<%BANNER%>

The Role of Oxygen in Ethylene-Induced Watersoaking in Immature Beit-Alpha Cucumber Fruit

Permanent Link: http://ufdc.ufl.edu/UFE0025024/00001

Material Information

Title: The Role of Oxygen in Ethylene-Induced Watersoaking in Immature Beit-Alpha Cucumber Fruit
Physical Description: 1 online resource (194 p.)
Language: english
Creator: Lee, Eunkyung
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: cucumber, ethylene, hyperoxia, hypoxia, receptors, ros, watersoaking
Horticultural Science -- Dissertations, Academic -- UF
Genre: Horticultural Science thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Watersoaking is an ethylene-induced disorder that affects members of the Cucurbitaceae. Our understanding of the cellular mechanisms contributing to watersoaking is incomplete. This study was conducted to address the role of oxygen in watersoaking using immature beit-alpha cucumber fruit. Ethylene at 10 ?L.L-1 induced watersoaking, and higher concentrations did not accelerate the disorder. At least 4 d of ethylene exposure (10 microL.L-1) induced watersoaking and accompanying symptoms including degreening, softening, and enhanced electrolyte leakage. Continuous ethylene exposure induced accumulation of reactive oxygen species (ROS) at 2-4 d and maximum levels of ethylene receptor transcripts (Cs-ERS, Cs-ETR1, and Cs-ETR2) at 1 d. Histochemical staining revealed that watersoaking appears closely associated with H2O2. Of three ethylene receptor genes, Cs-ETR1 in mesocarp and Cs-ERS in exocarp were the most markedly up-regulated in response to ethylene. Watersoaking in immature cucumber fruit was initiated in hypodermal tissue, followed by ingress to mesocarp. Altered gas-exchange properties of fresh-cut slices did not affect the spatial pattern of watersoaking. The intensity of watersoaking, however, was markedly diminished in slices compared with intact fruit. In intact fruit, hyperoxia (40 kPa O2) accelerated ethylene-induced watersoaking while hypoxia (2 kPa O2) suppressed these symptoms. In fresh-cut slices, ethylene-induced symptoms were negated by hypoxia but unaffected by hyperoxia. Ethylene-mediated increases in H2O2 occurred 2 d earlier than incipient watersoaking under normoxia and hyperoxia, but not hypoxia. O2.- production decreased in ethylene-treated fruit as watersoaking developed. Antioxidant capacity of cucumber fruit increased in response to ethylene at 6 d and 4-6 d in exocarp and mesocarp, respectively. Cucumber fruit preconditioned (2 kPa O2 for 8 d) prior to ethylene exposure under normoxia exhibited softening, ion leakage and tissue disruption, but no watersoaking. Preconditioning reduced ethylene-induced ROS and H2O2 generation. The data collectively show that watersoaking is a tissue-specific ethylene response and total ROS and H2O2 generation capacity appears to contribute to ethylene-induced watersoaking of immature cucumber fruit as influenced by pO2. Transcriptional regulation of ethylene receptors was noted as an early cellular response prior to incipient watersoaking. Up-regulation of ETR1-like receptors could represent a means of offsetting the delirious effects of excess ethylene.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Eunkyung Lee.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Huber, Donald J.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2012-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0025024:00001

Permanent Link: http://ufdc.ufl.edu/UFE0025024/00001

Material Information

Title: The Role of Oxygen in Ethylene-Induced Watersoaking in Immature Beit-Alpha Cucumber Fruit
Physical Description: 1 online resource (194 p.)
Language: english
Creator: Lee, Eunkyung
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2010

Subjects

Subjects / Keywords: cucumber, ethylene, hyperoxia, hypoxia, receptors, ros, watersoaking
Horticultural Science -- Dissertations, Academic -- UF
Genre: Horticultural Science thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Watersoaking is an ethylene-induced disorder that affects members of the Cucurbitaceae. Our understanding of the cellular mechanisms contributing to watersoaking is incomplete. This study was conducted to address the role of oxygen in watersoaking using immature beit-alpha cucumber fruit. Ethylene at 10 ?L.L-1 induced watersoaking, and higher concentrations did not accelerate the disorder. At least 4 d of ethylene exposure (10 microL.L-1) induced watersoaking and accompanying symptoms including degreening, softening, and enhanced electrolyte leakage. Continuous ethylene exposure induced accumulation of reactive oxygen species (ROS) at 2-4 d and maximum levels of ethylene receptor transcripts (Cs-ERS, Cs-ETR1, and Cs-ETR2) at 1 d. Histochemical staining revealed that watersoaking appears closely associated with H2O2. Of three ethylene receptor genes, Cs-ETR1 in mesocarp and Cs-ERS in exocarp were the most markedly up-regulated in response to ethylene. Watersoaking in immature cucumber fruit was initiated in hypodermal tissue, followed by ingress to mesocarp. Altered gas-exchange properties of fresh-cut slices did not affect the spatial pattern of watersoaking. The intensity of watersoaking, however, was markedly diminished in slices compared with intact fruit. In intact fruit, hyperoxia (40 kPa O2) accelerated ethylene-induced watersoaking while hypoxia (2 kPa O2) suppressed these symptoms. In fresh-cut slices, ethylene-induced symptoms were negated by hypoxia but unaffected by hyperoxia. Ethylene-mediated increases in H2O2 occurred 2 d earlier than incipient watersoaking under normoxia and hyperoxia, but not hypoxia. O2.- production decreased in ethylene-treated fruit as watersoaking developed. Antioxidant capacity of cucumber fruit increased in response to ethylene at 6 d and 4-6 d in exocarp and mesocarp, respectively. Cucumber fruit preconditioned (2 kPa O2 for 8 d) prior to ethylene exposure under normoxia exhibited softening, ion leakage and tissue disruption, but no watersoaking. Preconditioning reduced ethylene-induced ROS and H2O2 generation. The data collectively show that watersoaking is a tissue-specific ethylene response and total ROS and H2O2 generation capacity appears to contribute to ethylene-induced watersoaking of immature cucumber fruit as influenced by pO2. Transcriptional regulation of ethylene receptors was noted as an early cellular response prior to incipient watersoaking. Up-regulation of ETR1-like receptors could represent a means of offsetting the delirious effects of excess ethylene.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Eunkyung Lee.
Thesis: Thesis (Ph.D.)--University of Florida, 2010.
Local: Adviser: Huber, Donald J.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2012-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2010
System ID: UFE0025024:00001


This item has the following downloads:


Full Text

PAGE 1

1 THE ROLE OF OXYGEN IN ETHYLENE INDUCED WATERSOAKING IN IMMATURE BEIT ALPHA CUCUMBER FRUIT By EUNKYUNG LEE A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIRE MENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2010

PAGE 2

2 2010 Eunkyung Lee

PAGE 3

3 To my f amily

PAGE 4

4 ACKNOWLEDGMENTS I would like to express my gratitude to my advisor, Dr. Donald J. Huber, for guidance during my pursuit of the Ph.D. degree. His creativities and passion toward science provided motivation in my completion of my graduate studies. I acknowledge the helpful contributions of my graduate committee, Drs. Eduardo Vallejos, Steven Sargent, Jeffrey Brecht, and Maurice Marshall for their productive criticism, comments and suggestions. They were always willing to share their time and their insight for this project. I thank the entire Huber lab for their help and sharing their knowledge. I offer special thanks to James Lee for his professional assistance with lab work and Drs. Jiwon Jeong and Brandon Hurr for their professional assistance and advice. I am especially indebted to Dr. Valeriano Dal Cin for assistance with RNA expression analysis, and Emil Belibasis of Beli Farms for supplying cucumber fruit for this project. I am very grateful to Adrian Berry for being my friend. She provided encouragement and assistance in both my research endeavors and personal life. Sincere gratitude is also expressed to my family for all of their t rust, love and encouragement. My parents always trusted my decisions, supported everything I wanted to do, and provided the foundation to become well educated. They are my driving force. I also appreciate all of the support I have received from my husband, Jin. The work described in this dissertation would not have been completed without his help both in research and in daily life. I would like to thank my lovely daughter, Ellen. She was my joy and strong motivation even in times of frustration and struggle. Lastly, I would like to express my deepest gratitude to my God. This dissertation could not have been completed without the blessings of God.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS .................................................................................................. 4 LIST OF FIGURES .......................................................................................................... 8 ABSTRACT ................................................................................................................... 12 CHA PTER 1 INTRODUCTION .................................................................................................... 14 2 LITERATURE REVIEW .......................................................................................... 1 6 What i s W ater soaking? ........................................................................................... 17 Relationship between E thylene a nd W atersoaking ................................................. 20 Ethylene S ensitivity: R eceptor L evel ....................................................................... 21 Interactions between E thylene and O xygen ............................................................ 26 Reactive O xygen S pecies ....................................................................................... 32 3 THE EFFECT OF EXOGENOUS ETHYLENE ON WATERSOAKING DEVELOPMENT AND ACCUMULATION OF RADICAL OXYGEN SPECIES IN BEIT ALPHA CUCUMBER FRUI T .......................................................................... 36 Introduction ............................................................................................................. 36 Materials and Methods ............................................................................................ 39 Plant M aterials .................................................................................................. 39 Experiment 1. Influence of Ethylene Concentration and Exposure Duration on Watersoaking of Cucumber Fruit .............................................................. 40 Ethylene treatment ..................................................................................... 40 Respiration rate and ethylene production .................................................. 41 Surface color .............................................................................................. 41 Fruit firmness ............................................................................................. 42 Electrolyte leakage ..................................................................................... 42 Experiment 2. The Effects of Exogenous Ethylene on Accumulation of Reactive Oxygen Species ............................................................................. 43 Ethylene treatment ..................................................................................... 43 ROS release from mesocarp disks ............................................................ 43 Histochemical stainin g ............................................................................... 44 Results .................................................................................................................... 45 Experiment 1. The Effects of Ethylene Concentration and Exposure Duration on Watersoaking of Cucumber Fruit ............................................... 45 Experiment 2. The Effects of Continuous Ethylene Exposure on Accumulation of Reactive Oxygen Species ................................................... 50 Discussion .............................................................................................................. 51

PAGE 6

6 4 DIFFERENT ETHYLENE RESPONSES OF INTACT AND FRESH CUT SLICES OF IMMATURE CUCUMBER FRUIT Introduction ............................................................................................................. 70 Materials and Methods ............................................................................................ 73 Plant M aterials .................................................................................................. 73 Exocarp and Mesocarp Color ........................................................................... 74 Mesocarp F irmness .......................................................................................... 75 Electrolyte L eakage .......................................................................................... 75 ROS Release from Mesocarp Disks ................................................................. 76 Results .................................................................................................................... 77 Discussion .............................................................................................................. 82 5 THE EFFECTS OF HYPOXIA AND HYPEROXIA ON ETHYLENEINDUCED WATERSOAKING IN IMMATURE BEIT ALPHA CUCUMBER FRUIT ................. 100 Introduction ........................................................................................................... 100 Materials and Methods .......................................................................................... 103 Plant M aterials ................................................................................................ 103 Electrolyte Leakage ........................................................................................ 104 Mesocarp F irmness ........................................................................................ 104 ROS Release from Mesocarp Disks ............................................................... 105 H2O2 R elease from Mesocarp Disks ............................................................... 106 O2 R elease from Mesocarp Disks ................................................................. 106 Quantification of Ant ioxidant Capacity ............................................................ 107 Results .................................................................................................................. 108 The E ffect of H yperoxia on W atersoaking D evelopment. ............................... 108 The E ffect of H ypoxia on W atersoaking D evelopment. .................................. 111 The E ffect of Preconditioning under Hypoxia on W atersoaking D evelopment. .............................................................................................. 115 Discussion ............................................................................................................ 119 6 THE EFFECT OF EXOGENOUS ETHYLENE ON ETHYLENE RECEPTOR TRANSCRIPTS of immature BEIT ALPHA CUCUMBER FRUIT .......................... 150 Materials and Methods .......................................................................................... 152 Plant Materials ................................................................................................ 152 RNA Extraction and Reverse Transcription .................................................... 153 Semi Quantitative RT PCR ............................................................................ 154 Results .................................................................................................................. 156 Discussion ............................................................................................................ 157 7 CONCLUSIONS ................................................................................................... 163 APPENDIX A T IME COURSE OF DCFH OXIDATION ............................................................... 168

PAGE 7

7 B S TANDARD CURVE FOR DCFH ASSAY ............................................................ 169 LIST OF REFERENCES ............................................................................................. 170 BIOGRAPHICAL SKETCH .......................................................................................... 194

PAGE 8

8 LIST OF FIGURES Figure page 3 1 Watersoaking development of beit alpha cucumber fruit treat ed with air or .L1) at 13 oC. A) At 7 d. B) At 8 d. ............... 59 3 2 Respiration rate of beit alpha cucumber fruit during storage at 13 oC under air or ethylene at 10, 100, 500, or 1000 LL1. ................................................. 60 3 3 Surface hue angle of beit alpha cucumber fruit during storage at 13 oC under air or ethylene at 10, 100, 500, or 1000 LL1. ................................................... 61 3 4 Intact fruit firmness of beit alpha cucumber fruit during storage at 13 oC under air or ethylene at 10, 100, 500, or 1000 LL1. ........................................ 62 3 5 Watersoaking o f beit alpha cucumber fruit treated with air 10 L.L1 ethylene continuously, or stored in air after ethylene exposure for 12 h, 2 d, or 4 d. A) At 6 d. B) At 17 d. ................................................................................ 63 3 6 Surface hue angle of beit alpha cucumber fruit stored in air or 10 L.L1 ethylene continuously, or stored in air after ethylene exposure for 12 h, 2 d, or 4 d. ................................................................................................................. 64 3 7 Mesocarp firmness of beit alpha cucumber f ruit stored in air or 10 L.L1 ethylene continuously, or stored in air after ethylene exposure for 12 h, 2 d, or 4 d. ................................................................................................................. 65 3 8 Electrolyte leakage of mesocarp tissues of beit alpha cucumber fruit stored in air or 10 L.L1 ethylene continuously, or stored in air after ethylene exposure for 12 h, 2 d, or 4 d. ............................................................................................ 66 3 9 Total reactive oxygen species (ROS)generating capacity of beit alph a cucumber fruit stored at 13 o under air or continuous 10 LL1 ethylene. ........... 67 3 10 Localization of H2O2 in crosssection of cucumber fruit stored with/without ethylene (10 L.L1). ............................................................................................ 68 3 11 Localization of O2 in cross section of cucumber fruit stored with/without ethylene (10 L.L1). ............................................................................................ 69 4 1 Watersoaking development of beit alpha cucumber fruit stored at 13 oC. Intact cucumber fruit and freshcut slices were treated for 7 d with air or .L1) under normoxic, hyperoxic, and hypoxic conditions. A) Slices derived from intact fruit. B) Freshcut slices. ....................................... 93

PAGE 9

9 4 2 Watersoaking development of beit alpha cucumber fruit stored at 13 oC. Intact cucumber fruits and freshcut slices were treated for 9 d with air or .L1) under normoxic hyperoxic, and hypoxic conditions. A) Slices derived from intact fruit. B) Freshcut slices. ....................................... 94 4 3 Surface hue angle of beit alpha cucumber fruit during storage at 13 oC under air or 1 0 LL1 ethylene under normoxic, hypoxic, and hyperoxic conditions. A) Slices derived from intact fruit. B) Freshcut slices. ...................................... 95 4 4 Mesocarp hue angle of beit alpha cucumber fruit during st orage at 13 oC under air or 10 LL1 ethylene under normoxic, hypoxic, and hyperoxic conditions. A) Slices derived from intact fruit. B) Freshcut slices. ..................... 96 4 5 Mesocarp firmness of beit alp ha cucumber fruit during storage at 13 oC under air or 10 LL1 ethylene under normoxic, hypoxic, and hyperoxic conditions. A) Slices derived from intact fruit. B) Freshcut slices. ..................... 97 4 6 El ectrolyte leakage of beit alpha cucumber fruit during storage at 13 oC under air or 10 LL1 ethylene under normoxic, hypoxic, and hyperoxic conditions. A) Slices derived from intact fruit. B) Freshcut slices. ..................... 98 4 7 Total ROS generating capacity of mesocarp disks derived from intact or fresh cut slices of beit alpha cucumber fruit stored at 13 oC under air 10 LL1 ethylene. ................................................................................................... 99 5 1 Watersoaking development of beit alpha cucumber fruit stored at 13 oC under normoxia (21 kPa O2) or hyperoxia (40 kPa O2) ethylene (10 LL1) A) At 6 d B) At 8 d. ........................................................................................... 131 5 2 Electroly te leakage of beit alpha cucumber fruit stored at 13 oC under normoxia (21 kPa O2) or hyperoxia (40 kPa O2) ethylene (10 LL1).. .......... 132 5 3 T otal reactive oxygen species (ROS)g enerating capacity of beit alpha cucumber fruit stored at 13 oC under normoxia (21 kPa O2) or hyperoxia (40 kPa O2) ethylene (10 LL1). ......................................................................... 133 5 4 H ydrogen peroxide (H2O2) g enerating capacity of beit alpha cucumber fruit stored at 13 oC under normoxia (21 kPa O2) or hyperoxia (40 kPa O2) ethylene (10 LL1). ......................................................................................... 134 5 5 S uperoxide anion (O2 -) g enerating capacity of beit alpha cucumber fruit sto red at 13 oC under normoxia (21 kPa O2) or hyperoxia (40 kPa O2) ethylene (10 LL1). ......................................................................................... 135 5 6 Antioxidant capacity expressed as TEs ( mol/g FW) of beit alpha cucumber fruit during storage at 13 oC under normoxia (21 kPa O2) or hyperoxia (40 kPa O2) ethylene (10 LL1) A ) E xocarp tissue. B ) Mesocarp tissue.. ......... 136

PAGE 10

10 5 7 Watersoaking development of beit alpha cucumber fruit during storage at 13 oC under normoxia (21 kPa O2) or hypoxia (2 kPa O2) ethylene (10 LL1) A) At 8 d B) At 14 d. ......................................................................................... 137 5 8 Electrolyte leakage of beit alpha cucumber fruit during storage at 13 oC under normoxia (21 kPa O2) or hypoxia (2 kPa O2) ethylene (10 LL1). ...... 138 5 9 T otal reactive oxygen species (ROS)g enerating capacity of beit alpha cucumber fruit stored at 13 oC under n ormoxia (21 kPa O2) or hypoxia (2 kPa O2) ethylene (10 LL1). ................................................................................ 139 5 10 H ydrogen peroxide (H2O2) g enerating capacity of beit alpha cucumber fruit stored at 13 oC under normoxia (21 kPa O2) or hypoxia (2 kPa O2) ethylene (10 LL1). ........................................................................................................ 140 5 11 Superoxide anion (O2 -) generating capacity of beit alpha cucumber fruit stored at 13 oC under normoxia (21 kPa O2) or hypoxia (2 kPa O2) ethylene (10 LL1). ........................................................................................................ 141 5 12 Antioxidant capacity expressed as TEs (mol/g FW) of beit alpha cucumber fruit during storage at 13 oC under normoxia (21 kPa O2) or hypoxia (2 kPa O2) ethy lene (10 LL1). A) Exocarp tissue. B) Mesocarp tissue. ................. 142 5 13 Watersoaking development of beit alpha cucumber fruit stored at 13 oC. A) At 14 d. B) At 16 d Fruit were treated with continuous air (21 kPa O2), hypoxia (2 kPa O2), or transferred to air 10 LL1 ethylene after storage under hypoxia (2 kPa O2) for 8 d. ..................................................................... 143 5 14 Electrolyte leakage of beit alpha cucumber fruit stored at 13 oC. Fruit were treated with continuous air (21 kPa O2) 10 LL1 ethylene, hypoxia (2 kPa O2), or transferred to air 10 LL1 ethylene after storage under hypoxia (2 kPa O2) for 8 d ............................................................................................ 144 5 15 Mesocarp firmness of beit alpha cucumber fruit stored at 13 oC. Fruit were treated with continuous air (21 kPa O2) 10 LL1 ethylene, hypoxia (2 kPa O2), or transferred to air 10 LL1 ethylene after storage under hypoxia (2 kPa O2) for 8 d. ............................................................................................. 145 5 16 Total reactive oxygen species (ROS)g enerating capacity of beit alpha cucumber fruit stored at 13 oC. Fruit were treated with continuous air (21 kPa O2) 10 L L1 ethylene, hypoxia (2 kPa O2), or transferred to air 10 LL1 ethylene after storage under hypoxia (2 kPa O2) for 8 d. .................................. 146 5 17 Hydrogen peroxide (H2O2) g enerating capacity of beit alpha cucumber fruit stored at 13 oC. Fruit was treated with continuous air (21 kPa O2) 10 LL1 ethylene, hypoxia (2 kPa O2), or transferred to air 10 LL1 ethylene after storage under hypoxia (2 kPa O2) for 8 d ......................................................... 147

PAGE 11

11 5 18 Superoxide anion (O2 -) g enerating capacity of beit alpha cucumber fruit stored at 13 oC. Fruit was treated with continuous air (21 kPa O2) 10 LL1 ethylene and hypoxia (2 kPa O2) or transferred to air 10 LL1 ethyle ne after storage under hypoxia (2 kPa O2) for 8 d ................................................. 148 5 19 Antioxidant capacity expressed as TEs ( mol/g FW) of beit alpha cucumber fruit during storage at 13 oC. A ) E xocarp tissue. B ) Mesocar p tissue. Fruit was treated with continuous air (21 kPa O2) 10 LL1 ethylene, hypoxia (2 kPa O2), or transferred to air 10 LL1 ethylene after storage under hypoxia (2 kPa O2) for 8 d ................................................................................ 149 6 1 Gene expression level of ethylene receptors (Cs ERS, Cs ETR1, and Cs ETR2) in mesocarp tissue of immature cucumber fruit stored with air 10 L.L1 ethylene continuously at 13 oC. .............................................................. 161 6 2 Gene expression level of ethylene receptors (Cs ERS, Cs ETR1, and Cs ETR2) in exocarp tissue of immature cucumber fruit stored with air 10 L.L1 ethylene continuously at 13 oC. .............................................................. 162 7 1 Proposed model for watersoaking development in immature beit alpha cucumber fruit .................................................................................................. 167 A 1 Time course of DCFH oxidation by H2O2 (100 and 1000 M). .......................... 168 A 2 A standard curve for DCFH assay was prepared with dilutions of H2O2 (final concentrations of 10, 100, 1000, and 10000 M). ............................................ 169

PAGE 12

12 Abstract of Dissertation Presented to the Graduate School of t he University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy THE ROLE OF OXYGEN IN ETHYLENE INDUCED WATERSOAKING IN IMMATURE BEIT ALPHA CUCUMBER FRUIT By Eunkyung Lee December 2010 Chair: Don ald J. Huber Major: Horticultural Science Watersoaking is an ethyleneinduced disorder that affects members of the Cucurbitaceae. O ur understanding of the cellular mechanisms contributing to watersoaking is incomplete. This study was conducted to address the role of oxyg en in watersoaking using immature beit .L1 induced watersoaking, and higher concentrations did not accelerate the disorder. At least 4 d of ethylene exposure (10 L.L1) induced watersoaking and accompanying symptoms including degreening, softening, and enhanced electrolyte leakage. Continuous ethylene exposure induced accumulation of reactive oxygen species (ROS) at 24 d and maximum levels of ethylene receptor transcripts (Cs ERS, Cs ETR1, and Cs ETR2) at 1 d. Histo chemical staining revealed that watersoaking appears closely associated with H2O2. Of three ethylene receptor genes, Cs ETR1 in mesocarp and Cs ERS in exocarp were the most markedly upregulated in response to ethylene. Watersoaking in immature cucumber f ruit was initiated in hypodermal tissue, followed by ingress to mesocarp. A ltered gas exchange properties of freshcut slices did not affect the spatial pattern of watersoaking The intensity of watersoaking, however, was markedly diminished in slices comp ared with intact fruit. In intact fruit, hyperoxia

PAGE 13

13 (40 kPa O2) accelerated ethyleneinduced watersoaking while hypoxia (2 kPa O2) suppressed these symptoms. In freshcut slices ethyleneinduced symptoms were negated by hypoxia but unaffected by hyperoxia. Ethylenemediated increases in H2O2 occurred 2 d earlier than incipient watersoaking under normoxia and hyperoxia, but not hypoxia. O2 production decreased in ethylenetreated fruit as watersoaking developed. Antioxidant capacity of cucumber fruit incr eased in response to ethylene at 6 d and 46 d in exocarp and mesocarp, respectively. Cucumber fruit preconditioned (2 kPa O2 for 8 d) prior to ethylene exposure under normoxia exhibited softening, ion leakage and tissue disruption, but no watersoaking. Pr econditioning reduced ethyleneinduced ROS and H2O2 generation. The data collectively show that watersoaking is a tissue specific ethylene response and total ROS and H2O2 generation capacity appears to contribute to ethyleneinduced watersoaking of immatu re cucumber fruit as influenced by pO2. Transcriptional regulation of ethylene receptors was noted as an early cellular response prior to incipient watersoaking. Upregulation of ETR1like receptors could represent a means of offsetting the delirious effec ts of excess ethylene.

PAGE 14

14 CHAPTER 1 INTRODUCTION Watersoaking is a major cause of postharvest losses, frequently observed in commodities following storage at chilling temperatures and in freshcut fruit tissues The syndrome is characterized by acute softe ning, tissue translucency, enhanced electrolyte efflux, and cell wall disassembly. Watersoaking is an ethyleneinduced disorder that occurs in members of the Cucurbitaceae including watermelon, cucumber, and cantaloupe melon. Application of 1methylcyclopr opene (1MCP), an inhibitor of ethylene perception, confirmed the involvement of ethylene in the watersoaking disorder. Although both genotype and environmental factors play a role in the development of watersoaking, our understanding of the cellular mecha nisms contributing to the onset and development of watersoaking is incomplete. The present study was conducted to address the role of oxygen in watersoaking development using immature beit alpha cucumber fruit in which exogenous ethylene induces watersoaki ng uniformly and predictably. Cucumber fruit is commercially harvested prior to developmental maturation. Watersoaking development of cucumber fruit is dependent on developmental maturity (Hurr et al., 2009). I mmature fruit (4 6 d after anthesis) showed nearly 100% incidence of watersoaking at 6 d of continuous 10 L.L1 ethylene exposure whereas mature cucumber fruit (1014 d after anthesis) showed a much lower incidence (about 30%). In fruit at more advanced maturity (showing color break due to accumulati on of carotenoid carotene accumulation but did not cause watersoaking. Ethyleneinduced watersoaking in immature cucumber fruit was suggested to represent a form of programm ed cell

PAGE 15

15 death (PCD), supported by loss of cell viability, enhanced nuclease activity and DNA laddering (Hurr et al. 20 10). In this dissertation, C hapter 3 described the influence of ethylene concentration and exposure duration on ethylene responses in im mature cucumber fruit. Characteristic changes in total reactive oxygen species (ROS) upon ethylene exposure were monitored. Chapter 4 addressed the tissue specificity and spatial pattern of watersoaking development. Incipient watersoaking symptoms were fir st evident in hypodermal tissues, followed by ingress to mesocarp tissue. S patial patterns of watersoaking in response to altered gas exchange properties were monitored employing intact and freshcut slices of cucumber fruit. Chapter 5 focused on the role of pO2 in the ontogeny of ethyleneinduced watersoaking i n cucumber fruit. Of special interest was the potential involvement of total ROS, H2O2, and O2 and antioxidant levels in watersoaking development. The effect of preconditioning under hypoxia on sub sequent ethylene responses was also investigated. Chapter 6 addressed the ethyleneinduced c haracteristic changes in expression of three ethylene receptors (Cs ETR1, Cs ETR2, Cs ERS) using semi quantitative RT PCR. This research contributes to the understa nding of cellular and molecular events leading to the development of ethyleneinduced watersoaking in immature beit alpha cucumber fruit

PAGE 16

16 CHAPTER 2 LITERATURE REVIEW Horticultural commodities such as fruit and vegetables are living organisms, having act ive processes even after harvest. I nappropriate handling between harvest and consumption can cause both quantitative and qualitative losses. Qualitative losses including reduced flavor, nutritional value, edibility, and consumer acceptability are more diff icult to measure than quantitative losses (Kader, 2005). The values of postharvest loss are diverse depending on the commodity and countries. Kader (2005) estimated postharvest losses to be the range of 753% in developed countries and 770% in developing countries. In the United States, up to 23% of fruits and 25% of vegetables were lost during postharvest period (Kantor et al., 1997). Annually, U.S. potato industry loses an estimated $300 million due to bruising (Brook, 1996). Blond (1984) estimated posth arvest losses in Egypt to be nearly 20% of fruit and 30% of vegetables. In Venezuela, the estimates of postharvest losses in broccoli and celery were almost 50% (Guerra et al., 1998). The main goal of postharvest research is to maintain qualit y of horticultural crops via minimizing postharvest losses between harvest and consumption. Prevention of postharvest losses can contribute to the reduction of global malnutrition and conservation of natural resources. The most effective tool for maintaining fruit quality is application of proper temperature and relative humidity (RH) during postharvest handling (Kader, 2003). Maintaining cold chain throughout postharvest handling is emphasized to reduce biological deterioration (Kader, 2003). Controlled atmosphere (CA ; low O2 and high CO2) is another postharvest application for long term storage of fruits such as apple and pear (Saltveit, 2003). Study of edible waxing materials and

PAGE 17

17 packaging technologies has been continued to reduce water loss and respiration rate (Kad er, 2003). To extend postharvest life ethylene antagonists such as silver thiosulfate and 1methylcyclopropene (1MCP) have been used in flowers and fruit / vegetables, respectively ( Serek et al., 1994; Sisler and Serek, 1997; Sisler, 2006). Additionally, a dvanced biotechnology and plant breeding tools have provided new cultivars having improved flavor, shelf life, and /or disease resistance. Several factors induce postharvest losses of horticultural crops. The mechanical injury of fruits and vegetables has become a very important problem due to increasing use of mechanical equipment for harvesting, packing and transportation (Brusewitz and Bartsch, 1989; Marshall and Brook, 1999). Sanitation procedures are important to control postharvest diseases (Bartz and Brecht, 2002). P hysiological deterioration due to enhanced respiration rate, transpiration, and ethylene production occurs depending on preharvest and postharvest conditions. Preharvest conditions include climate, water supply, soil fertility, and cultivat ion practice (Ferguson et al., 1999; Mattheis and Fellman, 1999). Storage conditions including temperature, relative humidity, air pressure, and atmospheric composition (mainly O2, CO2, and ethylene) are also able to influence crop deterioration (Kader, 20 03; Kader, 2005). C ommodities stored under injurious temperatures, relative humidity, air pressure, and atmospheric composition (mainly O2, CO2, and ethylene) exhibit physiological disorders such as rapid softening discoloration, surface pitting, and watersoaking (Kader, 2002; Kader, 2003; Burg, 2004a) What i s W ater s oaking? Watersoaking is one of the major causes of postharvest losses, frequently observed in ripe and over ripe fruit, in commodities stored at chilling temperature

PAGE 18

18 (Jackman et al., 1992; Fe rnandez Trujillo and Artes, 1998; Karakurt and Huber, 2003; Cho et al., 2008) and in freshcut fruit tissues (Hong and Gross, 1998; Agar et al., 1999; Aguayo et al., 2004; Jeong et al., 2004 ; Ergun et al., 2007; MonteroCalderon et al., 2008). Chen and Paull (2000) reported that highly translucent pineapple has flat and off flavors, and lower edible quality. In watermelon, watersoaking is characterized by an alteration of flesh texture, enhanced electrolyte efflux, degradation of pectic polymers, cell separ ation, and loss of cell wall rigidity (Elkashif and Huber, 1988a, 1988b). Although this disorder was not induced by anaerobic conditions in netted melon, water soaked tissues exhibited decreased sucrose accumulation in the flesh and increased odors of ferm entation (Nishizawa et al., 2002). It is often difficult to detect the disorder upon casual observation since, for example, in cantaloupe and watermelon, watersoaking is largely restricted to internal tissues ( Karakurt and Huber, 2002; Madrid et al., 2004) Watersoaking in watermelon is believed to represent a stress response or disorder unrelated to normal ripening based on the report (Karakurt and Huber, 2002) that the disorder was induced by ethylene in both immature and fully ripe fruit and that watermelon fruit typically do not exhibit watersoaking during normal development. Both genotype and environmental factors play a role in the development of watersoaking (Hiraishi, 1972); however, the cellular events leading to the disorder remain unknown. Water soaked tissues are collapsed and have large intercellular spaces. Using scanning microscopy and analysis of water mobility via NMR imaging, du Chatenet et al. (2000) showed larger intercellular space in water soaked mesocarp tissue of melon fruit. These obs ervations suggest that liquidfilled intercellular space may be induced through enhanced water movement into the apoplast, possibly caused

PAGE 19

19 by sugar induced solute potential gradients between the symplast and the apoplast. T he modification in the permeabili ty of membrane and/or cell wall could play a role in watersoaking development by leading to the invasion of the intercellular space by cell liquid and solutes. Altered permeability could selectively enhance or suppress the activity of preexisting cell wall hydrolases (Karakurt and Huber, 2002; Mao et al., 2004), for example via altered apoplastic pH or ion composition (Almeida and Huber 1999; Huber et al., 2001). The increased activity and transcript abundance of polygalacturonase (PG) in ethylenetreated w atermelon fruit with the onset and development of the water soaking disorder indicates that catabolic reactions targeting the cell walls may contribute to the disorder (Karakurt and Huber, 2004). However, these changes are noted rather late during ethylene exposure, and following visible signs of the disorder (Karakurt and Huber, 2002). Reports that electrolyte leakage increased relatively early ( < 48 h) in watermelon fruit in response to ethylene (Elkashif and Huber, 1988b) suggested that enzymes targeting cell membranes are involved in development of the disorder. Mao et al. (2004) reported increased lipoxygenase (LOX), phospholipase C (PLC), and phospholipase D (PLD) activities increased phosphatidic acid (PA) and decreased phosphatidylcholine (PC) and phosphatidylinositol (PI) levels early in the development of watersoaking in ethylenetreated watermelon fruit. These trends indicate that lipid catabolism contributes to the development of the watersoaking disorder. Metabolites of lipid degradation includ ing peroxidative products have been implicated in senescence and programmed cell death through in hibition of protein function and propagation of radical species (Hildebrand, 1989; Avdiushko et al., 1993). Membrane dysfunction and cell leakage

PAGE 20

20 could also in fluence cell wall metabolism indirectly through ionor pH mediated activation or inhibition of specific hydrolases (Almeida and Huber, 1999; Huber et al., 2001). Relationship between E thylene and W atersoaking The relationship between watersoaking and ethylene has been thoroughly studied in watermelon. Ethylene treatment of healthy watermelon fruit induced the development of softening and incipient watersoaking in placental tissue in as few as 3 d ays (Elkashif and Huber, 1988a, 1988b; Mao et al., 2004). A pplication of 1methylcyclopropene (1MCP), a potent ethyleneaction inhibitor ( S isler 2006), confirmed the inductive role of ethylene in the watersoaking disorder. 1MCP treatment at 5 L.L1 for 18 h completely prevented the development of watersoaking in watermelon, even in fruit challenged with continuous ethylene for 8 d (Mao et al., 2004). Jeong et al. (2004) also found that watersoaking in freshcut tomato was a senescenceand possibly ethylenerelated response. du Chatenet et al. (2000), however, reported that watersoaking in cantaloupe melons during late ripening was not caused by ethylene based on the observation that 1 MCP did not prevent the disorder. Although vitrescence in melon appears at the beginning of the climacteric, Madrid et al. (2004) commented that there was no relationship between the disorder and ethylene based on the ethylene production trends by fruit from plants grown in both perlite and rockwool. It seems evident that watersoaking phenomena occur via different mechanisms in dif ferent commodities. The responses of immature cucumber fruit to ethylene parallel those reported for other members of the Cucurbitaceae, most notably watermelon. It is difficult to reconcile whether tissue watersoaking in cucumber fruit is caused by or si mply contributes to the extensive pectin degradation occurring in response to ethylene. Other fruits show

PAGE 21

21 similar degrees of pectin breakdown but show no overt evidence of watersoaking (Huber et al., 2001). Another factor possibly contributing to the water soaking phenomenon in cucumber fruit may involve ethyleneinduced membrane permeability changes. The response of watermelon fruit to ethylene seems to be unrelated to fruit maturity (Karakurt and Huber, 2002); however, cucumber fruit of different maturity stages showed markedly different symptom upon ethylene exposure. W atersoaking was observed in immature (4 6 d after anthesis) and to a lesser extent in mature cucumber fruit (10 14 d after anthesis), while chlorophyll degradation and massive accumulation o f carotene without this disorder were observed in fruit of more advanced maturity (Hurr et al. 200 9 ). Ethyleneinduced watersoaking in immature cucumber fruit was suggested to represent a form of programmed cell death (PCD ) (Hurr et al., 2010). Hallmar ks of PCD such as loss of cell viability, enhanced nuclease activity and DNA laddering were observed in ethylenetreated immature cucumber fruit. Several studies have revealed an involvement of ethylene in development of plant PCD during the hypersensitive response (Ciardi et al., 2001; Trobacher, 2009), aerenchyma formation (Drew et al., 2000), and senescence and abscission processes (Chandlee, 2001; Rogers, 2006; Chaves and de MelloFarias, 2006; Lerslerwong et al., 2008). Ethylene binding induces ethylene signaling pathways, leading to activation of PCD related genes and accumulation of cytosolic Ca2+ and reactive oxygen species (ROS) to promote PCD (Trobacher, 2009). Ethylene S ensitivity: R eceptor L evel Ethylene is a gaseous phytohormone influencing diverse development processes including seed germination, root initiation, abscission, fruit ripening, sex determination,

PAGE 22

22 and senescence (Abeles et al., 1992; Kieber, 1997; Lin et al., 2009). Ethylene can function in response to biotic and abiotic stresses inc luding pathogen attack, flooding, low temperatures, light, and wounding (Abeles et al., 1992; Lin et al., 2009) and can diffuse into and throughout plant tissues (Mattoo and Suttle, 1991). The effect of ethylene is influenced by development stage, and ethy lene concentration and exposure duration (Abeles et al., 1992; Saltveit, 1999). Ethylene action initiates with binding of ethylene to a family of endoplasmic reticulum ( ER ) associated receptors including ETR1like family and ETR2like family (Klee 2002; Hall et al., 2007) Ethylene receptors are similar to twocomponent histidine kinases (HKs) found in bacteria (Schaller and Bleecker, 1995). ETR1like receptors including ETR1 and ERS1 consist of five subdomains essential for HK activity while ETR2 like rece ptors lack at least one of these subdomains (Hall et al., 2007). Ethylene binding occurs at the N terminal transmembrane domain of the receptors, and a copper co factor is required for binding (Rodriguez et al., 1999). E thylene receptor regulatory genes, R EVERSION TO ETHYLENE SENSITIVITY1 (RTE1) and GREEN RIPE (GR), were reported in Arabidopsis and tomato, respectively (Barry and Giovannoni, 2006; Resnick et al., 2006). RTE1 and GR are negative regulators of ethylene signaling. RTE1 could regulate only a subset of etr1 alleles but there was no direct correlation between rte1 suppression and ethylene binding ability of etr1 alleles, indicat ing a role of RTE1 in conformational changes of the ETR1 receptor upon ethylene binding (Resnick et al., 2008). GR was al so capable of modulating the signal output of specific ethylene receptors in a tissuespecific manner (Barry and Giovannoni, 2006). Ethylene binding to receptors releases the negative regulator, which results in the signal transduction chain

PAGE 23

23 leading to the activation of transcription factors and the ethyleneresponsive genes (Bleecker et al., 1998; Chang, 2003). CTR1 is a downstream component of receptors. In the absence of an ethylene signal, ethylene receptors activate CTR1, and then CTR1 in turn negativ ely regulates the ethylene signaling pathway through a MAP kinase cascade (Kieber et al., 1993). Other d ownstream components in the ethylene pathway include several positive regulators (EIN2, and EIN 5 ) and transcription factors (EIN3, EIL1 and ERF1) locat ed in the nucleus (Chao et al., 1997; Trobacher 2009). The inhibitory effect of CTR1 on activity of EIN2, a downstream component, could be relieved by ethylene binding (Hall et al., 2007). EIN2 level is regulated by two F box proteins, ETP1 and ETP2. Ethyl ene binding reduced the levels of ETP1 and 2, inhibiting EIN degradation by ETP1 and 2 (Qiao et al., 2009). EIN3 a transcription factor, binds to the promoter of ERF1 gene and activates its transcription in an ethylenedependent manner (Solano et al., 1998). The level of EIN3 protein is controlled by ethylene via the ubiquitin/prote o some pathway mediated by two F box proteins EBF1 and EBF2 (Guo and Ecker, 2003). EIN5, a 5 3exoribonuclease, degrades EBF1 and EBF2, resulting in accumulation of EIN3 (Olmed o et al., 2006). Transcription factors ERF1 and other Ethylene Response Element Binding Protein (EREBPs) interact with the GCC box a cis element in the promoter of ethyleneresponsive genes and activate downstream ethylene responses (Wang and Ecker, 2002) Branch points in the ethylene response pathway may lie downstream of EIN3/EIL1. EREBPs may integrate ethylene responses with developmental signals and/or other hormone signals (Guo and Ecker, 2004; Li and Guo, 2007).

PAGE 24

24 Variation in ethylene sensitivity dur ing plant tissue maturation and development (Yang, 1987; Alexander and Grierson, 2002) may depend upon the levels of these ethylene receptors and downstream components. Since ethylene receptors function as negative regulators, there is an inverse correlati on between receptor levels and ethylene sensitivity; an increase in the level of receptors causes an increase in the threshold for initiating ethylene response, allowing decreased sensitivity (Klee, 2004). Based on the previously mentioned ethyleneregulat ion model, increased ethylene sensitivity in mature or ripening fruits could be explained by a significant decrease in receptor level. However, tomato and other climacteric fruits exhibit a marked increase in the expression of ethylene receptor genes during ripening (SatoNara et al., 1999; El Sharkawy et al., 2003; Klee, 2004). This paradox could be explained by the inconsistency between RNA and protein levels. In tomato fruit, accumulation of receptor mRNAs was greatly enhanced at the onset of ripening while receptors protein levels were highest in immature fruit and decreased at the onset of ripening (Kevany et al., 2007). 26S proteasome is involved in degradation of receptor proteins, which was confirmed by inhibitory effect of MG132 (a peptide aldehyde; an inhibitor of 26 S proteasome activity) (Kevany et al., 2007). 1MCP treatment of maturegreen tomato prevented both ripening and degradation of ethylene receptor proteins (Kevany et al., 2007). Different expression patterns of the receptor gene family can provide another explanation for changes in ethylene sensitivities in different tissues at different developmental stages (Wilkinson et al., 1995; Payton et al., 1996; Hua et al., 1998; Sato Nara et al., 1999; Tieman and Klee, 1999). The ethylene recep tors are differently

PAGE 25

25 regulated by ethylene and by other developmental factors. Transcription of receptors ERS1, ERS2, and ETR2 was regulated by ethylene itself (Hua and Meyerowitz ., 1998). Wilkinson et al. (1995) reported that NR mRNA is positively regulat ed by ethylene in a development specific manner. The effect of different expression patterns on ethylene sensitivity could be explained by different contributions of different receptor genes to ethylene signaling. The ETR1 like group is more important than the ETR2 like group in determining ethylene responses (Wang et al., 2003; Guo and Ecker 2004; Hall et al., 2007). The loss of the primary receptors including ETR1 and ERS1 would increase ethylene sensitivity more greatly than other receptors (Clark et al. 1998). Higher signals of ERS1 were reported in young and developing tissue than in older tissues of melon and Arabidopsis (Hua et al., 1998; SatoNara, 1999), which reduced sensitivity to ethylene. Functional redundancy within receptor genes might be explained by interactions with downstream components. CTR1 binds more strongly to ETR1like receptors than ETR 2 like receptors (Guo and Ecker, 2004). Compensation responses (increased transcripts of remaining receptors to compensate for missing receptors) were observed in loss of function mutations but there was a difference in phenotype, indicating specialized roles of receptor members in signal output (OMalley et al., 2005). Proteosomal degradation of transcription factors, especially by 26S, might also p lay a role in tissuespecific ethylene responses (Trobacher, 2009). In nonsensitive tissue, transcription factors responsible for ethylene response might be degraded by some mechanism to block the undesired ethylene response. Trobacher (2009) proposed that other plant hormones such as abscisic acid (ABA) and cytokinins could inhibit ethyleneinduced PCD through enhanced degradation of transcription factors.

PAGE 26

26 Interactions between ethylene and other phytohormones have been extensively reviewed by Wang et al. (2002) and Yoo et al. (2009). Interactions between E thylene and O xygen Oxygen (O2) is the terminal electron acceptor in the oxidative phosphorylation pathway, supplying ATP for cellular metabolism by regenerating NAD from NADH (Geigenberger, 2003) O2 is also essential in several cellular pathways such as heme, sterol, fatty acid, and ethylene biosynthesis (Geigenberger, 2003) Interc ellular O2 concentration is determined not only by the atmospheric O2 concentration bu t also O2 consumption rate, intercellular resistance to gas diffusion, and the porosity and gas exchange resistance of tissue surface (Burg, 2004). Since p lants do not have efficient systems for O2 delivery r e entry of O2 into hypoxic or anoxic plant tissues leads to the formation of potenti ally harmful reactive oxygen species inducing rapid oxidative damage ( Crawford and Braendle, 1996; Biemelt et al., 1998) pO2 is an important factor controlling the postharvest physiology of commodities. Generally, hypoxic environments (lower than 21 kPa O2) induce beneficial reactions including reductions in respiration rate, ethylene synthesis and perception, chlorophyll degradation, cell wall degradation, and phenolic oxidation ( Mir and Beaudry, 2001 ; Burg, 2004). Reduction of respiration reduces the r ate of deterioration of fruits and vegetables, extending storage life (Burton, 1974; Herner, 1987). Decreased respiration under hypoxia was observed in avocado fruit (Solomos and Kanellis, 1989; Metzidakis and Sfakiotakis, 1995), broccoli buds (Makhlouf et al., 1989), tomato fruit (Kim et al., 1999), and freshcut bell pepper (Conesa et al., 2007) Under 5 7 kPaO2, e thylene production in intact fruits including apple and avocado declined by 50% ( Abeles et al. 1992) Under hypoxic conditions (2.5 kPa O2), t he activities of PG, acid phosphatase,

PAGE 27

27 and cellulase in banana and avocado fruit were suppressed compared with those of air treated fruit (Kanellis et al., 1989; Metzidakis and Sfakiotakis, 1995). The effect of hyperoxic conditions (higher than 21 kPa O2) on the respiration rate and ethylene production was various depending on the commodity, ripening stage, O2 level, storage time and temperature ( Kader and BenYehoshua, 2000) Under increased pO2, O2 can enhance the production of ROS, inhibiting various met abolic activities and leading to deterioration of produce quality (Kader and BenYehoshua, 2000). In contrast, hyperoxic conditions have been suggested as a viable decay control alternative to pesticides, as well as an improvement over traditional MA treat ments that use elevated pCO2 and/ or reduced pO2 (Day, 1996). M ycelia growth rate in strawberry fruit was decreased by increasing pO2 (Wszelaki and Mitcham, 2000). Interactions between O2 and ethylene have been shown to play a role in the regulatory control of ripening (Altman and Corey, 1987). Elevated pO2 ( 60 or 100 kPa O2) hastened softening and ripening in 1MCP treated banana fruit (Jiang and Joyce, 2003). In grapes hyperoxia (80 kPa) suppressed softening and reduced galactosi dase, and cellulase activities (Deng et al., 2005). H ypoxia delayed ethylene or propyleneinduced ripening in avocado (Metzidakis and Sfakiotakis, 1995 ) banana (Hesselman and Freebain, 1969 ; Kanellis et al., 1989) kiwi ( Stavroulakis and Sfakiotakis, 1997) and tomato fruits (Kapotis et al., 2004). B anana and avocado fruit subjected to hypoxic conditions (2.5 kPa O2) showed lower PG, acid phosphatase, and cellulase activities compared with air treated fruit (Kanellis et al., 1989; Metzidakis and Sfakiotakis 1995). Low O2 prevented the rise in acid phosphatase

PAGE 28

28 activities and this suppression was not circumvented by subsequent application of 2.5 kPa O2 containing 100 L.L1 ethylene (Kanellis et al., 1989). The suppressing effect of low O2 on enzymic activit ies might be mediated through a decrease in the rate of production of metabolic energy as a result of the decrease in respiration. However, Beaudry (1999) noted that the retarding effect of low O2 may be explained by an attenuation of the biological efficacy of ethylene because this decrease in respiration may not reflect a restriction of the electron transport chain regarding high O2 affinity of the cytochrome oxidase (Kanellis et al., 1989). Burg (2004) explained the decreased response to ethylene at reduced pO2 as coupling activation. This concept is supported by the binding of O2 to ironcontaining cytochrome and copper containing oxidases, by carbon monoxides high affinity for both the copper containing ethylene receptor and cytochrome oxidase, and by the ability of CO2 to inhibit the binding of O2 to cytochrome oxidase. A report that avocado fruit soften very slowly when exposed to 130 L.L1 propylene (an ethylene analogue) in 2 pKa O2, and negligibly at 1 pKa O2 is consistent with a coupling activation (Burg, 2004). Burg and Burg (1967) provided evidence that for ethylene to exert its biological effects, O2 is required. A synergistic effect of O2 and ethylene was observed in ragweed seeds. Application of ethylene (10 L.L1) in 100 kP a O2 gave 71.3% germination after 2 weeks of treatment, while ethylene in air or no ethylene in 100 kP a O2 resulted in 41.3% and 11.3% germination, respectively (Brennan et al., 1978). These results are similar to other ethyleneO2 interactions. In potato tubers, ethylene triggered a respiratory upsurge (Reid and Pratt, 1972) that was markedly enhanced by high O2 tensions, while O2 alone had little or no effect (Chin and Frenkel, 1977). In the nonripening rin tomato mutant, ethylene was

PAGE 29

29 used to initiate the synthesis of lycopene but O2 concentration was rate limiting (Frenkel and Garrisoni, 1976). It appears that some of the processes that are initiated by ethylene and stimulated by O2 might reflect oxygen utilization through the formation of peroxides. Kidd and West (19 34) suggested that the beneficial effects of reduced O2 on the longevity of climacteric fruits might be related to its interference with ethylene production. Hypoxia reduced synthesis of and sensitivity to ethylene (Mir and Beaudry, 2001). Abeles et al. (1 992) reported that the range of 5 to 7 kPa O2 reduced ethylene production by 50% in several intact fruits. Reductions in the steady state levels of mRNAs for genes involved in ethylene synthesis were also induced by low O2 ( 5 kPa ) (Geigenberger, 2003) and ethylene production of propylenetreated avocado fruit was delayed by low O2 (1 and 2 kPa) (Metzidakis and Sfakiotakis, 1995). In kiwifruit, O2 was found to control ethylene biosynthesis through altering 1aminocyclopropane1 carboxylic acid (ACC) producti on, which appears to be the limiting factor in autocatalytic ethylene production under low O2 atmospheres Inhibition of ACC synthase (ACS) activity was reported in apples stored at 2 4 kPa O2 (Bufler and Bangerth, 1983; Gorny and Kader, 1996) and kiwi fru it treated with 130 L.L1 propylene under O2 levels of 10 kPa and lower (Stavroulakis and Sfakiotakis, 1997). However, the production of ACC is not the limiting factor in ethylene production of certain crops under low O2. S t imulated ACC content and ACS ac tivity were reported in t omato roots and leaves grown under low O2 (by N2 flush through growth solution) (Wang and Arteca, 1992). A pple fruit treated with 1.7 kPa O2 for 6 h exhibited much higher ACC content than air treated fruit, indicating that low O2 i nhibited the conversion of ACC to ethylene by ACC oxidase

PAGE 30

30 (ACO) (Li et al., 1983) Decreased ACO activity appears to be an important cause of decreased ethylene production under hypoxia since O2 is a co substrate for the enzyme ( Ververidis and John, 1991; Dong et al., 1992; Sairam et al., 2008) Km values for O2 are 0.4 and 0.44~0.53 kPa in ACO purified from apple (Kuai and Dilley, 1992) and pear fruit (Vioque and Castellano, 1994; Kato and Hyodo, 1999), respectively. Storage below 5 kPa O2 could inhibit ACO activity since internal pO2 is much lower than external pO2 due to gas diffusion barriers. Redripe tomato fruit stored under 4 kPa O2 exhibited 0.2 kPa internal pO2 (Berry and Sargent 2009). Reduced ACO activity was observed in broccoli flo wer buds stored at 2.5 kP a O2 (Makhlouf et al., 1989) Undetectable amounts of ACO protein were reported in apple fruit treated with 2 kPa O2 for 2 months while air treated fruit had large amounts of ACO protein (Gorny and Kader, 1999). O2 has been reported to exert an effect on ethylene perception (Burg and Burg, 1967). Beaudry (1999) proposed that the interactions between O2 and ethylene might be consistent with an enzyme kinetic model, in which a substrate (O2) must bind to a receptor before a dissociable activator (ethylene) can attach. Since O2 is required for ethylene action (Beaudry, 1999), it is a reasonable assumption that the suppressing effects of low O2 on fruit softening reflect an attenuation of ethylene action. O2 depletion reportedly reduces ethylene sensitivity in fruits (Kidd and West, 1945), and Burg and Burg (1967) observed a similar effect with pea stem sections. Five percent O2 apparently did not alter O2 consumption (Eichenberger and Thimann, 1957), stem elongation, or CO2 production (Hackett and S chneiderman, 1953) but markedly reduced ethylene effectiveness as measured with pea growth inhibition (Burg and Burg, 1967). Solomos and Kanellis (1989) mentioned that low O2 might interfere with the action of

PAGE 31

31 ethylene by affecting metabolic processes whic h lead to an increase in ethylene receptors. Enhancedsoftening of 1 MCP treated banana fruit in response to elevated pO2 ( 60 and 100 kPa) may reflect the synthesis of new receptors (Jiang and Joyce, 2003). In maize leaf, low O2 (3 kPa ) caused a 15fold in crease in accumulation of RP ERS1 after 24 h treatment (Sachs et al., 1996). It is unclear how the concentration of O2 affected gene expression, but it is evident that a number of physiological changes take place in the cell under low O2 atmosphere (Sachs et al., 1996). O2 might also affect plant metabolism related with ethylene. Burg (2004) proposed that binding of ethylene to its receptor occurs in the total absence of O2. Afterward, the ethylenereceptor complex interacts with a ratelimiting reactant t hat imparts specificity to the ethylenereceptor complex when it elicits a biological response. O2 may be essential for this step or later steps of transduction and response. Theologis and Laties (1982) noted that the effectiveness of high concentrations o f O2 in synergizing ethylene action might be induced by the involvement of O2 in a high Km process other than respiration per se based on the response to elevated O2 or to peeling. It seems that a bimolecular reaction, in the catalytic sense, between O2 an d ethylene might influence gene expression during fruit ripening. Low O2 not only suppressed the induction of new polypeptides associated with normal ripening, but also induced the accumulation of unique polypeptides. The suppression of a number of other polypeptides in response to low O2 environments may be a result of either suppression of translation due to the dissociation of polysomes, as was reported for soybeans (Lin and Key, 1967) and maize (Sachs and Ho, 1986), or repression of the expression of mR NA (Sachs and Ho, 1986;

PAGE 32

32 Kanellis, 1987), or both (Laemmli, 1970). In avocado fruit, 2.5 kPa O2 prevented the rise in total cellulase protein and its transcript during ripening (Solomos and Kanellis, 1989). Reactive O xygen S pecies Ground state or triplet O2 is converted to the much more reactive oxygen species (ROS) either by energy transfer or electron transfer (Klotz, 2002). The former leads to the formation of singlet forms of O2, whereas the latter results in the sequential reduction to superoxide, hydr ogen peroxide, and hydroxyl radical (Klotz, 2002). In plants, ROS are continuously produced as by products of various metabolic pathways localized predominantly in chloroplasts, mitochondria, and peroxisomes (Foyer and Harbinson, 1994; Circu and Aw, 2010). P lasma membranebound NADPH oxidases, cell wallbound peroxidases and amine oxidases in the apoplast are involved in ROS production of plant cells (Mittler et al., 2004). Plants generate ROS via activating various oxidases and peroxidases in response to environmental changes (Bolwell et al., 2002), mainly in chloroplasts and mitochondria at the sites of electron transport (Apel and Hirt, 2004). Some of the oxidative and antioxidative activities have been detected in the apoplastic space (Ogawa et al., 199 6; Duran and Bujan, 1998; Vanacker et al. 1998) suggesting that these activities in the apoplast have important roles in causing or alleviating tissue damage. Depending on the character of abiotic stresses plants differentially enhance the production of ROS that are chemically distinct and/ or are produced within different cellular compartments (Elstner, 1991). Biological organisms attempt to maintain homeostatic equilibrium between production and scavenging of ROS. Oxidative damage could be inhibited by direct quenching of ROS or through disruption of free radical propagation reactions (Alscher and Hess, 1993). ROS could act as signals to activate antioxidant systems (Mittler,

PAGE 33

33 2002). Plants have nonenzymatic and enzymatic ROS scavenging mechanisms (Apel a nd Hirt, 2004). Nonenzymatic antioxidants include the major cellular redox buffers ascorbate and glutathione (GSH), as well as tocopherol, flavonoids, alkaloids, and carotenoids. Enzymatic ROS scavenging mechanisms in plants include superoxide dismutase (S OD), ascorbate peroxidase (APX), glutathione peroxidase (GPX), and catalase (CAT). Geigenberger (2003) reported that low O2induced genes encoding peroxidase, monodehydroascorbate reductase, APX GPX and SOD are involved in detoxification of ROS. Th e bala nce between production and scavenging of ROS can be distur bed under extreme stress environments including high light, drought, temperature extremes, and mechanical stress (Malan et al., 1990; Elstner, 1991; Prasad et al., 1994 ; Hodges et al., 2004). The re sponse of antioxidative systems to oxidative stress during postharvest storage was various depending on commodities and/or cultivars, indicating the complexity of antioxidant system s to oxidative stress ( Hodges et al., 2004) ROS generation occurs in cellular compartments including mitochondria, peroxisomes, or chloroplasts ROS results in changes of the nuclear transcriptome, indicating that signals are transmitted from these organelles to the nucleus. The signal ing pathway remains unidentified. There are several way s through which ROS could affect gene expression. ROS receptors could be activated to induce signaling transduction pathways that eventually interrupt gene expression (Apel and Hirt, 2004). In mammalian cells, death receptors such as Fas TNFR (tumor necrosis factor receptor), and TRAIL (TNF related apoptosis inducing ligand) have been shown to mediate apoptosis (cell death) (Circu and Aw, 2010). In plants, ROS receptors remain unidentified. ROS receptors in plant might be twocomponent h istidine kinases,

PAGE 34

34 activating Calmodulin and a MAPK cascade and then regulating transcription factors (Mittler et al., 2004). Alternatively, components of ROS signaling pathways could be directly oxidized by ROS (Apel and Hirt, 2004). For example, ROS oxidized glut athione (GSH) to glutathione disulfide (GSSG), resulting in induction of cellular oxidative damage (Schafer and Buettner, 2001). Excessive ROS in mitochondria, a major ROS generator, could result in damage to mitochondrial DNA, triggering apoptosis (Circu et al., 2009; Rachek et al., 2009). Finally, ROS might alter gene expression by modifying the activity of transcription factors. The expression of several transcription factors such as WRKY, Zat, RAV, GRAS and Myb families is regulated by ROS (Mittler et a l., 2004). Oxygen radicals and hydrogen peroxide are highly reactive and destructive, shown to cause membrane lipid peroxidation and to enhance membrane leakage and tissue deterioration (Dhindsa et al., 1981; Fridovich, 1986; Moran et al., 1994; Rao et al ., 2000; Overmyer et al., 2003; Circu and Aw, 2010). Excessive ROS was shown to trigger PCD in plants ( Desikin et al. 2001 ; Rao and Davis, 2001; Mur et al., 2005). On the other hand, ROS can drive oxidative cross linking of cell wall components and activa te a range of defense mechanisms, protecting against invading microorganism s (Lamb and Dixon, 1997; Mittler 2002; Mittler et al, 2004; Circu and Aw, 2010). It has been demonstrated in several systems that NAD(P)H oxidase is a plasma membranebound enzyme that generates superoxide radicals that are active in the extracellular space (Bolwell et al., 1999). It has been postulated that this activity may have important roles in mediating several important responses such as hypersensitivity to pathogen invasion, xylem thickening and programmed cell death (Levine et al., 1994; Mehdy et al., 1996; Barcelo, 1998; Mittler et al., 2004 ).

PAGE 35

35 Reactive oxygen species (ROS) can control ethylene signaling directly or indirectly (Overmyer et al., 2003). Significant crosstalk between ROS and ethylene plays an important role in responding to biotic and abiotic stress (Overmyer et al., 2003; Kwak et al., 2006; Parent et al., 2008). ROS have been shown to trigger programmed cell death (PCD) in plants (Desikin et al., 2001; Rao and Davis, 2001; Overmyer et al., 2003; Mur et al., 2005; van Breusegem and Dat, 2006; Gadjev et al. 2008). Several studies have also revealed an involvement of e thylene in pla nt PCD ( Ciardi et al., 2001; Chandlee, 2001; Rogers, 2006; Chaves and de MelloFar ias, 2006; Lerslerwong et al., 2008; Trobacher, 2009). T he accumulation of ROS during ethylene exposure may be able to induce PCD, or vice versa. Watersoaking is a major cause of postharvest losses, but our understanding of the cellular mechanisms contributing to the onset and development of watersoaking is incomplete. Since exogenous ethylene induces watersoaking uniformly and predictably (Lima et al., 2005; Hurr et al., 2009), immature beit alpha cucumber fruit could be employed as a model system to study cellular events leading to watersoaking. In the present study, analyses of watersoaking were performed using beit alpha mini cucumber. Emphasis was on chara cterizing the relationships between ethylene, ethylene transcript abundance, pO2 and ROS on the induction and development of the watersoaking.

PAGE 36

36 CHAPTER 3 THE EFFECT OF EXOGEN OUS ETHYLENE ON WATE RSOAKING DEVELOPMENT AND ACCUMULATION OF RADICAL OXYGEN SPECIES IN BEIT ALPHA CUCUMBER FRUIT Introduction Watersoaking is the appearance of tissue translucenc y, vitrescence, watercore, or glassiness. This disorder is a significant cause of postharvest losses, frequently observed in commodities following storage at chilling temperatures ( Fernandez Trujillo and Artes, 1998; Karakurt and Huber, 2002; Cho et al., 2008 ) ethylenetreated fruit (Bernadac et al., 1996; Lima et al.; 2005; Mao et al., 2004; Hurr et al.,2009), and freshcut fruit tissues ( Agar et al., 1999; Aguayo et al., 2004; Jeong et al., 2004; Ergun et al., 2007; MonteroCalderon et al., 2008). Charac teristics of water soaked tissues are acute softening, enhanced electrolyte efflux, loss of flavor, and cell wall disassembly (Bauchot et al., 1999; Karakurt and Huber, 2002; Jeong et al., 2004; Lima et al., 2005; Mao et al., 2004; Nishizawa et al., 2002). Water soaked tissues apparently arise from liquid suffusion into intercellular air space s, result ing from modifications in the permeability of membrane and/or cell wall ( Chen and Paull, 2000; du Chatenet et al. 2000) .Degradation of cell wall and/or memb rane has been reported to contribute to the disorder. E thylenetreated watermelon fruit exhibited an increase in polygalacturonase (PG) activity (Karakurt and Huber, 2004) as well as increases in lipoxygenase (LOX), phospholipase C (PLC), phospholi pase D (PLD) activities along with the onset and development of the watersoaking disorder ( Mao et al. 2004). However, knowledge about the early cellular events leading to the disorder remains incomplete. Stud ying the physiological mechanisms of tissue watersoak ing has been limited due to the inability to induc e the

PAGE 37

37 disorder experimentally in a predictable and consistent manner. Recently, our lab has demonstrated that immature beit alpha cucumber fruit (cv. Manar) can serve as a model system to study watersoaking disorder ( Hurr et al., 2009). Watersoaking can be induced uniformly and consistently in response to continuous ethylene exposure (10 L L1) in immature fruit within 6 d. Watersoaking is an ethyleneinduced disorder in cucumber fruit (Lima et al., 2005; Hurr et al., 2009), and in other Cucurbitaceae including watermelon (Karakurt and Huber, 2002; Mao et al., 2004) and cantaloupe melon fruits (Bernadac et al., 1996). Application of 1methylcyclopropene (1MCP), an ethylene antagonist ( Sisler, 2006) inhibi ts watersoaking of cucumber and watermelon fruit challenged with ethylene, confirming the involvement of ethylene in the disorder ( Mao et al., 2004; Lima et al., 2005). Ethylene is a gaseous phytohormone influencing diverse development processes including germination, growth, flowering, ripening, senescence, and abscission (Abeles et al., 1992; Kieber, 1997; Lin et al., 2009). E thylene effects on quality of horticultural commodities are dependent on a number of factors with e thylene concentration and expos ure time being the primary factors (Saltveit, 1999). Abscission response of Hibicscus was greater when exposed to higher ethylene concentration for longer duration (Hyer, 1995). When plants were exposed to 0.1 or 1 L.L1 ethylene for 12 h, there was no s ignificant difference in intensity of bud abscission response for 23 d. However, exposure to 1 L.L1 ethylene for 72 h induced 75% of bud abscission at 4 d while that intensity of abscission response was seen at 16 d in treatment at 0.1 L.L1 for 72 h. W hen comparing 6, 12, or 24 h of 0.1 L.L1 ethylene exposure, longer exposure did not enhance abscission response. However, 24 h of 1 L.L1 ethylene exposure

PAGE 38

38 caused twice as much abscission at 8 d compared to 12 h of exposure. On the other hand, Palou et al. (2003) reported that the skin color (hue angle) of Brooks cherry and firmness of Patterson and Castlebrite apricot decreased in response to exogenous ethylene during storage at 5 oC, but was not influenced by ethylene concentration (0.01, 0.1, o r 1 L.L1for cherry; 1, 10, or 100 L.L1 for apricot). Watersoaking in watermelon is believed to represent a response not linked to normal ripening based on observations that ethylene induced this disorder in both immature and fully ripe fruit and that w atermelon fruit typically do not exhibit watersoaking during normal development ( Karakurt and Huber, 2002) H owever, cucumber fruit of different maturity stages showed different symptoms upon ethylene exposure. W atersoaking disorder was observed in immatur e (4 6 d after anthesis) and to a lesser extent in mature cucumber fruit (1014 d after anthesis), while fruit of more carotene without watersoaking (Hurr et al. 200 9 ). Ethy leneinduced watersoaking in immature cucumber fruit was suggested to represent a form of programmed cell death (PCD ) (Hurr et al., 2010). Hallmarks of PCD such as loss of cell viability, enhanced nuclease activity and DNA laddering were observed in ethylenetreated immature cucumber fruit. Several studies have revealed an involvement of ethylene in development of plant PCD during the hypersensitive response (Ciardi et al., 2001) aerenchyma formation (Drew et al., 2000) and senescence and abscission processes (Chandlee, 2001 ; Rogers, 2006; Chaves and de MelloFarias, 2006; Lerslerwong et al., 2008).

PAGE 39

39 Reactive oxygen species (ROS) have been shown to regulate PCD in plants (Overmyer et al., 2003; van Breusegem and Dat, 2006, Gadjev et al., 2008). Plants produce ROS continuously as by products of various metabolic pathways localized predominantly in chloroplasts, mitochondria, and peroxisomes (Foyer and Harbinson, 1994). ROS also can be generated by various oxidases and peroxidases in response to environmental stresses (Bolwell et al., 2002) Reactive oxygen species are highly reactive and destructive, shown to cause membrane lipid peroxidation, enhanced membrane leakage, tissue deterioration and cell death (Dhindsa et al., 1981; Fridovich, 1986; Moran et al., 1994 ; Rao et al., 2000; Overmyer et al., 2003).The enhanced accumulation of ROS was shown to trigger PCD in plant ( Desikin et al. 2001 ; Rao and Davis, 2001; Mur et al., 2005). On the other hand, ROS can act as signals for activating PCD network (such as cr oss talk with phytohormones, cell deathrelated gene expression, MAPK driven phosphorylation cascades and posttranslational modifications ) against biotic and environmental stresses and induc e defense mechanisms (Lamb and Dixon, 1997; Mittler, 2002; Mittle r et al., 2004 ). To improve our understanding of ethyleneinduced watersoaking in immature beit alpha cucumber fruit, the present study was designed to investigate ethylene responses as influenced by ethylene concentration and exposure duration. Furthermor e, we tested the hypothesis that accumulation of reactive oxygen species upon ethylene exposure is involved in initiation of watersoaking in immature cucumber fruit Materials and Methods Plant M aterials Experiments were conducted with beit alpha cucumber ( Cucumis Sativus L.; Manar) harvested at immature stage ( average fruit wt. 86 3.2 g) from a commercial

PAGE 40

40 greenhouse facility in Live oak, FL. Freshly harvested fruit were sorted by size, color and appearance, surface sterilized with 2.7 mM sodium hypochlorite and air dried. Experiment 1. Influence of Ethylene Concentration and Exposure Duration on Watersoaking of Cucumber Fruit Ethylene treatment Intact fruit (n=50 per container ) were placed in 20L plastic containers at 13 oC and 95% RH In an experim ent designed to investigate ethylene responses as influenced by ethylene concentrations, containers were sealed and provided with flow through air or atmospheres containing 10, 100, 500 or 1000 L.L1 of ethylene continuously F low rate was maintained at 500 mL.min1 to avoid CO2 accumulation, and the gas mixture was humidified by passing it through a water filled glass jar (2 L) In an experiment designed to study the effect of duration of ethylene exposure, containers were supplied with flowthrough atmos phere containing 10 L.L1 ethylene for 12 h, 2 d, or 4 d. After these time periods, each container was supplied with ethylenefree air for the duration of storage. Two controls were included in the experiment; in the negative control one container was con tinuously supplied with ethylenefree air while in the positive control ethylene was supplied continuously at a concentration of 10 L.L1. Continuous exposure to ethylene at this concentration has been shown to induce uniform watersoaking of cucumber frui t in 6 d (Lima et al., 2005; Hurr et al., 2009). As parameters of ethylene responses, the incidence of watersoaking and changes in fruit firmness, surface hue angle, respiration rate and electrolyte leakage were monitored.

PAGE 41

41 Respiration rate and ethylene pr oduction Six cucumber fruit per treatment were repeatedly used for measuring respiration rate and ethylene production every other day Two cucumber fruit were weighed and placed in 1,400 m L plastic containers (n= 3 ) fitted with septa To avoid off gassing effect of the applied ethylene, the lid of each container was opened for 1 h before sealing. Respiration and ethylene measurement s w ere conducted by sealing for 3 h at 13 C, after which 0.5 and 1.0 m L of the headspace w as removed by syringes to quantify ca rbon dioxide and ethylene, respectively. Respiration rate was determined using a gas chromatograph (GOW MAC, series 580; Bridgewater, NJ, USA) fitted with a thermal conductivity detector and a 1219 mm x 3.18 mm Porapac Q column [particle size 149177 m (80/100 mesh)]. The flow rate of the carrier gas (helium) was 0.4 m L.s1 and oven and injector/detector were set at 40 oC and 25 oC (ambient), respectively. Respiration rate is expressed in g CO2 .kg1.s1. Ethylene production was measured using a gas chromatograph (Tremetrics, Tracor 540; Austin, TX) fitted with a photoionization detector and an alumina packed column [ 914 mm 3.18 mm; particle size 149177 m (80/100 mesh)]. The flow rate of the carrier gas (helium) was 0.4 mL.s1 and the oven and injector/ detector were set at 50 and 100 oC, respectively. Surface color Surface color measurements were obtained from two equatorial regions per fruit with a Minolta Chroma Meter CR 400 (Minolta Camera Co. Ltd., Japan) which has an 8 mmdiameter aperture and illum inant C lighting condition. A white calibration plate was used for calibration (L* = 96.88, C* = 2.05, h* = 89.4, a* = 0.02, b* = 2.05). The values were expressed by the CIE L (lightness)a*(range from green to red)b*(range from blue

PAGE 42

42 to yellow) model (Mclaren, 1979). Hue angle was determined using the formula hab=tan1 (b*/a*). The angular coordination of hue start s from 0o for red, where 90o = yellow, 180 o = green, and 270 o = blue. Five fruit per treatment were evaluated at each measurement interval Fruit firmness Cucumber fruit firmness was determined using an Instron Universal Testing Instrument (Model 4411; Canton, MA, USA) equipped with a convex tip probe ( 3 mm diameter for mesocarp and 7.5 mm diameter for intact fruit ) and 0.05 kN load cell. For measurement of mesocarp firmness, each cucumber fruit was cut equatorially with a sharp, doublebladed knife into 10mm thick slices. E ach slice was immediately placed on a solid flat plate. Zero height was established between the probe and the intact fru it or mesocarp tissue. The probe was driven with a crosshead speed of 5 0 mmm in1, and a distance of 2.5 mm. M a ximum force (N) was recorded during compression. Two measurements were made per fruit and five individual fruit were evaluated per treatment at e ach measurement interval Electrolyte leakage Electrolyte leakage was measured using a conductivity bridge (YSI 3100 conductivity instrument; Ohio, USA) equipped with a conductivity electrode. Five individual fruit per treatment were evaluated every other day. Mesocarp dis ks (n=5) of 4.5 mm diameter were excised using No. 2 Cork borer from 2 transverse slices (10 mm thickness) per fruit. Five d is ks were rinsed with distilled water, briefly blotted on Whatman #4 filter paper, and transferred into 25 mL of 250 mM mannitol in a 50 mL capped centrifuge tube. After each sample was shaken for 4 h, electrical conductivity was read. Samples were then stored at 20 C for 24 h. After 24 h the samples were

PAGE 43

43 thawed at room temperature, heated in a boiling water bath for 15 min and, after cooling to room temperature, the final conductivity was taken to determine total conductivity. All leakage data were expressed as a percentage of the total electrolyte conductivity, where initial conductivity was divided by total conduct ivity, and multiplied by 100. Experiment 2. The Effects of Exogenous Ethylene on Accumulation of Reactive Oxygen Species Ethylene treatment After sorting fruit for size and sanitization with 2.7 mM sodium hypochlorite, intact fruit (n=20 per container) w ere placed in 20L plastic containers and provided with flow through atmospheres of air with or without 10 L.L1 of ethylene at 13 oC and 95% R.H. ROS release from mesocarp disks Total reactive oxygen species (ROS) released from cucumber tissue were determined using the 2',7' dichlorofluorescin (DCFH) assay of Schopfer et al. (2001) with some modifications. ROS oxidize nonfluorescent DCFH to the highly fluorescent 2,7 dichlorofluorescein (DCF) and fluorescence increase can be used to determine the amount of ROS release. DCFHdiacetate (10 mM) was dissolved in ethanol and stored as a stock solution at 20 oC Fifty M DCFHDA was prepared from stock solution with 20 mM K phosphate ( pH 6.0 ). Deacetyla t ion of DCFHDA (50 M ) was perf o rm ed using 0.1 g.L1 o f esterase ( EC 3.1.1.1 from porcine liver ) at room temperature for 15 min. This solution was used for the assay immediately and discarded each day after use. M esocarp disks ( 4.5 mm wide by 10mm thick three disks per fruit) were prepared from cucumber slic es (10 mm thickness) with a cork borer (#2) Three dis ks were rinsed with distilled water, briefly blotted on Whatman #4 filter paper, and incubated in a 50 mL centrifuge tube containing 10 mL of working solution in the dark. ROS release was

PAGE 44

44 quantitatively determined by measuring relative fluorescence of aliquots in a fluorometer ( VersafluorTM fluorometer; Bio Rad Laboratories, Inc., CA, USA ) (Ex: 480 nm, Em: 520 nm) As the fluorescence increases due to H2O2 (fluorescence of H2O2 solution fluorescence of working solution only) reached maximum at around 20 min and autooxidation of working solution was observed after 10 min (Appendix A) an incubation period of 15 min was used for measuring RO S release in the following experiments. Working solution without tissue was used to zero the instrument and 10 mM H2O2 (final concentration) to set the maximum fluorescence as 10, 000 A standard curve was prepared with dilutions of H2O2 ( final concentrations of 0, 10 100, 1 000 and 10 000 M) (Appendix B) Fluorescence was transformed into production of H2O2 in moles per disk per h using a standard curve. This analysis was conducted with 3 individual fruit stored with/without 10 L.L1 ethylene every other day of treatment. Peroxidase was also shown to cause DCFH oxidation (Keston and Brandt, 1965). However, e ndogenous peroxidase activity of cucumber fruit tissues was not a rate limiting factor based on the observation that the addition of peroxidase (1000 U.mL1; E.C. 1.11.1.7 from horseradish) to working solution had no significant effect on the fluorescence measurements Histochemical staining Hydrogen peroxide was detected using 3, 3 diaminobenzidine 4 HCl (DAB) which yields a brown precipitate by reaction with H2O2 (Schraudner et al 1998). One t ransverse fruit slice (30 m m thick ) per fruit was prepared with a sharp knife, and then processed into a wedgeshaped section (approximately 35 of a circle). Cross sections (300 m thick) of this wedgeshaped piece were prepared using a sliding microtome

PAGE 45

45 DK 10 (Uchida Yoko Co., LTD, Japan). Six slices (2 slices per fruit, 3 fruit per treatment) were immersed in 7 mL of staining solution consisting of 10 mM 2(N Morpholino) ethanesulphonic acid, pH 6. 5 and 0 1% (w/v) DAB for 45 m in under lab light on an orbital shaker and then destained in boiling 95% ethanol for 5 min. Accumulation of s uperoxide anion was measured using nitroblue tetrazolium (NBT) staining as described in Jabs et al (1996). Cross sections of cucumber fruit were prepared as for DAB staining. Six slice s o f cucumber fruit (2 slices per fruit, 3 fruit per treatment) were immersed in 7 mL staining solution consisting of 50 mM potassium phosphate, pH 64, 0 1% (w/v) NBT and 10 mM sodium azide (peroxidase inhibitor ) for 30 min on the shaker in the dark. Tissue was destained in boiling 95% ethanol for 5 min. Photographs of brown DAB staining and blue NBT staining were taken with a fluorescence stereomicroscope (Leica MZ 16F; Leica Microsystems Ltd., Switzerland) at two magnifications (1.25X and 8X). Results Exp eriment 1. The Effects of Ethylene Concentration and Exposure Duration on Watersoaking of Cucumber Fruit The effect of ethylene concentration on watersoaking development is show n in Figure 31 E thyleneinduced watersoaking was initiated in the hypodermal tissue (Fig. 3 1 A), progressing into internal mesocarp tissue (Fig. 31 B) i n immature beit alpha cucumber fruit A lthough fruit were not uniformly watersoaked, t here was no significant difference in intensity of watersoaking among ethylene concentrations ranging from 10 to 1000 L.L1. Watersoaking affected about 10~ 25% and 30~100% of fruit crosssection at 7d and 8 d, respectively.

PAGE 46

46 As ethylene has been reported to accelerate tissue deterioration and diminish shelf life of horticultural crop, the respira tion changes of cucumber fruit depending on ethylene concentration were measured. The initial respiration of beit alpha cucumber fruit, assessed from CO2 production, was around 10 g CO2kg1s1 (Fig.3 2). Respiration rate of air treated fruit changed lit tle during 7 d of storage, and there was no clear peak of CO2 production. Continuous ethylene treatment enhanced respiration rate, reaching a maximum at 4 d for all ethylene concentrations. There was no significant difference in CO2 production and the time to reach max imum among different concentrations of ethylene. At 4 d, ethylenetreated fruit produced 2.5 to 2.8 times as much of CO2 as c ontrol fruit regardless of ethylene concentration. Ethylene production of beit alpha cucumber fruit was undetectable d uring 8 d of storage even for fruit challenged with exogenous ethylene ( data not shown). The gas chromatograph used in these experiments has a detection limit for ethylene of 0.05 L.L1. As a visible and early response of cucumber fruit to ethylene exposu re, surface color change was used to ascertain the effect of ethylene concentration. Initial skin hue value was about 124 o, and this value was maintained in air treated fruit (Fig.3 3). Ethylene induced a decrease in hue angle, with the sharpest declines noted after 4 d regardless of ethylene concentration. Ethylenetreated fruit exhibited a significant decrease in hue angle (2~3o lower) compared with air treated fruit at all measurement intervals after 4 d .L1 ethylene showed a s teep decrease in hue angle during 5 through 6 d, having 4o or 2o lower hue angle than fruit treated with .L1

PAGE 47

47 ethylene induced less decrease in hue angle than the 1000 .L1 e thylene. Fruit .L1 ethylene maintained hue angle values of around 121.5~122 o during 6 d through 8 d significantly higher than the value of fruit treated with ethylene at 1000 .L1 Fruit firmness is an essential factor determining fruit quality and fruit softening has been reported as a significant response to ethylene exposure. Accordingly, the effect of ethylene concentration on firmness of intact fruit was assessed F irmness of intact cucumber fruit stored under air increased sig nificantly during storage (Fig.34), from an initial value of 19 N to 31 N at 8 d. In ethylenetreated fruit, firmness increased an average of 25% during the first 2 d, and then decreased. Ethyleneinduced softening continued progressively after 3 d, decli ning on average 60% at 8 d for all ethylene concentrations. At 8 d, firmness of ethylenetreated fruit was 78 N and fruit were sever e ly watersoaked. Firmness was not significantly influenced by ethylene concentration. The experiment conducted to evaluat e the influence of ethylene concentration on watersoaking development and accompanying symptoms revealed that ethylene concentration in excess of 10 .L1 induced no further e ffects on watersoaking, respiration, surface color, and firmness of immature beit alpha cucumber fruit This means that the ethylene receptors present in immature cucumber fruit could be saturated at 10 .L1. Subsequent experim ents addressed the influence of ethylene exposure duration wherein .L1. Included in these analyses were the effects of exposure duration on watersoaking intensity, surface

PAGE 48

48 color, mesocarp firmness, and electrol yte leakage. These parameters were examined in response to exposure to ethylene for 12 h, 2 d, 4d or continuously. Watersoaking assessed at 6 d was not evident in fruit exposed to ethylene for 12 h, 2 d, or 4 d (Fig. 35 A). In contrast, continuous ethylene exposure (10 L.L1) induced incipient watersoaking at 6 d, which became evident as a darkening of the hypodermal tissue. As shown in Fig. 35 B, fruit treated with ethylene for 4 d followed by transfer to air exhibited incipient watersoaking at 17 d. Figure 36 shows the surface color changes in response to ethylene exposure for different durations The initial hue angle of air treated fruit was about 124 o, and this value was maintained throughout storage (Fig. 36). There was no significant differenc e between fruit exposed to .L1 ethylene for 12 h or 2 d, followed by air, during 13 d of storage. Fruit having received ethylene exposure for the initial 2 d showed a slight decline in hue angle after 13 d, and by 15 d exhibited a more yellowish appearance compared w ith fruit treated with air or with ethylene for 12 h. Increasing the duration of ethylene exposure to 4 d induced a significant decline in hue angle that paralleled that of fruit treated with ethylene continuously for 8 d. After 8 d, fruit treated with co ntinuous ethylene were severely watersoaked and showed visible signs of surface fungal proliferation on fruit surface. While hue angle decline continued upon cessation of ethylene treatment at 4 d, watersoaking was not evident until 17 d. The initial hue a ngle values for the experiments described in Fig. 33 and Fig. 36 were similar, averaging about 124 o. However, the hue angle decline in fruit treated with ethylene for 4 d followed by air reached considerably lower values (Fig. 36, about 112 o) than did fruit treated with ethylene continuously (see Fig. 33, 3 6) although the hue

PAGE 49

49 angle values for the fruit exposed to ethylene continuously represent values for only 8 d (due to acute watersoaking and fruit deterioration) versus up to 20 d for fruit receivi ng ethylene for only 4 d. The increase in firmness of control fruit throughout storage and fruit of other treatments during the early period of storage (Fig. 34) suggested that epidermal tissues strongly influence whole fruit firmness. In the present experiment, firmness measurements were performed directly on mesocarp tissue of fruit cross sections in an effort to evaluate the influence of ethyleneexposure duration. Mesocarp firmness of beit alpha cucumber fruit stored in air was initially around 8 N, increased to 10 N at 2 d, and then remained unchanged for the remaining period of storage for 20 d (Fig. 37). Firmness value .L1 ethylene for 12 h or 2 d were not statistically different from those of air treated fruit. Cucumber fr uit exposed to ethylene continuously exhibited a 38% decrease in mesocarp firmness at 6 d and 75% after 10 d compared with air treated fruit. As was noted for hue angle values, a 4d exposure to ethylene initiated declines in mesocarp firmness that were only partially interrupted following transfer to air, with values declining 16% and 38% at 6 d and 10 d, respectively, compared with air treated fruit. Since degradation of cell membranes has been reported to contribute to watersoaking development, electrol yte leakage of beit alpha cucumber fruit was measured as an indicator of cellular membrane integrity (Fan and Sokorai, 2005) in response to ethylene exposure for different durations. Electrolyte leakage of immature cucumber fruit was initially about 8% (Fi g. 3 8). Fruit stored under air or treated with ethylene for 12 h or 2 d had no difference in electrolyte leakage, showing a gradual

PAGE 50

50 increase up to 20% during 10 d of storage with no change thereafter. Electrolyte leakage was significantly enhanced in frui t exposed to ethylene for 4 d or continuously, increasing to 20% and 45%, respectively, at 6 d. By 10 d, leakage increased to 52% and 95% in fruit exposed to ethylene for 4 d or continuously, respectively. Unlike the patterns of hue angle decline and mesoc arp firmness of fruit treated with ethylene for 4 d, wherein ethyleneinduced declines continued for the entire storage duration, electrolyte leakage stabilized at around 10 d. Experiment 2. The Effects of Continuous Ethylene Exposure on Accumulation of R eactive Oxygen Species Since reactive oxygen species (ROS) could play an important role in regulating watersoaking, 2, 7 dichlorofluorescin (DCFH) assay was used to asse ss total ROS generating capacity of mesocarp tissue from cucumber fruit stored under air or continuous ethylene (10 L.L1). The assay involves measuring the increase of dichlorofluorescein (DCF) fluorescence after oxidation of 2, 7 dichlorofluorescin (DCFH). I nitial ROS generation of a ir treated fruit averaged to about 0.6 mol of H2O2 equivalents per mesocarp disk per h, increasing to 3.9 mol of H2O2 equivalents at 8 d (Fig. 3 9 ) ROS production was significantly enhanced in fruit challenged with ethylene, increasing nearly 23and 11 fold at 4 and 6 d of treatment, respectively, compared with fruit stored in air. Peak ROS production at 6 d amounted to 9.8 mol of H2O2 equivalents per mesocarp disk per h, declining to undetectable levels at 10 d. The decline in ROS production coincided with the onset of severe tissue watersoaking and enhanced electrolyte leakage, reflecting the general occurrence of tissue death. Histochemical staining (DAB and NBT staining) was applied to determine the gross localization of hydrogen peroxide (H2O2) and superoxide anion ( O2 -) in cross

PAGE 51

51 sections of cucumb er fruit stored in air or continuous 10 L.L1 ethylene. The sites and pattern of H2O2 and O2 accumulation were different (Fig. 310 and Fig. 3 11). H2O2 accumulation, visualized as a brown precipitate formation increased in response to continuous ethy lene treatment, especially in hypodermal tissue. In contrast, ethylenetreated fruit had no visible O2 accumulat ion in exocarp tissue while air treated fruit showed increased blue NBT staining. Discussion The effects of exogenous ethylene on beit alpha c ucumber fruit included tissue (mesocarp) softening, skin degreening increased respiration and electrolyte leakage, and watersoaking development. These observations parallel reports by Hurr et al. (2009) and Lima et al. (2005) for ethylene treatment of imm ature beit alpha cucumber fruit. E thylenetreated cucumber fruit exhibited spatial patterns of watersoaking development, initiating in hypodermal tissue (out er layer of mesocarp) and then progressing into inner mesocarp tissue. This pattern could be explai ned as tissuespecific pattern. Even among members of the Cucurbitaceae, patterns of watersoaking development differ. Watermelon fruit exhibited watersoaking disorder in placental and mesocarp tissue concurrently, with minimal effects on surface tissues, as a response to continuous ethylene exposure (Karakurt and Huber, 2002). Watersoaking in cantaloupe fruit is an ethyleneindependent phenomenon which initiated in innermost mesocarp tissue and then progressed into peripheral tissues (du Chatenet et al., 2000). These observations indicate that the pattern of watersoaking disorder is a commodity dependent and tissuespecific phenomenon. On the other hand, spatial patterns of watersoaking development in cucumber fruit could be questioned as results of different gas diffusion rate among different tissue types. O uter tissues have potentially higher

PAGE 52

52 concentrations of applied gasses because of the presence of gas diffusion barriers including e pidermis, cuticle, and stoma (Burg, 2004; Laurin et al., 2006). Th is mig ht explain why the incipient watersoaking symptoms are first evident in hypodermal tissues in response to exogenous ethylene. Watersoaking disorder, shown in Fig. 3 1, was not uniformly developed, which could result from fruit maturity differences. T he responses of detached cucumber fruit to exogenous ethylene are developmentally dependent (Hurr et al., 2009) In the present study, immature fruit were selected based on fruit size and surface color, whereas in Hurr et al. (2010) fruit were selected based on days post anthesis (DPA). T his suggests that DPA rather than fruit size and color is a more adequate criterion for ensuring uniform watersoaking in response to ethylene. The present study was designed to investigate ethylene responses of cucumber fruit as influenced by ethylene concentration Postharvest ethylene exposure has been reported to induce quality losses in nonclimacteric fruit and vegetable crops in a dosedependent manner (Wills et al., 1999 Tian et al., 2000). In immature cucumber fruit eth ylene concentration .L1 had no further influence on intensity of watersoaking, respiration increase and fruit softening indicat ing .L1 ethylene was saturating with respect to ethylene responses of cucumber fruit. Ethylene saturation has been reported in other horticultural crops. Ethylene concentrations exceeding 40 .L1 did not induce further enhancement in color development (a/b ratio) of strawberry fruit (Tian et al., 2000). Cherry (Brooks) and apricot (Patterson and Castlebrite) showed declines in skin color and firmness, respectively, in response to ethylene but

PAGE 53

53 was not influenced by ethylene concentration (0.01 to 1 L.L1for cherry; 1 to 100 L.L1 for apricot) (Palou et al., 2003). .L1 had no further influence on the physiology of cucumber fruit, fruit responded differently depending on duration of .L1 ethylene showed no significant detrimental effect on quality of cucumber fruit during 20 d of storage. Fruit receiving ethylene for only 2 d exhibited significant decline of hue angle at 15 d, but no observable influence on watersoaking, electrolyte leakage and mesocarp firmness. Ethylene exposure for 4 d induced watersoaking, electrol yte leakage increase and firmness decline much more slowly compared to continuous exposure. The exposuretime threshold for skin degreening was 2 d but 4d for watersoaking electrolyte leakage, and softening L ag time between ethylene application and the initiation of the ethylene response might be required for alter ing physiological mechanisms and gene expressions to induce the ethylene response. The different exposure time thresholds for ethylene responses were observed in the present experiment, which has been reported in other horticultural commodities A requirement for continuous ethylene was reported in pea seedlings (Warner and Leopold, 1971) and radish roots (Jackson, 1983), where the decline in growth rate mediated by ethylene returned to control rate upon removal from ethylene. V ase life of Cordelia and Prato lily was also significantly reduced by 48 h of ethylene exposure (10 and 100 L.L1, respectively), but not by 24 h of exposure (Elgar et al., 1999). The efficiency of 1 MCP (an ethylene antagonist) has also been reported to depend on exposure duration of 1 MCP or pre treated ethylene. Extended shelf life in response to 1 MCP treatment (300 nL.L1 for 24 h) was observed in banana

PAGE 54

54 .L1 ethylene pre treatment for 30 or 40 h, but not fruit exposed to ethylene for 50 h (Moradinezhad et al., 2006). Grape fruit treated with 1 MCP (300 nL.L1) for 24, 48, or 72 h exhibited 20, 160 or 1000 fold increase in ethylene production, respectively, compared to non treated fruit (McCollum and Maul, 2007). Duration of exposure to ethylene had differential effects on watersoaking, surface color, respiration rate, electrolyte leakage, and fruit firmness. Hue angle of fruit treated with ethylene for 4 d or continuously reached around 119 o at 8 d simultaneously. In contrast, fruit receiving ethylene for only 4 d exhibited watersoaking, enhanced electrolyte leakage and firmness decline with much g reater delay compared with continuous ly exposed fruit Unlike the patterns of hue angle decline and mesocarp firmness of fruit receiving ethylene for only 4 d, wherein ethyleneinduced declines continued for the entire storage duration, electrolyte leakage stabilized at around 10 d. These results might be explained by different ethylene thresholds for the different ethylene responses of immature cucumber fruit Tian et al. (2000) have mentioned that ethylene responses in strawberry fruit have different ethy lene threshold levels based on no further enhancement in color development (a/b ratio) and softening after exogenous ethylene concentration exceeded 40 and 0.5 L.L1, respectively. In grapefruit, 1 MCP treatment at concentrations over 75 nL.L1 exhibited no further inhibition in ethyleneinduced degreening while ethylene production was increased by 1MCP treatment in a doseand timedependent manner over the range of 0 to 300 nL.L1 (McCollum and Maul, 2007). Different ethylene responses of potato tuber also have various saturation concentrations (Daniels Lake et al., 2005). Ethylene responses such as delay in sprouting, breaking of apical dominance, and increased formation of small sprouts were

PAGE 55

55 saturated between 0.4 and 4 L.L1 ethylene whereas inhibit i on of sprout elongation was not saturated until ethylene concentrations exceeded 40 L.L1. Cucumber fruit seem to have lower exposuretime threshold for degreening than for other ethylene responses. That is why ethylene exposure for 4 d is enough to induc e degreening to the same extent as was caused by continuous exposure, but was much less effective in inducing watersoaking. Fruit treated with ethylene for only 4 d exhibited incipient watersoaking at 17 d, when its hue angle reached considerably lower values (about 116 o) than that of fruit treated with ethylene continuously. Fruit exposed to ethylene continuously had hue angle of about 121.5 o when incipient watersoaking was observed (6 d). These data indicate that the influence of ethylene on surface color change and watersoaking are not tightly linked. In addition, the effect of ethylene exposure on fruit surface color was more evident in fruit receiving ethylene for only 4 d compared to continuous exposure since the postharvest longevity of the former was greatly extended relative to fruit receiving continuous ethylene exposure. The darkening of the fruit surface accompanying watersoaking, which is not accompanied by chlorophyll increases (Hurr et al., 2009), might mask yellowing of the fruit surface ev ident in fruit receiving short term ethylene exposure. Plants produce reactive oxygen species ( ROS ) under a variety of biotic and abiotic stresses (Bolwell et al., 2002) Continuous ethylene exposure (10 L.L1) induced increases in total ROS generating c apacity of cucumber fruit after 2 d This enhanced ROS generating capacity preceded the decline of firmness and hue angle, and increased electrolyte leakage, and well in advance of incipient watersoaking, suggesting

PAGE 56

56 that ROS accumulation plays an important role in watersoaking development. ROS can control ethylene signaling directly or indirectly (Overmyer et al., 2003). Also, the production of ROS during ethylene exposure can induce program med cell death (PCD) in cucumber, or vice versa. Hurr et al. (2010) reported that cucumber fruit exposed to 10 L.L1 ethylene exhibited hallmarks of PCD including increased nuclease activities and visible DNA laddering at 3~4 d. Enhanced levels of ROS could potentially directly contribute to watersoaking through membrane lipid peroxidation and subsequent loss of membrane integrity (Dhindsa et al., 1981; Fridovich, 1986; Moran et al., 1994). Increased electrolyte leakage, an indicator of cellular membrane integrity, was observed in ethylenetreated fruit after 4 d in present study. Up regulation of transcript abundance for ascorbate oxidase, allen oxide synthase, and hydroxyperoxide lyase in ethylenetreated watermelon indicated a possible relationship between ROS and watersoaking development (Karakurt and Huber, 2004) Tot al ROS generating capacity data can also explain the effect of ethylene exposuretime. E thylenetreated fruit exhibited increases in total ROS generating capacity at 4 d but not at 2 d, which was consistent with the lack of watersoaking development in cucumber fruit treated with ethylene for 2 d. ROS generating capacity of continuously ethylenetreated fruit peaked at 6 d, which can explain why the watersoaking was significantly delayed in fruit treated with ethylene for only 4 d. Ethyleneenhanced ROS coul d alter gene expression related to the induction and development of watersoaking disorder. ROS affects gene expressions through modifying signaling transduction pathways (Apel and Hirt, 2004; Circu et al., 2009) and the activity of transcription factors (Mittler et al., 2004). To verify the significant role of

PAGE 57

57 ROS in watersoaking, however antioxidant systems should be studied. O xidative damage could be inhibited by scavenging of ROS (Alscher and Hess, 1993; Apel and Hirt, 2004) ROS could act as signals to activate antioxidant systems (Mittler, 2002). The response of antioxidative systems to oxidative stress depends on commodities and/or cultivars, indicating the complexity of antioxidant system s to oxidative stress ( Hodges et al., 2004) The spatial accum ulation of hydrogen peroxide (H2O2) and superoxide anion (O2 -) were studi e d to investigate the role of specific ROS in development of watersoaking. Both O2 and H2O2 are key components of ROS signaling and the most commonly studied ROS (Overmyer et al., 2003). ROS specific dyes (DAB for H2O2 and NBT for O2 -) were used to identify sites of each ROS accumulation in cucumber fruit tissues. Spatial and quantitative correlation between hydrogen peroxide (H2O2) and watersoaking development was observed in cucumber fruit. Brown precipitate from DAB increased during 8 d of storage in ethylenetreated cucumber fruit, especially in the hypodermal area. However, ethylene exposure did not induce detectable accumulation of superoxide anion (O2 -) in hypodermal tissue while there was strong blue deposition in exocarp tissue of air treated fruit at 8 d. In beit alpha cucumber fruit, H2O2 accumulation seems to contribute to watersoaking development upon ethylene exposure. These observations support the idea that different ROS species, depending on commodities, might be associated with development of certain responses under biotic and/or abiotic stresses. Ozone exposure was able to stimulate accumulation of both O2 and H2O2 followed by lesion formation in Arabidopsis but only H2O2 accumulation in tobacco and tomato leaves (Wohlgemuth et al., 2002). A significant increase in total ROS level,

PAGE 58

58 however, was detected after 2 d while significantly enhanced deposition of H2O2 was observed after 4 d. This inconsistency could ref le ct the different sensitivit ies between DCFH assay for total ROS generating capacity and histochemical staining method for H2O2. On the other hand, this result seems to indicate the possible involvement of other ROS in watersoaking disorder of beit alpha cu cumber fruit. Therefore, further study of other ROS species such as hydroxyl(HO.), peroxyl (RO2 .), and alkoxyl (RO.) radicals (Trobacher, 2009) will be valuable to elucidate the role of specific ROS in development of watersoaking. Overall, the present study showed that ethylene concentrations exceeding .L1 had no further influence on the physiology of immature cucumber fruit. By contrast, ethylene exposure duration differently affect watersoaking development and accompanying symptoms including yellowing, softening, and electrolyte leakage. At least 4 d of ethylene exposure (10 L.L1) w ere required to induce watersoaking disorder in beit alpha cucumber fruit. Enhanced total ROS generation is closely associated with watersoaking in ethylenetreated cucumber fruit Histochemical staining revealed that watersoaking appears to be closely associated with H2O2 but not with O2 -.

PAGE 59

59 A B Figure 31. Watersoaking development of beit alpha cucumber fruit treated with air or ethylene (10, 100, 500, or 1000 L.L1) at 13 oC A) At 7 d. B) At 8 d. AIR Ethylene 10 L L 1 Ethylene 100 L L 1 Ethylene 500 L L 1 Ethylene 1000 L L 1 AIR Ethylene 10 L L 1 Ethylene 100 L L 1 Ethylene 500 L L 1 Ethylene 1000 L L 1 Hypodermal tissue Mesocarp tissue

PAGE 60

60 Figure 32. Respiration rate of beit alpha cucumber fruit during storage at 13 oC under air or ethylene at 10, 100, 500, or 1000 L L1. Each point represents the mean of 6 fruit. Vertical bar s represent LSD ( = 0.05) per day.

PAGE 61

61 Figure 33. Surface hue angle of beit alpha cucumber fruit during storage at 13 oC under air or ethylene at 10, 100, 500, or 1000 L L1. Each point represents the mean of 10 measurements (5 fruit, 2 measurements per fruit). Vertical bar s represent LSD ( = 0.05) per day.

PAGE 62

62 Figure 34. Intact fruit firmness of beit alpha cucumber fruit during storage at 13 oC under air or ethylene at 10, 100, 500, or 1000 L L1. Each point indicates the mean of 10 measurements (5 fruit, 2 measurements per fruit). Vertical bar s represent LSD ( = 0.05) per day.

PAGE 63

63 A B Figure 35. Watersoaking of beit alpha cucumber fruit treated with air 10 L.L1 ethylene continuously or stored in air after ethylene exposure for 12 h, 2 d, or 4 d. A) At 6 d. B) At 17 d. AIR Ethylene (12 h) Ethylene (2 d) Ethylene (4 d) Ethylene (Cont.) AIR Ethylene (12 h) Ethylene (2 d) Ethylene (4 d)

PAGE 64

64 Figure 36. Surface hue angle of beit alpha cucumber fruit stored in air or 10 L.L1 ethylene continuously or stored in air after ethylene exposure for 12 h, 2 d, or 4 d. Each point indicates the mean of 10 measurements (5 fruit, 2 measurements per fruit) Vertical bar s represent LSD ( = 0.05) per day.

PAGE 65

65 Figure 37. Mesocarp firmness of beit alpha cucumber fruit stored in air or 10 L.L1 ethylene continuously or stored in air after ethylene exposure for 12 h, 2 d, or 4 d. Each point indicates the mean of 10 measurements (5 fruit, 2 measurements per fruit) Vertical bar s represent LSD ( = 0.05) per day.

PAGE 66

66 Figure 38. Electrolyte leakage of mesocarp tissues of beit alpha cucumber fruit stored in air or 10 L.L1 ethylene continuously or stored in air after et hylene exposure for 12 h, 2 d, or 4 d Each point indicates the mean of 5 fruit Vertical bar s represent LSD ( = 0.05) per day.

PAGE 67

67 Figure 39 Total reactive oxygen species (ROS) generating capacity of beit alpha cucumber fruit stored at 13 o under air or continuous 10 L L1 ethylene. The production of total ROS was demonstrated using the oxidation of DCFH to DCF. Relative fluorescence at 520 nm was transformed into the production of H2O2 in moles per disk per h using a standard curve. Each bar represent s the mean of three fruit SE. ns = non significant ; *significant at P <0.0 5; **significant at P <0.0 1, according to analysis of variance.

PAGE 68

68 A B Figure 310. Localization of H2O2 in crosssection of cucumber fruit stored with/without ethylene (10 L.L1) At examining day, cross sections (300 m) were stained with DAB for 45 min. Photograph of brown DAB staining (red arrows) was taken with microscope at two different magnifications: A) 1.25X B ) 8X Each photograph is one of four biological replications.

PAGE 69

69 A B Figure 311. Localization of O2 in crosssection of cucumber fruit stored with/without ethylene (10 L.L1). At examining day, cross sections (300 m) were stained with NBT for 30 min in dark. Photograph of blue NBT staining (red arrows) was t aken with microscope at two different magnifications: A) 1.25X B) 8X Each photograph is one of four biological replications.

PAGE 70

70 CHAPTER 4 DIFFERENT ETHYLENE REPONSES OF INTACT AN D FRESHCUT SLICES OF IMMATURE CUCUMBER FRUIT Introduction Cucumber fruit are commercially harvested prior to developmental maturation. This immature fruit produces very low levels of ethylene, but is sensi tive to exogenous .L1 (Villalta and Sargent, 2004). In response to exogenous ethylene, cucumber fruit exhibit increased respiration, electrolyte leakage, microbial growth, enhanced epidermal degreening, and fruit soft ening (Lima et al., 2005; Hurr et al., 2009; Chapter 3). Watersoaking is another characteristic ethylene response observed in immature cucumber fruit (Lima et al., 2005; Hurr et al., 2009; Chapter 3), a physiological disorder observed in other members of t he Cucurbitaceae including watermelon (Karakurt and Huber, 2002; Mao et al., 2004) and cantaloupe melon (Bernadac et al., 1996). The syndrome is characterized by acute softening, subdermal tissue translucency, enhanced electrolyte efflux, and cell wall dis assembly (Karakurt and Huber, 2002; Lima et al., 2005; Mao et al., 2004). Watersoaking development appear s to be affected by many factors including storage temperature, ethylene, and/or fruit maturity. Hong and Gross (2000) suggested that watersoaking is a symptom of chilling injury and membrane physical responses to low temperatures. Several studies, however revealed that watersoaking is a wound response but not chilling injury. Watersoaking was observed in freshcut tomato slices stored at 1015 oC but not in intact fruit stored at 5 oC ( Bai et al., 2003; Jeong et al. 2004; Lana et al., 2006 ). W atersoaking dependence on ethylene as an inducer has been reported to vary from commodity to commodity. W atersoaking in cantaloupe was apparently ethylene independent, as application of 1methylcyclopropene (1MCP), an

PAGE 71

71 ethylene antagonist ( Serek et al. 1994; Sisler and Serek 1997), could not prevent watersoaking (du Chatenet et al., 2000). In contrast, 1 MCP inhibited watersoaking development of watermelon and imm ature cucumber fruit, indicating a cau sal relationship between ethylene and the disorder (Mao et al., 2004; Lima et al., 2005). The response of watermelon fruit to ethylene seems to be unrelated to fruit maturity (Karakurt and Huber, 2002) while ethylenei nduced watersoaking was observed only in immature cucumber fruit but not in ripe fruit (Hurr et al., 2009).These variable responses in different commodities indicate that several mechanisms would be involved in watersoaking development. Although study of the physiological and cellular processes leading to watersoaking remains still incomplete, degradation of cell wall and membrane were reported to contribute to watersoaking development (Karakurt and Huber, 2004; Mao et al., 2004; Lima et al., 2005). For ex ample, ethylenetreated watermelon fruit showed increased activity and transcript abundance of polygalacturonase (PG) (Karakurt and Huber, 2004) and increased lipoxygenase (LOX), phospholipase C (PLC), phospholipase D (PLD), and phosphatidic acid (PA) ( Mao et al., 2004) with the onset and development of watersoaking. In addition, reactive oxygen species ( ROS ) seem to be involved in watersoaking development. In immature cucumber fruit, enhanced ROS generating capacity represent ed the earliest response to ethylene treatment (Chapter 3). Excess ROS production has been reported to trigger programmed cell death (PCD) in plants (Desikin et al., 2001; Rao and Davis, 2001; Mur et al., 2005), and watersoaking in immature cucumber fruit appears to represent a form of PCD (Hurr et al., 2010). These data indicate that ethyleneenhanced ROS can induce watersoaking in immature

PAGE 72

72 cucumber fruit through PCD processes such as increased nuclease activity and DNA laddering. Watersoaking in cucumber fruit is an ethyleneinduced di sorder (Lima et al., 2005). Ethylene is a gaseous phytohormone influencing diverse developmental processes including seed germination, abscission, fruit ripening, sex determination, and senescence (Abeles et al., 1992; Kieber, 1997). Ethylene is synthesized in response to biotic and abiotic stresses including pathogen attack, flooding, chilling, and wounding (Abeles et al., 1992) and can diffuse into and throughout plant tissues (Mattoo and Suttle, 1991). The effect of ethylene is influenced by development stage, and ethylene concentration and exposure duration (Abeles et al., 1992; Saltveit, 1999). Watersoaking development of cucumber fruit is dependent on developmental maturity (Hurr et al., 2009) and ethylene exposure duration (Chapter 3). I mmature fruit (4 6 d after anthesis) showed incipient watersoaking at 6 d of continuous 10 L.L1 ethylene exposure and 100% incidence of watersoaking at 9 d whereas mature cucumber fruit (1014 d after anthesis) showed a much lower incidence of the disorder (about 30% at 12 d). In fruit at more advanced maturity (showing color break due to accumulation of carotenoid pigments), however, ethylene exposure caused chlorophyll degradation and massive carotene accumulation but did not cause watersoaking. Short duration exposure (less than 4 d) of immature cucumber to 10 L.L1 ethylene did not induce the disorder whereas fruit receiving ethylene for 4 d followed by transfer to air exhibited incipient watersoaking at 17 d (C hapter 3). Immature cucumber fruit exhibited spatial patterns of watersoaking development. In ethylenetreated fruit, incipient watersoaking is first evident in hypodermal (outlayer of

PAGE 73

73 mesocarp tissues) tissues and progresses into the inner mesocarp tissues (Chapter 3). This spatial pattern appears to be a consequence of tissuespecific ethylene responses. Even among members of the Cucurbitaceae patterns of watersoaking development are diverse. Watersoaking initiated in innermost m esocarp tissues of cantaloupe melon fruit (du Chatenet et al., 2000) whereas ethylenetreated watermelon showed incipient watersoaking in both placental and mesocarp tissue (Karakurt and Huber, 2002). On the other hand, this spatial pattern of watersoaking in cucumber fruit (incipient watersoaking in hypodermal tissues) could be explained by differences in gas diffusion properties or gradients among different tissue types. This view is supported by the observation of Praeger and Weichmann (2001) that pO2 pr ofiles decreased from outer to inner tissue in cucumber fruit. The epidermis and cuticle can act as barriers to gas diffusion into internal tissues (Burg, 2004a). Stomata were also reported as an important regulator of gas exchange and transpiration in cuc umber fruit (Cazier et al., 2001; Laurin et al., 2006). Therefore, it is possible that external tissues can have higher concentrations of gasses applied exogenously. This might explain why incipient watersoaking symptoms are first evident in hypodermal tis sues. In the present study, we employed intact and freshcut slices of cucumber fruit to address whether patterns of watersoaking differed in response to altered gas exchange properties. Furthermore, we investigated the influence of pO2 on watersoaking development of intact fruit and freshcut slices. Materials and Methods Plant M aterials Experiments were conducted with beit alpha cucumber ( Cucumis Sativus L.; Manar) harvested at immature stage ( average fruit wt. 86 3.2 g) from a commercial

PAGE 74

74 greenhouse facility in Live oak, FL. Freshly harvested fruit were returned to Gainesville within 2 h where they were sorted by size, color and appearance, sanitized with 2.7 mM sodium hypochlorite, and air dried. Fresh cut slices (10 mm thick; 4 slices per fruit) were prepared from the middle portion of fruit with a doublebladed knife. Intact fruit (n=50) were placed in a 20L plastic container (n=4) and freshcut slices (4 slices per fruit from 5 fruit) were placed in a ventilated 1.5L plastic container (FridgeS mart, Tupperware Corp., Orlando; n=10) which in turn were placed inside a 174L steel chamber (n=4) at 13 oC and 95% R.H. Four plastic containers holding intact fruit and four steel chambers holding freshcut slices were provided with flow through atmosph eres of air (21 kPa O2) 10 L.L1 ethylene, 2 kPa O2 (balance N2) + 10 L.L1 ethylene, or 40 kPa O2 (balance N2) + 10 L.L1 ethylene. F low rate was maintained at 500 mL.min1 to avoid CO2 accumulation and the gas mixture was humidified by passing through a water filled glass jars (2 L) At intervals during treatment, slices (10mm thick) from the middle portion of the treated intact fruit were cut with a double blade knife and were evaluated along with fresh cut slices prepared at the start of the exper iment. Changes in mesocarp firmness, surface and mesocarp hue angle, electrolyte leakage, and incidence of watersoaking were evaluated as indicators of ethylene responses Exocarp and Mesocarp Color Color measurement was conducted on freshcut slices and slices derived from intact fruit with a Minolta Chroma Meter CR 400 (Minolta Camera Co. Ltd., Japan), which has an 8 mm diameter aperture and illuminant C lighting condition. Fruit surface and mesocarp color were measured by placing the sensor over exocar p and mesocarp tissue, respectively. Ten slices (2 slices per fruit, 5 fruit) were evaluated per treatment

PAGE 75

75 and two measurements were made per slice. A white calibration plate was used for calibration (L* = 96.88, C* = 2.05, h* = 89.4, a* = 0.02, b* = 2.05). The values were expressed by the CIE L (lightness) a*(range from green to red)b*(range from blue to yellow) model (Mclaren, 1979). Hue angle was determined using the formula hab=tan1 (b*/a*). The angular coordination of hue is start from 0o for red, where 90o = yellow, 180 o = green, and 270 o = blue. Mesocarp F irmness Mesocarp firmness was determined on freshcut slices and slices prepared from intact fruit using an Instron Universal Testing Instrument (Model 4411; Canton, MA, USA) equipped wi th a convex tip probe ( 3 mm diameter) and 0.05 kN load cell. Each slice was placed on a solid flat plate and z ero height was established between the probe and the mesocarp tissue. The probe was driven with a crosshead speed of 5 0 mmmin 1 and the force was recorded at 2.5 mm deformation. Ten slices (2 slices per fruit, 5 fruit) were evaluated per treatment and two measurements were made per slice. Electrolyte L eakage Electrolyte leakage was measured using a conductivity bridge (YSI 3100 conductivity instr ument; Ohio, USA) equipped with a conductivity electrode. Slices derived from intact fruit (n=5) and freshcut slices made from 5 fruit per treatment were evaluated every other day. Mesocarp dis ks (n=5) of 4.5 mm diameter were excised using No. 2 Cork borer from 2 slices (10 mm thickness) per fruit. Five d isk s were rinsed with distilled water, briefly blotted on Whatman #4 filter paper, and transferred into 25 mL of 250 mM mannitol (Villalta and Sargent, 2004) in a 50 mL capped centrifuge tube. After each s ample was shaken for 4 h, electrical conductivity of the bathing solution was measured. Samples were then frozen at 20 C. After 24 h the samples were thawed at

PAGE 76

76 room temperature, heated in a boiling water bath for 15 min, and after cooling to room temperature, the final conductivity was determined. All leakage data were expressed as a percentage of total electrolyte conductivity, where initial conductivity was divided by total conductivity, and multiplied by 100. ROS Release from Mesocarp Disks Total reactive oxygen species (ROS) were determined using a 2',7' dichlorofluorescin (DCFH) assay of Schopfer et al. (2001) with some modifications. ROS oxidize nonfluorescent DCFH to the highly fluorescent 2,7 dichlorofluorescein (DCF) and fluorescence increase can be used to determine the amount of ROS release. DCFHdiacetate (10 mM) was dissolved in ethanol and stored at 20 oC as a stock solution. Fifty M DCFHDA was prepared from the stock solution with 20 mM K phosphate ( pH 6.0). Deacetylayion of DCFH DA (5 0 M ) was perf o rm ed using 0.1 g.L1 of esterase (EC 3.1.1.1 from porcine liver) at room temperature for 15 min This solution was used for the assay immediately and discarded each day after use. M esocarp disks ( 4.5 mm wide by 10mm thick three disks per fr uit) were prepared from cucumber slices (10 mm thickness) with a cork borer (#2) Three disks were rinsed with distilled water, briefly blotted on Whatman #4 filter paper, and incubated in a 50 mL centrifuge tube containing 10 mL of working solution in the dark for 15 min. ROS release was quantitatively determined by measuring relative fluorescence of aliquots (2 mL) in a fluorometer ( VersafluorTM fluorometer; BioRad Laboratories, Inc., CA, USA ) (Ex: 480 nm, Em: 520 nm) Working solution without tissue was used to zero the instrument and 10 mM H2O2 (final concentration) to set the maximum fluorescence as 10 000. Fluorescence was transformed into production of H2O2 in moles per disk per h using a standard curve prepared with dilutions of H2O2 (final concent rations of 0, 10, 100, 1000,

PAGE 77

77 and 10000 M). This analysis was conducted every other day with 3 intact fruit and fresh cut slices made from 3 fruit stored with/without 10 L.L1 ethylene. Peroxidase has been shown to cause DCFH oxidation (Keston and Brandt, 1965). However, e ndogenous peroxidase activity of cucumber fruit tissues was not a rate limiting factor based on the observation that the addition of peroxidase (1000 U.mL1; E.C. 1.11.1.7 from horseradish) to the working solution had no significant effec t on the fluorescence measurements Results As a response to challenge with 10 L.L1 ethylene, incipient watersoaking was observed in hypodermal tissues (the outlayer of mesocarp tissues) of both intact fruit and freshcut slices at 7 d under normoxic and hyperoxic conditions (40 kPa O2) (Fig. 4 1 A & B). Afterward, intact fruit exhibited more severe and rapid watersoaking development than did freshcut slices. As shown in Figure 4 2 A, watersoaking affected about 30~40% of mesocarp tissues of intact fruit treated with ethylene under normoxia and 80~90% incidence under hyperoxic conditions at 9 d. In contrast, 10~20% of mesocarp tissues of freshcut slices were watersoaked in response to ethylene under both normoxic and hyperoxic conditions at 9 d (Fig. 42 B). Watersoaking was not observed in intact fruit or slices exposed to normoxia without ethylene or to hypoxia (2 kPa O2) plus ethylene. Hypoxia negated ethyleneinduced watersoaking development for up to 9 d in both intact and freshcut slices, whereas hyperoxia accelerated ethyleneinduced watersoaking in intact fruit (Fig. 42 A) but not in freshcut slices (Fig. 4 2 B). Microbial proliferation was observed in ethylenetreated freshcut slices (Fig. 4 2 B) as was also seen in exocarp of ethylenetreated intact fruit (data not shown).

PAGE 78

78 The initial hue angle of exocarp was about 121.5 o (Fig. 4 3). This value of intact fruit treated with air changed negligibly over the initial 9 d, declining thereafter (Fig. 43 A). Intact fruit exposed to continuous ethyl ene (10 L.L1) under normoxic conditions exhibited steep declines in exocarp hue angle after 3 d. Exocarp hue angles of intact fruit treated with ethylene under normoxia were significantly lower (about 2.5 and 4 o) compared with air treated fruit at 5 and 7 d, respectively. Ethyleneinduced exocarp degreening was not accelerated by hyperoxia but negated by hypoxia. Intact fruit stored with air or ethylene under hypoxia showed similar exocarp hue angle values during storage. In contrast to intact fruit, ini tial exocarp hue angle of freshcut slices treated with air continuously decreased to about 118 o at 11 d (Fig. 4 3 B). Continuous ethylene exposure (10 L.L1) under normoxia and hyperoxia induced steep declines in exocarp hue angle of freshcut slices af ter 3 d, but there was no further acceleration by hyperoxia. At 7 d, freshcut slices exposed to ethylene under normoxic and hyperoxic conditions had significantly lower exocarp hue angle (about 3.5~4 o) compared to air treated freshcut slices. Hypoxia reduced the rate of surface discoloration caused by exogenous ethylene and freshcut processing in freshcut slices. Fresh cut slices exposed to ethylene under hypoxia had nearly 3 o higher exocarp hue angle compared with air treated slices at 11 d. Initial hue angle of mesocarp tissue was around 114.5 o (Fig. 4.4). Mesocarp hue angle of intact fruit stored under air declined slightly after 5 d, reaching around 113 o at 9 d (Fig. 44 A). In intact fruit, exogenous ethylene did not hasten degreening of mesocarp tissue under normoxia. However, hyperoxia with 10 L.L1 ethylene significantly enhanced mesocarp discoloration of intact fruit after 5 d, and hypoxia

PAGE 79

79 reduced the rate of mesocarp degreening. At 5 d, mesocarp tissue of intact fruit treated with ethylene under hyperoxia and hypoxia had 1.5 o lower and 2 o higher hue angles, respectively, compared with air treated fruit. Mesocarp hue angle of air treated freshcut slices declined significantly after 5 d, reaching around 110 o at 9 d (Fig. 44 B). Fresh cu t slices stored with 10 L.L1 ethylene under normoxic or hyperoxic condition showed significantly enhanced yellowing of mesocarp tissues; 2 and 4 o lower mesocarp hue angle compared with air treated slices at 5 and 9 d, respectively. In freshcut slices, the decline of mesocarp hue angle was inhibited by hypoxia during 11 d of storage as was also seen in exocarp hue angle, while hyperoxia induced no further mesocarp discoloration in freshcut slices. Firmness of mesocarp tissue was initially around 9 N, a value maintained for both intact fruit and freshcut slices stored under air (Fig. 45). Intact fruit treated with 10 L.L1 ethylene under normoxia exhibited significant softening at 5 d, which was accelerated by hyperoxia (Fig. 45 A). At 7 d, intact fr uit exhibited 40% and 60% declines in mesocarp firmness as a response to exogenous ethylene under normoxia and hyperoxia, respectively, compared with fruit treated with air. Mesocarp softening of intact fruit caused by exogenous ethylene was delayed by hypoxia. Mesocarp firmness of intact fruit exposed to ethylene under hypoxia reached around 4 N at 15 d, and at 9 d and 7 d in fruit treated with ethylene under normoxia and hyperoxia, respectively. Ethylenemediated mesocarp softening was significantly del ayed in freshcut slices compared with intact fruit (Fig. 45 B). Ethylenetreated intact fruit had significantly reduced mesocarp firmness compared to air treated fruit after 3 d, whereas there was no significant difference in mesocarp firmness between ai r and ethylenetreated fresh-

PAGE 80

80 cut slices until 9 d. Ethylene induced a 50% decrease in mesocarp firmness of freshcut slices at 9 d. In freshcut slices, hypoxia negated ethyleneinduced softening during 11 d of storage while hyperoxia showed no enhancement in softening compared with normoxia. Both intact fruit and freshcut slices stored under ethylenefree atmospheres showed slight increases in electrolyte leakage during storage (Fig. 46). Initial electrolyte leakage was around 10%, and tissues from fresh cut slices and intact fruit treated with air exhibited about 19% and 17% electrolyte leakage, respectively, at 11 d. Ethyleneinduced electrolyte leakage in intact fruit and freshcut slices was differently affected by hyperoxia and hypoxia. In intact f ruit, ethyleneinduced increases in electrolyte leakage were significantly enhanced by hyperoxia and delayed by hypoxia (Fig. 4 6 A). At 7 d, intact fruit treated with 10 L.L1 ethylene under normoxia had 2fold higher electrolyte leakage compared with co ntrol fruit and leakage of fruit treated with ethylene applied under hyperoxia was about 2fold higher than leakage of fruit treated with ethylene under normoxia. Electrolyte leakage of intact fruit treated with ethylene under normoxia, hyperoxia, or hypox ia was 65%, 90%, or 35% at 11 d, respectively. In fresh cut slices, enhanced electrolyte leakage by exogenous ethylene was negated under hypoxia while there was no acceleration by hyperoxia (Fig. 46 B). Fresh cut slices stored under normoxic or hyperoxic conditions with 10 L.L1 ethylene exhibited 2fold and 4fold increased electrolyte leakage compared with air treated slices at 5 d and 7 d, respectively. Increased electrolyte leakage due to ethylene exposure was greater in fresh cut slices than in intac t fruit. At 9 d, freshcut slices stored with ethylene under normoxia or hyperoxia exhibited around 90% electrolyte leakage while intact fruit

PAGE 81

81 exposed to ethylene under normoxia or hyperoxia had 55% or 65% electrolyte leakage, respectively. DCFH (2, 7di chlorofluorescin) assay was employed to measure total reactive oxygen species (ROS) generating capacities in mesocarp tissue disks of intact fruit and fresh cut slices stored under normoxia with or without ethylene (Fig. 47). ROS generation of intact frui t treated with air (IFA) amounted to about 0.6 mol of H2O2 equivalents per mesocarp disk per h at 2 d. ROS generating capacity of IFA increased to 2.6 mol/disk/h at 4 d, reached a maximum of 3.9 mol/disk/h at 8 d, and declined at 10 d. ROS production was significantly enhanced in intact fruit challenged with 10 L.L1 ethylene. Intact fruit exposed to ethylene (IFE) exhibited 5.0 mol/disk/h of total ROS generating capacity at 2 d and maximum ROS generating capacity of 9.0 mol/disk/h at 6 d. Total ROS g enerating capacity of IFE was about 23and 11fold higher at 4 and 6 d, respectively, compared with IFA. Freshcut slices had higher total ROS generating capacity than intact fruit during storage. Increases in ROS generating capacity in freshcut slices w ere noted early in storage. Freshcut slices treated with air (FSA) produced 1.5 mol/disk/h of total ROS at 2 d, increasing to a maximum of 6.2 mol/disk/h at 8 d. There was an 8.5and 3fold increase in ROS generating capacity of FSA compared with the v alue of IFA at 4 d and 6 d, respectively. When freshcut slices were challenged with 10 L.L1 ethylene, total ROS generating capacity was significantly enhanced. Fresh cut slices treated with 10 L.L1 ethylene (FSE) exhibited 3.3 fold higher total ROS ge nerating capacity (about 5.0 mol/disk/h) at 2 d compared with values for FSA. Total ROS generation of FSE was 2.6and 4.6fold higher than the value of FSA at 4 d and 6 d, respectively. In addition, ethyleneinduced increases in total ROS generating

PAGE 82

82 cap acity were significantly enhanced in freshcut slices (FSE) than intact fruit (IFE). Total ROS generation of FSE at 2 d was nearly 6fold higher compared with the value of IFE. FSE produced peak total ROS production (14.2 mol/disk/h) at 8 d; 2.3and 1.8fold increase compared with FSA and IFE, respectively. Both IFE and FSE showed steeper decline in total ROS production at 10 d compared with IFA and FSA. Discussion Watersoaking in immature beit alpha cucumber fruit was initiated in hypodermal tissue, subsequently affecting inner mesocarp tissues. As comparing ethylene responses of intact fruit and freshcut slices, the hypothesis that tissue ethylene and oxygen gradients can affect this spatial pattern of watersoaking was tested. Altering tissue ethylene and oxygen gradients through the use of freshcut slices did not alter the spatial pattern (initial appearance in hypodermal region) of watersoaking development and in fact greatly diminished watersoaking development. These observations indicate that water soaking in immature beit alpha cucumber fruit is a tissuespecific phenomenon caused by exogenous ethylene. Tissuespecific responses to ethylene have been shown in other commodities. Flores et al. (2001) reported that downregulation of ACO (1aminocyclopropane 1carboxylic acid oxidase) activity in melon fruit blocked autocatalytic ethylene production and suppressed ripening processes (degradation of chlorophyll, accumulation of carotenoids) in rind tissue but not in pulp tissue. In tomato, ethylene signaling mechanisms are differentially affected in a tissuespecific manner (Barry and Giovannoni, 2006). Overexpression of GR (Greenripe) induced nonripening phenotype (Gr) fruit, but not ethylene insensitivity in tomato hypocotyls and petiole tissues.

PAGE 83

83 This tissue specific modulation of ethylene responses in immature cucumber fruit could be the consequence of different expression patterns of ethylene receptors and downstream elements among tissue s. Diverse gene expressions of receptor family in different tis sues h ave been reported in other studies In tomato, the expression of six ethylene receptor genes was varied significantly depending on tissue types (Tieman and Klee, 1999). The outer, mid, and inner portions of melon fruit flesh exhibited slightly differ ent patterns of CmERS1and CmETR1 expression (SatoNara et al., 1999), and different ETR gene expression was shown in epicarp and mesocarp tissue of plum fruit (Fernandez Otero et al., 2007). Tissue specific expression of CTR1like genes, the downstream el ement of receptors, was also reported in t omato (Adams Phillips et al., 2004) and kiwi fruit (Yin et al., 2008). The ethylene signaling systems of different ethylene receptors could play specialized roles in determining ethylene response through different r egulations by ethylene and/or different interactions with CTR1. Different response of receptor family to ethylene was reported in tomato fruit where ethylene induced an increase in NR and LeETR4 levels but a decrease in LeETR2 levels ( Ciardi et al. 2000) ETR1 like receptors have been reported to bind more strongly to CTR1 than ETR 2 like receptors (Guo and Ecker, 2004). Furthermore, different combinatorial gene regulations among tissue could result in tissue specificity for ethylene. Highly conserved proteins such as GR (Green Ripe) in tomato and RTE1 ( ReversionTo Ethylene sensitivity1) in Arabidopsis have been reported to interact with specific receptors providing an explanation for tissuespecific ethylene responses (Klee, 2006) Proteosomal degradati on of transcription factors, especially by 26S, might also play a role in tissuespecific ethylene responses (Trobacher, 2009).

PAGE 84

84 While the spatial pattern of watersoaking was similar in intact fruit and freshcut slices, fresh cut slices exhibited much less acute ethyleneinduced watersoaking compared with intact fruit. This result stands in sharp contrast to watersoaking phenomena as reported for tomato (Hong and Gross, 1998; Jeong et al., 2004), watermelon (Mao et al., 2005), papaya (Ergun et al., 2006) and Galia (Ergun et al., 2007) and cantaloupe (Jeong et al., 2008; LunaGuzman et al., 1999) fruits. In these fruits, quality of freshcut tissues even in response to storage in air is greatly limited by accelerated tissue watersoaking and juice leakage. I nterestingly, in some cases, for example tomato (Jeong et al., 2004), cantaloupe (Jeong et al., 2008) and Galia(Ergun et al., 2007) fruits, watersoaking represents largely a fresh cut specific phenomena, as the disorder occurs negligibly in intact fruit and only at very late stages of ripening. Whereas 1 MCP treatment completely prevented ethyleneinduced watersoaking in intact beit alpha cucumber fruit (Lima et al., 2005), watersoaking was reduced but not prevented in 1MCP treated freshcut tomato (Jeong et al., 2004) and papaya (Ergun and Huber, 2004). Taken together, these findings suggest that watersoaking is commodity dependent.and that complicated and multiple mechanisms are involved in watersoaking development. Greater resistance to watersoaking development in freshcut slices could be explained by reported differences in ethylene sensitivity of intact versus wounded tissues. Blocking ethylene reception by application of 1MCP, an ethylene action inhibitor, was less beneficial or detrimental in fresh cut products. In apple fruit, 1MCP was more effective in intact fruit than freshcut slices and 1 MCP more beneficial when applied before processing than after (Jiang and Joy, 2002). 1MCP prevented softening

PAGE 85

85 of placental tissue in intact watermelon (M ao et al., 2004) but not in freshcut watermelon (Mao et al., 2005). Softening of persimmons was retarded when 1MCP was applied to intact fruit prior to freshcut processing but not after processing (Vilas Boas and Kader, 2007). Furthermore, 1MCP applica tion directly to pear slices induced even poorer quality attributes (Lu et al., 2009). Increased decay by 1MCP treatment was reported in freshcut cantaloupe cubes (Jeong et al., 2004), pineapple slices (Budu and Joyce, 2003) and Gala apple slices (Bai et al., 2004). This reduced efficiency of 1MCP in fresh cut products could be the consequence of ethyleneactivated protective mechanisms in wound ed tissues as reported by ODonnell et al. (1996). In the same manner, ethyleneinduced protective mechanisms seem to play a role in retarding watersoaking development in freshcut slices of cucumber fruit. What makes fresh cut slices highly resistant to watersoaking could also be the enhanced accumulation of reactive oxygen species (ROS). In present study, f res h cut slices had higher ROS generating capacities than intact fruit and exhibited greater increase in ROS generation when challenged with ethylene. Accumulation of ROS h a s been widely reported as a response to wounding stress (Hodges et al., 2004), and fre sh cut products generally exhibit 2to 3 fold higher respiration rates than intact fruit (Cantwell and Suslow, 2002; Watada et al., 1996). Wounding accelerates a number of physiological mechanisms such as defense signaling pathways (via formation of syste min, oligogalacturonides, and oxylipins) and ion channel activation pathways at membrane (Leon et al., 2001). Accordingly, the increased respiration and metabolic demands of wounded tissues likely contributed to earlier and higher production of ROS in fres h cut slices. In addition, excessive production of ROS could be the result of

PAGE 86

86 greater water loss in freshcut products. Dehydration is a major factor limiting the quality of fresh cut products (Salade et al., 2007; Toivonen and Brummell, 2008) Yan et al. (2003) reported that water deficit condition enhanced ROS accumulation, especially H2O2, in tobacco leaves Wound induced ROS in cucumber slices could act as signals to accelerate scavenging systems as reported by Mittler (2002). P lants modulate production and removal of ROS using nonenzymatic and enzymatic antioxidant mechanisms (Apel and Hirt, 2004). Increased ROS accumulation by freshcut processing can induce increased antioxidant levels which might explain the reduced watersoaking in freshcut cucumber slices compared with intact fruit. Significant increases in antioxidant capacity by freshcut processing were reported in celery stem (442%), lettuce leaves (233%), and carrot roots (77%) (Reyes et al., 2007). It has been noted that wounding can enhance antioxidant capacity through increased phenolic antioxidants (Ryes et al., 2007; Heredia and Cisneros Zevallos 2009). Furthermore, synergetic effects of wounding and exogenous ethylene at enhancing antioxidant levels were reported in study of Heredia and Cisneros Zevallos (2009) where ethylene exposure (1000 L.L1 for 4 d) enhanced antioxidant capacity in freshcut lettuce leaves and carrot roots but not in whole lettuce leaves and carrot roots. Collectively, enhancing antioxidant levels due to freshcut processing and exogenous ethylene might play a role in prevent ing watersoaking development in freshcut slices of beit alpha cucumber fruit. This enhanced antioxidant system can also explain how hyperoxia enhanced softening, electrolyte leakage and waters oaking in ethylenetreated intact fruit but not in freshcut slices. Increased antioxidant system in freshcut slices could accelerate healing of tissue and decrease

PAGE 87

87 susceptibility to physical disorder, which can make freshcut slice highly resistant to wa tersoaking even when challenged with ethylene under hyperoxia. This present study demonstrated that ethylene responses in cucumber fruit are pO2dependent. In intact fruit, hyperoxia (40 kPa O2) accelerated ethyleneinduced watersoaking and accompanying s ymptoms including degreening softening and enhanced electrolyte leakage while hypoxia (2 kPa O2) strongly suppressed these symptoms. In f resh cut slices, hyperoxia did not enhance watersoaking nor accompanying symptoms while hypoxia did largely prevent et hyleneinduced symptoms in slices. Similarly, s trong influence of pO2 on e thylene responses (ripening and enhanced respiration) has been reported in other fruits including avocado ( Metzidakis and Sfakiotakis, 199 5; Burg, 2004), banana (Kanellis et al., 1989; Jiang and Joyce, 2003), kiwi ( Stavroulakis and Sfakiotakis, 1997), muskmelon (Altman and Corey, 1987) and tomato (Kapotis et al., 2004) Strong influence of pO2 on ethylene responses might be mediated through controlling overall metabolic processes w hich could be the consequence of changes in gene expression and/or enzyme activities. For example, storage under hypoxic conditions significant ly suppressed gene expression of hydrolytic enzymes (Kanellis et al., 1989a, b, 1991, 1993; Loulakakis et al., 2006; Owen et al., 2004 ; Pasentsis et al., 2007). I dentified h ypoxia / anoxiainduced genes include transcription factors (de Vetten and Ferl, 1995; Hoeren et al., 1998) and signal transduction elements (Baxter Burrell et al., 2002; Dordas et al., 2003) The synthesis of mRNA and polypeptides associated with ethylene response could be inhibited through suppression in translation by the dissociation of polysomes (Lin and Key, 1987; Sachs and Ho, 1986 ) and/or in the

PAGE 88

88 expression of mRNA ( Kanellis, 1987, Sachs and Ho, 1986) Strong influence of pO2 on enzymic activity or levels was also reported in several studies. Hypoxic condition (2.5 kPa O2) suppressed the activities of polygalacturonase (PG), acid phosphatase, and cellulase in b anana and avocado fruit (Kanellis et al., 1989 a, 1989b; Metzidakis and Sfakiotakis, 1995). Suppressed activity of PG, galactosidase, and cellulose were also observed in hyperoxia (80 kPa O2) treated grape fruit maintaining fruit firmness (Deng et al., 2005). Since cell wall degradation has been reported to play a role in watersoaking development (Karakurt and Huber, 2004), this significant influence of pO2 on cell wall enzymes could result in modulation of watersoaking disorder in cucumber fruit. Another explanation for the significant influence of pO2 on ethylene responses might be found in changes in ethylene product ion and/or ethylene sensitivity. This view is parallel to that of Kanellis et al. ( 199 3) and Solomos and Kanellis ( 1997) mentioning that the effects of hypoxia were mediated through inhibition of ethylene biosynthesis and action Hypoxia delayed ethylene biosynthesis was observed in broccoli buds ( Makhlouf et al., 1989) and avocado fruit (Metzidakis and Sfakiotakis, 1995) In apple, t he rise in ethylene evolution was delayed when 1MCP (1 L.L1) and hypoxia (1.52 kPa O2) were applied together (Asif et al., 2006) pO2 appears to influence ethylene production mainly through modulating the activity of 1 aminocyclopropane1 carboxylic acid oxidase (ACO) as considering O2 is a co substrate for this e nzyme ( Ververidis and John, 1991; Dong et al., 1992; Sairam et al., 2008) Km values for O2 are 0.4 and 0.440.53 kPa in ACO purified from apple (Kuai and Dilley, 1992) and pear fruit (Vioque and Castellano, 1994; Kato and Hyodo, 1999), respectively. Storage below 5 kPa O2 can

PAGE 89

89 suppress ACO activity since internal pO2 is much lower than external pO2 due to gas diffusion barriers For example, ripe tomato fruit stored under 4 kPa O2 exhibited 0.2 kPa of internal pO2 (Berry and Sargent 2009) and pO2 level of inner cucumber tissue was 0.3 kPa when stored at 5 kPa O2 (Prae ger and Weichmann, 2001). Under hypoxic conditions ( 2 2.5 pKa O2), reduced ACO level s w ere observed in broccoli flower buds (Makhlouf et al., 1989) and apple fruit (Gorny and Kader, 1999). The i nfluence of pO2 in ethylene sensitivity has also been shown in several studies. E longation of petioles of Rumex species was enhanced in response to hypoxia through an increase in ethylene sensitivity but not ethylene production (Blom et al., 1994; Voesenek et al., 1996, 1997). Up regulation of RP ERS1 expression in R umex was highest when ethylene (5 L.L1) and hypoxia (3 kPa O2) were applied in combination (Voesenek et al., 1997; Vriezen et al., 1997). In banana fruit, 1MCP treated fruit softened more rapidly under hyperoxic conditions, leading to speculation that hy peroxia enhanced synthesis of new ethylene receptors (Jiang and Joyce, 2003). Taken together, O2 might act in a rate limiting factor in watersoaking of cucumber fruit by affecting ethylene production and/or action. Altered responses to e thylene in respons e to changes in pO2 appear to support an important role of reactive oxygen species (ROS) in watersoaking development as mentioned in C hapter 3. Continuous ethylene exposure (10 L.L1) induced marked increases in ROS generating capacity, preceding the decl ine of firmness and hue angle, and increased electrolyte leakage, and well in advance of incipient watersoaking (Chapter 3 and present study). pO2 could affect ROS level s through supplying different level of a substrate (O2) and modulating various metaboli c activities including oxidases and peroxidases. For example, hypoxia stimulated ROS generators including xanthine

PAGE 90

90 oxidase, NADH and NADPH oxidase in apple fruit (Gong and M a ttheis, 2003) and h ypoxia induced genes include ROS scavenging enzymes including p eroxidase and superoxide dismutase in Arabidopsis (Klok et al., 2002). Living organisms respond to biotic and abiotic stress through significant crosstalk between ROS and hormones including salicylic acid, jasmonic acid, and ethylene (Overmyer et al., 2003; Kwak et al., 2006; Parent, 2008). Overmyer et al., (2003) noted that ROS could mediate ethylene signaling directly or indirectly. Therefore, we cant exclude the possibility that altered ROS level depending on pO2 might induce significant modification in ethylene responses of cucumber fruit. Fresh cut cucumber slices experienced significant peel discoloration, but not enhanced softening or electrolyte leakage. Intact immature cucumber fruit, however, maintained initial peel hue value even though chlorophyll declined nearly 70% during 12 d of storage in ethylene (Hurr et al., 2009). Discoloration is a major factor limiting shelf life and marketability of freshcut products. Toivonen and Brummell (2008) mentioned that Type II chlorophyll breakdown occurs in d amaged cells of green plant tissues. Type II chlorophyll breakdown is mainly regulated by ROS (Brown et al., 1991). ROS are generated in the process of f atty acid degradation ( by chlorophyll oxidase and/or lipoxygenase) and phenolic compounds degradation ( by chlorophyll peroxidase) which can directly oxidize chlorophyll molecules and result in loss of green color ( Toivonen and Brummell 2008) This view is supported by several reports. Pheophytin accumulation was observed in discolored parsley leaves (Yamauchi and Watada, 1991) and discolored cabbage discs had increased lipoxygenase activity and fatty acid degradation (Chour et al., 1992). Strong association between chlorophyll peroxidase,

PAGE 91

91 oxidase, and/or lipoxygenase activity and chlorophyll loss was observed in broccoli florets (Zhang et al., 1994; Funamoto et al., 2002, 2003; Costa et al., 2005). Based on increased ROS production by freshcut processing in present study, ROS induced Type II chlorophyll oxidation might result in more significant peel di scoloration in freshcut slices than intact fruit. Combination of fresh processing and exogenous ethylene enhanced electrolyte leakage but not softening. This nonparallel relationship between firmness and electrolyte leakage was observed in tomato fruit (Lee et al., 2007) and Galia melon fruit (Ergun et al., 2007). Observed firmness retention in freshcut cucumber slices could be a case of the development of hardening at the cut surface which is observed in some vegetables (Everson et al., 1992; Via and Chaves, 2003). R etention of firmness in fresh cut slices could be a consequence of enhanced water loss. Freshcut processing removes natural barriers to gas diffusion and transpiration and results in greater surface area to volume, enhancing water loss ( Toivonen and Brummell, 2008). Firmness increase/retention by water loss was reported in intact immature cucumber fruit (Hurr et al., 2009). However, tissue disruption during freshcut processing can contribute to enhanced electrolyte leakage due to cell wa ll degradation. Karakurt and Huber (2003) noted that wounding induced rapid deterioration of freshcut papaya fruit along with increased activities of enzymes targeting cell wall and membranes including polygalacturonase, alphaand betagalactosidases lipoxygenase, and phospholipase D In summary the data from this study clearly demonstrated that watersoaking is a tissue specific response. Interestingly, whole fruit exhibited more severe and rapid watersoaking than freshcut slices. Altered ethylene res ponses by pO2 were observed in

PAGE 92

92 both intact fruit and freshcut slice s. In whole fruit, hyperoxia exacerbated watersoaking and accompanying symptoms such as yellowing, softening and enhanced electrolyte leakage while hypoxia delayed these symptoms. In freshcut slices, hypoxia negated the development of ethyleneinduced responses and there was no acceleration by hyperoxia. Strong influence of pO2 on watersoaking and the enhanced resistance to watersoaking in freshcut slices suggested that r eactive oxygen species (ROS) could play an important role in mediating watersoaking development of immature cucumber fruit.

PAGE 93

93 A Slices from intact fruit B Fresh cut slices Figure 41. Watersoaking development of beit alpha cucumber fruit stored at 13 oC. Intac t cucumber fruit and freshcut slices were treated for 7 d with air or .L1) under normoxic, hyperoxic, and hypoxic conditions. A) Slices derived from intact fruit. B) Fresh cut slices. 21 kPa O 2 (air) 21 kPa O 2 + 10 L L 1 C 2 H 4 2 kPa O 2 + 10 L L 1 C 2 H 4 40 kPa O 2 + 10 L L 1 C 2 H 4 21 kPa O 2 (air) 21 kPa O 2 + 10 L L 1 C 2 H 4 2 kPa O 2 + 10 L L 1 C 2 H 4 40 kPa O 2 + 10 L L 1 C 2 H 4 Watersoaking

PAGE 94

94 A Slices from intact fruit B Fresh cut sli ces Figure 42. Watersoaking development of beit alpha cucumber fruit stored at 13 oC. Intact cucumber fruits and freshcut slices were treated for 9 d with air or .L1) under normoxic, hyperoxic, and hypoxic conditions. A) Slice s derived from intact fruit. B) Freshcut slices. 21 kPa O 2 (air) 21 kPa O 2 + 10 L L 1 C 2 H 4 2 kPa O 2 + 10 L L 1 C 2 H 4 40 kPa O 2 + 10 L L 1 C 2 H 4 21 kPa O 2 (air) 21 kPa O 2 + 10 L L 1 C 2 H 4 2 kPa O 2 + 10 L L 1 C 2 H 4 40 kPa O 2 + 10 L L 1 C 2 H 4

PAGE 95

95 Figure 43. Surface hue angle of beit alpha cucumber fruit during storage at 13 oC under air or 10 LL1 ethylene under normoxic, hypoxic, and hyperoxic conditions. Each point repres ents the mean of 20 measurements (5 fruit, 2 slices per fruit, 2 measurements per slice). Vertical bars represent LSD ( 0.05). A) Slices derived from intact fruit. B) Fresh cut slices.

PAGE 96

96 Figure 44. Mesocarp hue angle of beit alpha cucumber fruit during storage at 13 oC under air or 10 LL1 ethylene under normoxic, hypoxic, and hyperoxic condit ions. Each point represents the mean of 20 measurements (5 fruit, 2 slices per fruit, 2 measurements per slice). Vertical 0.05). A) Sli ces derived from intact fruit. B) Fresh cut slices.

PAGE 97

97 Figure 45. Mesocarp firmness of beit alpha cucumber fruit during storage at 13 oC under air or 10 LL1 ethylene under normoxic, hypoxic, and hyperoxic conditions. Each point represents the mean of 20 measurements (5 fruit, 2 slices per fruit, 2 measurements per slice). Ver tical bars represent LSD ( 0.05) A) Slices derived from intact fruit. B) Fresh cut slices.

PAGE 98

98 Figure 46. Electrolyte leakage of beit alpha cucumber fruit during storage at 13 oC under air or 10 LL1 ethylene under normoxic, hypoxic, and hyperoxic conditio ns. Each point represents the mean of 10 measurements (5 fruit, 2 A) Slices derived from intact fruit. B) Fresh cut slices.

PAGE 99

99 Figure 47. Total ROS generating capacit y of mesocarp disks derived from intact or fresh cut slices of beit alpha cucumber fruit stored at 13 oC under air 10 LL1 ethylene. The production of total ROS was demonstrated using the oxidation of DCFH to DCF. Relative fluorescence at 520 nm was tr ansformed into the production of H2O2 in moles per disk using a standard curve. Each point represents the mean of 3 fruit. Vertical bars represent LSD (

PAGE 100

100 CHAPTER 5 THE EFFECTS OF HYPOX IA AND HYPEROXIA ON ETHYLENE INDUCED WATERSOAKING IN IMMATURE BEIT ALPHA CUCUMBER FRUIT Introduction Watersoaking the appearance of tissue translucency, is a characteristic ethylene response observed in immature cucumber fruit ( Lima et al., 2005; Hurr et al., 2009; Chapter 3 and 4) as well as in other members of the Cucurbitaceae including watermelon (Karakurt and Huber, 2002; Mao et al., 2004) and cantaloupe melon (Bernadac et al., 1996). This disorder is charac terized by acute softening, subdermal tissue translucency, loss of epidermal green color, enhanced electrolyte efflux, and cell wall disassembly (Karakurt and Huber, 2002; Mao et al., 2004; Lima et al., 2005). Application of 1methylcyclopropene (1MCP), a n inhibitor of ethylene perception ( Serek et al. 1994; Sisler and Serek 1997), inhibited watersoaking development of immature cucumber fruit, confirm ing the involvement of ethylene in the disorder (Lima et al., 2005). In ethylenetreated cucumber fruit, i ncipient watersoaking is first evident in hypodermal (outlayer of mesocarp tissues) tissues and then progresses into inner mesocarp tissues (Chapter 3). This spatial pattern was s imilar in both intact fruit and freshcut slices ( C hapter 4), indicating that watersoaking is a tissue specific ethylene response. Ethylene responses of cucumber fruit were influenced by several factors. Ethylene dose dependency was shown in the report of Villalta and Sargent (2004), wherein watersoaking accompanied by enhanced res pirat ion, softening, surface degreening .L1. In C hapter 3, ethylene .L1 had no further effect on the physiology of cucumber fruit E thylene exposure duration influences watersoaking development in cucumber fruit. .L1 ethylene showed no significant detrimental

PAGE 101

101 effect on quality of cucumber fruit during 20 d of storage while e thylene exposure for 4 d induced watersoaking much more slowly compared with continuous exposure (Chapter 3). Maturity of cucumber fruit is another factor affecting watersoaking disorder. W atersoaking disorder was observed in immature (4 6 d after anthesis) and to a lesser extent in mature cucumber fruit (1014 d after anthesis), while fruit at more advanced maturity exhibited chlorophyll degradation, fruit aroma evolution, and massive carotene without watersoaking (Hurr et al. 200 9 ). Oxygen level ( pO2) can also alter ethylene responses. Ethylene responses in immature cucumb er fruit were influenced by pO2 ( C hapter 4). H yperoxia (40 kPa O2) accelerated ethyleneinduced watersoaking and accompanying symptoms including degreening, softening and enhanced electrolyte leakage in intact fruit. Storage under h ypoxia (2 kPa O2) strong ly suppressed ethyleneinduced symptoms in both intact fruit and fresh cut slices. Altered ethylene responses by pO2 were also reported in other commodities such as avocado (Burg, 2004), banana (Kanellis et al 1989), and muskmelon (Altman and Corey, 1987). Oxygen is one of the most important factors influencing the postharvest physiology such as respiration rate, chlorophyll degradation, cell wall degradation, and phenolic oxidation (Mir and Beaudry, 2001; Burg, 2004). p O2 could mediate ethylene r esponses through modulation in ethylene perception and production and/or in the levels of active oxygen species (ROS) (Kader and BenYehoshua 2000) ROS are partially reduced forms of g round state O2. Examples include singlet oxygen ( O2 1) formed by energy transfer and superoxide (O2 -) hydrogen peroxide (H2O2) and hydroxyl radical (HO.) formed by sequential electron transfer (Klotz, 2002).

PAGE 102

102 ROS are highly reactive and destructive, shown to cause significant tissue deterioration ( Rao et al., 2000; Overmyer et al., 2003; Circu and Aw, 2010). Plants continuously generate ROS as by products of various metabolic pathways mainly in chloroplasts, mitochondria, and peroxisomes (Foyer and Harbinson, 1994 ; Apel and Hirt, 2004 ; Circu and Aw, 2010). Depending on the character of biotic and abiotic stresses plant s differentially enhance the generation of ROS that are chemically distinct and/ or are produced within different cellular compartments (Elstner, 1991). In ethylenetreated cucumber fruit greatly enhanced ROS generat i on was observed as an early cellular event before incipient w atersoaking ( C hapter 3 and 4). Excessive ROS was shown to trigger programmed cell death ( PCD) in plants ( Desikin et al. 2001 ; Rao and Davis, 2001; Mur et al., 2005). W atersoaking in immature cuc umber fruit is a form of PCD, supported by the presence of PCD hallmarks such as loss of cell viability, enhanced nuclease activity and DNA laddering in ethylenetreated fruit ( Hurr et al., 20 10) Altering ROS levels could modulate the onset and developmen t of PCD including watersoaking in immature cucumber fruit. E nhanced ROS during stimuli can pose a threat to cells but can also serve as signals to activate antioxidant systems (Mittler, 2002) As b iological organisms attempt to maintain homeostatic equil ibrium between production and scavenging of ROS o xidative damage could be inhibited by direct quenching of ROS or through disruption of ROS propagation (Alscher and Hess, 1993). Plants have nonenzymatic and enzymatic ROS scavenging mechanisms (Apel and Hi rt, 2004). Nonenzymatic antioxidants include ascorbate and glutathione, tocopherol, flavonoids, alkaloids, and carotenoids. Enzymatic ROS scavenging mechanisms in plants include superoxide dismutase

PAGE 103

103 (SOD), ascorbate peroxidase (APX), glutathione peroxidase (GPX), and catalase (CAT). The response of antioxidative systems to oxidative stress during postharvest storage varied depending on commodities and/or cultivars, indicating the complexity of antioxidant system s to oxidative stress ( Hodges et al., 2004) P revious studies ( C hapter 3 and 4) suggested that ROS could play an important role in watersoaking development of immature cucumber fruit. To confirm the involvement of ROS accumulation in watersoaking, the present study investigated the change in production of ROS, especially h ydrogen peroxide (H2O2) and superoxide anion (O2 -) of immature cucumber fruit in response to altered p O2. As o xidative damage could be controlled by altering antioxidant systems (Alscher and Hess, 1993 ; Mittler, 2002) this study al so examined whether ethyleneenhanced ROS induces counter increases in antioxidant levels T he effect of preconditioning under hypoxia on subsequent ethylene responses was also investigated. Materials and Methods Plant M aterials Experiments were conducted with b eit alpha cucumber ( Cucumis Sativus L.; Manar) harvested at immature stage ( average fruit wt. 86 3.2 g) from a commercial greenhouse facility in Live oak, FL. Freshly harvested fruit were returned to Gainesville within 2 h where they were sorted by size, color and appearance, sanitized with 2.7 mM sodium hypochlorite, and air dried. Intact fruit (n=40) were stored in 20 L plastic containers provided with flow through atmospheres of air (21 kPa O2) 10 L.L1 ethylene, 2 kPa O2 (balance N2) 10 L.L1 ethylene, or 40 kPa O2 (balance N2) 10 L.L1 ethylene. F low rate was maintained at 500 mL.min1 to avoid CO2 accumulation. In an experiment designed to study the effect of preconditioning under hyperoxia,

PAGE 104

104 containers were connected with flow throug h atmosphere of 2 kPa O2 (balance N2) for 8 d and then reconnected with flow through atmosphere of air (21 kPa O2) 10 L.L1 ethylene for the duration of storage. At intervals during treatments, changes in electrolyte leakage, mesocarp firmness, ROS generating capacity, antioxidant capacity, and watersoaking incidence were monitored Electrolyte L eakage Electrolyte leakage was measured using a conductivity bridge (YSI 3100 conductivity instrument; Ohio, USA) equipped with a conductivity electrode. Five i ndividual fruits were evaluated per treatment every other day. Mesocarp dis ks (n=5) of 4.5 mm diameter were excised using a No. 2 Cork borer from 2 slices (10 mm thickness) per fruit. Five d is ks were rinsed with distilled water, briefly dried on Whatman #4 filter paper, and transferred into 25 ml of 250 mM mannitol solution (Villalta and Sargent, 2004) in a 50 ml capped centrifuge tube. Samples were shaken in an oscillating shaker (Model 5850; Eberbach, Ann Arbor, MI) at 1 cycle/s for 4 h, electrical conductivity of the bathing solution was measured. Samples then were frozen at 20 C. After 24 h the samples were thawed at room temperature, heated in a boiling water bath for 15 min, and after cooling to room temperature, the final conductivity was determined. All leakage data were expressed as a percentage of total electrolyte conductivity, where initial conductivity was divided by total conductivity, and multiplied by 100. Mesocarp F irmness Mesocarp firmness was determined using an Instron Universal Testing Instrument (Model 4411; Canton, MA, USA) equipped with a convex tip probe ( 3 mm diameter) and 0.05 kN load cell. S lices (10 mm thick) were prepared from intact fruit with a double

PAGE 105

105 blade knife. Each slice was placed on a solid flat plate and z ero height w as established between the probe and the mesocarp tissue. The probe was driven with a crosshead speed of 5 0 mmmin 1 and the force was recorded at 2.5 mm deformation. This analysis was made every other day with one slice from each fruit (3 fruit per treatm ent) and 3 measurements were made per slice. ROS R elease from Mesocarp Disks Total reactive oxygen species (ROS) generating capacity was measured using the method of Schopfer et al. (2001) with some modifications. ROS oxidize s 2,7 dichlorofluorescin (DC FH) to the highly fluorescent 2,7 dichlorofluorescein (DCF) and fluorescence increase can be used to determine the amount of ROS release. DCFHdiacetate (10 mM) was dissolved in ethanol and stored at 20 oC as a stock solution. Fifty M DCFHDA was prepared from the stock solution with 20 mM K phosphate ( pH 6.0 ). Deacetylayion of DCFHDA (50 M ) was perf o rm ed using 0.1 g.L1 of esterase (EC 3.1.1.1 from porcine liver) at room temperature for 15 min. This solution was used for the assay immediately and dis carded each day after use. M esocarp disks ( 4.5 mm wide by 10mm thick three disks per fruit) were prepared from cucumber slices (10 mm thickness) with a cork borer (#2) Three disks were rinsed with distilled water, briefly blotted on Whatman #4 filter paper, and incubated in a 50 mL centrifuge tube containing 10 mL of working solution in the dark for 15 min. ROS release was quantitatively determined by measuring relative fluorescence of aliquots (2 mL) in a fluorometer ( VersafluorTM fluorometer; Bio Rad La boratories, Inc., CA, USA ) (Ex: 480 nm, Em: 520 nm) Working solution without tissue was used to zero the instrument and 10 mM H2O2 (final concentration) to set the maximum fluorescence as 10, 000. Fluorescence was transformed into production of H2O2 in moles per disk per h using a standard curve

PAGE 106

106 prepared with dilutions of H2O2 (final concentrations of 0, 10, 100, 1000, and 10000 M). This analysis was conducted every other day with 3 individual fruit per treatment. H2O2 R elease from Mesocarp Disks For quantitative determination of hydrogen peroxide (H2O2) production in vivo scopo le tin assay was conducted as described by Schopfer et al. (2001) with some modifications. This method uses the decrease in fluorescence by H2O2dependent oxidation of scopoletin. M esocarp disks (4.5 wide by 10 mm thick, three disks from 2 slices per fruit) were taken with a cork borer (#2) Three disks were incubated in a 50 mL centrifuge tubes containing 4 mL of working solution (5 M scopoletin and 3 g.mL peroxidase from horseradish (EC 1.11.1.7) in 20 mM K phosphate, pH 6) in dark. After 15 min, relative fluorescence of aliquots was read in a fluorometer ( VersafluorTM fluorometer; BioRad Laboratories, Inc., CA, USA ) (Ex: 360 nm, Em: 46 0 nm) Phosphate buffer was used to set zero and working solution (without tissue) to set maximum fluorescence as 10000. A standard curve was prepared with dilutions of H2O2 (0, 1, 10, 100 M). Reduction of fluorescence was transformed into production of H2O2 in nmoles per disk per h using a standar d curve. This analysis was conducted every other day with 3 individual fruit per treatment. O2 R elease from Mesocarp Disks For quantitative determination of superoxide anion (O2 ) production in vivo XTT {2,3 bis (2 methoxy 4 nitro 5 sulfophenyl) 5 [(ph enylamino)carbonyl] 2H tetrazolium hydroxide} was used as a sensitive and physiologically compatible probe (Schopfer et al., 2001; Aktas et al., 2005). XTT forms a water soluble and colored formazan that is not adsorbed to plant tissues, allowing a sensiti ve quantitative photometric determination of superoxide in vivo Mesocarp disks (4.5 wide by 10 mm thick, three

PAGE 107

107 disks from 2 slices per fruit) were taken with a cork borer (#2) Three disks were incubated in a 50 mL centrifuge tubes containing 4 mL of work ing solution (500 M XTT in 20 mM K phosphate, pH 6) in dark The reaction was initiated by adding NADH to a final concentration of 200 M After 60 min, three aliquots (0.3 mL) per sample were taken and the absorbance at 490 nm was read in a Gen5 microplate spectrophotometer (Bio Tec Instruments, Inc., VT, USA) Working solution (without tissue) was r u n in parallel to correct unspecific absorbance. The absorbance at 490 nm was transformed in to production of O2 in nmoles per disk per h using an extinction coefficient of 2.16 104 M1cm1 (Sutherland and Learmonth, 1997). This analysis was conducted every other day with 3 individual fruit per treatment. Quantification of A ntioxidant C apacity For quantification of total antioxidants, modificed ABTS [2,2 Azino bis(3 ethylbenzothiazoline6 sulfonic acid) diammonium salt] assay was conducted as described by Ozgen et al. (2006) with some modifications. ABTS is a sensitive probe abstracting an electron from antioxidants, resulting in color change. On every other day, mesocarp and exocarp tissues were excised from intact fruit and stored at 40 oC for later analysis. Partially thawed samples (1 g) were homogenized with 5 mL of distilled water using a polytron and centrifuged at 12,000 x g for 30 min at 4 C. The resulting supernatants were filtered through cheesecloth and used for antioxidant assay. Working solution was prepared as follows: A solution of 7 mM ABTS in 20 mM Naacetate (pH 4.5) was treated with potassium peroxodisulfate ( final concentration of 2.45 mM), and then incubated over night in dark. This stock solution was diluted 90 95 times with 20 mM Na acetate (pH 4.5) until the absorbance at 734 nm reached 0.70 0.01, which was used as the working solution for ABTS assay. Fruit extract prepared as des cribed

PAGE 108

108 above (20 L) was incubated with 3 mL of working solution. After 2 h, three aliquots (0.3 mL) per sample were taken and the absorbance at 734 nm was read in a Gen5 microplate spectrophotometer (BioTec Instruments, Inc., VT, USA) A standard curve w as prepared with dilutions of Trolox (0 100 M) in working solution. Absorba nce at 734 nm was expressed as t rolox equivalents (TE; mol per g tissue fresh weight ) based on the standard curve. This analysis was performed every other day with 3 individual fruit per treatment. Results The E ffect of H yperoxia on W atersoaking D evelopment. Figure 51showed the effect of hyperoxia on watersoaking disorder. Hyperoxia (40 kPa O2) alone did not cause watersoaking under the conditions employed in these experiments w hile ethyleneinduced watersoaking was accelerated by hyperoxia. As a response to continuous 10 L.L1 ethylene, immature cucumber fruit showed incipient watersoaking (a darkening of the hypodermal tissues) at 6 d under both normoxic and hyperoxic conditions (Fig. 5 1 A ). After an additional 2 d, fruit treated with ethylene under hyperoxia showed much more acute watersoaking compared with fruit stored under normoxia. At 8 d, around 7580% of mesocarp tissue was watersoaked under hyperoxia while 30% was watersoked under normoxia (Fig. 5 1 B). Electrolyte leakage was measured as an indicator of cellular membrane integrity (Fan and Sokorai, 2005) in response to hyperoxia since degradation of cell membrane has been reported to play a role in watersoaking development (Mao et al., 2004; Lima et al., 2005). Initial electrolyte leakage of cucumber fruit was around 15%, a value maintained in fruit stored under normoxic and hyperoxic conditions without ethylene (Fig. 5 2). Electrolyte leakage was enhanced by exogenous ethylene, but leakage was not

PAGE 109

109 further affected by hyperoxia. Cucumber fruit stored under normoxic or hyperoxic conditions with 10 L.L1 ethylene exhibited no significant increase in electrolyte leakage until 4 d. Ethylene treatment under normoxia or hyperoxia induced 3 fold and 4.5 fold increases in electrolyte leakage at 6 d and 8 d, respectively, compared with air stored fruit. Since greatly enhanced ROS generat ion was observed before incipient w atersoaking ( C hapter 3 and 4) total ROS generation capac ity (expressed as H2O2 equivalents) in mesocarp tissue of cucumber fruit was measured to assess the influence of hyperoxia on watersoaking development ( Fig. 5 3). Initial ROS generating capacity of air treated fruit was negligible. During further storage, ROS generating capacity of air stored fruit increased gradually through 8 d (about 16 mol of H2O2 equivalents generated per disk per h). ROS production of cucumber fruit was markedly enhanced by10 L.L1 ethylene. As a response to exogenous ethylene under normoxia, cucumber fruit produced 3fold and 3.5fold higher ROS at 4 d and 6 d, respectively, compared with air treated fruit. Ethylenetreated fruit exhibited maximum ROS generating capacity of 35 mol H2O2 equivalents per disk per h during 68 d, decli ning to 12 mol/disk/h at 10 d. Hyperoxia alone induced no significant enhancement in ROS generating capacity. The ethyleneinduced increase in ROS production was also not accelerated by hyperoxia. Fruit exposed to ethylene under hyperoxia produced maximum ROS of 32 mol H2O2 equivalents per disk at 6 d, declining to 21 mol/disk /h at 8 d. The decline in ROS production observed in ethylenetreated fruit was observed 2 d earlier under hyperoxia compared with normoxia, coinciding with the appearance of severe tissue watersoaking.

PAGE 110

110 To investigate the role of specific ROS in development of watersoaking, generating capacity of hydrogen peroxide (H2O2) and superoxide anion (O2 -) were monitored during storage as both O2 and H2O2 are key components of ROS signaling and the most commonly studied ROS (Overmyer et al., 2003). Hydrogen peroxide (H2O2) generating capacity was measured by H2O2dependent oxidation of scopoletin (Fig. 5 4). Airtreated fruit initially produced 3.0 nmol of H2O2 per disk per h, increasing up to 4.6 nmol/disk/h and declining to 1.9 nmol/disk/h at 10 d. H2O2 generating capacity was significantly enhanced in fruit challenged with 10 L.L1 ethylene, with levels maintained at nearly 4050% higher during 48 d compared with fruit stored in air. Et hylenetreated fruit produced 4.1 nmol of H2O2 per disk per h at 10 d, which was 2 fold higher than air treated fruit. There was no enhancement in H2O2generating capacity by hyperoxia regardless of ethylene exposure. Generating capacity of superoxide anion (O2 -) was measured using XTT, a sensitive probe for this radical species (Fig. 5 5). Initial production of O2 in air treated fruit was about 12.8 nmol O2 per disk per h, increasing to 19.5 and 21.5 nmol/disk/h at 2 and 6 d, respectively. Ethylene ex posure induced a significant decline in superoxide anion (O2 -) generation after 6 d, when incipient watersoaking was observed. Ethylenetreated fruit produced nearly 10% and 30% less O2 at 6 d and 810 d, respectively, compared with air treated fruit. T his decline coincided with the appearance of tissue watersoaking. Fruit stored under hyperoxia without ethylene showed slightly increased production of O2 compared with air treated fruit during storage. Ethyleneinduced change in production of O2 was n ot affected by hyperoxia.

PAGE 111

111 Antioxidant systems work to detoxify ROS generated through oxidative stress (Mittler, 2002). M odified ABTS assay was conducted f or quantification of total a ntioxidants (Fig. 5 6). Exocarp tissue of air treated fruit exhibited nearl y 60 mol TEs (trolox equivalents per g of tissue fresh weight) of antioxidant capacity, increasing slightly after 6 d (Fig. 5 6 A). At 10 d, exocarp tissue of air treated fruit had about 70 TEs (mol/g FW) of antioxidant capacity. Ethylene exposure (10 L.L1) enhanced antioxidant capacity of exocarp tissue, resulting in 50% and 70% higher levels of antioxidants at 6 d and 8 d, respectively, compared with air treated fruit. Hyperoxia (40 kPa O2) did not affect the antioxidant levels under ethylenefree con ditions Fruit treated with ethylene under hyperoxia had similar antioxidant capacity as ethylenetreated fruit under normoxia (21 kPa O2) through 6 d. Mesocarp tissue had lower antioxidant capacity compared with exocarp tissue (Fig. 5 6 B). Initial antioxi dant capacity of mesocarp tissue was about 35 TEs (mol/g FW) and changed little during storage. Antioxidant capacity in mesocarp tissue of ethylenetreated fruit was 37% and 120% higher at 6 d and 8 d, respectively, compared with that in air treated fruit Hyperoxia induced a 23% increase in antioxidant levels of mesocarp tissue at 4 d compared with normoxia, but no further enhancement at the other days. Fruit treated with ethylene under hyperoxia had 30% lower antioxidant levels in mesocarp tissue at 8 d compared with fruit treated with ethylene under normoxia, while there was no significant difference in antioxidant level of mesocarp tissue between ethylenetreated fruit under normoxic and hyperoxic conditions at 6 d. The E ffect of H ypoxia on W atersoaking D evelopment. Figure 57 show s the influence of hypoxia (2 kPa O2) on watersoaking development. As a response to exogenous ethylene (10 L.L1) under normoxic

PAGE 112

112 conditions (21 kPa O2), incipient watersoaking was observed at 6 d (data not shown) and about 2030% of mesocarp tissue was watersoaked at 8 d (Fig. 5 7 A). Cucumber fruit challenged with ethylene under hypoxia did not exhibit watersoaking symptoms over 14 d of storage (Fig. 5 7 B). The effect of hypoxia on electrolyte leakage is shown in F igure 58. Initial electrolyte leakage of cucumber fruit stored with air was around 11%, slowly increasing to 20% during 16 d of storage (Fig. 5 8). Under normoxic condition (21 kPa O2), electrolyte leakage of ethylenetreated fruit was enhanced 3.5fold and 5.3fold at 6 d and 8 d, respectively, compared with air treated fruit. Storage under hypoxia (2 kPa O2) alone did not influence electrolyte leakage of cucumber fruit. Additionally, the ethylenemediated increase in leakage was completely suppressed through 14 d un der hypoxia. Total ROS generation capacity in mesocarp tissue of cucumber fruit treated with /without ethylene under normoxia or hyperoxia was measured using oxidation of DCFH (Fig. 5 9). Initial ROS generating capacity of air treated fruit was negligible, increasing thereafter to 13 and 14 mol of H2O2 equivalents generated per disk per h at 8 and 10 d, respectively. Levels declined to 7 mol of H2O2 equivalents/disk/h at 12 d. ROS production of cucumber fruit was significantly and rapidly enhanced by 10 L.L1 ethylene under normoxia. Ethylene exposure under normoxia induced 2.6and 8.8fold increases in ROS production at 2 d and 4 d, respectively. Fruit treated with ethylene under normoxia exhibited maximum ROS production (29 mol of H2O2 equivalents gen erated per disk per h) at 8 d, declining to 6 mol of H2O2 equivalents/disk/h at 10 d. Fruit stored under hypoxia without ethylene maintained slightly lower levels of ROS generation capacity compared with air treated fruit, but there was no significant

PAGE 113

113 dif ference in ROS generating capacity between air treated and hypoxiatreated fruit. As seen in air treated fruit, ROS levels of hypoxiatreated fruit reached a maximum of 9 mol of H2O2 equivalents/disk/h) at 10 d, 35% lower compared with levels in air treat ed fruit. Hypoxia negated the ethyleneinduced increase in ROS generation capacity. Fruit treated with ethylene under hypoxia did not show ethyleneenhanced ROS generation, but had similar ROS generation capacity to fruit stored under hypoxia without ethyl ene through 14 d of storage. Figure 5 10 shows the changes in hydrogen peroxide (H2O2) generation capacity of cucumber mesocarp tissue. Air treated fruit initially produced 3.8 nmol of H2O2 per disk per h, increasing to 5.2 nmol/disk/h at 8 d and then dec lining to 3.7 nmol/disk/h at 16 d. As seen in F igure 5 4, H2O2 generation was significantly enhanced in response to 10 L.L1 ethylene under normoxic condition. Ethylenetreated fruit produced nearly 40% and 25% higher H2O2 at 4 d and at 610 d, respectively, compared with air treated fruit. Hypoxia (2 kPa O2) induced a slight decline in H2O2 production at 10 12 d. Fruit stored under hypoxic conditions without ethylene produced about 30% less H2O2 at 12 d compared with air treated fruit. Under hypoxia, ethy leneinduced increases in H2O2 production were not observed until 8 d. Fruit treated with ethylene under hypoxia produced 4.5 nmol of H2O2 per disk per h at 10 d, 10% higher than fruit under hypoxia without ethylene and 22% lower than fruit treated with ethylene under normoxia. Under hypoxic conditions, H2O2generation capacity in ethylenetreated fruit was 46% higher at 12 d compared with fruit not receiving ethylene. Superoxide anion (O2 -) generating capacity was measured using XTT (Fig. 5 11). Initial production of O2 in air treated fruit was 21.1 nmol O2 per disk per h, increasing

PAGE 114

114 to 32.2 nmol/disk/h at 2 d and declining to 20.2 nmol/disk/h at 10 d. As seen in F igure 55, ethylene induced a decline in O2 generating capacity after 6 d under normoxia. Ethylenetreated fruit produced 43% and 55% less O2 at 8 d and 10 d, respectively, compared with air treated fruit. Hypoxia significantly influenced O2 generation capacity after 10 d. Fruit stored under hypoxia without ethylene showed 43% and 50% higher O2 production at 14 d and 16 d respectively, compared with air treated fruit. Ethyleneinduced changes in production of O2 was negated by hypoxia. There was no significant difference in O2 production between ethylene treated and air treated fruit under hypoxia Total a ntioxidants were measured using a m odified ABTS assay (Fig. 5 12). Exocarp tissue of air treated fruit exhibited nearly 130 mol TEs (trolox equivalents per g of tissue fresh weight) of antioxidant capacity, declining through 6 d and increasing to 159.5 TEs at 16 d (Fig. 5 12A). Ethylene exposure (10 L.L1) under normoxia enhanced antioxidant capacity of exocarp tissue, resulting in 30% increases in antioxidant levels at 6 d and 8 d compared with air treated fruit. Hypoxia (2 kP a O2) resulted in increased antioxidant levels during 610 d, when hypoxiainduced decrease in ROS production was observed (Fig. 5 9). Under hypoxic conditions, ethylene did not enhance antioxidants in exocarp tissue. There was no significant difference in antioxidant capacity of exocarp tissue between ethylenetreated and air treated fruit under hypoxic conditions. Mesocarp tissue had lower antioxidant capacity during storage compared with exocarp tissue (Fig. 5 12 B), a pattern also seen in F igure 56. Ini tial antioxidant capacity of mesocarp tissue in air treated fruit was about 65 TEs (mol/g FW), increasing to 87 TEs at 10 d and declining to 60 TEs at 12 d. Antioxidant capacity of

PAGE 115

115 mesocarp tissue in ethylenetreated fruit was nearly 30% and 50% higher at 4 d and 6 d, respectively, compared with that in air treated fruit. Mesocarp tissue of ethylenetreated fruit had maximum antioxidant levels of 112 TEs at 8 d, declining to 88 TEs at 10 d. Hypoxia induced an 89% decrease in antioxidant capacity of mesocarp tissue at 8 d compared with normoxia. Hypoxia negated ethyleneinduced increases in antioxidants of mesocarp tissue that was observed under normoxia. The E ffect of P reconditioning under H ypoxia on W atersoaking D evelopment. Preconditioning cucumber frui t under hypoxia (2 kPa O2) for 8 d prevented watersoaking development upon subsequent treatment with 10 L.L1 ethylene under normoxia (Fig. 5 13). Other symptoms of ethylene exposure were also affected by preconditioning under hypoxia (data below). The ef fect of preconditioning under hypoxia on electrol yte leakage is shown in F igure 514. Fruit not subjected to preconditioning and treated with continuous air (NPA), exhibited 11% initial electrolyte leakage, increasing to 20% at 16 d. Fruit not subjected to preconditioning and treated with 10 L.L1 ethylene (NPE) showed ethyleneenhanced leakage. NPE had 3.5fold increased electrolyte leakage at 6 d compared with NPA. Storage under hypoxia (2 kPa O2) did not significantly affect electrolyte leakage compared with normoxia. Fruit stored under continuous hypoxia (CH) averaged about 17% electrolyte leakage at 8 d, a value maintained throughout storage. After transfer from hypoxia (2 kPa O2) to normoxia (21 kPa O2), electrolyte leakage was not significantly chang ed. Fruit subjected to preconditioning and then treated with air (PA) had similar electrolyte leakage to that of NPA and CH. Ethyleneenhanced electrolyte leakage was also observed in preconditioned fruit as shown in nonpreconditioned fruit. Electrolyte l eakage of fruit subjected to preconditioning prior to ethylene exposure under

PAGE 116

116 normoxia (PE) increased 1.5and 4.3fold at 12 d and 14 d (4 d and 6 d of ethylene exposure), respectively, compared with PA while ethyleneinduced increase in electrolyte leakage was observed at 6 d in fruit not subjected to preconditioning (NPE). Firmness of mesocarp tissue was initially around 6.5 N, increasing to 7.7 N at 2 d, a value maintained throughout storage for NPA (Fig. 5 15). Ethylene exposure under normoxia induced 35% and 72% decreases in mesocarp firmness of NPE at 6 d and 8 d, respectively. Hypoxia did not influence mesocarp firmness through 6 d. Thereafter, firmness slightly increased in fruit stored under hypoxia. CH had 15% higher firmness at 10 d compared wit h NPA. Mesocarp firmness of cucumber fruit stored under hypoxia was 7.4 N at 8 d when fruit subjected to preconditioning were transferred from hypoxia to normoxia. Firmness of PA was 8.8 N at 12 d (4 d after transferring), 14% and 18% higher compared with continuously hypoxiatreated (CH) and air treated fruit (NPA), respectively. In fruit previously stored under hypoxia, ethylene induced a 65% decline in mesocarp firmness of PE at 12 d (4 d after transfer ) compared with that of PA while an ethyleneinduced decline in firmness was observed 6 d after treatment in nonpreconditioned fruit (NPA). Low initial ROS generating capacity of air treated fruit (NPA) increased to 3.5 mol of H2O2 equivalents /disk/h at 2 d, a production rate maintained until 6 d (Fig. 5 16). Ethylene induced 2.6fold and 8.8fold increases in ROS generation of NPE at 2 d and 4 d, respectively. Storage under hypoxia did not significantly affect H2O2generation capacity through 4 d compared with air storage. ROS generation capacity of CH was 4.5 mol of H2O2 equivalents/disk/h at 8 d, 35% of the value of NPA. Cucumber fruit subjected to hypoxia preconditioning (PA and PE) generated 12 mol of H2O2

PAGE 117

117 equivalents/disk/h at 10 d (2 d after transfer to normoxia) regardless of ethylene treatment Thereafter, PA exhibited slightly lower ROS production of 8.7 mol of H2O2 equivalents/disk/h at 14 d (6 d after transferring) and enhanced ROS production of 16.8 mol of H2O2 equivalents/disk/h at 16 d (8 d after transferring). In preconditioned fruit, ethylene exposure induced 42% and 85% declines in ROS generation of PE at 12 (4 d after treatment) and 14 d (6 d after treatment), respectively, while ethylene significantly enhanced ROS generation at 2 d of treatment in nonconditioned fruit (NPE). Fig. 5 17 shows the hydrogen peroxide (H2O2) generating capacity of cucumber fr uit during storage. NPA showed i nitial H2O2generating capacity of 3.8 nmol of H2O2 per disk per h, increasing to 5.2 nmol/disk/h at 8 d. Ethylene (10 L.L1) induced a 40% increase in H2O2generation capacity of NPE at 4 d compared with NPA. Ethylenemediated elevation in H2O2 generation (in NPE) was maintained until 10 d. Fruit stored under hypoxia (CH) produced 10% less H2O2 at 8 d compared with fruit stored under normoxia (NPA). Tra nsferring from hypoxia to normoxia enhanced H2O2 production. Fruit transferred from hypoxia to normoxia (PA) had 20% and 200% higher H2O2 at 10 d and 12 d (2 d and 4 d after transferring), respectively, compared with CH. At 14 d (6 d after transferring), H2O2 production was not influenced by preconditioning. Ethylene did not enhance H2O2 production in fruit subjected to preconditioning (PE) whereas H2O2 production increased at 4 d in response to exogenous ethylene under continuous normoxia (NPE). Initial s uperoxide anion (O2 -) generating capacity in air treated fruit (NPA) was 21.1 nmol of O2 per disk per h, increasing to 32.2 nmol/disk/h at 2 d and declining to 20.2 nmol/disk/h at 10 d (Fig. 5 18). Ethylenetreated fruit (NPE) showed a 43% decline

PAGE 118

118 in O2 -generating capacity at 8 d compared with air treated fruit (NPA). Hypoxia did not significantly influenced O2 generation during 10 d of storage except at 2 d when fruit under hypoxia (CH) had 15% higher O2 levels compared with NPA. Fruit stored under hypoxia for 8 d showed 28.9 nmol/disk/h of O2 generation capacity. Transferring from hypoxia to normoxia attenuated an increase in O2 production observed under continuous hypoxia (CH) after 12 d. PA produced 18% less O2 at 14 d (6 d after transferr ing) compared with CH. In fruit subjected to preconditioning, ethylene induced a significant decline in O2 production of PE at 14 d (6 d after treatment) while fruit treated with ethylene under continuous normoxia (NPE) exhibited a significant decline at 8 d. After preconditioning under hypoxia, ethylene treated fruit (PE) produced 18% and 60% lower levels of O2 at 14 d and 16 d (6 d and 8 d after transferring), respectively, compared with fruit not receiving ethylene (PA). Exocarp tissue of air treat ed fruit (NPA) exhibited nearly 130 mol TEs (trolox equivalents per g of tissue fresh weight) of antioxidant capacity, declining through 6 d and thereafter increasing continuously to 159.5 TEs (mol/g FW) through 16 d (Fig. 5 19A). Ethylene exposure under normoxia induced 30% increases in antioxidant levels at 6 d and 8 d. Hypoxia did not significantly affect antioxidant capacity of exocarp tissue level during 14 d of storage except at 6 d when exocarp of fruit stored under hypoxia (CH) had nearly 20% higher antioxidant levels compared with air treated fruit (NPA). Antioxidant capacity of exocarp of fruit subjected to hypoxia (CH) was nearly 115 TEs at 8 d, similar to the value of NPA. PA had higher antioxidant capacity of exocarp tissue, nearly 14% at both 12 d and 16 d (4 d and 6 d after transferring, respectively), compared with CH. In fruit transferred from hypoxia to normoxia, ethylene did not

PAGE 119

119 enhance antioxidants level of exocarp tissue. There was no significant difference in antioxidant capacity of exocarp between PA and PE. Mesocarp tissue of air treated fruit (NPA) exhibited 65 TEs (mol/g FW) of initial antioxidant generating capacity (Fig. 5 19 B). Antioxidant generation in mesocarp tissue of NPA increased to 87 TEs at 10 d and declined to 60 TEs at 12 d. Ethylene induced sharp increases in antioxidant generation capacity of mesocarp tissue (in NPE), nearly 30% and 50% at 4 d and 6 d, respectively, compared with NPA. Hypoxia had a negligible effect on antioxidant generation capacity of mesocarp tiss ue through the first 8 d, except at 2 d. CH had slightly lower antioxidant levels after 8 d compared with NPA. Mesocarp tissue of fruit stored under hypoxia had nearly 72 TEs (mol/g FW) of antioxidant capacity at 8 d, similar to the value for NPA. Fruit t ransferred from hypoxia to normoxia at 8 d (PA) exhibited a significant decline in antioxidants at 10 d (2 d after transferring), about 30% and 40% lower compared with CH and NPA, respectively. Thereafter, there were no significant differences in antioxidant capacity between CH and PA. Mesocarp tissue of fruit subjected to preconditioning (PA), however, produced slightly lower levels of antioxidants compared with continuous air treated fruit (NPA). While ethylene enhanced antioxidant levels of mesocarp tiss ue at 4 d under continuous normoxia (in NPE), fruit subjected to preconditioning showed no significant enhancement in antioxidant level of mesocarp tissue in response to ethylene (in PE). In fruit subjected to hypoxia preconditioning, mesocarp tissue of PE produced 72 TEs of antioxidants at 14 d (6 d of ethylene treatment), a 1.6 foldincrease compared with PA. Discussion Ethyleneinduced watersoaking was altered in response to different oxygen level. Watersoaking in beit alpha cucumber fruit was initiated in hypodermal tissue after 6 d of

PAGE 120

120 10 L.L1 ethylene treatment and subsequently affect ed mesocarp tissues which was accelerated by hyperoxia (40 kPa O2) but greatly negated by hypoxi a (2 kPa O2) as shown in C hapter 4 This result was parallel to previous studies. A strong influence of pO2 on e thylene responses has been reported in other horticultural crops. Elevated pO2 enhanced faster softening in avocado (Burg, 2004), banana (Kanellis et al 1989 ; Jiang and Joyce, 2003), and muskmelon (Altman and Corey 1987) and ethylene induced r usset spotting in lettuce ( Kader and BenYehoshua, 2000). S uppressing ethylene responses (such as ripening and/or degreening) by hypoxia h ave been reported in avocado (Metzidakis and Sfakiotakis, 1995 ) b anana (Hesselman and Freebain, 1969; Kanellis et al., 1989) kiwi ( Stavroulakis and Sfakiotakis, 1997) and tomato fruit (Kapotis et al., 2004) and in broccoli flower buds (Makhlouf et al., 1989) H yperoxia alone, however, did not induce watersoaking in c ucumber fruit being consistent with n o overt effect of hyperoxia on the quality of other commodities such as intact litchi ( Duan et al., 2004) and peach fruit ( Wang et al., 2005) fresh cut peppers (Conesa et al., 2007), and pear slices (Kader and BenYeh osha, 2000) Taken together, these data indicate that pO2 affects watersoaking indirectly through alterations in ethyleneassociated mechanisms. Strong influence of pO2 on ethylene responses might be mediated through controlling overall metabolic processes which could be the consequence of changes in gene expression and/or enzyme activities. Storage under hypoxic conditions induced significant changes in gene expression level including induction of new mRNA and protein, t he suppression of other proteins, and constitutive expression of housekeeping and/or preexisting proteins or mRNA species (Kanellis et al., 1989a, b, 1991, 1993;

PAGE 121

121 Loulakakis et al., 2006; Owen et al., 2004 ; Pasentsis et al., 2007). I dentified h ypoxia / anoxiainduced genes include transcrip tion factors (de Vetten and Ferl, 1995; Hoeren et al., 1998) and signal transduction elements (Baxter Burrell et al., 2002; Dordas et al., 2003) that participate in nitrogen metabolism (Mattana et al., 1994), cell wall loosening (Saab and Sachs, 1996) and fermentation (Pasentsis et al., 2007). During ripening of avocado fruit under 2.5 kPa O2, synthesis of ripening related mRNA and polypeptides such as cellulase was inhibited (Solomos and Kanellis, 1989; Kanellis et al., 1993). This suppression could be induced through suppression in translation by the dissociation of polysomes (Lin and Key, 1987; Sachs and Ho, 1986) and/or in the expression of mRNA ( Kanellis, 1987 Sachs and Ho, 1986) Several studies also reported s trong influence of pO2 on enzymic activi ties Modeling the effect of superatmospheric oxygen on in vitro mushroom PPO activity revealed that storage under hyper oxia might prevent enzymatic browning by polyphenol oxidase ( PPO ) (Gomez et al., 2006). Storage under high O2 (80 kPa) delayed softening and accumulation of polygalacturonase (PG), galactosidase, and cellulase activities in grapes (Deng et al., 2005) Under continuous hypoxic conditions (2.5 kPa O2), the activities of PG, acid phosphatase, and cellulase was suppressed in banana and avocado fruit compared with air treated fruit (Ka nellis et al., 1989a, 1989b; Metzidakis and Sfakiotakis, 1995). PG activity was negligible throughout storage of tomato fruit under 1 kPa O2, regardless of exogenous ethylene treatment (Kapotis et al., 2004) Metzidakis and Sfakiotakis (1995) noted that t h is effect of hypoxia on enzyme activity or levels might be the consequence of a de cline in metabolic energy caused by a decrease in respiration. De creased respiration rate under hypoxia condition was observed in avocado fruit (Solomos and Kanellis, 1989; M etzidakis and Sfakiotakis,

PAGE 122

122 1995), broccoli buds (Makhlouf et al., 1989) tomato fruit (Kim et al., 1999), and freshcut bell pepper ( Conesa et al., 2007). By contrast, Solomos and Kanellis (1989) suggested that suppressed metabolic activity of the fruits u nder hypoxia would result in a decrease in the rate of respiration. This view was supported by the report of Srilaong and Tatsumi (2003) where the effect of pO2 on respiration rate of cucumber fruit was influenced by storage temperature. High oxygen (100 k Pa O2) increase d respiration rate at 20 oC but decreased respiration rate at 5 or 10 oC compared with air treated fruit Oxygen might act as a ratelimiting factor in watersoaking of cucumber fruit by affecting ethylene production and action. This view is supported by previous reports. Kanellis et al. ( 1993) and Solomos and Kanellis ( 1997) concluded that t he effects of hypoxia were through inhibition of ethylene biosynthesis and action. Hypoxia delayed ethylene biosynthesis in broccoli buds ( Makhlouf et al. 1989) and avocado fruit (Metzidakis and Sfakiotakis, 1995) The rise in ethylene evolution in apple was delayed synergistically when 1MCP (1 L.L1) and hypoxia (1.52 kPa O2) were applied together (Asif et al., 2006) E thylene biosynthetic genes were one of hypoxiainduced genes (Olson et al., 1995; Vriezen et al., 1999) On the other hand, elongation rate of petioles of Rumex species increased in response to hypoxia stress through an increase in ethylene sensitivity but not ethylene production (Blom et al., 1994; Voesenek et al., 1996, 1997). Upregulation of RP ERS1 expression in R umex was highest when of ethylene (5 L.L1) and hypoxia (3%) were applied in combination (Voesenek et al., 1997; Vriezen et al., 1997). Elongation rates of r ice coleoptiles w ere higher under 0.5 kPa O2 plus ethylene ( 10 L.L1) than under air ( 21 kPa O2) plus ethylene (Horton, 1991). Beaudry (2000) suggested that the primary benefits of hypoxic storage with

PAGE 123

123 climacteric fruit are to suppress ripening through interfering with et hylene action. Changes in ethylene sensitivity by pO2 were observed in banana fruit. 1MCP treated fruit softened more rapidly under high O2 atmosphere, leading to speculation that hyperoxia enhanced synthesis of new ethylene receptors (Jiang and Joyce, 2003). Altered ethylene responses in response to changes in pO2 could also be explained by a significant role of reactive oxygen species (ROS) in watersoaking development Continuous ethylene exposure (10 L.L1) induced marked increases in ROS generating capacity after 24 d, preceding the decline of firmness and hue angle, and increased electrolyte leakage, and well in advance of incipient watersoaking ( C hapter 3, 4 and present study). Hyperoxia (40 kPa O2) did not increase ROS production but induced an earlier decline in ROS production concomitant with the occurrence of more severe watersoaking compared with ethylenetreated fruit under normoxia. On the other hand, ROS production was suppressed by hypoxia (2 kPa O2), even in presence of exogenous ethylene. These data support the notion that early steps in ethyleneinduced watersoaking involve ROS generation. The production of ROS during ethylene exposure might explain the induction of programmed cell death (PCD) in cucumber, or vice versa. Hurr et al. (20 10 ) reported that cucumber fruit exposed to 10 L.L1 ethylene exhibited hallmarks of PCD including increased nuclease and protease activities and visible DNA laddering at 34 d, well in advance of incipient watersoaking. Enhanced levels of ROS could potenti ally directly contribute to watersoaking through membrane lipid peroxidation and subsequent loss of membrane integrity (Dhindsa et al., 1981; Fridovich, 1986; Moran et al., 1994). In the present study, the hypoxiainduced decline and hyperoxiainduced incr ease were observed in both ROS generation and electrolyte

PAGE 124

124 leakage. Living organisms respond to biotic and abiotic stress through significant crosstalk between ROS and hormones including salicylic acid, jasmonic acid, and ethylene (Overmyer et al., 2003; Kw ak et al., 2006; Parent, 2008). ROS could mediate ethylene signaling directly or indirectly (Overmyer et al., 2003). Among several ROS, hydrogen peroxide (H2O2) and superoxide anion (O2 -) generation was monitored during storage since both O2 and H2O2 ar e key components of ROS signaling (Overmyer et al., 2003). S uperoxide anion is one of abundant ROS, produced by reduction of triplet, groundstate oxygen (O2), and s uperoxide is reduced to H2O2 either spontaneously or by superoxide dismutases (SOD) ( Klotz, 2002; Halliwell, 2006). In the present study, ethylenetreated fruit had enhanced H2O2 production 2 d prior to incipient watersoaking under both normoxic and hyperoxic condition. The effect of hypoxia at suppressing H2O2 production was not affected by exogenous ethylene, paralleling the absence of watersoaking incidence under hypoxia in presence of exogenous ethylene. By contrast, O2 production was decreased in ethylenetreated fruit as watersoaking developed under both normoxic and hyperoxic conditions. No significant decline in superoxide anion (O2 -) was observed in hypoxic storage, even in presence of exogenous ethylene. These results indicate that hydrogen peroxide (H2O2) but not superoxide anion (O2 -) may play a key role in ethylenemediated waters oaking of immature cucumber fruit. This is consistent with the results from C hapter 3, where spatial and quantitative correlation between hydrogen peroxide (H2O2) and watersoaking development was observed in cucumber fruit by histochemical detection. In be it alpha cucumber fruit, H2O2 accumulation is strongly associated with ethyleneinduced watersoaking development. Significant role of certain specific ROS species in

PAGE 125

125 controlling plant responses against biotic and/or abiotic stresses has been reported in ot her commodities. Ozone exposure accelerated accumulation of both O2 and H2O2 followed by lesion formation in A rabidopsis but only H2O2 accumulation in ozoneexposed tobacco and tomato leaves (Wohlgemuth et al., 2002). A significantly enhanced deposition of H2O2 in ethylenetreated cucumber fruit, however, was observed after 6 d while significant increase in total ROS was detected after 2 d. In addition, the amount of H2O2 is much lower than the total ROS production even though different methods were appli ed for each measurement. These data indicate that study of other ROS species such as hydroxyl (HO.), peroxyl (RO2 .), and alkoxyl (RO.) radical s (Trobacher, 2009) will be valuable to elucidate the role of specific ROS in development of watersoaking. Waterso aking appeared to be mediated through imbalance between ROS production and scavenging. Plants try to maintain homeostatic equilibrium between production and scavenging of ROS. In the present study, antioxidant capacity of cucumber fruit was increased by ex ogenous ethylene at 6 d and 46 d in exocarp and mesocarp tissue, respectively, while ethyleneinduced increases in ROS generation was observed at 24 d. Scavenging systems of cucumber fruit appear to be accelerated in response to the induction of ROS accu mulation by ethylene. Ethylene exposure enhanced the production of ROS up to 500700% while antioxidant capacity of ethylenetreated fruit increased up to 5070% compared with that of air treated fruit. This suggests that ethyleneinduced ROS were not effi ciently scavenged by antioxidants, and the resulting imbalance between production and scavenging of ROS could have contributed to development of watersoaking. Several studies revealed that

PAGE 126

126 the balance between ROS production and scavenging can be distur bed under environmental stresses including high light, drought, low temperature, high temperature, and mechanical stress (Malan et al., 1990; Elstner, 1991; Prasad et al., 1994). Kadar and Ben Yehoshua ( 2000) also similarly suggested that oxidative stress coul d result in physiological disorders such as lesion formation and necrosis w hen ROS levels exceed antioxidant capacity. Oxidative damage could be inhibited by direct quenching of ROS or disruption of the free radical propagation reaction (Alscher and Hess, 1993). Hyperoxia (40 kPa O2) alone did not affect antioxidant capacity of either exocarp or mesocarp tissue. Ethyleneinduced increases in antioxidant levels were not accelerated by hyperoxia. On the other hand, hypoxia (2 kPa O2) alone significantly reduced antioxidant capacity of mesocarp but not exocarp tissue. Ethyleneinduced increases in antioxidant level were negated by hypoxia. These data support the idea that antioxidative systems in cucumber fruit were mediated to maintain the balance between production and scavenging of ROS in response to exogenous ethylene and modified pO2. Activated antioxidant mechanisms were reported upon occurrence of oxidative stress in cold stored mandarin fruit (Sala, 1998; Sala and Lafuente, 2000). Klok et al. (200 2 ) rep orted that low oxygen stress (5 kPa O2) enhanced the expression of genes associated with antioxidant enzymes ( peroxidase, ascorbate peroxidase, monodehydroascorbate reductase, glutathionereductase, and superoxide dismutase) in Arabidopsis root cultures. In blueberry fruit antioxidant levels were significantly increased by 6010 0 kPa O2 but not 40 kPa O2 as compared with air treated fruit (Zheng et al., 2003) Strawberries stored under hyperoxia (40 kPa O2) had higher antioxidant capacity compared with air treated fruit (AyalaZavala, et al., 2007) The response of

PAGE 127

127 antioxidative systems to oxidative stress during postharvest storage was various depending on commodities and/or cultivars, indicating the complexity of antioxidant responses to oxidative stress ( Hodges et al., 2004) For a more thorough understanding of the antioxidant response to ethylene and modified pO2, investigation of specific enzymic and nonenzymic antioxidants would be valuable. Antioxidative enzymes include superoxide dismutase (SOD), as corbate peroxidase (APX), glutathione peroxidase (GPX), and catalase (CAT). Non enzymic antioxidants include ascorbate and glutathione (GSH), tocopherol, flavonoids, alkaloids, and carotenoids S ince any one antioxidant assay generally does not provide com plete information on antioxidant capacity of plant tissues ( Ozgen et al. 2006; Thaipong et al., 2006) at least two assays for measuring total antioxidant capacity might be needed. Preconditioning of cucumber fruit with hypoxia (2 kPa O2) for 8 d significa ntly influenced subsequent ethylene responses under normoxia. In preconditioned fruit, exogenous ethylene resulted in significant softening and increased ion leakage but no watersoaking. Preconditioning with hypoxia (2 3 kPa O2) has been frequently applied in apple fruit to suppress physiological disorders including surface scald and bitter pit during subsequent cold storage (Wang and Dilley, 2000; Zanella, 2003; Pesis et al ., 2007; Val et al., 2009). Chilling symptoms in avocado fruit were reduced by preconditioning under 3 kPa O2 for 24 h (Pesis et al., 1994). In contrast to our data, apple and avocado fruit subjected to preconditioning (23 kPa for 7 10 d and 3 kPa O2 for 24 h, respectively) were firmer and exhibited less dehydration and electrolyte leakage than nontreated fruit ( Pesis et al., 1994; Pesis et al ., 2007; Val et al., 2009). Pre storage under 1 kPa O2 for 3 d delayed ripening of banana fruit during subsequent

PAGE 128

128 air storage (Wills et al., 1982). The effectiveness of preconditioning with hypoxia appears to be dependent on treatment temperature and duration. One day of preconditioning (3 kPa O2) at 17 oC was effective in suppressing chilling injury symptoms of avocado fruit ( Pesis et al., 1994). In apple fruit, 7 d of preconditioning under hypoxia (2 kPa O2) at 20 oC effectively prevented scald development while preconditioning for 24 h at 20 oC plus 6 d at 1 oC did not (Pesis et al., 2007). Reduced watersoaking in cucumber fruit subjected to preconditioning might be explained by altered ROS generat ion. Preconditioning with hypoxia influenced ROS generation capacity of cucumber fruit. In cucumber fruit subjected to preconditioning, subsequent ethylene exposure did not induce increases in total ROS and H2O2 production (in PE) which was observed in nonpreconditioned fruit (NPE). By contrast, preconditioned fruit (PE) exhibited ethyleneinduced increase in electrolyte leakage and decline in firmness 2 d earlier than nonpreconditioned fruit (NPE). Ethylene induced a significant decline in O2 production in parallel with increased electrolyte leakage in both preconditioned (PE) and nonconditioned fruit (NPE). Preconditioning under hypoxia reduced ethyleneinduced total ROS and H2O2 production and induced tissue softening with no visible watersoaking. These results support a role of ROS, especially H2O2, in watersoaking development of cucumber fruit. Preconditioning could inhibit watersoaking through enhancing scavenging system. For example, avocado fruit preconditioned under hypoxia (3 kPa O2 for 24 h) showed significantly increased total free sulfhydryl ( SH) groups in both peel and pulp tissue (Pesis et al., 1994). Free SH groups (mainly cysteine and glutathione) function as natural detoxification agents in ripening fruit including tomato and mango (Fuchs et al., 1981; Tabachnik Ma'ayan and Fuchs, 1982).

PAGE 129

129 The present study, however, showed that preconditioning (2 kPa O2 for 8 d) alone did not enhance antioxidant capacity of either exocarp or mesocarp tissue and negated the ethyleneinduced increase in anti oxidant capacity. On the other hand, s torage under hypoxic conditions could result in a restriction of metabolic activity leading to changes in metabolic pathways to consume less energy and utilize oxygen more efficiently ( Geigenberger, 2003). Hypoxia ind uces significant changes in the pattern s of gene expression (Loulakakis et al., 2006; Owen et al., 2004 ; Pasentsis et al., 2007). Preconditioning under hypoxia could result in changes in plant metabolism, especially related to ROS production, which might disturb watersoaking development in response to subsequent ethylene exposure under normoxic environments. Electrolyte leakage (EL) is an indicator of cellular membrane integrity, and is commonly used as an indicator of watersoaking disorder. However, in thi s preconditioning experiment, ethylene exposure in preconditioned fruit induced EL decline but no watersoaking. This result indicates that electrolyte leakage alone cannot represent the sole factor contributing to watersoaking in cucumber fruit. Hurr et al (2010) noted that two distinct mechanisms of electrolyte leakage seem to operate in cucumber fruit. In their study, ethyleneinduced EL in immature fruit was mechanistically different from that of more advanced fruit due to cellular structure changes. One mechanism could be developmentally regulated while the other could be affected by cellular disruption. Inconsistence between EL and watersoaking disorder in preconditioned fruit also supports the possibility of two distinctive mechanisms of EL in cucumber fruit. Ethylene exposure enhanced total ROS generation, followed by increased EL and watersoaking development in cucumber fruit not subjected to

PAGE 130

130 preconditioning. By contra st preconditioned fruit exhibited enhanced EL along with significant decline in tot al ROS generation and no watersoaking in response to ethylene. These results could suggest two different mechanisms of EL in cucumber fruit. One EL mechanism can be significantly related with ROS production and watersoaking development and another EL mecha nism not mediated by ROS is also present in cucumber fruit. Overall the present study showed that ethyleneinduced watersoaking in immature beit alpha cucumber fruit was altered by pO2. Hyperoxia (40 kPa O2) accelerated ethyleneinduced watersoaking while hypoxia (2 kPa O2) completely negated watersoaking. Modification in ROS levels, especially H2O2, seems to play an important role in watersoaking development in ethylenetreated fruit. I nfluence of pO2 on ethylene responses was parallel to that on ROS prod uction and antioxidant levels. Watersoaking in cucumber fruit appeared to be mediated through imbalance between ROS production and scavenging. Cucumber fruit subjected to preconditioning under hypoxia (2 kPa O2 for 8 d) prior to ethylene exposure under nor moxia exhibited tissue softening with no visible watersoaking. Ethyleneinduced increases in total ROS and H2O2 production were reduced by preconditioning treatment, which might inhibit watersoaking development.

PAGE 131

131 A B Figure 5 1. Watersoak ing development of beit alpha cucumber fruit stored at 13 oC under normoxia (21 kPa O2) or hyperoxia (40 kPa O2) ethylene (10 L L1) A) At 6 d B) At 8 d. 21 kPa O2 (air) 21 kPa O2 + 10 L L 1 C2H4 40 kPa O 2 40 kPa O 2 + 10 L L 1 C 2 H 4 21 kPa O 2 (air) 21 kPa O 2 + 10 L L 1 C 2 H 4 40 kPa O 2 40 kPa O 2 + 10 L L 1 C 2 H 4

PAGE 132

132 Figure 5 2. Electrolyte leakage of beit alpha cucumber fruit stored at 13 oC under normoxia (21 kPa O2) or hyperoxia (40 kPa O2) ethylene (10 L L1). Each point represents the mean of five fruit. Vertical bars represent LSD ( = 0.05)

PAGE 133

133 Figure 5 3. T otal reactive oxygen species (ROS) g enerating capacity of beit alpha cucumber fruit stored at 13 oC under normoxia (21 kPa O2) or hyperoxia (40 kPa O2) ethylene (10 L L1). The production of total ROS was demonstrated using the oxidation of DCFH to DCF. Relative fluorescence at 520 nm was tr ansformed into the production of H2O2 in moles per disk per h using a standard curve. Each point represents the mean of three fruit. Vertical bars represent LSD ( = 0.05)

PAGE 134

134 Figure 5 4. H ydrogen peroxide (H2O2) g enerating capacity of beit alpha cucumber fruit stored at 13 oC under normoxia (21 kPa O2) or hyperoxia (40 kPa O2) ethylene (10 L L1). The production of H2O2 was demonstrated using the o xidation of scopoletin. Relative fluorescence at 460 nm was transformed into the production of H2O2 in n moles per disk per h using a standard curve. Each point represents the mean of three fruit. Vertical bars represent LSD ( = 0.05)

PAGE 135

135 Fi gure 5 5. S uperoxide anion (O2 -) g enerating capacity of beit alpha cucumber fruit stored at 13 oC under normoxia (21 kPa O2) or hyperoxia (40 kPa O2) ethylene (10 L L1). The production of O2 was demonstrated using the formazan formation of XTT. Abso rbance at 490 nm was transformed into the production of O2 in n moles per disk per h. Each point represents the mean of three fruit. Vertical bars represent LSD ( = 0.05) .

PAGE 136

136 Figure 5 6. Antioxidant capacity expressed as TEs ( mol /g FW ) of beit alpha cucumber fruit during storage at 13 oC under normoxia (21 kPa O2) or hyperoxia (40 kPa O2) ethylene (10 L L1) A ) E xocarp tis sue B ) Mesocarp tissue. Each bar represents the mean of three fruit. Vertical bars represent LSD ( = 0.05)

PAGE 137

137 A B Figure 5 7. Watersoaking development of beit alpha cucumber fruit during storage at 13 oC under normoxia (21 kPa O2) or hypox ia (2 kPa O2) ethylene (10 L L1) A) At 8 d B) At 14 d. 21 kPa O 2 (air) 21 kPa O 2 + 10 L L 1 C 2 H 4 2 kPa O 2 2 kPa O 2 + 10 L L 1 C 2 H 4 21 kPa O 2 (air) 2 kPa O2 2 kPa O2 + 10 L L 1 C2H4

PAGE 138

138 Figure 5 8. Electrolyte leakage of beit alpha cucumber fruit during storage at 13 oC under normoxia (21 kPa O2) or hypoxia (2 kPa O2) ethylene (10 L L1). Each poi nt represents the mean of five fruit. Vertical bars represent LSD ( = 0.05)

PAGE 139

139 Figure 5 9. T otal reactive oxygen species (ROS) g enerating capacity of beit alpha cucumber fruit stored at 13 oC under normoxia (21 kPa O2) or h ypoxia (2 kPa O2) ethylene (10 L L1). The production of total ROS was demonstrated using the oxidation of DCFH to DCF. Relative fluorescence at 520 nm was transformed into the production of H2O2 in moles per disk per h using a standard curve. Each point represents the mean of three fruit. Vertical bars represent LSD ( = 0.05) .

PAGE 140

140 Figure 5 10. H ydrogen peroxide (H2O2) g enerating capacity of beit alpha cucumber fruit stored at 13 oC under normoxia (21 kPa O2) or hypoxia (2 kPa O2) ethylene (10 LL1). The production of H2O2 was demonstrated using the oxidation of scopoletin. Relative fluorescence at 460 nm was transformed into the production of H2O2 in nmoles per disk per h using a standard curve. Each point represents the mean of three fruit. Vertical bars represent LSD ( = 0.05) .

PAGE 141

141 Figure 511. Superoxide anion (O2 -) generating capacity of beit alpha cucumber fruit stored at 13 oC under normoxia (21 kPa O2) or hypoxia (2 kPa O2) ethylene (10 L L1). The production of O2 was demonstrated using the formazan formation of XTT. Absorbance at 490 nm was transformed into the production of O2 in n moles per disk per h. Each point represents the mean of three fruit. Vertical bars represent LSD ( = 0.05)

PAGE 142

142 Figure 512. Antioxidant capacit y expressed as TEs (mol /g FW ) of beit alpha cucumber fruit during storage at 13 oC under normoxia (21 kPa O2) or hypoxia ( 2 kPa O2) ethylene (10 L L1). A) Exocarp tissue. B) Mesocarp tissue. Each point is the mean of three fruit Vertical bar represents LSD ( = 0.05)

PAGE 143

143 A B Figure 5 13. Watersoaking development of beit alpha cucumber fruit stored at 13 oC. A) At 14 d B) At 16 d. Fruit were treated with continuous air (21 kPa O2), hypoxia (2 kPa O2), or transferred to air 10 L L1 ethyl ene after storage under hypoxia (2 kPa O2) for 8 d. LO stands for preconditioning with low oxygen condition (hypoxic condition). 21 kPa O 2 (Air) 2 kPa O 2 (LO) LO (8 d) + Air LO (8 d) + 10 L L 1 C 2 H 4 21 kPa O 2 ( Air) 2 kPa O 2 (LO) LO (8 d) + Air LO (8 d) + 10 L L 1 C 2 H 4

PAGE 144

144 Figure 5 14. Electrolyte leakage of beit alpha cucumber fruit stored at 13 oC. Fruit were treated with contin uous air (21 kPa O2) 10 L L1 ethylene, hypoxia (2 kPa O2), or transferred to air 10 L L1 ethylene after storage under hypoxia (2 kPa O2) for 8 d (arrow). LO stands for preconditioning with low oxygen condition (hypoxic condition). Each point repres ents the mean of three fruit. Vertical bars represent LSD ( = 0.05)

PAGE 145

145 Figure 5 15. Mesocarp firmness of beit alpha cucumber fruit stored at 13 oC. Fruit were treated with continuous air (21 kPa O2) 10 L L1 ethylene, hypoxia (2 kPa O2), or transferred to air 10 L L1 ethylene after storage under hypoxia (2 kPa O2) for 8 d (arrow). LO stands for preconditioning with low oxygen condition (hypoxic condition). Each point represents the mean of 9 measurements (3 fruit, 3 measurements per fruit) Vertical bars represent LSD ( = 0.05)

PAGE 146

146 Figure 5 16. Total reactive oxygen species (ROS) g enerating capacity of beit alpha cucumber fruit stored at 13 oC. Fruit were treated with continuous air (21 kPa O2) 10 L L1 ethylene, hypoxia (2 kPa O2), or transfe rred to air 10 L L1 ethylene after storage under hypoxia (2 kPa O2) for 8 d (arrow). LO stands for preconditioning with low oxygen condition (hypoxic condition). The production of total ROS was demonstrated using the oxidation of DCFH to DCF. Relative fluorescence at 520 nm was transformed into the production of H2O2 in moles per disk per h using a standard curve. Each point represents the mean of three fruit. Vertical bars represent LSD ( = 0.05)

PAGE 147

147 Figure 5 17. Hydrogen peroxide (H2O2) g enerating capacity of beit alpha cucumber fruit stored at 13 oC. Fruit was treated with continuous air (21 kPa O2) 10 L L1 ethylene, hypoxia (2 kPa O2), or transferred to air 10 L L1 ethylene after storage under hypoxia (2 kPa O2) for 8 d (arrow). LO stands for preconditioning with low oxygen condition (hypoxic condition). The production of H2O2 was demonstrated using the oxidation of scopoletin. Relative fluorescence at 460 nm was transformed into the production of H2O2 in n moles per disk per h using a standard curve. Each point represents the mean of three fruit. Vertical bars represent LSD ( = 0.05)

PAGE 148

148 Figure 5 18. Superoxide anion (O2 -) g enerating capacity of beit alpha cucumber fruit stored at 13 oC. Fruit was treated with continuous air (21 kPa O2) 10 L L1 ethylene and hypoxia (2 kPa O2) or transferred to air 10 L L1 ethylene after storage under hypoxia (2 kPa O2) for 8 d (arrow). LO stands for preconditioning with low oxygen condition (hypoxic condition). The production of O2 was demonstrated using the formazan formation of XTT. Abserbance at 490 nm was transformed into the production of O2 in n moles per disk per h Each point represents the mean of three fruit. Vertical bars represent LSD ( = 0.05) .

PAGE 149

149 Figure 5 19. Antioxidant capacity expressed as TEs ( mol /g FW ) of beit alpha cucumber fruit during storage at 13 oC. A ) E xocarp tissue B ) Mesocarp tissue. Fruit was treated with continuous air (21 kPa O2) 10 L L1 eth ylene, hypoxia (2 kPa O2), or transferred to air 10 L L1 ethylene after storage under hypoxia (2 kPa O2) for 8 d (arrow). LO stands for preconditioning with low oxygen condition (hypoxic condition) Each point represents the mean of three fruit Vertic al bars represent LSD ( = 0.05)

PAGE 150

150 CHAPTER 6 THE EFFECT OF EXOGEN OUS ETHYLENE ON ETHY LENE RECEPTOR TRANSCRIPTS OF IMMAT URE BEIT ALPHA CUCUMBER FRUIT Harvested horticultural crops are highly perishable, showing physical and physiological disorders and quality losses during posthar vest handling. Crop deterioration occurs in response to injurious temperature, atmospheric composition (mainly O2, CO2, and ethylene), air pressure, and pathogens (Kader, 2002; Kader, 2003; Burg, 2004a) Watersoaking, the appearance of tissue translucency, vitrescence, or glassiness, is one of the common physiological disorders observed in several commodities. Characteristics of water soaked tissues are acute softening, enhanced electrolyte efflux, loss of flavor, and cell wall disassembly (Bauchot et al., 1999; Karakurt and Huber, 2002; Jeong et al., 2004; Lima et al., 2005; Mao et al., 2004; Nishizawa et al., 2002). Watersoaking was observed in freshcut tissues of kiwi (Agar et al., 1999), tomato (Jeong et al., 2004), Galia melons (Ergun et al., 2007) and pineapple fruit (Montero Calderon et al., 2008) and ethylenetreated daffodil flowers (Hunter et al., 2004), cucumber (Lima et al., 2005; Hurr e t atl., 2009) and watermelon fruit (Karakurt and Huber, 2002; Mao et al., 2004). Chilling temperatures have also been reported to cause this disorder in peach (Fernndez Trujillo and Arts, 1998), papaya (Karakurt and Huber, 2003), cucumber fruit (Fernandez and Martinez, 2006), and green beans (Cho et al., 2008). Watersoaking is a characteristic ethylene respons e observed in immature cucumber fruit, not paralleling normal senescence ( Hurr et al., 2009). Application of 1methylcyclopropene (1 MCP), an inhibitor of ethylene perception (Serek et al., 1994; Sisler and Serek 1997), inhibited watersoaking development o f immature cucumber fruit, confirm ing the involvement of ethylene in the disorder (Lima et al., 2005). In

PAGE 151

151 ethylenetreated cucumber fruit, incipient watersoaking is first evident in hypodermal (outlayer of mesocarp tissues) tissues and then progresses into inner mesocarp tissues (Chapter 3). This spatial pattern was same in both intact fruit and freshcut slices ( C hapter 4), indicating that watersoaking is tissuespecific ethylene response. In addition, C hapter 5 revealed that hyperoxia (40 kPa O2) alone di d not induce watersoaking in immature cucumber fruit while w atersoaking was accelerated by the combination of ethylene and hyperoxia. Ethylene is a gaseous phytohormone influencing diverse aspects of plant biology including seed germination, root initiati on, abscission, fruit ripening, sex determination, and senescence (Abeles et al., 1992; Kieber, 1997; Lin et al., 2009). The effect of ethylene is influenced by development stage, and ethylene concentration and exposure duration (Abeles et al., 1992; Saltv eit, 1999; Hurr et al., 2009; C hapter 3). Ethylene responses rely on ethylene sensitivity (Saltveit, 1999). Several studies suggested that ethylene sensitivities are dependent on transcript abundance of the receptor gene family (Tieman et al., 2000; Cancel and Larsen, 2002; Hall and Bleecker, 2003). Ethylene action initiates with binding of ethylene to a family of endoplasmic reticulum ( ER ) associated receptors such as ETR1and ETR2like families, which results in signal transduction leading to activation of transcription factors and ethyleneresponsive genes (Bleecker et al., 1998; Klee 2002; Chang, 2003; Hall et al., 2007). Since ethylene receptors function as negative regulators, there is an inverse correlation between receptor levels and ethylene sensit ivity; an increase in the level of receptor expression causes an increase in the threshold for initiating an ethylene response, allowing decreased sensitivity (Klee, 2004).

PAGE 152

152 The ethylene receptors are differently regulated by ethylene. For example, transcr iption of receptors ERS1, ERS2, and ETR2 was regulated by ethylene itself in Arabidopsis (Hua and Meyerowitz ., 1998). Wilkinson et al. (1995) also reported that NR mRNA is positively regulated by ethylene in a development specific manner. The effect of dif ferent expression patterns on ethylene sensitivity could be explained by different contributions of different receptor genes to ethylene signaling. Ethylene receptors are controlled at transcriptional and post transcriptional levels (Chen et al., 2007; Kev any et al., 2007). CTR (a Raf like kinase activated by receptors) and EIN3 (transcriptional factor) are mainly regulated at post transcriptional level (Gao et al., 2003; Guo and Ecker, 2003 ; Yanagisawa et al., 2003; Chen et al., 2005). At the transcriptional level, ethylene receptors are an important component in ethylene signal transduction. The present study was designed to investigate the influence of ethylene exposure on expression of ethylene receptor genes in immature cucumber fruit. This study will h elp to elucidate the underlying molecular mechanisms of watersoaking and provide strategies to prevent the disorder. Materials and Methods Plant Materials Experiments were conducted with beit alpha cucumber ( Cucumis Sativus L.; Manar) harvested at immat ure stage ( average fruit wt. 86 3.2 g) from a commercial greenhouse facility in Live oak, FL. Freshly harvested fruit were sorted by size, color and appearance, sanitized with 2.7 mM sodium hypochlorite, and air dried. Afterward, intact fruit (n=25 per c ontainer) were placed in 20L plastic containers and provided with flow through atmospheres of air 10 L.L1 of ethylene at 13 oC and 95% R.H. F low rate

PAGE 153

153 was maintained at 500 mL.min1 to avoid CO2 accumulation, and the gas mixture was humidified by passi ng it through a water filled glass jar (2 L) RNA E xtraction and R everse T ranscription At intervals during storage (12 h, and 1, 3, and 5 d), 5 fruit per treatment were removed from treatment containers. Mesocarp and exocarp tissues were separated and cut into small pieces (approximate 0.2 g). The tissues were frozen in liquid N2 and stored at 70 oC. Total RNA was extracted as described in Vallejos et al. (2000). Approximately 3 g of frozen tissues ( composites of tissue from 5 fruit per treatment) were gr ound in liquid N2 and transferred to 12 mL of extraction buffer containing 0.125 mercaptoethanol. After vortexing for 30 sec, 7.5 mL phenol/chloroform [4:1 (v/v)] was added and the samples centrifuged at 8000 x g for 20 min at 4 oC. The aqueous phase was reextracted with an equal volume of chloroform/octanol [24:1 (v/v)] and centrifuged again at 8000 x g (4 oC, 20 min). The aqueous phase (about 10 mL) was precipitated with 1/5 vol of 12 M LiCl over night at 20 oC. After 20 min centrifugation at 8000 x g at 4oC, the pelleted RNA was gently dispersed in 25 mL of 2 M LiCl, and then layered on top of 5 mL of 4 M LiCl. After centrifugation at 8000 x g (4 oC for 20 min), the pellet was resuspended in 9 mL of TE buffer (10 mM of Tris, pH 7.6, 1 mM of EDTA, pH 8.0), 1 mL of 3 M NaOAc, pH 4.5, and 25 mL of 99% EtOH at 20 oC for 2 h. The pellet recovered after centrifugation at 12000 x g (4 oC, 20 min) was purified by incubation with 700 L of DEPC treated H2O, 600 L of isopropanol (99.5%) and 70 L of 3M NaOAc at 80 oC for 1 h. After centrifugation at 10500 x g (4 oC, 25 min), the pellet was washed with 250 L of 75% EtOH and dried in vacuum for 20 min.

PAGE 154

154 Subsequent DNase treatment was conducted following manufact urers instructions (Promega), followed by purification with phenol/chloroform [4:1(v/v)] and 70% EtOH. RNA concentration was quantified spectrophotometrically at 260 nm. To check RNA quality and quantity (1 g), RNA samples were electrophoresed on ethidiu m bromide stained 1% agarose gels (Dal Cin et al., 2005). cDNA was synthesized as described in Dal Cin et al. (2005). DNA free RNA (1 g) was reverse transcribed in RT PCR mix containing 1 unit of RNase inhibitor, 200 units of MMLV reverse transcriptase, 2.5 M of oligo dT18 primer in a final volume of 10 mL. The reaction was conducted at 37 oC for 90 min, 85 oC for 5 min, and then cooled to 10 oC. cDNA samples were stored at 80oC. Semi Q uantitative RT PCR Expression level of ethylene receptors was examin ed using semi quantitative RT PCR as described in Dal Cin et al. (2005). Genespecific PCR was conducted using 1 L of cDNA as a template in PCR mix (20 L of total volume) containing 2 L of 10X gold buffer, 2 mM MgCl2, 0.25 mM dNTPs, 15 pmol primer set, and 0.4 unit of Gold Taq DNA polymerase. Gene specific primers were designed from nonconserved sequence regions of Cs ETR1 (AB026498), Cs ETR2 (AB026500), and Cs ERS (AB026499) genes using primer 3 software (http://www.genome.wi.mit.edu). Alignment of eac h primer was performed using Blast program (http:// www.ncbi.nlm.nih.gov ) to confirm its specificity. Genomic DNA contamination was controlled by designing primers on exon regions spanning at least one intron. Trans cript accumulation of 18S ribosomal RNA (rRNA) gene (AF206894) was examined as an internal control. Selection of a proper internal control is a critical step since internal control is used to control experimental errors and to normalize RT PCR data. Ideal internal control gene should be expressed

PAGE 155

155 at a constant level in all samples and not affected by experimental conditions (Thellin et al., 1999). The suitable reference genes differ depending on species, tissue types, and developmental stages (Brunner et al ., 2004; Czechowski et al., 2005). Most frequently used housekeeping genes in plants and animals include 18S rRNA, glyceraldehyde3 phosphate dehydrogenase (GAPDH), ubiquitin (UBQ), and actin (ACT) genes (Goidin et al., 2001; Kim et al., 2003; Brunner et al., 2004; Dheda et al., 2004). In th e present study, the stability of expression level of 18S rRNA (AF206894) and ubiquitin (AF104391) genes were tested in the set of cucumber samples. Since 18S rRNA exhibited more stable expression than ubiquitin, 18S r R NA was used as internal control. Gene specific primers are as follows: 18S F, 5 CGGAGAGGGAGCCTGAGAA 3; 18S R, 5CCCGTGTTAGGATTGGGTAATTT 3; ERS F, 5 CCCTACTGAATTCTATCCAATGC3; ERS R, 5AAGTCCCACGCCACTATTTG 3; ETR1 F, 5 GTACATCTTGGATGCGAAGTA3; E TR1 R, 5GACGCTCTATAAGTTCCGAC3; ETR2 F, 5 GGATTTACACGAAGCATGG 3; ETR2 R, 5CAATCTGCACGCATCTCTC 3. PCR was performed under the following conditions, step 1: denaturization at 95 oC for 5 min, step 2: denaturization at 95 C for 30 s, annealing at 58 C (18S, ERS, ETR2) or 60 oC (ETR1) for 1 min, and extension at 72 C for 30 s (33, 38, or 39 cycles for 18S, ETR1 and 2, or ERS, respectively), and step 3: extension at 72 oC for 7 min. The PCR products were run in 2% agarose gel containing ethidium br omide. DNA mass ladder (Invitrogen) was also run to confirm the expected molecular weight of the amplified products. The densitometry value of each target band on a 2 % agarose gel with ethidium bromide staining was measured via Image J software ( http://rsbweb.nih.gov/ij/) three times independently to reduce

PAGE 156

156 measuring error. Each gene transcript level was normalized with the 18 S (internal standard) signal. Transcript level of ethylenetreated fruit was expressed relatively to each value of air treated fruit at selected examine day (12 h, and 1, 3, and 5 d). Value of initial day was set as 1. Three replicates of semi quantitative RT PCR were conducted for each gene. Average of normalized values of three independent PCR products per treatment was used to express the transcript level of each receptor gene. Results The changes in expression of three ethylene receptor genes (Cs ERS, Cs ETR1, and Cs ETR2) in mesocarp and exocarp tissues from fruit treated with air or continuous ethylene (10 L.L1) were monitored during storage. In mesocarp tissue, Cs ERS, Cs ETR1, and Cs ETR2 transcripts increased in response to ethylene (Fig. 61). Half day of continuous ethylene exposure enhanced Cs ETR 2 transcript about 2 fold, whereas Cs ERS and Cs ETR1 were unaffected. At 1 d, a 4fold increase in transcript level of Cs ETR1 was noted. Cs ERS transcript level was less affected by exogenous ethylene than were Cs ETR1 and Cs ETR2. At 5 d of continuous ethylene exposure, transcript levels of Cs ERS, Cs ETR1, and Cs ETR2 genes decreased 75%, 15%, and 55%, respectively, relative to levels present in air treated fruit. Cs ERS, Cs ETR1, and Cs ETR2 transcripts also increased in exocarp tissue following exposure of fruit to ethylene (Fig. 62). Cucumber fruit exposed to 10 L.L1 ethylene for half day (12 h) showed 100% and 50% increases in exocarp transcript levels of Cs ERS and Cs ETR 2, respectively, but no change in Cs ETR1 transcript. The greatest ethylene enhancement of transcript level, a 4fold in crease in Cs ERS and 2 fold increases in Cs ETR1 and Cs ETR2, was noted at 1 d. Exocarp tissues of ethylenetreated fruit had higher transcript level of ERS and ETR2 gene over control

PAGE 157

157 during 5 d of storage, while Cs ETR1 transcript level in ethylenetreate d fruit was about 65% of that in air treated fruit at 5 d. Discussion Although both genotype and environmental factors play a role in the development of watersoaking (Hiraishi, 1972), the cellular events leading to the disorder remain unknown. To investi gate the role of ethylene receptors (Cs ERS, Cs ETR1, and Cs ETR2) on watersoaking of beit alpha cucumber fruit, semi quantitative RT PCR analysis was conducted. Results indicated that all three receptor genes are ethyleneinducible in both mesocarp and ex ocarp tissues. Cucumber fruit stored under continuous ethylene exposure exhibited the highest transcript level of receptor genes around 1 d while incipient watersoaking occurred at 6 d. This indicates that ethylene responses in cucumber fruit included transcriptional regulation of ethylene receptors. Transcriptional regulation at receptor level may possibly act as an important key in controlling ethylene responses in cucumber fruit. Rapid regulations in expression level of receptor genes as a response to et hylene exposure have been reported in other studies. Expression level of Rh ETR1 and RhETR3 in petals of cut rose was significantly increased in response to 10 L.L1 ethylene within 18 h and 6 h, respectively (Ma et al., 2006). In tomato fruit, ethylene exposure (10 L.L1) enhanced the accumulation of NR, LeETR4, and LeETR6 mRNA within 2 h, while expression level of these receptor genes was reduced to pre treatment level within 24 h after discontinuing ethylene treatment (Kevany et al., 2007). FaETR1 Fa ETR2 and FaERS1 in strawberry fruit were also ethyleneinducible (100 L.L1for 24 and/or 48 h) (Trainotti et al., 2005) and expression levels of Ad ERS1a, Ad ETR2, and AdETR3 in kiwi fruit were up regulated by exogenous ethylene (100 L.L1for 24 h) within 1 d (Yin et al., 2008). 1 MCP treatment (5 L.L1 for

PAGE 158

158 24 h every other day) of avocado fruit reduced transcripts level of Pa ERS1 whereas termination of 1 MCP treatment enhanced expression levels to those observed at the climacteric peak of contro l fruit (Owino et al., 2002). In ethylenetreated cucumber fruit, different expression patterns of ethylene receptors were observed between mesocarp and exocarp tissues. Of three ethylene receptor genes, Cs ETR1 in mesocarp tissue and Cs ERS in exocarp ti ssue were the most significantly upregulated in response to exogenous ethylene. Transcript levels of Cs ERS were most abundant in shoot apices of cucumber plant, Cs ERS gene was the most significantly upregulated in response to ethrel treatment (Yamasaki et al., 2000). The response of Cs ERS in both cucumber exocarp and shoot apices suggests that exocarp responses may be more vegetative in nature than those occurring in mesocarp tissue. This tissue specific expression of receptor genes is parallel to previous reports. In strawberry, exogenous ethylene induced an increase in expression of FaETR2 in white fruit and FaERS1 in red fruit (Trainotti et al., 2005). Melon fruit exhibited slightly different expression patterns among outer, middle, and inner fles h tissues (Sato Nara et al., 1999) and ETR gene of plum fruit was differentially expressed in exocarp and mesocarp (Fernndez Otero et al., 2007). By contrast, similar expression patterns of receptors (AdERS1, Ad ETR1, Ad ETR2, and Ad ETR3) were observed in both flesh and core tissues of kiwi fruit (Yin et al., 2008). D ifferent expression patterns of ethylene receptors could affect tissue ethylene sensitivity by different contributions of different receptor genes to ethylene signaling. C sETR1, CsETR2, an d C sERS had 90%, 71%, and 79% amino acid sequence similarities to Arabidopsis ETR1, ETR2 and ERS1, respectively (Yamasaki et al., 2000)

PAGE 159

159 Cs ETR1 and Cs ERS belong to the ETR1 like group. As concerning their significant structural similarity to Arabidopsis and greatest increase in Cs ETR1 and Cs ERS expression by exogenous ethylene, ETR1like receptors might play a dominant role in regulating ethylene responses in beit alpha cucumber fruit. Wang et al. (2003) had already noted functional redundancy within r eceptor genes and indicated that the ETR1like group is more important than the ETR2like group in determining ethylene responses in Arabidopsis. Generally, living organisms try to maintain homeostatic equilibrium in response to biotic and abiotic stresses. When plants are subject to hormonal changes, for example, they can control it by modification in hormone synthesis, catabolism and/ or sensitivity (Klee, 2004). Beit alpha cucumber fruit produced no detectable ethylene, even upon ethylene exposure, and t here is no known biochemical pathway for catabolism of ethylene. Therefore, alteration in ethylene sensitivity would appear to represent the primary defense to challenge with excess ethylene. Klee (2004) speculated that ethyleneinduced increases in recept or expression can play a role in repressing ethylene responses. The data presented for cucumber fruit are consistent with this view. Postharvest ethylene exposure enhanced accumulation of receptor genes after 12 h or 1 d in both mesocarp and exocarp tissue. Receptor transcripts in mesocarp tissue, but not in exocarp tissue, decreased significantly 1 d before development of visible symptoms of watersoaking, which might reflect a loss in capacity to ward off deleterious effects of ethylene. It was reported that decreased receptor content enhanced sensitivity of plant tissues to ethylene (Hall and Bleecker, 2003).

PAGE 160

160 The p resent study was limited to ethylene effect s on ethylene receptor transcripts However, it is clear that hormone pathways can be regulat ed post translationally Kavany et al. (2007) reported that tomato fruit treated with exogenous ethylene (10 L.L1 for 8 h) showed a rapid degradation (about 50%) in receptor ( NR, ETR4, and ETR6 ) proteins within 2 h with patterns independent of transcript levels This is in contrast to the results of OMalley et al. (2005) where Arabidopsis exhibited a positive correlation between levels of ethylene receptor transcript and functional ethylenebinding activity. Therefore, further study in ethylene receptor protein levels will be needed to elucidate the role of ethylene receptor genes in ethyleneinduced watersoaking of beit alpha cucumber fruit. Overall, the present study revealed that all three receptor genes are ethyleneinducible in both mesocarp and exocarp t issues. Modification in expression level of ethylene receptors is an early cellular response prior to the occurrence of watersoaking disorder. Among different receptors, ETR1like receptors seem to play a role in regulating ethylene responses in beit alpha cucumber fruit.

PAGE 161

161 Figure 61. Gene expression level of ethylene receptors (Cs ERS, Cs ETR1, and Cs ETR2) in mesocarp tissue of immature cucumber fruit stored with air 10 L.L1 ethylene continuously at 13 oC. The expression level of ethylene receptors was normalized to 18S rRNA internal control, and then transcript content of ethylenetreated fruit was expressed as a ratio to one of air treated fruit at each day. Value of initial day was set as 1. Each bar represents the mean of three replications (thr ee individual PCR products with composites of five fruit) S.E.

PAGE 162

162 Figure 62. Gene expression level of ethylene receptors (Cs ERS, Cs ETR1, and Cs ETR2) in exocarp tissue of immature cucumber fruit stored with air 10 L.L1 ethylene continuously at 13 oC. The expression level of ethylene receptors was normalized to 18S rRNA internal control, and then transcript content of ethylenetreated fruit was expressed as a ratio to one of air treated fruit at each day. Value of initial day was set as 1. Each bar represents the mean of three replications (three individual PCR products with composites of five fruit) S.E.

PAGE 163

163 CHAPTER 7 CONCLUSIONS The present study was conducted to address the role of oxygen in watersoaking development using immature beit alpha cuc umber fruit in which exogenous ethylene induces watersoaking uniformly and predictably. The influence of ethylene concentration and exposure duration on ethylene responses was addressed. E .L1 induced tissue softening followed by watersoaking, skin discoloration, and increased respiration and electrolyte leakage. Higher concentrations did not accelerate ethylene responses, indicating .L1 ethylene was saturating with r espect to ethylene responses of cucumber fruit. By contrast, duration of ethylene exposure differentially affected physiological responses. Short .L1 ethylene elicited no detrimental effect on quality of cucumber fruit Fruit receiving ethylene for only 2 d exhibited a significant decline of hue angle only at 15 d. Ethylene exposure for only 4 d induced watersoaking, electrolyte leakage increase and firmness decline much more slowly compared to continuous exposure, but was without significant effect on hue angle. Hue angle of fruit treated with ethylene for 4 d or continuously reached around 119 o at 8 d. These results might be explained by different ethylene thresholds for the different ethylene responses of immature cucumber f ruit. Accumulation of reactive oxygen species (ROS) and ethylene receptor transcripts was observed in response to ethylene. Both responses occurred rapidly in response to ethylene and well in advance of incipient watersoaking and accompanying symptoms. Co ntinuous ethylene exposure (10 L.L1) induced noticeable increases in ROS generating capacity after 2 d while there was no detectable ROS generation until 8 d in

PAGE 164

164 air treated fruit. Histochemical staining (DAB and NBT staining for H2O2 and NBT for O2 -, re spectively) was performed to identify spatial and quantitative correlation between H2O2/O2 and watersoaking in cucumber fruit tissues. Brown precipitate from DAB increased during 8 d of storage in ethylenetreated cucumber fruit, especially in the exocar p. However, ethylene exposure did not induce detectable accumulation of superoxide anion (O2 -) in exocarp tissue while there was strong blue deposition in exocarp tissue of air treated fruit at 8 d. ROS accumulation, especially H2O2, appears to play an im portant role in watersoaking development. In addition, semi quantitative RT PCR revealed that transcript abundance for three receptor genes (Cs ERS, Cs ETR1, and Cs ETR2) increased in both mesocarp and exocarp tissues in response to ethylene. Transcript levels of receptor genes were most significantly increased (2 to 4fold) around 1 d in response to continuous ethylene exposure (10 L.L1). Of three ethylene receptor genes, Cs ETR1 in mesocarp tissue and Cs ERS in exocarp tissue were most significantly up regulated by exogenous ethylene, indicating ETR1like receptors might play a dominant role in regulating ethylene responses in beit alpha cucumber fruit. W atersoaking appears to be a tissuespecific response since altering tissue ethylene and oxygen gradients through the use of freshcut slices did not affect the spatial pattern of watersoaking development In the present study, i ntact and freshcut slices of cucumber fruit were employed to address whether patterns of watersoaking differed in response to al tered gas exchange properties. Incipient watersoaking of cucumber fruit was first evident in hypodermal (outlayer of mesocarp tissues) tissues and progressed into inner mesocarp tissue in both intact and freshcut slices.

PAGE 165

165 F resh cut slices of cucumber frui t, however, exhibited altered ethylene responses compared with intact fruit. Fresh cut cucumber slices treated with continuous ethylene exhibited peel discoloration, but not enhanced softening or electrolyte leakage. F resh cut slices were highly resistant to watersoaking, even when challenged with ethylene under hyperoxic conditions. I n intact fruit, hyperoxia (40 kPa O2) accelerated ethyleneinduced watersoaking and accompanying symptoms including degreening softening and enhanced electrolyte leakage whil e hypoxia (2 kPa O2) strongly suppressed these symptoms. In f resh cut slices, hyperoxia did not enhance watersoaking nor accelerate softening, hue angle decline, and electrolyte leakage. Hypoxia, however, negated ethyleneinduced symptoms in slices. Freshcut slices had higher ROS generating capacities than intact fruit regardless of ethylene treatment Increased ROS accumulation by freshcut processing could enhance antioxidant levels (Reyes et al., 2007; Heredia and Cisneros Zevallos 2009), which might r esult in reduced watersoaking in freshcut slices compared with intact fruit. A ltered pO2 markedly affected the course of watersoaking development of cucumber. Hyperoxia (40 kPa O2) accelerated watersoaking development while hypoxia (2 kPa O2) negated watersoaking. The effects of altered pO2 appeared to be mediated through altered ROS balance. Ethylenetreated fruit had enhanced ROS generating capacity and H2O2 production at 4 d and 2d, respectively, earlier than incipient watersoaking under both normoxic and hyperoxic conditions. By contrast, O2 production declined in ethylenetreated fruit as watersoaking initiated and developed under both normoxic and hyperoxic conditions. Neither significant increases in ROS and H2O2 production nor decline in superoxide anion (O2 -) was observed in hypoxic storage

PAGE 166

166 even in presence of exogenous ethylene. Antioxidant capacity of cucumber fruit increased in response to exogenous ethylene at 6 d and 46 d in exocarp and mesocarp tissues, respectively. ROS production of ethy lenetreated fruit increased up to 500700% while antioxidant capacity of ethylenetreated fruit increased up to 5070% compared with those of air treated fruit. These results indicate that ethyleneinduced ROS might not be adequately scavenged by antioxidants, resulting in imbalances between ROS production and scavenging and leading to watersoaking. Preconditioning treatment (2 kPa O2 for 1 wk) altered total ROS and H2O2 production and strongly suppressed watersoaking in response to subsequent ethylene exp osure. Cucumber fruit subjected to preconditioning (2 kPa O2 for 1 wk) prior to ethylene exposure (10 L.L1) under normoxia exhibited significant softening, ion leakage and tissue disruption, but no watersoaking. P reconditioning treatment reduced ethyleneinduced increases in total ROS production and H2O2 levels. Altered ROS generation could disturb watersoaking development in response to subsequent ethylene exposure under normoxic environments. The possible mechanisms of watersoaking development in immature cucumber fruit was proposed in Figure 71 based on the present study and previous reports. It is the simplified mechanisms and would not be applied to all fruit systems. The work presented here could significantly help our understanding of how ethylene induces watersoaking disorder in immature cucumber fruit. Elucidating early cellular events could greatly enhance our ability to reduce the quality losses caused by watersoaking disorder.

PAGE 167

167 Figure 7 1. Proposed m odel for watersoaking development in imma ture beit alpha cucumber fruit

PAGE 168

168 APPENDIX A TIME COURSE OF DCFH OXIDATION Figure A 1 Time course of DCFH oxidation by H2O2 (100 and 1000 M). Relative fluorescence of incubating medium was measured with a fluorometer (Ex: 480 nm, Em: 520 nm). Working s olution without tissue was used to set zero and 10,000 M H2O2 to set maximum fluorescence as 10,000.

PAGE 169

169 APPENDIX B STANDARD CURVE FOR DCFH ASSAY Figure A 2 A standard curve for DCFH assay was prepared with dilutions of H2O2 (final concentrations of 10, 100, 1000, and 10000 M). Relative fluorescence of incubating medium was measured with a fluorometer (Ex: 480 nm, Em: 520 nm). Working solution without tissue was used to set zero and 10,000 M H2O2 to set maximum fluorescence as 10,000.

PAGE 170

170 LIST OF REFERENCES Abeles, F. B., Morgan, P.W., Saltveit, M. E., 1992. Ethylene in plant biology. Academic Press, San Diego. Adams Phillips, L., Barry, C., Kannan, P., Leclercq, J., Bouzayen, M., Giovannoni, J., 2004. Evidence that CTR1mediated ethylene signal transduct ion in tomato is encoded bya multigene family whose members display distinct regulatory features. Plant Mol Biol. 54, 387404. Agar, I.T., Massantini, R., Hess Pierce, B., Kader, A.A., 1999. Postharvest CO2 and ethylene production and quality maintenance of fresh cut kiwifruit slices. J. Food Sci. 64, 433440. Aguayo, E., Escalona, V.H., Artes, F., 2004. Metabolic behavior and quality changes of whole and fresh processed melon. J. Food Sci. 69, S148S155. Aktas, H., Karni, L., Change, D., Turhan, E., Bar T al, A., Aloni, B., 2005. The suppression of salinity associated oxygen radicals production, in pepper ( Capsicum annuum ) fruit, by manganese, zinc and calcium in relation to its sensitivity to blossom end rot. Physiol. Plant. 123, 6774. Alexander, L., Gri erson, D., 2002. Ethylene biosynthesis and action in tomato: a model for climacteric fruit ripening. J. Exp. Bot. 53, 20392055. Almeida, D.P.F., Huber, D.J., 1999. Apoplastic pH and inorganic ion levels in tomato fruit: a potential means for regulation o f cell wall metabolism during ripening. Physiol. Plant. 105, 506512. Alscher, R.G., Hess, J.L., 1993 Antioxidants in higher plants. CRC Press, Boca Raton, pp.1174. Altman, S.T., Corey, K.A., 1987. Enhanced respiration of muskmelon fruits by pure oxyge n and ethylene. Sci. Hort. 31, 275 281. Apel, K., Hirt, H., 2004. Reactive oxygen species: metabolism, oxidative stress, and signal transduction. Ann. Rev. Plant Biol. 53, 373399. Asif, M., Trivedi, P., Solomos, T., 2006. Effects of low oxygen and MCP, ap plied singly or together, on apple fruit ripening. Acta Hort. 712, 253259. Avdiushko, S.A., Ye, X.S., Hildbrand, D.F., Kuc, J., 1993. Induction of lipoxygenase activity in immunized cucumber plants. Physiol. Mol. Plant Pathol. 42, 8395. Ayala Zavala, F.J ., Shiow, W.Y., Chien, W.Y., Gonzalez Aguilar, G.A., 2007. High oxygen treatment increases antioxidant capacity and postharvest life of strawberry fruit. Food Technol. Biotech. 45, 166173.

PAGE 171

171 Bai, J., Baldwin, E.A., Soliva Fortuny, R.C., Matthesis, J.P., Sta nley, R., Perera, C., Brecht, J.K., 2004. Effect of pretreatment of intact `Gala' apple with ethanol vapor, heat, or 1methylcyclopropene on quality and shelf life of freshcut slices. J. Amer. Soc. Hort. Sci. 129, 583593. Barcelo, A.R., 1998. The generat ion of H2O2 in the xylem of Zinnia elegans is mediated by an NADPH oxidaselike enzyme. Planta 207, 207216. Barry, C.S., Giovannoni, J.J., 2006. Ripening in the tomato greenripe mutant is inhibited by ectopic expression of a protein that disrupts ethylene signaling. Proc. Natl. Acad. Sci. USA. 103, 79237928. Bartz, J.A., Brecht, J.K., 2002. Postharvest physiology and pathology of vegetables, 2nd ed. Marcel Dekker, New York. Bauchot, A.D ., Hallett, I.C ., Redgwell, R.J ., Lallu, N., 1999. Cell wall properties of kiwifruit affected by low temperature breakdown. Postharvest Biol. Technol. 16, 245255. Baxter Burrell, A., Yang, Z., Springer, P.S., Bailey Serres, J., 2002. RopGAP4dependent Rop GTPase rheostat control of Arabidopsis oxygen deprivation tolerance. Science 296, 20262028. Beaudry, R.M., 1999. Effect of O2 and CO2 partial pressure on selected phenomena affecting fruit and vegetabl es quality. Postharvest Biol. Technol. 15, 293303. Bernadac, A., JeanBaptiste, I., Bertoni, G., Morard, P., 1996. Changes in calcium contents during melon ( Cucumis melo L.) fruit development. Scientia Hort. 66, 181189. Berry, A.D., Sargent, S.A., 2009. Real time microsensor measurement of internal oxygen partial pressure in tomato fruit under hypoxic conditions. Postharvest Biol. Technol. 52, 240242. Biemelt, S., Keetman, U., Albrecht, G., 1998. Re aeration following hypoxia or anoxia leads to activation of the antioxidative defense system in roots of wheat seedlings. Plant Physiol. 116, 651 658. Bleecker, A.B., Esch, J.J., Hall, A.E., Rodriguez, F.I., Binder, B.M., 1998. The ethylene receptor family from Arabidopsis: structure and function. Phil. Trans. R. Soc. Lond. B. 353, 14051412. Blom, C.W.P.W., Voesenek, L.A.C.J., Banga, M., Engelaar, W.M.H.G., Rijnders, J.H.G.M., Van de Steeg, H.M., Visser E.J.W., 1994. Physiologocal ecology of riverside species: adaptive responses of plants to submergence. Ann. Bot. 74, 253263.

PAGE 172

172 Blond, R.D., 1984. The agricultural development systems project in Egypt. Univ. Calif., Davis. pp. 4248, 190194. Bolwell, G.P., 1999. Role of active oxygen species and NO in plant defense responses. Curr. Opin. Plant Biol. 2, 287294. B olwell, G.P., Bindschedler, L.V., Blee, K.A., Butt, V.S., Davies, D.R., Gardner, S.L., Gerrish, C., Minibayeva, F., 2002. The apoplastic oxidative burst in response to biotic stress in plants: a threecomponent system. J. Exp. Bot. 53, 136776. Brennan, T. Willemsen, R., Rudd, T., Frenkel, C., 1978. Interaction of oxygen and ethylene in the release of ragweed seeds from dormancy. Bot. Gaz. 139, 4649. Brook, R.C., 1996. Potato Bruising; How and Why Emphasizing Blackspot Bruise. Running Water Publishing. Haslett. Brown, S.B., Houghton, J.D., Hendry, G.A.F., 1991. Chlorophyll breakdown. In: Scheer, H. (Ed.), Chlorophylls. CRC Press, Boca Raton, pp. 465489. Brunner, A.M., Yakovlev, I.A., Strauss, S.H., 2004. Validating internal controls for quantitative plant gene expression studies. BMC Plant Biol. 4, 14. Brusewitz, G.H., Bartsch, J.A., 1989. Impact parameters related to post harvest bruising of apples. Trans. ASAE 32, 953957. Budu, A.S., Joyce, D.C. 2003. Effect of 1 methylcyclopropene on the quality of min imally processed pineapple fruit. Austr. J. Expt. Agr. 43, 177184. Bufler, G., Bangerth. F. 1983. Effects of propylene and oxygen on the ethyleneproducing system of apples. Physiol. Plant. 58, 486492. Burg, S.P. 2004a. Gas and vapour mass transport. In: Burg, S.P. (Ed.), Postharvet physiology and hypobaric storage of fresh produce. CABI Publishing, Oxfordshire, pp. 1880. Burg, S.P. 2004b. Oxygen, carbon dioxide, ammonia and cyanide. In: Burg, S.P. (Ed.), Postharvet physiology and hypobaric storage of f resh produce. CABI Publishing, Oxfordshire, pp. 81127. Burg, S.P. Burg, E.A., 1967. Molecular requirements for the biological activity of ethylene. Plant Physiol. 42, 144152. Burton, W.G., 1974. Some biophysical principles underlying the controlled atm osphere storage of plant material. Ann. Appl. Biol. 78, 149168. Cancel, J.D., Larsen, P.B., 2002. Loss of function mutations in the ethylene receptor ETR1 cause enhanced sensitivity and exaggerated response to ethylene in Arabidopsis. Plant Physiol. 129, 15571567.

PAGE 173

173 Cantwell, M.I., Suslow, T.V., 2002. Postharvest handling systems: Freshcut fruits and vegetables. In: Kader, A.A. (Ed.), Postharvest technology of horticultural crops. Univ. Calif., Div. of Agric. & Nat. Resources, Oakland, pp. 445463. Cazier, J.B., 1, Nilsson, T., Gekas, V., 2001. Spatial modeling of gas exchange in cucumbers. Acta Hort. 553, 591594. Chandlee, J.M., 2001. Current molecular understanding of the genetically programmed process of leaf senescence. Physiol. Plant. 113, 18. Chang, C., 2003. Ethylene signaling: the MAPK module has finally landed. Trends Plant Sci. 8, 365368. Chao, Q., Rothenberg, M., Solano, R., Roman, G., Terzaghi, W., Ecker, J.R., 1997. Activation of the ethylene gas response pathway in Arabidopsis by the nuclear protein ETHYLENEINSENSITIVE3 and related proteins. Cell 89, 11331144. Chaves, A.L.S., de MelloFarias, P.C., 2006. Ethylene and fruit ripening: from illumination gas to the control of gene expression: more than a century of discoveries. Gen. Mol. Biol. 29, 508 515. Chen, C.C., Paull, R.E., 2000. Sugar metabolism and pineapple flesh translucency. J. Am. Soc. Hort. Sci. 125, 558562. Chen, Y.F., Etheridge, N., Schaller, G.E., 2005. Ethylene signal transduction. Ann. Bot. 95, 901915. Chen,Y.F., Shakeel, S.N ., Bowers, J., Zhao, X.C., Etheridge, N., Schaller, G.E., 2007. Ligandinduced degradation of the ethylene receptor ETR2 through a proteasomedependent pathway in Arabidopsis. J. Biol. Chem. 282, 2475224758. Chour, F., Arul, J., Makhlouf, J., Willemot, C ., 1992. Delay of membrane lipid degradation by calcium treatment during cabbage leaf senescence. Plant Physiol. 100, 16561660. Chin, C., Frenkel, C., 1977. Upsurge in respiration and peroxide formation in potato tubers as influenced by ethylene, propylene and cyanide. Plant Physiol. 59, 515518. Cho, M., Hurr, B., Jeong, J., Lim, C., Huber, D.J., 2008. Postharvest senescence and deterioration of 'Thoroughbred' and 'Carlo' green beans (Phaseolus vulgaris L.) in response to 1methylcyclopropene. HortScienc e 43, 427430. Ciardi, J.A., Tieman, D.M., Jones, J.B., Klee, H.J., 2001. Reduced expression of the tomato ethylene receptor gene LeETR4 enhances the hypersensitive response to Xanthomonas campestris pv. vesicatoria Mol. Plant Microbe Interact. 14, 48749 5.

PAGE 174

174 Ciardi, J.A., Tieman, D.M., Lund, S.T., Jones, J.B., Stall, R.E., Klee, H.J., 2000. Response to Xanthomonas campestris pv. vesicatoria in tomato involves regulation of ethylene receptor gene expression. Plant Physiol. 123, 8192. Circu, M.L., Aw, T.Y., 2010. Reactive oxygen species, cellular redox systems, and apoptosis. Free Radic. Biol. Med. 48, 749762. Circu, M.L., Moyer, M.P., Harrison, L., Aw, T.Y., 2009. Contribution of glutathione status to oxidant induced mitochondrial DNA damage in colonic epit helial cells. Free Radic. Biol. Med. 47, 11901198. Clark, K.L., Larsen, P.B., Wang, X.X., Chang, C., 1998. Association of the Arabidopsis CTR1 Raf like kinase with the ETR1 and ERS ethylene receptors. Proc. Natl. Acad. Sci. USA. 95, 54015406. Conesa, A., Verlinden, B.E., Artes Hernandez, F., NicolaI, B., Artes, F., 2007. Respiration rates of freshcut bell peppers under supertamospheric and low oxygen with or without high carbon dioxide. Postharvest Biol. Technol. 45, 8188. Costa, M.L., Civello, P.M 6 benzylaminopurine on chlorophyll degrading enzymes and a peroxidaselinked chlorophyll bleaching during post harvest senescence of broccoli at 20 C. Postharvest Biol. Technol. 35, 191199. C rawford, R.M.M., Braendle, R., 1996. Oxygen deprivation stress in a changing environment. J. Exp. Bot. 295, 145159. Czechowski, T., Stitt, M., Altmann, T., Udvardi, M.K., Scheible, W.R., 2005. Genome wide identification and testing of superior reference g enes for transcript normalization in Arabidopsis. Plant Physiol. 139, 517. Dal Cin, V., Danesin, M., Rizzini, F.M., Ramina, A., 2005. RNA extraction from plant tissues: the use of calcium to precipitate contaminating pectic sugars, Mol. Biotech. 31, 1131 19. Daniels Lake, B.J., Prange, R.K., Nowak, J., Asiedu, S.K., Walsh, J.R., 2005. Sprout development and processing quality changes in potato tubers stored under ethylene: 1. Effects of ethylene concentration. Am. J. Potato Res. 82, 389397. Day, B., 1996. High oxygen modified atmosphere packaging for fresh prepared produce. Postharvest News Inform. 7, 3134. de Vetten, N.C., Ferl, R.J., 1995. Characterization of a maize G box binding factor that is induced by hypoxia. Plant J. 7, 589601. Deng, Y., Wu, Y., Li, Y., 2005. Changes in firmness, cell wall composition and cell wall hydrolases of grapes stored in high oxygen atmospheres. Food Res. Int. 38, 769776.

PAGE 175

175 Desikin, R., Mackerness, S., Hancock, J. Neill, S.J., 2001. Regulation of the Arabidopsis transcript osome by oxidative stress. Plant Physiol. 127, 159172. Dheda, K., Huggett, J.F., Bustin, S.A., Johnson, M.A., Rook, G., Zumla, A., 2004. Validation of housekeeping genes for normalizing RNA expression in real time PCR. Biotechniques 37, 112119. Dhindsa, R.S., Dhindsa, P.P., Thorp, T.A., 1981. Leaf senescence: Correlation with increased levels of membrane permeability and lipid peroxidation, and decreased levels of superoxide dismutase and catalase. J. Exp. Bot. 32, 93101. Dong, J.G., Fernandez Maculet, J .C., Yang, S.F., 1992. Purification and characterization of 1aminocyclopropane1 carboxylate oxidase from apple fruit. Proc. Natl. Acad. Sci. USA. 89, 9789 9793. Dordas, C., Hasinoff, B.B., Igamberdiev, A.U., Manach, N., Rivoal, J., Hill, R.D., 2003. Exp ression of a stress induced hemoglobin affects NO levels produced by alfalfa root cultures under hypoxic stress. Plant J. 35, 763770. Drew, M.C., He, C J, Morgan, P.W., 2000. Programmed cell death and aerenchyma formation in roots. Trends Plant Sci. 5, 12 3 127. du Chatenet, C., Latche, A., Olmos, B., Charpenteau, M., Ranjeva, R., Pech, J.C., Graziana, A., 2000. Spatial resolved analysis of histological and biochemical alterations induced by water soaking in melon fruit. Physiol. Plant. 110, 248255. Duan, X., Jiang, Y., Su, X., Liu, H., Li, Y., Zhang, Z., Zheng, Y., Jiang, W., 2004. Role of pure oxygen treatment in browning of litchi fruit after harvest. Plant Sci. 167, 665668. Duran, C.M.V., Bujan, C.R., 1998. Antioxidant system in the leaf apoplast compartment of Pinus pinaster Ait. and Pin plants exposed to SO2. Ann. App. Biol. 133, 455466. Eichenberger, E., Thimann, K.V., 1957. Terminal oxidases and growth in plant tissues. IV. On the terminal oxidases of etiolated pea internodes. Arch. Biochem. Biophys. 67, 466478. Elgar, H.J., Woolf, A.B., Bieleski, R.L., 1999. Ethylene production by three lily species and their response to ethylene exposure. Postharvest Biol. Technol. 16, 257267. Elkashif, M.E., Huber, D.J., 1988a. Enzymic hydrolysis of placental cell wall pectins and cell separation in watermelon ( Citrullus lanatus ) fruits exposed to ethylene. Physiol. Plant. 73, 432439. Elkashif, M.E., Huber, D.J., 1988b. Electrolyte leakage, firmness, and scanning electron microscopic studies of watermelon frui t treated with ethylene. J. Am. Soc. Hort. Sci. 113, 378381.

PAGE 176

176 El Sharkawy, I., Jones, B., Li, Z., Lelievre, J., Pech, J.C., Latche, A., 2003. Isolation and characterization of four ethylene perception elements and their expression during ripening in pears with/without cold requirement. J. Exp. Bot. 54, 16151625. Elstner, E.F., 1991. Mechanisms of oxygen activation in different compartments of plant cells. In: Pelland, E.J., Steffen, K.L. (Eds.), Active oxygen/oxidative stress in plant metabolism Am. Soc. Plant Physiol., Rockville, pp.1325. Ergun, M., Huber, D.J., 2004. Suppression of ethylene perception extends shelf life and quality of Sunrise Solo papaya fruit at both preripe and ripe stages of development. Europ. J. Hort. Sci. 69,184192. Ergun, M ., Huber, D.J., Bartz, J.A., 2006. Suppression of ethylene sensitivity prolongs shelf life and quality of freshcut ripe papaya fruit. J. Amer. Soc. Hort. Sci. 131, 97103. Ergun, M., Jeong, J., Huber, D.J., Cantliffe, D.J., 2007. Physiology of freshcut Galia ( Cucumis melo var. reticulatus ) from ripe fruit treated with 1methylcyclopropene. Postharvest Biol. Technol. 44, 286292. Everson, H.P., Waldron, K.W., Geeson, J.D., Browne, K.M., 1992. Effects of modified atmospheres on textural and cell wall changes of asparagus during shelf life. Int. J. Food Sci. Technol. 27, 187199. Fan, X., Sokorai, K.J.B., 2005. Assessment of radiation sensitivity of freshcut vegetables using electrolyte leakage measurement. Postharvest Biol. Technol. 36, 191197. Ferguson, I., Volz, R., Woolf, A., 1999. Preharvest factors affecting physiological disorders of fruit Postharvest Biol. Technol. 15, 255262. Fernndez Otero, C.I., Torre, F.D.L., Iglesias, R., Rodrguez Gacio, M.C., Matilla, A.J., 2007. Stageand tissue expression of genes involved in the biosynthesis and signalling of ethylene in reproductive organs of damson plum (Prunus domestica L. subsp. insititia). Plant Physiol. Biochem. 45, 199208. Fernandez Tru jillo, J.P., Artes, F., 1998. Chilling injuries in peaches during conventional and intermittent warming storage. Int. J. Refrig. 21, 265272. Flores, F.B., Martnez Madrid, M.C., Snchez Hidalgo, F.J., Romojaro, F. 2001b. Differential rind and pulp ripening of transgenic antisense ACC oxidase melon. Plant Physiol. 39, 3743. Foyer, C.H., Harbinson, J.C., 1994. Oxygen metabolism and the regulation of photosynthetic electron transport. In: Foyer, C.H., Mullineaux, P.M. (Eds.), Causes of photooxidative stress and amelioration of defense systems in plant CRC Press, Boca Raton, pp. 142.

PAGE 177

177 Foyer, C.H., Noctor, G., 2005. Redox homeostasis and antioxidant signaling: a metabolic interface between stress perception and physiological responses. Plant Cell 17, 18661875. Francia, D. Demaria, D. Calderini, O. Ferraris, L. Valentino, D. Arcioni, S. Tamietti, G., Cardinale, F. 2007. Wounding induces resistance to pathogens with different lifestyles in tomato: role of ethylene in cross protection. Plant Cell Environ 30, 13571365. Frenkel, C. and Garrison, S.A. 1976. Initiation of lycopene synthesis in the tomato mutant rin as influenced by oxygen and ethylene interactions. HortScience 11, 2021. Fridovich, I., 1986. Biological effects of superoxide radicals. Arch. Biochem. Biophys. 247, 111. Fuchs, Y., Pesis, E., Zauberman, G., Tabachnik, L., 1981. Free sulfhydryl groups inripening tomato fruits. Plant Cell Physiol. 22, 733736. Funamoto, Y., Yamauchi, N., Shigenaga, T., Shigyo, M., 2002. Effects of heat treatment on chlorophyll degrading enzymes in stored broccoli ( Brassica oleracea L.). Postharvest Biol. Technol. 24, 163170. Funamoto, Y., Yamauchi, N., Shigyo, M., 2003. Involvement of peroxidase in chlorophyll degradation in stored broccoli ( Brassica oleracea L.) and inhibition of the activity by heat treatment. Postharvest Biol. Technol. 28, 3946. Gadjev, I., Stone, J.M., Gechev, T.S., 2008. Programmed cell death in plants: new insights into redox regulation and the role of hydrogen peroxide. Int. Rev. Cell Mole c. Biol. 270, 87 144. Gao, Z.Y., Chen, Y.F., Randlett, M.D., Zhao, X.C., Findell, J.L., Kieber, J.J., Schaller, E.S., 2003. Localization of the raf like kinase CTR1 to the endoplasmic receptor signaling complexes. J. Biol. Chem. 278, 3472534732. Geigenber ger, P., 2003. Response of plant metabolism to too little oxygen. Curr. Opin. Plant Biol. 6, 247256. Goidin, D., Mamessier, A., Staquet, M.J., Schmitt, D., Berthier Vergnes, O., 2001. Ribosomal 18S RNA prevails over glyceraldehyde3 phosphate dehydrogenas e and bactin genes as internal standard for quantitative comparison of mRNA levels in invasive and noninvasive human melanoma cell subpopulations. Anal. Biochem. 295, 1721. Gomez, P.A., Geysen, S., Verlinden, B.E., Artes, F., Nicolai, B.M., 2006. Modell ing the effect of superatmospheric oxygen concentrations on in vitro mushroom PPO activity. J. Sci. Food Agri. 86, 23872394.

PAGE 178

178 Gong, Y., Mattheis, J.P., 2003. Effects of low oxygen on active oxygen metabolism and internal browning in Braeburn apple fruit. Acta Hort. 628, 533539. Gorny J.R., Kader, A.A., 1996. Controlledatmosphere suppression of ACC Synthase and ADD Oxidase in Golden delicious apples during Long term cold storage. J.Amer. Soc. Hort. Sci. 121, 751 755. Guerra, M., Vivas, Z., Quintero, I., Zambrano de Valera, J., 1998. Estudio de las perdidas post cosecha en nueve rubros horticolas. Proc. Interamer. Soc. Trop. Hort. 42, 404411. Guo, H., Ecker, J.R., 2003. Plant responses to ethylene gas are mediated by SCFEBF1/EBF2 dependent proteolysis o f EIN3 transcription factor. Cell 115, 667677. Guo, H., Ecker, J.R., 2004. The ethylene signaling pathway: new insights. Curr. Opin. Plant Biol. 7, 40 49. Hackett, D.P., Schneiderman, H.A., 1953. Terminal oxidases and growth in plant tissues. I. The term inal oxidase medtiating growth of Avena coleoptile and Pisnin stem sections. Arch. Biochem. Biophys. 47, 190204. Hall, A.E., Bleecker, A.B., 2003. Analysis of combinatorial loss of function mutants in the Arabidopsis ethylene receptors reveals that the ers1 etr1 double mutant has severe developmental defects that are EIN2dependent. Plant Cell, 15, 20322041. Hall, B.P., Shakeel, S.N., Schaller, G.E., 2007. Ethylene receptors: Ethylene perception and signal transduction. J. Plant Growth Regul. 26, 118130 Halliwell, B., 2006. Reactive species and antioxidants. Redox biology is a fundamental theme of aerobic life. Plant Physiol. 141, 312322. Heredia, J.B., Cisneros Zevallos, L., 2009. The effects of exogenous ethylene and methyl jasmonate on the accumulat ion of phenolic antioxidants in selected whole and wounded fresh produce. Food Chem. 115, 15001508. Herner, R.C., 1987. High CO2 effects on plant organs. In: Weichman, J. (Ed.), Postharvest physiology of vegetables, Marcel Dekker, Inc., New York, pp. 239253. Hildebrand, D.F., 1989. Lipoxygenases. Physiol. Plant. 76, 249253. Hiraishi, M., 1972. Studies on an abnormality in the sarcocarp parenchyma of watermelon. The relationship between the abnormal conditions of sarcocarp parenchyma and abnormal respirat ion of watermelon. Bull. Kanagawa Hort. Exp. Stn. 20, 7277. Hodges, D.M., Lester, G.E. Munro, K.D., Toivonen, P.M.A., 2004. Oxidative stress: Importance for postharvest quality, HortScience 39, 924 929.

PAGE 179

179 Hoeren, F., Dolferus, R., Wu, Y., Peacock, W.J., Den nis, E.S., 1998. Evidence for a role for AtMYB2 in the induction of the Arabidopsis alcohol dehydrogenase (ADH1) gene by low oxygen. Genetics 149, 479490. Hong, J.H., Gross, K.C., 1998. Surface sterilization of whole tomato fruit with sodium hypochlorite influences subsequent postharvest behavior of freshcut slices. Postharvest Biol. Technol. 13, 5158. Horton, R.F., 1991. The effect of ethylene and other regulators on coleoptile growth of rice under anoxia. Plant Sci 79, 5762. Hyer, L., 1995. Interacti on between exposure time, temperature, and ethylene concentration on ethylene induced leaflet abscission. Acta Hort. 405, 290297. Hua, J., Meyerowitz, E.M., 1998. Ethylene responses are negatively regulated by a receptor gene family in Arabidopsis thaliana. Cell 94, 261271. Hua, J., Sakai, H., Nourizadeh, S., Chen, Q.H.G., Bleecker, A.B., Ecker, J.R., Meyerowitz, E.M., 1998. EIN4 and ERS2 are members of the putative ethylene receptor gene family in Arabidopsis. Plant Cell 10, 13211332. Huber, D.J., Karakurt,Y., Jeong, J., 2001. Pectin degradation in ripening and wounded fruits. Braz. J. Plant Physiol. 13, 224241. Hurr, B.M, Huber, D.J., Vallejos, C.E., 2010. Features of programmed cell death precede watersoaking development in ethylenetreated immature cucumber fruit. Postharvest Biol. Technol. In press. Hurr, B.M., Huber, D.J, Vallejos, E., Talcott, S.T., 2009. Developmentally dependent responses of detached cucumber ( Cucumis sativus L.) fruit to exogenous ethylene. Postharvest Biol. Technol. 52, 207215. Jabs T Dietrich R A Dangle J. L ., 1996. Initiation of runaway cell death in an Arabidopsis mutant by extracellular superoxide. Science 273, 18531856. Jackman, R.L., Gibson, H.J., Stanley, D.W., 1992. Effects of chilling on tomato fruit texture Physiol. Plant. 86, 600608. Jackson, M.B., 1983. Regulation of root growth and morphology by ethylene and other externally applied growth substances. In: George, E.C. (Ed.), Growth regulators in root development, Monograph 10. British Plant Growth Regul ator Group, Wantage, pp. 103116. Jahn, O.L., Chace, W.G. Jr., Cubbedge, R.H., 1969. Degreening of citrus fruits in response to varying levels of oxygen and ethylene. J. Am. Soc. Hort. Sci. 94, 123125.

PAGE 180

180 Jeong, J ., Brecht, J.K ., Huber, D.J ., Sargent, S.A ., 2004. 1 Methylcyclopropene (1MCP) for maintaining texture quality of freshcut tomato HortScience 39, 13591362. Jeong, J., Brecht, J.K., Huber, D.J., Sargent, S.A., 2008. The shelf life and deterioration of fresh cut cantaloupe fruit in response to 1methylcyclopropene. HortScience 43, 435438. Jiang, Y., Joyce, D.C., 2003. Softening response of 1methylcyclopropenetreated banana fruit to high oxygen atmospheres. Plant Growth Regul. 41, 225229. Jiang, Y.M., Joyce, D.C., 2002. 1 Methycyclopropene treatment effects on intact and fresh cut apple. J. Hortic. Sci. Biotechnol. 77:1921. Kader, A.A., 2002. Postharvest technology of horticultural crops. Univ. Calif., Div. of Agric. & Nat. Resources, Oakland. Kader, A.A., 2003. A perspective on postharvest horticulture (19782003). HortScience 38, 10041008. Kader, A.A., 2005. Increasing food availability by reducing postharvest losses of fresh produce. Acta Hort. 682, 21692176. Kader, A.A., BenYehoshua, S., 2000. Effects of superatmospheric oxygen levels on postharvest physiology and quality of fresh fruits and vegetables. Postharvest Biol. Technol. 20, 113. Kanellis, A.K., 1987. Studies on the suppressive effect of 2.5% oxygen in the rate of ripening, activities of hydrolytic enzymes and gene expression in ripening fruit. Ph.D. Dissertation. Department of Horticulture, University of Maryland, College Park, MD. Kanellis, A.K., Loulakakis, K.A., Hassan, M., Roubelakis Angelakis, K.A., 1993. Biochemical and molecular aspects of the low oxygen action on fruit ripening. In: Pech, C.J., Latch, A., Balagu, C. (Eds.), Cellular and molecular aspects of biosynthesis and action of the plant hormone ethy lene. Kluwer Academic Publishers, Dordrecht, pp. 117122. Kanellis, A.K., Solomos, T., Mattoo, A.K., 1989a. Changes in sugars, enzymatic activities and phosphatase isoenzyme profiles of bananas ripened in air or stored in 2.5% O2 with and without ethylene. Plant Physiol. 90, 251258. Kanellis, A.K., Solomos, T., Mattoo, A.K., 1989b. Hydrolytic enzyme activities and protein pattern of avocado fruit ripened in air and in low oxygen with and without ethylene. Plant Physiol. 90, 259266.

PAGE 181

181 Kanellis, A.K., Solomos T., Mehta, A.M., Mattoo, A.K., 1989c. Decreased cellulase activity in avocado fruit subjected to 2.5% O2 correlates with lower cellulase protein and gene transcript levels. Plant Cell Physiol. 30, 829834. Kanellis, A.K., Solomos, T., Roubelakis Angelaki s, K.A., 1991. Suppression of cellulase and polygalacturonase and induction of alcohol dehydrogenase isoenzymes in avocado fruit mesocarp subjected to low oxygen stress. Plant Physiol. 96, 269274. Kantor, L.S., Lipton, K., Manchester, A., Oliveira, V., 19 97. Estimating and addressing Americas food losses. Food Review 20, 311. Kapotis, G., Passam, H.C., Akoumianakis, K., Olympios, C.M., 2004. Storage of tomatoes in low oxygen atmospheres inhibits ethylene action and polygalacturonase activity. Russ. J. Pl ant Physiol. 51, 112 115. Karakurt, Y., Huber, D.J., 2002. Cell walldegrading enzymes and pectin solubility and depolymerization in immature and ripe watermelon ( Citrullus lanatus ) fruit in response to exogenous ethylene. Physiol. Plant. 116, 398405. Kar akurt, Y., Huber, D.J., 2003. Activities of several membrane and cell wall hydrolases ethylene biosynthetic enzymes, and cell wall polyuronide degradation during low temperature storage of intact and freshcut papaya (Carica papaya) fruit. Postharvest Biol Technol. 28, 219229. Karakurt, Y., Huber, D.J., 2004. Ethyleneinduced gene expression, enzyme activities, and water soaking in immature and ripe watermelon ( Citrullus lanatus ) fruit. J. Plant Physiol. 161, 381388. Kato, M., Hyodo, H., 1999. Purificat ion and characterization of ACC oxidase and increase in its activity during ripening of pear fruit. J. Jpn. Soc. Hortic. Sci. 68, 551557. Kevany, B.M., Tieman, D.M., Taylor, M.G., Dal Cin, V., Klee, H.J., 2007. Ethylene receptor degradation controls the t iming of ripening in tomato fruit, Plant J. 51, 458467. Kidd, F., West, C., 1934. The influence of the composition of the atmosphere upon the incidence of the climacteric in apples. Gt. Brit. Dept Sci Ind Res Rept Food Invest Board Rept. 1933, 5157. Kidd F., West, C., 1945. Respiratory activity and duration of life of apples gathered at different stages of development and subsequently maintained at a constant temperature. Plant Physiol. 20, 467504. Kieber, J.J., 1997. The ethylene response pathway in Ar abidopsis. Annu. Rev. Plant Physiol. Plant Mol. Biol. 48, 277 296.

PAGE 182

182 Kieber, J.J., Rothenberg, M., Roman, G., Feldman, K.A., Ecker, J.R., 1993. CTR1, a negative regulator of the ethylene response pathway in Arabidopsis encodes a member of the Raf family of protein kinases. Cell 72, 427441. Kim, B.D., Hall, C.B., 1976. Firmness of tomato fruits subjected to low concentrations of oxygen. HortScience. 11, 466470. Kim, B R., Nam, HY., Kim, S U., Kim, S I., Chang, Y J., 2003. Normalization of reverse transcrip tion quantitativePCR with housekeeping genes in rice. Biotechnol Lett 25, 18691872. Kim, J., Solomos, T., Gross, K., 1999. Changes in cell wall galactosyl and soluble galactose content in tomato fruit stored in low oxygen atmospheres. Postharvest Biol. T echnol. 17, 3338. Klee, H.J., 2004. Ethylene signaling transduction: Moving beyond Arabidopsis. Plant Physiol. 135, 660667. Klee H.J., 2006 Highly conserved proteins that modify plant ethylene responses Proc. Natl. Acad. Sci. USA. 1 03, 75377538. Klok, E.J., Wilson, I.W., Wilson, D., Chapman, S.C., Ewing, R.M., Somerville, S.C., Peacock, W.J., Dolferus, R., Dennis, E.S., 2002. Expression profile analysis of the low oxygen response in Arabidopsis root cultures. Plant Cell 14, 24812494. Klotz, L.O., 2002. Oxidant induced signaling: effects of peroxynitrite and singlet oxygen. Biol. Chem. 383, 443456. Kuai, J., Dilley, D.R., 1992. Extraction, partial purification and characterization of 1aminocyclopropane1 carboxylic acid oxidase from apple fruit. Postharvest Biol. Technol. 1, 203211. Kwak, J.M., Nguyen, V., Schroeder, J.I., 2006. The role of reactive oxygen species in hormonal responses. Plant Physiol. 141, 323 3299. Laemmli, U.K., 1970. Cleavage of structure proteins during the assembly of the head of bacteriophage T4. Nature 227, 680685. Lamb, C., Dixon, R.A., 1997. The oxidative burst in plant disease resistance. Ann. Rev. Plant Physiol. Plant Mol. Biol. 48, 251 275. Lana, M.M., Tijskens, L.M.M., de Theije, A., Hogenkamp, M., van Kooten, O., 2006. Assessment of changes in optical properties of freshcut tomato using video image analysis. Postharvest Biol. Technol. 41, 296306. Laurin, E., Nunes, M.C.N., mondc, JP, Brecht, J.K., 2006. Residual effect of low pressure stress during simulated air transport on Beit Alphatype cucumbers: Stomata behavior. Postharvest Biol. Technol. 41, 121127.

PAGE 183

183 Lee, E., Sargent, S.A., Huber, D.J., 2007. Physiological changes in roma type tomato induced by mechanical stress at several ripeness stages. HortScience 42, 12371242. Leon, J., Rojo, E., Sanchez Serrano, J.J., 2001. Wound signaling in plants. J. Exp. Bot. 52, 19. Lerslerwong, L., Ketsa, S., van Doorn, W.G., 2008. Protein degradation and peptidase activity during petal senescence in Dendrobium cv. Khao Sanan. Postharvest Biol. Technol. 52, 8490. Levine, A., Tenhaken, R., Dixon, R., Lamb, C., 1994. H2O2 from the oxidative burst orchestrates the plant hypersensitive disease resistance response. Cell 79, 583593. Li, H, Guo, H., 2007. Molecular basis of the ethylene signaling and response pathway in Arabidopsis. J. Plant Growth Regul. 26, 106117. Li, Z., Liu, Y., Dong, J., Xu, R., Zhu, M., 1983. Effect of low oxygen and high carbon dioxide on the levels of ethylene and 1aminocyclopropane1 carboxylic acid in ripening apple fruits. J. Plant Growth Regul. 2, 8187. Lima, L.C.O., Hurr, B.M., Huber, D.J., 2005. Deterioration of beit alpha and slicing cucumbers ( Cucumis sativus L .) during storage in ethylene or air: responses to suppression of ethylene perception and parallels to natural senescence. Postharvest Biol. Technol. 37, 265276. Lin, C.Y., Key, J.L., 1967. Dissociation and reassembly of polyribosomes in relation to protein synthesis in the soybean root. J. Mol. Biol. 26, 237247. Lin, Z.L., Zhong, S., Grierson, D., 2009. Recent advances in ethylene research. J. Exper. Botany 60, 33113336. Loulakakis, K., Hassan, M., Gerasopoulos, G., Kanellis, A.K., 2006. Effects of low oxygen on in vitro translation products of poly(A)+ RNA, cellulase and alcohol dehydrogenase expression in preclimacteric and ripening initiated avocado fruit. Postharvest Biol. Technol. 39, 2937. Lu, C., Cureatz, V., Toivonen, P.M.A., 2009. Improved qual ity retention of packaged `Anjou' pear slices using a 1methylcyclopropene (1MCP) co release technology. Postharvest Biol. Technol. 51, 378383. LunaGuzman, I., Cantwell, M., Barrett, D.M., 1999. Fresh cut cantaloupe: effects of CaCl2 dips and heat treat ments on firmness and metabolic activity. Postharvest Biol. Technol. 17, 201 213.

PAGE 184

184 Ma, N., Tan, H., Liu, X.H., Xue, J.Q., Li, Y.H., Gao, J.P., 2006. Transcriptional regulation of et hylene receptor and CTR genes involved in et hyleneinduced flower opening in cut rose (Rosa hybrida) cv. Sa ma ntha. J. Exp. Bot. 57, 27632773. Madrid, R., Valverde, M., Alcolea, V., Romojaro, F., 2004. Influence of calcium nutrition on water soaking disorder during ripening cantaloupe melon. Scientia Hort. 101, 6979. Makhlouf, J. Willemot, C., Arul, J., Castaigne, F., Emond, J.P., 1989. Regulation of ethylene biosynthesis in broccoli flower buds in controlled atmospheres. J. Am. Soc. Hort. Sci. 114, 955958. Malan, C., Gregling, M.M., Gressel, J., 1990. Correlation between CuZn s uperoxide dismutase and glutathione reductase and environmental and xenobiotic stress tolerance in maize inbreds. Plant Sci. 69, 157 66. Mao, L.C., Jeong, J., Que, F., Huber, D.J., 2005. Physiological properties of freshcut watermelon ( Citrullus lanatus ) in response to suppression of ethylene perception and post processing calcium application. J. Sci. Food Agric. 86, 4653. Mao, L.C., Karakurt, Y., Huber, D.J., 2004. Incidence of watersoaking and phospholipid catabolism in ripe watermelon ( Citrullus lanatu s) fruit: induction by ethylene and prophylactic effects of 1methylcyclopropene. Postharvest Biol. Technol. 33, 19. Marshall, D.E., Brook, R.C., 1999. Reducing bell pepper bruising during postharvest handling. HortTechnology 9, 254258. Mattana, M., Cora ggio, I., Bertani, A., Reggiani, R., 1994. Expression of the enzymes of nitrate reduction during the anaerobic germination of rice. Plant Physiol. 106, 16051608. Mattheis, J.P., Fellman, J.K., 1999. Preharvest factors influencing flavor of fresh fruit and vegetables Postharvest Biol. Technol. 15, 227232. Mattoo, A. K., Suttle, J. K., 1991. The plant hormone ethylene. CRC press, Inc., Boca Raton. McCollum, G., P. Maul., 2007. 1MCP inhibits degreening but stimulates respiration and ethylene biosynthesis in grapefruit. HortScience 42, 120 124. Mehdy, M.C., Sharma, Y.K., Sathasivan, K., Bays, N.W., 1996. The role of activated species in plant disease resistance. Physiol. Plant. 98, 365374. Metzidaki s, T.I., Sfakiotakis, E.M., 1995. Physiological disorders induced by low oxygen on avocado fruits. Acta Hort. 379, 397403. Mir, N.A., Beaudry, R.M., 2001. Interplay of O2 and C2H4 on climacteric respiration. Acta Hort. 553, 651655.

PAGE 185

185 Mittler, R., 2002. Oxi dative stress, antioxidants and stress tolerance. Trends Plant Sci. 7, 405410. Mittler, R., Vanderauwera, S., Gollery, M., Van Breusegem, F., 2004. Reactive oxygen gene network of plants. Trends Plant Sci. 9, 490498. MonteroCalderon, M., Rojas Grau, M. A., Martin Belloso, O. 2008. Effect of packaging conditions on quality and shelf life of fresh cut pineapple ( Ananas comosus ). Postharvest Biol. Technol 50:182189. Moradinezhad, F., Able, A.J., Sedgley, M., Klieber, A., 2006. Concentration and duration o f ethylene treatment influences the response of banana to 1methylcyclopropene. Acta Hort. 712, 747751. Moran, J.F., Becana, M., Ittrbe Ormaetxe, I., Frechilla, S., Klucas, R.V., Aparicio Tejo, P., 1994. Drought induces oxidative stress in pea plants. Pla nta 194, 346352. Mur, L.A.J., Kenton, P., Draper, J., 2005. In planta measurements of oxidative bursts elicited by avirulent and virulent bacterial pathogens suggests that H2O2 is insufficient to elicit cell death in tobacco. Plant Cell Environ. 28, 5485 61. Nishizawa, T ., Tamura, A ., Mitsuzuka, S ., Aikawa, T ., Togashi, M ., Motomura, Y ., 2002. Water soaked symptom of Andesu' net ted melon fruit does not develop under anaerobic nitrogen atmospheres during ripening Plant Growth Regul. 38, 714. ODonnell, P.J., Calvert, C., Atzon, R., Wasternack, C., Leyser, H.M.O., Bowles, D.J., 1996. Ethylene as a signal mediating the wound response of tomato plants. Science 274, 19141917. OMalley, R.C., Rodriguez, F.I., Esch, J.J., Binder, B.M., ODonnell, P., Klee, H.J., Bleecker, A.B., 2005. Ethylenebinding activity, gene expression levels, and receptor system output for ethylene receptor family members from Arabidopsis and tomato. Plant J. 41, 651659. Ogawa, K., Kanematsu, S., Asada, K., 1996. Intraand extracellular localization of cytosolic CuZn superoxide dismutase in spinach leaf and hypocotyl. Plant Cell Physiol. 37, 790799. Olm edo, G., Guo, H., Gregory, B.D., Nourizadeh, S.D., Aguilar Henonin, L., Li., H., An, F., Guzman, P., Ecker, J.R., 2006. Ethylene insensitive5 encodes a 5 3 exoribonuclease required for regulation of the EIN3targeting F box proteins EBF1/2. Proc. Natl. A cad. Sci. USA. 103, 1328613293. Olson, D.C., Oetiker, J.H., Yang, S.F., 1995. Analysis of LE ACS3, a 1aminocyclopropane1 carboxylica cid synthase gene expressed during flooding in the roots of tomato plants. J. Biol. Chem. 270, 1405614061.

PAGE 186

186 Overmyer, K ., Brosche, M., Kangasjarvi, J., 2003. Reactive oxygen species and hormonal control of cell death. Trends Plant Sci. 8, 335 342 Owen, C.A., Spano, T., Hajjar, S.E., Tunaru, V., Harytunyan, S., Filali, L., Kalaitzis, P., 2004. Expression of genes for alcoh ol dehydrogenase and pyruvate decarboxylase in petals of cut carnation flowers in response to hypoxia and anoxia. Physiol. Plant. 122, 412418. Owino, W.O., Nakano, R., Kubo, Y., Inaba, A., 2002. Differential regulation of genes encoding ethylene biosynthesis enzymes and ethylene response sensor ortholog during ripening and in response to wounding in avocados. J. Am. Soc. Hort. Sci. 127, 520527. Ozgen, M., Reese, R.N., Tulio, A.T., Scheerens, J.C., Miller, A.R., 2006. Modified 2,2azinobis 3 ethylbenzothi azoline6 sulfonic Acid (ABTS) method to measure antioxidant capacity of selected small fruits and comparison to ferric reducing antioxidant power (FRAP) and 2,2 diphenyl 1 picrylhydrazyl (DPPH) methods. J. Ag. Food Chem. 54, 11511157. Palou, L., Crisost o, C.H., Garner, D., Basinal, L.M., 2003. Effect of continuous exposure to exogenous ethylene during cold storage on postharvest decay development and quality attributes of stone fruits and table grapes. Postharvest Biol. Technol. 27, 243254. Parent, C., Capelli N., Dat, J., 2008. Reactive oxygen species, stress and cell death in plants. Comp. Rend. Biol. 331, 255 261. Pasentsis, K., Falara, V., Pateraki, I., Gerasopoulos, D., Kanellis, A.K., 2007. Identification and expression profiling of low oxygen regulated genes from Citrus flavedo tissues using RT PCR differential display. J. Exp. Botany, 58, 22032216. Payton, S., Fray, R., Brown, S., Grierson, D., 1996. Ethylene receptor expression is regulated during fruit ripening, flower senescence and abscission Plant Mol. Biol. 31, 12271231. Pesis, E. Marinansky, R., Zauberman, G., Fuchs, Y., 1994. Prestorage Low oxygen atmosphere treatment reduces chilling injury symptoms in 'Fuerte' avocado fruit. HortScience 29, 10421046. Pesis, E., Ben Arie, R., Feygenberg, O., Lichter, A., Gadiyeva, O., Antilofyev, I., Uryupina, T., 2007. A simple pretreatment with low O2 to alleviate superficial scaldinGranny Smith apples. J. Sci. Food Agric. 87, 18361844. Poenicke, E.F., Kays, S.J., Smittle, D.A., Williamson, R.E., 19 77. Ethylene in relation to postharvest quality deterioration in processing cucumbers. J. Amer. Soc. Hort. Sci. 102, 303306.

PAGE 187

187 Praeger, U., Weichmann, J., 2001. Influence of oxygen concentration on respiration and oxygen partial pressure in tissue of broccoli and cucumber. Acta Hort. 553, 679681. Prasad, T.K., Anderson, M.D., Martin, B.A., Stewart, C.R., 1994. Evidence for chilling induced oxidative stress in maize seedlings and a regulatory role for hydrogen peroxide. Plant Cell. 6, 6574. Qiao, H., Chang, K.N., Yazaki., J., Ecker, J.R., 2009. Interplay between ethylene, ETP1/ETP2 F box proteins, and degradation of EIN2 triggers ethylene resppnses in Arabidopsis. Genes Dev. 23, 512521. Rachek, L.I., Yuzefovych, L.V., Ledoux, S.P., Julie, N.L., Wilson, G.L. 2009. Troglitazone, but not rosiglitazone, damages mitochondrial DNA and induces mitochondrial dysfunction and cell death in human hepatocytes. Toxicol. Appl. Pharmacol. 240, 348354. Rao, M.V., Davis, K.R., 2001. The physiology of ozone induced cell death. Planta 213, 682690. Rao M.V., Koch J.R., Davis K.R., 2000. Ozone: a tool for probing programmed cell death in plants. Plant Mol. Biol. 44, 345358. Reid, S.M., Pratt, H.R., 1972. Effect of ethylene on potato tuber respiration. Plant Physiol. 49, 252255. Resnick, J.S., Rivarola, M., Chang, C., 2008. Involvement of RTE1 in conformational changes promoting ETR1 ethylene receptor signaling in Arabidopsis. The Plant J. 56, 423431. Resnick, J.S., Wen, C.K., Shockey, J.A., Chang, C., 2006. REVERSIONTOETH YLENE SENSITIVITY1, a conserved gene that regulates ethylene receptor function in Arabidopsis. Proc. Natl. Acad. Sci. USA. 103, 79177922. Reyes, L.F., Villarreal, J.E., Cisneros Zevallos, L., 2007. The increase in antioxidant capacity after wounding depen ds on the type of fruit or vegetable tissue. Food Chem. 101, 12541262. Reymond, P., Weber, D., Damond, M., Farmer, E.E., 2000. Differential gene expression in response to mechanical wounding and insect feeding in Arabidopsis thaliana. Plant Cell 13, 1531 65. Rodriguez, F.I., Esch, J.J., Hall, A.E., Binder, B.M., Schaller, G.E., Bleecker, A.B., 1999. A copper cofactor for the ethylene receptor ETR1 From Arabidopsis Science 283, 996998. Rogers, H.J., 2006. Programmed cell death in floral organs: How and why to flowers die? Ann. Bot. 97, 309315.

PAGE 188

188 Saab, I.N., Sachs, M.M., 1996. A flooding induced xyloglucan endotransglycosylase homolog in maize is responsive to ethylene and associated with aerenchyma. Plant Physiol. 112, 385391. Sachs, M.M. Subbaiah, C.C., S aab, I.N., 1996. Anaerobic gene expression and flooding tolerance in maize. J. Exp. Bot. 47, 115. Sachs, M.M., Ho, T.H.D., 1986. Alteration of gene expression during environmental stress in plants. Ann. Rev. Plant Physiol. 37, 363376. Sairam, R.K., Kumu tha, D., Ezhilmathi, K., Deshmukh, P.S., Srivastava, G.C., 2008. Physiology and biochemistry of waterlogging tolerance in plants. Biol. Plant. 52, 401412. Sala, J.M., Lafuente, M.T., 2000. Catalase enzyme activity is related to tolerance of mandarin fruit s to chilling. Postharvest Biol. Technol. 20, 8189. Sala, M.J., 1998. Involvement of oxidative stress in chilling injury in coldstored mandarin fruit. Postharvest Biol. Technol. 13, 255261. Salade, M., Matas, A.J., Isaacson, T., Jenks, M.A., Goodwin, S .M., Niklas, K.J., Xiaolin, R., Labavitch, J.M., Shackel, K.A., Fernie, A.R., Lytovchenko, A., ONeill, M.A., Watkins, C.B., Rose, J.K.C., 2007. A re evaluation of the key factors that influence tomato fruit softening and integrity. Plant Physiol.144, 10121028. Saltveit, M.E., 1999. Effect of ethylene on quality of fresh fruits and vegetables. Postharvest Biol. Technol. 15, 279292. Saltveit, M.E., 2003. Is it possible to find an optimal controlle d atmosphere? Postharvest Biol. Technol. 27, 313. Sanders, M.G., de Wild, H.P.J., 2003. The relation between in vivo ethylene production and oxygen partial pressure. Postharvest Biol. Technol. 30, 143151. Sato Nara, K., Yuhashi, K.I., Higashi, K., Hosoy a, K., Kubota, M., Ezura, H., 1999. Stage and tissue specific expression of ethylene receptor homolog genes during fruit development in muskmelon. Plant Physiol. 120, 321330. Schaller, G.E., Bleeker. A.B., 1995. Ethylenebinding sites generated in yeast expressing the Arabidopsis ETR1 gene. Science 270, 18091811. Schopfer, P., Plachy, C., Frahry, G., 2001. Release of reactive oxygen intermediates (superoxide radicals, hydrogen peroxide, and hydroxyl radicals) and peroxidase in germinating radish seeds controlled by light, gibberellin, and abscisic acid. Plant Physiol 125, 15911602.

PAGE 189

189 Schraudner M., Mder W., Wiese C., Van Camp W., Inz D., Langebartels C., Sandermann H., 1998. Ozoneinduced oxidative burst in the ozone biomonitor plant, tobacco Bel W3. Pl ant J. 16, 235245. Serek, M., Reid, M.S., Sisler, E.C., 1994. A volatile ethylene inhibitor improves the postharvest life of potted roses. J. Amer. Soc. Hort. Sci. 119, 572577. Sisler, E. C., 2006. The discovery and development of compounds counteracting ethylene at the receptor level. Biotechnol. Adv. 24, 357367. Sisler, E.C., Serek, M., 1997. Inhibitors of ethylene responses in plants at the receptor level: Recent developments. Physiol. Plant. 100, 577582. Solano, R., Stepanova, A., Chao, Q.M., Ecker, J.R., 1998. Nuclear events in ethylene signaling: a transcriptional cascade mediated by ETHYLENE INSENSITIVE3 and ETHYLENE RESPONSEFACTOR1. Genes Dev. 12, 37033714. Solomos, T., Kanellis, A., 1989. Low oxygen and fruit ripening. Acta Hort. 258, 151160. Solomos, T., Kanellis, A.K., 1997. Hypoxia and fruit ripening. In: Kanellis, A.K., Chang, C., Kende, H., Grierson, D. (Eds.), Biology and biotechnology of the plant hormone ethylene. Kluwer Academic Publishers, Dordrecht, pp. 239252. Srilaong, V., Tatsum i, Y., 2003. Changes in respiratory and antioxidative parameters in cucumber fruit (Cucumis sativus L.) stored under high and low oxygen concentrations. J. Jap. Soc. Hort. Sci. 72, 525532. Stavroulakis, G., Sfakiotakis, E., 1997. Regulation of propylenei nduced ripening and ethylene biosynthesis by oxygen in Hayward kiwifruit. Postharvest Biol. Technol. 10, 189194. Steffens, B, Sauter, M., 2005. Epidermal cell death in rice is regulated by ethylene, gibberellins, and abscisic acid. Plant Physiol. 139, 713 721. Sutherland, M.W., Learmonth, B.A., 1997. The tetrazolium dyes MTS and XTT provide new quantitative assays for superoxide and superoxide dismutase. Free Rad. Res. 27, 283289. Tabachnik Ma'ayan, L., Fuchs, Y., 1982. Free sulfhydryl groups in ripeni ng fruits. Plant Cell Physiol. 23, 13091314. Thaipong, K., Boonprakob, U., Crosby, K., Cisneros Zevallos, L., Byrne, D.H., 2006. Comparison of ABTS, DPPH, FRAP, and ORAC assays for estimating antioxidant activity from guava fruit extracts. J. Food Comp. A nal. 19, 669 675. Thellin, O., Zorzi, W., Lakaye, B., De Borman, B., Coumans, B., Hennen, G., Grisar, T., Igout, A., Heinen, E., 1999. Housekeeping genes as internal standards: use and limits. J. Biotechnol. 75, 291 295.

PAGE 190

190 Theologis, A., Laties, G.G., 1982. Potentiating effect of pure oxygen on the enhancement of respiration by ethylene in plant storage organs: a comparative study. Plant Physiol. 69, 10311035. Tian, M.S., Downs, C.G., Lill, R.E., King, G.A., 1994. A role for et hylene in the yellowing of broc coli after harvest. J. Am. Soc. Hort. Sci. 119, 276281. Tian, M.S., Prakash, S., Elgar, H.J., Young, H., Burmeister, D.M., Ross, G.S., 2000. Responses of strawberry fruit to 1methylcyclopropene (1MCP) and ethylene. Plant Growth Regul. 32, 8390. Tieman D.M., Klee, H.J., 1999. Differential expression of two novel members of the tomato ethylenereceptor family. Plant Physiol. 120, 165172. Tieman, D.M., Taylor, M.G., Ciardi, J.A., Klee, H.J., 2000. The tomato ethylene receptors NR and LeETR4 are negative regulators of ethylene response and exhibit functional compensation within a multigene family. Proc. Natl Acad. Sci. USA, 97, 56635668. Toivonen, P.M.A., Brummell, D.A., 2008. Biochemical bases of appearance and texture changes in freshcut fruit and veg etables. Postharvest Biol. Technol. 48, 114. Trainotti, L., Pavanello, A., Casadoro, G., 2005. Different ethylene receptors show an increased expression during the ripening of strawberries: Does such an increment imply a role for ethylene in the ripening of these non climacteric fruits? J. Exp. Bot. 56, 20372046. Trobacher, C.P., 2009. Ethylene and programmed cell death in plants. Botany 97, 757769. Val, J., Fernndez, V., Lpez, P., Peir, J.M., Blanco, A., 2010. Low oxygen treatment prio to cold storag e decreases the incidence of bitter pit in Golden Reinders apples. J. Sci. Food Agric. 90, 536 540. Vallejos, C.E., Malandro, J.J., Sheehy, K., Zimmermann, M.J., 2000. Detection and cloning of expressed sequences linked to a target gene. Theor. Appl. Genet. 101, 11091113. van Breusegem, F., Dat, J.F., 2006. Reactive oxygen species in plant cell death. Plant Physiol. 141, 384390. Vanacker, H., Harbinson, J., Ruisch, J., Carver, T.L.W., Foyer, C.H., Asard, H., Navas, P., 1998. Plasma membrane redox systems and their role in biological stress and disease. Protoplasma 205, 129140. Ververidis, P., John, P., 1991. Complete recovery in vitro of ethyleneforming enzyme activity. Phytochem. 3, 725727.

PAGE 191

191 Vilas Boas, E.V.de B., Kader, A.A., 2007. Effect of 1 methy lcyclopropene (1MCP) on softening of fresh cut kiwifruit, mango and persimmon slices. Postharvest Biol. Technol. 43, 238244. Villalta, A.M., Sargent, S.A., 2004. Response of beit alphatype cucumbers ( Cucumis sativus L., Manar) to continuous ethylene exposure. Proc. Fla. State Hort. Soc. 117, 368372. Via, S.Z., Chaves, A.R., 2003. Texture changes in fresh cut celery during refrigerated storage. J. Sci. Food Agric. 83, 13081314. Vioque, B., Castellano, J.M., 1994. Extraction and biochemical characteri zation of 1aminocyclopropane1 carboxylic acid oxidase from pear. Physiol. Plant. 90, 334338. Voesenek, L.A.C.J., Banga, M., Rijnders, J.G.H.M., Visser, E.J.W., Blom, C.W.P.M., 1996. Hormone sensitivity and plant adaptations to flooding. Folia Geobot. P hytotaxon 31, 4756. Voesenek, L.A.C.J., Banga, M., Rijnders, J.G.H.M., Visser, E.J.W., Harren, F.J.M., Brailsford, R.W., Jackson, M.B., Blom, C.W.P.M., 1997. Laserdriven photoacoustic spectroscopy: What we can do with it in flooding research (supplement A ). Ann. Bot. 79, 5765. Vriezen, W.H., Hulzink, R., Mariani, C., Voesenek, L.A.C.J., 1999. 1 Aminocyclopropane1 carboxylate oxidase activity limits ethylene biosynthesis in Rumex palustris during submergence. Plant Physiol. 121, 189195. Vriezen, W.H., Va n Rijn, C.P.E., Voesenek, L.A.C.J., Mariani, C., 1997. A homologue of the Arabidopsis thaliana ERS gene is actively regulated in Rumex palustris upon flooding. Plant J. 11, 12651271. Wang, K., Li, H., Ecker, J., 2002. Ethylene biosynthesis and signaling networks. Plant Cell 14, S131S151. Wang, T.W., Arteca, R.N., 1992. Effects of low O2 root stress on ethylene biosynthesis in tomato plants (Lycopersicon esculentum Mill cv Heinz 1350). Plant Physiol. 98, 97100. Wang, W., Hall, A.E., OMalley, R., Bleecke r, A.B., 2003. Canonical histidine kinase activity of the transmitter domain of the ETR1 ethylene receptor from Arabidopsis is not required for signal transmission. Proc. Natl. Acad. Sci. USA. 100, 352357. Wang, Y., Tian, S., Xu, Y., 2005. Effects of hig h oxygen concentration on proand anti oxidant enzymes in peach fruits during postharvest periods. Food Chem. 91, 99104.

PAGE 192

192 Wang, Z., Dilley, D.R., 2000. Initial low oxygen stress controls superficial scald of apples. Postharvest Biol. Technol. 18, 201 213 Warner, H.L., Leopold, A.C., 1971. Timing of growth regulation responses in peas. Biochem. Biophys. Res. Commun. 44, 989994. Watada, A.E., Ko, N.P., Minott, D.A., 1996. Factors affecting quality of fresh cut horticultural products. Postharvest Biol. Technol. 9, 115 125. Wilkinson, J.Q., Lanahan, M.B., Yen, H.C., Giovannoni, J.J., Klee, H.J., 1995. An ethyleneinducible component of signal transduction encoded by Never ripe. Science 270, 18071809. Wills, R.B.H., Ku, V.V.V., Shohet, D., Kim, G.H., 1999. Importance of low ethylene levels to delay senescence of nonclimacteric fruit and vegetables. Aust. J. Exp. Agr. 39, 221224. Wills, R.B.H., Pitakserikul, S., Scott, K.J., 1982. Effects of prestorage in low oxygen or high carbon dioxide concentrations on delaying the ripening of bananas. Austral. J. Agri. Res. 23, 10291036. Wohlgemuth, H., Mittelstrass, K., Kschieschan, S., Bender, J., Weigel, H.J., Overmyer, K., Kangasjrvi, J., Langebartels, C., Sandermann, H., 2002. Activation of an oxidative burst is a general feature of sensitive plant s exposed to the air pollutant ozone. Plant Cell Environ. 25, 717 726. Wszelaki, A.L., Mitcham, E.J., 2000. Effects of superatmospheric oxygen on strawberry fruit quality and decay. Postharvest Biol. Technol. 20, 125133 Yamasaki, S., Fujii, N., Takahashi, H., 2000. The ethyleneregulated expression of CS ETR2 and CS ERS genes in cucumber plants and their possible involvement with sex expression of flowers. Plant Cell Physiol. 41, 608616. Yamauchi, N.,Watada, A.E., 1991. Regulated chlorophyll degradation in spinach leaves during storage. J. Am. Soc. Hort. Sci. 116, 58 62. Yan, J.Q., Wang, J., Tissue, D., Holiday, A.S., Allen, R., Zhang, H., 2003. Photosynthesis and seed production under water deficit condition in transgenic tobacco plants that over express an Arabidopsis ascorbate peroxidase gene. Crop Sci. 43, 14771483. Yanagisawa, S., Yoo, S.D., Sheen, J., 2003. Differential regulation of EIN3 stability by glucose and ethylene signaling in plants. Nature 425, 521525. Yang, S.F., 1987. The role of ethylene and ethylene synthesis in fruit ripening. In: Thomson, W.W., Nothnagel, E.A., Huffaker, R.C. (Eds.), Plant senescence: its biochemistry and physiology, Am. Soc. Plant Physiol., Rockville, pp. 156165.

PAGE 193

193 Yin, X.R., Che n, K.S., Allan, A.C., Wu, R.M., Zhang, B., Lallu, N., Ferguson, L.B., 2008. Ethyleneinduced modulation of genes associated with the ethylene signaling pathway in ripening kiwifruit. J. Exp. Bot. 59, 2097 2108. Yoo, S., Cho, Y., Sheen, J., 2009. Emerging c onnections in the ethylene signalling network. Trends in Plant Sci. 14, 270279. Zanella, A., 2003. Controlof apple superficial scald and ripening: a comparison between 1 methylcyclopropene and diphenylamine postharvest treatments, initial low oxygen stres s and ultralow oxygen storage. Postharvest Biol. Technol. 27, 6978. Zhang, H., Barth, M.M., Hildebrand, D.F., 1994. Packaging influenced total chlorophyll, soluble protein, fatty acid composition and lipoxygenase activity in broccoli florets. J. Food Sci 59, 11711174. Zheng, Y., Wang, C.Y., Wang, S.Y., Zheng, W., 2003. Effect of high oxygen atmospheres on blueberry phenolics, anthocyanins, and antioxidant capacity. J. Ag. Food Chem. 51, 71627169. Zhong, G.V., Burns, J.K., 2003. Profiling ethyleneregul ated gene expression in Arabidopsis thaliana by microarray analysis. Plant Mol Biol. 53, 117 131.

PAGE 194

194 BIOGRAPHICAL SKETCH Eunkyung Lee was born and raised in Daegu, South Korea. She received the Bachelor of Science degree in plant science from Seoul National University, Korea, in 2002. Eunkyung continued her education at the University of Florida, USA and was awarded the Master of Science degree in horticultural sciences in 2005. Her research addressed mechanical injury of tomato fruit. She was awarded the Doctor of Philosophy degree from the H orticultural Sciences D epartment, University of Florida, US A in 2010, specializing in postharvest biology.