<%BANNER%>

Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2011-08-31.

Permanent Link: http://ufdc.ufl.edu/UFE0025081/00001

Material Information

Title: Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2011-08-31.
Physical Description: Book
Language: english
Creator: Lomba Otero, Paula
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: Agronomy -- Dissertations, Academic -- UF
Genre: Agronomy thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Statement of Responsibility: by Paula Lomba Otero.
Thesis: Thesis (M.S.)--University of Florida, 2009.
Local: Adviser: Altpeter, Fredy.
Electronic Access: INACCESSIBLE UNTIL 2011-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0025081:00001

Permanent Link: http://ufdc.ufl.edu/UFE0025081/00001

Material Information

Title: Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2011-08-31.
Physical Description: Book
Language: english
Creator: Lomba Otero, Paula
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: Agronomy -- Dissertations, Academic -- UF
Genre: Agronomy thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Statement of Responsibility: by Paula Lomba Otero.
Thesis: Thesis (M.S.)--University of Florida, 2009.
Local: Adviser: Altpeter, Fredy.
Electronic Access: INACCESSIBLE UNTIL 2011-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0025081:00001


This item has the following downloads:


Full Text

PAGE 1

EVALUATION OF TRANSGENIC STRATEGIES TO ENHANCE TURF QUALITY OF BAHIAGRASS ( Paspalum notatum FLGGE) By PAULA NOEMI LOMBA OTERO A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2009 1

PAGE 2

2009 Paula Noem Lomba Otero 2

PAGE 3

To my family and friends for their unconditiona l love and support And in loving memory of my grandfather 3

PAGE 4

ACKNOWLEDGMENTS I am grateful to my thesis advisor, Dr. Fredy Altpeter, for his guidance, patience, encouragement and support. His knowledge and expertise in plant molecular biology improved my research skills, and prepared me for future challenges. I thank my other committee members, Dr. Kevin E. Kenworthy, Dr. Thomas R. Sinclair and Dr. Wilfred Vermerris for their time and effort and their helpful suggesti ons and comments during my study. I thank all the lab members I have had the pleasu re of interacting with for all their help and support. I thank Dr. Hagning Zhang and Dr. Mrinalini Agharkar for their training and assistance with laboratory work. A special thanks goes to all the undergraduate assist ants and interns that assisted me in my research. I would especia lly like to thank Isaac Neibaur and Dr. Sukhpreet Sandhu for their friendship and suppo rt in and out of the lab. I would like to acknowledge the staff at the Pl ant Science Research and Education Unit for all of their support and help. My gratitude also goes to Meghan Brennan and James Colee from IFAS Statistics and Golam Rasul assisting me w ith statistical analysis. I also thank Southwest Florida Water Management District fo r funding this research project. 4

PAGE 5

TABLE OF CONTENTS page ACKNOWLEDGMENTS ............................................................................................................... 4LIST OF TABLES ...........................................................................................................................7LIST OF FIGURES .........................................................................................................................8ABSTRACT ...................................................................................................................... .............12 CHAPTER 1 INTRODUCTION AND RATIONALE .................................................................................142 LITERATURE REVIEW .......................................................................................................18Bahiagrass ( Paspalum notatum Flgge) .................................................................................18The Genus Paspalum L. ..................................................................................................18Importance and Use .........................................................................................................18Origin and Distribution ....................................................................................................19Botanical Characteristics .................................................................................................20Ploidy and Cytology ........................................................................................................20Agronomic Attributes ......................................................................................................21cv Argentine ..................................................................................................................22Strategies for Improvement of th e Turf Quality of Bahiagrass ..............................................22Traditional Breeding of Bahiagrass .................................................................................22Genetic Transformation of Tu rf and Forage Grasses ......................................................23Transgenic Turf and Forage Grasses ........................................................................26Transgenic Bahiagrass ..............................................................................................26Transgenic Strategies for Improveme nt of Bahiagrass Turf Quality ..............................27AtGA2ox1 .................................................................................................................27ATHB16 ....................................................................................................................283 MATERIALS AND METHODS ...........................................................................................29Transgenic Lines and E xperimental Controls .........................................................................29Field Evaluation .............................................................................................................. ........29Field Study I ................................................................................................................. ...29Propagation, Establishment and Field Site ...............................................................29Fertility and Management ........................................................................................30Evaluation Techniques .............................................................................................30Statistical Analysis ...................................................................................................31Field Study II ................................................................................................................ ...31Propagation, Establishment and Field Site ...............................................................31Fertility and Management ........................................................................................32Mowing and Irrigation Treatments ..........................................................................32 5

PAGE 6

Evaluation Techniques .............................................................................................33Statistical Analysis ...................................................................................................35Regulatory Compliance ......................................................................................................... .35Evaluation of Stable Transgene Expression of Field Grown Vegetative Progeny .................364 RESULTS AND DISCUSSION .............................................................................................40ATGA2ox1 Expressing Lines (B Lines) ..................................................................................40Results .............................................................................................................................40Field Study I .............................................................................................................40Field Study II ............................................................................................................41Discussion .................................................................................................................... ....51ATHB16 Expressing Lines (I Lines) .......................................................................................55Results .............................................................................................................................55Field Study I .............................................................................................................55Field Study II ................................................................................................................ ...57Discussion .................................................................................................................... ....655 SUMMARY AND CONCLUSIONS ...................................................................................109APPENDIX A: PROTOCOLS USED FOR FIELD EVALUATION OF TRANSGENIC BAHIAGRASS .................................................................................................................... .114Measuring Maximum Quantum Yield of Dark-Adapted Leaves with PAM 2100 ..............114Taking Measurements ...................................................................................................114Exiting Program and Turning Off .................................................................................114Transfering Data to the Computer .................................................................................114APPENDIX B: LABORATORY PROT OCOLS FOR EVALUATION OF STABLE TRANSGENE EXPRESSION OF TRANSG ENIC BAHIAGRASS VEGETATIVE PROGENY UNDER FIELD CONDITIONs ........................................................................115Purification of Total RNA using the RN easy Plant Mini Kit from Qiagen .......................115DNase Treatment using the RNase-Free DNase Set from Qiagen .......................................116Using the Nanodrop ND-1000 Spectrophotometer ..............................................................116cDNA Synthesis using the iScript cDNA Synthesis Kit from Bio-Rad ...........................116Basic RT-PCR Set-up using the HotStarT aq DNA Polymerase from Qiagen ..................117LIST OF REFERENCES .............................................................................................................118BIOGRAPHICAL SKETCH .......................................................................................................134 6

PAGE 7

LIST OF TABLES Table page 4-1 Emergence of inflorescences in AtGA2ox1 expressing lines (B11, B3, B6, B7, B9) and wild-type bahiagrass (W T) under field conditions. .....................................................724-2 Emergence of inflorescences of ATHB16 transgenic lines (I10, I32, I4) compared to wild-type bahiagrass (WT). ...............................................................................................91 7

PAGE 8

LIST OF FIGURES Figure page 3-1 Propagation and field establishment. .................................................................................373-2 Field study layout. ..................................................................................................... ........383-3 Total monthly rainfall and irrigation recei ved by full, moderate and no irrigation plots during seasonal drought. ...........................................................................................393-4 State vehicle loaded with transgenic plant material enclosed in double container ............394-1 Density of AtGA2ox1 expressing bahiagrass lines (B11, B3, B6, B7, B9) and wildtype bahiagrass (WT) and St. Augustinegrass (SA). .........................................................694-2 Field establishment of AtGA2ox1 expressing lines (B11, B 3, B6, B7, B9) and wildtype bahiagrass (WT) and St. Augustinegrass (SA). .........................................................70 4-3 Dry weight of cli ppings produced under weekly mowing four weeks after establishment by AtGA2ox1 expressing lines (B11, B3, B 6, B7, B9) and wild-type bahiagrass (WT) and St. Augustinegrass (SA). .................................................................714-4 Mowing quality of AtGA2ox1 expressing lines (B11, B3, B 6, B7, B9) and wild-type bahiagrass (WT). .............................................................................................................. ..714-5 Length of fully expanded inflorescence stems (without racemes) of AtGA2ox1 expressing lines (B11, B3, B6, B7, B9) and wild-type bahiagrass (WT). 0.05 ................724-6 Number of tillers produced in a 100 cm2 by AtGA2ox1 expressing lines (B10, B3, B7, B8) and wild-type bahiagrass (WT). ...........................................................................734-7 Density of AtGA2ox1 expressing bahiagrass lines (B 10, B3, B7, B8) and wild-type bahiagrass (WT) and St. Augustinegrass (SA) .................................................................744-8 Comparison of fully established AtGA2ox1 lines (B3, B7) and wild-type (WT). ............754-9 Field establishment of AtGA2ox1 expressing bahiagrass lines (B11, B3, B6, B7, B9) and wild-type bahiagrass (WT) and St. Augustinegrass (SA). ..........................................754-10 Dry weight of c lippings produced by AtGA2ox1 expressing lines (B11, B3, B6, B7, B9) and wild-type bahiagrass (W T) and St. Augustinegrass (SA) ...................................764-11 Visual ratings for resistance to weed encroachment of AtGA2ox1 expressing lines (B11, B3, B6, B7, B9) and wild-type bahi agrass (WT) and St. Augustinegrass (SA) .....774-12 Spring green-up of AtGA2ox1 expressing lines (B11, B3, B6, B7, B9) and wild-type bahiagrass (WT) and St. Augustinegrass (SA). .................................................................78 8

PAGE 9

4-13 Drought tolerance of AtGA2ox1 expressing lines (B11, B3, B6, B7, B9) and wildtype bahiagrass (WT) and St. Augustinegrass (SA). .........................................................794-14 Drought tolerance of AtGA2ox1 expressing lines (B11, B3, B6, B7, B9) and wildtype bahiagrass (WT) and St. Augustinegrass (SA) .........................................................804-15 Drought tolerance of AtGA2ox1 expressing lines (B11, B3, B6, B7, B9) and wildtype bahiagrass (WT) and St. Augustinegrass (SA). .........................................................814-16 Drought tolerance of AtGA2ox1 expressing lines (B11, B3, B6, B7, B9) and wildtype bahiagrass (WT) and St. Augustinegrass (SA). .........................................................824-17 Maximum quantum yield of dark-adapted leaves of transgenic lines (B10, B3, B7, B8), St. Augustinegrass (S) and wild-type bahiagrass (WT). ............................................824-18 SPAD meter readings of tr ansgenic lines (B10, B3, B7, B8), St. Augustinegrass (SA) and wild-type bahi agrass (WT). .........................................................................................834-19 Dry weight of rhizomes produced by AtGA2ox1 expressing lines (B11, B3, B6, B7, B9) and wild-type bahiagrass (WT) and St. Augustinegrass (SA) in non-irrigated plots. ...................................................................................................................................844-20 Dry weight of roots produced by AtGA2ox1 expressing lines (B11, B3, B6, B7, B9) and wild-type bahiagrass (W T) and St. Augustinegrass (SA) in non-irrigated plots. .......844-21 Inflorescences produced by AtGA2ox1 expressing lines (B11, B3, B6, B7, B9) and wild-type bahiagrass (WT). ...............................................................................................854-22 Total inflorescences produced by AtGA2ox1 expressing lines (B11, B3, B6, B7, B9) and wild-type bahi agrass (WT). .........................................................................................864-23 Average length of inflorescence stems w ithout racemes per field plot produced by AtGA2ox1 expressing lines (B11, B3, B6, B7, B9 ) and wild-type bahiagrass (WT). .......874-24 RT-PCR analysis for expression of the AtGA2ox1 gene using specific primers for amplification of cDNA from transgenic li nes (B11, B3, B6, B7, B9) compared to WT and plasmid UbiGAox1 ..............................................................................................874-25 Phenotypic differences observed between ATHB16 expressing lines (I4, I10, I32) and wild-type bahiagrass (WT). ...............................................................................................884-26 Field establishment of ATHB16 expressing bahiagrass lines (I4, I10, I32) and wildtype bahiagrass (WT) and St. Augustinegrass (SA). .........................................................894-27 Dry weight of clippi ngs produced under weekly mowing four weeks after establishment by ATHB16 expressing lines (I0, I32, I4 ) and wild-type bahiagrass (WT) and St. Augustinegrass (SA) ...................................................................................89 9

PAGE 10

4-28 Turf mowing quality of ATHB16 expressing lines (I0, I 32, I4) and wild-type bahiagrass (WT). .............................................................................................................. ..904-29 Length of fully expanded infl orescence stems (without racemes) of ATHB16 expressing bahiagrass line s (I10, I4, I32) and wild -type bahiagrass (WT). ......................914-30 Number of tillers produced in a 100 cm2 by ATHB16expressing lines (I12, I23, I28, I32) and wild-type bahiagrass (WT). .................................................................................924-31 Density of ATHB16 expressing lines (I12, I23, I28, I 32) and wild-type bahiagrass (WT) and St. Augustinegrass (SA). ...................................................................................934-32 Phenotypic differe nces observed between ATHB16 expressing lines (I12, I23, I28, I32) and wild-type bahiagrass (WT). .................................................................................944-33 Comparison of ATHB16 lines (I28, I12) and wild-type (WT). ..........................................954-34 Field establishment of ATHB16 expressing bahiagrass lines (I12, I23, I28, I32) and wild-type bahiagrass (WT) a nd St. Augustinegrass (SA). .................................................954-35 Dry weight of clippings produced by ATHB16 expressing lines (I 12, I23, I28, I32) and wild-type bahiagrass (WT) and St. Augustinegrass (SA). ..........................................964-36 Visual ratings for resist ance to weed encroachment of ATHB16 expressing lines and wild-type bahiagrass (WT) a nd St. Augustinegrass (SA). .................................................974-37 Spring green-up of ATHB16 expressing lines (I12, I23, I28, I32) and wild-type bahiagrass (WT) and St. Augustinegrass (SA). .................................................................984-38 Inflorescences produced by ATHB16 expressing lines (I12, I23, I28, I32) and wildtype bahiagrass (WT) over time. ........................................................................................994-39 Total inflorescences produced by ATHB161 expressing lines (I12, I23, I28, I32) and wild-type bahiagrass (WT). .............................................................................................1004-40 Average length of inflorescence stems of ATHB16 expressing lines (I12, I23, I28, I32) and wild-type bahiagrass (WT). ...............................................................................1014-41 Drought tolerance of ATHB16 expressing lines (I12, I23, I 28, I32) and wild-type bahiagrass (WT) and St. Augustinegrass (SA). ...............................................................1014-42 Drought tolerance of ATHB16 expressing lines (I12, I23, I 28, I32) and wild-type bahiagrass (WT) and St. Augustinegrass (SA). ...............................................................1024-43 Drought recovery of ATHB16 expressing lines (I12, I23, I28, I32) and wild-type bahiagrass (WT) and St. Augustinegrass (SA). ...............................................................103 10

PAGE 11

4-44 Drought tolerance of ATHB16 expressing lines (I12, I23, I 28, I32) and wild-type bahiagrass (WT) and St. Augustinegrass (SA). ...............................................................1044-45 Maximum quantum yield of dark-adapted leaves of transgenic lines (I12, I23, I28, I32), St. Augustinegrass (S) a nd wild-type bahiagrass (WT). .........................................1054-46 SPAD meter readings of transgenic lines (I12, I23, I28, I32), St. Augustinegrass (SA) and wild-type bahiagrass. (WT). .............................................................................1064-47 Dry weight of rhizomes produced by ATHB16 expressing lines (I 12, I23, I28, I32) and wild-type bahiagrass (W T) and St. Augustinegrass (SA) in non-irrigated plots. .....1074-48 Dry weight of roots produced by ATHB161 expressing lines (I12, I23, I28, I32) and wild-type bahiagrass (WT) and St. Augustin egrass (SA) in nonirrigated plots. ............1074-49 RT-PCR using analysis for expression of the ATHB16 gene using specific primers for amplification of cDNA from transgenic lines (B11, B3, B6, B7, B9) compared to WT and plasmid. ..............................................................................................................108 11

PAGE 12

Abstract of Thesis Presen ted to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science EVALUATION OF TRANSGENIC STRATEGIES TO ENHANCE TURF QUALITY OF BAHIAGRASS ( Paspalum notatum FLGGE) By Paula Noem Lomba Otero August 2009 Chair: Fredy Altpeter Major: Agronomy Bahiagrass ( Paspalum notatum Flgge) is a popular forage and turf species in the southeastern US due to its persistence under lowinput conditions. However, the turf quality of bahiagrass is limited by its open growth habit and prolific production of long inflorescences. We successfully improved turf quality in bahiagrass following reduction of bioactive gibberellic acid, by over-expressing GA-2-oxidase-1 ( AtGA2ox1 ) or ATHB16 from Arabidopsis. Here, evaluation of turf quality, performance and AtGA2ox1 or ATHB16 transgene expression of these plants under field c onditions is reported. Transgenic bahiagrass and wild-type contro ls plants were established in 1 x 1 m2 plots under USDA-APHIS permits 05-364-01r and 06-219-01r at the UF-IFAS Plant Research and Education Center in Citra, Florida. Turf quality and field performance were evaluated in two field studies. Bahiagrass over-expressing ATHB16 or ATGAox1 produced significantly more tillers than wild-type bahiagrass. Transgenic plants also showed decreased stem length while root and rhizome biomass as well as drought toleran ce and low input characteristics were not 12

PAGE 13

13 compromised. Most of the AtGA2ox1 expressing lines displayed improved tolerance and recovery from drought, whereas some of the ATHB16 expressing lines exhibited improved recovery from drought. Delayed and reduced fl owering and reduced inflorescence stem length was observed on ATHB16 and ATGAox1 expressing lines. Some of the bahiagrass lines expressing ATHB16 also exhibited a proportional semi-dwarf ing (shorter tillers and finer leaves). Our data on the AtGA2ox1 suggests that GA affects flowerin g, outgrowth of axillary buds and apical dominance in bahiagrass. Reduced levels of GA may also contribu te to improved drought stress response in bahiagrass. The data presented on the ATHB16 expressing lines indicates that expression of this gene in bahiagrass significantl y changes plant architecture of this species. Our findings are consistent with the proposed function of ATHB16 as repressor of cell expansion.

PAGE 14

CHAPTER 1 INTRODUCTION AND RATIONALE Turfgrasses are grown and main tained around the world. They can increase the value of a property and add aesthetic value. Turf can also prevent erosion, reduce noise and air pollution, generate oxygen, serve as fire retardant, filter groundwater a nd moderate temperature. In addition, natural turf serves as surface for many athletic and recreationa l activities. In the US alone, the turf industry is worth $40 billion annually (National Turfgrass Federation, 2003). It is estimated that in the US turf grasses cover 20 million hectares (National Turfgrass Federation, 2003). Despite its many benefits, the increasing use of turf is also creating challenges. Turf requires water, fertilizer, and pesticides for es tablishment and maintenance. This raises many environmental concerns including water conservation. With water resources available for irrigation becoming increasingly scarce due to global warming and increased populations (Bresh ears et al., 2005; Zhang and Wang, 2007), environmental enhancement and water conserva tion is becoming a common goal of our society. Thus increasing the demand for high quality, low maintenance turfgrasses with the ability to survive periods of environmental constraint. Wate r use in turf and ornamentals in urban areas in the US was estimated to account for 9% of the total annual water c onsumption (Landry, 2000; Huang, 2008). In 2005, withdrawals of freshwater for agricultural use constituted 40% while recreational irrigation used anothe r 5% of total withdrawals in Florida (Borisova and Carriker, 2009). Haley et al. (2007) reported that 64% of potable water was us ed for landscape irrigation in the central Florida Ridge area. In Florida irrigation is necessa ry due to its sandy soils with lower water holding capacity, dry spring weather and sporadic rainfall events experienced. Turfgrass pl ants, like all green plants, require water for survival and growth. According to Beard (1973 ), drought stress remains 14

PAGE 15

the most important environmental factor limiting gr owth of turfgrass. However, growing concern for depletion of our fresh water resources has motiv ated the state of Florid a to develop strategies to reduce water consumption. In 2001, after a re cord drought for the state was experienced, the Florida Department of Environmental Protection (FDEP) developed the Water Conservation Initiative (WCI) to find ways to improve water efficiency. One of their recommendations was to regulate irrigation practices (FDEP, 2002). Anot her strategy being explored by the state is passing ordinances that limit available water us e for landscapes and restricting the use of the states turf industry standard, St Augustinegrass, Hence, the deve lopment and utilization of more drought tolerant turfgrass species for Florida is warranted. Turfgr ass grown in Florida must be adapted to an array of environments and several abiotic and biotic stress es, which can hinder the performance of any given vari ety (Kenworthy et al., 2007). Bahiagrass( Paspalum notatum Flgge), tolerance to drought, heat, minimal fertility soil, overgrazing, long lived stands a nd resistance to most disease a nd pests makes it a prime lowinput turf species for Florida. Its root system is more extensive than a ny other turfgrass (Busey, 2003), which serves to support its drought tolerance and reduces the impact of nematode damage (Trenholm et al., 2003). Along with d eeper rooting, better recovery al so grants this species with the highest level of drought su rvival of any sod-forming turf grass (Busey, 2003). Bahiagrass can survive without much water by retarding its growth when water is limiting, but recovers rapidly when it receives water (Trenholm and Uruh, 2006) Native to South America, bahiagrass has widely adapted to the southern Coastal Plai n region of the US sin ce its introduction in 1912 (Scott, 1920). This creeping, warm-season perenn ial species is grown extensively throughout Florida and the southern US and is commonly used for forage and utility turf along highways and roadsides. All these qua lities make bahiagrass a prime lowinput turf species for the state. 15

PAGE 16

However, bahiagrass use as a turfgrass has b een limited to roadsides, along highways, road medians and for large lawn areas due to its poor tu rf quality. Factors contri buting to its poor turf quality include the prolific produc tion of tall (60 cm) inflorescen ces during the summer months and its poor stand density. Not only do these proble ms affect visual quality but also increase mowing requirements and weed encroachment respect ively. Plant growth retardants (PGRs) have been used to suppress inflorescences and leaf growth due to rising mowing costs (Unruh and Brecke, 2006). However, applications of PGRs are associated with phytotoxicity, reduced recuperative potential from physical damage on treated turf and increased weed pressure due to reduced competition from treated plants (Uruh and Brecke, 2006). An alternative would be the development of genetically improved bahiagrass cultivars. Argentine a tetraploid, is commonly used as low maintenance turf due to its darker green color, and reduced period of flowering compared to other cultivars such as diploid Pensacola (Trenholm et al., 2003). However, the improvement of tetraploid cultivars by traditional breeding methods is limited due to their genome comple xity and asexual apomictic reproduction lacking female meiotic recombination during seed production. The methodology for breeding these asexual tetraploids involves chromosome doubling of diploid cultivars, thus generating sexual tetraploids (Burton and Forbes, 1960). These sexual autotetraploid s generated are then used as female parents in crosses with the apomictic tetraploid males to produce segregating populations (Hanna and Burton, 1986). This induced polyploidy makes it possible then to overcome sterility associated with apomixis. An alternative to traditional breeding is the use of genetic transformation technology to introduce desired traits into the tetraploid cultivar Argentine. This technology allows direct introduc tions of desired traits and offers perhaps the least time consuming alternative with the greatest potential value. 16

PAGE 17

17 An effective tissue culture and transformati on protocol for apomictic bahiagrass cultivar Argentine was recently developed by Altpeter and James (2005) and Altpeter and Positano (2005). The apomictic nature of th is cultivar was expected to result in uniform transgenic progenies and may reduce risk of unintended transgene dispersal. However, Sandhu (2008) recently reported transgene flow between Arg entine and nontransgenic bahiagrass under greenhouse and field conditions. Thus using a highly apomictic cultivar like Argentine does not provide absolute transgene contai nment. Nevertheless, this tran sformation protocol allowed for the introduction of transgenes th at successfully improved reduced bioactive gibberellic acid, by constitutive expression of AtGA2ox1 (Agharkar et al., 2007) or ATHB16 (Zhang et al., 2007) from Arabidopsis. GA-2-oxidase-1 encodes a gibberellin-catabolizing enzyme, whereas ATHB16 encodes a transcription factor functioni ng as a repressor of cell expansion. Changing the plants architecture might compromise the low input characteristics. Also stability of transgene expression is not always guaranteed under fiel d conditions. Therefore, field-testing of these transgenic plants under di fferent low-input and management conditions is very important. The aim of this study was to co mparatively evaluate th e turf performance of transgenic bahiagrass plants overexpressing AtGA2ox1 or ATHB16 and evaluate stable transgene expression under field conditions.

PAGE 18

CHAPTER 2 LITERATURE REVIEW Bahiagrass ( Paspalum notatum Flgge) The Genus Paspalum L. Members of the genus Paspalum share various physical and genetic characteristics. This genus is characterized by their raceme-like inflor escences with plano-conve x spikelets, with the lower glume generally absent (Clayton and Re nvoize, 1986). Most Paspalum species have a chromosome base number x = 10. Polyploidy and apomictic reproduction are features that occur frequently among the Paspalum species (Jarret et al., 1998). Many Paspalum species are highly self-pollinating (Burson, 1987; Burson and Young, 2000). Paspalum L. member of the Paniceae trib e, is one of the largest genera within the Poaceae family (Watson and Dallwitz, 1994; Souza-Chies et al., 2006). This genus contains 300 to 400 species most of which are endemic to tropical and subtropical regi ons of the New World (Barkworth et al., 2007). Severa l species are economically important as forage and turf grasses (Burson and Bennet, 1971), including Paspalum notatum Flgge, P.fasciculatum, P. dilatatum Poir, P. atratum Swallen, P. nicorae Parodi, P. vaginatum Swartz, P. plicatulum Michx, and P.guenoarum Arech. However, only a few of these spec ies have been included in selection programs: P. notatum P. dilatatum P. plicatulum and P. guenoarum P. atratum, and P. vaginatum (Valls, 1992; Kretschmer et al., 1994; D uncan and Carrow, 2000; Pozzobon et al., 2008). Importance and Use Bahiagrass is one of the most widely grown grasses in the southeastern United States where it is estimated to cover more than 2.4milli on hectares (Burton et al., 1997). In the United States, bahiagrass is used for forage, turf, cr op rotations, and erosion control. In Georgia, 18

PAGE 19

Alabama, and Florida bahiagrass is the predom inant forage grass util ized by the beef cattle industry (Blount et al., 2001). In Florida, an estim ated that 2 million hectares of grasslands are planted in bahiagrass alone, as reported by th e Florida Agricultural St atistics in 1997 (Blount, 2004). It comprises approximately 85% of the imp roved pastures in Fl orida (Kretschmer and Hood, 1999; Kretschmer and Pitman, 2000). The diploid cultivar, Pensacola, is the predominant pasture grass in the southeastern US covering an estimated 1.2 million hectares in Florida alone (Nordie, 2008). As a turf, Bahiagra ss accounts for 19% of total turfgrass area in the state occupying an estimated 0.30 million hectares (Hodges et al., 2004). This creeping perennial is an excellent turf former (Rather, 1942) and wi dely used as a seeded lawn grass (Janick et al., 1969a). In 2003, bahiagrass comprised 24% (8,892 h ectares) of the total sod production in the state (Haydu et al., 2005). The a pomictic tetraploid cultivar Arg entine is more commonly used as low maintenance turf due to its darker green color, and reduced period of flowering compared to other cultivars such as Pensacola (Trenholm et al., 2003). Bahiagrass is also utilized in crop rotations to interrupt disease cy cles and improve soil quality in cash crop systems (Katsvairo et al., 2006). Origin and Distribution The first intenti onal introduction of Paspalum notatum into the US was in 1912 (Scott, 1920) from southern Brazil, Uruguay, northeastern Ar gentina, and Paraguay, the presumed center of origin is presumed to be from of th e species (Parodi, 1937). It has been introduced since the late 1800s to the United States, Africa, Asia, Australia and Eu rope (Busey, 2003). In the United States, bahiagrass can be found from southern California to eastern Texas, from Florida to New Jersey, and from central Te nnessee to Arkansas (Chase, 1929; Watson and Burton, 1985). Occurrences of bahiagrass in the US have been reported in Alabama, Arkansas, California, Florida, Georgia, Ha waii, Illinois, Louisiana, Missouri, North Carolina, New Jersey, 19

PAGE 20

Oklahoma, South Carolina, Tennessee, Texas, Vi rginia, Puerto Rico, a nd the Virgin Islands (USDA Plants database 2009). Botanical Characteristics A botanical description of Bahi agrass is found in Busey et al. (2003) and is summarized here. Bahiagrass is a warm season perennial gras s that spreads by stout runners covered with dead persistent sheaths of prev ious leaves. These runners can be found in the literature referred to as rhizomes or stolons or both. For sake of consistency they will be referred to as rhizomes thorough this thesis. Its leaf blad es are erect or decumbent and pointed. As with most of the Paspalum species, its inflorescences are racemose, gene rally with 2 racemes and the first glume is absent. Solitary plano-convex spikelets are found in two rows on each raceme. The floret contains three anthers and two stigmas, both ge nerally purple in color. Flowering occurs soon after sunrise beginning at the top of the inflorescence. Ploidy and Cytology The base chromosome number of bahiagrass is x=10. This species is highly diverse, containing races with various ploidy levels. Bahiagrass cytotypes have 20, 30, 40, and 50 chromosomes (Gould, 1975; Trischler and Burson, 1991; Burson and Young, 2000). Out of which the most common are diploids (2n=2x= 20) and tetraploids (2n=4x=40) (Burton, 1946; Saura, 1948; Gould, 1966). The diploid races belong to Paspalum notatum var. saurae, commonly known as Pensacola bahiagrass. These are sexual and cross pollinating due to selfincompatibility (Quarin et al, 2001). Generally referred to as Common ba hiagrass, the apomictic tetraploids are the most abundant cytotypes found in South America nears its center of genetic diversity (Burson and Watson, 1995; Pozzobon and Walls, 1997). These tetr aploids are obligate apomicts that reproduce through apospory a nd pseudogamy (Burton, 1948). Apomixis via apospory is when unreduced embryo sacs develop from nucellar somatic cells (Martnez et al., 20

PAGE 21

2001). Artificially induced tetraploid plants have been produced by doubling the chromosome number of diploid races with colchicine (Burton and Forbes, 1960), an alkaloid derived from Colchicum autumnale (Janick et al., 1969b). Natural or induced tetraploid plants may usually be distinguished from diploid by plan ts by their larger, thicker leaves and organs. Bahiagrass is not an exception to this rule. Broad leaves, str ong roots and stout rhizom es characterize common tetraploid bahiagrass. In contra st, the diploid Pensacola type is taller, wi th longer and narrower leaves and smaller spikelets. Agronomic Attributes Bahiagrass is a creeping perennial relatively easy and inexpensive to establish from seeds, sod, springs, or plugs. Its abundant seed production makes it easy and inexpensive to propagate (Trenholm et al, 2003). Bahiagrass also ha s a large and extensive root system (Blue and Graetz, 1977; Impithuksa and Blue, 1978 ). Its roots can penetrate through the compaction zone ( Elkins et al., 1977 ) which aids it under drought conditions. Bahi agrass root system also reduces the impact of nematode damage (Trenholm et al, 2003) It has the highest le vel of drought survival of any sod-forming turfgrass attributed to be tter recovery and deep er rooting (Busey, 2003). Bahiagrass is persistent under a variety of soils and conditions includi ng low fertility, drought and flooding. It grows on upla nd well-drained sands, as well as on moist, poorly drained flatwood soils, typical of peninsular Florida (Chambliss a nd Adjei, 2002). It displays good resistance to most diseases and pests. Bahiagrass tolerates intense clipping or over-grazing (Sampaio and Beaty, 1976). Day-length plays an important role in the grow th of bahiagrass (Blount et al., 2001). It was previously demonstrated that fo rage yield in short-day months is restricted by photoperiod in bahiagrass (Sinclair et al., 2001; Sinclair et al ., 2003). An overall forage yield increase was observed during short-day months when bahiagrass plots were artificially treated with 15-h 21

PAGE 22

photoperiods (Sinclair et al., 2001; Sinclair et al., 2003). Bahiagrass is al so strongly photoperiod dependent for flowering induction (Knight and Bennett, 1953). With a flowering threshold of 13h daylength, it can flower in 14-h but not 12-h days. Flowering under shor t-days was initiated whenever the night period was interrupted by red or far-red light (Marousky and Blondon, 1995). Targets for improvement of bahiagrass incl ude its turf quality shade tolerance, susceptibility to high soil pH salinity, mole crickets (Scapteriscus spp), and dollar spot ( Sclerotinia homoeocarpa) Also, bahiagrass does not tolerate freezes and ceases to grow in late fall and winter period (Blount et al., 2001). cv Argentine Argentine is a sele ction that was introduced from Argentina in 1944 (Chambliss and Adjei, 2002). In contrast to Pensacola, this apomictic tetraploid (2n=4x=40), has wider leaf blades, produces fewer inflorescences that emerge later in the season (Trenholm et al., 2003) and has a lower cold tolerance (Chamb liss and Adjei, 2002). It is widely used in lawns and for solid sodding on highways, roadsides and la rge residential areas. It is cons idered to be better for turf than other cultivars since it produces fewer in florescences (Trenholm et al., 2003) and has a darker green color. Argentine also has a higher root dry weight than Pensacola (Busey, 1992). Strategies for Improvement of the Turf Quality of Bahiagrass Traditional Breeding of Bahiagrass Bahiagrass breeding is a multi-state effort between University of Florida faculty and USDA scientists from Georgi a and Florida (Blount et al., 2003). Traditional breeding for bahiagrass, based on recurrent selection, has primarily focused on improved forage yield by improving establishment, seedling vigor, cold tolerance, reduced photoperiod sensitivity, seasonal distribution of forage production, forage quality, and insect and nematode and disease resistance. Recurrent Restricted Phenotypic Selec tion in diploid cytotypes for improved forage 22

PAGE 23

yield resulted in plants with more upright growth and reduced rhizome development (Blount et al., 2001). Although traditional breeding has proven successful in breeding sexual diploid types, breeding of tetraploid apomictic cultivars has been difficult. Breeding of sexual diploid cultivars is co mplicated by self incompatibility and the abundance of cross-pollinating pollen sources. Theref ore such cultivars are typically lacking the uniformity desired for turf applic ations. In contrast, an apomictic cultivar, reproducing asexually, produces uniform seed progeny that is a tremendous advantage if uniform turf quality needs to be achieved. However, improvement of apomictic cultivars is limited due to the lack of genetic recombination during asexual seed production (Blount et al., 2001). Applying transgenic approaches may help to overcome these limitations. Genetic Transformation of Turf and Forage Grasses Transgenic strategies offer opportunities to in troduce novel genes into plants, thus offering new opportunities for molecu lar breeding of grass ( Poaceae ) species. It allows the introduction of heritable traits between unrel ated species thus amplifying the genetic resources and variability beyond the possibilities within traditional breeding. The most popular methods used to generate transgenic plants are Agrobacterium -mediated and microprojectile bombardment genetic transformation. Agrobacterium tumefacienns is a phytopathogenenic ba cteria that contains a Tumor-inducing (Ti) plasmid that contains a transfer (T) DNA that can insert into the chromosome of cells at the wound site on the root of the plant and cause crown gall disease. In Agrobacterium -mediated transformation, the bacterium s T-DNA is replaced with the desired gene to be introduced into the plants genome. DNA within the T-DNA will be transferred to the plant and integrated into th e plant nuclear DNA. Using reco mbinant DNA methods, the tumorcausing genes are deleted from the T-DNA. Until recently, Agrobacterium-mediated transformation was thought to be limited to dico tyledons since most monocot species are not 23

PAGE 24

natural hosts for the bacterium. However, Hiei et al. in 1994 described effi cient transformation of rice by Agrobacterium. Following, there have be en reports for numerous monocot species including commercially important crops like maize, barley and wh eat (Ishida et al., 1996; Tingay et al., 1997; Cheng et al., 1997). Currently, particle bombardment is the mo st widely used and successful method for introducing genes into monocotyledonous plants (James, 2003; Altpeter et al., 2005). Microprojectile bombardment or bi olistic is the direct gene tran sfer with DNA-coated particles into embryogenic cells. This is achieved with a so called gene gun or "Biolistic Particle Delivery System" invented by Dr. Jonhn C. Sanford. Plasmid DNA carrying promoter sequence, selectable marker and/or reporter genes in add ition to the desired gene(s) is precipitated onto micron-sized tugsten or gold microcarrier partic les. DNA-coated microcarriers are accelerated with helium pressure into the nucleus within th e cells where the DNA may be integrated into the plants genome. Due to the physical nature of this system, microparticle bombardment is not limited by the pathogen-host interaction observed in Agrobacterium -mediated transformation. Transgene integration through either method occu rs through illegitimate recombination (Kohli et al.1999; Zhang et al. 2008; Sandhu et al., 2008). Fo llowing, transformed tissues are selected for the expression of the selectable marker gene and transgenic plants are regenerated and evaluated for integration and expression of the transgene(s). It is very important for the transgenic plants generated to stably express the transgene over successive generations. Major problems associated with the productions of stable transgenic plants include gene expression variability and silencing (De Wilde et al., 2000; Kohli et al., 2003; Chawla et al., 2006). Variation in expression levels is influenced by a multitude of factors including transgene copy number, positional effects, transgene structure, and gene silencing. The 24

PAGE 25

two mechanisms recognized in gene silencing of transgenics are transcri ptional gene silencing (TGS) and post-transcriptional gene silencing (PTGS) (Vaucheret al., 1998; Lechtenberg et al., 2003; Tang et al, 2007). Both mechanisms of s ilencing have been associated with multiple inserts of the transgene (Tang et al, 2007). Ge ne copy number rarely correlates to level of expression (Spencer et al., 1990; Pawlowski and Somers, 1996, Maqbool and Christou, 1999). In transformation the integration of only one transgene copy is believed to be desirable to avoid the possibility of co-suppression of expression caused by multiple gene integrations (Matzke et al., 1994; Gondo et al., 2009). Single copy integration of transgenes ha s been shown in transgenic grasses obtained by microprojectile bombardment, but the number of transg ene copies integrated usually varies resulting in complex transgene in tegration patterns (Spa ngenberg et al., 1995a, b; Ye et al., 1997; Dalton et al ., 1999; Richards et al., 2001; Wang et al., 2001, 2003b; Wang and Ge, 2006). It is known that Agrobacterium -mediated transformation generally results in a lower copy number and an improved stability of ge ne expression than bombardment methods. However, complex transgene integration patterns have also been reported in Agrobacterium mediated transformation (Kononov et al. 1997; Zha ng et al. 2008; Sandhu and Altpeter, 2008). It has been reported that transgen ic perennial ryegrass lines with five or more transgene copies exhibited gene silencing after se xual and vegetative re production but that an estimated 50% of these high-copy-number lines still stably expresse d the transgene (Altpeter et al. 2004; Altpeter et al., 2005). Positional effects, such as integra tion site have also been proposed to influence transgene expression (Kohli et al., 1999). Also transgene stru cture influenced expression. Rearranged copies of the transgene may result in silencing if other copies are intact and functional (Kohli et al., 1999; Altpet er et al., 2005). These rearrang ements can take place before or during integration into the host genome (Altpeter et al., 2005). 25

PAGE 26

Transgenic Turf and Forage Grasses Particle bombardment has been used for many years in the transformation of many graminaceous species including tall fescue ( Festuca arundinacea Schreb.) (Wang et al., 1992), creeping bentgrass (Agrostis palustris Huds .) (Zhong et al., 1993), red fescue ( Festuca rubra L.) (Spangenberg et al., 1995a), perennial ryegrass ( Lolium perenne L.) (Spangenberg et al., 1995b), Italian ryegrass (Lolium multiflorum ) (Ye et al., 1997), orchardgrass ( Dactylis glomerata L) (Denchev et al., 1997), wimmera ryegrass ( Lolium rigidum ) (Bhalla et al., 1999), Kentucky bluegrass ( Poa pratensis L.) (Ha et al., 2001), switchgrass ( Panicum virgatim ) (Richards et al., 2001), bahiagrass ( Paspalum notatum Flgge) (Smith et al., 2002), blue grama grass ( Bouteloua gracilis ) (Aguado-Santacruz et al., 2002), bermudagrass ( Cynodon spp) (Zhang et al., 2003), Dichanthium annulatum (Dalton et al., 2003), Russian wildrye ( Psathyrostachys juncea ) (Wang et al., 2004), and buffalograss ( Buchloe dactyloides ) (Fei et al., 2005). More recently, Agrobacterium -mediated transformation has been successfully used in grasses such as creeping bentgr ass (Yu et al., 2000), switchgrass (Somleva et al., 2002), Italian ryegrass (Bettany et al., 2003), tall fescue (Be ttany et al., 2003), zoysiagrass (Toyama et al., 2003), colonial bentgrass (Chai et al., 2004), bermudagrass (Hu et al., 2005), and perennial ryegrass (Wu et al., 2005). Transgenic Bahiagrass Biolistic transformation of bahiagrass has b een reported for the T7 genotype (Smith et al, 2002), and cultivars Argentine (Altpeter and Ja mes, 2005; Altpeter and Positano, 2005) and Pensacola (Gondo et al., 2005; Luciani et al., 2007). This technology has allowed the introduction of transgenes that successfully impr oved turf quality (Agharkar et al., 2007; Zhang et al., 2007), abiotic stress to lerance (James et al., 2008), in sect (Luciani et al., 2007) and herbicide resistance (Sandhu et al ., 2007). In this study, two differe nt approaches to alter the 26

PAGE 27

phenotype and improve the turf quality of bahi agrass were evaluated. The first involved overexpression of a gene coding an enzyme involved in gibberellin metabolism. Plant hormones control plant growth and devel opment by affecting the division, elongation, and differentiation of cells. Thus, a change in their level can cause a multitude of effects. Hormones therefore provide a tool for manipulating plant processes and their phenotype. The second involved the manipulation of a regulatory gene. Transcription factors are regulat ory proteins that control the expression of specific genes (Broun, 2004) with so me of them regulating plant development and response to environmental conditions (Zhang, 2003). Since transcription fact ors tend to control a multitude of genes, they are powerful tools for th e manipulation of metabolic pathways in plants (Broun, 2004). When transcription factors are ove r-expressed, changes such as altered plant architecture and improved stress tolera nce have been reported (Zhang, 2003). Transgenic Strategies for Improve ment of Bahiagrass Turf Quality AtGA2ox1 Gibberellins (GAs) are plant growth horm ones that control va rious developmental processes including stem elongation, leaf expansion, seed germina tion, floral induction, fruit development, and apical dominance (Harberd et al, 1998). They mediate these physiological responses in response to environmental signal s such as photoperiod and light (Hedden and Phillips, 2000). Several studies have made th e association between GAs and flowering in monocotyledons (Evans, 1964; Pharis and Ki ng, 1985; King and Evans 2003; King et al., 2001, 2006; MacMillan et al., 2005; King et al., 2008; Ubeda-Toms et al., 2006; Gallego-Giraldo et al., 2007). In ryegrass GA has been suggested as a leaf-derived long distance signaling molecule for floral transition (King et al, 2006; Colassa nti and Coneva, 2009). Bioactive GAs have been proposed to suppress tiller bud out growth, enhance apical dominance and promote flowering in 27

PAGE 28

28 grasses under long day (LD) (Lester et al., 1972 ; Johnston and Jeffcoat, 1977; Agharkar et al., 2007). Gibberellin-2-oxidases (GA2ox) are a family of enzymes involved in the degradation of bioactive GAs rendering them inactive. They are 2-oxoglutarate-dependent dioxygenases (2ODDs), which hydrolyze the C-2 of active GAs (Martin et al, 1999; Thomas et al, 1999; Sakamoto et al., 2001). ATHB16 ATHB16 ( Arabidopsis thaliana Homeobox 16 ) is an HDZip gene involved in the control of cell expansion (Wang, et al., 2003a). Members of the HDZip family of plant transcription factors encoded by HDZip genes are characterized by the presence of a DNA binding homeodomain and an adjacent Leu zipper motif from which their name originates. They are involved in the plants developmental processe s (Henriksson et al., 2005 ). The transcription factor encoded by ATHB16 functions as a repressor of cell elongation independent of the GA signal transduction (Wang et al ., 2003a). In Arabidopsis, tr ansgenic over-expression of ATHB16 resulted in plants with reduced stem length due to reduced leaf expansi on, increased number of shoots and reduced sensitivity of flower inducti on to photoperiod (Wang et al., 2003a). The exact mechanism for the altered phenotype is unknown. Ho wever, Wang et al. (2003a) suggested that ATHB16 transcription factor might regulate plant development as a mediator of blue-light based photomorphogenesis.

PAGE 29

CHAPTER 3 MATERIALS AND METHODS Transgenic Lines and Experimental Controls Transgenic lines selected for the field studies were generated and analyzed for transgene integration and expression ( AtGA2ox1 or ATHB16) and evaluated under greenhouse conditions as described by Agharkar et al. (2007) and Zhang et al. ( 2007). GA catabolizing AtGA2ox1 was subcloned under the control of the maize ubiquitin promoter and Nos 3'UTR. Whereas ATHB16 was subcloned under the control of the CaMV 35S promoter and Nos 3'UTR. Minimal AtGA2ox1 or ATHB16 expression cassettes lacking vector backbone sequences were stably introduced into apomictic bahiagra ss by biolistic gene transfer. Two non-transgenic controls were included in our study, wild-type A rgentine bahiagrass (WT) and wild-type St. Augustinegrass cultivar F loratam (SA) as the turf industry standard. Transgenic AtGA2ox1 and ATHB16 lines along with wild-type cont rols were established and evaluated simultaneously in field stu dy I (2006) and field II (2007, 2008 and 2009). Field Evaluation Field Study I Propagation, Establishment and Field Site Field study I was conducted in 2006. Plants from five transgenic lines expressing AtGA2ox1 (B3, B6, B7, B9 and B11) and thre e transgenic lines expressing ATHB16 (I4, I10 and I32) were propagated under greenhouse conditions along with experi mental controls from single rooted tillers in steam-sterilized soil from the fi eld site (Figure. 3-1A). Transgenic and control plants were established on 11 July 2006 at the G.C. Horn Turfgrass Research Facility, located at the UF-IFAS Plant Research and Education Center (PSREU) in Citra, Florida (USDA permit 05364-01r) in 1 x 1 m2 plots using four 8x8x7cm3 grass plugs (represent ative images shown in 29

PAGE 30

Figure 3-1B; Figure 3-1C). The experimental desi gn was a randomized block design with a total of 24 replications. The soil near Citra, FL is hyperthermic, uncoated Quartzipsamments of the Candler series (Thomas et al., 1979). Summer solstice at the fi eld site occurred on June 21, 2006 with a day length of 14-h. Fertility and Management All plots were treated equally and irrigated after transplanting to prevent severe moisture stress on the young transplants. After transplantin g plants were allowed to grow without being mowed for four weeks. Plants were mowed the second time on 3 October 2006, when a weekly mowing regime was established. Plants were fertilized with 0.23 kg of N 100 m-2 using a complete 18-3-18 NPK fertilizer on 26 July 2006. Prowl (Pendimethaline) herbicide was applied as a pre-emergent to all plots at 7.4 x10-3 kg 100 m-2 on 1 August 2006. Evaluation Techniques Turf quality was evaluated by recording density, mowing quality, aboveground biomass, establishment and development of inflorescence s. Turf density of transgenic plants was evaluated by counting the number of tillers in a ra ndomly selected 10 10 cm2 (100 cm2) area of each plot and with visual ratings To evaluate aboveground biomass, plots from different environments were mowed at 8 cm using a Rotary Mower HRX217TDA (American Honda Motor Co., Inc. Alpharetta, GA) equipped with a blade brake clutch that allows removing the bag to collect clippings while the engine is r unning. Clippings were harvested from each plot and their dry weights were measured after a week at 80C. Develo pment of inflorescences was monitored by counting total number of inflorescences per plot. Length of the inflorescence stems was also evaluated. Turf quality was evaluated using visual ra tings for mowing quality, density and establishment. Visual ratings were assigned follo wing National Turfgrass Evaluation Program (NTEP) guidelines (Morris and Shearman, 2006). Visual ratings we re based on a 1-9 30

PAGE 31

rating scale, 1 representing the poor est and 9 the best or highest overall rating of the parameter being evaluated w ithin the study. Statistical Analysis Statistical analysis was performed accordi ng to the randomization structure using the ANOVA-procedure of SAS version 9.2 (SAS Institu te Inc. Cary, North Carolina, USA). Means were compared by the t-test ( = 0.05). Field Study II Propagation, Establishment and Field Site Field study II was conducted from 2007 to 2009. Plants from four transgenic lines expressing AtGA2ox1 (B3, B7, B8 and B10) and four transgenic lines expressing ATHB16 (I12, I23, I28 and I32) were propagated under greenhouse conditions along with experimental wildtype controls from single rooted tillers in steam-ste rilized soil from the field site (a representative image is shown in Figure. 3-1A). Transgenic and experimental control plants were established on 10 July 2007 at the G.C. Horn Turfgrass Rese arch Facility, located at the UF-IFAS Plant Research and Education Center in Citra, Fl orida, USA (USDA permit 06-219-01r) in 1 x 1 m2 plots using four 8x8x7 cm3 grass plugs (Figure 3-1B; Figure 31C). Summer solstice at the field site for the corresponding eval uation years occurred at 21 June 2007 and 20 June 2008 both with a day length of 14-h. Field experiment treatments were arranged as split-split plots in a randomized complete block with four replicatio ns. Six main plots were assigned one of three irrigation treatments (full irriga tion, moderate irrigation or non-ir rigated). Main plots were split in half and one of two mowing frequencies (wee kly or biweekly) was assigned randomly to each split-plot. Two replications from each genotype (transgenic lines and wild-type controls) were randomly sited within each split-plot (Figure 3-2). 31

PAGE 32

Fertility and Management All plants were subjected to the same ferti lity and management aside from the irrigation and mowing treatment differences. Plants were fe rtilized with a 15-5-15 NPK fertilizer with iron at a rate of 0.25 kg m--2 on 10 August 2007, with a 7-7-7 NPK fertilizer at 0.5 kg m-2 on 24 October 2007, with a 18-3-18 NP K fertilizer at 0.5 kg m-2 on 6 March 2008 and with a 15-15-15 NPK fertilizer at 0.5 kg m-2 on 4 August 2008. Soar micronutrient mix was applied on 6 June 2008 at a rate of 4.7 L ha-1. To reduce weed pressure, Prowl (Pendimethaline) herbicide was applied as pre-emergent to all plots at rate of 1.5 L ha-1, on 7 August 2007, on 2 October 2007 at 3.5 L ha-1, on 28 May 2008 at 4.7 L ha-1 and on 17 February 2009 at 4.7 L ha-1. Prodiamine herbicide was also applied as a pre-emergent on 3 March 2008 at a rate of 1.1 kg ha-1, on 30 July 2008 at 1.7 kg ha-1 and on 21 October 2008 at 1.7 kg ha-1. Halosulfuron herbicide was applied to control sedge on 7 August 2007 at 92 g ha-1, 22 August 2007 at rate of 92 g ha-1, on 27 September 2007 at 71 g ha-1, on 14 May 2008 at 71 g ha-1 and on 28 August 2008 at 92 g ha-1. Acephate insecticide was applied to control insects on 28 August 2007 at 1.8 kg A-1, on 16 November 2007 at 4.5 kg ha-1 and on 4 June 2008 at 3.4 kg ha-1. Chlorothalonil fungicide was applied on 4 June 2008 at rate of 23.7 L ha-1 to control infection on the St. Augustinegrass control plants. Mowing and Irrigation Treatments During the establishment period, all transgenic and wild-type contro l plants were grown under the same conditions and management. All equa l irrigation to prevent moisture stress on the young transplants. The plots were mowed for the first time 4 weeks afte r transplanting. From then onwards, two alternative mowing schedules were compared (weekly and biweekly). Irrigation treatments were initiated at the end of March 2008 with the onset of a seasonal drought period experienced in Apri l and May 2008 (Figure 3-3). I rrigation was controlled using 32

PAGE 33

soil moisture sensors coupled to a Campbell Scien tific data logger controlli ng solenoid valves to mini-wobblers sprinkler system. Fu ll irrigation plots were irrigate d to prevent visual moisture stress in wild-type St. Augustine grass. The system was calibrated to override scheduled irrigation once specific volumetric water conten t (VWC) was detected. Fu lly irrigated plots, received approximately 1.25 cm of water twice a week (Figure 3-3). If approximately 1.25 cm of rainfall or more were received just prior to the scheduled irrigation, th e VWC would trigger the system to overwrite the scheduled irrigation. Moderate irrigation pl ots were irrigated to prevent visual moisture stress in the best transgenic lin es. For moderately irrigated plots the system was set to approximate 1.25 cm of water once a week (Figure 3-3). Non-irrigated plots received no additional water to that provided by rainfall (Figure 3-3). Irrigation events were scheduled in the early mornings to minimize negative impact of wind and high temperatures on irrigation success. Evaluation Techniques Turf quality was evaluated by assessing turf density, establishment, spring green-up, weed encroachment, drought tolerance and recovery, aboveand below-ground biomass, development of inflorescences, and length of inflorescence st ems. Turf density of transgenic plants was evaluated by counting the number of tillers in a ra ndomly selected 10 10 cm2 (100 cm2) area of each plot and with visual ratings Density, establishment, spring green-up, weed encroachment, and drought tolerance and recovery we re evaluated using visual ratings. Visual ratings were assigned following National Turfgrass Evaluati on Program (NTEP) guidelines (Morris and Shearmen, 2006). Visual ratings were based on a 1-9 rati ng scale, 1 representing the poorest and 9 the best overall quality of the parameter being evaluated within the study. To evaluate aboveground biomass all environm ents were mowed at 8-cm cutting height production using a Rotary Mower HRX217TDA (A merican Honda Motor Co., Inc. Alpharetta, GA) equipped with a blade brake clutch that allo ws removing the bag to collect clippings while 33

PAGE 34

the engine is running. Clippings were harvested from individual pl ots and the dry weight of the clippings was assessed after a week at 80C. To compare biom ass production from the different mowing treatments the dry weight data was analyzed as the total dry weight of clippings during a two-week period. Weekly plots were harvested once a week for two consecutive weeks and the sum of the dry weight for those two weeks was the value used. Biweekly plots were allowed to grow for these same two weeks but only harvested during the second week. Below-ground biomass was evaluated by r ecording root and rhizome dry weight. Rhizomes and roots samples were collected us ing a 10-cm wide, 5-cm across, and 50-cm long plant root sampler (Eijkelkamps 0508). Samples we re taken from each individual field plot, soil was washed off and roots and rhizomes separate d into different bags. Dry weight was assessed after 3 days at 80C. In the cas e of St. Augustinegrass, rhizome dry weight was assessed instead of rhizome. Development of inflorescences was m onitored throughout the flowering season by counting total number of inflorescences per field plot on a regular basis. Inflorescence length was measured without the racemes, which were cut regularly to prevent pollen formation. Besides using visual ratings to evaluate drought tolerance and recovery, SPAD readings and maximum quantum yield of photosystem II were measured during and after the drought event. The maximum quantum yield was measured using dark-adapted leaves. Measurements were made at night using Pulse Amplitude Modulated Fluorometry (PAM 2100, Heinz Walz GmbH, Germany). The measured photosynthetica lly active quantum flux density (PAR) was maintained between 5 and 8 mol quanta m-2s-1 during the measurements. Standard instrument settings were used and the measurements were made using the saturation pulse mode. Maximum quantum yield (Fv/Fm) data were obtained by us ing the pre-programmed run 2 mode. The third 34

PAGE 35

fully expanded leaf from two different tillers per plot was used for the measurements. SPAD measurements were made on the third fully expande d leaf from three diffe rent tillers per plot using a SPAD meter (Minolta SPAD 502 Meter, Spectrum Technologies, Inc., East-Plainfield, Illinois, USA). Statistical Analysis Statistical analysis was performed accordi ng to the randomization structure using the MIXED-procedure of SAS version 9.2 (SAS Institute Inc. Cary, North Carolina, U.S.A.). Genotypes, irrigation and mowing were considered fixed, while replicates and interactions were consider ed random. When analyzing the data no significant difference was observed betw een mowing treatments so data presented was analyzed by removing mowing from the model. Means were compared by the t-test ( = 0.05). Regulatory Compliance In order to ensure the containm ent of the transgenic material, a strict protocol was followed to fulfill the field trial re quirements under the USDA permits 05-364-01r and 06-219-01r. The field, laboratory and greenhouse sites used for this study were regularly inspected by USDAAPHIS and the institutional bios afety committee. All equipment used in the study, including the mower, was kept on-site in a shed. All transg enic plant material wa s transported in double containers in a well-contained state vehicle (Figur e 3-4). Clippings along with any plant material were autoclaved prior to discar ding. Bahiagrass plants in the fi eld plots were not allowed to produce pollen, by scheduled mowing and regular hand cutting of the inflorescence racemes. A 10 m fallow area surrounded the pl ots. Diploid bahiagrass grow ing around our field was also controlled with plant growth re tardants and weekly mowing. Upon termination of the field study, plants will be killed with herbicid e application and th e area monitored. 35

PAGE 36

Evaluation of Stable Transgene Expressi on of Field Grown Vegetative Progeny Transgene expression under field conditions was confirmed by RT-PCR results. After approximately 20 months in the field, includ ing periods of drought and freezing, 100 mg of young leaf tissue was used to extract total RNA us ing the RNeasy Plant Mini Kit (Qiagen Inc., Valencia, CA) followed by RNAse-free DNase I (Qiagen Inc., Valencia CA) treatment to eliminate genomic DNA contamination. For cDNA s ynthesis via reverse tr anscription, 500 ng of total RNA was used with the iScript cDNA Synthesis Kit (Bio-Rad Laboratories, Inc., Hercules, CA) in a reaction volume of 20 l. In detecting the AtGA2ox1 or ATHB16 gene transcripts by PCR, 2 l of cDNA synthesized and 1 l of the plasmid were used as template for PCR in an Eppendorf Mastercycler (Eppendorf, Westbury, NY, USA) using the HotStarTaq DNA Polymerase (Qiagen Inc., Valencia, CA). For the ATGA20x1 lines the primer pair with sense pair with sense 5 GAACACGAGACCGTCGATTT -3 and antisense 5 GGAGGGACAGAGATCCATGA -3 was designed to amplify a 516-bp fragment for RT-PCR. For the ATHB16 lines the primer pair with sense pair with sense 5 TGGGTCTATCGGAGAAGAAG -3 and antisense 5 TTGGAGAAGGGAATCATTGT -3 was designed to amplify a 278-bp fragment for RT -PCR. Samples were denatured at 95 C for 15 min; followed by 30 cycles at 95C for 30 s, 60C for 30 s, 72C for 1 min, and final extension at 72 C for 10 min. PCR products were analyzed by electropho resis in a 1.2% agarose gel at 100V for 30 minutes. 36

PAGE 37

37 C B A Figure 3-1. Propagation and field establishment. (A) Propagation of plants under greenhouse conditions from single rooted tillers. (B) Establishment of field plots using four 8x8x7cm3 grass plugs. (C) Fully-established 1 x 1 m2 plots.

PAGE 38

38 B A Figure 3-2. Field study layout. (A) Irrigation and mowing treatment assignment to split-split plots. (B) Overview of the six experimental plots at th e UF-IFAS Plant Research and Educa tion Center in Citra, Florida.

PAGE 39

A Figure 3-3. Total monthly rainfall and irrigation received by full, moderate and no irrigation plots during seasonal drought in (A) 2008 and (B) 2009. Figure 3-4. State vehicle loaded with transgenic plant material enclosed in double container B 0 2 4 6 8MarchApril JuneCentimitersTotal Monthly Rainfa ion during Seasonal Drought Peri very in 2008Mayll and Irrigat od and RecoRain Full Moderate No 0 5 10 15 20 25March April MayCentimitersTotal Monthly Rainf ion during Seasonal Drou 2009 all and Irrigat ght Period inRain Full Moderate No 39

PAGE 40

CHAPTER 4 RESULTS AND DISCUSSION ATGA2ox1 Expressing Lines (B Lines) Results Field Study I AtGA2ox1 expressing lines B3 and B9 consistently displayed the highest turf density with the most number of tillers produced among all transgenic lines and the wild-type. Eight weeks after establishment, B3 and B9 had 23% and 16% significantly more tillers than the wild-type bahiagrass (Figure 4-1A). Four weeks later li ne B11, B3, B7 and B9 had 25%, 44%, 22% and 40% more tillers than the wild-type, respectively (Figure 4-1B). The higher number of tillers in the transgenic plants resulted in denser turf as represented by our densit y ratings (Figure 4-1C) and a more erect growth pattern compared to wild-type with more pr ostrate and open growth habit (Figure 4-1D). The faster production of tillers by the transgenic lines B3 and B9 also resulted in a better field establishment than the other lines and wild-t ype bahiagrass. Most of the lines (B3, B7 and B9) that produced more tillers than the wild-type also received higher esta blishment ratings than the wild-type and St. Augustinegrass (Figure 4-2A). Line B6 also displayed better field establishment than the wild-type. These lines spr ead faster inside the fi eld plots than the wildtype bahiagrass and St. Augustinegrass (Figure 4-2B). The higher number of tillers, faster establishment and erect growth of the transgenic lines contributed to 52% (B3), 34% (B 7), and 62% (B9) more clippings compared to the wild-type bahiagrass, following four weeks of growth after establishment (Figure 4-3) Consistent with the data on tiller number, density and establishment, lines B9 and B3 had the highest clipping dry 40

PAGE 41

weight at this timepoint. Line B6, displaying the most dwarf phenotype, produced 44% significantly less clippings than the wild-type bahiagrass. The denser more upright (bunchtype appearan ce) phenotype of the transgenic lines also resulted in higher ratings for mo wing quality for lines B3, B6, B7 and B9 compared to the wildtype bahiagrass (Figure 4-4A). Consistent with the density ratings, lines B3 and B9 had the highest ratings for mowing quality among all lines a nd wild-type (Figure 4-4A). This is reflected in the comparison of freshly mowed transgenic line B3 to wild-type bahiagrass (Figure 4-4B). Line B3 displayed a high turf density with no visi ble rhizomes or gaps in contrast to wild-type (Figure 4-4B). Lines B3, B7 and B9 consistently produced le ss inflorescences than the wild-type and the other transgenic lines (Table 4-1). On 8 August the number of inflorescences production by transgenic lines B3, B7 and B9, ranging from 0 to .08, was significantly lower than the production by the wild-type (1.46) (Table 4-1). On 29August, lines B3, B7 and B9 produced 14%, 22% and 15% less inflorescences than the wild-type bahiag rass, respectively. The inflorescence stems of most lines was 13% (B11), 16% (B3), 31% (B6), and 11% (B7) shorter than that of the wild-type bahiagrass (Figure 4-5). Inflorescence stem length of line B9 was not significantly different to the wild-type or most transgenic line (B11, B3, B7). Line B6 displayed the shortest inflorescence stems of all lines and wildtype. Field Study II In Field study II, conducted in 2007, 2008 and 2009 most of the transgenic lines produced significantly more vegetative tillers than the wild -type bahiagrass. Lines B3and B7 consistently produced the highest amount of tillers among all lin es and the wild-type. During establishment in September 2007, AtGA2ox1 expressing lines B3, B7 and B8 produced 41%, 35% and 27% more vegetative tillers than the wild-type, respectiv ely (Figure 4-6A). Line B10 was the only 41

PAGE 42

transgenic line that did not produce significantly more tillers than the wild-type (Figure 4-6A). In measurements taken in May 2008, transgenic lin es again produced 26% (B10), 36% (B3), 38% (B7) and 17% (B8) more tillers than the wild-type bahiagrass (Figure 4-6B). Whereas in September 2008, the transgenic lines produced 21 % (B10), 43% (B3), 48% (B7) and 30% (B8) more tillers than the wild-type bahiagrass (F igure 4-6C). In May 2009 the transgenic lines produced 29% (B10), 44% (B3), 47% B7 and 28% (B8) more tillers than the wild-type bahiagrass (Figure 4-6D). Increased tillering of the tran sgenic lines in comparison to the wild-type bahiagrass was consistent under all three irrigation treatments in May 2008 (Figure 4-6E) and 2009 (Figure 46F). Number of tillers was significantly reduced in non-irrigated plots for all lines and wild-type bahiagrass during the droughts in May 2008 (Figure 4-6E) and 2009 (Figure 4-6F). Bahiagrass transgenic plants and the wild-type produced on average 35% and 27% more tillers under full irrigation than in non-irrigated plots during the drought period in May 2008 (Figure 4-6E) and 2009 (Figure 4-6F), respectively. Th is was the only timepoint w ith a significan t interaction between irrigation regime a nd production of tillers. The higher number of tillers in transgenic lines (B3, B7, B8) resulted in significantly higher turf density as confirme d by our density ratings taken in September 2007 (Figure 4-7A), in May 2008 (Figure 4-7B) and 2009 (Figure 4-7C). Line B3 consistently displayed the greatest density among all lines and wild-t ype. In all three assessments line B10 was the only transgenic line that did not display greater tu rf density than the wild-type (F igure 4-7). This is consistent with tiller data for September 2007 (Figure 4-6A). As previously observed in field study I, higher number of tillers for AtGAox1 lines was associated with a denser, more erect growth in the 42

PAGE 43

transgenic lines as compared w ith the wild-type bahiagrass with a more open growth habit and prostrate growth (Figure 4-8). As in Field Study I, the faster production of tillers by the transgenic lines was associated with quicker field establishment. All transgenic lines exhibited faster establishment than the wild-type four weeks after transp lanting as revealed by our rati ngs (Figure 4-9A). Eight weeks after transplanting, all transgenic lines (B3, B7, B8), except B 10, received higher establishment ratings than the wild-type (Figur e 4-9B). This is consistent w ith line B10 producing the least tillers and exhibiting the lowest density out of all the transgenic lines evaluated in this study. Lines B3 and B7 received the highest ratings among all lines and wild-type. The faster establishment was associated with the transgenic lines increased tillering and therefore spreading and establishing faster than the wild-type within the fi eld plots (Figure 4-9C). The higher number of tillers, erect growth and faster establishment in the transgenic lines contributed to greater dr y weight of clippings in transgenic lines compared to the wild-type bahiagrass plants for the establishment period in 2007 (Figure 4-10A). Tr ansgenic lines that consistently produced more t illers and received higher density and establishment ratings produced 47%, 42%, 37% (B3); 51%, 58%, 50% (B7); 57%, 42%, 40% (B8) significant greater clipping weight than the wild-t ype for August, September and Oc tober, respectively (Figure 410A). Line B7 consistently produced the greatest amount of clippings for this season. For these same months, clipping dry weight for B 10 did not differ from the wild-type. Differences in clipping dry weight between transgenics and the w ild-type were not as significant in the in the 2008 growing season as they had been in during establishment in 2007. In March 2008 there was no signifi cant difference between transgen ic and wild-type bahiagrass for clipping dry weight (Figure 410B). In April, line B7 produced significantly more clippings 43

PAGE 44

(51%) than the wild-type bahiagrass over all tr eatments (Figure 4-10B). During the months of May, June, July, and August 2008 transgenic lines B10 and B3 produced fewer clippings than the wild-type bahiagrass over all treatments (Figure 4-10B). They produced 39%, 44%, 21% (B10) and 32%, 30%, 19% (B3) less clippings than the wild-type for th e months of May, June and August 2008, respectively (Figure 4-10B. In September 2008, lines B7 and B8 produced 25% and 20% respectively more clippings than the wild-type bahiagrass (Figure 4-10B). In October 2008, line B3 produced 36% more clippings than the wild-type bahiagrass (Figure 410B). It is interesting to note that lines B7 consistently pr oduces more clippings than the wildtype early (April) and late (September and October) in the 2008 growing season (Figure 410B). Line B3 also produces more clippings than the wild-t ype late (October) in the 2008 growing season (Figure 4-10B). In dry weight of clippings data for March 2009, only line B7 was significantly different than the wild-type; producing 32% more clipping s Figure 4-10C). This is consistent with the greater production of clippings observed by B7 early in the 2008 growing season. No significant differences were observed for c lipping weight between the transgenic lines and the wild-type bahiagrass in the April 2009 data (Figure 410C). Line B10 produced less clippings than lines B7 and B8 in both April and May 2009 (Figure 4010C). Moreover, there was no significant interaction between any of our treatments and clipping weight in the 2009 data. Weed encroachment ratings are based visual estimate of the amount of weeds per plot. These were taken in March when the highest incidence of weed emergence was observed. Ratings were assigned using a 1 to 9 scale, with 9 being no weeds and 1 being all covered in weeds. In ratings taken in March 2008 transgenic lines B3, B7, B8 that produced more tillers and had a more dense habit, also had significantly fe wer weeds than the wild-t ype (Figure 4-11A). In 44

PAGE 45

2009, significant differences between transgenic lines and wild-type ba hiagrass were only observed for full irrigation plots wi th all transgenic lines having fewer weeds than the wild-type (Figure 4-11B). Spring green-up ratings were also used to eval uate performance. Green-up is a measure of the transition from winter dormancy to active spring growth. It is based on plot color not genetic color. The visual rating of spri ng green-up is based on a 1 to 9 ra ting scale with 1 equaling straw brown and 9 equaling dark green. Winter temperat ures in 2008 where not severe enough to turn all leaf tissue brow n (Figure 4-12A). By March 2008 lines B3, B7 and B8 had recovered their whole plot color faster as observed in the higher visual ratings compared to the wild-type (Figure 4-12B). Line B7 received the highest ratings in 2008, consistent with the higher clipping dry weight observed early in the growing season that year. In 2009 more extreme temperatures were experienced (Figure 4-12A) and by January 2009 all plots were completely brown. Green-up ratings in March 2009 identified tr ansgenic line B8 as recovering faster from winter dormancy (Figure 4-12C). There was a significant interac tion between irrigation regime and spring greenup ratings for 2009. As expected plants that ha d received full irrigati on the previous season hence less stress had high er green-up ratings. In 2008 a seasonal drought period was experi enced for the months of April and May (Figure 3-3A). Drought tolerance ratings were base d on leaf firing, wilting, and whole plot color. In April at the beginning of the drought, transg enic lines B3 and B7 received higher drought tolerance ratings than the wild -type under moderate and non-irrigated respectiv ely (Figure 413A). The same two lines produced 64% (B3) an d 70% (B7) significant hi gher clipping weight than the wild-type under moderate irrigation fo r April (Figure 4-13B). The improved biomass production and higher visual ratings of these two lines compared to the wild-type may reflect a 45

PAGE 46

better tolerance to drought than the wild-type. Figure 4-13C displays differences observed in April 2008 between line B7, wild-t ype bahiagrass and St. Augustin egrass in non-irrigated plots. Visual ratings for drought tolera nce were repeated in May 2008. Under moderate irrigation all lines displayed better tolerance to drought than the wild-type while only B7 had better tolerance in non-irrigated plots as rev ealed by our ratings (Figure 4-14A). However, no significant difference was observed in regards to dry weight of clippings between th e transgenic lines and the wild-type in the month of May (Figure 4-14B). Results for drought ratings are reflected in the comparison of line B7, wild-type bahiagrass and St. Augustinegrass in May 2008 in nonirrigated plots (Figure 4-14C). The interaction was also significant between irrigation regime and dry weight of clippings for the same two mont hs where drought was experienced. However, no individual lines displayed a significant difference in dry we ight between moderate and nonirrigated for the month of April (Figure 4-13B). In May, most lines and wild-type bahiagrass with the exception of line B10 and St. Augustinegrass produced significantly less clippings in non-irrigated plots than in m oderate irrigation in May (Fi gure 4-14B). St. Augustinegrass received the lowest visual ratings both in April and May (Figur e 4-13A;B). It also produced significantly less clippings under moderate and non-irrigated plots in April 2008 and under moderate irrigation in May 2008 (Figure 4-14B). In June, as the plants were recovering fr om the drought, all transg enic lines received significantly higher ratings than the wild-type un der moderate irrigation (Figure 4-15A). Lines B3, B7 and B8 continue to have higher ratings than the wild-type in non-i rrigated plots (Figure 4-15A). Significant interacti on was found between irrigation regime and drought recovery ratings taken in June. All lines and wild-type bahiagrass and St. Augustinegrass obtained higher recovery ratings under moderate irrigation as co mpared to non-irrigated (Figure 4-15A). No 46

PAGE 47

significant difference was observed in regards to dry weight of c lippings between most transgenics and the wild-type (F igure 4-15B). Transgenic line B 10 produced lower dry weight of clippings than the wild-type under moderate and non-irrigated (Figure 4-15B ). Being that this line had good visual ratings the difference in dry weight of clippings could be associated more with phenotypic difference. Line B10 displayed th e most dwarfing and the least tillering between the transgenic lines. No significant interaction was found between irrigation regime and dry weight of clippings for the month of June. Line B8 was the only line to produce fewer clippings in non-irrigated plots as compared to moderate irrigation (Figure 415B). St. Augustinegrass received the lowest visual ratings for recovery under moderate and non-irrigated plots Figure 415A). It also produced th e least amount of clippings at this time (Figure 4-15B). Figure 4-14C and Figure 4-15D displays differences observe d between transgenic lines and wild-type bahiagrass and St. Augustinegrass during recovery in June 2008. In 2009 a seasonal drought period was experienced for the months of March and April (Figure 3-3B). In contrast to 2008, the drought was experienced ear lier at which point the plants were still in the process of gr eening-up from winter dormancy. In drought ratings taken in April 2009, lines B10, B3 and B8 displa yed better tolerance to drought than the wild-type under moderate irrigation (Figure 4-16A). St. Augustin egrass displayed the least tolerance to drought (Figure 4-16A). However, no significant difference was observed in regards to dry weight of clippings between the transgenic lines, the wild-type or St. Augustinegrass in April 2009 (Figure 4-16B). In non-irrigated plots, line B8 produced significantly mo re clippings than B10 and B3 but not than the wild-t ype. There was no significant diffe rence in clipping weight between irrigation frequency within any transg enic line or wild-type bahiagrass. 47

PAGE 48

Performance during drought and recovery may su ggest that some of the transgenic lines have a better tolerance to lower irrigation than the wild-type and that th ey recover faster from drought. However, maximum quantum yield of photosystem II using dark-adapted leaves and SPAD measurements taken during the drought and recovery periods displayed no significant difference. Results for maximum quantum yield of photosystem II using dark-adapted leaves taken during the drought in May 2008 revealed no significant difference between any transgenic lines and the wild-type under fu ll and non-irrigated plots; under moderate irrigation only line B10 was significantly lower than the wild-typ e (Figure 4-17A). More over, no significant difference was observed in any line or wild-type between irrigation treatments for this measurement (Figure 4-17A). However, line B7 displayed significantly be tter readings than St. Augustinegrass under moderate and nonirrigated plots (Figure 4-17A). In June, during drought recovery, no significant differen ce was observed between irrigation treatments or between lines and wild-type for maximum quant um yield of photosystem II (F igure 4-17B). In June St. Augustinegrass received lower readings than mo st lines and the wild -type bahiagrass under moderate irrigation (Figure 4-17B ). No significant interaction was observed between irrigation regime and maximum quantum yield of photosystem II for either measurement time point, May or June 2008. SPAD measurement results for May reveal lines B3 and B7 having lower values than the wild-type under full irrigation (Figure 4-18A). Wild-type bahi agrass had lower SPAD readings than all the transgenic lines in non-irrigated plots (Figure 4-18A). In June, during drought recovery, only line B8 showed lower SPAD readings than the wild-type in non-irrigated plots (Figure 4-18B). Under moderate irrigation, line B10 had higher SPAD readings than the wildtype and the other transgenic lines (Figure 4-18B). There was significant interaction between 48

PAGE 49

SPAD readings and irrigation regime both in May and in June. We obtained higher readings for all lines in non-irrigated plots as compared to full or moderate irrigati on in May and in June (Figure 4-18). St. Augustinegrass received th e lowest SPAD readings in May under full and moderate irrigation (Figure 4-18A) and in June under moderate and non-irrigated plots (Figure 418B). In contrast to visual scores, tiller numbers and clipping weight data, chlorophyll fluorescence and SPAD measurements are point measurements which are subject to great variability within a single plant. Moreover, only two leaves from two separate tillers were measured per plot. Taking more measurements pe r plot might have had an effect on reducing the variability within these measurements. Root and rhizome dry weight was also evaluate d. In non-irrigated plots, the transgenic lines B10 and B7 produced 64% and 66% respec tively significantly higher dry weight of rhizomes than the wild-type (Figure 4-19). No significant difference was observed in root dry weight between the transgenics a nd the wild-type (Figure 4-20). We previously evaluated drought stress response of the AtGA2ox1 lines under greenhouse conditions. This evaluation also revealed, that the change in plant architecture did not compromise the drought tolerance of bahiagrass (Agharkar, 2007). Flowering in all of the transgenic lines was reduced as compared to the wild-type in 2007 (Figure 4-21A), 2008 (Figure 4-21B) and 2009 (Fi gure4-21C) during onset of flowering and throughout most of the flowering season of ba hiagrass. In 2007 all lines produced fewer inflorescences than the wildtype in July through end of August (Figure 4-21A). Towards the end of the flowering season (October) only line B10 produced more inflorescences than the wild-type both in 2007 (Figure 4-21A). In 2008 lines B 3, B7 and B8 consistently produced fewer inflorescences than the wild-type (Figure 421B). Line B10 did not display a significant 49

PAGE 50

difference in inflorescence produc tion to the wild-type in June and July (Figure 4-21B). As observed in 2007, line B10 produced more inflorescences than the wild-type and all other transgenic lines at the end of the flowering season in 2008(Figure 4-21B). Consistent with measurements taken in 2007 and 2008, early in the 2009 flowering season all lines produced fewer inflorescences than the wild-type. Despite line B10 producing the most infloresce nces at the end of the flowering season, it along all other lines produced si gnificantly less total inflores cences than the wild-type in 2007(Figure 4-22A), 2008 (Figure 4-22B), and 2009 (Figure 4-22C). In 2007, transgenic lines B10, B3, B7, and B8 produced 16%, 58%, 58%, and 36% less inflorescences than the wild-type bahiagrass respectively (Figure 4-22A). In 2008, transgenic lines produced 14% (B10), 76% (B3), 71% (B7) and 41% (B8) less total inflores cences than the wild-type bahiagrass (Figure 422B). As plants in the field started floweri ng in May 2009, transgenic lines produced 86% (B10), 99% (B3), 99% (B7) and 77% (B8) significantl y fewer inflorescences than the wild-type bahiagrass (Figure 4-22C). Production of inflor escences was not significantly affected by mowing frequency; no significant interaction wa s found between total inflorescences produced and mowing frequency in any y ear. Significant interaction was found between total number of inflorescences produced in 2008 and irrigation regime. Lines B 10, B8 and wild-type bahiagrass produced significantly more inflor escences in 2008 under moderate irrigation compared to full or moderate irrigation. Line B3 produced signifi cantly more inflorescences under moderate irrigation as compared to full irrigation only. Leng th of inflorescence stems of the transgenic lines was on average 8-cm shorter than the w ild-type. Transgenic lines B10, B3, B7 and B8 produced inflorescence stems on average 10-cm, 13cm, 4-cm and 4-cm shorter than the wildtype respectively (Figure 4-23). 50

PAGE 51

Reverse transcription PCR (RT-PCR) analysis (Figure 4-24) confirmed the presence of the AtGA2ox1 transcripts in all lines af ter approximately 20 months of growing in the field in nonirrigated plots. Discussion We previously reported that over-expression of AtGA2ox1 in bahiagrass resulted in reduction of bioactive GA levels with production of semi-dwarf plants with reduced stem length, increased number of vegetative tillers, delayed flowering and shorter inflorescences (Agharkar et al., 2007). The results presented here confirm our previous findings and demonstrate that field performance is not compromised and even im proved in some of our transgenic lines. The main characteristic of GA-deficient muta nt or transgenic plants described in the literature is reduced height, associated with s horter internodes. GA-deficient mutants exhibiting dwarf or semi-dwarf phenotypes have been iden tified and described in several plant species including pea, (Brian and He mming, 1955), maize (Phinney, 1956), Arabidopsis (Koornneef and van der Veen, 1980; Sun et al., 1992). Transg enic plants expressi ng a GA2-oxidase and exhibiting reduced height have also been descri bed in several species including rice (Sakamoto et al., 2001; Sakamoto et al., 2003), Arabidopsis (Schomburg et al., 2003 ; Radi et al., 2006), tabacco (Schomburg et al., 2003; Biemelt et al., 2004; Ubeda-Toms et al., 2006; GallegoGiraldo et al., 2007), wheat (Hedden and Phillip s, 2000; Appleford, 2007), poplar (Busov et al, 2003), Nicotiana sylvestris (Lee and Zeevaart, 2005; K ourmpetli et al., 2009), Poa pratensis L. (Blume et al., 2008), Solanum nigrum (Kourmpetli et al., 2009). Interestingly, none of the abovementioned re ports describe an enhanced number of vegetative tillers we consisten tly documented in our study wi th data over three years. Nevertheless, bioactive GAs have been proposed to suppress tiller bud outgrowth and enhance apical dominance in grasses (Lester et al., 1972 ; Johnston and Jeffcoat, 1977; Agharkar et al., 51

PAGE 52

2007). Increased tillering was reported following applications of Trinexapac-ethyl, inhibiting synthesis of bioactive GAs (Ervin and Koski, 1998). Increased tillering ability of transgenic lines may be attributed to the reduction of apical dominance due to a reduc tion in bioactive GAs. Expression of ATH1 in ryegrass resulted in plants with mo re vegetative tillers and delayed or nonflowering (van der Valk et al., 2004). ATH1, the Homeobox transcription factor from Arabidopsis, is a negative regulator in the li ght-regulated gibberellins biosynthesis pathway (Quaedvlieg et al., 1995; Garcia-M artinez and Gil, 2001). Tiller num ber and plant height exhibit a highly negative correlation in several plant spec ies including rice (Yan et al., 1998; Iwata et al., 1995; Li et al., 2003; Ishikawa et al., 2005) and in Arabidopsis and (Beveridge et al., 1996; Booker et al., 2004; Sorefan et al., 2003; Zou et al., 2006). Zou et al. (2006) proposed that dwarfing in GA mutants was a secondary effect to the increased formation of tillers partly due to the reduced apical dominance (Z ou et al., 2006; McSteen, 2009). In sharp contrast, in bahiagrass a more erect growth was observed in transgenic lines overexpressing AtGA2ox1 and displaying increased tillering. Increased tillering of the transgenic lines and more upright growth resulted in higher dry weight of clipping than the wild-type. Gates et al. (1999) speculated that morphological changes accompanying numerous selection cycles for higher yields in Pensacola bahiagrass resulted in taller more erect plants with fewer rhizomes (Werner and Burton, 1991; Pedreira and Brown, 1996a,b; Gates et al., 1999). Pedreira and Brown (1996b) suggested that tall er more erect growth in se lected Pensacola bahiagrass resulted in higher percentage of biomass bei ng harvested by mowing rath er than actual higher biomass yields. This is consistent with the obser vations for dry weight of clippings obtained in this study. 52

PAGE 53

Several studies have made the association between GAs and flowering in monocotyledons (Evans, 1964; Pharis and King, 1985; King a nd Evans 2003; King et al., 2001, 2006; MacMillan et al., 2005; King et al., 2008; Ubeda-Toms et al., 2006; Gallego-Giraldo et al., 2007). In ryegrass GA has been suggested as a leaf-deriv ed long-distance signali ng molecule for floral transition (King et al, 2006; Colassanti and Cone va, 2009). Consistent with our findings, in all years (2006-2009) delayed flowering has been cons istently observed in transgenic plants overexpressing a GA2-oxidase (Hedde n and Phillips, 2000; Sakamoto et al., 2001; Schomburg et al., 2003). However, ectopic expression of Ga2-oxidase gene resulted in plants with normal flowering (Hedden, 2003; Sakamoto et al., 2003). Bahiagrass popularity is largely owed to its extensive root system, which confers great drought tolerance. Evaluation of AtGA2ox1 transgenics under greenhouse conditions revealed that the change in plant architecture did not compromise the drought tolerance of bahiagrass (Agharkar, 2007). The phenotypical changes obs erved in our transg enic lines did not compromise root biomass or drought tolera nce. Moreover, performance during drought and recovery suggests that some of the transgenic lines have a better tolerance to lower irrigation than the wild-type and that they recover faster from drought. It has previously been reported that plants treated with gibberellin ( GA)-biosynthesis inhibitors are usua lly more tolerant to range of environmental stresses (Rademacher 1997; Vetta kkorumakankav et al., 1999; Magome et al., 2004; Sarkar et al, 2004). Vettakkorumakankav et al (1999) demonstrated that GA levels play a key role in heat stress response in barley and suggested the same is true fo r other abiotic stresses. Other studies have suggested the invo lvement of GA in stress response of Arabidopsis (Achard et al., 2006; Magome et al., 2004). Magome et al. (2008) describe how salt reduces bioactive GA contents via an increase in a GA2oxidase transcript levels in Arab idopsis. Under salinity stress 53

PAGE 54

these plants highly express DWARF AND DELAYEDFLOWERING1 ( DDF1 ), encoding an AP2 transcription factor closely related to the CBF/DREB1 family, which binds to the DRE-like motifs present in the GA2ox7 promoter, which reduced bioactive GA levels (Achard and Genschik, 2009). This reduction in bioactive GA levels resulting from salt stress improved abiotic stress protection (Magome et al., 2004, 20 08; Achard et al., 2006; Achard and Genschik, 2009). The dehydration responsive element/C-repeat (DRE/CRT) cis -acting element and the AP2 transcription factors DREB/CBF (DRE binding pr otein/CRT binding factors) play an important role in the ABA-independent stress response pathway (Shinozaki and Yamaguchi-Shinozaki, 2000). The overexpression of their genes improved dr ought and salt tolerance in different plants (Jaglo-Ottosen et al. 1998; Liu et al. 1998; Kasuga et al. 1999) including some grass species (Pellegrineschi et al., 2004; Oh et al., 2005; James et al., 2008). Magome et al. (2008) propose that the GA-de pendent growth retardation provided by GA2ox is an important mechanism for stress ad aptation. In contrast to these findings overexpression of AtGA2ox1 resulted in increased clipping weights and rhizome biomass in bahiagrass along with moderately improved drought suggesting that growth retardation may not be the main mechanism supporting drought toleran ce in this case. To better understand this mechanism activation or suppressi on of genes by GA suppression s hould be explored further in transgenic bahiagrass with a global gene expressi on profiling. It has been suggested that faster recovery of Andropogon gerardii (big bluestem grass) could be at tributed to greater leaf turnover after water stress, which leads to rapid recovery of photosynthesis post-stress, more allocation to roots and reduced allo cation to flowering. 54

PAGE 55

Reduced levels of gibberellins lead to a d ecrease in cell division and elongation at the apical meristem of the shoot, but have little effect on root growth (Giafagna, 1995). This is consistent with our findings. None of the transgen ic lines produced less r oots than the wild-type. Although clear trends were observed in tr ansgenic bahiagrass lines expressing AtGA2ox1, some line-to-line variation in phenotype and performance was also observed. Variation observed between lines may be due to variation in transg ene copy number, expression levels or interaction with other protein complexes, somaclonal variat ion, constitutive expression of transcription factors or their transgene integration site. Transgene silencing can occur through epigenetic mechanisms resulting from exposure to stress (Meng et al., 2006). Various plant stresses high light and temperature, and insecticide treatment have been associated with silencing in several sp ecies (Meng et al., 2006). Plant stresses, abiotic or biotic, can especially interfere w ith transgene stability when conducting field trials where the environment is not controlled (M eyer et al., 1992; Dorlh ac de Borne et al., 1994; Brandle et al., 1995; De Wilde et al., 2000). Our analysis confirmed transgene expression stability of our AtGA20x1 lines following various cycles of vegetative propagation under controlled environment conditions and almost two y ears in the field where they were exposed to stresses such as dehydration, freezing stress and mowing. ATHB16 Expressing Lines (I Lines) Results Field Study I In field study I conducted in 2006 transgenic ATHB16 bahiagrass plants displayed increased number of vegetative tillers or a pr oportional dwarfing with sh orter tillers and finer leaves. ATHB16 expressing line I10 displayed the highest turf density as a result of producing 55

PAGE 56

21% and 19% more vegetative tillers than the wi ld-type eight (Figure 4-25A) and twelve weeks (Figure 4-25B) after transplanti ng, respectively. The higher number of tillers per area of line I10 resulted in a more compact more dense growth as compared to the wild-type bahiagrass (Figure 4-25C). Transgenic lines I32 and I4 produced shorte r tillers and narrower leav es than those of the wild-type bahiagrass. Line I32 produced tillers 14% shorter (Figure 4-22D) and leaves 8% narrower (Figure 4-25E) than thos e of the wild-type bahiagrass. Line I4 produced tillers 13% shorter (Figure 4-25D) and leaves 12% narrower (Figure 4-25E) than those of the wild-type. This resulted in the lines displaying pr oportional dwarfing (Figure 4-25F). The faster production of till ers by transgenic line I10 re sulted in a better field establishment as confirmed by our establishment ratings (Fi gure 4-26A). Line I10 showed overall faster establishment than other lines and wild-type bahiagrass and St. Augustinegrass (Figure 4-26A). This line spread faster than th e wild-type and St. Augustin egrass inside the field plots (Figure 4-26B). St. Augustinegrass displaye d a slower establishment than all of our bahiagrass plants (Figure 4-26). As we observed in the AtGA2ox1 lines, a higher turf density and more vegetative tillers was associated with a more upright growth. The erect growth pattern an d the higher number of tillers in the transgenic line I10 contributed to 41% signifi cantly higher clipping weight compared to the wild-type, following four week s of growth after establishment (Figure 4-27). Lines I32 and I4, displaying, a more dwarf phenotype, produced 31% and 57% respectively less clippings than the w ild-type (Figure 4-27). All transgenic lines had significantly higher visual rating for mowing quality as compared to the wild-type bahiagrass (F igure 4-28A). Transgenic line I10 displayed a more compact growth with no visible rhizomes or gaps in contrast to wild-t ype (Figure 4-28B). 56

PAGE 57

The number of inflorescences in 8 Au gust 2006, during establishment, produced by transgenic lines I10 and I32, ranging from 0.67 to 0.88, was significantly lower th an wild-type (1.46) (Table 4-2). In 29 August lines I10 and I4 produced 31% and 45% less inflorescences than the wild-type, respectively. The length of inflorescence stems of all lines was 8% (I10), 17% (I32) and 28% (I4) shorter than those of the wild-type bahiagrass (Figure 4-29). Field Study II During field study II, conducted in 2007, 2008 and 2009, transgenic bahiagrass lines expressing ATHB16 produced significantly more vegetative tillers than the wild-type bahiagrass. Lines I12 and I28 consistently produced the highes t number of tillers in all dates and under all irrigation treatments (Figure 4-30). During establishment in September 2007, ATHB16 expressing lines produced on average 44% (I12), 19% (I23) and 39% (I28) more tillers than the wild-type bahiagrass (Figure 4-30A). Line I32 wa s the only transgenic line that did not produce significantly more tillers than the wild-type (F igure 4-30A). In measurements taken on May 2008, transgenic lines I12 and I 28 produced 33% and 31% more tillers than the wild-type, respectively (Figure 4-30B). Wh ereas in September 2008, the tr ansgenic lines produced 49% (I12), 32% (I23), 48% (I28), and 26% (I32) more ti llers than the wild-type (Figure 4-30C). We found significant interacti on between tillers produced and i rrigation regimes for May 2008. In May 2009 transgenic lines produced 45% (I12), 26% (I23), 44% (I28) and 22% (I32) more tillers than the wild-type (Figure 4-30D). In contrast to AtGA2ox1 data from the same time point, increased tillering of the transgenic lines in comparison to the wild-type bahiagrass was not consistent for all lines under al l three irrigation treatments in May 2008 (Figure 4-30E). In May 2008 number of tillers was significantly reduced in non-irrigated plots for all lines and wild-type bahiagrass during the drought (Figure 4-30E). During the drought, transgen ic plants and wildtype produced under full irrigation 27% (I12), 24 % (I23), 31% (I32), and 40% (WT) more tillers 57

PAGE 58

than in non-irrigated plots (Figure 4-30E). The exception was line I28, producing the most tillers under moderate irrigation, 47% more tillers than in non-irrigated plots (Figure 4-30E). Under full irrigation all lines except I23 produc ed more tillers than the wild -type bahiagrass (Figure 4-30E). While under moderate irrigation, I32 did not pro duce more tillers than the wild-type (Figure 430E). In non-irrigated plots, all lines produced more tillers than the w ild-type (Figure 4-30E). Tiller production was reduced in non-irrigated plots for all lines and wild-type bahiagrass in May 2009 (Figure 4-30F). Transgenic plants and wild -type produced under full irrigation 25% (I12), 10% (I23), 13% (I28), 25% (I32) and 43% (WT) more tillers than in non-irrigated plots (Figure 4-30F). Bahiagrass transgenic plants and w ild-type produced on average 30% and 23% more tillers under full irriga tion than in non-irrigated plot s in May 2008(Figure 4-30D) and 2009 (Figure 4-30F), respectively. These were the only time-points when there was a significant interaction between irrigation re gime and production of tillers. The higher number of tillers in transgenic li nes (I12, I23, I28) resulted in significantly higher turf density as confirme d by our density ratings taken in September 2007 (Figure 4-31A), May 2008 (Figure 4-31B) and May 2009 (Figure 4-31C). On all dates where density was evaluated, I32 was the only transgenic line that did not display greater turf density than the wildtype (Figure 4-31). This is c onsistent with tiller data for September 2007 (Figure 4-31A) and May 2008 tiller data Figure (4-31B). Consistent to findings from field study I, ATHB16 bahiagrass plants displayed a proportional dwarfing with shorter tillers and finer leaves. Transgenic lines produced 21% (I12), 14% (I23), 11% (I28) and 5% (I32) shorter tillers than those of th e wild-type bahiagrass (Figure 4-32A). The same lines produced 14% (I12), 9% (I23), 9% (I28) and 7% (I32) narrower leaves than those of the wild-type bahiagrass (Figure 4-32B). Narrower leaves of the transgenic lines 58

PAGE 59

resulted in finer leaf texture in all our lines confirmed by our visual ratings (Figure 4-32C). Visual ratings for leaf texture we re assigned using a 1 to 9 scale, where 1 is the coarsest (widest) and 9 is the finest leaf texture. As previously mentioned, higher number of til lers was associated with a denser, more compact and erect growth in the transgenic lines as compared with the wild-type bahiagrass, which exhibited a sparse r looking and prostrate gr owth (Figure 4-33). Four weeks after transplanting, faster producti on of vegetative tille rs by the transgenic lines I12 and I28 resulted in a be tter, faster field establishment as compared to the wild-type (Figure 4-34A). The faster establishment was associated with the transgenic lines having increased tillering (Figure 4-34B). Eight weeks la ter (twelve weeks after transplanting), lines I12 and I32 had lower establishment ratings than the wild-type (Figure 4-34C). This was a result of the denser, more compact and erect growth. The higher number of tillers of this line was very concentrated without much lateral spread twelve weeks after transplanting. This growth is evident in comparing growth between line I 12 and wild-type bahiag rass (Figure 4-33). The higher tiller number and erec t growth of transgenic lines I12 and I28 contributed to higher dry weight of clippings compared to the wild-type bahiagrass plants all months of the establishing period in 2007 (Fi gure 4-35A). Transgenic line I12 produced 73%, 57% and 60% greater clipping weight than the wild-type for the months of August, September and October 2007 (Figure 4-35A). Line I28 produced 58%, 54% and 52% greater clippi ng weight than the wild-type for the months of August, Septem ber and October 2007 (Figure 4-35A). Line I23 produced 13% more clippings than the wild-type in August 2007 (F igure 4-35A). No significant interactions or other signifi cant differences between transgenic lines and wild-type were observed for clipping dry weight in 2007. 59

PAGE 60

In 2008, some significant differences between dr y weight of clipping of transgenic lines and wild-type (Figure 4-35B). Line I28 produced 58%, 51% and 25% more clippings than the wild-type in March, April and September resp ectively (Figure 4-35B). Whereas, line I12 produced 34%, 46%, 36% and 40% less clippings than the wild-typ e for the months of April, May, June, July and August, respectively (Figur e 4-35B). Line I23 produced 29% and 24% less clippings than the wild-type in May and June and 22% more clippings than the wild-type in September (Figure 4-35B). Line I32 produced 35% and 42% less clippings than the wild-type in May and August (Figure 4-35B). In March and Ap ril 2009 only line I28 produced more clippings than the wild-type bahiagrass, 39% and 43% more respectively (Figure 4-35C). Moreover, there was no significant interaction between any of our treatments and clipping weight in March or April 2009. Some lines displayed reduced vigor as indicated by our esta blishment and dry weight of clippings data. Twelve weeks after establishment of field plots, lines I1 2 and I32 received lower establishment ratings (Figure 434C). The altered phenotypes obser ved in these lines affected their establishment rate. Lines I12, I23 and I32 produced less clippings than the wild-type at various time-points. Line I12, spreading the slowest, produced less clippi ngs than the wild-type during most of the summer months in 2008 (Fi gure 4-35B). Line I23, pr oduced less clippings than the wild-type during the dr ought and recovery months specif ically, which could indicate reduced vigor when exposed to drought (Figur e 4-35B). Line I32 also produced less clipping than the wild-type in May, during drought (Figure 4-35B). This could indicate that the changed observed by the over-expression of ATHB16 improve the appearance but may hinder the plant vigor of some of our lines. Specifically, line I12, which displayed the most extreme phenotype and reduced vigor. 60

PAGE 61

Weed encroachment ratings were taken in March when the highest incidence of weed emergence was observed. Ratings were assigned usi ng a 1 to 9 scale, with 9 being no weeds and 1 being all covered in weeds. In ratings taken in March 2008 transgenic lines I12, I23, I28 and St. Augustinegrass received higher ratings for re sistance to weeds (Figure 4-36A). Line I12, produced more tillers and had a denser habit, which suppressed weed encroachment. In 2009, significant differences between transgenic lines and wild-type bahiagrass were observed for full irrigation plots with lines I28, I32 and St Augus tinegrass having fewer w eeds than the wild-type (Figure 4-36B). There was a positive interaction between weed encroachment and irrigation with all lines and wild-types being more susceptibl e to weeds under full irri gation (Figure 4-36B). Spring green-up ratings were also used to eval uate performance. Green-up is a measure of the transition from winter dormancy to active spring growth. It is based on plot color not genetic color. The visual rating of spri ng green-up is based on a 1 to 9 ra ting scale with 1 equaling straw brown and 9 equaling dark green. Winter temperat ures in 2008 where not severe enough to turn all leaf tissue brow n (Figure 4-37A). By March 2008 lines I 12, I23 and I28 had almost recovered their whole plot color. Faster r ecovery from winter temperatures than the wild-type are described by higher visual ratings (Figure 437B.) More extreme winter temperatures were experienced in 2009 (Figure 4-37A). By January 2009 all plots were completely brown. Green-up ratings in March 2009 show one of the transgenic lines, I 28, recovering better from winter temperatures than the wild-type (Figure 4-37C). There was a significant interaction between irrigation regime and spring green-up ratings for 2009. As expected plants that had receiv ed full irrigation the previous season displayed higher green-up ratings. A ll lines and wild-types received significantly higher green-up ratings under full irrigation compared to no or moderate irrigation. 61

PAGE 62

Flowering in transgenic lines I12, I23 and I28 was reduced as compared to the wild-type during onset and throughout the flowering se ason in 2007 (Figure 4-38A), 2008(Figure 4-38B) and 2009 (Figure 4-38C). In 2007, lines I12 and I28 consistently produced the least amount of inflorescences (Figure 4-38A). Line I23and I32 produced less inflorescenc es than the wild-type in al dates measured except in 13 August (Figur e 4-38A). In 2008, lines I1 2 and I28 continued to produce the least amount of inflorescences a ll through the flowering season (Figure 4-38B). Lines I23 and I32 produce less infl orescences than the w ild-type early in the season but display no difference to the wild-type in 24 July, 28 A ugust and 29 September (Figure 4-38B). Early in the 2009 flowering season all lines produce signifi cantly less inflorescences than the wild-type (Figure 4-38C). Transgenic lines had 61% (I12), 16% (I23) and 47% (I28) less total inflorescences than the wild-type in 2007, which was statis tically significant (Figure 4-39A ). In 2008 transgenic lines produced 77% (I12), 17% (I23) and 65% (I28) fewe r inflorescences than the wild-type (Figure 439B). In 2009 lines produced 99.6% (I12), 68 % (I23), 97% (I28) and 79% (I32) fewer inflorescences than the wild-t ype (Figure 4-39C). We did find significant interaction between total number of inflorescences produced in 2008 or 2009 and irrigation regime. Lines I23, I28, I32 and wild-type bahiagrass produced significantly more inflorescences in 2008 under moderate irrigation compared to full or non-irrigated. Length of inflorescence stems of the transgenic lines was 21% (I12) and 13% (I32) shorter than that of the wild -type (Figure 4-40). In 2008 a seasonal drought period was experi enced for the months of April and May. (Figure 33A). Drought tolerance ratings were based on leaf firing, wilting, and whole plot color. In April at the beginning of the drought there was no significant difference between our transgenic lines and wild-type (F igure4-41A). All lines and wild-t ype received significant lower 62

PAGE 63

ratings in non-irrigated plots as compared to moderate irrigation (Figure 4-41A). St. Augustinegrass received the lowest ratings under bot h irrigation treatments at this time (Figure 4-41A). Significant difference in dry weight of clippings for th at same month shows line I28 producing more clippings under moderate irrigati on than other lines a nd wild-type (Figure 441B). Visual ratings for drought tolerance were repeated in May 2008. Unde r moderate irrigation lines I23, I28 and I32 displayed better toleran ce to drought than the w ild-type (Figure 4-42A). There was no significant difference between transgenic and wild-type bahi agrass in non-irrigated plots (Figure 4-42A). Again, all lines and wild -type received significan t lower ratings in nonirrigated plots as compared to moderate ir rigation (Figure 4-42A). In May, no significant difference was observed in regards to dry weight of clippings between th e transgenic lines and the wild-type (Figure 4-42B). Only line I28 and the wild-type produce significantly less clippings in non-irrigated plots as compared to moderate irriga tion (Figure 4-42B). Figure 4-42C displays visual differences observed in Ma y 2008 resulting from drought stress between transgenic line I 28 and wild-type. In June, as the plants were recovering fr om the drought, lines I23, I28 and I32 received higher ratings than the wild-typ e under moderate irrigation (Fi gure 4-43A). Lines I23 and I28 also had higher ratings than the wild-type in non-irrigated plots (Figure 4-43A). Significant interaction was found betw een irrigation regime and drought rec overy ratings taken in June. All lines and wild-type bahiagrass and St. Augustin egrass obtained higher recovery ratings under moderate irrigation as compared to non-irrigated (Fi gure 4-43A). In regards to dry weight of clippings, line I28 produced higher clippings th an the wild-type under moderate irrigation (Figure 4-43B). Figure 4-43C displays visual differences observed in June 2008 during the drought recovery period between tr ansgenic line I28 and wild-type. 63

PAGE 64

In 2009 a seasonal drought period was experienced for the months of March and April (Figure 3-3B). In contrast to 2008, the drought was experienced earlier at which point the plants were still in the process of gr eening-up from winter dormancy. In drought ratings taken in April 2009, lines I23, I28 and I32 displayed better tole rance to drought than the wild-type under moderate irrigation (Figure 4-44A). Line I28 produced more clip ping weight than the wild-type under moderate irrigation in April 2009(Figure 4-44B). Performance during drought and re covery indicates that all tran sgenic lines perform at least as well as the wild-type under drought. While line I28 appeared to perform better under the drought conditions than the other transgenic lines and the wild-type in. Nevertheless, maximum quantum yield of photosystem II using dark-ada pted leaves and SPAD measurements taken during the drought and recovery periods displa yed no significant difference. Results for maximum quantum yield of photosystem II using dark-adapted leaves taken during the drought in May 2008 revealed no signifi cant difference between any transgenic lines and the wild-type under full and non-irrigated (Figur e 4-45A). Moreover, no significant difference was observed in any line or wild-type between ir rigation treatments for this measurement (Figure 4-45A). In June, during drought recovery, no significant difference was observed between irrigation treatments or between lines a nd wild-type for maximum quantum yield; only line I32 had lower values than the wild-type in nonirrigated plots (Figure 4-45B). No significant interaction was observed between irrigation regime and maximu m quantum yield of photosystem II for either measurement timepoint, May or June 2008. SPAD measurement results for May reveal line I32 having higher SPAD readings than wild-type and other lines under all three irrigation regimes (Figure 4-46A). Line I28 had higher readings than wild-type under mode rate irrigation (Figure 4-46A). Line I23 had lower readings 64

PAGE 65

than the wild-type in non-irrigated plots (Figur e 4-46A). In June, during drought recovery, lines I23 and I32 have higher SPAD read ings than the wild-t ype under moderate irrigation (Figure 446B). Line I28 showed lower SPAD readings than the wild-type under full irrigation (Figure 446B). There was significant inte raction between SPAD readings and irrigation regime both in May and in June. A higher SPAD reading was record ed for all lines in non-irrigated plots as compared to full or moderate irrigation (Figure 4-46B). We also looked into root and rhizome dry weight to determine if the change in aboveground plant architecture had affected belowground organs. In non-irriga ted plots, transgenic line I12 produced 69% higher dry weight of rhizomes than the wild-type (Figure 4-47). No significant difference wa s observed in root dry weight between the transgenics a nd the wild-type (Figure 4-48). We also evaluated drought stress response of the ATHB16 lines under controlled environment conditions in comparison to wild-t ype bahiagrass plants and St. Augustinegrass (unpublished, 2006). We found that all lines evaluated performed at least as well as the wild-type under drought conditions, with line I32 recove ring better. Reverse transcription PCR (RT-PCR) analysis (Figure 4-49) confir med the presences of the ATHB16 transcripts in all lines after approximately 20 months of growing in the field in nonirrigated plots. Discussion It was previously reported that over-expression the Arabidopsis ATHB16 in bahiagrass resulted in proportional dwarfing of the plant with shorter, finer leaves, increased tillering and reduced and delayed flowering compared to w ild-type plants (Zhang et al., 2007). The results presented here confirm these findings and de monstrate that field performance is not compromised and even improved in some of the transgenic lines. 65

PAGE 66

Over-expression of ATHB16 in Arabidopsis resulted also in reduced leaf expansion and shoot elongation and with the proposed function for this gene as a suppr essor of cell expansion (Wang et al., 2003a). In Arabidopsis, the rosette leaf area of transgenic lines was 30 % less than the wild-type resulting from the over-expression of the ATHB16 As a result, these plants appeared more compact and smaller when compared to the wild-type, as di d our bahiagrass lines. Delayed and reduced flowering was also observed in transgenic bahiagrass lines. Transgenic expression of ATHB16 in Arabidopsis also resulted in plants with altered flowering time (Wang et al., 2003a). Arabi dopsis plants over-expressing ATHB16 also displayed significant delayed flowering and reduced inflorescence fo rmation under long days (Wang et al., 2003a). Increased tillering was another phenotype observed within the ATHB16 bahiagrass lines. Over-expression of ATHB16 in Arabidopsis also resulted in enhanced formation of vegetative tillers (Wang et al., 2003a). Expression of ATH1 in ryegrass resulted in plants with more vegetative tillers and delayed or nonflowering (van der Valk et al., 2004). Another Arabidopsis homeobox transcription factor, ATH1 gene is a negative regulat or in the light-regulated gibberellins biosynthesis pathwa y (Quaedvlieg et al., 1995; Garc ia-Martinez and Gil, 2001). Over-expression of ATH1 in perennial ryegrass resulted in decreased levels of GA1 and was accompanied by the outgrowth of normally quiescen t lateral meristems into extra leaves and delayed development of inflorescences (van de r Valk et al., 2004). Till er number and plant height exhibit a highly negative correlation in se veral plant species including rice (Ishikawa et al., 2005; Iwata et al., 1995; Li et al., 2003; Yan et al., 1998) and in Arabidopsis and (Beveridge et al., 1996; Booker et al., 2004; Sorefan et al ., 2003; Zou et al., 2006). Zou et al. (2006) proposed that dwarfing in GA mutants was a secondary effect to the increased formation of tillers partly due to the redu ced apical dominance (Zou et al., 2006; McSteen, 2009). However, 66

PAGE 67

ATHB16 represses cell expansion independent of the GA signal transduction pathway (Wang et al., 2003a). HDzip genes like ATHB16 represent a large gene family with 42 members in Arabidopsis. Proteins encoded by these genes are characterized by the presence of a DNA binding homeodomain and an adjacent Leu zipper motif; th ey are involved in developmental processes (Henriksson et al., 2005). Different members of HDzip proteins may form heterodimers and then bind to regulatory DNA region of downstream ge nes (Sessa et al., 1993; Wang, 2001). Hence, ATHB16 could interact with ot her HDzip proteins such as ATHB6 (Wang, 2001). ATHB6 is known to be upregulated in respons e to water-deficit conditions and to treatment of abscisic acid and has been proposed to function as a regulator of growth and development in response -to limited water conditions (Sderman et al. 1999; Himm elbach et al. 2002). This implies that overexpression of ATHB16 may in concert with ATHB6 enhance the drought tolerance of transgenic plants over-expressing ATHB16. Target genes downstream of ATHB16 still have to be identified to fully understand its function. Levels of expression of transcription factor encoding genes do not always correlate to the target gene expression and phenotype (Cao et al. 2006). This may be due to regulation by target gene expression by other mechanisms like postt ranslational modificatio n, protein-protein interaction and other signaling pathways (Gu et al. 2000; Chakra varthy et al. 2003 ). Pleiotrophic effects can also be caused by somaclonal variat ion, constitutive expression of transcription factors or their transgene integration site. Somacl onal variation is not likely to contribute to line to line variation, since the autote traploid genome of bahiagrass cu ltivar Argentine is buffered against mutations. 67

PAGE 68

Our analysis confirmed transgen e expression stability of our ATHB16 lines following various cycles of vegetative propagation under controlled environment conditions and almost two years in the field where they were exposed to stresses such as dehydration, freezing stress and mowing. 68

PAGE 69

A C Figure 4-1. Density of AtGA2ox1 expressing bahiagrass lines (B11, B3, B6, B7, B9) and wildtype bahiagrass (WT) and St. Augustinegrass (SA). (A) Number of tillers produced in a 100 cm2 area following eight weeks of growth after transplanting. (B) Number of tillers produced by in a 100 cm2 area following twelve weeks of growth after transplanting. (C) Visual ra tings for density eight weeks after transplanting (D) Comparison of AtGA2ox1 expressing line B3 and wild-t ype bahiagrass (WT) 4 weeks after establishment of field plots. Capital letters at the bottom of each graph indicate significant difference between lines at = 0.05 Error bars indicate standard error of the means. D B WT B3 0 20 40 60 B11B3B6B7B9WTTNumber of Tillers per 100 cm2of Field Plots Eight Weeks after TransplantingB A B B A B 1 3 5 7 9 B11B3B6B7B9SAWTDensityVisual Ratings for Density Eight Weeks after Transplanting C A B C AB E Dillers 0 20 40 60 B11B3B6B7B9WTNumber of Tillers per 100 cm2of Field Plots Twelve Weeks after TransplantingB A BC B A Cillers T 69

PAGE 70

A 1 3 5 7 9 B11B3B6B7B9SAWTEstablishmentVisual Ratings for Establishment of Field Plots Four Weeks after EstablishmentC A B B A D C B B3 WT SA Figure 4-2. Field establishment of AtGA2ox1 expressing lines (B11, B 3, B6, B7, B9) and wildtype bahiagrass (WT) and St. Augustineg rass (SA). (A) Visual ratings for establishment of field plots four weeks after transplanting. (B) Comparison of AtGA2ox1 expressing line B3 and wild-type bahiagrass (WT) and St. Augustinegrass (SA) 4 weeks after establishment of field plots. Capital letters at the bottom of the graph indicate significant difference between lines at = 0.05. Error bars indicate standard error of the means. 70

PAGE 71

0 2 4 6 8 10 12 B11B3B6B7B9SAWTWeight (g)Dry Weight of Clippings per Field Plot Four Weeks after TransplantingCD B E C A E D Figure 4-3. Dry weight of c lippings produced under weekly mowing four weeks after establishment by AtGA2ox1 expressing lines (B11, B3, B 6, B7, B9) and wild-type bahiagrass (WT) and St. Augustinegrass (SA). Capital letters at the bottom of the graph indicate significant difference between lines at = 0.05. Error bars indicate standard error of the means. A 1 3 5 7 9 B11B3B6B7B9WTMowing QualityVisual Ratings for Mowing Quality Eight Weeks after Transplanting C A B B A D WT B3 B Figure 4-4. Mowing quality of AtGA2ox1 expressing lines (B11, B3, B 6, B7, B9) and wild-type bahiagrass (WT). (A) Visual ratings for mowing quality eight weeks after transplanting. (B) A freshly mowed AtGA2ox1 expressing line B3 in comparison to wild-type bahiagrass (WT) following weekly mowing at 8 cm cutting heights and 14 week after establishment of field plots Capital letters at the bottom of the graph indicate significant difference between lines at = 0.05. Error bars indicate standard error of the means. 71

PAGE 72

Table 4-1. Emergence of inflorescences in AtGA2ox1 expressing lines (B11, B3, B6, B7, B9) and wild-type bahiagrass (W T) under field conditions. Capital letters below each entry indicate significant difference between lines at each timepoint at = 0.05. Record / Line B11 B3 B6 B7 B9 WT August 8, 2006 Average number of inflorescences per plot 1.21 0.20 0.00 0.00 0.88 0.04 0.04 0.04 0.08 0.06 1.46 0.33 A C A BC BC A August 29, 2006 Average number of inflorescences per plot 79.13 0.30 54.38 5.52 64.25 4.09 48.75 3.46 53.63 4.90 62.88 3.82 A B A B B A 0 10 20 30 40 50 B11B3B6B7B9WTLength (cm)Average Length of Fully Expanded Inflorescence StemsB B C B AB A Figure 4-5. Length of fully expanded in florescence stems (without racemes) of AtGA2ox1 expressing lines (B11, B3, B6, B7, B9) and wild-type bahiagrass (WT). Capital letters at the bottom of the graph indicate significant difference between lines at = 0.05 Error bars indicate standard error of the means. 72

PAGE 73

A B C D E F 0 10 20 30 B10B3B7B8WTTillersNumber of Tillers per 100 cm2of Field Plots in September 2007 C A AB B C 0 10 20 30 B10B3B7B8WTTillersNumber of Tillers per 100 cm2of Field Plots in May 2009 B A A B C 0 10 20 30 B10B3B7B8WTTillersNumber of Tillers per 100 cm2of Field Plots in May 2008 B A A C D 0 10 20 30 40 B10B3B7B8WTTillersNumber of Tillers per 100 cm2of Field Plots in May 2008 Full Moderate NoB A A C C B A A B C B AB A B C a a b a a b a a b a a b a a b 0 10 20 30 I12I23I28I32WTTillersNumber of Tillers per 100 cm2of Field Plots in September 2008 A B A B C 0 10 20 30 40 B10B3B7B8WTTillersNumber of Tillers per 100 cm2of Field Plots in May 2009 Full Moderate NoB A A B C B A A B C B AB A B C a a b a a b a a b ab a b a a b Figure 4-6. Number of tillers produced in a 100 cm2 by AtGA2ox1 expressing lines (B10, B3, B7, B8) and wild-type bahiagrass (WT) in (A) September 2007, (B) May 2008, (C) September 2008, (D) May 2009, (E) May 2008 by irrigation, (F) May 2009 by irrigation. Capital letters at the bottom of each graph indicate significant difference between lines at = 0.05. Lowercase letters above bars indicate si gnificant difference between irrigation treatments within each line at = 0.05. Error bars indicate standard error of the means. 73

PAGE 74

1 3 5 7 9 B10B3B7B8SAWTDensityVisual Ratings for Density in September 2007C A B B A C 1 3 5 7 9 B10B3B7B8SAWTDensityVisual Ratings for Density in May 2008D A A B C D 1 3 5 7 9 B10B3B7B8SAWTDensityVisual Ratings for Density in May 2009C A AB B D CDA B C Figure 4-7. Density of AtGA2ox1 expressing bahiagrass lines (B 10, B3, B7, B8) and wild-type bahiagrass (WT) and St. Augustinegrass (SA) in (A) September 2008, May 2008 (B) and 2009(C). Capital letters at the bottom of each graph indicate significant difference between lines at = 0.05. Error bars indicate standard error of the means. 74

PAGE 75

B3 WT B7 Figure 4-8. Comparison of fully established AtGA2ox1 lines (B3, B7) and wild-type (WT). 1 3 5 7 9 B10B3B7B8SAWTEstablishmentVisual Ratings for Establishment Four Weeks after TransplantingB A A A D C 1 3 5 7 9 B10B3B7B8SAWTEstablishmentVisual Ratings for Establishment Eight Weeks after TransplantingD A AB BC CD DB3 B7 WT A B C Figure 4-9. Field establishment of AtGA2ox1 expressing bahiagrass lines (B11, B3, B6, B7, B9) and wild-type bahiagrass (W T) and St. Augustinegrass (SA). (A) Visual ratings for establishment of field plots four weeks after transplanting. (B) Visual ratings for establishment of field plots eight weeks after transplant ing (C) Comparison of AtGA2ox1 expressing lines B3 and B7 and wild -type bahiagrass (WT) 4 weeks after establishment of field plots. Capital letters at the bottom of the graph indicate significant difference between lines at = 0.05. Error bars indicate standard error of the means. 75

PAGE 76

0 5 10 15 20 Mar AprWeight (g)Dry Weight of Clippings for 2009 B10 B3 B7 B8 SA WT c abc a ab bc bcb ab a a ab ab 0 10 20 30 40 50 60 Aug Sept OctWeight (g)Dry Weight of Clippings for 2007 B10 B3 B7 B8 SA WT b a a a b bc b a b c ccd b a b d c 0 20 40 60 80 100 Mar Apr May Jun Jul Aug Sept OctWeight (g)Dry Weight of Clippings for 2008 B10 B3 B7 B8 SA WT ab ab a ab b abc ab a b c bcc bc ab abc d ab b a a c a c bc a ab d ab b a a c ab ab a a c bbc a a ab c bC B A Figure 4-10. Dry weight of clippings produced by AtGA2ox1 expressing lines (B11, B3, B6, B7, B9) and wild-type bahiagrass (WT) and St. Augustinegrass (SA) in (A) 2007, (B) 2008 and (C) 2009. Lowercase letters at the bottom of the graph indicate significant difference between lines within each month and year at = 0.05. Error bars indicate standard error of the means. 76

PAGE 77

1 3 5 7 9 B10B3B7B8SAWTResistance to Weed EncroachmentVisual ratingts for Resistance to Weed Encroachment in March 2009 Full Moderate NoB AB AB AB A C A A A A A A b a a b ab a b a a b ab a b a a A A A A A A a a a 1 3 5 7 9 B10B3B7B8SAWTResistance to Weed EncroachmentVisual Ratings for Resistance to Weed Encroachment in March 2008B A A A A BA B Figure 4-11. Visual ratings for resi stance to weed encroachment of AtGA2ox1 expressing lines (B11, B3, B6, B7, B9) and wild-type bahiag rass (WT) and St. Augustinegrass (SA) in March (A) 2008 and (B) 2009. Capital letters at the bottom of each graph indicate significant difference between lines at = 0.05. Lowercase letters above bars indicate significant difference between irrigation treatment within each line at = 0.05. Error bars indicate standard error of the means. 77

PAGE 78

A Figure 4-12. Spring green-up of AtGA2ox1 expressing lines (B11, B3, B6, B7, B9) and wild-type bahiagrass (WT) and St. Augustinegra ss (SA). (A) Minimum temperatures experienced in winter months Visual ratings for greenup in March (B) 2008 and (C) 2009. Capital letters at the bottom of each graph indicate significant difference between lines at = 0.05. Error bars indicate standard error of the means. 1 3 5 7 9 B10B3B7B8SAWTSpring Green-upVisual Ratings for Spring Green-up in March 2009C ABC AB A AB B 1 3 5 7 9 B10B3B7B8SAWTSpring Green-upVisual Ratings for Spring Green-up in March 2008CD AB A BC D DB C -10 -5 0 5 10 15 20 25 30OctoberNovemberDecemberJanuaryFebruaryMarchTemperature ( C)Daily Minimum TemperaturesWinter 07-08 Winter 08-09 78

PAGE 79

A 1 3 5 7 9 B10B3B7B8SAWTDrought ToleranceVisual Ratings for Drought Tolerance in April 2008 Moderate NoB A AB AB C B CD B A B D BC a b a b a b a b a b a b 0 10 20 30 40 50 B10B3B7B8SAWTWeight (g)Dry Weight of Clippings in April 2008 Moderate NoB A A AB B B AB AB A AB B AB a a a a a a a a a a a a B C B7 WT SA Figure 4-13. Drought tolerance of AtGA2ox1 expressing lines (B11, B3, B6, B7, B9) and wildtype bahiagrass (WT) and St. Augustinegra ss (SA). (A) Visual ratings for drought tolerance in April 2008. (B) Dr y weight of clipping under mo derate and non-irrigated regimes in April 2008. (C) Comparison of line B7 and wild-type (WT) and St Augustinegrass (SA) during the onset of drought in April. Capital letters at the bottom of each graph indicate significant difference between lines at = 0.05. Lowercase letters inside the bars indicate significant difference between irrigation treatment within each line at = 0.05. Error bars indicate standard error of the means. 79

PAGE 80

A 1 3 5 7 9 B10B3B7B8SAWTDrought ToleranceVisual Ratings for Drought Tolerance in May 2008 Moderate NoAB A AB B D C CD B A B D BC a b a b a b a b a b a b B 0 10 20 30 40 50 60 B10B3B7B8SAWTWeight (g)Dry Weight of Clippings in May 2008 Moderate NoB AB A AB C AB A A A A A A a a a b a b a b a a a b B7 WT SA C Figure 4-14. Drought tolerance of AtGA2ox1 expressing lines (B11, B3, B6, B7, B9) and wildtype bahiagrass (WT) and St. Augustinegra ss (SA). (A) Visual ratings for drought tolerance in May 2008. (B) Dry weight of clipping under moderate and non-irrigated regimes in May 2008. (C) Comparison of line B7 and wild-type (WT) and St Augustinegrass (SA) during the drought in May. Capital letters at the bottom of each graph indicate significant difference between lines at = 0.05. Lowercase letters above bars indicate significant difference between irrigation treatment within each line at = 0.05. Error bars indicate standard error of the means. 80

PAGE 81

1 3 5 7 9 B10B3B7B8SAWTDrought RecoveryVisual Ratings for Drought Recovery in June 2008 Moderate NoA A A A C B C B A B D C a b a b a b a b a b a b A A 0 20 40 60 B10B3B7B8SAWTWeight (g)Dry Weight of Clippings in June 2008B 80 Moderate NoC BC AB A D AB C B A AB C AB a a a a a a a b a a a a B10 B3 SA B7 D C B7 WT Figure 4-15. Drought tolerance of AtGA2ox1 expressing lines (B11, B3, B6, B7, B9) and wildtype bahiagrass (WT) and St. Augustinegra ss (SA). (A) Visual ratings for drought recovery in June 2008. (B) Dry weight of clipping under moderate and non-irrigated regimes in June 2008. (C) Comparison of line B7 and wild-type (WT) during the drought recovery in June. (D) Compar ison of lines B3, B7, B10 and St Augustinegrass (SA) during the drought recovery in June. Capital letters at the bottom of each graph indicate significant difference between lines at = 0.05. Lowercase letters above bars indicate significant difference between irrigation treatment within each line at = 0.05. Error bars indicate standard error of the means.Figure 4-15. Drought tolerance of AtGA2ox1 expressing lines (B11, B3, B6, B7, B9) and wildtype bahiagrass (WT) and St. Augustinegra ss (SA). (A) Visual ratings for drought recovery in June 2008. (B) Dry weight of clipping under moderate and non-irrigated regimes in June 2008. (C) Comparison of line B7 and wild-type (WT) during the drought recovery in June. (D) Compar ison of lines B3, B7, B10 and St Augustinegrass (SA) during the drought recovery in June. Capital letters at the bottom of each graph indicate significant difference between lines at = 0.05. Lowercase letters above bars indicate significant difference between irrigation treatment within each line at = 0.05. Error bars indicate standard error of the means. 81

PAGE 82

A B 1 3 5 7 9 B10B3B7B8SAWTDrought ToleranceVisual Ratings for Drought Tolerance in April 2009 Moderate NoA A A A C B AB AB A AB C B a b a b a a a b a a a a 0 1 2 3 4 5 6 B10B3B7B8SAWTWeight (g)Dry Weight of Clippings in April 2009 Moderate NoA A A A A A B B AB A AB AB a a a a a a a a a a a a Figure 4-16. Drought tolerance of AtGA2ox1 expressing lines (B11, B3, B6, B7, B9) and wildtype bahiagrass (WT) and St. Augustinegra ss (SA). (A) Visual ratings for drought tolerance in April 2009. (B) Dr y weight of clipping under mo derate and non-irrigated regimes in April 2009. Capital letters at the bottom of each graph indicate significant difference between lines at = 0.05. Lowercase letters above bars indicate significant difference between irrigation treatment within each line at = 0.05. Error bars indicate standard error of the means. A B 0.7 0.72 0.74 0.76 0.78 0.8 0.82 0.84 B10B3B7B8SAWTFv/FmMaximum Quantum Yield of Dark-Adapted Leaves in May 2008 Full Moderate Noa aa A A A A A A C AB A AB BC AB A A A A A A a a a a a a a a a a a a a a a 0.7 0.72 0.74 0.76 0.78 0.8 0.82 0.84 0.86 B10B3B7B8SAWTFv/FmMaximum Quantum Yield of Dark-Adapted Leaves in June 2008 Full Moderate NoA A A B B A AB A A A B A A A A A A A a a a a a a a a a a a a a a a a a a Figure 4-17. Maximum quantum yield of dark-adapted leaves of transgenic lines (B10, B3, B7, B8), St. Augustinegrass (S) and wild-type bahiagrass (WT). (A) During drought in May 2008 (B) In June 2008, during recovery from drought. Capital letters at the bottom of each graph indicate significant difference between lines at = 0.05. Lowercase letters above bars indicate significant difference between irrigation treatment within each line at = 0.05 Error bars indicate standard error of the means. 82

PAGE 83

A Figure 4-18. SPAD meter readings of transgen ic lines (B10, B3, B7, B8), St. Augustinegrass (SA) and wild-type bahiagra ss. (WT). (A) During drought in May 2008 (B). In June 2008, during recovery from drought. Capital letters at the bottom of each graph indicate significant difference between lines at = 0.05. Lowercase letters above bars indicate significant difference between irrigation treatment within each line at = 0.05. Error bars indicate standard error of the means. 0 10 20 30 40 50 60 B10B3B7B8SPAD unitsSPAD Meter Readings in MaySAWT 2008 Full Moderate NoA C C BC A B B B A B B B b b a b b a b b a b b a bba D B C B B C b b a B 0 10 20 30 40 50 60 B10B3B7B8SAWTSPAD unitsSPAD Meter Readings in June 2008 Full Moderate NoAB B B B B C A BC C BC D BC A BC BC C D AB b b a ab b a b b a b b a b b a b b a 83

PAGE 84

0 10 20 30 40 50 B10B3B7B8SAWTWeight (g)Dry Weight of Rhizomes under Non-irrigated ConditionsA AB A ABC C BC Figure 4-19. Dry weight of rhizomes produced by AtGA2ox1 expressing lines (B11, B3, B6, B7, B9) and wild-type bahiagrass (WT) and St. Augustinegrass (SA) in non-irrigated plots. Capital letters at the bottom of each graph indicate significant difference between lines at = 0.05. Error bars indicate standard error of the means. 0 1 2 3 4 5 6 B10B3B7B8SAWTWeight (g)Dry Weight of Roots under Non-irrigated ConditionsA A A A A A Figure 4-20. Dry weight of roots produced by AtGA2ox1 expressing lines (B11, B3, B6, B7, B9) and wild-type bahiagrass (W T) and St. Augustinegrass (SA) in non-irrigated plots. Capital letters at the bottom of each graph indicate significant difference between lines at = 0.05. Error bars indicate standard error of the means. 84

PAGE 85

0 10 20 30 40 50 60 70Inflorescences17-Jul30-Jul14-Aug30-Aug9-OctNumber of Inflorescences Produced per Field Plot over Time in 2007 B10 B3 B7 B8 WT b c c c a c d d b a c c c b a c d d b a a c ccb 0 5 10 15 20 25 30 1-May 8-May 2-JunInflorescencesNumber of Inflorescences Produced per plot over Time in 2009 B10 B3 B7 B8 WT c d d b a b b b b a b b b b a 0 20 40 60 80 100 120 140 160 5-May18-Jun25-Jul29-Aug30-SepInflorescencesNumber of Inflorescences Produced per plot over Time in 2008 B10 B3 B7 B8 WT b d d c a a d c b a a d d b a b d d c a a c c c b A B C Figure 4-21. Inflorescences produced by AtGA2ox1 expressing lines (B11, B3, B6, B7, B9) and wild-type bahiagrass (WT) over time in (A) 2007, (B) 2008 and (C) 2009. Lowercase letters at the bottom of each graph indicate significant difference between lines within each time entry at = 0.05. Error bars indicate standard error of the means. 85

PAGE 86

0 40 80 120 160 B10B3B7B8WTInflorescencesTotal Number of Inflorescences per Field Plot in 2007A 17-Jul 30-Jul 14-Aug 30-Aug 9-Oct B D D C A 0 100 200 300 400 B10B3B7B8WTInflorescencesTotal Number of Inflorescences per Field Plot in 2008B 5-May 18-Jun 25-Jul 29-Aug 30-Sep B D D C A 0 10 20 30 40 B10B3B7B8WTInflorescencesTotal Number of Inflorescences per Field Plot in 2009C 1-May 8-May 2-Jun B C C B A Figure 4-22. Total inflorescences produced by AtGA2ox1 expressing lines (B11, B3, B6, B7, B9) and wild-type bahiagrass (WT) in (A) 2007, 2008 (B), and (C) 2009. Lowercase letters at the bottom of each graph indicate significant difference between lines at within each time entry = 0.05. Error bars indicate standard error of the means. 86

PAGE 87

0 10 20 30 40 50 B10B3B7B8WTLength (cm)Average Length of Inflorescence Stems per Field PlotC C B B A Figure 4-23. Average length of inflorescence stem s without racemes per field plot produced by AtGA2ox1 expressing lines (B11, B3, B6, B7, B9 ) and wild-type bahiagrass (WT). Capital letters at the bottom of each graph indicate significant difference between lines at = 0.05. Error bars indicate standard error of the means. M B3 B7 B8 B10 WT NC PC 500b p Figure 4-24. RT-PCR analysis for expression of the AtGA2ox1 gene using specific primers for amplification of cDNA from transgenic lines (B11, B3, B6, B7, B9) [516 bp] compared to WT and plasmid UbiGAox1 [652 bp]. 87

PAGE 88

A 0 10 20 30 40 50 I10I32 I4 WTLength (cm)Tiller LengthA B B AD 0 20 40 60 I10I32 I4 WTTillersNumber of Tillers per 100 cm2of Field Plots Eight Weeks after TransplantingA AB B B Figure 4-25. Phenotypic differences observed between ATHB16 expressing lines (I4, I10, I32) and wild-type bahiagrass (WT). (A) Number of till ers produced by in a 100 cm2 area following eight weeks of growth after tran splanting. (B) Number of tillers produced in a 100 cm2 area following twelve weeks of growth after transplanting (C) Comparison between transgenic line I10 and wild-type bahiagrass (WT) (D) Length of the tiller measured from the crown to the tip of the leaf. (E) Leaf width. (F) Comparison between transgenic line I32 and wild-type bahiagrass (WT ). Capital letters at the bottom of each graph indicate significant difference between lines at = 0.05. Error bars indicate standard error of the means.Figure 4-25. Phenotypic differences observed between ATHB16 expressing lines (I4, I10, I32) and wild-type bahiagrass (WT). (A) Number of till ers produced by in a 100 cm2 area following eight weeks of growth after tran splanting. (B) Number of tillers produced in a 100 cm2 area following twelve weeks of growth after transplanting (C) Comparison between transgenic line I10 and wild-type bahiagrass (WT) (D) Length of the tiller measured from the crown to the tip of the leaf. (E) Leaf width. (F) Comparison between transgenic line I32 and wild-type bahiagrass (WT ). Capital letters at the bottom of each graph indicate significant difference between lines at = 0.05. Error bars indicate standard error of the means. C B F E 0 10 20 30 40 50 I10I32 I4 WTTillersNumber of Tillers per 100 cm2of Field Plots Twelve Weeks after TransplantingA B B B 0.0 0.2 0.4 0.6 0.8 1.0 I10I32 I4 WTWidth (cm)Leaf WidthA B B AWT WT I10 I32 88

PAGE 89

A I10 WT SA B 1 3 5 7 9 I10I32I4SAWTEstablishmentVisual Ratings for Establishment of Field Plots Four Weeks after EstablishmentA B BC D C Figure 4-26. Field establishment of ATHB16 expressing bahiagrass lines (I4, I10, I32) and wildtype bahiagrass (WT) and St. Augustineg rass (SA). (A) Visual ratings for establishment of field plots four weeks af ter transplanting (B) Comparison line I10 and wild-type bahiagrass (WT) and St. Augustinegrass (SA) 4 weeks after establishment of field plots. Capital letters at the bottom of the graph indicates significant difference between lines at = 0.05. Error bars indicate standard error of the means. 0 1 2 3 4 5 6 7 I10I32I4SAWTWeight (g)Dry Weight of Clippings per Field Plot Four Weeks after TransplantingA BC C C B Figure 4-27. Dry weight of clippings produced under week ly mowing four weeks after establishment by ATHB16 expressing lines (I0, I32, I4 ) and wild-type bahiagrass (WT) and St. Augustinegrass (SA). Capital letters at the bottom of the graph indicate significant difference between lines at = 0.05. Error bars indicate standard error of the means. 89

PAGE 90

A 1 2 3 4 5 6 7 8 9 I10I32 I4 WTMowing QualityVisual Ratings for Mowing Quality Eight Weeks after Transplanting A B A C B I10 WT Figure 4-28. Turf mowing quality of ATHB16 expressing lines (I0, I 32, I4) and wild-type bahiagrass (WT). (A) Visual ratings for mowing quality. (B) Freshly mowed transgenic line I10 compared to wild-type bahiagrass (WT) following weekly mowing fourteen weeks after transplanting. Capital letters at the bottom of the graph indicate significant difference between lines at = 0.05 Error bars indicate standard error of the means. 90

PAGE 91

Table 4-2. Emergence of inflorescences of ATHB16 transgenic lines (I10, I32, I4) compared to wild-type bahiagrass (WT). Capital letters below each entry indicate significant difference between lines at each timepoint at = 0.05. Record / Line I10 I32 I4 WT 8th August 2006 Avg. No. of inflorescences per plot 0.67 0.23 0.88 0.23 1.08 0.26 1.46 0.33 B B AB A 29th August 2006 Avg. No. of inflorescences per plot 43.25 7.26 64.13 6.43 34.63 6.48 62.88 3.82 B A B A 0 10 20 30 40 50 I10I32 I4 WTLength (cm)Average Length of Fully Expanded Inflorescence StemsA B C A Figure 4-29. Length of fully expanded in florescence stems (without racemes) of ATHB16 expressing bahiagrass line s (I10, I4, I32) and wild -type bahiagrass (WT). Capital letters at the bottom of the graph indicate significant difference between lines at = 0.05. Error bars indicate standard error of the means. 91

PAGE 92

D 0 10 20 30 I12I23I28I32WTTillersNumber of Tillers per 100 cm2of Field Plots in September 2007 A B A BC C 0 10 20 30 I12I23I28I32WTTillersNumber of Tillers per 100 cm2of Field Plots in May 2008 A B A B B 0 10 20 30 40 I12I23I28I32WTTillersNumber of Tillers per 100 cm2of Field Plots in May 2009 Full Moderate NoA BC A B C A B A BC C A B A B C a ab b a a a a a a a a b a a b B 0 10 20 30 40 I12I23I28I32WTTillersNumber of Tillers per 100 cm2 of Field Plots in May 2008 Full Moderate NoA B A B B A B A B B A B A BC C a a b a a b a a b a a b a a b C E F A 0 10 20 30 I12I23I28I32WTTillersNumber of Tillers per 100 cm2of Field Plots in May 2009 A B A B C 0 10 20 30 I12I23I28I32WTTillersNumber of Tillers per 100 cm2of Field Plots in September 2008 A B A B C Figure 4-30. Number of til lers produced in a 100 cm2 by ATHB16expressing lines (I12, I23, I28, I32) and wild-type bahiagrass (WT) in (A) September 2007, (B) May 2008, (C) September 2008, (D) May 2009, (E) May 2008 by irrigation, (F) May 2009 by irrigation. Capital letters at the bottom of each graph indicate significant difference between lines at = 0.05. Lowercase letters above bars indicate si gnificant difference between irrigation treatments within each line at = 0.05. Error bars indicate standard error of the means. 92

PAGE 93

A B C 1 3 5 7 9DensityI12I23I28I32SAWTVisual Ratings for Density in September 2007A D C E B E 1 3 5 7 9 I12I23I28I32SAWTDensityVisual Ratings for Density in May 2008A B A C B C 0 10 20 30 40 I12I23I28I32WTLength (cm)Tiller LengthD C C B A Figure 4-31. Density of ATHB16 expressing lines (I12, I23, I28, I 32) and wild-type bahiagrass (WT) and St. Augustinegrass (SA) in (A) September 2008, (B) May 2008 and (A) 2009. Capital letters at the bottom of each graph indicate significant difference between lines at = 0.05. Error bars indicate standard error of the means. 93

PAGE 94

A B C 0 10 20 30 40 I12I23I28I32WTLength (cm)Tiller LengthD C C B A 0.0 0.2 0.4 0.6 0.8 1.0 I12I23I28I32WTWidth (cm)Leaf WidthC BC BC B A 1 3 5 7 9 I12I23I28I32SAWTLeaf TextureVisual Ratings for Leaf TextureA C B C E D Figure 4-32. Phenotypic differences observed between ATHB16 expressing lines (I12, I23, I28, I32) and wild-type bahiagrass (WT). (A) Length of the tiller measured from the crown to the tip of the leaf. (B) Leaf wi dth (C) Visual ratings for leaf texture. Capital letters at the bottom of each graph indicate significant difference between lines at = 0.05. Error bars indicate standard error of the means. 94

PAGE 95

Figure 4-33. Comparison of ATHB16 lines (I28, I12) and wild-type (WT). I28 I12 WT 1 3 5 7 9 I12I23I28I32SAWTEstablishmentVisual Ratings for Establishment Four Weeks after EstablishmentA B A B C B A B C I12 I 28 WT 1 3 5 7 9 I12I23I28I32SAWTEstablishmentVisual Ratings for Establishment Twelve Weeks after EstablishmentC AB AB B AB A Figure 4-34. Field establishment of ATHB16 expressing bahiagrass lines (I12, I23, I28, I32) and wild-type bahiagrass (WT) and St. Augus tinegrass (SA). (A) Visual ratings for establishment of field plots four weeks af ter transplanting (B) Visual ratings for establishment of field plots twelve week s after transplanti ng (C) Comparison of ATHB16 expressing lines I12, I28 and wild-t ype bahiagrass (WT) 4 weeks after establishment of field plots. Capital letters at the bottom of the graph indicates significant difference between lines at = 0.05. Error bars indicate standard error of the means. 95

PAGE 96

0 10 20 30 40 50 60 Aug Sept OctWeight (g)Dry Weight of Clippings for 2007 I12 I23 I28 I32 SA WT a c b cd d cda b a bc c bca c b d e cdA 0 5 10 15 20 25 Mar A p rTitleDry Weight of Clippings for 2009 I12 I23 I28 I32 SA WT b b a b b bb b a b b b 0 15 30 45 60 75 90 Mar Apr May Jun Jul Aug Sept OctWeight (g)Dry Weight of Clippings for 2008 I12 I23 I28 I32 SA WT ab b a b b bab b a b c bcc bc ab c d ac b ab b d a b a a a c ac ab a bc d ac ab a bc d cab a a ab b aB C Figure 4-35. Dry weight of clippings produced by ATHB16 expressing lines (I 12, I23, I28, I32) and wild-type bahiagrass (WT) and St Augustinegrass (SA) in (A) 2007, (B) 2008 and (C) 2009. Lowercase letters at the bottom of the graph indicate significant difference between lines within each month at = 0.05. Error bars indicate standard error of the means. 96

PAGE 97

1 3 5 7 9 I12I23I28I32SAWTResistance to Weed EncroachmentVisual Ratings for Resistance to Weed Encroachment in March 2008A AB AB BC A CA B 1 3 5 7 9 I12I23I28I32SAWTResistance to Weed EncroachmentVisual ratingts for Resistance to Weed Encroachment in March 2009 Full Moderate NoBC BC AB B A C A A A A A A A A A A A A b a a b a a a a a b ab a b a a a a a Figure 4-36. Visual ratings for resi stance to weed encroachment of ATHB16 expressing lines and wild-type bahiagrass (WT) and St. Augustinegrass (SA) in March 2008 (A) and March 2009 (B). Capital letters at the bottom of each graph indicate significant difference between lines at = 0.05. Lowercase letters above bars indicate significant difference between irrigation treatment within each line at = 0.05. Error bars indicate standard error of the means. 97

PAGE 98

-10 -5 0 5 10 15 20 25 30OctoberNovemberDecemberJanuaryFebruaryMarchTemperature ( C)Daily Minimum Temperatures Winter 07-08 Winter 08-09 1 3 5 7 9 I12I23I28I32SAWTSpring Green-upVisual Ratings for Spring Green-up in March 2009C C A C A BC 1 3 5 7 9 I12I23I28I32SAWTSpring Green-upVisual Ratings for Spring Green-up in March 2008B B A C C CA B C Figure 4-37. Spring green-up of ATHB16 expressing lines (I12, I23, I28, I32) and wild-type bahiagrass (WT) and St. Augustinegra ss (SA). (A) Minimum temperatures experienced in winter months. (B) Visual ratings for green-up in March 2008 and (C) 2009. Capital letters at the bottom of each graph indicate significant difference between lines at = 0.05. Error bars indicate standard error of the means. 98

PAGE 99

0 5 10 15 20 25 30 1-May 8-May 2-JunInflorescencesNumber of Inflorescences Produced per plot over Time in 2009 I12 I23 I28 I32 WT e b d c a b b b b a b b b b a 0 20 40 60 80 100 120 140 160 5-May18-Jun25-Jul29-Aug30-SepInflorescencesNumber of Inflorescences Produced per plot over Time in 2008 I12 I23 I28 I32 WT d b d c a e c d b a c a b a a c a b a a d b c a a 0 10 20 30 40 50 60 70 17-Jul30-Jul14-Aug30-Aug9-OctInflorescencesNumber of Inflorescences Produced per Field Plot over Time in 2007 I12 I23 I28 I32 WT d c d a b d c d a b d b c a ab e c d b a c b c a a A B C Figure 4-38. Inflorescences produced by ATHB16 expressing lines (I12, I23, I28, I32) and wildtype bahiagrass (WT) over time (A) 2007, (B) 2008 and (C) 2009. Lowercase letters at the bottom of each graph indicate significant difference between lines at within each time entry = 0.05. Error bars indicate standard error of the means. 99

PAGE 100

0 10 20 30 40 I12I23I28I32WTInflorescencesTotal Number of Inflorescences per Field Plot in 2009 1-May 8-May 2-JunC B C B A 0 50 100 150 200 250 300 350 I12I23I28I32WTInflorescencesTotal Number of Inflorescences per Field Plot in 2008 5-May 18-Jun 25-Jul 29-Aug 30-SepD B C B A 0 40 80 120 160 I12I23I28I32WTInflorescencesTotal Number of Inflorescences per Field Plot in 2007 17-Jul 30-Jul 14-Aug 30-Aug 9-OctD B C A AC B A Figure 4-39. Total inflorescences produced by ATHB161 expressing lines (I12, I23, I28, I32) and wild-type bahiagrass (WT) in (A) 2007, (B) 2008 and (C) 2009. Capital letters at the bottom of each graph indicate significant difference between lines within each timepoint at = 0.05. Error bars indicate standard error of the means. 100

PAGE 101

0 10 20 30 40 50 I12I23I28I32WTLength (cm)Average Length of Inflorescence Stems per Field Plot B A A B A Figure 4-40. Average length of inflorescence stems of ATHB16 expressing lines (I12, I23, I28, I32) and wild-type bahiagrass (WT). Capital letters at the bottom of each graph indicate significant difference between lines at within each time entry = 0.05. Error bars indicate standard error of the means. A B 1 3 5 7 9 I12I23I28I32SAWTDrought ToleranceVisual Ratings for Drought Tolerance in April 2008 Moderate NoB AB A BC C AB BC AB A CD D AB a b a b a b a b a b a b 0 10 20 30 40 I12I23I28I32SAWTWeight (g)Dry Weight of Clippings in April 2008 Moderate NoAB BC A BC C BC A A A A A A a a a a a a a a a a a a Figure 4-41. Drought tolerance of ATHB16 expressing lines (I12, I23, I 28, I32) and wild-type bahiagrass (WT) and St. Augustinegrass (SA) in April 2008. (A) Visual ratings for drought tolerance in. (B) Dry weight of clipping under moderate and non-irrigated regimes. Capital letters at the bottom of each graph indicate significant difference between lines at = 0.05. Lowercase letters above bars indicate significant difference between irrigation treatment within each line at = 0.05. Error bars indicate standard error of the means. 101

PAGE 102

A B C I28 WT 1 3 5 7 9 I12I23I28I32SAWTDrought ToleranceVisual Ratings for Drought Tolerance in May 2008 Moderate NoCD B A BC E D A A A A B A a b a b a b a b a b a b 0 10 20 30 40 50 60 I12I23I28I32SAWTWeight (g)Dry Weight of Clippings in May 2008 Moderate NoB B A B C AB A A A A A A a a a a a b a a a a a b Figure 4-42. Drought tolerance of ATHB16 expressing lines (I12, I23, I 28, I32) and wild-type bahiagrass (WT) and St. Augustinegrass (S A) in May 2008. (A) Visual ratings for drought tolerance. B) Dry weight of clipping under moderate and non-irrigated regimes. (C) Comparison of line I28 and wild-type (WT) during the drought in May. Capital letters at the bottom of each graph indicate significant difference between lines at = 0.05. Lowercase letters above bars indicate significant difference between irrigation treatment within each line at = 0.05. Error bars indicate standard error of the means. 102

PAGE 103

A B 1 3 5 7 9 I12I23I28I32SAWTDrought RecoveryVisual Ratings for Drought Recovery in June 2008 Moderate NoC B A AB D C BC B A D E CD a b a b a b a b a b a b 0 15 30 45 60 75 90 I12I23I28I32SAWTWeight (g)Dry Weight of Clippings in June 2008 Moderate NoBC B A B C AB B AB AB AB C A a a a a a b a a a a a a C I28 WT Figure 4-43. Drought recovery of ATHB16 expressing lines (I12, I23, I28, I32) and wild-type bahiagrass (WT) and St. Augustinegrass (SA) in June 2008. (A) Visual ratings for drought recovery. (B) Dry weight of c lipping under moderate and non-irrigated regimes. (C) Comparison of line I28 and w ild-type (WT) and St Augustinegrass (SA) during the drought recovery period in June. Capital letters at the bottom of each graph indicate significant diffe rence between lines at = 0.05. Lowercase letters above bars indicate significant difference between ir rigation treatment wi thin each line at = 0.05. Error bars indicate standard error of the means. 103

PAGE 104

A B 1 3 5 7 9 I12I23I28I32SAWTDrought ToleranceVisual Ratings for Drought Tolerance in April 2009 Moderate NoC A A AB D BC C A B B D B a b a a a b a b a a a a 0 1 2 3 4 5 6 7 I12I23I28I32SAWTWeight (g)Dry Weight of Clippings in April 2009 Moderate NoB B A B B B A A A A A A a a a a a a a a a a a a Figure 4-44. Drought tolerance of ATHB16 expressing lines (I12, I23, I 28, I32) and wild-type bahiagrass (WT) and St. Augustinegrass (S A) in May 2009 (A) Visual ratings for drought tolerance. (B) Dry weight of clipping under moderate and non-irrigated regimes. (C) Comparison of line I28 and w ild-type (WT) and St Augustinegrass (SA) during the drought in May. Capital letters at the botto m of each graph indicate significant difference between lines at = 0.05. Lowercase letters above bars indicate significant differ ence between irrigation treatment within each line at = 0.05 Error bars indicate standard error of the means. 104

PAGE 105

A B 0.7 0.72 0.74 0.76 0.78 0.8 0.82 0.84 I12I23I28I32SAWTFv/FmMaximum Quantum Yield of Dark-Adapted Leaves in May 2008 Full Moderate NoAB B A A AB AB A A A A A A A A A A A A a a a a a a a a a a a a a a a a a a 0.7 0.72 0.74 0.76 0.78 0.8 0.82 0.84 I12I23I28I32SAWTFv/FmMaximum Quantum Yield of Dark-Adapted Leaves in June 2008 Full Moderate NoAB A AB AB B A A A A A A A AB A AB C BC A a a a a a a a a a a a b a a a a a a Figure 4-45. Maximum quantum yield of dark-adapted leaves of transgenic lines (I12, I23, I28, I32), St. Augustinegrass (S) and wild-type bahiagrass (WT). (A) During drought in May 2008 (B) In June 2008, during recovery from drought. Capital letters at the bottom of each graph indicate significant difference between lines at = 0.05. Lowercase letters above bars indicate significant difference between irrigation treatment within each line at = 0.05. Error bars indicate standard error of the means. 105

PAGE 106

A B Figure 4-46. SPAD meter readings of transgen ic lines (I12, I23, I28, I32), St. Augustinegrass (SA) and wild-type bahiagrass. (WT). (A ) During drought in May 2008 (B) In June 2008, during recovery from drought. Capital letters at the bottom of each graph indicate significant difference between lines at = 0.05. Lowercase letters above bars indicate significant difference between irrigation treatment within each line at = 0.05 Error bars indicate standard error of the means. 0 10 20 30 40 50 60 I12I23SPAD unitsSPAD MeI28I32SAWTter Readings in May 2008 Full Moderate NoBC C B AB C AB b b a c BC A D B A A C B BC A D BC b a b ab a b b a b b a b b a 0 10 20 30 40 I12I23I28I32SAWTSPAD unter Readings in June 200850 60itsSPAD Me Full Moderate NoBC BC C A D AB B A AB A C B C AB BC A D BC a b b a b b a b b a b b a b b a c b 106

PAGE 107

0 10 20 30 40 50 I12I23I28I32SAWTWeight (g)Dry Weight of Rhizomes under Non-irrigated ConditionsA AB AB AB C BC Figure 4-47. Dry weight of rhizomes produced by ATHB16 expressing lines (I 12, I23, I28, I32) and wild-type bahiagrass (W T) and St. Augustinegrass (SA) in non-irrigated plots. Capital letters at the bottom of each graph indicate significant difference between lines at = 0.05. Error bars indicate standard error of the means. 0 1 2 3 4 5 6 7 8 I12I23I28I32SAWTWeight (g)Dry Weight of Roots under Non-irrigated ConditionsA AB A A B AB Figure 4-48. Dry weight of roots produced by ATHB161 expressing lines (I12, I23, I28, I32) and wild-type bahiagrass (WT) and St. Augustin egrass (SA) in non-irrigated plots. Capital letters at the bottom of each graph indicate significant difference between lines at = 0.05. Error bars indicate standard error of the means. 107

PAGE 108

108 500b p Figure 4-49. RT-PCR using anal ysis for expression of the ATHB16 gene using specific primers for amplification of cDNA from transgen ic lines (B11, B3, B6, B7, B9) [278 bp] compared to WT and plasmid.

PAGE 109

CHAPTER 5 SUMMARY AND CONCLUSIONS Bahiagrass ( Paspalum notatum Flgge) is a popular forage and turf species in the southeastern US due to its persistence under lowinput conditions. However, the turf quality of bahiagrass is limited due to its open growth hab it and prolific production of long inflorescences. Two transgenic strategies to alter bahiagrass pl ant architecture and improve its turf quality we evaluated. The gibberellin catabolizing enzyme gene ATGA2ox1 was subcloned under control of the constitutive maize ubiquitin promoter and co-transferred to the bahiagrass genome with the nptII selectable marker by biolistic gene transf er (Agharkar et al. 2007). The Arabidopsis ATHB16 transcription factor was subcloned under th e CaMV 35S promoter (Zhang et al., 2007). We recently reported successful improved turf quality in bahiagrass following reduction of bioactive gibberellic acid, by constitutive expression of GA2oxidase1 ( AtGA2ox1) or ATHB16 from Arabidopsis. The goal of this study was to comparatively evaluate the turf quality and performance of transgenic bahi agrass plants overexpressing AtGA2ox1 or ATHB16 and evaluate stable transgene expressi on under field conditions. In field study I several superior ATGAox1 lines were identified. ATGAox1 expressing lines produced significantly more tillers than wild-type bahiagrass. Specifically lines B3 and B9 consistently produced the most tillers and hence displayed the greatest density. The increased number of tillers resulted in a faster establishment for ATGAox1 lines. Increased tillering was also associated with a more upright growth and less visible rhizomes. Higher density, more tillers, faster establishment and upright growth resulted in grea ter production of clippings when mowing the plants. Transgenic ATGAox1 plants also showed reduced flowering. Specifically this was significant for lines B3, B7 and B9. Inflorescence stem lengt h was also reduced significantly in lines B11, B3, B6 and B7. Lines B3 and B9 were the most similar ATGAox1 lines in this 109

PAGE 110

study. Based on the results of this study, lines B3 and B9 having improved density and fewer inflorescences, display an overall impr oved turf quality to the wild-type In field study II, two superior ATGAox1 lines, in addition to B3 were identified. ATGAox1 expressing lines B10, B3, B7 and B8 produced significantly more tillers than wild-type bahiagrass. Furthermore, lines B3 and B7, in Fiel d Study I, consistently pr oduced the most tillers and hence displayed the greatest density. The incr eased number of tillers resulted in a faster establishment for ATGAox1 lines B3, B7 and B8. Line B7 displayed improved Spring green-up associated with higher clipping production early in the growth season. In terestingly, line B3, B7 and B8 also displayed higher cli pping production at the end of th e growing season. Line B7 also displayed improved drought tolerance and recovery. Transgenic ATGAox1 plants also showed reduced flowering. Specifically th is was significant for lines B 3, B7 and B8. Inflorescence stem length was also reduced significan tly in lines B10, B3, B7 and B8. Lines B3 and B8 were the most similar ATGAox1 lines in this study. Based on the result s of this study, these lines display an overall improved turf quality to the wild-type. In addition line B7 displays improved drought tolerance. Showing the best turf quality and the mo st consistent results, lines B3 and B7 would be a better choice for turf than the commercially available cultivars. Data on the AtGA2ox1 transgenics suggest that GAs aff ect flowering, outgrowth of axillary buds and apical dominance in bahiagrass. Reduc ed levels of GAs may also contribute to improved drought stress response in bahiagrass. For ATHB16 lines, a superior line was identified in field study I. Line I10 produced significantly more tillers than wild-type bahiagra ss thus displaying grea ter density. As observed with the AtGA2ox1 lines, this increased tillering was asso ciated with a more upright growth, faster establishment and greater clipping production Transgenic ATHB161 line I10 also showed 110

PAGE 111

reduced flowering. Although all lines displayed some improved char acteristics, line I10 showed the most comprehensive positive results with the most improved overall turf quality. In field study II, several ATHB16 lines display improved turf characteristics. Lines I12 and I28 consistently produced more tillers than wild-type bahiag rass, thus displaying the greatest density. The increased number of tillers resulted in a faster establishment for line I28. Increased tillering, faster establishment and upright growth re sulted in line I28 consistently producing the most clippings. Both lines also displayed a proportional dwarfing with shorter tillers and narrower leaves than the wild-type. Line I12 displays more dwarfing than I28. This and the difference in establishment explains the differe nce in clipping producti on between this lines. Line I28 also displayed higher clipping production during the onset of a drought period as well as better recovery from drought. Transgenic ATHB16 plants also showed reduced flowering. Lines I12 and I28 consistently produced fewer inflorescences than the wild-type. Inflorescence stem length was also reduced significantly in li ne I12. Based on the results of this study, these lines display an overall improved turf quality to the wild-type. However, line I28 displays better establishment and field performance. Showing the best turf quality, the mo st consistent results, and best field performance line I28 would be a better choice for turf than the commercially available cultivars. The data presented on the ATHB16 lines, indicate that over-expression of this transcription factor in bahiagrass significan tly changes plant architecture and performance of this species. These findings are consistent with the proposed function of ATHB16 as suppressor of cell expansion. Introduction of ATHB16 and AtGA2ox1 genes altered bahiagrass plant architecture and field performance, hence improving its turf qua lity. Moreover, the phenotypes observed in the 111

PAGE 112

transgenic lines could also proof beneficial for forage since total biomass production does not seem to be negatively impacted and even impr oved significantly in some of the transgenic bahiagrass plants. Late-season increased biom ass production, as observed in some of our AtGA2ox1 lines would be of great be nefit to the forage industry. Production of denser, faster tillering plants with more leaf tissue and fewer stems and gaps as observed in our transgenic plants can be desirable for forage plants Reduction in flowering can also be of benefit for forage since floral stems contain low digestible co mpounds such as lignin and cell wall compounds cross-linked with lignin accumulation, which reduce the palatability and th erefore fodder quality of the grass. Digestibility, palata bility, protein and productivity w ould have to be analyzed using field grown transgenic bahiagrass to further explore this potential. The mechanisms behind the transgene induced changes observed in our AtGA2ox1 and ATHB16 plants could be explored furt her in transgenic bahiagrass with a global gene expression profiling. Quantitative expression an alysis and further exploring integration sites could also be interesting. To confirm that th e phenotypes observed are a result of our transgenes chemical mutation targeting these proteins coul d be performed. In the case of the AtGA2ox1 lines exogenous application of GA could reverse the phenotype and confirm its nature. Findings in this study confirm th e great potential of transgenic technology for breeding of bahiagrass. However, the labor a nd expenses involved in the de-regulation of transgenic crops currently impedes the release of these plants for commercial purposes. Hybridization of transgenic crops with wild relatives is a public and environmental concern. And with the reported data by Sandhu (2007) we know that the apomictic nature of Argentine is not an absolute barrier against this phenomenon. Another option that can prove useful in improving the time and efficiency in breeding bahiagrass is mutation breeding. Random mutagenesis is 112

PAGE 113

113 currently being evaluated in our laboratory for ap plication in bahiagrass breeding for forage and turf. Various interesting phenotypes have already been identif ied. (unpublished). PCR based screening can aid in id entifying point mutations in key genes including those involved in gibberellin metabolism, cell expans ion, stress response, etc. in th e aims of improving turf and/or forage quality of this species. This technique would not require all the de-regulation involved in the release of genetically modified crops for commercial purposes.

PAGE 114

APPENDIX A PROTOCOLS USED FOR FIELD EVALUATION OF TRANSGENIC BAHIAGRASS Measuring Maximum Quantum Yield of Dark-Adapted Leaves with PAM 2100 (PAM 2100, Heinz Walz GmbH, Germany) Taking Measurements 1. Charge PAM prior to taking measurements. 2. Connect necessary cables to PAM: a. Fiber Optics b. Leaf clip 3. Turn on PAM-2000. A green light will flash regularly when on. 4. Insert the fiber optic cable into the leaf clip. 5. Press COM key. 6. Use arrow keys to place cursor over M ode Selection press RTRN key. 7. Place cursor over Saturation Pulse Mode and select using the RTRN key. 8. Now on the main screen, the one with the boxes use the arrow up or arrow down keys and move cursor over to the box labeled Run on the right of the screen. The box where the cursor is will be indicated by a da shed line instead of a solid line. 9. Select run 2 by either pre ssing the <-> or <+> buttons. 10. Open leaf clip and care fully place leaf inside. 11. Press red button on side of the clip to take measurement. 12. Measurements will be saved in the order taken. Exiting Program and Turning Off 1. Press COM key. 2. Move cursor over Quit Program and press RTRN key. 3. Pam will shut down. Transferring Data to the Computer 1. Press COM key. 2. Use arrow keys to place cursor over M ode Selection press RTRN key. 3. Place cursor over Continuous Mode a nd select using the RTRN key 4. From the Main Menu, choose Data with cursor and press RTRN key. 5. Select Transfer Files and press RTRN key. This will prompt the message data ready. 6. Connect Pam to RS-232 cable, already connected to the computer. 7. Open PamWin 2100 program on the computer and select Com 1 and press Enter key. 8. Data will be downloaded. 114

PAGE 115

APPENDIX B LABORATORY PROTOCOLS FOR EVALUATION OF STABLE TRANSGENE EXPRESSION OF TRANSGENIC BAHIAGRASS VEGETATIVE PROGENY UNDER FIELD CONDITIONS Purification of Total RNA using the RNe asy Plant Mini Kit from Qiagen 1. Harvest 100 mg of tissue from young leav es and freeze immediately using liquid nitrogen. Store tissue in -80C if not going to be used immediately. 2. Add 10l -mercaptoethanol per 1 ml Buffer RLT. 3. Add 44 ml of 100% ethanol to the RPE buffer concentrate to obtain a working solution. 4. Place tissue in liquid nitrogen and grind into fine powder with a previously autoclaved mortar and pestle. 5. Decant ground sample to a sterile, RNase-free 2 ml microcentrifuge tube previously cooled with liquid nitrogen. 6. Add 450 l Buffer RLT (with the -ME) to the tube and vortex vigorously. 7. Pipette the lysate onto a QIAs hredder spin column (lilac) plac ed in a 2 ml collection tube and centrifuge for 2 min at full speed in a bench-top centrifuge. 8. Transfer the supernatant of the flow-through to a new ster ile microcentrifuge without disturbing the pellet. 9. Estimate the approximate volume of the supernatant and add 0.5 volume 100% ethanol to the collected supernatant and mix immediately by pipetting. 10. Transfer entire sample, including any precip itate formed, to an RNeasy mini column (pink) placed in a 2 ml collection tube. 11. Close the tube gently and cen trifuge for 15s at 9,300g. Discard the flow-through solution. 12. Perform DNase treatment using the RNas e-Free DNase Set Qiagen (see below). 13. Transfer the RNeasy column to a new 2 ml collection tube. 14. Add 500 l Buffer RPE into the column and cen trifuging for 15 s at 9,300g. Discard the flow-through solution. 15. Add another 500 l of Buffer RPE onto the column and centrifuge for 2 min at 9,300g. Discard the flow-through solution. 16. Place column in a new sterile 1.5 ml co llection tube supplied with the kit. 17. To elute the RNA, pipette 30 l RNase-free water directly onto the RNeasy silica membrane in the center of the column. Close the tube gently and centrifuge for 1 min at 9,300g. 18. Estimate concentration using the Na nodrop spectrophotometer (see below). 19. Store RNA at -80C. 115

PAGE 116

DNase Treatment using the RNase-Free DNase Set from Qiagen 1. Dissolve the solid DNase I (1500 Kunitz units) in 550 l of the provided RNase-free water to prepare the DNase I stock solution. Mi x gently. Store the solution at -20C. for up to 9 months 2. Add 10 l DNase I stock solution to 70 l Buffer RDD for each sample and mix by inverting gently. 3. Add 350 l Buffer RW1 to the column and cen trifuging for 15 s at 9,300g. Discard the flow-through. 4. Pipette the 80 l DNase I-RDD buffer mixture onto the RNeasy silica-gel membrane and incubate at room temperature for 15 min. 5. Add another 350 l Buffer RW1 to column and centrifuge for 15 s at 9,300g. Discard the flow-through. 6. Continue with step 13 of the total RNA isolation protocol. Using the Nanodrop ND-1000 Spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA) 1. Pipette 2 l a drop of water on the upper and lower pedestals and wipe off using a soft laboratory wipe. 2. Pipette 1 l water on the lower pedestal close the sampling arm. 3. Open Nanodrop software on the computer. 4. Select the Blank option on the com puter screen to set the blank. 5. Open the sampling arm and wipe the pedestals using a laboratory wipe. 6. Pipette 1 l sample onto the lower pedestal and close the sampling arm. 7. Initiate the measurement usi ng the computer software. 8. On completion of the measurement, open the sampling arm and wipe the sample from both the upper and lower pedestal s using a laboratory wipe. 9. Repeat from step 5 for subsequent samples. 10. Upon completion of measurements, clean th e pedestals as described in step 1. cDNA Synthesis using the iScript cDNA Synthesis Kit from Bio-Rad 1. Estimate the volume of each sample required to get 1 g RNA using Nanodrop concentrations. 2. Set up the reaction mix as follows: 5x iScript Reaction Mixture 4 l iScript Reverse Transcriptase 1 l Nuclease-free water x l RNA template (1 g RNA) x l Final volume 20 l 3. Use the following cycling conditions: 5 min at 25C 30 min at 42C 5 min at 85C Hold at 4C 4. Store the cDNA at 4C. 5. 116

PAGE 117

117 Basic RT-PCR Set-up using the HotStarTaq DNA Polymerase from Qiagen 1. Prepare a master-mix for all the samp les, including controls, as follows 10x Buffer 2 l 5x Q solution 4 l 50x dNTP mix 0.4 l 10 M Forward primer 1 l 10 M Reverse primer 1 l Sterile ddH2O 9.5 l HotStarTaq 0.1 l (add last) Final volume 18 l 2. Keep master mix on ice until used. 3. Label RT-PCR tubes. 4. Dispense 2 l of cDNA to the samples, 2 l of sterile ddH2O to the negative control and 2 l of plasmid (50 pg/ l) to the positive control tubes. 5. Add 18 l of the master mix into each tube. 6. Spin briefly and start the PCR program. Note: Remember to start the PCR program with 15 min at 95C to activate the HotStarTaq PCR cycling parameters : 95C 15 min 95C 15 min HotStarTaq 95C 30 sec Initial denaturing 58C 30 sec 30 cycles Denaturing 72C 1 min Annealing 72C 10 min Extension Final extension 4 C hold Hold

PAGE 118

LIST OF REFERENCES Achard P, Cheng H, De Grauwe L, Decat J, Sch outteten H, Moritz T, Van Der Straeten D, Peng J, Harberd NP (2006) Integration of plan t responses to environmentally activated phytohormonal signals. Science 331: 91 Achard P, Genschik P (2009) Releasing the br akes of plant growth: how GAs shutdown DELLA proteins. J Exp Bot 4: 1085-1092 Agharkar M (2007) Molecular growth regulation of bahiagrass (Paspalum notatum Flgge). PhD dissertation, University of Fl orida, Gainesville, FL, USA Agharkar M, Lomba P, Altpeter F, Zhang H, Ke nworthy K, Lange T (2007) Stable expression of AtGA2ox1 in a low-input turfgrass (Paspa lum notatum Flgge) reduces bioactive gibberellin levels and improve s turf quality under field condi tions. Plant Biotechnol J 5: 791-801 Aguado-Santacruz GA, Rascon-Cr uz Q, Cabrera-Ponce JL, Ma rtinez-Hernandez A, OlaldePortugal V, Herrera-Estrella L (2002) Transgenic plants of blue grama grass, Bouteloua gracilis (HBK) Lag. ex Steud., from mi croprojectile bombardment of highly chlorophyllous embryogenic cells Theor Appl Genet 104: 763 Altpeter F, Baisakh N, Beachy R, Bock R, Capell T, Christou P, Daniell H, Datta K, Datta S, Dix PJ, Fauquet C, Huang N, Kohli A, Mooribroek H, Nicholson L, Nguyen TH, Nugent G, Raemakers K, Romano A, Somers DA, Stoger E, Taylor N, Visser R. (2005) Particle bombardment and the genetic enhancement of crops: myths and realities. Mol Breed 15: 305 Altpeter F, Fang Y-D, Xu J, Ma XR (2004) Co mparison of transgene ex pression stability after Agrobacterium-mediated or biol istic gene transfer into pere nnial ryegrass. In A Hopkins, ZY Wang, R Mian, M Sledge, R Barker, eds, Molecular Bree ding of Forage and Turf, Kluwer Academic Publishers, Dordrecht, Netherlands, pp 255 Altpeter F, James VA (2005) Genetic transformation of turf-type bahiag rass (Paspalum notatum Flgge) by biolistic gene transfer. Intl Turfgrass Soc Res J 10: 1-5 Altpeter F, Positano M (2005) Efficient plant regeneration from mature seed derived embryogenic callus of turf-type bahiagrass (P aspalum notatum Flgge). Intl Turfgrass Soc Res J 10: 479-484 Appleford NEJ, Wilkinson MD, Ma Q, Evans DJ Stone MC, Pearce SP, Powers SJ, Thomas SG, Jones HD, Phillips AL, Hedden P, Lenton JR (2007) Decreased shoot stature and grain aamylase activity following ectopic expression of a gibberellin 2-oxidase gene in transgenic wheat. J Exp Bot 58: 3213-3226 118

PAGE 119

Barkworth ME, Allen CM, Hall DW (2007) Paspalum. In MW Barkworth, LK Anderton, KM Capels, S Long, MB Piep, eds, Manual of Grasses for North America, Intermountain Herbarium and State University Press, Utah State University, L ogan, Utah, USA, pp 312318 Beard JB (1973) Turfgrass: Science and Cultu re. Prentice-Hall, Englewood Cliffs, NJ, USA Bettany AJE, Dalton SJ, Timms E, Manderyck B, Dhanoa MS, Morris P (2003) Agrobacterium tumefaciens-mediated transformation of Festuca arundinacea (Schreb.) and Lolium multiflorum (Lam). Plant Cell Rep 21: 437 Beveridge CA, Ross JJ, Murfet IC (1996) Branchi ng in pea (action of genes rms3 and rms4). Plant Physiol 110: 859 Bhalla PL, Swoboda I, Singh MB (1999) Antisense -mediated silencing of a gene encoding a major ryegrass pollen allergen. Proc Natl Acad Sci USA 96: 11676 Biemelt S, Tschiersch H, Sonnewald U (2004) Impact of altered gibberellin metabolism on biomass accumulation, lignin biosynthesis, and photosynthesis in transgenic tobacco plants. Plant Physiol 135: 254-265 Blount AR (2004) Forage production in the southern Coastal Plain region. EDIS Publication SSAGR-81 Agronomy Department, Fl orida Cooperative Extension Se rvice, Institute of Food and Agricultural Sciences, University of Florida, Gainesville, FL, USA Blount AR, Quesenberry KH, Mislevy P, Gates RN, Sinclair TR (2001) Bahiagrass and other Paspalum species: An overview of the plant breeding efforts in the southern Coastal Plain. Proc 56th Southern Pasture Forage Crop Improvement Conference, Springsdale, AR, USA April 21-22, 2001 http://www.spfcic.okstate.edu/pro ceedings/2001/breed ers/blount.htm Blount AR, Quesenberry KH, Myer B, Gates RN (2003) The bahiagrass and Paspalum breeding program. In Proceedings of Sod Based Cr opping Systems Conference. North Florida Research and Education Center-Quincy, University of Florida. Feb. 20-21, 2003 http://nfrec.ifas.ufl.edu/files/pdf/programs/sod_rotation/BahiagrassAndPaspalumBreeding. pdf Blue WG, Graetz DA (1977) The effect of split nitrogen applications on nitrogen uptake by Pensacola bahiagrass from an Aeric Haplaquod. Soil Sci Soc Am J 41:927 Blume CJ, Fei S, Christians NE, Stier JC (2008) Field evaluation of reduced-growth, Roundup ready Kentucky bluegrass in competitive stands of turf. Acta Hort (ISHS) 783: 357-369 Booker J, Auldridge M, Wills S, McCarty D, Klee H, Leyser O (2004) MAX3/CCD7 is a carotenoid cleavage dioxygenase required fo r the synthesis of a novel plant signaling molecule. Curr Biol 14: 1232 119

PAGE 120

Borisova T, Carriker RR (2009) Water use in Florida. EDIS Publication FE797 Food and Resource Economics Department, Florida Coopera tive Extension Service, Institute of Food and Agricultural Sciences, University of Florida, Gainesville, FL, USA Brandle JE, McHugh SG, James L, Labb H, Miki BL (1995) Instability of transgene expression in field grown tobacco carrying the csr1-1 gene for sulfonylurea herbicide resistance. Biotechnology 13: 994 Breshears DD, Cobb NS, Rich PM, Price KP, Allen CD, Balice RG, Romme WH, Kastens JH, Floyd ML, Belnap J, Anderson JJ, Myers OB, Meyer CW (2005) Regional vegetation dieoff in response to global-change-type drought. Proc Natl Acad Sci 102: 15144 Brian PW, Hemming HG (1955) The effect of gi bberellic acid on shoot growth of pea seedling. Physiol Plant 8: 669-681 Broun P (2004) Transcription factors as tools for metabolic engineering in plants. Curr Opin Plant Biol 7: 202-209 Burson BL (1987) Pollen germination, pollen tube growth and fertiliza tion following self and interspecific pollination of Pa spalum species. Euphytica 36: 64 Burson BL, Bennett HW (1971) Chromosome num ber, microsporogenesis, and mode of reproduction of seven Paspalum species. Crop Sci 11: 292-294 Burson BL, Watson VH (1995) Bahiagrass,dallisgr ass, and other Paspalum species. In RF Barnes, eds, Forages: An introdu ction to grasslan d agriculture, 5th edn, Iowa State Univ Press, Ames, IA, pp 431-440 Burson BL, Young BA (2000) Breeding and improvement of tropical grasses. In A SotomayorRos, WD Pitman, eds, Tropical Forage Plan ts: Development and Use, CRC Press, Inc., Boca Raton, FL, USA pp 59-80 Burton GW (1946) Bahiagrass type s. J Am Soc Agron 38: 273-281 Burton G W (1948) The method of reproduction in co mmon bahiagrass, Paspalum notatum. J Am Soc Agron 40:443 Burton GW, Forbes I Jr (1960) The genetics a nd manipulation of obligate apomixes in Common bahiagrass (Paspalum notatum Flgge). In C Skidmore ed, Proc 8th Intl Grassland Congress, Alden Press, Oxford, England pp 66 Burton GW, Gates RN, Gasho GJ (1997) Response of Pensacola bahiagrass to rates of nitrogen, phosphorus and potassium fertilizers. Soil Crop Sci Soc Florida Proc 56: 3135 Busey (1992) Seedling growth, fe rtilization timing, and establishment of bahiagrass. Crop Sci 32: 1099-1103 120

PAGE 121

Busey P (2003) Bahiagrass. In MD Casler, RR Duncan, eds, Turfgrass Biology, Genetics, and Breeding.Wiley & Sons, Inc., Hoboken, NJ, USA, pp 331-344 Busov VB, Meilan R, Pearce DW, Caiping M, Rood SB, Strauss SH (2003) Activation tagging of a dominant gibberellin catabolism gene ( GA 2-oxidase) from poplar that regulates tree stature. Plant Physiol 132: 1283-1291 Cao Y, Wu Y, Zheng Z, and Song F (2006) Ov erexpression of the rice EREBP-like gene OsBIERF3 enhances disease resistance and salt tolerance in transgenic tobacco. Physiol Mol Plant Pathol 37: 202-211 Chakravarthy S, Tuori RP, DAscenzo MD, Fobe rt PR, Despres C, and Martin GB (2003) The tomato transcription factor Pti4 regulates defense-related gene expression via GCC box and non-GCC box cis elements. Plant Cell 15: 3033-3050 Chai ML, Senthil KK, Kim DH (2004) Transgen ic plants of colonial bentgrass from embryogenic callus via Agrobacterium-mediat ed transformation. Plant Cell Tiss Organ Cult 77: 165 Chambliss CG, Adjei MB (2002) Bahiagrass. EDIS Publication SSR-36 Agronomy Department, Florida Cooperative Extension Service, Inst itute of Food and Agricultural Sciences, University of Florida, Gainesville, FL, USA Chase A (1929) The North American Species of Paspalum. Government Printing Office, Washington, USA Chawla R, Ariza-Nieto M, Wilson AJ, Moore SK, Srivastava V (2006) Transgene expression produced by biolistic-mediated, site-specific gene integration is consistently inherited by the subsequent generations. Plant Biotechnol J 4: 209 Cheng M, Fry JE, Pang S, Zhou H, Hironaka CM, Duncan DR, Conner TW, Wan Y (1997) Genetic transformation of wheat mediated by Agrobacterium tumefaciens. Plant Physiol 115:971-980 Clayton WD, Renvoize SA (1986) Genera Graminum : Grasses of the World. Kew Addit Bull Ser XIII, Her Majesty's Stationery Office, London, England Colassanti J, Coneva V (2009) M echanism of floral induction in grasses: Something borrowed, something new. Plant Physiol 149: 56-62 Dalton SJ, Bettany AJE, Bhat V, Gupta MG, Ba iley K, Timms E, Morris P (2003) Genetic transformation of Dichanthium annulatum (Forssk ): an apomictic trop ical forage grass. Plant Cell Rep 21: 974 Dalton SJ, Bettany AJE, Timms E, Morris P (1999) Co-transformed diploid Lolium perenne (Perenne ryegrass), Lolium multiflorum (It alian ryegrass) and Lolium temulentum (Darnel) plants produced by microprojectile bombardment. Plant Cell Rep 18: 721-726 121

PAGE 122

Denchev PD, Songstad DD, McDaniel JK, Conger BV (1997) Transgenic or chardgrass (Dactylis glomerata) plants by direct embryogenesis fr om microprojectile bombarded leaf cells. Plant Cell Rep 16: 813 De Wilde C, van Houdt H, De Buck S, Angenon G, De Jaeger G, Depicker A (2000) Plants as bioreactors for protein production: avoiding th e problem of transgen e silencing. Plant Mol Biol 43: 347 Dorlhac de Borne F, Vincentz M, Chupeau Y, Vaucheret, H. (1994) Co-suppression of nitrate reductase host genes and transgenes in tr ansgenic tobacco plants. Mol Gen Genet 243: 613 Duncan RR, Carrow RN (2000) Seashore Paspalum : the Environmental Turfgrass. Ann Arbor Press, Chelsea, MI, USA Elkins CB, Haaland RL, Hoveland CS (1977) Grass r oots as a tool for pene trating soil hardpans and increasing crop yields. In Proc. 34th Sout hern Pasture and Forage Crop Improvement Conf., Auburn Univ., Auburn, AL. 12 Ap r. 1977. USDA-ARS, New Orleans, LA, USA, pp 21 Ervin EH, Koski AJ (1998) Growth responses of Lolium perenne L. to trinexapac-ethyl. HortScience 33: 1200 Evans LT (1964) Inflorescence init iation in Lolium temulentum L.V. The role of auxins and gibberellins. Aust J Biol Sci 17: 10 Florida Department of Environmental Protecti on (2002) Florida Water Conservation Initiative. http://www.dep.state.fl. us/water/waterpolicy/doc s/WCI_2002_Final_Report.pdf Fei S, Riordan T, Bishnoi U, Clemente T ( 2005) Regeneration of transgenic buffalograss (Buchloe dactyloides) with glyphosate resi stance using particle bombardment. Intl. Turfgrass Research J 10: 550-554 Gallego-Giraldo L, Garca-Martnez JL, Moritz T, Lpez-Daz I (2007) Flowering in tobacco needs gibberellins but is not prom oted by the levels of active GA1 and GA4 in the apical shoot. Plant Cell Physiol 48: 615 Garcia-Martinez JL, Gil J (2001) Light regulation of gibberellin biosynthesis and mode of action. J Plant Growth Regul 20: 354 -368 Gates RN, Hill GM, Burton GW (1999) Respons e of selected and unselected bahiagrass populations to defoliation. Agron J 91: 787 Gianfagna T (1995) Natural and synthetic growth regulators and their use in horticultural and agronomic crops. In PJ Davies, ed, Plan t Hormones: Physiology, Biochemistry, and Molecular Biology. Kluwer Academic Publis hers, Dordrecht, Netherlands pp 751-773 122

PAGE 123

Gondo T, Matsumoto J, Tsuruta S, Yoshida M, Kawakami A, Terami F, Ebina M, Yamada T, Akashi R (2009) Particle inflow gun-mediated transformation of multiple-shoot clumps in Rhodes grass (Chloris gayana). J Plant Physiol 166: 435-441 Gondo T, Tsuruta SI, Akashi R, Kawamura O, Hoffman F (2005) Green, herbicide resistant plants by particle inflow genmediated gene transfer to diploid bahiagrass (Paspalum notatum). J Plant Physiol 162: 1367-1375 Gould FW (1966) Chromosome numbers of so me Mexican grasses. Can J Bot 44: 1683-1696 Gould FW (1975) The Grasses of Texas. Texas A& M University Press, College Station, Texas, USA Gu YQ, Yang C, Thara VK, Zhou J, and Martin GB (2000) Pti4 is induced by ethylene and salicylic acid, and its product is phosphorylated by the Pto kinase. Plant Cell 12: 771-786 Ha CD, Lemaux PG, Cho MJ (2001) Stable transfor mation of a recalcitrant Kentucky bluegrass (Poa pratensis L.) cultivar using mature seed -derived highly regenerative tissues. In Vitro Cell Dev Biol Plant 47: 6 Hanna WW, Burton GW (1986) Cytogenetics and breed ing behavior of an apomictic triploid in bahiagrass. J Hered 77: 457-459 Haley MB, Dukes MD, Miller GL (2007) Residentia l irrigation water use in Central Florida. J Irrig Drain Engnrg 133: 427-434 Harberd NP, King KE, Carol P, Cowling RJ, Peng J, Richards DE (1998) Gibberellin: Inhibitor of an inhibitor. Bioessays 20: 1001-1008 Haydu JJ, Satterthwaite LN, Cisar JL (2005) An economic and agronomic profile of Floridas sod industry in 2003. EDIS document FE561, a publication of the Department of Food and Resource Economics, Florida Cooperative Ex tension Service, Institute of Food and Agricultural Sciences, University of Florida, Gainesville, FL, USA Hedden P (2003) Constructing dwarf rice. Nature Biotech. 21: 873-874 Hedden P, Phillips AL (2000) Gibberellin meta bolism: new insights revealed by the genes. Trends Plant Sci 5: 523-530 Henrikson E, Olsson A, Johanneson H, Johansson H, Johannes H, Engstrm P, Sderman E (2005) Homeodomain leucine zipper class I genes in Arabadopsis. Expression patterns and phylogenetic relationships. Plant Physiol 139: 509-518 Hiei Y, Ohta S, Komari T, Ku mashiro T (1994) Efficient transfor mation of rice (Oryza saliva L.) mediated by Agrobacterium and sequence anal ysis of the boundaries of the T-DNA. Plant J 6:271-282 123

PAGE 124

Himmelbach A, Hoffmann T, Leube M, Hohe ner B, Grill E (2002) Homeodomain protein ATHB6 is a target of the protein phosphatase ABI1 and regulates hormone responses in Arabidopsis. Embo J 21: 3029-3038 Hodges AW, Haydu JJ, van Blokland PJ, Bell AP ( 2004) Contribution of th e turfgrass industry to Floridas economy, 1991-92: A value-adde d approach. Food and Resource Economics Department, Institute of Food and Agricultu ral Sciences, University of Florida, Gainesville, FL, USA http://hortbusiness.ifas.uf l.edu/pubs/TURFGRASS.PDF Hu F, Zhang L, Wang X, Ding J, Wu D (2005) Agrobacterium-medi ated transformed transgenic triploid bermudagrass (Cynodon dactylonC. transv aalensis) plants are highly resistant to the glufosinate herbic ide Liberty. Plant Cell Tiss Organ Cult 83: 13 Huang B (2008) Mechanism and strategies for improving drought resistance in turfgrass. Acta Hort (ISHS) 783: 221-228 Impithuksa V, Blue WG (1978) The fate of fertili zer nitrogen applied to Pensicola bahiagrass on sandy soils as indicated by nitrogen -15. Proc Soil Crop Sci Soc Fla 37:213 Ishida Y, Saito H, Ohta S, Hiei Y, Ko mari T, Kumashiro T (1996) High efficiency transformation of maize (Zea mays L.) mediat ed by Agrobacterium tumefaciens. Nature Biotechnol 14:745-750 Ishikawa S, Maekawa M, Arite T, Onishi K, Ta kamure I, Kyozuka J (2005) Suppression of tiller bud activity in tillering dwarf mutants of rice. Plant Cell Physiol 46: 79 Iwata N, Takamure I, Wu HK, Siddinq EA, Rutger JN (1995) List of genes for various traits (with chromosome and mainliterature). Rice Genet News 12: 61 Jaglo-Ottosen KR, Gilmour SJ, Zarka DG, Sc habenberger O, and Thomashow MF (1998) Arabidopsis CBF1 overexpression induces COR genes and enhances freezing tolerance. Science 29:104 James C (2003) Preview: Global Status of Commercialized Transgenic Crops: 2003. ISAAA Briefs No. 30. ISAAA, Ithaca, NY, USA James VA, Neibaur I, Altpeter F (2008) Stress inducible expression of DREB1A transcription factor from xeric, Hordeum spontaneum L. in turf and fo rage grass (Paspalum notatum Flgge) enhances abiotic stress tole rance. Transgenic Res 17: 93-104 Janick J, Schery RW, Woods FW, Ruttan VW (1 969a) Food crops: cereals, legumes, forages. In Plant Science: An Introduction to World Crops, WH Freeman and Company, San Francisco, CA, USA Janick J, Schery RW, Woods FW, Ruttan VW (1 969b) Crop improvement. In Plant Science: An Introduction to World Crops, WH Freeman and Company, San Francisco, CA, USA 124

PAGE 125

Jarret RL, Liu ZW, Webster RW (1998) Genetic diversity among Paspalum spp. as determined by RFLPs. Euphytica 104:119-125 Johnston GFS, Jeffcoat B (1977) Effects of some growth regulators on tiller bud elongation in cereals. New Phytol 79: 239-245 Kasuga M, Liu Q, Miura S, Yamaguchi-Shinozaki K, and Shinozaki K (1999) A combination of the Arabidopsis DREB1A gene and stress-inducible rd29A promot er improved droughtand low-temperature stress tolerance in tobacc o by gene transfer. Nat Biotechnol 17: 287 291 Katsvairo TW, Wright DL, Marois JJ, Hartzog D, Wiatrak PJ, Rich JR (2006) Sod/livestockbased peanut/cotton producti on system: Why we recommend it! EDIS Publication SSAGR-126 Agronomy Department, Florida Coopera tive Extension Service, Institute of Food and Agricultural Sciences, University of Florida, Gainesville, FL, USA Kenworthy KE, Nagata RT, Scully BT, Busey P, Dudeck AE (2007). History of turfgrass breeding at the University of Florida. Florida Turf Digest 24:10-14 King RW, Evans LT (2003) Gibberellins and flower ing of grasses and cereals: prizing open the lid of the florigen black box. Annu Rev Plant Biol 54: 3078 King RW, Evans LT, Martin J, Anderson CH, Bl undell C, Kardailsky I, Chandler PM (2006) Regulation of flowering in th e long day grass Lolium temule ntum by gibberellins and the FLOWERING LOCUS T gene. Plant Physiol 141: 498-507 King RW, Mander LN, Asp T, MacMillan CP, Blundell CA, Evans LT (2008) Selective deactivation of gibberellins below the shoot apex is critical to flowering but not to stem elongation of Lolium. Mol Plant 1: 295 King RW, Moritz T, Evans LT, Junttila O, Her lt AJ (2001) Long day induction of flowering in Lolium temulentum involves sequential increases in specific gibberellin s at the shoot apex. Plant Physiol 127: 624 Knight WE, Bennett HW (1953) Prel iminary report of the effect of photoperiod and temperature on the flowering and growth of several southern grasses. Agron J 45: 268-269 Kohli A, Gahakwa D,Vain P,Laurie D, Chri stou P (1999) Transgene expression in rice engineered through particle bombardment: mol ecular factors controlling stable expression and transgene silenc ing. Planta 208: 88 Kohli A, Twyman RM, Abranches R, Wegel E, Stoger E, Christou P (2003) Transgene integration, organization and interaction in plants. Plant Mo l. Biol 52: 247 Kononov ME, Bassuner B, Gelvin SB (1997) Integration of T-DNA binary vector backbone sequences into the tobacco genome: evidence for multiple complex pa tterns of integration. Plant J 11: 945 125

PAGE 126

Koornneef M, van der Veen JH (1980) Induction a nd analysis of gibberellin sensitive mutants in Arabidopsis thaliana (L). He ynh Theor Appl Genet 58: 257 Kourmpetli S, Bhattacharya A, Davey MR, Po wer JB, Hedden P, Phillips AL (2009) Genetic control of stature in ornamental species. Acta Hort (ISHS) 817: 135-142 Kretschmer AE, Hood NC (1999) Paspalum notatum in Florida, USA. In DT Fairey, DS Loch, JE Ferguson, JG Hampton, eds, Forage seed pr oduction: tropical and subtropical species. CABI Publishing, Cambridge, MA, USA Kretschmer AE, Kalmbacher RS, Wilson TC (1994) Preliminary evaluation of Paspalum atratum Swallen (atra paspalum): a high quality, seed-producing perennial forage grass for Florida. Poc Soil Crop Sci Soc of Florida 53: 60-63 Kretschmer AE, Pitman WD (2000) Germplasm re sources of tropical forage grasses. In A Sotomayor-Ros, WD Pitman, eds, Tropical forage plants: development and use, CRC Press, Inc., Boca Raton, FL, USA pp 27-40 Landry G (2000) Turfgrass water management. CAES Publications, College of Agricultural and Environmental Sciences, The Univer sity of Georgia, Tifton, GA, USA http://pubs.caes.uga.edu/caespubs/pubs/PDF/L399.pdf Lechtenberg B, Schubert D, Forsbach A, Gils M, Schmidt R (2003) Neither inverted repeat TDNA configurations nor arrangements of tande mly repeated transgenes are sufficient to trigger transgene silencing. The Plant J 34: 507 Lee DJ, Zeevaart JAD (2005). Molecular cloning of GA 2-oxidase3 from spinach and its ectopic expression in Nicotiana sylv estris. Plant Physiol 138: 243 Lester DC, Carter OJ, Kelleher FM, Laing DR (1972) The effect of gibberellic acid on apparent photosynthesis and dark respiration of simu lated swards of Pennisetum clandestinum Hochst. Aust J Agric Res 23: 205-213 Li X, Qian Q, Fu Z, Wang Y, Xiong G, Zeng D, Wang X, Liu X, Teng S, Hiroshi F, Yuan M, Luo D, Han B, Li J (2003) Control of tillering in rice. Nature 422: 618 Liu Q, Kasuga M, Sakuma Y, Abe H, Miura S, Yamaguchi-Shinozaki K, and Shinozaki K (1998) Two transcription factors, DREB1 and DREB2, with an EREBP/ AP2 DNA binding domain separate two ce llular signal transd uction pathways in droughtand lowtemperature-responsive gene expression, resp ectively, in Arabidops is. Plant Cell 10:1391 1406 Luciani G, Altpeter F, Chang JY, Zhang H, Gallo M, Meagher RL, Wofford D (2007) Expression of cry1Fa in bahiagrass enhances resistance to fall armyworm. Crop Sci 47: 2430-2436 126

PAGE 127

MacMillan CP, Blundell CA, King RW (2005). Flowering of the grass Lolium perenne L.: effects of vernalization and long days on gibberellin biosynthesis and signalling. Plant Physiol 138: 1794 Magome H, Yamaguchi S, Hanada A, Kamiya Y, Oda K. (2004) dwarf and delayed-flowering 1, a novel Arabidopsis mutant deficient in gibb erellin biosynthesis because of overexpression of a putative AP2 transcription factor. The Plant J 37: 720 Magome H, Yamaguchi S, Hanada A, Kamiya Y, Oda K. (2008) DDF1 transcriptional activator upregulates expression of a gibberellin deactivating gene, GA2ox7, under high-salinity stress in Arabidopsis. The Plant J 56: 613 Maqbool SB, Christou P (1999) Multipl e traits of agronomic importan ce in transgenic indica rice plants: analysis of transgene integration pa tterns, expression levels and stability. Mol Breeding 5: 471-480 Marousky FJ, Blandon F (1995) Re d and far-red light influence carbon partitioning, growth and flowering of bahiagrass (Paspalum notatum) J Agric Sci 125: 355-359 Martin DN, Proebsting WM, Hedden P (1999) The SLENDER gene of pea encodes a gibberellin 2-oxidase. Plant Physiol 121: 775-781 Martnez EJ, Urbani MH, Quarin CL, Ortiz JPA (2001) Inheritance of apospory in bahiagrass, Paspalum notatum. Hereditas 135:19 Matzke AJM, Neuhuber F, Park YD, Ambros PF, Matzke MA (1994) Ho mology-dependent gene silencing in transgenic plants: epistatic silenc ing loci contain multiple copies of methylated transgenes. Mol Gen Genet 244: 219 Meng L, Ziv M, Lemaux PG (2006) Nature of st ress and transgene locus influences transgene expression stability in barley. Plant Mol Biol 62: 15-28 Meyer P, Linn F, Heidmann I, Meyer H, Niedenhof I, Saedler H (1992) Endogenous and environmental factors influence 35S promoter me thylation of a maize A1 gene construct in transgenic petunia and its colour phenotype. Mol Gen Genet 231: 345-352 McSteen P (2009) Hormonal regulation of bran ching in grasses. Plant Physiol 149: 46-55 Morris KN, Shearman RC (2006) NTEP Turfgrass Evaluation Guidelines http://www.ntep.org/pdf/ratings.pdf National Turfgrass Federation (2003) Na tional Turfgrass Research Initiative http://www.ntep.org/ pdf/turfiniti ative.pdf 127

PAGE 128

Nordie T (2008) UF releases new bahiagrass cu ltivar with celebration honoring forage pioneer Edwin Hall Finlayson, longtime agriculture supporter Rep. Allen Boyd. IFAS News, Institute of Food and Agricultural Sciences, Univ ersity of Florida, Ga inesville, Florida, USA http://news.ifas.ufl.edu/2008/12/05/uf-re leases-new-bahiagrass-cultivar-withcelebration-honoring-forage-pioneer-edwin-hal l-finlayson-longtime-agriculture-supporterrep-allen-boyd/ Oh SJ, Song SI, Kim YS, Jang HJ, Kim SY, Kim M, Kim YK, Nahm BH, and Kim JK (2005) Arabidopsis CBF3/DREB1A and ABF3 in transg enic rice increased to lerance to abiotic stress without stunting growth. Plant Physiol 138: 341-351 Parodi LR (1937) Contribucion al estudio de las gramineas del genero Paspalum de la flora uruguaya. Revista del Museo de La Plata, NS, Bot 1:211-250 Pawlowski WP, Somers DA (1996) Transgene inheri tance in plants genetically engineered by microprojectile bombardment. Mol Biotechnol 6: 17-30 Pedreira CGS, Brown RH (1996a) Physiology, mo rphology, and growth of individual plants of selected and unselected bahiag rass populations. Crop Sci 36: 138 Pedreira CGS, Brown RH (1996b) Yield of selected and unselected bahiagrass populations at two cutting heights. Crop Sci 36: 134 Pellegrineschi A, Reynolds M, Pacheco M, Br ito RM, Almeraya R, Yamaguchi-Shinozaki K, and Hosington D (2004) Stress-induced expressi on in wheat of the Arabidopsis thaliana DREB1A gene delays water stress symptoms under greenhouse conditions. Genome 47: 493-500 Pharis RP, King RW (1985) Gibberellins and re productive development in seed plants. Annu Rev Plant Phys 36: 517 Phinney BO (1956) Growth responses of single-gene dwarf mutants in maize to gibberellic acid. Proc Nat Acad Sci 42: 185 Pozzobon MT, Machado ACC, Vaio M, Valls JFM, Pealoza APS, Santos S, Cortez AL, Rua GH (2008) Cytogenetic analyses in Paspal um L. reveal new diploid species and accessions. Cienc Rural 38: 1292-1299 Pozzobon MT, Valls JFM (1997) Chromosome numb er in germplasm accessions of Paspalum notatum (Gramineae). Brazilian J Gen 20: 29-34 Quaedvlieg N, Dock J, Rook F, Weisbeek P, Smeekens S (1995) The homeobox gene ATH1 of Arabidopsis is derepressed in the photomorphog enetic mutants cop1 and det1. Plant Cell 7: 117-129 Quarin CL, Espinoza F, Martinez EJ, Pessino SC, Bovo OA (2001) A rise of ploidy leve induces the expression of apomixes in Paspalum notatum. Sex Plant Reprod 13: 243-249 128

PAGE 129

Rademacher W. (1997) Bioregulation in crop plants with inhibitors of gibberellin biosynthesis. In JG Latimer ed, Proceedings Twenty-fourth Plant Growth Regulation Society America Annual Conference, Atlanta, Georgia, August 8-12, 1997, pp 27-31 Radi A, Lange T, Niki T, Koshioka M, Pi menta Lange MJ (2006) Ectopic expression of pumpkin gibberellin oxidases al ters gibberellin biosynthesis an d development of transgenic Arabidopsis plants. Plant Physiol 140: 528 Rather HC (1942) Perennial forage grasses. In LJ Cole, ed, Field Crops, McGraw-Hill Book Company, Inc., New York, NY, USA Richards HA, Rudas VA, Sun H, McDaniel JK, Tomaszewski Z, Conger BV (2001) Construction of a GFP-BAR plasmid and its use for switchgrass transformation. Plant Cell Rep 20: 48 Sakamoto T, Kobayashi M, Itoh H, Tagiri A, Kayano T, Tanaka H, Iwahori S, Matsuoka M (2001) Expression of a gibberellin 2-oxidase ge ne around the shoot apex is related to phase transition in rice. Plant Physiol 125: 1508-1516 Sakamoto T, Morinaka Y, Ishiyama K, Kobaya shi M, Itoh H, Kayano T, Iwahori S, Matsuoka M, Tanaka H (2003) Genetic ma nipulation of gibberellin metabolism in transgenic rice. Nat Biotechnol 21: 909-913 Sampaio EVSB, Beaty ER (1976) Morphology and growth of bahiagrass at three rates of nitrogen. Agron J 68: 377-381 Sandhu S (2008) Generation, characte rization, and risk assessment of transgenic apimictic bahiagrass. PhD disseertation, University of Florida, Gainesville, FL, USA Sandhu S, Altpeter F (2008) Co-integration, co-e xpression and inheritance of unlinked minimal transgene expression cassettes in an apomictic turf and forage gr ass (Paspalum notatum Flgge). Plant Cell Rep 27: 1755-1765 Sandhu S, Altpeter F, Blount AR (2007) Apomictic ba hiagrass expressing the bar gene is highly resistant to glufosinate under fi eld conditions. Crop Sci 47: 1691-1697 Sarkar S, Perras MR, Falk DE, Zhang R, Phar is RP, Austin R (2004) Relationship between gibberellins, height, and stress tolerance in barley (Hordeum vulgare L.) seedlings. Plant Growth Regul 42: 125-135 Saura F (1948) Cariologia de gramineas en Argentina. Rev Fac Agron Vet Buenos Aires 12: 5167 Schomburg FM, Bizzell CM, Lee DJ, Zeevart J AD, Amasino RM (2003) Overexpression of a novel class of gibberellin 2-oxidases decreases gibberellin levels and creates dwarf plants. Plant Cell 15: 151-163 Scott JM (1920) Bahiagrass. J Am Soc Agron 12: 112-113 129

PAGE 130

Sessa G, Morelli G, Rubert i I (1993) The ATHB-1 and -2 HDzip domains homodimerize forming complexes of different DNA binding specificities. EMBO J 12: 3507-3517 Shinozaki K and Yamaguchi-Shinozaki K (2000) Molecular responses to dehydration and low temperature: differences and cross-talk betw een two stress signaling pathways. Curr Opin Plant Biol 3: 217-223 Sinclair TR, Mislevy P, Ray JD (2001) Short photoperiod inhibits winter growth of subtropical grasses. Planta 213: 488 Sinclair TR, Ray JD, Mislevy P, Premazzi, LM (2003) Growth of subtropical forage grasses under extended photoperiod during shortdaylength months. Crop Sci 43: 618 Smith RL, Grando MF, Li YY, Seib JC, Shatte rs RG (2002) Transformation of bahiagrass (Paspalum notatum Flgge). Plant Cell Rep 20: 1017-1021 Sderman E, Hjellstrm,M, Fahleson J, E ngstrm P (1999) The HD-Zip gene ATHB6 in Arabidopsis is expressed in de veloping leaves, roots and carpels and up-regulated by water deficit conditions. Plant Mol Biol 40 : 1073 Somleva MN, Tomaszewski Z, Conger BV (2002) Agrobacterium-mediated genetic transformation of switchgr ass. Crop Sci 42: 2080 Sorefan K, Booker J, Haurogne K, Goussot M, Ba inbridge K, Foo E, Ch atfield S, Ward S, Beveridge C, Rameau C, Leyser O (2 003). MAX4 and RMS1 are orthologous dioxygenase-like genes that regu late shoot branching in Arab idopsis and pea. Genes Dev 17: 1469 Sousa-Chies TT, Essi L, Rua G, Valls JFM, Miz RB (2006) A preliminary approach to the phylogeny of the genus Paspalum (Poaceae). Genetica 126: 15-32 Spangenberg G, Wang Z-Y, Wu XL, Nagel J, Ig lesias VA, Potrykus I (1995a) Transgenic tall fescue ( Festuca arundinacea ) and red fescue ( F. rubra ) plants from microprojectile bombardment of embryogenic suspensi on cells. J Plant Physiol 145: 693-701 Spangenberg G, Wang Z-Y, Wu XL, Nagel J, Po trykus I (1995b) Transgenic perennial ryegrass (Lolium perenne) plants from microprojecti le bombardment of embryogenic suspension cells. Plant Sci 108: 209 Spencer TM, Gordon-Kamm WJ, Daines RJ, Star t WG, Lemaux PG (1990) Bialaphos selection of stable transformants from maize ce ll culture. Theor Appl Genet 79: 625-631 Sun TP, Goodman HM, Ausubel FM (1992). Cloning the Arabidopsis Ga1 locus by genomic subtraction. Plant Cell 4: 119 Tang W, Newton RJ, Weidner (2007 ) Genetic transformation and gene silencing mediated by multiple copies of a transgene in ea stern white pine. J Exp Bot 58: 545-554 130

PAGE 131

Thomas BP, Law L Jr, Stankey DL (1979) Soil Su rvey of Marion County Area, Florida. United States Department ofAgriculture, Soil Conservation Servi ce, Washington, DC. Thomas SG, Phillips AL, Hedden P (1999) Mole cular cloning and functional expression of gibberellin 2-oxidases, multifunctional enzymes involved in gibberellin deactivation. Proc Natl Acad Sci 96: 4698-4703 Tingay S, McElroy D, Kalla R, Fieg S, Wang M, Thornton S, Brettell R (1997) Agrobacterium tumeficiens-mediated barley transformation. Plant J 11:1369-1376 Tischler CR, Burson BL (1991) Evaluating different bahiagrass cyto types for heat tolerance and leaf epicuticular wax co ntent. Euphytica 84: 229-235 Toyama K, Bae C-H, Kang J-G, Lim Y-P, Ad achi T, Rui K-Z, Song P-S, Lee H-Y (2003) Production of herbicide-tolerant zoysiagra ss by Agrobacterium-mediated transformation. Mol Cells 16: 19 Trenholm LE, Cisar JL, Unruh JB (2003) Bahiagra ss for Florida lawns. EDIS Publication ENH6 Environmental Horticulture Department, Flor ida Cooperative Extensi on Service, Institute of Food and Agricultural Sciences, Univer sity of Florida, Gainesville, FL, USA Trenholm LE, Unruh JB (2006) New and not so new lawn grasses for Florida. EDIS Publication ENH1033, Environmental Horticulture Depa rtment, Florida Cooperative Extension Service, Institute of Food and Agricultural Scie nces, University of Fl orida, Gainesville, FL, USA Ubeda-Toms S, Garca-Martnez JL, LpezDaz I (2006) Molecula r, biochemical and physiological characterization of gibberellin biosynthesis and catabolism genes from Nerium oleander. J Plant Growth Regul 25: 52 Unruh JB, Brecke BJ (2006) Plant growth retardants for fine turf and roadsides/utilities. EDIS Publication AGR-17, Environmental Horticu lture Department, Florida Cooperative Extension Service, Institute of Food and Agricultural Sciences, University of Florida, Gainesville, FL, USA USDA Plants Database http://plants.usda.gov/ja va/profile?symbol=PANO2 Valls JFM (1992) Origem do germoplasma de Paspalum disponvel no Brasil para a rea tropical. In EA Pizarro, ed., Re unin Sabanas, Red Internaci onal de Evaluacin de Pastos Tropicales-RIEPT, Cali: CIAT, EMBRAPA-CPAC, Braslia, Brazil van der Valk P, Proveniers MCG, Pertijs JH Lamers JTWH, van Dun CMP, Smeekens JCM (2004) Late heading of perennial ryegrass caused by introducing an Arabidopsis homeobox gene. Plant Breeding 123: 531-535 Vaucheret H, Beclin C, Elmayan T, Feuerbach F, Godon C, Morel JB, Mourrain P, Palauqui JC, Vernhettes S (1998) Transgeneinduced gene silencing in plants. The Plant J16: 651 131

PAGE 132

Vettakkorumakanav NN, Falk D, Saxena P, Fletcher, RA, (1999) A crucial role for gibberellins in stress protection of plants. Plant Cell Physiol 40: 542 Wang Y, Henriksson E, Sdermann E, Henriksson KN, Sundberg E, Engstrm P (2003a) The Arabidopsis homeobox gene, ATHB16, regulates leaf developm ent and the sensitivity to photoperiod in Arabidopsis. Dev Biol 264: 228-239 Wang Z-Y, Bell J, Lehman D ( 2003b) Inheritance od transgenes in transgenic tall fescue (Festuca asundinacea Screb). In Vitr o Cell Dev Biol Plant 39:277-282 Wang Y (2001) The role of the homeobox gene ATHB16 in development regulation in Arabidopsis thaliana. Comprehe nsive Summaries of Uppsala Dissertation from the Faculty of Science and Technology, 618 Uppsala, Acta Universitatis Upsaliensis. Wang Z-Y, Bell J, Lehmann D (2004) Transgenic Russian wildrye (Psa thyrostachys juncea) plants obtained by biolistic transformation of embryogenic suspension cells. Plant Cell Rep 22: 903 Wang Z-Y, Ge YX (2006) Invited review: Recent advances in gene tic transformation of forage and turf grasses. In Vitro Cell Dev Biol 42: 1-18 Wang Z-Y, Takamizo T, Iglesias VA, Osusky M, Nagel J, Portryus I, Spangenberg G (1992) Transgenic plants of tall fescue (Festuca arundinacea Schreb.) obtained by direct gene transfer to protoplast. Biotechnology 10:691 Wang Z-Y, Ye XD, Nagel J, Potrykus I, Spange nberg G (2001) Expression of a sulphur-rich sunflower albumin gene in transgenic tall fescue (Festuca arundinacea Schreb.) plants. Plant Cell Rep 20: 213 Watson L, Dallwitz MJ (1994) The Grass Ge nera of the World. Revised edition. CAB International, Oxon, England Watson VH, Burton BL (1985) Bahiagrass, carpetgrass and dalligrass. In ME Heath, RF Barnes, DS Metcalfe, eds, Forages: The Science of Grassland Agriculture. Iowa State University Press, Ames, IA, USA Werner BK, Burton GW (1991) Changes in mor phology and yield of Pensacola bahiagrass due to recurrent restricted phenotypic se lection for yield. Crop Sci. 31: 48 Wu YY, Chen QJ, Chen M, Chen J, Wang XC (2 005) Salt-tolerant transg enic perennial ryegrass (Lolium perenne L.) obtained by Agrobacteriu m tumefaciens-mediated transformation of the vacuolar Na+/H+ antiporter gene. Plant Sci 169: 65 Yan J, Zhu J, He C, Benmoussa M, Wu P (1998) Molecular dissection of developmental behavior of plant height in rice (O ryza sativa L.). Genetics 150: 1257 132

PAGE 133

133 Ye XD, Wang Z-Y, Wu X, Potrykus I, Spange nberg G (1997) Transgen ic Italian ryegrass (Lolium multiflorum) plants from micr oprojectile bombardm ent of embryogenic suspension cells. Plant Cell Rep 16: 379 Yu TT, Skinner DZ, Liang GH, Trick HN, Hu ang B, Muthukrishnan S (2000) Agrobacteriummediated transformation of creeping bentgras s using GFP as a reporter gene. Hereditas 133: 229 Zhang H, Lomba P, Altpeter F (2007) Improved tu rf quality of transgenic bahiagrass (Paspalum notatum Flgge) constitutively expressing the ATHB16 gene, a repressor of cell expansion. Mol Breeding 20: 415-423 Zhang J (2003) Overexpression analysis of plant tr anscription factors. Curr Opin in Plant Biol 6: 430-440 Zhang GY, Lu S, Chen TA, Funk CR, Meye r WA (2003) Transformation of triploid bermudagrass (Cynodon dactylon x C. transvaalensis cv. TifEagle) by means of biolistic bombardment. Plant Cell Rep 21:860 Zhang J, Cai L, Cheng J, Mao H, Fan X, Meng Z, Chan KM, Zhang H, Qi J, Ji L, Hong Y (2008) Transgene integration and organization co tton (Gossypium hirsutum L.) genome. Transgenic Res 17: 293 Zhang J, Wang Z (2007) Recent advances in mol ecular breeding of forage crops for improved drought and salt stress tolerance. In MA Jenks, PM Hasegawa, SM Jain, eds, Advances in Molecular Breeding Toward Drought and Salt Tolerant Crops, Springer, Dordrecht Netherlands Zhong H, Bolyard MG, Srinivasan C, Strickle n MB (1993) Transgenic plants of turfgrass (Agrostis palustris Huds.) from microproject ile bombardment of embryogenic callus. Plant Cell Rep 13: 1-6 Zou J, Zhang S, Zhang W, Li G, Chen Z, Zhai W, Zhao X, Pan X, Xie Q, Zhu L (2006) The rice HIGH-TILLERING DWARF1 encoding an ortholog of Arabidopsis MAX3 is required for negative regulation of the outgrowth of axillary buds. Plant J 48: 687-696

PAGE 134

BIOGRAPHICAL SKETCH Paula Noem Lomba Otero was born in 1984 in Bayamon, Puerto Rico, to Lilia Otero and Esteban Lomba. She grew up in San Juan, PR where she attended elementary, middle, and high school. She graduated from University of Puerto Rico High School on May 2002. After high school, she received an academic scholarship to a ttend University of Florida in Gainesville, FL from where she received her Bachelor of Sc ience in biology on May 2006. While completing her undergraduate degree, she started wo rking in Dr. Fredy Altpeters Laboratory of Molecular Plant Physiology. Paula began her graduate career in th e Agronomy Department at the University of Florida in August 2006 under the supe rvision of Dr. Fredy Altpeter. 134