<%BANNER%>

Characterization of Microsomal Prostaglandin E Synthase-1 Gene Regulation by the Pro-Inflammatory Cytokine Interleukin 1-beta

Permanent Link: http://ufdc.ufl.edu/UFE0024982/00001

Material Information

Title: Characterization of Microsomal Prostaglandin E Synthase-1 Gene Regulation by the Pro-Inflammatory Cytokine Interleukin 1-beta
Physical Description: 1 online resource (164 p.)
Language: english
Creator: Walters, Jewell
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: arachidonic, egr1, il1, mpges1, pge2
Biochemistry and Molecular Biology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: The arachidonic acid (AA) pathway is a major contributor to the inflammatory response, pain production and cellular homeostasis. AA is liberated from membrane phospholipids by cytosolic PLA2alpha (cPLA2alpha) activity and then metabolized by either the cyclooxygenase (COX) or lipoxygenase (LOX) enzymes. The COX enzymes regulate the production of downstream prostanoids known to be involved in the regulation of a number of biological and pathophysiological processes. Of these prostanoids, PGE2 is the most widely studied due to its key role in inflammation. Over the years, the study of PGE2 biosynthesis and regulation focused entirely on the role of COX-2. More recently, the trend has shifted towards understanding the role of specific PGE2 terminal synthases. There are five known PGE synthases and microsomal PGES-1 (mPGES-1) has emerged as the crucial enzyme responsible for PGE2 production. mPGES-1 is highly induced by pro-inflammatory cytokines and existing gene regulation studies highlight the importance of early growth response factor-1 as a key regulator of mPGES-1 expression. This study demonstrates that mPGES-1 is induced by interleukin 1-beta (IL-1beta) in pulmonary fibroblasts requiring de novo transcription and identifies a hypersensitive site (HS) within the distal promoter region that exhibits both basal and inducible enhancer activity. Functional analysis of HS led to the identification of a binding site for CCAAT/enhancer binding protein within the enhancer and illustrated the importance of this element in recapitulating the complete cytokine induction of mPGES-1 gene expression. cPLA2alpha is activated by intracellular calcium levels and kinase activity but the exact signaling mechanism involved is still unclear. This study attempted to identify key factors involved in the IL-1? induction of cPLA2alpha in pulmonary cells. The results introduce a feed forward mechanism involving the initial rapid induction of cPLA2alpha enzymatic activity and the involvement of a downstream AA metabolite, 15-LOX as being necessary for the cytokine-mediated induction of cPLA2alpha. mPGES-1 expression is highly up-regulated in breast cancer and recent studies demonstrate a role for estrogen and possibly TNFalpha in mediating mPGES-1 gene expression. The final study explores the involvement of TNFalpha and illustrates that it is a potential mediator of mPGES-1 gene expression in breast cancer.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Jewell Walters.
Thesis: Thesis (Ph.D.)--University of Florida, 2009.
Local: Adviser: Nick, Harry S.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0024982:00001

Permanent Link: http://ufdc.ufl.edu/UFE0024982/00001

Material Information

Title: Characterization of Microsomal Prostaglandin E Synthase-1 Gene Regulation by the Pro-Inflammatory Cytokine Interleukin 1-beta
Physical Description: 1 online resource (164 p.)
Language: english
Creator: Walters, Jewell
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: arachidonic, egr1, il1, mpges1, pge2
Biochemistry and Molecular Biology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: The arachidonic acid (AA) pathway is a major contributor to the inflammatory response, pain production and cellular homeostasis. AA is liberated from membrane phospholipids by cytosolic PLA2alpha (cPLA2alpha) activity and then metabolized by either the cyclooxygenase (COX) or lipoxygenase (LOX) enzymes. The COX enzymes regulate the production of downstream prostanoids known to be involved in the regulation of a number of biological and pathophysiological processes. Of these prostanoids, PGE2 is the most widely studied due to its key role in inflammation. Over the years, the study of PGE2 biosynthesis and regulation focused entirely on the role of COX-2. More recently, the trend has shifted towards understanding the role of specific PGE2 terminal synthases. There are five known PGE synthases and microsomal PGES-1 (mPGES-1) has emerged as the crucial enzyme responsible for PGE2 production. mPGES-1 is highly induced by pro-inflammatory cytokines and existing gene regulation studies highlight the importance of early growth response factor-1 as a key regulator of mPGES-1 expression. This study demonstrates that mPGES-1 is induced by interleukin 1-beta (IL-1beta) in pulmonary fibroblasts requiring de novo transcription and identifies a hypersensitive site (HS) within the distal promoter region that exhibits both basal and inducible enhancer activity. Functional analysis of HS led to the identification of a binding site for CCAAT/enhancer binding protein within the enhancer and illustrated the importance of this element in recapitulating the complete cytokine induction of mPGES-1 gene expression. cPLA2alpha is activated by intracellular calcium levels and kinase activity but the exact signaling mechanism involved is still unclear. This study attempted to identify key factors involved in the IL-1? induction of cPLA2alpha in pulmonary cells. The results introduce a feed forward mechanism involving the initial rapid induction of cPLA2alpha enzymatic activity and the involvement of a downstream AA metabolite, 15-LOX as being necessary for the cytokine-mediated induction of cPLA2alpha. mPGES-1 expression is highly up-regulated in breast cancer and recent studies demonstrate a role for estrogen and possibly TNFalpha in mediating mPGES-1 gene expression. The final study explores the involvement of TNFalpha and illustrates that it is a potential mediator of mPGES-1 gene expression in breast cancer.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Jewell Walters.
Thesis: Thesis (Ph.D.)--University of Florida, 2009.
Local: Adviser: Nick, Harry S.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0024982:00001


This item has the following downloads:


Full Text





CHARACTERIZATION OF MICRO SOMAL PROSTAGLANDIN E SYNTHASE-1 GENE
REGULATION BY THE PRO-INFLAMMATORY CYTOKINE INTERLEUKIN 1-BETA





















By

JEWELL NADIA WALTERS


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2009


































2009 Jewell Nadia Walters

































To my mother Edith and my husband Cory









ACKNOWLEDGMENTS

I have had many positive influences in my life that have helped shaped me to be the person

that I am now. I would like to thank my mentor, Dr. Harry Nick, for allowing me the

opportunity to work in his laboratory and for pushing me to be better and think critically; it has

been an enlightening experience. I would also like to thank my committee members, Dr. Mavis

Agbandj e-McKenna, Dr. Jorg Bungert and Dr. Michael Clare-Salzler for their helpful comments

and guidance throughout my Ph.D training.

I would like to thank my lab mates, past and present, Dr. Herlihy, Molly Peck, Dr. Qiu, Dr.

Aiken, Justin Bickford and Dawn Beachy, for the fun and educational atmosphere. I would also

like to thank members of the Kilberg lab, Ishov lab, IDP, BMB and Neuroscience department

staff who were always helpful and friendly.

I thank my mother for always believing in me, her never-ending support and for reminding

me that I can achieve anything once I work hard at it. I thank my brothers who always look out

for me, even from afar and my husband Cory, for his continued love and support. Lastly, I

would like to thank the Almighty; my faith in Him has gotten me through many rough patches.










TABLE OF CONTENTS

page

A C K N O W L E D G M E N T S .............................................................. .............................................

LIST OF TAB LE S ............... .................................. 9

LIST O F FIG U RE S ................................. ..................... 10

L IST O F A B B R E V IA T IO N S ................................................................................................. 13

AB STRA CT .............. ................... ..................... ............................ 15

CHAPTER

1 IN T R O D U C T IO N ............................................................................................... ....... .......... 17

Overview of the Arachidonic Acid Pathway and Metabolites.............................................. 17
Prostaglandin/Prostanoid ................................... ......................................... 17
Cytosolic Phospholipase A2a (cPLA2a) and Arachidonic Acid Metabolism .........................20
Regulation and Activation of Cytosolic PLA2a..........................................................21
L ipoxygenases (L O X ).......................................................................... 23
Cyclooxygenases (C O X ) ........................ ......... .................. .................................... 24
Molecular and Transcriptional Regulation of COX-2 Expression...................................25
Inhibition of COX Activity by Non-Steroidal Anti-Inflammatory Drugs (NSAIDs) .....26
P rostaglandin E 2 (P G E 2) ............... ........ ... .. ....................... .......................... 27
PGE2 Activity is Regulated by EP Receptors: Evaluation of EP-Receptor
Knockout Mice.................. ................... ...........................................28
Prostaglandin E Synthase (PGES) ................................................................................................ 29
Transcriptional Regulation of Microsomal PGES-1 .................................................30
Physiological Relevance of Microsomal PGES-1 Gene Expression Evaluated in
K nockout M ice ........................... .......... ......................... 0
Expression of Microsomal PGES-1 in Cancers......... ................................31

2 MATERIALS AND METHODS ........................................ 36

Materials ........................................ ........ 36
Methods ........................................ ........ 37
Cell Culture......................... ............. .......... ........... 37
Plasmids, Probes and Site-Directed Mutagenesis.....................................38
Transient Transfection ........................................ .. .. .............39
RNA Isolation, Northern Blot and Hybridization....................................40
Transcription Rate Determination ........................................ ............. 41
First-Strand DNA Synthesis and Real-Time RT-PCR.........................42
Im m unoprecipitation A ssay ........................................ 43
Protein Isolation ........................................ ................................................................. 44
Immunoblot Analysis ....... ...................................... 44









DNase I Hypersensitive Site Analysis.................. ....... ..................... 45
Chromatin Immunoprecipitation Analysis.................. ............................................ 46
Short Interfering RNA (siRNA) Analysis................ ..... ..................... 47
D ensitom etry and Statistical Analysis................................ ................... 48

3 IDENTIFICATION OF DNASE I HYPERSENSITIVE SITES INVOLVED IN THE
INTERLEUKIN 1 BETA (IL-10) INDUCTION OF MICROSOMAL
PROSTAGLANDIN E SYNTHASE-1 (MPGES-1) GENE EXPRESSION.......................... 50

Introduction ............... ................... .... .. .. ...... .. ............... 50
Induction of Microsomal PGES-1 Gene Expression by Pro-Inflammatory
Cytokines ................... ... ....... .... .. .................. ............... 50
Stimulus-Dependent Activity of the Microsomal PGES-1 Promoter............................50
Involvement of the Early Growth Response Factor, Egr-1 in the Regulation of
M icrosom al PGES-1 Expression ........................................ 51
R results ............ .......... ......... .... ..................... ... ................. 52
Induction of Microsomal PGES-1 Messenger RNA and Protein Expression by the
Pro-Inflammatory Cytokine, IL-10 in Human Lung Fibroblasts.............................. 52
Determination of Microsomal PGES-1 Messenger RNA Decay After Stimulus
R em ov al ............... ......... ........... ....... .. .. ... .. ............... 5 3
The IL-10 Induction of Microsomal PGES-1 Gene Expression Requires De Novo
T ran scriptio n ............... ....... ..... ... .. .... ......... .... .. ............ 54
Evaluation of the Microsomal PGES-1 Proximal Promoter in the HFL-1 cells........... 55
Analysis of Internal Cis-Acting Elements That May be Involved in Regulating
Microsomal PGES-1 Gene Expression..................... ..................... 56
Microsomal PGES-1 Chromatin Structure: DNase I Hypersensitive Site Analysis ......57
D iscussion....................... ............... 58

4 FUNCTIONAL ANALYSIS OF PROMOTER AND DISTAL REGULATORY
ELEMENTS CONTROLLING THE IL-10 INDUCTION OF MICROSOMAL
PROTAGLANDIN E SYNTHASE-1 (MPGES-1) GENE EXPRESSION ............................73

Introduction ......................................... ............... 73
R results ................ ........ .. ....... .......... .............. .........74
Functional Analysis of the Distal Hypersensitive Site, HS2 Relative to the
M icrosom al PG E S-1 Prom other ................ ........... ......... .... .. ................. 74
HS2 Exhibits Characteristics of an Enhancer: Evaluation of HS2 Using a Minimal
Thymidine Kinase H eterologous Prom other ........................................ ................. 75
Identification of a Basal Element Within HS2 ................................. 76
Mapping of an Inducible Element Contained Within HS2 ............................................77
Identification of Three C/EBP3 Binding Sites in the Distal Regulatory
Enhancer Element: Evaluation of Single C/EBP3 Mutants in the IL-10
Induction of M icrosomal PGES-1 ................................. ........ .......... 77
Analysis of Double C/EBP3 Mutants in the IL-10 Induction of Microsomal
P G E S -1 ............................... ..... ... ........ ............................... 7 8
Evaluation of the C/EBPP Sites in Constructs Lacking the Egr-1 Binding Site......79









Targeted Deletion of C/EBP3 by Short Interfering RNA in Human and Rat Lung
C e lls ...................................... ... ............. ....... ... ...............7 9
Evaluation of Microsomal PGES-1 Expression in C/EBP3 Null Mouse Embryonic
Fibroblast (M EF) C ells .................................... .......................................... 80
Chromatin Immunoprecipitation (ChIP) Analysis of Egr-1, RNA Polymerase II and
C /E B P P B in ding ................ ... .. .. .. .............. .. ..... ....... ..... 80
Co-Immunoprecipitation Analysis of Egr-1 and C/EBP3 Binding............... ...............80
D iscu ssion ............................... 8 1

5 P38MAPK, CYTOSOLIC PHOSPHOLIPASE A2 ALPHA AND 15-
LIPOXYGENASE (15-LOX) ACTIVITIES ARE REQUIRED FOR
TRANSCRIPTIONAL INDUCTION OF CYTOSOLIC PHOSPHOLIPASE A2
ALPHA BY INTERLEUKIN-1BETA: A FEED-FORWARD MECHANISM .................. 101

Introduction ................. .... .................... ... .......... ............... 101
Cytosolic Phospholipase A2a (cPLA2a) Activation is Dependent on
Phosphorylation and Intracellular Calcium Levels............................. ..............101
R results ................... .. ................ ......... ......... .. ....... .. ......................... 103
IL-10 Induces Cytosolic PLA2a Phosphorylation via the Action of P38MAPK .......... 103
P38MAPK Mediates Cytosolic PLA2a Gene Expression in an IL-10-dependent
M manner .............. ........... .... ................ ....................... ........... 103
Phosphorylation of MKK3/MKK6 is Induced by IL-10 ................................................ 105
Phosphorylation of MSK-1 is Induced by IL-1 ......................................................... 106
Inhibition of Cytosolic PLA2a Enzymatic Activity Blocks the IL-10 Induction of
Cytosolic PLA2a Gene Expression: A Feed Forward Mechanism............................ 107
The Lipoxygenase Pathway but not Cyclooxygenase Pathway is Necessary for
Cytosolic PLA2a Expression..................................... ...... 108
Short Interfering RNA against 15-LOX Blocks the IL-10 Induction of Cytosolic
PLA2a Gene Expression ............................. ................... 110
Discussion...................................... ................... ...... .. .............. ........ 110

6 CONCLUSIONS AND FUTURE DIRECTIONS...... .............................................. 130

Conclusions ........................................ 130
Future Directions.................................................. 135

APPENDIX: EVALUATION OF EFFECTS OF A DIFFERENT PRO-INFLAMMATORY
CYTOKINE, TNF-ALPHA ON MICRO SOMAL PROSTAGLANDIN SYNTHASE-1 ... 138

Introduction ..................... ................................... ..... ............... 138
Analysis of Microsomal PGES-1 Expression and Promoter Activity in Human
Breast Cancer Cells..... .............................................. .. ...... .............. 138
R results ........... .. .......... ........... .... ... . .. .. ..................... 139
TNF-a Induces Microsomal PGES-1 Gene Expression in a Time-Dependent and
Cell-Specific Manner ........................ ........... .... ............... 139









Analysis of the Activation of the Distal Hypersensitive Site (HS2) by TNF-a............. 139
Identification of TNF-a Responsive Regulatory Elements within HS2 ......................... 140
Discussion ............ ............ .................. ............... ........ 140

LIST OF REFERENCES .......................................................................... 145

BIOGRAPHICAL SKETCH ......................................... 164










LIST OF TABLES


Table


2-1 Primers used for generating mPGES-1 fragments ....... .............. ...................49


page









LIST OF FIGURES


Figure page

1-1 Arachidonic A cid Pathw ay. ........................................ 33

1-2 Cleavage of arachidonic acid from membrane phospholipids. ............... ............ 34

1-3 S y n th e sis o f P G E 2. ................................................................................................................. 3 5

3-1 Induction of mPGES-1 gene expression by the pro-inflammatory cytokine, IL-10 in
human lung fibroblasts ............................. ............. .. ..... .............. 61

3-2 Induction of mPGES-1 mRNA expression by IL-10 in human lung fibroblasts...........62

3-3 Induction of mPGES-1 mRNA expression by IL-10 in human lung fibroblasts: HFL-
1 cells analyzed by quantitative real-time RT-PCR analysis. ....................................... 63

3-4 Induction of mPGES-1 protein expression by IL-10 in human lung fibroblasts. ..............64

3-5 Determination of mPGES-1 mRNA decay following stimulus removal............................65

3-6 The IL-10 induction of mPGES-1 gene expression requires de novo transcription. .........66

3-7 The IL-10 induction of mPGES-1 gene expression requires de novo transcription:
A naly si s of hnR N A levels. ...................................................................................... ...... ..... 67

3-8 Evaluation of the mPGES-1 proximal promoter.................................................68

3-9 Evaluation of the mPGES-1 proximal promoter.................................................69

3-10 Analysis of internal cis-acting elements that may be involved in regulating mPGES-1
gene expression. ......................................................70

3-11 mPGES-1 chromatin structure: DNase I hypersensitive site analysis 1..........................71

3-12 mPGES-1 chromatin structure: DNase I hypersensitive site analysis 2.........................72

4-1 Functional analysis of the distal hypersensitive site, HS2 relative to the mPGES-1
promoter. ...................................... ........ 84

4-2 Functional analysis of the distal hypersensitive site, HS2 relative to the mPGES-1
promoter. ...................................... ........ 85

4-3 HS2 exhibits characteristics of an enhancer: Evaluation of HS2 using a minimal
thymidine kinase (TK) heterologous promoter. .................................. ............... 86

4-4 HS2 exhibits characteristics of an enhancer: Evaluation of HS2 using a minimal
viral thymidine kinase heterologous promoter. .............................. ............... 87









4-5 Identification of a basal elem ent within H S2. ....................................................... 88

4-6 Mapping of an inducible element contained within HS2. ......................... ............... 89

4-7 Location of three C/EBPp binding sites in the distal regulatory enhancer element
predicted by computer analysis. .......... ............ ...... ............... 90

4-8 Evaluation of single C/EBP3 mutants in the IL-10 induction of mPGES-1. ..................... 91

4-9 Analysis of double C/EBPp mutants in the IL-10 induction of mPGES-1 .......................92

4-10 Evaluation of the C/EBP3 sites in constructs lacking the Egr-1 binding site. ...................93

4-11 Targeted deletion of C/EBP3 by siRNA in human lung fibroblasts............... ...............94

4-12 Targeted deletion of C/EBPp by siRNA in rat lung epithelial cells. ...............................95

4-13 Evaluation of mPGES-1 expression in C/EBPp-deficient mouse embryonic fibroblast
(MEF) cells. .................................. ...... ............... 96

4-14 Chromatin immunoprecipitation analysis of Egr-1 and RNA Polymerase II binding.......97

4-15 Chromatin immunoprecipitation analysis of C/EBP3 binding........... .............. 98

4-16 Co-immunoprecipitation analysis of Egr-1 and C/EBPp binding.............................. 99

4-17 Model of the functional role played by C/EBPp and Egr-1 in activating the IL-10
induction of mPGES-1 gene expression. ..................................... 100

5-1 IL-10 induces cPLA2a phosphorylation via the action of p38MAPK........................... 113

5-2 p38MAPK mediates cPLA2a gene expression in an IL-10-dependent manner............... 114

5-3 Inhibition of cPLA2a enzymatic activity blocks the IL-1p induction of cPLA2a gene
expression: A feed forward mechanism....................................... 115

5-4 Inhibition of cPLA2a enzymatic activity blocks the IL-1p induction of cPLA2a gene
expression: A feed forward mechanism....................................... 116

5-5 p38MAPK mediates cPLA2a gene expression in an IL-10-dependent manner............... 117

5-6 Phosphorylation of MKK3/MKK6 is induced by IL-1........................................ 118

5-7 MKK3/MKK6 mediates cPLA2a gene expression in an IL-10-dependent manner.. ...... 119

5-8 Phosphorylation of MSK-1 is induced by IL-1. .......................................... 120

5-9 The lipoxygenase pathway but not cyclooxygenase pathway is necessary for cPLA2c
expression: Inhibition of cPLA2a enzymatic activity ......................... ...... 121









5-10 The lipoxygenase pathway but not cyclooxygenase pathway is necessary for cPLA2a
expression: Inhibition of cPLA2a enzymatic activity ............... .......... ...... 122

5-11 The lipoxygenase pathway but not cyclooxygenase pathway is necessary for cPLA2a
expression: Inhibition of COX. .......... .................. ......... 123

5-12 The lipoxygenase pathway but not cyclooxygenase pathway is necessary for cPLA2a
expression: Inhibition of LOX. .......... ............ ..... ............... 124

5-13 The lipoxygenase pathway but not cyclooxygenase pathway is necessary for cPLA2a
expression: Inhibition of 5-LOX.. .... ...... ......................... 125

5-14 The lipoxygenase pathway but not cyclooxygenase pathway is necessary for cPLA2a
expression: Inhibition of 12/15-LOX................................. ....................... ..... 126

5-15 Pharmacological inhibition of 15-LOX and siRNA against 15-LOX activity blocks
the IL-10 induction of cPLA2a gene expression. .................................... 127

5-16 Pharmacological inhibition of 15-LOX and siRNA against 15-LOX activity blocks
the IL-10 induction of cPLA2a gene expression. .................................... 128

5-17 M odel of cPLA2a activation.. ............................................................................................ 129

A-i TNF-a induces mPGES-1 gene expression in a time dependent and cell-specific
m anner............ .... ........ .......... .. ........................... ........ 142

A-2 Analysis of the activation of the distal hypersensitive site (HS2) by TNF-a .................... 143

A-3 Identification of TNF-a responsive regulatory elements within HS2................... ...............144









LIST OF ABBREVIATIONS

AA Arachidonic acid

ALLN Calpain inhibitor N-acetyl-leucyl-leucyl-norleucinal

BAL Bronchial alveolar lavage fluid

CaMKII Calcium and calmodulin-dependent protein kinase II

C/EBP CCAAT-enhancer binding protein

ChIP Chromatin immunoprecipitation

COX Cyclooxygenase -lor -2

COXIB Cyclooxygenase-2 selective inhibitor

DP Prostaglandin D2 receptor

ECM Extracellular matrix

EGR1 Early growth response factor-i

EP Prostaglandin E2 receptor

ERK Extracellular signal-regulated kinase

FLAP 5-Lipoxygenase activating protein

JNK c-Jun N-terminal kinase

HETE Hydroxyeicosatetraenoic acid

HODE hydroxyoctadecadienoic acid

HPETE Hydroperoxyeicosatetraenoic acid

hGH Human growth hormone

hnRNA Heterogeneous nuclear RNA

HS Hypersensitive site

IL-10 Interleukin-lp

LOX Lipoxygenase

LPS Lipopolysaccharide

MAPK Mitogen-activated protein kinase









MEF Mouse embryonic fibroblasts

MSK Mitogen- and stress-activated protein kinase

NFKB Nuclear factor kappa-light-chain-enhancer of activated B cells

NSAID Nonsteroidal anti-inflammatory drugs

PCR Polymerase chain reaction

PPAR Peroxisome proliferator-activating receptor

PGD Prostaglandin D2

PGE Prostaglandin E2

PGH Prostaglandin H2

PGES Prostaglandin E synthase

PLA Phospholipase

TK Thymidine kinase

TNFa Tumor necrosis factor a

TxA2 Thromboxane









Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

CHARACTERIZATION OF MICROSOMAL PROSTAGLANDIN E SYNTHASE-1 GENE
REGULATION BY THE PRO-INFLAMMATORY CYTOKINE INTERLEUKIN 1-BETA

By

Jewell Nadia Walters

August 2009

Chair: Harry S. Nick
Major: Medical Sciences Biochemistry and Molecular Biology

The arachidonic acid (AA) pathway is a major contributor to the inflammatory response,

pain production and cellular homeostasis. AA is liberated from membrane phospholipids by

cytosolic PLA2alpha (cPLA2alpha) activity and then metabolized by either the cyclooxygenase

(COX) or lipoxygenase (LOX) enzymes. The COX enzymes regulate the production of

downstream prostanoids known to be involved in the regulation of a number of biological and

pathophysiological processes. Of these prostanoids, PGE2 is the most widely studied due to its

key role in inflammation. Over the years, the study of PGE2 biosynthesis and regulation focused

entirely on the role of COX-2. More recently, the trend has shifted towards understanding the

role of specific PGE2 terminal synthases. There are five known PGE synthases and microsomal

PGES-1 (mPGES-1) has emerged as the crucial enzyme responsible for PGE2 production.

mPGES-1 is highly induced by pro-inflammatory cytokines and existing gene regulation studies

highlight the importance of early growth response factor-i as a key regulator of mPGES-1

expression. This study demonstrates that mPGES-1 is induced by interleukin 1-beta (IL-Ibeta)

in pulmonary fibroblasts requiring de novo transcription and identifies a hypersensitive site (HS)

within the distal promoter region that exhibits both basal and inducible enhancer activity.

Functional analysis of HS led to the identification of a binding site for CCAAT/enhancer binding









protein within the enhancer and illustrated the importance of this element in recapitulating the

complete cytokine induction of mPGES-1 gene expression.

cPLA2alpha is activated by intracellular calcium levels and kinase activity but the exact

signaling mechanism involved is still unclear. This study attempted to identify key factors

involved in the IL-10 induction of cPLA2alpha in pulmonary cells. The results introduce a feed

forward mechanism involving the initial rapid induction of cPLA2alpha enzymatic activity and

the involvement of a downstream AA metabolite, 15 -LOX as being necessary for the cytokine-

mediated induction of cPLA2alpha.

mPGES-1 expression is highly up-regulated in breast cancer and recent studies

demonstrate a role for estrogen and possibly TNFalpha in mediating mPGES-1 gene expression.

The final study explores the involvement of TNFalpha and illustrates that it is a potential

mediator of mPGES-1 gene expression in breast cancer.









CHAPTER 1
INTRODUCTION

Overview of the Arachidonic Acid Pathway and Metabolites

Redness, pain, swelling, these are all visible characteristics of the inflammatory response,

but at the cellular level the response is much more complicated. In the initial stages, arachidonic

acid is metabolized to form eicosanoids which include prostaglandins, leukotrienes,

hydroxyeicostetraenoic acid and lipoxins as illustrated in Figure 1-1 (1-3). The eicosanoids then

serve as signaling molecules, regulating a variety of processes including chemotaxis (4),

vasodilatation (5), pain (6), fever (7), anaphylaxis and vasoconstriction (8,9). Aside from the

inflammatory response, eicosanoids have also been implicated in a number of disease states

including inflammatory bowel disease/Crohns' disease, many cancers such as breast, colon,

prostate and lung cancer, rheumatoid arthritis, chronic obstructive pulmonary disease (COPD)

and cardiovascular disease (3,8,10-16).

Prostaglandin/Prostanoid

Prostanoids were initially discovered when an extract of sheep seminal fluid was incubated

with arachidonic acid (17). The first steps ofprostanoid synthesis involve the conversion of

arachidonic acid to prostaglandin H2 (PGH2) by the action of prostaglandin endoperoxide H

synthase also called cyclooxygenase (COX-1 and COX-2). PGH2 serves as the central

intermediate and substrate for the synthesis of the following prostanoids PGD2, PGE2, PGF2a,

PGI2 and TxA2 (18,19). The conversion of PGH2 to the various prostanoids is mediated by the

action of specific terminal synthases which function not only in the catalysis of these reactions

but also in the regulation of prostanoid expression (1,11,20).

Prostanoids have been shown to regulate a wide variety of complex processes including

inflammatory responses, female reproduction, tumorigenesis, vascular hypertension, kidney









function, gastric mucosal protection, pain sensitivity, vasodilatation, bronchoconstriction,

pyresis, parturition, sleep and many diseases within the body (21-24). PGD2, for instance, plays

a role in asthma, smooth muscle relaxation, the activation of eosinophils and is synthesized by

mast cells in the lungs following allergen challenge and has been thought to play a role in

asthma, as well as, in the activation of eosinophils (5,25,26). PGD2 along with PGE2 are also

necessary during the sleep wake cycle; PGD2 promoting sleep and PGE2 promoting wakefulness

(27,28). On the other hand, TxA2, is synthesized by platelets, functions in platelet aggregation

and vasoconstriction in the cardiovascular system (29,30). Conversely, PGI2 acts opposite to

TxA2 as an anticoagulator for platelets, a vasodilator and like PGF2a has been widely studied in

pregnancy during embryo implantation (31-33). PGE2 has been implicated to promote fever,

inflammation, vasodilatation, cancer, pain and is involved in reproductive processes (11,34-41).

PGF2a also plays a critical role in reproductive processes promoting myometrial contractions,

cervical relaxation and ovulation (42,43).

Arachidonic acid metabolites play a role in overall lung health and function, the

predominant forms being PGD2,PGE2, and TxA2 (44). Airway inflammation, airway

obstruction, remodeling, hypertrophy/hyperplasia of bronchial smooth muscle cells and

eosinophil infiltration are all principal features of asthma (45-47). PDG2 is a potent

bronchoconstrictor that is produced by mast cells and purported to play a role in allergen-induced

asthma (48,49). In 2000, Matsuoaka et al. (25) highlighted the role of PGD2 in allergic asthma.

Using PGD2 receptor (DP) null mice, they were able to show that both the wild type and mutant

mice had similar levels of serum IgE, the antibody produced in response to antigen-induced

asthma. Furthermore, after sensitization and aerosolized application of ovalbumin, in a model of

allergen-induced asthma, wild type mice exhibited increased infiltration of eosinophils and









lymphocytes, while the DP -/- mice showed only marginal increases in the number of these

infiltrated cells. Also the wild type animals showed an increase in airway hyperactivity

compared to the DP -/- mice as well as an increase in the production of TH2 cytokines. Overall

this study provided strong evidence of the role of PGD2 in mediating the asthmatic response (25).

Derived from platelets, TxA2 is a known to be a constrictor of bronchial smooth muscles

and a stimulator of airway smooth muscle cell proliferation (29,44). Asthmatic patients are

known to produce excessive amounts of TxA2, as measured in their urine (50), bronchoalveolar

lavage (BAL) fluid (51) or exhaled air condensate (52). Davi et al. (53) illustrated that patients

suffering from chronic obstructive pulmonary disease showed increased urinary excretion of

TxA2 versus healthy patients and that hypoxia may stimulate increased synthesis of TxA2.

The most potent prostanoid in the human body is PGE2 and within the lung it is

bronchoprotective (15). A variety of cell types contribute to PGE2 production including

macrophages, dendritic cells and lung fibroblasts (15,54). In response to pro-inflammatory

mediators and stimuli such as IL-P0, LPS and phorbol esters, human alveolar macrophages, lung

fibroblasts and airway epithelial cells up-regulate COX-2 expression which alternatively leads to

an increase in PGE2 levels (55-57). Normal lung cells produce collagen, elastin,

cytokines/growth factors and extracellular matrix (ECM) proteins which provide structural

integrity as well as shape, movement, growth and differentiation. In response to injury or

environmental cues, fibroblast proliferation is activated and there is an increase in collagen

synthesis/ECM deposition which if left unchecked leads to fibrosis (15,39). Over the years,

several studies have shown that PGE2 is known to inhibit fibroblast migration, proliferation,

collagen synthesis and eosinophil degranulation, thus highlighting the protective effects of PGE2









in the lung (58-60). A detailed description of PGE2 and the synthase responsible for its

biosynthesis, which is a central topic of this dissertation, will follow.

An alternative metabolic pathway for arachidonic acid involves the synthesis of cysteinyl

leukotrienes, leukotriene C4, -D4 and -E4 (LTC4, LTD4 and LTE4) by the action of 5-

lipoxygenase (5-LOX) and leukotriene C4 synthase. These leukotrienes are produced by

leukocytes, lung fibroblasts, platelets and endothelial cells (61-63). In the lung, cysteinyl

leukotrienes are chemoattractants and are involved in fibroblast proliferation and collagen

synthesis (64,65). Over the years, cysteinyl leukotrienes have been implicated in lung disease,

particularly asthma and have been the target for drug development and treatments (66-69).

Further, the role of leukotrienes in pulmonary function was evaluated in animal models of

fibrosis (68). In bleomycin-induced fibrosis, 5-LOX -/- mice exhibited decreased levels ofECM

proteins and a reduction in the recruitment of immune cells lymphocytess, eosinophils and

macrophages) compared to wild type mice. The 5-LOX -/- mice also showed increased PGE2

production after bleomycin induction, which may explain the reduced response to bleomycin-

induced inflammation (70).

Together these studies highlight the importance of eicosanoids as they relate to lung health

and function. Each metabolite represents a potential therapeutic target for the development of

new drugs used for the treatment of asthma, fibrosis and other pulmonary disorders and

potentially as therapies in lung cancer. These studies also reveal the diversity exhibited by the

lung, thus establishing it as an interesting model for gene regulation studies.

Cytosolic Phospholipase A2a (cPLA2a) and Arachidonic Acid Metabolism

In the 1930's essential fatty acids were discovered as compounds that were vital for human

health but could only be obtained through diet (41,71). There are two main families of essential

fatty acids, omega-3 containing alpha-linolenic acid and omega-6 containing linoleic acid, which









serve as the starting point for the production of polyunsaturated fatty acids including arachidonic

acid (2,13,41). Arachidonic acid, an omega-6 fatty acid, is generated by the hydrolysis of

phospholipids via the action of phospholipase A2S (PLA2) (2,13,41,72-77). There are five

categories of phoshpolipases: secreted phospholipases (78-81), group (IV) cytosolic PLA2 (82-

84) and intracellular group (VI) calcium-independent PLA2 (85,86), PAF acetylhydrolysases and

lysosomal PLA2S (87-89). While each class of PLA2 is capable of cleaving arachidonic acid

from phospholipids, group IV PLA2, particularly cytosolic PLA2a (cPLA2a), shows a high

specificity for cleavage of arachidonic acid from the sn2 position of glycerophospholipids and

this reaction is illustrated in Figure 1-2 (82,84,90). The newly synthesized arachidonic acid is

further metabolized to leukotrienes, lipoxins, prostaglandins and hydroxyeicostetraenoic acids, as

shown in Figure 1-1.

Regulation and Activation of Cytosolic PLA2a

Group (IV) cytosolic PLA2 contains six isozymes, cPLA2a, cPLA20, cPLA2y, cPLA26,

cPLA2S and cPLA2, which all share a catalytic dyad and a homologous C2 domain involved in

Ca2+-dependent phospholipid binding. The only exception to this group is cPLA2y; which lacks

the C2 domain but is isoprenylated at its C-terminus and thereby thought to be membrane-

associated (91,92). Localized to chromosome 1q25, cPLA2a is ubiquitously expressed in all

human tissues, with an elevated basal level in the lung. The enzymatic activity and levels are

also induced in response to pro-inflammatory stimuli and various growth factors (54,93-100).

Furthermore, use of IL-4 or glucocorticoids has been shown to inhibit cPLA2a activation and

thus downstream eicosanoid formation (99,101-103).

Numerous studies have evaluated the enzymatic activity of cPLA2a in terms of arachidonic

acid production and found that the protein is also regulated at the post-translation level. The

activity of the 85kD enzyme is known to be induced by phosphorylation of a serine residue at









position 505, mediated by mitogen activated protein kinases (MAPK) (104,105). Two other

serine residues, at position 515 and 727 have also been shown to be important for cPLA2a

enzyme activity. Ser515 is reportedly phosphorylated by calcium/calmodulin-dependent kinase

II (CaMKII) and Ser727 by mitogen-activated protein kinase interacting kinase (MNK-1)

(93,106-108) and mutation of either of these two residues results in a loss of cPLA2a activity.

Previous reports have shown that micromolar levels of intracellular calcium levels promote the

translocation of cPLA2a from the cytoplasm to the nuclear envelope and endoplasmic reticulum,

putting the enzyme in close proximity to its substrate and other enzymes in the arachidonate

pathway (109-112). Aside from intracellular calcium levels, full activation of cPLA2a, is

dependent on the activity of members of the MAPK pathway including MKK3/MKK6 and p38

which will be discussed in some detail in Chapter 5.

In different cells and under certain conditions cPLA2a can localize to different regions

such as the nucleoplasm in endothelial cells, the plasma membrane in neutrophils and lipid

bodies in macrophages, mast cells, neutrophils and fibroblasts (113-115). As further verification

of the role of calcium in cPLA2a, the use of calcium agonists were employed and shown to

activate cPLA2a activity leading to translocation and the increased release of arachidonic acid

(116).

The physiological importance of cPLA2a has been highlighted by pathological studies of

cPLA2a-deficient mice. Overall these mice appear to develop normally, however they do exhibit

a few abnormalities, including a reduced litter size (117), impaired parturition (118), kidney

problems (urine-concentrating defect, aquaporin 1 defect/diminished water reabsorption) (119)

and the propensity to develop ulcerated intestines (120). In disease state models for lung injury

(111), such as experimental autoimmune encephalomyelitis (121), MPTP (1-methyl 4-phenyl









1,2,3,6-tetrahydropyri dine) neurotoxicity/Parkinsonian disease (122), ischemic brain injury

(118), collagen induced arthritis (123), atherogenesis (124); cPLA2a(-/-) mice show a decreased

incidence and severity of the respective diseases in comparison to their wild-type counterparts.

Furthermore, peritoneal macrophages isolated from the mutant mice show reduced levels or loss

of arachidonic acid release and downstream eicosanoid signaling (118,125).

Lipoxygenases (LOX)

The LOX enzymes form another major pathway involved in both arachidonic acid and

polyunsaturated fatty acid metabolism. Lipoxygenases reduce fatty acid substrates by

oxygenation, leading to the formation of hydroperoxyeicosatetraenoic acid (HPETE),

hydroxyeicosatetraenoic acid (HETE), leukotrienes, lipoxins or hydroxyoctadecadienoic acid

(HODE). There are four LOX enzymes, 5-, 8-, 12- and 15-, classified according to the site of

oxygen insertion within arachidonic acid (126-128). The LOX enzymes are very similar in both

mice and humans; in mice there are seven forms of LOX enzymes, four 12-LOX, 8-LOX, 5-

LOX, e-LOX1 (non-expressed epidermal) most of which map to chromosome 11 while in

humans there are four forms, 5-LOX, 12-LOX, 15-LOX1 and 15-LOX2, three of which are

localized to chromosome 17 (129-132).

Various cell types such as leukocytes, macrophages, granulocytes, dendritic and mast cells

express 5-LOX. An approximately 75kD protein, 5-LOX catalyzes the formation of 5-HPETE

leading to the formation leukotrienes. 5-LOX expression and activity has been observed in

bronchial asthma, cardiovascular disease and various cancers (67,131,133-135). There are two

isoforms of 15-LOX in humans, 15-LOX1 and 15-LOX2, which are 78kD proteins. 15-LOX1 is

closely related to the murine leukocyte 12-LOX and 15-LOX2 is similar to murine 8-LOX. Both

15-LOXs utilize arachidonic acid as a substrate; 15-LOX2 preferentially converts arachidonic

acid to 15S-HETE while 15-LOX1 produces 15S-HETE and 12S-HETE (132,136,137). Aside









from arachidonic acid, it is well documented that 15-LOX1 metabolizes linoleic acid to 13(S)-

HODE (138-140). 15-LOX1 is found in airway epithelium, monocytes, prostate and colorectal

carcinomas while 15-LOX2 is expressed in the cornea, skin, hair root, lungs and prostate gland

(132,141,142). The importance of 15-LOX2 to cPLA2a gene regulation will be addressed in

Chapter 5 where data will be presented on a feed forward mechanism controlling IL-10-

dependent induction of cPLA2a.

Cyclooxygenases (COX)

After arachidonic acid is liberated from glycerophospholipids by PLA2 activity, it is then

metabolized to prostaglandin G2 then prostaglandin H2 in a series of oxygenation reactions

catalyzed by cyclooxygenases (COX). Currently there are three known COX isoforms, COX-1,

COX-2 and COX-3 (which is a splice variant of COX-1 and also referred to as COX-lb)

(143,144). COX-1 is constitutively expressed in most tissues and cell types, and is known to be

important in development. COX-1 expression is induced by phorbol esters in monocytes,

megakaryoblasts, endothelial cells and fibroblasts by IL-10 and TGF-P (145-148). COX-3 is a

splice variant of COX-1 and although its precise role has not yet been determined, it is found to

be highly expressed in the cerebral cortex and heart (144). Where COX-1 is constitutively

expressed, COX-2 is inducibly expressed in many tissues in response to growth factors,

cytokines IL-10, TNF-a, LPS and phorbol esters (149-151).

The two main COX isoforms, COX-1 and COX-2 are expressed in the lung and are known

to be involved in the ultimate production of PGE2. Figure 1-3 illustrates the COX pathway

leading to the production of PGE2. The availability of COX null mice has allowed for a clearer

understanding of the roles these enzymes play in lung health. Knockout models for COX-1 and

COX-2 have revealed that COX-2 expression is required for PGE2 production (152). In a recent

study using either COX-1 -/- or COX-2 -/- mice, the results illustrated that following allergen









exposure, mice deficient for either COX isoform showed an increase in airway infiltrates and

exhibited severe inflammation in the lungs compared to wild type mice, presumably due to

reduced levels of PGE2 (153). Also, allergen-induced COX-2 -/- mice showed increased airway

responsiveness when exposed to metacholine versus wild type mice and a greater production of

BAL cells and proteins (153). In a somewhat similar study, Zeldin et al. (154) showed that mice

deficient for either COX-1 -/- or COX-2 -/- exposed to aerosolized LPS had increased

bronchoconstriction with no difference in the number of BAL cells or lung histopathology as

compared to wild type mice. However, they did observe reduced levels of BAL

cytokines/chemokines and PGE2, which lends further credence to the importance of the COX

isoforms in PGE2 production and lung health.

Molecular and Transcriptional Regulation of COX-2 Expression

Although both COX-1 and COX-2 are involved in the production of downstream

prostanoids, COX-2 transcriptional regulation has been extensively studied. The gene encoding

COX-2 is located on chromosome 1 spanning 8.3 kb and contains 10 exons. The COX enzymes

are structurally similar, sharing -61% homology at the amino acid level (143,155). They differ

only slightly in their catalytic sites, where position 523 in COX-1 is an isoleucine residue and the

analogous residue in COX-2 is a valine. This difference allows for the formation of a side

pocket which is known to be critical for specific COX-2 inhibition (143). COX-2 encodes a 4.6

kb full length transcript and a 2.8 kb polyadenylated variant. The 3'UTR of COX-2 contains an

instability element that is involved in its post-transcriptional regulation (155). The promoter

region of COX-2 contains a number of transcription factor binding sites including NF-KB,

C/EBP, cyclic AMP response elements, a TATA box and an E-box (155-157). COX-2

expression is also known to be influenced by chromatin remodeling as p300 plays a role in

transcriptional activation of COX-2 (158,159).









In human umbilical vein endothelial cells, human foreskin fibroblasts and human airway

smooth muscle cells, COX-2 mRNA and protein expression is up-regulated in response to IL-10

and mediated by NF-KB and C/EBP (160,161). Also, LPS has been shown to induce COX-2

expression in RAW 264.7 cells mediated by CRE-1, C/EBP and NF-KB (162). ERK1/2,

p38MAPK and JNK pathways have also been identified as having a role in COX-2 expression

(163,164). It should be noted that up-regulation of COX-2 expression also leads to increased

prostaglandin synthesis and deregulation of COX-2 expression is associated with inflammatory

diseases and many cancers making COX-2 an attractive target for pharmacological inhibitors.

Inhibition of COX Activity by Non-Steroidal Anti-Inflammatory Drugs (NSAIDs)

In the early 1970's NSAIDs such as aspirin, ibuprofen and indomethacin were found to

inhibit both COX-1 and COX-2 activity and prostaglandin production. Aspirin is capable of

inhibiting both COX-1 and COX-2, but it is known to selectively acetylate Ser530 on COX-1,

blocking the active site channel and irreversibly inhibiting COX-1 activity (165,166). Since that

time, numerous COX-2 specific inhibitors (COXIBs) have been developed along with drug trials

to assess their potential anti-inflammatory and analgesic effects (167). While COXIBs such as

celecoxib, valdecoxib and rofecoxib offered new hope in the management of cancer and the

treatment of rheumatoid arthritis as an alternative to the use of traditional NSAIDs, their efficacy

has been questioned due to the appearance of life-threatening side effects. It was found that

prolonged use of COXIBs was associated with increased risk of gastrointestinal and

cardiovascular problems (168-170). In a 1994 study by Garcia Rodriguez et al. (171), they

reported that patients taking NSAIDs, particularly piroxicam, exhibited an increase risk of

gastrointestinal complications. Alternatively, a 2001 study by Teismann and Forger (172),

reported the protective effects of COX-2 inhibition on Parkinson's disease. In general, there

have been numerous reports on both the protective and adverse effects associated with COX









inhibition. While COX-2 represents an attractive target for pharmacological inhibitors due to its

aberrant expression in chronic diseases, the use of COXIBs is still somewhat controversial as are

the downstream effects on prostanoid synthesis; therefore further studies and clinical trials are

needed to fully understand the off-target effects of these inhibitors. Furthermore, the

development of specific inhibitors of downstream synthases may offer equally beneficial

outcomes with reduced side effects. The studies in chapter 3 will address the regulation of a

specific PGE2-dependent synthase that offers such an alternative therapeutic target.

Prostaglandin E2 (PGE2)

Of all the prostanoids listed thus far, PGE2 is by far the most widely studied, as it plays a

role in a number of inflammatory conditions and biological processes. PGE2 exerts it effects

through binding to one of four receptors, EP1, EP2, EP3 or EP4 (173,174). Each receptor is

expressed in specific tissues of the body, for instance EP2 is expressed in the lung, small

intestine, thymus, uterus and kidneys (175), while EP1 is expressed in the breast, stomach and

the skin (176). From the early studies conducted on metabolites of arachidonic acid, a link

between COX-2 and PGE2 was identified, wherein it was shown that after treatment with

inflammatory stimuli such as cytokines, growth factors and oncogenes an increase in COX-2

levels led to a subsequent increase in PGE2 production (57,177). In many cell culture models,

increases in COX-2 expression were shown to correlate with increases in PGE2 production (57).

As previously discussed, NSAIDS, including indomethacin, ibuprofen, piroxicam and sulindac

along with aspirin are known COX inhibitors (178,179), competitively inhibiting the synthesis of

PGG and PGH2 by the COX enzymes. Aspirin therapy is known to be beneficial to those

suffering inflammation, pain and cardiovascular health, but one of the side effects is

gastrointestinal complications (169,170). In general, when COX-2 levels are inhibited by









treatment with NSAIDS, glucocorticoids or COX-specific inhibitors, PGE2 levels were also

reduced.

Apart from regulation by COX-2 and the EP receptors, PGE2 production is dependent on

specific PGES synthases while its metabolism is dependent on the cytosolic enzyme,

hydroxyprostaglandin dehydrogenase (15-PGDH) (180,181). An NADP dependent enzyme, 15-

PGDH catabolizes the oxidation of prostaglandins to the 15-keto form thereby reducing their

biological activity. In a recent study, Yan et al. (181) showed that 15-PGDH also functions as an

antagonist in colorectal cancer. They found that 15-PGDH expression is greatly reduced in

colon cancer compared to normal colon mucosa. Subsequent addition of 15-PGDH and

treatment with the growth factor TGF-3 restored 15-PGDH expression and tumor suppression.

PGE2 Activity is Regulated by EP Receptors: Evaluation of EP-Receptor Knockout Mice

Considering the fact that PGE2 activity is dependent on the levels of each EP receptor,

numerous studies have been conducted on individual receptor knockout animals. Knockout

animals for EP1, EP2 or EP3 have been generated; EP4 has also been generated but most of

these animals die during the neonatal period (182). The EP3 receptor knockout has been

investigated during the febrile response (183). While EP1 and EP2 knockout animals are shown

to exhibit a fever when PGE2 is administered, EP3 -/- mice show no signs of a fever after

administration of PGE2, LPS or IL-10 (35,183,184). However, only after stress or stimulus-

hyperthermia, do the animals exhibit a febrile response (35,183-185).

In the case of the EP1 receptor, EP1 -/- mice have been studied in pain perception and

blood pressure models (38,186). Compared to wild-type animals, the EP1 -/- mice show a

reduced sensitivity to pain and there is a significant change in their cardiovascular profile

(38,186-189). Like the EP1 receptor knockout, the EP2 -/- mice have also been investigated in

regard to blood pressure and reproduction. It was found that when fed a normal diet, blood









pressure was reduced in EP2 -/- mice compared to wild-type mice, but on a high salt diet EP2 -/-

mice had a significant increase in blood pressure (189). With regard to reproduction, while EP2

-/- mice were no different than wild-type mice phenotypically, EP2 -/- mice exhibited reduced

pregnancy rates and delivered smaller litters compared to wild-type mice (37,188,190,191).

Overall, the EP receptor knockout studies highlight the importance of PGE2 in a number of

biological functions including cardiovascular homeostasis, reproduction, renal activity, fever and

pain perception.

Prostaglandin E Synthase (PGES)

As the contribution of PGE2 to many biological processes continues to be investigated,

the focus of PGE2 production has shifted to studying the role of the PGE2 specific synthases.

Jakobsson et al. (192) were the first to clone and characterize a human PGES, showing that this

enzyme was part of the MAPEG (membrane-associated proteins involved in eicosanoid and

glutathione metabolism) family of proteins and that it was capable of catalyzing the terminal step

conversion of PGH2 into PGE2. Their over-expression data revealed that PGES was a membrane

protein, which, when incubated with glutathione and PGH2 showed high levels of PGES activity

(192). Earlier work by the same group and others revealed two key residues, arginine at position

100 and tyrosine at position 130, conserved within the MAPEG family, that are essential for

enzymatic activity (193-196). When the arginine residue was mutated this resulted in a loss

enzymatic activity.

There exist five forms of PGES, two membrane or microsomal prostaglandin synthases

(mPGES-1 and mPGES-2), cytosolic prostaglandin synthase (cPGES/p23) and two glutathione

transferases (GSTM2-2 and GSTM3-3) (197,198). In terms of activity, mPGES-2 is glutathione

independent, constitutively expressed and known to associate with both COX-1 and -2, while

cPGES is functionally coupled to COX-1, mPGES-1 is glutathione-dependent and functionally









coupled to COX-2. Although all forms of PGES contribute to the overall production of PGE2,

mPGES-1 is strongly up-regulated in response to pro-inflammatory stimuli analogous to COX-2

and has been shown to be the major producer of PGE2 (199-201).

Transcriptional Regulation of Microsomal PGES-1

It is now widely accepted that COX-2 and mPGES-1 expression are functionally coupled

(193,200,202,203). Early studies of the COX-2 gene identified a number of transcription factor

binding sites such as NF-kappa B, CRE, E-box and NF-IL6 that are required for its inducible

expression (155,157,160,204). The gene encoding mPGES-1 is located on the long arm of

chromosome 9, 9q34.3. The genome consists of two introns and three exons spanning -14.8 kb;

the promoter region is GC-rich and lacks a TATA box. In 2000, work conducted by Forsberg et

al. (205) provided insight into the structure and potential regulation of mPGES-1. Their

functional analysis of a 0.6 kb mPGES-1 promoter fragment illustrated a strong increase in

promoter activity following IL-10 treatment. Later studies by Naraba et al. (206) and Moon et

al. (207) revealed that the transcription factor, Egr-1 was capable of binding to a region within

the proximal promoter of mPGES-1 and was important for its gene transcription. More recently,

a regulatory region for NF-kappa B was identified within the promoter region of mPGES-1 and

mutational analysis revealed that this region was important for mPGES-1 promoter activation

(208,209). In Chapter 3, a more detailed overview of mPGES-1 gene regulation will be

provided.

Physiological Relevance of Microsomal PGES-1 Gene Expression Evaluated in Knockout
Mice

Much of what is known about mPGES-1 activity has been centered on COX-2 and PGE2

expression. Recently, the generation of mPGES-1 null mice has revealed a number of interesting

details as to its function and most importantly its physiological significance. Overall, the









phenotype of the null mice appears to be no different than that of the wild-type mice; they

develop normally and are capable of reproduction. Studies focusing on endotoxin-induced shock

(210), arthritis (211), fever (210), pain perception/blood pressure (212), stroke and anorexia have

utilized mPGES-1 null mice (213,214). In an early study by Levin et al. (215), they showed that

the administration of exogenous PGE2 to the ventricular system of the brain and not IL-1I

suppressed food intake in mPGES-1 -/- animals. A later study by Pecchi et al. (216) also

confirmed that administration of PGE2 induces anorexia by suppressing food intake in mPGES-1

-/- mice whereas IL-10 did not decrease food intake in these mice. In studies analyzing pain

hypersensitivity (211,217,218), researchers found that mPGES-1 -/- animals exhibited a lower

response to stimuli compared to wild-type animals and interestingly, the prostanoid profile was

altered in these animals. In both collagen-induced arthritis and collagen antibody-induced

arthritis models, both the wild-type and mPGES-1 -/- animals developed arthritis but the degree

of severity was 50% less in the knockout animals compared to the wild-type animals (211,218).

Intuitively, targeted disruption of the mPGES-1 gene leads not only to a reduction of its

enzymatic activity but also to an overall reduction in PGE2 production, strongly implicating this

synthase in the regulated production of PGE2 (35,219).

Expression of Microsomal PGES-1 in Cancers

Like COX-2 and PGE2, mPGES-1 is highly expressed in many cancers including breast,

colon, ovarian and lung (220-224). Yoshimatsu et al. (199,225) evaluated mPGES-1 expression

in both lung cancer and colorectal adenomas. Their studies revealed that in over 80% of

colorectal tumors mPGES-1 was expressed. The authors also analyzed the effect of the cancer-

causing gene, Ras, on mPGES-1 expression and found that Ras expression led to a marked

increase in mPGES-1 promoter activity. They analyzed COX-2 expression in the tumors and

found that COX-2 was also induced about 80% and a known inducer of COX-2 expression,









TNF-a, stimulated an up-regulation of both mPGES-1 and COX-2 expression (199). In their

subsequent paper, the authors evaluated mPGES-1 expression in non-small cell lung cancer

harboring oncogenic Ras and nontransformed cells. They found that mPGES-1 and COX-2

expression were up-regulated in transformed cell lines harboring the mutant Ras gene, and both

mPGES-1 and COX-2 expression were up-regulated in response to treatment with TNF-a (225).

It should be noted that in both of these studies the molecular mechanism involved in the

regulation of mPGES-1 was not addressed. Finally in 2004, Chang et al. (226) demonstrated that

PGE2 induced tumor-associated angiogenesis and treatment with the NSAID, indomethacin,

inhibited tumorigenesis and tumor-associated angiogenesis in murine mammary glands.

In conclusion, there are many studies which support the role of PGE2 in tumorigenesis.

These studies also implicate the role of COX-2 in the formation of PGE2 and the recent

discovery of mPGES-1 and its up-regulation in many cancers has been shown to correlate with

COX-2 expression. Epidemiological studies have evaluated the role ofNSAIDs and COXIBs in

many cancers and disease states, and although they have been shown to reduce the risk of tumor

progression and the inflammatory response, they are associated with devastating side effects

including increased risk of gastrointestinal complications, such as bleeding ulcers and adverse

cardiovascular effects. Therefore, mPGES-1 represents a new and potentially advantageous

therapeutic target for the development of drugs aimed at suppressing PGE2 production without

affecting the general prostanoid profile and potentially without major side effects.









Leukotrienes ^ Arachidonic Acid

Lipoxins Cyclooxygenase
ETES
Prostaglandin H2


Prostaglandin D2 Prostaglandin F2a Thromboxane

Prostaglandin E2 Prostaglandin12


Figure 1-1. Arachidonic Acid Pathway. This diagram illustrates two different pathways
involved in arachidonic acid metabolism. The first pathway is mediated by
cyclooxygenase, which converts arachidonic acid to a central intermediate
prostaglandin H2. Prostaglandin H2 can be further metabolized to yield, PGD2, PGE2,
PGF2a, PGI2 and thromboxane. In the second pathway, lipoxygenase converts
arachidonic acid to leukotrienes, lipoxins or hyroxyeicosatetraenoic acid (HETE).










0= P- O -X


HO


Arachidonic Acid

Phospholipid













Figure 1-2. Cleavage of arachidonic acid from membrane phospholipids. The diagram depicts
the liberation of arachidonic acid from phospholipids. cPLA2a preferentially cleaves
membrane phospholipids at the sn-2 position, liberating free arachidonic acid which
is further metabolized by downstream enzymes.













Arachidonic Acid

COOH
"'"" I

OOH




PGH7I


Cyclooxygenase
(COX- 1/COX-2)


-COOH


OH PGE2


Figure 1-3. Synthesis of PGE2. Free arachidonic acid is metabolized by the action of
cyclooxygenase 1 and 2 in a series of redox reactions to PGH2. PGH2 is then
converted to PGE2 in a reaction catalyzed by the PGE2-specific synthases.


PGE









CHAPTER 2
MATERIALS AND METHODS

Materials

FUGENE 6 transfection reagent (11988387001), interleukin-l1 (IL-10) (201-LB) and

complete protease inhibitor cocktail (11697498001) were purchased from Roche Applied

Science (Indianapolis, IN). Restriction endonucleases, T4 DNA Ligase (M0202L), Vent

Polymerase (M0254L), Taq Polymerase (M0267L) and Klenow (large fragment of E. coli DNA

Polymerase) (M0210L) were purchased from New England Biolabs (Boston, MA). AACOCF3

(100109), pyrrolidine (525143), Bay-11-7082 (196870), ALLN (208719), SP600125 (420119),

PD98059 (513000), SB203580 (559389), SB202190 (559388) and L-a-lyso-lecithin (440154)

were purchased from Calbiochem (Gibbstown, NJ). DNase I (LS006342) was purchased from

Worthington Biochemical (Lakewood, NJ). Ham's F12K media (N3520), PD146176 (P4620),

curcumin (C1386), actinomycin D (A9415) and proteinase K (P6556) were purchased from

Sigma-Aldrich (St. Louis, MO). Ciglitazone (71730), Luteolin (10004161), MK886 (10133),

NDGA (70300), indomethacin (70270), mPGES-1 monoclonal and polyclonal antibodies

(10004350, 160140) were purchased from Cayman Chemical (Ann Arbor, MI). Dulbecco's

modified eagle medium (DMEM 10-013-CV) was purchased from Mediatech Inc. (Manassas,

VA). Phospho-cPLA2 (ser505) (2831), phospho-MSKI (Ser376) (9591) and phospho-

MKK3/MKK6 (Serl89/207) (9231) antibodies were purchased from Cell Signaling

Technologies (Dover, MA). Protein AG agarose beads (SC-2003), anti-His antibody (SC-803),

Egr-I antibodies (SC-189, SC-101033) and C/EBPP antibodies (SC-150, SC-7962) were

purchased from Santa Cruz Biotechnology Inc (Santa Cruz, CA). Hyperfilm MP (28906846)

and ECLTM western blotting system (RPN2108) were purchased from GE Healthcare

(Piscataway, NJ) and Bicinchoninic acid protein assay kit from Pierce (Rockland, IL). A









Quikchange site-directed mutagenesis kit with XL-1 Blue competent cells (200518-5) was

purchased from Stratagene (La Jolla, CA). QIAquick Nucleotide Removal Kit 28306), Qiagen

Plasmid Maxi Kit (12163), Hispeed Plasmid Midi Kit (12643), QIAquick Gel Extraction Kit

28706), QIAquick PCR purification kit (28106), RNeasy Mini Kit (74106), QIAprep Spin

Miniprep Kit (27106), RNase Free DNase Kit (79254) and the siRNA for Luciferase

(SI03650353) were purchased from Qiagen (Valencia, CA). iTaqTM SYBR Green Supermix

with ROX (172-5851), Criterion precast Tris-HCI gels (10% and 15%) (345-0009, 345-0019)

and Zeta-Probe nitrocellulose membrane (162-0115) were purchased from Bio Rad (Hercules,

CA). A random-primer DNA labeling kit (18187-013), TOPO XL PCR Cloning Kit with One

Shot Chemically Competent Cells (K4700-10) and SuperScriptfm first strand synthesis kit

(11904-018) were purchased from Invitrogen Technologies (Carlsbad, CA). The siRNAs for rat

C/EBPP (L-092218-00), human C/EBP3 (L-006423-00), human Aloxl5B (L-009026-00),

cyclophilin B (D-001136-01) and DharmaFECT 1 transfection reagent (T-2001-02) were

purchased from Dharmacon, Inc (Lafayette, CO).

Methods

Cell Culture

Human lung fibroblast, HFL-1 cells (ATCC CCL 153) and a rat pulmonary epithelial-like

cell line, L2 (ATCC CCL 149) obtained from ATCC were maintained in continuous cell culture

in Ham's F12K media supplemented with 4 mM glutamine, ABAM (0.1 mg/mL streptomycin,

0.25 [tg/mL amphotericin B and 10 [g/mL penicillin G) and 10% FBS at 370C and 5% CO2.

Mouse embryonic fibroblasts (MEF): wild type and C/EBP3 -/- cells were provided by Dr. P.

Johnson, NIH via Dr. Michael Kilberg; wild type and p38a -/- cells were provided by Dr. A.

Nebreda, EMBL; wild type and p38p -/- cells were provided by Dr. A. Choi, Harvard Medical

School and wild type and MKK3/6 -/- cells were provided by Dr. R. Davis University of









Massachusetts. All MEF cell lines were maintained in DMEM media supplemented with 10%

fetal bovine serum and ABAM (10 [g/mL penicillin G, 0.1 mg/mL streptomycin, and 0.25

[tg/mL amphotericin B) in continuous culture at 37C in humidified air with 5% CO2. For

plasmid transfections and protein over-expression, cells were seeded on 10 cm or 150 mm

dishes. For cytokine treatment, cells were seeded on 10 cm dishes and for inhibitor studies cells

were seeded on 10 cm dishes then treated with pharmacologic inhibitors for 1 h prior to exposure

with IL-10. For siRNA transfections cells were seeded on 35 mm dishes.

Plasmids, Probes and Site-Directed Mutagenesis

An Mlul site was introduced into a pUC12-based human growth hormone (hGH)

expression vector using site-directed mutagenesis by Dr. JD Herlihy in our lab. The hGH

reporter constructs were generated by sub-cloning the following mPGES-1 promoter fragments, -

1104/+160 (-1.1 kb) and -434/+160 (-0.6 kb) into the promoter-less, hGH expression vector

using the Hind III and BamHI sites, all numbering relative to the start of transcription (+1) of the

mPGES-1 gene. An Egr-1 consensus site and a C/EBP3 consensus site in the mPGES-1

promoter construct, identified by TESS transcription element search software (227) were

deleted by site-directed mutagenesis. Briefly, 10 ng of -1.1 kb promoter construct was used as

the template and 125 ng of each mutagenesis primer were added to 1 [tL dNTP mixture, 1.5 [tL

dimethyl sulfoxide (DMSO), 5 [tL 10X reaction buffer, 1 [tL Pfu Turbo Polymerase and mixed

together, then brought to a final volume of 50 [tL with sterile double distilled water. The

reaction was conducted in a PTC 100 peltier thermal cycler using the following parameters:

Cycle 1 (95 'C, 30 sec) Ix, Cycle 2 (95 'C for 45 sec, 60 'C for 1 min, 68 'C 7 min) 18x. The

reaction was stopped by incubation on ice for 5 min and 1 [tL DpnI was added to digest the

methylated parental strand, leaving the mutated product, which is then transformed into XL-1-

Blue competent cells and incubated on agar containing ampicillin. Resultant colonies containing









the recombinant plasmids were isolated and sequenced for verification of the mutation. The

following mPGES-1 genomic fragments were sub-cloned into pGH1.1 at the Mlul site: -10.7/-

6.4, -10.7/-9.6, -10.1/-9.0, -9.5/-8.5, -8.6/-6.4, -7.6/-6.4, -8.6/-8.1 and -8.1/-7.6, all numbering

relative to the start of transcription (+1) of the mPGES-1 gene. The primer sequences are listed

in Table 2-1. The -10.7/-6.4 fragment was also cloned into an hGH expression vector containing

the heterologous viral thymidine kinase promoter at the Ndel site of this vector. The three

potential C/EBPj consensus sites in the -8.6/-8.1 fragment were also identified by TESS and

deleted by site-directed mutagenesis, using the primers listed in Table 2-1. The mPGES-1 probe

used for northern blot analysis were amplified from the cDNA sequence using the forward

primer 5'-GAATTCGCCAGAGATGCCTGCCCACA-3' and reverse primer 5'-

GAATTCACACACGGGCACACACACAGGC-3'. The 0.7 kb growth hormone probe was

generated by restriction digest of the growth hormone cDNA using the Xbal and HindIII sites.

Transient Transfection

Prior to transfection and treatment with cytokines, HFL-1 cells were cultured as previously

described and transfected at approximately 60 70% confluency. 5 [g of the indicated plasmid

was transfected into HFL-1 cells using the Fugene 6-Reagent protocol from Roche. Briefly, in a

1.5 mL tube, 5 [tg of DNA was completed with 15 [tg of Fugene 6-Reagent (ratio of 1:3 DNA to

Fugene 6-Reagent) in 580 [tL serum free media and the complex was incubated at room

temperature for 20 min, during this time the cells were washed Ix with IX PBS and the media

replaced. The DNA-complex was added to the cells and incubated at 37C for 3h. The cells

were again rinsed Ix with IX PBS, media replaced and then incubated overnight at 3T in

humidified air with 5% CO2. At 24 h post-transfection, each 10 cm plate of cells was trypsinized

and split into two 10 cm plates and incubated overnight. This batch transfection method controls

for equal transfection efficiency for each transfected construct. Forty hours post-transfection,









cells were stimulated with or without 2 ng/mL of IL-10 for 8 h. As a control a promoter-less

construct was also transfected to ensure that the transfection or the hGH plasmid does not have

any effect on the mPGES-1 message.

RNA Isolation, Northern Blot and Hybridization

Total cellular RNA was isolated as described by Chomczynski and Sacchi with

modifications (96,228) or using the Qiagen RNeasy Kit. After treatment with cytokines, cells

were rinsed Ix with IX PBS, lysed on the plate by the addition of 500 [tL GTC solution (4M

guanidinium thiocyanate, 25mM sodium citrate pH 7.0, 0.5% sarcosyl and 0.1M 0-

mercaptoethanol) and then lysate transferred to a 1.5 mL tube. The mixture was then vortexed

briefly to aid cellular lysis, then 50 [tL 2M sodium acetate pH4.0 followed by 500 [tL water-

saturated phenol was added to the tube. The lysate was then inverted 5x to mix and incubated at

room temperature for 5 minutes. Next, 110 [tL of 49:1 chloroform:isoamyl alcohol mixture was

added to the lysate and the tube was shaken to mix and centrifuged at 13200 rpm for 15 minutes.

The aqueous phase was removed to a fresh 1.5 mL tube and an equal amount of isopropanol was

added to the sample which was then incubated at -200C for one hour. The sample was

centrifuged at 13,200 rpm for 30 minutes at 40C and the pellet was re-suspended in 75 pL

pyrocarbonate (DEPC) treated double distilled water. The RNA was precipitated by the addition

of 2 M lithium chloride followed by incubation -200C for 30 minutes. After centrifugation at

13,200 rpm for 30 minutes 40C, the RNA pellet was washed with ethanol, briefly dried and re-

suspended in 50-150 [tL DEPC-water. For Qiagen RNeasy Kit extraction protocol, after

treatment with cytokines, cells were rinsed Ix with IX PBS, then lysed on the plate by the

addition of 600 [tL Buffer RLT and the lysate transferred to a 1.5 mL tube. The tube was then

vortexed briefly to aid cellular lysis, an equal volume of 70% ethanol was added to precipitate

the RNA and mixed by pipetting up and down. The RNA was bound by passing the mixture









over an RNeasy spin column and spinning the column at 13,200 rpm for 15 seconds. The flow-

through was discarded and 350 [tL of Buffer RW1 was added to the column. The column was

again spun at 13,200 rpm for 15 seconds, the flow-through was discarded and 80 [iL DNase

solution (10 [tL DNase 1, 70 [tL Buffer RDD) was added to the column. After a 15 minute

incubation at room temperature the reaction was stopped by the addition of 350 [tL Buffer RW1.

The column was rinsed 2x with 500 [tL of Buffer RPE spinning at 13,200 rpm for 15 seconds

and 2 minutes, respectively. The RNA was eluted from the column by adding 50 [iL DEPC-

water, incubation at room temperature 2 minutes then spinning at 13,200 rpm for 1 minute. The

concentration was determined by spectrophotometrical analysis at A260. For northern blot

analysis, 20 [tg of total RNA was size-fractionated on a 1% agarose-formaldehyde gel, running at

40V overnight in IX TBE (89 mM Tris, 89 mM Boric Acid and 2 mM EDTA). The size

fractionated RNA was electro-transferred to a nylon membrane and UV cross-linked for 2

minutes. The membrane was incubated for one hour in a prehybridization buffer (0.45M sodium

phosphate, 6% sodium dodecyl sulfate (SDS), ImM EDTA and 1% bovine serum albumin

(BSA). A random primed double stranded 32P-labeled gene-specific probe for (human mPGES-

1, hGH or human large subunit ribosomal L7a) was added to the prehybridization solution and

the membrane incubated overnight (mPGES-1 at 650C, hGH or L7a at 610C). The membrane

was washed three times for 10 minutes at 60-650C in a high stringency buffer (0.04M sodium

phosphate, 2mM EDTA and 1% SDS) and exposed to X-ray film.

Transcription Rate Determination

Total RNA was isolated from HFL-1 cells at the indicated time points after treatment with

IL-1p and DNase treated to eliminate genomic DNA contamination. To measure the

transcription rate for mPGES-1, primers specific for Intron 2 and Exon 3 were used for real-time









RT-PCR after first strand cDNA synthesis to measure the level of pre-mRNA or heterogeneous

RNA (hnRNA). The primers used for hnRNA amplification were sense primer 5'-

TGGCTGTGAATGGATTTGAGTG-3' and antisense primer 5'-

AGGAAAAGGAAGGGGTAGATGG-3'. This method is based on the published work of

Lipson and Baserga (229). To rule out any amplification from contaminating genomic DNA, an

equal amount of RNA following first strand cDNA synthesis without the addition of

SuperscriptTM II reverse transcriptase was used as a negative control.

First-Strand DNA Synthesis and Real-Time RT-PCR

One (1 [tg) microgram of total RNA was used to generate first strand cDNA for real-time

PCR analysis using a SuperScriptTM first strand synthesis kit. First, in a 0.5 mL PCR tube, 1 [tg

of total RNA was mixed with 10 mM dNTPs, 0.5 [tg oligo dT and DEPC-water to a final volume

of 10 [tL and denatured by incubation at 650C for 5 minutes then 40C. Next, 9 [tL of reaction

mixture (10X RT Buffer, 25 mM DEPC-MgCl2, 0.1 mM DTT, 40 U/[iL RNaseOUTTM

Recombinant RNase Inhibitor) was added to the tube which was then incubated at 420C for 2

minutes. 1 [tL (50 U) of SuperscriptTM II RT was added to the tube and the reaction was further

incubated at 420C for 50 minutes. The reaction was terminated by incubation at 700C for 15

minutes and the tubes were spun briefly in a microcentrifuge. To remove template RNA, 1 [tL

(40 U) of RNase H was added to the tube and the reaction incubated at 370C for 20 minutes. The

tubes were spun briefly and sterile double-distilled water was added to a final volume of 100 [tL.

Real-time PCR was conducted using 2 [tL cDNA as the template, 0.3 [tM of each primer, 12.5

[tL of iTaq SYBR Green Supermix with ROX and water to a final volume of 25 [tL. The

primers used for amplification are as follows: human mPGES-1 sense primer, 5'-

GCCGCCGTGGCTATACC-3', and antisense primer, 5'-GGTTCCCATCAGCCACTTC-3',









hGH, sense primer 5'-GAACCCCCAGACCTCCCT-3', and antisense primer 5'-

CATCTTCCAGCCTCCCCAT-3', mouse mPGES-1 sense primer, 5'-

TTAGAGGTGGGCAGGTCAGAG-3', and antisense primer, 5'-

CCACTCGGGCTAAGTGAGAC-3', rat mPGES-1 sense primer 5'-

CGCAACGACATGGAGACGA-3', and antisense primer, 5'-GCGTGGGTTCATTTTGCC-3',

human cPLA2a sense primer 5'-CGTGATGTGCCTGTGGTAGC-3', and antisense primer, 5'-

TCTGGAAAATCAGGGTGAGAATAC-3'. Each real-time PCR reaction was conducted using

the Applied Biosystems 7000 sequence detection system (Foster City, CA) with the following

parameters: 500C for 2 min, 950C for 10 min followed by 40 cycles of 950C for 15 s, 600C for 1

min. At completion, the melting curves were acquired by a stepwise increase of the temperature

from 550C to 950C to ensure that a single product was amplified in the reaction. Cyclophilin A

levels were also measured concurrently as the internal control utilizing the following primers:

human cyclophilin A sense primer, 5'-CATCCTAAAGCATACGGGTCC-3' and antisense

primer, 5'-GCTGGTCTTGCCATTCCTG-3', mouse cyclophilin A sense primer, 5'-

GCGGCAGGTCCATCTACG-3', and antisense primer, 5'-GCCATCCAGCCATTCCAGTCT-

3', rat cyclophilin A sense primer, 5'-GGTGGCAAGTCCATCTACGG-3', and antisense

primer, 5'-TCACCTTCCCAAAGACCACAT-3'. Each PCR reaction was done in triplicate

based on samples from three independent experiments and the AACT method was used to

determine the relative fold expression, normalized to cyclophilin A as described by Livak et al.

(230).

Immunoprecipitation Assay

HFL-1 cells were grown as described and treated with 2 ng/mL of IL-lp as indicated.

Total cell extracts were prepared in TNE lysis buffer (10 mM Tris-HCI pH 8.0, 150 mM NaC1, 1

mM EDTA pH 8.0, 1% NP-40, 10 [g aprotinin, 10 [g leupeptin, 10 [g pepstatin, 5 [L of 200









mM PMSF, 25 [iL DTT) and incubated at 40C overnight with the monoclonal antibody against

the indicated protein. Protein AG agarose beads were washed 4x in TNE lysis buffer then

incubated with the lysates at 40C for 2 h. Bead complexes were washed 4x with TNE lysis

buffer and proteins were eluted using 30 [tL of IX Laemeli buffer followed by immunoblot

analysis.

Protein Isolation

For immunoblot analysis, protein lysates were prepared from HFL-1 as follows; on ice

cells were washed twice with cold IX PBS and lysed by the addition of 50 ul of Tris lysis buffer

(1M Tris-HCl pH7.5, 5MNaCl, 0.5M EDTA pH8.0, Triton X-100 plus IX protease inhibitors).

The cell membrane was further disrupted by the use of a hand held homogenizer and incubated

on ice for 10 min. The lysates were centrifuged at 14,000x g for 15 min at 4 oC to remove

cellular debris. The supernatant was removed to a fresh pre-chilled 1.5 mL tube and the protein

concentration was determined by the bicinchoninic acid (BCA) assay in triplicate.

Immunoblot Analysis

Total cell extracts or imunoprecipitates were separated on a 10% or 15% Tris-HCl

polyacrylamide gel, respectively and electro-transferred to a nitrocellulose membrane. The

membrane was blocked overnight at 4 OC with 7.5% non-fat dry milk in TBST (10 mM Tris-

HCl, pH 7.5, 0.1% (v/v) Tween 20, 200 mM NaCl). The indicated primary antibody (Egr-1

1:200, C/EBPP 1:600, mPGES-1 1:400, Alox1 5B 1:1000) was added to the membrane which

was then incubated at 40C overnight. The membrane was washed 3x with TBST, incubated with

a peroxidase-conjugated secondary antibody (rabbit 1:10,000) for 1 h, washed again 3x with

TBST and subjected to chemiluminescent detection. The membrane was soaked in the detection

agent (equal mixture of ECL Advance Solution A and B) for 1 minute then exposed to

autoradiography film.









DNase I Hypersensitive Site Analysis

HFL-1 cells were incubated in the presence or absence of 2 ng/mL IL-10 for 8 h, rinsed IX

with PBS then trypsinized for 10 min at 370C. The cells were resuspended in 4 mL of

permeabilization buffer (150 mM Sucrose, 80 mM KC1, 35 mM HEPES pH 7.4, 5 mM K2HP04,

5 mM MgCl2, 0.5 mM CaCl2) containing 0.1% L-a-lyso-lecithin on ice for -2.5 min. The

reaction was stopped by the addition of 40 mL permeabilization buffer and the cells pelleted for

5 minutes at 40C. The permeabilized cell pellets were resuspended in 3.2 mL of permeabilization

buffer. 300 [iL of permeabilized cell suspension was digested with increasing concentrations of

DNase I for 4 minutes at 370C. The reactions were terminated by the addition of DNA lysis

buffer (4% SDS, 0.2 M EDTA and 800 [g/mL proteinase K). Genomic DNA was purified by

incubation at 500C for 3 h followed by organic extractions and precipitation with ethanol.

Samples were then resuspended in 100-200 [iL of TE (10 mM Tris-HCl, pH 8.0 and 1 mM

EDTA). The samples were then digested with the restriction enzyme, HindIII, in a total volume

of 300 pIL. The digests were size-fractionated on a 0.8% HGT agarose gel in TAE buffer, pH 7.8

(40 mM Tris, 3 mM NaOAc, 1 mM EDTA, 4 mM NaOH) overnight at 40 V to resolve the DNA

fragments. The gel was then alkaline-denatured by incubation in 50 mM NaOH for 30 minutes

then 0.1M TBE (IM TBE: Tris 242g, Boric Acid 107g, EDTA 6g) 2x for 30 minutes. The gel

was electro-transferred to a nylon membrane, and cross-linked to the membrane with UV light 2

minutes. The membrane was hybridized with an end-specific single copy DNA probe at 61 oC.

The DNA probes used were generated by PCR from the human mPGES-1 genomic clone using

the following primers; 19.6 kb end forward 5'-GCTTAATGCATGAAGTGGTTAC-3', reverse

5'-AAGATGAAGCTGCCTTTGAG-3' and 6.8 kb end forward 5'-

TCAGGATGCAGAGCCAAGC-3', reverse 5'-CCAGTGAACTACAGGCACCAG-3'. The









DNA probe was radiolabeled using the random primer DNA labeling system and hybridized to

the membrane. Hybridization and autoradiography were performed as previously described.

Chromatin Immunoprecipitation Analysis

Chromatin immunoprecipitation (ChIP) analysis was performed according to a modified

protocol from Upstate Biotechnology, Inc. (Charlottesville, VA). HFL-1 cells were grown to

90% confluency on 150 mm plates and cross-linked with 1% formaldehyde for 10 min at room

temperature and quenched by the addition of 125 mM glycine for 5 min. The cells were then

scraped into 50 mL conical tubes and centrifuged at 3000 rpm for 15 min at 4 oC. The pellet was

washed 2x with IX PBS and resuspended in cold swelling buffer (5 mM PIPES pH 8.0, 0.5%

NP-40, 85 mM KCl plus IX protease inhibitors) and incubated on ice for 10 min. The swelled

cells were then centrifuged at 5,000 rpm for 5 min at 4 oC and the cell pellet was gently

resuspended in 1 mL lysis buffer (1% SDS, 50 mM Tris pH 8.1, 10 mM EDTA and IX protease

inhibitors). The lysates were sonicated to ~500bp fragments using a Branson Model 500

dismembrator (Fisher Scientific) at 40% amplitude for 5x 30 sec bursts with 2 min rest on ice

between bursts. The sonicated samples were removed to 1.5 mL tubes and centrifuged at 13,000

rpm for 5 min at 4 'C to clear cell debris. The supernatants were diluted 1:10 in ChIP dilution

buffer (0.l1% SDS, 1.2 mM EDTA, 16.7 mM Tris pH 8.1, 167 mMNaCl and 1.1% Triton X-

100), then pre-cleared with 500 [tL of Protein A sepharose beads for 2 h at 4 oC. The pre-cleared

supernatants were then split into 1 mL aliquots, and 2 [tg of indicated antibodies were added and

tubes were incubated overnight at 4 oC. The next day, 60 [tL protein A or G sepharose beads

blocked with 30% BSA were added to each tube to capture the complex. Following incubation

at 4 'C for 2 h, the complexes were isolated by centrifugation at 1,000 rpm for 2 min, 500 [tL of

IgG control samples were removed for Input controls and the complexes were washed as

follows: once with low salt (0.l1% SDS, 1% Triton X-100 (v/v), 20 mM Tris pH 8.1, 2 mM









EDTA, 150 mM NaCI), high salt (0.1% SDS, 1% Triton X-100 (v/v), 20 mM Tris pH 8.1, 2 mM

EDTA, 500 mM NaCI), LiCI (250 mMLiCl, 1% NP-40, 1% sodium deoxycholate (DOC), 10

mM Tris pH 8.1, 1 mM EDTA) and three times with TE (10 mM Tris pH 8.0 and 1 mM EDTA

pH 8.0). The samples were then eluted with 500 [tL of elution buffer (1% SDS and 100 mM

NaHCO3) with incubation at 37 'C and rocking for 30 min. The eluted samples were centrifuged

at 2,000 rpm for 2 min at room temperature, and the supernatants were removed to a fresh 1.5

mL tube. To remove contaminating protein, the eluted samples and Input controls were treated

with the addition of the following solutions to reach final concentrations of 11 mM EDTA, 200

mM NaCl, 44 mM Tris pH 7.0, then 2 [tL of proteinase K (20 mg/mL) and incubation at 45 'C

for 1 h followed by reverse cross-link at 65 'C for 4 h. The samples were purified with the

Qiagen PCR kit and subjected to real-time RT-PCR analysis. The forward primer 5'-

ACAGCTCTGGGCGCACAC-3' and reverse primer 5'-TGGGGAAATGGGAATGACTG-3'

were used to amplify region -8.6 to -8.1 kb; the forward primer 5'-

CGGCAACTGCTTGTCTTTCTC-3' and reverse primer 5'-TCTTGATGACCAGCAGCGTG-3'

were used to amplify the promoter region of human mPGES-1. The forward primer 5'-

GCATCAAAAACATCACTCCCTCT-3' and reverse primer 5'-

ACTCCAGCTTGGGCAACAGA-3' were used to amplify the 3'UTR and the forward primer

5'-AGAAGCGTAAACATCACTCTCCTC-3' and reverse primer 5'-

ACAGCCTCACAGACATACCCAG-3' were used to amplify the 5'UTR of mPGES-1 as

negative controls. All results are expressed as a fraction of the total isolated chromosomal DNA

(input) prior to immunoprecipitation or relative to IgG, as specified.

Short Interfering RNA (siRNA) Analysis

HFL-1 cells were seeded on 35 mm plates at 50% confluency and transfected with a final

concentration of 100 nM SMARTpool C/EBPP siRNA, Aloxl5B siRNA or a cyclophilin-









specific siRNA (Dharmacon) using 5 [tL ofDharmaFECTT 1 siRNA transfection reagent

(Dharmacon) according to manufacturer's protocol. Briefly, using 15 mL tubes, in tube A, 100

[tM of siRNA was diluted in IX siRNA buffer and mixed with an equal volume of serum free

media. In tube B, 5 [tL of the reagent diluted in serum free media to a final volume equal to that

of tube A. Both tubes were incubated at room temperature for 5 min, then the contents of both

tubes were combined and the single tube was incubated at room temperature for 20 min.

Depending on the number of plates used, complete media was then added to the tube and the

contents divided equally among the plates. Treatment with DharmaFECTTM 1 without siRNA

was used to control for transfection reagent specific effects. After 72 h incubation, one set of

plates were treated with 2 ng/mL of IL-p for 4 h. Protein and total RNA were isolated and

analyzed by immunoblot analysis or reverse transcription followed by real-time RT-PCR.

Densitometry and Statistical Analysis

All densitometry was quantified from autoradiography films using a Microtek scan maker

9600XL and analyzed with NIH Scion Image analysis software. The relative fold-induction was

determined for the mPGES-1 mRNA band or the hGH mRNA band, normalized to the L7a

ribosomal protein internal control. For real-time RT-PCR analysis, each reaction was done in

triplicate and the AACT method was used to determine the relative fold expression, normalized

to cyclophilin A. Data points are the means from at least three independent experiments and the

error bars represent the standard error of the means (SEM). An asterisk (*) denotes significance

as determined by a Student's t-test to a p value < 0.05 and (**) denotes a p value < 0.01.









Table 2-1. Primers used for generating mPGES-1 fragments


Primer Pairs
Human mPGES-1
Promoter -434/+160

Human mPGES-1
Promoter -1.1/+160

Human mPGES
HS2 Fragment

Human mPGES-1
(-10.7 to -9.6)

Human mPGES-1
(-10.1 to -9.0)

Human mPGES-1
(-9.5 to -8.5)

Human mPGES-1
(-8.6 to -6.4)

Human mPGES-1
(-8.6 to -8.1)

Human mPGES-1
(-8.1 to -7.5)

Human mPGES-1
(-7.6 to -6.4)

C/EPBp Site 1
(-8.6 to -8.1) Al

C/EPBp Site 2
(-8.6 to -8.1)A2

C/EPBp Site 3
(-8.6 to -8.1)A3


Primer Sequence 5' to 3
F -AAGCTTTCCATTGTCCAGGCTGAGTGT
R -GGATCCTTCTTCCGCAGCCTCACTTG

F-AAGCTTAGAGTCAGTTGATAGGTCTTTCGGG
R -GGATCCTTCTTCCGCAGCCTCACTTG

F -ACGCGTCCGGCAGTCTGAGCTGAGT
R -ACGCGTTGGCCCTGGGTCCTGACT

F -ACGCGTCCGGCAGTCTGAGCTGAGT
R -ACGCGTGTCATCACGCCTGACGGAC

F -ACGCGTCTAAAGGGTGTCTGGCCATTAGG
R -ACGCGTCCACGGGCTGCAGAGGAG

F -ACGCGTGTCAGGAGTTCAAGACCAGCC
R -ACGCGTTGGAATTGCACACTTGAAGATG

F -CCGTCAGGGACGCGT/CCCTGCATTTAACGC
R -GCGTTAAATGCAGGG/ACGCGTCCCTGACGG

F -ACGCGTAGAAGGAGAGGGCGGCATC
R -ACGCGTGGAGAGTTGCCCAGGCTAGAGT

F -ACGCGTCTGGGCAACTCTCCGTCTCA
R -ACGCGTGCAGTGAGCCATGCTGTGATC

F -ACGCGTTGCTTCCGGCCTGTTTATTT
R -ACGCGTTGGCCCTGGGTCCTGACT

F -GTTCAGGCCGTCTGT/TATTTACCAAGCACAGCTC
R -GAGCTGTGCTTGGTAAATA/ACAGACGGCCTGAAC

F -CATTGGTACAGTCACAATA/ATCTTTACCATCCATTTCC
R -GGAAATGGATGGTAAAGAT/TATTGTGACTGTACCAATG

F -TTGCAACCATCTTTACCATCC/CATTTTCATCATCCCAG
R -CTGGGATGATGAAAATGGGAT/GGTAAAGATGGTTGCAA









CHAPTER 3
IDENTIFICATION OF DNASE I HYPERSENSITIVE SITES INVOLVED IN THE
INTERLEUKIN 1 BETA (IL-10) INDUCTION OF MICROSOMAL PROSTAGLANDIN E
SYNTHASE-1 (MPGES-1) GENE EXPRESSION

Introduction

Induction of Microsomal PGES-1 Gene Expression by Pro-Inflammatory Cytokines

PGE2 is known to be involved in a variety of biological processes including reproduction,

gastric mucosal protection, pyresis, vasodilatation, sleep and many disease states

(3,7,10,28,231,232). The conversion of PGH2 to PGE2 is catalyzed by the action of specific PGE

synthases, in particular mPGES-1 but while PGE2 production and activities have been widely

studied in a variety of cell types, little is known about the regulation of mPGES-1. Jakobsson et

al. (192) were among the first to show that mPGES-1 gene expression is induced by the pro-

inflammatory cytokine, IL-10. Subsequent studies also revealed that mPGES-1 mRNA

expression is also induced by LPS (219,233), TNFa (201,234), growth factors such as TGFP

(235), phorbol esters such as phorbol 12-myristate 13-acetate (236) and by the flavonoid

epigallocatechin-3-gallate in a number of cell types (237).

Stimulus-Dependent Activity of the Microsomal PGES-1 Promoter

Forsberg et al. (205) analyzed the transcriptional activity of minimal mPGES-1 promoter

fragments in transfected human epithelial cells (A549) derived from a lung adenocarcinoma.

They generated two promoter fragments, 0.19 kb and 0.65 kb fragments, and observed that the

transcriptional activity of each promoter fragment increased ~2 fold in response to treatment with

IL-10. From this study it was postulated that cis-acting elements involved in basal mPGES-1

gene expression are contained within the proximal 0.19 kb promoter fragment. In a later study

by Han et al. (238) using a 0.51 kb mPGES-1 promoter construct in human orbital fibroblasts,

they illustrated that mPGES-1 promoter activity is up-regulated following IL-10 stimulation,









validating the previous study by Forsberg et al. (205). Their study also evaluated a 1.8 kb COX-

2 promoter fragment and revealed that like mPGES-1, COX-2 promoter activity is also induced

following IL-10 treatment. Other studies have shown that mPGES-1 promoter activity is up-

regulated in response to treatment by phorbol esters (206,239), thapsigargin (239) and TNF-a

(234). Alternatively, it should be noted that stimulus-dependent activation of the mPGES-1

promoter is inhibited by the peroxisome-proliferator activating receptor (PPAR) ligands

(240,241), inhibition of histone deacetylase activity (242) and inhibition of protein kinase C

(243).

Involvement of the Early Growth Response Factor, Egr-1 in the Regulation of Microsomal
PGES-1 Expression

Recently, the transcription factor, Egr-1 was found to be important for mPGES-1 gene

expression. In 2000, Forsberg et al. (205) identified the presence of two GC boxes within the

mPGES-1 proximal promoter by sequence analysis. Later, Naraba et al. (206) evaluated the

importance of these two GC boxes in relation to mPGES-1 gene expression. Based on deletion

analysis of the promoter region, they showed that Egr-1 binding induced promoter activity 2.0 -

3.0 fold in the presence of a stimulus. Subsequent deletion of the Egr-1 binding site attenuated

mPGES-1 promoter activity. A few years later, Moon et al. (207) validated these findings by

inhibiting Egr-1 expression, in A549 cells, using an siRNA against Egr-1. They further showed

that inhibition of Egr-1 expression led to a significant decrease in mPGES-1 promoter activity.

Combined with further studies by other groups (234,237,240,242), a clear role for Egr-1 activity

in regulating the inducible expression of the mPGES-1 promoter has been outlined. While Egr-1

is required for mPGES-1 transcriptional activation, suppression of Egr-1 expression does not

completely block induced mPGES-1 expression (237). Moreover, treatment with IL-10, for

example causes an ~8 fold induction of steady state mPGES-1 mRNA levels compared to the









published 2 fold induction observed with minimal proximal promoter fragments. Furthermore,

mutagenesis of the Egr-1 binding site does not always completely eliminate this level of

induction. Therefore, these findings imply that other transcription factors may be involved in the

regulation of mPGES-1 gene expression and thus is the basis for our attempts to identify

additional regulatory sequences that are potentially responsible for the IL-1p-dependent

regulation.

Results

Induction of Microsomal PGES-1 Messenger RNA and Protein Expression by the Pro-
Inflammatory Cytokine, IL-1p in Human Lung Fibroblasts

PGE2 is known to be cyto-protective in the lung and recent studies have shown that

mPGES-1 expression is up-regulated in lung fibroblasts in a stimulus dependent manner

(15,205,222), therefore human lung fibroblasts (HFL-1) were used as the cell model for studying

the regulation of mPGES-1 gene expression. In the initial studies, a dose response with IL-10

was conducted to determine the effective concentration that produced the largest induction of

mPGES-1 gene expression. HFL-1 cells were incubated with increasing concentrations of IL-10

(0.5 10 ng/mL) and total RNA isolated. Purified RNA was analyzed by real-time RT-PCR and

data was evaluated for the level of induction compared to the untreated control which was

normalized to 1. As illustrated in Figure 3-1, 2 ng/mL of IL-10 induced mPGES-1 mRNA

expression approximately 8 fold; therefore this concentration will be used for all subsequent

treatments.

After continued stimulation with IL-10 over the course of 12 h, mPGES-1 mRNA

expression was analyzed by northern blot. The results in Figure 3-2 provide a representative

northern analysis, and reveal that endogenous steady-state levels of mPGES-1 mRNA expression

is induced in a time dependent manner with an apparent maximal induction by 8 12 h. To









quantify this increase in mRNA expression, HFL-1 cells were treated with IL-10 over the course

of 8 h, total RNA was isolated and subjected to real-time RT-PCR analysis with mPGES-1

specific primers. The chart in Figure 3-3 illustrates that similar to the northern blot analysis in

Figure 3-2, mPGES-1 mRNA levels increased approximately 9 fold in a time dependent manner

by 8 h.

To demonstrate that the increase in mRNA levels translates into a logical increase in

protein levels, mPGES-1 protein expression was evaluated following IL-10 stimulation in HFL-1

cells. There are two commercially available antibodies used to detect mPGES-1 protein but after

unsuccessful attempts to detect mPGES-1 protein expression by standard immunoblot analysis,

we devised an immunoprecipitation protocol as described in the Materials and Methods. To

quantify mPGES-1 protein expression, total protein from control and stimulated cells was

immunoprecipitated with a mouse monoclonal antibody to mPGES-1, then size fractionated by

SDS/PAGE followed by immunoblotting with a rabbit polyclonal mPGES-1 antibody. The

immunoprecipitation analysis in Figure 3-4 revealed that in control cells, there is no detectable

mPGES-1 protein expression but following 72 h of IL-10 stimulation, mPGES-1 protein

expression was significantly elevated, thereby demonstrating that IL-10 treatment caused a

significant induction of both mPGES-1 mRNA and protein levels.

Determination of Microsomal PGES-1 Messenger RNA Decay After Stimulus Removal

The classical experiment to evaluate mRNA half-life involves stimulating cells for a short

time period, followed by the addition of actinomycin D to globally inhibit transcription; samples

are then analyzed at various time points post treatment to determine the level and time-dependent

degradation of the message. Since there is often no detectable basal expression of mPGES-1, the

measurement of basal mRNA decay cannot be accurately determined. We therefore chose to

evaluate the decay of the induced message by first treating with IL-1 to stimulate induction of









mPGES-1 mRNA followed by removal of the stimulus. HFL-1 cells were stimulated for 8 h

with IL-10, the stimulus was removed and the cells were rinsed 3x with IX PBS and fresh media

was added to the cells. Cells were harvested at specific time points over the course of 12 h, total

RNA isolated and analyzed by northern blot. The data in Figure 3-5 reveals that at 6 h post

stimulus removal, a rapid decay of the mRNA levels was observed where by 12 h the mRNA

levels were almost undetectable.

The IL-1p Induction of Microsomal PGES-1 Gene Expression Requires De Novo
Transcription

In order to determine whether the IL-1 induction of mPGES-1 gene expression was a

consequence of regulation at the transcriptional level, a global transcriptional inhibitor

actinomycin D was utilized and steady state mRNA levels were measured. HFL-1 cells were

treated with actinomycin D alone to inhibit global transcription in the absence or presence of IL-

10 and mPGES-1 mRNA expression was analyzed by northern blot. The results in Figure 3-6

indicate that treatment with actinomycin D alone did not affect mPGES-1 mRNA expression

while actinomycin D did block the IL-10 induction of mPGES-1 mRNA expression.

To directly address whether de novo transcription is responsible for the IL-10-dependent

induction of mPGES-1 expression, heterogeneous nuclear RNA levels were evaluated by real-

time RT-PCR amplification across an intron-exon boundary. Heterogeneous nuclear RNA

(hnRNA) is a pre-mRNA intermediate, that exists prior to splicing, containing both introns and

exons. The level of hnRNA present at any given time directly correlates with the presence of de

novo transcription (229). As an alternative to the classical nuclear run-off assay, the measure of

hnRNA is being utilized as an efficient and quantitative assessment of de novo transcription.

Primers spanning the intron 2/exon 3 boundary were designed and utilized for real-time RT-PCR

amplification.









The data in Figure 3-7 illustrates that within 0.5 h ofIL-10 treatment, there is a significant

increase in hnRNA levels with a maximum at 1 h (~8 9 fold) thus indicating that de novo

transcription is required for the IL-1j induction of mPGES-1 gene expression. The decrease in

induction following 1 h is possibly due to the competing rates of new hnRNA synthesis and the

time at which intron splicing eliminates the template for the intron specific primer.

Evaluation of the Microsomal PGES-1 Proximal Promoter in the HFL-1 cells

In an attempt to elucidate the mechanism involved in regulating mPGES-1 gene

expression, mPGES-1 promoter activation was evaluated following IL-10 stimulation. A 1.1 kb

and 0.6 kb mPGES-1 promoter fragment were generated by PCR and cloned into a human

growth hormone (hGH) reporter construct. The human GH reporter gene is a complete genomic

locus with introns and exons, producing hnRNA followed by normal splicing events. Moreover,

hGH mRNA is known to have a relatively long half-life (12 18 h) so assessment of the mRNA

by northern blot or real-time RT-PCR is not subject to issues of decay. Another advantage of the

system is that it allows for the direct measurement of transcription by evaluating mRNA levels

rather than detecting the levels of protein activity.

HFL-1 cells were transiently transfected with each construct and total RNA was analyzed

by northern blot for growth hormone expression. The diagram in Figure 3-8(A) depicts the two

mPGES-1 promoter/reporter constructs. The results in Figure 3-8(B) indicate that in the absence

of stimulus, there is basal growth hormone expression with each promoter construct and upon the

addition of IL-10 there is a further increase in growth hormone expression. Densitometric

analysis of three experiments revealed that the 1.1 kb promoter construct conferred a 2.5 fold

increase in promoter activation following IL-10 stimulation, while the 0.6 kb promoter conferred

a 1.5 fold increase (data not shown).









Previous studies by Naraba et al. (206) and Moon et al. (207) highlight the importance of

the transcription factor Egr-1 in the stimulus-mediated activation of the mPGES-1 promoter.

Therefore the binding site for Egr-1 was located within the mPGES-1 1.1 kb promoter construct

and subsequently deleted by site-directed mutagenesis. A binding site for C/EBP3 was also

identified in the 1.1 kb promoter by computer analysis as indicated in Figure 3-9(A) and also

deleted by site-directed mutagenesis. The mutant constructs were transiently transfected into

HFL-1 cells and growth hormone expression was analyzed by northern blot. Figure 3-9(B)

illustrates the result of the northern blot analysis and reveals that in the absence of Egr-1, both

basal and induced growth hormone expression is significantly reduced, while deletion of the

C/EBPP site did not affect the induction and showed an expression pattern similar to that of the

wild type promoter.

Analysis of Internal Cis-Acting Elements That May be Involved in Regulating Microsomal
PGES-1 Gene Expression

The published studies on the minimal mPGES-1 promoter and our efforts shown in Figure

3-8 and Figure 3-9 demonstrate that although a ~ 2 fold induction is observed following stimulus

treatment, the proximal promoter fragments do not recapitulate the steady state increase of ~ 8 to

9 fold (Figure 3-2 and Figure 3-3). Therefore, in an attempt to identify additional potential

regulatory elements within the mPGES-1 locus, a series of overlapping fragments across intron 1

to the beginning of exon 3 were generated as indicated in Figure 3-10(A). This strategy was

based more on our laboratory's previous experience in identifying internal cytokine-dependent

regulatory elements versus an experimental rationale for mPGES-1. The fragments were cloned

into the 1.1 kb promoter fragment driving human growth hormone expression and analyzed by

transient transfection and northern blot. All fragments were analyzed; whereas Figure 3-10(B)

illustrates a representative blot of three fragments, indicating that none of the fragments









conferred a significant increase in growth hormone expression over that of the wild type

promoter construct. As such the brute force approach was clearly not adequate to systematically

identify relevant regulatory sequences.

Microsomal PGES-1 Chromatin Structure: DNase I Hypersensitive Site Analysis

As an alternative strategy, DNase I hypersensitive analysis was undertaken as an approach

that can: (i) scan larger regions for alterations in chromatin structure; (ii) provide a rationale that

open chromatin structure or hypersensitive sites would harbor regulatory factors and their

analogous binding sites and; (iii) ultimately rapidly identify, although not based on functional

significance, regulatory sequences relevant to IL-10 regulation. Located on the long arm of

chromosome 9, the mPGES-1 gene spans 15 kb containing two introns and three exons and thus

can be effectively studied by DNase I hypersensitive site analysis due to its small size. First, a

restriction fragment of at least 10-13 kb was identified, then a single copy probe specific to one

end of the fragment was generated by PCR, which would later be used for indirect-end labeling

coupled to Southern analysis. DNase I hypersensitive site analysis was performed as described

in the Materials and Methods, with HFL-1 cells incubated in the absence or presence of IL-1p.

Cells were permeabilized with lyso-lecithin to allow access of DNase I, individual samples were

then treated with increasing concentrations ofDNase I and total genomic DNA was purified.

DNA was cut by restriction digest using an enzyme to define fragments flanking the mPGES-1

locus, size-fractionated on an agarose gel, transferred to a nylon membrane and subjected to

Southern analysis using indirect labeling with a single copy probe. This displays any regions of

altered chromatin and allows for the direct mapping of these sites based on the indirect end

labeling. The diagram in Figure 3-1 1(A) schematically depicts the position of a 13.3 kb HindIII

fragment which spans from -6.4 to +6.8 kb, mapping a region directly 5' to the transcriptional

initiation site. Figure 3-1 1(B) illustrates the result of a hypersensitive site analysis of the









promoter region which revealed the existence of a constitutive hypersensitive site which maps at

~-0.3 kb. This correlates with the location of the Egr-1 binding site in the proximal promoter.

In a similar analysis, an adjacent HindIII fragment spanning from -19.6 to -6.4 kb depicted

in Figure 3-12(A) was evaluated. Similar to the proximal promoter DNase I site designated

HS1, a second hypersensitive site was identified, present in both control and IL-1p-treated cells.

Figure 3-12(B) shows the results for this second hypersensitive site analysis looking further 5' of

the promoter and demonstrating the existence of a constitutive hypersensitive site that maps to -

8.6 kb.

Discussion

Previous reports indicate that mPGES-1 gene expression is up-regulated in response to

cytokine treatment in a number of cells and tissues including the lung (207,237,244-247).

Whereas, in the absence of stimuli, there is low level basal mRNA and protein expression of

endogenous mPGES-1. Presumably this is a consequence of the cells maintaining a homeostatic

balance, due to a lack of substrate produced from the upstream activities of PLA2 and COX

enzymes, which does not require the synthesis of downstream synthases such as mPGES-1.

Alternatively, in inflammatory situations where systemic/immune cell-derived pro-inflammatory

mediators such as IL-10 are elevated, synthesis of signaling molecules, such as prostanoids, are

induced to locally initiate events such as vasoconstriction or airway responsiveness.

The data presented in this dissertation illustrates that, in human lung fibroblast cells,

mPGES-1 mRNA and protein expression are both induced at high levels following treatment

with the pro-inflammatory cytokine, IL-10. In addition, treatment with the global transcriptional

inhibitor actinomycin D blocked the IL-10 induction of mPGES-1 mRNA and evaluation of

mPGES-1 heterogeneous nuclear RNA levels following IL-10 stimulation revealed a significant

increase in the level of un-spliced message within 1 h of cytokine treatment. Both studies









demonstrate that de novo transcription is at least in part required for the IL-10 induction and as

an alternative to de novo transcriptional events, the stability of the mPGES-1 message could also

have an impact on stimulus-dependent increases. The results shown in Figure 3-5 indicate that

the mRNA for mPGES-1 has an induced half-life around 6 h. In 2006 Degousee et al. (233)

showed that in cardiomyocytes stimulated with IL-10 or LPS in conjunction with actinomycin D,

the mPGES-1 mRNA half-life was about 6 h, an observation consistent with our results.

Analysis of mPGES-1 promoter activity by transient transfection revealed approximately a

2 fold increase in expression following IL-10 treatment. Naraba et al. (206) identified an Egr-1

consensus site, which is highly similar to the Spl binding site, in the mPGES-1 promoter and

illustrated the importance of this site by promoter deletion analysis. Similar to their study, the

Egr-1 binding site was evaluated in the human mPGES-1 1.1 kb promoter construct used in our

work. Deletion of the Egr-1 sequence revealed that loss of Egr-1 binding attenuated promoter

activity with a loss of both the basal and induced expression. Further, a computer predicted

binding site for the transcription factor, C/EBPj was identified within our 1.1 kb promoter

construct and deletion of this site did not appear to have an effect on the basal or induced

expression of the promoter. Together these studies revealed the importance of Egr-1 in basal and

induced promoter activation but the proximal promoter alone did not recapitulate the level of

induction seen by northern analysis of endogenous mPGES-1 gene expression stimulated with

IL-1P.

We have shown that endogenous expression of mPGES-1 is induced 8-10 fold by IL-1p

but activation of the promoter by Egr-1 only generates a ~2 fold increase in mPGES-1

expression. Therefore, the assumption that potential regulatory elements exist outside of the

proximal promoter region could account for the observed increase in endogenous expression by









IL-10. In our attempt to analyze the mPGES-1 locus, overlapping fragments 3' to the start of

transcription were evaluated in context of the human mPGES-1 1.1 kb promoter construct. None

of the fragments analyzed were able to elicit an increase in the IL-1 induction similar to that of

endogenous mPGES-1 mRNA. Furthermore, each fragment behaved similar to the proximal

promoter and only generated a ~1.5 2 fold increase in promoter activity.

DNase I hypersensitive analysis can be used to detect subtle changes in chromatin structure

and for scanning large regions of DNA. The alterations in chromatin structure are known to be

associated with binding of regulatory factors and gene transcription, thus this method was

employed in our next study. There are inducible and constitutive DNase I hypersensitive sites,

both of which are associated with transcriptional activation. Our results identified two

constitutive hypersensitive sites. The first site actually mapped to the proximal promoter region,

~ 0.3 kb and the Egr-1 site which was functionally analyzed in this chapter.

The second site, HS2, is also a constitutive hypersensitive site and maps further 5' of the

promoter at -8.6 kb. Although this site is also constitutive, a finer analysis may illustrate the

existence of regulatory elements within this site that could possibly account for the regulation of

mPGES-1 expression through inducible binding of transcription factors but which cannot be

observed at the level of this chromatin study. In Chapter 4, the HS2 site will be further analyzed

in an attempt to identify elements involved in the regulation of mPGES-1 gene expression by IL-

1P.


















8m
7-

6-










Untreated 0.5 1 2 5 10

IL-1p (ng/ml)

Figure 3-1. Induction of mPGES-1 gene expression by the pro-inflammatory cytokine, IL-1 in
human lung fibroblasts. HFL-1 cells were treated with increasing concentrations of
IL-10 for 8 h and total RNA was analyzed by real-time PCR for mPGES-1 mRNA
expression. The graph depicts three independent experiments and the asterisk (**)
indicates statistical significance with p value < 0.01 compared to the untreated
sample.










Time (h)

mPGES-1


L7a


IL-103
0 1 2 4 6 8 12


Figure 3-2. Induction of mPGES-1 mRNA expression by IL-1j in human lung fibroblasts.
HFL-1 cells were treated with or without IL-10 over the course of 12 h. Total RNA
was extracted and analyzed by northern blot. The membrane was hybridized with
radiolabeled probes for mPGES-1 and L7a (L7a serves as the loading control).










10 **

















compared with the control sample.
8

r,2









0


0 0.5 1 2 4 8

Time (h)


Figure 3-3. Induction of mPGES-1 mRNA expression by IL-13 in human lung fibroblasts:
ITFL-1 cells analyzed by quantitative real-time RT-PCR analysis. ITFL-1 cells were
treated with or without IL-13 over the course of 8 h. Total RNA was extracted and
subjected to real-time RT-PCR to determine mPGES-1 and cyclophilin A mRNA
levels. The mPGES-1/cyclophilin A ratio of untreated cells was set to 1. The graph
depicts a summary of three independent experiments, where the data points are
represented as mean SEM (standard error of the mean). The asterisk (*) indicates
statistical significance with p values 0.05 and (**) indicates p value< 0.01 as
compared with the control sample.







IP-


a- mPGES-1


16 kDa-


a


a-mPGES-1


Figure 3-4. Induction of mPGES-1 protein expression by IL-10 in human lung fibroblasts.
HFL-1 cells were stimulated with IL-10 for 72 h, total protein was isolated and
immunoprecipitated with a monoclonal antibody against mPGES-1. Immunoblot
analysis was conducted with a polyclonal antibody against mPGES-1


IL-1i


+








Time (h)
Post IL-1 0
Removal
IL-10 -


0 0.5 1 2 4 6 8 12


+ + +


+ + + + +


mPGES-1


4 uiisS


L7a


Figure 3-5. Determination of mPGES-1 mRNA decay following stimulus removal. HFL-1 cells
were stimulated with IL-10 for 8 h; the stimulus was removed and fresh media was
added to each plate. The cells were lysed at the indicated times, total RNA extracted
and analyzed by northern blot. The membrane was hybridized with radiolabeled
probes for mPGES-1 and L7a.









IL-lB (2ng/ml)

ActD (10pIM)


+ +


+-


mPGES-1




L7A


Figure 3-6. The IL-10 induction of mPGES-1 gene expression requires de novo transcription.
HFL-1 cells were treated with actinomycin D in the absence or presence of IL-10. At
the indicated time points, total RNA was isolated and analyzed by northern blot. The
membrane was hybridized with radiolabeled probes for mPGES-1 and L7a (L7a
serves as the loading control).









10 -
9
8-




0a
~4 -




0

0 0.5 1 2 4

Time (h)


Figure 3-7. The IL-10 induction of mPGES-1 gene expression requires de novo transcription:
Analysis of hnRNA levels. HFL-1 cells were stimulated with IL-10 for the indicated
times and total RNA isolated then subjected to real-time RT-PCR analysis to detect
mPGES-1 hnRNA levels. The mPGES-1 hnRNA/cyclophilin A ratio of untreated
cells was set to 1. The graph depicts a summary of three independent experiments,
where the data points are represented as mean SEM (standard error of the mean).
The asterisk (*) indicates statistical significance with p valuo 0.05 and (**)
indicates p value 0.01 as compared with the control sample.








Egr-1
(-0.lkb)+

Ifi


0.2kb


1.1kb


06 -hGH I

0.6kb --hGH


1.1 0.6


IL-13


hGH


L7a


- +


- +


Figure 3-8. Evaluation of the mPGES-1 proximal promoter. A) A depiction of the mPGES-1
promoter fragments driving the expression of human growth hormone (hGH)
reporter. B) HFL-1 cells were transiently transfected with either the 1.1 kb or the 0.6
kb promoter construct and 40 h post transfection cells were either untreated or
stimulated with IL-1I for 8 h. Total RNA was extracted and analyzed by northern
blot. The membrane was hybridized with radiolabeled probes for hGH and L7a.


0









A Egr-
C/EBP-p (-0.1kb
0.2kb (-0. kb)


1.1kb hGH




IL-1P + + + +

hGHll


mPGES-1


L7a



Figure 3-9. Evaluation of the mPGES-1 proximal promoter. A) A schematic of the 1.1 kb
promoter fragment indicating the location of transcription factor binding sites for Egr-
1 (-0.1 kb) and C/EBP3 (-0.9 kb) relative to the start of transcription (+1). B) The
binding sites of Egr-1 and C/EBP3 were deleted (AEgr-1 and AC/EBP3) from the 1.1
kb promoter fragment construct by site-directed mutagenesis. Each construct was
transiently transfected into HFL-1 cells and 48 h later, total RNA was extracted from
control and IL-10 treated cells, then analyzed by northern blot. The membrane was
hybridized with radiolabeled probes for hGH, mPGES-1 and L7a.











Exon 1
it


I


Exon 2


FE

-J


InlA 2A
4200bp 2B 2C Frag
2D 2C
2E
2F


dxon 3



tents 2A-F
)00bp


- +- + + + +


IL-1P

hGH


L7a


Figure 3-10. Analysis of internal cis-acting elements that may be involved in regulating
mPGES-1 gene expression. A) A series of overlapping fragments spanning from the
beginning intron 1 to the beginning of exon 3 were generated by PCR and cloned into
the 1.1 kb mPGES-1 promoter construct driving hGH expression. B) HFL-1 cells
were transiently transfected with the indicated construct and total RNA was isolated
from untreated or cytokine treated plates then analyzed by northern blot. The
membrane was hybridized with radiolabeled probes for hGH and L7a.


A A AA











Hind III
2kb -6.4kb

I I


HS1
(~ -0.3kb)

-4r


Hind III
+6.86kb


13.3kb


Control
SDNase 1

~133 kb-.. -

F- .
6.0kb- ""
5.0kb-. -
4.0kb-- -

3.0kb --.

2.0kb -.
1.6kb --.


IL-1-Treated
DNase 1
--S---c


HS1
(-6.1kb)


Figure 3-11. mPGES-1 chromatin structure: DNase I hypersensitive site analysis 1. A) A
diagram of the mPGES-1 gene, indicating the location of a 13.3 kb HindIII fragment
covering -6.4 to +6.8 kb. The dark arrow (*) at the front of the 13.3 kb line indicates
the location of a single copy probe abutting the 5'end of the HindIII restriction site
which was used for indirect end-labeling of the genomic restriction fragment as well
as hybridizing to HS1 located at --0.3 kb. B) Southern blot analysis of a 13.3 kb
fragment to detect HS sites within the mPGES-1 promoter region. M denotes the
molecular weight markers and the (-) lane indicates the genomic HindIII fragment
with no DNase I treatment. The triangle denotes increasing concentrations of DNase I
in control and cytokine treated cells. The arrow on the right side indicates the
approximate size of the HS1 site (-6.1 kb) which maps to the proximal promoter
region of the mPGES-1 gene.


-0














2kb
II


HindIII
-19.6kb
I


HS2

(-8.6kb) HindIII

1 -6.4kb


13.2kb

Control IL-1-Treated

DNase 1 DNase 1


-13.2 kb
.. -r~~l


-
V ,,


HS2
'4--11kb)


6.0kb


4.0kb





2.0kb


Figure 3-12. mPGES-1 chromatin structure: DNase I hypersensitive site analysis 2. A) A
depiction of the mPGES-1 gene, indicating the location of a 13.2 kb HindIII fragment
covering -19.6 to -6.4 kb. The dark arrow (*) at the front of the 13.2 kb line indicates
the location of a single copy probe abutting the 5'end of the HindIII restriction site
which was used for indirect end-labeling of the genomic restriction fragment as well
as hybridizing to HS1 located at --8.6 kb. B) Southern blot analysis of a 13.2 kb
fragment to detect HS sites within the mPGES-1 genome. The (-) lane indicates the
genomic HindIII fragment with no DNase I treatment. The triangle denotes increasing
concentrations of DNase I in control and cytokine treated cells. The arrow on the
right side indicates the approximate size of the HS1 site (~11 kb) which maps to the
distal promoter region of the mPGES-1 gene.


__ 1 I









CHAPTER 4
FUNCTIONAL ANALYSIS OF PROMOTER AND DISTAL REGULATORY ELEMENTS
CONTROLLING THE IL-10 INDUCTION OF MICROSOMAL PROTAGLANDIN E
SYNTHASE-1 (MPGES-1) GENE EXPRESSION

Introduction

Gene transcription is commonly associated with remodeling of chromatin structure. In the

inactive state, DNA is tightly associated with nucleosomes and maintained as heterochromatin;

virtually prohibiting the binding of transcription factors to the DNA. When gene transcription is

activated, the nucleosomes are modified allowing access to DNA and subsequent binding of

transcription factors and the general transcription machinery. The balance between gene

silencing and activation is known to be mediated by the action of histone deacetylases and

acetyltransferases, respectively (248-252).

During gene transcription, DNA is also more susceptible to DNase I digestion leading to

the detection of "hypersensitive" sites. There are two types of hypersensitive sites, constitutive

and inducible. In constitutive sites, DNA is held open and free of nucleosomes, independent of a

stimulus. These sites are normally associated with the promoter region of genes poised for

transcriptional activation (253-255). On the other hand, for inducible sites, DNA and

nucleosomes are tightly associated and upon addition of stimulus the chromatin structure is

modified, the nucleosomes are removed allowing access to the DNA, which is now sensitive to

DNase I cleavage (254,255). These hypersensitive sites are thought to be devoid of nucleosomes

and usually found within the 5' region of genes, close to or within regions that are involved in

regulating gene expression. Numerous studies of the human P-globin locus control region

revealed the presence of enhancer elements within hypersensitive sites that are known to control

gene expression (256-258). Enhancers elements are known to act in both a position and

orientation independent manner and in the context of a heterologous promoter (259).









As shown in Chapter 3, published data and the results presented thus far, implicate the

need for additional elements to explain the level of cytokine-mediated induction. The data

presented in Figure 3-12 indicated the existence of a DNase I hypersensitive site mapping at -8.6

kb, 5' to the transcription initiation site. Although it is a constitutive site, analysis of this region

for functional activity seemed to be the next logical approach.

Results

Functional Analysis of the Distal Hypersensitive Site, HS2 Relative to the Microsomal
PGES-1 Promoter

In the previous chapter two DNase I hypersensitive sites were identified within the

mPGES-1 genome, one mapping to the proximal promoter region at the Egr-1 binding site and

the other in the distal 5' region of the promoter (-8.6 kb). Since the first hypersensitive site

mapping to the proximal promoter region was previously evaluated in the proximal promoter

constructs, the distal hypersensitive site, HS2, will now be evaluated in context with the mPGES-

1 promoter. A fragment spanning HS2 region, -10.7 to -6.4 kb, was amplified by PCR and

cloned in front of the 1.1 kb promoter construct driving human growth hormone expression.

Activity of the construct was then evaluated by transient transfection and northern blot analysis

in HFL-1 cells. Figure 4.1 (A and B) illustrates the location of the -10.7 to -6.4 kb fragment

around the HS2 site and the results of the transfection. In the presence of the -10.7 to -6.4 kb

fragment, there was a significant increase in basal growth hormone expression compared to the

wild type construct. Treatment with IL-10 caused a further increase in growth hormone

expression with the HS2 containing construct. The membrane was also reprobed for mPGES-1

expression demonstrating the normal level of IL-10 induction. Also, comparing the un-induced

lane for the promoter alone (1.1 kb) with the induced lane in the HS2 construct (1.1 + (-10.7 to -

6.4)), clearly illustrates a comparable level of induction to the endogenous gene. A graph









depicting densitometry of three independent experiments is shown in Figure 4-2 and illustrates

that the IL-10 treated cells display an overall induction of approximately 9 fold if compared back

to the untreated promoter alone samples normalized to 1.

HS2 Exhibits Characteristics of an Enhancer: Evaluation of HS2 Using a Minimal
Thymidine Kinase Heterologous Promoter

The fragment was then analyzed for enhancer activity. This was accomplished by

subcloning the -10.7 to -6.4 kb fragment into a human growth hormone reporter construct

containing a 0.2 kb minimal viral thymidine kinase promoter fragment. This experiment would

demonstrate the ability of this region to work with a heterologous promoter in a stimulus

dependent manner. Figure 4-3 (A and B) illustrates the thymidine kinase promoter construct and

the results of the northern blot analysis. The TK promoter construct alone exhibited no

significant increase in promoter activity following IL-10 stimulation. The presence of the -10.7

to -6.4 kb fragment slightly increased basal growth hormone expression with a further increase in

growth hormone expression following IL-10 treatment. A graph depicting densitometry of three

independent experiments is shown on the left of Figure 4-4.

To further address that HS2 functions as an enhancer, the thymidine kinase promoter

construct containing the -10.7 to -6.4 kb fragment in the reverse orientation was evaluated by

real-time PCR following transient transfection in HFL-1 cells. A true enhancer can be defined as

an element or DNA sequence that functions independent of position or orientation. Briefly HFL-

1 cells were transiently transfected with the each construct, total RNA was isolated according to

the QiagenTM RNeasy Mini Kit, DNase treated, then subjected to real-time RT-PCR analysis

with growth hormone specific primers. The results on the right of Figure 4-4 show that in the

reverse orientation, the HS2 fragment still elicits a strong growth hormone expression following

IL-1B treatment, with an induction in either orientation of 4 5 fold. Furthermore, these results









demonstrate that this region of the mPGES-1 locus can function with a heterologous promoter in

an orientation independent manner.

Identification of a Basal Element Within HS2

The present results imply that the HS2 fragment can exhibit both basal and inducible

activity. Therefore in an attempt to delineate the location of two potential elements, one

involved in basal expression and the other, inducible activity, a series of 5' overlapping

fragments were generated then cloned into the 1.1 kb promoter construct shown in Figure 4-

5(A). At this point it should be noted that the function of transiently transfected plasmid

constructs is not controlled by events which mediate responses at the level of chromatin since

these plasmid molecules lacked endogenous chromatin structure.

Each construct was evaluated by transient transfection and real-time RT-PCR for growth

hormone expression. The diagram in Figure 4-5 depicts the location of the 5' overlapping

fragments generated from the HS2 containing fragment, -10.7 to -6.4 kb. The results illustrate

that compared to the wild type promoter; the -10.7 to -9.6 kb and -10.1 to -9.0 kb fragments both

exhibited an increase in basal growth hormone expression, with a further increase upon IL-10

treatment that was comparable to the induction at the promoter. The last fragment, -9.5 to -8.4

kb, displayed expression levels similar to the 1.1 kb promoter alone. The interpretation of these

results is that the large increase in basal expression (~4 -5 fold) observed most prominently with

the -10.1 to 9.0 kb fragment indicates the presence of a DNA sequence which may aid in basal

expression. However, the level of induction seen in these constructs does not appear to be

greater than the promoter alone. Therefore, our hypothesis is that an additional stimulus-

dependent element must reside elsewhere in the -10.7 to -6.4 kb enhancer fragment.









Mapping of an Inducible Element Contained Within HS2

An element controlling basal activity has now been mapped to the 5' portion of the HS2

fragment; the next step was to evaluate the remaining DNA sequence for an inducible element.

A series of 3' deletion fragments were amplified by PCR and cloned into the 1.1 kb promoter

construct. Each construct was evaluated for growth hormone expression following transient

transfection and real-time RT-PCR as described in the Materials and Methods. The graph in

Figure 4-6 illustrates the results of the real-time RT-PCR analysis and indicates that compared to

the wild type promoter, both the -8.6 to -6.4 kb and the -8.6 to -8.1 kb fragment exhibit a

significant increase in growth hormone expression following IL-10 treatment. On the other

hand, the -8.1 to -7.6 kb and the -7.6 to -6.4 kb fragments displayed a behavior that was similar

to that of the wild-type promoter construct.

Overall, this data demonstrates the existence of an element (-8.6 to -8.1 kb) in conjunction

with the endogenous promoter, that confers an IL-10-dependent induction of -6 7 fold, which

is comparable to the level of induction seen with the endogenous gene (Figure 3-2). In addition,

taking into account the effects of the basal element (Figure 4-5) and the inducible element

(Figure 4-6), the combined level of expression recapitulates the natural induction. This further

accentuates the importance of multiple regulatory elements, which, when combined with the

impact of the endogenous chromatin structure may appropriately recreate the events in the cell.

Identification of Three C/EBPP Binding Sites in the Distal Regulatory Enhancer Element:
Evaluation of Single C/EBPP Mutants in the IL-1p Induction of Microsomal PGES-1

Having identified an enhancer element covering -8.6 to -8.1 kb which is involved in the IL-

10 induction, computer analysis of this 500 bp region was conducted to predict the location of

potential transcription factor binding sites using TESS transcription element search software









(227). Figure 4-7 illustrates the nucleotide sequence of the 500 bp fragment, showing the

location of three putative C/EBPp sites that were identified by TESS analysis.

To verify the relevance of these three C/EBPp sites to the IL-10-dependent induction of

mPGES-1 expression, each site was deleted by site-directed mutagenesis and evaluated for

functional activity by transient transfection and real-time RT-PCR. The results in Figure 4-8

illustrate that deletion of the C/EBP3 Site 1 only, had no effect on the overall induction by IL-10,

while deletion of C/EBP3 Site 3 only, showed a slight increase in the IL-10 induction, over that

of both the wild type promoter construct and the non-mutated -8.6 to -8.1 kb construct. The

observed increase in the IL-10 induction following deletion of Site 3 is a reproducible trend but

was not statistically significant. On the other hand deletion of C/EBPP Site 2 alone, decreased

the IL-10 induction versus the non-mutated -8.6 to -8.1 kb construct yielding an overall induction

that was now similar to that of the wild type promoter construct alone.

Analysis of Double C/EBPp Mutants in the IL-1p Induction of Microsomal PGES-1

To further verify the contribution made by each C/EBP3 site to the overall induction by IL-

10, a series of double mutants were also generated to analyze each individual C/EBPP site.

Figure 4-9 illustrates the following deletions: C/EBP3 Sites 2/3, leaving only Site 1 present,

C/EBPp Sites 1/2, leaving only Site 3 present and C/EBP3 Sites 1/3, leaving only Site 2 present.

The deletion of Sites 2/3 and Sitesl/2 led to a decrease in the IL-10 induction, similar to that of

the promoter alone construct. However, deletion of C/EBPp Sites 1/3, leaving only Site 2

present led to an increase in overall IL-10 induction over that of the wild type promoter construct

coupled to the non-mutated -8.6 to -8.1 kb construct. This a further example that, at least in the

context of a plasmid, Site 3 may serve as an additional/competitive binding site since as with the

single site mutants the loss of Site 3 and Site 1 showed the similar increase over the unmutated

fragment.









Evaluation of the C/EBPP Sites in Constructs Lacking the Egr-1 Binding Site.

To determine the role Egr-1 binding in the promoter has on the C/EBPj mediated IL-10

induction seen with the distal enhancer element, another set of C/EBPj mutant constructs were

generated which included deletion of the Egr-1 binding site from the promoter region. Each of

these constructs was analyzed by transient transfection in HFL-1 cells and real-time RT-PCR for

growth hormone expression. As a comparison, the single site mutant C/EBPj A3 and the double

mutant C/EBPj A1/A3 constructs were also analyzed. As illustrated in Figure 4-10, absence of

Egr-1 binding in either the single site mutant or the double site mutant had virtually no effect on

the overall IL-10 induction. This result illustrates that at least in the context of a plasmid

molecule, lacking appropriate chromatin structure, the distal C/EBPj site within the enhancer

can strongly and independently drive the IL-10 induction. However, this does not diminish the

importance of the Egr-1 site as a relevant activator in the proximal promoter and its role in the

endogenous chromatin structure.

Targeted Deletion of C/EBPP by Short Interfering RNA in Human and Rat Lung Cells

To establish the significance of C/EBPj with regard to the IL-10 induction of mPGES-1

gene expression, siRNA studies to knockdown C/EBPj expression were conducted. Both HFL-1

cells and a rat pulmonary epithelial-like cell line, L2, were transfected with siRNAs specifically

targeting both human and rat C/EBPj expression, respectively, and mPGES-1 expression was

analyzed by real-time RT-PCR following stimulation with the pro-inflammatory cytokine, IL- P.

As illustrated in Figure 4-1 1(A), knockdown of C/EBPj expression in HFL-1 cells treated

with a human C/EBPj siRNA led to an approximately 60% decrease in the IL-1p-induced

expression of endogenous mPGES-1. Knockdown of C/EBPj expression in HFL-1 cells was

verified by immunoblot analysis illustrated in Figure 4-11(B), which shows a decrease in

C/EBPP protein expression. In L2 cells, the results in Figure 4-12 similarly indicate that









knockdown of C/EBP3 expression with a rat specific siRNA led to an approximately 50%

decrease in the IL-10 induction following treatment with a rat specific C/EBP3 siRNA.

Evaluation of Microsomal PGES-1 Expression in C/EBPp Null Mouse Embryonic
Fibroblast (MEF) Cells

As further verification of the functional relevance of C/EBP3, mouse embryonic

fibroblasts from C/EBP3 knockout mice were also evaluated to address the role in mPGES-1

gene expression. Wild type or C/EBP3 deficient (C/EBPp -/-) MEF cells in the absence or

presence of IL-lp were evaluated for mPGES-1 mRNA expression by real-time RT-PCR. The

results in Figure 4-13 illustrate that while IL-10 induced mPGES-1 mRNA expression in the

wild type MEFs, there was no induction of mPGES-1 expression in the C/EBPp -/- MEFs.

Chromatin Immunoprecipitation (ChIP) Analysis of Egr-1, RNA Polymerase II and
C/EBPP Binding

Binding of Egr-1 to the proximal promoter and C/EBPp binding to the distal enhancer

element following IL-10 treatment were analyzed by ChIP. The results in Figure 4-14 illustrate

that Egr-1 is constitutively bound to the promoter with no increased binding following exposure

to IL-10. Binding of RNA Polymerase II to the promoter was also analyzed by ChIP and the

data revealed that in the absence of stimulus, RNA Polymerase II is bound at a low level to the

promoter and following treatment with IL-p0, there is a significant increase in RNA Polymerase

II binding also shown in Figure 4-14. Figure 4-15 illustrates ChIP analysis of the distal enhancer

element and the data revealed that in the absence of stimulus, C/EBPp is a bound to this region

while treatment with IL-10 caused a further time-dependent increase in C/EBPp binding, about

~4 fold higher by 8 h.

Co-Immunoprecipitation Analysis of Egr-1 and C/EBPp Binding

As previously indicated, the results demonstrate the importance of Egr-1 alone to basal and

induced expression in the proximal promoter (Figure 3-9). Similarly, C/EBPp also plays a









central role as an enhancer specific regulatory factor. Although the mutagenesis studies in

Figure 4-10 seem to diminish the overall role of Egr-1 in the context of the enhancer, it was still

strongly felt that Egr-1 does have an important role in vivo. Therefore, to test this notion, studies

were performed to determine whether Egr-1 and C/EBP3 are capable of interacting with each

other, as evaluated by co-immunoprecipitation (IP) analysis. Figure 4-16 (A) illustrates that Egr-

1 is detectable following immunoprecipitation with an antibody to C/EBP3. Conversely,

C/EBPp is detectable in a complex when Egr-1 is immunoprecipitated as illustrated in Figure 4-

16 (B). An antibody to a histidine tag was employed as a negative control in the IP experiments.

Discussion

In these studies, the presence of a constitutive hypersensitive site, HS2, in the distal

promoter region of the mPGES-1 gene was identified. Analysis of a fragment spanning from -

10.7 to -6.4 kb encompassing this hypersensitive site, revealed the existence of both a basal and

inducible element which contribute to the overall induction by IL-10 and recapitulates the -8-10

fold expression seen by real-time analysis of endogenous mPGES-1 expression following IL-10

treatment.

The -10.7 to -6.4 kb fragment was evaluated for enhancer-like characteristics and it was

found that the fragment is capable of activating gene transcription in an orientation independent

manner and with a heterologous promoter. Based on deletion analysis of the 5' end of the HS2

containing fragment, the location of a region conferring basal activity was also delineated.

Further analysis of the 3' end of the HS2 containing fragment led to the identification of a 500bp

fragment associated with the inducible activity. Computer analysis and subsequent site directed

mutagenesis of this IL-10 responsive fragment led to the identification of a C/EBPp site that is

involved in the IL-10 induction.









Moon et al. (207) previously reported that the transcription factor, Egr-1, is required for the

IL-1p-dependent induction of mPGES-1 gene expression. As a consequence of this, the

contribution of Egr-1 binding at the promoter and C/EBP3 at the enhancer following IL-10

treatment was evaluated for activation of the inducible fragment. Consequently, in the absence

of the Egr-1 site, no significant change in the overall induction by IL-10 was observed.

The use of siRNAs to knockdown C/EBPj illustrated the importance of C/EBPj

expression in regulating mPGES-1 gene expression independent of cell type. As further

verification of the involvement of C/EBP3 in regulating the IL-1p induction of mPGES-1, MEF

cells deficient for C/EBPP were utilized. It was found that while IL-10 increased mPGES-1

mRNA levels approximately 2 fold in wild type MEFs, in C/EBP3 -/- MEFs IL-10 treatment

attenuated mPGES-1 gene expression, further validating the importance of C/EBPp in the IL-1

induction.

Previous deletion analysis of the proximal promoter region confirmed that Egr-1 binding is

involved in the inducible expression of mPGES-1 (206,234). Chromatin immunoprecipitation

analysis showed that under basal conditions Egr-1 was already bound to the promoter and further

addition of IL-1p did not increase Egr-1 binding. The ChIP data also represents the first study of

Egr-1 binding by ChIP analysis. The data also revealed RNA Polymerase II was bound to the

promoter under basal conditions and treatment with IL-1p caused a significant increase in RNA

Polymerase II binding.

Analysis of Egr-1 binding and RNA Polymerase II binding to the enhancer element

revealed no significant binding prior to and following IL-1p treatment (data not shown).

Evaluation of C/EBP3 binding to IL-10 responsive element by chromatin immunoprecipitation

revealed that C/EBPP was initially bound and significantly increased following IL-10 treatment.









A search of the current literature yielded no studies evaluating whether Egr-1 and C/EBP3

are capable of interacting. Co-immunoprecipitation of Egr-1 and C/EBP3 followed by

immunoblot analysis revealed that Egr-1 and C/EBP3 do interact but in an IL-10 independent

manner. The model in Figure 4-17 illustrates that low levels of C/EBP3 and RNA Polymerase II

are bound to the mPGES-1 locus in the absence of stimulus. Following IL-1 treatment, there is

increased RNA Polymerase II and C/EBP3 binding at the promoter and enhancer, respectively.

Egr-1 binding was constitutively observed at the promoter potentially leading to cross-talk

between Egr-1 and C/EBPP and subsequent activation of mPGES-1 gene expression.










-10.7kb



-10.7'


HS2

I


-6.4kb
1


-p.....
~-6A


Sr


IL-lp


hGH


,-.


-*+ -+ +
- + -+- +


mPGES-1



L7a



Figure 4-1. Functional analysis of the distal hypersensitive site, HS2 relative to the mPGES-1
promoter. A) A schematic of the HS2 containing fragment -10.7 to -6.4 kb. B) The -
10.7 to -6.4 kb fragment was cloned into the 1.1 kb or 0.6 kb promoter construct
driving hGH expression. HFL-1 cells were transiently transfected with each
construct, total RNA was extracted and analyzed by northern blot. The membrane
was hybridized with radiolabeled probes for hGH, mPGES-1 and L7a.


*











* Untreated
*IL-1P


1.1 + (10.7-6.4)


Figure 4-2. Functional analysis of the distal hypersensitive site, HS2 relative to the mPGES-1
promoter. The graph illustrates densitometry of three independent northern blot
analyses where data points are represented as mean SEM. The asterisk (*) denotes
statistical significance with p value K 0.05 compared with the untreated wild type
promoter. The diamond (+) denotes statistical significance with p value K 0.05 as
compared with the untreated wild type promoter.


10

9

8

7-

6-

S5


4-

?1







Thymidine Kinase
Promoter



-6.4 Human Growth
Hormone Gene


YV
^<>'C

lA~


-+ -+-


Figure 4-3. HS2 exhibits characteristics of an enhancer: Evaluation of HS2 using a minimal
thymidine kinase (TK) heterologous promoter. A) A depiction of the TK promoter
fragment driving the expression of human growth hormone (hGH) reporter containing
the HS2 fragment -10.7 to -6.4 kb, cloned into the Ndel site. B) HFL-1 cells were
transiently transfected with following constructs: 1.1 kb, 1.1 + (-10.7 to -6.4 kb), TK,
TK + (-10.7 to -6.4kb). Total RNA was extracted and analyzed by northern blot. The
membrane was hybridized with radiolabeled probes for hGH and L7a.


Ndel


-10.7


B

IL-Ip


hGH


L7a


NN- 4 --


~s~-"










* Untreated
HIL-P


**


TK + (10.7-6.4)
Rev


Real-time RT-PCR


Figure 4-4. HS2 exhibits characteristics of an enhancer: Evaluation of HS2 using a minimal
viral thymidine kinase heterologous promoter. The graph depicts densitometry of the
wild type TK promoter construct and the HS2 fragment coupled to the TK promoter
construct in the forward orientation and real-time RT-PCR analysis of the HS2
fragment cloned in the reverse orientation. The graph is a summary of three
independent experiments where data points are represented as mean SEM. The
asterisk (*) denotes statistical significance with p value 0.05 and (**) denotes
statistical significance with p values 0.01 as compared with the untreated sample.


6-

w3 _



4-


0


2-





0-


TK


1K + (10.7-6.4)
Fwd


Densitometry


---T-


----i


- ~ ~-~ 1\










A -10.7kb HS2 -6.4kb +1

..... .......... ..............
-10.7s'-"""""** --.6.4*
-10.7 -9.6
-10.1 -9.0
-9.5 -8.5

B |
8-
I Untreated


6-
5-
;4-


.3 **





11.1+ (10.7-9.6) 1.1 + (10.1-9.0) 1.1 + (9.5-8.5)


Figure 4-5. Identification of a basal element within HS2. A) A depiction of the HS2 containing
fragment -10.7 to -6.4 kb, illustrating the location of a series of 5' overlapping
fragments generated by PCR. B) Each fragment was coupled to the -1.1 kb promoter
construct, transiently transfected into I-IL-1 cells and total RNA was extracted as
indicated in the Materials and Methods and analyzed by real-time RT-PCR to detect
hGH. The hGH/cyclophilin A ratio of untreated cells was set to 1. The graph depicts a
summary of three independent experiments and the data points are represented as
mean SEM. The diamond (+) denotes statistical significance with p value < 0.05
compared to the untreated wild type promoter. The asterisk (*) denotes statistical
significance with p value< 0.05 as compared with the untreated wild type promoter.
The asterisk (**) denotes statistical significance with p value 0.01 as compared
with the untreated sample.










-1.1 kb Promoter

-8.6 kb -6.4



-8.6 -8.1


-8.1 -7.5


-7.6 -6.4 U Untreated

L =IL-ip

0 1 2 3 4 5 6 7 8
Relative Fold Expression


Figure 4-6. Mapping of an inducible element contained within HS2. A series of overlapping
internal fragments from the 3'end of the second hypersensitive site (HS2) were
generated, -8.6 to -6.4 kb, -8.6 to -8.1 kb, -8.1 to -7.5 kb and -7.6 to -6.4 kb by PCR
then coupled to the -1.1 kb promoter construct. Growth home expression was
evaluated by transient transfection in HFL-1 cells and real-time RT-PCR analysis.
The hGH/cyclophilin A ratio of untreated cells was set to 1. The graph depicts a
summary of four independent experiments and the data points are represented as
mean + SEM. The asterisk (*) denotes statistical significance with p value< 0.05 and
(**) denotes statistical significance with p valut 0.01 as compared with the
untreated samples.










-8650

-8600

-8550

-8500

-8450

-8400

-8350

-8300

-8250

-8200

-8150


AGAAGGAGAG GGCGGCATCA


ACGCACACGT TCAGGCCGTC

CTCTGGGCGC ACACCATGCT

AGAAGCTCAG TTTCAGTTTT

GTGCAATTCC ATGTCATTGG
Site 3
CCATCCATTT CCAGAACATT
C/EBP-P
ATGAAGCAGT CATTCCCATT

AAATCTGCTT TCTCTCTCTA

CGTGGAATCA TCATAAAACA

CCAGAGGCTG AGGCAGAAGA

GTGAGCCGAG ATGGCACCAC


Figure 4-7. Location of three C/EBP3 binding sites in the distal regulatory enhancer element
predicted by computer analysis. The (-8.6 to -8.1 kb) fragment sequence was
analyzed by TESS transcription element search software and illustrates the location
of the consensus sequence for three C/EBPB binding sites.


CAGTCAGCTC CAGGAATTCC CCTGCATTTA
Site 1
TGTCTTTCCA CAAATATTTA CCAAGCACAG
C/EBP-P
AGGCACTGTA AATTCAGCCA TAAACAAGAC

CTCTTACCAT AAAACTAACC ATCTTCAAGT
Site 2
TACAGTCACA ATATTTTGCA ACCATCTTTA
C/EBP-P
TTCATCATCC CAGAAGAAAA CTTTATACGC

TCCCCACCCC GCCTACCCGC TGGCAACCAC

TAGATTTGCC CATTCTGGAC ATTTTATATG

TGTGACTGCA CACCTGTTGT CCCAGTTACT

ACCGCTTGAA CCCAGGAGGT GGAGGTTGCA

TGCACTCTAG CCTGGGCAAC TCTCCGTCTC





















0 1 2 3 4 5 6 7 8 9






Relative Fold Expression


Figure 4-8. Evaluation of single C/EBP* mutants in the IL-10 induction of mPGES-1. Each of
the three C/EBPP binding sites identified by TESS analysis were mutated by site-
directed mutagenesis in the -8.6 to -8.1 kb fragment. These three mutated fragments (-
8.6 to -8.1)A1, (-8.6 to -8.1)A2 and (-8.6 to -8.1)A3, coupled to the -1.1 kb promoter
construct, were evaluated by transient transfection in HFL-1 cells and real-time RT-
PCR analysis to detect hGH expression. The hGH/cyclophilin A ratio of untreated
cells was set to 1. The graph depicts a summary of six independent experiments and
the data points are represented as mean SEM. The asterisk (**) denotes statistical
significance with p value< 0.01 as compared with the untreated samples. (Note:
C/EBPP sites are represented as filled circles<) and deleit d sites are denoted by an
X).










-1.1 kb Promoter 0 Untreated

-8.6 -8.1
1*1 2 3 ...






le x 1xi... I





0 1 2 3 4 5 6 7 8
Relative Fold Expression


Figure 4-9. Analysis of double C/EBPj mutants in the IL-10 induction of mPGES-1. A series of
double C/EBPp mutant constructs were generated by site-directed mutagenesis of the
-8.6 to -8.1 kb fragment. These three mutated fragments (-8.6 to -8.1)A1/3, (-8.6 to -
8.1)A2/3 and (-8.6 to -8.1)A1/2, coupled to the -1.1 kb promoter construct, were
compared to the wild type fragment by transient transfection in HFL-1 cells and real-
time RT-PCR analysis to detect hGH expression. The hGH/cyclophilin A ratio of
untreated cells was set to 1. The graph depicts a summary of six independent
experiments and the data points are represented as mean SEM. The asterisk (**)
denotes statistical significance with p valu6 0.01 as compared with the untreated
samples. (Note: C/EBPp sites are represented as filled circles<) and deleted sites
are denoted by an X).











Unlrented
* *IL-1 I


*
*


*


0 1 2 3 4 5 6 7 8
Relative Fold Expression


9
9


Figure 4-10. Evaluation of the C/EBP3 sites in constructs lacking the Egr-1 binding site. The
following fragments (8.6 to 8.1), (8.6 to 8.1)A3, (8.6 to 8.1)A1/3, coupled to the
AEgr-1 promoter construct, were compared to the wild type fragments, (8.6 to 8.1),
(8.6 to 8.1)A3, (8.6 to 8.1)A1/3, following transient transfection in HFL-1 cells and
real-time RT-PCR analysis to detect hGH expression. The hGH/cyclophilin A ratio of
untreated cells was set to 1. The graph depicts a summary of three independent
experiments and the data points are represented as mean SEM. The asterisk (**)
indicates statistical significance with p value < 0.01 relative to untreated samples.
(Note: C/EBPP sites are represented as filled circles() and deleted sites are denoted
by an X).


rI 0 x)*.. ..i


-8.6 -81
1 1 2 3f
Is 6i1-....









A 14


012-
0
'10

8 0
a


0


34


B




51 kDa

42 kDa


ENo Tx
MDFect
O siRNA C/EBP P


IL-1p (4h)


a-C/EBP-p


a- ~


Actin


Figure 4-11. Targeted deletion of C/EBPj by siRNA in human lung fibroblasts. A) HFL-1 cells,
were mock-transfected (vehicle alone) or transfected with a Dharmafect siRNA
specifically targeting human C/EBPj, with or without 4h IL-10 treatment. Total RNA
was extracted and subjected to real-time RT-PCR analysis to detect either mPGES-1
or cyclophilin A mRNA. The mPGES-1/cyclophilin A ratio of untreated cells was set
to 1. The graph depicts a summary of three independent experiments, where the data
points are represented as mean SEM. The asterisk (*) indicates statistical
significance with p value< 0.05 as compared with the control sample. B)
Immunoblot analysis of C/EBPj knockdown in HFL-1 cells using a rabbit polyclonal
antibody against C/EBPj. A mouse monoclonal antibody against actin was used as a
loading control.








16-
DFect
S14- siRNA CycloB n=2

12 o siRNA C/EBP 3

12o












0 1L-1P (4h)


Figure 4-12. Targeted deletion ofC/EBP3 by siRNA in rat lung epithelial cells. Rat pulmonary
epithelial cells, L2, were mock-transfected (vehicle alone) or transfected with a
Dharmafect siRNA specifically targeting either rat cyclophilin B or C/EBP3,
respectively, with or without 4h IL-1i treatment. Total RNA was extracted and
subjected to real-time RT-PCR analysis to detect either mPGES-1 or cyclophilin A
mRNA. The mPGES-1/cyclophilin A ratio of untreated cells was set to 1. The graph
depicts a summary of three independent experiments, where the data points are
represented as mean + SEM.









2-
2.5


E-
1 2-
WO

0a -
P4


0
3 1 -



oj-





0-


wtMEF (+/+)


C/EBP-P (-/-)


Figure 4-13. Evaluation of mPGES-1 expression in C/EBPj-deficient mouse embryonic
fibroblast (MEF) cells. Wild type (+/+) and C/EBPj (-/-) MEFs were untreated or
stimulated with 2ng/mL IL-10 for 8h. Total RNA was extracted and subjected to real-
time RT-PCR analysis to detect mPGES-1 or cyclophilin A mRNA. The mPGES-
1/cyclophilin A ratio of untreated cells was set to 1. The graph depicts a summary of
four independent experiments, where the data points are represented as mean SEM.
The asterisk (*) indicates statistical significance with p value 0.05 as compared
with the untreated sample.


* Untreated
EIL-1P









* Untreated
* IL-1ji (8h)


0




ODM
-W








PEC
0
44

a
_o


IgG


PollI


Promoter


Figure 4-14. Chromatin immunoprecipitation analysis of Egr-1 and RNA Polymerase II binding.
HFL-1 cells were stimulated with 2ng/mL IL-10 for 0 and 8 h, and subjected to a
ChIP assay as described in the Experimental Procedures with control IgG, RNA
Polymerase II or Egr-1 specific antibodies. All values are graphed as a fraction of
input relative to IgG SEM. The asterisk (*) indicates statistical significance with p
value < 0.05 as compared with the untreated samples.


16

14-

12-

10-

8

6-

4-

2-

0


n=2


Egr-1


I










* Untreated
HIL-1i (4h)
El L- (8h)


I-


IgG


IL-1p Responsive Region


Figure 4-15. Chromatin immunoprecipitation analysis of C/EBPj binding. ChIP analysis of
HFL-1 cells stimulated with IL-10 for 0, 4 and 8 h using control IgG and C/EBPj
specific antibodies. All values are graphed as a fraction of input relative to IgG +
SEM. The asterisk (*) indicates statistical significance with p value < 0.05 as
compared with the untreated samples.


30


0
* 25 -


o 15



0
-~ t-

15 -


cI0

"0


C/EBP-P












Input a-C/EBPP a-His


+


a-Egr-1


a-C/EBPP


Input a-Egr-1 a-His


IL-10P

51 kDa

81 kDa


+


+


+


a-C/EBPp


a-Egr-1


Figure 4-16. Co-immunoprecipitation analysis of Egr-1 and C/EBP3 binding. A) HFL-1 cells
were stimulated with IL-1I for 8 h then subjected to co-immunoprecipitation with a
mouse monoclonal antibody against C/EBP3 followed by immunoblot analysis with a
rabbit polyclonal antibody against Egr-1. An antibody against a polyhistidine peptide
was used a control. The membrane was reprobed with a rabbit polyclonal antibody
against C/EBP3 to confirm its expression. B) Co- immunoprecipitation analysis in
IL-10 stimulated HFL-1 cells with a mouse monoclonal antibody against Egr-1
followed by immunoblot analysis with a rabbit polyclonal antibody against C/EBPP.
An antibody against a polyhistidine peptide was used as a control. The membrane
was also reprobed with a rabbit polyclonal antibody against Egr-1 to confirm its
expression.


IL-10P

81 kDa


i:


+


51 kDa


+";~u~ irr~i~rr.. .~ilC ~;*L*











-IL-10








+IL-1P


C/EBP3


mPGES-1 mRNA


Figure 4-17. Model of the functional role played by C/EBP3 and Egr-1 in activating the IL-10
induction of mPGES-1 gene expression. In the absence of stimulus, Egr-1 and RNA
Polymerase II bind to the proximal promoter while C/EBP3 binds to the distal
enhancer element leading to basal expression of mPGES-1. In the presence of IL-10,
there is increased RNA Polymerase II binding at the proximal promoter region,
perhaps stabilized by the presence of Egr-1 and there is an increase in C/EBPP
binding to the distal region. There is potential cross-talk between Egr-1 and C/EBPp
leading to the up-regulation of mPGES-1 expression.









CHAPTER 5
P38MAPK, CYTOSOLIC PHOSPHOLIPASE A2 ALPHA AND 15-LIPOXYGENASE (15-
LOX) ACTIVITIES ARE REQUIRED FOR TRANSCRIPTIONAL INDUCTION OF
CYTOSOLIC PHOSPHOLIPASE A2 ALPHA BY INTERLEUKIN-1BETA: A FEED-
FORWARD MECHANISM

Introduction

Cytosolic Phospholipase A2a (cPLA2a) Activation is Dependent on Phosphorylation and
Intracellular Calcium Levels

As the principal enzyme involved in liberating arachidonic acid from membrane

phospholipids, cPLA2a activation and regulation are considered one of the rate-limiting steps in

arachidonic acid metabolism (91,260). cPLA2a contains a C2 domain which has been shown to

regulate the binding of intracellular Ca2+ and the translocation of cPLA2a from the cytosol to the

perinuclear membrane; bringing the enzyme in close contact with its substrate and downstream

enzymes involved in arachidonic acid metabolism (109,261,262). cPLA2c also contains two

catalytic domains interspaced with isoform specific sequences (261). Three serine residues,

Ser505, Ser515 and Ser727, located in the linker sequences surrounding the second catalytic

domain, have been implicated in the regulation of cPLA2a enzymatic activity (104,113).

Phosphorylation of Ser505, Ser515 and Ser727 by mitogen activated protein kinase (MAPK)

(104), Ca2+/calmodulin-dependent protein kinase II (CaMKII) (263) and the MAPK-interacting

kinase (MNK1) (108) is known to increase cPLA2a enzymatic activity. Alternatively, a number

of studies including a 1995 study by Schievella et al. (112) have shown that deletion of the C2

domain abrogates cPLA2a translocation to the perinuclear membrane while mutation of Ser505

had no effect on cPLA2a translocation (109,112). Further, the role of phosphorylated Ser505 in

regulating cPLA2a enzymatic activity was evaluated by over expression of a mutant Ser505,

S505A; the results illustrated a reduction in agonist-induced arachidonic acid release in S505A

mutant cells compared to wild type cPLA2c over-expressing cells (104). Overall both









intracellular Ca2+ levels and phosphorylation of serine residues in the linker regions of cPLA2a

by MAPK and other kinases have been shown to be involved in regulating of cPLA2a activity.

A number of studies have illustrated that IL-10 stimulates the rapid induction of cPLA2a

phosphorylation, with a concomitant increase in cPLA2a enzymatic activity within 15 30 min

of treatment (264,265), while cPLA2a mRNA expression occurs a few hours after IL-1l

induction (96,266,267). Our lab previously showed that cytokine-induced cPLA2a gene

expression was a consequence of de novo transcription (96). Furthermore cPLA2a gene

expression is known to be inhibited by glucocorticoid treatment (267-269). While a handful of

studies have evaluated the proximal promoter region of cPLA2a and identified a number of

putative transcription factor binding sites involved in basal expression of cPLA2a (96,270,271),

the direct mechanism involved in the cytokine-mediated induction of cPLA2a is still unknown.

The information presented thus far illustrates the involvement of kinase pathways in

regulating cPLA2a enzymatic activity and highlights the need for studies evaluating the

mechanisms underlying the cytokine-mediated induction of cPLA2a gene expression. Therefore,

the work presented in this chapter attempted to elucidate the signaling mechanisms involved in

the cytokine-mediated induction of cPLA2a gene expression. Kinase pathways involved in

mediating enzymatic activation and cPLA2a gene expression will be evaluated, together with the

activities of downstream arachidonic acid metabolites as part of a feed forward mechanism.

It should be noted that the results in this chapter were performed in conjunction with Dr.

J.D. Herlihy and Ms. Molly Strickland. Some of the studies have been previously presented in

Dr. Herlihy's dissertation; however the organization, compilation of all the data, data analysis

and a number of additional studies were conducted by myself. A manuscript describing these









studies with myself as first author is under review with the Journal of Biological Chemistry and

a revised manuscript will be submitted after the completion of my dissertation.

Results

IL-1p Induces Cytosolic PLA2a Phosphorylation via the Action of P38MAPK

Previous studies have identified the involvement of MAPK in regulating cPLA2a

enzymatic activity; MAPK mediates the phosphorylation of cPLA2a leading to a rapid induction

of its enzymatic activity (104). Alternatively, this rapid induction of cPLA2a enzymatic activity,

which occurs on the minute time scale, also leads to a rapid increase in arachidonic acid levels

(272). Furthermore, the pro-inflammatory stimuli, IL-10, TNFa or LPS, are known to induce

cPLA2a mRNA and protein expression which occurs -1 to 2 h after stimulation (96,99,273,274).

Therefore, in an attempt to explore whether signaling by the pro-inflammatory cytokine, IL-10,

involves phosphorylation of cPLA2a, HFL-1 cells were treated with IL-1 in the absence or

presence of a known p38MAPK inhibitor, SB203580. Total protein was isolated and evaluated

by immunoblot analysis with a phospho-specific antibody recognizing Ser505 of cPLA2a. The

results in Figure 5-1(A) illustrate that IL-10 caused a significant increase in cPLA2a

phosphorylation within 10 min and reaching maximal levels by 1 h. Also, treatment with the

p38MAPK inhibitor, SB203580, blocked the IL-10-dependent phosphorylation of cPLA2a,

suggesting a role for p38MAPK in the phosphorylation and thus rapid activation of cPLA2a

enzymatic activity. The chart in Figure 5-1(B) illustrates quantitative statistical analysis of three

independent experiments.

P38MAPK Mediates Cytosolic PLA2a Gene Expression in an IL-1p-dependent Manner

There have been conflicting reports as to the involvement of other kinases such as MNK-1

(108), ERK1/2 (275) or CaMKII (105,276,277) in the phosphorylation and rapid activation of

cPLA2a enzymatic activity. Also, previous work by our lab demonstrated that cPLA2a gene









expression is induced at the transcriptional level by IL-10 and TNFa (96), whereby treatment

with either pro-inflammatory cytokine induced cPLA2a mRNA and protein expression in a time-

dependent manner. Therefore, to correlate the rapid phosphorylation event with transcriptional

induction of cPLA2a and illustrate the specificity of p38MAPK in the activation of cPLA2a,

induction of cPLA2a gene expression was evaluated. HFL-1 cells were treated with inhibitors of

p38MAPK (SB203580 and SB202190), ERK1/2 (PD98059) and JNK (SP600125) in the absence

or presence of IL-p1 for 8 h. Total RNA was isolated and analyzed by northern blot. The results

in Figure 5-2(A) illustrate that both p38MAPK inhibitors effectively blocked the IL-10-

dependent induction of cPLA2a gene expression. Further, cPLA2a protein expression was

evaluated in HFL-1 cells following treatment with the JNK inhibitor (SP600125) and the

p38MAPK inhibitor (SB203580). The data in Figure 5-2(B) demonstrates that treatment with

the p38MAPK inhibitor caused a reduction in cPLA2a protein levels.

To systematically demonstrate the specific involvement of p38MAPK in the transcriptional

induction of cPLA2a, cPLA2a gene expression was evaluated by northern blot following

treatment with p38MAPK inhibitors. HFL-1 cells were exposed to varied concentrations of both

p38MAPK inhibitors, SB203580 or SB202190, in the absence or presence of IL-10 for 8 h.

Figure 5-3(A and B) illustrate that both p38MAPK inhibitors blocked the IL-10-dependent

induction of cPLA2a gene expression in a dose dependent manner. The chart in Figure 5-4 is

densitometric analysis of three independent experiments for SB203580.

There are four known p38MAPK isoforms, p38a, p380, p38y and p386. Of the four, two

isoforms, p38a and p38p have been widely studied and are known to be involved in the

regulation and activation of many different genes involved in numerous cellular and biological

processes (278-280). As a specific verification of the involvement of p38MAPK, mouse









embryonic fibroblasts (MEF), wild type and p38a or p380 deficient were utilized to evaluate

cPLA2a gene expression. MEF cells were stimulated with IL-10 for 8 h, total RNA was

extracted and analyzed by real-time RT-PCR which mouse-specific cPLA2c primers. The data

in Figure 5-5 illustrates that cPLA2a gene expression is induced ~1.5 fold in both the p38a and

p38p wild-type MEFs, but in the absence of p3 8a or p380p, IL-10 is not able to induce cPLA2a

expression.

Together, the data in Figure 5-1 to Figure 5-5 highlight for the first time, the specific

involvement of p38MAPK in both the rapid induction of cPLA2a enzymatic activity within 30

min to 1 h and the IL-10-dependent induction of cPLA2a gene expression over a longer time

period. These results also suggest a potential role for other kinases, that are activated by p38 or

which activate p38, in mediating the IL-10-dependent induction of cPLA2a expression. In the

next sections, individual kinases known to be upstream and downstream of p38 will be evaluated

for their involvement in the IL-1 induction of cPLA2a gene expression.

Phosphorylation of MKK3/MKK6 is Induced by IL-1p

For years, numerous studies have researched and elucidated the intracellular signaling

cascade for MAPK activation (130,281,282). It is known that activation of p38MAPK is

mediated by the actions of the dual upstream kinases MKK3 and MKK6 (283,284). Therefore,

in this study MKK3/MKK6 activation by IL-10 will be evaluated. HFL-1 cells were stimulated

with IL-10 over the course of 1 h, protein was isolated and analyzed by immunoblotting with a

dual phospho-specific antibody recognizing Serl89 (MKK3) and Ser207 (MKK6). The results

in Figure 5-6(A) illustrate that in a time dependent manner, IL-10 caused a significant increase in

MKK3/MKK6 phosphorylation. A graph depicting densitometry of three independent

experiments is also shown in Figure 5-6(B).









To further demonstrate the role of MKK3/MKK6 in p38MAPK activation and subsequent

activation of cPLA2a gene expression, mouse embryonic fibroblasts, wild type and

MKK3/MKK6-deficient, were evaluated for cPLA2a gene expression. Wild type and deficient

MEF cells were stimulated with IL-10 for 8 h, total RNA was extracted and analyzed by real-

time RT-PCR. The data in Figure 5-7 demonstrates that IL-10 significantly induced cPLA2a

mRNA levels approximately 1.9 fold in the wild type MEFs but not in the MKK3/MKK6-

deficient MEF. These results illustrate that IL-1 is capable of inducing phosphorylation of

MKK3/MKK6, a kinase upstream of p38MAPK, which is directly involved in the

phosphorylation and subsequent activation of p38MAPK. Further, this data demonstrates the

involvement of MKK3/MKK6 in the IL-1p mediated induction of cPLA2a gene expression.

Phosphorylation of MSK-1 is Induced by IL-1p

Within the MAPK signaling cascade there is a kinase, MSK1, which is believed to be

downstream of p38 (280). A nuclear kinase, MSK-1 is known to be phosphorylated and

subsequently activated by p38MAPK (285-287). Studies have shown that activation of MSK-1

is involved in the regulation and activation of various transcription factors such as nuclear factor-

kappa B (288), cAMP-response element-binding protein (287,289) and the chromatin remodeling

proteins histone H3 and HMG-14 (290). Therefore, to determine whether treatment with IL-10

could induce phosphorylation of MSK-1 and whether p38MAPK inhibition has any effect on this

phosphorylation event, HFL-1 cells were treated with IL-10 in the absence or presence of the

p38MAPK inhibitor, SB203580. As shown in Figure 5-8(A) IL-10 stimulates the

phosphorylation of MSK-1 within 10 minutes of treatment, while co-treatment with SB203580

blocks the phosphorylation event.

The data presented thus far illustrates, that IL-10 induces the phosphorylation of

MKK3/MKK6. This kinase then goes on to activate p38MAPK which leads to the









phosphorylation and rapid activation of cPLA2a enzymatic activity and gene expression. Within

this cascade, p38MAPK is involved in the phosphorylation of MSK-1, demonstrated in Figure 5-

8(A and B) where IL-10 caused the rapid phosphorylation of MSK-1, while the p38MAPK

inhibitor SB203580 blocked the IL-10-dependent induction. It should be noted that attempts to

procure MSK-1 deficient fibroblasts were not successful. In the next section, the involvement of

downstream metabolites of arachidonic acid will be evaluated for their role in the IL-10-

mediated induction of cPLA2a gene expression.

Inhibition of Cytosolic PLA2a Enzymatic Activity Blocks the IL-1p Induction of Cytosolic
PLA2a Gene Expression: A Feed Forward Mechanism

It has been postulated that rapid activation of cPLA2a enzymatic activity may lead to an

increase in cPLA2a gene expression and increased levels of free arachidonic acid (272). In 1994,

Bartoli et al. (291) demonstrated that specific inhibition of cPLA2a enzymatic activation blocked

thrombin-induced release of arachidonic acid, through tight association of the specific cPLA2a

inhibitor, trifluoromethyl ketone (AACOCF3) with cPLA2a. We hypothesized that the rapid

induction of cPLA2a enzymatic activity may play a role in the transcriptional induction of

cPLA2a gene expression through a feed forward mechanism.

HFL-1 cells were treated with the cPLA2a inhibitor, arachidonyl trifluoromethyl ketone

(AACOCF3) in the absence or presence of IL-1 for 8 h. Figure 5-9(A) illustrates northern

analysis of cPLA2a mRNA expression and reveals that AACOCF3 blocks the IL-10 mediated

induction of cPLA2a gene expression in a dose dependent manner. The graph in Figure 5-9(B)

represents densitometry of three independent experiments. Utilizing another specific cPLA2a

inhibitor, pyrrolidine, the data in Figure 5-10(A) further illustrates the dose dependent decrease

in the IL-10 induction of cPLA2a gene expression following treatment with pyrrolidine. The

chart in Figure 5-10(B) shows an average of two independent experiments. Together these









results demonstrate involvement of arachidonic acid and possibly its downstream metabolites as

part of a feed forward mechanism in the IL-10 induction of cPLA2a.

The Lipoxygenase Pathway but not Cyclooxygenase Pathway is Necessary for Cytosolic
PLA2a Expression

It is widely accepted that cPLA2a liberates arachidonic acid from membrane phospholipids

for metabolism and downstream eicosanoid signaling as illustrated in Figure 1-1. In the next

series of experiments the arachidonic acid metabolites were evaluated to determine their

involvement in regulating cPLA2a gene expression. To evaluate the involvement of the

cyclooxygenase (COX) pathway, HFL-1 cells were treated with a non-selective COX inhibitor,

indomethacin, in the absence or presence of IL-1p for 8 h. Total RNA was isolated and analyzed

by northern blot, and the results in Figure 5-11 revealed that treatment with indomethacin had no

effect on the induction of cPLA2a gene expression by IL-10. As a consequence of these results,

the involvement of the lipoxygenase pathway was then evaluated. HFL-1 cells were treated with

the non-selective LOX inhibitor, nordihydroguaiaretic acid (NDGA), a polyphenol derivative

(292), in the absence or presence of IL-1p for 8 h. The data in Figure 5-12(A) illustrates that

treatment with NDGA blocks the induction of cPLA2a gene expression by IL-10. Densitometry

of three independent experiments is shown in Figure 5-12(B).

Since NDGA inhibits 5-, 12- and 15-LOX, it was important to determine which of the

three LOX enzymes was required for the IL-10 induction of cPLA2a gene expression. The

lipoxygenase enzymes are involved in converting arachidonic acid to leukotrienes (5-LOX

mediated reaction) and 15-HETEs (15-LOX mediated reaction) (67,132,136). 5-lipoxygenase

activating protein (FLAP) is known to regulate 5-LOX activation and the inhibitor, MK-886 is

known to specifically inhibit FLAP activity (293,294). Therefore, HFL-1 cells were treated with

the 5-LOX inhibitor, MK886, in the absence or presence of IL-1P, total RNA was isolated and









analyzed by northern blot. The results in Figure 5-13 indicate that 5-LOX activity is not

involved in the IL-10-dependent induction of cPLA2a gene expression.

The previous results have ruled out the involvement of 5-LOX in the IL-10 induction of

cPLA2a gene expression. Therefore to determine the specific involvement of 12-LOX or 15-

LOX, a pharmacological inhibitor of either 12-LOX or 15-LOX was used. Previously HFL-1

cells were treated with baicalein, a known inhibitor of 12-LOX (295), and the results of that

experiment indicated that 12-LOX did not play a role in the IL-10 induction (data not shown).

To illustrate the specific involvement of 15-LOX, HFL-1 cells were treated with a potential 15-

LOX inhibitor, luteolin, a plant flavonoid, in the absence or presence of IL-I 0 for 8 h. Total

RNA was isolated and analyzed by northern blot. The results in Figure 5-14(A) indicate that

luteolin reduced both the basal and induced expression of cPLA2a. Densitometry of three

independent experiments is illustrated in Figure 5-14(B).

Luteolin is a plant flavonoid known to inhibit tyrosine kinase activity and like other

flavonoids may undergo metabolic transformation resulting in modified bioactivity (296,297).

Sendobry et al. (298) identified a compound, PD146176, which lacked non-specific antioxidant

activity but was reported to specifically inhibit 15-LOX while exhibiting a moderate inhibitory

effect on 5- or 12-LOX activity. Therefore, total RNA from HFL-1 cells treated with PD146176

in the absence or presence of IL-10 for 8 h was analyzed by northern blot for cPLA2a expression.

The results in Figure 5-15(A) illustrate that PD146176 significantly decreased the IL-10

induction of cPLA2a gene expression in a dose dependent manner. These results are confirmed

by densitometry of the IL-10 induction from three independent experiments depicted in Figure 5-

15(B). Thus far, the results demonstrate that inhibition of the LOX pathway, specifically 15-

LOX and not the COX pathway is involved in the IL-10 induction of cPLA2a gene expression,









supporting our hypothesis of a feed forward mechanism involved in the regulation of cPLA2a

gene expression. In the final section, the specific functional importance of 15-LOX activity will

be verified by siRNA analysis.

Short Interfering RNA against 15-LOX Blocks the IL-1p Induction of Cytosolic PLA2a
Gene Expression

The previous experiments utilized putative 15-LOX inhibitors, to determine whether 15-

LOX activity is required for the IL-10-dependent induction of cPLA2a. To further illustrate the

importance of 15-LOX in mediating the IL-10 induction of cPLA2a gene expression, knockdown

of 15-LOX expression by siRNA analysis was then evaluated. Since there are two 15-LOX

isoforms, their expression in HFL-1 cells following IL-10 stimulation was analyzed by real-time

RT-PCR. The results indicated no basal or inducible 15-LOX1 expression in HFL-1 cells. On

the other hand, HFL-1 cells exhibited basal 15-LOX2 expression and increased levels following

IL-10 treatment (data not shown). Therefore an siRNA against 15-LOX2 was transfected into

HFL-1 cells as indicated in the Materials and Methods and cPLA2a mRNA expression was

measured following 4 h of IL-10 treatment. The data in Figure 5-16 illustrates that knockdown

of 15-LOX2 expression caused about a 50% decrease in cPLA2a gene expression, validating the

involvement of the lipoxygenase pathway, particularly 15-LOX2, in a feed forward mechanism

regulating the IL-10 induction of cPLA2a expression.

Discussion

The MAPK pathway and intracellular Ca2+ levels are known to be involved in regulating

the enzymatic activity of cPLA2a (104,261). This study focused on determining which aspects

of the p38MAPK signaling cascade lead to the IL-10 induction of cPLA2a enzymatic activation

and transcriptional activation. The data confirms work presented in previous studies (104,272),

illustrating that IL-1P caused a rapid activation of cPLA2a phosphorylation within 10 minutes,









and that this phosphorylation event is attenuated by treatment with the p38MAPK inhibitor,

SB203580. Analysis of cPLA2a gene expression as a consequence of IL-10 induction was

evaluated using pharmacological inhibitors of p38MAPK and mouse embryonic fibroblasts

deficient for the two major p38MAPK isoforms, p38a and p3 8P. The results presented in Figure

5-2 to Figure 5-5, further illustrated the specific involvement of p38MAPK in the induction of

cPLA2a mRNA expression.

Kinases known to be involved in the p3 8MAPK pathway are MKK3 and MKK6 kinases,

which are upstream of p38MAPK and directly involved in its phosphorylation (283), and MSK-

1, a downstream target of p38MAPK (287). The results shown in Figure 5-6 to Figure 5-7

illustrate that IL-10 induces an upstream p38MAPK activator, MKK3/MKK6, which is

reportedly activated by MyD88-IRAK/TRAF6 (280). A downstream target of p38MAPK, MSK-

1, was also shown to be activated by IL-10 further implying involvement of p38MAPK in the

cytokine-mediated induction of cPLA2a (Figure 5-8). A few studies have implied that

phosphorylation of cPLA2a by MSK-1 may trigger the translocation of cPLA2a to the

perinuclear membrane, bringing the enzyme in close proximity to its substrate (299).

Furthermore, Vermeulen et al. (288) illustrated that MSK-1 phosphorylates NFKB in a stimulus

dependent manner and inhibition of MSK-1 significantly attenuated NFKB phosphorylation.

Future studies on the activation of cPLA2a gene expression may illustrate the specific role of

MSK-1 in cPLA2a enzymatic activation and gene transcription. Presently, looking at the data

presented thus far, an interesting observation can be made, in that there is a sequential activation

of MKK3/MKK6, p38MAPK, MSK-1 leading to the eventual phosphorylation of cPLA2a, all

happening within 10 30 min of IL-10 treatment. A model of depicting these events is

illustrated in Figure 5-17.









Increased cPLA2a enzymatic activity could potentially lead to increased cPLA2a gene

expression and this was proven by utilizing inhibitors of cPLA2a enzymatic activity, AACOCF3

and pyrrolidine. It is known that cPLA2a activity is required for liberating arachidonic acid from

membrane phospholipids for further metabolism by lipoxygenases and cyclooxygenase.

Increased availability of arachidonic acid leads to cell-mediated production of eicosanoids which

regulate numerous physiological and pathological events. The availability of these signaling

molecules, whether rapidly induced within minutes or produced over a longer time scale, can

exhibit varied physiological responses within the cell.

Evaluation of the involvement of downstream arachidonic acid metabolites in regulating

cPLA2a expression revealed that while cyclooxygenase activity was not involved in the

induction, lipoxygenase activity was required for the IL-10-dependent induction. Furthermore,

using selective pharmacological inhibitors of the lipoxygenase enzymes, the data illustrated the

specific involvement of 15-LOX in regulating the IL-1j induction of cPLA2a (Figure 5-9 to

Figure 5-15).

Further analysis of the lipoxygenase pathway by pharmacological inhibition and targeted

knockdown by siRNA, illustrated the involvement of 15-LOX2 in the transcriptional activation

of cPLA2a (Figure 5-16). Overall this data confirmed the ability of cPLA2a to regulate its own

gene expression via a feed forward mechanism and illustrated the unique quality of p38MAPK to

regulate both the enzymatic activation of cPLA2a and transcriptional induction of cPLA2a gene

expression.











IL-1P3 SB20

0 10 20 40 60 10 20


%Om- -00


0
a-
so


60
%40

20
PI

1 to


3 + IL-10


40 60


p-cPLA2a
Ser505


* **


IL-ip


IL-1p + SB203


Time (min)


Figure 5-1. IL-10 induces cPLA2a phosphorylation via the action of p38MAPK. A) HFL-1 cells
were stimulated with IL-10 in the absence or presence of the p38MAPK inhibitor
SB203580. Phosphorylation of cPLA2a was evaluated by immunoblot analysis with
a phospho-specific antibody against Ser505. B) The graph depicts densitometry of
three independent experiments. The asterisk (*) indicates statistical significance with
p value < 0.05 and (**) indicates statistical significance with p value < 0.01 as
compared with the control samples.


Time (min)

115 kDa --










Control SB203 SB202 DMSO PD98059 SP600125


- +


- +


- +


m0


- +

mm


- +--


- +


6CI


IL-1P


C D SB SP

115 kDa -** JM
A-. .. -i u miriii


C
1Wir-....


D SB SP

BE- -
----k~j^H^ ^*"*


a-cPLA2a


Figure 5-2. p38MAPK mediates cPLA2a gene expression in an IL-lp-dependent manner. A)
HFL-1 cells were exposed to p38MAPK, ERK1/2 or JNK inhibitors in the absence or
presence of IL-lp for 8 h. Total RNA was isolated and analyzed by northern blot.
The membrane was hybridized with radiolabeled probes for cPLA2a and L7a. B)
Immunoblot analysis of cPLA2c protein expression in HFL-1 cells treated with the
p38MAPK inhibitor, SB203580 or the JNK inhibitor, SP600125.


IL-1P

cPLA2a



L7a










SB203 (pM)


IL-1p
SB203 (piM)


C D 0.1 0.5 1


C D 2.5


5 10 15 20


10 C D 0.1 0.5 1

,a 60 04 ag


IL-10
SB202 (pM)
C D 2.5 5 10 15 20


cPLA2c _MM

L7a 40 4. ,4SEE.#EU


Figure 5-3. Inhibition of cPLA2a enzymatic activity blocks the IL-10 induction of cPLA2a gene
expression: A feed forward mechanism. A) HFL-1 cells were exposed to increasing
concentrations of SB203580 in the absence or presence of IL-10 for 8 h. Total RNA
was extracted and subjected to northern blot analysis. The membrane was hybridized
with radiolabeled probes for cPLA2a and L7a (L7a serves as the loading control). B)
Northern blot analysis of HFL-1 cells treated with an analog of SB203580,
SB202190, in the absence or presence of IL-10. The membrane was hybridized with
radiolabeled probes for cPLA2a and L7a (L7a serves as the loading control).


cPLA2a


L7a


SB202 (plM)










100 N)

90

80-

S70

S60\(4)


S 40
a 6) (4)
| 30-
20-
(2)
10-


0 0.1 0.5 1 2.5 10
SB203 (tM)


Figure 5-4. Inhibition of cPLA2a enzymatic activity blocks the IL-10 induction of cPLA2a gene
expression: A feed forward mechanism. The graph illustrates densitometry data for
HFL-1 cells treated with SB20358 in the presence of IL-10. The number in
parentheses above each point indicates the number of independent data points. The
asterisk (*) indicates statistical significance with p value K 0.05 and (**) indicates
statistical significance with p value K 0.01 as compared with the control samples.










* Untreated
SIL-lp3


p38a +/+ p38a -/-


p38p (+/+)


p38p (-/-)


Figure 5-5. p38MAPK mediates cPLA2a gene expression in an IL-lp-dependent manner. Wild-
type, p38a -/- and p380 -/- MEF cells were stimulated with IL-10 for 8 h. Total RNA
was isolated and subjected to real-time RT-PCR analysis to detect cPLA2c gene
expression. The cPLA2c/cyclophilin A ratio of untreated cells was set to 1. The
graph depicts a summary of four independent experiments, where the data points are
represented as mean SEM. The asterisk (**) indicates statistical significance with p
value < 0.01 as compared with the control sample.


1.5




1




0.5


0 -


I


___T_


___1










A
Time (min)


40 kDa-*


16-

S14

.212 -
to-
S8-
0
S6-

I 4-
92 2-


IL-10
0 10 20 40 60


- w w p-MIKK3/MKK6
Ser189/207


20
IL-Ip (min)


Figure 5-6. Phosphorylation of MKK3/MKK6 is induced by IL-10. A) HFL-1 cells were
stimulated with IL-1l and phosphorylation of MKK3/MKK6 was evaluated by
immunoblot analysis with a dual phospho-specific antibody recognizing Serl89
(MKK3) and Ser207 (MKK6). B) The graph depicts densitometry of three
independent experiments. The asterisk (*) indicates statistical significance with p
value < 0.05 as compared with the control samples.


--








2.5 -
Untreated
SIL-13

*
-



S1.5








0.5 -



0
MKK3/6 (+/+) MKK3/6 (-/-)


Figure 5-7. MKK3/MKK6 mediates cPLA2a gene expression in an IL-10-dependent manner.
Wild-type and MKK3/6 -/- MEF cells were treated with IL-10 for 8 h. Total RNA
was isolated and subjected to real-time RT-PCR analysis to detect cPLA2c
expression. The cPLA2c/cyclophilin A ratio of untreated cells was set to 1. The
graph depicts a summary of three independent experiments, where the data points are
represented as mean SEM. The asterisk (*) indicates statistical significance with p
value < 0.05 as compared with the control sample.










A IL-IP IL-1p + SB203
Time (min) 0 10 20 40 60 10 20 40 60
Do- C m '0' -MSK-1
90 kDa- p-MSK-
Ser 376

25-


Cl

i 15-









0 10 20 40 60 10 20 40 60
I-Ip HlAP+SB203
Time (min)


Figure 5-8. Phosphorylation of MSK-1 is induced by IL-10. A) HFL-1 cells were stimulated
with IL-1p in the absence or presence of the p38MAPK inhibitor, SB203580.
Phosphorylation of MSK-1 was evaluated by immunoblot analysis with a phospho-
specific antibody against Ser376. The arrow head () indicates an unspecific
interaction. B) The graph depicts densitometry of three independent experiments.
The asterisk (*) indicates statistical significance with p value < 0.05 and (**)
indicates statistical significance with p value < 0.01 as compared with the control
samples.










IL-103


AACOCF3 (pM)

e P 5 15 25 50 r F


AACOCF3 (PM)

5 15 25 50


110.
100
90.
80.
70'
S60,
50
40,
30
20-
10.
0


15
AACOCF3 (pM)


Figure 5-9. The lipoxygenase pathway but not cyclooxygenase pathway is necessary for cPLA2a
expression: Inhibition of cPLA2a enzymatic activity. A) HFL-1 cells were exposed
to an inhibitor of cPLA2a enzymatic activity, AACOCF3 in the absence or presence
ofIL-lp for 8 h. Total RNA was isolated and analyzed by northern blot. The
membrane was hybridized with radiolabeled probes for cPLA2a and L7a. B) The
graph depicts a summary of three independent experiments, where the data points are
represented as mean SEM. The asterisk (*) indicates statistical significance with p
value < 0.05 and (**) indicates statistical significance with p valu6 0.01 as
compared with the control sample.


cPLA2a



L7a


-. IL-I J











Pyrrolidine (nM)


C D 6


IL-10
12 30 60 120 C D 6 12 30 60 120


cPLA2a


L7a


100 -
90-


80 -
70 -
60 -
s-
50-
40-
30 -
20 -


120


Pyrrolidine (nM)


Figure 5-10. The lipoxygenase pathway but not cyclooxygenase pathway is necessary for
cPLA2a expression: Inhibition of cPLA2a enzymatic activity. A) Northern analysis
ofHFL-1 cells which were treated with pyrrolidine, an inhibitor of cPLA2a enzymatic
activity, in the absence or presence of IL-10 for 8 h. The membrane was hybridized
with radiolabeled probes for cPLA2a and L7a. B) Densitometric analysis of two
independent experiments where the data points are represented as an average.


# 6" 006#WC









IL-1P3


Indomethacin (pM)
C D 5 10 20 50 C


Indomethacin (pM)
D 5 10 20 50


cPLA2a


L7a



Figure 5-11. The lipoxygenase pathway but not cyclooxygenase pathway is necessary for
cPLA2a expression: Inhibition of COX. A) HFL-1 cells were treated with the non-
selective COX inhibitor, indomethacin, in the absence or presence of IL-10 for 8 h.
Total RNA was analyzed by northern blot to detect cPLA2a expression. The
membrane was hybridized with radiolabeled probes for cPLA2a and L7a.












NDGA (pM)

C D 5 10 20 50


IL-1p
NDGA (pM)

C D 5 10 20 50


cPLA2a


L7a


100.
90.
so-
80*
70-
'60
150
40.
30


~ n ..4* ~i 4*r o~ E


- -IL-13


10
NDGA (pM)


Figure 5-12. The lipoxygenase pathway but not cyclooxygenase pathway is necessary for
cPLA2a expression: Inhibition of LOX. A) Northern analysis of HFL-1 cells treated
with the selective LOX inhibitor, NDGA, in the absence or presence of IL- for 8 h.
The membrane was hybridized with radiolabeled probes for cPLA2a and L7a. B)
Densitometry of three independent experiments, where the data points are represented
as mean SEM. The asterisk (*) indicates statistical significance with p value
0.05 and (**) indicates statistical significance with p valu6 0.01 as compared with
the control sample.










IL-1p3


MK-886 (pM)
C D 1 2.5 5 10


C D


MK-886 (pM)
1 2.5 5 10


cPLA2a


L7a


----- w w


a


- w ~


Figure 5-13. The lipoxygenase pathway but not cyclooxygenase pathway is necessary for
cPLA2a expression: Inhibition of 5-LOX. HFL-1 cells were treated with a 5-LOX
inhibitor, MK-886, in the absence or presence of IL-10 for 8 h. Total RNA was
analyzed by northern blot to detect cPLA2a expression. The membrane was
hybridized with radiolabeled probes for cPLA2a and L7a.












Luteolin (pM)


IL-1P3
Luteolin (plM)


C D 10 25 50 100 C


D 10 25 50


cPLA2a


L7a


25
Luteolin (pM)


Figure 5-14. The lipoxygenase pathway but not cyclooxygenase pathway is necessary for
cPLA2a expression: Inhibition of 12/15-LOX. A) Northern analysis of HFL-1 cells
treated with a general LOX inhibitor, luteolin, in the absence or presence of IL-10 for
8 h. The membrane was hybridized with radiolabeled probes for cPLA2a and L7a.
B) Densitometry of three independent experiments, where the data points are
represented as mean SEM. The asterisk (*) indicates statistical significance with p
value < 0.05 and (**) indicates statistical significance with p valu6 0.01 as
compared with the control sample.


100


-.- IL-iP


o 70-
60-
so-
W 50-
40-
30-











PD146 (pM) C


D 1 10 100


IL-13
C D 1 10 100


cPLA2a


L7a


100 -


80-




S40-


20-


-
0-


IL-lp


10
PD146 (pM)


Figure 5-15. Pharmacological inhibition of 15-LOX and siRNA against 15-LOX activity blocks
the IL-10 induction of cPLA2a gene expression. A) HFL-1 cells were treated with the
15-LOX specific inhibitor, PD146176, in the absence or presence ofIL-10 for 8 h.
Total RNA was analyzed by northern blot to detect cPLA2a expression. The
membrane was hybridized with radiolabeled probes for cPLA2a and L7a. B)
Densitometry of three independent experiments, where the data points are represented
as mean SEM. The asterisk (**) indicates statistical significance with p valu6
0.01 as compared with the control sample.










SNo Tx

6 E Luciferas e siRNA
o 15-LOX2 siRNA
S5

4-




12






JUntreated IL-1 4h

cPLA2a mRNA Levels


Figure 5-16. Pharmacological inhibition of 15-LOX and siRNA against 15-LOX activity blocks
the IL-10 induction of cPLA2a gene expression. HFL-1 cells were transfected with a
control siRNA targeting Luciferase, or with an siRNA specifically targeting human
15-LOX2, with or without 4h IL-10 treatment. Total RNA was extracted and
subjected to real-time RT-PCR analysis to detect either cPLA2a or cyclophilin A
mRNA. The cPLA2a/cyclophilin A ratio of untreated cells was set to 1. The graph
depicts a summary of two independent experiments.

































Figure 5-17. Model of cPLA2a activation. IL-10 binds to its receptor activating
MyD88/IRAK/TRAF6 and triggering the phosphorylation of MEKK3. The dual
kinase MKK3/MKK6 is activated by phosphorylation and in turn phosphorylates,
p38MAPK. p38MAPK goes on to phosphorylate MSK-1 which ultimately leads to
the phosphorylation and enzymatic activation of cPLA2a. The activated enzyme
translocates to the peri-nuclear membrane and is able to mediate downstream
transcriptional events.









CHAPTER 6
CONCLUSIONS AND FUTURE DIRECTIONS

Conclusions

PGE2 has been well characterized and is known to play a role in a number of biological

and pathophysiological functions. As a downstream product of arachidonic acid metabolism, it

was initially thought to be a direct by-product of COX metabolism of the central prostanoid

intermediate, PGH2. In the late 90's Jakobsson et al. (192) identified a terminal prostaglandin E

synthase and showed that this enzyme was directly responsible for the production of PGE2 and

was induced by the pro-inflammatory cytokine, IL-10. A decade later, numerous studies

illustrated the importance of mPGES-1 in PGE2 production and demonstrated that a stress

response factor, Egr-1, is capable of binding to the proximal promoter region of mPGES-1 thus

driving its inducible expression (207,234,237,300). Since that time, no other studies have

clarified the exact mechanisms involved in the cytokine-dependent regulation of mPGES-1 gene

expression and aside from the proximal promoter no other regulatory elements have been

identified. Therefore, the goal of the current study was to examine the underlying mechanisms

surrounding the induction of mPGES-1 gene expression by pro-inflammatory cytokines.

In my initial studies, I examined the induction of mPGES-1 gene transcription as a

consequence of IL-10 stimulation and the results illustrated that both the mRNA and protein

levels were strongly up-regulated in the presence of IL-10 (Figure 3-1 to Figure 3-4). Degousee

et al. (233) illustrated that the induced mPGES-1 message had a half-life of -6 h compared to ~3

h in the un-induced state in cardiomyocytes. In a parallel study, I analyzed decay of the induced

message following stimulus removal; the results showed that the message had a half-life of about

~6 h in human lung fibroblasts (Figure 3-5). Further, I was able to demonstrate the requirement

of de novo transcription for the cytokine-mediated induction of mPGES-1 gene expression, by









actinomycin D treatment and the measurement of hnRNA levels, a pre-spliced mRNA

intermediate (Figure 3-6 and Figure 3-7).

Analysis of two mPGES-1 promoter fragments illustrated basal promoter activation in the

absence of stimulus and a subsequent increase in activity following IL-10 stimulation.

Functional analysis of the wild type mPGES-1 promoter fragment (1.1 kb) and a mutant

construct harboring an Egr-1 deletion, confirmed the involvement ofEgr-1 in regulating

promoter activation corroborating the studies previously conducted by other groups (Figure 3-8

to Figure 3-9) (206,207). Alternatively, I used computer analysis to predict the location of

transcription factor binding sites within the promoter and identified a potential binding site for

C/EBPP. Deletion of this site revealed that it did not contribute to the basal or induced promoter

activation.

In the absence of other data or regulatory studies in the literature, we hypothesized that

there must be additional regulatory elements within or near the mPGES-1 gene that are involved

in regulating its expression and thus achieving the level of induction observed by measuring

steady-state increases. The first approach was to generate fragments of the entire mPGES-1

locus, subclone each fragment into the hGH construct and evaluate the reporter activity, a

strategy based on our lab's experience in identifying internal cytokine-dependent regulatory

elements. Therefore, I examined fragments internal to the gene and found no regulatory

elements that significantly contributed to overall promoter activation by IL-10 (Figure 3-10).

Further, the overall induction with each of these fragments was similar to that of the promoter

alone, approximately -1.5 2 fold.

Taking another approach, DNase I hypersensitive site analysis was utilized to identify

potential regulatory regions (Figure 3-11 and Figure 3-12). This method allows for the rapid









detection of structural alterations or open chromatin regions associated with hypersensitive sites

harboring regulatory factors and their analogous binding sites. These open regions can then be

further evaluated for functional significance as it relates to the IL-10 induction.

The analysis revealed the existence of two potential regulatory regions or constitutive

hypersensitive sites, one mapping to -0.3 kb and the other mapping at -8.6 kb. Unlike

inducible hypersensitive sites, constitutive hypersensitive sites are known to be associated with

the promoter region of genes and subsequent transcriptional activation. At times, finer analysis

of these regions reveal the existence of regulatory regions that are potentially involved in

regulating gene expression (301). The first site mapped to the region ofEgr-1 binding which

was previously analyzed by site-directed mutagenesis of the mPGES-1 promoter construct

(Figure 3-8 and Figure 3-9). Functional analysis of the second HS site illustrated that the

fragment exhibits enhancer-like characteristics, functioning in an orientation independent manner

and activating transcription through a heterologous promoter in an IL-I -dependent manner.

Also this site contained both a basal and inducible element involved in the regulation of mPGES-

1 expression (Figure 4-1 to Figure 4-6). Furthermore, combining the level of induction seen in

the induced lane of the promoter+enhancer construct (~9 fold) with the un-induced lane of the

promoter alone construct, recapitulates the level of induction of the endogenous gene by northern

blot and real-time RT-PCR.

Contrary to published reports which indicated that Egr-1 is the sole factor regulating the

induction of mPGES-1 gene expression; deletion analysis of the inducible enhancer element

together with site-directed mutagenesis, siRNA and the availability of wild type and knockout

MEF cells revealed the involvement of another transcription factor, C/EBP3 as a key mediator of

the IL-10-dependent induction of mPGES-1 gene expression, the existence of which has not been









previously reported (Figure 4-7 to Figure 4-13). Further analysis of both Egr-1 and C/EBPp by

chromatin immunoprecipitation indicated that Egr-1 bound to the promoter in an IL-10-

independent manner while C/EBPp bound in a cytokine-dependent manner to the enhancer

element (Figure 4-14 to Figure 4-15). This analysis also illustrated that RNA Polymerase II

bound to the mPGES-1 promoter in an IL-1j manner.

It is not known whether Egr-1 and C/EBPp are capable of interacting and therefore a co-

immunoprecipitation analysis was conducted and revealed that these factors are capable of

interacting independent of cytokine treatment (Figure 4-16). In lieu of other known data, our

model of IL-10 activation suggests that under basal conditions, Egr-1 is bound to the promoter,

while C/EBPp is bound at the enhancer. Also, in the absence of IL-10, RNA Polymerase II is

bound to the promoter. Following IL-10 treatment, there is a significant increase in RNA

Polymerase II binding at the promoter and C/EBPp binding at the enhancer. At some point there

is cross talk between Egr-1 and C/EBPp leading to the up-regulation of mPGES-1 expression.

Overall, this study focused on delineating the mechanisms involved in regulating the

physiological levels of mPGES-1. It also illustrated the need for a concise examination of the

entire mPGES-1 locus. This work revealed the involvement of another transcription factor,

C/EBPp aside from Egr-1, in mediating the IL-10-dependent induction of mPGES-1. Most

relevantly, the data presented thus far illustrate that regions outside of the proximal promoter are

required to achieve the full expression seen by IL-1P. Hopefully this work will aid in the

development of anti-inflammatory drugs aimed at inhibiting mPGES-1 enzymatic activation.

cPLA2a is the enzyme responsible for liberating arachidonic acid from membrane

phospholipids for downstream metabolism. Enzymatic activation of cPLA2c is regulated by

intracellular calcium levels and MAP kinase activity (84,91,104,109). Initially a few groups









illustrated that cPLA2a enzymatic activity is rapidly induced within 30 min to 1 h, following

treatment with pro-inflammatory cytokines (272). Further, p38MAPK activation is known to

play a role in the enzymatic activation of cPLA2a (109,275,302). As such, our studies focused

on delineating the involvement of kinase pathways and we hypothesized that downstream

arachidonic acid metabolites may be involved in regulating cPLA2a gene expression. Since

many studies indicated that kinase activity is involved in mediating cPLA2a enzymatic activity,

our initial studies utilized specific kinase inhibitors to determine some of the pathways involved.

Our data revealed that IL-10 caused rapid phosphorylation of cPLA2a, which was subsequently

blocked by inhibition of p38MAPK. Using inhibitors to ERK, JNK and MAPK, it was found

that inhibition of p3 8MAPK attenuated the IL-1 -induced activation of cPLA2a gene

transcription (Figure 5-1 to Figure 5-4). Also, analysis of p38a and p380 MEFs further

illustrated the importance of p38MAPK in cPLA2a activation (Figure 5-5). Interestingly,

MKK3/MKK6, a kinase known to phosphorylate p38MAPK (283), showed increased levels of

phosphorylation following IL-10 treatment (Figure 5-6). This was further supported by data

from MKK3/MKK6 MEF cells which illustrated that in the absence of the dual kinases,

MKK3/MKK6, the IL-1 induction of cPLA2a gene transcription was attenuated (Figure 5-7).

Another kinase, MSK-1 which is downstream of p38MAPK and identified as a target of

p38MAPK activity (285), was analyzed by immunoblot and was phosphorylated following IL-10

treatment (Figure 5-8). Together the data suggests that IL-10 induces activation of

MKK3/MKK6 which in turn phosphorylates p38MAPK leading to the activation of MSK-1 and

eventually cPLA2a enzymatic activation, all happening within 10 30 min post treatment

(Figure 5-17). Although our data could not illustrate the direct involvement of MSK-1 in the









activation of cPLA2a, Aimond et al. (303) illustrated this event in cardiomyctes, analyzing

cPLA2a protein expression following treatment with an inhibitor of MSK-1, Ro318220.

We then hypothesized that products of arachidonic acid metabolism may play a role in the

IL-1p induction of cPLA2a. First, inhibition of cPLA2a enzymatic activity by AACOCF3 and

pyrrolidine illustrated that cPLA2a enzymatic activity was required for transcriptional activation

by IL-10 (Figure 5-9 and Figure 5-10). Analysis of downstream arachidonic acid metabolites

revealed that COX activity was not involved in the IL-1 induction of cPLA2a gene expression

illustrated by inhibition with indomethacin (Figure 5-11). Using inhibitors to the lipoxygenase

pathway illustrated the specific involvement of 15-LOX in the activation of cPLA2a expression

(Figure 5-12 to Figure 5-15). Real-time RT-PCR analysis of 15-LOX1 and 15-LOX2 expression

in HFL-1 cells showed that only 15-LOX2 is expressed in these cells (data not shown).

Therefore, utilizing an siRNA against 15-LOX2 confirmed the involvement of this lipoxygenase

in the IL-10 activation of cPLA2a gene expression (Figure 5-16). Overall the data illustrated the

role of a feed forward mechanism involved in regulating the enzymatic activity and

transcriptional induction of cPLA2a, along with the direct involvement of the p38MAPK

signaling pathway. Coupled with current work being conducted in our lab, we will hopefully be

able to contribute further information on the enzymatic and transcriptional activation of cPLA2a

expression.

Future Directions

Like previous studies, my analysis of the mPGES-1 promoter region revealed increased

activation following IL-10 but there was a visible difference in the overall induction.

Densitometric analysis revealed that the 1.1 kb fragment elicited a 2.5 fold increase in reporter

expression versus a 1.5 fold increase seen with the 0.6 kb fragment implying that there is a

potential regulatory element between -1.1 kb and -434 kb. Computer analysis of this region









identified a C/EBP site which was later ruled out. Further, Egr-1 was shown to be important for

induced gene expression by promoter deletion, conducted by our group and others. Another

group conducted siRNA analysis of Egr-1 and found that there was a 50% reduction in induced

promoter activation. The data presented in Chapter 3 confirmed the involvement of Egr-1 on the

IL-10 induction of mPGES-1 and I believe that Egr-1 -/- MEF cells may reveal in the presence of

IL-p0, that mPGES-1 levels are significantly increased more than ~2 fold (which is seen with

promoter fragments); indicating the involvement of another regulatory factory that co-

operatively interacts with Egr-l to regulate promoter activation. Therefore, further analysis of

the promoter fragment is needed to identify other potential factors involved in the activation of

the mPGES-1 promoter.

Analysis of the mPGES-1 gene by DNase I led to the discovery of two constitutive

hypersensitive sites. Functional analysis of the second site illustrated basal and inducible

activity. The inducible activity was further characterized to a 500 bp region and the involvement

of the transcription factor C/EBPP was reported but no other work was done on the basal

element. It is possible that like the inducible element, a single or multiple transcription factors

are co-operatively regulating the basal expression of this fragment. Complete mapping and

functional analysis of the basal element are needed. ChIP and co-IP analysis revealed that Egr-l

can interact with C/EBP3 and RNA Polymerase II binds inducibly to the promoter. It is unclear

whether Egr-l is involved in recruiting RNA Polymerase II to the promoter or even if they can

interact. I believe that Egr-l is potentially interacting with members of the pre-initiation

complex and as such is involved in the recruitment of RNA Polymerase II to the promoter. To

test this hypothesis, I suggest further analysis of Egr-1/RNA Polymerase II interaction by ChIP









or co-immunoprecipitation followed by immunoblot analysis with antibodies specific to known

members of the pre-initiation complex.

The cPLA2c study illustrated the involvement of MKK3/MKK6 and p38MAPK by

immunoblot and MEF cell analyses. Although MSK-1 is reportedly involved, the data provided

thus far only supports part of our model of cPLA2a activation. I was unable to obtain mouse

embryonic fibroblasts deficient for MSK-1 and my hypothesis is that analogous to the

transcriptional induction of cPLA2a gene expression, cPLA2a protein expression would be

activated in the wild type MSK-1 MEFs following IL-10 induction but not the MSK-1 -/- MEFs.

Therefore, further analysis of cPLA2a expression in MSK-1 MEF cells is needed to complete the

story surrounding p38MAPK, MSK-1 phosphorylation and activation of cPLA2a.

The siRNA analysis implicated 15-LOX2 in the regulation of cPLA2a gene expression,

while MEF cells for 15-LOX2 do not exist as yet, I believe IL-10 would stimulate cPLA2a

activation and transcriptional induction in the wild type MEFs but only cPLA2a enzymatic

activity would be induced in the 15-LOX2 -/- cells. Data not presented in this dissertation

suggested the potential involvement of NRB in regulating cPLA 2a gene expression and as such

current studies are underway in the lab by Dr. Kimberly Aiken, to characterize the regulation of

cPLA2a gene expression by IL-1l induction.









APPENDIX
EVALUATION OF EFFECTS OF A DIFFERENT PRO-INFLAMMATORY CYTOKINE,
TNF-ALPHA ON MICRO SOMAL PRO STAGLANDIN SYNTHASE-1

Introduction

Analysis of Microsomal PGES-1 Expression and Promoter Activity in Human Breast
Cancer Cells

Breast cancer is one of the leading causes of death in women and the third leading cause of

cancer deaths in the US (304). At the cellular level, many factors are involved in the regulation,

genetic and epigenetic changes associated with breast cancer, invasiveness and eventual

prognosis of this disease. Some breast cancers can be classified based on estrogen receptor

status, ER+ or ER- and the hormone estrogen is speculated to stimulate the proliferation of breast

cancer cells (305,306).

Estrogen has been shown to up-regulate a number of genes that are involved in the

proliferation and survival of breast cancer cells. Aromatase activity is known to induce estrogen

biosynthesis in breast cancer and PGE2, a bi-product of arachidonic acid metabolism regulates

aromatase expression (307,308). Two studies revealed mPGES-1 is expressed in breast cancer

cell lines versus normal tissue and further, mPGES-1 expression in tumors is associated with

estrogen up-regulation (223,309).

Recently, Frasor et al. (209) delineated that the inducible PGE2 synthase, mPGES-1, is an

ER target gene that is up-regulated in the breast cancer cell line, MCF-7, following estrogen and

cytokine stimulation. An estrogen response element (ERE) was identified in the promoter region

of mPGES-1 and subsequent analyses revealed that estradiol stimulated promoter activation.

Further, co-treatment with the pro-inflammatory cytokine, TNF-a and estradiol caused a

synergistic up-regulation of mPGES-1 expression. Catley et al. (310) implicated a role for NF-

KB activation in regulating the cytokine-dependent induction of mPGES-1. In the absence of









estradiol, the data presented by Frasor et al. (209) illustrated that while a IKKj-dominant

negative construct reduced the synergistic up-regulation of mPGES-1 expression by co-treatment

with estradiol and TNF-a, no induction of mPGES-1 gene expression was seen with TNF-a

alone. This implies that NF-KB is not required for the TNF-a-mediated induction of mPGES-1

and that there may be other elements within the mPGES-1 genome that could potentially

contribute to the TNF-a induction.

Results

TNF-a Induces Microsomal PGES-1 Gene Expression in a Time-Dependent and Cell-
Specific Manner

In an attempt to elucidate the mechanism of mPGES-1 transcriptional activation following

TNF-a treatment in the MCF-7 breast cancer cell line, cells were stimulated with TNF-a. Figure

A-i illustrates that TNF-a increased mPGES-1 mRNA expression about ~9 fold. Alternatively,

in HFL-1 cells (normal lung fibroblast cell line) TNF-a stimulated a moderate increase in

mPGES-1 levels, about -4.5 fold. Together the data illustrates that TNF-a can induce mPGES-1

gene expression in a time-dependent and potentially cell-specific manner.

Analysis of the Activation of the Distal Hypersensitive Site (HS2) by TNF-a

The distal hypersensitive site, HS2, in the promoter region of mPGES-1 was recently

evaluated for cytokine-induced activation of mPGES-1 gene expression. Therefore, the HS2

fragment (-10.7 to -6.4 kb) driving growth hormone expression was evaluated in MCF-7 cells

following induction by TNF-a. The results illustrated in Figure A-2 reveal that wild type

promoter activity was not induced by TNF-a, but in the presence of the HS2 fragment, there was

an increase in basal expression in the absence of TNF-a followed by a subsequent increase in the

induced expression.









Identification of TNF-a Responsive Regulatory Elements within HS2

Sub-fragments of HS2 were previously generated and evaluated for expression in response

to another pro-inflammatory cytokine, IL-10. Due to the TNF-a-mediated induction of the large

HS2 fragment, the sub-fragments were next evaluated for TNF-a-responsiveness. The following

fragments were evaluated for growth hormone expression: (-10.1 to -9.0 kb), (-8.6 to -6.4 kb), (-

8.6 to -8.1 kb) and (-7.6 to -6.4 kb). Figure A-3 reveals that the (-10.1 to -9.0 kb) sub-fragment

exhibited an increase in both the basal and induced expression compared to the wild type

promoter construct following TNF-a. Further, none of the other fragments which previously

showed a significant increase in response to IL-1 treatment responded favorably to TNF-a.

Discussion

In breast cancer versus normal breast tissue, mPGES-1 is known to be highly up-regulated.

The steroid hormone, estrogen is known to be active in breast cancer and a literature search

revealed a number of studies illustrating a role for estrogen in mPGES-1 gene activation and

expression in both a cytokine-dependent and independent manner. Within the mPGES-1

proximal promoter region, an ERE was identified and deemed important for mPGES-1 gene

activation following estradiol treatment (209). This estradiol-induction was further enhanced by

treatment with the pro-inflammatory cytokine, TNF-a. Alternatively, TNF-a alone, was not able

to induce promoter activation and the transcription factor, NFRB was found to have no effect on

TNF-a mediated induction of mPGES-1.

In Chapter 4 a distal hypersensitive site, HS2 was identified by DNase I hypersensitive site

analysis and it was found to contain IL-10-responsive element which is required for mPGES-1

gene induction by IL-10. Therefore, HS2 was evaluated for TNF-a mediated induction of

mPGES-1 gene expression. The preliminary data indicates that while the endogenous promoter

construct is not activated by TNF-a, the presence of HS2 lead to a significant increase in both









basal and inducible activity following TNF-a treatment. Further analysis of HS2 sub-fragments

revealed a potential element within the 5'region of HS2 that is extremely responsive to TNF-a,

while analysis of the 3' end of HS2 yielded no significantly active elements. Therefore a finer

analysis of the entire HS2 fragment is needed to efficiently delineate the location of the highly

responsive basal element and further elucidate the location of an inducible element.














6-
8-









T27-

I 2-

1-


MCF-7
















0




HFL-1


6 8


Time (h)


2 4


6 8


Time (h)


Figure A-1. TNF-a induces mPGES-1 gene expression in a time dependent and cell-specific
manner. MCF-7 and HFL-1 cells were stimulated with 10 ng/mL TNF-a, total RNA
was isolated and analyzed by real-time RT-PCR.


2 4


0 I-


6-


i 5-
o


0
54-


2 3-
o

I2-


ll-


0o--


--


I












3.5 -

E
3-




"a 2-
0
S. 1.5


2 2 -
6 1
O'.4


0.5


0


* Untreated
* TNFa (6h)


1.1 + (-10.7 to -6.4)


Figure A-2. Analysis of the activation of the distal hypersensitive site (HS2) by TNF-a. MCF-7
cells were transiently transfected with the indicated fragments. 46 h later total RNA
was isolated from cells stimulated with or without TNF-a and analyzed by real-time
RT-PCR. The mPGES-1/cyclophilin A ratio of untreated cells was set to 1. The
graph depicts a summary of three independent experiments, where the data points are
represented as mean SEM (standard error of the mean). The asterisk (*) indicates
statistical significance p value < 0.05 as compared with the untreated wild type
promoter samples.










" Untreated
STNFa (6h)


1.1 +(-
10.7 to -
6.4)


1.1 + (-
10.1 to -
9.0)


n=2


1.1 + (-8.6 1.1 + (-8.6 1.1 + (-7.6
to -6.4) to -8.1) to -6.4)


Figure A-3. Identification of TNF-a responsive regulatory elements within HS2. Real-time
analysis of MCF-7 cells transiently transfected with the indicated fragments.


:5

4-
0r
2 3 -


. 2-









LIST OF REFERENCES


1. Botting, R. (2004) Front Biosci 9, 956-966

2. Brash, A. R. (2001) The Journal of clinical investigation 107(11), 1339-1345

3. Charbeneau, R. P., and Peters-Golden, M. (2005) Clin Sci (Lond) 108(6), 479-491

4. Kuitert, L. M., Newton, R., Barnes, N. C., Adcock, I. M., and Barnes, P. J. (1996) Thorax
51(12), 1223-1228

5. Hart, P. H. (2001) Immunol CellBiol 79(2), 149-153

6. Brenneis, C., Maier, T. J., Schmidt, R., Hofacker, A., Zulauf, L., Jakobsson, P. J.,
Scholich, K., and Geisslinger, G. (2006) Faseb J 20(9), 1352-1360

7. Samuelsson, B., Morgenstern, R., and Jakobsson, P. J. (2007) Pharmacological reviews
59(3), 207-224

8. Drazen, J. M. (2003) Advances in experimental medicine and biology 525, 1-5

9. Funk, C. D., and FitzGerald, G. A. (2007) Journal of cardiovascular pharmacology 50(5),
470-479

10. Cipollone, F. (2005) Lupus 14(9), 756-759

11. Harris, S. G., Padilla, J., Koumas, L., Ray, D., and Phipps, R. P. (2002) Trends in
immunology 23(3), 144-150

12. Hartney, J. M., Coggins, K. G., Tilley, S. L., Jania, L. A., Lovgren, A. K., Audoly, L. P.,
and Koller, B. H. (2006) Americanjournal ofphysiology 290(1), L105-113

13. Iversen, L., and Kragballe, K. (2000) Prostaglandins & other lipid mediators 63(1-2), 25-
42

14. Narumiya, S. (2003) Life sciences 74(2-3), 391-395

15. Vancheri, C., Mastruzzo, C., Sortino, M. A., and Crimi, N. (2004) Trends in immunology
25(1), 40-46

16. Wang, D., Wang, M., Cheng, Y., and Fitzgerald, G. A. (2005) Current opinion in
pharmacology 5(2), 204-210

17. Moonen, P., Buytenhek, M., and Nugteren, D. H. (1982) Methods in enzymology 86, 84-91

18. Smith, W. L. (1989) The Biochemicaljournal 259(2), 315-324









19. Smith, W. L. (1992) The American journal ofphysiology 263(2 Pt 2), F181-191

20. Wang, D., Mann, J. R., and DuBois, R. N. (2005) Gastroenterology 128(5), 1445-1461

21. Narumiya, S., Sugimoto, Y., and Ushikubi, F. (1999) Physiological reviews 79(4), 1193-
1226

22. Smyth, E. M., Grosser, T., Wang, M., Yu, Y., and FitzGerald, G. A. (2009) Journal of
lipidresearch 50 Suppl, S423-428

23. Funk, C. D. (2001) Science (New York, N. Y 294(5 548), 1871-1875

24. Miller, S. B. (2006) Seminars in arthritis and rheumatism 36(1), 37-49

25. Matsuoka, T., Hirata, M., Tanaka, H., Takahashi, Y., Murata, T., Kabashima, K.,
Sugimoto, Y., Kobayashi, T., Ushikubi, F., Aze, Y., Eguchi, N., Urade, Y., Yoshida, N.,
Kimura, K., Mizoguchi, A., Honda, Y., Nagai, H., and Narumiya, S. (2000) Science (New
York, N.Y287(5460), 2013-2017

26. Powell, W. S. (2003) Prostaglandins, leukotrienes, and essentialfatty acids 69(2-3), 179-
185

27. Hayaishi, 0. (1991) Faseb J 5(11), 2575-2581

28. Hayaishi, 0., Matsumura, H., Onoe, H., Koyama, Y., and Watanabe, Y. (199 1) Advances
in prostaglandin, thromboxane, and leukotriene research 21B, 723-726

29. Hamberg, M., Svensson, J., and Samuelsson, B. (1975) Proceedings of the National
Academy of Sciences of the United States ofAmerica 72(8), 2994-2998

30. Patrono, C. (1990) Circulation 81(1 Suppl), 112-15; discussion 122-13

31. Lim, H., Gupta, R. A., Ma, W. G., Paria, B. C., Moller, D. E., Morrow, J. D., DuBois, R.
N., Trzaskos, J. M., and Dey, S. K. (1999) Genes & development 13(12), 1561-1574

32. Huang, J. C., Arbab, F., Tumbusch, K. J., Goldsby, J. S., Matijevic-Aleksic, N., and Wu,
K. K. (2002) The Journal of clinical endocrinology and metabolism 87(9), 4361-4368

33. Lim, H., and Dey, S. K. (2002) Endocrinology 143(9), 3207-3210

34. Ivanov, A. I., and Romanovsky, A. A. (2004) Front Biosci 9, 1977-1993

35. Romanovsky, A. A., Almeida, M. C., Aronoff, D. M., Ivanov, A. I., Konsman, J. P.,
Steiner, A. A., and Turek, V. F. (2005) Front Biosci 10, 2193-2216

36. Corson, S. L., and Bolognese, R. J. (1975) The Journal of reproductive medicine 14(2), 43-
46









37. Tilley, S. L., Audoly, L. P., Hicks, E. H., Kim, H. S., Flannery, P. J., Coffman, T. M., and
Koller, B. H. (1999) The Journal of clinical investigation 103(11), 1539-1545

38. Stock, J. L., Shinjo, K., Burkhardt, J., Roach, M., Taniguchi, K., Ishikawa, T., Kim, H. S.,
Flannery, P. J., Coffman, T. M., McNeish, J. D., and Audoly, L. P. (2001) The Journal of
clinical investigation 107(3), 325-331

39. Martey, C. A., Pollock, S. J., Turner, C. K., O'Reilly, K. M., Baglole, C. J., Phipps, R. P.,
and Sime, P. J. (2004) Americanjournal ofphysiology 287(5), L981-991

40. Matsumura, K., and Kobayashi, S. (2004) Front Biosci 9, 2819-2826

41. Tapiero, H., Ba, G. N., Couvreur, P., and Tew, K. D. (2002) Biomedicine &
pharmacotherapy = Biomedecine & ph/ii uhi t'( /l'i/iwp' 56(5), 215-222

42. Senior, J., Sangha, R., Baxter, G. S., Marshall, K., and Clayton, J. K. (1992) British
journal ofpharmacology 107(1), 215-221

43. Fuchs, A. R. (1987) Journal of steroid biochemistry 27(4-6), 1073-1080

44. Rolin, S., Masereel, B., and Dogne, J. M. (2006) European journal ofpharmacology
533(1-3), 89-100

45. Vignola, A. M., Mirabella, F., Costanzo, G., Di Giorgi, R., Gjomarkaj, M., Bellia, V., and
Bonsignore, G. (2003) Chest 123(3 Suppl), 417S-422S

46. Hossain, S. (1973) The American review ofrespiratory disease 107(1), 99-109

47. Jeffery, P. K., Wardlaw, A. J., Nelson, F. C., Collins, J. V., and Kay, A. B. (1989) The
American review of respiratory disease 140(6), 1745-1753

48. Emery, D. L., Djokic, T. D., Graf, P. D., and Nadel, J. A. (1989) JAppl Physiol 67(3),
959-962

49. Hardy, C. C., Robinson, C., Tattersfield, A. E., and Holgate, S. T. (1984) The New
England journal of medicine 311(4), 209-213

50. Kumlin, M., Dahlen, B., Bjorck, T., Zetterstrom, 0., Granstrom, E., and Dahlen, S. E.
(1992) The American review of respiratory disease 146(1), 96-103

51. Wenzel, S. E., Westcott, J. Y., Smith, H. R., and Larsen, G. L. (1989) The American
review of respiratory disease 139(2), 450-457

52. Huszar, E., Szabo, Z., Jakab, A., Barta, I., Herjavecz, I., and Horvath, I. (2005) Inflamm
Res 54(8), 350-355

53. Davi, G., Basili, S., Vieri, M., Cipollone, F., Santarone, S., Alessandri, C., Gazzaniga, P.,
Cordova, C., and Violi, F. (1997) American journal ofrespiratory and critical care
medicine 156(6), 1794-1799









54. Ghosh, M., Stewart, A., Tucker, D. E., Bonventre, J. V., Murphy, R. C., and Leslie, C. C.
(2004) American journal of respiratory cell and molecular biology 30(1), 91-100

55. Hempel, S. L., Monick, M. M., and Hunninghake, G. W. (1994) The Journal of clinical
investigation 93(1), 391-396

56. Jackson, B. A., Goldstein, R. H., Roy, R., Cozzani, M., Taylor, L., and Polgar, P. (1993)
Biochemical and biophysical research communications 197(3), 1465-1474

57. Mitchell, J. A., Belvisi, M. G., Akarasereenont, P., Robbins, R. A., Kwon, 0. J., Croxtall,
J., Barnes, P. J., and Vane, J. R. (1994) Britishjournal ofpharmacology 113(3), 1008-
1014

58. Kohyama, T., Ertl, R. F., Valenti, V., Spurzem, J., Kawamoto, M., Nakamura, Y., Veys,
T., Allegra, L., Romberger, D., and Rennard, S. I. (2001) American journal ofphysiology
281(5), L1257-1263

59. Elias, J. A., Rossman, M. D., Zurier, R. B., and Daniele, R. P. (1985) The American review
ofrespiratory disease 131(1), 94-99

60. Goldstein, R. H., and Polgar, P. (1982) The Journal of biological chemistry 257(15), 8630-
8633

61. Koyama, S., Sato, E., Masubuchi, T., Takamizawa, A., Nomura, H., Kubo, K., Nagai, S.,
and Izumi, T. (1998) The American journal ofphysiology 275(2 Pt 1), L223-230

62. Palmantier, R., and Borgeat, P. (1991) Britishjournal ofpharmacology 103(4), 1909-1916

63. Fiore, S., and Serhan, C. N. (1990) The Journal of experimental medicine 172(5), 1451-
1457

64. Baud, L., Perez, J., Denis, M., and Ardaillou, R. (1987) JImmunol 138(4), 1190-1195

65. Phan, S. H., McGarry, B. M., Loeffler, K. M., and Kunkel, S. L. (1988) Biochemistry
27(8), 2846-2853

66. Wenzel, S. E. (2003) Prostaglandins, leukotrienes, and essentialfatty acids 69(2-3), 145-
155

67. Steinhilber, D. (1999) Curr Med Chem 6(1), 71-85

68. Drazen, J. M., Israel, E., and O'Byrne, P. M. (1999) The New England journal of medicine
340(3), 197-206

69. Drazen, J. M. (1999) Proceedings of the Association ofAmerican Physicians 111(6), 547-
559









70. Peters-Golden, M., Bailie, M., Marshall, T., Wilke, C., Phan, S. H., Toews, G. B., and
Moore, B. B. (2002) American journal of respiratory and critical care medicine 165(2),
229-235

71. Das, U. N. (2006) Biotechnology journal 1(4), 420-43 9

72. Soberman, R. J., and Christmas, P. (2003) The Journal of clinical investigation 111(8),
1107-1113

73. Sublette, M. E., Russ, M. J., and Smith, G. S. (2004) Bipolar disorders 6(2), 95-105

74. Chakraborti, S. (2003) Cellular signalling 15(7), 63 7-665

75. Schaloske, R. H., and Dennis, E. A. (2006) Biochimica et biophysica acta 1761(11), 1246-
1259

76. Taketo, M. M., and Sonoshita, M. (2002) Biochimica et biophysica acta 1585(2-3), 72-76

77. Diaz, B. L., and Arm, J. P. (2003) Prostaglandins, leukotrienes, and essentialfatty acids
69(2-3), 87-97

78. Menschikowski, M., Hagelgans, A., and Siegert, G. (2006) Prostaglandins & other lipid
mediators 79(1-2), 1-33

79. Murakami, M. (2004) Biological & pharmaceutical bulletin 27(8), 1179-1182

80. Murakami, M., and Kudo, I. (2004) Biological & pharmaceutical bulletin 27(8), 1158-
1164

81. Triggiani, M., Granata, F., Giannattasio, G., and Marone, G. (2005) The Journal of allergy
and clinical immunology 116(5), 1000-1006

82. Ghosh, M., Tucker, D. E., Burchett, S. A., and Leslie, C. C. (2006) Progress in lipid
research 45(6), 487-510

83. Bonventre, J. V., and Sapirstein, A. (2002) Advances in experimental medicine and biology
507, 25-31

84. Clark, J. D., Schievella, A. R., Nalefski, E. A., and Lin, L. L. (1995) Journal of lipid
mediators and cell signalling 12(2-3), 83-117

85. Balsinde, J., Perez, R., and Balboa, M. A. (2006) Biochimica et biophysica acta 1761(11),
1344-1350

86. McHowat, J., and Creer, M. H. (2004) Current medicinal chemistry 2(3), 209-218

87. Burke, J. E., and Dennis, E. A. (2009) Cardiovascular drugs and therapy/sponsored by
the International Society of Cardiovascular Pharmacotherapy 23(1), 49-59


149









88. Dennis, E. A. (1994) The Journal of biological chemistry 269(18), 13057-13060

89. Six, D. A., and Dennis, E. A. (2000) Biochimica et biophysica acta 1488(1-2), 1-19

90. Kita, Y., Ohto, T., Uozumi, N., and Shimizu, T. (2006) Biochimica et biophysica acta
1761(11), 1317-1322

91. Murakami, M., and Kudo, I. (2002) Journal of biochemistry 131(3), 285-292

92. Underwood, K. W., Song, C., Kriz, R. W., Chang, X. J., Knopf, J. L., and Lin, L. L. (1998)
The Journal of biological chemistry 273(34), 21926-21932

93. Miyashita, A., Crystal, R. G., and Hay, J. G. (1995) Nucleic acids research 23(2), 293-301

94. Leslie, C. C. (1997) The Journal of biological chemistry 272(27), 16709-16712

95. Leslie, C. C. (2004) Prostaglandins, leukotrienes, and essential fatty acids 70(4), 373-376

96. Dolan-O'Keefe, M., Chow, V., Monnier, J., Visner, G. A., and Nick, H. S. (2000)
American journal ofphysiology 278(4), L649-657

97. Hansen, W. R., Drew, A., Helsby, N., Keelan, J. A., Sato, T. A., and Mitchell, M. D.
(1999) Placenta 20(4), 303-308

98. Lal, M. A., Kennedy, C. R., Proulx, P. R., and Hebert, R. L. (1997) The American journal
ofphysiology 273(6 Pt 2), F907-915

99. Newton, R., Kuitert, L. M., Slater, D. M., Adcock, I. M., and Barnes, P. J. (1997) Life
sciences 60(1), 67-78

100. Xu, X. X., Rock, C. 0., Qiu, Z. H., Leslie, C. C., and Jackowski, S. (1994) The Journal of
biological chemistry 269(50), 31693-31700

101. Keelan, J. A., Sato, T. A., Hansen, W. R., Gilmour, J. S., Gupta, D. K., Helsby, N. A., and
Mitchell, M. D. (1999) Prostaglandins, leukotrienes, and essential fatty acids 60(4), 255-
262

102. Kuroda, A., Sugiyama, E., Taki, H., Mino, T., and Kobayashi, M. (1997) Biochemical and
biophysical research communications 230(1), 40-43

103. Murakami, M., Penrose, J. F., Urade, Y., Austen, K. F., and Arm, J. P. (1995) Proceedings
of the National Academy of Sciences of the United States of America 92(13), 6107-6111

104. Lin, L. L., Wartmann, M., Lin, A. Y., Knopf, J. L., Seth, A., and Davis, R. J. (1993) Cell
72(2), 269-278

105. Kudo, I., and Murakami, M. (2002) Prostaglandins & other lipid mediators 68-69, 3-58









106. Borsch-Haubold, A. G., Bartoli, F., Asselin, J., Dudler, T., Kramer, R. M., Apitz-Castro,
R., Watson, S. P., and Gelb, M. H. (1998) The Journal of biological chemistry 273(8),
4449-4458

107. de Carvalho, M. G., McCormack, A. L., Olson, E., Ghomashchi, F., Gelb, M. H., Yates, J.
R., 3rd, and Leslie, C. C. (1996) The Journal of biological chemistry 271(12), 6987-6997

108. Hefner, Y., Borsch-Haubold, A. G., Murakami, M., Wilde, J. I., Pasquet, S., Schieltz, D.,
Ghomashchi, F., Yates, J. R., 3rd, Armstrong, C. G., Paterson, A., Cohen, P., Fukunaga,
R., Hunter, T., Kudo, I., Watson, S. P., and Gelb, M. H. (2000) The Journal of biological
chemistry 275(48), 37542-37551

109. Gijon, M. A., Spencer, D. M., Kaiser, A. L., and Leslie, C. C. (1999) The Journal of cell
biology 145(6), 1219-1232

110. Peters-Golden, M., Song, K., Marshall, T., and Brock, T. (1996) The Biochemical journal
318 (Pt 3), 797-803

111. Uozumi, N., and Shimizu, T. (2002) Prostaglandins & other lipid mediators 68-69, 59-69

112. Schievella, A. R., Regier, M. K., Smith, W. L., and Lin, L. L. (1995) The Journal of
biological chemistry 270(51), 30749-30754

113. Hirabayashi, T., Murayama, T., and Shimizu, T. (2004) Biological & pharmaceutical
bulletin 27(8), 1168-1173

114. Sierra-Honigmann, M. R., Bradley, J. R., and Pober, J. S. (1996) Laboratory investigation;
a journal of technical methods and pathology 74(3), 684-695

115. Yu, W., Bozza, P. T., Tzizik, D. M., Gray, J. P., Cassara, J., Dvorak, A. M., and Weller, P.
F. (1998) The American journal ofpathology 152(3), 759-769

116. Huang, X. L., Pawliczak, R., Cowan, M. J., Gladwin, M. T., Madara, P., Logun, C., and
Shelhamer, J. H. (2002) The Journal of biological chemistry 277(41), 38431-38440

117. Uozumi, N., Kume, K., Nagase, T., Nakatani, N., Ishii, S., Tashiro, F., Komagata, Y.,
Maki, K., Ikuta, K., Ouchi, Y., Miyazaki, J., and Shimizu, T. (1997) Nature 390(6660),
618-622

118. Bonventre, J. V., Huang, Z., Taheri, M. R., O'Leary, E., Li, E., Moskowitz, M. A., and
Sapirstein, A. (1997) Nature 390(6660), 622-625

119. Downey, P., Sapirstein, A., O'Leary, E., Sun, T. X., Brown, D., and Bonventre, J. V.
(2001) Am JPhysiol Renal Physiol 280(4), F607-618

120. Hong, K. H., Bonventre, J. C., O'Leary, E., Bonventre, J. V., and Lander, E. S. (2001)
Proceedings of the National Academy of Sciences of the United States of America 98(7),
3935-3939









121. Marusic, S., Leach, M. W., Pelker, J. W., Azoitei, M. L., Uozumi, N., Cui, J., Shen, M. W.,
DeClercq, C. M., Miyashiro, J. S., Carito, B. A., Thakker, P., Simmons, D. L., Leonard, J.
P., Shimizu, T., and Clark, J. D. (2005) The Journal of experimental medicine 202(6), 841-
851

122. Klivenyi, P., Beal, M. F., Ferrante, R. J., Andreassen, 0. A., Wermer, M., Chin, M. R., and
Bonventre, J. V. (1998) Journal ofneurochemistry 71(6), 2634-2637

123. Hegen, M., Sun, L., Uozumi, N., Kume, K., Goad, M. E., Nickerson-Nutter, C. L.,
Shimizu, T., and Clark, J. D. (2003) The Journal of experimental medicine 197(10), 1297-
1302

124. Ii, H., Hontani, N., Toshida, I., Oka, M., Sato, T., and Akiba, S. (2008) Biological &
pharmaceutical bulletin 31(3), 363-368

125. Balestrieri, B., Hsu, V. W., Gilbert, H., Leslie, C. C., Han, W. K., Bonventre, J. V., and
Arm, J. P. (2006) The Journal of biological chemistry 281(10), 6691-6698

126. Yamamoto, S. (1992) Biochimica et biophysica acta 1128(2-3), 117-131

127. Mahipal, S. V., Subhashini, J., Reddy, M. C., Reddy, M. M., Anilkumar, K., Roy, K. R.,
Reddy, G. V., and Reddanna, P. (2007) Biochemicalpharmacology 74(2), 202-214

128. Kim, C., Kim, J. Y., and Kim, J. H. (2008) BMB reports 41(8), 555-559

129. Shureiqi, I., and Lippman, S. M. (2001) Cancer Res 61(17), 6307-6312

130. Funk, C. D., Chen, X. S., Johnson, E. N., and Zhao, L. (2002) Prostaglandins & other lipid
mediators 68-69, 303-312

131. Radmark, 0., Werz, 0., Steinhilber, D., and Samuelsson, B. (2007) Trends in biochemical
sciences 32(7), 332-341

132. Brash, A. R., Boeglin, W. E., and Chang, M. S. (1997) Proceedings of the National
Academy of Sciences of the United States ofAmerica 94(12), 6148-6152

133. Koshino, T., Takano, S., Houjo, T., Sano, Y., Kudo, K., Kihara, H., Kitani, S., Takaishi,
T., Hirai, K., Ito, K., and Morita, Y. (1998) Biochemical and biophysical research
communications 247(2), 510-513

134. Spanbroek, R., Grabner, R., Lotzer, K., Hildner, M., Urbach, A., Ruhling, K., Moos, M. P.,
Kaiser, B., Cohnert, T. U., Wahlers, T., Zieske, A., Plenz, G., Robenek, H., Salbach, P.,
Kuhn, H., Radmark, 0., Samuelsson, B., and Habenicht, A. J. (2003) Proceedings of the
National Academy of Sciences of the United States ofAmerica 100(3), 123 8-1243

135. Samuelsson, B., Dahlen, S. E., Lindgren, J. A., Rouzer, C. A., and Serhan, C. N. (1987)
Science (New York, N. Y237(4819), 1171-1176









136. Chang, M. S., Schneider, C., Roberts, R. L., Shappell, S. B., Haselton, F. R., Boeglin, W.
E., and Brash, A. R. (2005) Investigative ophthalmology & visual science 46(3), 849-856

137. Brash, A. R., Jisaka, M., Boeglin, W. E., and Chang, M. S. (1999) Advances in
experimental medicine and biology 447, 29-36

138. Kelavkar, U. P., and Cohen, C. (2004) Neoplasia (New York, N. Y 6(1), 41-52

139. Cesano, A., Visonneau, S., Scimeca, J. A., Kritchevsky, D., and Santoli, D. (1998)
Anticancer Res 18(3A), 1429-1434

140. Ikawa, H., Kamitani, H., Calvo, B. F., Foley, J. F., and Eling, T. E. (1999) Cancer Res
59(2), 360-366

141. Nadel, J. A., Conrad, D. J., Ueki, I. F., Schuster, A., and Sigal, E. (1991) The Journal of
clinical investigation 87(4), 1139-1145

142. MacMillan, D. K., Hill, E., Sala, A., Sigal, E., Shuman, T., Henson, P. M., and Murphy, R.
C. (1994) The Journal of biological chemistry 269(43), 26663-26668

143. Smith, W. L., DeWitt, D. L., and Garavito, R. M. (2000) Annual review of biochemistry
69, 145-182

144. Chandrasekharan, N. V., Dai, H., Roos, K. L., Evanson, N. K., Tomsik, J., Elton, T. S., and
Simmons, D. L. (2002) Proceedings of the National Academy of Sciences of the United
States ofAmerica 99(21), 13926-13931

145. Diaz, A., Chepenik, K. P., Korn, J. H., Reginato, A. M., and Jimenez, S. A. (1998)
Experimental cell research 241(1), 222-229

146. Smith, C. J., Morrow, J. D., Roberts, L. J., 2nd, and Marnett, L. J. (1993) Biochemical and
biophysical research communications 192(2), 787-793

147. Ueda, N., Yamashita, R., Yamamoto, S., and Ishimura, K. (1997) Biochimica et biophysica
acta 1344(1), 103-110

148. Xu, X. M., Tang, J. L., Chen, X., Wang, L. H., and Wu, K. K. (1997) The Journal of
biological chemistry 272(11), 6943-6950

149. Asano, K., Lilly, C. M., and Drazen, J. M. (1996) The American journal ofphysiology
271(1 Pt 1), L126-131

150. Choi, S. H., Langenbach, R., and Bosetti, F. (2006) Journal ofneurochemistry 98(3), 801-
811

151. Harris, R. C., and Breyer, M. D. (2001)Am JPhysiol Renal Physiol 281(1), Fl-11

152. Lama, V., Moore, B. B., Christensen, P., Toews, G. B., and Peters-Golden, M. (2002)
American journal ofrespiratory cell and molecular biology 27(6), 752-758









153. Gavett, S. H., Madison, S. L., Chulada, P. C., Scarborough, P. E., Qu, W., Boyle, J. E.,
Tiano, H. F., Lee, C. A., Langenbach, R., Roggli, V. L., and Zeldin, D. C. (1999) The
Journal of clinical investigation 104(6), 721-732

154. Zeldin, D. C., Wohlford-Lenane, C., Chulada, P., Bradbury, J. A., Scarborough, P. E.,
Roggli, V., Langenbach, R., and Schwartz, D. A. (2001) American journal ofrespiratory
cell and molecular biology 25(4), 457-465

155. Tanabe, T., and Tohnai, N. (2002) Prostaglandins & other lipid mediators 68-69, 95-114

156. Yamamoto, K., Arakawa, T., Ueda, N., and Yamamoto, S. (1995) The Journal of
biological chemistry 270(52), 31315-31320

157. Chun, K. S., and Surh, Y. J. (2004) Biochemicalpharmacology 68(6), 1089-1100

158. Zhu, Y., Saunders, M. A., Yeh, H., Deng, W. G., and Wu, K. K. (2002) The Journal of
biological chemistry 277(9), 6923-6928

159. Deng, W. G., Zhu, Y., and Wu, K. K. (2004) Blood 103(6), 2135-2142

160. Nie, M., Pang, L., Inoue, H., and Knox, A. J. (2003) Molecular and cellular biology
23(24), 9233-9244

161. Wu, G., Mannam, A. P., Wu, J., Kirbis, S., Shie, J. L., Chen, C., Laham, R. J., Sellke, F.
W., and Li, J. (2003) Am JPhysiolHeart Circ Physiol 285(6), H2420-2429

162. Chen, B. C., Chang, Y. S., Kang, J. C., Hsu, M. J., Sheu, J. R., Chen, T. L., Teng, C. M.,
and Lin, C. H. (2004) The Journal of biological chemistry 279(20), 20889-20897

163. Dean, J. L., Brook, M., Clark, A. R., and Saklatvala, J. (1999) The Journal of biological
chemistry 274(1), 264-269

164. Xie, W., and Herschman, H. R. (1995) The Journal of biological chemistry 270(46),
27622-27628

165. Catella-Lawson, F. (2001) Neurology 57(5 Suppl 2), S5-7

166. Loll, P. J., Picot, D., Ekabo, 0., and Garavito, R. M. (1996) Biochemistry 35(23), 7330-
7340

167. Hippisley-Cox, J., Coupland, C., and Logan, R. (2005) BMJ (Clinical research ed
331(7528), 1310-1316

168. FitzGerald, G. A., and Patrono, C. (2001) The New Englandjournal of medicine 345(6),
433-442

169. Tran, H., and Anand, S. S. (2004) Jama 292(15), 1867-1874









170. Vane, J. R., Flower, R. J., and Botting, R. M. (1990) Stroke; a journal of cerebral
circulation 21(12 Suppl), IV12-23

171. Garcia Rodriguez, L. A., and Jick, H. (1994) Lancet 343(8900), 769-772

172. Teismann, P., and Ferger, B. (2001) Synapse (New York, N.Y39(2), 167-174

173. Negishi, M., Sugimoto, Y., and Ichikawa, A. (1993) Progress in lipid research 32(4), 417-
434

174. Ashby, B. (1994) Receptor 4(1), 31-42

175. Bastien, L., Sawyer, N., Grygorczyk, R., Metters, K. M., and Adam, M. (1994) The
Journal of biological chemistry 269(16), 11873 -11877

176. Thorat, M. A., Morimiya, A., Mehrotra, S., Konger, R., and Badve, S. S. (2008) Mod
Pathol 21(1), 15-21

177. Wilborn, J., Crofford, L. J., Burdick, M. D., Kunkel, S. L., Strieter, R. M., and Peters-
Golden, M. (1995) The Journal of clinical investigation 95(4), 1861-1868

178. Reilly, I. A., and FitzGerald, G. A. (1987) Blood 69(1), 180-186

179. Reilly, I. A., and FitzGerald, G. A. (1988) Drugs 35(2), 154-176

180. Ensor, C. M., and Tai, H. H. (1995) Journal of lipid mediators and cell signalling 12(2-3),
313-319

181. Yan, M., Rerko, R. M., Platzer, P., Dawson, D., Willis, J., Tong, M., Lawrence, E.,
Lutterbaugh, J., Lu, S., Willson, J. K., Luo, G., Hensold, J., Tai, H. H., Wilson, K., and
Markowitz, S. D. (2004) Proceedings of the NationalAcademy of Sciences of the United
States ofAmerica 101(50), 17468-17473

182. Segi, E., Sugimoto, Y., Yamasaki, A., Aze, Y., Oida, H., Nishimura, T., Murata, T.,
Matsuoka, T., Ushikubi, F., Hirose, M., Tanaka, T., Yoshida, N., Narumiya, S., and
Ichikawa, A. (1998) Biochemical and biophysical research communications 246(1), 7-12

183. Ushikubi, F., Segi, E., Sugimoto, Y., Murata, T., Matsuoka, T., Kobayashi, T., Hizaki, H.,
Tuboi, K., Katsuyama, M., Ichikawa, A., Tanaka, T., Yoshida, N., and Narumiya, S.
(1998) Nature 395(6699), 281-284

184. Lazarus, M., Yoshida, K., Coppari, R., Bass, C. E., Mochizuki, T., Lowell, B. B., and
Saper, C. B. (2007) Nature neuroscience 10(9), 1131-1133

185. Nakamura, K., Matsumura, K., Kaneko, T., Kobayashi, S., Katoh, H., and Negishi, M.
(2002) JNeurosci 22(11), 4600-4610









186. Audoly, L. P., Tilley, S. L., Goulet, J., Key, M., Nguyen, M., Stock, J. L., McNeish, J. D.,
Koller, B. H., and Coffman, T. M. (1999) The American journal ofphysiology 277(3 Pt 2),
H924-930

187. Hosoi, M., Oka, T., Abe, M., Hori, T., Yamamoto, H., Mine, K., and Kubo, C. (1999) Pain
83(2), 221-227

188. Breyer, M. D., Zhang, Y., Guan, Y. F., Hao, C. M., Hebert, R. L., and Breyer, R. M.
(1998) Kidney Int Suppl 67, S88-94

189. Hockel, G. M., and Cowley, A. W., Jr. (1980) Hypertension 2(4), 529-537

190. Hayashi, S., Noda, Y., Matsumoto, H., and Mori, T. (1987) Gamete research 18(4), 291-
299

191. Hayashi, S., Noda, Y., and Mori, T. (1988) European journal of obstetrics, gynecology,
and reproductive biology 29(4), 287-297

192. Jakobsson, P. J., Thoren, S., Morgenstern, R., and Samuelsson, B. (1999) Proceedings of
the National Academy of Sciences of the United States ofAmerica 96(13), 7220-7225

193. Murakami, M., Naraba, H., Tanioka, T., Semmyo, N., Nakatani, Y., Kojima, F., Ikeda, T.,
Fueki, M., Ueno, A., Oh, S., and Kudo, I. (2000) The Journal of biological chemistry
275(42), 32783-32792

194. Jakobsson, P. J., Morgenstern, R., Mancini, J., Ford-Hutchinson, A., and Persson, B.
(1999) Protein Sci 8(3), 689-692

195. Jakobsson, P. J., Morgenstern, R., Mancini, J., Ford-Hutchinson, A., and Persson, B.
(2000) American journal ofrespiratory and critical care medicine 161(2 Pt 2), S20-24

196. Ouellet, M., Falgueyret, J. P., Ear, P. H., Pen, A., Mancini, J. A., Riendeau, D., and
Percival, M. D. (2002) Protein expression and purification 26(3), 489-495

197. Beuckmann, C. T., Fujimori, K., Urade, Y., and Hayaishi, 0. (2000) Neurochemical
research 25(5), 733-738

198. Murakami, M., Nakatani, Y., Tanioka, T., and Kudo, I. (2002) Prostaglandins & other
lipid mediators 68-69, 383-3 99

199. Yoshimatsu, K., Golijanin, D., Paty, P. B., Soslow, R. A., Jakobsson, P. J., DeLellis, R. A.,
Subbaramaiah, K., and Dannenberg, A. J. (2001) Clin Cancer Res 7(12), 3971-3976

200. Claveau, D., Sirinyan, M., Guay, J., Gordon, R., Chan, C. C., Bureau, Y., Riendeau, D.,
and Mancini, J. A. (2003) JImmunol 170(9), 4738-4744

201. Kojima, F., Naraba, H., Miyamoto, S., Beppu, M., Aoki, H., and Kawai, S. (2004) Arthritis
research & therapy 6(4), R355-365









202. Cipollone, F., Prontera, C., Pini, B., Marini, M., Fazia, M., De Cesare, D., lezzi, A.,
Ucchino, S., Boccoli, G., Saba, V., Chiarelli, F., Cuccurullo, F., and Mezzetti, A. (2001)
Circulation 104(8), 921-927

203. Bosetti, F., Langenbach, R., and Weerasinghe, G. R. (2004) Journal of neurochemistry
91(6), 1389-1397

204. Yuan, C. J., Mandal, A. K., Zhang, Z., and Mukherjee, A. B. (2000) Cancer Res 60(4),
1084-1091

205. Forsberg, L., Leeb, L., Thoren, S., Morgenstern, R., and Jakobsson, P. (2000) FEBS letters
471(1), 78-82

206. Naraba, H., Yokoyama, C., Tago, N., Murakami, M., Kudo, I., Fueki, M., Oh-Ishi, S., and
Tanabe, T. (2002) The Journal of biological chemistry 277(32), 28601-28608

207. Moon, Y., Glasgow, W. C., and Eling, T. E. (2005) The Journal ofpharmacology and
experimental i/li' qk'I/ik \ 315(2), 788-795

208. Ackerman, W. E. t., Summerfield, T. L., Vandre, D. D., Robinson, J. M., and Kniss, D. A.
(2008) Biology of reproduction 78(1), 68-76

209. Frasor, J., Weaver, A. E., Pradhan, M., and Mehta, K. (2008) Endocrinology 149(12),
6272-6279

210. Saha, S., Engstrom, L., Mackerlova, L., Jakobsson, P. J., and Blomqvist, A. (2005) Am J
Physiol RegulIntegr Comp Physiol 288(5), RI 100-1107

211. Kamei, D., Yamakawa, K., Takegoshi, Y., Mikami-Nakanishi, M., Nakatani, Y., Oh-Ishi,
S., Yasui, H., Azuma, Y., Hirasawa, N., Ohuchi, K., Kawaguchi, H., Ishikawa, Y., Ishii,
T., Uematsu, S., Akira, S., Murakami, M., and Kudo, I. (2004) The Journal of biological
chemistry 279(32), 33684-33695

212. Jia, Z., Zhang, A., Zhang, H., Dong, Z., and Yang, T. (2006) Circulation research 99(11),
1243-1251

213. Degousee, N., Fazel, S., Angoulvant, D., Stefanski, E., Pawelzik, S. C., Korotkova, M.,
Arab, S., Liu, P., Lindsay, T. F., Zhuo, S., Butany, J., Li, R. K., Audoly, L., Schmidt, R.,
Angioni, C., Geisslinger, G., Jakobsson, P. J., and Rubin, B. B. (2008) Circulation
117(13), 1701-1710

214. Elander, L., Engstrom, L., Hallbeck, M., and Blomqvist, A. (2007) Am JPhysiolRegul
Integr Comp Physiol 292(1), R258-267

215. Levine, A. S., and Morley, J. E. (1981) Pharmacology, biochemistry, and behavior 15(5),
735-738









216. Pecchi, E., Dallaporta, M., Thirion, S., Salvat, C., Berenbaum, F., Jean, A., and Troadec, J.
D. (2006) Physiological genomics 25(3), 485-492

217. Mabuchi, T., Kojima, H., Abe, T., Takagi, K., Sakurai, M., Ohmiya, Y., Uematsu, S.,
Akira, S., Watanabe, K., and Ito, S. (2004) Neuroreport 15(9), 1395-1398

218. Trebino, C. E., Stock, J. L., Gibbons, C. P., Naiman, B. M., Wachtmann, T. S., Umland, J.
P., Pandher, K., Lapointe, J. M., Saha, S., Roach, M. L., Carter, D., Thomas, N. A.,
Durtschi, B. A., McNeish, J. D., Hambor, J. E., Jakobsson, P. J., Carty, T. J., Perez, J. R.,
and Audoly, L. P. (2003) Proceedings of the National Academy of Sciences of the United
States ofAmerica 100(15), 9044-9049

219. Ikeda-Matsuo, Y., Ikegaya, Y., Matsuki, N., Uematsu, S., Akira, S., and Sasaki, Y. (2005)
Journal of neurochemistry 94(6), 1546-1558

220. Kamei, D., Murakami, M., Nakatani, Y., Ishikawa, Y., Ishii, T., and Kudo, I. (2003) The
Journal of biological chemistry 278(21), 19396-19405

221. Puxeddu, E., Mitsutake, N., Knauf, J. A., Moretti, S., Kim, H. W., Seta, K. A., Brockman,
D., Myatt, L., Millhorn, D. E., and Fagin, J. A. (2003) The Journal of biological chemistry
278(52), 52131-52138

222. Martey, C. A., Baglole, C. J., Gasiewicz, T. A., Sime, P. J., and Phipps, R. P. (2005)
American journal ofphysiology 289(3), L3 91-3 99

223. Mehrotra, S., Morimiya, A., Agarwal, B., Konger, R., and Badve, S. (2006) The Journal of
pathology 208(3), 356-363

224. Murakami, M., and Kudo, I. (2006) Current pharmaceutical design 12(8), 943-954

225. Yoshimatsu, K., Altorki, N. K., Golijanin, D., Zhang, F., Jakobsson, P. J., Dannenberg, A.
J., and Subbaramaiah, K. (2001) Clin Cancer Res 7(9), 2669-2674

226. Chang, S. H., Liu, C. H., Conway, R., Han, D. K., Nithipatikom, K., Trifan, 0. C., Lane, T.
F., and Hia, T. (2004) Proceedings of the National Academy of Sciences of the United
States ofAmerica 101(2), 591-596

227. Schug, J. (2003) Using TESS to Predict Transcription Factor Binding Sites in DNA
Sequence, 2003 Ed., J. Wiley and Sons

228. Chomczynski, P., and Sacchi, N. (1987) Analytical biochemistry 162(1), 156-159

229. Lipson, K. E., and Baserga, R. (1989) Proceedings of the NationalAcademy of Sciences of
the United States ofAmerica 86(24), 9774-9777

230. Livak, K. J., and Schmittgen, T. D. (200 1) Methods (San Diego, Calif 25(4), 402-408









231. Boulet, L., Ouellet, M., Bateman, K. P., Ethier, D., Percival, M. D., Riendeau, D., Mancini,
J. A., and Methot, N. (2004) The Journal of biological chemistry 279(22), 23229-23237

232. Engblom, D., Saha, S., Engstrom, L., Westman, M., Audoly, L. P., Jakobsson, P. J., and
Blomqvist, A. (2003) Nature neuroscience 6(11), 1137-1138

233. Degousee, N., Angoulvant, D., Fazel, S., Stefanski, E., Saha, S., Iliescu, K., Lindsay, T. F.,
Fish, J. E., Marsden, P. A., Li, R. K., Audoly, L. P., Jakobsson, P. J., and Rubin, B. B.
(2006) The Journal of biological chemistry 281(24), 16443-16452

234. Subbaramaiah, K., Yoshimatsu, K., Scherl, E., Das, K. M., Glazier, K. D., Golijanin, D.,
Soslow, R. A., Tanabe, T., Naraba, H., and Dannenberg, A. J. (2004) The Journal of
biological chemistry 279(13), 12647-12658

235. Harding, P., Balasubramanian, L., Swegan, J., Stevens, A., and Glass, W. F., 2nd. (2006)
Kidney international 69(9), 1578-1585

236. van Rees, B. P., Sivula, A., Thoren, S., Yokozaki, H., Jakobsson, P. J., Offerhaus, G. J.,
and Ristimaki, A. (2003) Internationaljournal ofcancer 107(4), 551-556

237. Moon, Y., Lee, M., and Yang, H. (2007) Biochemical pharmacology 73(1), 125-135

238. Han, R., Tsui, S., and Smith, T. J. (2002) The Journal of biological chemistry 277(19),
16355-16364

239. Pham, H., Shafer, L. M., and Slice, L. W. (2006) Journal of cellular biochemistry 98(6),
1653-1666

240. Cheng, S., Afif, H., Martel-Pelletier, J., Pelletier, J. P., Li, X., Farrajota, K., Lavigne, M.,
and Fahmi, H. (2004) The Journal of biological chemistry 279(21), 22057-22065

241. Li, X., Afif, H., Cheng, S., Martel-Pelletier, J., Pelletier, J. P., Ranger, P., and Fahmi, H.
(2005) The Journal of rheumatology 32(5), 887-895

242. Chabane, N., Li, X., and Fahmi, H. (2009) Journal of cellular biochemistry 106(3), 453-
463

243. Yucel-Lindberg, T., Olsson, T., and Kawakami, T. (2006) Cellular signalling 18(12),
2131-2142

244. Kawao, N., Nagataki, M., Nagasawa, K., Kubo, S., Cushing, K., Wada, T., Sekiguchi, F.,
Ichida, S., Hollenberg, M. D., MacNaughton, W. K., Nishikawa, H., and Kawabata, A.
(2005) The Journal ofpharmacology and experimental ithel lptinki 315(2), 576-589

245. Wang, H. W., Hsueh, C. T., Lin, C. F., Chou, T. Y., Hsu, W. H., Wang, L. S., and Wu, Y.
C. (2006) Annals of surgical oncology 13(9), 1224-1234

246. Radi, Z. A., and Ostroski, R. (2007) Mediators of inflammation 2007, 85091









247. Nagataki, M., Moriyuki, K., Sekiguchi, F., and Kawabata, A. (2008) Cell biochemistry and
function 26(2), 279-282

248. Weintraub, H., and Groudine, M. (1976) Science (New York, N. Y 193(4256), 848-856

249. Brownell, J. E., Zhou, J., Ranalli, T., Kobayashi, R., Edmondson, D. G., Roth, S. Y., and
Allis, C. D. (1996) Cell 84(6), 843-851

250. Ogryzko, V. V., Schiltz, R. L., Russanova, V., Howard, B. H., and Nakatani, Y. (1996)
Cell 87(5), 953-959

251. Taunton, J., Hassig, C. A., and Schreiber, S. L. (1996) Science (New York, N.Y272(5260),
408-411

252. Wong, J., Patterton, D., Imhof, A., Guschin, D., Shi, Y. B., and Wolffe, A. P. (1998) The
EMBO journal 17(2), 520-534

253. Wu, C., Bingham, P. M., Livak, K. J., Holmgren, R., and Elgin, S. C. (1979) Cell 16(4),
797-806

254. Nyborg, J. K., and Spindler, S. R. (1986) The Journal of biological chemistry 261(13),
5685-5688

255. Gross, D. S., and Garrard, W. T. (1988) Annual review of biochemistry 57, 159-197

256. Gong, Q., and Dean, A. (1993) Molecular and cellular biology 13(2), 911-917

257. Ney, P. A., Sorrentino, B. P., McDonagh, K. T., and Nienhuis, A. W. (1990) Genes &
development 4(6), 993-1006

258. Tuan, D. Y., Solomon, W. B., London, I. M., and Lee, D. P. (1989) Proceedings of the
NationalAcademy of Sciences of the United States ofAmerica 86(8), 2554-2558

259. Blackwood, E. M., and Kadonaga, J. T. (1998) Science (New York, N. Y281(5373), 60-63

260. Gijon, M. A., and Leslie, C. C. (1999) Journal ofleukocyte biology 65(3), 330-336

261. Evans, J. H., Spencer, D. M., Zweifach, A., and Leslie, C. C. (2001) The Journal of
biological chemistry 276(32), 30150-30160

262. Hirabayashi, T., Kume, K., Hirose, K., Yokomizo, T., lino, M., Itoh, H., and Shimizu, T.
(1999) The Journal of biological chemistry 274(8), 5163-5169

263. Muthalif, M. M., Hefner, Y., Canaan, S., Harper, J., Zhou, H., Parmentier, J. H.,
Aebersold, R., Gelb, M. H., and Malik, K. U. (2001) The Journal of biological chemistry
276(43), 39653-39660

264. Schmidlin, F., Loeffler, S., Bertrand, C., Landry, Y., and Gies, J. P. (2000) Naunyn-
Schmiedeberg's archives ofpharmacology 361(3), 247-254

160









265. Yuhas, Y., Azoulay-Alfaguter, I., Berent, E., and Ashkenazi, S. (2007) Antimicrobial
agents and chemotherapy 51(12), 4225-4230

266. Beasley, D. (1999) The American journal ofphysiology 276(4 Pt 2), H1369-1378

267. Dolan-O'keefe, M., and Nick, H. S. (1999) Gastroenterology 116(4), 855-864

268. Schalkwijk, C. G., Vervoordeldonk, M., Pfeilschifter, J., and van den Bosch, H. (1993)
FEBS letters 333(3), 339-343

269. Xue, S., Slater, D. M., Bennett, P. R., and Myatt, L. (1996) Prostaglandins 51(2), 107-124

270. Wu, T., Ikezono, T., Angus, C. W., and Shelhamer, J. H. (1994) Nucleic acids research
22(23), 5093-5098

271. Tay, A., Maxwell, P., Li, Z., Goldberg, H., and Skorecki, K. (1994) Biochimica et
biophysica acta 1217(3), 345-347

272. de Carvalho, M. G., Garritano, J., and Leslie, C. C. (1995) The Journal of biological
chemistry 270(35), 20439-20446

273. Kuwata, H., Nakatani, Y., Murakami, M., and Kudo, I. (1998) The Journal of biological
chemistry 273(3), 1733-1740

274. Wang, X., Xue, H., Xu, Q., Zhang, K., Hao, X., Wang, L., and Yan, G. (2008)
Prostaglandins & other lipid mediators 86(1-4), 61-67

275. Zhou, H., Das, S., and Murthy, K. S. (2003) Am JPhysiol Gastrointest Liver Physiol
284(3), G472-480

276. Hasegawa, S., Kohro, Y., Tsuda, M., and Inoue, K. (2009) Molecular pain 5(1), 22

277. Li, F., and Malik, K. U. (2005) Am JPhysiolHeart Circ Physiol288(5), H2306-2316

278. Ichijo, H., Nishida, E., Irie, K., ten Dijke, P., Saitoh, M., Moriguchi, T., Takagi, M.,
Matsumoto, K., Miyazono, K., and Gotoh, Y. (1997) Science (New York, N. Y275(5296),
90-94

279. Uhlik, M. T., Abell, A. N., Johnson, N. L., Sun, W., Cuevas, B. D., Lobel-Rice, K. E.,
Home, E. A., Dell'Acqua, M. L., and Johnson, G. L. (2003) Nat Cell Biol 5(12), 1104-1110

280. Johnson, G. L., and Lapadat, R. (2002) Science (New York, N. Y 298(5600), 1911-1912

281. Chang, L., and Karin, M. (2001) Nature 410(6824), 37-40

282. Seger, R., and Krebs, E. G. (1995) Faseb J9(9), 726-735









283. Inoue, T., Boyle, D. L., Corr, M., Hammaker, D., Davis, R. J., Flavell, R. A., and Firestein,
G. S. (2006) Proceedings of the National Academy of Sciences of the United States of
America 103(14), 5484-5489

284. Li, Y., Batra, S., Sassano, A., Majchrzak, B., Levy, D. E., Gaestel, M., Fish, E. N., Davis,
R. J., and Platanias, L. C. (2005) The Journal of biological chemistry 280(11), 10001-
10010

285. Nagy, N., Shiroto, K., Malik, G., Huang, C. K., Gaestel, M., Abdellatif, M., Tosaki, A.,
Maulik, N., and Das, D. K. (2007) JMol Cell Cardiol 42(5), 981-990

286. Marais, E., Genade, S., and Lochner, A. (2008) Cardiovascular drugs and therapy/
sponsored by the International Society of Cardiovascular Pharmacotherapy 22(1), 3-17

287. Deak, M., Clifton, A. D., Lucocq, L. M., and Alessi, D. R. (1998) The EMBO journal
17(15), 4426-4441

288. Vermeulen, L., De Wilde, G., Van Damme, P., Vanden Berghe, W., and Haegeman, G.
(2003) The EMBO journal 22(6), 1313-1324

289. Wiggin, G. R., Soloaga, A., Foster, J. M., Murray-Tait, V., Cohen, P., and Arthur, J. S.
(2002) Molecular and cellular biology 22(8), 2871-2881

290. Soloaga, A., Thomson, S., Wiggin, G. R., Rampersaud, N., Dyson, M. H., Hazzalin, C. A.,
Mahadevan, L. C., and Arthur, J. S. (2003) The EMBO journal 22(11), 2788-2797

291. Bartoli, F., Lin, H. K., Ghomashchi, F., Gelb, M. H., Jain, M. K., and Apitz-Castro, R.
(1994) The Journal of biological chemistry 269(22), 15625-15630

292. Salari, H., Braquet, P., and Borgeat, P. (1984) Prostaglandins LeukotMed 13(1), 53-60

293. Harizi, H., Juzan, M., Moreau, J. F., and Gualde, N. (2003) JImmunol 170(1), 139-146

294. Dixon, R. A., Diehl, R. E., Opas, E., Rands, E., Vickers, P. J., Evans, J. F., Gillard, J. W.,
and Miller, D. K. (1990) Nature 343(6255), 282-284

295. Nie, D., Krishnamoorthy, S., Jin, R., Tang, K., Chen, Y., Qiao, Y., Zacharek, A., Guo, Y.,
Milanini, J., Pages, G., and Honn, K. V. (2006) The Journal of biological chemistry
281(27), 18601-18609

296. Sadik, C. D., Sies, H., and Schewe, T. (2003) Biochemical pharmacology 65(5), 773-781

297. Loke, W. M., Proudfoot, J. M., Stewart, S., McKinley, A. J., Needs, P. W., Kroon, P. A.,
Hodgson, J. M., and Croft, K. D. (2008) Biochemicalpharmacology 75(5), 1045-1053

298. Sendobry, S. M., Cornicelli, J. A., Welch, K., Bocan, T., Tait, B., Trivedi, B. K., Colbry,
N., Dyer, R. D., Feinmark, S. J., and Daugherty, A. (1997) British journal of
pharmacology 120(7), 1199-1206









299. Markou, T., Vassort, G., and Lazou, A. (2003) Molecular and cellular biochemistry 242(1-
2), 163-171

300. Fahmi, H. (2004) Current opinion in rheumatology 16(5), 623-627

301. Kuo, S., Chesrown, S. E., Mellott, J. K., Rogers, R. J., Hsu, J. L., and Nick, H. S. (1999)
The Journal of biological chemistry 274(6), 3345-3354

302. Gijon, M. A., Spencer, D. M., and Leslie, C. C. (2000) Adv Enzyme Regul 40, 255-268

303. Almond, F., Rauzier, J. M., Bony, C., and Vassort, G. (2000) The Journal of biological
chemistry 275(50), 39110-39116

304. Slamon, D. J., Clark, G. M., Wong, S. G., Levin, W. J., Ullrich, A., and McGuire, W. L.
(1987) Science (New York, N. Y235(4785), 177-182

305. Frasor, J., Danes, J. M., Komm, B., Chang, K. C., Lyttle, C. R., and Katzenellenbogen, B.
S. (2003) Endocrinology 144(10), 4562-4574

306. Stender, J. D., Frasor, J., Komm, B., Chang, K. C., Kraus, W. L., and Katzenellenbogen, B.
S. (2007) Molecular endocrinology (Baltimore, Md 21(9), 2112-2123

307. Richards, J. A., and Brueggemeier, R. W. (2003) The Journal of clinical endocrinology
and metabolism 88(6), 2810-2816

308. Zhao, Y., Agarwal, V. R., Mendelson, C. R., and Simpson, E. R. (1996) Endocrinology
137(12), 5739-5742

309. Sotiriou, C., Neo, S. Y., McShane, L. M., Kom, E. L., Long, P. M., Jazaeri, A., Martiat, P.,
Fox, S. B., Harris, A. L., and Liu, E. T. (2003) Proceedings of the NationalAcademy of
Sciences of the United States ofAmerica 100(18), 10393-10398

310. Catley, M. C., Chivers, J. E., Cambridge, L. M., Holden, N., Slater, D. M., Staples, K. J.,
Bergmann, M. W., Loser, P., Barnes, P. J., and Newton, R. (2003) FEBS letters 547(1-3),
75-79









BIOGRAPHICAL SKETCH

Jewell Nadia Walters was born on the island of Tortola in the British Virgin Islands. She

attended school and worked there until 1993 when she left to start her undergraduate education at

Hampton University in Virginia. After graduating with a Bachelor of Science degree in 2001,

she relocated to Maryland and got a job as a research technician at Johns' Hopkins University

(Baltimore, Maryland) in the laboratory of Dr. Prashant Desai, working on herpes simplex virus

type II. In 2003, she left Johns' Hopkins University andjoined the Interdisciplinary Doctoral

Program (IDP) at the University of Florida (Gainesville, Florida) and in May 2004, joined Dr.

Harry Nick's lab.





PAGE 1

1 CHARACTERIZATION OF MICROSOMAL PROSTAGLANDIN E SYNTHASE 1 GENE REGULATION BY THE PRO INFLAMMATORY CYTOKINE INTERLEUKIN 1 BETA By JEWELL NADIA WALTER S A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FL ORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2009

PAGE 2

2 2009 Jewell Nadia Walters

PAGE 3

3 To my mother Edith and my husband Cory

PAGE 4

4 ACKNOWLEDGMENTS I have had many positive influences in my life that have helped shaped me to be the person that I am now. I would like to thank my mentor, Dr. Harry Nick, for allowing me the opportunity to work in his laboratory and for pushing me to be better and think critically ; it has been an enlightening experience. I would also like to thank my committee members, Dr. Mavis Agbandje McKenna, Dr. Jorg Bungert and Dr. Michael Clare -Salzler for their helpful comments and guidance throughout my Ph.D training. I would li ke to thank my lab mates, past and present, Dr. Herlihy, Molly Peck, Dr. Qiu, Dr. Aiken, Justin Bickford and Dawn Beachy, for the fun and educational atmos phere. I would also like to thank members of the Kilberg lab, Ishov lab, IDP, BMB and Neuroscience d epartment staff who were always helpful and friendly. I thank my mother for always believing in me, her never -ending support and for reminding me that I can achieve anything once I work hard at it. I thank my brothers who always look out for me even from afar and my husband Cory for his continued love and support. Lastly, I would like to thank the Almighty; my faith in Him has gotten me through many rough patches

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS .................................................................................................................... 4 LIST OF TABLES ................................................................................................................................ 9 LIST OF FIGURES ............................................................................................................................ 10 LIST OF ABBREVIATIONS ............................................................................................................ 13 ABSTRACT ........................................................................................................................................ 15 CHAPTER 1 INTRODUCTION ....................................................................................................................... 17 Overview of the Arachidonic Acid Pathway and Metabolites ................................................. 17 Prostaglandin/Prostanoid ............................................................................................................ 17 Cytosolic Phospholipase A22 ......................... 20 Regulation and Activation of Cytosolic PLA2 ................................................................. 21 Lipoxygenases (LOX) ................................................................................................................. 23 Cy clooxygenases (COX) ............................................................................................................ 24 Molecular and Transcriptional Regulation of COX 2 Expression ................................... 25 Inhibition of COX Activity by Non -Steroid al Anti Inflammatory Drugs (NSAIDs) ..... 26 Prostaglandin E2 (PGE2) ............................................................................................................. 27 PGE2 Activity is Regulated by EP Receptors: Evaluation of EP Receptor Knockout Mice ................................................................................................................. 28 Prostaglandin E Synthase (PGES) ............................................................................................. 29 Transcriptional Regulation of Microsomal PGES 1 ......................................................... 30 Physiological Relevance of Microsomal PGES 1 Gene Expression Evaluated in Knockout Mice ................................................................................................................. 30 Expression of Microsomal PGES 1 in Cancers ................................................................. 31 2 MATERIALS AND METHODS ............................................................................................... 36 Materials ...................................................................................................................................... 36 Methods ....................................................................................................................................... 37 Cell Culture .......................................................................................................................... 37 Plasmids, Probes and Site -Directed Mutagenesis .............................................................. 3 8 Transient Transfec tion ......................................................................................................... 39 RNA Isolation, Northern Blot and Hybridization.............................................................. 40 Transcription Rate Determination ...................................................................................... 41 First -Strand DNA Synthesis and Real Time RT -PCR ...................................................... 42 Immunoprecipitation Assay ................................................................................................ 43 Protein Isolation ................................................................................................................... 44 Immunoblot Analysis .......................................................................................................... 44

PAGE 6

6 DNase I Hypersensitive Site Analysis................................................................................ 45 Chromatin Immunoprecipitation Analysis ......................................................................... 46 Short Interfering RNA (siRNA) Analysis .......................................................................... 47 Densitometry and Statistical Analysis ................................................................................ 48 3 IDENTIFICATION OF DNASE I HYPERSENSITIVE SITES INVOLVED IN THE INTERLEUKIN 1 BETA (IL PROSTAGLANDIN E SYNTHASE 1 (MPGES 1) GENE EXPRESSION .......................... 50 Introduction ................................................................................................................................. 50 Induction of Microsomal PGES 1 Gene Expression by Pro Inflammatory Cytokines .......................................................................................................................... 50 Stimulus Dependent Activity of the Microsomal PGES 1 Promoter ............................... 50 Involvement of the Early Growth Response Factor, Egr 1 in the Regulation of Microsomal PGES 1 Expression .................................................................................... 51 Results .......................................................................................................................................... 52 Induction of Microsomal PGES 1 Messenger RNA and Protein Expression by the Pro Inflammatory Cytokine, IL roblasts .................................. 52 Determination of Microsomal PGES 1 Messenger RNA Decay After Stimulus Removal ............................................................................................................................ 53 The IL GES 1 Gene Expression Requires De Novo Transcription .................................................................................................................... 54 Evaluation of the Microsomal PGES 1 Proximal Promoter in the HFL 1 cells .............. 55 Analysis of Internal Cis -Acting Elements That May be Involved in Regulating Microsomal PGES 1 Gene Expression ........................................................................... 56 Microsomal PGES 1 Chromatin Structure: DNase I Hypersensitive Site Analysi s ...... 57 Discussion .................................................................................................................................... 58 4 FUNCTIONAL ANALYSIS OF PROMOTER AND DISTAL REGULATORY ELEMENTS CONTROLLING THE IL L PROTAGLANDIN E SYNTHASE 1 (MPGES 1) GENE EXPRESSION ............................ 73 Introduction ................................................................................................................................. 73 Results .......................................................................................................................................... 74 Functional Analysis of the Distal Hypersensitive Site, HS2 Relative to the Microsomal PGES 1 Promoter ....................................................................................... 74 HS2 Exhibits Characteristics of an Enhancer: Evaluation of HS2 Using a Minimal Thymidine Kinase Heterologous Promoter .................................................................... 75 Ident ification of a Basal Element Within HS2 .................................................................. 76 Mapping of an Inducible Element Contained Within HS2 ............................................... 77 Identification of Three C/EBP Induction of Microsomal PGES 1 ........................................................................... 77 duction of Microsomal PGES 1 ...................................................................................................................... 78 1 Binding Site. ..... 79

PAGE 7

7 Targeted Deletio Cells .................................................................................................................................. 79 Evaluation of Microsomal PGES Fibroblast (MEF) Cells .................................................................................................... 80 Chromatin Immunoprecipitation (ChIP) Analysis of Egr 1, RNA Polymerase II and ............................................................................................................... 80 Co Immunoprecipitation Analysis of Egr ing .................................. 80 Discussion .................................................................................................................................... 81 5 P38MAPK, CYTOSOLIC PHOSPHOLIPASE A2 ALPHA AND 15 LIPOXYGENASE (15 LOX) ACTIVITIES ARE REQUIRED FOR TRANSC RIPTIONAL INDUCTION OF CYTOSOLIC PHOSPHOLIPASE A2 ALPHA BY INTERLEUKIN FORWARD MECHANISM .................. 101 Introduction ............................................................................................................................... 101 Cyt osolic Phospholipase A22 Phosphorylation and Intracellular Calcium Levels ...................................................... 101 Results ........................................................................................................................................ 103 IL 2 .......... 103 P38MAPK Mediates Cytosolic PLA2 -dependent Manner ............................................................................................................................ 103 Phosphorylation of MKK3/MKK6 is Induced by IL ................................................. 105 Phosphorylation of MSK 1 is Induced by IL ............................................................. 106 Inhibition of Cytosolic PLA2 Cytosolic PLA2 ............................ 107 The Lipoxygenase Pathway but not Cyclooxygenase Pathway is Necessary for Cytosolic PLA2 ......................................................................................... 108 Short Interfering RNA against 15-LOX Blocks the IL PLA2 ................................................................................................ 110 Discussion .................................................................................................................................. 110 6 CONCLUSIONS AND FUTURE DIRECTIONS .................................................................. 130 Conclusions ............................................................................................................................... 130 Future Directions ....................................................................................................................... 135 APPENDIX: EVALUATION OF EFFECTS OF A DIFFERENT PRO INFLAMMATORY CYTOKINE, TNF -ALPHA ON MICROSOMAL PROSTAGLANDIN SYNTHASE 1 ... 138 Introduction ............................................................................................................................... 138 Analysis of Microsomal PGES 1 Expression and Promoter Activity in Human Breast Cancer Cells ........................................................................................................ 138 Results ........................................................................................................................................ 139 TNF 1 Gene Expression in a Time Dependent and Cell Specific Manner ..................................................................................................... 139

PAGE 8

8 Analysis of the Activation of the Distal Hypersensitive Site (HS2) by TNF ............. 139 Identification of TNF ......................... 140 Discussion .................................................................................................................................. 140 LIST OF REFERENCES ................................................................................................................. 145 BIOGRAPHICAL SKETCH ........................................................................................................... 164

PAGE 9

9 LIST OF TABLES Table page 2 1 Pr imers used for generating mPGES 1 fragments ............................................................... 49

PAGE 10

10 LIST OF FIGURES Figure page 1 1 Arachidonic Acid Pathway. ................................................................................................... 33 1 2 Cleavage of arachidonic acid from membrane phospholipids. ........................................... 34 1 3 Synthesis of PGE2. ................................................................................................................. 35 3 1 Inductio n of mPGES 1 gene expression by the proinflammatory cytokine, IL human lung fibroblasts. .......................................................................................................... 61 3 2 Induction of mPGES 1 mRNA expression by IL .............. 62 3 3 Induction of mPGES 1 mRNA expression by IL 1 cells analyzed by quantitative real -time RT PCR analysis. ............................................. 63 3 4 Induction of mPGES 1 protein expression by IL .............. 64 3 5 Determination of mPGES 1 mRNA decay following stimulus removal. ........................... 65 3 6 The IL 1 gene expression requires de novo transcription. ......... 66 3 7 The IL 1 gene expression requires de novo transcri ption: Analysis of hnRNA levels. .................................................................................................... 67 3 8 Evaluation of the mPGES 1 proximal promoter.. ................................................................ 68 3 9 Evaluation of the mPGES 1 proximal promoter.. ................................................................ 69 3 10 Analysis of internal cis acting elements that may be involved in regulating mPGES 1 gene expression. ..................................................................................................................... 70 3 11 mPGES 1 chromatin structure: DNase I hypersensitive site analysis 1. ........................... 71 3 12 mPGES 1 chromatin structure: DNase I hypersensitive site analysis 2.. .......................... 72 4 1 Functional analysis of the distal hypersensitive site, HS2 relative to the mPGES 1 promoter. ................................................................................................................................. 84 4 2 Functional analysis of the distal hypersensitive site, HS2 rela tive to the mPGES 1 promoter. ................................................................................................................................. 85 4 3 HS2 exhibits characteristics of an enhancer: Evaluation of HS2 using a minimal thymidine kinase (TK) heterologous promoter. ................................................................... 86 4 4 HS2 exhibits characteristics of an enhancer: Evaluation of HS2 using a minimal viral thymidine kinase heterologous promoter. .................................................................... 87

PAGE 11

11 4 5 Identification of a basal element within HS2. ...................................................................... 88 4 6 Mapping of an inducible element contained within HS2. ................................................... 89 4 7 sites in the distal regulatory enhancer element predicted by computer analysis. ............................................................................................ 90 4 8 1. ..................... 91 4 9 1. ....................... 92 4 10 1 binding site. ................... 93 4 11 .................................. 94 4 12 ng epithelial cells. .................................. 95 4 13 Evaluation of mPGES -deficient mouse embryonic fibroblast (MEF) cells. ............................................................................................................................ 96 4 14 Chromatin immunoprecipitation analysis of Egr 1 and RNA Polymerase II binding. ...... 97 4 15 ........................................... 98 4 16 Co immunoprecipitation analysis of Egr ...................................... 99 4 17 1 in activating the ILinduction of mPGES 1 gene expression. ............................................................................ 100 5 1 IL 2 ............................. 113 5 2 p38MAPK mediates cPLA2 dependent manner. .............. 114 5 3 Inhibition of cPLA2 2 expression: A feed forward mechanism. ............................................................................ 115 5 4 Inhibition of cPLA2 2 expression: A feed forward mechanism. ............................................................................ 116 5 5 p38MA PK mediates cPLA2 dependent manner. .............. 117 5 6 Phosphorylation of MKK3/MKK6 is induced by IL ................................................... 118 5 7 MKK3/MKK6 mediates cPLA2 -dependent manner.. ...... 119 5 8 Phosphorylation of MSK 1 is induced by IL ............................................................... 120 5 9 The lipoxygenase pathway but not cyclooxygenase pathway is necessary for cPLA2 expression: Inhibition of cPLA2 ...................................................... 121

PAGE 12

12 5 10 The lipoxygenase pathway but not cyclooxygenase pathway is necessary for cPLA2 expression: Inhibition of cPLA2 ...................................................... 122 5 11 The lipoxygenase pathway but not cyclooxygenase pathway is necessary for cPLA2 expressi on: Inhibition of COX. .......................................................................................... 123 5 12 The lipoxygenase pathway but not cyclooxygenase pathway is necessary for cPLA2 expression: Inhibition of LOX. .......................................................................................... 124 5 13 The lipoxygenase pathway but not cyclooxygenase pathway is necessary for cPLA2 expression: Inhibition of 5 LOX.. ...................................................................................... 125 5 14 The lipoxygenase pathway but not cyclooxygenase pathway is necessary for cPLA2 expression: Inhibition of 12/15-LOX. ................................................................................ 126 5 15 Pharmacological inhibition of 15 LOX and siRNA against 15 LOX activity blocks the IL 2 gene expression. ............................................................... 127 5 16 Pharmacological inhibition of 15 LOX and siRNA against 15 LOX activity blocks the IL 2 ............................................................... 128 5 17 Model of cPLA2 .............................................................................................. 129 A 1 TNF 1 gene expression in a time dependent and cell -specific manner. .................................................................................................................................. 142 A 2 Analysis of the activation of the distal hypersensitive site (HS2) by TNF .................. 143 A 3 Identification of TNF .............................. 144

PAGE 13

13 LIST OF ABBREVIATIONS A A Arachidonic acid ALLN Calpain inhibitor N acetyl leucyl leucyl -norleucinal BAL Bronchial alveolar lavage fluid Ca MKII Calcium and calmodulin dependent protein kinase II C/EBP CCAAT -enhancer binding protein Ch IP Chromatin immunoprecipitation COX Cyclooxygenase 1or 2 COXIB Cyclooxygenase 2 selective inhibitor DP Prostaglandin D2 receptor ECM Extracellular matrix EGR1 Early growth response factor 1 EP Prostaglandin E2 receptor ERK Extracellular sign al regulated kinase FLAP 5Lipoxygenase activating protein JNK c Jun N terminal kinase HETE Hydroxyeicosatetraenoic acid HODE hydroxyoctadecadienoic acid HPETE Hydroperoxyeicosatetraenoic acid hGH Human growth hormone hnRNA Heterogeneous nuclear RNA HS Hyp ersensitive site IL Interleukin LOX Lipoxygenase LPS Lipopolysaccharide MAPK Mitogen activated protein kinase

PAGE 14

14 MEF Mouse embryonic fibroblasts MSK Mitogen and stress activated protein kinase NF Nuclear factor kappa light chainenhancer of activated B cells NSAID No nsteroidal antiinflammatory drugs PCR Polymerase chain reaction PPAR Peroxisome proliferator activating receptor PGD Prostaglandin D2 PGE Prostaglandin E2 PGH Prostaglandin H2 PGES Prostaglandin E synthase PLA Phospholipase TK Thymidine kinase Tumor TxA2 Thromboxane

PAGE 15

15 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy CHARACTERIZATION OF MICROSOMAL PROSTAGLANDIN E SYNTHASE 1 GENE REGULATION BY THE PRO INFLAMMATORY CYTOKINE INTERLEUKIN 1 BETA By Jewell Nadia Walters August 2009 Chair: Harry S. Nick Major: Medical Sciences Biochemistry and Molecular Biology T he arachidonic acid (AA) pathway is a major contributor to the i nflamm atory response pain production and cellular homeostasis. AA is liberated from membrane phospholipids by c ytosolic PLA 2 alpha (cPLA2alpha) activity and then metabolized by either the cyclooxygenase (COX ) or lipoxygenase (LOX ) enzymes. The COX enzymes regulate the production of downstream prostanoids known to be involved in the regulation of a number of biological and pathophysiological processes Of these prostanoids, PGE 2 is the most widely studied due to its key role in i nflammat ion Over the years, the study of PGE 2 biosynthesis and regulation focused entirely on the role of COX 2. More r ecently, the trend has shifted towards understanding the role of specific PGE 2 terminal syntha ses T here are five known PGE synthases and m icrosomal PGES 1 (mPGES 1) has emerged a s the crucial enzyme responsible for PGE 2 production. mPGES 1 is highly induce d by pro inflammatory cytokines and existing gene regulation studies highlight the importance o f early growth response factor 1 as a key regulator of mPGES 1 expression. This stud y demonstrates that mPGES 1 is induced by interleukin 1 beta ( IL 1 beta) in pulmonary fibroblasts requiring de novo transcription and identif ies a hypersensitive site (HS) within the distal promoter region that exhibits both basal and inducible enhancer activity. Functional analysis of HS led to the identification of a binding site for CCAAT/enhancer binding

PAGE 16

16 protein within the enhancer and illustrated the importance of this element in recapitulat ing the compl ete cytokine induction of mPGES 1 gene expression cPLA2alpha is activated by intracellular calcium levels and kinase activity but the exact signaling mechanism involved is still unclear. This study attempted to identify key factors involved in the IL 1 induction of cPLA2alpha in pulmonary cells The results introduce a fee d forward mechanism involving the initial rapid induction of cPLA2alpha enzymatic activity and the involvement of a downstream AA metabolite, 15 LOX as being necessary for the cytoki ne mediated induction of cPLA2alpha. mPGES 1 expression is highly up regulated in breast cancer and recent studies demonstrate a role for estrogen and possibly TNFalpha in mediating mPGES 1 gene expression The final study explores the involvement of TNFa lpha and illustrates that it is a potential mediator of mPGES 1 gene expression in breast cancer

PAGE 17

17 CHAPTER 1 INTRODUCTION Overview of the Arachidonic Acid Pathway and Metabolites Redness, pain, swelling, these are all visible characteristics of the infla mmatory response but at the cellular level the response is much more complicated. In the initial stages, arachidonic acid is metabolized to form eicosanoids which include prostaglandins, leukotrienes hydroxyeicostetraenoic acid and lipoxins as illustrat ed in Figure 1 1 (1 3) The eicosanoids then serve as signaling molecules regulating a variety of processes including chemotaxis (4), vasodilatation (5), pain (6), fever (7), anaphylaxis and vasoconstriction (8,9) Aside from the inflammatory response, eicosanoids have also been impli cated in a number of disease states including inflammatory bowel disease/Crohns disease, many cancers such as breast, colon, prostate and lung cancer, rheumatoid arthritis, chronic obstructive pulmonary disease (COPD) and cardiovascular disease (3,8,1016) Prostaglandin/ Prostanoid Prostanoids were initially discovered when an extract of sheep seminal fluid was incubated with arachidonic acid (17) The first steps of prostanoid synthesis involve the conversion of arachidonic acid to prostaglandin H2 (PGH2) by the action of prostaglandin endoperoxide H synthase also called cyclooxygenase (COX 1 and COX 2). PGH2 serves as the central intermediate and substrate for the synthesis o f the following prostanoids PGD2, PGE2, PGF, PGI2 and TxA2 (18,19) The conversion of PGH2 to the various prostanoids is mediated by the action of specific terminal synthases which function not only in the catalysis of these reactions but also in the regu lation of prostanoid expression (1,11,20) Prostanoids have been shown to regulate a wide variety of complex processes including inflammatory responses, female reproduction, tumorigenesis, vascular hypertension, kid ney

PAGE 18

18 function, gastric mucosal protection, pain sensitivity, vasodilatation, bronchoconstriction, pyresis, parturition, sleep and many diseases within the body (21 24) PGD2, for instance, plays a role in asthma, sm ooth muscle relaxation, the activation of eosinophils and is synthesized by mast cells in the lungs following allergen challenge and has been thought to play a role in asthma as well as in the activation of eosinophils (5,25,26) PGD2 along with PGE2 are also necessary during the sleep wake cycle ; PGD2 promoting sleep and PGE2 promoting wakefulness (27,28) On the other hand, TxA2, is synthesized by platelets functions in platelet aggregation and vasoconstriction in the cardiovascular system (29,30) Conversely, PGI2 acts opposite to TxA2 as an anticoagulator for platelets a vasodilator and like PGF2 has been widely studied in pr egnancy during embryo implantation (31 33) PGE2 has been implicated to promote fever inflammation, vasodilatation, cancer, pain and is involved in reproductive processes (1 1,3441) PGF2 also plays a critical role in reproductive processes promoting myometrial contractions cervical relaxation and ovulation (42,43) A rachidonic acid metabolites play a role in overall lung health and function, the predominant forms being PGD2, PGE2, and TxA2 (44) Airway inflammation, airway obstruction, remodeling, hypertrophy/hyperplasia of bronchial smooth muscle cells and eosinophil infiltration are all principal features of asthma (45 47) PDG2 is a potent bronchoconstrictor that is produced by mast cells and purported to play a role in allergen induced asthma (48,49) In 2000, Matsuoaka e t al. (25) highlighted the role of PGD2 in allergic asthma. Using PGD2 receptor (DP) null mice, they were able to show that both the wild type and mutant mice had similar levels of serum IgE, the antibody produced in response to antigen-induced asthma. Further more after sensitization and aerosolized application of ovalbumin, in a model of allergen -induced asthma, wild type mice exhibited increased infiltration of eosinophils and

PAGE 19

19 lymphocytes, while the DP -/ mice showed only marginal increases in the number of these infiltrated cells. Also the wild type animals showed an increase in airway hyperactivity compared to the DP / mice as well as an increase in the production of TH2 cytokines. Overall this study provi ded strong evidence of the role of PGD2 in mediating the asthmatic response (25) Derived from platelets, TxA2 is a known to be a constrictor of bronchial smooth muscles and a stimulator of airway smooth muscle cell proliferation (29,44) Asthmatic patients are known to produce excessive amounts of TxA2, as measured in their urine (50), bronchoalveolar lavage (BAL) fluid (51) or exhaled air condensate (52) Davi et al. (53) illustrated that patients suffering from chronic obstructive pulmonary disease showed increased urinary excretion of TxA2 versus healthy patients and that hypoxia may stimulate increased synthesis of TxA2. The most potent prostanoid in the human body is PGE2 and within the lung it is bronchoprotective (15) A variety of cell types contribute to PGE2 production including macrophages, dendritic cells and lung fibroblasts (15,54) In response to pro inflammatory mediators and stimuli such as IL LPS and phorbol esters, hu m an alveolar macrophages, lung fibroblasts and airway epithelial cells up regulate COX 2 expression which alternatively leads to an increase in PGE2 levels (55 57) Normal lung cel ls produce collagen, elastin, cytokines/growth factors and extracellular matrix (ECM) proteins which provide structural integrity as well as shape, movement, growth and differentiation. In response to injury or environmental cues, fibroblast proliferation is activated and there is an increase in collagen synthesis/ECM deposition which if left unchecked leads to fibrosis (15,39) Over the years, several studies have shown that PGE2 is known to inhibit fibroblast mig ration, proliferation, collagen synthe s is and eosinophil degranulation thus highlighting t he protective effects of PGE2

PAGE 20

20 in the lung (58 60) A detailed description of PGE2 and the synthase responsible for its bios ynthesis which is a central topic of this dissertation will follow A n alternative metabolic pathway for arachidonic acid involves the synthesis of cysteinyl leukotrienes, leukotriene C4, -D4 and E4 (LTC4, LTD4 and LTE4) by the action of 5 lipoxygenase (5 LOX) and leukotriene C4 synthase. These leukotrienes are produced by leukocytes, lung fibroblasts, platelets and endothelial cells (61 63) In the lung, cysteinyl leukotrienes are chemoattractants and are invol ved in fibroblast proliferation and collagen synthesis (64,65) Over the years, cysteinyl leukotrienes have been implicated in lung disease, particularly asthma and have been the target for drug development and tre atments (66 69) Further the role of leukotrienes in pulmonary function was evaluated in animal models of fibrosis (68) In bleomycin induced fibrosis, 5 LOX / mice exhibited decreased levels of ECM proteins and a reduction in the recruitment of immune cells (lymphocytes, eosinophils and macr ophages) compared to wild type mice. T he 5 -LOX / mice also showed increased PGE2 production after bleomycin induction, which may explain the reduced response to bleomycin induced inflammation (70) Together these studi es highlight the importance of eicosanoids as they relate to lung health and function. Each metabolite represents a potential therapeutic target for the development of new drugs used for the treatment of asthma, fibrosis and other pulmonary disorder s and potentially as therapies in lung cancer These studies also reveal the diversity exhibited by the lung, thus establishing it as an inter esting model for gene regulation studies. Cytosolic Phospholipase A2 (cPLA2 and Arachidonic Acid Metabolism In the 1930s essential fatty acids were discovered as compounds that were vital for human health but could only be obtained through diet (41,71) There are two main families of essential fatty acids, omega 3 contain ing alpha linolenic acid and omega 6 containing linoleic acid, which

PAGE 21

21 serve as the starting point for the production of polyunsaturated fatty acids including arachidonic acid (2,13,41) Arachidonic acid, an omega 6 fatty acid, is generated by the hydrolysis of phospholipids via the action of phospholipase A2s ( PLA2) (2,13,41,7277) There are five categories of phoshpolipases: secreted phospholipases (78 81) group (IV) cytosolic PLA2 (82 84) and intracellular group (VI) calcium independent PLA2 (85,86) PAF acetylhydrolysases and lysosomal PLA2s (87 89) While each class of PLA2 is capable of cleaving arachidonic acid from phospholipids, group IV PLA2, particularly cytosolic PLA2 (cPLA2 ) shows a high specificity for cleavage of arachidonic acid from the sn2 p osi tion of glycerophospholipids and this reaction is illustrated in Figure 1 2 (82,84,90) The newly synthesized arachidonic acid is further metabolized to leukotrienes, lipoxins, prostaglandins and hydr oxyeicostetrae noic acids as shown in Figure 1 1 Regulation and A ctiv ation of Cytosolic P L A2 Group (IV) cytosolic PLA2 contains six isozymes, c PLA2 c PLA2 c PLA2 c PLA2 c PLA2 and c PLA2 which all share a catalytic dyad and a homologous C2 domain involved in Ca2+dependent phospholipid binding. The only exception to this group is c PLA2 ; which lacks the C2 domain but is isoprenylated at its C -terminus and thereby thought to be membrane associated (91,92) Localized to chromosome 1q25, cPLA2 is ubiquitously expressed in all human tissue s with an e levated basal level in the lung The enzymatic activity and levels are also induced in response to pro inflammatory stimuli and various growth factors (54,93 100) Furthermore, use of IL 4 or glucocorticoids has been shown to inhibit cPLA2 thus downstream eicosanoid formation (99,101103) Numerous studies have evaluated the enzymatic activity of cPLA2 in terms of arachidonic acid production and found that the protein is also regulat ed at the post translation level. The activity of the 85kD enzyme is known to be induced by phosphorylation of a serine residue at

PAGE 22

22 position 505, mediated by mitogen activated protein kinase s (MAPK) (104,105) Two other serine residues, at position 515 and 727 have also been shown to be important for cPLA2 enzyme activity. Ser515 is reportedly phosphorylated by calcium/calmodulindependent kinase II (CaMKII) and Ser727 by mitogen activated protein kinase interacting kinase (MNK 1) (93,106108) and mutation of eithe r of these two residues results in a loss of cPLA2 Previous reports have shown that micromolar levels of intracellular calcium levels promote the translocation of cPLA2 putt ing the enzyme in close proximity to its substrate and other enzymes in the arachidonate pathway (109112) Aside from intracellular calcium levels, f ull activation of cPLA2is dependent on the activit y of member s of the MAPK pathway including MKK3/MKK6 and p38 which will be discussed in some detail in Chapter 5. In different cells and under certain conditions cPLA2 such as the nucleoplasm in endothelial cells, the plasma membran e in neutrophils and lipid bodies in macrophages, mast cells, neutrophils and fibroblasts (113115) As further verification of the role of calcium in cPLA2 activate cPLA2 activity leading to translocation and the increased release of arachidonic acid (116) The physiological importance of cPLA2 has been highlighted by pathological studies of cPLA2 -deficient mice. Ov erall these mice appear to develop normally, however they do exhibit a few abnormalities, including a reduced litter size (117) impaired parturition (118) kidney problem s (urine -concentrating defect, aquaporin 1 defect/diminished water reabsorption) (119) and the propensity to develop ulcerated intestines (120) In disease state models for lung injury (111) such as experimental autoimmune encephalomyelitis (121) MPTP (1 -methyl 4 phen yl

PAGE 23

23 1,2,3,6 tetrahydropyridine) neurotoxicity/Parkinsonian disease (122) ischemic brain injury (118) collagen induced arthritis (1 23) atherogenesis (124) ; cPLA2 ( / ) mice show a decreased incidence and severity of the respective disease s in comparison to their wild type counterparts. Furthermore, peritoneal macrophages isolated from the mutant mice show reduced levels or loss of arachidonic acid release and dow nstream eicosanoid signaling (118,125) Lipoxygenase s (LOX) The LOX enzymes form another major pathway involved in both arachidonic acid and polyunsaturated fatty acid metabolism. Lipoxygenases reduce fatty acid s ubstrates by oxygenation, leading to the formation of hydroperoxyeicosatetraenoic acid (HPETE), hydroxyeicosatetraenoic acid (HETE), leukotrienes, lipoxins or hydroxyoctadecadienoic acid (HODE). There are four LOX enzymes, 5 8 12and 15-, classified according to the site of oxygen insertion within arachidonic acid (126128) The LOX enzymes are very similar in both mice and humans; in mice there are seven forms of LOX enzymes, four 12 -LOX, 8 LOX, 5 LOX, e LOX1 (non-expressed epidermal) most of which map to chromosome 11 while in humans there are four forms, 5 LOX 12 LOX, 15 -LOX1 and 15 LOX2 three of which are localized to chromosome 17 (129132) Various cell types suc h as leukocytes, macrophages, granulocytes, dendritic and mast cells express 5 LOX. An approximately 75kD protein, 5 LOX catalyzes the formation of 5 HPETE leading to the formation leukotrienes. 5 LOX expression and activity has been observed in bronchia l asthma, cardiovascular disease and various cancers (67,131,133135) There are two isoforms of 15 LOX in humans, 15-LOX1 and 15 LOX2, which are 78kD proteins. 15LOX1 is closely related to the murine leukocyte 12 LOX and 15 LOX2 is similar to murine 8 -LOX. Both 15LOXs utilize arachidonic acid as a substrate; 15 -LOX2 preferentially converts arachidonic acid to 15S HETE while 15 -LOX1 produces 15S -HETE and 12S HETE (132,136, 137) Aside

PAGE 24

24 from arachidonic acid, it is well documented that 15LOX1 metabolizes linoleic acid to 13(S) HODE (138140) 15 LOX1 is found in airway epithelium, monocytes, prostate and colorectal carcinomas while 15 LOX2 is expressed in the cornea, skin, hair root, lungs and prostate gland (132,141,142) The importance of 15 LOX2 to cPLA2 Chapter 5 where data will be presented on a feed forward mechanism controlling IL dependent induction of cPLA2 Cyclooxygenase s (COX) After arachidonic acid is liberated from glycerophospholipids by PLA2 activity it is then metabolized to prostaglandin G2 then prostaglandin H2 in a series of oxygenation reactions catalyzed by cyclooxygenase s (COX). Currently there are three known COX isoforms, COX 1, COX 2 and COX 3 (which is a splice variant of COX 1 and also referred to as COX 1b) (143,144) COX 1 is cons titutively expressed in most tissues and cell types, and is known to be important in development. COX 1 expression is induced by phorbol esters in monocytes, megakaryob lasts, endothelial cells and fibroblasts by IL (145148) COX 3 is a splice variant of COX 1 and although its precise role has not yet been determined, it is found to be highly expressed in the cerebral cortex and heart (144) Where COX 1 is constitutively expressed, COX 2 is inducibly expressed in many tissues in response to growth factors, cytokines IL sters (149151) The two main COX isoforms, COX 1 and COX 2 are expressed in the lung and are known to be involved in the ultimate production of PGE2. Figure 1 3 illustrates the COX pathway leading to the production of PGE2. The availability o f COX null mice has allowed for a clearer understanding of the roles these enzymes play in lung health. Knockout models for COX 1 and COX 2 have revealed that COX 2 expression is required for PGE2 production (152) In a recent study using either COX 1 / or COX 2 / mice, the results illustrated that following allergen

PAGE 25

25 exposure, mice deficient for either COX isoform showed an increase in airway infiltrates and exhibited severe inflammation in the lungs compared t o wild type mice, presumably due to reduced levels of PGE2 (153) Also allergen induced COX 2 / mice showed increased airway responsiveness when exposed to metacholine versus wild type mice and a greater product ion of BAL cells and proteins (153) In a somewhat similar study, Zeldin et al. (154) showed that mice deficient for either COX 1 / or COX 2 / exposed to aerosolized LPS had increased bronchoconstriction with no difference in the number of BAL cells or lung histopathology as compared to wild type mice. However, they did observe reduced levels of BAL cytokines/chemokines and PGE2, which lends further credence to the impor tance of the COX isoforms in PGE2 production and lung health. Molecular and Transcriptional R egulation of COX -2 E xpression Although both COX 1 and COX 2 are involved in the production of downstream prostanoids, COX 2 transcriptional regulation has been ext ensively studied. The gene encoding COX 2 is located on chromosome 1 spanning 8.3 k b and contains 10 exons The COX enzymes are structurally similar, sharing ~ 61% homology a t the amino acid level (143,155) They differ only slightly in their catalytic sites, where position 523 in COX 1 is an isoleucine residue and the analogous residue in COX 2 is a valine This difference allows for the formation of a side pocket which is known to be critical for specific COX 2 inhibition (143) COX2 encodes a 4. 6 k b full length transcript and a 2.8 k b polyadenylated variant. The 3UTR of COX 2 contains an instability element that is involved in its post transcriptional regulation (155) The promoter region of COX 2 contains a number of transcription factor binding sit es including NF C/EBP, cyclic AMP response elements, a TATA box and an E -box (155157) COX 2 expression is also known to be influenced by chromatin remodeling as p300 plays a role in transcriptional activation of COX 2 (158,159)

PAGE 26

26 In human umbilical vein endothelial cells, human foreskin fibroblasts and human airway smooth muscle cells, COX 2 mRNA and protein expression is up regulated in response to IL and mediated by NF (160,161) Also, LPS has been shown to induce COX 2 expression in RAW 264.7 cells mediated by CRE 1, C/EBP and NF (162) ERK1/2, p38MAPK and JNK pathways have also been identified as having a role in COX 2 expression (163,164) It should be noted that up regulation of COX 2 expression also leads to increased prostaglandin synthesis and deregulation of COX 2 expres sion is associated with inflam matory diseases and many cancers making COX 2 an attractive target for pharmacological inhibitors. Inhibition of COX A ctivity by N on -S teroidal A nti -In flammatory D rugs (NSAIDs) In the early 1970s NSAID s such as aspirin, ibupro fen and indomethacin were found to inhibit both COX 1 and COX 2 activity and prostaglandin production. Aspirin is capable of inhibiting both COX 1 and COX 2, but it is known to selectively acetylate Ser530 on COX 1, blocking the active site channel and ir reversibly inhibiting COX 1 activity (165,166) Since that time, numerous COX 2 specific inhibitors (COXIBs) have been developed along with drug trials to assess their potential anti -inflammatory and analgesic effects (167) While COXIBs such as celecoxib, valdecoxib and rofecoxib offered new hope in the management of cancer and the treatment of rheumatoid arthritis as an alternative to the use of traditional NSAIDs, their e fficacy has been questioned due to the appearance of life -threatening si de effects. It was found that prolonged use of COXIBs was associated with increased risk of gastrointestinal and cardiovascular problems (1681 70) In a 1994 study by Garcia Rodriguez et al. (171) they reported that patients taking NSAIDs, particularly piroxicam, exhibited an increase risk of gastrointestinal complications Alternatively, a 2001 study by Teismann a nd Forger (172) reported the protective effects of COX 2 inhibition on Parkinsons disease In general, there have been numerous reports on both the protective and adverse effects associated with COX

PAGE 27

27 inhibition. While COX 2 represents an attractive target for pharmacological inhibitors due to its aberrant expression in c hronic diseases, the use of COXIBs is still somewhat controversial as are the downstream effects on prostanoid synthesis ; therefore further studies and clinical trials are needed to fully understand the offtarget effects of these inhibitors. Furthermore, the development of specific inhibitors of downstream synthases may offer equally beneficial outcomes with reduced side effects. The studies in chapter 3 will address the regulation of a specific PGE2-dependent synthase that offers such an alternative the rapeutic target. P rostaglandin E2 (PGE2) Of all the prostanoids listed thus far, PGE2 is by far th e most widely studied, as it plays a role in a number of inflammatory conditions and biological processes. PGE2 exerts it effects through binding to one of f our receptors, EP1, EP2, EP3 or EP4 (173,174) Each receptor is expressed in specific tissues of the body for instance EP2 is expressed in the lung, small intestine, thymus, uterus and kidneys (175) while EP1 is expressed in the breast, stomach and the skin (176) From the early studies conducted on metabolites of arachidonic acid, a link between COX 2 and PGE2 was identified, wherein it was shown that after treatment with inflammatory stimuli such as cytokines growth factors and oncogenes an increase in COX 2 levels led to a subsequent increase in PGE2 production (57,177) In many cell culture models, increases in COX 2 expression were shown to correlate with increases in PGE2 production (57) As previously discussed, NSAIDS, including indomethacin, ibuprofen, piroxicam and sulindac along with aspirin are known COX inhibitors (178,179) competitively inhibit ing th e synthesis of PGG and PGH2 by the COX enzymes. Aspirin therapy is known to be beneficial to those suffering inflammation, pain and cardiovascular health, but one of the side effects is gastrointestinal complications (169,170) In general, when COX 2 levels are inhibited by

PAGE 28

28 treatment with NSAIDS, glucocorticoids or COX -specific inhibitors, PGE2 levels were also reduced. Apart from regulation by COX 2 and the EP receptors, PGE2 production is dependent on specific PG ES synthases while its metabolism is dependent on the cytosolic enzyme, hydroxyprostaglandin dehydrogenase (15 PGDH) (180,181) An NADP dependent enzyme, 15 PGDH catabolizes the oxidation of prostaglandins to the 15 keto form thereby reducing their biological activity. In a recent study, Yan et al. (181) showed that 15 PGDH also functions as an antagonist in colorectal cancer. They found that 15 PGDH expression is greatly r educed in colon cancer compared to normal colon mucosa. Subsequent a ddition of 15 -PGDH and treatment with the growth factor TGF -PGDH expression and tumor suppression. PGE2 A ctivity is Regulated by EP R eceptors : Evaluation of EP -R eceptor K nockout Mice Considering the fact that PGE2 activity is dependent on the levels of each EP receptor numerous studies have been conducted on individual receptor knockout animals. Knockout animals for EP1, EP2 or EP3 have been generated; EP4 has also been generated but most of these animals die during the neonatal period (182) The EP3 rec eptor knockout has been investigated during the febrile response (183) While EP1 and EP2 knockout animals are shown to exhibit a fever when PGE2 is administered, EP3 -/ mice show no signs of a fever after administration of PGE2, LPS or IL (35,183,184) However, only after stress or stimulus hyperthermia do the animals exhibit a febrile response (35,183185) In the case of the EP1 receptor, EP 1 / mice have been studied in pain perception and blood pressure models (38,186) C ompared to wild type animals the EP1 / mice show a reduced sensitivity to pain and there is a significant change in their cardiovascular profile (38,186189) Like the EP1 receptor knockout, the EP2 -/ mice ha ve also been investigated in regard to blood pressure and reproduction. It was found that when fed a normal diet, blood

PAGE 29

29 pressure was reduced in EP2 -/ mice compared to wild type mice, but on a high salt diet EP2 -/ mice had a significant increase in blood pressure (189) With re gard to reproduction, while EP2 / mice were no different than wild type mice phenotypically, EP2 -/ mice exhibited reduced pregnancy rates and deliver ed smaller litters compared to wild type mice (37,188,190,191) Overall, the EP receptor knockout studies highlight the importance of PGE2 in a number of biological functions including cardiovascular homeostasis, reproduction, renal activity, fever and pain perception. P rost aglandin E Synthase (PGES) As the contribution of PGE2 to many biological processes continues to be investigated, the focus of PGE2 production has shifted to studying the role of the PGE2 specific synthases. Jakobsson et al. (192) were the first to clone and characterize a human PGES, showing that this enzyme was part of the MAPEG (membrane associated proteins involved in eicosanoid and glutathione metabolism) family of proteins and that it was capable of catalyzing the terminal step conversion of PGH2 into PGE2. Their over -expression data revealed that PGES was a membrane protein, which, when incubated with glutathione and PGH2 showed high levels of PGES activity (192) Ear lier work by the same group and others revealed two key residues, arginine at position 100 and tyrosine at position 130, conserved within the MAPEG family, that are essential for enzymatic activity (193196) When the arginine residue was mutated this resulted in a loss enzymatic activity. There exist five forms of PGES, two membrane or microsomal prostaglandin synthases (mPGES 1 and mPGES 2), cytosolic prostaglandin synthase (cPGES/p23) and two glutathione transferases (GSTM2 2 and GSTM3 3) (197,198) In terms of activity, mPGES 2 is glutathione independent, constitutively expressed and known to associate with both COX 1 and 2, while cPGES is functionally coupled to COX 1 mPGES 1 is glutathione -dependent and functionally

PAGE 30

30 coupled to COX 2. Although all forms of PGES contribute to the overall production of PGE2, mPGES 1 is strongly upregulated in response to pro -inflammatory stimuli analogous to COX 2 and has been shown to be the major producer of PGE2 (199201) Transcription al R egulation of Microsomal PGES -1 It is now widely accepted that COX 2 and mPGES 1 expression are functionally coupled (193,200,202,203) Early studies of the COX 2 gene identified a number of transcription factor binding sites such as NF kappa B, CRE, E box and NF IL6 that are required for its inducible expression (155,157,160,204) The gene encoding mPGES 1 is located on the long arm of c hromosome 9, 9q34.3. The genome consists of two introns and three exons spanning ~14.8 kb ; the promoter region is GC rich and lacks a TATA box. In 2000, work conducted by Forsberg et al. (205) provided insight into the structure and potential regulation of mPGES 1. Their functional analysis of a 0.6 kb m PGES 1 promoter fragment illustrated a strong increase in promoter activity following IL treatment. Later studies by Naraba et al. (206) and Moon et al. (207) revealed t hat the transcription factor, Egr 1 was capable of binding to a regi on within the proximal promoter of mPGES 1 and was important for its gene transcription. More r ecently a regulatory region for NF kappa B was identified with in the promoter region of mPGES 1 and mutational analysis revealed th at this region was important for mPGES 1 promoter activation (208,209) In Chapter 3 a more detailed overview of mPGES 1 gene regulation will be provided. Physiological Relevance of Microsomal PGES -1 G ene Expression Evaluated in K nockout M ic e Much of what is known about mPGES 1 activity has been centered on COX 2 and PGE2 expression. Recently, the g eneration of mPGES 1 null mice has revealed a number of interesting details as to its function and most importantly its physiological significanc e Overall, the

PAGE 31

31 phenotype of the null mice appears to be no different than that of the wild type mice ; they develop normally and are capable of reproduction. Studies focusing on endotoxin -induced shock (210) arthritis (211) fever (210) pain perception/blood pressure (212) stroke and anorexia have utilized mPGES 1 null mice (213,214) In an early s tudy by Levin et al. (215) they showed that the administration of exogenous PGE2 to the ventricular sy stem of the brain and not I L suppressed food intake in mPGES 1 / animals. A later study by Pecchi et al. (216) also confirmed that administration of PGE2 induces anorexia by suppressing food intake in mPGES 1 / mice whereas IL not decrease food intake in these mice. In studies analyzing pain hypersensitivity (211,217,218) researchers found that mPGES 1 / animals exhibited a lower response to stimuli compared to wild -type animals and i nterestingly the prostanoid profile was altered in these animals. In both collagen -induced arthritis and collagen antibody induced arthritis models, both the wild type and mPGES 1 / animals developed arthritis but the degree of severity was 50% less in the knockout animals compared to the wildtype animals (211,218) Intuitively, targeted disruption of the mPGES 1 gene leads not only to a reduction of its enzymatic activity but also to an overall reduction in PG E2 production, strongly implicating this synthase in the regulated production of PGE2 (35,219) Expression of Microsomal PGES -1 in C ancers Like COX 2 and PGE2, mPGES 1 is highly expressed in many cancers including b reast, colon, ovarian and lung (220224) Yoshimatsu et al. (199,225) evaluated mPGES 1 expression in both lung cancer and colorectal adenomas. Their studies revealed that in over 80% of colorectal tumors mPGES 1 was expressed. The authors also analyzed the effect of the cancer causing gene, R as on mPGES 1 expression and found that Ras expression led to a marked increase in mPGES 1 promoter activity. They analyzed COX 2 e xpression in the tumors and found that COX 2 was also induced about 80% and a known inducer of COX 2 expression,

PAGE 32

32 TNF stimulated an up -regulation of both mPGES 1 and COX 2 expression (199) In their subsequent pa per, the authors evaluated mPGES 1 expression in no n -small cell lung cancer harboring oncogenic Ras and nontransformed cells They found that mPGES 1 and COX 2 expression were up regulated in transformed cell lines harboring the mutant Ras gene, and both mPGES 1 and COX 2 expression were up regulated in response to treatment with TNF (225) It should be noted that in both of these studies the molecular mechanis m involved in the regulation of mPGES 1 was not addressed. Finally in 2004, Chang et al. (226) demonstrated that PGE2 induced tumor associated angiogenesis and treatment with the NSAID in domethacin, inhibited tumo rigenesis and tumor associated angiogenesis in murine mammary glands. In conclusion, there are many studies which support the role of PGE2 in tumorigenesis. These studies also implicate the role of COX 2 in the formation of PGE2 and the recent discovery o f mPGES 1 and its upregulation in many cancers has been shown to correlate with COX 2 expression. Epidemiological studies have evaluated the role of NSAIDs and COXIBs in many cancers and disease states and although they have been shown to reduce the ris k of tumor progression and the inflammatory response, they are associated with devastating si d e effects including increased risk of gastrointestinal complications, such as bleeding ulcers and adverse cardiovascular effects. Therefore, mPGES 1 represents a new and potentially advantageous therapeutic target for the development of drugs aimed at suppressing PGE2 production without affecting the general prostanoid profile and potentially without major side effects.

PAGE 33

33 Figure 1 1. Arachidonic Acid Pathway This diagram illustrates two different pathways involved in arachidonic acid metabolism. The first pathway is mediated by cyclooxygenase, which converts arachidonic acid to a central intermediate prostaglandin H2. Prostaglandin H2 can be further metabo lized to yield, PGD2, PGE2, PGF2 PGI2 and thromboxane. In the second pathway, lipoxygenase converts arachidonic acid to leukotrienes lipoxins or hyroxyeicosatetraenoic acid (HETE).

PAGE 34

34 Figure 1 2. Cleavage of arachidonic acid from membrane phospholipids. The diagram depicts the li beration of arachidonic acid from phospholipids. cPLA2 preferentially cleaves membrane phospholipids at the sn 2 position, liberating free arachidonic acid which is further metabolized by downstream enzymes.

PAGE 35

35 Figure 1 3. Synthesis of PGE2. Free arachidonic acid is metabolized by the action of cyclooxygenase 1 and 2 in a series of redox reactions to PGH2. PGH2 is then converted to PGE2 in a reaction catalyzed by the PGE2-specific synthases.

PAGE 36

3 6 CHAPTER 2 MATERIALS AND METHOD S M aterials FUGENE 6 trans fection reagent (11988387001) interleukin (201LB) and complete protease inhibitor cocktail (11697498001) were purchased from Roche Applied Science (Indianapolis, IN). Restriction endonucleases, T4 DNA Ligase (M0202L) Vent Polymerase ( M0254L) Taq Polymerase (M0267L) and Klenow (large fragment of E. coli DNA Polymerase) (M0210L) were purchased from New England Biolabs (Boston, MA). AACOCF3 (100109), p yrrolidine (525143) Bay 117082 (196870) ALLN (208719) SP600125 (420119) PD98059 (513000) SB203580 (559389) SB202190 (559388) and L lyso lecithin (440154) w ere purchased from Calbiochem (Gibbstown, NJ). DNase I (LS006342) was purchased from Worthington Biochemical (Lakewood, NJ). Hams F12K media (N3520) PD146176 (P4620) c urcumin (C1386) actinomycin D ( A9415) and proteinase K (P6556) were purchased from Sigma -Aldrich (St. Louis, MO ). Ciglitazone (71730) Luteolin (10004161) MK886 (10133) NDGA (70300) i ndomethacin (70270) mPGES 1 monoclonal and polyclonal antibodies (10004350, 160140) were purchased from Cayman Chemical (Ann Arbor, MI). Dulbeccos modified eagle medium (DMEM 10 013-CV) was purchased from Mediatech Inc. (Manassas, VA). Phospho-cPLA2 (ser505) (2831) phospho -MSK1 (Ser376) (9591) and p hospho MKK3/MKK6 (Ser189/207) (9231) antibodies were purchased from Cell Sig naling Technologies (Dover, MA). Protein AG agarose beads (SC 2003) anti -His antibody (SC 803) Egr 1 antibodies (SC 189, SC 101033) antibodies (SC 150, SC 7962) were purchased from Santa Cruz Biotechnology Inc (Santa Cruz, CA). Hyperfilm MP (28906846) and ECL western blotting system (RPN2108) were purchased from GE Healthcare (Piscataway, NJ) and Bicinchoninic acid protein assay kit from Pierce (Rockland, IL) A

PAGE 37

37 Quikchange site directed mutagenesis kit with XL 1 Blue competent cells (2005185) was purchased from Stratagene (La Jolla, CA) QIAquick Nucleotide Removal Kit 28306), Qiagen Plasmid Maxi Kit (12163), Hispeed Plasmid Midi Kit (12643), QIAquick Gel Extraction Kit 28706), QIAquick PCR purification kit (28106), RNeasy Mini Kit (74106) QIAprep Spin Miniprep Kit (27106) RNase Free DNase Kit (79254) and the siRNA for Luciferase (SI03650353) were purchased from Qiagen (Valencia, CA). iTaq SYBR Green Supermix with ROX (1725851) Criterion precast Tris HCl gels (10% and 15%) (3450009, 3450019) and Zeta Probe nitrocellulose m embrane (1620115) were purchased from Bio Rad (Hercules, CA ) A random primer DNA labeling kit (18187013) TOPO XL PCR Cloning Kit with One Shot Chemically Competent Cells ( K470010) and SuperScriptTM first strand s ynthesis kit (11904018) were purchased from Invitrogen Technologies (Carlsbad, CA). The siRNAs for rat (L 09221800) (L 00642300), human Alox15B (L 00902600), cyclophilin B (D 00113601) and DharmaFECT 1 transfection reagent (T 200102) were purchased from Dharmacon, Inc (Lafayette, CO). Methods Cell Culture Human lung fibroblast, HFL 1 cells (ATCC CCL 153) and a rat pulmonar y epi thelial li ke cell line, L2 (ATCC CCL 149) obtained from ATCC were maintained in continuous cell culture in Hams F12K media supplemented with 4 mM glutamine, ABAM (0.1 mg/mL streptomycin, 2. Mouse embryonic fibroblasts (MEF) : / cells were provided by Dr. P Johnson, NIH via Dr. Michael Kilberg ; / cells were provided by Dr. A. Nebreda, EMBL ; / cells were provided by Dr. A. Choi, Harvard Medical School and wild type and MKK3/6 / cells were provided by Dr. R. Davis U niversity of

PAGE 38

38 Massachusetts All MEF cell lines were maintained in DMEM media supplemented with 10% fetal bovine serum and ABAM (10 g/mL penicillin G, 0.1 mg/mL streptomycin, and 0.25 g/mL amphotericin B) in continuous culture at 37 with 5% CO2. For plasmid transfections and protein over -expression, cells were seeded on 10 cm or 150 mm dishes F or cytokine treatment cells were seeded on 10 cm dishes and for inhibitor studies cells were seeded on 10 cm dishes then treated with pharm acologic inhibitors for 1 h prior to exposure with IL siRNA transfections cells were seeded on 35 mm dishes. Plas mids, Probes and Site -Directed M utagenesis An MluI site was introduced into a pUC12 -based human growth hormone (hGH) expression vector using site -directed mutagenesis by Dr. JD Herlihy in our lab. The hGH reporter constructs were generated by sub -cloning the following mPGES 1 promoter fragments, 1104/+160 ( 1. 1 k b ) and 434/+160 ( 0. 6 k b ) into the promoter -less, hGH expression vector u sing the Hind III and BamHI sites all numbering relative to the start of transcription (+1) of the mPGES 1 gene An Egr 1 consensus site in the mPGES 1 promoter construct, identified by TESS transcription element search software (227) were deleted by site -directed mutagenesis. Briefly, 10 ng of 1.1 k b promoter construct was used as the template and 125 ng of each mutagenesis primer were added to 1 Pfu Turbo Polymerase and mixed together then brought to a final volume of 50 with sterile double distilled water. The reaction was conducted in a PTC 100 peltier thermal cycler using the following parameters: Cycle 1 (95 C, 30 sec) 1x, Cycle 2 (95 C for 45 sec, 60 C for 1 min, 68 C 7 min) 18x. The methylated parental strand, le aving the mutated product, which is then transformed into XL 1 Blue competent cells and incubated on agar containing ampicillin. Resultant colonies containing

PAGE 39

39 the recombinant plasmids were isolated and sequenced for verification of the mutation. The foll owing mPGES 1 genomic fragments were sub cloned into pGH1. 1 at the MluI site: 10.7/ 6.4, 10.7/ 9.6, 10.1/ 9.0, 9.5/ 8. 5 8.6/ 6.4, 7.6/ 6.4, 8.6/ 8.1 and 8.1/ 7.6 all numbering relative to the start of transcription (+1) of the mPGES 1 gene The primer sequences are listed in Table 2 1 The 10.7/ 6.4 fragment was also cloned into an hGH expression vector containing the heterologous viral thymidine kinase promoter at the NdeI site of this vector. The three in the 8.6/ 8.1 fragment were also identified by TESS and deleted by site -directed mutagenesis using the primers listed in Table 2 1 The mPGES 1 probe used for northern blot analysis were amplified from the cDNA sequen ce using the forward primer 5 GAATTCGCC AGAGATGCCTGCCCACA 3 and reverse primer 5 GAATTCACACACGGGCACACACACAGGC 3. The 0.7 k b growth hormone probe was generated by restriction digest of the growth hormone cDNA using the XbaI and HindIII sites. Transient Transfection Prior to transfection and t reatment with cytokines, HFL 1 c ells were cultured as previously described and transfected at approximately 60 7 0% confluency. 5 g of the indicated plasmid was transfected into HFL1 cells using the Fu gene 6 Reagent protocol from Roche Briefly, in a 1 Reagent (ratio of 1:3 DNA to Fugene 6 and the complex was incubated at room temperature for 20 min during this time the cells were washed 1x with 1X PBS and t he media replaced. The DNA -complex was added to the cells and incubated at 37 were again rinsed 1x with 1X PBS, media replaced and then incubated overnight at 37 humidified air with 5% CO2. At 24 h post transfection, each 10 cm plate of cells was trypsinized and split into two 10 cm plates and incubated overnight. This batch transfection method controls for equal transfection efficiency for each transfected construct. Forty hours post transfection,

PAGE 40

40 cells were stimulated with or without 2 ng/mL of IL less construct was also transfected to ensure that the transfection or the hGH plasmid does not have any effect on the mPGES 1 message. RNA Isolation, Northern Blot and Hybridization Total cellula r RNA was isolated as described by Chomczynski and Sacchi with modifications (96,228) or using the Qiagen RNeasy Kit. After treatment with cytokines, cells were rinsed 1x with 1X PBS, lysed on the plate by the addit ion of 500 GTC solution (4M mercaptoethanol) and then lysate transferred to a 1.5 mL tube. The mixture was then vortexed briefly to aid cellular lysis, then 50 2M sodium acetate pH4. 0 followed by 500 water saturated phenol was added to the tube. The lysate was then inverted 5x to mix and incubated at room temperature for 5 minutes. Next, 110 of 49:1 chloroform:isoamyl alcohol mixture was added to the lysate and the tube was sh aken to mix and centrifuged at 13200 rpm for 15 minutes. The aqueous phase was removed to a fresh 1.5 mL tube and an equal amount of isopropanol was added to the sample which was then incubated at 20C for one hour. The sample was centrifuged at 13,200 rpm for 30 minutes at 4C and the pellet was re -suspended in 75 pyrocarbonate (DEPC) treated double distilled water. The RNA was precipitated by the addition of 2 M lithium chloride followed by incubation 20C for 30 minutes. After centrifugation at 13,200 rpm for 30 minutes 4C, the RNA pellet was washed with et hanol, briefly dried and re suspended in 50 150 DEPC -water For Qiagen RNeasy Kit extraction protocol, a fter treatment with cytokines, cells were rinsed 1x with 1X PBS, then lysed on the plate by the addition of 600 Buffer RLT and the lysa te transfe rred to a 1.5 mL tube. The tube was then vortexed briefly to aid cellular lysis, an equal volume of 70% ethanol was added to precipitate the RNA and mixed by pipetting up and down. The RNA was bound by passing the mixture

PAGE 41

41 over a n RNeasy spin column and s pinning the column at 13,200 rpm for 15 seconds. The flow through was discarded and 350 of Buffer RW1 was added to the column. The column was again spun at 13,200 rpm for 15 seconds, the flow -through was discarded and 80 DNase solution (10 DNase 1, 70 Buffer RDD) was added to the column. After a 15 minute incubation at room temperature the reaction was stopped by the addition of 350 Buffer RW1. The column was rinsed 2x with 500 of Buffer RPE spinning at 13,200 rpm for 15 seconds and 2 minutes, respectively. The RNA was eluted from the column by adding 50 DEPC water i ncubation at room temperature 2 minutes then spinning at 13,200 rpm for 1 minute. The concentration w as determined by spectrophotometrical analysis at A260. For northern blot analysis, 20 g of total RNA was size -fractionated on a 1% agarose -formaldehyde gel running at 40V overnight in 1X TBE ( 89 mM Tris, 89 mM Boric Acid and 2 mM EDTA) The size fractionated RNA was electro transferred to a nylon membrane and UV cross linked for 2 minutes The membrane was incubated for one hour in a prehybridization b uffer (0.45M sodium phosphate, 6% sodium dodecyl sulfate (SDS), 1mM EDTA and 1% bovine serum albumin (BSA). A random primed double stranded 32P -labeled gene -specific probe for (human mPGES 1, hGH or human large subunit ribosomal L7a) was added to the preh ybridization solution and the membrane incubated overnight ( mPGES 1 at 65 C, hGH or L7a at 61 C) The membrane was washed three times for 10 minutes at 60 65C in a high stringency buffer (0.04M sodium phosphate, 2mM EDTA and 1% SDS) and exposed to X ray film. Transcription Rate Determination Total RNA was isolated from HFL 1 cells at the indicated time points after treatment with IL transcription rate for mPGES 1, primers specific for Intron 2 and Exon 3 were used for real time

PAGE 42

42 RT PCR after first strand cDNA synthesis to measure the level of pre -mRNA or heterogeneous RNA (hnRNA). The primers used for hnRNA amplification were sense primer 5 TGGCTGTGAATGGATTTGAGTG3 and antisense primer 5 AGGAAAAGGAAGGGGTAGATGG3. This method is based on the published work of Lipson and Baserga (229) To rule out any amplification from contaminating genomic DNA, an equal amount of RNA following first strand cDNA synthesi s without the additio n of Superscript II reverse transcriptase was used as a negative control. First -Strand DNA Synthesis and Real -T ime RT -PCR of total RNA was used to generate first strand cDNA for real time PCR analysis using a SuperScriptTM first stran d s ynthesis kit First -water to a final volume C for 5 minutes then 4 C. Next, 9 mixture (10X RT Buffe r, 25 mM DEPC -MgCl2 m DTT, 40 U/ L RNaseOUTTM Recombinant RNase Inhibitor) was added to the tube which was then incubated at 42 C for 2 (50 U) of SuperscriptTM II RT was added to the tube and the reaction was further incubated at 42 C for 50 minutes. The reaction was terminated by incubation at 70 C for 15 minutes and the tubes were spun briefly in a microcentrifuge. To remove template RNA, 1 (40 U) of RNase H was added to the tube and the reaction incubated at 37 C for 20 minutes The tubes were spun briefly and sterile double Real time PCR was conducted using 2 of iTaq SYBR Green Supermix with ROX and water to a final volume of 25 The primers used for amplification are as follows: human mPGES 1 sense primer, 5 GCCGCCGTGGCTATACC 3, and antisense primer, 5 GGTTCCCATCAGCCACTTC3,

PAGE 43

43 hGH, sense primer 5 GAACCCCCAGACCTCCCT 3, and antisense p rimer 5 CATCTTCCAGCCTCCCCAT 3 mouse mPGES 1 sense primer, 5 TTAGAGGTGGGCAGGTCAGAG 3, and antisense primer, 5 CCACTCGGGCTAAGTGAGAC 3, rat mPGES 1 sense primer 5 CGCAACGACATGGAGACGA 3, and antisense primer, 5 GCGTGGGTTCATTTTGCC 3 human cPLA2 CGT GATGTGCCT GTGGTAGC 3, and antisense primer, 5 TCTGGAAAATCAGGGTGAGAATAC 3 Each real -time PCR reaction was conducted using the Applied Biosystems 7000 sequence detection system (Foster City, CA) with the following parameters: 50C for 2 min, 95C for 10 min follo wed by 40 cycles of 95C for 15 s, 60C for 1 min. At completion, the melting curves were acquired by a stepwise increase of the temperature from 55C to 95C to ensure that a single product was amplified in the reaction. Cyclophilin A levels were also m easured concurrently as the internal control utilizing the following primers: human cyclophilin A sense primer, 5 CATCCTAAAGCATACGGGTCC 3 and antisense primer, 5GCTGGTCTTGCCATTCCTG 3 mouse cyclophilin A sense primer, 5 GCGGCAGGTCCATCTACG 3, and ant isense primer, 5 GCCATCCAGCCATTCCAGTCT 3, rat cyclophilin A sense primer, 5 -GGTGGCAAGTCCATCTACGG 3, and antisense primer, 5TCACCTTCCCAAAGACCACAT 3 Each PCR reaction was done in triplicate based on samples fro m three independent experiments and the determine the relative fold expression, normalized to cyclophilin A as described by Livak et al. (230) Immunoprecipitation Assay HFL 1 cel ls were grown as described and treated with 2 ng/mL of IL as indicated Total cell extracts were prepared in TNE lysis buffer (10 mM Tris HCl pH 8.0, 150 mM NaCl, 1 mM EDTA pH 8.0, 1% NP 40, 10 g aprotinin, 10 g leupeptin, 10 g pepstatin, 5 L of 200

PAGE 44

44 mM PMSF, 25 L DTT) and incubated at 4C overnight with the monoclonal antibody against the indicated protein Protein AG agarose beads were washed 4x in TNE lysis buffer then incubated with the lysates at 4 C for 2 h. Bead complexes were washed 4x with TNE lysis buffer and proteins were eluted using 1X Laemeli buffer followed by immunoblot analysis. Protein Isolation For immunoblot analysis, protein lysates were prepared from HFL 1 as follows; on ice cells were washed twice with cold 1X PBS and lysed by the addition of 50 ul of Tris lysis buffer (1M Tris -HCl pH7.5, 5M NaCl, 0.5M EDTA pH8.0, Triton X 100 plus 1X protease inhibitors ) The cell membrane was further disrupted by the use of a hand held homogenizer and incubated on ice for 10 min The lysa tes were centrifuged at 14,000x g for 15 min at 4 C to remove cellular debris. The supernatant was removed to a fresh pre-chilled 1.5 mL tube and the protein concentration was determined by the bicinchoninic acid (BCA) assay in triplicate. Immunoblot Analysis Total cell extracts or i munoprecipitates wer e separated on a 10% or 1 5 % Tris HCl polyacrylamide gel respectively and electro -transferr ed to a nitrocellulose membrane The membrane was blocked overnight at 4 C with 7. 5% non-fat dry milk in TBST (10 mM Tris HCl, pH 7.5, 0.1% (v/v) Tween 20, 200 mM N aCl). The indicated primary antibody (Egr 1 1 1:400, Alox15B 1:1000) was added to the membrane which was then incubated at 4C overnight The membrane was washed 3 x with TBST, incubated with a peroxidase -conjugated secondary ant ibody (rabbit 1:10,000) for 1 h, washed again 3 x with TBST and subjected to chemiluminescent detection. The membrane was soaked in the detection agent (equal mixture of ECL Advance Solution A and B) for 1 minute then exposed to autoradiography film

PAGE 45

45 DNase I Hypersensitive Site Analysis HFL 1 cells were incubated in the presence or absence of 2 ng/mL IL with PBS then trypsinized for 10 min at 37C. The cells wer e resuspended in 4 mL of permeabi lization buffer (150 mM Sucrose, 80 mM KCl, 35 mM HEPES pH 7.4, 5 mM K2HPO4, 5 mM MgCl2, 0.5 mM CaCl2) containing 0.1% L lyso lecithin on ice for ~2.5 min. The reaction was stopped by the addition of 40 mL permeabilization buffer and the cells pelleted for 5 min utes at 4C. The permeabilized cell pellets were resuspended in 3.2 mL of permeabilization buffer. 300 L of permeabilized cell suspension was digested with increasing concentrations of DNase I for 4 min utes at 37C. The reactions were terminated by the addition of DNA lysis buffer (4% SDS, 0.2 M EDTA and 800 g/mL prote inase K). Genomic DNA was purified by incubation at 50C for 3 h followed by organic extractions and precipitation with ethanol. Samples were then resuspended in 100200 L of TE (10 mM Tris -HCl, pH 8.0 and 1 mM EDTA). The samples were then digested with the restriction enzyme, HindIII, in a total volume of 300 L. The digests were size -fractionated on a 0.8% HGT agarose gel in TAE buffer, pH 7.8 (40 mM Tris, 3 mM NaOAc, 1 mM EDTA, 4 mM NaOH) overnight at 40 V to resolve the DNA fragments. The gel was th en alkaline -denatured by incubation in 5 0 mM NaOH for 30 minutes then 0.1M TBE ( 1M TBE: Tris 242g, Boric Acid 107g, EDTA 6g) 2x for 30 minutes. The gel was electro transferred to a nylon membrane, and cross -linked to the membrane with UV light 2 minutes The membrane was hybridized with an end-specific single copy DNA probe at 61 C. The DNA probes used were generated by PCR from the human mPGES 1 genomic clone using the following primers; 19.6 k b end forward 5 GCTTAATGCATGAAGTGGTTAC 3, reverse 5 -AAGATG AAGCTGCCTTTGAG3 and 6.8 k b end forward 5 TCAGGATGCAGAGCCAAGC 3, reverse 5 CCAGTGAACTACAGGCACCAG 3. The

PAGE 46

46 DNA probe was radiolabeled using the random primer DNA labeling system and hybridized to the membrane. Hybridization and autoradiography were per formed as previously described. Chromatin Immunoprecipitation Analysis Chromatin immunoprecipitation (ChIP) analysis was performed according to a modified protocol from Upstate Biotechnology, Inc. (Charlottesville, VA) HFL 1 cells were grown to 90% conf luency on 150 mm plates and cross linked with 1% formaldehyde for 10 min at room temperature and quenched by the addit ion of 125 mM glycine for 5 min The cells were then scraped into 50 mL conical tubes and centrifuged at 3000 rpm for 15 min at 4 C Th e pellet was washed 2x with 1X PBS and resuspended in cold swelling buffer (5 mM PIPES pH 8.0, 0.5% NP 40, 85 mM KCl plus 1X protease inhibitors) and incubated on ice for 10 min. The swelled cells were then centrifuged at 5,000 rpm for 5 min at 4 C and t he cell pellet was gently resuspended in 1 mL lysis buffer (1% SDS, 50 mM Tris pH 8.1, 10 mM EDTA and 1X protease inhibitors). The lysates were sonicated to ~500bp fragments using a Branson Model 500 dismembrator (Fisher Scientific) at 40% amplitude for 5 x 30 sec bursts with 2 min rest on ice between bursts. The sonicated samples were removed to 1.5 mL tubes and centrifuged at 13,000 rpm for 5 min at 4 C to clear cell debris. The supernatants were diluted 1:10 in ChIP dilution buffer (0.1% SDS, 1.2 mM E D TA, 16.7 mM Tris pH 8.1, 167 mM NaCl and 1.1% Triton X 100), then pre C The pre cleared tubes were incubated overnight at 4 C blocked with 30% BSA were added to each tube to capture the complex. Following incubation at 4 C for 2 h, the complexes were isolated by centrifugation at 1,000 rpm for IgG control samples were removed for I nput controls and the complexes were washed as follows: once with low salt (0.1% SDS, 1% Triton X 100 (v/v), 20 mM Tris pH 8.1, 2 mM

PAGE 47

47 EDTA, 150 mM NaCl), high salt (0.1% SDS, 1% Triton X 100 (v/v), 20 mM Tris pH 8.1, 2 mM EDTA, 500 mM NaCl), LiCl (250 mM LiCl, 1% NP 40, 1% sodium deoxycholate (DOC), 10 mM Tris pH 8.1, 1 mM EDTA) and three times with TE (10 mM Tris pH 8.0 and 1 mM EDTA pH 8.0). (1% SDS and 100 mM NaHCO3) with incubation at 37 C and rocking for 30 min. The eluted samples were centrifuged at 2,000 rpm for 2 min at room temperature, and the supernatants were removed to a fresh 1.5 mL tube. To remove contaminating protein, the elu ted samples and I nput controls were treated with the addition of the following solutions to reach final concentrations of 11 mM EDTA, 200 C for 1 h followed by reverse cross link at 65 C fo r 4 h. The samples were purified with the Qiagen PCR kit and subjected to real -time RT PCR analysis. The forward primer 5 ACAGCTCTGGGCGCACAC 3 and reverse primer 5 TGGGGAAATGGGAATGACTG3 were used to ampl if y region 8.6 to 8.1 kb ; the forward primer 5 CGGCAACTGCTTGTCTTTCTC 3 and reverse primer 5 TCTTGATGACCAGCAGCGTG 3 were used to amplify the promoter region of human mPGES 1. T he forward primer 5 GCATCAAAAACATCACTCCCTCT 3 and reverse primer 5 ACTCCAGCTTGGGCAACAGA3 were use d to ampl if y the 3 UTR and the forward primer 5 -AGAAGCGTAAACATCACTCTCCTC 3 and reverse primer 5 ACAGCCTCACAGACATACCCAG 3 were used to amplify the 5UTR of mPGES 1 as negative control s All results are expressed as a fraction of the total isolated chromosomal DNA (input) prior to immunoprecipitation or relative to IgG, as specified Short Interfering RNA ( siRNA ) A nalysis HFL 1 cells were seeded on 35 mm plates at 50% confluency and transfected with a final concentration of 100 nM SMART or a cyclophilin -

PAGE 48

48 specific siRNA (Dharmacon) using Dharma FECTTM 1 siRNA transfection reagent (Dharmacon) according to manufacturers protocol. Briefly using 15 mL tubes, in tube A, 100 X siRNA buffer and mixed with an equal volume of serum free of tube A. Both tubes were incubated at room temperature for 5 min, then the contents of both tu bes were combined and the single tube was incubated at room temperature for 20 min. Depending on the number of plates used, complete media was then added to the tube and the contents divided equally among the plates Treatment with Dharma FECTTM 1 without siRNA was used to control for transf ection reagent specific effects. After 72 h incubation, one set of plates were treated with 2 ng/mL of IL analyzed by immunoblot analysis or reverse transcription followed by real -time RT PCR. Densitometry and Statistical Analysis All densitometry was quantified from autoradiography films using a Microtek scan maker 9600XL and analyzed with NIH Scion Image analysis software. The relative foldinduction was determined for the mPGES 1 mRNA band or the hGH mRNA band, normalized to the L7a ribosomal protein internal control For real -time RT PCR analysis, eac h reaction was done in triplicate to cyclophilin A. Data points are the means from at least three independent experiments and the error bars represent the standard error of the means (SEM). An asterisk (*) denotes significance as determined by a Students t test to a p value 0.05 and (**) denotes a p value 0.01.

PAGE 49

49 Table 2 1. Primers used for generating mPGES 1 fragments Primer Pairs Primer Sequence 5 to 3 Human mPGES 1 Promoter 434/+160 F AAGCTTTCCA TTGTCCAGGCTGAGTGT R GGATCCTTCTTCCGCAGCCTCACTTG Human mPGES 1 Promoter 1.1 /+160 F AAGCTTAGAGTCAGTTGATAGGTCTTTCGGG R GGATCCTTCTTCCGCAGCCTCACTTG Human mPGES HS2 Fragment F ACGCGTCCGGCAGTCTGAGC TGAGT R -ACGCGTTGGCCCTGGGTCCT GACT Human mPGES 1 (10.7 to 9.6) F ACGCGTCCGGCAGTCTGAGCTGAGT R -ACGCGTGTCATCACGCCTGACGGAC Human mPGES 1 (10.1 to 9.0) F ACGCGTCTAAAGGGTGTCTGGCCATTAGG R -ACGCGTCCACGGGCTGCAGAGGAG Human mPGES 1 (9.5 to 8.5 ) F ACGCGTGTCAGGAGTTCAAGACCAGCC R -ACGCGTTGGAATTGCACACTTGAAGATG Hu man mPGES 1 (8.6 to 6.4) F CCGTCAGGGACGCGT/CCCT GCATTTAACGC R -GCGTTAAATGCAGGG/ACGC GTCCCTGACGG Human mPGES 1 (8.6 to 8.1) F ACGCGTAGAAGGAGAGGGCGGCATC R -ACGCGTGGAGAGTTGCCCAGGCTAGAGT Human mPGES 1 (8.1 to 7.5) F ACGCGTCTGGGCAACTCTCCGTCTCA R -AC GCGTGCAGTGAGCCATGCTGTGATC Human mPGES 1 (7.6 to 6.4) F ACGCGTTGCTTCCGGCCTGTTTATTT R -ACGCGTTGGCCCTGGGTCCTGACT (8.6 to F GTTCAGGCCGTCTGT/TATT TACCAAGCACAGCTC R GAGCTGTGCTTGGTAAATA/ ACAGACGGCCTGAAC (8.6 to 8.1) F CATTGGTACAGTCACAATA/ ATCTTTACCATCCATTTCC R GGAAATGGATGGTAAAGAT/ TATTGTGACTGTACCAATG (8.6 to F TTGCAACCATCTTTACCATC C/CATTTTCATCATCCCAG R CTGGGATGATGAAAATGGGAT/GGTAAAGATGGTTGCAA

PAGE 50

50 CHAPTER 3 IDENTIFICATION OF DNASE I HYPERSENSITIVE SITES INVOLVED IN THE INTERLEUKIN 1 BETA (IL AL PROSTAGLANDIN E SYNTHASE 1 (M PGES 1) GENE EXPRESSION Introduction Induction of Microsomal PGES -1 G ene Expression by P ro -Inflammatory C ytokines PGE2 is known to be involved in a variety of biological processes including reproduction, gastric mucosal protection, pyresis, vasodilatation, sleep and many d isease states (3,7,10,28,231,232) T he conversion of PG H2 to PG E2 is catalyzed by the ac tion of specific PGE synthases, in particular mPGES 1 but while PGE2 production and activities have been widely studied in a variety of cell types, little is known about the regulation of mPGES 1. Jakobsson et al. (192) were among the first to show that mPGES 1 gene expression is induced by the proinflammatory cytokine, IL 1 mRNA expression is also induced by LPS (219,233) TN (201,234) (235) phorbol esters such as phorbol 12-myristate 13 acetate (236) and by the flavo noid ep igallocatechin 3 -gallate in a number of cell types (237) Stimulus -Dependent A ctivity of the Microsomal PGES -1 P romoter Forsberg et al. (205) analyzed the transcriptional activity of minimal mPGES 1 promoter fragments in transfected human epithelial cells (A549) derived from a lung adenocarcinoma They gener ated two promoter fragments, 0.19 kb and 0.65 kb fragments, an d observed that the transcriptional activity of each promoter fragment increased ~2 fold in response to treatme nt with IL acting elements involved in basal mPGES 1 gene expression are contained within the proximal 0.19 kb promoter fragment. In a later study by Han et al. (238) using a 0.51 kb mPGES 1 promoter construct in human orbital fibroblasts, they illustrated that mPGES 1 promoter activity is up regulated following IL

PAGE 51

51 validating the previous study by Forsberg et al. (205) Their study also evaluated a 1.8 kb COX 2 promoter fragment and revealed that like mPGES 1, COX 2 promoter activity is also induced following IL Other studies have shown that mPGES 1 promoter activity is upregulated in response to treatment by phorbol esters (206,239) thapsigargin (239) and TNF (234) Alternatively, it should be noted that stimulus -dependent activation of the mPGES 1 promoter is inhibited by the peroxisome -proliferator activating receptor (PPAR) ligands (240,241) inhibition of histone deacetylase activity (242) and inhibition of protein kinase C (243) Involvement of the E arly G rowth Response F actor, Egr -1 in the R egulati on of Microsomal PGES -1 E xpression Recently, the transcription factor, Egr 1 was found to be important for mPGES 1 gene expression. In 2000, Forsberg et al. (205) i dentified the presence of two GC boxes with in the mPGES 1 proximal promoter by sequence analysis. Later, Naraba et al. (206) evaluated the importance of these two GC boxes in relation to mPGES 1 gene expression Based on deletion analysis of the promoter region, they showed that Egr 1 binding induced promoter activity 2.0 3.0 fold in the presence of a stimulus. Subsequent deletion of the Egr 1 binding site atte nuated mPGES 1 promoter activity. A few years later, Moon et al. (207) validated these findings by inhibiting Egr 1 expression, i n A549 cells using an siRNA against Egr 1 T hey further showed that inhibition of Egr 1 expression led to a significant decrease in mPGES 1 promoter activity. Combined with further studies by other groups (234,237,240,242) a clear role for Egr 1 activity in regulating the inducible expression of the mPGES 1 promoter has been outlined. While Egr 1 is required for mPGES 1 transcriptional activation, suppression of Egr 1 expression does not completely block induced mPGES 1 expression (237) Moreover, treatment with IL example causes an ~8 fol d induction of steady state mPGES 1 mRNA levels compared to the

PAGE 52

52 published 2 fold induction observed with minimal proximal promoter fragments. Furthermore, mutagenesis of the Egr 1 binding site does not always completely eliminate this level of induction. Therefore, these findings imply that other transcription factors may be involved in the regulation of mPGES 1 gene expression and thus is the basis for our attempts to identify additional regulatory sequences that are potentially responsible for the IL -dependent regulation Results Induction of Microsomal PGES -1 Messenger RNA and P rotein E xpression by the P ro I nflamm atory C ytokine, IL H uman Lung F ibroblasts PGE2 is known to be cyto-protective in the lung and recent studies have shown that mPG ES 1 expression is upregulated in lung fibroblasts in a stimulus dependent manner (15,205,222) therefore human lung fibroblasts (HFL 1) were used as the cell model for studying the regulation of mPGES 1 gene expre ssion. In the initial studies, a dose re s ponse with IL was conducted to determine the effective concentration that produce d the large st induction of mPGES 1 gene expression. HFL 1 cells were incubated with increasing concentrations of IL (0.5 10 ng/mL) and total RNA isolated. Purified R NA was analyzed by real time RT-PCR and data was evaluated for the level of induction compared to the untreated control which was normalized to 1. As illustrated in Figure 3 1, 2 ng/mL of IL induced mPGES 1 mRNA expression approximately 8 fold; therefo re this concentration will be used for all subsequent treatments. After continued stimulation with IL mPGES 1 mRNA expression was analyzed by northern blot The results in Figure 3 2 provide a representative norther n analysis and reveal that endogenous steady -state levels of mPGES 1 mRNA expression is induced in a time dependent manner with an apparent maximal induction by 8 12 h To

PAGE 53

53 quantify this increase in mRNA expression, HFL 1 cells were treated with IL se of 8 h, total RNA was isolated and subjected to real time RT -PCR analysis with mPGES 1 specific primers. The chart in Figure 3 3 illustrates that similar to the northern blot analysis in Figure 3 2, mPGES 1 mRNA levels increased approximately 9 fold in a time dependent manner by 8 h. To demonstrate that the increase in mRNA levels translates into a logical increase in protein levels, mPGES 1 p rotein expression was evaluated following IL in HFL 1 cells There are two commercially available antibodies used to detect mPGES 1 protein but af ter unsuccessful attempts to detect mPGES 1 p rotein expression by standard immunoblot analysis we devised an immunoprecipitation proto col as described in the Materials and Methods. To quantify mPGES 1 protein expression, total protein from control and stimulated cells was immunoprecipitated with a mouse monoclonal antibody to mPGES 1, then size fractionated by SDS/PAGE followed by immun oblotting with a rabbit polyclonal mPGES 1 antibody. The immunoprecipitation analysis in Figure 3 4 revealed that in control cells, there is no detect able mPGES 1 protein expression but following 72 h of IL stimulation, mPGES 1 protein expression was significantly elevated thereby demonstrating that IL caused a significant induction of both mPGES 1 mRNA and protein levels Determinati on of Microsomal PGES -1 Messenger RNA Decay A fter S ti mulus R emoval The classical experiment to evaluate mRNA half life involves stimulating cells for a short time period, followed by the addition of actinomycin D to globally inhibit transcription ; samples are then analyzed at various time points post treatment to determine the level and time -dependent degradation of the message Since there is often no detectable basal expression of mPGES 1, the measurement of basal mRNA decay cannot be accurately determined. We therefore chose to evaluate the decay of the induced message by first treating with IL

PAGE 54

54 mPGES 1 mRNA followed by removal of the stimulus. HFL 1 cells were stimulated for 8 h with IL was added to the cells. Cells were harvested at specific time points over the course of 12 h, total RNA isolated and analyzed by nort hern blot. The data in Figure 3 5 reveal s that at 6 h post stimulus removal, a rapid decay of the mRNA levels was observed wh ere by 12 h the mRNA levels were almost undetectable. The I L-1 Gene E xpression R equires D e N ovo Transcription In order to determine w hether the IL 1 induction of mPGES 1 gene expression was a consequence of regulation at the transcriptional level, a global transcriptional inhibitor actinomycin D was utilized and steady state m RNA levels were measured HFL 1 cells were treated with actinomycin D alone to inhibit global transcription in the absence or presence of IL 1 mRNA expression was analyzed by norther n blot. The re sults in Figure 3 6 indicate that treatment with actinomycin D alone did not affect mPGES 1 mRNA expression while actinomycin D did bl ock the IL on of mPGES 1 mRNA expression. To directly address whether de novo transcription is responsible for t he IL -dependent induction of mPGES 1 expression, heterogeneous nuclear RNA levels were evaluated by real time RT -PCR amplification across an intron -exon boundary. Heterogeneous nuclear RNA (hnRNA) is a pre -mRNA intermediate, that exists prior to splici ng, containing both introns and exons The level of hnRNA present at any given time directly correlates with the presence of de novo transcription (229) As an alternative to the classical nuclear run off assay, t he measure of hnRNA is being utilized as an efficient and quantitative assessment of de novo t ranscription Primers spanning the intron 2/exon 3 boundary were designed and utilized for real time RT-PCR amplification.

PAGE 55

55 The data in Figure 3 7 illustrates tha t within 0.5 h of IL treatment, there is a significant increase in hnRNA levels with a maximum at 1 h (~8 9 fold) thus indicating that de novo transcription is required for the IL 1 gene expression. The decrease in induction fol lowing 1 h is possibly due to the competing rates of new hnRNA synthesis and the time at which intron splicing eliminates the template for the intron specific primer. Evaluation of the Microsomal PGES -1 P roximal P romot er in the HFL 1 cells In an attempt to elucidate the mechanism involved in regul ating mPGES 1 gene expression, mPGES 1 promoter activation was evaluated following IL A 1.1 k b and 0.6 k b mPGES 1 promoter fragment were generated by PCR and cloned into a human growth hormone (hGH) reporter construct. The human GH reporter gene is a complete genomic locus with introns and exons, producing hnR NA followed by normal splicing events Moreover, hGH mRNA is known to have a relatively long half -life (12 18 h) so assessment of th e mRNA by northern blot or real time RT-PCR is not subject to issues of decay. Another advantage of the system is that i t allows for the direct measurement of transcription by evaluating mRNA levels rather than detecting the levels of p rotein activity. HFL 1 cells were transiently transfected with each construct and total RNA was analyzed by northern blot for growth hormone expr ession. The diagram in Figure 3 8(A) depicts the two mPGES 1 promoter/reporter constructs. The results in Figure 3 8 (B) indicate that in the absence of stimulus, there is basal growth hormone expression with each promoter construct and upon the addi tion of IL a further increase in growth hormone expression. Densitomet ric analysis of three experiments revealed that the 1.1 k b promoter construct conferred a 2.5 fold increase in promoter activation following IL k b promoter conferred a 1.5 fold increase (data not shown)

PAGE 56

56 Previous studies by Naraba et al. (206) and Moon et al. (207) highlight the importance of the transcription facto r Egr 1 in the stimulus -mediated activation of the mPGES 1 promo ter. Therefore the binding site for Egr 1 was located within the mPGES 1 1.1 kb promoter construct and subsequently deleted by site -directed mutagenesis. A binding was also identified in the 1.1 kb promoter by computer analysis as indicated in Figure 3 9(A) and also deleted by site -directed mutagenesis. The mutant constructs were transiently transfected into HFL 1 cells and growth hormone expression was analyzed by northern blot. Figure 3 9 (B) illustrates the result of the northern blot analysis and reveals that in the absence of Egr 1, both basal and induced growth hormone expression is significantly reduced while deletion of the t affect the induction and showed an expression pattern similar to that of the wild type promoter. Analysis of I nternal C is A cting Elements T hat M ay be I nvolved in R egulating Microsomal PGES -1 G ene Expression The published studies on the minimal mPGES 1 pr omoter and our efforts shown in Figure 3 8 and Figure 39 demonstrate that although a ~ 2 fold induction is observed following stimulus treatment, the proximal promoter fragments do not recapitulate the steady state increase of ~ 8 to 9 fold (Figure 3 2 an d Figure 3 3) Therefore, i n an attempt to identify additional potential regulatory elements within the mPGES 1 locus a series of overlapping fragments across intro n 1 to the beginning of exon 3 were generated as indicated in Figure 3 1 0 (A) This strate gy was based more on our laboratorys previous experience in identifying internal cytokine -dependent regulatory elements versus an experimental rationale for mPGES 1. T he fragments were cloned into the 1.1 k b promoter fragment driving human growth hormone expression and analyzed by transient transfection and northern blot. All fragments were analyzed; whereas Figure 3 1 0 (B) illustrates a representative blot of three fragments indicating that none of the fragments

PAGE 57

57 conferred a significant increase in growt h hormone expression over that of the wild type promoter construct. As such the brute force approach was clearly not adequate to systematically identify relevant regulatory sequences. Microsomal PGES -1 Chromatin Structure: DNase I H ypersensitive S ite A na lysis As an alternative strategy, DNase I hypersensitive analysis was undertaken as an approach that can: (i) scan larger regions for alterations in chromatin structure; (ii) provide a rationale that open chromatin structure or hypersensitive sites would h arbor regulatory factors and their analogous binding sites and; (iii) ultimately rapidly identify, although not based on functional significance, regulatory sequences relevant to IL Located on the long arm of chromosome 9, t he mPGES 1 gene spans 15 k b containing two introns and three exons and thus can be effectively studied by DNase I hypersensitive site analysis due to its small size First, a restriction fragment of at least 10 13 k b was identified then a single copy probe specific to one end of the fragment was generated by PCR which would later b e used for indirect -end labeling coupled to S outhern analysis DNase I hypersensitive site analysis was performed a s described in the Materials and Methods, with HFL 1 cells incubated in the ab sence or presence of IL Cells were permeabilized with lyso -lecithin to allow access of DNase I i ndividual samples were then treated with increas ing concentrations of DNase I and total genomic DNA was purified. DNA was cut by restriction digest using an enzyme to define fragments flanking the mPGES 1 locus, size -fractionated on an agarose gel transferred to a nylon membrane and subjected to Southern analysis using indirect labeling with a single copy probe. This displays any regions of altered chromatin and allows for the direct mapping of these sites based on the indirect end labeling. The diagram in Figure 3 11(A) schematically depicts the position of a 13.3 kb HindIII fragment which spans from 6.4 to +6.8 kb, mapping a region directly 5 to the transcriptional initiation site. Figure 3 1 1 (B) illustrates the result of a hypersensitive site analysis of the

PAGE 58

58 promoter region whi c h revealed the existence of a constitutive hypersensitive site which maps at ~ 0.3 k b This correlates with the location o f the Egr 1 binding site in the proximal promoter In a similar analysis, an adjacent HindIII frag men t spanning from 19.6 to 6.4 kb depicted in Figure 3 12(A) was evaluated. Similar to the proximal promoter DNase I site designated HS1, a second hyperse nsitive site was identified, present in both control and IL treated cells. Figure 3 1 2 (B) shows the result s for this second hypersensitive site analysis looking further 5 of the promoter and demonstrating the existence of a constitutive hyper sensitive site that maps to ~ 8.6 kb Discussion Previous reports indicate that mPGES 1 gene expression is up regulated in response to cytokine treatment in a number of cells and tissue s including the lung (207,237,244247) Whereas, in the absence of stimuli, there is low level basal mRNA and protein expression of endogenous mPGES 1. Presumably this is a consequence of the cells maintaining a homeostatic balance, due to a lack of substrate produced from the upstream activi ties of PLA2 and COX enzymes which does not require the synthesis of downstream synthases such as mPGES 1. Alternatively, in inflammatory situations where systemic/immune cell -derived pro-inflammatory mediators such as IL gnaling molecules, such as prostanoids, are induced to locally initiate events such as vasoconstriction or airway responsiveness. The data presented in this dissertation illustrates that, in human lung fibroblast cells, mPGES 1 mRNA and protein expression are both induced at high levels following treatment with the pro inflammatory cytokine, IL In addition, t reatment with the global transcriptional inhibitor actinomycin D blocked the IL 1 mRNA and evaluation of mPGES 1 heterogeneous nuclear RNA levels following IL ificant increa se in the level of un -spliced message within 1 h of cytokine treatment. Both studies

PAGE 59

59 demonstrate that de novo transcription is at least in part required for the IL and as a n alternative to de novo transcriptional events, the sta bility of the mPGES -1 message could also have an impact on stimulus dependent inc reases. The results shown in Figure 3 5 indicate that the mRNA for mPGES 1 has an induced half -life around 6 h. In 2006 Degous e e et al. (233) showed that in cardi o myocytes stimulated with IL in conjunction with actinomycin D, the mPGES 1 mRNA half life was about 6 h an observation consistent with our results. Analysis of mPGES 1 promoter activity by transient transfection revealed approximately a 2 fold i ncrease in expression following IL Naraba et al. (206) identified an Egr 1 consensus site which is highly similar to the Sp1 binding site, in the mPGES 1 promoter and illustrated the importance of th is site by promoter deletion analysis. Similar to their study, the Egr 1 binding site was evaluated in the human mPGES 1 1.1 k b promoter construct used in our work. Deletion of the Egr 1 sequence revealed that loss of Egr 1 binding attenuated promoter ac tivity with a loss of both the basal and induced expression. Further, a computer predicted binding site for the transcription facto was identified within our 1.1 k b promoter construct and deletion of this site did not appear to have an effect on the basal or induced expression of the promoter. Together these studies revealed the importance of Egr 1 in basal and induced promo ter activation but the proximal promoter alone did not recapitulate the level of induction seen by northern analysis of endogenous mPGES 1 gene expression stimulated with IL We have shown that endogenous expression of mPGES 1 is induced 8 10 fold by IL but activation of the promoter by Egr 1 only generates a ~2 fold increase in mPGES 1 expression Therefore, the assumption that potential regulatory elements exist outside of the proximal promoter region could account for the observed increase in endogenous expression by

PAGE 60

60 IL In our attempt to analy ze the mPGES 1 locus, overlapping fragments 3 to the start of transcription were evaluated in context of the human mPGES 1 1.1 kb promoter construct. None of the fragments analyzed were able to elicit a n increase in the IL endogenous mPGES 1 mRNA. Furthermore, each fragment behaved similar to the proximal promoter and only generated a ~1.5 2 fold increase in promoter activity. DNase I hypersensitive analysis can be used to detect subtle changes in chromatin structure and for scanning large regions of DNA. The alterations in chromatin structure are known to be associated with binding of regulatory factors and gene transcription, thus t his method was employed in our next study. There are inducible and constitutive DNase I hypersensitive sites, both of which are associated with transcriptional activation. Our results identified two constitutive hypersensitive sites T he first site actually mapped to the proximal promoter region ~ 0.3 kb and the Egr 1 site which was function ally analyzed in this chapter. The second site, HS2, is also a constitutive hypersensitive site and maps further 5 of the promoter at ~8.6 kb. Although this site is also constitutive, a finer analysi s may illustrate the existence of regulatory elements within this site that could possibly account for the regulation of mPGES 1 expression through inducible binding of transcription factors but which cannot be observed at the level of this chromatin stud y In Chapter 4, the HS2 site will be further analyze d in an attempt to identify elements involved in the regulation of mPGES 1 gene expression by IL

PAGE 61

61 Figure 3 1. Induction of mPGES 1 gene expression by the pro inflammatory cytokine, IL huma n lung fibroblasts HFL 1 cells were treated with increasing concentrations of IL time PCR for mPGES 1 mRNA expression. The graph depicts three independent experiments and the asterisk (**) indicates statisti cal significance with p value 0.01 compared to the untreated sample.

PAGE 62

62 Figure 3 2. Induction of mPGES 1 mRNA expression by IL HFL 1 cells were treated with or without IL was extra cted and analyzed by northern blot. The membrane was hybridized with radiolabeled probes for mPGES 1 and L7a (L7a serves as the loading control).

PAGE 63

63 Figure 3 3. Induction of mPGES 1 mRNA expression by IL : HFL 1 cells analyzed by quantitative real -time RT PCR analysis HFL 1 cells were treated with or without IL 8 h. Total RNA was extracted and subjected to real -time RT PCR to determine mPGES 1 and cyclophilin A mRNA levels. The mPGES 1/cyclophilin A ratio of untreated cells was set to 1. The graph depicts a summary of three independent experiments, where the data points are represented as mean SEM (standard error of the mean). The a sterisk (*) indicates statistical significance with p value 0.0 5 and (**) indicates p value 0.01 as compared with the control sample

PAGE 64

64 Figure 3 4. Induction of mPGES 1 protein expression by IL HFL 1 cells were stimulated with IL for 72 h, total protein was isolated and immunopr ecipitated with a monoclonal antibody against mPGES 1 Immunoblot analysis was conducted with a polyclonal antibody against mPGES 1

PAGE 65

65 Figure 3 5. Determination of mPGES 1 mRNA decay following stimulus removal. HFL 1 cells were stimulated with IL r 8 h; the stimulus was removed and fresh media was added to each plate. The cells were lysed at the indicated times, total RNA extracted and analyzed by northern blot. The membrane was hybridized with radiolabeled probes for mPGES 1 and L7a.

PAGE 66

66 Figure 3 6. The IL 1 gene expression requires de novo transcription. HFL 1 cells were treated with actinomycin D in the absence or presence of IL At the indicated time points, t otal RNA was isolated and analyzed by northern blot. The membrane was hybridized with radiolabeled probes for mPGES 1 and L7a (L7a serves as the loading control).

PAGE 67

67 Figure 3 7. The IL 1 gene expression requires de novo transcription : Analysis of hnRNA levels HFL 1 cells were stimulated with IL for the indicated times and total RNA isolated then subjected to real -time RT PCR analysis to detect mPGES 1 hnRNA levels The mPGES 1 hnRNA/cyclophilin A ratio of untreated cells was set to 1. The graph depicts a summary of three independent experiments, where the data points are represented as mean SEM (standard error of the mean). The a sterisk (*) indicates statistical significance with p value 0.05 and (**) indicates p value 0.01 as compared with the control sample

PAGE 68

68 Figure 3 8. Evaluation of the mPGES 1 proximal promoter. A) A depiction of t he mPGES 1 promoter fragments driving the expression of human growth hormone (hGH) reporter B) HFL 1 cells were transiently transfected with either the 1. 1 kb or the 0.6 kb promoter construct and 40 h post transfection cells were either untreated or stimulated with IL h. Total RNA was extracted and analyzed by northern blot. The membrane was hybridized with radiolabeled probes for hGH and L7a.

PAGE 69

69 Figure 3 9. Evaluation of the mPGES 1 proximal promoter. A) A schematic of the 1.1 kb promoter fragment indicating the location of transcription factor binding sites for Egr 1 ( 0.1 0.9 kb) relative to the star t of transcription (+1). B) The binding sites of Egr ) from the 1.1 kb promoter fragment construct by site -directed mutagenesis Each construct was transiently transfected into HFL 1 cells and 48 h later, t otal RNA was extracted from control and IL analyzed by northern blot. The membrane was hybridized with radiolabeled probes for hGH, mPGES 1 and L7a.

PAGE 70

70 Figure 3 10. Analysis of internal cis acting elements that may be involved in regulating mPGES 1 gene expression A) A series of overlapping fragments spanning from the beginning intron 1 to the beginning of exon 3 were generated by PCR and cloned into the 1.1 k b mPGES 1 promoter construct driving hGH expression. B) HFL 1 cells were transiently transfected with the indicated construct and total RNA was isolated from untreated or cytokine treated plates then analyzed by northern blot. The membrane was hybridized with radiolabeled probes for hGH and L7a.

PAGE 71

71 Figure 3 11. mPGES 1 chromatin structure: DNase I hypersensitive site analysis 1 A) A diagram of the mPGES 1 gene, indicating the location of a 13.3 kb HindIII fragment covering 6.4 to +6.8 kb. The dark arrow ( ) at the front of the 13.3 kb line indicates the location of a single copy probe abutting the 5end of the HindIII restriction site which was used for indirect end labeling of the genomic restriction fragment as well as hybridizing to HS1 located at ~ 0.3 kb. B) Southern blot analysis of a 13.3 kb fragment to detect HS sites within the mPGES 1 promoter region M denotes the molecular weight markers and the ( ) lane indicates the genomic HindIII fragment with no DNase I treatment. The triangle denotes increasing concentrations of DNase I in control and cytokine treated cells. The arrow on the right side indicates the approximate size of the H S1 site (~6.1 kb) which maps to the proximal promoter region of the mPGES 1 gene.

PAGE 72

72 Figure 3 12. mPGES 1 chromatin structure: DNase I hypersensitive site analysis 2 A) A depiction of the mPGES 1 gene, indicating the location of a 13.2 kb HindIII frag ment covering 19.6 to 6.4 kb. The dark arrow ( ) at the front of the 13.2 kb line indicates the location of a single copy probe abutting the 5end of the HindIII restriction site which was used for indirect end labeling of the genomic restriction fragment as well as hybridizing to HS1 located at ~ 8.6 kb. B) Southern b lot analysis of a 13.2 kb fragment to detect HS sites within the mPGES 1 genome T he ( ) lane indicates the genomic HindIII fragment with no DNase I treatment. The triangle denotes increasi ng concentrations of DNase I in control and cytokine treated cells. The arrow on the right side indicates the approximate size of the HS1 site (~ 11 kb) which maps to the distal promoter region of the mPGES 1 gene.

PAGE 73

73 CHAPTER 4 FUNCTIONAL ANALYSIS OF PROMOTE R AND DISTAL REGULATORY ELEMENTS CONT ROLLING THE IL SYNTHASE 1 (M PGES 1 ) GENE EXPRESSION Introduction Gene transcription is commonly associated with remodeling of chromatin structure. In the inactive state, DNA is tightly associated with nucleosomes and maintained as heterochromatin; virtually prohibiting the binding of transcription factors to the DNA. When gene transcription is activated, the nucle osomes are modified allowing access to DNA and subsequent binding of transcription factors and the general transcription machinery. The balance between gene silencing and activation is known to be mediated by the action of histone deacetylases and acetyltransferases, respectively (248252) During gene transcription, DNA is also more susceptible to DNase I digestion leading to the detection of hypersensitive sites. There are two types of hypersensitive sites, constitutive and inducible. In constitutive sites, DNA is held open and free of nucleosomes, independent of a stimulus. These sites are normally associated with the promoter region of genes poised for transcriptional activation (253255) On the other hand, for inducible sites, DNA and nucleosomes are tightly associated and upon addition of stimulus the chromatin structure is modified, the nucleosomes are removed allowing access to the DNA, which is now sensitive to DNase I cleavage (254,255) These hypersensitive sites are thought to be devoid of nucleosomes and usually found within the 5 region of genes, close to or within regions that are involved in regulating gene expres sion. globin locus control region revealed the presence of enhancer elements with in hypersensitive sites that are known to control gene expression (256258) Enhancers elements are known to act in both a position and orientation independent manner and in the context of a heterologous promoter (259)

PAGE 74

74 As shown in Chapter 3, published data and the results presented thus far, implicate the need for additional elements to explain the level of cytokine -mediated induction. The da ta presented in Figure 3 12 indicated the existence of a DNase I hypersensitive site mapping at ~8.6 kb, 5 to the transcription initiation site. Although it is a constitutive site, analysis of this region for functional activity seemed to be the next log ical approach. Results Functional A nalysis of the D istal Hypersensitive S ite HS2 Relative to the Microsomal PGES -1 P romoter In the previous chapter two DNase I hypersensitive sites were identified within the mPGES 1 genome, one mapping to the proximal pro moter region at the Egr 1 binding site and the other in the distal 5 region of the promoter (~8.6 kb) Since the first hypersensitive site mapping to the proximal promoter region was previously evaluated in the proximal promoter constructs the distal hy persensitive site HS2, will now be evaluated in context with the mPGES 1 promoter A fragment spanning HS2 region, 10.7 to 6.4 kb, was amplified by PCR and cloned in front of the 1.1 k b promoter construct driving human growth hormone expression Activ ity of the construct was then evaluated by transient tran s fection and northern blot analysis in HFL 1 cells. Figure 4.1 (A and B) illustrates the location of the 10.7 to -6.4 kb fragment around the HS2 site and the results of the transfection. In the pr esence of the 10.7 to 6.4 kb fragment, there was a significant increase in basal growth hormone expression compared to the wild type construct. Treatment with IL expression with the HS2 containing construct. The membrane was also reprobed for mPGES 1 expression demonstrat ing the normal level of IL Also, comparing the un-induced lane for the promoter alone (1.1 kb) with the induced lane in the HS2 construct (1.1 + ( 10.7 to 6.4)) clearly illustrates a comparable level of induction to the endogenous gene. A graph

PAGE 75

75 depicting densitometry of three independent experiments is shown in Figure 4 2 and illus trates that the IL 1 if compared back to the untreated promoter alone samples normalized to 1 HS2 Exhibits C haracteristics of an E nh ancer: Evaluation of HS2 U sing a Minimal Thymidine K inase H eterologous P ro moter The fragment was then analyzed for enhancer activity This was acc omplished by sub cloning the 10.7 to 6.4 k b fragment into a human growth hormone reporter construct containing a 0.2 k b minimal viral thymidine kinase promoter fr agment This experi ment would demonstrate the ability of this region to work with a heterologous promoter in a stimulus dependent manner. Figure 4 3 (A and B) illustrates the thymidine kinase promoter construct and the results of the northern blot analysis. The TK promoter construct alone exhibit ed no significant increase in promoter activity following IL 10.7 to 6.4 kb fragment slightly increased basal growth hormone expression with a further increase in growth hormone expression follo wing IL A graph depicting densitometry of three independent experiments is shown on the left of Figure 4 4 To further address that HS2 functions as an enhancer, the thymidine kinase promoter construct containing the 10.7 to 6.4 k b fragmen t in the reverse orientation was evaluated by real time PCR following transient transfection in HFL 1 cells A true enhancer can be defined as an element or DNA sequence that functions independent of position or orientation. Briefly HFL 1 cells were tran siently transfected with the each construct, total RNA was isolated acco rding to the Qiagen RNeasy Mini Kit, DNase treated, then subjected to real time RTPCR analysis with growth hormone specific primers The results on the right of Figure 4 -4 show that in the reverse orientation, the HS2 fragment still elicits a strong gro wth hormone expression following IL with an induction in either orientation of ~4 5 fold. Furthermore, these results

PAGE 76

76 demonstrate that this region of the mPGES 1 locus can function with a heterologous promoter in an orientation independent manner. Identification of a Basal E lement W ithin HS2 The present results imply that the HS2 fragment can exhibit both basal and inducible activity. Therefore in an attempt to delineate the location of two potential elements, one involved in basal expressi on and the other, inducible activity, a series of 5 overlapping fragments were generated then cloned into the 1.1 k b promoter construct shown in Figure 4 5(A) At this point it should be note d that the function of transiently transfect ed plasmid construc ts is not controlled by events which mediate responses at the level of chromatin since these plasmid molecules lack ed endogenous chromatin structure. Each construct was evaluated by transient transfection and real -time RT PCR for growth hormone expres sion. The diagram in Figure 4 5 depicts the location of the 5 overlapping fragment s generated from the HS2 containing fragment, 10.7 to 6.4 k b The results illustrate that compared to the wild type promoter; the 10.7 to 9.6 k b and 10.1 to 9.0 kb fragme nts both exhibited a n increase in basal growth hormone expres sion, with a further increase upon IL treatment that was comparable to the induction at the promoter. The last fragment, 9.5 to 8.4 k b displayed expression levels similar to the 1.1 kb pro moter alone T he interpretation of these results is that the large increase in basal expression (~4 5 fold) observed most prominently with the 10.1 to 9.0 kb fragment indicates the presence of a DNA sequence which may aid in basal expression. However, t he level of induction seen in these constructs does not appear to be greater tha n the promoter alone. Therefore, our hypothesis is that an additional stimulus dependent element must reside elsewhere in the 10.7 to 6.4 kb enhancer fragment.

PAGE 77

77 Mapping of an I nducible Element C ontained W ithin HS2 An element controlling basal activity has now been mapped to the 5 portion of the HS2 fragment; the next step was to evaluate the remaining DNA sequence for an inducible element A series of 3 deletion fragments w ere amplified by PCR and cloned into the 1.1 k b promoter construct. Each construct was evaluated for growth hormone expression following transient transfection and real time RT-PCR as described in the Materials and Methods. The graph in Figure 4 6 illustrates the results of the real time RT PCR analysis and indicates that compared to the wild type promoter, both the 8.6 to 6.4 k b and the 8.6 to 8.1 k b fragment exhibit a significant increase in growth hormone expression following IL On t he other hand, the 8.1 to 7.6 k b and the 7.6 to 6.4 k b fragments displayed a behavior that was similar to that of the wild type promoter construct. Overall, this data demonstrates the existence of an element ( 8.6 to 8.1 kb) in conjunction with the en dogenous promoter, that confers an IL dependent induction of ~ 6 7 fold, which is comparable to the level of induction seen with the endogenous gene (Figure 3 2). In addition, taking into account the effects of the basal element (Figure 4 5) and the inducible element (Figure 4 6), the combined level of expression recapitulates the natural induction. This further accentuates the importance of multiple regulatory elements, which, when combined with the impact of the endogenous chromatin structure may appropriately recreate the events in the cell. Iden Evaluation of S M utants in the IL I nduction of Microsomal PGES -1 Having identified an enhancer element covering 8.6 to 8.1 kb which is involved in the IL bp region was conducted to predict the location of potential transcription factor binding sites using TESS transcription element search software

PAGE 78

78 (227) Figure 4 7 illustrates the nucleotide sequence of the 500 bp fragment, showing the To verify the relevance of these three to the IL -dependent induction of mPGE S 1 expression, each site was deleted by site -directed mutagenesis an d evaluated for functional activity by transient transfection and real time RT PCR. The results in Figure 4 8 illustrate that deletion of the only, had no effect on the ove rall induction by IL slight increase in the IL over that of both the wild type promoter construct and the non-mutated 8.6 to 8.1 k b construct. The observed increase in the IL following deletion of Site 3 is a reproducible trend but was not statistically significant. the IL versus the non-mutated 8.6 to 8.1 kb construct yielding an overall induction th at was now similar to that of the wild type promoter construct alone Analysis of D M ut ants in the IL PGES -1 ouble mutants were also generated to analyze each individual Figure 4 9 illustrates the following deletion s: Sites 2/ 3, leaving only Site 1 present Sites 1/2 leaving only Site 3 present 2 present. The deletion of Sites 2/3 and Sites1/2 led to a decrease in the IL similar to that of the promoter alone construct. However ly Site 2 present le d to a n increase in overall IL over that of the wild type promoter construct coupled to the non-mutated 8.6 to 8.1 k b construct. This a further example that, at least in the context of a plasmid, Site 3 may serve as an additional/ competitive binding site since as with the single sit e mutants the loss of Site 3 and Site 1 showed the similar increase over the unmutated fragment.

PAGE 79

79 S ites in C onstructs Lacking the Egr -1 B inding S ite To determine the role Egr 1 binding in induction seen with the distal enhancer element, a nother generated which include d deletion of the Egr 1 binding site from the promoter region. Each of these constructs was analyzed by transient transfection in HFL 1 cells and real time RT-PCR for growth hormone expression. As a comparison the single site muta were also analyzed A s illustrated in Figure 4 10, absence of Egr 1 binding in either the single site mutant or the double site mutant had virtually no effect on the overall IL This result illustrates that at least in the context of a plasmid within the enhancer can strongly and independently drive the IL diminish the impor tance of the Egr 1 site as a relevant activator in the proximal promoter and its role in the endogenous chromatin structure Targeted uman and R at Lung C ells To establish d to the IL 1 gene expression were conducted Both HFL 1 cells and a rat pulmonary epithelial -like cell line, L2, were transfected with siRNAs specifically targeting both human and rat C/ expression, respectively, and mPGES -1 expression was analyzed by real -time RT PCR following stimulation with the pro -inflammatory cytokine, IL As illustrated in Figure 4 11(A) -1 cells treated with a human C/E led to an approximately 60% decrease in the IL induced expression of endogenous mPGES 1. 1 cells was verified by immunoblot analysis illustrated in Figure 4 1 1 (B), which shows a decrease in expression. In L2 cells, the results in Figure 4 1 2 similarly indicate that

PAGE 80

80 led to a n approximately 50% decrease in the IL following treat ment with a rat specific Evaluat ion o f Microsomal PGES ull M ouse E mbryonic F ibroblast (ME F) C ells fibroblasts from out mice were also evaluated to address the role in mPGES 1 gene expression. Wild -/ ) MEF cells in the absence or presence of IL were evaluated for mPGES 1 mRNA expression b y real -time RT PCR. The results in Figure 4 1 3 illustrate that while IL 1 mRNA expres sion in the wild type MEFs, there was no induction of mPGES / MEFs. Chromatin I mmunoprecipitation (ChIP) A nalysis of Egr -1 RNA Polymerase II and B inding Binding of Egr 1 to the proximal promoter and C/EBP e distal enhancer element following ILwere analyzed by ChIP The results in Figure 4 1 4 illustrate that Egr 1 is constitutively bound to the promoter with no increased binding following exposure to IL Binding of RNA Pol ymerase II to the promoter was also analyzed by ChIP and the data revealed that in the absence of stimulus RNA Pol ymerase II is bound at a low level to the promoter and following treatment with IL ymerase II bind ing also shown in Figure 4 1 4 Figure 4 1 5 illustrates ChIP a nalysis of the distal enhancer element and the data while treatment with IL a further time -dependent binding about ~4 fold higher by 8 h. Co -I mmunoprecipitatio n Analysis of Egr inding As previously indicated, the results demonstrate the importance of Egr 1 alone to basal and induced expression in the proximal promoter (Figure 3 9). Similarly,

PAGE 81

81 central role as an enhancer specific regulatory factor. Although the mutagenesis studies in Figure 4 10 seem to diminish the overall role of Egr 1 in the context of the enhancer, it was still strongly felt that Egr 1 does have an impo rtant role in vivo Therefore, to test this notion, studies were performed t o determine whether Egr other as evaluated by co -immunoprecipitation (IP) analysis Figure 4 16 (A) illustrates that Egr 1 is d r 1 is immunoprecipitated as illustrated in Figure 4 16 (B). An antibody to a histidine tag was employed as a negative control in the IP experiments Discussion In these studies, the presence of a constitutive hypersensitive site HS2, in the distal promoter region of the mPGES 1 gene was identified Analysis of a fragment spanning from 10.7 to 6.4 k b encompassing this hypersensitive site revealed the existence of both a basal and inducible element which contribute to the overall induction by IL and recapitulates the ~ 8 10 fold expression seen by real time analysis of endogenous mPGES 1 expression following IL treatment. The 10.7 to 6.4 k b fragment was evaluated for e nhancer -like characteristics and it was found that the fragment is capable of activating gene transcription in an orientation in dependent manner and with a heterologous promoter Based on deletion analysis of the 5 end of the HS2 containing fragment the location of a region conferring basal activi ty was also delineated Further analysis of the 3 end of the HS2 containing fragment led to the identification of a 500bp fragment associated with the inducible activity. Computer analysis and subsequent site directed mutagenesis of thi s IL involved in the IL

PAGE 82

82 Moon et al. (207) previously reported that the transcription factor, Egr 1, is required for the IL -d ependent induction of mPGES 1 gene expression As a consequence of this, the contribution of Egr 1 binding following IL treatment was evaluated for activation of the inducible fragment. Consequently, in the a bsence of the Egr 1 site no significant change in the overall induction by IL was observed expression in regulating mPGES 1 gene expression independent of cell type As furthe r induction of mPGES 1, MEF were utilized I t was found that while IL increased mPGES 1 mRNA levels approximately 2 fold in wild type -/ MEFs IL attenuated mPGES induction Previous deletion analysis of the proximal promoter region confirmed that Egr 1 binding is involved in the inducible expression of mPGES 1 (206,234) C hromatin immunoprecipitation analysis showed that under basal conditions Egr 1 was already bound to the promoter and further addition of IL Egr 1 binding. The ChIP data also repr esents the first study of Egr 1 binding by ChIP analysis. The data also revealed RNA Pol ymerase II was bound to the promoter under basal conditions and treatment with IL increase in RNA Pol ymerase II binding. Analysis of Egr 1 bind ing and RNA Pol ymerase II binding to the enhancer element revealed no significant binding prior to and following IL revealed that C/EB was initially bound and significantly increa sed following IL

PAGE 83

83 A search of the current literature yield ed no studies evaluating whether Egr are capable of interacting. Co immunoprecipitation of Egr immu noblot analysis revealed that Egr manner. The model in Figur e 4 and RNA Polymerase II are bound to the mPGES 1 locus in the absence of stimulus. Following IL treatment, there is increased RNA Pol ymerase Egr 1 binding was constitutively observed at the promoter potentially leading to cross talk between Egr 1 and of mPGES 1 gene expression.

PAGE 84

84 Figure 4 1. Functional analysis of the distal hypersensitive site, HS2 relative to the mPGES 1 promoter A) A schematic of the HS2 containing fragment 10.7 to 6.4 kb. B) The 10.7 to 6.4 kb fragment was cloned into the 1.1 kb or 0.6 kb promoter construct driving hGH expression. HFL 1 cells were transiently transfected with each construct, total RNA was extracted and analyzed by northern blot. The membrane was hybridized with radiolabeled probes for hGH, mPGES 1 and L 7a.

PAGE 85

85 Figure 4 2. Functional analysis of the distal hypersensitive site, HS2 relative to the mPGES 1 promoter The graph illustrates densitometry of three independent northern blot analyses where data points are represented as mean SEM. The asterisk (*) denotes statistical significance with p value 0.05 compared with the untreated wild type promoter. T he diamond ( 0.05 as compared with the untreated wi ld type promoter.

PAGE 86

86 Figure 4 3 HS2 exhibits characteristics of an enhancer: Evaluation of HS2 using a minimal thymidine kinase (TK) heterologous promoter A) A depiction of the TK promoter fragment driving the expression of human growth hormone (hGH) reporter containing the HS2 fragment 10.7 to 6.4 kb, cloned into the NdeI site B) HFL 1 cells were transiently transfected with following constructs: 1.1 kb 1.1 + ( 10.7 to 6.4 kb), TK TK + ( 10.7 to 6.4kb). Tota l RNA was extracted and analyzed by northern blot. The membrane was hybridized with radiolabeled probes for hGH and L7a

PAGE 87

87 Figure 4 4 HS2 exhibits characteristics of an enhancer: Evaluation of HS2 using a minimal viral thymidine kinase heterologous promoter The graph depicts densitometry of the wild type TK promoter construct and the HS2 fragment coupled to the TK pr omoter construct in the forward orientation and real time RT -PCR analysis of the HS2 fragment cloned in the reverse orientation. The graph is a summary of three independent experiments where data points are represented as mean SEM. The asterisk (*) denot es statistical significance with p value 0.05 and (**) denotes statistical significance with p value 0.01 as compared with the untreated sample

PAGE 88

88 Figure 4 5 Identification of a basal element within HS2 A) A depiction of the HS2 containing fra gment 10.7 to 6.4 kb, illustrating the location of a series of 5 overlapping fragments generated by PCR. B) Each fragment was coupled to the 1.1 kb promoter construct, transiently transfected into HFL 1 cells and total RNA was extracted as indicated i n the Materials and Methods and analyzed by real -time RT PCR to detect hGH The hGH/cyclophilin A ratio of untreated cells was set to 1. The graph depicts a summary of three independent experiments and the data points are repr esented as mean SEM. The dia mond ( 0.05 compared to the untreated wild type promoter The asterisk (* ) denotes statistical significance with p value 0.0 5 as compared with the untreated wild type promoter The asterisk (**) denot es statistical significance with p value with the untreated sample.

PAGE 89

89 Figure 4 6 Mapping of an inducible element contained within HS2 A series of overlapping internal fragments from the 3end of the second hypersensitive site (HS 2) were generated 8.6 to 6.4 kb, 8.6 to 8.1 kb, 8.1 to 7.5 kb and 7.6 to 6.4 kb by PCR then coupled to the 1.1 kb promoter construct. Growth home expression was evaluated by transient transfection in HFL 1 cells and real time RT PCR analysis. Th e hGH/cyclophilin A ratio of untreated cells was set to 1. The graph depicts a summary of four independent experiments and the data points are repr esented as mean SEM. The asterisk (*) denotes statistical sign ificance with p value 0.05 and (**) denotes statistical significance with p value 0.01 as compared with the untreated samples.

PAGE 90

90 Figure 4 7 Location of the dista l regulatory enhancer element predicted by computer an alysis The ( 8.6 to 8.1 kb) fragment sequence was analyzed by TESS transcription element search software and illustrates the location

PAGE 91

91 Figure 4 8 e IL 1 Each of the three binding sites identified by TESS analysis were mutated by site directed mutagenesis in the 8.6 to 8.1 kb fragment. These three mutated fragments ( 8.6 to 8.6 to 8.6 to 8.1) 3 coupled to the 1.1 kb promoter construct, were evaluated by transient transfection in HFL 1 cells and real -time RT PCR analysis to detect hGH expression. The hGH/cyclophilin A ratio of untreated cells was set to 1. The graph depicts a summary of six i ndependent experiments and the data points are repr esented as mean SEM. The asterisk (**) denotes statistical significance with p value 0.01 as compared with the untreated samples ( Note: d sites are denoted by an X)

PAGE 92

92 Figure 4 9 1 A series of -directed mutagenesis of the 8.6 to 8.1 kb fragment. These three mutat ed fragments ( 8.6 to 8.6 to 8.6 to 1.1 kb promoter construct, were compared to the wild type fragment by transient transfection in HFL 1 cells and real time RT -PCR analysis to detect hGH expression. The hGH/cyclophilin A ratio of untreated cells was set to 1. The graph depicts a summary of six independent experiments and the data points are repr esented as mean SEM. The asterisk (**) denotes statistical significance with p value 0.01 as compared w ith the untreated samples. ( Note: are denoted by an X)

PAGE 93

93 Figure 4 10 sites in constructs lacking the Egr 1 binding site. The following fragments (8.6 to 1 promoter construct, were compared to the wild type fragments, (8.6 to 8.1), 1 cells and real time RT -PCR analysis to det ect hGH expression The hGH/cyclophilin A ratio of untreated cells was set to 1. The graph depicts a summary of three independent experiments and the data points are repr esented as mean SE M. The asterisk (**) indicates statistical significance with p va lue 0.01 relative to untreated samples. (Note: denoted by an X)

PAGE 94

94 Figure 4 1 1 Targeted delet lung fibroblasts A) HFL 1 cells, were mock tra nsfected (vehicle alone) or transfected with a Dharmafect siRNA specifically targeting human with or without 4h IL Total RNA w as extracted and subjected to real -time RT PCR analysis to detect either mPGES 1 or cyclophilin A mRNA The mPGES 1 /cyclophilin A ratio of unt reated cells was set to 1 The graph depicts a summary of three independent experiments, where the data points are represented as mean SE M The a sterisk (*) indicates statistical significance with p value 0.05 as co mpared with the control sample. B) knockdown in HFL 1 cells using a rabbit polyclonal antibody against A mouse monoclonal antibody against actin was used as a loading control.

PAGE 95

95 Figure 4 1 2 Targeted deletion of C rat lung epithelial cells Rat pulmonary epithelial cells, L2, were mock transfected (vehicle alone) or transfected with a Dharmafect siRNA specifically targeting either rat cyclophilin B or respectively, with or without 4h IL treatment Total RNA w as extracted and subjected to real -time RT PCR analysis to detect either mPGES 1 or cyclophilin A mRNA The mPGES 1 /cyclophilin A ratio of unt reated cells was set to 1 The graph depicts a summary of three independent experiments, w here the data points are represented as mean SE M.

PAGE 96

96 Figure 4 1 3 Evaluation of mPGES -deficient mouse embryonic fibroblast (MEF) cells / ) MEF s were untreated or stimulated with 2ng/m L IL time RT -PCR analysis to detect mPGES 1 or cyclophilin A mRNA. The mPGES 1/cyclophilin A ratio of untreated cells was set to 1. The graph depicts a summary of four independent experiments, where the data points are represented as mean SEM. The a sterisk (*) indicates statistica l significance with p value 0.05 as compared with the untreated sample

PAGE 97

97 Figure 4 1 4 Chromatin immunoprecipitation analysis of Egr 1 and RNA Pol ymerase II binding HFL 1 cells were stimulated with 2ng/m L IL and 8 h, and subjected to a Ch IP assay as described in the Experimental Procedures with control IgG, RNA Pol ymerase II or Egr 1 specific antibodies. All values are graphed as a fraction of input relative to IgG SEM The a sterisk (*) indicates statistical significance with p value 0.0 5 as compared with the untreated samples.

PAGE 98

98 Figure 4 1 5 Chromatin immunoprecipitation analysis of C. ChIP analysis of HFL 1 cells stimulated with IL 4 and 8 h using control IgG and specific antibodies. All values are graphed as a fraction of input relative to IgG SEM The a sterisk (*) indicates statistical significance with p value 0.0 5 as compared with the untreated samples.

PAGE 99

99 Figure 4 1 6 Co -immunoprecipitation analysis of Egr g. A) HFL 1 cells were stimulated with IL -immunoprecipitation with a mouse analysis with a rabbit polyclonal antibody against Egr 1 An antibody against a polyhistidine pepti de was used a control The membrane was reprobed with a rabbit polyclonal antibody against confirm its expression. B) Coimmunoprecipitation analysis in IL 1 cells with a mouse monoclonal antibody against Egr 1 followed by im munoblot analysis with a rabbit polyclonal antibody against An antibody against a polyhistidine peptide was used as a control. The membrane was also reprobed with a rabbit polyclonal antibody against Egr 1 to confirm its expression

PAGE 100

100 Figure 4 17. Model of the function al role 1 in activating the ILinduction of mPGES 1 gene expression. In the absence of stimulus, Egr 1 and RNA Polymerase II enhancer ele ment leading to basal expression of mPGES 1. In the presence of IL there is increased RNA Pol ymerase II binding at the proximal promoter region, perhaps stabilized by the presence of Egr binding to the distal region. There is potential cross -talk between Egr leading to the up regulation of mPGES 1 expression.

PAGE 101

101 CHAPTER 5 P 38MAPK, CYTOSOLIC PHOSPHOLIPASE A2 ALPHA AND 15 LIPOXYGENASE (15 LOX) ACTIVITIES ARE REQUIRED FOR TRANSCRIPTIONAL INDUCTION OF CYTOSOLIC PHOSPHOLIPASE A2 ALPHA BY INTERLEUKIN FORWARD MECHANISM Introduction Cytosolic Phospholipase A2 cPLA2 ) A ctivation is D ependent on Phosphorylation and I ntracellular C alcium Levels As the principal enzyme involved in liberating arachido nic acid from membrane phospholipids, cPLA2 n and regulation are considered one of the rate limiting steps in arachidonic acid metabolism (91,260) cPLA2 which has been shown to regu late the binding of intracellular Ca2+ and the translocation of cPLA2 perinuclear membrane; bringing the enzyme in close contact with its substrate and downstream enzymes involved in arachidonic acid metabolism (109,261,262) cPLA2 catalytic domains interspaced with isoform specific sequences (261) Three serine residues, S er 505, S er 515 and S er 727, located in the linker sequences s urrounding the second catalytic domain, have been implicated in the regulation of cPLA2 (104,113) Phosphorylation of Ser505, Ser515 and Ser727 by mitogen activated protein kinase (MAPK) (104) Ca2+/calmodulin dependent protein kinase II (CaMKII) (263) and the MAPK -interacting kinase (MNK1) (108) is known to increase cPLA2 nzymatic activity. Alternatively a number of studies including a 1995 study by Schievella et al. (112) have shown that deletion of the C2 domain abrogates cPLA2 memb rane while mut ation of Ser505 had no effect on cPLA2 (109,112) Further, the role of phosphorylated Ser505 in regulating cPLA2 activity was evaluated by over expression of a mutant Ser505, S505A ; the re sults illustrated a reduction in agonist induced arachidonic acid release in S505A mutant cells compared to wild type cPLA2 -expressin g cells (104) Overall both

PAGE 102

102 intracellular Ca2+ levels and phosphorylation o f serine residues in the linker regions of cPLA2 by MAPK and other kinases have been shown to be involved in regulatin g of cPLA2 A number of studies have illustrated that IL the rapid induction of cPLA2 phosphorylation, with a co ncomitant increase in cPLA2 within 15 30 min of treatment (264,265) while cPLA2 induction (96,266,267) Our lab previously showed that cytokine induced cPLA2 expression was a consequence of de novo transcription (96) Furthermore cPLA2 expression is known to be inhibited by glucocorticoid treatment (267269) While a handful of studies have evaluated the proximal promoter region of cPLA2 a number of putative transcription factor binding sites involved in basal expression of cPLA2 (96,270,271) the direct mechanism involved in the cytokine -mediated induction of cPLA2 The information presented thus far illustrates the involvement of kinase pathways in regulating cPLA2 d highlights the need for studies evaluating the mechanisms underlying the cytokine -mediated induction of cPLA2 the work presented in this chapter attempted to elucidate the signaling mechanisms involved in the cytokine -mediat ed induction of cPLA2 gene expression Kinase pathways involved in mediating enzymatic activation and cPLA2 activities of downstream arachidonic acid metabolites as part of a feed forward mechanism. It should be noted that the results in this chapter were performed in conjunction with Dr. J.D. Herlihy and Ms. Molly Strickland. Some of the studies have been previously presented in Dr. Herlihys dissertation; however the organization, compilation of all the data, data analysis and a number of additional studies were conducted by myself. A manuscript describing these

PAGE 103

103 studies with myself as first author is under review with the Journal of Biological Chemistry and a revised manuscript will be submitted aft er the completion of my dissertation. Results IL nduces Cytosolic PLA2 hosphorylation via the A ction of P 38MAPK Previous studies have identified the involvement of MAPK in regulating cPLA2 enzymatic activity; MAPK mediates the phosphorylation of cPL A2 leading to a rapid induction of its enzymatic activity (104) Alternatively, this rapid induction of cPLA2 enzymatic activity which occurs on the minute time scale, also leads to a rapid increase in arachidon ic acid levels (272) Furthermore, t he pro inflammatory stimuli, IL are known to induce cPLA2 mRNA and protein expression which occurs ~1 to 2 h after stimulation (96,99,273,274) Therefore, i n an attempt to e xplore whether signaling by the pro -inflammatory cytokine, IL involves phosphorylation of cPLA2 HFL 1 cells were treated with IL presence of a known p38MAPK inhibitor, SB2035 80. Total prote in was isolated and evaluated by immunoblot analysis with a phospho-specific antibody recognizing Ser505 of cPLA2 The results in Figure 5 1 (A) illustrate that IL 2 phosphorylation with in 1 0 min an d reaching maximal levels by 1 h Also, treatment with the p38MAPK inhibitor, SB203580, blocked the IL dependent phosphorylation of cPLA2 suggesting a role for p38MAPK in the phosphorylation and thus rapid activation of cPLA2 enzymatic activity. Th e chart in Figure 5 1(B) illustrates quantitative statistical analysis of three independent experiments. P 38MAPK M ediates Cytosolic PLA2 G ene Expression in an IL -dependent M anner There have been conflicting reports as to the involvement of other kinase s such as MNK 1 (108) ERK1/2 (275) or CaMKII (105,276,277) in the phosphorylation and rapid activation of cPLA2 enzymatic activity. Also, p revious work by our lab demonstrated that cPLA2 gene

PAGE 104

104 expression is induced at the transcriptional level by IL and (96) whereby treatment with either pro -inflammatory cytokine induced cPLA2 mRNA a nd protein expression in a time dependent manner. Therefore, to correlate the rapid phosphorylation event with transcriptional induction of cPLA2 and illustrate the specificity of p38MAPK in the activation of cPLA2 induction of cPLA2 gene expression w as evaluated. HFL 1 cells were treated with inhibitors of p38MAPK (SB203580 and SB202190), ERK1/2 (PD98059) and JNK (SP600125) in the absence or presence of IL in Figure 5 2(A ) illustrate that both p38MAPK inhibitors effectively blocked the IL dependent induction of cPLA2 gene expression. Further, cPLA2 protein expression was evaluated in HFL 1 cells following treatment with the JNK inhibitor (SP600125) and the p38MAPK in hibitor (SB203580). The data in Figure 5 2(B) demonstrates that treatment with the p38MAPK inhibitor caused a reduction in cPLA2 protein levels. To systematically demonstrate the specific involvement of p38MAPK in the transcriptional induction of cPLA2 cPLA2 gene expression was evaluated by northern blot following treatment with p38MAPK inhibitors. HFL 1 cells were exposed to varied concentrations of both p38MAPK inhibitors, SB203580 or SB202190, in the absence or presence of IL Figure 5 3(A and B) illustrate that both p38MAPK inhibitors blocked the IL dependent induction of cPLA2 gene expression in a dose dependent manner. The chart in Figure 5 4 is densitometric analysis of three independent experiments for SB203580. There are four the regulation and activation of many different genes involved in numerous cellular and biological process es (278280) As a specific verification of the involvement of p38MAPK, mouse

PAGE 105

105 embryonic fibroblasts (MEF) deficient were utilized to evaluate cPLA2 gene expression. MEF cells were stimulated with IL extracted and analyzed by real -time RT PCR which mouse -specific cPLA2 primers. The data in Figure 5 5 illustrates that cPLA2 type MEFs, but in t 2 expression. T ogether, the data in Figure 5 1 to Figure 5 5 highlight for the first time the specific involvement of p38MAPK in both the rapid induction of cPLA2 enzymatic activity within 30 m in to 1 h and the IL -dependent induction of cPLA2 gene expression over a longer time period. These results also suggest a potential role for other kinases, that are activated by p38 or which activate p38, in mediating the IL dependent induction of cPLA2 expression. In the next sections, individual kinases known to be upstream and downstream of p38 will be evaluated for their involvement in the IL 2 gene expression. P hosphorylation of MKK3/MKK6 is I nduced by IL For years, nu merous studies have researched and elucidated the intracellular signaling cascade for MAPK activation (130,281,282) It is known that activation of p38MAPK is mediated by the actions of the dual upstream kinases MK K3 and MKK6 (283,284) Therefore, in this study MKK3/MKK6 activation b y IL w ill be evaluated HFL 1 cells were stimulated with I L analyzed by immunoblot ting with a dual phospho-specific antibody recognizing Ser189 (MKK3) and Ser207 (MKK6) The results in Figure 5 6 (A) illustrate that in a time dependent manner, IL d a significant increase in MKK3/MKK6 phosphorylation. A graph depicting densitometry of three independent experiments is also shown in Figure 5 6(B).

PAGE 106

106 To further demonstrate the role of MKK3/MKK6 in p38MAPK activation and subsequent activation of cPLA2 gene expression m ouse embryonic fibroblasts, wild type and MKK3/MKK6 -deficient, were evaluated for cPLA2 gene expression. Wild type and deficient MEF cells were stimulated with IL was extracted and analyzed by real time RT -PCR. The data in Figure 5 7 demonstrates that IL 2 mRNA levels approximately 1.9 fold in the wild type MEFs but not in the MKK3/MKK6 deficient MEF. These results illustrate that IL MKK3/MKK6, a kinase upstream of p38MAPK which is directly involved in the phosphorylation and subsequent activation of p38 MAPK Further this data demonstrates the involvement of MKK3/MKK6 in the IL ed induction of cPLA2 gene expression. Phosp horylation of MSK -1 is I nduced by IL Within the MAPK signaling cascade there is a kinase, MSK1, which is believed to be downstream of p38 (280) A nuclear kinase, MSK 1 is known to be phosphorylated and subsequently activated by p38MAPK (285287) Studies have shown that activation of MSK 1 is involved in the regulation and activation of various transcription factors such as nu clear factor kappa B (288) cAMP -response element -binding protein (287,289) and the chromatin remodeling proteins histone H3 and HMG 14 (290) Therefore, to determine whether treatment with IL could induce phosphorylation of MSK 1 and whether p38MAPK inhibition has any e ffect on this phosphorylation event HFL 1 cells were treated with IL p38MAPK inhibitor, SB203580. As shown in Figure 5 8 (A) IL phosphorylation of MSK 1 wit hin 10 minutes of treatment, while co treatment with SB203580 blocks the phosphorylation event. The data presented thus far illustrates, that IL MKK3/MKK6. T his kinase then goes on to activate p38MAPK which leads to the

PAGE 107

107 phosphorylation and rapid activation of cPLA2 enzymatic activity and gene expression. Within this cascade, p38MAPK is involved in the phosphorylation of MSK 1 demonstrated in Figure 5 8(A an d B) where IL the rapid phosphorylation of MSK 1, while the p38MAPK inhibitor SB203580 blocked the IL -dependent induction. It should be noted that attempts to procure MSK 1 deficient fibroblasts were not successful. In the next section, the involvement of downstream metabolites of arachidonic acid will be evaluated for their role in the IL mediated induction of cPLA2 gene expression. I nhibition of Cytosolic PLA2 nzymatic A ctivity Blocks the ILnduction of Cytosolic PLA2 ene E xpres sion: A F eed F orward M echanism It has been postulated that rapid activation of cPLA2 enzymatic activity may lead to an increase in cPLA2 gene expression and increased levels of free arachidonic acid (272) In 19 94, Bartoli et al. (291) demonstrated that specific inhibition of cPLA2 enzymatic activation blocked thrombin -induced release of arachidonic acid through tight association of the specific cPLA2 inhibitor, trifluo romethyl ketone (AACOCF3) with cPLA2 We hypothesized that the rapid induction of cPLA2 enzymatic activity may play a role in the transcriptional induction of cPLA2 gene expression through a feed forward mechanism. HFL 1 cells were treated with the cPL A2 inhibitor, arachidonyl trifluoromethyl ketone (AACOCF3) in the absence or presence of IL Figure 5 9 (A) illustrates northern analysis of cPLA2 and reveals that AACOCF3 blocks the IL induction of cPLA2 ession in a dose dependent manner. The graph in Figure 5 9 (B) represents densitometry of three independent experiments. Utilizing another specific cPLA2 inhibitor, pyrrolidine, the data in Figure 5 1 0 (A) further illustrates the do se dependent decrease i n the IL 2 following treatment with pyrrolidine. The chart in Figure 5 1 0 (B) shows an average of t wo independent experiments. Together these

PAGE 108

108 results demonstrate involvement of arachidonic acid and possibly its downstr eam metabolites as part of a feed forward mechanism in the IL 2 The Lipoxygenase P athway but not C yclooxygenase P athway is N ecessary for Cytosolic PLA2 E xpression It is widely accepted that cPLA2 liberates arachidonic acid from memb rane phospholipids for metabolism and downstream eicosanoid signaling as illustrated in Figure 11. In the next series of experiments the arachidonic acid metabolites were evaluated to determine their involve ment i n regulating cPLA2 gene expression. To e valuate the involvement of the cyclooxygenase (COX) pathway, HFL 1 cells were treated with a non -selective COX inhibitor, indomethacin in the absence or presence of IL for 8 h Total RNA was isolated and analyzed by norther n blot, and the results in F igure 5 1 1 revealed that treatment with indomethacin had no effect on the induction of cPLA2 As a consequence of these results, t he involvement of the lipoxyge nase pathway was then evaluated HFL 1 cells were treated with the n on-selective LOX inhibitor, nordihydroguaiaretic acid (NDGA) a polyphenol derivative (292) in the absence or presence of IL for 8 h The data in Figure 5 1 2 (A) illustrates that treatment with NDGA blocks the induction of cPLA2 by IL of three independent experiments is shown in Figure 5 1 2 (B). Since NDGA in hibits 5 12and 15-LOX, it was important to determine which of the three LOX enzymes was required for the IL 2 The lipoxygenase enzymes are involved in converting arachidonic acid to leukotrienes ( 5 LOX mediated re action) and 15HETEs (15 LOX mediated reaction) (67,132,136) 5 lipoxygenase activating protein (FLAP) is known to regulate 5 LOX activation and th e inhibitor, MK 886 is known to specifically inhibit FLAP activity (293,294) Therefore, HFL 1 cells were treated with the 5 LOX inhibitor, MK886 in the absence or presence of IL total RNA was isolated and

PAGE 109

109 analyzed by northern blot. The results in Figure 51 3 indicate that 5 LOX activity is not involved in the IL dependent induction of cPLA2 The previous results have ruled out the involvement of 5 -LOX in the IL cPLA2 gene expression. Therefore to determine the specific involvement of 12 LOX or 15 LOX a pharmacological inhibitor of either 12 LOX or 15 LOX was used. Previously HFL 1 cells were treated with baicalein a known inhibitor of 12 LOX (295) and the results of that experiment indicated that 12-LOX did not play a role in the IL To illustrate the specific involvement of 15 LOX, HFL 1 cells were treated with a potential 15LOX inhibitor, luteolin a plant flav o noid, in the absence or presence of IL for 8 h. Total RNA was isolated and analyzed by northern blot. The results in Figure 5 1 4 (A) indicate that luteolin reduced both the basal and induce d expression of cPLA2 Densitometry of three independent experiments is illustrated in Figure 5 1 4 (B). Luteolin is a plant flavonoid known to inhibit tyrosine kinase activity and like other flavonoids may undergo metabolic transforma tion resulting in modified bioactivity (296,297) Sendobry et al. (298) identified a compound, PD146176, which lacked non-specific antioxidant activity but was reported to s pecifically inhibit 15 LOX while exhibiting a moderate inhibitory effect on 5 or 12 -LOX activity. Therefore, total RNA from HFL 1 cells treated with PD146176 in the absence or presence of IL 2 The results in Figure 5 1 5 (A) illustrate that PD146176 significantly decreased the IL induction of cPLA2 hese results are confirmed by densitometry of the IL s depicted in Figure 5 1 5 (B). Thus far, the results demonstrate that inhibition of the LOX pathway, specifically 15LOX and not the COX pathway is involved in the IL 2 gene expression

PAGE 110

110 supporting our hypothesis of a feed forward mecha nism involved in the regulation of cPLA2 gene expression. In the final section, the specific functional importance of 15 LOX activity will be verified by siRNA analysis. Short Interfering RNA against 15 -LOX Blocks the IL I nduction of Cytosolic PLA2 G ene Expression The previous experiment s utilized putative 15 LOX inhibitor s to determine whether 15 LOX activity is required for the IL dependent induction of cPLA2To further illustrate the importance of 15 LOX in mediating the IL PLA2 of 15 LOX expression by siRNA analysis was then evaluated. Since there are two 15 LOX isoforms, their expression in HFL 1 cells following IL time RT P CR. The results indicated no basal or inducible 15LOX1 expression in HFL 1 cells. On the other hand, HFL 1 cells exhibited basal 15 -LOX2 expression and increased levels following IL -LOX2 was transfected into HFL 1 cells as indi cated in the Materials and Methods and cPLA2 mRNA expression was measured following 4 h of IL The data in Figure 5 1 6 illustrates that knockdown of 15 LOX2 expression caused about a 50% decrease in cPLA2 validating the inv olvement of the lipoxygenase pathway, particularly 15-LOX2, in a feed forward mechanism regulating the IL 2 Discussion The MAPK pathway and intracellular Ca2+ levels are known to be involved in regulating the enzymatic acti vity of cPLA2 (104,261) This study focused on determining which aspects of the p38MAPK signaling cascade lead to the IL 2 and transcriptional activation. The data confir ms work presented in previous studies (104,272) illustrating that IL cPLA2 rylation within 1 0 minutes

PAGE 111

111 and that this phosphorylation event is attenuated by treatment with the p38MAP K inhibitor, SB203580. Analysis of cPLA2 evaluated using pharmacological inhibitors of p38MAPK and mouse embryonic fibroblasts e results presented in Figure 5 2 to Figure 5 5, further illustrated the specific involvement of p38MAPK in the induction of cPLA2 expression. Kinases known to be involved in the p38MAPK pathway are MKK3 and MKK6 kinases, which are upstream of p38MAP K and directly involved in its phosphorylati o n (283) and MSK 1, a downstream target of p38MAPK (287) The results shown in Figure 5 -6 to Fi gure 5 7 illustrate that IL duces an upstream p38MAPK activator MKK3/MKK6 which is reportedly activated by MyD88 IRAK /TRAF6 (280) A downstream target of p38MAPK MSK 1, was also shown to be activated by IL f p38MAPK in the cytokine -mediated induction of cPLA2 8). A few studies have implied that phosphorylation of cPLA2 1 may trigger the translocation of cPLA2 perinuclear membrane, bringing the enzyme in close proximity to its subs trate (299) Furthermore, Vermeulen et al. (288) illustrated that MSK 1 phosphorylates NF dependent manner and inhibition of MSK 1 significantly attenuated N F Future studies on the activation of cPLA2 MSK 1 in cPLA2 ooking at the data presented thus far an interesting observation can be made, in that there is a sequential activation of MKK3/M KK6, p38MAPK, MSK 1 leading to the eventual phosphorylation of cPLA2 all happening within 10 30 min of IL A model of depicting these events is illustrated in Figure 5 17.

PAGE 112

112 In creased cPLA2 could potentially lead to increased cPLA2 expression and this was proven by utilizing i nhibitors of cPLA23 and pyrrolidine. It is known that cPLA2 chidonic acid from membrane phospholipids for further metabolism by lipoxygenases and cyclooxygenase Increased availability of arachidonic acid leads to cell -mediated production of eicosanoids which regulate numerous physiological and pathological events The availability of these signaling molecules whether rapidly induced within minutes or produced over a longer time scale, can exhibit varied physiological responses within the cell. Evaluation of the involvement of downstream arachidonic acid metaboli tes in regulating cPLA2 revealed that while cyclooxygenase activity was not involved in the induction, lipoxygenase activity was required for the IL -dependent induction. Furthermore, using selective pharmacological inhibitors of the lipoxygenase enzymes, the data illustrated the specific involvement of 15-LOX in regulating the IL 2 (Figure 5 9 to Figure 5 15) Further analysis of the lipoxygenase pathway by pharmacological inhibition and targeted knockdown by siRNA, illustrated the involvement of 15 LOX2 in the transcriptional activation of cPLA2 (Figure 5 16) Overall this data confirmed the ability of cPLA2 own gene expression via a feed forward mechanism and illustrated the unique quality of p38MAP K to regulate both the enzymatic activation of cPLA22 expression.

PAGE 113

113 Figure 5 1. IL 2 A) HFL 1 cells were stimulated with IL nce of the p38MAPK inhibitor SB203580. Phosphorylation of cPLA2 a phospho-specific antibody against Ser505. B) The graph depicts densitometry of three independent experiments. The asterisk (* ) indicates statis tical significance with p value 0.0 5 and (**) indicates statistical significance with p value 0.0 1 as compared with the control samples.

PAGE 114

114 Figure 5 2. p38MAPK mediates cPLA2 IL -dependent manner A) HFL 1 cells were expos ed to p38MAPK, ERK1/2 or JNK inhibitors in the absence or presence of IL for 8 h Total RNA was isolated and analyzed by northern blot. The membrane was hybridized with radiolabeled probes for cPLA2 Immunoblot analysis of cPLA2 expression in HFL 1 cells treated with the p38MAPK inhibitor, SB203580 or the JNK inhibitor, SP600125.

PAGE 115

115 Figure 5 3. I nhibition of cPLA2 2 expression: A feed forward mechanis m. A) HFL 1 cel ls were exposed to increasing concentrations of SB203580 in the absence or presence of IL for 8 h Total RNA was extracted and subjected to northern blot analysis. The membrane was hybridized with radiolabeled probes for cPLA2 the loading control). B) Northern blot analysis of HFL 1 cells treated with an analog of SB203580, SB202190, in the absence or presence of IL The membrane was hybridized with radiolabeled probes for cPLA2 ).

PAGE 116

116 Figure 5 4. I nhibition of cPLA2 2 expression: A feed forward mechanis m. The graph illustrates densitometry data for HFL 1 cells treated with SB20358 in the presence of IL The numbe r in parentheses above each point indicates the number of independent data points. The asterisk (* ) indicates statistical significance with p value 0.0 5 and (**) indicates statistical significance with p value 0.0 1 as compared with the control sampl es

PAGE 117

117 Figure 5 5. p38MAPK mediates cPLA2 IL -dependent manner Wild / -/ MEF cells were stimulated with IL was isolated and subjected to real time RT-PCR analysis to detect cPLA2 gene expression. The cPLA2 graph depicts a summary of four independent experiments, where the data points are represented as mean SEM. The a sterisk (* ) indicates statistical significance with p value 0.0 1 as compared with the control sample.

PAGE 118

118 Figure 5 6 Phosphorylation of MKK3/MKK6 is induced by IL A) HFL 1 cells were stimulated with IL immunoblot analysis with a dual phospho-specific antibody recognizing Ser189 (MKK3) and Ser207 (MKK6) B) The graph depicts densitometry of three independent experiments. The asterisk (* ) indicates statistical significance with p value 0.0 5 as compared with the control samples.

PAGE 119

119 Figure 5 7. MKK3/MKK6 mediates cPLA2 IL -dependent manner Wild type and MKK3/6 / MEF cells were treated with IL was isolated and subjected to real time RT-PCR analysis to detect cPLA2 expression. The cPLA2 yclophilin A ratio of untreated cells was set to 1. The graph depicts a summary of three independent experiments, where the data points are represented as mean SEM. The a sterisk (*) indicates statistical significance with p value 0.05 as compared wit h the control sample.

PAGE 120

120 Figure 5 8 Phosphorylation of MSK 1 is induced by IL A) HFL 1 cells were stimulated with IL in the absence or presence of the p38MAPK inhibitor, SB203580. Phosphorylation of M S K 1 was evaluated by immunoblot analysis with a phosphospecific antibody against Ser 376. The arrow head ( interaction. B) The graph depicts densitometry of three independent experiments. The asterisk (* ) indicates statistical significance with p value 0.0 5 and ( **) indicates statistical significance with p value 0.0 1 as compared with the control samples.

PAGE 121

121 Figure 5 9 The lipoxygenase pathway but not cyclooxygenase pathway is necessary for cPLA2 expression : Inhibition of cPLA2 enzymatic activity A) H FL 1 cells were exposed to an inhibitor of cPLA23 in the absence or presence of IL for 8 h Total RNA was isolated and analyzed by northern blot. The membrane was hybridized with radiolabeled probes for cPLA2 The graph depicts a summary of three independent experiments, where the data points are represented as mean SEM. The a sterisk (*) indicates statistical significance with p value 0.05 and (**) indicates statistical significance with p value 0.0 1 a s compared with the control sample.

PAGE 122

122 Figure 5 1 0 The lipoxygenase pathway but not cyclooxygenase pathway is necessary for cPLA2: Inhibition of cPLA2 enzymatic activity A) Northern analysis of HFL 1 cells which were treated with p yrrolidine, an inhibitor of cPLA2 activity, in the absence or presence of IL for 8 h The membrane was hybridized with radiolabeled probes for cPLA2 independent experiments where the data points a re represented as an average

PAGE 123

123 Figure 5 1 1 The lipoxygenase pathway but not cyclooxygenase pathway is necessary for cPLA2: Inhibition of COX A) HFL 1 cells were treated with the non selective COX inhibitor, indomethacin, in the absence or presence of IL for 8 h Total RNA was analyzed by northern blot to detect cPLA2 membrane was hybridized with radiolabeled probes for cPLA2

PAGE 124

124 Figure 5 1 2 The lipoxygenase pathway but not cyclooxygenase pathway is ne cessary for cPLA2: Inhibition of LOX A) Northern analysis of HFL 1 cells treated with the selective LOX inhibitor, NDGA, in the absence or presence of IL for 8 h The membrane was hybridized with radiolabeled probes for cPLA2 B) Densitometry of three independent experiments, where the data points are represented as mean SEM. The a sterisk (*) indicates statistical significance with p value 0.05 and (**) indicates statistical significance with p value 0.0 1 as compared w ith the control sample.

PAGE 125

125 Figure 5 1 3 The lipoxygenase pathway but not cyclooxygenase pathway is necessary for cPLA2: Inhibition of 5 LOX HFL 1 cells were treated with a 5 LOX inhibitor, MK 886, in the absence or presence of IL for 8 h Total RNA was analyzed by northern blot to detect cPLA2 hybridized with radiolabeled probes for cPLA2

PAGE 126

126 Figure 5 1 4 The lipoxygenase pathway but not cyclooxygenase pathway is necessary for cPLA2 on: Inhibition of 12/15LOX A) Northern analysis of HFL 1 cells treated with a general LOX inhibitor, luteolin, in the absence or presence of IL for 8 h The membrane was hybridized with radiolabeled probes for cPLA2 B) Densitometry of t hree independent experiments, where the data points are represented as mean SEM. The a sterisk (*) indicates statistical significance with p value 0.05 and (**) indicates statistical significance with p value 0.0 1 as compared with the control sampl e

PAGE 127

127 Figure 5 1 5 Pharmacological i nhibition of 15-LOX and siRNA against 15 -LOX activity blocks the IL 2 n A) HFL 1 cells were treated with the 15LOX specific inhibitor, PD146176, in the absence or presence of IL for 8 h Total RNA was analyzed by northern blot to detect cPLA2 membrane was hybridized with radiolabeled probes for cPLA2 Densitometry of three independent experiments, where the data points are represented as mean SEM. The a sterisk (**) indicates statistical significance with p value 0.0 1 as compared with the control sample.

PAGE 128

128 Figure 5 1 6 Pharmacological i nhibition of 15-LOX and siRNA against 15 -LOX activity blocks the IL 2 io n. HFL 1 cells were transfected with a control siRNA targeting Luciferase, or with a n siRNA specifically targeting human 15LOX 2 with or without 4h IL Total RNA w as extracted and subjected to real -time RT PCR analysis to detect either cPL A2 or cyclophilin A mRNA The cPLA2 /cyclophilin A ratio of unt reated cells was set to 1 The graph depicts a summary of two independent experiments

PAGE 129

129 Figure 5 17. Model of cPLA2 MyD88/IRAK/TRAF6 a nd triggering the phosphorylation of MEKK3. The dual kinase MKK3/MKK6 is activated by phosphorylation and in turn phosphorylates, p38MAPK. p38MAPK goes on to phosphorylate MSK 1 which ultimately leads to the phosphorylation and enzymatic activation of cP LA2 translocat es to the peri -nuclear membrane and is able to mediate downstream transcriptional events.

PAGE 130

130 CHAPTER 6 CONCLUSIONS AND FU TURE DIRECTIONS Conclusions PGE2 has been well characterized and is known to play a role in a number of biological and pathophysiological functions. As a downstream product of arachidonic acid metabolism, it was initially thought to be a direct by-product of COX metabolism of the central prostanoid intermediate, PGH2. In the late 90s Jakobsson et al (192) identified a terminal prostaglandin E synthase and showed that this enzyme was directly responsible for the production of PGE2 and was induced by the pro inflammatory cytokine IL A decade later, numero us studies illustrated the importance of mPGES 1 in PGE2 production and demonstrated that a stress response factor, Egr 1 is capable of binding to the proximal promoter region of mPGES 1 thus driving its inducible expression (207,234,237,300) Since that time, no other studies have clarified the exact mechanisms involved in the cytokine -dependent regulation of mPGES 1 gene expression and aside from the proximal promoter no other regulatory elements have been identi fied. Therefore the goal of the current study was to examine the underlying mechanisms surrounding the induction of mPGES 1 gene expression by pro-inflammatory cytokines. In my initial studies I examined the induction of mPGES 1 gene transcription as a consequence of IL levels were strongly upregulated in the presence of IL 1 to Figure 3 4). Degous e e et al. (233) illustrated t hat the induced mPGES 1 message had a half -life of ~6 h compared to ~3 h in the un induced state in cardiomyocytes In a parallel study, I analyz ed decay of the induced message following stimulus removal; the results showed that the message had a half lif e of about ~6 h in human lung fibroblasts (Figure 3 5) Further, I was able to demonstrate the requirement of de novo transcription for th e cytokine -mediated induction of mPGES 1 gene expression, by

PAGE 131

131 actinomycin D treatment and the measurement of hnRNA lev els, a pre -spliced mRNA intermediate (Figure 3 6 and Figure 3 7) Analysis of two mPGES 1 promoter fragments illustrated basal promoter activation in the absence of stimulus and a subsequent increase in activity following IL Function al ana lysis of the wild type mPGES 1 promoter fragment (1.1 kb) and a mutant construct harboring an Egr 1 deletion, confirmed the involvement of Egr 1 in regulating promoter activation corroborating the studies previously conducted by other groups (Figure 3 8 to Figure 3 9) (206,207) Alternatively, I used computer analysis to predict the location of transcription factor binding s ites within the promoter and identifi ed a potential binding site for D eletion of thi s site revealed that it did not contribute to the basal or induced promoter activation. In the absence of other data or regulatory studies in the literature we hypothesized that there must be additional regulatory elements within or near the mPGES 1 gene that are involved in regulating its expression and thus achieving the level of induction observed by measuring steady -state increases The first approach was to generate fragments of the entire mPGES 1 locus, subclone each fragment into the hGH construct and evaluate the reporter activity a strategy based on our labs experience in identifying internal cytokine -dependent regulatory elements. Therefore I examined fragments internal to the gene and found no regulatory elements that significantly contribut ed to overall promoter activation by IL (Figure 3 10). Further, the overall induction with each of these fragments was similar to that of the promoter alone, approximately ~1.5 2 fold. T aking another approach, DNase I hypersensitive site analysis was utilized to identify potential regulatory regions (Figure 3 11 and Figure 3 12). This method allows for the rapid

PAGE 132

132 detection of structural alterations or open chromatin regions associated with hypersensitive sites harbor ing regulatory factors and their an alogous binding sites These open regions can then be further evaluated for functional significance as it relates to the IL induction The analysis revealed the existence of two potential regulatory regions or constitutive hypersensitive sites one map ping to ~ 0.3 kb and the other mapping at ~ 8.6 kb Unlike inducible hypersensitive sites, constitutive hypersensitive sites are known to be associated with the promoter region of genes and subsequent transcriptional activation. At times, finer analysi s of these regions reveal the existence of regulatory regions that are potentially involved in regulating gene expression (301) The first site mapped to the region of Egr 1 binding which was previously analyzed by site -directed mutagenesis of the mPGES 1 promoter construct (Figure 3 8 and Figure 3 9) F unctional analysis of the second HS site illustrated that the fragment exhibits enhancer like characteristics functioning in an orientation independent manner and activating transcription through a heterologous promoter in an IL -dependent manner Also this site contained both a basal and inducible element involved in the regulation of mPGES 1 expression (Figure 4 1 to Figure 4 6). Furthermore, combining the level of induction seen in the induced lane of the promoter+enhancer construct (~9 fold) with the uninduced lane of the promoter alone construct, recapitulates the level of induction of the endogenous gene by northern blot and real time RT PCR. Contrary to published reports which indicated that Egr 1 is the sole factor regulating the inductio n of mPGES 1 gene expression; deletion analysis of the inducible enhancer element together with site -directed mutagenesis, siRNA and the availability of wild type and knockout key mediator of the IL -dependent induction of mPGES 1 gene expression, the existence of which has not been

PAGE 133

133 previously reported (Figure 4 7 to Figure 4 13). Further analysis of both Egr c hromatin i mm u n oprecipitation indicated that Egr 1 bound to the promoter in a n IL dependent manner to the enhancer element (Figure 4 14 to Figure 4 15). This analysis also illustrated that RNA Polymerase II bound to the mPGES 1 promoter in an IL nner. It is not known whether Egr immunoprecipitation analysis was conducted and revealed that these factors are capable of interacting independent of cytokine treatment (Figure 4 16). I n lieu of other known data, our model of IL suggests that under basal conditions Egr 1 is bound to the promoter, RNA Pol ymerase II is bound to the promoter. Following IL treatm ent there is a significant increase in RNA Pol ymerase is cross talk between Egr regulation of mPGES 1 expression. Overall, this study focuse d on delineating the mechanisms involved in regulating the physiological levels of mPGES 1. It also illustrated the need for a concise examination of the entire mPGES 1 locus This work revealed the involvement of another transcription fa ctor, de from Egr 1, in mediat ing the IL dependent induction of mPGES 1. Most relevantly, the data presented thus far illustrate that regions outside of the proximal promoter are required to achieve the full expression seen by IL l aid in the development of anti inflammatory drugs aimed at inhibiti ng mPGES 1 enzymatic activation. cPLA2 phospholipids for downstream metabolism. Enzymatic activation of cPLA2 regulated by intracellular calcium levels and MAP kinase activity (84,91,104,109) Initially a few groups

PAGE 134

134 illustrated that cPLA2 treatment with pro-inflammatory cytokines (272) Further, p38MAPK activation is known to play a role in the enzymatic activation of cPLA2 (109,275,302) As such our studies focused on delineating the involvement of kinase pathways and w e hypothesized that downstream arachidonic acid metabolites may be involved in regulating cPLA2 many studies indicated that kinase activity is involved in mediating cPLA2 tic activity, our initial studies utilized specific kinase inhibitors to determine some of the pathways involved. O ur data revealed that IL cPLA2 blocked by inhibition of p38MAPK. Using inhibito rs to ERK, JNK and MAPK, it was found that inhibition of p38MAPK attenuated the IL induced activation of cPLA2 gene transcription (Figure 5 1 to Figure 5 4 ). illustrate d the importance of p38MAPK in cPLA2 activation (Figure 5 5) Interestingly, MKK3/MKK6, a kinase known to phosphorylate p38MAPK (283) showed increased levels of phosphorylation following IL 6 ). This was further supported by da ta from MKK3/MKK6 MEF cells which illustrated that in the absence of the dual kinases, MKK3/MKK6, the IL 2 (Figure 5 7) Another kinase, MSK 1 which is downstream of p38MAPK and identified as a target of p38MAPK activity (285) was analy zed by immunoblot and was phosphorylated following IL 1 treatment (Figure 5 8 ). Together the data suggests that IL MKK3/MKK6 which in turn phosphorylates p38MAPK leading to the activation of MSK 1 and eventually cPLA2 activation, all happening within 10 30 min post treatment (Figure 5 17) Although our data could not illustrate the direct involvement of MSK 1 in the

PAGE 135

135 activation of cPLA2 Aimond et al. (303) illustrated this ev ent in cardiomyctes analyzing cPLA2 protein expression following treatment with an inhibitor of MSK 1, Ro318220. We then hypothesized that products of arachidonic acid metabolism may play a role in the IL 2 First, inhibition of cPL A2 enzymatic activity by AACOCF3 and pyrrolidine illustrated that cPLA2 enzymati c activity was required for transcriptional activation by IL 9 and Figure 5 1 0 ). Analysis of downstream arachidonic acid metabolites revealed that COX activity w as not involved in the IL of cPLA2 illustrated by inhibition with indomethacin (Figure 5 1 1 ). Using inhibitors to the lipoxygenase pathway illustrated the specific involvement of 15 -LOX in the activation of cPLA2 expression (Figure 5 1 2 to Figure 5 1 5 ). Real time RT -PCR analysis of 15 LOX1 and 15LOX2 expression in HFL 1 cells showed that only 15-LOX2 is expressed in these cells (data not shown) Therefore, utilizing a n siRNA against 15 -LOX2 confirmed the involvement of th is lipoxygenase in the IL 2 gene expression (Figure 5 1 6 ). Overall the data illustrated the role of a feed forward mechanism involved in regulating the enzymatic activity and transcriptional induction of cPLA2 along with the direct involvement of the p38MAPK signaling pathway. Coupled with current work being conduct ed in our lab, we will hopefully be able to contribute further information on the enzymatic and transcriptional activation of cPLA2 expression. Future Directions Like p revious studies, my analysis of the mPGES 1 promoter region revealed increased activation following IL Densitometric analysis revealed that the 1.1 kb fragment elicited a 2.5 fold increase in reporter expression versus a 1.5 fold increase seen with the 0.6 kb fragment implying that there is a potential regulatory element between 1.1 kb and 434 kb. Computer analysis of this region

PAGE 136

136 identified a C/EBP site which was later ruled out Further, Egr 1 was shown to be important for induced gene expression by promoter deletion, conducted by our group and others. Another group conducted siRNA analysis of Egr 1 and found that there was a 50% reduction in induced promoter activation. The data present ed in Chapter 3 confirmed the involvement of Egr 1 on the IL 1 and I believe that Egr 1 -/ MEF cells may reveal in the presence of IL that mPGES 1 levels are significantly increased more than ~2 fold (which is seen with promoter fragments); indicating the involvement of another regulatory factory that cooperatively interacts with Egr 1 to regulate promoter activation Therefore, further analysis of the promoter fragment is needed to identify other potential factors involved in t he activation of the mPGES 1 promoter. Analysis of the mPGES 1 gene by DNase I led to the discovery of two constitutive hypersensitive site s Functional analysis of the second site illustrated basal and inducible activity The inducible activity was further characterized to a 500 bp region and the involvement but no other work was done on the basal element. It is possible that like the in ducible element, a single or mu ltiple transcription factors are co -ope ratively regulating the basal expression of this fragment. Complete mapping and functional analysis of the basal element are needed. ChIP and coIP analysis revealed that Egr 1 ymerase II binds inducibly to the promote r. It is unclear whether Egr 1 is involved in recruiting RNA Pol ymerase II to the promoter or even if they can interact I believe that Egr 1 is potentially interacting with members of the pre initiation complex and as such is involved in the recruitment of RNA Polymerase II to the promoter. To test this hypothesis, I suggest further analysis of Egr 1/RNA Pol ymerase II interaction by ChIP

PAGE 137

137 or co immunoprecipitation foll owed by immunoblot analysis with antibodies specific to known members of the pre -initia tion complex. The cPLA2 immunoblot and MEF cell analyses. Although MSK 1 is reportedly involved, the data provided thus far only support s part of our model of cPLA2 I was unable to obtain m ouse embryonic fibroblasts deficient for MSK 1 and my hypothesis is that analogous to the transcriptional induction of cPLA2 cPLA2 activated in the wild type MSK 1 MEFs following IL not the MSK 1 / MEFs. Therefore, further analysis of cPLA2 expression in MSK 1 MEF cells is need ed to complete the story surroundin g p38MAPK MSK 1 phosphorylation and activation of cPLA2 The siRNA analysis implicated 15 -LOX2 in the regulation of cP LA2 w hile MEF cells for 15 -LOX2 do not exist as yet, I believe IL cPLA2 activation and transcriptional induction in the wild type MEFs but only cPLA2 activity would be induced in the 15 -LOX2 / cells. D ata not presented in this dissertation suggest ed the potential involvement of NF 2 current studies are underway in the lab by Dr. Kimberly Aiken, to characterize the regulation of cPLA2 1

PAGE 138

138 APPENDIX E VALUATION OF EFFECTS OF A DIFFERENT PRO INFLA MMATORY CYTOKINE, TNF -ALPHA ON MICROSOMAL P ROSTAGLANDIN SYNTHASE 1 Introduction Analysis of Microsomal PGES -1 Expression and P romoter A ctivity in H uman Breast C ancer C ells Breast cancer i s one of the leading causes of death in women and the third leading cause of cancer deaths in the US (304) At the cellular level, many factors are involved in the regulation, genetic and epigenetic changes associated with breast cancer, invasiveness and eventual prognosis of this disease. Some breast cancers can be classified based on estrogen receptor status, ER+ or ER and the hormone estrogen is speculated to stimulate the proliferation of breast cancer cells (305,306) Estrogen has been shown to upregulate a number of genes that are involved in the proliferation and survival of breast cancer cells. Aromatase activity is known to induce estrogen biosynthesis in breast cancer an d PGE2, a bi -product of arachidonic acid metabolism regulates aromatase expression (307,308) Two studies revealed mPGES 1 is expressed in breast cancer cell lines versus normal tissue and further, mPGES 1 expressi on in tumors is associated with estrogen up regulation (223,309) Recently, Frasor et al. (209) delineated that the inducible PGE2 synthase, mPGES 1 is an ER target gene that is up regulated in the breast ca ncer cell line, MCF 7 following estrogen and cytokine stimulation. An estrogen response element (ERE) was identified in the promoter region of mPGES 1 and subsequent analyses revealed that estradiol stimulated promoter activation Further, co -treatment with the pro inflammatory cytokine TNF and estradiol caused a synergistic up regulation of mPGES 1 expression. Catley et al. (310) implicated a role for NF activation in regulating the cytokine -dependent indu ction of mPGES 1. In the absence of

PAGE 139

139 estradiol the data presented by Frasor et al. (209) -dominant negative construct reduced the synergistic upregulation of mPGES 1 expression by cotreatment with estradiol and TNF no induction of mPGES 1 gene expression was seen with TNF alone. This implies that NF -mediated induction of mPGES 1 and that there may be other elements within the mPGES 1 genome that could potentially contribute to the TNF Results TNF I nduces Microsomal PGES -1 G ene Expression in a T ime -D ependent and C ell S pecific M anner In an attempt to elucidate the mechanism of mPGES 1 transcriptional activation following TNF 7 breast cancer cell line, cells were stimulated with TNF A 1 illustrates that TNF d mPGES 1 mRNA expression about ~ 9 fol d Alternatively, in HFL 1 cells (normal lung fibroblast cell line) TNF mPGES 1 levels, about ~ 4 .5 fold. Together the data illustrates that TNF 1 gene expression in a time dependent and potentially cell -specific manner. Analysis of the A ctivatio n of the Distal Hypersensitive S ite (HS2) by TNF The distal hypersensitive site, HS2, i n the promoter region of mPGES 1 was recently evaluated for cytokine induced activation of mPGES 1 gene expression. Therefore, the HS2 fragment ( 10.7 to 6.4 kb) driving growth hormone expression was evaluated in MCF 7 cells following induction by TNF The results illustrated in Figure A 2 reveal that wild type promoter activity was not induced by TNF but in the presence of the HS2 fragment, there was a n increase in basal expression in the absence of TNF ed by a subsequent increase in the in duced expression.

PAGE 140

140 Identification of TNF Responsive Regulatory Elements within HS2 Sub -fragments of HS2 w ere previously generated and evaluated for expression in response to another pro inflammatory cytokine, IL -mediated induction of the large HS2 fragment the sub-fragments w ere next evaluated for TNF responsiveness The following fragments were evaluated for growth hormone expression: ( 10.1 to 9.0 kb), ( 8.6 to 6.4 kb), ( 8.6 to 8.1 kb) and ( 7.6 to 6.4 kb). Fi gure A 3 reveals that the ( 10.1 to 9.0 kb) sub-fragment exhibited an increase in both the basal and induced expression compared to the wild type promoter construct following TNF showed a signif icant increase in response to IL responded favorably to TNF Discussion In breast cancer versus normal breast tissue, mPGES 1 is known to be highly up-regulated. The steroid hormone, estrogen is known to be active in breast cancer and a li terature search revealed a number of studies illustrating a role for estrogen in mPGES 1 gene activation and expression in both a cytokine dependent and independent manner. Within the mPGES 1 proximal promoter region, an ERE was identified and deemed important for mPGES 1 gene activation following estradiol treatment (209) This estradiol -induction was further enhanced by treatment with the pro -inflammatory cytokine, TNF to induce promoter activation and the transcription factor, NF TNF 1. In Chapter 4 a distal hypersensitive site, HS2 was identified by DNase I hypersensitive site analysis and it was found to contain IL responsive element w hich is required for mPGES 1 gene induction by IL mPGES 1 gene expression. The preliminary data indicates that while the endogenous promoter construct is not activated by TNF e of HS2 lead to a significant increase in both

PAGE 141

141 basal and inducible activity following TNF -fragments revealed a potential element within the 5region of HS2 that is extremely respons iv e to TNF while analysis of the 3 end of HS2 yielded no significantly active elements. Therefore a finer analysis of the entire HS2 fragment is needed to efficiently delineate the location of the highly responsive basal element and further elucidate the location of an inducible element

PAGE 142

142 Figure A 1. TNF 1 gene expression in a time dependent and cell -specific manner MCF 7 and HFL 1 cells were stimulated with 10 ng/mL TNF was isolated and analyzed by real time RT-PCR.

PAGE 143

143 Figure A 2. Analysis of th e activation of the distal hypersensitive site (HS2) by TNF MCF 7 cells were transiently transfected with the indicated fragments. 46 h later total RNA was isolated from cells stimulated with or without TNF time RT PCR. The mPG ES 1/cyclophilin A ratio of untreated cells was set to 1. The graph depicts a summary of three independent experiments, where the data points are represented as mean SEM (standard error of the mean). The a sterisk (*) indicates statistical significance p value 0.0 5 as compared with the untreated wild type promoter samples.

PAGE 144

144 Figure A 3. Identification of TNF Real -time analysis of MCF 7 cells transiently transfected with the indicated fragments.

PAGE 145

145 LIST OF REFERENCES 1. Botting, R. (2004) Front Biosci 9 956966 2. Brash, A. R. (2001) The Journal of clinical investigation 107(11), 13391345 3. Charbeneau, R. P., and Peters Golden, M. (2005) Clin Sci (Lond) 108(6), 479 491 4. Kuitert, L. M., Newton, R., Barnes, N. C., Adcock, I. M., and Barnes, P. J. (1996) Thorax 51(12), 12231228 5. Hart, P. H. (2001) Immunol Cell Biol 79(2), 149153 6. Brenneis, C., Maier, T. J., Schmidt, R., Hofacker, A., Zulauf, L., Jakobsson, P. J., Scholich, K., and Geisslinger, G. (2006) Faseb J 20(9), 13521360 7. Samuelsson, B., Morgenstern, R., and Jakobsson, P. J. (2007) Pharmacological reviews 59(3), 207224 8. Drazen, J. M. (2003) Advances in experimental medicine and biology 525 1 5 9. Funk, C. D., and Fi tzGerald, G. A. (2007) Journal of cardiovascular pharmacology 50(5), 470479 10. Cipollone, F. (2005) Lupus 14(9), 756759 11. Harris, S. G., Padilla, J., Koumas, L., Ray, D., and Phipps, R. P. (2002) Trends in immunology 23 (3), 144150 12. Hartney, J. M., Coggins, K. G., Tilley, S. L., Jania, L. A., Lovgren, A. K., Audoly, L. P., and Koller, B. H. (2006) American journal of physiology 290 (1), L105113 13. Iversen, L., and Kragballe, K. (2000) Prostaglandins & other lipid mediators 63(1 2), 2542 14. Narumi ya, S. (2003) Life sciences 74(2 3), 391395 15. Vancheri, C., Mastruzzo, C., Sortino, M. A., and Crimi, N. (2004) Trends in immunology 25(1), 40 46 16. Wang, D., Wang, M., Cheng, Y., and Fitzgerald, G. A. (2005) Current opinion in pharmacology 5 (2), 2042 10 17. Moonen, P., Buytenhek, M., and Nugteren, D. H. (1982) Methods in enzymology 86, 84 91 18. Smith, W. L. (1989) The Biochemical journal 259(2), 315324

PAGE 146

146 19. Smith, W. L. (1992) The American journal of physiology 263 (2 Pt 2), F181 -191 20. Wang, D., Mann J. R., and DuBois, R. N. (2005) Gastroenterology 128(5), 14451461 21. Narumiya, S., Sugimoto, Y., and Ushikubi, F. (1999) Physiological reviews 79(4), 11931226 22. Smyth, E. M., Grosser, T., Wang, M., Yu, Y., and FitzGerald, G. A. (2009) Journal of lip id research 50 Suppl S423428 23. Funk, C. D. (2001) Science (New York, N.Y 294(5548), 18711875 24. Miller, S. B. (2006) Seminars in arthritis and rheumatism 36(1), 37 49 25. Matsuoka, T., Hirata, M., Tanaka, H., Takahashi, Y., Murata, T., Kabashima, K., Sugimoto, Y., Kobayashi, T., Ushikubi, F., Aze, Y., Eguchi, N., Urade, Y., Yoshida, N., Kimura, K., Mizoguchi, A., Honda, Y., Nagai, H., and Narumiya, S. (2000) Science (New York, N.Y 287(5460), 20132017 26. Powell, W. S. (2003) Prostaglandins, leukotrie nes, and essential fatty acids 69(2 3), 179185 27. Hayaishi, O. (1991) Faseb J 5 (11), 25752581 28. Hayaishi, O., Matsumura, H., Onoe, H., Koyama, Y., and Watanabe, Y. (1991) Advances in prostaglandin, thromboxane, and leukotriene research 21B 723726 29. Hamberg, M., Svensson, J., and Samuelsson, B. (1975) Proceedings of the National Academy of Sciences of the United States of America 72(8), 29942998 30. Patrono, C. (1990) Circulation 81(1 Suppl), I1215; discussion I22 13 31. Lim, H., Gupta, R. A., Ma, W. G., Paria, B. C., Moller, D. E., Morrow, J. D., DuBois, R. N., Trzaskos, J. M., and Dey, S. K. (1999) Genes & development 13(12), 15611574 32. Huang, J. C., Arbab, F., Tumbusch, K. J., Goldsby, J. S., Matijevic -Aleksic, N., and Wu, K. K. (2002) The Jo urnal of clinical endocrinology and metabolism 87(9), 43614368 33. Lim, H., and Dey, S. K. (2002) Endocrinology 143 (9), 32073210 34. Ivanov, A. I., and Romanovsky, A. A. (2004) Front Biosci 9 19771993 35. Romanovsky, A. A., Almeida, M. C., Aronoff, D. M., Ivanov, A. I., Konsman, J. P., Steiner, A. A., and Turek, V. F. (2005) Front Biosci 10, 21932216 36. Corson, S. L., and Bolognese, R. J. (1975) The Journal of reproductive medicine 14(2), 43 46

PAGE 147

147 37. Tilley, S. L., Audoly, L. P., Hicks, E. H., Kim, H. S ., Flannery, P. J., Coffman, T. M., and Koller, B. H. (1999) The Journal of clinical investigation 103(11), 15391545 38. Stock, J. L., Shinjo, K., Burkhardt, J., Roach, M., Taniguchi, K., Ishikawa, T., Kim, H. S., Flannery, P. J., Coffman, T. M., McNeish, J. D., and Audoly, L. P. (2001) The Journal of clinical investigation 107(3), 325 331 39. Martey, C. A., Pollock, S. J., Turner, C. K., O'Reilly, K. M., Baglole, C. J., Phipps, R. P., and Sime, P. J. (2004) American journal of physiology 287 (5), L981991 40. Matsumura, K., and Kobayashi, S. (2004) Front Biosci 9 28192826 41. Tapiero, H., Ba, G. N., Couvreur, P., and Tew, K. D. (2002) Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie 56(5), 215222 42. Senior, J., Sangha, R., Baxter, G. S., M arshall, K., and Clayton, J. K. (1992) British journal of pharmacology 107(1), 215221 43. Fuchs, A. R. (1987) Journal of steroid biochemistry 27(4 6), 10731080 44. Rolin, S., Masereel, B., and Dogne, J. M. (2006) European journal of pharmacology 533(1 3) 89 100 45. Vignola, A. M., Mirabella, F., Costanzo, G., Di Giorgi, R., Gjomarkaj, M., Bellia, V., and Bonsignore, G. (2003) Chest 123(3 Suppl), 417S 422S 46. Hossain, S. (1973) The American review of respiratory disease 107(1), 99 109 47. Jeffery, P. K., Wardlaw, A. J., Nelson, F. C., Collins, J. V., and Kay, A. B. (1989) The American review of respiratory disease 140(6), 17451753 48. Emery, D. L., Djokic, T. D., Graf, P. D., and Nadel, J. A. (1989) J Appl Physiol 67(3), 959962 49. Hardy, C. C., Robinso n, C., Tattersfield, A. E., and Holgate, S. T. (1984) The New England journal of medicine 311(4), 209213 50. Kumlin, M., Dahlen, B., Bjorck, T., Zetterstrom, O., Granstrom, E., and Dahlen, S. E. (1992) The American review of respiratory disease 146(1), 96103 51. Wenzel, S. E., Westcott, J. Y., Smith, H. R., and Larsen, G. L. (1989) The American review of respiratory disease 139(2), 450457 52. Huszar, E., Szabo, Z., Jakab, A., Barta, I., Herjavecz, I., and Horvath, I. (2005) Inflamm Res 54(8), 350355 53. Davi, G., Basili, S., Vieri, M., Cipollone, F., Santarone, S., Alessandri, C., Gazzaniga, P., Cordova, C., and Violi, F. (1997) American journal of respiratory and critical care medicine 156(6), 17941799

PAGE 148

148 54. Ghosh, M., Stewart, A., Tucker, D. E., Bonvent re, J. V., Murphy, R. C., and Leslie, C. C. (2004) American journal of respiratory cell and molecular biology 30(1), 91 100 55. Hempel, S. L., Monick, M. M., and Hunninghake, G. W. (1994) The Journal of clinical investigation 93(1), 391 396 56. Jackson, B. A., Goldstein, R. H., Roy, R., Cozzani, M., Taylor, L., and Polgar, P. (1993) Biochemical and biophysical research communications 197 (3), 14651474 57. Mitchell, J. A., Belvisi, M. G., Akarasereenont, P., Robbins, R. A., Kwon, O. J., Croxtall, J., Barnes, P. J., and Vane, J. R. (1994) British journal of pharmacology 113(3), 10081014 58. Kohyama, T., Ertl, R. F., Valenti, V., Spurzem, J., Kawamoto, M., Nakamura, Y., Veys, T., Allegra, L., Romberger, D., and Rennard, S. I. (2001) American journal of physiol ogy 281(5), L12571263 59. Elias, J. A., Rossman, M. D., Zurier, R. B., and Daniele, R. P. (1985) The American review of respiratory disease 131 (1), 94 99 60. Goldstein, R. H., and Polgar, P. (1982) The Journal of biological chemistry 257(15), 86308633 61. Koyama, S., Sato, E., Masubuchi, T., Takamizawa, A., Nomura, H., Kubo, K., Nagai, S., and Izumi, T. (1998) The American journal of physiology 275(2 Pt 1), L223-230 62. Palmantier, R., and Borgeat, P. (1991) British journal of pharmacology 103 (4), 19091916 63. Fiore, S., and Serhan, C. N. (1990) The Journal of experimental medicine 172 (5), 14511457 64. Baud, L., Perez, J., Denis, M., and Ardaillou, R. (1987) J Immunol 138(4), 11901195 65. Phan, S. H., McGarry, B. M., Loeffler, K. M., and Kunkel, S. L. ( 1988) Biochemistry 27(8), 28462853 66. Wenzel, S. E. (2003) Prostaglandins, leukotrienes, and essential fatty acids 69(2 3), 145155 67. Steinhilber, D. (1999) Curr Med Chem 6 (1), 71 85 68. Drazen, J. M., Israel, E., and O'Byrne, P. M. (1999) The New Engl and journal of medicine 340(3), 197206 69. Drazen, J. M. (1999) Proceedings of the Association of American Physicians 111(6), 547559

PAGE 149

149 70. Peters -Golden, M., Bailie, M., Marshall, T., Wilke, C., Phan, S. H., Toews, G. B., and Moore, B. B. (2002) American j ournal of respiratory and critical care medicine 165(2), 229235 71. Das, U. N. (2006) Biotechnology journal 1 (4), 420439 72. Soberman, R. J., and Christmas, P. (2003) The Journal of clinical investigation 111(8), 11071113 73. Sublette, M. E., Russ, M. J ., and Smith, G. S. (2004) Bipolar disorders 6 (2), 95 105 74. Chakraborti, S. (2003) Cellular signalling 15(7), 637665 75. Schaloske, R. H., and Dennis, E. A. (2006) Biochimica et biophysica acta 1761(11), 12461259 76. Taketo, M. M., and Sonoshita, M. (2 002) Biochimica et biophysica acta 1585 (2 3), 7276 77. Diaz, B. L., and Arm, J. P. (2003) Prostaglandins, leukotrienes, and essential fatty acids 69(2 3), 8797 78. Menschikowski, M., Hagelgans, A., and Siegert, G. (2006) Prostaglandins & other lipid medi ators 79(1 2), 1 33 79. Murakami, M. (2004) Biological & pharmaceutical bulletin 27(8), 11791182 80. Murakami, M., and Kudo, I. (2004) Biological & pharmaceutical bulletin 27(8), 11581164 81. Triggiani, M., Granata, F., Giannattasio, G., and Marone, G. ( 2005) The Journal of allergy and clinical immunology 116(5), 10001006 82. Ghosh, M., Tucker, D. E., Burchett, S. A., and Leslie, C. C. (2006) Progress in lipid research 45 (6), 487510 83. Bonventre, J. V., and Sapirstein, A. (2002) Advances in experimenta l medicine and biology 507, 25 31 84. Clark, J. D., Schievella, A. R., Nalefski, E. A., and Lin, L. L. (1995) Journal of lipid mediators and cell signalling 12 (2 3), 83117 85. Balsinde, J., Perez, R., and Balboa, M. A. (2006) Biochimica et biophysica acta 1761(11), 13441350 86. McHowat, J., and Creer, M. H. (2004) Current medicinal chemistry 2 (3), 209 218 87. Burke, J. E., and Dennis, E. A. (2009) Cardiovascular drugs and therapy / sponsored by the International Society of Cardiovascular Pharmacotherapy 2 3 (1), 49 59

PAGE 150

150 88. Dennis, E. A. (1994) The Journal of biological chemistry 269(18), 1305713060 89. Six, D. A., and Dennis, E. A. (2000) Biochimica et biophysica acta 1488(1 2), 1 19 90. Kita, Y., Ohto, T., Uozumi, N., and Shimizu, T. (2006) Biochimica et biophysica acta 1761(11), 13171322 91. Murakami, M., and Kudo, I. (2002) Journal of biochemistry 131(3), 285292 92. Underwood, K. W., Song, C., Kriz, R. W., Chang, X. J., Knopf, J. L., and Lin, L. L. (1998) The Journal of biological chemistry 273(34), 2192 6 21932 93. Miyashita, A., Crystal, R. G., and Hay, J. G. (1995) Nucleic acids research 23(2), 293301 94. Leslie, C. C. (1997) The Journal of biological chemistry 272(27), 1670916712 95. Leslie, C. C. (2004) Prostaglandins, leukotrienes, and essential fatty acids 70(4), 373376 96. Dolan -O'Keefe, M., Chow, V., Monnier, J., Visner, G. A., and Nick, H. S. (2000) American journal of physiology 278 (4), L649657 97. Hansen, W. R., Drew, A., Helsby, N., Keelan, J. A., Sato, T. A., and Mitchell, M. D. (1999) Pla centa 20(4), 303308 98. Lal, M. A., Kennedy, C. R., Proulx, P. R., and Hebert, R. L. (1997) The American journal of physiology 273 (6 Pt 2), F907915 99. Newton, R., Kuitert, L. M., Slater, D. M., Adcock, I. M., and Barnes, P. J. (1997) Life sciences 60(1) 67 78 100. Xu, X. X., Rock, C. O., Qiu, Z. H., Leslie, C. C., and Jackowski, S. (1994) The Journal of biological chemistry 269 (50), 3169331700 101. Keelan, J. A., Sato, T. A., Hansen, W. R., Gilmour, J. S., Gupta, D. K., Helsby, N. A., and Mitchell, M. D. (1999) Prostaglandins, leukotrienes, and essential fatty acids 60(4), 255262 102. Kuroda, A., Sugiyama, E., Taki, H., Mino, T., and Kobayashi, M. (1997) Biochemical and biophysical research communications 230(1), 4043 103. Murakami, M., Penrose, J. F., Urade, Y., Austen, K. F., and Arm, J. P. (1995) Proceedings of the National Academy of Sciences of the United States of America 92(13), 61076111 104. Lin, L. L., Wartmann, M., Lin, A. Y., Knopf, J. L., Seth, A., and Davis, R. J. (1993) Cell 72(2), 2692 78 105. Kudo, I., and Murakami, M. (2002) Prostaglandins & other lipid mediators 68-69, 3 58

PAGE 151

151 106. Borsch -Haubold, A. G., Bartoli, F., Asselin, J., Dudler, T., Kramer, R. M., Apitz Castro, R., Watson, S. P., and Gelb, M. H. (1998) The Journal of biological chemistry 273(8), 44494458 107. de Carvalho, M. G., McCormack, A. L., Olson, E., Ghomashchi, F., Gelb, M. H., Yates, J. R., 3rd, and Leslie, C. C. (1996) The Journal of biological chemistry 271(12), 69876997 108. Hefner, Y., Borsch Haubold, A. G., Muraka mi, M., Wilde, J. I., Pasquet, S., Schieltz, D., Ghomashchi, F., Yates, J. R., 3rd, Armstrong, C. G., Paterson, A., Cohen, P., Fukunaga, R., Hunter, T., Kudo, I., Watson, S. P., and Gelb, M. H. (2000) The Journal of biological chemistry 275(48), 3754237551 109. Gijon, M. A., Spencer, D. M., Kaiser, A. L., and Leslie, C. C. (1999) The Journal of cell biology 145 (6), 12191232 110. Peters -Golden, M., Song, K., Marshall, T., and Brock, T. (1996) The Biochemical journal 318 ( Pt 3) 797803 111. Uozumi, N., an d Shimizu, T. (2002) Prostaglandins & other lipid mediators 68-69, 59 69 112. Schievella, A. R., Regier, M. K., Smith, W. L., and Lin, L. L. (1995) The Journal of biological chemistry 270 (51), 3074930754 113. Hirabayashi, T., Murayama, T., and Shimizu, T. (2004) Biological & pharmaceutical bulletin 27(8), 11681173 114. Sierra Honigmann, M. R., Bradley, J. R., and Pober, J. S. (1996) Laboratory investigation; a journal of technical methods and pathology 74(3), 684 695 115. Yu, W., Bozza, P. T., Tzizik, D. M., Gray, J. P., Cassara, J., Dvorak, A. M., and Weller, P. F. (1998) The American journal of pathology 152 (3), 759 769 116. Huang, X. L., Pawliczak, R., Cowan, M. J., Gladwin, M. T., Madara, P., Logun, C., and Shelhamer, J. H. (2002) The Journal of biological chemistry 277(41), 38431 38440 117. Uozumi, N., Kume, K., Nagase, T., Nakatani, N., Ishii, S., Tashiro, F., Komagata, Y., Maki, K., Ikuta, K., Ouchi, Y., Miyazaki, J., and Shimizu, T. (1997) Nature 390(6660), 618622 118. Bonventre, J. V., Huang, Z., Taheri, M. R., O'Leary, E., Li, E., Moskowitz, M. A., and Sapirstein, A. (1997) Nature 390(6660), 622625 119. Downey, P., Sapirstein, A., O'Leary, E., Sun, T. X., Brown, D., and Bonventre, J. V. (2001) Am J Physiol Renal Physiol 280(4), F607618 120. Hong, K. H., Bonventre, J. C., O'Leary, E., Bonventre, J. V., and Lander, E. S. (2001) Proceedings of the National Academy of Sciences of the United States of America 98(7), 39353939

PAGE 152

152 121. Marusic, S., Leach, M. W., Pelker, J. W., Azoitei, M. L., Uozumi, N., C ui, J., Shen, M. W., DeClercq, C. M., Miyashiro, J. S., Carito, B. A., Thakker, P., Simmons, D. L., Leonard, J. P., Shimizu, T., and Clark, J. D. (2005) The Journal of experimental medicine 202(6), 841 851 122. Klivenyi, P., Beal, M. F., Ferrante, R. J., A ndreassen, O. A., Wermer, M., Chin, M. R., and Bonventre, J. V. (1998) Journal of neurochemistry 71(6), 26342637 123. Hegen, M., Sun, L., Uozumi, N., Kume, K., Goad, M. E., Nickerson Nutter, C. L., Shimizu, T., and Clark, J. D. (2003) The Journal of exper imental medicine 197 (10), 12971302 124. Ii, H., Hontani, N., Toshida, I., Oka, M., Sato, T., and Akiba, S. (2008) Biological & pharmaceutical bulletin 31(3), 363368 125. Balestrieri, B., Hsu, V. W., Gilbert, H., Leslie, C. C., Han, W. K., Bonventre, J. V ., and Arm, J. P. (2006) The Journal of biological chemistry 281(10), 66916698 126. Yamamoto, S. (1992) Biochimica et biophysica acta 1128(2 3), 117131 127. Mahipal, S. V., Subhashini, J., Reddy, M. C., Reddy, M. M., Anilkumar, K., Roy, K. R., Reddy, G. V., and Reddanna, P. (2007) Biochemical pharmacology 74 (2), 202214 128. Kim, C., Kim, J. Y., and Kim, J. H. (2008) BMB reports 41(8), 555559 129. Shureiqi, I., and Lippman, S. M. (2001) Cancer Res 61(17), 63076312 130. Funk, C. D., Chen, X. S., Johnson, E. N., and Zhao, L. (2002) Prostaglandins & other lipid mediators 68-69 303312 131. Radmark, O., Werz, O., Steinhilber, D., and Samuelsson, B. (2007) Trends in biochemical sciences 32(7), 332341 132. Brash, A. R., Boeglin, W. E., and Chang, M. S. (1997 ) Proceedings of the National Academy of Sciences of the United States of America 94(12), 61486152 133. Koshino, T., Takano, S., Houjo, T., Sano, Y., Kudo, K., Kihara, H., Kitani, S., Takaishi, T., Hirai, K., Ito, K., and Morita, Y. (1998) Biochemical and biophysical research communications 247(2), 510 513 134. Spanbroek, R., Grabner, R., Lotzer, K., Hildner, M., Urbach, A., Ruhling, K., Moos, M. P., Kaiser, B., Cohnert, T. U., Wahlers, T., Zieske, A., Plenz, G., Robenek, H., Salbach, P., Kuhn, H., Radmark, O., Samuelsson, B., and Habenicht, A. J. (2003) Proceedings of the National Academy of Sciences of the United States of America 100(3), 12381243 135. Samuelsson, B., Dahlen, S. E., Lindgren, J. A., Rouzer, C. A., and Serhan, C. N. (1987) Science (New Yo rk, N.Y 237(4819), 11711176

PAGE 153

153 136. Chang, M. S., Schneider, C., Roberts, R. L., Shappell, S. B., Haselton, F. R., Boeglin, W. E., and Brash, A. R. (2005) Investigative ophthalmology & visual science 46(3), 849856 137. Brash, A. R., Jisaka, M., Boeglin, W. E., and Chang, M. S. (1999) Advances in experimental medicine and biology 447, 29 36 138. Kelavkar, U. P., and Cohen, C. (2004) Neoplasia (New York, N.Y 6 (1), 41 52 139. Cesano, A., Visonneau, S., Scimeca, J. A., Kritchevsky, D., and Santoli, D. (1998) Anticancer Res 18(3A), 14291434 140. Ikawa, H., Kamitani, H., Calvo, B. F., Foley, J. F., and Eling, T. E. (1999) Cancer Res 59(2), 360366 141. Nadel, J. A., Conrad, D. J., Ueki, I. F., Schuster, A., and Sigal, E. (1991) The Journal of clinical investigatio n 87(4), 11391145 142. MacMillan, D. K., Hill, E., Sala, A., Sigal, E., Shuman, T., Henson, P. M., and Murphy, R. C. (1994) The Journal of biological chemistry 269(43), 2666326668 143. Smith, W. L., DeWitt, D. L., and Garavito, R. M. (2000) Annual review of biochemistry 69, 145182 144. Chandrasekharan, N. V., Dai, H., Roos, K. L., Evanson, N. K., Tomsik, J., Elton, T. S., and Simmons, D. L. (2002) Proceedings of the National Academy of Sciences of the United States of America 99(21), 1392613931 145. Dia z, A., Chepenik, K. P., Korn, J. H., Reginato, A. M., and Jimenez, S. A. (1998) Experimental cell research 241 (1), 222229 146. Smith, C. J., Morrow, J. D., Roberts, L. J., 2nd, and Marnett, L. J. (1993) Biochemical and biophysical research communications 192(2), 787793 147. Ueda, N., Yamashita, R., Yamamoto, S., and Ishimura, K. (1997) Biochimica et biophysica acta 1344(1), 103110 148. Xu, X. M., Tang, J. L., Chen, X., Wang, L. H., and Wu, K. K. (1997) The Journal of biological chemistry 272 (11), 69436950 149. Asano, K., Lilly, C. M., and Drazen, J. M. (1996) The American journal of physiology 271(1 Pt 1), L126131 150. Choi, S. H., Langenbach, R., and Bosetti, F. (2006) Journal of neurochemistry 98(3), 801811 151. Harris, R. C., and Breyer, M. D. (2001 ) Am J Physiol Renal Physiol 281(1), F1 11 152. Lama, V., Moore, B. B., Christensen, P., Toews, G. B., and Peters Golden, M. (2002) American journal of respiratory cell and molecular biology 27(6), 752 758

PAGE 154

154 153. Gavett, S. H., Madison, S. L., Chulada, P. C. Scarborough, P. E., Qu, W., Boyle, J. E., Tiano, H. F., Lee, C. A., Langenbach, R., Roggli, V. L., and Zeldin, D. C. (1999) The Journal of clinical investigation 104(6), 721732 154. Zeldin, D. C., Wohlford -Lenane, C., Chulada, P., Bradbury, J. A., Scarb orough, P. E., Roggli, V., Langenbach, R., and Schwartz, D. A. (2001) American journal of respiratory cell and molecular biology 25(4), 457 465 155. Tanabe, T., and Tohnai, N. (2002) Prostaglandins & other lipid mediators 68-69, 95 114 156. Yamamoto, K., A rakawa, T., Ueda, N., and Yamamoto, S. (1995) The Journal of biological chemistry 270 (52), 3131531320 157. Chun, K. S., and Surh, Y. J. (2004) Biochemical pharmacology 68(6), 10891100 158. Zhu, Y., Saunders, M. A., Yeh, H., Deng, W. G., and Wu, K. K. (20 02) The Journal of biological chemistry 277 (9), 69236928 159. Deng, W. G., Zhu, Y., and Wu, K. K. (2004) Blood 103(6), 21352142 160. Nie, M., Pang, L., Inoue, H., and Knox, A. J. (2003) Molecular and cellular biology 23(24), 92339244 161. Wu, G., Mannam A. P., Wu, J., Kirbis, S., Shie, J. L., Chen, C., Laham, R. J., Sellke, F. W., and Li, J. (2003) Am J Physiol Heart Circ Physiol 285(6), H24202429 162. Chen, B. C., Chang, Y. S., Kang, J. C., Hsu, M. J., Sheu, J. R., Chen, T. L., Teng, C. M., and Lin, C H. (2004) The Journal of biological chemistry 279 (20), 2088920897 163. Dean, J. L., Brook, M., Clark, A. R., and Saklatvala, J. (1999) The Journal of biological chemistry 274(1), 264 269 164. Xie, W., and Herschman, H. R. (1995) The Journal of biological chemistry 270(46), 2762227628 165. Catella -Lawson, F. (2001) Neurology 57 (5 Suppl 2), S57 166. Loll, P. J., Picot, D., Ekabo, O., and Garavito, R. M. (1996) Biochemistry 35(23), 73307340 167. Hippisley Cox, J., Coupland, C., and Logan, R. (2005) BMJ ( Clinical research ed 331(7528), 13101316 168. FitzGerald, G. A., and Patrono, C. (2001) The New England journal of medicine 345(6), 433442 169. Tran, H., and Anand, S. S. (2004) Jama 292(15), 18671874

PAGE 155

155 170. Vane, J. R., Flower, R. J., and Botting, R. M. (1990) Stroke; a journal of cerebral circulation 21(12 Suppl), IV12 23 171. Garcia Rodriguez, L. A., and Jick, H. (1994) Lancet 343(8900), 769772 172. Teismann, P., and Ferger, B. (2001) Synapse (New York, N.Y 39(2), 167174 173. Negishi, M., Sugimoto, Y. and Ichikawa, A. (1993) Progress in lipid research 32(4), 417434 174. Ashby, B. (1994) Receptor 4 (1), 31 42 175. Bastien, L., Sawyer, N., Grygorczyk, R., Metters, K. M., and Adam, M. (1994) The Journal of biological chemistry 269(16), 1187311877 176. T horat, M. A., Morimiya, A., Mehrotra, S., Konger, R., and Badve, S. S. (2008) Mod Pathol 21(1), 15 21 177. Wilborn, J., Crofford, L. J., Burdick, M. D., Kunkel, S. L., Strieter, R. M., and Peters Golden, M. (1995) The Journal of clinical investigation 95(4 ), 18611868 178. Reilly, I. A., and FitzGerald, G. A. (1987) Blood 69(1), 180186 179. Reilly, I. A., and FitzGerald, G. A. (1988) Drugs 35(2), 154176 180. Ensor, C. M., and Tai, H. H. (1995) Journal of lipid mediators and cell signalling 12(2 3), 313319 181. Yan, M., Rerko, R. M., Platzer, P., Dawson, D., Willis, J., Tong, M., Lawrence, E., Lutterbaugh, J., Lu, S., Willson, J. K., Luo, G., Hensold, J., Tai, H. H., Wilson, K., and Markowitz, S. D. (2004) Proceedings of the National Academy of Sciences of the United States of America 101(50), 1746817473 182. Segi, E., Sugimoto, Y., Yamasaki, A., Aze, Y., Oida, H., Nishimura, T., Murata, T., Matsuoka, T., Ushikubi, F., Hirose, M., Tanaka, T., Yoshida, N., Narumiya, S., and Ichikawa, A. (1998) Biochemical a nd biophysical research communications 246(1), 7 12 183. Ushikubi, F., Segi, E., Sugimoto, Y., Murata, T., Matsuoka, T., Kobayashi, T., Hizaki, H., Tuboi, K., Katsuyama, M., Ichikawa, A., Tanaka, T., Yoshida, N., and Narumiya, S. (1998) Nature 395 (6699), 281284 184. Lazarus, M., Yoshida, K., Coppari, R., Bass, C. E., Mochizuki, T., Lowell, B. B., and Saper, C. B. (2007) Nature neuroscience 10(9), 11311133 185. Nakamura, K., Matsumura, K., Kaneko, T., Kobayashi, S., Katoh, H., and Negishi, M. (2002) J Neur osci 22(11), 46004610

PAGE 156

156 186. Audoly, L. P., Tilley, S. L., Goulet, J., Key, M., Nguyen, M., Stock, J. L., McNeish, J. D., Koller, B. H., and Coffman, T. M. (1999) The American journal of physiology 277(3 Pt 2), H924930 187. Hosoi, M., Oka, T., Abe, M., Hor i, T., Yamamoto, H., Mine, K., and Kubo, C. (1999) Pain 83(2), 221227 188. Breyer, M. D., Zhang, Y., Guan, Y. F., Hao, C. M., Hebert, R. L., and Breyer, R. M. (1998) Kidney Int Suppl 67, S88 94 189. Hockel, G. M., and Cowley, A. W., Jr. (1980) Hypertensio n 2 (4), 529537 190. Hayashi, S., Noda, Y., Matsumoto, H., and Mori, T. (1987) Gamete research 18(4), 291299 191. Hayashi, S., Noda, Y., and Mori, T. (1988) European journal of obstetrics, gynecology, and reproductive biology 29(4), 287297 192. Jakobsson P. J., Thoren, S., Morgenstern, R., and Samuelsson, B. (1999) Proceedings of the National Academy of Sciences of the United States of America 96(13), 72207225 193. Murakami, M., Naraba, H., Tanioka, T., Semmyo, N., Nakatani, Y., Kojima, F., Ikeda, T., F ueki, M., Ueno, A., Oh, S., and Kudo, I. (2000) The Journal of biological chemistry 275(42), 3278332792 194. Jakobsson, P. J., Morgenstern, R., Mancini, J., Ford Hutchinson, A., and Persson, B. (1999) Protein Sci 8 (3), 689692 195. Jakobsson, P. J., Morge nstern, R., Mancini, J., Ford Hutchinson, A., and Persson, B. (2000) American journal of respiratory and critical care medicine 161 (2 Pt 2), S2024 196. Ouellet, M., Falgueyret, J. P., Ear, P. H., Pen, A., Mancini, J. A., Riendeau, D., and Percival, M. D. (2002) Protein expression and purification 26(3), 489495 197. Beuckmann, C. T., Fujimori, K., Urade, Y., and Hayaishi, O. (2000) Neurochemical research 25 (5), 733738 198. Murakami, M., Nakatani, Y., Tanioka, T., and Kudo, I. (2002) Prostaglandins & other lipid mediators 68-69, 383 399 199. Yoshimatsu, K., Golijanin, D., Paty, P. B., Soslow, R. A., Jakobsson, P. J., DeLellis, R. A., Subbaramaiah, K., and Dannenberg, A. J. (2001) Clin Cancer Res 7 (12), 39713976 200. Claveau, D., Sirinyan, M., Guay, J., Gor don, R., Chan, C. C., Bureau, Y., Riendeau, D., and Mancini, J. A. (2003) J Immunol 170(9), 47384744 201. Kojima, F., Naraba, H., Miyamoto, S., Beppu, M., Aoki, H., and Kawai, S. (2004) Arthritis research & therapy 6 (4), R355 365

PAGE 157

157 202. Cipollone, F., Pront era, C., Pini, B., Marini, M., Fazia, M., De Cesare, D., Iezzi, A., Ucchino, S., Boccoli, G., Saba, V., Chiarelli, F., Cuccurullo, F., and Mezzetti, A. (2001) Circulation 104(8), 921927 203. Bosetti, F., Langenbach, R., and Weerasinghe, G. R. (2004) Journal of neurochemistry 91(6), 13891397 204. Yuan, C. J., Mandal, A. K., Zhang, Z., and Mukherjee, A. B. (2000) Cancer Res 60(4), 10841091 205. Forsberg, L., Leeb, L., Thoren, S., Morgenstern, R., and Jakobsson, P. (2000) FEBS letters 471(1), 78 82 206. Nar aba, H., Yokoyama, C., Tago, N., Murakami, M., Kudo, I., Fueki, M., Oh Ishi, S., and Tanabe, T. (2002) The Journal of biological chemistry 277(32), 2860128608 207. Moon, Y., Glasgow, W. C., and Eling, T. E. (2005) The Journal of pharmacology and experimen tal therapeutics 315 (2), 788795 208. Ackerman, W. E. t., Summerfield, T. L., Vandre, D. D., Robinson, J. M., and Kniss, D. A. (2008) Biology of reproduction 78(1), 68 76 209. Frasor, J., Weaver, A. E., Pradhan, M., and Mehta, K. (2008) Endocrinology 149(1 2), 62726279 210. Saha, S., Engstrom, L., Mackerlova, L., Jakobsson, P. J., and Blomqvist, A. (2005) Am J Physiol Regul Integr Comp Physiol 288(5), R11001107 211. Kamei, D., Yamakawa, K., Takegoshi, Y., Mikami Nakanishi, M., Nakatani, Y., Oh -Ishi, S., Ya sui, H., Azuma, Y., Hirasawa, N., Ohuchi, K., Kawaguchi, H., Ishikawa, Y., Ishii, T., Uematsu, S., Akira, S., Murakami, M., and Kudo, I. (2004) The Journal of biological chemistry 279(32), 3368433695 212. Jia, Z., Zhang, A., Zhang, H., Dong, Z., and Yang, T. (2006) Circulation research 99(11), 12431251 213. Degousee, N., Fazel, S., Angoulvant, D., Stefanski, E., Pawelzik, S. C., Korotkova, M., Arab, S., Liu, P., Lindsay, T. F., Zhuo, S., Butany, J., Li, R. K., Audoly, L., Schmidt, R., Angioni, C., Geissli nger, G., Jakobsson, P. J., and Rubin, B. B. (2008) Circulation 117(13), 17011710 214. Elander, L., Engstrom, L., Hallbeck, M., and Blomqvist, A. (2007) Am J Physiol Regul Integr Comp Physiol 292(1), R258 267 215. Levine, A. S., and Morley, J. E. (1981) P harmacology, biochemistry, and behavior 15(5), 735738

PAGE 158

158 216. Pecchi, E., Dallaporta, M., Thirion, S., Salvat, C., Berenbaum, F., Jean, A., and Troadec, J. D. (2006) Physiological genomics 25(3), 485492 217. Mabuchi, T., Kojima, H., Abe, T., Takagi, K., Sak urai, M., Ohmiya, Y., Uematsu, S., Akira, S., Watanabe, K., and Ito, S. (2004) Neuroreport 15(9), 13951398 218. Trebino, C. E., Stock, J. L., Gibbons, C. P., Naiman, B. M., Wachtmann, T. S., Umland, J. P., Pandher, K., Lapointe, J. M., Saha, S., Roach, M. L., Carter, D., Thomas, N. A., Durtschi, B. A., McNeish, J. D., Hambor, J. E., Jakobsson, P. J., Carty, T. J., Perez, J. R., and Audoly, L. P. (2003) Proceedings of the National Academy of Sciences of the United States of America 100(15), 90449049 219. Ikeda -Matsuo, Y., Ikegaya, Y., Matsuki, N., Uematsu, S., Akira, S., and Sasaki, Y. (2005) Journal of neurochemistry 94(6), 15461558 220. Kamei, D., Murakami, M., Nakatani, Y., Ishikawa, Y., Ishii, T., and Kudo, I. (2003) The Journal of biological chemistry 278(21), 1939619405 221. Puxeddu, E., Mitsutake, N., Knauf, J. A., Moretti, S., Kim, H. W., Seta, K. A., Brockman, D., Myatt, L., Millhorn, D. E., and Fagin, J. A. (2003) The Journal of biological chemistry 278(52), 5213152138 222. Martey, C. A., Baglol e, C. J., Gasiewicz, T. A., Sime, P. J., and Phipps, R. P. (2005) American journal of physiology 289 (3), L391399 223. Mehrotra, S., Morimiya, A., Agarwal, B., Konger, R., and Badve, S. (2006) The Journal of pathology 208(3), 356363 224. Murakami, M., and Kudo, I. (2006) Current pharmaceutical design 12 (8), 943954 225. Yoshimatsu, K., Altorki, N. K., Golijanin, D., Zhang, F., Jakobsson, P. J., Dannenberg, A. J., and Subbaramaiah, K. (2001) Clin Cancer Res 7 (9), 26692674 226. Chang, S. H., Liu, C. H., Con way, R., Han, D. K., Nithipatikom, K., Trifan, O. C., Lane, T. F., and Hla, T. (2004) Proceedings of the National Academy of Sciences of the United States of America 101(2), 591596 227. Schug, J. (2003) Using TESS to Predict Transcription Factor Binding Sites in DNA Sequence 2003 Ed., J. Wiley and Sons 228. Chomczynski, P., and Sacchi, N. (1987) Analytical biochemistry 162(1), 156 159 229. Lipson, K. E., and Baserga, R. (1989) Proceedings of the National Academy of Sciences of the United States of America 86(24), 97749777 230. Livak, K. J., and Schmittgen, T. D. (2001) Methods (San Diego, Calif 25(4), 402408

PAGE 159

159 231. Boulet, L., Ouellet, M., Bateman, K. P., Ethier, D., Percival, M. D., Riendeau, D., Mancini, J. A., and Methot, N. (2004) The Journal of biological chemistry 279(22), 2322923237 232. Engblom, D., Saha, S., Engstrom, L., Westman, M., Audoly, L. P., Jakobsson, P. J., and Blomqvist, A. (2003) Nature neuroscience 6 (11), 11371138 233. Degousee, N., Angoulvant, D., Fazel, S., Stefanski, E., Saha, S., Iliescu, K., Lindsay, T. F., Fish, J. E., Marsden, P. A., Li, R. K., Audoly, L. P., Jakobsson, P. J., and Rubin, B. B. (2006) The Journal of biological chemistry 281 (24), 1644316452 234. Subbaramaiah, K., Yoshimatsu, K., Scherl, E., Das, K. M., Glazier, K. D., Golijanin, D., Soslow, R. A., Tanabe, T., Naraba, H., and Dannenberg, A. J. (2004) The Journal of biological chemistry 279 (13), 1264712658 235. Harding, P., Balasubramanian, L., Swegan, J., Stevens, A., and Glass, W. F., 2nd. (2006) Kidney internat ional 69(9), 15781585 236. van Rees, B. P., Sivula, A., Thoren, S., Yokozaki, H., Jakobsson, P. J., Offerhaus, G. J., and Ristimaki, A. (2003) International journal of cancer 107(4), 551556 237. Moon, Y., Lee, M., and Yang, H. (2007) Biochemical pharmacology 73(1), 125135 238. Han, R., Tsui, S., and Smith, T. J. (2002) The Journal of biological chemistry 277(19), 1635516364 239. Pham, H., Shafer, L. M., and Slice, L. W. (2006) Journal of cellular biochemistry 98(6), 16531666 240. Cheng, S., Afif, H., M artel -Pelletier, J., Pelletier, J. P., Li, X., Farrajota, K., Lavigne, M., and Fahmi, H. (2004) The Journal of biological chemistry 279 (21), 2205722065 241. Li, X., Afif, H., Cheng, S., Martel Pelletier, J., Pelletier, J. P., Ranger, P., and Fahmi, H. (20 05) The Journal of rheumatology 32(5), 887895 242. Chabane, N., Li, X., and Fahmi, H. (2009) Journal of cellular biochemistry 106(3), 453463 243. Yucel Lindberg, T., Olsson, T., and Kawakami, T. (2006) Cellular signalling 18(12), 21312142 244. Kawao, N. Nagataki, M., Nagasawa, K., Kubo, S., Cushing, K., Wada, T., Sekiguchi, F., Ichida, S., Hollenberg, M. D., MacNaughton, W. K., Nishikawa, H., and Kawabata, A. (2005) The Journal of pharmacology and experimental therapeutics 315 (2), 576589 245. Wang, H. W., Hsueh, C. T., Lin, C. F., Chou, T. Y., Hsu, W. H., Wang, L. S., and Wu, Y. C. (2006) Annals of surgical oncology 13(9), 12241234 246. Radi, Z. A., and Ostroski, R. (2007) Mediators of inflammation 2007, 85091

PAGE 160

160 247. Nagataki, M., Moriyuki, K., Sekiguchi F., and Kawabata, A. (2008) Cell biochemistry and function 26(2), 279 282 248. Weintraub, H., and Groudine, M. (1976) Science (New York, N.Y 193(4256), 848856 249. Brownell, J. E., Zhou, J., Ranalli, T., Kobayashi, R., Edmondson, D. G., Roth, S. Y., and Allis, C. D. (1996) Cell 84(6), 843851 250. Ogryzko, V. V., Schiltz, R. L., Russanova, V., Howard, B. H., and Nakatani, Y. (1996) Cell 87(5), 953959 251. Taunton, J., Hassig, C. A., and Schreiber, S. L. (1996) Science (New York, N.Y 272(5260), 408411 2 52. Wong, J., Patterton, D., Imhof, A., Guschin, D., Shi, Y. B., and Wolffe, A. P. (1998) The EMBO journal 17(2), 520534 253. Wu, C., Bingham, P. M., Livak, K. J., Holmgren, R., and Elgin, S. C. (1979) Cell 16(4), 797806 254. Nyborg, J. K., and Spindler, S. R. (1986) The Journal of biological chemistry 261(13), 56855688 255. Gross, D. S., and Garrard, W. T. (1988) Annual review of biochemistry 57, 159197 256. Gong, Q., and Dean, A. (1993) Molecular and cellular biology 13 (2), 911917 257. Ney, P. A., So rrentino, B. P., McDonagh, K. T., and Nienhuis, A. W. (1990) Genes & development 4 (6), 9931006 258. Tuan, D. Y., Solomon, W. B., London, I. M., and Lee, D. P. (1989) Proceedings of the National Academy of Sciences of the United States of America 86(8), 25 542558 259. Blackwood, E. M., and Kadonaga, J. T. (1998) Science (New York, N.Y 281(5373), 6063 260. Gijon, M. A., and Leslie, C. C. (1999) Journal of leukocyte biology 65(3), 330336 261. Evans, J. H., Spencer, D. M., Zweifach, A., and Leslie, C. C. (20 01) The Journal of biological chemistry 276 (32), 3015030160 262. Hirabayashi, T., Kume, K., Hirose, K., Yokomizo, T., Iino, M., Itoh, H., and Shimizu, T. (1999) The Journal of biological chemistry 274 (8), 51635169 263. Muthalif, M. M., Hefner, Y., Canaan S., Harper, J., Zhou, H., Parmentier, J. H., Aebersold, R., Gelb, M. H., and Malik, K. U. (2001) The Journal of biological chemistry 276(43), 3965339660 264. Schmidlin, F., Loeffler, S., Bertrand, C., Landry, Y., and Gies, J. P. (2000) NaunynSchmiedebe rg's archives of pharmacology 361(3), 247254

PAGE 161

161 265. Yuhas, Y., Azoulay -Alfaguter, I., Berent, E., and Ashkenazi, S. (2007) Antimicrobial agents and chemotherapy 51(12), 42254230 266. Beasley, D. (1999) The American journal of physiology 276(4 Pt 2), H13691378 267. Dolan -O'keefe, M., and Nick, H. S. (1999) Gastroenterology 116(4), 855864 268. Schalkwijk, C. G., Vervoordeldonk, M., Pfeilschifter, J., and van den Bosch, H. (1993) FEBS letters 333(3), 339343 269. Xue, S., Slater, D. M., Bennett, P. R., and M yatt, L. (1996) Prostaglandins 51(2), 107124 270. Wu, T., Ikezono, T., Angus, C. W., and Shelhamer, J. H. (1994) Nucleic acids research 22(23), 50935098 271. Tay, A., Maxwell, P., Li, Z., Goldberg, H., and Skorecki, K. (1994) Biochimica et biophysica act a 1217(3), 345347 272. de Carvalho, M. G., Garritano, J., and Leslie, C. C. (1995) The Journal of biological chemistry 270(35), 2043920446 273. Kuwata, H., Nakatani, Y., Murakami, M., and Kudo, I. (1998) The Journal of biological chemistry 273(3), 17331 740 274. Wang, X., Xue, H., Xu, Q., Zhang, K., Hao, X., Wang, L., and Yan, G. (2008) Prostaglandins & other lipid mediators 86(1 4), 6167 275. Zhou, H., Das, S., and Murthy, K. S. (2003) Am J Physiol Gastrointest Liver Physiol 284(3), G472480 276. Hasega wa, S., Kohro, Y., Tsuda, M., and Inoue, K. (2009) Molecular pain 5 (1), 22 277. Li, F., and Malik, K. U. (2005) Am J Physiol Heart Circ Physiol 288(5), H23062316 278. Ichijo, H., Nishida, E., Irie, K., ten Dijke, P., Saitoh, M., Moriguchi, T., Takagi, M., Matsumoto, K., Miyazono, K., and Gotoh, Y. (1997) Science (New York, N.Y 275(5296), 9094 279. Uhlik, M. T., Abell, A. N., Johnson, N. L., Sun, W., Cuevas, B. D., Lobel -Rice, K. E., Horne, E. A., Dell'Acqua, M. L., and Johnson, G. L. (2003) Nat Cell Biol 5 (12), 11041110 280. Johnson, G. L., and Lapadat, R. (2002) Science (New York, N.Y 298(5600), 19111912 281. Chang, L., and Karin, M. (2001) Nature 410(6824), 3740 282. Seger, R., and Krebs, E. G. (1995) Faseb J 9 (9), 726735

PAGE 162

162 283. Inoue, T., Boyle, D. L., Corr, M., Hammaker, D., Davis, R. J., Flavell, R. A., and Firestein, G. S. (2006) Proceedings of the National Academy of Sciences of the United States of America 103(14), 54845489 284. Li, Y., Batra, S., Sassano, A., Majchrzak, B., Levy, D. E., Gaestel, M., Fish, E. N., Davis, R. J., and Platanias, L. C. (2005) The Journal of biological chemistry 280 (11), 1000110010 285. Nagy, N., Shiroto, K., Malik, G., Huang, C. K., Gaestel, M., Abdellatif, M., Tosaki, A., Maulik, N., and Das, D. K. (2007) J Mol Cell Cardiol 42(5), 981990 286. Marais, E., Genade, S., and Lochner, A. (2008) Cardiovascular drugs and therapy / sponsored by the International Society of Cardiovascular Pharmacotherapy 22(1), 3 17 287. Deak, M., Clifton, A. D., Lucocq, L. M., and Alessi, D. R. (1998) The EMBO journal 17(15), 44264441 288. Vermeulen, L., De Wilde, G., Van Damme, P., Vanden Berghe, W., and Haegeman, G. (2003) The EMBO journal 22(6), 13131324 289. Wiggin, G. R., Soloaga, A., Foster, J. M., Murray Tait, V., Cohen, P., and Arthu r, J. S. (2002) Molecular and cellular biology 22 (8), 28712881 290. Soloaga, A., Thomson, S., Wiggin, G. R., Rampersaud, N., Dyson, M. H., Hazzalin, C. A., Mahadevan, L. C., and Arthur, J. S. (2003) The EMBO journal 22(11), 2788 2797 291. Bartoli, F., Lin H. K., Ghomashchi, F., Gelb, M. H., Jain, M. K., and Apitz -Castro, R. (1994) The Journal of biological chemistry 269 (22), 1562515630 292. Salari, H., Braquet, P., and Borgeat, P. (1984) Prostaglandins Leukot Med 13 (1), 53 60 293. Harizi, H., Juzan, M., Moreau, J. F., and Gualde, N. (2003) J Immunol 170(1), 139146 294. Dixon, R. A., Diehl, R. E., Opas, E., Rands, E., Vickers, P. J., Evans, J. F., Gillard, J. W., and Miller, D. K. (1990) Nature 343(6255), 282284 295. Nie, D., Krishnamoorthy, S., Jin, R., Tang, K., Chen, Y., Qiao, Y., Zacharek, A., Guo, Y., Milanini, J., Pages, G., and Honn, K. V. (2006) The Journal of biological chemistry 281(27), 1860118609 296. Sadik, C. D., Sies, H., and Schewe, T. (2003) Biochemical pharmacology 65 (5), 773781 297. L oke, W. M., Proudfoot, J. M., Stewart, S., McKinley, A. J., Needs, P. W., Kroon, P. A., Hodgson, J. M., and Croft, K. D. (2008) Biochemical pharmacology 75(5), 10451053 298. Sendobry, S. M., Cornicelli, J. A., Welch, K., Bocan, T., Tait, B., Trivedi, B. K ., Colbry, N., Dyer, R. D., Feinmark, S. J., and Daugherty, A. (1997) British journal of pharmacology 120 (7), 11991206

PAGE 163

163 299. Markou, T., Vassort, G., and Lazou, A. (2003) Molecular and cellular biochemistry 242(1 2), 163171 300. Fahmi, H. (2004) Current o pinion in rheumatology 16(5), 623 627 301. Kuo, S., Chesrown, S. E., Mellott, J. K., Rogers, R. J., Hsu, J. L., and Nick, H. S. (1999) The Journal of biological chemistry 274(6), 33453354 302. Gijon, M. A., Spencer, D. M., and Leslie, C. C. (2000) Adv Enz yme Regul 40, 255268 303. Aimond, F., Rauzier, J. M., Bony, C., and Vassort, G. (2000) The Journal of biological chemistry 275(50), 3911039116 304. Slamon, D. J., Clark, G. M., Wong, S. G., Levin, W. J., Ullrich, A., and McGuire, W. L. (1987) Science (Ne w York, N.Y 235(4785), 177182 305. Frasor, J., Danes, J. M., Komm, B., Chang, K. C., Lyttle, C. R., and Katzenellenbogen, B. S. (2003) Endocrinology 144(10), 45624574 306. Stender, J. D., Frasor, J., Komm, B., Chang, K. C., Kraus, W. L., and Katzenellenb ogen, B. S. (2007) Molecular endocrinology (Baltimore, Md 21(9), 21122123 307. Richards, J. A., and Brueggemeier, R. W. (2003) The Journal of clinical endocrinology and metabolism 88(6), 28102816 308. Zhao, Y., Agarwal, V. R., Mendelson, C. R., and Simps on, E. R. (1996) Endocrinology 137(12), 57395742 309. Sotiriou, C., Neo, S. Y., McShane, L. M., Korn, E. L., Long, P. M., Jazaeri, A., Martiat, P., Fox, S. B., Harris, A. L., and Liu, E. T. (2003) Proceedings of the National Academy of Sciences of the Uni ted States of America 100(18), 1039310398 310. Catley, M. C., Chivers, J. E., Cambridge, L. M., Holden, N., Slater, D. M., Staples, K. J., Bergmann, M. W., Loser, P., Barnes, P. J., and Newton, R. (2003) FEBS letters 547(1 3), 7579

PAGE 164

164 BIOGRAPHICAL SKETC H Jewell Nadia Walters was born on the island of Tortola in the British Virgin Islands. She attended school and worked there until 1993 when she left to start her undergraduate education at Hampton University in Virginia. After graduating with a Bachelor of Science degree in 2001, she relocated to Maryland and got a job as a research technician at Johns Hopkins University (Baltimore, Maryland) in the laboratory of Dr. Prashant Desai, working on herpes simplex virus type II. In 2003, she left Johns Hopkins University and joined the Interdisciplinary Doctoral Program (IDP) at the University of Florida (Gainesville, Florida) and in May 2004, joined Dr. Harry Nicks lab