<%BANNER%>

Characterization of Mutants of the Porphyromonas Gingivalis Strain W83

Permanent Link: http://ufdc.ufl.edu/UFE0025082/00001

Material Information

Title: Characterization of Mutants of the Porphyromonas Gingivalis Strain W83
Physical Description: 1 online resource (88 p.)
Language: english
Creator: Rainho, Jennifer
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: abc, alpha, amylase, biofilm, fimbriae, gingipain, glycosyl, hcaec, hemagglutination, pg0092, pg1683, porphyromonas, transporter, w83
Medicine -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Periodontal disease is the second most common infectious disease, affecting 50 to 90% of adults world wide. Porphyromonas gingivalis is an important etiologic agent in the development of periodontal disease and may be involved in cardiovascular disease as well. The objective of this study was to characterize two genes of P. gingivalis: encoding a putative ABC transporter PG0092 and encoding PG1683 a putative glycosyl hydrolase/alpha amylase, both of which in previous studies were found to be up-regulated during host cell invasion. Previously, double crossover mutants of these genes were constructed in strain W83. For this study, mutant strains were tested in assays of adherence, invasion and persistence using human coronary artery endothelial cells, for biofilm development, hemagglutination and the presence of fimbriae in order to begin to characterize the roles of these genes during P. gingivalis infection. The effect of growth conditions on phenotype and gene expression was found to be critical to this analysis. These studies have provided additional information regarding the role of these genes in P. gingivalis pathogenesis.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Jennifer Rainho.
Thesis: Thesis (M.S.)--University of Florida, 2009.
Local: Adviser: Progulske-Fox, Ann.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0025082:00001

Permanent Link: http://ufdc.ufl.edu/UFE0025082/00001

Material Information

Title: Characterization of Mutants of the Porphyromonas Gingivalis Strain W83
Physical Description: 1 online resource (88 p.)
Language: english
Creator: Rainho, Jennifer
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: abc, alpha, amylase, biofilm, fimbriae, gingipain, glycosyl, hcaec, hemagglutination, pg0092, pg1683, porphyromonas, transporter, w83
Medicine -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Periodontal disease is the second most common infectious disease, affecting 50 to 90% of adults world wide. Porphyromonas gingivalis is an important etiologic agent in the development of periodontal disease and may be involved in cardiovascular disease as well. The objective of this study was to characterize two genes of P. gingivalis: encoding a putative ABC transporter PG0092 and encoding PG1683 a putative glycosyl hydrolase/alpha amylase, both of which in previous studies were found to be up-regulated during host cell invasion. Previously, double crossover mutants of these genes were constructed in strain W83. For this study, mutant strains were tested in assays of adherence, invasion and persistence using human coronary artery endothelial cells, for biofilm development, hemagglutination and the presence of fimbriae in order to begin to characterize the roles of these genes during P. gingivalis infection. The effect of growth conditions on phenotype and gene expression was found to be critical to this analysis. These studies have provided additional information regarding the role of these genes in P. gingivalis pathogenesis.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Jennifer Rainho.
Thesis: Thesis (M.S.)--University of Florida, 2009.
Local: Adviser: Progulske-Fox, Ann.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0025082:00001


This item has the following downloads:


Full Text

PAGE 1

CHARACTERIZATION OF MUTANTS OF THE PORPHYROMONAS GINGIVALIS STRAIN W83 By JENNIFER NINA RAINHO A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2009 1

PAGE 2

2009 Jennifer Nina Rainho 2

PAGE 3

To my parents, Gloria and Joseph Rainho 3

PAGE 4

ACKNOWLEDGMENTS I would like to acknowledge Dr. Ann Progulske-Fox and thank her especially for her guidance and support in my research and writing. I would also like to thank the other members of my committee, Dr. Myriam Belanger and Dr. Gr egory Schultz, for their time, patience and guidance. The members of the APF lab have made it pos sible for me to complete my Masters degree. Joan Whitlock, Amanda Barrett, and Dr. Ni cole Grieshaber have given me much needed support and friendship. I am indebted to Dr. Myriam Belanger, Jacob Burks and Dr. Paulo Rodrigues, for all their help with techniques, protocols and with keeping my sanity during difficult times. I would also like to thank De bbie Akin and Dr. William Dunn for their much needed input, and help with microscopy pictur es and western blots. I would like to show gratitude to Dr. Scott Grieshab er for his assistance on the Co nfocal Microscope, Dr. Steeve Giguere for aiding me with statistical analys is and Kim Kenneth of the Scanning Electron Microscopy Core Laboratory of the Interdiscip linary Center for Biotechnology Research for processing my samples. I would also like to show my appreciation to th e Center for Molecular Microbiology and the NIH grant DE 13545 for providing funding for my project. On a personal note, I would lik e to thank my parents and brot her for all they have done for me and for the support they have provided for me during my school career. I am also grateful for my boyfriend, Joel Tomko, for his understanding, pa tience and love. I have been truly blessed with a caring and loving family. 4

PAGE 5

TABLE OF CONTENTS page ACKNOWLEDGMENTS...............................................................................................................4 LIST OF TABLES................................................................................................................. ..........7 LIST OF FIGURES.........................................................................................................................8 ABSTRACT...................................................................................................................................10 CHAPTER 1 INTRODUCTION................................................................................................................. .11 Porphyromonas gingivalis ......................................................................................................13 Biofilms...........................................................................................................................14 Fimbriae....................................................................................................................... ....16 Hemagglutinins/ Hemolysis............................................................................................17 Gingipains........................................................................................................................18 Adhesion, Invasion and Persistence................................................................................20 2 INVASION AND PERSISTENCE STUDIES.......................................................................24 Introduction................................................................................................................... ..........24 Material and Methods.............................................................................................................25 Bacterial Strains and Growth Conditions........................................................................25 Mutant Construction........................................................................................................26 Growth Curves.................................................................................................................26 Cell Culture................................................................................................................... ..27 Adhesion Assays.............................................................................................................27 Invasion Assay.................................................................................................................28 Results.....................................................................................................................................28 Growth Curve..................................................................................................................28 Adherence........................................................................................................................28 Invasion...........................................................................................................................29 Persistence.......................................................................................................................29 Discussion...............................................................................................................................30 3 BIOFILM...................................................................................................................... ..........39 Introduction................................................................................................................... ..........39 Material and Methods.............................................................................................................40 Bacterial Strains and Growth Conditions........................................................................40 Mutant Construction........................................................................................................40 Homotypic Biofilm..........................................................................................................40 Flourescently labeling Porphyromonas gingivalis for Homotypic Biofilm....................41 5

PAGE 6

Heterotypic Biofilm (P. gingivalis and F. nucleatum 22586).........................................42 Results.....................................................................................................................................43 Homotypic Biofilm..........................................................................................................43 Heterotypic Biofilm.........................................................................................................44 Discussion...............................................................................................................................44 4 VIRULENCE FACT ORS AND ENVIRONMENTAL SIGNALS.......................................55 Introduction................................................................................................................... ..........55 Material and Methods.............................................................................................................56 Bacterial Strains and Growth Conditions........................................................................56 Mutant Construction........................................................................................................56 Fimbriae Negative Staining for Electron Microscopy.....................................................56 Hemagglutination Assay.................................................................................................57 Results.....................................................................................................................................57 Fimbriae....................................................................................................................... ....57 Hemagglutination............................................................................................................58 Adherence Assay.............................................................................................................58 Biofilm.............................................................................................................................59 Discussion...............................................................................................................................60 5 DISCUSSION................................................................................................................... ......71 Gene PG0092 (Putativ e ABC Transporter)............................................................................73 Gene PG1683 (Putative Glycosyl Hydrolase/Alpha Amylase)..............................................74 Further Directions............................................................................................................. ......75 REFERENCES..............................................................................................................................77 BIOGRAPHICAL SKETCH.........................................................................................................88 6

PAGE 7

LIST OF TABLES Table page 2-1 Primers used for mutant construction in P. gingivalis W83. Genes were mutated by double crossover allelic exchange.....................................................................................33 3-1 Chi square analysis values of biofilm peaks >120 in intensity for P. gingivalis wildtype W83 strain and mutant W83 0092 at 24 and 48 hours.............................................50 3-2 Chi square analysis values of biofilm peaks >120 in intensity for P. gingivalis wildtype W83 strain and mutant W83 1683 at 24 and 48 hours.............................................50 4-1 Phenotype summary. Summary of re sults of mutants and wild type.................................70 7

PAGE 8

LIST OF FIGURES Figure page 2-1 Bioinformatic analysis of the putative operon for P. gingivalis genes PG0091, PG0092, PG0093, and PG0094.........................................................................................34 2-2 Bioinformatic analysis of the putative operon for P. gingivalis genes PG1681, PG1682, PG1683, and PG1684.........................................................................................34 2-3 Growth curve of P. gingivalis strains W83, W83 0092 and W83 1683 in sTSB media..................................................................................................................................34 2-4 Adherence of P. gingivalis to HCAEC of strain W83 and W83 0092 in the presence of Cytochalasin D..............................................................................................................35 2-5 Adherence of P. gingivalis to HCAEC of strain W83 and W83 1683 in the presence of Cytochalasin D..............................................................................................................36 2-6 Invasion and Persistence of HCAEC for P. gingivalis W83 and W83 0092 in sTSB media. ................................................................................................................................37 2-7 Invasion and Persistence of HCAEC by P. gingivalis W83 and W83 1683 in sTSB media..................................................................................................................................38 3-1 Microtiter plate monosp ecies biofilm production by P. gingivalis W83 and W83 0092 in sTSB media.................................................................................................47 3-2 Microtiter plate monosp ecies biofilm production by P. gingivalis W83 and W83 1683 in sTSB media.................................................................................................48 3-3 Confocal micrographs of m onospecies biofilm production of P. gingivalis W83 and W83 0092 at 24 and 48 h in sTSB....................................................................................49 3-4 Confocal micrographs of m onospecies biofilm production of P. gingivalis W83 and W83 1683 at 24 and 48 h in sTSB media.........................................................................51 3-5 Scanning electron micrographs of monospecies biofilm production of P. gingivalis mutants and wild type at 24 and 48 h in sTSB media........................................................52 3-6 Mixed species biofilms of P. gingivalis W83, W83 0092 and F. nucleatum 22586 in sTSB media........................................................................................................................53 3-7 Mixed species biofilms of P. gingivalis W83, W83 1683 and F. nucleatum 22586 in sTSB media........................................................................................................................54 4-1 Electron micrograph of negative stains of P. gingivalis strains W83 and W83 0092 in sTSB and sBHI media....................................................................................................63 8

PAGE 9

4-2. Electron micrograph of negative stains of P. gingivalis strains W83 and W83 1683 in sTSB and sBHI media. I................................................................................................64 4-3 Hemagglutination of P. gingivalis wild-type W83, W83 0092 and W83 1683 when grown in sTSB media.........................................................................................................65 4-4 Hemagglutination of P. gingivalis wild-type W83, W83 0092 and W83 1683 when grown in sBHI media.........................................................................................................65 4-5 Adherence to HCAEC for P. gingivalis W83 and W83 0092 in sBHI media.................66 4-6 Adherence to HCAEC by P. gingivalis W83 and W83 1683 in sBHI media..................67 4-7 Adherence of P. gingivalis W83 to HCAEC, previously grown in sTSB and sBHI media..................................................................................................................................68 4-8 Microtiter plate homotypic biofilm production by P. gingivalis W83 and W83 1683 in sBHI media.................................................................................................................. ..68 4-9 Microtiter plate hom otypic biofilm production by P. gingivalis W83 and W83 0092 in sBHI media.................................................................................................................. ..69 4-10 Microtiter plate monosp ecies biofilm production by P. gingivalis W83 in sTSB and sBHI media..................................................................................................................... ...69 9

PAGE 10

10 Abstract of Thesis Presen ted to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science CHARACTERIZATION OF MUTANTS OF THE PORPHYROMONAS GINGIVALIS STRAIN W83 By Jennifer Nina Rainho August 2009 Chair: Ann Progulske-Fox Major: Medical Sciences Periodontal disease is the sec ond most common infectious disease, affecting 50 to 90% of adults world wide. Porphyromonas gingivalis is an important etiologic agent in the development of periodontal disease and may be involved in car diovascular disease as well. The objective of this study was to characterize two genes of P. gingivalis : encoding a putative ABC transporter PG0092 and encoding PG1683 a putative glycosyl hydrolase/alpha amylase, both of which in previous studies were found to be up-regulated during host cell inva sion. Previously, double crossover mutants of these genes were constructe d in strain W83. For this study, mutant strains were tested in assays of adherence, invasi on and persistence using human coronary artery endothelial cells, for biofilm development, hema gglutination and the pres ence of fimbriae in order to begin to characterize the roles of these genes during P. gingivalis infection. The effect of growth conditions on phenotype a nd gene expression was found to be critical to this analysis. These studies have provided additional inform ation regarding the role of these genes in P. gingivalis pathogenesis.

PAGE 11

CHAPTER 1 INTRODUCTION Periodontal disease is the second most common infectious disease of humans, affecting 50 to 90% of adults worldwide and causing pathol ogical changes to the su pporting tissu es of the teeth (1). Periodontal disease is a group of diseases that varies in severity, from mild and reversible inflammation of the gum (gingiva) to chronic damage of the periodontal tissues which include the gingival soft tissues, periodontal ligament, and alveolar bone. The most severe cases result in eventual exfoliation of the affected teeth (2). Th e initiation and progression of the disease is associated with the presence of a variety of organism s, making its bacterial etiology complex. In fact many of the pathogenic bacteria are present in individuals th at are periodontally healthy and can exist with the host in collective harmony (2). As the ecological balance between bacterial and host factors shift, the result is a change in the quantity of specific organisms, alteration in gene expression a nd pathogenicity, and alteration of particular host factors (2). There is a shift from predominantly gram positive b acteria in a state of health to predominantely gram negatives in diseased conditions. Aggregatibacter actinomycetemcomitans Porphyromonas gingivalis and Tannerella forsythia are among the Gram negative microorganisms that are considered significan t etiologic agents of periodontitis (3). P. gingivalis Treponema denticola, and T. forsythia are a group of organisms fre quently found together in the subgingival plaque and are members of the red complex, and have been strongly linked to advanced periodontal lesions (4). The members of the red comp lex, which are all Gram negative anaerobic bacteria, promote an immunodestructive host response l eading to disease (5). These bacteria express a number of virulence factors, allowing the bacteria to colonize sites in the subgingiva, leading to disruption of the host defense system and invasion and destruction of the 11

PAGE 12

periodontal tissues (5). It is this host immune response to the bacterial challenge that is the primary etiologic factor of periodontitis (5). Numerous groups have reported associations between poor de ntal health and coronary heart disease, particularly atherosclerosis. For example, studies by Mattila have shown an association between cardiovascular disease (C VD) and periodontal disease, demonstrated a significant association between dent al infections and severe corona ry atheroma and reported that subjects with periodontitis were found to have a 25% increased risk of coronary heart disease (CHD) compared to those with minimal periodontal disease (6). There is also experimental evidence proving an epidemiological link betwee n periodontal disease and atherosclerosis, including an asso ciation between P. gingivalis and atherosclerosis in humans (7-10). For example, genomic DNA of pe riodontal pathogens including P. gingivalis DNA, has been identified in atheromatous plaques (11). Animal studies have also prove n that a relationship exists since oral infection with P. gingivalis accelerates early atherosc lerosis in apolipoprotein Edeficient ( apo -E) mice (12-14). Furthermore, a more extensive accumulation of lipids in the aortas of rabbits in which periodontitis had been induced was f ound than in periodontally healthy rabbits (15). Additionally, intravenous injection of P. gingivalis in pigs lead to coronary disease and atherogenesis (16). Others in the Progulske-Fox laborator y have also been able to show that human atherosclerotic plaque contains live P. gingivalis and A. actinomycetemcomitans which, can in fact, adhere to and invade endothelial ce lls (17, 18). Recently, a stu dy by Amar et al., with apo-E mice, has concluded that the presence and invasion of Porphyromonas gingivalis is critical to the progression of atherosclerosis (19). Atheroma development and thromboembolic phe nomena in cardiovascular diseases are thought to progress with systemic exposure to in flammatory mediators of periodontal origin (20, 12

PAGE 13

21). These localized cytokines that are produced in response to pe riodontal infections can cause a systemic effect (20). The cytokines that are involve d in artherosclerosis in vascular cells include IL-6, VCAM-1, MCP-1, IL-1, TNF-alpha, and IL-8 ( 22). Most often bacteria entry into host cells elicits cytokine production includin g IL-1B, IL-6 and IL-8, which in turn will attract phagocytes to this area (23). Since periodontal disease is also an inflammatory condition, periodontal infections may contribute to the progressi on of atherosclerosis simply by increasing inflammation (19). Invasion of cor onary artery cells by periodontal bacterial species may initiate and/or aggravate an inflammatory response associated with atherosclerosis. In the gingival crevice, oral microorganisms cross the inflamed gingival barrier and enter the circulatory system (24). Therefore, in teractions between P. gingivalis and the endothelial laye r of the arteries may have a significant effect on the pr ogression of atherosclerosis. Thus P. gingivalis can gain access to the vasculature and interact directly with th e endothelial layer, by adhering to and invading the endothelial cells. This adherenc e/invasion then likely triggers signal transduction pathways, leading to an amplified inflammatory response and atheroma formation. Porphyromonas gingivalis Porphyromonas gingivalis ( formerly Bacteroides gingivalis ) is an obligately anaerobic, nonmotile, non-spore-forming, gram-negative bacteriu m that requires hemin as an iron source. It is a rod shaped organism that is asaccharolytic and acquires its source of energy and carbon from small peptides. It is believed that Porphyromonas gingivalis initially colonizes the mouth and is transmitted via infected individuals. It coloni zes by attaching to available surfaces including components found in saliva that form a pellicle on oral surfaces or to other plaque bacteria. For example, it co-aggregates with some oral streptococci, Actinomyces naeslundii and other late colonizers such as Fusobacterium nucleatum Treponema denticola and Tannerella forsythia 13

PAGE 14

(25-30). This co-aggregation likely not only promotes colonization but also nutritional interrelationships and intercellular signaling mechanisms (31). P. gingivalis produces several virulen ce factors as protection from host defenses allowing the bacteria to survive and thrive in the hos t. These virulence factors include a capsule, lipopolysaccharide, fimbriae, outer membrane protei ns, such as hemagglutinins, outer membrane vesicles and a variety of enzymes including the Rgp and Kgp gingipains (23). Fimbriae are important for adherence to bacterial cells and receptors (see Fimbriae section). Hemagglutinins are proteins that serve as adhesi ns but also may allow for the att achment to erythrocytes that can be lysed to provide iron for nutrition and growth (see Hemagg lutinins/Hemolysis section). Gingipain proteases have been shown to be im portant for adherence to the host cell and other bacteria in the host environment and cleave polype ptides at arginine and lysine residues. The gingipains also help support the growth of P. gingivalis in vivo inhibit host defense mechanisms and are involved in direct tissue destruction (23) (see Gingipains sect ion). The functional and genetic determinants of these virulence factors are inevitably linked and allow for the invasive potential and subsequent overgrowth of P. gingivalis resulting in disease activity (2). Biofilms Dental plaque is a biofilm of a complex organization of bacteria that develops in the oral cavity. Saliva coats the surfaces of target tissues and the pr imary colonizers, which are predominantly gram positive species, express biochemical components that allow for their attachment to many host derived molecules on this salivary pellicle (26, 32, 33). When the biofilm is not consistently removed, the biofilm thickens and gram negative bacteria, often containing components that allow them to adhere to early colonizers, begin to colonize the gingival area. This colonization of many bacteria leads to inflammation and the destruction of 14

PAGE 15

host tissues supporting the teeth and can lead to the pathogenesis and th e chronic disease known as periodontal disease (34). Biofilm formation occurs in a se ries of steps. First, the primary colonizers must adhere to a surface, which brings about the alteration of their gene expression, allowing them to adjust to the environment of the surface to which they have attached (35). Assuming the environment is beneficial for growth, the bacteria will continue to grow on this surf ace, recruiting additional bacteria, eventually developing into an establishe d biofilm encased in a matrix (35). Ultimately, the cycle is completed with the detachment of b acteria, which then disseminate and colonize new surfaces (35). The biofilm formation process is complex and requires the expression and coordinated regulation of many ge nes (35). Specific bacterial sp ecies will clump together when forming a biofilm, allowing for acquisition of nutrients, protection from mediators of host immunity and possibly exchange of genetic information (36). P. gingivalis can adhere to the salivary pellicle bu t colonization in the oral plaque is delayed until the oxygen tension is re duced by predecessor organisms (37). P. gingivalis has been shown to autoaggregate and form homotypic biofilms. It has also been shown to colonize with oral streptococci, for example S. gordonii, and A. naeslundii and form in vitro biofilms (37). The highly proteolytic properties of gingivalis allow this bacterium to colonize the subgingival plaque area and allow fo r other bacteria, which lack th is capability, to co-localize with P. gingivalis and to benefit from the significant extracellular hydrolytic activity (33, 38). It frequently coexists with other bacteria associated with periodontal disease, such as F. nucleatum, Prevotella intermedia Treponema denticola and Tannerella forsythia (33, 39-42). P. gingivalis is vulnerable to pH levels lower than 6.5 and is sensitive to oxygen. In terestingly, it has been shown that P. gingivalis can grow in the presence of incr eased oxygen levels, as high as 20% O2, 15

PAGE 16

when co-cultured with Fusobacterium nucleatum (43). Studies have also shown that F. nucleatum can maintain an optimum pH and satisfy the CO2 requirement for P. gingivalis growth and when co-infected can lead to increased expression of viru lence factors and subsequent infection (43). Thus beyond s upporting adherence and aiding in bacterial progression, coaggregation may present additional bene fits to species that interact. Fimbriae The initial step in bacteria colonization is adherence. For most bacteria, fimbriae, proteinaceous hair-like projections from the su rface of bacteria, mediate specific adhesion to surfaces (44-47). The major fimbriae of P. gingivalis interact with salivary receptors for P. gingivalis including proline-rich proteins, glycopro teins, and statherin (2, 37). P gingivalis has been shown to express more than one type of fimbriae; the major fimbriae (FimA), the minor fimbriae (mFa1) which are 67kDa in size and Pg-II which are 72kDa (48, 49). Depending on the strain, FimA fimbriae vary in size, between 41 and 49kDa proteins, are 3 to 5nm wide and 0.3 to 3.0um long (2, 50). However, not all strains of P. gingivalis express FimA (51). FimA facilitates the adhesion and invasion of or al epithelial cells and are ex pressed in both noninvasive and invasive strains (51, 52). The minor fimbriae are involved in the development of micro-colonies and P gingivalis biofilm maturation (53). P. gingivalis fimbriae may represent unique classes of gram-negative fimbriae, since there are no homologi es to fimbrial proteins of other bacteria, when comparing protein se quences (16). Fimbriae of P. gingivalis, can facilitate adherence to a range of oral substrates and molecules. FimA is the major structural component of P. gingivalis major fimbriae, but it is now known that additional proteins ar e part of the fimbrial structure and are encoded by genes directly downstream of FimA (54-56). The acces sory proteins, including FimC, FimD, and FimE, with molecular masses of 50, 80 and 60 kDa, respectively, contribute considerably to P. 16

PAGE 17

gingivalis virulence but yet only comprise of 1% of the fimbrial prot ein (54, 55). Studies in the mouse periodontitis model have shown a dramatical loss in virulence in P. gingivalis mutants that express fim A but are devoid of these acc essory proteins (54). Fimbriae and gingipains have been shown to act together in regulating P. gingivalis biofilm development (57). Specifically, a mutant de ficient in FimA was able to initiate biofilm formation but was unable to form a mature biofilm (57). In this same study, the role of Mfa was found to be suppressive in the regulation of bi ofilm development. (57). The relationship of biofilm development and fimbriae remain unclear. For example, long fimbriae have been shown to suppress autoaggregation where small fimbriae have been shown to enhance it (57). In a second study, mutation of long fimb riae showed negligible autoaggr egation and a mutant devoid of short fimbriae showed enhanced autoaggregation (58). Therefore, additiona l studies need to be done to fully understand the role of fimbriae in biofilm development. Hemagglutinins/ Hemolysis Hemagglutinin proteins are expressed by a number of bacterial species and are known virulence factors. P. gingivalis is reported to express at l east five hemagglutinins that aid microbial binding to erythroc ytes and host cells (2, 20). Hemagglutination genes in P.gingivalis include hag A, hag B, hag C, hag D, and hag E, which have all been cloned and sequenced (5963). There are significant homologies among some of the hemagglutinins including Hag A and Hag D, 73.8% homology; Hag A and Hag E, 93% homology; and Hag B and Hag C, 98% homology (20, 61). Hag B induces proinflammatory cytoki ne responses in several rodent models, and is involved in P. gingivalis adherence to HCAEC, but is not sufficient for invasion into host cells (20, 64). P. gingivalis hemagglutinin activities may be complexed with lipopolysaccharide (LPS)(65), lipid s on the cell surface (65) or released as 40-kDa activity designated as exhemagglutinin (2, 66). So me of the hemagglutinins, specifically Hag A, Hag D 17

PAGE 18

and Hag E, have significant sequen ce homology to the gingipains, and associations have been found between hemagglutinating and pr oteolytic activities (20, 67-71). The P. gingivalis gingipains, as well as several other adhesion proteins, are complexed together to form a hemagglutination complex, all of which are tr anscribed from the same gene. Both the 50-kDa Arg-gingipain molecule and 60-kDa Lys-gingipa in molecule are complexed with a 44-kDa hemagglutinin (72). It has also been suggested that fimbriae must be complexed to HA-Ag2 for full hemagglutination expression (73). The P. gingivalis hemagglutinins, along with the hemolysins and other enzymatic activities may promote colonization by ai ding in the acquisition of hemin or iron (74, 75). The ability of pathogens to grow in a partic ular niche requires th e ability to acquire nutrients in that niche. Iron has a crucial role in the establishment and progression of an infection (76). An abundance of iron can be found intra-cellularly in the form of hemoglobin, ferritin or heme proteins. Thus many pathogens that occupy intracellular niches can utilize heme directly (23). P. gingivalis similarly has developed mechanisms that allow for the capture of iron and hemin, which are required for its growth (23). P. gingivalis is able to utiliz e a broad range of hemin containing compounds and is capable of storing hemin-containing compounds on its cell surface, giving P. gingivalis its black pigment (23). This li kely allows the survival of P. gingivalis in a healthy periodontal pocket, which has limited iron concentrations. Gingipains P. gingivalis contains many hydrolytic, proteolytic and lipolytic enzymes that play significant roles in its virulence (23). The proteinases, especially the cysteine proteinases that cleave polypeptides at arginine and lysine resi dues have been given the most attention (23). These Argand Lys-proteinases are referred to as gingipains. Proteinases are important for adherence to the host cell and to other bacteria in the host environment, they help support the 18

PAGE 19

growth of P. gingivalis in vivo inhibit host defense mechanisms and are likely involved in direct tissue destruction (23). Proteases can be post-translationally pr ocessed for secretion into the extracellular milieu or locali zed to the cell surface (57). In vivo experiments indicate that P. gingivalis proteinases are functionally important since the species is asachrolytic and expresses an elaborate proteolytic system that serves to pr ovide nutrients in the form of small peptides and amino acids, leading to tissue destruction (77). In P. gingivalis there are at least three different gene s that encode two cysteine arginine gingipains, rgp A and rgpB, and a lysine gingipain, kgp (23). The polyproteins that encompass proteinases, Rgp and Kgp, are pr oteolytically processe d and contain C-terminal adhesion domain (78). Specifically, rgpA and kgp contain separate adhesion/hem agglutinin domains that are catalytic and are non covalent comp lexes. The proteolytic activity of Kgp is vital in hydrolyzing the hemoglobin protein rapidly and therefore th e RgpA-Kgp complexes may play a role in the disruption of vascular cells and binding and quick degradation of hemoglobin for P. gingivalis heme assimiliation (78, 79). RgpB is also a protei nase on the cell surface that is very similar to that of RgpA, however it lacks th e C-terminal adhesion binding mo tif that is found in the RgpA and Kgp catalytic domains (80). Gingipains play a role in a variety of importa nt functions, such as maturation of fimbriae, host protein amino acid uptake, bacterial housek eeping functions, development and infection (81). For example, studies have shown that the RgpA-Kgp proteinase -adhesion complexes are involved in colonization of P. gingivalis by binding to crevicular ep ithelial cells and binding to other bacteria in the subgingival plaque, through the adhesi on domains A1 and A3 (78, 82). Sustained colonization of P. gingivalis is facilitated by the degradation of macrophage CD14 by gingipains, which inhibits ac tivation of the leuko cytes through the li popolysaccharide (LPS) 19

PAGE 20

receptor (81). Additionally, studies conclude that P. gingivalis, specifically HRgpA, a product of rgpA and RgpB, have the ability to activate the ka llikrein/kinin pathway which induces vascular permeability and in turn activates the blood coagulat ion system (83-86). Theoretically this can be linked with the production of gingival crevic ular fluid, which provi de nutrients, and inflammation progression in the periodontitis site, leading to alveolar bone loss (78). Gingipains are also involved in the bleedi ng tendency at sites of periodon titis, even though the 3 gingipains degrade fibrinogen/fibrin. Kgp is the most potent enzyme in this regard (87). A recent study has also shown that gingipains are important in bi ofilm formation, Kgp in suppression and regulation of biofilm development, whereas Rgp affects morphology and biofilm volume (57). Furthermore, indications that polyphenolic inhibitors of gingipains can prevent both homotypic ( P. gingivalis ) and heterotypic ( P. gingivalis and F. nucleatum ) biofilm formation, have been reported (88). In addition, a P. gingivalis mutant lacking Rgp lost the abilit y to form synergistic biofilms with Treponema denticola (89). However, more studies must be completed in order to better understand the roles of gingipa ins in biofilm development. Adhesion, Invasion and Persistence P. gingivalis has a variety of virulence factors whic h contribute to its pathogenesis and aid in its colonization, modulation of the host im mune system and nutrient acquisition in the periodontal site. Colonization is an important step in pathogen ecity and can be facilitated by adhesions, invasions and cell si gnaling effecting molecules. Adhesion molecules, such as fimbriae and hemagglutinins, allow bacteria to inte ract with host cells as well as other bacteria. Adherence can also be promoted by gingipains and its hemagglutinins domains, aid in maturation of fimbriae and exposure of cryptic epitopes (23, 90, 91). Proteases can destroy tissues during the progression of disease and allow for spreading of P. gingivalis into deeper tissues (23). Factors expressed by P. gingivalis shield the bacteria from clearance by the immune 20

PAGE 21

system. Once in the host, P. gingivalis can acquire nutrients with the help of proteases, hemagglutinins and hemolysins (23, 83, 92, 93). Given these complex molecular mechanisms P. gingivalis is an interesting microorgani sm to study. An important tool to study its virulence is the analysis of site-directed mutants. In order to find an appropriate niche for col onization invading bacteria must breach the outer barrier of the host, avoid continuous host cell fluid movement and cilia action. Adherence is the key step that allows for the initial colonization and subsequent ability of the microorganisms to be internalized by nonphagocytic cells. Bacterial pathogens adhere to eukaryotic surfaces through adhesins and interact with receptors on the ce lls surfaces. Bacterial components that function as adhesins incl ude fimbriae, flagella, lipopolysaccharides, polysaccharides, capsules, micro-vesicles and outer membrane proteins such as hemagglutinins (23, 94). Bacteria can avoid the immune system by invading host cells and persis ting in these cells. Several bacterial pathogens including Brucella abortus, enteropathogenic E. coli (EPEC), Listeria monocytogenes Salmonella spp., Shigella flexneri and Yersinia spp invade nonphagocytic cells (95-97). These bacteria are inte rnalized into host cell s via a ligand-receptor interaction which activates host cell signals to direct the entry of the bacteria. The signals induce cytoskeletal rearrangements which then facilitate s bacterial internalizati on. It has been shown that internalization can be prevented for ma ny species of pathogenic bacteria by an actin polymerization inhibitor, Cytochalasin D (96-100) Once the bacteria have invaded they can be free in the cytoplasm of enclosed in phagocyt ic vacuoles. Some pathogens, for example, S. flexneri and A. actinomycetemcomitans have been shown to evade these vacuoles, where as Salmonella spp. and Yersinia spp, remain in the vacuoles (101-103). 21

PAGE 22

P. gingivalis has been reported to invade multiple cell types including macrophages (9), bovine aortic endothelial cells (BAEC), fetal bov ine heart endothelial cells (FBHEC), human umbilical vein endothelial cells (HUVEC) (104), dendritic cells (105 ), and KB cells (51). Our lab has reported the invasion of HCAEC and co ronary artery smooth muscle cells by P. gingivalis (18). The results show that invasion is strain sp ecific with some strains being highly invasive, while others are not i nvasive at all (106). Even though Porphyromonas gingivalis gains access to the circulatory system and has been proven to invade HCAEC, the mechanism by which P. gingivalis invasion affects the expression of molecules and cyt okines involved in atherosclero sis is unknown (23). Previous researchers in the Progulske-Fox la boratory have established that P. gingivalis adheres to the cell surface of HCAEC within the firs t 15 minutes of co-culture. P. gingivalis is then internalized via lipid rafts and incorporated in to an early phagosome. The early phagosome then fuses with a double membrane-membrane bound early autophagos ome derived from the rough endoplasmic reticulum. However, when this autophagosome is suppressed by wortmannin, P. gingivalis instead transmits to a late phagosome and phagolys osome where the bacteria are degraded. Thus, the survival of P. gingivalis in HCAEC depends upon infection and the activation of autophagy in HCAEC. The bacteria is sorted to a vacuole that is similar to an autophagosome. However, P. gingivalis prevents maturation of the autophagosom e into an autolysosome. Therefore, P. gingivalis may remain in a replicating vacuole which has characterisitics similar to late autophagosomes, but in which the bacteria replicate and persist for many hours. Thus P.gingivalis enters an endothelial cell, it traffics through the autophagi c vacuole and is able to prevent the final degradative steps, thereby estab lishing itself in a niche where it can survive and 22

PAGE 23

23 replicate. In the first 24 hours of co-culture P.gingivalis promotes the survival of its endothelial host cell and does not induce apoptosis.

PAGE 24

CHAPTER 2 INVASION AND PERSISTENCE STUDIES Introduction A microorganisms ability to invade and pe rsist within host tissues can provide an intracellular niche that allows for access to nutrients and ev asion of the hosts immune mechanisms. P. gingivalis can invade HCAEC as well as many other cells types, as described earlier (18). P. gingivalis expresses multiple adhesins, both fimbrial and non fimbrial, to attach to host cells. Examples of these are specifically FimA (fimbrial) and HagB (nonfimbrial) (51, 52, 64, 107-109). However, the initial steps of internalization for P. gingivalis especially with regard to HCAEC, are not well under stood. Some evidence has shown that P. gingivalis interacts with lipid rafts which can provide a portal for entry in to host eukaryotic cells, but our knowledge is limited of the role of lipid ra fts in bacterial invasion (109). Once P. gingivalis is inside the endothelial cell, it traffics to the autophagic pathway. P. gingivalis induces and suppresses death in these cells, allowing for a microenvironment favorable for its replication (109). Once P. gingivalis leaves the oral cavity and enters the ci rculatory system, it likely invades HCAEC, thereby evading systemic immune defenses also inducing an inflammatory response (20). Thus P. gingivalis may allow for the acceleration of at heroma formation by triggering signal transduction pathways, leading to an amplified inflammatory response and foam cell formation (10). The purpose of this study was to investigate how P. gingivalis mutants W83 0092 and W83 1683 interact with HCAEC as a model system fo r the endothelial layer of the vasculature. This is the layer that lines the lumen of the circul atory vessels and is the s ite of the initiation of artherosclerosis. Prior to this study, microarray analysis of P. gingivalis W83 genes expressed during invasion of HCAEC were completed (110). A group of genes that were determined to be 24

PAGE 25

up-regulated at different time poi nts during invasion were mutate d by allelic replacement (9). Two of these mutants were chosen fo r this study. The first mutant is 0092, is a putative ABC transporter with 77% homology to a Bacteroides fragilis (putative) ABC transporter gene (Figure 2-1). Dr. Liu in the Department of Bioinformatics at the University of Florida predicted that it was in an operon with PG0091, PG0093 and PG0094. PG0091 and PG0092, are putative ABC transporters (transport and binding proteins, substrate unknown), PG0093 is a HlYD family secretion protein (transport and binding protein), and PG0094 is a putative outer membrane efflux protein (transport and bindi ng proteins, unknown substrate). The second mutant chosen for this study is 1683, a putative glycosyl hydrolase / alpha amylase with 78% homology to a Parabacteroides distasonis gene. Dr. Liu predicted that this gene was in an operon with PG1681, PG1682, PG1684 (Figure 2-3). PG1681 is predicted to be a glycogen debranching enzyme and to play a role in energy metabolism (biosynthesi s and degradation of polysaccharides), PG1682 is predicted to be a glycosyl tran sferase that plays a role in th e cell envelope (biosynthesis and degradation of surface polysaccharides and lipop olysaccharides), and PG1684 is a hypothetical protein. The following experiments were perform ed to investigate the role of P. gingivalis genes PG1683 and PG0092 in adherence to and invasion of HCAEC. HCAEC were chosen because of their significance in atherosclerosis. Material and Methods Bacterial Strains and Growth Conditions Strain W83 (the type strain) was isolat ed during the 1950s from an undocumented oral human infection by H. Werner (111). This strain and mutants (see below) were stored as at 80C. For broth culture, the bact eria were grown in tryptic soy broth (sTSB), supplemented with vitamin K1, hemin, yeast extract and L-cysteine hydrochloride. P. gingivalis strains were also 25

PAGE 26

maintained on blood agar plates (s BAP), supplemented with vitamin K1, hemin, yeast extract and L-cysteine hydrochloride, as previously described (112). In all cases P. gingivalis strains were cultured in a Coy anaerobic chamber (Ann Arbor MI) with an atmosphere of 10% H, 5% CO2, and 85% N2. Mutant Construction The mutant strains used in this study we re constructed by Dr. Paulo Rodrigues. For reference purposes the following is a br ief description of their construction. P. gingivalis W83 1683 and W83 0092 were constructed as double cross over mutants by allelic replacement using an erythromycin cassette as described previously (112). Briefly, the upstream and downstream regions of the PG1683 gene were am plified by PCR with gene-specific primers (Insert A, FW 5 CTGGCTGCCCGACACAAGATAG 3 and RV 5 GCGCAGCACTACCGGTTTTACAC 3; Insert B, FW 5 CTCCGCAATCCATGGCTGAG 3 and RV 5 GTTTCGATCGGGCTGAAGTTGC 3). The upstream and downstream regions of the PG0092 gene were amplified by PCR with gene-specific primers (Insert A, FW PG0092 5CATGGTCGACGGGAAGAAGAGA 3and RV 5 GCCAACGCGTCGCAAAAAG 3; Insert B, FW 5 TTCCTGCCGGTA TTGAGATGTT 3 and RV 5 ACGGCCGGTACCAGTATGTCCA 3). The PCR amp licons were cloned into the suicide vector pPR-UF1. This vector was developed in this laboratory by Dr. Paulo Rodrigues (110). Growth Curves The growth rate of P. gingivalis wild type W83 and mutants W83 1683 and W83 0092 were determined. Overnight cultures in sTSB we re used to inoculate 100 ml of sTSB at an OD550 of 0.1, in triplicate. Every two hours 1.0 ml of culture was taken for optical density measurements at 550nm. Experiments were completed in triplicate. 26

PAGE 27

Cell Culture Human coronary artery endothelial cells (HCAEC) (Lonza,Walk erville, MD) were maintained in minimum essential medium (Lonza) supplemented with fetal bovine serum with EGM-2-MV singlequots (Lonza), a ccording to the suppliers inst ructions with the following: FBA, hydrocortisone, hFGF, VEGF, R3-IGF-1, ascorbic acid, hEGF and heparin. Cells were cultured in 75-cm2 flasks (Starstest, Newton, NC) at 37C in a humidified atmosphere of 5% CO2. Confluent monolayers were split by treatment with Hanks Balanced Salt Solution (HBSS) (Mediatech, Manassas, VA) and trypsin-versene (BioWhittaker, Walkersville, MD). The cells were obtained from the company at passage 3 an d they were not passaged more than 3 other times in our laboratory. Adhesion Assays HCAEC were seeded at 1x105/well into 24-well cell culture plates (Costar, Corning, NY) and grown overnight to confluence. The cells were then incubated with 5 ug/ml Cytochalasin D (Sigma-Aldrich, St. Louis, MO) for 30 minutes, followed by the addition of anaerobically grown cultures of P. gingivalis at a concentration of 1x107 CFU/ml and 5 ug/ml Cytochalasin D in EBM-2 antibiotic free cell culture medium. Th e bacterial culture was also plated for determination of the colony forming unit (CFU) for standardiza tion. The 24-well plate (Costar) was then incubated without agitation at 37C/5%CO2 for 1 hr. The cells were washed three times with warm EBM-2 media containing 5% feta l bovine serum (EGM-FBS), and then lysed (pipeting up and down) with warm sterile water fo r 20 minutes in a 37C incubator. Cell lysates were serially diluted and adhere nt bacteria were pl ated on sBAP for enumeration. All individual cell culture experiments were performed in qui ntuplicate wells, and each experiment was completed twice. 27

PAGE 28

Invasion Assay Approximately 105 HCAEC were seeded in 24 well tissue culture plates (Costar) and washed three times with antibiotic free EBM-2 media. An overnight culture 1x107 CFU/ml of P. gingivalis was re-suspended in fresh warmed antibiotic-free EBM-2 media and 1.0 ml was added to HCAEC for a 1.5 h infection period at 37C in the 5% CO2 incubator. The bacteria suspension was then removed and the cells were subse quently washed with warmed EBM-2 media. Extracellular bacteria were ki lled by adding 1.0 ml of warm ed EBM-2 containing 300ug/ml Gentamycin (Sigma-Aldrich) and 200ug/ml Metroni dazole (Sigma-Aldrich) with incubation for 1 hour at 37C in the 5% CO2 incubator. The medium was rem oved and the cells washed three times with EBM-2. Cells were lysed af ter a 20 minute incubation at 37C/5% CO2 with distilled sterile water and the lysate was plated on sBAP for enumeration of the intracellular bacteria (2.5 h invasion time point). For additi onal time points, cells were incubated with fresh antibiotic free EBM-2 and at 6, 24, and 48 h of infection. All plates were incubated at 37C in an anaerobic chamber and colonies were grown for up to 10 days before enumera tion. Individual invasion assays were performed in quintupl icate wells and completed twice. Results Growth Curve The growth rate of P. gingivalis wild-type strain W83, W83 0092 and W83 1683 were determined every two hours, using a growth curve assay (Figure 2-3). The growth curves did not reveal a difference in in vitro growth as a result of the mutations. Adherence The adherence of P. gingivalis strain W83 and the two mutant strains to HCAEC were measured after 30 minutes of co-culture using an adherence assay and are recorded as percent inoculum. Cytocholsin D inhibits the polymerization, or remodeling, of the actin cytoskeleton of 28

PAGE 29

the host cell which normally forms a vesicle arou nd the target particle/substance, allowing for endocytosis, in the case of P. gingivalis (18). Thus this toxin prevents P. gingivalis from entering the HCAEC by inhibiting the endocyt osis normally induced by the P. gingivalis when it binds to Beta-1 integrin (18). This inhibition then allows the quantificati on of the number of P. gingivalis adhering to the cell surface in the ab sence invasion (Figure 2-4 and 2-5). Interestingly, mutant PG0092 demonstrated a 150% increase in adherence to HCAEC when compared to the wild-type strain, as determined using the Students ttest and One Way ANOVA (2.2 fold, p<0.05). Similarly, the PG1683 mutant demonstrated an 80 % increase in adherence to the HCAEC when compared to the wild type (1.4 fold, p<0.05). Invasion The ability of P. gingivalis W83 and the two mutant strains to invade HCAEC was determined using an antibiotic protection assay at 2.5 hours of co-culture and is reported as percent inoculum (Figure 2-6 and 2-7). Mu tations in genes PG0092 and PG1683 showed no effect (Two-way ANOVA) on invasion when compared to the wild-type strain W83. Persistence The ability of P. gingivalis strain W83 and the two mutant s to persist longer than 2.5 hours of co-culture within HCAEC was examined using a modified antibiotic protection assay. In order to measure persistence, multiple plates were setup at various time points. Following antibiotic treatment to eradicate extra-cellular bacteria, antibiotic free medium was added and the cells were incubated for an additional 3.5, 21.5, and 45.5 hours. At postinoculation time: 6, 24, and 48 hours, the number of bacteria present in the medium was determin ed by plating serial dilutions on sBAP. To determine the number of b acteria still present inside the cells, the cells were washed, lysed, diluted and colonies were grown for up to 10 days before enumeration. The 29

PAGE 30

individual persistence experiments were pe rformed using quintuplicate wells and each experiment was performed two times. The number of bacteria that persisted compared to the wild-type strain, is shown in Figures 2-6 and 2-7. The results ar e expressed as the percentage of that strain recovered at postinoculation of 2.5 hours. Throughout, post-inocula tion times of 6, 24 and 48 hours, there was no significant differences found when comparing to wild-type and muta nt strains as determined by two-way ANOVA. As post inocula tion times increased, fewer bacter ia were recovered from the cells in both mutants and wild-type. Discussion The ability of an intracellular pathogen to inva de and persist within a cell is important for its ability to cause dis ease. The understanding of the relationship between P. gingivalis and artherosclerosis depends on elucidating how this bacterium is able to enter endothelial cells. The testing of site-directed mutants in the HCAEC invasion model can be used as a tool to identify genes important for the survival of P. gingivalis within these host cells. To this end, the ability of P. gingivalis W83 and two mutant strains were evaluated fo r their ability to at tach to, invade and persist in HCAEC. PG0092 is classified as a putative ABC trans porter in the TIGR database. Surprisingly, this mutant demonstrated a significant increase in adherence, but no difference in invasion or persistence, were observed when compared to th e parent strain W83. This may indicate that entry/invasion is actually impaired in this muta nt, assuming that attached bacteria all have an equal ability or likelihoo d of entry. Thus, if this mutant adheres to the HCAEC at numbers 2.2 times greater than the wild-type strain it would be expected that the number of mutant bacteria that invaded would also be 2.2 times greater. However, this was not the case, indicating that the 0092 mutant is less able to enter/invade HCAEC once it has attached to the cell surface. One 30

PAGE 31

explanation for this could be that whatever change in surface properties of the mutant that allows for increased interaction with the host cell surface decreases its ability to signal conditions in the cell that allows/facilitates entry. Another possib ility is that the mutant is more likely to autoaggregate and that larger aggregates of P. gingivalis are less able to enter the cell. Presently, there is no evidence to s upport this, and this mutant did not demonstrate an increased ability to form monotypic biofilms but did produce morphologi cally different biofilms higher than the wild type strain (see chapter 3). Concerning persistence, the muta tion in PG0092 resulted in no change compared to the parent, W83. A mutatio n in a putative ABC transporter, as in PG0092, may prevent transport of some, as yet, unidentifie d molecule that is involved in adherence and or aggregation but not in internalizat ion. However, this is purely speculation at this time because the substrate for this putative ABC transporter, or even if PG0092 is a transporter is unknown. PG1683 is identified as a putative glyc osyl hydrolase/alpha amylase [on the P. gingivalis W83 genome TIGR database]. The loss of this gene product also demonstrated increased adherence to HCAEC and no change in the invasion of HCAEC. Therefore, the mutation may functionally be similar to the PG0092 mutation but mechanistically different. The mutation in the putative glycosyl hydrolase may allow for increased adherence of the bacter ia to one another but prevent internalization. Altern atively, glycosyl hydrolases ca n break down carbohydrates on the surface of the host cell which may otherwise reveal a cryptic epitope or receptor, facilitating adherence. The mutation may also modify P. gingivalis surface carbohydrates allowing for increased P. gingivalis adherence but no increase in internalization. For both mutants, no difference was de tected in persistence in HCAEC. P. gingivalis tends to be difficult to culture from invasion as says after an extended period of time. Studies have shown that after 48 hour s of co-culture, viable P. gingivalis can no longer be recovered in 31

PAGE 32

vitro (113). However, when co-incubat ed with fresh HCAEC, viable P. gingivalis can be recovered. Therefore uncultivable P. gingivalis can exit the initially infected cells and subsequently enter and multiply in fresh HCAE C (113). Future studies which include culturing in fresh HCAEC, need to be completed to obtain conclusive about persiste nce of these mutants. An important factor in bacterial intracellular pathogenesis is the ability of bacteria to adhere to enter and traffic within host cells. The mechanisms of adherence and invasion are complex and require multiple molecules and co ordination and regulation of gene expression. Additional studies are needed to more completely understand how P. gingivalis is able to invade and persist. However, this study indicates that among those genes i nvolved in at l east the initial events of these interactions are PG0092 and PG1683. 32

PAGE 33

Table 2-1. Primers used for mutant construction in P. gingivalis W83. Genes were mutated by double crossover allelic exchange. Gene Primer name Sequence (5 3) PG0092 0092 5F CATGGT CGACGGGA AGAAGAGA 0092 5 R GCCAACGCGTCGCAAAAAG 0092 3 F TTCCTGC CGGTATTGAGATGTT 0092 3 R ACGGCCGGTACCAGTATGTCCA PG1683 1683 5F CTGGCT GCCCGACACAAGATAG 1683 5R GCGCAGCACTACCGGTTTTACAC 1683 3F CTCCGCAATCCATGGCTGAG 1683 3R GTTTCGATC GGGCTGAAGTTGC 33

PAGE 34

Figure 2-1. Bioinformatic analys is of the putative operon for P. gingivalis genes PG0091, PG0092, PG0093, and PG0094. Figure 2-2. Bioinformatic analys is of the putative operon for P. gingivalis genes PG1681, PG1682, PG1683, and PG1684. Figure 2-3. Growth curve of P. gingivalis strains W83, W83 0092 and W83 1683 in sTSB media. Growth curve of mutants compared to the wild type strain W83 over time. Students t-test was used fo r statistical comparisons. PG0090 PG0091 PG0092 PG0093 45bp PG0094 PG0095 PG0097 130bp 59bp 50bp 895bp 293bp 479 728 1217 1139 995 1505 2675 PG1678 Overlap16bp 36bp PG1679 PG1680 PG1681 487bp PG1682 763bp PG1683 PG1684 PG1685 107 1394 699 1976 1262 1286 476 782 Overla p 3b p 0 0.05 0.1 0.15 0.2 0.25 0.3 0.35 0.4 12345678910111213141516171819 Time Points (hours) OD 550 nm W83 92 1683 34

PAGE 35

0 50 100 150 200 250 300 350 W83 W83 0092 P. gingivalis strainsRelative adherenc e Figure 2-4. Adherence of P. gingivalis to HCAEC of strain W83 and W83 0092 in the presence of Cytochalasin D. Cells were pre-e xposed to Cytochalasin D (to prevent internalization) for 1 hour in sTSB media. P. gingivalis W83 and W83 0092 were allowed to adhere to cells for 30 minutes at an MOI of 100 and nonadherent bacteria were washed away. Cells were lysed with 1 ml of water for 20 minutes. The adherent bacteria were serially diluted with PBS and plated for enumeration on sBAP to measure adherent bacteria. Mutant W83 0092 demonstrated an increase in adherent ability to HCAEC at 30 minutes when co mpared to the wild-type (P < 0.05). Twoway ANOVA was used for statistical comparisons. Asterisks indicate a significant difference. 35

PAGE 36

0 50 100 150 200 250 300 350 W83 W83 1683 P. gingivalis strainsRelative adherenc e Figure 2-5. Adherence of P. gingivalis to HCAEC of strain W83 and W83 1683 in the presence of Cytochalasin D. Cells were pre-e xposed to Cytochalasin D (to prevent internalization) for 1 hour in sTSB media. P. gingivalis W83 and W83 1683 were allowed to adhere to cells for 30 minutes at an MOI of 100 and nonadherent bacteria were washed away. Cells were lysed with 1 ml of water for 20 minutes. The adherent bacteria were serially diluted with PBS and plated for enumeration on sBAP to measure adherent bacteria. Mutant W83 1683 demonstrated an increase in adherent ability to HCAEC at 30 minutes when comp ared to the wild type. (P < 0.05). Twoway ANOVA was used for statistical comparisons. Asterisks indicate a significant difference. 36

PAGE 37

0 0.5 1 1.5 2 2.5 3 3.5 2.5 h 6 h% of inoculum that invad e W83 W83 0092 0 0.01 0.02 0.03 0.04 24 h 48 h% of inoculum that invad e W83 W83 0092 Figure 2-6. Invasion and Pe rsistence of HCAEC for P. gingivalis W83 and W83 0092 in sTSB media. P. gingivalis W83 and W83 0092 were allowed to invade the HCAEC at a MOI of 100 for 1.5 hours. The wells were washed with EBM-2 media and 300 g/ml gentamycin and 400 g/ml metronidazole were added to kill extracell ular bacteria. After incubation for 1 additional hour, the cells were washed with EBM-2 media and lysed with 1ml of water for 20 minutes. The intracellular bacteria were diluted in EBM-2 and plated for enumeration on blood agar plates to quantify invasion and persistence over 48 h. Mu tant PG0092 demonstrated no difference when compared to the wild type in invasion and pe rsistence. ANOVA was used to make statistical comparisons. 37

PAGE 38

0 0.5 1 1.5 2 2.5 3 3.5 2.5 h 6 h% of inoculum that invade W83 W83 1683 0 0.01 0.02 0.03 0.04 0.05 0.06 0.07 24 h 48 h% of inoculum that inva d W83 W83 1683 Figure 2-7. Invasion and Pe rsistence of HCAEC by P. gingivalis W83 and W83 1683 in sTSB media. P. gingivalis W83 and W83 1683 were allowed to invade the HCAEC at a MOI of 100 for 1.5 hours. The wells were washed with EBM-2 media and 300 g/ml gentamycin and 400 g/ml metronidazole were added to kill extr acellular bacteria. After incubation for 1 additional hour, the cells were washed with EBM-2 media and lysed with 1ml of water for 20 minutes. The intracellular bacteria were diluted in EBM-2 and plated for enumeration on bl ood agar plates to quantify invasion and persistence over 48 h. W83 1683 demonstrated no difference when compared to the wild type in invasion and persistence. ANOVA was used to make statistical comparisons. 38

PAGE 39

CHAPTER 3 BIOFILM Introduction Biofilm is a complex organization of aggregat ed bacteria. Biofilm in the gingival area leads to inflammation and destruction of host ti ssues leading to pathoge nesis and the chronic disease known as periodontal disease (34). P. gingivalis is a secondary colonizer that is able to bind to salivary receptors, aggreg ate with itself and co-aggregate with many other bacteria such as Fusobacterium nucleatum As previously mentioned, the comp lexity of biofilm formation is likely to require the coordinated expression of mu ltiple genes (35). Biofilm formation allows for acquisition of nutrients, protecti on from mediators of host immun ity and possibly exchange of genetic information (36). The goal of this study was to dete rmine the role, if any, of two P. gingivalis proteins, PG0092, a putative ABC transporter and PG1683, a put ative glycosyl hydrolase/alpha amylase, in biofilm development. A previous study reported the importance of a putative ABC transporter in the negative regulation of biofilm formation in Listeria monocytogenes (114). Another study characterized a glycos yl hydrolase (NghA) of Y. pseudotuberculosis and determined its role in reducing biofilm formation of Y. pestis and S. epidermis biofilms in vitro (115). Yet another study confirmed that glycos yl hydrolases (PGA) of A. actinomycetemcomitans and A. pleuropneumoniae biofilms (PGA) are involved in biof ilm matrix polysaccharide synthesis and may play a role in intercellular adhesion and ce llular detachment and dispersal (116). Based on these studies in other pathogens, the purpose of our study was to compare biofilm formation between the wild-type P. gingivalis W83 strain and mutants W83 0092 and W83 1683. Homotypic biofilm height, biofilm volume and biof ilm structure were determined using a crystal violet assay, spinning confocal microscopy and scanning electron microscopy, respectively. 39

PAGE 40

Further studies were completed to test differences in hetero typic biofilm formation with P. gingivalis and Fusobacterium nucleatum 22586 Material and Methods Bacterial Strains and Growth Conditions Bacterial strains and growth conditions were maintained as previously described in Chapter 2. Mutant Construction Mutations were constructed as pr eviously described in Chapter 2. Homotypic Biofilm To determine homotypic biofilm formation by P. gingivalis, strain W83 and mutants W83 0092 and W83 1683 were grown anaerobically overnight in sTSB at 37C and then subcultured to an OD 1.0. Five replicates of 500 l of the P. gingivalis cultures were inoculated into wells of a 48-well microtiter plate (Nunclon, Denmark). After 12, 24, 48, 72 and 96 hrs in an anaerobic chamber, the resulting biofilms were washed three times with pre-reduced PBS and stained with 100l of filtered 1% cr ystal violet in water for 15 minutes. After staining, the plates were washed three times with sterile distilled water by immersing the 24 well plate (Costar) in a bowl of water, shaking the excess water into th e sink and blotting the pl ate on paper towels. The biofilms were then visualized as circles at the bottom of each well and biofilm production was quantatively analyzed by adding 200l of 95% et hanol for 15 minutes to destain the wells. Fifty l of the ethanol from each well were then pipe ted in triplicate into a 96 flat bottom well plate (Costar). A Benchmark microplate reader (Bio -Rad Laboratories) was used to measure absorbance at 595nm. The average OD of the cont rol wells was calculated and subtracted from the OD of sample wells, the averages were dete rmined and graphed with standard deviations. 40

PAGE 41

ANOVA was used for statistical an alysis. Independent biofilm assa ys were repeated twice with each strain in quintuplicate. Flourescently labeling Porphyromonas gingivalis for Homotypic Biofilm For homotypic biofilm height and volume measurements determined by confocal microscopy, 1 ml of P. gingivalis wild type W83, mutant W83 0092 or W83 1683, grown anaerobically overnight in sTSB at 37C, was centrifuged at 5000 g/4 min and washed twice in 1 ml pre-reduced PBS (Mediatech). The bacterial cel ls were then re-suspended in pre-reduced PBS and 1l of 5-(6)-carboxyfluorescein-succinimidyl ester (fluorescein isothiocyanate [FITC], 4g ml -1; Molecular probes C1311, green fluorescence), from a stock solution of 10 mg/ml in DMSO. The bacterial cells were then covered with aluminum foil and incubated on a rolling platform at 4C for 30 minutes. The labeled cells were then centrifuged for 4 min at 5000 g, washed three times and resuspended in 1x PBS (Mediatech). The OD550 of the bacterial suspension was adjusted to a concentration of 2x108 CFU/ml and 200l of each labeled bacterial preparation (5x107 CFU/well) was pipeted into a 16 we ll chamber coverglass system (Nalge Nunc International, Rochester, NY). The slides were covered with aluminum foil and incubated anaerobically with rocking at 37C for 24 and 48h. At each time point, the supernatant was exchanged with fresh PBS and biofilm development on the coverglass bottom was observed by spinning disk confocal consisting of a CSU10 Yo kagowa confocal scan head, a Roper Cascade II EMCCD 512b camera, ASI X, Y, and peizo Z com puter controlled stage, three lasers for 3 channel fluorescent imaging attached to a Leica DMIRB inverted microscope. This system was controlled by the open source soft ware package Micro-manager ( http://www.micromanager.org/). Quantification of P. gingivalis specific fluorescence bi ofilm height and biofilm volume was described using the following Image J plugins: Micro Manager, Volume Viewer, Plot Profile and Volume Renderer. Biofilm a ssays were repeated tw ice and in duplicate. 41

PAGE 42

Heterotypic Biofilm ( P. gingivalis and F. nucleatum 22586 ) Fusobacterium nucleatum 22586 which was kindly provided by Dr. Clay Walker, University of Florida, was used with P. gingivalis for studies on heterotypic biofilms which were completed using the microtiter plate assay de scribed in the previous section (Homotypic Biofilm). Bacterial suspensions of P. gingivalis were prepared from anaerobically grown overnight cultures in sTSB wher eas bacterial suspensions of F. nucleatum 22586 were grown anaerobically at 37C in sTSB for three days Different ratios of parental and mutant P. gingivalis strains were mixed with F. nucleatum 22586 in sTSB, aliquoted into 24 well plates (Costar, Corning, NY), and incubated anaerobic ally at 37C for 24 and 48 h. In addition, F. nucleatum 2256 was added to a preformed 24h P. gingivalis homotypic biofilm. For this, the medium was removed and F. nucleatum 22586 was added on top for an additional 24 h. The reverse was also done. After the incubation period, the liquid was removed from the wells for all experiments and the wells were washed three time s with pre-reduced PBS (Mediatech), allowing for removal of loosely associated bacteria. The remaining cells (biofilm) were stained with 100l of filtered 1% crystal violet in water for 15 minutes and plates were washed three times with sterile distilled water by the immersion tec hnique described above. Biofilm production was quantitively analyzed by adding 50 l of 95% ethanol to destain the wells and 50l from each well was pipeted in triplicate into wells of a 96 flat bottom well plate. The intensity at OD595 of the crystal violet present in the destaining solu tion was measured using a Benchmark microplate reader (Bio-Rad Laboratories). The average OD fr om the control wells was subtracted from the OD of all sample wells and the averages and standard deviations of the samples were calculated. Two-way ANOVA was used for statistical analysis. Independent biofilm assays were repeated twice with each strain in quintuplicate. 42

PAGE 43

Results Homotypic Biofilm Overall mass of homotypic biofilm using P. gingivalis W83, W83 0092 or W83 1683 was measured using a crystal violet staining assay at abso rbance 595 nm over 24, 48, 72 and 96 hours. As shown in Figures 3-1 and 3-2, no di fference was found in biofilm production for the two mutants when compared to wild type stra in W83, under the conditions described. The data also indicate that biofilm production using this assay and media reached its maximum volume at 48 hours. For biofilm structure visualization and quan tification, biofilms we re also generated on 16-well chamber coverglass systems, stained with FITC (as described earlier) and examined by confocal laser microscopy. The images were ob served at 490 wavelength and analyzed with Image J to determine biofilm volume and biofilm height (Figure 3-3). The biofilm formation of the PG0092 mutants showed no statistical diffe rence in biofilm volume or average biofilm height. A more detailed analysis of the proportional height, co mpared to W83, indicated that mutant PG0092 formed sporadic taller biofilm colonies than the wild-type. Chi square analysis was used to statistically analyze proportions of wild-typ e versus mutant peak heights greater than 120 in intensity and demonstrated a difference among the strains. A peak intensity of 120 was chosen since it is roughly 50% of the largest p eak intensity of the highest intensity observed. When comparing W83 to W83 0092 at 24 h, W83 had 0.33% of peak s greater than the 120 peak intensity with a 95% confidence of 0.16 to 0.60%, while W83 0092 had 20.3% peaks greater than the 120 peak intensity with a 95% conf idence of 18.9 to 21.7%. At 48h, strain W83 had 6.9% peaks greater than th e 120 peak intensity (95% CI 6.0 to 7.9%) and W83 0092 had 30.4% peaks greater than 120 peak intensity (95% CI 28.7 to 32.0%). Thus the biofilm formed by W83 0092 contained a greater proporti on of high biofilm peaks than did the W83 biofilm (Table 43

PAGE 44

3-1, Figure 3-5). The scanning electron microscopy biofilm pictures of this mutant appeared sparser than that of the wild -type W83 strain (Figure 3-5). When comparing biofil ms of W83 to W83 1683 at 24h using chi square analysis (Figure 3.4 A), W83 1683 had no peaks greater than the 120 peak intensity (95% CI 0 to 0.0012%), but at 48 h, 11.9% of its peaks had an intensity of greater than 120 (95% CI 10.8 to 13.1%) W83 1683 had greater biofilm height at 48h (P valu e <0.05) when compared to wild-type W83 but there was no statistical difference at 24 h. Visually, mutant 1683 had patchy and chain-like formation of biofilm colonies compared to the fo rmation of wild-type biof ilm with evenly spread dispersed micro-colonies (Figure 3-4, 3-5). Heterotypic Biofilm Heterotypic biofilm was measured using a crystal violet staining assay over 24 and 48 hours with mixtures of P. gingivalis strain W83 and Fusobacterium nucleatum strain 22586. No differences were determined with the P. gingivalis mutant W83 1683 and Fusobacterium nucleatum 22586 compared to P. gingivalis wild type strain W83. As shown in Figure 3-6, the only significant difference found was with the addition of mutant W83 0092 grown initially for 24 hours on the microtiter plate, followed by the addition of Fusobacterium nucleatum 22586 on top, when compared to the same conditions of W83, (P value < 0.05). It was also determined that heterotypic biofilm with the initial bacteria (mutants and wild-type) grown on the plate for 24 hours and later adding a s econd type of bacteria, F. nucleatum 22586, resulted in greater biofilm production than the homotypic biofilms or when F. nucleatum 22586 was grown first. Discussion Oral biofilm development is vital to the progr ession of periodontal di sease. It allows for the colonization of multiple bacterial species in the oral cavity, leading ultimately to inflammation, destruction of th e supporting tissues of the te eth and bone resorption. When 44

PAGE 45

comparing our mutants to P. gingivalis wild type strain W83, no difference was determined in homotypic biofilm production, biofilm volume, or average biofilm height formation. However more detailed analysis of pr oportions of biofilm height form ation revealed differences in biofilms of the mutants compared to that of W 83. These differences indicate that mutations of either of these genes, PG1683 and PG0092, affect P. gingivalis biofilm morphology. How the difference in morphology translates into biofilm pathogenicity is not kn own at this time. As stated above, a study by Zhu et al., has shown that another Listeria monocytogenes putative ABC transporter functions as a negative regulator of biofilm formation (114). This appears not to be the case with this P. gingivalis putative ABC transporter with respect to monospecies biofilms. However, it could be that other ABC transporters compensate for the loss of the PG0092 putative ABC transporter or that PG0092 is in f act, not an ABC transporter. Regardless of its function, this protein plays a role in biofilm formation, since a mutation in PG0092 resulted in a difference in biofilm peak height. Thus loss of function of this gene resulted in higher biofilm peaks and more pr ofound aggregation within mono-species and mixed species biofilms. This putative ABC transpor ter may, however, be a negative regulator of heterotypic biofilm formed by P. gingivalis and F. nucleatum since in the case of the 0092 mutant, the loss of this gene re sulted in greater formation at 48 h. Further studies must be completed to further characterize this genes substrate (function) and phenotype. Heterotypic biofilms of P. gingivalis and F. nucleatum have been shown to aggregate well with one another and promote biofilm production (117 ). Studies reported here, also indicate that all strains of P. gingivalis tested make more biof ilm in the presence of F. nucleatum 22586 than homotypic biofilm. This further substantiates that, P. gingivalis and F. nucleatum assist each other with coaggregation, as previously discussed. 45

PAGE 46

Recent studies have concluded that glycosyl hydrolases are important for the amount of biofilm formed, may function as a biofilm matr ix polysaccharide, and may be important in intercellular adhesion, cellular detachment and dispersal ( 115, 116). The mutation in PG1683, a putative glycosyl hydrolase/alpha amylase, resulted in a change in biofilm height. Thus the loss of this gene function affects bi ofilm structure in that higher ch ain-like peaks form compared to wild type biofilm which forms dispersed micro-co lonies. It may be that this putative glycosyl hydrolase plays a role in enhanc ing mono-species aggregation. When this mutant was grown as a mixed-species biofilm with F. nucleatum 22586, there was more abundant accumulation of biofilm compared to the monospecies biofilm, bu t no differences were observed compared to the wild type strain dual species biofilm. It is reasonable to speculate that the differences detected in biofilm structure may be related to differences in adhesion to HCAEC as reported in Chapter 2. The change in architecture of the P. gingivalis surface structure(s) likely mediate ch anges in both adherence and biofilm formation. 46

PAGE 47

0 0.1 0.2 0.3 0.4 0.5 0.6 W83 W83 0092 P. gingivalis strainsOD 595n m 24h 48h 72h 96h Figure 3-1. Microtiter plate monospecies biofilm production by P. gingivalis W83 and W83 0092 in sTSB media. P .gingivalis biofilms were stained with 1% crystal violet. A) Biofilms of P. gingivalis W83 and W83 0092 at 24, 48, 72 and 96 h. Two-way ANOVA was used for statistical analysis. No differences were determined for mutant compared to wild-type. 47

PAGE 48

0 0.1 0.2 0.3 0.4 0.5 0.6 W83 W83 1683 P. gingivalis strainsOD 595n m 24h 48h 72h 96h Figure 3-2. Microtiter plate monospecies biofilm production by P. gingivalis W83 and W83 1683 in sTSB media. P .gingivalis biofilms were stained with 1% crystal violet. A) Biofilms of P. gingivalis W83 and W83 1683 at 24, 48, 72 and 96 h. Two-way ANOVA was used for statistical analysis. No differences were determined for mutant compared to wild-type. 48

PAGE 49

A B C D 0 1000 2000 3000 4000 5000 6000 7000 W83 W83 0092 P. gingivalis strainspixel s 24h 48h 0 20 40 60 80 100 120 140 160 24 h 48 hAverage biofilm height (pixels ) W82 W83 0092 E F Figure 3-3. Confocal micrographs of monospecies biofilm production of P. gingivalis W83 and W83 0092 at 24 and 48 h in sTSB. Confocal laser scanning microscopy projections of monospecies biofilm formation by P. gingivalis strains A) W83 at 24 h B) W83 at 48 hand C) W83 0092 at 24 h D) W83 0092 at 48 h. P. gingivalis was pre-stained with FITC (green). Magnification 60X. E) Total biofilm volume analysis of a 268.6 by 268.6 m x-y section of P. gingivalis strains W83 and W83 0092. F) Total biofilm height analysis of a 268.6 by 268.6 m x-y section of P. gingivalis W83 and W83 0092. The horizontal pictures placed under each confocal picture represents cross sections of each biofilm used to determine peak height.Two-way ANOVA was used for statistical analysis. 49

PAGE 50

Table 3-1. Chi square analysis values of biofilm peaks >120 in intensity for P. gingivalis wildtype W83 strain and mutant W83 0092 at 24 and 48 hours Strain 24 h 48 h W83 0.33% (95% CI 0.16 .60%) 6.9% (95% CI 6.0 7.9%) W83 0092 20.3% (95% CI 18.9 21.7%) 30.4% (95% CI 28.7 32.0%) Table 3-2. Chi square analysis values of biofilm peaks >120 in intensity for P. gingivalis wildtype W83 strain and mutant W83 1683 at 24 and 48 hours. Strain 24 h 48 h W83 0.33% (95% CI 0.16 .60%) 6.9% (95% CI 6.0 7.9%) W83 1683 0% (95% CI 0-0.0012%) 11.9 % (10.8 131%) 50

PAGE 51

A B C D E 0 1000 2000 3000 4000 5000 6000 7000 W83 W83 1683 P. gingivalis strainspixels 24h 48h 0 20 40 60 80 100 120 140 160 24 h 48 hAverage biofilm height (pixels ) W83 W83 1683F Figure 3-4. Confocal micrographs of monospecies biofilm production of P. gingivalis W83 and W83 1683 at 24 and 48 h in sTSB media. Confocal laser scanning microscopy projections of monospecies biofilm formation by P. gingivalis strains. A) W83 at 24 h B) W83 at 48 h. C) W83 1683 at 24 h D) W83 1683 at 48 h. P. gingivalis was prestained with FITC (green). Magnification 60X. E) Total biofilm volume analysis of a 268.6 by 268.6 m x-y section of P. gingivalis strains W83 and W83 1683. F) Total biofilm height analysis of a 268.6 by 268.6 m x-y section of P. gingivalis W83 and W83 1683. The horizontal pictures placed under each confocal picture represents cross sections of each biofilm used to determine peak height. Two-way ANOVA was used for statistical analysis. 51

PAGE 52

B A C D F E Figure 3-5. Scanning electron micrographs of monospecies biofilm production of P. gingivalis mutants and wild type at 24 and 48 h in sTSB media. A) W83 at 24 h B) W83 0092 at 24 h. C) W83 1683 at 24 h. D) W83 at 48 h. E) W83 0092 at 48 h. F) W83 1683 at 48 h. 52

PAGE 53

A 0 0.2 0.4 0.6 0.8 1 1.2 1.4w83 22 5 8 6 w83:22586 w 8 3 / 2 2 58 6 2 2 5 86 / w83 Bacterial strainOD 595 n m 24h 48h B 0 0.2 0.4 0.6 0.8 1 1.2 1.4 24 h 48 h Time pointsOD 595n m W83 W83 0092 22586 W83:22586 W83 0092:22586 W83 / 22586 W83 0092 / 22586 22586 / W83 22586 / W83 0092 Figure 3-6. Mixed species biofilms of P. gingivalis W83, W83 0092 and F. nucleatum 22586 in sTSB media. A) Biofilms at 24 and 48 h grouped by time and separated by strain. B) Biofilms at 24 and 48 h grouped as strains a nd separated by time. Asterisks indicate a significant difference. Twoway ANOVA was used to make statistical comparisons. 53

PAGE 54

A 0 0.2 0.4 0.6 0.8 1 1.2 1.4w 83 22586 w 83: 22586 w 83 / 22586 22586 / W83 Bacterial strainOD 595n m 24h 48h B 0 0.2 0.4 0.6 0.8 1 1.2 1.4 24 h 48 h Time pointsOD 595n m W83 W83 1683 22586 W83:22586 W83 1683:22586 W83 / 22586 W83 1683 / 22586 22586 / W83 22586 / W83 1683 Figure 3-7. Mixed species biofilms of P. gingivalis W83, W83 1683 and F. nucleatum 22586 in sTSB media. A) Biofilms at 24 and 48 h grouped by time and separated by strain. B) Biofilms at 24 and 48 h grouped as strain s and separated by time. Two-way ANOVA was used for statistical analysis. 54

PAGE 55

CHAPTER 4 VIRULENCE FACTORS AND ENVIRONMENTAL SIGNALS Introduction A microorganisms ability to survive within different environmental niches is dependent upon its ability to adapt and res pond to environmental cues by re gulating the expression of its genes (118). For a pathogen, adapting to a new environment quickly can determine the microorganisms rate of colonization, pro liferation and successful infection (118). The coordinated expression of bacterial virulence ge nes during an infectious process is vital for adherence, penetration, replicati on and colonization of host tissues and cells (118). Therefore, the bacterium must adapt to its varying niche by turn ing on and off different virulence factors as a response to different environmenta l signals in various stages of infection (118). As discussed earlier, P. gingivalis has mechanisms to acquire nutrients, such as hemin, which is limited in the subgingival crevice and is require d for its growth. For example, P. gingivalis grown in a heme limiting environment, showed a decrease in transcrip tion of a specific set of genes, believed to be the result of severe stress (119, 120). Another study showed that P. gingivalis grown under various conditions of growth resulted in differe nt expression patterns of virulence factors (121). The expression of various factors on the surface of bacteria that are associated with adhesion and invasion include fimbriae, flagella, LPS, polysaccharide, micro vesicles and outer membrane vesicles (118). The fimbriae of P. gingivalis are among its most significan t virulence factors and are important for host cell interactio ns such as adherence and inva sion. A report from the Hanley laboratory measured the length of fimb riae present on the surface of several P. gingivalis strains, including W83 (122). However, our laboratory was unsuccessful in detecting fimbriae on the surface of W83. Of significance, wa s the fact that our growth c onditions for W83 were different 55

PAGE 56

from those used by the Hanley laboratory. The purpose of this study was to compare the expression of fimbriae by W83 under the two different conditions of growth as well as determine the phenotypes of two W83 mutants in the varying conditions. To this end, P. gingivalis wildtype W83 and mutants W83 0092 and W83 1683 were evaluated for biofilm formation, the production of fimbriae, adhesion, invasion, and hemagglutination activity in response to conditions of growth. Material and Methods Bacterial Strains and Growth Conditions Bacterial strains and growth conditions were maintained as previously described in Chapter 2, as well as maintained and transferre d biweekly on Reinfor ced Clostridial Medium (Difco, Sparks, MD) plates (sRCP) supplemented with menadione, KNO3 and NaHCO3 as previously described (122). For liquid growth, P. gingivalis strains were also grown in Brain Heart infusion Broth (sBHI), y east extract, glucose, NaHCO3, KNO3 and menadione as previously described (122). All P. gingivalis cultures were incubate d in a Coy anaerobic chamber (Ann Arbor MI) at 37C with an atmosphere of 10% H, 5% CO2, and 85% N2. Mutant Construction Mutations were constructed as pr eviously described in Chapter 2. Fimbriae Negative Staining for Electron Microscopy Porphyromonas gingivalis strainW83 and mutants W83 0092 and W83 1683 were grown anaerobically overnight at 37C in either sTSB or sBHI for 24 hours. Negative staining and examination by electron microscopy was performed as described previously (123). Briefly, the bacteria were washed three times in water, re suspended in PBS with 1% BSA and one drop of this suspension was then app lied to copper grids (300 mesh, EMS, Hatfield, PA ). Ten microliters of 1 per cent w/v methylamine tungsta te (Ted Pella, Redding, CA) was added to one 56

PAGE 57

drop of the P. gingivalis suspension on a grid to negatively st ain the bacteria for 45 seconds. Any excess fluid was then wicked aw ay with filter paper. The negatively stained grids were then examined by Debra Akin at the University of Florida, Department of Anatomy and Cell Biology, using a JEOL 100CX electron microscope. Hemagglutination Assay P. gingivalis wild type W83 and mutants W83 0092 and W83 1683, grown overnight in sTSB or sBHI, were centrifuge d at 5000 g and washed 3 times with PBS. The bacterial cells were then resuspended in PBS to an OD660 of 2.0. Sheep erythroc ytes (QUAD-FIVE) were centrifuged at 400 g/5min/4C, washed twice with PBS and re-suspended in PBS to a final concentration of 2%. Aliquots of 100ul from each bacterial suspension were serially diluted twofold with PBS into 96 well v-shaped microtiter plates (Costar). An equal volume of 2% sheep erythrocytes was then added to the bacterial suspensions and mixed with each dilution. After incubation for 2h at 4C, the hemagglutination tite r was assessed as the last dilution that showed complete agglutination (pellet could not be obser ved). The plate was further incubated for 16 h at 4C and observed again. Hemagglutination assays were performed twice for each strain. Adherence Assay Adherence assays were performed as previously described in the Materi al and Methods section of Chapter 3. Results Fimbriae The presence of fimbriae was determined using electron microscopy, as previously described. No fimbriae were detected on any of the strains, wild-type or mutants, when they were cultured in sTSB (Figure 4-1 and 4-2). However, when grown in BHI, long, peritrichous fimbriae 57

PAGE 58

on strain W83 were evident (Figure 4-1 and 4-2). In contrast, no fimbriae could be observed on strains W83 0092 and W83 1683 when grown in sBHI. In experiments done by Debra Aki n, Western blot analysis usi ng specific antisera indicated that the structural ge ne of major fimbriae, fim A, is being expressed in all three strains W83, 0092 and 1683 (data not shown), but neither wild -type nor mutants express the minor fimbriae, MfaI, when grown in e ither media. (data not shown) Hemagglutination Hemagglutination activity of wild type strain W83 and mutants W83 0092 and W83 1683 was measured using an hemagglutination a ssay. Serial dilutions of each strain were incubated with sheep erythrocytes at 4C overnight. The titer was de fined as the last dilution that showed full agglutination, which was determined by the lack of a pellet. As is shown in Figure 43, the hemagglutinin titers of strains W83 0092, and 1683 were all 1:128, when grown in sTSB. Thus no difference in hemagglutina tion was detected when both mutants W83 0092 and W83 1683 were compared to the wild-type strain. However, as is evident in Figure 4-4, when grown in sBHI, the hemagglutinin titer of W83 and W83 0092 were 1:8, but W83 1683 did not demonstrate any hemagglutination activity at all. Adherence Assay The adherence of P. gingivalis strain W83 and the two mutants which had been cultured in the media described by Handley (sBHI) to HCAEC was measured at 30 minutes of co-culture using the previoudly described a dherence assay and was recorded as percent inoculum (Figure 45 and 4-6). As previously discussed, cytocholsi n D inhibits the polymer ization of the actin cytoskeleton of the host cell, thereby pr eventing endocytosis, and thus entry of P. gingivalis (18). Consequently, the number of P. gingivalis that adhere to the cell su rface without complication of invasion can be quantified. As can be seen in Fi gure 4-5 a mutation in PG0092 resulted in a 51% 58

PAGE 59

decrease in adherence to HCAEC, as compared to the parental W83 strain, similarly the mutation in PG1683 resulted in 60% (as analyzed using the Students ttest and One Way ANOVA (2.1 fold, P<0.05). Given this difference in adherenc e of the mutants as compared to W83, for reference, a comparison of the adherence of W83 grown in the two media was also done. Interestingly, W83 grown in sBHI was slightly (1.2 times) less adherent than when it was grown in sTSB and this difference was statistic ally different (P<0.05) (Figure 47). Biofilm Homotypic biofilm production by P. gingivalis wild type W83 and mutants W83 0092 and W83 1683 when grown overnight in sBHI was dete rmined using the crystal violet assay over 96 hours. Drastic differences were observed for biofilm formation by W83 1683 when compared to W83 (Figure 4-8). In fact, a muta tion in this putative glycosyl hydrolase/alpha amylase gene resulted in the total loss of biofilm formation. In strain W83 0092 (Figure 4-9), a putative mutant in an ABC transporter, demonstrated a 0.9x reduced ability to form biofilm (0.9 fold) was observed when compared to wild type W83 and this differen ce was not statistically significant. For all strains, biofilm formation re mained essentially constant over 96 hrs. Similar to adherence experiments, the amount of biofilm formed by the parent strain grown in the two media was also compared. As can be seen in Fi gure 4-10, there was a sign ificant difference in biofilm formation comparing W83 grown in sTSB versus sBHI at all time points. However the culture grown in sTSB formed more biofilm early, through 48 h, but by 72 h, the BHI grown culture formed significantly more biofilm, whic h continued through 96 h. This difference at the later time points was due to th e sBHI cultured cells maintainin g a greater amount of the 24 48 h biofilm as compared to the sTSB cultured cells. 59

PAGE 60

Discussion Characterizing mutants involved in adhesion, hemagglutination, protease activity, biofilm development, and fimbriae formation allows us to better understand to what extent these individual gene products influence the course of infection and disease. As discussed earlier, P. gingivalis is able to colonize, evade host responses and adapt to its environment in order to acquire nutrients and allow for the progression of this disease. The data reported here clearly indicate that when characterizing genes in bact eria, cultural conditions should be taken into consideration since differences in conditions of growth will likely result in a change in gene expression and, consequently, possibly virulence. In our studies, changing growth media in some cases completely changed the phenotype of mutate d genes compared to th e wild type strain. Gene PG1683, as determined by the TIGR instit ute, encodes a putative glycosyl hydrolase/ alpha amylase. In earlier chap ters, it was reported that W83 1683, grown in sTSB exhibited no difference in invasion, fimbriae formation a nd most homotypic and heterotypic biofilm measurements, as compared to W83. The most significant difference found was an increase in adherence. However, the experiments report ed in this chapter demonstrate that W83 1683 has a drastic phenotypic difference when cultured in sBHI. In this study, it was determined that a mutation in PG1683 resulted in the loss of hema gglutination activity, decreased adherence to host cells and the inability to form biofilms when the mutant was cultured in sBHI. A glycosyl hydrolase can be important for the degradation/ synthesis of carbohydrat es and may logically change carbohydrate surface structures. Given these phenotypes, it is logical to conclude that one or more surface molecules of W83 are ab sent or significantly changed in W83 1683. As reported in earlier chapte rs, the phenotype found for PG0092 was an increase in adherence and biofilm structural formation, when cultured in sTSB. However, when this strain was cultured in sBHI, it did not express structural fimbriae and exhibited a significant decrease 60

PAGE 61

in adherence as compared to W83. No differences were observed in hemagglutination or invasion compared to W83. The TIGR institute lists PG0092 as a putative ABC transporter. Although, it is difficult to make conclusions on the function of this gene without first characterizing its substrate, it is possible that it is involved in fimbriae formation. As discussed in the introduction, ABC transporters are trans-membrane proteins that utilize the energy of ATP to carry out various biological proce sses and in other bacteria have b een reported to be important in the regulation of biofilm formation. However this does not seem to be the case for this P. gingivalis putative ABC transporter in the sBHI envi ronment. Additional studies need to be completed in order to more fully charact erize the function of this gene product. The negative stains/electron microscopy anal ysis revealed long fi mbriae present on the surface of W83 but not present on the surface of W83 1683, when grown in sBHI. However, no fimbriae were visible on strain W83 0092 either, when grown in sBHI, and this strain exhibited no reduction in hemagglutination activity and only a slight reduction in biofilm formation. Thus the presence/absence of fimbriae alone cannot account for the loss of phenotype for the W83 1683 mutant. However the loss of the expressi on of intact fimbriae by the mutants is significant. Interestingly, Wester n blots indicated that the protei ns for both the major fimbriae (FimA) are expressed in these strains, when gr own in both sTSB and sBHI media but the minor fimbriae were not expressed for either condi tion (data not shown, Debra Akin personal communication). However, when this mutant was maintained in sTSB no fimbriae could be detected by electron microscopy. These data thus indicate that FimA is expressed but intact fimbriae are not formed. Therefore, the loss of th ese gene product results in the inability to produce functional fimbriae, and this phenotype is environment specific. 61

PAGE 62

Analysis of the parental strain when grown in different media resulted in some interesting observations. First, the adheren ce of strainW83 to HCAECs was compared when grown in both media and the data indicated a significant difference in phenot ype. When W83 was cultured in sBHI, a reduction in adherence was found and determ ined to be statistically different from the sTSB grown culture. These results are puzzling since fimbriae are expressed when W83 is grown in sBHI but not in the sTSB media. This may indicate that fimbriae are not involved in the specific adherence mechanism responsible for this difference and it is known that many other P. gingivalis surface structures mediate adherence as well. In fact, W83 hemagglutination is reduced when it is grown in sBHI versus sTSB as discussed in the in troduction hemagglutination is important for adherence.Additionally, homotypic biofilm formation was statistically different between cultures from the two media. When grow n in sTSB, the W83 biofilm increased at 48 h but then decreased over the 72 and 96 h. However, in sBHI media, the W83 biofilm remained constant over the 96 h. The resulting biofilm phenot ype may be due to the expression of fimbriae on the surface of W83 when gr own in sBHI, which may medi ate increased adherence of P. gingivalis cells and partially inhibits the detachment, and dissem ination stages of biofilm formation. Experiments reported in this chap ter indicate that when testin g mutants in different media, the phenotype can be different. The data presen ted here demonstrate that the sBHI medium promotes the expression of some genes that are not expressed in sTSB The reverse is also undoubtedly true. Table 4-1, summarizes the phenot ypes of the W83 parental genes and mutants when grown in both media. It would be intere sting to complete microarray analysis of the expression of W83 genes when W83 is cultured in these two media. 62

PAGE 63

A B C D Figure 4-1. Electron microgra ph of negative stains of P. gingivalis strains W83 and W83 0092 in sTSB and sBHI media. A) W83 grown in sTSB. (B) Strain W83 grown in sBHI C) Strain W83 0092 grown in sTSB D) Strain W83 0092 grown in sBHI. 63

PAGE 64

A B C D Figure 4-2. Electron microgra ph of negative stains of P. gingivalis strains W83 and W83 1683 in sTSB and sBHI media. A) W83 grow n in sTSB. (B) W83 grown in sBHI. C) W83 1683 grown in sTSB (D) W83 1683 grown in sBHI. 64

PAGE 65

1:2 1:4 1:8 1:16 1:32 1:62 1:128 1:256 1:512 1:1024 1:2048 1:4096 W83 1683 0092 Control Figure 4-3. Hemagglutination of P. gingivalis wild-type W83, W83 0092 and W83 1683 when grown in sTSB media. The titer was define d as the last dilution that showed full agglutination. 1:2 1:4 1:8 1:16 1:32 1:62 1:128 1:256 1:512 1:1024 1:2048 1:4096 W83 0092 1683 Control Figure 4-4. Hemagglutination of P. gingivalis wild-type W83, W83 0092 and W83 1683 when grown in sBHI media. The titer was define d as the last dilution that showed full agglutination. 65

PAGE 66

0 20 40 60 80 100 120 140 W83 W83 0092 P. gingivalis strainsRelative adherence Figure 4-5. Adherence to HCAEC for P. gingivalis W83 and W83 0092 in sBHI media. Cells were pre-exposed to Cytochalasin D (t o prevents internalization) for 1 hour. P. gingivalis W83 and W83 0092 (with Cytochalasin D) were allowed to adhere to cells for 30 minutes at an MOI of 100 and non-adhe rent bacteria were washed away. Cells were lysed with 1 ml of water for 20 minutes The adherent bacteria were diluted with PBS and plated for enumeration on blood agar plates to measure adherent bacteria. Mutant W83 0092 demonstrated an increase in adherent ability of HCAEC at 30 minutes when compared to the wild-type. (P < 0.05). Two-way ANOVA was used for statistical comparisons. Asterisks indicate a significant difference. 66

PAGE 67

0 20 40 60 80 100 120 140 W83 W83 1683 P. gingivalis strainsRelative adherenc e Figure 4-6. Adherence to HCAEC by P. gingivalis W83 and W83 1683 in sBHI media. Cells were pre-exposed to Cytochalasin D (t o prevent internaliz ation) for 1 hour. P. gingivalis W83 and W83 1683 (with Cytochalasin D) were allowed to adhere to cells for 30 minutes at an MOI of 100 and nonadhere nt bacteria were washed away. Cells were lysed with 1 ml of water for 20 minutes The adherent bacteria were diluted with PBS and plated for enumeration on blood agar plates to measure adherent bacteria. Mutant W83 1683 demonstrated an increase in adherent ability of HCAEC at 30 minutes when compared to the wild type. (P < 0.05). ANOVA was used for statistical comparisons. *Asterisks indicate significant difference. Asterisks indicate a significant difference. 67

PAGE 68

0 1 2 3 4 5 6 7 sTSB sBHI Bacterial media% inoculum that adhered W83 Figure 4-7. Adherence of P. gingivalis W83 to HCAEC, previously grown in sTSB and sBHI media. Cells were pre-exposed to Cytochal asin D (to prevent internalization) for 1 hour. P. gingivalis W83 (with Cytochalasin D) from sTSB and sBHI were allowed to adhere to cells for 30 minutes at an MO I of 100 and non-adherent bacteria were washed away. Cells were lysed with 1 ml of water for 20 minutes. The adherent bacteria were diluted with PBS and plated for enumeration on blood agar plates. Students t -test was used for statistical compar isons. Asterisks indicate significant difference. 0 0.1 0.2 0.3 0.4 0.5 W83 W83 1683 P. gingivalis strainsOD 595n m 24 h 48 h 72 h 96 h * Figure 4-8 Microtiter plate homotypic biofilm production by P. gingivalis W83 and W83 1683 in sBHI media. P .gingivalis biofilms were stained with 1% crystal violet. Biofilms of P. gingivalis W83 and W83 1683 at 24, 48, 72 and 96 h. Two-way ANOVA was used for statistical comparisons. Asterisks indicate significant difference (P value < 0.05). 68

PAGE 69

0 0.1 0.2 0.3 0.4 0.5 W83 W83 0092 P. gingivalis strainsOD 595n m 24 h 48 h 72 h 96 h Figure 4-9. Microtiter plate homot ypic biofilm production by P. gingivalis W83 and W83 0092 in sBHI media. P .gingivalis biofilms were stained with 1% crystal violet. Biofilms of P. gingivalis W83 and W83 0092 at 24, 48, 72 and 96 h. Two-way ANOVA was used for statistical comparisons. 0 0.1 0.2 0.3 0.4 0.5 0.6 sTSB sBHI Bacterial mediaOD 595 nm 24h 48h 72h 96h * Figure 4-10. Microtit er plate monospecies biofilm production by P. gingivalis W83 in sTSB and sBHI media. P .gingivalis biofilms were stained with 1% crystal violet at 24, 48, 72 and 96 h. Students t -test was used to make statistical comparisons. Asterisks indicate significant difference. 69

PAGE 70

Table 4-1. Phenotype summ ary. Summary of results of mutants and wild type. Phenotype sTSB sBHI Strain Adhesion Invasion Biofilm Fimbriae HA Fimbriae HA Adhesion Biofilm W83 + + + + + + + + 0092 + + + + + 1683 + + + 70

PAGE 71

CHAPTER 5 DISCUSSION According, to the Center for Disease Contro l, periodontal disease is the second most common infectious disease in the world. It has more recently been associated with cardiovascular and other systemic diseases. It is believed that Porphyromonas gingivalis an etiologic agent of periodontal disease, is able to enter the bloodstream via daily rou tines, such as toothbrushing and flossing, and can invade the human coronary artery endothelial cells that line the blood vessel walls of the human artery, (51). The studies reported here focused on characterizing two mutants of Porphyromonas gingivalis wild type strain W83 and their abilities to invade and adhere to HCAEC, as well as to determination of the importance of these genes in other virulence mechanisms. Such analysis allows us to advance our knowledge of P. gingivalis as a pathogen and more completely understand the importance of this pathogen in inf ections and in cardiovascular disease. The two genes that were the focus of this investig ation, PG0092 and PG1683, were chosen because they were previously found to be up-regulated during invasion of HCAE C at several time points. The up-regulation of genes under specif ic conditions suggests a function or role for the gene products in these conditions. In the model of invasion of HCAEC, up-regulation of genes at earlier time points may suggest their involvement in adherence and/or entry whereas e xpression at later time points may suggest a function in persistence. PG1683 was found to be upregulated at 5 min, 1 and 2.5 h, therefore indicating a lik ely purpose in earlier events su ch as adherence, entry and trafficking, whereas PG0092 was found to be up-regulated at 2.5 h, indicating possible importance in trafficking and /or persistence. Pr ior to the work reported here, mutants in PG0092 and PG1683 had been constructed by allelic replacement to allow for mutational analysis to be completed. 71

PAGE 72

To this end and as reported here, mutational an alysis was used to examine the role of these genes in multiple assays related to virulence/pathogenesis. The two mutants were initially tested in adherence, invasion, and persistence assa ys. Both mutants, when grown in sTSB, demonstrated an increase in adherence to HCAE C but no difference in in vasive capabilities at 2.5 and 6 h, when compared to the parental wild type strain, W83. In extended invasion assays, the mutants and wild type all showed reduced persistence at 24 and 48 hrs. This was not surprising since P. gingivalis is difficult to culture at later time points (17). In addition, the mutants were tested in other virulence assays. Ne ither mutants, when grown in sTSB, exhibited a difference in hemolysis, hemmaglutination, or gi ngipain activity. Both mutant and wild type strains were devoid of fimbriae wh en grown overnight in sTSB. The mutants were further characterized as to biofilm phenotype. When grown in sTSB, no differences were detected for both mutants compared to the w ild type in homotypic biofilm formation. Scanning electron microscopy analysis of homotypic biofilm illustrated a difference in biofilm aggregation in both mutants when co mpared to wild-type W83 in that the mutants sporadically aggregated in long chains, and w ild type strain W83 fo rmed a flat, evenly distributed biofilm. Confocal microscopy also indi cated that the mutants formed taller peaks of biofilm when compared to W83. Differences were also determined using a heterotypic biofilm model, containing Porphyromonas gingivalis and Fusobacterium nucleatum 22586, which showed an increase in total biofilm production for W83 0092 at 48 hrs. All three strains made significantly more heterotypi c than homotypic biofilm. Contrastingly, different phenot ypes were observed when the P. gingivalis strains were cultured in a different medium (122).The most significant changes were changes in adherence, hemagglutination, biofilm formation and the pr esence/absence of fimbriae. When grown in 72

PAGE 73

sBHI, mutant W831683, was no longer able to agglutinate erythrocytes, did not form intact fimbriae and was totally impaired in biofilm formation, all in contrast to wild type W83. When mutant W83 0092 was cultured in this medium, it did not form fimbriae and was partially impaired in its ability to form biofilms, as comp ared to W83. Interestingly, all three strains had a significantly higher hemagglutinat ion titers when cultured in sT SB as compared to sBHI. Gene PG0092 (Putative ABC Transporter) PG0092 is classified as a putative ABC transpor ter in the TIGR databa se and is predicted to span the entire inner and outer membrane. Th e gene is homologous to an ABC transporter in Bacteroides fragilis and the predicted operon contains a HlYD family secretion protein. The expression profile of this gene was evaluated during invasion of HCAEC and was up-regulated 3.5 fold at 2.5 hours. In sTSB, a mutation in PG0092 did show an affect on adherence (an increase) but not invasion or persistence. However, when cultured in sBHI an opposite phenotype was observed, with a decrease in adhere nce and biofilm formation. This putative ABC transporter may facilitate the transp ort of some molecule that affects adherence. If adherence is changed, perhaps the dynamics of ba cterial entry is affected. It is likely that the difference in adherence is the result of a ch ange in surface structure. A change in surface structure may also expl ain the affect on biofilm formation. When mutant W83 0092 was cultured in sTSB an increase in biofilm height was also observed, suggesting that this mutation incr eases aggregation as well as adherence. However, when grown in sBHI, this mutant showed a reduction in th e formation of homotypic biofilm and adherence, showing an opposite phenotype. Interestingly, a study has shown that an ABC transporter of Listeria monocytogenes up-regulates biofilm formation (114) The change in biofilm formation may be related to the lack of fimbriae in the new media when compared to the wildtype. Regardless of mechanism, the data clearly indicate that PG0092 is important in adherence even if 73

PAGE 74

opposite affects are observed when cultured in tw o conditions. This mutation may be preventing the transport of a molecule that is responsible for surface structure formati on or the transport of a virulence factor that contributes to adherence. It will this be important to further characterize this mutant regarding the function of PG0092 transport. Gene PG1683 (Putative Glycosy l Hydrolase/Alpha Amylase) PG1683 is listed as a putative glycosyl hydrol ase/alpha amylase in the TIGR database. This gene is homol ogous to a gene in Parabacteroides distasonis and its predicted operon contains a glycogen debranching enzyme and a gl ycosyl transferase. Si nce this gene was found to be up-regulated at 0.5 min, 1 and 2.5 hours, this indicates that the gene most likely plays an important role during the earlier stages of invasion of HCAECs. However, when grown in sTSB, this mutant showed no difference in invasion, persistence, hemagglutinat ion, gingipain activity, or fimbriae expression. The only differences determined were in adherence (an increase) and biofilm height formation. Most significantly, however, when grown in sBHI, this mutant exhibited a drastic reduction in adherence, hom otypic biofilm formation, fimbriae expression and hemagglutination. Although the basis of this phenotype is unknow n, it can be speculated that PG1683 may be involved in the assembly of surface structures including functional fimbriae, since when this mutant was cultured in sBHI no fimbriae were de tected by electron microscopy in contrast to W83. Since the data it is indicated that W83 1683 expresses the major structural fimbrial protein, FimA, it is likely that it is not able to assemble functional fimbriae. Therefore, the loss of this gene product results in the inability to produce fimbriae in this environment The reduction in adherence and biofilm formation observed with this mutant may be due to the lack of fimbriae. This gene (including PG1683) may al so be able to degrade carbohydrates on the surface of the host or other cells, exposing an epit ope (cryptitope) or adhesion receptor that allow 74

PAGE 75

for increased adhesion and/or changes in car bohydrate surface structur es. Through this same mechanism, the absence of this process may lead to decrease hemagglutination, adherence, and fimbriae expression. Further Directions The experiments completed on these two mutant s have raised severa l questions. Since the mutants had different phenotypes wh en grown in different media, environmental factors must be responsible for a change in gene expressi on. Consequently, the identification of the component(s) of the media responsible for the difference in the phenotypes of the mutants should be determined. Thus a biochemical analysis of the media components a nd the identification of the environmental signal in the sBHI medium will be significant for future characterization of these mutants. In addition the examination of biofilms grown in the BHI broth and using confocal laser and scanning electron microscopy im aging techniques may prove inciteful. It will also be important to characterize the substr ate for the putative ABC transporter (PG0092), determine or confirm the function of both gene s and to characterize both of the operons. The construction of complemented strains would be he lpful in establishing that these mutations did not result in polar effects. P. gingivalis is internalized into HCAEC, turns on autophagy and then traffics within autophagic vacuoles. However, since P. gingivalis is an obligate anaerobe the question of how it survives within eukaryotic cells is significant. One reasonable hypothesis is that it creates a microenvironment within the endot helial cell vesicle that is anaer obic. However this remains an important question and studies need to be completed to analyze the process by which P. gingivalis can survive in aerobic cells. It is also important to study how the mutant genes, PG0092 and PG1683, might interact and affect vascul ar endothelial cells including the role of these genes in establishing a microenvironment for P. gingivalis intracellularly. These mutants 75

PAGE 76

may interact different from the wild-type with vascular endothelial cells and possibly provide us with a better understanding of the intracellular trafficking of P. gingivalis in HCAEC. The characterization of the phe notype of mutants in these ge nes has provided additional information regarding the role of these genes in P. gingivalis pathogenesis. However, the elucidation of the significance a nd roles of these genes in pat hogenesis, both oral and nonoral, associated with P. gingivalis infections will require additional studies. The important question is to find the important factor in the environment th at is leading to changes in phenotype and gene expression. 76

PAGE 77

REFERENCES (1) Albandar JM, Tinoco EM. Global epidemiol ogy of periodontal diseases in children and young persons Periodontology 2000 2002; 29: 153 176. (2) Lamont RJ, Jenkinson HF. Life below th e gum line: pathogenic mechanisms of Porphyromonas gingivalis. Microbiol Mol Biol Rev 1998; 62: 1244 1263. (3) Consensus report: Periodontal diseas es: pathogenesis and microbial factors. Ann Periodontol 1996; 1(1) : 926 32. (4) Socransky SS, Haffajee AD, Cugini MA, Smith C, Kent RL, Jr. Microbial complexes in subgingival plaque Journal of clinical periodontology 1998; 25: 134 144. (5) Bodet C, Chandad F, Grenier D. [Pathogenic potential of Porphyromonas gingivalis Treponema denticola and Tannerella forsythia the red bacterial complex associated with periodontitis] Pathologie-biologie 2007; 55: 154 162. (6) Mattila KJ, Nieminen MS, Valtonen VV, et al. Association between dental health and acute myocardial infarction BMJ (Clinical research ed 1989; 298: 779 781. (7) Cavrini F, Sambri V, Moter A, et al. Molecular detection of Treponema denticola and Porphyromonas gingivalis in carotid and aortic atheroma tous plaques by FISH: report of two cases. Journal of medical microbiology 2005; 54: 93 96. (8) Desvarieux M, Demmer RT, Rundek T, et al. Periodontal microbiota and carotid intimamedia thickness: the Oral Infections and Vascular Disease Epidemiology Study (INVEST) Circulation 2005; 111: 576 582. (9) Kuramitsu HK, Kang IC, Qi M. Interactions of Porphyromonas gingivalis with host cells: implications for cardiovascular diseases Journal of periodontology 2003; 74: 85 89. (10) Qi M, Miyakawa H, Kuramitsu HK. Porphyromonas gingivalis induces murine macrophage foam cell formation Microbial pathogenesis 2003; 35: 259 267. (11) Haraszthy VI, Zambon JJ, Trevisan M, Ze id M, Genco RJ. Identification of periodontal pathogens in atheromatous plaques Journal of periodontology 2000; 71: 1554 1560. (12) Gibson FC, 3rd, Hong C, Chou HH, et al. Inna te immune recognition of invasive bacteria accelerates atherosclerosis in a polipoprotein E-deficient mice Circulation 2004; 109: 2801 2806. (13) Lalla E, Lamster IB, Hofmann MA, et al. Oral infection with a periodontal pathogen accelerates early atherosclerosis in apolipoprotein E-null mice Arteriosclerosis, thrombosis, and vascular biology 2003; 23: 1405 1411. 77

PAGE 78

(14) Li L, Messas E, Batista EL, Jr., Levine RA, Amar S. Porphyromonas gingivalis infection accelerates the progression of atherosclerosi s in a heterozygous apolipoprotein Edeficient murine model Circulation 2002; 105: 861 867. (15) Jain A, Batista EL, Jr., Serhan C, Stahl GL, Van Dyke TE. Role for periodontitis in the progression of lipid depos ition in an animal model Infection and immunity 2003; 71: 6012 6018. (16) Brodala N, Merricks EP, Bellinger DA, et al. Porphyromonas gingivalis bacteremia induces coronary and aor tic atherosclerosis in normocholesterolemic and hypercholesterolemic pigs Arteriosclerosis, thrombosis, and vascular biology 2005; 25 : 1446 1451. (17) Kozarov EV, Dorn BR, Shelburne CE Dunn WA, Jr., Progulske-Fox A. Human atherosclerotic plaque co ntains viable invasive Actinobacillus actinomycetemcomitans and Porphyromonas gingivalis. Arteriosclerosis, thrombosis, and vascular biology 2005; 25: e17 18. (18) Dorn BR, Dunn WA, Jr., Progulske-Fox A. Invasion of human coronary artery cells by periodontal pathogens Infection and immunity 1999; 67: 5792 5798. (19) Amar S, Wu SC, Madan M. Is Porphyromonas gingivalis cell invasion required for atherogenesis? Pharmacotherapeutic implications J Immunol 2009; 182: 1584 1592. (20) Joly AS, Myriam Belanger, Georgi a K. Johnson, Ann Progulske-Fox, and Kin A. Brogden. Infection with Porphyromonas gingivalis a Potential Risk Factor for Chronic Systemic Disease, In: Pina M. Fr atamico JLS, and Kim A. Brogden, ed. Post-infectious Sequelae and Long-term Consequences of Infectious Diseases Washington D.C.: ASM Press, 2009: 443 457. (21) Offenbacher S. Periodon tal diseases: pathogenesis Annals of periodontology / the American Academy of Periodontology 1996; 1: 821 878. (22) Loppnow H, Werdan K, Buerke M. Vascul ar cells contribute to atherosclerosis by cytokineand innate-immunity-related inflammatory mechanisms Innate immunity 2008; 14: 63 87. (23) Holt SC, Kesavalu L, Walker S, Genco CA. Virulence factors of Porphyromonas gingivalis. Periodontology 2000 1999; 20: 168 238. (24) Carroll GC, Sebor RJ. De ntal flossing and its relati onship to transient bacteremia Journal of periodontology 1980; 51: 691 692. (25) Lamont RJ, Hersey SG, Rosan B. Characterization of the adherence of Porphyromonas gingivalis to oral streptococci. Oral microbiology and immunology 1992; 7: 193 197. 78

PAGE 79

(26) Kolenbrander PE, Andersen RN, Blehert DS, Egland PG, Foster JS, Palmer RJ, Jr. Communication among oral bacteria Microbiol Mol Biol Rev 2002; 66: 486 505. (27) Theilade E. Factors controlling the microflora of the healthy mouth Boca Raton, Fla.: CRC Press, Inc., 1990: 1 56. (28) Goulbourne PA, Ellen RP. Evidence that Porphyromonas (Bacteroides) gingivalis fimbriae function in adhesion to Actinomyces viscosus. Journal of bacteriology 1991; 173: 5266 5274. (29) Grenier D. Demonstration of a bimodal coaggregation reaction between Porphyromonas gingivalis and Treponema denticola. Oral microbiology and immunology 1992; 7: 280 284. (30) Yao ES, Lamont RJ, Leu SP, Weinberg A. Interbacterial binding among strains of pathogenic and commensal oral bacterial species Oral microbiology and immunology 1996; 11: 35 41. (31) Kolenbrander PE AR, Clemans DL, Whittaker CJ, Klier CM. Potential role of functionally coaggregation mediat ors in bacterial suspension : Cardiff: Bioline, 1999: 171 186. (32) Rosan B, Lamont RJ. Dental plaque formation Microbes and infection / Institut Pasteur 2000; 2: 1599 1607. (33) Kuramitsu HK, He X, Lux R, Anderson MH, Sh i W. Interspecies interactions within oral microbial communities. Microbiol Mol Biol Rev 2007; 71: 653 670. (34) Nakamura T, Amano A, Nakagawa I, Hamada S. Specific in teractions between Porphyromonas gingivalis fimbriae and human extracellular matrix proteins FEMS microbiology letters 1999; 175: 267 272. (35) Davey ME, Duncan MJ. Enhanced biofilm formation and loss of capsule synthesis: deletion of a putative glycosyltransferase in Porphyromonas gingivalis. Journal of bacteriology 2006; 188: 5510 5523. (36) Ellen RP, Lepine G, Nghiem PM. In vitr o models that support adhesion specificity in biofilms of oral bacteria Advances in dental research 1997; 11: 33-42. (37) Lamont RJ, Jenkinson HF. Subgingival colonization by Porphyromonas gingivalis. Oral microbiology and immunology 2000; 15: 341 349. (38) Darenfed H, Grenier D, Mayra nd D. Acquisition of plasmin activity by Fusobacterium nucleatum subsp. nucleatum and potential contri bution to tissue destruction during periodontitis Infection and immunity 1999; 67: 6439 6444. 79

PAGE 80

(39) Dzink JL, Socransky SS, Haffajee AD. The predominant cultivable microbiota of active and inactive lesions of destructive periodontal diseases Journal of clinical periodontology 1988; 15 : 316 323. (40) Moore WE, Holdeman LV, Smibert RM, et al Bacteriology of experi mental gingivitis in young adult humans. Infection and immunity 1982; 38: 651 667. (41) Moore WE, Holdeman LV, Cato EP, Smibert RM, Burmeister JA, Ranney RR. Bacteriology of moderate (chronic) periodontitis in mature adult humans Infection and immunity 1983; 42: 510 515. (42) Moore WE, Holdeman LV, Cato EP, et al. Comparative bacteriology of juvenile periodontitis Infection and immunity 1985; 48: 507 519. (43) Diaz PI, Zilm PS, Rogers AH. Fusobacterium nucleatum supports the growth of Porphyromonas gingivalis in oxygenated and carbon-dioxide-depleted environments Microbiology (Reading, England) 2002; 148: 467 472. (44) Beachey EH, Courtney HS. Bacterial adherence: the attach ment of group A streptococci to mucosal surfaces Reviews of infectious diseases 1987; 9 Suppl 5: S475 481. (45) Dickinson DP, Kubiniec MA, Yoshimur a F, Genco RJ. Molecular cloning and sequencing of the gene encoding the fimbrial subunit protein of Bacteroides gingivalis. Journal of bacteriology 1988; 170: 1658 1665. (46) Abraham SN, Beachey EH. Bindi ng of bacteria to mucosal surfaces Monographs in allergy 1988; 24: 38 43. (47) Gaastra W, de Graaf FK. Host-specific fi mbrial adhesins of noni nvasive enterotoxigenic Escherichia coli strains Microbiological reviews 1982; 46: 129 161. (48) Hamada N, Sojar HT, Cho MI, Genco RJ Isolation and characterization of a minor fimbria from Porphyromonas gingivalis. Infection and immunity 1996; 64: 4788 4794. (49) Ogawa T, Yasuda K, Yamada K, Mori H, Ochiai K, Hasegawa M. Immunochemical characterisation and epitope mapping of a novel fimbrial protein (Pg-II fimbria) of Porphyromonas gingivalis. FEMS immunology and medical microbiology 1995; 11: 247 255. (50) Lee JY, Sojar HT, Bedi GS, Genco RJ. Porphyromonas (Bacteroides) gingivalis fimbrillin: size, amino-terminal sequence, and antigenic heterogeneity Infection and immunity 1991; 59: 383 389. (51) Dorn BR, Burks JN, Seifert KN, ProgulskeFox A. Invasion of endot helial and epithelial cells by strains of Porphyromonas gingivalis. FEMS microbiology letters 2000; 187: 139 144. 80

PAGE 81

(52) Njoroge T, Genco RJ, Sojar HT, Hamada N, Genco CA. A role for fimbriae in Porphyromonas gingivalis invasion of oral epithelial cells Infection and immunity 1997; 65: 1980 1984. (53) Lin X, Wu J, Xie H. Porphyromonas gingivalis minor fimbriae are required for cell-cell interactions Infection and immunity 2006; 74: 6011 6015. (54) Nishiyama S, Murakami Y, Nagata H, Shizukuishi S, Kawagishi I, Yoshimura F. Involvement of minor components associ ated with the FimA fimbriae of Porphyromonas gingivalis in adhesive functions Microbiology (Reading, England) 2007; 153: 1916 1925. (55) Wang M, Shakhatreh MA, James D, et al. Fimbri al proteins of Porphyromonas gingivalis mediate in vivo virulence and exploit TLR2 and complement receptor 3 to persist in macrophages J Immunol 2007; 179: 2349 2358. (56) Yoshimura F, Murakami Y, Nishikawa K, Hasegawa Y, Kawaminami S. Surface components of Porphyromonas gingivalis. Journal of periodontal research 2009; 44: 1 12. (57) Kuboniwa M, Amano A, Hashino E, et al Distinct roles of long/short fimbriae and gingipains in homotypic biofilm development by Porphyromonas gingivalis. BMC microbiology 2009; 9: 105. (58) Umemoto T, Hamada N. Ch aracterization of biologically active cell surf ace components of a periodontal pathogen. The role s of major and minor fimbriae of Porphyromonas gingivalis. Journal of periodontology 2003; 74: 119 122. (59) Han N, Whitlock J, Progulske-Fox A. The hemagglutinin gene A (hagA) of Porphyromonas gingivalis 381 contains four large, contiguous, direct repeats Infection and immunity 1996; 64: 4000 4007. (60) Progulske-Fox A, Tumwasorn S, Holt SC. The expression and function of a Bacteroides gingivalis hemagglutinin gene in Escherichia coli. Oral microbiology and immunology 1989; 4: 121 131. (61) Lepine G, Ellen RP, Progulske-Fox A. C onstruction and preliminar y characterization of three hemagglutinin mutants of Porphyromonas gingivalis. Infection and immunity 1996; 64: 1467 1472. (62) Lepine G, Progulske-Fox A. Duplication and differential expression of hemagglutinin genes in Porphyromonas gingivalis. Oral microbiology and immunology 1996; 11: 65 78. 81

PAGE 82

(63) Progulske-Fox A, Tumwasor n S, Lepine G, et al. The cloning, expression and sequence analysis of a second Porphyromonas gingivalis gene that codes for a protein involved in hemagglutination Oral microbiology and immunology 1995; 10: 311 318. (64) Song H, Belanger M, Whitlock J, Kozarov E, Progulske-Fox A. Hemagglutinin B is involved in the adherence of Porphyromonas gingivalis to human coronary artery endothelial cells Infection and immunity 2005; 73: 7267 7273. (65) Boyd J, McBride BC. Fractionation of hema gglutinating and bacter ial binding adhesins of Bacteroides gingivalis. Infection and immunity 1984; 45: 403 409. (66) Inoshita E, Amano A, Hanioka T, Tamaga wa H, Shizukuishi S, Tsunemitsu A. Isolation and some properties of exohemagglutinin from the culture medium of Bacteroides gingivalis 381. Infection and immunity 1986; 52 : 421 427. (67) Grenier D. Further evidence for a possible ro le of trypsin-like activity in the adherence of Porphyromonas gingivalis. Canadian journal of microbiology 1992; 38: 1189 1192. (68) Hoover CI, Ng CY, Felton JR. Correlation of haemagglutination activ ity with trypsin-like protease activity of Porphyromonas gingivalis. Archives of oral biology 1992; 37: 515 520. (69) Nishikata M, Yoshimura F. Characterization of Porphyromonas (bacteroides) gingivalis hemagglutinin as a protease Biochemical and biophysical research communications 1991; 178: 336 342. (70) Nishikata M, Yoshimura F. Active site structure of a hemagglutinating protease from Porphyromonas gingivalis : similarity to clostripain Biochemistry and molecular biology international 1995; 37: 547 553. (71) Progulske-Fox A, Kozarov E, Dorn B, Dunn W, Jr., Burks J, Wu Y. Porphyromonas gingivalis virulence factors and invasion of cells of the cardiovascular system Journal of periodontal research 1999; 34: 393 399. (72) Pike R, McGraw W, Potempa J, Travis J. Lysineand arginine-spe cific proteinases from Porphyromonas gingivalis Isolation, characterization, a nd evidence for th e existence of complexes with hemagglutinins The Journal of biological chemistry 1994; 269: 406 411. (73) Chandad F, Mouton C. Antigenic, struct ural, and functional re lationships between fimbriae and the hemagglutinating adhesin HA-Ag2 of Porphyromonas gingivalis. Infection and immunity 1995; 63: 4755 4763. (74) Chu L, Bramanti TE, Ebersole JL, Holt SC Hemolytic activity in the periodontopathogen Porphyromonas gingivalis : kinetics of enzyme release and localization Infection and immunity 1991; 59: 1932 1940. 82

PAGE 83

(75) Mayrand D, Holt SC. Biology of asaccharol ytic black-pigmented Bacteroides species Microbiological reviews 1988; 52: 134 152. (76) Wooldridge KG, Williams PH. Iron upt ake mechanisms of pathogenic bacteria FEMS microbiology reviews 1993; 12: 325 348. (77) Kozarov E, Sweier D, Shelburne C, Progulske-Fox A, Lopatin D. Detection of bacterial DNA in atheromatous plaques by quantitative PCR Microbes and infection / Institut Pasteur 2006; 8: 687 693. (78) NM OB-S, Veith PD, Dashper SG, Reynolds EC. Porphyromonas gingivalis gingipains: the molecular teeth of a microbial vampire Current protein & peptide science 2003; 4: 409 426. (79) Lewis JP, Dawson JA, Hannis JC, Muddiman D, Macrina FL. Hemoglobinase activity of the lysine gingipain protease (Kgp) of Porphyromonas gingivalis W83 Journal of bacteriology 1999; 181: 4905 4913. (80) Slakeski N, Bhogal PS, O'Brien-Simpson NM, Reynolds EC. Characterization of a second cell-associated Arg-specif ic cysteine proteinase of Porphyromonas gingivalis and identification of an adhesin-bi nding motif involved in associ ation of the prtR and prtK proteinases and adhesins into large complexes. Microbiology (Reading, England) 1998; 144 ( Pt 6) : 1583 1592. (81) Imamura T. The role of gingipains in the pathogenesis of periodontal disease Journal of periodontology 2003; 74 : 111 118. (82) Chen T, Nakayama K, Belliveau L, Duncan MJ. Porphyromonas gingivalis gingipains and adhesion to epithelial cells Infection and immunity 2001; 69: 3048 3056. (83) Hinode D, Nagata A, Ichimiya S, Hayash i H, Morioka M, Nakamura R. Generation of plasma kinin by three types of protease isolated from Porphyromonas gingivalis 381 Archives of oral biology 1992; 37: 859 861. (84) Kaminishi H, Cho T, Itoh T, et al. Vascular permeability enhancing activity of Porphyromonas gingivalis protease in guinea pigs FEMS microbiology letters 1993; 114: 109 114. (85) Imamura T, Pike RN, Potempa J, Travis J. Pathogenesis of periodontitis: a major arginine-specific cystei ne proteinase from Porphyromonas gingivalis induces vascular permeability enhancement through activati on of the kallikrein/kinin pathway The Journal of clinical investigation 1994; 94: 361 367. 83

PAGE 84

(86) Imamura T, Potempa J, Pike RN, Travis J. Dependence of vascular permeability enhancement on cysteine proteinases in vesicles of Porphyromonas gingivalis. Infection and immunity 1995; 63: 1999 2003. (87) Imamura T, Potempa J, Pike RN, Moore JN Barton MH, Travis J. Effect of free and vesicle-bound cysteine proteinases of Porphyromonas gingivalis on plasma clot formation: implications for bleeding tendency at periodontitis sites Infection and immunity 1995; 63: 4877 4882. (88) Labrecque J, Bodet C, Chandad F, Gren ier D. Effects of a high-molecular-weight cranberry fraction on growth, biof ilm formation and adherence of Porphyromonas gingivalis. The Journal of antimicrobial chemotherapy 2006; 58: 439 443. (89) Yamada M, Ikegami A, Kuramits u HK. Synergistic biofilm formation by Treponema denticola and Porphyromonas gingivalis. FEMS microbiology letters 2005; 250: 271 277. (90) Tokuda M, Chen W, Karunakaran T, Kura mitsu HK. Regulation of protease expression in Porphyromonas gingivalis. Infection and immunity 1998; 66: 5232 5237. (91) Banbula A, Bugno M, Kuster A, Heinrich PC, Travis J, Potempa J. Rapid and efficient inactivation of IL-6 gingipains, lysineand arginine-specifi c proteinases from Porphyromonas gingivalis. Biochemical and biophysical research communications 1999; 261: 598 602. (92) Shibata Y, Hiratsuka K, Hayakawa M, et al. A 35-kDa co-aggrega tion factor is a hemin binding protein in Porphyromonas gingivalis. Biochemical and biophysical research communications 2003; 300 : 351 356. (93) Imamura T, Travis J, Potempa J. The biphasic virulence activ ities of gingipains: activation and inactiva tion of host proteins Current protein & peptide science 2003; 4: 443 450. (94) Ofek I, Sharon N. Adhesins as lect ins: specificity and role in infection Current topics in microbiology and immunology 1990; 151: 91 113. (95) Detilleux PG, Deyoe BL, Cheville NF. Penetration and intracellular growth of Brucella abortus in nonphagocytic cells in vitro Infection and immunity 1990; 58 : 2320 2328. (96) Gaillard JL, Berche P, Mounier J, Richard S, Sansonetti P. In vitro model of penetration and intracellular growth of Li steria monocytogenes in the hu man enterocyte-like cell line Caco-2 Infection and immunity 1987; 55: 2822 2829. (97) Finlay BB, Ruschkowski S, Dedhar S. Cytoskeletal rearrangements accompanying salmonella entry into epithelial cells. Journal of cell science 1991; 99 ( Pt 2) : 283 296. 84

PAGE 85

(98) Clerc P, Sansonetti PJ. Entry of Shigella flexneri into HeLa cells: evidence for directed phagocytosis involving actin polyme rization and myosin accumulation Infection and immunity 1987; 55: 2681 2688. (99) Lamont RJ, Chan A, Belton CM, Izutsu KT, Vasel D, Weinberg A. Porphyromonas gingivalis invasion of gingi val epithelial cells Infection and immunity 1995; 63: 3878 3885. (100) Meyer DH, Sreenivasan PK, Fives-Taylor PM. Evidence for invasion of a human oral cell line by Actinobacillus actinom ycetemcomitans. Infection and immunity 1991; 59 : 2719 2726. (101) High N, Mounier J, Prevost MC, Sansonetti PJ. IpaB of Shigella flexneri causes entry into epithelial cells and escap e from the phagocytic vacuole The EMBO journal 1992; 11: 1991 1999. (102) Meyer DH, Lippmann JE, Fives-Taylor PM. Invasion of epithelial cells by Actinobacillus actinomycetemcomitans : a dynamic, multistep process. Infection and immunity 1996; 64: 2988 2997. (103) Small PL, Isberg RR, Falkow S. Comp arison of the ability of enteroinvasive Escherichia coli Salmonella typhimurium, Yersinia pseudotuberculosis and Yersinia enterocolitica to enter and replicate within HEp-2 cells Infection and immunity 1987; 55 : 1674 1679. (104) Deshpande RG, Khan M, Genco CA. I nvasion strategies of the oral pathogen Porphyromonas gingivalis : implications for cardiovascular disease Invasion & metastasis 1998; 18: 57 69. (105) Cutler CW, Jotwani R, Palucka KA, Davous t J, Bell D, Banchereau J. Evidence and a novel hypothesis for the role of dendritic cells and Porphyromonas gingivalis in adult periodontitis Journal of periodontal research 1999; 34: 406 412. (106) Jandik KA, Belanger M, Low SL, Dorn BR, Yang MC, Progulske-Fox A. Invasive Yersinia pestis differences among Porphyromonas gingivalis strains from healthy and diseased periodontal sites Journal of periodontal research 2008; 43: 524 530. (107) Deshpande RG, Khan MB, Genco CA. Invasi on of aortic and heart endothelial cells by Porphyromonas gingivalis. Infection and immunity 1998; 66: 5337 5343. (108) Xie H, Cai S, Lamont RJ. Environmenta l regulation of fimbrial gene expression in Porphyromonas gingivalis. Infection and immunity 1997; 65: 2265 2271. (109) Belanger M, Rodrigues PH, Dunn WA, Jr., Progulske-Fox A. Autophagy: a highway for Porphyromonas gingivalis in endothelial cells Autophagy 2006; 2: 165 170. 85

PAGE 86

(110) Rodrigues PH, Progulske-Fox A. Gene expression profile analysis of Porphyromonas gingivalis during invasion of human corona ry artery endothelial cells Infection and immunity 2005; 73: 6169 6173. (111) Nelson KE, Fleischmann RD, DeBoy RT, et al. Complete genome sequence of the oral pathogenic Bacterium Porphyromonas gingivalis strain W83. Journal of bacteriology 2003; 185: 5591 5601. (112) Belanger M, Rodrigues P, Progulske-Fox A. Genetic manipulation of Porphyromonas gingivalis. Curr Protoc Microbiol 2007; Chapter 13 : Unit13C. 12. (113) Li L, Michel R, Cohen J, Decarlo A, Kozar ov E. Intracellular survival and vascular cellto-cell transmission of Porphyromonas gingivalis. BMC microbiology 2008; 8: 26. (114) Zhu X, Long F, Chen Y, Knochel S, She Q, Shi X. A putative ABC transporter is involved in negative regulati on of biofilm formation by Listeria monocytogenes. Applied and environmental microbiology 2008; 74: 7675 7683. (115) Erickson DL, Jarrett CO, Callison JA, Fischer ER, Hinnebusch BJ. Loss of a biofilminhibiting glycosyl hydrolase during the emergence of Journal of bacteriology 2008; 190: 8163 8170. (116) Kaplan JB, Velliyagounder K, Ragunath C, et al. Genes involved in the synthesis and degradation of matrix polysaccharide in Actinobacillus actinomycetemcomitans and Actinobacillus pleuropneumoniae biofilms Journal of bacteriology 2004; 186: 8213 8220. (117) Saito Y, Fujii R, Nakagawa KI, Kuram itsu HK, Okuda K, Ishihara K. Stimulation of Fusobacterium nucleatum biofilm formation by Porphyromonas gingivalis. Oral microbiology and immunology 2008; 23: 1 6. (118) Forng RY, Champagne C, Simpson W, Genco CA. Environmental cues and gene expression in Porphyromonas gingivalis and Actinobacillus actinomycetemcomitans. Oral diseases 2000; 6: 351 365. (119) Kiyama-Kishikawa M, Hiratsuka K, Abiko Y. Gene expression profiling and characterization under hemin limitation in Porphyromonas gingivalis. Journal of oral science 2005; 47: 191 197. (120) Dashper SG, Ang CS, Veith PD, et al. Response of Porphyromonas gingivalis to heme limitation in continuous culture Journal of bacteriology 2009; 191: 1044 1055. (121) Masuda T, Murakami Y, Noguchi T, Yosh imura F. Effects of various growth conditions in a chemostat on expression of virulence factors in Porphyromonas gingivalis. Applied and environmental microbiology 2006; 72: 3458 3467. 86

PAGE 87

(122) Handley PS, Tipler LS. An electron microscope survey of the surface structures and hydrophobicity of oral and nonoral species of the bact erial genus Bacteroides Archives of oral biology 1986; 31: 325 335. (123) Robinson JM, Karnovsky MJ. Ultrastructural localization of seve ral phosphatases with cerium J Histochem Cytochem 1983; 31: 1197 1208. 87

PAGE 88

88 BIOGRAPHICAL SKETCH Jennifer Nina Rainho was born in Newark, NJ to Portuguese immigrants, Gloria and Joseph Rainho. She attended Queen of Peace High School in North Arlington, NJ and graduated in May 1999. In 2002, Jennifer earned an Associate of Arts degree in Bu siness at Union County College in Cranford, NJ. Jennifer went on to attend Kean University in Union, NJ, where she served as a Secretary for the Student Organizatio n Inc. and the American Chemical Society. She was a member of Beta Beta Beta Biological Honor s Society and Theta Phi Alpha Fraternity Inc. During 2004, Jennifer began research in the labor atory of Dr. My Abdelmajid Kassem of the Botany Department in which she assisted in the mapping of soybean traits and was co-author of two published peer reviewed papers. In December 2005, she graduated from Kean University with a Bachelors of Science in Biology and worked as a temporary employee at ColgatePalmolive Corporation. In the fall of 2007, Jennife r entered the College of Medicines M.S. program at the University of Florida and bega n conducting research in the laboratory of Dr. Progulske-Fox. During her time at the University of Florida, Jennifer placed first at the Seventh Annual University of Florida College of Den tistry Research Day in the Masters/Resident division. In the fall of 2009, Jennifer will be enro lling in the Ph.D. Program in Biomedical Sciences at the University of Miami.