<%BANNER%>

Population Dynamics of Pasteuria penetrans in a Peanut Field and Description of a Pasteuria Isolate Infecting Mesocricon...

Permanent Link: http://ufdc.ufl.edu/UFE0024960/00001

Material Information

Title: Population Dynamics of Pasteuria penetrans in a Peanut Field and Description of a Pasteuria Isolate Infecting Mesocriconema ornatum
Physical Description: 1 online resource (182 p.)
Language: english
Creator: Orajay, Joey
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: arenaria, detection, meloidogyne, mesocriconema, nematode, ornatum, parasite, pasteuria, peanut, penetrans, phylogeny, simulation, suppression
Entomology and Nematology -- Dissertations, Academic -- UF
Genre: Entomology and Nematology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Pasteuria spp. are bacterial parasites with potential as biological control agents of plant-parasitic nematodes. In a peanut research site in Marion Co., FL an undescribed population of Pasteuria that infects Mesocriconema ornatum was found occurring sympatrically with P. penetrans, the parasite of Meloidogyne arenaria race 1.The endospores of the ring nematode Pasteuria (RNP) had morphology and morphometrics that were different from P. penetrans and other described Pasteuria species. They attached only to M. ornatum females. Phylogenetic analysis based on 16S rRNA gene sequence showed that RNP represents a distinct lineage within the group of Pasteuria spp. that infects tylenchid nematodes. The morphological and genetic uniqueness of RNP justify its consideration as a new species. The population dynamics of M. arenaria and P. penetrans were monitored in nonfumigated and fumigated plots for a period of 3 years after 2 years of fumigation with either chloropicrin or 1,3-D. The results showed that the population densities of the nematode in nonfumigated plots fluctuated within a low density range. Fumigation by 1,3-D and chloropicrin suppressed the nematode and bacterial populations, respectively, only during the years when they were applied. When stopped, nematode population resurgence was immediately observed in both fumigated plots. The P. penetrans population increased rapidly in a host density-dependent manner with time delay. The Lotka-Volterra simulation projected a scenario in which M. arenaria population in previously fumigated plots was suppressed by the parasite to levels nearing extinction. This approach is in line with the paradox of enrichment theory and may provide a paradigm for managing soil suppressiveness. Sorting out sympatric populations of Pasteuria is an essential step towards developing a reliable method of population density monitoring. The nucleotide sequences of sporulation genes sigE, sigF, spoIIAB, and spo0A were obtained from RNP. A species-specific primer was designed for RNP and P. penetrans based on their spo0A sequences. Using PCR, the primers were able to distinguish the target from the non-target species. The P. penetrans-specific primer amplified the spo0A genes of both P. penetrans P-20 and P-100, reinforcing the idea that these two populations represent biotypes of the same species.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Joey Orajay.
Thesis: Thesis (Ph.D.)--University of Florida, 2009.
Local: Adviser: Dickson, Donald W.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0024960:00001

Permanent Link: http://ufdc.ufl.edu/UFE0024960/00001

Material Information

Title: Population Dynamics of Pasteuria penetrans in a Peanut Field and Description of a Pasteuria Isolate Infecting Mesocriconema ornatum
Physical Description: 1 online resource (182 p.)
Language: english
Creator: Orajay, Joey
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: arenaria, detection, meloidogyne, mesocriconema, nematode, ornatum, parasite, pasteuria, peanut, penetrans, phylogeny, simulation, suppression
Entomology and Nematology -- Dissertations, Academic -- UF
Genre: Entomology and Nematology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Pasteuria spp. are bacterial parasites with potential as biological control agents of plant-parasitic nematodes. In a peanut research site in Marion Co., FL an undescribed population of Pasteuria that infects Mesocriconema ornatum was found occurring sympatrically with P. penetrans, the parasite of Meloidogyne arenaria race 1.The endospores of the ring nematode Pasteuria (RNP) had morphology and morphometrics that were different from P. penetrans and other described Pasteuria species. They attached only to M. ornatum females. Phylogenetic analysis based on 16S rRNA gene sequence showed that RNP represents a distinct lineage within the group of Pasteuria spp. that infects tylenchid nematodes. The morphological and genetic uniqueness of RNP justify its consideration as a new species. The population dynamics of M. arenaria and P. penetrans were monitored in nonfumigated and fumigated plots for a period of 3 years after 2 years of fumigation with either chloropicrin or 1,3-D. The results showed that the population densities of the nematode in nonfumigated plots fluctuated within a low density range. Fumigation by 1,3-D and chloropicrin suppressed the nematode and bacterial populations, respectively, only during the years when they were applied. When stopped, nematode population resurgence was immediately observed in both fumigated plots. The P. penetrans population increased rapidly in a host density-dependent manner with time delay. The Lotka-Volterra simulation projected a scenario in which M. arenaria population in previously fumigated plots was suppressed by the parasite to levels nearing extinction. This approach is in line with the paradox of enrichment theory and may provide a paradigm for managing soil suppressiveness. Sorting out sympatric populations of Pasteuria is an essential step towards developing a reliable method of population density monitoring. The nucleotide sequences of sporulation genes sigE, sigF, spoIIAB, and spo0A were obtained from RNP. A species-specific primer was designed for RNP and P. penetrans based on their spo0A sequences. Using PCR, the primers were able to distinguish the target from the non-target species. The P. penetrans-specific primer amplified the spo0A genes of both P. penetrans P-20 and P-100, reinforcing the idea that these two populations represent biotypes of the same species.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Joey Orajay.
Thesis: Thesis (Ph.D.)--University of Florida, 2009.
Local: Adviser: Dickson, Donald W.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0024960:00001


This item has the following downloads:


Full Text

PAGE 1

1 POPULATION DYNAMICS OF Pasteuria penetrans IN A PEANUT FIELD AND DESCRIPTION OF A Pasteuria ISOLATE INFECTING Mesocriconema ornatum By JOEY ISURITA ORAJAY A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2009

PAGE 2

2 2009 Joey Isurita Orajay

PAGE 3

3 To my Tatay and Nanay for their 50th wedding anniversary

PAGE 4

4 ACKNOWLEDGMENTS This dissertation came in part out of long history of research done on Pasteuria penetrans in the Nematode Management Laboratory headed by Dr. Dickson. When I joined the research group in 2004, I have worked with a number of scienti sts and peers who made various contributions to honing my scientific perspectives and skills in conducting studies. I also got involved in several activities and organizations in the university that gave me chances to have productive interactions with a di verse group of people. To all of them, I wish to convey my sincerest appreciation. Foremost, I would like to express my gratitude to Dr. Donald W. Dickson, my major professor and dissertation adviser, for his unwavering support and constant guidance throug hout my stay in his laboratory. I also thank him for instilling confidence in me by believing that I can do this research His passion in nematology is truly worth emulating and it was such an honor for me to being part of his research team. I also expres s my gratefulness to the members of my advisory committee, Drs. James F. Preston, William T. Crow, Robin M. GiblinDavis and Janet A. Brito for all their guidance and encouragements. I also spent part of my work in the laboratory of Dr. Preston, and for this, I am particularly thankful. I am so fortunate to being mentored by the best experts in Pasteuria research. My sincere appreciation to my professors and mentors in the Entomology and Nematology Department and Division of Plant Industry. I owe Dr. Rober t McSorley much of my basic knowledge on the ecology of nematodes in which my research was founded. I would like to mention also Drs. Khuong Nguyen, Jimmy Rich, Larry Duncan, and Renato Inserra for unselfishly sharing their vast knowledge and wisdom gained through their long history of working with nematodes. Indeed, my journey is just starting.

PAGE 5

5 I also thank my colleagues in the lab, Drs. Maria Mendes, George Kariuki, Ramazan Cetintas, Marisol Davila, Ramandeep Kaur, Jason Stanley, and Adriana Espinosa for the mentoring, encouragements, and meaningful conversations. Particularly I am genuinely grateful to Drs. Liesbeth Schmidth, Guang Nong and Virginia Chow of Microbiology and Cell Science Department for patiently guiding me through the conduct of my molec ular experiments. Special thanks go to my friends Justin Havird, Anders Bck and Andrei Hatara for helping me in phylogenetic analysis and Lotka Volterra simulation. My earnest thanks to Ms. Debra Anderson of the UF International Center for not only provi ding me a home atmosphere while I am away from my country, but most importantly, bringing out the best and strongest in me. Through her, I realized that the world is much bigger than me and my beliefs an d that our differences should not hinder us from from working together. Her warmness and generosity will forever be treasured. Collective acknowledgments to my fellow nematology majors ; dearest friends in the Pinoy UF, ENSO, volleyball, Fulbright, and various international students groups ; and roommates in the University Commons apartments for impacting my life in one way or the other. Through them, I learned how to productive ly intera ct and work in diverse settings, smartly take risks, and courageously face life including the most difficult situations. For the person I am now, I owe all of you a lot. Lastly, I am indebted to the University of the Philippines Los Baos, Department of Agriculture Fulbright Scholarship, and the Entomology and Nematology Department, University of Florida for sponsoring my study and stay in the United States. I would like to mention also the Florida Peanut Producers Association for financially supporting my research. These institutions were instrumental to making this study possible.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS ...............................................................................................................4 LIST OF TABLES ...........................................................................................................................9 LIST OF FIGURES .......................................................................................................................10 LIST OF ABBREVIATIONS ........................................................................................................12 ABSTRACT ...................................................................................................................................13 CHAPTER 1 INTRODUCTION ..................................................................................................................15 Peanut Production ...................................................................................................................15 Plant Parasitic Nematodes Associated with Peanut ...............................................................16 Species of Meloidogyne Pathogenic to Peanut ................................................................16 Other Species of Nematodes Associated with Peanut .....................................................18 Root Knot of Peanut ...............................................................................................................18 Disease Cycle ..................................................................................................................19 Population Dynamics .......................................................................................................20 Integrated Nematode Management .........................................................................................21 Crop Rotation ..................................................................................................................22 Resistant Varieties ...........................................................................................................23 Chemical Nematicides .....................................................................................................23 Biological Control Agents ...............................................................................................24 Pasteuria spp.: Bacterial Parasites of Plant Parasitic Nematodes ..........................................24 History .............................................................................................................................25 Taxonomy ........................................................................................................................26 Geographical Distribution ...............................................................................................28 Host Specificity and Variab ility ......................................................................................29 Biology and Life Cycle ...................................................................................................31 Effects of Pasteuria on the Host .....................................................................................33 Factors Affecting the Abundance and Persistence of Pasteuria penetrans in the Soil ..........36 Nematode Host Densities ................................................................................................37 Cropping Pattern ..............................................................................................................37 Temperature .....................................................................................................................38 Moisture ...........................................................................................................................39 Soil Chemicals and Nematicides .....................................................................................40 Soil Texture and Irrigation ..............................................................................................41 Place of Pasteuria Penetrans in Integrated Root Knot Nematode Management ...................42 Management of Soil Suppressiveness Induced by Pasteuria penetrans ................................44 Objectives ...............................................................................................................................46

PAGE 7

7 2 MORPHOLOGY, DEVELOPMENT, AND MOLECULAR CHARACTERIZATION OF A Pasteuria ISOLATE INFECTING PEANUT RING NEMATODE, Mesocriconema ornatum ........................................................................................................47 Introduction .............................................................................................................................47 Materials and Methods ...........................................................................................................50 Identification of Ring Nematode Species ........................................................................50 Determination of the Range of Ring Nematode Pasteuria (RNP) Endospore Attachment ...................................................................................................................51 Morphology and Morphometrics of Ring Nematode Pasteuria ......................................52 Light micros copy (LM) ............................................................................................52 Scanning electron microscopy (SEM) ......................................................................53 Transmission electron microscopy (TEM) ...............................................................53 Molecular Characterization of Ring Nematode Pasteuria ..............................................54 DNA extraction ........................................................................................................54 Amplification of partial 16S rRNA gene .................................................................55 Gene cloning and sequencing ...................................................................................56 Phylogenetic analysis ...............................................................................................57 Results .....................................................................................................................................58 Species Identification of Ring Nematode ........................................................................58 Parasitism of M. ornatum by RNP in Natural Populations .............................................59 Range of RNP Endospore Attachment ............................................................................60 Morphology and Morphometrics of RNP ........................................................................60 Development and Ultrastructure ......................................................................................61 Phylogenetic Analysis Based on Partial 16S rRNA Gene Sequences .............................62 Discussion ...............................................................................................................................63 3 POST FUMIGATION POPULATION DYNAMICS OF Meloidogyne arenaria RACE 1 AND Pasteuria penetrans IN A PEANUT FIELD .............................................................88 Introduction .............................................................................................................................88 Materials and Methods ...........................................................................................................91 Background ......................................................................................................................91 Experimental Design .......................................................................................................92 Determination of Standard Curve ....................................................................................94 Statistical Analysis ..........................................................................................................95 Lotka Volterr a Simulation ...............................................................................................95 Results .....................................................................................................................................96 Field Experiment .............................................................................................................96 Determination of Standard Curve ....................................................................................99 Simulation of the Post Fumigation Population Dynamics ............................................100 Discussion .............................................................................................................................100 4 MOLECULAR DIFFERENTIATION OF TWO POPULATIONS OF Pasteuria OCCURRING IN A PEANUT FIELD .................................................................................127 Introduction ...........................................................................................................................127

PAGE 8

8 Materials and Methods .........................................................................................................132 Sources of Pasteuria Isolates ........................................................................................132 DNA Extraction and Multiple Strand Amplification (MDSA) .....................................133 Degenerate Primer Design .............................................................................................135 PCR Amplification of Sporulation Genes .....................................................................136 Agarose Gel Electrophoresis .........................................................................................136 Cloning and Sequencing of Sporulation Genes of RNP ................................................137 Specific Primer Design and Amplification ....................................................................138 Nucleotide Sequence Analysis ......................................................................................138 Results ...................................................................................................................................139 Amplif ication, Cloning and Sequencing of sigE sigF spoIIAB and spo0A .................139 Partial Gene Sequences Analysis ..................................................................................139 S pecies Specific Amplif ication of spo0A ......................................................................140 Discussion .............................................................................................................................140 APPENDIX A 16S rRNA GENE SEQUENCES OF TWO CLONES OF RING NEMATODE Pasteuria (RNP) ALIGNED B Y CLUSTALW ...................................................................151 B PARTIAL NUCLEOTIDE S EQUENCES OF SPORULAT ION GENES spoIIAB spo0A sig E AND sig F OF RING NEMATODE PASTEURIA IN FASTA FORMAT .....153 LIST OF REFERENCES .............................................................................................................154 BIOGRAPHICAL SKETCH .......................................................................................................182

PAGE 9

9 LIST OF TABLES Table page 21 Gram positive bacterial species included in inferring a 16S rRNA gene tree and their respective accession number in GenBank. .........................................................................73 22 Attachment of ring nematode Pasteuria endospores to selected species of plant parasitic tylenchid nematodes. ...........................................................................................74 23 Pasteuria. .....................75 24 Diameter ratios of selected Pasteuria spp. ........................................................................76 25 Similarity (%) of the 16S rRNA gene sequence of the two clones of ring nematode Pasteuria to those of other named and unnamed Pasteuria isolates. ................................77 31 Population densities of Meloidogyne are naria race 1 and Pasteuria penetrans in plots that were nonfumigated or fumigated at the start of 2004 and 2005 peanut growing seasons. ..............................................................................................................117 41 Degenerate and isolate specific primer sequences used to amplify spo0A sigE sigF and spoIIAB of ring nematode Pasteuria and Pasteuria penetrans ................................144 42 Nucleotide sequence similarities of four sporulation genes of ring nematode Pasteuri a and other Pasteuria species. ............................................................................145

PAGE 10

10 LIST OF FIGURES Figure page 21 SEM micrograph of Mesocriconema ornatum .................................................................78 22 Light micrograph of ring nematode Pasteuria endospores inside and outside Mesocriconema ornatum ..................................................................................................79 23 LM, SEM, and TEM of endospores of ring nematode Pasteuri a adhering fully or partly on the cuticle of Mesocriconema ornatum female. .................................................80 24 LM and TEM micrographs of late vegetative and various stages of sporogenesis of ring nematode Pasteuria in Mes ocriconema ornatum females. ........................................81 25 TEM micrograph of ring nematode Pasteuria development in Mesocriconema ornatum female. .................................................................................................................82 26 Ultrastructure of a mature endospore of ring nematode Pasteuria while still enclosed by sporangium (Stage VI). .................................................................................................84 27 Phylogram of Pasteuria spp. and other gram positive bacteria inferred by Bayesian analysis 16S rRNA gene sequence alignment consisting of 1,431 characters. ..................85 28 Phylogram of Pasteuria spp. and other gram positive bacteria inferred by neighbor joining analysis of 16S rRNA gene sequence alignment consisting of 1,431 characters. ..........................................................................................................................86 29 Phylogram of Pasteuria spp. and other gram positive bacteria inferred by maximum likelihood analysis of 16S rRNA gene se quence alignment consisting of 1,431 characters. ..........................................................................................................................87 31 Population dynamics of Meloidogyne arenaria and Pasteuria penetrans in plots that were nonfumigated or fumigated at the start of 2004 and 2005 seasons. ........................119 32 Relationship between Meloidogyne arenaria second stage juvenile (J2) density in the soil and number that were encumbered with Pasteuria penetrans endospores. ..............120 33 Relationship between Pasteuria penetrans endospore density in the soil and number of Meloidogyne arenaria second stage juvenile (J2) encumbered with endospores of the bacterial parasite. .......................................................................................................121 34 Relationship between Meloidogyne arenaria second stage juvenile (J2) density and proportion that were encumbered with Pasteuria penetrans endospores. .......................122 35 Proportion of Meloidogyne arenaria second stage juvenile (J2) encumbered with Pasteuria penetrans endospores at different density classes of the nematode. ...............123

PAGE 11

11 36 Standard curve for estimating the number of Pasteuria penetrans endospores per gram of soil based on the number of endospores attached per Meloidogyne arenaria second stage juvenile. ......................................................................................................124 37 Phase plane representation of Lotka Volterra simulation of Meloidogyne arenaria and Pasteuria penetrans population dynamics in nonfumigated and previously fumigated plots.. ...............................................................................................................125 38 Time serie s representation of Lotka Volterra simulation of Meloidogyne arenaria and Pasteuria penetrans population dynamics in nonfumigated and previously fumigated plots. ................................................................................................................126 41 Touchdown PCR products using degenerate primers designed to amplify four sporulation genes of Pasteuria penetrans P 20 (Pp) and ring nematode Pasteuria (RNP).. .............................................................................................................................146 42 Cladograms showing the position of ring nematode Pasteuria relative to other members of Pasteuria and species of Bacillus based on Bayesian analysis of partial sequences of four sporulation genes. ...............................................................................147 43 Alignment of spo0A sequences of P asteuria penetrans (Pp) and ring nematode Pasteuria (RNP) by ClustalW showing the location of the specific primers. .................149 44 Species specific amplification of spo0A by PCR. ...........................................................150

PAGE 12

12 LIST OF ABBREVIATIONS BI Bayesian inference 1,3D 1,3Dichloropropene dH2g gram O Distilled water g gravity GTR General time reversible J2 Second stage juvenile LM Light microscopy M Molar MANOVA Multiple analysis of variance MDSA Multiple strand displacement amplification ML Maximum likelihood ml Milliliter NJ Neighbor joining P Probability PCR Polymerase c hain r eaction r2RCBD Randomized complete block design Correlation coefficient RNP Ring nematode Pasteuria rpm Revolutions per minute SEM Scanning electron microscopy TEM Tr a nsmission electron microscopy Microliter

PAGE 13

13 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy POPULATION DYNAMICS OF Pasteuria penetrans IN A PEANUT FIELD AND DESCRIPTION OF A Pasteuria ISOLATE INFECTING Mesocriconema ornatum By Joey Isurita Orajay August 2009 Chair: Donald W. Dickson Major: Entomology and Nematology Pasteuria spp. are bacterial parasites with potential as biological control agen ts of plant parasitic nematodes. In a peanut research site in Marion Co., FL an undescribed population of Pasteuria that infects Mesocriconema ornatum w as found occurring sympatrically with P. penetrans the parasite of Meloidogyne arenaria race 1. The end ospores of the ring nematode Pasteuria (RNP) had morpholog y and morphometrics that were different from P. penetrans and other described Pasteuria species. They attach ed only to M. ornatum females. Phylogenetic analysis based on 16S rRNA gene sequence showe d that RNP represents a distinct lineage within the group of Pasteuria sp p. that infects tylenchid nematodes. The morphological and genetic uniqueness of RNP justify its conside ration as a new species. The population dynamics of M arenaria and P. penetrans were monitored in nonfumigated and fumigated plots for a period of 3 years after 2 years of fumigation with either chloropicrin or 1,3D. The results showed that the population densities of the nematode in nonfumigated plots fluctuated within a low densi ty range F umigation by 1,3D and chloropicrin suppressed the nematode and bacterial populations, respectively, only during the years when they were applied. When stopped, nematode population resurgence was immediately observed in both fumigated plots. The P. penetrans population increased rapidly in a host density dependent

PAGE 14

14 manner with time delay. The Lotka Volterra simulation projected a scenario in which M. arenaria population in previously fumigated plots was suppressed by the parasite to levels nearing extinction. This approach is in line with the paradox of enrichment theory and may provide a paradigm for managing soil suppressiveness. Sorting out sympatric populations of Pasteuria is an essential step towards developing a reliable method of populat ion density monitoring. The nucleotide sequences of sporulation genes sigE sigF spoIIAB and spo0A were obtained from RNP. A species specific primer was designed for RNP and P. penetrans based on their spo0A sequences. Using PCR, the primers were able to distinguish the target from the nontarget species. The P. penetrans specific primer amplified the spo0A genes of both P. penetrans P 20 and P 100, reinforcing the idea that these two populations represent biotypes of the same species

PAGE 15

15 CHAPTER 1 INTROD UCTION Peanut P roduction The peanut, Arachis hypogaea L., also widely called groundnut and to a lesser extent as earthnut, monkeynut, or goober, is an annual legume belonging to the plant family Fabaceae (Nwokolo, 1996). It is believed to have originated i n South America where the greatest diversity of the species can be found (Hammons, 1982). There are four major market classes of peanut, namely, Virginia, Peruvian, Valencia, and Spanish. Respectively, they are believed to have been developed in Amazonia, Peru, northeastern Brazil and the Paraguay Paran basin (Kokalis Burelle et al., 1997). The Portuguese introduced peanut to Africa whose people later brought it to the United States. The Spanish on the other hand have been credited for bringing peanut from South America to Asia through its former colony, the Philippines (Kaprovickas, 1969). Today, peanut is grown in more than 100 countries with China, India, Nigeria, the United States and Indonesia as the top five producers (Anonymous, 2007). Together, the y accounted for approximately 77% of the worlds shelled peanut production in 2007. In that year, the United States produced nearly 1.7 million metric tons from about 483,599 ha (Anonymous, 2007) largely from the states of Georgia, Alabama, Texas, Florida and the Carolinas. Florida is the fourth largest producer of peanut in the country, with nearly a 9% share in national production whereas Georgia topped the list with a 45% share (Anonymous, 2008). Peanut may not be a staple food like rice, corn and bana na, but it is undoubtedly an essential part of human nutrition. Peanut is a good source of protein, lipid and fatty acids for the human diet ( Grosso and Guzman, 1995; Tai and Young, 1975 ), and it is commonly consumed as cooked seeds, shelled or unshelled, or processed into peanut butter and as ingredients in other

PAGE 16

16 snack products like chocolate and cereal bars. Next to soybean, it is an important source of high quality vegetable oil with culinary, pharmaceutical, and industrial use s (Allen, 1981). There are two distinct types of peanut in terms of their growth habits: spreading and erect. The crop forms a yellow petaled, pea like inflorescence borne in axillary clusters aboveground. After self pollination, the flowers wither and the stalks, called gynophores or pegs, elongate downward into the soil. They then turn horizontally and form swollen ovaries that grow to form the pods (Dickson, 1998). The pods have a role in nutrient absorption and have wrinkled shells that are constricted between the seeds. They mat ure ca. 120 to 150 days after planting. The mature seed s resemble those of other legumes, such as bean, except that they have paper thin seed coats. Peanut, which is grown as a summer crop, can tolerate fairly dry conditions and high soil temperatures (Dic kson, 1998). Plant Parasitic Nematodes Associated w ith Peanut Plant parasitic nematodes are among the most important constraints in successful peanut production. Several species belonging to different genera have been reported to be associated with peanut, but only a few species are of primary concern. Others may be important depending on location (Sharma and McDonald, 1990). Species of Meloidogyne P athogenic to P eanut The genus Meloidogyne contains species that are widespread and considered the most damagi ng nematode pathogens of many agricultural crops worldwide (Sasser, 1980; Sasser and Carter, 1985). Meloidogyne spp. are placed in the class Secernentea, order Tylenchida, family Meloidogynidae, and subfamily Meloidogyninae (Siddiqi, 2000). In another clas sification system, the genus is placed in a subfamily within Heteroderidae (Luc et al., 1988). To date, there are at least 90 accepted nominal species in the genus ( Karssen, 2002; Karssen and van Hoenselaar, 1998). The genus consists of species that are se xually dimorphic. They have a

PAGE 17

17 sedentary endoparasitic feeding habit. The female life stage is haped like a pear, has well developed rectal glands, and lay eggs singly in a gelatinous matrix that forms an egg sac ( Karssen, 2002; Siddiqi, 2000). Meloidogyne arenaria (peanut root knot nematode) is the most commonly found species that infects peanut in tropical and subtropical countries (Sasser and Carter, 1985). Although known mainly as a pathogen of peanut, this species is polyphagous with hosts including several important agronomic vegetable, ornamental and fruit crops that belong to different plant families ( Brito et al., 2008; Lamberti, 1981). It reproduces by obligatory mitotic parthenogenesis (Triantaphyllou, 1985) and is considered to be the most morphologically and cytologically variable species ( Carneiro et al., 2008; Starr et al., 2002). Cytologically, populations of this species vary in the number of chromosomes from 30 to 56, and have been classified as diploid, triploid, and hypotriploid (Triantaph yllou, 1985). Four enzymatic phenotypes based on e sterase and malate dehydrogense were reported (Carneiro et al., 2008). Two races based on host preferences have been identified: race 1 infects peanut whereas race 2 does not (Hartman and Sasser, 1985). Me loidogyne javanica (Javanese root knot nematode) also has been reported to infect peanut in the United States ( Cetintas et al., 2003; Minton et al., 1969) and other countries ( Lordello and Gerin, 1981; Martin, 1958; Patel et al., 1988; Tomaszewski et al., 1994), but it is less widespread and has a lower reproduction rate on peanut than M. arenaria (Abdel Momen and Starr, 1997). This species however, may emerge as the dominant nematode pathogen in peanut fields when the M. arenaria is suppressed by Pasteuria penetrans as observed in Florida (Cetintas et al., 2003; Cetintas and Dickson, 2004). The two other root knot nematode species pathogenic on peanut are M. hapla (northern root knot nematode) and M. haplanaria. M. hapla

PAGE 18

18 is only found in the more northern l atitudes or at higher elevations and is considered less damaging than M. arenaria ( Koenning and Barker, 1992; Machmer, 1951). M. haplanaria, a newly described species from Texas, has only been reported in the United States (Eisenback et al., 2003). Other S pecies of Nematodes Associated w ith Peanut In addition to Meloidogyne spp., Dickson and D e Waele (2005) listed Pratylenchus brachyurus Belonolaimus longicaudatus Mesocriconema ornatum Aphelenchoides arachidis Scutellonema cavanessi Tylenchorynchus bre vilineatus and Ditylenchus africanus as important nematodes that may also cause some damage to peanut. Some species of Xiphinema and Helicotylenchus have also been reported occurring in peanut fields, but whether they actually cause any disease is unclear (Sharma and McDonald, 1990). Pratylenchus brachyurus which was originally reported in Alabama (Steiner, 1945) and then in Georgia (Boyle, 1950), is the major lesion nematode species infecting peanut in the United States (Minton, 1984). The importance of B. longicaudatus in peanut varies depending on location. It can be a damaging pathogen in some peanut production fields in North Carolina (Crow and Brammer, 2005). M. ornatum on the other hand can cause significant damage only when it reaches high populat ion densities ( Minton and Bell, 1969; Sasser et al., 1968) or interact s synergistically with fungal pathogens like Cylindrocladium crotolariae (Diomande and Beute, 1981). Root K not of P eanut In the southeastern United States where the bulk of countrys pea nut production occurs, the single most important nematode disease is root knot caused by M. arenaria race 1. Infection by this nematode can cause 50% or greater yield losses in severely infested fields (Ingram and Rodrguez Kbana, 1980; Minton and Baujard, 1990; Motsinger et al., 1976). Aboveground

PAGE 19

19 symptoms appear as patches of stunted and chlorotic plants. Infection of roots, pegs and pods produces typical galls. Soil particles often adhere to egg masses, which give the roots a crusty appearance. There is some evidence that this nematode may predispose peanut to infection by soilborne pathogens such as Sclerotium rolfsii and Sclerotinia minor (Starr et al., 1996, 2002) Yield reduction occurs as a result of poor growth and breaking of pegs during harvest, leaving the pods in the soil (Starr et al., 2002). Galled pods appear unsightly and are not acceptable in the market. Additionally, a positive relationship between galling severity and aflatoxin contamination of peanut kernels has been reported (Timper and Wilson, 2002) Disease C ycle The disease cycle of M. arenaria in peanut starts with the penetration of roots by second stage juveniles (J2), the infective stage. Proite et al. (2008) studied the development and histopathology of M. arenaria on peanut at 2530oC under greenhouse conditions. They observed that J2 successfully penetrated the roots through the apical portion within 3 to 8 days after inoculation (DAI). Migration of J2 in the cortex occurred intercellularly and was observed until 11 DAI. As earl y as 9 DAI, swollen J2/J3 stages were located in the vascular cylinder where they initiated their feeding site. At 11 to 13 DAI, roots began to enlarge in the site of infection and form galls. Once the J2 establish their feeding sites, they begin to enlarg e, become sedentary, and they initiate the formation of giant cells, which are highly specialized to provid e nutrients for the nemato des further development. Giant cells were evident at 15 to 19 DAI. These cells, which are referred to as transfer cells (J ones and Northcote, 1972), appeared to be similar irrespective of hosts and species of root knot nematode (Blok et al., 1997). Nutrients are withdrawn using a feeding tube that acts as a molecular sieve that only allows passage of soluble assimilates (Huss ey and Mims, 1991). Only J2 and females feed. Females with egg masses were obse rved after 32 to 48 DAI. A female may produce up to 2,000 eggs under favorable conditions. Eggs are

PAGE 20

20 deposit ed in a gelatinous matrix that is secreted by the rectal glands and ex uded on to the surface of the gall through a channel believed to be created by enzyme secretions (Orion and Franck, 1990). These constitute the egg masses that are visible outside or near the galled surface of the roots. The deposition of eggs outside the roots facilitates more rapid secondary infection of susceptible tissues such as new roots, pegs and pods in the nearby site once the J2 hatch (Dickson and De Waele, 2005). Males will normally be found in small numbers among the populations of this species but may increase in the event of stressful periods (Triantaphyllou, 1960; Trudgill, 1972). The nematodes high rate of development on a good host and a parthenogenetic mode of reproduction make it possible for M. arenaria to produc e multiple generations wi thin one cropping season that leads to severe crop damage (Trudgill and Blok, 2001). Population D ynamics The population dynamics of M. arenaria in association with peanut is dependent on the abundance and distribution of roots. Once peanut is planted into an infested site, the nematode remains almost undetectable even during the first 80 days of the growing season and symptoms may be difficult to detect (Rodrguez Kbana et al., 1986). However, when the crop is planted into a site with high initial densitie s, the plants often become stunted and yellow in color. McSorley et al. (1992) determined the preplant threshold for this nematode to be 1 egg/100 cm3 of soil. This very low preplant threshold density value is hard to detect by conventional extraction tech niques ( McSorley et al., 1992; Rodrguez Kbana et al., 1982 ). This can be very critical for the growers because the population density can grow exponentially as the season progresses, reaching high densities at harvest time (Rodrguez Kbana et al., 1986) It is at this time that damage is most easily observed on roots, pegs and pods. When peanut plants were not harvested, the densities increased to even higher levels. A carrying capacity of 5,000 to 6,000

PAGE 21

21 J2/100 cm3Some reports suggest that eggs play a critical role in the off season and winter survival of Meloidogyne spp., at least in the locations wher e those studies were conducted. Ferris et al. (1977) reported that 74% of M. arenaria eggs hatched almost immediately while the remainder not only hatched at a lower rate, but also seemed unaffected by temperature shocks and root exudates. This was validat ed by Starr and Jeger (1985) who reported that eggs of M. incognita and M. arenaria in the deeper soil profile of fields previously grown with cotton and peanut, respectively, remained viable during the winter months in the absence of hosts and probably s erved as a source of J2 for the next growing season. They also observed that the percentage of egg hatch in the top 20 cm varied from December to March, with none hatching in March. In contrast, eggs located at 20 to 40 cm depth had a more stable rate of hatching during the same period. T hi s study seemed to corroborate the results of Rodrguez Kbana and Robertson (1987) who examined the vertical distribution of M. arenaria J2 populations in a peanut field in Alabama. They reported that the J2 population de nsity was highest and at the same time, most variable in the top 30 to 40 cm. The fluctuations in the J2 densities in the top layers correlated with the abundance of host roots, and had their peak just before harvest. At greater depths, the densities were low but fairly constant regardless of time of sampling. However, this vertical distribution of J2 density observed in Alabama may not be the same in deep sandy soil such that which occurs in Florida In such conditions high densities of J2 c an be recover ed at different so il depths (Dickson, pers. obs.). of soil was reached in microplot experi ments (McSorley et al., 1992) but was about 10 times lower in actual field soil (Rodrguez Kbana and Ivey, 1986). Integrated Nematode Management The potentially severe problem caused by M. arenaria in peanut production warrants an equally serious diligence in its management on the part of growers. They now have fewer options

PAGE 22

22 regarding the use of nematicides because of the suspension of two highly efficacious and relatively low cost nematicides, 1,2dibromo3chloropropane ( DBCP ) and ethylene dibromide ( EDB ) (Dickson and De Waele, 2005). Contrastingly they have new opt ions with the development and release of peanut cultivars with resistant genes that suppress root knot nematode development (Starr et al., 2002). The aggressive efforts of nematologists to expand the options available for growers have yielded some applicab le practices that can be integrated into a holistic approach of nematode management. Crop R otation Crop rotation is one of the traditional management practices against M. arenaria in the southeastern Unites States ( Dickson and Hewlett, 1989; Rodrguez Kbana and Ivey, 1986). Cotton, velvet bean and bahiagrass are poor hosts to M. arenaria race 1. Rotating peanut with any of them was reported to significantly reduce the density of J2 and increase peanut yield ( Johnson et al., 2000; Rodrguez Kbana et al., 1 987, 1994, 1991a, 1991b). However, it is critical that the rotation be done for a sufficiently long period (Dickson and Hewlett, 1989). Two years of corn after a year of peanut or peanut soybean corn cropping pattern worked well in a study in Alabama and kept the number of J2 below 100/100 cm3 of soil (Rodrguez Kbana and Ivey, 1986). The numbers of M. arenaria J2 at the end of the peanut season were lower when soybean was grown for 2 years before peanut than when it was rotated for only a year (Rodrguez Kbana et al., 1988). In Florida however, 2 years in a nonhost did not prevent M. arenaria from causing serious yield reductions, hence, a longer rotation period was recommended. The long growing period for peanut (from 135 to 175 days) may have allowed l ate season increase in nematode densities even if they were significantly reduced by the nonhost crop during rotation (Dickson and Hewlett, 1989).

PAGE 23

23 Resistant Varieties Until recently, l ittle resistance to root knot nematodes has existed among peanut cultiva rs. However, with the ingression of genes from wild Arachis spp. into cultivated peanut, we now have sources of resistance (Choi et al., 1999). The peanut cultivar COAN was the first such release and was soon followed by cv. NemaTam. Both have resistance a gainst M. arenaria and M. javanica (Starr et al., 2002). The mechanism of resistance in COAN is believed to be constitutive in nature rather than a hypersensitive response. N ecrotic lesions on roots of COAN were rarely observed and the nematodes were restr icted within the cortical tissues and tended to emigrate from the roots (Bendezu and Starr, 2003) The yields of these two cultivars however, were only higher than the susceptible cultivar when the nematode infestation level was very high and they were in ferior to that of the susceptible cultivar if grown in a field with no or low root knot nematode infestation densities (Starr et al., 2002). Another limitation for growing these two cultivars is that they are susceptible to tomato spotted wilt tospovirus ( TSWT), an important disease of peanut in the southeastern United States. Most recently, the cultivar Tifguard was released by the University of Georgia Coastal Plain Research Station, Tifton, GA. This cultivar has a high level of resistance to both M. arenaria and TSWT (Holbrook et al., 2008). Chemical N ematicides Chemical control of M. arenaria on peanut relied on the halogenated hydrocarbons DBCP and EDB until their withdrawal from the market in 1977 and 1983, respectively. Currently the most viable alter natives for heavily infested fields is the nonfumigant aldicarb (Temik) or the fumigant 1,3dichloropropene (1,3D) (Telone II). Combination treatments of aldicarb and 1,3D provided control of M. arenaria comparable or even better than EDB (Rodrguez Kaba na et al., 1985). In a field experiment in North Carolina, all nematicide treatments containing 1,3 D significantly suppressed population densities of M. arenaria, M. hapla, and Mesocriconema

PAGE 24

24 ornatum and improved peanut yield by 20 to 100% over the nontrea ted plots (Koenning et al., 1998). Biological Control Agents The aggressive search for alternatives to chemical nematicides in recent years has led to the discovery of several naturally occurring microbial agents that have antagonistic activities against root knot nematodes. Fungal species such as Paecilomyces lilacinus (Esser and El Gholl, 1993; Kahn et al., 2006), Arthrobotrys dactyloides (Stirling et al., 1998), Pochonia chlamydosporium (Stirling and Smith, 1998), Monacrosporium lysipagum (Khan et al., 2006), Trichoderma harzianum (Sahebani and Hadavi, 2008), and Glomus spp. (Zhang et al., 2008) were tested in various studies but only a few of them were commercialized. Other microbial agents such as rhizobacteria belonging to genera of Pseudomonas (Ali e t al., 2002), and Bacillus (Gokta and Swarup, 1988; Kloepper et al., 1992; Madamba et al., 1999), as well as c yanobacteria Oscillatoria chlorina (Khan et al., 2007), and even the blue green algae Microcoleus vaginatus (Khan et al., 2005) were also reported to have some suppressive effects on root knot nematodes. These bacterial species suppress plant parasitic nematodes by various mechanisms (Tian et al., 2007). The high variability in the performances of these microbial agents in actual field situations re mains the biggest obstacle towards their acceptability and wide scale use (Meyer, 2003). Pasteuria spp.: Bacterial Parasites of Plant Parasitic Nematodes Species of Pasteuria are considered as promising biological control agent s of plant parasitic nematodes Since the pioneering works of several scientists during the 1970s, there have been many follow up studies devoted to the characterization and understanding of its morphology, phylogeny, biochemistry, life cycle diversity, and ecology. The ultimate goal of

PAGE 25

25 these continuous and concerted works is to develop technologies that will realize its utility as biological control agents in the field. History The first described member of this endospore forming bacterial genus was discovered as a parasite of water fleas ( Daphnia magna) by Metchnikoff (1888) and named Pasteuria ramosa. He observed longitudinal divisions and provided illustrations showing stalked spores. Cobb (1906) is credited for the first report of an association of a Pasteurialike organism wi th a nematode ( Dorylaimus bulbiferus ). However, he considered it as a sporozoan parasite belonging to the microsporidia, an idea that persisted for almost 70 years. Micoletzky (1925) suggested its placement in the genus Duboscqia. Following the transfer, a parasite from Pratylenchus pratensis was named Duboscqia penetrans on the assumption that it was similar to the one described by Micoletzky (Thorne, 1940). Mankau (1975a) made a very defining contribution by establishing the organisms nature as bacteria rather than sporozoa. Through electron microscopy, he reported that the organism infecting M. javanica divided by forming cross walls typical of Bacillus spp. and further emphasized its ability to form endospores. It was renamed Bacillus penetrans (Mankau, 1975b) although it was not included in the approved list of bacterial names (Skerman et al., 1980). Another name change occurred when Sayre and Starr (1985) pointed out the resemblance of B. penetrans with Pasteuria ramosa described originally by Metchni koff in 1888, thus naming the bacteria infecting root knot nematodes as Pasteuria penetrans. During those years, Pasteuria was considered as an actinomycete based primarily on the appearance of elongated and branching septate cells (Sayre and Wergin, 1977) This taxonomic placement however, was corrected when sequence data from 16S rRNA gene of P. ramosa ( Ebert et al. 1996) and P. penetrans (Anderson et al., 1999) were obtained. Phylogenetic analysis based on this gene showed that the genus Pasteuria belonged to the low G+C g ram

PAGE 26

26 positive branch of eubacteria with members of Bacillales as its closest neighbors. This was further solidified when its endospore forming nature was confirmed by molecular analysis of genes involved in sporulation (Preston et al., 2003; Trotter and Bishop, 2003). Taxonomy To date, there are four recognized nominal species of Pasteuria based on morphometrics, ultrastructure of mature endospores, and host specificity These and their respective hosts are P. ramosa on Daphnia magna (Eb ert et al., 1996) P. penetrans on Meloidogyne spp. (Sayre and Starr, 1985) P. thornei on Pratylenchus spp. (Starr and Sayre, 1988) and P. nishizawae on Heterodera spp. and Globodera spp. (Sayre et al., 1991). Recently, a Pasteuria that infects Belonolai mus longicaudatus was described and named Candidatus Pasteuria usgae ( GiblinDavis et al., 2003). Another species of Pasteuria, which parasitizes Meloidogyne ardenensis was reported recently and named P. hartismeri (Bishop et al., 2007). This taxon wi ll become a Candidatus species when validated per the International Code of Nomenclature of Bacteria (1992) (Dickson et al., 2009). There are several other isolates of Pasteuria reported in the literature but they were only partially described and are sti ll unnamed. These Pasteuria isolates were found infecting Trophonema okamotoi (Inserra et al., 1992), Helicotylenchus lobus (Ciancio et al., 1992), Tylenchulus semipenetrans (Kaplan, 1994), Heterodera cajani (Sharma and Davies, 1996a ), Hoplolaimus galeatus (Ciancio et al., 1998; GiblinDavis et al., 1990), Mesocriconema peleren t si (Han et al., 1999), Tylenchorynchus cylindricus (Galeano et al., 2003), and nematodes in the family Plectidae (Sturhan et al., 2005). It is likely that many other species of Paste uria exist naturally in soil and freshwater habitats, but their obligate parasitic nature makes their separation into distinct strains of species difficult to impossible when relying on only a few observable characters. These characters, which are mainly b ased on morphology, morphometrics

PAGE 27

27 and host specificity, are oftentimes overlapping ( Chen and Dickson, 1998; Ciancio et al., 1994; Giblin Davis et al., 2001). The advent of the genomic era not only provide d another way to characterize bacteria in general, but totally revolutionized their systematics and taxonomy (Wilson et al., 1977; Woese, 1987). This became particularly useful for species whose usual phenotypic information was not readily accessible by conventional techniques. Among the different candida te genes, the 16S rRNA is chosen as the standard for making taxonomic comparisons and inferring phylogenetic relationships among bacterial species (Clarridge, 2004). This particular gene is highly conserved functionally, present in all species, relatively large with several domains, and has mutations at different positions ( Clarridge, 2004; Woese, 1987). Although the absolute rate of change in the sequence of this gene is unknown, the critical role it plays in cell function made it seem independent from sel ection, thus, it can be used as a measure of evolutionary distance and relatedness among organisms (Woese, 1987). In Pasteuria, analysis of 16S rRNA sequence helped to unambiguously settle the confusions surrounding its biological and morphological nature and subsequently became one of the cornerstones for establishing nominal species. Ebert et al. (1996) were the first one to obtain this sequence for the genus while working on P. ramosa. They showed its relatedness to other low G+C, endospore forming g ram positive eubacteria particularly to species of Bacillus and Alicyclobacillus At that time however, the 16S rRNA gene sequence of Thermoactinomyces was not available, thus, it was not included in their analysis. Species of Pasteuria and Thermoactinomyces have developmental similarities in that they have a growth stage characterized by branching mycelium (Ebert et al., 1996; Yoon et al., 2005). After P. ramosa, 16S rRNA gene sequences of Pasteuria isolates with known information about morphology and

PAGE 28

28 host pr eferences were obtained. These were P. penetrans P 20 that goes to M. arenaria race 1 and P 100 that infects M. arenaria race 2, M. javanica and M. incognita (Anderson et al., 1999), Hg Pasteuria (also known as NA or North American strain) that infects Het erodera glycines (Atibalentja et al., 2000) and Pasteuria S 1 that parasitizes B. longicaudatus (Giblin Davis et al., 1990). Anderson et al. (1999) showed that P. penetrans P 20 and P 100 have identical 16S rRNA gene sequences but were only 93% similar to P. ramosa. Pasteuria S 1 had a 16S rRNA sequence that was 96% or less similar to previously described P. penetrans suggesting that it is a different species (Bekal et al., 2001; Giblin Davis et al., 2003). This finding supported its separation from the other P. penetrans as previously proposed based on endospore morphology, morphometrics and host preference (GiblinDavis, 2000; GiblinDavis et al., 1990, 1995, 2001). Bekal et al. (2001) further postulated that Pasteuria S 1 was phylogenetically close to Pas teuria Hg, which in turn was found to have the same 16S rRNA gene sequence as the previously established species, P. nishizawae ( Noel et al., 2005; Preston et al., 2003). Geographical Distribution Pasteuria is a cosmopolitan genus. The organism occurs in at least 80 countries on five continents and various islands in the Pacific, Atlantic and Indian Oceans. Pasteurialike organisms were reported to be associated with at least 323 species belonging to 116 genera of soilborne nematodes that include plant par asitic, freeliving, predacious, and entomopathogenic nematodes ( Chen and Dickson, 1998; Ciancio et al., 1994; Sayre and Starr, 1988; Sturhan, 1988). A survey of Pasteuria in the Hawaiian Islands provided some interesting observations and insights about t he distribution and history of dispersal of Pasteuria (Ko et al., 1995). Pasteuria was found occurring more in the lowlands where moist and wet conditions were more prevalent than in the dry highlands It was not detected in areas with mean annual temperat ure s below 10oC, but was very abundant in areas achieving at least 21oC. Pasteuria spp. were observed to be

PAGE 29

29 associated frequently with introduced plant species rather than endemic ones, suggesting the involvement of human activities in their dispersal. Ho st S pecificity and V ariability Host specificity is one of the most fundamental characteristics of a parasite (Adamson and Caira, 1994). This refers to the extent by which a population of parasites is restricted in the number of host species being exploited (Lymbery, 1989). Some parasites are generalists while others are specialists (Lajeunesse and Forbes, 2001). Specialization may even be manifested within a parasitic species where parasite strains exhibit local adaptation to their sympatric host populations or subpopulations ( Carius et al., 2001; Kaltz and Shykoff, 1998 ). Both genetic interaction of host and parasites, and phenotypic plasticity or acclimatization are believed to be the driving factors that determine parasite specificity (Little et al., 2006 ). The importance of determining host specificity of a parasite is highlighted when its likelihood of successful establishment in a new habitat following its introduction is being assessed (Poulin and Mouillot, 2003). During the early years of studying Pas teuria great emphasis was given to the nematode host genus as a taxonomic parameter used for species identification together with morphological and morphometric characters ( Sayre et al., 1991; Starr and Sayre, 1988). For example, Starr and Sayre (1988) br oadly separated Pasteuria species infecting plant parasitic nematodes into P. penetrans and P. thornei based on endospore morphology and host nematode, in which the former was limited to species of Meloidogyne and the latter to species of Pratylenchus Ho st specificity and host range, however, were commonly determined based on endospore attachment on different nematodes, a test that yielded results with no clear relationship with nematode phylogeny (Davies et al., 2001). For instance, Hewlett and Dickson ( 1993) reported that endospores of an isolate from M. arenaria race 1 adhered to Aphelenchoides sp., Criconemella

PAGE 30

30 sp., and Tylenchus sp., nematodes that are unrelated to the source. Similarly, two separate studies showed that isolates of P. penetrans attach ed to Pratylenchus scribneri although at a lower rate (Mankau and Prasad, 1977; Oostendorp, et al., 1990). Attachment that crossed generic boundaries was also observed among Pasteuria populations naturally infecting cyst nematodes (Davies et al., 1990; Mendoza de Gives et al., 1999; Wishart et al., 2004). Populations of P. penetrans showed variability in attachment rates as influenced by Meloidogyne species, populations within a Meloidogyne species, developmental stages within a species, and nematode source of endospores used for determining attachment specificity. Oostendorp et al. (1990) reported that P. penetrans isolates B 3, P 122, P 104 and B 8 variably attached to different species and races of Meloidogyne Attachment rate of isolate P 20 was high on M. arenaria race 1, but very low on other species. In a similar study, Stirling (1985) also reported differential rates of attachment of P. penetrans to Meloidogyne spp. An isolate from California readily attached to different populations of M. incognita, M javanica and M. hapl a, whereas an Australian isolate seemed to be more specific. Variability among populations within host species were observed where three Australian isolates of P. penetrans attached at high rates to M. javanica from S outh Australia infecting grapes but attached at much lower rates to other M. javanica populations Similarly, the three isolates had relatively good rates of attachment to all M. incognita populations except the one from Boonah, Queensland that infect ed soybean. In ano ther study, Duponnois et al. (2000) showed that P. penetrans isolates PP 5, PP 12 and PP 23 attached at high rates and PP 10 at moderate rate to M. arenaria population from Saint Anne, French West Indies but not at all on three other populations of the sam e nematode species from the same country. A higher level of specificity involving attachment to a particular developmental stage was reported by Carneiro et al. (1999). They observed endospores of

PAGE 31

31 P. penetrans P 100 adhering only on males of M. hapla but not on J2. The opposite was observed when they were exposed to M. arenaria race 2, M. javanica and M. paranaensis Concerning the effect of the nematode host from which the endospores were obtained, Stirling (1985) and Oostendorp et al. (1990) had contras ting conclusions. Stirling showed that the nematode source of endospore and/or the recipient nematode species did not influence attachment and its rate. This was demonstrated when two populations of P. penetrans maintained and extracted from M. javanica, varied in attachment rates to different M. javanica populations from different hosts and localities. In contrast, Oostendorp et al. (1990) showed that the nematode host of origin was an important determinant of attachment. For example, P. penetrans isolate P 100 attached to M. arenaria at a high rate only when the endospores were extracted from the same nematode host but not when they were obtained from M. javanica. These obvious inconsistencies between attachment and nematode host phylogeny in addition to the fact that attachment does not guarantee infection, have led some experts to propose that attachment should not be used as the lone parameter to assess host range of Pasteuria spp. ( Carneiro et al., 2004; Stirling, 1985). Attachment rates may also va ry depending on the length of exposure of the nematodes to endospores ( Mankau and Prasad, 1977; Oostendorp et al., 1990) and this may further complicate the interpretation of the results. However, until a reliable method of species specific detection is de veloped, the use of an attachment assay to estimate putative host specificity and host range might continue as a common practice with known caveats. Biology and Life Cycle In general, the life cycle of P. penetrans has five distinct stages: endospore atta chment, germination, proliferation in the pseudocoelom of the nematode, sporulation, and release of mature endospores. The attachment process starts as the endospores recognize the cuticle of their

PAGE 32

32 host nematode and tightly bind to it (Sayre, 1980). In the natural soil environment, this occurs as the mobile stages of the nematode moves between soil particles where Pasteuria endospores are present Several endospores may adhere onto a single nematode but different studies suggest that different numbers of at tached endospores are required in order for infection to occur. One study showed that at least five endospores are needed to guarantee infection (Stirling, 1984). P ossible reason s for failure to infect are endospore detachment which may occur under certai n conditions (Ratnasoma et al., 1991) and their lack of viability. Endospore germination occurs following successful attachment. In the case of root knot nematodes, Serracin et al. (1997) reported that this occurred 4 to 10 days after the endospore encumb ered J2 entered roots and started feeding. The germ tube emerges through the central opening in the basal attachment layer of the endospore and penetrates the nematode cuticle and musculature before entering the pseudocoelom. This process is seemed to be a ccomplis hed enzymatically (Mankau, 1975b). The formation of microcolonies which are evident as mycelial balls, occurs after germ tube penetration. They appear as dichotomously branched septate mycelia. Daughter colonies are formed when the intercalary cells lyse (Sayre and Starr, 1989). These colonies fragment and spread throughout the pseudocoelom. The terminal cells of each fragment enlarge, and undergo sporogenesis. Sporogenesis in Pasteuria is similar to that of other gram positive bacteria (Chen et al., 1997a) in which Bacillus subtilis is considered a model species (Doi, 1989). This process is divided into seven morphological stages ( Doi, 1989; van Iterson, 1984). Stage I is characterized by the condensation of the replicated DNA to form an axial fi lament, but this stage has not been detected in Pasteuria. Stages II through VII are comparable in both bacteria. A septum forms

PAGE 33

33 (Stage II) and engulfs the forespore (Stage III). The perisporium or peripheral fibers in Pasteuria are formed during this peri od. Stages IV through VI are characterized by formation of the cortex, coat and exosporium and maturation of the endospore. The sporangium then disintegrates and in the process, releases the mature endospores (Stage VII). The sporogenesis and ultrastructur e of bacterial endospores are perceived to be highly conserved and are thought to have evolve d only once ( Arcuri et al., 2000; Priest, 1993). Mature endospores are then released into the soil when the nematodes and roots decay. Effects of Pasteuria on the H ost Much of the present knowledge about the effects of Pasteuria on its host was generated by detailed studies on Daphnia magnaP. ramosa system (Ebert, 2008). In this host parasite model system, it was demonstrated that D. magna infected by P. ramosa we re completely sterilized but could still live for several weeks despite of infection (Ebert et al., 2000) This strong effect on host fecundity but weak effect on mortality is a parasitic quality that may drive the host populations to local extinction. So me parallel observations were reported on Meloidogyne spp. infected with P. penetrans and we may use the D. magnaP. ramosa model to help understand the fundamental aspects of the biology and dynamics of their interactions. Firstly, multiple endospore atta chment on a root knot nematode J2 can cause its premature death. Attachment occurs when J2 contact endospores while migrating in the soil. I f not unduly burdened with endospores, these J2 can still penetrate the roots. Studies that determined the effect of spore burden of J2 on their motility, and thus their ability to penetrate host root, produced variable results. The numbers reported that affected J2 infectivity were at least 40 (Stirling, 1984), 26 (Sayre and Gherna, 1990), 15 (Davies et al., 1988) and 3 endospores/J2 (Kariuki et al., 2006). It can be assumed, at least for root knot nematode J2, that failure to penetrate the roots would cause their death since Meloidogyne spp.

PAGE 34

34 are obligate plant pathogens. Therefor e, at high endospore densities of a com patible Pasteuria biotype in the soil, a fraction of J2 population will not even make it into the root tissues that could translate to reduced galling severity ( Adiko and Gowen, 1999; Chen et al., 1997b; Kariuki et al., 2006; Stirling, 1984; Stirling et al., 1990; ). Secondly, P. penetrans could slow down the rate of development of an infected nematode. For example, there were more J2 and less J3/J4 observed in tomato roots 14 days after inoculation with P. penetrans encumbered M. incognita J2 The opposite was observed when plants were inoculated with unencumbered M. incognita J2 At the end of the experiment, there was a significant reduction in the number of females produced when the J2 inocula were encumbered versus when they were not encumbered (Davies et al., 1988) In D. magnaP. ramosa model, it is believed that the parasite prolong s the life span of its host for the parasites advantage ( Ebert et al. 2004) By allowing this the parasite could maximize the utility of host resources by completi ng th eir development and producing more transmission structures the endospores This was confirmed by Darban et al. (2004) who observed that both the number of endospores contained per female of M. javanica and weight of the nematode s progressively increased u ntil 88 days after inoculation, their final sampling period The uninfected females ceased to increase in size after 71 days. Unfortunately, in the case of root knot nematodes embedded in roots, there is no way to determine when they actually died. Thirdly infected females failed to produce eggs (Mankau, 1980; Sayre, 1980; Sayre and Wergin, 1977) but were larger in size (Darban et al., 2004). This contributes significantly to the reduction of nematode population densities normally observed in the succeedin g generations (Davies et al., 1988). These phenomena were called parasitic castration and gigantism, respectively, in the D. magnaP. ramosa model system (Ebert et al., 2004). Castration, defined as

PAGE 35

35 severe parasite induced reduction in host fecundity, is c onsidered as an alternative strategy for the evolution of virulence (Ebert et al., 2004; Hall et al., 2007). This may lead to increase in the body size and prolonged life span of the host (Baudoin, 1975; Obrebski, 1975). The events leading to gigantism after castration may be explained by the temporal storage hypothesis (Ebert et al., 2004) and a very similar model called dynamic energy budgets (Hall et al., 2007). Briefly, they suggest that the parasite castrates the host early and the host resources s upposedly allocated for its own reproductive development, a process that requires high energy investment s are diverted into growth. Much of these host resources would be used by the parasite when it reaches later stage of infection or during sporulation i n the case of Pasteuria. This particular stage can be assumed to have high resource requirements because it involves packing energy molecules into its core for later transmission (Hall et al., 2007) and at the same time, synthesizing endospore structures. As observed in both P ramosa and P. penetrans host gigantism resulting from parasitic castration may benefit the bacterial parasite in terms of production of more transmission structures or endospores (Darban et al., 2004; Ebert et al., 2004). From the pr eceding observations, it becomes clear that the suppression of M. arenaria population by P. penetrans can be achieved in two ways: premature death of J2 because of high endospore burden and failure of the nematode to reproduce. It was show n that the number s of eggs per root system and J2 per 100 cm3 of soil at harvest, and the severity of root and pod gall s were inversely related to Pasteuria inoculation levels (Chen et al., 1997b) This finding suggests that an endospore density threshold in the soil must be attained if the nematode is to be managed by inundative release of Pasteuria. At this minimum Pasteuria density, it can be assumed that most of the J2 in the vicinity of the crop would be encumbered by a high number of endospores

PAGE 36

36 that would hinder them from penetrating roots, and others would just have few endospores attached to their cuticle but enough to initiate parasitism once the nematode began development in the roots (Stirling et al., 1990). Chen et al. (1996) reported that at least 1 104 endospores/g of soil were needed to significantly suppress M. arenaria race 1 on peanut although a significantly higher levels of suppression were attained at inoculation level of 1 105 endospores/g of soil During the first year of their trial, the higher inoculation level resulted in a 60% and 95% reduction in root and pod gall severities, respectively. In the second year, the reductions in those parameters were 81% and 90%, respectively. A t inoculation level of 1 104 endospores/g of soil, reduction in root and pod gall severities were only 20% and 65% in the first year and 61% and 82% in the second year for the same parameters, respectively. In Australia, Stirling et al. (1990) reported that about 2.5 105 endospores/g of soil were required to suppress M. javanica on tomato. This density resulted in attachment of 50 endospores/J2 compared to 20 if the endospore density was 1 105/g of soil. They however reported earlier that a significant reduction in root penetration occurred when M. javanica J2 was encum bered by 40 endospores (Stirling. 1984), which is much higher than three endospores observed by Kariuki et al. (2006) in M. arenaria. Despite the discrepancies between the two studies regarding the number of endospores that would prevent J2 from penetratin g roots, the endospore threshold densities i n the soil seemed to converge at 104 to 105Factors Affecting the Abundance and Persistence o f Pasteuria penetrans in t he So il depending probably on the root knot nematode species and level of suppression desired. S uppression of nematodes by Pasteuria is related to the abundance of viable endospores in the soil. A number of biotic and abiotic factors affect the rates of replenishment and loss of endospores in the rhizosphere. Replenishment occurs when the bacteri um successfully develops in the nematode and the mature endospores are eventually released as the nematode s deteriorate

PAGE 37

37 in the soil. Loss encompasses all processes that reduce the quantity and viability of endospores in the soil. The difference between rep lenishment and loss rates will determine the abundance of Pasteuria at a given time. Nematode Host Densities As an obligate parasite, P. penetrans can only be maintained and increased in the soil if the host nematode is present in sufficient numbers. The bacterium occurs in the soil as endospores and the only way for the organism to start its life cycle is to be in contact with a host J2. With more J2 moving in the soil, chances of transmission can be expected to increase proportionately. Darban et al. (2005b) monitored the effects of different initial densities of M. javanica on the buildup of P. penetrans over four successive cycles of tomato. Their study showed that population buildup of the parasite was faster at higher ro ot knot nematode initial densi ties. This was due to the higher number of J2 being infected initially and utilized to produce endospores at the end of each season. Similarly, a higher percentage of root knot nematode females had Pasteuria at higher inoculum levels of the bacterium. But even with the highest inoculation levels of both nematode and bacterium, the highest percentage of infected females recorded was just 70% at the end of the fourth cycle. C ropping P attern The cropping pattern indirectly affects Pasteuria in the soil by infl uencing the nematode population density. Timper et al. (2001) evaluated the effect of two cycles of cotton, corn, and bahiagrass as rotation crops with peanut. The other treatment involved three seasons of peanut monoculture. At the end of their trial, Pas teuria density was highest in peanut monoculture based upon a bioassay test, but low in a cottonpeanut rotation scheme. M. arenaria reproduces well on peanut and this increase in nematode population density caused the multiplication of the Pasteuria. The same was observed by Oostendorp et al. (1991) when they grew vetch, an

PAGE 38

38 excellent host for M. arenaria, after peanut. Under rye grass, a poor host for the nematode, and fallow period, Pasteuria did not increase during the winter season. In a separate yet si milar study, Ciancio and Qunherv (2000) reported that changes in the population density of P. penetrans was synchronous with the dynamics of M. incognita populations whose fluctuations during a 1year study period was influenced by cropping pattern. T emperature Temperature is an important factor affecting Pasteuria endospore attachment on and development in the nematode host. Attachment of endospores was reported to increase up to around 30oC (Ahmed, 1990; Javed et al., 2002; Singh and Dhawan, 1990; St irling et al., 1990). The number of endospores attaching to J2 of Meloidogyne spp. was almost double at 27oC than at 18oC (Stirling et al., 1990). The highest attachment was attained at 30oC but declined beyond this temperature (Ahmed, 1990; Hatz and Dicks on, 1992; Orui, 1997). High temperatures up to 30oC probably increased nematode movement but temperatures from 35 to 40oDepending on the isolate, temperature range for development may vary. H atz and Dickson (1992) reported that the development of a Florida isolate of P. penetrans in M. arenaria was faster at 30 and 35 C, significantly decreased the receptivity of J2 to endospores. oC than at 25oC and below, with optimum development observed at 35oC. The number of days the bacterium took to sporulate at 35oC was 28 compared to 35 and more than 90 days at 25 and 21oC, respectively (Serracin et al., 1997). Additionally, they recorded more endospores per root system when plants were grown at temperatures around 30 to 35oC (Hatz and Dickson, 1992). Elsewhere, a Japanese isolate of P. penetrans developed well at 30oC under greenhouse conditions (Nakasono et al., 1993). At 30oC, Stirling et al. (1981) observed extensive proliferation of P. penetrans within the pseudocoelom of female root knot nematodes before they reached maturity. However, at 20oC, females developed mature gonads

PAGE 39

39 containing eggs before Pasteuria infection prevented their further development. At temperatures above 50oC, endospore attachment, percentage of infected females and percentage of females w ith mature endospores were decreased, suggesting a terminating effect on the bacterial development (Freitas et al., 2000b). While other workers did not observe growth of P. penetrans at 10oC, Bhattacharya and Swarup (1988) reported an Indian isolate infect ing both cyst and root knot nematodes was able to complete its life cycle in the latter in 49 days at this temperature. As for the effect of temperature fluctuation, Darban et al. (2005a ) reported that the development of Pasteuria was faster at stable high temperatures (between 26 and 29oC) than under fluctuating conditions (20 to 32oSeparate studies yielded different estimates of the number of endospores contained in a female Meloidogyne when the host plants were gown at different temperature regimes although the length of growing period might also be a factor (Darban et al., 2004). At 25 C). oC, Davies et al. (1988) obtained 0.8 106 endospores / female. Stirling (1981) recorded 2.4 106 endospores per female when tomato plants were grown at 20oC but only 1.4 106 endospores per female were found when they were grown at 30oMoisture C. Darban et al. (2004) opined however, that certain temperatures might be favorable for the nematode and bacterium, but may not be conducive to the host plant where the development and reproduction of the two parasites ultimately depend. Bacterial endospores are generally known to be resistant to desiccation and various levels of water saturation (Nicholson et al., 2000). Some evidence showing endospores of Pasteuria to exhibit such properties has been reported ( Oostendorp et al., 1990; Williams et al., 1989). Moisture seemed to enhance attachment of endospores to J2 as observed w hen air dried soil containing P. penetrans endospores w as moistened 3 days before adding M. incognit a (Oostendorp et al., 1990) In field soil, moisture allows nematodes to move, so contact between

PAGE 40

40 the immobile endospores and mobile J2 is facilitated ( Chen and Dickson, 1998; Stirling et al., 1990; Van Gundy, 1985). During development, Pasteuria in the host was negatively affected by excessive moisture as indicated by lower percentages of endospore filled females recovered when plants were grown under high moisture conditions (Davies et al., 1991). Interestingly however, Pasteuria developed normally in M. arenaria maintained in tomato growing in a hydroponic system for 65 days (Serracin et al., 1994). Soil Chemicals and Nematicides The volatile compounds released during decomposition of organic amendments like cabbage was reported to negatively affect Pas teuria development in the nematode (Freitas et al., 2000b). A higher percentage of M. arenaria females with vegetative cells were observed when tomato plants were grown in raised beds in which chopped cabbage was introduced, incorporated and covered with polyethylene film. The decomposition was apparently hastened by the warm tem peratures that reached up to 50oFumigant and nonfumigant nematicides have variable effects on Pasteuria. Aldicarb did not affect the viability and a bundance of Pasteuria in soil (Mankau and Prasad, 1972; Timper et al., 2001). Interestingly though, there were significantly fewer juveniles recovered from aldicarb treated plots than in nontreated and flotolanil treated plots (Timper et al., 2001), but t he abundance of endospores in those plots were comparable, negating the notion that the bacterium increases with nematode density. Chloropicrin on the other hand, did not affect endospore attachment but was shown to be detrimental to the development of Pas teuria in the nematode host (Nishizawa, 1986). The same finding was reported by Freitas et al. (2000a) when chloropicrin was applied by itself or in combination with methyl bromide (33% chloropicrin + 67% methyl bromide) or 1,3D (16.5 to 35% chloropicrin) Metam sodium, the only nematicide C over the period of the study.

PAGE 41

41 tested that did not contain chloropicrin, was found harmless to Pasteuria development (Freitas et al., 2000a). 1,3Dichloropropene by itself is not detrimental to Pasteuria. Kariuki and Dickson (2007) showed that the percentage of Pasteuriainfected females at the end of the season was not adversely affected by pre plant fumigation of 1,3D, but was greatly reduced when chloropicrin (100%) was applied. Other nematicides reported with no noticeable effects on Pasteuria w ere 1,3dichloropropene, 1,2dichloropropane (D D) carbofuran, phenamiphos and ethroprop (Mankau and Prasad, 1972). Soil Texture and Irrigation The interaction of soil texture and free water was reported to influence the parasitism of nematodes by Pasteur ia and their distribution in soil. Spaull (1984) collected and assayed soil samples from 81 sugarcane fields in South Africa. He found that Pasteuria occurred more in fields with higher sand content as indicated by higher percentages of infected nematodes and endospore filled females recorded from those samples. Similarly, Carneiro et al. (2007) observed a higher percentage reduction in M. incognita reproduction in coffee by P. penetrans P 10 when they were grown in sandy soil than in clay sandy soil. In ge neral, movement and migration of plant parasitic nematodes are enhanced in coarse rather than fine textured soil (Prot and Van Gundy, 1981; Tarjan, 1971). As cited above, factors that improve movement of J2 increases the chance of contact with immobile endospores. Irrigation and rainfall can facilitate leachin g of soil colloids (Hornberger, 1992) that may include endospores of P. penetrans Cetintas and Dickson (2005) reported that after one application of water, endospores were moved down to a depth of 37.5 cm. After a third watering, they were detected up to 50 cm deep. Despite being leached, the majority of the endospores were still retained in the top 30 cm.

PAGE 42

42 The interaction of soil texture and intensity of irrigation was shown to have a significant eff ect on endospore retention and transmission. It was demonstrated that as much as 53% of the endospores inoculated in sandy soil were leached by water flow versus only 14 and 0.1% in a sandy clay soil and clay soil, respectively ( Dabir et al., 2007; Dabir and Mateille, 2004). Under higher irrigation regimes, the percentages of encumbered J2 were 10.2, 27.5 and 0.0% in sandy, sandy clay and clay soils, respectively. The three soil textures tested had 1.1, 10.4 and 57.0% clay, respectively. The difference in the observed transmission rate underscores the strong impact of intense irrigation by reducing the amount of endospores available for attachment. The clay fraction contributed to the retention of endospores as evidenced by a significantly higher endospore count in the soil but a lower number in the leacheate after intense irrigation compared with sandy and sandy clay soils. However, it was observed that no nematodes survived in the clay soil but were abundant in coarse textured soils. Lack of aeration and accumulation of toxins when clay soil becomes saturated with water were thought to be responsible for the low survival of J2. So even if endospores are retained by clay particles, transmission would be low because of the limitations on the movement and sur vival of the J2. The authors proposed that the best spore percolation/retention balance occurred in soils with 10 to 30% clay. Place of Pasteuria Penetrans in Integrated Root Knot Nematode Management The voluminous literature published about P. penetrans from the time of the pioneering observations by Mankau (1975a), Sayre (1980), and Stirling (1984) dating in the 1970s and early 1980s speak about the great attention this bacterium has received from different nematologists worldwide. Some already consid er this bacterial parasite as the most efficient biological control agent of nematodes based on the data resulting from studies on root knot nematodes (Ciancio, 2008). The extent of nematode density reductions caused by a Pasteuria application varied among studies but declines as high as 90% were observed (Stirling, 1984).

PAGE 43

43 Despite some success stories, many also admitted that by itself, P. penetrans, like other biological control agents, may not be able to consistently provide an acceptable level of nemato de control in various agricultural settings (Hidalgo Diaz and Kerry, 2008). That is why trials involving P. penetrans in combinations with other management strategies have been done in order to test their compatibilities. Talavera et al. (2002) reported a synergistic effect of combined applications of Pasteuria and the mycorhizal fungus Glomus sp. on reducing the reproduction of M. incognita on two cultivars of tomato. Together, the extent of reduction in J2 densities in the soil was 61 and 57% in the two c ultivars. They further observed that the mycorhizal fungus did not affect the attachment and development of Pasteuria on M. incognita. In another study, a combination of P. penetrans and neem cake and leaves resulted in a significant reduction in galling s everity caused by M. javanica and enhanced growth of tomato plants (Javed et al., 2008). The possibility of combining Pasteuria and nematicides has also been considered seriously, provided that the latter was not detrimental to the biological control agent. Brown and Nordmeyer (1985) demonstrated that the carbamate nematicides carbofuran and aldicarb had synergistic effects with P. penetrans in reducing root galling severity of tomato caused by M. javanica. One possible explanation for this synergism was the increased movement of J2 at a sublethal dose of the nematicide, thus increasing the chances for contacting endospores. In another study, an additive effect was observed when the soil was treated with a combination of P. penetrans and the carbamate nematicide oxamyl (Tzortzakakis and Gowen, 1994). The reductions in galling severity of tomato and cucumber as well as J2 and egg densities of M. incognita were much higher when they were applied together than separately. The additive effect contributed by P. penetrans was likely due to parasitism of nematodes not affected by the

PAGE 44

44 carbamate nematicides. These nematicides could only provide initial inhibition of the nematodes because their concentrations decreased with time, thus, allowing nematodes to rebound. This rebounding population could be kept in check by Pasteuria. Management of Soil Suppressiveness Induced by Pasteuria penetrans Stirling (1991) defined suppressive soils as ecosystems where an increase in the population of a n ematode is lower than in con duc ive soil despite the presence of a susceptible host, virulent pathogen and favorable environmental conditions. In an agricultural setting, there are a number of density independent and dependent factors that can regulate the abundance of plant parasiti c nematodes. Cropping pattern, tillage, edaphic factors and soil chemicals such as nematicides, are examples of density independent regulatory mechanisms whereas intra and interspecific competitions and predation/parasitism constitute the density dependen t mechanisms. The ability of P. penetrans to suppress Meloidogyne spp. is well supported by most experimental data that accumulated through years of studies (Chen et al., 1996; Chen and Dickson, 1998; Ciancio, 2008). The only hindrance towards its full ut ilization in agriculture is the lack of technology to efficiently mass produce and deliver the organism in sufficient numbers whereby it would provide a biological nematicide effect. Small scale field trials have resort ed to applying in vivo produced inoculum such as powdered roots (Stirling and Wachtel, 1980) or shells in the case of peanut (Kariuki and Dickson, 2007). Realistically speaking though, these methods will not likely be adopted for applications in agriculturally relevant areas. The inundative a pproach for large field scale delivery will only be possible once Pasteuria is mass produced in vitro. But even then, this approach will still face some huge challenges under actual field situations. Firstly, there is the problem of specificity of the orga nism to its nematode host (Stirling, 1985). To date, there is no single P. penetrans species or biotype that will infect and suppress the numerous species and races of root knot nematodes that exist. In agricultural fields,

PAGE 45

45 t here were various cases documen ted where root knot nematode exists in mixed populations (Cetintas et al., 2003). And secondly it is commonly observed that the virulence of pathogenic bacteria tends to decrease after culturing in artificial media (Catrenich and Johnson, 1988). While thi s attenuation of virulence can be restored by passage to suitable host (Wong et al., 1981), this still remains an important issue that needs to be addressed now that the technology for in vitro cultivation of some Pasteuria species i s underway (Hewlett et al., 2004). The inoculative or classical biological control approach might be more appropriate to use while the technology for mass production is still being developed. The study of Kariuki and Dickson (2007) accomplished a significant first step under thi s paradigm, and this involves being able to transfer P. penetrans from one site to another. The same feat was achieved by Trudgill et al. (2000) who introduced an exotic biotype of P. penetrans with a different attachment profile in Tanzania and Ecuador an d observed some levels of suppression of Meloidogyne spp. Maintenance and further enhancement of suppressiveness however, are two other equally vital processes. It has been suggested that continuous planting for some years of a crop species and varieties susceptible or at least mildly resistant to the nematode species might be necessary to increase the abundance of P. penetrans and through this density dependent increase, their levels will become even more suppressive (Melki et al., 1998; Tateishi et al., 2007; Timper et al., 2001; Walia et al., 2 005). While it has been shown in past studies that certain nematicides do not harm Pasteuria, there is no information about the effect of nematicides on the buildup of Pasteuria once these chemicals are no longer applied. The changes in the densities of both the nematode and bacteria with time will only be meaningful if interpreted within the context of wellestablished population dynamics and simulation models rather than the usual general linear model that simply compares

PAGE 46

46 treatment means. Data on host and parasite densities are vital inputs in managing soil suppressiveness towards the nematodes. Very basic to this is the development of reliable methods of quantifying the organisms involved. Improved tools for sort ing out populations of Pasteuria occurring in the field will not only help us understand the overall diversity of this bacterium, but also will make quantification of a target population more specific and hence, accurate. Objectives The overall objectives of this research were: ( i ) to characterize the Pasteuria isolate that infects peanut ring nematode, Mesocriconema ornatum ; ( ii) to characterize the post fumigation population dynamics of M. arenaria race 1 and P. penetrans P 20 in a peanut field; and ( iii) to develop a PCR based technique that will sort out Pasteuria species occurring in agricultural field s

PAGE 47

47 CHAPTER 2 MORPHOLOGY, DEVELOPMENT, AND M OLECULAR CHARACTERIZ ATION OF A P asteuria ISOLATE INFECTING PE ANUT RING NEMATODE, Mesocriconema ornatum Int rod uction Ring nematode is the common name given to nematodes species belonging to the genera Mesocriconema and Criconemoides of the nematode family Criconematidae (Loof and De Grisse, 1967, 1989) Members of the former, still called Macroposthonia by Siddiqi (2000), are generally distinguished from the latter by having open vulva lips and separate submedian lobes in the lip region. These nematodes are exclusively ectoparasites as their entire body remains outside the roots but they can feed on inner root tiss ues by inserting their long stomatostylet. They have a wide geographical distribution and are particularly favored by light soils and high pH (Siddiqi, 2000). Mesocriconema ornatum is one of the 91 nominal species listed in the latest published compendium of the genus (Brzeski et al., 2002). In other publications, this nematode has been called Criconemoides cylindricus Criconemoides ornatus Macroposthonia ornata, Criconemella ornata, Macroposthonia crassiorbus Criconemella crassiorbus and Mesocriconema crassiorbus (Brzeski et al., 2002). This ring nematode species is frequently found associated with peanut (Boyle, 1950; Motsinger et al., 1976) where it can cause discoloration and brown necrotic lesions on roots, pods and pegs. Many root primordia and yo ung roots are killed, greatly reducing the number of functional lateral roots (Minton and Bell, 1969). Plants then become stunted and chlorotic, hence the disease being called peanut yellows (Machmer, 1953). In a microplot experiment in Ge orgia, this nem atode caused about 50% pod yield reductions (Minton and Bell, 1969) Yield losses in a peanut field in North Carolina were estimated to increase by 18.7% per 10fold rise in initial infestation densities (Rickard et al., 1977). When occurring in the soil t ogether with Cylindrocladium crotolariae black rot was more

PAGE 48

48 severe in certain peanut cultivars than when the fungus was present without the nematode (Diomande and Beute, 1981). Elsewhere, this nematode is considered an important parasite of peanut in Braz il and Thailand (Sharma and McDonald, 1990). Other than peanut, M. ornatum is also commonly associated with centipedegrass and as one of the species contributing to peach tree short life (PTSL). In Florida, this species significantly retarded centipedegras s growth at densities of at least 60 nematodes/100 cm3Several soilborne microorganisms have been studied for thei r potential as biological control agents of plant parasitic nematodes. Unlike the sedentary endoparasites such as root knot and cysts nematodes, all developmental stages of migratory ectoparasites, like ring nematodes, are exposed to microbial parasitism. For example, the nematophagous fungus Hirsutella rhossiliensis is frequently associated with M. xenoplax (Jaffee and Zehr, 1982) but was considered a weak regulator (Jaffee et al., 1989). In contrast, seven fluorescent Pseudomonas spp. were observed capabl e of inhibiting reproduction of M. xenoplax. They were isolated from of soil. Apparently, these density levels were very common in the state where centipedegrass is grown in home lawns (Ratanaworabhan and Smart, 1970). PSTL is a very serious disease problem in peach orc hards particularly in the southeast. This disease complex occurs as the result of predisposition caused by the nematode feeding and by infection from the bacterial canker pathogen, Pseudomonas syringe and/or to cold injury. Species of ring nematodes detected in peach orchards are M. xenoplax M. curvata, M. ornatum and M. sphaerocephala ( Jaffee et al., 1987 ; Nyczepir et al., 1985). Among them, M. xenoplax is the species most frequently found and regarded as the most damaging (Nyczepir et al., 1983, 1988). Ring nematodes principally damage the root system and upon interaction with other agents, growth of aboveground parts suddenly collapse and the whole tree then dies (Nyczepir et al., 1983, 1989).

PAGE 49

49 sites where the nematodes and incidence of PTSL were low (Kluepfel et al., 2002), implying their possible role in disease regulation. Han et al. (1999) reported a Pasteuria population infecting Mesocriconema pelerentsi in Florida The said population produced endospores that were pyramidal in shape and able to attach to M. pelerentsi but not to M. incognita race 1 and M. arenaria races 1 and 2. The sporangium and central body diameters we re also smaller than those of P. penetrans. Recently, some endospore filled ring nematodes were extracted from soil samples taken from an experimental site located at the Univeristy of Florida Plant Science Research and Education Unit, Citra, FL. The site was also infested with M. arenaria and P. penetrans both introduced from Levy County, FL in 2003. Initial observations revealed that this Pasteuria infecting peanut ring nematode have endospores with different morphology from those of P. penetrans The ge nus Pasteuria consists of species reported to parasitize plant parasitic nematodes, some of which were demonstrated to be the biological agents of soil suppressiveness ( Dickson et al., 1994; Minton and Sayre, 1989). Species of Pasteuria were normally repor ted with the nematode host from which they were originally found. When P. thornei was first described, it was distinguished from the already known parasite of Meloidogyne incognita, P. penetrans by associating it with its host, Pratylenchus brachyurus ( St arr and Sayre, 1988 ). Since then, only one nominal and one candidate species were formally added to the list of Pasteuria that infects terrestrial nematodes. These were P. nishizawae ( Noel et al., 2005; Sayre et al., 1991) and Candidatus P. usgae ( Giblin Davis et al., 2003). Respectively, they infect cyst forming nematode species belonging to Heterodera and Globodera ( Noel et al., 2005; Sayre et al., 1991) and Belonolaimus longicaudatus (Bekal et al., 2001; Giblin Davis et al., 2003). Three other isolates were sufficiently described but only the one infecting the root knot nematode

PAGE 50

50 M. ardenensis had a proposed name that is P. hartismeri (Bishop et al., 2007). The two unnamed isolates were parasites of Heterodera goettingiana (Sturhan et al., 1994) and nematodes in the family Plectidae (Sturhan et al., 200 5). Currently and in addition to the type species P. ramosa, these are the Pasteuria species and isolates with 16S rRNA gene sequence deposited in a public database. Experts believe that the genus Pasteu ria is more diverse than what the current list seems to suggest In literature, several other Pasteuria isolates infecting terrestrial nematodes in different orders and families are partially described (Chen and Dickson, 1998) Studies however, are constra ined largely by their obligate nature that makes their characterization limited to a few observable and many times overlapping morphological characters and morphometrics. Host range and specificity of Pasteuria spp. is commonly inferred based on the attachment of endospores to various nematodes (Sayre et al., 1991) without actual verification of infection. The results of these assays were shown to be variable and misleading relative to host phylogeny. This study was done to (i) identify the species of ring nematode host of a Pasteuria isolate; ( i i) characterize a population of Pasteuria infecting ring nematode based on morphology morphometrics and development ; and ( i ii) infer its phylogenetic relationship relative to other species of Pasteuria based on its 16S rRNA gene sequence. M aterials and Methods Identification o f Ring Nematode Species Soil samples were collected from an experimental site planted with peanut Georgia Green at the University of Florida Plant Science Research and Education Unit, Citra, F L. The nematodes were extracted by the centrifugal flotation method (Jenkins, 1964). They were killed and fixed in a one step procedure by adding an equal volume of double strength TAF (7% formalin and 2% triethanolamine as final concentration) that was he ated previously to 90oC

PAGE 51

51 (Courtney et al., 1955; Golden, 1990). The nematodes were kept in the fixative solution for 3 days before mounting. Twenty five females were randomly picked and mounted on a drop of 4% formalin on glass slides with a nail polish rin g. After sealing the cover slip on each slide, the specimens were examined at 400 and 1,000 magnification of light microscope. M easurements were taken from each female conforming to the descriptions of species in the latest available compendium of the ge nus Mesocriconema (Brzeski et al., 2002). Fifteen ring nematode females were also prepared for scanning electron microscopy (SEM) to view the lip region morphology This is important in establishing its placement at the genus level (Siddiqi, 2000). The pr otocol followed was for conventional SEM (GiblinDavis et al., 2001) and described in the section below. Determination of the Range of Ring Nematode Pasteuria (RNP) Endospore Attachment One hundred fifty female ring nematodes appearing to have mature endospores were handpicked from a s uspension and collected in a 1.5ml siliconized microcentrifuge tube 2O. The nematodes were crushed using a plastic pestle to release the endospores. The resulting spore suspension was filtered through a 20mesh ( Spectrum, CA) in a 13mm disc holder (Millipore, MA) fixed on a 5ml syringe. The endospores were collected in a new 1.5ml siliconized tube, concentrated by centrifugation at 6,000g 2 onto depression slides. This volume contained around 30,000 endospores as estimated by hemacytometer count ing The nematode species tested for susceptibility to attachment of RNP endospores were Mesocriconema ornatum females, M. ornatum juveniles (J3 and J4), Meloidogyne arenaria race 1 J2 Belonolaimus longicaudatus mixed stages ( juveniles and adults ) Hoplolaimus galeatus mixed stages ( juveniles and adults) and Hemicricon emoides sp. O, and sonicated for 10 minutes

PAGE 52

52 females. Both the ring and root knot nematodes were collected from peanut soil and root samples, whereas the sting, lance and sheathoid nematodes were extracted from turfgrass soil samples. Although taxonomic references indicate existence of male M. ornatum (Siddiqi, 2000), they were not found in the suspension, therefore, not included in this study. Twenty five nematodes of each appropriated species were manually transferred into the endospore suspension on the depression slide that was then pl aced in a plastic petri dish with a Y divider (Fisher, PA) acting as support. Water was added on the dish to maintain a saturated condition and avoid the drying out of the endospore nematode suspension. Each assay was prepared in triplicate. The plates wer e sealed with parafilm and kept in the dark at 29 1oMorphology and M orphometrics of Ring Nematode Pasteuria C for 7 days. At the end of the incubation period, 15 live nematodes from each species were hand picked and mounted in a drop of Brilliant blue G (1 mg/ml) (Bird, 1988) on a glass slide for microscopic e xamination at 1,000 magnification with the aid of a light microscope. Only those nematodes that showed mobility were chosen because their movement facilitates contact with the endospores. This increased the likelihood that specimens chosen for observations were exposed to endospores for the same length of time. The number of endospores adhering on the cuticle of each specimen was counted. Light m icroscopy (LM) Freshly extracted ring nematodes showin g signs of Pasteuria endospore attachment or infection as viewed under a dissecting microscope were handpicked and mounted on glass slides with a nail polish ring. The body contents of infected nematodes normally appeared darker than healthy ones. Specimen s for endospore attachment examination were mounted live either on a drop of distilled water or Brilliant blue G. Endospore filled nematodes were mounted in a drop of the stain solution and cut with a picking needle to release endospores.

PAGE 53

53 Measurements of endospores were carried out using the Auto Montage Pro version 5.02.0096 (Synoptics, MD ) pre calibrated at 1,000. Old nematode cadavers were chosen as sources of endospores for measurements to make sure that endospores had attained their fullest possible dimensions and therefore, minimize endospore maturity related size variations. These endospores were already devoid of sporangium. For each of the 20 nematodes, 15 randomly selected endospores were measured, for a total of 300 endospores. The diameter of e ach endospore was determined by measuring the distance between the ends of t he parasporium. The height w as measured from the ventral end of the basal adhesion layer to the dorsal surface of the bulging central body. The prominent roundish structure embedde d in the endospore was collectively considered as the central body. Diamet er and height of this structure were also measured. The central body to endospore diameter and height ratios were computed and compared to other Pasteuria isolates reported in litera ture. Scanning e lectron m icroscopy (SEM) A suspension containing heat killed nematodes in water was examined using the 100 magnification of an inverted microscope. At this magnification, endospores adhering on the cuticle were clearly visible. Fifteen en cumbered nematodes were picked and subjected to SEM processing procedures as described by GiblinDavis et al. (2001). Briefly, they were fixed in 3% (v/v) glutaraldehyde, dehydrated in a graded ethanol series, subjected to critical point drying from liquid CO2Transmission e lectron m icroscopy (TEM) mounted on a st ub with a double sided tape, supercoated with 20 nm of goldpalladium, and viewed with a Hitachi (Tokyo, Japan) S 4000 Field Emission SEM at 7 kV. The TEM protocol used in this study was the same as the one used for Candidatus P. usgae (Giblin Davis et al., 2001). Ten ring nematodes that appeared infected with RNP were picked from a water suspension, cut into two pieces with a surgical blade and fixed in 2% (v/v)

PAGE 54

54 glutaraldehyde and 2% (v/v) form aldehyde in 0.1 M sodium cacodylate buffer (pH 7.2) overnight at 4oC. They were then embedded in 3% (w/v) agarose, which was then cut into small blocks. The blocks were washed five times with 0.1 M sodium cacodylate buffer to rinse off the glutaraldehyde The tissues were postfixed in 2% (w/v) osmium tetroxide in 0.1 M sodium cacodylate buffer and 1% (w/v) aqueous uranyl acetate overnight at 4oC The tissues were dehydrated in an ethanol acetone series before being embedded in Spurrs epoxy resin. Thin sect ions (50 to 70 were prepared using a diamond knife on an RMC MT 6000XL ultramicrotome The sections were mounted on 100mesh copper grids coated with Formvar film and then post stained in uranyl acetate for 10 minutes and in saturated aqeous lead citrate for 5 minutes (Dykstra, 1993) Sections were viewed with a Hitachi H 7000 TEM. Molecular Characterization of Ring Nematode Pasteuria DNA e xtraction The method used for extracting DNA from ring nematode Pasteuria followed the methodology described by Tsai and O lson (1991). Three hundred nematodes that were either clearly filled with endospores as seen under dissecting microscope or appearing to contain the parasite in its vegetative growth stage were handpicked. The endospores and vegetative cells were released from the nematodes, filtered and pelleted in the same manner as described above. They were resuspended in 2 ml lysis solution (0.15 M NaCl, 0.1 M Na2EDTA, pH 8.0) containing 15 mg of ly sozyme/ml and incubated in a 37oC water bath for 2 hours with agitation every 20 to 30 minutes. A 2ml solution of 0.1 M NaCl, 10% sodium dodecyl sulfate, and 0.5 M Tris HCl pH 8.0 w as added. The suspension was subjected to three cycles o f freezing in 80oC liqu id nitrogen and thawing in a 65oC water bath to release DNA from the endospores. After the freezethaw cycles, 0.5 ml of saturated phenol (0.1 M Tris HCl, pH 8.0) was added, after which, the suspension was shaken in a Vortex mixer briefly to obtain an emulsion and centrifuged at

PAGE 55

55 6,000g for 10 minutes The top 0.5 ml aqueous layer was transferred into a fresh microcentrifuge tube where 0.5 ml phenol and 0.5 ml chloroform mixture (chloroform/isoamyl alcohol ratio, 24:1) was added. The tube was inverted 10 times to mix the reagents and then centrifuged at 10,000g for 10 minutes The aqueous phase containing the DNA was collected carefully and transferred into a fresh microcentifuge tube. The DNA was precipitated by adding an equal volume of chilled isopropanol and incubated at 20oC for at least 1 hour. The total DNA was reco vered by centrifugation at 10,000g for 10 minutes and air dried for another 10 minutes The HCl, pH 8.0, 0.5 M EDTA) and kept at 20oThe genomic DNA of RNP was amplified using GenomiPhi V2 DNA amplifica tion kit (GE Healthcare, NJ ) following the manufacturers protocol. This pr ocedure exponentially amplified the whole bacterial genome using the bacteriophage Phi29 DNA polymerase through strand displacement, thus eliminating the need for thermal cycling. The final reaction volume was diluted 30 times with nuclease free water (Amb ion, TX). C until used. Amplification of partial 16S rRNA gene A portion of 16S rRNA gene of RNP was amplified using the bacterial primer pair: 27F (5 AGAGTTTGATCMTGGCTCAC 3) and 1,422R (5 ACGGGMGGTGTGRCA3) (Lane, 1991). Additionally, DNA of Paenibacillus sp. associated with the entomopathogenic nematode Steinernema diaprepesi (El Borai et al., 2005) was obtained from Dr. El Borai and was included in this study to generate a longer sequence comparable to the product for RNP The 16S rRNA gene sequence of this speci es of Paenibacillus as deposited in the GenBank (Accession number: AY995172) consisted only of 534 bp. The 20polymerase chain reaction ( PCR) mix consisted Taq polymerase, PCR buffer, and 4 mM MgCl2, 0.4 mM each of dNTA, dNTC, dNTG and dNTT (BioRad

PAGE 56

56 free water. The reactions were carried out in a 96 well iCycler thermal cycler (Bio Rad) with the following temperature profile: denaturation for 5 minutes at 95oC; 30 cycles each of 30 seconds denaturation at 95oC, 30 seconds primer annealing at 55oC, 90 seconds elongation at 72oC; and a final extension step for 10 minutes at 72o dye (Bio Rad ) in 2% agarose gel (in 0.5X TBE buffer) alongside a 1.0 kb DNA ladder (New England Biolabs, MA ). The agarose gel electrophoresis was performed by applying 100 volts for 30 minutes. The gels were then immersed in 1% ethidium bromide solution for 20 minutes, and rinsed by soaking in dH C. 2Gene cloning and s equencing O water for 15 minutes, and viewed on a UV transilluminator. Fresh PCR products, after confirmation of size by agarose gel electrophoresis, were cloned in a pCR4TOPO vector supplied in the TOPO TA cloning kit (Life Technologies CA) following the manufacturers protocol. The products of the cloning reaction were then used to transform E scherichia coli competent cells provided in the same kit. The transformed cells were g medium at 37oThree cultures whose PCR reaction yielded the expect ed product size upon agarose gel electrophoresis were picked for culturing in 4 ml LB ampicillin broth. After 16 hours at 37 C for 1 hour and spread plated on Luria Bertani (LB) agar (per liter, 10 g bactotryptone, 5 g bactoyeast extract, 10 g NaCl, 15 g bacto agar; pH adjusted domly for colony PCR, where the same protocol as described above was used except that the templates were live bacterial cells. The same colonies were correspondingly streak plated on LB ampicillin agar. oC,

PAGE 57

57 cells were harvested and the plasmids containing the cloned genes were extracted using QIAprep miniprep kit (Qiagen, CA) followi ng the manufacturers protocol. The products were sent to DNA Sequencing Core Laboratory of the University of Floridas Interdisciplinary Center for Biotechnology Research. Sequencing was done using the Sanger method with the vector primers T3 and F20. Ph ylogenetic a nalysis The resulting nucleotide sequences of RNP and Paenibacillus sp. were assembled in GeneTools 2.0 software (BioTools, Alberta, Canada). The primer sequences at the 5 and 3 ends of each of the assembled sequences were also trimmed prior to alignment. The 16S rRNA gene sequences of seven named and unnamed species and isolates of Pasteuria and som e representatives of Bacillales and Clostridiales were retrieved from Genebank. Mycobacterium tuberculosis and Streptomyces coelicolor both gram positive bacteria that do not produce endospores (Woese, 1987) were included for outgroup comparison. These species and their respective accession numbers are listed ( Table 2 1 ) The multiple sequence alignments were performed with ClustalX software (Thompson et al., 1997) using the default settings. The phylogeny of Pasteuria spp. and other g ram positive bacteria was inferred using neighbor joining (NJ), Bayesian inference (BI), and maximum likelihood (ML ) methods The distancebased method NJ was run using MEGA 4 software (Tamura et al., 2007) with 1,000 replicates. The options chosen for nucleotide substitution included transitions and transversions and heterogeneity was assumed among lineages. LogDet transformation was chosen in order to correct the dist ances due to varying base compositions (Lockhart et al., 1994; Mooers and Holmes, 2000). The Bayesian phylogeny was generated using MrBayes version 3.1.2 (Ronquist and Huelsenbeck, 2003) with 5 million generations. A sample of 45,000 trees was taken after a 10% burnin. A model of nucleotide substitution was chosen using ModelTest (Posada and

PAGE 58

58 Crandall, 1998) under the Akaike Information Cri terion (AIC) specifying the GTR +I+G as the most suited model of nucleotide substitution for 16S rRNA gene. This model a ssumes that there are six nucleotide substitution categories with rates varying from site to site following the gamma distribution, and that some sites are invariable. For ML, the PhyML version 3.0 was used (Guindon and Gascuel, 2003) using the GTR model f or nucleotide substitution. The proportion of invariable sites and gamma shape parameter were both estimated while the number of substitution rate categories was fixed at six. The tree searching was started using BioNJ and improved by NNI. The branch support was determined by performing bootstrap analysis with 1,000 replicates. The corresponding tree files generated by BI and ML methods were viewed using TreeView (Page, 1996). All trees were rooted using M tuberculosis and S. coelicolor .The similarities of the 16S rRNA gene sequences of the two clones of RNP to other named and unnamed isolates of Pasteuria were determined by performing pairwise alignments using Clustal X function of the MEGA 4 software (Tamura et al., 2007). The similarities were expressed as percentages of conserved characters over the total number of characters in the matrix generated by the alignment. Results Species Identification of Ring Nematode The ring nematode had retrorse annuli with smooth margins and no posterior appendages. The tail was conically rounded and labial plates were present. The open vulva and possession of four submedian lobes in the lip region (Fig. 21A C) placed it in genus Mesocriconema following the classification by Siddiqi (2000). The following were the measurements, ratios and numbers of annuli based on 25 nematodes: stylet length = 52.3362.79 m ( 55.37 1.60 m ) ; body length = 410 560 m ( 530 20 m ) ; ratio of length from anterior end to vulva position and body length (V) = 90 96% (93 1% ) ; ratio of length from posterior end to vulva position and

PAGE 59

59 body width at vulva position (VL/VB) = 0.871.42 m ( 1.24 0.11) ; number of body annules (R) = 8894 ( 91 1.89 ) ; number of annules from anterior end to excretory pore (Rex) = 2527 ( 26 0.74) ; number of annules from posterior end to vulva (RV) = 78 ( 8 0.50) ; number of annules between vulva and anus (Rvan) = 1 ( 1 0.00) ; number of annules from posterior end to anus (Ran) = 6 8 ( 7 0.58) The morpholog y and morphometrics of this population of ring nematode sui ted the description for M. ornatum (Brzeski et al., 2002). Parasitism of M. ornatum by RNP in Natural Populations Several females of ring nematode extracted from the soil samples collected from a peanut field were found to be filled with endospores. They w ere distinguishable from uninfected females by the fact that their body contents appeared darker and denser in addition to having at least one endospore adhering on their cuticle. The mass of endospores occupied the otherwise clear neck region (Fig. 2 2A). Both live and dead (assumed based on the absence of movement) endospore filled females were observed in suspensions. Depending on the age of the cadavers, endospores may or may no longer be enclosed by the sporangial sac (Fig. 22B D). A single cadaver co ntained about 5,000 to 8,000 endospores as estimated by hemacytometer c ount ( n = 5). Ring nematode Pasteuria endospores were only found adhering t o females (Fig. 2 3A,D) but not on juvenile stages of ring nematode. Endospore attachment was observed on the anterior, mid body and caudal region. They were mostly adhering on the surface between the groves created by largely spaced retrorse annuli (Fig. 2 3E G) and may retain their exosporial sac (Fig. 23G). In a few instances, endospores were observed to be i mproperly oriented towards the retrorse annules that resulted in partial and probably unsuccessful adhesion. In one case, only a side of the endospore parasporal fibers was in contact with the cuticle while the opposite side was hanging loose (Fig. 23B). In another case, the opposite edges of the peripheral fibers were

PAGE 60

60 resting on the tips of two retrorse annules leaving the middle portion free from contact with the cuticle surface (Fig. 2 3C). Range of RNP Endospore Attachment After 7 days of being expose d to a RNP endospore suspension, only M. ornatum females were clearly seen to have endospores attached to their bodies (Table 2 2). Of the 15 nematodes examined, an average of 12 had at least one endospore attached to their cuticle. The mean number of endospores adhering was two. In juvenile M. ornatum (J3 and J4), few endospores were seen either clinging t o or somewhat inserted between the annules. These were not counted as being attached. The endospores did not attach or even cling to M. arenaria race 1, B. longicaudatus H. galeatus or Hemicriconemoides sp. Morphology and M orphometrics of RNP The mature endospores of RNP appeared to have a nearly spherical central body that was less stained with Brilliant blue G tha n the parasporal fibers (Fig. 22D). T he dorsum of the central body was offset from the contour of the parasporal fibers. The large and bulging central body and somewhat narrowly expanded parasporal fibers give the endospores a characteristic cup shaped appearance. The mature endospores from old cadavers were devoid of sporangium and were contained in a large, transparent and pouchshaped exosporial sac (Fig. 22D). The endospores of RNP were 3.79 The width of the central body was 2.41 0.13 while the height was 1.81 central body to endospore diameter ratio was 0.64 0.04 (Table 2 3). The diameters of endospores and central bodies of some selected species of Pasteuria as published are also presented ( Table 2 4 )

PAGE 61

61 Development and Ultrastructure The development of RNP was asynchronous within an individual nematode as seen on both LM and TEM micrographs (Fig. 2 4A C). Depending on the duration in which the parasite has been inside the nematode pseudocoelom different stages of its development can be observed. For instance, some cells were already undergoing sporogenesis while others were still in doublet (Fig. 2 4A) and singlet (Fig. 2 4B) stages of sporangium development. Some vegetative cells were also still evident. A dichotomously branched vegetative hyphae was observed with each branch having remnants of a detached thall us on their ends (Fig. 2 5A) The elongate and enlarged termin al cell of the fragmented thallus developed into a sporangium (Fig. 25B ). Sporogenesis in Past euria is similar to other endospore forming g ram positive bacteria and is divided into seven stages. All of them were evident in the TEM images of RNP except stage I. This particular stage is characterized by condensation of nucleoid material to form the a xial filament. Formation of a bilayered septum that asymmetrically divided the sporangium into mother cell and forespore compartments (Fig. 25C) occurred in stage II. The forespore was located terminally and about one third smaller than the mother cell. A t this stage, the sporangium was seen to be already detached from the vegetative thallus. Engulfment of forespore (stage III) proceeded in an endocytosis like event that ended up in the conversion and condensation of forespore contents into a protoplast wi th inner and outer membranes (Fig. 2 5D F). A large electron translucent region, assumed to contain the genetic material was seen inside the protoplast (Fig. 25D,E). The peripheral fibers started to form and appeared as sublateral electron translucent reg ions near the base of the forespore (Fig. 2 5E,F) and as it developed, it pushed the sporangium laterally causing it to expand. In stage IV, the cortex and epicortex were gradually formed as electron dense materials filling up the spaces between the inner and outer membranes

PAGE 62

62 of the forespore (Fig. 25G ,H ). In its final form, the epicortex in RNP was thick, trapezoidal in cross section, laterally formed and about twothirds the height of the core. The outer forespore membrane, which at this stage surrounds t he cortex and epicortex, formed a characteristic apex (future germination pore) basally directed into the cytoplasm of the mother cell (Fig. 25G ). The basal adhesion layer was also first observed in this stage (Fig. 2 5H ). Stages V and VI marked the forma tion of the spore coat and exosporium (Fig. 25I,J ). The developing endospore continued to expand laterally. The inner spore coat appeared as lamellae that outlined the dorsad and ventrad of the cortex and sides of the epicortex (Fig. 25 I ). The outer spor e coat enclosed the endospore core in all surfaces except the basal germinal pore where it became thin. It was thickest on the dorsal surface, measuring about 0 microprojections and did not form a basal ring around germination pore. The pore measured peripheral fibers also accumulated electron dense materials (Fig. 2 5J ). The basal adhesion layer, appearing as a band of fine fibers became much more well defined. The exosporium, within the sporangium enclosed the entire endospore and appeared like a folded sheath on the basal end. At this stage, the sporangium of RNP appeared r S tage VII is characterized by the disintegration of the sporangial sac that left the endospores enclosed by just the exosporium (Fig. 25K ). The morphology and ultrastructure of a mature RNP endospore before the disintegrati on of the sporangium is shown ( Fig 2 6) Phylogenetic Analysis Based on Partial 16S rRNA Gene Sequences The resulting alignment matrix of 16S rRNA gene sequences of Pasteuria spp. and other gram positive bacte ria had 1,431 sites including gaps. Of these positions, 782 were conserved, 620 were variable and 508 were parsimony informative. The three methods of phylogenetic inference yielded the same overall and ingroup topologies but differed in branch support val ues.

PAGE 63

63 Likewise, species representing families Paenibacillaceae, Bacillaceae, Alicyclobacillaceae, and Thermoactinomycetaceae within Bacillales were grouped accordingly with high support in all methods of analysis. Their clustering pattern however, although identical in all phylogenetic trees was only highly supported in BI (Fig. 27 ) and not necessarily in NJ (Fig. 2 8) and ML (Fig. 2 9) especially in the case of the proximity of Pasteuria to Thermoactinomycetaceae. The species of Pasteuria formed a well s upported subclade with P. ramosa occupying the basal position. The next two lineages leading to the Pasteuria infecting Plectidae and H. goettingiana were also highly supported in all methods of phylogenetic inference. The topology leading to the next lin eages lacked support from NJ and ML but were moderately to highly supported by the BI method except for the placement of Candidatus P. usgae and RNP together. The 16S rRNA gene sequences of the two clones of RNP had 99.78% similarity, differing in only 3 out of 1,344 positions ( Appendix A ). Compared to other Pasteuria isolates, the sequences of RNP clones were most similar to those of P. nishizawae at 96.66 to 96.80% and least similar to P. ramosa at 90.64%. Among the Pasteuria that infects Tylenchid nematodes, they had the lowest similarity to Candidatus P. usgae (Table 2 5) Discussion The measurements and ratios obtained from 25 specimens conformed to the morphometric data for M ornatum as presented by Brzeski et al. (2002). Other than morphometrics the other basis for identifying the species as M. ornatum was the host. This species is known to be widely associated with peanut (Boyle, 1950; Motsinger et al., 1976) although Han et al. (1995) reported a Pasteuria isolate parasitizing what was identified as M. pelerentsi occurring in a peanut field in Florida This ring nematode species differs from M. ornatum by having a longer stylet (5356 m) and body (420 650 m); fewer Rex (17 22), RV (57), and Ran (45). Vulva and anus were

PAGE 64

64 also farther apart (R van = 2 3). After M. pelerentsi M. ornatum then becomes the second identified species of ring nematode reported to have an associated species of Pasteuria. In Mexico, a species of Mesocriconema parasitizing white lilies w as observed being infected with P asteuria (Franco Navarro and Godinez Vidal, 2008). The species of this ring nematode, however, was not identified, The result of the attachment assay confirmed the observations made on naturally encumbered M. ornatum from the peanut field that only females were susceptible to being encumbered by RNP endospores. The J3 or J4 seemed to at least attract endospores as evidenced by those clinging or inserted between annules. No attachment was observed on M. arenaria, B. longicaudatus H. galeatus or Hemicricon emoides sp. Species of Pasteuria occur in various levels of virulence and their endospores exhibit variations in forms and sizes. These variations are believed to result from their adaptation to maximize their fitness in their respective host. Ciancio (19 95a ) detected a positive correlation between endospore ultrastructure measurements of 69 Pasteuria isolates and the body wall thickness of their respective nematode hosts. The relationship appeared to be related to their evolutionary adaptation resulting f rom selection of endospores with core volume s proportionate to the amount of energy needed to penetrate the body wall of their respective nematode host species Furthermore, the relationship also seemed to indicate evolution towards maximization of attachm ent which is vital in order to remain adhering and to keep the core in place before germination occurs. Forces challenging the retention of attached endospores come from cuticle deformation while it elongates and contracts during movement and also from the external friction acting on the endospores as they contact soil particles and root tissues while the nematode moves.

PAGE 65

65 The cuticular pattern of M. ornatum and the rest of Criconemati dae in general, is unique among members of Tylenchida The dimensions of t he endospores of RNP seemed to be reflective of a morphometric adaptation towards parasitism of this nematode Firstly, the narrow instead of wide parasporium appeared to be more appropriate for attachment to the cuticle of this ring nematode. The retrorse pattern of the cuticle of M. ornatum creates deep grooves in between the annules and these were the surfaces where endospores were seen adhering based on TEM micrographs. Having a narrow parasporium ensures that the endospores would adhere completely with in the dimension of these surfaces. A broader parasporium would be a disadvantage because part of it would likely extend beyond the annule surface and remain unattached. Ring nematodes are sluggish and because of their naturally wavy cuticle structure, dis placement of the endospores due to contraction and extension of the cuticle surface would be less likely to occur in comparison to root knot nematode juveniles or sting nematode juveniles and adults The cuticle surfaces of these two nematode species are f latter than that of a ring nematode and they a re both more agile. Endospores with a wider parasporium as occurs with these nematodes would likely provide for a stronger grip that could resist displacement caused by frequent cuticle contractions and extensi ons. Indeed, Pasteuria species infecting those nematodes possess broader para sporal fibers (Table 2 4). The physical nature of attachment observed in RNP may also explain partly why females were susceptible to being encumbered. The depth and width of the grooves between annules in juvenile stages are less than those of the adult. Endospores would probably not fit well in the cuticular groove spaces of immature stages of ring nematode. It is not known if RNP would attach also to male M. ornatum Taxonomic re ference (Siddiqi, 2000) implies their existence but they were not found in the soil samples from the peanut field.

PAGE 66

66 Secondly, the large central body suggests the accommodation of more energy molecules that seemed to be needed by RNP in order to successfully initiate infection. The attached endospores on M. ornatum cuticle are oriented at an angle to the longitudinal axis of the host due to its adhesion on the retrorse surface of the annule. No TEM section produced an image of an endospore with a penetration tube but from the available images, it can be deducted that the germ tube that comes out from the endospore would need to penetrate a thick body wall before reaching the pseudocoelom. This is different from the Pasteuria species attaching on the J2 of Melo idogyne Heterodera Hoplolaimus and B. longicaudatus where the cuticle surfaces in contact with basal adhesion layer of the endospores are parallel to the longitudinal axis of the nematode. The Pasteuria isolates infecting these nematodes, except Candidatus P. usgae have smaller central bodies than RNP. The large central body of Candidatus P. usgae is due to the thick spore coat with microprojections (Giblin Davis et al ., 2001). The large central bodies of RNP endospores therefore, appear to correlate with the need to store more energy to support the longer period for penetration as already suggested by Ciancio (1995 a ). In the case of RNP, this hypothesis is at least justified morphometrically. Other than morphometric characters, RNP exhibited a combi nation of ultrastructural and developmental features different from other described species of Pasteuria that may warrant its recognition as a new species, at least typologically It was different from P. penetrans by not possessing a basal ring; from P. p enetrans P. nishizawae and Candidatus P. usgae by having outer spore coat without microprojections; and from Candidatus P. usgae and P. thornei by having a trapezoidal epicortex whose height was about twothirds of the core. Compared with P. hartism eri, RNP endospore development occurred in single and fragmented thalli rather than clumped.

PAGE 67

67 Han et al. (1999) reported a Pasteuria isolate infecting a population of M. pelerentsi in a peanut field in Florida. Based on the measurements of sporangia and c entral bodies of its endospores, this isolate seemed to be different from the RNP isolate presently studied. The average central body diameter and height of the endospores reported in that study were 1.08 and measurement being less, the shape seemed to be more expanded vertically (height greater than diameter) rather than horizontally as observed in the presently studied RNP. T he estimated number of endospores inside the body of M. pelerentsi was 25,000 compare d with 5,000 to 8,000 in M. ornatum The size variations between the two Pasteuria isolates infecting two species of ring nematodes suggest that they might be different morphotypes or biotypes, if not species. This apparent diversity is not surprising as G iblin Davis et al. (1990) observed parasitism of Hoplolaimus galeatus by Pasteuria populations with large and small endospores. Currently, no data is available to prove if these Pasteuria populations sharing the same or closely related nematode host species were really phylogenetically different. The identity of the bacterial parasite infecting M. ornatum was confirmed as a member of Pasteuria based on its 16S rRNA gene sequence. The phylogenetic analyses likewise placed it in a robustly supported group of Pasteuria species infecting Tylenchid nematodes. Taken together, the group formed a highly supported monophyletic clade that was separate from Pasteuria infecting Plectidae and the crustacean species, Daphnia magna. This suggests a speciation of Pasteuria that was related to the evolution of their hosts, at least at the higher taxonomic levels. This hypothesis can be tested when Pasteuria isolates infecting nematodes belonging to other orders like Dorylaimida, Triplonchida and Rhabditida will be sequenced and analyzed. At specific level however, the topology that grouped RNP P. nishizawae and Candidatus P. usgae was only supported in BI (posterior probability = 0.95). The clustering of these three

PAGE 68

68 isolates was poorly supported in ML (boostrap support = 44%) and was not recovered in NJ. These variations suggest that there is an apparent lack of a well defined relationship among lineages of Pasteuria species that infect tylenchid nematodes based on their 16S rRNA gene sequences A closer examination of the 16S rRNA gene trees generated in previous studies ( Bekal et al., 2001; Preston et al., 2003; Sturhan et al., 2005; Bishop et al., 2007) confirm ed this assessment. With only limited number of Pasteuria species and isolates with 16S rRNA gene sequence avail able for analysis, it is possible that this lack of resolution is caused by missing lineages. O ther isolates of Pasteuria infecting other families within Tylenchida might fill this gap, following the hypothesis of host parasite coevolution. For example, He terodera Belonolaimus and Mesocriconema belong to morphologically and phylogenetically distinct groups of tylenchid nematodes (Siddiqi, 2000; Subbotin et al., 2006) and their associated Pasteuria species are likely to be more distantly related as well. Pa steuria isolates infecting Tylenchulus and Trophotylenchus (syn. Trophonema) of the family Tylenchulidae; Hoplolaimus and Helicotylenchus of the family Hoplolaimidae; and Pratylenchus of the family Pratylenchidae have been reported before. These Pasteuria isolates might provide the missing lineages that will connect the species and isolates included in the present study. Another possible explanation for lack of definition in the relationships among lineages within the group of Pasteuria infecting Tylenchid nematodes is the low sequence variation in the 16S rRNA gene. Pasteuria species in this ingroup were between 95 and 97% similar to that of RNP. Candidatus P. usgae and P. hartismeri were also reported to have about 96% sequence similarity to P. penetra ns and Pasteuria infecting H. goettingiana, respectively (Bekal et al., 2001; Bishop et al., 2007). These levels of divergence might be good enough to justifying these lineages as distinct phylogenetic species having satisfied the currently accepted thresh old of 97%

PAGE 69

69 sequence similarity (Amann et al., 1992; Hagstr m et al., 2002), but may not be variable enough in resolving phylogenetic relationships. Palys et al. (2000) attributed this limited ability of 16S rRNA gene in resolving closely related species t o its extremely slow rate of evolution. It is very likely that these Pasteuria species and isolates have accumulated sequence divergence at rapidly evolving loci, which correlates with their differences in host preferences, but is not yet reflected in the 16S rRNA gene. For the time being and pending the availability of sequences from other previously reported isolates of Pasteuria or an accepted alternative to 16S rRNA gene based phylogeny, this study will conclude that RNP is a distinct lineage that is ri ghtfully placed within the subgroup of Pasteuria species infecting t ylenchid nematodes. This placement is highly supported regardless of the method of phylogenetic inference used in this study. The two Pasteuria species infecting each of Heterodera and Mel oidogyne had different evolutionary histories as suggested by the result of the phylogenetic analysis. This was even more evident in P. nishizawae and the unnamed parasite of H. goettingiana whose positions in the tree were separated by the two species of Pasteuria infecting root knot nematodes. Their hosts, H. glycines and H. goettingiana belong to morphologically and genetically distinct subgroups within Heterodera namely the Schactii and Goettingiana, respectively (Baldwin, 1992; Ma et al., 2008). Simil arly, M. ardenensis the host of P. hartismeri could be a species distantly related to the M. arenaria, M. javanica and M. incognita cluster, which are known hosts of P. penetrans Unfortunately, M. ardenensis was not included in the published phylogenet ic analysis of the genus Meloidogye (De Ley et al., 2002) The results of the phylogenetic analysis suggest that there are possibly several isolates or even species of Pasteuria infecting nematode species belonging to the same genus. As noted by Duan et al (2003), a surprising degree of 16S

PAGE 70

70 rRNA sequence diversity was observed in what was thought to be a single strain designated as P. penetrans P 20. In the deep phylogenetic analysis, Thermoactinomyces and Shimazuella, both members of Thermoactinomycetace ae, formed the basal taxon for the genus Pasteuria and together, they formed a distinct subclade within Bacillales. Again, their grouping was only supported in BI but not in NJ and ML methods. When the first 16S rRNA gene sequence for a species of Pasteuri a was obtained, the authors established its nature as a bacterium (Ebert et al., 1996) and not an actinomycete as earlier suggested ( Sayre and Wergins 1977). P. ramosa belonged to the branch of gram positive bacteria with low G+C that included A. cyclohe ptanicus A. acidocaldarius and B. tusciae as the closest neighbors. It was recognized however, that P. ramosa was far more morphologically complex than these bacteria considered as its sister taxa. It actually had more morphological resemblance to Thermo actinomyces spp., whose members like Pasteuria form branching mycelium and are resistant to lysozyme treatment (Ebert et al., 1996). Unfortunately, at the time when they carried out their phylogenetic analysis, no sequence of 16S rRNA gene of any species o f Thermoactinomyces was available. In publications with phylogenetic analysis that included Alicyclobacillus and Thermoactinomyces Pasteuria was placed closer to the former. Anderson et al., (1999) used maximum parsimony (MP) but excluded several charact ers that were present in unalignable sections of the alignment matrix. The resulting topology placed Pasteuria spp. in between subclades that contained Bacillus and Alicyclobacillus spp. In another study, Bishop et al. (2007) who used MP, NJ, and ML methods, placed Pasteuria in the basal position of a distinct subclade that included three species of Alicyclobacillus and B. tusciae Thermoactinomyces spp. formed another subclade that included Paenibacillus validus a topology that placed the latter distant

PAGE 71

71 f rom P. larvae subs. pulvifaciens Duan et al. (2003) expanded the number of taxa analyzed by MP with the inclusion of Sulfobacillus spp. In their phylogenetic tree, the ordering of genera from apex to base was Alicyclobacillus Sulfobacillus Pasteuria, Th ermoactinomyces and Bacillus The position of Sulfobacillus in between Alicyclobacillus and Pasteuria led them to question the placement of Pasteuria within Alicyclobacillaceae, and therefore, proposed its re evaluation. This question seemed to be valid but on a different ground. In the 2nd edition of Bergeys Manual of Systematic Bacteriology, Sulfobacillus was classified as a member of Family XVII Incertae Sedis of Clostridiales (Ludwig et al., 2008). In other words, its position in the phylogenetic analysis of Duan et al. (2003) was questionable Nevertheless, the relationship of Pasteuria with Alicyclobacillaceae was reevaluated and eventually resulted in the erection of the family Pasteuriaceae (Ludwig et al., 2008). This separation was based on subs tantial phenotypic and genetic divergence between the two genera. The present phylogenetic analysis showing Pasteuria being more closely related to Thermoactinomyces was in agreement with the current revisions in the Order Bacillales. The two genera howeve r were not combined in one family despite their apparent similarities in morpholog y and proximity in 16S rRNA gene tree because of the inability of Pasteuria to be cultured axenically that limits the amount of phenotypic and genotypic information available. Furthermore, the pathogenic nature of species of Pasteuria was considered significant enough to deserve a separate status (Ludwig et al., 2008). In summary, this study established that the Pasteuria isolate infecting M. ornatum exhibits phenotypic and ge netic uniqueness supporting its status as a new species. Its attachment only to females and not on juveniles of M. ornatum and other nematodes suggests a very specific parasitism that could partly be correlated with the dimensions determined from mature

PAGE 72

72 en dospores. The importance of RNP as a population regulator of M. ornatum in peanut field is not known and was not covered in this study. Likewise, its occurrence in other agricultural or horticultural sites planted with crops that are hosts of M. ornatum ma y warrant further research.

PAGE 73

73 Table 2 1. Gram positive bacterial species included in inferring a 16S rRNA gene tree and their respective accession number in GenBank. Bacterial species GenB ank accession number Pasteuria hartismeri AJ878853 Candidatus Pa steuria usgae AF254387 Pasteuria infecting Heterodera goettingiana AF515699 Pasteuria infecting Plectidae AY652778 Pasteuria nishizawae AF516396 Pasteuria nishizawae AF134868 Pasteuria penetrans AY081918 Pasteuria penetrans AF077672 Pasteuria ramos a DEU3468 Acetanobacterium elongatum AY518589 Alicyclobacillus acidocaldarius AB059674 Alicyclobacillus acidoterrestris AB059676 Bacillus halodurans EU091310 Bacillus licheniformis EF644415 Bacillus thuringiensis FJ784127 Catonella morbi NR 026248 Clostridium botulinum 148378011 Clostridium cellulosi FJ465164 Clostridium perfringens 18308982 Clostridium saccharolyticum NR 026494 Ethanoligens harbi AY295777 Paenibacillus campinasensis AB073187 Paenibacillus curdlanolyticus AB073202 Thermoactin omyces dichotomicus AF138733 Shimazuella kribbense AB049939 Mycobacterium tuberculosis FJ468345 Streptomyces coelicolor FJ406047

PAGE 74

74 Table 2 2. Attachment of ring nematode Pasteuria endospores to selected species of plant parasitic tylenchid nematodes. N ematode species and stages Plant host Number of nematodes encumbered a Number of endospores per nematode b Mesocriconema ornatum (female) Peanut 12.00 1.73 2.02 1.44 Mesocriconema ornatum (J3/J4) Peanut 0 .00 0.00 Meloidogyne arenaria race 1(J2) Pea nut 0.00 0.00 Belonolaimus longicaudatus (mixed) Bermudagrasss 0.00 0.00 Hoplolaimus galeatus (mixed) Bermudagrasss 0.00 0.00 Hemicriconemoides sp. (females) Bermudagrasss 0.00 0.00 Note: Numbers are mean standard deviation. a A total of 15 nematodes for each of the three replicates were examined after 7 days of incubation in a suspension with about 30,000 endospores b Determined from 15 nematodes examined under 1,000 magnification of light microscope.

PAGE 75

75 Table 2 Pasteuria. Statistics a Central body Endospore Central body/endospore Height Diameter Height Diameter Height Diameter Mean 1.81 2.41 2.22 3.79 0.82 0.64 Std. deviation 0.12 0.13 0 .12 0.12 0.06 0.04 Min 1.46 2.15 1.90 3.42 0.67 0.55 Max 2.09 2.69 2.60 4.15 0.97 0.76 a Computed from measurements of 300 endospores released from 20 Mesocriconema ornatum females.

PAGE 76

76 Table 2 4. Diameter ratios of selected Pasteuria spp. Pasteuria spp. N ematode host Ratio (CB/E)a Reference Central body (CB) Endospore (E) Ring nematode Pasteuria Mesocriconema ornatum 2.41 3.79 0.64 Unnamed Heterodera goetinngiana 2.60 5.00 ( 0.52 ) Sturhan et al., 1994 Unnamed Hoplolaimus galeatus 1.90 4.50 ( 0.42 ) Ciancio et al., 1998 Unnamed Helicotylenchus lobus 2.00 4.60 ( 0.43 ) Ciancio et al., 1992 Pasteuria nishizawae Heterodera glycines 1.90 4.20 ( 0.45 ) Atibalentja et al., 2004 Pasteuria penetrans Meloidogyne javanica 1.90 3.89 0.4 9 Sharma and Davies, 1996b Candidatus Pasteuria usgae Belonolaimus longicaudatus 3. 08 6. 05 b ( 0.51 ) Giblin Davis et al., 2001 aRatios in parentheses were not in the original piblications but were computed based on the provided mean diameters of CB and E. bSporangium rather than endospore diameter was measured.

PAGE 77

77 Table 2 5. Similarity (%) of the 16S rRNA gene sequence of the two clones of ring nematode Pasteuria to those of other named and unnamed Pasteuria isolates. Pasteuria spp. Accession number Ring nematode Pasteuria a Clone 1 Clone 2 Ring nematode Pasteuria clone 2 unpublished 99.78 Pasteuria nishizawae AF134868 96.73 96.80 Pasteuria nishizawae AF516396 96.66 96.73 Pasteuria hartismeri AJ878853 96.22 96.29 Pasteuria penetrans AY081918 96.20 96.28 Pasteuria p enetrans AF077672 96.13 96.21 Pasteuria infecting Heterodera goettingiana AF515699 95.98 95.91 Candidatus Pasteuria usgae AF254387 95.77 95.84 Pasteuria infecting Plectidae AY652778 94.18 94.25 Pasteuria ramosa DEU3468 90.64 90.64 a A pairwise ali gnment using MEGA 4 software was performed on the 1,344 bp partial sequences of ring nematode Pasteuria clones 1 and 2 and other isolates of Pasteuria. The percentage similarity between two sequences was calculated using the formula: Percent similarity = Number of conserved characters 100 Total number of characters in alignment matrix

PAGE 78

78 Figure 2 1.S canning electron micrograph of Mesocriconema ornatum A) Whole body of a female. B) Posterior end showing an open vulva. C) Labial region showing four submedian lobes. (va = vulva; an = anus; sl = submedian lobe; lp = labial plate; fba = first body annule). v v a a a a n n f f b b a a s s l l l l p p A C B

PAGE 79

79 Figure 2 2. Light micrograph of ring nematode Pasteuria endospores inside and outside Mesocriconema ornatum A) Neck region of the nematode filled with endospores. B) Young nematode cadaver with endospores still enclosed in sporangia. C) Old nematode cadaver with endospores devoid of sporangia. D) Mature endospores released from o ld cadaver and stained with Brilliant blue G. (cb = central body; pf = peripheral fibers; exo = exosporial sac). 20 m C D cb exo pf A 0.05 mm B

PAGE 80

80 Figure 2 3. L ight, scanning and transmission electron micrographs of endospores of ring nematode Pasteuria adher ing fully or partly on the cuticle of Mesocriconema ornatum female. A) Endospore with the entire basal adhesion layer (BAL) in contact with cuticle (arrow). B) Endospore with only portion of its BAL in contact with the cuticle (arrow). C) Endospore with only the opposite edges of BAL in contact with the cuticle (arrow). D) Neck region of M. ornatum with multiple attached endospores. E) SEM of an endospore while attached on the cuticle. F) TEM of endospores attached on the cuticular grooves of retrorse annul es. G) TEM of an endospore with exosporial sac sloughing off (arrow). E 10 m B 20 m D C 10 m 10 m F G 10 A

PAGE 81

81 Figure 2 4. LM and TEM micrographs of late vegetative and various stages of sporogenesis of ring nematode Pasteuria in Mesocriconema ornatum females. A) LM of nascent sporangia in doublet (arrow). B) LM of nascent sporangia in singlet (arrow). C) TEM of Pasteuria vegetative cells and endospores at various stages of development. A B C

PAGE 82

82 Figure 2 5. TEM micrograph of ring nematode Pasteur ia development in Mesocriconema ornatum female. A) Vegetative hyphae with remnants of detached thalli. B) N ascent sporangium still attached to vegetative thallus). C) Septum formation (Stage II). D) Engulfment of the forespore (Stage III). E) Late Stage I II showing the formation of peripheral fibers. F) Late Stage III showing the forespore with double membrane. G) Cortex formation (Stage IV). H) Late Stage IV showing formation of basal adhesion layer. I) Inner spore coat formation (Stage V). J) Outer spore coat formation (Stage V). K) Mature endospore after disintegration of sporangial sac (Stage VII). (vh = vegetative hyphae; vt = vegetative thallus; sp = sporangium; fs = forespore; sep = septum; mc = mother cell; mem = membrane; pf = peripheral fibers; i = inner membrane; o = outer membrane; r = remnant of attachment; ep = epicortex; c = cortex; bal = basal adhesion layer; isc = inner spore coat; osc = outer spore coat; exo = xosporium). sp vt B r vh A sep mc fs C pf E mem D o i F r

PAGE 83

83 Figure 2 5. Continued ep c G bal H isc I K exo J bal pf isc osc exo

PAGE 84

84 Figure 2 6. Ultrastructure of a mature endospore of ring nematode Pasteuria while still enclosed by sporangium (Stage VI). E picortex P eripheral fibers B asal adhesion layer E xospori um S porangial sac O uter spore coat I nner spore coat C ortex P rotoplast G erminal pore C entral body

PAGE 85

85 Figure 2 7. Phylog ram of Pasteuria spp. and other g ram positive bacteria inferred by Bayesian analysis 16S rRNA gene sequence alignment consisting of 1,431 characters. A Markov Chain Monte Carlo was run for 5,000,000 generations under the nucleotide substitution model GTR+I probabilities while scale bar represents evolutionary distance. 0.1 Pasteuria infecting M. ornata Pasteuria infecting M ornata Candidatus Pasteuria usgae 0.51 Pasteuria nishizawae Pasteuria nishizawae 0.95 Pasteuria penetrans Pasteuria penetrans 0.87 Pasteur ia hartismeri 0.92 Pasteuria infecting H. goettingiana 1.00 Pasteuria infecting Plectidae 1.00 Pasteuria ramosa 1.00 Thermoactinomyces dichotomicus Shimazuella kribbense 0.94 1.00 Paenibacillus SD Paenibacillus curdlanolyticus 0.98 Paenibacillus campinasensis 1.00 Bacillus licheniformis Bacillus thuringiensis 1.00 Bacillus halodurans 1.00 1.00 Alicyclobacillus acidocaldarius Alicyclobacillus acidoterrestris 1.00 1.00 1.00 Clostridium cellulosi Ethanoligens harbinensi 1.00 Acetanobacterium elongatum 1.00 Catonella morbi Clostridium saccharolyticum 1.00 0.59 Clostridium botulinum Clostridium perfringens 1.00 1.00 1.00 Streptomyces coelicolor Mycobacterium tuberculosis

PAGE 86

86 Figure 2 8. Phylogram of Pasteuria spp. and other gram positive bacteria inferred by neighbor joining analy sis of 16S rRNA gene sequence alignment consisting of 1,431 characters. Distances of lineages due to varying base composition were corrected by LogDet transformation. Numbers at each node represent bootstrap percentages based on 1,000 replicates while scal e bar indicates evolutionary distance. Pasteuria nishizawae Pasteuria nishizawae Candidatus Pasteuria usgae Pasteuria penetrans Pasteuria penetr ans Pasteuria infecting M. ornata Pasteuria infecting M. ornata Pasteuria hartismeri Pasteuria infecting H. goettingiana Pasteuria infecting Plectidae Pasteuria ramosa Thermoactinomyces dichotomicus Shimazuella kribbense Alicyclobacillus acidoca ldarius Alicyclobacillus acidoterrestris Paenibacillus SD Paenibacillus campinasensis Paenibacillus curdlanolyticus Bacillus halodurans Bacillus licheniformis Bacillus thuringiensis Catonella morbi Clostridium saccharolyticum Clostridium botuli num Clostridium perfringens Acetanobacterium Clostridium cellulosi Ethanoligens harbinensi Streptomyces coelicolor Mycobacterium tuberculosis 53 64 50 33 99 97 100 100 50 99 82 99 99 94 58 56 56 100 100 98 100 100 55 100 0.02

PAGE 87

87 Figure 2 9. Phylogram of Pasteuria spp. and other gram positive bacteria inferred by maximum likelihood analysis of 16S rRNA gene sequence alignment consisting of 1,431 characters. The an alysis was performed under GTR model of nucleotide substitution with estimated gamma shape parameter and proportion of invariant. Numbers at each node were bootstrap percentages based on 1,000 replicates while scale bar represents evolutionary distance. 0.1 Pasteuria infecting M. ornata Pasteuria infecting M. ornata Candidatus Pasteuria usgae 25 Pasteuria nishizawae Pasteuria nishizawae 44 Pasteuria penetrans Pasteuria penetrans 43 Pasteuria hartismeri 6 7 Pasteuria infecting H. goettingiana 100 Pasteuria infecting Plectidae 99 Pasteuria ramosa 100 Shimazuella kribbense Thermoactinomyces dichotomicus 76 66 Bacillus thuringiensis Bacillus licheniformis 97 Bacillus halodurans 100 Paenibacillus curd lanolyticus Paenibacillus SD 83 Paenibacillus campinasensis 100 98 Alicyclobacillus acidocaldarius Alicyclobacillus terrestris 100 70 59 Clostridium cellulosi Ethanoligens harbinensi 99 Acetanobacterium elongatum 100 Clostridium saccharolyticum Catonella morbi 100 52 Clostridium perfringens Clostridium botulinum 100 94 100 Streptomyces coelicolor Mycobacterium tuberculosis

PAGE 88

88 CH APTER 3 POST FUMIGATION POPULATION DYNAMICS OF Meloidogyne arenaria RACE 1 AND P asteuria penetrans IN A PEANUT FIELD Introduction Meloidogyne arenaria race 1, commonly known as the peanut root knot nematode, is an important nematode pathogen causing serious economic losses in peanut growing regions of the United States. The nematode is especially problematic in the states of Alabama, Georgia, Florida, North Carolina, South Carolina, and Texas, ( Ingram and Rodriguez Kbana, 1980; Motsinger et al., 1976; Sturgeon, 1986; Wheeler and Starr, 1987). Other countries where the nematode is important includes China (Zhang, 1985), Egypt (Ibrahim and El Saedy, 1976), India (Sharma and Mc Donald, 1990), Israel (Orion and Cohn, 1975), Taiwan (Cheng and Tu, 1980), and Zim babwe (Martin, 1958) Besides causing numerous galls on roots, the nematode also infects pegs and pods resulting to poor yield quality and pod recovery during harvest. Yield losses occur even on lightly infested soil (Rodriguez Kbana et al., 1982), but lo sses are especially evident in highly infested soil. Above ground symptoms include a patchy distribution of greatly stunted plants to those showing only slight to no stunting. Other symptoms include chlorosis and incipient wilting. Secondary damage may occur because of the heavy galling that predisposes the plant s to infection by wilt pathogens particularly Sclerotium rolfsii and Sclerotinia minor These pathogens increase the incidence of plant death (Starr et al., 2002). The population dynamics of M. arenaria over the peanut cropping season in the southeastern United States have been investigated. Within the growing season of peanut in Alabama, it was observed that the number of second stage juveniles ( J2 ) in soil was low before planting and even during the first 80 days, but thereafter increased rapidly towards harvest and declined sharply right after harvest (Rodriguez Kbana et al., 1986) When peanut was not harvested, population densities still increased exponentially. In another study, the highest dens ity

PAGE 89

89 of M. arenaria J2 found to occur in the top 30 to 40 cm of the soil profile but low at depths below 40 cm (Rodriguez Kbana and Robertson, 1987) This finding suggests that the deeper soil layer s may provide a reservoir of nematode inoculum for the ne xt growing season (Garcia, 1976) This vertical distribution however, as observed in Alabama, may not necessarily be the same as occurs in deep sandy soils where abundant nematodes may be extracted from 45 to 122 cm soil depths (Dickson, pers. obs .). Speci es of Pasteuria have been studied from many different standpoints and are being considered as viable biological control agent that can be integrated with other nematode management tactics ( Freitas et al., 2000a; Kariuki and Dickson, 2007; Talavera et al., 2002; Tzortzakakis and Gowen, 1994). The dynamics of Pasteuria spp. in an actual field situation and the various factors influencing them however, are just beginning to be understood. Stirling and White (1982) reported a wide distribution of P. penetrans in older vineyards of South Australia and that the density of root knot nematodes in those areas tended to be lower than in vineyards less than 10 years old. This reduction in nematode density was attributed to the establishment of the parasite over the ye ars. A similar finding in a peanut field in Florida was reported where reductions in root and pod galling severity caused by M. arenaria was generally improved in the second year (Chen et al., 1996) The degree of suppression though, was also proportionate to inoculation levels of P. penetrans such that 100,000 endospores/g of soil suppressed the nematode better than 10,000 endospores/ g of soil. The obligate nature of P. penetrans makes its population dynamics tied to the host nematode in a density depende nt manner. Any factors therefore, affecting the nematode host such as cropping pattern and soil pesticide application may have an eventual effect on the dynamics of Pasteuria. Timper et al (2001) showed that continuous growing of peanut varieties

PAGE 90

90 suscepti ble to M. arenaria race 1 allowed the rapid buildup of P. penetrans Rotating peanut with cotto n and corn, both nonhost for this nematode, resulted in poor establishment of the bacterium. Similar results were reported in Japan by Tateishi et al. (2007) where continuous growing of a sweet potato variety susceptible to M. incognita favored the buildup of Pasteuria, while rotating it with a resistant variety slowed it down. Likewise, suppression of M. javanica by Pasteuria was observed during the 3rd year af ter 2 years of growing susceptible tomato (Eddaoudi and Bourijate, 1998). In ecology, a model describing the predator prey (or host parasite) relationship in an ecosystem was proposed by Rosenzweig (1971). In this model, which he called the paradox of enr ichment, he showed that increasing the carrying capacity of a system towards the prey tends to disrupt its steady state and causes the population to exhibit cyclic behavior. Increasing further the carrying capacity will cause the cycles to gradually grow and bring the population of either the prey or the predator or both closer to zero. This model seemed to provide a theoretical basis for the observed buildup of Pasteuria populations in a field continuously grown with nematode susceptible crops, a practice that tends to favor an initial increase in nematode population density. In general, chemicals applied in the soil to control nematode and other soilborne disease causing agents may have some dynamicchanging effects on the soil biotic communities dependi ng on their target organism, mode of action, toxicity, and persistence ( Piotrowska Seget, 2009; Martikainen et al., 1998). For example, the soil fumigant nematicide 1,3dichloropropene (1,3 D) may be formulated in combination with chloropicrin, the latter providing fungicidal benefits. Also, methyl bromide, a broad spectrum soil fumigant may be formulated with different percentages of chloropicrin to boost the fungicidal benefits of the combination treatment (Noling and Becker, 1994). Chloropicrin and perhaps methyl bromide

PAGE 91

91 were reported to have a detrimental effect on the development of P. penetrans in the nematode host ( Freitas et al., 2000a; Nishizawa, 1986). When the concentrations of these pesticides drop to sublethal levels, which they eventually do after a certain period, pest pathogen populations may resurge ( Dutcher, 2007). Mechanisms that allow pest pathogen populations to rebound following exposure to pesticides include reduction in inter and intraspecific competition and elimination of natural enemies, among others (Cohen, 2006; Dutcher, 2007). In light of the paradox of enrichment model, resurgence in the nematode population following fumigation by 1,3D might lead to a parallel increase in the density of P. penetrans to suppressive levels. On the other hand, the long term detrimental effect of chloropicri n on development of P. penetrans is not known. To evaluate these e ffects and the possible resurgence of P penetrans following fumigation, a field study was designed from 2003 to 2005 to monitor the dynamics of M. arenaria and P. penetrans population in the field for a period of 3 years following 2 years of fumigation with either chloropicrin or 1,3D. The current study monitored the levels of M. arenaria and P. penetrans in th is field from 2006 to 2008 following the initial 3 year study The objectives of this study were ( i ) to characterize and compare the population dynamics of M. arenaria and P. penetrans in peanut grown in nonfumigated and previously fumigated plots; ( ii) compare the effects of the two fumigants with different target organism on the pos t fumigation dynamics of the nematode and the bacterial parasite; and ( iii) to perform population dynamics simulation using the Lotka Volterra model of host parasite interaction. Materials and Methods Background The current study was conducted in a 25 m 185 m field situated at the University of Florida Plant Science Research and Education Unit, Citra, FL. Both the bacterium and nematode had been introduced to the site in 2003 and they were amplified in a peanut wheat vetch

PAGE 92

92 cropping system. The fumigants c hloropicrin (100%) and 1,3D had been applied in the spring of 2004 and 2005 at the rate of 263 kg/ha and 168 liters/ha, respectively ( Kariuki and Dickson, 2007; Kariuki 2006) Control plots did not receive any fumigant treatment. Experimental D esign The plot assignments from 2005 to 2008 were the same as those used during the previous study in 2004 to 2005 ( Kariuki, 2006; Kariuki and Dickson, 2007) except that nematicides were no longer applied. The experiment was arranged in a randomized complete block design ( RCBD ) with four replicates with each replicate having three beds with two rows of peanut per bed for a total of 12 beds per treatment. A plot measured 6.1 m long 3.6 m wide and a 1.8 m wide nontilled border separated each one. Each year peanut (Ar achis hypogaea L.) cv. Georgia G reen was grown as a summer crop in rows 91 cm apart. During the autumn season of each year common hairy vetch ( Vicia sativa L.) was planted as a winter cover crop. Sampling Peanut plants were dug 120 to 130 days after seedi ng. Soil and root samples were collected at harvest on the two inner rows per plot. Soil was collected using a cone shaped sam pling tube (2.5cm diam., 20cm deep). Six soil cores were taken per plot, three from each of the two inner row s and mixed thoroughly. For root samples 15 root systems that showed galls were chosen arbitrarily from each plot. All samples were placed in polypropylene bags and taken back to the laboratory and stor e d at 4oData C ollection C until used. The J2 of M. arenaria were extract ed from 100 cm3 of soil by the centrifug al flotation technique (Jenkins, 1964). Suspensions were examined at 0 magnification with an inverted microscope and the numbers of J2 with and without endospores attached were counted. F or an individual to be considered encumbered it had to have at least one endospore attached.

PAGE 93

93 The percentage of P penetrans infected females was determined based on those extracted from 20 g of composited root samples taken from 15 plants. Only galled portions of roots were remove d. This protocol was followed from 2004 to 2007 seasons but modified in 2008. During that season, the visual incidence of root galling was very low in almost all plots. In this case, the r oot systems from the three plots within a block that received the same treatment w ere bulked to constitute a 30 gsample for processing. To extract females from roots, galled root portions were placed individually in 250ml beakers and a buffered solution of 10% Rapidase Pomaliq 2F (Gist Brocades Pomaliq product number 7003A/DSM, Food Specialties USA, Menominee, WI), 50 mM Na OAc (pH 5.0), and 0.1% CaCl2 The number of endospores in soil for each plot was estimated using a soil bioassay method. The soil samples were air dried at room temperature for 20 days and passed through 600pore opening (30 mesh) sieve. Forty grams of the soil was placed in a 50 ml conical tube and stored at room temperature until used. M. arenaria race 1 eggs were extracted from galled roots of tomato grown in the glasshouse for 60 days using the macerationsodium hypochlorite method (Hussey and Barker, 1973) and incuba ted in a Baermann tray at 28 1 at ca. 50:50 v/v (Charnecki, 1997) was added at the rate of 5 ml/g of roots. The samples were placed on an oscillating shaker at 200 rpm for 3 days at room temperature. Fem ale nematodes were collected by placing the roots on a sieve with 600pore openings (30 mesh) nested over a sieve with 150pore openings (100 mesh) and flushed with a strong stream of water. The resulting suspensions were placed under a dissecting microscope and the first 30 females observed were picked and mounted on a slide with a drop of distilled water to examine for P. penetrans infection under 400 magnification. A female was considered infected if after smashing, mature endospores oozed out fr om the cadaver. oC.

PAGE 94

94 In each assay sample, 5 00 J2 obtained on the 2nd and 3rd days were inoculated as a 10 ml suspension in distilled water. Tubes were incubated at room temperature for 72 hours and the J2 extracted using the centrifuge flotation method (Jenkins, 1964). The suspensions were examined at 400 with an inverted microscope and the number of endospore s attached per individual nematode was determined for the first 25 J2 observed in the suspension. Determination of Standard Curve Galled roots of peanut were obtained from the peanut field an d the M. arenaria females were extracted by enzymatic digestion of roots as described above. About 1,500 Pasteuriainfected females were picked, placed in a 1.5ml siliconized microcentrifuge tube containing 1.0 ml dH2O, and crushed by plastic pestle to r elease endospores. The endospore suspension was filtered through a 20 CA) in a 13 mm Swinnex disc holder (Millipore MA ) fixed on a 5ml syringe. The endospores were collected in a new 1.5 ml siliconized tube and cent rifuged at 6,000g for 5 minutes, resuspended in 1.0 ml dH2O and diluted (102) suspension in a hemacytometer and repeating four times. A serial dilution of endospor es was prepared as 10 ml suspensions that would deliver 1107 to 10 endospores/g of soil. Forty grams of autoclaved, air dried, sifted soil was placed in 100ml beakers. The endospore suspensions were added to the soil and air dried for 7 days. The infes te d soil in each beaker was stirred to homogenize the distribution of the endospores before transferring into 50ml plastic conical tubes and infes ted with 500 M. arenaria J2. The preparation, inoculation, and extraction of J2 from the bioassay soil samples and the counting of endospores atta ching on their cuticle was performed as described above.

PAGE 95

95 Statistical Analysis Data were subjected to multiple analysis of variance (MANOVA) with year and treatment as factors using Statistica Version 6.0 (Statsoft, Tuls a, OK). A ll count data and percentage data were subjected to log ( x +1) and arcsin ( x) transformation s respectively. Means were separated by pairwise comparison using student t test at P = 0.05. Means, standard errors around mean (SEM) and ranges of untransformed data are presented. Lotka Volterra Simulation A Lotka Volterra (Lotka, 1 925; Volterra, 1926) simulation was performed data from the number of J2 per 100 cm3aln (y) by = cx dln ( x ) + k (3 1) of soil and number of endospores per J2 in the soil bioassay to represent M. arenaria and P. penetrans population densities, respectively. The Lotka Volterra differential equation, was estimated from two systems of linear equations, xt+1 = xt + axt bxtyt and (3 2) yt+1 = yt + cxtyt dyt where xt and yt are the harvest density estimates for M. arenaria an d P. penetrans respectively, taken at interval t which in the case of this study, was yearly. In the context of M. arenaria and P. penetrans host parasite system, the parameters are a = host growth rate; b = host decrease rate because of parasitism; c = parasite amplification rate in relation to host exploitation; and d = parasite decrease (Atibalentja et al., 1998; Ciancio, 2008). (3 3) Ideally, the data collected from the field experiment should be used to estimate the values of the parameters. However, be cause there were only three sets of data, which represented the harvest densities of M. arenaria and P. penetrans from 2006 to 2008, no realistic and meaningful

PAGE 96

96 estimates of the parameters could be generated. More end of the season data points were needed in order to produce a reliable mathematical model that would describe the field dynamics. Nevertheless, there were already a few population dynamics studies done on cyst and dagger nematodes in sites infested with Pasteuria spp. where parameters were estim ated based on actual field data (Atibalentja et al., 1998; Ciancio and Qunherv, 2000). The values for the parameters a, b, c and d were assigned using the published values from these two studies as starting point until the ratios a/ b and d/ c which corr espond to parasite and host equilibrium densities, respectively, assumed values close to the observed densities in the nonfumigated plots. The parameter values used were a = 0.01826, b = 0.00583, c = 0.000037 and d = 0.00298. The number of J2 per 100 cm3 of soil and number of endospores attached per J2 in 2006 were substituted to xt and ytResults in Equations 32 and 33. The simulation was run by generating 1,000 to 1,500 iterative solutions for these two systems of linear equations. The nematode and parasite den sities derived from the simulation were plotted and presented in both phase plane and time series. Field E xperiment The previous study showed that P. penetrans was established in the peanut field where the present experiment was conducted ( Kariuki 2006; Kariuki and Dickson, 2007) Fumigation with either chloropicrin or 1,3 D affected the build up of P. penetrans as indicated by significantly lower number of endospores adhering on the cuticle of M. arenaria J2 as determined by bioassay method compa red with the nonfumigated plots. At peanut harvest in 2005, the J2 population density in chloropicrinfumigated plots was significantly higher ( P 0.05) than in both nonfumigated and 1,3D fumigated plots. The results from the previous experiment (Kariuki, 2006; Kariuki and Dickson, 2007) are included (Table 3 1)

PAGE 97

97 In 2006, a year after the fumigant s w ere applied, the population density of M. arenaria increased in all three plots (Fig. 3 1A C ). The change, however, was much more pronounced in both previously fumigated plots. From 80 J2/100 cm3 of soil in 2005, the count from chloropicrintreated plots had an average of 365 in 2006, an increase by m ore than four fold (Fig. 3 1B) It was even more pronounced in the 1,3D treated plots where the increase in level s was more than 13 fold from 39 to 526 J2/100 cm3 of soil in the same period (Fig. 3 1C) These were the highest densities recorded for the w hole duration of the study. The mean count in the nonfumigated plots also increased but remained below 100 J2/100 cm3The level s of Pasteuria continued to increase in both chloropicrin and 1,3D treated plots, reaching t heir peak at the end of the 2007 growing season (Fig. 3 1B,C)) The increase though, was not as sharp as in the previous year. Their mean of 6.8 and 5.9 endospores per J2, respectively, were both just about 1.5fold higher than their level in 2006. In the nonfumigated plots, there was a slight drop in endospore numbers per J2, from 3.5 in 2006 to 3.1 in the 2007 season. Nematode densities on the other hand declined by at least threefold in all plots from their levels in 2006. Nonfumigated plots averaged 29 J2/100 cm of soil. Despite significant differences in the total count of juveniles, the percentages of encumbered J2 in all three plots were compara ble to each other (Table 3 1) It was most variable though in the nonfumigated plots having a range of 0 to 85%. The 2006 growing season was also the only time when the levels of Pasteuria across plots were not significantly different from each other ( P > 0.05) In this sampling period, the nonfumigated and chloropicrin and 1,3D fumigated plots had a mean of 3.5, 4.7 and 3.6 endospores/J2, respectively. 3 of soil and remained having significantly lower nematode counts than either of the fumigated plots ( P 0.05). The mean counts in chloropicrinand 1,3D treated plots, recorded at 102 and 171 J2/100 cm3 of soil,

PAGE 98

98 respectively, were not significantly different from each other ( P > 0.05). As in the 2006 season, the proportion of the juvenile population having at least one endospore attached on their cuticle was comparable in all plots. Each of the three treatments had at least one plot with more than 90% of M. arenaria J2 encumbered by P. penetrans. These high levels were not recorded in previous seasons. Th e downward trend in the level of P. penetrans encumbrance continued into the 2008 growing season. The number of endospores per J2 however, remained significantly higher in both chloropicrin and 1,3 D fumigated plots than in nonfumigated plots ( P 0.05) (Table 31) In the latter, the mean count of 1.5 endospores / J2 was just half of what it used to be during the previous season. This was the lowest number recorded for the nonfumigated plots in the entire experiment. While the endospore numbers in soil dropped, the nematode density in the nonfumigated plots increased from 29 J2/ 100 cm3 of soil in 2007 to 94 J2/ 100 cm3 of soil in 2008. Conversely, the nematode densities in previously fumigated plots dropped in between those two seasons. In 2008, chloropicrin and 1,3D treated plots had 28 and 81 J2/100 cm3A highly significant and strong positive linear relationship ( P 0.01; r of soil, respectively, which were 3.6 and 2.1fold lower than the previous season. The mean number in 1,3D plots however, was not different from the mean of the nonfumigated plots ( P > 0.05), which made the number from chloropicrinfumigated plots lower than the other two ( P 0.05). The proportion of encumbered juveniles from each treatment again did not differ from each other ( P > 0.05). However, each treatment had at least a plot with 100% encumbered juveniles. 2 = 0.94) between the total number of J2 per 100 cm3 of soil and number of J2 with endospores attached was observed (Fig. 3 2) In contrast, nematode density and endos pore level in the soil as determined by bioassay method had a nonsignificant and very weak positive linear relationship ( P > 0.05;

PAGE 99

99 r2 = 0.01) (Fig. 3 3) Likewise, no correlation was detected between nematode density and the proportion of encumbered J2 ( P > 0.05; r2The mean percentage of infected females increased to at least 65% in all plots after fumigation was stopped (Table 31). Like what was observed in nematode density, the increase was more pronounced in previously fumigated plots. In 2006, the fumigated plot s were not different from the nonfumigated ( P > 0.05). In 2007, both chloropicrin and 1,3D fumigated plots had more than 90% of the females infected. These were higher than in the nonfumigated plots that recorded 85% infection ( P 0.05) No statistical analysis was done in 2008 because there were insufficient females extracted from the root samples. Most plots had less than 10 females, below the 30 females required by the protocol. Nevertheless, previously fumigated plots had a numerically higher percentage of infected females than the nonfumigated. = 0.005) (Fig. 3 4 ) Th e proportion of encumbered J2 did not vary much at different J2 density levels (Fig. 35). When J2 densities were divided into classes, the mean proportion of encumbered J2 in e ach class f luctuated between 0.59 and 0.71. Determination of S tandard C urve Endospore attachment on J2 was observed at concentrations of 1 107 to 1 103/g of soil. As the endospores become diluted, fewer J2 were found encumbe red. Respectively, out of 25 J2 examined, there were 25, 23, 12, 3 and 1 encumbered individuals at inoculation levels of 1107 to 1 103The logarithm of the mean endospores attached per J2 ( x ) and inoculation levels ( y ) were taken to compute the standard curve. Only the endospore inoculation levels that had attachment were included in the calculation. The resulti ng linear regression equation was log ( y ) = 1.657 log ( x ) + 3.8554 with a corresponding fitness of r / g of soil. The mean numbers of endospores attached per J2 were 50.23, 25.67, 7.23, 1.13 and 0.27 for the same inoculat ion levels, respectively. 2 = 0.9769 (Fig. 36). From this equation, the numbers of endospores per gram of field soil samples were calculated using the attachment data

PAGE 100

100 generated by b ioassay as input. The estimated numbers of endospores per gram of soil samples from 2006 to 2008 are presented ( Table 3 1) The results showed that the levels of P. penetrans in chloropicrinfumigated plots remained above the 100,000 endospores/g of soil from 2006 through 2008, after starting low in both 2004 to 2005 when these plots were fumigated. In 1,3D plots, the endospore levels exceeded the 100,000 mark only in 2007. The levels however in 2006 and 2008, were not very far below 100,000 endospores/g of soil. In nonfumigated plots, the levels of P. penetrans were only above this mark in 2004 or a year after it was introduced in the field. Simul ation of the P ost F umigation P opulation D ynamics Using the assigned a = 0.01826, b = 0.00583, c = 0.000037 and d = 0.00298, the number of J2 per 100 cm3Discussion soil ( a/b) and endospores per J2 ( d/c ) had equilibrium values of 3.13 and 80, respectively. The phase plane representation indicated that the orbit of the dynamics in nonfumigated plots covers a small area near t he equilibrium point and was also close (Fig 37 ). In the chloropicrin and 1,3D fumigated plots, the orbits were not only larger than that of nonfumigated plots, but also open, hence, gradually increasing in every cycle. Their orbits approached the y axi s which means extinction for the M. arenaria population. They were also getting close to the x axis but did not reach that ex tinction point of the parasite. In time series representation, the densities of the nematode and the bacterium fluctuated within a low density range (Fig. 3 8A) In plots previously fumigated with either chloropicrin or 1,3D, fluctuations had a higher amplitude (Fig. 3 8B,C) The P. penetrans and M arenaria populations in the field grown with peanut for five consecutive seasons generally showed density dependent dynamics with a time delayed response. Fumigation with chloropicrin and 1,3D in the first 2 years proved to be a strong factor

PAGE 101

101 that altered the dynamics of the bacterial parasite and the nematode host. Disturbanc e, in an ecological sense, is defined as any relatively discrete natural or man made event in time that disrupts ecosystem, community, or population structure and changes resource pools, substrate availability, or the physical environment (White and Pickett 1985). The application of pesticides is a form of disturbance that has been documented to alter soil microbial and nematodes communities (Bongers and Ferris, 1999; Ibekwe et al., 2001). For the sake of discussion, the nonfumigated and the initially fumigated plots will be designated here as the nondisturbed and disturbed systems, respectively. Throughout the history of research on Pasteuria, several reports of the organisms suppressive effect s on nematodes have been shown (Bird and Brisbane, 1988; Ce tintas and Dickson, 2004; Chen et al., 1996; Dickson and Oostendorp, 1990; Kariuki and Dickson, 2007; Oostendorp et al., 1991; Stirling and White, 1982; Trudgill et al., 2000). These studies also indicated that build up to suppressive levels requires time because of its dependency on living nematode host for multiplication. In microplots infested with M. arenaria for instance, the establishment of P. penetrans took 3 years ( Chen et al., 1996; Oostendorp et al., 1991). But o nce established, this bacterium ap pears to provide a long term suppression of the nematode such as observed in old vineyards in Australia (Stirling and White, 1982) In the bioassay test the nonfumigated plots had means ranging from 3.1 to 7.4 endospores/J2 from 2004 to 2007. These numbe rs corresponded to 74,265 to 197,568 endospores/g of soil based on calculations from a standard curve. In 2008, the estimate of the number of endospores dropped to 32,718/g of soil. These endospore soil concentrations that persisted for 5 years in the nonf umigated plots were more that the minimum threshold of 10,000

PAGE 102

102 endospores/g of soil needed for a significant root knot nematode suppression to occur (Chen et al. 1996). Persistence of enough viable endospores of P. penetrans in the rhizosphere appears to be the key for long term suppression of M. arenaria. Successful management of M. arenaria or any plant parasitic nematodes in general by Pasteuria spp. requires a thorough understanding of the basic biological and ecological factors shaping this host paras ite interaction. With breaks between growing seasons, three conditions must be met for the parasite to persist: invasion of the host population at the start of each season, infection of sufficient number of hosts during a season, and lastly, persistence in between seasons (Gubbins and Gilligan, 1997). Meloidogyne arenaria, like its bacterial parasite, is an obligate pathogen, so the host plant has a significant influence on its population dynamics. Peanut is an annual crop grown in Florida only during the summer season. Its seasonality can be considered a form of disturbance (Gubbins and Gilligan, 1997) in the M. arenariaP. penetrans interaction because this prevents the continuity of food source for the nematode. In this study, hairy vetch was planted in the experimental site as a winter crop but nematode multiplication during this period was lower compared to peanut in the summer season (Kariuki and Dickson, 2007). Regardless of whether a winter crop is grown or not, the seasonality of peanut by itself ca uses the density of M. arenaria to fluctuate (Rodrguez Kbana et al. 1986), which impact s the dynamics of Pasteuria, especially its persistence. In Martinique, it was shown that the abundance of P. penetrans in the soil was related to M. incognita densit ies whose fluctuations were determined by the presence or absence of suitable crop hosts and fallow periods (Ciancio and Qunherv, 2000) During fallow periods or when nonhost crops were grown, densities of both M. incognita and P. penetrans were low bu t recovered when a susceptible host was grown. It was suggested that

PAGE 103

103 continuous cultivation of nematode susceptible crops for a few years might be needed to increase the population density of Pasteuria to suppressive levels ( Melki et al., 1998; Tateishi et al., 2007; Timper et al., 2001; Walia et al., 2005). Invasion of nematodes by Pasteuria is preceded by the attachment of the endospores on the cuticle. This highly specific process is governed by intricate surface biochemical and physical interactions inv olving adhesins on the parasporal fibers of the endospores and receptors on nematode cuticle ( Afolabi et al., 1995; Persidis et al., 1991). Soil conditions such as temperature, moisture, texture, and pH were reported to have effects on attachment (Hatz and Dickson, 1992; Javed et al., 2002; Talavera and Mizukubo, 2003). The length of endospore dormancy had no effect on attachment but decreased their viability (Espaol et al., 1997; Gianakou et al., 1997). Attachment and infection of M. arenaria race 1 by P. penetrans were presumed in the present study and confirmed by recording 40 to 100% infected females at the end of each season. Infection of enough hosts, the second requirement for persistence, appeared to not be satisfied during the 2007 to 2008 seasons. The lowest number of J2 per 100 cm3 of soil was recorded in 2007 season, so even if the soil had a high endospore load at the time, the low nematode host density limited the chance of the Pasteuria to multiply (Darban et al., 2005b). The bioassay count f ell to 1.5 endospores / J2 in 2008, which yielded a corresponding estimate of about 32,718 endospores/g of soil based on the standard curve. This density was one half lower than the previous year. As stated above, c onstant multiplication is essential for obl igate parasites like Pasteuria to provide a reservoir to sustain itself (Gubbins and Gilligan, 1997) especially in light of a continual percolation loss on sandy soils common in Florida An infected root knot nematode female may contain and eventually rele ase about 380,000 (Cho et al., 2005) to as high

PAGE 104

104 as 2,000,000 endospores (Darban et al., 2004). Intuitively, a potentially large number of endospores were not loaded into the soil in 2008 just because there were less nematodes to infect during the previous year. The third requirement for persistence is that endospore remains viable in the rhizosphere zone in between seasons. The viability factor can be assumed since the growing season was yearly and the endospores were structurally and chemically equipped t o resist harsh environmental conditions while resting in the soil (Chen and Dickson, 1998). On the other hand, the physical retention of endospores in the soil is greatly influenced by external factors such as soil texture and irrigation regime s Free water plays an important role in spreading the bacteria in the soil (Gammack et al., 1992). This becomes even more important for Pasteuria whose immobile endospores rely on water to spread them from the nematode cadavers. Several studies however, conclusively demonstrated that excessive irrigation or rainfall could leach Pasteuria endospores to a deeper soil profile. In the sandy field soils of Florida endospore encumbered J2 were recovered at 122 cm deep (Dickson et al., 1994) It has also been demonstrated that some endospores are carried by water to a deeper soil profile although most still remained i n the top 30 cm (Cetintas and Dickson, 2005) Dabir et al. (2005) observed a decrease in the percentage of infected Meloidogyne juveniles as a result of a redu ction of endospore density in the top soil by leaching. The extent of endospore loss through leaching was found to be more pronounced in sandy soils and less so in clay soils (Dabir et al., 2007). They further stated that the best spore percolation to ret ention ratio was observed when soils had 10 to 30% clay content. In the present study, the observed decrease in endospore density in 2008 may be attributed to higher rate s of loss caused by leaching than replenishment in the top soil.

PAGE 105

105 Pesticides in general are considered the most persistent manmade disturbances and can significantly alter the biological composition and dynamics of a given soil ecosystem (Adams et al., 2005; Banks et al., 2008; Ibekwe et al., 2001). Depending on mode of action and target or ganism, pesticides can enhance or suppress certain trophic groups of soil nematodes (Yardim and Edwards, 1998). In the present study, 1,3D maintained the density of M. arenaria in 2004 and 2005 significantly lower than the nonfumigated plots, while chloropicrin fumigated plots had significantly more nematodes than the other two. When the fumigants were not applied, a sharp increase in nematode density was observed in previously fumigated plots. The Pasteuria levels in those plots exhibited a pattern simila r to that of the nematode, although with a time delayed characteristic. Several definitions were given to the phenomenon called pesticide induced pest resurgence. In the context of arthropods, it was defined as an increase in target arthropod pest species abundance to a level which exceeds that of a control or untreated population following the application of an insecticide (Hardin et al., 1995) Depending on the toxicity and mode of action of a pesticide, the density of the target pest pathogen popula tion may or may not decline prior to resurgence. It is commonly recognized that the harmful effect of pesticides on the pests natural enemies is a major cause of resurgence among others (Bartlett, 1964; DeBach, 1974; Oudejans, 1983; Staring, 1984). While resurgence of M. arenaria was observed in both chloropicrin and 1,3 D fumigated plots, the causal mechanism could be different. 1,3D is the most reliable pre plant nematicide against root knot nematode s and considered one of the possible chemical alterna tives to methyl bromide (Dickson, 1985; Dungan and Yates, 2003). Stirling (1984) reported that 1,3D did not affect infection of M. javanica by P. penetrans Chloropicrin on the other hand, is normally

PAGE 106

106 added to methyl bromide formulations as a warning agent as well for its fungicidal activity or to 1,3D to impart fungicidal activity (Dungan and Yates, 2003; Stromberger et al., 2005). Chloropicrin was reported to decrease the number of most culturable soil microbial groups by up to 80% (Itoh et al., 2000). Studies showed that chloropicrin or fumigant formulations containing it generally had a detrimental effect on Pasteuria as indicated by lower percentage of endospore filled female nematodes recovered from root systems ( Freitas et al., 2000a; Nishizawa, 1986). These findings may help differentiate the causal mechanism of resurgence of nematode populations in plots where these fumigants were previously applied. Chloropicrin did not suppress the nematode. Its resurgence, a more than two fold increase in density from 2005 to 2006, was most likely a result of density independent suppression of the parasite. In 2005, the bioassay result fr om soil samples taken from chloropicrinfumigated plots had an average of less than 1 endospores/J2, which in practical sense me ans barely detectable, at least by the method used. The depression in Pasteuria density could be the result of the lack of amplification caused by inhibition of its development in the nematode host by chloropicrin, thus independent of the nematode density. The exact mechanism of inhibition is still unknown (Freitas et al., 2000a) but seems to be more bacteriostatic rather than bactericidal. If Pasteuria were killed by chloropicrin, the observed parallel increase in its level in the soil from 2005 to 2007 would not have been detected. The fumigants methyl bromide, methyl isothiocyanate, 1,3 D and chloropicrin were shown to have the strongest impact on heterotrophic microbial communit ies only during the first week after application but the effect weakened ther eafter (Ibekwe et al., 2001). Among these fumigants, 1,3D exerted the least effect on the microbial community structure. It was further demonstrated that the gram positive bacteria had better survival after fumigation and that they recovered to their init ial levels faster than the gram negative bacteria (Ibekwe et al., 2001;

PAGE 107

107 Yamamoto et al., 2008) resulting to a microbial community dominated by the former. These findings substantiate the results of the current study in which the population of P penetrans a gram positive bacteri um, recuperated and responded quickly to increasing M. arenaria densities after being suppressed initially by chloropicrin. 1,3D ichloropropene on the other hand, being a nematicide, directly suppressed the nematode. This explains the depression in its density during the first 2 years. Having only small number of hosts to colonize, the bacterial parasite level also failed to increase suggesting a suppression mechanism on the bacteria that is dependent on nematode host density. The r esurgence in nematode densities, characterized by a dramatic 10 fold increase from 2005 to 2006 may only be partially explained by lower Pasteuria densities relative to the nonfumigated control plots. Other mechanisms of resurgence observed among insects a nd mites, such as decreased competition might also be in play (Hardin et al., 1995). Placing this in the context of the present study, the lowered competition for feeding sites at low nematode population densities might have allowed them to attain their ma ximum reproductive potential. It was commonly observed that the reproductive rate of plant parasitic nematodes was higher when the starting population densities were low ( Chindo et al., 2006; Phillips, 1984). This reproductive rate might have been high enough to enable them to escape the weak parasite regulation, thus reaching a level higher than the nonfumigated plots. Indeed, parthenogenetic species like M. arenaria are capable of rapid multiplication because of their short generation time and high reproductive rates, characteristics that give them a great er advantage in responding to environmental selection (Trudgill and Blok, 2001). Population regulation is a fundamental concept of ecology, but the mechanism by which it operates in nature has always been the subject of debates ( Berryman, 2004; Hixon, et al., 2002;

PAGE 108

108 Murray, 1999; White, 2004). According to Hixon et al. (2002), a population is regulated if it displays persistence, boundedness, and return tendency where density dependent negative feedback is involved. A regulated population is capable of rebounding when their density declines, and decreasing when they reach high density levels. When the negative feedback becomes weaker than various disturbing density independent or stochastic events, a populat ion can go extinct. The negative feedback loop may include intrinsic and extrinsic mechanisms such as competition and predation/parasitism, respectively. Regulation by competition happens quickly, whereas predation/parasitism is normally a time delayed res ponse ( Berryman and Kindlmann, 2008; Hixon et al., 2002). The present study showed how P. penetrans was involved in density dependent regulation of its nematode host and itself. The concurrent increase in the densities of Pasteuria and nematode conformed t o the observation of Darban et al (2005b) who reported that the buildup of a Pasteuria population was proportional to initial nematode host densities. The eventual rise in the abundance of Pasteuria to levels that were suppressive caused the nematode den sities to drop. Consequently, the increase in the abundance of the bacterial parasite was not sustained likely because of host density dependence and dosage induced mortality of J2. The dosage induced mortality of J2 happened when the endospores in the soi l became so abundant causing multiple attachments on J2 (Stirling et al., 1990). Studies did not agree on the number, but they all concluded that multiple endospore attachment impeded nematode movement and root infection (Ahmed and Gowen, 1991; Davies et a l., 1991; Kariuki et al., 2007; Stirling, 1984; Stirling et al., 1990) Unable to penetrate the host root, encumbered J2 would die without developing into the next juvenile stage. This has a consequence also for P. penetrans where each of the numerous endospores adhering to the J2 would lose its chance to initiate infection and

PAGE 109

109 propagate itself, thus, would be counted as loss. At this point of the dynamics, the buildup of Pasteuria would likely be halted and this illustrates a negative feedback mechanism. Ciancio (2008) included this death of J2 due to encumbrance as a component of his proposed model for Pasteuria parasitism of root knot nematodes. The time delayed response in the dynamics of Pasteuria was expected and conforms to the common observations of population regulation by parasites (Hixon et al., 2002). In previous studies, a time delayed response was observed in Xiphinema diversicaudatum (Ciancio, 1995b), Tylenchulus semipenetrans and Heterodera goettingiana (Ciancio, 1996). In the se studies, parasitism of Pasteuria correlated with changes in nematode densities with a 2 to 3 month delay. This time delayed response just underscores the tight association of P. penetrans to M. arenaria in terms of host specificity and the obligate nature of parasitism (Sayre and Starr, 1988). This study is another demonstration of the potential of P. penetrans as a biological control agent of root knot nematodes. More than its efficacy, it was shown that it c ould buildup to suppressive levels under field conditions. One of the likely reasons why P. penetrans achieves this can be attributed to its basic biology. Infection by P. penetrans leads to host steriliz ation a property that can theoretically cause extinction of the host population (Boots and Sasaki, 2002) In t he so called tradeoff hypothesis, parasites balance host exploitation with lifetime transmission success by evolving to express intermediate level s of virulence (Anderson and May, 1982). The lowered virulence level can be assumed in P. penetrans in the sense that completion of its life cycle occurs only in females (Starr and Sayre, 1988). This involves delay in their development from the time they first attach to J2, thereby, prevent ing the early killing of the ir host. If virulence is to be measured in t erms of time to kill the host (Jensen et al., 2006), then, the biology of P. penetrans conforms to the trade off hypothesis. The benefit of having moderate

PAGE 110

110 virulence for P. penetrans is mainly to capitalize on larger body volume of females compared to J2 so more endospores can be produced for increased chances of transmission. This mechanism was described in details in Daphnia magnaP. ramosa model (Ebert (2008) There were instances however, that P. penetrans endospores were observed in J2 of Meloidogyne spp. infecting turfgrass in Broward Co ., F L (Giblin Davis et al., 1990). It is not clear however, if this population was simply a virulent variant of P. penetrans or may represent another species that happened to have hosts in genus Meloidogyne The latte r is not impossible as Sturhan et al. (1994) reported a Pasteuria population that was found infecting pea cyst nematode, H. goettingiana. They viewed this population to be a different species from P. nishizawae the parasite of H. glycines based on morphology and its ability to complete its life cycle in J2 of H. goettingiana. In summary, the application of fumigants during the first 2 years caused a disturbance in the otherwise stable dynamics of PasteuriaM. arenaria populations. Although the previous application of the two fumigants directly affected different organisms, the ir disturbance triggered an oscillation of the PasteuriaM. arenaria populations with higher amplitude compared to that of nonfumigated plots. This study also showed that chloropicr in was only inhibiting P. penetrans when it was applied in the soil. The mechanism by which this fumigant suppresses Pasteuria remains unknown but seemed to be bacteriostatic because it allowed the P. penetrans population to rebound after the fumigation wa s stopped. The Lotka Volterra model of predator prey population dynamics has been used by nematologists who looked at the parasitism of nematodes by species of Pasteuria Examples are T. semipenetrans on citrus (Ciancio and Racuzzo, 1992), X. diversicaudat um in peach (Ciancio, 1995b), and H. glycines on soybean (Atibalentja et al., 1998). This deterministic model allows

PAGE 111

111 the prediction of equilibrium densities for both host and parasite, an attractor point around which the densities will fluctuate (Christian sen and Fenchel., 1977). For instance, Atibalentja et al. (1998) predicted that in the H. glycines Pasteuria sp. system, the equilibrium value for J2 density per 250 cm3 of soil and percentage of endospore encumbered J2 were 58.2 and 58%, respectively. In X. diversicaudatum P. penetrans system, these values were 120.9 nematodes / 100 cm3In the present simulation, the equilibrium number of endospores per J2 and number of J2 per 100 cm of soil and 6.84 %, for the same two parameters, respectively (Ciancio, 1995b). They however, did not determine the equilibrium density of the Pasteuria which could provide a practical indicator in terms of maintaining the suppressiveness of the soil towards the nematodes. 3In the actual field dynamics, the lowest post fumigation nematode population densities were recorded in 2008. The treatment means did not reflect the specific dynamics happening in each plot but raw data indicated a trend towards local extinction in some previously fumigated plots. In 1,3D plots, 8 of the 12 plots had densities below 10 J2/100 cm of soil were 3.13 and 80, respectively. These values we re realistic as far as the observed dynamics was concerned, but an other set of parameter values might be possible. While it was not the objective to determine the exact equilibrium densities for both M. arenaria and P. penetrans as this would need several data points taken in a longer period of time, the simulation showed a probable effect of the disturbance caused by the fumigants. The extinction of the nematode host is just one possible scenario in this dynamics. Other parameter values may drive the para site to extinction as well, but were not explored in this simulation study. 3 of soil and two of them did not have any J2 in the suspension. In chloropicrinfumiga ted plots, all had nematodes but 6 of 12 plots had counts below 10 J2/100 cm3 of soil. Nematode densities in these plots were in the hundreds during the 2006 sampling period. The nematode suppression was also reflected as

PAGE 112

112 very low numbers of females in the roots. In the same plots where the J2 count was very low, the number of females extracted from roots did not even reach 10/ 30 g of roots. The protocol for evaluating percentage infected females requires examination of 30 individuals, a number normally ex ceeded in the previous seasons. Parasitedriven extinctions are possible under certain biological and ecological situations as some empirical and simulation studies have suggested. Those studies imply that parasites that significantly reduced host reproduction drove their host to extinction (Boots and Sasaki, 2002). Ebert et al. (2000) compared the effect of six parasites with different modes of transmission on the fecundity, survival and density reduction of Daphnia magna. P. ramosa, one of the parasites studied, drove all the replicates of host population to extinction and in the process, went extinct as well. As a parasite, P. ramosa effectively decreases host density by reducing its fecundity. It can be argued therefore, that nematode host can be driven to extinction by species or isolates of Pasteuria that completely sterilizes the host such as P. penetrans (Mankau, 1980; Sayre, 1980). Some ecologists argue however that at the metapopulation level, host population extinction rarely happens unless some very strong stochastic or density independent events take place when the host population density reaches its bottleneck (Boots and Sasaki, 2002). In fields with a history of coexistence between populations of nematodes and Pasteuria, survey data indicated the existence of a plateau effect on the rate of attachment. For instance, Giblin Davis et al. (1990) reported that the percentage of Belonolaimus longicaudatus encumbered with endospores remained at around 74% during the entire 16 months of sampling. Such leveling of transmission below 100% may ensure a long term availability of healthy yet susceptible host. Stabilizing factors, such as spatio temporal heterogeneity and host and parasite polymorphism, may interact to prevent extinction of either organisms and therefore, preserv e

PAGE 113

113 their coexist ence. Spatial heterogeneity has been recognized as an important factor promoting a stable coexistence between the host and parasite by reducing the risk of exploitation by the latter (Hillborn, 1975; Murdoch, 1977). He terogeneity in densities of nematode and bacterium across the field may be created due to the spatially structured nature of both populations. M. arenaria females either produce eggs or release endospores within their vicinity and the parasite transmission via endospore attachment happens within that microcosm. Differences in the densities of nematodes and bacterium at the start of each growing season would result in various dynamics as predicted by Lotka Volterra model (Stewart, 1977). Some patches would have a high concentration of endospores, enough to cause local extinction, while others might have decreased endospore densities due to previous extinction of the nematode host. Heterogeneity in endospore densities and distribution can also be enhanced by e xternal factors such as soil texture and water flow (Dabir and Mateille, 2004; Mateille et al., 2009). In spots where endospore levels dropped because of any of the mechanisms mentioned, the possibility of J2 contacting an endospore would be low. Serving as temporal refuges ( Boots and Sasaki, 2002; Haraguchi and Sasaki, 2000), those patches could be recolonized and allow buildup of the nematode population until it became regulated again by parasitism. Cuticle polymorphism in a nematode host population ma y also contribute to the prevention of extinction by allowing a certain proportion of the population to escape the parasite. The study of Davies et al. (2008) on M. incognita, an obligate parthenogenetic species like M. arenaria, revealed that individual l ines from single egg masses may have polymorphism in the cuticle surface as indicated by differential rate of attachment of Pasteuria. They cited possible genetic and epigenetic mechanisms that could generate variability in a population that produces clone s. This variability would confer advantage for the parthenogenetic species encountering selection

PAGE 114

114 pressure by parasites such as Pasteuria by generating resistant individuals (Trudgill and Blok, 2001). Correlation analysis showed that the increase in transm ission as indicated by the number of encumbered J2 was more related to the densities of J2 in the soil ( r2 = 0.94; P < 0.01) (Fig. 3 2) than the endospore densities ( r2When the proportion of encumbered J2 was used as the response variable its linear relationship with nematode density was neither strong nor signi ficant ( r =0.01; P > 0.05) (Fig. 3 3) This reflects the nature of the horizontal transmission where J2 are the ones moving through the soil and in the process, contact the immobile endospores. The significant linear response to nematode densities indicates that the chances of contacting immobile endospores increase with the number of individuals exposed to. Transmission will not increase even if the soil has a high endospore load unless they are encountered by J2. This relationship suggests a mechanistic explanation on the density dependent increase of Pasteuria when the nematode population resurged a ssuming that each encumbered J2 would become endospore producing females upon completion of their life cycle. 2 = 0.005; P > 0.05) (Fig 34). At low nematode densities, a wider range of proportions of encumbered J2 were observed. As the nematode densities increased, the value of the proportion tended to narrow, suggesting a fixation in the rate of encum brance below 100%. The small value of the slope of the regression line (m = 0.0257) indicates an almost flat line (m = 0) and supports the idea of a constant level of encumbrance across J2 densities. When plotted against density classes created by the hist ogram (Fig. 3 5), the average proportion of encumbered J2 per class actually did not vary much regardless of nematode densities. The proportions fluctuated narrowly between 0.59 and 0.71. Epidemiological studies on Pasteuria have used percentage infection as the functional response instead of absolute number of infected or encumbered nematodes (At i balentja et al.,

PAGE 115

115 1998; Ciancio, 2008; Ciancio and Qunherv, 2000; Regoes et al, 2003). Ciancio and Qunherv (2000) pooled their data and showed that there was a significant but very weak positive linear relationship between abundance of J2 and proportion of encumbered nematodes ( r2The present stud y yielded some interesting and practical insights that can be incorporated into designing future strategies for M. arenaria management using P. penetrans. The population dynamics including persistence of the bacterial parasite was shown to be strongly depe ndent on the presence and abundance of the nematode host. At this point, Pasteuria is hard to mass produce for inundative application. With a limited amount of Pasteuria inoculum, the classical approach of biological control is the only feasible option. However, in order for the bacterium to be established in the field, the nematode host must be initially allowed to increase following the paradox of enrichment principle (Rosenzweig, 1971) This can be done by either inoculating the field with susceptible po pulations of nematodes or, as some previous researchers have suggested, growing of host plant susceptible to the nematode species targeted to be managed by Pasteuria = 0.1225; P < 0 .01). This statement would lead to the conclusion that the proportion of encumbered J2 would increase proportionatel y with J2 density in the soil. This idea was not supported by the nearly flat average proportion of encumbered J2 across nematode density levels recorded in the present study and by the observations of GiblinDavis et al. (1990) on the attachment of Candi datus P. usgae on B. longicaudatus in a natural population. Differential susceptibility of host population, virulence level of the parasite, spatial heterogeneity and other factors might explain this seemingly observed equilibrium rate of encumbrance far below 100% at the metapopulation level. Ciancio and Qunherv (2000) reported that the linearity between nematode density and Pasteuria parasitism was only evident at low nematode density levels and dissipates when their numbers get high

PAGE 116

116 ( Melki et al., 1998; Tateishi et al., 2007; Timper et al., 2001; Walia et al., 2005). The first approach is considered unrealistic and illogical to the farmers and will therefore be difficult to implement. The second approach may not be profitable and may take longer for the Pasteuria to reach suppressive levels, although this is the most natur al approach. The present study suggests that another way would be to induce the resurgence of nematode population by initial fumigation. Fumigants were demonstrated to be a significant disturbance in the population dynamics, causing populations to decline when applied and resurge when stopped. As seen in this study, the suppression of M. arenaria by P. penetrans was more evident in the previously fumigated than the nonfumigated plots. The induced high amplitude of the fluctuation of their population density could bring the M. arenaria population to a bottleneck level where strong stochastic events may act to cause their local extinction. Stable coexistence on the other hand is not a bad option either as this will keep the nematode and parasite populations f luctuating at low density levels.

PAGE 117

117 Table 3 1. Population densities of Meloidogyne arenaria race 1 and Pasteuria penetrans in plots that were nonfumigated or fumigated at the start of 2004 and 2005 peanut growing seasons. Year a Treatment N o of endospor es / J2 a No of endospore /g of soil b No J2/100 cm 3 of soil c % Encumbered J2 d % I nfected f emales e 2004 Control 7.4 a 197,568 84.7 b 49 a Chloropicrin 2.4 b 54,458 144.8 a 19 c 1,3 D 2.4 b 54,458 30.2 c 33 b 2005 Control 3.6 a 89,865 63.6 b 55 a Chloropicrin 0.5 b 14,034 152.1 a 22 a 1,3 D 1.4 b 30,578 51.6 b 47 b 2006 Control 3.5 0.1 a (0.2 8.2) 86,651 92 28 b (0 302) 58 7 a (0 85) 72 1.24 a (40 97) Chloropicrin 4.7 0.1 a (0.6 12.8) 128,199 365 63 a (61 772) 66 3 a (54 84) 70 1.42 a (37 90) 1,3 D 3.6 0.1 a (0.4 9.7) 89,865 526 87 a (77 1,238) 62 5 a (21 79) 65 1.95 a (27 100) 2007 Control 3.1 0.6 b (0.27.1) 74,265 29 9 b (6 98) 61 9 a (0 100) 85 0.97 a (62 100) Chloropicrin 6.8 1.7 a (2.3 18.4) 215,576 102 49 a (16 624) 58 11 a (0 96) 94 0.45 b (87 100) 1,3 D 5.9 1.1 a (2.0 13.8) 175,943 171 76 a (10 980) 63 10 a (0 93) 95 0.42 b (83 100) 2008 Control 1.5 0.3 b (0.1 3.7) 32,718 94 22 a (6 254) 64 6 a (30 100) 65 Chloro picrin 4.5 0.9 a (0.3 8.2) 120,832 28 12 b (2 146) 76 12 a (0 100) 78 1,3 D 3.4 0.5 a (0.26.1) 83,484 81 39 a (0 454) 69 11 a (0 100) 74

PAGE 118

118 Note: Chloropicrin and 1,3D were applied before the peanut season in 2004 and 2005. Samples were ta ken at the end of each peanut season for quantification of M. arenaria and P. penetrans Data f rom these seasons are from Kari uki and Dickson ( 2007) ; while data from 2006 to 2008 were gathered during the current study. Means of original data were presented but were transformed prior to analysis using log10 ( x +1) for endospore and secondstage juvenile (J2) counts and arcsin ( x ) for percent age encumbered J2. Means in a column (within the same year) followed by a common letter are not significantly different according to t test ( P 0.05). a Determined by bioassay method. Numbers are the means standard error of 12 replications (25 J2/replicate). b Calculated based on the linear regression equation: log ( y ) = 2.2765 log ( x ) + 2.9589; where x = mean number of endospores attached per secondstage juvenile ( J2 ) and y = number of endospores per gram of soil. c Counted from a suspension extracted by centrifug al flotation method. Numbers are the means standard error of 12 replications. d Percentage based on total number of J2 extracted from 100 c m3 of soil. Numbers are the means standard error of 12 replications. e Percentage based on 30 females from 20 g of roots enzymatically digested. No analysis was performed for 2008 data because of large variation in the number of females recovered from each plot, including zero in a few plots.

PAGE 119

119 Figure 3 1. Population dynamics of Meloidogyne arenaria and Pasteuria penetrans in plots that were nonfumigated or fumigated at the start of 2004 a nd 2005 seasons. A) In non fumigated plots. B) In plots fumigated with chloropicrin. C) In plots fumigated with 1,3D. (solid line s = M. arenaria; broken line s = P. penetrans ). 2003 2004 2005 2006 2007 2008 2009 No. endospores per J2 0 2 4 6 8 10 No. of J2/cm 3 of soil 0 100 200 300 400 500 600 2003 2004 2005 2006 2007 2008 2009 No. of endospores per J2 0 2 4 6 8 10 No. of J2/100 cm 3 of soil 0 100 200 300 400 500 600 Sampling period 2003 2004 2005 2006 2007 2008 2009 No. of endospores per J2 0 2 4 6 8 10 No. of J2/100 cm 3 of soil 0 100 200 300 400 500 600 A B C

PAGE 120

120 y = 1.0117x 0.2135 r2 = 0.94 log (No. of J2/100 cm 3 of soil + 1) 0 1 2 3 log (No. of encumbered J2 +1) 0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5 Figure 3 2. Relationship between Meloi dogyne arenaria second stage juvenile (J2) density in the soil and number that were encumbered with Pasteuria penetrans endospores.

PAGE 121

121 y = 0.2829x + 1.4076 r2 = 0.01 log (No. of endospores/J2 + 1) 0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 1.6 log (No.of encumbered J2 +1) 0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5 Figure 3 3. Relationship between Pasteuria penetrans endospore density in the soil and number of Meloidogyne arenaria second stage juvenile (J2) encumbered with endospores of the bacterial parasite.

PAGE 122

122 y = 0.0257x + 0.6310 r2= 0.005 log (No. of J2/100 cm 3 of soil +1) 0 1 2 3 Proportion of encumbered J2 0.0 0.2 0.4 0.6 0.8 1.0 1.2 Figure 3 4. Relationship between Meloidogyne arenaria second stage juvenile ( J2 ) density and proport ion that were encumbered with Pasteuria penetrans endospores.

PAGE 123

123 M. arenaria J2 density class midpoint (No. of J2/100 cm3 of soil) 77 232 387 542 696 851 1006 1161 Frequency of M. arenaria J2 20 40 60 80 Proportion of encumbered M. arenaria J2 0.0 0.2 0.4 0.6 0.8 Figure 3 5. Proportion of Meloidogyne arenaria second stage juvenile ( J2 ) encumbered with Pasteuria penetrans endospores at different density classes of t he nematode. (vertical bars = frequencies of M. arenaria J2 at each density class; dots = mean proportion of P. penetrans encumbered J2 at each density class).

PAGE 124

124 y = 1.657x + 3.8554 r2 = 0.9769 log (No. of endospores/J2) -1.0 -0.5 0.0 0.5 1.0 1.5 2.0 log (No. of endospores/g of soil) 0 1 2 3 4 5 6 7 8 Figure 3 6. Standard curve for estimating th e number of Pasteuria penetrans endospores per gram of soil based on the number of endospores attached per Meloidogyne arenaria second stage juvenile Attachment was performed using the bioassay method where 40 g soil was inoculated with P. penetrans endos pores such that the concentration would be 1 107 to 0 endospores/g of soil. For determination of the linear regression equation, only the inoculation levels that yielded attachment were included. Numbers were transformed using log ( x ) prior to obtaining the linear regression equation.

PAGE 125

125 No. of J2/100 cm3of soil 0 200 400 600 800 No. of endospores/J2 0 2 4 6 8 10 a: x o = 92; y o = 3.6 a b c c: x o = 526; y o = 3.6 b: x o = 365; y o = 4.7 Figure 3 7. Phase plane representation of Lotka Volterra simulation of Meloidogyne arenaria and Pasteuria penetrans population dynamics in nonfumigated and previously fu migated plots The initial values used in the simulation were treatment means for the number of secondstage juvenile per 100 cm3 of soil ( xo) and number of endospores per J2 ( yo) in 2006. a) In nonfumigated plots. b) In plots fumigated with chloropicrin. c) In plots fumigated with 1,3D.

PAGE 126

126 Figure 3 8. Time series representation of Lotka Volterra simulation of Meloidogyne arenaria and Pasteuria penetrans population dynamics in nonfumigated and previously fumigated plots The i nitial values used in the simulation were treatment means for the number of secondstage juvenile per 100 cm3 of soil ( xo) and number of endospores per J2 ( yo 0 200 400 600 800 1000 No. of J2/100 cm 3 of soil 0 100 200 300 400 500 No. of endospores per J2 0.0 2.0 4.0 6.0 8.0 x o = 365; y o = 4.7 Iteration period ( t ) 0 200 400 600 800 1000 1200 0 100 200 300 400 500 600 No. of endospores per J2 0.0 2.0 4.0 6.0 8.0 10.0 No. of J2/100 cm 3 of soilxo = 526; yo = 3.6 0 250 500 750 1000 1250 1500 No. of J2/100 cm 3 of soil 0 20 40 60 80 100 120 No. of endospores per J2 0.0 2.0 2.5 3.0 3.5 4.0 xo = 92; yo = 3.6 ) in 2006. A ) In nonfumigated plots. B ) In plots fumigated with chloropicrin. C ) In plots fumigate d with 1,3D. (solid lines = M. arenaria; broken lines = P. penetrans ). A C B

PAGE 127

127 CHAPTER 4 MOLECULAR DIFFERENTI ATION OF TWO POPULAT IONS OF PASTEURIA OCCURRING IN A PEANUT FIELD Introduction Pasteuria penetrans was reported to be the agent of soil suppressiveness against Meloidogyne arenaria race 1 in peanut fields in Georgia and Florida, USA ( Dickson et al., 1994; Minton and Sayre, 1989). The endospores, occurring in the soil as immobile and dormant structures, attach to the cuticle of the second stage juveniles ( J2), germinate and proliferate in the nematode pseudocoel. This bacterial parasite uses the nematode host metabolic system to produce about a million endospores (Darban et al., 2004) which are released into the soil upon deterioration of the host cadaver. The attachment of certain numbers of endospores on the cuticle of J2 can reduce their ability to move and penetrat e roots (Stirling, 1984; Sayre and Gherna, 1990; Davies et al., 1988; Kariuki et al., 2006) causing their premature death. Contrastingly those that successfully penetrate despite their encumberance by endospores fail to produce eggs (Mankau, 1980; Sayre, 1980; Sayre and Wergin, 1977) The reduction in survival and fecundity cause the decline in nematode populations, which becomes more evident in the succeeding generations (Brown et al., 1985; Davies et al., 1988). Surveys conducted in natural populations revealed different species of nematodes within the same site as being parasitized by Pasteuria. In Puerto Rico, it was found that both Pratyl enchus spp. and Meloidogyne spp. were infected with Pasteuria spp. (Vargas and Acosta, 1990) In England, J2 of Heterodera avenae and juveniles and adults of Pratylenchus sp. and Tylenchorynchus sp. were found infected with Pasteuria isolates with similar sizes (Davies et al., 1990). And lately, FrancoNavarro and Godinez Vidal (2008) reported several nematodes belonging to six genera and three orders being filled or encumbered with endospores of Pasteuria. These nematodes were spread across four sites in two localities in Mexico. In one of

PAGE 128

128 the sites, a pasture in Venustiano Carranza, they found 32 Pratylenchus and 9 Mesocriconema with Pasteuria endospores either filling their body or adhering to their cuticle s The diameters of the endospores and central bodies of these Pasteuria populations infecting various nematodes were 4.55 to 4.83 these reports, whether these nematodes occurring in the same sites were infected by one species or just merely sympatric populations of different species of Pasteuria. The possibility of a n isolate of a Pasteuria sp. infecting nematodes species belonging to another gen us is exemplified by P. penetrans B 4. This biotype was originally found infecting P. scribneri in Seminole Co., FL but attached at low rate to M. arenaria, M. java nica M. hapla, M incognita and P. brachyurus in a laboratory test that used spore water suspension method (Oostendorp et al., 1990). In another study, P. penetrans B 4 was propagated in M. incognita race 1 growing in tomato (Chen et al., 1997) It seemed unclear however, if indeed, the P. penetrans B 4 as used in the two studies cited were the same. Endos pores of P. penetrans B 4 were smaller in diameter compared with P. penetrans P 20 and P 100 in the first study (Oostendorp et al., 1990) but were wider than those produced by the two other biotypes after culturing in M. incognita in the second study (Chen et al., 1996). Unfortunately, attempts to further verify the seemingly inter generic infectivity of P. penetrans B 4 failed because P. scribneri with this Pasteuria could no longer be found from the original site (Dickson, per. comm.). Sorting of sympatric populations was first attempted using spore morphology and morphometrics as criteria. In sugarcane fields in South Africa, Spaull (1981) divided the Pasteuria diameter was found infecting Pratylenchus zeae Helicotylenchus dihystera and Meloidogyne

PAGE 129

129 incognita Scut ellonema and Xiphinema spp. The author speculated that the isolate found attaching to Discocriconemella mauritiensis and Tylenchulus sp. was of the small type while the one on Helicotylenchus krugeri Histotylenchus histoides and Rotylenchulus spp. belonged to the large type. In another study, Giblin Davis et al. (1990) observed sympatric populations of Pasteuria infecting five plant parasitic nematodes spread in different counties of south Florida. The nematode hosts and their occurrences were Belonolaimus longicaudatus Helicotylenchus microlobus and Meloidogyne spp. in Collier Co., B. longicaudatus Hoplolaimus galeatus Meloidogyne spp., and Tylenchorynchus annulatus in Broward Co. and H. microlobus and Meloidogyne spp. in Palm Beach Co. The bivariate scattergram and discriminant analysis of the endospore width, sporangium diameter and their ratios showed that the Pasteuria isolates belonged to six population clusters. Pasteuria populations belonging to two of these morphometric clusters were found infe cting H. galeatus. The authors also observed some endospore filled J2 of Meloidogyne spp., a rather unusual finding based on the common knowledge that in root knot nematodes, P. penetrans complete their life cycle only in adults (Sayre et al., 1988). Shar ma and Davies (1996) was the first one to sort out sympatric populations of Pasteuria occurring in India beyond morphological and morphometrics characters. In addition to the differences observed in those mentioned aspects, the two populations of Pasteuria, one infecting M. javanica and the other infecting Heterodera cajani differed also in antigenic ladder and molecular weight of the antigens following Western blot analysis using a polyclonal antibody raised against the whole endospores of both isolates. They suggested that the divergence of these two populations might have resulted from continuous cultivation in their respective hosts. They

PAGE 130

130 however, did not rule out the possibility that they were distinct and genetically isolated populations brought toget her by human activities. Recent sampling in an experimental site located in Marion Co., Florida used to evaluate P. penetrans as a biocontrol agent against M. arenaria in peanut, revealed ring nematodes with endospores on their cuticle and inside their body. A decade ago, Han et al. (1999) initially described an unknown population of Pasteuria from ring nematodes with measurements smaller than those of P. penetrans. That particular population did not attach to either M. incognita or M. arenaria, both hos ts of P. penetrans It is known that species of Pasteuria are specific (Davies et al., 2001) and therefore, it is very unlikely to find a species that will work against a wide range of taxonomically unrelated nematodes occurring altogether in a given field However, knowledge of the diversity of Pasteuria populations will allow assessment of the suppressive potential of the soil towards the different nematode species important to agricultural crops as any of them can be a major pathogen given the right host environment combinations. The study of microbial diversity and ecology had been constricted by the fact that a vast majority of naturally occurring microorganisms, which include various obligately symbiotic and parasitic bacteria like Pasteuria cannot be cultured (Liesack and Stackebrandt, 1992; Pace et al., 1986). Advancements in molecular biology however, have allowed us to side step this barrier and enabled researchers to study them by accessing genotypic information rather than the conventional phenot ypic characters (Farber, 1996). The use of nucleotide sequence data to assess species diversity is justified by the evolutionary genetics theory. This theory state s that organisms fall into distinct sequence clusters and that the average divergence of lin eages within the same cluster is smaller than that of lineages belonging to separate clusters ( Ambler, 1996; Cohan, 1994). The 16S rRNA gene has

PAGE 131

131 been so far very robust in inferring phylogenetic relationships among bacterial species ( Clarridge, 2004; Ibrah im et al. 1997) and was successfully used to detect and enumerate bacterial species such as Mycobacterium spp. (Briglia et al., 1996), Nitrobacter spp. (Degrange and Bardin, 1995), and Desulfomonile spp. (Fantroussi et al ., 1997) occurring in soil environment s Other studies however, presented some cases where the 16S rRNA gene appeared not variable enough to differentiate closely related species ( La Scola et al. 2003; Yamamoto and Harayama, 1998) and alternative ly proposed the analysis of the more diverg ent proteincoding genes (Palys et al., 1997). Examples of these proteincoding genes and the closely related bacterial species successfully resolved were pyk and ald for Bacillus globisporus and B. psychrophilus (Palys et al., 2000) and rpoB for species of Paenibacillus (da Mota et al., 20004, 2005). M olecular techniques have been only partially explored in studying Pasteuria diversity. On this note, early attempts done on P. penetrans even produced seemingly contradicting results. Anderson et al. (1999) found that P. penetrans P 20 and P 100 had an identical 16S rRNA gene sequence but in another study, Duan et al. (2003) detected a surprising level of sequence diversity among different populations of what was thought to be a single strain of P. penetrans P 20. The latter, however, was based on sequence analysis of DNA extracted from endospores in the soil and not from female Meloidogyne sp. cultured in a plant host (Duan et al., 2003). On the other hand, proteincoding genes may be more variable than the 16S rRNA gene. Single nucleotide polymorphisms were identified in spoIIAB sequences of P. penetrans P 20 and B 4 (Nong et al., 2007) while they were observed in several proteincoding genes of five populations of P. ramosa (Schmidt et al., 2008). These studies contributed significantly in identifying target genes for locating genetic variability but the task of utilizing these variations into a practical

PAGE 132

132 method that will sort out populations and species of Pasteuria remains to be done. The objectives of thi s study were to (i) sequence selected sporulation genes of ring nematode Pasteuria and (ii) develop species specific primers that will distinguish its from P. penetrans Materials and Methods Sources of Pasteuria I solates A total of three Pasteuria isolates were used to carry out this study: ring nematode Pasteuria (RNP), and P. penetrans P 20 and P 100. RNP infects Mesocriconema ornatum and was obtained from the University of Florida Plant Science Research and Education Unit, Citra, Marion Co., FL. Peanut cv. Georgia G reen was grown at the site, which was used for studying the population dynamics of P. penetrans and M. arenaria race 1. The soil at the site was classified as Arredondo fine sand with 92.7% sand, 3.9% silt, 3.4% clay; < 1% organic matter; pH 5.5. At the end of peanut growing season in 2006, a total of 60 soil core samples were collected using a coneshaped sampling tube (2.5cm diam., 20cm. deep) from 10 plots specifically identified from previous sampling to harbor Pasteuriainfected ring ne matodes. Fifteen 15 cm diam. clay pots were filled with this soil and planted with 4 week old Georgia G reen peanut seedlings. The pots were maintained in the greenhouse for 12 months and the nematodes were extracted using the sugar flotation technique (J enkins, 1964). Two hundred individual ring nematodes showing signs of Pasteuria infection were manually picked, and kept in distilled water in 1.5 ml siliconized microcentrifuge tube. Pasteuria structures which consisted of vegetative cells and endospores of various stages of development were released by manually crushing the nematode cadavers in the tube using a plastic pestle. To separate vegetative stages and endospores from nematode cuticle, the resulting suspension was filtered through a 20g macroporous mesh (Spectrum, CA ) fixed on a 13mm Swinnex disc holder (Millipore MA ) that was attached on a 5 ml syringe. The endospores were collected in a

PAGE 133

133 new 1.5ml siliconized tube, concentrated by centrifugation at 6,000g for 5 minutes, and stored a t 4oThe two biotypes of P. penetrans were included in this study in order to test the specificity of the primer to be designed. Endospores of the P 20 isolate of P penetrans were obtained from M arenaria race 1 infecting peanut in the same location as above. Galled peanut roots were collected during the harvest season of 2007, washed and cut into 2cm pieces. On the other hand, P. penetrans P 100 was propagated and then collected from a 45 day old tomato pot culture of M. javanica race 4 mai ntained in the greenhouse. For each of the root knot nematode isolates, a 50 g root samples was placed in a 250 ml beaker and incubated in 10% Rapidase Pomaliq 2F (Gist Brocades Pomaliq product number 7003A/DSM, Food Specialties USA, Menominee, WI), 50 mM Na OAc (pH 5.0), and 0.1% CaCl C until used. 2 DNA E xtraction and M ultiple S trand A mplif ication (MDSA) at ca. 50:50 v/v (Charnecki, 1997) at room temperature while shaking on an oscillating shaker at 200 rpm. Five milliliters of the solution was added per gram of roots. Roots were washed vigorously over stacked sieves with 600(30 mesh) nested over a sieve with 150pore openings (100 mesh) and sprayed with a heavy stream of tap water (Hussey, 1971). The suspension was examined under a dissecting microscope and 20 Pasteuriainfected females, identified by larger body size and pearly white color, were handpicked and smashed in a drop of distilled water on a glass slide for light microscopic examination. Endospores were collected and filtered in the same manner as described for RNP The method used for extracting DNA from ring nematode Pasteuria followed the methodology described by Tsai and Olson (1991) with a few modifications on the volume. The mixture of vegetative cells and endospores were pell eted by centrifugatio n at 6,000g for 10

PAGE 134

134 minutes. They were resuspended in 2 ml lysis solution (0.15 M NaCl, 0.1 M Na2EDTA, pH 8.0) containing 15 mg of lysozyme/ml and incubated in a 37oC water bath for 2 hours with agitation every 20 to 30 minutes. A 2 ml solution of 0.1 M NaC l, 10% sodium dodecyl sulfate, and 0.5 M Tris HCl pH 8.0 were added. The suspension was subjected to three cycles of freezing in 80oC liquid nitrogen and thawing in a 65oC water bath to release DNA from the endospores. After the freezethaw cycles, 0.5 ml of saturated phenol (0.1 M Tris HCl, pH 8.0) was added, after which, the suspension was shaken in a Vortex mixer briefly to obtain an emulsion and centrifuged at 6,000g for 10 minutes. The top 0.5 ml aqueous layer was transferred into a fresh microcentrif uge tube where 0.5 ml phenol and 0.5 ml chloroform mixture (chloroform/isoamyl alcohol ratio, 24:1) were added. The tube was inverted 10 times to mix the reagents and then centrifu ged at 10,000g for 10 minutes. The aqueous phase containing the DNA was coll ected carefully and transferred into a fresh microcentifuge tube. The DNA was precipitated by adding equal volume of chilled isopropanol and incubated at 20oC for at least 1 hour. The total DNA was recove red by centrifugation at 10,000g for 10 minutes and ai r dried for another 10 minutes. The DNA was HCl, pH 8.0, 0.5 M EDTA) and kept at 20oThe extraction of DNA from P. penetrans P 20 and P 100 isolates was performed using the bead beating method ( Ander son et al. 1999; Ebert et al. 1996) because the samples consisted mainly of mature endospores. The crude sample containing endospores was pelleted by centrifugation at 6,000g for 5 mixture was cen trifuged again at 10,000g UDSDS solution (8.9 M urea, 3.0 mM dithiothreitol, 2% w/v sodium dodecyl sulfate) and incubated at 60 C until used. oC for 2 hours to lyse Gram negative bacterial contaminants that might be present

PAGE 135

135 in the samples. The mixture was centrifuged at 10,000g of 10 mM Tris HCl, pH 7.0. The washing step was performed twice and after the final centrifugation, the pellet was resuspended and incubated for 30 minutes at 37o 2 equivalent volume or 250300 mg of 0.13 mmdiam. g lasperlen glass beads (Braun Biotech, phenol in TE buffer (pH 8.0) were added. Bead mill homogenization was performed using a high speed (5,000 rpm) bead beater for 2 minutes. The homog enate was centrifuged at 10,000 g was transferred to a fresh microcentrifuge tu be and added with the same volume of chloroform isoamyl alcohol (24:1 v/v). The mixture was shaken on a Vortex mixer and then centrifuged at 10,000g for 5 minutes. The top aqueous layer was transferred into a fresh microcentrifuge tube The tube was incubated at 20oDegenerate Primer D esign C for 1 hour and then washed with 70% ethanol, air dried, and Pasteuria isolates were all subjected to multiple strand displacement amplification (Nong et al., 2007) using the GenomiPhi kit following the manufacturers protocol. The final product was diluted 30 times with nuclease free water before used. Degenerate pr imers were designed to amplify portions of selected sporulation genes of RNP, namely spo0A sigF and spoIIAB. Nucleotide sequences of these genes for P. penetrans and P. ramosa were downloaded from GenBank and aligned using ClustalW. The primers were desi gned using GeneTool version 2.0 software (BioTools, Alberta, Canada) and degenerate positions were manually determined from the alignment. For sigE the degenerate primer F (5 AAGAAAATMAARCTWGCCACKTATGC 3) and

PAGE 136

136 R (5 MGGWACRTCCTTCTGTGTTTTCTC 3) was us ed (Schmidt et al., 2008). The sequences of the oligonucleotides and their expected product sizes are listed (Table 4 1 ) PCR A mplification of S porulation G enes Using the MSDA products as templates, the four genes were amplified by degenerate primers using the touchdown PCR protocol. This particular PCR protocol minimizes formation of false products by starting at slightly higher than the optimum annealing temperature, thereby favoring specific primer annealing. The temperature was gradually decreased per c ycle or every other cycle until the touchdown temperature is reached (Don et al., 1991). The reaction was recombinant Taq polymerase, PCR buffer, and 4 mM MgCl2, 0.4 mM each of dNTA, dNTC, dNTG and dNTT) (Biofree water. The reactions were carried out in a 96 well iCycler thermal cycler (Bio Rad Laboratories, CA) with the following temperature profile: initial denaturation for 90 seconds at 95oC; 21 cycles each of 30 seconds denaturation at 95oC, 30 seconds annealing at 58oC which was decreased by 0.5oC for every two cycles, and 45 seconds of elongation at 72oC. Anot her round consisted of 20 cycles for each step was run but only at 53oAgarose G el E lectrophoresis C annealing temperature. An additional elongation step was done for 10 minutes. The detection of PCR products was carried out by loading x TBE buffer) alongside a 100 bp DNA ladder (New England Biolabs, MA). After running, the gel was stained by soaking in 1% ethidium bromide solution for 20 minutes and destained by soaking in distilled water for 15 minutes. T he presence of amplification products with the right sizes was confirmed by view ing on a UV transilluminator.

PAGE 137

137 Cloning and S equencing of S porulation G enes of RNP The dominant bands appearing in agarose gels were excised and the DNA was extracted using QIAquick gel extraction kit (Qiagen, CA). The purified products were used as templates for another PCR reaction. The reaction components were the same as above. The thermal conditions were as follows: 4 minutes of initial denaturation at 95oC, 30 cycles each of 30 seconds denaturation at 95oC, 30 seconds annealing at 56oC, 30 seconds of extension at 72oThe fresh PCR products were cloned in a pCR4TOPO vector supplied in the TOPO TA cloning kit (Life Technologies, CA) following the manufacturers protocol. The products of the cloning reaction were then used to transform Escherichia coli competent c ells provided in the C. An extra extension step for 10 minutes was added in the protocol to make sure that the products would have the adenine overhang, a critical property for cloning. oThree cultures whose PCR reaction yielded the expected product size upon agarose gel electrophoresis were picked for culturing in 4 ml LB ampicillin broth. After 16 hours at 37 C for 1 hour and plated on Luria Bertani (LB) agar (per liter, 10 g bactotryptone, 5 g bactoyeast extract, 10 g NaCl, 15 g bactoagar, pH 7.0) amended with ampici were picked randomly for colony PCR, where the same protocol as described above was used except that the templates were live bacterial cells and the initial denaturation step was run for 10 minutes. The same colonies were correspondingly plated on LB ampicillin agar. oC, cells were har vested and the plasmids containing the cloned genes were extracted using QIAprep miniprep kit (Qiagen) following the manufacturers protocol. The products were sent to DNA Sequencing Core Laboratory of the University of Floridas Interdisciplinary Center f or Biotechnology Research. Sequencing was performed using the Sanger method with the vector primers T3 and F20.

PAGE 138

138 Specific Primer Design and Amplification The primer sequences were trimmed from the gene sequences obtained for RNP. The trimmed sequences were then uploaded in GeneTool version 2.0 (BioTools, Alberta, Canada). The entire length of the sequences was navigated for specific priming sites. When sites were located, sequences of P. penetrans for that gene was accessed from the GenBank and likewise eva luated for specific priming sites. Amplification of the selected sporulation gene was carried out using the specific primer and genomic DNA of RNP, P. penetrans P 20 and P 100 as templates. A negative control was free water was reaction volume consisted of the same reagents as above except that the primers used were specific for RNP and P. penetrans The specific primer sequences for both isolates are presented in Table 4.1. The PCR r eaction was run under the following conditions: 4 minutes of initial denaturation at 95oC, 30 cycles each of 30 seconds denaturation at 95oC, 30 seconds annealing at 56oC, 30 seconds of extension at 72oNucleotide Sequence Analysis C. The products were detected in the same manner as de s in the gel The partial nucleotide sequences of spo0A sigE sigF and spoIIAB of RNP were aligned with homologous sequences of P. penetrans and P. ram osa, Candidatus P. usgae, Bacillus spp., and Clostridium spp. with the use of ClustalX. Individual gene trees were constructed by Bayesian inference method using MrBayes software version 3.1.2 (Ronquist and Huelsenbeck, 2003). The analyses were run for 5,000,000 generations under the assumption that there were six nucleotide substitution categories and that rates vary from site to site following gamma distribution. A sample of 45,000 trees was taken after a 10% burnin. The resulting tree file was

PAGE 139

139 exporte d to TreeView software for visualization (Page, 1996). The degree of similarities among the gene sequences of Pasteuria isolates was determined using GeneTool version 2.0 (BioTools ). Results Amplification, Cloning and Sequencing of sigE sigF spoIIAB and spo0A The touchdown PCR yielded major products with the expected sizes (Fig. 4 1). Smears and few faint bands were evident in gels loaded with PCR products of spoIIAB sigE and spo0A while amplification products of sigF formed a single band. These dominan t bands conforming to the expected sizes were probable indications of successful amplification of target genes by the degenerate primers. The major bands were excised from the gel and the DNA extracted from the gel pieces. The cleaned DNA was then used as templates for cloning. The four sporulation genes of RNP were successfully cloned in E. coli cells. Once the gene sequences were obtained, the primer sequences were trimmed from both 5 and 3 ends. The resulting sequences for spo0A sigE sigF and spoIIA B had 356, 265, 133 and 161 bp, respectively. Partial G ene Sequences Analysis The Bayesian inference analysis placed RNP close to other species of Pasteuria (Fig. 4 2A D) Except for sigF the Pasteuria species formed a distinct subclade that was related to Bacillus spp. Their group however, was only strongly supported in sigE and not in spo0A and spoIIAB Also, the analysis did not provide a definitive relationship among lineages within the Pasteuria group as suggested by we ak to moderate branch supports In terms of sequence similarities, the sporulation gene sequences of RNP were more similar to P. penetr ans than to P. ramosa. The two isolates were 81.4, 85.2, 86.9 and 80.1% similar in their nucleotide sequences for spo0A, sigE sigF and spoIIAB respe ctively. Surprisingly, the sigE sequence of RNP was more similar to P. ramosa than Candidatus

PAGE 140

140 P. usgae. This was based on the alignment of their partial sequences consisted of 265 bp (Table 4 2). Species Specific Amplification of spo0A Evaluation of pa rtial sequences of each of the four sporulation genes for priming sites yielded negative results except for spo0A The newly sequenced spo0A gene of RNP was 356 bp long while that of P. penetrans had 783 bp (GenBank accession number: AJ550852). The two seq uences were aligned in ClustalW and the positions of the primers were indicated (Fig. 4 3). Based on P. penetrans numbering, the variable region between positions 376 and 588 of their sequences provided good specific priming sites. The forward primer for P penetrans was situated between positions 379 and 399 while that of RNP was located between positions 390 and 410 based on P. penetrans numbering. The reverse primer for each Pasteuria isolate occupied positions 567 to 587. The expected sizes of their amplification products were 203 and 198 for P. penetrans and RNP, respectively. The PCR gave positive results only if the DNA of the target Pasteuria isolate was used as template In agarose gel, the single band appeared near the 200 bp mark. The P. penetrans specific primer amplified both spo0A of isolates P 20 and P 100, while RNP specific primer amplified only spo0A of RNP. When the genomic DNA of nontarget isolate was used as the template, no amp lification was observed (Fig. 4 4). Discussion Bacterial end ospores are among the most durable biological entities known (Nicholson et al., 2000) Despite being able to withstand many physical and chemical extremes, they are formed not in response to these conditions but to nutritional limitations and cell populati on density in a process called endosporulation (Sonenshein, 2000). This process is believed to occur only among the g ram positive branch of eubacteria, also called the Firmicutes (Woose, 1987). In

PAGE 141

141 Bacillus subtilis this complex developmental process invol ves more than 150 gene products that are temporally and compartmentally expressed (Errington, 1993; Hilbert and Piggot, 2004; Ireton and Grossman, 1992). The regulatory processes in the sporulation pathways are believed to be conserved at least in sporulat ing species of Bacillus and Clostridium (Brown et al., 1994; Sauer et al., 1995). The genus Pasteuria belongs to the newly erected family Pasteuriaceae of the order Bacillales (Ludwig et al., 2008). To date, and pending the availability of full genome sequ ence of Pasteuria, there are only a handful of genes involved in sporulation based on its homology to those described in Bacillus that have been identified. Among them are the four genes included in this study. Spo0A is the main transcriptional regulatory protein that switches the cellular differentiation from vegetative growth to spore formation ( Fujita and Losick, 2005; Hoch, 1993; Olmedo et al., 1990). This gene was shown to be exclusively restricted within the endospore forming genera (Brown et al., 1994). By sequencing this gene, Trotter and Bishop (2003) provided the first molecular basis of the sporulating nature of P. penetrans Sigma factors direct the RNA polymerase to transcribe specific genes whose products lead to a series of morphological chan ges in the cell. In B. subtilis SigE and SigF, are activated in mother cell and forespores, respectively right after forespore formation. The products of the genes that SigE and SigF control are required during the engulfment of the forespore in a phagocy tic like manner that eventually result to the forespore being surrounded by two membranes with opposite polarity ( Hilbert and Piggot, 2004; Kroos et al., 1999; Preston et al., 2003). SpoIIAB is an anti sigma factor that binds to SigF, and therefore, is thought to be involved in compartmentalized gene expression (Duncan and Losick, 1993)

PAGE 142

142 Except for sigE these sporulation genes were sequenced, at least partially for the first time in a Pasteuria species other than P. ramosa and P. penetrans Phylogenetic ana lysis based on the sporulation genes placed RNP close to the other members of Pasteuria in a pattern resembling that of 16S rRNA phylogeny. Exception was observed in sigF tree where Pasteuria species formed a moderately supported but unresolved subclade wi th Bacillus spp. The sequence obtained for sigF however, is very short, consisted of only 133 bp and may not be sufficiently long to represent the polymorphism is this gene. Ring nematode Pasteuria and P. penetrans are phylogenetically distant based on their 16S rRNA sequence, but they may occur sympatrically as observed in a peanut field in Marion Co., FL. Distinguishing one from the other is important in ecological studies. SigE and spoIIAA/spoIIAB were more variable than 16s rRNA gene (Schmidt et al., 2008) and this was confirmed in the present study. For instance, RNP was found having only 80 to 87% similarity with P. penetrans at least on the segment of the four sporulation genes analyzed. The two isolates had 96.3% similarity based on partial 16S rRN A gene sequences (see Chapter 2). By targeting the more divergent genes, there is a higher probability that isolates can be separated using PCR based methods. In this study, variable sites within the S po0A gene segment were located that allowed the separat ion of RNP and P. penetrans using specific primers. The P. penetrans specific primer amplified the spo0A of both isolates P 20 and P 100 but not of RNP. Likewise, RNP specific primer only amplified RNP spo0A but not P 20 or P 100. The fact that P 20 and P 100 were both recognized by P. penetrans specific primer further reinforced the notion that they represent biotypes of the same species as suggested earlier (Preston et al., 2003). Nong et al. (2007) analyzed the sequences of spoIIAB of P. penetrans P 20 a nd B 4 and found sites containing

PAGE 143

143 single nucleotide polymorphism (SNP). In a similar study, Schmidt et al. (2008) reported that five distinct populations of P. ramosa also had single nucleotide variations in several sites. At the polypeptide level, they found that these SNPs did not alter the amino acid coded or if they did, the resulting amino acid has similar chemical properties thus, conserving the function of the protein. Such SNPs can only be detected by sequencing of individual biotypes and may not be enough to allow designing primers that will distinguish one from the other. A way by which such separation can be achieved was shown in this study and may be followed in separating other sympatrically occurring species of Pasteuria. This is the first at tempt to distinguishing species of Pasteuria by using sequence specific primers. Serological based approach has been used previously in both characterization and quantification of Pasteuria species (Preston et al., 2003; Schmidt et al., 2003). Different is olates and species of Pasteuria showed variations in Western blot profiles when subjected to monoclonal antibody raised against w hole spores of P. penetrans P 20 (Brito, 2002; Schmidt et al., 2008). Although useful in characterizing individual species, the subtle implication of using serological based method as described was that the epitope detected by the monoclonal antibody is shared by species of Pasteuria. Even P. ramosa whose host is distant to nematodes contain an epitope that was also recognized by the same monoclonal antibody (Schmidt et al., 2008). This broad recognition by the monoclonal antibody might limit its usefulness if the objective is to sort out mixed populations of Pasteuria in the soil. On the other hand, a PCR based detection method us ing specific primers may be more promising in this respect provided that the density of endospores of each population is large enough to supply DNA that is within the detection threshold.

PAGE 144

144 Table 4 1. Degenerate and isolate specific primer sequences used t o amplify spo0A sigE sigF and spoIIAB of ring nematode Pasteuria and Pasteuria penetrans Primer name Type Sequence (5 to 3) Expected product size spo0A Degenerate F NCAGGAGGAYACNACNCARCGTG 396 R TTNCCNCGATTCCANGCNACYTC sigE a Degenerate F AAGAAAATMAARCTWGCCACKTATGC 315 R MGGWACRTCCTTCTGTGTTTTCTC SigF Degenerate F ATCCGNYTNGTNTGGTCTGTNGTGC 158 R ARDATCATTGGNACNGCATANGTAGA spoIIAB Degenerate F GCRGTDACMAAKRSKRTKATYCAYGSCT 217 R CCATGAARTKTTCCATRATSAWAAAYCC spo0A RNP S pecific F AGCGCAAGGTGGGTTCGGTG 198 R TCGGCAATACGGGGATAAAGG spo0A Pp Specific F TTCCTAACCCCAGCGTACCA 203 R TCGGCAATGCGTGGGTAGAGC a Degenerate primer designed by Schmidt et al. (2008).

PAGE 145

145 Table 4 2. Nucleotide sequence similarities of fo ur sporulation genes of ring nematode Pasteuria and other Pasteuria species. Pasteuria species Nucleotide sequence similarity (%) a sigE (265) sigF (1 07 ) spo0A (35 6 ) spoIIAB (161) Pasteuria penetrans 84.9 86.9 81.4 80.1 Pasteuria ramosa 74.7 84.1 68.9 63.3 Candidatus Pasteuria usg a e 68.3 a The numbers in parenthesis after gene name represents the sizes in base pairs of the gene segments being compared.

PAGE 146

146 Figure 4 1. Touchdown PCR products using degenerate primers designed to amplify four sporulation genes of Pasteuria penetrans P 20 (Pp) and ring nematode Pasteuria (RNP). M = 100 bp molecular size standard. 100 300 200 500 bp 400 spoIIAB sigE sigF Spo0A Pp RNP Pp RNP Pp RNP Pp RNP M

PAGE 147

147 Fig. 4 2. Cladograms showing the position of ring nematode Pasteuria relative to other members of Pasteuria and species of Bacillus based on Bayesian analysis of partial sequences of four sporulation genes. A) spoIIAB B) spo0A. C) sig F D) sigE Sequences were aligned using ClustalX. The analyses were run for 5,000,000 generations under the nucleotide substitution model GTR+ Cladograms were generated by TreeView and rooted using Clostridium spp. Numbers at each node represents posterior probabilities. Accession numbers of nucleotide sequences from GenBank are in parentheses Pasteuria penetrans (28972535) Pasteuria infecting M. ornata 1.00 Pasteuria ramosa (93007305) 0.85 Bacillus subtilis (2627063) Bacillus cereus (47568124) 0.97 Clostridium cellulolyticum (118725125) Pasteuria infecting M. ornata Pasteuria penetrans (31338656) 0.87 Pasteuria ramosa (31338658) 0.50 Bacillus subtilis (51440550) 1.00 Bacillus cereus (152973854) Clostridium botulinum (148378011) 1.00 B A

PAGE 148

148 Figure 42. Continued Pasteuria penetrans (28972535) Pasteuria infecting M. ornata 1.00 Pasteuria ramosa (93007305) 0.85 Ba cillus subtilis (2627063) Bacillus cereus (47568124) 0.97 Clostridium cellulolyticum (118725125) D Bacillus thuringiensis (49476684) Bacillus anthracis (30260195) 1.00 Pasteuria penetrans P 100 Pasteuria infecting M. ornata 0.53 Pasteuria ramosa (93007305) 0.87 Paenibacillus polymyxa (2529 264) Clostridium cellulolyticum (118725125) 0.87 C

PAGE 149

149 Figure 4 3. Alignment of spo0A sequences of Pasteuria penetrans (Pp) and ring nematode Pasteuria (RNP) by ClustalW showing the location of the specific primers. Pp CAAATTATGGGCTATGTTTCCTTTTCCTCACCCCAGCGTACCATCGCTTCAGTAGC---416 RNP CAAATTACAGGTCATGTTTCCTTTTCCTCACCCCAGCGCAAGGTGGGTTCGGTGGCCGTG 131 ******* ** ************************* *** ** ** Pp --GCGTAAGCGTTCCGCCAATCTCGATGCTAGCATTACTAACGTGATCCACGAAATTGGT 474 RNP GCACGTAAGCGTTCTGCCAATTTGGATGCAAGTATTACCAATGTGATTCAGGAAATCGGT 191 *********** ****** ***** ** ***** ** ***** ** ***** *** Pp GTGCCCGCCCATATCAAGGGTTATCTTTATCTACGGGAGGCTATTGCCATGGTGTACAAT 534 RNP GTACCTGCGCATATCAAGGGTTACCTCTATCTGAGGGAAGCCATTGCTATGGTTTACAAC 251 ** ** ** ************** ** ***** **** ** ***** ***** ***** Pp GAGGTGGATCTGTTGGGGGCTATCACGAAAACGCTCTACCCACGCATTGCCGAAATGTAC 594 RNP GAGGTAGATTTATTGGGGGCCATCACCAAGACCCTTTATCCCCGTATTGCCGAGATGTAC 311 ***** *** ******** ***** ** ** ** ** ** ** ******** ******

PAGE 150

150 Figure 4 4. Species specific amplification of spo0A by PCR. A) With ring nematode Pasteuria (RNP) DNA as template. B) With Pasteuria penetrans P 20 and P 100 DNA as templates. Lane 1: RNP; Lane 2: P. penetrans P 20; Lane 3: P. pene trans P 100; Lane 4: negative control; M = 100 bp molecular size standard. 100 200 300 400 500 1,000 bp 1 2 3 4 M 1 2 3 4 M B B A A

PAGE 151

151 APPENDIX A 16S r RNA GENE SEQUENCES OF TWO CLONES OF RING NEMATODE Pasteuria (RNP) ALIGNED BY CLUSTALW RNP1 GACGAACGCTGGCGGCGTGCCTACTACATGCAAGTCGAGCGCGCACCCCTCGGGGTGCGA 60 RNP2 GACGAACGCTGGCGGCGTGCCTACTACATGCAAGTCGAGCGCGCACCCCTCGGGGTGCGA 60 ************************************************************ RNP1 GCGGCGGACGGGTGAGTAACACGTGGATAACTTACCCAGAAGACGGGGATTACCCCTGGA 120 RNP2 GCGGCGGACGGGTGAGTAACACGTGGATAACTTACCCAGAAGACGGGGATTACCCCTGGA 120 ************************************************************ RNP1 AACGGGGGTCAATACCGGATAAGCCTCTTGGATCGCATGATTCGGGTGGGAAAGGTGCTC 180 RNP2 AACGGGGGTCAATACCGGATAAGCCTCTTGGATCGCATGATTCGGGTGGGAAAGGTGCTC 180 ************************************************************ RNP1 TTGGGTGCCGCTTTTGGAGAGATCCGCGGCGCATTAGCTAGTTGGTAGGGTAAAGGCCTA 240 RNP2 TTGGGTGCCGCTTTTGGAGAGATCCGCGGCGCATTAGCTAGTTGGTAGGGTAAAGGCCTA 240 ************************************************************ RNP1 CCAAGGCGACGATGCGTAGCCGGCTTGGGAGAGCGGACGGCCACACTGGGACTGAGACAC 300 RNP2 CCAAGGCGACGATGCGTAGCCGGCTTGGGAGAGCGGACGGCCACACTGGGACTGAGACAC 300 ************************************************************ RNP1 GGCCCAGACTCCTACGGGAGGCAGCAGTAGGGAATTTTCCGCAATGGGCGAAAGCCTGAC 360 RNP2 GGCCCAGACTCCTACGGGAGGCAGCAGTAGGGAATTTTCCGCAATGGGCGAAAGCCTGAC 360 ************************************************************ RNP1 GGAGCGACGCCGCGTGGGTGAAGACGGCCTTCGGGTTGTAAAGCCCTGTTCATCGGGAAG 420 RNP2 GGAGCGACGCCGCGTGGGTGAAGACGGCCTTCGGGTTGTAAAGCCCTGTTCATCGGGAAG 420 ************************************************************ RNP1 AAGAAATGACGGTACCGGTGAAGAAAGCCCCGGCTAACTACGTGCCAGCAGCCGCGGTAA 480 RNP2 AAGAAATGACGGTACCGGTGAAGAAAGCCCCGGCTAACTACGTGCCAGCAGCCGCGGTAA 480 ************************************************************ RNP1 TACGTAGGGGGCGAGCGTTGTCCGGGATGATTGGGCGTAAAGGGCGTGTAGGCGGATACA 540 RNP2 TACGTAGGGGGCGAGCGTTGTCCGGGATGATTGGGCGTAAAGGGCGTGTAGGCGGATACA 540 ************************************************************ RNP1 TAGGTCGGGCGTGAAAGCCGCGGGCTCAACCCGTGTGAGCGTTCGAAACGGTGTGTCTTG 600 RNP2 TAGGTCGGGCGTGAAAGCCGCGGGCTCAACCCGTGTGAGCGTTCGAAACGGTGTGTCTTG 600 ************************************************************ RNP1 AGTACGGTAGAGGGAAGTGGAATTTCTGGTGTAGCGGTGGAATGCGTAGATATCAGAAGG 660 RNP2 AGTACGGTAGAGGGAAGTGGAATTTCTGGTGTAGCGGTGGAATGCGTAGATATCAGAAGG 660 ************************************************************ RNP1 AACACCGGTGGCGAAGGCGGCTTCCTGGACTGTTACTGACGCTGAGGCGCGAAGGCGTGG 720 RNP2 AACACCGGTGGCGAAGGCGGCTTCCTGGACTGTTACTGACGCTGAGGCGCGAAGGCGTGG 720 ************************************************************ RNP1 GGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCGGTAAACGATGACTGCTAGGTGTA 780 RNP2 GGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCGGTAAACGATGAGTGCTAGGTGTA 780 ************************************************ ***********

PAGE 152

152 RNP1 GGGATGCTCAGCATCTTTGTGCCGAAGGAAACCCATTAAGCACTCCGCCTGGGGAGTACG 840 RNP2 GGGATGCTCAGCATCTTTGTGCCGAAGGAAACCCATTAAGCACTCCGCCTGGGGAGTACG 840 ************************************************************ RNP1 GCCGCAAGGTTGAAACTCAAAGGAATTGACGGGGGCCCGCACAAGCGGTGGAGCATGTGG 900 RNP2 GCCGCAAGGTTGAAACTCAAAGGAATTGACGGGGGCCCGCACAAGCGGTGGAGCATGTGG 900 ************************************************************ RNP1 TTTAATTCGATGCAACGCGAAGAACCTTACCAAGGCTTGACATCCCGATGAAAGGCCCCG 960 RNP2 TTTAATTCGATGCAACGCGAAGAACCTTACCAAGGCTTGACATCCCGGTGAAAGGCCTCG 960 *********************************************** ********* ** R NP1 AGAGAGTGCCGTGCCCCCCTCGGGGGGAGCATCGGTGACAGGTGGTGCATGGTTGTCGTC 1020 RNP2 AGAGAGTGCCGTGCCCCCCTCGGGGGGAGCATCGGTGACAGGTGGTGCATGGTTGTCGTC 1020 ************************************************************ RNP1 AGCTCGTGTCGTGAGATGTTGGGTTCAGTCCCGCAACGAGCGCAACCCTTATCTCCGGTT 1080 RNP2 AGCTCGTGTCGTGAGATGTTGGGTTCAGTCCCGCAACGAGCGCAACCCTTATCTCCGGTT 1080 ************************************************************ RNP1 GCCAGCACGTAGAGGTGGGCACTTTGGAGAGACAGCCGGCGAAAGCCGGAGGAAGGCGGG 1140 RNP2 GCCAGCACGTAGAGGTGGGCACTTTGGAGAGACAGCCGGCGAAAGCCGGAGGAAGGCGGG 1140 ************************************************************ RNP1 GATGACGTCAAATCATCATGCCCCTTATGTCTTGGGCTACACACGTGCTACAATGGCCGT 1200 R NP2 GATGACGTCAAATCATCATGCCCCTTATGTCTTGGGCTACACACGTGCTACAATGGCCGT 1200 ************************************************************ RNP1 TACAAAGGGAAGCGAAGTCGTGAGGCGGAGCGGACCCCAAAAAAGCGGTCTCAGTTCGGA 1260 RNP2 TACAAAGGGAAGCGAAGTCGTGAGGCGGAGCGGACCCCAAAAAAGCGGTCTCAGTTCGGA 1260 ************************************************************ RNP1 TCGCAGGCTGCAACTCGCCTGCGTGAAGTAGGAATCGCTAGTAATCGCGGATCAGCATGC 1320 RNP2 TCGCAGGCTGCAACTCGCCTGCGTGAAGTAGGAATCGCTAGTAATCGCGGATCAGCATGC 1320 ************************************************************ RNP1 CGCGGTGAATACGTTCCCGGGCCT 1344 RNP2 CGCGGTGAATACGTTCCCGGGCCT 1344 ************************

PAGE 153

153 APPENDIX B PARTIAL NUCLEOTID E SEQUENCES OF SPORU LATION GENES spoIIAB spo0A sig E AND sig F OF RING NEMATODE Pasteuria IN FASTA FORMAT > spoIIAB ring nematode Pasteuria ATGGGGAACATGTTGGGGATAGGATGGTTCGCGTTTCTGTGGAAATAGAG GATGCACAGGTGGCCATCACTGTCACGGATCGGGGGGTGGGGATTGTAGA TGTGGAACGGGCT AGACAGCCGTTGTATACCTCTAAACCAGAATGGGAGC GGGCGGGGATG > spo0A ring nematode Pasteuria CGGTGGAGCTAGGTGCTTCCTATTACATTCTCAAACCCTTCGATCTTGATG TCCTCGTGGATCGTGTTCGGCAAATTACAGGTCATGTTTCCTTTTCCTCAC CCCAGCGCAAGGTGGGTTCGGTGGCCGTGGCACGTAAGCGTTCTGCCAAT TTGGATGCAAGTATTACCAATGTGATTCAGGAAATCGGTGTACCTGCGCA TATCAAGGGTTACCTCTATCTGAGGGAAGCCATTGCTATGGTTTACAACG AGGTAGATTTATTGGGGGCCATCACCAAGACCCTTTATCCCCGTATTGCC GAGATGTACAATACCACGGCGAGTCGGGTAGAACGTGCAATTCGGCATG CTATC > sigE ring nematode Pasteuria TTCAAGATGCATTGAGAACGAAATTTTGATGTTTTTACGTCGTAATAACA AAATTCGTTCTGAGGTTTCCTTCGATGAGCCCCTCAACATCGATTGGGAT GGTAATGAGCTGTTGCTTTCTGACGTCCTAGGTACAGAGAATGATACTAT TTATAGAGATATTGAGGATCAGGTAGATAAGCAAGTATTGCGCATGGCC CTCAGTACGCTCTCTGATCGTGAGCGAAAGATTGTTATTTTGCGCTTCGG TCTGGGTGGGGGGGAG > sigF ring nematode Pa steuria AGCGCTTTCTCAATCGTGGATATGATTCGGATGATATTTTTCAGATTGGT TGTATTGGTCTCCTTAAGGCCGTAGACAAATTCAATCTTGCTTATGATGT TAAATTT

PAGE 154

154 LIST OF REFERENCES Abdel Momen, S. M., and J. L. Starr. 1997. Damage function for three Meloidogyne species on Arachis hypogaea in Texas Journal of Nematology 29:478483. Adams, B. M., H. T. Banks, J. E. Banks, and J. D. Stark. 2005. Population dynamics models in plant insect herbivore pesticide interactions. Mathematical Biosciences 196:39 64. Adamson, M. L., and J. N. Caira. 1994. Evolutionary factors influencing the nature of parasite specificity. Parasitology 109:8595. Adiko, A., and S. R. Gowen. 1999. The parasitic activity of Meloidogyne incognita as affected by the dynamics of acquisition of Pasteuria penetrans spores. Nematologia Mediterranea 27:21 26. Afolabi, P., K. G. Davies, and P. S. O'Shea. 1995. The electrostatic nature of the spore of Pasteuria penetrans the bacterial parasite of root knot nematodes. Journal of Applied Microbiology 79: 244249. Ahmed, R. 1990. Studies on the efficacy of Pasteuria penetrans for the biological control of Meloidogyne species. Ph.D. dissertation, University of Reading, Reading, UK. Ahmed, R., and S. R. Gowen. 1991. Studies on infection of Meloidogyne spp. with isolates of Pasteuria penetrans Ne matologia Mediterranea 19:229233. Ali, N. I., I. A. Siddiqi, S. S. Shaukat, and M. J. Zaki. 2002. Nematicidal activity of some strains of Pseudomonas spp. Soil Biology and Biochemistry 34:10511058. Allen, E. K. 1981. The Leguminosae, A source book of characteristics, uses, and nodulation. Madison, WI : University of Wisconsin Press. Amann, R. I., C. Lin, R. Key, L. Montgomery, and D. A. Stahl. 1992. Diversity among Fibrobacter isolates: Towards a phylogenetic classification. Systematic and Applied Microbi ology 15:2331. Ambler, R. P. 1996. The distance between bacterial species in sequence space. Journal of Molecular Evolution 42:617630. Anderson, R. M., and R. M. May. 1982. Coevolution of hosts and parasites. Parasitology 85:411426. Anderson, J. M., J. F. Preston, D. W. Dickson, T. E. Hewlett, N. H. Williams, and J. E. Maruniak. 1999. Phylogenetic analysis of Pasteuria penetrans by 16S rRNA gene cloning and sequencing. Journal of Nematology 31:319325. Anonymous. 2007. Food and Agriculture Organization. Available: http://faostat.fao.org/site/567/default.aspx#ancor. Accessed 15 December 2008.

PAGE 155

155 Anonymous. 2008. USDA Crop Production 2007 Summary Available: http://usda.mannlib.cornell.edu/usda/nass/CropProdSu//2000s/2008/CropProdSu01112008.pdf Accessed 15 January 2009. Arcuri, E. F., M. Wiedmann, and K. J. Boor. 2000. Phylogeny and functional conservation of E in endospore forming bacteria. Microbiology 146:15931603. Atibalentja, N., B. P. Jakstys, and G. R. Noel. 2004. Life cycle, ultrastructure, and host specificity of the North American isolate of Pasteuria that parasitizes the soybean cyst nematode, Heterodera glycines Journal of Nematology 36:171180. Atibalentja, N., G. R. Noel, and L. L. Domier. 2000. Phylogenetic position of North American isolate of Pasteuria that parasitizes the soybean cyst nematode, Heterodera glycines as inferred from 16S rDNA sequence analysis. International Journal of Systematics and Evolutionary Microbiology 50:605613. Atibalentja, N., G. R. Noel, T. F. Liao, and G. Z. Gertner. 1998. Population changes in Heterodera glycines and its bacterial parasite Pasteuria sp. in natura lly infested soil. Journal of Nematology 30:8192. Baldwin, J. G. 1992. Evolution of cyst and noncyst forming Heteroderinae. Annual Review in Phytopathology 30:271290. Banks, J. E., L. K. Dick, H. T. Banks, and J. D. Stark. 2008. Time varying vital rates in ecotoxicology: Selective pesticides and aphid population dynamics. Ecological Modeling 210:155160. Bartlett, B. R. 1964. Integration of chemical and biological control. Pp. 489 514 in P. Debach, ed. Biological control of insect pests and weeds. New Yo rk, NY : Reinhold. Baudoin, M. 1975. Host castration as a parasitic strategy. Evolution 29:335352. Bekal, S., J. Borneman, M. S. Springer, R. M. GiblinDavis, and J. O. Becker. 2001. Phenotypic and molecular analysis of a Pasteuria strain parasitic to the sting nematode. Journal of Nematology 33:110115. Bendezu, I. F., and J. L. Starr. 2003. Mechanism of resistance to Meloidogyne arenaria in peanut cultivar COAN. Journal of Nematology 35:115118. Berryman, A. 2004. Limi ting factors and population regulation. Oikos 105:667670. Berryman, A. A., and P. Kindlmann. 2008. Population regulation and a general model. Pp. 5791 in A. A. Berryman and P. Kindlmann, eds. Population systems: A general introduction. The Netherlands: Springer. Bhattacharya, D., and G. S warup. 1988. Pasteuria penetrans, a pathogen of genus Heterodera, its effect on nematode biology and control. Indian Journal of Nematology 18:6170.

PAGE 156

156 Bird, A. F. 1988. A technique for staining the endospores of Pasteuria penetrans Revue de Nmatologie 11: 364365. Bird, A. F., and P. G. Brisbane. 1988. The influence of Pasteuria penetrans in field soils on the reproduction of root knot nematodes. Revue de Nmatologie 11:7581. Bishop, A. H., S. R. Gowen, B. Pembroke, and J. R. Trotter. 2007. Morphological a nd molecular characteristics of a new species of Pasteuria parasitic on Meloidogyne ardenensis Journal of Invertebrate Pathology 96:2833. Blok, V. C., M. Ehwaeti, M. Fargette, A. Kumar, M. S. Phillips, W. M. Robertson, and D. L. Trudgill, 1997. Evoluti on of resistance and virulence in relation to the management of nematodes with different biology, origins and reproductive strategies. Nematologica 43:113. Bongers, T., and H. Ferris. 1999. Nematode community structure as a bioindicator of environmental m onitoring. Tree 14:224228. Boots, M., and A. Sasaki. 2002. Parasite driven extinction in spatially explicit hostparasite systems. The American Naturalist 159:706713. Boyle, L. W. 1950. Several species of parasitic nematodes on peanuts in Georgia. Plant Disease Reporter 34:61 62. Briglia, M., R. I. L. Eggen, W. M. deVos, and J. D. van Elsas. 1996. Rapid and sensitive method for the detection of Mycobacterium chlorophenolicum PCP 1 in soil based on 16S rRNA gene targeted PCR. Applied and Environmental Mic robiology 62:14781480. Brito, J. A. 2002. Biochemical events during the development of Pasteuria penetrans within the pseudocoelom of Meloidogyne arenaria. Ph.D. dissertation, University of Florida, Gainesville, Florida. Brito, J. A., R. Kaur, R. Cetinta s, J. D. Stanley, M. L. Mendes, E. J. McAvoy, T. O. Powers, and D. W. Dickson. 2008. Identification and isozyme characterization of Meloidogyne spp. infecting horticultural and agronomic crops, and weed plants in Florida. Nematology 10:757766. Brown, S. M ., and D. Nordmeyer. 1985. Synergistic reduction in root galling by Meloidogyne javanica with Pasteuria penetrans and nematicides. Revue de Nmatologie 8:285286. Brown, S. M., J. L. Kepner, and G. C. Smart, Jr. 1985. Increased crop yields following appli cation of Bacillus penetrans to field plots infested with Meloidogyne incognita. Soil Biology and Biochemistry 17:483486. Brown, D. P., L. Ganova Raeva, B. D. Green, S. R. Wilkinson, M. Young, and P. Youngman. 1994. Characterization of spo0A homologues in diverse Bacillus and Clostridium species identifies a probable DNA binding domain. Molecular Microbiology 14:411426.

PAGE 157

157 Brzeski, M. W., P. A. Loof, and Y. E. Choi. 2002. Compendium of the genus Mesocriconema Andrssy, 1965 (Nematoda: Criconematidae). Nema tology 4:341360. Carius, H. J., T. L. Little, and D. Ebert. 2001. Genetic variation in a host parasite association: Potential for coevolution and frequency dependent selection. Evolution 55:11361145. Carneiro, R. M. D. G., L. F. G. De Mesquita, P. A. S. Cirotto, F. C. Mota, M. R. A. Almeida, and M. C. Cordeiro. 2007. The effect of sandy soil, bacterium dose and time on the efficacy of Pasteuria penetrans to control Meloidogyne incognita race 1 on coffee. Nematology 9:845851. Carneiro, R. M. D. G., M. F. A. dos Santos, M. R. A. Almeida, F. C. Mota, A. C. M. M. Gomes, and M. S. Tigano. 2008. Diversity of Meloidogyne arenaria using morphological, cytological and molecular approaches. Nematology 10:819834. Carneiro, R. M. D. G., M. S. Tigano, C. L. Jorge, A C. O. Teixeira, and M. C. Cordero. 2004. Selection and polymorphism of Pasteuria penetrans isolates in relation to Meloidogyne spp. from coffee. Nematology 6:3747. Carneiro, R. M. D. G., O. Randig, L. G. Freitas, and D. W. Dickson. 1999. Attachment of e ndospores of Pasteuria penetrans to male and juveniles of Meloidogyne spp. Nematology 1:267271. Catrenich, C. E., and W. Johnson. 1988. Virulence conversion of Legionella pneumophila: A one way phenomenon. Infection and Immunity 56:31213125. Cetintas, R ., and D. W. Dickson. 2004. Persistence and suppressiveness of Pasteuria penetrans to Meloidogyne arenaria race 1. Journal of Nematology 36:540 549. Cetintas, R., and D. W. Dickson. 2005. Distribution and downward movement of Pasteuria penetrans in field s oil. Journal of Nematology 37:155160. Cetintas, R., R. D. Lima, M. L. Mendes, J. A. Brito, and D. W. Dickson. 2003. Meloidogyne javanica on peanut in Florida. Journal of Nematology 35:433436. Charnecki, J. H. 1997. Pasteuria penetrans spore proteins: Pot ential function in attachment to Meloidogyne spp. M. S c thesis, University of Florida, Gainesville, Florida. Chen, Z. X., and D. W. Dickson. 1998. Review of Pasteuria penetrans : Biology, ecology and biological control potential. Journal of Nematology 30:313340. Chen, Z. X., D. W. Dickson, L. G. Freitas, and J. F. Preston. 1997a. Ultrastructure, morphology, and sporogenesis of Pasteuria penetrans Phytopathology 87:273283. Chen, Z. X., D. W. Dickson, D. J. Mitchell, R. McSorley, and T. E. Hewlett. 1997b. Suppression mechanisms of Meloidogyne arenaria race 1 by Pasteuria penetrans Journal of Nematology 29:1 8.

PAGE 158

158 Chen, Z. X., D. W. Dickson, R. McSorley, D. J. Mitchell, and T. E. Hewlett. 1996. Suppression of Meloidogyne arenaria race 1 by soil application of endospores of Pasteuria penetrans. Journal of Nematology 28:159168. Cheng, Y. H., and C. C. Tu. 1980. Identification of Meloidogyne arenaria of peanut in Taiwan. Journal of Agricultural Research of China 29:4753. Chindo, P., A. Emechebe, and P. Marley. 2006. Effect of initial population density of Pratylenchus brachyurus on maize. Archives of Phytopathology and Plant Protection 39:205208. Cho, M. R., D. W. Dickson, and T. E. Hewlett. 2005. Comparison of inoculation methods, Meloidogyne spp. and different host plants for production of Pasteuria penetrans Journal of Asia Pacific Entomology 8:297300. Choi, K., M. D. Burow, G. Church, G. B urow, A. H. Paterson, C. E. Simpson, and J. L. Starr. 1999. Genetics and mechanism of resistance to Meloidogyne arenaria in peanut germplasm. Journal of Nematology 31:283290. Christiansen, F. B., and T. M. Fenchel. 1977. Ecological studies, Vol. 20: Theories of populations in biologcal communities. Berlin: Springer Verlag. Ciancio, A. 1995a Phenotypic adaptations in Pasteuria spp. nematode parasites. Journal of Nematology. 27: 328338. Ciancio, A. 1995b. Density dependent parasitism of Xiphinema diversi caudatum by Pasteuria penetrans in naturally infested soil. Phytopathology 85:144149. Ciancio, A. 1996. Time delayed parasitism and density dependence in Pasteuria spp. and host nematode dynamics. Nematropica 26:251 (Abstr.). Ciancio, A. 2008. Modeling ne matodes regulation by bacterial endoparasites. Pp. 321337 in A. Ciancio and K. G. Mukerji, eds. Integrated management and biocontrol of vegetable and grain crops nematodes. The Netherlands: Springer. Ciancio, A., and G. Racuzzo. 1992. Observations on a P asteuria sp. parasitic in Tylenchulus s e mipenetrans Nematologica 38:403404 (Abstr.). Ciancio, A., and P. Qu n herv. 2000. Population dynamics of Meloidogyne incognita and infestation levels by Pasteuria penetrans in a naturally infested field in Martini que. Nematropica 30:7786. Cianc io, A., R. Mankau, and M. MundoOcampo. 1992. Parasitism of Helicotylenchus lobus by Pasteuria penetrans in naturally infested soil. Journal of Nematology 24:2935. Ciancio, A., V. Vega Farfan, E. Carbonell Torres, and G. Gr asso. 1998. Observations on a Pasteuria isolate parasitic on Hoplolaimus galeatus in Peru. Journal of Nematology 30:206210.

PAGE 159

159 Cianc i o, A., R. Bonsignore, N. Vovlas, and F. Lamberti. 1994. Host records and spore morphometrics of Pasteuria penetrans group par asites of nematodes. Journal of Invertebrate Pathology 63:260267. Clarridge, J. E., III. 2004. Impact of 16S rRNA gene sequence analysis for identification of bacteria on clinical microbiology and infectious disease. Clinical Microbiology Reviews 17:840862. Cobb, N. A. 1906. Fungus maladies of the sugar cane, with notes on associated insects and nematodes. 2nd ed. Honolulu, HI: Hawaiian Sugar Planters Association. Cohan, F. M. 1994. Genetic exchange and evolutionary divergence in prokaryotes. Trends in E cology and Evolution 9:175180. Cohen, E. 2006. Pesticide mediated homeostatic modulation in arthropods. Pesticide Biochemistry and Physiology 85:2127. Courtney, W. D., D. Polley, and V.I. Miller. 1955. TAF, an improved fixative in nematode technique. Pla nt Disease Reporter 39:570571. Crow, W. T., and A. S. Brammer. 2005. Sting Nematode, Belonolaimus longicaudatus Rau (Nematoda: Secernentea: Tylenchida: Tylenchina: Belonolaimidae: Belonolaiminae). Available: http://edis.ifas.ufl.edu/pdffiles/IN/IN39500.pdf. Accessed: 11 November 2008. Seget. 2009. Changes in bacterial diversity and community structure following pesticide addition to soil estimated by cultivation technique. Ecotoxicology 18:632642. da Mota, F. F., E. A. Gomes, E. Paiva, and L. Seldin. 2005. Assessment of the diversity of Paenibacillus species in environmental samples by a novel rpoB based PCR DGGE method. FEMS Microbiology Ecology 53: 317328. da Mota, F. F., E. A.Gomes, E. Paiva, A. S. Rosado, and L. Seldin. 2004. Use of rpoB gene analysis for identification of nitrogenfixing Paenibacillus species as an alternative to the 16S rRNA gene. Letters in Applied Microbiology 39:3440. Dabir, K. R., and T. Mateille. 2004. Soil texture and irrigation influence the transport and the development of Pasteuria penetrans a bacterial parasite of root knot nematodes. Soil Biology and Biochemistry 36:539543. Dabir, K. R., S. Ndiaye, D. Mounport, and T. Mateille. 2007. Relationships between abiotic soil factors and epidemiology of the biocontrol bacterium Pasteuria penetrans in a root knot nematode Meloidogyne javanicainfested f ield. Biological Control 40: 2229. Dabir, K. R., S. Ndiaye, J.L. Chotte, S. Fould, M. T. Diop, and T. Mateille. 2005. Influence of irrigation on the distribution and control of the nematode Meloidogyne javanica by the biocontrol bacterium Pasteuria penet rans in the field. Biology and Fertility of Soils 41: 205211.

PAGE 160

160 Darban, D. A., B. Pembroke, and S. R. Gowen. 2004. The relationship of time and temperature to body weight and numbers of endospores in Pasteuria penetrans infected Meloidogyne javanica females. Nematology 6:33 36. Darban, D. A., S. R. Gowen, B. Pembroke, and A. N. Mahar. 2005 a Development of Pasteuria penetrans in Meloidogyne javanica females as affected by constantly high vs fluctuating temperature in an in vivo system. Journal of Zhejiang Uni versity Science B 6:155157. Darban, D. A., M. A. Pathan, A. G. Bhatti, and S. A. Maitelo. 2005b. The effect of different initial densities of nematode ( Meloidogyne javanica) on the buildup of Pasteuria penetrans population. Journal of Zhejiang Universit y Science B 6:113118. Davies K. G., B. R. Kerry, and C. A. Flynn. 1988. Observations on the pathogenecity of Pasteuria penetrans a parasite of root knot nematodes. Annals of Applied Biology 112:491501. Davies, K. G., C. A. Flynn, V. Laird, and B. R. Ke rry. 1990. The life cycle, population dynamics and host specificity of a parasite of Heterodera avenae similar to Pasteuria penetrans Revue de Nmatologie 13:303309. Davies, K. G., J. A. Rowe, and V. M. Williamson. 2008. Inter and intra specific cuticl e variation between amphimictic and parthenogenetic species of root knot nematode ( Meloidogyne spp.) as revealed by a bacterial parasite ( Pasteuria penetrans ). International Journal for Parasitology 38:851859. Davies, K. G., M. Fargette, G. Balla, A. Daudi, R. Duponnois, S. R. Gowen, T. Mateille, M. S. Phillips, A. Sawadogo, C. Trivino, E. Vouyoukalou, and D. L. Trudgill. 2001. Cuticle heterogeneity as exhibited by Pasteuria spore attachment is not linked to the phylogeny of parthenogenetic root knot nema todes ( Meloidogyne spp.). Parasitology 122:111120. Davies, K. G., V. Laird, and B. R. Kerry. 1991. The motility, development and infection of Meloidogyne incognita encumbered with spores of the obligate hyperparasite Pasteuria penetrans Revue de Nmatologie 14:611618. De Bach, P. 1974. Biological Control of Natural Enemies. London: Cambridge University Press. De Ley, I. T., P. De Ley, A. Vierstraete, G. Karssen, M. Moens, and J. Vanfleteren. 2002. Phylogenetic analyses of Meloidogyne small subunit rRNA. Journal of Nematology 34:319327. Degrange, V., and R. Bardin. 1995. Detection and counting of Nitrobacter populations in soil by PCR. Applied and Environmental Microbiology 61:20932098. Dickson, D. W. 1985. Nematode diseases of peanut. Nematology Circula r No. 121. Florida Department of Agriculture and Consumer Services, Division of Plant Industry, Gainesville, Florida.

PAGE 161

161 Dickson, D. W. 1998. Peanut. Pp. 523566 in K. R. Barker, G. A. Pederson, and G. L. Windham, eds. Plant nematode interactions. Madison, WI: American Society of Agronomy. Dickson, D. W., and D. De Waele. 2005. Nematode parasites of peanut. Pp. 393436 in M. Luc, R. A. Sikora, and J. Bridge, eds. Plant parasitic nematodes in subtropical and tropical agriculture, 2nd ed. Wallingford, UK: CA B International. Dickson, D. W., and T. E. Hewlett. 1989. Effects of bahiagrass and nematicides on Meloidogyne arenaria on peanut. Supplement to the Journal of Nematology 21:671676. Dickson, D. W., and M. Oostendorp. 1990. Biological control of nematodes with Pasteuria spp. Nematology Circular No. 175, Florida Department of Agriculture and Consumer Services, Division of Plant Industry, Gainesville, Florida. Dickson, D. W., M. Oostendorp, R. M. GiblinDavis, and D. J. Mitchell. 1994. Control of plant parasitic nematodes by biological antagonists. Pp. 575601 in D. Rosen, F. D. Bennett, and J. L. Capinera, eds. Pest management in the subtropics. Biological control A Florida perspective. Andover, UK: Intercept. \ Dickson, D. W., J. F. Preston, R. M. GiblinDavis, G. R. Noel, D. Ebert, and G. W. Bird. 2008. Family Pasteuriaceae Laurent 1890AL. pas.teu.ri.ace.ae.N.L. gen. n. Pasteuria type genus of the family; suff. aceae ending denoting family; N.L. fem. Pl. n. Pasteuriaceae, the Pasteuria family. in B. Whi tman, ed. Bergys manual of systematic bacteriology. Bergys Manual Trust. (in press). Diomande, M., and M. K. Beute. 1981. Relation of Meloidogyne hapla and Macroposthonia ornata populations to Cylindrocladium black rot in peanuts. Plant Disease 65:339342. Doi, R. H. 1989. Sporulation and germination. Pp. 169215 in C. R. Harwood, ed. Bacillus London, UK: Plenum. Don, R. H., P. T. Cox, B. J. Wainwright, K. Baker, and J. S. Mattick. 1991. Touchdown PCR to circumvent spurious priming during gene amplif ication. Nucleic Acid Research 19:4008. Duan, Y. P., H. F. Castro, T. E. Hewlett, J. H. White, and A. V. Ogram. 2003. Detection and characterization of Pasteuria 16S rRNA gene sequences from nematodes and soils. International Journal of Systematic and Evol utionary Microbiology 53:105112. Duncan, L., and R. Losick. 1993. SpoIIAB is an anti factor that binds to and inhibits transcription by regulatory protein F from Bacillus subtilis Proceedings of the National Academy of Science 90:23252329. Dungan, R S., and S. R. Yates. 2003. Degradation of fumigant pesticides: 1,3Dichloropropene, methyl isothiocyanate, chloropicrin, and methyl bromide. Vadose Zone Journal 2:279286.

PAGE 162

162 Duponnois, R., M. Fargette, S. Fould, J. Thioulouse, and K. G. Davies. 2000. Diver sity of the bacterial hyperparasite Pasteuria penetrans in relation to the control of root knot nematodes ( Meloidogyne spp.) on Acacia holosericea Nematology 2:435442. Dutcher, J. D. 2007. A review of resurgence and replacement causing pest outbreaks in IPM. Pp. 2743 in A. Ciancio and K. G. Mukerji, eds. Integrated management and biocontrol of vegetable and grain crops nematodes. The Netherlands: Springer. Dykstra, M. J. 1993. A manual of applied techniques for biological electron microscopy. New York: P lenum Press. Ebert, D. 2008. Host parasite coevolution: Insights from the Daphniaparasite model system. Current Opinion in Microbiology 11:290301. Ebert, D., H. J. Carius, T. Little, and E. Decaestecker. 2004. The evolution of virulence when parasites cause host castration and gigantism. The American Naturalist 164:1932. Ebert, D., M. Lipsitch, and K. L. Mangin. 2000. The effect of parasites on host population density and extinction: Experimental epidemiology with Daphnia and six microparasites. American Naturalist 156:459477. Ebert, D., P. Rainey, T. M. Embley, and D. Scholz. 1996. Development, life cycle, ultrastructure and phylogenetic position of Pasteuria ramosa Metchnikoff 1888: Rediscovery of an obligate endoparasite of Daphnia magna Straus. Philo sophical Transactions of the Royal Society of London B 351:16891701. Eddaoudi, M, and M. Bourijate. 1998. Comparative assessment of Pasteuria penetrans and three nematicides for the control of Meloidogyne javanica and their effect on yields of successive crops of tomato and melon. Fundamental and Applied Nematology 21:113118. Eisenback, J. D., E. C. Bernard, J. L. Starr, T. A. Lee, Jr., and E. K. Tomaszewski. 2003. Meloidogyne haplanaria n. sp. (Nematoda: Meloidogynidae), a root knot nematode parasitizing peanut in Texas. Journal of Nematology 35:395403. El Borai, F. E., L. W. Duncan, and J. F. Preston. 2005. Bionomics of a phoretic association between Paenibacillus sp. and the entomopathogenic nematode Steinernema diaprepesi Journal of Nematology 37:1825. Errington, J. 1993. Bacillus subtilis sporulation: Regulation of gene expression and control of morphogenesis. Microbiology and Molecular Biology Reviews 57:133. Espaol, M., S. VerdejoLucas, K. G. Davies, and B. R. Kerry. 1997. Compatibility betwee n Pasteuria penetrans isolates and Meloidogyne populations from Spain. Biocontrol Science and Technology 7:219230. Esser, R. P., and N. E. El Gholl. 1993. Paecilomyces lilacinus a fungus that parasitizes nematode eggs. Nematology Circular No. 203, Florida Department of Agriculture and Consumer Services, Division of Plant Industry, Gainesville, FL.

PAGE 163

163 Fantroussi, S. E., J. Mahillon, H. Naveau, and S. N. Agathos. 1997. Introduction and PCR detection of Desulfomonile tiedjei in soil slurry microcosms. Biodegrad ation 8:125133. Farber, J. M. 1996. An introduction to the hows and whys of molecular typing. Journal of Food Protection 59:1091 1101. Ferris, H., H. S. DuVer nay, and R. H. Small. 1977. Development of a soil temperature database on Meloidogyne arenaria for a simulation model. Journal of Nematology 10:3942. Franco Navarro, F., and D. Godinez Vidal. 2008. Occurrence of Pasteuria forms from a biosphere reserve in Mexico. Nematropica 38:187194. Freitas, L. G., D. W. Dickson, D. P. Mitchell, and T. E. Hewlett. 2000a. Infectivity and suppression of Pasteuria penetrans to Meloidogyne arenaria race 1 in tomato following soil fumigation. Nematologia Brasileira 24:157 166. Freitas, L. G., D. J. Mitchell, D. W. Dickson, and D. O. Chellemi. 2000b. Soil solarization and organic amendment effects on Pasteuria penetrans Nematologia Brasileira 24:133 146. Fujita, M., and R. Losick. 2005. Evidence that entry into sporulation i n Bacillus subtilis is governed by a gradual increase in the level and activity of the master regulator Spo0A. Genes and Development 19:22362244. Galeano, M., S. VerdejoLucas, and A. Ciancio. 2003. Morphology and ultrastructure of a Pasteuria form parasi tic in Tylenchorhynchus cylindricus (Nematoda). Journal of Invertebrate Pathology 83:8385. Gammack, S. M., E. Patterson, J. S. Kemp, and K. Killham. 1992. Factors affecting the movement of microorganisms in soils. Pp. 263305 in G. Stotzky and J. M. Boll ag. Soil Biochemistry. New York, NY: Marcel Dekker. Garcia, R. M. 1976. Vertical distribution and survival of stages of Meloidogyne arenaria in Florida with peanut as a host crop. M. S c thesis, University of Florida, Gainesville, Florida. Giannakou, I. O ., B. Pembroke, S. R. Gowen, and K. G. Davies. 1997. Effects of longterm storage and above normal temperatures on spore adhesion of Pasteuria penetrans and infection of the root knot nematode Meloidogyne javanica. Nematologica 43:185192. Giblin Davis, R. M. 2000. Pasteuria sp. for biological control of the sting nematode, Belonolaimus longicaudatus in turfgrass. Pp. 408426 in J. M. Clark and M. P. Kenna, eds. Fate and management of turfgrass chemicals, American Chemical Society Symposium Series no. 743. New York, NY : Oxford University Press. Giblin Davis, R. M., D. S. Williams, S. Bekal, D. W. Dickson, J. A. Brito, J. O. Becker, and J. F. Preston. 2003. Candidatus Pasteuria usgae' sp. nov., an obligate endosparasite of the phytoparasitic nematode Belonolaimus longicaudatus International Journal of Systematics and Evolutionary Microbiology 53:197200.

PAGE 164

164 Giblin Davis, R. M., D. S. Williams, W. P. Wergin, D. W. Dickson, T. E. Hewlett, S. Bekal, and J. O. Becker. 2001. Ultrastructure and development of Pasteu ria sp. (S 1 strain), an obligate endoparasite of Belonolaimus longicaudatus (Nemata: Tylenchida). Journal of Nematology 33:227238. Giblin Davis, R. M., D. Williams, T. E. Hewlett, and D. W. Dickson. 1995. Development and host attachment studies using Pas teuria from Belonolaimus longicaudatus from Florida. Journal of Nematology 27:500 (Abstr.). Giblin Davis, R. M., L. L. McDaniel, and F. G. Bilz. 1990. Isolates of the Pasteuria penetrans group from phytoparasitic nematodes in bermudagrass turf. Supplement to the Journal of Nematology 22:750762. Gokta, N., and G. Swarup. 1988. On the potential of some bacterial biocides against root knot and cyst nematodes. Indian Journal of Nematology 18:152153. Golden, A. M. 1990. Preparation and mounting nematodes for microscopic observation. Pp. 197205 in B. M. Zuckerman, W. F. Mai, and L. R. Krusberg, eds. Plant nematology laboratory manual. Amherst, MA: University of Massachusetts Agricultural Experiment Station. Grosso, N. R., and C. A Guzman. 1995. Chemical composition of aboriginal peanut ( Arachis hypogaea L.) seeds from Peru. Journal of Agricultural and Food Chemistry 43:102105. Gubbins, S., and C. A. Gilligan. 1997. Persistence of host parasite interactions in a disturbed environment. Journal of Theoretical B iology 188:241258. Guindon, S., and O. Gascuel. 2003. A simple, fast and accurate algorithm to estimate large phylogenies by maximum likelihood. Systematic Biology 52:696704. Hagstr m, A., T. Pommier, F. Rohwer, K. Simu, W. Stolte, D. Svenson, and U. L. Zweifel. 2002. Use of 16S ribosomal DNA for delineating of marine bacterioplankton species. Applied and Environmental Microbiology 68:36283633. Hall, S. R., C. Becker, and C. E. Cceres. 2007. Parasitic castration: A perspective from a model of dynamic en ergy budgets. Integrative and Comparative Biology 47:295309. Hammons, R. O. 1982. Origin and early history of the peanut. Pp. 120 in H. E. Pattee and C. T. Young, eds. Peanut Science and Technology. Yoakum, TX: American Peanut Research and Education Soc iety. Han, S. C., T. E. Hewlett, and D. W. Dickson. 1999. Pasteuria sp. parasitizing Criconemella sp. in Florida. Journal of Nematology 31:539 (Abstr.). Haraguchi, Y., and A. Sasaki. 2000. The evolution of parasite virulence and transmission rate in a spat ially structured population. Journal of Theoretical Biology 203:8596. Hardin, M. R., B. Benrey, M. Coll, W. O. Lamp, G. K. Roderick, and P. Barbosa. 1995. Arthropod pest resurgence: An overview of potential mechanisms. Crop Protection 14:318.

PAGE 165

165 Hartman, R. M., and J. N. Sasser.1985. Identification of Meloidogyne species on the basis of differential host test and perineal pattern morphology. Pp. 6977 in K. R. Barker, C. C. Carter, and J. N. Sasser, eds. An advanced treatise on Meloidogyne Vol. 2, Methodology. Raleigh, NC: North Carolina State University Graphics. Hatz, B., and D. W. Dickson. 1992. Effect of temperature on attachment, development, and interactions of Pasteuria penetrans on Meloidogyne incognita. Journal of Nematology 24:512521. Hewlett, T. E., and D. W. Dickson. 1993. A centrifugation method for attaching endospores of Pasteuria spp. to nematodes. Supplement to the Journal of Nematology 25:785788. Hewlett, T. E., J. F. Gerber, and K. S. Smith. 2004. In vitro culture of Pasteuria penetrans Pp. 175185 in R. Cook and D. J. Hunt, eds. Nematology M onographs and P erspectives vol. 2: Proceedings of the Fourth International Congress of Nematology; 8 13 June 2002, Tenerife, Spain. Hilbert, D. W., and P. J. Piggot. 2004. Compartmentalization of gen e expression during Bacillus subtilis spore formation. Microbiology and Molecular Biology Reviews 68:234262. Hilborn, R. 1975. The effect of spatial heterogeneity on the persistence of predator prey interactions. Theoretical Population Biology 8:346355. Hildalgo Diaz, L., and B. R. Kerry. 2008. Integration of biological control with other methods of nematode management. Pp. 2949 in A. Ciancio and K. G. Mukerji, eds. Integrated management and biocontrol of vegetable and grain crops nematodes. The Netherla nds: Springer Hixon, M. A., S. W. Pacala, and S. A. Sandin. 2002. Population regulation: Historical context and contemporary challenges of open vs. closed systems. Ecology 83:14901508. Hoch, J. A. 1993. Regulation of the phosphorelay and the initiation of sporulation in Bacillus subtilis Annual Review of Microbiology 47:441465. Holbrook, C. C., P. Timper, A. K. Culbreath, and C. K. Kvien. 2008. Registration of Tifguard peanut. Journal of Plant Registrations 2:9294. Hornberger, G. M., A. L. Mills, and. L. Herman. 1992. Bacterial transport in porous media: Evaluation of a model using laboratory observations. Water Resource Research 28:915938. Hussey, R. S. 1971. A technique for obtaining quantities of living Meloidogyne females. Journal of Nematology 3 :99100. Hussey, R. S., and K. R. Barker. 1973. A comparison of methods of collecting inocula of Meloidogyne spp., including a new technique Plant Disease Reporter 57: 10251028. Hussey, R. S., and C. W. Mims. 1991. Ultrastructure of feeding tubes formed in giant cells induced in plants by the root knot nematode Meloidogyne incognita. Protoplasma 162:99107.

PAGE 166

166 Ibekwe, A. M., S. K. Papiernik, J. Gan, S. R. Yates, C. Yang, and D. E. Crowley. 2001. Impact of fumigants on soil microbial communities. Applied and Environmental Microbiology 67:32453257. Ibrahim, A., W. Liesack, A. G. Steigerwalt, D. J. Brenner, E. Stackebrandt, and R. M. RobinBrowne. 1997. A cluster of atypical Yersinia strains with a distinctive 16S r R NA signature. FEMS Microbiology Letters 146:7378. Ibrahim, I. K. A., and M. A. El Saedy. 1976. Plant parasitic nematodes associated with peanuts in Egypt. Egyptian Journal of Phytopathology 8:3135. Ingham, E. G., and Rodrguez Kbana, R. 1980. Nematodes parasitic on peanut in Alabama and evaluation of methods for detection and study of population dynamics. Nematropica 10:21 30. Inserra, R. N., M. Oostendorp, and D. W. Dickson. 1992. Pasteuria sp. parasitizing Trophonema okamotoi in Florida. Journal of Nematology 24:3639. Ireton, K., and A. D. Gross man. 1992. Coupling between gene expression and DNA synthesis early during development in Bacillus subtilis Proceedings of the National Academy of Science 89:88088812. Itoh, K., M. Takahashi, R. Tanaka, K. Suyama, and H. Yamamoto. 2000. Effect of fumiga nts on soil microbial population and proliferation of Fusarium oxysporum inoculated into fumigated soil. Journal of Pesticide Science 25:147149. Jaffee, B. A., and E. I. Zehr. 1982. Parasitism of the nematode Criconemella xenoplax by the fungus Hirsutella rhossiliensis. Phytopathology 72:13781381. Jaffee, B. A., J. T. Gaspard, and H. Ferris. 1989. Density dependent parasitism of the soil borne nematode Criconemella xenoplax by the nematophagous fungus Hirsutella rhossiliensis Microbial Ecology 17:193200. Jaffee, B. A., A. P. Nyczepir, and A. M. Golden. 1987. Criconemella spp. in Pennsylvania peach orchards with morphological observations of C. curvata and C. ornata. Journal of Nematology 19:420423. Javed, N., H. U. Khan, Z. Hussein, and M. Ashfaq. 2002. Effect of temperature, soil pH, agitation intervals and soil types on the spore attachment of Pasteuria penetrans to root knot nematode, Meloidogyne javanica. Pakistan Journal of Plant Pathology 1:66 67. Javed, N., S. El Hassan, S. Gowen, B. Pembroke, a nd M. Inam ul Haq. 2008. The potential of combining Pasteuria penetrans and neem ( Azadirachta indica) formulations as a management system for root knot nematodes on tomato. European Journal of Plant Pathology 120:5260. Jenkins, W. R. 1964. A rapid centrif ugal flotation technique for separating nematodes from soil. Plant Disease Reporter 48:692.

PAGE 167

167 Jensen, K. H., T. Little, A. Skorping, and D. Ebert, 2006. Empirical support for optimal virulence in a castrating parasite. PLOS Biology 4:12651269. Johnson, A. W., C. C. Dowler, and Z. A. Handoo. 2000. Population dynamics of Meloidogyne incognita, M. arenaria, and other nematodes and crop yields in rotations of cotton, peanut, and wheat under minimum tillage. Journal of Nematology 32:5261. Jones, M. G. K., and D H. Northcote. 1972. Multinucleate transfer cells induced in coleus roots by the root knot nematode Meloidogyne arenaria. Protoplasma 75:381395. Kaltz, O., and J. A. Shykoff. 1998. Local adaptation in host parasite systems. Heredity 81:361370. Kaplan, D T. 1994. Partial characterization of a Pasteuria sp. attacking the citrus nematode, Tylenchulus semipenetrans in Florida. Fundamental and Applied Nematology 17:509512. Kaprovickas, A. 1969. The origin, variability, and spread of the groundnut ( Arachis hypogaea). Pp. 427441 in P. J. Ucko and J. W. Dimbleby, eds. The domestication and exploitation of plants and animals. Chicago, IL: Aldine. Kariuki, G. M. 2006. Management of soil suppressiveness to peanut root knot nematode using Pasteuria penetrans Ph.D. dissertation, University of Florida, Gainesville, Florida. Kariuki, G. M., and D. W. Dickson. 2007. Transfer and development of Pasteuria penetrans Journal of Nematology 39:5561. Kariuki, G. M., J. A. Brito, and D. W. Dickson. 2006. Effects of Pasteur ia penetrans endospore rate of attachment on root penetration and fecundity of Meloidogyne arenaria race 1. Nematropica 36:261 268. Karssen, G. 2002. The plant parasitic nematode genus Meloidogyne Gldi, 1892 (Tylenchida) in Europe. Leiden, The Netherlands : Koninklijke Brill NV. Karssen, G., and T. van Hoenselaar. 1998. Revision of the genus Meloidogyne Gldi, 1892 (Nematoda: Heteroderidae) in Europe. Nematologica 44:713788. Khan, A., K. L. Williams, and H. K. M. Nevalainen. 2006. Control of plant parasiti c nematodes by Paecilomyces lilacinus and Monacrosporium lysipagum in pot trials. Biocontrol 51:643658. Khan, Z., Y. H. Kim, S. G. Kim, H. W. Kim. 2007. Observations on the suppression of root knot nematode ( Meloidogyne arenaria) on tomato by incorporation of cyanobacterial powder ( Oscillatoria chlorina ) into potting field soil. Bioresource Technology 98:6973. Khan, Z., S. D. Park, S. Y. Shin, S. G. Bae, I. K. Yeon, and Y. J. Seo. 2005. Management of Meloidogyne incognita on tomato by root dip treatment in culture filtrate of the blue green alga, Microcoleus vaginatus Bioresource Technology 96:13381341.

PAGE 168

168 Kloepper J. W., R. Rodrguez Kbana, J. A. McInroy, and R. W. Young. 1992. Rhizosphere bacteria antagonistic to soybean cyst ( Heterodera glycines ) and r oot knot ( Meloidogyne incognita) nematodes: Identification by fatty acid analysis and frequency of biological control activity. Plant and Soil 139:7584. Kluepfel, D. A., A. P. Nyczepir, J. E. Lawrence, W. P. Wechner, and B. Leverentz. 2002. Biological con trol of the phytoparasitic nematode Mesocriconema xenoplax on peach trees. Journal of Nematology 34:120123. Ko, M. P., E. C. Bernard, D. P. Schmitt, and B. S. Sipes. 1995. Occurrence of Pasteurialike organisms on selected plant parasitic nematodes of pin eapple in the Hawaiian Islands. Journal of Nematology 27:395408. Koenning, S. R., and K. R. Barker. 1992. Relative damage functions and reproductive potentials of Meloidogyne arenaria and M. hapla on peanut. Journal of Nematology 24:187192. Koenning, S. R., J. E. Bailey, D. P. Schmitt, and K. R. Barker. 1998. Management of plant parasitic nematodes on peanut with selected nematicides in North Carolina. Supplement to the Journal of Nematology 30:643650. Kokalis Burelle, N., D. M. Porter, R. Rodrguez K bana, D. H. Smith, and P. Subrahmanyam, eds. 1997. Compendium of peanut diseases. 2nd ed. St. Paul, MN: The American Phytopathological Society. Kroos, L., B. Zhang, H. Ichikawa, and Y. T. N. Yu. 1999. Control of factor activity during Bacillus subtilis sporulation. Molecular Microbiology 31:12851294. La Scola, B., Z. Zeaiter, A. Khamis, and D. Raoult. 2003. Gene sequencebased criteria for species definition in bacteriology: The Bartonella paradigm. Trends in Microbiology 11:318321. Lajeunesse, M. J. and M. R. Forbes. 2001. Host range and local parasite adaptation. Proceedings of the Royal Society 269:703710. Lamberti, F. 1981. Plant nematode problems in the Mediterranean region. Helminthological Abstract Series B 59:145 166. Lane, D. J. 1991. 16S/23S rRNA sequencing. Pp. 115176 in E. Stackebrandt and M. Goodfellow, eds. Nucleic acid techniques in bacterial systematics. Chichester, UK: John Wiley. Liesack, W., and E. Stackebrandt. 1992. Unculturable microbes detected by molecular sequences and probe s. Biodiversity and Conservation 1:1250262. Little, T. J., K. Watt, and D. Ebert. 2006. Parasite host specificity: Experimental studies on the basis of parasite adaptation. Evolution 60:3138. Lockhart, P. J., M. A. Steel, M. D. Hendy, and D. Penny. 1994. Recovering evolutionary trees under a more realistic model of sequence. Molecular Biology and Evolution 11:605612.

PAGE 169

169 Loof, P. A. A., and A. De Grisse. 1967. Re establishment of the genus Criconemoides Taylor, 1936 (Nematoda: Criconematidae). Mededelingen R ijksfaculteit Landbouwwetenschappen Gent 32: 466475. Loof, P. A. A., and A. De Grisse. 1989. Taxonomic and nomenclatorial observations on the genus Criconemella De Grisse and Loof, 1965 sensu Luc and Raski, 1981. Mededelingen Faculteit Landbouwwetenschappen Rijksuniversiteit Gent 54:5374. Lordello, A. I. L., and M. Gerin. 1981. Nematoide javanes parasitando raizes e nodules de amendoim. Revista de Agricultura Piracicaba 56:278. Lotka, A. J. 1925. Elements of physical biology. Baltimore, MD: Williams and W ilkins. Luc, M., A. R. Maggenti, and R. Fortuner. 1988. A reappraisal of Tylenchina (Nemata). 9. The family Heteroderidae Filipjev and Schuurmans Stekhoven, 1941. Revue de Nmatologie. 11:15976. Ludwig, W., K. H. Schleifer, and W. B. Whitman. 2008. Revise d road map to the phylum Firmicutes. in P. De Vos, G. Garrity, D. Jones, N. R. Krieg, W. Ludwig, F. A. Rainey, K. H. Schleifer, and W.B. Whitman, eds. Bergey's manual of systematic bacteriology, vol. 3, 2nd ed. New York, NY: Springer Verlag. In Press. Ly mberry, A. J. 1989. Host specificity, host range and host preference. Parasitology Today 5:298. Ma, H., R. M. Overstreet, and S. A. Subbotin. 2008. ITS2 secondary structure and phylogeny of cyst forming nematodes of the genus Heterodera (Tylenchida:Hetero deridae). Organisms, Diversity and Evolution 8:182193. Machmer, J. H. 1951. Root knot of peanut. I. Distribution. Plant Disease Reporter 35:364366. Machmer, J. H. 1953. Criconemoides sp., a ring nematode associated with peanut yellows. Plant Disease Reporter 37:156. Madamba, C. P., E. N. Camaya, D. B. Zenarosa, and H. M. Yater. 1999. Screening soil bacteria for potential biocontrol agents against the root knot nematode, Meloidogyne spp. The Philippine Agriculturist 82:113122. Mankau, R. 1975a Prokar yote affinities of Duboscqia penetrans Thorne. Journal of Protozoology 21:3134. Mankau, R. 1975b. Bacillus penetrans n. comb. causing a virulent disease of plant parasitic nematodes. Journal of Invertebrate Pathology 26:333339. Mankau, R. 1980. Biologic al control of nematode pests by natural enemies. Annual Review of Phytopathology 18:415440.

PAGE 170

170 Mankau, R., and N. Prasad. 1972. Possibilities and problems in the use of a sporozoan endoparasite for biological control of plant parasitic nematodes. Nematropica 2:78. Mankau, R., and N. Prasad. 1977. Infectivity of Bacillus penetrans in plant parasitic nematodes. Journal of Nematology 9:4045. Martikainen, E., J. Haimi, and J. Ahtiainen. 1998. Effects of dimethoate and benomyl on soil organisms and soil processe s A microcosm study. Applied Soil Ecology 9:381387. Martin, G. C. 1958. Root knot nematodes ( Meloidogyne spp.) in the Federation of Rhodesia and Nyasaland. Nematologica 3:332349. Mateille, T., S. Fould, K. R. Dabir, M. T. Diop, and S. Ndiaye. 2009. Spatial distribution of the nematode biocontrol agent Pasteuria penetrans as influenced by its soil habitat. Soil Biology and Biochemistry 41:303 308. McSorley, R., D. W. Dickson, E. M. CandaneroLay, T. E. Hewlett, and J. J. Frederick. 1992. Damage functions for Meloidogyne arenaria on peanut. Journal of Nematology 24:193198. Melki, K. C., I. O. Giannokou, B. Pembroke, and S. R. Gowen. 1998. The cumulative buildup of Pasteuria penetrans spores in root knot nematodes infested soil and the effect of soil app lied fungicide on its infectivity. Fundamental and Applied Nematology 21:679683. Mendoza de Gives, P., K. G. Davies, M. Morgan, and J. M. Behnke. 1999. Attachment tests of Pasteuria penetrans to the cuticle of plant and animal parasitic nematodes, free living nematodes and srf mutants of Caenorhabditis elegans. Journal of Helminthology 73:6771. Metchnikoff, E. 1888. Pasteuria ramosa, un representant des bactries division longitudinale. Annales de l'Institut Pasteur 2:165170. Meyer, S. L. F. 2003. Unit ed States Department of Agriculture Agricultural Research Service research programs on microbes for management of plant parasitic nematodes. Pest Management Science 59:665 670. Micoletzky, H. 1925. Die freilebenden Susswasser und Moornematoden Danemarks. Copenhagen: Host and Son. Minton, N. A. 1984. Nematode parasites of peanut. Pp. 373394 in W. R. Nickle, ed. Plant and insect nematodes. New York, NY : Marcel Dekker. Minton, N. A., and D. K. Bell. 1969. Criconemoides ornatus parasitic on peanuts. Journal of Nematology 1:349351. Minton, N. A., and P. Baujard. 1990. Nematode parasites of peanuts. Pp. 285320 in M. Luc, R. A. Sikora, and J. Bridge, eds. Plant parasitic nematodes in tropical and subtropical agriculture. Wallingford, UK: CAB International.

PAGE 171

171 Mi nton, N. A., and R. M. Sayre. 1989. Suppressive influence of Pasteuria penetrans in Georgia soil on reproduction of Meloidogyne arenaria. Journal of Nematology 21:574575 (Abstr.). Minton, N. A., J. F. Magill, and A. M. Golden. 1969. Meloidogyne javanica a ttacks peanut in Georgia. Plant Disease Reporter 53:668. Mooers, A. O., and E. C. Holmes. 2000. The evolution of base composition and phylogenetic inference. Tree 15:365 369. Motsinger, J. H., J. Crawford, and S. Thompson. 1976. Nematode survey of peanuts and cotton in southwest Georgia. Peanut Science 3:7274. Murdoch, W. W. 1977. Stabilizing effects of spatial heterogeneity in predator prey systems. Theoretical Population Biology 11:252273. Murray, B. G. 1999. Can the population regulation controversy b e buried and forgotten? Oikos 84:148152. Nakasono, K., J. T. Gaspard, and Y. Tateishi. 1993. Effects of soil temperatures on spore increase of Pasteuria penetrans parasitizing Meloidogyne incognita in vinyl house conditions. Japanese Journal of Nematology 23:19. Nicholson, W. I., N. Munakata, G. Horneck, H. J. Melosh, and P. Setlow. 2000. Resistance of Bacillus endospores to extreme terrestrial and extraterrestrial environments. Microbiology and Molecular Biology Reviews 64:548572. Nishizawa, T. 1986. On a strain of Pasteuria penetrans parasitic to cyst nematodes. Revue de Nmatologie 9:303304. Noel, G. R., N. Atibalentja, and L. L. Domier. 2005. Emended description of Pasteuria nishizawae International Journal of Systematic and Evolutionary Microbiology 55:16811685. Noling, J. W., and J. O. Becker. 1994. The challenge of research and extension to define and implement alternatives to methyl bromide. Supplement to the Journal of Nematology 26:573586. Nong, G., V. Chow, L. M. Schmidt, D. W. Dickson, and J. F. Preston. 2007. Multiple strand displacement and identification of single nucleotide polymorphisms as markers of genotypic variation of Pasteuria penetrans biotypes infecting root knot nematodes. FEMS Microbiology Ecology 61:327336. Nwokolo, E. 1996. Peanut ( Arachis hypogaea L.). Pp. 49 in E. Nwokolo and J.S. Mart, eds. Legumes and Oil Seeds in Nutrition. London: Chapman and Hall. Nyczepir, A. P. 1989. Peach tree short life: A nematode associated disease. Nematology Circular No. 163. Florida Departm ent of Agriculture and Consumer Services, Division of Plant Industry, Gainesville, Florida.

PAGE 172

172 Nyczepir, A. P., P. F. Bertrand, R. W. Miller, and R. E. Motsinger. 1985. Incidence of Criconemella spp. and peach orchard histories in short life and nonshort life sites in Georgia and South Carolina. Plant Disease 69:874877. Nyczepir, A.P., C. C. Reilly, R. E. Motsinger, and W. R. Okie. 1988. Behavior, parasitism, morphology, and biochemistry of Criconemella xenoplax and C. ornata on peach. Journal of Nematology 20:4046. Nyczepir, A. .P., E. I. Zehr, S. A. Lewis, and D. C. Harshman. 1983. Short life of peach trees induced by Criconemella xenoplax Plant Disease 67:507508. Obrebski, S. 1975. Parasite reproductive strategy and evolution of castration of host by parasites. Science 188:13141316. Olmedo, G., E. G. Ninfa, J. Stock, and P. Youngman. 1990. Novel mutations that alter the regulation of sporulation in Bacillus subtilis : Evidence that phosphorylation of regulatory protein Spo0A controls the initiation of s porulation. Journal of Molecular Biology 215:359372. Oostendorp, M., D. W. Dickson, and D.J. Mitchell.1990. Host range and ecology of isolates of Pasteuria spp. from the southern United States. Journal of Nematology 22:525531. Oostendorp, M., D. W. Dicks on, and D. J. Mitchell. 1991. Population development of Pasteuria penetrans on Meloidogyne arenaria. Journal of Nematology 23:5864. Orion, D., and E. Cohn. 1975. Crop rotation for control of certain nematodes. Phytoparasitica 3:69 (Abstr.). Orion, D., and A. Franck. 1990. An electron microscope study of cell wall lysis by Meloidogyne javanica gelatinous matrix. Revue de Nmatologie 13:105107. Orui, Y. 1997. Effect of spore sonication on attachment and host attachment range of Pasteuria penetrans to the r oot knot nematode. Applied Entomology and Zoology 32:101107. Oudejans, J. H. 1983. AgroPesticides: Their management and application, 2nd ed. Bangkok, Thailand: United Nations Economic and Social Commission for Asia and the Pacific. Pace, N. R., G. J. Ol sen, and C. R. Woese. 1986. Ribosomal RNA phylogeny and the primary lines of evolutionary descent. Cell 45:325326. Page, R. D. M. 1996. TREEVIEW: An application to display phylogenetic trees on personal computers. Computer Applications in the Biosciences 12: 357358. Palys, T, E. Berger, I. Mitrica, L. K. Nakamura, and F. M. Cohan. 2000. Proteincoding genes as molecular markers for ecologically distinct populations: The case of two Bacillus species. International Journal of Systematic and Evolutionary Mic robiology 50:10211028.

PAGE 173

173 Palys, T., L. K. Nakamura, and F. M. Cohan. 1997. Discovery and classification of ecological diversity in the bacterial world: The role of DNA sequence data. International Journal of Systematic Bacteriology 47:1145 1156. Patel, D. J., B. A. Patel, J. C. Chavda, and H. V. Patel. 1988. Record of Meloidogyne javanica on groundnut in Gujart, India. International Arachis Newsletter 3:1617. Persidis, A., J. G. Lay, T. Manousis, A. H. Bishop, and D. J. Ellar. 1991. Characterisation of pot ential adhesins of the bacterium Pasteuria penetrans and of putative receptors on the cuticle of Meloidogyne incognita, a nematode host. Journal of Cell Science 100:613622. Phillips, M.S. 1984. The effect of initial population density on the reproduction of Globodera pallida on partially resistant potato clones derived from Solanum vernei Nematologica 30:5765. Posada, D., and K. A. Crandall. 1998. Modeltest: Testing the model of DNA substitution. Bioinformatics 14:817818. Poulin, R., and D. Mouillot. 2003. Parasite specialization from a phylogenetic perspective: A new index of host specificity. Parasitology 126:473480. Preston, J. F., D. W. Dickson, J. E. Maruniak, G. Nong, J. A. Brito, L. M. Schmidt, and R. M. GiblinDavis. 2003. Pasteuria spp: Sys tematics and phylogeny of these bacterial parasites of phytopathogenic nematodes. Journal of Nematology 35:198207. Priest, F. G. 1993. Systematics and ecology of Bacillus Pp. 316 in A. L. Sorenshein, J. A. Hoch, and R. Losick, eds. Bacillus subtilis an d other Gram positive bacteria: Biochemistry, physiology, and molecular genetics. Washington, D.C.: American Society for Microbiology. Proite, K., R. Carneiro, R. Falco, A. Gomes, S. Leal Bertioli, P. Guimares, and D. Bertioli. 2008. Post infection devel opment and histopathology of Meloidogyne arenaria race 1 on Arachis spp. Plant Pathology 57:974980. Prot, J. C., and S. D. Van Gundy. 1981. Effect of soil texture and the clay component on migration of Meloidogyne incognita second stage juveniles. Journal of Nematology 13:213217. Ratanaworabhan, S., and G. C. Smart, Jr. 1970. The ring nematode, Criconemoides ornatus on peach and centipedegrass. Journal of Nematology 2:204208. Ratnasoma, H. A., S. R. Gowen, and N. G. M. Hague. 1991. Observations on the detachment of spores of Pasteuria penetrans from pre parasitic second stage juveniles of Meloidogyne spp. Nematologia Mediterranea 19:225 227. Regoes, R. R., J. W. Hottinger, L. Sygnarski, and D. Ebert. 2003. The infection rate of Daphnia magna by Pasteuria ramosa conforms with the mass action principle. Epidemiology and Infection 131:957966. Rickard, D. A., K. R. Barker, and J. C. Wells. 1977. Effects of Macroposthonia ornata and Meloidogyne hapla on yield and value of peanut. Journal of Nematology 9:281 ( Abstr.).

PAGE 174

174 Rodrguez Kbana, R., and H. Ivey. 1986. Crop rotation systems for the management of Meloidogyne arenaria in peanut. Nematropica 16:5563. Rodrguez Kbana, R., and D. G. Robertson 1987. Vertical distribution of Meloidogyne arenaria juveniles in a peanut field Nematropica 17:199208. Rodrguez Kbana R., H. Ivey, and P.A. Backman. 1987. Peanut cotton rotations for management of Meloidogyne arenaria. Journal of Nematology 19:484487. Rodrguez Kbana, R., C. F. Weaver, and P. S. King. 1985. Combinations of 1,3D and aldicarb for management of Meloidogyne arenaria in peanuts. Nematropica 15:93106. Rodrguez Kbana, R., J. C. Williams, and R. A. Shelby. 1982. Assessment of peanut yield losses caused by Meloidogyne arenaria. Nematropica 12:279288. Rodrguez Kbana, R., C. F. Weaver, D. G. Robertson, and E. L. Snoddy. 1986. Population dynamics of Meloidogyne arenaria juveniles in field with Florunner peanut. Nematropica 16:185196. Rodrguez Kbana R., D. G. Robertson, P. A. Backman, and H. Ivey. 1988. Soybean peanut rotations for the management of Meloidogyne arenaria. Annals of Applied Nematology 2:8185. Rodrguez Kbana, R., D. G. Robertson, C. F. Weaver, and L. Wells. 1991a. Rotations of bahiagrass and castorbean with peanut for the management of Meloidogyne arenaria. Supplement to the Journal of Nematology 23:658 661. Rodrguez Kbana, R., D. G. Robertson, L. Wells, C. F. Weaver, and P. S. King. 1991b. Cotton as a rotation crop for management of Meloidogyne arenaria and Sclerotium rolfsii in peanut. Supplement to the Journal of Nematology 23:652657. Rodrguez Kbana, R., N. Kokalis Burelle, D. G. Robertson, P. S. King, and L. W. Wells. 1994. Rotations with coastal bermudagrass, cotton, and bahiagrass for management of Meloidogyne arenaria and southern blight in peanut. Supplement to the Journal of Nematology 26:665668. Ronquist, F., and J. P. Huelsenbeck. 2003. MrBayes3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19:15721574. Rosenzweig, M. L. 1971. Paradox of enrichme nt: Destabilization of exploitation ecosystems in ecological time. Science 29:385 387. Sahebani, N., and N. Hadavi. 2008. Biological control of the root knot nematode Meloidogyne javanica by Trichoderma harzianum Soil Biology and Biochemistry 40:20162020. Sasser, J. N. 1980. Root knot nematodes: A global menace to crop production. Plant Disease. 64:3641.

PAGE 175

175 Sasser, J. N., and C. C. Carter. 1985. Overview of the International Meloidogyne Project 19751984. Pp. 1924 in J. N. Sasser and C. C. Carter, eds. An advanced treatise on Meloidogyne : Biology and control, vol. 1. Raleigh, NC: North Carolina State University Graphics. Sasser, J. N., J. C. Wells, and L. A. Nelson. 1968. The effect of 9 parasitic nematode species on growth, yield and quality of peanuts as determined by soil fumigation and correlation of nematode populations with host response. Nematologica 14:15 (Abstr.). Sauer, U., J. D. Santangelo, A. Treuner, M. Buchholz, and P. Drre. 1995. Sigma factor and sporulation genes in Clostridium FEMS Microbiology Reviews 17:331340. Sayre, R. M. 1980. Biocontrol: Bacillus penetrans and related parasites of nematodes. Journal of Nematology 12:260270. Sayre, R. M., and R. L. Gherna. 1990. Attachment and host specificity of a bacterium, Pasteuria penetrans th at parasitizes the root knot nematode, Meloidogyne arenaria. Pp. 247250 in B. M. Zuckerman, W. F. Mai, and L. R. Krusberg, eds. Plant nematology laboratory manual. Revised Edition. Amherst, MA: University of Massachusetts Agricultural Experimental Station Sayre, R. M., and M. P. Starr. 1985. Pasteuria penetrans (ex Thorne, 1940) nom. rev., comb. n., sp. n., a mycelial and endospore forming bacterium parasitic in plant parasitic nematodes. Proceedings of the Helminthological Society of Washington 52:149165. Sayre, R. M., and M. P. Starr. 1988. Bacterial diseases and antagonists of nematodes. Pp. 69101 in G. O. Poinar, Jr. and H. B. Jansson, eds. Diseases of nematodes. Boca Raton, FL: CRC Press. Sayre, R. M., and M. P. Starr. 1989. Genus Pasteuria Metchni koff, 1888. Pp. 26012615 in S. T. Williams, M. E. Sharpe, and J. G. Holt, eds. Bergeys manual of systematic bacteriology. Baltimore, MD: Williams and Wilkins. Sayre, R. M., and W. P. Wergin. 1977. Bacterial parasite of a plant nematode: Morphology and ul trastructure. Journal of Bacteriology 129:10911101. Sayre, R. M., M. P. Starr, A. M. Golden, W. P. Wergin, and B. Y. Endo. 1988. Comparison of Pasteuria penetrans from Meloidogyne incognita with a related mycelial and endospore forming bacterial parasite from Pratylenchus brachyurus Proceedings of the Helminthological Society of Washington 55:2849. Sayre, R. M., W. P. Wergin, J. M. Schmidt, and M. P. Starr. 1991. Pasteuria nishizawae sp. nov., a mycelial and endospore forming bacterium parasitic on cyst nematodes of genera Heterodera and Globodera. Research in Microbiology 142:551564. Schmidt, L. M., J. F. Preston, D. W. Dickson, J. D. Rice, and T. E. Hewlett. 2003. Environmental quantification of Pasteuria penetrans endospores using in situ antigen extr action and immunodetection with a monoclonal antibody. FEMS Microbiology Ecology 44:1726.

PAGE 176

176 Schmidt, L. M., L. Mouton, G. Nong, D. Ebert, and J. F. Preston. 2008. Genetic and immunological comparison of the cladoceran parasite Pasteuria ramosa with the nema tode parasite Pasteuria penetrans Applied and Environmental Microbiology 74:259264. Serracin, M. A., C. Schuerger, D. W. Dickson, and D. P. Weingartner. 1997. Temperature dependent development of Pasteuria penetrans in Meloidogyne arenaria. Journal of Ne matology 29:228238. Serracin, M. A., C. Schuerger, D. W. Dickson, D. P. Weingartner, and T. Hewlett. 1994. An alternative method for culturing Pasteuria penetrans. Journal of Nematology 26:565 (Abstr.). Sharma, S. B., and D. McDonald. 1990. Global status of nematode problems of groundnut, pigeonpea, chickpea, sorghum and pearl millet, and suggestions for future work. Crop Protection 9:453458. Sharma, S. B., and K. G. Davies. 1996a Characterization of Pasteuria isolated from Heterodera cajani using morphology, pathology, and serology of endospores. Systematic and Applied Microbiology 19:106112. Sharma, S. B., and K. G. Davies. 1996b. Comparison of two sympatric Pasteuria populations isolated from a tropical vertisol soil. World Journal of Microbiology and Biotechnology 12:361366. Siddiqi, M. R. 2000. Tylenchida: Parasites of plants and insects, 2nd ed. Wallingford, UK: CAB International. Singh, B., and S. C. Dhawan. 1990. A new bacterial strain of Pasteuria penetrans its host range and effect of temperature on spore attachment to secondstage juveniles of pigeonpea cyst nematode, Heterodera cajani Indian Journal of Nematology 20:161166. Skerman, V. B. D., V. McGowan, and P. H. A. Sheath. 1980. Approved lists of bacterial names. International Journal of Systematic Bacteriology 30:225 420. Sonenshein, A. L. 2000. Endospore forming bacteria: An overview. Pp. 133150 in Y. V. Brun and L. J. Shimkets, eds. Prokaryotic Development. Washington, D. C.: The American Society for Microbiology. Spaull, V. W. 1981. Bacillus penetrans in South African plant parasitic nematodes. Nematologica 27:244245. Spaull, V.W. 1984. Observations on Bacillus penetrans infecting Meloidogyne in sugarcane field in South Africa. Revue de Nmatologie 7:277282. Staring, W. D. E. 1984. Pesticides: Data collection systems and supply distribution and use in selected countries of the Asia Pacific region. Bangkok, Thailand: United Nations Economic and Social Commission for Asia and the Pacific.

PAGE 177

177 Starr, J. L., and M. J. Jeger. 1985. Dynamic s of winter survival of eggs and juveniles of Meloidogyne incognita and M. arenaria. Journal of Nematology 17:252256. Starr M. P., and R. M. Sayre. 1988. Pasteuria thornei sp. nov. and Pasteuria penetrans sensu stricto emend., mycelial and endospore form ing bacteria parasitic, respectively, on plant parasitic nematodes of the genera Pratylenchus and Meloidogyne Annales de lInstitut Pasteur Microbiologie 139:1131. Starr, J. L., E. R. Morgan, and C. E. Simpson. 2002. Management of the peanut root knot ne matode, Meloidogyne arenaria, with host resistance. Available: http://www.plantmanagementnetwork.org/pub/php/management/rootknot. Accessed 25 February 2009. Starr, J. L., M. Y. Shim, T. A. Lee, Jr., and C. E. Simpson. 1996. Additive effects of Meloidogyne arenaria and Sclerot ium rolfsii on peanut. Journal of Nematology 28:99106. Steiner, G. 1945. Meadow nematodes as the cause of root destruction. Phytopathology 35:935937. Stewart, J. 1977. Behavioural sensitivity of the Lotka Volterra model. Pp. 379390 in E. C Pielou, ed. Mathematical Ecology. New York, NY :Wiley Interscience. Stirling, G. R. 1981. Effect of temperature on infection of Meloidogyne javanica by Bacillus penetrans Nematologica 27:458462. Stirling, G. R. 1984. Biological contr ol of Meloidogyne javanica with Bacillus penetrans Phytopathology 74:55 60. Stirling, G. R. 1985. Host specificity of Pasteuria penetrans within the genus Meloidogyne Nematologica 31:203209. Stirling, G. R. 1991. Biological control of plant parasitic ne matodes: Progress, problems and prospects. Wallingford, UK: CAB International. Stirling, G. R., and L. J. Smith. 1998. Field test of formulated products containing either Verticillium chlamydosporium or Arthrobotrys dactyloides for biological control of root knot nematodes. Biological Control 11:231239 Stirling, G. R., and M. F. Wachtel. 1980. Mass production of Bacillus penetrans for the biological control of root knot nematodes. Nematologica 26:308312. Stirling, G. R., and A. M. White. 1982. Distributio n of a parasite of root knot nematodes in South Australian vineyards. Plant Disease 66:5253. Stirling, G. R., R. D. Sharma, and J. Perry. 1990. Attachment of Pasteuria penetrans spores to the root knot nematode Meloidogyne javanica in soil and its effect on infectivity. Nematologica 36:246252.

PAGE 178

178 Stirling, G. R., L. J. Smith, K. A. Licastro, and L. M. Eden. 1998. Control of root knot nematode with formulation of nematode trapping fungus Arthrobotrys dactyloides Biological Control 11:224230. Stromberger M E., S. Klose, H. Ajwa, T. Trout, and S. Fennimore. 2005. Microbial populations and enzyme activities in soils fumigated with methyl bromide alternatives. Soil Science Society of America Journal 69:19871999. Sturgeon, R. V. 1986. Peanut disease loss esti mates for major peanut producing states in the United States in 1984 and 1985. Proceedings of the American Peanut Research and Education Society 18:2426. Sturhan, D. 1988. New host and geographical records of nematode parasitic bacteria of the Pasteuria penetrans group. Nematologica 34:350356. Sturhan, D., R. Winkelheide, R. M. Sayre, and W. P. Wergin. 1994. Light and electron microscopical studies of the life cycle and developmental stages of a Pasteuria isolate parasitizing the pea cyst nematode, Hetero dera goettingiana. Fundamental and Applied Nematology 17:2942. Sturhan, D., T. S. Shutova, V. N. Akimov, and S. A. Subbotin. 2005. Occurrence, hosts, morphology, and molecular characterisation of Pasteuria bacteria parasitic in nematodes of the family Ple ctidae. Journal of Invertebrate Pathology 88:1726. Subbotin, S. A ., D. Sturhan, V. N. Chizhov, N. Vovlas, and J. G. Baldwin. 2006. Phylogenetic analysis of Tylenchida Thorne, 1949 as inferred from D2 and D3 expansion fragments of the 28S rRNA gene sequenc es. Nematology 8:455474. Tai, Y. P., and C. T.Young. 1975. Genetic studies of peanut proteins and oils. Journal of American Oil Chemist Society 52:377 385. Talavera, M., and T. Mizukubo. 2003. Influence of soil conditions, spore densities and nematode age on Pasteuria penetrans attachment to Meloidogyne incognita Spanish Journal of Agricultural Research 4:5763. Talavera, M., K. Itou, and T. Mizukubo. 2002. Combined application of Glomus sp. and Pasteuria penetrans for reducing Meloidogyne incognita (Tylenchida: Meloidogynidae) populations and improving tomato growth. Applied Entomology and Zool ogy 37:6167. Tamura, K., J. Dudley, M. Nei, and S. Kumar. 2007. MEGA4: Molecular evolutionary genetics analysis (MEGA) software version 4.0. Molecular Biology and Evolution 24:15961599. Tarjan, A. C. 1971. Migration of three pathogenic citrus nematodes t hrough two Florida citrus soils. Soil and Crop Science Society of Florida Proceedings 31:253255.

PAGE 179

179 Tateishi, Y., Z. Sano, and H. Iwahori. 2007. Emergence of suppression of root knot nematodes in sweet potato cropping system treated with Pasteuria penetrans Japanese Journal of Nematology 37:19. Thompson, J. D., T. J. Gibson, F. Plewniak, F. Jeanmougin, and D. G. Higgins. 1997. The CLUSTAL X windows interface: Flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acid R esearch 25:48764882. Thorne, G. 1940. Duboscqia penetrans n. sp. (Sporozoa, Microsporidia, Nosematidae), a parasite of the nematode Pratylenchus pratensis (de Man) Filipjev. Proceedings of the Helminthological Society of Washington 7:5153. Tian, B., J. Y ang, and K. Q. Zhang. 2007. Bacteria used in the biological control of plant parasitic nematodes: Populations, mechanisms of action, and future prospects. FEMS Microbiology Ecology 61:197213. Timper, P., and D. M. Wilson. 2002. Infection of Arachis hypogaea by Meloidogyne arenaria may increase aflatoxin contamination of kernels. Nematology 4:214 (Abstr.). Timper, P., N. A. Minton, A. W. Johnson, T. B. Brenneman, A. K. Culbreath, G. W. Burton, S. H. Baker, and G. J. Gascho. 2001. Influence of cropping syste m on stem rot ( Sclerotium rolfsii), Meloidogyne arenaria, and the nematode antagonist Pasteuria penetrans in peanut. Plant Disease 85:767772. Tomaszewski, E. K., M. A. M. Khalil, A. A. El Deeb, T. O. Powers, and J. L. Starr. 1994. Meloidogyne javanica par asitic on peanut. Journal of Nematology 26:436441. Triantaphyllou, A. C. 1960. Sex determination in Meloidogyne incognita and intersexuality in M. javanica. Annales de I'lnstitut Phvtopathologique Benaki, New Series 3:1231. Triantaphyllou, A. C. 1985. Cy togenetics, cytotaxonomy, and phylogeny of root knot nematodes. Pp. 107114 in J. N. Sasser and C. C. Carter, eds. An advanced treatise on Meloidogyne Vol. 1: Biology and control. Raleigh, NC: North Carolina State University Graphics. Trotter, J. R., and A. H. Bishop. 2003. Phylogenetic analysis and confirmation of the endospore forming nature of Pasteuria penetrans based on the spo0A gene. FEMS Microbiology Letters 225:249256. Trudgill, D. L. 1972. Influence of feeding duration on sex determination and m oulting of Meloidogyne incognita. Nematologica 18:47681. Trudgill, D. L., and V. C. Blok. 2001. Apomictic, polyphagous root knot nematodes: Exceptionally successful and damaging biotrophic root pathogens. Annual Review of Phytopathology 39:53 77. Trudgill D. L., V. C. Blok, G. Bala, A. Daudi, K. G. Davies, S. R. Gowen, M. Fargette, J. D. Madulu, T. Mateille, W. Mwageni, C. Netscher, M. S. Phillips, A. Sawadogo, C. G.

PAGE 180

180 Trivino, and E. Voyoukallou. 2000. The importance of tropical root knot nematodes ( Meloi dogyne spp.) and factors affecting the utility of Pasteuria penetrans as a biocontrol agent. Nematology 2:823845. Tsai, Y. L., and B. H. Olson. 1991. Rapid method for direct extraction of DNA from soil and sediments. Applied and Environmental Microbiology 57:10701074. Tzortzakakis, E. A., and S. R. Gowen.1994. Evaluation of Pasteuria penetrans alone and in combination with oxamyl, plant resistance and solarization for control of Meloidogyne spp. on vegetables grown in greenhouse in Crete. Crop Protection 13:455462. Van Gundy, S. D. 1985. Ecology of Meloidogyne spp.: Emphasis on environmental factors affecting survival and pathogenicity. Pp. 177182 in K. R., Barker, C. C. Carter, J. N. Sasser, eds. An Advanced treatise on Meloidogyne Vol. I: Biology and Control. Raleigh, NC: North Carolina State University Graphics. van Iterson, W. 1984. Inner Structures of Bacteria. New York, NY: Van Nostrand Reinhold. Vargas, R., and N. Acosta. 1990. Pasteuria penetrans a biological control agent of nematodes in Puerto Rico. The Journal of Agriculture of the University of Puerto Rico 74:319321. Volterra, V. 1926. Variations and fluctuations of the number of individuals in animal species living together. Pp. 409448 in R. N. Chapman, ed. Amimal ecology. New York, NY : Mc Graw Hill. Walia, R. K., A. Kumar, and A. Kapoor. 2005. Potential of a bacterial parasite, Pasteuria penetrans for the management or root knot disease of horticultural crops. Pp. 287299 in R. C. Sharma and J. N. Sharma. Challenging problems in horticultural and forest pathology. New Delhi: Indus Publishing. Wheeler, T. A., and J. L. Starr. 1987. Incidence and economic importance of plant parasitic nematodes on peanut in Texas. Peanut Science 14:9496. White, P. S., and S. T. A. Pickett 1985. Natural disturbance and patch dynam ics: An introduction. Pp. 313 in S. T. A. Pickett and P. S. White, eds. The ecology of natural disturbance and patch dynamics. New York, NY : Academic Press. White, T. C. R. 2004. Limitations of populations by weather driven changes in food: A challenge to density dependent regulation. Oikos 105:664666. Williams, A. B., G. R. Stirling, A. C. Hayward, and J. Perry. 1989. Properties and attempted culture of Pasteuria penetrans a bacterial parasite of root knot nematodes ( Meloidogyne javanica). Journal of Ap plied Bacteriology 67:145156. Wilson, A. C., S. S. Carlson, and T. J. White. 1977. Biochemical evolution. Annual Review of Biochemistry 46:473639.

PAGE 181

181 Wishart, J., V. C. Blok, M. S. Phillips, and K. G. Davies. 2004. Pasteuria penetrans and P. nishizawae atta chment to Meloidogyne chitwoodi M. fallax and M. hapla. Nematology 6:507510. Woese, C. R. 1987. Bacterial evolution. Microbiological Reviews 51:221271. Wong, M. C., W. L. Peacock, Jr., R. M. McKinney, and K. H. Wong. 1981. Legionella pneumophila: Avirul ent to virulent conversion through passage in cultured human embryonic lung fibroblasts. Current Microbiology 5:3134. Yamamoto, S., and S. Harayama. 1998. Phylogenetic relationship of Pseudomonas putida strains deduced from the nucleotide sequences of gyr B rpoD and 16S rRNA genes. International Journal of Systematic Bacteriology 48:813 819. Yamamoto, T., V. U. Ultra, Jr., S. Tanaka, K. Sakurai, and K. Iwasaki. 2008. Effects of methyl bromide fumigation, chloropicrin fumigation and steam sterilization on soil nitrogen dynamics and microbial properties in a pot culture experiment. Soil Science and Plant Nutrition 54:886894. Yardim, E. N., and C. A. Edwards. 1998. The effects of chemical pest, disease and weed management practices on the trophic structure o f nematode populations in tomato agroecosystems. Applied Soil Ecology 7:137 147. Yoon, J. H., I. G. Kim, Y. K. Shin, and Y. H. Park. 2005. Proposal of the genus Thermoactinomyces sensu stricto and three new genera, Laceyella Thermoflavimicrobium and Seinonella on the basis of phenotypic, phylogenetic and chemotaxonomic analyses. International Journal of Systematic and Evolutionary Microbiology 55:395400. Zhang, Y. 1985. Occurrence and control of peanut root knot disease in nonirrigated sloping fields of Zhangjiang District. Agricultural Science of Guangdong Province 6:4849. Zhang, L., J. Zhang, P. Christie, and X. Li. 2008. Pre inoculation with arbuscular mycorrhizal fungi suppresses root knot nematode ( Meloidogyne incognita) on cucumber ( Cucumis sativus ). Biology and Fertility of Soils 45:205211.

PAGE 182

182 BIOGRAPHICAL SKETCH Joey I. Orajay was born to Mr. Benjamin P. Orajay, Sr. and Mrs. Priscila L. Isurita in 1977. He grew up in Luisiana, Laguna, Philippines where he also obtained his primary and secondary education in Luisiana Central Elementary School and Luis Bernardo Memorial High School, respectively. In 1994, he was accepted in the B. S. Agriculture program of the countrys premiere agricultural college in the University of the Philippines Los Baos (U PLB). He majored in Plant Pathology under the supervision of Dr. Gil Divinagracia and identified the pathogen causing leaf blight of an ornamental plant. After finishing his degree, he worked as a research assistant on project dealing with biological contr ol of damping off pathogens using Trichoderma spp. He then got a scholarship from Flemish Inter University Council to pursue Master of Science in Nematology administered by University of Ghent, Belgium. His research project involved screening of selected M usa varieties for resistance to Radopholus similis under the guidance of Prof. Dirk D e Waele and Dr. Annemie Elsen of Catholic University of Leuven. After finishing, he returned to the Philippines and work as an Assistant Professor in the Dept. of Plant Pa thology, UPLB. His involvements in academic activities made him realized the obvious lack of general awareness among agricultural practitioners in the country about the importance of nematodes as pathogens and pest of agricultural crops. Realizing the need to get more training, he went to pursue a doctoral program at the University of Florida where he studied Pasteuria spp. under the supervision of Dr. Donald W. Dickson. Upon his return to his home university, he plans to continue working on P penetrans an d establish a nematode diagnostic laboratory. He was a member of the Philippine Phytopathological Society, Mycological Society of the Philippines, Organization of Nematologists of Tropical America, Society of Nematologists, and Epsilon Iota Honor Society, University of Florida Chapter.