<%BANNER%>

Influence of soldier derived semiochemicals on Reticulitermes flavipes worker caste differentiation and gene expression

Permanent Link: http://ufdc.ufl.edu/UFE0025142/00001

Material Information

Title: Influence of soldier derived semiochemicals on Reticulitermes flavipes worker caste differentiation and gene expression
Physical Description: 1 online resource (4 p.)
Language: english
Creator: Tarver, Matthew
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: caste, differentiation, flavipes, gene, reticulitermites, semiochemical, soldier, termite
Entomology and Nematology -- Dissertations, Academic -- UF
Genre: Entomology and Nematology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: This dissertation focused on the termite Reticulitermes flavipes (Kollar), a serious structural pest in the USA. The goal of this research was to investigate potential impacts that soldier termites have on nestmate caste differentiation. Specifically, studies were conducted to understand the influence of soldier head chemicals on nestmate worker caste differentiation. The central hypothesis was that the chemicals produced by soldiers influence phenotype and gene expression of worker, and responsive genes that show differential expression will play a role in caste differentiation. Results showed that soldier head extracts, when combined with juvenile hormone (JH), synergistically increased worker-to-presoldier (PS) formation relative to JH alone. Using gas chromatography (GC), mass spectrophotometry (MS), and nuclear magnetic resonance (NMR) analyses, the two major components of SHE were determined to be ?-cadinene and ?-cadinenal. Through use of quantitative real-time PCR, the expression patterns of 47 genes in response to JH and soldier head chemicals were investigated. The three main groups of genes with significant differential expression were 1) genes encoding enzymes involved in hormone and semiochemical biosynthesis/ degradation, 2) hemolymph protein coding genes, and 3) developmental genes. Also, the individual effects of the two major components of SHE (?-cadinene and ?-cadinenal) on phenotypic caste differentiation and gene expression of workers was investigated. Finally, the last phase of this dissertation was to further characterize genes from the chemical biosynthesis/ degradation group: two cytochrome P450s and a putative JH esterase (Cyp15F1, Cyp15A2, and RfEst1). Gene homology analyses, expression profiling, and RNAi studies support the hypothesis that these genes play roles in JH production and degradation. In summary, this research has led to: 1) a better understanding of the role semiochemicals produced by soldiers play in worker caste differentiation, 2) the impacts that JH, soldier head chemicals, JH+soldier head chemicals, and live soldiers have on nestmate gene expression, and 3) a better understanding of the potential function of three specific genes in caste regulation, or the mediation of worker-to-soldier caste differentiation. As a result of understanding how soldiers are formed, new and novel control methods for this pest can eventually be designed. This dissertation provides a step towards development of more environmentally friendly, next-generation termiticides.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Matthew Tarver.
Thesis: Thesis (Ph.D.)--University of Florida, 2009.
Local: Adviser: Scharf, Michael E.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0025142:00001

Permanent Link: http://ufdc.ufl.edu/UFE0025142/00001

Material Information

Title: Influence of soldier derived semiochemicals on Reticulitermes flavipes worker caste differentiation and gene expression
Physical Description: 1 online resource (4 p.)
Language: english
Creator: Tarver, Matthew
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: caste, differentiation, flavipes, gene, reticulitermites, semiochemical, soldier, termite
Entomology and Nematology -- Dissertations, Academic -- UF
Genre: Entomology and Nematology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: This dissertation focused on the termite Reticulitermes flavipes (Kollar), a serious structural pest in the USA. The goal of this research was to investigate potential impacts that soldier termites have on nestmate caste differentiation. Specifically, studies were conducted to understand the influence of soldier head chemicals on nestmate worker caste differentiation. The central hypothesis was that the chemicals produced by soldiers influence phenotype and gene expression of worker, and responsive genes that show differential expression will play a role in caste differentiation. Results showed that soldier head extracts, when combined with juvenile hormone (JH), synergistically increased worker-to-presoldier (PS) formation relative to JH alone. Using gas chromatography (GC), mass spectrophotometry (MS), and nuclear magnetic resonance (NMR) analyses, the two major components of SHE were determined to be ?-cadinene and ?-cadinenal. Through use of quantitative real-time PCR, the expression patterns of 47 genes in response to JH and soldier head chemicals were investigated. The three main groups of genes with significant differential expression were 1) genes encoding enzymes involved in hormone and semiochemical biosynthesis/ degradation, 2) hemolymph protein coding genes, and 3) developmental genes. Also, the individual effects of the two major components of SHE (?-cadinene and ?-cadinenal) on phenotypic caste differentiation and gene expression of workers was investigated. Finally, the last phase of this dissertation was to further characterize genes from the chemical biosynthesis/ degradation group: two cytochrome P450s and a putative JH esterase (Cyp15F1, Cyp15A2, and RfEst1). Gene homology analyses, expression profiling, and RNAi studies support the hypothesis that these genes play roles in JH production and degradation. In summary, this research has led to: 1) a better understanding of the role semiochemicals produced by soldiers play in worker caste differentiation, 2) the impacts that JH, soldier head chemicals, JH+soldier head chemicals, and live soldiers have on nestmate gene expression, and 3) a better understanding of the potential function of three specific genes in caste regulation, or the mediation of worker-to-soldier caste differentiation. As a result of understanding how soldiers are formed, new and novel control methods for this pest can eventually be designed. This dissertation provides a step towards development of more environmentally friendly, next-generation termiticides.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Matthew Tarver.
Thesis: Thesis (Ph.D.)--University of Florida, 2009.
Local: Adviser: Scharf, Michael E.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0025142:00001


This item has the following downloads:


Full Text

PAGE 1

Object Table 3-3 Summary of ANOVAs for Chapter 3 Objective #1 Gene Day Gene Day Gene Day 1 18s Day 1 Source DF F ratio p value 18s Day 5 Source DF F ratio p value 18s Day 10 Source DF F ratio p value Whole model 14 4.8293 <0.0001 Whole model 14 1.7378 0.0859 Whole model 11 10.8825 <0.0001 Colony 2 16.4451 <0.0001 Colony 2 6.2775 0.0043 Colony 2 35.7793 <0.0001 Treatment 4 3.8515 0.0097 Treatment 4 0.535 0.7108 Treatment 3 4.6165 0.009 Colony*Treatment 8 2.9117 0.0116 Colony*Treatment 8 1.3233 0.0260 Colony*Treatment 6 6.5522 0.000 Error 40 Error 40 Error 32 Total 54 Total 54 Total 43 2 28s Day 1 Source DF F ratio p value 28s Day 5 Source DF F ratio p value 28s Day 10 Source DF F ratio p value Whole model 14 6.3222 <0.0001 Whole model 14 10.6085 <0.0001 Whole model 11 27.2187 <0.0001 Colony 2 33.0155 <0.0001 Colony 2 34.3806 <0.0001 Colony 2 78.8196 <0.0001 Treatment 4 0.8364 0.5102 Treatment 4 8.6914 <0.0001 Treatment 3 20.0106 <0.0001 Colony*Treatment 8 2.5625 0.0234 Colony*Treatment 8 6.8063 <0.0001 Colony*Treatment 6 16.4924 <0.0001 Error 40 Error 40 Error 32 Total 54 Total 54 Total 43 3 APO Day 1 Source DF F ratio p value APO Day 5 Source DF F ratio p value APO Day 10 Source DF F ratio p value Whole model 14 2.4001 0.0153 Whole model 14 2.5927 0.0093 Whole model 11 3.062 0.007 Colony 2 7.4973 0.0017 Colony 2 4.7836 0.0137 Colony 2 4.9083 0.014 Treatment 4 1.7372 0.1609 Treatment 4 4.1383 0.0067 Treatment 3 4.5247 0.009 Colony*Treatment 8 1.5734 0.1637 Colony*Treatment 8 1.4976 0.1880 Colony*Treatment 6 2.1554 0.074 Error 40 Error 40 Error 32 Total 54 Total 54 Total 43 4 ATP Day 1 Source DF F ratio p value ATP Day 5 Source DF F ratio p value ATP Day 10 Source DF F ratio p value Whole model 14 8.6631 <0.0001 Whole model 14 8.4374 <0.0001 Whole model 11 1.8555 0.085 Colony 2 49.628 <0.0001 Colony 2 43.9826 <0.0001 Colony 2 5.814 0.007 Treatment 4 6.4725 0.0159 Treatment 4 1.0107 0.4134 Treatment 3 1.4943 0.235 Colony*Treatment 8 1.0881 0.3912 Colony*Treatment 8 3.3966 0.0046 Colony*Treatment 6 0.8895 0.514 Error 40 Error 40 Error 32 Total 54 Total 54 Total 43 5 Bactin Day 1 Source DF F ratio p value Bactin Day 5 Source DF F ratio p value Bactin Day 10 Source DF F ratio p value Whole model 14 28.5382 <0.0001 Whole model 14 17.5887 <0.0001 Whole model 11 9.9029 <0.0001 Colony 2 168.7539 <0.0001 Colony 2 112.341 <0.0001 Colony 2 45.788 <0.0001 Treatment 4 6.6426 0.0003 Treatment 4 3.0349 0.0282 Treatment 3 3.5127 0.026 Colony*Treatment 8 5.0049 0.0002 Colony*Treatment 8 1.0327 0.4283 Colony*Treatment 6 1.3708 0.256 Error 40 Error 40 Error 32 Total 54 Total 54 Total 43 6 Bic Day 1 Source DF F ratio p value Bic Day 5 Source DF F ratio p value Bic Day 10 Source DF F ratio p value Whole model 14 22.7386 <0.0001 Whole model 14 31.0983 <0.0001 Whole model 11 23.6156 <0.0001 Colony 2 155.9237 <0.0001 Colony 2 189.4903 <0.0001 Colony 2 123.6353 <0.0001 Treatment 4 0.8504 0.5019 Treatment 4 6.2622 0.0005 Treatment 3 0.2702 0.846 Colony*Treatment 8 0.4255 0.8988 Colony*Treatment 8 4.8035 0.0003 Colony*Treatment 6 2.0399 0.089 Error 40 Error 40 Error 32 Total 54 Total 54 Total 43 7 broad Day 1 Source DF F ratio p value broad Day 5 Source DF F ratio p value broad Day 10 Source DF F ratio p value Whole model 14 4.065 0.0002 Whole model 14 5.1715 <0.0001 Whole model 11 3.0637 broad Colony 2 14.8027 <0.0001 Colony 2 1.3838 0.2624 Colony 2 3.1857 0.007 Treatment 4 3.2188 0.0221 Treatment 4 7.4034 0.0001 Treatment 3 5.738 0.055 Colony*Treatment 8 1.8013 0.1055 Colony*Treatment 8 5.2196 0.0002 Colony*Treatment 6 1.8208 0.003 Error 40 Error 40 Error 32 0.126 Total 54 Total 54 Total 43 8 Btube Day 1 Source DF F ratio p value Btube Day 5 Source DF F ratio p value Btube Day 10 Source DF F ratio p value Whole model 14 3.1224 0.0024 Whole model 14 3.3072 0.0015 Whole model 11 3.191 0.005 Colony 2 7.3685 0.0019 Colony 2 8.789 0.0007 Colony 2 5.8937 0.007 Treatment 4 4.3039 0.0055 Treatment 4 3.0143 0.0290 Treatment 3 2.6607 0.065 Colony*Treatment 8 1.4827 0.1942 Colony*Treatment 8 2.3031 0.0392 Colony*Treatment 6 2.8431 0.025 Error 40 Error 40 Error 32 Total 54 Total 54 Total 43 9 Carbx-1 Day 1 Source DF F ratio p value Carbx-1 Day 5 Source DF F ratio p value Carbx-1 Day 10 Source DF F ratio p value Whole model 14 5.0755 <0.0001 Whole model 14 2.647 0.0080 Whole model 11 3.5481 0.003 Colony 2 2.2181 0.1220 Colony 2 5.3599 0.0087 Colony 2 5.817 0.007 Treatment 4 8.7257 <0.0001 Treatment 4 3.9228 0.0089 Treatment 3 6.1191 0.002 Colony*Treatment 8 4.9276 0.0003 Colony*Treatment 8 1.3466 0.2495 Colony*Treatment 6 2.0947 0.082 Error 40 Error 40 Error 32 Total 54 Total 54 Total 43 10 Carbx-2 Day 1 Source DF F ratio p value Carbx-2 Day 5 Source DF F ratio p value Carbx-2 Day 10 Source DF F ratio p value Whole model 14 3.2546 0.0017 Whole model 14 3.2742 0.0016 Whole model 11 5.8068 <0.0001 Colony 2 12.3537 <0.0001 Colony 2 3.7263 0.0328 Colony 2 20.0491 <0.0001 Treatment 4 2.0556 0.1049 Treatment 4 4.5221 0.0042 Treatment 3 2.4091 0.085 Colony*Treatment 8 1.735 0.1200 Colony*Treatment 8 3.0825 0.0084 Colony*Treatment 6 3.0732 0.017 Error 40 Error 40 Error 32 Total 54 Total 54 Total 43 11 cJun-1 Day 1 Source DF F ratio p value cJun-1 Day 5 Source DF F ratio p value cJun-1 Day 10 Source DF F ratio p value Whole model 14 10.2528 <0.0001 Whole model 14 1.499 0.1557 Whole model 11 8.4074 <0.0001 Colony 2 63.4537 <0.0001 Colony 2 4.6466 0.0153 Colony 2 40.4608 <0.0001 Treatment 4 1.767 0.1546 Treatment 4 0.4351 0.7824 Treatment 3 2.8676 0.052 Colony*Treatment 8 1.2841 0.2791 Colony*Treatment 8 1.1554 0.3494 Colony*Treatment 6 0.5727 0.749 Error 40 Error 40 Error 32 Total 54 Total 54 Total 43

PAGE 2

12 Cop9 Day 1 Source DF F ratio p value Cop9 Day 5 Source DF F ratio p value Cop9 Day 10 Source DF F ratio p value Whole model 14 5.8423 <0.0001 Whole model 14 2.2536 0.0225 Whole model 11 3.3925 0.003 Colony 2 33.0208 <0.0001 Colony 2 2.4019 0.1035 Colony 2 14.0204 <0.0001 Treatment 4 1.8103 0.1458 Treatment 4 1.6377 0.1837 Treatment 3 0.9687 0.420 Colony*Treatment 8 1.0921 0.3886 Colony*Treatment 8 2.746 0.0163 Colony*Treatment 6 1.2137 0.325 Error 40 Error 40 Error 32 Total 54 Total 54 Total 43 13 CoxIII Day 1 Source DF F ratio p value CoxIII Day 5 Source DF F ratio p value CoxIII Day 10 Source DF F ratio p value Whole model 14 11.4704 <0.0001 Whole model 14 32.782 <0.0001 Whole model 11 22.9592 <0.0001 Colony 2 68.8327 <0.0001 Colony 2 200.8569 <0.0001 Colony 2 116.5026 <0.0001 Treatment 4 1.9159 0.1266 Treatment 4 4.6187 0.0037 Treatment 3 1.831 0.161 Colony*Treatment 8 1.9791 0.0745 Colony*Treatment 8 5.4836 0.0001 Colony*Treatment 6 2.6147 0.036 Error 40 Error 40 Error 32 Total 54 Total 54 Total 43 14 Cyp15F1 Day 1 Source DF F ratio p value Cyp15F1 Day 5 Source DF F ratio p value Cyp15F1 Day 10 Source DF F ratio p value Whole model 14 54.6314 <0.0001 Whole model 14 88.5437 <0.0001 Whole model 11 42.2086 <0.0001 Colony 2 347.1446 <0.0001 Colony 2 598.9824 <0.0001 Colony 2 200.65 <0.0001 Treatment 4 16.4485 <0.0001 Treatment 4 3.605 0.0133 Treatment 3 8.2026 0.0003 Colony*Treatment 8 0.6457 0.7347 Colony*Treatment 8 3.7806 0.0022 Colony*Treatment 6 6.9677 <0.0001 Error 40 Error 40 Error 32 Total 54 Total 54 Total 43 15 Cyp4U3 Day 1 Source DF F ratio p value Cyp4U3 Day 5 Source DF F ratio p value Cyp4U3 Day 10 Source DF F ratio p value Whole model 14 8.7651 <0.0001 Whole model 14 8.8778 <0.0001 Whole model 11 9.9752 <0.0001 Colony 2 29.4149 <0.0001 Colony 2 51.3058 <0.0001 Colony 2 36.1562 <0.0001 Treatment 4 8.4481 0.0065 Treatment 4 3.2456 0.0214 Treatment 3 9.7837 <0.0001 Colony*Treatment 8 3.1078 0.0049 Colony*Treatment 8 1.3371 0.2538 Colony*Treatment 6 2.0419 0.0887 Error 40 Error 40 Error 32 Total 54 Total 54 Total 43 16 CYP4C43v1 Day 1 Source DF F ratio p value CYP4C43v1 Day 5 Source DF F ratio p value CYP4C43v1 Day 10 Source DF F ratio p value Whole model 14 4.5016 <0.0001 Whole model 14 14.1278 <0.0001 Whole model 11 19.8067 <0.0001 Colony 2 18.5522 <0.0001 Colony 2 73.6217 <0.0001 Colony 2 87.7363 <0.0001 Treatment 4 2.8693 0.0352 Treatment 4 2.9052 0.0335 Treatment 3 3.1727 0.0374 Colony*Treatment 8 2.1325 0.0550 Colony*Treatment 8 5.403 0.0001 Colony*Treatment 6 5.9721 0.0003 Error 40 Error 40 Error 32 Total 54 Total 54 Total 43 17 CYP4C44v1 Day 1 Source DF F ratio p value CYP4C44v1 Day 5 Source DF F ratio p value CYP4C44v1 Day 10 Source DF F ratio p value Whole model 14 2.8413 0.0049 Whole model 14 5.6732 <0.0001 Whole model 11 6.206 <0.0001 Colony 2 13.5248 <0.0001 Colony 2 22.4113 <0.0001 Colony 2 25.2446 <0.0001 Treatment 4 1.3979 0.2522 Treatment 4 6.3549 0.0005 Treatment 3 2.0689 0.1239 Colony*Treatment 8 1.0433 0.4210 Colony*Treatment 8 1.3618 0.2427 Colony*Treatment 6 2.0587 0.0863 Error 40 Error 40 Error 32 Total 54 Total 54 Total 43 18 CYP4C45v1 Day 1 Source DF F ratio p value CYP4C45v1 Day 5 Source DF F ratio p value CYP4C45v1 Day 10 Source DF F ratio p value Whole model 14 3.8817 0.0004 Whole model 14 5.8309 <0.0001 Whole model 11 12.0328 <0.0001 Colony 2 19.9505 <0.0001 Colony 2 30.2416 <0.0001 Colony 2 58.9606 <0.0001 Treatment 4 1.8338 0.1413 Treatment 4 2.5505 0.0539 Treatment 3 1.3586 0.2730 Colony*Treatment 8 1.1005 0.3832 Colony*Treatment 8 1.659 0.1390 Colony*Treatment 6 1.5484 0.1945 Error 40 Error 40 Error 32 Total 54 Total 54 Total 43 19 CYP4C46 Day 1 Source DF F ratio p value CYP4C46 Day 5 Source DF F ratio p value CYP4C46 Day 10 Source DF F ratio p value Whole model 14 4.9135 <0.0001 Whole model 14 3.0586 0.0031 Whole model 11 7.8212 <0.0001 Colony 2 11.2471 <0.0001 Colony 2 9.0964 0.0006 Colony 2 13.8531 <0.0001 Treatment 4 9.2901 <0.0001 Treatment 4 3.6287 0.0134 Treatment 3 4.376 0.0114 Colony*Treatment 8 1.1456 0.3552 Colony*Treatment 8 1.0628 0.4089 Colony*Treatment 6 5.8361 0.0004 Error 40 Error 38 Error 32 Total 54 Total 52 Total 43 20 CYP4C47 Day 1 Source DF F ratio p value CYP4C47 Day 5 Source DF F ratio p value CYP4C47 Day 10 Source DF F ratio p value Whole model 14 6.0509 <0.0001 Whole model 14 1.541 0.1407 Whole model 11 2.8234 0.0108 Colony 2 4.4612 0.0178 Colony 2 1.1986 0.3122 Colony 2 4.3022 0.0221 Treatment 4 17.1475 <0.0001 Treatment 4 2.9822 0.0303 Treatment 3 3.0658 0.0419 Colony*Treatment 8 1.5399 0.1744 Colony*Treatment 8 1.1683 0.3418 Colony*Treatment 6 2.2824 0.0603 Error 40 Error 40 Error 32 Total 54 Total 54 Total 43 21 CYP4C48 Day 1 Source DF F ratio p value CYP4C48 Day 5 Source DF F ratio p value CYP4C48 Day 10 Source DF F ratio p value Whole model 14 5.7146 <0.0001 Whole model 14 1.8649 0.0620 Whole model 11 5.9729 <0.0001 Colony 2 7.5363 0.0017 Colony 2 6.4588 0.0037 Colony 2 22.2546 <0.0001 Treatment 4 14.1399 <0.0001 Treatment 4 2.4501 0.0616 Treatment 3 0.1269 0.9434 Colony*Treatment 8 1.5755 0.1630 Colony*Treatment 8 0.3955 0.9165 Colony*Treatment 6 3.4943 0.0090 Error 40 Error 40 Error 32 Total 54 Total 54 Total 43 22 Cyp6.G Day 1 Source DF F ratio p value Cyp6.G Day 5 Source DF F ratio p value Cyp6.G Day 10 Source DF F ratio p value Whole model 14 5.034 <0.0001 Whole model 14 11.1309 <0.0001 Whole model 11 7.5794 Cyp6.G Colony 2 9.8775 0.0003 Colony 2 35.0717 <0.0001 Colony 2 24.0173 <0.0001 Treatment 4 9.0154 <0.0001 Treatment 4 7.5359 0.0001 Treatment 3 3.2081 <0.0001 Colony*Treatment 8 1.2423 0.3006 Colony*Treatment 8 8.0447 <0.0001 Colony*Treatment 6 4.7359 0.0361 Error 40 Error 40 Error 32 0.0015 Total 54 Total 54 Total 43 23 Epox-1 Day 1 Source DF F ratio p value Epox-1 Day 5 Source DF F ratio p value Epox-1 Day 10 Source DF F ratio p value Whole model 14 1.5902 0.1246 Whole model 14 1.1247 0.3676 Whole model 11 2.6903 0.0143 Colony 2 0.7701 0.4697 Colony 2 0.5118 0.5118 Colony 2 0.8242 0.4477 Treatment 4 2.2106 0.0851 Treatment 4 0.153 0.1530 Treatment 3 7.1882 0.0008 Colony*Treatment 8 1.4245 0.2163 Colony*Treatment 8 0.5619 0.5619 Colony*Treatment 6 1.4149 0.2394 Error 40 Error 40 Error 32 Total 54 Total 54 Total 43

PAGE 3

24 Famet-1 Day 1 Source DF F ratio p value Famet-1 Day 5 Source DF F ratio p value Famet-1 Day 10 Source DF F ratio p value Whole model 14 3.6657 0.0006 Whole model 14 7.4513 <0.0001 Whole model 11 17.42 <0.0001 Colony 2 21.7254 <0.0001 Colony 2 37.3263 <0.0001 Colony 2 75.4851 <0.0001 Treatment 4 1.1342 0.3542 Treatment 4 2.4681 0.0602 Treatment 3 6.0388 0.0022 Colony*Treatment 8 0.426 0.8985 Colony*Treatment 8 2.7839 0.0151 Colony*Treatment 6 4.4995 0.0021 Error 40 Error 40 Error 32 Total 54 Total 54 Total 43 25 Famet-2 Day 1 Source DF F ratio p value Famet-2 Day 5 Source DF F ratio p value Famet-2 Day 10 Source DF F ratio p value Whole model 14 2.952 0.0037 Whole model 14 13.3167 <0.0001 Whole model 11 2.6312 0.0162 Colony 2 8.262 0.0010 Colony 2 7.2443 0.0021 Colony 2 6.888 0.0033 Treatment 4 2.3202 0.0734 Treatment 4 22.0555 <0.0001 Treatment 3 2.8876 0.0725 Colony*Treatment 8 1.9909 0.0727 Colony*Treatment 8 13.1742 <0.0001 Colony*Treatment 6 1.3386 0.2692 Error 40 Error 40 Error 32 Total 54 Total 54 Total 43 26 Famet-3 Day 1 Source DF F ratio p value Famet-3 Day 5 Source DF F ratio p value Famet-3 Day 10 Source DF F ratio p value Whole model 14 0.9644 0.5042 Whole model 14 3.725 0.0005 Whole model 11 0.9313 0.5240 Colony 2 3.066 0.0577 Colony 2 8.4977 0.0008 Colony 2 3.248 0.0520 Treatment 4 0.8478 0.5034 Treatment 4 2.4337 0.0630 Treatment 3 0.2338 0.8722 Colony*Treatment 8 0.5677 0.7978 Colony*Treatment 8 3.6018 0.0031 Colony*Treatment 6 0.5048 0.8001 Error 40 Error 40 Error 32 Total 54 Total 54 Total 43 27 Gtpase Day 1 Source DF F ratio p value Gtpase Day 5 Source DF F ratio p value Gtpase Day 10 Source DF F ratio p value Whole model 14 2.704 0.0069 Whole model 14 11.934 <0.0001 Whole model 11 6.142 <0.0001 Colony 2 10.6823 0.0002 Colony 2 69.3128 <0.0001 Colony 2 27.5149 <0.0001 Treatment 4 1.3283 0.2761 Treatment 4 3.0221 0.0287 Treatment 3 1.9999 0.1338 Colony*Treatment 8 1.6289 0.1472 Colony*Treatment 8 2.4083 0.0318 Colony*Treatment 6 1.2873 0.2910 Error 40 Error 40 Error 32 Total 54 Total 54 Total 43 28 Hex-1 Day 1 Source DF F ratio p value Hex-1 Day 5 Source DF F ratio p value Hex-1 Day 10 Source DF F ratio p value Whole model 14 6.7827 <0.0001 Whole model 14 4.2904 <0.0001 Whole model 11 3.1652 0.0053 Colony 2 38.7132 <0.0001 Colony 2 9.5149 0.0004 Colony 2 4.9835 0.0131 Treatment 4 0.8633 0.4943 Treatment 4 8.5116 <0.0001 Treatment 3 5.5603 0.0035 Colony*Treatment 8 1.8432 0.0972 Colony*Treatment 8 0.6904 0.6974 Colony*Treatment 6 1.6936 0.1547 Error 40 Error 40 Error 32 Total 54 Total 54 Total 43 29 Hex-2 Day 1 Source DF F ratio p value Hex-2 Day 5 Source DF F ratio p value Hex-2 Day 10 Source DF F ratio p value Whole model 14 2.6697 0.0076 Whole model 14 10.6668 <0.0001 Whole model 11 3.5759 0.0023 Colony 2 3.0092 0.0606 Colony 2 9.6987 0.0004 Colony 2 4.7587 0.0155 Treatment 4 5.1241 0.0020 Treatment 4 25.8501 <0.0001 Treatment 3 3.1193 0.0396 Colony*Treatment 8 1.3596 0.2437 Colony*Treatment 8 2.3431 0.0362 Colony*Treatment 6 3.5478 0.0083 Error 40 Error 40 Error 32 Total 54 Total 54 Total 43 30 HMG Day 1 Source DF F ratio p value HMG Day 5 Source DF F ratio p value HMG Day 10 Source DF F ratio p value Whole model 14 2.9741 0.0035 Whole model 14 2.2007 0.0258 Whole model 11 0.8981 0.5523 Colony 2 8.5091 0.0008 Colony 2 6.8427 0.0028 Colony 2 2.1979 0.1275 Treatment 4 3.6011 0.0134 Treatment 4 2.1235 0.0957 Treatment 3 1.2832 0.2969 Colony*Treatment 8 1.54 0.1743 Colony*Treatment 8 1.2153 0.3151 Colony*Treatment 6 0.2728 0.9456 Error 40 Error 40 Error 32 Total 54 Total 54 Total 43 31 HSP Day 1 Source DF F ratio p value HSP Day 5 Source DF F ratio p value HSP Day 10 Source DF F ratio p value Whole model 14 8.6166 <0.0001 Whole model 14 11.3062 <0.0001 Whole model 11 2.5761 0.0182 Colony 2 54.4968 <0.0001 Colony 2 58.475 <0.0001 Colony 2 7.6581 0.0019 Treatment 4 1.7485 0.1584 Treatment 4 3.6285 0.0129 Treatment 3 0.9199 0.4423 Colony*Treatment 8 0.5659 0.7992 Colony*Treatment 8 3.8855 0.0018 Colony*Treatment 6 1.8573 0.1192 Error 40 Error 40 Error 32 Total 54 Total 54 Total 43 32 Intro Day 1 Source DF F ratio p value Intro Day 5 Source DF F ratio p value Intro Day 10 Source DF F ratio p value Whole model 14 6.0839 <0.0001 Whole model 14 9.1773 <0.0001 Whole model 11 5.5467 <0.0001 Colony 2 37.2679 <0.0001 Colony 2 55.092 <0.0001 Colony 2 15.2613 <0.0001 Treatment 4 1.018 0.4097 Treatment 4 2.9529 0.0315 Treatment 3 2.7977 0.0559 Colony*Treatment 8 0.7477 0.6495 Colony*Treatment 8 1.0171 0.4391 Colony*Treatment 6 3.7431 0.0062 Error 40 Error 40 Error 32 Total 54 Total 54 Total 43 33 LCP Day 1 Source DF F ratio p value LCP Day 5 Source DF F ratio p value LCP Day 10 Source DF F ratio p value Whole model 14 1.5724 0.1302 Whole model 14 1.9553 0.0490 Whole model 11 1.599 0.1465 Colony 2 3.2355 0.0498 Colony 2 0.6686 0.5181 Colony 2 2.5846 0.0911 Treatment 4 2.4879 0.0586 Treatment 4 1.2137 0.3202 Treatment 3 2.697 0.0623 Colony*Treatment 8 0.6393 0.7400 Colony*Treatment 8 2.4525 0.0291 Colony*Treatment 6 0.7481 0.6154 Error 40 Error 40 Error 32 Total 54 Total 54 Total 43 34 Lprs Day 1 Source DF F ratio p value Lprs Day 5 Source DF F ratio p value Lprs Day 10 Source DF F ratio p value Whole model 14 2.0853 0.0349 Whole model 14 2.3742 0.0164 Whole model 11 4.7083 0.0003 Colony 2 9.6803 0.0004 Colony 2 0.0218 0.9784 Colony 2 5.1163 0.0118 Treatment 4 1.2372 0.3106 Treatment 4 2.5123 0.0567 Treatment 3 6.1393 0.0020 Colony*Treatment 8 0.5773 0.7902 Colony*Treatment 8 3.256 0.0060 Colony*Treatment 6 4.6028 0.0018 Error 40 Error 40 Error 32 Total 54 Total 54 Total 43 35 MalcoA Day 1 Source DF F ratio p value MalcoA Day 5 Source DF F ratio p value MalcoA Day 10 Source DF F ratio p value Whole model 14 1.8464 0.0650 Whole model 14 3.5714 0.0008 Whole model 11 1.038 0.4381 Colony 2 0.8537 0.4334 Colony 2 0.3545 0.7037 Colony 2 2.8896 0.0702 Treatment 4 1.225 0.3155 Treatment 4 1.4257 0.2431 Treatment 3 0.9158 0.4430 Colony*Treatment 8 2.4832 0.0274 Colony*Treatment 8 5.2988 0.0001 Colony*Treatment 6 0.4996 0.8038 Error 40 Error 40 Error 32 Total 54 Total 54 Total 43

PAGE 4

36 Myosin Day 1 Source DF F ratio p value Myosin Day 5 Source DF F ratio p value Myosin Day 10 Source DF F ratio p value Whole model 14 8.561 <0.0001 Whole model 14 4.9159 <0.0001 Whole model 11 13.7575 <0.0001 Colony 2 30.7634 <0.0001 Colony 2 22.4703 <0.0001 Colony 2 36.2774 <0.0001 Treatment 4 8.6208 <0.0001 Treatment 4 1.5011 0.2202 Treatment 3 19.7016 <0.0001 Colony*Treatment 8 3.5224 0.0036 Colony*Treatment 8 2.0163 0.0692 Colony*Treatment 6 3.798 0.0057 Error 40 Error 40 Error 32 Total 54 Total 54 Total 43 37 NADH Day 1 Source DF F ratio p value NADH Day 5 Source DF F ratio p value NADH Day 10 Source DF F ratio p value Whole model 14 91.7212 <0.0001 Whole model 14 34.168 <0.0001 Whole model 11 20.895 <0.0001 Colony 2 541.5197 <0.0001 Colony 2 215.1253 <0.0001 Colony 2 95.1761 <0.0001 Treatment 4 20.2498 <0.0001 Treatment 4 4.2354 0.0060 Treatment 3 5.3908 0.0041 Colony*Treatment 8 17.6794 <0.0001 Colony*Treatment 8 4.5538 0.0005 Colony*Treatment 6 4.6889 0.0016 Error 40 Error 40 Error 32 Total 54 Total 54 Total 43 38 nanos Day 1 Source DF F ratio p value nanos Day 5 Source DF F ratio p value nanos Day 10 Source DF F ratio p value Whole model 14 4.07 0.0002 Whole model 14 7.6749 <0.0001 Whole model 11 4.2238 0.0007 Colony 2 9.9968 0.0003 Colony 2 33.8798 <0.0001 Colony 2 16.2633 <0.0001 Treatment 4 3.6645 0.0124 Treatment 4 5.0986 0.0020 Treatment 3 1.7572 0.1752 Colony*Treatment 8 3.3161 0.0053 Colony*Treatment 8 2.9444 0.0110 Colony*Treatment 6 1.6548 0.1648 Error 40 Error 40 Error 32 Total 54 Total 54 Total 43 39 R-Pro Day 1 Source DF F ratio p value R-Pro Day 5 Source DF F ratio p value R-Pro Day 10 Source DF F ratio p value Whole model 14 15.5736 <0.0001 Whole model 14 12.5922 <0.0001 Whole model 11 25.8509 <0.0001 Colony 2 97.6239 <0.0001 Colony 2 70.4115 <0.0001 Colony 2 127.6766 <0.0001 Treatment 4 4.446 0.0046 Treatment 4 3.0918 0.0262 Treatment 3 3.6042 0.0238 Colony*Treatment 8 0.7942 0.6108 Colony*Treatment 8 2.9109 0.0117 Colony*Treatment 6 2.9175 0.0220 Error 40 Error 40 Error 32 Total 54 Total 54 Total 43 40 SH3 Day 1 Source DF F ratio p value SH3 Day 5 Source DF F ratio p value SH3 Day 10 Source DF F ratio p value Whole model 14 8.0306 <0.0001 Whole model 14 10.0626 <0.0001 Whole model 11 3.7236 0.0018 Colony 2 36.5278 <0.0001 Colony 2 46.9173 <0.0001 Colony 2 8.3693 0.0012 Treatment 4 1.5876 0.1963 Treatment 4 4.8454 0.0028 Treatment 3 4.6371 0.0084 Colony*Treatment 8 3.9516 0.0016 Colony*Treatment 8 3.6633 0.0027 Colony*Treatment 6 2.2348 0.0651 Error 40 Error 40 Error 32 Total 54 Total 54 Total 43 41 Shp Day 1 Source DF F ratio p value Shp Day 5 Source DF F ratio p value Shp Day 10 Source DF F ratio p value Whole model 14 7.6141 <0.0001 Whole model 14 16.6325 <0.0001 Whole model 11 22.2795 <0.0001 Colony 2 38.7225 <0.0001 Colony 2 94.6769 <0.0001 Colony 2 108.844 <0.0001 Treatment 4 3.2903 0.0201 Treatment 4 4.1374 0.0067 Treatment 3 6.1392 0.0020 Colony*Treatment 8 2.3776 0.0338 Colony*Treatment 8 3.813 0.0021 Colony*Treatment 6 1.6725 0.1599 Error 40 Error 40 Error 32 Total 54 Total 54 Total 43 42 To-F Day 1 Source DF F ratio p value To-F Day 5 Source DF F ratio p value To-F Day 10 Source DF F ratio p value Whole model 14 3.8449 0.0004 Whole model 14 2.6242 0.0085 Whole model 11 3.4257 0.0032 Colony 2 13.5125 <0.0001 Colony 2 8.5861 0.0008 Colony 2 9.5682 0.0006 Treatment 4 2.23 0.0829 Treatment 4 3.485 0.0156 Treatment 3 4.0328 0.0153 Colony*Treatment 8 2.314 0.0383 Colony*Treatment 8 0.6614 0.7217 Colony*Treatment 6 1.2248 0.3196 Error 40 Error 40 Error 32 Total 54 Total 54 Total 43 43 Tro-1 Day 1 Source DF F ratio p value Tro-1 Day 5 Source DF F ratio p value Tro-1 Day 10 Source DF F ratio p value Whole model 14 6.505 <0.0001 Whole model 14 3.2901 0.0016 Whole model 11 6.2964 <0.0001 Colony 2 31.0656 <0.0001 Colony 2 15.8375 <0.0001 Colony 2 16.7849 <0.0001 Treatment 4 2.7395 0.0418 Treatment 4 2.0189 0.1102 Treatment 3 3.9901 0.0160 Colony*Treatment 8 2.0926 0.0595 Colony*Treatment 8 0.7571 0.6417 Colony*Treatment 6 3.781 0.0059 Error 40 Error 40 Error 32 Total 54 Total 54 Total 43 44 Tro-2 Day 1 Source DF F ratio p value Tro-2 Day 5 Source DF F ratio p value Tro-2 Day 10 Source DF F ratio p value Whole model 14 5.6249 <0.0001 Whole model 14 2.8793 0.0044 Whole model 11 3.1576 0.0054 Colony 2 30.2072 <0.0001 Colony 2 14.2313 <0.0001 Colony 2 4.3639 0.0211 Treatment 4 1.7241 0.1637 Treatment 4 1.9523 0.1205 Treatment 3 2.0563 0.1257 Colony*Treatment 8 1.5723 0.1640 Colony*Treatment 8 0.5371 0.8214 Colony*Treatment 6 3.2642 0.0128 Error 40 Error 40 Error 32 Total 54 Total 54 Total 43 45 Vit-1 Day 1 Source DF F ratio p value Vit-1 Day 5 Source DF F ratio p value Vit-1 Day 10 Source DF F ratio p value Whole model 14 2.6918 0.0072 Whole model 14 3.7806 0.0005 Whole model 11 2.8854 0.0095 Colony 2 1.1124 0.3387 Colony 2 8.844 0.0007 Colony 2 3.3534 0.0476 Treatment 4 3.2933 0.0201 Treatment 4 5.4188 0.0014 Treatment 3 2.0417 0.1277 Colony*Treatment 8 3.2046 0.0066 Colony*Treatment 8 1.3699 0.2391 Colony*Treatment 6 2.9587 0.0206 Error 40 Error 40 Error 32 Total 54 Total 54 Total 43 46 Vit-2 Day 1 Source DF F ratio p value Vit-2 Day 5 Source DF F ratio p value Vit-2 Day 10 Source DF F ratio p value Whole model 14 2.338 0.0180 Whole model 14 8.0829 <0.0001 Whole model 11 7.0682 <0.0001 Colony 2 1.6441 0.2060 Colony 2 6.0978 0.0049 Colony 2 8.2693 0.0013 Treatment 4 3.1184 0.0253 Treatment 4 21.2548 <0.0001 Treatment 3 11.069 <0.0001 Colony*Treatment 8 2.4999 0.0265 Colony*Treatment 8 1.1484 0.3536 Colony*Treatment 6 3.6228 0.0074 Error 40 Error 40 Error 32 Total 54 Total 54 Total 43



PAGE 1

1 INFLUENCE OF SOLDIER DERIVED SEMIOCHEMICALS ON RETICULITERMES FLAVI PES WORKER CASTE DIFFERE NTIATION AND GENE EXPRESSION By MATTHEW ROBERT TARVER A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2009

PAGE 2

2 2009 Matthew Robert Tarver

PAGE 3

3 To all of those who have helped me along my path

PAGE 4

4 ACKNOWLEDGMENTS I would like to thank all of the people who have helped m e throughout this process. With out everybodys kind help I would not have succeeded. I am thankful to all of my friends, my wonderful wife Meg umi and most importantly Dr. Scharf for giving me the opportunity, resources, and guidance to make this happen.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS .................................................................................................................... 4 LIST OF TABLES ................................................................................................................................ 9 LIST OF FIGURES ............................................................................................................................ 10 ABSTRACT ........................................................................................................................................ 13 CHAPTER 1 INTRODUCTION ....................................................................................................................... 15 Background .................................................................................................................................. 15 Termite Castes and Cas te Differentiation .................................................................................. 17 Socio Regulatory Factors ........................................................................................................... 19 Termite Biology and Control ...................................................................................................... 22 Termite Socio Genomics Research ............................................................................................ 22 Hypotheses, Rationale and Objectives ....................................................................................... 24 2 EFFECTS OF SOLDIER DERIVED TERPENES ON SOLDIER CASTE DIFFERENTIATION IN THE TERMITE RETICULITERMES FLAVIPES ......................... 26 Introduc tion ................................................................................................................................. 26 Materials and Methods ................................................................................................................ 29 Termites ................................................................................................................................ 29 Dish Assays .......................................................................................................................... 30 Solider Head Extracts .......................................................................................................... 30 SHE Concentration Response and Investigation of Colony V ariation ............................. 30 Gas Chromatography (GC) and Mass Spectrometry (MS) ............................................... 31 Nuclear Magnetic Resonance (NMR) Analysis ................................................................. 31 Previously Identified Chemicals ......................................................................................... 33 Statistical Analyses .............................................................................................................. 34 Results .......................................................................................................................................... 35 SHE Concentration Response ............................................................................................. 35 GC MS and NMR Analysis ............................................................................................... 35 Cadinene and Previously Described Soldier Chemicals Enhance JH Induced Presoldier Differentiation ................................................................................................ 37 Discussion .................................................................................................................................... 37 3 SEMIOCHEMICAL AND SOCIO ENVIRONMENTAL EFFECTs ON C ASTE DIFFERENTIATION AND GENE EXPRESSION IN RETICULITERMES FLAVIPES ..... 46 Introduction ................................................................................................................................. 46 Experimental Procedures ............................................................................................................ 51

PAGE 6

6 Termites ................................................................................................................................ 51 Bioassays .............................................................................................................................. 52 Solider Head Extracts .......................................................................................................... 52 Gas Chromatography (GC) and Mass Spectrometry (MS) ............................................... 53 Phenotypic and Gene Expression Bioassays ...................................................................... 54 RNA Isolation and cDNA Synthesis .................................................................................. 54 Gene Expression .................................................................................................................. 55 Reference Gene Selection ................................................................................................... 55 Data and Statistical Analyses .............................................................................................. 56 Results .......................................................................................................................................... 57 Phenotypic Responses of Objective #1 .............................................................................. 57 Reference Gene Selection ................................................................................................... 57 Gene Expression Results of Objective #1 .......................................................................... 57 Day 1 .................................................................................................................................... 58 Day 5 .................................................................................................................................... 59 Day 10 .................................................................................................................................. 60 GC -MS Analysis and GC Separation of Soldier Head Chemicals ................................... 60 Phenotypic Results from Objective #2 ............................................................................... 61 Gene Expression Results from Objective #2 ..................................................................... 61 Discussion .................................................................................................................................... 62 Chemical Production / Degradation Genes ........................................................................ 64 Hemolymph Protein Coding Genes .................................................................................... 67 Developmental Genes .......................................................................................................... 69 Defining Chemical Ecology Through Gene Expression ................................................... 71 Conclusions .......................................................................................................................... 72 4 FUNCTIONAL ANALYSES OF R. FLAVIPES CYTOCHROME P450 AND ESTERASE GENES LINKED TO JUVENILE HORMONE BIOSYNTHESIS AND DEGRADATION ........................................................................................................................ 87 Introduction ................................................................................................................................. 87 Materials and Methods ................................................................................................................ 90 Termites ................................................................................................................................ 90 Solider Head Extract ............................................................................................................ 90 Gene Sequence Identification and Analyses ...................................................................... 90 Gene Tissue Distribution and JH and JH+SHE Response ................................................ 91 RNA Isolation and cDNA Synthesis .................................................................................. 91 Gene Expression .................................................................................................................. 91 Data and Statistical Analyses .............................................................................................. 92 Esterase Native PAGE and Colorimetric Esterase Assays ............................................... 92 Esterase Native PAGE ......................................................................................................... 93 Colorimetric Esterase Assays .............................................................................................. 93 Results .......................................................................................................................................... 94 Gene Sequencing ................................................................................................................. 94 Alignments ........................................................................................................................... 94 Tissue Localization .............................................................................................................. 95 Localized Expression Response to JH and JH+SHE ......................................................... 96

PAGE 7

7 Functional Characterization of RfEst1 ................................................................................ 96 Discussion .................................................................................................................................... 97 5 OVERALL CONCLUSIONS .................................................................................................. 112 Conclusions ............................................................................................................................... 112 Hypotheses and Caveats ........................................................................................................... 114 Soldier Head Extracts ........................................................................................................ 114 JH Effects on Caste Differentiation .................................................................................. 114 Gene Silencing Through RNAi ......................................................................................... 115 Summary .................................................................................................................................... 116 APPENDIX A SOLDIER HEAD EXTRACTS PREPARED IN DICHLOROMETHANE (DCM, MECL2) ALSO SYNERGISTICALLY INCREASE JH INDUCED PRESOLDIER DIFFERENTIATION BY R. FLAVIPES WO RKERS. .......................................................... 117 B COMPARISON OF MULTIPLE RNA ISOLATION METHODS ...................................... 121 Introduction ............................................................................................................................... 121 Materials and Methods .............................................................................................................. 121 Termites .............................................................................................................................. 121 RNA Extraction ................................................................................................................. 121 cDNA Synthesis ................................................................................................................. 122 Quantitative Real Time PCR ............................................................................................ 122 Results and Discussion ............................................................................................................. 123 C SEQUEN CES AND PHYLOGENETIC ANALYSES OF TERMITE GENES .................. 129 Introduction ............................................................................................................................... 129 Materials and Methods .............................................................................................................. 129 Results and Discussion ............................................................................................................. 131 SECTION 1: 16s rDNA Sequences .................................................................................. 132 SECTION 2 Hexamerin 2 Sequences ............................................................................. 135 SECTION 3 Sequences of qRT PCR Products That Correspond to ESTs Identified by Tartar et al. (2009) .................................................................................................... 136 SECTION 4 Sequences from Library Clones Identified from Tartar et al. (2009 ....... 138 SECTION 5 Sequences from Library Clones Identified from Tartar et al. (2009) ...... 142 SECTION 6 High Throughput Array Genes Sequences ................................................ 145 D SOLDIER INFLUENCE ON WORKER CASTE DIFFERENTIATION ............................ 152 Introduction ............................................................................................................................... 152 Methods ..................................................................................................................................... 152 Results ........................................................................................................................................ 152

PAGE 8

8 E GENE SILENCING THROUGH RNAI ................................................................................. 155 Introduction ............................................................................................................................... 155 RNAi Materials and Methods ................................................................................................... 155 Termites .............................................................................................................................. 155 dsRNA/ siRNA Synthesis ................................................................................................. 155 dsRNA Feeding Assays ..................................................................................................... 156 Treatments .......................................................................................................................... 156 Statistical Analysis ............................................................................................................. 157 Results and Discussion ............................................................................................................. 158 Feeding ............................................................................................................................... 158 Injection .............................................................................................................................. 159 LIST OF REFERENCES ................................................................................................................. 164 BIOGRAPHICAL SKETCH ........................................................................................................... 175

PAGE 9

9 LIST OF TABLES Table page 3 1 Gene list and primers ............................................................................................................. 74 3 2 Meta analysis of all genes over all treatments and days ...................................................... 75 3 4 Objective #2 ANOVA table .................................................................................................. 76 3 5 Objective #1 Day 1 relative expression ................................................................................ 77 3 6 Objective #1 Day 5 relative expression ................................................................................ 78 3 7 Objective #1 Day 10 relative expression .............................................................................. 79 4 1 Cyp15 signature motifs ........................................................................................................ 103 4 2 Day 0 Tissue distribution of three potential JH production/ degradation protein coding genes. ........................................................................................................................ 103 4 3 ANOVA table for gene localization. ................................................................................... 104 A 1 Effects of soldier head extraction solvents and live soldiers on juvenile hormone III (JH) -induced termite presoldier induction. Three separate experiments were performed on five different colonies. .................................................................................. 119 B1 Spectrophotometer measurements of each of the RNA isolations .................................... 125

PAGE 10

10 LIST OF FIGURES Figure page 2 1 Soldier head extract (SHE) dose -response ......................................................................... 42 2 2 SHE chemis try.. ...................................................................................................................... 43 2 3 Analysis of soldier head extracts by mass spectrometry.. ................................................... 44 2 4 Previously described soldier derived terpenes synergistically enhance JH dependent presoldier differentiation. ..................................................................................................... 45 3 1 Impact of semiochemical and socio -environmental treatments on soldier caste differentiation ........................................................................................................................ 80 3 2 Expression changes for significant genes in termite workers in response to semiochemical and socio -environmental treatments after 1, 5, and 10 days.. ..................... 1 3 3 Impact of SHE blend and SHE components on soldier caste differentiation.. ................... 84 3 4 Expression changes for genes in termite workers in response to SHE blend and SHE components after 1, 5, and 10 days. ...................................................................................... 85 3 5 Diagrams summarizing the influence of so cio -environmental and semiochemical factors on caste differentiation.. ............................................................................................ 86 4 1 Cyp15F1 and Cyp15A1 sequences .................................................................................... 105 4 2 RfEst1 sequences. ................................................................................................................. 106 4 3 Analysis of gene expression in R. flavipes worker body regions for the three target genes, Cyp15F1, Cyp15A1, and RfEst1. ............................................................................ 107 4 4 JH induction of RfEst1 ......................................................................................................... 108 4 5 RfEst1 Native PAGE ............................................................................................................ 109 4 6 Colorimetric esterase assays.. .............................................................................................. 110 4 7 JH production and degradation ............................................................................................ 111 A 1 Effects of soldier head extracts prepared in DCM on four R. flavipes colonies.. ............ 120 B1 RNA samples ........................................................................................................................ 126 B2 Comparisons of gene expression levels of for four genes in R. flavipes workers determined from RNA isolation performed by different methods.. .................................. 127

PAGE 11

11 B3 Analysis of potential genomic DNA contamination in RNA preparations. ..................... 128 C1 Clustal W alignment of nucleotide sequences for R. flavipes 16s mitochondrial gene.. 149 C2 Clustal W phylogenetic tree of nucleotide sequences for R. flavipes 16s mitochondrial gene. .............................................................................................................. 150 C3 Clustal W alignment of Hex -2 sequences. .......................................................................... 151 D 1 Influence of live soldiers on worker nestmate caste differentiation.. ............................... 154 E 1 dsRNA feeding assay.. ......................................................................................................... 160 E 2 Relati ve expression of the Laccase gene of termites fed control vs. Laccase dsRNA. ... 161 E 3 Relative expression of siRNAi injected genes. .................................................................. 162 E 4 Relative expression of the RfEst1 gene in termites injected with siRNA negative control vs. RfEst1 siRNA. .................................................................................................... 163

PAGE 12

12 LIST OF OBJECTS Object page 3 1 Table 3 3 ................................................................................................................................. 56

PAGE 13

13 Abstract of Dissertation P resented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy INFLUENCE OF SOLDIER DERIVED SEMIOCHEMICALS ON RETICULITERMES FLAVIPES WORKER CASTE DIFFERE NTIATION AND GENE EX PRESSION By Matthew Robert Tarver December 2009 Chair: Michael E. Scharf Major: Entomology and Nematology This dissertation focused on the termite Reticulitermes flavipes (Kollar), a serious structural pest in the USA. The goal of this research was to investigate potential impacts that soldier termites have on nestmate caste differentiation. Specifically, studies were conducted to understand the influence of soldier head c hemicals on nestmate worker caste differentiation. The central hypothesis was that the chemicals produced by soldiers influence phenotype and gene expression of worker, and responsive genes that show differential expression will play a role in caste differ entiation. Results showed that soldier head extracts (SHE), when combined with juvenile hormone (JH), synergistically increased worker to presoldier (PS) formation relative to JH alone. Using gas chromatography (GC), mass spectrophotometry (MS), and nuclea r magnetic -cadinene -cadinenal. Through use of quantitative real time PCR, the expression patterns of 47 genes in response to JH and soldier head chemicals were investi gated. The three main groups of genes with significant differential expression were 1) genes encoding enzymes involved in hormone and semiochemical biosynthesis / degradation, 2) hemolymph protein coding genes, and 3) developmental genes. Also, the individ -

PAGE 14

14 -cadinenal) on phenotypic caste differentiation and gene expression of workers was investigated. Finally, the last phase of this dissertation was to further characterize genes from the chemical biosynthesis / degradation group: two cytochrome P450s and a putative JH esterase (Cyp15F1, Cyp15A2, and RfEst1 ). Gene homology analyses, expression profiling, and RNAi studies support the hypothesis that these genes play roles in JH production and degr adation. In summary, this research has led to: 1) a better understanding of the role semiochemicals produced by soldiers play in worker caste differentiation, 2) the impacts that JH, soldier head chemicals, JH+soldier head chemicals, and live soldiers have on nestmate gene expression, and 3) a better understanding of the potential function of three specific genes in caste regulation, or the mediation of worker to -soldier caste differentiation. As a result of understanding how soldiers are formed, new and novel control methods for this pest can eventually be designed. This dissertation provides a step towards development of more environmentally friendly, next generation termiticides.

PAGE 15

15 CHAPTER 1 INTRODUCTION Background Social insects fall outside the traditional idea of evolution via natural selection in which individuals who are best suited for their environment are able to reproduce and pass their genetic information to the next generation (Thorne, 1997). In social insect colonies, most individuals do not mate; rather, they are altruistic helpers that perform various tasks within the colony. Since members of social insect colonies have high degrees of relatedness, an organism may increase its own fitness by helping its relatives offspring to survive (Dugatkin, 1997). Altruistic behavior, while superficially appearing self -destructive, actually benefits the colony and raises the individuals fitness (Myles and Nutting, 1988). Organisms that are eusocial share three main characteristics: 1) a reproductive division of labor, 2) overlapping generations, and 3) cooperative care of the young. A number of organisms display a gradient of eusociality, but the two main insect orders that display eusociality are Hymenoptera and Isoptera. Although not all Hymenoptera are eusocial, all Isoptera are eusocial. Termites are members of the order Isoptera. Termites are small, pale, soft -bodied, hemimetabolous social insects that live in a colony system. Within a colony, termites have a division of labor based on castes that are characterized by both phenotype and behavior. In contrast to termites, hymenopteran insects (ants, bees, and wasps) have a social structure which is different in the following ways: 1) they are holometabolous, 2) they have a haplodiploid genetic system, and 3) most colony individuals are female. Holometabolous development, also known as complete metamorphosis, is defined as the progression of worm like larvae through a pupal stage prior to molting into adults.

PAGE 16

16 Because of their haplo -diploid genetic system, hymenopteran workers are more related to one another than they would be to their own progeny (Hamilton, 1964; Thorne, 1997). By providing c ooperative care of young, they increase the chance of passing their genetic information to the next generation. The evolution of hymenopteran sociality is discernable because of the wide range of social behaviors observed in hymenoptera, ranging from indiv iduals that work alone (solitary wasps), to the whole colonies that work together for the good of the colony (honey bees). It is difficult to draw a parallel between hymenopteran and isopteran sociality because termites are diploid, hemimetabolous, and all living species are social (Thorne, 1997). The flexibility to adapt to changing environmental conditions is an important survival strategy for many organisms. Phenotypic plasticity refers to a single genotype that can produce numerous different phenotype s, depending on various conditions encountered through its development (Nijhout, 1999). Phenotypic plasticity can be divided into two major types of responses to signals; reaction norms and polyphenisms. Reaction norms are phenotypically graded responses t o environmental factors, while polyphenisms occur as two or more discrete alternative phenotypes, which transpire without intermediate forms (Nijhout, 2003). Social insects have evolved multiple complex phenotypes. A phenotype is an individuals appearance or behaviors, as produced by the interaction of genes and environment (Nijhout, 1999, 2003; Miura, 2004). Castes are phenotypically and behaviorally discrete individuals that cooperate to perform colony tasks (Miura, 2004). Most termite colonies are made up of three distinct castes that include; workers, soldiers, and reproductives. All termite eggs, except when a rare genetic component might be involved (Hayashi et al., 2007), are totipotent and differentiate into the different castes based on a number o f intrinsic and extrinsic factors.

PAGE 17

17 A recent set of articles discussed genetic caste determination versus environmental caste determination. Past literature has suggested that caste determination in termites is controlled entirely by environment and genet ic predisposition does not play a role (Queller and Strassmann, 1998; Lo et al., 2009). However, Hayashi et al. (2007), through an array of complex sexual crosses, suggested that reproductive development (like some ant species) has a genetic component. Mat suura et al. (2009) observed queen reproductive replacement through asexual parthogenesis, and suggested that eusocial insects, because of their unique life histories, can generate unique modes of reproduction. This might possibly explain the unique result s observed by Hayashi et al. (2007). Still more work needs to be conducted to define reproductive developmental pathways. There is far more data in existence showing that environment plays a major role in directing termite caste differentiation, especially soldier caste differentiation (Koshikawa, 2005; Scharf et al., 2007; Zhou et al., 2007). Termite Castes and Caste Differentiation Termite caste differentiation can proceed along two routes, the imaginal (winged) or the apterous (wingless). All forms are considered immature in lower termites except soldiers, alates and the three reproductive forms. After termite eggs hatch, the first developmental branch is where the larvae differentiate into workers, soldiers or nymphs. Workers can, 1) undergo status quo worker to -worker molts, 2), differentiate into presoldiers (immediately followed by a molt into a soldier), or 3) differentiate into apterous eyeless third -form reproductives. Nymphs can, 1) regress into worker -like pseudergates, 2) differentiate into full y winged eyed adult alates that disperse, mate and become primary reproductives, or 3) differentiate into second form reproductives that serve as supplemental reproductives (Buchli, 1958; Lain and Wright, 2003; Scharf et al., 2003a).

PAGE 18

18 Workers constitute th e majority of individuals in the colony and perform most of the work. Workers feed other caste members, groom the queen, excavate the nest, make tunnels, tend to larvae, dispose of corpses, perform hygienic behaviors, and forage for food. A true worker is a non reproductive, non -soldier individual of the third or fourth or a later instar that has diverged early and irreversibly from the imaginal line (Noirot, 1985). Workers are responsible for the majority of damage caused by termites. Pseudergates, sometim es called false workers, perform the same tasks as workers, but are actually differentiating along the imaginal line and have the ability to eventually differentiate into alates. True workers, pseudergates and nymphs exhibit altruistic helping behaviors that are characteristic of the worker caste. Within the termite colony the main role of the soldiers is colony defense (Wilson, 1971). Soldiers are morphologically specialized and have large heavily sclerotized heads and well developed mandibles. The ster ile soldier caste is at the end of its developmental pathway (it is terminally developed). Soldiers are unable to feed themselves and rely on workers to feed them. Worker termites differentiate into soldiers by first molting into presoldiers, and then into soldiers; a process that takes approximately four weeks. However, the soldier termites inability to feed itself and its low numbers within the colony has raised many questions of their role within the colony. Recent research suggests soldiers could possi ble play an influential role in the caste differentiation process. The soldier caste has been theorized to act as a juvenile hormone (JH) sink (Henderson, 1998). However there is no evidence that JH can be transferred among nestmates by any other means t han cannibalism. In this role, soldiers are hypothesized to either regulate JH titers of nestmates or uninhibit worker maturation by controlling a different primer pheromone (Mao et al., 2005; Park and Raina, 2004, 2005). Thus, soldiers clearly regulate

PAGE 19

19 so ldier formation, and may regulate the ability of workers to metamorphose into reproductives, nymphs, or neotenics (Henderson, 1998). The third caste of termites is the reproductive caste, which is responsible for the production of offspring and passage of genetic information to subsequent generations. There are a number of phenotypic forms of reproductives. Primary and secondary forms develop from the imaginal pathway, while tertiary forms come from the apterous line (Lain and Wright, 2003; Thorne, 1996; S charf et al., 2005b). Primary reproductives arise from nymphs that molt into alates which disperse, mate, and form a new colony. Secondary reproductives arise from nymphs that do not disperse and stay in the colony. Tertiary reproductives develop from the apterous line of workers. As discussed above, the specific factors that regulate differentiation of the different reproductives remain unknown. One possibility is that reproductive caste determination could be genetically controlled (Hayashi et al., 2007), but this evidence is not compelling or well supported. Socio -Regulatory Factors As noted above, social insects are unique because they display caste polyphenism and an overlap of generations, resulting in multiple castes of different age classes being pr esent at the same time (Miura, 2004). Also, individuals with the same genetic background express various phenotypes according to intrinsic and extrinsic factors (Koshikawa, 2005; Scharf et al., 2007; Zhou et al., 2007). Intrinsic factors, by definition, o riginate or are due to causes within a body, organ, or part. One established intrinsic factor that controls the development of termites is juvenile hormone (JH). Juvenile hormone is a morphogenetic hormone produced by a paired neurosecretory gland (the corpus allatum) that has a broad range of developmental and physiological effects (Nijhout, 1994). In insects, juvenile hormone plays a role in the control of larval development and metamorphosis, but also has been shown to play a role in diapause,

PAGE 20

20 migratory behavior, wing length, seasonal development, and eusocial caste determination (Hartfelder, 2000). How can this single hormone have such a great diversity of effects? A single conventional JH receptor has yet to be discovered, and an alternative hypothesi s is that JH is acting as part of a diverse, multi receptor lipid signaling system. Wheeler and Nijhout (2003) compared JH action to lipid -soluble signaling molecules found in vertebrates, invertebrates and plants. They suggest that JH may be a lipid signa ling molecule that participates in both signal transduction and transcriptional regulation as seen in other organisms. The termite model system may help to address this hypothesis. For example, Zhou et al. (2006a) found a prenylation motif in the termite h examerin (Hex 1) protein which may covalently bind JH or act as a membrane anchor that mediates signal transduction. In termites, JH shows characteristics of primer pheromones. Primer pheromones are chemical messengers that are passed among individuals an d trigger physiological responses in recipients (Wilson and Bossert, 1963). At high JH titers a worker termite differentiates into a presoldier, which is directly followed by a molt into a soldier. The role of JH in soldier development is apparently the op posite of the normal role of JH among insects, which is apparently to maintain immature features (Truman and Riddiford, 1999). Previous studies have shown that exposure of worker termites to various JH homologues, including JH III, induces soldier differ entiation (Howard and Haverty, 1979; Scharf et al., 2003b). Morphogenic hormones, such as JH, thus appear to be directly responsible for at least soldier caste differentiation. The trigger for JH production by the corpora allata however may be extrinsic, a s described below.

PAGE 21

21 Factors that affect individuals from outside the body (extrinsic factors) also clearly play a role in termite differentiation and development. Extrinsic factors, by definition, originate from or on the outside, originating outside a pa rt and acting upon the part as a whole. Examples of extrinsic factors in termite caste differentiation are colony caste composition, reproductive type and number, seasonality (temperature and rainfall), and nutrition (food quality, presence or absence of food). Two specific extrinsic factors that play a role in termite development are environmental factors such as seasonality and food quality. Cabrera and Kamble (2001) showed R. flavipes that were pre -exposed to a reduced thermo-photoperiod had an increas ed survival rate at low temperatures. Liu et al. (2005) monitored JH levels in field collected termites and demonstrated that they fluctuate throughout the year. Specifically, JH titers peaked with rising temperatures in early spring in correspondence with increased alate and soldier formation, but decreased thereafter. Scharf et al. (2007) demonstrated a correlation between temperature, caste differentiation, hexamerin protein levels, and JH sequestration. They suggested that hexamerin proteins are part of an environmentally and nutritionally responsive switching mechanism that helps regulate caste composition. The influence of colony nestmates also plays a role in the regulation of caste differentiation. The termite colony produces individual castes based on the necessities of the colony. If there are low numbers of soldiers in the colony, some evidence suggests that workers will change into soldiers; while if a colony has too many soldiers then none will be formed (Park and Raina, 2003; Mao et al., 2005). Soldiers within the colony appear to play a key role in caste regulation (Park and Raina, 2004, 2005; Mao et al., 2005; Henderson, 1998). It has also been hypothesized that presoldiers and soldiers can act as JH sponges in the colony by absorbing JH from the colony, thus inhibiting soldier formation and stimulating the worker to alate

PAGE 22

22 transformation (Henderson, 1998). Mao and Henderson (2006) suggest the enlarged functional labrum and broad soft mandibles of the presoldiers could be absorbing exogenous JH However, there is no evidence that JH can be transferred among individuals. Okot -Kotber et al. (1991) and Korb (2003) showed live soldiers and soldier head extracts (SHE), in combination with synthetic JH analogs, could block soldier differentiation. Don g et al. (2009) suggested that physical contact between workers and soldiers is also important in soldier caste regulation. Termite Biology and Control Although termites represent model social organism for studying phenotypic plasticity, they remain one of the most highly destructive insect pests. An estimated 20 billion US dollars is spent globally on termite damage and control each year (Su, 2002). Termites cause structural damage to buildings by eating cellulose -based building materials or chewing through non cellulose material. Throughout the history of termite control, a number of methods have been developed and employed. Chemical treatments for subterranean termite control include liquid soil treatments (repellent and non repellent), baits, and wood tr eatments. Non -chemical control methods include barriers, such as aggregates and stainless steel meshes. Also, removal of high moisture conditions and vegetation in contact with the structure helps prevent termite infestations (Bennett et al., 2003). A draw back of chemical control methods is that they can be highly toxic, non -selective, require large amounts of chemical, and may not provide complete coverage (Forschler, 1993). Non-chemical treatments can be ineffective if termites are already established in a structure (Culliney and Grace, 2000). Understanding the unique social structure of termites, as well as its regulation, could lead to more efficient and safer termite control methods. Termite Socio -Genomics Research Previous research has identified differentially expressed genes across termite castes, and has led to the identification of a number of candidate genes that might play a role in caste

PAGE 23

23 differentiation. Miura et al. (1999) used mRNA differential -display and found one gene, SOL1 that was expressed specifically in mature soldiers. Hojo et al. (2005) identified another soldier specific protein (Ntsp1) in the frontal gland of a nasute termite. The protein has homology with known insect secretory carrier proteins, which they suggest could be a carrier of JH or related defensive terpenes. Koshikawa et al. (2005), using fluorescent differential display, identified 12 upregulated genes expressed in developing soldier mandibles. These genes included cuticle proteins, nucleic acid binding proteins, ribosomal proteins, and actin binding proteins, which Koshikawa et al., inferred to be involved in caste -specific morphogenesis (2005). Wu -Scharf et al. (2003) executed a pilot study in R. flavipes using expressed sequence t ags (ESTs), or partial cDNA sequences, to identify 88 high quality ESTs. Next, Scharf et al., (2003b) used cDNA macroarrays to compare gene expression between polyphenic castes. This experiment was the first that provided a summary of more than 20 caste as sociated genes in termites. They found cellulase genes expressed in only workers and nymphs, genes relating to transcriptional and translational regulation and signal transduction in soldiers, genes associated with musculature and cytoskeletal architecture in soldiers, genes encoding vitellogenin in presoldiers, and several unidentified genes present in some castes but not others. Scharf et al., (2005a) used the same approach to identify 34 nymph-biased genes. These genes had associations with vitellogenesi s, nutrient storage, juvenile hormone sequestration, ribosomal translational and filtering mechanisms, fatty acid biosynthesis, apoptosis inhibition, and both endogenous and symbiont cellulases. Scharf et al. (2005b) used model bioassays to identify specif ic genes and hemolymph proteins that change expression during the worker -to -presoldier transition. This study also validated the usefulness of JH model assays for inducing synchronized molecular changes in worker to presoldier differentiation. Having a JH model assay system

PAGE 24

24 enables controlled experiments to be conducted, which allows the direct comparison between treatments and controls. This bioassay system is considered to have an advantage over other experimental approaches that are based on behavioral o bservation alone (e.g., Whitman and Forschler, 2007) or physiological comparisons of caste phenotypes after differentiation alone (e.g., Korb et al., 2009a). In focusing on two candidate caste regulatory genes, Zhou et al. (2006a) identified two hexamerin genes that help regulate caste differentiation by binding JH. Using RNAi, they showed that by silencing the Hex -1 and Hex -2 genes, protein expression was lowered. The hexamerin silencing apparently limited JH sequestration, resulting in greater pre -soldie r differentiation. Zhou et al. (2006b, 2007) provide additional evidence that the Hex1 and Hex 2 proteins participate in the regulation of caste -differentiation by modulating JH availability. They demonstrated that Hex -1 and Hex -2 have elevated expression s in caste phenotypes that differentiate in response to rising JH titers, and that Hex -1 and Hex -2 have distinct protein structures. Also results from Hex silencing has similar effects on gene expression as JH treatment. These findings were the first demo nstration of a status quo regulatory mechanism for worker caste retention, providing the first example of a physiological caste regulatory mechanism in a social insect. Hypotheses, Rationale and Objectives Although the work reviewed above provides evidenc e that soldiers influence nestmate caste differentiation, and that socio -genomic factors contribute to nestmate caste differentiation, what remains unknown is how these two mechanisms work together. To resolve this problem, the following research sought to investigate the relevant interactions between termite soldiers (and the chemicals they produce) and their nestmates. To understand this relationship, I tested the central hypothesis that the chemicals produced by R. flavipes soldiers influence phenotype

PAGE 25

25 a nd gene expression of workers. To reach the overall objective, the following specific aims were pursued: 1) characterize and identify the effects soldier head chemicals (SHE) have on worker caste differentiation, 2) identify genes that respond to multiple socio -environmental and semio chemical factors including SHE, and 3) further characterize three genes ( Cyp15F1, Cyp15A1, and RFest1 ) that potentially play roles in worker termite caste differentiation.

PAGE 26

26 CHAPTER 2 EFFECTS OF SOLDIER DERIVED TERPENES ON SOLDIER CASTE DIFFER ENTIATION IN THE TERMITE RETICULITERMES FLAVI PES Introduction Social insect castes are groups of phenotypically, morphologically and behaviorally distinct individuals that cooperate to perform colo ny tasks (Wilson, 1971; Miura, 2004). Caste differentiation plays an important and necessary role in creating an effective division of labor. It is imperative that colonies find ways to regulate caste differentiation within this system. Improper regulation could result in the over abundance or absence of specific castes, making colony tasks such as food acquisition, grooming, defense, and reproduction inefficient or even impossible. Polyphenisms are alternative morphological phenotypes that differentiate i n response to environmental conditions (Nijhout, 2003). Termites use polyphenism to produce different castes that perform complementary roles within the colony (Miura, 2004). Termite colonies are made up of three distinct castes that include workers/pseude rgates, soldiers, and reproductives. Only soldiers and reproductives are considered adults in lower termites, while all castes can be adults in higher termites. Termite caste differentiation can proceed along two routes; the imaginal (winged) or the apterous (wingless) route. The first developmental branch point occurs when larvae differentiate into either workers or nymphs after the second instar (Buchli, 1958; Lain and Wright, 2003). Workers can: (1) undergo status quo worker to -worker molts, (2) differe ntiate into presoldiers (immediately followed by soldier differentiation) or (3) differentiate into apterous and eyeless third -form reproductives, or ergatoid neotenics Nymphs can either; (1) regress into worker -like pseudergates, (2) differentiate into fully winged and eyed adult alates that disperse, mate, and become primary reproductives, or (3) differentiate into wingless and

PAGE 27

27 eyed non -dispersive second form reproductives, or brachypterous neotenics that serve as supplemental reproductives (Buchli, 1958; Lain and Wright, 2003). Caste polyphenism in social insects is distinct from solitary insects because multiple castes that perform non -overlapping tasks are present in colonies at the same time (Miura, 2004). Individuals in termite colonies with the same genetic background can differentiate into alternate phenotypes depending on a number of intrinsic and extrinsic factors (Lenz, 1976; Greenberg and Tobe, 1984; Koshikawa et al., 2005; Scharf et al., 2007). One intrinsic factor is juvenile hormone (JH) (Scharf et al., 2003b; Park and Raina, 2004, 2005; Mao et al., 2005). Juvenile hormone is a morphogenetic hormone produced by a neurosecretory gland (the corpus allatum) that has a broad range of developmental and physiological effects (Wigglesworth, 1935; Schal et al., 1997; Truman and Riddiford, 1999; Gilbert et al., 2000; Truman et al., 2006). For example, in insects juvenile hormone plays a role in the control of larval / nymphal development and metamorphosis, diapause, migratory behavior, wing length, seasonal development, reproduction, and caste determination (Hartfelder, 2000). Primer pheromones are chemical messengers that are passed among individuals and trigger physiological responses in recipients (Wilson and Bossert, 1963). Primer pheromones a re distinct from releaser pheromones, which elicit rapid behavioral responses in recipients (Vander Meer et al., 1998). Two examples of releaser pheromones in termites are the trail pheromone (Z,Z,E) 3,6,8 -dodecatrien 1 -ol (Matsumura, 1968) and the phagostimulatory pheromone hydroquinone (Reinhard et al., 2002). Three examples of primer pheromones from the honey bee are worker behavioral maturation inhibitory pheromone (ethyl oleate; Leoncini et al., 2004), brood pheromone (fatty acid esters; LeConte et a l., 2006), and queen mandibular pheromone (5 carboxylate and aromatic components; Grozinger et al., 2007). Although no

PAGE 28

28 primer pheromones have been identified in termites, JH has been proposed as a possible termite primer pheromone (Henderson, 1998). Previo us studies have shown that ectopic exposure of worker termites to JH III readily induces soldier caste differentiation (Howard and Haverty, 1979; Scharf et al., 2003b, 2005, 2007; Zhou et al. 2006a,b, 2007), indicating that JH can act via exogenous exposur e. Under natural conditions, high endogenous JH titers in worker termites cause differentiation into presoldiers, and then into soldiers (Park and Raina, 2004; Mao et al., 2005). Regardless of whether JH acts exogenously as a primer pheromone, or as an end ogenous hormone, or both, the role of JH in soldier development is unique and contrast s the immature status quo role of JH among insects (Henderson, 1998). It has been hypothesized that termite soldiers may play a role in regulating worker differentiati on to other caste phenotypes (Henderson, 1998). For example, JH titers in workers rise upon removal from the colony (Okot -Kotber et al., 1993; Mao et al., 2005), which can result in presoldier / soldier formation (Mao et al., 2005). However, if workers are held with soldiers, worker JH titers remain below threshold levels and presoldier formation is attenuated (Mao et al., 2005; Park and Raina, 2005). It has been theorized that soldiers can down regulate worker JH titers by acting as a JH sink (Henderson, 1998; Mao et al., 2005) or by lifting some other primer pheromones inhibition on worker differentiation (Park and Raina, 2004, 2005; Mao et al., 2005). Previously, Lefeuve and Bordereau (1984) investigated live soldiers and the effects of methylene chlo ride (dichloromethane; DCM) soldier head extracts (SHE) on caste differentiation in the higher termite Nasutitermes lujae ; they found that SHE inhibited worker to -soldier differentiation. They further suggested that soldier termites may secrete an inhibitory pheromone that contributes to worker -soldier homeostasis in termite societies. Korb et al. (2003) also

PAGE 29

29 reported that DCM SHE inhibited soldier formation in the lower termite Cryptotermes secundus. Additionally, Okot -Kotber et al. (1991) also showed that soldier formation in R flavipes was reduced by DCM SHE when coapplied in combination with synthetic JH analogs. While these studies have verified primer pheromone -like effects for SHE, no bona -fide termite primer pheromones have yet been chemically iden tified. Thus, two important outstanding questions in termite research relate to whether or not caste regulatory primer pheromones exist, and if so, what are their chemical structures and modes of action? Retic uliterme flavipes and its European synonym R. santonensis are common and economically destructive termites in the U.S. and Europe; thus, there is a need to define their chemical ecology with respect to cast e regulation. The central objective of this study was to investigate chemical constituents of R. flavipes SHE as possible primer pheromones. To meet this objective, we conducted studies to (1) investigate SHE effects on JH -dependent soldier caste differentiation, (2) identify SHE constituents, and (3) compare constituent activity with previously iden tified soldier head chemicals. Through these studies, we provide evidence supporting the idea that soldier -derived terpenes play roles as caste regulatory primer pheromones in termites. Materials and Methods Termites Retic ulitermes flavipes colonies were c ollected from various locations on the University of Florida campus. Termites were brought back to the laboratory and held for at least 2 months before use. Laboratory colonies were maintained in darkness within sealed plastic boxes, at 22 oC. A total of 9 termite colonies were tested, all of which contained male and female neotenic reproductives. Termite workers were considered workers if they did not possess any sign of wing buds or distended abdomens. Termites were identified as R. flavipes from sequence of the 16S

PAGE 30

30 mitochondrial ribosomal RNA gene, (Szalanski et al., 2003), gut fauna (Lewis and Forschler, 2004) and soldier morphology (Nutting, 1990). Dish Assays Dish assays were conducted at 27 C as described previously (Scharf et al., 2003b). Paired paper towel sandwiches (Georgia Pacific) were treated with respective control, JH III, and SHE treatments delivered in solvent (acetone). JH III (75% purity; Sigma; St. Louis, MO) was provided at 112.5 g per dish in a volume of 200 l acetone. This JH qua ntity was chosen based on its maximal efficacy and minimal mortality observed in previous concentration range studies (Scharf et al., 2003b). SHE was tested at several different quantities (see next section). After solvent evaporation, paper towel sandwich es were placed in 5 cm plastic Petri dishes and then received 150 l of reverse osmosis water. Fifteen worker termites were placed in each dish. Every five days termites were counted, presoldier formation was noted, and deionized water was added if needed. Solider Head Extracts Soldier head extract (SHE) was prepared by collecting soldiers from laboratory colonies, removing their heads, and then by homogenizing the heads (~80 150 total, depending on the experiment) in acetone with a Tenbroeck glass homogenizer. SHE was fractionated by passing it through a glass Pasteur pipette filled with approximately 250 mg of silica gel (60200 mesh) on top of a glass wool plug. The eluting solvent in fractions consisted of 10 column volumes of the extraction solvent (ac etone). The fractionated SHE was then brought to 50 ml in a volumetric flask. SHE Concentration Response and Investigation of Colony Variation SHE prepared in acetone was tested at multiple concentrations on three R. flavipes colonies (Colonies 7, 8 and 9). Seven different treatments were tested: control (300 l acetone), JH III

PAGE 31

31 (200 l acetone containing 112.5 g JH III), SHE alone (4 head equivalents), and JH III plus a range of soldier head extract equivalents (0.5, 1, 2 and 4). Each treatment was replicated six times. Gas Chromatography (GC) and Mass Spectrometry (MS) Thirty soldier and worker heads from two different colonies (colonies 5 and 7) were extracted as described above (acetone) in a volume of 2 ml and evaporated under N2 to 400 l. Samples were first analyzed by GC/MS (electron ionization, 70eV) to confirm the presence of the previously published predominant terpenoids, namely cadinene and -cadinenal (Nelson et al., 2001), and then subsequently quantified using a 6890 gas chromatograph (Agilent; Santa Clara, CA) coupled to a flame ionization detector as described in full by Schmelz et al. (2001). We also examined pine wood extracts, prepared from the same shim wood used to provision lab colonies (seasoned and kiln -baked), to specifically test the hypothesis that SHE chemicals are produced in termites de novo. Fresh pine wood sawdust (1.26 g) was extracted and analyzed as described above for head extracts (acetone). To quantify semiochemical levels found in i ndividual soldier heads, five individual soldier heads were extracted in a similar manner as above. Individual extracts were in a final volume of 400 l; an internal standard of 400 ng of nonyl acetate was added to each sample. Samples were then separated by GC. Peaks were analyzed and quantified by comparing to the nonyl acetate standard. Nuclear Magnetic Resonance (NMR) A nalysis NMR analyses were performed to accurately identify the cadinene chemicals from the soldier heads. The two main peaks of the SHE were separated using preparative GC and analyzed by NMR. Initial sample preparation of soldier head solvent extracts utilized vapor

PAGE 32

32 phase extraction at 80 C on polymeric adsorbent traps, followed by dichloromethane elution to remove less volatile contami nants (Schmelz et al., 2004). Micropreparative gas chromatography (GC) was accomplished using an Agilent (Santa Clara CA) 6890 gas chromatograph (He carrier gas; 5.7 ml min 1; cool on-column injector set to track oven) with an DB 1 column (30 m long, 530 m i.d., 0.50 m film thickness) with the temperature programmed from 35 C (2 min hold) at 10 C min1 to 260 C (hold for 5.5 min). Recovery of separated GC fractions followed from Heath and Dueben (1998) with slight modification. Specifically a glass p ress-fit splitter was used at the end of the DB 1 column, coupling a 0.5 m (150 m i.d. fused silica) capillary to the flame ionization detector (FID) and a second 0.5 m (350 m i.d. fused silica) capillary directed to the heated transfer line and chilled glass capillary for sample collection. Under these conditions, the two predominant soldier head sesquiterpenes eluted at 16.1 and 18.9 min. -cadinene were similarly chromatographed, eluted at 16.1 min and recollected for NMR. One d imensional (1 D ) and two dimensional (2 D) NMR spectra were acquired at 20 C with standard techniques using TopSpin (version 2.1) software on a Bruker Avance II600 spectrometer equipped with a 1 mm hightemperature superconducting (HTS) CryoProbe (Brey et al. 2006). Solutions of the SHE -cadinene, ~ 10 g/15 l, the authentic -cadinene, ~ 25 g/17 l and of the SHE -cadinene aldehyde, ~ 50 g/10 l, were prepared in CDCl3 (99.96 atom % D). These solutions were added via a 110 mm -needled 10 l syringe to 1 mm O.D. x 0.73 mm I.D. x 100 mm long capillary NMR tubes (Norell, Inc.). The capillaries were then attached to an appropriate Bruker MATCHTM apparatus before being lowered into the NMR magnet for analysis. Proton spectra were acquired at 600.23 MHz us ing 45 pulses, 32768 complex points over an 11 ppm spectral width (SW) corresponding to a 2.48 second

PAGE 33

33 acquisition time (AT), and a 3 second relaxation delay (RD). The 1H data was processed by zero filling the FIDs to 32768 real points before applicatio n of line broadening (LB) and Fourier transformation. An exponential LB value of 0.4 Hz was used for integrated spectra, and a negative LB value of ( ) 0.2 Hz was used for peak picking. The 1H chemical shift axis was referenced to CHCl3, assigned to 7.26 ppm (Gottlieb et al. 1997). Abbreviations in 1H spectra: s = singlet, d = doublet, t = triplet, q = quartet, m = multiplet, J = apparent coupling constants in Hertz. Two Dimensional 1H/1H COSY data sets (SW = 8 ppm, AT = 0.21 seconds, RD = 2 seconds, 2 8 transients) were acquired with Brukers cosygpqf pulse sequence as 2048 complex points in the directly detected dimension (DD) and 512 increments in the indirect dimension (ID), and they were processed with sine -function apodization into 1024 x 1024 poi nt spectra. Carbon 13 spectra were acquired at 150.93 MHz using 45 pulses, 65536 complex points over a 220 ppm SW corresponding to a 0.98 second AT, and a 3 second RD. The 13C FIDs were Fourier transformed after zero filling to 65536 real points and ap plying an exponential LB value of 2 Hz. The 13C chemical shift axis was referenced to CDCl3, assigned to 77.16 ppm (Gottlieb et al. 1997). Multiplicity-edited 2 -dimensional 1H/13C HSQC data sets (1H SW = 8 ppm, 13C SW = 170 ppm, AT = 0.14 seconds, RD = 2 seconds, 4896 transients) were acquired with Brukers hsqcedetgpsisp2.2 pulse sequence as 1348 complex points in the DD dimension and 256 increments in the ID dimension, and they were anodized with cosine squared-functions into 2048 x 512 point spectra. Previously Identified Chemicals Past research (Zalkow et al., 1981; Bagnres et al., 1990; Nelson et al., 2001; Quintana et al., 2003) and my own GC MS efforts (current chapter ) have identified a number of chemicals from termite soldier heads. Chemicals ( or close structural analogs) were tested individually in

PAGE 34

34 dish assays on a single R. flavipes colony (Colony 5). All treatments were applied at 50 g/dish, with and without JH III (300 l acetone containing 112.5 g JH III). Individual chemical treatments w ere provided at a quantity equivalent to approximately one half of the JH III dose in order to test synergistic effects on JH III induced presoldier differentiation. This amount [50 g/dish] approximates endogenous cadinene levels found in 25 soldier head equivalents, based on GC -MS analysis. Treatments were as follows: controls (300 l acetone), SHE alone (4 head -humulene (CAS: 675398-farnesene (CAS:18794848, Bedoukian, Danbury, CT), cadinene (CAS: 29350730, Vigon International, East Stroudsburg, PA), geranyl linalool (CAS: 1113 219, Acros, New Jersey, NJ), linalool (CAS: 78 70 6, Aldrich), farnesol (CAS: 460284-pinene oxide (CAS: 6931540, Acros), limonene (C AS: 5989275, Aldrich), nootkatone (CAS: 4674504, Bedoukian), nerolidol (CAS: 721244 -pinene (CAS: 80 568, Acros), and geranylgeraniol (CAS: 24034 739, Fluka, Sigma Aldrich). Control treatments included acetone, JH III alone, SHE alon e, JH III+SHE. All SHE was prepared in acetone. Each treatment was replicated three times. Statistical Analyses In all experiments the number and caste of each termite in each dish was counted every five days. The percentage of presoldiers formed out of t he total number of workers put into each assay was used in statistical analyses (Scharf et al., 200 3b, 2005; Zhou et al., 2006a,b) Data were first analyzed for normality using the Levene test. If the data were not normal, the data were transformed to rank ed averages and means separated using the TukeyKramer test (p<0.05). For bioassays with previously identified soldier chemicals, ranked averages were separated using a LSD Student t test (p<0.05).

PAGE 35

35 Results SHE Concentration Response Three colonies were exa mined in SHE dose response bioassays using SHE prepared in acetone (Fig ure 2 1). Two of the three colonies responded similarly, but one colony (colony 9) responded slightly differently, which led to a significant colony effect in the ANOVA (df=2,117, F=4.7 88, p=0.01). Nonetheless, a pooled dose -response analysis of the three colonies was conducted. Presoldier induction significantly increased when termite workers were co -exposed to SHE and JH III, as compared to treatments of JH III alone (p<0.05). Controls treated with either acetone or SHE alone resulted in no presoldier formation. Presoldiers first appeared between days 10 and 15, and reached maximum levels by day 25 in all SHE + JH III and JH III alone treatments. This analysis verifies that SHE does ind eed cause a significant increase in presoldier formation when combined with JH III however, this effect is not significantly dose -dependent in the range of 0.5 4 head equivalents (df= 6,117, F= 32.32, p<0.0001). GC -MS and NMR Analysis GC -FID analyses o f soldier head extract identified two major sets of peaks (Fig ure 2 2 ). Retention times, peak size, and GC -MS spectra of the two sets of peaks have similar profiles as Zalkow et al. (1981) and Nelson et al. -cadinenal as major who le head extract components (Figure 23 -cadinene, was identified by comparing its spectra with those in the literature, as well as by a gas -chromatographic comparison with the same sample. Additionally, comparison of the SHE -cadinene and of an -cadinene (kindly provided by Dr. Bartelt, USDA -ARS NCAUR; Peoria, IL) by GC -MS analysis (EI, 70 eV) gave the same EI mass spectra and identical GC retention times. The mass spectrum and the 1H (600 MHz) NMR spe -cadinene were cadinene by Quintana et al. (2003). My analyses further

PAGE 36

36 confirmed that the SHE -cadinene produced the same NMR spectra. That is, except for trace impurities in the natural sample, they gave identical 1 dimensional (1H) and 2 -dimensional (1H/1H COSY and 1H/13C HSQC) NMR spectra. -cadinenal), assumed to arise from allylic oxidation of -cadinene, was identified by comparison of its 1H NMR spectrum (see data below) and EI -mass spectrum to those reported by Kaiser and Lamparsky (1983). Since we observed some small differences between their 400 MHz 1H spectrum and ours at 600 MHz, we also report the details of the 1H NMR spectrum here, along with the fifteen chemical shifts for the 13 -cadinene aldehyde. NMR results are as follows; additional data and structural information can be provided upon request. 1H NMR (600 MHz, CHCl3 = 7.26 ppm (Gottlieb et al. 1997)) 9.47 (s, 1 H), 6.91 s, 1 H), 4.74 (d, J = 1.5, 1 H), 4.62 (d, J = 1.3, 1 H), 2.522.46 (m, 1 H), 2.44 (ddd, J = 2.9, 4.0, 13.0, 1 H), 2.26 (d septets, J = 3.3, 6.9, 1 H), 2.15 2.07 (multiplets, 2 H), 2.06 (broad dt, J = 4.5, 13.1, 1 H), 1.97 1.91 (t of five line patterns, 1 H), 1.901.84 (multiplets, 2 H), 1.501.41 (multiplet, 1 H), 1.42 (tt, J = 3.2, 11.6, 1 H), 1.21 (dq, J = 4.2, 12.8, 1 H), 0.99 (d, J = 6.9, 3 H), 0. 82 (d, J = 6.9, 3 H). 13C NMR (151 MHz, CDCl3 = 77.16 ppm (Gottlieb et al. 1997)) 194.76, 151.78, 151.75, 141.77, 104.65, 46.37, 46.05, 44.07, 36.05, 26.69, 26.65, 24.45, 21.87, 21.57, 15.34. cadinenal from sold iers was 1.44 0.29 and 9.42 -cadinenal was significantly higher than the amount of -cadinene (df=1,8, F=20.2864, p=0.0020). Although weakly abundant in the worker extracts, -cadinenal were subs tantially more prev alent in the soldier heads (Figure 2 2 ). Pine wood extracts prepared using an identical extraction method did not indicate any

PAGE 37

37 similarity to chemicals found in SHE (Fig ure 2 2 ), supporting that cadinene and cadinenal are produced de novo. Cadinene and Previously Described Soldier Chemicals Enhance JH -I nduced Presoldier Differentiation Twelve previously identified soldier -derived chemicals including cadinene, were tested for their ability to induce presoldier formation in dish assays. Al l of these previously described chemicals (except nootkatone and nerolidol), when tested in combination with JH III, caused significant increases in presoldier differentiation relative to JH III alone. When tested without JH III, the soldier chemicals caus ed no presoldier differentiation (df= 26,63, F= 14.4633, p<0.0001) (Fig ure 2 4 ). Similar to all previous assays, no presoldiers were observed in acetone controls, while high presoldier induction levels (~80%) were observed in SHE + JH III treatments. Treatme nts of JH III alone induced significantly lower presoldier levels (~20%), which are comparable to results of preceding experiments as presented above and Appendix A Discussion In previous research, termite soldier -produced chemicals have mostly been investigated as a taxonomic tool for species identification (Zalkow et al., 1981; Prestwich, 1983; Bagneres et al., 1990; Nelson et al., 2001; Quintana et al., 2003, Nelson et al. 2008). Such research has identified a number of chemicals in soldier secretions but little consideration has been given to roles of these chemicals in caste differentiation. The study presented here confirms the effects of R. flavipes SHE on JH induced presoldier differentiation. Results from multiple bioassays on different colonies at different times of the year indicated th at SHE synergistically increases worker to soldier morphogenesis when applied in combination with JH III. These findings support the idea that the soldier caste, in addition to playing a defensive role, also plays a part in caste regulation within termite society (Henderson, 1998).

PAGE 38

38 This study also supports previous research showing ectopic JH III treatments cause s ome workers to molt into presoldiers (and onto soldiers) (Scharf et al., 2003b, 2005, 2007; Zhou et al. 2006a,b). The JH III mediated worker -to -soldier molt is an atypical example of a JH III response when compared to other insect groups. In most insects, JH causes insects to remain as immature forms during a molt, while the absence of JH causes the insect to molt into an adult form. Thus, termites have apparently co -opted JH for a different function than other insect groups. The combination of SHE with ectopic JH III treatments synergistically enhanced presoldier development relative to JH III alone, while SHE by itself caused no presoldier induction. This suggests that SHE probably does not contain significant quantities of JH. Preliminary thin layer ch romatography separations of JH III and SHE showed no common bands (MRT unpublished) and GC MS of SHE identified no JH III supporting the absence of JH III in SHE. Therefore, in these assays, I conclude that chemicals from soldier heads modulate the termit e response to ectopically applied JH III, thereby enhancing JH III activity. It is hypothesize d that, endogenously, the synergistic effect of these SHE terpenes is manifest only in individuals with elevated JH titers. The results from this study are in co ntrast with past reports concluding that soldiers and extracts from soldiers inhibit presoldier formation (Lefeuve and Bordereau, 1984; Okot -Kotber et al., 1991; Korb et al., 2003). There are several differences between the current and past research that could at least partially explain these discrepancies. First, Lefeuve and Bordereau (1984) exposed groups of 200 workers of the higher termite Nasutitermes lujae to one of three treatments that included nothing, live soldiers, or SHE extracted in dichloromet hane (DCM ) Differences between this and the current study include extraction solvent, termite species, and group size. Korb et al. (2003) tested the effect of precocene II, an allatectomizing agent, and

PAGE 39

39 SHE extracted in DCM on whole colonies of the lower termite, Cryptotermes secundus. Differences between this study and that of Korb et al. (2003) include solvent, termite species, and treatment size. Also, Korb et al. did not test precocene in combination with natural JH or SHE. Okot -Kotber et al. (1991) te sted combinations of methoprene and SHE extracted in DCM on R. flavipes in a dish assay, similar to the experiment described here and found that the combination resulted in less presoldier formation than treatments of methoprene alone. W e found no differe nce between SHE extracted in DCM or acetone ( Appendix A ), eliminating the effect of solvent. However, we used JH III in this study while Okot -Kotber et al. (1991) used the JH analog methoprene. Other factors that may explain some of the differences between this study and preceding studies may be colony conditions at the time of testing and the time of year at which testing was performed; e.g., responses to SHE and JH may vary among termite colonies, as well as within a colony over a year according to season. An additional potential difference would be a difference in the ratio of components found in the SHE blend. While these results suggest components of Reticulitermes SHE function as primer pheromones, soldier secretions of other termite species have bona fide defensive functions. For example, Coptotermes soldiers produce latex to defend against predators (Prestwich, 1983, 1984; Abe et al., 2000). This proposed primer pheromone function for Reticulitermes head chemicals is supported by a study reported by Zalkow et al. (1981) who assayed a number of R. flavipes and R. virginicus soldier head chemicals against the native fire ant, Solenopsis geminata. Their results indicated the ants had not been sprayed with an irritant or toxicant and that the soldier he ad chemicals have non -defensive functions. No evidence was obtained in the present study to suggest that the chemicals are expelled from soldiers. One explanation for the soldiers having a large amount of putative primer

PAGE 40

40 pheromone in their heads is to se rve as a recruiting mechanism after an individual soldier is killed. For example, if a soldier is killed when defending the colony, the chemicals acquired while disposing of the body may signal nestmate workers to differentiate into soldiers. Since workers also contained small amounts of cadinene and cadinenal, another possibility is that soldiers may absorb and sequester these compounds away from workers in order to suppress worker differentiation. For example, live soldiers suppress worker JH titers and i nhibit presoldier formation (Park and Raina, 2004; Mao et al., 2005). Future research efforts will test hypotheses relating to impacts of live and dead soldiers in nestmate differentiation and terpene sequestration. Of the soldier head terpenes identified in previous research, all but two significantly enhanced JH -induced presoldier formation when combined with JH III at a ratio of 1:2 (terpene:JH). When applied at the same concentration without JH III, however, none of the terpenes induced presoldier forma tion. This suggests that Reticulitermes have the ability to utilize an array of terpenes as cues to trigger soldier caste differentiation, provided that endogenous JH titers are above critical thresholds. Future research should determine what structural fe atures of the terpenes are necessary for activity and investigate ratios of blend components The regulation of termite caste differentiation is important in maintaining social structure and function, and therefore the disruption of termite caste differ entiation / homeostasis may be able to be used as a control method. By using the termites own chemistry (i.e., soldier -derived terpenes), it may be possible to develop a specific termiticide that causes a large proportion of worker termites to molt into s oldiers. Because soldier termites cannot feed themselves, this would likely cause the termite colony to starve or at least have a severe effect on the colony. For

PAGE 41

41 example, in this study (unpublished results), mortality was greatest in replicates in which a high proportion of worker termites molted into presoldiers. In summary, the findings presented here verify a role beyond defense for the soldier caste within termite societies, as initially proposed by Henderson (1998). These results indicate that non J H terpenes from termite soldier castes can influence caste polyphenism in nestmates. The results presented here help identify part of the complex chemical communication system that termites utilize to maintain a balanced social environment.

PAGE 42

42 % Cumulative Presoldiers (Day 25)Colony 710 20 30 40 50 60 10 20 30 40 50 60 10 20 30 40 50 60 10 20 30 40 50 60 % Cumulative Presoldiers (Day 25) % Cumulative Presoldiers (Day 25) % Cumulative Presoldiers (Day 25)a a b b b b b a a ab bc bc c c a a ab bc c c c a a b c c c c Control JH III No. SH equivalents + JH III SHE (4 eq) 0.5 eq 1 eq 2 eq 4 eq Control JH III No. SH equivalents + JH III SHE (4 eq) 0.5 eq 1 eq 2 eq 4 eq Control JH III No. SH equivalents + JH III SHE (4 eq) 0.5 eq 1 eq 2 eq 4 eq Control JH III No. SH equivalents + JH III SHE (4 eq) 0.5 eq 1 eq 2 eq 4 eq Colony 8 Colony 9 Colonies 7,8,9 combined % Cumulative Presoldiers (Day 25)Colony 710 20 30 40 50 60 10 20 30 40 50 60 10 20 30 40 50 60 10 20 30 40 50 60 10 20 30 40 50 60 10 20 30 40 50 60 10 20 30 40 50 60 10 20 30 40 50 60 % Cumulative Presoldiers (Day 25) % Cumulative Presoldiers (Day 25) % Cumulative Presoldiers (Day 25)a a b b b b b a a ab bc bc c c a a ab bc c c c a a b c c c c Control JH III No. SH equivalents + JH III SHE (4 eq) 0.5 eq 1 eq 2 eq 4 eq Control JH III No. SH equivalents + JH III SHE (4 eq) 0.5 eq 1 eq 2 eq 4 eq Control JH III No. SH equivalents + JH III SHE (4 eq) 0.5 eq 1 eq 2 eq 4 eq Control JH III No. SH equivalents + JH III SHE (4 eq) 0.5 eq 1 eq 2 eq 4 eq Control JH III No. SH equivalents + JH III SHE (4 eq) 0.5 eq 1 eq 2 eq 4 eq Control JH III No. SH equivalents + JH III SHE (4 eq) 0.5 eq 1 eq 2 eq 4 eq Control JH III No. SH equivalents + JH III SHE (4 eq) 0.5 eq 1 eq 2 eq 4 eq Control JH III No. SH equivalents + JH III SHE (4 eq) 0.5 eq 1 eq 2 eq 4 eq Control JH III No. SH equivalents + JH III SHE (4 eq) 0.5 eq 1 eq 2 eq 4 eq Control JH III No. SH equivalents + JH III SHE (4 eq) 0.5 eq 1 eq 2 eq 4 eq Control JH III No. SH equivalents + JH III SHE (4 eq) 0.5 eq 1 eq 2 eq 4 eq Control JH III No. SH equivalents + JH III SHE (4 eq) 0.5 eq 1 eq 2 eq 4 eq Colony 8 Colony 9 Colonies 7,8,9 combined Figure 2 1 Soldier head extract (SHE) dose response Worker termites were exposed to different soldier head equivalents (eq) or control treatments for 25 days. SHE was prepared in acetone. Soldier head extract alone was applied at 4 head equivalents. The number of head equivalents tested in combination with JH III was 0.5, 1, 2 and 4. Each treatment was replicated six times on three different colonies (7, 8 and 9) The graphs for colonies 7, 8 and 9 show cumulative avg. std error presoldier induction through assa y day 25 for each of the separate colonies. The graph at the bottom right shows cumulative avg std error presoldier induction for the combined colony responses. Letters represent significant differences at p <0.05.

PAGE 43

43 Figure 2 2. SHE chemistry. A) Gas c hromatograms (flame ionization detection) of acetone extracts prepared from heads of 30 soldier (top) and worker (middle) R. flavipes as well as 1.26 g of seasoned pinewood (bottom). Pinewood was seasoned and identical to that used to feed termite colonie s. Chemical structures were putatively identified through NMR. B) Acetone extracts from individual soldiers were analyzed and the cadinenal estimated by comparison to internal nonyl acetate standards. Bars represent avg. +/ st d. error determined from 5 individuals. Asterisks (*) denote significant differences as p<0.05.

PAGE 44

44 Figure 2 3. Analysis of soldier head extracts by mass spectrometry. Dominant compounds identified by gas chromatography were analyzed using mass spectrometry and were -cadinenal.

PAGE 45

45 Figure 2 4. Previously described soldier -derived terpenes synergistically enhance JH -dependent presoldier differentiation. Twelve previously identified soldier chemicals (mono sesqui and di terpen es) were tested for their ability to induce presoldier differentiation alone and in combination with JH III Treatments include d ; negative controls (300 l acetone), SHE (4 soldier head equivalents), humulene, -farnesene, -pinene, limonene, n ootkatone, -pinene, and geranyl geraniol. All soldier head chemicals were tested at 50 g / dish with and without JH III (150 g). Each treatment was replicated t hree times. The graph shows cumulative avg. std error presoldier induction through assay day 25. Letters represent significant differences at p < 0.05.

PAGE 46

46 CHAPTER 3 SEMIOCHEMICAL AND SOCIO ENVIRONMENTAL EFFECT S ON CASTE DIFFERENTIATION AND GENE EXPRESSION I N RETICULITERMES FLAVI PES Introduction Phenotypic plasticity is described as a single genotype that has the ability to produce numerous different phenotypes, depending on various conditions encountered through its development (Nijhout, 1999). Phenotypic pl asticity can be divided into two major types of responses to signals: reaction norms and polyphenisms. Reaction norms are phenotypically graded responses to environmental factors. Polyphenisms occur when two or more discrete alternative phenotypes are obse rved without intermediate forms (Nijhout, 2003). Social insects have evolved to exhibit and use multiple phenotypes to accomplish different tasks within a colony. Castes are phenotypically and behaviorally discreet individuals that cooperate to perform c olony tasks (Miura, 2004). Hemimetabolous social insects, such as the termites, utilize castes to meet various different needs within the colony. Most termite colonies are made up of three distinct castes; workers, soldiers, and reproductives. All termite eggs, except when a rare genetic component might be involved (Hayashi et al., 2007), are totipotent and differentiate based on a number of intrinsic and extrinsic factors. Caste differentiation can proceed along two routes; the imaginal (winged) or the apterous (wingless). All castes are considered immature in lower termites except soldiers, alates and the three reproductive forms (Lain and Wright, 2003). The first developmental branch is the point at which larvae differentiate into either workers or nymphs. Nymphs can either 1) regress into worker -like nymph/pseudergates, 2) differentiate into fully winged and eyed adult alates that disperse or 3) differentiate into winged and eyed non -dispersive second form reproductives that serve as supplemental repr oductives within the colony. Workers can 1) undergo status quo worker -to -worker molts, 2) differentiate into a presoldier (immediately followed by a molt into a

PAGE 47

47 soldier), 3) or differentiate into an apterous eyeless third -form reproductive (Buchli, 1958; L ain and Wright, 2003). The intrinsic and extrinsic factors that impact each of the developmental switches have yet to be fully understood. Essentially, the factors that affect the developmental switches in termites appear to be numerous environmental and social signals. Some of the signals that have been identified are temperature, food quality, juvenile hormone, instar, nestmates (soldiers and reproductives), nutrition, and season (Howard and Haverty, 1981; Waller and LaFage, 1988; Horiuchi et al., 2002; Fei and Henderson, 2002; Liu et al., 2005; Park and Raina, 2004; Mao et al., 2005; Scharf et al., 2007). Phenotypic divergence from the worker -to -soldier caste has been shown to be regulated by multiple factors. For example, the application of juvenile hormone to workers causes them to molt into presoldiers (Park and Raina, 2004; Scharf et al., 2003). This alteration in the hormone titer presumably controls the developmental switch into a presoldier. Additionally, nestmates have also been shown to have an effect on soldier develo pment. For example, the presence of soldiers inhibits the formation of new soldiers, thus implying that soldier termites produce an inhibitory pheromone that causes an elevated JH response threshold in nestmates (Park and Raina, 2003, 2004, 2005; Mao et al ., 2005). This inhibition is presumed to be caused by a primer pheromone from the soldier termite (Lefeuve and Bordereau, 1984; Okot -Kotber et al., 1991; Korb et al., 2003). Alternatively, the putative primer pheromone may modulate hormone production withi n nestmates. Recently, soldier head extracts (SHE), in combination with juvenile hormone III (JHIII), have been shown to synergistically increase the number of presoldiers, compared to JHIII alone (Chapter 2). Interestingly, the SHE alone did not cause additional presoldiers to form (Chapter 2). SHE could contain components that act as a primer pheromone

PAGE 48

48 that regulates caste differentiation. Primer pheromones are chemical messengers that are passed among individuals and trigger physiological responses in re cipients (Wilson and Bossert, 1963). cadinenal). Thus, while the SHE blend is active, whether it is being actively released or absorbed has yet to be determined. Also the active component/s of the SHE blend has not been identified. Functional genomics is described as the use of a holistic or global view of the entire or a large part of the system to elucidate gene function (Tittiger, 2004). One approach to determine t he functions of semiochemicals (i.e., pheromones and hormones) and their production is to use functional genomics to identify and characterize the genes responsible for their action (Tittiger, 2004). Transcript levels generally correlate with the physical demand for the product they produce and the changes in transcript abundance can indicate which genes are most important in relation to a stimulus (Tittiger, 2004). By simultaneously observing changes in multiple transcript levels, we hope to better underst and how genes work together and the networks they form. Such an approach has been used to help elucidate the chemical ecology of the bark beetle (Ips pini ) (Seybold and Tittiger, 2003) and the honeybee ( Apis mellifera ) (Grozinger et al., 2003; Alaux et al. 2009). In bark beetles, research has shown that JHIII regulates pheromone production in male beetles through interactions in the midgut (Keeling et al., 2006). JHIII stimulates the HMG -CoA reductase gene, which plays a role in the mevalonate pathway (Till man et al., 2004). Analysis by quantitative real time PCR (qRT PCR) of multiple genes in the mevalonate pathway indicated that feeding stimulated the pathway in male bark beetles and partially in females (Keeling et al., 2004). Through the use of functiona l genomics, pheromone biosynthesis along with multiple physiological processes in the bark beetle are now better understood. The use of functional genomics in the study of termites can help us better understand

PAGE 49

49 potential primer pheromone function as well a s the effects of internal and external factors on caste differentiation. Several functional genomics experiments have been completed for termites. Miura et al. (1999) used differential display and found one gene, SOL1 was expressed specifically in mature H. sjostedti soldiers. Hojo et al. (2005) identified a soldier specific protein (Ntsp1) in the frontal gland of a nasute termite. The protein has homology with known insect secretory carrier proteins of the takeout -homologous gene family, which they sugg ested could be a carrier of JH. Wu -Scharf et al. (2003) completed a study in R. flavipes identifying expressed sequence tags (ESTs), or partial cDNA sequences, to identify 88 high quality ESTs. Next, Scharf et al. (2003) used cDNA macroarrays to compare ge ne expression between polyphenic castes. This was the first experiment that provided a summary of caste associated genes in termites. They found cellulase genes expressed in only workers and nymphs, genes relating to transcription regulation and signal tra nsduction in soldiers, genes associated with musculature and cytoskeletal architecture in soldiers, genes encoding vitellogenin in presoldiers, and several unidentified genes present in some castes but not others. Scharf et al. (2005a) used the same approa ch to identify 34 nymph-biased genes. These genes had associations with vitellogenesis, nutrient storage, juvenile hormone sequestration, ribosomal translational and filtering mechanisms, fatty acid biosynthesis, apoptosis inhibition, and both endogenous a nd symbiont cellulases. Scharf et al. (2005b) used model bioassays to identify specific genes and hemolymph proteins that change expression during the worker to presoldier transition. Specifically, four hemolymph protein coding genes, two hexamerins and tw o vitellogenins, were differentially expressed between control and JH treatments (Scharf et al., 2005a).

PAGE 50

50 Koshikawa et al. (2005) using fluorescent differential display, identified 12 upregulated genes expressed in developing H. sjostedti soldier mandibles These genes included cuticle proteins, nucleic acid binding proteins, ribosomal proteins, and actin binding proteins, which Koshikawa et al. inferred to be involved in caste -specific morphogenesis. Zhou et al. (2006a,b) determined the change in expression of 17 genes in response to separation from the colony, the addition of JHIII, and to hexamerin RNAi silencing. Results indicated that multiple genes change expression during different treatments. This led the authors to hypothesize that hexamerins play a n important role in regulating JH efficacy. Also, Zhou et al. (2006b) identified a number of new termite cytochrome P450 genes and showed that their expression patterns varied in response to JHIII and colony release treatments. Termite caste polyphenism is regulated by a multitude of semiochemical and socioenvironmental conditions. Given that most termites within a colony are highly genetically similar, caste differentiation is thought to be controlled by differential gene expression. Therefore, my hypot hesis is that different semiochemical and socio -environmental conditions will be associated with the differential expression of key target genes. The two main objectives of this study were to 1) concurrently investigate the organismal and molecular impacts of semiochemical and socio -environmental conditions on totipotent termite workers, and 2) to test -cadinenal. The treatments tested in the first objective include: juvenile hormone III (JHIII), j uvenile hormone III+ soldier head extract (JH+SHE), soldier head extract (SHE), and live soldiers (LS). In the second objective I -cadinenal. The specific goals for the first objective were to 1) determine the im pacts of JHIII, JH+SHE, SHE and live soldier conditions on caste differentiation and the expression of 49 candidate genes, and 2) identify genes that are

PAGE 51

51 significantly differentially expressed among treatments. The specific goals in the second objective were to identify the impact of the major SHE components on caste differentiation and gene expression, in order to identify the active component of the potential primer pheromone blend. The findings below reveal the impact that multiple semiochemical and soci o environmental conditions have on phenotypic plasticity and gene expression of termite workers. -cadinene and cadinene aldehyde on caste cadinene as a significant active compon -cadinenal as inhibitory. Experimental Procedures Termites R flavipes colonies were collected from different locations near Gainesville, Florida USA. Termites were held in the laboratory for at least two months before use in bioassays. Colonies were maintained in darkness within sealed plastic boxes, at 22 oC. Experiments were replicated across three termite colonies. All colonies contained male and female neotenic reproductives. Termites were considered true workers if they did not possess any s ign of wing buds or distended abdomens. Termites were identified as R. flavipes by a combination of soldier morphology (Nutting, 1990), and 16S mitochondrial ribosomal RNA gene sequencing (Szalanski et al., 2003). The partial mitochondrial 16S sequences of the four test colonies were deposited, respectively, in Genbank under accession numbers: FJ265704 (colony GB1), FJ627943 (colony K2), FJ265705 (colony A8) and GQ403073 (colony K5). Using the 16S mitochondrial sequences, colony 1 was 99% identical to mitochondrial haplotypes F22 and F1 (EU259755, EU259734), colony 2 was 98% identical to haplotype F20 (EU259753), colony 3 was 96% identical to haplotypes F34, 28, and 21 (EU259767, EU259761, EU259754) and colony 4 was 98% identical to haplotype F20 (EU259753).

PAGE 52

52 Bioassays Bioassays were conducted at 27 oC as described previously (Scharf et al., 2003b; Chapter 2). Paired paper towel sandwiches were treated with acetone (controls), JHIII, or SHE treatments delivered in acetone. JHIII (75% purity; Sigma; St. Louis, MO) was provided at a rate of 112.5 g per dish in a volume of 200 l acetone in the first objective and 56 g per dish in the second objective. These two JHIII rates were chosen based on maximal efficacy with minimal mortality observed in previous concentration range studies (Scharf et al., 2003b). An adjustment from 112.5 g to 56 g was based on a number of personal observations and a change in JHIII quality from the manufacturer (Sigma). After solvent evaporation, paper towel sandwiches were plac ed in 5 cm plastic Petri dishes and moistened with 150 l of reverse osmosis water. Fifteen worker termites were placed in each assay dish. Live solider treatments consisted of holding two live soldiers with 15 workers from the same colony. Every five days termites were counted, presoldier formation was noted, and water was added if needed. Each treatment was monitored for 25 days. Solider Head Extracts Soldier head extract was collected as described in Chapter 2. In brief, soldier head extract (SHE) was prepared by collecting soldiers from lab colonies, removing their heads, and homogenizing the heads (80 150) in acetone, using a Tenbroeck glass homogenizer. To remove particulate matter, the homogenate was fractionated by passing it through a glass Paste ur pipette filled with approximately 250 mg of silica gel (60 200 mesh) on top of a glass wool plug. The SHE was eluted with 10 column volumes of acetone. The fractionated SHE was then brought to 50 ml with acetone in a volumetric flask. SHE components use d in the second objective were separated by preparative gas -chromatography as described below, and similar to Chapter 2.

PAGE 53

53 Gas Chromatography (GC) and Mass Spectrometry (MS) Soldier heads from two different colonies (colonies 3 and 4) were extracted as desc ribed above (acetone), in a volume of 50 ml and evaporated under N2 to 400 l. Samples were first analyzed by GC / MS (electron ionization, 70eV) to confirm the presence of the previously -cadinenal (Nelson et al., 2001), and then subsequently quantified using a 6890 gas chromatograph (Agilent; Santa Clara, CA) coupled to a flame ionization detector as described in full by Schmelz et al. (2001). To quantify semiochemical levels found in individual soldier heads, five individual soldier heads were extracted in a similar manner as above. Individual extracts were in a final volume of 400 l; an internal standard of 400 ng of nonyl acetate was added to each sample. Samples were then separated by GC. Peaks were analyzed and quantified by comparing to the nonyl acetate standard. The two main peaks of the SHE were separated using preparative GC. Initial sample preparation of soldier head solvent extracts utilized vapor phase extraction at 80 C on polymeric adsorbent traps, followed by dichloromethane elution to remove less volatile contaminants (Schmelz et al., 2004). Micropreparative gas chromatography (GC) was accomplished using an Agilent (Santa Clara, CA) 6890 gas chromatograph (He carrier gas; 5.7 ml mi n 1; cool on column injector set to track oven) with an DB 1 column (30 m long, 530 m i.d., 0.50 m film thickness) with the temperature programmed from 35 C (2 min hold) at 10 C min1 to 260 C (hold for 5.5 min). Recovery of separated GC fractions fol lowed from Heath and Dueben (1998) with slight modification. Specifically, a glass press -fit splitter was used at the end of the DB 1 column, coupling a 0.5 m (150 m i.d. fused silica) capillary to the flame ionization detector (FID) and a second 0.5 m (350 m i.d. fused silica) capillary directed to the heated transfer line

PAGE 54

54 and chilled glass capillary for sample collection. Under these conditions, the two predominant soldier head sesquiterpenes eluted at 16.1 and 18.9 min. Phenotypic and Gene Expression Bioassays For the first objective a total of five different treatments were tested including acetone controls (300 l), JHIII (200 l acetone containing 112.5 g JHIII), JHIII+SHE (112.5 g JHIII in acetone + 1.5 soldier head equivalents in acetone), SHE (1.5 head equivalents extracted in acetone), and live soldiers (two per assay replicate). Each treatment was replicated five times for colony 1 and six times for both colonies 2 and 3. During the SHE bioassays additional replicates were included for gene e xpression studies. Three biological replicates were used for the colony 1 and four biological replicates were used for the colonies 2 and 3 per treatment. Samples of 15 termites were collected for destructive sampling at days 0, 1, 5, and 10. Collected sam ples were immediately frozen at 80 oC. For the second objective procedures were similar as above except the treatments used were acetone controls, JHIII (56 g), JHIII+SHE (56 g JHIII in acetone +1.5 soldier head cadinene), and JH+AL D (JHIII -cadinenal were determined by relative quantification of approximately 1.5 soldier heads described in Chapter 2. Each treatment was replicated four times for colonies 3 and 4. Addit ional replicates were included for gene expression studies. Four biological replicates were used for each colony per treatment. Samples of 15 termites were collected for destructive sampling at days 0, 1, 5, and 10. Collected samples were immediately froze n at 80 oC. RNA Isolation and cDNA Synthesis Total RNA was isolated from frozen samples using the SV total RNA Isolation System (Promega; Madison, WI) according to the manufacturers protocol. Whole body RNA extracts

PAGE 55

55 were isolated from the 15 worker term ites included in each bioassay dish. The amount of RNA was quantified by spectrophotometry and equal amounts of RNA were used in cDNA synthesis reactions. First strand cDNA was synthesized using the iScript cDNA synthesis Kit (Bio-Rad; Hercules, CA) accord ing to the manufacturers protocol. Gene Expression Quantitative real time PCR (qRT -PCR) was performed using an iCycler iQ real time PCR detection system (Bio Rad) with SYBR -green product tagging from cDNA (similar to Scharf et al., 2003a; Zhou et al., 2006). Gene specific primers are listed in Table 3 1 D uring the first objective forty nine genes were chosen based on their homology to developmental genes identified in other organisms (Scharf et al., 2003, 2005; Zhou et al., 2006, 2007), homology to JH biosynthetic and/or metabolism genes, and developmental genes from recent R. flavipes sequencing projects (Tartar et al., 2009). In the first objective there were eleven total biological replicates tested for qRT PCR (three from colony 1, and four from colonies 2 and 3). Average Ct values of three technical replicates were used for the analysis of each biological replicate. Ct values were collected at the end of each qRT -PCR run. For the second objective only genes identified to be significantly differentially expressed between the JH and JH+SHE treatments w ere tested. In the second objective there were a total of eight biological replicates tested for qRT-PCR (four form colony 3 and four from colony 4). Average Ct values of three technical replicates were used for the analysis of each biological replicate. C t values were collected at the end of each qRT -PCR run. Reference Gene Selection To select appropriate reference genes all of the Ct values across all colonies, treatments, biological reps, and technical reps for each gene were analyzed to identify genes with the least

PAGE 56

56 amount of variation in expression. Three genes with the lowest standard deviation were chosen for use as reference genes in the first objective (Table 3 2) (analysis similar to Zhou et al., 2006a, 2006b). For the second objective only one r eference gene was used ( Stero -1 ). Stero 1 was was selected based on results from the first objective that showed this gene had low variation between the treatments tested in this experiment thus, indicating that Stero -1 was a suitable control gene. Data and Statistical Analyses Relative expression of target genes was calculated by comparing the average of the three technical replications first normalized to the reference genes and then normalized to the control treatment using the 2method (Livak a nd Schmittgen, 2001). Normalized expression values (2t) from all colony replicates were analyzed using the microarray visualization software ArrayStar (DNASTAR, Inc, Madison, Wisconsin, USA). To identify potential gene networks, genes with significan t differential expression were clustered hierarchically using euclidean distance metrics and centroid linkage for each day (1, 5 and 10) using ArrayStar. To determine significantly differentially expressed genes, CT expression values for target genes were -way ANOVA, with adjusted least squares (LS) means and false discovery rate (FDR) correction was used to separate significant genes using JMP statistical software (SAS Institute, Cary, NC, US A) (Object Table -3 -3 ). Tukeys HSD tests were used for separating means by treatment for each gene. An FDR correction was not used for ANOVAs associated with Objective #2 (Table 3 4) because of the lower number of ANOVAs that were performed. Object 3 1. Table 3 3( .pdf 297 kb )

PAGE 57

57 Results Phenotypic Responses of Objective #1 Results from the phenotypic bioassays were similar to previously described work showing that the combination of JHIII + SHE significantly increases presoldier development when compared to JHIII alone (Chapter 2). As in prev ious work, no presoldiers formed in the acetone treated control, SHE, or live soldier treatments (Figure. 3 1). A two -way ANOVA and adjusted LS means were used for analysis (whole model F=24.092, df=14, P<0.0001; treatment F= 54.32, df=4, P<0.0001; colony F=24.140, df=2, P<0.0001; treatment*colony F=11.513, df=8, P<0.0001). Variation was observed between the different colonies tested, with Colony 1 showing the greatest responsiveness to JHIII (40%) and JHIII+SHE (80%). But, as seen in previous research, the overall trend was the same in that JHIII+SHE increased presoldier development compared to JHIII alone (Chapter 2). Reference Gene Selection To accurately determine relative gene expression in totipotent workers, we chose three reference genes that had st able expression across all treatments and colonies ( Stero -1 LIM and Mev -1 ). These reference genes were selected by comparing the standard deviation of the raw Ct values for all 49 genes across treatments (Table 3 2). This determination is important becau se it allows normalization of target genes (n=46) to reference genes (n=3) that have stable expression across all treatments and colonies (similar to Zhou et al., 2006a,b). Gene Expression Results of Objective #1 Changes in the expression patterns of mult iple genes across several days in response to JH, JH+SHE, SHE and live soldier treatments were determined via qRT -PCR. Two -way ANOVAs identify significantly differentially expressed genes across treatments ( Object Table -3 -3 Table

PAGE 58

58 3 5, 3 6, 3 7 ). For a large proportion of the genes tested colony effect was significant. These results are to be expected because there was also a significant colony effect in the phenotypic bioa ssay and the colonies are different mitochondrial haplotypes. Colony effect was compensated for by using adjusted LS means. To easily visualize gene expression responses, genes showing significant expression changes across treatments were organized into h eat maps separated by Day (Figure. 3 2a,b,c). Genes with similar expression profiles were clustered together. By clustering genes we were able to identify groups of genes that 1) respond similarly and 2) putatively belong to the same gene networks. Day 1 A s shown in the Day 1 heat map (Figure 3 2a), 17 out of the 46 genes tested showed differences in their expression in response to the different semiochemical and socio environmental conditions tested (Table 3 5). Day 1 receives focus here because we presum e Day 1 responsive genes to be important immediate early responders. Three main clusters of genes were identified, with subgroupings of genes in some clusters. Genes in group IIB were significantly affected by SHE and live solder treatments, with IIB2ii ge nes Carbx -1 Myosin Bactin Btube R Pro ATPase and HMG all being downregulated with live soldiers, while group IIB1, NADH and nanos were up regulated in live soldier treatments. Group IIB2i genes Hex -2 and 18s were down regulated in SHE treatments. T he P450 protein coding genes in group IIA, CYP15F1 CYP4C48, CYP6.G and CYP4C47 were down regulated with JHIII and JHIII+SHE treatments, while group I genes, CYP4C46 and CYP4U3 were up regulated with JHIII. These Day 1 results reveal a number of early re sponder genes from totipotent workers that are both up and downregulated in response to the different treatments. Perhaps most

PAGE 59

59 importantly, a number of P450 genes that may play roles in semiochemical or hormone processing were differentially expressed amo ng treatments at this early time point. Day 5 Five days into assays, 23 genes showed significant differential expression among the five treatments (Figure 3 2b, Table 3 6). A larger number of genes showed significant variation in expression at this point compared with Days 1 and 10, with the majority of the genes showing a down regulation in response to most treatments. Genes in group IIB2iib3, CYP4C44v1, broad, and APO had a slight expression increase with JH, while being down regulated with SHE and liv e soldier treatments. Group IIB2iib2 genes, CoxIII, HSP and Shp displayed an upregulation with live soldier treatment. Genes SH3 NADH and CYP15F1 in group IIB2iib1, were down regulated with JH+SHE and SHE treatments. Group IIB2iia genes, Famet -2 Carbx -1 CYP4U3 Carbx -2 and To F were all down regulated with live soldier treatments. Bic and nanos in group IIB2i, were down regulated with JHIII, JHIII+SHE and SHE. Genes that clustered into group IIB1, Hex -2 Hex -1 and CYP4C46 were up -regulated wit h JHIII and JH+SHE treatments. Finally two hemolymph protein coding genes, Vit-1 (IIA) and Vit-2 (I) were up -regulated with JHIII and JH+SHE and down regulated with SHE and live soldier treatments. Five days into assays is in the middle of the worker to -so lder differentiation process (Scharf et al., 2005a). Therefore, genes identified at this time point could be playing intermediate roles in the caste differentiation cascade. The hemolymph protein coding genes Vit-1 Vit-2 Hex -1 and Hex -2 have been linked to caste differentiation in past research in termites and honey bees (Scharf et al., 2007, Zhou et al., 2006a,b; Zhou et al., 2007, Page et al., 2006; Amdam et al., 2003; Bloch et al., 2002, Nelson et al., 2007; Antonio et al., 2008, Denison and Raymond-D elpech, 2008). Thus, their differential expression during the worker -to -presoldier differentiation process was expected, and serves as a positive control that validates this approach.

PAGE 60

60 Day 10 On the last day investigated (day 10), nineteen genes showed significant variation across treatments (Figure 3 2c, Table 3 7). The group II genes Epox -1 and Vit -2 were up regulated with JHIII and JH+SHE treatments. Genes in group IB3iib CYP15F1 Shp, and Tro -1 were down regulated with JH+SHE treatment, while Hex -1 and T o F (IB3iia) were down regulated with JHIII and JH+SHE treatments. The putative ribosomal RNA coding 18s gene was downregulated with live soldier treatment (IB3i). Group IB2ii genes CYP4U3 28s and CYP4C46 were up -regulated with JHIII but down regulated with JH+SHE treatment, while genes in group IB2i, Lprs Famet -1 and NADH were down regulated with JHIII. Genes that clustered in group IB1, Myosin APO and broad were up regulated with JH+SHE treatment. Finally group IA genes, Carbx -1 and SH3 were down regulated with JH+SHE treatment. These results from Day 10 revealed a number of late responding genes that are both up and down-regulated in response to the different treatments. Thus, these late responding genes likely are part of multiple pathways that a re involved in the later stages of the worker -to -presoldier differentiation process. Also, across all three days tested four genes, CYP15F1 CYP4C46, CYP4U3 and NADH were found to have significant differential expression on all treatment days. This suggests that these four genes could be of broad general importance in worker to -soldier caste differentiation or caste regulation / homeostasis. GC -MS Analysis and GC Separation of Soldier Head Chemicals GC -FID analyses of SHE produced similar results to those obtained in Chapter 2, that cadinenal (ALD). The approximate -cadinenal was estimated to be 0.75 and 3.38 ug per soldier. Amounts are less than reported in Chapter 2, cadinenal)

PAGE 61

61 but is probably due to seasonal or colony variation. The SHE blend was then separated using a micropreparative GC to be used in phenotypic and expression studies for Objective #2. Phenotypic Result s from Objective #2 -cadinenal (ALD) were assayed for their impacts on worker caste differentiation and gene expression. The combination of JH+SHE and JH+CAD treatments caused the greatest number of PS t o form compared with JH+ALD and control treatments (Figure 3 3c) (whole model F=8.5678, df=9, P<0.001; treatment F=6.3768, df=4, P=0.0008; colony F=35.167, df=1, P<0.0001; treatment*colony F=4.1089, df=4, p=0.009). Because the JH+CAD and the JH+SHE each ha d a similar impact on worker to -cadinene is the active component of the SHE blend. Also, JH+ALD had less of an impact, although not significant, compared to JH alone and -cadinenal is not the active component, and perhaps could be inhibitory (Figure 3 3c). Gene Expression Results from Objective #2 For Objective#2 we only tested genes that were found to be significantly differentially expressed between the JH and JH+SHE treatments from Objective #1. This was done to narrow our focus and thus, potentially identify the genes that had a similar synergistic effect between JH and SHE as seen in the phenotypic bioassays (Chapter 2). This res ulted in testing only one gene on Day 1, two on Day 5, and eleven genes on Day 10. Throughout all three days tested (1,5, and 10) only four genes were significantly differentially expressed between treatments; Btube at Day 1 and CYP15F1 NADH and Myosin a t Day 10 (Figure 3 4). Two genes Btube and Myosin had similar expression patterns between JH+SHE and JH+CAD, further supporting the idea that CAD is the active component in the SHE blend.

PAGE 62

62 Discussion Phenotypic plasticity is an important evolutionary adaptation that allows organisms to rapidly respond to changing environmental conditions. Social organisms, specifically hemimetabolous termites, utilize phenotypic plasticity to develop into different castes. Because all termite colony members share essential ly the same genetic background, they rely on differential gene expression to differentiate among the castes (Miura, 2004). The functionality of the colony is dependent upon the cooperative effort of all castes. The development of a termite along a continuous caste pathway is regulated by a number of different internal and external factors (Scharf et al., 2007). This study identifies clear phenotypic effects of SHE and its main components and describes patterns of gene expression correlated with these phen otypic effects. Changes in expression were detected in several genes having homology to other well -characterized developmental and metabolic genes when termites were subjected to different treatments. Several genes and apparent gene networks important in c aste differentiation and social interactions were also identified. Our bioassay system induces changes in phenotype, gene and protein expression, and has been used repeatedly to monitor and elucidate mechanisms of caste differentiation, specifically the wo rker -to -soldier transition (Scharf et al., 2003, 2005, 2007; Zhou at al., 2006a, 2007; Chapter 2). Here, we investigated the effects of specific semiochemical and socio -environmental cadin enal) on soldier caste differentiation and gene expression of termite workers. Although there are certainly many other semiochemical and socio -environmental conditions that could play a role in worker -to -soldier differentiation, we focused on the component s listed above.

PAGE 63

63 Phenotypic assay results were similar to past findings in that JHIII induced presoldier formation, JHIII+SHE synergistically increased presoldier development, and SHE alone had no effect on PS development (Chapter 2). The addition of live soldiers to the bioassay did not increase soldier formation. However, this experimental design did not allow for determination of any inhibitory soldier effects. This suggests that SHE, or a component of it (as discussed later), acts with JH as a primer p heromone to help regulate caste differentiation within the termite colony. As with past research, inter -colony variation was observed; a common occurrence in insect sociobiology research (Bourke and Franks, 1995; Hahn, 2006). Colony variation could be a re sult of multiple factors, such as colony age, caste composition, maternal effects, nutrition, or multiple others. In this research, we monitored phenotypic effects in concert with the expression patterns of multiple genes. This was accomplished with destru ctive sampling of some assay replicates for RNA isolation, while allowing other to proceed without disturbance. Because caste differentiation is mostly a result of differential gene expression, we hypothesized that genes responsible for caste differentiati on should be differentially expressed. The typical worker -to presoldier differentiation process takes approximately 15 days. To capture potential expression changes up to ecdysis, gene expression levels were monitored at 1, 5, and 10 days post treatment, w hich are considered early, middle and late time points, respectively. A total of forty-nine genes were investigated across three replicate colonies. Statistically significant genes that passed the FDR cutoff were clustered together based on expression patt ern (Figure 3 2a,b,c). As discussed below three main groups of genes were identified as having potential roles in caste differentiation: 1) chemical production / degradation, 2) hemolymph protein coding, and 3) developmental.

PAGE 64

64 Chemical Production / Degradat ion Genes Chemical producing / degrading proteins are responsible for the production and / or degradation of many chemicals within an organism. Cytochrome P450s, JH production / degradation, and mevalonic pathway protein coding genes are included in this g roup. Many of the genes tested in this group were differentially expressed when treated with different semiochemical and socio -environmental treatments, suggesting the production and degradation of numerous chemicals are important in the caste differentiat ion process. Cytochrome P450s are known for their role in the oxidation of endogenous and xenobiotic substrates including hormones, pheromones, insecticides, and secondary plant compounds (Andersen et al., 1997; Feyereisen, 2005). Specifically, P450s have been shown to play a role in the biosynthesis and metabolism of morphogenic hormones (JHIII, ecdysone) and terpenoids (Andersen et al., 1997). On Day 1, two groups of P450s were identified. The first group of P450s (IIA), CYP15F1 CYP4C48, CYP6.G and CYP4 C47 were down regulated with JHIII and JHIII+SHE treatments, while group I, CYP4C46 and CYP 4U3 were up regulated with JHIII and JHIII+SHE treatments. This opposite expression profile of the different P450s suggests they have different functions, likely ac ting on multiple substrates. However, it is still unknown whether their role is to degrade or produce specific chemicals, or what substrates are utilized or produced. Past research has identified P450s that play significant roles in JH biosynthesis and degradation. In the cockroach, Diploptera punctata, CYP15a1 directly epoxidizes methyl farnesoate to form JHIII (Helvig et al., 2004). In the present study, those P450s that were downregulated with JH treatment ( CYP15F1 CYP4C48 CYP6.G and CYP4C47 ) could ha ve a similar function. Insect P450s have also been shown to play a role in the degradation of JHIII, as is the case with CYP4C7 which converts JHIII to 12trans -hydroxy JHIII in Diploptera punctata

PAGE 65

65 (Sutherland et al., 1998, 2000). The group of P450s (I) ( CYP4C46 and CYP4U3 ) that were up regulated in the present study could be playing this role and / or the group of genes that were down regulated could be inactivated, potentially blocking the worker to -soldier transition. A number of the P450s tested were differentially expressed at Days 5 and 10. Cytochrome P450s CYP15F1 CYP4U3 CYP6.G and CYP4C44v1 were down -regulated with live soldier treatments on Day 5. This observation is opposite to those made at Day 1 where most P450s were up -regulated by JHIII tre atment. Perhaps this indicates that P450s act on multiple substrates, or treatments at Day 5 have downstream effects relative to those at Day 1. Finally, on Day 10, CYP15F1 was down regulated with JH+SHE, and CYP4U3 and CYP4C46 were up regulated with JH, s imilar to Day 1. Functional characterization studies must be undertaken to determine the exact role of each P450. Juvenile hormone metabolism is also potentially mediated by JH esterases and epoxide hydrolases (Roe et al., 1996). Three genes having homolo gy to JH esterases and epoxide hydrolases displayed significant expression differences between treatments. First, a potential JH esterase, Carbx -1 was down regulated with live soldier treatments at Days 1 and 5, then down regulated at Day 10 with JHIII an d JH+SHE treatments. Although the carboxylesterase 1 of R. flavipes (Accession No. GQ180944) shares homology with the JH -esterase of the wood -feeding beetle Psacothea hilaris (BAE94685) (Munyiri and Ishikawa, 2007), it is shortened and missing the JH -ester ase motif identified by Mackert et al. (2008). Because it lacks this motif, it may be degrading one of many lignin carboxylesters found in the termite diet (Geib et al., 2008; Wheeler et al., 2009) instead of metabolizing JH. Carbx -2 (Accession No. GQ18094 4), which has homology to the JH esterase of the sawfly Athalic rosae (BAD91555), was downregulated with live soldiers and SHE treatments at Day 5 only. Similarly, Carbx -2 is truncated and apparently

PAGE 66

66 missing the JH -esterase motif, suggesting it could also be degrading lignin and/or hemicellulose carboxyl esters (Wheeler et al., 2009). The next group of candidate JH metabolism enzymes is the epoxide hydrolases, which break down JH by hydrolyzing the JH epoxide. R. flavipes epoxide hydrolase has sequence ho mology to that of Aedes aegypti (XP_001651935, evalue: 7e 55). Epox -1 was significantly up regulated at Day 10 with JH and JH+SHE treatments. If Epox -1 is acting as a JH epoxide hydrolase, then the termite hydrolase could be up regulated degrade or inactivate any exogenous of endogenous remaining JH prior to apolysis or ecdysis. The production of JH and other sesquiterpenes is important to termite colony success, not only for development and caste differentiation, but also for production of defensive chemi cals and pheromones possessing a sesquiterpene backbone (Seybold and Tittiger, 2003, Belles et al., 2005). Research has shown that upand downregulation of genes in the mevalonic pathway leads to the production of JH and pheromones (Tillman et al., 2004, Keeling et al., 2004). In the present study, five mevalonic pathway genes were investigated Famet -1 Famet -2 Famet -3 Mev -1 and HMG Two genes homologous to farnesoic acid methyl transferase ( Famet -1 Famet 2 ) were differentially expressed. Famet -1 was up regulated at Day 10 with JH and SHE treatments, and Famet -2 was down -regulated with live soldiers on Day 5. Farnesoic acid methyl transferase methylates farnesoic acid, producing methyl farnesoate in the mevalonate pathway (Belles et al., 2005). RN Ai -mediated knockdown of this gene in Tribolium castaneum lead to lower JH levels subsequently causing precocious molting (Minakuchi et al., 2008). R. flavipes Famet -1 shares strongest homology to hymenoptera Melipona scitellaris FAMet (AM493719, evalue 2e 41) (Vieira et al., 2008). These results reveal that JH causes increased Famet -1 expression. If this gene was acting as a farnesoic methyl transferase, increased expression would

PAGE 67

67 raise JH titers causing a worker -to -soldier molt. These results also reveal that the presence of live soldiers down regulated the Famet -2 gene in workers. If the Famet -2 gene is acting as a farnesoic acid methyl transferase, its down regulation would lead to lower JH production and result in decreased worker to -soldier molts. Pas t research and research performed in Appendix D show that live soldier inhibit the formation of additional soldiers (Park and Raina, 2004; Mao et al., 2005). Another potential JH production gene, HMG of R. flavipes has homology to the HMG CoA reductase gene found in the German cockroach Blattella germanic a (p54960, evalue: 0.0), and the bark beetle Ips pini (AAL09351, evalue: 9e 165) (Keeling et al., 2006) and was upregulated at Day 1 with JHIII and down -regulated live soldier treatments, respectively. HMG CoA reductase is part of the bark beetle mevalonate pathway responsible for the production of JH and other sesquiterpenoids (Seybold and Tittiger, 2003; Belles et al., 2005). Overall, these results suggest that JHIII causes up regulation of the mevalonate pathway, while live soldiers are suppressive. An upregulation of the mevalonate pathway would likely result in increased downstream products, such as JH. An increase in JH, as shown here and in past research, would increase internal hormonal levels r esulting in a worker -to -soldier molt. Hemolymph Protein Coding Genes Four hemolymph protein coding genes, Hex -1 Hex -2 Vit-1 and Vit-2 were found to be significantly differentially expressed throughout my experiments. These four genes are important in c aste differentiation and regulation for a number of social insects. Much research has shown that these genes play major roles in insect sociobiology; therefore, it was not surprising they were again identified in the present study. The termite hexamerin genes have been shown to act as a socio regulatory mechanism that affects the activity of JH, possibly limiting its availability (Zhou et al., 2006a). RNAi silencing of two hexamerins resulted in an increase in presoldier

PAGE 68

68 development, suggesting hexamerins s equester JH, thereby preventing differentiation by worker termites to presoldiers and soldiers (Zhou et al., 2006a,b; Zhou et al., 2007). The extrinsic and intrinsic factors of temperature and nutrition have also been shown to affect hexamerin proteins and modulate caste differentiation (Scharf et al., 2007). Similar to past research, we observed increased Hex -2 transcripts in JHIII treated termites, supporting the notion that Hex -2 may bind excess JH, thus preventing worker -to -soldier molts (Zhou et al., 2 006b). Also, there was a slight increase in the Hex -1 transcript in the JHIII+SHE treatments, similar to the increased presoldier differentiation results in the JHIII+SHE treatment when compared to JHIII alone. This indicates that Hex -1 was more responsive to the JHIII+SHE signal than to JHIII alone, possibly serving to inhibit the transition from worker to -soldier. Vit -1 and Vit-2 two other hemolymph protein genes that were upregulated with JHIII and JHIII+SHE treatments at Day 5, while only Vit -2 was differentially expressed at Day 10. Throughout the experiment, both Vit-1 and Vit-2 genes displayed a high amount of variability among treatments and replicates. One explanation for this observation is the inclusion of both sexes of worker termites in the assay. In most insects, vitellogenin ( Vg ) serves as a female yolk precursor protein in oocyte development. However, Vg has also been shown to play a role in social insect caste regulation. For example, Vg in honeybee workers, which are female, has been sh own to interact with JH. Both higher JH levels and lower Vg levels increased the transition from nursing to foraging behavior by worker bees (Page et al., 2006; Amdam et al., 2003; Bloch et al., 2002), while a reduction of JH delayed the onset of foraging (Schulz et al., 2002). Honeybee workers with RNAi -suppressed Vg levels performed foraging behaviors earlier than untreated workers (Nelson et al., 2007; Antonio et al., 2008). Nutrition has also been shown to affect Vg and JH, regulating transition from nursing to foraging (Schulz et al., 1998; Toth et al.,

PAGE 69

69 2005; Toth and Robinson, 2005). Finally, Vg has been shown to affect queen honeybee longevity by interacting with insulin signaling cascades (Corona et al., 2007). Together, these factors suggest that th e Vg protein in honeybees has been co-opted for an additional role as a regulator of caste polyethism (Denison and RaymondDelpech, 2008). These results suggest that the same may be true for termite polyphenism. The Vg transcripts Vit-1 and Vit -2 were up -regulated in termites treated with JHIII and JHIII+SHE, and down regulated with SHE and live soldier treatments. The addition of JHIII causes workers to develop into soldiers, molting from an immature worker to an adult soldier form. Potentially, Vg acts as a signal to modulate behavior and physiological caste differentiation. Developmental Genes The dramatic morphological change that occurs as worker termites become soldiers requires significant rearrangement of the termite body plan (Miura, 2004). The soldier termites large structural mandibles and their associated muscles represent a large change from the relative small head of a worker termite (Miura and Matsumoto, 2000; Koshikawa et al., 2003; Ishikawa et al., 2008). Thus, it is likely that multiple genes must be needed to reorganize the termite body plan (Koshikawa et al., 2005). Six developmental genes were significantly differentially expressed throughout these experiments. Two main groups of developmental genes were identified, the cytoskeletal / structural and the body-plan genes. The cytoskeletal gene, Myosin was down regulated in live soldier treatment at Day 1. Myosin proteins are actin based motor proteins that convert chemical energy from ATP into mechanical force (Harrington and Rodgers, 1984). The R. flavipes Myosin gene has highest homology to a Drosop hila Myosin gene (AAA28687, evalue: 8e 32). Down-regulation at Day 1 suggests that live soldiers inhibit the formation of new soldiers. On Day 10, expression of the muscle related Myosin gene was upregulated in the JH+SHE treatment. Previously, this

PAGE 70

70 treat ment caused the greatest presoldier formation, suggesting that Myosin is used in the worker to -soldier molt. The cytoskeletal/ structural protein coding gene, -tubulin ube was also significantly differentially expressed at Day 1. R. flavipes tubulin has homology to that of many other insects which are thought to provide cytoskeletal structure (Dettman et al., 2001) and was previously found to have significant increased expression in R. flavipes soldiers (Scharf et al., 2003). -tubulins are also hormone -dependent and perhaps play a role in the production of ecdysteroids in Manduca sexta (Rybczynski and Gilbert 1995, 1998). and -tubulin genes were identified in Bombyx mori EST libraries linked to imaginal wing disk metamorphosis and 20hyd roxyecdysone (Kawasaki et al., 2003, 2004). The authors suggested that the expression change was due to the large restructuring needed in adult wing formation. R. flavipes tube shares homology with -tubulin (NP_001036964, evalue: 2e 35). The soldier termite has numerous muscles driving its enlarged mandibles in comparison to those of the worker caste; perhaps influence by live soldiers down-regulates these structural genes as a soldier inhibitory mechanism. Or, R. flavipes tube could be participa ting in ecdysteroid hormone production similar to M. sexta as it shares homology with tubulin (017449, evalue: 4e 36). Three developmental/ body plan genes were also differentially expressed. First, broad (BTB/POZ), homologous to the broad ( br ) transcription factor of the hemimetabolous insect Oncopeltus fasciatus (ABA02191, evalue: 2e 33) and holometabolous T. castaneum (XP_973299, evalue 2e 43), was up-regulated at Day 5 with JH and JH+SHE treatments and at Day 10 with JH+SHE treatment. Erezylimaz et al. (2006) successfully silenced the br gene in O. fasciatus resulting in an additional immature molt. They suggested that br is required for morphogenesis, and that its expression is regulated by JH. RNAi silencing of br in T. castaneum

PAGE 71

71 had simil ar results (Parthasarathy et al., 2008). If br is acting in the same manner in termites, up regulation of the gene by JH+SHE would enable the worker to -soldier transition. This mechanism is in agreement with phenotypic bioassay showing a greater number of worker -to soldier molts in the JH+SHE treatment. In Drosophila, two transcription factors, bicaudal and nanos are important in embryonic pattern formation. In R. flavipes the bicaudal and nanos homologs, Bic and nanos were up regulated with live soldier treatments; nanos at Day 1 and bic and nanos at Day 5. Bicaudal has been shown to regulate expression of the posterior determinant gene, nanos (Bull, 1966; Markesich et al., 2000). The similar expression patterns shown here suggest these genes cooperate and perhaps play similar roles in body plan regulation. Defining Chemical Ecology Through Gene Expression Transcriptional profiling clearly ca n lead to a better understanding of chemical ecology (Tittiger, 2004). By using gene expression patterns to identify active components of a pheromone blend, one can eliminate, or narrow down the amount of bioassays needed to identify an active component. H ere, I correlated the response of worker gene expression profiles and worker to -cadinenal). -cadin enal reduced PS formation, suggesting it might be inhibitory. However, the expression profiles of 14 target genes did not give a clear view to which component was the active one. Only two genes Btube at Day 1 and Myosin at day 10 shared similar expression patterns when comparing JH+SHE and cadinene is the active component. JH+ALD transcription profiles did not share any significant matches with JH+SHE profiles. Possibilities why there were not as may genes with similarit ies among the treatments could be because of a small sample size of genes and associated statistical power. A larger sample size or a whole transcriptome

PAGE 72

72 would certainly give a clearer picture. Another possibility could be that the two major components of the SHE blend that we tested may not be the active components, or the phenotypic effects observed may result from a specific ratio of the two components (Roelofs and Jurenka, 1996). Additional research using genome arrays or whole transcriptome comparisons would provide a larger number of genes to sample, and likely clearer results. Conclusions The research presented here demonstrates for the first time, the effects semiochemicals, influence of other castes, and internal hormones have on phenotype and gene expression of totipotent R. flavipes workers (Figure 3 5). Factor such as JHIII, JH+SHE, and JH+CAD all increased worker to presoldier differentiation, while live soldiers and JH -ALD inhibited presoldier formation. SHE by itself did not have any observabl e phenotypic effects (Figure 3 5a). Results suggest the influence of nestmates, specifically the soldier caste, helps to regulate caste -cadinene could be the active component of the SHE blend. Semiochemical and socio -environmental factors modulated gene expression patterns for a number of genes. Significantly responsive gene networks identified here include chemical production/ degradation, hemolymph protein coding, and developmental genes (Figure 3 3b). The JHIII and live soldier treatments had a significant influence on a number of genes homologous to those responsible for JH biosynthesis / degradation and development. However, the responsive genes had an opposite reaction to JHIII and live soldier treatments. Past research using a larger group format demonstrated the presence of live soldiers inhibited additional soldier formation (Mao et al., 2005; Appendix D). This suggests that live soldiers act as part of a negative feedback loo p, inhibiting new soldier formation by regulating the expression of genes important for caste differentiation (Figure 3 5b) (Henderson, 1998; Mao et al., 2005; Park and Raina, 2005).

PAGE 73

73 Still unknown is the biological role that potential SHE primer p heromones play within the termite colony. Extracts from the soldier head, when combined with JHIII, caused an increase in presoldier development. However, SHE caused differing gene expression patterns when compared to live soldier treatments. This finding reveals that SHE terpenes act differently than live soldiers in the termite colony, thus, these findings suggest two hypotheses: 1) either soldiers are sponging chemicals (or some other still unidentified element) from the colony, inhibiting nestmate wor ker -to -soldier molts (Henderson, 1998), or 2) soldiers are producing SHE terpenes, which are used to trigger new soldier replacements when current soldiers expire (Chapter 2). -cadinen e produced cadinenal caused a reduction in the number of PS cadinenal, then they could be able to both promote PS formation and inhibit PS formation depending on the need of the colony. This could explain past research that showed that SHE was inhibitory to PS formation (Lefeuve and Bordereau, 1984; Okot -Kotber et al., 1991; Korb et al., 2003). Further research using RNAi to silence key responsive genes, whole genome expression profiles, and GC quantification of soldier head chemicals in response to proximate and socio environmental conditions is needed to resolve the roles of soldiers and soldier -derived terpenes in termite caste regulation.

PAGE 74

74 Table 3 1. Gene list and primers Gene Abbreviation Accession No. Forward Primer (5' to 3') Reverse Primer (5' to 3') 1 bicaudal (Rfb-NAC) bic AY258589 GAGGCAAGTACGGATTGGAG CTCTTCATGGTAACAACCAG 2 nanos (RF PDL) nanos BQ788190 CCACTGACTAAATGTATGGG TTCAAGCCTCAACACTCTGT 3 broad (Rf BTB POZ) broad AY258590 CTGGACCAGCATCTACATCTTC GATGGTGTTCTGTCGTGGAG 4 Cop-9 Signalsome Subunit 5 Cop9 DN792518 CTCGATCAGGAGGCACACTC TTGCTGCCTCAATGTATGCT 5 LIM (legs incomplete & malformed) LIM CB518301 GTGCTTCAAGTGTGGCATGT GTCCATGCTGAGACAACCAG 6 18S rRNA-like (Senescence Protein) 18S AY572860 TATCGATCCTTTTGGCTTGG TCGCAATGATAGGAAGAGCC 7 28S RRNA-like (Integral Membr. Prot.) (transporter) 28s CK906357 GCGAATGATTAGAGGCCTTG ACAGCGCCAGTTCTGCTTAC 8 SH3 Domain Kinase SH3 CB518513 CGTGTTGCCAATGAGTTGAG ACAATCCTATTCGGCCATCC 9 GTPase Activating Protein Gtpase BQ788178 TTCCAACAGCACAAGAGCAC TAACTGGTTGCGACAGGCAC 10 Malonyl Co-A Decarboxylase MalcoA AY572861 GCTACCGGCGACTCTTAATC GAGGACACGCTGATTCCTTC 11 Apoptosis Inhibitor APO CK906364 CGTACATGTGTGAGCAGGTG ATCACCATCAGGTGGCAGAG 12 ATP-ase ATP BQ788171 TCAGGAAGTCTTGGATTCGG TACGAACTCTGGTGCGTCTG 13 Larval Cuticle Protein LCP DN792534 CGTCGACACCGACTACGAC GGTCAGCGGTGTACTCGAC 14 Troponin I (Rf1 form) wup Tro-1 CB518302 CGACCTAGAATACGAAGTGG TTCTTCTCCTTGTCCTCCTCC 15 Troponin I (Rf2 form) wap Tro-2 CB518303 GAAGAGTTGAAGAAGGAGCAGG TTGTTCACCAGGCTATTCAGG 16 Hexamerin-1 Hex-1 AY572858 GATCCATTCCACAAGCACG ACATTCTCCACCGTCACTCC 17 Hexamerin-2 Hex-2 AY572859 ACGGAAGACGTTGGACTCAG GAGGACCTGCTGGATCTTGT 18 Vitellogenin-1 Vit-1 BQ788169 CCTACATGCGTTGTTGATGG TGACGACTATGCACTCCAGC 19 Vitellogenin-2 Vit-2 CB518311 AGCGGTTATGCACCTCTCTG ACCTGCAACTGTTGTTGTGC 20 BActin Bactin DQ206832 AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT 21 NADHdh NADH BQ788175 GCTGGGGGTGTTATTCATTCCTA GGCATACCACAAAGAGCAAAA 22 HS p70 HSP BQ788164 AGAACCAAGTGGCCATGAAC CCAATGCTTCATGTCTGC 23 COX III CoxIII DQ001073 GATCAACCTTCTTCATAGCC GCTGCTGCTTCAAATCCAA 24 R-Protein Ribonucleoprotein SMD3 R-Pro CK906360 CTGTGCTATCGAGTGAAGGC TTCATATTGTCCTCCGCCTC 25 Intronic Ribosomal intronic protein Intro CK906359 ATATTGCGCGCCACCGTAAG TCTCTGATCTGCGTTGCTTG 26 CYP4U3 Cyp4U3 DQ279461 ACGTCTGGCATTTGTTTCAC ATCCGTGTAGGTGGCATCA 27 CYP4C43v1 CYP4C43v1 DQ279463 AGGAGAAGGCGTACCAGGAG TCATTCAAAGTTCTTCCAACACC 28 CYP4C4v1 CYP4C4v1 DQ279465 GAAGTGCCTTGAGAGGGTCA TGGGAACTGGACAGGGTTC 29 CYP4C45v1 CYP4C45v1 DQ279467 CTTCAAACATCTCCTGGACCA TCTCCTTAATTACTCGCTCCAAA 30 CYP4C46 CYP4C46 DQ279469 TGAAGTACCTTGAGAGGGTCATT TTGAATTGGGTCCCGATAG 31 CYP4C47 CYP4C47 DQ279470 GCATTTCATGGGCTATGTACTTG GAGCTTCCTTGATAACCTGCTC 32 CYP4C48 CYP4C48 DQ279471 TGACCACTCTGTGACCATGAA TGGGTACTGTCATTATCACTCCA 33 Deviate To-F BQ788174 AGGCGAGTTGGTGACCATAG GTAGAAGGCAGGCCAGTACG 34 Cyp15F1 Cyp15F1 FJ792773 /FL638893, FL636088, FL636262, FL636256, FL640637, FL640773, FL635527 CGGCCTCAACATTCACAGAA CTTCCCACAACTGCATCCAA 35 B-Tubulin Btube CB518304 CAGATCGGTGCTAAGTTCTGG TATGGCACGCGGTACATATT 36 Myosin Myosin CB518305 CAAGGAGTTGAGCTTCCA TCTTCCAGTTCCTGCTGTGC 37 SHpPIP kinase Shp CK906365 AATTCTGCTGCCTTCTCTGG ACCTTGCTTGGTCAACCATC 38 Farnesoic methyl transferase 1 Famet-1 FL638251, FL637991 CCACTTCTGCATAACCACAGAG CAGGGCACATAAGAGGCATT 39 Cyp6.G Cyp6.G FL637360 GTCCCAATGTCTCTCGGAATAG GTCCATTGTCATACCAGCAGAG 40 Carboxyl Esterase-1 Carbx-1 FL636973, FL640151, FL638979 GGCACCGATAAAGGCATAGA GGTCCGTTCCTGCGTTAATA 41 Mevalonate kinase-1 Mev-1 FL639092 CTGAGGTCACGGTTCCTATACA TGAACCACTGAATGCTCACC 42 Farnesoic methyl transferase 2 Famet-2 FL639748, FL638947 ACTGCACATTGAGGTTCGTG GCCACTCTATCAAGAAGCGACT 43 Steroid binding protein 1 Stero-1 FL639110, FL636382, FL635522 TTGGACTGTGGACCTTAAGAGG CCCTTAGCAACGCAGACAAT 44 Epoxide hydrolase-1 Epox-1 FL640608, FL636393, FL635113 ATACAGACGTTCACAGCGACAG CACTCCCTCAATTGGCAGAT 45 cJun transcription factor-1 cJun-1 FL638224 GGGTCCATGACATGCTCAATAC GGGCTGGCAACAAAGTTCTA 46 Carboxyl Esterase-2 Carbx-2 FL638686 GCCAGAATTCAAGCTGCTGT TGTCCTTGTCTTGCTGTGTCTC 47 Farnesoic methyl transferase-3 Famet-3 FL636743 TGGAGGACACGACAAAGATG TCACTTGCAGTCTGCCACAT 48 Lipophorin receptor Lprs FL635452,FL636727, FL636380, FL637727, FL636288 ACCAGTACCAGCCACAGAGAAT TACCACTTTGAGCGATGCAC 49 HMG-CoA-Reductase HMG FL638074, FL637763, FL638896, FL640394, FL638646 CTCCTGTTGGATGGGTGTCT GTTCTGAGGTTCCTGCATCC

PAGE 75

75 Table 3 2. Meta analysis of all genes over all treatments and days Gene N Max [CT] Min [CT] Average SD 1 Stero1* 495 24.18 19.00 20.47 0.70 2 Lim* 494 20.89 15.96 17.55 0.79 3 Broad 495 28.88 21.74 23.65 0.80 4 Mev-1* 495 27.01 20.78 22.75 0.80 5 JHest2 494 29.25 21.10 22.99 0.86 6 Intro 495 25.29 18.71 21.09 0.87 7 Lprs 495 25.99 19.89 22.55 0.91 8 ATP 495 26.41 17.64 19.99 0.92 9 Tro-1 492 22.80 17.86 20.06 0.92 10 Famet-3 495 35.14 20.57 24.41 0.92 11 Btube 495 24.64 16.09 19.23 0.93 12 Myosin 494 21.61 15.18 18.22 0.94 13 28s 495 13.89 8.66 10.76 0.94 14 Tro-2 490 23.46 17.40 19.46 0.96 15 CYP4C43v1 494 28.16 21.90 24.67 0.96 16 GTP 495 29.78 22.14 25.76 0.96 17 Famet2 495 26.74 19.99 21.71 0.97 18 Cop9 495 27.67 20.68 22.68 0.98 19 cJun-1 493 35.82 20.86 23.38 1.00 20 CoxIII 492 19.25 14.14 16.71 1.01 21 R-Pro 494 26.49 20.07 22.88 1.01 22 Cyp15F1 494 26.69 18.76 21.26 1.03 23 HSP 628 26.47 17.81 19.98 1.05 24 Famet-1 495 36.69 18.90 21.12 1.06 25 CYP4C44v1 495 30.79 23.79 26.17 1.09 26 CYP4c45v1 495 32.21 22.21 25.04 1.09 27 TO-F 495 24.51 17.63 20.25 1.12 28 18s 494 15.06 8.71 9.77 1.12 29 APO 495 32.59 22.45 24.97 1.14 30 CYP4C47 494 30.55 22.51 25.03 1.15 31 CYP4C48 495 30.70 21.96 24.30 1.23 32 MalcoA 489 16.08 8.10 11.50 1.23 33 Hex-2 495 20.81 13.69 16.90 1.28 34 HMG 312 23.32 31.66 25.77 1.29 35 Cyp6.1 495 32.58 23.68 25.92 1.32 36 CYP4C46 457 43.60 36.62 40.00 1.37 37 Hex-1 495 26.24 16.13 19.28 1.38 38 Bactin 648 25.75 16.76 20.88 1.42 39 Jhest-1 495 33.40 21.76 24.10 1.59 40 Nanos 494 32.06 22.57 28.56 1.61 41 NADH 626 30.96 22.08 26.07 1.65 42 Shp 494 41.80 30.49 35.57 1.71 43 Cyp4U3 495 32.38 21.62 27.72 1.79 44 Sh3 493 36.73 22.37 26.96 2.59 45 Epox1 494 34.47 17.06 25.41 2.64 46 Bic 495 37.03 19.89 23.65 3.05 47 Vit-1 494 43.10 21.79 30.51 3.36 48 Vit-2 494 43.37 21.42 33.62 3.97 49 LCP 495 37.59 14.08 23.56 4.14

PAGE 76

76 Table 3 4. Objective #2 ANOVA table Gene Day Gene Day Gene Day Btube Day 1 Source DF F ratio p value 28s Day 5 Source DF F ratio p value NADH Day 5 Source DF F ratio p value Whole model 9 8.800 <0.0001 Whole model 9 18.370 <0.0001 Whole model 9 20.700 <0.0001 Colony 1 42.835 <0.0001 Colony 1 155.770 <0.0001 Colony 1 165.900 <0.0001 Treatment 4 6.570 0.0006 Treatment 4 0.920 0.4625 Treatment 4 2.500 0.0631 Colony*Treatment 4 2.500 0.0631 Colony*Treatment 4 1.461 0.2386 Colony*Treatment 4 2.590 0.0563 Error 30 Error 30 Error 30 Total 39 Total 39 Total 39 Gene Day Gene Day Gene Day Cyp15F1 Day 10 Source DF F ratio p value Shp Day 10 Source DF F ratio p value Tro-1 Day 10 Source DF F ratio p value Whole model 9 6.242 <0.0001 Whole model 9 32.494 <0.0001 Whole model 9 10.169 <0.0001 Colony 1 41.210 <0.0001 Colony 1 272.495 <0.0001 Colony 1 85.311 <0.0001 Treatment 4 2.837 0.0416 Treatment 4 2.162 0.0975 Treatment 4 0.313 0.8672 Colony*Treatment 4 9051.000 0.4735 Colony*Treatment 4 2.825 0.0422 Colony*Treatment 4 1.240 0.3151 Error 30 Error 30 Error 30 Total 39 Total 39 Total 39 Gene Day Gene Day Gene Day Cyp4U3 Day 10 Source DF F ratio p value Cyp4-5 Day 10 Source DF F ratio p value NADH Day 10 Source DF F ratio p value Whole model 9 42.577 <0.0001 Whole model 9 5.442 0.0002 Whole model 9 39.359 <0.0001 Colony 1 374.081 <0.0001 Colony 1 36.186 <0.0001 Colony 1 327.174 <0.0001 Treatment 4 1.339 0.2783 Treatment 4 2.160 0.0977 Treatment 4 4.396 0.0065 Colony*Treatment 4 0.938 0.4556 Colony*Treatment 4 1.037 0.4044 Colony*Treatment 4 2.367 0.0751 Error 30 Error 30 Error 30 Total 39 Total 39 Total 39 Gene Day Gene Day Gene Day Myosin Day 10 Source DF F ratio p value 28s Day 10 Source DF F ratio p value APO Day 10 Source DF F ratio p value Whole model 9 7.429 <0.0001 Whole model 9 58.650 <0.0001 Whole model 9 7.301 <0.0001 Colony 1 45.969 <0.0001 Colony 1 524.746 <0.0001 Colony 1 54.564 <0.0001 Treatment 4 5.141 0.0028 Treatment 4 0.447 0.7738 Treatment 4 2.144 0.0998 Colony*Treatment 4 0.081 0.9875 Colony*Treatment 4 1.322 0.3299 Colony*Treatment 4 0.642 0.6368 Error 30 Error 30 Error 30 Total 39 Total 39 Total 39 Gene Day Gene Day broad Day 10 Source DF F ratio p value SH3 Day 10 Source DF F ratio p value Whole model 9 11.018 <0.0001 Whole model 9 0.808 0.6123 Colony 1 87.012 <0.0001 Colony 1 0.557 0.4614 Treatment 4 1.902 0.1360 Treatment 4 1.623 0.1942 Colony*Treatment 4 1.497 0.3589 Colony*Treatment 4 0.057 0.9937 Error 30 Error 30 Total 39 Total 39

PAGE 77

77 Table 3 5 Objective #1 Day 1 relative expression Day 1 Gene Description Control JH JH+SHE SHE LS Whole model Colony Treatment interaction q-value 9 Carbx-1 1 1.275 1.004 1.008 0.573 <0.0001 0.1220 <0.0001 0.000 1 0.0011 14 Cyp15F1 1 0.459 0.430 1.097 1.033 <0.0001 <0.0001 <0.0001 0.735 2 0.0022 19 CYP4C46 1 2.369 3.985 1.024 1.208 <0.0001 <0.0001 <0.0001 0.355 3 0.0033 20 CYP4C47 1 0.323 0.364 1.226 1.600 <0.0001 0.0178 <0.0001 0.174 4 0.0043 21 CYP4C48 1 0.436 0.577 1.213 1.050 <0.0001 0.0017 <0.0001 0.163 5 0.0054 22 Cyp6.G 1 0.518 0.588 1.375 0.905 <0.0001 0.0003 <0.0001 0.301 6 0.0065 36 Myosin 1 1.062 0.809 1.029 0.680 <0.0001 <0.0001 <0.0001 0.004 7 0.0076 37 NADH 1 1.293 1.125 1.091 1.863 <0.0001 <0.0001 <0.0001 <0.0001 8 0.0087 5 Bactin 1 1.050 0.886 0.806 0.641 <0.0001 <0.0001 0.0003 0.000 9 0.0098 29 Hex-2 1 1.726 1.335 0.686 0.927 0.0076 0.0606 0.0020 0.244 10 0.0109 39 R-Pro 1 1.417 1.304 1.091 0.914 <0.0001 <0.0001 0.0046 0.611 11 0.0120 8 Btube 1 1.277 0.847 0.901 0.994 0.0024 0.0019 0.0055 0.194 12 0.0130 15 Cyp4U3 1 4.112 4.454 0.966 1.303 <0.0001 <0.0001 0.0065 0.005 13 0.0141 1 18s 1 1.304 1.415 0.737 1.098 <0.0001 <0.0001 0.0097 0.012 14 0.0152 38 nanos 1 0.992 0.853 1.178 2.332 0.0002 0.0003 0.0124 0.005 15 0.0163 30 HMG 1 1.403 1.347 1.019 0.599 0.0035 0.0008 0.0134 0.174 16 0.0174 4 ATP 1 1.340 1.265 1.077 0.887 <0.0001 <0.0001 0.0159 0.391 17 0.0185 41 Shp 1 1.128 1.382 1.217 2.129 <0.0001 <0.0001 0.0201 0.034 18 0.0196 45 Vit-1 1 0.779 0.622 1.074 5.288 0.0072 0.3387 0.0201 0.007 19 0.0207 7 broad 1 1.009 0.937 0.900 0.761 0.0002 <0.0001 0.0221 0.106 20 0.0217 46 Vit-2 1 1.099 0.916 1.815 3.901 0.0180 0.2060 0.0253 0.027 21 0.0228 16 CYP4C43v1 1 0.731 0.849 1.146 1.013 <0.0001 <0.0001 0.0352 0.055 22 0.0239 43 Tro-1 1 1.402 1.343 1.456 1.350 <0.0001 <0.0001 0.0418 0.060 23 0.0250 33 LCP 1 3.540 0.412 0.228 1.008 0.1302 0.0498 0.0586 0.740 24 0.0261 25 Famet-2 1 1.170 1.016 1.074 0.895 0.0037 0.0010 0.0734 0.073 25 0.0272 42 To-F 1 1.132 0.701 0.897 0.795 0.0004 <0.0001 0.0829 0.038 26 0.0283 23 Epox-1 1 1.937 0.643 1.063 1.474 0.1246 0.4697 0.0851 0.216 27 0.0293 10 Carbx-2 1 0.892 0.843 0.857 1.015 0.0017 <0.0001 0.1049 0.120 28 0.0304 13 CoxIII 1 1.197 1.293 0.940 1.216 <0.0001 <0.0001 0.1266 0.075 29 0.0315 18 CYP4C45v1 1 0.656 0.834 1.130 1.084 0.0004 <0.0001 0.1413 0.383 30 0.0326 12 Cop9 1 1.249 1.042 1.148 1.420 <0.0001 <0.0001 0.1458 0.389 31 0.0337 11 cJun-1 1 0.982 0.967 0.799 1.021 <0.0001 <0.0001 0.1546 0.279 32 0.0348 31 HSP 1 1.175 1.293 0.997 0.934 <0.0001 <0.0001 0.1584 0.799 33 0.0359 3 APO 1 1.088 0.866 1.153 0.930 0.0153 0.0017 0.1609 0.164 34 0.0370 44 Tro-2 1 1.144 1.043 1.273 1.156 <0.0001 <0.0001 0.1637 0.164 35 0.0380 40 SH3 1 0.738 0.911 0.782 0.839 <0.0001 <0.0001 0.1963 0.002 36 0.0391 17 CYP4C44v1 1 0.881 1.035 1.279 0.969 0.0049 <0.0001 0.2522 0.421 37 0.0402 27 Gtpase 1 0.970 0.956 1.028 1.344 0.0069 0.0002 0.2761 0.147 38 0.0413 34 Lprs 1 1.299 1.206 1.022 1.132 0.0349 0.0004 0.3106 0.790 39 0.0424 35 MalcoA 1 1.366 1.816 1.331 1.436 0.0650 0.4334 0.3155 0.027 40 0.0435 24 Famet-1 1 0.978 0.915 0.868 1.044 0.0006 <0.0001 0.3542 0.899 41 0.0446 32 Intro 1 1.293 1.293 1.221 1.203 <0.0001 <0.0001 0.4097 0.650 42 0.0457 28 Hex-1 1 1.010 0.805 0.774 0.917 <0.0001 <0.0001 0.4943 0.097 43 0.0467 6 Bic 1 1.589 1.215 1.378 1.626 <0.0001 <0.0001 0.5019 0.899 44 0.0478 26 Famet-3 1 1.050 1.219 0.884 1.034 0.5042 0.0577 0.5034 0.798 45 0.0489 2 28s 1 1.168 1.114 0.916 1.193 <0.0001 <0.0001 0.5102 0.023 46 0.0500 Relative Expression ANOVA Results

PAGE 78

78 Table 3 6. Objective #1 Day 5 relative expression Day 5 Gene Description Control JH JH+SHE SHE LS Whole model Colony Treatment interaction q-value 2 28s 1 2.115 1.006 1.013 1.383 <0.0001 <0.0001 <0.0001 <0.0001 1 0.0011 25 Famet-2 1 1.070 1.096 1.082 0.648 <0.0001 0.0021 <0.0001 <0.0001 2 0.0022 28 Hex-1 1 2.079 2.466 0.741 0.863 <0.0001 0.0004 <0.0001 0.697 3 0.0033 29 Hex-2 1 2.614 3.361 0.748 0.890 <0.0001 0.0004 <0.0001 0.036 4 0.0043 46 Vit-2 1 26.483 126.862 0.452 1.336 <0.0001 0.0049 <0.0001 0.354 5 0.0054 7 broad 1 1.155 1.445 0.950 1.071 <0.0001 0.2624 0.0001 0.000 6 0.0065 22 Cyp6.G 1 0.940 0.706 0.898 0.548 <0.0001 <0.0001 0.0001 <0.0001 7 0.0076 6 Bic 1 0.564 0.955 0.508 1.289 <0.0001 <0.0001 0.0005 0.000 8 0.0087 17 CYP4C44v1 1 1.795 1.439 0.846 0.853 <0.0001 <0.0001 0.0005 0.243 9 0.0098 45 Vit-1 1 2.088 6.702 0.216 0.487 0.0005 0.0007 0.0014 0.239 10 0.0109 38 nanos 1 0.830 0.630 0.569 1.787 <0.0001 <0.0001 0.0020 0.011 11 0.0120 40 SH3 1 0.776 0.656 0.966 1.292 <0.0001 <0.0001 0.0028 0.003 12 0.0130 13 CoxIII 1 1.080 1.021 1.241 1.313 <0.0001 <0.0001 0.0037 0.000 13 0.0141 10 Carbx-2 1 1.162 1.105 0.942 0.744 0.0016 0.0328 0.0042 0.008 14 0.0152 37 NADH 1 1.394 0.671 0.854 1.138 <0.0001 <0.0001 0.0060 0.001 15 0.0163 3 APO 1 1.194 1.148 0.670 0.923 0.0093 0.0137 0.0067 0.188 16 0.0174 41 Shp 1 1.447 1.261 1.463 1.358 <0.0001 <0.0001 0.0067 0.002 17 0.0185 9 Carbx-1 1 0.709 1.061 0.688 0.612 0.0080 0.0087 0.0089 0.250 18 0.0196 31 HSP 1 1.255 1.214 1.148 1.453 <0.0001 <0.0001 0.0129 0.002 19 0.0207 14 Cyp15F1 1 1.100 0.754 0.767 1.036 <0.0001 <0.0001 0.0133 0.002 20 0.0217 19 CYP4C46 1 1.734 2.397 1.650 1.167 0.0031 0.0006 0.0134 0.409 21 0.0228 42 To-F 1 0.841 0.985 1.436 0.856 0.0085 0.0008 0.0156 0.722 22 0.0239 15 Cyp4U3 1 1.003 1.037 0.763 0.603 <0.0001 <0.0001 0.0214 0.254 23 0.0250 39 R-Pro 1 1.010 1.375 0.904 1.239 <0.0001 <0.0001 0.0262 0.012 24 0.0261 5 Bactin 1 0.796 0.813 1.115 0.869 <0.0001 <0.0001 0.0282 0.428 25 0.0272 27 Gtpase 1 1.143 1.138 0.767 1.198 <0.0001 <0.0001 0.0287 0.032 26 0.0283 8 Btube 1 1.339 1.295 0.930 1.418 0.0015 0.0007 0.0290 0.039 27 0.0293 20 CYP4c47 1 1.717 1.238 1.109 0.920 0.1407 0.3122 0.0303 0.342 28 0.0304 32 Intro 1 1.393 1.125 0.932 1.137 <0.0001 <0.0001 0.0315 0.439 29 0.0315 16 CYP4C43v1 1 1.066 0.959 1.001 1.396 <0.0001 <0.0001 0.0335 0.000 30 0.0326 18 CYP4c45v1 1 1.220 1.332 1.137 0.775 <0.0001 <0.0001 0.0539 0.139 31 0.0337 34 Lprs 1 0.975 0.890 0.907 1.350 0.0164 0.9784 0.0567 0.006 32 0.0348 24 Famet-1 1 1.174 1.205 1.146 1.176 <0.0001 <0.0001 0.0602 0.015 33 0.0359 21 CYP4c48 1 0.865 0.582 1.101 0.899 0.0620 0.0037 0.0616 0.917 34 0.0370 26 Famet-3 1 1.211 1.030 0.963 1.238 0.0005 0.0008 0.0630 0.003 35 0.0380 30 HMG 1 1.163 1.188 1.221 0.974 0.0258 0.0028 0.0957 0.315 36 0.0391 43 Tro-1 1 1.026 0.890 1.202 1.295 0.0016 <0.0001 0.1102 0.642 37 0.0402 44 Tro-2 1 1.095 0.793 0.765 0.940 0.0044 <0.0001 0.1205 0.821 38 0.0413 23 Epox-1 1 0.777 0.610 2.739 1.726 0.3676 0.5118 0.1530 0.562 39 0.0424 12 Cop9 1 0.864 0.988 0.813 1.167 0.0225 0.1035 0.1837 0.016 40 0.0435 36 Myosin 1 0.954 0.912 1.037 0.905 <0.0001 <0.0001 0.2202 0.069 41 0.0446 35 MalcoA 1 1.183 1.552 1.751 0.930 0.0008 0.7037 0.2431 0.000 42 0.0457 33 LCP 1 1.002 3.655 7.032 1.412 0.0490 0.5181 0.3202 0.029 43 0.0467 4 ATP 1 1.110 1.175 0.964 1.133 <0.0001 <0.0001 0.4134 0.005 44 0.0478 1 18s 1 0.961 1.075 1.013 1.119 0.0859 0.0043 0.7108 0.026 45 0.0489 11 cJun-1 1 0.644 1.216 1.161 1.169 0.1557 0.0153 0.7824 0.349 46 0.0500 Relative Expression ANOVA Results

PAGE 79

79 Table 3 7 Objective #1 Day 10 relative expression Day 10 Gene Description Control JH JH+SHE SHE Whole model Colony Treatment interaction q-value 2 28s 1 2.055 0.898 1.059 <0.0001 <0.0001 <0.0001 <0.0001 1 0.0011 15 Cyp4U3 1 2.200 0.621 1.603 <0.0001 <0.0001 <0.0001 0.089 2 0.0022 36 Myosin 1 1.028 1.890 1.107 <0.0001 <0.0001 <0.0001 0.006 3 0.0033 46 Vit-2 1 7.331 28.136 0.869 <0.0001 0.0013 <0.0001 0.007 4 0.0043 14 Cyp15F1 1 0.892 0.525 0.892 <0.0001 <0.0001 0.0003 <0.0001 5 0.0054 23 Epox-1 1 2.604 8.965 0.859 0.0143 0.4477 0.0008 0.239 6 0.0065 34 Lprs 1 1.376 1.341 1.380 0.0003 0.0118 0.0020 0.002 7 0.0076 41 Shp 1 0.982 0.582 1.161 <0.0001 <0.0001 0.0020 0.160 8 0.0087 9 Carbx-1 1 0.425 0.328 1.010 0.0025 0.0070 0.0021 0.082 9 0.0098 24 Famet-1 1 1.337 1.165 1.346 <0.0001 <0.0001 0.0022 0.002 10 0.0109 7 broad 1 1.082 1.525 1.216 0.0066 0.0547 0.0029 0.126 11 0.0120 28 Hex-1 1 0.650 0.583 1.409 0.0053 0.0131 0.0035 0.155 12 0.0130 37 NADH 1 1.835 1.136 1.504 <0.0001 <0.0001 0.0041 0.002 13 0.0141 40 SH3 1 1.021 0.260 0.889 0.0018 0.0012 0.0084 0.065 14 0.0152 1 18s 1 0.766 0.726 0.622 <0.0001 <0.0001 0.0086 0.000 15 0.0163 3 APO 1 0.919 1.644 1.009 0.0066 0.0138 0.0094 0.074 16 0.0174 19 CYP4C46 1 1.589 0.794 1.033 <0.0001 <0.0001 0.0114 0.000 17 0.0185 42 To-F 1 0.764 0.841 1.365 0.0032 0.0006 0.0153 0.320 18 0.0196 43 Tro-1 1 1.099 0.765 0.857 <0.0001 <0.0001 0.0160 0.006 19 0.0207 39 R-Pro 1 1.399 1.194 1.393 <0.0001 <0.0001 0.0238 0.022 20 0.0217 5 Bactin 1 1.116 1.681 1.287 <0.0001 <0.0001 0.0262 0.256 21 0.0228 22 Cyp6.G 1 0.706 0.702 0.841 <0.0001 <0.0001 0.0361 0.002 22 0.0239 16 CYP4C43v1 1 1.221 0.982 1.103 <0.0001 <0.0001 0.0374 0.000 23 0.0250 29 Hex-2 1 1.102 1.585 1.327 0.0023 0.0155 0.0396 0.008 24 0.0261 20 CYP4C47 1 1.356 0.835 0.939 0.0108 0.0221 0.0419 0.060 25 0.0272 11 cJun-1 1 1.330 1.399 1.269 <0.0001 <0.0001 0.0518 0.749 26 0.0283 32 Intro 1 1.364 1.310 1.083 <0.0001 <0.0001 0.0559 0.006 27 0.0293 33 LCP 1 4.384 28.946 4.600 0.1465 0.0911 0.0623 0.615 28 0.0304 8 Btube 1 1.111 1.555 1.102 0.0051 0.0066 0.0648 0.025 29 0.0315 25 Famet-2 1 0.949 1.093 1.234 0.0162 0.0033 0.0725 0.269 30 0.0326 10 Carbx-2 1 1.234 0.991 1.149 <0.0001 <0.0001 0.0852 0.017 31 0.0337 17 CYP4C44v1 1 0.879 0.765 0.964 <0.0001 <0.0001 0.1239 0.086 32 0.0348 44 Tro-2 1 1.327 1.059 0.978 0.0054 0.0211 0.1257 0.013 33 0.0359 45 Vit-1 1 3.670 4.766 1.169 0.0095 0.0476 0.1277 0.021 34 0.0370 27 Gtpase 1 1.368 1.259 1.385 <0.0001 <0.0001 0.1338 0.291 35 0.0380 13 CoxIII 1 1.173 0.928 1.043 <0.0001 <0.0001 0.1614 0.036 36 0.0391 38 nanos 1 1.377 0.766 1.347 0.0007 <0.0001 0.1752 0.165 37 0.0402 4 ATP 1 0.843 1.251 1.029 0.0851 0.0070 0.2348 0.514 38 0.0413 18 CYP4C45v1 1 1.786 1.472 1.332 <0.0001 <0.0001 0.2730 0.195 39 0.0424 30 HMG 1 1.307 1.332 1.489 0.5523 0.1275 0.2969 0.946 40 0.0435 12 Cop9 1 1.044 1.092 1.177 0.0034 <0.0001 0.4195 0.325 41 0.0446 31 HSP 1 1.019 1.071 1.231 0.0182 0.0019 0.4423 0.119 42 0.0457 35 MalcoA 1 1.256 0.960 1.576 0.4381 0.0702 0.4430 0.804 43 0.0467 6 Bic 1 1.016 1.154 1.075 <0.0001 <0.0001 0.8464 0.089 44 0.0478 26 Famet-3 1 0.977 0.903 0.989 0.5240 0.0520 0.8722 0.800 45 0.0489 21 CYP4C48 1 1.069 1.091 1.029 <0.0001 <0.0001 0.9434 0.009 46 0.0500 Relative Expression ANOVA Results

PAGE 80

80 Figure 3 1. Impact of semiochemical and socio -environmental treatments on soldier caste differentiation Results shown represent cumulative presoldier formation through Day 25 of assays that were conducted under five different treatments: control, JHIII, JHIII+SHE, SHE, and LS (live soldiers) for three different colonies (1,2,3). The three colonies were combined and an adjusted LS means are sh own. Bars with the same letter are not significantly different p < 0.05.

PAGE 81

81 Figure 3 2. Expression changes for significant genes in termite workers in response to semiochemical and socio -environmental treatments after 1, 5, and 10 days. Results shown represent the relative expression values of significant differentially expressed genes under five different treatments: control, JHIII, JHI II+SHE, SHE, and live soldiers at three different days; ( A ) Day 1 (2b ) Day 5 and (2c ) Day 10. Blue box es represent genes that are down regulated while red boxes represent genes that are up regulated. Boxes with the same letter are not significantly different (FDR). Caladograms at the left group genes by similar expression pattern. A

PAGE 82

82 Figure 3 2 Conti nued. B

PAGE 83

83 Figure 3 2 Continued. C

PAGE 84

84 Figure 3 3. Impact of SHE blend and SHE components on soldier caste differentiation. Results shown represent cumulative presoldier formation through Day 25 of assays that were conducted under five different -cadinenal (ALD), for two different colonies (3 (A) and 4 (B)). (C) The two colonies were combined and an adjusted LS means are shown. Bars with the same letter are not significantly different p < 0.05.

PAGE 85

85 Figure 3 4. Expression changes for genes in termite workers in response to SHE blend and SHE components after 1, 5, and 10 days. Results shown represent the relative expression values of significant differentially expressed genes u nder five different treatments: -cadinenal (ALD). Blue boxes represent genes that are down -regulated while red boxes represent genes that are up regulated. Boxes with the same letter are not s ignificantly different.

PAGE 86

86 Figure 3 5. Diagrams summarizing the influence of socio-environmental and semiochemical factors on caste differentiation. A) Semiochemical and socio -environmental factors tested and their effects on worker to -soldier differentiation. JHIII and JH+SHE caused an increase in soldier formation, while SHE had no effect on presoldier/soldier formation. Past research (Mao et al. 2005; Park and Raina, 2004; Appendix D ) indicates that soldiers inhibit worker differentiation. S -cadinene -cadinenal +JH resulted in a reduction in soldier formation. B) Diagram representing how socio -environmental and semiochemicals factors might modulate the expression patterns of m ultiple genes and caste differentiation. Networks including the following gene categories showed significant changes among treatments: chemical production/degradation, hemolymph protein coding, and developmental genes. Dotted lines represent the possible feedback loop when colony worker termites molt into soldiers, the increase in the soldier number consequently inhibits the formation of additional soldiers.

PAGE 87

87 CHAPTER 4 FUNCTIONAL ANALYSES OF R. FLAVIPES CYTOC HROME P450 AND ESTER ASE GENES LINKED TO JUVE NILE HORMONE BIOSYNTHESIS AND DEGRADATION Introduction In animals, the control of the production and degradation of hormones is essential for proper development (Nijhout, 1994). One of the major morphogenic hormones in insects is the terpene, juvenile hormone (JH). Juvenile hormone has been shown to play diverse roles in insect biology including modulation of larval development, metamorphosis, diapause, migratory behavior, wing length, seasonal development, and eusocial caste determination (Hartfelder, 2000). JH is produced in insects through the mevalonate pathway. The mevalonate pathway begins with acetyl -CoA and ends with JH as the end product. One of the final steps in the pathway, the epoxidation of methyl farnesoate to JH III, is carried out by cytochr ome P450 enzymes (Bells et al., 2005; Helvig et al., 2004). The P450s are a diverse family of oxidative enzymes found in almost all living organisms (Feyereisen, 2005). P450s are general mixed function oxidases that catalyze the transfer of oxygen to su bstrates, while in the process reducing oxygen to water. Cytochrome P450s are known for their diverse roles in the oxidation of endogenous and xenobiotic substrates including hormones, pheromones, insecticides, and secondary plant compounds (Andersen et al ., 1997; Feyereisen, 2005). Specifically, P450s have been shown to play a role in the biosynthesis and metabolism of morphogenic hormones (JHIII, ecdysone) and other terpenoids (Andersen et al., 1997, Helvig et al. 2004; Rewitz et al. 2006). Helvig et al. (2004) reported that the cytochrome P450, Cyp15A1 of the cockroach, Diploptera punctata is responsible for the last epoxidation step in JH biosynthesis. In the termite, Zhou et al. (2006b) identified a number of family 4 cytochrome P450 genes and showed th at their expression patterns varied in response to JHIII and colony release (removal from colony)

PAGE 88

88 treatments, suggesting that they might play a role in caste differentiation. However, no physiological roles of termite P450s are yet defined. The degradati on of JH within immature and adult insects is also an integral part of their development. For example, the removal of circulating JH from the insect hemolymph is necessary for an immature insect to molt into an adult (Nijhout, 1994). The degradation of JH has been shown to be controlled in part by JH esterases (Roe et al., 1996). Juvenile hormone esterases are usually synthesized in the fat body and secreted into the hemolymph, where they metabolize JH through hydrolysis of the ester linkage, converting it to JH acid (Goodman and Granger, 2005). Mackert et al. (2008) functionally identified a juvenile hormone esterase like gene ( amjhe -like ) in the honey bee ( A. mellifera ). Comparison of published information on developmental JH titers and expression analysis of the gene indicates that amjhe -like transcript levels are positively correlated with JH titers (Mackert et al., 2008). RNAi mediated silencing of the amjhe -like gene resulted in an increase in JH levels. The authors concluded that the amjhe like gene wa s a JH esterase responsible for the metabolism of JH within the honey bee (Mackert et al., 2008). In social insects JH plays an important role in caste differentiation (Hartfelder, 2000; Scharf et al., 2007; Macket et al., 2008). Castes are phenotypic ally and behaviorally discreet individuals that cooperate to perform colony tasks (Miura, 2004). Termite colonies are composed of three main castes: workers, soldiers, and reproductives. Because all colony individuals share the same genetic background, ter mites castes develop in response to a combination of intrinsic and extrinsic factors (Koshikawa, 2005; Scharf et al., 2007; Zhou et al., 2007), except where a rare genetic component might be involved (Hayashi et al., 2007; Goodisman and Crozier, 2003 ).

PAGE 89

89 In termites, juvenile hormone has been proposed to act as a possible primer pheromone (Henderson, 1998). Primer pheromones are chemical messengers that are passed among individuals and trigger physiological responses in recipients (Wilson and Bossert, 1963). Previous studies have shown that ectopic exposure of worker termites to JH III readily induces soldier caste differentiation (Howard and Haverty, 1979; Scharf et al., 2003b, 2005a, 2007; Zhou et al., 2006a,b, 2007), indicating that JH can act via exogenou s exposure. Under natural conditions, high endogenous JH titers in worker termites cause differentiation into presoldiers, and then into soldiers (Park and Raina, 2004; Mao et al., 2005). Work in Chapter 2 identified two potential primer pheromones, locate d in the soldier termite head, which apparently work synergistically with JH to increase worker to presoldier differentiation. Soldier head extract (SHE) in R eticulitermes flavipes cadinenal. Further s -cadinene is the active cadinenal might actually be inhibitory towards soldier development (Chapter 3). The central objective of this study was to begin to understand the roles of two cytochrome P450 genes ( Cyp15F1, Cyp15A1) and a putative JH esterase ( R fE st1 ) in termite caste differentiation and/ or caste regulation. As discussed above, the rationale behind this work is that these genes may play roles in JH biosynthesis / degradation, and subseq uently, termite caste differentiation and thus, they may serve as good pesticidal targets. To meet this objective, studies were conducted to 1) obtain the full length gene sequence of each of the three genes, 2) determine the baseline tissue distribution o f expression for each of the three genes, 3) investigate gene expression changes in response to JH and JH+ soldier head extract (SHE), and 4) use RNAi to identify possible gene functions in caste differentiation or regulation.

PAGE 90

90 Materials and Methods Termit es R. flavipes colonies were collected from locations near Gainesville, Florida USA. Termites were identified as R flavipes by a combination of soldier morphology (Nutting, 1990), and 16S mitochondrial ribosomal RNA gene sequencing (Szalanski et al., 2003). Termites were brought to the laboratory and held for at least two months before use in bioassays. Colonies were maintained in darkness within sealed plastic boxes at 22 oC. Termite workers were considered workers if they did not possess any sign of wing buds or distended abdomens. Solider Head Extract Soldier head extract was collected as described in Chapter 2. In brief, soldier head extract (SHE) was prepared by collec ting soldiers from the colony, removing their heads, and homogenizing the heads (80 150) in acetone, using a Tenbroeck glass homogenizer. To remove particulate matter, the homogenate was fractionated by passing it through a glass Pasteur pipette filled wit h approximately 250 mg of silica gel (60 200 mesh) on top of a glass wool plug. Gene Sequence Identification and Analyses Two cytochrome P450s and one esterase were chosen from a set of ESTs previously sequenced from an R. flavipes normalized gut library (Tartar et al., 2009). Each gene was assembled from multiple ESTs to form contigs. To obtain additional sequence length and verify sequences, select library clones were picked and re -sequenced. Translated amino acid sequences were a ligned using MegalignTM in the Laser gene software package (Madison, WI). Hydropathy plots were made and signal peptides identified using ProteanTM in Laser gene. Virtual translations were made using standard genetic code with ExPASy translation tool.

PAGE 91

91 Gen e Tissue Distribution and JH and JH+SHE Response Bioassays were conducted at 27 oC as described previously (Scharf et al., 2003b; Chapter 2). Paired paper towel sandwiches (Georgia Pacific) were treated with acetone (controls), JHIII, or JH+SHE treatments delivered in acetone. JHIII (75% purity; Sigma; St. Louis, MO) was provided at a rate of 56 g per dish in a volume of 50 l acetone and SHE was provided at 1.5 soldier head equivalents in acetone. After solvent evaporation, sandwiches were placed in 5 cm plastic Petri dishes and moistened with 60 l of reverse osmosis water. Fifteen worker termites were placed in each assay dish. Each treatment was replicated three times. The three treated groups of fifteen worker termites were dissected into head, gut and carcass. Dissections were placed into PBS and immediately frozen at 80 C. The experiment was repeated on two different colonies. RNA Isolation and cDNA Synthesis Total RNA was isolated from frozen samples using the SV total RNA Isolation System (Pro mega; Madison, WI) according to the manufacturers protocol. Whole body RNA extracts were isolated from 15 termites from each bioassay dish. The amount of RNA was quantified by spectrophotometry and equal amounts of RNA were used for cDNA synthesis. First strand cDNA was synthesized using the iScript cDNA synthesis Kit (Bio Rad; Hercules, CA) according to the manufacturers protocol. Gene Expression Quantitative real time PCR (qRT -PCR) was performed using an iCycler iQ real time PCR detection system (Bio Rad) with SYBR -green product tagging from cDNA (similar to Scharf et al., 2003a; Zhou et al., 2006). Four genes were tested, one control ( Stero -1 ) and three target ( Cyp15F1, Cyp15A1, RfEst1 ), gene specific primers are the same as used in the previous chapte r.

PAGE 92

92 Data and Statistical Analyses For Day 0 tissue localization, relative expression of target genes was calculated by comparing the average of three technical replications first normalized to the reference gene (Stero -1 ) and then normalized to the body region that had the lowest expression or control treatment using the 2method (Livak and Schmittgen, 2001). To determine significantly differentially expressed genes for the body region response to JH and JH+SHE CT expression values for target genes were normalized to the CT values from -way ANOVA, with Tukeys HSD correction for multiple comparisons was used to separate significant genes using JMP statistical software (SAS Institute, Cary, NC, USA) (Table 4 1). Esterase Native PAGE and Colorimetric Esterase Assays In the first experiment, 15 termites per treatment were held on paper towel, glass microfiber filters (Whatman, Cat. No. 1823 042), or on paper towel treated with JH (56ug) After five days termites were dissected to collect hemolymph, gut, and carcass fractions. Hemolymph from fifteen individuals was isolated into 30 uL of 0.1 M potassium phosphate, pH 7.6 buffer. Dissected guts from 15 individuals were isolated in to 400 ul of potassium phosphate, and carcasses into 1000 ul of potassium phosphate. In the second set of experiments, 15 termites per treatment were added and held for a time course of 0 5 days. The two treatments were control and siRNA injected. Control individuals were injected with 41.4 nl of RNase free H20. siRNA treated individuals were injected with 41.4 nl of Rfest1 siRNA at a concentration of 15 pg/nl (621 pg/insect). To make the Rfest1 siRNA, dsRNA was first synthesized using a commercially available ki t (Silencer Ambion, Austin, TX) and eluted with H20. dsRNA was then quantified using a spectrophotometer. For production of siRNA, dsRNA was digested into ~25 -mer fragments

PAGE 93

93 using RNAse III included with the Ambion kit. Rfest1 dsRNA primers with T7 ends wer e F TAATACGACTCACTATAGGGTGGTTTCAAAAGCCATGACA and R TAATACGACTCACTATAGGGACATACACCTGGGAAGCGAC. At each time point, sets of individuals were dissected into hemolymph, gut, and carcass as above and immediately frozen at 80 C. Esterase Native PAGE Methods f ollowed an established protocol with slight modification (Scharf et al., 1998). Volumes of supernatant containing 5 g of total protein were diluted 1:1 with Native PAGE sample buffer (Bio Rad) and loaded onto native PAGE gels (7.5% resolving gels and 4% s tacking gels). Electrophoresis was conducted in Tris Glycine running buffer for 1 hr at 4 C. After running, gels were incubated in 100 ml sodium phosphate buffer (0.1 M, pH 7.5) naphthyl propionate (Sigma; St. Louis, MO) substra te in acetone (1 mM final conc.) for 15 min. To visualize bands, 20 mg of Fast Blue BB (Sigma) in 1 ml water (0.02% final conc.) was added. The Fast Blue BB solution was filtered through glass wool just before use to remove insoluble particles. Gels were f ixed, destained and stored in 10% acetic acid before photographing. Colorimetric Esterase Assays Methods followed an established protocol (Scharf et al., 1998) with adaptation to a phosphate buffer room temperature for 10 min. Reactions were stopped with 50 l of 0.3% Fast Blue BB dissolved in 3.5 % SDS in water. The assay plates were incubated at 30 C for 15 min before being read at 600 nm with a microplate reader. Formation of the naphthol product was

PAGE 94

94 -naphthol standard curves (serial dilutions starting at 5m), stained with the Fast Blue SDS stop solution as above. Trea tments were separated using a Student t test (p<0.05). Results Gene Sequencing Over 5,000 ESTs were previously sequenced from a normalized R. flavipes gut cDNA library (Tartar et al., 2009). Here we focused on three genes identified by Tartar et al. (2009) that encoded predicted proteins with significant homology to known proteins involved in JH biosynthesis and degradation from other insects; two cytochrome P450s, Cyp15F1 and Cyp15A1, and one JH like esterase, RfEst1 Each cDNA sequence was compiled fro m multiple ESTs to build continuous contigs. Library clones were also selected and re -sequenced to add additional length and verify sequence. Corresponding Genbank accession numbers for each gene Cyp15F1, Cyp15A1, and RfEst1 are FJ792773, FJ792774, and GQ180944, respectively. Nucleotide sequences and amino acid translations, are provided in Figure 4 1. RfEst1 was previously described in Wheeler et al. (2009). Alignments Cyp15F1 and Cyp15A1 amino acid sequences were aligned and compared with seven homologous cytochrome P450s (Figure 4 1a,b). The alignment revealed a significant proportion of conserved amino acid residues, including five signature P450 motifs (Table 4 1). Cyp15F1 contains three out of the five signature P450 motifs, but was missing the WxxR an d GxE/DTT/S motifs. Each of these motifs is present, but with slight amino acid variation (Table 4 1). Cyp15F1 also contains the N terminus PGPP hinge necessary for proper heme incorporation in the mature protein (Figure 4 1a). Cyp15A1 contains four of f ive signature P450 motifs, while missing the ExLR motif (Figure 4 1, Table 4 1). The ExLR motif is present but contains a substitution of Q for L.

PAGE 95

95 Interestingly, Cyp15A1 lacks the N -terminal PGPP hinge and a signal peptide. Re -sequencing of the 5 end of t he cDNA was performed multiple times to ensure the missing PGPP hinge and signal peptide were not due to sequencing errors. Except for its missing signal peptide, Cyp15A1 is a virtual ortholog of the Diploptera punctata Cyp15A1, which is involved in methyl farnesoate epoxidation (evalue 0.0) (Helvig et al., 2004). A preliminary phylogenetic tree shows the relationship between Cyp15F1, Cyp15A1, and the seven homologs, with Cyp15A1 closely matching D. punctata Cyp15A RfEest1 motifs and alignments were previ ously described by Wheeler et al. (2009). Briefly, Rfest1 contains a signal peptide, 30 N glycosylation sites, a conserved JH esterase catalytic triad (GxSAG,E/D, and GxxHxD), and two substrate recognition motifs (RF, DQ) (Figure 4 2a). RfEst1 shares homol ogy with other insect JH esterases including isoforms from: P sacothea hilaris (BAE94685), T ribolium castaneum (XP_967137), A. mellifera (AAU81605), and A thalia rosae (BAD91555) (Wheeler et al., 2009) (Figure 4 2b). A preliminary phylogenetic tree shows the relationship between RfEst1 and the four homologs, with RfEst1 being most similar to the A. rosae JH esterase. Tissue Localization Baseline tissue expression levels in colony workers for all three genes were determined through qRT -PCR (Table 4 2). The Cyp15F1 transcript was expressed most highly in the carcass followed by the head and then the gut. The Cyp15A1 transcript was significantly more highly expressed in the head than the carcass or gut. Finally, under baseline conditions, RfEst1 was significantly more highly expressed in the carcass than in the head or gut. These results indicate where each gene is predominantly expressed in workers under colony conditions: Cyp15F1 and RfEst1 in the carcass, and Cyp15A1 in the head.

PAGE 96

96 Localized Expression Response to JH and JH+SHE Tissue expression profiles 24 hours after JH and JH+SHE treatment were measured by qRT -PCR (Figure 4 3). One day after treatment, Cyp15F1 expression was lower with JH and JH+SHE treatment in all body regions; but was only significantly decreased in the gut and carcass (Figure 4 3a). Cyp15A1 expression was reduced with JH and JH+SHE treatment only in the head region (Figure 4 3b). Finally, R fEst1 expression was significantly increased in the gut with JH treatment (Figure 4 3c). These results suggest that Cyp15A1 and Rfest1 play physiologically significant roles in head and gut tissue, respectively. Functional Characterization of RfEst1 Este rase activity was investigated through a combination of Native PAGE with naphthyl propionate staining, colorimetric microplate assays, and injection of RfEst1 siRNA. First, esterase activity was compared between control, starved, and JH treated termites af ter five days of JH exposure in dish assays, in the hemolymph, gut, and carcass (Figure 4 4a). An increase in esterase staining was evident in the carcass fraction with JH treatment, while a slight increase in intensity was observed in the hemolymph and gut fractions. Re analysis of untreated versus JH treated termites verified a significant increase in esterase activity in the carcass (Figure 4 4b). Next, a five day time course evaluation of esterase activity after siRNA injection was performed. Protein k nockdown of a single esterase band was observed in the gut and carcass only at five days after injection of RfEst1 siRNA (Figure 4 5a). Gel imaging on gut esterases indicated a noticeable reduction with siRNA treatment 1 and 5 days after treatment (Figure 4 5b). Carcass esterases increased one day after siRNA treatment, but consistent with the carcass results, were reduced at Day 5 (Figure 4 5cC). Colorimetric naphthyl propionate microplate assays indicated a reduction of esterase activity in the gut with J H treatment, but an increase in the carcass (df= 3,7; F=6.19; p=0.0031) (Figure 4 6a). Microplate assays on siRNA treated gut

PAGE 97

97 and carcass fractions were similar to Native PAGE results showing a reduction in esterase activity (df=7,11; F=49.40; p<0.001) (Fi gure 4 6b). Overall, siRNA treatment allowed for the identification of a native esterase protein band that appears to be the RfEst1 gene product. Discussion Three genes identified in Chapter 3 with homology to JH biosynthesis and metabolism protein coding genes were selected for further characterization. Two P450s, Cyp15F1 and Cyp15A1, had significant translated amino acid homology to P450 proteins responsible for JH production (methyl farnesoate epoxidation), while RfEst1 had significant translated amino acid homology to esterase proteins responsible for JH metabolism (via hydrolysis of the C12 ester linkage). Juvenile hormone is a morphogenetic hormone produced by a paired neurosecretory gland, the corpus allatum, which has a broad range of developmental and physiological effects (Nijhout, 1994; Gilbert et al., 2000; Goodman and Granger, 2005). In insects, JH plays a role in the control of larval development and metamorphosis, but also has been shown to affect diapause, migratory behavior, wing length, sea sonal development, and eusocial caste determination (Hartfelder, 2000). In termites, JH demonstrates primer pheromone like characteristics. Primer pheromones are chemical messengers passed among individuals which trigger physiological responses in recipien ts (Wilson and Bossert, 1963). At high JH titers, worker termites differentiate into presoldiers, followed by a molt into a soldier (Park and Raina, 2004, 2005; Mao et al., 2005). The role of JH in soldier termite development is apparently the opposite of the normal role of JH among insects, where it maintains immature features (Truman and Riddiford, 1999). Previous studies have shown that exposure of worker termites to various JH homologues including JH III induces soldier differentiation (Howard and Hav erty, 1979; Scharf et al., 2003a). Therefore,

PAGE 98

98 morphogentic hormones such as JH appear to play a direct role in soldier caste differentiation, although the trigger for JH production by the corpora allata is likely to be extrinsic. In insects, the production of the sesquiterpene JH is accomplished via the mevalonate pathway (Figure 4 7a). The mevalonate pathway begins with the reductive polymerization of acetyl CoA, a precursor of several isoprenoid compounds (Bells et al., 2005). In vertebrates, a final product of this pathway is cholesterol; however, insects lack a number of enzymes used to synthesize the sterol branch of cholesterol at the end of the mevalonate pathway. One of the final steps in the production of JH is the epoxidation of methyl farnesoate to JH III (Figure 4 7b). The order of the final two steps is different in orthopteran insects where esterification occurs before epoxidation; in lepidopterans it is reversed (Bells et al., 2005). Helvig et al. (2004) reported that the cytochrome P450 Cyp1 5A1 of the cockroach, Diploptera punctata is expressed in the head and is responsible for the last epoxidation step in JH biosynthesis. Use of recombinant Cyp15A1 in metabolism studies confirmed that D. punctata Cyp15A1 has a high affinity for methyl farne soate and it is able to catalyze the NADPH dependent epoxidation of 2E,6E -methyl farnesoate (Helvig et al., 2004; Feyereisen, 2005). These results conclusively linked D. punctata Cyp15A1 to methyl farnesoate epoxidation in the production of JHIII. The two cytochrome P450s studied here ( Cyp15F1 and Cyp15A1) share highly significant homology to Cyp15A1 in D. punctata (Figure 4 1a,b). Cyp15A1 is highly expressed in the termite head and has an e -value of 0.0 indicating almost an exact match to D. punctata Cyp15A1 (Table 4 1). However, R. flavipes Cyp15A1 is missing a signal peptide, which is thought to be responsible for incorporation of the terminal end of the protein into the microsomal membrane. The lack of a signal peptide, although unprecedented among insec t P450s, suggests that the R. flavipes Cyp15A1 could have cytosolic expression like bacterial P450s such as P450CAM

PAGE 99

99 (Larson et al., 1991a). More likely is that the protein can still function and incorporate into microsomes without its signal peptide. For example, recombinant cytochrome P450s engineered without signal peptides and heterologously expressed in E.coli have been shown to incorporate into the membrane and still function (Larson et al., 1991a,b). Based on sequence homology and relatedness of cock roaches and termites, it is possible that both R. flavipes Cyp15s could share the same function of methyl farnesoate epoxidation in the production of JH III. The degradation of JH is also important in insect physiology and development. The ability to clear the body of JH is an important factor in insect development during the molt from an immature to an adult. Juvenile hormone esterases are members of the carboxylesterase family (EC 3.1.1.1) which are synthesized in the fat body and secreted into the hemolymph where they degrade JH (Goodman and Granger, 2005). Juvenile hormone esterases degrade JH by hydrolyzing the ester linkage on the C12 end of the molecule (Figure 4 7b). The R. flavipes RfEst1 gene characterized in this study shares translated identity with several putative JH esterases (Figure 4 2a,b) and it was found to be expressed in the carcass, which contains significant amounts of fat body (Table 4 2). Also Wheeler et al. (2009) proposed that the RfEst1 was one of the microsomal permethrin degrading esterases previously isolated by Valles et al. (2001), based on size and large number of predicted glycosylation sites. It has been hypothesized that genes such as JH esterases could participate in caste differentiation by regulating the titers and timing of JH and other semiochemicals and terpenes (Henderson, 1998, Wheeler et al., 2009). Understanding the location of gene expression can also suggest potential functions. Although all the genes characterized here were first identified through sequencing of a gut EST library, their expression was also detected elsewhere in the termite body. Tissue localization

PAGE 100

100 studies revealed expression distributions throughout the entire R. flavipes body for all three genes. Under baseline conditions, Cyp15F1 was predominately expressed in the carcass, Cyp15A1 was most highly expressed in the head, and RfEst1 was most highly expressed in the carcass. However with JH treatment (i.e., feeding on JH treated paper), Rfest1 expression increased most substantially in the gut. Wheeler et al. (2009) focused on a suite of gut carboxyl esterases genes including RfEst1 and identified the site of expression within the gut to be mostly in the mid and hindgut. Production of semiochemicals, by social insects is integral for colony survival. In bark beetles, pheromone production was shown to be regulated through an interaction with JHIII and the midgut in male beetles (Keeling et al., 2006). JHIII stimulates the mevalonate path way gene, HMG -CoA reductase (Tillman et al., 2004). Analysis by quantitative real time PCR (qRT PCR) of multiple genes in the mevalonate pathway indicated that feeding stimulated the JH and pheromone producing pathway in male bark beetles, and partially in females (Keeling et al., 2004). The identification of multiple JH responsive and JH production/ degradation genes in R. flavipes suggests that termites could be producing semiochemicals and communicating through the gut and trophallaxis, which may implica te RfEst1 Although Cyp15F1 was constitutively expressed throughout the termite body, it was slightly higher in the carcass. Cyp15F1 expression was reduced with JH and JH+SHE one day after treatment, which is similar to the expression pattern observed previously (Chapter 3). Based on the similar JH and JH+SHE expression patterns, the potential primer pheromones contained in soldier head extracts do not appear to have any effect on the three genes studied here. These results suggest that the synergistic eff ect combining JH and SHE does not affect these three genes at the Day 1 time point. In previous experiments Cyp15F1 was

PAGE 101

101 differentially expressed between JH and JH+SHE only ten days after treatment (Chapter 3), thus future studies should examine gene expres sion changes of these genes at later time points. Past results have shown that termite esterases can be visualized through native PAGE and naphthyl ester staining (Valles et al., 2001; Wheeler et al., 2009). In the current study native PAGE and esterase staining revealed termite esterases are JH inducible and that one esterase in particular was reduced with targeted RfEst1 siRNA injection, suggesting the reduced band is the RfEst1 protein. If RfEst1 is a true JH esterase this is the first example of the N ative PAGE being used for JHE visualization. Transcript levels were measured by qRT PCR at multiple days after siRNA injection; however no detectable reduction in transcript level could be detected (Appendix E). These results disagree with native PAGE and esterase staining that clearly showed a reduction in an esterase at Day 5 (Figure 4 4a). It appears that there is some disconnect between transcript and protein levels that are not fully understood. Additional research is needed to further investigate the lack of detectable transcript reduction. Results also suggest that five days were required before protein expression was reduced after RfEst1 siRNA injection. A number of past studies using a combination of RNAi and JH have given inconclusive results (Appendix E). A possible reason why phenotypic bioassays and gene expression studies have yet to find any significant RNAi effect could be due to the delayed protein knockdown, and application of JH prior to protein attenuation. This study investigated the ac tivity and expression of three potential JH production/degradation genes in R. flavipes The goals were to characterize the potential roles of these three genes in JH production and metabolism. Gene sequence, amino acid translation, and alignment with homologs were first completed. Two P450s, Cyp15F1 and Cyp15A1, had significant translated amino acid homology to P450 proteins responsible for JH production

PAGE 102

102 (methyl farnesoate epoxidation). RfEst1 had significant translated amino acid homology to esterase prot eins responsible for JH metabolism (ester hydrolysis). Each gene showed significant 24hour responses to JH and JH+SHE treatments with an overall reduction in Cyp15F1 expression, reduced Cyp15A1 expression in the head, and increased RfEst1 expression in th e gut. Native PAGE and esterase staining revealed that termite esterases are JH inducible and one esterase in particular was reduced with targeted RfEst1 siRNA injection. Results suggest that RfEst1 is a JH esterase visible on Native PAGE gels with naphthy l propionate staining. This is potentially the first example of JH esterase identification by Native PAGE. Overall these findings suggest that these three genes play a role in JH production and degradation in R. flavipes which potentially could have a dir ect impact on termite caste differentiation.

PAGE 103

103 Table 4 1. Cyp15 signature motifs Motifs S.P. PGPP hinge 1 2 3 4 5 PGPPWxxxR GxE/DTT/S ExLR PxxFxPE/DRF PFxxGxRxCxG/A Cyp15F1 Yes PPGP WVEQP GGETMA ELIR PEVFRPERFPFGAGKRVCIG Cyp15A1 No No WQEQR GSETTS EVQR PEVFRPDRF PFGFGKRRCLG Table 4 2. Day 0 Tissue distribution of three potential JH production / degradation protein coding genes. Tissue (std. error) Gene Head Gut Carcass Cyp15F1 0.06 (0.21) ab 0.62 (0.22) a 0.61 (0.17) b 2.00 (0.72) 1.00 (0.00) 2.2 (0.55) Cyp15A1 4.12 (0.15) b 7.57 (0.09) a 7.28 (0.27) a 11.34 (1.19) 1.00 (0.00) 1.39 (0.30) RfEst1 Aver 3.09 (0.10) a 3.33 (0.24) a 2.33 (0.19) b 1.25 (0.17) 1.00 (0.00) 2.24 (0.48) Data points within row with the same letter are not significantly different by ANOVA tukeys (Cyp15F1 d.f.=3,17 F=5.7027, P<0.0091, treatment d.f.=2 F=8. 5469, P<0.0038; Cyp15A1 d.f.=3,17 F=75.5942, P<0.0001, treatment d.f.=2 F=112.41, P<0.0001; RfEst1 d.f.=3,17 F=5.5295, P<0.0102, treatment d.f.=2 F=7.7793, P<0.0053). Stero -1 (Chapter 3) es normalized to first the control gene Stero -1 and then to the body region with the lowest level of expression.

PAGE 104

104 Table 4 3. ANOVA table for gene localization. Gene Location Gene Location Gene Location Cyp15F1 Head Source DF F ratio p value Cyp15F1 Gut Source DF F ratio p value Cyp15F1 Carcass Source DF F ratio p value Whole model 5 2.190 0.123 Whole mode 5 6.131 0.005 Whole mode 5 20.613 <.0001 Treatment 2 3.635 0.058 Treatment 2 11.345 0.002 Treatment 2 46.145 <.0001 Colony 1 2.719 0.125 Colony 1 6.468 0.026 Colony 1 0.132 0.723 Treatment*Colony 2 0.483 0.628 Treatment*C 2 0.748 0.494 Treatment*C 2 5.321 0.022 Error 12 Error 12 Error 12 Total 17 Total 17 Total 17 Gene Location Gene Location Gene Location Cyp15A1 Head Source DF F ratio p value Cyp15A1 Gut Source DF F ratio p value Cyp15A1 Carcass Source DF F ratio p value Whole model 5 26.510 <.0001 Whole mode 5 1.003 0.457 Whole mode 5 2.305 0.110 Treatment 2 58.883 <.0001 Treatment 2 0.880 0.440 Treatment 2 0.891 0.436 Colony 1 2.377 0.149 Colony 1 1.857 0.198 Colony 1 8.117 0.015 Treatment*Colony 2 6.203 0.014 Treatment*C 2 0.698 0.517 Treatment*C 2 0.814 0.466 Error 12 Error 12 Error 12 Total 17 Total 17 Total 17 Gene Location Gene Location Gene Location RfEst1 Head Source DF F ratio p value RfEst1 Gut Source DF F ratio p value RfEst1 Carcass Source DF F ratio p value Whole model 5 1.721 0.204 Whole mode 5 4.052 0.022 Whole mode 5 1.845 0.178 Treatment 2 1.251 0.321 Treatment 2 6.414 0.013 Treatment 2 2.539 0.120 Colony 1 3.811 0.075 Colony 1 3.500 0.086 Colony 1 0.139 0.716 Treatment*Colony 2 1.146 0.350 Treatment*C 2 1.967 0.182 Treatment*C 2 2.005 0.177 Error 12 Error 12 Error 12 Total 17 Total 17 Total 17

PAGE 105

105 Figure 4 1 Cyp15F1 and Cyp15A1 sequences (A) Clustal W alignments of translated amino acid sequences of Cyp15F1 and Cyp15A1 with other translated insect cytochrome P450s. Triangles ( amino acids. Species abbreviations are as follows: R. flav, R. flavipes ; D. pun, D. punctata; A. gam, A. gambiae ; T. cas, T. castaneum ; A. mel, A. mellifera ; A. pis, A. pisum ; B. mor, B. mori (B) Cyp15F1 and Cyp15A1 and related sequences aligned by Clustal W, and tree generated by Clustal W, with an out gro up of R. flavipes Cyp4U3v1.

PAGE 106

106 Figure 4 2. RfEst1 sequences (A) Clustal W alignments of translated amino acid sequences for R. flavipes esterases RfEst1 with other insect JHE (juvenile hormone exterase) -like esterases. Triangles ( recognition motifs. Shaded residues are identical to the RfEst1 sequence. Additional species abbrevi ations not listed in Figure 1 are as follows: P.hil, P. hilaris ; A. ros, A. rosae (B) RfEst1 and related sequences aligned by Clustal W, and tree generated by Clustal W, with an out group of R. flavipes Rfest4.

PAGE 107

107 Figure 4 3. Analysis of gene expression in R. flavipes worker body regions for the three target genes, Cyp15F1, Cyp15A1, and RfEst1 CT expression values for target genes were normalized to the CT values from the reference genes and then to the target gene on Day 0 control ( A two -way ANOVA (excluding Day 0) with adjusted LS means was used to separate significant genes using JMP statistical software (SAS Institute, Cary, NC, USA) (Table 4 3) Tukeys HSD tests were used for separating means by treatment for each body region.

PAGE 108

108 Figure 4 4. JH induction of RfEst1 naphthyl propionate in R. flavipes worker hemolymph, gut and carcass, each for starved, control and JHIII treatment. (B) Native PAGE gel showing esterase activity -naphthyl propionate in the gut and carcass for untreated vs. JHIII treated R. flavipes workers.

PAGE 109

109 Figure 4 5. RfEst1 Native PAGE (A) G naphthyl propionate in R. flavipes worker carcass and gut over five days compari ng control vs. RfEst1 siRNAi injections. (B,C) Side by side comparison of control vs RfEst1 siRNAi five days after treatment, showing a reduction in a single esterase band in both gut and carcass.

PAGE 110

1 10 Figure 4 6. Colorimetric esterase assays. (A) Colorimetric e stera se a ssays -naphthyl propionate comparing control vs. JHIII treatment in gut and carcass fractions. Bars with the same letter are not significantly different p < 0.05. (B) Microplate esterase naphthyl propionate comparing Days 1 a nd Days 5 gut and carcass, control vs. RfEst1 siRNAi injected R. flavipes worker termites. Bars with the same letter are not significantly different p < 0.05.

PAGE 111

111 Figure 4 7. JH production and degradation (A) Diagram summarizing juvenile hormone production t hrough the mevalonate pathway. (B) Conversion of methyl farnesoate to juvenile hormone III through a P450 and the metabolism of JHIII to JH acid by a JH esterase.

PAGE 112

112 CHAPTER 5 OVERALL CONCLUSIONS Conclusions The broad goal of this research was to investigate a potential impact that soldier termites may have on nestmate caste differentiation. Specifically, studies were conducted to better understand the influence of soldier head chemicals on nestmate worker caste differentiation. The central hypothe sis tested was that the chemicals produced by soldiers influence phenotype and gene expression of worker termites, and that responsive genes that are differentially expressed play a role in caste differentiation or regulation. The first phase of this disse rtation (Chapter 2) was to characterize and identify the phenotypic effect that soldier head extracts (SHE) have on worker caste differentiation. Results showed that soldier head extracts, when combined with JH, synergistically increased worker -to presoldi er (PS) formation in most colonies tested. Through gas chromatography (GC), mass spectrophotometry (MS), and nuclear magnetic resonance (NMR) the two major components of -cadinenal. In addition, other previously id entified soldier head terpenes also had synergistic effects when tested in combination with JH. The first goal of the second phase of this dissertation (Chapter 3) was to test the effects of JH, JH+SHE, SHE, and live soldier treatments concurrently on phe notypic caste differentiation and gene expression of worker termites at 1, 5, and 10 days of exposure. Through use of quantitative real time PCR I investigated the expression pattern of 47 target genes. I identified 17, 23, and 19 genes with significant di fferential expression among treatments on days 1, 5, and 10 respectively. The three main groups of genes with significant differential expression were 1) chemical production/degradation protein coding genes, 2) hemolymph protein coding genes, and 3) developmental genes.

PAGE 113

113 The second goal of the second phase of this dissertation was to test the individual effects of -cadinenal) on phenotypic caste differentiation and gene expression of worker termites at three d ifferent days (1, 5, and 10). -cadinene was the active component of the SHE blend; -cadinenal is apparently inhibitory. Next we monitored the expression of the genes that were significantly differentially expresse d between JH and JH+SHE from Phase II Objective #1. Two genes, tube and myosin -cadinene is the active component in the SHE blend. Clearly a larger number of genes need to -cadinene as the active component of the SHE blend. The last phase of this dissertation (Chapter 4) was conducted to further characterize three genes from the chemical production/ degradation group, identified in Chapter 3 (Cyp15F1, Cyp15A2, and RfEst1 ). Specifically these genes were chosen for investigation because their expression profiles from Chapter 3 and homology to previously published gene sequences that suggest Cyp15F1, Cyp 15A2, and RfEst1 have roles in JH productio n and degradation (Helivg et al., 2004; Mackert et al., 2008), suggesting they would likely have direct impacts on termite caste differentiation. The full length cDNA sequences and amino acid translations were analyzed and compared to their closest homologs. Both Cyp15s ( Cyp15F1, Cyp15A1) have close homology to Cyp15A1 of the cockroach Diploptera punctata, which was found to be responsible for the last epoxidation step in JH biosynthesis. RfEst1 was found to be closely related to other insect JH esterases responsible for the breakdown of JHIII to JH acid. Finally RfEst1 was putatively visualized with Native PAGE and esterase staining and was shown to be JH inducible and

PAGE 114

114 silenced with targeted siRNA. Chapter 4 findings are not yet conclusive, but they do provide a solid foundation for additional experiments that are likely to provide conclusive answers. Hypotheses and Caveats Soldier Head Extracts Past research has shown that different termites produce different amounts of terpene chemicals (Zalkow et al., 1981; Prestwich, 1983; Bagneres et al., 1990; Nelson et al., 2001; Quintana et al., 2003, Nelson et al., 2008); however these studies did not assay termites over a period of time to see if levels changed. I hypothesize that the termite soldiers can modulat e the amount of terpene chemicals within the colony and therefore regulate the amount of soldiers within the colony. For example if additional soldiers are needed within the colony soldiers cadinene, causing additional soldiers to be formed. If t here is an excess of soldiers cadinenal. JH Effects on Caste Differentiation Over the last four years of my research I have noticed a fluctuation in the potency of co mmercially available JHIII in its ability to force the worker to -soldier differentiation. Possible reasons for this include; 1) the quality and purity of the JHIII we obtain from Sigma -Alrich, 2) seasonal fluctuation of colony caste composition, 3) colony variation due to sampling (i.e. removing soldiers for SHE preparation disrupts the colonys endocrine balance). Howard and Haverty, (1981) documented a natural rise in the number of soldiers during the early spring. This natural rise in soldier numbers coincides with alate production for swarming. The rise in soldiers was always hypothesized to be for the protection of the alates as they leave the colony. I believe that alate protection could be part of the reason for an increase in soldier numbers, but I feel that the rise in soldiers is needed to instead influence caste

PAGE 115

115 composition, as hypothesized by Henderson (1998). Henderson (1998) hypothesized that the soldier caste was used as a sink for absorbing JH from the colony so that alates can form, therefor e influencing nestmate caste differentiation. Mao et al. (2005) monitored JH levels and soldier formation of workers held with different number of soldiers. They found that soldier formation increased with lower initial soldier proportions (same as Appendi x C) and found that JH levels were higher in those individuals, as compared to workers held with higher numbers of soldiers. They suggested that soldier caste proportions regulate JH levels which directly correlate to caste differentiation. My research dir ectly supports this hypothesis that the soldiers influence nestmate caste differentiation, but through primer pheromones instead of sponging JH. Gene Silencing Through RNAi A number of experiments were performed with the goal of silencing gene transcripts through RNAi. Through a large number of attempts, genes, and methods have yet to give clear RNAi effect at the phenotypic level or transcript level (Appendix E). There are three main factors that could explain the lack of a result; 1) termite grouping, 2) termite variability, and 3) RNAi dosage. In my research I monitored groups of fifteen termites for each biological replicate. Perhaps when grouping all fifteen termites together I am missing the RNAi effect; for example the genes are being silenced, but hi gh baseline variation between individuals, thus knockdown affects if any, are not detectible. I have attempted to monitor RNAi effect in individuals, but still I did not see a reduction in transcript level. Also, monitoring individual termites over multipl e replicates across colonies is prohibitively expensive. Finally, I have been currently using the RNAi dosage published previously by Zhou et al. (2006a, 2008) and Korb et al. (2009). I hypothesize that each gene is different and would require a different amount of siRNA/dsRNA to obtain knockdown. A dose response to each siRNA fragment would be ideal, but again can be logistically impossible with siRNA injections.

PAGE 116

116 On a positive note, in the final part of Chapter 4 the RfEst1 protein was visualized with nati ve PAGE and esterase staining. The JH inducible esterase was silenced with corresponding RfEst1 siRNA injections after five days; although no transcript reduction was observed. Results suggest that there is a possible disconnect between transcript and prot ein levels. A possible reason why I have yet to find any significant RNAi effect could be due to the delayed protein knockdown, and application of JH prior to protein attenuation. Additional research with combined transcript and esterase monitoring needs t o be conducted. Summary In summary, this research has led to 1) a better understanding of the role termite soldier derived chemicals play in worker caste differentiation, 2) the impact that JH, soldier head chemicals, JH+soldier head chemicals, an d live soldiers have on nestmate gene expression, and 3) a better understanding of the potential function of three specific genes in caste regulation, or the mediation of termite worker to -soldier caste differentiation. Results from this dissertation provi de a better understanding of how soldier termites may manipulate or control caste differentiation, and provide a better understanding of termite biology, insect sociobiology, hemimetabolous insect development, and basic developmental biology. As a result o f understanding how soldiers are formed, new and novel control methods of this serious structural pest can eventually be designed. By potentially causing all of the individuals within a treated colony to molt into soldiers, the feeding ability of a colony would clearly be reduced and theoretically the colony would starve. Such a control method would be highly termite -specific and therefore help reduce the current reliance on non -discriminatory pesticides. This dissertation represents a critical step toward development of more environmentally friendly, next generation termiticides.

PAGE 117

117 APPENDIX A SOLDIER HEAD EXTRACTS PREPARED IN DICHLOROMETHANE (DCM, MECL2) ALSO SYNERGISTICALLY INCREASE JH INDUCED PRESOLDIER DIFFERENTIATION BY R. FLAVIPES WORKERS The overall g oal of these experiments was to identify the effects different solvents have on the ability of soldier head extract to synergistically affect JH induced soldier caste differentiation. Experiments were conducted as a continuation of Chapter 2 using identica l materials and methods. Trends shown here using acidic dichloromethane (DCM) as a SHE extraction solvent are identical to trends identified when using acetone as the extraction solvent, as reported in Chapter 2. In initial experiments, DCM was used as an extraction solvent based on three previous studies (Lefevue and Bordereau, 1984; Okot -Kotber et al., 1991; Korb et al., 2003). DCM (Fisher Scientific) was of 99% purity and stored in its original amber glass bottle. The pH of the DCM was determined by mixi ng 1:1 with distilled water, shaking vigorously, then by measuring the pH of the upper water phase with a pH meter (pH = 4.0). As shown in Figure A 1, four colonies were compared in their responses to SHE prepared in DCM. On average, presoldier induction s ignificantly increased by 22% when termite workers were co exposed to SHE + JH III, as compared to treatments of JH III alone (p<0.05). Controls treated with either acetone, DCM or SHE alone resulted in no presoldier formation. Presoldiers first appeared between days 10 and 15, and reached maximum levels by day 25 in both SHE + JH III and JH III alone treatments. All four of the initially tested colonies responded similarly, but with variation. An ANOVA did not detect a colony effect (p < 0.05); thus result s across colonies were pooled for mean separation testing. On average, treatment of workers with JH III alone resulted in 12.2% presoldier differentiation, whereas combining SHE + JH III treatments led to 34.4% presoldier differentiation (df= 4,55, F=69.3094, p<0.05)

PAGE 118

118 Additional experiments were conducted as described in the Materials and Methods of Chapter 2, except that the JH III and SHE were extracted in different solvents (acetone or DCM) as reported in Table A 1 below. DCM (Fisher Scientific) was of 99% purity and stored in its original amber glass bottle. The pH of the DCM was determined by mixing 1:1 with distilled water, shaking vigorously, then by measuring the pH of the upper water phase with a pH meter (pH = 4.0). Results show only one incidence of presoldier formation in untreated controls, SHE alone, or LS alone treatments. Since this is the only time that PS formation was observed in a control treatment in this entire dissertation, the 1.3% presoldier formation observed in one control experiment is likely the result of sampling a colony worker that was already becoming a presoldier. JH III diluted in acetone caused on average 25.6% presoldier formation, while presoldier formation was drastically reduced to 0.008% when JH III was in DCM. When JH I II in acetone and SHE in either acetone or DCM were combined, 41.4% of workers on average became presoldiers. The combination of live soldiers and JH III in acetone resulted in no reduction in presoldier formation. These results suggest that (1) JH III is not stable in acidic DCM, but (2) SHE is, and (3) that live soldiers have no impact on JH III efficacy in our bioassay system. Also these results suggest that the results generated by past researchers showing SHE inhibited PS formation might be because of the DCM used in SHE extraction. However, as shown in Chapter 3, some SHE components may be inductive and others inhibitory; and thus variation in blend ratios also may dramatically impact soldier formation under bioassay conditions.

PAGE 119

119 Table A 1. Effects of soldier head extraction solvents and live soldiers on juvenile hormone III (JH) -induced termite presoldier induction. Three separate experiments were performed on five different colonies. % Presoldier Induction Treatment Acetone DCM Experiment Colony ( Std. Error) Untreated controls x 1 1 1.3 (1.3) x 1 6 0 x 2 2 0 x 3 7 0 x 3 8 0 x 3 9 0 JH alone x 1 1 16.0 (5.0) x 2 2 45.3 (13.2) x 1 6 21.3 (5.3) x 3 7 40 (14.6) x 3 8 8.8 (3.7) x 3 9 22.2 (5.4) x 1 1 0 x 1 6 1.3 (1.3) x 2 2 1.3 (1.3) SHE alone x 2 2 0 x 2 2 0 x 3 7 0 x 3 8 0 x 3 9 0 JH+SHE combinations JH SHE 1 1 52.0 (4.9) JH SHE 2 2 25.3 (6.8) JH SHE 1 6 32.0 (15.5) JH, SHE 2 2 44.0 (16.9) JH,SHE 3 7 86.7 (3.7) JH,SHE 3 8 12.2 (4.0) JH,SHE 3 9 37.8 (9.8) JH,SHE 1 1 6.7 (6.7) JH,SHE 1 6 13.3 (14.7) live soldiers alone x 2 2 0 x 3 7 0 x 3 8 0 x 3 9 0 live soldiers + JH x 2 2 34.6 (18.7) Solvent

PAGE 120

120 Figure A 1 Effects of soldier head extracts prepared in DCM on four R. flavipes colonies. Workers were isolated from colonies and exposed to five different treatments for 25 days. Soldier head extracts (SHE) were obtained by homogenizing soldier heads in methylene chloride (DCM MeCl2). The graph shows cumulative avg. std. error presoldier induction through assay day 25. Groups of bars with different letters indicate significant differences at p <0.05.

PAGE 121

121 APPENDIX B COMPARISON OF MULTIPLE RNA ISOLATION METHODS Intro duction In order to generate accurate data, choosing the most efficient RNA isolation method that preserves maximal RNA quality is critical. The objective of this investigation was to compare multiple RNA isolation methods to determine the most efficient and effective method for isolation of total RNA from termites. Three isolation methods were examined that included trizol, trizol + DNase, and the Promega SV Total RNA Isolation System. Results were used to determine the best RNA isolation procedure for application in Chapter 3 and 4 experiments. Materials and Methods Termites Workers termites used in these experiments were from a laboratory colony (Colony Y) held at a constant 22 oC in darkness and provisioned with brown paper towels and pine shims. Colony Y was collected on the University of Florida campus (Gainesville, FL, USA) approximately one year before use (colony started 7/7/06). Termites were identified as Reticulitermes flavipes by mitochondrial RFLP -PCR (Szalanski et al., 2003). RNA Extraction To tal RNA was obtained by using three different methods; each method was tested using two different tissue concentrations (5 and 15 termites). In method #1, total RNA was isolated using trizol (Trisure, Bioline, Randolph, MA, USA) following the manufactures protocol. In method #2 the method #1 trizol isolation was followed by DNase treatment (Promega, Madison, WI, USA) using the manufacturers protocol for analyzing samples by gel electrophoresis.

PAGE 122

122 In method #3, RNA was isolated using the Promega SV Total RNA Isolation System (Promega, Madison, WI, USA) following the manufacturers protocol. Samples with 15 termites were divided into two isolations of 7 and 8 termites. This was done based on previous findings that the Promega SV kit becomes irreversibly plugged when attempting to isolate RNA from all 15 termites at once. Future experience found that the SV kit can handle 15 termites at once, and that the mixture step of the lysis and ethanol is critical to prevent plugging. Sample concentrations were then determ ined by spectrophotometry (A260 method) using an Eppendorf BiophotometerTM and analyzed on both a 2% agarose gel and a 0.9% formaldehyde agarose gel. cDNA Synthesis RNA samples were transcribed to cDNA in vitro using the iScript cDNA Synthesis Kit (Bio -Ra d, Hercules, CA, USA). Equal quantities of 0.5 g total RNA were added to each of the cDNA reactions based on spectrophotometry readings. To measure genomic DNA contamination, three RNA conditions were tested per isolation method: 1) trizol 15 termites, 2) trizol+DNase 15 termites, and 3) Promega 15 termites. The RNA was then separated into two aliquots. In the first aliquot 0.5 g of RNA was treated normally for cDNA conversion. In the second aliquot the reverse transcriptase (RT) was omitted and an addi tional 1l of water was added in its place. Quantitative Real -Time PCR Using the cDNA prepared above as a template, expression levels for four genes were measured by quantitative real -time PCR (qRT PCR) using an iCycler iQ real -time PCR detection system with iQ SYBR Green Supermix (Bio -Rad). Ct values were determined for the four genes, Nicotinamide adenine dinucleotide -dehydrogenase ( NADH -dh) (BQ788175), B -actin

PAGE 123

123 (DQ206832), heat shock protein ( HSP -70) (BQ788164), and hexamerin1 ( Hex -1 ) (AY572858). Ct va lues were used for analysis. Results and Discussion Three different RNA isolation methods (trizol, trizol+DNase, Promega SV) were tested using two different termite quantities per method (5 and 15 termites). Trizol isolation provided the greatest concentr ation and elution volume of total RNA followed by the Promega SV and Trizol +DNase methods (Table B 1). The trizol extraction alone does not remove trace amounts of genomic DNA, therefore a DNase step must be added to remove any leftover DNA. However, the additional DNase step results in a lower RNA yield. The Promega SV kit protocol includes a DNase step. All samples with 15 termites provided more RNA than samples with only 5 termites. However, the Promega SV kit will can not handle 15 termites, so prepar ations must be divided into two samples and combined on the last elution step ( Later experience found the columns to be able to handled 15 termites. Fifteen termites per preparation were used in Chapter 3 and 4 experiments ). RNA samples were viewed on both agarose and formaldehyde agarose gels (Figure B 1). The RNA samples were equally visible on both gels indicating that the extra steps in running formaldehyde agarose specific RNA gels are unnecessary. In fact, bands were less diffused on regular agarose g els. After isolation, the RNA samples were transcribed in vitro to cDNA and tested in qRT PCR reactions that amplified four separate genes (Figure B 2). Resulting Ct values indicated a difference between extraction methods with the trizol DNase extraction of 15 termites providing the lowest overall Ct values. Equal amounts of cDNA were added to each reaction so variations

PAGE 124

124 in gene expression could be because of error in cDNA degradation, spectrophotometry readings, pipetting error, or contamination from geno mic DNA. RNA samples were then tested for genomic DNA contamination. By leaving reverse transcriptase out of cDNA synthesis reactions, the only thing that should amplify in PCR reactions would be contaminating genomic DNA. Ct values of treatments with and without reverse transcriptase suggested genomic DNA contamination with all three RNA isolation methods (Figure B 3). As seen earlier, all three methods provided similar trends in the data, but different absolute values. All RT treated samples were significantly dif ferent than the non -RT treated samples by pair -wise t tests. Nadh RT and non RT had the closest Ct values, followed by -actin Hsp and Hex -1 The SV Promega kit provided the lowest overall p-values when comparing RT and non -RT treatments. These results suggest that the SV Promega isolation method has the least amount of genomic DNA contamination. The overall goal of this study was to determine which RNA extraction method to use for the rest of my PhD thesis experiments (Chapters 3 and 4). From the results presented here, the Promega Total RNA SV kit provides the largest amount of RNA in the shortest amount of time with the smallest amount of genomic DNA contamination. As a result, the Promega SV Total RNA Isolation System was used for RNA isolations in Cha pter 3 and 4 gene expression studies.

PAGE 125

125 Table B 1. Spectrophotometer measurements of each of the RNA isolations Treatment # Termites Sample* A260 A260/280 Con (ng/l) Elution (l) RNA (g) Triazol 5 1 0.132 1.38 132.4 48 6.36 Triazol 5 2 0.103 1.49 102.6 48 4.92 Triazol 15 3 0.567 1.49 566.5 48 27.19 Triazol 15 4 0.786 1.58 786.4 48 37.74 Promega SV 5 5 0.048 1.91 48.3 75 3.60 Promega SV 15 6 0.083 1.69 83.0 150 12.45 Triazol Dnase 5 2a 0.038 1.75 37.5 23 0.87 Triazol Dnase 15 3a 0.034 1.82 33.8 23 0.78 Lane positions on Figure B 1

PAGE 126

126 Figure B 1. RNA samples viewed on both A) 2% agarose and B) 0.9% formaldehyde agarose gels. Three l of sample + 2l of loading buffer were loaded into each lane. Lanes were loaded as follows : 1) trizol 5 termites, 2) trizol 5 termites, 3) trizol 15 termites, 4) trizol 15 termites, 5) Promega SV 5 termites, 6) Promega S V 15 termites, 2a) trizol+DNase 5 termites, 3a) trizol+DNase 15 termites, 1l 1kb ladder, and 2.5 l 0.1 kb ladder

PAGE 127

127 Figure B 2. Comparisons of gene expression levels of for four genes in R. flavipes workers determined from RNA isolation performed by dif ferent methods. RNA isolation treatments were as follow s : 1) trizol 5 termites, 2) trizol 5 termites, 3) trizol 15 termites, 4) trizol 15 termites, 5) Promega SV 5 termites, 6) Promega SV 15 termites, 2a) trizol+DNase 5 termites, 3a) trizol+ DNase 15 termit es.

PAGE 128

128 Figure B 3. Analysis of potential genomic DNA contamination in RNA preparations Gene expression for four genes in R. flavipes workers from cDNA made from RNA with reverse transcriptase (RT) or without RT. By performing RT reactions without RT no cDNA should be made; thus, any resulting PCR amplification should be from genomic DNA contamination. Three different RNA isolation methods were tested trizol trizol+DNase, and Promega SV. ANOVAs between treatments within genes indicated a significant model effect (p<0.0001). Pair -wise t test p -values between non RT and RT treatments are listed.

PAGE 129

129 APPENDIX C SEQUENCES AND PHYLOGENETIC ANALYSES OF T ERMITE GENES Introduction The following section is a collection of the gene sequences that I have obtaine d throughout this dissertation. The identity of these genes had to be verified through sequencing. Genbank accession numbers for corresponding genes are listed next to the gene name, where available. Sequences are listed in the forward direction (Sp6 seque nced from a vector) except when sequenced from the reverse direction, indicated by an r, or T7. Section 1 The first section lists 16s mitochondrial gene sequences corresponding to the termite colonies used in this dissertation. These sequences were u sed for species identification (Szalanski et al., 2003). Section 2 The next section reports the Hexamerin 2 sequences from eight different colonies. This analysis was used as a secondary method to assess relatedness of termite colonies. Section 3 -Sequen ces of qRT PCR products that correspond to EST sequences identified by Tartar et al. (2009). These genes were studied in Chapters 3 and 4. Section 4,5 Sequences from library clones identified from Tartar et al. (2009). These genes were targeted in Chapte rs 3 and 4. Section 6 Cloned high throughput array gene sequences used to make the macro arrays. Some of these genes were also targeted in Chapters 3 and 4. Materials and Methods Sequences from Section 1 were obtained by the following protocol. Genomic DNA was extracted using QuickExtractTM (Epicentre, Madison, WI) following the manufacturers protocol. Termite genomic DNA was used as a template for PCR following the protocol of Sz alanski et al. (2003) using SyberGreen PCR Master Mix (2xSensiMix Plus SYBR & Flourescein (Quantace, Norwood, MA)). PCR products were then purified by sodium acetate/ ethanol precipitation and viewed on agarose gels. 16s bands were gel -extracted using the QIAquick gel extraction kit (Qiagen Valencia, CA) following the manufacturers protocol.

PAGE 130

130 Samples were submitted for sequencing at the UF ICBR Genomics Core. All resulting 16s sequences were compared by BlastN against the NCBI nr database to confirm species identity. Resulting 16s sequences were also trimmed, aligned, and used to generate phylogenetic trees within MegAlign Clustal W in the Lasergene software package. Sequences from Section 2 and 3 were obtained by the following protocol. cDNA was reverse tr anscribed from total RNA as described in Chapter 3. PCR reactions were performed using SyberGreen PCR Master Mix with gene specific primers (Chapter 3, Table 3 1). PCR products were visualized on agarose gels and gel extracted using the QIAquick gel extrac tion kit (Qiagen). Samples were submitted for sequencing at the ICBR Genomics Core. Section 2 sequences were trimmed, aligned, and used to generate phylogenetic trees within MegAlign Clustal W in the Lasergene software package. Sequences from Section 4 and 5 were obtained by the following protocol. Select clones identified by Tartar et al. (2009) from a termite gut cDNA library were picked and grown up overnight at 37 C in 3ml LB broth containing 3l of (40 g/ml) chloramphenicol. Samples were purified usi ng the QIAprep Miniprep Kit (Qiagen Valencia, CA) following the manufacturers protocol. Samples were submitted for sequencing at the UF -ICBR Genomics Core. Sequences from Section 6 were obtained by the following protocol. First, cDNA was reverse transcri bed from total RNA as described in Chapter 3. PCR reactions were performed using SyberGreen PCR Master Mix with gene specific primers (Chapter 3, Table 3 1). PCR products were then visualized on agarose gels and gel -extracted using the QIAquick gel extract ion kit. Products were ligated overnight into the pGEM T Easy Vector (Cat.# A1360) (Promega, Madison, WI) following the manufacturers protocol. Plasmids were transformed into JM109 competent cells (Cat.# L2001) (Promega) and plated on LB agar plates trea ted with Xgal,

PAGE 131

131 IPTG, and ampicillin. After growing overnight at 37 C, colonies were picked and colony PCR was performed to confirm positive insertion of the fragment, (gene specific primers are listed in Chapter 3, Table 3 1). Positive clones were picked and grown up overnight in 3ml LB with 100 g/ml ampicillin at 37 C with shaking. Glycerol stocks were made for a portion of each positive clone by adding 875 l of LB liquid culture to 125 l of sterile glycerol and frozen at 80 C. Plasmid DNA was purif ied from the remaining using the QIAprep Miniprep Kit (Qiagen, Valencia, CA) following manufacturers protocol. Samples were submitted for sequencing at the UF ICBR Genomics Core. Results and Discussion Alignments and phylogenetic trees of 16s mitochondria l gene sequences (Figure C 1,2) indicated the presence of genetic differences between the 15 termite colonies and one out group that were sequenced. Most of the R. flavipes colonies grouped together with the Coptotermes formosanus separating the R. virginicus samples. Interestingly colony K2 16s sequence was highly different from the other colonies. In Chapter 3 K2 colony (Colony 2) showed a reduced response to JH and JH+SHE compared to the two other colonies tested. Perhaps this result was because of the d ifference in relatedness. Alignments and phylogenetic trees of Hex -2 gene sequences (Figure C 3) revealed that there were minor nucleotide substitutions between the eight colonies tested, but larger differences between R. flavipes and B.discoidalis sequ ences. These results further support that genetic differences exist between termite colonies used in this research. Overall, sequence variations could be indicative of genetic differences between termite colonies, and could be associated with variability observed between colonies in phenotypic and gene expression assays.

PAGE 132

132 SECTION 1: 16s rDNA Sequences >A8 16S FJ265705 AACGAATATCTTACATCCAAATAAATGGCTCAGCAAATATAAATAAATATAACAACACAAAGGAGGG GTTAAATAATATCCCTCCCATCACCCCAACAAAACATATTTGACAGCCCTACTGAACCCTCACAAACA GAAAGACACCATACAAAATG >A8 16S R CTTCCCCTAGTTTTTGAGTATGGCCTGCCCCTGACCTTGAATGTTGAAGGGCCGCGGTATTTTGACCGT GCAAAGGTAGCATAGTCATTAGTTCTTTAATTGTGATCTGGTATGAATGGCTTGACGAGGCATAAGCT GTCTTAATTTTGAATTGTTTATTGAATTTGGTCTTTGAGTTAAAATTCTTAGATGTTTTTATGGGACGAG AAGACCCTATACAGTTTGGC ATTTATTATGGTCTCTTTCTGTTTGTGAGGGTTCACCATGGCTGCCAAA TC >BI1 16S CCGCATATACTCATCAAAAAATGGTTCAGCAAATATAAATAAATATAACAACACAAAGGAGGGGTTA AATAATATCCCTCCCATCACCCCAACAAAACATATTAAACAGCCCTAGTGAACCCTCACAAACAGAAA GAGACCATAATAAATGTCAAACTCTATAGGGTCTTCTCGTCCCATAAAAACATCTAAGAATTTTAACTC AAAGACCAAATTCAATAAACAATTCAAAATTAAGACAGCTCATGCCTCGTCAAGCCATTCATACCAGA TCACAATTAAAGAACTAATGACTATGCTACCTTTGCACGGTCAAAATACCGCGGCCCTTCAACATTCA AAGTCAGTGGGCAGGCCATACTTCAAAAACTAACGAGAAGAGATGTTTTTGATAAACAGGCGA >GB1 16S FJ265704 GTCACGGGGCTGGAGTTATATTGGGT CTGTTCGACCTTTAAAATCTTACATGATCTGAGTTCAAACCGG CGTTCCTTGTGTAAC >GB 16S R CCTTTCTAGTTTTTGAGTATGGCCTGCCCCTGACCTTGAATGTTAGAAGGGCCGCGGTATTTTGACCGT GCAAAGGTAGCATAGTCATTAGTTCTTTAATTGTGATCTGGTATGAATGGCTTGACGAGGCATAAGCT GTCTTAATTTTGAATTGTTTATTGAATTTGTTCTTTGAGTTAAAATTCTTAGATGTTTTTATGGGACGAG AAGACCCTATAGAGTTTGACATTTATTATGGTCTTTTTCTGTTTGTGAG GGTTCACTAGGGCTGTTTAAT ATGTTTTGTTGGGGTGATGGGAGGGATATTATTTAACCCCTCCTTTGTGTTGTTATATTTATTTATATTT GCTTGATCCATTTATTTTGATTGTAAGATTAAATTACCTTAGGGATAACAGCGT >GB 16S ATCACATCTTCATAAAATAAATGGACAGCAAATATAAATAAATATAACAACACAAAGGAGGGGTTAA ATAATATCCCTCCCATCACCCCAACAAAACATAT TAAACAGCCCTAGTGAACCCTCACAAACAGAAAA AGACCATAATAAATGTCAAACTCTATAGGGTCTTCTCGTCCCATAAAAACATCTAAGAATTTTAACTTA AAGAACAAATTCA >IN 16S ACGAATTATCTTCCTTCAAAATAAATGGACAGCAAATATAAATAAATATAACAACACAAAGGAGGGG TTAAATAATATCCCTCCCATCACCCCAACAAAACATATTAAACAGCCCTAGTGAACCCTCACAAACAG AAAGAGACCATAATAAATGTCAAACTCTATAGGGTCTTCTCGTCCCATAAAAACATCTAAGAATTTTA ACTCAAAGACCAAATTCAATAAACAATTCAAAATTAAGACAGCTTATGCCTCGTCAAGCCATTCATAC CAGATCACAATTAAAGAACTAATGACTATGCTACCTTTGCACGGTCAAAATACCGCGGCCCTTCAACA TTCAAGGTCAGTGGGCAGGCCATA >IN 16S R ACTCCTCTAGT TTTTGAGTATGGCCTGCCCCTGACCTTGAATGTTGAAGGGCCGCGGTATTTTGACCGT GCAAAGGTAGCATAGTCATTAGTTCTTTAATTGTGATCTGGTATGAATGGCTTGACGAGGCATAAGCT GTCTTAATTTTGAATTGTTTATTGAATTTGGTCTTTGAGTTAAAATTCTTAGATGTTTTTATGGGACGAG AAGACCCTATAGAGTTTGACATTTATTATGGTCTCTTTCTGTTTGTGAGGGTTCACTAGGGCTGTTTAAT

PAGE 133

133 ATGTTTTGTTGGGGTGATGGGAGGGATATTATTTAACCCCTCCTTTGTGTTGTTATATTTATTTATATTT GCTTGATCCATTTATTTTGATTGTAAGATTAAATTACCTTAGGGATAACAGCGTAAA >K2 16S FJ627943 TTGATATCTTCAATCAAATAACATGGATCAGCAAATATTAATAAATATAACAACATAAAGGAGGGGTT AAACAATATCCCTCCCATCACCCCAACAAAA CATATTAAACAGCCCTAGTGAACCCTCACAAACAGAA AGAGACCATAATAAATGTAAAACTCTATAGGGTCTTCTCGTCCCATAAAAACATCTAAGAATTTTAAC TCAAAGACCAAATTCAATAAACAATTCAAAATTAAGACAGCTCATGCCTCGTGTGGCCATTCATACCA GG >K2 16S R CCTACCTTGTTTTTGAGTATGGCCTGCCCACTGACCTTGAATGTTGAAGGGCCGCGGTATTTTGACCGT GCAAAGGTAGCATAGTCATTAGTTCTTTAATTGTGATCTGGTATGAATGGCTTGACGAGGCATGAGCT GTCTTAATTTTGAATTGTTTATTGAATTTGGTCTTTGAGTTAAAATTCTTAGATGTTTTTATGGGACGAG AAGACCCTATAGAGTTTTACATTTATTATGGTCTCTTTCTGTTTGTGAGGGTTCACTAGGGCTGTTTAAT ATGTTTTGTTGGGGTGATGGGAGGGATATTGTTTAACCCCTCCTTTAT GTTGTTATATTTATTAATATTT GCTTGATCCATTTATTTTGATTGTAAGATTAAA >NA 16S CGATATCTTCATCAAATAAATGGACAGCAAATATAAATAAATATAACAACATAAAGGAGGGGTTAAA CAATATCCCTCCCATCACCCCAACAAAACATATTAAACAGCCCTAGTGAACCCTCACAAACAGAAAGA GACCATAATAAATGTAA >NA 16S R GTTATCTAGTTTTTGAGTATGGCCTGC CCCTGACCTTGAATGTTAGAAGGGCCGCGGTATTTTGACCGT GCAAAGGTAGCATAGTCATTAGTTCTTTAATTGTGATCTGGTATGAATGGCTTGACGAGGCATGAGCT GTCTTAATTTTGAATTGTTTATTGAATTTGGTCTTTGAGTTAAAATTCTTAGATGTTTTTATGGGACGAG AAGACCCTATAGAGTTTTACATTTATTATGGTCTCTTTCTGTTTGTGAGGGTTCACTAGGGCTGTTTAAT ATGTTTTGTTGGGGTGATGGGAGGGATATTGTTTAACCCCTCCTTTATGTTGTTATATTTATTTATATTT GCTTGATCCAA >K4 16S CAGTGAGGGGCTGAAGTTATATTGGGTCTGTTCGACCTTTAAAACCTTACATGATCTGAGTTCAAACCG GCGTAACCACACT >K5 6S GQ403073 AAGATCTTCATAAAATAAATGGACAAGCAAATATTAATAAATATAACAACATAAAGGAGGGGTTAAA CAATATCCCTCCCATCACCCCAACAAAACATATTAAACAGCCCTAGTGAACCCTCACAAACAGAAAGA GACCATAATAAATGTAAAACTCTATAGGGTCTTCTCGTCCCATAAAAACATCTAAGAATTTTAACTCA AAGACCAAATTCAATAAACAATTCAAAATTAAGACAGCTCATGCCTCGTCAAGCCATTCATACCAGAT CACAATTAAAGAACTAATGACTATGCTACCTTTGCACGGTCAAAATACCGCGGCCCTTCAACATTCAA GGTCAGTGGGCAGGCCATACTTCAAAAACTAACGAGAAGAGATGTTTTTGATAACCAGGCG >K6 16S GQ403074 GGACCGCCTAATCCTACATCAAAAAATGGATAAGCAATATTAATAAATATAACAACATAAAGGAGGG GTTAAACAATATCCCTCCCATCACC CCAACAAAACATATTAAACAGCCCTAGTGAACCCTCACAAACA GAAAGAGACCATAATAAATGTAAAACTCTATAGGGTCTTCTCGTCCCATAAAAACATCTAAGAATTTT AACTCAAAGACCAAATTCAATAAACAATTCAAAATTAAGACAGCTCATGCCTCGTCAAGCCATTCATA CCAGATCACAATTAAAGAACTAATGACTATGCTACCTTTGCACGGTCAAAATACCGCGGCCCTTCAAC ATTCAAGGT CAGTGGGCAGGCCATACTTCAAAAACTAACGAGAAGAGATGTTTTTGATAAACAGGCG ACC >NA_5 16S NGCGACGGGGCTGAAGTTATATTGGGTCTGTTCGACCTTTAAAACCTTACATGATCTGAGTTCAAACC GGCGTAATTTCTATCG

PAGE 134

134 >NA6 16S GCGGCCCTATCCTTCATAAAAAAATGGATCAACAAATATAATTAAATATAACAACACAAAGGAGGGG TTAAATTATATCCCTCCCATC ACCCCAACAAAACATATTAAATGGCCCAGTGAACCCTCACAAACAGA AAGAGACCATAATAAATGTCAAACTCTATAGGGTCTTCTCGTCCCATAAAAACATCTAAGAATTTTAA CTCAAAGACCAAATTCAATAAGCAATTTAAAATTAAGACAGCCCATGCCTCGTCAAGCCATTCATACC AGATCACAATTAAAGAACTAATGACTATGCTACCTTTGCACGGTCAAAATACCGCGGCCCTTCAACAC CAAAGTCAGCGGGCAGGCCATACTTCAAAAACTAACAAGAAAAGATGTTTTTGATAAACAGGCGA >REGGIEIII16S CCGAAATATCTTCAATCAAAAAATGGACAAGCAAATATAAATAAATATAACAACATAAAGGAGGGGT TAAACAATATCCCTCCCATCACCCCAACAAAACATATTAAACACCCCTGTGAACCCTCACAAACAGAA AGACACCTTAATAAATGTAA >REGGIEIII16S R ATTTC TCTAGTTTTTGAAGTATGGCCTGCCCCTGACCTTGAATGTTGAAGGGCCGCGGTATTTTGACCG TGCAAAGGTAGCATAGTCATTAGTTCTTTAATTGTGATCTGGTATGAATGGCTTGACGAGGCATGAGCT GTCTTAATTTTGAATTGTTTATTGAATTTGGTCTTTGAGTTAAAATTCTTAGATGTTTTTATGGGACGAG AAGACCCTATAGAGTTTTACATTTATTATGGTCTCTTTCTGTTTGTGAGGGTT CACTAGGGCTGTTTAAT ATGTTTTGTTGGGGTGATGGGAGGGATATCGTTCAACCCCTT >TR 16S CCGTAAAATCTTCATCCAAAATAAATGGATCAGCAAATATAAATAAATATAACAACATAAAGGAGGG GTTAAACAATATCCCTCCCATCACCCCAACAAAACATATTAAACAGCCCTAGTGAACCCTCACAAACA GAAAGAGACCATAATAAATGTAAAACTCTATAGGGTCTTCTCGTCCCATAAAAACATCTAAGAATTTT AACTCAAAGACCAAATTCAATAAACAATTCAAAATTAAGA >TR 16S R CTTCCCCTAGTTTTTGAAGTATGGCCTGCCCCTGACCTTGAATGTTGAAGGGCCGCGGTATTTTGACCG TGCAAAGGTAGCATAGTCATTAGTTCTTTAATTGTGATCTGGTATGAATGGCTTGACGAGGCATGAGCT GTCTTAATTTTGAATTGTTTATTGAATTTGGTCTTTGAGTTAAAATTCTTAGATGTTTTTATGGGACGAG AAGACCCTATAGAGTTTTACATTTATTATGGTCTCTTTCTGTTTGTGAGGGTTCACTAGGGCTGTTTAAT ATGTTTTGTTGGGGTGATGGGAGGGATATTGTTTAACCCCTCCTTTATGTTGTTATATTTATTTATATTT GCTTGATCCATTTATTTTGATTGTAAGATTAAATTACCTTAGGGATAACAGCGTAA >W10 16S AAGTATCTTCATAAAATAAATGGACAAAC AAATATAAATAAATATAACAACACAAAGGAGGGGTTAA ATTATATCCCTCCCATCACCCCAACAAAACATATTAAATGGCCCAGTGAACCCTCACAAACAGAAAGA GACCATAATAAATGTCAAACTCTATAGGGTCTTCTCGTCCCATAAAAACATCTAAGAATTTTAACTCAA AGACCAAATTCAATAAGCAATTTAAAATTAAGACAGCCCATGCCTCGTCAAGCCATTCATACCAGATC ACAATTAAAGAAC TAATGACTATGCTACCTTTGCACGGTCAAAATACCGCGGCCCTTCAACACCAAAG TCAGCGGGCAGGCCATACTTCAAAAACTAACAAGAAAAGATGTTTTTGATAACAGGCGA >W11 16S ACGTTCTTCATAAAATAAATGGACAAACAAATATAAATAAATATAACAACACAAAGGAGGGGTTAAA CTATATCCCTCCCATCACCCCAACAAAACATATTAAATGGCCCAGTGAACCCTCACAAACAAATAAAA GACCATAATAAATGTCAAACTCTATAGGGTCTTCTCGTCCCATAAAAACATCTAAGAATTTTAACTCAA AGACCAAATTCAATAAGCAATTTAAAATTAAGACAGCCCATGCCTCGTCAAG CCATTCATACCAGATC ACAATTAAAGAACTAATGACTATGCTACCTTTGCACGGTCAAAATACCGCGGCCCTTCAACACCAAAG TCAGCGGGCAGGCCATACTTCAAAAACTAACAAGAAAAGATGTTTTTGATAAACAGGCGA >W18 16S AAGTATCTCATAAAATAAATGGACAAACAAATATAAAAAATATAACAAACAAAGGAGGGGTTAAATT ATATCCCTCCCATCACCCCAACAAAACATATTAA ATGGCCCAGTGAACCCTCACAAACAGAAAGAGAC CATAATAAATGTCAAACTCTATAGGGTCTTCTCGTCCCATAAAAACATCTAAGAATTTTAACTCAAAG ACCAAATTCAATAAGCAATTTAAAATTAAGACAGCCCATGCCTCGTCAAGCCATTCATACCAGATCAC

PAGE 135

135 AATTAAAGAACTAATGACTATGCTACCTTTGCACGGTCAAAATACCGCGGCCCTTCAACACCAAAGTC AGCGGGCAGGCCATACTT CAAAAACTAACAAGAAAAGATGTTTTTGATAAACAGGCGA >W27 516S AAGTATCTTCATAAAATAAATGGACAAACAAATATAAATAAATATAACAACACAAAGGAGGGGTTAA ACTATATCCCTCCCATCACCCCAACAAAACATATTAAATGGCCCAGTGAACCCTCACAAACAAATAAA GACCATAATAAATGTCAAACTCTATAGGGTCTTCTCGTCCCATAAAAACATCTAAGAATTTTAACTCAA AGACCAAATTCAATAAGCAATTTAAAATTAAGACAGCCCATGCCTCGTCAAGCCATTCATACCAGATC ACAATTAAAGAACTAATGACTATGCTACCTTTGCACGGTCAAAATACCGCGGCCCTTCAACACCAAAG TCAGCGGGCAGGCCATACTTCAAAAACTAACAAGAAAAGATGTTTTTGATAACAAGGCG >Y 16S CCGCATTTCTTCATAAAATAAATGGACAGCAAATATTAATAAATATAACAA CATAAAGGAGGGGTTAA ACAATATCCCTCCCATCACCCCAACAAAACATATTAAACAGCCCTAGTGAACCCTCACA >Y 16S R CCCCTCGGAGTTTTTGAGTATGGCCTGCCCCTGACCTTGAATGTTAGAAGGGCCGCGGTATTTTGACCG TGCAAAGGTAGCATAGTCATTAGTTCTTTAATTGTGATCTGGTATGAATGGCTTGACGAGGCATGAGCT GTCTTAATTTTGAATTGTTTATTGAATTTGG TCTTTGAGTTAAAATTCTTAGATGTTTTTATGGGACGAG AAGACCCTATAGAGTTTTACATTTATTATGGTCTCTTTATGTTTGTGAGGGTTCACTAGGGCTGATTAA TA SECTION 2 Hexamerin -2 S equences >A8 HEX 2 GAGACCCTAATACCTCTATACTACTACAACTACCCCCGTTCTTCACAGCACCGATTACGGCGTTCATTT CAACCGTCGCGGTGAGCAGTTCTACTACAAAATCCAGCAGGTCCTACCTG >A8 HEX2 R GNCCGTCAGACTGCTCCGCGCGGTCGAATGAACGCCGTACTCGGTGCTGTTGAAGAACGTGGGGTAGT TGTAGTAGTAGTAGAGGTAGTACGTGCTGAGTCCAACGTCTTCCGT >GB HEX 2 TGGACCTTAATCCCTCTATACTACTACAACAACCCCCGTTCTTAAACAGCACCGATTACGGCGTTAATT TCGACCGTCGCGGGGAGCAGTTCTACTAC AAAACCCGGCAGGTCCTAAGCCTAGGAATTAGT >GB HEX2 R GCCGCAGTGCTCTCCGCGCGGTCGAATGAACGCCGTACTCGGTGCTGTTGAAGAACGTGGGGTAGTTG TAGTAGTAGTAGAGGTAGTACGTGCTGAGTCCAACGTCTTCCGTAACACG >K2 HEX 2 ACCTCAAACCTCTAAACTACTACAACTACCCCCGTTCTTCACAGCACCGAGTACGGCGTTAATTTCAAC CGTCGCGGTGAGCAGTTCTACTACAAAACCCAGCAGGTCCTAAAAC >K2 HEX2 R AACTCCAGTACTGCTCCGCGCGGTCGAAAGAACGCCGTACTCGGTGCTGTTGAAGAACGTGGGGTAGT TGTAGTAGTAGTAGAGGTAGTACGTGCTGAGTCCAACGTCTTCCGTAACAG >NA HEX 2 CAGACCTCCTACCTCTATACTACTACAACTACCCCCGTTCTTCACAGCACCGATTACGGCGTTAATTTC AACCGTCGCGGTGAGCAGTTCTACTACAAAACCCAGCAGGTCCTAAGCTTG >NA HEX2 R TATGGCAGTACCGCTCCGCGCGGTCGAAAGAACGCCGTACTCGGTGCTGTTGAAGAACGTGGGGTAGT TGTAGTAGTAGTAGAGGTAGTACGTGCTGAGTCCAACGTCTTCCGTAACCTC A

PAGE 136

136 >IN HEX 2 GGCAGCACTAATACCTCTATACTACTACAACTACCCCCGTTCTTAACAGCACCGATTACGGCGTTAATT TCGACCGTCGCGGGGAGCAGTTCTACTACAAAACCCGGCAGGTCCTAAGCGGA >IN HEX2 R TGTAGGCAGTGCTGCTCCGCGCGGTCGAAAGAACGCCGTACTCGGTGCTGTTGAAGAACGTGGGGTAG TTGTAGTAGTAGTAGAGGTAGTACGTGCTGAGTCCAACGT CTTCCGTAGGCTC >REGGIE IIIHEX 2 GTGAACTCATACCTCTCTACTACTACAACAACCCCCGTTCTTCACAGCACCGAGTACGGCGTTCATTTC AACCGTCGCGGTGAGCAGTTCTACTACAAAACCCAGCAGGTCCTAAGCC >REGGIEIIIHEX2 R CACGGCCAGTACTGCTCCGCGCGGTCGAAAGAACGCCGTACTCGGTGCTGTTGAAGAACGTGGGGTAG TTGTAGTAGTAGTAGAGGTAGTACGTGCTGAGTCCAACGTCTTCCGT >TR HEX 2 CGGAACTAATACCTCTCTACTACTACAACTACCCCACGTTCTTCACAGCACCGAGTACGGCGTTCATTT CGACCGTCGCGGTGAGCAGTTCTACTACAAAATCCAGCAGGTCCTAACCCGTGGGCCTGGA >TR HEX2 R TTAGGCCAGTGCCTGCTCCGCGCGGTCGAAAGAACGCCGTACTCGGTGCTGTTGAAGAACGTGGGGTA GTTGTAGTAGTAGTAGAGGTAGTACGTGCTGAGTCCAACGTCTTCCGTA >Y HEX 2 GANGACCTCATACTCTATACTACTACAACAACCCCCGTTCTTCACAGCACCGATTACGGCGTTAATTTC AACCGTCGCGGTGAGCAGTTCTACTACAAAACCCAGCAGGTCCTAA >Y HEX2 R C TGGGCCCAGTACTGCTCCGCGCGGTCGAAAGAACGCCGTACTCGGTGCTGTTGAAGAACGTGGGGTA GTTGTAGTAGTAGTAGAGGTAGTACGTGCTGAGTCCAACGTCTTCCGTAACTT SECTION 3 Sequences of qRT -PCR Products That Correspond to ESTs I dentified by Tartar et al. (2009) >CJUN1 ACCESSION NO. FL638224 CT CGCCTGGTGGATAGCCGATTGTAAAAGAACCAACTTCCTGTAATGTCGAGTGCATGACCGGCCCAG CATACGGAAACGTTGGTGCCTGGTGCGAGGCTAGATAGGCAGCAACTGGCCTTGCCTTCACTTGCGTA ATTCATCGCCACAACGTCATGTTGCGAACCGGATTAGAACTTTGTTGCCAGCCC >CJUN 1R AACCGTTCGCATGAGTTGTGGCGATGAATTACGCAAGTGAAGGCAAGGCAGTTGCT GCCTATCTAGCC TCGCACCAGGCACCAACGTTTCCGTATGCTGGGCCGGTCATGCACTCGACATTACAGTGAAGTTTGGTT TCTTTTACAAATCTGGCTACTCCACACAGTTCAGTATTGAGCATGTCATGGACCCC >CYP6 2FL637360 CCCCCTAACGATATTACGACCTTCTTCCGCACGCTTGTGCACGAGACCGTCAAATTCAGGGAGCAACA TTCCGTAACTCGCAACGACTTCTTGCAACTT CTGATCCGACTCAAGAACAAGGAAAGCCTTGAATCCG ATACTTCAACCGAAGACTGCGATGGAAACTCTGCTGGTATGACAAGGGCCA >CYP6 2R

PAGE 137

137 TTCATCCGAATTTTTGGTTGGAATTTGGGTTCCGGGTTTTCTTGGTTTTGAATCCGAAAAAAGTTGCAA AAAGTCCTTGCCAATTACCGAATGGTGCCCCCTGGATTTGACGGGTTTCGGCCCCAACCGGGCGAAAA AGGGCCAAATTTCCTTTGGGGGGGTCCCTTTTCCCAAAAACCTTGGGCCCACCC >EPOX1 FL640608, FL636393, FL635113 TTAATAATGTGTGTCGCGTGCTTTCTTTGTGGCTTCTCTAGCCTTCGGCCGGCTATGTCTCAGCATCCTC CTGCATCCTACCAGGATCTTTTGGAGGGTGAAGCGGCGTCAGACAGCTCCTGAGTGCCTCACTGACCC TGCCTACGGGATCCATGGATATCTGCCAATTGAGGGAGTGA > EPOX1R TACAGGTCCTGTAGCAGGGTCGTGAGGCACTCAGGAGCTGTCTGACGCCGCTTCACCCTCCAAAAGAT CCTGGTAGGATGCAGGAGGATGCTGAGACATAGCCGGCCGAAGGCTAGAGAAGCCACAAAGAAAGCT AC >FAMET1 FL638251, FL637991 TTCTCGTTGTGAGGGGATTTGAAGTCTATCTTACCAACAGTGGAATACCTACTCCTGTGGCTGACAACG GAATATTGAGAATGAAATCAAAGTTAGGATAATATGATTGTAATGTATGTAATAAAATGTATCCTAAT TAATTTCCCTGCTGTATAAGTGGTCAAAAAAAT >FAMET 1R ATTCATTGACTTATACAGCAGGGAAATTAATTAGGATACATTTTATTACATACATTACAATCATATTAT CCTAACTTTGATTTCATTCTCAATATTCCGTTGTCAGCCACTGGAGTATGGTATTCCACTGTTTGGTAAG ATATGACTTTCAAATTCCCTCACATACACTACTCTGTGGTTTGCAAAAGTGG >FAMET2 FL639748, FL638947 CCCTCATGAACATTGCTCTAACATCAGCCGTAATGAGACAGAACCTATGTACGAGATTCTGCTTGGAG GCTGGGAGAACACAGCATCTGTCATTCGCTACAACCGCCAGAAACCAGACAAGGTTCGGGCAGACAC GCCTGGACTCTTGACCAACAGTGACTACAGTCGCTTCTTGATAGAGTGGCA >FAMET 2R CAGTATCTGTTGGTAAGGTCCGGCGTGTCTGCCCGAACCTTGTCTGGTTTCTGGCGGTTGTAGCGAATG ACAGATGCTGTGTTCTCCCAGCCTCCAAGCAGAATCTCGTACATAGGTTCTGTCTCATTACTGGCTGAT GTTAGAGCAATGTGTGCATTGGAGGGGGCACGAACCTCAATGTGCAGT >FAMET3 FL636743 CAGCTCCTTTATTGGAGCGCGTATTATGAGTCTGACATT CTACCTGCCAAATAGTTCCCAACAACGGCG CTGCATATGTGGCCTACGGCGGCCAAGAGCATCAGGTTTCGCATTATGAGGTGTTATGTCACGGAATT GCCATGTGGCAGACTGCAAGTGAACCCACCTCTAATGCGACCCTGCTGCACTAGGCCGACGAAGGCTA AATATGCAGCGCAGAGATAATAAAACAAA >FAMET 3R ACAGCTTTGCGTGATAAACCTAATAATGCGAAACCTGTTGCTTTTGGC CGCCGTGGGCCCATATGCAG CGCCGTTGTTGGGAACTTTTTTGGCAGGTAAAATGTCAAACTCATAATACGCCCGTCCAATGTACAGG GACCCTCCATTTTTGTCGTGTCCTCAAA >JHEST1 FL636973, FL640151, FL638979Carbx 1 TTTTCAGCTTCTTCGAGTAGTCGGTAGATTTCTTTCTTCTTGAACGAGAGCGTGCCGGAAGATCTCGTC TCCGACACGTGGCATAATGTGAGCGACTTCTACTTGGGCAGCGACCGCGTCGTTACCACAACCAATGT GCACAACATTATTAACGCAGGAACGGACCAGGTGGGGGTCGCTCACATTATGCCCGTGTCGGGGCCGG GATCTTCGGGCCCGCCCTCGTTCAGGAGGAGGAAAGGAAA >JHEST1 R AAGTTGATTGGTTGTGGTACGACGCGGTCGCTGCCCAAGTAGAAGTCGCTCACATTATGCCCGTGTCG GAGACGAGATCTTCCGGCACGCTCTCGTTCAAGAAGAAAGAAAGTCTACCGACATCTTCGAAGAAGCT ATTGAAATATTCTATGCCTTTATCGGTGCCA

PAGE 138

138 >JHEST2 FL638686Carbx 2 GAATCGACTGTAATGTTTATCGTTTGGCTCAGAGGGAAACACAGTTTATCTGAAGCACTATCGGGAAC AAACATTGATTTCGGTGCTGCCCATGCAGATGATGCAGCTTTTGTACTACAAATTCCCTATCATAACAC TGAAGAGACACAGCAAGACAAGGACA >JHEST2 R TTCTGATGAAGTGAATTTGTAGTACAAAGCTGCATCATCTGCATGGGCAGCACCGAAATCAATGTTTG TTCCCGATAGTTCTTCAGATAAACTGTGTTTCCCTCTGTAGCCAAACTGATAAACATATACAGGTGCTG AGTT GACAGCAGCTTGAATTCTGGCA >LPRS FL635452,FL636727, FL636380, FL637727, FL636288 AACCCTGCCAGTTGGATGGAGCCCAGGGGCCCTCACAAGTCCTGGAACAAATGATTATGTATAACTAG GCAAGGCTCAGCCCTAATGAGACGTCACTGTGCTGTGTCAAGTGGGCAGACTTTAGAGCAAGTGTGCT CAAGCCCTTTCTGCTGAGGTGCATCGCTCAAAGTGGTA >LPRS R CCTCCCGAGGCTTGGCACACTTGCTCTAAGTCTGCCCACTTGACACAGCACAGTGACGTCTCATTAGGG CTGAGCCTTGCCTAGTTATACATAATCATTTGTTCCAGGACTTGTGAGTGGCTCCTGGGCCTCCTCTCC AACTGTGGCAGGGTATATTCTCTGTGGCTGGTACTGGT >MEVASE 1FL639092 ACCTCTAGCAGTGTTGGCTTATAAAAATTTGATCCAGCTTTCGTTCTGAGGTAAAGTTCAGAGAATTTG CCAGTAGTCAGTATTCAGTCATGATGGTACCACATAAACATCCTCTAGCCTTCAGAGTGTCAGCACCTG GCAAGGTCATTCTTCACGGTGAGCATTCAGTGGTTCAACC >MEVASE1 R TCGTCATCCTTGCCGGTGCTGAACTCTGAGGCTAGAGGATGTTTATGTGGTACATCATGACTGAATACT GACTACTGGCAAATTCTCTGAACTTTACCTCAGAATGAAAGCTGTGATGAAATTTTTATAAGCCAACA CTGCTTATGTGTACTGTATAGGAACCGTGACCTCAGA >NADH DH F BQ788175 CTGAATCTCTAGAATCCGTTTTTGGGGGGGGTATATGTTTATATGCCTTTTACTTTTTCTTGTGTGAGGG GTTCTATTTTTGCTCTTTGTGGGGTGCCACACCGACGACTCTAACCCCTCCAGAGATTTAAAGGGGATA TCTCATAACCCCCAAAAAGAGACCCCACACCTCTA GGTATGAATGCCCACCCCAAGCAAC >NADH DH R CGACTAAAAAGAGAGTAAAAGGCATATAAACAGATAAACCCCCCATAAAACGGATATCCTGAGAATC TCCTATGAAAGAGAAACACCCCCCCCACACCCCGCTTCTTCTACTGCGCCCACCGAGCCGAAAATCAC CAGCGCGCCGCTCCCACGGTCGAGAAAACCGATATGCACACCGGCGGCATTCAACG >STERO 1FL639110, FL636382, FL635522 CCGTGACCGGGGCCCCACAGCCTGGTAAAGCTGACTGTACACTAACACTTGCTGATGAGGACATGGTA CAAATTGGATCAGGAAAGTTGAATCGACAGGCAGCATTCATACAGGGCAAGTTGAAGGTGGCAGGCA ACATTATGCTGACACAGAAATTGTCTGCGTTGCTAAGGGA >STERO 1R TTTGTGTCGATATGTTGCCTGCCCCTTCACTTGCCCTGTATGAATGCTG CCTGTGGATTCAACTTTCCTG ATGCAATTTGTACCATGTCCTCATCAGCAAGTGTTAGTGTACAGTCAGCTTTACCAGTCTGTGGTGGTC CCTGGTACACACTAGGCCTCTTAAGGTCCACAGTCCAAA SECTION 4 Sequences from Library Clones I dentified from Tartar et al. (2009) >AACTIN SP6 TAGCATTTAGGTGAACTATAGAATACTCAAGCT ATGCATCCAACGCGTTGGGAGCTCTCCCATATGGT CGACCTGCAGGCGGCCGCGAATTCACTAGTGATTCGCTCAGTCAGGATCTTCATCAGGTAGTCGGTCA AGTCACGGCCAGCCAAGTCCAGACGCAGGATGGCATGGGGCAGAGCGTAACCTTCATAGATGGGGAC

PAGE 139

139 GGTGTGGGAGACACCATCACCTGAGTCCAGCACGATACCAGTGGTACGACCGGAAGCGTACAGGGAC AGGACAGCCTGGATTGCGA CATACATGGAATCGAATTCCCGCGGCCGCCATGGCGGCCGGGAGCATG CGACGTCGGGCCCAATTCGCCCTATAGTGAGTCGTATTACAATTCACTGGCCGTCGTTTTACAACGTCG TGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCG TAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGACGC GC CCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCA GCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCA AGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACT TGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTT TCGCCCTTTGACGTTGGA GTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTC TTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATT TAACGCGAATTTTAACAAATATTAACGCTTACAATTTCCTGATGCGGTATTTTCTCTTTACGCATCTGTG CGGTATTTCACACCCGCATCAGGTGGCACT TTTCGGGGAAATGTGCGCGGACCCTATTTGTTTATTTTT CTAAATTACATCCAAATATGTATCCGCTCATGAGAAAAATTAACCTTGATAAATGCCTCATAAATATTG AAAAGGAAGAATTGGAGATTCCAACATTTCCGGTGTCGCCTTATTCCCTTTTTTTC >BTUBE SP6 CB518304 TAGATTTAGGTGAACTATAGAATACTCAAGCTATGCATCCAACGCGTTGGGAGCTCTCCCATATGGTC G ACCTGCAGGCGGCCGCGAATTCACTAGTGATTTATGGCACGCGGTACATATTTACCGCCAGATGCCT CATTGTAGTAGACATTTATTCTCTCTAGCTGAAGGTCGGAGTCACCATGGTAGGCGCCAGTTGGGTCG ATGCCGTGCTCATCAGAGATGATCTCCCAGAACTTAGCACCGATCTGAATCGAATTCCCGCGGCCGCC ATGGCGGCCGGGAGCATGCGACGTCGGGCCCAATTCGCCCTATAGTGAGTCGT ATTACAATTCACTGG CCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATC CCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGC CTGAATGGCGAATGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAG CGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCT CCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACG TTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGG CACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGT TTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACT CAACCCTATCTCGGTCT ATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAAT GAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGCTTACAATTTCCTGATGCGGT ATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATCAGGTGGCACTTTTCGGGGAATGTGCGCG GAACCCCTATTTGTTTATTTTTCTAATACATTCAAATATGTATCCGCTCATGAGACATAACCCTGATAA TGCTTCAATAATATGGAAAAAGAGAGTATGAGTTATTCACATCCGTGTCGCCCTAATTCCATTTTTGGC CGCAATTTTGGCGCT >CEL2 R24DQ014511 CTACCATTAGGTGAACTATAGAATACTCAAGCTATGCATCCAACGCGTTGGGAGCTCTCCCATATGGT CGACCTGCAGGCGGCCGCGAATTCACTAGTGATTCAACTCATCCCATCGGAATCCCACAAAGAAAACA CAACAACATGACCTTTTGAAAATGTTGATGTCATGTTCTGCTTTCCAGAACATCGAGTCTGGTTCAAAA CTCCACCATCAATTGGATTGCCGTTTTGAATGTACTTCCTTGTAACATCCCCATTGGAATCGAATTCCC GCGGCCGCCATGGCGGCCGGGAGCATGCGACGTCGGGCCCAATTCGCCCTATAGTGAGTCGTATTACA ATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTG CAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAG TTGCGCAGCCTGAATGGCGAATGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTT ACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTC TCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGG GGGCTCCCTTTAGGGTTCCGATTTAGTG CTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGA TAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGA ACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGT TAAAAAATGAGCTGATTTAAC AAAAATTTAACGCGAATTTTAACAAAATATTAACGCTTACAATTTCC TGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATCAGGTGGCACTTTTCGGGGA ATGTGCGCGGAACCCTATTTTGTTTATTTTTTCTAAATAACATCAAATATGTATCCCGCTCATGAAACA TACCTGATAAATGCTCATAAATATTGGAAAACGAGAGTATGAGTAATCACATTCCGGTATCGCCTTAA TCA TTTTTGCGGCATTTGACCCTTCCAT

PAGE 140

140 >HEX 1R24AY572858 GCGGCATTAGGTGACCTATAGAATACTCAAGCTATGCATCCAACGCGTTCGGGAGCTCTCCCATATGG TCGACCTGCAGGCGGCCGCGAATTCACTAGTGATTGATCCATTCCACAAGCACGGGCTCGCACCCAGC GCCCTGGAACAACCCGAGACAGCCCTGAGGGATCCCGCCTACTACCAGCTGTACAAGCGAATGTACCA CTTA GTCAATAAGTACAAGGACAGGCTGCCTCGCTACACGCACGAACAGCTTTGGTTCGAAGGAGTGA CGGTGAATCGAATTCCCGCGGCCGCCATGGCGGCCGGGAGCATGCGACGTCGGGCCCAATTCGCCCTA TAGTGAGTCGTATTACAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTAC CCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAA GAGGCCCGCACCG ATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGACGCGCCCTGTAGCGGCGCATTAAGCG CGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTC GCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTT TAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCC CAAAAAACTTGATTAGGGTGATGGTTCACGTA GTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGAC TCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGATTTGCCG ATTTCGGCCTATTGGTTAAAAAATGAGCTGATTAACAAATTTAACGCGAATTTTAACATATATTAACGC TTACATTTCCTGATGCG GTATTTCTCTTTACGCATCTGTGCAGTATTTCACACCGCATCACGTGGCACTT TGCGGGGTAAATGTGGCGCAGGAAACCCTATTCGCTTATTTGTCTAAATACAATCCAAATATGTATCC GCTCATGCAGACATGACCTGATAATGCTTCATTAATATGGAAAAGGAGGTTGAGATTCGACATTCCAG GTTCGCGTATGCCTTTATTTGCCGCGACATTTTT >HMG_COA M13R FL638074, FL637763, FL638896, FL640394, FL638646 TCTCTGGCCCCCGCGCCAACGAAGGTCTAGAAAGCTTCTCGAGGGCCGAGGCGGCCTTTTTTTTTTTTT TTTTTTGTGTACATAATAATAATTTAATGAACTTTTTATATGCTGAAGAATGTTTCTCTGTTTAATAAAG CAACAATTTCTATTGATTTGTGCACATACACATTTCACACCCATCCATTCATTCATTAAGTCTCTTGCTG AGGTAACCTGACCA CACTCCACAGTGCAGTATGTGTCGTCGGAAGTACCAGTTGTGTGCCAGACAGCT GAGGGCTTCAGGACTTGTCCTTACAGACAGCAGGGCTACTTGGCTCAGTGCCTGATGTACTCACTGAT GCCCTGTTGTGCTGTAAGTGGCTCTTCACTAGATGACCTGCTGCCAGTGCTGACATGAGTGAAAGCTCA CCAGCAAGTACAGTTCCACACACAATGCGGGCCAACCTGTTGGCATTCTCTCCAGGGCACAGCTT ATT TGCTCCTCGCACACCAAGCATCTCCAGACATGCTGCTTGTGGTGGCAACACTGTGCCTCCACCAACAGT GCCAATCTCTATAGAAGGCATTGTGCAGGACACGTAGAGGTCTTGGCCATCTTCTCCCCAAGGCTCCA TCAGTGTCATGCAGTTGCTACTGCCCACATTCTGGGCTGGGTCCTGTCCTGTTGCAATGAAGATGGCTG TCACGATGTTTGCAGCATGTGCATTGAAGCCCCCAATGCTGCCAGCAACAGCTGAGCCAATCAGGTTC TTGGTAATATTCACATCCACCAGGGCATGTACAGTAGTCTTAAGAATCGAGCTCACCACATCTGCTGG CACAATAGCCTCACACACCACACATTTGCCACGCCCCTCAATCCAGTTGACAGCTGCAGGTTTTTTGTC TGTGCAGAAGTTGCCACCTGAGACTCAGTATTTCCATGTCTGAGATGTCTTGCACGAACCCCCAGTGCC ACCTCCGTGCCCTTGGAGAGCATATTCAT TCCATAGCATCACCTGTTGTAGCTACAAAGCGGATGANA AATGGCGACCAGCAATACCGGATGTTGAGTCCGGNNAGCGGCAACGACTAGTGGNAGTTAAACCTTT CCTTANGCTCCAAGTCCTGAAGTTCTGCATTCNAGCATNCNTACTANCTNCTGAGTNAGNANTCNNNA CAGNNCCACGTGTCATGNCATCANNNCAG >MYOSINSP6 CB518305 TCCCCATTAGGTGCCCTATAGAATACTC AAGCTATGCATCCAACGCGTTGGGAGCTCTCCCATATGGTC GACCTGCAGGCGGCCGCGAATTCACTAGTGATTTCTTCCAGTTCCTGCTGTGCTTTGCGGAACTTGGCC AGATTCAGGGCTGCAATCTCCTCCGCCTCCTCGATCTGCCTCTTGTATGTCTTAATCTTCTGTTGTAGTT TGTCAACTAAGTCTTGCATACGCTCATGGTTCTTACGGTCTTCTTCACCCTGGAAGCTCAACTCCTTGA ATCGAAT TCCCGCGGCCGCCATGGCGGCCGGGAGCATGCGACGTCGGGCCCAATTCGCCCTATAGTGA GTCGTATTACAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACT TAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCC CTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGG GTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCT TCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTT CCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGC CATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTT CCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTC GGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAAATTTAACGCGAATTTTAACAAAAATATTAAC GCTTACAATTTTCCTGATGCGGTATTTTTCTCCTTTACGCATCTGTGCGGTATAGCACACCGCATCAGGT

PAGE 141

141 GGCACTTTTCCGGGGAAATGTGCGCGACCCCTATGTATCTCCTAATACATCCAAATATGTATCGCTCAT GAGAACATACCTGATAAATGCTTCAATAATTGGAAAAAGGCGGAGAATTGAGTTATTTCCAACAATTT CTTCA >NADH R 24BQ788175 GTACCATTTAGGTGCCTATAGAATACTCAAGCTATGCATCCAACGCGTTGGGAGCTCTCCCATATGGTC GACCTGCAGGCGGCCGCGAATTCACTAGTGATTGGCATACCACAAAGAGCAAAACTAGAAACCATCA AACAAGAAGAAGTAAAAGGCATATAAACAGATAAACCCCCCATAAAACGGATATCCTGAGAATCTCC TAGGAATGAATAACACCCCCAGCAATCGAATTCCCGCGGCCGCCATGGCGGCC GGGAGCATGCGACG TCGGGCCCAATTCGCCCTATAGTGAGTCGTATTACAATTCACTGGCCGTCGTTTTACAACGTCGTGACT GGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAAT AGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGACGCGCC CTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTA CGCGCAGCGTGACCGCTACACTTGCCAGCG CCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGC TCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGA TTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTC CACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTT GATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAAC GCGAATTTTAACAAATATTAACGCTTACAATTTCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGG TATTTCACACCGCATCAGGTGGCACTTTTCGGGGAATGTGCGCGGAACCCCTATTTGGTTTATTTT TTCT AATACATTCAAATATGTATCCGCTCATGAGACATAACCCTGATAAATGCTTCCATATATTGAAAAAGG AAGAGTATGAGTATCAACATTCCCGGTGTCGCCTTATTCCCTTTTTGGCCGGCATTTTGGCCTTCCTGAT TTGCTCACCAGCAACGCTGGGTGAAAGTAAATATGTCCTCTGAAGAATATCCACT >NANOS SP6 BQ788190 TCGCTCCGAATAACCCTCCTAAGGGACAAAAGCTGGAGCTCCACCGCGGTGGCGGCCGCTCTAGAACT AGTGGATCCCCCGGGCTGCAGGAATTCGGCACGAGGCAGTGCCCAGGTAATTATTGAAGCTCATCTTT TATAATAGTACAGGATGTTTGAACAACAGTGTGTAGTTTGTAACCACTGACTAAATGTATGGGTGTTA CATTTGAATGTTTTTCCAGTTTCCTTCATTTTTTCTACCTTTTATAGGTGGCATGTAAGTGTATAGAAAA CACAGAGTGTTGAGGCTT GAAGTAAGATACATTTTTTGGATGGTGGAATTTTTTCTGTGACTTTTCATT GCAGTCACTTAGTATGATTTGTTTGTATTGTAAGTAGACACGAACACAACCAGCCACAGCAGATTCAT GCCAAAGCAGCGAGAAAGCTCCATGAGGTTCTGTGAGAGTCATGACCCTGTTTCAGATGCCATTTCTG TTGAAGCCAGAGAAGGCAGCAGAATTTTAAGTGGAAGGGCTCAGAACTTCAAAAGATTGGTAGCTTC GAAGTCAGTGTCTTCCAGTCAGTCATTGAACAACACTGTAAACAGAAGCGACAAGTGTTCACTGGGAA CTCGGAAACATCGAGAACTGGAGGACTTTAAAGGAGAAACATCGAAGCAGAGAGGATATGTCGGTGT TCCATTTGACATCTGTGACAGTGAGGATGAACTGCTGACAGGCATGCCAACCGACATCAGTGTCCGCA ACCCTGGAACGTATAGTCCTCTGTCCGTTAGACGTGCAGCTTCTCCAGTGCAATA CTTCAAGTCTGTGC TTGGCGTGGAGGACAAAGCGGATTCACCCAGGCCTGTATTATCTCCTTGGCAACAACACAGATGGAAA GATATAGACAGATTTGTAAAAAGACAACAGACCATGGAAGGGAATATGGGAGAATTCAGTCCTAGAA CCAACCCACTGGACAGAGGCTGATAAATTTGGAACTGCAAATGATCGCATCAGTCCAGTTTTCACCGG TACAGTTGATGTTGTAGAGACAAGCATCCTCTTTTGATGAGAGATCTCTCAGTTCGACTTTTCACTGCA GAAGTAGAAAATAATGTATTTATTCTGTCGATCTGCATCATGAGACAACTGGCTGAATTTATCTTCTTT ATTTGCACATTGAACCCAATCTCTAACAAGCT >P450CYP2V1 R24 DQ279463 CACCATTAGGTGCCCTATAGAATACTCAAGCTATGCATCCAACGCGTTGGGAGCTCTCCCATATGGTC GACCTGCAGGCGGCCGCGAATTCACTAGTGATTTCATTCAAAGTTCTTCCAACACCAGGAACACTGGG ATATAATCTTAGGGTCTCCTTGATGACCATCTCAAGGTACTTCATCTCACTGAGGTCTCCCATCGTGAC AGAGCGATCGGACCCCTGGAAGATGCTTTCCTGCTCCTGGTACGCCTTCTCCTAATCGAATTCCCGCGG CCGCCATGGCGGCCGGGAGCATGCGACGTCGGGCCCAATTCGCCCTATAGTGAGTCGTATTACAATTC ACTGGCCGTC GTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGC ACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGC GCAGCCTGAATGGCGAATGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACG CGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTC CTTTCTCG CCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTT TACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAG

PAGE 142

142 ACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACA ACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAA AAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGCTTACAATTTCCTGA TGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCCGCATCAGGTGGCACTTTTCGGGGAAA TGTGCGCGGAACCCCTATTTTGTTTATTTTTTCTAAATACATTTCAAATATTGTATCGCTCATGAGACCA ATACCCTGATAAATGCTTCAATAATATTTGAAAAAGAAGAGTATGGAGTATTCAACATTTCGTGTCGC CCTTTATTCCTTTTTGCGCATTGACTTGCGTTTGGCCTAACCGGAAAAACGGCC >TRORF1 SP6 CB518302 TAAATTTTAGGTGAACCTATAGAATACTCAAGTCTATGCATCCCAACGCGTCGGGAGCTCTCCCATATG GTCGACCTGCAGGCGGCCGCGAATTCACTAGTGATTCTCTCTTCCTTGCCCTCCTCCTCCAG AGAGCTT GCCTTCTTCTTGACAACCTTGAGCGGGGAACAACCGTCGAACTAATTTCCTTCTTCTGCCTGTTGGCGA ACTTGTTCTCATACATGGACACCTTCTTCAGGGGGGGAAGGTGGCATTTACCAGCAAGCGAAACCACC AGACGGTTGAGGTGAAAGATCTCCAACGCTTTTTGGCCACTCCAGGAGCTAGAAAATCACCAGTGAAC AATCCGCCGCCTGCTGGTGGACCACCATGGAGAGCTCCCCCCCCACCCGCATGCAGCGCTCGCGTATC CTATCGATCGCCCCTACCTAGATAGCCCGCCGCCACGCGCGTACCTCGCTCCCCCCCCCCCCCCCCCCC CCCCCC >TRO RF 2SP6 CB518303 TAAATTTTAGGTGAACTATAGAATACTCAAGCTATGCATCCAACGCGTTGGGAGCTCTCCCATATGGTC GACCTGCAGGCGGCCGCCCAATTCACTAGTGATTGAAGAGTTGAAGAAGGAGCAGGAAAGGAAAGCG GCCGAGAGGAAGAGGATCATTGATGAACGTTGTGGCAAGCCCAAAAGTGTTCTAGATGCAAATGAAG CTCACCTCAAGAAAATCATCAATGCCTACCACAACCGCGTCTGAAAGCTAGAGGCCGAAAAATGCGAT CTAGAACACGAAGTGAGCAAGAAGAACTGGGAGATCTCTGACCTGAATAGCCTGGTGAAAAAATCGA ATTCCCGCGGCCGCCATGGCGGCCGGGAGCATGCGACGTCGGGCCCAAT CGCCCTATAGGAGTCGTAT ACAATTCACTGGCCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGGTACCCCACTTAATTCG CTTGCAGCACATCCCCCTTTTCGCCAGCTGGCGTAATAACCAAAAAGCCCCGCACCGGTCCGCCCTTTC CAAACAGTTGGCCAGCCTGGATGGGCGAATGGCCCCGCCCCTGTAGCGGGCGCATTAAGCGCGGCGG GTGTGGGGGGTACGCCGCAGCGTGACCCGCTA CACTTTGCCCAGCGCCCTAGCGCCCGCTCCTTTTCGC TTTTCTTTCCCTTCCTTTCTCGCACGTTCGGCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTT AGGGTTCCGATTTAGTGCTTTACGGCACCCTCGACCCAAAAAACTTGATTAAGGGTGATGGTTCACGT AGTGGGCCATCGCCCCTGAAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGA TCTTGTCCAACT GGAACACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTGCCCGAT TCGGCCTATTGCTTAAAAAATGAGCTGATTAACCAAATTTAACGCGATTTTAACAAATATAACCGCTTA CATTCCTGATGCGTATTTCTCTTCCCATTGTCCGATTTCCACACGCATCAGGTGGACATTTCCGGCAAT GTGCCGCCGACCCCTATGGTATTTCTAATACATCAATGTATCGTCATGAACACTAAACCT GTATAATGC CCTTCCATACATAC SECTION 5 Sequences from Library C lones I dentified from Tartar et al. (2009) >TG_14_C6 AAAATGGGACCATACTATACAGCGCGAATGAACATGCAAGACAACGAGATGATGTCAATTACCGGTT ATGAAGAACAAATGCTTTATTTATACTTTATATGAGCACCCAACTACATTAGTCCGATGTATCCTTGCA AACTTAAAATATTCAAATATAAATTTGGGCCATACTGAGAACACACAATTATTTGAACATCATTCTCCA CATAAAATGGCCGATAACATACACTGTTCCAAATTTTCATTTTGGAAATTT ACACTGGTATATTCAATG TGAATTAAGACTCAGAGAATACTCATTGTAGCTTTCCTTTTCTGGGCCCCCACATGGAGCTGTTATTCC TGTTCTCAACACTCCTTTTTTTCTCCATTCTCACGGCCAGTCTTCATTGGCTTGTACCTTTATTTCACTCG AAACTTCAAATTCTGGCACAAGCTCCGCATCCCATACGCGAAACCCACACCGTTTGTTGGCGCCTCTTA GGGAGTGTGTCTTACAGAAAGTAAATATT GGAAAACATCTCCAGAGAATGTATGACGAACACAGCGA CAAGCCTTATGTCAGAATTTTCTCGTTCGATAAGACCAGTTTGTTGATCCGTGACCTGAAGCTGGTGAA GAATATTCTGGTCAAGGA >TG_07_B9 CAAGCCGTACACAATCCCAGGCACCGATGTGTTGATCGAGAAAGGGACTCCGGTCATCATCCCGATCT ACGCGATCCACCGCGACCAGCTCTACTATTCGGACCCCGACAGATTCGACC CCGAACGCTTCACAGAG TACAATAAGGAGAAGAGACCTGCCTACACCTACCTGCCTTTCGGGGAAGGCCCCCGCATCTGCATAGG

PAGE 143

143 TCTAAGATTCGGTTTGATGCAGGTGAAGATGGGACTTGCTATTTTGGTGTCTCGCTTCCAATTTGATAT TTGCGAGAAATCTGAAGTTCCCCTAATCATGGACCCAAAGAAGTTTGTAATGAACACATTTGGAGGAC TGTGGCTCAAGATAACTCCCAGGACACAGTGAAT GTCTCAACTGTGATCCCCTTTCGAGATAAAACTTT GAAGAATCGTTACTATAATTATCATTTTGTATTTGAAACGTGGTAAAGACAGCAAAATATTCTCCAAA GCTGAAGTACACATTCAGTTTTATAGTGTTCTAACGGTGAGTACCATTAGCTATAGGGCTTCTTCCAAC ACCAGTAGTTAAAAATACAAAAATTGAACACAGTCTGTCCCTCAAGCACTGTCCCTTACTTTTTGTGTT CTTGAAGACTGATTGATTGAAAAATGTAATATTTGAGTGGTGTTAAATGAAGCATATATATTTTATGGC CTTATGTTCATTTATTTCAGATAAAAATGCATTTTAACAAGGCCTATTTGA >TG_14_C1 CATGCCTTCCCTCGTGTTGAGTACTTTGGAAAAGTATTATCCACGCGCAGACAAATTCATTCCAGAGCG GTGGATAAAAGGCGACCCTCAATACAACACGAAGACGCACCCTTTTGTTACAATGCCATTCGGTTTCG GC CCAAGAATGTGTATTGGGAGAAGATTCGCTGAGCTAGAGATTGAAACTTTGGTGACAAAGATTATT CGTAACTTCATGGTTGAAATATACTATGAAATGAAGTTC >TG_16_H8 AGAAATTTCGTCCTTTTCCGATGAGCAACTGAAAGTTATAGGCATAGATTTCTTGTTCCCTGCCTCCAC CACAGTGACATCCACCCTCAACTTCGCCATGCTGTTTCTGCTTCATTACCCTGAGGTACAGACTAAGAT GCAGCAAGAGCTGGATGCAGTAGTGGGACGTGACCGTCTGCCTACCTTGGATGACAGGGCAGGGTTA CCATACAATGAGGCATTCCTGAGAGAGGTGATGCGTAAAGAGGCAGTAGCT CCATTGGCTGTGCTTCA CAGGTCCACAGAAGACACTGAACTCGGCGGCTACAACATTCCCAAGGACACAGTGATGATCTTGAACC TGTGGAGCTTCCATAATGACCCCAAGTTCTGGGGTGACCCAGAAGTATTCCGCCCTGAGAGGTTCCTT GATGAGAAGGGCCACCTGCTCAAGAAAGACTACTCCTTGCCCTTTGGAGCAGGTAAGCGCCTGTGTGC CGGAGAGACATTCGCTCGTCACATCATGTTCCTGATAGTGTCAGCTCTGCTGCAGAACTTTACTGTCAA AAGAGCTCCAGGGAAACCACTGCCTTCCATGGAACCTGATCTGCCTGGTGTCATCATCACCAAGAAGG ACGTGCGGATGAAGTTTGAGCCCAGGGCTTGACACTGTCCCACACCACACTACAGGCTTTTGTTTTGCG GTCAGAAAGGGTAAAAACTTGGAGTGGACGTAAAGATAATTGCCAGGGATCCCTGCAGTGTGAAGAT GGCAAGACATGGAAAGCAACATCTTGCGACTGGATGAACTTCATAAA >TG_20_B8 TCTGGATCTGTTGATAAAGGCTTCAGAGAACGGTGCTGTACTTTCGAAAGAAGATATCCGAGAAGAAG TAGATACATTTATGTTTGAGGGCCACGATACGACCTCTGCTGCCATCTCTTGGGCTCTCTTCTTACTAG GTGGTCATCCGGACATACAGAAAAAAGCTATGGACGAAGTCGATGGCATCGCAGGTCCGGACGAGGA GTATCGCTTCA CCATGAGGGACCTAAACGAAATGAAATACCTGGAATGCTGCATAAAGGAAGCCCTGC GGCTGTACCCCAGCGTACCTGTCATCGCACGCAAAATCGGCGAAGACATCAGCATCGCCAACTACACC GTACCTGCCGGTACTACAGCTCTCATCCTTACGTATATGCTACACCGCAACGCAGATTTGTTCCCACAG CCTGAACAGTTTAACCCAGACAGATTCTTGCCAGAGAATGTGTTGGGCCGACATCCTTATGC CTATATC CCTTTTAGTGCAGGACCCAGGAATTGCATAGGTCAGAAATTCGCCTTGCTGGAAGAGAAGGCAGTGAT TTCTTCGTTACTGAGGAAGTACAGAGTTGAAGCTGTGGATAGACGAGAAGATCTCACACTGATGGGAG AGCTCATCCTCAGACCTAAACACGGACTAAGAATCAAGATCTTCCCAAGGACATCGTGATTTTCTCTA GTTTGATTTCTTTGTGATAGTCTTCTACAGCGTATTTTAGTT > TG_23_B10 CAGTAGCATATGCTGTATTCACGGGACAAGACAGAGAGAGACTAGTCGGTGGATTGAAGCAGCAGAC ACCGGTTACAATGGACCCAGTCACAATCCTGCTAGGAGCCCTGTTCTTTATAGCGCTGTTCTTCCTGCT GACTGGCGACAAGAAGGAAAAGGAAGTTGCCAGGCGCGTAAATAAACTACCTGGACCAACAAGCTAT CCCATATTCGGCACGGCTTTGCCCTTAATGTTTCTCAAGAGAAAGGATTTATTCAATAATTTATTAATA ATCCAAGAGAAGTTCAGCCCAATCTTCCGCACGTGGACCGCCAACAAGCCACAGGTACACCTTCTTCA GCCGGAAGATGTGGAGGTGATACTTAGGAGCAGTGACCTTCTTGACAAAAGTCAGATTTACGAGTTCA TGCGCGACTGGCTCGGTACAGGCCTGCTGACATCTACAGGAGAGAAATGGCACACCCACAGGAAGAT GATCACACCGACCTTCCACTTCAAGAT ACTGGACAGCTTCGTGGAAGTGTTCTCGGAGAGGAGCGAGA TCCTGATCAGCAAGCTGCGGAAGGAAGTCGGATTCCAGGGCTTCAACATCTATCCTTATATCACCAAG TGCACGCTGGACATCATATGCGAGACCGCCATGGGTACGCCGATACATGCTCAGGACGACACGGAGTC GGACTACGTGAAGGCTGTCCAAGATATGGGTGAAATCATACTGCATCGCATGTTCCATCCGTGGTTGC ATCCTGATTTC AT

PAGE 144

144 >TG_29_F10 TACAATATCAGTAAAGAAGGTAATTTGCTTATTCTGGAACTGAAGGACATATACACAAGATGCACCAC AGACATGATTGCCACAACAGCATTTGGACTTAAGGTGGACTCCTTACAACAGCCAACTAACAAATTTT ATGTGATGGGAAAAGACGCCACCAATTTTGGTCCACTGAAATGGTTTATGGTGTTGGCGCTACCAAGG GTCATGGAGCTGTTGGGCCTTGATCTTGTACCGGGAAAGATCACGGAATTCTTCAGGACATTGGTGCT CGACACAGTTGCCACACGCGAACGAGAAGGCATCGTCAGACCTGACATGTTGCAGCTGCTGATTGAGG CTAAGAAAGGAACTCTACATGACGAGCACTCTGGAGAGCATCAGAAGAGCGCCAAAATCAAACTGGA TGATGAAGACATTTTATCTCAGGCCCTCTTGTTCTTCTTGGCGGGCTTTGACACTGCGTCCACACTTCTG TGCTTTGTCTCTCACCAACT GGCCACACATCCGGATGTACAGAAATGTCTGCAGGAGGATATTGATAA AACGCTGCAAGAGCATGGTGGCAAGTTCACATATGAGGCTGTTCACAGCATGAAGTACCTGGACATGG TTGTGTCAGAAACTCTCAGGCTGTACCACCAGGAGCTGCCGTGGGACGCCTTTGTGTTCAAACTACAC ACTAAAATCCAACCCTCCACT >TG_37_B8 AGTCGCGGTGTTAAATTCGGTACAGAAGTATAAGCAGCAGTAAGAGGCATTACGTGAGTTGTGAACA GTTCTTACAGAAGACACAAGCCGATCTGACTACCAACCACAATGCTCGACACATCACTTCTCCCGCTG TGGGTTCTCTCAGCAGTTGTACTGACTGCCATCTACGTGTACTTCAAGGTGTCTTTCTCATACTGGAAG AAACGTGGTGTCCCCAGTTTGAATCCTACACCTCCTTTCGTTGATATTGGCGCTGCAATATTCAAACGA AAGAATGTTTCACAACTAATCAATGCAAGTTACAAAGAATTTGATGGAAAGAAATTTGGTGGATTTTA CAATTTCACTCGCCCAGTGCTCATTGTCCGAGACCTTAAAGTTATAAAGAGTATTCTGGTCAAAGATTT CGACAAGTTTCACAGCCGCGGAATTGTAATAAATGAAAAAGCGGAGCCACTGCAAGGTCATCTGTTTA CCTTGTCCGGATCAAAATGGAGGAACCTCAGAGTTAAACTGAGTCCAACATTCACATCCGGGAAGATG AAGAT GATGTTTGGCACATTTATGGAATGTGGGAAAGAGCTCCAGGAGTGTCTTCAGGAACCTGCTGA TAAGGGGGAAACAATAGAGGTAAAAGATATCCTAGCAAGATATAGCACAGATGTCATAGCTTCTTGT GCGTTTGGGATTCAGTGTAACTGCTTGAAAAACCCGGACGCTGAATTT >TG_14_B1M13R CCACTGGCCCCGCGCAACGAATGGTCTAGAAAGCTTCTCGAGGGCCGAGGCGGCCTTTTTT TTTTTTTT TTTTTTTAAAGGTATAATGATTTACAATATATTATTTTTCCACAGTTTATAACAAACATAACAAACTTA ACAAACTTTCAATCTTTTGCTGCAATATTAATTGGTAACAATGATAAATAACATGAGGAAGATCACAC ATATTCACAGTTTTGCCATTAATTATTTTGGAATAATGAACTTACATACATAATCATCCTAAATGGTAA AGCTTTTCACACAAAGGGCAGAAGATCCCAAAACCAGTGAAG CCTTCAGGCCGTCTTAATTCATTTTC ATTTTACAGTTGTTAGTATGTCCCCACCACTTTTAATGGTTAAATACATGGAGCATTCTCCCATAACTG CATTACCCAGAAGTGAATTGCAGAACAATAACCAACTTATAAACAAGTCTCCAAGAAAACAGAGACA TCAGATATTCGTTTAACTGTTCTGTCTGCACATCCAGAACATTTGAACCACACACAAATCACATCCTCC TCTACTAAAAAAACTAATCAAGGCC ATAACAGGTTGGCAACACGAGGCATCATGAGGCCCATCACAA CTGTCGAGAGGAGGTTAACACTGTGATTATCCAGTATCTGTACCCCACTGACATGGCGAATGCCCTTTC CAGCATGCTCCACAATACAGCCAGTCTGTTTATCTACACCTGAAAACTGAAGTGTTGCTCCAAGGATG GAATCCACCAGGCTTCCAACAAGACCAGCAAAAGATCCTGCAAACACCAGTGGCCACTGTGGGGGGC TAGTTGCCAGAACAGATGAATCAACGAAGTACAGAACAGACAAATAATATGAGAAATGAATAGCTGG TCAGGGTTAATACAAACCCCACAAGGGAAGCCAAGGATAGCACCGGAAAAACCAACTCTCTGCGACA CCCCCACACAGAAATGCAGTGGAGTATATAGAAACAGCCACCTTGTGGAGGATACAAACATCTCACC ATGACTGTATTTGCACCTTCTGTGAAATGAANTGCNAANCNAATCCATGATCNTGAGGNCATGCA CTG CAACNAACCTGGNACANTNNTNCTGGGNNNNTCATCTCCGTCAGNGTANNNN >TG_18_E6M13R TCACTGGTCGGCGCCAACGAAGGTCTAGAAAGCTTCTCGAGGGCCGAGGCGGCCTTTTTTTTTTTTTTT TTTTTATTCTGCGACTGTTTATTTCAGCAAGTGTCTGAATACTCTCATAAAATAGTTAAACAGATTACA GCAATGATTGGTTGACATTGATGATATATGTCCCTATTTCCATAGGTTTCAATGTCGCAGCTCTGGTTT CAGGACCGTACCATGCCCTTTTATCCTTTGCTGTGTAGCTAGTAGATTTCCAAACCAGTTTGTTTACATC TTCGACCCACTGGTTGCCCGCAAGCGTTGTCATACGTGTGGAAGTGACATTAAACGCTCTAAATAAAT CCTCATATGCTACTTCAGCAGGAAGTGATAGTACTGAATCTTCGTTTTCTTCCATAATATGTTCCAGTCT TAGTAGCAATGTCTTTTCCTTCCAC GGTTCCAAAGTTAGTATTTGGACATTTATTGGGAGACTTTCCTTG AGCCCAGAGTACTCCATGCTATAGTTAGCTCTCCAGCCCTCGAAACTTGTCCCGCCCGGTGAGAAGAA GAGCCAGGGAGACAGATGCTTCCTCTTTGCTAATTCTCTCTCCTGGGCCGCCATATTCGGACTGTCCCC

PAGE 145

145 TTTGATAGCGCCGGCCATAACATAGTGCCGCCCTCTTGCTACCAGACCTTTCCCGAACGCTGTCTCGTT CAGTG CTTCTCCCACTCCGAAATAATCATCGTTCAGAAGTCTTCGGTGAACCATGAGTTCCACTTGGCC GTCATTAAGACTTGAGCCACCCTGAGGCCTATCATTCAACACTGCCAATTCCTGTTGCCTTGTAGTGTC TCTGATCAAGATCTTCGAAGTTACTGGGTAATAGTTTCCTGATTCTGGCTCGGATAGTTGCACTTTCCC ACGTAGGTCGGTAGTTTCCTCTTACGTTCAAGAAGTTTCCCGTCCATTCGAGTC CCCGGCCGTAATGGC CCGAATTCCCGGGCATATGTCCGGTACCGTCGACTGATAACTTCGTATAATGTATGCTATACGAAGTAT GCGCNNNTNTCGCTCACTGACTCGCTGCGCTCGTCGTCGCTGCGCGAGCTAGCGCCTNTAGTGAGTTC GTATTACAGATTNACTGGNCGTCNTTNCANCGCNTAAGNNNNNNNNNNCNCANNATCAGGNNACGCC AGNAAAGAAACCATTGTTN >TG_14_G12M13R ACCCACTTCAATACCCTGGCCCGCCCCCCAACGAATGGTCTAGAAAGAAAATCGAGGGCCCCCCGCGG CCTTTTTTTTTTTTTAAATTTTTTCTTGGCCCCGGCGCGTCCCGCTGCGCGCG >TG_18_D7M13R TCCTGGCCCGGCGCCAACGAATGGTCTAGAAAGCTTCTCGAGGGCCGAGGCGGCCTTTTTTTTTTTTTT TTTTTTTTTATGGAAGAAAGAAAACATTTAATTCTGCATTGTAACGCAAACGGTGCCACAACATATCTA TTATATTAACAATTGCTCAAATTCAGTATTTTCTGGATGCAAGTTATTCCTTGAAGCAGATTATATTGA TGTGTAGAACAGGCTTTATTTAAACCTGTTTGGCAGACCCACTGAAGCAAACCTCTCATGCTGCTGTTA TTGGTTTTCCTTAAGGGGCAGTGAATCCCAGAGGTCCATGCGATCCTTGAATTTGTCAGGAACCACACT GATACGTAGTGGCCTGACACCATAAATGGGTTCGGCTGGGGGTGGTGAATGATCGAAAACGTAGTAG GTTATGGCATCTTTGTTGGCTCCGGCCGTGGGCCACACGACGCCTTGCGGAGTTGGAGTTTCTGCTTCA GGCGTCGGGTTTCCGTGTGTAGCAAAATTTGTCCACAAGGTGACCAAGTCTTCAACCGTCTCTAGATCA GGATGTCCAGGCTCCCATCTGTCGGCCGTGAAAGCGGACGATAAGATAAATTCCAATTCATCTACATG GGCAACGCCGAGATCATACCGGGTGTTCCCATACCGTGCCTTTGGCAGTAAGCTGTATTTACCACGGT AGCCCAGGTTGTAGAGATATACTGTGTCGTGGCCTGACTGGAGGTGTAGTTCCACAGACTTCTGTATAT TATGCTGCATGAACCGGTCCGTTCCTGCGTTAATAATGTTGTGCACATTGGTTGTGGTAACGACGCGGT CGCTGCCCCCCCGGCCGTAATGGCCCGAATTTCCCGGGCATATGTCCGGTACCGTCGACTGA TAACTTC GTATAATGTATGCTATACGAAGTTATGCGGGCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTT CGGCTGCGGCGGGGCTAGCGCCCTATAGTGAGTCGTATTACAGATCTACTGGNGTCGTTTACACCGCG TAGGCGGTAATACGGTTATCCANNAATCAGGGNNACGCAAGANGAACNTTNAGCAAGCCAGCAAGNC AGGACCGNANGCCGNGCTGGNNTTTCTNNNTCGCCCCTGNNNNNATCCCANATTGGNGAGGCN SECTION 6 High Throughput Array Genes Sequences >1r C04CoxIII DQ001073 CTTCAATCCAAAGTGGTGGTTTGATGAGAAGTGTAGAGTGTTTGTCGTAATAAGCATGTGGTTAAGAA TGTTGTCCGATAATTACGTGAAGTCCGTGGAATCCTGTGGCTATGAAGAAGGTTGATCA >1r F02Cel 4DQ014513 TCCGGCGCATGGCGGCGCGGGAATCGATTCTTCGAGCAAGCATGAACTGTGTACGCCTGGGAAACTAA GTTGCCTTCCCAAATATCCATTTCCGAACAGCATGTTCCAAGCTTTCCATTCCCTGAATTTTCATCATTG TCCTGTGGCTTCA >1r F01Cel 3DQ014512 GCGGGAATCGATTGCTGGAAACACAGGACAATGATGAAAA >1R E12 Cel 2DQ014511 CGGCGCGGGAATCGATCCAATGGGGATGTACAAGGAAGTACATCAAAACGGCAATCCAATTGATGGT GGAGTTTTGAACCAGACTCGATGTTCTGGAAAGCAGAACATGACATCAACATTTTCAAAAGGTCATGT TGTTGTGTTTTCTTTGTGGGATTCCGATGGGATGAGTTGA >1r E11 Cel 1AY578262 CGGCGCATGCGGCGGGGAATCGATTATGAGAGCAGAATTGGCAGCATGTCGCAGGGTACCCCACT GG TCGATGTATACGAGACCCTTGGGTGTCTTCTTCTGAGACGAAATCAAGTAATCGACGTAGCCTTGTACC TTGTCCTTGTATGCCTGCTTGCTTGTGAA

PAGE 146

146 >1r E09 TO F BQ788174Deviate TTTCGCAATGATAGGAAGAGCGACATCGAAGGATCAAAAAGCGACGTCGCTATGAACGCTTGGCCGC CACAAGCCAGTTATCCCTGTGGTAACTTTTCTGACACCTCTTGCTGGAAACTCT CCAAGCCAAAAGGAT CGATAA >1r e07 P450 7DQ279471 CGAGGGGCACGACACTACAAGTGCTGGTATCTGTTGGGCAATCTATTTACTGGGTCTGCATACAGATA TTCAGAACAAGGTGTCCTGAGGAGCTGGATCATATCTTCC >1r e04 p450 6DQ279470 TGACACTTCATGTTCGAGGGGCACGACACGACTTCTGTGGGCATTCATGGGCTATGTACTTGCTTGGAT CT CATCCAGAAGTTCAGGAGAAAGTGGCGGAGGAGTTAAAGGGCATCTTCGGGGATTCTGACCGAGA AGCTACTTACGAGGACCTGCAACAGATGAAGTACCTAGAGCAGGTTATCAAGGAAGCTCTAAGGCTTT TTCCTAGTGTTCCAGGAATCTCCAGACTCCTGGAAGTTGACGTAAAGATAAAGAATTACACTATTCCC GCTGGGACACAGACTCCGATCTTTCCATTTCTTATCCACCGTAATCCAGAAGTGT TCCCCAACCCTGAA AACTTCAACCCAGACAATTTTCTGCCCGAGAAAGTGCAGAACAGGCACCCGTTTGCTTACATTCCCTTC TCGGCCGGCCCCCGAACTGTATCGGCCAGA >1r e02 p450 5DQ279469 GCGCGGGAATCGATTCTGGCCGATGCAGTTGCGTGGGCCGGCGGTGAAGGGGATGTAGGCGTAGGGG TGTCTCTTTGCTACCCTCTCTGGCAGGAAGTTGTCAGGGTCGAACTTTTCGGGGTTGGGGAATTGAATT GGGTCCCGATGGACTCTGTAGATATGCATCATCAGTGTGCATCCCGACGGGATATCATAGCCAGCTAT ATTGACGTCTTTCTTCAGTATCCTTCCGATTATTGGAACACTGGGGTACAAT CTTAATGTCTCCTTGATG ACCCTCTCAAGGTACTTCATCTCGTTGAGGTCATTCATGTTCACAGAGCGGTCAGAACCCTGGAAGAT GCTCTCCTGCTCCTGGTATGCAATCTCTTGGACATCGGGATGGAGTCCTAGAAGGAAGAGTGTCCAAC TTATCCCAGCACCTGTTGGGTCGTGCCCCTCGAACATGAACGTATCCACCTCA >1r d11P4504v1DQ279468 CATGGCGGCGCGGGAATCGATTGAGGTGGATACGTTCATGTTCGAGGGGCACGATACAGTTACTTCAA ACATCTCCTGGACCATCCAAGTGCTGGGGATGAACCAAGACATCCAGGACAAAGTGTGTGAAGAGCT GCAGACCATATTTCAAGGGTCGGCCCGCCCTCCTACAATGACTGACCTGAACGAGATGAAGTATTTGG AGCGAGTAATTAAGGAGACGATGAGGCTGTATCCGCCTGTGCCTCTAATTTTCAGGGAACTAACAGAA GACAC AGAGATAGGTGGTTACACTATCCCCGCAGGAGTAAAAATCGCGATTCCGATATTGTGCTTACA TCGCATGGCCGAGCACTTTCCCAACCCAATGAAGTTCGACCCTGACAACTTCCTACCAGAGAGGATGG TAAAGAGACACCCCTACTCTTACATCCCCTTCACCGGCGGCCCACGCAACTGCATCGGGCAGA >1r d06p4503v1DQ279465 TCGATTCTGGCCGATGCAGTTGCGTGGGCCGGC CGAGAATGGGATGTAGGCGTAGGGGTGTCTCTTTG CTACCCTCTCTGGCAGGAAGTTGTCACGGTCGAACTTCTCAGGGTTTGGGAACTGGACAGGGTTCCGA TGGACTCTGTAGATATGCATGATCAGTGTGCATCCCGACGGGATATCATAGCCAGCTATATTGACGTCT TTCTTCAGTATCCTTCCGATTACTGGAACACTGGGGTACAATCTTAATGTCTCCTTGATGACCCTCTCA AGGCACTTCATCTCG TTGAGGTCCTTCATAGTCACAGAGCGGTCAGAACCCTGGAAGATGCTCTCCTG CTCCAGGTATGCAATCTCTTGGACATCGGGATGAAGTCCTAGAAGGAAGAGTGTCCAACTTATCCCAG CACCTGTCGTGTCGTGCCCTCGAACATGAAA >1r d02p4501v1DQ279461 CGGCGCGGGAATCGATTGAGGTGGATACGTCATGTTCGAAGGGCACGACACGACAACGTCTGGCATTT GTTTCACC CTGTGGGCTCTGGCAAAACACCAAGACGTACAGGCAAAGGCGCTACAAGAACAGAGGGC GATCTTCGGCGGAAGCGATCGTGATGCCACCTACACGGATCTTCAGGAAATGAAATATCTAGAGCAAG TCATCAAGGAGGCACACAGACTGTACCCGCCAGTTCCTCTGTACGGCCGGAGAATATCGGAAAATCTG ACAGTCGGTGATTACGTCTTGCCAGCAGGAAGCAATGTCATGGTCCTTGCCTTCATGCTAC ACAGAAA CCCGGATCATTTCCCGGATCCGGAGAGGTTTGACCCGGATCGCTTTCTGACTGAAAACTGTAAAGACA GACATCCGTATTGCTACGTTCCATTCAC >1r c10 intronic CK906359

PAGE 147

147 CCGGCGCATGGCGGCGCGGGAATCGATTATATTGAGGCGCACCGTAAGTTGTATGGCTATCGATTGGA TTACCATGAACGCAAAAGGAAGAAAGAGGCTCGTCAGCCTCATAAACTGGCTGAAAAAGCTAAAAAG CTTCGAGGATTGAAAGCCAAAATGTTCAACAAGCAACGCAGATCAGAGAA >1r c08 r pro CK906360 TCTGTGCTATCGAGTGAAGGCTTTTATTTATTTGTGTGGAATACATCGTTAAAGGCCAAAATGTCTATT GGTGTTCCCATTAAAGTTTTGCATGAAGCAGAAGGCCATATCGTAACTTGCGAAACGAATACCGGTGA AGTGTATAGAGGTAAACTGATTGAGGCGGAGGACAATATGAAA >1r c03 coxIII DQ001073 CATGGCGGCGCGGGAATCGATTGCTGCTGCTTCAAATCCAAAGTGGTGGTTTGATGAGAAGTGTAGAG TTGTTTGTCGTAATAAGCATGTGGTTAAGAATGTTGTTCCGATAATTACGTGAAGTCCGTGGAATCCTG TGGCTATGAAGAAGGTTGATCA >1r c01 nadhBQ788175 TTGTTTTATCATCATCATTACATAGTTTTTATTATGAAAACTATGTATAACAAGGTCAGAAACACATAA AAACTACAGATCACTTTTACAAACAGAGCAGTACTTTGAAATGAAAACATTTATTCAAATACTGTAGT CAAAATTTCGGTATTTGACTCTGCGACAGTTTCTGTCCATCTGTTTGGTTTTCAATGACAAAATTTTGCA GACACACTTTGCTCTTTTTTAATCACTGAATCACATTCCTCTGTTGTTCTAACAGCAGTCGGTGATATTC AATATCTGC ACTGATTTCACAACCTCCAGTGGTAGATAATGACTGTCTGATGGAGATTACTTCTGGTTT TACCTGTGTCAGAGATAAGGTAAGGGAATGGTATGTTGAAAAGTCAGCACTGGAACAGTCTTGAACCC AAGACCTTAGGCACAAAAGTCCAGCACCTTATCCCTAGGCCTCTTAGACATCAATTTACTCACAGCCT ATTCACAGATGGGGCTGAATATATAACAATTACACTACCTACAGCACATGAAGTTTCTAATTGTTCAC AGTTCAATATTTACACTACTTTAATTGGCAGTTACACCATTAAGAGCAAATTGAATAGCGAAGGATTCT TCAGACACCACTTTAACCTTTACACATCTGTAAATGAAAT >1r b12bactin DQ206832 CGGCGCGGGAATCGATTAGAGGGAAATCGTGCGTGACATCAAAGAGAAACTGTGCTATGTCGCCCTG GACTTCGAGCAGGAAATGGCAACCGCCGCTGCTTCCACCTCTC TGGAGAAGTCATACGAGTTGCCTGA CGGCCAGGTCATCACTATTA >1r b10Vit 1BQ788169 TCCATCAACAACGCATGTAGGTTCAGGCGGATATTGGTGAA >1r b11Vit 2CB518311 CTCTGTGAAATTCGAGGGACGCACCAAAGCAGAGTTTGTAATGACTGCTGCTTGGGCTTCATCTTTGGT GAACGGAAGTCAAAGCGTTCTGCTCTTCCTGAAATCAATTCCCGGGCAGGTACCACTGATCCCCCGAC AACAACAGTTGCAGGTA >1r b04ATP aseBQ788171 ATCAACTTATGTAGTGAGCTACTCCCCACATTTCCTGGGGATATCACGACATAGAAACTTCAATAATTT ATTTGTGGCATGACTTTTCCACGCATTACAACAGCAACAATGAAAAAATGCATGACAACTGTTCCACT ATACATACACTAAAGTGCACGATGCATTTAAGTGAACTCAGGCTCTGTAACTGTTTTGAGTAGTTCTGA TGTAAAAATTACAATGAAAGGAAAGGACGTTACAATTCATCATCTATCAAGATGATTCTATAACCAAG CAGACCCTCAATCACAAGTTTGTACAGTCATACACTACTCAGAACTGGTAATGTT CTCTCACACTAACT ATAGATGGCAATGTACACAAAGATTTTTCCTGTTTATTGGCTTCGAAGCTGTTGCAGAACACCTTAATT CGTCGACTCTGCAAGTCTCTCTGCCTTTTGAACCACTTCTTCAATAGGTCCAACCATGTAGAATGCAAC TTCAGGCAAGTGATCATACTCTCCATTTAGAATTTGCTGGAATCCCTTAATGGTTTCCTGCAGTGGCAC TAGTTTGCCCGCATGACCAGTGAAAACTTCGGCCA CCTGGAAAGGCTGTGACAGGAACCTCTGGATCT TACGAGCCCGAGCTACCGTAAGCTTATCTTCTTCAGACAATTCATCC >1r b03APO CK906364 GATTCGTACATGTGTGAGCAGGTGCTGCCCCAGTTTGATGAAATCTCGTCTAATGAAGAAGGGGCTGA TCCTCAGCTTGAGATACTTAAGTTGTTTGCTGAGTTGTGTACGCACTGTGGAAGTCTGGAGAATTCTGA GTCCAGAGTAGAGAAGGTGTTTGAAAGGCTGATTGAGTTTATGCCTCTGCCACCTGATGGTGATA

PAGE 148

148 >1r b02MalCoA AY572861 CGACTCTTAATCTTCTTAGAGGGACAGGCGGCTTCTAGCCGCACGAGATTGAGCAATAATAGGTCTGT GATGCCCTTAGATGTTCTGGGCCGCACGCGCGCTACACTGAAGGAATCAGCGTGTCCTCA >1r a12 GTPase BQ788178 TTTTTTTTTTTACGTGCCTAC ATTTCTTTTCATTCTTCATTTATTATAACATTCCACAAATCCATAAAATG TCATATGTTGGATACAGAACATGTCAACAGAAACATGTACACACTATCAACAAACAAACTTAGAAAAT AGCGTAATAAGTAAAATTGTTAAAATTTAATAATAAACATATATGGAAAACAAAACAGTCATTCATTC CAAGTCAGGTATAAGATAGTGTTAACATACACAATAACAGAGCAATTTGGTCTCTAAAATATAGCTCT AGGCAAATACACTATATGCCAAAGGGAAAGAATTTACCTAGAAAATGACATGGCTTGAGATAGTCAA ATGTCCTCAACAATAAGGCTTGTGAGCAGTACAAAACAGTATAACAATTTAATAAAATAAGATATAAC ATTATAATATAAAATAATATTCAAAAATTGTATAAAATTTATAAAATAACATAAAAAGACAAGTCAAA AAAAAATTAAAAAATACACAAGCCAAATAAACTCCACATAATT >1r A10 S H3 CB518513 CGGCGCGGGAATCGATTACAATCCTATTCGGCCATCCAACTCACCTTTCCACATTCCAGATTCATGCTT CTCAATGAGGGTGATTATATCTCCTTCTTTGAAACTCAACTCATTGGCAACACGA >1r a08 18s rRNA like AY572860 GGCGCGGGAATCGATTTCGCAATGATAGGAAGAGCCGACATCGAAGGATCAAAAAGCGACGTCGCTA TGAACGCTTGGCCGCCA CAAGCCAGTTATCCCTGTGGTAACTTTTCTGACACCTCTTGCTGGAAACTCT CCAAGCCAAAAGGATCGATAA >1r a06 LIM CB518301 TGTGCTTCAAGTGTGGCATGTGCAACAAACTTCTGGACTCAACCAACTGCGCCGAGCATGAAGGTGAG CTGTTCTGCAAGACGTGCCATGCACGCAAGTATGGCCCCAAGGGCTATGGCTTTGGCGGTGGTGCTGG TTGTCTCAGCATGGACA >1r a04 broadAY258590 CGGCGGGGATGATCTGGACAGATTACATCTTCATCACATGACGAAGACTTCTTCCCCTACTCTTCGTCG CAACGGATGACTACATGGATGAATCGCTTCCTCAACTTCCAGTGCCAGAAGGGCAGAAAGAGGAGAA CTATTGCATTCTGCCAACTCCCACGACAGAACACCATCTCTCCACACCGCAACC >1r a02 nanos BQ788190 AAATGAGTAAGTGATATTTAATTATTCTTCATGTCATACTACATTTACCCTCCTTAGGTCCATGAAAAA ATTAGAGATGCCTGCTTCAAAACCTGTTTGCACGCCAGCCACATATTTCGCCCGCAGTATGCTGCCGTG CTGGTACCACAATAGCAGTTGTCTTTTCTAAGTGTTGTGCCTGTCTTTCAGGTACTCCCCTTCTCCTTTA TTTAACAGTACATTAATAGAGCACTCTTATGGGAATAAAGTGAAAATT ATTAGTCTTTGTACAAAAGT AACTGGTCAAGCCTGGACAGATATGGGATATACACTCCATATGAGAAACTTGTGCCCTTGTAAGTTTT ATAGAGTTGTTCTACTTTTTACTATATATTCTCCTCTGTTTAATATTGCTGTTGTTTTAATCAATATCTAC AGTTACAAAAAAAAATGTTTCTTTTCTACTTACTTTTAGATTGTTTTAAATGTTGAAATAAAAGAAAGA TAAAAATTCACCACAGTTGTCCTCATGAATGCAGATCGACCAGATAATACATTTATTTTCTACTATCTG CAGTGGAAAAGTCCGAACTGGAGAGATCTTCTTCATCAAAGGAGGATGCTTTGTCTT >1 a01 bicaudal AY258589 GATTGAGGCAAGTACGGATTGGAGGGAAAGGTACACCACGAAGGAAGAAGAAGGTGGTCCATGCAA CTGCCGCTACCGATGATAAGAAACTGCAGAGTTCTTTGAAAAAGCTCTCAGTAAATACAATTC CAGGT ATTGAAGAGGTTAATATGATTAAGGATGATGGTACTGTGATCCATTTTAACAACCCAAAAGCCCAAGC TTCGTTAGCAGCGGACACATTTGCTATTACTGGTCATGGGGAGAACAAACAAATTACGGAAATGTTGC CAGGAATTTTGAGTCAACTAGGACCAGAAGGTTTAACACAACTCAAACGTCTTGCATCTAGTGTGGCA AATAGTGCCACTGGTGGGAGAGTAAGCATTGAAGAAGACGATGAGGT TCCAGGAGTTAGTGGAAAAC TTTGACGAGGACAGCAAGGAAGAGGTTCCCGTCAATATTTCAGATAAGGAAGACAAAGGAAAAGGAA AGGAAAATGATTCGGTATCAGCTGGTTCTGGTGAAGTGGCGAAGGGGGAAGGACAGAAGGGGGCTGT ACAATCGTCATCAGACAAGCGCATCAAGTAGAGAACAGTTATATTGTTCTCAAAACCGGA

PAGE 149

149 Figure C 1 Clustal W alignment of nuc leotide sequences for R. flavipes 16s mitochondrial gene. Shaded residues indicate differences to C. formosanus (AY558910).

PAGE 150

150 Figure C 2 Clustal W phylogenetic tree of nucleotide sequences for R. flavipes 16s mitochondrial gene. Next to the colony name i s the top Blast haplotype and the chapter where the colony was used.

PAGE 151

151 Figure C 3 Clustal W alignment of Hex -2 sequences (A) and phylogenetic tree (B) of nucleotide sequences for R. flavipes Hexamerin -2 gene. B.discoidalis Hexamerin -2 gene (BDU31328) wa s used as an out -group.

PAGE 152

152 APPENDIX D SOLDIER INFLUENCE ON WORKER CASTE DIFFERE NTIATION Introduction Past research in other termite species has shown that live soldiers inhibit the formation of additional soldiers in laboratory settings (Henderson, 1998; Mao et al., 2005). However, research completed in Chapter 1 found that extracts from soldiers heads synergistically increased worker to soldier morphogenesis when applied in combination with JH III. Additional experiments as described here were conducted to investigate if live soldiers from Florida Reticulitermes flavipes colonies can suppress soldier differentiation in worker termites in the absence of ectopic JH. Methods Two treatments were examined to assess the influence of live solders on soldier form ation in larger experimental groups than tested in other chapters (n=100). Control treatments (100 workers) and soldier treatments (90 workers and 10 soldiers) from one colony were placed into large Petri dishes (diameter 9cm). Caste composition and survival were monitored every ten days for a total of 40 days. Each treatment was replicated five times on a single colony (A8). Results Results from the gene expression experiments (Chapter 3) suggested that live soldiers are capable of impacting expression of genes important in caste differentiation, thereby potentially inhibiting workers from becoming soldiers. Throughout this dissertati on research I observed only a single incidence of presoldier formation in untreated controls (Appendix A). One possibility for this is that the bioassay utilizes a small number of workers (n=15) and is only 25 days long. Therefore, to test if live soldiers can indeed inhibit nestmate soldier formation, we tested the effect that live soldiers have on a larger number of workers (n=100) in a longer assay. Forty days after treatment no additional soldiers had formed in the bioassays that had included 10% soldie rs

PAGE 153

153 (Figure D 1a). However, in the treatments with only workers, soldier differentiation did occur and reached a level of 0.6% by day 40 (Figure D 1a). Survival rates between each treatment were similar with each treatment having around 83% survival after 4 0 days (Figure D 1b). These results verify that soldier caste members inhibit the formation of new soldiers in R. flavipes

PAGE 154

154 Figure D 1.Influence of live soldiers on worker nestmate caste differentiation. A) The Y axis represents soldier numbers in bioa ssays. B) The number of worker termites was monitored 0 40 days. Lines with white and black circles, respectively, represent bioassays, that began with 10% and 0% soldiers (90% and 100% workers).

PAGE 155

155 APPENDIX E GENE SILENCING THROUGH RNAI Introduction The goa l of these studies was to attempt to functionally characterize responsive genes identified in Chapter 3 through RNAi -based transcriptional silencing. The hypothesis was that, if worker to presoldier differentiation is affected by target gene silencing, the n the target gene must play a role in caste differentiation. However, if RNAi does not affect caste differentiation, then 1) the target gene does not play a role in caste differentiation, 2) my method was not able to adequately silence the transcript, or 3 ) the bioassay strategies or detection methods are not able to detect effects. RNAi Materials and Methods Termites Termites were collected form colonies around the Gainesville, FL area. Colonies were maintained in sealed plastic boxes for alteast one mon th before assay data. Colonies were identified as R. flavipes through 16s DNA sequencing (Szalanski et al., 2003). Only worker termites were used in bioassays. dsRNA/ siRNA Synthesis dsRNA was synthesized using a commercially available kit (Silencer Ambio n, Austin, TX) and eluted with H20. dsRNA was then quantified using a spectrophotometer (A260 method). For RNAi experiments #7,10, and 13 dsRNA was RNAse III -digested using the Ambion Silencer kit. RNAi template primers were T7 appended 41 mers. Primers we re: 1) RfCyp15F1F TTTCTCTGATGGCCCGTACT, RfCyp15F1 R TTACAAGGCAATAATCCGGC, 2) RfCyp15A1 -F -ATGGATGCCAGTGGTAGGAA, RfCyp15A1 R CACTGAATGACAAACGCCTG, 3)

PAGE 156

156 RfFaMet2 -F ACTGCCATCAGACGAGACC, RfFaMet2 R AGTCGCTTCTTGATAGAGTGG, 4) RfVit 1 -F -ACTGCCGTCAACGTATCCAT, RfVi t 1 R ATGAGTTGCCAAGTGGAGCTG, 5)RfVit 2 F GGGTGAAATGGAACAAAGC, RfVit 2 F TACCCTATGGACCTTGGCAA, 6)RfLacF1 GCTCCCGGACATCAACTACT, RfLacR1 TTACTGGTTCCCTCACTGCC siRNA for experiment RNAi#15 was purchased directly from Invitrogen, Stealth siRNA. RfEst1 steal th_550 GCAGAUGUCGUUGUAGUCACUUUAA. A pre -designed siRNA control was a scrambled Stealth RNAi siRNA duplex (48% GC content) negative Control -STEALTH RNAI NEG CTRL MED GC#2 Cat no. 12935112. dsRNA Feeding Assays dsRNA feeding assays were performed as describ ed by Zhou et al. (2008) with slight modifications. Termites were immediately removed from colonies and placed into 35 -mm assay dishes that contained an 18 -mm paper disk. Paper disks received dsRNA, JHIII or control treatments. dsRNA disks received 20 g per disk. Disks treated with JHIII received 56g of JHIII in acetone. Papers were treated only once at the beginning of assays. These procedures differ from Zhou et al. (2008) in that Zhou et al. pre -starved termites 24 hours before assays, and they also re placed treated papers every 8 days in bioassays. Treatments For experiment RNAi#7, six different genes were tested; GFP, Famet -2 Cyp15F1, Cyp15A1, Vit -1 and Vit-2 Each was tested with and without JHIII. An untreated control was also included. Four biol ogical replicates were used for each treatment. For experiment RNAi#11, termites were feed with nothing as a control or Laccase dsRNA and collected at 1,2,4, and 8 days after treatment. Termites guts were dissected into PBS and immediately frozen at 80 oC. RNA was extracted, normalized, transcribed into cDNA, and analyzed by qRT PCR as described in full in Chapter 3. -actin was used as a control gene. qRT -

PAGE 157

157 PCR primers are Laccase F1 -AATCAAACTGGGTGCTTTGG, Laccase R1 GGCTACGCGATCATCAAGTT For experiment RN Ai#13, seven treatments were used 1) Control Day 0, 2) control day 2, 3) GFP, 4) Cyp15F1, 5) Cyp15A1, 6) RfEst1 and 7) H20. All treatments were injected with 500 pg siRNA per termite (15 ng/l), except for controls. Injections were conducted exactly as described in Zhou et al. (2006). Treatments 2 7 were destructively sampled two days after treatment and frozen at 80 oC. RNA was extracted, normalized, transcribed into cDNA, and analyzed by qRT PCR as described in full in Chapter 3. Stero -1 was used as a control gene and Cyp15F1, Cyp15A1 and RfEst1 were target genes. Primer sequences are listed in Chapter 3, Table 3 1. For experiment RNAi#15 termites were injected with either negative control siRNA or RfEst1 at a rate of 37 ng (identically to Korb et al., 2009b) and collected at 2,4, and 6 days after treatment and stored at 80 oC. RNA was extracted, normalized, transcribed into cDNA, and analyzed by qRT PCR as described in full in Chapter 3. Stero -1 was used as a control gene and RfEst1 was the target gene. Expression of the target gene was normalized to the control gene in both negative -control injected and target -gene -injected treatments and plotted over the course of 6 days. For each experiment fifteen termites were used for each replicate. If needed, termites were counted every five days and scored for mortality and caste differentiation. Water was added ad libitum Termites were kept at 27 C. Statistical Analysis ANOVAs with mean separations by Tukeys HSD were used to determine significant differences on percent presoldier formation for phenotypic experiments, and delta CT for transcript level.

PAGE 158

158 Results and Discussion Feeding Prior studies conducted in the Scharf laboratory documented transcript knockdown and phenotypic impact by dsRNA feeding in R. flavipes (Zhou et al., 2008). A number of dsRNA feeding experiments were performed but I am only presenting a few representative experiments. For RNAi experiment #7 termites were fed dsRNA and held both with and without JH. Results show that termit es treated with JH+GFP and JH+Vit 1 had an increase in mortality but there was no significant difference between treatments through 25 days (Figure E 1a). No presoldiers formed in dsRNA alone treatments. There was a slight increase in presoldier productio n in Famet -2 and Cyp15A1alone treatments; however, it was not significantly different from the control treatments (Figure E 1b). Of most interest, in termites treated with dsRNA+JH, there was on average a 58% increase in presoldier production with JH. Ter mites treated with JH+ Cyp15F1, Cyp15A1, Vit-1 and Vit -2 dsRNA showed a non -significant decrease in presoldier formation when compared to the JH alone positive control treatment (df 13,55; F=7.6136; p<0.0001) (Figure E 1b). Grouping of individuals could also impact gene silencing detection. For knockdown quantification studies, because the groups of termites were initially separated into groups of 15 per biological rep, there was a possibility I was not able to detect an expression knockdown because of ba seline expression variability, or non uniform silencing among individuals. As a result, I next sought to measure transcript level in individual termites. Target gene expression was compared in individual termites fed siRNA for a digestive Laccase relative to untreated controls. Results indicate that there was a large amount of variability between individual termites, and there was no trend in transcript knockdown over the four days tested (1,2,4,8). Days 1 and 4 are shown as an example (Figure E 2).

PAGE 159

159 Inject ion As shown above, feeding termites dsRNA did not reduce the target gene transcript level or reveal any repeatable phenotypic differences. Therefore, I proceeded to inject termites with siRNA, similar to Zhou et al. (2006a). A number of dsRNA/siRNA injec tion experiments were performed but only a representative few are shown. In RNAi experiment #14, transcript levels were measured for the target gene in termites that were injected with nothing, H20, GFP siRNA, or the target siRNA. Three different target g enes were tested, Cyp15F1, Cyp15A1, and RfEst1 No significant reductions in transcript levels were identified one day after injection for the three target genes Cyp15F1, Cyp15A1, and RfEst1 when compared to the GFP siRNA and H20 controls (Figure E 3a,b,c). To monitor transcript levels over a number of days, siRNA control and RfEst1 siRNA were injected and termites were destructively sampled over a six day time course (RNAi#15). There was no significant reduction in transcript l evel after injection of Stealth RfEst1 siRNA compared to the siRNA control over six days (Figure E 4). However, as shown in Chapter 4, there was a significant reduction in an esterase protein isoform 5 days after injection with RfEst1 siRNA.

PAGE 160

160 Figure E 1 dsRNA feeding assay. A) Percent mortality at Day 25 of termites feed dsRNA of six target genes with and without JHIII. B) Percent cumulative presoldier formation at Day 25 of termites feed dsRNA of six target genes with and without JHIII. Bars with diffe rent letters are significantly different (p<0.05).

PAGE 161

161 Figure E 2.Relative expression of the Laccase gene of termites fed control vs. Laccase dsRNA. Each bar represents an individual termite. Data from days 1 and 4 after treatment are shown

PAGE 162

162 Figure E 3. Relative expression of siRNAi injected genes A) Cyp15F1, B) Cyp15A1, and C) Rfest1 from termites injected with either; 1) nothing (Control), 2) GFP, 3) H20, or 4) target gene (A) Cyp15F1, (B) Cyp15A1, (C) Rfest1 Bars with different are significantly diff erent (p<0.05).

PAGE 163

163 Figure E 4. Relative expression of the RfEst1 gene in termites injected with siRNA negative control vs. RfEst1 siRNA over six days.

PAGE 164

164 LIST OF REFERENCES Abe, T., Bignell, D.E., Higashi, M., 2000. Termites: Evolution, Sociality, Symbioses, Ecology. Kluwer, Boston. Alaux, C., Le Conte, Y., Adams, H.A., Rodriguez Zas, S., Grozinger, C.M., Sinha, S., Robinson, G.E., 2009. Regulation of brain gene expression in honey bees by brood pheromone. Genes, Brain and Behav. 8, 309 319. Amdam, G.V., Norberg, K., Hagen, A., Omholt, S.W., 2003. Social exploitation of vitellogenin. Proc. Natl. Acad. Sci. USA 100, 17991802. Andersen, J.F., Walding, J.K., Evans, P.H., Bowers, W.S., Feyereisen, R., 1997. Substrate specificity for the epoxidation of t erpenoids and active site topology of house fly cytochrome P450 6A1. Chem. Res. Toxicol. 10, 156164. Antonio, D.S.M., Guidugli -Lazzarini, K.R., Nascimento, A.M.d., Simoes, Z.L.P., Hartfelder, K., 2008. RNAi -mediated silencing of vitellogenin gene function turns honeybee ( Apis mellifera ) workers into extremely precocious foragers. Naturwissenschaften. 95, 953961. Bagneres, A.G., Clement, J.L., Blum, M.S., Severson, R.F., Joulie, C., Lange, C., 1990. Cuticular hydrocarbons and defensive compounds of Reticu litermes flavipes (Kollar) and R. santonensis (Feytaud): Polymorphism and chemotaxonomy. J. Chem. Ecol. 16, 32133244. Bells, X., Martin, D., Piulachs, M. D., 2005. The mevalonate pathway and the synthesis of juvenile hormone in insects. Annu. Rev. Entomol. 50, 181199. Bennett, G.W., Owens, J.M., Corrigan, R.M., 2003. Trumans scientific guide to pest management operations. Advanstar Communications Inc., Cleveland. Bloch, G., Sullivan, J.P., Robinson, G.E., 2002. Juvenile hormone and circadian locom otor activity in the honey bee Apis mellifera J. Insect. Physiol. 48, 11231131. Bourke, A.F.G., Franks, N.R., 1995. Social evolution in Ants. Princeton University Press, Princeton, NJ. Brey, W.W., Edison, A.S., Nast, R.E., Rocca, J.R., Saha, S., Withers, R.S., 2006. Design, construction and validation of a 1mm triple resonance hightemperature superconducting probe for NMR. J. Mag. Res. 179, 290293. Buchli, H., 1958. L'origine des castes et les poetntialities ontogeniques des termites europeens du genre Reticulitermes Holmgren Ann. Sci. Nat. Zool. 20, 261429. Bull, A., 1966. bicaudal, a genetic factor which affects the polarity of the embryo in Drosophila melanogaster J. Exp. Zool. 161, 221242.

PAGE 165

165 Cabrera, B., Kamble, S., 2001. Effects of decreasing ther mophotoperiod on the Eastern subterranean termite (Isoptera: Rhinotermitidae). Environ. Entomol. 30, 166171. Corona, M., Velarde, R., Remolina, S., Moran -Lauter, A., Wang, Y., Hughes, K.A., Robinson, G.E., 2007. Vitellogenin, juvenile hormone, insulin signaling, and queen honey bee longevity. Proc. Natl. Acad. Sci. USA 107, 71287133. Culliney, T.W., Grace, J.K., 2000. Prospects for the biological control of subterranean termites (Isoptera: Rhinotermitidae), with special reference to Coptotermes formosanus Bull. Entomol. Res. 90, 9 21. Denison, R., RaymondDelpech, V., 2008. Insights into the molecular basis of social behavior from studies on the honeybee, Apis mellifera Invert. Neurosci. 8, 1 9. Dettman, R.W., Turner, F.R., Hoyle, H.D., Raff, E., 2001. E mbryonic expression of the divergent drosophila beta3-tubulin isoform is required for larval behavior. Genetics 158, 253263. Dong, S. L., Mao, L., Henderson, G., 2009. Physical contact between soldier and worker is essential in soldier self -regulation of Coptotermes formosanus (Isoptera, Rhinotermitidae). Insectes. Soc. 56, 2834. Dugatkin, L.A., 1997. Cooperation among animals, an evolutionary perspective. Oxford University Press, New York, Ecology and Evolution. Erezyilmaz, D., Riddiford, L.M., Truman, J .W., 2006. The pupal specifier broad directs progressive morphogenesis in a direct -developing insect. Proc. Natl. Acad. Sci. USA 103, 69256930. Fei, H., Henderson, G.R., 2002. Formosan subterranean termite wood consumption and worker survival as affected by temperature and soldier proportion. Environ. Entomol. 31, 509514. Feyereisen, R., 2005. Insect cytochrome P450. In Iatrou, G.K. and Gill, S.S. (eds.), Comprehensive Molecular Insect Science [vol. 4]: Biochemistry and Molecular Biology, Elsevier, Amster dam, Biochemistry and Molecular Biology Vol. 4, pp. 1 77. Forschler, B.T., 1993. Survivorship and tunneling activity of Reticulitermes flavipes (Kollar) (Isoptera: Rhinotermitidae) in response to termiticide soil barriers with and without gaps of untreated soil. J. Entomol. Sci. 29, 43 54. Geib, S.M., Filley, T.R., Hatcher, P.G., Hoover, K., Carlson, J.E., Jimenez -Gasco, M.d.M., Nakagawa Izumi, A., Sleighter, R.L., Tien, M., 2008. Lignin degradation in wood -feeding insects. Proc. Natl. Acad. Sci. USA 105, 1 293212937. Gilbert, L.I., Granger, N.A., Roe, R.M., 2000. The juvenile hormones, historical facts and speculation on future research directions. Insect. Biochem. Molec. Biol. 30, 617644.

PAGE 166

166 Goodisman, M.A., Crozier, R.H., 2003. Association between caste and genotype in the termite Mastotermes darwiniensis Froggatt (Isoptera: Mastotermitidae). Australian J. Entomol. 42, 1 5. Goodman, W.G., Ganger, N.A., 2005. The juvenile hormones. In Iatrou, G.K. and Gill, S.S. (eds.), Comprehensive Molecular Insect Science, Elsevier, San Diego, Comprehensive Molecular Insect Science Vol. 3, pp. 320408. Gottlieb, H.E., Kotlyar, V., Nudelman, A.M., 1997. NMR chemical shifts of common laboratory solvents as tra ce impurities. J. Org. Chem. 62, 75127515. Greenberg, S., Tobe, S.S., 1984. Adaptation of a radiochemical assay for juvenile hormone biosynthesis to study caste differentiation in a primitive termite. J. Insect. Physiol. 31, 347 352. Grozinger, C.M., Fisc her, P., Hampton, J.E., 2007. Uncoupling primer and release responses to pheromone in honey bees. Naturwissenschaften 94, 375379. Grozinger, C.M., Sharabsh, N.M., Whitfield, C.W., Robinson, G.E., 2003. Pheromone -mediated gene expression in the honey bee b rain. Proc. Natl. Acad. Sci. USA 100, 1451914525. Hahn, D.A., 2006. Two closely related species of desert carpenter ant differ in individual level allocation to fat storage. Physiol. Biochem. Zool. 79, 847856. Hamilton, W.D., 1964. The genetic evolution of social behavior I, II. J. Theo. Biol. 7, 152. Harrington, W.F., Rodgers, M.E., 1984. Myosin. Annu. Rev. Biochem. 53, 3573. Hartfelder, K., 2000. Insect juvenile hormone: from "status quo" to high society. Braz. J. Med. Biol. Res. 157177. Hayashi, Y., Lo, N., Miyata, H., Kitade, O., 2007. Sex linked genetic influence on caste determination in a termite. Science 318, 985987. Heath, R.R., Dueben, B.D., 1998. Analytical and preparative gas chromatography. In Millar, J.G. and Haynes, K.F. (eds.), Methods of chemical ecology: chemical methods, Kluwer, New York, Vol. 1, pp. 85 162. Helvig, C., Koener, J.K., Unnithan, G.C., Feyereisen, R., 2004. CYP15A1, the cytochrome P450 that catalyzes epoxidation of methyl farnesoate to juvenile hormone III in cockroach c orpora allata. Proc. Natl. Acad. Sci. USA 101, 40244029. Henderson, G.R., 1998. Primer pheromones and possible soldier caste influences on the evolution of sociality in lower termites. In Vander Meer, R.K. et al. (eds.), Pheromone Communication in Social Insects, Westview Press, Boulder.

PAGE 167

167 Hojo, M., Morioka, M., Matsumoto, T., Miura, T., 2005. Identification of soldier caste -specific protein in the frontal gland of nasute termite Nasuitetermes takasagoensis (Isoptera: Termitidae). Insect. Biochem. Mol. Biol. 35, 347 354. Horiuchi, S., Yamamura, N., Abe, T., 2002. Soldier production strategy in lower termites: from young instars or old instars? J. Theor. Biol. 218. Howard, R.W., Haverty, M.I., 1979. Termites and juvenile hormone analogs: a review of methodolog y and observed effects. Sociobiology 4, 269278. Howard, R.W., Haverty, M.I., 1981. Production of soldiers and maintenance of soldier proportion by laboratory experimental groups of Reticulitermes flavipes (Kollar) and Reticulitermes virginicus (Banks) (Is optera: Rhinotermitidae). Insect Soc. 28, 32 39. Ishikawa, Y., Aonuma, H., Miura, T., 2008. Soldier -specific modifications of the mandibular motor neurons in termites. PLoS One 3. Kaiser, R., Lamparsky, R. 1983. New carbonyl compounds in the high-boiling f raction of lavender oil. 1st communication. Helv. Chim. Acta. 66, 18351842. Kawasaki, H., Ote, M., Okano, K., Shimada, T., Quan, G. -X., Mita, K., 2004. Change in the expressed gene patterns of the wing disc during the metamorphosis of Bombyx mori Gene 343, 133142. Kawasaki, H., Sugaya, K., Quan, G. -X., Nohata, J., Mita, K., 2003. Analysis of alphaand beta tubulin genes of Bombyx mori using an EST database. Insect. Biochem. Molec. Biol. 33, 131137. Keeling, C.I., Bearfield, J.C., Young, S., Blomquist, G.J., Tittiger, C., 2006. Effect of juvenile hormone on gene expression in the pheromone -producing midgut of the pine engraver beetle, Ips pini Insect. Mol. Biol. 15, 207216. Keeling, C.I., Blomquist, G.J., Tittiger, C., 2004. Coordinated gene expression for pheromone biosynthesis in the pine engraver beetle, Ips pini (Coleoptera: Scolytidae). Naturwissenschaften 91, 324328. Korb, J., Hoffmann, K., Hartfelder, K., 2009a. Endocrine signatures underlying plasticity in postembryonic development of a lower t ermite, Cryptotermes secundus (Kalotermitidae). Evol. Dev. 11, 269277. Korb, J., Roux, E.A., M. Lenz, 2003. Proximate factors influencing soldier development in the basal termite Cryptotermes secundus (Hill). Insect. Soc. 50, 299303. Korb, J., Weil, T., Hoffmann, K., Foster, K.R., Rehli, M., 2009b. A gene necessary for reproductive suppression in termites. Science 324, 758.

PAGE 168

168 Koshikawa, S., Cornette, R., Hojo, M., Maekawa, K., Matsumoto, T., Miura, T., 2005. Screening of genes expressed in developing mandib les during soldier differentiation in the termite Hodotermopsis sjostedti FEBS Lett. 579, 13651370. Koshikawa, S., Matsumoto, T., Miura, T., 2003. Mandibular morphogenesis during soldier differentiation in the damp -wood termite Hodotermopsis sjoestedti (Isoptera: Termopsidae). Naturwissenschaften 90, 180184. Lain, L.V., Wright, D.J., 2003. The life cycle of Reticulitermes spp. (Isoptera: Rhinotermitidae): what do we know? Bull. Entomol. Res. 93, 267378. Larson, J.R., Coon, M.J., Porter, T.D., 1991a. Alcohol inducible cytochrome P 450IIE1 lacking the hydrophobic NH2 terminal segment retains catalytic activity and is membrane-bound when expressed in Escherichia coli. J. Biol. Chem. 266, 73217324. Larson, J.R., Coon, M.J., Porter, T.D., 1991b. Purificat ion and properties of a shortened form of cytochrome P 450 2E1: Deletion of the NH2-terminal membrane -insertion signal peptide does not alter the catalytic activities. Proc. Natl. Acad. Sci. USA 88, 91419145. LeConte, Y., Becard, J.M., Costagliola, G., de Vaublanc, G., Maatoui, M., Crauser, D., Plaettner, E., Slessor, K.N., 2006. Larval salivary glands are a source of primer and releaser pheromone in honey bee. Naturwissenschaften 93, 237241. Lefeuve, P., Bordereau, C., 1984. Soldier formation regulated b y a primer pheromone from the soldier frontal gland in a higher termite, Nasutitermes lujae Proc. Natl. Acad. Sci. USA 81, 76657668. Lenz, M., 1976. The dependence of hormone effects in caste determination on external factors. In Luscher, M. (ed.), Phase and Caste Determination in Insects. Endocrine Aspects, Pergamon Press, Oxford, pp. 73 90. Leoncini, I., Le Conte, Y., Costagliola, G., Plettner, E., Toth, A.L., Wang, M., Huang, Z., Becard, J. -M., Crauser, D., Slessor, K.N., Robinson, G.E., 2004. Regulati on of behavioral maturation by a primer pheromone produced by adult worker honey bees. Proc. Natl. Acad. Sci. USA 101, 1755917564. Lewis, J.L., Forschler, B.T., 2004. Protist communities from four castes and three species of Reticulitermes (Isoptera: Rhin otermitidae). Ann. Entomol. Soc. AM. 97, 12421251. Liu, Y., Henderson, G., Mao, L., Roger A. Laine, 2005. Seasonal variation of juvenile hormone titers of the Formosan subterranean termite, Coptotermes formosanus (Rhinotermitidae). Environ. Entomol. 34, 557 562. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real time quantitative PCR and the 2 -delta delta Ct method. Methods. 25, 402408. Lo, N., Hayashi, Y., Kitade, O., 2009. Should environmental caste determination b e assumed for termites? AM. Natural. 173, 848853.

PAGE 169

169 Mackert, A., Nascimento, A.M.d., Bitondi, M.M.G., Hartfelder, K., Simoes, Z.L.P., 2008. Identification of a juvenile hormone esterase like gene in the honey bee, Apis mellifera L. expression analysis and functional assays. Comp. Biochem. Physiol. B. 150, 3344. Mao, L., Henderson, G., 2006. Untrastructure of the head and mouthparts of Coptotermes formosanus presoldier and soldier. Sociobiology 48, 649 659. Mao, L., Henderson, G., Liu, Y., Laine, R.A., 2005 Formosan subterranean termite (Isoptera: Rhinotermitidae) soldiers regulate juvenile hormone levels and caste differentiation in workers. Ann. Entomol. Soc. AM. 98, 340345. Markesich, D.C., Gajewski, K.M., Nazimiec, M.E., Beckingham, K., 2000. bicaudal encodes the Drosophila beta NAC homolog, a component of the ribosomal translational machinery. Development 127, 559572. Matsumura, F., Coppel, H.C., Tai, A., 1968. Isolation and identification of termite trail -following pheromone. Nature 219, 963964. Mat suura, K., Vargo, E.L., Kawatsu, K., Labadie, P.E., Nakano, H., Yashiro, T., Tsuji, K., 2009. Queen succession through asexual reproduction in termites. Science 323, 1687. Minakuchi, C., Namiki, T., Yoshiyama, M., Shinoda, T., RNAi -mediated knockdown of ju venile hormone acid O -methyltransferase gene causes precocious metamorphosis in the red flour beetle Tribolium castaneum FEBS 275, 29192931. Miura, T., 2004. Proximate mechanisms and evolution of caste polyphenism in social insects: From sociality to genes. Ecol. Res. 19, 141148. Miura, T., Kamikouchi, A., Sawata, M., Takeuchi, H., Natori, S., Kubo, T., Matsumoto, T., 1999. Soldier caste -specific gene expression in the mandibular glands of Hodotermopsis japonica (Isoptera: Termopsidae). Proc. Natl. Acad. Sci. USA 96, 1387413879. Miura, T., Matsumoto, T., 2000. Soldier morphogenesis in a nasute termite: discovery of a disc like structure forming a soldier nasus. Proc. Roy. Soc. Lon. B. Bio. 267, 11851189. Munyiri, F.N., Ishikawa, Y., 2007. Molecular clon ing and developmental expression of the gene encoding juvenile hormone esterase in the yellow -spotted longicorn beetle, Psacothea hilaris Insect. Biochem. Molec. Biol. 37, 497505. Myles, T.G., Nutting, W.L., 1988. Termite eusocial evolution: a re examination of Bartz's hypothesis and assumptions. Quat. Rev. Biol. 63, 123. Nelson, C.M., Ihle, K.E., Fondrk, M.K., Page Jr., R.E., Amdam, G.V., 2007. The gene vitellogenin has multiple coordinating effects on social organization. PLOS Biol. 5, 06730 677.

PAGE 170

170 Nelson, J.L., Cool, L.G., Solek, C.W., Haverty, M.I., 2008. Cuticular hydrocarbons and soldier defense secretions of Reticulitermes in southern California: a critical analysis of the taxonomy on the genus in North America. J. Chem. Ecol.34. Nelson, L. J., Cool, L.G., Forschler, B.T., Haverty, M.I., 2001. Correspondence of soldier defense secretion mixtures with cuticular hydrocarbon phenotypes for chemotaxonomy of the termite genus Reticulitermes in North America. J. Chem. Ecol. 27, 14491479. Nijhout, F.H., 1994. Insect Hormones. Princeton University Press, Princeton. Nijhout, F.H., 1999. Control mechanisms of polyphenic development in insects. Bioscience 49, 181192. Nijhout, F.H., 2003. Development and evolution of adaptive polyphenisms. Evol. Devel. 5, 9 18. Noirot, C., 1985. Pathways of caste development in the lower termites. In Watson, J.A.L. et al. (eds.), Caste Determination in Social Insects, Pergamon, New York, pp. 59 -74. Nutting, W.L., 1990. Insect: Isoptera. Wiley and Sons, New York, pp. 9971032. Okot -Kotber, B.M., Prestwich, G.D., Strambi, A., Strambi, C., 1993. Changes in morphogenetic hormone titers in isolated workers of the termite Reticulitermes flavipes (Kollar). Gen. Comp. Endocrinol. 90, 290295. Okot -Kotber, B.M., Ujvary, I., Mollaa ghababa, R., Szurdoki, F., Matolcsy, G., Prestwich, G.D., 1991. Physiological influence on fenoxycarb proinsecticides and soldier head extracts of various termite species on soldier differentiation in Reticulitermes flavipes (Isoptera). Sociobiology 19, 77 89. Page Jr., R.E., Scheiner, R., Erber, J., Amdam, G.V., 2006. The development and evolution of division of labor and foraging specialization in a social insect ( Apis mellifera L.). Curr. Top. Dev. Biol. 74, 253 286. Park, Y.I., Raina, A.K., 2003. Facto rs regulating caste differentiation in the Formosan subterranean termite with emphasis on soldier formation. Sociobiology 41, 1 12. Park, Y.I., Raina, A.K., 2004. Juvenile hormone III titers and regulation of soldier caste in Coptotermes formosanus J. Ins ect. Physiol. 50, 561 566. Park, Y.I., Raina, A.K., 2005. Regulation of juvenile hormone titers by soldiers in the Formosan subterranean termite, Coptotermes formosanus J. Insect. Physiol. 51, 358391. Parthasarathy, R., Tan, A., Bai, H., Palli, S.R., 200 8. Transcription factor broad suppresses precocious development of adults structures during larval -pupal metamorphosis in the red flour beetle, Tribolium castaneum Mech. Develop. 125, 299313. Prestwich, G.D., 1983. Chemical systematics of termite exocrin e secretions. Ann. Rev. Ecol. Syst. 14, 287311.

PAGE 171

171 Prestwich, G.D., 1984. Defense mechanisms of termites. Ann. Rev. Entomol. 29, 201232. Queller, D.C., Strassmann, J.E., 1998. Kin selection and social insects. BioScience 48, 165 175. Quintana, A., Reinhard, J., Faure, P.U., Bagneres, A. G., Mossiot, G., Clement, J. L., 2003. Interspecific variation in terpenoid composition on defensive secretions of European Reticulitermes termites J. Chem. Ecol. 29, 639 652. Reinhard, J., Lacey, M.J., Ibarra, F., Schroeder F.C., Kaib, M., Lenz, M., 2002. Hydroquinone: a general phagostimulating pheromone in termites. J. Chem. Ecol. 28, 1 14. Rewitz, K.F., Rybczynski, R., Warren, J.T., Gilbert, L.I., 2006. The Halloween genes code for cytochrome P450 enzymes mediating synthesis of the insect moulting hormone. Biochem. Soc. T. 34, 12561260. Roe, R.M., Kallapur, V., Linderman, R.J., Viviani, F., Harris, S.V., Walker, E.A., Thompson, D.M., 1996. Mechanism of action and cloning of epoxide hydrolase from the cabbage looper Trico plusia ni Arch. Insect. Biochem. 32, 527535. Roelofs, W.L., Jurenka, R.A., 1996. Biosynthetic enzymes regulating ratios of sex pheromone components in female redbanded leafroller moths. Bioorgan. Med. Chem. 4, 461466. Rybczynski, R., Gilbert, L.I., 1995 Prothoracicotropic hormone elicits a rapid, developmentally specific synthesis of beta tubulin in an insect endocrine gland. Dev. Biol. 169, 1528. Rybczynski, R., Gilbert, L.I., 1998. Cloning of a beta1 tubulin cDNA from an insect endocrine gland: Devel opment and hormone -induced changes in mRNA expression. Mol. Cell. Endocrinol. 141, 141151. Schal, C., Holbrook, G.L., Bachmann, J.A.S., Sevala, V.L., 1997. Reproductive biology of the German cockroach, Blattella germanica : juvenile hormone as a pleiotropi c master regulator. Arch. Insect. Biochem. 35, 405 426. Scharf, M.E., Neal, J.J., Bennett, G.W., 1998. Changes in insecticide resistance levels and detoxification enzymes following insecticide selection in the German cockroach, Blattella germanica. Pestic. Biochem. Physiol. 59, 67 79. Scharf, M.E., Buckspan, C.E., Grzymala, T.F., Zhou, X., 2007. Regulation of polyphenic differentiation in the termite Reticulitermes flavipes by interaction of intrinsic and extrinsic factors. J. Exp. Biol. 210, 43904398. Sch arf, M.E., Ratliff, C.R., Hoteling, J.T., Pittendrigh, B.R., Bennett, G.W., 2003a. Caste differentiation responses of two sympatric Reticulitermes termite species to juvenile hormone homologs and synthetic juvenoids in two laboratory assays. Insect. Soc. 50, 346354.

PAGE 172

172 Scharf, M.E., Ratliff, C.R., Wu Scharf, D., Zhou, X., Pittendrigh, B.R., Bennett, G.W., 2005a. Effects of juvenile hormone III on Reticulitermes flavipes : changes in hemolymph protein composition and gene expression. Insect. Biochem. Molec. Bio l. 35, 207215. Scharf, M.E., Wu -Scharf, D., Pittendrigh, B.R., Bennett, G.W., 2003b. Caste and development associated gene expression in a lower termite. Genome Biol. 4, R62. Scharf, M.E., Wu -Scharf, D., Pittendrigh, B.R., Bennett, G.W., 2005b. Gene expression profiles among immature and adult reproductive castes of the termite Reticulitermes flavipes Insect. Mol. Biol. 14, 3144. Schmelz, E.A., Alborn, H.T., Tumlinson, J.H., 2001. The influence of intact -plant and excisedleaf bioassay designs on volic itin and jasmonic acid -induced sesquiterpene volatile release in Zea mays Planta 214, 171179. Schmelz, E.A., Engelberth, J., Tumlinson, J.H., Block, A., Alborn, H.T., 2004. The use of vapor phase extraction in metabolic profiling of phytohormones and ot her metabolites. Plant J. 39, 790808. Schulz, D.J., Huang, Z., Robinson, G.E., 1998. Effects of colony food shortage on behavioral development in honey bees. Behav. Ecol. Socio. 42, 295303. Schulz, D.J., Barron, A.B., Robinson, G.E., 2002. A role for octopamine in honey bee division of labor. Brain. Behav. Evolut. 60, 350359. Seybold, S.J., Tittiger, C., 2003. Biochemistry and molecular biology of de novo isoprenoid pheromone production in the scolytidae. Ann. Rev. Entomol. 48, 425 453. Su, N. Y., 200 2. Novel technologies for subterranean termite control. Sociobiology 40, 95 101. Sutherland, T.D., Unnithan, G.C., Andersen, J.F., Evans, P.H., Murataliev, M.B., Szabo, L.Z., Mash, E.A., Bowers, W.S., Feyereisen, R., 1998. A cytochrome P450 terpenoid hydroxylase linked to the suppression of insect juvenile hormone synthesis. Proc. Natl. Acad. Sci. USA 95, 1288412889. Sutherland, T.D., Unnithan, G.C., Feyereisen, R., 2000. Terpenoid w -hydroxylase (CYP4C7) messenger RNA levels in the corpora allata: a marker for ovarian control of juvenile hormone synthesis in Diploptera punctata. J. Insect. Physiol. 46, 12191227. Szalanski, A.L., Austin, J.W., Owens, C.B., 2003. Identification of Reticulitermes spp. (Isoptera: Reticulitermatidae) from South Central United S tates by PCR RFLP. J. Econ. Entomol. 96, 15141519. Tartar, A., Wheeler, M.M., Zhou, X., Coy, M.R., Boucias, D.G., Scharf, M.E., 2009. Parallel meta transcriptome analyses of host and symbiont digestive factors in the gut of the termite Reticulitermes flav ipes In review. Thorne, B.L., 1996. Termite Terminology. Sociobiology 28, 253261.

PAGE 173

173 Thorne, B.L., 1997. Evolution of eusociality in termites. Ann. Rev. Ecol. Syst. 28, 2754. Tillman, J.A., Lu, F., Goddard, L.M., Donaldson, Z.R., Dwinell, S.C., Tittiger, C ., Hall, G.M., Storer, A.J., Blomquist, G.J., Seybold, S.J., 2004. Juvenile hormone regulates de novo isoprenoid aggregation pheromone biosynthesis in pine bark beetles, Ips SPP., through transcriptional control of HMG -CoA reductase. J. Chem. Ecol. 30, 24 592494. Tittiger, C., 2004. Functional genomics and insect chemical ecology. J. Chem. Ecol. 30, 23352358. Toth, A.L., Kantarovich, S., Meisel, A.F., Robinson, G.E., 2005. Nutritional status influences socially regulated foraging ontogeny in honey bees. J Exp. Biol. 208, 46414649. Toth, A.L., Robinson, G.E., 2005. Worker nutrition and division of labour in honeybees. Anim. Behav. 69, 427435. Truman, J.W., Hiruma, K., Allee, J.P., MacWhinnie, S.G.B., Champlin, D.T., Riddiford, L.M., 2006. Juvenile hormone is required to couple imaginal disc formation with nutrition in insects. Science 312, 13851388. Truman, J.W., Riddiford, L.M., 1999. The origins of insect metamorphosis. Nature 401, 447452. Valles, S.M., Oi, F.M., Strong, C.A., 2001. Purification and c haracterization of trans -permethrin metabolizing microsomal esterases from worker of the Eastern subterranean termite, Reticulitermes flavipes Insect. Biochem. Molec. Biol. 31, 715725. Vander Meer, R.K., Alonso, L.E., 1998. Pheromone directed behavior in ants. In Vander Meer, R.K. et al. (eds.), Pheromone communication in social insects, Westview Press, Boulder, pp. 159192. Vieira, C.U., Bonetti, A.M., Simoes, Z.L.P., Maranhao, A.Q., Costa, C.S., Costa, M.C.R., Siquieroli, A.C.S., Nunes, F.M.F., 2007. Fa resoic acid o -methyl transferase (FAMeT) isoforms: conserved traits and gene expression patterns related to caste differentiation in the stingless bee, Melipona scutellaris Arch. Insect. Biochem. 67, 97 106. Waller, D.A., La Fage, J.P., 1988. Environmenta l influence on soldier differentiation in Coptotermes formosanus Insect. Soc. 35, 144152. Wheeler, D.E., Nijhout, H.F., 2003. A perspective for understanding the modes of juvenile hormone action as a lipid signaling system. BioEssays 25, 9941001. Wheeler, M.M., Tarver, M.R., Coy, M.R., Scharf, M.E., 2009. Characterization of four esterase genes and esterase activity from the gut of the termite Reticulitermes flavipes Arch. Insect. Biochem. Accepted.

PAGE 174

174 Whitman, J.G., Forschler, B.T., 2007. Observational no tes on short lived and infrequent behaviors displayed by Reticulitermes flavipes (Isoptera: Rhinotermitidae). Ann. Entomol. Soc. AM. 100, 763771. Wigglesworth, V.B., 1935. Functions of the corpus allatum in insects. Nature 136, 338. Wilson, E.O., 1971. Th e insect societies. Belknap Press, Cambridge. Wilson, E.O., Bossert, W.H., 1963. Chemical communication among animals. Recent. Prog. Horm. Res. 19, 673716. Wu -Scharf, D., Scharf, M.E., Pittendrigh, B.R., Bennett, G.W., 2003. Expressed sequence tags from a polyphenic Reticulitermes flavipes (Isoptera: Rhinotermitidae) cDNA library. Sociobiology 41, 479490. Zalkow, L.H., Howard, R.W., Gelbaum, L.T., Gordon, M.M., Deutsch, H.M., Blum, M.S., 1981. Chemical ecology of Reticulitermes flavipes (Kollar) and R. vi rginicus (Banks) (Rhinotermitidae): Chemistry of the soldier cephalic secretions. J. Chem. Ecol. 717731. Zhou, X., Oi, F.M., Scharf, M.E., 2006a. Social exploitation of hexamerin: RNAi reveals a major caste regulatory factor in termites. Proc. Natl. Acad. Sci. USA 103, 44994504. Zhou, X., Song, C., Grzymala, T.L., Oi, F.M., Scharf, M.E., 2006b. Juvenile hormone and colony conditions differentially influence cytochrome P450 gene expression in the termite Reticulitermes flavipes Insect. Mol. Biol. 15, 749761. Zhou, X., Tarver, M.R., Bennett, G.W., Oi, F.M., Scharf, M.E., 2006c. Two hexamerin genes from the termite R. flavipes : sequence, evolution, expression and proposed function in caste regulation. Gene 376, 4758. Zhou, X., Tarver, M.R., Scharf, M.E ., 2007. Hexamerin-based regulation of juvenile hormone dependent gene expression underlies phenotypic plasticity in a social insect. Development 134, 601610. Zhou, X., Wheeler, M.M., Oi, F.M., Scharf, M.E., 2008. RNA interference in the termite Reticulitermes flavipes through ingestion of double -stranded RNA. Insect. Biochem. Molec. Biol. 38, 805815.

PAGE 175

175 BIOGRAPHICAL SKETCH Matt hew R. Tarver grew up in Indiana and attended Purdue University for both his bachelor s and master s degree in entomology. Then he moved down to Florida to attend school at the University of Florida to study entomology. While in Gainesville he met his wonderful wife Megumi. During his stay in Gainesville, he has met many wonderful people who have made his l ife be tter in everyway. Thanks!!