<%BANNER%>

An Independent Test of Ratite Polyphyly

Permanent Link: http://ufdc.ufl.edu/UFE0025068/00001

Material Information

Title: An Independent Test of Ratite Polyphyly
Physical Description: 1 online resource (44 p.)
Language: english
Creator: Smith, Jordan
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: convergence, flightlessness, paleognath, primer, ratite, vicariance
Zoology -- Dissertations, Academic -- UF
Genre: Zoology thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Some of the most recognizable of all living birds are the ratites, the giant birds of the southern hemisphere such as the ostrich, the emu, and the rheas. Traditionally, these birds are thought to have evolved from a common, flightless ancestor. Given their current distribution across Africa, Australia, South America, and New Zealand, the biogeography of the flightless ratites has long fascinated researchers. If they are closely related and flightless, how did they reach such wide spread locations? The prevalent hypothesis is that the ancestral ratite rafted across the southern hemisphere when the ancient super-continent Gondwana broke apart leading to species divergence by continental drift. In sharp conflict, this study suggests that the ratites had ancestors that could fly and instead of rafting to their current distribution, a hypothesis that has been a textbook example of speciation by vicariance, they may have been able to disperse by flight.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Jordan Smith.
Thesis: Thesis (M.S.)--University of Florida, 2009.
Local: Adviser: Braun, Edward L.
Local: Co-adviser: Kimball, Rebecca T.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0025068:00001

Permanent Link: http://ufdc.ufl.edu/UFE0025068/00001

Material Information

Title: An Independent Test of Ratite Polyphyly
Physical Description: 1 online resource (44 p.)
Language: english
Creator: Smith, Jordan
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: convergence, flightlessness, paleognath, primer, ratite, vicariance
Zoology -- Dissertations, Academic -- UF
Genre: Zoology thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Some of the most recognizable of all living birds are the ratites, the giant birds of the southern hemisphere such as the ostrich, the emu, and the rheas. Traditionally, these birds are thought to have evolved from a common, flightless ancestor. Given their current distribution across Africa, Australia, South America, and New Zealand, the biogeography of the flightless ratites has long fascinated researchers. If they are closely related and flightless, how did they reach such wide spread locations? The prevalent hypothesis is that the ancestral ratite rafted across the southern hemisphere when the ancient super-continent Gondwana broke apart leading to species divergence by continental drift. In sharp conflict, this study suggests that the ratites had ancestors that could fly and instead of rafting to their current distribution, a hypothesis that has been a textbook example of speciation by vicariance, they may have been able to disperse by flight.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Jordan Smith.
Thesis: Thesis (M.S.)--University of Florida, 2009.
Local: Adviser: Braun, Edward L.
Local: Co-adviser: Kimball, Rebecca T.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0025068:00001


This item has the following downloads:


Full Text

PAGE 1

1 AN INDEPENDENT TEST OF RATITE POLYPHYLY By JORDAN VICTORIA SMITH A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIV ERSITY OF FLORIDA 2009

PAGE 2

2 2009 Jordan V. Smith

PAGE 3

3 To my family and mentors

PAGE 4

4 ACKNOWLEDGMENTS I would like to thank my advisors Drs. Edward L. Braun and Rebecca T. Kimball for their patience and assistance i n helping me with my thesis research. I would also like to thank committee member Dr. David W. Steadman whose guidance helped to broaden the scope of my research. I am grateful for the help and support provided by members of the Kimball Braun lab group a nd friends from the Department of Zoology at the University of Florida. Last of all, I would like to thank my family for their continued encouragement.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS .................................................................................................................... 4 LIST OF TABLES ................................................................................................................................ 6 LIST OF FIGURES .............................................................................................................................. 7 ABSTRACT .......................................................................................................................................... 8 CHAPTER 1 INTRODUCTION ......................................................................................................................... 9 2 METHODS .................................................................................................................................. 16 Taxa .............................................................................................................................................. 16 Locus Development .................................................................................................................... 16 Amplification and Sequencing ................................................................................................... 17 Alignment .................................................................................................................................... 18 Phylogenetic Analyses ................................................................................................................ 18 Locus Characterization ............................................................................................................... 20 3 RESULTS .................................................................................................................................... 24 Concatenated Trees ..................................................................................................................... 24 Individual Gene Trees ................................................................................................................. 24 Gene Tree Species Tree Incongruence ...................................................................................... 25 Alignment Bias ............................................................................................................................ 25 Bias in Locus Selection Strategy ................................................................................................ 26 4 DISCUSSION .............................................................................................................................. 33 An Independent Test of Ratite Polyphyly ................................................................................. 33 Evolutionary Implications .......................................................................................................... 33 Biogeographic Implications ........................................................................................................ 34 5 CONCLUSION ........................................................................................................................... 39 LIST OF REFERENCES ................................................................................................................... 40 BIOGRAPHICAL SKETCH ............................................................................................................. 44

PAGE 6

6 LIST OF TABLES Table page 2 1 Sampled Specimens ............................................................................................................... 21 2 2 Primer Information ................................................................................................................. 22 2 3 Locus Char acterization .......................................................................................................... 23 3 1 A summary of the core phylogenetic analyses for the three concatenated datasets ........... 27 3 2 P values from a Shimo daira Hasegawa (SH) test ................................................................ 28 3 3 Bootstrap support for ratite polyphyly at the critical node uniting all nonostrich paleognaths from maximum likelihood and maximum parsimony analyses ..................... 29 3 4 Resulting maximum likelihood topologies using guided alignments biased for ostrich basal and ratite polyphyly. ..................................................................................................... 30

PAGE 7

7 LIST OF FIGURES Figure page 1 1 The modern consensus on paleognath phylogeny ................................................................ 13 1 2 Patterns of flightlessness in the paleognaths when ratites are considered monoph yletic and the ancestral paleognath is assumed to be volant .................................. 14 1 3 Patterns of flightlessness in the paleognaths when ratites are considered polyphyletic and the ancestral paleognath is assumed to be volant .......................................................... 15 3 1 Multiple phylogenetic analyses indicated ratite polyphyly ................................................. 31 3 2 The paleognath species tree supported rat ite polyphyly ...................................................... 32

PAGE 8

8 Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science AN INDEPENDENT TEST OF RATITE POLYPHYLY By Jordan Victoria Smith August 2009 Chair: Edward L. Braun Cochair: Rebecca T. Kimball Major: Zoology The paleognaths are an ancient lineage of birds important for understanding early avian evolution, yet paleognath phylogeny remains unresolved, with the flightless ratites being most controversial. As some of the most well recognized of living birds, the ratites (modern paleognaths minus tinamous) include the giant birds of Africa, South America, Australia, and New Zealand. Although relationships within the ratites are unclear, the modern consensus on ratite phylogeny suggests they are the reciprocally monophyletic sister clade of the tinamous, volant paleognaths of the neotropics. In sharp conflict, a recent publication of the Avian Tree of Life Project supports ratite polyphyly because the ostrich emerges basal in the paleognath clade, nesting the volant tinamous within the flightless ratites. This study is an independent test of ratite phylogeny using a large nuclear dataset, further validating ratite polyphyly and the early divergence of ostrich from all other paleognaths. Phylogenetic artifacts, such as alignment bias and gene tree -species tree conflict, do not explain this result, nor does bias from locus selection strategies, specifically EPIC (Ex on -primed Intron -crossing) and anonymous approaches. A species tree that supports paleognath monophyly but ratite polyphyly has significant implications for reinterpreting paleognath evolution.

PAGE 9

9 CHAPTER 1 INTRODUCTION Paleognaths are an ancient lineage of birds that emerge at the deepest branch in the avian tree of life (Groth and Barrowclough, 1999; Braun and Kimball, 2002; Livezey and Zusi, 2007; Hackett et al., 2008; Harshman et al., 2008). Although they comprise less then one percent of all avian s pecies, paleognaths are some of the most widely recognizable living birds. Most distinct are the ratites, the giant cursorial birds of the southern hemisphere. The extant ostrich of Africa, the South American rheas, Australias emu and cassowaries, and t he kiwis of New Zealand all belong to this distinctive group. Also included among the ratites are the extinct moas of New Zealand and elephant birds of Madagascar. Initially recognized by their keel -less sternum, the ratites were first formally described in the early nineteenth century (Merrem, 1813). Closely related to the ratites are the tinamous of the neotropics. The ratites and the tinamous share unique palatal structures for which the paleognaths were named (Huxley, 1867). Unlike the ratites, the tinamous are volant. A unified paleognath clade with reciprocally monophyletic ratite and tinamou lineages was first proposed by Pycraft in 1900 (Fig. 1 1A). Although the modern consensus on paleognath relationships broadly reflects that of Pycraft (1900), paleognath phylogeny has been in conflict throughout its long history. Neither monophyly of the paleognaths nor the ratites gained substantive support until the first avian cladistic works of Cracraft in 1974, more than a century later (see Sibley and Ahlquist (1990) for a thorough review). In early works, discrepancy was largely attributed to convergence, an idea supported by the disparate biogeography of the taxa (Parker, 1895; Furbringer, 1902; Mayr and Amadon, 1951; DeBeer, 1956). Over the last f ew decades, however, most morphological and molecular phylogenetic studies have supported unified ratite and paleognath

PAGE 10

10 lineages, the exceptions including Houde and Olson (1981), Olson (1985), Houde (1986), Bock and Butler (1990), and Elzanowski (1995). Conflict has shifted largely to relationships within the ratites. The recently published Avian Tree of Life presents another source of conflict in the evolutionary relationships of the paleognaths (Hackett et al., 2008) (Fig. 1 1B). In sharp contrast wi th the modern consensus (Cracraft, 1974; Sibley and Ahlquist, 1990; Cooper et al., 1992; Lee et al., 1997; van Tuinen et al. 1998, Cooper et al. 2001; Haddrath and Baker, 2001; Livezey and Zusi, 2007), Hackett et al. (2008) maintain paleognath monophyly but reject ratite monophyly. Unlike previous studies, this large -scale nuclear DNA dataset confidently nests the volant tinamous within the flightless ratites, making the ratites polyphyletic. Using a substantially overlapping dataset, Harshman et al. (2 008) examine this topology for phylogenetic artifacts. Bias from long -branch attraction, deviations in base composition, gene tree -species tree conflicts, and misguided alignments do not contribute to the controversial paleognath phylogeny presented in Ha ckett et al. (2008). Although preliminary, the results from Hackett et al. (2008) and Harshman et al. (2008) suggest ratite polyphyly is a robust, genome -wide signal. Incongruence between the molecular datasets above and those supporting ratite monophyl y ( e.g., Cooper et al., 1992; Lee et al., 1997; van Tuinen et al. 1998; Cooper et al. 2001; Haddrath and Baker, 2001) can be attributed to methodological bias such as lack of power (Qui et al. 1999; Braun and Kimball, 2001; Chojnowski et al. 2008), or improper analyses (Kimball and Braun, 2002; Phillips, 2004). A re -evaluation of mitochondrial data using more sophisticated models and increased taxon sampling recovers ratite polyphyly (Phillips et al.; in press). Importantly, this result indicates that the collective molecular signal may support the non -monophyly of ratites.

PAGE 11

11 A topology supporting paleognath monophyly but ratite polyphyly sharply alters our understanding of the evolutionary history of the paleognaths. Considering the modern consensus, flightlessness among the paleognaths symbolizes the evolutionary divergence between the tinamous and the ratites; flightlessness is most parsimoniously explained by a single loss of flight in the lineage leading to the ratites (Fig. 1 2). The name ratite refers to the inability of ratite birds to fly and describes their raft like sternum (Merrem, 1813). Under conditions of ratite polyphyly however, the assumption of a single loss of flight relatively early in paleognath ancestry is not fully supported. T his scenario would have required a gain of flight in the tinamou lineage (Fig. 1 3A). Since there are no known instances of a regain of flight in birds, this is not a likely explanation. Instead, ratite polyphyly implies that flight was lost multiple ind ependent times across at least three ratite lineages (see Harshman et al. 2008)(Fig. 1 3B). Multiple losses of flight have been well documented in over twenty avian lineages, most notably the rails (Feduccia, 1996; Steadman, 2006). Importantly, this alte rnative scenario would mean that flightlessness is not a synapomorphy of ratite birds and that some of the most distinguishable morphological characters in ratites arose through convergent evolution. In this study, I provide an independent test of ratite polyphyly using a 40 -gene dataset, doubling the amount of loci collected in Hackett et al. (2008) and Harshman et al. (2008). Over 22kilobases (kb) of nuclear data were collected from across the genome, none of which have been used in any previous paleognath studies. To compliment and extend the analyses in Harshman et al. (2008), I examine the potential impact of phylogenetic artifacts due to gene tree species tree incongruence (Degnan and Rosenberg, 2006) and alignment bias (Lake, 1991) using Bayesian and novel methods. I also investigate the potential bias of EPIC (Exon-primed Intron crossing) (Palumbi and Baker, 1994) and anonymous locus selection strategies on phylogenetic

PAGE 12

12 signal. To my knowledge, this is the first study to quantitatively compare these two approaches for deep avian phylogenetics. One common strategy for locus selection is the EPIC approach (Palumbi and Baker, 1994). This approach utilizes the flanking coding regions for primer design of introns. Though convenient since primers a re relatively easy to design in exons, the EPIC approach limits primer development to short introns. EPIC loci access less then 10% of the avian genome (estimate derived from Ellegren (2005)). In comparison, anonymous loci (Karl and Avise, 1993) are collected randomly from across the genome and are not constrained by exon/intron boundaries. Importantly, these loci represent arbitrary fragments of the genome accessing large introns and intergenic regions that are not available using the EPIC approach. I evaluate if phylogenetic signal is similar between EPIC and anonymous loci; a comparison that indicates whether the use of short introns, such as those used in Hackett et al (2008) and Harshman et al. (2008), may mislead phylogenies.

PAGE 13

13 Figure 1 1. The m odern consensus on paleognath phylogeny. A) supports monophyletic ratite and paleognath lineages (Cracraft 1974). In contrast, B) Hackett et al. (2008) maintain paleognath monophyly but support ratite polyphyly (both figures have been modified).

PAGE 14

14 F igure 1 2. Patterns of flightlessness in the paleognaths when ratites are considered monophyletic and the ancestral paleognath is assumed to be volant. Patterns of flightlessness among the paleognaths can be most parsimonious explained by a single loss o f flight as indicated by the X on the tree. This hypothesis suggests that flight was lost relatively early in paleognath evolution.

PAGE 15

15 Figure 1 3. Patterns of flightlessness in the paleognaths when ratites are considered polyphyletic and the an cestral paleognath is assumed to be volant. Dashed lines represent loss of flight, the solid line represents a gain of flight. Since there are no know instances of flight being regained in birds A), multiple independent losses of flight are considered the most likely hypothesis B). Multiple Independent losses of flight suggest that some of the most distinguishable ratite characters may exhibit homoplasy.

PAGE 16

16 CHAPTER 2 METHODS Taxa Ten taxa are sampled in this study (Table 2 1) including two tinamous: Crypturellus soui (Little Tinamou) and Tinamus guttatus (White -throated Tinamou). The ratites are represented by the rheas, Pterocnemia pennata (Lesser Rhea) and Rhea americana (Greater Rhea) as well as Struthio camelus (Ostrich). Since the Aus tralasian clade is strongly united in Harshman et al (2008) only one Australasian taxa was used in this study, Dromaius novaehollandiae (Emu). In addition, three representatives of Galloansere were used as outgroups: Chauna semitorquata (Southern Screamer), Crax alector (Black Currasow), and Gallus gallus (Chicken). Providing a neoaves representative, Taeniopygia guttata (Zebra Finch) was included in the dataset using sequences available from NCBI traces archives Locus Development Two locus selection st rategies were used to generate this data: the anonymous approach and the EPIC (exon -primed intron -crossing) approach. In total, 10 anonymous loci were used for phylogenetic analyses (Table 2 2). In order to isolate the random genomic regions necessary fo r anonymous locus development, a small insert nuclear DNA library was constructed from the Little Tinamou. Genomic DNA was sheared via sonication to produce fragments in the range of 2 kb. Fragments were blunt end repaired via the DNA Terminator End Repair Kit (Lucigen Corporation) and cloned using the pEZSeqTMBlue/White Cloning Kit (Lucigen Corporation) for high efficiency cloning. Plasmids were prepared for sequencing by TempliPhi purification (Amersham Biosciences). Library Clones were selected ra ndomly and sequenced as described below. Candidate regions for anonymous primer design were identified by comparing sequence

PAGE 17

17 similarity between chicken and the tinamou sequences with BLASTN searches. Primers were designed from nonrepetitive, homologous regions greater than 300 bases in length. To provide comparison to the anonymous loci, 30 EPIC loci were also included in the dataset Twelve EPIC loci were from previous non -paleognath studies (Table 2 2) and the remaining 18 were developed for use in t his study. EPIC loci were designed using the general philosophy described by Kimball et al. (2009). Chicken was compared against Zebra Finch ESTs (Express Sequence Tags) and other available avian data for primer design. Homology was assessed using chick en BLAT (Kent, 2002). BLAT was useful because it distinguishes exon boundaries facilitating primer design in the coding regions. Primers were designed to isolate short introns (averaging 500 bp) that do not require internal primers. Amplification and S equencing PCR amplification (Polymerase Chain Reaction) was achieved through standard procedures. Products were cleaned by precipitation using an equal volume of PEG:NaCl (20 %:2.5M). Several primer sets required purification via gel electrophoresis using the PerfectprepGel Cleanup (Eppendorf). Cycle sequencing was performed using ABI BigDye Terminator v.3.1 and sequences were obtained using an ABI PrismTM 3100-Avant genetic analyzer (PE Applied Biosystems). If length polymorphisms between alleles resu lted in unusable sequence data, these PCR products were cloned using the pGEMT Easy vector (Promega Corp.). Plasmids were prepared for sequencing using the Perfectprep Plasmid Mini kit (Eppendorf) and sequenced using the same protocol I used for PCR pr oducts. Sequences were examined and assembled in to double -stranded contigs using Sequencher 4.1 (Gene Codes Corp.).

PAGE 18

18 Alignment Two alignment strategies were used in this study. First, contigs were imported into MacClade 4.0 ( Maddison and Maddison, 2000) and alignments were optimized by eye. These were t he primary alignments used in the phylogenetic analyses and locus characterization. Second, a progressive alignment program, the Probabilistic Alignment Kit (PRANK), was used to generate automated alignments (Loytynoja and Goldman, 2005). The PRANK alignments were used to evaluate alignment bias in phylogenetic signal. Alignment bias was induced in PRANK by manipulating the guide trees used in alignment construction. When the tinamous, rheas, and outgroups were constrained as monophyletic lineages, ther e were only 15 possible trees. All 15 topologies were used as guides to generate bias in 15 sets of corresponding alignments. Maximum likelihood (ML) analyses of the 15 sets of alignments were then conducted in PAUP* 4.0b10 ( Swofford, 2003) using random addition heu ristic searches. Support was assessed using 1000 bootstrap replicates. Topologies of the 15 biased datasets were then compared to determine if alignment bias influenced phylogenetic signal. Phylogenetic Analyses Multiple analyses were conducted on each individual locus as well as three separate concatenated datasets: an anonymous locus partition, an EPIC locus partition, and the total combined dataset. Maximum parsimony (MP) and ML analyses of all 40 individual gene trees were performed using PAUP* 4.0b10 using branch and bound searches. ML and MP analyses of the three concatenated datasets were conducted in PAUP* 4.0b10 ( Swofford, 2003) using 10 random addition heuristic searches with TBR branch swapping. For ML analyses, the appropriate model for each partition was determined by the akaike information criterion (AIC) in MODELTEST 3.06 ( Posada and Crandall, 1998). Support for all MP and ML analyses was

PAGE 19

19 examined by 1000 bootstrap replicates using heuristic searches. A to pology test using the Shimodaira Hasegawa test in PAUP* 4.0b10 was conducted on all 15 possible topologies to further evaluate the best likelihood tree topology from the total, combined dataset (Shimodaira and Hasegawa, 1999). In addition to the concat enated ML analyses in PAUP, partitioned ML analyses were conducted using RAxML (Stamatakis, 2006) (Table 4). For each separate concatenated dataset, data was partitioned by locus and searches used a GTRMIX model. Also, partitioned bayesian analyses of th e three concatenated datasets were conducted using MrBayes 3.0b4 (Huelsenbeck and Ronquist, 2001; Ronquist and Huelsenbeck, 2003). Here the appropriate model for each partition was determined using the AIC after limiting the models to those implemented in MrBayes. Each analysis consisted of two simultaneous searches of 50 million generations with burn in values of 5 million generations. Convergence was assumed when the average standard deviation of the split frequencies for the simultaneous runs approached zero, the potential scale reduction factors (PSRF) approached o ne, and the likelihood values reached stationary values. In this study, the majority of gene trees supported the basal divergence of ostrich however, the most frequent gene tree might not represent the true species tree in some instances (Edwards et al 2005; Degnan and Rosenburg 2006; Kubatko and Degnan, 2007). To examine if gene tree -species tree discordance influenced my results, I used Bayesian estimation of species trees (BEST) (Liu and Pearl 2007). BEST generates a species tree without concaten ation of the loci by accounting for gene tree variability. As mentioned for the MrBayes runs above, the complete concatenated dataset was modeled by locus and two simultaneous runs were conducted for 50 million generations. Burn in was set at 5 million generations Chicken and Zebra Finch were chosen as outgroups among the four neognath taxa and were evaluated in separate analyses.

PAGE 20

20 Locus Characterization Estimates of stationary base composition and evolutionary rate for locus characterization were cal culated using PAUP*4.0b10. Evolutionary rates were based on the ML trees and were normalized using the rate of the total evidence tree. The position of each locus on the chicken chromosome and the corresponding gene association was determined using the N CBI database (Table2 3)

PAGE 21

21 Table 2 1. Sampled Specimens Species Common name Instituition* Voucher or tissue number Paleognaths Dromaius novaehollandiae Emu LSUMNS B5895 Rhea americana Greater Rhea FLMNH 44923 Pterocnemia pennata Darwin's Rhea U SNM 620827 Struthio camelus** Common Ostrich LSUMNS B1526 Crypturellus soui Little Tinamou USNM 586295 Tinamus guttatus White throated Tinamou FMNH 389673 Galloanseres Crax alector Black Curassow USNM 625104 Chauna torquata Southern Screame r USNM 614546 Institutions who provided the specimens were: FLMNH, Florida Museum of Natrual History, FMNH, Field Museum of Natural History, LSUMNS, Louisiana State University Museum of Natural Science, USNM, United States National. ** The Struthio cam elus DNA used for this study was not formally vouchered but was validated using loci from the provided specimen and published in Hackett et al (2008).

PAGE 22

22 Table 2 2. Primer Information Locus Forward Primer Reverse Primer Gene Associati on Anon1 CTGCTAAAWAGAATCCNGG GRAGTCATTRTGCACCCTC SLC25A21 Anon2 GGATGCTCGCTCAGKAMTTTG GTGGTTTAGCCTGGAGTTAAG -Anon3 CTGCACWGGAAGGCTKATG GTCTGAWGATGTCTSAGCTGTG PALLID TCCTGGYCAGCCTCATRTTAGAAG Anon4 GTCCACCAGTNMGGTATTAATC CCTNCCACTGTANCAAAN G BMP5 GAGGGGAAACTTGGAAYTTTGTGG GAGGGGAAACTTGGAAYTTTGTGG Anon5 GGAGACCTTRTTGGACATATTGTTG CACMGCTTCAATGAGACACCTC PUM2 Anon6 GCTGCACTYATAGKTRAGG GACCAACTGAAAAGACTTG RXFP2 AATGTGGGACTYAAGGAAGCTG CAAYAGCCAAGGTCCTGATTCAG Anon7 GGYTGTTGAGAGRACAG AAGG GTTTKGGCAGGTRCTGGC NUSAP1 Anon8 CACAACACTTGACTATGGC GAYKCAGACACCRCATTATC -Anon9 GGCAGYATTAAGGAAACGCAC GAGTAYGTAGACCAAMCCATACG TTN Anon10 GTTATCAAGTGATCTGTTTGCAGTC GCAKCYGTGATGCCAGGRTG -Epic1 GGTTGGAGAACTTGTTTATGG GGCTCATAAAGGGCT TTG GRIA2 Epic2 3 CCTGATGGTCAGGTCATCA CAGCAATGCCAGGGTACAT ACTB Epic3 1 TGGTTCAGTTTCATGAACCCTTG CCTGAAGCACRCTGTCCATGCT ARNTL Epic4 2 AGGGTGTCAARATGTGTGSGAAAGA GTANAGCTTCCCTCCATCNGACAA CALB1 Epic5 AGAAAGGCCTGGAGAGGAGAGC GTCTTCAACCACCAGTCCGAGAG CRAT CATGSTATCTGCTGCTGTTYGGTCC Epic6 GACTACGTCTTTGACTGGAACATGCT ATCCTCAGGGTTTCGGGCTG CSNK1E Epic7 CCCTGAATCAGCCCTCAAATTCTACTGTTA AATCTCCCCAAGTCGCTGCTG CIZ1 Epic8 1 CCAGAGGGGGAACATTCAGAA TCCTTTGGGTCTATTGTTCCTCG CLOCK CATGTGGATGATCTAGATAATCTGGC* GYAATGT GTTTGCAGCCAAATCCA* Epic9 1 CTGGTGCTGTAAGTGCTCGTAAC CCAGGCTGTAAGGTTTCTAGGTCAC CSDE1 Epic10 CATATAAATCATCAGCCATTCCTGG GTTGGTGCCAGCACAAGAC DDX5 Epic11 1 GCAGGCCTRRCTGGAAAAGARCC TTCTGAGCTCCWAGRTTACC PARK7 Epic12 GTCCAGCAATGAGACACCTCCAC CCAGTCATCA TCGTCCTCCTCC EIF5 Epic13 GGTGATGATCTGACTGTGACCAACC CATCACACCCCAGCCATTGGAC ENO1 Epic14 CAGTGGCTTCACAAAGGAACAGTGTC CAAACATGCTGTTCAGTCCACAACC ETS2 Epic15 2 TGCGGGTGCTGGCATTGC TGCATGCCATGTGGACCAT GAPDH Epic16 GATCACCTCCTGCTTCAGCTC GGCCCCAGCATCAA GATCTG GNB2L1 Epic17 GCATTTCCTGTCTAGAGAGGGCTTTC CATTTGATGACCATGATCCTGTGTGG HNRPA2B1 Epic18 CTAAGTAGGAATTGTCTTCATCAGC GATGAAGACGATTTGGAAGC CHMP5 Epic19 CATGGACCGAAGAGGAGGCACT CCAGAGAGCATCTGCATATGTGGAG KCNQ5 Epic20 1 CCCTCAGACACTGGATTAYG AATCAT CCAAGGATTCCGAAGCAGTAAG PAXIP1 Epic21 1 ATCAGAGGGGTTCTCAAAGATGG AGAGAAGGCTCTGGGCTTGTCGGTA NAT15 Epic22 1 CATCTTCAYCCAAATGACAGACC CCTGATTGGTGAATAGTCAAAAGG PER2 Epic23 TGGGGYTGGCTGTNGCRGGTGGAGT CAGGGGATGAGGAAGTGGGTRCCTTC PHB Epic24 GTATAGTGGTATGGGT CCAGATTAC GCTGTTGGAATGGGCTCATGATAAAC PSMA2 Epic25 1 GGAAACCCCAGCTACAAGTATTTC GGCCTCCTTCATCCCTTGG TXNDC12 Epic26 GCTGTGTATTTGGTCTATTCAGAG CAGGTGGCAAATGTAAAGATGTG SFRS3 Epic27 CTTGGCGATCACAGGGACAATG GAACAGGCGCCACATTATAGACAATAG SEPT2 Epic2 8 CCCNGATCGCAAAAATCTGAAATG CGAAGAATAGTAATTGCWGCTTCTGTTGC TCP1 Epic29 GTCAACGTCACAACCTAGG CAACTTTCTCACCAAATACAGG VDAC2 Epic30 1 GACCGTGGAAACTAGAGATGGAC GTCATCGTGATGCTGGGAAGTTTC VIM 1Loci can be found in Kimball et al. (2009), 2loci in Cox et al. (2007), and 3loci in Waltari and Edwards (2002).

PAGE 23

23 Table 2 3. Locus Characterization Locus Gene Association Chromosome* Base Composition Stationary Normalized rate** ML Support For Ratite Polyphyly*** Anon1 a SLC25A21 5 yes 0.78 yes Anon2 b -2 ye s 0.98 yes Anon3 d PALLID 4 NO 0.91 yes Anon4 a BMP5 3 yes 0.18 NO Anon5 d PUM2 3 yes 0.85 yes Anon6 a RXFP2 4 NO 1.44 NO Anon7 d NUSAP1 5 yes 0.95 NO Anon8 b -Z NO 0.96 yes Anon9 c TTN 7 yes 0.25 yes Anon10 b -8 yes 0.97 yes Epic1 GRIA2 4 yes 0.86 ye s Epic2 ACTB 10 yes 1.34 yes Epic3 ARNTL 5 yes 0.98 yes Epic4 CALB1 2 yes 0.70 yes Epic5 CRAT 17 NO 0.84 yes Epic6 CSNK1E 2 yes 1.07 yes Epic7 CIZ1 17 yes 0.63 yes Epic8 CLOCK 4 NO 1.01 yes Epic9 CSDE1 2 yes 1.10 yes Epic10 DDX5 18 yes 1.59 yes E pic11 PARK7 21 yes 1.00 yes Epic12 EIF5 5 yes 1.76 yes Epic13 ENO1 21 yes 1.37 yes Epic14 ETS2 1 yes 0.57 yes Epic15 GAPDH 1 yes 1.33 NO Epic16 GNB2L1 16 yes 2.20 yes Epic17 HNRPA2B1 2 yes 1.47 NO Epic18 CHMP5 2 yes 1.26 yes Epic19 KCNQ5 3 yes 0.8 6 yes Epic20 PAXIP1 2 yes 0.95 yes Epic21 NAT15 14 yes 1.22 yes Epic22 PER2 9 yes 1.27 yes Epic23 PHB 27 yes 1.26 yes Epic24 PSMA2 2 yes 1.11 yes Epic25 TXNDC12 8 yes 0.90 yes Epic26 SFRS3 z NO 0.91 yes Epic27 SEPT2 15 yes 0.95 yes Epic28 TCP1 3 y es 1.55 yes Epic29 VDAC2 6 yes 1.18 yes Epic30 VIM 2 yes 1.24 yes Anonymous locus types are represented by a large intron, b intergenetic region, c exon only, and d intron plus exon. Chromosomal position of the locus is referenced to the chicken genome. ** Individual locus rates were normalized by the total evidence rates. *** Support for ratite polyphyly is shown based on the single best ML topology for each locus.

PAGE 24

24 CHAPTER 3 RESULTS Concatenated Trees This 40 locus dataset provided independent support that the ratites are not monophyletic. In all combined analyses, non -ostrich paleognaths are united at the basal node of the tree nesting tinamous within the ratites and supporting the early divergence of the ostrich (Fig. 3 1). Although controversial, this critical node was supported by a bootstrap value of 100 in nearly all maximum parsimony (MP) and maximum likelihood (ML) analyses, and a posterior probability of 1 in all Bayesian analyses (Table 3 1). Furthermore, the basal emergence of ostr ich is congruent with Harshman et al. (2008) and Hackett et al. (2008) and provides strong support for ratite polyphyly using nuclear DNA. Although the basal position of the ostrich is well resolved, the specific relationship of the tinamous within the non -ostrich ratites remains uncertain (Table 3 1). An SH test reveals that none of the three possible sister relationships of the tinamous with the non-ostrich ratites can be rejected as significantly worse hypotheses (Table 3 2). Although kiwis are not represented in this dataset, including this lineage would likely not have improved resolution of the tinamou sister clade; the phylogenetic position of the tinamous was unclear in Harshman et al. (2008) despite inclusion of the kiwi lineage. A combinati on of small taxon number and variable internodes lengths makes this a particularly difficult phylogenetic problem (Lee et al ., 1997). Individual Gene Trees Ultimately, 35 of the 40 loci supported ratite polyphyly using ML analyses (Table 3 3). Nine of t hese loci supported a non -ostrich ratite emerging at the basal node and the large majority, 26 loci, supported the basal position of the ostrich. Interestingly, the basal emergence of ostrich is supported by 65% percent of the total gene trees, a similar proportion as found in

PAGE 25

25 Harshmen et al. (2008). For the four gene trees that supported ratite monophyly, the evolutionary rate is relatively fast, although similar rates occur for gene trees supporting ratite polyphyly. The results of the MP analyses wer e similar. Only eight loci supported ratite monophyly and the large majority of trees (32) supported ratite polyphyly (Table 3 3). Gene Tree -Species Tree Incongruence For this dataset, Bayesian estimation of species trees (BEST) supports a species tree wi th ratite polyphyly and has ostrich emerging at the basal node regardless of which outgroup was used for analysis (Fig. 3 2). This result confirms the ML, MP, and Bayesian topologies and suggests that gene tree -species tree discordance is not a strong sou rce of discrepancy between this large -scale molecular study and those of previous phylogenetic studies. Alignment Bias No matter which of the 15 guide trees was used to generate alignments in PRANK, each resulting concatenated dataset supported ratite p olyphyly. Furthermore, ostrich emerged at the critical node with ML bootstrap values of 100 in all 15 topologies. Therefore, even when the guide tree biased alignments toward ratite monophyly, the phylogenetic signal for ratite polyphyly was recovered wi th confidence. Alignment bias did not affect the critical node in this alternative topology (data not shown). There was some evidence for alignment bias in determining the sister taxa of the tinamous. For example, when the three possible topologies su pporting ratite polyphyly with ostrich basal were used as guides, two alternative sister relationships had conflicting bootstrap values of 99 or greater (Table 3 4). This demonstrates the potential for alignment bias when the phylogenetic signal is weak t herefore, I advocate cautious use of PRANK when phylogenetic

PAGE 26

26 relationships are uncertain. Other programs that do not incorporate models of substitution in the alignment process may be less susceptible to guide -tree bias (for review see Nelesen et al., 2008). Bias in Locus Selection Strategy Both anonymous and EPIC (Exonprimed Intron -crossing) partitions clearly supported the basal position of ostrich among the paleognaths (Table 31). Therefore, ratite polyphyly cannot be attributed to locus selection b ias. As might be expected, the placement of the tinamous is unclear between the two. Ultimately, short introns isolated by the EPIC approach and anonymous loci accessing long introns and intergenic regions seem to recover similar phylogenetic signal.

PAGE 27

27 Table 3 1. A summary of the core phylogenetic analyses for the three concatenated datasets. For all analyses support uniting a non ostrich paleognath clade and therefore ratite polyphyly is 100% except in two cases (*). The support values shown correspo nd to the tinamou sister relationship for the total concatenated dataset (T), the anonymous partition (A), and the epic partition (E). Topology Partitioned Mr.Bayes Partioned ML Concatenated ML Concatenated MP (Ostrich, (Emu,(Rheas, Tinamous))) 589T, 64 1 E 61T, 62 E (Ostrich, (Rheas,(Emu,Tinamous))) 97T, 91 E 422A* 72T, 62 E 37A* (Ostrich, (Tinamous,(Rheas,Emu))) 71A 70A Support uniting a non-ostrich paleognath clade is 100 for all analyses except the anonymous MP and partitioned ML analy ses that are 90 and 97.5% respectively.

PAGE 28

28 Table 3 2. P -values from a Shimodaira Hasegawa (SH) test. An SH test compared the most likely tree topology from the concatenated ML analysis of the complete dataset to all 15 possible tree topologies. All topologies with no significant difference in likelihood values from the best topology are shown. Topology P values (Ostrich, (Emu,(Rheas, Tinamous))) 0.725 (Ostrich, (Rheas,(Emu,Tinamous))) Best topology (Ostrich, (Tinamous,(Rheas,Emu))) 0.735

PAGE 29

29 Table 3 3. Bootstrap support for ratite polyphyly at the critical node uniting all non -ostrich paleognaths from maximum likelihood and maximum parsimony analyses ML MP Locus Support Conflict Support Conflict Anon1 -72 -52 Anon2 94 89 -Anon3 84 -85 -Anon4 -25* --Anon5 73 -49 -Anon6 -60* -93* Anon7 ----Anon8 83 -90 -Anon9 46 -64 -Anon10 69 -69 -Epic1 43 ---Epic2 100 -89 -Epic3 86 -88 -Epic4 69 ---Epic5 99 -88 -Epic6 66 --81* Epic7 53 -38 -Epic8 72 -74 -Epic9 72 -54 -Epic10 -50 --Epic11 90 -89 -Epic12 -40 -42 Epic13 74 -76 -Epic14 86 -82 -Epic15 -50* -75* Epic16 68 -48 -Epic17 -45* -53* Epic18 42 -48 Epic19 68 ---Epic20 -65 -61 Epic21 -24 -69 Epic22 67 --45* Epic23 -82 -36 Epic24 45 --50* Epic25 80 -86 -Epic26 96 -93 -Epic27 73 -89 -Epic28 -37 -34* Epic29 -73 -69* Epic30 52 -57 -* Indicates loci which supported ratite monophyly. If multiple best trees conflicted at the critical node, results are not presented for that locus.

PAGE 30

30 Table 3 4. Resulting maximum likelihood topologies using guided alignments biased for ostrich basal and ratite polyphyly. Guide Tree ML Bootstrap Support Tinamous + Rhea Tinamous + Emu (Ostrich, (Emu,(Rheas, Tinamous))) 99 (Ostrich, (Rheas,(Emu,Tinamous))) 99 (Ostrich, (Tinamous,(Rheas,Emu))) 84

PAGE 31

31 Figure 3 1. Multiple phylogen etic analyses indicated ratite polyphyly. Using 22kb of nuclear data, the topology from the concatenated ML analysis and the partitioned Bayesian analysis of the complete dataset is shown in A). Branch lengths are represented from the concatenated ML anal ysis. For each node, the top number represents the bootstrap value and the bottom number represents the posterior probability. The topology from the partitioned ML analysis and the unpartitioned MP analysis of the complete dataset is shown in B). Support values for the partitioned ML analysis are on top and un-partitioned MP bootstrap values are on bottom. Branch lengths are represented from the partitioned ML analysis. The critical node indicating ratite polyphyly is circled on both topologies.

PAGE 32

32 Figure 3 2. The paleognath species tree supported ratite polyphyly. BEST analyses of the complete dataset using A) zebra finch and B) chicken as neognath outgroups have tinamous nested within the ratites. Support values are shown and the critical node i ndicating ratite polyphyly is circled.

PAGE 33

33 CHAPTER 4 DISCUSSION An Independent Test of Ratite Polyphyly This independent dataset provides strong and consistent support for ratite polyphyly through a variety of analyses of nuclear DNA. Phylogenetic signa l was robust to alignment bias at the critical node, and neither locus selection strategy or gene tree -species tree conflicts appear to have misled analyses. My results support the novel conclusions of Hackett et al. (2008) and Harshman et al. (2008). Ev olutionary Implications A species tree that supports ratite polyphyly has major implications for paleognath evolution. As mentioned previously, multiple independent losses of flight may mean that some of the most distinguishable ratite characters arose th rough convergent evolution such as reduction of the sternal keel, reduction in wing structure, opening of the pelvic region, emphasis of hind -limb structure, and larger size (Feduccia, 1996). Convergence has been shown to misled phylogenies (McCracken et al. 1999) and the possibility of convergence among the ratites is alarming. Not only does this hypothesis call to question previous synapomorphies of the clade, as suggested by Harshman et al. (2008), it offers an unambiguous explanation for the discrepan cy between molecular and morphological phylogenetic signals. Two morphological studies using cranial characters further validate this hypothesis (Bock and Buhler, 1990; Elzanowski, 1995). Cranial characters have been proposed as being less susceptible to convergence from loss of flight (Bock and Buhler, 1990; Feduccia, 1996) and both studies support ratite polyphyly.

PAGE 34

34 Biogeographic Implications Ratite polyphyly offers some flexibility for resolving paleognath biogeography, a question that has long fascinate d researchers. The distribution of these flightless birds has previously been related to vicariant events under the assumption that ancestral ratites were flightless (Cracraft ,1974; Sibley and Ahlquist, 1990). Given their broad distribution across the s outhern hemisphere, their divergence has been attributed to continental drift and the breakup of Gondwana (Cracraft, 1974). However, recent mitochondrial studies suggest dispersal must be considered (van Tuinen et al ., 1998; Haddrath and Baker, 2001; Cooper et al., 2001). Two studies were able to incorporate data from the extinct moas of New Zealand and found that the two New Zealand lineages (the moas and the kiwis) were not each others closest relatives (Haddrath and Baker, 2001; Cooper et al., 2001). This result suggests there were two independent colonization events of New Zealand with only the earliest divergence (the moas) possibly coinciding with the split of New Zealand from Antarctica. Although flightless birds have the ability to disperse by r afting or swimming (Cooper et al., 1992), if ancestral paleognaths were prevalently volant as implied by ratite polyphyly, flight offers a more logical mechanism for explaining paleognath biogeography. Good dispersal capabilities would no longer constra in ancestral paleognaths to a Gondwanan origin. As indicated by the fossil record, ratites and paleognaths did have a distribution in the Northern Hemisphere (Houde, 1986, 1988; Houde and Haubold, 1987; Mayr, 2005) Several ratite fossils have been ident ified in Europe. The most well known is Palaeotis weigelti of the early Eocene (Houde and Haubold, 1987). Palaeotis has a close affinity to either the ostrich (Houde and Haubold, 1987) or the rheas (Peters, 1992b). Remiornis minor the oldest presumed r atite of the northern hemisphere, coincides closely in geologic time with the earliest ratite known in the southern hemisphere, Diogenornis fragilis (Alvarenga and Olson, 1983)

PAGE 35

35 Although the precise affinity of Remiornis is debated, it suggests the possib le simultaneous distribution of ratite like paleognaths in the northern and southern hemisphere in the late Paleocene (Houde and Haubold, 1987; Feduccia, 1996). Considering ambiguity in the fossil record and the possibility for flight, a Laurasian origin for the paleognath clade should not be dismissed. Subsequently, I suggest a re -examination of the extinct lithornithids and their place on the paleognath tree. Lithornithids are volant fossil paleognaths found in North America and Europe during the Pal eocene and Eocene (Mayr, 2005). They have never been examined in a rigorous phylogenetic context although, they are generally considered to be ancestral tinamous (Houde and Olson, 1981; Houde, 1988; Feduccia, 1996; Leonard et al ., 2005). If paleognath an cestors were prevalently volant, then the lithornithids may have a more central role in paleognath evolution as suggested by Feduccia (1996) and consistent with the predictions of Parkes and Clark (1966). Remarkably, a recently identified fossil of Lithor nis has a well -preserved skull that may allow for the phylogenetic assessment of the lineage while avoiding the potentially convergent characters of the postcranial skeleton (Leonard et al., 2005). Although a species tree that supports ratite polyphyly clearly broadens biogeographic hypotheses for the clade, it is important to note that this phylogeny does not refute all aspects of a Gondwanan -based vicariance model. Ostrich emerges basal in the tree possibly corresponding to the initial split of Afric a from Gondwana (Szatmari and Milani, 1999). Ultimately, resolution of paleognath biogeography will require good estimates of molecular divergence for direct comparison to the geologic time frame.

PAGE 36

36 Anonymous Primer Utility Despite the overall consensus in paleognath topology between the anonymous and EPIC loci, we recommend careful use of anonymous loci for multi locus studies of deep phylogenetic questions. We found that the EPIC (Exon -primed Intron -crossing) approach yielded over three times as many phy logenetically informative markers than the anonymous approach when spanning a relatively large evolutionary depth. In my study, phylogenetically informative markers are defined by the non paralogous locus amplification of all critical taxa: the ostrich, o ne tinamou, and at least one other non -ostrich ratite. According to mitochondrial estimates, the paleognaths last shared a common ancestor roughly 90 million years ago (Haddrath and Baker, 2001). Here, the proportion of phylogenetically useful anonymous loci was only 23% of the 43 initially examined. In comparison, 50% of the 60 EPIC loci were phylogenetically useful. In birds this suggests that the anonymous approach is less efficient than the EPIC approach for resolving deep phylogenies. When isolatin g genomic regions across inter -specific taxa, anonymous loci are more slowly evolving then EPIC loci on average (Table 23). This is most likely a constraint due to methodology specifically from homology requirements for primer design rather then an intri nsic property. Anonymous loci have an average rate of 0.83 substitutions per site and EPIC have an average rate of 1.15 substitutions per site. The two most slowly evolving regions of the entire dataset are anonymous loci. The slowest is Anon4, a large, conserved noncoding region of the developmental gene BMP5. This is congruent with other studies suggesting that introns of developmental genes should be avoided when variability is needed (Woolfe et al., 2005). Surprisingly, the rate of evolution of Ano n4 is even slower then Anon9, a protein coding region.

PAGE 37

37 Another potential downfall of the anonymous locus approach is having no control over the physical location of the sampled loci. Although in some instances this may be viewed as an advantage, the mac ro -chromosomes are overrepresented. In addition, anonymous loci more frequently deviate from stationary base composition meaning they more frequently violate the evolutionary models currently used in phylogenetic analyses. There are no distinguishing patt erns in locus characteristics between the four anonymous locus types (Table 2 3). Anonymous primers have been most commonly used to address population level questions, typically as an alternative to microsatellite data (Hare et al. 1996; Kuhner et al 2000; Jennings and Edwards, 2005). To my knowledge, this is one of only two studies (Thomson et al ., 2008) to examine anonymous primer utility for deep phylogenetic questions. Analysis of both studies suggests a trend of decreasing anonymous efficiency over large depths. First, considering efficiency of the anonymous approach in the paleognaths, only 3.28% of all the anonymous regions examined resulted in phylogenetically useful loci. That represents only 10 out of the original 304 library clones that produced readable sequences. Only 14.14% (43) of the readable sequences yielded candidate loci (as defined in methods). Most of the 43 candidate loci were eliminated due to high levels of nonspecific amplification. One region was excluded as a paralog. The second study is a very careful examination of anonymous primer utility across a deep turtle phylogeny (Thomson et al ., 2008). While direct comparisons cannot be made between the two studies, a close look at Thomson et al. (2008) provides similar concl usions. When controlling for phylogenetic depth over 65%, 32 of 49 non-repetitive loci, had problematic amplification of 4 or more of the 9 genera of interest. Problematic amplification includes smears, multiple bands, or no amplification. Although loci have not been optimized in this

PAGE 38

38 study, our results suggest that optimization will not greatly improve amplification success. In conclusion, these two studies indicate that anonymous loci may be problematic across large depths in a variety of organisms. When alternative methods to primer design are available, we advise cautious use of anonymous loci for deep phylogenetic questions.

PAGE 39

39 CHAPTER 5 CONCLUSION Thorough examination of 40 unlinked nuclear genes provides strong and independent support of ratite polyphyly and paleognath monophyly. Tinamous are consistently nested within the ratites and ostrich emerges at the basal node of the paleognath tree. This topology indicates that similarities among the ratites may be due to convergent evolution. If flig ht was lost multiple independent times among the ratites, convergence may account for incongruence in paleognath phylogenies. Furthermore, this topology adds flexibility for understanding ratite biogeography. Volant paleognath ancestry would no longer re strict ratites to a Gondwana origin, a hypothesis with conflicting support in the fossil record. The ratites may have had more widespread distribution, and the role of lithornithids in paleognath evolution should be re -evaluated.

PAGE 40

40 LIST OF REFERENCES Al varenga, R., And S. L. Olson. 1983. Uma ave ratita do paleoceno brasileiro: bacia calcaria de itaborai, Estado Do Rio De Janeiro, Brasil. Boletim Do Museu Nacional 41:1 11. Bock, W. J., And P. Buhler. 1990. The evolution and biogeographical history of the palaeognathous birds. Pages 31 36 In Proceedings of the International Centennial Meeting of the Deutsche OrnithologenGesellschaft. Verlag der Deutschen Ornithologen Gesellschaft, Bonn, Germany. Braun, E. L., And R. T. Kimball. 2001. Polytomies, the power of phylogenetic inference, and the stochastic nature of molecular evolution: a comment on walsh et al. (1999). Evolution 55:1261 1263. Braun, E. L., And R. T. Kimball. 2002. Examining basal avian divergences with mitochondrial sequences: model complexity, taxon sampling, and sequence length. Systematic Biology 51:614 625. Chojnowski, J. L., R. T. Kimball, And E. L. Braun. 2008. Introns outperform exons in analyses of basal avian phylogeny using clathrin heavy chain genes. Gene 410:89 96. Cooper, A., C. Lalu eza -Fox, S. Anderson, A. Rambaut, J. Austin, And R. Ward. 2001. Complete mitochondrial genome sequences of two extinct moas clarify ratite evolution. Nature 409:704 707. Cooper, A., C. Mourerchauvire, G. K. Chambers, A. Vonhaeseler, A. C. Wilson, And S. Pa abo. 1992. Independent origins of New -Zealand moas and kiwis. Proceedings Of The National Academy Of Sciences Of The United States Of America 89:8741 8744. Cox, W. A., R. T. Kimball, And E. L. Braun. 2007. Phylogenetic position of the New World Quail (Odon tophoridae): eight nuclear loci and three mitochondrial regions contradict morphology and the sibley ahlquist tapestry. Auk 124:71 84. Cracraft, J. 1974. Phylogeny and evolution of the ratite birds. Ibis 116:494 521. DeBeer, G. 1956. The evolution of ratit es. Bulletin Of The British Museum (Natural History) 4:59 70. Degnan, J. H., And N. A. Rosenberg. 2006. Discordance of species trees with their most likely gene trees. Plos Genetics 2:762 768. Edwards, S. V., W. B. Jennings, And A. M. Shedlock. 2005. Phylogenetics of modern birds in the era of genomics. Proceedings Of The Royal Society B Biological Sciences 272:979 992. Ellegren, H. 2005. The avian genome uncovered. Trends In Ecology & Evolution 20:180 186. Elzanowski, A. 1995. Cretaceous birds and avian phylogeny. Courier Forschungsinstitut Senckenberg 181:37 53. Feduccia, A. 1996. Evolution of flightlessness. Pages 231 289 In The Origin And Evolution Of Birds Yale Universiy Press, New Haven & London. Furbringer, M. 1902. Zur vergleichenden anatomie des bru stchulterapparates und der schultermuskeln. V. Teil. Jena. Zeitschr. Xxxvi:Pp. 289 736. Groth, J. G., And G. F. Barrowclough. 1999. Basal divergences in birds and the phylogenetic utility of the nuclear RAG 1 gene. Molecular Phylogenetics And Evolution 12: 115 123. Hackett, S. J., R. T. Kimball, S. Reddy, R. C. K. Bowie, E. L. Braun, M. J. Braun, J. L. Chojnowski, W. A. Cox, K. L. Han, J. Harshman, C. J. Huddleston, B. D. Marks, K. J. Miglia, W. S. Moore, F. H. Sheldon, D. W. Steadman, C. C. Witt, And T. Yur i. 2008. A phylogenomic study of birds reveals their evolutionary history. Science 320:1763 1768.

PAGE 41

41 Haddrath, O., And A. J. Baker. 2001. Complete mitochondrial DNA genome sequences of extinct birds: ratite phylogenetics and the vicariance biogeography hypot hesis. Proceedings Of The Royal Society Of London Series B Biological Sciences 268:939 945. Hare, M. P., S. A. Karl, And J. C. Avise. 1996. Anonymous nuclear DNA markers in the American oyster and their implications for the heterozygote deficiency phenomenon in marine bivalves. Molecular Biology And Evolution 13:334 345. Harshman, J., E. L. Braun, M. J. Braun, C. J. Huddleston, R. C. K. Bowie, J. L. Chojnowski, S. J. Hackett, K. L. Han, R. T. Kimball, B. D. Marks, K. J. Miglia, W. S. Moore, S. Reddy, F. H. Sheldon, D. W. Steadman, S. J. Steppan, C. C. Witt, And T. Yuri. 2008. Phylogenomic evidence for multiple losses of flight in ratite birds. Proceedings Of The National Academy Of Sciences Of The United States Of America 105:13462 13467. Houde, P. 1986. Ost rich ancestors found in the NorthernHemisphere suggest new hypothesis of ratite origins. Nature 324:563 565. Houde, P. W. 1988. Paleognathous birds from the Early Tertiary of the Northern Hemisphere. Publications of the Nuttall Ornithological Club:iii vii 1 148. Houde, P., And H. Haubold. 1987. Palaeotis Weigelti Restudied: A small Eocene ostrich (Aves: Struthioniformes). Paleovertebrata 17:27 42. Houde, P., And S. L. Olson. 1981. Paleognathous carinate birds from the Early Tertiary of North America. Science 214:1236 1237. Huelsenbeck, J. P., And F. Ronquist. 2001. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics 17:754 755. Huxley, T. H. 1867. On the classification of birds; and on the taxonomic value of the modifications of certain of the cranial bones observable in that class. Proc. Zool. Soc.:Pp. 415 472. Jennings, W. B., And S. V. Edwards. 2005. Speciational history of Australian Grass Finches (Poephila) inferred from thirty gene trees. Evolution 59:2033 2047. Karl, S. A., And J. C. Av ise. 1993. PCR -based assays of mendelian polymorphisms from anonymous single -copy nuclear -dna techniques and applications for population genetics. Molecular Biology And Evolution 10:342 361. Kent, W. J. 2002. BLAT the BLAST -like alignment tool. Genome Rese arch 12:656 664. Kimball, R. T., E. L. Braun, F. K. Barker, R. C. K. Bowie, M. J. Braun, J. L. Chojnowski, S. J. Hackett, K.L. Han, J. Harshman, V. Heimer Torres, W. Holznagel, C. J. Huddleston, B. D. Marks, K. J. Miglia, W. S. Moore, S. Reddy, F. H. Sheld on, J. V. Smith, C. C. Witt, And T. Yuri. 2009. A well tested set of primers to amplify regions spread across the avian genome. Molecular Phylogenetics And Evolution 50:654 660. Kubatko, L. S., And J. H. Degnan. 2007. Inconsistency of phylogenetic estimate s from concatenated data under coalescence. Systematic Biology 56:17 24. Kuhner, M. K., P. Beerli, J. Yamato, And J. Felsenstein. 2000. Usefulness of single nucleotide polymorphism data for estimating population parameters. Genetics 156:439 447. Lake, J. A 1991. The order of sequence alignment can bias the selection of tree topology. Molecular Biology And Evolution 8:378 385. Lee, K., J. Feinstein, And J. Cracraft. 1997. The phylogeny of ratite birds: resolving conflicts between molecular and morphological data sets Pages 173 211 In Avian Molecular Evolution And Systematics (D. P. Mindell, Ed.) Academic Press, New York.

PAGE 42

42 Leonard, L., G. J. Dyke, And M. Van Tuinen. 2005. A new specimen of the fossil palaeognath Lithornis from the Lower Eocene of Denmark. Ame rican Museum Novitates:1 11. Liu, L., And D. K. Pearl. 2007. Species trees from gene trees: reconstructing Bayesian posterior distributions of a species phylogeny using estimated gene tree distributions. Systematic Biology 56:504 514. Livezey, B. C., And R L. Zusi. 2007. Higher order phylogeny of modern birds (Theropoda, Aves : Neornithes) based on comparative anatomy. II. Analysis and discussion. Zoological Journal Of The Linnean Society 149:1 95. Loytynoja, A., And N. Goldman. 2005. An algorithm for progressive multiple alignment of sequences with insertions. PNAS 102:10557 10562. Maddison, D., And M. W. 2000. Macclade 4:Analysis of phylogeny and character evolution. Sinauer Associates, Inc., Sunderland, MA. Mayr, E., And D. Amadon. 1951. A classification of recent birds. American Musuem Novalties 1496:42. Mayr, G. 2005. The paleogene fossil record of birds in Europe. Biological Reviews 80:515 542. Mccracken, K. G., J. Harshman, D. A. Mcclellan, And A. D. Afton. 1999. Data set incongruence and correlated c haracter evolution: an example of functional convergence in the hind limbs of stifftail diving ducks. Systematic Biology 48:683 714. Mcdowell, S. 1948. The bony palate of birds. Part 1. The Palaeognathae. Auk 65:520 549. Merrem, B. 1813. Temtamen systemati s naturalis avium. Abh. Konigel. Akad. Wiss. Berlin 23:237 259. Nelesen, S., K. Liu, D. Zhao, And C. R. Linder, Warnow, T. 2008. The effect of the guide tree on multiple sequence alignments and subsequent phylogenetic analyses. Pacific Symposium Of Biocomp uting 13:25 36. Olson, S. L. 1985. The fossil record of birds. Pages 79 238 In Avian Biology (D. S. Farner, King, J.R., Parkes,K.C., Ed.) Academic Press, New York. Palumbi, S. R., And C. S. Baker. 1994. Contrasting population structure from nuclear intron sequences and mtdna of Humpback Whales. Molecular Biology And Evolution 11:426 435. Parker, J. J. 1895. On the cranial osteology, classification, and phylogeny of the Dinornithidae. Tr. Zool. Soc. London Xiii:Pp. 373 431. Parkes, K. C., And G. A. Clark. 19 66. An additional character linking ratites and tinamous, and an interpretation of their monophyly. Condor 68:471. Peters, D. S. 1992b. Messel birds: a landbased assemblage. In Messel: an insight into the history of life and of the earth (S. S. A. W. Zieg ler, Ed.) Clarendon Press, Oxford. Phillips, M. J., F. Delsuc, And D. Penny. 2004. Genome scale phylogeny and the detection of systematic biases. Molecular Biology And Evolution 21:1455 1458. Phillips, M. J., G. C. Gibb, E. A. Crimp, And D. Penny. In Press 2009. Tinamous And Moa flock together: mitochondrial genome sequence analysis reveals indepedent losses of flight among ratites. Systematic Biology. Posada, D., And K. A. Crandall. 1998. MODELTEST: testing the model of DNA substitution. Bioinformatics 14: 817 818. Pycraft, W. P. 1900. On the morphology and phylogeny of the Palaeognathae (Ratitae And Crypturi) And Neognathae (Carinatae). Transactions Of The Zoological Society Of London 15:149 290.

PAGE 43

43 Qiu, Y. L., J. H. Lee, F. Bernasconi Quadroni, D. E. Soltis, P. S. Soltis, M. Zanis, E. A. Zimmer, Z. D. Chen, V. Savolainen, And M. W. Chase. 1999. The earliest Angiosperms: evidence from mitochondrial, plastid and nuclear genomes. Nature 402:404 407. Ronquist, F., And J. P. Huelsenbeck. 2003. Mrbayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19:1572 1574. Shimodaira, H., And M. Hasegawa. 1999. Multiple comparisons of loglikelihoods with applications to phylogenetic inference. Molecular Biology And Evolution 16:1114 1116. Sibley, C. G., And J. E. Ahlquist. 1990. Phylogeny and classification of birds. Yale University Press, New Haven & London. Stamatakis, A. 2006. Raxml -VI HPC: maximum likelihood -based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 22:2688 2 690. Steadman, D. W. 2006. Extinction and biogeography of tropical pacific birds. University Of Chicago Press, Chicago. Swofford, D. L. 2003. PAUP*: phylogenetic analysis using parsimony (*and other methods), Version 4.0. Sinauer Associates, Inc., Sunderla nd, MA. Szatmari, P., and E. J. Milani. 1999. Microplate rotation in northeast Brazil during South Atlantic rifting: Analogies with the Sinai microplate. Geology 27:1115 1118. Thomson, R. C., A. M. Shedlock, S. V. Edwards, And H. B. Shaffer. 2008. Developi ng markers for multilocus phylogenetics in non model organisms: a test case with turtles. Molecular Phylogenetics And Evolution 49:514 525. Van Tuinen, M., C. G. Sibley, And S. B. Hedges. 1998. Phylogeny and biogeography of ratite birds inferred from dna s equences of the mitochondrial ribosomal genes. Molecular Biology And Evolution 15:370 376. Waltari, E., And S. V. Edwards. 2002. Evolutionary dynamics of intron size, genome size, and physiological correlates in archosaurs. American Naturalist 160:539 552. Woolfe, A., M. Goodson, D. K. Goode, P. Snell, G. K. Mcewen, T. Vavouri, S. F. Smith, P. North, H. Callaway, K. Kelly, K. Walter, I. Abnizova, W. Gilks, Y. J. K. Edwards, J. E. Cooke, And G. Elgar. 2005. Highly conserved non coding sequences are associate d with vertebrate development. Plos Biology 3:116 130.

PAGE 44

BIOGRAPHICAL SKETCH Jordan Smith received a bachelors degree, cum laude, in May of 2006. She majored in microbiology and zoology with a minor in chemistry from the University of Florida. In August of 2007, Jordan began graduate school in the Department of Zoology at the University of Florida working with Drs. Edward L. Braun and Rebecca T. Kimball. Jordans thesis research was investigating the evolutionary relationships of paleognath birds, a controversial group important to understanding early avian evolution. In addition, Jordan was a collaborator in investigations of the population genetics of the Brown-headed Nuthatch ( Sitta pusilla ), a locally declining cooperative breeding bird