<%BANNER%>

Molecular and Morphological Characterization of Rhizoctonia Isolates Collected in Florida and Screening of St. Augustine...

Permanent Link: http://ufdc.ufl.edu/UFE0025120/00001

Material Information

Title: Molecular and Morphological Characterization of Rhizoctonia Isolates Collected in Florida and Screening of St. Augustinegrass Germplasm for Brown Patch and Large Patch Resistance
Physical Description: 1 online resource (98 p.)
Language: english
Creator: Flor, Norma
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: analysis, augustinegrass, brown, characterization, diseases, florida, genotypes, germplasm, grasses, isolates, its, large, level, molecular, morphological, morphotypes, patch, phylogenetic, ploidy, resistance, rhizoctonia, screening, season, solani, st, susceptibility, turf, warm
Plant Pathology -- Dissertations, Academic -- UF
Genre: Plant Pathology thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Fungi in the genus Rhizoctonia make up a complex taxonomical group of plant pathogens. Multinucleate species such as Rhizoctonia solani (Thanatephorus cucumeris), Rhizoctonia zeae, Rhizoctonia oryzae (Waitea circinata var. zeae and var. oryzae), Rhizoctonia circinata (not defined anamorph) and binucleate species such as Rhizoctonia cerealis (Ceratobasidium cerealis) are known for causing major and minor diseases on cool and warm season turfgrasses. Rhizoctonia solani causes brown patch and large patch diseases. Brown patch is a disease of cool season grasses caused by the AG 2-2 III B during summer. Large patch on warm season grasses caused by AG 2-2 LP is the most economically important disease that affects turf quality and development in fall and spring seasons. The present study was focused on describing the isolates present on the University of Florida collection that are associated mainly with warm season grasses. The description was based on the most important morphological features of the fungus and supported by molecular data obtained from amplification of Internal Transcribed Spacer regions, a gene phylogenetically informative. Screening of twenty St. Augustinegrass genotypes also was performed in order to evaluate the possible effect that ploidy level of the plants and morphotypes had on disease response.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Norma Flor.
Thesis: Thesis (M.S.)--University of Florida, 2009.
Local: Adviser: Harmon, Phillip.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0025120:00001

Permanent Link: http://ufdc.ufl.edu/UFE0025120/00001

Material Information

Title: Molecular and Morphological Characterization of Rhizoctonia Isolates Collected in Florida and Screening of St. Augustinegrass Germplasm for Brown Patch and Large Patch Resistance
Physical Description: 1 online resource (98 p.)
Language: english
Creator: Flor, Norma
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: analysis, augustinegrass, brown, characterization, diseases, florida, genotypes, germplasm, grasses, isolates, its, large, level, molecular, morphological, morphotypes, patch, phylogenetic, ploidy, resistance, rhizoctonia, screening, season, solani, st, susceptibility, turf, warm
Plant Pathology -- Dissertations, Academic -- UF
Genre: Plant Pathology thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Fungi in the genus Rhizoctonia make up a complex taxonomical group of plant pathogens. Multinucleate species such as Rhizoctonia solani (Thanatephorus cucumeris), Rhizoctonia zeae, Rhizoctonia oryzae (Waitea circinata var. zeae and var. oryzae), Rhizoctonia circinata (not defined anamorph) and binucleate species such as Rhizoctonia cerealis (Ceratobasidium cerealis) are known for causing major and minor diseases on cool and warm season turfgrasses. Rhizoctonia solani causes brown patch and large patch diseases. Brown patch is a disease of cool season grasses caused by the AG 2-2 III B during summer. Large patch on warm season grasses caused by AG 2-2 LP is the most economically important disease that affects turf quality and development in fall and spring seasons. The present study was focused on describing the isolates present on the University of Florida collection that are associated mainly with warm season grasses. The description was based on the most important morphological features of the fungus and supported by molecular data obtained from amplification of Internal Transcribed Spacer regions, a gene phylogenetically informative. Screening of twenty St. Augustinegrass genotypes also was performed in order to evaluate the possible effect that ploidy level of the plants and morphotypes had on disease response.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Norma Flor.
Thesis: Thesis (M.S.)--University of Florida, 2009.
Local: Adviser: Harmon, Phillip.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0025120:00001


This item has the following downloads:


Full Text

PAGE 1

MOLECULAR AND MORP HOLOGICAL CHARACTERIZATION OF Rhizoctonia ISOLATES COLLECTED IN FLORIDA AND SCREENING OF ST. AUGUSTINEGRASS GERMPLASM FOR BROWN PATCH AND LARGE PATCH RESISTANCE By NORMA CRISTINA FLOR A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2009

PAGE 2

2009 Norma Cristina Flor

PAGE 3

To Isabella and Natalia, my two little plant pathologists, and the best things ever happened to my life, with all my love for you To my parents, Ca rlos and Nelly, for their love, inconditional support and guidance throughout this proce ss and in every day of my life To my sister Marta, for bringing love and happine ss to my life and to the world To m y husband Juan Carlos, for his love, support, patience and encouragement To my family and all my friends To my God To that beautiful place of the world called Colombia

PAGE 4

ACKNOWLEDGMENTS I nfinite and sincere acknowledgments to the members of my committee, Dr. Lawrence E. Datnoff, Dr. Phili p Harmon and Dr. Richard Raid, f or their patience, support and guidance. For their valuable suggestions and corrections to the document and for making me learn with the best attitude and in the best possible way. I have special gratitude to Dr. Lawrence Datnoff, who gave me the oppo rtunity of pursue my degree at University of Florida and for being not only a good advisor, also a counselor. Special acknowledgment to Dr. Philip Harm on, who took the rudder of the ship, when Dr. D atnoff changed his route toward Louisiana University. I am very thankful to Dr. Russell Nagata, for his help, comments and support during the elaboration of the project and especially on t he screening germplasm chapter. I would also like to thank Robert Cating for his opportune and accurate help on the molecular chapter ; ChengHua Huang, for his important contribution and support on the phylogenetic analysis ; Brenda Rutherford and Patt y Hill for their important training, suggestions and contributions on the laboratory part ; and Eldon Philman and Herman Brown, f or all thei r help in the greenhouse tasks. Adriana Espinosa became my first friend in Gainesville. She was a great support during the beginning, and has been a special friend during all these years. I fall short of words to t hank her fo r everything she has done for me Catalina Torres is a nother special friend that I met on th is pathway. Thank you s o much for being close to me, for your advices and your company, even thro ugh the distance. I would also like to acknowledge all my friends and classmates, who in different ways, helped me during the course of my study.

PAGE 5

All this would not have been possible without some wonderful family support. Special acknowledgments to my parents Carlos an d Nelly, for encouraging and helping me out They stayed in close touch with me and thus were a lot of support. I thank my sister Marta, f or her friendshi p, love and camaraderie I thank my loving husband Juan C arlos, for his patienc e, love and company, f or making me laugh and even for making me cry (sometimes) And my acknowledgements cannot be complete without my two loving daughters Isabella and Natalia, who have been living this process even before they were born I really hope that these efforts bring to them a brighter future, and happiness to come in every day of their lives. I woul d like also to thank the faculty of the Plant Pathology Department at the Uni versity of Florida, especially Gail Harris, Lauretta Rahmes, Donna Per ry, Dr. Jeffrey Jones, Dr. Raghavan Charuddatan, Carrie L. Harmon and Dr. Jane Polston, for their strong support, encouragement and assistance at any time during these years without whom this thesis would have never seen the light of the day.

PAGE 6

TABLE OF CONTENTS page ACKNOWLEDGMENTS ...............................................................................................................4 LIST OF TABLES ...........................................................................................................................9 LIST OF FIGURES .......................................................................................................................11 ABSTRACT ...................................................................................................................................12 CHAPTER 1 LITERATURE REVIEW .......................................................................................................13 Rhizoct onia spp .......................................................................................................................13 Morphology .....................................................................................................................13 Taxonomic Classification ................................................................................................14 Hyphal Anastomosis ........................................................................................................15 Epidemiology and Disease Cycle ....................................................................................16 Genetics of Infection .......................................................................................................17 Population Biology and Genetic Diversity ......................................................................17 rDNA Sequence Analysis Using Internal Transcribed Spacer (ITS) Sequences ...................18 St. Augustinegrass ..................................................................................................................18 Uses and Economic Importance ......................................................................................19 History of Breeding and Population Improvement .........................................................19 Genetics, Breeding and Selection Techniques ................................................................19 Varietal Resistance ..........................................................................................................20 Brown and Large Patch Diseases ...........................................................................................21 Brown Patch ....................................................................................................................21 Large Patch ......................................................................................................................22 Horticultural Management Practices for La rge Patch and Brown Patch Diseases .................22 General Recommendations ..............................................................................................22 Control for Brown Patch ..........................................................................................23 Control for Large Patch ............................................................................................23 2 SCREENING ST. AUGUSTINEGRASS GERMPLASM FOR BROWN PATCH AND LARGE PATCH RESISTANCE ............................................................................................24 Introduction .............................................................................................................................24 Materials and Methods ...........................................................................................................25 Plant Material ..................................................................................................................25 Fungal Isolates .................................................................................................................26 Inoculation Experiments ..................................................................................................26 Statistical Analysis ..........................................................................................................27

PAGE 7

Results .....................................................................................................................................28 Brown Patch Susceptibility .............................................................................................28 Final disease severity ...............................................................................................28 Apparent infection rate .............................................................................................29 Area under disease progress curve ...........................................................................29 Effect of ploidy level and morphotypes on disease response variables ...................29 Large Patch Susceptibility ...............................................................................................29 Final disease severity ...............................................................................................30 Apparent infection rate .............................................................................................30 Area under disease progress curve ...........................................................................30 Effect of ploidy level and morphotype on disease response variables .....................30 Discussion ...............................................................................................................................31 Screening for Brown Patch Disease ................................................................................31 Screening for Large Patch Disease ..................................................................................32 Comparison of St. Augustinegrass Reaction for Brown Patch and Large Patch Isolates .........................................................................................................................33 3 PHYLOGENETIC ANALYSIS OF RHIZOCTONIA ISOLATES COLLECTED FROM TURFGRASSES IN FLORIDA .............................................................................................49 Introduction .............................................................................................................................49 Materials and Methods ...........................................................................................................50 Fungal Isolates Collection ...............................................................................................50 Sequence Data from GenBank ........................................................................................51 Genomic DNA Extraction ...............................................................................................51 Polymerase Chain Reaction Amplifications and Primer Sets Used ................................51 Bacterial Cloning of Amplicons ......................................................................................52 Sequencing ......................................................................................................................53 Sequence Alignment, Molecular and Phylogene tic Analyses .........................................53 Results .....................................................................................................................................54 Discussion ...............................................................................................................................55 4 MORPHOLOGICAL CHARACTERIZATION OF Rhizoctonia ISOLATES FROM TURFGRASSES AND OTHER HOSTS IN FLORIDA .......................................................67 Introduction .............................................................................................................................67 Materials and Methods ...........................................................................................................68 Fungal Isolates Collection ...............................................................................................68 Cultural Morphology .......................................................................................................68 Nuclear Condition ...........................................................................................................69 Mycelia Growth Rate ......................................................................................................69 Results .....................................................................................................................................70 Morphological Characterization ......................................................................................70 Mycelial Growth Rate .....................................................................................................71 Nuclear Condition ...........................................................................................................71 Discussion ...............................................................................................................................71

PAGE 8

5 SUMMARY AND CONCLUSIONS .....................................................................................82 APPENDIX A SAS PROC MIXED CODE TO ANALYZ E INTRINSEC RATE OF GROWTH ...............86 B SAS PROC CONTRAST TO ANALYZE THE EFFECT OF PLOIDY AND MORPHOTYPES OVER DISEASE RESPONSE .................................................................87 REFERENCES ..............................................................................................................................88 BIOGRAPHICAL SKETCH .........................................................................................................98

PAGE 9

LIST OF TABLES Table page 21 Morphotypes and ploidy level of St Augustinegrass germplasm. ....................................35 22 AUDPC, apparent infection rate, and final severity of St. Augustinegrass genotypes inoculated with the brown patch isolate. Means represent combined data from three experi ments. .......................................................................................................................36 23 T test results of comparisons between final disease severity of St. Augustinegrass genoytpes inoculated with the brown patch isolate of R. solani .......................................37 24 T test results of comparisons between apparent infection rates calculated fo r St. Augustinegrass genotypes inoculated with the brown patch isolate of R. solani .............38 25 T test results of comparisons between area under disease progress curves calculated for St. Augustinegrass genotypes inoculated with the brown patch isolate of R. solani .................................................................................................................................39 26 Effects of ploidy level and morphotype on disease response variables for brown patch disease experiments. .................................................................................................40 27 AUDPC, apparent infection rate and final severity of St Augustinegrass genotypes inoculated with large patch isolate. Means represent combined data from two experiments. .......................................................................................................................41 28 T test results of comparisons between final disease sverity of St. Augustinegrass genotypes inoculated with the large patch isolate of R. solani .........................................42 29 T test results of comparisons between apparent infection rates calculated for St. Augustinegrass genotypes inoculated with the large patch isolate of R. solani ...............43 210 T test results of comparisons between area under disease progress curves calculated for St. Augustinegrass genotypes inoculat ed with the large patch isolate of R. solani ....44 211 Effects of ploidy level and morphotype on disease response variables for large patch disease experiments. ..........................................................................................................45 31 Fungal isolates used in this study for phylogenetic analysis .............................................60 32 Sequences obtained from the GenBank used in this study for phylogenetic analysis .......62 33 Nucleotide sequence, cycle profile, and PCR reaction mix for amplification of AG 22LP, IIIB, and IV and ITS primers. ...................................................................................63 41 Morphological features of Rhizoctonia spp. ......................................................................79

PAGE 10

42 Sclerotial features of Rhizoctonia spp. ...............................................................................80 43. Mycelial growth rate of Rhizoctonia spp at different temperatures. ......................................81

PAGE 11

LIST OF FIGURES Figure page 21 Brown patch disease on genotype FX 313 six days after inoculation ...............................46 22 Brown patch symptoms on the genotype Delmar six days after inoculation .....................47 23 Large patch symptoms .......................................................................................................48 31 Fifty percent majority rule consensus tree from Bayesian inference analysis of rDNA ITS gen sequences ..............................................................................................................65 32 Phylogenetic tree of rDNA ITS gen sequence from Max imum Parsimony analysis ........66 41 Colony features of Rhizoctonia isolates .............................................................................75 42 Colony features of Rhizoctonia isolates .............................................................................76 43 Different classes of sclerotia of Rhizoctoni a species .........................................................77 44 Nuclear condition of Rhizoctonia species ..........................................................................78

PAGE 12

Abstract of T hesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requ irements for th e Degree of Master in Science MOLECULAR AND MORPHOLOGICAL CHARACTERIZATION OF Rhizoctonia ISOLATES COLLECTED IN FLORIDA AND SCREENING OF ST. AUGUSTINEGRASS GERMPLASM FOR BROWN PATCH AND LARGE PATCH RESISTANCE By Norma Cristina Flor August 2009 Chair: Philip Harmon Major: Plant Pathology Fungi in the genus Rhizoctonia make up a complex taxonomical group of plant pathogens Multinucleate species such as Rhizoctonia solani ( Thanatephorus cucumeris), Rhizoctonia zeae Rhizoctonia oryzae ( Wait ea circinata var. zeae and var. oryzae), Rhizoctonia circinata (not defined anamorph) and binucleate species such as Rhizoctonia cerealis ( Ceratobasidium cerealis) are known for causing major and minor diseases on cool and warm season turfgrasses. Rhizoctonia solani causes brown patch and large patch diseases. Brown patch is a disease of cool season grasses caused by the AG 2 2 III B during summer. Large patch on warm season grasses caused by AG 2 2 LP is the most economically important disease that affect s turf quali ty and development in fall and spring seasons. The present study was focused on describing the isolates present on the University of Florida collection that are associated mainly with warm season grasses. The description was based on the most im portant morphological features of the fungus and supported by molecular data obtained from amplification of Internal Transcribed Spacer regions, a gene phylogenetically informative. Screening of twenty St. Augustinegrass genotypes also was performed in or der to evaluate the possible effect that ploidy level of the plants and morphotypes had on disease response.

PAGE 13

CHAPTER 1 LITERATURE REVIEW Rhizoctonia spp Fungi in the genus Rhizoctonia make up a complex taxonomical group of plant pathogens. In the turfgr ass literature four anamorph species of Rhizoctonia are widely recognized: Rhizoctonia solani Rhizoctonia zeae Rhizoctonia oryzae, and Rhizoctonia cerealis (27, 101, 110, 111, 113). With the discovery and naming of the teleomorphs for these anamorphic f ungi, recent taxonomic revisions and reorganizations are still ongoing and have yet to be widely accepted in some circles including tur fgrass pathologists. For this reason, nomenclature is seldom consistent and can be difficult to follow. Members of this genus have been found to be plant pathogens of many crops The most widely studied species is R hizoctonia solani, which is the most pathogenic and polyphagous species worldwide It also has been reported as a saprophyte and having mycorrhizal behavior on orchids (101). It causes diseases on more than 200 species of plants, including corn, cotton, forest trees, fruits, ornamentals, potato, rice, soybeans, turfgrasses and wheat and shows extensive variation in characteristics such as geographical location morphology, host spe cificity, pathogenicity (38, 108) and types of diseas e symptoms (97). The extent of this variation has been considered as evidence that this fungus is a species complex (35, 38 ). Morphology The species concept for R hizoctoni a solani enhanced by Ogoshi 1975 and currently used, stipulates that isolates of R solani possess the following characteristics: a) branching near the distal septum of cells in young vegetative hyphae, b) constriction of hyphae and formation of septa a short distance from the point of origin of hyphal branches, c) presence of dolipore septa

PAGE 14

and d) absence of clamp connections with conidia, rhizomorphs and sclerotia differentiated into rind and medulla (101). Isolates of Rhizoctonia spp produce simple or branched chains of cells called moniliod cells. These cells may be hyaline or brown and vary in shape ( lobate, pyriform, irregular or barrelshaped). T hey arise as buds or blownout ends of pre existing cells. Chains of moniliod cells are formed on or above the sur face of a host or a substrate, but also within host tissue. They may be few and scattered or form loose to semi compact masses varying in sizes, or they may be aggregated to form sclerotia Sclerotia are considered resting or dispersal structures. Color, s hape, size and location on culture media are often features to identify species in a wide sense. Sclerotial color of R solani ranges between different shades of brown. Those of R hizoctonia zeae are reddish, small, regular and ball shaped, while those of R oryzae are salmon colored and irregular ( 101 ). Isolates of Rhizoctonia spp may sporulate when exposed to specific environmental conditions but sporulation is not commonly observed in nature or the lab. Short hyphal cells branch frequently and produce dense interwoven mats on which basidia are formed. Basidiospores (4) are spherical, oval or pyriform (101). The teleomorphs of the Rhizoctonia spp. include: Ceratobasidium cereal is (anamorph is Rhizoctonia cerealis ), Waitea circinata (anamorphs include R. zeae R. oryzae and R. circinata ) and Thanatephorus cucumeris (anamorph is R. solani ). Taxonomic C lassification Rhizoctonia has been placed within division Amastigota, subdivision Basidiomycotina class Basidiomycetes, order Tulasnellales, subclass: Holob asidiomycetidae III Hymenomycetes III (2, 3, 101 ).

PAGE 15

The classic taxonomical scheme divides species into groups ba sed on nuclear condition: multi nucleate (MNR), bi nucleate (BNR) and uni nucleate (UNR) and has been essentially based on hyphal fusion (ve get ati ve incompatibility) (98 ). Thus, species are either binucleate ( R. cerealis) or multinucleate (R. solani, R. oryzae, and R. zeae ). The number of nuclei in multinucleate species may vary from 3 to 28 in young cells ( 101 ). The first helpful scheme to classify isolates was the anastomosis reaction, which groups isolates in to different Anastomosis Groups (AGs) Ba sically, isolates that form i n AG have the ability of fusing their hyphae in a perfect reaction, showing a high level of cell compatibility, during this process, an exchange of cytoplasmatic content and nuclei may occur. Authors cite Matsumoto et al., 1932 and/or Schultz ,H., 1937 as the pioneers of this scheme of classification. In the United States, Parmeter, J.R, et al., 1969 was the first resear cher to apply this concept to Thanatephorus cucumeris This reaction is stil l used to classify some isolates. In recent years, AGs were also genetically supported by the use of DNA DNA hybridization ( 98, 99) Hyphal Anastomosis Four different types of anastomosis are described: C0 (no reaction= incompatibility), C1(contact fusion), C2 (killing reaction= somatic fusion) and C3 (perfect fusion). AG are determined when a C3 reaction is observed between a pair of isolates. Commonly, isolates that share an AG, also have similar morphology and pathogenicity profiles, as well as similar physiological, serological and ecological features or respons es. However, recent studies also have shown considerable vari ability within and between AGs. Some have proposed they are different evolutionary units and even dis tinct species. Moreover, t his reaction has been considered i nsufficient for accurate identification and classification of the isolates because some isolates lose the capability to self anastomose, some will no t anastomose with all isolates of the same AG and some anastomose with isolates of more than one AG (99). M echanisms and

PAGE 16

biological relevance of this reaction are still not completely understood. Cubeta and Vilgalys ( 1997) suggest ed the presence of a heter othallic mating system that may also undergo recombination through heterokaryonhomokaryon mating under artificial condition s. Interesting ly further studies have shown that AGs have levels of host specificity. Currently f ourteen different AG s of R sol ani are recognized (AG 1 to AG 13 and AG BI) including isolates from many crops. Seven AG s (AG1, AG 2, AG 3, AG 4, AG 6, AG 8 and AG 9) have been further divided into subgroups to reflect differences observed in frequency of anastomosis, fatty acid and i sozyme patterns, pathogenicity, thiamine requirement and cultural appearance among isolates ( 36, 80, 108) The term intraspecific group (ISG), introduced initially by Ogoshi (1987) was late r defined in 1992 and 1993 by Liu and Sinclair to describe the mol ecular variability present in AG 2. Therefore, AG 2 1, AG 22 IIIB (rush type), AG 2 2 IV (sugar be e t root rot type), AG 2 2 LP (warm seasons turfgrasses), AG 2 E and AG 2 F were recognized also as AG 2 subsets. AG 2 1 was further been divided intoAG2t and AGNt ( 47, 54, 59, 101). Epidemiology and D isease Cycle Rhizoctonia spp can survive unfavorable environmental conditions over seasons on plant debris thatch or in soil in the form of m yce lia or sclerotia (58 ). Most Rhizoctonia diseases are initiated b y mycelium and/or sclerotia; however, several important diseases of beans, sugar beet and tobacco resu lt from bas idiospore infection (77 ). Basidiospores also serve as a source for rapid and long distance dispersal of the fungus (77). When the right conditions are present, spore s germinate producing hyphae that when come into c ontact with healthy host plant tissue produce s a structure known as an infection cushion ( 6, 77). Lobate appresoria may be formed to penetrate after which the fungus produces penetrat ion hyphae. New mycelia and sclerotia can continue the infection process in healthy tissue or rest until more tissue is available, or until

PAGE 17

conduc ive environmental conditions return. The pathogen also can enter into the plant through wounds a nd stomata and even colonize dead tissue ( 2, 58, 67, 77). Genetics of Infection Chemical stimulants released by actively growing plant cells and/or decomposing plant residues attract the fungus, which initiates the infection process by the production of many different extracellular enzymes that degrade cellulose, cutin, pectin and o ther s components of plant cell s walls It has been hypothesized that each AG has a distinct process of infection. H factor, consists of a single gene with multiple alleles and may be is the o utbreeding mechanism that AG 1 and A G 4 share (6 ). On suscep tible sugar beet cultivars, the infection progressed to the periderm or outer secondary cortex in roots, while in resistant cultivars, the fungus is only able to produce hyphae and infection cushi ons with penetration pegs (6, 77). Certain preexisting structural plant defenses like the amount and quality of wax and cuticle that cover the epidermal cells, the structure of epidermal cell walls, the size, location, and shapes of stomata and lenticels, as well as t he presence of thick walled cells (2 ), may have a role in resistance to Rhizoctoni a spp. Population Biology and Gen etic D iversity Several molecular techniques have been used to accurately identify isolates of Rhizoctonia spp. and to investigat e the genetic variation within and between the AGs and to support the identification of additional subgroups. The various molecular methods used include : isozyme anal ysis, total cellular fatty acid analysis, electrophoretic karyotyping, DNA DNA hybridizat ion, DNA fingerprinting based on random amplified polymorphic DNA (RAPD), amplified fragment length polymorphism (AFLP), repetitive probe, AT rich DNA restriction fragment length polymorphism (RFLP), single copy nuclear RFLP, rDNA sequence analys is the use of microsatellite, inter simple sequence repeats (ISSR) and the use of universal rice pri mers

PAGE 18

(URPs) Unique zymogram pattern groups are also a good system to identify MNR AGs and subgr oups within each AG (97, 98). However, ea ch of these methods have ad vant ages and disadvantages when studying Rhizoctonia populations. Hyphal anastomosis reaction can sometimes be subjecti ve and difficult to interpretate. S equence analysis of ribosomal DNA genes and ITS sequences has beco me useful, objective and informative technique to make phylogenetics studies in this fungus. rDNA Sequence Analysis U sing Internal Transcribed Spacer (ITS) Sequences In most fungi, three rRNA genes (28, 5.8 and 18 s rDNA) are present as repeated units separated by nontranscribed spacers wit h different evolutionary rates (98 ). The 5.8s rDNA gen e is flanked by the internal transcribed spacer regions (ITS1 and ITS 2). These two regions have been very useful for evaluating phylogenetic and taxonomic relationships (15 ). ITS regions have been parti cularly useful for identifying genetic groups at the spec ies level because of their higher rate of molecular evolution and proximity to highly conserved rDNA regions ( 35). Among the various molecular classification methods used for Rhizoctonia spp., the rDNAITS sequence analysis seems to offer the most accurate way for establishing taxonomic and phylogenetic relationships behind previousl y identified AGs (53, 98). St. Augustinegrass St. Augustinegrass, Stenotaphrum secundatum (Walter) Kuntze is a stol oniferous and perennial species that belongs to the Class: Monocotyledons, Subclass: Commelinidae, Order: Cyperales and Family: Poaceae. A dense turf is formed when regularly mowed or grazed. It is propagated vegetatively using well rooted sprigs, broadcas ting stolons, plugs an d sod (23, 70). Efforts to develop seeded cultivars have not been successful (23 ). It is native to some countries in Africa, Central America, Mexico, North America South America and the Caribbean (23).

PAGE 19

St. Augustinegrass grows on infertile to moderately fertile soils as well as a wide range of well or poorly drained soils, from s andy loams to light clays This grass has good soil salinity tolerance but moderate drought and shade tolerance. It can tolerate extreme shade and responds well to N fertilization (70 ). The species is commonly found in the humid tropics (rainfall from 1,000 2000 mm /yr ) and subtropics and grows best between about 200C and 300C ( 23 ). Uses and E conomic I mportance St. Augustinegrass mostly occurs in natural swa rds or is planted as turf grass and plays a role as a pasture or as a soil conservation groundcover under trees or near the sea where salt spray may damage other grasses. St. Augustinegrass is commonly used in homelawns, parks, roads and recreation sports fields. In addition, Cook, B.G and his colleagues ( 2005) reported its palatability for smal l and large ruminants. Yields on the order of 5 t/ha/yr of dry matter have been reported when use d in animal production, in humidtropical locations (23 ) History of Breeding and Population Improvement C ommercial and organized breeding development of St. Augustinegrass has been limited because it is primarily a clonal grass, n ot used on gol f courses, which limits the potential market ( 21). Breeding e fforts by public s cientists have involved discovery of clonal types such as Floratine and Raleigh and the discovery of seedlings of partially unknown pedigree, for example Floratam and Floralawn. Before the UF breeding program was assigned to Dr. Ru s sell Nagata (U F Belle Glade), only large scale population improvement was done (f rom 19771996) (21 ). Since that time two varieties, Captiva and FloraVerde have been released, displaying slow leaf extension and superior shade tolerance ( 75, 76). Ge netics, Breeding and Selection Techniques Stenotaphrum secundatum evolved as a fertile diploid from S dimidiatum There are two distinct variants; a sterile, triploid origi nating at the Cape of Good Hope that produce s little seed

PAGE 20

and a fertile diploid variant em anating fr om the Natal region of South Africa. M utation i n the triploids is common, hence considerable diversity T etraplo id types are completel y sterile (23, 70) Most cultivars are diploids (2n = 18) and are subdivided into the Breviflorus and the Longicaudatus Ra ces. Plants with elongate d leaves and stolons are classified into the Longicaudatus category, a lso named l ongstemmed (13 ) and those wi th dwarf or short habit growth ( narrow and short leaf blades and highly branching pattern) belong to the Breviflorus c ategory, also named short flowered (13, 21). Polyploids identified in 1961, came from sterile triploids (2n=27) with irregular meiosis (21 ) Adaptive and morphological variations are associated with chromosome differences; d iploids cultivars have narrowe r, thinner, more translucent, brighte r green leaf blades while polyploids have coarser, thicker leaf blades which are more opaque and darker green color (13 ). St. Augustinegrass is easy to hybridi ze artificially (13 ). Seed is set and easily produced withi n ploidy levels; however, crosses between different ploidy levels have not been successful (Busey 1982,Cook 2005) High rates of somatic mutations with adequate survival can be induced in sprigs using gam ma rays (30004500 rads) T he biggest challenge in breeding this crop is its perennial condition and longterm field evaluation ( 12, 23). Varietal Resistance Host plant resistance has potential for managing diseases caused by R solani but there are few reports on St. Augustinegrass genotypes with regard to their resistance to brown patch and large patch diseases. Host resistance could help reduce the cost of producing and maintaining lawns as well as provide a more environmentally friendly method of controlling the disease (58 ). Use of host plant resista nce has been complicated by discrepancies between laboratory disease ratings and greenhouses observations for St. Augusti negrass selections when challenged inoculated by R. solani ( 46).

PAGE 21

Liddell, D. E., et al, 2001, indicated that no r esistance response in 15 St. Augustinegrass lines tested. However, Capti va and Texas Common seemed consistent ly susceptible, while Rosalawn and Floralawn seemed more resistant to BP. Brown and Large Patch Diseases Rhizoctonia diseases of turf grasses were first recorded in th e United States more than 80 years ago (Piper and Coe 1919). There are two Rhizoctonia related diseases of major importance: brown patch and large patch In general, brown patch is caused by isolates of A G 2, subgroup 2, strain IIIB (AG 2 2 IIIB) on cool s eason grasses. Large patch disease (LP) is caused by isolates of A G 2, subgroup 2, strain Large Patch (AG 22 LP) on warm season grasses. Awareness of the distinctions between the two diseases is important because there are major differences in their occur rence and in effective means of control ( 7, 16, 50). Isolates of AG 1 have also been found causing diseases as well on cool season turfgrasses (100). S t. Augustinegrass, zoysiagrass and centipedegrass are most susceptible to this disease; common and hybrid bermudagrasses are rarely damaged (41). Brown Patch B rown patch is mainly a foliar disease that blights the blades of all cool seaso n turfgrass species ( 50, 55, 100 ). The disease most often occurs in summer, during hot humid weather when surface moisture and humidity are high and night temperatures are above 16200C ( 7, 55, 100 119). Infection is triggered by rainfall, excessive irrigation, or extended periods of leaf wetnesss on the leaf canopy ( 48 hours or more) (30 ). BP may start in any region of a la wn, but initial foci are located away from lawn borders (58). Damaged turf usually recovers when conditions no longer favor the spread of the disease (41). If light infections of BP occur the affected turf generally recovers in 2 or 3 weeks. The disease m ay be spread longer distances by mycelium clinging to wet lawn m ow er wheels (58 ). The type IIIB strain also affects warm season grasses

PAGE 22

like bahiagrass, bermudagrass, centipedegrass, St. Augustinegrass and zoysiagrass and is also known to cause sheath blig ht of rice dampingoff and crown and root rot on a variety of other hosts ( 7, 41 ). Large Patch Rhizoctonia large patch (LP) is the most signif icant infectious disease of zoysiagrass species ( Zoysia japonica ) LP can appear as very large patches, sometimes exceeding 6 to 8 feet (1.82.4 meters) in diameter with a yellow margin (50). I deal environmental conditions for infection exist mostly from fall to spring in the United States when temperatures range from 77 F (250 C) to 83 F (280 C) within the turfgra ss canop y (50). Isolates from AG 2 2 LP can be recovered from sheath tissues, thatch, and rhizosphere soil, regardless of whether the disease occurred or not and from the crowns of host plants, where it ov erwinters (7 ). Horticultural M anagement Practices f or Large Patch and Brown Patch Diseases General Recommendations Management recommendations include d red ucing thatch, limiting dew duration, and improving draina ge, mowing, fertilization and irrigation pra ctices Fertility may also play a role. Lowering Nit rogen fertilizer and the use of a slow release N it rogen source s as well as maintaining Phosphorus and Potassium fertility levels according to soils test recommendations are helpful prac tices to reduce the risk of these diseases. ( 30, 41, 58). Periodic mech anical dethatching or core aerification of turf is helpful in preventing thatch buildup that may harbor the fungus when conditions are conducive to disease ( 41, 58). Since moisture plays such an important role in disease development, irrigation practices t hat minimize foliar wetness and promote good drainage are also recommended (41).

PAGE 23

Control for Brown Patch Applications of fungicides are recommended once the first symptoms appear and weather conditions favor the spread of diseas e. Fungicidal sprays should continue until the turf starts to recover and/or until weather conditions no longer f avor disease development (41) F ungicides containing myclobutanil propiconazole thiophanate methyl and triadimefon are recommended for disease control (30). Azoxystrobi n, flutolanil Iprodione mancozeb pyrasclostrobin thiophanate methyl trifloxystrobin and vinclozolin are effective as preventive applications for management of brown patch (30). Control for Large Patch Prevention is the best management strategy to con trol the disease; but when fungicides sprays are needed. Strobilurins and Flutolanil provide exceptional control; however, timing of applying fungicides is critical for optimum levels of diseas e control (85).

PAGE 24

CHAPTER 2 SCREENING ST. AUGUST INEGRASS GERMPLASM FOR BROWN PATCH AND LARGE PATCH RESISTANCE I ntroduction St. Augustinegrass ( Stenotaphrum secundatum Walt. Kuntze) is the most popular lawn grass in Florida. The popularity of St. Augustinegrass (SAG) is due to its many favorable characteristics. Its ha s good performance on infertile soils, in soils with poor drainage and/or with high salinity conditions, it is moderately drought and shade tolerant and requires low conditions of maintaince. Approximately 1.5 million acres of SAG are managed in Floridas commercial and residential landscapes (120). Large patch (LP) disease caused by the fungus Rhizoctonia solani anastomosis group (AG) 22 LP is the most important fungal disease of SAG. Brown patch (BP) is an important disease that primarily affects cool season grasses such as creeping bentgrass and is caused by the same anastamosis group AG 22, but different strain III B (AG 2 2 IIIB). Brown patch occasionally affects SAG and other warm season grasses but is rarely damaging enoug h to be of management concern. However, given favorable conditions for disease, LP and BP can both result in major turfgrass losses. BP and LP typically occur at different times of the year, produce distinct symptoms, require very different control strategies, and primarily affec t differe nt tur fgrasses species (115 ). The diseases can be managed through adjustments in cultur al practices, fungicides sprays, or a combination of both. The use of resistant cultivars may reduce the reliance on pesticides and would be more environmentall y friendly, although no commercially available cultivars are completely resistant to these diseases. T here are few reports addressing the resistance of St.Augustinegrass genotypes to LP. Assessments of resistance to BP in tall fescue ( Festuca arundinaceae ) have been conducted

PAGE 25

using area under disease progress curves (AUDPC) to show differences in susceptibility between cul tivars (39 ). Observations of turfgrass managers and researchers suggest that differences in susceptibility of SAG cultivars exist in the wide variety of cultivars that were principally developed for improved turf quality. Preliminary studies conducted by Datnoff, et al (2005) suggested a possible ploidy effect on LP resistance (L. Datnoff, personal communication). Ploidy level varies bet ween SAG cultivars. Most cultivars are diploid (2X=18), but some are triploid (3X=27) and polyploid (3X=32) as well ( 12, 14) Ploidy level has been shown to play an important role in disease resistance in oth er crops, including red clover ( Trifolium prete nse L.) hybrids Musa spp, and bentgrass ( Agrostis spp) ( 22, 24, 81). The objective of this study was to evaluate 20 different cultivars of St. Augustinegrass with various ploidy levels and morphological characteristics for their reaction to isolates of R. solani that cause BP and LP using three quantitative measurements of disease (final severity, AUDPC, and intrinsic rate of infection development ). Materials and Methods Plant M aterial P loidy level, morphotype ( semi dwarf dwarf or long and genotypes names of St. Augustinegrass selections used for this research are given in table 2.1. Forty three day old plant s were received in 3growing trays (Growing, Systems, Inc, WS, USA) from Dr Russell Nagata,UF Everglades Research and Education C enter (EREC). Plant s were repot ed into 4 diameter plastic pots (KORD products, Toronto, Ontario, Canada) using approximately 92 g of Professional 4P potting mix (Fafard company, Agawam MA, USA) and grown in the greenhouse for approximately 80 d or until plants began to fil l the pots. Temperatures in the air conditioned greenhouse ranged between 23 and 28C. Plants were watered by drip irrigation, and pots sat in trays that held water. Watering was done twice a week or as needed. Plants were

PAGE 26

fe rtilized every two weeks or a s needed with 20 ml of 2.63 g Miracle Grow ( The Scott s company, LLC, Marysville, Ohio, USA ) per liter of distilled water. Fungal Isolates Isolates UF0465 and UF0714 of Rhizoctonia solani were used in all inoculation experiments. The isolates were maintained in oat seed storage culture at 4C. Colonies were transferred on oat seed from storage onto potato dextrose agar (PDA, Difco) plates. Isolate UF0465 was isolated from St. Augustinegrass exhibiting brown patch symptoms near Belle Glade, FL The time of collection and anastomosis group of this isolate were unknown; however, the isolate was negative for the AG 2 2 LP PCR test ( 111). Isolate UF0714 was isolated in late April of 2007 from Palmetto St. Augustinegrass exhibiting large patch symptoms on a sod farm in Belle Glade, FL. The isolate was confirmed as R. solani anastomosis group 22 LP with specific PCR primers ( 111). Inoculation Experiments Genotypes of SAG were inoculated with 5 mm diameter mycelial plugs fro m three day old colonies of the aforementioned isolate s Agar plugs of sterile PDA were used to inoculate control plants. Agar plugs were placed on the leaf sheath of the terminal shoot and were secured to the plant with strips of parafilm M (Pechiney plastic packaging Illinois, USA ) Inoculated plants were enclosed in 1 gallon sealable plastic bags (Glad company, USA) with one saturated wet paper towel placed at the bottom of the bag. Inoculated plants were placed in an incubator or controlled clim ate growth room at 23 to 26C. Phot operiod was maintain ed between 12 h light and 12 h dark. Levels of artificial lighting ranged between 32.63 2/s1 (Li Cor, Quatum/Radiometer/Photometer, model LI 250, light meter, USA) Relative humidity inside the bags was estimated to be ne ar 100 % based on visible high condensation.

PAGE 27

The experimental design was completely random ized. Each replication contained one sprig per pot. The n umber of replications varied among isolates due to the number of available plants Three (BP) and two (LP) e xperiments were conducted. Four (BP) and three (LP) replications of SAG were used for a total of 240 and 114 inoculated plants, respectively. Ratings of disease severity were recorded by visually estima ting the percent disease daily until day six after the inoculation, when some cultivars were highly infected bu the disease. Statistical A nalysis The logistic disease model was used to characterize and compare epidemics for each genotype Intrinsic rate of infection r, area under disease progress curve AU DPC, and maximum disease severity Y were calculated. The differential equation is: dy / dt = rL y (1 y), in which rL is the rate parameter (apparent infection rate) and y is disease severity. AUDPC was calculated according to: AU i=1 n 1 = ( y i + y i + 1 / 2 ) (t i + 1 t I ) (64). Where i is the order index for the times, n is the number of times, y is the disease severity, and t is time. Maximum severity (Y) was the mean final disease rating of the total number of re plications of each cultivar Calculations were made using Statistical Analysis System (SAS Institute, Inc., Cary, NC). Univariate procedure in SAS was used to test the equality of variance and the normality of the residuals of each variable by isolate. R esiduals were normal; therefore, data of the experiments were pooled and analyzed together by isolate. Differences in cultivar means were obtained using the Mixed procedure in SAS with a random effect and least square means t test with TukeyKramer adjust ment. Contrast statement was used to observe the effect of ploidy level and morphotype on each disease variable. Means were compared using the least significant

PAGE 28

difference as appropriate. For all the comparisons, a significance level of P unless otherwise stated. SAS c odes are included in Appendix A and B. Results B rown Patch Susceptibility The inoculation method was successful in inducing disease. One day after inoculation, the fungus started to produce abundant aerial mycelia on most of th e genotypes All genotypes showed typical symptoms of the disease following inoculation. The first symptom observed was water soaking followed by brown irr egular lesions. By day 2 (48 h), differences in percent severity ranging from 2.25 vs 14.7% (low to h igh) were observed among genotypes (data not shown). As the disease progressed, new lesions appeared and spread over the plant (Figs 2.1 and Fig. 2.2). All genotypes showed dark brown or black lesions on stem s (canker like lesions), especially below the i nternodes. Perceivable differences were observed in how fast disease spread and the amount of disease that occurred between genotypes Sclerotia were produced on many, but not all genotypes All the c ontrol pla nts remained free of BP disease. Normal growt h and presence of new leaves were observed on them. Mean AUDPC, appa rent infection rate, and final severity by genotype for the combined BP experiments are given in Table 2.2. Statistically significa nt differences between genotypes are indicated in Table 2 .3, 2.4, and 2.5 for final severity, apparent infection rate, and AUDPC respectively. Final disease severity Palmetto (94%), FX 313 (88%), Floratine (80%), FX 10, Delmar and FloraVerde (79%) and Classic (76%) had the highest final disease severity. FH S A 115 and Raleigh had the lowest final disease severity values.

PAGE 29

Apparent infection rate By the end of the experiment (6 days after inoculation), there were statistically significa nt differences between genotypes. Palmetto (1.55) and FX 10 (1.51) had the highest rate of infection. Delmar and FloraVerde (1.3), FX 313 and Classic (1.2) and Floratine (1.17) also exhibited high rates of infection. FHSA 115 (0.83), Mercedes (0.73) and Raleigh (0.68) had the lowest calculated rates of infection. Area under d iseas e progress curve Palmetto (290), FX 313 (280), Floratine (230), Jade (220) and FX 10 (210) show ed the highest values of AUDPC. Floratam (110), FHSA 115 (99), and Raleigh (86) had the lowest values of AUDPC. Effect of ploidy level and morphotypes on disease response variables Ploidy level did not have any significant effect on disease response variables. Means of diploid and triploid cultivars were not statistically different (Table 2.6). Morphotype did have a significant effect on all disease respo nse vari ables (P < 0.05). D warf cultivars had statistically higher overall disease severity values on average than long bladed cultivars. Large Patch Susceptibility Aerial mycelia were produced on the plants after 5 days The f irst symptom observed was water soake d le sions on leaves that became brown and irregular with time By day 8, differences in severity percent ranging from 2.5 to 26 % (low to high) were observed among genotypes (data not shown). In advanced stages of infection (between 11 and 15 days), yello wing became a symptom evaluated. Production of new healthy tissue (recovery) was observed on Captiva, FX 313, FX 33, FX 10, Palmetto, Floratam, FH SA 115, Classic, Winchester, and Jade during the experiments. Sclerotia production was not observed in any of the cultivars. All c ontrol plan ts

PAGE 30

remained free of LP symptoms by the end of the experiment. Normal growth and development of new leaves were observed on them. Mean AUDPC, apparent infection rate, and final severity by genotype for the combined LP experim ents are given in Table 2.7. Statistically significa nt differences between genotypes are indicated in Table s 2.8, 2.9, and 2.10 for final severity, apparent infection rate, and AUDPC respectively. Final disease severity FX 10 (72%), Raleigh (59%) and Fl oraVer de (59%) had the highest final disease severity on average. Winchester (20%), T. Common (19%), Mercedes (16%) and Sunclipse (8,6%) had the lowest values. Apparent infection rate There were statistically significant differences between genotypes. FX 10 (0.63), FX 33 (0.37), Flora Verde and Jade (0.35) and Raleigh (0.32) showed the highest rate of infection. T. Common, Sunclipse (0.17) and Winchester (0.13) had the lowest rates. Palmetto, Delmar, Classic, Bitterblue, Floratine, Mercedes, Seville, and F loralawn had similar rates of disease progress. A rea under disease p rogress c urve Raleigh (310), FX 10 (280), FloraVerde (260), Jade (210) and FX 313 (200) had the highest AUDPC values while T. Common and Floratine (99), Mercedes (97) and Sunclipse (52) ha d the lowest values. The rest of the genot ypes showed intermediate values between these two groups. Effect of ploidy level and morphotype on disease response variables Ploidy level had no significant effect on measured disease variables. Means o f diploid a nd triploid genotypes were not statistically different (Table 2.11). Morphotype had a significant

PAGE 31

effect on final severi ty (P < 0.0110). Dwarf genotypes had higher maximum disease severity values than longbladed cultivars. Discussion Results of this stud y indicated that some genotypes could be differentiated for delay in severity as early as day 2 for BP and at day 8 for LP. The optimal time to evaluate genotypes for their resistance or susceptibility appears to be 5 to 6 days after the inoculation for BP and 14 days after the inoculation for LP. At this particular point for these two diseases, susceptible materials are highly infected, especially for the BP isolate. Ratings too early or too late could lead to inappropriate assumptions. In these experiments AUDPC was the most informative varia ble calculated for the genotypes AUDPC gave the best me ans separation between genotypes for both diseases. However, values of rate parameter and maximum severity were useful to compare disease susceptibility of the d ifferent genotype s. Screening for B rown Patch Disease Palmetto, FX 313, Floratine, Jade and FX 10 were considered highly susc eptible genotypes based on AUDPC, followed by Delmar, FloraVerde and Classic. Captiva, Mercedes and Floratam, but principally FHSA 115 and R aleigh were considered genotypes wi th possible resistance. The delayed response in severity in Raleigh may corroborate the presence of some resistance. Overall, Raleigh was considered as the most resistant genotypes. This finding contradicts previous reports that Raleigh is quite susceptible to large patch under greenhouse conditions and suggests cultivar response may differ between large patch and brown patch isolates (46). Furthe r studies need to be addressed to elucidate the possible compone nts of tolerance in this cultivar, if present. S clerotia production was observed on 10 genotypes It was most noticeable in FX 10 (3 sclerotia), Sunclipse (4) and FX 33 (4). It is unclear if susceptibility of the cultivar played a role

PAGE 32

or if the absence of he althy plant material triggered production of sclerotia Few studies have reported the production of sclerotia by R hizoctonia solani on turfgrass. This may be further evidence that the brown patch disease and isolates that cause it are distinct from large patch isolates previously studied. Effect of p loidy level and m orphotyp e on d isease response v ariables : There was no effect of ploidy level and the response of genotypes Similar reactions were observed on the triploid and diploid genotypes Morphotypes had an effect on AUDPC, final severity, but mainly on rate parameter; dwarf genotypes developed disease much faster than long ones. The colonization process might have been faster because of the small, compacted leaves and the short internodes of the dwarf genotypes Additional work is needed to elucidate these differences and in the underlying causes. Screening for Large Patch Disease Raleigh, FX 10, FloraVerde, Jade and FX 313 were conside red highly susceptible genotypes followed by Captiva and FX 33, w hereas T. Common, Floratine, Mercedes and mainly Sunclipse were considered to be possibly resistant Plan t grow th was observed on 13 genotypes after inoculation with the fungus. The concept of crop recovery can be an estimate of post epidemic vegetative r egrowth of foliage or other plant parts, and it c an be used to evaluate genotypes. Selection of genotyes that show enhanced crop recovery may reveal a tolerance to R solani that would be difficult to detect in a crop such a s turfgrass where biomass reduct ion is not considered an important result of disease (16 ). Effect of ploidy l evel and m orphotype on disease response variables : Host p loidy level did not significantly affect AUDPC, maximum severity or rate parameter. Morphotypes had an effect only on fina l severity. L ongbladed plants had lower disease severity values than dwarf

PAGE 33

genotypes W ider and longer leaves and longer internodes may confer structural defense to the fungus Comparison of St. Augusti negrass Reaction for B rown P atch and L arge P atch I so lates Flentje, N. T., 1957 suggested that there are several stages during infection by R. solani when the process could be affected. These stages are: failure of the hyphae to attach to the plant surface; failure to form infection structures; failure of pe netration pegs to penetrate and failure of penetrating hyphae Infection, colonization and even sclerotia production of the fungus were obs erved on most of the cultivars in these trials. Therefore, the term tolerance is the most adequate for those materi als with less or reduced damage. However, results of this study indicated that some components of resistance may be present on longbladed cultivars. Infection on these genotypes occurred at lower proportions, especially on early stages of infection (48 h) Constitutive factors such as cuticle tickness, may have had an effect on conferring resistance to Rhizoctonia on the genotypes evaluated. Morphological features such as leaf width and length of tall fescue cultivars, reported by Green II. et al, 1999 could have an effect on delay ing disease response and reducing percent severity on those SAG genotypes less affected by the isolate. T he RhizoctoniaSAG pathosystem is likely governed by partial or horizontal resistance, since varying different levels of susc eptibility were observed on the genotypes No material h as been reported as immune, suggesting t he absence of dominant resistance genes. This suggest s the presence of many genes to confer effective resistance against the se diseases. However, not all commer cial SAG cultivars were included in this study. Future screening projects should include additional cultivars and breeding lines to corroborate the polygenic nature of the resistance. Additional research is needed to elucidate these mechanisms and to corr oborate responses obtained in controlled environment experiments with those observed in the field.

PAGE 34

One of the objectives of this research was to develop a screening protocol for St. Augustinegrass that could evaluate differences in susceptibility between c ultivars to diseases caused by R solani M eth ods outlined did result in good and discernable amounts of disease with both isolates. Results corroborated the efficacy of the methodology proposed by Datnoff et al 2005. The data from experiments with differ ent isolates were not combined, because a significant interaction effect between isolate and cultivar was noted. Although LP and BP are caused by the same species of fungus, there were differences in the response of cultivars to the two isolates. This wa s unexpected but suggests that screening efforts should rely on an isolate that causes the most economically important disease for the particular turfgrass species. Discerning the differences in cultivar response to the different isolates was not the objective of this research, and experiments were not designed to elucidate those differences. Future studies should take into account that these results suggest that screening efforts with an aggressive isolate that causes a relatively unimportant disease (brown patch) may not produce usable and valuable selection for resistance to even closely related diseases (large patch). Finally, for future and established disease screening projects, it would be desirable to have additional information about the effect o f plant age, pathogenicity of different isolates and effect of different environmental condi tions to understand better this Rhizoctonia solani pathosystem and to define the components associated with disease response against this pathogen.

PAGE 35

Table 2 1. Mor photypes and ploidy level of St. Augustinegrass germplasm. GENOTYPE MORPHOTYPE Ploidy level *** Captiva Dwarf semi dwarf 2 X Classic Dwarf semi dwarf 2 X Delmar Dwarf semi dwarf 2 X FloraVerde Dwarf semi dwarf 2 X FX 313 Dwarf semi dwarf 2 X J ade Dwarf semi dwarf 2 X Seville Dwarf semi dwarf 2 X Texas Common Dwarf semi dwarf 2 X FX 10 Dwarf semi dwarf 3 X Mercedes Long ** 2 X Palmetto Long 2 X Raleigh Long 2 X Sunclipse Long 2 X Winchester Long 2 X Bitterblue Long 3 X FH SA 115 Lo ng 3 X Floralawn Long 3 X Floratam Long 3 X Floratine Long 3 X FX 33 Long 3 X Dwarf semi dwarf genotypes: plants with short habit growth, narrow and short leaf blades. ** Long :plants with elongated and wide r leaves and stolons. *** Diploid (2X)= 9 chromosomes/nuclei. Triploid (3X)=27 chromosomes/nuclei.

PAGE 36

Table 2 2. AUDPC, appa rent infection rate, and final severity of St. Augustinegrass genotypes inoculated with the brown patch isolate. Means represent combined data from th ree experiments. Cultivar AUDPC Apparent infection rate (units/day) Final severity (%) Palmetto 290 1,55 94 FX-313 280 1,2 88 Floratine 230 1,17 80 Jade 220 0,91 70 FX-10 210 1,51 79 Sunclipse 180 0,98 72 Delmar 180 1,3 79 Winchester 180 1,13 71 FloraVerde 180 1,3 79 Classic 170 1,2 76 FX-33 160 1 66 Bitterblue 150 0,91 57 T.Common 140 1,06 63 Seville 140 1,02 58 Floralawn 130 0,98 55 Captiva 120 1,15 60 Mercedes 120 0,73 50 Floratam 110 0,88 50 FHSA-115 99 0,83 46 Raleigh 86 0,68 35 Means obtained using Proc Mixed code with random effect in SAS. Means were significantly different at P -test with Tukey adjustment AUDPC: Area Under Disease Progress Curve

PAGE 37

Table 2 3. T test results of comparisons between final disease severity of St. Augustinegrass genoytpes inoculated with the brown patch isolate of R. so lani Sunclipse Mercedes Floralawn Bitterblue Captiva FX-313 FX-33 FX-10 Palmetto Raleigh Floratam Floratine T. Common FHSA-115 Classic Winchester Seville Jade Delmar FloraVerdeSunclipse Mercedes Floralawn Bitterblue Captiva FX-313 FX-33 FX-10 Palmetto Raleigh * Floratam Floratine T. Common FHSA-115 Classic Winchester Seville Jade Delmar FloraVerde Means were significantly different at P to pairwise ttests with Tukey a djustment.

PAGE 38

Table 2 4. T test results of comparisons between apparent infection rates calculated for St. Aug ustinegrass genotypes inoculated with the brown patch isolate of R. solani Sunclipse Mercedes Floralawn Bitterblue Captiva FX-313 FX-33 FX-10 Palmetto Raleigh Floratam Floratine T. Common FHSA-115 Classic Winchester Seville Jade Delmar FloraVerdeSunclipse ** Mercedes ** Floralawn ** Bitterblue ** Captiva FX-313 FX-33 ** FX-10 ** Palmetto ** Raleigh ** Floratam FloratineT. Common FHSA-115 ** Classic WinchesterSeville Jade Delmar FloraVerde Means were significantly different at P tests with Tukey a djustment.

PAGE 39

Table 2 5. T test results of comparisons be tween area under disease progress curves calculated for St. Augustinegrass genotypes inoculated with the brown patch isolate of R. solani Sunclipse Mercedes Floralawn Bitterblue Captiva FX-313 FX-33 FX-10 Palmetto Raleigh Floratam Floratine T. Common FHSA-115 Classic Winchester Seville Jade Delmar FloraVerdeSunclipse Mercedes Floralawn Bitterblue Captiva FX-313 FX-33 FX-10 Palmetto Raleigh Floratam Floratine T. Common FHSA-115 Classic Winchester Seville Jade Delmar FloraVerde Means were significantly different at P to pairwise ttests with Tukey a djustment.

PAGE 40

Table 2 6. Effects of ploidy level and morphotype on disease response variables for brown patch disease experiments. Pr > F ** Ploidy means Ploidy Morphmeans Morphotype AUDPC Ploidy 0.1132 175.25 A 2X 181.66 A Dwarf Morphotype 0.0385 155.41 A 3X 157.64 B Long YMAX Ploidy 0.0922 68.894 A 2X 72.308 A Dwarf Morphotype 0.0033 62.642 A 3X 62.188 B Long r parameter Ploidy 0.5686 0.5686 A 2X 1.18432 A Dwarf Morphotype 0.0005 0.0005 A 3X 1.01308 B Long Values obtained using contrast procedure in SAS to evaluate effect of ploidy and morphotype on disease response. Means of genotypes were analyzed using Least Significant Difference. ** Means follow ed by the same letter are not significantly different according to t test comparison at P 0.05. AUDPC: Area Under Disease Progress Curve YMAX: Final severity r parameter: apparent infection rate

PAGE 41

Table 2 7. AUDPC, apparent infection rate and final severi t y of St Augustinegrass genotypes inoculated with large patch isolate. Means represent combined data from two experiments. Cultivar AUDPC Apparent infection rate (units/day) Final severity (%) Raleigh 310 0.32 59 FX-10 280 0.63 72 FloraVerde 260 0.35 59 Jade 210 0.35 39 FX-313 200 0.30 45 Captiva 190 0.29 40 FX-33 190 0.37 40 Floralawn 180 0.20 30 Palmetto 170 0.21 28 Seville 170 0.24 38 FHSA-115 160 0.31 31 Classic 150 0.22 30 Bitterblue 140 0.22 28 Delmar 140 0.22 25 Winchester 120 0.13 20 Texas Common 99 0.17 19 Floratine 99 0.22 23 Mercedes 97 0.23 16 Means obtained using Proc Mixed code with random effect in SAS. Means were significantly differe nt at P test with Tukey adjustment.

PAGE 42

Table 2 8. T test result s of comparisons between final disease sverity of St. Augustinegrass genotypes inoculated with the large patch isolate of R. solani Sunclipse Mercedes Floralawn Bitterblue Captiva FX-313 FX-33 FX-10 Palmetto Raleigh Floratam Floratine T. Common FHSA-115 Classic Winchester Seville Jade Delmar FloraVerdeSunclipse *Mercedes *Floralawn Bitterblue Captiva FX-313 FX-33 FX-10 *Palmetto Raleigh Floratam Floratine T. Common FHSA-115 Classic Winchester Seville Jade Delmar FloraVerde Means were significantly different at P to pairwise ttests with Tukey a djustment.

PAGE 43

Table 2 9. T test results of comparisons between apparent infection rates calculated for St. Augustinegrass genotypes inoculated with th e large patch isolate of R. solani Sunclipse Mercedes Floralawn Bitterblue Captiva FX-313 FX-33 FX-10 Palmetto Raleigh Floratam Floratine T. Common FHSA-115 Classic Winchester Seville Jade Delmar FloraVerdeSunclipse*Mercedes Floralawn Bitterblue Captiva FX-313 FX-33 FX-10* *Palmetto Raleigh Floratam Floratine T. Common FHSA-115 Classic Winchester Seville Jade Delmar FloraVerde Means were significantly different at P to pairwise ttests with Tukey a djustment.

PAGE 44

Table 2 10. T test results of comparisons between area under disease progress curves cal culated for St. Augustinegrass genotypes inoculated with the large patch isolate of R. solani Sunclipse Mercedes Floralawn Bitterblue Captiva FX-313 FX-33 FX-10 Palmetto Raleigh Floratam Floratine T. Common FHSA-115 Classic Winchester Seville Jade Delmar FloraVerdeSunclipse* *Mercedes* *Floralawn Bitterblue* *Captiva FX-313 FX-33 FX-10* *Palmetto*Raleigh* * *Floratam Floratine*T. Common*FHSA-115 Classic Winchester*Seville Jade Delmar FloraVerde Means were significantly different at P to pairwise ttests with Tukey a djustment.

PAGE 45

Table 2 11. Effects of ploidy level and morphotype on disease response variables for large patch disease experiments. Pr < F ** Ploidy m eans Ploidy Morph means Morphotype AUDPC Ploidy 0.7232 177.20 A 3X 190.41 A Dwarf Morpho 0.1043 170.44 A 2X 155.67 A Long YMAX Ploidy 0.3999 37.278 A 3X 40.815 A Dwarf Morpho 0.0110 32.955 A 2X 28.475 B Long r parameter Ploidy 0.0763 0.33070 A 3X 0.30862 A Dwarf Morpho 0.1011 0.24613 A 2X 0.23933 A Long *Values obtaine d using contrast procedure in SAS to evaluate effect of ploidy and morphotype on disease response. Means of genotypes were analyzed using Least Significant Difference. ** Means followed by the same letter are not significantly different according to t test comparison at P 0.05. AUDPC: Area Under Disease Progress Curve YMAX: Final severity r parameter: apparent infection rate

PAGE 46

Figure 21. Brown patch disease on genotype FX 313 six days after inoculation. Abundant aerial mycelia associated with severe foliar blight symptoms on leaves and sheaths.

PAGE 47

Figure 22. Brown patch symptoms on the genotype Delmar six days after inoculation. Lesions show water soaking and general necrosis of leaf tissue.

PAGE 48

Figure 23. Large patch symptoms. Lesions, water soa king, general necrosis of sheath and crown tissue and yellowing of newest leaves .

PAGE 49

CHAPTER 3 PHYLOGENETIC ANALYSIS OF RHIZOCTONIA ISOLATES COLLECTED F ROM TURFGRASSES IN FLORIDA Introduction Historically, taxonomy of Rhizoctonia spp. has been confusing and variable, since the classical species concept is so wide many have considered it a species complex ( 26, 47, 94, 89). Rhizoctonia taxonomy is further complicated by the reportedly wide host range and uncommon occurrences of sexual structures. The classica l hyphal anastomosis reaction has been a fundamental technique to classify isolates into distinct groups (26). Currently, 14 different anastomosis groups or independent evolutionary groupings exist ( 35, 37 ) However, anastomosis reaction can be open to sub jective interpretation (26 ). Additional ly morphological features of hyphae also have been used to differentiate species. However, these features can vary with spe cific environmental conditions. Most recently, t he use of phylogenetic and molecular analyses have had a big impact in the classification of these fungi. Ribosomal RNA genes are conserved genes that contain sequence components possessing different evolutionary rates. Some of the sequence regions are phylogenetically and taxonomically inform ative for fungi (15). Internal transcribed spacer regions (ITS 1 a nd ITS 2) are found between the 18 S and 5.8 S, and the 5.8 S and 28 S genes respectively. The ITS regions have become essential for population studies with fungi. M olecular genetic analyses supp ort some AGs, such as AG4, AG 5, AG6, AG7, AG8, AG 11, AGBI and some subgroups ( AG 1 IA, IB, IC) (36). The publication of the rDNA ITS sequences in the GenBank also has facilitated direct comparison of data obtained by different research groups and has led to progress in the Rhizoctonia spp systematics. However, some sequences deposited in GenBank lack information either at the start or the end of the informative sequence. Missing sequence data is problematic for phylogenetic

PAGE 50

analyses. Recently, some Rhi zoctonia researchers (99 ) reported for inaccuracies in the currently accepted classification system cit ing the need for better quality data to make concrete conclusions. The ladder phenomenon observed in some R solani AG 2 isolates, reported by Sa lazar et al 1999 might explain the number of ambiguous and unresolved nucleotides which affect phylogenetic analyses. The principal objective of this study was to characterize Rhizoctonia isolates from turfgrass in Florida by using DNA cloning and sequencing prot ocols to obtain good quality sequence data. Secondary objectives were: 1) to standardize the protocol to obtain data with the minimum number of missing or ambiguous nucleotides, 2) classify isolate s to AG or species level by comparison with known sequence data in GenBank and 3) evaluate specific primers for some AGs reported in literature. M aterials and M ethods Fungal Isolates Collection Fungal i solations were made from small pieces of infected leaves and sheaths (2 5 mm). Tissue was soaked in 10% househo ld bleach for 30 s econds rinsed 3 consecutive times in de ionized water, dried with a paper towel, and transferred to water agar media without antibiotics Presence of Rhizoctonia mycelia was confirmed 2 3 days after plating. Efforts resulted in 32 isolates of Rhizoctonia spp obtained from warm season grasses collected from various turfgrass fields in Florida A single isolate was obtained from a cool season grass ( Poa trivialis ) while 9 isolates were collected from vegetable crops (bean, c orn, and rice) grown in the Everglades agricultural area for comparison. To recover isolates from storage, 4 infested oat seeds were aseptically transferred to PDA medium. Additional transfer of hyphae were made onto 9 cm petri dishes containing

PAGE 51

approximately 20 mL of Potato Dextrose Agar medium (PDA, 33 g/L ) and incubated at 25C in the dark. Cultures were transferred every 2 3 weeks. Sequence Data from GenBank Sequences of partial rDNA coding regions from 34 isolates with reported anastomosis groups (AG) were included a s reference sequences. One sequence of an At helia rolfsii isolate was included as an outgroup (98), for a total of 76 taxa. All the external sequences were downloaded from GenBank through the National Center of Biotechnology Information website. A complete list of isolates used in this study, describing the plant host, source, year of collection and the genbank accession number is presented in Table 3 1 and 32. Genomic DNA Extraction Genomic DNA from 42 isolates maintained on PDA culture plates was extra cted using ExtractN Amp (Sigma Aldrich) and/or Dneasy Plant Mini Kit (Qiagen, Valencia, CA). Threads of mycelia (aerial or prostrate) from each isolate were used for DNA extraction. Isolates with no aerial mycelia were grown on 100 mL of Luria Bertani bro th ( LB) ( 10.0 g. of Tryptone, 5.0 g. of Yeast extract and 5.0 g. of NaCl), covered by aluminum foil under agitation until adequate mycelia growth was observed (5 6 days). Mycelia was collected with vacuum filtration and ground in liquid Nitrogen by using mortar and pestle to obtain a fine powder. When needed, fungal mycelia were crushed using a bead beater and tungsten carbide beads. DNA was eluted in deionizeddistilled sterile water. P olymerase C hain R eaction Amplifications and Primer Sets Used Prime r sets specific to AG 2 2LP, AG 2 2 IIIB, and AG 2 2 IV (20, 111) were used to determine if some isolates were related to this group of AGs The primer s et ITS1 and ITS4 (121) were used to amplify the internal transcribed spacer regions and the 5.8s rDNA sequence. All primers were synthesized by Integrated DNA Technologies, Inc. Table 33 shows the

PAGE 52

sequences, PCR reaction mix conditions and the profile used for the amplification of each pair of primers. The temperature cycles were controlled with MyCyclerTM thermal cycler (Bio Rad California, USA Products were electrophoresed at 110 volt s; amplified products were visualized using a UV transilluminator. Products from amplification with ITS primers were purified using QIA prep spin Miniprep kit (QIAGEN) following manufacturers instructions. Bacterial Cloning of Amplicons The amplicons w ere submitted to an additional extension cycle with dATP (100 mM; 2 deoxyadenosine 5 triphosphate solution, Bioline Boston, USA ) to be cloned in the pCR II vector (plasmid) (pCR 2.1 TOPO TA cloning kit, Invitrogen, Inc.) through ligase reaction and chem ical transformation into competent cells of E. coli (One ShotTM TOP 10 Invitrogen, Inc.). Transformed colonies were obtained after the incubation of the ligated products at 37C, and 16 were confirmed to have the plasmid through the presence of blue whit e colonies using LB media (same composition mentioned above + 16 g.of agar) amended with X GAL (2%; 5 Bromo 4Chloro3indolyl D galactopyranoside, Bioline), IPTG (100 mM; Isopropyl D thiogalactopyranoside, Bioline) and ampi cillin salt solution (50 mg /m l ). Bacterial DNA of positive clones (=plasmid + fungal DNA) was cleaned using QIA prep spin Miniprep kit (QIAGEN) according to manufacturers instructions. Restriction analysis with EcoRI (strain RY13, Invitrogen, Inc.) was done to verify the presence and fragment size of the insert. stock solution. Electrophoresis was carried out at 120 volts for 45 minutes.

PAGE 53

Sequencing An average of three four clones/ isolate were sequenced bidirectionally. Sequencing of the clones was done at the University of Florida DNA Sequencing Core Laboratory using a Perkin Elmer Applied Biosystems ABI PRISM model 3130 automated DNA sequencer ABI (Applied Biosystems, Foster City, CA, USA) that uses four dye fluorescent labeling methods and a real time scanning detector. Sequence Alignment, Molecular and P hylogenetic Analyses Forward and reverse sequence data of each bacterial clone were aligned to get a consensus sequence. Consensus sequences of all clones for each isolate were obtained by automated multiple alignment using Clu stalW (109 ) software package available in MEGA version 4 software (107 ). For gap opening and gap extension, default options were set up. No more than 7 ambiguous sites (as maximum) were found between strains of the same clone. Ambiguous sites between strains were solved by majority rule of any particular nucleotide at the specific site. A final alignment of all consensus sequences using ClustalW was done, using the same options described above. Alignment was later adjus ted manually under MEGA version 4. To observe results from different phylogenetic methods and to support congruency of the tree topology, data were analyzed using the most common phylogenetics packages. Nei ghbor Joining (NJ) with two Kimu ra parameter model (52 ) was run using MEGA version 4 ( 107) and maximum parsimony (MP) with Phyloge netic Analysis Under Parsimony PAUP 4.0 b10 (105). Heuristic searches were performed with random stepwise addition (1000 repl ications) and branch swapping algorithm using tree bisectionreconnection (TBR). Clade stability was evaluated using 1000 replicates with arrangement limited to 1,000,000 per replicate. For Bayesian inference and Maximum Likelihood a model of nucleotide substitution was used with the program Modeltest v3.4 ( 90). The best fit model of sequence evolution was chosen based on the Akaike Information

PAGE 54

Criterion (AIC) (44 ). The model selected was TVM + G, transversion model with variable base frequencies, variable transversions and equal transitions. Bayesian inference (BI) method was estimated with MrBayes v3.1.2 ( 92). The Markov Chain Monte Carlo (MCMC) was run with four chains for 10,000,000 generations. Sampling was done every 100 generations starting with a random tree. A 90% majority rule consensus tree was obtained. Maximum Likelihood (ML) was analyzed using GARLI software version 0.96 (124). A 50% majority rule consensus tree was obtained. Results A total of thirty three isolates were tested to determine if they were AG 2 2 LP, AG 2 2 I II B or AG 2 2 IV and only 12 were positive for AG 2 2 LP. Isolate 07 06 (from Bermudagrass) was positive fo r AG 2 2 IIIB. No isolate amplified with the AG 2 2 IV primers. Tree topology of the four phylogenetic analyses was ver y similar (trees not shown) Basi cally, the four analyses were consistent in differentiating isolates of Rhizoctonia solani Waitea circinata, A thelia rolfsii, and Marasmius oreades with boostrap values of 100% The ML analysis showed bootst rap va l ue s of 88 % for the R. solani clade. Because of this, results are analyzed based on Bayesian analysis (90% majority rule) and MP. Regarding Bayesian analysis twelve different clades with more than one isolate were differentiated and seventeen isolates were located in to single clades (Figure 3 1). Twelve isolates of the W circinata group (11 of var. circinata and 1 of var. zeae ) were weakly supported as clades when compared to clades formed by isolates of var. oryzae zeae and agrostis Anastomosis groups were sh own as independent evolutionary units with sufficient levels of heterogeneity (20, 25, 26, 35, 61, 53, 93, 94, 95). Most of the isolates within the W. circ. clade are not clearly identified at the species level when they are compared to tester isolates. On ly 0705, rice 3 and 0538 appear to be similar (91%) t o var. oryzae (Table 3 1 and figure 3 1).

PAGE 55

Isolates 0544A 0709, and 0631 w ere identical but different from the other W. circinata like isolates. In relation to MP analysis, 787 characters were used, 241 were constant, 113 variable characters were parsimonyuninformative and 433 parsimony informative. Fourteen different clades with more than o ne isolate were conformed and four isolates were located as single clades (Figure 3 2). Various isolates representi ng different anastomosis groups formed a clade but with we ak support Varieties within W. circ. group were better differentiated with high bootstrap values. W. circinata like isolates used in this study formed three clades and were not clearly grouped with the tester isolates; this was especially so in the clade formed by 0544A, 0709 and 0631. Isolates of W. circ. var. circinata formed a defined clade. Isolates from vegetables crops were located within the R. solani clade. Two AG were identified (AG 4 HGIII and AG 1 IA). Other isolates seem to be similar to AG 22 isolates and one isolate (B eans 8) could not be accurately classified. ITS regions and 5.8s rDNA gene length variation : Table 3 4 shows the length of the sequenced amplicons for each defined clade AG 2 2 LP and AG 1IA clades had the longest amplicons Isolates of W circ. var agrostis had the shortest. The length of the 5.8s rDNA gene sequence corresponded to 143 bp and was highly conserve d among all the isolates. Fifteen bp were found to be var iable among W circ. group and R solani Within W circ clade, 0544A, 0709 and 0631 showed differences in three nucleotides in the 5.8 s rDNA gen. These three sites are: base pair 81 (T/C), 92 bp (C/T), 103 bp (G/A). Discussion Primers specific for AG groups differentiated the AG 2 2 LP subgroup; however, diagnostic should also be supported by other additional features, due to the high similarity among AG 22 subgroups The fragment size of this region was about 400 bp. AG 2 2 subgroup

PAGE 56

primers are differe nt by a few nucleotides. Although, these primers are used to am plify a highly conserved region, molecular diagnosis should be done carefully, because the ladder phenomenon of Rhizoctonia may cause changes in nucleotides that result in a misidentification of isolates Isolate 0706 was positive for AG 22 IIIB (Brown patch primer), but in the tree appear ed not to be highly similar to the tester isolate. In this study, some host spe cialization by AGs was observed W arm season grasses like St. Augustinegrass, Seashore paspalum and zoysia grass were infected by isolates of the subgroup AG 22 LP. A h igh level of sequence variation was observed in the rDNA ITS regions of Rhizoctonia spp; however 5.8s rDNA gene appears to be highly conserved, mainly within species. R hizoctonia.solani and Waitea species have fifteen distinct informative nucleotides in this gene that could be used to differentiated them at the species level. Lengths of amplicons support the species classificati on, since they are smaller in Waitea ci rcinata ITS regions. Furthermore, the variety classification in the Waitea group was well supported by high bootstrap values. Isolates in the AG 2 2 LP clade were highly similar and clearly different than the rest of the AGs included in the study. Surpris ingly, isolate s from beans showed very similar ITS sequence data, may indicating a possible gene flow between isolates under natural conditions and the possibility of finding alternative hosts to certain AG groups or subgroups. Clade organization of bean 1, 2 and 4 isolates were consistent with pathogenicity previously reported for the AG 4HG II, but mainly for AG 4 HG III. Although this AG and their subgroups have been suggested as different species, the phylogenetic analysis only allowed observing the differences between HGI II and III. Pathogenicity reported by AG 4HG III on common, snap, lima, dry edible beans is consistent with their isolation from field beans.

PAGE 57

Bean 5 and 7 show high similarity between them, but dissimilarity with B ean 8, whic h is found as a single clade. This may indicates of some level of population diversity, since isolates were taken from the same field at the same season of the year. Isolates 0465, 0650 and 0649, collected in different years and sites in Alachua Co (Florida) fr om St. Augustinegrass and the corn isolate w ere identical and thus, placed i n a very distinct cluster, along with the AG 1 IA tester (100 % similarity). Isolate 0465 was chosen based on preliminary studies of its pathogenicity on St. Augustinegrass and r esults of the screening with this isolate on different genotypes of this host showed a high level of virulence in many cultivars. Isolates from this AG have been reported causing diseases on rice, corn and cool season turfgrasses (49, 53, 86, 93, 100, 106) but no report was found of this AG causing brown patch symptoms on warm season grasses. Therefore, it may constitute a unique finding not previously reported. Applications of rDNA ITS sequence analysis have been very useful, especially to clarify Rhizoc tonia taxonomy and to develop specific sets of primers that have allow ed AG identification or confirmation based on accurate methodology. Results of this research constitute a re novel information for Florida, because previous phylogenetic studies of Rhizoc tonia were from other hosts or were conducted in different countries or USA states. However, diagnosis using AG 22 LP primers and phylogenetic trees were consistent on detecting this AG on warm season grasses. Isolates 0408 (bermudagrass) and 06 58 ( S. pas palum ) were highly similar with respect to ITS sequences, although collected from two different warm season grasses at different seasons of the year. They were located a part from any of the other clade s formed and were found to be consistent with results o btained using the homology search in BLAST They showed high homology with Ceratobasidium sp AGG, a binucleate Rhizoctonia sp A s imilar observation

PAGE 58

was found with 0515A and 0515B ( from bermudagrass); their homology search revea led them as Rhizoctonia cer ealis The use of A. rolfsii as an outgroup was appropriate (Sharon et al 2006, Sharon et al 2008). Isolate 0545 was classified as member of Tricholomataceae sp or Marasmius oreades sp ; two taxa as far related as the isolate proposed as an outgroup. It cou ld be suggested as outgroup for f uture phylogenetic analyses. Cloning protocol became an adequate methodology to obtain sequence data of excellent quality. Only three ambiguous sites were unresolved within 115 clones. The few ambiguities present (7 as max imum) in a few clones were easily solved by majority rule. Thus, the sequence data obtained during this study are considered an excellent contribution for future phylogenetic analyses of this fungal pathogen. Complete sequence data for ITS 1 and 2 regions and the 5.8 s rDNA gene were obtained with this methodology. However, with all of the molecular and phylogenetic analys es performed by Rhizoctonia researchers, only Pope and Carter 2001, Ming et al 2003, and Tewoldemedhin et al 2006 reported a cloning pr otocol for obtaining sequence data Briefly, de la Cerda, et al 2007, mentioned two heterozygous positions on Waitea circinata var c ircinata isolates. Tree topology with high b ootstrap values clearly supported Rhizoctonia species differentiation. Maximum parsimony and Bayesian analysis seemed to be the most appropriate analysi s that biologically explain the data; however some differences were found between both analyse s. The access to sequences deposited in GenBank ha s allowed many researchers to perform phylogenetic analyses based on direct comparison of sequence data. It has been found that many sequences publ ished in the database are incompl ete. According to Gonzales et al 2001, the accumulation of a larger and high quality rDNA sequence database shoul d establish a foundation

PAGE 59

for the development of a species concept in Rhizoctonia for testing hypothese s related to geographic subdivision, host and ecological specialization. Currently, the rDNA ITS sequences deposited in GenBank vary significantly; from the longest rDNA ITS sequences of AG 2 2IV (isolate BC10) of about 678 bp to the shorter sequences of W circinata of about 570bp (98). Sequences obtained through cloning in this study varied from 703 bp (longest) to 583 bp (shortest). This may indicate t hat the use of the direct s equencing method is not highly re li a ble for obtaining good quality data with this pathogen, especially when the sequence data obtained is used to elucidate the presence of new species or to re name others (including AGs groups). The l adder phenomenon or heterozygous condition in a multinucleate fungus, has been little considered by Rhizoctonia researchers. Salazar, et al.,1999 reported the existe nce of more than one sequencing the ITS 1 and ITS 2 regions in AG 22 isolates. The condition w as named the ladder phenomenon due to the visualization of the different bands in a gel. Pope and Carter 2001 also reported the existence of more than one ITS sequences in isolates of AG 6, AG 8 and AG12. This phenomenon in Rhizoctonia could be explained by: i) the existence of different sequences in the same ribosomal region, ii) different sequences in the same chromosome or different chromosomes from the same nucleus, or iii) different sequences in different nuclei of this multinucleate hete rok aryotic fungus (94) Boys en et al 1996 and ODonnell et al 1998, observed sequence ladders in R solani AG 4 isolates and in Fusarium species, respectively. Results of this study demonstrated the existence of this phenomenon in the isolates selected, th rough the existence of nucleotides ambiguities in clones of the same isolate. According to Salazar et al 1999, it seems that the third hypothesis is the most appropriate.

PAGE 60

Table 3 1. Fungal isolates used in this study for phylogenetic analysis Isolate Host Date Size BLAST search BLAST search 0502 Seashore paspalum 01//2005 702 R.solani (99%) T cucumeris (98%) T cucumeris AG 2 2IV, 2 2 IIIB (96%) 0501 Seashore paspalum Jan-05 700 R.solani (99%) T cucumeris (98%) T cucumeris AG 2 -2IV, 2 -2 IIIB (96%) 0470 B St. Augustinegrass 11/10/2004 700 R. solani (98%) T cucumeris AG 2 2 IV (97%), 2 2 IIIB (96%) 0508 A Seashore paspalum pending 697 R. solani (99%) T. cucumeris (98%) T cucumeris AG 2 2 IV (97%), 2 2 IIIB (96%) 0544 B Seashore paspalum 9/12/2005 697 R.solani (99%) T cucumeris (98%) T cucumeris AG 2 2IV, 2 2 IIIB (96%) 0714 St. Augustinegrass 4/24/2007 699 R. solani (98%) T. cucumeris (98%) T cucumeris AG 2 2 IV, 2 2 IIIB (96%) 0508 B Seashore p aspalum pending 698 R.solani (99%) T cucumeris AG 2 2IV, 2 2 IIIB (96%) 0508 C Seashore paspalum pending 698 R. solani (98%) T cucumeris AG 2 2 IV, 2 2 IIIB (96%) 0702 B Seashore paspalum 1/16/2007 698 R.solani (99%) T cucumeris (98%) T cucumeris AG 2 2IV, 2 2 IIIB (96%) 0472 Zoysia grass 9/11/2004 701 R. solani (98%) T cucumeris AG 2 2IV (96%) 0470 A St. Augustinegrass 11/10/2004 697 R.solani (99%) T cucumeris (98%) T cucumeris AG 2 2IV, 2 2 IIIB (96%) 0481 St. Augustinegrass 9/12/2004 697 R. solani (99%) T. cucumeris (98%) T cucumeris AG 2 2 IV, 2 2 IIIB (96%) 0706 Bermudagrass 12/2/2007 697 R.solani (98%) T cucumeris (97%) T cucumeris AG 2 2 IIIB(97%) AG 2 2 IV (96%) 0650 St. Augustinegrass 8/29/2006 673 T. cucumeris (99%). C. oryzae s ativae(99%) T cucumeris AG I 1A (99%) 0649 St. Augustinegrass 8/28/2006 673 T. cucumeris (99%). C. oryzae sativae(99%) T cucumeris AG I 1A (99%) 0465 St. Augustinegrass unknown 673 T. cucumeris (99%). C. oryzae sativae(99%) T cucumeris AG I 1A (99%) 0408 Bermudagrass 1/30/2004 616 Ceratobasidium sp AG G (99%) R solani (99%) 0658 Seashore paspalum 8/24/2006 617 Rhizoctonia sp (99%) Ceratobasidium sp AG G (99%) 0515 A Bermudagrass 4/20/2005 647 R. cerealis (99%) Ceratobasidium sp CAG 1 AG D (98%) 0 515 B Bermudagrass 4/20/2005 648 R. cerealis (98%) Ceratobasidium sp CAG 1 AG D (98%) 0544 A Seashore paspalum 9/12/2005 587 W. circinata (94 %) R zeae (88 %) 0709 Bermudagrass 4/17/2007 588 W. circinata (98%) R zeae (87%) 0631 Bermudagrass 04/27/200 6 589 W. circinata (94%) R zeae (88%) 0503 Bermudagrass Jan 05 605 R. zeae (98%) W circinata (98%) 0705 Seashore paspalum 5/1/2007 614 W. circinata (99%) R zeae (92%) 0538 Bermudagrass 4/8/2005 621 W. circinata (97%) R zeae (93%) 0528 A Poa trivial is 10/6/2005 602 W. circinata var circinata (99%) Thanatephorus sp AG I 1DA (100%) 0707 AB Bermudagrass 1/29/2007 605 R. zeae (99%) W circinata (98%) 0633 Bermudagrass 04/19/2006 605 R. zeae (99%) W. circinata (98%) W circinata var circinata (93%) 05 24 St. Augustinegrass Jul 05 606 R. zeae (99%) W circinata (98%) 0647 Seashore paspalum 08/15/2006 607 R. zeae (99%) W circinata (98%) 0503 A Bermudagrass Jan 06 605 R. zeae (99 %) W circinata (98%) 0545 St. Augustinegrass 9/12/2005 630 Tricholomatac eae sp (98%) Marasmius oreades (97%) Bean 1, 2 ,4 Snap beans "Bronco" 10/12/2004 686 T.cucumeris ,T .cucumeris AG 4 HG III Bean 5 Kidney bean (C. Harmon) Jun 06 701 T.cucumeris R.solani

PAGE 61

Table 3 1. Continued. Isolate Host Date Size BLAST search BLAST search Bean 7 Lima beans (C. Harmon) Jun 06 700 T. cucumeris, R. s olan i Bean 8 Snap bean (C. Harmon) Jun-06 627 Ceratobasidium sp AG -B (o), Rhizoctonia sp Rice 1 Unknown variety 8/14/2004 683 T. cucumeris T. cucumeris AG 4 HG III Rice 3 Unknown variety 12/8/2004 615 R.oryzae, W.circinata Corn 2 Sweet corn 10/12/2004 673 T. cucumeris T. cucumeris AG 4 HG III

PAGE 62

Table 3 2. Sequences obtained from the GenBank used in this study for phylogenetic anal ysis. Species AG GenBank accession Number of bp At h elia rolfsii AY684917 646 W. circinata var agrostis AB213590 570 W. circinata var agrostis AB213575 571 W. circinata var circinata AB213582 565 W. circinata var circinata AB213 580 564 W. circinat a var circinata AB213585 565 W. circinata var circinata AF222799 568 W. circinata var circinata AB213579 565 W. circinata var circinata AB21 3583 563 W. circinata var circinata AB213584 565 W. circinata var circinata AB213586 564 W. circinata va r circinata AB213587 564 W. circinata var circinata AB21 3581 565 W. circinata var oryzae AB213591 576 W. circinata var oryzae AB213589 575 W. circinata var oryzae AB213590 575 W. circinata var zeae AB213597 571 W. circinata var zeae AB213594 5 71 W. circinata var zeae AB213593 571 AG 1 IA AB122133 672 AG 1 IB AB122139 678 AG 1 IC AB122142 651 AG 1 ID AB1 22130 693 AG 2 2 IIIB AF354116 689 AG 2 2 IV AB000014 684 AG 2 2 LP AB054866 678 AG 4 HGI AB000007 659 AG 4 HGII AB000006 661 AG 4 H GIII AY154659 667 AG 5 AF153778 650 AG 6 GVI AF153780 625 AG 7 AB000003 636 AG 8 AF153797 624 AG 9 AF354065 652 AG 10 AF153800 649 AG 11 AF153802 633 AG 12 AF153804 658 AG 2 BI AB054873 674

PAGE 63

63 Table 3 3. Nucleotide sequence, cycle profile and PCR reaction mix for amplification of AG 2 2LP, IIIB and IV and ITS primers. Product size (bp) Primers Sequence PCR reactio n mix Profile Cycles expected AG 2 2 LP 5 AGGCAGAGAAACATGGATGGGC 3 Extract Amp Initial denaturation for 2 min at 94 0 C 5 CCTCCAATACCAAAGTGAAACCAAATC 3 0 stock = 20 nmol) 40 s at 94 0 C 30 400 nized distilled water 1 min at 62 0 C 1 min at 72 0 C 5 min at 72 0 C AG 2 2 IIIB 5 AGGCAGAG(A/G)CATGGATGGGAG3 Same as AG 2 2 LP. Same as AG 2 2 LP. 30 500 5 ACTTGGCCA(A/C)CCTTTTTATC 3 AG 2 2 IV 5 AGGCAGAGACA TGGATGGGAA 3 Same as AG 2 2 LP. Same as AG 2 2 LP. 30 500 5 CTTGGCCACCC(A/C)TTTTTTAC3 ITS 1 5' TCCGTAGGTGAACCTGCGC 3' Extract Amp Initial denaturation for 3 min at 94 0 C 30 700 ITS 4 5' TCCTCCGCTTATTGATATGC 3' primer (1X stock = 20 nmol) 1 min at 94 0 C distilled water 1 min at 55 0 C 2 min at 72 0 C 10 min at 72 0 C

PAGE 64

64 Table 3 4. Length variation within ITS 1 and ITS 2 regions and 5.8s r DNA gene within isol a tes Values from minimum to maximum number of base pair Clade ITS 1 lengh (bp)* 5.8 s r gen (bp) ITS 2 lengh (bp)* AG 2 2 LP 287 292 143 267 Binucleate 222 253 143 251 252 AG 1 IA 263 264 143 266 0647, 0503A, etc 249 251 143 213 0705, rice 3, 0538 252 253 143 219 221 0544A, 0709, 0631 234 235 143 210 211 W circ var oryzae 238 239 143 193 194 W circ v ar ze ae 239 240 143 188 W circ var. circinata 232 245 143 187 214 W. circ. var agrostis 239 143 188 189

PAGE 65

65 Figure 31. Fifty percent majority rule consensus tree from Bayesian inference analysis of rDNA ITS gen s equences. Number above branches indicates posterior probability values. AG 2 -2 LP Binucleate clade AG 1 IA clade W. circ clade W. circ clade W.circ circ oryzAB213590 0472R 0502R 0470B 0501R 0508B 0508C 0508A 0544B 0702B 0714R 0470A 0481R AG22LP AG22IV BEANS5 BEANS7 0706R AG22IIIB AG4HGII AG4HGI BEANS1 BEANS2 BEANS4 RICE1 AG4HGIII 0515A 0515B 0408R 0658R 0650R CORN2 0649R AG1IA 0465R AG7 AG11 AGBI AG9 AG10 AG5 AG12 AG8 AG6 BEANS8pNF117 0647R 0503A 0503R 0524R 0707AB 0633R 0544A 0709R 0631R W.circ zeaeAB213597 W.circ zeaeAB213593 W.circ zeaeAB213594 W.circ agrosAB213575 W.circ agrosAB213570 0705R RICE3 0538pNF78 W.circ oryzAB213591 W.circ oryAB213589 W.circ circAB213580 W.circ circAB213585 R.zeaecircAF222799 0528A W.circ circAB213579 W.circ circAB213582 W.circ circAB213583 W.circ circAB213584 W.circ circAB213586 W.circ circAB213587 W.circ circAB213581 0545pNF80 ArolfsiiOUTGROUP 100 55 100 59 100 96 100 94 100 96 75 100 92 100 62 96 100 82 76 100 100 97 100 59 54 98 100 60 83 82 81 97 88 94 99 100 62 82 94 99 91 94 99 78 100 60 87 Majority rule W.circ.var zeae W.circ.var agrostis W. circ clade W.circ.var oryzae W.circ.var circinata AG 2 2 LP Binucleate clade AG 1 IA clade W. circ clade W. circ clade W.circ circ oryzAB213590 0472R 0502R 0470B 0501R 0508B 0508C 0508A 0544B 0702B 0714R 0470A 0481R AG22LP AG22IV BEANS5 BEANS7 0706R AG22IIIB AG4HGII AG4HGI BEANS1 BEANS2 BEANS4 RICE1 AG4HGIII 0515A 0515B 0408R 0658R 0650R CORN2 0649R AG1IA 0465R AG7 AG11 AGBI AG9 AG10 AG5 AG12 AG8 AG6 BEANS8pNF117 0647R 0503A 0503R 0524R 0707AB 0633R 0544A 0709R 0631R W.circ zeaeAB213597 W.circ zeaeAB213593 W.circ zeaeAB213594 W.circ agrosAB213575 W.circ agrosAB213570 0705R RICE3 0538pNF78 W.circ oryzAB213591 W.circ oryAB213589 W.circ circAB213580 W.circ circAB213585 R.zeaecircAF222799 0528A W.circ circAB213579 W.circ circAB213582 W.circ circAB213583 W.circ circAB213584 W.circ circAB213586 W.circ circAB213587 W.circ circAB213581 0545pNF80 ArolfsiiOUTGROUP 100 55 100 59 100 96 100 94 100 96 75 100 92 100 62 96 100 82 76 100 100 97 100 59 54 98 100 60 83 82 81 97 88 94 99 100 62 82 94 99 91 94 99 78 100 60 87 Majority rule W.circ circ oryzAB213590 0472R 0502R 0470B 0501R 0508B 0508C 0508A 0544B 0702B 0714R 0470A 0481R AG22LP AG22IV BEANS5 BEANS7 0706R AG22IIIB AG4HGII AG4HGI BEANS1 BEANS2 BEANS4 RICE1 AG4HGIII 0515A 0515B 0472R 0502R 0470B 0501R 0508B 0508C 0508A 0544B 0702B 0714R 0470A 0481R AG22LP AG22IV BEANS5 BEANS7 0706R AG22IIIB AG4HGII AG4HGI BEANS1 BEANS2 BEANS4 RICE1 AG4HGIII 0515A 0515B 0408R 0658R 0650R CORN2 0649R AG1IA 0465R AG7 AG11 AGBI AG9 AG10 AG5 AG12 AG8 AG6 BEANS8pNF117 0647R 0503A 0503R 0524R 0707AB 0633R 0544A 0709R 0631R W.circ zeaeAB213597 W.circ zeaeAB213593 W.circ zeaeAB213594 W.circ agrosAB213575 W.circ agrosAB213570 0705R RICE3 0538pNF78 W.circ oryzAB213591 W.circ oryAB213589 W.circ circAB213580 W.circ circAB213585 R.zeaecircAF222799 0528A W.circ circAB213579 W.circ circAB213582 W.circ circAB213583 W.circ circAB213584 W.circ circAB213586 W.circ circAB213587 W.circ circAB213581 0545pNF80 ArolfsiiOUTGROUP 100 55 100 59 100 96 100 94 100 96 75 100 92 100 62 96 100 82 76 100 100 97 100 59 54 98 100 60 83 82 81 97 88 94 99 100 62 82 94 99 91 94 99 78 100 60 87 Majority rule W.circ.var zeae W.circ.var agrostis W. circ clade W.circ.var oryzae W.circ.var circinata

PAGE 66

66 Figure 32. Phylogenetic tree of rDNA ITS gen sequence from Maximum Parsimony analysis. Numbers above branches indicate bootstrap value. Tree Length: 1740 Consist ency index (CI) : 0.573Retention index (RI) : 0.915 Rescaled consisten cy index (RC)(RC=CI*RI): 0.524. 0472R 0502R 0470B 0501R 0508B 0508C 0508A 0544B 0702B 0714R 0470A 0481R AG22LP AG22IV BEANS5 BEANS7 0706R AG22IIIB AG4HGII AG4HGI BEANS1 BEANS2 BEANS4 RICE1 AG4HGIII 0515A 0515B 0408R 0658R 0650R CORN2 0649R AG1IA 0465R AG11 AGBI AG7 AG9 AG5 AG12 AG10 AG6 BEANS8pNF117 AG8 0545pNF80 0647R 0503A 0503R 0633R 0524R 0707AB 0705R RICE3 0538pNF78 W.circ oryzAB213591 W.circ oryAB213589 W.circ circ oryzAB213590 W.circ zeaeAB213597 W.circ zeaeAB213593 W.circ zeaeAB213594 W.circ circAB213580 W.circ circAB213585 R.zeaecircAF222799 0528A W.circ circAB213582 W.circ circAB213579 W.circ circAB213583 W.circ circAB213584 W.circ circAB213586 W.circ circAB213587 W.circ circAB213581 W.circ agrosAB213575 W.circ agrosAB213570 0544A 0709R 0631R ArolfsiiOUTGROUP 52 100 100 56 86 56 100 59 69 98 62 64 82 100 73 54 99 100 100 100 58 90 100 97 100 62 74 99 100 97 98 84 53 100 52 100 100 66 Bootstrap AG 2 2 LP Binucleate clade AG 1 IA clade W. circ clade W. circ clade W.circ.var zeae W.circ.var agrostis W.circ .var.circ.clade W.circ.var oryzae W. circ clade 0472R 0502R 0470B 0501R 0508B 0508C 0508A 0544B 0702B 0714R 0470A 0481R AG22LP AG22IV BEANS5 BEANS7 0706R AG22IIIB AG4HGII AG4HGI BEANS1 BEANS2 BEANS4 RICE1 AG4HGIII 0515A 0515B 0408R 0658R 0650R CORN2 0649R AG1IA 0465R AG11 AGBI AG7 AG9 AG5 AG12 AG10 AG6 BEANS8pNF117 AG8 0545pNF80 0647R 0503A 0503R 0633R 0524R 0707AB 0705R RICE3 0538pNF78 W.circ oryzAB213591 W.circ oryAB213589 W.circ circ oryzAB213590 W.circ zeaeAB213597 W.circ zeaeAB213593 W.circ zeaeAB213594 W.circ circAB213580 W.circ circAB213585 R.zeaecircAF222799 0528A W.circ circAB213582 W.circ circAB213579 W.circ circAB213583 W.circ circAB213584 W.circ circAB213586 W.circ circAB213587 W.circ circAB213581 W.circ agrosAB213575 W.circ agrosAB213570 0544A 0709R 0631R ArolfsiiOUTGROUP 52 100 100 56 86 56 100 59 69 98 62 64 82 100 73 54 99 100 100 100 58 90 100 97 100 62 74 99 100 97 98 84 53 100 52 100 100 66 Bootstrap AG 2 2 LP Binucleate clade AG 1 IA clade W. circ clade W. circ clade W.circ.var zeae W.circ.var agrostis W.circ .var.circ.clade W.circ.var oryzae W. circ clade

PAGE 67

67 CHAPTER 4 MORPHOLOGICAL CHARACTERIZATION OF RHIZOCTONIA ISOLATES FROM TURFGRASSES AND OTHE R HOSTS IN FLORIDA Introduction Members of the genus Rhizoctonia include a wide collection of pathogenic saprophyt ic, and endophytic species with varying morphological features host range s and geographical distributions ( 101). Many groups within the genus ha ve been considered species complex es ( 19, 35, 36, 47, 61) w ith overlapping and varia ble taxonomy and morphology. Taxonomy of the genus has undergone significant revision in recent years based on sequence data of DNA regions of phylogenetic importance such as i nternal t ranscribed s pacer (ITS) regions and recently, beta tubulin genes ( 20, 27, 34, 35, 38, 47, 53, 60, 61, 91, 94, 95, 110, 111, 113, 121) Species of Rhizoctonia were historically differentiated primary by morphologica l characters (101 ) including affinit y for hyphal fusion (anastomosis reaction) ( 6, 26, 53, 91, 95, 100, 101). Currently 14 anastamosis groups ( AGs ) have been described. However, since the genetic basis of this phenomena are not fully understood and because method (s) of determining AGs is not always accurate ( 5, 19, 26, 53, 95, 97, 117), the use of DNA sequence divergence has become important for additional clarification in classifying isolates in anastomosis groups. In order to clarify taxonomy, many attempts have been made to associate morphological features and sequence data (95). As a result knowledge about this fungus has improved. But, m any taxonomic questions remain, however T he primary objective of this study was to characterize the morphological features of Rhizoctonialike isolates collected from turfgrass and some vegetable hosts in Florida. A s econdary objective was to compare these morphological features with molecular data through the use of ITS sequences.

PAGE 68

68 Materials and Methods Fungal Isolate s Coll ection The m ethodology for collecting isolates was described in the phylogenet ics chap ter three In summary, thirty one isolates were collected from warm season grasses and one isolate was collected from a cool season grass, all from different fields in Florida and thirteen isolates were from vegetables crops ( corn, rice and snap beans ) A complete list of isolates used in this study, describing the plant host, source, year of collection is presented in Table 3 1 and 32 of chapter III. Isolates were recovered from short term storage and were maintained at 25 C in the dark and wer e transferred to PDA every 2 to 3 weeks. During all evaluations, isolates were maintained in Petri dishes (9 cm) containing 20 mL of Potato Dextrose Agar (PDA) medium Cultural Morphology Isolates were incubated at 5 different temperatures (23, 26, 28, 33 and 38C) on 20 mL of PDA medium in the dark, and their morphological features were recorded at different times during the incubation period, starting 1 week after transfer. Isolates were described on the basis of the following cultural characteristics su ch as kind and color of colony and mycelia (aerial, flat, abundance, color), z onation (radial growth), sclerotia formation and features (color, size, location, time to production and estimated number) and finally the determination of nucle ar condition. Fif teen isolates were chose n to estimate the size of sclerotial structures produced at 23, 28 and 33C. The lengt h and width of nine sclerotia randomly chosen from a petri dish were measured for each isolate and temperature, for a total of 27 sclerotia /isolat e. S clerotia l size was estimated using the average of these measurements.

PAGE 69

69 Nucle ar Condition A small of agar plug of each isolate from an active culture grown in PDA was placed on one side of a sterilized glass slide coated with a thin layer of water agar (1. 5 %). Two slides were prepared for each isolate. Slides were located in a moist chamber and incubated at 26 C in the dark and humidity was maintained using wet paper towel s. After 2 or 3 days, mycelia were stained using safranin O in distilled water (0 .5 %) and de stain ed with KOH (3%) (9 ). Young hyphal cells tips were observed microscopicall y under oil immersion (100X). Ten hyphal tips were selected from each slide and the number of nuclei per cell was recorded A total of twenty hyphal tips per isolate w ere observed. Nuclei data w ere analyzed using Statis tical Analysis System (SAS, Institute Inc., Cary, NC ) analysis of variance. Means separation by isolate was done using Fisher Least Significant Difference at P = 0.05 level. M ycelia Growth Rate Mycelia agar disks of 5 mm diameter were taken from the 3 dayold pure culture (grown on PDA) and were transferred to the center of 9 cm petri dishes containing 20 mL of the same medium. Petri dishes were incubated at 26, 28, 33 and 38C in the dark. Three replications were done for each isolate and for each temperature. Each experiment was replicated 4 times. Colony diameter was measured every 24 hours, until the colony of any isolate reached the edge of the petri dish. Colony growth rate per day was calculated as the difference of radial growth between ratings. Data obtained w ere analyzed using Statistical Analysis System (SAS, Institute Inc., Cary, NC) through analysis of variance for mean separation using Least Significant Difference at P = 0.05 level.

PAGE 70

70 Results Morphological Characterization Morphological characters are summarized in (Table 4 1) Sclerotial features varied among isolates and are summarized in Table 4 2. Figure 44 show s the sclerotia features of the different Rhizoctonia spp. Sixteen isolates pro duced aerial mycelia with light to dark brown colonies. Ten isolates formed a group with buff appearance (Fig. 41 (A, B and C). Isolates 0465, 0649 and 0650 shared similarity mainly in colony color (light to dark brown) (Fig. 4 1D and E ) but isolates 0408 and 0658 were slightly different from the others B oth showed light brown colonies, with sandy appearance (Fig. 4 1G, H and I ). Isolate 0658 produced little aerial mycelia, and 0408 produced few dense aerial mycelia strands and had zonate growth at 33C. Eleven isolates had a flat growth, feathery appearance, without or with aerial hyphae and with colony colors ranging from beige to medium yellow, orange and pink (Fig.42 (A I ) These isolates were further divided into three additional groups, using da ta from mycelial growth rate. Isolates 0647, 0503A (Fig.42B ) 0524, 0633(Fig. 42D) 0707AB had colonies that were white or a light yellow mixed with light pink and orange pigmentation. Isolates 0705 (Fig.4 2C) and 0538 had similar colony morphology but had more aerial mycelia that became denser with extended incubation. Isolates 0544A (Fig.42I ) 0709, 0631(Fig.42A) and 0528A were mainly light yellow to beige without a erial mycelia. Zonation was only observed for 0633 and 0707. Colonies of 0515A, 0515B (Fig.42E) and 0545 were considered unique due to their distinct morphology and were classified as Rhizoctonialike isolates. Colonies were white to dark beige without aerial mycelia and with zonate growth (Table 4 1 ). At 380C isolates were affected morphologically. I solate 0538 produced a white and crinkled dense mycelia with cottony appearance and isolates 0503A and 0633 showed similar features, but without the crinkled growth.

PAGE 71

71 Mycelial Growth Rate The mycelial growth rate s of the isolates are summarized in Table 4.3. Significant differences between isolates in each temperature were observed; however the growth at 250C and 280C was similar for most of the isolates. At 28 0C isolates had higher rates of growth, specially the Waitea circinata group. At 33 0C, the growth of isolates from R. solani group decreased dramatically; only W. circinata isolates continue growing. Most isolates were not able to grow at 380C. Nucle ar Condition Number of nuclei per hyphae differ ed between isolates and are summari zed in table 4.1. Isolates were binucleate (Fig. 28) and multinucleate (Figs. 30 32). The n umber of nuclei ranged from two to eleven Other features of Rhizoctonia solani such dolipore septa were observed (Fig. 29). Discussion T wo main groups of isolates w ere clearly distinguished and related to suspected species. They were the Rhizoctonia solani group with aerial mycelia production and brown pigmentations and the Waitea circinata group with different colony colors and little aerial mycelia. Isolate 0545, which had very distinct features is most likely not a Rhizoctonia species but Marasmius oreades Sclerotial features also were considered important for the di fferentiation of these species. Some R hizoctonia solani isolates produced large sclerotial structu res on the agar surface and some isolates of W circinata produce d small sclerotia with orange pink and red pigmentation These were commonly submerged in the medium .These sclerotial observations agree with those previously reported ( 56), in addition, re d pigmentation of sclerotia also observed for R zeae isolates in this study The presence of the three variants of W circinata is supported by slight differences in colony morphology and sclerotia features. However, the

PAGE 72

72 classification of three isolates ( 0544A, 0709 and 0631) remains uncertain. These isolates shared sclerotial features and colony morphology with the R zeae isolates and with the isolate of W circ.var circinata. However, s clerotia were produced on the agar surface and their mycelial growth rate decreased at 33 C. Some isolates produce d no real sclerotia as it has been reported previously by S neh et al 1991 and Aoyagi et al 1998. Morphological features described in this study for that group agree with those report ed for AG 2 2IIIB IV and LP. AGs commonly associated with brown patch and large patch diseases on warm season (IV LP) and cool season grasses (IIIB) At higher temperatures (33 C) mycelial growth decreased which also agrees with Hyakumachi et al 1998. Differences in morphology cl early indicate that a number distinct species of Rhizoctonia are present in the UF collection from turfgrasses. All of them, except for isolate 0528A were collected from warm season grasses. Among them are: Rhizoctonia solani (AG 2 2 IIIB IV and LP), Rhizo ctonia solani (AG 1 IA), Waitea circinata var zeae Waitea circinata var oryzae, Waitea circinata var circinata Ceratobasidium sp (AGD R. cerealis), Ceratobasidium sp (AGG) and Tricholomataceae sp. Previous reports have indicated that R. zeae and R. oryzae occurs as pathogens of cool and warm season grasses, mostly grown in warm humid regions. Isolate 0706, collected from bermudagrass had similar morphology to AG 2 2 IIIB IV isolates and tested negative for AG 2 2 LP primer (111) This isolate m ay be something different. Three isolates with morphology similar to R. solani AG I 1A were collected from St. Augustinegrass on lawns showing brown patch (not large patch) symptoms at the end of the summer. The presence of real sclerotia and the absence o f buff mycelia placed them in a different morphology group in this study. This AG is reported to caus e sheath blight of rice and

PAGE 73

73 sheath b light on creeping bentgrass but has not been reported to cause brown patch disease on warm season grasses. This is the first report of brown patch presumably caused by R. solani AG 1I A on warm season grasses. Isolates of W circ group (var zeae and oryzae ) were collected mainly from b ermudagrass, but also from seashore paspalum and St. Augustinegrass. B inucleate isolate s were collected from bermudagrass and W. circ. var circinata was isolated from Poa trivialis. Colony features were not substantially different between temperatures of 23 to 33C within groups of isolates. Changes in morphology were evident for some isola tes at 33C. O nly s everal isolates of W circ. group were able to grow at 38C but their growth rates were not significantly higher (11 mm/day) than at lower temperatures Growth at this temperature could help preliminarily determine if isolates may be in this group. Growth rate of the isolates were similar between 25 and 28C but 23 isolates had increased growth rates at 28 C which was optimal for growth. Growth of 0515A and 0515B ( R cerealis) was reduced at 28C, suggesting that the optimal temperature for these particular isolates is less than 25C. At 33 C, 23 of the isolates had a significant decrease in growth rate. Isolates in W. circ. group had similar rates at 28C Four isolates (0515A, 0515B, 0709 and 0631) were not able to grow at this temper ature Isolates 0709 and 0631 are similar to W circ. var zeae in morphology, so they were expected to grow at this temperature (113). However, growth r ates of these two isolates were similar to 0528A (var circinata ), which may indicate that they are closer to circinata variety than zeae and oryzae. At 38 C isolates were not able to growth. Nucle ar condition was not a determinant for isolate identification. Thirty three isolates were multinucleate and four were binucleate This finding determined the pres ence of binucleate

PAGE 74

74 species within the collection. Isolates with multinucleate condition showed variation between isolates. The higher numbers of nuclei were seen in isolates of R solani There was no consistent difference between young and old hyphae (d ata not shown). Although hyphal diameter was not measured, it was observed during nuclei counts that hyphal cells of R solani isolates were noticeably wider than those of W circ. group. Although, morphological features were relatively stable at differe nt temperatures, they should only be considered a step in correct identification of the pathogen. Many authors report that they are not tot ally stable A dditional information, like molecular data (gene sequencing or PCR tests) and/or morphology under diff erent culture media should be combined to support observations of morphological features under specific conditions to approach a correct isolate identification.

PAGE 75

75 Figure 41. Colony features of Rhizoctonia isolates.A) to C) Is olates of AG 2 2IIIB IV: 0481, 0502, 0544B. D) E) Isolates of AG I 1A: 0465 and 0650. F) 0706. G) to I). Ceratobasidium sp AGG: 0658 and 0408 at 28 and 33 0C. A B C D E F G H I

PAGE 76

76 Figure 42. Colony features of Rhizoctonia isolates. A) 0631 ( R zeae W circinata ). B) 0503A ( W circinata var circinata). C) 0705 ( R oryzae W circ.). D) 0633 ( R zeae W circ inata). E) 0515A B ( R cerealis Ceratobasidium AGD). F) G) AG HGIII: Beans 2 and 4. H) Beans 7 ( T cucumerisR sol ani ). I) 0544A ( W circinata) A F E D B C G H I

PAGE 77

77 Figure 43. Different classes of sclerotia of Rhizoctonia species. A) 0470A. B) 0503A. C) 0515A B. D) 0524. E) 0647. F) Beans 7. G) 0538. H) Rice 1. I). Rice 4. A B C D E F G H I

PAGE 78

78 Figure 44. Nucle ar condition of Rhizoctonia species A) Binucleate condition on isolate 0408. B) Dolipore septa of Rhizoctonia solani isolate. C) to E). Different nuclei number in multinucleate isolates. A B C D E

PAGE 79

79 Table 4 1. Morphological features of Rhizoctonia spp. Isolate Nuclei/cel l Colony description 23 33 0 C Color 23 33 0 C 0502 6 Light brown aerial mycelia. Buff appearance. Light dark brown colony 0470B 5.3 Light brown thin aerial mycelia. Buff appearance. Light dark brown colony. 0501 4.7 Light brown dense aerial mycel ia. Buff appearance. Light dark brown colony. 0508A 6.0 Light brown thin aerial mycelia. Buff appearance. Light dark brown colony. 0508B 10.5 Light brown thin aerial mycelia. Buff appearance. Light dark brown colony. 0508C 6.2 Light brown thin aerial mycelia. Buff appearance. Light dark brown colony. 0702B 8.8 Dark beige dark brown dense aerial mycelia. Dark beige dark brown colony. 0714 6.3 Light brown dense aerial mycelia. Buff appearance. Light dark brown colony. 0470A 5.7 Light br own thin aerial mycelia. Buff appearance. Light dark brown colony. 0481 10. 1 Light brown thin aerial mycelia. Buff appearance. Light dark brown colony. 0508B 10.5 Light brown thin aerial mycelia. Buff appearance. Light dark brown colony. 0544B 5.9 Light brown dense aerial mycelia. Buff appearance. Light dark brown colony. 0472 6.6 Thin light brown aerial mycelia. Light brown thin aerial mycelia. Buff appearance. 0515A 2.0 Flat growth. Sandy appearance. No aerial mycelia. White dark beige c olony 0515B 2.0 Flat growth. Sandy appearance. No aerial mycelia. White dark beige colony 0706 6.9 Medium brown thin aerial mycelia. Zonation. Dark beige medium brown colony. 0408 2.0 Light brown aerial mycelia. Few but dense mycelia. Zonation at 28 0C Light medium brown colony. 0658 2.0 Thin few light brown aerial mycelia. Sandy appearance. Light brown colony. 0650 3.6 Medium brown aerial mycelia. Medium dark brown colony. 0649 6.5 Light brown colony and white few thin aerial mycelia. Light brown colony. 0465 4.6 Light brown thin few aerial mycelia. Light dark brown colony. 0647 2.1 Flat growth. Few thin aerial mycelia, color dark beige Dark beige dark greyish colony. 0503A 5.1 Flat and feather growth. No aerial mycelia. Whi te light yellow pink colony 0524 4.6 Flat growth. Few aerial mycelia. Crinkled growth. Dark beige white colony. 0633 4.6 Flat and feather growth. No aerial mycelia. Zonation Beige light orange or pink colony. 0707AB 5.6 Flat growth. Beige white thin aerial mycelia.Zonation Medium pink beige colony. 0631 5.1 Flat colony. Feather growth. No aerial mycelia. Beige light yellow. 0705 7.9 Flat and feather growth. Dark beige yellow thin aerial mycelia. Dark beige yellow colony. 0538 6.3 Flat and feather growth. Light yellow white few thin aerial mycelia. Light yellow pink colony. 0544A 5.1 Flat colony. Feather growth. No aerial mycelia. Light orange 0709 5.9 Flat colony. No aerial mycelia. Light yellow beige colony. 0528A 6.5 Flat and feather growth Light yellow beige colony, thiny aerial mycelia. 0545 unknown Flat and feather growth Dark white ligh t yellow colony. *This feature was only observed in this isolate at 28 0C. **Not or weak growth was observed at 38 0C.

PAGE 80

80 Table 4 2. Sclerotial features of Rhizoctonia spp. Days Color Size Location Sclerotial number Observation 9 Cream, light brown Small, very small Above Many, NC Cotton appearance, mainly old growth, aggregated, round. 6, 9 Cream-ligh medium brown, light Small-medium, VS Above Many Mainly in new growth, round. orange, dark brown with time Small-medium 5,6 Medium brown, cream-beige, white Small, very small Above Many, NC Aggregated, star formation. 4,5,6 Light-medium brown, white Very smallS-M Above Many, NC Star formationscattered, aggregated, No real sclerotia. 4, 6, 9 Light-medium brown Small-medium Above Many, NC Aggregated circular, new growth, round. 4, 5, 6 White young, medium brown-brown Smallmedium-big Above Many, C (74-100 at 9 day) Some with exudate,new-old growth. Some like tumors. 9 Orange, salmon Small-medium A-below Many, NC New growth. Aggregated more noticeable with time, round. 6,9 Dark brown, light brown Small, very small Above Many, NC Distributed in all media, aggregated circular. 5, 6 Cream, light brown, dark brown with Small-medium Above Many, NC Cotton balls when young, mainly in old growth. time. Medium (15 days) Below Few 5,9 White, beige Small-medium Above Many, NC Aggregated circular, old growth, cotton. 5,9 White, some light brown Small-very small Above Many, NC Aggregated circular, old growth, cotton, exudate, round,new growth. 6, 9 Cream, light pink, white,light brown Very small,s-m, some B Above Many, NC Aggregated, scattered, cotton, old growth, orange exudate. Round mass appearance. 3,4,5 Brown, white young Medium-big, big with time Above Many, C Approximately 100-122 sclerotia at 9 days, new growth. 12 Dark orange, dark red with time Very small A-below Few Round, found in medium growth. 60 at 15 days. 12 Dark orange, dark red with time Small A-some B Approx, 45 Mainly in new growth, but also distributed, round. 5 Light brown Very small Below Many, NC Aggregated, star formation. 15 Light orange, salmon Very small-medium Above-B Many, NC Mainly new growth, round. 19 Light brown Small Star formation. 19 Cream Medium Above Mainly in new growth. 19 Light brown Small Star formation. 19 Light brown Small Above all, S: small, M: medium, B: big. a: elow. ntable, sclerotia-like, C:countable

PAGE 81

81 Table 4 3. Mycelial growth rate of Rhizoctonia spp at different temperatures. Colony growth rate (cm/day) Isolate 25 28 33 38 0502 1.4 1.4 0.6 0.05 0470B 1.7 1.9 0.5 0.12 0501 1.5 1.7 0.6 0.18 0508A 1.9 2.3 0.96 0.07 0508B 1.9 2.3 1.0 0.16 0508C 2.0 2.2 1.3 0.17 0702B 1.4 1.3 0.2 0 0714 1.9 2.2 0.8 0.13 0470A 1.7 2.0 0.6 0.06 0481 1.6 1.6 0.8 0.07 0544B 0472 0515A 0.87 0.71 0 0 0515B 0.84 0.62 0 0 0408 1.3 1.8 1.5 0.40 0658 1.2 1.6 1.4 0.77 0650 1.9 2.8 1.2 0 0649 2.1 2.5 1.7 0.18 0465 2.3 2.7 1.7 0.21 0647 1.8 2.5 2.1 0.58 0503A 2.0 2.6 2.6 0 0524 2.0 2.8 2.7 1.0 0633 2.0 2.8 2.7 1.1 0707AB 1.4 2.3 1.9 0 0631 2.3 2.4 0.2 0 0705 2.0 2.6 2.0 0.30 0538 2.2 2.8 2.4 0.70 0544A 2.0 2.5 1.3 0 0709 1.8 1.5 0 0 0528A 2.0 2.4 1.6 0.37 0545 1.0 1.7 1.8 0.27 M eans of mycelial growth rate were analyzed using Fisher Least Significant Diffe rence at P <0.05 level.

PAGE 82

82 C HAPTER 5 SUMMARY AN D CONCLUSIONS Growth chamber inoculations of diploid and triploid St. Augustinegrass (SAG) genotypes with different morphotypes (Longicaudatus=long bladed leaves and Breviflorus= dwarf semi dwarf plants) using brown patch and large patch isolates resulted on successful infections for both diseases. Delay in disease response was observed on some genotypes at 48 h after the inoculation; however by the end of the experiments, no material was found to be immune to the isolates. Genotypes showed different levels of suscep tibility, with long bladed genotypes less affected in terms of AUDPC, rate parameter and fin al severity. Ploidy level had no effect on disease response; indicating that additional factors associated with resistance are may be present besides ploi dy. Structural mechanisms of defense against Rhizoctonia suggested by many authors appeared not to play a role on SAG genotypes; however, experiments were not designed to elucidate resistance mechanisms. Brown patch (BP) isolate was confirmed as anastomosi s group 1IA, reported causing BP on different cool season grasses, but not previously reported on warm season grasses, which constitutes a possible first report of this AG in Florida. AUDPC was the most informative disease measurement to evaluate genotyp es for their disease response. Response of the genotypes was different for both isolates, therefore, future screening studies should be focused on evaluating materials against large patch disease, the most economical and serious disease on warm season grasses. Potential effects of environmental conditions and plant age should be studied to und erstand better this pathosystem better. Ef f ectiveness of the AG 2 2 LP primers and the protocol was observed through the presence of thirteen positive isolates from warm season grasses, confirming the reports of this AG made by different authors. Only one isolate was identified as AG 2 2 IIIB. Cloning

PAGE 83

83 procedure, not commonly used for Rhizoctonia researchers was successful for the obtention of excellent quality of sequen ce data of the ITS rDNA gene. The heterozygous condition of t he fungus was clearly observed t hrough nucleotides differences on sequence data of different clones of the same isolate. For phylogenetic analysis of this species complex it is highly suggested t o use molecular methodologies that produce unambiguous data. Thus, data from different research groups can be used confidently to perform different analyses. Tree topology using the most common phylogenetic analyses was highly similar, supporting the resul ts obtained. However, maximum parsimony and Bayesian analysis explained the data better. R. solani W. circinata, A. rolfsii and M. oreades isolates were clearly differentiated in the trees. Within R. solani clade, some AG testers isolates appeared to be as independent evolutionary units with possible polypha letic origin. Different varieties of W. circinata species were well differentiated in the clade. H owever, three isolates of the UF collection could not be easily identified as W. ci rcinata varieties. A high level of sequence variation was observed in the rDNA ITS 1 2 regions of Rhizoctonia spp; however 5.8s rDNA gene appears to be highly conserved, mainly within species. One isolate of Poa trivialis a cool season grass, was identified as Waitea circin ata var. circinata for first time in Florida. Morphological features and inoculations to observe its pathogenicity, corroborate d these results. AG 1 IA and AG 4 HG II and AG 4 HG III were isolated from vegetables crops. The analysis also confirmed the presence the AG 1 IA isolates collected on St. Augustinegrass, a warm season grass. App arently, it may also constitute the first report of this AG on the host. Morphol ogy features of the isolates were highly correlated with phylogenetic clades.

PAGE 84

84 Currently, phylogenetic and molecular systematics of Rhizoctonia species are one of the most principal subject of research. Thus, results of sequence data obtained with this study, are considered a great contribution for actual and future investigations. Based on morphology, isolates were also clearly differentiated. Four groups were formed. The first one grouped isolates with dark brown colonies, aerial and dense mycelia production, without the presence of sclerotia. The second group showed brown colonies, with thiny ae rial mycelia or absence of it and with production of evident a lot of units of sclerotia on surface. The third group, only had few isolates, showing brown colonies, with zonation, dense aerial mycelia, and without sclerotia formation. All of these isolates were classified within Rhizoctonia solani group. The last group, was conformed by isolates with colonies showing: beige, light yellow, orange and pink colors, with flat, feather growth, and thiny aerial mycelia. The group was further divided based on scle rotia features. Some isolates produced these structures only on agar surface, others only submerged and some in both locations of the dish. They were smaller than R.solani isolates, and usually showed similar colony colors These isolates were classified w ithin W. circinata group. Morphology was agree with description of the AG 22 LP, AG 1 IA, R. oryzae R. zeae and R. circinata species, reported in the literature. Morphology and mycelial growth rate were similar in tem perature ranges from 23 0C to 33 0C u sing PDA media and dark conditions. At higher temperatures such as 38 0C mycelial growth rate decreased, dramatically for R. solani isolates. Waitea circinata isolates were able to continue growing as reported in the literature. Nuclei condition was only informative to classify isolates on multinucleate and binucleate

PAGE 85

85 condition. In multinucleate isolates, t he nuclear number did not provide significant information to differentiate isolates.

PAGE 86

86 APPENDIX A SAS PROC MIXED CODE TO ANALYZE INTRINSEC RATE OF GROWTH OPTIONS PS=65 LS=70; DATA norma1; input cultivar $ rep rpar exp; cards; NUF146 1 0.13516 1 NUF146 1 2 NUF146 2 0.1476 1 NUF146 2 0.20164 2 NUF146 3 0.65787 1 NUF146 3 0.08368 2 NUF152 1 0.26027 1 NUF152 1 0.21972 2 NUF152 2 0.23461 1 NUF152 2 0.29863 2 NUF152 3 0.51835 1 NUF152 3 0.41415 2 NUF157 1 0.16642 1 NUF157 1 0.11741 2 NUF157 2 0.16769 1 NUF157 2 0.24907 2 NUF157 3 0.43378 1 NUF157 3 0.20164 2 NUF171 1 0.30187 1 NUF171 1 0.22255 2 NUF171 2 0.1976 1 NUF171 2 0.04626 2 NUF171 3 0.1579 1 NUF171 3 0.0715 2 ; proc mixed data=norma1; class exp cultivar; model rpar=cultivar/outp=out_resid DDFM=SAT; random exp; lsmeans cultivar/pdiff adjust=tukey; run; proc gplot d ata=out_resid; plot resid*pred; plot pred*rpar; run; proc univariate data=out_resid normal plot; var resid; run; The same SAS code was used to analyze AUDPC and final severity for Brown patch and Large patch inoculations.

PAGE 87

87 APPENDIX B SAS PROC CONTRAST TO ANALYZE THE EFFEC T OF PLOIDY AND MORP HOTYPES OVER DISEASE RESPONS E title 'Experiment 10465'; data experiment1; input cultivar $ rep AUDPC Ymax r; cards; ; proc glm; class cultivar; model audpc Ymax r = cultivar; contrast'ploidy level 2 vs 3' cultivar 7 7 13 13 7 13 7 7 7 7 7 7 7 7 13 13 7 7 13 13; contrast 'morpho long vs short' cultivar 9 9 9 9 11 9 9 11 9 11 11 11 11 9 9 9 11 11 9 11; means cultivar/LSD; lsmeans cultivar/stderr tdiff; run;

PAGE 88

88 REFERENCES 1. Agrawal, R. L. 1998. Disease resistance breeding. In:Fundamentals of Plant Breeding and Hybrid S eed Production. Science Publishers, Enfield, N.H. 2. Agrios, G. N. 2005. Plant Pathology. 5th ed. Els evier Academic Press, Boston. 3. Alexopoulos, C. J, Mims, C. W., and Blackwell, M. 1996. Introductory Mycology. 4th Ed. John Wiley & Sons, New York, New York. 869 pp. 4. Alvarez, J. M., and Hoy, M. 2002. Evaluation of the ribosomal ITS2 DNA sequences in separating closely related populations of the parasitoid Ageniaspis (Hymenoptera: Encyrtidae). Ann. Entomol. Soc. America. 95:250256. 5. Andersen, T. F. 1996. A comparative taxonomic study of Rhizoctonia sensu lato employing morphological, ultrastructural and molecular methods. Mycol. Res. 100:11171128. 6. Anderson, N. A. 1982. The genetics and pa thology of Rhizoctonia solani Annu. Rev. Phytopathol. 20:329347. 7. Aoyagi, T., Kageyama, K., and Hyakumachi M. 1998. Characterization and survival of Rhizoctonia solani AG 2 2 LP associated with large patch disease of Zoysia grass Plant Dis. 82:857863. 8. Atilano, R., and F reeman, T. E. 1981..Brown patch of turfgrasses. Plant pathology fact sheet. Institute of Food and Agriculture Sciences. University of Florida. Gainesville, Florida. Florida Cooperative Extension Service. PP20. 9. Bandoni, R. J. 1979. Sa franin O as a rapid nuclear stain for fungi. Mycologia 71: 873 874. 10. Bonos, S. A., Clarke, B. B., and Meyer, W. A. 2006. Breeding for disease resistance in the major cool season turfgrasses. Annu. Rev. Phytopathol. 44:213 234. 11. Boysen, M., Borja, M., del Moral, C., Salazar, O., and Rubio, V. 1996. Identification at strain level of Rhizoctonia solani AG4 isolates b y direct sequence of asymmetric PCR products of the ITS regions. Curr. Genet. 29:174 181. 12. Busey, P., T. K., Broschat, and B.J., Cent er. 1982. Classification of St. Augustinegrass. Crop Sci. 22:469473. 13. Busey, P. 1986. Morphological identification of St. Augustinegrass. Crop Sci. 26:2832/ 14. Busey, P. 1995. Genetic diversity and vulnerability of St. Augustinegrass. Crop Sci.35:322327. 15. Bruns T. D., White T. J., and Tailor, J. W. 1991. Fungal molecular systematics. Annual Rev. Ecol. System. 22:525564.

PAGE 89

89 16. Burpee, L., and Martin B. 1992. Biology of Rhizoctonia species associated with turfgrasses. Plant Dis. 76:112117. 17. Burpee, L. L. 1992. Assessment of resistance to Rhizoctonia solani in tall fescue based on disease progress and crop recovery. Plant Dis. 76:10651068. 18. Brosnan, J. T., and Deputy, J. 2008. St. Augustinegrass. Turf management TM 3. Cooperative Ext ension Service. University of HawaiI at Manoa. 19. Carling, D. E. 1996. Grouping in Rhizoctonia solani by hyphal anastomosis. In: Rhizoctonia species: Taxonomy, Molecular Biology, Ecology, Pathology and Disease Control. Sneh, B.,Jabaji Hare, S., Neate, S ., Dijst, G, eds. Kluwer Academic Publishers, Dordrecht, the Netherlands. 20. Carling D. E., Kuninaga, S., and Brainard, K. A. 2002. Hyphal anastomosis reactions, rDNAinternal transcribed spacer sequences, and virulence levels among subsets of Rhizocton ia solani anastomosis group 2 (AG2) and AG BI. Phytopathology 92:4350. 21. Casler, Michael Darwin, Duncan, Ronny R. 2003. Turfgrass Biology, G enetics, and B reeding. John Wiley & Sons, Inc., Hoboken, N.J. 22. Chang, S. W., Chang, T. H., Abler, R. A. B ., and Jung, G. 2007. Variation in bentgrass susceptibility to Typhula incarnata and in isolate aggressiveness under controlled environment conditions. Plant Dis. 91:446452. 23. Cook, B. G, Pengelly, B. C., Brown, S. D., Donnelly, J. L., Eagles, D. A., Franco, M. A., Hanson, J., Mullen, B. F., Partridge, I. J., Peters, M., and Schultze Kraft, R. 2005. Tropical Forages: an interactive selection tool., [CD ROM], CSIRO, DPI&F(Qld),CIAT and ILRI, Brisbane, Australia. 24. Craenen K., and O rtiz R. 1996. E ffect of the black sigatoka resistance locus bs1 and ploidy level on fruit and bunch traits of plantain banana hybrids. Euphytica 87:97101. 25. Cubeta, M. A., Echandi, E., Abernethy, T., and Vilgalys, R. 1991. Characterization of anastomosis groups of binucleate Rhizoctonia species using restriction analysis of an amplified ribosomal RNA gene. Phytopathology 81:13951400. 26. Cubeta, M. A., and Vilgalys R. 1997. Population biology of the Rhizoctonia solani complex. P hytopathology 87:480484. 27. de la Cerda, K., Douhan, G. W., and Wong, F. 2007. Discovery and characterization of Waitea circinata var. circinata affecting annual bluegrass from the Western United States. Plant Dis. 91:791797. 28. Dudeck, A. E. St Augustinegrass preformance in North F lorida. Turfgrass Science University of Florida, Gainesville. Institute of Food and Agricultural Sciences. www.turf.ufl.edu/researchstaugustine98.shtml Retrieved on 07/06/2009.

PAGE 90

90 29. Engelke s, C. A., and Windels, C. E. 1994. Relationship of plant age, cultivar, and isolate of Rhizoctonia solani AG 2 2 to sugar beet root and crown rot. Plant Dis. 78:685689. 30. Elliot, M., and Simone, G. W. 2001. Brown patch. University of Florida Extension sheet. I nstitute of Food and Agricultural Sciences. SS PLP 5. 31. Flentje, N. T. 1957. Studies on host penetration and resistance and strain specialization. Trans. Br. Mycol. Soc. 40:322336. 32. Flor, N., Harmon, P., Datnoff, L. E., Raid, R., and Nagata, R. 2008. First report of brown ring patch caused by Waitea circinata var. circinata on Poa trivialis in Florida. Plant Dis. 92: 11. 33. Foolad, M. R., Ntahimpera, N., and Christ, B. J. a nd Lin,G. Y. 2000. Comparison of field, green house, and detachedleaflet evaluations of tomato germ plasm for early blight resistance. Plant Dis. 84:967972. 34. GodoyLutz, G., Kuninaga, S., Steadman, J. R., and Powers K. 2008. Phylogenetics analysis of Rhizoctonia solani subgroups associated wit h web blight symptoms on common bean based on ITS 5.8S rDNA. J Gen Plant Pathology 74:3240. 35. Gonzalez, D., Carling, D. E., Kuninaga, S., Vilgalys, R., and Cubeta, M. A. 2001. Ribosomal DNA systematics of Ceratobasidium and Thanatephorus with Rhizoc tonia anamorphs. Mycologia 93:11381150. 36. Gonzalez, V., Salazar, O., Julian, M. C., Acero, J., Portal, M. A., Munoz, R., Lopez Corcoles, H., Gomez Acebo, E., Lopez Fuster, P., and Rubio, V. 2002. Ceratobasidium albasitensis. A new Rhizoctonia like fun gus isolated in Spain. Persoonia 17:601614. 37. GonzalezHernandez D. 2002. Estado actual de la taxonomia de Rhizoctonia solani Kuhn. Revista M exicana de Fitopatologia 20 :200205. 38. Gonzalez, D., Cubeta, M. A, and Vilgalys, R. 2006. Phylogenetic uti lity of indels within ribosomal DNA and B tubulin sequences from fungi in the Rhizoctonia solani species complex. Mol. Phylogenet. Evol. 40:459470. 39. Green II, D. E., Burpee, L. L., and Stevenson, K. L. 1999. Components of resistance to Rhizoctonia solani associated with two tall fescue cultivars. Plant Dis. 83:834838. 40. Guleria, S., Aggarwal, R., Thind, T. S., and Sharma, T. R. 2007. Morphological and pathological variability in rice isolates of Rhizoctonia solani and molecular analysis of their genetic variability. Journal of Phytopathology 155:654661. 41. Hagan, A. K. 1999. Controlling brown patch on warm season trufgrasses in home lawns. Auburn University Extension Sheet. ANR 492. 42. Hall, B. G. 2008. Phylogenetics trees made easy: a how t o manual. 3rd ed. Sinauer Associates.

PAGE 91

91 43. Haygood, R. A., and Martin, S. B. 1990. Characterization and pathogenicity os species of Rhizoctonia associated with centipede grass and St. Augustinegrass in South Carolina. Plant Dis. 74:510514. 44. Huelsenbe ck J P ., and Rannala B. 1997. Phylogenetic methods come of age: testing hypothesis in an evolutionary context. Science 276:227232. 45. Hsiang, T., Olds, D., and Gowan R. 2006. A new Rhizoctonia fungus on turfgrass in Ontario. GreenMaster 41 :2830. 46. Hurd, B., and Grisham, M. P. 1983. Rhizoctonia spp. associated with brown patch of Saint Augustine grass. Phytopathology 73:16611 665. 47. Hyakumachi, M., Mushika, T., Ogiso, Y., Toda, T., Kageyama, K., and Tsuge T. 1998. Characterization of a new c ultural type (LP) of Rhizoctonia solani AG 2 2 isolated from warm season turfgrasses, and its genetic differentiation from other cultural types. Plant Dis. 47:19. 48. Jia, Y., Correa Victoria, F., McClung, A., Zhu, L. Liu, G., Wamishe, Y., Marchetti, M A., Pinson, S. R. M., Rutger, J. N., and Correll, J. C. 2007. Rapid determination of rice cultivar responses to the sheath blight pathogen Rhizoctonia solani using a microchamber screening method. Plant Dis. 91:485489. 49. Jones, R. K., and Belmar, S. B. 1989. Characterization and pathogenicity of Rhizoctonia spp. isolated from rice, soybean, and other crops grown in rotation with rice in Texas. Plant Dis. 73:10041010. 50. Kammerer, S. J., and Harmon, P. F. 2008.The importance of early and accurate diagnosis of Rhizoctonia diseases. Golf Course Management. Pages 92 98. 51. Keinath, A. P., and Farnham, M. W. 1997. Differential cultivars and criteria for evaluating resistance to Rhizoctonia solani in seedling Brassica oleracea Plant Dis. 81:946952. 52 Kimura, M. 1980. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol. 16:111120. 53. Kuninaga, S., Natsuaki, T., Takeuchi, T., and Yokosawa R. 1997. Sequence va riation of the rDNA ITS regions within and between anastomos is groups in Rhizoctonia solani Curr. Genet. 32:237243. 54. Kuninaga, S., Nicoletti, R., Lahoz, E., and Naito, S. 2000. Ascription of Nt isolates of Rhizoctonia solani to anastomosis Group 21 (AG 2 1) on account of rDNA ITS sequence similarity. J. Plant Pathol. 82:61 64. 55. Latin, R. 2005. Brown patch. Turfgrass Disease Profiles. Purdue Extension Sheet. Purdue University. BP 106W.

PAGE 92

92 56. Leiner, R. H ., and Carling, D. E. 1994. Characterizat ion of Waitea circinata ( Rhizoctonia) isolated from agricultural soils in Alaska. Plant Dis. 78:385388. 57. Li J ., Martin, B. S., Jeffers, S. N., Dean, R. A., and Camberato, J. J. 2005. Genetic variation among Rhizoctonia solani isolates from warm season turfgrasses. Inter. Turf. Soc. Res. J. 10:230236. 58. Liddell, D. E., Datnoff, L. E., and Nagata, R. T. 2001. Screening of brown patch (caused by Rhizoctonia solani Kuhn) resistance on St. Augustinegrass, and the influence of fertilization with Sil icon on the disease development. Everglades Research and Education Center, University of Florida, Belle Glade. Research report. 59. Liskey, E. 2002. Strobilurin fungicides: Nature's cle anup crew. Grounds maintenance. http://grounds mag.com/mag/grounds maintenancestrobilurin fungicides natures/index.html Retrieved on 07/06/2009. 60. Liu, Z., and Sinclair, J. B. 1992. Genetic diversity of Rhizoctonia solani anastomosis group 2. Phytopathology 82:778787. 61. Liu, Z., a nd S inclair, J. B. 1993. Differentiation of intraspecific groups within anastomosis group 1 of Rhiz octonia solani using ribosomal DNA internal transcribed spacer a nd isozyme comparison s. Can. J. Plant Pathol. 15:272280. 62. Lopez Olmos, K., Hernandez Delgado, S., and MayekPerez, N. 2005. AFLP fingerprinting for identification of anastomosis groups of Rhizoctonia solani Kuhn from common bean ( Phaseolus vulgaris L.) in Mexico. Revista M exicana de Fitopatologia 23:147151. 63. Ma, M., Tan, T. K., and Wong, S.M. 2003. Identification and molecular phylogeny of Epulorhiza isolates from tropical orc hids. Mycol. Res. 107:10411049. 64. Madden, L. V., Bosch, F. V. D., and Hughes, G. 2007. Study of Plant Diseases Epidemics. American Phytopathological Society, St. Paul, MN. 65. Maniatis, T., Fritsch, E. F., and Sambrook, J. 1982. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Sping Harbor, New York. 66. Manici L. M., and Bonora P. 2007. Molecular genetic variability of Italian binucleate Rhizoctonia spp. isolates from strawberry Eur. J. Plant Pathol. 118:3142. 67. Marshall, D. S., and Rush, M. C. 1980. Infection cushion formation on rice sheaths by Rhizoc tonia solani Phytopathology 70:947950. 68. Martin, S. B., and Lucas, L.T. 1983. Pathogenicity of Rhizoctonia zeae on Tall fescue and other turfgrasses. Plant Dis. 67:676678.

PAGE 93

93 69. Martin, S. B., and Lucas, L. T. 1984. Characterization and pathogenicity of Rhizoctonia spp. and binucleate Rhizoctonia like fungi from turfgrasses in North Carolina. Phytopathology 74:170175. 70. Menendez, J. L. 2008. Stenotaphrum secundatum (Walter) Kuntze". Asturnatura .com [ en linea]. Num. 104, 09/01/07. Retrieved on 10/12/2008. http//:www.asturnatura.com/especie/stenotaphrum secundatum/html. 71. Mengistu, A., Grau, C. R., and Gritton, E. T. 1986. Comparison of soybean genotypes for resistance to and agronomic performance in the presence of brown stem rot. Plant Dis. 70:10951098. 72. MezaMoller, A., Esqueda, M., Gardea, A., Tiznado, M., and Virgen Calleros G. 2007. Variabilidad morfologica, patogenica y susceptibilidad a fungicidas de Rhizo ctonia solani aislado de rizosfera de Vitis vinifera var. perlette seedless. Revista Mexicana de Micologia 24:17. 73. Moore, R. T. 1987. The genera of Rhizoctonialike fungi: Ascorhizoctonia Ceratorhiza gen. nov., Epulorhiza gen. nov., Moniliopsis and Rhizoctonia. Mycotaxon 29: 9199. 74. Mghalu, M. J., Kobayashi, Y., Kawagishi, H., and Hyakumachi M. 2004. Lectin variation in members of Rhizoctonia species. Microb. Environ. 19:227 235. 75. Nagata, R. T. 2007. Captiva Research Report. Sod Solutions. University of Florida, IFAS, Everglades Research and Education Center. www.sodsolutions.com/pdf/captiva_june2007report from nagata.pdf Retrieved on 07/06/2009. 76. Nagata, R. T. 2007. Captiva. St Augustine. A detailed description of Captiva, a chinch bug resistant St. Augustine with a slow leaf growth habit, developed by the University of Florida. Sod Solutions, University of Florida, IFAS, Everglades Research and E ducation Center. Report No.: Plant Patent information. www.sodsolutions.com/pdf/captiva plant patent information.pdf Retrieved on 07/06/2009. 77. Naito, S. Basidiospore dispersal and survival. 1996. Pages: 197295. In: Rhizoctonia Species : Taxonomy, Molecular Biology, Ecology, Pathology, and Disease Control. Sneh, B. 1996, Jabaji Hare, S., Neate, S., and Dijst, G.. Kluwer Academic, Dordrecht ; the Netherlands. 78. O'Don nell, K., Cigelnik, E., and Nirenberg, H. I. 1998. Molecular systematics and phylogeography of the Gibberella fujikuroi species complex. Mycologia 90 :465493. 79. Ogoshi, A. 1976. Studies on the grouping of Rhizoctonia solani Kuhn with hyphal anastomosis and on the perfect stages of groups. Bulletin of the National Institute of Agricultural Sciences Series C, No. 30. 80. Ogoshi, A. 1987. Ecology and pathogenicity of Anastomosis Groups. Ann. Rev. Phytopathology 25:125143.

PAGE 94

94 81. Ohber g, H., Ruth, P., Bang, U. 2005. Effect of ploidy and flowering type of red clover cultivars and of isolate origin on severity of clover rot, Sclerotinia trifoliorum Journal of Phytopathology. 53: 505511. 82. Oniki, M., Kobayashi, K., Araki, T., and Ogoshi A. 1986. A new dis ease of turf grass caused by binucleate Rhizoctonia AGQ. Ann. Phytopathol. Soc. Jpn. 52:850853. 83. Parlevliet, J. E. 1979. Components of resistance that reduce the rate of epidemic development. Ann. Rev. of Phytopathol 17:203222. 84. Parmeter, J. R., and Whitney, H. S. 1970. Taxonomy and nomenclature of the imperfect state. In: Biology and Pathology of Rhizoctonia solani J. R. Parmeter, Jr., ed. University of California Press, Berkeley. 85. Patton, A., and Latin, R. 2005. Rhizoctonia large patch. Turfgrass disease profiles. Purdue Extension Sheet. Purdue University. BP 117W. 86. Perdomo, R., Hernandez, A., Gonzalez, A., Pineda, J., y Alezones, J. 200 7. Caracterizacion y evaluacion de virulencia en aislamientos de Rhizoctonia solani Kuhn, causante de la mancha bandeada en maiz. Interciencia 32 :48 55. 87. Piper, C. V., and Coe, H. S. 1919. Rhizoctonia in lawns and pastures. Phytopathology 9:8992. 88. Ploetz, R. C., Mitchell, D. J., and Gallaher, R. N. 1985. Characterization and pathogenicity of Rhizoctonia species from a reduced tillage experiment multicropped to rye and soybean in Florida. Phytopathology 75:833839. 89. Pope, E. J., and Carter, D. A. 2001. Phylogenetic placement and host specificity of mycorrhizal isolates belonging to AG 6 and AG12 in the Rhizoctonia solani species complex. Mycologia 93 :712719. 90. Posada, D ., and Crandall K A. 1998. Modeltest: testing the model of DNA substitution. Bioinformatics 14:817 818. 91. Priyatmojo, A., Escopalao, V. E., Tangonan, N. G., Pascual, C. B., Suga, H., Kageyama, K., and Hyakumachi, M. 2001. Characterization of a new subgroup of Rhizoctonia solani anastomosis group 1 (AG 1IA), causal agent of a necrotic leaf spot on coffee. Phytopathology 91:10541061. 92. Ronquist, F., and Huelsenbeck, J. P. 2003. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19:15721574. 93. Rosewich, U. L., Pettway, R. E., McDonald, B. A., and Kistler, H. C. 1999. High levels of gene flow and heterozygote excess characterize Rhiz octonia solani AG1 IA ( Thanatephorus cucumeris ) from T exas. Fungal Genet. Biol. 28:148159.

PAGE 95

95 94. Salazar, O., Schneider, J., Julian, M. C., Keijer, J., and Rubio, V. 1999. Phylogenetic subgrouping of Rhizoctonia solani based on ribosoma l ITS sequences. M ycologia 91 :459467. AG 2 isolates 95. Salazar, O., Julian, M. C., and Rubio, V. 2000. Primers based on specific rDNA ITS sequences for PCR detection of Rhizoctonia solani Rhizoctonia solani AG2 subgroups and ecological types and binucleate Rhizoctonia. Mycol. Res. 104:281285. 96. SAS, Institute Inc. 1988. SAS/STAT User's Guide. Release 6.03 edition. SAS Institute Inc., Cary, NC. 97. Sharma, M., Gupta, S. K., and Sharma, T. R. 2005. Characterization of variability in Rhizoctonia solani by using morphological and molecular markers. J. Phytopathology 153:449456. 98. Sharon, M., Kuninaga, S., Hyakumachi, M., and Sneh B. 2006. The advancing identification and classification of Rhizoctonia spp. using molecular and biotechnological methods compared with the classical anastomosis grouping. Mycoscience 47:299 316. 99. S haron, M., Kuninaga, S., Hyakumachi, M., Naito, S., and Sneh B. 2008. Classification of Rhizoctonia spp. using rDNA ITS sequence analysis supports the genetic basis of the classical anast omosis grouping. Mycoscience 49:93114. 100. Smiley, R. W., Dernoeden, P. H., and Clarke, B. B. 1992. Compendium of Turfgrass Diseases. Second Edition. APS Press. The American Phytopathological Soci ety., St. Paul, MN 106 pp. 101. Sneh, B., Burpee, L., and Ogoshi, A. 1991. Identification of Rhizoctonia Species. The American Phytopathology Society Press., St. Paul, Minnesota. 102. Sneh B. 1996, Jabaji Hare, S., Neate, S., and Dijst, G.. Rhizoctonia Species : Taxonomy, Molecular Biology, Ecology, Pathol ogy, and Disease Control. Kluwer Academic, Dordrecht ; the Netherlands. 103. Sninsky, J. J., White, T. J, eds. PCR protocols: A guide to methods and a pplications. New York, NY, USA: Academic Press., New York. 104. Stevens, J. J., and Jones, R. K. 2001. Differentiation of three homogeneous groups of Rhizoctonia solani anastomosis group 4 by analysis of fatty acids. Phytopathology 91:821830. 105. Swofford, D. 2002. PAUP*: Phylogenetic analysis using parsimony (*and other methods), Version 4. Sunderland, Massachusetts: Sinauer Associates. 106. Taheri, P., Gnanamanickam, S., and Hofte M. 2007. Characterization, genetic structure, and pathogenicity of Rhizoctonia spp. associated with rice sheath diseases in India. Phytopathology 97:373383.

PAGE 96

96 107. Tamur a, K., Dudley, J., Nei, M. & Kumar, S. 2007. MEGA 4: Molecular E volutionary Genetics Analysis (MEGA) software version 4.0. Molecular Biology and Evolution 10.1093/molbev/msm092. 108. Tewoldemedhin, Y. T., L amprecht, S. C., McLeod, A., and Mazzola, M. 2006. Characterization of Rhizoctonia spp. recovered from crop plants used in rotational cropping systems in the Western Cape province of South Africa. Plant Dis. 90:13991406. 109. Thompson, J. D., Higgins, D. G., Gibson, T. J. 1994. CLUSTALW: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position specific gap penalties and weight matrix choice. Nucl. Acids Res. 22:46734680. 110. Toda, T., Hyakumachi, M., Suga, H., Kageyama, K., Tanaka, A., and Tani, T. 1999. Differentiation of Rhizoctonia AGD isolates from turfgrasses into subgroups I and II based on rDNA and RAPD analyses. Eur. J. of Plant Pathol. 105:835846. 111. Toda, T., Mushika, T., and Hyakumachi M. 2004. Development of specific PCR primers for the detection of Rhizoctonia solani AG 2 2 LP from the leaf sheaths exhibiting large patch symptom on zoysia grass. Microbiol. Lett. 232:6774. 112. Toda, T., Mushika, T., Hayakawa, T., Tanaka, A., Tani T ., and Hyakumachi M. 2005. Brown ring patch: a new disease on b entgrass caused by Waitea circinata var. circinata Plant Dis. 89:536542. 113. Toda, T., Hayakawa, T., Mgha lu, J. M., Yaguchi, S., and Hyakumachi M. 2007. A new Rhizoctonia sp. closely related to Waitea circinata causes a new disease of creeping bentgrass. J. Gen. Plant Pathol. 73:379387. 114. Tomaso Peterson, M., and Trevathan, L. E. 2007. Characterization of Rhizoctonialike fungi isolated from agronomic crops and turfgrasses in Mississippi. Plant Dis. 91:260265. 115. Tredway, L., Wilkerson, B. R., Lassiter, J. J., and Reynolds and Gregory, S. B. 2009. Large patch [ Rhizoctonia solani ] Departments of Plant Pathology and Crop Science, College of Agricultural and life sciences. North Carolina State University 70:13. 116. Tu, C. C., Roberts, D. A., and Kimbrought, J. W. 1969. Hyphal fusion, nuclear condition, and perfect stages of three species of Rhizoctonia. Mycologia 61:775783. 117. Vilgalys, R., and Cubeta, M. A. 1994. Molecular systematics and popula tion biology of Rhizoctonia. Annu. Rev. Phytopathol. 32:135155. 118. Vilgalys, R. 1988. Genetic relatedness among anastomosis groups in Rhizoctonia as measured by DNA/DNA hybridization. Phytopathology 78:698702. 119. Watkins, J. E. 1999. Brown patch disease of turfgrass. Nebraska Cooperative Extension Sheet. University of Nebraska. G84 688A.

PAGE 97

97 120. Weinbrecht, J., and Miller, G. unknown. St. Augustine growth responses to various plant growth retardents. Turfgrass science. University of Florida. Instit ute of Food and Agricultural Sciences. http://turf.ufl.edu/research_stauggro.shtml. Retrieved at 7/27/2009. 121. White, T. J., Bruns, S. L., and Taylor, J. 1990. Amplific ation and direct sequencing of fungal ribosomal RNA genes for phylogenetics. Pages 315322 in: PCR Protocols: A Guide to Methods and Applications. Innis, M. A., Gelfand, D. H., Sninsky, J. J., White, T.J, eds. Academic Press, New York, NY, USA. 122. Zarl engo, P. J., Rothrock, C. S., and and King, J. W. 1994. Influence of Shading on the Response of Tall Fescue Cultivars to Rhizoctonia solani AG1 IA. Plant Dis. 78 :126129. 123. Zummo, N., and Plakidas G. 1958. Brown Patch of St. Augustine grass. Plant D is. Report 42: 11411146. 124. Zwickl, D. L. 2008. GARLI version 0.96. Available online at http://www.nescent.org/informatics/download.php?software_id=4.

PAGE 98

98 BIOGRAPHICAL SKETCH Norma Cristina Flor, was born in Cali, Valle del Cauca, Colombia in 1975 to Ca rlos and Nelly. She only have one older sister, Marta Nelly, who is an economist and likes to work in the financial wor l d. Norma is an A gronomist Engineer, like her father. She got her degree in December 1998 at Universidad Nacional de Colombia Palmira. At International Center of Tropical Agriculture CIAT s he worked with the fungus Pyricularia grisea as her research topic along with Dr. Fernando Correa Victoria, a rice pathologist The research was twice awarded at national level. Then, she started to wor k to Dr. Daniel Debouck, a genetist, on cassava, Manihot sculenta Crantz., with four quarantine importance viruses At CIAT she spend more than 8 years of her professional carreer On August 2005, she cam e to Gainesville to pursue her m aster s d egree in pl ant pathology with Dr. Lawrence Datnoff, Dr. Philip Harmon, Dr. Richard R aid and Dr. Rusell Nagata. Her research was focused on characterizing Rhizoctonia isolates associated with warm season grasses at mo rphological and molecular level. She arrived alone. Then she got married wi th Juan Carlos, a Computer E ngineer. Suddenly, she realized that she was going to enjoy the company of Isabella and Natalia her two beautiful twins, who were born on July 2008. Now Norma is planning to get a job related to her academic formation to continue working in her most favorite topic: plant pathology. Eventually, she would like to continue with her studies to pursue a Ph.D degree.