<%BANNER%>

Mechanism and Function of Aldosterone Induction of Endothelin-1 in Renal Collecting Duct Cells

Permanent Link: http://ufdc.ufl.edu/UFE0025127/00001

Material Information

Title: Mechanism and Function of Aldosterone Induction of Endothelin-1 in Renal Collecting Duct Cells
Physical Description: 1 online resource (225 p.)
Language: english
Creator: Stow, Lisa
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: aldosterone, endothelin, kidney, sodium, transcription
Physiology and Pharmacology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: This dissertation will focus on the function and mechanism of interaction between two hormones that regulate renal sodium transport; aldosterone and endothelin-1 (ET-1). Data presented in this work demonstrate that the ET-1 peptide was stimulated by aldosterone in rat inner medulla in vivo and the ET-1 gene (edn1) was stimulated by aldosterone in acutely isolated rat inner medullary collecting duct cells ex vivo and in mouse cortical, outer medullary, and inner medullary collecting duct cells in vitro. Mechanistic studies revealed that aldosterone directed the transcription of the edn1 promoter through two hormone response elements that bound both the mineralocorticoid receptor (MR) and the glucocorticoid receptor (GR). These hormone receptors mediated the association of chromatin remodeling complexes, histone modification, and RNA polymerase II at the edn1 promoter. A synthetic glucocorticoid was able to replicate aldosterone action on edn1 through the exclusive action of GR. Preliminary functional studies indicated that edn1 knockdown altered normal mRNA expression patterns for two aldosterone response genes, sgk1 and scnn1a. Direct interaction between aldosterone and ET-1 has important implications for renal and cardiovascular function.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Lisa Stow.
Thesis: Thesis (Ph.D.)--University of Florida, 2009.
Local: Adviser: Wingo, Charles S.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0025127:00001

Permanent Link: http://ufdc.ufl.edu/UFE0025127/00001

Material Information

Title: Mechanism and Function of Aldosterone Induction of Endothelin-1 in Renal Collecting Duct Cells
Physical Description: 1 online resource (225 p.)
Language: english
Creator: Stow, Lisa
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: aldosterone, endothelin, kidney, sodium, transcription
Physiology and Pharmacology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: This dissertation will focus on the function and mechanism of interaction between two hormones that regulate renal sodium transport; aldosterone and endothelin-1 (ET-1). Data presented in this work demonstrate that the ET-1 peptide was stimulated by aldosterone in rat inner medulla in vivo and the ET-1 gene (edn1) was stimulated by aldosterone in acutely isolated rat inner medullary collecting duct cells ex vivo and in mouse cortical, outer medullary, and inner medullary collecting duct cells in vitro. Mechanistic studies revealed that aldosterone directed the transcription of the edn1 promoter through two hormone response elements that bound both the mineralocorticoid receptor (MR) and the glucocorticoid receptor (GR). These hormone receptors mediated the association of chromatin remodeling complexes, histone modification, and RNA polymerase II at the edn1 promoter. A synthetic glucocorticoid was able to replicate aldosterone action on edn1 through the exclusive action of GR. Preliminary functional studies indicated that edn1 knockdown altered normal mRNA expression patterns for two aldosterone response genes, sgk1 and scnn1a. Direct interaction between aldosterone and ET-1 has important implications for renal and cardiovascular function.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Lisa Stow.
Thesis: Thesis (Ph.D.)--University of Florida, 2009.
Local: Adviser: Wingo, Charles S.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0025127:00001


This item has the following downloads:


Full Text

PAGE 1

1 MECHANISM AND FUNCTION OF ALDOSTERONE INDUCTION OF ENDOTHELIN-1 IN RENAL COLLECTING DUCT CELLS By LISA REBECCA STOW A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2009

PAGE 2

2 2009 Lisa Rebecca Stow

PAGE 3

3 To my hero, my grandfathe r, George C. Stow

PAGE 4

4 ACKNOWLEDGMENTS I would like to express my gr atitude to m y doctoral mentor, Dr. Charles Wingo, for his guidance during my dissertation work. Thank you for your commitment to my education. I would also like to express my gratitude to th e members of my dissertation committee, Dr. Brian Cain, Dr. Chris Baylis, and Dr. Peter Sayeski. Their advice was crucial in the development and success of this project. I would also like to thank the American Heart Association for awarding me with a predoctoral fellowship that funded a major portion of my dissertation work. I would also like to thank the other members of my lab including Dr. Michelle Gumz for her support and friendship. A special thank you goes to Ms. Jeanette Lync h for the many hours of technical assistance during the majority of the animal studies presente d here. I also thank Ms. Alicia Rudin and Ms. Megan Greenlee for their tech nical support and friendship. I would not have made it to the finish line wi thout the love and support of my friends and family. Thank you Mom, for being my best frie nd and my biggest fan. Another big thanks goes to my fianc, Dr. Marc Bailly, for his encouragem ent and love. Marc is also a scientist and has given me a tremendous amount of scientific a nd moral support. Marc was also kind enough to assist me in the preparation of the figures that appear in this document. Thank you! But most of all, I want to thank my gra ndfather, George C. Stow. I admired my grandfather greatly and I have c hosen to dedicate my dissertation to him for many reasons. He was a World War II veteran that enlisted as a paratrooper in the United States Army. This decision caused him to leave his family, forfe it his admission to medical school and ultimately left him a wounded veteran. The title American he ro is used so often that it almost seems clich. However, when I think of the sacrifice my grandfather made to save the lives of others I realize that it was nothing shor t of heroic. Without the selfle ss bravery of men and women like

PAGE 5

5 my grandfather I may not have had the opportunity to live a free and peacef ul life, nor may I had the opportunity to pursue a doctora te of philosophy in science. For these reasons, I am forever grateful. I knew my grandfather as a patient and quiet man. He had the kind of wisdom that could only be acquired through decades of experience. He was an avid reader, a wine enthusiast, a dog lover and a gardener. He was also a chemist. In many ways, it was his infectious passion for knowledge and his inquisitive appreciation of the natu ral world inspired me to pursue a scientific career. In an effort to share with me some of his knowledge, my grandfather gave me many books. He would write inspiring messages and q uotes from famous philosophers inside the cover of each book to encourage me to seek an education, believe in myself and follow my dreams. It is only now that I truly appreciate how amazing of a gift it is to have his words of advice in indelible ink inside books filled with information he thought was interesting or valuable. I will always be grateful for the lessons my gr andfather taught me. He will always be my hero and the greatest man Ive ever known. A lthough he is no longer with us, I hope that somehow, someway I ma de him proud today.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS ............................................................................................................... 4LIST OF TABLES .........................................................................................................................10LIST OF FIGURES .......................................................................................................................11ABSTRACT ...................................................................................................................... .............14 CHAP TER 1 INTRODUCTION AND OVERVIEW .................................................................................. 15The Kidneys ............................................................................................................................15General Functions ............................................................................................................15The Role of the Kidneys in Blood Pressure Control ....................................................... 16Gross Anatomy ................................................................................................................16The Nephron and Collecting Duct System ......................................................................17Formation of the Tubular Ultrafiltrate ............................................................................. 19Mechanisms of Renal Sodium Transport ............................................................................... 20Sodium Transport in the Proximal Tubule ...................................................................... 21Sodium Transport in the Limb of Henle ..........................................................................22Sodium Transport in the Di stal Convoluted Tubule ........................................................24Sodium Transport in the Collecting Duct ........................................................................ 25Regulation of Renal Sodium Tr ansport and Blood Pressure .................................................. 27Glomerular Filtration Rate .............................................................................................. 28Tubuloglomerular Feedback ............................................................................................29Natriuretic Signals ........................................................................................................... 29Antinatriuretic Signals .....................................................................................................30Renin-Angiotensin-Al dosterone System .........................................................................30The Aldosterone System ........................................................................................................ .31Classical Aldosterone Targets ......................................................................................... 32The Mineralocorticoid Receptor ...................................................................................... 33Ligand specificity of the mi neralocorticoid receptor ...............................................34Ligand promiscuity and overlap of nuclear receptors .............................................. 35Hormone Response Elements .......................................................................................... 36Emerging Aldosterone Targets ........................................................................................ 37The Endothelin-1 System .......................................................................................................38Systemic ET-1 System .................................................................................................... 39The Renal ET-1 System ................................................................................................... 39ET-1 in Renal Water Transport ................................................................................ 41ET-1 in Renal Sodium Transport ............................................................................. 42Renal ET-1 Mediated Natriuresi s in Experimental Models .....................................42Regulation of the Renal ET-1 System. ..................................................................... 44

PAGE 7

7 Interaction Between Aldoste rone and Endothelin-1 ............................................................... 45Summary ....................................................................................................................... ..........462 ALDOSTERONE STIMULATES ET-1 PEPTIDE IN THE RAT KIDNEY ........................ 64Introduction .................................................................................................................. ...........64Materials and Methods ...........................................................................................................65Animals ....................................................................................................................... .....65Subcutaneous Osmotic Minipump Implantation ............................................................. 66Chronic Vascular Catheters and Pl asma Aldosterone Determination ............................. 66Intraperitoneal Aldoste rone Administration ....................................................................67Measurement of Tissue ET-1 .......................................................................................... 67Quantification of mRNA Expression in Tissues. ............................................................ 67Results .....................................................................................................................................68Axial Heterogeneity in ET-1 Pathway Ge ne Expression in the Rat Kidney ................... 68Age-Dependent Gene Expression ....................................................................................69Validation of Aldosterone Delivery Method ................................................................... 70Aldosterone Dependent ET-1 Pep tide Levels in the Kidney ........................................... 71Aldosterone Dependent Gene E xpression in the Rat Kidney .......................................... 72Discussion .................................................................................................................... ...........753 ENDOTHELIN-1 PROMOTER ACTIVITY IN LUCIFERASE REPORTER ASSAYS ..... 96Introduction .................................................................................................................. ...........96Materials and Methods ...........................................................................................................98Reagents ...................................................................................................................... ....98Plasmids ...................................................................................................................... .....98Cell Culture and Transient Transfection .........................................................................99Luciferase Reporter Assay ............................................................................................ 100Results ...................................................................................................................................100Sequence Analysis of the edn1 Promoter ......................................................................100Characterization of the pEdn1 and Control Luciferase Vectors .................................... 101The edn1 Promoter Construct is Transcripti onally Active in Collecting Duct Cells In Vitro .......................................................................................................................102Optimization of In Vitro Luciferase Assay ................................................................... 103Discussion .................................................................................................................... .........1054 ALDOSTERONE MODULATES STERIOD RECEP TOR BINDING TO THE ENDOTHELIN-1 GENE ( EDN1 ) ........................................................................................ 118Introduction .................................................................................................................. .........118Materials and Methods .........................................................................................................120Chemicals ......................................................................................................................120Animals ....................................................................................................................... ...120Acutely Isolated Rat IMCD Cells .................................................................................. 121Aldosterone Administration in Ra t and ET-1 Peptide Measurement ............................ 121Cell Culture and Aldoste rone Treatments .....................................................................122

PAGE 8

8 Steady-State mRNA Determination .............................................................................. 122Heterogeneous Nuclear RNA (hnRNA) Assay ............................................................. 123Nuclear Translocation and Western Blots .....................................................................123Hormone Receptor siRNA Knockdown ........................................................................ 124Chromatin Immunoprecipitation (ChIP) Assays ........................................................... 124Coimmunoprecipitation ................................................................................................. 125DNA-Affinity Purification Analysis .............................................................................125Statistics .................................................................................................................... .....126Results ...................................................................................................................................126Aldosterone Stimulates ET1 in Rat Inner Medulla ......................................................126Aldosterone Stimulates Dose-D ependent Transcription of edn1 in Collecting Duct Cells ......................................................................................................................... ..127Aldosterone Action on edn1 Involves Both MR and GR. ............................................. 128Aldosterone Modulates Hormone Receptor Binding to the edn1 Promoter ..................129Discussion .................................................................................................................... .........1325 DEXAMETHASONE STIMULATES ENDOTHELIN-1 GENE EXPRESSION IN COLLECTING DUCT CELLS IN VITRO .......................................................................... 148Introduction .................................................................................................................. .........148Materials and Methods .........................................................................................................150Cell Culture and Hormone Treatment ........................................................................... 150Steady-State mRNA Determination .............................................................................. 150Hormone Receptor siRNA Knockdown ........................................................................ 151Statistics .................................................................................................................... .....151Results ...................................................................................................................................151Relative Expression of Hormone Receptors in mIMCD-3 cells ................................... 151Dexamethasone-Dependent Gene Expression in Collecting Duct Cells ....................... 152Effect of Pharmacological Inhibition of Hormone Receptors on DexamethasoneInduced Gene Expression ..........................................................................................153Effect of siRNA Knockdown of Hormone Receptors on Dexamethasone-Regulated Gene Expression ........................................................................................................154Discussion .................................................................................................................... .........1556 REDUCED EDN1 EXPRESSION BY SIRNA A LTERS ALDOSTERONE TARGET GENES IN COLLECTING DUCT CELLS ......................................................................... 164Introduction .................................................................................................................. .........164Materials and Methods .........................................................................................................166Cell Culture and Hormone Treatment ........................................................................... 166edn1 siRNA Knockdown ...............................................................................................167Steady-State mRNA Determination .............................................................................. 167Statistics .................................................................................................................... .....168Results ...................................................................................................................................168Validation of siRNA Expe rimental Controls ................................................................168Efficacy of Four Differe nt siRNAs Targeting edn1 ......................................................170Effect of edn1 Knockdown on Aldosterone Ta rget Gene Expression .......................... 171

PAGE 9

9 Effect of edn1 Knockdown on Aldosterone-Depe ndent Gene Expression in m IMCD-3 and mpkCCDc14 cells ...............................................................................171Effect of edn1 Knockdown on Aldosterone-Dependent scnn1a Expression at 6 Hours ......................................................................................................................... .173Discussion .................................................................................................................... .........1747 CONCLUSIONS AND PE RSPE CTIVES ...........................................................................187Summary of Results ..............................................................................................................187Aldosterone-ET-1 Action in the Inner Medulla in vivo .................................................187Aldosterone Action on edn1 is Mediated Via GR and MR ........................................... 188Analysis of edn1 HREs ................................................................................................. 189Effect of edn1 Knockdown on Aldosterone Ta rget Gene Expression .......................... 190Model of Aldosterone-Induced ET1 Negative Feedback Loop .......................................... 191Perspectives and Future Directions ...................................................................................... 192A Functional Aldsosterone-ET-1 Axis ..........................................................................192Molecular Machinery and Therapeutic Targets ............................................................193The Aldosterone-ET-1 Axis in Hypertension and Human Disease ............................... 196APPENDIX A OPTIMIZED PROTOCOL FOR INDIVIDUA L NEPHRON DISSECTI ON IN RAT ....... 198Method ........................................................................................................................ ..........198B IMMUNOHISTOCHEMISTRY OF ETB RE CE PTORS IN THE RAT KIDNEY ............. 200Method ........................................................................................................................ ..........200Results ...................................................................................................................................201LIST OF REFERENCES .............................................................................................................202BIOGRAPHICAL SKETCH .......................................................................................................224

PAGE 10

10 LIST OF TABLES Table page 2-1 TaqMan assays sets for QPCR on rat ............................................................................. 772-2 Renal ET-1 peptide concen trations in adult rats ................................................................ 782-3 Primer sequences for rat SyBr Green QPCR ..................................................................... 792-4 Renal ET-1 peptide conc entrations in young rats .............................................................. 803-1 Putative HREs in the murine edn1 promoter ...................................................................1093-2 Potential CpG islands in the murine edn1 promoter ........................................................1104-1 Antibodies and applications ............................................................................................. 1365-1 TaqMan assays used for QPCR .................................................................................... 1586-1 CT values for -actin ( actb ) in mIMCD-3 control experiments. ...................................... 179A-1 Identification criteria for microdissected nephron segments ........................................... 199

PAGE 11

11 LIST OF FIGURES Figure page 1-1 Diagram of the bisect ed kidney and tubule. .......................................................................491-2 Na+ transport mechanisms of the proximal tubule. ............................................................ 501-3 Na+ transport mechanisms of the thick ascending limb of Henle. ..................................... 511-4 Na+ transport mechanisms of the distal convoluted tubule. ............................................... 521-5 Na+ transport mechanisms of the collecting duct. ............................................................. 531-6 Overview of al dosterone action. ........................................................................................ 541-7 Overview of the mine ralocorticoid receptor. ..................................................................... 561-8 Overview of MR-directe d gene transcription. ...................................................................571-9 Comparison of MR and GR structural domains. ............................................................... 581-10 Potential role of GR in collecting duct cells. ....................................................................591-11 Three-dimensional structure of a dimeric GR DNA binding domain complex interacting with a classical hormone response element. .................................................... 601-12 Overview of endotheli n-1 gene and protein. ...................................................................... 611-13 Overview of ETA and ETB receptor actions. ...................................................................... 621-14 Hypothetical model of aldosterone-induced ET-1 action in the re nal collecti ng duct. ..... 632-1 Relative mRNA expression of genes involved in ET-1 or aldost erone signaling in adult rat kidneys. ............................................................................................................ ....812-2 Relative mRNA expression of ENaC subunit genes in adult rat kidneys. .........................822-3 Relative mRNA expression genes involved in ET-1 or aldosterone signaling in young rats. ..........................................................................................................................832-4 Effect of age on gene expre ssion profiles in the rat kidney. .............................................. 842-5 Validation of aldosterone delivery method in adult rats. ...................................................852-6 Effect of aldosterone on renal ET-1 pe ptide concentrations in adult rats. ......................... 862-7 Effect of time on aldosterone-dependent ET1 peptide levels in the rat inner medulla. ... 87

PAGE 12

12 2-8 Effect of age on aldosterone-dependent ET-1 peptide levels in the inner m edulla. .......... 882-9 Effect of 1 h aldosterone treatment on gene expression in the adult rat kidney. ............... 892-10 Effect of 2 h aldosterone treatment on gene expression in the adult rat kidney. ............... 902-11 Effect of 6 h aldosterone treatment on gene expression in the adult rat kidney ................ 912-12 Effect of 24 h aldosterone treatment on gene expression in the adult rat kidney. ............. 922-13 Effect of 1 h aldosterone treatment on ge ne expression in adrenalectomized rats. ...........932-14 Effect of an alternativ e dissection method on aldosterone-dependent gene expression in adult rats. ........................................................................................................................942-15 Aldosterone-dependent gene expres sion in wild-type C57 Bl/6J mice. ............................953-1 Map of luciferase vectors. ................................................................................................1123-2 Putative HREs in the murine edn1 promoter. ..................................................................1133-3 The edn1 promoter is transc riptionally active. ................................................................ 1143-4 Comparison of pEdn1 activity in mpkCCDc14 and mIMCD-3 cells. ............................... 1153-5 Time course of luciferase activity in hormone treated mIMCD-3 cells. ......................... 1163-6 Effect of low and high dose aldosterone or dexamethasone on pEdn1 reporter gene activity..............................................................................................................................1174-1 Aldosterone stimulation of inner medullary ET-1 expression in rat. ...............................1374-2 Aldosterone stimulation of edn1 mRNA and hnRNA in collecting duct cells. ............... 1384-3 Aldosterone stimulation of edn1 mRNA in mIMCD-K2 cells. ....................................... 1394-4 Aldosterone stimulation of ET-1 pe ptide release from mIMCD-3 cells.......................... 1404-5 Aldosterone action in mIMCD-3 cells is mediated through MR and GR. ....................... 1414-6 Blockade of MR or GR i nhibits aldosterone induction of edn1 mRNA. ......................... 1424-7 Aldosterone recruits steroid rece ptors to a region of the murine edn1 promoter containing two putative HREs. ........................................................................................ 1434-8 Steroid receptors bind direct ly to HRE1 and HRE2 in the edn1 promoter. ..................... 1444-9 Aldosterone-dependent association of MR and GR by coimmunoprecipitation. ............ 145

PAGE 13

13 4-10 Aldosterone-dependent recruitm ent of RNA polym erase II to the edn1 promoter. ........ 1464-11 Spironolactone and RU486 induce nuclear translocation and binding of MR and GR to edn1. ............................................................................................................................. 1475-1 Relative mRNA expression of hormone receptors in mIMCD-3 cells. ........................... 1595-2 Dexamethasone-stimulated gene expression in mIMCD-3 cells. .................................... 1605-3 Dexamethasone-stimulated gene expression in mpkCCDc14 cells. .................................. 1615-4 Effect of pharmacological blockade of MR and GR on dexamethasone-induced edn1 gene expression in mIMCD-3 cells. .................................................................................1625-5 Effect of MR-siRNA or GR-siRNA on de xamethasone-induced gene expression in mIMCD-3 cells. ...............................................................................................................1636-1 Effect of lipofection and NT-siRNA on al dosterone target gene expression in mIMCD-3 cells. ...............................................................................................................1806-2 Efficacy of four different siRNAs against edn1. ............................................................. 1816-3 Effect of 24 h knockdown with siEdn1-09 on gene expression in mIMCD-3 cells. ....... 1826-4 Effect of siEdn1-09 on aldosterone-induced gene expression in mIMCD-3 cells. .......... 1836-5 Effect of siEdn1-09 on aldosterone -mediated gene expression in mpkCCDc14 cells. ..... 1846-6 Effect of siEdn1-09 on al dosterone regulated gene e xpression at 6 h in mIMCD-3 cells. Cells were transfected with NT-s iRNA or siEdn1-09 for 24 h prior to a 6 h vehicle (veh) or 1 M aldosterone (aldo) treatment. ....................................................... 1856-7 Effect of siEdn1-09 on al dosterone regulated gene e xpression at 6 h in mIMCD-3 cells. Cells were transfected with siEdn1-09 for 24 h prior to a 6 h vehicle (veh) or 1 M aldosterone (aldo) treatment. ..................................................................................... 1867-1 Proposed Model for ET-1 Mediated Negativ e Feedback on Aldosterone Action in the Kidney. ....................................................................................................................... ......197

PAGE 14

14 Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy MECHANISM AND FUNCTION OF ALDOSTERONE INDUCTION OF ENDOTHELIN-1 IN THE RENAL COLLECTING DUCT By Lisa Stow December 2009 Chair: Charles S. Wingo Major: Medical Sciences Concentration: Physiology and Pharmacology This dissertation will focus on the function and mechanism of inte raction between two hormones that regulate renal sodium transport; aldosterone and endothe lin-1 (ET-1). Data presented in this work demonstr ate that the ET-1 peptide was stim ulated by aldosterone in rat inner medulla in vivo and the ET-1 gene ( edn1) was stimulated by aldosterone in acutely isolated rat inner medullary collecting duct cells ex vivo and in mouse cortical, outer medullary, and inner medullary collecting duct cells in vitro Mechanistic studies revealed that aldosterone directed the transcription of the edn1 promoter through two hormone response elements that bound both the mineralocorticoid receptor (MR) and the glucocorticoid receptor (GR). These hormone receptors mediated the association of chromatin remodeling complexes, histone modification, and RNA polymerase II at the edn1 promoter. A synthetic glucoc orticoid was able to replicate aldosterone action on edn1 through the exclusive action of GR Preliminary functional studies indicated that edn1 knockdown altered normal mRNA expressi on patterns for two aldosterone response genes, sgk1 and scnn1a. Direct interaction betw een aldosterone and ET-1 has important implications for renal and cardiovascular function.

PAGE 15

15 CHAPTER 1 INTRODUCTION AND OVERVIEW The Kidneys General Functions The kidneys are a pair of highly specialized organs that filter the blood and produce urine. Because of their function, the kidneys receive an impressive 1700 liters (L) per day of blood or roughly 20 percent (%) of the cardiac output (Williams and Leggett, 1989). Proper renal function is essential for numerous processes in cluding fluid and electrolyte homeostasis, acidbase balance, maintenance of systemic arterial blood pressure, and excre tion of metabolic waste and toxic bioactive substances (Brenner and Rector, 2008). The human body is continuously accumulating meta bolic waste products such as urea, uric acid, and creatinine. These waste products, along with other toxic substances, are removed from the circulation by the kidneys or the liver. Th e kidney is a vital orga n and patients in kidney failure cannot live without blood or peritoneal dialysis or renal tran splantation that facilitates the removal of these toxic waste products. Othe r functions of the kidne ys include bioactive metabolism and gluconeogenesis (Marsenic, 200 9). The kidneys participate in several biosynthetic pathways includi ng the synthesis of active v itamin D (1,25-dihydroxyvitamin D3) (Dusilova-Sulkova, 2009; Michigami, 2007) and the production of erythropoietin (Jacobson et al., 1957; Lemke and Muller, 1989). Erythropoietin is an importan t hormone that stimulates the bone marrow to increase red blood cell production, which is known as eryt hropoesis. Indeed, anemia is often present in patients in renal failure. The kidneys possess transport mechanisms for various mineral ions, organic ions, amino acids and metabolites (Brenner a nd Rector, 2008). Renal transport mechanisms also play a fundamental role in the maintenance of water (H2O) and sodium (Na+) homeostasis. H2O and

PAGE 16

16 Na+ balance is ultimately important due to the di rect impact on extracellular fluid volume and blood pressure. The work presented in this dissertation will focus on the function and mechanism of interaction be tween two hormones that aff ect blood pressure through the regulation of renal Na+ transport, aldosterone and endothelin-1 (ET-1). The Role of the Kidneys in Blood Pressure Control The kidneys participate in se veral integrated physiological m echanisms that modulate blood pressure. Ultimately, these renal mechanis ms converge on one of the two key factors that determine blood pressure, cardiac output and systemic vascular resistance (Guyton, 1981; Luetscher et al., 1973). The kidneys produce various vasoactive substances that modulate total vascular resistance such as pr ostaglandins (Schulz et al., 1995), nitric oxide (Ito, 1995), ET-1 (Kohan and Fiedorek, 1991), and angiotensin II (Ang II). The kidneys also control mechanisms that determine the concentration of potassium (K+) in the body, and K+ participates in the repolarization of the myocardium to ensure nor mal cardiac contractile function (Walker et al., 1964). However, the kidneys primarily functi on in the maintenance of blood pressure by controlling blood volume, which is a primary determ inant of cardiac output. The kidneys control blood volume through th e regulation of Na+ and H2O homeostasis. The following sections will present the anatomy of the kidney followed by a discussion of the important transport processes for Na+ and H2O that occur in the different regions of the kidney. Gross Anatomy The kidneys are located in the retroperitoneal cavity and norm ally receive blood flow from a single renal artery. A bisected kidney is divide d into two distinct regions: the renal cortex and the renal medulla (Figure 1-1, left panel). In hu mans, the medulla is orga nized into 8-18 conical masses referred to as renal pyramids that each extend toward the renal pelvis to form a papilla (Preuss, 1993). In comparison, many small labor atory animals including rodents have kidneys

PAGE 17

17 with only one renal pyramid and one papilla (Dunn, 1949). Blood flow from the renal artery passes into smaller lobar arteries and eventu ally flows into a capillary bed known as a glomerulus. The glomerular capillary bed is unique because it has both upstream and downstream resistance vessels known as afferent and efferent arterioles Each glomerulus represents a single filtration un it of the kidney and is located inside a structure called the Bowmans capsule. Together, the glomerulus and Bowmans capsule comprise a structure known as the renal corpuscle. Blood plasma is filtered across the glomerulus and the primary filtrate collects in the Bowmans space where it flows into the lumen of the nephron and the adjoining tubule structure called the collecting duct. The nephron and collecting duct receive blood flow from peritubular capillaries. In humans, collecting ducts drain into funnel-like calyces that surround each of the renal pyramids. In unipapillated animals, collecting ducts drain directly into the renal pelvis. The final filtered product is the urinary output, which exits each kidney through a ureter that conne cts to the urinary bladder. The Nephron and Collecting Duct System The prim ary glomerular filtrate contains elect rolytes, organic ions, glucose, amino acids, vitamins, and other small proteins that must be reabsorbed back into the circulation. This process of selective reabsorption occurs along the length of the nephron and collecting duct, which is comprised of a single epithelial cell layer that participates in the selective transport of water, electrolytes, and organic solutes. Each human kidney contains about one million nephrons (Gumz et al., 2009c; Preuss, 1993). In comparison, a rat kidney contains approximately 30,000 nephrons (Corman et al., 1985). Each nephron includes a renal corpuscle, the proximal tubul e, thin descending limb, thick ascending limb, distal tubule, a nd connecting tubule (Figure 1-1, right panel). The initial region of the nephron is called the proximal convoluted t ubule, which connects to the proximal straight

PAGE 18

18 tubule typically at the corticomedullary juncti on before transitioning in to the loop of Henle. Mammalian kidneys have nephrons with both lo ng and short loops of Henle depending on the location of the originating glomer ulus (Brenner and Rector, 2008). The majority of nephrons in humans and rodents have short l oops of Henle with a thin limb th at curves back into the thick ascending limb in the outer medulla. Alterna tively, long nephrons typically originate from juxtamedullary glomeruli and have a descending thin limb that extends deep into the inner medulla. These inner medullary thin limbs even tually transition into a thin ascending limb and subsequently a thick ascending limb of Henle in the outer medulla. The thick ascending limb returns the filtrate back into the cortex where sp ecialized macula densa cells of the tubule run adjacent with the source glomerulus at a speciali zed region called the juxtaglomerular apparatus. Following the juxtaglomerular apparatus, the co rtical thick ascending limb has an abrupt transition to the distal convoluted tubule and subsequently th e connecting segment, the terminal region of the nephron. Each nephron drains into a collecting duct system that consists of cortical, outer medullary, and inne r medullary collecting ducts. Co llecting ducts have a different embryonic origin than the nephron, however they are also composed of a single epithelial cell layer involved in tubular transpor t. The collecting duct epithelium is composed of two major cell types known as principal cells and intercalated cells (Madsen et al., 1988). Each cell type has distinct functional and morphological properties. Intercalated cells have a low cellular profile in the tubule lumen and are thought to mediate transport invo lved in acid-base ba lance (Clapp et al., 1987). Principal cells are ta ll with relatively few or ganelles and function in Na+ and H2O reabsorption. The following sections will focus on how the kidneys regulate Na+ homeostasis starting with the formation of the glomerular ultrafiltrate and continuing with a detailed description of Na+ transport mechanisms in diffe rent regions in the tubule.

PAGE 19

19 Formation of the T ubular Ultrafiltrate Tubular tran sport is highly dependent on the composition and the rate of formation of the primary filtrate entering the nephron. This initial filtrate is formed by a process called glomerular filtration, which is the movement of blood plasma across the glomerular capillary wall into the Bowmans space (Thomson and Blantz, 2008). Three adjacent layers form the filtration barrier: the fenestrated endothelium of the glomerular capillary, the glomerular basement membrane, and the slit diaphragm of the surrounding podocytes (Haraldsson et al., 2008; Jarad and Miner, 2009). This filtration barrier has both charge and size selective properties that restrict the passage of molecules that are too nega tively charged or larger than 8 nanometers (nm). As a result, the normal filtration barrier is completely impermeable to molecules larger than 70 kiloda ltons (kDa), whereas molecules smaller than 7 kDa are freely filtered. Substances between 7 and 70 kDa or 4 and 8 nm in diameter have variable filterability (Haraldsson and Jeansson, 2009). For example, al bumin has molecular weight of 66 kDa and a diameter of 7 nm, however, less than 0.02% of albumin is filtered due to its negative charge (Jarad and Miner, 2009). In contrast, minera l ions and organic solutes are small and freely filtered irrespective of their charge. The concentration of freely f iltered substances, like Na+, in the primary ultrafiltrate is called the filtered load and is directly proportional to glomerular filtration rate (GFR). The tubule reabsorbs approximately the same percentage of filtered Na+ in a process referred to as glomerulotubular balance. Consequently, changes in GFR are reflected by changes in net Na+ excretion. Neurohumoral factors th at control GFR also influence Na+ homeostasis and will be discussed in further detail in the section Regulation of Renal Sodium Transport Primary determinants of GFR include the permea bility of the glomerular capillaries, the glomerular filterable surface area, and the net filtration pressure (Brenner and Rector, 2008).

PAGE 20

20 The product of glomerular capillary permeability (i.e., hydraulic conductivity) and the effective filtration surface area is know n as the glomerular ultrafiltration coefficient (Kf). Net filtration pressure is determined is the sum of hydros tatic pressures (P) and oncotic pressures ( ) on either side of the glomerular filtration barrier known as Starling forces (Starling, 1899). Net hydrostatic and oncotic pressures are determined by the difference between the pressure in the glomerular capillary (PGC or GC) and the pressure in the tubule (PT or T). Taken together, GFR is calculated for each nephron by the following equation: GFR = Kf *[(PGC PT) (GC T)] (Brenner and Rector, 2008). GFR is tightly maintained in a healthy i ndividual and GFR measurement is the most important clinical indicator of renal function (B renner and Rector, 2008). The glomerulus possesses both upstream (afferent ) and downstream (efferent) vasc ular resistance vessels to autoregulate glomerular perfusion pressure and maintain a relatively constant GFR over a large range of arterial blood pressures (Cupples, 2007; Haraldsson et al., 2008). A normal GFR is 125 ml/min or 180 L/day (Brenner and Rector, 2008). At this rate, a human would excrete their entire blood volume in a matter of minutes. Howe ver, an average person produces only 1 L/day of urine (Brenner and Rector, 2008). This mean s that the renal nephrons and collecting ducts have the daunting task to reabsorb greater th an 99% or 179 L of tubular fluid everyday. Mechanisms of Renal Sodium Transport Na+ constitutes over 90% of the osmotically active solute in the blood plasma and extracellular fluid (140 milliequi valents (mEq)/L) (Gumz et al., 2009c). Consequently, the reabsorption of Na+ is critical to the maintenance of extracellular fluid volume and blood pressure. This process of Na+ reabsorption occurs along the le ngth of the nephron and collecting duct and is summarized in Table 1-1 (Gumz et al., 2009c). The universal driving force for Na+ reabsorption is generated by the activity of the basolateral Na+/K+ adenosine triphosphatase

PAGE 21

21 pump (Na+/K+-ATPase). For every ATP three Na+ ions are pumped into the interstitial fluid in exchange for two K+ ions pumped into the cell. This uneven stoichiometry produces an intracellular negative charge and contributes to the generation of the electrochemical gradient that favors Na+ reabsorption. However, the net transport of Na+ is accompanied by an anion and a water molecule and is therefore, electro -neutral. The major anions coupled to Na+ are chloride (Cl-) and bicarbonate (HCO3 -), which are present in the extracellular fluid at 110 and 24 mEq/L, respectively (Eaton and Pooler, 2004 ). The kidneys typically reabsorb between 96% and greater than 99% of the filtered Na+. The vast majority of this Na+ is reabsorbed in the proximal tubule and thick ascending limb of Henle; while less than 10% of the total filtered load of Na+ is reabsorbed in the distal nephron and collec ting duct. Relatively small changes in Na+ reabsorption can lead to large changes fluid tran sport and a concomitant in crease or decrease in extracellular fluid volume. Therefore, the tr ansport mechanisms in the distal nephron and collecting duct are ideal targets for controlling the fine-tuning of Na+ reabsorption. Indeed, most hormonal, paracrine and neuronal regulato ry mechanisms converge on this region of the tubule to achieve homeostatic adjustments in Na+ balance. Sodium Transport in the Proximal Tubule The proximal tubule is responsible for reabsorbing the bulk of the glom erular ultrafiltrate including greater than 60% of Na+, 80% of HCO3 and virtually all of the organic compounds that are filtered at the glomerulus (Brenner and Rector, 2008). To accommodate this immense transport capacity, proximal tubule cells have ap ical microvilli that increase the absorptive surface area and give the cells their characteristic brush border. As depicted in Figure 1-2, proximal tubule cells have both active tr anscellular and passi ve paracellular Na+ transport mechanisms. The transcellular electrochemical gradient favors Na+ reabsorption, and Na+ absorption transport is often coupled to the movement of glucose, amino acids, phosphate,

PAGE 22

22 sulfate, and organic molecules including lactate, acetoacetate, -hydroxybutyrate, and tricarboxylic acid cycle intermediates such as -ketoglutarate, succinate and citrate. However, the predominant mechanism for Na+ reabsorption in the proximal tubule is via apical Na+/H+ exchange (NHE) (Burckhardt et al., 2002). The activity of NHE results in the reabsorption of one Na+ ion in exchange for the extrusion of one H+ into the lumen (Figure 1-2). Intracellular Na+ ions are then pumped back into the interstitial space by basolateral Na+/ K+-ATPase and Na+/ HCO3 -cotransport (NBC). In fact, proximal tubule Na+ reabsorption is closely associated with net HCO3 reabsorption and is important for proper acid-base balance. As show n in Figure 1-2, tubular (type IV) and cytosolic (type II) carbonic anhydrases link tr ansport by apical NHE to baso lateral NBC and result in net reabsorption of NaHCO3. The tight junctions of the proximal t ubule are particularly permeable to Na+ and Clions. In the early proximal tubule the lumen has a ne t negative charge. Th is negative potential difference between the lumen and interstitial fl uid drives the parace llular movement of Clfrom the tubule lumen to the interstitium. As a result of luminal Clremoval, the lumen potential difference changes from negative to positive in the midto lateportions of the proximal tubule. Under these conditions the electrical grad ient drives paracellular diffusion of Na+ ions. In addition, the removal of NaHCO3 from the tubular lumen serves to increase the c oncentration of luminal Cland shifts the concen tration gradient for Cland the electrical gradient for Na+ to favor passive paracellular reabsorpti on in the late proximal tubule. Sodium Transport in the Limb of Henle The loop of Henle participates in the renal countercurrent system which functions to concentrate the urinary output. To generate the countercurrent system the descending and ascending limbs of Henle transport water and elect rolytes in separate regions. This unique

PAGE 23

23 property of the loop of Henle generates a hypert onic medullary interstitium; which, in turn, determines the capacity of downstream water tran sport in the collecting duct and the overall urinary concentrating ability of the kidney. The majority of the transport in the thin limb of Henle is passive. As tubular fluid moves from the proximal tubule to the thin descending limb the epithelial tight junctions become less permeable to Na+ and Cl-. However, these cells are particularly permeable to H2O and facilitate passive H2O reabsorption. Consequently, the osmola lity of the tubular fluid progressively increases as it moves toward the renal papillary ti p. In contrast to the descending limb, the thin ascending limb has low H2O permeability, but a very large Na+ and Clpermeability. Consequently, Na+ and Clare passively reabsorbed along th e ascending thin limb. Although the electrolyte transport in the thin ascending limb participates in the countercurrent multiplier, the overall quantity of Na+ reabsorbed in this region remains relatively small. The majority of Na+ reabsorbed in the loop of Henle takes place in the thick ascending limb. The thick ascending limb is responsible for reabsorbing greater than 25% of the filtered load of Na+ through both active transport and passive paracellular diffusion (Figure 1-3) (Gumz et al., 2009c). Active Na+ transport in these cells is coupled to the reabsorption of K+ and Clvia the action of the electro-neutral Na+-K+-2Cl--cotransporter (NKCC2) (Gamba et al., 1994). Reabsorbed Na+ is pumped across the basolatera l membrane by the ubiquitous Na+/K+-ATPase. Basolateral Clchannels (ClC-Kb) facilitate electrogenic Clefflux into the interstitial fluid (Estevez et al., 2001). Additionally, the electrogenic Clgradient is used to cotransport Cland K+ on a basolateral K+/Clsymporter (KCC) (Greger, 1985 ). The activity of NKCC2 is dependent on K+ recycling at the apical membrane via ROMK channels (Wang, 2006). In addition, apical K+ recycling via ROMK, in combination with basolateral ClC-Kb channels,

PAGE 24

24 generates a lumen positive charge. This positiv e transepithelial potential difference serves to drive a significant amount of pa ssive paracellular diffusion of Na+. Loss of function of NKCC2, ROMK, or CIC-Kb results in Bartters synd rome, which is characterized by chronic Na+ wasting, hypokalemia and hypovolemia with activation of re nin and aldosterone without hypertension (Lang et al., 2005; Unwi n and Capasso, 2006). In addition to mediating bulk Na+ reabsorption, the thick as cending limb also mediates tubuloglomerular feedback (TGF) in specialized macula densa cells in the cortical thick ascending limb (Schnermann, 1998). Furthermore, the thick ascending limb also has an important role to generate a medullary osmotic gradient that is requi red to concentrate the urinary output (Gottschalk and Mylle, 1958). Similar to the thin ascending limb, the thick ascending limb remains impermeable to H2O. As a result, active NaCl reabsorption via NKCC2 causes the luminal fluid to become hypotonic, which is a key determinant of downstream H2O transport in the collecting duct (Sands and Layt on, 2009). A larger medullary osmotic gradient decreases the osmolality of the tubular fluid l eaving the thick ascending limb and proportionally increases downstream H2O reabsorption in the collecting duc t. Pharmacological blockade of NKCC2 with furosemide or bumetanide prevents the generation of the medullary osmotic gradient and reduces downstream H2O transport leading to a diuresis Clinically, these inhibitors are referred to as loop diuretic s (Shankar and Brater, 2003). Sodium Transport in the Distal Convoluted Tubule By the tim e the filtrate enters the distal convol uted tubule greater than 90% of the filtered Na+ has been reabsorbed (Gumz et al., 2009c). Th e role of the distal convoluted tubule, along with the downstream connecting segment and colle cting duct system, is to reabsorb the precise amount of remaining Na+ to maintain whole body Na+ and fluid homeostasis. Not surprisingly,

PAGE 25

25 Na+ transport processes in these regions of the re nal tubule are subject to numerous regulatory factors (Bhalla and Hallows, 2008; Me neton et al., 2004; Zeidel, 1993). The major Na+ transport mechanism in the distal convoluted tubule is the apical Na+/Clcotransporter (NCC) (Figure 1-4) (Gamba et al., 1994; Gumz et al., 2009c). Reabsorbed Na+ is pumped through the basolateral Na+/K+-ATPase, while Clexits via KCC or basolateral Clchannels. Blockade of NCC with thiazide di uretics, a first line treatment for clinical hypertension, results in an increase in excretion of Na+ and H2O in the urine, processes referred to as natriuresis and diuresis, respectively (Sal vetti and Ghiadoni, 2006). Evidence also exists that the distal convoluted tubule expresses other Na+ reabsorptive mechanisms such as apical NHE2 (Chambrey et al., 1998) and apical epithelial Na+ channels (ENaC) (Loffing et al., 2000). ENaC is an important target of aldosterone, a mineralocorticoid hormone that acts to increase Na+ reabsorption and blood pressure, and will be discussed in further detail below. Sodium Transport in the Collecting Duct The colle cting duct is the terminal site for re gulated fluid and electr olyte transport by the kidney. The collecting duct is composed of prin cipal cells and intercalated cells that each specialize in different types of solute transport. Na+ transport occurs in principal cells and is primarily mediated by apical ENaC and the basolateral Na+/K+-ATPase pump (Figure 1-5) (Loffing et al., 2000; Masilamani et al., 1999). In the collecting duc t principal cell, H2O is also transported and occurs almost exclusively through the coordinated action of apical and basolateral aquaporin (AQP) cha nnels (Nielsen et al., 2002). Th e apical AQP isoform is AQP2 and the basolateral AQP isoforms include both AQP3 and AQP4. Most notably, the expression of apical AQP2 is directly controlled by an tidiuretic hormone (ADH, also known as arginine vasopressin). ADH is formed in the hypothalamus and transported to the pituitary gland where it is released in response to hyperosmolality, hypo tension, hypovolemia, and other factors such as

PAGE 26

26 angiotensin II (Ang II) (von B ohlen und Halbach and Albrecht, 2006). Following release, ADH activates vasopressin 2 (V2) receptors in the collecting duct th at mediate the insertion of AQP2 channels into the apical membrane. The basolateral exit pathway for H2O is mediated by AQP3 and AQP4 channels (Nielsen et al., 2002). Collecting duct Na+ transport also influen ces the transport of K+ and Cl-. In the traditional view, net Na+ reabsorption generates a lumen negative potential difference to drive paracellular Clreabsorption in addition to active Cltransport in adjacent inte rcalated cells. This lumennegative potential difference promotes luminal K+ secretion via apical K+ channels (Koeppen et al., 1983; Sansom et al., 1984; Stokes, 1981). However, Clreabsorption can occur in the absence of basolateral Na+/K+-ATPase activity, which is required to maintain the lumen negative potential difference that drives Cltransport in the classical m odel (Wingo, 1989a, b; Zhou et al., 1998). Moreover, the electro-neutral apical secretory pathway for K+ is highly dependent on Cland is consistent with the actions of an apical K+/Clcotransporter (Wingo, 1989b) (Figure 1-5). The movement of Na+ through ENaC is passive as the ion moves down its electrochemical gradient generated by the basolateral Na+/K+-ATPase pump. ENaC is a heterotrimeric membrane channel consisting of and subunits transcribed from three individual genes, scnn1a, scnn1b and scnn1g, respectively (Bhalla and Hallows, 2008). The importance of ENaC is emphasized by fact that activating mu tations in the genes that encode for ENaC or ENaC ( scnn1b or scnn1g) result in a severe hypertensive phe notype called Liddles syndrome (Lang et al., 2005; Martinez-Aguayo and Fardella, 2009). In contrast, inactivating mutations in ENaC, ENaC, or ENaC ( scnn1a, scnn1b, or scnn1g) cause pseudohypoaldosteronism type I, which is a severe Na+ wasting syndrome associated with hype rkalemia and metabolic acidosis (Riepe, 2009). Undoubtedly, renal Na+ transport and blood pressure are closely related. In the collecting

PAGE 27

27 duct, the expression of ENaC ( scnn1a) represents the rate-limiting step for forming an active channel. However, ENaC is further regulated by mechanisms that control the channel activity as well as the cellular localization and proteasomal degradation of ENaC. Regulation of Renal Sodium Transport and Blood Pressure Com pounds that inhibit renal Na+ transport represent a major class of antihypertensive drugs. In fact, hypertensive drugs are the most commonly prescribed drugs in the world as hypertension is estimated to affect over 1 billion people worldwide (Kearney et al., 2005). Although cardiovascular and renal control of blo od pressure has been described, the mechanisms driving hypertension are poorly understood. Indeed, greater than 90% of hypertensive patients are diagnosed with essential hypertension, for wh ich there is no known cause (Binder, 2007). Most of the known etiologies of hypertension such as renovascula r disease, hyperaldosteronism and gene mutations, converge on the kidney. In deed, most forms of chronic kidney disease regardless of the primary etiology result in secondary hypertension. Not surprisingly, the numerous hormonal, neuronal, and paracr ine mechanisms that modulate renal Na+ transport are of particular importance for blood pressure control. Aberrations in any of these mechanisms can lead to pathological changes in blood pressure. A relationship between systemic arterial pressure and renal Na+ excretion also exists and is known as the phenomenon of pr essure natriuresis (Guyton, 1991). Normally, an increase in arterial blood pressure ultimately results in an increase urinary H2O and Na+ excretion that minimizes the increas e in blood pressure (Guyton et al., 1972). In general, small changes in total body Na+ content can lead to large changes in extracellular fluid volume and blood pressure. Consequently, most f actors that control Na+ balance affect renal Na+ absorption mechanisms in the di stal nephron and collecting duct.

PAGE 28

28 Glomerular Filtration Rate When GFR changes the kidney responds by adjusting the net rate of Na+ excretion. This phenomenon is defined as glomerulotubular balance. Changes in GFR are achieved by alterations in factors that affect either glomerular ultrafiltration coefficient (Kf) or the net filtration pressure (Brenner and Rector, 2008; Vallon, 2003). Glomerular mesangial cells have the ability to influence Kf due to their intrinsic contractile pr operties. Increased mesangial tone can result in a decrease in glomerular filtration surface area and a consequent decrease in GFR. The inverse is also true, and fact ors that relax mesangial cells can result in an increase in GFR and net Na+ filtration. A change in net glomerular f iltration pressure is typically a consequence of a change in PGC due to afferent and efferent arteriol e vascular resistances. However, the control of GFR through the modulation of arteriol e vascular tone is complex. For example, preferential vasoconstriction of the efferent arteriole can lead to an increase in PGC and GFR. Conversely, vasoconstriction of the a fferent arteriole or both the a fferent and efferent arterioles results in a decreased PGC and a decrease in GFR. The control of both Kf and arteriole vascular tone is dynamic and involves various signaling molecules. The sympathetic nervous sy stem plays an important role in controlling arteriole vascular tone. In fact, endogenous catecholamines, (norepinephrine, epinephrine, and dopamine) have important roles in both the toni c and phasic regulation of renal vascular tone. Norepinephrine, along with Ang II and ET-1, all result in potent vasoconstriction of both afferent and efferent arterioles. Cons equently, these factors lead to a decrease in GFR and Na+ and fluid retention. Ang II and ET-1 preferen tially constrict the efferent arte riole. Factors that decrease the vascular tone of both arterioles include ni tric oxide, dopamine, acetylcholine, prostaglandin E2, and prostacyclin. Furthermore, some hormo nes such as bradykinin and adenosine have no reported effects on the afferent arte riole while they selectively rela x the efferent arteriole. Under

PAGE 29

29 these conditions, net glomerular filtration pressure will decrease due to decreased hydrostatic pressures in the glomerular capillaries. Tubuloglomerular Feedback Another im portant feature of renal Na+ transport is the process by which an individual nephron autoregulates its own blood flow and GF R. This process is called tubuloglomerular feedback (TGF) and occurs in the juxtaglomerula r apparatus that is composed of specialized macula densa cells, extra-glomerular mesangial ce lls, and specialized reninsecreting cells of the afferent arteriole. Macula densa cells sense the composition of the filtrate delivered to the distal nephron by sensing the transport of ions through the apical NKCC2. A change in transport at the macula densa results in inverse changes on renin release and GFR. In the current model (Vallon, 2003), an increase in NKCC2 activity results in an increase in adenosine production and consequent adenosine A1 receptor activation on th e adjacent extra-glomerular mesangial cells. This is followed by an increase in intracellular calcium and calcium currents that inhibit the release of renin and vasoconstric tion of the afferent arteriole. The latter effect immediately decreases RBF and GFR. The secretion of reni n activates the renin-a ngiotensin system and results in decreased Na+ excretion as discussed in detail below. Natriuretic Signals Various natriuretic signals ac t in the kidney including nitric oxide, prostaglandin and natr iuretic peptides. Brain natriuretic peptide a nd atrial natriuretic peptide are produced by the heart and have both vascular and tubular acti on in the kidney (Martinez-Rumayor et al., 2008). These peptides act to vasodilate the afferent arte riole to increase GFR as well as inhibit classical Na+ retaining mechanisms such as renin release and Ang II production. Other hormones that have reported natriuretic prope rties include glucag on (Gutzwiller et al ., 2006), progesterone (Oparil et al., 1975), and parathyr oid hormone (Agus et al., 1973).

PAGE 30

30 Antinatriuretic Signals Antinatriur etic signals act to increase renal Na+ reabsorption. The most important hormone pathway is the renin-angiotensin pathwa y and the consequent induction of aldosterone. These hormones will be described in detail belo w. Other well-known hormones that stimulate Na+ reabsorption include cortisol estrogen, growth hormone, thyr oid hormone and insulin. Net Na+ reabsorption in the collecting duct can also be stimulated indirectly by ADH; a hormone that acts to increase the H2O permeability of the cortical and medullary collecting ducts and decrease net renal H2O excretion. Notably, ADH and aldosterone act in coordinati on to preserve blood volume and blood pressure dur ing volume depletion. Renin-Angiotensin-Al d osterone System A central theme in the regulation of renal Na+ balance and blood pressu re is the activation of the renin-angiotensin-aldoster one system. Indeed, the vast majo rity of inheritable monogenetic hypertension results from a defect in this pathway (Martinez-Aguayo and Fardella, 2009). The two major effectors of this path way are aldosterone and Ang II. Ang II is the biologically active eight amino acid peptide that mediates an incr ease in blood pressure th rough its action on the vasculature as well as renal epit helium. Renin is a monospecific as partyl proteolytic enzyme that is synthesized and secreted from specialized a fferent arteriole cells of the juxtaglomerular apparatus. Renin is responsible for the conversion of angioten sinogen into the ten amino acid peptide angiotensin I (Ang I). Angiotensin conve rting enzyme (ACE) then converts Ang I into Ang II. ACE is predominantly localized to the lu ngs; however, it is also widely expressed on the luminal surface of vascular endothelial cells. The later enzymatic r eaction occurs freely, consequently the synthesis and secretion of reni n is the rate-limiting step in the production of Ang II. Renin is released in res ponse to various stimuli including a decrease in afferent arteriole pressure and a decrease in NaCl deliv ery to the macula densa (via TGF).

PAGE 31

31 Ang II has multiple actions that modulate renal Na+ excretion and increase blood pressure. Ang II binds to angiotensin 1 (AT1) receptors to produce potent vasoconstriction of both afferent and efferent arterioles, as well as systemic resistance vessels (Mehta and Griendling, 2007). AT1 receptor activation is also indicated in Ang II-dependent cardiac remodeling. Furthermore, Ang II acts on the brain to stimulate ADH release from the pituitary gland, as well as to stimulate thirst centers. Ang II further potentiates the vaso constrictive effect by s timulating norepinephrine release from sympathetic nerves. In fact, AT1 re ceptor blockers (ARBs) and ACE inhibitors are two major classes of antihypertensi ve drugs that are used clini cally (Izzo et al., 2008). Ang II also has a well-known and very important role in stimulating the adrenal cortex to release aldosterone, a steroid hormone with im portant actions to control renal Na+ transport and fluid homeostasis (Blair-West et al., 1963; Ganong et al., 1966). The Aldosterone System Aldosterone was originally id entified in the early 1950s as key physiological horm one that participates in the conservation of salt and minerals; hence the name mineralocorticoid (Grundy et al., 1952; Simpson SA, 1953). In additi on to Ang II, aldosterone is released in response so several other stimuli includi ng stimulation by pituitary hormone and adenocorticotropic hormone (A CTH) (Romero et al., 2007; Spat and Hunyady, 2004). Once released, aldosterone acts on certain polarized epith elial cells, including the principal cells of the distal nephron and collecting duct, to increase Na+ reabsorption. In general, the action of aldosterone is mediated through the mineralo corticoid receptor (MR); a ligand-dependent transcription factor responsibl e for orchestrating the transc ription of genes involved in transepithelial Na+ transport (Fuller, 2004). The response to aldoster one is generally biphasic characterized by both an early a nd late response (Gaeggeler et al., 2005). The early response is predominantly transcriptional, whereas the late response involves an increase in Na+ transport. In

PAGE 32

32 addition, several lines of eviden ce suggest that aldoste rone can also mediate rapid, non-genomic effects via second messenger pathways that may or may not involve the activation of MR (Boldyreff and Wehling, 2003a; Harvey et al., 2008). The net effect of aldosterone is to couple the apical reabsorption of Na+ by ENaC to the basolateral Na+/K+-ATPase. Indeed, increased plasma concentrations of circulating al dosterone can lead to inappropriate Na+ retention and hypertension. Classical Aldosterone Targets A basic m odel of aldosterone action is shown in Figure 1-6. Aldosterone binds to and activates cytoplasmic MR. Ligand binding leads to a conformational ch ange in MR and the release of chaperone heat shock proteins. Th is ligand-dependent conf ormation also reveals multiple nuclear localization sign als and causes the receptor to unde rgo nuclear translocation and binding to the deoxyribonucleic aci d (DNA) sequence of target ge nes to stimulate or repress transcription. Classical aldos terone induced genes include scnn1a ( ENaC) (Sayegh et al., 1999), atp1a1 (Na+/K+-ATPase 1) (Kolla et al., 1999), and sgk1 (serumand glucocorticoidregulated kinase-1) (Loffing et al., 2001; Webster et al., 19 93). Increasing the expression levels of ENaC and Na+/K+-ATPase will increase a cells capacity to mediate electrogenic Na+ transport. Sgk1 is a serine/threonine kina se that is homologous to protei n kinase B/Akt kinases and it is highly conserved across mammalian species (M cCormick et al., 2005). Sgk1 functions to enhance Na+ transport positively regulates the apical localization of ENaC and stimulates the channel open probability (Vallon and Lang, 2005). A major function of Sgk1 is to mediate the phosphorylation of ubiquitin ligase neural pr ecursor cell-expressed developmentally downregulated (gene 4) protein (N edd4-2) (Debonneville et al., 2001; Flores et al., 2005) (Figure 1-6). Nedd4-2 binds to and ubiquitinylates ENaC, which nega tively controls ENaC surface expression and causes rapid ENaC turnover. However, phosphoryla tion of Nedd4-2 by Sgk1

PAGE 33

33 creates a docking site for 14-3-3 adaptor prot ein and prevents Nedd4-2 from binding ENaC by steric hindrance. Blocking Nedd4-2 precludes ENaC ubiquitinyl ation, internalization, and degradation. Indeed, aldosterone stimulation results in enhanced apical membrane expression of all three ENaC subunits (Masilamani et al., 1999). The Mineralocorticoid Receptor Aldosterone action is predom inantly mediated through MR at the le vel of transcription (Arriza et al., 1987). MR is a member of the nuclear receptor family that includes the estrogen, progesterone, androgen, and glucocorticoid receptor (GR). The MR gene ( nr3c2 ) has eight coding exons and two untranslated exons. The first two exons are a lternatively spliced from exon 1 or 1 (Arriza et al., 1987) (Figur e 1-7). The gene codes for a 107 kDa protein with four distinct functional domains including an N-terminal domain (NTD), a DNA binding domain (DBD), a hinge region, and a ligand binding domain (LBD) (Figure 1-7). This structure is highly homologous to the well-characterized GR (Arriza et al., 1987) (Figure 1-9). The action of MR is consistent with classi cal steroid receptors (Beato and Klug, 2000). In the absence of ligand, MR is lo cated in the cytoplasm and is stabilized in an inactive conformation through the interac tion of the LBD with several heat shock proteins (HSPs). Aldosterone binding leads to a conformational cha nge in MR structure that causes the HSPs to be released and nuclear localization signals to be revealed. Aldosterone-bound receptors are transported into the nucleus as dimers where they bind directly to specific DNA regions known as hormone response elements (HREs). The DBD is 66 amino acids long and is highly conserved (>90% homology) among steroid receptors. This domain contains two zinc fingers that facilitate binding to an impe rfect palindrome that is classica lly represented as the consensus sequence: 5-GGTACAnnnTGTTC T-3 (Beato, 1989).

PAGE 34

34 The hinge region is responsible for the interac tion of the NTD and the LBD. Disruption of the interface between the NTD and LBD by spironolactone, an MR antagonist, prevents MR activity and demonstrates the func tional importance of th is interaction (Rogerson et al., 2003). The NTD is the only domain that displays a si gnificant amount of dive rsity between steroid receptors. However, it is highly evolutionarily conserved across species (Pascual-Le Tallec and Lombs, 2005) indicating that the NTD houses impor tant activation functions specific to MR. The NTD contains two transact ivation domains (AF1a and AF 1b) (Pascual-Le Tallec and Lombs, 2005) and numerous modifi cation sites (Figure 1-7). AF1a and AF1b transactivation functions are generally thought to be ligand-independent, but recent evidence has revealed mineralocorticoid-selective AF1 activity as well. The LBD also has a transactivation domain, AF2, which is formed and activated in a ligand-dependent, but not ligand-specific ma nner (i.e. both mineralocorticoids and glucocorticoids can activate AF2). The functiona l importance of AF2 is evident in patients suffering from type I pseudohypoaldosteronism due to naturally occurring missense mutations in the LBD (Pascual-Le Tallec and Lombs, 2005) AF2 is highly conserved among steroid receptors and is capable of interacting with several transcriptional coactivators, including the steroid receptor coactivator-1 (SRC-1). SRC-1 mediates the formation of the transcriptional preinitiation complex by the sequential re cruitment of SWI/SNF chromatin remodeling complexes, histone-methyltransferases including CARM1 and PRTM1, and the histone acetylase cyclic adenosine monophosphate (cAMP) resp onse element binding pr otein-binding protein (CBP/p300) (Li et al., 2005; Pascua l-Le Tallec and Lombs, 2005). Ligand specificity of the mineralocorticoid receptor MR can bind both m ineralocorticoids and gl ucocorticoids with approximately the same affinity (KD = 0.5 nM and 0.7 nM, respectivel y) (Arriza et al., 1987). Na+-transporting epithelia

PAGE 35

35 confer aldosterone-selective MR ac tivity largely by expression of 11 -hydroxysteroid dehydrogenase type II (11 HSD-2), which converts cortisol into inactive cortisone (Whorwood et al., 1994). Naturally occurring defects in 11 HSD-2 activity leads to Apparent Mineralocorticoid Excess, a syndr ome characterized by severe hype rtension (Mune et al., 1995). This disease exemplifies the importance of 11 HSD-2 in protecting MR from spurious glucocorticoid activation. Although mineralocort icoids and glucocorticoids have similar KDs for MR, glucocorticoids have different transactivation activities than mineralocorticoids. Moreover, despite their similar structures, mineralocortic oids and glucocorticoids induce ligand-specific conformational changes in the LBD, which alte rs the interaction between the NTD and LBD (Lombes et al., 1994). Compared to cortisol, al dosterone induces a stro nger interaction between the NTD and LBD of MR (Rogerson and Fuller, 2003) Recently, it was discovered that these ligand-specific conformational ch anges extend to the AF1a domain of the NTD. Aldosterone, but not cortisol, causes an exclusive interacti on of AF1a and ribonucleic acid (RNA) helicase A (RHA) (Kitagawa et al., 2002). Furthermore, aldos terone-specific recruitm ent of RHA leads to the association of CBP, which has intrinsic hi stone acetyltransferase activity. The selective association of a CBP may result in aldosterone-specific changes in chromatin structure, and this potential mechanism of aldosterone-mediated tr anscription should be investigated further. Ligand promiscuity and overlap of nuclear receptors It is well accepted that mi neralocorticoid responsive cells of the distal nephron and colle cting duct inactivate gl ucocorticoid ligands by 11 HSD-2. However, these cells express the glucocorticoid receptor (GR) (ToddTurla et al., 1993) and the role of GR is not well defined in 11 HSD-2 expressing cells. MR is highly homol ogous to the glucocortic oid receptor (GR) (Figure 1-9). Not surprisingly, aldos terone is also able to bind GR with a slightly lower affinity than it binds to MR (KD = 14-60 nM) (Arriza et al., 1987). MR and GR have overlapping DNA

PAGE 36

36 target genes and the two receptors can heterodimerize to mediate transcription of certain genes (Gaeggeler et al., 2005; Ou et al ., 2001). In fact, both MR and GR are able to stimulate Na+ transport in IMCD cells (Husted et al., 1990). It is possible that aldosterone action is mediated through both MR and GR in mineralocorticoid-re sponsive cells such as collecting duct cells (Figure 1-10). However, the diversity in MR and GR NT Ds suggests that they have different transactivation functions and may interact with different transcriptional coactivators. To date, the only known MR-specific coactiv ator is the elongation factor ELL. ELL binds directly to the NTD of MR and mediates potent AF1b transac tivation (Pascual-Le Tallec and Lombs, 2005). Interestingly, ELL strongly represses the transa ctivation of GR, and ELL may play an important role in preventing illicit GR-mediated transcripti on of mineralocorticoid target genes (Pascual-Le Tallec et al., 2005). Taken togeth er, a specific interaction between MR and GR has the potential to stimulate or repress transcri ption of target genes in a different manner than either receptor acting as an individual homodimer. Clearly, the differences in aldosterone-specific MR and GR transactivation are functionally import ant and warrant furt her investigation. Hormone Response Elements In general, steroid hormone receptors bind to D NA as dimers and the corresponding DNA element consists of two half-sites in which each receptor interacts wi th the DNA. This is reflected in the fact that efficient HREs often c onsist of multiple binding sites. Moreover, halfsite orientation is known to affect both hormone receptor binding and activity (Geserick et al., 2005). The human ENaC gene ( scnn1a) contains two putative HREs; one with half-sites arranged as direct-repeats and the other as an imperfect palindrome. Only the palindromic HRE was capable of stimulating transcription as de monstrated by deletion analysis (Sayegh et al., 1999). GR is known to bind to the DNA as a hom odimer in a head-to-head orientation that

PAGE 37

37 favors dimerization on an inverted repeat (Luisi et al., 1991) (Figure 1-11). However variations in half-site spacing and orientati on are common (Aumais et al., 1996). Emerging Aldosterone Targets Because of aldosterones physiolog ical role in Na+ balance, its mechanism of action has been extensively studied. Recent reports have id entified several novel tran scriptional targets of aldosterone. For example, microarray analysis identified the glucocor ticoid-induced leucine zipper protein ( gilz ) as an aldosterone-induced transcri pt (Soundararajan et al., 2005). The protein Gilz was later shown to induce Na+ transport in Xenopus ooc ytes and renal epithelial cells. Fakitsas et al. performed a microarray analysis on dissected CCD segments from mice treated with aldosterone for one hour (Fakitsas et al., 2007). Three novel aldosterone-induced transcripts were identified, whic h included the gene encoding fo r the protein-related to DAN and Cerberus, activating transcription factor 3, a nd ubiquitin-specific pr otease 2-45 (Usp2-45). Subsequent experiments showed that Usp2-45 stimulated a Na+ current in Xenopus oocytes and renal epithelial cells. It was further demons trated that Usp2-45 de-represses ENaC by removing the ubiquitin groups added by the ubiqu itin ligase neural precursor cell-expressed developmentally downregulated ge ne 4 protein (Nedd42). Gumz et al. used microarray to identify early aldosterone response genes in IMCD cells at 1 h (Gumz et al., 2003). This approach identified several novel aldosterone-stimulated gene s including connective tissue growth factor, period 1 ( per1 ), and endothelin-1 ( edn1). Interestingly, Per1 was recently shown to regulate both the tonic and al dosterone-dependent expression of scnn1a ( ENaC) messenger RNA (mRNA) in collecting duct cells (Gumz et al., 2009b). Of particul ar interest was the induction of edn1. The edn1 gene encodes for preproendothelin -1, the precursor to ET-1. ET-1 plays a complex role in regulating vascular tone and fluid homeostasis (see below).

PAGE 38

38 Demonstration of an interaction between aldoste rone and ET-1 would have a significant impact on vascular and renal physiology. The Endothelin-1 System ET-1 was discovered in 1985 by Hickey and coll eagues as an endothelium -secreted peptide that induced prolonged vasoconstriction (Hickey et al., 1985). The gene product of ET-1 is a 212 amino acid prepropeptide that must undergo several enzymatic cleavages to form the biologically active, 21 amino acid peptide (Figure 1-12). The fina l cleavage step is mediated by endothelin converting enzymes (ECE-1 and ECE2), which cleave Big ET-1 (1-38 amino acids) to ET-1 (1-21 amino acids). ECE-1 and ECE-2 are integral membrane metalloproteases that have distinct functional characteristics. ECE-1 is an extracellula r integral membrane protein and rapidly converts exogenous Big ET-1 to ET1. Conversely, ECE-2 is active in acidic environments and does not convert exogenous Big ET-1 efficiently; s uggesting that ECE-2 functions primarily intracellularly (Emoto and Yanagisawa, 1995). Cardi ovascular production of ET-1 occurs primarily in endothelial cells, but has also been demonstrated in vascular smooth muscle and epicardial cells. ET-1 mediates both autocrine and paracrine signaling through two ET-1 receptor subtypes, ETA and ETB (Figure 1-13). ETA receptors are localized to vascular smooth muscle and mediate vasoconstriction, pr oliferation, and hypertrophy (Davenport, 2002; Molenaar et al., 1993) (Figure 1-13). ETB receptors are localized to endothelial cells where they mediate vasodilation by the release of nitric oxide and prostacyc lin (D'Orleans-Juste et al., 2002; Edwards et al., 1992; Vassileva et al., 2003) (Figure 1-13). However, there is also evidence that ETB receptors located on vascular smooth muscle mediate vasoconstriction (Davenport et al., 1993; Just et al., 2004), signifying the existence of cell-specific signal transduction pathways and emphasizing the paracrine nature of ET-1 signaling.

PAGE 39

39 Systemic ET-1 System Intravenous injection of ET-1 leads to tr ansient hypotension f ollowed by a sustained increase in arteri al pressure (Clavell et al., 1995). ETA antagonism attenuates the increase in blood pressure, indicating predominant ETA-mediated vasoconstriction. Conversely, ETB antagonism abolishes the transient depressor response and exacerbates the pressor response, which indicates that ETB receptors are largely responsible for vasodilation. ETB also functions as a clearance receptor, and ETB antagonism results in an increas e in circulating ET-1 levels. Consequently, the increase in blood pre ssure in the presence of systemic ETB antagonism may result from reduced ETB-mediated vasodilation or enhanced ETA-mediated vasoconstriction. High doses of exogenous ET-1 are al so associated with antidiures is and antinatriuresis, whereas, low doses of ET-1 leads to tran sient natriuresis and diuresis, suggesting that ET-1 plays an important role in modulating renal function (Clavell et al., 1995). The Renal ET-1 System As depicted in Figure 1-14, the kidney is bot h a functional target a nd source of ET-1. In fact, the highest concentration of ET-1 in the body has been consistently localized to the inner m edulla (Kitamura et al., 1990; Pupilli et al., 1994). Within the inner medulla, both IMCDs and vasa recta endothelial cells ar e known to produce ET-1 (Chen et al., 1993; Kohan and Fiedorek, 1991; Pupilli et al., 1994). In vivo data also demonstrates ET-1 synthesis in the glomeruli, proximal tubules, juxtaglomerular cells, medullary thick ascending limb, cortical collecting duct (CCD) and outer medullary collecting duct (OMCD) (Battistini et al., 2006; Kotelevtsev and Webb, 2001; Lehrke et al., 2001). Expression of ET-1 receptor subtypes largely parallels ET-1 synthesis, with the highest concentration in the inner medulla (B attistini et al., 2006; Wendel et al., 2006). In addition, ETB receptors are more numerous than ETA receptors and are the predominant receptor subtype in the hu man kidney (Pupilli et al., 1994). ETB receptors are

PAGE 40

40 expressed in proximal tubules, colle cting ducts, peritubular capillarie s, vasa recta, glomeruli, and both afferent and efferent arterioles (Battistin i et al., 2006; Davenport et al., 1993; Gellai et al., 1994; Kohan et al., 1992; Wendel et al., 2006). ETA receptors are abundantly expressed in the cortical vasculature including the arcuate arteries and both afferent and e fferent arterioles, but expression has also been identifi ed in mesangial cells, descendi ng vasa recta, and, to a lesser extent, renal tubule cells (Batti stini et al., 2006; Inscho et al ., 2005; Kuc and Davenport, 2004; Wendel et al., 2006). The heterogeneous population of ETA and ETB receptors demonstrates that ET-1 has a complex role in the kidney. Evidence exists for ET-1 mediating effects on renal hemodynamics (Inscho et al., 2005), Na+ and water homeostasis (Kohan, 2006) and acid-base balance (Khanna et al., 2005). To add to the complexity, the e ffect of ET-1 depends on its dose and source. A high dose of exogenous ET-1 causes profound cortical vasoconstriction of a fferent and efferent arterioles, arcuate arteries and mesangial cells. This vasoconstriction is largely attributed to the activation of ETA receptors. However, there are conflicting reports regarding the role of the ETB receptor in vasoconstriction of th e afferent arteriole (Baylis, 1 999; Inscho et al., 2005). As a result of cortical vasoconstriction, renal blood flow (RBF) and GFR subsequently decrease and antidiuresis and antinatriuresis ar e observed as secondary changes (Clavell et al., 1995; Katoh et al., 1990). In contrast to cortical action, ET-1 results in medullary vasodilation, even at doses capable of inducing cortical vasoconstriction (Va ssileva et al., 2003). Me dullary vasodilation is mediated by ETB receptors and functions through th e production of nitric oxide and prostaglandins (Chou and Porush, 1995; Pollock a nd Pollock, 2008). Interestingly, low doses of ET-1 lead to transient natriuresis and diuresis by a mechanism that is also attributed to ETB receptors (Clavell et al., 1995). Vasodilation of the inner medulla will increase medullary blood

PAGE 41

41 flow and result in enhanced Na+ excretion (Cowley, 1997). However, in addition to vasodilatory mechanisms, ET-1 can mediate direct effects on Na+ and water transport. ET-1 in Renal Water Transport ET-1 controls water transport by m odulating ADH responsivene ss of the collecting duct. Oishi et al. originally demons trated that ET-1 inhibits ADH-stimulated water permeability in isolated perfused IMCD segments (Oishi et al., 1991). The decrease in water permeability results from ETB-mediated inhibition of adenylate cyclase and cAMP accumulation (Kohan, 1993). However, the most unambiguous eviden ce for ET-1s role in modulating ADH action comes from a series of collecting duct edn1 and etar knockout mice. The edn1 or etar genes were selectively knocked out in principal cells of th e collecting duct with a cre recombinase driven by the aquaporin-2 promoter (Stric klett et al., 1999). Collecting duct cell edn1 knockout mice exhibit enhanced ADH sensitivity (Ge et al., 2005a). Consequently, these mice demonstrate a reduced ability to excrete an ac ute water load, exhibit a higher increase in ADHstimulated cAMP, and have lower levels of ci rculating ADH. In cont rast, collecting duct etar knock out mice demonstrate an enhanced ability to excrete an acute water load as a result of blunted ADH activity (Ge et al., 2005b). Taken t ogether, collecting duct derived ET-1 acts to inhibit ADH responsiveness through the ETB receptor; whereas, ETA receptors stimulate ADH responsiveness. Interestingly, extracellular hypertonicity stim ulates ET-1 release from IMCD cells. An increase in medullary tonicity occurs duri ng antidiuresis when medullary ADH levels are elevated. This suggests that ET-1 is stimulat ed to mediate a negative feedback mechanism on water reabsorption. Likewise, in creased tubule and vasa recta flow rate occur during salt and water loading. Although it has not be en directly observed in tubul es or vasa recta, increased flow rate and shear stress stimulate the releas e of ET-1 from many vascular and nonvascular cell

PAGE 42

42 types (Kohan, 2006). Moreover, increased IMCD shear stress results in the release of nitric oxide (Cai et al., 2000) and may be a downstream product of ET-1 synthesis. Thus, ET-1 is stimulated under several conditions where wa ter flux is maximal and suggests that ET-1 mediates an important negative feedb ack loop on water reabsorption. ET-1 in Renal Sodium Transport In 1993, Tom ita et al. demonstrated that ET-1 reversibly inhibited H2O and Cltransport in isolated CCD (Tomita et al., 1993). Mounting evidence exists that ETB receptors promote natriuresis by direct inhibition of ENaC activity through a mechanism mediated, at least in part, by nitric oxide and Src kinases (Gilmore et al., 2001). Using a patch-cl amp technique, Gallego et al. demonstrated that ET-1 inhibited amiloride-sensitive Na+ transport in an ETB dependent manner (Gallego and Ling, 1996). Moreover, ET1 inhibits medullary thick ascending limb Cltransport via an ETB-mediated increase in endothelial ni tric oxide synthase (eNOS) expression and release of nitric oxide (He rrera and Garvin, 2004). In the IM CD, ET-1 is able to stimulate eNOS (Ye et al., 2003), nitric oxide (Schneider et al., 2008), cyclic guanosine monophosphate (cGMP) (Edwards et al., 1992), and inhibit Na+/K+-ATPase via cyclooxygenase metabolites (Zeidel et al., 1989). Russell et al. demonstrated that Big ET-1 binds to the glomeruli, distal tubules, collecting ducts, and endothelial cells in human kidneys (Russell et al., 1998). In contrast to ET-1, systemic infusion of Big ET-1 at high doses lead s to profound natriuresis, diuresis, and sustained vasoconstriction (Hoffman et al., 2000). This observation likely results from local conversion of Big ET-1 to ET-1 by ECE-1 and reflects ET-1 production de novo Renal ET-1 Mediated Natriuresis in Experimental Models Medullary E T-1 is reduced in several mode ls of experimental hypertension including spontaneously hypertensive, Dahl S, and Prague hypertensive ra ts (Kohan, 2006). However, the

PAGE 43

43 importance of ETB-mediated natriuresis was originally re vealed in studies conducted on spotting lethal (sl) ETB deficient rats. Homozygous spotting leth al rats have a naturally occurring 301 bp deletion in etbr that leads to aganglionic megacolon a nd mortality shortly after birth. Gariepy and colleagues rescued the fatal phenotype in the enteric system by a dopamine hydroxylase promoter (Gariepy et al., 2000). Rescued spottin g lethal rats exhibit low renin salt-sensitive hypertension and do not demonstrate an acute de pressor response to systemic ET-1 injection. These rats also have higher levels of circul ating ET-1 presumably as a result of decreased ETB clearance. As mentioned prev iously, in the absence of ETB receptors levels of ET-1 can accumulate in the circulation leadi ng to the activation of vascular ETA receptors and vasoconstriction. In addition, rescued spotting lethal rats have enhanced ETA-mediated sympathetic tone that was also implicated in th e observed increase in blood pressure (Ohkita et al., 2005). However, selective ETA antagonism only partially decr eased blood pressure; whereas, treatment with the ENaC inhibitor, amiloride, led to the complete normalization of blood pressure. This data strongly supports the role of ETB-mediated inhibition of ENaC. However, the most definitive evidence of ETB-mediated natriuresis comes from collecting duct cell specific edn1, etar and etbr knockout mice. Collecting duct edn1 knockout mice are hypertensive on a normal NaCl diet (Ahn et al., 2 004). These mice are also salt-sensitive as demonstrated by their redu ced ability to excrete Na+ in the presence of a NaCl challenge. Treatment with amiloride corrected the inappropriate Na+ retention and normalized the blood pressure. Clearly, collecting duct derived ET1 plays an important role in inhibiting Na+ reabsorption. Collecting duct ETB knockout mice also develop hype rtension due to impaired Na+ excretion, but to a lesser extent than collecting duct ET-1 knockout mice (Ge et al., 2006). This indicates that ETB receptors located on the collecti ng duct are functionally important in

PAGE 44

44 mediating Na+ excretion, but surrounding ETB receptors likely compen sate by producing nitric oxide which is readily membrane permeable and can rapidly diffuse into neighboring cells. In contrast to ET-1 and ETB, collecting duct ETA knockout mice exhibit normal Na+ excretion on both a normal and high NaCl diet (Ge et al., 2005). Collectively, these data unambiguously establishes the role for collecting duct ET-1 and ETB receptors in modulating transepithelial Na+ transport in the collecting duct. Regulation of the Renal ET-1 System. ET-1 has well defined ef fects to promote Na+ excretion and many components of the medullary ET-1 system are upregulated in respon se to a high NaCl diet, including ET-1, ECE-1, and ETB (Fattal et al., 2004; Herrera and Garvin, 2005; Tsai et al ., 2006; Vassileva et al., 2003). These observations provide direct evidence fo r a physiological role of ET-1-mediated Na+ excretion. Furthermore, Herrera and colleagues demonstrated that a hi gh salt diet increases medullary osmolality and stimulates eNOS expr ession in the medullary thick ascending limb by an ET-1 and ETB mediated pathway (Herrera and Garv in, 2005). Stimulation of eNOS will increase levels of nitr ic oxide and inhibit Na+ transport. In addition, hypertonicity also stimulates ET-1 synthesis and release from the IMCD (Herrera and Garvin, 2005; Kohan and Padilla, 1993). In normal humans, plasma ET-1 is not affected by dietary salt intake, but urinary ET-1, a marker of renal-derived ET-1 (Serneri et al., 1995), positively correlates with Na+ excretion and urinary volume (Modesti et al., 19 98). These data suggests that renal ET-1 may participate in normal natriuretic pr ocesses in a healthy humans. There is also extensive literature demonstra ting the functional regula tion of the renal ET-1 system in response to mineralocorticoid-i nduced hypertension. Me dullary ET-1, ECE-1, and ETB expression are upregulated in the pre-hypertensive and hype rtensive deoxycorticosterone acetate (DOCA)salt treated rat (Hsieh et al., 20 00; Pollock et al., 2000; Tostes et al., 2000).

PAGE 45

45 Furthermore, blockade of ETB in DOCA-salt sensitive hypertensive animals exacerbates the increase in blood pressure and impairs Na+ excretion. These observations indicate that the upregulation of ET-1, ECE-1, and ETB is a compensatory mechanism that should reduce systemic arterial pressure and promote Na+ excretion. Interaction Between Aldost erone and Endothe lin-1 As mentioned in Emerging Aldosterone Targets section, the ET-1 gene ( edn1 ) has been identified as an aldosterone response gene in IMCD cells in vitro (Gumz et al., 2003). This observation is of particular interest because aldosterone and ET-1 have well defined and opposing action on Na+ transport in the collecting duct. A possible explanation for this observation is that ET-1 triggers a negativ e feedback loop on aldosterone-mediated Na+ reabsorption. This hypothesis is in agreement with the previous observations that DOCA-salt hypertensive rats upregulate their medullary ET-1/ETB pathway as a compensatory mechanism (Hsieh et al., 2000). As noted below, there is a considerable body of literature linking ET-1 and ETB signaling to a negative f eedback mechanism that inhi bits aldosterone action. The only documented negative feedback loop on aldosterone action involves the activation of extracellular receptor kinases (ERK1/2) by epidermal growth factor (EGF) and its receptor (EGFR). In renal collecting duct cell s, EGF inhibits amiloride-sensitive Na+ reabsorption through activation of ERK1/2 (Shen and Cotton, 2003). Aldosterone st imulates EGF-EGFRERK1/2 signaling cascade in principal cells, and functional patch clamp data demonstrates that this signaling cascade serves as negative feedback to control aldosterone-induced Na+ reabsorption (Grossmann et al., 2004a). There are four observations directly linking ET-1/ETB signaling to ERK1/2 activation. First, ET-1 s timulates EGFR transact ivation and downstream ERK1/2 activation in several cell models (Grantcharova et al., 2006; Portik-Dobos et al., 2006). In vascular smooth muscle, ETB receptors demonstrate a distin ct biphasic pattern of ERK1/2

PAGE 46

46 activation (Grantcharova et al ., 2006). The second phase of ERK activation involves EGFR transactivation and is dependent on th e extracellular N-terminal domain of ETB (Grantcharova et al., 2002). Second, ETB receptors stimulate G proteins-G / and downstream activation of ERK2 in kidney cells (Aquilla et al ., 1996). Third, blocking ERK activation with pertussis toxin preferentially inhibits ETB, but not ETA mediated-intracellular calc ium signaling (Saita et al., 1997). This demonstrates that known ETB action is mediated through ERK activation. Finally, protein kinase C (PKC)-mediated activation of ERK1/2 in distal tubule cells leads to the targeted degradation of ENaC. This is of particular interest because ET-1 stimulates PKC to modulate ADH activity in the same region of the nephron. Taken together, ETB has several direct links to the only known negative feedback loop on aldosterone action. However, it still remains to be determined if medullary ETB receptors stimulate directly EGF-EGFR-ERK1/2 signal transduction in the collecting duct to mediate inhibition of aldosterone. Summary Hypertensio n is a leading risk factor for cardi ovascular disease, the leading cause of death. However, the molecular mechanisms driving hyp ertension are not well defined, as more than 95% of hypertensive patients have no known etiology. However, it is known is that Na+ reabsorption by the distal nephron and collecti ng duct plays a pivotal role in determining extracellular fluid volume and blood pressure and this process is stimulated by the mineralocorticoid hormone, aldosterone. Currently, a negative feedback loop on aldosterone action in the kidney has not been defined. Gumz et al. has reported that aldosterone stimulated the edn1 mRNA and ET-1 protein in mIMCD-3 cells in vitro (Gumz et al., 2003). ET-1 has a direct inhibition of amiloride-sensitive Na+ transport through ENaC in collecting duct ce lls. Moreover, collecting duct-specific gene knockout mice have revealed an important role for ET-1 in salt-sensitive hypertension. The

PAGE 47

47 overarching hypothesis of this disserta tion is that aldosterone-stimulated edn1 mediates a negative feedback loop on aldosterone-stimulated Na+ transport in the renal collecting duct. The scientific objectives of this dissertation were to 1) character ize aldosteroneand age-dependent ET-1 expression in the kidney in vivo 2) determine if collecting duct cells were the target cell type for aldosterone-dependent edn1 stimulation, 3) characterize the mechanism of aldosterone induction of edn1 in target epithelial collecting duct cells, and 4) evaluate the role of edn1 in aldosterone-dependent gene expression. Initial whole animal experiments revealed that important aldosterone-dependent gene expression occurred in the rena l inner medulla, as well as th e known aldosterone-responsive regions of the kidney; the cortex and outer me dulla. Furthermore, ET-1 peptide levels positively correlated with age and plasma aldosterone conc entrations in the inner medulla, but not the cortex. Collecting duct cells were verified as the target cell type for aldosterone action on the edn1 gene. In vitro reporter assays were not capable of reproducing the endogenous gene activity. However, evaluation of the endogenous gene revealed aldosterone-dependent association of MR and GR with the edn1 promoter. Further analysis of the edn1 promoter revealed at least two HREs each that differed from the classi cal HRE sequence. The synthetic glucocorticoid dexamethasone confirme d the role of GR in modulating edn1 transcription. In fact, dexamethasone action on the collecting duct mimicked aldosterone in that every aldosterone-response gene investigated was stimulated. Finally, blocking edn1 mRNA expression caused alterations in the aldosterone-target genes scnn1a and sgk1 in the presence or absence of hormone. Taken together, these studi es presented in this dissertation clearly demonstrate that aldosterone activates both MR and GR to drive the transcription of edn1 in collecting duct cells and that the role of edn1 expression has a dire ct effect on ENaC.

PAGE 48

48 Table 1-1. Sodium transport mechanisms in the nephron and collecting duct* Tubule Segment % Filtered Na+ Reabsorbed Molecular Mechanism Proximal tubule 65% Na+/H+ exchanger (NHE), other Na+/anion exchangers, Na+-cotransporters, and paracellular diffusion Thick ascending limb of Henle 25% Na+/K+/2Clcotransporter (NKCC2) Distal convoluted tubule 5 7% Na+/Clcotransporter (NCC) and the epithelial Na+ channel (ENaC) Collecting duct 1 3% ENaC *Adapted from (Gumz, Stow et al., 2009b)

PAGE 49

49 Figure 1-1. Diagram of the bisected kidney and tubule. (Left panel) Cross sectional view of the kidney indicating the major anatomical feat ures. (Right panel) Enlargement of a typical long-looped nephron and collecting duct indicating the basic morphological features and regional boundari es. G: glomerulus, PCT: proximal convoluted tubule, PST: proximal straight tubule, TL: thin limb of Henle, mTAL: medullary thick ascending limb of Henle, DC T: distal convoluted tubule, MD: macula densa, CNT: connecting segment, CCD: cortical co llecting duct, OMCD: outer medullary collecting duct, IMCD: inner medullary collecting duct.

PAGE 50

50 Figure 1-2. Na+ transport mechanisms of the proximal t ubule. In the proximal tubule (PT) apical Na+ transport occurs by Na+/ H+ exchangers (NHE) and by symport with various molecules. Intracellular Na+ is pumped into the interstitium by basolateral Na+/K+ATPase and Na+/HCO3 cotransporters (NBC). Luminal H+ and HCO3 spontaneously form H2CO3, which carbonic anhydrase (CA) type IV converts to CO2 and H2O molecules that move back into the cell by diffusion or via aquaporin channels (AQP), respectively. Intracellular CA II catalyzes the reverse reac tion to facilitate apical H+ recycling and net HCO3 reabsorption. The early PT ha s a lumen negative potential difference ([-]PD) that drives Cland H2O paracellular diffusion. Clis reabsorbed via apical exchange for HCO3 (not shown). Anion removal in the early PT eventually generates a [+]PD in the late PT to drive paracellular Na+ and H2O diffusion.

PAGE 51

51 Figure 1-3. Na+ transport mechanisms of the thick asce nding limb of Henle. The majority of Na+ reabsorption in this region of the tubule occurs via the apical Na+/K+/2Clcotransporter (NKCC2). Basolateral e xport mechanisms include the ubiquitous Na+/K+-ATPase pump, Clchannels, and the K+/Clcotransporter (KCC). K+ recycling via the renal outer medullary K+ channel (ROMK) is essential for NKCC2dependent NaCl reabsorption. K+ recycling also helps to generate a lumen positive potential difference ([+]PD) that drives paracellular diffusion of Na+ and K+. This region of the tubule is also particularly impermeable to H2O, which causes the tubular fluid to become progressively hypoosmo tic as NKCC2 fac ilitates net NaCl reabsorption.

PAGE 52

52 Figure 1-4. Na+ transport mechanisms of the distal convoluted tubule. The Na+/Clcotransporter (NCC) is responsible for the majority of apical Na+ entry, however the apical epithelial Na+ channel (ENaC) is also present in this region of the tubule. Basolateral export mechanisms include the ubiquitous Na+/K+ ATPase pump and both K+ and Clchannels. Intracellular K+ can also be secreted into the lumen via apical K+ channels. In addition, the removal of Na+ from the lumen also drives paracellular Cldiffusion.

PAGE 53

53 Figure 1-5. Na+ transport mechanisms of the collecting duct. Na+ reabsorption occurs in principal cells of the collecting duct and is facilitated by the apic al ENaC and the basolateral Na+/K+ ATPase pump. Classically, the removal of Na+ from the lumen causes a net negative potential difference that serves to drive paracellular Clreabsorption. In addition, Na+ reabsorption is closely coupled to K+ secretion that occurs via K+ channels and an apical K+/Clcotransport mechanism. Functional evidence has also demonstrated the existence of an apical H+/K+-ATPase (not pictured).

PAGE 54

54 Figure 1-6. Overview of aldoster one action. (Left panel): In the absence of aldos terone, MR is located in the cytosol bound by chaperone heat shock proteins such as HSP90. Consequently, apical ENaC pr oteins are continuously targeted for internalization and degradation by a Nedd42 ubiquitin ligase. (Right pa nel) In the presence of aldosterone, the hormone enters a principal cell of the collecting duct and binds to MR, resulting in receptor nuclear translocation and dimerization. In the nucleus, aldosterone-bound MRs direct the transcription of target genes incl uding genes involved in transepithelial Na+ transport such as sgk1 atp1a1, and scnn1a. Aldosterone increases both ENaC and Na+/K+-ATPase proteins, and Sgk1-mediated phosphorylation and inhibition of Nedd4-2. Ultimately, these actions lead to an increase in transepithelial Na+ transport.

PAGE 55

55

PAGE 56

56 Figure 1-7. Overview of the mineralocorticoid receptor. The genomic organization of MR is shown on top indicating the two alterna tive exons 1 in gray, followed by the remaining exons 2 through 9. Exon 2 codes for the N-terminal domain (NTD), and exons 3 and 4 encode for the DNA bindi ng domain (DBD) and hinge region. The ligand binding domain (LBD) is encoded fo r by exons 5-9. Known modifications to MR are indicated. Three nuclear localiz ation signals are also indicated (NLS0, NLS1, NLS2)

PAGE 57

57 Figure 1-8. Overview of MR-direc ted gene transcription. MR bi nds directly to HREs in the DNA of target genes and typically binds in the preferred dimeric conformation. MR then recruits numerous coactivators including SRC-1, CBP/p300, and ELL. The RNA polymerase II (RNA pol II) transcription complex is also recruited. Figure based on data from (Pascual-Le Tallec and Lombs, 2005).

PAGE 58

58 Figure 1-9. Comparison of MR and GR structural domains. The percent homology between MR and GR is indicated for each major domai n. Blue corresponds to the N-terminal domain NTD), yellow corresponds to the DNA binding domain (DBD), beige corresponds to the hinge region and red corresponds to the ligand binding domain (LBD). Numbers correspond to the first am ino acid residue in each domain, as well as the terminal amino acid residue in each receptor. Figure modeled on data from (Arriza et al., 1987).

PAGE 59

59 Figure 1-10. Potential role of GR in collec ting duct cells. Collec ting duct cells express 11 HSD-2 that inactivates the endogenous gl ucocorticoid, cortisol, and prevents cortisol-dependent activation of MR and GR and downstream stimulation of Na+ transport mechanisms (gray arrows). However, aldosterone also has an affinity for GR and may activate both MR and GR to mediate aldoste rone-dependent action and downstream Na+ transport mechanisms.

PAGE 60

60 Figure 1-11. Three-dimensional structure of a dimeric GR DNA binding domain complex interacting with a cl assical hormone response element. GR typically binds to HREs in a dimeric conformation. Nucleotides that make direct contacts with the hormone receptor are shown in red. Structural data obtained from Protein Data Bank 1R4R (Luisi et al., 2003).

PAGE 61

61 Figure 1-12. Overview of endothelin-1 gene and protein. The edn1 gene contains 5 exons that code for mRNA. The protein product of edn1 is a 212 amino acid prepropeptide. Endopepsidases cleave lysine (lys)arginine (arg) residue s to form the biologically inactive Big ET-1. The final cleavage step is mediated by endothelin converting enzymes (ECE) which cleaves at the trytophan (trp)-valine (val) residues to form the biologically active 21 amino aci d peptide, ET-1. The seconda ry structure of ET-1 is shown on the bottom, indicating the disulfid e bridges that form between cystine (C) residues.

PAGE 62

62 Figure 1-13. Overview of ETA and ETB receptor actions. In general, ETB receptors (blue) are located on vascular endothelial cells are linked to vasodilatory signal transduction pathways that ultimately lead to an increase in nitric oxide synthase (NOS) and nitric oxide (NO). In contrast, ETA receptors (red) are typically located on vascular smooth muscle cells and are linked to vasocons triction through an increase in cAMP and intracellular Ca+ concentrations.

PAGE 63

63 Figure 1-14. Hypothetical model of aldosterone-induced ET-1 action in the renal collecting duct. Aldosterone binds to MR in the cytosol and caused nuclear translocation, dimerization and activation of the edn1 gene. Edn1 is then translated into preproET-1 and processed to the active 21 amino acid peptide ET-1. ET-1 binds to basolateral ETB receptors and via signal transduction pathway blocks ENaC activity.

PAGE 64

64 CHAPTER 2 ALDOSTERONE STIMULATES ET-1 PEPTIDE IN THE RAT KIDNEY Introduction The edn1 gene was previously identif ied as a novel aldosterone target gene in IMCD cells in vitro (Gumz et al., 2003). An interaction between aldosterone and ET-1 may have important implications for the regulation of Na+ transport by ENaC, the major pathway for regulated Na+ reabsorption in the distal nephron and collecting duct. In the ki dney, aldosterone action results in an increase in scnn1a ( ENaC) transcription and an increase in ENaC activity (Figure 1-6) that ultimately results in an increase in ex tracellular fluid volume and blood pressure (Masilamani et al., 1999; Mick et al., 2001) The importance of aldosterone in Na+ and fluid homeostasis is underscored by the fact that de fects in aldosterone or a component of the aldosterone-signaling pathway have been implicat ed in the pathogenesis of both monogenic and essential hypertension (Lang et al., 2005; Mart inez-Aguayo and Fardella, 2009; Pravenec and Petretto, 2008). In contrast to the action of al dosterone, the renal ET-1 system has direct inhibitory actions on Na+ transport in the collecting duct. Several i nvestigators have report ed that ET-1 signals through ETB receptors to rapidly reduce the open proba bility of ENaC in co llecting duct cells in vitro and in vivo (Bugaj et al., 2008; Galle go and Ling, 1996; Gilmore et al., 2001). Published evidence further suggests that ET-1 may be respons ible for the tonic inhi bition of ENaC (Bugaj et al., 2008). Consistent with this concept is the observation that collecting duct cell specific edn1 knockout mice exhibit salt sensitive hypertension, which appeared to be a consequence of excessive ENaC-dependent activity (Ahn et al., 2 004). Studies have also shown that renal ET-1 stimulates natriuretic and diuretic compounds in the kidney including ETB receptor-mediated release of nitric oxide (Strickl ett et al., 2006) and cGMP (Edwards et al., 1992). Furthermore,

PAGE 65

65 urinary ET-1 positively correlates with Na+ intake in healthy humans (Modesti et al., 1998), but negatively correlates in patients with salt-sen sitive hypertension (Hoffman et al., 1994). These data suggest that renal ET-1 mediates norma l natriuretic responses in human, and that a reduction of renal ET-1 may lead to inappropriate Na+ retention and hypertension. Despite these observations, a clear role for ET-1 in human hypertension remains to be elucidated (Dhaun et al., 2008). Given that the inhibito ry actions of ET-1 on ENaC di rectly oppose the action of aldosterone, a functional interact ion between aldosterone and ET1 may represent an important negative feedback loop on aldosterone dependent Na+ reabsorption in the collecting duct. In order to test this hypothesis it was first im portant to determine if aldosterone stimulated edn1 mRNA or ET-1 peptide in the kidney in vivo Several attempts to quantify aldosteronedependent edn1 gene expression were unsuccessful. However, the characterization of basal edn1 mRNA levels was accomplished. These studies revealed both regional heterogeneity and agedependent effects on the expression of edn1 as well as other genes involved in ET-1 or aldosterone signaling in the kidney. Finally, data reported here de monstrated for the first time that administration of aldosterone stimulated an increase in the c oncentration of the ET-1 peptide in renal inner medulla in vivo Materials and Methods Animals Male wild-type C57Bl/6J m ice (Jackson Labs) and male Sprague Dawley rats (Harlan) were housed at the University of Florida Animal Care Services rodent facilities. Standard rodent chow (0.29% Na+, 1.04% K+; Teklab 8604) and tap water we re provided ad libitum. All procedures adhered to the Animal Care Services guidelines and were approved by the University of Florida Institutional Animal Care and Use Committee.

PAGE 66

66 Subcutaneous Osmotic Mi nipump Implantation The im plantation was performed with full st erile surgical techni que under isoflurane anesthesia. A mid-scapular incision was ma de for the insertion of a hemostat, and the subcutaneous tissue was separate d to create a pocket for the pu mp (Alzet Model 2001, Durect Corp., Cupertino, CA). Pre-prim ed pumps were loaded to de liver aldosterone (1.2 mg/kg body weight/24 h) or vehicle (polyeth ylene glycol 300). Pumps were weighed before and after filling to ensure proper dosing. Each pump was inserted into the pocket, delive ry portal first and the incision was closed with wound clips. Chronic Vascular Catheters and Plasma Aldosterone Determination Adult ra ts were implanted with chronic indw elling vascular catheters according to the method of Qiu et al. (Qiu et al., 1995). Catheters were hand-fashioned using pulled tygon tubing and gas sterilized prior to implantation. Rats were anesthetized with inha led isoflurane and given buprenorphine (0.05 mg/kg) as an analgesic. The su rgical sites were shaved, cleaned with a 1:1 betadyne-ethanol mixture and isolated with sterile drapes. Ophthalmic ointment was applied to both eyes and body temperature was maintained with a circulating heating pad. Catheters were inserted into the left femoral artery and vein and held in place with non-absorbable 3.0 silk sutures. Blunt ended scissors were used to gently separate the skin from the fascia and a trocar was inserted to guide the catheters to the back of the neck where they were exteriorized. Exterior wounds were closed wound clips. Catheters were primed with 1:1 dextro se: heparin (1000 units) solution and monitored every day for integrity. Af ter 4 days of recovery animals were given either an intraperitoneal (ip) or intravenous (iv) injection of vehicle (20 l/kg ethanol) or aldosterone (1 mg/kg body weight ). In all cases the final in jection volume was 1 ml/kg body weight. A baseline blood sample (150 l) was drawn just prior to hormone injection. Blood samples (150 l) were also taken at 15, 30, 60, 90, 120, and 180 minutes (min) following the

PAGE 67

67 injection. Each sample was immediately spun at 1000x g at 4 C. Plasma was aliquoted, snap frozen in liquid nitrogen and stored at -80 C until use. Afte r each blood draw, red blood cells were reconstituted with 150 l 13.4% sterile Ficoll and returned to the animal to prevent hemorrhage. Plasma samples were thawed on ice and aldosterone concentrations were determined using a acetylcholinesterase-c onjugate based competitive enzyme immunoassay (EIA) (Cayman Chemical). Intraperitoneal Aldostero ne Administration Rats were given aldosterone (1 m g/kg, ip) or vehicle (20 l/kg ethanol, ip). After 1 24 h rats were anesthetized with inhaled is oflurane and kidneys were flushed by an in vivo aortic perfusion of ice-cold phosphate buffered saline (PBS) (pH 7.4) with the vena cava vented. Kidneys were removed and dissected into cortex, outer medulla, and inner medulla. Tissues were immediately snap frozen in liquid nitroge n and stored at -80 C until use. Measurement of Tissue ET-1 ET-1 was extracted from renal tissues using a pr otocol originally described by Yorikane et al. (Yorikane et al., 1993). Briefly, sam ples were homogenized in 1 molar (M) acetic acid containing 10 g/ml pepstatin A protease inhibito r. Samples were incubated at 100 C for 10 min, chilled on ice, and centrifuged at 20,000x g at 4 C for 30 min. The supernatant containing the soluble protein fraction was removed and analyzed for ET-1 peptide levels by chemiluminescent enzyme linked immunosorbant assay (ELISA) (QuantiGlo, R&D Systems). Immunoreactive ET-1 peptide was normalized to tota l protein content as determined by Bradford protein assay (Bio-Rad). Quantification of mRNA Expression in Tissues. Frozen tissu e was thawed directly in TRIzol (Invitrogen ) and immediately homogenized for RNA extraction acc ording to the manufacturers in structions with the exception

PAGE 68

68 that RNA-ethanol pellets were precipitated overnight at 80 C. RNA pellets were dissolved in RNase-free H2O and stored at -80 C until analysis. RNA concentration was determined by spectrophotometric absorbance at 260 nm and R NA integrity was analyzed by visualizing 18S ribosomal RNA on an agarose gel. RNA (2 g) was treated with DNase (Ambion) to remove genomic contamination and first-strand comp lementary DNA (cDNA) was synthesized with oligo dT, random hexamers and SuperScript III reverse transcriptase (Invitrogen). Resulting cDNAs (32 g) were used as templates in duplicat e quantitative real-time polymerase chain reactions (QPCR) (Applied Bios ystems). Cycle threshold (CT) values were normalized against actin (actb ) and relative quantificatio n was performed using the CT method (Livak and Schmittgen, 2001). All QPCR experiments were pe rformed with TaqMan primer/probe sets that have guaranteed 100% PCR efficiency over six logarithms of template DNA (Applied Biosystems, 2006). TaqMan primer/probes for rat genes are indicated in Table 2-1 and TaqMan primer/probe sets for mous e are indicated in Table 5-1. Results Axial Heterogeneity in ET-1 Pathway Gene Expression in the Rat Kidney In order to better understand the role of ET-1 and its potential interaction with aldosterone in the kidney, initial studies were conducted to characterize the relative expression of ET-1 signaling genes as well as classica l aldosterone response genes in the three major regions of the kidney; the cortex, outer medulla and inner medulla. Gene expr ession analyses were conducted on control kidneys isolated from adult rats that were vehicle treated fo r 1 h prior to tissue harvest. Levels of mRNA were determined by QPCR, normalized to actb ( -actin) and expressed as the fold change relative to cortical mR NA levels (Figure 2-1). The expression of edn1 and the ETB receptor (etbr ) exhibited an increase in mRNA abunda nce along the cortico-medullary axis with the highest level of both mRNAs localized to the inner medulla (Figure 2-1). Similarly, the

PAGE 69

69 expression of two established aldosterone response genes, sgk1 and per1 were highest in inner medullary extracts. Only a minor increase in the expression of the endothelin converting enzyme-1 gene ( ece1 ) was detected in the outer medulla. To evaluate the potential heteroge neity in the expression of the and subunits of ENaC, the different regions of the a dult kidney were also evaluated for scnn1a, scnn1b, and scnn1g expression. The expression of each ENaC subunit gene was detected in the cortex, outer medulla and inner medulla (Figure 2-2), and this consistent with published reports (Frindt et al., 2007). The scnn1b and scnn1g genes exhibited a decrease in expression along the corticomedullary axis. However, the highest level of scnn1a expression was unexpectedly in the outer medulla, not the cortex (Figure 2-2). Age-Dependent Gene Expression To identify the specific structures in the kidney responsible for the observed regional heterogeneity in gene expression, a series of experim ents on individua l microdissected nephron segments were proposed. However, the microdissection of individual nephr ons from adult rats was not possible due to naturally occurring renal fibrosis. Accordingly, the approach was modified for use with younger rats (30 days ol d) and the optimized procedure can be found in Appendix A. Since the modified technique required the use of younger animals and edn1 expression levels have been documented to change with age (Pedersen et al., 2007), it was first important to determine if there were age dependent effects on edn1 expression in the kidney. Experiments were conducted to evaluate the relative gene expression in cortical, outer medullary and inner medullary extracts from young ra ts (30 days old). In c ontrast to adult rats, edn1 mRNA levels were highest in the outer me dulla (Figure 2-3). The region pattern of etbr, ece1 and sgk1 mRNA expression was similar between the age groups. However, levels of sgk1

PAGE 70

70 mRNA in the inner medulla were a remarkable 65.1 1.5 fold higher compared to the cortex (Figure 2-3). Gene expression profiles were also dir ectly compared between young and adult rats (Figure 2-4). While the etbr gene was expressed at moderately 2.2 0.1 fold higher level in the cortex of young animals, the most prominent diffe rences in gene expression were observed in the outer and inner medulla. The edn1, etbr, ece1 and sgk1 mRNA levels were notably higher in outer medullary extracts from young animals compar ed to outer medullary extracts from adult rats (Figure 2-4). Edn1 and etbr mRNA expression levels were 3.5 0.1 and 3.2 0.3 fold higher in young rat outer medulla s, respectively. However, the largest difference in gene expression between the age groups was observed for sgk1 in inner medullary homogenates, which was 15.5 0.4 fold higher in young animals (Fi gure 2-4). These data indicated that basal gene expression profiles were different between young rats and adult rats. Validation of Aldosterone Delivery Method A prim ary goal of the animal experiments pres ented in this chapter was to determine if aldosterone and ET-1 interacted in vivo The original report identifying edn1 as an aldosterone target gene was conducted afte r 1 h of hormone stimulation in vitro (Gumz et al., 2003). Therefore, it seemed reasonable that edn1 would be stimulated afte r an aldosterone treatment in vivo In order to investigate the effect of an acute aldosterone treatment in rats, the hormone needed to be delivered either intravenous (iv) or intraperitoneal (ip). Therefore, preliminary experiments were conducted to evaluate the difference in aldo sterone absorption or clearance rate following an iv or ip dosing (Figure 2-5). Adult rats were implanted with femoral catheters to allow for repeated blood sampling and animals we re given an iv or ip injection of aldosterone (1 mg/kg) or vehicle (20 l et hanol/kg). Plasma aldosterone c oncentrations were virtually the

PAGE 71

71 same following either injection method (Figure 25). This data indicate d that either delivery route was acceptable for studying acute aldosterone responses. Aldosterone Dependent ET-1 Pe ptide Levels in the Kidne y Since the potential interacti on between aldosterone and ET-1 in vivo has implications for renal Na+ transport and blood pressure, initial experi ments were conducted to determine both the basal and aldosterone dependent concentration of ET-1 in the rat kidney. Consistent with published reports, adult animals had basal levels of ET-1 that were approximately 50 times greater in the inner medulla compared to cortex or outer medulla (Table 2-2) (Kitamura et al., 1989). Since the origin al report identifying edn1 as a novel aldosterone target gene was conducted at 1 h (Gumz et al., 2003), initial aldosterone experiments in rats were conducted at 2 h to allow time for translation and enzymatic pr ocessing to the biologica lly active ET-1 peptide. A 2 h aldosterone treatment resulted in a near doubling of ET-1 peptide concentrations in the inner medulla, but had no significant effect on the cortex or outer medulla (Figure 2-6). To determine if ET-1 was stimulated at another time point, studies were conducted to evaluate inner medullary ET-1 peptide levels 1, 6 and 24 h after aldos terone treatment. However, inner medullary ET-1 peptide levels were increased only afte r 2 h of aldosterone treatment (Figure 2-7). Since plasma aldostero ne levels indicated a supraphysiological spike following an ip dose of the hormone (Figure 25), studies were conducted to determine if a constant lower dose of aldosterone had an eff ect on renal ET-1. Rats were implanted with subcutaneous osmotic minipumps to deliver 50 g/kg/h (1.2 mg/day) of al dosterone or vehicle (polyethylene glycol 300). After 24 h, inner medullary ET-1 levels were not statistically different in aldosterone treate d animals (1.00 0.15 fold change relative to vehicle, n=4). Since inner medullary gene e xpression profiles were differe nt between the age groups (Figure 2-4), similar experiments were conducted to analyze the effect of aldosterone on inner

PAGE 72

72 medullary ET-1 peptide levels in young rats. The basal concentration of ET-1 in the inner medulla of young rats was similar to adults (Tab le 2-4). However, aldosterone treatment had no effect on inner medullary ET-1 peptide levels in young rats after 2 or 6 h of hormone treatment (Figure 2-8). Taken together, these data suggest that the rena l ET-1 system if differentially regulated with age. Aldosterone Dependent Gene Ex pression in t he Rat Kidney Studies conducted on adult rats indicated that ET-1 peptide le vels were increased 2 h after a bolus injection of aldosterone. An increase in ET-1 peptide at this time point is consistent with an acute transcriptional respons e. Therefore, experiments were conducted to evaluate gene expression on adult rats treated with vehicle or aldosterone (1 mg/kg, ip) for 1 h. As shown in Figure 2-9, there was no de tectable change in edn1 mRNA in the cortex, outer medulla or inner medulla. However, moderate increases were observed for sgk1 in each region and scnn1a in the cortex and inner medulla (Figure 2-9). The circadian rhythm genes per1 and per2 appeared to be stimulated in the inner medulla, but the change was not significant due to high standard error. There were no significant cha nges in the mRNA levels of ENaC or ENaC ( scnn1b or scnn1g), the ET receptor genes ( etar or etbr ) or ece1 Similarly, no changes were observed in the expression of neuronal NOS (nNOS, nos1), endothelial NOS (eNOS, nos3 ), or the sirtuin 1 gene ( sirt1 ). Gene expression in the kidney was also analyz ed after a 2 h aldosterone injection (Figure 2-10), 6 h aldosterone injection (Figure 2-11) and a 24 h aldoster one injection (Figure 2-12). After 2 h of aldosterone treatment, sgk1 mRNA remained increased in the outer medulla, but had returned to level that not was si gnificantly different from vehicle control levels in the cortex and inner medulla (Figure 2-10). An aldost erone-dependent second increase in sgk1 mRNA was detected in the inner medulla after 6 h of aldosterone treatment (Figure 2-11). However, sgk1

PAGE 73

73 mRNA levels in other regions or after 24 h were not significantly different in aldosterone treated animals. The expression of scnn1a was moderately increased in outer and inner medullary homogenates after 6 h, but not 24 h of aldosterone treatment (Figure 2-11 versus Figure 2-12). The most prominent of change in gene expression was observed for per1 at 6 h, which demonstrated an approximate 3-fold incr ease in each region of the kidney. The observation that sgk1 and scnn1a mRNAs were not increased at higher levels at any of the time points tested was unexpected and sugges ted that the experimental approach was not adequate for studying an aldosterone re sponse. Commonly, investigators will use adrenalectomized animals in order to observe aldosterone-dependent responses in vivo (Brennan and Fuller, 2006; Muller et al., 2003). Therefore, simila r experiments were conducted on adrenalectomized rats (Harlan) treated with vehicle or aldos terone (1 mg/kg, ip) for 1 h. Adrenalectomy dramatically sensitized the kidney to aldosterone as indicated by greater than 5 fold changes in sgk1 and per1 expression in the cortex and oute r medulla and greater than 2 fold changes in each gene in the inner medulla (Fi gure 2-13). Unfortunately, there was no detectable change in edn1 mRNA in any region. The absence of aldosterone-dependent edn1 expression in adrenalectomized rats was particularly unexpected given that a recent repo rt from Wong et al. showed a moderate, but significant increase in edn1 mRNA in whole kidney homogenates from adrenalectomized rats injected with 0.5 mg/kg aldosterone (Wong et al., 2007). Only minor differences existed between the study in Figure 2-13 and the W ong study. Indeed, Wong and colleagues reported quantifying renal edn1 mRNA by SyBr Green PCR. Therefore, edn1 and sgk1 primers homolgous to the sequences reported by Wong et al. were ordered (Table 2-3). These primers were used in a SyBr Green QPCR experiment to re-analyze the relative gene expression in the

PAGE 74

74 adrenalectomized animals. Sgk1 mRNA levels were roughly 2.5 fold higher in aldosterone treated adrenalectomized rats. However, edn1 mRNA levels were actually reduced (0.62 0.1 fold change relative to vehicle). The inability to detect an increase in edn1 mRNA using the same experimental parameters reported by Wong et al. indicated that selective RNA degradation may have interfered with the quantification of edn1. Indeed, edn1 mRNA is known to be extremel y unstable with a half-life of 15 minutes (Inoue et al., 1989). Consequently, a pilot expe riment was conducted using a modified tissue preparation technique (per sonal communication with Dr. Donald Kohan, University of Utah, Salt Lake City, Utah). In th ese experiments, wild type adrenal-intact rats were given a 1 h injection of ve hicle or aldosterone (1 mg/kg, ip). Kidneys were immediately removed, two coronal slices were made to allo w faster freezing and the samples were snap frozen. Frozen tissues were thaw ed directly in ice cold TRIzol (Invitrogen) and cortex, outer medulla and inner medulla regions were dissected. Sgk1 mRNA levels were increased in the cortex and outer medulla (2.8 0.1 and 2.7 0.1 fold change, respectively, n = 3). However, there was no change in edn1 expression in the cortex or ou ter medulla (1.1 0.2 and 0.9 0.1 fold change, respectively, n = 3). Furthermore, there was no change in edn1 sgk1 or etbr expression observed in inner medu llary homogenates (Figure 2-14). A final experiment was conducted to determine if species-specific differences influenced the aldosterone-dependent expression of edn1 in the kidney. Wild-type C57 Bl/6J mice, the background strain for the collecting duct cell specific edn1 knockout mice, were given a bolus injection of vehicle or aldosterone (1 mg/kg, ip) and analyzed for gene expression after 1 h. Kidneys were removed, dissected and immediately processed for edn1 or sgk1 mRNA by QPCR. Cortical and outer medullary sgk1 mRNA levels were 1.6 0.3 fold and 2.0 0.1 fold higher in

PAGE 75

75 aldosterone treated animals, respectively. However, al dosterone had no effect on edn1 mRNA levels in the cortex or outer medulla. Similarly, no changes in edn1 or sgk1 mRNA levels were observed in the inner medulla of aldo sterone treated mice (Figure 2-15). Discussion Experim ents presented in this chapter demons trated for the first time that aldosteronestimulated an increase in ET-1 peptide levels in the rat kidney in vivo and that the increase in renal ET-1 was exclusive to the inner medulla. Furthermore, basal mRNA expression of edn1 and sgk1 and basal ET-1 peptide levels were highes t in the renal inner medulla in both young and adult rats. However, a direct comparison between the age groups revealed age-specific expression levels for edn1 etbr and sgk1 in the kidney. The failure of aldosterone to stimulate an increase in edn1 mRNA was unexpected since aldosterone-dependent edn1 expression has now been documented by several groups (Gumz et al., 2003; Stow et al., 2009; Wolf et al., 2006; Wong et al., 2007). In fact, Wong et al. reported a 50% increase in edn1 mRNA after 1 h of aldosterone treat ment in adrenalectomized Sprague Dawley rats. An attempt was made to repr oduce the experimental conditions by Wong and colleagues. However, an increase in edn1 mRNA was not detected in our hands. A possible explanation for this discrepancy is that edn1 mRNA is known to be highly unstable with a halflife of only 15 min (Inoue et al ., 1989). Most likely, the edn1 mRNA signal was lost during sample preparation. In fact, this rationale is su pported by the fact that experiments in Chapter 4 demonstrate that aldosterone stimulates edn1 mRNA in acutely isolated rat IMCDs ex vivo (Stow et al., 2009). The aldosterone-dependent increase in ET-1 pe ptide concentration in the renal medulla in vivo strongly supported the concept that aldosterone functionally interacted with ET-1 in the kidney. Moreover an analysis of th e renal inner medulla gene expres sion profile reve aled that all

PAGE 76

76 of the necessary molecular machinery was pres ent for aldosterone-induced ET-1 to mediate the proposed negative feedback loop on aldoster one. First, all th ree ENaC subunits ( scnn1a, scnn1b and scnn1g) were expressed. Furthermore, the highe st increase in aldosterone-dependent scnn1a expression was observed in the inner medulla of adrenal-intact, adult animals after 6 h of hormone stimulation. The expression of sgk1 mRNA was markedly higher in the inner medulla compared to either the cortex or the outer medulla. This observation was consistent with published reports (Shigaev et al., 2000). Basal levels of edn1 and etbr expression were also highest in the inner medulla. Again, these obser vations were consistent with the reported abundance of ET-1 and ETB receptor protein levels in the ki dney (Chen et al., 1993; Kitamura et al., 1989; Kohan, 1991; Pupilli et al., 1994). Finally, per1 expression levels we re also highest in the inner medulla (1.8 0.3 fold higher relative to cortex). While the inner medullary per1 expression data from this dissert ation were recently published (G umz et al., 2009a), the observed cortico-medullary heterogeneity in per1 has not been prev iously reported. Taken together, the renal inner medulla co-expressed ENaC and its modulators, sgk1 and per1 This supported the concept that ENaC-dependent Na+ transport occurre d in the inner medulla and that the process could be regulated, at least in part, by S gk1 and Per1 action. The inner medulla also expressed high levels of edn1 and etbr, which suggested that an ET-1-ETB receptor pathway was present in this region. Although an increase in aldosterone-dependent edn1 mRNA was not detected for expected techni cal reasons, aldosterone did result in an increase in the biologically active ET-1 peptide in rat inner medullas in vivo Therefore, it seemed reasonable that ET-1 woul d act through inner medullary ETB receptors, resulting in ENaC inhibition and a decrease in aldosterone-dependent Na+ transport.

PAGE 77

77 Table 2-1. TaqMan assays sets for QPCR on rat Gene Gene Product Assay ID edn1 ET-1 Rn00561129_m1 sgk1 Sgk1 Rn00570285_m1 scnn1a ENaC Rn00580652_m1 scnn1b ENaC Rn00561892_m1 scnn1g ENaC Rn00566891_m1 per1 Per1 Rn01325256_m1 per2 Per2 Rn0058158177_m1 ece1 ECE-1 Rn00585943_m1 etar ETA Receptor Rn00561137_m1 etbr ETB Receptor Rn00561129_m1 sirt1 Sirt1 Rn01428096_m1 nos1 NOS1 (nNOS) Rn00583793_m1 nos3 NOS3 (eNOS) Rn02132634_s1 actb -actin 4352931E gapdh Gapdh 4352338E

PAGE 78

78 Table 2-2. Renal ET-1 peptide c oncentrations in adult rats Kidney Region ET-1 (pg/mg protein) cortex 9.8 0.8 outer medulla 12.0 2.4 inner medulla 543.8 112.2

PAGE 79

79 Table 2-3. Primer sequences for rat SyBr Green QPCR Gene Primer Sequence edn1 Forward: 5CTCT GCTGTTTGTGGCTTTC-3 Reverse: 5CCTCTGC CAGTCTGAACAAG-3 sgk1 Forward: 5TAGCAATCCTCATCGCTTTC-3 Reverse: 5GAGTTGTTGGCAAGCAAGCTT-3 actb Forward: 5CACCCTGTGCTGCTCACC-3 Reverse: 5TCCATCACAATGCCAGTGG-3

PAGE 80

80 Table 2-4. Renal ET-1 peptide concentrations in young rats Kidney Region ET-1 (pg/mg protein) cortex 8.0 0.9 outer medulla 13.2 1.9 inner medulla 407.2 34.8

PAGE 81

81 Figure 2-1. Relative mRNA expression of genes i nvolved in ET-1 or aldosterone signaling in adult rat kidneys. Kidneys were isolated fr om 1 h vehicle (ethanol) treated adult rats, dissected into cortex, outer medulla and inner medulla and homogenized in TRIzol (Invitrogen) for total RNA extraction. The cDNA was prepared and analyzed for the expression of each gene indicated by QPCR for the cortex (open bars), outer medulla (gray bars) and inner medulla (closed bars). Values were normalized to actb ( -actin) and are expressed as the mean fold ch ange relative to cortex SE. (n=6) 0 3 6 9 12 15 edn1ece1etbrsgk1per1mRNA fold change relative to cortex cortex outer medulla inner medulla

PAGE 82

82 Figure 2-2. Relative mRNA expression of ENaC subunit genes in adult rat kidneys. Kidneys were isolated from vehicle treated controls rats, sectioned into cortex (open bars), outer medulla (gray bars) and inner medulla (closed bars) and ho mogenized for total RNA and QPCR analysis as described above. Values for scnn1a, scnn1b and scnn1g were normalized to actb and are expressed as the mean fold change relative to cortex SE. (n=6) 0 1 2 3 scnn1ascnn1bscnn1gmRNA fold change relative to cortex Cortex Outer Medulla Inner Medulla

PAGE 83

83 Figure 2-3. Relative mRNA expression genes invo lved in ET-1 or aldosterone signaling in young rats. Kidneys were harvested from young rats (30 days old) from a 1 h vehicle treated control group. Kidneys were sectioned and RNA was prepared as described above for QPCR analysis of cortex (open bars), out er medulla (gray bars) and inner medulla (closed bars). Values for edn1, ece1 etbr and sgk1 were normalized to actb and are expressed as the mean fold change relative to cortex SE. (n 4) 0 25 50 75 sgk1 0 4 8 edn1ece1etbrmRNA fold change relative to cortex cortex outer medulla inner medulla

PAGE 84

84 Figure 2-4. Effect of age on gene expression profiles in the rat kidney. Young and adult rat kidney samples were evaluated for the mRNA expression of edn1, ece1 etbr and sgk1 genes by QPCR. Values were normalized to actb Gene expression values for young animals were compared to adult values in the same region of the kidney. Values are expressed as mean fold change relative to adult SE. (n 4)

PAGE 85

85 Figure 2-5. Validation of aldosterone delivery method in adult rats. Conscious chronically catheterized rats were given an intravenous (iv, open bars) or intraperitoneal (ip, closed bars) injection of aldoster one (1 mg/kg) and blood samples (150 l) were collected at the time indicated for plasma aldosterone concentration determination by enzymatic immunoassay (Cayman Chemical). Plasma aldosterone values are expressed as g/deciliter (dl). Time 0 indicates time of injection. (n=4)

PAGE 86

86 Figure 2-6. Effect of aldosterone on renal ET-1 peptide concentrations in adult rats. Rats were given an injecti on of vehicle (20 l/kg ethanol, ip) (open bars) or aldosterone (1 mg/kg, ip) (closed bars). After 2 h rats we re anesthetized with isoflurane and the kidneys were flushed via an in vivo aortic perfusion of ice-cold PBS (pH 7.4) with the vena cava vented. Kidneys were removed a nd dissected into cortex, outer medulla and inner medulla before being frozen in liquid nitrogen. Samples were thawed and protein was extracted in 1 M acetic acid plus 10 g/ml pepstatin A. Renal ET-1 content was determined by ELISA (R&D Syst ems). Values were normalized to total protein and are expressed as mean fold change relative to vehicle SE (**p<0.005, n 6).

PAGE 87

87 Figure 2-7. Effect of time on aldos terone-dependent ET-1 peptide leve ls in the rat inner medulla. Adult rats were given an inje ction (ip) of vehicle (open bars) or 1 mg/kg aldosterone (closed bars). Animals were sacrificed at the time indicated and kidneys were prepared as described in Figure 2-6. Inner medullary ET-1 content was assayed by ELISA (R&D Systems). Values were normalized to total protein and are expressed as mean fold change relative to vehicle SE (**p<0.005, n 5).

PAGE 88

88 Figure 2-8. Effect of age on aldos terone-dependent ET-1 peptide levels in the inner medulla. Young rats (30 days old) were given an injection of vehicle (0 .2% ethanol) (open bars) or aldosterone (1 mg/kg, ip) (closed ba rs). After 2 or 6 h kidneys were harvested as described above and inner medullary ET-1 content was assayed by ELISA and total protein concentrations were dete rmined by Bradford assay. Values were normalized to total protein and are expressed as mean fold change relative to vehicle SE (**p<0.005, n 5).

PAGE 89

89 Figure 2-9. Effect of 1 h aldoster one treatment on gene expression in the adult rat kidney. Male Sprague Dawley rats were given a 1 h in jection (ip) of vehicle (open bars) or aldosterone (closed bars). Rats were anesth etized with isoflurane and the aorta was cannulated for an in vivo aortic perfusion of PBS (pH 7.4) with the vena cava vented to flush the kidneys. Kidneys were removed and dissected into cortex, outer and inner medulla and snap frozen in liquid nitrogen. Frozen tissues were thawed and RNA was extracted for gene expression analysis us ing QPCR. Values were normalized against actb and are expressed at the mean fold change relative to vehicle SE. (*p < 0.05, n 6 )

PAGE 90

90 Figure 2-10. Effect of 2 h aldosterone treatment on gene expression in the adult rat kidney. Rats were given a 2 h injection (ip) of vehicle (open bars) or aldosterone (closed bars). Rats were anesthetized and th e kidneys were flushed by an in vivo aortic perfusion of PBS (pH 7.4) with the vena cava vented. Ki dneys were removed and dissected into cortex, outer and inner medulla and snap frozen in liquid nitrogen. Frozen tissues were thawed and RNA was extracted for gene expression analysis using QPCR. Values were normalized against actb and are expressed at the mean fold change relative to vehicle SE. (*p < 0.05, n 6 )

PAGE 91

91 Figure 2-11. Effect of 6 h aldosterone treatment on gene expression in the adult rat kidney. Rats were given a 6 h injection (ip) of vehicle (open bars) or aldosterone (closed bars). Rats were anesthetized and kidneys were flushed by an in vivo aortic perfusion of PBS (pH 7.4) with the vena cava vented. Ki dneys were removed and dissected into cortex, outer and inner medulla and snap frozen in liquid nitrogen. Frozen tissues were thawed and RNA was extracted for gene expression analysis using QPCR. Values were normalized against actb and are expressed at the mean fold change relative to vehicle SE. (n 6)

PAGE 92

92 Figure 2-12. Effect of 24 h aldosterone treatmen t on gene expression in the adult rat kidney. Rats were given a 24 h injection of vehicle (open bars) or aldosterone (closed bars). Rats were anesthetized and the aorta was cannulated for an in vivo aortic perfusion of PBS (pH 7.4) with the vena cava vented to fl ush the kidneys. Kidneys were removed and dissected into cortex, outer and inner me dulla and snap frozen in liquid nitrogen. Frozen tissues were thawed and RNA was extracted for gene expression analysis using QPCR. Values were normalized against actb and are expressed at the mean fold change relative to vehicle SE. (*p < 0.05, n 6 )

PAGE 93

93 Figure 2-13. Effect of 1 h aldos terone treatment on gene expression in adrenalectomized rats. Bilaterally adrenalectomized rats were purchased from Harlan and maintained on 0.9% saline. Rats were given vehicle (open bars) or aldoste rone (closed bars) for 1 h. Kidneys were prepared as described above and RNA extracted for gene expression analysis by QPCR. Values were normalized against actb and are expressed at the mean fold change relative to vehicle SE. (n = 5)

PAGE 94

94 Figure 2-14. Effect of an alternative disse ction method on aldosterone-dependent gene expression in adult rats. Rats were given an injection of vehi cle (open bars) or aldosterone (closed bars). After 1 h rats were anesthetized and kidneys were removed. Two coronal slices were quickly made and the tissues were immediately snap frozen without further dissection. Frozen kidneys were thawed and inner medullas were dissected in TRIzol (Invitrogen) at 4 C Isolated RNA was converted to cDNA and analyzed for edn1, sgk1 or etbr mRNA expression by QPCR. Values were normalized to actb and are expressed at the mean fo ld change relative to vehicle SE. (n=3) 0 1 2 edn1sgk1etbrmRNA fold change

PAGE 95

95 Figure 2-15. Aldosterone-dependent gene expression in wild-type C57 Bl/6J mice. Mice were given an injection of vehicl e (open bars) or aldosterone (closed bars) for 1 h. The mice were anesthetized and kidneys were immediately removed and inner medullas were dissected and flash frozen in liquid nitrogen. Frozen tissues were thawed and RNA was extracted for gene expression analysis using QPCR. Values were normalized to actb and are expressed as the mean fo ld change relative to vehicle SE. (n=3) 0 1 2 edn1sgk1mRNA fold change

PAGE 96

96 CHAPTER 3 ENDOTHELIN-1 PROMOTER ACTIVITY IN LUCIFE RASE REPORTER ASSAYS Introduction In 1961 spironolactone was patented by G.D. S earle & Co as the first pharm acological antagonist of MR (Cella and Twe it, 1961). In the years that fo llowed MR blockade was quickly established as a cornerst one of antihypertensive therapy; howe ver, researchers had only begun to appreciate the transcriptional mechanism of action (Horisberger and Rossier, 1992; Rossier, 1978). More than two decades passed between the time spironolactone was introduced to the market and the first aldosterone-regulated ge ne was identified. While the discoveries of aldosterone target genes involved in vectorial Na+ transport such as scnn1a ( ENaC) and atp1a1 (Na+/K+ ATPase 1) provided insight into the molecula r action of aldosterone, relatively few transcripts have been validated beyo nd these canonical response genes. One problem in identifying new aldosterone ta rget genes is the fact that most HREs deviate from the classical response element: 5-GGTACAnnnTGTTCT-3 (Beato, 1989). In fact, this element was initially identified as the glucocorticoid response element that bound a GR-GR homodimer (Luisi et al., 1991). While it is known that both MR and GR bind this target sequence, it is not known if both receptors bind to non-canonical re sponse elements or if these unique sequences somehow confer selective resp onses. Indeed, the ability of degenerate response elements to recruit hormone receptors and mediate transcripti on is an active area of investigation (Meijsing et al., 2009 ). Since it is not possible to identify aldosterone response genes by sequence analysis alone, several invest igators have used gene microarray technology to identify new target genes. This approach led to the discovery of several genes including gilz (Soundararajan et al., 2005), usp2-45 (Fakitsas et al., 2007), and the circadian rhythm gene per1 (Gumz et al., 2003; Gumz et al., 2009a); all of these genes have been linked to stimulatory

PAGE 97

97 effects on ENaC. Microarray analysis also identified edn1 as an aldosterone-induced transcript (Gumz et al., 2003). The stimulation of edn1 was of particular inte rest given that the ET-1 peptide is known to block Na+ reabsorption by ENaC in aldost erone-target cells of the renal collecting duct (Bugaj et al., 2008 ). A mechanism for turning o ff MR-directed transcription or downstream MR signaling has not been identified. Thus, the edn1 gene is an attractive candidate for mediating a negative feedback loop on aldosterone-driven Na+ transport in the collecting duct. Since aldosterone is known to act at the leve l of gene expression, we hypothesized that the edn1 gene was under transcriptional regulation by MR. A useful technique to study the transcriptional regulation of a particular gene is an in vitro reporter assay. For this approach, a plasmid containing the promoter of interest is fu sed to a reporter gene and transfected into an appropriate cell line (Alam and Cook, 1990). A common reporter gene is the Photinus pyralis (firefly) luciferase ( luc) gene because the gene is not found in mammalian cells and the enzyme requires no post-translational processing for ac tivity and can be easily detected using a luminometer (de Wet et al., 1985; Wood et al., 1984). The enzyme luciferase catalyzes the bioluminescent oxidation of luciferin resulting in photon emission. Luciferase reporter assays have been successfully used to demonstrat e the calcium-dependent repression of the edn1 promoter (Strait et al., 2007). In addition, reporte r assays have also been successfully used to study the hormonal regulation of several genes including scnn1a (Chow et al., 1999; Mick et al., 2001; Sayegh et al., 1999), atp1a1 (Kolla et al., 1999), a nd phenylethanolamine Nmethyltransferase ( pnmt ) (Ross et al., 1990). In this chapter, the transcriptionally active region of the edn1 promoter and 5-UTR was cloned into the plasmid pEdn1 that contained a luciferase reporter gene. Sequence analysis

PAGE 98

98 revealed several putative HREs in the promoter. The reporter gene driven by the edn1 promoter demonstrated cell-line dependent expression levels in two collec ting duct cell models. However, the pEdn1 reporter gene demonstrated excessive tran scriptional activity that was not sensitive to hormone treatment. These studies indicated that an important transcriptional repressive mechanism was missing from the reporter assay conditions and the observations were critical for the development of experiments in later chapters. Materials and Methods Reagents Stocks of aldosterone (F luka), dexameth asone, spironolactone and RU486 (Sigma) were prepared at 1 mg/ml in 100% ethanol and stored at -20 C until use. FuGENE 6 (Roche) and Lipofectamine 2000 (Invitrogen) transfection reagents were stored at 4 C until use. KpnI, BglII, XbaI and XhoI restriction enzymes were purch ased from Promega and stored at -20 C. Plasmids The pGL3-Basic and p GL3-Pro vectors each c ontained a firefly lucife rase gene and were purchased from Promega. The pGL3-Basic plasmi d was promoterless and the pGL3-Pro plasmid contained a constitutively active SV40 pr omoter. The pRL-TK vector contained a Renilla luciferase gene driven by the herpes simplex virus thymidine kinase (HSV-TK) promoter and was also obtained from Promega. The pEdn1 cons truct was a kind gift of Dr. Brian Cain and contained 1990 bp of the murine edn1 promoter and 5-untranslated region (UTR) inserted upstream of the firefly luciferase gene. The pE dn1 construct was made in the following manner: The RP23-438J18 commercial bacterial artificial clone was purch ased and PCR primers were designed to amplify a 1990 bp se gment containing 1714 bp of the edn1 promoter and 276 bp of the edn1 5-UTR. The PCR product was ligated into the TOPO cloning vect or (Invitrogen) and the nucleotide sequence determined by the Universi ty of Florida core facility. The sequence was

PAGE 99

99 identical to that documented in GenBank. The edn1 promoter fragment was excised from the cloning vector and transferred to the firefly luciferase reporter gene vector pGL3-Basic using KpnI and XhoI restriction enzymes. The resu lting reporter vector was termed pEdn1. The pEdn1 1 plasmid was also a gift of Dr. Brian Cain. This deletion construct was made by digesting pEdn1 with BglII restriction enzyme to remove 194 bp from the edn1 5-UTR and religating the vector. Each of the above plasmi ds contained an ampicillin resistance gene for selection. Vectors were transformed into DH5 cells and grown overnight on Luria-Bertani (LB) agar plates containing 200 g/ml ampicillin. A single colony was used to inoculate LB broth and propagate the plasmid. Plasmid DNA was prepar ed using the Maxiprep kit from Qiagen. Amplification of the appropriate plasmid was validated by restri ction enzyme digestion (Figure 3-1) and concentrations were determin ed by ultraviolet absorption at 260 nm. Cell Culture and Transient Transfection The m pkCCDc14 cells were a kind gift of Dr. Alain Vandewalle (Duong Van Huyen et al., 1998) and mIMCD-3 cells were purchased from American Type Culture Collection. Both cell lines were maintained in DMEM/F12 plus 10% FBS and 50 g/ml gentamicin. It is important to note that most of the experimental conditions for transfection, ce ll culture, and hormone treatments were varied in an attempt to optimize the in vitro reporter system (Table 3-1). However, unless otherwise stated the general protocol was as follo ws: cells were seeded at 1 x 105 cells/ml into 12-well Transwe ll dishes (Corning) 24 h prior to transfection. One of the experimental firefly lu ciferase vectors (0.18 g) was transiently cotran sfected along with a fixed quantity of the transfection control pRL-TK vector (0.02 g) into cells using FuGENE 6 (0.6 l). At the time of transfection the media was ch anged to DMEM/F12 plus 10% charcoal-dextran stripped FBS (Invitrogen). After 24 h of transfection th e cells were confluen t and treated with

PAGE 100

100 vehicle (ethanol), hormone (aldos terone or dexamethasone), or antagonists (spironolactone or RU486) for 1-48 hours (See Table 3-3). Luciferase Reporter Assay The Dual-L uciferase Reporter Assay System was purchased from Promega. This assay measured the activities of two different lu ciferases, the firefly luciferase and the Renilla luciferase. The bioluminescent reaction catalyzed by the Renilla luciferase requires a different substrate, coelentrerate-luciferin. Therefore, its quantitation was used to normalize for transfection efficiency and cell vi ability. At the time of each lucife rase assay, cells were treated with passive lysis buffer (Promega) and frozen at 80 C for at least 1 h to ensure complete lysis. Cell lysates were thawed and gently transferred to a microcentrifuge tube. A pipette tip was used to gently scrape cells that remained attached to the bottom of the well to ensure complete sample transfer. Lysates were cleared by brief centrifugation and assayed according to the manufacturers instructions (Promega) using a SIRIUS Lumi nometer V2.2 set for a 2 second delay and a 10 second read time. Firefly values were normalized to Renilla values and ar e expressed as relative light units (RLUs) SE. Results Sequence Analysis of the edn1 Promoter Most aldosterone response genes have HREs located within 1000 bp upstream from the transcriptional start site (D erfoul et al., 1998; Kolla et al., 1999; Sayegh et al., 1999). Furthermore, the known regulatory elements in the edn1 promoter are located in this proximal region (Figure 3-2). Therefore, 1990 bp of the edn1 promoter and 5-UTR were analyzed for potential MR binding sites using the Transcription Element Search Software (TESS) available online at http://www.cbil.upenn.edu/tess (Schug, 2003). Although the edn 1 promoter did not contain any elements that were 100% ho mologous to either the consensus 5-

PAGE 101

101 GGTACAnnnTGTTCT-3 (Beato, 1989) several putative HRE half-site s were identified (Table 3-1, Figure 3-2). Of note, visu al inspection of the region su rrounding the HRE1 half-site (5TGGTGGA-3) revealed that the se quence was directly repeated eight nucleotides downstream. These two adjacent half-sites likely form a comple te HRE. Similarly, HRE2 (nucleotides -690 to -671) was identified by visual inspection. This element contained two half-sites separated by eight nucleotides and arranged as an inverted palindrome, which is the preferred orientation for hormone receptor binding (Luisi et al., 1991). Fu rthermore, the upstream half-site in HRE2 (5TGTACC -3) was homologous to the reverse complement of the consensus GR binding site. Of note, HRE2 (nucleotides -690 to -671) is imme diately adjacent to a re gion identified by TESS analysis (HRE2TESS) that may also contribute to the functionality of HRE2. The edn1 promoter was also analyzed using the online program EMBOSS (European Molecular Biology Open Software Suite) for its composition of cytosines (C) and guanines (G). Mammalian gene promoters typically have methylation-resistant regions containing a higher than expected percentage of adjacent Cs and Gs forming a CpG island. EMBOSS was set to identify regions containing a C + G content of gr eater than 50% and a CpG frequency (observed/ expected) to 0.6. Four potential CpG islands were identified (Table 3-2). The location of CpG1 was consistent with a known CpG is land that extends further into the edn1 5-UTR (Vallender and Lahn, 2006). In addition, HRE2 and HRE1 were sandwiched in between two CpG islands supporting the hypothesis that these HREs are functional promoter elements. Characterization of the pEdn1 and Control Luciferase Vectors The 1990 bp region of the edn1 promoter was cloned into the pGL3 reporter vector immediately upstream of the firefly luciferase gene (Figure 3-1A). The resulting vector containing the edn1 promoter was termed pEdn1 and was 6871 bp in length. The pEdn1 vector was transformed into DH5 bacterial cells and propagate d plasmid DNA was validated by

PAGE 102

102 restriction enzyme digestion. The bottom panel on Figure 3-1A shows a representative agarose gel indicating the irregular migration pattern of the uncut circular plasmid. In addition, the gel shows that linearization of pEdn1 wi th either KpnI or XhoI resu lted in a single migratory band that corresponded to the correct molecular weight (Figure 3-1A ). Double digestion of pEdn1 with KpnI and XhoI yielded two bands corresponding to a 4787 bp fragment containing the luciferase gene and a 2084 bp fragment containing the edn1 promoter region (Figure 3-1A, bottom panel). The negative control pGL3-Basic and positive control pGL3-Pro vectors were also transformed into DH5 bacterial cells for vector amplificatio n. Purified plasmids were validated by restriction enzyme digestion (Figure 3-1B-C). Both uncut plasmids exhibited irregular migration patterns, whereas KpnI digestions linearized each vector and resulted in the expected migration patterns for both pGL3-Basic (4818 bp ) and pGL3-Pro (5010 bp) (Figure 3-1B-C). Double digestion of pGL3-Basic wi th KpnI and XbaI resulted in two bands of the expected size: 3081 bp and 1737 bp (Figure 3-1B). Similarly, double digestion of the pGL3-Pro with KpnI and XbaI resulted in two bands of the exp ected size: 3081 bp and 1929 bp (Figure 3-1C). The edn1 Promoter Construct is Transcriptiona lly Activ e in Collecting Duct Cells In Vitro To determine if the cloned region of the edn1 promoter was transcriptionally active, the pEdn1 plasmid was transiently tr ansfected into mIMCD-3 cells for 24 h. In these pilot experiments, luciferase activity was more than 30 times greater in pEdn1 tr ansfected cells than in pGL3-Basic transfected cells (Figure 3-3). Surprisingly, the edn1 promoter was so strong that cells transfected with pEdn1 demonstrated lucife rase activity that was approximately 4 times higher than cells transfected with the positive control pGL3-Pro (Figure 3-3). This observation was unexpected since pGL3-Pro contains a strong, constitutively active SV 40 promoter that is known to generate high luciferase activity in mI MCD-3 cells (Bai et al., 2001; Zhang et al.,

PAGE 103

103 2006). Taken together, these observations demonstrated that the region of the edn1 gene cloned into pEdn1 contained a strong, tran scriptionally active promoter. Fu rthermore, a deletion of 194 bp of the edn1 5-UTR using the Bgl II restriction enzyme (pEdn1 1) had no significant effect on the level of reporter gene expression (Figure 3-3). Since the pEdn1 plasmid containe d a transcriptionally active edn1 promoter and aldosterone is known to stimulate endogenous edn1 mRNA levels in collecting duct cells (Stow et al., 2009) (Chapter 4), we hypot hesized that aldosterone treatm ent would result in increased luciferase activity in pEdn1 tran sfected cells. Luciferase vectors were transfected into mIMCD-3 as well as mpkCCDc14 cells, another aldosterone-responsive collecting duct cell line. After 24 h of transfection in the presence of 10% charco al-stripped FBS cells were treated with 1 M aldosterone or vehicle (ethanol) for 1 h. Unexpect edly, aldosterone treatment did not result in a further increase in luciferase activity in either cell line tran sfected with pEdn1 (Figure 3-4). However, the basal luciferase activity was not ably higher in mIMCD-3 cells compared to mpkCCDc14 cells (Figure 3-4). This observation is c onsistent with the expression levels of the endogenous edn1 gene in each cell line (Stow et al., 2009) (Chapter 4). Optimization of In Vitr o Luciferase Assay The observation that the pEdn1 luciferase gene was not responsive to aldosterone indicated that experimental parameters might not have be en appropriate to reproduce aldosterone action. Several possibilities could explain why the initial reporter assays failed were addressed in the following experiments and are summarized in Table 3-3. First, aldosterone-dependent edn1 expression is known to be biphasic (Gumz et al ., 2003) and it was possi ble that the initial experiments were conducted at an inappropriate time point. To address this concern a 24 h timecourse experiment was conducted on mI MCD-3 cells transfected with pEdn1, pEdn1 1, pGL3Basic or pGL3-Pro in the presence or absence of 1 M aldosterone (Figure 3-5). As expected,

PAGE 104

104 transfection of the positive contro l pGL3-Pro resulted luciferase activity that was an average of 6.4 0.2 fold higher than pGL3-Basic lucife rase activity throughout the course of the experiment. Furthermore, pEdn1 transfection resulte d in luciferase activity that was an average of 2.6 0.1 fold higher than pGL3-Pro and an av erage of 15.9 0.2 fold higher than pGL3-Basic throughout the 24 h time course. However, 1 M aldosterone did not indu ce a further increase in luciferase activity in cells transfected with pEdn1 or pEdn1 1 at any time point (Figure 3-5). These data are consistent with observations made in Figure 3-3 and rule out a time-point issue. Another potential pitfa ll of the original experimental design was that the endogenous edn1 promoter may have been regulat ed by GR, not MR. I recently va lidated the original report by Gumz et al. showing that aldostero ne-dependent mRNA expression of edn1 was sensitive to MR antagonism as well as GR antagonism (Stow et al., 2009) (Chapter 6). Ther efore, it was possible that edn1 was controlled by GR and pEdn1 would be res ponsive to glucocorticoid hormones. To test this possibility, a time-cour se experiment was conducted in parallel to the one described above on mIMCD-3 cells. In this case, cells were treated with 1 M dexamethasone or 1 M dexamethasone plus 1 M aldosterone. These treatments were also unable to stimulate a further increase in pEdn1 or pEdn1 1 luciferase activity (Figure 3-5). The experiments conducted up until this point were all conducted with 1 M aldosterone, which is the same concentration used in the original report identifying edn1 as an aldosterone response gene (Gumz et al., 2003). Since aldosterone failed to stimulate an increase in reporter gene activity, it did not seem plausible that the assay failed due to supra-physiological hormone concentrations. However, a high hormone concentration is a common concern for in vitro experiments. Therefore, aldoster one and dexamethasone were tested at concentrations of 1 nM and 1 M on pEdn1 transfected mIMCD-3 cells. Transf ection of the positive control pGL3-Pro

PAGE 105

105 and pEdn1 vectors resulted in hi gher luciferase activity compared to the negative control pGL3Basic. However, there was no significant change in pEdn1 reporter gene ac tivity in the presence 1 nM or 1 M aldosterone or dexamethasone treatments for either 3 or 9 h (Figure 3-6). Since we observed high basal activity of the pE dn1 luciferase gene and it was possible that our control assay reagents had residual st eroid hormones at leve ls high enough to induce transcription of aldosterone response genes. Since serum would be the source of steroid contaminants, experiments were conducted in the presence of reduced serum or serum-free media preparations. However, the modifications ma de to the media (See Table 3-3) had no effect on aldosterone responsiveness of the pEdn1 reporter gene. To verify these results, 1 M or the MR or GR antagonist spironolac tone and RU486, respectively we re added before or after transfection (Table 3-3). Again, the pEdn1 reporter gene consistently showed no response to hormones in the presence or absence of the hormone receptor antagonist. In conclusion, the transiently transfected pEdn1 plasmid cannot re produce aldosterone-dependent gene expression in an in vitro reporter assay. Discussion The experim ents presented in this chapter demonstrated that the 1990 bp region of the edn1 gene cloned into pEdn1 plasmid contained a strong, transcriptionally active promoter in vitro Sequence analysis of the edn1 promoter region indicated five putative HREs; two of which were complete elements containing two half-site s. The pEdn1 reporter gene demonstrated higher basal expression in mIMCD-3 cells compared to mpkCCDc14 cells, which is consistent with the endogenous edn1 expression in each cell line (Stow et al., 2009) (Chapter 4). However, the pEdn1 reporter gene activity was so high that it surprisingly exceeded the reporter activity from the positive control pGL3-Pro plasmid that contained an SV40 promoter. The pEdn1 reporter

PAGE 106

106 gene was also unexpectedly insensitive to aldost erone or dexamethasone and was not affected by hormone receptor blockade. Aldosterone studies were conducted on both mIMCD-3 and mpkCCDc14 cells transfected with pEdn1. The reporter gene did not respond to al dosterone treatment in either cell line, which is in contrast to the reported hormone responsiveness of the endogenous edn1 gene in both cell lines (Stow et al., 2009). However, the difference in the overall levels of luciferase activity between mIMCD-3 and mpkCCDc14 cells lines was consistent with the difference between the endogenous edn1 gene expression in the re spective portions of the collecting duct. Therefore, the differences in pEdn1 activity between mIMCD-3 and mpkCCDc14 cells was most likely due to differences in available transcriptio nal machinery in each cell line. The observed inability of aldosterone to stim ulate a further increase in pEdn1 reporter gene activity was unexpected. Indeed, the origin al microarray study that identified edn1 gene as an early aldosterone response gene was conducted in mIMCD-3 cells the same cell line used in these studies (Gumz et al., 2003). The re ported studies were conducted using 1 M aldosterone; a concentration that was also tested in these studies. Furthermore, this original report also validated aldosterone stimulation of edn1 using real-time QPCR and Nort hern blot analysis using comparable conditions. Moreover, I will repor t aldosterone regulation of the endogenous edn1 gene in IMCD cells ex vivo and in both mIMCD-3 and mpkCCDc14 cells in the following chapter (Stow et al., 2009) (Chapter 4). All of these data support th e concept that the edn1 promoter is under direct regulation by aldosterone and hormone receptors. Differences in hormone-dependent reporter ge ne activity and the endogenous gene have been observed for other genes such as pnmt (Ross et al., 1990). Several possibilities may account for the discrepancy between the aldosterone-res ponsiveness of the pEdn1 reporter gene and the

PAGE 107

107 endogenous edn1 gene. First, the aldost erone responsive element may reside outside of the 1990 bp cloned into pEdn1. However, most aldosterone responsive HREs are located within 1000 bp of the transcriptional start si te (Kolla et al., 1999; Mick et al., 2001). Furthermore, the pEdn1 reporter gene was transcriptiona lly active indicating that a func tional promoter was cloned into the vector. In fact, the excessive promoter activ ity could be explained if the assay conditions lacked an important inhibitory transc ription mechanism. For example, the edn1 gene may be controlled by a negative enhan cer element that resides outside of the 1990 bp region cloned into the reporter vector. Another explanation for excessive pEdn1 reporte r gene activity and a notable disadvantage of in vitro reporter assays is that the DNA in the promoter construct does not reflect the endogenous gene environment in the context of eukaryotic chromatin. Tr ansiently transfected plasmids will not assemble histones as the endoge nous gene. The association of histones and the packaging of eukaryotic DNA into chromatin resu lts in transcriptional repression since the DNA is no longer accessible to transcri ption factors (Struhl, 1999). The lack of properly associated histones with pEdn1 could leave the edn1 promoter freely accessible to transcription factors in the nucleus. This concept is supported by the di fferences in reporter gene activity observed in mIMCD-3 and mpkCCDc14 cells. Furthermore, steroid receptors play a role in chromatin remodeling (Truss et al., 1995) and MR is known to associate with several chromatin remodeling complexes (Pascual-Le Tallec and Lombs, 2005). One way to circumvent this issue is to create a stably transfected cell line such that pEdn1 would integrate into the genome and associate with histones. However, this approach may also have technical issues depending on where pEdn1 inserts into the genome. Vector integration often occurs in areas of transcriptionally active euchromatin and pEdn1 may still exhibit excessive re porter gene activity. Therefore, the better

PAGE 108

108 experiment is to test the aldoste rone responsivene ss of the endogenous edn1 gene in the context of the native chromatin. This w ill be explored in Chapter 4.

PAGE 109

109 Table 3-1. Putative HREs in the murine edn1 promoter HRE Sequence Position Identification Method HRE0 5AGAACTG-3 -15 to -9 TESS HRE1 5TGGTGGAaggggtggTGGTGGA -3 -572 to -551 TESS: -572 to -566 half-site Visual inspection: -557 to -551 half-site HRE2TESS 5TGTTGTTGTT -3 -670 to -661 TESS HRE2 5TGTACCtgacaaaaCCACAT -3 -690 to -671 Visual inspection HRE3 5TGTGCCT -3 -1255 to -1249 TESS HRE4 5TGTTGTT -3 -1351 to -1345 TESS HRE5 5AGTTGTT -3 -1641 to -1635 TESS

PAGE 110

110 Table 3-2. Potential CpG islands in the murine edn1 promoter CpG Island Position Detection Method CpG1 -49 to +145 EMBOSS CpG2 -215 to -132 EMBOSS CpG3 -769 to -719 EMBOSS CpG4 -903 to -852 EMBOSS

PAGE 111

111 Table 3-3. Experimental parameters tested in luciferase assays. Parameter Affected Potential Pitfall Experimental Modification Time point Aldosterone response is biphasic 24 h time course conducted Hormone treatment conditions Inappropriate aldosterone dose 1 nM and 1 M aldosterone tested edn1 regulated by GR 1 nM and 1 M dexamethasone tested edn1 regulated by MR, but not GR 1 M aldosterone + 2 M RU486 (GR antagonist) edn1 regulated by GR, but not MR 1 M dexamethasone + 2 M spironolactone (MR antagonist) edn1 regulated by both MR and GR 1 M Dexamethasone + 1 M aldosterone tested Cell culture medium Cell culture reagents have contaminating hormones causing pEdn1 reporter gene activity 10% charcoal-dextran stripped FBS 0.2% charcoal-dex tran stripped FBS 0% FBS Opti-MEM (Gibco), a serum free transfection medium Serum free plus 5 g/ml transferrin, 50 g/ml gentamycin, 5 nM triiodothyronine, 50 nM hydrocortisone, 5 g/ml insulin, 10 nM sodium selenite, and 1% (w/v) bovine serum albumin (BSA) (hydrocortisone and BSA removed after 6 h transfection) 1-2 M spironolactone (MR antagonist) added before or after transfection 1-2 M RU486 (GR antagonist) added before or after transfection Transfection conditions Inadequate transfection FuGene6 (6-24 h) Lipofectamine 2000 (24 h)

PAGE 112

112 Figure 3-1. Map of luciferase vectors. A) The pEdn1 vector c ontained 1990 bp fragment of the edn1 promoter. A representative agarose ge l is shown below the vector map. Lanes correspond to pEdn1 that was not digested (ND), linearized with Kpn1 or XhoI individually, or double digested with Kpn1 and Xho1. The latter double digestion resulted in the excision of the edn1 promoter insert. B) Vector map of the negative control pGL3-Basic plasmid that lacks a functional promoter. A representative agarose gel is indicated below the map s howing both the digestion with Kpn1 and the double digestion with Kpn1 and Xba1. C) Vector map of the positive control pGL3Pro vector contains an SV40 promoter. Digestion with K pn1 linearized the vector and codigestion with Kpn1 and Xba1. (L, ladder)

PAGE 113

113 Figure 3-2. Putative HREs in the murine edn1 promoter. The 1990 bp fragment of the edn1 promoter and 5UTR is shown above. The tr anscriptional start s ite, as determined by primer extension and S1 nuclease analysis (I noue et al., 1989), is indicated as +1 and the 5UTR is shown in yellow. Known pr omoter elements are also indicated including the TATA box (Inoue et al., 1989; Sakurai et al., 1991), AP-1 (Lee et al., 1991a), GATA-2 (Lee et al., 1991b; Yamashita et al., 2001), and vascular endothelial zinc finger (VezF) (Aitsebaomo et al., 2001) binding sites. Possible CpG islands were identified by EMBOSS analysis and are shown in blue. Putative HREs were identified by TESS analysis and visual inspection and are shown in red.

PAGE 114

114 Figure 3-3. The edn1 promoter is transcripti onally active. Comparison of luciferase activity in mIMCD-3 cells transiently transfected fo r 24 h with pGL3-Basic, pGL3-Pro, pEdn1, or pEdn1 1. Luciferase activity is normalized to Renilla (pRL-TK) and expressed as relative light units (RLUs) SE. (n 3).

PAGE 115

115 Figure 3-4. Comparison of pEdn1 activity in mpkCCDc14 and mIMCD-3 cells. Cells were transiently transfected with pEdn1 for 24 h pr ior to treatment with vehicle (open bars) or 1 M aldosterone (closed bars) for 1 h. Fo llowing hormone treatment cells were harvested for analysis of luciferase ac tivity. Values were normalized for control Renilla luciferase activity and expressed as relative light units (RLUs) SE. (n 3)

PAGE 116

116 Figure 3-5. Time course of luciferase activity in hormone treated mIMCD-3 cells. The mIMCD3 cells were transfected for 24 h with either A) pEdn1 or B) pEdn1 1 in the presence of 10% charcoal-dextran stripped FBS. Cells where then treated with vehicle (veh), 1 M aldosterone (aldo), 1 M aldo plus 1 M dexamethasone (dex), or 1 M dex alone for 1 24 h. Luciferase activity was normalized to Renilla and expressed as relative light units (RLUs). (n 2)

PAGE 117

117 Figure 3-6. Effect of low and high dose aldosterone or dexamethasone on pEdn1 reporter gene activity. The pEdn1 plasmid was transiently tr ansfected in mIMCD-3 cells for 24 h in the presence of 10% charcoal-dextran stri pped FBS. Cells were then treated with vehicle (veh, open bars), 1 nM or 1 M aldosterone (aldo, closed bars) or 1 nM or 1 M dexamethasone (dex, gray bars) for 3 h. Luciferase activity was normalized to Renilla to control for transfection and cell vi ability. Values are expressed as relative fold change compared to vehicle SE. (n=3 ). Experiments were also conducted at 9 h and similar results were obtained.

PAGE 118

118 CHAPTER 4 ALDOSTERONE MODULATES STERIOD RE CEP TOR BINDING TO THE ENDOTHELIN1 GENE ( EDN1 ) Introduction The steroid horm one aldoste rone is critical for Na+ homeostasis and blood pressure control. Aldosterone works by modu lating the fine regulation of Na+ reabsorption in the distal nephron and collecting duct of the kidney. Classi cal aldosterone action is mediated through the mineralocorticoid receptor (MR), a member of th e nuclear receptor family of proteins that function as ligand-dependent transcription factor s (Arriza et al., 1987). MR acts on cells of the distal nephron and collecting duct to stimulate tran scription of genes invol ved in transepithelial Na+ transport including scnn1a ( ENaC), atp1a1 (Na+/K+-ATPase 1), and sgk1 (Rogerson and Fuller, 2000). The increase in expression of genes involved in Na+ transport results in net Na+ reabsorption followed by in increase in extracellu lar fluid volume and a co nsequent increase in blood pressure. Indeed, MR an tagonists such as spironolact one and eplerenone are used clinically as diuretic and anti -hypertensive agents (McManus et al., 2008; Struthers et al., 2008). The mechanism of MR action is consistent with a classical steroid receptor mechanism (Beato and Klug, 2000). Prior to activation MR resi des in the cytosol. Li gand binding induces a conformational change that releases chaperone prot eins and reveals a nuclear localization signal. Nuclear MR binds directly to DNA at hormone response elements (HREs) in target genes to modulate their transcription. A t ypical HRE for MR consists of tw o receptor binding half-sites with the consensus sequence: 5-TGTTCT-3 arra nged as an inverted palindrome (Arriza et al., 1987; Geserick et al., 2005). These HREs facilit ate binding of steroid receptors in a dimeric conformation. Once bound to a gene promoter MR serves as a molecular platform for the recruitment of transcription factors such as th e steroid receptor coactivator-1 (SRC-1) and RNA polymerase II (Hellal-Levy et al., 2000; Li et al., 2005; Pascual-Le Tallec and Lombs, 2005).

PAGE 119

119 MR is highly homologous to the glucocorticoid receptor (GR) and can bind glucocorticoids with equal affinity to aldosterone (Arriza et al., 1987). However, inappropriate glucocorticoid activation of MR can lead to se vere hypertension (Frey et al., 2004; Ulick et al., 1979). Aldosterone responsive cells are protected from glucoc orticoids by the activity of 11 hydroxysteroid dehydrogenase type 2 (11 -HSD2), an enzyme that c onverts glucocorticoids into 11-ketosteroids that have very little affinity for MR or other steroid receptors (Funder et al., 1988; Rebuffat et al., 2004). Alternatively, GR can bind mineralocorticoids (KD = 14-60 nM) (Arriza et al., 1987) and may c ontribute to aldosterone action. MR and GR share 94% homology in their DNA binding domains and have conserved amino acids at each re sidue shown to make direct contacts with DNA (Arriza et al., 1987; Luisi et al., 1991). Indeed, MR and GR are known to bind to the same HRE in seve ral genes (Derfoul et al., 1998; Itani et al., 2002; Kolla et al., 1999; Mick et al., 2001; Webster et al., 1993). Previously, we identified endothelin-1 ( edn1) as a novel aldosterone response gene in inner medullary collecting duct (mIMCD-3) cells (Gum z et al., 2003). Similarly, this interaction has been documented in whole kidney extracts from rat (Wong et al., 2007). The gene product of edn1 is a 212 amino acid prepropeptide that is en zymatically processed to form the biologically active 21 amino acid peptide, ET-1. ET-1 plays a complex role in cardiovascular and renal physiology. Several reports have dem onstrated aldosterone induction of edn1 in vascular smooth muscle and cardiac tissue (Doi et al., 2008; Wolf et al ., 2004). In these cell types, systemic ET-1 is largely vasoconstrictive and profibrotic. In fact, both ET-1 and aldosterone have been implicated in cardiac and renal fibrosis, glomer ular damage and protei nuric disease (Barton, 2008; Barton and Yanagisawa, 2008; Funder a nd Mihailidou, 2009). In the kidney, ET-1 has effects on renal hemodynamics (B aylis, 1999; Inscho et al., 2005), Na+ and water homeostasis

PAGE 120

120 (Kohan, 2009), and acid-base balance (Khanna et al., 2005). These same processes are also influenced by aldosterone. However, renal ET-1 is a well-documented natriuretic peptide that directly blocks Na+ transport in the collec ting duct (Ahn et al., 2004; Kizer et al., 1995; Kohan, 2006; Nakano et al., 2008; Schneid er et al., 2008). The physiological importance of collecting duct ET-1 is emphasized by the fact that collecting duct cell-specific edn1 knockout mice exhibit salt sensitive hypertension (Ahn et al., 2004). Thus, in the renal co llecting duct, the actions of aldosterone and ET-1 on Na+ transport directly oppose each other. The goal of the present report was to ch aracterize aldoster one regulation of edn1 in the renal collecting duct. Indeed, studies presented here demons trate aldosterone-stimulated edn1 in cortical, outer medullary, and IMCD cells in vitro and edn1 and ET-1 peptide in the rat kidney in vivo Putative HREs in the edn1 promoter were identified. These elements were evaluated for the recruitment of hormone receptors and the asse mbly of an aldosterone-dependent transcription complex. Materials and Methods Chemicals Aldosterone, spironolactone and RU486 (Sigm a) were prepared in 100% ethanol at 1 mg/ml stock concentrations and stored at 20 C. Collagenase type I (MP Biomedicals), hyaluronidase type IV (Sigma), and DNase I (Sigma) were prepared fresh on the day of the experiment. Animals Male Sprague Dawley rats (300-350 g) we re obtained from Harlan and housed at the University of Florida Animal Care Services rode nt facilities. Standard rat chow and tap water were provided ad libitum. All procedures adhere d to the Animal Care Services guidelines and were approved by the University of Florida In stitutional Animal Use and Care Committee.

PAGE 121

121 Acutely Isolated Rat IMCD Cells Rats were euthanized by sodium pent obarbital (50 mg/kg body weight) and cervical dislocation. Kidneys were immediately removed and the inner medulla was carefully dissected for acute IMCD isolation according to Stricklett et al. (Stricklett et al., 2006). In brief, minced tissue was incubated at 37 C in a digestion so lution containing collagenase type I (3 mg/ml), hyaluronidase type IV (2 mg/ml) and DNase I (0.1 mg/ml). Digested IMCDs were collected by centrifugation through a sucrose bu ffer. Isolated IMCDs were resuspended in DMEM/F-12 and equilibrated in a 5% CO2 incubator at 37 C for 20 min. I nner medullas from the left and right kidney of each rat were processe d in tandem, but separately, to allow for a paired analysis between vehicle (0.04% ethanol) and 1 M aldosterone treatments. Thus, each rat served as its own internal control. After 1 h cells were immediately pelleted by gentle centrifugation at 4 C and resuspended in TRIzol Reagent (Invitroge n) for RNA isolation as described below. Aldosterone Administration in Ra t and ET-1 Peptide Measurement Rats were given an intraperitoneal (ip) inj ection (1 ml/kg body weight) of aldosterone (1 mg/kg) or vehicle (2% ethanol in saline). After 2 h rats were anesthetized with inhaled isoflurane and kidneys were flushed by an aortic perfusion of ice-cold PBS with the vena cava vented. Kidneys were removed and dissected into cortex, outer medulla, and inner medulla. Tissues were immediately snap frozen in liquid nitrogen and st ored at -80 C until use. ET-1 was extracted from renal tissues using a protocol originally described by Yorikane et al. (Yorikane et al., 1993). Immunoreactive ET-1 peptide was dete cted by chemiluminescent ELISA (R&D Systems) and normalized to total protein content as determined by standard protein assays (BioRad).

PAGE 122

122 Cell Culture and Aldosterone Treatments All cells were m aintained in DMEM/F12 plus 10% FBS and 50 g/ml gentamicin. The mpkCCDc14 cells were a kind gift of Dr. Alain Vandewalle (Bens et al., 1999), OMCD-1 cells were a kind gift of Dr. Thomas DuBose from Wake Forest Medical Sch ool (Guntupalli et al., 1997), mIMCD-K2 cells were a gift of Dr. Br uce Stanton from Dartmouth Medical School (Kizer et al., 1995) and mIMCD-3 cells were purchased from American Type Culture Collection. For all hormone experiments cells were grown 24 h past confluency and changed to DMEM/F12 plus 10% charcoal-dextran stri pped FBS (Invitrogen Corp.). After 24 h, cells were treated with vehicle (ethanol) or al dosterone (0.01 to 1 M) for 1 h. Steady-State mRNA Determination Hor mone studies were conducted as descri bed above on growth-arrested confluent monolayers grown in 6-well Costar Transwell plates (Corning). The final concentration of ethanol in all treatments was 0.1%. Total RNA (2 g) was isolated from cells using TRIzol Reagent (Invitrogen), treated with DNase I (Amb ion) to eliminate genomic DNA, and reverse transcribed using oligo dT, random hexamers and Superscript III reverse transcriptase (Invitrogen). No reverse transcri ptase served as a negative cont rol. Resulting cDNAs (32 ng) were used as templates in duplicate QPCR reactions (Applied Biosystems). Cycle threshold (CT) values were normalized against -actin (actb ) and relative quantifica tion was performed using the CT method (Livak and Schmittgen, 2001). All QPCR was performed with TaqMan primer/probe sets that have guaranteed 100% P CR efficiency over six logarithms of template (Applied Biosystems, 2006). Primer/probes for rat edn1, sgk1 and actb are indicated in Table 21 and primer/probe sets for mous e are indicated in Table 5-1.

PAGE 123

123 Heterogeneous Nuclear RNA (hnRNA) Assay As described by Lipson and Baserga (Lipson and Baserga, 1989), levels of unspliced edn1 hnRNA were detected using prim ers designed to am plify a regi on between exon 4 and intron 4 (forward: 5-GAAGTGTATCTATCA GCAGCTGG-3; reverse: 5'AGACCATGACGACTCTATTACTGG-3). QPCR reactio ns were set up with 32 ng cDNA, 200 nM of each primer and SyBr Green mastermix (Bio-Rad). Expression of hnRNA was normalized to glyceraldehyde-3-phos phate dehydrogenase ( gapdh) mRNA (forward primer: 5GAAGCCCATCACCATCTTCC-3; reverse pr imer: 5-TGATGATCCTTTTGGCTCC-3). Edn1 hnRNA and gapdh primers were validated for QPCR over 4 orders of magnitude of input cDNA for similar PCR efficiency (data not shown) Melting curves (55-95 C) and agarose gel electrophoresis were used to verify product size. Nuclear Translocation and Western Blots Hor mone experiments were conducted in mIMC D-3 cells as described above except that cells were grown in 150 mm dishes (Corning). Cells were treated with ve hicle (0.15% ethanol), aldosterone, antagonist or aldoste rone plus antagonist. Antagoni sts, spironolactone and RU486, were supplied at the final concentration of 10 M in each experiment. In some cases, cells were pretreated with antagonists 1 h pr ior to aldosterone treatment. Cy toplasmic and nuclear extracts were obtained using the NE-PER Reagents (P ierce Biotechnology). Prot ein concentrations were determined using the Bradford assay and 90 g were separated on a 7.5% sodium dodecyl sulfate polyacrylamide gel (Bio-Rad). Proteins were transferred to PVDF overnight and visualized by Ponseau S. Membranes were bl ocked with 2% Rodeo blocker plus 0.05% saddle soap (United States Biochemical Corp.) in Tris buffered saline (TBS). The monoclonal MR antibody was a kind gift of Drs. Elise and Ce lso Gomez-Sanchez (Gomez-Sanchez et al., 2006). Detailed information on all primary and secondary antibodies used is listed in Supplemental

PAGE 124

124 Table 1. Blots were washed with blocking soluti on and developed with Rodeo Western Detection Reagents (United States Biochemical Corp.). Densitometric analysis was performed with Quantity One software (Bio-Rad). For each nuclear translocation experiment bl ots were stripped usi ng 2% sodium dodecyl sulfate plus 10% -mercaptoethanol for 30 min at 70 C. Blots were redeveloped to ensure completely antibody stripping, washed and re probed using another primary antibody. Hormone Receptor siRNA Knockdown MR-siRNA (J-061269-09 NR3C2), GR-siRNA ( J-045970-10 NR3C1) and control nontargeting siRNA against luciferase (#2 D001210-02-05) were purchased from Dharmacon (Lafayette, CO, USA). Cells were seed ed at a density of 75,000 cells per cm2 on 6-well Transwell plates (Corning) and transf ected for 24 h with 66 nM siRNA in 1.5 l of DharmaFect 4. At the time of transfection cells were switched to phenol-red free DMEM/F12 plus 10 % charcoal dextran stripped FBS. After 24 h the cells were treated with 1 M aldosterone or vehicle for 1 h. RNA was extracted and pro cessed as described above for QPCR. Chromatin Immunoprecipitation (ChIP) Assays ChIP assays were perform ed as previously described (Leach et al ., 2003). Briefly, cells were fixed with 1% formaldehyde and quenched with glycine. Nuclei were isolated and DNA was sonicated to approximately 500 bp. Fragment length was verified by gel electrophoresis. Specific antibodies (Table 4-1) were used to immunoprecipitate DNA-protein complexes on BSA-blocked protein-A sepharose beads. Cross links were reversed and DNA fractions were analyzed for bound edn1 by PCR. Primers: forward 5-TCTGATCGGCGATACTAGGG-3 and reverse 5-CGCTCTTGAATCCCAGCTAC-3, amp lify a 235 bp region c ontaining putative HREs (Figure 4-7). Standard PCR products were visualized with SyBr Green on a 5% TBE gel. Alternatively, bound edn1 was quantified by QPCR using SyBr Green mastermix (Bio-Rad).

PAGE 125

125 Values were normalized to total input DNA and are expressed as fold change relative to control. Primers were validated for quantification by anal yzing PCR efficiency over a serial dilution of input DNA. Melting curves confirmed specifi c PCR products and melting temperatures. Coimmunoprecipitation Cytosolic and nuclear extracts (175 g) obtained from vehicle and aldosterone treated mIMCD-3 cells were diluted to a final volume of 250 l in PBS with fresh protease inhibitors (Roche). Diluted samples were pre-cleared with 30 l BSA-blocked protein-A sepharose beads and 0.4 g of normal mouse IgG (Santa Cruz) for 30 mi n at room temperature with end-over-end rotation. Following gentle centrifugation supernatants (240 l) were collected and subjected to immunoprecipitation with anti-MR or anti-GR (Table 4-1) and 40 l blocked protein-A sepharose beads for 1 h. Beads were pelleted and washed three times with ice-cold PBS plus protease inhibitors. Wash supernatants were re moved with flat-head gel-loading tips (USA Scientific) after each wash. Washed samples were resuspended in 40 l of 2x lithium dodecyl sulfate sample buffer (Invitrogen Corp) plus 10% mercaptoethanol, boiled for 5 min, and subjected to Western blo tting as described above. DNA-Affinity Purification Analysis Cytosolic and nuclear extracts obtained from mIMCD-3 cells as described above were subjected to DNA-affinity purific ation analysis (DAPA) as r ecently described (Deng et al., 2003). Double stranded DNA probes were biotinylat ed on each 5 end (Sigma Genosys) and were homologous to HRE1: 5-AGACTTGGT GGAAGGGGTGGTGGTGGA AAAGT or HRE2: 5GGATGTACCTGACAAAACCACATTGTTGTTGTTATC in the edn1 promoter (Figure 36). Probes were immobilized on 50 l of streptavidin coated agar ose beads and incubated with 175 g of cellular extract in the presence of freshl y prepared protease inhibitors (Roche) for 1 h at room temperature with end-over-end rota tion. Beads were pellete d. Supernatants were

PAGE 126

126 removed and used for input controls by Western blotting for actin. Pelleted beads were washed four times with ice-cold PBS plus protease inhibitors. After the final wash, all liquid was aspirated from the beads with fl at-headed gel lo ading tips and 50 l of 2x lithium dodecyl sulfate sample buffer (Invitrogen Corp) plus -mercaptoethanol. Samples were boiled for 5 min, chilled on ice, and loaded onto a 7.5% Tris-HCl sodi um dodecyl sulfate poly acrylamide Ready Gel (Bio-Rad) for electrophoresis. Purified proteins were identified by Western analysis as described above except that blots were washed with TBS plus 0.05% saddle soap w ithout blocking reagent. Equal loading was controlled for by Bradford a ssay, input control Westerns against actin, and reprobing DAPA blots with actin. Statistics Data are p resented as the mean standard error (SE). Unless otherwise stated all experiments were performed in duplicate at least three independent times. Statistical significance was calculated using th e two-tailed Students t test and p < 0.05 was cons idered significant. Results Aldosterone Stimulates ET-1 in Rat Inner Medulla Renal collecting duct cells are a target cell type for aldosterone action in the body. Indeed, our original report s howed stim ulation of edn1 mRNA by aldosterone occurred in mIMCD-3 cells (Gumz et al., 2003). This interaction has also been documented in whole kidney extracts from rat (Wong et al., 2007). To determine if coll ecting duct cells were also the target cell type in the animal, aldosterone studies were c onducted on acutely isolat ed rat IMCD cells ex vivo Following a brief equilibration, IMCD cells isolated from a single ra t were separated for a paired analysis between vehicle and 1 M aldosterone treatments. After 1 h, aldosterone led to a 41 6% increase in edn1 mRNA expression compared to control (Figure 4-1A). The observed

PAGE 127

127 stimulation in edn1 exceeded the 28 5% increase in the mRNA of the well-established aldosterone response gene sgk1 (Flores et al., 2005; Vallon and Lang, 2005). Animal studies were extended to investigate th e level of ET-1 peptide in rat kidney. Earlier work had demonstrated that basal ET-1 levels we re highest in the inner medulla (Table 2-2). Aldosterone injection (1 mg/kg body weight, ip) resulted in an approximate 2-fold increase in inner medullary ET-1 levels compared to control (Figure 4-2B). The observation that aldosterone stimulated ET-1 in inner medulla in vivo combined with the known ro le of ET-1 in modulating renal Na+ transport (Bugaj et al., 2008; Gilmore et al., 2001), supports th e hypothesis that ET-1 is a regulator of aldosterone action in the kidney. Aldosterone Stimulates Dose-Dependent Transcription of edn1 in Collec ting Duct Cells To determine if the stimulation of edn1 by aldosterone was specifi c to IMCD cells or was a more generalized collecting duct cell response the effect of aldos terone was evaluated in three renal cell lines thought to be repr esentative of cortical, outer medullary and IMCD cells. These cell lines were mpkCCDc14 (Bens et al., 1999), OMCD-1 (Gunt upalli et al., 1997) and mIMCD-3 (Gumz et al., 2003; Rauchman et al., 1993) cells, respectively. Aldosterone (1 M) led to an approximate 3-fold increase in edn1 mRNA at 1 h in each cell line (Figure 4-2A). Aldosterone also stimulated a 2.5 0.4 fold increase in edn1 mRNA in mIMCD-K2 cells, an independently derived IMCD cell model (Kizer et al., 1995) (Figure 4-3). Ta ken together, this evidence indicates that aldos terone induction of edn1 mRNA occurs in multiple collecting duct cells in vitro and is likely to occur along th e length of the collecting duct in vivo To more fully characterize aldosterone induction of edn1, aldosterone dose-response studies were conducted in mIMCD-3 cells. This ce ll line was selected because the inner medulla is an important site for ET-1 action in vivo and because this cell line has been validated as a model for aldosterone action (Boesen et al., 2008 ; Gumz et al., 2003; Kitamura et al., 1989;

PAGE 128

128 Vassileva et al., 2003). Edn1 mRNA exhibited a dose-dependen t increase in the presence of aldosterone that was significant at concentrations as low as 0.1 M (Figure 4-2B). Importantly, mRNA induction of edn1 paralleled that of sgk1 (Figure 4-2B), which ensured that hormone concentrations were appropriate to reproduce an aldosterone response in vitro. In addition, aldosterone treatment resulted in an increase in functional ET-1 peptid e release from mIMCD-3 cells (Figure 4-4), which further validates this cell line as a mo del of aldosterone action on ET-1. In general, aldosterone action is mediated at the level of transcription (Bhargava et al., 2004). To test the hypothesi s that the increase in edn1 mRNA in response to aldosterone also occurred at the level of tran scription, the c oncentration of edn1 heterogeneous nuclear RNA (hnRNA) was determined. Levels of hnRNA can ge nerally be used to measure transcriptional activity of a specific gene because pre-splici ng hnRNA molecules are not subject to factors affecting overall mRNA stability (Palii et al., 200 6). Consistent with levels of steady state mRNA (Figure 4-2B), aldosterone stimu lated a dose-dependent increase in edn1 hnRNA (Figure 4-2C). Given the transcriptional mech anism of aldosterone, the increase in edn1 hnRNA supports the hypothesis that the induction of edn1 occurs by transcription. Aldosterone Action on edn1 Involves Both MR and GR. Activation of MR is central to the m echanism by which aldosterone modulates transcription of target genes. However, aldosterone-regulated ge ne transcription may also be mediated through GR. Therefore, se veral approaches were used to investigate the contribution of each receptor in mediating aldosterone action. Firs t, a Western blotting approach was adopted to follow nuclear translocation of MR (Figure 4-5A, top panel) or GR (Figure 4-5A, middle panel) in response to aldosterone treatment. Aldosterone (1 M) resulted in comparable 10.9 0.2 and 11.9 0.8 fold increases in the abundance of nucl ear MR and GR, respectiv ely (Figure 4-5A-C). Furthermore, nuclear translocation of MR and GR was dose-dependent and occurred at

PAGE 129

129 concentrations of aldosterone as low as 0.01 M. Of note, this concentration of hormone failed to stimulate a detectable increase in edn1 or sgk1 mRNA (Figure 4-2B versus Figure 4-5B). These observations provide strong evid ence that aldosterone action is mediated through both MR and GR in mIMCD-3 cells. To determine if each receptor was directly involved in edn1 transcription receptor blockade experiments were performed on mIMCD-3 cells. C onsistent with previo usly reported data (Gumz et al., 2003), inhibition of MR or GR with spironolactone or RU486 respectively, completely blocked aldosterone induction of edn1 mRNA (Figure 4-6A). To corroborate these findings, siRNA gene silencing was used to specifically knockdown MR or GR expression. Independent transfections of MR-siRNA or GR -siRNA resulted in nearly 90% knockdown of their relevant receptor mRNAs in mIMCD-3 cel ls (Gumz et al., 2009a). In the presence of aldosterone, transfection of MR-siRNA or GR-siRNA i nhibited the induction of edn1 mRNA by 35 8% and 40 4%, respectively (Figure 4-6B ). Cotransfection of MR-siRNA and GR-siRNA together resulted in a 54 4% reduction in edn1 mRNA. However, the e ffect of cotransfection was not significantly additive compared to eith er siRNA transfected alone (Figure 4-6B). The additive trend by siRNA knockdown most likely reflects the differe nt mechanism of receptor inhibition given that pharmacologi cal blockade of either receptor alone completely prevented the induction of edn1. Nevertheless, the observation that targeted inhibition of GR blocked aldosterone-induced edn1 demonstrates that MR was not able to compensate for the loss of GR. Thus, these data indicate that both MR and GR are functionally required for the aldosteronemediated induction of edn1. Aldosterone Modulates Hormone Receptor Binding to the edn1 Promoter The observation that both MR and GR we re involved in aldosterone m ediated edn1 transcription suggested that the edn1 promoter contained functiona l HREs. Luciferase studies

PAGE 130

130 from Chapter 3 indicated that the proximal 1990 bp region of the murine edn1 promoter and 5untranlated region contained a tr anscriptionally active promoter. Furthermore, sequence analysis revealed several putative HRE half-sites includi ng two complete elements designated HRE1 and HRE2 (Figure 4-7A). In contrast to a classical element that contains receptor binding half-sites separated by three nucleotides, the identified HR Es each have half-sites separated by eight nucleotides. Furthermore, each of the identified HR Es are different from one another in that the downstream HRE1 consists of two directly repeated half-sites, while the upstream HRE2 has half-sites arranged as an imperfect inverted palindrome (Figure 4-7A). Chromatin immunoprecipitation (ChIP) assa ys were performed on vehicle or 1 M aldosterone treated mIMCD-3 cells in order to determine if MR or GR interacted directly with the edn1 promoter. PCR primers were designed to flank both HREs (Figure 4-7A). After 1 h, aldosterone treatment resulted in a 5.4 0.3 fold increase in MR and a 6.8 1.2 fold increase in GR bound to the edn1 promoter (Figure 4-7B). Furthe rmore, the aldosterone-dependent association of MR and GR was accompanied by a 2.6 0.4 fold increase in the transcriptional coactivator SRC-1 associated with the edn1 promoter. Regional histone H3 lysine 4 residues were dimethylated after treatme nt with aldosterone. This part icular histone modification is widely associated with transcriptionally active promoters (Liang et al., 2004). Taken together, these data are consistent with the concept that the edn1 promoter is more active in the presence of aldosterone. The association of MR and GR in the same region of the edn1 promoter suggested that the receptors bound directly to one or both of th e identified HREs. Accordingly, higher resolution DAPA experiments were employed to map the al dosterone-dependent recruitment of MR and GR to either HRE1 or HRE2. DAPA allows one to use a small region of double stranded DNA,

PAGE 131

131 in this case HRE1 or HRE2 of the edn1 promoter, as bait in an affi nity purification protocol to pull down the protein complex bound to the DNA (Deng et al., 2003). Aldosterone induced dosedependent association of MR and GR with HRE2 (Figure 4-8A). Both receptors were also recruited to HRE1 in the presence of 1 M aldosterone (Figure 4-8B). However, the relative abundance of either receptor re cruited to HRE1 was approximate ly 10% of the total abundance of MR or GR bound to HRE2. Furthermore, receptor s could not be consistent ly detected at lower concentrations of hormone suggest ing that the upstream HRE2 is the primary response element governing edn1 induction by aldosterone. The observation that both MR a nd GR interacted with the same HRE suggested that both receptors might also be in the same tran scription complex in the nucleus. Indeed, coimmunoprecipitation experiments performed on mIMCD-3 cells revealed that MR and GR were present in the same protein complex in th e nucleus of aldosterone, but not vehicle treated cells (Figure 4-9A). The interaction of MR and GR in the nucleus was dose-dependent and occurred at concentrations of aldosterone as low as 0.01 M. Coimmunoprecipitation experiments were also conducted on cy tosolic extracts from vehicle and 1 M aldosterone treated mIMCD-3 cells (Figure 4-9B, top panels). Both MR and GR were detected in the same protein complex in the presence or absence of al dosterone in the cytosol. Conversely, neither MR nor GR were precipitated from cytosolic extr acts by DAPA using either HRE as bait (Figure 49B, middle panels). Together these data indica te that MR and GR are in the same protein complex in the cytosol prior to hormone activati on. However, the associa tion of either MR or GR with DNA is exclusive to aldosterone-ac tivated receptors localized in the nucleus. In order to test whether al dosterone-activated MR and GR could recruit RNA polymerase II to the edn1 promoter, ChIP and DAPA experiments we re performed. ChIP analysis revealed

PAGE 132

132 that RNA polymerase II was present on the edn1 promoter in aldosterone treated cells at levels 2.5 0.5 fold higher than control (Figure 4-10A ). Likewise, DAPA expe riments showed dosedependent recruitment of RNA polymerase II to HRE2 (Figure 4-10B). In summary, aldosterone stimulates edn1 in collecting duct cells by a mechanism i nvolving the assembly of a transcription complex at HRE2 in the edn1 promoter that contains MR, GR SRC-1, and RNA polymerase II. Discussion In this report the regulation of edn1 by aldosteron e was characterized in renal collecting duct cells. Aldosterone stimulated edn1 in rat IMCD cells ex vivo as well as four independent collecting duct cell models in vitro We report the first direct ev idence of aldosterone induction of ET-1 peptide in rat inner medulla in vivo Coimmunoprecipitation experiments showed that MR and GR were present in the same protein co mplex in the cytosol prior to hormone activation. Nuclear translocation, pharmacological in hibition, siRNA silencing, ChIP and DAPA experiments all demonstrated that both MR a nd GR were involved in mediating aldosterone action on the edn1 gene. Receptors bound directly to the edn1 promoter to facilitate the assembly of a transcription complex that included the transcription coactivator SRC-1 and RNA polymerase II. Supporting the hypothesis that ET1 modulates aldosterone ac tion in the kidney was the observation that aldoste rone induction of edn1 mRNA occurred in collecting duct cells, the target cell type for aldosterone action. Fu rthermore, induction of ET-1 peptide was detected in the renal inner medulla of rats given a 2 h injection of aldosterone. Inner medullary ET-1 is wellcharacterized natriuretic peptide that stimulates compounds such as nitric oxide and cyclic GMP (Edwards et al., 1992; Po llock, 2000). Similarly, ET-1 potently inhibits Na+ transport through the ENaC channel in collecti ng duct cells (Bugaj et al., 2008; Gallego and Ling, 1996). Consequently, aldosterone induction of edn1 may represent an importa nt negative feedback loop

PAGE 133

133 on aldosterone-stimulated Na+ reabsorption in the collecting duct. Indeed, the renal ET-1 pathway is differentially regulated in animal s with mineralocorticoid-induced hypertension (Hsieh et al., 2000; Matsumura et al., 2000a, b; Montezano et al., 2005). However, direct support for this concept comes from studies c onducted on collecting duct cell-specific edn1 knockout mice. These mice exhibit severe salt-sensitive hypertension that is e ffectively remediated by either ENaC or MR antagonists (A hn et al., 2004; Ge et al., 2008). Given the known functions of aldosterone and ET-1 in collecting duct cells, studies were conducted to more fully characte rize aldosterone regulation of edn1 in mIMCD-3 cells. Aldosterone treatment resulted in dose-dependent increases in edn1 and sgk1 mRNA and edn1 hnRNA. This increase in hnRNA is consistent wi th the classical transcriptional mechanism of aldosterone. Two HREs were mapped in the edn1 promoter that each contained receptor binding halfsites separated by eight nucleotides in different orientat ions. Variations in spacer regions have been reported for several aldosterone response ge nes (Mick et al., 2001; Ou et al., 2001) and may influence cooperative binding of multiple hormone receptors (Ou et al., 2001). Indeed, both MR and GR interacted at the same HRE in the edn1 promoter. Half-site orient ation is also known to affect receptor binding as well as transcripti onal activation (Geserick et al., 2005). Although GR can bind to directly repeated half -sites with low affinity (Aumais et al., 1996), structural studies revealed that GR preferentially binds to pali ndromic DNA sequences as a dimer in a head-tohead conformation (Luisi et al., 1991). Cons istent with these reports, both MR and GR demonstrated a stronger affinity for HRE2 in comparison to HRE1. Moreover, only HRE2 could recruit RNA polymerase II. Similarly, the aldosterone response gene scnn1a also contains two

PAGE 134

134 HREs in different orientations. Only the inverted HRE was capa ble of stimulating transcription (Sayegh et al., 1999). Interestingly, inhibition of hormone receptors with spironolactone and RU486 resulted in hormone receptor nuclear translocation and edn1 promoter binding (Figure 4-11). However, these antagonists are known to inhibit hormone receptors by altering receptor conformation and disrupting coactivator recrui tment (Rogerson et al., 2003). Indeed, proper transcriptional coactivation by MR and GR require s the recruitment of SRC-1 (H e et al., 2002; Li et al., 2005). ChIP analysis revealed that SRC-1 was recruited to the edn1 promoter in the presence of aldosterone. Multiple molecular studies in this report show that MR and GR were actively recruited to the edn1 gene to mediate aldosterone action. Both hormone receptors have documented roles in regulating aldosterone re sponse genes including scnn1a (Mick et al., 2001; Sayegh et al., 1999), sgk1 (Chen et al., 1999; It ani et al., 2002), and atp1a1 (Kolla et al., 1999 ; Whorwood et al., 1994). Both receptors have also been repor ted to mediate aldo sterone stimulated Na+ transport in the renal collecting duct (Bens et al., 1999; Gaeggeler et al., 2005). However, the role of GR in aldosterone action is actively de bated due to the concept that GR would not active in aldosterone responsive cells that express 11 -HSD2 (Funder and Mihailidou, 2009; Funder et al., 1988; Gaeggeler et al., 2005; Odermatt and Atanasov, 2009). Indeed, 11 -HSD2 is an important enzyme that functions to inactive endogenous glucocorticoids and prevent glucocorticoidmediated Na+ retention by the collecting duct. However, 11 -HSD2 metabolites also lack an affinity for GR leaving GR expressed in collec ting duct cells readily available for activation by another high affinity ligand such as aldosterone. Our studies show that MR and GR were present in the same protein complex. Several methods have demonstrated heterodimerization between

PAGE 135

135 MR and GR (Liu et al., 1995; Savory et al., 2001) including Fluorescence Resonance Energy Transfer (Nishi et al., 2004). Mo reover, these heterodimers exhi bited distinct transcriptional properties (Liu et al., 1995). I ndeed, aldosterone action mediated by two hormone receptors with different transcriptional propert ies would certainly provide a co llecting duct cell with a higher degree of adaptability in the regulation of Na+ transport.

PAGE 136

136 Table 4-1 Antibodies and applications Antibody Source/Epitope Application Preparation Supplier anti-MR monoclonal mouse anti-rat (aa 1-18) Western/DAPA 1:100 Kind gift of Drs. Elise and Celso Gomez-Sanchez ChIP/ CoIP 10 l/ IP anti-GR rabbit-anti-mouse (N-terminus) Western/DAPA 1:5000 Santa Cruz (sc1004x) ChIP/ CoIP 2.5 l /IP anti-SRC-1 monoclonal mouse anti-human (aa 477947) ChIP 1.5 l /IP Upstate (05-522) anti-RNA pol II monoclonal mouse anti-human (Cterminus) Western/DAPA 1:1000 Upstate (05-623) ChIP 1 l /IP anti-H3 rabbit anti-human (Cterminus) ChIP 2.5 l /IP Upstate (07-690) anti-mK4H3 rabbit anti-human (aa 1-8) ChIP 5 l /IP Upstate (07-030) anti-actin goat-anti-human West ern/DAPA/CoIP1:500 Santa Cruz (sc1616) secondary antibodies anti-mouse HRP Western 1:5000 USB (Rodeo Western Kit) anti-rabbit HRP Western 1:5000 USB (Rodeo Western Kit) anti-goat HRP Western 1:10000 Santa Cruz (sc2768)

PAGE 137

137 Figure 4-1. Aldosterone stimulation of inner medu llary ET-1 expression in rat. A) IMCD cells were acutely isolated from rat and tr eated with vehicle (open bars) or 1 M aldosterone (closed bars) for 1 h ex vivo. Levels of edn1 and sgk1 mRNA were determined by QPCR, normalized to -actin and expressed as fold change relative to vehicle SE. (n=4, *p<0.05, **p<0.005) B) Inner medullary ET-1 peptide levels were measured in kidneys isolated from ra ts injected with al dosterone (1 mg kg-1 body weight, ip) or vehicle for 2 h. Inner medullary ET-1 peptide levels were determined by ELISA and normalized to tota l protein content. Values are expressed as ET-1 (pg/mg protein) SE. (n 8 per group, *p<0.05).

PAGE 138

138 Figure 4-2. Aldosterone stimulation of edn1 mRNA and hnRNA in collecting duct cells. A) Confluent monolayers of mpkCCDc14, OMCD1, or mIMCD-3 cells were treated with vehicle (open bars) or 1 M aldosterone (closed bars) for 1 h. Steady state edn1 mRNA was measured by QPCR, normalized to -actin and expressed as mRNA fold change relative to vehicle SE. B) Steady state mRNA of edn1 or sgk1 was quantified as above from mIMCD-3 cells tr eated with vehicle or aldosterone (0.01, 0.1, or 1 M) for 1 h. C) Levels of edn1 hnRNA were determined by SyBr Green QPCR, normalized to gapdh and expressed as hnRNA fold change relative to vehicle SE. (n 3, *p<0.05, **p<0.005)

PAGE 139

139 Figure 4-3. Aldosterone stimulation of edn1 mRNA in mIMCD-K2 cells Confluent monolayers of mIMCD-K2 cells were treated with vehicle (open bars) or 1 M aldosterone (closed bars) for 1 h. Total RNA was extr act, converted to cDNA and steady state edn1 mRNA was measured by QPCR. Values were normalized to gapdh and are expressed as mean fold change relative to vehicle SE. (n=2)

PAGE 140

140 Figure 4-4. Aldosterone stimula tion of ET-1 peptide release from mIMCD-3 cells. Confluent monolayers of mIMCD-3 cells were grown on permeable supports and treated with vehicle (open bars) or 1 M aldosterone (closed bars) fo r 1 h. Media was collected from the top (apical) and bottom (basolat eral) wells, and soluble ET-1 peptide was measured by ELISA. (n=3)

PAGE 141

141 Figure 4-5. Aldosterone action in mIMCD-3 cells is mediated through MR and GR. A) Receptor nuclear translocation was followed by west ern blot for MR (top panel) and GR (middle panel) on cytosolic and nuclear extracts obtained from mIMCD-3 cells treated with vehicle or aldosterone (0.01, 0.1, or 1 M) for 1 h. Blots were stripped and reprobed for actin (lower panel) to verify equal loading. B,C) Densitometry was used to quantify the relative abundance of MR (B) and GR (C) in the nucleus. Values are expressed as the fold change in intens ity units (IU) relative to vehicle control SE. (n 3, *p<0.05, **p<0.005)

PAGE 142

142 Figure 4-6. Blockade of MR or GR inhibits aldosterone induction of edn1 mRNA. A) The effect of pharmacological inhibition of MR or GR on aldosterone-stimulated edn1 mRNA was evaluated in mIMCD-3 cells treate d with vehicle (veh, open bars), 1 M aldosterone (aldo, cl osed bars), or 1 M aldosterone in the presence of 10 M spironolactone (spiro) or 10 M RU486 for 1 h. Edn1 mRNA levels were determined by QPCR. Values are expressed as mean fo ld change relative to vehicle SE. (n 3, **p<0.005 vs. vehicle; tp<0.005 vs. aldosterone) B) The e ffect of siRNA silencing of MR or GR on aldosterone-stimulated edn1 mRNA was evaluated. Cells were transfected with control non-target (NT)-siRNA, MR-siRNA or GR-siRNA 24 h prior to being treated with vehicle or 1 M aldosterone for 1 h. Changes in mRNA were measured by QPCR as above. Values are expressed as mean fold change relative to vehicle treated cells transfect ed with NT-siRNA SE. (n=3, **p<0.005 vs. NT-siRNA plus vehicle, tp<0.05 vs. NT-siRNA + aldosterone, NS=not significant)

PAGE 143

143 Figure 4-7. Aldosterone recru its steroid receptors to a region of the murine edn1 promoter containing two putative HREs. A) Diagram of the edn1 promoter indicating the position of the identified HREs relative to th e transcriptional start site (+1) (not to scale). HRE sequences are magnified and receptor binding half-sites are shown in capital letters. Half-site orientation is i ndicated with arrows. Primers used in ChIP assays flank both HREs and are indicated with half arrows. B) ChIP assays were used to detect protein binding to the edn1 promoter in vehicle (open bars) or 1 M aldosterone (closed bars) treated mIMCD-3 cells. Antibodies used for immunoprecipitation are i ndicated below. Bound edn1 DNA was quantified by SyBr Green QPCR. Values were normalized to total input DNA and expressed as mean fold change relative to vehicle SE. Additionally, standard PCR products were run on a 5 % TBE gel and imaged with SyBr green dye. Representative gels are displayed below their corresponding QPCR values. (n 3)

PAGE 144

144 Figure 4-8. Steroid receptors bind directly to HRE1 and HRE2 in the edn1 promoter. DAPA experiments were performed on nuclear extrac ts from vehicle and aldosterone treated mIMCD-3 cells in order to map recepto r binding to either HRE with higher resolution. A) Representative immunobl ots following DAPA experiments using HRE2 as bait are shown for MR (left panel) and GR (right panel) Immunoblots were quantified by densitometry. Values were nor malized by setting total intensity units calculated for MR (or GR) in the presence of 1 M aldosterone to 100%. Equal loading was verified by immunoblot against actin (bottom panel). (n 3). It is also important to note that the DAPA probe (shown on top of panel A) contains a region of DNA immediately adjacent to HRE2 that may also contribute to hormone receptor binding (See Chapter 3). B) Representati ve immunoblots are shown for MR (left panel), GR (right panel), and actin (low er panel) from DAPA experiments using HRE1 as bait. Densitometry was not performed because MR and GR were not consistently detected at concentra tions of aldosterone lower than 1 M. (n 3)

PAGE 145

145 Figure 4-9. Aldosterone-depende nt association of MR and GR by coimmunoprecipitation. A) Nuclear extracts from mIMCD-3 treated with vehicle, aldosterone aldosterone plus 10 M spironolactone (S), or 10 M spironolactone alone were subjected to immunoprecipitation (IP) with anti-MR and subsequently immunoblotted for GR. As a control, nuclear extracts from vehicle and 1 M aldosterone treated cells were subjected to the reverse immunoprecipita tion by anti-GR followed by immunoblot against anti-MR. (n 3) B) The ability of MR and GR interact with one another and with DNA was evaluated in cytosolic and nuclear extracts from mIMCD-3 cells. Coimmunoprecipitation (coIP) experiments were conducted as above using either anti-GR or anti-MR as bait. Similarly, cyto solic and nuclear extrac ts from vehicle or aldosterone treated cells were subjected to DAPA using either HRE2 or HRE1 as bait. Western blots against MR and ac tin are shown as controls.

PAGE 146

146 Figure 4-10. Aldosterone-dependent recr uitment of RNA polymerase II to the edn1 promoter. A) ChIP assays were used to detect RN A polymerase II (Pol II) binding to the edn1 promoter in vehicle (open bars) or 1 M aldosterone (closed bars) treated mIMCD-3 cells. Bound edn1 DNA was quantified as above by SyBr Green QPCR or imaged by running standard PCR products on a 5% TBE gel. QPCR values are normalized to total input DNA and expressed as mean fo ld change relative to vehicle SE. (n 3) B) Dose-dependent recruitment of RNA polymerase II to HRE2 was evaluated by DAPA on vehicle and aldosterone treated mIMCD3 cells. Representative immunoblots for Pol II and actin loading c ontrols are shown. (n=3)

PAGE 147

147 Figure 4-11. Spironolactone and RU486 induce nucle ar translocation and binding of MR and GR to edn1. A,B) Nuclear translocation studies were performed on mIMCD-3 cells treated with vehicle (V), 1 M aldosterone (A), 10 M spironolactone (S), and/or 10 M RU486 (R). Treatments are indicated above each lane. Aldosterone was added at the same time as antagonist in lane 3 (A +S) and lane 6 (A+R). Antagonists were added 1 h prior to aldosterone treatments in lane 4 (S A) and lane 7 (R A). Representative western blots are shown fo r MR (A) and GR (B) and densitometric values are indicated above each gel. (n 3) C,D) DAPA experiments were performed on nuclear extracts obtained from mIMCD-3 cells treated as above to evaluated MR (C) and GR (D) binding to HRE2. Densitome tric values are indicated above each blot. (n 3) Actin loading control is shown at the bottom.

PAGE 148

148 CHAPTER 5 DEXAMETHASONE STIMULATES ENDOTHELIN-1 GENE EXPRESSION IN COLLECTING DUCT CELLS IN VITRO Introduction The glucoco rticoid receptor (GR) is ubiquitously expressed in the body and is responsible for modulating an extraordinarily wide range of physiological processes (Coutard et al., 1978; Kalinyak et al., 1987; Rashid and Lewis, 2005; Thompson, 1987; Turner et al., 2006). GR functions as a ligand-dependent transcription factor and is es timated to modulate 10% of the genes within the human genome (Galon et al., 2002; van der L aan et al., 2008). GR shares extensive structural homology and overlapping DNA targets with th e mineralocorticoid receptor (MR) (Arriza et al., 1987). However, the expres sion and function of MR is more specific than GR. Most notably, MR is expressed in polarized epithelial cells involved in Na+ transport including the mineralocorticoid-sensitive cells of the distal nephron and collecting duct of the kidney (Funder, 2005). In these cells, MR pl ays a vital role in the maintenance of Na+ homeostasis and blood pressure control through th e transcriptional regulat ion of genes involved in transepithelial Na+ transport (Fuller, 2004; Odermatt and Atanasov, 2009; Viengchareun et al., 2007). Renal collecting duct cells express both MR and GR in vivo (Todd-Turla et al., 1993). However, the function of GR in aldosterone-tar get cells is not well understood since these cells express 11 -hydroxysteroid dehydrogenase type II (11 HSD-2). This enzyme oxidizes endogenous glucocorticoids (cortisol in humans, corticosterone in rats) into 11-keto metabolites that are unable to activate MR or GR (Funde r et al., 1988; Grossmann et al., 2004b). The absence of functional 11 HSD-2 in renal collecting duct cells can have detrimental effects. Indeed, glucocorticoids can bind to MR w ith similar affinity to aldosterone (KD 0.5 nM) (Arriza et al., 1987) and result in inappropriate salt retention and hypertension (Frey et al., 2004;

PAGE 149

149 Ulick et al., 1979). However, under normal conditions endogenous glucocorticoids are inactivated, so the purpose of its cognate receptor, GR, is not well defined in renal collecting duct cells (Odermatt and Atanasov, 2009). Aldosterone is known to bind GR with an a ffinity that is similar to cortisol (KD 10 nM) (Arriza et al., 1987; Hellal-Levy et al., 1999). Therefore, it is possible that GR functions in concert with MR to mediate aldos terone action. Consistent with this hypothesis is a recent study conducted on an inducible transgenic mouse line over expressing GR in the collecting duct (Nguyen Dinh Cat et al., 2009). In this study, mice exhibited an increase in scnn1a ( ENaC) in the collecting duct and a decrease in urinary aldosterone levels, indi cating a transient GRdependent change in Na+ balance in vivo Furthermore, published data from Chapter 4 showed that aldosterone stimulated the transcription of edn1 in collecting duct cells by a mechanism involving both MR and GR (Stow et al., 2009). Indeed, both receptors bound directly to the same HREs in the edn1 promoter (Figure 4-8); a phenomenon that has been observed for several other aldosterone target genes (I tani et al., 2002; Kolla et al., 1999; Mick et al., 2001; Ou et al., 2001). Likewise, aldosterone-dependent GR activation has been previously reported (Gaeggeler et al., 2005; Gauer et al., 2007; Gumz et al., 2003; Liu et al., 1995) and signaling by both MR and GR are able to stimulate Na+ transport in collecting duct cells (Husted et al., 1990). While there is mounting evidence suggesting th at GR can contribute to aldosterone action in the kidney, it is not known whether GR acts in concert with MR or if GR can act independently. The goal of the present study wa s to determine if GR could independently stimulate edn1 expression in mIMCD-3 and mpkCCDc14 collecting duct cell lines. Since collecting duct cells metabolize endogenous glucocorticoids, selective GR action on edn1 was evaluated with dexamethasone, a synthetic gl ucocorticoid that is not inactivated by 11 HSD-2

PAGE 150

150 Importantly, dexamethasone is advantageous for studying selective GR activation because it exhibits a very high affinity for GR and essent ially no affinity for MR (Rebuffat et al., 2004). Data presented in this chapter shows that selective activation of GR by dexamethasone stimulates edn1 expression in renal co llecting duct cells. Materials and Methods Cell Culture and Hormone Treatment The m pkCCDc14 cells were a kind gift of Dr. Alain Vandewalle (Rebuffat et al., 2004) and mIMCD-3 cells were purchased from American Type Culture Collection. All cells were maintained in DMEM/F12 plus 10% FBS and 50 g/ml gentamicin and passaged every 48 h. For all hormone experiments cells we re plated on 6-well Costar Tran swell plates (Corning Inc.). Cells were grown 24 h past confluency and ch anged to DMEM/F12 plus 10% charcoal-dextran stripped FBS (Invitrogen Corp.) for another 24 h prior to hormone treatments. Aldosterone, dexamethasone, spironolactone and RU486 were pur chased from Sigma-Aldrich, prepared in 100% ethanol at 1 mg/ml stocks and stored at -2 0 C until use. Cells were treated with vehicle (0.1% ethanol), 1 M dexamethasone or 1 M aldosterone for 1 h. For inhibitor studies, cells were treated with agonist plus RU486 (10 M) or spironolactone (10 M). Steady-State mRNA Determination Hor mone studies were conducte d as described above on grow th-arrested confluent cell monolayers grown in 6-well Costar Transwell plates. Total RNA (2 g) was isolated from cells using TRIzol Reagent (Invitrogen), treated with DNase I (Ambion) to eliminate genomic DNA, and reverse transcribed using oligo dT, random hexamers and Superscript III (Invitrogen). No reverse transcriptase served as a negative co ntrol in the cDNA reaction. Resulting cDNAs (32 ng) were used as templates in duplicate QPCR reactions run on an Applied Biosystems QPCR machine. No template cDNA was used a nega tive control in QPCR experiments. Cycle

PAGE 151

151 threshold (CT) values were normalized against -actin (actb ) and relative quantification was performed using the CT method (Livak and Schmittgen, 2001). TaqMan (Applied Biosystems) primer/probe sets for used are indicated in Table 5-1. Applied Biosystems guarantees that all TaqMan primer/probe se ts are target specific and were run with standardized QPCR c onditions using the CT method. Importantly, Applied Biosystems guarantees that TaqMan products have 100% PCR efficiency over six logarithms of template (Applied Biosystems, 2006). Hormone Receptor siRNA Knockdown MR-siRNA (J-061269-09 NR3C2), GR-siRNA ( J-045970-10 NR3C1) and control nontargeting siRNA against luciferase (#2 D001210-02-05) were purchased from Dharmacon (Lafayette, CO, USA). Cells were seed ed at a density of 75,000 cells per cm2 on 6-well Transwell plates (Corning Incorporat ed) and transfected for 24 h with 2 M siRNA in 6 l of DharmaFect 4. At the time of transfection cells were switched to phenol-red free DMEM/F12 plus 10% charcoal dextran stripped FBS. After 24 h the cells were treated with 1 M dexamethasone or vehicle for 1 h. RNA was ex tracted and processed as described above for QPCR. Statistics Unless otherwise stated, all experim ents we re performed in duplicate at least three independent times. Statistical significance wa s determined using a two-tailed Students t test and p < 0.05 was considered significant. Results Relative Expression of Hormon e R eceptors in mIMCD-3 cells Published data presented in Chapter 4 showed that aldosterone treatment resulted in comparable increases in MR and GR bound to HRE2 of the edn1 promoter (Figure 4-8) (Stow et

PAGE 152

152 al., 2009). Furthermore, blockade of either MR or GR resulte d in a comparable reduction in aldosterone-dependent edn1 gene expression (Figure 4-6) (S tow et al., 2009). Therefore, we hypothesized that mIMCD-3 cells e xpressed the MR and GR genes, nr3c2 and nr3c1 respectively. Furthermore, it seemed reasonable that the mRNA levels for both receptors would be present at approximately equal levels. To test this hypothesis, MR and GR mRNA expression levels were evaluated in mIMC D-3 cells from control experi ments. QPCR was run using Taqman assay reagents that have validated PCR efficiencies of 100% for each primer/probe set (Applied Biosystems, 2006). As expected, mIMC D-3 cells expressed both MR and GR mRNA (Figure 5-1), which is consis tent with expression patterns in vivo (Todd-Turla et al., 1993). However, the expression of GR was unexpected ly 13.2 0.4 fold higher than the expression of MR. Of note, the higher level of GR expre ssion is roughly equal to the difference in aldosterones affinity for MR (~ 0.5 nM) versus GR (~10 nM) (Arriza et al., 1987). These data support the concept that aldosterone action on colle cting duct cells is mediated through both GR and MR in mIMCD-3 cells. Dexamethasone-Dependent Gene Exp ression in Collec ting Duct Cells To test the hypothesis that selective GR activ ation could stimulate edn1 gene transcription, mIMCD-3 cells we re treated with vehicle, 1 M dexamethasone or 1 M aldosterone for 1 h. As expected, aldoster one induced a 2.72 0.35 fold increase in edn1 mRNA levels (Figure 5-2). Dexamethasone also stimulated an increase in edn1 mRNA levels that was equal to 4.00 0.08 fold increase compared to vehicle control, a leve l significantly higher in magnitude compared to edn1 levels in the presence of 1 M aldosterone (Figure 5-2). The pattern of robust gene expression indu ced by dexamethasone was also observed for other aldosterone-regulated genes. The level of sgk1 mRNA was 8.15 0.20 fold higher in the presence of dexamethasone compare to vehicle. Similarly levels of per1 mRNA was 9.14 0.47

PAGE 153

153 fold higher in the presence of dexamethasone compared to vehicle. For both genes, the magnitude of mRNA induction was greater in the presence of 1 M dexamethasone than in the presence of 1 M aldosterone (Figure 5-2). Of note, both aldosterone and dexamethasone stimulated a modest increase in ENaC ( scnn1a) expression at 1 h. This low level of stimulation at 1 h is consistent with the fact that aldosterone-dependent scnn1a expression takes 2 to 4 h to observe a significant increas e (Mick et al., 2001). A similar hormone study was conducted in mpkCCDc14 cells to determine if dexamethasone stimulation of edn1 occurred in another collecti ng duct cell line. Importantly, this cell line also expresses functional 11 HSD-2 and both MR and GR at relatively high abundances (Bens et al., 1999). Consistent with results from mIMCD-3 cells, 1 M dexamethasone stimulated robust increases in sgk1 and per1 mRNAs at 1 h (Figure 5-3). Furthermore, edn1 and scnn1a mRNAs also exhibited moderate increases. In some experiments cells were also treated with 1 M aldosterone as a positive contro l. On a technical note, these pilot experiments were conducted at a separate time than other reported st udies (Chapter 4) and mpkCCDc14 cells did not appear as responsive. However, as observed in mIMCD-3 cells, the trend for higher gene expression in the presen ce of dexamethasone compared to equal molar aldosterone was obser ved (Figure 5-3). Effect of Pharmacological Inhibition of Hormone Receptors on Dexamethasone-Induced Gene Expression The effect of MR or GR anta gonism on dexamethasone-stimulated edn1, sgk1 and scnn1a expression was evaluated by treatment w ith spironolactone or RU486, respectively. RU486 is a GR antagonist with little affinity for MR. Treatment of mIMCD-3 cells with RU486 completely blocked dexamethasone induction of edn1 mRNA (Figure 5-4). Likewise, RU486 greatly reduced dexamethasone induction of sgk1 mRNA, although mRNA levels did not

PAGE 154

154 completely return to levels in control treated cells (Figure 5-4). In contrast, antagonism of MR with spironolactone had no eff ect on dexametheasone-mediated sgk1 and appeared to have very little effect on scnn1a mRNA. Spironolactone also result ed in only a modest reduction in dexamethasone-mediated edn1 expression (Figure 5-4). Of not e, spironolactone has a moderate antagonistic effects on GR (Couette et al., 1992 ) and studies in Chapter 4 that showed spironolactone was able to induce GR nuc lear translocation and binding to the edn1 promoter (Stow et al., 2009). Taken together, these data suggested that most if not all of the dexamethasone-dependent edn1 gene expression was mediated through GR. Effect of siRNA Knockdown of Hormone Recep tors on Dexamethasone-Regulated Gene Expression Because pharm acological inhibitors have overlap ping specificities, th e effect of MR or GR siRNA knockdown was evaluated in mIMCD-3 ce lls. Independent transfection of either MRor GR-siRNA resulted in approximately 90% knockdown of their relevant mRNA (Gumz et al., 2009a). In the presence of 1 M dexamethasone, siRNA blockade of GR blunted edn1 and sgk1 mRNA levels by approximately 50% (Figure 5-5). Conversel y, siRNA of blockade of MR had no effect on dexamethasone-induced edn1 mRNA levels (Figure 5-5). Interestingly, dexamethasone-induced sgk1 mRNA was actually higher in th e presence of MR-siRNA (Figure 5-5). Cotransfection of MR and GR siR NAs together had no additive effect on edn1 or sgk1 compared to GR-siRNA alone. These data strongly support the concep t that dexamethasone action was mediated exclusivel y through GR. Moreover, these data support the concept that spironolactone is a partial an tagonist of GR-dependent edn1 transcription since siRNA against MR had no effect on edn1 transcription but spiro nolactone tended to decrease edn1 mRNA levels. There was no significant effect on the minimal dexamethasone-dependent scnn1a gene expression observed at 1 h (F igure 5-5, right panel).

PAGE 155

155 Taken together, dexamethasone-s timulated gene expression of edn1, sgk1 and per1 in mIMCD-3 and mpkCCDc14 cells was consistently more robus t than aldosterone-stimulated gene expression using equal molar amounts of aldos terone or dexamethasone. Furthermore, dexamethasone-dependent gene expression was mediated exclusively though GR. Discussion The studies presented here dem onstrat ed that dexamethasone stimulated edn1 gene expression in mIMCD-3 and mpkCCDc14 collecting duct cells. QPCR analysis determined that mIMCD-3 cells expressed GR mR NA in addition to MR mRNA, which is consistent with protein expression in mIMCD-3 cells (C hapter 4) (Stow et al., 2009), mpkCCDc14 cells (Bens et al., 1999) and in collecting ducts in vivo (Todd-Turla et al., 1993). Pharmacological and siRNA knockdown studies confirmed that the action of dexamethasone on edn1 mRNA was mediated exclusively though GR. Furthermore, dexamethasone -dependent GR activation resulted in the robust stimulation of ot her aldosterone target genes tested including sgk1 and per1 The magnitude of dexamethasone-dependent gene transcription in bot h mIMCD-3 and mpkCCDc14 cells was higher than aldosterone-dependent gene transcription under the experimental conditions tested. There was also a minimal increase observed in scnn1a in the presence of aldosterone or dexamethasone that did not appear to be affected by MR or GR blockade. Indeed, the earliest stimulation in scnn1a may be due to non-genomic acti ons of MR and/or GR cascade signaling (Boldyreff and Wehling, 2003). Given that aldosterone acts through both MR and GR, whereas dexamethasone is thought to have exclusive affinity for GR, the observatio n that dexamethasone resulted in a more robust increase in edn1 mRNA suggests that GR might be a str onger transcription factor than MR for the edn1 gene. Consistent with this concept, de xamethasone activation of GR resulted in a robust increase in Na+ transport in primary cultures of rat inner medullary collecting ducts that

PAGE 156

156 exceeded the response achieved by aldosterone (Hus ted et al., 1990). The apparent difference in the magnitude of dexamethasone-induced edn1 mRNA compared to aldosterone induction may be explained by differences in transcriptiona l machinery recruited to GR versus MR. For example, the elongation factor ELL (11, 19-lysine rich leukemia) activates MR, but strongly represses GR (Pascual-Le Tallec et al., 2005). Furt hermore, it is possible that MR and GR form a functional heterodimers in the presence of al dosterone. Indeed, hete rodimerization between MR and GR is known to occur (Nishi et al., 2004; Ou et al., 2001; Pascual-Le Tallec et al., 2005) and exhibit distinct transcriptional properties comp ared to either receptor acting alone (Ou et al., 2001; Trapp and Holsboer, 1996). Alternatively, the difference in transcrip tion activation may be explained by ligandmediated conformational changes in GR. Aldoster one and glucocorticoids have similar chemical structures, however each ligand induces differe nt conformational cha nges in the receptor (Hultman et al., 2005; Kitagawa et al., 2002; Trapp and Holsboer, 1996). For example, aldosterone induces a stronger interaction be tween the N-terminal domain and ligand binding domain compared to cortisol (Rogerson and Fu ller, 2003). Aldosterone, but not hydrocortisone causes an exclusive interacti on of MR with the RNA helicase A (Rogerson and Fuller, 2003). Moreover, cortisol and dexamethasone stimulate different changes in Na+ transport in cortical collecting duct cells (Kitagawa et al., 2002) indicating that dexamethasone has unique transactivation properties for GR. In the present chapter, I demonstrate that dexamethasone stimulates edn1 mRNA transcription in two indepe ndent collecting duct cells in vitro While collecting duct cells express 11 HSD-2 and are not typically activated by endogenous glucocorticoids, ET-1 and dexamethasone have documented interactions in ot her cells types. For example, glucocorticoids

PAGE 157

157 decrease ET-1 binding to vascular smooth muscle cells from wildtype and spontaneously hypertensive rats (Nambi et al., 1992; Prove ncher et al., 1995). Dexamethasone-induced edn1 mRNA may also be clin ically relevant in Na+ transporting epithelia. Dexamethasone is commonly used in the clinic as an anti-inflammatory and immunosuppressant agent. However, many undesirable side effects are known to occur including alterations in Na+ transport epithelia in the eye resulting in hypertension and open-angle glaucoma. In fact, dexamethasone is known to induce ET-1 in the trabecular meshwork and increased levels of ET-1 have been directly linked to the etiology of open angle glaucoma (Zhang et al., 2003). Dexamethasone can also stimulate ENaC mediated Na+ transport in collecting duct cells and may contribute to unwanted pharmacological actions such as hypertension and electrolyte disorders. However, dexamethasone activated edn1 mRNA in collecting duct cells may mitigate ENaC-dependent Na+ reabsorption since ET-1 is known to direct ly block ENaC activity (Bugaj et al., 2008; Gilmore et al., 2001). It is impor tant to understand the action of dexamethasone in various cell types in order to develop alternative glucocorticoid drugs with fewer side effects.

PAGE 158

158 Table 5-1. TaqMan assays used for QPCR Gene Gene Product Applied Biosystems Assay ID edn1 ET-1 Mm00438656_m1 sgk1 Sgk1 Mm00441380_m1 nr3c1 GR Mm00433832_m1 nr3c2 MR Mm01241597_m1 scnn1a ENaC Mm00803386_m1 per1 Per 1 Mm00501813_m1 actb -actin Mm00607939_s1

PAGE 159

159 Figure 5-1. Relative mRNA expression of hormone r eceptors in mIMCD-3 cells. The levels of MR ( nr3c2 ) and GR (nr3c1 ) gene expression were eval uated in mIMCD-3 control experiments. Confluent monolayers of mIMC D-3 cells were changed to 10% charcoal dextran stripped FBS for 24 h prior to a 1 h vehicle treatment. Total RNA was extracted and mRNA levels were determined by QPCR. GR values are expressed as mean fold difference SE comp ared to MR mRNA levels. (*p < 0.001, n=3)

PAGE 160

160 Figure 5-2. Dexamethasone-stimulated gene expression in mIMCD-3 cells. Confluent monolayers of mIMCD-3 cells were treated with vehi cle (veh, open bars) or 1 M dexamethasone (dex, closed bars) for 1 h. As a positive control, cells were also treated with 1 M aldosterone (aldo, gray bars) fo r 1 h and data are shown as a reference. Steady state edn1, sgk1 scnn1a, and per1 mRNA was measured by QPCR, normalized to actb ( -actin) and expressed as mRNA fold change relative to vehicle SE. (*p < 0.05, **p < 0.001 relative to vehicle; unless otherwise indicated n 3)

PAGE 161

161 Figure 5-3. Dexamethasone-stimula ted gene expression in mpkCCDc14 cells. Confluent monolayers of mpkCCDc14 cells were treated with vehicle (veh, open bars) or 1 M dexamethasone (dex, closed bars ) for 1 h. Cells treated with 1 M aldosterone (aldo, gray bars) for 1 h are shown as a reference. Steady state edn1, sgk1 scnn1a and per1 mRNA was measured by QPCR, normalized to actb ( -actin) and expressed as mRNA fold change relative to vehicle SE. Of note, these experiments were conducted at a separate time comp ared to earlier studies on mpkCCDc14 in Chapter 4. The overall edn1 levels appeared to be lower in these experiments, therefore aldosterone was run as a control in the fi nal dexamethosone experiment. (aldo: n=1, dex: n=3)

PAGE 162

162 Figure 5-4. Effect of pharm aco logical blockade of MR and GR on dexamethasone-induced edn1 gene expression in mIMCD-3 cells. The eff ect of pharmacological inhibition of MR or GR on dexamethasone-stimulated edn1 mRNA was evaluated in mIMCD-3 cells treated with vehicle (veh, open bars), 1 M dexamethasone (dex, closed bars), or 1 M dexamethasone in the presence of 10 M spironolactone (spiro) or 10 M RU486 for 1 h. Edn1, sgk1 and scnn1a mRNA levels were determined by QPCR. Values are expressed as mean fold change relative to vehicle SE. (n 3)

PAGE 163

163 Figure 5-5. Effect of MR-siRNA or GR-siRNA on dexamethasone-induced gene expression in mIMCD-3 cells. Cells were transiently tran sfected with non-target (NT), MRor GRsiRNA for 24 h prior to a 1 h dexamethasone (Dex) treatment. Changes in mRNA were measured by QPCR as above. Values ar e expressed as mean fold change relative to vehicle treated cells transfected with NT-siRNA SE. In the presence of NTsiRNA, dexamethasone resulted in a significant 4.13 0.05 and a 5.66 0.78 fold increase in edn1 and sgk1 respectively. (*p<0.05 vs. NT-siRNA + dexamethasone, n=3 except for scnn1a data that is representati ve of a single experiment)

PAGE 164

164 CHAPTER 6 REDUCED EDN1 EXPRESSION BY SIRNA ALTERS ALDOSTERONE TARGET GENES IN COLLECTING DUCT CELLS Introduction Greater than 90% of hypertensi ve patients are diagnosed w ith essential hypertension, for which there is currently no known cause despite a clear pattern of fam ilia l inheritance (Binder, 2007). In contrast to a disease resulting from a mutation in a single gene essential hypertension is thought to be the result of multiple gene loci and their complex interaction with the environment (Deng, 2007). The essential hypertensi ve phenotype is acquired over time and is most likely caused by subtle genetic polymorphi sms (Binder, 2007) or imbalances in gene expression (Doris and Fornage, 2005). Many polymorphisms associated with clinical hypertension have been identified in aldosterone target genes, including edn1 (Treiber et al., 2003), sgk1 (Busjahn et al., 2002) and scnn1a ( ENaC) (Iwai et al., 2002). Several of these polymorphisms are located in gene regulatory regions and were shown to alter the normal pattern of mRNA expression (Gonzalez et al., 2007; Iwai et al., 2002; Popow ski et al., 2003). Abnormal patte rns of aldosterone-dependent gene expression have also been observed in experimental models of hypertension (Aoi et al., 2006). Indeed, the concept that essential hypertension can originate from abnormal gene regulation is not new. The act ion of aldosterone, the primary hormone regulating systemic arterial blood pressure, is mediated at the level of gene tran scription. A substantial amount of work has been done to elucidate novel aldosterone-regulated transcripts and normal patterns of aldosterone-dependent gene expression in collecting duct cells (Gumz et al., 2003; Soundararajan et al., 2005). Experiments presented earlier in this dissertation have demonstrated that edn1 was under direct transcriptional control by al dosterone in renal collecting duct cells (Chapter 4) (Stow et al.,

PAGE 165

165 2009). In contrast to most aldosterone target genes that contribute to Na+ reabsorption, aldosterone-dependent edn1 expression is unique in that ET-1 is a potent inhibitor of Na+ transport through ENaC in the collecting duct (Bugaj et al., 2 008). Therefore, aldosteroneinduced edn1 likely mediates a negative feedb ack loop on aldosterone-dependent Na+ transport. Consistent with this hypothesis is the obs ervation that collecting duct cell specific edn1 knockout mice, which exhibit severe salt-sensitive hypertension, did not ade quately suppress their aldosterone levels during a dietary challe nge (Ge et al., 2008). Moreover, renal edn1 expression levels are reduced in experimental (Hughes et al., 1992; Vogel et al., 1999) and clinical hypertension (Hoffman et al., 1994; Zoccali et al., 1995). Indeed, if edn1 mediates negative feedback on aldosterone action, th e uncoupling of aldosterone and edn1 might result in excessive Na+ retention and hypertension. Studies presented in this chap ter were designed to evaluate the effect of aldosterone in collecting duct cells in the presence or absence of edn1 knockdown. It was important that the experimental approach reduced edn1 expression but not abolis h it since the homozygous knockout of edn1 is known to be lethal (Kurihara et al., 1994) so the complete loss of edn1 is not relevant to human disease. Despite the fact that viable tissue-specific edn1 knockout mice exist, an experimental approach that allowed for graded edn1 knockdown would reflect more realistic changes that might occur in a particular cell. Therefore, an RNA interference technique using small interfering RNA (siRNA) was adopted to specifically knockdown edn1 expression in collecting duct cells. In this approach a s ynthetic siRNA complementary to the mRNA of interest is introduced into th e cell. Once inside the cell th e siRNA harvests the endogenous cellular machinery called the RNA Induced Silencing Complex to bind to its complementary mRNA sequence and ultimately target the mRNA for degradation (Zamore, 2001).

PAGE 166

166 The long-term goal of these studies was to develop an effective technique to block edn1 mRNA in collecting duct cells in order to evaluate the role of aldosterone-induced edn1 on ENaC-dependent Na+ transport. Indeed, the overriding hypothesis was that edn1 mediated a negative feedback loop on aldosterone and that the failure of aldosterone to induce edn1 would result in excessive ENaC activity and consequent changes in the expression of aldosterone target genes involved in ENaC regula tion. These studies demonstrat ed that the siRNA-dependent knockdown of edn1 had a stimulatory effect on sgk1 mRNA that was potentiated in the presence of aldosterone in mIMCD-3 cells. In contrast, edn1 knockdown resulted in reduced scnn1a mRNA in the absence of aldosterone. This inhibitory effect of edn1 knockdown could not be reversed in the presence of aldoste rone in either mIMCD-3 or mpkCCDc14 cells. These data indicate that edn1 is required to maintain normal scnn1a expression levels a nd that a reduction in edn1 renders the scnn1a gene unresponsive to aldosterone stimulation. Materials and Methods Cell Culture and Hormone Treatment The m pkCCDc14 cells were a kind gift of Dr. Alain Vandewalle (Rebuffat et al., 2004) and mIMCD-3 cells were purchased from American Type Culture Collection. All cells were maintained in DMEM/F12 plus 10% FBS and 50 g/ml gentamicin and passaged every 48 h. For all hormone experiments cells we re plated on 6-well Costar Tran swell plates (Corning Inc.). Cells were grown 24 h past confluency and ch anged to DMEM/F12 plus 10% charcoal-dextran stripped FBS (Invitrogen Corp.) for another 24 h prior to hormone treatments. Aldosterone, dexamethasone, spironolactone and RU486 were pur chased from Sigma-Aldrich, prepared in 100% ethanol at 1 mg/ml stocks and stored at -2 0 C until use. Cells were treated with vehicle (0.1% ethanol), 1 M dexamethasone or 1 M aldosterone for 1 h. For inhibitor studies, cells were treated with agonist plus RU486 (10 M) or spironolactone (10 M).

PAGE 167

167 edn1 siRNA Knockdow n The ON-TARGETplus set of four edn1 siRNAs (LQ-062546-010005) and control nontargeting siRNA against luciferase (siGE NOME Non-Targeting siRNA #2, D-001210-02) were purchased from Dharmacon (Lafayette, CO, USA) In addition, a pilot experiment was also conducted to compare the NT-siRNA to another negative non-target control containing a scrambled sequence (siGENOME Non-Targeting siRNA #3, D-001210-03). Five nmoles of each siRNA were resuspended in 250 l of PBS, aliquoted and stored at -80 C until use. Cells were seeded at a density of 75,000 cells per cm2 on 6-well Transwell plates (Corning Inc.) and transfected with 66.7 nM siRNA using 1.5 l of DharmaFect 4. At the time of transfection cells were switched to phenol-red free DMEM/F12 plus 10% charcoal dextran stripped FBS. Notransfection and mock transfections served as ne gative controls for comparison. After 24 or 48 h of transfection cells were either harvested for RNA extraction. Alternatively, cells transfected for 24 h were subsequently treate d with vehicle (ethanol) or 1 M aldosterone for 1 to 6 h. The final concentration of ethanol in all treatments was 0.1%. Total RNA was extracted and processed as descri bed below for QPCR. Steady-State mRNA Determination Hor mone studies were conducted on growth-a rrested confluent monolayers of mIMCD-3 or mpkCCDc14 cells as described above. Media was aspi rated and cells were gently washed with PBS (pH 7.4) before 1 ml of TRIzol (Invitrogen Co rp.) was added directly to each well. Total RNA was extracted according to Invitrogens instructions except that RNA-ethanol pellets were precipitated overnight at -80 C. RNA concentration was determined by absorbance at A260 and a total of 2 g was treated with DNase I (Ambion) to eliminate genomic DNA. Reverse transcription was conducted using oligo dT, rando m hexamers and Superscript III (Invitrogen Corp.). No reverse transcriptase served as a negative control. Resulting cDNAs (32 ng) were

PAGE 168

168 used as templates in duplicate QPCR reactions (Applied Biosystems). Cycle threshold (CT) values were normalized against actb ( -actin) and relative quantific ation was performed using the CT method (Livak and Schmittgen, 2001). Information for primer/probe sets for murine edn1, sgk1 scnn1a, per1 and actb are shown in Table 5-1. Statistics Unless otherwise stated, all experim ents we re performed in duplicate at least three independent times. Statistical significance wa s determined using a two-tailed Students t test and p < 0.05 was considered significant. Results Validation of siRNA Experimental Controls Targeted gene silencing through siR NA has become a well-established technique to evaluate the specific function of a given gene. However, the introduction of siRNA into a cell can have non-specific effects and must be controlled for carefully. In general, off-target effects originate from three sources; the delivery met hod (Fedorov et al., 2005), siRNA-activation of the interferon response (Sledz et al., 2003), and non-specific siRNA-dependent effects (Snove and Holen, 2004). Preliminary experiments in mIMCD-3 cells were conducted to evaluate the effect of the liposomal transfection r eagent DharmaFect 4. Cells were either untreated or mocktransfected with 1.5 l of DharmaFect 4 for 24 h. Of note, this concentration of transfection reagent was shown to be effective for siRNA de livery to mIMCD-3 cells in Chapter 4 (Stow et al., 2009). Total RNA was isolated and converted to cDNA for analysis of gene expression by QPCR. There were no visible sign s of cellular toxicity, and there were no significant changes in actb ( -actin) CT values observed between untreated or mock transfected cells (Table 6-1). In comparison to untreated cells, mock-tra nsfection caused a small increase in sgk1 and scnn1a mRNAs and a small decrease in per1 mRNA (Figure 6-1A). However, there was virtually no

PAGE 169

169 effect of Dharmafect 4 on edn1 mRNA expression compared to untreated control cells (1.02 0.04 fold) (Figure 6-1A). Using mock-transfected cells as a negative control in siRNA experiments would easily control for the minor effect of lipofection. Howeve r, it was important to determine if there were any nonspecific effects attributed to the introduction of the siR NA itself, not just the delivery method. Since the advent of RNA interference technology, non-targeting siRNAs have become the gold standard for a negative control in siRNA experiments (Huppi et al., 2005). Two different non-targeting (NT)-siRNAs were purch ased from Dharmacon and were evaluated for their use as negative controls in siRNA experime nts. One of the non-targeting siRNAs contained a random RNA sequence with greater than four mi smatches to any known murine or human gene transcript and is referred to as NT-siRNA (scrambled). The other siRNA was the same nonspecific control used in experiments from Chapters 4 and 5 and is referred to as NT-siRNA to be consistent with the terminology from earlier studies. The NT -siRNA sequence actually targets the firefly luciferase gene. However, it also contained greater than four mismatches to any known murine or human transc ript. In order to determine if either NT-siRNA induced nonspecific effects on the baseline expression of edn1 or other aldostero ne target genes, mIMCD-3 cells were either mock-transfected or transfected with 66.7 nM of either NT-siRNA or NT-siRNA (scrambled) using 1.5 l of DharmaFECT 4. Cells transfected with NT-siRNA demonstrated the least amount of nonspecific effects, which is consistent with earlier studies (Chapter 4) (Stow et al., 2009). The minor reduction in edn1 mRNA (Figure 6-1B) was not a major concern considering that earli er studies validated that NT-siRNA had no effect on aldosterone-dependent edn1 mRNA induction (Figure 4-6) (Stow et al., 2009). In contrast, delivery of th e scrambled NT-siRNA caused large changes in the

PAGE 170

170 expression of edn1, sgk1 and scnn1a (Figure 6-1B). Conseque ntly, the scrambled NT-siRNA would not have been a useful negative control and was eliminated from further experiments. The NT-siRNA (against luciferase) was selected fo r use as a negative control in subsequent experiments. Efficacy of Four Diffe rent siRNAs Targeting edn1 Four different siRNAs against m urine edn1 mRNA (siEdn1-09, -10, -11, -12) were designed by Dharmacon using a va lidated bioinformatics algorith m (Anderson et al., 2008). To determine the effectiveness of each siEdn1 on edn1 knockdown, mIMCD-3 cells were transfected with NT-siRNA or one of the siEdn1 constructs us ing DharmaFect 4. After 24 h, total RNA was prepared and edn1 mRNA expression levels were determined by QPCR analysis. The most effective siRNA against edn1 was siEdn1-09, which reduced edn1 levels to approximately 50% of the expression levels compared to NT-siRNA control samples (Figure 62). Conversely, transfecti on of siEdn1-11 actually resu lted in an increase in edn1 mRNA levels and was consequently eliminated from further an alysis (Figure 6-2). Furthermore, delivery of either siEdn1-10 or siEdn1-12 had no effect on edn1 expression indicating that these siRNAs were ineffective under the condition tested (Fi gure 6-2). Doubling the amount of DharmaFect 4 did not improve siEdn1-10 dependent silencing of edn1 (1.08 0.02 fold change relative to NT-siRNA, n=2). Similarly, increasing the si RNA transfection time to 48 h did not improve siEdn1-10 or siEdn1-12 mediated edn1 knockdown (Figure 6-2). However, the longer incubation time resulted in a similar 50% reduction of edn1 in the presence of siEdn1-09. Taken together, siEdn1-09 was effective at reducing edn1 mRNA expression and was useful for studying both basal and aldosterone-dependent edn1 expression between 24 and 48 h after siRNA delivery.

PAGE 171

171 Effect of edn1 Knockdown on Aldosterone Target Gene Expression In order to determine if edn1 knockdown had an effect on the basal expression of common aldosterone target genes, mIMC D-3 cells were transfected with NT-siRNA or siEdn1-09 for 24 h. As expected, siEdn1-09 reduced endogenous edn1 mRNA levels to approximately 50% of NT-siRNA control cells (Figure 6-3). Transfection of siEdn109 had no significant effect on per1 mRNA levels (Figure 6-3) or on the expressi on of sirtuin-1 (0.88 0.2 fold change, n=3), a reported negative aldosterone response gene (Z hang et al., 2009). However, transfection of siEdn1-09 stimulated a 1.74 0.24 fold increase in sgk1 mRNA levels (Figure 6-3). Furthermore, siEdn1-09 transfected cells demonstrated a 0.26 0.08 fold reduction in scnn1a mRNA levels (p = 0.01, n = 4). These da ta demonstrated that a 50% loss of edn1 expression resulted in an abnormal mRNA expression patte rn of classical aldosterone response genes involved in Na+ transport. Effect of edn1 Knockdown on Aldosterone-Dependent Gene Expression in mIMCD-3 and mpkCCDc14 cells To test the effect of siE dn1-09 on aldosterone-dependent edn1 expression, mIMCD-3 cells were transfected with NT-siRNA or siEdn1-09 in the presence of 10% charcoal dextran stripped FBS. After 24 h, cells were treated with vehicle or 1 M aldosterone for 1 h. In the presence of NT-siRNA, aldosterone resulted in a 2.7 0.14 fold change in edn1 expression (Figure 6-4). This observation was entirel y consistent with normal edn1 expression levels reported in earlier experiments in Chapter 4 (Stow et al., 2009). Ho wever, in the presence of siEdn1-09, the level of aldosterone-induced edn1 mRNA was not different from vehicle treated NT-siRNA control cells (Figure 6-4). This obser vation indicated that siEdn1-09 effectively blunted aldosteronedependent edn1 transcription in mIMCD-3 cells.

PAGE 172

172 Transfection of the control NT-siRNA into mICMD-3 cells had no effect on the expected magnitude of aldosterone-induced gene expression for sgk1 scnn1a, or per1 at 1 h (Figure 6-4). There was no effect of edn1 knockdown on per1 expression in the presence of aldosterone. However, edn1 knockdown was associated with lower mRNA levels of the ETA receptor gene ( etar ) suggesting that edn1 knockdown may also affect the expression of genes involved in ET-1 signaling. The analysis of the ETB receptor gene was not conducted because the mRNA levels were below the level of detection in mIMCD-3 cells. The most apparent effect of edn1 knockdown on aldosterone depe ndent transcription was on the sgk1 gene. Transfection of siEdn1 result ed in a 4.2 0.02 fold increase in sgk1 mRNA in the presence of aldosterone compared to vehi cle treated NT-siRNA transfected cells (Figure 64). Interestingly, the level of sgk1 mRNA in control NT-siRNA transfected cells treated with aldosterone was only 2.9 0.01 fold higher than vehicle. The al dosterone-dependent expression of scnn1a was also evaluated at 1 h. The expression of scnn1a was not different in NT-siRNA transfected cells treated with 1 M aldosterone or vehicle. This observation is consistent with the fact that scnn1a generally requires several hours of aldosterone treatment to observe a significant increase in gene expression. In cont rast, cells transfected with siEdn1-09 exhibited significantly lower scnn1a mRNA levels in the presence of aldosterone compared to vehicle treated NT-siRNA control cells (Figure 6-4). Taken together these data indicated that edn1 knockdown negatively affected scnn1a expression. To determine if the effect of edn1 knockdown to alter aldosterone-dependent gene expression occurred in anothe r collecting duct cell model, si milar siRNA experiments were conducted on vehicle or al dosterone treated mpkCCDc14 cells (Figure 6-5). A 1 h aldosterone treatment resulted in a 1.4 0.1 fold increase in edn1 mRNA expression in NT-siRNA control

PAGE 173

173 cells. However, the levels of edn1 mRNA were significantly redu ced in aldosterone treated siEdn1-09 transfected cells compared to aldosterone treated NT-siRNA cells. In fact, the level of edn1 expression in the presence of siEdn1-09 was 37 5% lower compared to vehicle treated NT-siRNA transfected control cells. Consistent with results from mIMCD-3 cells, there was no effect of edn1 knockdown on aldosterone-dependent per1 expression. The levels of sgk1 mRNA were increased in the presence of edn1 knockdown, however the sgk1 mRNA levels were lower compared to aldosterone treated NT-siRNA tran sfected cells which sugge sted that cell-line specific factors may also contribut e to the consequent effect of edn1 knockdown (Figure 6-5). However, the effect of edn1 knockdown on scnn1a expression was consistent between the cells lines. Transfection of siEdn1-09 in aldosterone treated cells resulted in mRNA levels of scnn1a that were 40 10% lower than vehicle trea ted NT-siRNA controls cells and 57 10% lower than aldosterone treated NT-siRNA transfected cells (Figure 6-5). Effect of edn1 Knockdown on Aldosterone-Dependent scnn1a Expression at 6 Hours In order to better te st the effect of edn1 knockdown on aldosterone-dependent scnn1a expression, siRNA experiments we re conducted on mIMCD-3 cells treated with vehicle or 1 M aldosterone for 6 h. Aldoster one-dependent increases in scnn1a mRNA levels were expected to be detected at this time point (May et al., 1997; Mick et al., 2001; Spindler et al., 1997). Indeed, NT-siRNA transfected cells treated with aldoste rone demonstrated a 1.9 0.3 fold increase in scnn1a. However, aldosterone treatment failed to induce scnn1a mRNA expression in cells transfected with siEdn109 (Figure 6-6). In contrast, transf ection of siEdn1-09 had no effect on hormone-stimulated sgk1 or per1 expression (Figure 6-6). However, the level of etar expression remained blunted compared to either vehicle or aldosterone treated NT-siRNA control cells, indicating that the reduction in etar expression was independent of aldosterone action.

PAGE 174

174 Since siEdn1-09 was demonstrated to affect the levels of scnn1a expression in the absence of aldosterone, it was possible that scnn1a mRNA increased in the presence of aldosterone, but that the levels of mRNA did not exceed those in NT-siRNA transfect ed vehicle treated cells. To clarify this issue, experiments were done on siE dn1-09 transfected cells tr eated with vehicle or 1 M aldosterone for 6 h (Figure 6-7). This experiment revealed that edn1 knockdown blunted, but did not completely prevent the effect of aldosterone on edn1 transcription. However, the reduced levels of edn1 expression caused by siRNA knockd own completely prevented the induction of scnn1a by aldosterone. Taken together, thes e data suggested that the effect on scnn1a mRNA was the result of overall lower levels of edn1 mRNA as opposed to the failure of aldosterone to induce edn1 Discussion Data pres ented in this chapter de monstrated that a 50% reduction in edn1 mRNA expression was sufficient to alter th e basal gene expression patterns for scnn1a and sgk1 in collecting duct cells. In the ab sence of any hormonal stimuli, edn1 knockdown resulted in increased levels of sgk1 mRNA; whereas the levels of scnn1a mRNA were moderately and consistently decreased. In the presence of aldosterone, edn1 knockdown was associated with decreased scnn1a mRNA levels in response to an acu te aldosterone admi nistration in both mIMCD-3 and mpkCCDc14 cells. However, the most importa nt finding was that after 6 h of aldosterone treatment edn1 knockdown blocked the normal induction of scnn1a mRNA. The overarching goal of the studie s in this chapter was to develop an effective technique to study the role of edn1 in aldosterone-dependent action in collecting duct cells. To do this, a siRNA approach was selected. While gene knockout technology has clear advantages in certain settings, the complete loss of both edn1 alleles is not relevant to changes that might occur in normal cell since homozygous edn1 knockout is perinatally lethal mice (Kurihara et al., 1994)

PAGE 175

175 and has not been reported in humans. Moreover, complete genetic knockout animals typically activate compensatory mechanisms that may confound data interpretation. However, reduced quantities of urinary ET-1 levels, a marker of renal edn1 expression, have been reported in the essential hypertensive patients (Hoffman et al., 1994; Zoccali et al., 1995). Therefore, the better experimental approach to investig ate the role of aldosterone-induced edn1 was a siRNA approach that would allow bette r control over the level of edn1 knockdown. It was important to validate the experiment al parameters and negative controls in our siRNA experiment. Indeed, nonspecific effects from siRNA delivery can occur. A common source of off-target effects is the siRNA deliver y method itself (Fedorov et al., 2005). However, the liposomal DharmaFect 4 tran sfection reagent had no effect on edn1 mRNA expression. Two NT-siRNAs were also evaluated for use as ne gative controls. Transf ection of the scrambled NT-siRNA into mIMCD-3 cells resulted in substantial increases in edn1 and sgk1 and a decrease in scnn1a mRNA levels. The unexpected increase in edn1 mRNA suggested that the scrambled NT-siRNA may have activated the in terferon pathway since interferon is known to stimulate edn1 (Woods et al., 1999). Indeed, activation of the interferon response is a common source of undesirable off-target effects of siRNA (Bridge et al., 2003). However, in contrast to the nonspecific effects caused by the scrambled NT-siRNA, transfection of the NT-siRNA against luciferase had no significant effect on the genes studied and was therefore selected as a negative control. The siEdn1-09 construct result ed in a 50% reduction in edn1 mRNA levels under basal conditions. In contrast to a total gene knockout approach, this level of reduction in edn1 mRNA expression is more relevant to changes th at might occur in a collecting duct cell in vivo Indeed, reduced but not absent levels of renal ET-1 have been documented in clinical hypertension

PAGE 176

176 (Hoffman et al., 1994; Zoccali et al., 1995). The siEdn1-09 was effectively blunted aldosteroneinduced edn1 expression both mIMCD-3 and mpkCCDc14 cells. Edn1 knockdown had effects on sgk1 scnn1a and etar expression. However, the expression of per1 was not affected by siEdn109 in the presence or absence of aldo sterone in either mIMCD-3 or mpkCCDc14 cells. This result indicated that per1 expression was not directly affected by edn1 expression. Both cells lines also exhibited decreased etar gene expression in the pr esence of aldosterone and edn1 knockdown. The reduction in etar expression is likely a direct effect of edn1 knockdown since ET-1 is known to mediate positive feedback on etar expression in other cell type s (Landgraf and Jancar, 2008). Edn1 knockdown resulted in higher sgk1 mRNA expression levels in both control and aldosterone treated mIMCD-3 cells. However, edn1 knockdown did not appear to affect aldosterone-induced sgk1 mRNA in mpkCCDc14 cells. This effect may be explained by innate differences between the cells lines since mIMCD-3 cells express higher levels of sgk1 mRNA (5.6 1.3 fold) compared to mpkCCDc14 cells. However, a solid conclusion cannot be drawn for the effect of edn1 knockdown on sgk1 in mpkCCDc14 cells because the level of sgk1 mRNA was not determined in the absence of aldosterone. It was possible that edn1 knockdown in the absence of hormone stimulated sgk1 mRNA expression, as was seen in mIMCD-3 cells. Indeed, a more complete analysis of mpkCCDc14 cells should be conducted in the future. The effect of edn1 knockdown was also tested on scnn1a mRNA expression. Experiments in both mIMCD-3 cells and mpkCCDc14 cells treated with aldosterone for 1 h revealed that edn1 knockdown resulted in reduced levels of scnn1a expression. Furthermore, experiments in mIMCD-3 cells in the absence of hormone also indicated that edn1 knockdown resulted in a moderate decrease in basal scnn1a expression. These data showed that the loss of edn1 expression directly or indirectly caused scnn1a levels to decrease. However, the most interesting

PAGE 177

177 finding was that scnn1a failed to respond to aldosterone stim ulation after 6 h tr eatment in cells transfected with siEdn1-09. Indeed, scnn1a should be markedly induced at this time point (Mick et al., 2001). Substantial evidence exists that collecting duc t derived ET-1 blocks the activity of ENaC (Bugaj et al., 2008; Gallego and Li ng, 1996; Gilmore et al., 2001). Th erefore, a decrease in local ET-1 levels caused by edn1 knockdown might result in the c onsequent increase in ENaC activity. Excessive ENaC activity might result in a compensatory decrease in scnn1a mRNA. In fact, a compensatory decrease in scnn1a mRNA has been observed in several models of salt dependent hypertension. For example, incr eased ENaC activity was associated with a compensatory decrease in scnna1 expression along the collecting duct in the Milan hypertensive rat model (Capasso et al., 2005) Similarly, a reduction in scnn1a was also observed in a model of prenatally programmed hypertension (Manning et al., 2002). In both cases, the reduction of scnn1a mRNA was moderate, which is comparable to the observations made in siEdn1-09 transfected cells. The decrease in scnn1a may also explain the increase in sgk1 mRNA if the response were secondary to the decrease in scnn1a. Alternatively, the change in sgk1 mRNA levels could be explained by a primary effect of edn1 knockdown. ET-1 signaling is directly involved in the transcriptional control of several other genes (Felx et al., 200 6; Gerstung et al., 2007; Kao and Fong, 2008; Sutcliffe et al., 2009). The unifying obs ervation between these studies is that ET-1mediated transcription involves the activation of NFB. To date, the onl y known transcription factor to inhibit sgk1 mRNA is also NFB (de Seigneux et al., 2008). Taken together, the loss of ET-1-dependent NFB signaling would result in the de-repression of sgk1 transcription.

PAGE 178

178 The data presented in this chapter demonstrate that edn1 knockdown independently alters the normal expression pattern of sgk1 and scnn1a in collecting duct cells The decrease in scnn1a mRNA is likely a compensatory response due to over active ENaC activity, which would be consistent with observations in models of experimental hypertension. However, the observation that edn1 knockdown completely prevented scnn1a mRNA induction by aldosterone at 6 hours suggests that the compensatory mechanism induced by the loss of edn1 expression is able to alter normal aldosterone signaling. Furthermore, it is interesting to speculate that the increase in sgk1 mRNA could be due to the loss of ET-1-dependent NFB signaling. This hypothesis is consistent with the role of ET-1-mediated negative feedback on aldosterone and is the first proposed mechanism for directly shut ting off aldosterone-dependent transcription. Future studies should be conduc ted to explore the role of edn1 knockdown on sgk1 scnn1a and ENaC-mediated Na+ transport.

PAGE 179

179 Table 6-1. CT values for -actin ( actb) in mIMCD-3 control experiments. Treatment Group CT Value Untreated 17.6 0.2 Mock-transfected 17.3 0.1 NT-siRNA transfected 17.5 0.1 NT-siRNA (scrambled) transfected 17.3 0.1

PAGE 180

180 Figure 6-1. Effect of lipofection and NT-siRNA on aldosterone target gene expression in mIMCD-3 cells. A) Comparison of untreated and mock-transfected cells at 24 h. Mock-transfected cells were treated with 1.5 l of the liposomal transfection reagent DharmaFect 4. Total RNA was extracted, converted to cDNA and analyzed for edn1, sgk1 scnn1a or per1 mRNA using QPCR. Values were normalized against actb ( -actin) and are expressed as mean fold ch ange SE relative to untreated control cells. (n 3) B) Cells were either mock-transf ected or transfected with 66.7 nM of either a siRNA against luciferase (NT-si RNA) or an siRNA containing a scrambled sequence (NT-siRNA scrambled). After 24 h total RNA was extracted for QPCR analysis as above. Values are expressed as mean fold change SE relative to mocktransfected cells. (n 2)

PAGE 181

181 Figure 6-2. Efficacy of four different siRNAs against edn1. Murine IMCD-3 cells were transfected with 66.7 nM of NT-siR NA or one of the siRNAs against edn1 (siEdn109, -10, -11, or -12) using 1.5 l DharmaFect for 24 or 48 h. Total RNA was extracted, converted to cDNA and analyzed for edn1 mRNA expression using QPCR. Values were normalized to actb mRNA and are expressed as the mean fold change SE relative to NT-siRNA transfected cells. (*p < 0.05, **p < 0.005, data from 24 h represents n 3; data from 48 h represents n=2)

PAGE 182

182 Figure 6-3. Effect of 24 h knockdown with siEdn1-09 on gene expression in mIMCD-3 cells. Cells were transiently transfected with siEdn1-09 for 24 h. Total RNA was extracted, converted to cDNA and analyzed for edn1, sgk1 scnn1a or per1 mRNA by QPCR. Values were normalized to actb and are expressed as mean fold change SE relative to NT-siRNA transfected cells. (*p < 0.05, **p < 0.005, n 3)

PAGE 183

183 Figure 6-4. Effect of siEdn1-09 on aldosterone-induced gene expres sion in mIMCD-3 cells. Cells were transfected with 66.7 nM of NT-siRNA or siEdn1-09 for 24 h in the presence of 10% charcoal-dextran stripped FBS. Cells were then treated with vehicle (ethanol) or 1 M aldosterone for 1 h. Total RNA was extr acted, converted to cDNA and analyzed for edn1, sgk1 scnn1a, per1 or etar mRNA expression using QPCR. Values were normalized against actb and are expressed as mean fold change SE relative to vehicle treated cells transfected with NT-siRNA. P values are relative to NT-siRNA + Veh unless otherwise indicated. (*p < 0.05, **p < 0.005, n 3)

PAGE 184

184 Figure 6-5. Effect of siEdn1-09 on aldoster one-mediated gene expression in mpkCCDc14 cells. Cells were transfected with NT-siRNA or siEdn1-09 for 24 h prior to a 1 h vehicle (veh) or 1 M aldosterone (aldo) treatment. Total RNA was extracted, converted to cDNA and analyzed for mRNA expression of the indicated genes by QPCR. Values for each gene were normalized to actb and are expressed as mean fold change SE relative to NT-siRNA + Veh. P values are relative to NT-siRNA + Veh unless otherwise indicated. (*p < 0.05, **p < 0.005, n 3)

PAGE 185

185 Figure 6-6. Effect of siEdn1-09 on aldosterone regulated gene expression at 6 h in mIMCD-3 cells. Cells were transfected with NT-s iRNA or siEdn1-09 for 24 h prior to a 6 h vehicle (veh) or 1 M aldosterone (aldo) treatment. Total RNA was extracted, converted to cDNA and analyzed for mRNA expression of the indicated genes by QPCR. Values for each gene indicated were normalized to actb and are expressed as mean fold change SE relative to NT-s iRNA + Veh. P values are relative to NTsiRNA + Veh unless otherwise indicated. (*p < 0.05, **p < 0.005, n 3)

PAGE 186

186 Figure 6-7. Effect of siEdn1-09 on aldosterone regulated gene expression at 6 h in mIMCD-3 cells. Cells were transfected with siEdn1-09 for 24 h prior to a 6 h vehicle (veh) or 1 M aldosterone (aldo) treatment. Total R NA was extracted, conve rted to cDNA and analyzed for mRNA expression of the indicated genes by QPCR. Values for each gene indicated were normalized to actb and are expressed as mean fold change SE relative to NT-siRNA + Veh. (n = 3).

PAGE 187

187 CHAPTER 7 CONCLUSIONS AND PERSPECTIVES Summary of Results The data presented in this disse rtation have dem onstrated for the first time that aldosterone stimulated an increase in ET-1 peptide levels in rat inner medulla in vivo and in increase of edn1 mRNA in rat IMCD ex vivo (Stow et al., 2009). The aldoste rone-dependent stimulation of edn1 mRNA was confirmed in multiple renal collecting duct cells lines in vitro A 1990 bp region of the edn1 promoter demonstrated robust transcripti onal activity in lucifera se reporter assays. Sequence analysis revealed that this region contained several candidate HREs. Aldosterone action on edn1 occurred at the level of transcription and involved th e recruitment of both MR and GR to two HREs (HRE1 and HRE2) located in the edn1 promoter. The activation of edn1 in collecting duct cells could be recapitulated by th e administration of dexamethasone, a synthetic glucocorticoid that demonstrates selectiv e GR activation. Finally, siRNA knockdown of edn1 in collecting duct cells caused a concomitant increase in sgk1 and decrease in scnn1a expression levels in the absence of aldosterone. Surprisingly, edn1 knockdown rendered the scnn1a gene unresponsive to a 1 or 6 h aldosterone treatment. In contrast to most aldosterone ta rget genes that contribute to Na+ reabsorption, aldosterone-dependent edn1 expression is unique in that ET-1 is a known inhibitor of Na+ transport through ENaC in the collecting duct (Bugaj et al., 2 008). Therefore, aldosteroneinduced edn1 likely mediates a negative feedb ack loop on aldosterone-dependent Na+ transport. Aldosterone-ET-1 Action in the Inner Medulla in vivo Studies reported in Chapter 2 showed that aldosterone stim ulated an increase inner medullary ET-1 peptide levels. The observed array of genes expressed in the inner medulla from control animals demonstrated that the nece ssary molecular machinery was present for a

PAGE 188

188 functional ET-1-dependent feedback loop on al dosterone action. Firs t, the inner medulla expressed important compone nts for ENaC dependent Na+ transport including sgk1 per1 and the three ENaC subunits ( scnn1a, scnn1b and scnn1g ). The renal inner medulla also expressed the required components for ET-1 signaling including edn1, ece1 and etbr. In fact, the inner medulla also contained the highest level of etbr gene expression in the kidne y. Therefore, it seemed reasonable that an increase in inner medullary ET-1 levels, as was observed in the presence of aldosterone, would resu lt in increased ET-1-ETB receptor signaling in the inner medulla in vivo Aldosterone Action on edn1 is Med iated Via GR and MR Studies from Chapter 4 confirmed that th e aldosterone-depende nt stimulation of edn1 involved both MR and GR recruitment to the edn1 promoter. Similarly, both hormone receptors are known to regulate aldoster one response genes including scnn1a (Mick et al., 2001; Sayegh et al., 1999), sgk1 (Chen et al., 1999; It ani et al., 2002), and atp1a1 (Kolla et al., 1999; Whorwood et al., 1994). A role for MR and GR has also been implicated in aldosterone-dependent Na+ transport in the renal collecti ng duct (Bens et al., 1999; Gaegge ler et al., 2005). Despite these observations, the role of GR in aldosterone action is actively debated due to the concept that GR would not be active in aldosterone responsive cells that express 11 -HSD2 (Funder and Mihailidou, 2009; Funder et al., 1988; Gaeggele r et al., 2005; Odermatt and Atanasov, 2009). Indeed, 11 -HSD2 is an important enzyme that functi ons to inactive endogenous glucocorticoids and prevent cortisol-mediated Na+ retention by the collecting duct. However, 11 -HSD2 metabolites also lack an affinity for GR leavi ng GR expressed in collecting duct cells readily available for activation by another high affinity ligand such as aldosterone. Studies from Chapter 4 further revealed that MR and GR were present in the same protein complex suggest that MR and GR may functiona lly interact with one another. Although the studies in Chapter 4 did not di rectly address whether MR and GR were forming heterodimers,

PAGE 189

189 MR and GR heterodimers are known to exist (Liu et al., 1995; Savory et al., 2001). MR-GR heterodimers exhibited distinct transcriptional properties (L iu et al., 1995). Compared to aldosterone, dexamethsone stim ulated greater increases in edn1 sgk1 and per1 mRNA expression (Chapter 5). Since dexamethsone does not have an affinity for MR these studies suggested that GR-GR homodimers (by dexamethasone stimulation) have distinct transcriptional properties compared to a mixe d MR/GR activation (by aldosterone stimulation). Indeed, aldosterone action mediated by two hormone recepto rs with different transcriptional properties would certainly provide a collecting duct cell with a higher degree of adaptability in the regulation of Na+ transport. Analysis of edn1 HREs Two HREs were m apped in the edn1 promoter that each demonstr ated an ability to recruit MR and GR. These HREs were unique because they contained recep tor binding half-sites separated by eight nucleotides. Variations in the spacer region exist in several aldosterone response genes including the human atp1a1 gene (Mick et al., 2001) and may influence cooperative binding of multiple hormone receptors (Ou et al., 2001). For example, the aspartate aminotransferase gene has a HRE with an eight nucleotide spacer regi on (Garlatti et al., 1994). This unique element was more efficient in th e cooperative binding of two hormone receptor dimers suggesting the formation of a unique tetram eric complex. Studies in Chapter 4 revealed that both MR and GR interacted at the same HRE in the edn1 promoter. However, further studies need to be conducted to evaluate the stoichiome try of MR/GR binding to the edn1 gene. The identified HREs were also unique. HRE2 contained half-sites arranged as an inverted repeat, whereas HRE1 contained di rectly repeated half-sites. Ha lf-site orientation is also known to affect receptor binding as well as transc riptional activation (Ges erick et al., 2005). Although GR can bind to directly repeated half-sites w ith low affinity (Aumais et al., 1996), structural

PAGE 190

190 studies revealed that GR pref erentially binds to palindromic DNA sequences as a dimer in a head-to-head conformation (Luisi et al., 1991). Consistent with these reports, both MR and GR demonstrated a stronger affinity for HRE2 in comparison to HRE1. Moreover, only HRE2 could recruit RNA polymerase II. Similarly, the aldosterone response gene scnn1a also contains two HREs in different orientations. Only the inverted HRE was capa ble of stimulating transcription (Sayegh et al., 1999). Although GR can bind to direct ly repeated half-sites with lower affinity, these direct repeats are not thought to induce dimerization since i nverting the orientation of the one half-site would also rotate the orientation of a GR monomer. Directly repeated half-sites may in fact represent a negativ e HRE (Aumais et al., 1996; Gese rick et al., 2005). The neural seratonin (5-HT1A) gene contains a negative HRE th at consists a direct repeat of 5-TGTCCT-3 separated by 6 nucleotides. Interestingly, the affinity of this element was greater for MR/GR heterodimers than it was for MR or GR alone. This topology suggests that hormone receptors would bind to the DNA in a head-to-tail conforma tion. Interestingly, deletion of 3 nucleotides from the spacer region rotated the receptor di mer 180 and converted the negative HRE into a positive HRE that mediated glucocorticoid induced transcription. Thus, HRE1 represents a low affinity element that is only occupied at high concentrations of hormo ne. Although the functional activity of HRE1 remains to be elucidated, it is interesting to speculate on the evolutionary advantage of having negative response elemen t to prevent excessive hormone activation. Effect of edn1 Knockdown on Aldosterone Target Gene Expression Chapter 6 reports that siRNA knockdown of edn1 resulted in an increase in sgk1 mRNA expression. This observation co uld be explained if ET-1 me diated tonic inhibition of sgk1 expression. ET-1 signaling has been linked to the transcriptional control of other genes and is known to involve the activation of NFB. Interestingly, the only known transcription factor that inhibits sgk1 mRNA is NFB (de Seigneux et al., 2008). Knockdown of e dn1 expression was

PAGE 191

191 also associated with a decrease in scnn1a mRNA expression (Chapter 6). Given that ET-1 has been implicated in the tonic inhibition of ENaC (Bugaj et al., 2008), the reduction is scnn1a mRNA most likely reflected a compensatory response. Surprisingly, however, was that edn1 knockdown was able to completely ab rogate the expected increase in scnn1a mRNA after 1 or 6 h of hormone treatment. Model of Aldosterone-Induced ET-1 Negative Feedback Loop Based on the experim ents presented in this dissertation a proposed model has been developed for the mechanism of aldosterone -induced ET-1. In this proposed model a physiological increase in plasma aldosterone activates both MR and GR in the collecting duct (Figure 7-1A). The aldosterone-bound MR/GR co mplex is transported into the nucleus where the receptors bind to HREs in the edn1 sgk1 scnn1a and per1 promoter regions. The immediate response to aldosterone involves an increase in edn1, sgk1 and per1 mRNA. Translated Sgk1 then results in an increase in ENaC cha nnel activity. However, the increase in edn1 expression results in an increase ET-1 and the subsequent activation of ETB receptors. ETB receptor signal transduction results in rapid i nhibition of ENaC open probab ility (Bugaj et al., 2008). The balance between Sgk1 activity and ETB-mediated action is anticipated to determine the actual net Na+ transport by ENaC. In the second phase of aldos terone action (Figure 7-1B) ETB-dependent activation of NFB results in a decrease in sgk1 mRNA. The consequent decrease in Sgk1 results in ENaC ubiquitinylation and degradation. However, the increased Per1 pr oduct enters the nucleus where it binds to and upregulates scnn1a expression (Gumz et al., 2009a). Interestingly, Per1 has also been implicated in the inhibition of edn1 (personal communication with Dr. Michelle Gumz, University of Florida). Therefore, Per1 al so serves as a negative feedback signal for edn1. Finally, in this model Big-ET-1 is expected to shuttled to sub-membrane vesicles. As

PAGE 192

192 aldosterone dependent Na+ reabsorption restores normal Na+ balance a consequent increase in tubular flow rate is expected to the distal nephron. Flow-depe ndent ET-1 mediated release then acts in a second wave of ETB-dependent inhibition of ENaC. Taken together, this model provides the first potential negative fee dback pathway on aldosterone dependent Na+ transport and aldosterone-dependent transcription. Perspectives and Future Directions The goal of future studies should be designed w ith three m ajor goals in mind. First, it is pertinent that future studies demonstrate the al dosterone-ET-1 axis has a functional role in Na+ transport in the collecting duct ce ll. Second, studies should be de signed to fully characterize the molecular mechanisms involved in the aldostero ne-ET-1 axis. Finally, future studies should address the role of aldosterone-induced ET-1 in h ypertension, as well as other human diseases. These studies should provide great insight into the role of aldost erone-induced ET-1 in the body. A Functional Aldsosterone-ET-1 Axis Imm ediate focus should be on determining whet her or not aldosterone induced ET-1 has an effect on aldosterone-dependent Na+ transport in renal collecting duct cells. The first studies should be conducted in mpkCCDc14 cells and mIMCD-3 cells in vitro since both of these cells lines are validated models for aldosterone ac tion. A good experiment would be designed to apply the siRNA technique presented in Chapte r 6 for use in combination with an Ussing chamber experiment to evaluate the role of ET-1 on ENaC-depende nt transepithelial Na+ voltage. Knockdown of edn1 should result in an increas e in ENaC activity in the presence or absence of aldosterone. This observation would also confirm that the decrease in scnn1a mRNA levels was a compensatory response due to increased ENaC activity. These functiona l studies should also be conducted over a 24-48 h time course in orde r to fully characterize the aldosterone-ET-1 mechanism. Furthermore, additional electrophysio logical experiments, such as single-channel

PAGE 193

193 patch clamp studies, should be conducted to confirm data coll ected using an Ussing chamber approach. After initial studies have characterized the f unctional role of aldoste rone-induced ET-1 in the collecting duct, experiments should then be de signed to confirm the mechanism exists in an animal. An inducible, colle cting duct cell specific edn1 knockout mouse would allow investigators to study the specific role of edn1 in response to aldosterone Creating an inducible knockout would eliminate confounding compensatory responses during development. This mouse model would have a greater degree of clinical relevance to disease since aberrations, but not the complete loss of edn1 has been documented in human disease. It would also be highly advantageous to create a technique to allow of the identification of edn1 expression in vivo. Since the edn1 mRNA is too liable for is olation from animal tissue extracts (Chapter 2), an alternat ive approach will be required. The best approach would involve the creation of another mouse model. The edn1 promoter containing th e functional HRE1 and HRE2 could be inserted upstream of a reporter gene such as luciferase or -galatosidase. The reporter construct should then be delivered to a mouse embryo and inse rted into the mouse genome to create a transgenic mouse model. Tr eating these mice with vehicle or aldosterone would allow researchers to identify cells that normally express edn1, as well as cells that modulate their edn1 expression in response to aldosterone. This study would also determine if aldosterone-induced ET-1 is exclusive to the IM CD or occurs in CCD and OMCD, a question that has not been resolved in vivo Moreover, this mouse model would be useful for identifying other regulatory signals that control edn1 expression. Molecular Machinery and Therapeutic Targets Future experim ents should also address the molecular mechanism for aldosterone induction of ET-1, as well as ET-1-mediated feedback on aldosterone action. The studies

PAGE 194

194 presented in this dissertation have provided a great deal of insight into the mechanism of aldosterone action on edn1 Indeed, the studies presented in this dissertation have shown that aldosterone acts through bot h MR and GR to modulate edn1 mRNA expression. However, it still remains to be confirmed that MR and GR form a functional heter odimer in collecting duct cells. Demonstration of a func tional heterodimer in the kidne y would change the clinical paradigm and most certainly provide new avenues for pharmacological drug design. An in vivo fluorescence resonance energy transfer experiment in collecting duct cells would directly address this issue. If, indeed, a MR-GR heterodimer is verified in collecting duct cells, it will be necessary to determine what set of genes this heteromeric complex regulates in collecting duct cells. It is possible that MR and GR homodimers and heterodimers regulate distinct sets of genes. Indeed, this hypothesis is consistent w ith observations in Chapters 4 and 5 that showed equimolar concentrations of aldosterone, which activated MR and GR, and dexamethasone, which activates only GR, demonstrated differe nt magnitudes of mRNA induction. This added degree of transcriptional complex ity would allow a particular cell to respond more specifically to a given physiological need. More over, expanding the ce lls capacity to differentially regulate transcription would clearly be an evolutionary advantage. Gene microarray technology and candidate gene approaches should be used to ev aluate differences in tr anscription in response homodimer or heterodimers. Another important goal of future molecular stud ies should be to identify the key molecules and molecular mechanism involved in the aldosterone -ET-1 feedback loop (Figure 7-1). First, it is not known how PreproET-1 is processed to ET-1 in collecting duct cells. It is possible that signal transduction path ways regulate the secretion of Big-ET-1. Indeed, increased ET-1 secretion has been observed due to an increase in flow and shear stre ss (Kohan, 2009; Walshe et

PAGE 195

195 al., 2005). The regulatory release of ET-1 in res ponse to mechanical stimuli or other factors may explain why renal ET-1 is increase d in both states of high (Fattal et al., 2004) and low (Klinger et al., 2008) NaCl intake in animals. Indeed, dur ing states of low NaCl intake the body would release aldosterone in order to in crease NaCl content by stimulating Na+ transport in the distal nephron and collecting duct. Under these conditions ET-1 is directly stimulated by aldosterone to mediate a negative feedback loop that either shuts down aldosterone signaling or simply prevents excessive Na+ reabsorption. In contrast, a high Na Cl intake stimulates ET-1 secretion via mechanical stimuli such as an increase in fl ow or shear stress. U nder these conditions the increase in ET-1 likely facilita tes natriuresis and prevents an increase in NaCl and blood pressure. Therefore, renal ET-1 can be stimulated to block Na+ reabsorption during both high and low NaCl conditions. However, further m echanistic studies are n eeded to confirm this model of ET-1 action. Other important molecular studies in the future should include ev aluating the molecules involved in ET-1-ETB receptor feedback. Current studies ha ve demonstrated that nitric oxide, Src kinases and cGMP are involved in ETB-dependent inhibition of EN aC activity (Bugaj et al., 2008; Gilmore et al., 2001). However, the full signal transduction cascade targeting ENaC activity has not been elucidated. Moreover, data in Chapter 6 s uggests for the first time that an ETB-dependent pathway blocking transcrip tion of the aldosterone-target gene sgk1 also exists. The potential role of NFB in mediating ETB receptor-dependent inhibition of sgk1 mRNA expression should be addresse d. A combination of NFB antagonists and ETB receptor antagonists should address this experimental que stion. Similarly, the molecules involved in ETB receptor-mediated ENaC activity inhibition should be confirmed in order to identify new molecular targets for therapeutic intervention.

PAGE 196

196 The Aldosterone-ET-1 Axis in Hy pertension and Human Disease The confirmation of a functiona l ET-1 m ediated feedback lo op on aldosterone action, and the identification of the molecular pathways in volved have major implications for patients diagnosed with hypertension. Hypertension rema ins a major medical concern. In 2009, the American Heart Association reported that hypertension affected an astounding 73 million Americans, or one-third of our entire adult population. Hypertension is a leading risk factor for cardiovascular disease, stroke a nd all-cause mortality. Greater th an 90% of hypertensive patients are diagnosed with essential hype rtension (Binder, 2007). Essen tial hypertension is thought to be involve multiple gene loci (Deng, 2007) a nd is most likely caused by subtle genetic polymorphisms (Binder, 2007) or imbalances in ge ne expression that develop over time (Doris and Fornage, 2005). Many polymorphisms associated with clinical hypertension have been identified in aldosterone target genes, including edn1 (Treiber et al., 2003), sgk1 (Busjahn et al., 2002) and scnn1a ( ENaC) (Iwai et al., 2002). Several of these polymorphisms are located in gene regulatory regions and were shown to alter the normal pattern of mRNA expression (Gonzalez et al., 2007; Iwai et al., 2002; Popow ski et al., 2003). Abnormal patte rns of aldosterone-dependent gene expression have also been observed in experimental models of hypertension (Aoi et al., 2006). Indeed, if edn1 mediates negative feedback on aldosterone action, th e uncoupling of aldosterone and edn1 might result in excessive Na+ retention and hypertension. Molecular studies presented in this dissert ation, combined with data co llected in the proposed future experiments, could aid researchers in the development of more specific clinical interventions that treat the specific mechanism of essen tial hypertension in a given patient.

PAGE 197

197 Figure 7-1 P roposed Model for ET-1 Mediated Ne gative Feedback on Aldosterone Action in the Kidney.

PAGE 198

198 APPENDIX A OPTIMIZED PROTOCOL FOR INDIVI DUAL NEPHRON DISSECTION IN RAT Method While m icrodissection of mouse nephron segments is a well-established procedure in our laboratory, the isolation of indivi dual rat nephrons had not been pr eviously performed. Due to naturally occurring interstitial fibrosis in the a dult rat kidney, several tech nical parameters were modified. The following procedure allowed for isol ation of >30 mm of cort ical collecting ducts: Male Sprague Dawley rats (150 g; Harlan) were anesthetized with pentobarbital (100 mg/kg, ip) and kidneys were removed. Corona l slices were dissected into co rtex, outer and inner medulla. Samples were torn with forceps and placed into 2 ml of collagenase digestion solution (CDS) that contained 1 mg/ml collagenase type II (Worthington Biochemical, Freehold, NJ), 5 mM glycine, 50 U/ml DNase I, 50 g/ml soybean tr ypsin inhibitor, and 10 U/ml RNase inhibitor (Promega, Madison, WI) in 1:1 Dulbeccos Mo dified Eagle Medium/Hams F-12 without HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) or phenol red. Samples were agitated by hand and placed in a 5% CO2 incubator. CDS was changed every 10 min and individual segments were present after approxim ately 35 min. Supernatant was transferred into glass tubes and tubules were sedimented on ice for 5 min. The CDS was removed and replaced with 1:1 Dulbeccos Modified Eagle Medium/H ams F-12 plus 1% bovine serum albumin. Tubules were sorted for 1 h at 4 C. Nephron and collecting duct segments were identified based on the sorting criteria below. Tubules were meas ured with a micrometer and transferred into 800 l TRIzol (Invitrogen) for conventional RNA extraction.

PAGE 199

199 Table A-1. Identification criteria for microdissected nephron segments Digestion Nephron Segment Identification Criteria cortex proximal convoluted tubule white, reflective, convoluted, thicker than the distal convoluted tubule proximal straight tubule reflective, smooth membrane, wide cortical thick ascending limb of Henle thin, straight, wiry, uniform cell population distal convoluted tubule white, reflective, convoluted, transition to connecting tubule connecting tubule transition from distal convoluted tubule, not reflective, tall and uniform cells initial collecting tubule branch points, not reflective, low and heterogeneous cell population cortical collecting duct not reflective, gray modeled membrane, sticky, and wider than initial collecting tubule outer medulla medullary thick ascending limb of Henle straight, wiry, uniform cells, brighter and slightly thinner than outer medullary collecting duct outer medullary collecting duct gray, modeled membrane, sticky inner medulla thin limbs (ascending and descending) very thin, straight inner medullary collecting duct very white, not reflective, sticky, flexible, and very wide

PAGE 200

200 APPENDIX B IMMUNOHISTOCHEMISTRY OF ETB RE CEPTORS IN THE RAT KIDNEY Method W ild-type black swiss mice were anesthetized with isoflurane and ki dneys were preserved by in vivo cardiac perfusion with PBS (pH 7.4) followed by periodate-lysine-2% paraformaldehyde fixative. Kidneys were remove d, sectioned into 2 to 4 mm thick slices and immersed overnight at 4 C in the same fixa tive. Samples of kidney from each animal were embedded in polyester wax (polye thylene glycol 400 disterate, Polysciences, Warrington, PA). Sections (5 m thick) were cu t with a microtome and mounted on gelatin-coated glass slides. Immunolocalization of the ETB receptor was attempted with two different antibodies: a rabbit-anti-human antibody to the N-terminus (epitope: EERGFPPDRATPLLQ) (#91508, Assay Designs) and a rabbit-anti-ra t antibody against residues 298-314 (CEMLFKKSGMQIALND) (Product #AER-002, Lot # AN-02, Alomone). A st andard immunoperoxidase procedure was used (Vectastain Elite, Vector Laboratories, Burlingame, CA). Sections were dewaxed in a graded series of ethanol, rehydrat ed and rinsed in PBS. Sections were blocked for 15 min with 5% normal goat serum (Vector Labora tories) in PBS, and then inc ubated at 4 C overnight with one of the primary antibodies. Sections were washed in PBS and endogenous peroxidase activity was blocked by incubating the sections in 0.3% H2O2 for 30 min. The sections will be washed again in PBS and incubated for 30 min with biotin lyated goat anti-rabbit IgG secondary antibody (Vector Laboratories) diluted 1:200 in PBS and again washed in PBS. The sections were treated for 30 min with the avidin-biotin complex reagent, rinsed with PBS and then exposed to diaminobenzidine. The sections will then be dehydrated with xylene, mounted with Permount (Fisher, Fair Lawn, NJ) and observed by light microscopy. For controls in each of the

PAGE 201

201 immunolocalization experiments, preimmune seru m diluted at the same concentration as the primary antibody in PBS or PBS alone was substituted for the primary antibody. Results The antibod ies each localized to different stru ctures in the kidney, which confounded data interpretation.

PAGE 202

202 LIST OF REFERENCES Agus, Z.S., Gardner, L.B., Beck, L.H., and Gol dberg, M. (1973). Effects of parathyroid horm one on renal tubular reabsorption of calcium sodium, and phosphate. Am J Physiol 224, 11431148. Ahn, D., Ge, Y., Stricklett, P.K., Gill, P., Taylor D., Hughes, A.K., Yanagisawa, M., Miller, L., Nelson, R.D., and Kohan, D.E. (2004). Collec ting duct-specific knoc kout of endothelin-1 causes hypertension and sodium retention. J Clin Invest 114, 504-511. Aitsebaomo, J., Kingsley-Kallesen, M.L., Wu, Y., Quertermous, T., and Patterson, C. (2001). Vezf1/DB1 is an endothelial cell -specific transcription factor that regulates expression of the endothelin-1 promoter. J Biol Chem 276, 39197-39205. Alam, J., and Cook, J.L. (1990). Reporter genes: application to the study of mammalian gene transcription. Anal Biochem 188, 245-254. Anderson, E.M., Birmingham, A., Baskerville, S., Reynolds, A., Maksimova, E., Leake, D., Fedorov, Y., Karpilow, J., and Khvorova, A. (2008). Experimental validation of the importance of seed complement frequency to siRNA specificity. RNA 14, 853-861. Aoi, W., Niisato, N., Sawabe, Y., Miyazaki, H ., and Marunaka, Y. (2006). Aldosterone-induced abnormal regulation of ENaC and SGK1 in Da hl salt-sensitive rat. Biochem Biophys Res Commun 341, 376-381. Applied Biosystems (2006). Amplification Efficiency of TaqMan Gene Expression Assays (Foster City, CA, Applied Biosystems). Aquilla, E., Whelchel, A., Knot, H.J., Nelson, M. and Posada, J. (1996). Activation of multiple mitogen-activated protein kinase signal transduction pathways by the endothelin B receptor requires the cytoplasmic tail. J Biol Chem 271, 31572-31579. Arriza, J.L., Weinberger, C., Cerelli, G., Gl aser, T.M., Handelin, B.L., Housman, D.E., and Evans, R.M. (1987). Cloning of human mineralocorticoid receptor complementary DNA: structural and functional kinship with the glucocorticoid receptor. Science 237 268-275. Aumais, J.P., Lee, H.S., DeGannes, C., Horsford, J ., and White, J.H. (1996). Function of directly repeated half-sites as response elements for steroid hormone receptors. J Biol Chem 271, 12568-12577. Bai, L., Collins, J.F., Xu, H., and Ghishan, F.K. (2001). Transcriptional regulation of rat Na(+)/H(+) exchanger isoform-2 (NHE-2) gene by Sp1 transcription factor. Am J Physiol Cell Physiol 280, C1168-1175. Battistini, B., Berthiaume, N., Kelland, N.F., Webb, D.J., and Kohan, D.E. (2006). Profile of past and current clinical trials involving endot helin receptor antagonist s: the novel "-sentan" class of drug. Exp Biol Med (Maywood) 231, 653-695.

PAGE 203

203 Beato, M. (1989). Gene regulati on by steroid hormones. Cell 56 335-344. Beato, M., and Klug, J. (2000). Steroid horm one receptors: an update. Hum Reprod Update 6, 225-236. Bens, M., Vallet, V., Cluzeaud, F., Pascual-Letalle c, L., Kahn, A., Rafestin-Oblin, M.E., Rossier, B.C., and Vandewalle, A. (1999). Corticosteroid-dependent sodium transport in a novel immortalized mouse collecting duct pr incipal cell line. J Am Soc Nephrol 10, 923-934. Bhalla, V., and Hallows, K.R. (2008). Mechanisms of ENaC regulation and clinical implications. J Am Soc Nephrol 19, 1845-1854. Binder, A. (2007). A review of the genetics of essential hypertension. Curr Opin Cardiol 22, 176184. Blair-West, J.R., Coghlan, J.P., Denton, D.A., Goding, J.R., and Wright, R.D. (1963). The effect of aldosterone, cortisol, and corticosterone upon the sodium and potassium content of sheep's parotid saliva. J Clin Invest 42 484-496. Boldyreff, B., and Wehling, M. (2003). Rapid aldosterone ac tions: from the membrane to signaling cascades to gene transcription and physiological effects. J Steroid Biochem Mol Biol 85, 375-381. Brennan, F.E., and Fuller, P.J. (2006). Mammalia n K-ras2 is a corticosteroid-induced gene in vivo. Endocrinology 147, 2809-2816. Brenner, B.M., and Rector, F.C. (2008). Brenne r & Rector's the kidney, 8th edn (Philadelphia, Saunders Elsevier). Bridge, A.J., Pebernard, S., Ducraux, A., Nicoul az, A.L., and Iggo, R. (2003). Induction of an interferon response by RNAi vector s in mammalian cells. Nat Genet 34, 263-264. Bugaj, V., Pochynyuk, O., Mironova, E., Vandewalle, A., Medina, J.L., and Stockand, J.D. (2008). Regulation of the epithelial Na+ channe l by endothelin-1 in ra t collecting duct. Am J Physiol 295, F1063-1070. Burckhardt, G., Di Sole, F., and Helmle-Kolb, C. (2002). The Na+/H+ exchanger gene family. J Nephrol 15 Suppl 5, S3-21. Busjahn, A., Aydin, A., Uhlmann, R., Krasko, C., Ba hring, S., Szelestei, T., Feng, Y., Dahm, S., Sharma, A.M., Luft, F.C. et al. (2002). Serumand glucocorticoid-regulated kinase (SGK1) gene and blood pressure. Hypertension 40 256-260. Cai, Z., Xin, J., Pollock, D.M., and Pollock, J. S. (2000). Shear stress-mediated NO production in inner medullary collecting duct cells. Am J Physiol 279, F270-274.

PAGE 204

204 Capasso, G., Rizzo, M., Evangelista C., Ferrari, P., Geelen, G., Lang, F., and Bianchi, G. (2005). Altered expression of renal apical plasma memb rane Na+ transporters in the early phase of genetic hypertension. Am J Physiol 288, F1173-1182. Cella, J., and Tweit, R. (1961). Alkanoylthio17 alpha-carboxyethyl-17 beta-hydoxyandrosten-3one lactones, U.S.P. Office, ed. (United St ates of America, G. D. Searle & Co). Chambrey, R., Warnock, D.G., Podevin, R.A., Bruneval, P., Mandet, C., Belair, M.F., Bariety, J., and Paillard, M. (1998). Immunolocalizat ion of the Na+/H+ exchanger isoform NHE2 in rat kidney. Am J Physiol 275, F379-386. Chen, M., Todd-Turla, K., Wang, W.H., Cao, X., Sm art, A., Brosius, F.C., Killen, P.D., Keiser, J.A., Briggs, J.P., and Schnermann, J. (1993) Endothelin-1 mRNA in glomerular and epithelial cells of kidney. Am J Physiol 265, F542-550. Chen, S.Y., Bhargava, A., Mastroberardino, L., Me ijer, O.C., Wang, J., Buse, P., Firestone, G.L., Verrey, F., and Pearce, D. (1999). Epithelial sodium channel regulated by aldosteroneinduced protein sgk. Proc Natl Acad Sci USA 96, 2514-2519. Chou, S.Y., and Porush, J.G. (1995). Renal actions of endothelin-1 and endot helin-3: interactions with the prostaglandin system and nitric oxide. Am J Kidney Dis 26, 116-123. Chow, Y.H., Wang, Y., Plumb, J., O'Brodovich, H., and Hu, J. (1999). Hormonal regulation and genomic organization of the human amiloride-sensitive epithelial sodium channel alpha subunit gene. Pediatr Res 46, 208-214. Clapp, W.L., Madsen, K.M., Verlander, J.W., and Tisher, C.C. (1987). Intercalated cells of the rat inner medullary collecti ng duct. Kidney International 31, 1080-1087. Clavell, A.L., Stingo, A.J., Margulies, K.B., Brandt, R.R., and Burnett, J.C., Jr. (1995). Role of endothelin receptor subtypes in the in vivo regulation of renal function. Am J Physiol 268, F455-460. Corman, B., Pratz, J., and Poujeol, P. (1985). Changes in anatomy, glomerular filtration, and solute excretion in agi ng rat kidney. Am J Physiol 248, R282-287. Couette, B., Marsaud, V., Baulieu, E.E., Richar d-Foy, H., and Rafestin-Oblin, M.E. (1992). Spironolactone, an aldosterone antagonist, acts as an antiglucocorticosteroid on the mouse mammary tumor virus promoter. Endocrinology 130, 430-436. Coutard, M., Osborne-Pellegrin, M.J., and Funder, J.W. (1978). Tissue distribution and specific binding of tritiated dexamethasone in vivo: autoradiographic and cel l fractionation studies in the mouse. Endocrinology 103, 1144-1152. Cowley, A.W., Jr. (1997). Role of the renal medu lla in volume and arteri al pressure regulation. Am J Physiol 273, R1-15.

PAGE 205

205 Cupples, W.A. (2007). Interactions contributing to kidney blood flow autoregulation. Curr Opin Nephrol Hypertens 16, 39-45. D'Orleans-Juste, P., Labonte, J., Bkaily, G., C houfani, S., Plante, M., and Honore, J.C. (2002). Function of the endothelin(B) receptor in cardiovascular physiology and pathophysiology. Pharmacol Ther 95, 221-238. Davenport, A.P. (2002). International Union of Pharmacology. XXIX. Update on endothelin receptor nomenclature. Pharmacol Rev 54, 219-226. Davenport, A.P., O'Reilly, G., Molenaar, P., Magui re, J.J., Kuc, R.E., Sharkey, A., Bacon, C.R., and Ferro, A. (1993). Human endothelin receptors characterized using reverse transcriptase-polymerase chain reaction, in s itu hybridization, a nd subtype-selective ligands BQ123 and BQ3020: evidence for expre ssion of ETB receptors in human vascular smooth muscle. J Cardiovasc Pharmacol 22 Suppl 8 S22-25. de Seigneux, S., Leroy, V., Ghzili, H., Rousselo t, M., Nielsen, S., Rossier, B.C., Martin, P.Y., and Fraille, E. (2008). NF-kappaB inhibits sodium transport via down-regulation of SGK1 in renal collecting duct principal cells. J Biol Chem 283, 25671-25681. de Wet, J.R., Wood, K.V., Helinsk i, D.R., and DeLuca, M. (1985). Cloning of firefly luciferase cDNA and the expression of active luciferase in Escherichia coli. Proc Natl Acad Sci U S A 82, 7870-7873. Debonneville, C., Flores, S.Y., Kamynina, E., Plan t, P.J., Tauxe, C., Thomas, M.A., Munster, C., Chraibi, A., Pratt, J.H., Horisberger, J.D. et al. (2001). Phosphorylation of Nedd4-2 by Sgk1 regulates epithelial Na(+) chan nel cell surface expression. EMBO J 20 7052-7059. Deng, A.Y. (2007). Genetic basis of pol ygenic hypertension. Hum Mol Genet 16 Spec No. 2 R195-202. Deng, W.G., Zhu, Y., Montero, A., and Wu, K.K. ( 2003). Quantitative analysis of binding of transcription factor complex to biotinylated DNA probe by a streptavidin-agarose pulldown assay. Anal Biochem 323, 12-18. Derfoul, A., Robertson, N.M., Lingrel, J.B., Hall, D.J., and Litwack, G. (1998). Regulation of the human Na/K-ATPase beta1 gene promoter by mineralocorticoid and glucocorticoid receptors. J Biol Chem 273, 20702-20711. Dhaun, N., Goddard, J., Kohan, D.E., Pollock, D.M., Schiffrin, E.L., and Webb, D.J. (2008). Role of endothelin-1 in clinical hyp ertension: 20 years on. Hypertension 52, 452-459. Doris, P.A., and Fornage, M. (2005). The transcri bed genome and the heritable basis of essential hypertension. Cardiovasc Toxicol 5, 95-108. Dunn, T.B. (1949). Some observations on the norma l and pathologic anatomy of the kidney of the mouse. J Natl Cancer Inst 9, 285-301.

PAGE 206

206 Dusilova-Sulkova, S. (2009). Vitamin D metabolism and vitamin D traditional and nontraditional, target organs: implications for kidney patients. J Ren Care 35 Suppl 1, 3944. Eaton, D.C., and Pooler, J.P. (2004). Vander's re nal physiology, 7th edn (New York, NY, Lange Medical Books/McGraw Hill, Medical Pub. Division). Edwards, R.M., Pullen, M., and Nambi, P. ( 1992). Activation of endothelin ETB receptors increases glomerular cGMP via an L-ar ginine-dependent pathway. Am J Physiol 263, F1020-1025. Emoto, N., and Yanagisawa, M. (1995). Endothelin-converting enzyme-2 is a membrane-bound, phosphoramidon-sensitive metalloprotease wi th acidic pH optimum. J Biol Chem 270, 15262-15268. Estevez, R., Boettger, T., Stein, V., Birkenhager, R., Otto, E., Hildebrandt, F., and Jentsch, T.J. (2001). Barttin is a Clchannel beta-subunit cruc ial for renal Clreab sorption and inner ear K+ secretion. Nature 414, 558-561. Fakitsas, P., Adam, G., Daidi, D., van Bemmelen, M.X., Fouladkou, F., Patrignani, A., Wagner, U., Warth, R., Camargo, S.M., Staub, O. et al. (2007). Early aldosterone-induced gene product regulates the epithelia l sodium channel by deubiquitylation. J Am Soc Nephrol 18, 1084-1092. Fattal, I., Abassi, Z., Ovcharenko, E., Shimada, K. Takahashi, M., Hoffman, A., and Winaver, J. (2004). Effect of dietary sodium intake on th e expression of endothelin-converting enzyme in the renal medulla. Nephron Physiol 98, p89-96. Fedorov, Y., King, A., Anderson, E., Karpilow, J., Ilsley, D., Marshall, W., and Khvorova, A. (2005). Different delivery methods-different expression profiles. Nat Methods 2, 241. Felx, M., Guyot, M.C., Isler, M., Turcotte, R.E., Doyon, J., Khatib, A.M., Leclerc, S., Moreau, A., and Moldovan, F. (2006). Endothelin-1 (ET-1) promotes MMP-2 and MMP-9 induction involving the transcript ion factor NF-kappaB in human osteosarcoma. Clin Sci (Lond) 110, 645-654. Flores, S.Y., Loffing-Cueni, D., Kamynina, E., Daidi, D., Gerbex, C., Chabanel, S., Dudler, J., Loffing, J., and Staub, O. (2005) Aldosterone-induced serum and glucocorticoid-induced kinase 1 expression is accompanied by Nedd4-2 phosphorylation and increased Na+ transport in cortical collecti ng duct cells. J Am Soc Nephrol 16 2279-2287. Frey, F.J., Odermatt, A., and Frey, B.M. (2004) Glucocorticoid-mediated mineralocorticoid receptor activation and hypertension. Curr Opin Nephrol Hypertens 13, 451-458. Frindt, G., Ergonul, Z., and Palmer, L.G. (2007) Na channel expression and activity in the medullary collecting duct of rat kidney. Am J Physiol 292, F1190-1196.

PAGE 207

207 Fuller, P.J. (2004). Aldoster one and DNA: the 50th annivers ary. Trends Endocrinol Metab 15, 143-146. Funder, J.W. (2005). Mineralocorticoid receptor s: distribution and act ivation. Heart failure reviews 10, 15-22. Funder, J.W., and Mihailidou, A.S. (2009). Al dosterone and mineralocorticoid receptors: Clinical studies and basic biology. Mol Cell Endocrinol 301, 2-6. Funder, J.W., Pearce, P.T., Smith, R., and Smith, A.I. (1988). Mineralocort icoid action: target tissue specificity is enzyme, not receptor, mediated. Science 242 583-585. Gaeggeler, H.P., Gonzalez-Rodriguez, E., J aeger, N.F., Loffing-Cueni, D., Norregaard, R., Loffing, J., Horisberger, J.D., and Rossier, B.C. (2005). Mineralocorticoid versus glucocorticoid receptor occupa ncy mediating aldosterone-stimula ted sodium transport in a novel renal cell line. J Am Soc Nephrol 16, 878-891. Gallego, M.S., and Ling, B.N. (1996). Regulation of amiloride-sensitive Na+ channels by endothelin-1 in distal nephron cells. Am J Physiol 271, F451-460. Galon, J., Franchimont, D., Hiroi, N., Frey, G., Bo ettner, A., Ehrhart-Bornstein, M., O'Shea, J.J., Chrousos, G.P., and Bornstein, S.R. (2002) Gene profiling reveals unknown enhancing and suppressive actions of glucoc orticoids on immune cells. FASEB J 16 61-71. Gamba, G., Miyanoshita, A., Lombardi, M., Lytt on, J., Lee, W.S., Hediger, M.A., and Hebert, S.C. (1994). Molecular cloning, primary structur e, and characterization of two members of the mammalian electroneutral sodium-(potassium )-chloride cotransporter family expressed in kidney. J Biol Chem 269, 17713-17722. Ganong, W.F., Biglieri, E.G., and Mulrow, P.J. (1966). Mechanisms regul ating adrenocortical secretion of aldosterone and glucocorticoids. Recent Prog Horm Res 22, 381-430. Gariepy, C.E., Ohuchi, T., Williams, S.C., Richar dson, J.A., and Yanagisawa, M. (2000). Saltsensitive hypertension in endothelin-B receptor-deficient rats. J Clin Invest 105, 925-933. Garlatti, M., Daheshia, M., Slater, E., Bougue t, J., Hanoune, J., Beato, M., and Barouki, R. (1994). A functional glucocorticoid-responsive unit composed of two overlapping inactive receptor-binding sites: evidence for forma tion of a receptor tetramer. Mol Cell Biol 14 8007-8017. Gauer, S., Segitz, V., and Goppelt-Struebe, M. (2007). Aldosterone induces CTGF in mesangial cells by activation of the glucocorticoi d receptor. Nephrol Dial Transplant 22, 3154-3159. Ge, Y., Bagnall, A., Stricklett, P.K., Strait, K., Webb, D.J., Kotelevtsev, Y., and Kohan, D.E. (2006). Collecting duct-specific knockout of the endothelin B receptor causes hypertension and sodium retention. Am J Physiol 291, F1274-1280.

PAGE 208

208 Ge, Y., Huang, Y., and Kohan, D.E. (2008). Role of the renin-angiotensin-aldosterone system in collecting duct-derived endothe lin-1 regulation of blood pressu re. Can J Physiol Pharmacol 86, 329-336. Ge, Y., Stricklett, P.K., Hughes, A.K., Yanagisawa, M., and Kohan, D.E. (2005). Collecting duct-specific knockout of the endothelin A receptor alters renal vasopressin responsiveness, but not sodium excre tion or blood pressure. Am J Physiol 289, F692-698. Gerstung, M., Roth, T., Dienes, H.P., Licht, C., and Fries, J.W. (2007). Endothelin-1 induces NF-kappaB via two independent pathways in human renal tubular epithelial cells. Am J Nephrol 27, 294-300. Geserick, C., Meyer, H.A., and Haendler, B. (2 005). The role of DNA response elements as allosteric modulators of steroid receptor function. Mol Cell Endocrinol 236 1-7. Gilmore, E.S., Stutts, M.J., and Milgram, S.L. (2001). Src Family Kinases Mediate Epithelial Na+ Channel Inhibition by Endothelin. J Biol Chem 276, 42610-42617. Gonzalez, A.A., Carvajal, C.A., Riquelme, E., Kr all, P.M., Munoz, C.R., Mosso, L.M., Kalergis, A.M., and Fardella, C.E. (2007). A polymorphic GT short tandem repeat affecting betaENaC mRNA expression is associated w ith low renin essential hypertension. Am J Hypertens 20 800-806. Gottschalk, C.W., and Mylle, M. (1958). Evidence that the ma mmalian nephron functions as a countercurrent multiplier system. Science 128, 594. Grantcharova, E., Furkert, J., Reusch, H.P., Kr ell, H.W., Papsdorf, G., Beyermann, M., Schulein, R., Rosenthal, W., and Oksche, A. (2002). The extracellular N termi nus of the endothelin B (ETB) receptor is cleaved by a metalloproteas e in an agonist-dependent process. J Biol Chem 277, 43933-43941. Grantcharova, E., Reusch, H.P., Grossmann, S ., Eichhorst, J., Krell, H.W., Beyermann, M., Rosenthal, W., and Oksche, A. (2006). N-termin al proteolysis of the endothelin B receptor abolishes its ability to induce EGF recepto r transactivation and contractile protein expression in vascular smooth muscle cells. Arterioscler Thromb Vasc Biol 26, 1288-1296. Greger, R. (1985). Ion transport mechanisms in thick ascending limb of Henle's loop of mammalian nephron. Physiol Rev 65 760-797. Grossmann, C., Freudinger, R., Mildenberger, S ., Krug, A.W., and Gekle, M. (2004a). Evidence for epidermal growth factor receptor as nega tive-feedback control in aldosterone-induced Na+ reabsorption. Am J Physiol 286, F1226-F1231. Grossmann, C., Scholz, T., Rochel, M., Bumke-Vogt C., Oelkers, W., Pfeiffer, A.F., Diederich, S., and Bahr, V. (2004b). Transactivation via the human glucocorticoid and mineralocorticoid receptor by therapeutically us ed steroids in CV-1 cells: a comparison of their glucocorticoid and mineraloco rticoid properties. Eur J Endocrinol 151, 397-406.

PAGE 209

209 Grundy, H.M., Simpson, S.A., and Tait, J.F. (1952). Isolation of a highly active mineralocorticoid from beef adrenal extract. Nature 169, 795-796. Gumz, M.L., Popp, M.P., Wingo, C.S., and Cain, B.D. (2003). Early transcriptiona l effects of aldosterone in a mouse inner medullary collecting duct cell line. Am J Physiol 285, F664673. Gumz, M.L., Stow, L.R., Lynch, I.J., Greenlee, M.M., Rudin, A., Cain, B.D., Weaver, D.R., and Wingo, C.S. (2009a). The circadia n clock protein Period 1 regula tes expression of the renal epithelial sodium channel in mice. J Clin Invest. Gumz, M.L., Stow, L.R., Lynch, I.J., Greenlee, M.M., Rudin, A., Cain, B.D., Weaver, D.R., and Wingo, C.S. (2009b). The circadia n clock protein Period 1 re gulates expression of the renal epithelial sodium cha nnel in mice. J Clin Invest 119, 2423-2434. Gumz, M.L., Stow, L.R., and Xia, S.L. (2009c ). Epithelial Transport Physiology. In, G. Gerencser, ed. (Humana Press). Guntupalli, J., Onuigbo, M., Wall, S., Alpern, R. J., and DuBose, T.D., Jr. (1997). Adaptation to low-K+ media increases H(+)-K(+)-ATPase but not H(+)-ATPase-mediated pHi recovery in OMCD1 cells. Am J Physiol 273, C558-571. Gutzwiller, J.P., Hruz, P., Huber, A.R., Hamel, C., Zehnder, C., Drewe, J., Gutmann, H., Stanga, Z., Vogel, D., and Beglinger, C. (2006). Glu cagon-like peptide-1 is involved in sodium and water homeostasis in humans. Digestion 73, 142-150. Guyton, A.C. (1981). The relationship of cardiac output and arterial pressure control. Circulation 64, 1079-1088. Guyton, A.C. (1991). Blood pressure control--sp ecial role of the kidneys and body fluids. Science 252, 1813-1816. Guyton, A.C., Coleman, T.G., Cowley, A.V., Jr., Scheel, K.W., Manning, R.D., Jr., and Norman, R.A., Jr. (1972). Arterial pressure regula tion. Overriding dominance of the kidneys in long-term regulation and in hypertension. Am J Med 52, 584-594. Haraldsson, B., and Jeansson, M. (2009). Glomer ular filtration barrier. Curr Opin Nephrol Hypertens 18 331-335. Haraldsson, B., Nystrom, J., and Deen, W.M. ( 2008). Properties of the glomerular barrier and mechanisms of proteinuria. Physiol Rev 88, 451-487. He, Y., Szapary, D., and Simons, S.S., Jr. (2002). Modulation of induction properties of glucocorticoid receptor-agonist and -antagonist complexes by coactivators involves binding to receptors but is independent of ability of coactivators to augment transactivation. J Biol Chem 277, 49256-49266.

PAGE 210

210 Hellal-Levy, C., Couette, B., Fagart, J., Souque, A., Gomez-Sanchez, C.E., and Rafestin-Oblin, M. (1999). Specific hydroxylations determine selective corticosteroid recognition by human glucocorticoid and mineralo corticoid receptors. FEBS Lett 464, 9-13. Herrera, M., and Garvin, J.L. ( 2004). Endothelin stimulates endothe lial nitric oxide synthase expression in the thick as cending limb. Am J Physiol 287, F231-235. Herrera, M., and Garvin, J.L. (2005). A high-salt di et stimulates thick ascending limb eNOS expression by raising medullary osmolality a nd increasing release of endothelin-1. Am J Physiol 288, F58-64. Hickey, K.A., Rubanyi, G., Paul, R.J., and Hi ghsmith, R.F. (1985). Characterization of a coronary vasoconstrictor produced by cu ltured endothelial cells. Am J Physiol 248, C550556. Hoffman, A., Abassi, Z.A., Brodsky, S., Ramadan, R., and Winaver, J. (2000). Mechanisms of big endothelin-1-induced diuresis and natriure sis : role of ET(B) receptors. Hypertension 35, 732-739. Hoffman, A., Grossman, E., Goldstein, D.S., Gill, J.R., Jr., and Keiser, H.R. (1994). Urinary excretion rate of endothelin-1 in patients w ith essential hypertension and salt sensitivity. Kidney International 45, 556-560. Horisberger, J.D., and Rossier, B. C. (1992). Aldosterone regulation of gene transcription leading to control of ion transport. Hypertension 19, 221-227. Hsieh, T.J., Lin, S.R., Lee, Y.J., Shin, S.J., Lai, Y.H., Hsu, C.H., and Tsai, J.H. (2000). Increased renal medullary endothelin-1 synthesis in pr ehypertensive DOCAa nd salt-treated rats. Am J Physiol 279, F112-121. Hughes, A.K., Cline, R.C., and Kohan, D.E. ( 1992). Alterations in rena l endothelin-1 production in the spontaneously hyper tensive rat. Hypertension 20, 666-673. Hultman, M.L., Krasnoperova, N.V., Li, S., Du, S., Xi a, C., Dietz, J.D., Lala, D.S., Welsch, D.J., and Hu, X. (2005). The ligand-dependent interaction of mineralocorticoid receptor with coactivator and corepressor peptides s uggests multiple activation mechanisms. Mol Endocrinol 19 1460-1473. Huppi, K., Martin, S.E., and Caplen, N.J. ( 2005). Defining and assaying RNAi in mammalian cells. Mol Cell 17, 1-10. Husted, R.F., Laplace, J.R., and Stokes, J.B. (1990). Enhancement of electrogenic Na+ transport across rat inner medullary co llecting duct by glucocorticoid and by mineralocorticoid hormones. J Clin Invest 86 498-506. Inoue, A., Yanagisawa, M., Takuwa, Y., Mitsui, Y., Kobayashi, M., and Masaki, T. (1989). The human preproendothelin-1 gene. Complete nucleotide sequence and regulation of expression. J Biol Chem 264, 14954-14959.

PAGE 211

211 Inscho, E., Imig, J., Cook, A., and Pollock, D. (2005). ETA and ETB receptors differentially modulate afferent and effere nt arteriolar responses to endothelin. Br J Pharmacol 146, 1019-1026. Itani, O.A., Liu, K.Z., Cornish, K.L., Campbell, J.R., and Thomas, C.P. (2002). Glucocorticoids stimulate human sgk1 gene expression by activat ion of a GRE in its 5'-flanking region. Am J Physiol Endocrinol Metab 283, E971-979. Ito, S. (1995). Nitric oxide in the kidney. Curr Opin Nephrol Hypertens 4, 23-30. Iwai, N., Baba, S., Mannami, T., Ogihara, T., an d Ogata, J. (2002). Association of a sodium channel alpha subunit promoter variant with blood pressure. J Am Soc Nephrol 13, 80-85. Izzo, J.L., Sica, D.A., Black, H.R., and Council for High Blood Pressure Research (American Heart Association) (2008). H ypertension primer, 4th edn (P hiladelphia, PA, Lippincott Williams & Wilkins). Jacobson, L.O., Goldwasser, E., Fried, W., and Plzak, L.F. (1957). Studies on erythropoiesis. VII. The role of the kidney in the pr oduction of erythropoie tin. Trans Assoc Am Physicians 70 305-317. Jarad, G., and Miner, J.H. (2009). Update on the glomerular filtration barrier. Curr Opin Nephrol Hypertens 18 226-232. Just, A., Olson, A.J., and Arendshor st, W.J. (2004). Dual constricto r and dilator ac tions of ET(B) receptors in the rat renal microc irculation: interactions with ET(A) receptors. Am J Physiol 286, F660-668. Kalinyak, J.E., Dorin, R.I., Hoffman, A.R., and Perlman, A.J. (1987). Tiss ue-specific regulation of glucocorticoid receptor mRNA by dexamethasone. J Biol Chem 262, 10441-10444. Kao, Y.S., and Fong, J.C. (2008). Endothelin-1 induces glut1 transcription through enhanced interaction between Sp1 and NF-kappa B transcription factors. Cell Signal 20, 771-778. Kearney, P.M., Whelton, M., Reynolds, K., Munt ner, P., Whelton, P.K., and He, J. (2005). Global burden of hypertension: anal ysis of worldwide data. Lancet 365, 217-223. Khanna, A., Simoni, J., and Wesson, D.E. (2005). Endothelin-induced increased aldosterone activity mediates augmented distal nephron acid ification as a result of dietary protein. J Am Soc Nephrol 16, 1929-1935. Kitagawa, H., Yanagisawa, J., Fuse, H., Ogawa, S., Yogiashi, Y., Okuno, A., Nagasawa, H., Nakajima, T., Matsumoto, T., and Kato, S. (2002). Ligand-selectiv e potentiation of rat mineralocorticoid receptor activation function 1 by a CBP-containing histone acetyltransferase complex. Mol Cell Biol 22, 3698-3706.

PAGE 212

212 Kitamura, K., Tanaka, T., Kato, J., Eto, T., a nd Tanaka, K. (1989). Regional distribution of immunoreactive endothelin in porcine tissue: abundance in inner medulla of kidney. Biochem Biophys Res Commun 161, 348-352. Kitamura, K., Yukawa, T., Morita, S., Ichiki, Y., Eto, T., and Tanaka, K. (1990). Distribution and molecular form of immunoreactive big e ndothelin-1 in porcine tissue. Biochem Biophys Res Commun 170, 497-503. Kizer, N.L., Lewis, B., and Stanton, B.A. (1995). Electrogenic sodium absorption and chloride secretion by an inner medullary collecting duct cell line (mIMCD-K2). Am J Physiol 268, F347-355. Klinger, F., Grimm, R., Steinb ach, A., Tanneberger, M., Kunert-K eil, C., Rettig, R., and Grisk, O. (2008). Low NaCl intake elevates renal me dullary endothelin-1 and endothelin A (ETA) receptor mRNA but not the sensitivity of renal Na+ excretion to ETA receptor blockade in rats. Acta Physiol (Oxf) 192, 429-442. Koeppen, B.M., Biagi, B.A., and Giebisch, G.H. (1983). Intracellular microelectrode characterization of the rabbit corti cal collecting duct. Am J Physiol 244, F35-47. Kohan, D.E. (1991). Endothelin synthesis by rabbit renal tubule cells. Am J Physiol 261, F221226. Kohan, D.E. (1993). Autocrine role of endothe lin in rat inner medu llary collecting duct: inhibition of AVP-induced cAMP accumulation. J Cardiovasc Pharmacol 22 Suppl 8, S174-179. Kohan, D.E. (2006). The renal medullary endothe lin system in control of sodium and water excretion and systemic blood pressu re. Curr Opin Nephrol Hypertens 15, 34-40. Kohan, D.E. (2009). Biology of endot helin receptors in the collecting duct. Kidney international 76, 481-486. Kohan, D.E., and Fiedorek, F.T., Jr. (1991). En dothelin synthesis by rat inner medullary collecting duct cells. J Am Soc Nephrol 2, 150-155. Kohan, D.E., and Padilla, E. (1993). Osmolar regulation of endot helin-1 production by rat inner medullary collecting duct. J Clin Invest 91, 1235-1240. Kolla, V., Robertson, N.M., and Litw ack, G. (1999). Identification of a mineralocorticoid/glucocorticoid response element in the human Na/K ATPase alpha1 gene promoter. Biochem Biophys Res Commun 266, 5-14. Kotelevtsev, Y., and Webb, D.J. (2001). Endothe lin as a natriuretic hormone: the case for a paracrine action mediated by nitric oxide. Cardiovasc Res 51, 481-488.

PAGE 213

213 Kurihara, Y., Kurihara, H., Suzuki, H., Kodama, T., Maemura, K., Nagai, R., Oda, H., Kuwaki, T., Cao, W.H., Kamada, N. et al. (1994). Elevated blood pressure and craniofacial abnormalities in mice deficient in endothelin-1. Nature 368, 703-710. Landgraf, R.G., and Jancar, S. (2008). Endothelin A receptor antagonist modulates lymphocyte and eosinophil infiltratio n, hyperreactivity and mucus in murine asthma. Int Immunopharmacol 8, 1748-1753. Lang, F., Capasso, G., Schwab, M., and Waldegger, S. (2005). Renal tubul ar transport and the genetic basis of hypertensive disease. Clin Exp Nephrol 9, 91-99. Lee, M.E., Dhadly, M.S., Temizer, D.H., Clifford, J.A., Yoshizumi, M., and Quertermous, T. (1991a). Regulation of endothelin-1 gene expression by Fos and Jun. J Biol Chem 266, 19034-19039. Lee, M.E., Temizer, D.H., Clifford, J.A., and Quertermous, T. (1991b). Cloning of the GATAbinding protein that regulates endothelin-1 ge ne expression in endot helial cells. J Biol Chem 266, 16188-16192. Lehrke, I., Waldherr, R., Ritz, E., and Wagner, J. (2001). Renal endothelin-1 and endothelin receptor type B expression in glomerular diseases with proteinuria. J Am Soc Nephrol 12 2321-2329. Lemke, C., and Muller, A. (1989). [Erythropoietin--a review]. Folia Haematol Int Mag Klin Morphol Blutforsch 116 715-721. Li, Y., Suino, K., Daugherty, J., and Xu, H.E. (2005). Structural and biochemical mechanisms for the specificity of hormone binding and coactivator assembly by mineralocorticoid receptor. Mol Cell 19, 367-380. Liang, G., Lin, J.C., Wei, V., Yoo, C., Cheng, J.C ., Nguyen, C.T., Weisenberger, D.J., Egger, G., Takai, D., Gonzales, F.A., et al. (2004). Distinct localization of histone H3 acetylation and H3-K4 methylation to the tran scription start sites in the human genome. Proc Natl Acad Sci USA 101, 7357-7362. Liu, W., Wang, J., Sauter, N.K., and Pearce, D. (1995). Steroid recept or heterodimerization demonstrated in vitro and in vivo. Proc Natl Acad Sci USA 92 12480-12484. Livak, K.J., and Schmittgen, T.D. (2001). Analysis of relative gene expression data using realtime quantitative PCR and the 2(-D elta Delta C(T)) Method. Methods 25 402-408. Loffing, J., Pietri, L., Aregger, F ., Bloch-Faure, M., Ziegler, U., Meneton, P., Rossier, B.C., and Kaissling, B. (2000). Differential subcellula r localization of ENaC subunits in mouse kidney in response to highand low-Na diets. Am J Physiol 279, F252-258. Lombes, M., Kenouch, S., Souque, A., Farman, N., and Rafestin-Oblin, M.E. (1994). The mineralocorticoid receptor discriminates aldos terone from glucocorticoids independently of the 11 beta-hydroxysteroid dehydrogenase. Endocrinology 135 834-840.

PAGE 214

214 Luetscher, J.A., Boyers, D.G., Cuthbertson, J. G., and McMahon, D.F. (1973). A model of the human circulation. Regulation by autonomic nerv ous system and renin-angiotensin system, and influence of blood volume on cardiac output and blood pressure. Circ Res 32, Suppl 1:84-98. Luisi, B.F., Xu, W.X., Otwinowski, Z., Freed man, L.P., Yamamoto, K. R., and Sigler, P.B. (1991). Crystallographic analysis of the interaction of the glucocorticoid receptor with DNA. Nature 352, 497-505. Luisi, B.F., Xu, W.X., Otwinowski, Z., Freed man, L.P., Yamamoto, K. R., and Sigler, P.B. (2003). Crystallographic analysis of the interaction of the glucocorticoid receptor with DNA (Research Collaboratory for Structural Bioinformatics Protein Data Bank, www.pdb.org) Madsen, K.M., Verlander, J.W ., and Tisher, C.C. (1988). Relationship between structure and function in distal tubule and colle cting duct. J Electron Microsc Tech 9, 187-208. Manning, J., Beutler, K., Knepper, M.A., and Ve haskari, V.M. (2002). Upregulation of renal BSC1 and TSC in prenatally programmed hypertension. Am J Physiol 283, F202-206. Marsenic, O. (2009). Glucose control by the kidn ey: an emerging target in diabetes. Am J Kidney Dis 53, 875-883. Martinez-Aguayo, A., and Fardella, C. (2009). Ge netics of hypertensive syndrome. Horm Res 71, 253-259. Martinez-Rumayor, A., Richards, A.M., Burnett, J.C., and Januzzi, J.L., Jr. (2008). Biology of the natriuretic peptides. Am J Cardiol 101, 3-8. Masilamani, S., Kim, G.H., Mitchell, C., Wade J.B., and Knepper, M.A. (1999). Aldosteronemediated regulation of ENaC alpha, beta, and gamma subunit proteins in rat kidney. J Clin Invest 104, R19-23. May, A., Puoti, A., Gaeggeler, H.P., Horisberger, J.D., and Rossier, B.C. (1997). Early effect of aldosterone on the rate of synthesis of the epithelial sodium channel alpha subunit in A6 renal cells. J Am Soc Nephrol 8, 1813-1822. McCormick, J.A., Bhalla, V., Pao, A.C., and P earce, D. (2005). SGK1: a rapid aldosteroneinduced regulator of renal sodium r eabsorption. Physiology (Bethesda, Md) 20, 134-139. Mehta, P.K., and Griendling, K.K. (2007). Angi otensin II cell signali ng: physiological and pathological effects in the cardiovascular system. Am J Physiol Cell Physiol 292, C82-97. Meijsing, S.H., Pufall, M.A., So, A.Y., Bates, D.L., Chen, L., and Yamamoto, K.R. (2009). DNA binding site sequence directs glucocorticoid receptor structure and activity. Science 324 407-410.

PAGE 215

215 Meneton, P., Loffing, J., and Wa rnock, D.G. (2004). Sodium a nd potassium handling by the aldosterone-sensitive distal ne phron: the pivotal role of th e distal and connecting tubule. Am J Physiol 287, F593-601. Michigami, T. (2007). Vitamin D me tabolism and action. Clin Calcium 17 1493-1498. Mick, V.E., Itani, O.A., Loftus, R.W., Husted, R. F., Schmidt, T.J., and Thomas, C.P. (2001). The alpha-subunit of the epithelial sodium channel is an al dosterone-induced transcript in mammalian collecting ducts, and this transcripti onal response is mediated via distinct ciselements in the 5'-flanking region of the gene. Mol Endocrinol 15, 575-588. Modesti, P.A., Cecioni, I., Miglio rini, A., Naldoni, A., Costoli, A., Vanni, S., and Serneri, G.G. (1998). Increased renal endothelin formation is associated with sodium retention and increased free water clearance. Am J Physiol 275, H1070-1077. Molenaar, P., O'Reilly, G., Sharkey, A., Kuc, R. E., Harding, D.P., Plumpton, C., Gresham, G.A., and Davenport, A.P. (1993). Characterization and localization of endothelin receptor subtypes in the human atrioventricular conduc ting system and myocardium. Circ Res 72 526-538. Muller, O.G., Parnova, R.G., Centeno, G., Rossier, B.C., Firsov, D., and Horisberger, J.D. (2003). Mineralocorticoid effects in the ki dney: correlation between alphaENaC, GILZ, and Sgk-1 mRNA expression and urinary excr etion of Na+ and K+. J Am Soc Nephrol 14, 1107-1115. Nambi, P., Pullen, M., Wu, H.L., Nuthulaganti P., Elshourbagy, N., and Kumar, C. (1992). Dexamethasone down-regulates the expression of endothelin receptors in vascular smooth muscle cells. J Biol Chem 267, 19555-19559. Nguyen Dinh Cat, A., Ouvrard-Pascaud, A., Tronc he, F., Clemessy, M., Gonzalez-Nunez, D., Farman, N., and Jaisser, F. (2009). Conditional transgenic mice for studying the role of the glucocorticoid receptor in the renal collecting duct. Endocrinol 150, 2202-2210. Nielsen, S., Frokiaer, J., Marples, D., Kwon, T.H., Agre, P., and Knepper, M.A. (2002). Aquaporins in the kidney: from mo lecules to medicine. Physiol Rev 82, 205-244. Nishi, M., Tanaka, M., Matsuda, K., Sunaguchi, M., and Kawata, M. (2004). Visualization of glucocorticoid receptor and mine ralocorticoid receptor interactions in living cells with GFP-based fluorescence resonanc e energy transfer. J Neurosci 24, 4918-4927. Odermatt, A., and Atanasov, A.G. (2009). Minera locorticoid receptors: Emerging complexity and functional diversity. Steroids 74, 163-171. Ohkita, M., Wang, Y., Nguyen, N.D., Tsai, Y.H ., Williams, S.C., Wiseman, R.C., Killen, P.D., Li, S., Yanagisawa, M., and Gariepy, C.E. ( 2005). Extrarenal ETB plays a significant role in controlling cardiovascular responses to high dietary sodium in rats. Hypertension 45 940-946.

PAGE 216

216 Oparil, S., Ehrlich, E.N., and Lindheimer, M.D. (1975). Effect of progesterone on renal sodium handling in man: relation to al dosterone excretion and plasma renin activity. Clin Sci Mol Med 49, 139-147. Ou, X.M., Storring, J.M., Kushwaha, N., and Al bert, P.R. (2001). Heterodimerization of mineralocorticoid and glucocorticoid receptors at a novel negative response element of the 5-HT1A receptor gene. J Biol Chem 276 14299-14307. Pascual-Le Tallec, L., and Lombs, M. (2005) The mineralocorticoid receptor: a journey exploring its diversity and speci ficity of action. Mol Endocrinol 19, 2211-2221. Pascual-Le Tallec, L., Simone, F., Viengchare un, S., Meduri, G., Thirman, M.J., and Lombs, M. (2005). The elongation factor ELL (eleven-nine teen lysine-rich leuk emia) is a selective coregulator for steroid receptor functions. Mol Endocrinol 19 1158-1169. Pedersen, L.G., Offenberg, H., Moesgaard, S.G., Thomsen, P.D., Pedersen, H.D., and Olsen, L.H. (2007). Transcription levels of endotheli n-1 and endothelin receptors are associated with age and leaflet location in porcine mitral valves. J Vet Med A Physiol Pathol Clin Med 54, 113-118. Pollock, D.M., Allcock, G.H., Krishnan, A., Dayton, B.D., and Pollock, J.S. (2000). Upregulation of endothelin B receptors in ki dneys of DOCA-salt hypertensive rats. Am J Physiol 278, F279-286. Pollock, J.S., and Pollock, D.M. (2008). Endot helin and NOS1/nitric oxide signaling and regulation of sodium homeostasi s. Curr Opin Nephrol Hypertens 17, 70-75. Popowski, K., Sperker, B., Kroemer, H.K., John, U., Laule, M., Stangl, K., and Cascorbi, I. (2003). Functional significance of a hereditary adenine insertion varian t in the 5'-UTR of the endothelin-1 gene. Pharmacogenetics 13, 445-451. Portik-Dobos, V., Harris, A.K ., Song, W., Hutchinson, J., Johnson, M.H., Imig, J.D., Pollock, D.M., and Ergul, A. (2006). Endothelin antagon ism prevents early EG FR transactivation but not increased matrix metall oproteinase activity in diabetes Am J Physiol Regul Integr Comp Physiol 290, R435-441. Pravenec, M., and Petretto, E. (2008). Insight into the genetics of hypertension, a core component of the metabo lic syndrome. Curr Opin Clin Nutr Metab Care 11 393-397. Preuss, H.G. (1993). Basics of renal anatomy and physiology. Clin Lab Med 13, 1-11. Provencher, P.H., Saltis, J., and Funder, J.W. (19 95). Glucocorticoids but not mineralocorticoids modulate endothelin-1 and angiot ensin II binding in SHR vasc ular smooth muscle cells. J Steroid Biochem Mol Biol 52, 219-225. Pupilli, C., Brunori, M., Misciglia, N., Selli, C., Ianni, L., Yanagisawa, M., Mannelli, M., and Serio, M. (1994). Presence and distribution of endothelin-1 gene expression in human kidney. Am J Physiol 267, F679-687.

PAGE 217

217 Qiu, C., Samsell, L., and Baylis, C. (1995). Ac tions of endogenous endothelin on glomerular hemodynamics in the rat. Am J Physiol 269, R469-473. Rashid, S., and Lewis, G.F. (2005). The mech anisms of differential glucocorticoid and mineralocorticoid action in the brain and peripheral tissues. Clin Biochem 38 401-409. Rebuffat, A.G., Tam, S., Nawrocki A.R., Baker, M.E., Frey, B.M., Frey, F.J., and Odermatt, A. (2004). The 11-ketosteroid 11-ket odexamethasone is a glucocor ticoid receptor agonist. Mol Cell Endocrinol 214 27-37. Riepe, F.G. (2009). Clinical and molecular f eatures of type 1 pseudohypoaldosteronism. Horm Res 72, 1-9. Rogerson, F.M., and Fuller, P.J. (2000). Mineralocorticoid action. Steroids 65, 61-73. Rogerson, F.M., and Fuller, P.J. (2003). Inter domain interactions in the mineralocorticoid receptor. Mol Cell Endocrinol 200, 45-55. Rogerson, F.M., Yao, Y.Z., Smith, B.J., Dimopoulos, N., and Fuller, P.J. (2003). Determinants of spironolactone binding specificity in th e mineralocorticoid receptor. J Mol Endocrinol 31, 573-582. Romero, D.G., Plonczynski, M.W., Welsh, B.L., Gomez-Sanchez, C.E., Zhou, M.Y., and Gomez-Sanchez, E.P. (2007). Gene expression profile in rat adrenal zona glomerulosa cells stimulated with aldosterone secretagogues. Physiol Genomics 32, 117-127. Ross, M.E., Evinger, M.J., Hyman, S.E., Carroll J.M., Mucke, L., Comb, M., Reis, D.J., Joh, T.H., and Goodman, H.M. (1990). Identificatio n of a functional glucocorticoid response element in the phenylethanolamine N-methyltransferase promoter using fusion genes introduced into chromaffin cells in primary culture. J Neurosci 10, 520-530. Rossier, B.C. (1978). Role of RNA in the action of aldosterone on Na+ transport. J Membr Biol 40 Spec No, 187-197. Russell, F.D., Coppell, A.L., and Davenport, A.P. (1998). In vitro enzymatic processing of radiolabelled big ET-1 in human kidney. Biochem Pharmacol 55, 697-701. Saita, Y., Koizumi, T., Yazawa, H., Morita, T ., Takenaka, T., and Honda, K. (1997). Endothelin receptors and their cellular signal transduction mechanism in human cultured prostatic smooth muscle cells. Br J Pharmacol 121, 687-694. Sakurai, T., Yanagisawa, M., Inoue, A., Ryan, U.S., Kimura, S ., Mitsui, Y., Goto, K., and Masaki, T. (1991). cDNA cloning, sequence anal ysis and tissue di stribution of rat preproendothelin-1 mRNA. Biochem Biophys Res Commun 175, 44-47. Salvetti, A., and Ghiadoni, L. (2006). Thiazide di uretics in the treatment of hypertension: an update. J Am Soc Nephrol 17, S25-29.

PAGE 218

218 Sands, J.M., and Layton, H.E. (2009). The physio logy of urinary concen tration: an update. Semin Nephrol 29, 178-195. Sansom, S.C., Weinman, E.J., and O'Neil, R.G. (1984). Microelect rode assessment of chlorideconductive properties of cortical collecting duct. Am J Physiol 247, F291-302. Savory, J.G., Prfontaine, G.G., Lamprecht, C., Liao, M., Walther, R.F., Lefebvre, Y.A., and Hach, R.J. (2001). Glucocorticoid receptor homodimers and glucocorticoidmineralocorticoid receptor heterodimers fo rm in the cytoplasm through alternative dimerization interfaces. Mol Cell Biol 21, 781-793. Sayegh, R., Auerbach, S.D., Li, X ., Loftus, R.W., Husted, R.F., St okes, J.B., and Thomas, C.P. (1999). Glucocorticoid induction of epithelial sodium channel expression in lung and renal epithelia occurs via trans-activation of a hormone response element in the 5'-flanking region of the human epithelial sodium channel alpha subunit gene. J Biol Chem 274, 12431-12437. Schnermann, J. (1998). Juxtaglomerular cell comple x in the regulation of renal salt excretion. Am J Physiol 274, R263-279. Schug, J. (2003). Using TESS to Predict Transcri ption Factor Binding Sites in DNA Sequence. In Current Protocols in Bioinf ormatics, A.D. Baxevanis, ed. Schulz, E., Ruschitzka, F., Lueders, S., Heydenbl uth, R., Schrader, J., and Muller, G.A. (1995). Effects of endothelin on hemodynamics, pros taglandins, blood co agulation and renal function. Kidney international 47, 795-801. Serneri, G.G., Modesti, P.A., Cecioni, I., Biagin i, D., Migliorini, A., Costoli, A., Colella, A., Naldoni, A., and Paoletti, P. (1995). Plasma endothelin and renal endothelin are two distinct systems involved in volume homeostasis. Am J Physiol 268, H1829-1837. Shankar, S.S., and Brater, D.C. (2003). Loop diuretic s: from the Na-K-2Cl transporter to clinical use. Am J Physiol 284, F11-21. Shen, J.P., and Cotton, C.U. (2003). Epidermal grow th factor inhibits amiloride-sensitive sodium absorption in renal collecting duct cells. Am J Physiol 284, F57-64. Shigaev, A., Asher, C., Latter, H., Garty, H ., and Reuveny, E. (2000). Regulation of sgk by aldosterone and its effects on the epit helial Na(+) channel. Am J Physiol 278, F613-619. Simpson SA, T.J., Wettstein A, Neher R, von Euw J, Reichstein T (1953). Isolierung eines neuen kristallisierten Hormons aus Neben nieren mit besonders hoher Wiksamkeit auf den Mineral-stoffwechsel. Experientia, 333-335. Sledz, C.A., Holko, M., de Veer, M.J., Silverman, R.H., and Williams, B.R. (2003). Activation of the interferon system by shor t-interfering RNAs. Nat Cell Biol 5, 834-839.

PAGE 219

219 Snove, O., Jr., and Holen, T. (2004). Many commonl y used siRNAs risk off-target activity. Biochem Biophys Res Commun 319, 256-263. Soundararajan, R., Zhang, T.T., Wang, J., Vandewalle, A., and Pearce, D. (2005). A novel role for glucocorticoid-induced leucine zipper protei n in epithelial sodi um channel-mediated sodium transport. J Biol Chem 280, 39970-39981. Spat, A., and Hunyady, L. (2004). Control of aldosterone secretion: a model for convergence in cellular signaling pa thways. Physiol Rev 84, 489-539. Spindler, B., Mastroberardino, L., Custer, M., and Verrey, F. (1997). Char acterization of early aldosterone-induced RNAs identified in A6 kidney epithelia. Pflugers Arch 434, 323-331. Starling, E.H. (1899). The glomerular functions of the kidney. J Physiol 24 317-330. Stokes, J.B. (1981). Potassium secretion by cor tical collecting tubule: relation to sodium absorption, luminal sodium concentration, a nd transepithelial voltage. Am J Physiol 241, F395-402. Stow, L.R., Gumz, M.L., Lynch, I.J., Greenlee, M.M., Rudin, A ., Cain, B.D., and Wingo, C.S. (2009). Aldosterone modulates st eroid receptor binding to the endothelin-1 gene (Edn1). J Biol Chem. Strait, K.A., Stricklett, P.K., Kohan, J.L., Miller, M.B., and Kohan, D.E. (2007). Calcium regulation of endothelin-1 synt hesis in rat inner medullary collecting duct. Am J Physiol 293, F601-606. Stricklett, P.K., Hughes, A., and Kohan, D.E. (2006). Endothelin-1 stimulates NO production and inhibits cAMP accumulation in rat inner medullary collecting duct through independent pathways. Am J Physiol 290, F1315-1319. Stricklett, P.K., Nelson, R.D., and Kohan, D.E. ( 1999). The Cre/loxP system and gene targeting in the kidney. Am J Physiol 276, F651-657. Struhl, K. (1999). Fundamentally different lo gic of gene regulati on in eukaryotes and prokaryotes. Cell 98, 1-4. Sutcliffe, A.M., Clarke, D.L., Bradbury, D.A., Corb ett, L.M., Patel, J.A., and Knox, A.J. (2009). Transcriptional regulation of monocyte chemotactic protein1 release by endothelin-1 in human airway smooth muscle cells involve s NF-kappaB and AP-1. Br J Pharmacol 157, 436-450. Thompson, E.B. (1987). The structure of the hum an glucocorticoid receptor and its gene. J Steroid Biochem 27, 105-108. Thomson, S.C., and Blantz, R.C. (2008). Glomerul otubular balance, tubuloglomerular feedback, and salt homeostasis. J Am Soc Nephrol 19, 2272-2275.

PAGE 220

220 Todd-Turla, K.M., Schnermann, J., Fejes-Tth, G ., Naray-Fejes-Tth, A., Smart, A., Killen, P.D., and Briggs, J.P. (1993). Distribution of mineralocorticoid and gluc ocorticoid receptor mRNA along the nephron. Am J Physiol 264, F781-791. Tomita, K., Nonoguchi, H., Terada, Y., and Maru mo, F. (1993). Effects of ET-1 on water and chloride transport in cortical collec ting ducts of the rat. Am J Physiol 264, F690-696. Tostes, R.C., David, F.L., Carvalho, M.H., Nigro, D., Scivoletto, R., and Fortes, Z.B. (2000). Gender differences in vascular reactivity to endothelin-1 in deoxycorticosterone-salt hypertensive rats. J Cardiovasc Pharmacol 36, S99-101. Trapp, T., and Holsboer, F. (1996). Heterodi merization between mineralocorticoid and glucocorticoid receptors increase s the functional dive rsity of corticosteroid action. Trends Pharmacol Sci 17, 145-149. Treiber, F.A., Barbeau, P., Harshf ield, G., Kang, H.S., Pollock, D.M., Pollock, J.S., and Snieder, H. (2003). Endothelin-1 gene Lys198Asn pol ymorphism and blood pressure reactivity. Hypertension 42, 494-499. Truss, M., Candau, R., Chavez, S., and Beato, M. (1995). Transcripti onal control by steroid hormones: the role of chromatin. Ciba Found Symp 191, 7-17; discussion 17-23. Tsai, Y.H., Ohkita, M., and Gariepy, C.E. (2006). Chronic high-sodium diet increases aortic wall endothelin-1 expression in a blood pressure-i ndependent fashion in rats. Exp Biol Med (Maywood) 231 813-817. Turner, J.D., Schote, A.B., Macedo, J.A., Pelascini, L.P., and Muller, C.P. (2006). Tissue specific glucocorticoid receptor expression, a role for alternative first exon usage? Biochem Pharmacol 72, 1529-1537. Ulick, S., Levine, L.S., Gunczler, P., Zanconat o, G., Ramirez, L.C., Rauh, W., Rosler, A., Bradlow, H.L., and New, M.I. (1979). A s yndrome of apparent mineralocorticoid excess associated with defects in the peripheral me tabolism of cortisol. J Clin Endocrinol Metab 49, 757-764. Unwin, R.J., and Capasso, G. (2006). Bartter's and Gitelman's syndromes: their relationship to the actions of loop and thiazide diuretics. Curr Opin Pharmacol 6, 208-213. Vallender, T.W., and Lahn, B.T. (2006). Localized methylation in the key regulator gene endothelin-1 is associated with cell type-spe cific transcriptional silencing. FEBS Lett 580, 4560-4566. Vallon, V. (2003). Tubuloglomerular feedback and th e control of glomerular filtration rate. News Physiol Sci 18 169-174. Vallon, V., and Lang, F. (2005). New insights into the role of serumand glucocorticoidinducible kinase SGK1 in the regulation of renal function and blood pressure. Curr Opin Nephrol Hypertens 14, 59-66.

PAGE 221

221 van der Laan, S., Sarabdjitsingh, R.A., Van Bate nburg, M.F., Lachize, S.B., Li, H., Dijkmans, T.F., Vreugdenhil, E., de Kloet, E.R., and Meijer, O.C. (2008). Chromatin immunoprecipitation scanning iden tifies glucocorticoid receptor binding regions in the proximal promoter of a ubiquitously expresse d glucocorticoid target gene in brain. J Neurochem 106 2515-2523. Vassileva, I., Mountain, C., and Pollock, D.M. ( 2003). Functional role of ETB receptors in the renal medulla. Hypertension 41, 1359-1363. Viengchareun, S., Le Menuet, D., Martinerie, L., Munier, M., Pascual-Le Tallec, L., and Lombs, M. (2007). The mineralocorticoid receptor: insights into its molecular and (patho)physiological biology. Nucl Recept Signal 5, e012. Vogel, V., Backer, A., Heller, J., and Kramer, H. J. (1999). The renal endo thelin system in the Prague hypertensive rat, a new model of spontaneous hypertension. Clin Sci (Lond) 97 91-98. von Bohlen und Halbach, O., and Albrecht, D. (2006). The CNS renin-angiotensin system. Cell Tissue Res 326, 599-616. Walker, W.J., Elkins, J.T., Jr., and Wood, L.W. (1964). Effect of Potassium in Restoring Myocardial Response to a Subthresho ld Cardiac Pacemaker. N Engl J Med 271, 597-601. Walshe, T.E., Ferguson, G., Connell, P., O'Brien, C., and Cahill, P.A. (2005). Pulsatile flow increases the expression of eNOS, ET-1, and prostacyclin in a novel in vi tro coculture model of the retinal vasculature. Invest Ophthalmol Vis Sci 46 375-382. Wang, W.H. (2006). Regulation of ROMK (Kir1.1) channels: new mechanisms and aspects. Am J Physiol 290, F14-19. Whorwood, C.B., Ricketts, M.L., and Stewart, P.M. (1994). Regulation of sodium-potassium adenosine triphosphate subunit gene expr ession by corticosteroids and 11 betahydroxysteroid dehydrogenase activity. Endocrinology 135, 901-910. Williams, L.R., and Leggett, R.W. (1989). Reference values for resting blood flow to organs of man. Clin Phys Physiol Meas 10, 187-217. Wingo, C.S. (1989a). Potassium secretion by the cortical collecting t ubule: effect of C1 gradients and ouabain. Am J Physiol 256, F306-313. Wingo, C.S. (1989b). Reversible ch loride-dependent potassium fl ux across the rabbit cortical collecting tubule. Am J Physiol 256, F697-704. Wolf, S.C., Schultze, M., Risler T., Rieg, T., Lang, F., Schulze-Os thoff, K., and Brehm, B.R. (2006). Stimulation of serumand glucocorti coid-regulated kinase-1 gene expression by endothelin-1. Biochem Pharmacol 71, 1175-1183.

PAGE 222

222 Wong, S., Brennan, F.E., Young, M.J., Fuller, P.J., and Cole, T.J. (2007). A direct effect of aldosterone on endothelin-1 gene expression in vivo. Endocrinology 148, 1511-1517. Wood, K.V., de Wet, J.R., Dewji, N., and DeLu ca, M. (1984). Synthesis of active firefly luciferase by in vitro translation of RNA obtained from adult lanterns. Biochem Biophys Res Commun 124, 592-596. Woods, M., Mitchell, J.A., Wood, E.G., Barker, S ., Walcot, N.R., Rees, G.M., and Warner, T.D. (1999). Endothelin-1 is induced by cytokines in human vascular smooth muscle cells: evidence for intracellular endothelin-converting enzyme. Mol Pharmacol 55, 902-909. Yamashita, K., Discher, D.J., Hu, J., Bishopric N.H., and Webster, K.A. (2001). Molecular regulation of the endothelin-1 gene by hypoxia. Contributions of hypoxi a-inducible factor1, activator protein-1, GATA2, AND p300/CBP. J Biol Chem 276, 12645-12653. Ye, Q., Chen, S., and Gardner, D.G. (2003). Endo thelin Inhibits NPR-A and Stimulates eNOS Gene Expression in Rat IMCD Cells. Hypertension 41, 675-681. Yorikane, R., Sakai, S., Miyauchi, T., Sakurai, T ., Sugishita, Y., and Goto, K. (1993). Increased production of endothelin-1 in th e hypertrophied rat heart due to pressure overload. FEBS Lett 332, 31-34. Zamore, P.D. (2001). RNA interference: listenin g to the sound of silence. Nat Struct Biol 8, 746750. Zeidel, M.L. (1993). Hormonal regulation of inner medullary collecting duct sodium transport. Am J Physiol 265, F159-173. Zeidel, M.L., Brady, H.R., Kone, B.C., Gullans, S.R., and Brenner, B.M. (1989). Endothelin, a peptide inhibitor of Na(+)-K(+ )-ATPase in intact renaltubular epithelial cells. Am J Physiol 257, C1101-1107. Zhang, D., Li, S., Cruz, P., and Kone, B.C. (2009). Sirtuin 1 Functi onally and Physically Interacts with Disruptor of Te lomeric Silencing-1 to Regulat e {alpha}-ENaC Transcription in Collecting Duct. J Biol Chem 284, 20917-20926. Zhang, W., Xia, X., Reisenauer, M.R., Hemenw ay, C.S., and Kone, B.C. (2006). Dot1a-AF9 complex mediates histone H3 Lys-79 hypermethyl ation and repression of ENaCalpha in an aldosterone-sensitive manner. J Biol Chem 281, 18059-18068. Zhang, X., Clark, A.F., and Yorio, T. (2003). Intera ctions of endothelin-1 with dexamethasone in primary cultured human trabecular mesh work cells. Invest Ophthalmol Vis Sci 44, 53015308. Zhou, X., Xia, S.L., and Wingo, C.S. (1998). Chloride transport by the rabbit cortical collecting duct: dependence on H,K-ATPase. J Am Soc Nephrol 9, 2194-2202.

PAGE 223

223 Zoccali, C., Leonardis, D., Parlongo, S., Mallamaci F., and Postorino, M. (1995). Urinary and plasma endothelin 1 in essential hyperte nsion and in hypertension secondary to renoparenchymal disease. Nephrol Dial Transplant 10, 1320-1323.

PAGE 224

224 BIOGRAPHICAL SKETCH Lisa R. Stow was born in Pensacola, Florida in 1983. Lisa left high school in her junior year to attend Em ory University for her first year of undergraduate educat ion. During this year she began work on her first research project de signing mathematical models of random particle movement under the supervision of Dr. George He ntschel in the Department of Physics. The following summer Lisa interned at the Nava l Aerospace Medical Research Laboratory at Pensacola Naval Airstation where she helped to de velop software for a tactile awareness system to prevent disorientation of pilots while flying at high speed s. Lisa finished her undergraduate career at the University of Flor ida. During this time she had th e honor of being apart of Dr. Ben Dunns research laboratory in the Department of Biochemistry and Molecular Biology. Lisa graduated with a Bachelor of Science in integr ative biology from the University of Florida in 2004. After entering the Interdisciplinary Program in Biomedical Sciences at the University of Florida, Lisa joined Dr. Charles Wingos labora tory where she conducted her dissertation work on the Regulation and Function of Aldosterone In duced Endothelin-1. In 2006 the University of Florida Medical Guild presented Lisa with an award for Research Excellence at the annual Department of Medicine Research Competition. The following year Lisa was honored to receive a travel award and an invited oral presentation as the 10th International Meeting on Endothelin in Bergamo, Italy. In 2007 Lisa received a competitiv e American Heart Association Predoctoral Fellowship, which helped to fund th e last two years of her disserta tion project. Lisa is also the founder and President of the Colla boration of Scientists for Critical Research in Biomedicine (CSCRB, Inc). CSCRB, Inc is a not-for-profit orga nization with the mission to support targeted and collaborative research initiatives in areas of medicine that ar e in critical need of funding or greater scientific interest. Si nce January 2009 CSCRB has raised over $20,000 for triple negative breast cancer research.

PAGE 225

225 After graduation, Lisa plans on pursuing a career in science. She also plans to continue her work with CSCRB and eventually start a seed gran t program for triple negative research at the University of Florida. Her life long goals include completing a marathon and founding a collaborative research institute.