<%BANNER%>

Heme Oxygenase-1 Regulates Ccr2/mcp-1 Axis and Granuloma Formation in a Mouse Model of Nontuberculous Mycobacterial Infe...

Permanent Link: http://ufdc.ufl.edu/UFE0025083/00001

Material Information

Title: Heme Oxygenase-1 Regulates Ccr2/mcp-1 Axis and Granuloma Formation in a Mouse Model of Nontuberculous Mycobacterial Infection.
Physical Description: 1 online resource (65 p.)
Language: english
Creator: Regev, Doron
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: granuloma, heme, mycobacterium
Medicine -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Non Tuberculous Mycobacterial (NTM) infections are a major cause of disease in animals and humans around the world and have become an increasing source of infection among patients with HIV and AIDS. Recently, there has been an increase in NTM infections in immunocompetent patients, especially in the Southeastern United states. A hallmark of NTM infection is the formation of granulomas which are a conglomeration of the invading pathogen and host inflammatory cells including macrophages, T-cells, B-cells and dendritic cells. Granulomas can contain the pathogen and protect the host from further dissemination of the infection. Heme Oxygenase-1 (HO-1) is a cytoprotective enzyme which breaks down heme. HO-1 is induced by oxidative stress, bacterial infection and many pro-inflammatory cytokines and has been shown to be up-regulated in granulomas and infected tissue. Monocyte Chemotactic Protein-1 (MCP-1) along with its receptor Chemokine Receptor2 (CCR2), are responsible for the recruitment of monocytes from peripheral blood to the site of infection. Our hypothesis is that HO-1 plays a role in the formation of organized (tight) granulomas by regulating the expression of CCR2 and MCP-1 in monocytes and coordinating cellular recruitment form peripheral blood to the site of infection. We have developed a mouse model of Mycobacterium avium infection in both HO-1 +/+ and HO-1 -/- mice to test whether the lack of HO-1 expression results in the formation of unorganized (loose) granulomas and to test whether HO-1 regulates MCP-1 and CCR2 in this disease model.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Doron Regev.
Thesis: Thesis (M.S.)--University of Florida, 2009.
Local: Adviser: Antony, Veena.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0025083:00001

Permanent Link: http://ufdc.ufl.edu/UFE0025083/00001

Material Information

Title: Heme Oxygenase-1 Regulates Ccr2/mcp-1 Axis and Granuloma Formation in a Mouse Model of Nontuberculous Mycobacterial Infection.
Physical Description: 1 online resource (65 p.)
Language: english
Creator: Regev, Doron
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: granuloma, heme, mycobacterium
Medicine -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Non Tuberculous Mycobacterial (NTM) infections are a major cause of disease in animals and humans around the world and have become an increasing source of infection among patients with HIV and AIDS. Recently, there has been an increase in NTM infections in immunocompetent patients, especially in the Southeastern United states. A hallmark of NTM infection is the formation of granulomas which are a conglomeration of the invading pathogen and host inflammatory cells including macrophages, T-cells, B-cells and dendritic cells. Granulomas can contain the pathogen and protect the host from further dissemination of the infection. Heme Oxygenase-1 (HO-1) is a cytoprotective enzyme which breaks down heme. HO-1 is induced by oxidative stress, bacterial infection and many pro-inflammatory cytokines and has been shown to be up-regulated in granulomas and infected tissue. Monocyte Chemotactic Protein-1 (MCP-1) along with its receptor Chemokine Receptor2 (CCR2), are responsible for the recruitment of monocytes from peripheral blood to the site of infection. Our hypothesis is that HO-1 plays a role in the formation of organized (tight) granulomas by regulating the expression of CCR2 and MCP-1 in monocytes and coordinating cellular recruitment form peripheral blood to the site of infection. We have developed a mouse model of Mycobacterium avium infection in both HO-1 +/+ and HO-1 -/- mice to test whether the lack of HO-1 expression results in the formation of unorganized (loose) granulomas and to test whether HO-1 regulates MCP-1 and CCR2 in this disease model.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Doron Regev.
Thesis: Thesis (M.S.)--University of Florida, 2009.
Local: Adviser: Antony, Veena.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0025083:00001


This item has the following downloads:


Full Text
xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20101221_AAAADJ INGEST_TIME 2010-12-22T01:50:09Z PACKAGE UFE0025083_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
FILE SIZE 54733 DFID F20101221_AABSYD ORIGIN DEPOSITOR PATH regev_d_Page_53.pro GLOBAL false PRESERVATION BIT MESSAGE_DIGEST ALGORITHM MD5
45eae43806d2f05df4ed7b73a3ad726f
SHA-1
c0c1f5790cfd4e892f1eb6133f0b39f30cb81577
533 F20101221_AABTAD regev_d_Page_50.txt
c79bcd8c4820012b3bf91b6c5da303cd
f826e31e5b368142df649a386dfbc9e1e0c31ae9
113392 F20101221_AABSOI regev_d_Page_17.jpg
7a4b57a1e0835884b961873af3e4c369
09d89d71ce74ba3454a51327bb9a9ac392e108ce
54890 F20101221_AABSYE regev_d_Page_55.pro
95e9fd5a31ab9fa77bf6bc34fe48083c
d5a95149488741d1155d6aeab54afe40296a0463
606 F20101221_AABTAE regev_d_Page_51.txt
f4161b73371548dca3cb1dd1064bd619
b4fc07b9625e4f4f4ddedb29cbaeee6e597a08e8
1051982 F20101221_AABSTG regev_d_Page_12.jp2
b6ff106ae93caccb42518a25c989d582
feeb9d7a672c97704e27cea9fdd128487a72b610
129847 F20101221_AABSOJ regev_d_Page_06.jpg
45ef43308f61ce5469442daa68f06006
0f2ecae6147eb2b92efc792dd2a7a8de6e3ff173
648 F20101221_AABTAF regev_d_Page_52.txt
d83eb4c39a0d6212c37139b534434699
b549c48a04166880aaefbd70d4d2fba85a83707b
1051952 F20101221_AABSTH regev_d_Page_13.jp2
77fd660dbd1079d588b267b3a3b12ddc
193a5b66c9e5ac9478337c98492014fce01052b8
47849 F20101221_AABSOK regev_d_Page_57.pro
c5d9815dd8a56591fb1a703196fc6e5a
4ede5b3f029815c5b419ca8ab5a0bb6fee02eb1b
63508 F20101221_AABSYF regev_d_Page_58.pro
c30f642ae11bad27676bcefc6af66db5
0d0d74f864e4165e9490a680be926f7ddd566b33
2219 F20101221_AABTAG regev_d_Page_53.txt
2dce4b899d4730f2ac91807890373d5f
bbe44a7ea50fbc8cb6a6fb03e42178314dc4588c
1051936 F20101221_AABSTI regev_d_Page_15.jp2
5669b59ca43ca71d3bd5aef1af1296c7
e0dc5d5e54950162c53b2c04bf8c617c181817a0
4773 F20101221_AABSOL regev_d_Page_41thm.jpg
4a35275c7bf1d528cffdefa06684df72
641665ffce5aefa67d52284c0f54ec3b80a89266
57720 F20101221_AABSYG regev_d_Page_59.pro
eca9f53a9103cb483e63906b55673d41
31c05c9fa171173afa4419606948114c0f882455
2089 F20101221_AABTAH regev_d_Page_54.txt
8b29cde137f7177409b9ce081ec18d35
a6e28279996dbb32365808ba6930700ee182785c
1051934 F20101221_AABSTJ regev_d_Page_17.jp2
5b572609273554fe70389455188e0310
2eec448a55f43f758106e3575952ca0360e0449c
14641 F20101221_AABSOM regev_d_Page_40.pro
2336cf9ec2bf0fb98a8caef538024b67
2dbbf92b9ccb1a340e62e966fe0c96c2159770b9
62865 F20101221_AABSYH regev_d_Page_60.pro
7c71c1114f4131908e30b7f1048525f4
06282eef14e5e3191ea90821beec36a27b150c3a
2149 F20101221_AABTAI regev_d_Page_55.txt
1be7397cd10c2a3c681419ee4d81912f
0c477301ef47c76ee4959f4ffb138082507fc73b
1051984 F20101221_AABSTK regev_d_Page_18.jp2
f07a9155f38bd2af0eb21e94d09cc499
4b97a9ef3156e15847db6d8e68a2fab14e644187
110873 F20101221_AABSON regev_d_Page_54.jpg
09d39a8242efe1eaf2c01d893cb30db0
24aa6f58def162a5cf45c17a13b3a0987b1d6d00
65233 F20101221_AABSYI regev_d_Page_61.pro
39d3f1c778f39aa6654a9617f63bfd5e
7a9709cf6e7f69c920010f91d1c86e4e00f3c6be
709 F20101221_AABTAJ regev_d_Page_56.txt
5db1a5841f836220a4505fe37cb618e6
b2a378cc363d9c5a1369d57bfe262fabb867bf40
1051985 F20101221_AABSTL regev_d_Page_19.jp2
e108132451f792a6eba899454ea2ca6c
fa15879ef982e56e06ff96e54ea15204321f476f
922352 F20101221_AABSOO regev_d_Page_33.jp2
011d538f7a33c0cdf68b801f0e5319b9
1c3ca9a9817036e12943a485900c22eef5b9238c
66855 F20101221_AABSYJ regev_d_Page_62.pro
d3d373514cc7efb107f81206051c5795
7a0336b16e02ee5f677d21d761f86eee399e7cb7
2607 F20101221_AABTAK regev_d_Page_58.txt
32f770240b7f28edadfeb04e2d0d9d23
7764f4c3a383d39004486f79e5093993f2eb801d
1051960 F20101221_AABSTM regev_d_Page_20.jp2
6762a678358cc4041cda58390734503c
094e4065d41b39a6bb15c951b8db090998d5b3c0
27080 F20101221_AABSOP regev_d_Page_33.QC.jpg
41a4fb4bb09f074013246f76a93f4e63
933867eaa073f74c1097135621c98458e2048c8e
73826 F20101221_AABSYK regev_d_Page_63.pro
128c01ef61a90585b91a7d905d6306db
92e7b795941f4f68909a2ef560fe3eef6dfceb38
2382 F20101221_AABTAL regev_d_Page_59.txt
11a43fbf7bcb5999f38165df570e756d
6e1232682d83601bb03ebbf08410fe61a2ae8461
1051967 F20101221_AABSTN regev_d_Page_21.jp2
9b11bd560676e02c820902f8aa9ce502
1309ae6bb9b03a304bb210152ab1e1784bd17386
49047 F20101221_AABSOQ regev_d_Page_10.pro
56482217513ce0924d2439d679a33850
be9f4240b63f92c6faebae8a766f83fc24dedc89
660430 F20101221_AABSTO regev_d_Page_22.jp2
09ab21fc5f2f3cb4504f384539e301ab
bb081450b43873a1887ed7616c66e6d6f907ef34
9873 F20101221_AABSOR regev_d_Page_39.pro
e5ac209d3d1eeb673d9d9b88f35a59b0
f0efc13d3de96ced31913d70ef02ee3039f05979
3733 F20101221_AABSYL regev_d_Page_64.pro
db231426ee76ef00414e7990677ee100
7f23f26fb90b57164c5f7e97c641c10ee6b4800a
2582 F20101221_AABTAM regev_d_Page_60.txt
ca25fa1edfba8b5f5d9f98af3cfbd29c
21c04f242adf4a43e4e7aa92352ad130e935cce7
600583 F20101221_AABSTP regev_d_Page_23.jp2
184a3a32deb32a2ea7bc2a4bf9a11b5f
97181abadc7d8de2c9f404e2e68db83603abdc46
42742 F20101221_AABSOS regev_d_Page_03.jpg
5da4f3248582307f5b6f93e7dac305b5
13311c61817eae9cbbdcf775719619c5804420ba
30093 F20101221_AABSYM regev_d_Page_65.pro
0d221263fb92929678ad2d1f2cedf4e8
3c8ac3a74da4114fbf74381a49e5dd96a97ef5fd
2681 F20101221_AABTAN regev_d_Page_61.txt
ff395a7e1ad3c8aacf754f2a11c2f438
e30ab37c996874c20f6408a2af0760691fe991cf
897928 F20101221_AABSTQ regev_d_Page_24.jp2
2c188116a5087f60d20b1c5ec58e2f41
24d31f634c583cc566212c49f5dc258bb9ffb868
25271604 F20101221_AABSOT regev_d_Page_25.tif
6ed5f5e937fbfe9131350bfa0ab9c929
dd8b8165bc0318362086ec805c887ec0aeb0d56e
529 F20101221_AABSYN regev_d_Page_01.txt
9b97832580b5f38c35f771c1fc4aa5aa
1024742bcd5a4aa9f847c539524674f9c2f6d625
157 F20101221_AABTAO regev_d_Page_64.txt
0c58cca321fd6a74f20b9be9cbc10693
83cba2d09b0f1ed93bdb4c92554bb089b225b6fa
630637 F20101221_AABSTR regev_d_Page_26.jp2
d86e4833b2c7f9d7719685e8136ad0d8
5eadefb804ab31e15a3a7ab56099f78d72fb51b7
8008 F20101221_AABSOU regev_d_Page_47.pro
6f17dc41d718ccafd33647cb02adecd3
ed3fd12a259e6230ff28dac8ce4279d98b491da5
91 F20101221_AABSYO regev_d_Page_02.txt
7a9555043e27b13313a8266cb7f49f69
e1188c20d47d005d38ec81fe24f33dd5b37ead76
1835552 F20101221_AABTAP regev_d.pdf
16a3eee28f95e44d6dab271836c20ac5
346ec9641d342417e488133aae9b013fda2f6eba
F20101221_AABSTS regev_d_Page_27.jp2
ec66f39b8ad0090c56948086ae125d55
27077a8d2398e71584217f31f6d1c13a3f3c7464
F20101221_AABSOV regev_d_Page_31.tif
342d06e746ecb9b64011e43007f213b9
0ffe6a482a7010bffefb4ef40a139629fb46bf1c
782 F20101221_AABSYP regev_d_Page_03.txt
8ea3e9d8bcb10581356d8b3105fe0aea
a3ea93af13e9d68ba9e745835c5defa91db7c70f
8669 F20101221_AABTAQ regev_d_Page_01.QC.jpg
6f1fb5474a3b15ca5578b36ee7b50ff7
5a3f1aa5db3b582f8179e5317a081287c00c4e42
1051976 F20101221_AABSTT regev_d_Page_28.jp2
440dd3526bdc0b825941c9804412569a
481ff69176047c3258686090efeb4d91b544a159
12237 F20101221_AABSOW regev_d_Page_05.QC.jpg
7d79cc08dc907db112e74f1ea9bb2272
b91c594cf07958d08c9783ec56bb581473fed2f8
3439 F20101221_AABSYQ regev_d_Page_04.txt
14a309252e4b60ead5de896a1ecbef34
d2868194de6d693f424f07738b3c60d7a853bd78
1073 F20101221_AABTAR regev_d_Page_02.QC.jpg
bc18746e044ad3fa71c673f882641686
1f6fae9a0016cf27f3d618d826ac06e15cd938a1
1051963 F20101221_AABSTU regev_d_Page_29.jp2
f6c3b25811a1a19224834738545aa5d6
fa15223907df637c5f6a293609b6d5fcec3b56e5
3033 F20101221_AABSOX regev_d_Page_63.txt
212bcca1e142e4108cdbb6764789217a
82c7346ed2cb6d9d0f4c4facc51fcd0b77f096e5
1288 F20101221_AABSYR regev_d_Page_05.txt
36e90f31a22aacb416a15d143a3cb4ad
5bee4705fd0cfa691c50b54887e5b89427db95ba
1051975 F20101221_AABSTV regev_d_Page_30.jp2
da2c24128ea42b1f22fbd084d0c25129
4f40f2b1232c9048576474774c2dc6e5560e0850
129647 F20101221_AABSOY regev_d_Page_61.jpg
ba9ee0dd0506a38ba210cfb32e4d6053
4a62ba58ee82294af096dce58b0f2bcf16640d1d
2620 F20101221_AABSYS regev_d_Page_06.txt
7493b021fdd91f9546ca1ef05fc56833
030587e10265b3db5e796b35e44d1f321805624a
501 F20101221_AABTAS regev_d_Page_02thm.jpg
f32033441e2163858b64febc6d669a1d
dae4ae44e5322ff2b53726e063cf54887a59b8c9
1051973 F20101221_AABSTW regev_d_Page_31.jp2
17d9ed967392547ea60c4dec7e8d8cdb
043adf4417be350abe18f88126df2a6682acb090
4560 F20101221_AABSOZ regev_d_Page_45thm.jpg
694478a70b81fbc3f0a58bebe856f317
d1fb5e1a0db3406aea666787066694e7ee91c7c4
263 F20101221_AABSYT regev_d_Page_09.txt
7d8f404179f07b13ec3da01ea6f8b719
731a1092387069263d167234770bf3743a95edce
3544 F20101221_AABTAT regev_d_Page_03thm.jpg
0976573974c5376edba92d175370365e
4d805070a7abdf0df98dc8d425e3c1f4a32e927b
1051972 F20101221_AABSTX regev_d_Page_32.jp2
ab2873ebd38c200583be860546dcc29f
8e5ebc6d4ee80f83883f9d747ffcb54fc2e17104
2007 F20101221_AABSYU regev_d_Page_10.txt
691c0743c6c024884bfe7a9d72ec9cb3
3dfab04e7878347b31515439ce21afb6348c1024
25616 F20101221_AABTAU regev_d_Page_04.QC.jpg
e5eb32a27d5f3e6a23647f98de4736e1
b21145e3c82297454990d5e4955862e610e86cc6
986600 F20101221_AABSTY regev_d_Page_35.jp2
1e48813c1d3eb96b9366aa7d02b751d4
d5c36025c5e14cc47402a919ef7b9e415b9159f0
1105 F20101221_AABSYV regev_d_Page_11.txt
429e110afc20eff6d34fa2a7d176a190
8f7eb4533e018f789680c68d34a139f0d847e15f
6376 F20101221_AABTAV regev_d_Page_04thm.jpg
a6fb96c6f522f8105e221f1d0bc4deb9
5cedd3590d1d0e94eec8d835758645ed27ebf130
52138 F20101221_AABSRA regev_d_Page_05.jpg
e914a6ffa705892dfa1b7f4c752220aa
63ed3c07f94af2cd064800cf55fa8626a16337ec
1051955 F20101221_AABSTZ regev_d_Page_37.jp2
e0b1d6c76b82286480692f96d0f7c1cb
fd51b725d43373bed4e34b2891e58a3d265a2733
2099 F20101221_AABSYW regev_d_Page_12.txt
58aa80b167a0be314c61a03b6d4fae20
cf497e724b2016c722052f8c339527b952b06c03
3145 F20101221_AABTAW regev_d_Page_05thm.jpg
1853c9114ffc38abcb9184f53e078fe4
422dae1935e6b64cfd0154913fd2224a64c266dd
135852 F20101221_AABSRB regev_d_Page_07.jpg
280ab6c2accd9a88ae31ccc2719385dc
2b996b106c064604489e945c5c9a2e16a621efc2
2302 F20101221_AABSYX regev_d_Page_13.txt
29123da604baeb858012f6bd8e9c68e2
f123ccfe19eeac8d23c8adf04735e54c193bff1c
8519 F20101221_AABTAX regev_d_Page_06thm.jpg
6ff4d7d0a2da68ab7e50cf431d2025fb
f9ab2b23a5ef528463207923be450441650a78ae
97695 F20101221_AABSRC regev_d_Page_08.jpg
87339ed073d34fdb9712e3b68e1b9be5
2411ce9ecc6d987f87a3d080d2899857274be35b
F20101221_AABSWA regev_d_Page_41.tif
bad4db6cf4408f6260f6496b8ce0f79b
f71785b24fd9a4d477815f8ae2b9ac8c55140a3e
2267 F20101221_AABSYY regev_d_Page_14.txt
ec97201f539990d2d070c8409da919aa
532b9149f9866374bcc6106311e3afb6dbceaf62
34838 F20101221_AABTAY regev_d_Page_07.QC.jpg
3f6e5572a5c5d2638806c8510235772b
6e0f1fc7e96f507443732b7e317546a965996d38
16903 F20101221_AABSRD regev_d_Page_09.jpg
caf379001a99cf3ba772b8159b563db5
334a854cdfdfdd33167d9f0b3e1a80301bc094f8
F20101221_AABSWB regev_d_Page_42.tif
d41bb7fab1d68ccf8b235aa3da74ae1c
2537b480b7b7ae81f5f5299c711f2ab1e733bee2
F20101221_AABSYZ regev_d_Page_15.txt
4d1daaa2814144f00e54106546893f77
f6320266a8e64e26ae0bba1874a6428d10520958
8260 F20101221_AABTAZ regev_d_Page_07thm.jpg
f5421898607278068d74d61e0e2b927b
2169fa97d6370016506866a54284f8f2d19d4c2c
F20101221_AABSWC regev_d_Page_43.tif
c3c5ad654706e0e32bd5c3c00673c6cd
3dcad733c8b10b0f2eb2265f14989a3af196ea0c
103115 F20101221_AABSRE regev_d_Page_10.jpg
45a51d6f020fc94f648baed3817445da
13dc44530289b59ea1c73504f36e7d914ea1581a
4203 F20101221_AABTDA regev_d_Page_43thm.jpg
2f8378a90c2a8329969a57c14ab857a0
0049e283676130f970d99804c266bcd66e42b7b5
F20101221_AABSWD regev_d_Page_44.tif
b9913683c89f7c8d38a0eeb7a0c4c6d2
ef3a76cb1436e612c4888e408bbf2c89bd3591b8
55488 F20101221_AABSRF regev_d_Page_11.jpg
81db64b7e6a9a51066f313c974effbd9
3041629d349872a52b50dc0f1311bfda1a49d33a
20655 F20101221_AABTDB regev_d_Page_44.QC.jpg
7a23b573e417b2e844dc542f85f32b32
066cd0cc2279af6e04b9a3ac0d4fea7e6c718f55
F20101221_AABSWE regev_d_Page_46.tif
d2118fa3e006b4f41c8a9870dccaa640
5133b3be599609fef4daae6cb086fd92f2f923d8
104496 F20101221_AABSRG regev_d_Page_12.jpg
5b8845fc967307eb548a4c548d7be106
fe6c4850777a87af24780568ef434f03a157b24e
5945 F20101221_AABTDC regev_d_Page_44thm.jpg
289c492722da5a1f2f890c5a3e9e9662
332e2ed20575c520a33042fc7201538409f71b44
F20101221_AABSWF regev_d_Page_48.tif
efd1e9b7a1e960f6e87fd0360e02138c
2d71b0a7e3ace956e5c4187b197e1bc7350d9ca5
112826 F20101221_AABSRH regev_d_Page_13.jpg
fe29f935eb1b6fc1124dd7704090c3da
ec9b749edd7e9a92c865b09cdb166d193b3e94d5
15382 F20101221_AABTDD regev_d_Page_45.QC.jpg
685e1c24de28ebd72cdfcd92e27e51ee
b920cc503de082e37e9ad4b8aad0918b804b9ebd
F20101221_AABSWG regev_d_Page_50.tif
55e2c83b0c5be366a85e0daf166b82fd
13e579fee5f79bd9e8c6ef6ef95564044a4d0b24
114985 F20101221_AABSRI regev_d_Page_14.jpg
9fe22fee1db33d946aa5ed245015418f
50d247e9c012849d340a26b55a30845992d34b5c
33947 F20101221_AABTDE regev_d_Page_46.QC.jpg
85cd4c8677ef9fa9f8ebd2b220e4ad9f
9abd6438d740566e1459cafe485d6367971d6344
F20101221_AABSWH regev_d_Page_51.tif
4f90fdadf497ea750a027834bef19e12
29d14db1986bf5e4ffaaef2e9e480daad72ada64
113461 F20101221_AABSRJ regev_d_Page_15.jpg
7eb34973b775ef121131fe2b4c59b8c1
2ed4d2f00a061d7fddc474999597154ee699ba61
8344 F20101221_AABTDF regev_d_Page_46thm.jpg
1df6689cc33352119f757e0256eeeea5
c4aa7cc7f5a7b7dc299f689c894911c26f72321b
F20101221_AABSWI regev_d_Page_52.tif
d04789115a4d6b75a41c9fcdaedaa38c
c693fcd497ee9ac0e8034384b4b6e1209f48eb13
107772 F20101221_AABSRK regev_d_Page_16.jpg
b378d6de45fb6758ff45c7f8a29aca1b
49ac366cd4705a8e174e87f14f18cdf5738adcee
24594 F20101221_AABTDG regev_d_Page_47.QC.jpg
d0bafade7806ec7415bea71dd9927582
32b887573e48185a61d442b1760b336dc2467cfb
117108 F20101221_AABSRL regev_d_Page_19.jpg
775a85f4030c4ce87c4ec7b6a661d447
33a5aa951c55df6c6585152ef06217ec0fd89e21
7216 F20101221_AABTDH regev_d_Page_47thm.jpg
d348dc351adae394f8670b8f349b53cd
59e0464e5cbbca81f15afde02be8c1f899bd0528
F20101221_AABSWJ regev_d_Page_54.tif
4981584db8a4856e12bc32bd584acb5e
fa928c96ee144c29b5e852ac379ab0819f7f06d9
116467 F20101221_AABSRM regev_d_Page_20.jpg
9be3bf1bce6766b68cecf74d5edde66a
6b5cd73222b581bb93442a06fe9d654f3cefa5fb
29660 F20101221_AABTDI regev_d_Page_48.QC.jpg
3425afaa1a297c84f88a27283b262f55
bffb446a1423ea7602cee154672d0eb4da47df10
F20101221_AABSWK regev_d_Page_55.tif
0f83f10ae0cad5b5181b924ddbac454a
97fcfb9422744613c81b8482338572ba80f9fff0
118901 F20101221_AABSRN regev_d_Page_21.jpg
2e5c23d5c0e8cf192a491db391736c71
26141c61c586535f41d476ca525a7d3d62f68bb2
8132 F20101221_AABTDJ regev_d_Page_48thm.jpg
f880125a953f44c6518a4d06951c4e1e
5a736dcc3f07e3dc9fdf4db478558c2f83a5eec0
F20101221_AABSWL regev_d_Page_56.tif
d0cdbc31b3c01390059ee0b580c29fb4
4e3a8bd76f79754a1156033fef312cc661a581e0
48702 F20101221_AABSRO regev_d_Page_23.jpg
95ca7cf41fd2a308b2f6e858d02eefcd
61285b8c9b4b5c91173c1d771c0d3ca8d02fbe07
35813 F20101221_AABTDK regev_d_Page_49.QC.jpg
72917913ad6b78a6bf52eb3b3476071f
9b287deb84f006141597eb2c00145a180d79437f
F20101221_AABSWM regev_d_Page_57.tif
88b81720d10edc314941f4b45ce6c5bd
d39caa0a63a110dc457c34059a5b709affaa5027
62963 F20101221_AABSRP regev_d_Page_24.jpg
95c3efb278d4e09e9036c3f78ab4f8c8
f8ea591fca9bff11f0ea5d6b6aeb7053c2bb5b53
9041 F20101221_AABTDL regev_d_Page_49thm.jpg
3606970a0c795a014bd02443efd26709
67d712a79a4b83db579d33d8047e1201cb2d5613
F20101221_AABSWN regev_d_Page_58.tif
a1f7d6089a72b2071bd367a6d00b1405
88d71e67854daee6252a8e1b8ddea0f6806bc43b
58822 F20101221_AABSRQ regev_d_Page_26.jpg
c59e01ea42e854892dcaf5953e84bf4a
72b520a0dd5221f2659a05718b29d5eb8db4e46e
34080 F20101221_AABTDM regev_d_Page_50.QC.jpg
fa02f5a5a907130780f1dbb1117ad747
249f9abad1aac39307d2fc1758e46d82b0b2461a
F20101221_AABSWO regev_d_Page_59.tif
a6fde7b97a0b4bcda6df58e92641f30d
77b9002e3dbbc4c6a87f7d3f41e5c30f84f216c0
107406 F20101221_AABSRR regev_d_Page_27.jpg
f83c1c06a45db8e003fac6767e843c0f
38e6b9fff51bcf448e788dfbbeaecae9cfe7e737
8761 F20101221_AABTDN regev_d_Page_50thm.jpg
7b7a7813806ed7b38b1c2f140b73b3e7
9f6d5aa665676c719670ed822c8925f52888bafa
F20101221_AABSWP regev_d_Page_60.tif
bc6952b468336ae5423f065b10a2a769
503cb8796640a7bf897365d4064f7185c81aaf56
108570 F20101221_AABSRS regev_d_Page_28.jpg
7dfa8b17c63d9ec1b1e846775120058b
4d41fe563f24bcef787455bd4532162514bf9281
12703 F20101221_AABTDO regev_d_Page_51.QC.jpg
bd00fec077911c249d925bcd8519ccea
4ff6d180a65ea809dbf3fef74b0d40e941456d0b
F20101221_AABSWQ regev_d_Page_61.tif
51d2b4a6bb841eab850dfd301d1a6a00
8762c811c8c7d91139339a6b079381ababee25f1
104801 F20101221_AABSRT regev_d_Page_29.jpg
d3b58b2adf8cee5337067fb12fde2087
b39dfa0f559769f0067aa92d5d1a3a749c4026db
4225 F20101221_AABTDP regev_d_Page_51thm.jpg
9115eaf73aaec9a7ed57c6d8b35f0217
db862b57e4935f35b240a5447e1f0fcaa53903e4
F20101221_AABSWR regev_d_Page_62.tif
fd347683c05780c791f4aa5295ec19e5
3c13fa99e66e7da05f230a25267852a4943a978e
108986 F20101221_AABSRU regev_d_Page_30.jpg
5502bbda0f2264e16f3163af54737e3d
4093dedc142bb4c9e5dab8b15095fda39eb839ac
7613 F20101221_AABSMX regev_d_Page_08thm.jpg
f6ee315db3a78e5a9859fa95abb27093
afa2629ebc3be8f42969695f4d9e65a77f05863e
14285 F20101221_AABTDQ regev_d_Page_52.QC.jpg
83393c21f26b6758fc26610dc01c7231
c6f0111226820c7278cba1ffb00d4817f3ff2f69
F20101221_AABSWS regev_d_Page_63.tif
f1fedbc526e5b67c6f0365c084b70ae3
408813e437d87df9010081352c89c02a1c916350
102387 F20101221_AABSRV regev_d_Page_31.jpg
7f0cb34107fa5e9e9b1dc5b248180977
0458abbb2422bf6026db071e47daba1c4444e558
F20101221_AABSMY regev_d_Page_47.tif
3f263493fd23fef25ce038452248e359
60af99a1501e550787b1223ee8a1119892d464e2
5275 F20101221_AABTDR regev_d_Page_52thm.jpg
2cfbfc370443d47e7f4b518222d175b2
097a7a16c0ff8ddd0434fb54901ae280b9730c0c
F20101221_AABSWT regev_d_Page_64.tif
85e21089c62be4e3e647573ba74154b6
9589f2b8212bc9f1e7754e2260a515250f114c25
84427 F20101221_AABSRW regev_d_Page_33.jpg
ca44b260842956ef4309d363ece3a160
d07b381fa295382b483400c626602f6f8e17d64e
878 F20101221_AABSMZ regev_d_Page_43.txt
12292d4a00042d9221b81c504f835fae
3e5f958fec0b9023390ce800e7060b7e2ece0d14
8916 F20101221_AABTDS regev_d_Page_53thm.jpg
230a6e3d0b691dfe6ee88e0f28d8b1e4
0cd34290a18db34c52569e3ffc069f2e22ccfb6a
F20101221_AABSWU regev_d_Page_65.tif
bc8ce981ffb00a41a0aa98e55d40a326
e01b1c4e0bfd5acfca57cf2d6c484025290d493b
42757 F20101221_AABSRX regev_d_Page_34.jpg
6359dc0445d6303ea3ba927c8b4523aa
dd6b932882abedc1993d5920767ceb3972139834
8878 F20101221_AABTDT regev_d_Page_54thm.jpg
ae30a0b588ba47345c32bf56c4f5ec8e
03d2249164cbdc6c0f33ba236834b9ed2ed7cc16
9079 F20101221_AABSWV regev_d_Page_01.pro
707a4b984e3a8f787e36fc7cfd0b2a17
ae1cb7e0c1dffa64bced0d499c0fed7036aeb866
52500 F20101221_AABSPA regev_d_Page_30.pro
da674b2f2f970c7776e4fb8fd7777048
40b07cddfe455afc5d9a671f3de8b0ec64225137
90923 F20101221_AABSRY regev_d_Page_35.jpg
8f2206626cf73f394fbfd5f0391cf04e
28ccf6dc2b0d9a188fc5171b8988af5a6408cc27
8998 F20101221_AABTDU regev_d_Page_55thm.jpg
5c16a2c4320de8734d112c7a07dc5d29
cfc6343442cb27c5d13a978c54cd057bd0cedd01
754 F20101221_AABSWW regev_d_Page_02.pro
27cb1d7c067e59eeedd1467b4768c3bb
d32e68103a1241f3517a10026f866010e258afc0
F20101221_AABSPB regev_d_Page_18.tif
5252f20cf7d288eb482fc8c438220069
93fd8a94b8a5cfb51782501ec7ca232ad4ab1a9e
99758 F20101221_AABSRZ regev_d_Page_36.jpg
228354fc45afb0b9d1c7aaecf1c1d99a
f377a4ea480723e1a87542394f1cef36713eba5f
63530 F20101221_AABSWX regev_d_Page_06.pro
1e8ee7b1ca7a0d0f96f002bd30ace367
7211675f6ad1cc6c666cc4d882981efb7fdc3d39
13412 F20101221_AABTDV regev_d_Page_56.QC.jpg
dd7f98034db6ff8ec73d4dea637e4fef
903dfc55fbe3531a10050b8ebf6aab8d34c12939
60755 F20101221_AABSWY regev_d_Page_07.pro
8ddcf617f5f45adb12a1a799a4f9c9e4
351c32a62067d6805786294c17f578fd9153dd58
2047 F20101221_AABSPC regev_d_Page_08.txt
06a403c7f681da91acf8ebadb46bf2f7
3c05d5ab4bf8a73218fd1e6e0d7c4659390a1310
427143 F20101221_AABSUA regev_d_Page_38.jp2
5bfb5316135e256f8ccddf12f04753b4
a47a4bcdcdf37171970543be24447bf902c820fe
3307 F20101221_AABTDW regev_d_Page_56thm.jpg
9bbf0a6ecf2489f15155df70a0cf788c
b1065b0ccb91d22944d63677e1af83dfff5f985c
45512 F20101221_AABSWZ regev_d_Page_08.pro
ff5750bb19b0b0544be77516cd584a4b
0902f2f898d9e7805fab23f31504e9d25fb059c7
45071 F20101221_AABSPD regev_d_Page_41.jpg
b4630c9a4d5a44fbabfd62814c597733
4d4be1eb0544c77b1ed36e64e881e151012abc2c
406850 F20101221_AABSUB regev_d_Page_41.jp2
5992cc4aaadba3bcfa5abd4fea6fd7bd
5880c9ab5db227dd0018f9addba3753fee9c341c
32275 F20101221_AABTDX regev_d_Page_57.QC.jpg
1a98689d3b28a14abd61a367870d0a94
0362ca3146d6eeac56b32729a89fe0974710e509
8731 F20101221_AABSPE regev_d_Page_16thm.jpg
88a184af5e791eeb2d3ca78f758c4f5f
9cf0780703c512e33cbe9da480eeb150ce2f3924
388007 F20101221_AABSUC regev_d_Page_42.jp2
0d43e0786e8af8c7ad311bbb884cf015
4cf01e212137a17c58ce83a331d1c932dedc06ba
7830 F20101221_AABTDY regev_d_Page_57thm.jpg
2b136079196b03a7de56858f1c4188b5
590910411263e30d4048910473e1e9af3a25a4d0
107736 F20101221_AABSPF regev_d_Page_32.jpg
8b6db85fe54dc8a65c41d5b2423b9f86
2c045ffa9b0da5246773724f2276e4acb8c944af
2169 F20101221_AABSZA regev_d_Page_16.txt
0b004bd7641bacc1a2a5961283404787
08e9b3d086894119fa7d4e03f0e0bd22692df6b9
30587 F20101221_AABTBA regev_d_Page_08.QC.jpg
db8606c9ca64ebd97e09f7393d93ccea
80f1216042f9a03ff5124ae6513e40b545c1a152
322665 F20101221_AABSUD regev_d_Page_43.jp2
cfc93f82fe4e89119dd8f4a7a32db1a9
75fb6bb8664e667ae52b44669fc8a3f85c9498a9
36054 F20101221_AABTDZ regev_d_Page_58.QC.jpg
343dd8171d3aa92be40e1449cae195ab
a058dd5309e2d4e85d85d5189c18509aaf89cf1d
17835 F20101221_AABSPG regev_d_Page_56.pro
83398d5fe39a66ac37e1524cdbf27d4e
0e6524410dc975ff3a11e1709c8f5df703ad5afc
2262 F20101221_AABSZB regev_d_Page_17.txt
791932588aed0d8cdcbb6b3e5f89e351
f5de6f8397a89eb1854bf7424b0806ded7e0880c
6162 F20101221_AABTBB regev_d_Page_09.QC.jpg
61c9c0ff6aaf166e12e73dd7fe664ca0
f7d8182182c40eee32583480ac8271a4123487fb
889180 F20101221_AABSUE regev_d_Page_44.jp2
77e03c68191cca9b175bcaf019260f66
21c02eb3d6bd989c6ea4cd77c8707ba44434d5da
893960 F20101221_AABSPH regev_d_Page_39.jp2
f0150302f38280d0c7d79d112656ba67
3eb952e861ed4ebee43ccd41540cee44a932135f
2214 F20101221_AABSZC regev_d_Page_18.txt
c6795e43cefe34f69afc787bcbdffe77
4a1b80194b1b7eb67e83e8255ae76b687149cf75
1635 F20101221_AABTBC regev_d_Page_09thm.jpg
a707a3422ed8f17fd731abe64fa0c701
6ab4be3b6dc4874fa9180fb09eea684f4ffb28bc
502325 F20101221_AABSUF regev_d_Page_45.jp2
a182309168a5c5dea5a89071f74918ca
7d94c65138d11bb5d99a73030bb1a7c7a4c20787
7734 F20101221_AABSPI regev_d_Page_35thm.jpg
79ae55401e7ffe9c12163bdccf620494
f1d63a902acc8a88d3f321cf763b0d3006e93771
2308 F20101221_AABSZD regev_d_Page_19.txt
97d17cc72f46910a06994f6d00a9e2de
f96f24c61cbba91a65da26fe69c63b25e9388406
8069 F20101221_AABTBD regev_d_Page_10thm.jpg
8c95991ab8ffaa1520f181972971e0a4
6f3906ce7e760e7cab1ed0b00b65d9e9db309f24
F20101221_AABSUG regev_d_Page_46.jp2
441975ab14a95fe22b86c7c9d5fb1760
23a2aef26a9ca2a2c67bfd4cae470d5b6afb8d55
5740 F20101221_AABSPJ regev_d_Page_24thm.jpg
e71e3e8d3625c61e6fc605604ec99617
0a44eaaabddd2d51b83d7bb4c581b9156e7509f4
2213 F20101221_AABSZE regev_d_Page_20.txt
42ad5c1aeeb537640a8d653bdaf99ff2
6979cbd3354d40b043370b2551672e054fc1fb15
17598 F20101221_AABTBE regev_d_Page_11.QC.jpg
3fde70e9169ed586f8be2ba7998688c2
43a7902916070f65acc09a91d4050e44a982757e
35012 F20101221_AABSPK regev_d_Page_06.QC.jpg
e0d62c6071f391908d41e07bd1c2bee3
6247321e135189d2ce546194ce6402a8f900cbf8
2291 F20101221_AABSZF regev_d_Page_21.txt
8b2c6b7ed2631887d3da4c56974b6bee
df52b73e463c171d710923bd88718e6dcccf30aa
4699 F20101221_AABTBF regev_d_Page_11thm.jpg
0a74cb5dac79c873f25aa547c7615dd5
da1197f4a280c1fb0448c81ce96c1ada5a092e19
F20101221_AABSUH regev_d_Page_47.jp2
d326468e0be26e04e0b923418315cad0
b8536b12d360b9ef0e137b0c48d2beb121a12f42
1051962 F20101221_AABSPL regev_d_Page_57.jp2
93da233032bc4a119a52f6789a0be0c4
6f36d2690f418706c6c6e1ff9f970c6c2f407e92
1136 F20101221_AABSZG regev_d_Page_22.txt
c06dc8c9c27c440d9b9cf0a43f2d06fa
7e50274ff583ace4a76049e322e97d6ef3fa821b
8192 F20101221_AABTBG regev_d_Page_12thm.jpg
88cbf8d9507105cd1ba9ca3f621c733e
7166c4b76aaf5394937121bc398560f9051b5e6e
1051852 F20101221_AABSUI regev_d_Page_48.jp2
1d58244ba4f23c4d799d5904f8e0ed4d
c66d49a8a87176ee5d1c92cdf6cadc3086377c16
33805 F20101221_AABSPM regev_d_Page_12.QC.jpg
9758e3afec63cf7f1b97cc63b45dfca0
fd558b3e3f1867669dbe8e92b71b04218fb8daae
772 F20101221_AABSZH regev_d_Page_23.txt
12d3b35655eb1c96f33dc18afc0db1eb
65ecb3e8c5adc59542848b34b3641ef5052c58c1
37014 F20101221_AABTBH regev_d_Page_13.QC.jpg
540beddea061f03240af8c5927f7862c
e92cb642c5cf5dc1c375f0278b7b57f2cbdec228
1051953 F20101221_AABSUJ regev_d_Page_49.jp2
fede5f47762b63973814ebcb7feee4d8
c4b65ba1310dca6260a4455352905069eb1d6463
124902 F20101221_AABSPN regev_d_Page_49.jpg
3ded8534fd2a9619c1501245582d3d69
82c6dcdcf177a49dcfbfe3f2f853eb71ebc6204a
1043 F20101221_AABSZI regev_d_Page_25.txt
c5af390333bf7f585c08bb7fa3ec530c
625ed6d3e22eee8b4651f4f88c222fdab66ef96d
8883 F20101221_AABTBI regev_d_Page_13thm.jpg
a8043cb70d406964ff882985863d727f
695f7db70474d39590d8224afd85f5413078afd6
1051986 F20101221_AABSUK regev_d_Page_50.jp2
e94afd9fd795a68e2cd729402d25768d
2b57d5753b54997e908bb438c1222bc29b70a122
688365 F20101221_AABSPO regev_d_Page_65.jp2
4bc9a62c8dbf1bf35ca15bd7cb14df87
c57b0eb101ea7f738c0be7ab2f68bdabb7da356f
831 F20101221_AABSZJ regev_d_Page_26.txt
931c8d320bd92697bab5458c7eed924a
a6de9429a8af545b360255d204309d54837d62d5
38464 F20101221_AABTBJ regev_d_Page_14.QC.jpg
41a5d12504e00db52dcfbd7a26b2d303
9d817d6d650176112334bc2e087fd7296723f7a3
294446 F20101221_AABSUL regev_d_Page_51.jp2
1b0053d37e22a471a86cf58038046432
507d34216d5cbcbdb04893d36581da3abbfae249
F20101221_AABSPP regev_d_Page_02.tif
179bf24287e4f587eaa27fe81bc4433b
ca222363717e737184a9498ed1f0fb5a1537ba9c
2035 F20101221_AABSZK regev_d_Page_27.txt
cbece849a514b882c2dba0fedb9ebc66
762efade93039e3f5d2d639316477e705bcb9ab6
9146 F20101221_AABTBK regev_d_Page_14thm.jpg
807cb2d037ec1f268edd79f70cf08f5a
4d44e628d8c075f797130e915c895a12aa4ec481
342997 F20101221_AABSUM regev_d_Page_52.jp2
5980731847001ad072c475c928d7b351
3ec9e3675a7339316b4c821204b83f08de4f3962
2172 F20101221_AABSZL regev_d_Page_28.txt
12c56de10a47ae9357871f2cbb3f5d8f
f77f14d70307f6ca10af7e24af13df8ee859754f
37616 F20101221_AABTBL regev_d_Page_15.QC.jpg
82a8da94dedbba7b9edd21dc134ed82f
f4b468952db503d95e9c4aab99b7916272aced99
1051902 F20101221_AABSUN regev_d_Page_53.jp2
4eb71eb33bf161fbcb733607cafcb09e
373bc4a95a019891b9aebbdcb0b9649593e4ada2
13696 F20101221_AABSPQ regev_d_Page_42.pro
a7fb4b7b717032165db0e1dead52f56b
b138f494f55c8fcd8b5291e28da2dae647f6938a
8814 F20101221_AABTBM regev_d_Page_15thm.jpg
b99404b18192400fc49730f4c96b44d7
ce275e4b7c84f54a13abe2de70989a49f2c9d290
1051924 F20101221_AABSUO regev_d_Page_55.jp2
009d7a07d9876b35f6c2f30993afd37e
183d0affc4eb232738c2d70957cb44e1420ad664
28686 F20101221_AABSPR regev_d_Page_22.pro
a6785711c1f075828a3cc6c6adde62e3
900aa58da3dd1c0dc8831c73bf6dfdcdaf0afbc5
2078 F20101221_AABSZM regev_d_Page_29.txt
71ec6c48b7844e4e517e949741fd3b37
9551fb06bc3d8ec9565de2d418246b09a9999514
35712 F20101221_AABTBN regev_d_Page_16.QC.jpg
f3e64ea61bac815b1725a9538da96f32
baf026114b100bcc045d598ba3a47f343eb66917
407113 F20101221_AABSUP regev_d_Page_56.jp2
b30c3196918ed59aa6ae9195663142e5
f79388416a8cc40254e3176b3b644506a59951f4
51365 F20101221_AABSPS regev_d_Page_32.pro
5d528dfdf597ca7d14ec76ebf7b0cd1c
7d4fad01d268248b8bcad5235de44d574b4fbefc
2156 F20101221_AABSZN regev_d_Page_30.txt
fe872fd6ac82a69844b6e880a0409d20
880bdf4385221e019f6a5080fe08f372497b00ca
37074 F20101221_AABTBO regev_d_Page_17.QC.jpg
d99a788f877ec687ee08161cf2bcf8ba
fedf4cec254e61fc38b78d3e34cd835aa9ccb40b
F20101221_AABSUQ regev_d_Page_59.jp2
30df99adca12df0120b33708820ea280
9aef2230784a26e9566fe299cb2b0bc7433637cc
9000 F20101221_AABSPT regev_d_Page_19thm.jpg
c8bf0832c4a30ac24e46c29491e7be6b
6682856571ee245434d347141286a8876e1ebc60
1971 F20101221_AABSZO regev_d_Page_31.txt
5a528f23a517d6a3d025028e5780db9b
37884e157d4de57c861c074cb9eba08a12b10a36
38710 F20101221_AABTBP regev_d_Page_19.QC.jpg
bae9a5c7a99fde70d7adfa2d824d1ccf
fa864208aeada2d315028b777cdaebf2f4e49267
1051965 F20101221_AABSUR regev_d_Page_60.jp2
8ba62d8b33bf3d09fefab2e40d6001d2
e4ac9ecf5ac64fd8c389803ffa4f647187ae486e
13575 F20101221_AABSPU regev_d_Page_03.QC.jpg
37b5711ed386e50a5f819f79b0c4c065
b979b69846573c5f405dfa6f6192c39321c6d047
2113 F20101221_AABSZP regev_d_Page_32.txt
9ce94858bc5bb7c096b4152f205873ea
117f54766b9a9aa145f058c0871d19f39595b99e
38003 F20101221_AABTBQ regev_d_Page_20.QC.jpg
b12decf3b6def03f822784b5c5df732a
813bf670a231a2f0e8a19a8866173a0a96fcf9b7
1051959 F20101221_AABSUS regev_d_Page_61.jp2
f118510859dc075dcb6664b48046fd33
f00cf91ba864c88fa2ace311c14a58a9df53d670
2070 F20101221_AABSPV regev_d_Page_01thm.jpg
4faea5f429115291e08db842e029a6f0
61b5f1185f9837b7da318c87477ee2041fbdfac4
1425 F20101221_AABSZQ regev_d_Page_33.txt
7c284aff121f8ffe2e1ff01f7211c5d3
6b4cbe9371899a2ec1b469f546cbb628d2e17910
9281 F20101221_AABTBR regev_d_Page_20thm.jpg
182820cbd1a61df6d9f79c64a2e1be5c
076b8dd135a2bc3d4a80b7ad0ce33afe55231041
F20101221_AABSUT regev_d_Page_62.jp2
d511fe066cda9b58145eabbec6d8e37a
8bf59bc63e9a28209729dad1f112b49c1dfc9bfd
F20101221_AABSPW regev_d_Page_15.tif
1b5431e82a545ea1956dc5306ec085ba
7c1112a38477d2adbc898d92fc6d149531ee128c
892 F20101221_AABSZR regev_d_Page_34.txt
6f4cfceb2f8a9305534c93f9c390025f
6f872e8ba20de2cfbc80d13d9d9855b8e1987e4d
40041 F20101221_AABTBS regev_d_Page_21.QC.jpg
e8146162143f555b0932a1c11d8b949e
09ac187d5bfa9a072504dfeaf4bda6c40e879897
1051974 F20101221_AABSUU regev_d_Page_63.jp2
34be2281f919cc905bb0c0de0d022b45
19f8ecee42b092ea41011d3fb9ebcc6c11f36b96
49985 F20101221_AABSPX regev_d_Page_29.pro
e08e70cdd5f8a60ada2227b9194cc598
cedfd573149009941de49524b0ad2ca4bcdabbee
1815 F20101221_AABSZS regev_d_Page_35.txt
a1236ecc7a80bc74ea20d9b37dd4cf6b
0d10d2d8d1f839194338c341e210ffcb6c9ee208
93073 F20101221_AABSUV regev_d_Page_64.jp2
d5bd1210751fcd5c8f2e6d78e68a4af8
6e163ccc8220d2c73be4be29f2e99d22c8deaae5
575871 F20101221_AABSPY regev_d_Page_25.jp2
a8b85413c226e84a1ae5e1dd699e9ffb
3b17059e3d171a2f760059c23b2da16daa594c1e
1880 F20101221_AABSZT regev_d_Page_37.txt
de7d29cb0769e5a8e4622393e46b4c07
08eed96b5616d8b1d55edf22e12c9e1b67972e6f
F20101221_AABTBT regev_d_Page_21thm.jpg
26d853eb912bdf82bf7ee3b5d1281a1d
fb306979af9e549587e38491e10de74fd359296d
F20101221_AABSUW regev_d_Page_01.tif
3f093359f92c8b9ed0fdd08fd049bac4
1b8c930c376d5901710b2ad6f5972505d0084e66
6751 F20101221_AABSNA regev_d_Page_33thm.jpg
0b69b8399959bea5d4a3f4ddf189f36a
532e33f8a2b0758d6f799403fba2d1cabf8e030a
55773 F20101221_AABSPZ regev_d_Page_17.pro
75e3b0c88aab0e678d955b1899fa176f
6c332072b010d0a73825d66f518519a83cd95d36
746 F20101221_AABSZU regev_d_Page_38.txt
118e2270eb36ee1c8f9eb06a786f1a9d
b8634e238b9dc02616ff74906a0a7fe90fd94f7a
20661 F20101221_AABTBU regev_d_Page_22.QC.jpg
09864e2f9c011e042d08c37f38075d7e
db4e46906a027b9fb599f0e5be397b0a27ef72f3
F20101221_AABSUX regev_d_Page_05.tif
5b72d8c0bfe3c61c807b9f5a9ac90812
8f66e60a90471831741a04649eea0a2fea485fde
42844 F20101221_AABSNB regev_d_Page_35.pro
c06455ec6f9acf41b1a2e1dd838c12f5
285f5b845bc11932a4a875c1c093a5a33761dec1
445 F20101221_AABSZV regev_d_Page_39.txt
e7bd5f7999b7caf831698f3f7258c49d
8e68fb065902e648940604a2fc0d1012fbc87776
13336 F20101221_AABTBV regev_d_Page_23.QC.jpg
66e6e6cb69b4406c74bfaf6a3f5dd115
b83b5b410ec0387d161083db6c7f736189c2439a
100212 F20101221_AABSSA regev_d_Page_37.jpg
d8815bfd9a7f136cbf269143650c4192
d47b033fce3a03a6c1fc0b3560c1394d87fa40db
F20101221_AABSUY regev_d_Page_06.tif
584f220d5d2c19d0517016a9e605f682
d6fadd39b02578bc9854cb1cd2b135374a6af486
F20101221_AABSNC regev_d_Page_45.tif
01fe7c20bdd6bfa55f8e954ebabd59d3
b586697f48ea7e6c286f49668cefa42cd8a0e555
894 F20101221_AABSZW regev_d_Page_40.txt
58641c3cf5a79a8e7501a36452206489
733b86855ec3134ec478b5ed52da0d28f84520e5
3776 F20101221_AABTBW regev_d_Page_23thm.jpg
bdf80bba54d6fa3af78562eba76c7610
c7855e50684ba0933d88939246459764cdb1bb39
42402 F20101221_AABSSB regev_d_Page_38.jpg
791cf3b2d07ccece2594e4b9b9962257
954b485674c06c393e103ae7361b7b5a4f90c2bd
F20101221_AABSUZ regev_d_Page_07.tif
c56c19cef1bd61454ad3008ad9d2bf05
4a43866962d9cbe74df0fad242ef004dda75125c
F20101221_AABSND regev_d_Page_58.jp2
28ac414c15feda32f45fbb0cba8c3cc5
a9a61bb470a2a4a37a22f4f3ac8f6983525172d7
788 F20101221_AABSZX regev_d_Page_41.txt
99d7da869eefcaf16cdd1804494977cf
a1f8b0ab19d41dc3a40c5122e38d2eac7eab4e49
20034 F20101221_AABTBX regev_d_Page_24.QC.jpg
974b1ddc935cf126cb888c7df6e2d58c
354dfac1256209992acddc72ecc056119a24b741
75235 F20101221_AABSSC regev_d_Page_39.jpg
b2c96260d1e8a07273dd539548fae1cf
b34f6770de134dfa3a1a77a55a0331e9ec288112
32533 F20101221_AABSNE regev_d_Page_36.QC.jpg
a7ffab2ebeefd7957eedd8554870186d
1e14a8b5953dfbcb17f36b677ccbc2b0acd66caa
326 F20101221_AABSZY regev_d_Page_44.txt
99037fef33f60811c05e70f6bf9fba5d
527042a91207a31cbd9f8fd1810ec47a45e268b4
18584 F20101221_AABTBY regev_d_Page_25.QC.jpg
4b97d3ab84b3626b3d3b390348ece109
e42da2b245969d18fb5db81860eaa9d4f7acd83f
39287 F20101221_AABSSD regev_d_Page_40.jpg
331fc0e5585243b043fb66eef45e6fe6
c0780ff9b095906621d0bc4e452410affb1a4126
56543 F20101221_AABSNF regev_d_Page_20.pro
52c84b3dbed825eefbbf543ace76c8ab
c90e1f44af4b419a4280be9f4a29c9b89837e009
6554 F20101221_AABSXA regev_d_Page_09.pro
1541de4a9319245945de45f42aad97b6
6248f942a23885606be946e2f1cae516f4913f5e
5525 F20101221_AABTBZ regev_d_Page_25thm.jpg
c1ccc3b1e9c0d3e509f75aa9cc978040
ea6040319f7e0ed0d694a9bf6e42ce785989b437
37142 F20101221_AABSSE regev_d_Page_43.jpg
0a28ca95a8ac519180a179eaf3584c77
991b5f64c3d4ddc1eb3e72a833c3330be51c97f6
1963 F20101221_AABSNG regev_d_Page_57.txt
8386c4f14cbf028000f8534798f0a5d3
219343c755fb0fcec0fd199ee8ac4fdb60c83d61
25388 F20101221_AABSXB regev_d_Page_11.pro
9de0fcc8aea2ab1399effe7841016eb7
ccadad4e284d9d0965da5084366767c02a73d478
293 F20101221_AABSZZ regev_d_Page_45.txt
424a1e448aa826d0145ac1ece5112edb
f628451780b629bf3aa1877ba56d033a3dd63f97
51682 F20101221_AABSNH regev_d_Page_28.pro
aae7b0b711b7b380fddce7aefdbf09e1
909b77ba9db199351052024fbe62332f44d8de7e
56648 F20101221_AABSXC regev_d_Page_13.pro
5bd86d887a7f4af031584f30fe362406
f4f13df24a653ca3a915a8ca0c06e6a708726b58
9049 F20101221_AABTEA regev_d_Page_58thm.jpg
06a9592596af344a7cd98b2066720743
fbede9b6d3face3f4b74fee8f6b1e76e5e1c797b
45696 F20101221_AABSSF regev_d_Page_45.jpg
d33f15fd14389d03da189c7e2cac8917
022977f2205bcc9b4f6b333019b1692247f845fd
53354 F20101221_AABSNI regev_d_Page_54.pro
cf84936051fbcd2180af88d387eeb5b9
e92ddecebc62209df73e7dbdd7b98d787a7afae3
56218 F20101221_AABSXD regev_d_Page_14.pro
eb1fca6795b3f8b2cb9d0ef4e3aba058
5c6cfea29e7fd98c6dd99aab16e53ff055827b70
34788 F20101221_AABTEB regev_d_Page_59.QC.jpg
6574ba95fb4649d8c3889812622527de
2dfa1e82f60e0f80252ce6bcadf95e63dce7fe54
118370 F20101221_AABSSG regev_d_Page_46.jpg
2a69816befca4346c34dc65c6365fc21
23fc714f79c4818ca3d134d47c4589d209bd16b5
3819 F20101221_AABSNJ regev_d_Page_34thm.jpg
69461b373d5c7a3edaf0fafa1fbfaab8
dfebf00aa5e31e21c7f61dcdfb1d53b2fea802ea
55995 F20101221_AABSXE regev_d_Page_15.pro
92da6f4c83d29c4d1627bb2f7a6f7858
bf6d7c0e0764584c8102f629a2b52b6587915306
8730 F20101221_AABTEC regev_d_Page_59thm.jpg
ab2669d1ad58c4252aeb53e640ce9c5e
595acbb2a1e3ef155247670135d6e0611378110b
80591 F20101221_AABSSH regev_d_Page_47.jpg
2e1ad84c4012499d30d8553d11e08564
22e9a1483fa204bcb90653d0d79a3c0556b4d143
2504 F20101221_AABSNK regev_d_Page_07.txt
d1c0cfd10bab30209ec8b784ffb0815b
08d29cea2e25d34db777ccb1ff849454ca0ca719
53289 F20101221_AABSXF regev_d_Page_16.pro
aadd8aab9688731f23d2b6291943d1bd
9a8a164e4c48dffe94dbb34528982c335ae0d986
37560 F20101221_AABTED regev_d_Page_60.QC.jpg
02be05f21132d16d7721ff33b0c84a8c
5d9493c91047809af313e1ef16aa219a6e6040a6
95386 F20101221_AABSSI regev_d_Page_48.jpg
e653c23e86fe27af05eeeb2e90a4fcf9
86e64b6b11c84f74a17c921c81bc43d701d84afb
1998 F20101221_AABSNL regev_d_Page_36.txt
1f33a8b8e368f137086c25c61f3e5cb8
8bc47e30827bb1e8d53623ae7d7aaca2c674ff70
56748 F20101221_AABSXG regev_d_Page_18.pro
6062427161234414fea8190ecb1a8cfd
b6ed092986fae276ffadb27a5b882377bb9fb830
9288 F20101221_AABTEE regev_d_Page_60thm.jpg
9d34bc91de65068bc8aa338bdba30043
d28f9f2684ebfa6d3477ee7beb2f760f949d9864
117685 F20101221_AABSSJ regev_d_Page_50.jpg
a25d0748716068ec0d27b3657598eec3
f2d55221df843e049dd9cd1fec5db77d36914c61
15327 F20101221_AABSNM regev_d_Page_41.pro
bc3d8240d6a3583ca5500c7f0f0d1666
4833ffd8acd366248fa61195c6acc92892fc20e0
57350 F20101221_AABSXH regev_d_Page_19.pro
a08ae23d770b08345203c7d5477c4c25
a1532a625ef00fd166b17f9e6ed358d2e3ceef2a
36491 F20101221_AABTEF regev_d_Page_61.QC.jpg
8bdb6eac3b847497b7b61db80e8ea0c0
17ffc863e76e3210ce405120cbb1be965a89b2b7
36803 F20101221_AABSSK regev_d_Page_51.jpg
e7b2da6d8ad1d65a5536ce4090754068
a8939507287aa97fa5fdfe2ceea7f990a7892a5e
F20101221_AABSNN regev_d_Page_04.jp2
ac294edb79bf1b2ecfcd06156d857f85
3f97e52645d31d38f10aaa88efc1112e46e340c2
56886 F20101221_AABSXI regev_d_Page_21.pro
bb4b0e44ad7a79d306084731dce38517
99487f3021a7618e33b51045b0fa8bd75f831dcf
8952 F20101221_AABTEG regev_d_Page_61thm.jpg
52ea81df83b050cea01e541f56c62e56
b0e1c03aa5fca212de0acddc86eeed26e14dd303
41584 F20101221_AABSSL regev_d_Page_52.jpg
6b5c3355ba989082de2a61c96a63309a
3226ff16481be3aa1c2d1c3a59efd92b0d1f4d56
F20101221_AABSNO regev_d_Page_03.tif
60f211d3ecd68129c32ff37c965e3bea
181de7b71dca63d2a53a613db96600cbac8c4184
17437 F20101221_AABSXJ regev_d_Page_23.pro
bb8e673bd3a8bec6d4f4e15d5ef6cd59
a60b54368babd0f0178596cb77aff650552b933b
38797 F20101221_AABTEH regev_d_Page_62.QC.jpg
e2905fd8ecd2351186b26dabb1c1d486
b8ca81c34e63c4ccd34bfab2c46bc83310cfcc91
8125 F20101221_AABSNP regev_d_Page_31thm.jpg
403acb7c368980ffb557e2e23f303055
92fc025a80d5180b85f6b8cb5ac3230468c400da
113101 F20101221_AABSSM regev_d_Page_53.jpg
870b54297457770e1839a583bae2c055
fdce1138a3796a78464766972faf8e7ae6905d82
9300 F20101221_AABTEI regev_d_Page_62thm.jpg
1e82a9603325242cf659a96f200217c2
8fdd090f8444edb07d25500d2d9a98ba1986f019
1051946 F20101221_AABSNQ regev_d_Page_36.jp2
1bfd87f12d90ee5f372e2fd055d3d09c
c86b947b405753c317e2f8da9444e2e2fe026126
20390 F20101221_AABSXK regev_d_Page_24.pro
549f130cc15f65f13d76746af7df21c6
7235fbff69e1d8e7e4ef09ca90ae6db05eed2c93
111870 F20101221_AABSSN regev_d_Page_55.jpg
ec4239deaf033600828ce87adac60447
5c34543378173d7fcdfef221941e3f7d72134315
40722 F20101221_AABTEJ regev_d_Page_63.QC.jpg
a8476fda1eb16b9341f4055f573189c7
583a5f7ead8f7c1dd7b3ac529eace0526aadc761
9196 F20101221_AABSNR regev_d_Page_18thm.jpg
58e1786acba17b01e01e3b1971c68ea6
c8eeeea3ddd2c7f2eea39ae311bd5bfc2a32d98a
19748 F20101221_AABSXL regev_d_Page_25.pro
b30cdaf2908aa6b6027729b9d851a307
1ddd18e35673dd130d85e11c24023ca63c5a1c4d
38450 F20101221_AABSSO regev_d_Page_56.jpg
8767ae2b5efa2a2dae0ad019ddb8435e
5d35d98e5e50e3d984b6ae149b2a0ba2467a6720
9557 F20101221_AABTEK regev_d_Page_63thm.jpg
fe0470e81235a07b908ab8dd1755723d
532265a2d4e122dd06c1d0b86aee788c82732357
61904 F20101221_AABSNS regev_d_Page_22.jpg
121cd4c99d145ec77378bcef8087ca39
b3453019ca414d238181c59ae2f2457fd5e60976
18796 F20101221_AABSXM regev_d_Page_26.pro
ac9591755727f771119087e839e93db6
896cb5168834c8ed8c39ced2c81f2794f38e3a18
99421 F20101221_AABSSP regev_d_Page_57.jpg
2826c885f5553e3a19d90ea8d9d2245b
5da40a4fb3a8c86b675c07c691d283228cc0d243
3768 F20101221_AABTEL regev_d_Page_64.QC.jpg
3ec7504ed84138a4ed41f0baaa46408c
e4d3c171582843c14a37c73f4cf368e2566099a9
50503 F20101221_AABSNT regev_d_Page_12.pro
deba99bf915ff043c5a431f37d939e71
c9f194169a03320bea3de10a67fdb8c92571c25f
49451 F20101221_AABSXN regev_d_Page_27.pro
9ee59996bfa69099fc4fe8434e759740
b35f3a60ed6f43dc97af7655681a65adb9558d0c
130050 F20101221_AABSSQ regev_d_Page_58.jpg
3f2da36acc70697a95751cd739b6b3e6
587a68a5262095ffed1246a809f13de8d3c27b79
914 F20101221_AABTEM regev_d_Page_64thm.jpg
d1b8b36c1dea72186f4965947306a818
55f0211fd62888ea0788e51a2c59484e0d39c820
419480 F20101221_AABSNU regev_d_Page_34.jp2
34f161a84136875f945742926b9fc82f
a90776ae1a89e07870d02a9bad81833f88ff3301
48991 F20101221_AABSXO regev_d_Page_31.pro
bec9646556fb87a1e0578a7b45cb25d8
877b11d7d56563fdc762df7bbb086c7670bf687c
121324 F20101221_AABSSR regev_d_Page_59.jpg
c1117415a6e2772e790b8381862a1fb7
1173602376ed743622bf5a63f0cf0f659f5bcef4
20880 F20101221_AABTEN regev_d_Page_65.QC.jpg
0f57ef1a2c7e97a363513e410a0e331e
e78a3710aec84edafba58b65bfeb9d0812a42449
115293 F20101221_AABSNV regev_d_Page_18.jpg
8b786f3ef115fdbb1d809c86eaa3049d
512ae62aff2948c453c5e8a84e832910e5306372
34823 F20101221_AABSXP regev_d_Page_33.pro
fadd5c7918067d9efb2cea2c22928d9f
ac6785560892277c993f01c30427d6e2f6a08fa9
131142 F20101221_AABSSS regev_d_Page_60.jpg
83e69174725a9c341caf0a7ba9cb482c
9f4f055556a7a014459f9930dad7fef55da390b5
77015 F20101221_AABTEO UFE0025083_00001.mets FULL
e0a6c2c774b7c7ba65040b075b316927
a97514dfe4ada387c6b6a071a5d2e0fa1d4a73ee
36321 F20101221_AABSNW regev_d_Page_53.QC.jpg
86e35cf5c9783a6a3af87a7360c1a21b
85171d2282acee3a2c7131b6288d4bb68cbb7ec1
16999 F20101221_AABSXQ regev_d_Page_34.pro
587b3e89d85494247254c3b88940ddde
a54e3a5623ed6d7f471ad57e0529db16f16074e5
144868 F20101221_AABSST regev_d_Page_63.jpg
295294186c03b78573a1540ea3217d11
62c901cc992f17ad5a1eede4698b37c168720994
F20101221_AABSNX regev_d_Page_53.tif
4d3ed36f7f8226ac9bec270453d18273
8cc62e1621fa113a68604d82424bff20e1783797
48479 F20101221_AABSXR regev_d_Page_36.pro
aceab7e21f63555263cd09263c1ea31e
47429df69b2cbec01e818ae59e30aa4e84c995a8
10929 F20101221_AABSSU regev_d_Page_64.jpg
143fba27d73ad72263f7870788d5f94f
2c8b9989648d48e540fe6499804173cb6cdb6eef
4855 F20101221_AABSNY regev_d_Page_22thm.jpg
7614af5b4c171f2e2560d9678495be29
6772550387cd6ba4ff7545b837b16d8c853a4276
47518 F20101221_AABSXS regev_d_Page_37.pro
ed41b2c13c466ec53fa6863d89b67064
237b9534341184667c7f08febc96d87729699371
65112 F20101221_AABSSV regev_d_Page_65.jpg
bbad6843d13a7b035920efa29c180800
0cf2cf5bb87abafd773973684b2e49061f7fd48d
1231 F20101221_AABSNZ regev_d_Page_65.txt
eeb103df3d83bec942e9ca34575630c6
3513d9c01f830dd7ccf7a337e1b2232195487637
18604 F20101221_AABSXT regev_d_Page_38.pro
fde37656a690a36cd924c7564ca0c5c4
c22f553e8730a7fdfdbffe76d7551d004d6c0522
278871 F20101221_AABSSW regev_d_Page_01.jp2
b32f3b575b69403a6e41d95f48e2b8b0
3b5210e502ea396494a6d5c88e38a3f9a66584c2
12547 F20101221_AABSXU regev_d_Page_43.pro
4b6b7985525f5721c9b534fa81795195
5d81438196e8d256c27c14731c564005e2d1859f
24038 F20101221_AABSSX regev_d_Page_02.jp2
6132a908b697eb407be7d7ae03965194
46e159ae4a927ffce75a66c16188a7a49c9c38e3
6406 F20101221_AABSXV regev_d_Page_44.pro
3d2a1cf70d7624be2ff52c90c0704269
e259c8e32596224f6d691d75973e30af9c4ff3b1
4622 F20101221_AABSQA regev_d_Page_26thm.jpg
8d045e0cadde06c25e2780ba2d12ab76
3647d5c4801acb9cf4089c56d8d84042881e8729
435301 F20101221_AABSSY regev_d_Page_03.jp2
024597c5a4d9b5ad2c0e816fcf7de8f1
2cfcafe8ac4cbc60925350510a9c90608bb3aa97
6163 F20101221_AABSXW regev_d_Page_45.pro
372aff9044922272c98eee1317dde026
f416d6d02ffd30a7892b0c917098cb11f3208c24
F20101221_AABSQB regev_d_Page_04.tif
a363b17f68e7e4fa35595481d9f71ce4
028593a0757abbf62c0c5c6a70c983df4bb68194
944736 F20101221_AABSSZ regev_d_Page_05.jp2
ca8b625991615daf235ec6e1e39b31a5
37c816878c6f9eaa18cae7f49637feba233f070a
17114 F20101221_AABSXX regev_d_Page_46.pro
25b1158fdf7839c351e4632cc8db6e11
acf05ed7b38092befedf0c9bfbcfd1049ce4c8e1
5240 F20101221_AABSQC regev_d_Page_65thm.jpg
7000a68a0336db65dc04fc8e206ccbab
558e7a2f920f0caf96fb68f89be8317eecda9b16
F20101221_AABSVA regev_d_Page_08.tif
534f51a39aa41c77268920f99f6f0e7b
1286c480b3ce7fd07f9fcac1aac894d730bd298f
17351 F20101221_AABSXY regev_d_Page_48.pro
b78b77b3c821713d2b2d51cf6f36fcdc
ad2e035652958bb3d0aca03e68ffe5581a7dcb49
F20101221_AABSVB regev_d_Page_09.tif
8d62e77a4a09df3b21f7398bad6d7a8e
26bd6fdd0a03633b8f14d28acaea5b68fcadd25a
18673 F20101221_AABSXZ regev_d_Page_49.pro
c5a8213f30dbef2283f73def3bae17ff
e76523a83a2689ff2f63d224d350e7efe2c54746
31459 F20101221_AABSQD regev_d_Page_05.pro
ef90358d97c4680a70f1ec15c88af3a5
3b48147822169884cd1d10603533a01d3500a7cd
F20101221_AABSVC regev_d_Page_10.tif
334268665803fdd014168beb546b1675
34cbe21c4dab2bfb3b0bf08f90ab7d2d753afeb6
963 F20101221_AABSQE regev_d_Page_49.txt
9962b10fc81a336d01440d5e53dea2ca
45c7cf765165fe9803e6d768188dc4ef5374287e
F20101221_AABSVD regev_d_Page_11.tif
4d7ec7621aaa14878b6a4c42f6dc9e3b
c054e4e3bc82bc629698bc8309668bfdef9f23ac
326222 F20101221_AABSQF regev_d_Page_40.jp2
3506f0e16d245aee724fc81818106b3e
66df252ebec5e74e39a06e59d07ba333adb6a18f
16926 F20101221_AABTCA regev_d_Page_26.QC.jpg
7caca0c8d186f18b02caaa4753c2d01e
838afb6f9a0540bea3c04eb9c23e29e15ae06a09
F20101221_AABSVE regev_d_Page_12.tif
fffb6ef8f74a2df6cb06620f882c4676
2539d98243a4040a1f542d188affa1e79cbeb58f
26066 F20101221_AABSQG regev_d_Page_39.QC.jpg
a073b3eca9b545c2c14616ac6dd3264d
9c7d1c5346f23940a3837e060cbdf2e84404d098
35042 F20101221_AABTCB regev_d_Page_27.QC.jpg
d128336a5b68cef73ad3fb2bca9441ba
d7248aff79ba6f1297b2602657dacc3f40dbd58d
F20101221_AABSVF regev_d_Page_13.tif
e96c09dfd541eba6ad8e395684afcefe
ef4ac23f60d4b2dd374ee1137a5b04976380347b
1402 F20101221_AABSQH regev_d_Page_24.txt
7653ae7a6c3a65328057afcbc9ee651c
efdeb1cd3436bd49fdb04d2c16d1b95983abdff6
8362 F20101221_AABTCC regev_d_Page_27thm.jpg
e70456cc190775bbe084108923dbcd81
8ab61a401b27bc7df4f51664db268ec88d280962
F20101221_AABSVG regev_d_Page_14.tif
3f09d95ed7b27316e56919e8e8b27e89
5efdaa68452e9fb7c3760f9ef8cd462252ef716c
42403 F20101221_AABSQI regev_d_Page_42.jpg
74db017c8aa7b97d80ebf2222f0753f0
9132630da1b5f04279d431b3bde40c6a8672e425
36153 F20101221_AABTCD regev_d_Page_28.QC.jpg
330ca3ee509f81427150d79f0afb6b98
f8a361ea3ebb4ab9dab16880d4a6fa676a987e11
F20101221_AABSVH regev_d_Page_16.tif
01c644f11a0ffc7a053bd5433d05c9c4
d6774945d87b9c9eae0ccd6a12abcbf760581722
F20101221_AABSQJ regev_d_Page_34.tif
a02929162c90ac55d4152b269d43217f
9eb5abed00498afb3d246d2eeb14dcd58c2481ee
8583 F20101221_AABTCE regev_d_Page_28thm.jpg
29e0c1cb72d82bcede7649fd60ae9a3e
43bbbb1c74a36748dc4b8904bb67329c10e99cbe
83486 F20101221_AABSQK regev_d_Page_04.pro
b1cafccdf65bf960738b3f05731ad796
d219006d67c231e78557f32c8903faf36d025b34
34885 F20101221_AABTCF regev_d_Page_29.QC.jpg
c1d3c95d436dbb04fcf1a7de0a0c9a5c
5f5f78f2a4ceb491f04794efd341e0b3fb6e5ea4
36392 F20101221_AABSQL regev_d_Page_55.QC.jpg
560ab19500e1c00ff82edbd786570966
33b50c27686553029282c71eb44139efbfb955d6
8699 F20101221_AABTCG regev_d_Page_29thm.jpg
2e9e38ecfc372ff2155566c7577b9926
a1ee4099757cf254a2c372614ab5f3711a3a1cbc
F20101221_AABSVI regev_d_Page_17.tif
3a7b63918229c63d6d44c464afcd064d
16f97b4e81dcde557163d88f3f6d6fe3cb44b92e
32528 F20101221_AABSQM regev_d_Page_10.QC.jpg
cfc5ef1620acb45eb74b0b9a9ab5ab39
c8279e1ddfa4d94c3240974da58a933ab99815ef
36194 F20101221_AABTCH regev_d_Page_30.QC.jpg
6b7f8ff8edc5a29b6c739bdd8fc0eff7
9238bb5274da80c186702d6ebbdab0f25d19289b
F20101221_AABSVJ regev_d_Page_19.tif
1c112ab502d45978f21c9d4cf5f85e17
99bae3e66874b90de94d0111f99d2bede9615518
1051977 F20101221_AABSQN regev_d_Page_16.jp2
749f3b857929485dcac8cc476436a79b
78a91fc1a3a53d42cac0bcc76ea03d6cbf63f597
8772 F20101221_AABTCI regev_d_Page_30thm.jpg
d60a3345c1b912e20461bf0cddc29aa6
838056737bf3d9120b12f3b6d4e2bab1b30aea70
F20101221_AABSVK regev_d_Page_20.tif
0f4098366f2e3ee0418df41684ee8837
a3f8117f9b14335cebebd7aa5271f2e2716d4ae3
33875 F20101221_AABTCJ regev_d_Page_31.QC.jpg
8cb94d42e163a4db401c701f833aa093
ed47f832fa8d37d09231ef3092a53d8c03413d9b
140957 F20101221_AABSQO regev_d_Page_62.jpg
a5b44497bfe43c0509c1b4bd389da501
9b8af88cb803e8c7be1a832c3af6d2143c93f08b
F20101221_AABSVL regev_d_Page_22.tif
d37ef7be7b8a1f8ebbfdf16b64ae3463
b010e75c2e5a44242cc7ba161c913e94ad521d19
36356 F20101221_AABTCK regev_d_Page_32.QC.jpg
3eda12d3854f842b73198ec65bf43f99
14241906a982c9f63b314ecd16de029240f78d1e
F20101221_AABSQP regev_d_Page_21.tif
f86f33a41eb479ef621eabf10c6e8696
7cb5fa562423cb768b1a56e8ef8b208638784a2d
F20101221_AABSVM regev_d_Page_23.tif
02f7814619c2f17f8d37c39bcc55a915
012ba2278be66fecf5f1e210b908a2e5bf64e910
8752 F20101221_AABTCL regev_d_Page_32thm.jpg
a7ac6738cff5cc372b5ddb6bf8bb0b0d
405fbb53bb26873d116c4a7e6794a5a24bdf941a
678 F20101221_AABSQQ regev_d_Page_42.txt
cdcc9b153abeec486f211ff79c713e87
dfab2829b6df1837db809d8c58eba7e436d7d07a
F20101221_AABSVN regev_d_Page_24.tif
334289da3c7e3c951df87fd5b4ee0c79
83cdfbedba48f1bce65cb28ce2399ef910628dd2
13244 F20101221_AABTCM regev_d_Page_34.QC.jpg
a1a97ac79012e95156ec7d2b6e698e50
2eb3abca3d990a1cff4932b73f3f5c337c51fec9
18708 F20101221_AABSQR regev_d_Page_03.pro
952a89ae67508afcc012c69a9972e48b
e4867b8c18c05d6bd57395a86a137bda74f60bd7
F20101221_AABSVO regev_d_Page_26.tif
f50146610fc8fcd9bf4824ff5e62ffcf
eded2f24562fe068f97c5b98169cf7a60a34572f
30185 F20101221_AABTCN regev_d_Page_35.QC.jpg
f1fd02f8c20c5fd1ebf38a05369c5729
ec6b28eca3acf870dca8d8628b4c6fd97b4290a3
1051958 F20101221_AABSQS regev_d_Page_14.jp2
a7b9fa2809b0d2822df069345b5a7e9f
e424233f11d8543bb38c766a2e67c3ec7081ed4a
F20101221_AABSVP regev_d_Page_27.tif
2722eea684edc492af6d9fb6c4021c57
6d8bb01442e24869cd45a7afec0af5a911c0a9dc
8062 F20101221_AABTCO regev_d_Page_36thm.jpg
2665e1f2269ee54317e09496e0764392
205fdd765203bed9a56ad9fee9c2f1ccf596aac6
2749 F20101221_AABSQT regev_d_Page_62.txt
217ee9d60367c9b18bd8972b3ea15fb2
174e2b82f69915f48cfebb01d42fd0bdf594f0bb
F20101221_AABSVQ regev_d_Page_29.tif
0e2c4db98656b8019e17c61504b75cd3
df57d27bb6234daa250c179766d205f427936d5b
31805 F20101221_AABTCP regev_d_Page_37.QC.jpg
fac17a5d5fd31bbe664c68e60ee2de7a
b84b8146e3edf39b0412344b802ccd12cc95c265
8691 F20101221_AABSQU regev_d_Page_17thm.jpg
ca643efc4cb8d17b938238a96cc1f8ac
9981049b00020db0fd4c95d3c529b30136ed6c51
F20101221_AABSVR regev_d_Page_30.tif
4916c6e90613a3d54167f5f690b8458d
986a8f27b917a48be5180d0b5d4b65eef5ac0ebb
8080 F20101221_AABTCQ regev_d_Page_37thm.jpg
09c960f09b36ef164afa821a748a16b2
7f84e781e2138a373c726ccc0715c6832f5f169f
99189 F20101221_AABSQV UFE0025083_00001.xml
45ee901ad79d81d207357a296433d0b7
50d6def65eb9a7475255e29974db56d993a6857d
F20101221_AABSVS regev_d_Page_32.tif
efae658ac02eb73ffcb81224b365ed5c
40365b06aef895c8ac311269cdc0eded5203e137
13462 F20101221_AABTCR regev_d_Page_38.QC.jpg
4075d8ac6d453030da8454ea2960b495
03bb23666f8d88e634146a5463c340542a360e6f
F20101221_AABSVT regev_d_Page_33.tif
718af18a22d481c0abf78c8d51ba85f3
617942f7e7f0b94dd0d64e59676a838d85652aae
3483 F20101221_AABTCS regev_d_Page_38thm.jpg
d632695867646d01a2841e5dc52ba437
7e30ee2bfacf1713a7d2035e3b1e2ac93e67844a
F20101221_AABSVU regev_d_Page_35.tif
f47f23a848bb9d1011691043c3f06154
68b77cbb4b347a8d176fe90e2087fa0bd1ca5d0e
8169 F20101221_AABTCT regev_d_Page_39thm.jpg
00ade1fee2a2b5b43043132db649cbea
e9a33342a12d61c21b6fe0d6aa4562d746a1843c
28618 F20101221_AABSQY regev_d_Page_01.jpg
23703c09a9ca3ff99f77f17a6dc91c85
e86d96a1830958610e73ad9173245c40820c9df4
F20101221_AABSVV regev_d_Page_36.tif
0b79896ab50004d000402aca01086d87
3c2e78a9a628e7e4f108c64ac3d2e5b65c9d4057
1051890 F20101221_AABSOA regev_d_Page_54.jp2
eb594b9d44f4485c27595091f298fdfd
dd6d420c374854a9df0f69854e2f95568ddb49c6
3756 F20101221_AABSQZ regev_d_Page_02.jpg
0693f4fb485deda6ed7d39063cd93401
617e6b01f813ea97b76a88000404a9eaef77ed6b
F20101221_AABSVW regev_d_Page_37.tif
5a4671a998100a113f49205cd554d3f7
72188dc7e9ca59ecd7fe23a114a3793a5c3d7b66
13022 F20101221_AABTCU regev_d_Page_40.QC.jpg
1d04bfebd66c148bc25f649404f01ad0
d5a7767357bdef43acc792281552006aca2ecd3c
F20101221_AABSVX regev_d_Page_38.tif
9c975bd638d2b27b36dfcd89efb1fb58
3815d7025a89d91723f50aee7ee371738594e1fb
F20101221_AABSOB regev_d_Page_49.tif
1ebe5bd37faa01cd3cb56239faff9332
3615bf29543e62dc49a7387205793506223ee008
4188 F20101221_AABTCV regev_d_Page_40thm.jpg
dd17b06041197a90bce9d6b6c3a74132
a09c2a6a4f98481eea0d1530dc86bda841e4c6f5
F20101221_AABSTA regev_d_Page_06.jp2
a5d3b6a15a09ed5b11f8d4ecac93afc7
baf8061a0b1906b17e341499b7182690d5dc9865
F20101221_AABSVY regev_d_Page_39.tif
6d83538e81eff2d263f3e798dc6db581
a99dd60d9ac12e014276e889bc92fee7059841b1
67096 F20101221_AABSOC regev_d_Page_44.jpg
5481a0574543234d92c21a7c8b1d74da
d838cdcfaedd680c2514fdd36a6fa984e1d881ae
14075 F20101221_AABTCW regev_d_Page_41.QC.jpg
55128ac68b70e87cf87d1d1601339cf5
cce86beef50ed7f9772ad78ade3ec55de9eea39f
1051966 F20101221_AABSTB regev_d_Page_07.jp2
ed626a88998d00cb9962d92521431e39
5402f10241806df63933d4a533621a1e656adbd4
F20101221_AABSVZ regev_d_Page_40.tif
6a80a40ca40ba5cdea868c9bf8e1c59d
a61743c9a8d85ef7930e2b67a13611d04a843e3b
115286 F20101221_AABSOD regev_d_Page_04.jpg
0dc1d3c2c97a9d00964115fe85435715
c103943015614f51e978ac73c83ce0e2c9dc200a
14329 F20101221_AABTCX regev_d_Page_42.QC.jpg
5d9e4c1fc7333f37c283e38370b29f31
e5d735d0f02e7adc1d433c6bb023f3527467536f
F20101221_AABSTC regev_d_Page_08.jp2
77a0de45c7648d134fe3b1f697c3205c
eebe178a8dbe5a2ae7d052d34523e42a02e7e25f
36480 F20101221_AABSOE regev_d_Page_54.QC.jpg
b3c7a9b7ebc8a5a17ba3b4520b935291
39e586805059ed1af2785651ac5a143c7d7c8bd3
4377 F20101221_AABTCY regev_d_Page_42thm.jpg
4a09d0a35399904d9c2756203a7f96c0
b3a0edf6114ae7fab28d4720a779754d731ece5f
10941 F20101221_AABSYA regev_d_Page_50.pro
fc1b480f069c8b4ecfb6554934906f11
860d289a13d4ff450cc14a0a30486b850cf47f7e
845 F20101221_AABTAA regev_d_Page_46.txt
73de175e9543f231012de4da4f2a9dc4
d971e7e64aaf7516dcd7aab4237fa279fd1f12dd
156783 F20101221_AABSTD regev_d_Page_09.jp2
5e2e77daa266dbdcfa5fab51bc8f3065
eb53d4b412e754b65ad3985c78804875936efe41
37674 F20101221_AABSOF regev_d_Page_18.QC.jpg
eac5ca8410fc03435512f27dd0518e8a
c6414bb957b59d5ca061ef4d0fefccec68d7a0c3
12514 F20101221_AABTCZ regev_d_Page_43.QC.jpg
838c64cbd4a0d04e10c58b6cfce8cabd
03c86ae37df744f575701ed394ada3c6e3de7bbb
10559 F20101221_AABSYB regev_d_Page_51.pro
e2123749c8e5a425c67fc50f07c62226
0db15213e93e0314e5d073b116051c2089c6d492
380 F20101221_AABTAB regev_d_Page_47.txt
a900d3ea685b3a5638b066be666c69aa
c9a6fc96c1489f8771af2645c553b79c4cdbc99b
F20101221_AABSTE regev_d_Page_10.jp2
4de856e1afbbe3c1896113b8b92b6335
01ea5c5d2c85888d92c7a5e70ca8d5fdd28876ea
60281 F20101221_AABSOG regev_d_Page_25.jpg
7c6286ed33028b62f7bcbd02be6a1369
984b61a3cc30b5b81f329c110b195760778f2634
12069 F20101221_AABSYC regev_d_Page_52.pro
0996152d8758dd9274b3ee1855d3b1d1
5450570da3d74ec3ddba83110568242ae1f4096f
812 F20101221_AABTAC regev_d_Page_48.txt
afcf431c2153ca678a0a2574ee04965f
76e8b06b37d82b375845b27d682c7814dd2e7b0b
582432 F20101221_AABSTF regev_d_Page_11.jp2
0646d459f70bcd0cf376c1af3d1a2822
72fda9cefaeb131fa59c5544bcdce469fbf770ff
F20101221_AABSOH regev_d_Page_28.tif
a0bc190485adf7de884371151367abeb
506e22441adfb49e66f118db3166a30bbc929b22







HEME OXYGENASE-1 REGULATES CCR2/MCP-1 AXIS AND GRANULOMA
FORMATION IN A MOUSE MODEL OF NONTUBERCULOUS MYCOBACTERIAL
INFECTION.




















By

DORON REGEV


A THESIS PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
MASTER OF SCIENCE

UNIVERSITY OF FLORIDA

2009




































2009 Doron Regev









ACKNOWLEDGMENTS

I would like to acknowledge Dr. Veena Antony and especially thank her for her guidance

in my research and my writing. I would also like to thank the other members of my committee,

Dr. Henry Baker and Dr. Reuben Ramphal for all the input they provided. Thanks to Dr. Ana

Montes-Worboys and Dr. Yimu Lai for their continued help and technical assistance in the lab

and thanks to Edward Hensel for showing me the clinical aspects of medical research. I would

like to thank Dr, Kamal Mohammed and Dr. Nasreen Najmunnisa for their help and guidance

along the way. Finally, I am grateful to my parents, Michael and Dalia and my sister, Dana for

their support and inspiration throughout my life.










TABLE OF CONTENTS

page

A C K N O W L E D G M E N T S ...............................................................................................................3

LIST OF FIGURES ................................... ............ .. .............................6

ABSTRACT ............................ .......................................................8

CHAPTER

1 IN TRODU CTION ................... ............. .................................. .............. 10

Hypothesis ................................. ... ........................................II
Obj active ........................................ ........ ............... ...............11

2 BACKGROUND .................................................. .......................12

Mycobacterium ................................. ....... ...........12
M ycobacterium Avium ............. .......... .. ........ .... .. ............. .... 13
Mycobacterium Avium Complex (M AC)................................... .................. 14
Host Response To Infection.............................................. 15
Formation Of Granuloma ......................................... 16
H em e O xygenase-i (H O -1) .......................................................................................... ... ....... 17
Monocyte Chemoattractant Protein-i (MCP-1) ....................................................... 19
Chem okine (C-C M otif) Receptor 2 (CCR2) ....................................................... 21

3 M ATERIALS AND M ETHODS ................................................. ...............27

HO-1 Knockout M house M odel ........................................................................... 27
M. Avium culture..................... .... .. ..................... 28
Collection Of Serum ....................................... ..........28
Bronchial Alveolar Lavage Fluids (BALF)........................................................ ......... 28
Tissue H harvest ...................................................... ........ 29
Immunohistochem istry .................. .................................................... .............. 29
TIB-71 (RAW 264.7) Cells ............................................... ...............30
Co-Culture of RAW 264.7 Cells With M. Avium.......... ...............................30
HO-1 Inhibition By Zinc Protoporphyrin-IX In Cell Cultures.............................................31
Mouse Model For M Avium Infection ................................................ 31
Cytokine Studies ....................... ......................... ..........32
Real-Time Polymerase Chain Reaction (RT-PCR) Analysis ......................................32
Statistical A nalysis............................................... 33

4 RESULTS ...........................................................................35

In Vitro Results.................. ................................... .............. 35
HO-1 is induced by M avium in RAW 264.7 cells............................. .............35

4










MCP-1 relative gene expression in RAW 264.7 cells........................35
.CCR2 relative gene expression in RAW 264.7 cells................................ ......35
M CP-1 levels in Cell Culture Supernates....................... ............................. .......... 36
In Vivo Results ...................................................... ........ 36
M house tissue ......................................................... ................36
Immunohistochemistry ...................... ........................................ ........ 36
HO-1 protein expression in mouse lung tissue............................................................ 37
CCR2 expression in mouse lung tissue ............................... ...............37
MCP-1 levels in BALF and serum ........................................... ...............38

5 DISCUSSION .......................... .... ... ............... .53

6 FUTURE CON SIDERATION S .................................................. ............... 57

REFERENCES ................................................. .........58

BIOGRAPHICAL SKETCH .................. ......... .................. 65









LIST OF FIGURES


Figure page

2-1 Recognition of an appropriate ligand by TLR-2..................................23

2-2 Formation of granuloma involving pathogen, macrophages, T-cells, and B cells. ...........24

2-3 Degradation of heme by HO-1 ...........................................................................25

2-4 CCR2 structure ................... ........................................... ........ ............... 25

2-5 Schematic representation of the signaling pathways activated through the CCR2.
Ligand .............................. ..................... ........ 26

3-1 Targeted disruption of the Hmoxl gene ............... .................... ....... 34

4-1 400x magnification stain of RAW 264.7 cells after 4 hours of incubation in SFM
showing basal levels of HO-1 ........................ ..... ............39

4-2 400x stain of RAW 264.7 cells after 4 hours treatment with M avium showing
increased levels of HO-1 ..... ................. ..... .... .. ...... .............. 39

4-3 HO-1 relative apparent gene expression significantly increases in a time dependent
manner in mouse monocytes after treatment with M. avium..................... ......... 40

4-4 MCP-1 Relative Gene Expression significantly increased (p < .001) in monocytes
after treatment with M. avium for 8 and 24 hours as compared to controls ...................41

4-5 CCR-2 Relative Gene Expression was significantly increased (p<.05 ) in M. avium
treated monocytes as compared with controls at 4 hours (*), 8 hours (**), and 24
hours (***) and in cells treated with ZnPP and M avium as compared to controls. .......42

4-6 MCP-1 levels significantly increase (p < .05) in cell supernates in a time dependent
manner after treatment with M avium as compared to controls...... ................ ..43

4-7 HO-1+/+ 6 month control lung ................. .... ......... .... .........44

4-8 HO-1 +/+ lung showing granuloma formation ............. .............................. 44

4-9 HO-1 -/- 6 month control lung.............. .... ......... ..... ........45

4-10 HO-1 -/- lungs showed disseminated infection and loose granuloma formation............45

4-11 A) 100x magnification H&E stain of an HO-1 +/+ control mouse lung. B) 100x
magnification H&E stain of an HO-1 +/+ mouse infected with M. avium...................46









4-12 A) 100x magnification H&E stain ofHO-i -/- saline control lung. B) 100x
magnification H&E stain of HO-1 -/- showing loose, unorganized granulomas and
disseminated infection in lung tissue following 6 month exposure to M. avium .............46

4-13 100x magnification of control lung from HO-1 +/+ mouse showing basal levels of
H O-1 ............. ................... ......................................................... ........ 47

4-14 200x magnification ofM. avium infected HO-1 +/+ mouse lung tissue showing
increased expression of HO-1 in granuloma............... ................47

4-15 200x magnification of granuloma in M avium infected HO-1 +/+ mouse lung
showing increased expression of HO-1 in granuloma....................................................48

4-16 A) 100x magnification of control HO-1 +/+ control lung showing basal levels of
CCR2 (brown). B) 100x magnification of HO-i -/- control mouse lung showing
basal levels of CCR2....... ................. ..................... ...... ........ 48

4-17 A) l00x magnification of an HO-1+/+ control mouse lung tissue showing basal
levels of CCR2 (brown). B) 100x magnification of an HO-1 +/+ mouse lung
inoculated with M avium for 6 months showing increased expression of CCR2.............49

4-18 A) l00x magnification of an HO-1 +/+ mouse lung after 6 months M avium
infection showing CCR2 expression (brown). B) An increase in CCR2 expression in
HO-1 -/- mouse lung after 6 months of M avium infection ...........................................49

4-19 A and B. 100x magnification of an HO-1 +/+ mouse lung after 6 month infection
with M avium showing CCR2 co-localizes with granuloma ............... ...............50

4-20 A and B. 100x magnification of an HO-1 -/- mouse lung following 6 month infection
with M avium showing disseminated expression of CCR2 ...........................................50

4-21 MCP-1 levels are significantly increased in BALF of infected HO-1 +/+ and HO-1 -
/- mice as compared with controls. ........................................ ................. 51

4-22 MCP-1 levels are increased in mouse serum after 6 month M avium infection and
are significantly higher in infected HO-1 +/+ and HO-1 -/- mice as compared with
saline controls. .......................................................52









Abstract of Thesis Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Master of Science


HEME OXYGENASE-1 REGULATES CCR2/MCP-1 AXIS AND GRANULOMA
FORMATION IN A MOUSE MODEL OF NONTUBERCULOUS MYCOBACTERIAL
INFECTION

By

Doron Regev

August 2009

Chair: Dr. Veena Antony
Major: Medical Sciences

Non Tuberculous Mycobacterial (NTM) infections are a major cause of disease in animals

and humans around the world and have become an increasing source of infection among patients

with HIV and AIDS. Recently, there has been an increase in NTM infections in

immunocompetent patients, especially in the Southeastern United states. A hallmark of NTM

infection is the formation of granulomas which are a conglomeration of the invading pathogen

and host inflammatory cells including macrophages, T-cells, B-cells and dendritic cells.

Granulomas can contain the pathogen and protect the host from further dissemination of the

infection. Heme Oxygenase-i (HO-1) is a cytoprotective enzyme which breaks down heme.

HO-1 is induced by oxidative stress, bacterial infection and many pro-inflammatory cytokines

and has been shown to be up-regulated in granulomas and infected tissue. Monocyte

Chemotactic Protein-i (MCP-1) along with its receptor Chemokine Receptor2 (CCR2), are

responsible for the recruitment of monocytes from peripheral blood to the site of infection. Our

hypothesis is that HO-1 plays a role in the formation of organized (tight) granulomas by

regulating the expression of CCR2 and MCP-1 in monocytes and coordinating cellular

recruitment form peripheral blood to the site of infection. We have developed a mouse model of

8









Mycobacterium avium infection in both HO-1 +/+ and HO-1 -/- mice to test whether the lack of

HO-1 expression results in the formation of unorganized (loose) granulomas and to test whether

HO-1 regulates MCP-1 and CCR2 in this disease model.









CHAPTER 1
INTRODUCTION

Non-Tuberculous Mycobacteria (NTM) are a group of Mycobacteria that are not members

of the Mycobacterium tuberculosis complex. NTM are a major cause of opportunistic infection

in immunocompromised and healthy hosts. These organisms can cause disease in animals and

humans and have become an increasing source of infection among patients infected with Human

Immunodeficiency Virus (HIV) or Acquired Immune Deficiency Syndrome (AIDS) (1).

Mycobacterium avium complex (MAC) is the most common disseminated bacterial infection in

untreated patients with AIDS. A hallmark of disseminated MAC infections is the formation of

granulomas in multiple organs including the liver, spleen, lymph nodes, bone marrow, and lung

(1). Granulomas are lesions in tissue that are formed by the aggregation of activated

macrophages, T-cells and fibroblasts and are considered a defense mechanism against invading

pathogens. Importantly, bacteria are not always eliminated within the granuloma, but can

become dormant, resulting in a latent infection (2). In disseminated mycobacterial disease, the

function and structure of granulomas are either absent or compromised. This leads to a failure of

the host defenses to contain the bacterium and to further pathology. Our current study aims to

elucidate the role of Heme Oxygenase-i (HO-1), a cytoprotective enzyme, in the formation of

organized granulomas. Specifically, we are looking at the role of HO-1 in the regulation of two

cytokines, Chemokine Receptor 2 (CCR2) and Monocyte Chemoattractant Protein-i (MCP-1)

both of which are responsible for the recruitment of inflammatory cells to the site of infection.

Recruitment of immune cells to the site of infection is a vital step in granuloma formation and if

the process is inhibited or altered, the Mycobacterial infection may not be contained.









Hypothesis

Our hypothesis was that HO-1 plays a key role in granuloma formation following

mycobacterial infection by regulating the expression of CCR2 and MCP-1 in mouse monocytes,

therefore, influencing the recruitment of these inflammatory cells to the site of injury. In HO-1

+/+ mice, we expected to find high levels of MCP-1 in the lung following infection with M

avium, creating a gradient for chemotaxis of immune cells from the periphery to the site of

injury. In HO-1 -/- mice, in which the HO-1 gene was mutated and knocked out, we expected to

see high levels of MCP-1 and CCR2 in the periphery as well as in the lung following infection

with M avium., therefore, causing the gradient for chemotaxis to be disturbed and inflammation

to be disseminated.

Objective

Our objective was to develop a murine model of M. avium infection and granuloma

formation in order to elucidate the role of HO-1 and its regulation of MCP-1 and CCR2 in mouse

monocytes.









CHAPTER 2
BACKGROUND

Mycobacterium

Mycobacterium is a genus of Actinobacteria, a gram positive bacterium with a high G-C

content. Mycobacteria are aerobic and non-motile. They are classified as gram positive because

they lack an outer cell membrane but they characteristically have a thick cell wall comprised of

mycolic acid or mycolates (the Latin prefix "myco" pertains to the waxy compounds in the cell

wall of these organisms). The Mycobacterial cell wall consists of a hydrophobic mycolate layer

and a peptidoglycan (PGN) layer which are held together by arabinogalactan, a polysaccharide

(1). This waxy cell wall is an essential virulence factor which contributes to the organism's

survival and gives these organisms their ability to withstand the environment and resist many

antibiotics. Mycobacteria can survive long exposure to acids, alkalis, detergents, oxidative burst,

and lysis by complement. They can also resist antibiotics that target the cell wall such as

penicillin. These organisms are widespread in the environment and typically live in water and

food sources (4).

Before the AIDS epidemic, the usual presentation ofNTM disease in immunocompetent

patients was pulmonary, confined to cervical lymph nodes, limited to skin or in rare cases,

disseminated (3). Most patients presenting this disease were older men who had previous

underlying pulmonary diseases such as chronic obstructive pulmonary disease (COPD),

bronchiectasis, previous tuberculosis and silicosis (5). Other risk factors for NTM disease

include: reduced immune competence due to cancer chemotherapy, immunosuppression involved

with transplantation, altered chest architecture, alcoholism, and smoking tobacco (4). Recent

findings, however, suggest that the occurrence of NTM disease in immunocompetent patients

with no underlying lung disease is on the rise. The major pulmonary mycobacterial pathogens









are: Mycobacterium avium (M. avium), Mycobacterium kansasii (M. kansasii) and

Mycobacterium intracellulare (M. intracellulare). There is little evidence of person-to-person

spread of NTM and it is believed that the environment is the main source or reservoir for these

organisms. NTM disease in AIDS is caused primarily by M. avium and is second only to AIDS

wasting syndrome as the most common cause of death in these patients (6).

Mycobacterium Avium

M. avium is a non-tuberculous mycobacterium which infects humans and animals alike.

M. avium is an opportunistic infectious agent that mostly affects patients with underlying

conditions that compromise local or systemic immunity (7) and has become a major human

pathogen, primarily due to the emergence of the AIDS epidemic. This mycobacterium is found in

the environment, particularly in water sources and is in close contact with human populations

(7). Human infection is believed to be initiated either through the intestinal tract or by the

inhalation of aerosols containing bacteria (7). When inhaled, M. avium enters the body via the

respiratory route through aerosols and the first host cells to encounter the pathogen are bronchial

epithelial cells and alveolar macrophages (7). Mycobacteria use different receptors to gain

access into macrophages: mannose receptors, complement receptors (CR3), type A Scavenger

receptors and in exposed hosts with mycobacteria-specific antibodies, Fcy receptors (7, 8).

M. avium can spread from the initial site of infection to the rest of the body through the

lymphatics or through the blood. At the main site of infection, the bacilli are phagocytosed by

alveolar macrophages (4). This is the first event in which the host develops a response to the

invading pathogen and is vital to the outcome of infection. Of the many virulence factors of

Mycobacteria, their ability to reside and multiply within alveolar macrophages is seen as one of

the most important. Other virulence factors of NTM are: prevention of acidification of

phagocytic vesicles, prevention of phagosomes-lysosome fusion, delay in tumor necrosis factor

13









secretion by infected host cells, uptake by epithelial cells and production of receptors for

macrophage binding (9). Phagocytosed pathogens are normally transported from the

phagosomes to lysosomes within the macrophages and are effectively destroyed after phago-

lysosomal fusion. The most well-characterized antimicrobial mechanisms of the macrophage are

the ones that involve oxidative damage: the respiratory burst and nitric oxide (NO) production

(9). These two systems work synergistically in killing many microbes (7, 10). Macrophages that

have phagocytosed the bacilli normally die and form a central area of necrosis or a caseum; the

pathogen is then contained within these caseous granulomas (11).

Mycobacterium Avium Complex (MAC)

Mycobacterium avium complex (MAC) is generally referred to as an opportunistic

pathogen since it usually infects patients with established lung damage (11). Mycobacteria

included in the MAC family are classified as acid-fast, slowly growing bacilli that may produce a

yellow pigment in the absence of light (1). Other species of Mycobacteria which are included in

MAC include: M. avium paratuberculosis, M. avium silvaticum, M. avium hominissuis and M

avium colombiense (3). MAC in AIDS patients most often causes a disseminated illness

(bacteria is spread though the blood stream) and can cause many symptoms throughout the body.

The risk of MAC is inversely related to the patient's CD4+ T-cell count, and increases

significantly when the CD4+ T-cell count decreases below 50 cells/mm3 of blood (3). 98% of

MAC infections in AIDS patients are due toM. avium (1). Isolates from MAC infected patients

are commonly referred to as Mycobacterium avium hominissuis, since this strain is found mostly

in humans. Like most NTM, MAC bacteria are found in air, water, soil, foods, some tobacco

products, and in many animals. Covert et al showed that person-to-person transmission of MAC

bacteria is unlikely, suggesting that humans contract this disease from the environment (12).

Recently, there has been a growing concern about human exposure to MAC through drinking

14









water due to its high resistance to most chemical disinfectants in water treatment processes and

its high prevalence in biofilms in water distribution systems (13, 14, 15). Because most

Mycobacteria are intracellular pathogens, the host cells, alveolar macrophages (AM) in this case,

can actually serve as a barrier to the delivery of drugs to the intracellular environment (16).

MAC organisms have shown to have resistance to many antimycobacterial drugs, which adds to

the challenges of treating this disease.

Host Response To Infection

After mycobacterial infection, the innate and adaptive immune systems respond with the

recruitment of immune cells to the site of injury. The bacilli are recognized by host immune cells

via Toll-Like Receptor (TLR) 2 ligation (17). TLRs are pattern recognition receptors (PRRs)

which recognize and bind to mycobacterial cell wall components and other pathogenic materials.

TLRs are believed to represent key receptors for the recognition of mycobacterial antigens and

activation of macrophages and Dendritic cells (DC), as well as other cells of innate immunity,

thereby likely modulating the adaptive immune response (15,17,19). A variety of microbial

products recognize and activate mammalian TLRs, facilitating the transcription of genes

involved in regulating the adaptive immune response, including chemokines, cytokines and co-

stimulatory molecules (15,20,21,22). Mammalian TLRs represent a structurally conserved

family of membrane receptors, which have homology to the Drosophila Toll system (17, 20).

TLR signaling leads to the nuclear translocation of the transcription factor nuclear factor-xB

(NFKB) via a MyD88 dependent or independent manner (9) (Figure2-1). NFKB is involved in

the expression of many immune response genes, such as those encoding cytokines. TLR

signaling also triggers differentiation of monocytes into macrophages and dendritic cells

allowing for a more potent innate and adaptive immune response (9, 24). Cytokines are likely to

be important mediators during the pulmonary inflammatory response (25). It is also believed

15









that the ordered influx of leukocytes to the site of inflammation is controlled by different

regulatory Chemokines (26, 27). Chemokines are a large family of structurally related secreted

proteins that are important for leukocyte trafficking. These small (8-12kDa) inducible secreted

cytokine proteins act primarily as chemoattractants and activators of leukocytes (28).

Chemokines can be divided into four subfamilies (C-C, C-X-C, C, and C-X-X-X-C) depending

on spacing of highly characteristic cysteine residues within their amino terminal regions (29).

Chemokines are produced by a variety of cells, including leukocytes, epithelial cells, endothelial

cells, fibroblasts and numerous other cell types following stimulation by cytokines or microbial

products (25 30, 31). Chemokines exert their effect via a distinct group of seven-

transmembrane-domain protein receptors that signal through heterodimeric GTP-binding

proteins (29, 32).

Two important molecules involved in the recruitment of monocyte-macrophages and T-

cells to the site of infection are Monocyte chemoattractant protein-i (MCP-1) and Chemokine

receptor 2 (CCR2). MCP-1, acting through its receptor CCR2, is a potent chemoattractant for

mononuclear cells (25).

Formation Of Granuloma

Granulomas are formed as a consequence of chronic antigen persistence and are thus a

hallmark of all mycobacterial infections (32). In general, the production of pro-inflammatory

cytokines and chemokines is essential for the recruitment of inflammatory cells to the site of

infection and for the formation and maintenance of granuloma. This will not only localize and

sequester the bacteria, but will also localize the immuno-pathologic responses to the bacteria

(34). Granuloma formation involves the interaction of bacteria, fibroblasts, immune cells,

including macrophages, and T cells, as well as immune effectors such as chemokines and

cytokines (Figure 2-2). This process involves a cytokine network which drives the T-helper cell

16









immune response. Formation of granulomas is dependent on sequential release of specific

cytokines and chemokines, which activate and chemoattract T lymphocytes and monocytes, the

cellular components of granulomas. In vivo granuloma formation is induced and maintained by

various cytokines (35). It is believed that small, solid (organized) granulomas can contain the

infection and prevent further pathology, whereas, large, necrotic (loose) granulomas may lead to

the dissemination of the bacteria and cause greater infection. For this reason, the integrity of a

developing granuloma is crucial in terms of disease progression and survival. Ehlers et al., (32)

have shown that mice lacking a Tumor Necrosis Factor (TNF) receptor have granulomas that

disintegrate and cause widespread inflammatory apoptosis of both granulomas and surrounding

tissue, leading to higher mortality. Granulomas can provide antibacterial protection in host

tissue, but can also induce tissue damage and inflammation concomitantly. Thus, the outcome of

mycobacterial disease is linked to granuloma formation and maintenance of granuloma integrity

(16, 36, 37, 38). We believe that MCP-1 forms a gradient for immune cells expressing CCR2 on

their surfaces following mycobacterial infection. It is this gradient which allows immune cells

such as monocyte/macrophages, T-cells, and Dendritic cells to be recruited to the site of

infection from the peripheral blood. If this gradient is somehow lost, then the immune response

will not be effective in clearing the infection since the proper inflammatory cells will not be able

to migrate towards the injury and will cause widespread inflammation and further pathology of

the disease.

Heme Oxygenase-1 (HO-1)

Heme Oxygenase (HO) is a ubiquitously expressed protein which catalyzes the

degradation of heme to produce three catabolic byproducts: carbon monoxide (CO), Iron (Fe2+)

which is sequestered by ferritin and Biliverdin which is converted to Bilirubin by Biliverdin

reductase (39) (Figure 2-3). There are three isoforms of HO including: one inducible form, HO-

17









1, and two constitutive forms, HO-2 and HO-3 (40). Also known as Heat Shock protein 32

(HSP32), HO-1 is the rate limiting enzyme involved in the degradation of heme, a potent

oxidant. In addition to its role as a key enzyme in heme degradation, HO-1 has been shown to be

anti-inflammatory and anti-oxidative through its breakdown of heme (41). HO-1 is a 32 kDa

microsomal stress response protein that is induced by oxidative stress, inflammation and

bacterial infection and is secreted by many cell types (41). Mitzuno et al. (41) have shown that

among peripheral blood leukocytes, monocytes are the principal source of HO-1 when stimulated

in vitro and that his production plays a role in systemic inflammation. HO-1 has been shown to

be induced by glutathione depletion, lipopolysaccharide (LPS) and both hyperoxia and hypoxia

in vivo (42). In addition, HO-1 is induced by various cytokines and growth factors (43). The 5'-

flanking region of the HO-1 gene contains binding sites for the transcription factors that regulate

inflammation, including nuclear factor-kappa B and activator protein 1(74). However, these do

not appear to mediate lipopolysaccharide-induced HO-1 gene expression. This transcription

factor may also be important in the regulation of HO-1 by pro-inflammatory stimuli (44). HO-1

plays a central role in the defense against oxidative and inflammatory insults in the lung and has

been shown to be upregulated in many pulmonary diseases (45). HO-1 deficiency, however, is

associated with chronic inflammation and increased leukocyte recruitment in mice and in

humans (41). Zampetaki et al (46) have shown that HO-1 deficiency in humans and mice results

in chronic inflammation and increased leukocyte recruitment. The byproducts of HO-i

enzymatic activity are cyto-protective, anti-inflammatory and may act as anti-oxidants at the

right concentrations (44). HO-1 has been implicated in the protection of lung tissue during

oxidative stress, but the expression and cellular distribution of HO-i is poorly characterized. In

healthy lung tissue, HO-1 has been shown to be expressed in alveolar macrophages and in









bronchial epithelial cells (46). HO-1 is recognized to alter both chemokine production as well as

chemokine receptor expression (74). Recruitment of monocytes to the site of infection is a

complex phenomenon dependant on the expression of chemokines and expression of receptors

for these chemokines on peripheral blood monocytes. HO-1 has been shown to act in cell

mediated immunity in the pleura and infections with M. avium have been shown to increase the

expression of HO-i in mononuclear cells and pleural mesothelial cells (47). HO-1 has been

shown to downregulate the inflammatory response in the lungs by attenuating the expression of

adhesion molecules and inhibiting the recruitment of leukocytes or by repressing the induction of

cytokines and chemokines such as MCP-1 (47). It is not known how HO-1 regulates and

suppresses cytokine expression. It is possible that HO-1 inhibits the actions of NFKB and

therefore abrogates an inflammatory response (45). HO-1 has been shown to directly regulate

MCP-1 mRNA expression trough the degradation of heme (48). Furthermore, HO-1 induction

results in suppression of monocyte chemotactic response via inhibition of CCR2 expression (49).

Monocyte Chemoattractant Protein-1 (MCP-1)

MCP-1 (Also known as monocyte chemotactic and activating factor (MCAF)) is a 76

amino acid peptide that is selectively chemotactic for peripheral blood monocytes (50). MCP-i

is an 8.7-kDa protein that has specific chemoattractant and activating activity for monocytes in

acute inflammatory conditions (25).The regulated interactions of chemokines with their

respective receptors are thought to mediate the controlled recruitment of specific leukocyte

subpopulations required during host defense and inflammation. MCP-1, a member of the CC

motif chemokine family, is secreted by pleural mesothelial cells, endothelial cells, fibroblasts,

monocytes, macrophages and leukocytes in response to inflammatory signals such as IL-1 and

TNF-alpha and bacterial infection (51). CC chemokines have two conserved, adjacent cysteines

near their amino terminus and are predominantly chemotactic for mononuclear cells (65). MCP-

19









1 is a primary and specific mononuclear cell chemoattractant from a class of cytokines that are

referred to as the platelet factor 4 (PF4) super family and are related by predicted primary

structural similarities and by conservation of a 4 cysteine motif (51). MCP-1 was first cloned

from mouse fibroblasts as a PDGF-inducible gene termed JE (24,52) and is homologous to

human MCP-1 (24, 53, 54, 55, 56,57). It has been shown that increased levels of MCP-1

following bacterial infection correlate with the influx of CD4+ T cells and macrophages in to the

lungs (25). However, other results suggest that MCP-1 is a mediator of inflammation and can

specifically stimulate the directional migration of T cells as well as monocytes and may play an

important role in immune cell recruitment into sites of antigenic challenge (47).

Previous results show that MCP-1, along with several other chemokines, is controlled by

the Nuclear Factor Kappa Beta (NFKB) signaling pathway (58, 59, 60). MCP-1 creates a

gradient for chemotaxis of monocytes-macrophages, T-cells and natural killer (NK) cells towards

the site of infection and is the ligand for CCR2 which is expressed on cell surfaces of leukocytes

(28). This receptor-chemokine interaction has been shown to induce haptotaxis (the migration of

cells along the gradient of substrate-bound attractant molecules) in mesothelial cells (28). MCP-

1 is characterized by its ability to evoke chemotaxis mainly in monocytes (50). MCP-1 has also

been shown to aid in the recruitment of other mononuclear phagocytes such as: CD45ARO+ T

lymphocytes, B cells, and NK cells (61). In vitro, MCP-1 is chemotactic for mononuclear cells,

but not Neutrophils (62). However, Neutrophils in an inflammatory milieu, can express CCR2,

potentially enabling their chemotaxis to MCP-1 (63). The association between augmented levels

of MCP-1 and the recruitment of mononuclear cells expressing CCR2 plays a crucial role during

chronic inflammatory disease (62). MCP-1 has been shown to be upregulated in HO-1 knockout

mice (64). This suggests a possible inhibitory effect by HO-1 on MCP-1. Alternatively,









Kanakiriya et al (65) have shown that inhibition of HO-1 with Zinc protoporphyrin (ZnPP), a

specific HO-1 inhibitor, prevented the hemin-induced expression of MCP-1 mRNA and that the

active form of Iron can also induce the expression of both HO-1 and MCP-1 (45). During

infection and inflammatory disease, the increased release of MCP-1 attracts T-lymphocytes and

macrophages to the site of infection and results in granuloma formation (54). ZnPP prevented

the expression of MCP-1 by hemin at 6 hours; examination at later time points demonstrate an

increasing level of expression of MCP-1 mRNA despite the continued presence of this inhibitor

of HO activity; indeed, at 18 hours, the level of expression of MCP-1 was increased almost

threefold in the presence of ZnPP (47). Thus, MCP-1 can also be induced by HO-1 independent

pathways, but this leads to a delayed expression of the chemokine (47). It is believed that MCP-

1 plays a crucial role in the development of disseminated MAC disease. Some studies have

shown that MCP-1 can act as a negative regulator for the CCR-2 cell surface receptor (66).

Chemokine (C-C Motif) Receptor 2 (CCR2)

CCR2 is a seven-transmembrane-spanning G-protein coupled receptor expressed on the

cell surface of leukocytes (60) (Figure 2-4). This receptor binds MCP-1 with high affinity and is

activated upon ligand binding (60). MCP-1 interacts with CCR2 which has two isoforms,

CCR2A and CCR2B (29, 68). Activation of CCR2 leads to downstream activation of

Phospholipase C (PLC) which cleaves the molecule Phosphotidyl inositol (4, 5) bisphosphate

(PIP2) (68). This cleavage forms two second messenger molecules called Inositol trisphospahte

(IP3) and Diacylglycerol (DAG) which induce intracellular signaling events and trigger

inflammation (68). Specifically, DAG has been shown to activate Protein Kinase C (PKC) and

IP3 has been shown to trigger the release of calcium from internal cellular stores (60). These

events promote the activation of the Mitogen Activated Protein Kinase (MAPK) pathway and

induce differentiation and chemotaxis of leukocytes (60) (Figure 2-5). CCR2 is expressed on

21









many different cell type surfaces and provides a mechanism for specific interaction with certain

chemokines. Belperio et al. (60) have shown that CCR2-/- mice have a reduced infiltration of

mononuclear phagocytes and neutrophils in a mouse model using tracheal allografts. However,

the levels of lymphocyte infiltration were not changed and the absence of CCR2 expression did

not change the protein levels of MCP-1 (60). Additionally, it has been shown that CCR2-/- mice

showed a decreased level of recruitment of mononuclear phagocytes to the site of granulomas

(69). Other experiments have shown that the CCR2 receptor can regulate MCP-1 levels by

binding and internalizing MCP-1, creating a self-limiting negative feedback loop and abrogating

the influx of inflammatory cells to the site of injury (70). Lu et al., (71) reported that CCR2 is

probably the only receptor for MCP-1 in vivo. We believe that expression of CCR2 on

monocytes plays an integral role in granuloma formation. This receptor allows immune cells to

chemotax along an MCP-1 gradient towards the site of infection.

















Toll-like receptor


IRAK


TRAF6


Nucleus


Figure 2-1. Recognition of an appropriate ligand by TLR-2 (for example, lipopolysaccharide)
triggers the Toll-like receptor to recruit MyD88. MyD88 interacts with the Toll-like
receptor through its own Toll/IL-1 receptor domain and in turn engages the serine-
threonine kinase IRAK though a death domain. Signal transduction factors such as
TRAF6 carry the signal through a series of phosphorylations until NFKB is ultimately
released to the nucleus where it can activate the transcription of appropriate immune
response genes. Allan Genome Biology 2000 1:reports0079 doi:10.1186/gb-2000-1-
6-reports0079













a Initiation of Immune response
Antigenic activation
1--t--1



Microcirculation k Mast cell NK cell y& T cell Dendritic
ro Histiocyte cell

Monocyte 1
Neutropily TNF IFNy
Q ?TNF IFN-y Antigen
_k Chermokines
Recruitment vi ya c 5

Developing granulomatous inflammation b Production of Ag-specific T cells in lymph node
Thi
TNF CDT cell









Antigen-loaded
dendrilic cell


-- Persistent
antigen


Pathogenesis of granuloma formation
Expert Reviews in Molecular Medicine 2005 Published by Cambridge University Press


Figure 2-2. Formation of granuloma involving pathogen, macrophages, T-cells, and B cells.











F 2+ Ferritin
Heme- Fe Fet Biliverdin
oxygenase Reductase

Heme Biliverdin Bilirubin


CO

Figure 2-3. Degradation of heme by HO-1. HO-1 catalyzes heme degradation to biliverdin-IX,
CO, and iron. These metabolites mediate the antiapoptotic, anti-inflammatory,
vasodilatory, anticoagulant, antioxidant, and antiproliferative properties of HO-i
(Fredenburgh et. al).


* Ligand binding sile V-T
N N-ytyc0iiadtiun sies v
, DRY motif
G protein binding site
* GRKs binding site
T Targets for GRKs


Figure 2-4. CCR2 structure. Regions implicated in ligand binding, coupling of effector
molecules and suggested targets for GRK and JAK are highlighted.
(apresslp.gvpi.net)











(MCFIN


N N


Nuclear
Translocation
Gene expression


iMJ



Ad1eao

Chnital


Figure 2-5. Schematic representation of the signaling pathways activated through the CCR2.
Ligand-binding to CCR2 induces conformational changes in the receptor, leading to
its dimerization; this in turns disables JAK2 association and activation. JAK
activation initiates the JAK/STAT pathway and enables efficient G protein coupling
to CCR2. G proteins mediate signaling cascades through GRK and arrestins, leading
to receptor desensitization and internalization. Other signaling molecules triggered
through CCR2 include PI-3 kinase, PLC, and MAPK (apresslp.gvpi.net)


Internalization
Recyding
Degradation









CHAPTER 3
MATERIALS AND METHODS

HO-1 Knockout Mouse Model

C57BL/6 mice were used for this model since it has previously been shown that this strain

develops focused lesions that grow into large granulomas following M. avium infection; these

granulomas exhibit central necrosis caseouss necrosis) similar to human granulomas described in

tuberculosis lesions (7). We used the HO-1 knockout model developed by Kenneth D. Poss and

Susumu Tonegawa as described (72). Briefly, the construct was designed to remove a 3.7kb

XhoI-HindIII fragment of murine DNA with intron sequence and coding sequence for the final

226 amino acids (Figure 3-1). Chimeric mice were generated as described (71, 73) and HO-1 -/-

(Hmox1-/-) were obtained by mating male chimeras with C57BL/6 females; these Hmoxl+/-

animals were intercrossed to produce Hmoxl-/- mice. HO-1 wild type (+/+), heterozygous (+/-),

and knockout (-/-) mice were maintained in a breeding colony in a specific pathogen free (SPF)

animal housing facility under Animal Care Services at the University of Florida. HO-1 -/- male

mice of 8 weeks of age were paired with heterozygous (+/-) females of the same age and

subsequent litters were genotyped for the HO-1 gene. Genotyping was done upon weaning

mouse pups 21 days after birth. Mouse tissue was obtained by cutting a small piece (1cm) off

the tip of the tail. This tissue was digested and genomic DNA was isolated using Extract-N-

AmpTM Tissue PCR Kit (Sigma, St. Louis, MO). PCR was performed using specific primers for

wild type and knockout (mutant) HO-1 genes. HO-1 Wild type primer sequence (forward, 5'-

GTA CAC TGA CTG TGG TRG GGG GAG-3', reverse, 5'- AGG GCC GAG TAG ATA TGG TAC-3')

and HO-1 mutant primer sequence (forward, 5'- GCT TGG GTG GAG AGG CTA TTC-3', reverse,

5'- CAA GGT GAG ARG ACA GGA GAT C-3'). The PCR product was run on a 2% agarose gel









supplemented with Ethidium bromide for UV imaging of DNA. The molecular weight of the

wild type and mutant gene products are 180base pairs and 290 base pairs respectively.

M. Avium culture

M. avium subspecies avium Chester (ATCC# 15769) was maintained in ATCC medium 90

Lowenstein Jenson medium and grown in Lowenstein-Jensen Medium Slants (BD Biosciences,

San Jose, CA) according to manufacturer's instructions. Alternatively, colonies were grown on

Middlebrook and Cohn 7H10 agar plates (BD Biosciences, San Jose, CA) and incubated for 14

days at 37 degrees in 95% oxygen and 5% carbon dioxide. A stock solution was prepared and the

concentration was measured by reading the optical density (OD) using a spectrophotometer at

600nm (BioRad, Hercules, CA). Bacteria were frozen in 1ml aliquots in 10% glycerol at -800 C

at a concentration of 1.3 x 109 Colony forming units (cfu)/ml. Frozen aliquots were thawed and

briefly sonicated before each use.

Collection Of Serum

The mice were euthanized in a desiccator with an overdose of Isoflourane, an analgesic

(Webster veterinary supply, Sterling, MA). Then, whole blood was collected through the

abdominal aorta using a 25 gauge needle. The blood was left at room temperature for 30 minutes

to clot and then centrifuged at 12,000 rpm to separate the serum from the red blood cells (RBCs).

The serum was then aliquoted and stored in a -80' C freezer for further analysis.

Bronchial Alveolar Lavage Fluids (BALF)

BALF was collected by lighting the trachea using thread and placing a catheter into the

airway through the trachea. Fluids were collected by injecting 800-1000 [tL of Hanks' Balanced

Salt Solution (HBSS) into the mouse lung via canulation of the trachea. The fluid was then re-

drawn and the process was repeated twice for a total volume of 1600-2000 [tL BALF. The fluid

was placed on ice and then centrifuged at 1500g to pellet the cells and separate the supernatant.

28









The supernatant was aliquoted and stored in a -80' C freezer until further use. The BAL cell

pellet was stored in Cell Freezing Medium (Sigma, St. Louis, MO) and stored in a -80' C

freezer.

Tissue Harvest

We collected the lungs, liver, spleen and kidneys from each mouse following euthanasia.

Some tissue was frozen in Optimal Cutting Temperature (OCT) compound (Sakura, Torrance,

CA) and stored in -80' C. The rest was fixed in 4% Paraformaldehyde and stored in room

temperature for 24 hours. This tissue was then transferred to 70% ethanol and stored at room

temperature until used.

Immunohistochemistry

Lung tissue from sacrificed mice was fixed in 4% Paraformaldehyde for 24 hours then

transferred to 70% Ethanol. Tissue was sent for paraffin embedding and Hematoxylin and Eosin

(H&E) staining to Histology Tech Services, Gainesville Florida. Paraffin-embedded slides were

stained for CCR2 using Goat anti mouse primary antibody (Capralogics, Hardwick, MA) and

ABC staining kit (Vector laboratories, Burlingame, CA) according to manufacturer

recommendations. Alternatively, slides were stained with primary antibody for HO-1

(Calbiochem, San Diego, CA). Briefly, the slides were de-paraffinzed using Xylenes (Fisher

Scientific, Fairlawn, NJ). Slides were placed in Xylene solution for 5 minutes twice. The slides

were then washed with IX Phosphate Buffered Saline (PBS) for 2 minutes. Next, the slides were

permeated by incubating with triton X 100 (Sigma Aldrich, St. Louis, MO) for 10 minutes and

incubated with Hydrogen Peroxide for (H202) for 30 minutes. Normal goat serum (ABC kit) was

then added for 30 minutes to block tissue from background or non-specific binding. Primary

antibody for CCR2 was added to slides for 1 hour followed by washing and addition of

secondary antibody (ABC kit) for 30 minutes. The slides were them incubated for 5 minutes in

29









DAB peroxidase substrate solution (Vector laboratories, Burlingame, CA) for color

development. All slides were counter-stained with Hematoxylin (fisher Scientific, Fair Lawn,

NJ) for 30 seconds. Sections were visualized using a Nikon DIAPHOT inverted microscope.

The ocular is magnified to 10 times (10x) and the objectives used were magnified to lOx, 20x

or40x. Pictures were taken using the SPOT Imaging Solutions software (Sterling Heights, MI).

TIB-71 (RAW 264.7) Cells

RAW 264 (7TIB-71) cells were obtained from American Type Culture Collection

(Manassas, VA). RAW 264 cells are macrophages derived from BALB/C mice and are known to

produce lysozyme. The base medium for this cell line is ATCC-formulated Dulbecco's

Modified Eagle's Medium (DMEM) supplemented with 10% Fetal Bovine Serum (FBS),

Fungizone (MP Biomedicals United States, Solon, OH) and Penicillin-Streptomycin solution

(MP Biomedicals United States, Solon, OH). Cells were grown to confluence in 6-well plates

and the culture medium was replaced with serum-free medium (SFM) to perform the

experiments. Camhi et al. have shown that HO-1 is induced in RAW 264.7 cells with treatment

of LPS (74).

Co-Culture of RAW 264.7 Cells With M. Avium

TIB-71 cell cultures were plated on 60mm culture plates (Coming, Lowell, MA) at a

concentration of 1x10^6 cells per plate and treated with M avium in SFM at a concentration of

50x10^6 bacteria per plate or a ratio of 50:1 bacteria per cell. After reaching confluence, the

plates were incubated at 370 C for different time points (4, 8, and 24 hours) and the cells and

supemates were harvested. All treatments were done in triplicate. Cell culture supemates were

stored in a -80' C freezer. Cell pellets were stored in either Buffer RLT (Qiagen, Valencia, CA)

or RIPA cell lysis buffer (Sigma Aldrich, St. Louis, MO) for RNA isolation and Western Blot

protein analysis respectively. The resulting samples were stored in a -80' C freezer until needed.

30











HO-1 Inhibition By Zinc Protoporphyrin-IX In Cell Cultures

Zinc protoporphyrin-IX (ZnPP) is a normal metabolite that is formed in trace amounts

during heme biosynthesis (75). ZnPP may regulate heme catabolism through competitive

inhibition of HO-1 enzyme activity. ZnPP is found in erythrocytes and is deposited in the spleen

along with heme where both bind HO-1. This process slows down heme degradation by HO-1.

ZnPP inhibits the enzyme activity of HO-1 but does not alter the gene and protein expression of

HO-1. Cells in culture were pretreated with 10tM ZnPP-IX (Frontier Scientific, Logan, UT) for

thirty minutes in SFM. The media is then changed to fresh SFM and the cells are exposed to

different treatments as described above and incubated for different time points. Cells are

collected, spun down and stored in RLT Lysis Buffer (10 parts RLT Lysis buffer, Qiagen

sciences, MD, USA and 1 part 2-Mercaptoethanol Bio-Rad Laboratories Inc., Hercules, CA)

for RNA isolation. Cell Supernates were also collected and stored in a -80' C freezer for

cytokine studies.

Mouse Model For M. Avium Infection

We have developed a murine model for M avium infection and chronic colonization which

leads to granuloma formation in the lungs and other tissue. C57BL/6 wild type and HO-1

knockout mice were inoculated intranasal with 7xl06 M. avium in PBS once per week for three

weeks. Alternatively, wild type control mice were inoculated with equal volume of PBS. Throat

swabs were done once a month and plated on M. avium-specific plates to monitor colonization.

The swabs were plated on the aforementioned 7H10 plates (BD) and incubated for 14 days in a

370 C incubator with 95% 02 and 5% C02. Colonies are visualized and counted on each plate

to determine the level of colonization in each mouse. The mice were sacrificed at different time









points (2, 4 and 6 months) and the lungs, spleen and liver were harvested. BALF, BAL cells and

serum were collected.

Cytokine Studies

MCP-1 levels in cell culture supernatants, mouse sera and BALF were measured using

Enzyme-Linked ImmunoSorbent Assay (ELISA). We used a Quantikine Mouse CCL2/JE/MCP-

1 immunoassay kit according to manufacturer recommendation (R&D systems Inc.,

Minneapolis, MN). The cells and media are collected and centrifuged at 2000 RPM for 5

minutes. The culture supernates were collected and stored in a -80 C freezer until needed. 50

[tL of each sample (supernates, BALF, or serum) was used in the assay to measure MCP-1

levels. The OD was measured at 450 nm in a Biotek Synergy 2 microplate reader using Gene5

software (Biotek Industries, Winooski, VT).

Real-Time Polymerase Chain Reaction (RT-PCR) Analysis

Total RNA from cultured RAW 264 cells was purified and diluted with RNase-free water

to 100 ng/L; then, 10 ptL of each sample were reverse transcribed into combinational DNA

(cDNA). After the reverse transcription reaction was finished, 80 [tL of RNase-free water were

added to each sample. 10ptL of diluted cDNA product were mixed with 25 [tL of SYBR Green

JumpStart Taq ReadyMix, 0.5 [tL of internal reference dye, H20 and 2 [tL of specific

oligonucleotide primers (80 nM final concentrations) to a total volume of 50 ptL for

quantification of the real-time polymerase chain reaction (PCR). The quantification of real-time

PCR was performed by using the SYBR Green method on the Applied Biosystems 7500 Real

Time PCR System with the following profile: 1 cycle at 940C for 2 minutes; 40 cycles at 940C

for 15 seconds, at 600C for 1 minute, and at 720C for 1 minute; and the at acquired fluorescent

signal from the elongation step. Beta-actin or 18s rRNA was used as a house-keeping internal

control. The real-time PCR products were confirmed by electrophoresis on 2% agarose gels.

32









cDNA was amplified using mRNA-specific primers for mouse 18S rRNA (forward: 5'-

TGTCTCAAAGATTAAGCCATGCAT-3', reverse: 5'-

AACCATAACTGATTTAATGAGCCATTC-3'), mouse MCP-1 (forward: 5'-

GGCTCAGCCAGATGCAGTTAA-3', reverse: 5'CCTACTCATTGGGATCATCTTGCT-3')

mouse CCR2 (forward: 5'-CAACTCCTTCATCAGGCACAR-3' reverse: 5'-

GGAAAGAGGCAGTTTGCAAAG-3') mouse HO-1 (forward: 5'-

CTTTCAGAAGGGYCAGGTGWCC-3', reverse: 5'-GTGGAGMCGCTTYACRTAGYGC-3').

Data analysis was carried out by using the ABI sequence-detection software using relative

quantification. The threshold cycle (Ct), which is defined as the cycle at which PCR

amplification reaches a significant value, is expressed as the mean value. The relative expression

of messenger RNA (mRNA) was calculated by using the Ct method (where Ct is the value

obtained by subtracting the Ct value of the housekeeping gene -actin mRNA from the Ct value of

the target mRNA). The amount of the target relative to B-actin or 18s rRNA mRNA was

expressed as 2-(ct)

Statistical Analysis

The data obtained from independent experiments are presented as the mean +/- standard

deviation; they were analyzed by the unpaired student t-test using Statview software version 5.0,

SAS Inst. INC. (Cary, NC). All experiments were done in triplicate. Differences were

considered significant at P < 0.05 level.













**
-i -

I '
e Hmox I



K4X


5' probe


Mutant Hmoxl

K p X XL_ 2K D5Xb

el ez e5


5' probe


e5
3' probe


3' probe


Figure 3-1. Targeted disruption of the Hmoxl gene. (a) Hmoxl genomic locus and targeting
vector. A 3.7-kb region including exons 3, 4 and a portion of 5 (e3-e5) was replaced
with a pkg-neo cassette. The 5' and 3' probes used for screening ES cell clones and
genotyping mice are shown. The 5' probe hybridizes to an 11-kb KpnI fragment of
the native Hmoxl gene and a 6.5-kb fragment from the disrupted gene. D, HindIII
site; K, Kpnl; X, Xhol; Xb, Xbal. (Poss, Tonegawa, 1997).


Wild-tyl









CHAPTER 4
RESULTS

In Vitro Results

HO-1 is induced by M. avium in RAW 264.7 cells

We stained RAW 264.7 cells for HO-1 to test whether the expression levels of HO-1 are

increased after insult with M. avium. Our results showed that HO-1 was induced by M. avium in

RAW 264.7 cells after 4 hours (Figure 4-2) as opposed to controls (Figure 4-1). HO-1 was still

expressed at 8, 24 and 48 hours after exposure to M. avium as well (results not shown).

We next looked at mRNA levels of HO-1 in RAW 264.7 cells in the presence and absence of M

avium in order to see whether M avium induces gene expresison of HO-1. Our results showed

that HO-1 expression was induced in a time dependent manner in this mouse monocyte cell line

after M avium treatment (Figure 4-3).

MCP-1 relative gene expression in RAW 264.7 cells

Following the same protocol as explained above, we analyzed the mRNA levels of MCP-i

in RAW 264.7 cells using real time PCR. After treatment with M. avium, MCP-1 mRNA levels

increased in a time dependent manner as compared to controls, but these levels were abrogated

when we treated the cells with ZnPP, a competitive inhibitor of HO-1 enzymatic activity, prior to

M. avium exposure (Figure 4-4).

CCR2 relative gene expression in RAW 264.7 cells

In order to test whether M. avium infection and HO-1 inhibition affect gene expression of

CCR2, mRNA levels of CCR-2 were measured in TIB-71 (RAW 264.7) cells. Our results

indicate that when these cells are treated with ZnPP, CCR2 expression is significantly increased

on the surface of mouse monocytes and this increase is time dependent (Figure4-5).









MCP-1 levels in Cell Culture Supernates

To support our previous results obtained with RNA, we measured the levels of the same

cytokine in RAW 264.7 cell culture supernates using ELISA. MCP-1 levels were significantly

increased in a time dependent manner in cell culture supernates of cells that were treated with M

avium for 4, 8 and 24 hours, but these levels were abrogated after treatment with ZnPP-IX even

with concurrent infection with M avium (Figure 4-6).

In Vivo Results

Mouse tissue

After euthanasia, we checked the lungs, liver and spleen of HO-1 +/+ and HO-1 -/- mice to

ensure granuloma formation and therefore, infection has occurred. We observed that the lungs of

HO-1 +/+ and HO-1 -/- mice showed detectable differences in granuloma formation. Figure 4-8

shows that HO-1 +/+ mice infected with M avium formed granuloma in the lungs as compared

to saline controls (figure 4-7). We then examined the lungs of HO-1 -/- mice to see whether they

form similar lesions following infection with M. avium. Figure 4-10 shows that HO-1 -/- mice

inoculated with M avium do not form organized granulomas and have disseminated infection in

the lung as compared to saline controls (figure 4-9).

Immunohistochemistry

To confirm the mouse model of M avium infection, we examined the formation of

granuloma in lung tissue of infected mice. From analyzing our H&E stained tissue sections, it

was evident in HO-1+/+ mice developed granulomas after 6 months exposure to M. avium via

intra-nasal inoculation as compared to saline controls (Figure 4-11). These mice exhibited

organized granuloma formation and were able to contain the pathogen to the site of infection.

HO-1 -/- mice displayed loose, unorganized lesions in the lungs after exposure to M avium as

compared to their control counterparts (Figure 4-12).

36









HO-1 protein expression in mouse lung tissue

We stained the lungs tissue of HO-1 +/+ control and infected mice to study whether M

avium infection induces HO-1 expression. HO-1 levels were up-regulated in granulomatous

tissue in HO-1 +/+ mouse lungs infected with M avium as compared to Control mice. Figure 4-

13 shows a 100x magnification of a control lung from an HO-1 +/+ mouse which was inoculated

with saline (PBS) which was stained for HO-1. This tissue exhibited basal levels of HO-1.

Figures 4-14 and 4-15 show a 200x magnification of an HO-1 +/+ mouse lung stained for HO-1.

This mouse was inoculated withM. avium for 6 months and shows upregulation of HO-1 in

granulomatous tissue.

CCR2 expression in mouse lung tissue

To test and confirm previous results that showed that HO-1 regulates the expression of

CCR2, we looked at CCR2 expression in the lung tissue of HO-1 +/+ and HO-1 -/- infected and

control mice. Figure 4-16 shows that HO-1 -/- mice have higher basal levels of CCR2 in lung

tissue. CCR2 levels were up-regulated in lung tissue of infected HO-1 +/+ mice as compared to

uninfected controls (Figure 4-17). Additionally, we observed higher levels of CCR2 in infected

lungs of HO-i -/- mice as compared to infected HO-1 +/+ mice (Figure 4-18 ). In HO-1 +/+

mouse lung tissue, CCR2 co-localized to granulomas (figure 4-19). Our results showed that

CCR2 is normally regulated by HO-1 in the lungs of HO-1 +/+ mice following infection. Figure

24 shows that CCR2 is co-localized to the granuloma and is not expressed in other areas of the

lung. In HO-1 -/- mice we see that this regulation is lost and CCR2 is expressed in a much larger

area of the lung and is disseminated after infection as compared to CCR2 expression in HO-1

+/+ tissue from infected mice (Figure 4-20).









MCP-1 levels in BALF and serum

When we analyzed the levels of MCP-1 in both BALF and serum, we observed a

significant increase of MCP-1 in the BALF of infected wild type C57BL/6 mice as compared to

uninfected controls and increased levels in infected HO-1 -/- mice as compared to knockout

controls as measured with ELISA (Figure 4-21). Additionally, MCP-1 levels were higher in HO-

1 -/- control mice as compared with wild type controls. MCP-1 levels were also increased in the

sera of mice infected with M. avium as compared to control mice and the levels of MCP-1 in sera

of HO-1 -/- mice infected with M. avium were significantly higher than wild type controls and

HO-1 -/- controls (Figure 4-22).





























Figure 4-1. 400x magnification stain of RAW 264.7 cells after 4 hours of incubation in SFM
showing basal levels of HO-1. Blue color shows counter-stain with Hematoxylin


Figure 4-2. 400x stain of RAW 264.7 cells after 4 hours treatment with M. avium showing
increased levels of HO-i expression (brown). Blue color shows counter-stain with
Hematoxylin.











8

7-

6


1 *


CL 4 hour

S8 hour

.3 24 hour

2 E48 hour

1



Control M. avium

Figure 4-3. HO-1 relative apparent gene expression significantly increases in a time dependent
manner in mouse monocytes after treatment with M. avium. HO-1 levels increase
significantly (p < .001) in cells treated with M. avium (*). RAW 264.7 cells were
treated for 4, 8, 24 and 48 hours in serum free medium (C), or with M. avium.














2.5

2


1.5


1 -


0.5


4 hour


- 24hour


0I I
Control M. avium ZnPP+ M. avium
Treatments

Figure 4-4. MCP-1 Relative Gene Expression significantly increased (p < .001) in monocytes
after treatment with M avium for 8 and 24 hours as compared to controls (*) and
were significantly lowered when cells were pretreated with ZnPP for 8 and 24 hours
(**) as compared to M avium alone for the same time points. RAW 264.7 cells were
incubated for 4,8 and 24 hours in serum free media (Control) or treated with M.
avium, or both ZnPP and M. avium



















4


S4 hour

S8 hour

* 24 hour


4


4, J,


--1-r


I1


Control M. avium ZnPP+M. avium
Sample
Figure 4-5. CCR-2 Relative Gene Expression was significantly increased (p<.05 ) in M avium
treated monocytes as compared with controls at 4 hours (*), 8 hours (**), and 24
hours (***) and in cells treated with ZnPP and M avium as compared to controls.
RAW 264. 7 cells were incubated for 4, 8, and 24 hours in serum free media
(Control), treated with M. avium or treated with both ZnPP and M. avium















3500


3000 *


2500 -
**

E 2000 4 hour

8 hour
,.. 24 hour

1000 -

500


0
Control M. avium ZnPP + M. avium



Figure 4-6. MCP-1 levels significantly increase (p < .05) in cell supernates in a time dependent
manner after treatment with M avium as compared to controls (*) and are
significantly decreased (p < .05) after inhibition of HO-1 with ZnPP as compared
with M avium treatment alone (**).



















Figure 4-7. HO-1+/+ 6 month control lung. Control mice were inoculated with intranasal PBS








: .99




Figure 4-8. HO-1 +/+ lung showing granuloma formation after 6 months exposure to M. avium
via intranasal inoculation


Ad LA





























Figure 4-9. HO-1 -/- 6 month control lung. Control mice were inoculated with intranasal PBS.


Figure 4-10. HO-1 -/- lungs showed disseminated infection and loose granuloma formation
following 6 month exposure to M. avium.











i.. ,'-I.
.i cr- '*
^ *^ i: 1' *7 <

3, A- *'
'** .~ ** 4 *i ,.* *
.I .d.^ !;^

. VL -


A &r% .'' I ` Z O-e' 6! B Bi. 2'aH -'-%I I r I /-! M1;

Figure 4-11. A) 100x magnification H&E stain of an HO-1 +/+ control mouse lung. B) 100x
magnification H&E stain of an HO-1 +/+ mouse infected with M avium for 6
months showing granuloma formation

















Figure 4-12. A) lOOx magnification H&E stain of HO- -/- saline control lung. B) 100lx
magnification H&E stain of HO-1 -/- showing loose, unorganized granulomas and
disseminated infection in lung tissue following 6 month exposure to M. avium


r.
e : ~-'~::C~


























Figure 4-13. 100x magnification of control lung from HO-1 +/+ mouse showing basal levels of
HO-1 (brown).


Figure 4-14. 200x magnification of M avium infected HO-1 +/+ mouse lung tissue showing
increased expression of HO-1 (brown) in granuloma. Blue color shows counter-stain
with Hematoxylin





























Figure 4-15. 200x magnification of granuloma in M avium infected HO-1 +/+ mouse lung
showing increased expression of HO-1 in granuloma. Blue color shows counter-stain
with Hematoxylin











A .. Br






Figure 4-16. A) 100x magnification of control HO-1 +/+ control lung showing basal levels of
CCR2 (brown). B) 100x magnification of HO-1 -/- control mouse lung showing basal
levels of CCR2 (brown). Blue color shows counter-stain with Hematoxylin
Figre4-6.A)lOx agnfiatonofcotrl H-i+1 cntollug sowngbaalleel o
CC2(ron.B)l' mgiicto ofI HO- -- conrolmueln hwn aa
leel of CCR2 (bon.Bu clrsoscune-ti it eaoyi














-L S
d
d:
~~5.
'I:l


)
I


C- *



A~!Sb~.. -


* 1






4. .
* Jf- .
^ ^
'*
-* .'


Figure 4-17. A) 100x magnification of an HO-1+/+ control mouse lung tissue showing basal
levels of CCR2 (brown). B) 100x magnification of an HO-1 +/+ mouse lung
inoculated with M. avium for 6 months showing increased expression of CCR2
(brown). Blue color shows counter-stain with Hematoxylin




















A .0 _- B


Figure 4-18. A) 100x magnification of an HO-1 +/+ mouse lung after 6 months M avium
infection showing CCR2 expression (brown). B) An increase in CCR2 expression in
HO-1 -/- mouse lung after 6 months of M avium infection. Blue color shows counter-
stain with Hematoxylin
























Figure 4-19. A and B. 100x magnification of an HO-1 +/+ mouse lung after 6 month infection
with M. avium showing CCR2 (brown) co-localizes with granuloma. Blue color
shows counter-stain with Hematoxylin

















Figure 4-20. A and B. 100x magnification of an HO-1 -/- mouse lung following 6 month
infection with M avium showing disseminated expression of CCR2 (brown). Blue
color shows counter-stain with Hematoxylin











1600


1400


1200 -


1000 -


800 -

t 600 -


400 -


200 -



HO-1 +/+ Control HO-1+/+ M. avium HO-1-/- Control HO-1-/- M. avium

Figure 4-21. MCP-1 levels are significantly increased (p < .001) in BALF of infected HO-1 +/+
and HO-1 -/- mice as compared with controls (*). Basal levels of MCP-1 are
significantly higher (p < .001) in HO-1 -/- control mice as compared to HO-1 +/+
control mice (**).












450

400 -

350 -

S300 -


t 250 -

r*I
S200 -

150 -

100 -

50



Wild type Control Wild type M. avium HO-1-/- Control HO-1-/- M. avium

Mouse Sample

Figure 4-22. MCP-1 levels are increased in mouse serum after 6 month M avium infection and
are significantly higher (p < .0001) in infected HO-1 +/+ and HO-1 -/- mice (*) as
compared with saline controls. Significantly higher basal levels of MCP-1 are seen in
HO-1 -/- sera then HO-1 +/+ sera (**).









CHAPTER 5
DISCUSSION

Since the advent of HIV and the AIDS epidemic, NTM infections have become a major

source of disease in the United States and around the world (1). Although NTM typically do not

cause disease in humans, MAC infections have been on the rise in both immune competent

patients as well as the immunocompromised (2). The formation of granuloma is a vital part of

the body's immune defense against invading pathogens. After infection with M. avium, failure to

develop organized granulomas results in the dissemination of the infection and greater injury to

the host. The regulated recruitment of immune cells including monocyte-macrophages, T-cells,

dendritic cells and B-cells to the site of infection and injury is essential for the host to contain

and eliminate invading pathogens (33). In this study, we tested the interaction and regulation of

three proteins (HO-1, MCP-1 and CCR2) in the process of granuloma formation. HO-1, an

inducible, cyto-protective protein has been implicated in many inflammatory disease as well as

mycobacterial infections (45). We hypothesized that HO-1 plays a role in granuloma formation

by regulating MCP-1 and CCR2 expression in mouse monocytes and therefore regulating the

cellular recruitment of these immune cells from the periphery to the site of infection and injury.

MCP-1 is a chemokine responsible for creating a gradient for the chemotaxis of immune cells

from the periphery to the site of infection and CCR2 is the cell surface receptor which is bound

by MCP-1 (25). MCP-1 and CCR2 are both highly involved in the process of cellular

recruitment and in this study we demonstrate that HO-1 is a key regulator of these cytokines and

therefore the immune recruitment process and granuloma formation. From our in vitro

experiment using RAW 264.7 mouse monocytes, we observed that HO-1 is induced by M avium

as early as 4 hours post treatment and stays highly expressed for up to 48 hours (Figure 9). Once

activated by M. avium, these monocytes began to express higher levels of both MCP-1 (Figure









10) and CCR2 (Figurel 1). However, when we treated the cells with ZnPP, a competitive

inhibitor for HO-1 enzyme activity, we saw a decreased expression of MCP-1 and an increase

expression of CCR2, suggesting that HO-1 levels are directly correlated with MCP-1 expression

and inversely correlated with CCR2 expression. Previous findings have given contradicting

evidence in terms of the correlation between HO-1, MCP-1 and CCR2. In many studies, the

level of both MCP-1 mRNA and protein were reduced with the inhibition of HO-1 (34), but in

others, the opposite finding was observed (57). Zampetaki et al (45) have shown that despite

high mRNA levels, significantly lower levels of cytokine protein were found in BALF of mice

over-expressing HO-1. These findings suggest that HO-1 over-expression can suppress the

induction of cytokine mRNA levels and that this regulation might act through the NFKB

signaling pathway. Our in vitro and in vivo results, however, show that inhibiting HO-1 enzyme

activity led to a decrease in MCP-1 protein levels in cell supernates (Figure 12), BALF (Figure

27) and mouse serum (Figure 28), suggesting that HO-1 is directly correlated to MCP-1

expression in mouse monocytes. Since we observed an induction of HO-i and increased levels

of MCP-1 in the lung tissue, BALF and serum of infected HO-1 +/+ mice, it is possible that an

MCP-1 gradient was established in order to recruit monocytes from the peripheral blood to the

site of infection. This corresponds to a normal immune response in which cells expressing

CCR2 are recruited from the periphery and chemotax along an MCP-1 gradient towards the site

of insult in order to from granulomas (28). When testing MCP-1 protein levels in infected mice,

we observed higher basal levels of MCP-1 in sera and BALF in control HO-1 -/- mice as

compared to wild type controls. These results support previous findings (46) and suggest that

HO-1 -/- mice are in a chronic state of inflammation. This chronic inflammatory state could lead









to the destruction of the MCP-1 chemotactic gradient which would then disrupt cellular

recruitment to the site of infection.

Previous findings along with our results suggest that different cell types in different organ

systems may react differently to altered levels of HO-1. This could be the result of direct

regulation by HO-1 on MCP-1 gene expression via NFKB or the result of over expression of the

CCR2 receptor on monocytes and macrophages in the vicinity of the infection which creates a

negative feedback loop between CCR2 and MCP-1. It has been reported that when HO-1

enzymatic activity is inhibited by ZnPP, the levels of CCR2 increase (48, 49) suggesting that

HO-1 somehow regulates the expression of CCR2 on the surface of monocytes, macrophages

and other immune cells. Our results show that HO-1 -/- mice indeed had increased levels of

CCR2 on monocyte/macrophage cell surfaces as seen by relative gene expression (Figure 11)

and immunohistochemistry (Figure 26). Our findings also suggest that HO-1 normally regulates

the expression of the CCR2 during infection and allows these cells to chemotax along an MCP-1

gradient towards infection. When we analyzed the results from our in vivo mouse model, we

observed that the loss of HO-1 expression led to loose or unorganized granuloma formation in

mice following M. avium infection. The inability of these mice to form solid granulomas led to a

disseminated infection with more inflammation and more lesions covering a greater area of the

lungs, liver and spleen. As Figure 18 shows, HO-1 -/- mice had loose, unorganized granulomas

in the lungs. It is possible that these mice did not contain the mycobacterium as compared to HO-

1 +/+ mice and therefore had disseminated infections. These findings suggest that HO-1 plays a

critical role in the regulation of cellular recruitment to the site of infection and in organized

granuloma formation. When analyzing our HO-1 -/- mouse tissue and immunohistochemistry,

we observed that the lack of the HO-1 gene in mice infected with M avium led to severe









disseminated infection, loose, unorganized granulomas and greater pathology as compared with

their HO-1 +/+ counterparts which formed organized granulomas after infection. This is a

significant finding because we can now focus our efforts on the direct role of HO-1 in the

process of granuloma formation and cellular recruitment to the site of infection in the live

animal. Our HO-1 -/- mouse model has given us a useful tool in the study of granuloma

formation following M. avium infection. Our studies have helped shed light on the role of HO-1

in the regulation of MCP-1 and CCR2 and in the process of cellular recruitment during and

following mycobacterial infection.









CHAPTER 6
FUTURE CONSIDERATIONS

Having established an HO-1 -/- animal model ofM. avium infection and granuloma

formation, we can now focus on the direct role of HO-1 in the innate and adaptive immune

responses, specifically focusing on granuloma formation. We plan to further elucidate the role of

HO-1 in regulating cytokines such as MCP-1 and CCR2 and how this regulation affects cellular

recruitment from the periphery to sites of infection and inflammation. As stated previously, HO-

1 expression may exert different physiological changes in different organ systems and cell types.

We can now study the effects of HO-1 or lack thereof, in several organs, cell types and in

different states of health. We can also concentrate on the different aspects of heme catabolism

by HO-1 which may affect this immune process. We plan on testing the affects of free iron

(Fe+), Billirubin, and C02 on granuloma formation and the immune response to M. avium

infection. Another challenge will be to test whether it is possible to rescue the cyto-protective

role of HO-1 in HO-1 -/- mice by treating them with one or more of the catabolic byproducts of

heme degradation. Another possibility is the use of HO-1 therapy to treat NTM infected patients

with HIV or AIDS in the hopes of rescuing their immune function. With these future studies, we

hope to contribute not only to the scientific field of microbiology, but also to the clinical and

therapeutic areas of medicine. Hopefully our findings will help us understand the mechanisms of

NTM infection and help prevent such diseases in the future. Alternatively, we hope that our

study will help elucidate the role of HO-1 in NTM disease and will lead to a better understanding

of how to approach and treat other disease caused by both NTM and Mycobacterium

tuberculosis.









REFERENCES


1. Falkinham, JO: Epidemiology of Infection by Nontuberculous Mycobacteria. Clinical
Microbiology Reviews 1996; 9:177-215

2. Hendricks, EE, Lin, KC, Boisvert, K, Pauley, D, Mansfield, KG: Alterations in
Expression of Monocyte Chemotactic Protein-i in the Simian Immunodeficiency Virus
Model of Disseminated mycobacterium avium Complex. JID 2004; 189:1714-1720

3. Inderlied, CB, Kemper, CA, Bermudez, LEM: The Mycobacterium avium Complex.
Clinical Microbiology Reviews 1993;6:266-310

4. Falkinham, JO: Surrounded by Mycobacteria: Nontuberculous Mycobacteria in the
Human Environment. Journal of Applied Microbiology. 2009:1-12

5. Iseman, MD, Corpe, RF, O'brien, RJ, Rosenzwieg, DY, Wolinsky, E: Disease Due to
mycobacterium avium-intracracellulare. Chest 1985;87:139S-149S

6. Hardy, WD, Feinberg, JD, Finkelstien, M, Power, ME, He, W, Kaczka, C, Frame, PT,
Holmes, M, Waskin, H, Fass, RJ, Powderly, WG, Steinbigel, RT, Zuger, A, Hlzman, RS:
A control trial of trimethoprim-sulphamethoxazole or aerosolized pentamidine for
secondary prophylaxis of pneumocystis carnii pneumonia in patients with the acquired
immunodeficiency syndrome. New England Journal of Medicine 1992;327:1842-1848

7. Appelberg, R: Pathogenesis of Mycobacterium avium Infection. Typical Responses to an
Atypical Mycobacteriim. Immunologic research 2006;35/3:179-190

8. Fenton, MJ, Riley, LW, Schlesinger, LS: Receptor-mediated recognition of
Mycobacterium tuberculosis by host cells, in Cole ST, et al (eds.): Tuberculosis and the
Tubercle Bacillus, Washington, DC, ASM Press, 2005, pp. 405-426

9. Houben, ENG, Nguyen, L, Pieters, J: Interaction of pathogenic mycobacteria with the
host immune system. Current Opinions in Microbiology. 2008;9:76-85

10. Nathan, C, Xie, Q: Nitric oxide synthases: roles, toils and controls. Cell 1994; 78:915-
918.

11. Middleton, AM, Chadwick, MV, Nicholson, AG, Dewar, A, Feldman, D, Wilson, R:
Investigation of mycobacterial colonization and invasion of the respiratory mucosa.
Thorax 2003;58:246-251

12. Covert, TC, Rodgers, MR, Reyes, AL, Stelma, GN: Occurrence of Nontuberculous
Mycobacteria in Environmental samples. Applied and Environmental Microbiology
1999;65:2492-2496

13. Shin, GA, Lee, JK, Freeman, R, Cangelosi, GA: Inactivation of Mycobacterium avium
complex by UV Irradiation. Applied and Environmental Microbiology. 2008;74:7067-
7069









14. Taylor, RH, Falkinham, JO, III, Norton, CD, LeChevallier, MW: Chlorine, chloramine,
chlorine dioxide, and ozone susceptibility of Mycobacterium avium. Appl Environ
Microbiol 2000;66:1702-5

15. von Reyn, CF, Maslow, JN, Barber, TW, Falkinham, JO, III ,Arbeit, RD: Persistent
colonization of potable water as a source of Mycobacterium avium infection in AIDS.
Lancet 1994; 343: 1137-41

16. Alamelu, R: Immunology of tuberculosis. Indian J. Med. Res. 2004;120:213-232

17. Quesniaux, V, Fremond, C, Jacobs, M, Parida, S, Nicolle, D, Yeremeev, V, Bihl, F,
Erard, F, Botha, T, Drennan, M, Soler, MN, Bert, M, Schnyder, B, Ryffel, B: Toll-like
receptor pathways in the immune responses to mycobacteria. Microbes and Infection
2004;6:946-959

18. Stenger, S, Modlin, RL: Control of Mycobacterium tuberculosis through mammalian
Toll-like receptors. Curr. Opin. Immunol. 2002; 14:452-457.

19. Heldwein, KA, fenton, MJ: The role of Toll-like receptors in immunity against
mycobacterial infection. Microb. Infect. 2002;4:937-944

20. Medzhitov, R, Biron, CA: Innate immunity, Curr. Opin. Immunol. 2003;15:2-4

21. Akira, S: Mammalian Toll-like receptors, Curr. Opin. Immunol. 2003;15:5-11

22. Takeda, K, kaisho, T, Akira, S: Toll-like receptors. Annu. Rev. immunol. 2003; 21:335-
376.

23. Medzhitov, R, Preston-Hurlburt, P, Janeway, CA: A human homologue of the
Drosophila Toll protein signals activation of adaptive immunity. Nature 1997;388:392-
397

24. Krutzik, SR, Tan, B, LI, H, Ochoa, MT, Liu, PT, Sharfstein, SE, Graeber, TG, Sieling,
PA, Liu, YG, Rea, TH et al: TLR activation triggers the rapid differentiation of
monocytes into macrophages and dendritic cells. Nat Med 2005;11:653-660.

25. Huffnagle, GB, Strieter, RM, Standiford, TJ, McDonald, RA, Burdick, MD, Kunkel, SL,
Towes, GB: The Role of Monocyte Chemotactic Protein-i (MCP-1) in the Recruitment
of Monocytes and CD4+ T Cells During a Pulmonary Crytococcus neoformans infection.
The journal of immunology 1995;

26. Emery, P, Salmon, M: The Immune response. 2 Systemic mediators of inflammation.
Br. J. Hosp. 1991;45:164-168

27. Schall, TJ: Biology of the RANTES/SIS cytokine family. Cytokine 1991;3:165









28. Lundien, MC, Mohammed, KA, Nasreen, N, Tepper, RS, Hardwick JA, Sanders, KL,
Van Horn RD, Antony, VB: Induction of MCP-1 Expression in Airway Epithelial Cells:
Role of CCR2 in Airway Epithelial Injury. Journal of Clinical Immunology
2002;22:144-152

29. Nasreen, N, Mohammed, KA, Galffy, G, Ward, MJ, Antony, VB: MCP-1 in pleural
injury: CCR2 mediates haptotaxis of pleural mesothelial cells. m J Physiol Lung Cell
Mol Physiol 2000;278:L591-598

30. Oppenheim, JJ, Zachariae, COC: Properties of a novel pro-inflammatory supergene
"intecrine" cytokine family. Annu. Rev. immunol. 1991;9:617

31. Schall, TJ: Biology of the RANTES/SIS cytokine family. Cytokine 1991;3:165

32. Baggiolini, M, Dewald, B, Moser, B: Human Chemokines: an update. Annu. Rev.
Immunol. 1997;15:675-705

33. Ehlers, S, Kutsch, S, Ehlers, EM, Benini, J, Pfeffer, K: Lethal granuloma Disintegration
in mycobacterial-Infected TNFp55-/- Mice Is Dependent on T Cells and IL-12. J.
immunol. 2000;165:483-492

34. Lee, JS, Lee JY, Son JW, Oh J, Shin DM, Yuk JM, Song CH, Paiks TH, Jo EK:
Expression and Regulation of the CC-Chemokine Lignad 20m During Human
Tuberculosis Scandinavian Journal of Immunology 2007; 67(1):77-85

35. Kaufmann, S: Protection against tuberculosis: cytokines, T cells, and macrophages. Ann
Rheum Dis 2002;61:ii54-ii58

36. Dannenberg, AM, Dannenberg, GA, Rook, W: Pathogenesis of pulmonary tuberculosis:
an interplay of tissue damaging and macrophage activating immune responses. In
tuberculosis: Pathogenesis, Protection and Control. B.R. Bloom, ed. Am. Soc. Microbiol.
Press., Washington, DC, p. 459

37. Jagirdar, J, Zapzag, D: Pathology and insights into the pathogenesis of tuberculosis. In
Tuberculosis. W.N. Romand S. Garay, eds. Little Brown, Boston, p. 467

38. Rook, GAW, Bloom, BR: Mechanism of pathogenesis of tuberculosis. In Tuberculosis:
Pathogenesis, Protectiona dn Control. B.R. Bloom ed. Am. Soc. Microbiol. Press,
Washinton, DC, p. 485

39. Lee, CY, Yen, MH: Nitric Oxide and Carbon Monoxide, Collaborative and Competitive
Regulators of Hypertension. Chang Gung Med J. 2009;32:12-21

40. Maestrelli, P, Paska, C, Saetta, M, turato, G, Nowicki, Y, Monti, S, formichi, B, Miniati,
M, Fabbri, LM: Decreased haem oxygenase-1 and and increased inducible nitric oxide
synthesis in the lung of severe COPD patients. Eur Respir J. 2003;21:971-976









41. Mitzuno, K, Toma, T, Tsukiji, H, Okamoto, H, Yamazaki, H, Ohta, K, Ohta, K,
Kasahara, Y, Koizumi, S, Yachie, A: Selective expansion of CD16highCCR2-
subpopulation of circulating monocytes with preferential production of haem Oxygenase
(HO)-1 in response to acute inflammation. British Society of immunology, clinical and
Experimental Immunology. 2005;142:461-470

42. Lakari, E, Pylkas, P, Pietarinen-Runtti, P, Paakko, P, Soini, Y, Kinnula, V: Expression
and Regulation of Hemeoxygenase 1 in Healthy Human Lung and Interstitial Lung
Disorders. Human Pathology 2001;32:1257-1263

43. Kanwar, Yashpal, S: A dynamic interplay between monocyte chemoattractant protein-i
and heme oxygenase-1: Implications in renal injury. Kidney International 2005;68:896-
897

44. Rushworth, SA, O'Connell, MA: Haem oxygenase-1 in inflammation. Biochemical
Society transactions 2004;32(Pt 6): 1093-4

45. Fredenburgh, LE, Perella, MA, Mitsialis SA: The Role of Heme Oxygenase-1 in
Pulmonary Disease. Am. J Respir Cell Mol Biol. 2006;36:158-165

46. Zampetaki, A, Minamino, T, Mitsialis, SA, Kourembanas, S: Effect of Heme
Oxygenase-1 Overexpression in Two Models of Lung inflammation. Experimental
Biology and Medicine 2003;228:442-446

47. Mohammed, KA, Nasreen, N, Ward, MJ, Mubarak, K, Rodriguez-Panadero, P, Antony,
VB: Mycobacterium-Mediated Chemokine Expression in Pleural Mesothelial Cells: Role
of C-C Chemokines in Tuberculous Pleurisy. The Journal of infectious Disease
1998;178:1450-1456

48. Kanakiriya, KRS, Croatt, AJ, Haggard, JJ, Ingelfinger, JR, Tang, SS, Alam, J, Nath, KA:
Heme: A novel inducer of MCP-1 through HO-dependent and HO-independent
mechanisms. Am. J. Physiol Renal Physiol 2003; 284: F546-F554,

49. Morita, T., T. Imai, T. Yamaguchi, T. Sugiyama, S. Katayama, and G. Yoshino:
Induction of heme oxygenase-1 in monocytes suppresses angiotensin II-elicited
chemotactic activity through inhibition of CCR2: role of bilirubin and carbon monoxide
generated by the enzyme. AntioxidRedox Signal 2003; 5:439-447.

50. Zachariae CO, Anderson AO, Thompson HA, et al: Properties of monocyte chemotactic
and activationg factor (MCAF) purified from human fibrosarcoma cell line. J. Exp. Med.
1990;171:2177-82

51. Taub, DD, Proost, P, Murphy, WJ, Anver, M, Longo, DL, Van Damme, J, Oppenheim,
JJ: Monocyte Chemotactic Protein-i (MCP-1), -2, and -3 Are Chemotactic for Human T
Lymphocytes. The Journal of Clinical Investigation, Inc. 1995;95:1370-1376









52. Rollins, BJ, Morrison, ED, Stiles, CD: Cloning and expression of JE, a gene inducible by
platelet derived growth factor and whose product as cytokine-like properties. Proc Natl
Acad Sci USA 1998;85:3738-3742

53. Matsushima,K, Larsen, CG, DuBois, GC, Oppenheim, JJ: Purification and
Characterization of a Novel Monocyte chemotactic and Activating Factor Produced by a
Human Myelomonocytic Cell Line. The journal of Experimental medicine; 169:1485-
1490

54. Yoshimura, T, Robinson, E, Tanaka, S, Appella, E, Leonard, E: Purification and Amino
Acid Analysis Of Two Human Monocyte Chemoattractants Produced By
Phytohemagglutinin-Stimulated Human Blood Mononuclear Leukocytes. The Journal of
Immunology 1989;142:1956-1962

55. Valente, AJ, Graves, DT, Vialle-Valentin, CE, Delgado, R, Schwartz, CJ: Purification of
a monocyte chemotactic factor secreted by nonhuman primate vascular cells in culture.
Biochemistry 1998;27:4162-4168

56. Furutani, Y, Nomura, H, Notake, M, Oyamada, Y, Fukui, T, Yamada, M, Larsen, CG,
Oppenheim-JJ, Matsushima, K: Cloning and sequencing of the cDNA for human
monocyte chemotactic and activating factor (MCAF). Biochemical and Biophysical
Research Communications 1989;159:249-255

57. Jiang, Y, Valente, AJ, Williamson, MJ, Zhang, L, Graves, DT: Post-translational
modifications of a monocyte-specific chemoattractant synthesized by glioma,
osteosarcoma, and vascular smooth muscle cells. The Journal of Biological Chemistry
1990;265:18318-18321

58. Botazzi, B, Colotta, F, Sica, A, Nobili, N, Mantovani, A: A chemoattractant expressed in
human sarcoma cells (tumor-derived chemotactic factor, TDCF) is identical to monocyte
chemoattractant protein-1/monocyte chemotactic and activating factor (MCP-1/MCAF).
International Journal of Cancer 1990;45:795-797

59. Hale-Donze, H, greenwel-Wild, T, Mizel, D, Doherty, MT, Chatterjee, D, Orenstein, JM,
Wahl, SM: Mycobacterium avium Complex Promotes Recruitment of Monocyte Hosts
for HIV-1 and Bacteria. The Journal of Immunology 2002;169:3854-3862

60. Nibbs, RJB, Graham, GJ, Pragnell, IB: Macrophage inflammatory protein 1-alpha. In
Cytokines 1998 p. 467

61. Proost, P, Wuyts, A, Opdenakker, G, Van Damme, J: Monocyte Chemotactic Protein1, 2
and 3. In Cytokines. P. 489

62. Belperio, JA, Keane, MP, Burdick, MD, Lynch, JP III, Xue, YY, Berlin, A, Ross, DJ,
Kunkel, SL, Charo, IF, Strieter, RM: Critical Role for the Chemokine MCP-1/CCR2 in
the Pathogenesis of Bronchiolitis Obliterans Syndrome. J. Clin. Invest. 2001;108:547-556









63. Loetscher, P, dewald, B, Baggiolini, M, Seitz, M: Monocyte chemoattractant protein 1
and interleukin 8 production by rheumatoid synoviocytes. Effects of anti-rheumatic
drugs. Cytokine 1994;6:162-170

64. Johnston, B, Bums, AR, Suematsu, M, Issekutz, TB, Woodman RC, Kubes, P: Chronic
inflammation upregulates chemokine receptors and induces neutrophil migration to
monocyte chemoattractant protein-i J. Clin Invest. 1999; 103:1269-1276

65. Pittock, ST, Norby, SM, Grande, JP, Croatt, AJ, Bren, GB, Badley, AD, Caplice, NM,
griffin, MD, Nath, KA: MCP-1 is up-regulated in unstressed and stressed HO-1
knockout mice: Pathophysiology correlates. Kidney International 2005;68:611-622

66. Kanakiriya, KRS, Croatt, AJ, Haggard, JJ, Ingelfinger, JR, Tang, SS, Alam, J, Nath, KA:
Heme: A novel inducer of MCP-1 through HO-dependent and HO-independent
mechanisms. Am. J. Physiol Renal Physiol 2003; 284: F546-F554

67. Fantuzzi, L, Borghi, B, Ciolli, V, Pavlakis, G, Betardelli, F, Gessani, S: Loss of CCR2
Expression and Functional Response to Monocyte Chemotactic Protein (MCP-1) During
the Differentiation of Human Monocytes: Role of Secreted MCP-1 in the Regulation of
the Chemotactic Response. Blood. 1999;4:875-883

68. Charo, IF, Myers, SJ, Herman, A, Franci, C, Conolly, AJ, Coughlin, SR: Molecular
cloning and functional expression of two monocyte chemoattractant protein-i receptors
reveals alternative splicing of the carboxyl-terminal tails. Proc. Acad. Sci. 1994;91:2752-
2756

69. Warmington, KS, Boring, L, Ruth, JH, Sonstein, J, Hogaboam, CM, Curtis, JL, Kunkel,
SL, Charo, IR, Chensue, SW: Effect of C-C chemokine receptor 2 (CCR2) knockout on
type-2 schistosomall antigen-elicited) pulmonary granuloma formation: analysis of
cellular recruitment and cytokine responsesAm. J. Pathol. 1999;154:1407-1416

70. Tylaska, AL, Boring, L. Weng, W, Aiello, R, Charo, IF, Rollins, BJ, Gladue, RP: CCR2
Regulates The Level of MCP-i/CCL2 In Vitro And At Inflammatory Sites And controls
T Cell Activation In Response to Alloantigen. Cytokine, 2002; 18:184-190

71. Lu, BB, Rutledge BJ, Gu, L, Fiorillo, J, Lukacs, NW, Kunkel, SL, North, R, Gerard, C,
Rollins, BJ: Abnormalities in Monocyte recruitment and Cytokine Expression in
Monocyte Chemoattractant Protein I-deficient Mice. J. Exp. Med. 1998;187:601-608

72. Poss, KD, Tonegawa, S: Heme Oxygenase 1 is required for mammalian iron
reutilization. Proc. Natl. Acad. Sci. 1997;94:10919-10924

73. Bradley, A: Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, ed.
Robertson, E. (IRL-Oxford). 1987:113-151

74. Camhi, SL, Alam, J, Otterbein, L, Sylvester, SL, Choi, AM: Induction of Heme
Oxygenase-i expression by lipopolysaccharide is mediated by AP-1 activation. Am J
Respir Cell Mol Biol. 1995;13:387-398









75. Labbe RF, Hendrik VJ, Stevenson DK: Zinc Protoporphyrin: A Metabolite with a
Mission. Clinical Chemistry 1999; 45:12, 2060-2072









BIOGRAPHICAL SKETCH

Doron Regev was born in Tel-Hashomer, Israel. He grew up in Kfar Saba, Israel and

moved to the United States at the age of 8. Doron spent most of his childhood in Rochester, NY

and graduated from Brighton High School in 1995. He earned his bachelor's degree in Biology

from the University at Albany (NY) in 1999. Doron also excelled as a collegiate football player

at Albany, earning a first team All-American award as a place kicker his senior year. Following

college, Doron pursued a career as a football player and in 2001, played for the Rochester

Brigade, a professional arena football team in Rochester, NY. He later decided to embark on a

scientific career and began his research at the University of Rochester, where he worked in a

cardiovascular research lab for two years. He then moved to Gainesville, Florida where he

worked in a pulmonary research lab under Dr. Veena Antony and entered the MS program at the

University of Florida. Upon completion of his master's degree, Doron will continue his studies in

the IPD program at the University of Florida in the hopes of attaining a Ph.D. in medical

sciences.





PAGE 1

1 HEME OXYGENASE 1 REGULATES CCR2/MCP 1 AXIS AND GRANULOMA FORMATION IN A MOUSE MODEL OF NONTUBERCULOUS MYCOBACTERIAL INFECTION. By DORON REGEV A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2009

PAGE 2

2 2009 Doron Regev

PAGE 3

3 ACKNOWLEDGMENTS I would like to acknowledge Dr. Veena Antony and especially thank her for her guidance in my research and my writing. I would also like to thank the other members of my committee, Dr. Henry Baker and Dr. Reuben Ramphal for all the input they provided. Thanks to Dr. Ana Montes Worboys and Dr. Yimu Lai for their continued help and technical assistance in the lab and thanks to Edward Hensel for showing me the clinical aspects of medical research I would like to thank Dr, Kamal Mohammed and Dr. Nasreen Najmunnisa for their help and guidance along the way. Finally, I am grateful to my parents Michael and Dalia and my siste r, Dana for their support and inspiration throughout my life

PAGE 4

4 TABLE OF CONTENTS page ACKNOWLEDGMENTS ...............................................................................................................3 LIST OF FIGURES .........................................................................................................................6 ABSTRACT .....................................................................................................................................8 CHAPTER 1 INTRODUCTION ..................................................................................................................10 Hypothesis ..............................................................................................................................11 Objective .................................................................................................................................11 2 BACKGROUND ....................................................................................................................12 Mycobacterium .......................................................................................................................12 Mycobacterium Avium ............................................................................................................13 Mycobacterium Avium Complex (MAC) ................................................................................14 Host Response To Infection ....................................................................................................15 Formation Of Granuloma .......................................................................................................16 Heme Oxygenase1 (HO 1) ....................................................................................................17 Monocyte Chemoattractant Protein1 (MCP 1) .....................................................................19 Chemokine (C C Motif) Receptor 2 (CCR2) .........................................................................21 3 MATERIALS AND METHODS ...........................................................................................27 HO1 Knockout Mouse Model ...............................................................................................27 M. Avium culture .....................................................................................................................28 Collection Of Se rum ...............................................................................................................28 Bronchial Alveolar Lavage Fluids (BALF) ............................................................................28 Tissue Harvest ........................................................................................................................29 Immunohistochemistry ...........................................................................................................29 TIB 71 (RAW 264.7) Cells ....................................................................................................30 Co Culture of RAW 264.7 Cells With M. Avium ..................................................................30 HO1 Inhibition By Zinc ProtoporphyrinIX In Cell Cultures ...............................................31 Mouse Model For M. Avium Infection ...................................................................................31 Cytokine Studies .....................................................................................................................32 Real Time Polymerase Chain Reaction (RT PCR) Analysis .................................................32 Statistical Analysis ..................................................................................................................33 4 RESULTS ...............................................................................................................................35 In Vitro Results .......................................................................................................................35 HO1 is induced by M. avium in RAW 264.7 cells .........................................................35

PAGE 5

5 MCP 1 relative gene expression in RAW 264.7 cells .....................................................35 .CCR2 relative gene expression in RAW 264.7 cells .....................................................35 MCP 1 levels in Cell Culture Supernates ........................................................................36 In Vivo Results .......................................................................................................................36 Mouse tissue ....................................................................................................................36 Immunohistochemistry ....................................................................................................36 HO1 protein expression in mouse lung tissue ................................................................37 CCR2 expression in mouse lung tissue ...........................................................................37 MCP 1 levels in BALF and serum ..................................................................................38 5 DISCUSSION .........................................................................................................................53 6 FUTURE CONSIDERATIONS .............................................................................................57 REFERENCES ..............................................................................................................................58 BIOGRAPHICAL SKETCH .........................................................................................................65

PAGE 6

6 LIST OF FIGURES Figure page 21 Recognition of an appropriate ligand by TLR 2 ................................................................23 22 Formation of granuloma involving pathogen, macrophages, T cells, and B cells. ...........24 23 Degradation of heme by HO 1 ...........................................................................................25 24 CCR2 structure ..................................................................................................................25 25 Schematic representation of the signaling pathways activated through the CCR2. Ligand ................................................................................................................................26 31 Targeted disruption of the Hmox1 gene ...........................................................................34 41 400x magnification stain of RAW 264.7 cells after 4 hours of incubation in SFM showing basal levels of HO 1 ............................................................................................39 42 400x stain of RAW 264.7 cells after 4 hours treatment with M. avium showing increased levels of HO 1 ....................................................................................................39 43 HO1 relative apparent gene expression significantly increases in a time dependent manner in mouse monocytes after treatment with M. avium.............................................40 44 MCP 1 Relative Gene Expression significantly increased (p < .001) in monocytes after treatment with M. avium for 8 and 24 hours as compared to controls ......................41 45 CCR2 Relative Gene Expression was significantly increased (p<.05 ) in M. avium treated monocytes as compared with controls at 4 hours (*), 8 hours (**), and 24 hours (***) and in cells treated with ZnPP and M. avium as compared to controls. .......42 46 MCP 1 levels significantly increase (p < .05) in cell supernates in a time dependent manner after treatment with M. avium as compared to controls ........................................43 47 HO1+/+ 6 month control lung ..........................................................................................44 48 HO1 +/+ lung showing granuloma formation ..................................................................44 49 HO1 / 6 month control lung ...........................................................................................45 410 HO1 / lungs showed disseminated infection and loose granuloma formation ...............45 411 A) 100x magnifi cation H&E stain of an HO 1 +/+ control mouse lung. B) 100x magnification H&E stain of an HO 1 +/+ mouse infected with M. avium ......................46

PAGE 7

7 412 A) 100x magnification H&E stain of HO 1 / saline control lung. B) 100x magnification H&E stain of HO 1 / showing loose, unorganized granulomas and disseminated infection in lung tissue following 6 month exposure to M. avium ..............46 413 100x magnification of control lung from HO 1 +/+ mouse showing basal levels of HO1 ..................................................................................................................................47 414 200x magnification of M. avium infected HO 1 +/+ mouse lung tissue showing incr eased expression of HO 1 in granuloma ......................................................................47 415 200x magnification of granuloma in M. avium infected HO 1 +/+ mouse lung showing increased expression of HO 1 in granuloma .......................................................48 416 A) 100x magnification of control HO 1 +/+ control lung showing basal levels of CCR2 (brown). B) 100x magnification of HO 1 / control mouse lung showing basal levels of CCR2 ..........................................................................................................48 417 A) 100x magnification of an HO 1+/+ control mouse lung tissue showing basal levels of CCR2 (brown). B) 100x magnification of an HO 1 +/+ mouse lung inoculated with M. avium for 6 months showing increased expression of CCR2 .............49 418 A) 100x magnification of an HO 1 +/+ mouse lung after 6 months M. avium infection showing CCR2 expression (brown). B) An increase in CCR2 expression in HO1 / mouse lung after 6 months of M. avium infection ..............................................49 419 A and B. 100x magnification of an HO 1 +/+ mouse lung after 6 month infection with M. avium showing CCR2 co localizes with granuloma ............................................50 420 A and B. 100x magnification of an HO 1 / mouse lung following 6 month infection with M. avium showing disseminated expression of CCR2 ..............................................50 421 MCP 1 levels are significantly increased in BALF of infected HO 1 +/+ and HO 1 / mice as compared with controls ....................................................................................51 422 MCP 1 levels are increased in mouse serum after 6 month M. avium infecti on and are significantly higher in infe cted HO 1 +/ + and HO 1 / mice as compared with saline controls. ...................................................................................................................52

PAGE 8

8 Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science HEME OXYGENASE 1 REGULATES CCR2/MCP 1 AXIS AND GRANULOMA FORMATION IN A MOUSE MODEL OF NONTUBERCUL OUS MYCOBACTERIAL INFECTION By Doron Regev August 2009 Chair: Dr. Veena Antony Major: Medical Sciences Non Tuberculous M ycobacterial (NTM) infections are a major cause of disease in animals and humans around the world and have become an increasing source of infection among patients with HIV and AIDS. Recently, there has been an increase in NTM infections in immunocompetent patients, especially in the Southeastern United states A hallmark of NTM infection is the formation of granulomas which are a conglomeration of the invading pathogen and host inflammatory cells including macrophages, T cells, B cells and dendritic cells. Granulomas can contain the pathogen and protect the host from further dissemination of the infection. Heme Oxygenase1 (HO1) is a cytoprotective enzyme which breaks down heme. HO1 is induced by oxidative stress, bacterial infection and many pro inflammatory cytokines and has been shown to be upregulated in granulomas and infected tissue. Monocyte Chemotactic Protein 1 (MCP 1) along with its receptor Chemokine Receptor2 (CCR2), are responsible for the re cruitment of monocytes from peripheral blood to the site of infection. Our hypothesis is that HO 1 plays a role in the formation of organized (tight) granulomas by regulating the expression of CCR2 and MCP 1 in monocytes and coordinating cellular recruitme nt form peripheral blood to the site of infe ction. We have developed a mouse model of

PAGE 9

9 Mycobacterium avium infection in both HO 1 +/+ and HO 1 / mice to test whether the lack of HO1 expression results in the formation of unorganized (loose) granulomas a nd to test whether HO1 regulates MCP 1 and CCR2 in this disease model.

PAGE 10

10 CHAPTER 1 INTRODUCTION Non Tuberculous Mycobacteria (NTM) are a group of Mycobacteria that are not members of the Mycobacterium tuberculosis complex. NTM are a major cause of opportunistic infection in immunocompromised and healthy hosts. These organisms can cause disease in animals and humans and have become an increasing source of infection among patients infected with Human Immunodeficiency Virus (HIV) or Acquired Immune Deficiency Syndrome (AIDS) (1) Mycobacterium avium complex (MAC) is the most common disseminated bacteria l infection in untreated patients with AIDS. A hallmark of disseminated MAC infections is the formation of granulomas in multiple organs including the liver, spleen, lymph nodes, bone marrow, and lung (1). Granulomas are lesions in tissue that are formed by the aggregation of activated macrophages, T cells and fibroblasts and are considered a defense mechanism against invading pathogens. Importantly, bacteria are not always eliminated within the granuloma, but can become dormant, resulting in a latent inf ection (2). In disseminated mycobacterial disease, the function and structure of granulomas are either absent or compromised. This leads to a failure of the host defenses to contain the bacte rium and to further pathology. Our current study aims to eluci date the role of Heme Oxygenase1 (HO1), a cytoprotective enzyme, in the formation of organized granulomas. Specifically, we are looking at the role of HO 1 in the regulation of two cytokines, Chemokine Receptor 2 (CCR2) and Monocyte Chemoattractant Prot ein 1 (MCP 1) both of which are responsible for the recruitment of inflammatory cells to the site of infection. Recruitment of immune cells to the site of infection is a vital step in granuloma formation and if the process is inhibited or altered, the Myc obacterial infection may not be contained.

PAGE 11

11 Hypothesis Our hypothesis was that HO 1 plays a key role in granuloma formation following mycobacterial infection by regulating the expression of CCR2 and MCP 1 in mouse monocytes, therefore, influencing the recr uitment of these inflammatory cells to the site of injury. In HO 1 +/+ mice, we expected to find high levels of MCP 1 in the lung following infection with M. avium creating a gradient for chemotaxis of immune cells from the periphery to the site of injury In HO 1 / mice, in which the HO 1 gene was mutated and knocked out, we expected to see high levels of MCP 1 and CCR2 in the periphery as well as in the lung following infection with M. avium ., therefore, causing the gradient for chemotaxis to be distur bed and inflammation to be disseminated. Objective Our objective was to develop a murine model of M. avium infection and granuloma formation in order to elucidate the role of HO 1 and its regulation of MCP 1 and CCR2 in mouse monocytes.

PAGE 12

12 CHAPTER 2 BACKGROUND Mycobacterium Mycobacterium is a genus of Actinobacteria, a gram positive bacterium with a high G C content. Mycobacteria are aerobic and non motile. They are classified as gram positive because they lack an outer cell membrane but they characterist ically have a thick cell wall comprised of mycolic acid or mycolates (the Latin prefix myco pertains to the waxy compounds in the cell wall of these organisms). The Mycobacterial cell wall consists of a hydrophobic mycolate layer and a peptidoglycan (PGN ) layer which are held together by arabinogalactan, a polysaccharide ( 1). This waxy cell wall is an essential virulence factor which contributes to the organisms survival and gives these organisms their ability to withstand the environment and resist man y antibiotics. Mycobacteria can survive long exposure to acids, alkalis, detergents, oxidative burst, and lysis by complement. They can also resist antibiotics that target the cell wall such as penicillin. These organisms are widespread in the environme nt and typically live in water and food sources ( 4). Before the AIDS epidemic, the usual presentation of NTM disease in immunocompetent patients was pulmonary, confined to cervical lymph nodes, limited to skin or in rare cases, disseminated ( 3). Most pati ents presenting this disease were older men who had previous underlying pulmonary diseases such as chronic obstructive pulmonary disease (COPD), bronchiectasis, previous tuberculosis and silicosis ( 5). Other risk factors for NTM disease include: reduced im mune competence due to cancer chemotherapy, immunosuppression involved with transplantation, altered chest architecture, alcohol ism, and smoking tobacco (4). Recent findings, however, suggest that the occurrence of NTM disease in immunocompetent patients with no underlying lung disease is on the rise. The major pulmonary mycobacterial pathogens

PAGE 13

13 are: Mycobacterium avium ( M. avium ), Mycobacterium kansasii ( M. kansasii ) and Mycobacterium intracellulare ( M. intracellulare ) There is little evidence of person to person spread of NTM and it is believed that the environment is the main source or reservoir for these organisms. NTM disease in AIDS is caused primarily by M. avium and is second only to AIDS wasting syndrome as t he most common cause of death in these patients ( 6 ). Mycobacterium Avium M. avium is a nontuberculous mycobacterium which infects humans and animals alike. M. avium is an opportunistic infectious agent that mostly affects patients with underlying condi tions that compromise local or systemic immunity ( 7) and has become a major human pathogen, primarily due to the emergence of the AIDS epidemic. This mycobacterium is found in the environment, particularly in water sources and is in close contact with huma n populations (7). Human infection is believed to be initiated either through the intestinal tract or by the inhalation of aerosols containing bacteria (7). When inhaled, M. avium enters the body via the respiratory route through aerosols and the first host cells to encounter the pathogen are bronchial epithelial cells and alveolar macrophages ( 7). Mycobacteria use different receptors to gain access into macrophages: mannose receptors, complement receptors (CR3), type A Scavenger receptors and in exposed hosts with mycobacteria 7, 8 ). M. avium can spread from the initial site of infection to the rest of the body through the lymphatics or through the blood. At the main site of infection, the bacilli are phagocytosed b y alveolar macrophages (4). This is the first event in which the host develops a response to the invading pathogen and is vital to the outcome of infection. Of the many virulence factors of Mycobacteria, their ability to reside and multiply within alveol ar macrophages is seen as one of the most important. Other virulence factors of NTM are: prevention of acidification of phagocytic vesicles, prevention of phagosomes lysosome fusion, delay in tumor necrosis factor

PAGE 14

14 secretion by infected host cells, uptake b y epithelial cells and production of receptors for macrophage binding ( 9). Phagocytosed pathogens are normally transported from the phagosomes to lysosomes within the macrophages and are effectively destroyed after phago lysosomal fusion. The most well c haracterized antimicrobial mechanisms of the macrophage are the ones that involve oxidative damage: the respiratory burst and nitric oxide (NO) production ( 9). These tw o systems work synergistically in killing many microbes (7, 10). Macrophages that have phagocytosed the bacilli normally die and form a central area of necrosis or a caseum; the pathogen is then contained withi n these caseous granulomas (11). Mycobacterium Avium C omplex (MAC ) Mycobacterium avium complex (MAC) is generally referred to as an opportunistic pathogen since it usually infects patients with established lung damage ( 11). Mycobacteria included in the MAC family are classified as acid fast, slowly growing bacilli that may produce a yellow pigment in the absence of light (1). Other species of Mycobacteria which are included in MAC include: M. avium paratuberculosis M. avium silvaticum M. avium hominissuis and M. avium colombiense ( 3). MAC in AIDS patients most often causes a disseminate d illness (bacteria is spread though the blood stream) and can cause many symptoms throughout the body. The risk of MAC is inversely related to the patients CD4 + T cell count, and increases significa ntly when the CD4+ T cell count decreases below 50 cells/mm3 of blood (3). 98% of MAC infections in AIDS patients are due to M. avium ( 1). Isolates from MAC infected patients are commonly referred to as Mycobacterium avium hominissuis since this strain is found mostly in humans. Like most NTM, MAC bacteria are found in air, water, soil, foods, some tobacco products, and in many animals. Covert et al showed that personto person transmission of MAC bacteria is unlikely, suggesting that humans contract this disease from the environment ( 12). Recently, there has been a growing concern about human exposure to MAC through drinking

PAGE 15

15 water due to its high r esistance to most chemical disinfectants in water treatment processes and its high prevalence in biofilms in water distribution systems (13 14, 15). Because most Mycobacteria are intracellular pathogens, the host cells, alveolar macrophages (AM) in this case, can actually serve as a barrier to the delivery of drugs to the intracellular environment ( 16). MAC organisms have shown to have resistance to many antimycobacterial drugs, which adds to the challenges of treating this disease. Host Response To Infec tion After mycobacterial infection, the innate and adaptive immune systems respond with the recruitment of immune cells to the site of injury. The bacilli are recognized by host immune cells via Toll Like Receptor (TLR) 2 ligation ( 17). TLRs are pattern r ecognition receptors (PRRs) which recognize and bind to mycobacterial cell wall components and other pathogenic materials. TLRs are believed to represent key receptors for the recognition of mycobacterial antigens and activation of macrophages and Dendriti c cells (DC), as well as other cells of innate immunity, thereby likely modulating the adaptive immune response (15,17,19). A variety of microbial products recognize and activate mammalian TLRs, facilitating the transcription of genes involved in regulati ng the adaptive immune response, including chemokines, cytokines and co stimulatory molecules (15, 20,21,22) Mammalian TLRs represent a structurally conserved family of membrane receptors, which have homology t o the Drosophila Toll system (17, 20) TLR s ignaling leads to the nuclear translocation of the transcription factor nuclear factor 2the expression of many immune response genes, such as those encoding cytokine s. TLR signaling also triggers differentiation of monocytes into macrophages and dendritic cells allowing for a more potent innate and adaptive immune response (9, 24) Cytokines are likely to be important mediators during the pulmonary inflammatory resp onse ( 25). It is also believed

PAGE 16

16 that the ordered influx of leukocytes to the site of inflammation is controlled by different regulatory Chemokines ( 26, 27). Chemokines are a large family of structurally related secreted proteins that are important for leukocyte trafficking. These small (8 12kDa) inducible secreted cytokine proteins act primarily as chemoattractants and activators of leukocytes ( 28) Chemokines can be divided into four subfamilies (C C, C X C, C, and C X X X C) depending on spacing of highly characteristic cysteine residues within their amino terminal regions ( 29 ). Chemokines are produced by a variety of cells, including leukocytes, epithelial cells, en dothelial cells, fibroblasts and numerous other cell types following stimulation by cytokines or microbial products ( 25 30, 31). Chemokines exert their effect via a distinct group of seventransmembrane domain protein receptors that signal through heterodimeric GTP binding proteins ( 29, 32). Two important molecules involved in the recruitment of monocyte macrophages and T cells to the site of infection are Monocyte chemoattractant protein 1 (MCP 1) and Chemokine receptor 2 (CCR2). MCP 1, acting through i ts receptor CCR2, is a potent chemoattractant for mononuclear cells (25). Formation Of Granuloma Granulomas are formed as a consequence of chronic antigen persistence and are thus a hallmark of all mycobacterial infections ( 32). In general, the producti on of proinflammator y cytokines and chemokines is essential for the recruitment of inflammatory cells to the site of infection and for the formation and maintenance of granuloma. This will not only localize and sequester the bacteria, but will also localize the immunopathologic responses to the bacteria ( 34). Granuloma formation involves the interaction of bacteria, fibroblasts, immune cells, including macrophages, and T cells, as well as immune effectors such as chemokines and cytokines (Figure 22). T his process involves a cytokine network which drives the T helper cell

PAGE 17

17 immune response. Formation of granulomas is dependent on sequential release of specific cytokines and chemokines, which activate and chemoattract T lymphocytes and monocytes, the cellu lar components of granulomas. In vivo granuloma formation is induced and maintained by various cytokines (35) It is believed that small, solid (organized) granulomas can contain the infection and prevent further pathology, whereas, large, necrotic (loose ) granulomas may lead to the dissemination of the bacteria and cause greater infection. For this reason, the integrity of a developing granuloma is crucial in terms of disease progression and survival. Ehlers et al., (32) have shown that mice lacking a Tumor Necrosis Factor (TNF) receptor have granulomas that disintegrate and cause widespread inflammatory apoptosis of both granulomas and surrounding tissue, leading to higher mortality. Granulomas can provide antibacterial protection in host tissue, but can also induce tissue damage and inflammation concomitantly. Thus, the outcome of mycobacterial disease is linked to granuloma formation and maintenance of granuloma integrity (16 36, 37, 38). We believe that MCP 1 forms a gradient for immune cells expressing CCR2 on their surfaces following mycobacterial infection. It is this gradient which allows immune cells such as monocyte/macrophages, T cells, and Dendritic cells to be recruited to th e site of infection from the peripheral blood. If this gradient is somehow lost, then the immune response will not be effective in clearing the infection since the proper inflammatory cells will not be able to migrate towards the injury and will cause wide spread inflammation and further pathology of the disease. Heme Oxygenase 1 (HO 1) Heme Oxygenase (HO) is a ubiquitously expressed protein which catalyzes the degradation of heme to produce three catabolic byproducts: carbon monoxide (CO), Iron (Fe2+) which is sequestered by ferritin and Biliverdin which is converted to Bilirubin by Biliverdin reductase ( 39) (Figure 23). There are three isoforms of HO including: one inducible form, HO -

PAGE 18

18 1, and two constitutive forms, HO 2 and HO 3 ( 40 ). Also known as H eat Shock protein 32 (HSP32), HO 1 is the rate limiting enzyme involved in the degradation of heme, a potent oxidant. In addition to its role as a key enzyme in heme degradation, HO 1 has been shown to be anti inflammatory and antioxidative through its br eakdown of heme ( 41). HO1 is a 32 kDa microsomal stress response protein that is induced by oxidative stress, inflammation and bacterial infection and is secreted by many cell types (41). Mitzuno et al. (41) have shown that among peripheral blood leukoc ytes, monocytes are the principal source of HO 1 when stimulated in vitro and that his production plays a role in systemic inflammation. HO 1 has been shown to be induced by glutathione depletion, lipopolysaccharide (LPS) and both hyperoxia and hypoxia in vivo ( 42). In addition, HO 1 is induced by various cytokines and growth factors ( 43 ). The 5'flanking region of the HO 1 gene contains binding sites for the transcription factors that regulate inflammation, including nuclear factor kappa B and activator protein 1(74). However, these do not appear to mediate lipopolysaccharide induced HO 1 gene expression. This transcription factor may also be important in the regulation of HO 1 by proinflammatory stimuli ( 44). HO 1 plays a central role in the defense a gainst oxidative and inflammatory insults in the lung and has been shown to be upregulated in many pulmonary diseases ( 45). HO1 deficiency, however, is associated with chronic inflammation and increased leukocyte recruitment in mice and in humans ( 41). Zampetaki et al ( 46) have shown that HO 1 deficiency in humans and mice results in chronic inflammation and increased leukocyte recruitment. The byproducts of HO 1 enzymatic activity are cyto protective, anti inflammatory and may act as antioxidants at t he right concentrations (44) HO1 has been implicated in the protection of lung tissue during oxidative stress, but the expression and cellular distribution of HO 1 is poorly characterized. In healthy lung tissue, HO 1 has been shown to be expressed in alveolar macrophages and in

PAGE 19

19 bronchial epithelial cells ( 46). HO1 is recognized to alter both chemokine production as well as chemokine receptor expression (74) Recruitment of monocytes to the site of infection is a complex phenomenon dependant on the ex pression of chemokines and expression of receptors for these chemokines on peripheral blood monocytes. HO 1 has been shown to act in cell mediated immunity in the pleura and infections with M. avium have been shown to increase the expression of HO 1 in mononuclear cells and pleural mesothelial cells ( 47) HO1 has been shown to downregulate the inflammatory response in the lungs by attenuating the expression of adhesion molecules and inhibiting the recruitment of leukocytes or by repressing the induction of cytokines and c hemokines such as MCP 1 (47). It is not known how HO 1 regulates and suppresses cytokine expression. It is possible that HO therefore abrogates an inflammatory response (45). HO 1 has been shown to dir ectly regulate MCP 1 mRNA expression trough the degradation of heme ( 48) Furthermore, HO 1 induction results in suppression of monocyte chemotactic response via inhibition of CCR2 expression ( 49). Monocyt e Chemoattractant Protein 1 (MCP 1) MCP 1 (Also known as monocyte chemotactic and activating factor (MCAF)) is a 76 amino acid peptide that is selectively chemotactic for peripheral blood monocytes ( 50). MCP 1 is an 8.7kDa protein that has specific chemoattractant and activating activity for monocytes in acute inflammatory conditions (25).The regulated interactions of chemokines with their respective receptors are thought to mediate the controlled recruitment of specific leukocyte subpopulations required during host defense and inflammation. MCP 1, a member of the CC motif chemokine family, is secreted by pleural mesothelial cells, endothelial cells, fibroblasts, monocytes, macrophages and leukocytes in response to inflammatory signals such as IL 1 and TNF alpha and bacterial infection ( 51). CC chemoki nes have two conserved, adjacent cysteines near their amino terminus and are predominantly chemotactic for mononuclear cells (65) MCP -

PAGE 20

20 1 is a primary and specific mononuclear cell chemoattractant from a class of cytokines that are referred to as the plate let factor 4 (PF4) super family and are related by predicted primary structural similarities and by cons ervation of a 4 cysteine motif ( 51) MCP 1 was first cloned from mouse fibroblasts as a PDGF inducible gene termed JE (24,52) and is homologous to huma n MCP 1 (24, 53, 54, 55, 5 Previous results show that MCP 1, along with several othe r chemokines, is controlled by 58, 59, 60). MCP 1 creates a gradient for chemotaxis of monocytes macrophages, T cells and natural killer (NK) cells towards the site of infection and is the ligand for CCR2 which is expressed on cell surfaces of leukocytes ( 28). This receptor chemokine interaction has been shown to induce haptotaxis (the migration of cells along the gradient of substratebound attractant molecules) in mesothelial cells ( 28). MCP 1 is characterized by its ability to evoke chemotaxis mainly in monocytes (50). MCP 1 has also been shown to aid in the recruitment of other mononuclear phagocytes such as: CD45ARO+ T lymphocytes, B cells, and NK cells ( 61). In vitro, MCP 1 is chem otactic for mononuclear cells, but not Neutrophils ( 62). However, Neutrophils in an inflammatory milieu, can express CCR2, potentially enabling their chemotaxis to MCP 1 ( 63). The association between augmented levels of MCP 1 and the recruitment of mononuclear cells expressing CCR2 plays a crucial role during chronic inflammatory disease ( 62) MCP 1 has been shown to be upregulated in HO 1 knockout mice ( 64). This suggests a possible inhibitory effect by HO 1 on MCP 1. Alternatively, 6,57). It has been shown that increased levels of MCP 1 following bacterial infection correlate with the influx of CD4+ T cells and macrophages in to the lungs ( 25) However, other results suggest that MCP 1 is a mediator of inf lammation and can specifically stimulate the directional migration of T cells as well as monocytes and may play an important role in immune cell recruitment into sites of antigenic challenge (47).

PAGE 21

21 Kanakiriya et al ( 65) have shown that inhibition of HO 1 with Zinc protoporphyrin (ZnPP), a specific HO 1 inhibitor, prevented the hemininduced expression of MCP 1 mRNA and that the active form of Iron can also induce the expression of both HO 1 and MCP 1 (45). During infe ction and inflammatory disease, the increased release of MCP 1 attracts T lymphocytes and macrophages to the site of infection and results in granuloma formation (54). ZnPP prevented the expression of MCP 1 by hemin at 6 hours; examination at later time p oints demonstrate an increasing level of expression of MCP 1 mRNA despite the continued presence of this inhibitor of HO activity; indeed, at 18 hours the level of expression of MCP 1 was increased almost threefold in the presence of ZnPP (47). Thus, MCP 1 can also be induced by HO 1 independent pathways, but this leads to a delayed expression of the chemokine (47). It is believed that MCP 1 plays a crucial role in the development of disseminated MAC disease. Some studies have shown that MCP 1 can act as a negative regulator for the CCR 2 cell surface receptor ( 66). Chemo kine (C C Motif) Receptor 2 (CCR 2) CCR2 is a seven transmembrane spanning G protein coupled receptor expressed on the cell surface of leukocytes ( 60) (Figure 2 4). This receptor binds MC P 1 with high affinity and is activated upon ligand binding ( 60) MCP 1 interacts with CCR2 which has two isoforms, CCR2A and CCR2B ( 29, 68). Activation of CCR2 leads to downstream activation of Phospholipase C (PLC) which cleaves the molecule Phosphotid yl inositol (4, 5) bisphosphate (PIP2) (68). This cleavage forms two second messenger molecules called Inositol trisphospahte (IP3) and Diacylglycerol (DAG) which induce intracellular signaling events and trigger inflammation (68) Specifically, DAG has been shown to activate Protein Kinase C (PKC) and IP3 has been shown to trigger the release of calcium from internal cellular stores (60) These events promote the activation of the Mitogen Activated Protein Kinase (MAPK) pathway and induce differentiation and chemotaxis of leukocytes (60) (Figure 2 5). CCR2 is expressed on

PAGE 22

22 many different cell type surfaces and provides a mechanism for specific interaction with certain chemokines. Belperio et al. (60) have shown that CCR2/ mice have a reduced infiltration of mononuclear phagocytes and neutrophils in a mouse model using tracheal allograft s However, the levels of lymphocyte infiltration were not changed and the absence of CCR2 expression did not chan ge the protein levels of MCP 1 (60) Additionally, it has been shown that CCR2/ mice showed a decreased level of recruitment of mononuclear phagocytes to the site of granulomas ( 69). Other experiments have shown that the CCR2 receptor can regulate MCP 1 levels by binding and internalizing MCP 1, creating a self limiting negative feedback loop and abrogating the influx of inflammatory cells to the site of injury (70). Lu et al., ( 7 1) reported that CCR2 is probably the only receptor for MCP 1 in vivo. We believe that expression of CCR2 on monocytes plays an integral role in granuloma formation. This receptor al lows immune cells to chemotax along an MCP 1 gradient towards the site of infection.

PAGE 23

23 Figure 2 1. Recognition of an appropriate ligand by TLR 2 (for example, lipopolysaccharide) triggers the Tolllike receptor to recruit MyD88. MyD88 interacts with the Toll like receptor through its own Toll/IL 1 receptor domain and in turn engages the serine threonine kinase IRAK though a death domain. Signal transduction factors such as TRAF6 carry the signal through a series of phosphorylations until NF B is ultimately released to the nucleus where it can activate the transcription of appropriate immune response genes. Allan Genome Biology 2000 1 :reports0079 doi:10.1186/gb2000 16reports0079

PAGE 24

24 Figure 2 2. Formation of granuloma involving pathogen, macrophages, T cells, and B cells.

PAGE 25

25 Figure 2 3. Degradation of heme by HO 1. HO 1 catalyzes heme degradation to biliverdinIX, CO, and iron. These metabolites mediate the antiapoptotic, antiinflammatory, vasodilatory, anticoagulant, antioxidant, and antiproliferative properties of HO 1 (Fredenburgh et. al). Figure 2 4. CCR2 structure. Regions implicated in ligand binding, coupling of effector molecules and suggested targets for GRK and JAK are highlighted. ( apresslp.gvpi.net)

PAGE 26

26 Figure 2 5. Schematic representation of the signaling pathways activated through the CCR2. Ligand binding to CCR2 induces conformational changes in the receptor, leading to its dimerization; this in turns disables JAK2 association and activation. JAK activation initiates the JAK/STAT pathway and enables efficient G protein coupling to CCR2. G proteins mediate signaling cascades through GRK and arrestins, leading to receptor desensitization and internalization. Other signaling molecules triggered through CCR2 include PI 3 kinase, PLC, and MAPK ( apresslp.gvpi.net )

PAGE 27

27 CHAPTER 3 MATERIALS AND METHODS HO1 Knockout Mouse Model C57BL/6 mice were used for this model since i t has previously been shown that this strain develops focused lesions that grow into large granulomas following M. avium infection; these granulomas exhibit central necrosis (caseous necrosis) similar to human granulomas described in tuberculosis lesions ( 7). We used the HO 1 knockout model developed by Kenneth D. Poss and Susumu Tonegawa as described ( 72). Briefly, the construct was designed to remove a 3.7kb XhoI HindIII fragment of murine DNA with intron sequence and coding sequence for the final 226 amino acids (Figure 3 1). Chimeric mice were generated as described (71 73) and HO 1 / (Hmox1 / ) were obtained by mating male chimeras with C57BL/6 females; these Hmox1+/animals were intercrossed to produce Hmox1/ mice. HO1 wild type (+/+) heter ozygous (+/ ) and knockout ( / ) mice were maintained in a breeding colony in a specific pathogen free (SPF) animal housing facility under Animal Care Services at the University of Florida. HO1 / male mice of 8 weeks of age were paired with heterozygous (+/ ) females of the same age and subsequent litters were genotyped for the HO 1 gene. Genotyping was done upon weaning mouse pups 21 days after birth. Mouse tissue was obtained by cutting a small piece (1cm) off the tip of the tail. This tissue was dig ested and genomic DNA was isolated using Extract N Amp Tissue PCR Kit (Sigma, St. Louis, MO). PCR was performed using specific primers for wild type and knockout (mutant) HO 1 genes. HO 1 Wild type primer sequence (forward, 5 GTA CAC TGA CTG TGG TRG GGG GAG 3, reverse, 5AGG GCC GAG TAG ATA TGG TAC3) and HO 1 mutant primer sequence (forward, 5GCT TGG GTG GAG AGG CTA TTC 3, reverse, 5 CAA GGT GAG ARG ACA GGA GAT C 3). The PCR product was run on a 2% agarose gel

PAGE 28

28 supplemented with Ethidium bromide for UV imaging of DNA. The molecular weight of the wild type and mutant gene products are 180base pairs and 290 base pairs respectively. M. Avium culture M. avium subspecies avium Chester (ATCC# 15769) was maintained in ATCC medium 90 Lowenstein Je nson medium and grown in LowensteinJensen Medium Slants (BD Biosciences, San Jose, CA) according to manufacturers instructions. Alternatively, colonies were grown on Middlebrook and Cohn 7H10 agar plates (BD Biosciences, San Jose, CA ) and incubated for 14 days at 37 degrees in 95% oxygen and 5% carbon dioxide. A stock solution was prepared and the concentration was measured by reading the optical density (OD) using a spectrophotometer at 600nm (BioRad Hercules, CA ). Bacteria were fr ozen in 1ml aliquots in 10% glycerol at 80 C at a concentration of 1.3 x 109Collection Of Serum Colony forming units (cfu)/ml. Frozen aliquots were thawed and briefly sonicated before each use. T he mice were euthanized in a desiccator with an overdose of Isoflourane, an analgesic (Webster veterinary supply, Sterling, MA). Then, whole blood was collected through the abdominal aorta using a 25 gauge needle. The blood was left at room temperature for 30 minutes to clot an d then centrifuged at 12,000 rpm to separate the serum from the red blood cells (RBCs). The serum was then aliq uoted and stored in a 80 C freezer for further analysis. Bronchial Alveolar Lavage Fluids (BALF) BALF was collected by ligating the trachea using thread and placing a catheter into the airway through the trachea. Fluids were collected by injecting 800 1000 of Hanks Balanced S alt S olution (HBSS) into the mouse lung via canulation of the trachea. The fluid was then re drawn and the process was repeated twice for a total volume of 1600was placed on ice and then centrifuged at 1500 g to pellet the cells and separate the supernatant.

PAGE 29

29 The supernatant was aliquoted a nd stored in a 80 C freezer until further use The BAL cell pellet was stored in Cel l Freezing Medium (Sigma, St. Louis, MO) and stored in a 80 C freezer Tissue Harvest We collected the lungs, liver, spleen and kidneys from each mouse following euthanasia. Some tissue was frozen in Optimal Cutting Temperature (OCT) compound (Sakura, Torrance, CA) and stored in 80 C. The rest was fixed in 4% Paraformaldehyde and stored in room temperature for 24 hours. This tissue was then transferred to 70% ethanol and stored at room temperature until used. Immuno histochemistry Lung tissue from sacrificed mice was fixed in 4% Paraformaldehyde for 24 hours then t ransferred to 70% Ethanol Tissue was sent for paraffin embedding and Hematoxylin and Eosin (H&E) staining to Histology Tech Services, Gainesville Florida. Paraffin embedded slides were s tained for CCR2 using Goat anti mouse primary antibody (Capralogics, Hardwick, MA) and ABC staining kit (Vector laboratories Burlingame, CA) according to manufacturer recommendations. Alternatively, slides were stained with primary antibody for HO 1 (Calb iochem, San Diego, CA). Briefly the slides were deparaffinzed using Xylenes (Fisher Scientific Fairlawn, NJ ). Slides were placed in Xylene solution for 5 minutes twice. The slides were then washed with 1X Phosphate Buffered Saline (PBS) for 2 minutes. Next, the slides were permeated by incubating with triton X 100 ( Sigma Aldrich, St. Louis, MO ) for 10 minutes and incubated with Hydrogen Peroxide for (H2O2) for 30 minutes. Normal goat serum (ABC kit) was then added for 30 minutes to block tissue from ba ckground or nonspecific binding. Primary antibody for CCR2 was added to slides for 1 hour followed by washing and addition of secondary antibody (ABC kit) for 30 minutes. The slides were them incubated for 5 minutes in

PAGE 30

30 DAB peroxidase substrate solution ( Vector laboratories Burlingame, CA) for color development. All slides were counter stained with Hematoxylin (fisher Scientific, Fair Lawn, NJ) for 30 seconds. Sections were visualized using a Nikon DIAPHOT inverted microscope. The ocular is magnified to 10 times (10x) and the objectives used were magnified to 10x, 20x or40x Pictures were taken using the SPOT Imaging Solutions software (Sterling Heights, MI). TIB 71 (RAW 264.7) C ells RAW 264 ( 7TIB 71) cells were obtained from American Type Culture Col lection ( Manassas, VA Co Culture of RAW 264.7 Cells With M Avium ). RAW 264 cells are macrophages derived from BALB/C mice and are known to produce lysozyme The base medium for this cell line is ATCC formulated Dulbeccos Modified Eagles Medium (DMEM) supplemented with 10% Fetal Bovine Serum (FBS), Fungizone ( MP Biomedicals United States Solon, OH) and Penicillin Streptomycin solution ( MP Biomedicals United States Solon, OH ). Cells were grown to confluence in 6well plates and the culture med ium was replaced with serum free medium (SFM) to perform the experiments. Camhi et al. have shown that HO 1 is induced in RAW 264.7 cells with treatment of LPS ( 74) TIB 71 c ell cultures were plated on 60mm culture plates (Corning, Lowell, MA ) at a concentration of 1x10^6 cells per plate and treated with M. avium in SFM at a concentration of 50x10^6 bacteria per plate or a ratio of 50:1 bacteria per cell. After reaching confluence, the plates were incubated at 37 C for different time points (4, 8, and 24 hours) and the cells and supernates were harvested. All treatments were done in triplicate. Cell culture supernates were stored in a 80 C freezer. Cell pellets were stored in either Buffer RLT (Qiagen, Valencia, CA) or RIPA cell lysis buffer (Sigma Aldrich, St. Louis, MO) for RNA isolation and Western Blot protein analysis respectively. The resulting samples were stored in a 80 C freezer until needed.

PAGE 31

31 HO1 Inhibition By Zinc Protoporphyrin IX In Cell Cultures Zinc protoporphyrinIX (ZnPP) is a normal metabolite that is formed in trace amounts during heme biosynthesis ( 75). ZnPP may regulate heme catabolism through competitive inhibition of HO 1 enzyme activity ZnPP is found in erythrocytes and is de posited in the spleen along with heme where both bind HO 1. This process slows down heme degradation by HO 1. ZnPP inhibits the enzyme activity of HO 1 but does not alter the gene and protein expression of HO1. Cells in culture were pretreated with ZnPP IX (Frontier Scientific, Logan, UT) for thirt y minutes in SFM The media is then cha nged to fresh SFM and the cells are exposed to different treatments as described above and incubated for different time points. Cells are collected, spun down and stor ed in RLT Lysis Buffer ( 10 parts RLT Lysis buffer, Qiagen sciences, MD, USA and 1 part 2Mercaptoethanol Bio Rad Laboratories Inc., Hercules, CA) for RN A isolation. Cell Supernates were also collected and stored in a 80 C freezer for cytokine studies. Mouse Model For M. Avium I nfection We have developed a murine model for M. avium infection and chronic colonization which leads to granuloma formation in the lungs and other tissue. C57BL /6 wild type and HO 1 knockout mice were inoculated intranasal with 7x106 M. avium in PBS once per week for three weeks. Alternatively, wild type control mice were inoculated with equal volume of PBS. Throat swabs were done once a month and plated on M. avium specific plates to monitor colonization. The swabs were plated on the aforementioned 7H10 plates (BD) and incubated for 14 days in a 37 C incubator with 95% O2 and 5% CO2. Colonies are visualized and counted on each plate to determine the level of colonization in each mouse. The mice were sacrificed at different t ime

PAGE 32

32 points (2, 4 and 6 months) and the lungs, spleen and liver were harvested. BALF, BAL cells and serum were collected. Cytokine Studies MCP 1 levels in cell culture supernatants, mouse sera and BALF were measured using Enzyme Linked ImmunoSorbent Assay (ELISA). We used a Quantikine Mouse CCL2/JE/MCP 1 immunoassay kit according to manufacturer recommendation (R&D systems Inc., Minneapolis, MN ). The cells and media are collected and centrifuged at 2000 RPM for 5 minutes. The culture supernates were collected and stored in a 80 C freezer until needed. 50 1 levels. The OD was measured at 450 nm in a Biotek Synergy 2 microplate reader using Gene5 software ( Biotek Industri es, Winooski, VT ). Real Time Polymerase Chain Reaction (RT PCR) Analysis Total RNA from cultured RAW 264 cells was purified and diluted with RNase free water to 100 ng/L; then, 10 L of each sample were reverse transcribed into combinational DNA (cDNA). Af ter the reverse transcription reaction was finished, 80 L of RNase free water were added to each sample. of diluted cDNA product were mixed with 25 L of SYBR Green JumpStart Taq ReadyMix, 0.5 L of internal reference dye, H2O and 2 L of specific oligonucleotide primers (80 nM final concentrations) to a total volume of 50 L for quantification of the real time polymerase chain reaction (PCR). The quantification of real time PCR was performed by using the SYBR Green method on the Appli ed Biosystems 7500 Real Time PCR System with the following profile: 1 cycle at 94C for 2 minutes; 40 cycles at 94C for 15 seconds, at 60C for 1 minute, and at 72C for 1 minute; and the at acquired fluorescent signal from the elongation step. Beta actin or 18s rRNA was used as a house keeping internal control. The real time PCR products were confirmed by electrophoresis on 2% agarose gels.

PAGE 33

33 cDNA was amplified using mRNA specific primers for mouse 18S rRNA (forward: 5 TGTCTCAAAGATTAAGCCATGCAT 3, revers e: 5 AACCATAACTGATTTAATGAGCCATTC 3), mouse MCP 1 (forward: 5 GGCTCAGCCAGATG CAGTTAA3, reverse:5 CCTACTCATTGGGATCATCTTGCT3) mouse CCR2 (forward: 5 CAACTCCTTCATCAGGCACAR 3 reverse: 5 GGAAAGAGGCAGTTTGCAAAG3) mouse HO 1 ( forward : 5 CTTTCAGAAGGGYC AGGTGWCC 3 reverse : 5 GTGGAGMCGCTTYACRTAGYGC 3 ) Data analysis was carried out by using the ABI sequencedetection software using relative quantification. The threshold cycle (Ct), which is defined as the cycle at which PCR amplification reaches a sig nificant value, is expressed as the mean value. The relative expression of messenger RNA (mRNA) was calculated by using the Ct method (where Ct is the value obtained by subtracting the Ct value of the housekeeping gene actin mRNA from the Ct value of the target mRNA). The amount of the target relative to actin or 18s rRNA mRNA was expressed as 2(Ct)Statistical Analysis The data o btained f r om independent experiments are pres ented as the mean +/ standard deviation; they were analyzed by the unpaired st udent t test using Statview software version 5.0, SAS Inst. INC. (Cary, NC). All experiments were done in triplicate. Differences were considered significant at P < 0.05 level

PAGE 34

34 Figure 3 1. Targeted disruption of the Hmox1 gene. (a) Hmox1 genomic locus and targeting vector A 3.7kb region including exons 3, 4 and a portion of 5 (e3 e5) was replaced with a pkgneo cassette. The 5 and 3 probes used for screening ES cell clones and genotyping mice are shown. The 5 probe hybridizes to an 11kb KpnI fragment of the native Hmox1 gene and a 6.5kb fragment from the disrupted gene. D, HindIII site; K, KpnI; X, XhoI; Xb, XbaI. (Poss, Tonegawa, 1997).

PAGE 35

35 CHAPTER 4 RESULTS In Vitro Results HO1 is induced by M. avium in RAW 264.7 cells We stained RAW 2 64.7 cells for HO 1 to test whether the expression levels of HO 1 are increased after insult with M. avium. Our results showed that HO 1 was induced by M. avium in RAW 264.7 cells after 4 hours (Figure 42) as opposed to controls (Figure 41). HO 1 was sti ll expressed at 8, 24 and 48 hours after exposure to M. avium as well (results not shown). We next looked at mRNA levels of HO 1 in RAW 264.7 cells in the presence and absence of M. avium in order to see whether M. avium induces gene expresison of HO 1. Our results showed that HO 1 expression was induced in a time dependent manner in this mouse monocyte cell line after M. avium treatment (Figure 4 3). MCP 1 relative gene expression in RAW 264.7 cells Following the same protocol as explained above, we analyzed the mRNA levels of MCP 1 in RA W 264.7 cells using real time PCR. After treatment with M. avium, MCP 1 mRNA levels increased in a time dependent manner as compared to controls, but these levels we re abrogated when we treated the cells with ZnPP a competitive inhibitor of HO 1 enzymatic activity, prior to M. avium exposure (Figure 44). CCR2 relative gene expression in RAW 264.7 cells In order to test whether M. avium infection and HO 1 inhibition affect gene expression of CCR2, mRNA levels of CCR2 were measured in TIB 71 (RAW 264.7) cells Our results indicate that when these cells are treated with ZnPP, CCR2 expression is significantly increased on the surface of mouse monocytes and this increa se is time dependent (Figure4 5)

PAGE 36

36 MCP 1 levels in Cell Culture Supernates To support our previous results obtained with RNA, we measured the levels of the same cytokine in RAW 264.7 cell culture supernates using ELISA. MCP 1 levels were significantly increased in a time dependent manner in cell culture supernates of cells that were treated with M. avium for 4, 8 and 24 hours, but the se levels were abrogated after treatment with ZnPP IX even with concurrent infection with M. avium (Figure 4 6). In Viv o Results Mouse t issue After euthanasia, we checked the lungs, liver and spleen of HO 1 +/+ and HO 1 / mice to ensure granuloma formation and therefore, infection has occurred. We observed that the lungs of HO1 +/+ and HO 1 / mice showed detectable d ifferences in granuloma formation. Figure 4 8 shows that HO 1 +/+ mice infected with M. avium formed granuloma in the lungs as compared to saline controls (figure 47). We then examined the lungs of HO 1 / mice to see whether they form similar lesions f ollowing infection with M. avium. Figure 410 shows that HO 1 / mice inoculated with M. avium do not form organized granulomas and have disseminated infection in the lung as compared to saline controls (figure 49) Immunohistochemistry To confirm the m ouse model of M. avium infection, we examined the formation of g ranuloma in lung tissue of infected mice. From analyzing our H&E stained tissue sections, it was evident in HO1+/+ mice developed granulomas after 6 months exposure to M. avium via intra nasal inoculation as compared to saline controls (Figure 411 ). These mice exhibited organized granuloma formation and were able to contain the pathogen to the site of infection. HO1 / mice displayed loose, unorganized lesions in the lungs after exposure t o M. avium as compared to their control counterparts (Figure 412 ).

PAGE 37

37 HO1 protein expression in mouse lung tissue We stained the lungs tissue of HO 1 +/+ control and infected mice to study whether M. avium infection induces HO 1 expression. HO1 level s were up regulated in granulomatous tissue in HO1 +/+ mouse lungs infected with M avium as compared to Control mice. Figure 4 13 shows a 100x magnification of a control lung from an HO 1 +/+ mouse which was inoculated with saline (PBS) which was stained for HO 1. This tissue exhibited basal levels of HO 1. Figures 4 14 and 415 show a 200x magnification of an HO 1 +/+ mouse lung stained for HO 1. This mouse was inoculated with M. avium for 6 months and shows upregulation of HO 1 in granulomatous tissue. CCR2 expression in mouse lung tissue To test and confirm previous results that showed that HO 1 regulates the expression of CCR2, we looked at CCR2 expression in the lung tissue of HO1 +/+ and HO 1 / infected and control mice Figure 4 16 shows that HO1 / mice have higher basal levels of CCR2 in lung tissue. CCR2 levels were up regulated in lung tissue of infected HO 1 +/+ mice as compared to uninfected controls (Figure 417). Additionally, we observed higher levels of CCR2 in infected lungs of HO 1 / mice as compared to infected HO 1 +/+ mice (Figure 418 ). In HO 1 +/+ mouse lung tissue, CCR2 colocalized to granulomas (figure 419). Our results showed that CCR2 is normally regulated by HO 1 in the lungs of HO 1 +/+ mice following infection. Figure 24 shows that CCR2 is colocalized to the granuloma and is not expressed in other areas of the lung. In HO 1 / mice we see that this regulation is lost and CCR2 is expressed in a much larger area of the lung and is disseminated after infection a s compared to CCR2 expression in HO 1 +/+ tissue from infected mice (Figure 420).

PAGE 38

38 MCP 1 l evels in BALF and serum When we analyzed the levels of MCP 1 in both BALF and serum, we observed a significant increase of MCP 1 in the BALF of infected wild type C5 7BL/6 mice as compared to uninfected controls and increased levels in infected HO 1 / mice as compared to knockout controls as measured with ELISA (Figure 421). Additionally, MCP 1 levels were higher in HO 1 / control mice as compared with wild type controls. MCP 1 levels were also increased in the sera of mice infected with M. avium as compared to control mice and the levels of MCP 1 in sera of HO 1 / mice infected with M. avium were significantly higher than wild type controls and HO1 / control s (Figure 422).

PAGE 39

39 Figure 4 1. 400x magnification stain of RAW 264.7 cells after 4 hours of incubation in SFM showing basal levels of HO 1. Blue color shows counter stain with Hematoxylin Figure 4 2. 400x stain of RAW 264.7 cells after 4 hours treatment with M. avium showing increased levels of HO 1 expression (brown). Blue color shows counter stain with Hematoxylin.

PAGE 40

40 Figure 4 3. HO 1 relative apparent gene expression significantly inc reases in a time dependent manner in mouse monocytes a fter treatment with M. avium. HO1 levels increase significantly (p < .001) in cells treated with M. avium ( *). RAW 264.7 cells were treated for 4, 8, 24 and 48 hours in serum free medium (C), or with M. avium. 0 1 2 3 4 5 6 7 8 Control M. aviumRelative Gene Expression 4 hour 8 hour 24 hour 48 hour*

PAGE 41

41 Figure 4 4. MCP 1 Relative Gene Expression significantly increased (p < .001) in monocytes after treatment with M. avium for 8 and 24 hours as compared to controls (*) and were significantly lowered when cells were pretreated with ZnPP for 8 and 24 hours (**) as compared to M. avium alone for the same time points RAW 264.7 cells were incubated for 4,8 and 24 hours in serum free media (Control) or treated with M. avium, or both ZnPP and M. avium 0 0.5 1 1.5 2 2.5 3 Control M. avium ZnPP + M. aviumReltive Gene ExpressionTreatments 4 hour 8 hour 24 hour* ** **

PAGE 42

42 Figure 4 5. CCR 2 Relative Gene Expression was significantly increased (p<.05 ) in M. avium treated monocytes as compared with controls at 4 hours (*), 8 hours (**), and 24 hours (***) and in cells treated with ZnPP and M. avium as compared to controls. RAW 264. 7 cells were incubated for 4, 8, and 24 hours in serum free media (Control), treated with M. avium or treated with both ZnPP and M. avium 0 1 2 3 4 5 6 7 Control M. avium ZnPP+M. aviumRelative Gene ExpressionSample 4 hour 8 hour 24 hour* ** *** ** ***

PAGE 43

43 Figure 4 6. MCP 1 levels significantly increase (p < .05) in cell supernates in a time dependent manner after treatment with M. avium as compared to controls (*) and are significantly decreased (p < .05) after inhibition of HO 1 with ZnPP as compared with M. avium treatment alone (**). 0 500 1000 1500 2000 2500 3000 3500 Control M. avium ZnPP + M. avium MCP-1 (pg/mL) 4 hour 8 hour 24 hour ** ** **

PAGE 44

44 Figure 4 7. HO1+/+ 6 month control lung. Control mice were inoculated with intranasal PBS Figure 4 8. HO 1 +/+ lung showing granuloma formation after 6 months exposure to M. avium via intranasal inoculation

PAGE 45

45 Figure 4 9. HO 1 / 6 month control lung. Control mice were inoculated with intranasal PBS. Figure 4 10. HO 1 / lungs showed disseminated infection and loose granuloma formation following 6 month exposure to M. avium.

PAGE 46

46 A B Figure 4 11. A) 100x magnification H&E stain of an HO 1 +/+ control mouse lung. B) 100x magnification H&E stain of an HO 1 +/+ mouse infected with M. avium for 6 months showing granuloma formation A B Figure 4 12. A) 100x magnification H&E stain of HO 1 / saline control lung. B) 100x magnification H&E stain of HO 1 / showing loose, unorganize d granulomas and disseminated infection in lung tissue following 6 month exposure to M. avium

PAGE 47

47 Figure 4 13. 100x magnification of control lung from HO 1 +/+ mouse showing basal levels of HO1 (brown). Figure 4 14. 200x magnification of M. avium infected HO 1 +/+ mouse lung tissue showing increased expression of HO 1 (brown) in granuloma. Blue color shows counter stain with Hematoxylin

PAGE 48

48 Figure 4 15. 200x magnification of granuloma in M. avium infected HO 1 +/+ mouse lung showing increased expression of HO 1 in granuloma. Blue color shows counter stain with Hematoxylin A B Figure 4 16. A) 100x magnification of control HO 1 +/+ control lung showing basal levels of CCR2 (brown) B) 100x magnification of HO 1 / control mouse lung showing basal levels of CCR2 (brown) Blue color shows counter stain with Hematoxylin

PAGE 49

49 A B Figure 4 17. A) 100x magnification of an HO 1+/+ control mouse lung tissue showing basal levels of CCR2 (brown). B) 100x magnification of an HO 1 +/+ mouse lung inoculated with M. avium for 6 months showing increased expression of CCR2 (brown). Blue color shows counter stain with Hematoxylin A B Figure 4 18. A) 100x magnification of an HO 1 +/+ mouse lung after 6 months M. avium infection showing CCR2 expression (brown). B) An increase in CCR2 expression in HO1 / mouse lung after 6 months of M. avium infection. Blue color shows counter stain with Hematoxylin

PAGE 50

50 A B Figure 4 19. A and B. 100x magnification of an HO 1 +/+ mouse lung after 6 month infection with M. avium showing CCR2 (brown) colocalizes with granuloma. Blue color shows counter stain with Hematoxylin A B Figure 4 20. A and B. 100x magnification of an HO 1 / mouse lung following 6 month infection with M. avium showing disseminated expression of CCR2 (brown). Blue color shows counter stain with Hematoxylin

PAGE 51

51 Figure 4 21. MCP 1 levels are significantly increased (p < .001) in BAL F of infected HO 1 +/+ and HO 1 / mice as compared with controls (*). Basal levels of MCP 1 are significantly higher (p < .001) in HO 1 / control mice as compared to HO 1 +/+ control mice (**). 0 200 400 600 800 1000 1200 1400 1600 HO 1 +/+ Control HO 1+/+ M. avium HO 1 / Control HO 1 / M. aviumMCP 1 pg/uL*

PAGE 52

52 Figure 4 22. MCP 1 levels are increased in mouse s erum after 6 month M. avium infection and are significantly higher (p < .0001) in infected HO 1 +/+ and HO 1 / mice ( *) as compared with saline controls. Significantly higher basal levels of MCP 1 are seen in HO1 / sera then HO 1 +/+ sera ( **). 0 50 100 150 200 250 300 350 400 450 Wild type Control Wild type M. avium HO 1 / Control HO 1 / M. avium MCP1 (pg/mL)Mouse Sample*

PAGE 53

53 CHAPTER 5 DISCUSSION Since the advent of HIV and the AIDS epidemic, NTM infections have become a major source of disease in the United States and around the world (1). Although NTM typically do not cause disease in humans, MAC infections have been on the rise in both immune c ompetent patients as well as the immunocompromised (2). The formation of granuloma is a vital part of the bodys immune defense against invading pathogens. After infection with M. avium, failure to develop organized granulomas results in the dissemination of the infection and greater injury to the host. The regulated recruitment of immune cells including monocyte macrophages, T cells, dendritic cells and B cells to the site of infection and injury is essential for the host to contain and eliminate invadin g pathogens (33). In this study, we tested the interaction and regulation of three proteins (HO 1, MCP 1 and CCR2) in the process of granuloma formation. HO 1, an inducible, cyto protective protein has been implicated in many inflammatory disease as well a s mycobacterial infections (45). We hypothesized that HO 1 plays a role in granuloma formation by regulating MCP 1 and CCR2 expression in mouse monocytes and therefore regulating the cellular recruitment of these immune cells from the periphery to the site of infection and injury. MCP 1 is a chemokine responsible for creating a gradient for the chemotaxis of immune cells from the periphery to the site of infection and CCR2 is the cell surface receptor which is bound by MCP 1 (25). MCP 1 and CCR2 are both highly involved in the process of cellular recruitment and in this study we demonstrate that HO 1 is a key regulator of these cytokines and therefore the immune recruitment process and granuloma formation. From our in vitro experiment using RAW 264.7 mous e monocytes, we observed that HO 1 is induced by M. avium as early as 4 hours post treatment and stays highly expressed for up to 48 hours (Figure 9). Once activated by M. avium, these monocytes began to express higher levels of both MCP 1 (Figure

PAGE 54

54 10) and CCR2 (Figure11). However, when we treated the cells with ZnPP, a competitive inhibitor for HO 1 enzyme activity, we saw a decreased expression of MCP 1 and an increase expression of CCR2, suggesting that HO 1 levels are directly correlated with MCP 1 ex pression and inversely cor related with CCR2 expression. Previous findings have given contradicting evidence in terms of the correlation between HO 1, MCP 1 and CCR2. In many studies, the level of both MCP 1 mRNA and protein were reduced with the inhibiti on of HO 1 (34), but in others, the opposite finding was observed (57). Zampetaki et al (45) have shown that despite high mRNA levels, significantly lower levels of cytokine protein were found in BALF of mice over expressing HO 1. These findings suggest that HO 1 over expression can suppress the signaling pathway. Our in vitro and in vivo results, however, show that inhibiting HO 1 enzyme activity led to a decrease in M CP 1 protein levels in cell supernates (Figure 12), BALF (Figure 27) and mouse serum (Figure 28), suggesting that HO 1 is directly correlated to MCP 1 expression in mouse monocytes. Since we observed an induction of HO 1 and increased levels of MCP 1 in t he lung tissue, BALF and serum of infected HO 1 +/+ mice, it is possible that an MCP 1 gradient was established in order to recruit monocytes from the peripheral blood to the site of infection. This corresponds to a normal immune response in which cells e xpressing CCR2 are recruited from the periphery and chemotax along an MCP 1 gradient towards the site of insult in order to from granulomas (28). When testing MCP 1 protein levels in infected mice, we observed higher basal levels of MCP 1 in sera and BALF in control HO 1 / mice as compared to wild type controls. These results support previous findings (46) and suggest that HO1 / mice are in a chronic state of inflammation. This chronic inflammatory state could lead

PAGE 55

55 to the destruction of the MCP 1 chem otactic gradient which would then disrupt cellular recruitment to the site of infection. Previous findings along with our results suggest that different cell types in different organ systems may react differently to altered levels of HO 1. This could be the result of direct regulation by HO 1 on MCP CCR2 receptor on monocytes and macrophages in the vicinity of the infection which creates a negative feedback loop between CCR2 and MCP 1. It has been reported that when HO 1 enzymatic activity is inhibited by ZnPP, the levels of CCR2 increase (48, 49) suggesting that HO1 somehow regulates the expression of CCR2 on the surface of monocytes, macrophages and other immune cells. Our results show that HO 1 / mice indeed had increased levels of CCR2 on monocyte/macrophage cell surfaces as seen by relative gene expression (Figure 11) and immunohistochemistry (Figure 26). Our findings also suggest that HO 1 normally regulates the expression of the CCR2 during infection and allows these cells to chemotax along an MCP 1 gradient towards infection. When we analyzed the results from our in vivo mouse model, we observed that the loss of HO 1 expression led to loose or unorganized granuloma formation in mice following M. avium infection. The inability of these mice to form solid granulomas led to a disseminated infection with more inflammation and more lesions covering a greater area of the lungs, liver and spleen. As Figure 18 shows, HO 1 / mice had loose, unorganized granulomas in the lungs. It is possible that these mice did not contain the mycobacterium as compared to HO 1 +/+ mice and therefore had disseminated infections. These findings suggest that HO 1 plays a critical role in the regulation o f cellular recruitment to the site of infection and in organized granuloma formation. When analyzing our HO 1 / mouse tissue and immunohistochemistry, we observed that the lack of the HO 1 gene in mice infected with M. avium led to sever e

PAGE 56

56 disseminated i nfection, loose, unorganized granulomas and greater pathology as compared with their HO 1 +/+ counterparts which formed organized granulomas after infection. This is a significant finding because we can now focus our efforts on the direct role of HO 1 in t he process of granuloma formation and cellular recruitment to the site of infection in the live animal. Our HO 1 / mouse model has given us a useful tool in the study of granuloma formation following M. avium infection. Our studies have helped shed lig ht on the role of HO 1 in the regulation of MCP 1 and CCR2 and in the process of cellular recruitment during and following mycobacterial infection.

PAGE 57

57 CHAPTER 6 FUTURE CONSIDERATIONS Having established an HO 1 / animal model of M. avium infection and gr anuloma formation, we can now focus on the direct role of HO 1 in the innate and adaptive immune responses, specifically focusing on granuloma formation. We plan to further elucidate the role of HO1 in regulating cytokines such as MCP 1 and CCR2 and how this regulation affects cellular recruitment from the periphery to sites of infection and inflammation. As stated previously, HO 1 expression may exert different physiological changes in different organ systems and cell types. We can now study the effect s of HO 1 or lack thereof, in several organs, cell types and in different states of health. We can also concentrate on the different aspects of heme catabolism by HO 1 which may affect this immune process. We plan on testing the affects of free iron (Fe+ ), Billirubin, and CO2 on granuloma formation and the immune response to M. avium infection. Another challenge will be to test whether it is possible to rescue the cyto protective role of HO 1 in HO 1 / mice by treating them with one or more of the catabolic byproducts of heme degradation. Another possibility is the use of HO 1 therapy to treat NTM infected patients with HIV or AIDS in the hopes of rescuing their immune function. With these future studies, we hope to contribute not only to the scientif ic field of microbiology, but also to the clinical and therapeutic areas of medicine. Hopefully our findings will help us understand the mechanisms of NTM infection and help prevent such diseases in the future. Alternatively, we hope that our study will he lp elucidate the role of HO 1 in NTM disease and will lead to a better understanding of how to approach and treat other disease caused by both NTM and Mycobacterium tuberculosis.

PAGE 58

58 REFERENCES 1. Falkinham, JO : Epidemiology of Infection by Nontuberc ulous Mycobacteria. Clinical Microbiology Reviews 1996; 9:177215 2. Hendricks, EE, Lin, KC, Boisvert, K, Pa uley, D, Mansfield, KG : Alterations in Expression of Monocyte Chemotactic Protein1 in the Simian Immunodeficiency Virus Model of Disseminated mycoba cterium avium Complex. JID 2004;189:17141720 3. Inderlied CB, Kemper, CA, Bermudez, LEM : The Mycobacterium avium Complex. Clinical Microbiology Reviews 1993;6:266310 4. Falkinham, JO : Surrounded by Mycobacteria: Nontuberculous Mycobacteria in the Human Environment. Journal of Applied Microbiology. 2009:112 5. Iseman, MD, Corpe, RF, Obrien, RJ, Rosenzwieg, DY, Wolinsky, E : Disease Due to mycobacterium avium intracracellulare. Chest 1985;87:139S 149S 6. Hardy, WD, Feinberg, JD, Finkelstien, M, Power, ME, H e, W, Kaczka, C, Frame, PT, Holmes, M, Waskin, H, Fass, RJ, Powderly, WG, Steinbigel, RT, Zuger, A, Hlzman, RS : A control trial of trimethoprimsulphamethoxazole or aerosolized pentamidine for secondary prophylaxis of pneumocystis carnii pneumonia in pati ents with the acquired immunodeficiency syndrome. New England Journal of Medicine 1992;327:18421848 7. Appelberg, R : Pathogenesis of Mycobacterium avium Infection. Typical Responses to an Atypical Mycobacteriim. Immunologic research 2006;35/3:179190 8. Fento n, MJ, Riley, LW, Schlesinger, LS : Receptor mediated recognition of Mycobacterium tuberculosis by host cells, in Cole ST, et al (eds.): Tuberculosis and the Tubercle Bacillus, Washington, DC, ASM Press, 2005, pp. 405426 9. Hou ben, ENG, Nguyen, L, Pieters, J : Interaction of pathogenic mycobacteria with the host immune system. Current Opinions in Microbiology. 2008;9:7685 10. Nathan, C, Xie, Q : Nitric oxide synthases: roles, toils and controls. Cell 1994; 78:915918. 11. Middleton, AM, Chadwick, MV, Nicholson, AG, Dewar, A, Feldman, D, Wilson, R : Investigation of mycobacterial colonization and invasion of the respiratory mucosa Thorax 2003;58:246251 12. Covert, TC, Rodgers, MR, Reyes, AL, Stelma, GN : Occurrence of Nontuberculous Mycobacteria in Environmental samp les. Applied and Environmental Microbiology 1999;65:24922496 13. Shin, GA, Lee JK, Freeman, R, Cangelosi, GA : Inactivation of Mycobacterium avium complex by UV Irradiation. Applied and Environmental Microbiology. 2008;74:70677069

PAGE 59

59 14. Taylor, RH, Falkinham, JO III No rton, CD, LeChevallier, M W : Chlorine, chloramine, chlorine dioxide, and ozone susceptibility of Mycobacterium avium. Appl Environ Microbiol 2000;66:17025 15. von Reyn, CF, Maslow, JN, Barber, TW, Falkinham, JO, III ,Arbeit, R D : Persistent colonization of potable water as a source of Mycobacterium avium infection in AIDS. Lancet 1994; 343: 113741 16. Alamelu, R : Immunology of tuberculosis. Indian J. Med. Res. 2004;120:213232 17. Quesniaux, V, Fremond, C, Jacobs, M, Parida, S, Nicolle, D, Yeremeev, V, Bihl, F, Erard, F, Botha, T, Drennan, M, Soler, MN, B ert, M, Schnyder, B, Ryffel, B : Toll like receptor pathways in the immune responses to mycobacteria. Microbes and Infection 2004;6:946959 18. Stenger, S, Modlin, RL : Control of Mycobacterium tuberculosis through mammalian Toll like receptors. Curr. Opin. Immunol. 2002; 14:452457. 19. Heldwein, KA, fenton, MJ : The role of Toll like receptors in immunity against mycobacterial infection. Microb. Infect. 2002;4:937944 20. Medzhitov, R, Biron, CA : Innate immunity, Curr. Opin. Immunol. 2003;15:24 21. Akira, S : Mammalian Tolllike receptors, Curr. Opin. Immunol. 2003;15:511 22. Takeda, K, kaisho, T, Akira, S : Toll like receptors. Annu. Rev. immunol. 2003; 21:335376. 23. Medzhitov, R, P reston Hurlburt, P, Janeway, CA : A human homologue of the Drosophila Toll protein signals activation of adaptive immunity. Nature 1997;388:392397 24. Krutzik, SR, Tan, B, LI, H, Ochoa, MT, Liu, PT, Sharfstein, SE, Graeber, TG, Siel ing, PA, Liu, YG, Rea, TH et al : TLR activation triggers the rapid differentiation of monocytes into macrophages and dendritic cells. Nat Med 2005;11:653660. 25. Huffnagle, GB, Strieter, RM, Standiford, TJ, McDonald, RA, Bur dick, MD, Kunkel, SL, Towes, GB : The Role of Monocyte Chemotactic Protein1 (M CP 1) in the Recruitment of Monocytes and CD4+ T Cells During a Pulmonary Crytococcus neoformans infection. The journal of immunology 1995; 26. Emery, P, Salmon, M : The Immune response. 2 Systemic mediators of inflammation. Br. J. Hosp. 1991;45:164168 27. Sch all, TJ : Biology of the RANTES/SIS cytokine family. Cytokine 1991;3:165

PAGE 60

60 28. Lundien, MC, Mohammed, KA, Nasreen, N, Tepper, RS, Hardwick JA, Sande rs, KL, Van Horn RD, Antony, VB : Induction of MCP 1 Expression in Airway Epithelial Cells: Role of CCR2 in Airw ay Epithelial Injury. Journal of Clinical Immunology 2002;22:144152 29. Nasreen, N, Mohammed, KA, Galffy, G, Ward, MJ, A ntony, VB : MCP 1 in pleural imjury: CCR2 mediates haptotaxis of pleural mesothelial cells. m J Physiol Lung Cell Mol Physiol 2000;278:L591598 30. Oppenheim, JJ, Zachariae, COC : Properties of a novel proinflammatory supergene intecrine cytokine family. Annu. Rev. immunol. 1991;9:617 31. Schall, TJ : Biology of the RANTES/SIS cytokine family. Cytokine 1991;3:165 32. Bag giolini, M, Dewald, B, Mos er, B : Human Chemokines: an update. Annu. Rev. Immunol. 1997;15:675705 33. Ehlers, S, Kutsch, S, Ehlers, EM, Benini, J, Pfeffer, K : Lethal granuloma Disintegration in mycobacterial Infected TNFp55/ Mice Is Dependent on T Cells and IL 12. J. immunol. 2000;165:483492 34. Lee, JS, Lee JY, Son JW, Oh J, Shin DM, Y uk JM, Song CH, Paiks TH, Jo EK : Expression and Regulation of the CC Chemokine Lignad 20m During Human Tuberculosis Scandinavian Journal of Immunology 2007; 35. Kaufmann, S : Protection against tuberculosis: cytokines, T cells, and macrophages. Ann Rheum Dis 2002;61:ii54ii58 67(1):7785 36. Dannenbe rg, AM, Dannenberg, GA, Rook, W : Pathogenesis of pulmonary tuberculosis: an interplay of tissue damaging and macrophage activating immune responses. In tuberculosis: Pathogenesis, Protection and Control. B.R. Bloom, ed. Am. Soc. Microbiol. Press., Washington, DC, p. 459 37. Jagirdar, J, Z apzag, D : Pathology and insights into the pathogenesis of tuberculosis. In Tuberculosis. W.N. Romand S. Garay, eds. Little Brown, Boston, p. 467 38. Rook, GAW, Bloom, BR : Mechanism of pathogenesis of tuberculosis. In Tuberculosis: Pathogenesis, Protectio na dn Control. B.R. Bloom ed. Am. Soc. Microbiol. Press, Washinton, DC, p. 485 39. Lee, CY, Yen, MH : Nitric Oxide and Carbon Monoxide, Collaborative and Competitive Regulators of Hypertension. Chang Gung Med J. 2009;32:1221 40. Maestrelli, P, Paska, C, Saetta, M, turato, G, Nowicki, Y, Monti, S, form ichi, B, Miniati, M, Fabbri, LM : Decreased haem oxygenase1 and and increased inducible nitric oxide synthesis in the lung of severe COPD patients. Eur Respir J. 2003;21:971976

PAGE 61

61 41. Mitzuno, K, Toma, T, Tsukiji, H, Okamoto, H, Yamazaki, H, Ohta, K, Ohta, K, Kas ahara, Y, Koizumi, S, Yachie, A : Selective expansion of CD16highCCR2subpopulation of circulating monocytes with preferential production of haem Oxygenase (HO) 1 in response to acute inflammation. British Soci ety of immunology, clinical and Experimental Immunology. 2005;142:461470 42. Lakari, E, Pylkas, P, Pietarinen Runtti, P, Paakko, P, Soini, Y, Kinnula, V : Expression and Regulation of Hemeoxygenase 1 in Healthy Human Lung and Interstitial Lung Disorders Hum an Pathology 2001;32:12571263 43. Kanwar, Yashpal, S : A dynamic interplay between monocyte chemoattractant protein 1 and heme oxygenase1: Implications in renal injury. Kidney International 2005;68:896897 44. Rushworth, SA, OConnell, MA : Haem oxygenase1 in inflammation. Biochemical Society transactions 45. Fredenburgh, LE, Perella, MA, Mitsialis SA : The Role of Heme Oxygenase1 in Pulmonary Disease. Am. J Respir Cell Mol Biol. 2006;36:158165 2004;32(Pt 6):10934 46. Z ampetaki, A, Minamino, T M itsialis, SA, Kourembanas, S : Effect of Heme Oxygenase 1 Overexpression in Two Models of Lung inflammation. Experimental Biology and Medicine 47. Mohammed, KA, Nasreen, N, Ward, MJ, Mubarak, K, Rodriguez Panadero, P, Antony, VB : Mycobacterium Mediated Chemokine Expression in Pleural Mesothelial Cells: Role of C C Chemokines in Tuberculous Pleurisy. The Journal of infectious Disease 1998;178:14501456 2003;228:442446 48. Kanakiriya, KRS, Croatt, AJ, Haggard, JJ, Ingelfinger, JR, Tang, SS, Alam, J, N ath, KA : Heme: A novel inducer of MCP 1 through HO dependent and HO independent mechanisms. Am. J. Physiol Renal Physiol 2003; 284: F546F554, 49. Morita, T., T. Imai, T. Yamaguchi, T. Sugiyama, S. Katayama, and G. Yoshino: Induction of heme oxygenase 1 in monocytes suppresses angiotensin II elicited chemotactic activity through inhibition of CCR2: role of bilirubin and carbon monoxide generated by the enzyme. Antioxid Redox Signal 2003; 5:439447. 50. Zachariae CO, Anderson AO, Thompson HA, et al : Properties o f monocyte chemotactic and activationg factor (MCAF) purified from human fibrosarcoma cell line. J. Exp. Med. 1990;171:217782 51. Taub, DD, Proost, P, Murphy, WJ, Anver, M, Longo, DL, Van Damme, J, Oppenheim, JJ : Monocyte Chemotactic Protein 1 (MCP 1), 2, a nd 3 Are Chemotactic for Human T Lymphocytes. The Journal of Clinical Investigation, Inc. 1995;95:13701376

PAGE 62

62 52. Rollin s, BJ, Morrison, ED, Stiles, CD : Cloning and expression of JE, a gene inducible by platelet derived growth factor and whose product as cytokine like properties. Proc Natl Acad Sci USA 1998;85:37383742 53. Matsushima,K, Larsen CG, DuBois, GC, Oppenheim, JJ : Purification and Characterization of a Novel Monocyte chemotactic and Activating Factor Produced by a Human Myelomonocytic Cell Line. The j ournal of Experimental medicine;169:14851490 54. Yoshimura, T, Robinson, E, Ta naka, S, Appella, E, Leonard, E : Purification and Amino Acid Analysis Of Two Human Monocyte Chemoattractants Produced By Phytohemagglutinin Stimulated Human Blood Mononuclear Leukocytes. The Journal of Immunology 1989;142:19561962 55. Valente, AJ, Graves, DT, Vialle Valenti n, CE, Delgado, R, Schwartz, CJ : Purification of a monocyte chemotactic factor secreted by nonhuman primate vascular cells in culture. Biochemistry 1998;27:41624168 56. Furutani, Y Nomura H Notake, M, Oyamada, Y, Fukui, T, Yamada, M, Larsen, CG, Oppenheim 57. Jiang, Y, Valente, AJ, Williamson, MJ, Zhang, L, Graves, DT : Post translational modific ations of a monocyte specific chemoattractant synthesized by glioma, osteosarcoma, and vascular smooth muscle cells. The Journal of Biological Chemistry 1990;265:1831818321 JJ, Matsushima K : Cloning and sequencing of the cDNA for human monocyte chemotactic and activating factor (MCAF). Biochemical and Biophysical Research Communications 1989;159:249255 58. Botazzi, B, Colotta, F, Sica, A, Nobili, N, Mantovani, A : A chemoattractant expressed in human sarcoma cells (tumor derived chemotactic factor, TDCF) is identical to monocyte chemoattractant protein 1/monocyte chemotactic and activating factor (MCP 1/MCAF). International Journal of Cancer 1990;45:795797 59. HaleDonze, H, greenwel Wild, T, Mizel, D, Doherty, MT, Chatter jee, D, Orenstein, JM, Wahl, SM : Mycobacterium avium Complex Promotes Recruitment of Monocyte Hosts for HIV 1 and Bacteria. The Journal of Immunology 2002;169:38543862 60. Nibbs RJB, Graham, GJ, Pragnell, IB : Macrophage inflammatory protein 1 alpha. In Cytokines 1998 p. 467 61. Proost, P, Wuyts, A, Opdenakker, G, Van Damme, J : Monocyte Chemotactic Protein1, 2 and 3. In Cytokines. P. 489 62. Belperio, JA, Keane, MP, Burdick, MD, Lynch, JP III, Xue, YY, Berlin, A, Ross, DJ, Kunkel, SL, Charo, IF, Strieter, RM : Critical Role for the Chemokine MCP 1/CCR2 in the Pathogenesis of Bronchiolitis Obliterans Syndrome. J. Clin. Invest. 2001;108:547556

PAGE 63

63 63. Loetscher, P, dew ald, B, Baggiolini, M, Seitz, M : Monocyte chemoattractant protein 1 and interleukin 8 production by rheumatoid synoviocytes. Effects of anti rheumatic drugs. Cytokine 1994;6:162170 64. Johnston, B, Burns, AR, Suematsu, M, Iss ekutz, TB, Woodman RC, Kubes, P : Chronic inflammation upregulates chemokine receptors and induces neutrophil migration to monocyte chemoattractant protein 1 J. Clin Invest. 1999;103:12691276 65. Pittock, ST, Norby, SM, Grande, JP, Croatt, AJ, Bren, GB, Badley, AD, Caplice, NM, griffin, MD, N ath, KA : MCP 1 is upregulated in unstressed and stressed HO 1 knockout mice: Pathophysiology correlates. Kidney International 2005;68:611622 66. Kanakiriya, KRS, Croatt, AJ, Haggard, JJ, Ingelfinger, JR, Tang, SS, Alam, J, Nath, KA : Heme: A novel inducer of MCP 1 through HO dependent and HO independent mechanisms. Am. J. Physiol Renal Physiol 2003; 284: F546F554 67. Fantuzzi, L, Borghi, B, Ciolli, V, Pavlakis, G, Betardelli, F, Ges sani, S : Loss of CCR2 Expression and Functional Response to Monocyte Chemotactic Protei n (MCP 1) During the Differentiation of Human Monocytes: Role of Secreted MCP 1 in the Regulation of the Chemotactic Response. Blood. 1999;4:875883 68. Charo, IF, Myers SJ, Herman A, Franc i, C, Conolly, AJ, Coughlin, SR : Molecular cloning and functional expression of two monocyte chemoattractant protein 1 receptors reveals alternative splicing of the carboxyl terminal tails. Proc. Acad. Sci. 1994;91:27522756 69. Warmington, KS, Boring, L, Ruth, JH, Sonstein, J, Hogaboam, CM, Curtis, JL, Kunkel, SL, Charo, IR, Chensue, SW : Effect of C C chemokine receptor 2 (CCR2) knockout on type 2 (schistosomal antigen elicited) pulmonary granuloma formation: analysis of cellular recruitment and cytokine responses Am. J. Pathol. 1999;154:14071416 70. Tylaska, AL, Boring L. Weng, W, Aiello R, Cha ro, IF, Rollins, BJ, Gladue, RP : CCR2 Regulates The Level of MCP 1/CCL2 In Vitro And At Inflammatory Sites And controls T Cell Activation In Response to Alloantigen. Cytokine, 2002;18:184190 71. Lu, BB, Rutledge BJ, Gu, L, Fiorillo, J, Lukacs, NW, Kunkel, SL, N orth, R, Gerard, C, Rollins, BJ : Abnormalities in Monocyte recruitment and Cytokine Expression in Monocyte Chemoattractant Protein 1deficient Mice. J. Exp. Med. 1998;187:601608 72. Poss, KD, Tonegawa, S : Heme Oxygenase 1 is req uired for mammalian iron reutilization. Proc. Natl. Acad. Sci. 1997;94:1091910924 73. Bradley, A : Teratocarcinomas and Embryonic Stem Cells: A Practical Approach ed. Robertson, E. (IRL Oxford). 1987:113151 74. Camhi, SL, Alam, J, Otterb ein, L, Sylvester, SL Choi, AM : Induction of Heme Oxygenase 1 expression by lipopolysaccharide is mediated by AP 1 activation. Am J Respir Cell Mol Biol. 1995;13:387398

PAGE 64

64 75. Labb e RF, Hendrik V J, Stevenson DK : Zinc Protoporphyrin: A Metabolite with a Mission. Clinical Chemistr y 1999; 45:12, 20602072

PAGE 65

65 BIOGRAPHICAL SKETCH Doron Regev was born in Tel Hashomer, Israel. He grew up in Kfar Saba, Israel and moved to the United States at the age of 8. Doron spent most of his childhood in Rochester, NY and graduated from Brighton High School in 1995. He earned his bachelors degree in Biology from the University at Albany (NY) in 1999. Doron also excelled as a collegiate football player at Albany, earn ing a first team AllAmerican award as a place kicker his senior year. Following college, Doron pursued a career as a football player and in 2001, played for the Rochester Brigade, a professional arena football team in Rochester, NY. He later decided to embark on a scientific career and began his research at the University of Rochester, where he worked in a cardiovascular research lab for two years. He then moved to Gainesville Florida where he worked in a pulmonary research lab under Dr. Veena Antony an d entered the MS program at the University of F lorida. Upon completion of his m aster s degree, Doron will continue his studies in the IPD program at the University of Florida in the hopes of attaining a Ph.D. in medical sciences.