to clearly define any specific roles e ach isoform may have (Mobley et al., 1999). To date, loss of function mutations for any of the higher plant CM family members have not been reported. The majority of the upstream and downstream pathway proteins have been empirically tested for subcellular localization and all pathway proteins close to the CM step have been localized to the plastid in Arabidopsis leaf tissue (Herrmann and Weaver, 1999; Rippert et al., 2009). Therefore, the function of the Arabidopsis cytosolic isoform remains unclear, due to the separation from pathway proteins and substrate. Interestingly, a Solanum lycopersicum CM was cloned by one of the same labs that reported on the AtCMs, and it appears to be located in the cytosol because the predicted protein sequence lacks a cTP (Ebe rhard et al., 1996a). Additionally, activity of two CM isoforms from Papaver somniferum have been reported and differential centrifugation resulted in a plastidic and cytosolic isoform (Benesova and Bode,

PAGE 26

26 1992). The question remains, why do multiple geneti c backgrounds contain a CM sequence encoding for a protein that is unable to participate in a very specific enzymatic reaction? Has a new function evolved (broad substrate specificity), or maybe the biological separation between cytosol and plastid is dyna mic and all variables have not been tested. R2R3 MYB Transcriptional Regulators Transcription is the biosynthesis of ribonucleic acid (RNA) chains under the direction of deoxyribonucleic acid (DNA) templates. Multiple factors are necessary for the pr ocess of transcription including DNA unwinding and/or remodeling, the RNA polymerase complex, and many other proteins involved in the pre initiation complex. Additionally, other factors can control the transcription rate. Regulation of the transcription ra te increases the versatility and adaptability of an organism by controlling when and where a protein is expressed. Proteins that recognize and bind DNA in a sequence specific manner in order to regulate the rate of initiation of transcription are called tr anscriptional regulators. These proteins can be activators, repressors, or both and have been classified into families based upon similarity of DNA binding domains (reviewed in Pabo and Sauer, 1992). Of these proteins, MYB transcriptional regulators compri se one of the largest families in the plant kingdom (Riechmann et al., 2000). The oncogene v MYB from the avian myeloblastosis virus was the first MYB transcriptional regulator identified (Klempnauer et al., 1982). MYB genes have since been identified fr om insects, plants, fungi, and slime molds (Lipsick, 1996). The MYB proteins are further classified into subfamilies based on the composition of the DNA binding domain, which is generally comprised of three imperfect repeats: R1, R2, and R3 (Ogata et al., 1992). In plants, R2R3 MYB transcriptional regulators contain two imperfect repeats and this subfamily consists of approximately 125 individual genes in Arabidopsis thaliana. Protein functions of these 125

PAGE 27

27 genes vary from controlling cellular proliferation and differentiation to controlling phenylpropanoid metabolism (reviewed in Stracke et al., 2001). Research Objectives The object of this study was to investigate molecular, biochemical, and metabolic aspects of regulation committed to FVBP production in petunia. Therefore, MD genes previously identified as necessary for differential aspects of FVBP production were assayed for coordinate transcriptional regulation. Employing the transcript accumulation screen we focused further research on candidate genes whose transcript profiles were similar to known FVBP profiles. The identification of PhCM1 and PhMYB5d8 enabled an examination of metabolite control and flux through the phenylpropanoid pathway and ultimately to FVBP synthesis in petunia.

PAGE 28

28 Figure 1 1. The floral volatile benzenoid/phenylpropanoid pathway. The shikimate pathway (dark grey) concludes with the formation of chorismate. CHORISMATE MUTASE catalyzes the rearrangement of chorismate to prephenate, directing the flux of metabolites to the prod uction of phenylalanine and tyrosine. From the phenylpropanoid backbone (light grey), FVBP production consists of three main branch points; phenylalanine, trans cinnamic acid, and ferulic acid. Floral volatile compounds derived from each branch point are highlighted in pink and known FVBP genes are abbreviated at the appropriate enzymatic positions. Enzymes are in red. Solid red arrows indicate established biochemical reactions. Multiple arrows indicate multiple biochemical steps. Dashed arrows indicate pos sible biochemical reactions.

PAGE 29

29 CHAPTER 2 PETUNIA FLORAL VOLAT ILE BENZENOID/PHENYL PROPANOID GENES ARE REGULATED IN A SIMIL AR MANNER Preface This work has been submitted to and accepted in modified form at the journal Phytochemistry for publication (Thomas A. Colquhoun, Julian C. Verdonk, Bernardus C.J. Schimmel, Denise M. Tieman, Beverly A. Underwood, and David G. Clark. [2009] Petunia Floral Volatile Benzenoid/Phenylpropanoid Genes are Regulated in a Similar Manner. Phytochemistry, [ In Press ]) Introductio n Floral volatile compounds serve multiple roles in the reproductive strategy of many angiosperms, functioning in antifeedant, antimicrobial, antifungal, and pollinator attractant roles (reviewed in Dudareva et al., 2006). The relatively large metabolic c ost for scent production in many species underscores the importance of this enterprise. Many aspects regarding the regulation of the floral volatile system as a whole remain unclear; for example, are all the genes involved in the biosynthesis of floral vol atiles a part of a transcriptionally regulated network? Petunia x hybrida cv Mitchell Diploid (MD) is an excellent model system for the study of floral volatiles. Benzenoids and phenylpropanoids constitute the majority of the volatile organic compounds emitted by the petunia flower (Kolosova et al., 2001a; Verdonk et al., 2003; Boatright et al., 2004; Underwood et al., 2005; Verdonk et al., 2005; Koeduka et al., 2006) These low molecular weight compounds have high vapor pressures and are putatively synthesized de novo (Par e and Tumlinson, 1997; Verdonk et al., 2003; Pichersky et al., 2006) Subsequent to synthesis, these compounds are emitted from epidermal cells of the corolla limb (Kolosova et al., 2001b; Underwood et al., 2005; Verdonk et al., 2005) MD flowe rs emit 13

PAGE 30

30 benzenoids/phenylpropanoids; benzaldehyde (Bald), benzyl acetate (BeAc), benzyl alcohol (BOH), benzyl benzoate (BeBA), methyl benzoate (MeBA), methyl salicylate (MeSA), phenylacetaldehyde (PAA), 2 phenylethyl acetate (2 PhAc), phenylethyl alcoho l (2 POH), phenylethyl benzoate (PhBA), eugenol (EG), isoeugenol (IE), and vanillin ( Figure 1 1, Kolosova et al., 2001a; Verdonk et al., 2003; Boatright et al., 2004; Verdonk et al., 2005; Koeduka et al., 2006) Beginning at anthesis (flower opening) these volatile compounds are synthesized and emitted in a rhythmic pattern with a maximum emission at night (Kolosova et al., 2001a; Verdonk et al., 2003; Underwood et al., 2005; Verdonk et al., 2005) In petunia, seven floral v olatile benzenoid/phenylpropanoid (FVBP) biosynthetic genes have been identified: SADENOSYL L METHIONINE:BENZOIC ACID/SALICYLIC ACID CARBOXYL METHYLTRANSFERASE 1 and 2 ( PhBSMT1 and PhBSMT2 ), BENZOYL COA:BENZYL ALCOHOL/PHENYLETHANOL BENZOYLTRANSFERASE ( PhB PBT ), PHENYLACETALDEHYDE SYNTHASE ( PhPAAS ), CONIFERYL ALCOHOL ACYLTRANSFERASE ( PhCFAT ), ISOEUGENOL SYNTHASE 1 ( PhIGS1), and EUGENOL SYNTHASE1 ( PhEGS1 ) [Figure 1 1] PhBSMT1 and PhBSMT2 encode enzymes that catalyze the synthesis of MeBA and MeSA from benzoi c acid and salicylic acid respectively (Negre et al., 2003; Underwood et al., 2005). PhBPBT encodes an enzyme that catalyzes synthesis of BeBA and PhBA from benzoyl CoA and BOH or 2 POH respectively (Boatrigh t et al., 2004; Orlova et al., 2006; Dexter et al., 2008) PhIGS1 encodes an enzyme that catalyzes the formation of IE from coniferyl acetate (Koeduka et al., 2006) PhPAAS encodes a bifunctional decarboxylase/amine oxidase that catalyzes synthesis of PAA from phenylalanine (Kaminaga et al., 2006) PhCFAT encodes an enzyme that catalyzes the formation of coniferyl acetate (substrate for PhIGS1 ) from coniferyl a lcohol and acetyl CoA (Dexter et al., 2007) Most

PAGE 31

31 recently PhEGS1 was shown to produce eugenol from coniferyl acetate (Koeduka et la., 2008; Koeduka et al., 2009a), but because the current work was started prior to these publications PhEGS1 was unfortunately not included. To date, a single transcriptional regulator involved in the production of floral volatile benzenoids/phenylpropanoids has been identified from petunia. ODORANT 1 (PhODO1) is a R2R3 MYB transcriptional regulator that functions to regulate gene expression in the shikimate pathway (Verdonk et al., 2005) The shikimate pathway couples metabolism of carbohydrates to formation of aromatic amino acids (Figure 1 1) [ Herrmann and Weaver, 1999] The transcriptional upregulation of the shikimate pathway genes upon anthesis elevates levels of precursors, as deduced from benzoi c acid levels, available for the floral volatile benzenoid/phenylpropanoid biosynthesis pathways (Verdonk et al., 2005) In petunia, pollination followed by increased ethylene production precede floral senescence as the flower transitions from being a pollinator attractor to supporting seed development (Hoekstra and Weges, 1986; Negre et al., 2003; Underwood et al., 2005) Upon pollination of the MD flower, ethylene is rapidly produced in the stigma and style resulting in increased ethylene production around 12 hours after pollination and peaking after approximately 24 hours in the ovary (Tang and Woodson, 1996) Subsequently, ethylene production is induced in the corolla tissue between 24 and 36 hours after pollination (Jones et al., 2003) Thirty six hours after pollination, volatile benzenoid/phenylpropanoid emissions and transcript levels of PhBSMT1 and PhBSMT2 are significantly reduced when compared to unpollinated MD flowers or pollinated flowers of an ethylene insensitive ( CaMV 35S:: e tr1 1) transgenic petunia line, 44568 (Wilkinson et al., 1997; Negre et al., 2003; Underwood et al., 2005)

PAGE 32

32 Since the petunia genes involved in the production of floral volatiles have been characterized in various ways and in large part one gene at a time, conceptualizing these genes into a specific group is difficult. Focusing at a molecular level, a spatial PhIGS1 transcript accumulation profile h as been reported (Koeduka et al., 2006), but a PhPAAS transcript accumulation profile for a spatial, floral development, and daily time course has been reported (Orlova et al., 2006), while a spatial, daily time course, and ethylene treated PhCFAT transcri pt accumulation profile has been reported (Dexter et al., 2007). Therefore, the statement that the genes involved in the production of floral volatiles share similar transcript accumulation profiles throughout a spatial, floral development, daily time cour se, and ethylene treatment is a putative concept and requires further examination. We hypothesized the seven genes analyzed in this study would share similar transcript accumulation profiles because the corresponding floral volatile compounds share similar emission profiles. To test this hypothesis, we used four transcript accumulation criteria (spatial, flower development, ethylene regulated and rhythmic) and analyzed these seven FVBP gene transcript accumulation profiles in MD and 44568 plants. The result s show similar transcript accumulation profiles of the FVBP genes in three out of four criteria examined. The FVBP gene group can be separated into two general rhythmic transcript accumulation patterns. Finally, ethylene studies suggest a reversible mechan ism to the ethylene dependent reduction of FVBP gene transcript levels. Results Spatial FVBP G ene E xpression A nalysis in MD P lants The spatial transcript accumulation profiles for the floral volatile benzenoid/phenylpropanoid (FVBP) genes PhBSMT1 PhBSMT2 PhBPBT PhPAAS PhIGS1, PhCFAT and PhODO1, were examined by semi quantitative (sq)RT PCR and quantitative (q)RT PCR. Root, stem, stigma, anther, leaf, petal tube, petal limb, and sepal tissues of MD

PAGE 33

33 plants were harvested at 16:00 h. Compared to the othe r plant tissues examined, the highest levels of FVBP gene transcripts were detected in the petal limbs of MD flowers (Figures 2 1 and 24A). PhBSMT1 mRNA was detected in the petal tube and limb. PhBSMT2 and PhIGS1 transcripts were detected in the stigma, a nther, petal tube, and petal limb. Only PhBPBT mRNA was detected in the petal limb and also weakly in leaf tissue. PhPAAS and PhCFAT transcripts were only detected in petal limb, and PhODO1 mRNA was primarily detected in the petal limb with lower levels ob served in the petal tube, stem, and stigma. Combined, these results not only corroborate the current literature ( Negre et al., 2003; Boatright et al., 2004; Verdonk et al., 2005; Underwood et al., 2005; Koeduka et al., 2006; Kaminaga et al., 2006; Dexter et al., 2007; Dexter et al., 2008) but clearly illustrate coordinated transcription accumulation profiles for the seven FVBP genes in floral limb tissue. Developmental FVBP G ene E xpression A nalysis in MD and 44568 F lowers To identify FVBP transcript accumulation profiles during floral development, whole flowers were collected at eleven co nsecutive developmental stages of the MD and the ethylene insensitive 44568 flower lifecycle (Figure 22) and transcript levels were analyzed by sqRT PCR and qRT PCR. This analysis revealed a common developmental transcript accumulation profile for all gen es examined (Figures 2 3 and 24B). In both MD and 44568 flowers, FVBP gene transcripts were detected at relatively low levels throughout floral bud stages (1 5). In MD flowers, high levels of FVBP gene transcripts were detected at anthesis (stage 6) and r emained high through the open flower stages (710), until transcript levels decreased upon senescence (stage 11) [Figures 23A and 24B]. In 44568 flowers, FVBP gene transcripts were detected in a similar developmental pattern through open flower stages as in MD flowers. However, FVBP gene transcripts were more abundant in observably senescing 44568 flowers (Figure 23B) than MD flowers at the same stage (11). The present analysis supports the existence of a concerted

PAGE 34

34 system of transcriptional regulation with regard to these seven genes during the development of a petunia flower. Volatile E mission throughout D evelopment from MD and 44568 F l owers In order to compare the developmental transcript accumulation analysis (Figures 2 3 and 24B) to developmental volatile benzenoid/phenylpropanoid emission in petunia flowers; excised whole buds and flowers from MD and 44568 plants at specific stages were analyzed for volatile benzenoid/phenylpropanoid emission (Figure 25). Benzyl alcohol (BOH), benzyl benzoate (Be BA), benzaldehyde (Bald), methyl benzoate (MeBA), methyl salicylate (MeSA), phenylethyl benzoate (PhBA), phenylacetaldehyde (PAA), phenylethylalcohol (2 POH), eugenol (EG) and isoeugenol (IE) emissions were measured at all floral developmental stages. All volatile compounds analyzed in MD and 44568 flowers were either at the detection limit or below detection in bud stages of floral development prior to stage 5. The initial detection of most volatiles was at anthesis (stage 6). High amounts of all volatiles were detected throughout open flower stages (stages 7 10) and markedly lower amounts of most volatiles were detected in senescing tissue (stage 11) of MD flowers but not 44568 flowers (Figure 2 5). These data coincide with the FVBP gene transcript results (Figures 2 3 and 2 4B). That is, FVBP gene transcripts and FVBP emissions are low or not detected in floral bud stages (15). The initial detection of substantial levels of both FVBP gene transcripts and emissions are at anthesis (stage 6) and high levels of both are detected throughout open flower stages (710). In addition, comparison of MD and 44568 FVBP transcript abundance and volatile emissions in senescing floral tissues (stage 11) supports the association further. Low levels of FVBP gene transcript s and emissions are found in MD flowers, but relatively higher amounts of FVBP gene transcripts and emissions are found in 44568 flowers (Figures 23 and 25).

PAGE 35

35 Ethylene D ependent D own R egulation of FVBP G ene E xpression Comparison between MD and 44568 FVB P gene transcript levels at developmental stage 11 (Figure 2 3) suggests transcription of all seven FVBP genes is affected by ethylene. To test this hypothesis, excised MD and 44568 flowers were treated with air or ethylene for 0, 1, 2, 4, and 8 hrs and ge ne transcript accumulation was analyzed by sqRT PCR and qRT PCR. All FVBP genes examined showed a reduction of transcript levels in MD flowers treated with ethylene compared to those treated with air (Figures 2 6 and 24C). In contrast, no reduction of exp ression was observed for any of the FVBP genes in 44568 flowers treated with ethylene or air. PhBSMT1, PhBSMT2, and PhCFAT transcripts were reduced in MD flowers after two hours of ethylene exposure (Figure 26), which agreed with previously published dat a (Negre et al., 2003; Underwood et al., 2005; Dexter et al., 2007) PhPAAS and PhODO1 transcript levels were also reduced after two hours of ethylene treatment in MD flowers. PhBPBT and PhIGS1 transcript levels were reduced after four hou rs of ethylene treatment. These data show that two to four hours of exogenously applied ethylene is sufficient to reduce transcript levels of all seven FVBP genes examined in MD flowers. Volatile E mission after E xogenous E thylene T reatment Ten hours of exogenous ethylene treatment has been shown to accelerate floral senescence and permanently reduce volatile emission in petunia flowers (Underwood et al., 2005) Two hours of ethylene treatment is suffic ient to reduce transcript accumulation from many of the FVBP genes (Figure 2 6) without accelerating senescence (Figure 2 7). Therefore, MD and 44568 flowers were excised and treated with ethylene for 0, 2, and 10 h starting at 20:00 h of day 1 to determine if short term ethylene exposure that does not lead to senescence would lead to a permanent reduction in floral volatile benzenoid/phenylpropanoid synthesis. Individual

PAGE 36

36 volatiles emitted from 44568 flowers the day after air and ethylene treatments were similar. Twenty four hours after the start of treatments, volatiles emitted from MD flowers treated with ethylene for 10 hours were greatly reduced. However, volatiles from MD flowers treated with ethylene for two hours were comparable to volatile levels of air treated MD flowers (Figure 2 8). Therefore, a relatively short exposure (two hours) to ethylene that did not accelerate senescence did not reduce volatile emissions, whereas a longer exposure (ten hours) to ethylene that did accelerate senescence (Figu re 2 7) reduced volatile emissions. These results suggest a reversible component of ethylene in the regulation of floral volatile benzenoid/phenylpropanoid production in MD flowers, which is dependent on the exposure duration. Rhythmic R egulation of FVBP G ene E xpression in MD F lowers Since emission of FVBPs is rhythmic and peaks around 1:00 h (Verdonk et al., 2005) FVBP gene transcript accumulation was analyzed by sqRT PCR from stage 9 corollas every three hour s over a 36 hour time period to achieve comparable, daily expression profiles in MD flowers. In general PhBSMT1 PhBSMT2 PhBPBT PhPAAS and PhIGS1 (genes responsible for the direct formation of emitted volatile compounds) transcripts were detected at hig h levels during the light period (6:00 to 21:00 h), and lowest mRNA levels detected during the dark period, 24:00 to 6:00 h (Figure 29). PhCFAT and PhODO1 (genes responsible for the availability of precursors and direct substrates for the above mentioned genes) transcripts were detected at high levels late in the light period and into the dark period (15:00 to 3:00 h). PhODO1 and PhCFAT transcript accumulation profiles demonstrate an obvious shift towards the dark period as compared to the other FVBP trans cript profiles examined These data indicate the presence of at least two transcriptional regulatory systems controlling rhythmicity of FVBP gene transcript accumulation in MD flowers.

PAGE 37

37 PhPAAS A ctivity in MD F lowers Transcript levels for the FVBP genes and v olatile emission are rhythmic in petunia (Figure 8; Verdonk et al., 2005). To determine if protein activity contributes to rhythmic volatile emission, PhPAAS activity was examined in MD limb tissue from developmentally identical flowers (stage 8) at four t ime points. Over the course of a 24 h experiment with time points every six hours, PhPAAS activity was not significantly different from sample to sample (Figure 210). These data along with the data in figure 8 suggest that as is the case for PhBSMT activi ty (Kolosova et al., 2001a), rhythmic phenylacetaldehyde emission is not limited by enzyme activity levels, but rather the availability of substrate for PhPAAS. Discussion Through the efficient transcript accumulation analysis of the seven floral volatile benzenoid/phenylpropanoid (FVBP) genes investigated here, it is now clear the FVBP genes are spatially, developmentally, and ethylene regulated at the transcriptional level as a coordinated group. Compared to the other plant tissues examined, the highest levels of FVBP gene transcripts are in the petal limbs of MD flowers (Figure 2 1). This is in accordance with the specific floral tissue where the majority of volatile benzenoid/phenylpropanoid compounds are detected in the MD flower (Verdonk et al., 2003; Underwood et al., 2005; Dexter et al., 2007) Thus, an organ specific biological association between floral volatile benzenoid/phenylpropanoid production and gene regulation is apparent. These observations suggest a potential reproductive advantage for a fragrant flower with this level of spatial regulation by attracting a pollinator to the specific area where the best opportunity lies to come i n contact with the receptacle for the male gametes and access the nectary (reward for the pollinator). In order to better understand the regulation of floral volatile emission, we have examined a large set of FVBP genes in developmentally staged tissues. The resolution and standardization

PAGE 38

38 of the petunia floral developmental stages (Figure 22) shows a tightly regulated subset of genes prior to and after anthesis in both MD and 44568 flowers. Transcripts from all FVBP genes examined are detected at the full y elongated bud stage (stage 5), followed by a substantial increase in transcript levels as the flower begins to open and becomes receptive to pollination (Figures 2 3 and 24B). Essentially, stages 1 5 of development can be termed Box 1 of flower develo pment in petunia. Box 1 is characterized with corolla tube elongation, pigment production in colored cultivars, a minimum level of FVBP gene transcripts (Figures 2 3 and 24B) and a minimum level of volatile emissions detected in MD (Figure 2 5) [Weiss et al., 1995; Ben Nissan and Weiss, 1996; Moalem Beno et al., 1997; Verdonk et al., 2003] In short, Box 1 is a growth and maturation stage of development in a petunia flower. The next m ajor developmental stage, anthesis (stage 6), is the transitionary stage (TS) between Box 1 and Box 2 of flower development where the flower function shifts from growth and maturation to pollinator attraction and fertilization. The TS is characterized by slowed elongation of the corolla tube tissue, the incipient opening of the corolla limb, and upregulation of the FVBP genes (Figures 2 3 and 24B). Box 2 encompasses the functional reproductive stage of flower development (open flowers) and is defined by volatile benzenoid/phenylpropanoid synthesis and emission (Figures 2 3, 24B, and 25). In a MD flower, anthers dehisce to disperse the male gametes (Wang and Kumar 2007) and upon pollination and successful fertilization is followed by an ethylene mediated senescence of the corolla tissue (Negre et al., 2003; Underwood et al., 2005) This stage of flower development requires a large commitment of energy and resources in the synthesis of fragrance to facilitate reproduction. Therefore, the high level of FVBP gene transcription only when the flower is receptive to pollination is an excellent means to efficiently utilize metabolites.

PAGE 39

39 We hypothesized that benzenoid/phenylpropanoid emission from developing MD and 44568 flowers would be similar from stage 1 to stage 10 of flower development, due to the similarity in FVBP gene expression between MD and 44568 flowers (Figure 2 3). In general, this is the case up to stage 11. The difference in volatile emission between MD and 44568 flowers at stage 11 can be explained by relatively higher levels of FVBP transcripts detected in observably senescing 44568 flowers when com pared to transcript levels in MD flowers at the same stage (Figures 2 3 and 25). Stage 11 is accompanied by endogenous ethylene production mediating senescence in MD; however, in 44568 the ethylene is not perceived and results in a longer floral lifespan and presumably continued transcription of the FVBP genes with concomitant FVBP emission. Therefore, the developmental gene expression and emission observations suggest a developmentally direct relationship between FVBP gene transcript abundance and FVBP em issions. We then tested all seven FVBP genes for any transcriptional effect subsequent to exogenously applied ethylene. Indeed, as indicated from the developmental FVBP gene expression comparison between MD and 44568 (Figure 23), where transcripts examin ed are still detected at substantial levels in observably senescing 44568 flowers when compared to MD flowers, ethylene treatment for two to four hours was sufficient to reduce transcript levels of the FVBP genes in MD flowers, but not in 44568 flowers (Fi gures 2 4C and 2 6). Thus, it is now evident that all seven of these FVBP genes are transcriptionally affected by ethylene exposure in a similar manner suggesting that there are transcriptional regulators common to all the FVBP genes examined here. Since either pollination or 10 hours of exogenous ethylene treatment induces senescence in MD flowers (Wilkinson et al., 1997; Underwood et al., 2005) we postulated that the system-

PAGE 40

40 wide repression of transcription for the FVBP genes by ethylene was due to an irreversible senescence program. While two hours of ethylene treatment is sufficient to reduce transcript levels of PhBSMT1, PhBSMT2, PhPAAS PhCFAT and PhODO1 (Figure 26), this treatment does not accelerate floral senescence in MD flowers (Figure 2 7). Therefore we tested if two hours of ethylene treatment causes a long term reduction of floral volatile emission in MD flowers. After two hours of ethylene treatment, flowers emitted levels of volatile benzenoids/phenylpropanoids equivalent to those of untreated flowers. In contrast, MD flowers treated with ethylene for 10 hours emitted greatly reduced levels of volatiles (Figure 2 8) and senesced earlier (Figure 2 7) than air treated flowers. These observations indicate MD flowers can tolerate a short burst of ethylene without entering into senescence and with no effect on floral volatile emission (reversible component), but a longer and sustained exposure to ethylene triggers a senescence program and long term reduction in volatile emission (irreversible component). While a single molecular mechanism was not elucidated through the ethylene studies shown here, together these data along with previous findings (ethylene effect on PhBSMT activity (Negre et al., 2003)) clearly support a role for ethylene at the transcriptional and post transcriptional levels in the regulatio n of floral volatile benzenoid/phenylpropanoid production in petunia flowers. Thus, the ethylene regulation imparted upon floral volatile production is multifaceted and may consist of more than one molecular action. The rhythmic emission of floral volatile benzenoids/phenylpropanoids peaks around 1:00 h (Verdonk et al., 2005) which corresponds to when nocturnal moths, suspected petunia pollinators, are active (Hoballah et al., 2005) However, PhBSMT1 PhBSMT2 PhBPBT PhPAAS and PhIGS1 transcript accumulation peaks around 15:00 h (Figure 29) [Negre et al.,

PAGE 41

41 2003; Boatright et al., 2004; Underwood et al., 2005; Kaminaga et al., 2006; Koeduka et al., 2006; Orlova et al., 2006; Dext er et al., 2008], while PhODO1 and PhCFAT transcript accumulation peaks around 21:00 h (Figure 2 9) [Verdonk et al., 2005; Dexter et al., 2007]. In addition, the internal substrate pools of benzoic acid and cinnamic acid are relatively low (around 4 and 0.04 g gfw1 respectively) at 10:00 h and are at high levels (around 24 and 0.4 g gfw1 respectively) at 22:00 h (Boatright et al., 2004; Underwood et al., 2005; Orlova et al., 2006) Therefore, PhODO1 (regulating shikimate genes) and PhCFAT (responsible for the formation of the substrate for PhIGS1) transcript accumulation, internal substrate pool accumulation, and floral volatile be nzenoid/phenylpropanoid emission demonstrate concurrent timing. In contrast, peak transcript levels of the genes responsible for the direct formation of emitted floral benzenoid/phenylpropanoid compounds ( PhBSMT1 PhBSMT2 PhBPBT PhPAAS and PhIGS1 ) precedes volatile emission by approximately six hours, while PhBSMT and PhPAAS activity (Kolosova et al., 2001 and Figure 210, respectively) do not reflect a rhythmic nature required for control over the rhythmic emission of floral volatiles in flowers. Thus, the rhythmic transcript accumulation of at least the FVBP genes PhBSMT1, PhBSMT2 and PhPAAS are not the determining factor for rhythmic emission of the floral volatiles. In contrast, oscillations of precursor pools and the rhythmic transcript accumulation of PhODO1 suggest the regulation controlling the rhythmic emission of floral fragrance is upstream in the floral volatile benzenoid/phenylpropanoid biosynthetic pathway, perhaps at the first committed step in phenylalanine biosynthesis. The transcript accumulation analyses in this study illustrate four criteria with multiple categories therein, which can be used to standardize the characterization of any FVBP genes identified in the future. The seven FVBP genes examined here, are likely a part of a common

PAGE 42

42 transcriptionally regulated network throughout three expression criteria (spatial, developmental, and ethylene regulated). Interestingly, two distinct rhythmic transcript accumulation profiles are clear, while the volatile emission profile has a single peak. Together, these observations suggest the rhythmic production and emission of volatile benzenoids/phenylpropanoids from the MD flower is controlled by the availability of substrates for the e nzymes responsible (example: PhBSMT and PhPAAS) for the direct formation of the emitted volatile compounds. However, the regulatory mechanism depicting the level of corresponding transcripts to enzyme activity is not known. Furthermore, the regulatory role of ethylene may be more complex than merely a protagonist to floral senescence in the flower of Petunia hybrida cv. Mitchell Diploid. Experimental Procedures Plant M aterials Inbred Petunia x hybrida cv Mitchell Diploid (MD) plants were utilized as a wild type control in all experiments. The ethylene insensitive CaMV 35S: etr1 1 line 44568, generated in the MD genetic background (Wilkinson et al., 1997) was utilized as a negative control for ethylene sensitivity where applicable. MD and 44568 plants were grown as previously described (Underwood et al., 2005; Dexter et al., 2007) A growth chamber (Environmental Growth Cambers, model TC 1, Chagrin Falls, OH, USA) was utilized for experiments to determine rhythm ic regulation of the FVBP genes. The chamber was programmed for 16 hrs light (approximately 400 mol m2 s1) and 8 hrs dark with a temperature of 24oC. Four MD plants were acclimated in the growth chamber for two weeks prior to the start of the experiment al collection. For exogenous application of ethylene experiments, excised MD and 44568 flowers from greenhouse grown plants were placed in 40 L glass tanks located in a climate controlled (23oC) room with 10 mol m2 s1 of fluorescent light. All exogenous ethylene treatments used two L L1 of ethylene with air treatments for controls.

PAGE 43

43 Expression S eries C onstruction All expression experiments were conducted multiple times with equivalent results observed, and in all cases, total RNA was extracted as previo usly described (Verdonk et al., 2003) To determine the spatial regulation of all the FVBP genes in MD plants total RNA was isolated from root, stem stigma, anthe r, leaf, petal tube, petal limb, and sepal tissues of three individual plants at 16:00 h. To examine the developmental regulation of all FVBP genes, MD and 44568 floral tissue was collected at eleven different stages; floral bud < 0.5 cm, bud 0.5 < 1.5 cm bud 1.5 < 3.0 cm, bud 3.0 < 5.0 cm, bud fully elongated 5.0 < 6.5 cm, flower opening 0 < 2 cm limb diameter (anthesis), flower fully open day 0, day 1, day 2, day 3, and observably senescing flower (flower opening day 7 for MD and flower opening day 13 f or 44568 [due to the delayed senescence phenotype of 44568 flowers]). All tissues were collected at 16:00 h on the same day, and total RNA was isolated from all samples collected. To determine rhythmic regulation of the FVBP genes, on day 1 of tissue colle ction, five randomly selected corollas per stage were collected at 6:00 h and every three hours thereafter for a total of 36 hours. Samples were frozen in liquid N2 and stored at 80C. Total RNA was then isolated from all samples including multiple biolog ical replicates. To investigate the effects of exogenous ethylene on the FVBP gene transcription, excised MD and 44568 fully open day 2 flowers (placed in tap water) from greenhouse grown plants were acclimated to treatment conditions for four hours prior to treatment. All excised flowers were placed into eight tanks, four for ethylene treatments and four for air treatments. Air and ethylene treatments were conducted for 0, 1, 2, 4, and 8 hours starting at 12:00 h. Individual samples consisted of three flow ers. Immediately following treatment, each of the flower samples were collected, stored at 80oC, and then total RNA was isolated from all corolla tissues once all samples had been collected.

PAGE 44

44 Gene E xpression A nalysis Semi quantitative RT PCR was perfor med using a Qiagen One step RT PCR kit (Qiagen Co., Valencia, CA, USA) with 50 ng total RNA. To visualize RNA loading concentrations, samples were amplified with Ph18S primers (forward primer 5TTAGCAGGCTGAGGTCTCGT 3 and reverse primer 5 AGCGGATGTTGCTTT TAGGA 3) and analyzed on an agarose gel. The following primers were designed and utilized for the visualization of the mRNA levels corresponding to the floral volatile benzenoid/phenylpropanoid genes: PhBSMT1 (accession number AY233465) and PhBSMT2 (acces sion number AY233466) forward primer, 5 AGAAGGAAGGATCATTCACCA3; PhBSMT1 reverse primer, 5 TATTCGGGTTTTTCGACCAC 3; PhBSMT2 reverse primer, 5 GAGAGATCTGAAAGGACCCC 3; PhBPBT (accession number AY611496) forward primer, 5 TGGTGGACCAGCTAAAGGAG3; PhBPBT reverse primer, 5 GGATTTGGCATTTCAAACAAA3; PhPAAS (accession number DQ243784) forward primer, 5 TCCTTGTAGTTCTAGTACTGCTGGAA 3; PhPAAS reverse primer, 5 TCAACAGCAGTTGTTGAAGTAGTTC 3; PhCFAT (accession number DQ767969) forward primer 5 CCATATCTTCCACCCCTTGA 3; PhCFAT reverse primer, 5 CAAATGACTAAACCGGAGTTCA3, PhPhIGS1 (accession number DQ372813) forward primer, 5 GCCTATGTCATGCCATTGAA3; PhPhIGS1 reverse primer, 5 TGCTTTAATTGTGTAGGCTGC 3, and PhODO1 (accession number AY705977) forward primer, 5 T TCAATTGGCTTTCGGGTTA 3; PhODO1 reverse primer, 5 AGGCACCTTGGACTCTTCG3. In addition, quantitative (q)RT PCR was used to validate the multiple biologically replicated sqRT PCR results for three of the four transcript accumulation criteria using PhPAAS and PhCFAT as examples on a MyIQ real time PCR detection system (Bio Rad Laboratories Inc., Hercules, CA). qRT PCR analysis with Power SYBR Green RNA-

PAGE 45

45 to Ct 1Step Kit (Applied Biosystems, Foster City, CA) was used to amplify and detect resulting products following the manufacturers protocol. The following qRT PCR primers were constructed in Primer Express software v2.0 (Applied Biosystems, Foster City, CA) and demonstrated gene specificity during melt curve analysis and then optimized: PhPAAS forward prime r, 5 CCAACCCGAACCAATTGAGA 3; PhPAAS reverse primer, 5 CCTGGGAAAATATCGCTTCGA3; PhCFAT forward primer, 5 AGGCAACTCGCAATGGAAGT 3; PhCFAT reverse primer, 5 AGGCGCTGAAACACTCCAAT 3; PhFBP1 (M91190) forward primer, 5 TGCGCCAACTTGAGATAGCA3; PhFBP1 rev erse primer, 5 TGCTGAAACACTTCGCCAATT 3; Pa18S (AJ236020) forward primer, 5 TGCAACAAACCCCGACTTCT 3; Pa18S reverse primer, 5 AGCCCGCGTCAACCTTTTAT 3. Floral V olatile E xperiments and E mitted V olatile Q uantification For all volatile emission experiments, emitted floral volatiles from excised flowers were collected and quantified as previously described (Underwood et al., 2005; Dexter et al., 2007) For the developmental volatile emission experiment, flowers from MD and 44568 plants were analyzed for levels of emitted volatile compounds at each stage shown in figure 3. All flowers were tagged at stage 6 and allowed to reach the desired age as judged by days after this stage. Volatile collections were performed on three flowers for each developmental stage at 19:00 h, and each sample was replicated three times. For volatile emission analysis from MD and 44568 flowers after ethylene treatment, open flowers at comparable stages of development were excised and used after a four hour acclimation period. Treatments started at 20:00 h of day 1 and lasted two and ten hours respectively with air treatments as controls. After all treatments, flowers were placed in ambient air conditions in the

PAGE 46

46 same climate controlled room until 20:00 h of day 2. Therefore 24 hours after the start of all treatments floral volatiles were c ollected and quantified. All treatments consisted of three flowers per sample and six replicates for each sample. Determination of PAAS Activity in Limb Crude Protein Extract Limb tissue from developmentally identical flowers (beginning at flower open day 1, stage 8) were collected at 18:00 h, 0:00 h, 6:00 h, and 12:00 h from MD plants grown as previously described (Underwood et al., 2005; Dexter et al., 2007) Frozen limb tissue from nine flowers per sample was disrupted with liquid nitrogen in mortar and pestles. Chilled extraction buffer (50 mM Tris pH 8.5, 10 m M mercaptoethanol, 5 mM Na2S2O5, 0.2 mM pyridoxal 5 phosphate, 1% polyvinylpyrrolidone MW 360,000, 1mM phenylmethanesulphonylfluoride, and 10% glycerol) was added to the ground tissue and further disrupted until the material was liquid. Samples were cen trifuged at 12,000 x g for 15 minutes. The supernatant was desalted and concentrated with centrifugal filters (Millipore) designed to eliminate compounds < 30,000 daltons. Phenylacetaldehyde synthase (PhPAAS) activity was measured through the production of 14C CO2 in reactions containing 30 M L [U -14C] phenylalanine (Amersham), 50 mM Tris pH 8.5, 0.2 mM pyridoxal 5 phosphate, 0.1 mM EDTA, and 20 L protein extract. 14C CO2 was collected on filter paper infused with 2N KOH as described by Tieman et al., 2006. Reactions were incubated at room temperature for 30 minutes. Captured 14C CO2 was quantified by scintillation counting. Activity in the extracts was determined against background activity in assays with boiled protein and reactions without protein. Res ults were averaged from three replicate assays per sample and two sets of duplicate tissues per time point. Production of phenylacetaldehyde was verified by GC MS from separate reactions containing 12C phenylalanine and otherwise identical reaction conditi ons.

PAGE 47

47 Floral L ongevity S ubsequent to E thylene A pplication in MD and 44568 F l owers Excised MD and 44568 flowers were placed in water and treated with ethylene for 0, 2, and 10 hours (Fig S1). After all treatments the flowers were allowed ambient air conditi ons and monitored for signs of senescence for an experimental total of 32 h. Four flowers per genetic background were used for each time point and the experiment was replicated three times. Acknowledgements The authors wish to thank Becky Hamilton and Joshua Bodenweiser for their excellent care of the petunia plants. This work was supported by grants from the USDA Nursery and Floral Crops Initiative, the Fred C. Gloeckner Foundation, and the Florida Agricultural Experiment Station.

PAGE 48

48 Figure 2 1. Tissue specific transcript accumulation analysis of seven FVBP genes in MD. Root, stem, stigma, anther, leaf, petal tube, petal limb, and sepal tissues were collected and total RNA was isolated from three MD plants at 16:00 h. Primers specific for PhBSMT1 PhBSMT2, PhBPBT PhPAAS PhIGS1 PhCFAT and PhODO1 with Ph18S as a loading control were used for semi quantitative RT PCR. The number of cycles used for amplification of each gene is shown on the right.

PAGE 49

49 Figure 2 2. Picture of floral stages used for the deve lopmental studies in MD and 44568. Floral tissues were collected at 11 different developmental stages; bud < 0.5 cm (1), bud 0.5 <1.5 cm (2), bud 1.5 < 3 cm (3), bud 3 < 5 cm (4), fully elongated bud 5 < 6.5 cm (5), flower opening [limb diameter 0 < 2 cm] (6), flower open day 0 (7), flower open day 1 (8), flower open day 2 (9), flower open day 3 (10), and observably senescing flower [flower open day 7 for MD and flower open day 13 for 44568] (11).

PAGE 50

50 Figure 2 3. Developmental transcript accumulation analysis of seven FVBP genes in MD (A) and 44568 (B). Floral tissues were collected at 11 different developmental stages as shown in figure 3. Primers specific for PhBSMT1 PhBSMT2 PhBPBT PhPAAS PhIGS1, PhCFAT and PhODO1 with Ph18S as a loading control were used for semi quantitative RT PCR. The number of cycles used for amplification of each gene is shown on the right.

PAGE 51

51 Figure 2 4. qRT PCR transcript accumulation analysis of PhPAAS and PhCFAT in petunia. Spatial analysis used root, stem, stigma, anth er, leaf, petal tube, petal limb, and sepal tissues of MD harvested at 16:00 h (A) The spatial experiment consisted of one biological replicate used for sqRT PCR and one separate biological replicate with two technical replicates per biological replicate. Floral developmental analysis used MD flowers from 11 sequential stages at 16:00 h (B) The MD developmental analysis consisted of one biological replicate separate from the biological replicates used for the sqRT PCR with three technical replicates. Ethylene treatment (two L L1) analysis used excised MD and 44568 whole flowers treated for 0, 1, 2, 4, and 8 hours (C) The ethylene treated series consisted of one biological replicate used in the sqRT PCR with two technical replicates. PhFBP1 and Ph18S were u sed as references throughout these experiments.

PAGE 52

52

PAGE 53

53 Figure 2 5. Developmental floral emission analysis of major volatile compounds from MD and 44568 flowers (mean se; n = 3). Each graph shows the concentration (ng g1 fw hr1) of individual volatile compounds emitted from excised MD (black bars) and 44568 (gray bars) flowers over the course of eleven floral developmental stages as depicted in figure 3. Volatile collection was performed on whole flowers at 19:00 h. Figure 2 6. Transcript accumulation analysis of seven FVBP genes in MD flowers and 44568 flowers. MD and 44568 flowers were treated with ethylene (two L L1) and air for 0, 1, 2, 4, and 8 hours. Corolla limbs were collected immediately after each time point and total RNA was isolated. Prime rs specific for the floral volatile genes PhBSMT1, PhBSMT2 PhBPBT PhPAAS PhIGS1, PhCFAT and PhODO1 with Ph18S as a loading control were used for semi quantitative RT PCR. The number of cycles used for amplification of each gene is shown on the right.

PAGE 54

54 Figure 2 7. Picture of MD and 44568 flowers 32 hours after the initial treatments of ethylene for 0, 2, 4, 8, and 10 hours. MD is the left column and 44568 is the right column.

PAGE 55

55 Figure 2 8. Emission analysis of major volatile compounds from MD and 44568 flowers subsequent to differential durations of ethylene exposure (mean se; n = 6). Excised MD and 44568 flowers were treated with ethylene (two L L1) for 0, 2, and 10 hours beginning at 20:00 h on day 1. Upon completion of treatments, flowers were allowed ambient air conditions until 20:00 h on day 2 when volatile emissions were collected and quantified. Each graph shows the concentration (ng g1 fw hr1) of individual volatile compounds emitted from MD and 44568 flowers.

PAGE 56

56 Figure 2 9. Rhythmi c transcript accumulation analysis of seven FVBP genes in MD. Four plants were acclimated for two weeks in a large growth camber set at 24C with a long day photoperiod (16 hrs of light and 8 hrs of dark). Corolla tissue was collected every three hours beg inning at 6:00 h of day 1 for 36 hrs. Primers specific for PhBSMT1 PhBSMT2 PhBPBT PhPAAS PhIGS1, PhCFAT and PhODO1 with Ph18S as a loading control were used for semi quantitative RT PCR. The number of cycles used for amplification of each gene is show n on the right. Figure 2 10. Rhythmic analysis of PhPAAS activity in corolla limb tissue of MD flowers. Corolla limb tissue was collected at six hour intervals for a total of 24 h, beginning with flowers from stage 8 (flower open day 1) at 18:00 h. Results were averaged from three replicate assays per sample and two sets of duplicate tissues per timepoint.

PAGE 57

57 CHAPTER 3 A SPECIALIZED CHORIS MATE MUTASE IN THE F LOWER OF PETUNIA X H YBRIDA Preface This work has been submitted to and accepted in modified for m at The Plant Journal for publication (Thomas A. Colquhoun, Bernardus C.J. Schimmel, Joo Young Kim, Didier Reinhardt, Kenneth Cline and David G. Clark. [2009] A petunia chorismate mutase specialized for the production of floral volatiles. Plant J [In Pre ss]) Introduction Flowering plant species have developed several mechanisms for attracting pollinating organisms. Flower shape, color, and fragrance all contribute to an increased specialization of the floral phenotype aimed at the attraction of a pollinat or (Fenster et al., 2004) Floral fragrance consists of an assortment of volatile organic molecules, which ar e commonly referred to as a scent bouquet. These volatile organic compounds are not only involved in plant reproductive processes, but also in plant plant interactions, defense, and abiotic stress responses (Dudareva et al., 2006) The majority of volatile compounds are lipophilic liquids with high vapor pressures, which cross biological membranes freely in the epidermal cells of the petal (Pichersky et al., 2006) Floral volatiles are generally differentiated into three main groups; benzenoids/phenylpropanoids, terpenoids, and fatty acid der ivatives. Petunia ( Petunia x hybrida cv Mitchell Diploid [MD]) synthesizes and emits 13 known floral volatile benzenoid/phenylpropanoid (FVBP) compounds (Kolosova et al., 2001; Verdonk et al., 2003; Boatright et al., 2004; Verdonk et al., 2005; Koeduka et al., 2006) [Figure 1 1] The majority of FVBP compounds are putatively derived from the aromatic amino acid phenylalanine (Boa tright et al., 2004; Schuurink et al., 2006) Eight genes that are known to participate in FVBP synthesis have been isolated from petunia: PhBSMT1 PhBSMT2 PhBPBT PhPAAS

PAGE 58

58 PhIGS1, PhEGS1 PhCFAT and PhODO1 (Negre et al., 2003; Boatright et al., 2004; Underwood et al., 2005; Verdonk et al., 2005; Kaminaga et al., 2006; Koeduka et al., 2006; Orlova et al., 2006; Dexter et al., 2007; Dexter et al., 2008; Koeduka et al., 2008) [Figure 1 1]. All of these gene products are involved in the direct formation of a FVBP compound except PhODO1 ( Verdonk et al., 2005) which is a transcri ptional regulator, and PhCFAT (Dexter et al., 2007), which produces substrate for PhIGS1 and PhEGS1. Regulation of the petunia FVBP system is complex and very specific. Substantial emission of MD FVBPs is confined to the corolla limb tissue during open fl ower stages of development, which coincides with the presentation of the reproductive organs (Verdonk et al., 2003). MD FVBP internal substrate pool accumulation and emission is diurnal with the highest level detected during the dark period (Kolosova et al., 2001; Verdonk et al., 2003; Underwood et al., 2005; Verdonk et al., 2005) FVBP synthesis and emission, FVBP gene transcript accumulation, and PhBSMT activity are greatly reduced following a successful pollination/fertilization event or exogenous treatment with ethylene (Hoekstra and Weges, 1986; Negre et al., 2003; Underwood et al., 2005) Subsequent to a successful fertilization event, the corolla tissue senesces as the petunia flower shifts from pollinator attraction to supporting seed set. The shikimate pathway couples metabolism of carbohydrates to the formation of aromatic amino acids (Figure 3 1) [ Herrmann and Weaver, 1999] CHORISMATE MUTASE (CM) catalyzes an intramolecular, [3, 3] sigmatropic rearrangement of chorismic acid to prephenic acid, the initial committed step in phenylalanine and tyrosine biosynthesis (Haslem, 1993). In Arabidopsis thaliana, three CM genes have been identified and characterized: AtCM1 AtCM2 and AtCM3 (Eberhard et al., 1996b; Mobley et al., 1999) AtCM1 and AtCM3 encode

PAGE 59

59 putatively plastid localized CM isoforms, which are allosterically down regulated by phenylalanine and tyrosine, but upregulated by tryptophan. AtCM2 encodes a C M isoform not regulated by aromatic amino acids and appears to be located in the cytosol. The majority of floral volatile studies in petunia have focused on identification of gene products involved in the formation of individual, emitted FVBP compounds ( i.e. genes at the end of the FVBP pathway). Since the FVBPs are putatively derived from phenylalanine and CM is the first committed step in phenylalanine biosynthesis, we identified and characterized two petunia CM cDNAs ( PhCM1 and PhCM2 ). Additionally, we identify the principal CM responsible for the production of FVBP compounds in petunia. Results Identification of T wo D istinct CM cDNAs To identify putative CM genes, we searched a publicly available petunia EST database (http://www.sgn.cornell.edu) and a petunia root EST collection (courtesy of Dr. Didier Reinhardt at the University of Fribourg) for sequences with homology to any of the three CM genes from Arabidopsis thaliana. The in silico analysis identified two partial ESTs whose fulllength sequences were recovered by 5 and 3 RACE technology. These two sequences exhibited high similarity to AtCMs and were subsequently renamed CHORISMATE MUTASE1 ( PhCM1 ) and CHORISMATE MUTASE2 ( PhCM2 ), which were deposited in GenBank under accession numbers, EU751616 a nd EU751617, respectively (Figure 3 2) The predicted PhCM1 and PhCM2 proteins were 324 and 263 amino acids in length, respectively. PhCM1 contains a predicted N terminal chloroplast transit peptide (cTP) of 56 amino acids ( ChloroP 1.1) and is therefore predicted to be plastid localized (Predator v. 1.03) while PhCM2 is likely located in the cytosol (Benesova and Bode, 1992) The predicted mature PhCM1 and PhCM2 share 46.7 % amino acid identity. When aligned with CM amino aci d

PAGE 60

60 sequences from Arabidopsis thaliana, Fagus sylvatica, Solanum lycopersicum Nicotiana tabacum Oryza sativa Vitis vinifera Zea mays and Saccharomyces cerevisiae common sequence features including a CM_2 superfamily domain in the N terminal half of the predicted proteins and a conserved C terminal domain of 19 amino acids were observed (Figure 33A). Additionally, an allosteric regulatory site (GS marked by red box) was present in PhCM1, but not PhCM2, which would be consistent with aromatic amino acid regulation of the putative plastidic PhCM1. Phylogenetic analysis demonstrated that the three solanaceous cytosolic CMs closely associate in an unrooted neighbor joining tree (Figure 3 3B). PhCM1 associates with CMs from multiple species containing both a predicted cTP and the allosteric regulatory site. PhCM1 shares 62.2 % identity with AtCM1. Chloroplast I mport A ssay To test the predicted subcellular localization of PhCM1 and PhCM2, both full length coding sequences were cloned into a pGEMT Easy vector in vitro transcribed and translated. The radiolabeled translation product was incubated with isolated chloroplasts ( Pisum sativum ) in a protein import assay (Figure 3 4). The radiolabeled PhCM2 translation product associated with the chloroplast fraction was equal in size to the original translation product and unprotected from the thermolysin protease treatment, indicating that PhCM2 did not enter the plastid. However, the PhCM1 translation product associated with the chloroplast fraction was processed t o a smaller size and was protected from the thermolysin treatment, indicating PhCM1 is imported into the plastid and processed to a mature size. Furthermore, the radiolabeled PhCM1 was associated with the stromal fraction of separated chloroplasts. Togethe r with primary amino acid sequence features, these results demonstrate PhCM1 is localized to the chloroplast stroma, while PhCM2 is most likely not located in the chloroplast.

PAGE 61

61 PhCM1 and PhCM2 T ranscript A bundance A nalysis Because of the large drain on t he free phenylalanine pool by the FVBP synthesis pathway, we hypothesized that a CM gene would be transcriptionally co regulated with known FVBP genes. Three criteria of transcript accumulation spatial, flower development, and ethylene treated were chosen for analysis by semi quantitative reverse transcriptase polymerase chain reaction (sqRT PCR) and validated by quantitative (q)RT PCR (Figures 3 5 and 36). The spatial analysis consisted of root, stem, stigma, anther, leaf, petal tube, petal limb, and sepa l tissues (Figures 3 5A and 3 6A). PhCM1 transcripts were detected at high levels in the petal limb and tube, and to a much lesser extent in the sexual organs, stem, and root. PhCM2 transcripts were detected in all tissues examined with relatively high lev els in the petal tube and stem tissues. The MD flower development series consisted of whole flowers collected at 11 consecutive stages beginning from a small bud to floral senescence (Figures 35B and 3 6B). PhCM1 transcripts were detected at relatively lo w levels throughout the closed bud stages of development (stages 1 5). Relatively high levels of PhCM1 transcripts were detected at anthesis (stage 6) and throughout all open flower stages of development examined (stage 710). PhCM1 transcripts were detect ed at the lowest level in observably senescing flower tissue (stage 11). PhCM2 transcripts were detected at similar levels throughout all stages examined except for stage 11 (Figures 3 5B and 36B). The ethylene study used excised whole flowers from MD and an ethyleneinsensitive ( CaMV 35S:: etr1 1) transgenic petunia line, 44568 (Wilkinson et al., 1997) All flowers were treated with air or ethylene (2 L L1) for 0, 1, 2, 4, and 8 hours beginning at 12:00 h with an experimental end time of 20:00 h (Figures 35C and 3 6C). PhCM1 transcripts were reduced in MD flowers after four hours of ethylene treatment compared to air treatments, while no change in PhC M1 transcript level was observed in experiments using 44568. In contrast, PhCM2 transcript levels were unchanged throughout the treatment conditions in both

PAGE 62

62 genetic backgrounds. Together, these results indicate the transcript accumulation profile for PhCM1 is similar to that of known FVBP genes and is therefore sufficient for FVBP production. Total CM A ctivity in P etunia F lowers To investigate whether CM activity contributes to daily substrate pool oscillations (Underwood et al., 2005; Orlova et al., 2006) and concomitant rhythmic emission of FVBPs in MD (Verdonk et al., 2005) we developmentally staged MD flowers and collected whole corollas at three time points over the course of 24 h. Desalted crude protein extracts were obtained, and total CM activit y was assayed for each timepoint with close attention paid to nonenzymatic chorismic acid breakdown (Figure 3 7). Throughout the three daily time points, total CM activity was unchanged with an approximate specific activity average of 0.07 nkat mg1. Not discounting the presence of a regulatory molecule in vivo which may be lost through the extraction process, total CM activity in crude protein extracts from stage 9 and 10 MD corollas, did not parallel that of FVBP emission profiles. Functional C omplemen tation and R ecombinant E nzyme A ctivity of PhCM1 and PhCM2 In spite of the high homology to other CMs at the amino acid level, it was necessary to test the biochemical function of both PhCM1 and PhCM2. The mature coding sequences for both genes were cloned into a pET 32 vector and transformed into the CM deficient E. coli transformant KA12/pKIMP UAUC, which was provided by Dr. Peter Kast at the Swiss Federal Institute of Technology Zurich. The KA12/pKIMP UAUC system requires the complementation of both pheny lalanine and tyrosine auxotrophies while under a double antibiotic selection and has been well characterized (Kast et al., 1996; Kast et al., 2000) Both pET 32PhCM1 and pET 32PhCM2 complemented KA12/pKIMP UAUC when grown on minimal media without the addition of phenylalanine and tyrosine as compared to all controls (Table 31). This result

PAGE 63

63 indicates both PhCM1 and PhCM2 encode proteins that are suf ficient for the enzymatic, intramolecular conversion of chorismic acid to prephenic acid. We then utilized the pET 32CM vectors to transform E. coli strain BL21(DE3)pLysS with the aim of generating recombinant proteins for PhCM1 and PhCM2. PhCM1 and PhC M2 proteins were purified by Ni2+ affinity chromatography and assayed for CM activity with and without the addition of the aromatic amino acids (Figure 3 8). PhCM2 had a specific activity of approximately 5.0 nkat mg1 and was not affected by the presence of aromatic amino acids. However, PhCM1 specific activity was close to 2.2 nkat mg1 and increased approximately three fold in the presence of tryptophan. As is the case in Arabidopsis, opium poppy, and tomato (Benesova and Bode, 1992; Eberhard et al., 1996a; Eberhard et al., 1996b; Mobley et al., 1999) the cytosolic PhCM2 is not allosterically regulated by the aromatic amino acids. In contrast to allosteric regulation patterns found for plastidic CMs in Arabidopsis and poppy, phenylalanine and tyrosine had no effect on PhCM1 enzymatic activity, but try ptophan regulation is similar in magnitude to AtCM1 (Eberhard et al., 1996b) Suppression of PhCM1 by RNAi Because the transcript accumulation profile for PhCM1 is similar to known FVBP genes (Figures 3 5 and 36) and the subcellular location for PhCM1 is in the plastidial stroma (Figures 33A and 34), PhCM1 was chosen for RNAi mediated gene silencing. A 213 bp fragment at the 3 end of the PhCM1 coding sequence was used fo r the RNAi inducing fragment (Figure 3 9). Since the PhCM1 RNAi fragment was less than 60 % homologous to the corresponding region of PhCM2 we hypothesized PhCM2 expression and possibly any other gene family members would be unaffected by the PhCM1 silenc ing construct driven by a constitutive promoter (pFMV).

PAGE 64

64 Fifty independent PhCM1 RNAi (CM1R) plants were generated by leaf disc transformation, and analyzed for reduced levels of PhCM1 transcripts when compared to MD by sqRT PCR. Eight plants were chosen for further analysis and selfpollinated to produce T1 seeds. Five transgenic T1 CM1R lines segregated in an expected 3:1 manner for the transgene, and these lines were more extensively studied for gene transcript accumulation and FVBP emission differences compared to MD. Representative individuals from three independent T1 CM1R lines (2 4, 249, and 33 9) showed reduced PhCM1 transcript levels, but PhCM2 transcript levels were unchanged (Figure 310). Additionally, when transcript levels of multiple other genes in the shikimate, phenylpropanoid, and FVBP pathways were analyzed, no differences were observed. All three selected T1 CM1R lines showed similar FVBP emission profiles. Using MD FVBP emission levels as a reference, phenylacetaldehyde was reduced 85 to 89 % in the CM1R lines (Figure 3 11). The emissions of three volatile compounds derived from t rans cinnamic acid (benzaldehyde, benzyl benzoate, and methyl benzoate) were reduced by 73 to 84 %, 62 to 75 %, and 50 to 68 %; respectively. Isoeugenol emissi on was modestly lower in the CM1R lines when compared to MD (14 to 28 %), but was not reduced as much as the rest of the major FVBPs analyzed here. Total FVBP emissions were abated by 33.5 to 40.9 % in the T1 CM1R lines as compared to MD (Figure 311). Taken together, these data suggest the lower level of PhCM1 transcripts in the CM1R lines resulted in lower levels of prephenic acid available for phenylalanine synthesis, and thus, concomitant FVBP emission. All T1 CM1R lines were self pollinated and T2 generation plants were screened for homozygosity. The screen resulted in two homozygous T2 CM1R lines, termed 249 and 338 (Figure 3 12). Whole corollas from stage 9 MD, 249, and 338 plants were used for quantitative transcript accumulation and quantitat ive total CM activity assays (Figure 3 13). Compared to

PAGE 65

65 MD, transcript accumulation for PhCM1 was reduced in 24 9 and 33 8 by 80 to 85 %, while PhCM2 transcript accumulation was unaffected (Figure 3 13A). Total CM specific activity from desalted crude extr acts from 24 9 and 338 was reduced by 81 to 84 % compared to MD (Figure 313B). Together, these results indicate the reduction of PhCM1 transcript and subsequent total CM activity are sufficient for the reduction in total FVBP emission in the CM1R lines c ompared to MD. 249 and 338 were grown side by side with MD numerous times and no observable phenotypic differences were observed. There were no significant differences between MD, 24 9, and 338 in seed germination, nor in fresh weight, number of true l eaves, aerial height (of nine week old plants), or stem lignin content (Figures 3 14 and 315). Discussion CHORISMATE MUTASE (CM) has been extensively studied in prokaryotes and fungi, but comparatively less is known about CM in higher plants. The enzymat ic reaction of CM is the initial committed step in synthesis of the aromatic amino acids phenylalanine and tyrosine (Haslem, 1993), and MD corollas synthesize and emit large quantities of volatile benzenoid/phenylpropanoid compounds, which are putatively d erived from phenylalanine (Boatright et al., 2004). Therefore, we chose to investigate CM in petunia flowers through reverse genetic, molecular, biochemical, and metabolic approaches. The results indicate that PhCM1 has a major role in the production of FV BPs in petunia flowers. In petunia, two CM cDNAs have been isolated. PhCM1 is plastid localized based on a putative cTP sequence and a chloroplast import assay (ChloroP 1.1; Zybailov et al., 2008) [Figure 3 4]. Of the two putative plastidic Arabidopsis CMs, PhCM1 shares the highest identity to AtCM1 (Figure 33B). Transcript accumulation sugge sts that AtCM1 possesses a distinct role in the supply of phenylalanine and tyrosine under stressed conditions, while AtCM3 activity can

PAGE 66

66 produce requisite levels of prephenic acid under nonstressed growing conditions (Eberhard et al ., 1996b; Mobley et al., 1999) PhCM2 is likely to be located in the cytosol due to the lack of a signal peptide (Figure 33A), inability to be imported into a chloroplast (Figure 34), and the lack of allosteric amino acid regulation (Figures 33A and 38) similar to the cytosolic isoforms in Arabidopsis, tomato, and poppy (AtCM2, LeCM1, and CM2 from poppy) [ Benesova and Bode, 1992; Eberhard et al., 1996a; and Eberhard et al., 1996b] Recently, a subcellular localization study in Arabidopsis leaf tissue w ith all six arogenate dehydratases and two arogenate dehydrogenases showed these proteins, which are responsible for the ultimate production of phenylalanine and tyrosine (respectively), are plastidic proteins. Furthermore, pathway intermediates are confin ed to the plastid (Rippert et al., 2009) This indicates cytosolic isoforms of CM are separated from substrate and other pathway proteins under normal growing conditions. Therefore, PhCM2 most likely does not have a major role in the production of prephenic acid during nonstressed growing conditions, as proposed for AtCM3. We searched extensively for additional CM sequences in petunia, but did not isolate a potential PhCM3 That said, two lines of evidence support the existence of other pl astidic CM family members in non floral tissues of petunia and at the same time illustrate the biological specificity of PhCM1 (1) The CM1R RNAi transgenic plants are not observably impaired in vegetative growth compared to MD plants (Figures 314 and 315), but show a specific FVBP phenotype (Figures 311). (2) Relative transcript accumulation for PhCM1 is extremely low in all tissues examined except the corolla (Figures 3 5A and 3 6A). However, production of the aromatic amino acids phenylalanine and tyr osine are essential for cellular processes throughout the plant. The PhCM1 transcript accumulation profile is congruent with several other known FVBP genes in petunia. High levels of transcripts are detected in corollas from anthesis to senescence,

PAGE 67

67 and are reduced by ethylene exposure, which mimics the pollination event (Figure 3 5 and 36). PhCM2 transcript accumulation follows a more constitutive profile with a noticeable exception in senescing floral tissue of MD (stage 11) where transcript accumulates t o relatively high levels (Figures 3 5B and 36B). However, PhCM2 transcript accumulation does not appear to be affected by exogenous ethylene exposure (Figures 3 5C and 36C). This result implies that an increase in PhCM2 transcript abundance during senesc ence is not a direct effect of ethylene perceived at that developmental stage, and may provide a favorable situation to examine the biological function of cytosolic CM isoforms in planta. Since FVBP emission is rhythmic, transcript accumulation from FVBP biosynthetic genes are rhythmic, and intermediate substrate pools in the FVBP pathway oscillate from low to high in the evening (Underwood et al., 2005; Verdonk et al., 2005; Orlova et al., 2006) it is reasonable to hypothesize enzyme activity of one or more proteins in the FVBP pathway os cillate on a daily cycle. However, like PhBSMT activity (Kolosova et al., 2001) total C M activity is not significantly changed from morning to night in desalted crude extracts (Figure 3 7). Recombinant PhCM1 activity is increased in the presence of tryptophan (Figure 3 8), and so oscillations in the free tryptophan pool in vivo cannot be dis counted as a regulatory mechanism affecting rhythmic FVBP emission. AtCM1 and AtCM3 activities are allosterically down regulated by phenylalanine and tyrosine (Eberhard et al., 1996b; Mobley et al., 1999) but recombinant PhCM1 is unaffected by these aromatic amino acids (Figure 3 8). Petunia corolla limb tissue accumulates a large free phenylalanine pool in the evening with a calculated concentration of 5.5 mM (Kaminaga et al., 2006) Therefore, PhCM1 is sufficient to direct the flux of chorismic acid to the production of phenylalanine without feedback inhibition in the petunia flower. However, it must be noted that

PAGE 68

68 the phenylalanine concentrati on reported in petunia flowers is a whole tissue measurement, and compartmentalization of the free phenylalanine pool and PhCM1 at a subcellular level remains a plausible mechanism allowing for the large phenylalanine pool. That said, Arabidopsis thaliana tissues may not have a biological need for such a large phenylalanine pool, and it would be of interest to assay allosteric regulation of CMs from Arabidopsis lyrata ssp Petraea an outcrossing perennial, which emits relatively high levels of benzaldehyde and phenylacetaldehyde from floral tissues (Abel et al., 2009). RNAi mediated gene silencing produced transgenic petunia plants (CM1R) reduced in PhCM1 transcript, but not PhCM2 (Figure 3 10 and 313A), and total CM enzyme activity (Figure 3 13B) with a concomitant reduction of FVBP emission (Figure 311). Therefore, PhCM1 has a central role in the production of FVBPs in a petunia flower. Interestingly, total FVPB emission is reduced in CM1R lines to about 40 % compared to MD and recombinant PhCM1 activit y is increased over two fold in the presence of tryptophan (Figure 38). Therefore it is plausible the 20 % total CM activity would be increased in vivo by a presumably higher level of tryptophan in the flowers of the RNAi lines. Metabolic analysis of the PhCM1 RNAi lines (Figure 311) may illustrate the demand for substrate at each branch of the FVBP pathway. FVBPs derived directly from phenylalanine are the most affected by limiting substrate conditions, while the benzenoids formed from t rans cinnamic acid are affected significantly but to a lesser extent (Figure 3 11). In contrast, the phenylpropanoids derived from coniferyl acetate are the FVBPs least affected in the CM1R lines. However, too many variables may exist in the regulation at each branch po int of the pathway, and therefore we can only speculate. PhCM1 RNAi lines in conjugation with metabolite labeling experiments may aid in delineating the flux through the FVBP pathway in the future.

PAGE 69

69 Experimental Procedures Plant M aterials Inbred Petunia x hybrida cv Mitchell Diploid (MD) plants were utilized as a wild type control in all experiments. The ethylene insensitive CaMV 35S: etr1 1 line 44568, generated in the MD genetic background (Wilkinson et al., 1997) was utilized as a negative control for ethylene sensitivity where applicable. MD, 44568, and PhCM1 RNAi plants were grown as previously described (Dexter et al., 2007) Ethylene treatments used two L L1 of ethylen e with air treatments for controls. cDNA I solation Partial sequences from the SGN (http://www.sgn.cornell.edu) petunia EST database (Unigene: SGN U208050) and from a petunia root EST collection (EST ID: dr001P0018N07_F.ab1), courtesy of Didier Reinhardt a t the University of Fribourg, were used as references to obtain full length cDNAs by 5 and 3 race with the SMART RACE cDNA Amplification Kit (Clontech Laboratories, Inc., Mountain View, CA) as per manufacturers protocol. A resulting 1257 bp cDNA had a 975 bp coding sequence (GenBank accession number: EU751616) for a predicted 324 amino acid protein and was termed PhCM1 while another 913 bp cDNA had a 792 bp coding sequence (EU751617) for a predicted 263 amino acid protein termed PhCM2 Both PhCM1 and PhCM2 c oding sequences were amplified by Phusion Hot Start High Fidelity DNA Polymerase (New England Biolabs, Inc., Ipswich, MA) and were cloned into a pGEMT EASY vector (Promega Corp., Madison, WI), which were extensively sequenced and checked for errors. Thes e constructs were used as template to clone the predicted mature PhCM1 and PhCM2 coding sequences into a pET 32 EK/LIC vector (Novagen, Gibbstown, NJ).

PAGE 70

70 Transcript accumulation analysis All experiments were conducted with at least two biological replicate s with equivalent results observed. In all cases, total RNA was extracted as previously described (Verdonk et al., 2003) and subjected to TURBO DNase treatment (Ambion Inc., Austin, TX) followed by total RNA purification with RNeasy Mini protocol for RNA cleanup (Qiagen, Valencia, CA). Tot al RNA was then quantified on a NanoDrop 1000 spectrophotometer (Thermo Scientific, Wilmington, DE) and 50 ng/l dilutions were prepared and stored at 20oC. Semi quantitative (sq)RT PCR was performed on a Veriti 96well thermal cycler (Applied Biosys tems, Foster City, CA). All sqRT PCR reactions used a Qiagen One step RT PCR kit with 50 ng total RNA template. To visualize RNA loading concentrations, samples were amplified with Ph18S primers and analyzed on an agarose gel. Gene specific primers were de signed and utilized for the visualization of the relative transcript accumulation levels (Table 3 2). The spatial transcript accumulation series consisted of total RNA isolated from root, stem stigma, anther, leaf, petal tube, petal limb, and sepal tissue s of three individual MD plants at 16:00 h on multiple occasions over the course of a year. The developmental transcript accumulation series consisted of MD floral tissue collected at eleven different stages; floral bud < 0.5 cm (stage 1), bud 0.5 < 1.5 cm (2), bud 1.5 < 3.0 cm (3), bud 3.0 < 5.0 cm (4), bud fully elongated 5.0 < 6.5 cm (5), flower opening 0 < 2 cm limb diameter (anthesis) [6], flower fully open day 0 (7), day 1 (8), day 2 (9), day 3 (10), and observably senescing flower (flower open day 7 for MD), stage 11. All tissues were collected at 16:00 h on the same day, and total RNA was isolated from all samples collected. The developmental tissue collections were conducted multiple times over the course of a year. The exogenous ethylene series con sisted of excised MD and 44568 stage 9 flowers (placed in tap water) placed into eight tanks, four for ethylene

PAGE 71

71 treatments and four for air treatments. Air and ethylene treatments were conducted for 0, 1, 2, 4, and 8 hours starting at 12:00 h. Immediately following treatment, each of the flower samples were collected, stored at 80oC, and total RNA was isolated from all corolla tissues once all samples had been collected. The ethylene treatment experiment consisted of two biological replicates and was condu cted twice. For all tissue collections individual samples consisted of three flowers. Quantitative (q)RT PCR was performed and analyzed on a MyIQ real time PCR detection system (Bio Rad Laboratories Inc., Hercules, CA). Stage 9, whole corolla tissue was c ollected from MD and two independent homozygous T2 PhCM1 RNAi lines at 16:00 h. Total RNA was isolated from all samples as described earlier and transcript accumulation was initially analyzed by sqRT PCR. For subsequent qRT PCR analysis the Power SYBR Gre en RNA to Ct 1Step Kit (Applied Biosystems, Foster City, CA) was used to amplify and detect resulting products following the manufacturers protocol. qRT PCR primers (Table S2) were constructed with Primer Express software v2.0 (Applied Biosystems, Foster City, CA) demonstrated gene specificity during melt curve analysis, and then optimized. Protein E xtraction, O verproduction, and P urification Desalted crude protein extracts were obtained from whole corolla tissue by grinding in a mortar and pestle with liquid Nitrogen until a fine powder, addition of chilled extraction buffer (50 mM Bis Tris HCl pH 6.9, 10 mM B mercaptoethanol, 5 mM Na2S2O5, 1 % PVP, 1:100 protease inhibitor cocktail [Sigma, P9599], and 10 % glycerol), centrifugation at 4oC (Beckman Coulter, Avanti J 25) to separate cellular debris, and further separation of low molecular weight substances with a PD 10 desalting column (GE Healthcare, Piscataway, NJ). Total crude protein concentration was determined by the Bradford method using BSA as a standard (Rio Rad).

PAGE 72

72 Biologically active pET 32PhCM1 and pET 32 PhCM2 were expressed in E. coli BL21(DE3)/pLysS with an induction of 1 mM IPTG overnight at 37oC. Induction was analyzed from crude cellular extracts on a 10 % polyacrylamide, Tris HCl R eady Gel (Bio Rad). Soluble protein was obtained from induced cells lysed with BugBuster protein extract reagent and affinity purified with His Band resin chromatography (Novagen). The resulting recombinant proteins were then separated from any low molec ular weight compounds and concentrated with 30,000 NMWL Amicon Ultra 4 centrifugal filter devices (Millipore, Billerica, MA). Recombinant protein concentration was determined by the Bradford method using BSA as a standard. CHORISMATE MUTASE E nzyme A ctivi ty A ssays Specific activities in vitro were resolved by carefully following the absorb ance of chorismic acid spectrophotometrically (Bio 1 cm1) (Gilchrist and Connelly, 1987; Kast et al., 1996) All assays were conducted at 30oC with 0.5 mM chorismic acid (> 90 %, Sigma, C1761) in 50 mM KPO4 buffer, pH 7.6. Where state d, 50 M phenylalanine, tyrosine, and tryptophan (Sigma: P2126, T3754, and T0254; respectively) were used to assay for allosteric regulation of enzyme activity. Non enzymatic chorismic acid breakdown along with inactive protein controls were used to normal ize all data generated. Additionally, no activity was detected when purified tag fusion proteins from the empty pET 32 vector were used. Multiple biological replicates and corresponding technical replicates were used to generate all data shown. Chloropl ast I mport A ssay Full length coding sequences for PhCM1 and PhCM2 were cloned into a pGEMT Easy (Promega, Madison, WI) vector in the SP6 orientation. The chloroplast import assay was conducted as described previously (Martin et al., 2009). Briefly, in vi tro transcription and

PAGE 73

73 translation with wheat germ TNT (Promega, Madison, WI) resulted in radiolabeled PhCM1, PhCM2, and PsOE23, which were individually incubated with isolated pea chloroplasts for 15 min. After import, the isolated chloroplasts were treate d with 100 g ml1 thermolysin for 40 min at 4oC as depicted in the figure. Proteolysis was terminated by the addition of EDTA to a final concentration of 10 mM, and the intact chloroplasts were then repurified by centrifugation through 35 % Percoll. Chlor oplasts were washed, lysed, and fractionated into total membranes and stromal extracts by centrifugation for 18 min at 15,000 x g. The translation products, chloroplasts, thermolysin treated chloroplasts, stromal extracts, and total membranes were analyzed with SDS PAGE and fluorography. In figure 34, PhCM2 and PsOE23 are from a 20 hour exposure. PhCM1 is from a 4 day exposure. These are from two different gels of the same samples loaded the same. The panels have been cropped and contrast adjusted, but no other modifications. Volatile E mission For all volatile emission experiments, emitted floral volatiles from excised flowers were collected at 17:00 h and quantified as previously described (Under wood et al., 2005; Dexter et al., 2007) Generation of PhCM1 RNAi T ransgenic P etunia The generation of PhCM1 RNAi transgenic plants was as describe earlier (Dexter et al., 2007) but with two fragments of the PhCM1 cDNA (Figure S3) amplified and ligated end to end in a sense/antisense orientation with additional sequence information used for an inter fragment intron (hairpin). Acknowledgements This work was supported by grants from the USDA Nursery and Floral Crops Initiative (grant #: 00058029), the Fred C. Gloeckner Foundati on (grant #: 00070429), Florida Agricultural

PAGE 74

74 Experiment Station (grant #: 00079097), and in part by National Institutes of Health (grant #: R01 GM46951 to KC). The authors wish to thank Dr. Harry Klee (Horticultural Sciences Department, University of Flori da) for critically reviewing the manuscript and Dr. Peter Kast ( Swiss Federal Institute of Technology Zurich, Switzerland) for providing the CM deficient E. coli transformant KA12/pKIMP UAUC.

PAGE 75

75 Table 3 1. Functional complementation of CM deficient E. coli K A12/pKIMP UAUC. M9c minimal media was used for all experiments and supplemented with 20 g/ml of L phenylalanine and L tyrosine where stated. Antibiotics used were chloramphenicol [Ch] (30 g/ml) for selection of the pKIMP plasmid and carbenicillin [Ca] (1 00 g/ml) for selection of the pET 32 plasmid. KA12/pKIMP lysogenic E. coli so bacteriophage CE6 (Novagen, cat# 69390) infection was used to induce transcription from the pET 32 T7 promoter where stated and no CE6 administered (NA) wher e stated. Transformants were incubated at 37oC for two days, and growth was scored as a plus (+) or minus ( ). A sample of positive colonies was picked and colony PCR was performed for confirmation of pET 32CM1 or pET 32CM2 plasmids.

PAGE 76

76 Table 3 2. Gene specific primers used for the transcript accumulation analyses throughout this study.

PAGE 77

77 Figure 3 1. Aromatic amino acid biosynthesis pathway. CHORISMATE MUTASE directs the flux of metabolites from the shikimate pathway into the phenylpropanoid pathway by catalyzing a [3,3] sigmatropic rearrangement of chorismate to prephenate. Phenylalanine is thought to be the precursor for the majority of the volatile benzenoids/phenylpropanoids emitted by a petunia flower.

PAGE 78

78 Figure 3 2. PhCM1 and PhCM2 CDS alignme nt using the Align X program in Vector NTI advance 10.3.0 software package (Invitrogen; Carlsbad, CA). PhCM1 and PhCM2 share 46.1 % identity at the nucleotide level.

PAGE 79

79 Figure 3 3. Predicted peptide sequence alignment and an unrooted neighbor joining phy logenetic tree of CM proteins from various species. Sequences represented are from Arabidopsis thaliana (accession: NP_566846, NP_196648, and NP_177096), Fagus sylvatica (ABA54871), Solanum lycopersicum (AAD48923), Nicotiana tabacum (BAD26595), Oryza sativa (NP_001061910), Petunia x hybrida (EU751616, EU751617), Vitis vinifera (CAO15322), Zea mays (AY103806), and Saccharomyces cerevisiae (NP_015385). (a) Sequences were aligned using the AlignX program of the Vector NTI Advance 10.3.0 software (Invitrogen). Residues highlighted in: blue represent consensus residues derived from a block of similar residues at a given position, green represent consensus residues derived from the occurrence of greater than 50 % of a single residue at a given position, and yellow represent consensus residues derived from a completely conserved residue at a given position. Petunia sequences are highlighted in red to the left, a red vertical bar represents the beginning of the mature protein sequence used for PhCM1, and a red box i ndicates an allosteric regulatory site (GS). (b) TREEVIEW software with the nearest joining method was used to create the resulting tree. Scale bar represents distance as the number of substitutions per site (i.e., 0.1 amino acid substitutions per site).

PAGE 80

80 Figure 3 4. Plastid import assay. Radiolabeled PhCM1, PhCM2, and PsOE23 were individually incubated with isolated pea chloroplasts. After import, the isolated chloroplasts were treated with thermolysin as depicted in the figure. Proteolysis was terminated and the intact chloroplasts were then repurified, washed, lysed, and fractionated. PsOE23 is a thylakoid lumen protein with a stromal intermediate, which was used as a positive control. The translation products (tp), chloroplasts (Cp), thermolysin treat ed chloroplasts (Cp*), stromal extracts (SE), and total membranes (M) were analyzed with SDS PAGE and fluorography. Positions of the molecular weight marker are depicted on the left.

PAGE 81

81 Figure 3 5. sqRT PCR transcript accumulation analysis of PhCM1 and P hCM2 in petunia. Spatial analysis used root, stem, stigma, anther, leaf, petal tube, petal limb, and sepal tissues of MD harvested at 16:00 h (A). Floral developmental analysis used MD flowers from 11 sequential stages at 16:00 h (B). Ethylene treatment (t wo L L1) analysis used excised MD and 44568 whole flowers treated for 0, 1, 2, 4, and 8 hours (C).The number of cycles used for amplification of each transcript is shown on the right. Ph18S was used as a loading control in all cases.

PAGE 82

82 Figure 3 6. qRT PCR transcript accumulation analysis of PhCM1 and PhCM2 in petunia. Spatial analysis used root, stem, stigma, anther, leaf, petal tube, petal limb, and sepal tissues of MD harvested at 16:00 h (A). The spatial experiment consisted of one biological replicate used for sqRT PCR and one separate biological replicate with two technical replicates per biological replicate. Floral developmental analysis used MD flowers from 11 sequential stages at 16:00 h (B). The developmental analysis consisted of two biologica l replicates separate from the biological replicates used for the sqRT PCR with three technical replicates. Ethylene treatment (two L L1) analysis used excised MD and 44568 whole flowers treated for 0, 1, 2, 4, and 8 hours (C). The ethylene treated series consisted of one biological replicate used in the sqRT PCR with two technical replicates per biological replicate. PhFBP1 and Ph18S were used as references throughout these experiments.

PAGE 83

83 Figure 3 7. Total CM activity in desalted crude protein extracts from MD whole corollas starting at 9 h of stage 9 in flower development. (mean se; n = 6) Figure 3 8. Enzyme activity of and effects of aromatic amino acids on petunia CMs. Recombinant protein was assayed for enzymatic activity in 50 mM KPO4 buffer pH 7.6 with 0.5 mM chorismic acid (CA) as a substrate and 50 M phenylalanine (Phe), tyrosine (Tyr), and tryptophan (Trp) as allosteric effectors. (mean se; n = 4) Figure 3 9. Schematic representation and nucleotide comparison of RNAi region used for the production of petunia PhCM1 RNAi transgenic lines. 213 bases at the 3 end of the coding sequence of PhCM1 were chosen for the RNAi construct. This region shared 58.2 % identity with the corresponding nucleotide region from PhCM2

PAGE 84

84 Figure 3 10. sqRT PCR transcript accumulation analysis in floral tissues of three independent T1 PhCM1 RNAi lines. MD, CM1R 24, CM1R 249, CM1R 339 were used with primers specific for floral volatile benzenoid/phenylpropanoid, shikimate, and phenylpropanoid transcripts. The number of cycles used for amplification of each transcript is shown on the right. Ph18S was used as a loading control in all cases.

PAGE 85

85 Figure 3 11. Floral volatile emission analysis from three independent T1 PhCM1 RNAi lines (mean se; n = 3). Major volatile compounds shown from MD, CM1R 24, CM1R 249, CM1R 339 flowers. Figure 3 12. sqRT PCR transcript accumulation analysis in floral tissues of two independent, homozygous T2 PhCM1 RNAi lines. Individuals and biological replicates from MD, 249, 338 were used with primers specific for PhCM1 The number of cycles used for amplification of each transcript is shown on the right. Ph18S was used as a loading control.

PAGE 86

86 Figure 3 13. Comparative transcript analysis and total CM activity between MD and representative individuals from independent homozygous T2 PhCM1 RNAi lines. (A) qRT PCR was carried out with two biological replicates and three technical replicates per biological replicate. The entire experiment was done i n duplicate, and analyzed by PhFBP1 and Ph18S as the internal references. (B) Total CM activity in desalted crude protein extracts from whole corollas of MD and representative individuals from two independent homozygous T2 PhCM1 RNAi lines 249 and 338.

PAGE 87

87 Figure 3 14. Physiological comparison between MD and representative independent T2 PhCM1 homozygous RNAi lines 249 and 338 in 9 week old petunia seedlings (mean se; n = 5). Figure 3 15. Stem cross sections (between 7 8 node from apical meristem) from 9 week old petunias stained with Phlorogucinol. Shown are MD and representative individuals from two independent PhCM1 homozygous T2 RNAi lines, 249 and 338. Pictures are from light microscopy at 4X on a Leica MZ 16F and are repres entative of three biological replicates.

PAGE 88

88 CHAPTER 4 PHMYB5D8 EFFECTS PHC 4H TRANSCRIPTION IN THE PETUNIA COROLLA Introduction Floral fragrance consists of an array of volatile organic compounds. These volatile compounds are generally lipophilic liquids w ith high vapor pressures and putatively cross biological membranes by passive diffusion in the absence of a barrier (Pichersky et al., 2006). Many angiosperm species produce floral fragrance and each species produces a unique blend of volatile organic compounds, which facilitate environmental interaction (reviewed in Dudareva et al., 2006). The emission of floral volatiles can reach between 30 and 150 g h1 for some species (Knudsen and Gershenzon, 2006; personal calculation). Therefore, the complexity and stringency of regulation imparted upon floral volatile production is not surprising. Petunia x hybrida cv Mitchell Diploid (MD) has been used as a model system for floral volatile compound studies for nearly a decade. MD has relatively large, white flowers that produce large amounts of floral volatile compounds. Volatile benzenoid and phenylpropanoid compounds dominate the floral mixture of volatile compounds emitted by the MD flower (Schuurink et al., 2006) [Figure 11]. In MD, floral volatile benzenoi d/phenylpropanoid (FVBP) production is confined to the corolla limb tissue subsequent to anthesis and until senescence, and high levels of emission peak during the dark period (Kolosova et al., 2001a; Verdonk et al., 2003; Underwood et al., 2005; Verdonk et al., 2005) Additionally, FVBP production and emission is severely reduced after a successful pollination and fertilization event or 10 h of exogenous ethylene exposure in petunia (Figures 2 6 and 28; Negre et al., 2003; Underwood et al., 2005; Dexter et al., 2007; Dexter et al., 2008). In petunia, FVBPs are all putatively derived from the aromatic amino acid phenylalanine (Boatright et al. 2004) and the production of individual FVBP compounds stems from the

PAGE 89

89 phenylpropanoid pathway at phenylalanine, t rans cinnamic acid, and ferulic acid (Figure 1 1). Numerous proteins must be involved in the production of FVBPs from the shikimate pathway to the end biochemical steps resulting in the direct formation of volatile compounds. To date, nine genes have been identified to encode proteins associated with the production of FVBPs in petunia: PhBSMT1 PhBSMT2 PhBPBT PhPAAS PhIGS1, PhEGS1 PhCFAT Ph CM1 and PhODO1 (Negre et al., 2003; Boatright et al., 2004; Underwood et al., 2005; Verdonk et al., 2005; Kaminaga et al., 2006; Koeduka et al., 2006; Orlova et al., 2006; Dexter et al., 2007; Dexter et al., 2008; Koeduka et al., 2008; Chapter 3) [Figure 1 1]. The first six petunia genes listed are involved in the direct form ation of FVBP compound, while PhCFAT and PhCM1 are associated with the production of intermediate metabolites. PhODO1 is an R2R3MYB transcriptional regulator that is involved in the transcriptional control of shikimate and phenylpropanoid pathway genes, hence metabolite production. All the FVBP genes are coordinately, transcriptionally regulated concomitant to FVBP emission (Chapters 2 and 3). That is, high levels of transcript accumulation from the FVBP genes is confined to the corolla limb, after anthes is and to senescence, each transcript has a peak accumulation through a daily cycle, and transcript accumulation is greatly reduced after a successful pollination/fertilization event or exposure to ethylene. The regulation of FVBP gene transcription is tig htly controlled as appears to be a direct relationship with FVBP emission in a spatial, developmental, and hormone interaction context (Verdonk et al., 2003, Underwood et al., 2005; Verdonk et al., 2005; Chapter 2). Since all the identified petunia genes involved in FVBP production display similar transcript accumulation profiles, we hypothesized that at least a subset of genes involved in the regulation of FVBP gene transcript accumulation would share similar transcript accumulation

PAGE 90

90 profiles. Additionally, because a single R2R3 MYB transcriptional regulator has been previous identified as a FVBP metabolite regulator, and multiple R2R3 MYBs have been shown to function in a single pathway; we hypothesized that multiple R2R3 MYB transcriptional regulators are responsible for the overall level of regulation imparted upon the FVBP pathway. Therefore, we examined multiple sequences homologous to R2R3MYBs through a transcript accumulation screen, which produced a candidate with a similar transcript accumulation pr ofile as the FVBP genes, PhMYB5d8 A reverse genetic approach to test gene function generated transgenic petunia plants with elevated levels of isoeugenol and eugenol emission. The following results indicate multiple transcriptional regulators are responsible for the precise production and subsequent emission of FVBP in petunia. Results Identification of PhMYB5d8 We were interested in the regulation of the FVBP gene network; therefore, we searched a publicly available petunia EST database (http:// www.sgn.cornell.edu) for sequences with high similarity to the conserved R2R3 domain of Arabidopsis R2R3MYB proteins. This search produced multiple results, but one Unigene sequence was chosen for further investigation, SGN U208628. Through a long standin g collaboration with Dr. Robert Schuurink (University of Amsterdam), the fulllength CDS sequence was obtained with the named PhMYB5d8. The predicted PhMYB5d8 amino acid sequence was 257 amino acids in length and predicted to be nuclear localized (WoLFPSOR T). When aligned with highly similar amino acid sequences from varying species (Figure 4 1) three main features were observed: an N terminal R2R3 domain, C1 motif (LLSRGIDPTTHXI), and a MYB subgroup 4 EAR domain (PDLNLELKISPP). Phylogenetic analysis demons trated that the two solanaceous MYB proteins (LeTH27 and PhMYB5d8) closely associate in an unrooted neighbor joining tree (Figure 42). PhMYB5d8

PAGE 91

91 shares 66.1 and 55.9 % identity with LeTH27 and AtMYB4, respectively. Of these two potential orthologs, AtMYB4 is best characterized in the literature with a supported function as a transcriptional repressor of CINNAMATE 4HYDROXYLASE ( C4H ) [Jin et al., 2000]. PhMYB5d8 transcript abundance analysis Four criteria of transcript accumulation spatial, flower developme nt, daily time course, and ethylene treated were chosen for analysis by semi quantitative reverse transcriptase polymerase chain reaction (sqRT PCR) [Figure 4 3]. The spatial analysis consisted of root, stem, stigma, anther, leaf, petal tube, petal limb, a nd sepal tissues (Figure 4 3A). PhMYB5d8 transcripts were detected at relatively high levels in the petal limb, petal tube, anthers, stigma, and to a lesser extent in stem tissue. The MD and 44568 flower developmental series consisted of whole flowers coll ected at 11 consecutive stages beginning from a small bud to floral senescence (pictured in Figure 2 2). PhMYB5d8 transcripts were detected at relatively low levels throughout the closed bud stages of development in both genetic backgrounds (Figure 4 3B). Relatively high levels of PhMYB5d8 transcripts were detected at anthesis (stage 6) and throughout all open flower stages of development examined in both MD and 44568 (stage 710). PhMYB5d8 transcripts were detected at the lowest level in observably senesci ng MD flower tissue (stage 11). In contrast, PhMYB5d8 transcripts were detected at relatively high levels in observably senescing 44568 floral tissue, suggesting ethylene sensitivity is required to reduce transcript levels as observed in MD tissue at the s ame stage (Figure 4 3B). The daily time course analysis used MD plants acclimated in a growth chamber with a long day photoperiod and samples collected every three hours for a total of 36 hours (Figure 43C). PhMYB5d8 transcripts were detected at relativel y high levels between 15:00 and 24:00 h, which is similar to PhODO1 transcript accumulation pattern throughout a daily time course analysis (Figure 2 9; Verdonk et al., 2005). The ethylene study used excised whole flowers from MD and an ethyleneinsensitiv e

PAGE 92

92 ( CaMV 35S:: etr1 1) transgenic petunia line, 44568 (Wilkinson et al., 1997) All flowers were treated with air or ethylene (2 L L1) for 0, 1, 2, 4, and 8 hours beginning at 12:00 h with an experimental end time of 20:00 h (Figure 4 3D). PhMYB5d8 transcripts were reduced in MD flowers after eight hours of ethylene treatment compared to air treatments, while no change in PhMYB5d8 transcript level was ob served in experiments using 44568. Together, these results indicate the transcript accumulation profile for PhMYB5d8 is similar to that of known FVBP genes and suggests PhMYB5d8 may be involved in FVBP production in petunia. Suppression of PhMYB5d8 by RNAi The transcript accumulation profile for PhMYB5d8 is similar to known FVBP genes (Figures 4 3, 21, 23, 2 9, and 35); therefore, PhMYB5d8 was chosen for RNAi mediated gene silencing. A 200 bp fragment at the 3 end of the PhMYB5d8 coding sequence was us ed for the RNAi inducing fragment (Figure 4 4). Fifty independent PhMYB5d8 RNAi ( PhMYB5d8R ) plants were generated by leaf disc transformation, and analyzed for reduced levels of PhMYB5d8 transcripts by sqRT PCR (Figure 4 5). PhMYB5d8 transcript accumulation from at least nine individual T0 PhMYB5d8 R plants was detected at relatively low levels compared to MD samples, while PhMYB5d8 transcript accumulation from three representative PhMYB5d8R plants was detected at similar levels as MD. Due to the previous ly reported function for AtMYB4 (Jin et al., 2000), PhC4H transcript accumulation was also assayed (Figure 4 5). PhC4H transcript accumulation was detected at relatively higher levels in all 9 PhMYB5d8 R plants with reduced levels of PhMYB5d8 transcripts. PhC4H transcript accumulation was detected at similar levels in MD and the representative PhMYB5d8 R plants with wildtype levels of PhMYB5d8 transcripts. Additionally, when transcript levels of multiple other genes in the shikimate, phenylpropanoid, and FV BP pathways were analyzed, no differences were observed between

PAGE 93

93 MD, PhMYB5d8R with the expected reduced transcript levels of PhMYB5d8, and the transgenic control plants (data not shown). Multiple, independent T0 PhMYB5d8R plants displayed a reduced leve l of PhMYB5d8 transcripts, and an elevated level of PhC4H transcripts (Figure 4 5). The C6C3 FVBP compounds, isoeugenol and eugenol, are downstream of C4H in the biosynthesis pathway (Figure 1 1). Therefore, we hypothesized elevated levels of PhC4H transc ripts would increase C4H activity with a concomitant increase of metabolites directed to the production of isoeugenol and eugenol; thus, high levels of emission for these C6C3 compounds in PhMYB5d8R flowers compared to wildtype flowers. Six of the major FVBP compounds were analyzed from stage 9 (Figure 2 2) corollas of MD and PhMYB5d8R plants (Figure 46). Benzaldehyde and benzyl benzoate were detected at similar levels throughout all samples. Methyl benzoate and phenylacetaldehyde were detected at lower levels in the PhMYB5d8R corollas with reduced levels of PhMYB5d8 transcript when compared to MD and PhMYB5d8R 34 (wildtype levels of PhMYB5d8 transcript). Isoeugenol and eugenol emission was detected at higher levels in the PhMYB5d8R corollas with reduced levels of PhMYB5d8 transcript, while MD and PhMYB5d8R 34 corollas emitted comparable levels of isoeugenol and eugenol (Figure 4 6). These results suggest that a reduction of PhMYB5d8 transcript elevates PhC4H transcript levels and emission of isoeugenol and eugenol. Discussion In petunia, floral volatile benzenoid/phenylpropanoid production and emission is both complex and controlled. Gene regulation is a key aspect of control, which appears coordinate through multiple categories that can be utilized to screen candidate genes possibly involved in the production of FVBPs (Chapter 2). Employing this similarity screen by sqRT PCR provided a cost effective and efficient method for the isolation of multiple genes involved in FVBP

PAGE 94

94 production like PhMYB5d8 PhMYB5d8 predicted amino acid sequence is highly similar to a family of proteins called R2R3 MYB transcriptional regulators (Figure 4 1) [Stracke et al., 2001]. A small conserved domain (EAR domain) in the C terminal half of the protein, LNL(E/D)L, puts Ph MYB5d8 into subgroup 4 and supports a repression function (Ohta et al., 2001). Additionally, the most similar Arabidopsis R2R3MYB is AtMYB4 (Figure 4 2). AtMYB4 represses the transcription of the phenylpropanoid pathway gene, CINNAMATE 4HYDROXYLASE (C4H) [Jin et al., 2000]. PhMYB5d8 transcripts accumulate to the highest levels in corolla tissue from anthesis to senescence (Figure 4 3A, B). PhMYB5d8 transcript accumulation oscillates through a daily cycle similar to PhODO1 (Figures 4 3C and 29), and transcript accumulation appears to be reduced after eight hours of ethylene exposure (Figure 4 3D). In short, PhMYB5d8 transcripts are present in the tissue responsible for FVBP production, at the same developmental stages when FVBP are emitted, in a rhythmic pattern similar to the only other transcriptional regulator shown to be involved in FVBP production, and is affected by hormone exposure. The PhMYB5d8 transcript analysis and function of AtMYB4 suggests PhMYB5d8 may be involved in the regulation of FVBP pr oduction in petunia. To test the gene function of PhMYB5d8 directly, we generated transgenic PhMYB5d8RNAi petunia plants by using a 200 bp sequences at the 3 end of the coding sequence as an RNAi trigger (Figure 4 4). At least nine independent T0 PhMYB5d 8RNAi plants had reduced levels of the desired PhMYB5d8 transcripts (Figure 4 5). Similar to what was found in Arabidopsis with a dSpm insertion A tmyb4 line (Jin et al., 2000), PhC4H transcripts accumulate to higher levels in the PhMYB5d8 RNAi plants comp ared to MD and transgenic controls (Figure 45). These results suggest that PhMYB5d8 negatively regulates PhC4H transcript accumulation.

PAGE 95

95 However, it must be clear; we examined the transcript accumulation of specific genes and not a comprehensive set such a s used in a microarray. In addition, we did not perform any direct assays to test for protein promoter interactions. Both microarray and proteinpromoter assays will be conducted in the near future. Because PhC4H transcript accumulation was increased in t he PhMYB5d8RNAi plants (Figure 4 5) and three FVBP compounds are downstream of C4H (Figure 11), we analyzed the emission of only major FVBP compounds (Figure 46). Four independent PhMYB5d8RNAi plants emitted 3 to 4 fold higher levels of isoeugenol and eugenol compared to all controls. Emission of benzaldehyde, methyl benzoate, and phenylacetaldehyde were varied among the PhMYB5d8RNAi plants compared to the controls, but the magnitude of difference was much smaller than observed for isoeugenol and eug enol (Figure 4 6). Together the transcript accumulation and FVBP emission analyses of the PhMYB5d8RNAi plants indicate higher levels of PhC4H transcript results in higher levels of emitted FVBP compounds downstream of C4H. FVBP production is highly regula ted in petunia and likely consists of multiple interconnected factors. We found a cDNA that is highly similar to R2R3MYB transcriptional regulators, and contains an EAR domain, which has a repression function. The transcript accumulation profile of the Ph MYB5d8 is highly similar to other known FVBP genes. A reduction of PhMYB5d8 transcript accumulation results in an increase of PhC4H transcript accumulation, and an increase in emission of isoeugenol and eugenol. The data presented here suggests that PhMYB5 d8 negatively regulates PhC4H transcript abundance (Figure 47) coinciding with the temporal, spatial, and developmental production of FVBP compounds in petunia. Further experimentation is required to confirm the above conclusion, however, the exact compos ition of the petunia floral volatile bouquet may be determined by an exact ratio of

PAGE 96

96 specific proteins to substrates and PhMYB5d8 may be involved in the regulation of the exact ratio. Experimental Procedures Plant M aterials Inbred Petunia x hybrida cv Mit chell Diploid (MD) plants were utilized as a wild type control in all experiments. The ethylene insensitive CaMV 35S: etr1 1 line 44568, generated in the MD genetic background (Wilkinson et al., 1997) was utilized as a negative control for ethylene sensitivity where applicable. MD, 44568, and PhMYB5d8 RNAi plants were grown as previously described (Dexter et al., 2007) Ethylene treatments used two L L1 of ethylene with air tr eatments for controls. Generation of PhMYB5d8 RNAi T ransgenic P etunia The generation of PhMYB5d8 RNAi transgenic plants was as describe earlier (Dexter et al., 2007) but with two fragments (3 of the R2R3 domain) of the PhMYB5d8 cDNA amplified and ligated end to end in a sense /antisense orientation with additional sequence information used for an inter fragment intron (hairpin). Transcript accumulation analysis All experiments were conducted with at least two biological replicates with equivalent results observed. In all cases total RNA was extracted as previously described (Verdonk et al., 2003) and subjected to TURBO DNase treatment (Ambion Inc., Austin, TX) followed by total RNA purification with RNeasy Mini protocol for RNA cleanup (Qiagen, Valencia, CA). Total RNA was then quantified on a NanoDrop 1000 s pectrophotometer (Thermo Scientific, Wilmington, DE) and 50 ng/l dilutions were prepared and stored at 20oC. Semi quantitative (sq)RT PCR was performed on a Veriti 96well thermal cycler (Applied Biosystems, Foster City, CA). All sqRT PCR reactions u sed a Qiagen One step RT -

PAGE 97

97 PCR kit with 50 ng total RNA template. To visualize RNA loading concentrations, samples were amplified with Ph18S primers (forward primer 5 TTAGCAGGCTGAGGTCTCGT 3 and reverse primer 5 AGCGGATGTTGCTTTTAGGA3) and analyzed on an agarose gel. Gene specific primers were designed and utilized for the visualization of the relative transcript accumulation levels for PhMYB5d8 (forward primer 5TTTTGCTGCTGGAATGAAGA3 and reverse primer 5 TTCCTGCTACAACTGCAACCT 3) and PhC4H [SGNU210924] (forward primer 5CTTGGACCAGGAGTGCAAAT 3 and reverse primer 5 GCTCCTCCTACCAACACCAA 3). The spatial transcript accumulation series consisted of total RNA isolated from root, stem stigma, anther, leaf, petal tube, petal limb, and sepal tissues of thre e individual MD plants at 16:00 h on multiple occasions over the course of a year. The developmental transcript accumulation series consisted of MD floral tissue collected at eleven different stages; floral bud < 0.5 cm (stage 1), bud 0.5 < 1.5 cm (2), bud 1.5 < 3.0 cm (3), bud 3.0 < 5.0 cm (4), bud fully elongated 5.0 < 6.5 cm (5), flower opening 0 < 2 cm limb diameter (anthesis) [6], flower fully open day 0 (7), day 1 (8), day 2 (9), day 3 (10), and observably senescing flower (flower open day 7 for MD), stage 11. All tissues were collected at 16:00 h on the same day, and total RNA was isolated from all samples collected. The developmental tissue collections were conducted multiple times over the course of a year. The exogenous ethylene series consisted of excised MD and 44568 stage 9 flowers (placed in tap water) placed into eight tanks, four for ethylene treatments and four for air treatments. Air and ethylene treatments were conducted for 0, 1, 2, 4, and 8 hours starting at 12:00 h. Immediately following treatment, each of the flower samples were collected, stored at 80oC, and total RNA was isolated from all corolla tissues once all samples had been collected. The ethylene treatment experiment consisted of two biological

PAGE 98

98 replicates and was conducted twice. For all tissue collections individual samples consisted of three flowers. Volatile E mission For all volatile emission experiments, emitted floral volatiles from excised flowers were collected at 18:00 h and quantified as previously described (Underwood et al., 2005; Dexter et al., 2007) Acknowledgements Dr. R ob Schuurink is acknowledged for his contribution of the PhMYB5d8 coding sequence.

PAGE 99

99 Figure 4 1. Predicted peptide sequence alignment of homologous R2R3MYB proteins from various species. Sequences represented are from Arabidopsis thaliana (accession: NM_119665 [MYB32] and AY070100 [MYB4]), Eucalyptus gunnii (AJ576024), Gossypium hirsutum ( AF336286), Vitis vinifera (EF113078), Humulus l upulus (AB292244), Solanum lycopersicum (X95296), and Petunia x hybrida (EB175095). Sequences were aligned using the AlignX program of the Vector NTI Advance 10.3.0 software (Invitrogen). Residues highlighted in: blue represent consensus residues derived f rom a block of similar residues at a given position, green represent consensus residues derived from the occurrence of greater than 50 % of a single residue at a given position, and yellow represent consensus residues derived from a completely conserved residue at a given position. Petunia sequences are highlighted in red to the left.

PAGE 100

100 Figure 4 2. An unrooted neighbor joining phylogenetic tree of homologous R2R3MYB proteins from various species. TREEVIEW software with the nearest joining method was us ed to create the resulting tree. Scale bar represents distance as the number of substitutions per site (i.e., 0.1 amino acid substitutions per site).

PAGE 101

101 Figure 4 3. PhMYB5d8 transcript accumulation analysis (sqRT PCR). Spatial analysis used root, stem, stigma, anther, leaf, petal tube, petal limb, and sepal tissues of MD harvested at 16:00 h (A). Floral developmental analysis used MD flowers from 11 sequential stages at 16:00 h (B). Rhythmic analysis used MD plants acclimated in a growth chamber with a long day photoperiod and samples collected every three hours for a total of 36 hours (C). Ethylene treatment (two L L1) analysis used excised MD and 44568 whole flowers treated for 0, 1, 2, 4, and 8 hours (D).The number of cycles used for amplification of ea ch transcript is shown on the right. Ph18S was used as a loading control in all cases. Figure 4 4. PhMYB5d8 cDNA model with the RNAi region used for the production of petunia PhMYB5d8 RNAi transgenic lines. 200 bases at the 3 end of the coding sequenc e of PhMYB5d8 were chosen for the RNAi construct (between RNAi F and RNAi R primers). Figure 4 5. sqRT PCR transcript accumulation analysis in floral tissues of independent T0 PhMYB5d8RNAi lines and MD plants. Gene specific primers for PhMYB5d8 and PhC4H were used. The number of cycles used for amplification of each transcript is shown on the right. Ph18S was used as a loading control.

PAGE 102

102 Figure 4 6. Floral volatile emission analysis from five independent T0 PhMYB5d8 RNAi lines (mean sd; n = 2). Only major volatile compounds are shown.

PAGE 103

103 Figure 4 7. Schematic model of the FVBP pathway in petunia. FVBP production consists of three main branch points; phenylalanine, trans cinnamic acid, and ferulic acid. Floral volatile compounds derived from each branch point are highlighted in pink and proteins are in red. Solid red arrows indicate established biochemical reactions. Multiple arrows indicate multiple biochemical steps. Dashed arrows indicate possible biochemical reactions.

PAGE 104

104 LIST OF REFERENCES Abel, C., Clauss, M., Schaub, A., Gershenzon, J., and Tholl, D. (2009) Floral and insect induced volatile formation in Arabidopsis lyrata ssp. petraea a perennial, outcrossing relative of A. thaliana. Planta 10, 921 927. Achnine, L., Blancaflor, E.B., Ra smussen, S., and Dixon, R.A. (2004). Colocalization of L PHENYLALANINE AMMONIALYASE and CINNAMATE 4 HYDROXYLASE for metabolic channeling in phenylpropanoid biosynthesis. Plant Cell 16, 3098 3109. Alonso, J.M., Hirayama, T., Roman, G., Nourizadeh, S., and Ecker, J.R. (1999). EIN2, a bifunctional transducer of ethylene and stress responses in Arabidopsis. Science 284, 21482152. Ando, T., Nomura, M., Tsukahara, J., Watanabe, H., Kokubun, H., Tsukamoto, T., Hashimoto, G., Marchesi, E., and Kitching, I.J. (2 001). Reproductive isolation in a native population of Petunia sensu Jussieu (Solanaceae). Ann. Bot. 88, 403413. Benesova, M., and Bode, R. (1992). CHORISMATE MUTASE isoforms from seeds and seedlings of Papaver s omniferum Phytochemistry 31, 29832987. Ben Nissan G ., and Weiss D (1996) The petunia homologue of tomato GAST1 : transcript accumulation coincides with gibberellin induced corolla cell elongation. Plant Mol Biol 32, 10671074. Bleecker, A.B., and Kende, H. (2000). Ethy lene: a gaseous signal molecule in plants. Annu. Rev. Cell Dev. Biol. 16, 118. Boudet, A.M. (2007). Evolution and current status of research in phenolic compounds. Phytochemistry 68, 2722 2735. Boatright J ., Negre F ., Chen, X ., Kish C .M., Wood, B ., P eel G ., Orlova I ., Gang D ., Rhodes D ., and Dudareva N (2004) Understanding in vivo benzenoid metabolism in petunia petal tissue Plant Physiol. 135, 19932011. Chang, C., Kwok, S.F., Bleecker, A.B., and Meyerowitz, E.M. (1993). Arabidopsis ethylene response gene ETR1 similarity of product to 2 component regulators Science 262, 539 544. Chao, Q.M., Rothenberg, M., Solano, R., Roman, G., Terzaghi, W., and Ecker, J.R. (1997). Activation of the ethylene gas response pathway in Arabidopsis by the nuc lear protein ETHYLENEINSENSITIVE3 and related proteins. Cell 89, 11331144. Chen, Y.F., Etheridge, N., and Schaller, G.E. (2005). Ethylene signal transduction. Ann. Bot. 95, 901915.

PAGE 105

105 Clark, D.G., Gubrium, E.K., Barrett, J.E., Nell, T.A., and Klee, H.J. ( 1999). Root formation in ethyleneinsensitive plants. Plant Physiol. 121, 5359. Clark, K.L., Larsen, P.B., Wang, X.X., and Chang, C. (1998). Association of the Arabidopsis CTR1 Raf like kinase with the ETR1 and ERS ethylene receptors. Proc. Natl. Acad. S ci. U. S. A. 95, 54015406. Deroles, S.C., and Gardner, R.C. (1988a). Expression and inheritance of kanamycin resistance in a large number of transgenic petunias generated by Agrobacterium mediated transformation Plant Mol. Biol. 11, 355364. Deroles, S .C., and Gardner, R.C. (1988b). Analysis of the T DNA structure in a large number of transgenic petunias generated b y Agrobacterium mediated transformat ion. Plant Mol. Biol. 11, 365377. Dexter R ., Qualley A ., Kish C .M., Ma C .J., Koeduka T ., Nagegowd a D .A. Dudareva N ., Pichersky E ., and Clark D (2007) Characterization of a petunia acetyltransferase involved in the biosynthesis of the floral volatile isoeugenol Plant J 49, 265 275. Dexter R .J., Verdonk, J .C. Underwood, B .A. Shibuya K ., Sc hmeltz E .A. and Clark D .G. (2008) Tissue specific PHBPBT expression is differentially regulated in response to endogenous ethylene J Exp Bot 59, 609618. Dudareva, N., Negre, F., Nagegowda, D., and Orlova, I. (2006). Plant volatiles: r ecent advances and future perspectives. Crit. Rev. Plant Sci. 25, 417440. Dudareva, N., and Pichersky, E. (2000). Biochemical and molecular genetic aspects of floral scents. Plant Physiol. 122, 627633. Dudareva, N., Pichersky, E., and Gershenzon, J. (2004). Bioche mistry of plant volatiles. Plant Physiol. 135, 18931902. Eberhard, J., Raesecke, H.R., Schmid, J., and Amrhein, N. (1993) Cloning and expression in yeast of a higher plant CHORISMATE MUTASE Molecular cloning, sequencing of the cDNA and characterization of the Arabidopsis thaliana enzyme expressed in yeast. FEBS Lett. 15, 233236. Eberhard, J., Bischoff, M., Raesecke, H.R., Amrhein, N., and Schmid, J. (1996a). Isolation of a cDNA from tomato coding for an unregulated, cytosolic CHORISMATE MUTASE Plant Mol. Biol. 31, 917922. Eberhard, J., Ehrler, T.T., Epple, P., Felix, G., Raesecke, H.R., Amrhein, N., and Schmid, J. (1996b). Cytosolic and plastidic CHORISMATE MUTASE isozymes from Arabidopsis thaliana: molecular characterization and enzymatic properties. Plant J. 10, 815821.

PAGE 106

106 Fenster, C., Armbruster, W., Wilson, P., Dudash, M., and Thomson, J. (2004). Pollination syndromes and floral specialization. Annu. Rev. Ecol. Evol. S. 35, 375403. Fraley, R.T., Rogers, S.G., and Horsch, R.B. (1983). In vitro pl ant transformation by bacterial co cultivation and expression of foreign genes in plant cells In Vitro Cell Dev B 19, 284284. Friedman, M., Henika, P.R., and Mandrell, R.E. (2002). Bactericidal activities of plant essential oils and some of their isol ated constituents against Campylobacter jejuni Escherichia coli Listeria monocytogenes and Salmonella enterica. J. Food Prot. 65, 15451560. Gerats, T., and Vandenbussche, M. (2005). A model system for comparative research: p etunia. Trends Plant Sci. 10, 251256. Gilchrist, D.G., and Connelly, J.A. (1987). CHORISMATE MUTASE from Mung Bean and Sorghum. Methods Enzymol. 142, 450463. Griesbach, R.J., and Kamo, K.K. (1996). The effect of induced polyploidy on the flavonols of petunia 'Mitchell'. Phytoche mistry 42, 361363. Guo, H.W., and Ecker, J.R. (2004). The ethylene signaling pathway: new insights. Curr. Opin. Plant Biol. 7, 4049. Hall, A.E., Findell, J.L., Schaller, G.E., Sisler, E.C., and Bleecker, A.B. (2000). Ethylene perception by the ERS1 protein in Arabidopsis. Plant Physiol. 123, 14491457. Haslam, E (1993) Shikimic a cid: metabolism and metabolites. Chichester, Wiley. Herrmann K .M., and Weaver L .M. (1999) The shikimate pathway Annu. Rev Plant Physiol Plant Mol Biol 50, 473503. Hoballah M .E. Stuurman, J ., Turlings T .C., Guerin, P .M., Connetable S ., Kuhlemeier C (2005) The composition and timing of flower odour emission by wild Petunia axillaris coincide with the antennal perception and nocturnal activity of the pollinator Manduca sexta Planta 222, 141150. Hoekstra F ., and Weges R (1986) Lack of control by early pistillate ethylene of the accelerated wilting of Petunia hybrida flowers Plant Physiology 80, 403408. Horsch, R.B., Fry, J.E., Hoffmann, N.L., Eichholtz, D., Rogers, S.G., and Fraley, R.T. (1985). A simple and general method for transferring genes into plants Science 227, 12291231. Hua, J., and Meyerowitz, E.M. (1998). Ethylene responses are negatively regulated by a receptor gene family in Arabidopsis t haliana. Cell 94, 261271.

PAGE 107

107 Hua, J., Sakai, H., Nourizadeh, S., Chen, Q.H.G., Bleecker, A.B., Ecker, J.R., and Meyerowitz, E.M. (1998). EIN4 and ERS2 are members of the putative ethylene receptor gene family in Arabidopsis. Plant Cell 10, 13211332. Hudak, K.A., and Thompson, J.E. (1997). Subcellular localization of secondary lipid metabolites including fragrance volatiles in carnation petals Plant Physiol. 114, 705713. Jin, H., Cominelli, E., Bailey, P., Parr, A., Mehrtens, F., Jones, J., Tonelli, C., W eisshaar, B., and Martin, C. (2000). Transcriptional repression by AtMYB4 controls production of UV protecting sunscreens in Arabidopsis. EMBO J. 19, 61506161. Jones, M.L ., Langston, B.J., and Johnson, F. (2003). Pollination induced senescence of ethylen e sensitive and insensitive petunias, in: Vendrell, M., Klee, H., Pech, J.C., Romotaro, F. (Eds.), Biology and Biotechnology of the Plant Hormone Ethylene III. IOS Press, Amsterdam, pp. 324327. Jorgensen, R.A., Cluster, P.D., English, J., Que, Q.D., and Napoli, C.A. (1996). CHALCONE SYNTHASE cosuppression phenotypes in petunia flowers: c omparison of sense vs antisense constructs and single copy vs complex T DNA sequences. Plant Mol. Biol. 31, 957973. Kaminaga Y ., Schnepp, J ., Peel G ., Kish C .M., Ben Nissan G ., Weiss D ., Orlova I ., Lavie O ., Rhodes D ., Wood, K ., Porterfield D .M., Cooper A .J., Schloss J .V. Pichersky E ., Vainstein A ., and Dudareva N (2006) Plant PHENYLACETALDEHYDE SYNTHASE is a bifunctional homotetrameric enzyme that cataly zes phenylalanine decarboxylation and oxidation. J Biol Chem 281, 2335723366. Kast, P., Asif Ullah, M., Jiang, N., and Hilvert, D. (1996). Exploring the active site of CHORISMATE MUTASE by combinatorial mutagenesis and selection: the importance of electrostatic catalysis. Proc. Natl. Acad. Sci. U. S. A. 93, 50435048. Kast, P., Grisostomi, C., Chen, I.A., Li, S., Krengel, U., Xue, Y., and Hilvert, D. (2000). A strategically positioned cation is crucial for efficient catalysis by CHORISMATE MUTASE J. Biol. Chem. 275, 3683236838. Klempnauer, K.H., Gonda, T.J., and Bishop, J.M. (1982). nucleotide sequence of the retroviral leukemia gene V MYB and its cellular progenitor C MYB the architecture of a transduced oncogene Cell 31, 453463. Knudsen, J.T., Eriksson, R., Gershenzon, J., and Stahl, B. (2006). Diversity and distribution of floral scent. Bot Rev 72, 1120. Knudsen, J., Tollsten, L., and Berstrom, L. (1993). Floral scents a checklist of volatile compounds isolated by headspace techniques. Phytochemistry 33, 253280.

PAGE 108

108 Koeduka T ., Fridman, E Gang D .R., Vassao D .G. Jackson, B .L. Kish C .M., Orlova I ., Spassova S .M., Lewis N .G. Noel J .P., Baiga T .J., Dudareva N ., and Pichersky E (2006) Eugenol and isoeugenol, characteristic aro matic constituents of spices, are biosynthesized via reduction of a coniferyl alcohol ester Proc Natl Acad Sci U S A 103, 1012810133. Koeduka, T., Louie, G.V., Orlova, I., Kish, C.M., Ibdah, M., Wilkerson, C.G., Bowman, M.E., Baiga, T.J., Noel, J .P., Dudareva, N., and Pichersky, E. (2008). The multiple PHENYLPROPENE SYNTHASES in both Clarkia breweri and Petunia hybrida represent two distinct protein lineages. Plant J. 54, 362374. Kolosova N ., Gorenstein, N ., Kish C .M., and Dudareva N (2001a) Regulation of circadian methyl benzoate emission in diurnally and nocturnally emitting plants Plant Cell 13, 23332347. Kolosova N ., Sherman D ., Karlson, D ., and Dudareva N (2001b) Cellular and subcellular localization of S ADENOSYL L METHIONINE: BENZOIC ACID CARBOXYL METHYLTRANSFERASE, the enzyme responsible for biosynthesis of the volatile ester methylbenzoate in snapdragon flowers Plant Physiology 126, 956964. Lipsick, J.S. (1996). One billion years of MYB Oncogene 13, 223 235. Martin, J.R., Harwood, J.H., McCaffery, M., Fernandez, D, E., and Cline, K. (2009) Localization and integration of thylakoid protein translocase subunit cpTatC. Plant J. 58, 831842. Matsui, K. (2006). Green leaf volatiles: hydroperoxide lyase pathway of oxylipin me tabolism. Curr. Opin. Plant Biol. 9, 274280. Mitchell, A.Z., Hanson, M.R., Skvirsky, R.C., and Ausubel, F.M. (1980). Anther culture of petunia genotypes with highfrequency of callus, root, or plantlet formation. Z Pflanzenphysiol 100, 131146. Moalem Beno D ., Tamari G ., Leitner Dagan Y ., Borochov, A ., and Weiss D (1997) Sugar dependent gibberellininduced CHALCONE SYNTHASE gene expression in petunia corollas Plant Physiol 113, 419424. Mobley, E.M., Kunkel, B.N., and Keith, B. (1999). Identif ication, characterization and comparative analysis of a novel CHORISMATE MUTASE gene in Arabidopsis thaliana. Gene 240, 115123. Negre F ., Kish C .M., Boatright J ., Underwood, B ., Shibuya K ., Wagner C ., Clark D .G. and Dudareva, N (2003) Regulation of methylbenzoate emission after pollination in snapdragon and petunia flowers Plant Cell 15, 29923006.

PAGE 109

109 Newman, J.D., and Chappell, J. (1999). Isoprenoid biosynthesis in plants: carbon partitioning within the cytoplasmic pathway. Crit. Rev. Biochem. Mo l. Biol. 34, 95106. Ogata, K., Hojo, H., Aimoto, S., Nakai, T., Nakamura, H., Sarai, A., Ishii, S., and Nishimura, Y. (1992). Solution structure of a DNA binding unit of MYB a helix turn helix related motif with conserved tryptophans forming a hydrophobic core. Proc. Natl. Acad. Sci. U. S. A. 89, 64286432. Ohta, M., Matsui, K., Hiratsu, K., Shinshi, H., and Ohme Takagi, M. (2001). Repression domains of class II ERF transcriptional repressors share an essential motif for active repression. Plant Cell 13, 19591968. Orlova I ., Marshall Colon, A ., Schnepp, J ., Wood B ., Varbanova M ., Fridman E ., Blakeslee, J .J. Peer W .A. Murphy A .S., Rhodes D ., Pichersky E ., and Dudareva N (2006) Reduction of benzenoid synthesis in petunia flowers reveals mul tiple pathways to benzoic acid and enhancement in auxin transport Plant Cell 18, 34583475. Oxenham, S.K., Svoboda, K.P., and Walters, D.R. (2005). Altered growth and polyamine catabolism following exposure of the chocolate spot pathogen Botrytis fabae t o the essential oil of Ocimum basilicum Mycologia 97, 576579. Pabo, C.O., and Sauer, R.T. (1992). Transcription factors structural families and principles of DNA recognition Annu. Rev. Biochem. 61, 10531095. Pare, P .W., and Tumlinson, J .H. (1997) De novo biosynthesis of volatiles induced by insect herbivory in cotton plants Plant Physiol 114, 11611167. Peters, D. (2007). Raw materials. Adv. Biochem Eng Biot 105, 130. Pichersky E ., Noel J .P., and Dudarev ,a N (2006) Biosynthesis of plant volatiles: nature's diversity and ingenuity Science 311, 808811. Pichersky, E., and Gang, D.R. (2000). Genetcs and biochemistry of secondary metabolites in plants: an evolutionary perspective. Trends Plant Sci. 5, 439445. Pichersky, E., and Gershenzon, J. (2002). The formation and function of plant volatiles: perfumes for pollinator attraction and defense. Curr. Opin. Plant Biol. 5, 237243. Riechmann, J.L., and Ratcliffe, O.J. (2000). A genomic perspective on plant transcription factors. Curr. Opin. Plant Biol. 3, 423434. Rippert, P., Puyaubert, J., Grisollet, D., Derrier, L., and Matringe, M. (2009). Tyrosine and phenylalanine are synthesized within the plastids in Arabidopsis Plant Physiol. 149, 12511260.

PAGE 110

110 Rodriguez, F.I., Esch, J.J., Hall, A.E ., Binder, B.M., Schaller, G.E., and Bleecker, A.B. (1999). A copper cofactor for the ethylene receptor ETR1 from Arabidopsis. Science 283, 996998. Rohmer, M. (1999). The discovery of a mevalonate independent pathway for isoprenoid biosynthesis in bacter ia, algae and higher plants. Nat. Prod. Rep. 16, 565574. Sakai, H., Hua, J., Chen, Q.H.G., Chang, C.R., Medrano, L.J., Bleecker, A.B., and Meyerowitz, E.M. (1998). ETR2 is an ETR1 like gene involved in ethylene signaling in Arabidopsis. Proc. Natl. Acad. Sci. U. S. A. 95, 58125817. Schaller, G.E., and Bleecker, A.B. (1995). Ethylene binding sites generated in yeast expressing the Arabidopsis ETR1 gene Science 270, 1809 1811. Schaller, G.E., Ladd, A.N., Lanahan, M.B., Spanbauer, J.M., and Bleecker, A.B (1995). The ethylene response mediator ETR1 from Arabidopsis forms a disulfide linked dimer J. Biol. Chem. 270, 1252612530. Schuurink, R.C., Haring, M.A., and Clark, D.G. (2006). Regulation of volatile benzenoid biosynthesis in petunia flowers. Trends Plant Sci. 11, 2025. Shibuya, K., Barry, K.G., Ciardi, J.A., Loucas, H.M., Underwood, B.A., Nourizadeh, S., Ecker, J.R., Klee, H.J., and Clark, D.G. (2004). The central role of PhEIN2 in ethylene responses throughout plant development in petunia. Plant Physiol. 136, 29002912. Simkin, A.J., Underwood, B.A., Auldridge, M., Loucas, H.M., Shibuya, K., Schmelz, E., Clark, D.G., and Klee, H.J. (2004). Circadian regulation of the PhCCD1 carotenoid cleavage dioxygenase controls emission of beta ionone, a fragr ance volatile of petunia flowers. Plant Physiol. 136, 35043514. Solano, R., Stepanova, A., Chao, Q.M., and Ecker, J.R. (1998). Nuclear events in ethylene signaling: a transcriptional cascade mediated by ETHYLENE INSENSITIVE3 and ETHYLENE RESPONSE FACTOR1 Gene Dev 12, 37033714. Stracke, R., Werber, M., and Weisshaar, B. (2001). The R2R3 MYB gene family in Arabidopsis thaliana. Curr. Opin. Plant Biol. 4, 447456. Tang X ., and Woodson, W .R. (1996) Temporal and spatial expression of 1AMINOCYCLOPROPANE1CARBOXYLATE OXIDASE mRNA following pollination of immature and mature petunia flowers Plant Physiol 112, 503511. Tieman D .M ., Taylor M., Schaurer N. Fernie A.R., Hanson, A.D. and Klee H.J. (2006) Tomato aromatic amino acid decarboxylases participate in synthesis of the flavor volatiles 2 phenylethanol and 2phenylacetaldehyde. Proc. Natl. Acad. Sci. U. S. A. 103, 82878292.

PAGE 111

111 Underwood, B .A. Tieman D .M., Shibuya K ., Dexter R .J. Loucas H .M., Simkin A .J. Sims C .A. Sc hmelz E .A. Klee, H .J., and Clark D .G. (2005) Ethylene regulated floral volatile synthesis in petunia corollas Plant Physiol. 138, 255266. Verdonk, J .C., Haring M .A. Van Tunen, A .J., and Schuurink, R .C. (2005) ODORANT1 regulates fragrance biosynth esis in petunia flowers Plant Cell 17, 16121624. Verdonk, J .C., Ric De Vos C .H. Verhoeven H .A. Haring M .A. Van Tunen, A .J., and Schuurink, R .C. (2003) Regulation of floral scent production in petunia revealed by targeted metabolomics Phytochemis try 62, 9971008. Wang, K.L.C., Li, H., and Ecker, J.R. (2002). Ethylene biosynthesis and signaling networks. Plant Cell 14, S131S151. Wang Y ., and Kumar P .P. (2007) Characterizatio n of two ethylene receptors PHERS1 and PHETR2 from petunia: PHETR2 re gulates timing of anther dehiscence J Exp Bot 58, 533544. Weiss D ., Van Der Luit A ., Knegt E ., Vermeer E ., Mol J ., and Kooter J .M. (1995) Identification of endogenous gibberellins in petunia flowers (induction of anthocyanin biosynthetic gene expression and the antagonistic effect of abscisic acid) Plant Physiol 107, 695702. Wasternack, C., and Hause, B. (2002). Jasmonates and octadecanoids: signals in plant stress responses and development. Prog. Nucleic Acid Res. Mol. Biol. 72, 165221. Wasternack, C., Stenzel, I., Hause, B., Hause, G., Kutter, C., Maucher, H., Neumerkel, J., Feussner, I., and Miersch, O. (2006). The wound response in tomato--role of jasmonic acid. J Plant Physiol 163, 297306. Wilkinson, J .Q. Lanahan M .B. Clark D .G. Bleecker A .B. Chang C ., Meyerowitz E .M., and Klee, H .J. (1997) A dominant mutant receptor from Arabidopsis confers ethylene insensitivity in heterologous plants Nat Biotechnol 15, 444447. Wilkinson, J.Q., Lanahan, M.B., Yen, H.C., Giovannoni, J.J., and Klee, H.J. (1995). An ethyleneinducible component of signal transduction encoded by NEVER RIPE Science 270, 18071809. Wink, M. (2003). Evolution of secondary metabolites from an ecological and molecular phylogenetic perspective. Phytochemi stry 64, 319. Yu, O., and Jez, J.M. (2008). Nature's assembly line: biosynthesis of simple phenylpropanoids and polyketides. Plant J. 54, 750762. Zhu, Z., and Guo, H. (2008). Genetic basis of ethylene perception and signal transduction in Arabidopsis. J Integr Plant Biol 50, 808815.

PAGE 112

112 Zybailov, B., Rutschow, H., Friso, G., Rudella, A., Emanuelsson, O., Sun, Q., and van Wijk, K.J. (2008). Sorting signals, N terminal modifications and abundance of the chloroplast proteome. PLoS ONE 3, e1994.

PAGE 113

BIOGRAP HICAL SKETCH Thomas Angus Colquhoun was born in Fargo, North Dakota He was raised by Linda Lou Colquhoun and Thomas E. Colquhoun along with two older sisters, Tesa D. Larson and Christann Schmid. After graduating from Fargo South High School, Thomas attended Coastal Carolina University, South Carolina for his freshmen year, and then transferred to Minnesota State University of Moorhead (MSUM) for the remainder of his undergraduate career. During his undergraduate career, Thomas met and married the love of his life, Cynthia M. Colquhoun. Additionally, at MSUM Thomas worked in Dr. Chris Chastains lab helping to characterize a pyruvate, orthophosphate dikinase in developing rice (Oryza sativa) seeds (Chastain et al., 2006). Dr. Chastain had a profound effect on Thomas and his education, for it was through Dr. Chastains mentorship that Thomas found his interest in basic research and plants in general. University of Florida and the Plant Molecular and Cellular Biology Program was the next a ppointment for Thomas, and Dr. David G. Clark was his Ph.D. advisor. Dr. Clark was Thomas second intellectual mentor and advisor, although Dr. Clark also actively participated in personal mentorship with Thomas. It was through Dr. Clark that Thomas gained a deeper understanding of biology a nd science as a whole, which le d Thomas into a never ending form of question and answer with nature.