<%BANNER%>

N-Methyl-D-Aspartate (NMDA) Receptors in the Enteric Nervous System (ENS)

Permanent Link: http://ufdc.ufl.edu/UFE0024928/00001

Material Information

Title: N-Methyl-D-Aspartate (NMDA) Receptors in the Enteric Nervous System (ENS)
Physical Description: 1 online resource (81 p.)
Language: english
Creator: Pinero, Arseima
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: colon, elisa, ens, enteric, hypersensitivity, ibd, ibs, immunohistochemistry, invivo, manometry, mk801, mpo, nmda, nmdars, pain, pcr, peristalsis, rat, vip, visceral
Neuroscience (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: More than 1.4 million Americans suffer from Crohn's disease or ulcerative colitis. Main complaints in these patients are changes in bowel movements and pain. One current theory suggests that these changes may be linked to the N-methyl-D-aspartate receptors (NMDARs). We found that: 1) the NMDARs in the colon of untreated rats are complexes of specific NR1 and NR2 receptors. 2) The expression of these NR1 receptors increases in a model of colitis induced by acid (trinitrobenzene sulfonic acid, TNBS). 3) These receptors are localized in a subset of neurons that contain the vasoactive intestinal peptide (VIP). 4) VIP concentration in the blood plasma was elevated during inflammation. 5) Animals treated with TNBS had significantly increased contractility when NMDA was administered locally. 6) This effect was reversed by NMDA receptor antagonist MK-801. Thus, the study of NMDARs could provide useful information for the development of therapies that selectively modulate bowel function.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Arseima Pinero.
Thesis: Thesis (Ph.D.)--University of Florida, 2009.
Local: Adviser: Caudle, Robert M.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0024928:00001

Permanent Link: http://ufdc.ufl.edu/UFE0024928/00001

Material Information

Title: N-Methyl-D-Aspartate (NMDA) Receptors in the Enteric Nervous System (ENS)
Physical Description: 1 online resource (81 p.)
Language: english
Creator: Pinero, Arseima
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: colon, elisa, ens, enteric, hypersensitivity, ibd, ibs, immunohistochemistry, invivo, manometry, mk801, mpo, nmda, nmdars, pain, pcr, peristalsis, rat, vip, visceral
Neuroscience (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: More than 1.4 million Americans suffer from Crohn's disease or ulcerative colitis. Main complaints in these patients are changes in bowel movements and pain. One current theory suggests that these changes may be linked to the N-methyl-D-aspartate receptors (NMDARs). We found that: 1) the NMDARs in the colon of untreated rats are complexes of specific NR1 and NR2 receptors. 2) The expression of these NR1 receptors increases in a model of colitis induced by acid (trinitrobenzene sulfonic acid, TNBS). 3) These receptors are localized in a subset of neurons that contain the vasoactive intestinal peptide (VIP). 4) VIP concentration in the blood plasma was elevated during inflammation. 5) Animals treated with TNBS had significantly increased contractility when NMDA was administered locally. 6) This effect was reversed by NMDA receptor antagonist MK-801. Thus, the study of NMDARs could provide useful information for the development of therapies that selectively modulate bowel function.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Arseima Pinero.
Thesis: Thesis (Ph.D.)--University of Florida, 2009.
Local: Adviser: Caudle, Robert M.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0024928:00001


This item has the following downloads:


Full Text

PAGE 1

1 N METHYL D ASPARTATE (NMDA) RECEPTORS IN THE ENTERIC NERVOUS SYSTEM (ENS) By ARSEIMA YESENIA DEL VALLE PINERO A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQU IREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2009

PAGE 2

2 2009 Arseima Yesenia Del Valle Pinero

PAGE 3

3 Para Mami Fernanda, Abuela Regina y las dems amazonas en mi familia, quienes me ensear on que la muje r que busca ser igual al hombre carece de ambicin

PAGE 4

4 ACKNOWLEDGMENTS This dissertation would not have been possible wit hout the support of many people. Immense gratitude goes to my advis o r Dr. Robert M. Caudle, who gave me the chance to work o n this project and provided me with guidance and numerous indispensable comments for my manuscripts. I highly value his advice and opinion in anything from astrocytes biophysics to pop culture. I would like to thank my committee members for their a ssistance and constructive comments: Dr. Donald Price Dr. John Neubert and Dr. Brian Harfe I would also like to express my appreciation to Dr. Sue Semple Rowland, who generously sat through my qualifying exam when asked in the nick of time. Thanks to Dr Lee Kaplan, who recommend I look into Dr. Caudles lab, the best advice I had in the last 6 years I am a lso grateful to many persons who shared their technical assist ance, experience and friends hip, especially; Federico Perez and the members of the Caud le lab, both past and present, with whom I have been fortunate enough to work: Shelby Suckow, Ethan Anderson, Ingrid Paredes and Matthew Martin. Thanks go to the National Institute of Diabetes and Digestive and Kidney Disease (NIH NIDDK) for awarding me wi th a Ruth L. Kirschstein s National Research Service Award Pre doctoral Fellowship providing me with the financial means to complete this dissertation. Also thanks to Harriet Scott, our grant specialist, for all her help and great disposition. I would lik e to thank my family, Mamita Irma, Titi Ileana, but especially my Dad, Edgard Resto who pointed me in the right direction, teaches me by example, and never stops believing in me. Finally, thanks go to my dear friends, Francisco and my Gainesvilles friends my family away from home. My life is better because I met them. I could have not done it with out them.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ ........... 4 LIST OF TABLES ................................ ................................ ................................ ...................... 7 LIST OF FIGURES ................................ ................................ ................................ .................... 8 LIST OF ABBREVIATIONS ................................ ................................ ................................ .... 10 LIST OF ABB REVIATIONS ................................ ................................ ................................ .... 10 ABSTRACT ................................ ................................ ................................ ............................. 11 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ ............. 13 N Methyl D A spartate (NMDA) Receptors ................................ ................................ ........ 13 Overview ................................ ................................ ................................ .................... 13 Pathology ................................ ................................ ................................ .................... 14 Enteric Ne rvous System ................................ ................................ ................................ ..... 15 Overview ................................ ................................ ................................ .................... 15 Peristalsis ................................ ................................ ................................ .................... 16 Pathology: Bowel Diso rders ................................ ................................ ........................ 17 Inflammatory Bowel Disease (IBD) ................................ ................................ ..... 17 Irritable Bowel Syndrome (IBS) ................................ ................................ ........... 18 NMDA Receptors in the Enteric Nervous System ................................ .............................. 19 Significance ................................ ................................ ................................ ....................... 19 2 GENERAL METHODS ................................ ................................ ................................ ..... 25 Animals ................................ ................................ ................................ .............................. 25 Tissue Collection ................................ ................................ ................................ ................ 25 Reverse Transcription PCR (RT PCR) ................................ ................................ ............... 25 Western Blots ................................ ................................ ................................ ..................... 26 TNBS Induced Colitis ................................ ................................ ................................ ........ 27 Colo Rectal Distension ................................ ................................ ................................ ....... 27 Mechanical Threshold Testing on Hind Paws: von Frey ................................ ..................... 28 Myeloperoxidase Activity Assay ................................ ................................ ........................ 28 Immunohistochemistry ................................ ................................ ................................ ....... 29 Whole Mount ................................ ................................ ................................ .............. 29 Cryostat Sections ................................ ................................ ................................ ......... 30 VIP Peptide Enzyme Immunoassay (EIA) Protocol ................................ ............................ 31 Ex Vivo Circular Muscle Colonic Contractility Assay ................................ ........................ 32 Colo Rectal Manometry: In Vivo Motility ................................ ................................ .......... 32

PAGE 6

6 Statistical Analyses ................................ ................................ ................................ ............ 33 3 EXPRESSION OF THE N METHYL D ASPARTATE RECEPTOR NR1 SPLICE VARIANTS AND NR2 SUBUN IT SUBTYPES IN THE RAT COLON ........................... 38 Introduction ................................ ................................ ................................ ........................ 38 Results ................................ ................................ ................................ ............................... 39 Expre ssion of NR1 Protein in the Rat Colon. ................................ ............................... 39 Expression of Ssplice Variants of the NR1 Protein. ................................ ..................... 40 Expression of the N1 Cassette (e xon 5) in the Rat Colon. ................................ ............ 40 Expression of C Terminal Cassettes in the Rat Colon. ................................ ................. 41 Expression of NR2 Protein Subtypes. ................................ ................................ .......... 41 Co labeling of NR1 with NR2B and NR2D in the Rat Colon. ................................ ...... 42 Discussion ................................ ................................ ................................ .......................... 42 4 NMDA RECEPTOR MEDIATED CHANGES IN CONTRACTILITY AFTER TNBS INDUCED COLITIS. ................................ ................................ ................................ ......... 51 Introduction ................................ ................................ ................................ ........................ 51 Results ................................ ................................ ................................ ............................... 52 Inflammation after TNBS Treatment ................................ ................................ ........... 52 NMDA Receptors Co localize with VIP and NOS in the Rat Colon after Colitis. ........ 53 Changes in VIP Concentration Following TNBS Treatment ................................ ........ 53 NMDA Receptor Mediated Changes in Motility after TNBS Colitis ............................ 53 Discussion ................................ ................................ ................................ .......................... 54 5 CONCLUSIONS AND FUTURE CONSIDERATIONS ................................ .................... 67 NMDA Receptors in the Enteric Nervous Sys tem in the Nave Rat Colon .......................... 67 NMDA Receptors in the Enteric Nervous System after TNBS Induced Colitis ................... 68 Clinical Implications ................................ ................................ ................................ .......... 70 Future Considerations ................................ ................................ ................................ ........ 71 LIST OF REFERENCES ................................ ................................ ................................ .......... 74 BIOGRAPHICAL SK ETCH ................................ ................................ ................................ ..... 81

PAGE 7

7 LIST OF TABLES Table page 2 1 RT PCR Primers Sequences.. ................................ ................................ ........................ 34 2 2 A ntibodies us ed for Western Blots and Immunohistochemical Assays.. ......................... 35

PAGE 8

8 LIST OF FIGURES Figure page 1 1 Schematic representations of the proposed structure of the NMDA receptor channel subunits and the NR1 subunit splice variant composition ................................ ............... 21 1 2 Central Sensitization ................................ ................................ ................................ ...... 22 1 3 The Enteric Ne rvous System (ENS) ................................ ................................ ............... 23 1 4 Transmission from motor neurons to gastrointestinal muscle ................................ ......... 24 2 1 Clear colon tissue for whole mount p reparations ................................ ............................ 36 2 2 Immunohistochemistry negative controls ................................ ................................ ....... 37 3 1 Expression of NR1 in the rat colon ................................ ................................ ................ 45 3 2 Visualization of NR1 protein and neuronal markers; PGP and neurofilament in the rat colon ................................ ................................ ................................ ........................ 46 3 3 Expression of NR1 splice variants in the rat colon ................................ ......................... 47 3 4 Visualization of the C2 and C2cassettes in the rat myenteric plexus ............................. 48 3 5 Expression of NR2 subtypes in the rat colon ................................ ................................ .. 49 3 6 Co labeling of NR1 with NR2B and NR2D subunits in the rat colon ............................. 50 4 1 Weight loss following trinitrobenzene sulfonic acid (TNBS) administration .................. 57 4 2 Visceral hypersensitivity after TNBS treatment ................................ ............................. 58 4 3 Somatic hypersensitivity after TNBS treatment ................................ .............................. 59 4 4 Myeloperoxidase (MPO) activity following TNBS induced colitis ................................ 60 4 5 NMDA receptors present in the VIP/NOS neurons of th e rat myenteric plexus 14 days following TNBS treatment ................................ ................................ ..................... 61 4 6 VIP in plasma after TNBS treatment ................................ ................................ .............. 62 4 7 NMDA receptor effect in VIP release 2 hours after TNBS treatment ............................. 63 4 8 NMDA receptor effect in VIP release 14 days after TNBS treatment. ............................ 64 4 9 Ex Viv o contractility following TNBS induced colitis ................................ ................... 65

PAGE 9

9 4 10 Colo rectal Manometry: In Vivo motility after TNBS ................................ .................... 66 5 1 Mechanism Model ................................ ................................ ................................ ......... 73

PAGE 10

10 LIST OF ABBREVIATIONS ACh Acetylcholine APV 2 Amino 5 phosphonovalerate CAN Colospinal Afferent Neurons ENS Enteric Nervous System GAPDH Glyceraldehyde 3 phosphate dehydrogenase GI Gastrointestinal HTAB Hexad ecyltrimethylammonium Bromide HRP Horse radish peroxidase IBD Inflammatory Bowel Disease IBS Irritable Bowel Syndrome ICC Interstitial cells of Cajal IHC Immunohistochemistry MPO Myeloperoxidase NF Neurofilament NGS Normal Goat Serum NMDA N methyl D aspartate NOS Nitric Oxide Synthase PBS Phosphate Buffered Saline PGP 9.5 Protein gene product 9.5 PVG Prevertebral ganglia RT PCR Reverse transcriptase polymerase chain reaction TNBS Trinitrobenzene sulfonic acid VIP Vasoactive intest inal peptide

PAGE 11

11 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy N METHYL D ASPARTATE (NMDA) RECEPTORS IN THE ENTERIC NERV OUS SYSTEM (ENS) By Arseima Yesenia Del Valle Pinero August 2009 Chair: Robert Caudle Major: Medical Sciences Neuroscience More than 1.4 million Americans suffer from Crohns disease or ulcerative colitis the disorders that make up Inflammatory Bowel Disease (IBD). Irritable Bowel Syndrome (IBS) afflicts 12% of adults in the US. The economic consequences of bowel disorders like IBD and IBS are substantial not just because of direct medical care costs, but also as a result of time lost at work. The ann ual costs of IBS management is estimated to be over $30 billion. Moreover, the economic reward for an effective therapeutic is estimated to be on the order of $15 billion per year. The major complaints in IBS and IBD patients are changes in bowel movements and the associated pain Previous studies have shown that the N methyl D aspartate (NMDA) receptor NR1 subunit and vasoactive intestinal peptide (VIP) co exist in enteric neurons of the rat. Moreover, NMDA alters peristalsis in the guinea pig colon and t his effect is reversed by NMDA receptor antagonists. We found that in the nave animals colon, NMDA receptors are heteromeric complexes of NR1 001 or NR1 000 with NR2B and/or NR2D Moreover, the expression of specific NR1 splice variants increases after tri nitrobenzene sulfonic acid (TNBS) induced colitis. Immunohistochemistry showed that the NMDA receptors present after inflammation co localized with vasoactive intestinal peptide and nitric oxide synthase VIP concentration in the

PAGE 12

12 plasma was also elevated f ollowing TNBS treatment. Also, NMDA inhibited VIP release in vitro from colon segments. While NMDA receptor antagonist, MK 801, promoted VIP release. The effect s of NMDA receptor agonists and antagonists in rat colon motility after colitis were also studi ed Using colo rectal manometry on restrained, non anesthetized rats it was found that animals treated with TNBS had significantly increased contractility when NMDA was administered locally. Moreover, this effect was reversed MK 801. T hese effects were not seen when isolated colon segments were used The results taken together suggest that NMDA receptor mediated changes in colonic motility after colitis requires modulation of VIP release Thus, the study of NMDA receptors could provide useful information f or the development of therapie s that selec tively modulate bowel function.

PAGE 13

13 CHAPTER 1 INTRODUCTION N Methyl D Aspartate (NMDA) Receptors Overview N Methyl D aspartate (NMDA) receptor s are the most clearly def ined glutamate receptor channel subtype These receptors have two subunit families designated NR1 and NR2 [1] In mammals, the functional NMDA receptor is a heteromeric complex containing NR1 and NR2 subunits [2] (Fig 1 1A) However, the exact number of subunits in each heteromeric glutamate receptor is still unknown. The NR1 subunit gene h as a total of 22 exons, three of which (exon s 5, 21 and 22) undergo alternative splicing to generate eight NR1 splice variants The alternatively spliced cassettes of the NR1 protein ar e named N1, C1 and C2 ( Fig. 1 1B ) The resultant eight splice variants of the NR1 protein in the presence (+) or absence ( ) of the spliceable exons have several nomenclatures [3] The nomenc lature use d her e; NR1 xyz was proposed by Durand and coll eagues [4] where x, y and z, represent the cassettes N1, C1 and C2, respectively The values of x, y and z are either 0 or 1 indicating the absence or prese nce of the respective cassette (Fig. 1 1C). The N1 and C1 cassettes may be either present or absent without affecting the remaining NR1 structure When the C2 cassette (exon 22) is spliced out the first stop codon is removed, resulting in the expression of the C2 cassette. Therefore, e ither the C2 or C2 cassette is present in all NR1 protein, but the two cassettes are not co expressed within the same NR1 protein [5] The N1 cassette is located extracellularly and interacts with various pharmacological modulators of the channel, including zinc, protons and polyamines [6] The C terminal cassettes of the protein control cell surface expression of NR1, whereas proteins with the shortest C terminal

PAGE 14

14 region (lacking the C1 cassette and containing C2; NR1x00) show the highest cell surface expression [7] The NR2 subunit family includes four members NR2A, 2B, 2C and 2D. Expression of different NR2 subunits determines the deactivation kinetics, antagonist sensitivity and ligand affinity of recombinant NR1/NR2 receptors [2] While the NR1 is widely expressed throughout the whole brain, the expression of the NR2 subunits is greatly regulated. The distributions of NR2A and NR2C have temporal and spati al similarities to that of NR1, while the expression of NR2B shows differences in the density and distribution. NR2D is very faint compared to other NR2s, and mutant mice defective in NR2D expression appear to develop normally [8] But in general, the expression of the NR2A and NR2B containing receptors is more predominant relative to the NR2C and NR2D receptor subtypes. Activation of NMDA receptor channels requires binding of both L glutamate and the co agonist glycine. Site directed mutagenesis has identified determinants of glycine binding in distinct regions of the NR1 subunit. While the glutamate binding site was shown to reside in the homolog ous regions of the N R2 subunits (Fig 1 1A). These distinctive properties of the NMDA receptors have implicated them in important physiological functions such as synaptic plasticity, synapse formation, memory, learning and formation of neura l networks during development [3;9] Pathology NMDA receptors may have roles in several pathological states including ischemia, epilepsy, Huntington's disease, AIDS dementia complex, amyotrophic lateral sclerosis and Alzheimer's disease. Addit ionally, these receptors are suspected to be involved in psychiatric disorders and neuropathic pain syndromes [3;9]

PAGE 15

15 Also, activation of the NMDA receptors in the dorsal horn neurons of the spinal cord that r eceive primary afferent input is a key step in the development of central sensitization Stimulation of nociceptive afferents following injury/inflammation causes an increased release of glutamate from the central terminals of nociceptive afferents in the d orsal horn. This results in activation of AMPA receptors, which then depolariz e the membrane relieving NMDA receptors from their Mg 2 + block. NMDA receptor activation ends up in the consequent amplification of pain (Fig. 1 2) This NMDA mediated central sen sitization mechanism has been studied in both human and animal models of hypersensitivity and is attenuated by NMDA receptor antagonist s [10;11] The pi votal role of NMDA receptor channels in physiological and pathological functions implies that specific and selective drugs may be developed for therapeutic intervention. Enteric Nervous System Overview The enteric nervous system (ENS) is formed of interc onnected plexuses of neurons, their axons and glial cells within the walls of the gastrointestinal tract. The ENS is of particular interest because it is the only extensive group of neurons outside the central nervous system that can assemble circuits capa ble of autonomous reflex activity Humans have 200 500 million enteric neurons with up to 20 different functional classes. The enteric nervous system has been called the second brain due to its complexity and size. The digestive tract has several layers (Fig. 1 3 ) ; the first layer (starting from the lumen) is the mucosa (MC) which is arranged into tightly packed straight tubular glands of cells specialized for water absorption and mucus secreting cells to aid the passage of feces. The next layer is the su bmucosal plexus (SP) ; one of two ganglionated neural networks in the enteric nervous system. The submucosal (Meissner's) plexus neurons (#9) innervate the epithelium, blood vessels, endocrine cells and other

PAGE 16

16 submucosal ganglia and play an important role i n regulating ion and water transport. The other ganglionated plexus is the myenteric (Auerbach's) plexus (MP) This is located between the longitudinal (LM) and circular muscle (CM) layers of the gut. Its neurons project to both muscle layers, to other mye nteric ganglia, to submucosal ganglia, or directly to the epithelium, and play an important role in regulating and patterning gut contraction. The enteric neurons found in these two ganglionated plexuses can be classified in various categories. Sensory neu rons (#2,#6) monitor tension and chemical content, associative interneurons (#1,#11) serve as a linkage between the sensory neurons and the motor neurons. The motor neurons can synapse either at the circular muscle layer (#7,#8) or the longitudinal muscle layer (#4,#5) They can be separated depending on their chemical coding, as excitatory or inhibitory motor neurons. Excitatory motor neurons (#4,#8) are mostly cholinergic and control contraction. Inhibitory motor neurons (#5,#7) control relaxation and hav e multiple transmitters like vasoactive intestinal peptide (VIP) and nitric oxide (NO) [12] There are two other subsets of intrinsic neurons that innervates outside the ENS. The intest inofugal neurons (#3) have cell bodies in the myenteric plexus and processes that innervate the prevertebral ganglia (PVG) [12] The other group, a unique population of neurons, colosp inal afferent neurons (CANs, #10), provides direct projection from both the myenteric and submucosal plexuses to the spinal cord [13] Peristalsis The law of the intestine states that; a stimulus within the intestine (e.g. the presence of food) initiates a band of constriction on the proximal side and relaxation on the distal side. Currently we know that peristalsis is the product of the co activation of excitatory and inhibitory reflexes in a distended segment of intestine [14] There are two phases of peristalsis: the preparatory and emptying phases. During the preparatory phase, enteric inhibitory motor neurons maintain the circular muscle in a relaxed state. When the intestine is distended, there is a

PAGE 17

17 simultaneou s activation of ascending excitatory and descending inhibitory pathways along the length of the intestine, with the inhibitory reflex prevailing [15] The emptying phase occurs when a particular intraluminal volume (the threshold volume) is reached and triggers a contraction at the oral end. Contractions can be accomplishe d by local stimulation (e.g. due to a bolus) or generalized distension (e.g. due to fluid distension). A contraction then indicates a shift from net inhibition to net excitation. Contraction of the oral end, deactivates enteric neurons sensitive to distens ion, consequently the descending inhibitory reflex is no longer activated from the contracted region. In this way the inhibition immediately anal to the contraction is reduced and the ascending excitatory reflex dominates, leading to the anal propagation o f the contraction [16] Neur al influence is superimposed on the rhythmic activity of the muscle, generated by interstitial cells of Cajal (ICC) (Fig. 1 4 ). These pacemaker cells are non neural cells of similar mesenchymal origin to the muscle. Motor neurons, both excitatory and inhib itory, release transmitter that acts on ICC. The ICC cells are then electrically coupled to muscle cells through gap junctions [17] Pathol ogy: Bowel Disorders Inflammatory Bowel Disease (IBD) Inflammatory bowel disease (IBD) refers to two chronic diseases that cause inflammation of the intestines: ulcerative colitis and Crohn's disease. Research has not determined yet what causes inflammato ry bowel disease but researchers believe that a number of factors may be involved, such as the environment, diet, and possibly genetics. Development of either disease can be the result of an exaggerated or insufficiently suppressed immune response to a pre viously undefined antigen, probably derived from the microbial flora. This inflammatory process leads to mucosal damage and a further disturbance of the epithelial barrier function. This results in an

PAGE 18

18 increased influx of bacteria into the intestinal wall [18] The most common symptoms of IBD are diarrhea and abdomina l pain but some may also experience constipation. Colazal and Entocort are two drugs developed recently for use in treating IBD. Colazal (Balsalazide) is an anti inflammatory drug which acts on the lining of the colon to reduce inflammation. Entocort EC is a nonsystemic corticosteroid that is released into the intestine and works to reduce inflammation. Irritable Bowel Syndrome (IBS) Irritable bowel syndrome (IBS) is a gastrointestinal (GI) disorder of unknown etiology often desc ribed as a functional disor der. L iterature suggests that bacte rial infection and inflammation may play a role in the etiology of this functional disorder [19] The presence of mast cells in mucosal biopsies of IBS patients s upports an inflammatory component in this pathology. There is also a strong correlation between acute episodes of Salmonella and other bacterial infections and the development of post infectious IBS (PI IBS). About 29 31% of patients with acute bacterial g astroenteritis develop PI IBS, 3 to 12 months after the inflammatory/infectious process [20 22] IBS is characterized by abdominal pain and cramps; changes in bowel movements (diarrhea, constipation, or alternation between diarrhea and constipation), gassiness, bloating, nausea and other symptoms. The dia gnosis of IBS rests basically on the occurrence of a set of symptoms and the exclusion of other GI pathology, called the Rome criteria [23] Patients with IBS also present extraintestinal symptoms such as migraine, backach es and muscle pain. Moreover, IBS patients showed not only visceral hypersensitivity to rectal distension but also cutaneous hypersensitivity to heat stimuli applied to the hand and foot. The cutaneous hyperalgesia was more prominent in the foot but was al so present in hand to a lesser extent. These results are likely related to the fact that nociceptive afferents from both the rectum and foot converge on common lumbosacral spinal segments. Consequently, it is likely that central sensitization is expressed to a greater degree at lumbosacral levels as compared to

PAGE 19

19 cervical spinal levels. Even though, the presence of mild hyperalgesia at cervical spinal levels suggests a widely distributed, yet topographically organized, central hyperexcitability [24 28] It is evident that IBS comprise s a complex collection of symptoms, but the major complaints in these patients are the changes in bowel movements and the associated pain. Frequently prescribed drugs target intestinal motility. Zelnorm (tega serod), a 5 HT4 receptor agonist, is used to treat constipation and Lotronex (alosetron hydrochloride), 5 HT3 receptor antagonist, is used for diarrhea. Clinical trials with both drugs showed that reinstating normal bowel motility alleviates the pain [29] Unfortunately, both of these drugs are no longer available, leaving patients with no suitable alternatives. NMDA Receptors in the Enteric Nervous System The NM DA receptor NR1 subunit has been characterized by in situ hybridization and PCR techniques in the rat [30] guinea pig [31] and human [32] enteric plexuses. NR1 was also co labeled with vasoactive intestinal peptide (VIP) in enteric neurons of t he rat using double in situ hybridization [33] NMDA receptors are also expressed in postganglionic parasympathetic neurons of the rat larynx and esophagus and their activation may be associated with VIP or NO release [34] Moreover, NMDA altered the colonic peristaltic reflex in an in vitro model that retained sympathetic and parasympathetic innervation [35] NMD A produced concentration dependent tonic contractions of the rat rectum [36] Shafton et al. found that peripherally administered NMDA receptor antagonist ketamine reduces visceromotor responses and motility reflexes in vivo [37] These findings suggest that NMDA receptors are likely to be involved in peristalsis. S ignificance The objective of this investigation was to identify the changes in NMDA receptor expression that occur during inflammation using the TNBS induced colitis rat model. The

PAGE 20

20 functional response of these receptors present after inflammation and the effect of NMDA ligands in colonic contractility were studied The hypothesis was that alterations in expression and function of NMDA receptors fol lowing TNBS induced colitis results in an enhanced activity of these receptors. The enhanced NMDA receptor activity could account for the changes in contractility reported Since disturbances in peristalsis are major factors influencing the quality of life of patients with bowel disorders, it is critical that we increase our knowledge of NMDA receptor structural/functional changes following inflammation Subunit s pecific NMDA receptor drug s could be used to selectively modulate bowel function.

PAGE 21

21 Figure 1 1 Schematic representations of the proposed structure of the NMDA receptor channel subunits and the NR1 subunit splice variant composition. (A) Schematic representation of the proposed structure of the NMDA receptor channel subunits NR1 and NR2. The NR1 th ree transmembrane segment topology model shows the transmembrane domains in red and the alternatively spliced cassettes; N1 (yellow triangle), C1 (dark blue cylinder) and C2 (orange cylinder). Adapted from Yamakura and Shimoji 1999 [3] (B) Detailed scheme of splice variant composition of NR1 protein. Colored boxes indicate the four alternatively spliced cassettes of NR1 pr otein, along with their name and exon number. The N1 cassette (exon 5) is extracellular at the N terminal (solid yellow box). The red bars indicate the four transmembrane (M1, 3 and 4) or intramembrane (M2) domains of the NR1 protein. The three C terminal cassettes; C1 (blue diamonds filled box), C2 (orange grid filled box) and C2 (vertical green lines filled box) are located intracellularly [38] (C) Splice variants of the NR1 subunit. The eight splice variants of the NR1 protein in the presence (+) or absence ( ) of three alternatively spliced exons (N1, C1 and C2); NR1xyz, where x, y and z represent the cassettes N1, C1 and C2, respectively. The values of x, y and z are either 0 or 1 indicating the absence or presence of the respective cassette Adap ted from [4]

PAGE 22

22 Figure 1 2. Central Sensitization. Stimulation of nociceptive afferents following injury/inflammation causes an increased release of glutamate from the central terminals of nociceptive afferents in the dorsal horn. This results in activation of AMPA receptors, which then depolarize the membrane relieving NMDA receptors from their Mg2+ block. NMDA receptor activation ends up in the consequent amplification of pain. Nociceptive Afferent Inflammation/Injury GLU Mg2 + NMDA AMPA Pain Amplification Dorsal Horn Neuron

PAGE 23

23 Figure 1 3. The Enteric Nervous System (ENS). View of the layers of the ENS in the colon; Longitudinal muscle (LM), Myenteric plexus (MP), Circular muscle (CM), Submucosal plexus (SP), Mucosa (MC). Neurons are numbered as follows; (1) Ascending interneurons, (2) In trinsic Primary Afferents Neurons (IPANs) of the MP, (3) Intestinofugal neurons that innervates the prevertebral ganglia (PVG), (4) Excitatory motor neurons to the LM, (5) Inhibitory motor neurons to the LM, (6) IPANs of the submucosal plexus, (7) Inhibito ry motor neurons to the CM, (8) Excitatory motor neurons to the CM, (9) Submucosal secretory and/or circulatory neurons, (10) Colo spinal Afferent Neurons (CANs) that innervates the spinal cord (SC), (11) Descending interneurons. Adapted from [12] Adapted from Furness 2006 9

PAGE 24

24 Figure 1 4 Transmission from motor neurons to gastrointestinal muscle. Motor neurons, both excitatory and inhibitory, release transmitter that acts on interstitial cells of Cajal (ICC). T he ICC cells are then electrically coupled to muscle cells through gap junctions. Adapted from [12]

PAGE 25

25 CHAPTER 2 GENERAL METHODS Animals All methods were approved by the University of Florida Institutional Animal Care and Use Committee. Male Sprague Dawley rats (300 350 g, N= 154 ) were maintained on a 12 hour light/dark cycle and fed standard rodent chow and water ad libitum Animals were weighted before and every day after all treatm ents. Tissue Collection Animals were euthanized with CO 2 /decapitation method. The skull was exposed using a surgical blade. The brain was then exposed by breaking into the skull using bone shears and scooped out using a small spatula. Approximately 300 g of Forebrain was collected. Brain tissue was deep frozen in liquid nitrogen and used for RNA and protein extractions. Intestinal tissues were collected from the descending colon and prepared according to the different protocols. Reverse Transcription P CR (R T P CR ) Total RNA was isolated from rat brain and colon tissues using RNeasy Mini Kit from Qiagen ( Valencia CA.). T arget transcripts were amplified with PCR primers from GenoMechanix (Gainesville, Fl) listed on Table 2 1. RT PCR reactions were carried o ut using Access RT PCR System from Promega ( Madison, WI ) and the following cycle conditions: 1 cycle at 48C for 45 minutes 94C for 2 minutes and 72C for 1 minutes 35 cycles of PCR (94C for 30 sec, 60C for 1 minutes 72C for 2 minutes ) and a final e longation period of 7 minutes at 72C. PCR products were separated on 1.2% agarose gel with 1X TBE buffer, view ed with ethidium bromide and analyzed with Bio Rad Gel Doc EQ Gel Documentation System, Bio Rad Laboratories (Hercules, CA) All the RT

PAGE 26

26 PCR produ cts were sequenced at the Genome Sequencing Services Laboratory (GSSL) part of the Interdisciplinary Center for Biotechnology Research (ICBR) at the University of Florida Gainesville, FL. W estern Blots Samples of tissue were taken from rat brain and desc ending colon. Tissue was homogenized in cold Cell Lysate Buffer ( 1mM Sodium Ortho Vanadate, 10 mM Tris and 1% SDS ) using a Sonics Vibra Cell Sonicator. Lysates were boiled for 5 min utes and then centrifuged at 16,000 g for 5 min utes and the supernatant was collected Protein concentration was determined by standard spectrophotometer method Proteins were separated using 4 20% Tris Glycine Gel from Invitrogen (Carlsbad, CA), each lane was loaded with 1 5 g of protein extract Proteins in the gel were then transferred to a Millipore (Bedford, MA) Immobilon P polyvinylidene fluoride membrane using a semi dry transfer device (Bio Rad Laboratories, Hercules, CA). The transfer buffer used contains 20% methanol 48 mM Tris pH 9.2, and 39 mM glycine. The membrane wa s then placed in TTBS buffer ( 20 mM Tris pH 7.6, 0.9% NaCl, and 0.05% Tween 20, pH 7.4 ) containing 5% non fat dry milk for 1 hour to block non specific binding of antibodies. NR1 splice variant specifi c primary antibodies were provide d by Dr. Michael Iadarola from The National Institute of Dental and Craniofacial Research ( NIDCR), Bethesda, MD (Antibodies selectivity was assessed in Caudle et al. 2005). Antibodies against Actin, NR1 NR2B and NR2D were purchased from different vendors (Table 2 2). After overnight incubation with primary antibody at 4C, the membrane wa s washed three times in TTBS (5 minutes each ) and then placed in fresh TTBS containing 5% non fat dry milk and secondary antibody [diluti on 1:4000] for rabbit or mouse IgG coupled to

PAGE 27

27 horse radish peroxidase (HRP) for 1 h ou r. The membrane is then washed three times with TTBS (5 minutes each ) and placed in chemiluminescence substrate (LumiGLO Cell Signaling Technology, Beverly, MA) and expo sed to film at variable times points (15 sec onds to 1 0 minutes) to ensure best resolution. TNBS Induced Colitis Colitis was induced in rats anesthetized with 3% isoflur ane in oxygen. Rats received an enema of 1 mL of TNBS (15 mg/ mL) in 50% ethanol using a polyethylene catheter ( 18 gauge; Fi sher Scientific, Pittsburgh, PA) t hat was inserted rectally 7 cm proximal to the anus. Animals were sacrificed at 7, 14, 21 a nd 28 days after TNBS treatment. Colo Rectal Distension Nave and TNBS treated rats underwent co lo rectal distension at 7, 14, 21 and 28 days. While anesthetized with 3% isoflurane in oxygen, a 4 cm balloon attached to a plastic tube ( 14 gauge ; Fisher Scientific, Pittsburgh, PA) was inserted rectally 2 3 cm proximal to the anus. The balloon was secur ed in place by taping the tube to the base of the tail and rats were contained in a plastic restraining device. The tube was then attached to a pressure transducer (Harvard Apparatus, Holliston, MA) connected to a LAB TRAX Data Acquisition System with Tran sducer Amplifier (World Precision Instruments, Sarasota, FL). Following recovery from anesthesia, the animals were allowed 10 minutes to acclimatize before behavioral testing began. Rats received phasic colon distension (0 80 mmHg) until the first contract ion of the testicles, tail, or abdominal musculature occurred. These responses are considered indicative of the first nociceptive response as previously described [39;40] The colonic distensions were repeat ed 3 times and the

PAGE 28

28 mean pressures at the nociceptive threshold were recorded for each rat. Data was then analyzed using the Data Trax 2 software (World Precision Instruments, Sarasota, FL). Mechanical Threshold Testing o n Hind Paws: v on Frey Mechanical hy persensitivity was measured using an electronic von Frey device (Dynamic Plantar Aesthesiometer, Ugo Basile, Italy). Rats were placed on a wire mesh floor in a plastic enclosure. Rats were left to acclimate for 20 minutes. Then, a fine filament was extende d up through the mesh floor and exerted an increa sing amount of pressure (max. 50 g) onto the rat s hind paw. The mechanical threshold was defined as the force in grams required until the rat withdrew its hind paw. The stimulus was repeated three times fol lowing a 5 min rest interval and the mean was calculated for each hind paw Myeloperoxidase Activity Assay Myeloperoxidase activity was assessed as described by Krauter et al [41] The descending colon was removed from nave rats, vehicle (ethanol) treated at 2 days and TNBS treated at 2, 7, 14 and 28 days. Colons were cut open along the mesenteric border and frozen in liquid nitrogen. Tissue segments weighing 100 200 mg were homogenized in po tassium phosphate buffer (50 mg/ mL 50 mM potassium phosphate, pH 6.0) and spun at 20, 000 g for 20 minutes. The supernatant was removed and HTAB buffer (Hexadecyltrimethyl ammonium Bromide: 5 g/L in 50 m M potassium phosphate buffer) was added T he pellet was homogenized and spun at 10 000 g. The samples were sonicated, frozen in liquid nitrogen thawed and spun at 10, 000 g for 10 minutes. This step was repeated twice. The le vel of myeloperoxidase (MPO) activity was determined from the total supernatant by adding 200 L of O dianisidine buffer (16.7 mg O dianisidine dihydrochloride in 5 m M phosphate buffer containing 0.005% H 2 O 2 ). The

PAGE 29

29 change in absorbance at 450 nm was determi ned every 30 seconds over a 3 minute period right after adding the O dianisidine buffer by a Synergy HT microplate reader (BioTek Instruments Winooski, VT). Values are expressed as units of MPO activity per gram of tissue sample where one unit of MPO is d efined as that which degrades 1 mol of hydrogen peroxide per minute. Immunohistochemistry Whole Mount Adapted from Rosa Molinar et al. 1999 [42] Segments of t issue from the descending colon (2 3cm) w ere remov ed and cut longitudinally. The segment s were spread and mounted onto slides containing a si licone base to enable pinning of the tissue to the slides. To defat the tissue, the se gment s were washed through a series of ethanol dilutions starting with 2 washes in 100% ethanol followed by single washes in 95%, 70%, and 50% ethanol for 20 minutes each Sections were incubated in distilled water overnight at 4C. The mucosa submucosal plexus and circular muscle l ayer s w ere then pealed from each tissue section and the remaining myenteric plexus layer placed in 4% paraformaldehyde overnight followed by 3 5 washes (5 min utes each ) in PBS. Tissu e sections were cleared (Fig. 2 1) by placing them in KOH (in PB S) and glycerin serial incubations: 3:1 0.5% KOH: glycerin for 1 hour 1:1 0.5% KOH: glycerin for 1 hour, 1:3 0.5% KOH: glycerin for 1 hour and 100% gl ycerin overnight. A few drops of 30% H 2 O 2 were added to both 1:1 and 1:3 KOH: glycerin incubations. After 3 5 washes (5 min utes each ) in PBS, the tissue was placed in blocking buffer containing 3% Normal Goat Serum (NGS) with PBS for 30 min utes then incub ated in the primary antibody (1:500 1:100) in 3% NGS/PBS, 1% Triton X 100 overnight at 4C. After 5 washes (10 min utes each ) in PBS, the tissue was incubated for 60 minutes in secondary antibodies, either

PAGE 30

30 Alexa Fluor 594 or Alexa Fluor 488 (1:2000, Molec ular Probes, Boston, MA ) with 1% NGS/PBS, 0.3% Triton X 100. The tissue was then washed 6 times (5 min utes each ) in PBS and placed in distilled water Tissues were then mounted into clean slides and coversliped with ProLong Antifade Kit mounting media (Mo lecular Probes, Boston, MA ). Slides were visualized with filters for red and green excitation. Images were photographed on an Olympus BX51 Fluorescence microscope (Olympus, Center Valley, PA). Cryostat Sections Descending colons were removed from nave and TNBS treated rats at 14 days. This time point was chosen since we previously found it to be the time at which NMDA receptor expression changes were most prominent [43] Tissues were then fixed in 4% Formalin for 24 hours and then preserved in 30% sucrose at 4C. Tissues were sectioned at 10 20 m on a cryostat, se rially mounted on a glass slide and air dried for 1 hour. Slides were treated with Target Retrieval Solution, pH 6 (Dako, Carpinteria, CA) for 24 hours at 60C. All preparations were washed 3 times (10 minutes each) in Phosphat e Buffered Saline (PBS, 10 m M sodium phosphate, pH 7.4, 0.9% NaCl). Slides were then incubated with goat anti VIP ( Santa Cruz Biotechnology, Santa Cruz, CA ) with either rabbit anti NOS (Chemicon, Temecula, CA), rabbit anti NR1 N1 or anti NR1 C1 (Provided b y Dr. Iadarola, NIDCR, Bethesda, MD) in 0.3% tween 20 in PBS for 24 hours at 4C. The sections were washed 3 times in PBS (10 minutes each) followed by 1 hour incubation in secondary antibodies The secondary antibodies were anti goat Alexa Fluor 488 and a nti rabbit Alexa Fluor 594 (Molecular Probes, Boston, MA) in 0.3% tween 20 in PBS. Negative controls were performed by incubating samples with only

PAGE 31

31 secondary antibodies and omitting primary antibodies (Fig. 2 2) After incub ation with secondary antibodies tissue was washed 3 times (10 minutes each) and coversliped with VECTASHIELD Mounting Medium with DAPI (Vector Laboratories, Burlingame, CA). The sections were visualized with filters for red, green and blue excitation. Images were photographed on a Leica DM LB2 Fluorescence microscope (Leica, Wetzlar, Germany). VIP Peptide Enzyme Immunoassay (EIA) Protocol Blood and colon tissues were collected from nave rats and TNBS treated rats, 2 hours and 14 days after enema. Blood was mixed with 6% EDTA to prevent coagulation. Samples were centrifuged at 2,000 g for 10 minutes at 4C. Plasma was removed and immediately placed on dry ice. Colon segments (2 cm) were incubated for 30 minutes with either saline, NMDA 1X (200 M), NMDA 10X (2 mM), MK 801 (10 M), NMDA 1X + MK 801 and NMDA 10X + MK 801. VIP levels were assessed by following a Peptide Enzyme Immunoassay (EIA) Protocol (Bachem Group, San Carlos, CA). Briefly, 50 L of samples, 25 L of VIP antiserum, and 25L of biotinylated tracer were mix into each well of a 96 well plate pre coated with anti rabbit secondary antibody and incubated at room temperature for two hours. The plate was then washed 5 times with buffer, and 100 L/well of streptavidin conjugated horseradish peroxidase were added, and the plate was incubated for one hour. The plate was then washed 5 times with buffer, and 100 L/well of TMB solution were added. The change in absorbance at 6 50 nm was determined every minute over 3 0 minutes using a Bio Tek Synergy HT Microplate reader. The reaction wa s terminated by adding 100uL 2 N HCL per well, and readings were taken again at 450nm. VIP concentration was calculated by comparing

PAGE 32

32 samples absorbance to a standard curve generated using the standard peptide provided with the kit. Ex Vivo Circular Muscle Colonic Contractility Assay Descending colon segments (1.5 2 cm) were removed from nave and TNBS treated rats at 14 days and mounted i n individual tissue chambers. Circular muscle c ontractions were recorded for 10 minutes while applying acetylcholine ( 200 M ) diluted in Mg 2+ free Tyrode solution ( mM : NaCl, 140; KCl, 4; CaCl 2 4; Glucose, 10; HEPES, 10; pH 7.4) and acetylcholine combined with NMDA (200 M ) and MK 801 (10 M ). Tissue was washed for 5 minutes with Mg 2+ free Tyrode solution before and after each trial and temperature was maintained at 35 o for the duration of the experiments. Circular muscle c ontractility was recorded using a MYOBATH II multi channel isolated tissue bath system combined with the LAB TRAX Data Acquisition System with a 4 chann el Transbridge amplifier and analyzed using the Data Trax 2 software (World Precision Instruments, Sarasota, FL). Data was then transferred to an Excel spreadsheet and the area under the contraction peaks was integrated. Colo Rectal Manometry: In Vivo Mot ility Nave and TNBS treated rats at 14 days were anesthetiz ed with 3% isoflurane in oxygen and a 4 cm balloon attached to a plastic tube (14 gauge ; Fisher Scientific, Pittsburgh, PA ) was inserted rectally 2 3 cm proximal to the anus. This tube was then attached to a pressure transducer (Harvard Apparatus, Holliston, MA) connected to a LAB TRAX Data Acquisition System with Transducer Amplifier (World Precision Instruments, Sarasota, FL). Attached to the balloon was a small polyethylene tube ( 30 gauge ; Fi sher Scientific, Pittsburgh, PA ) connected to a 1 mL syringe for drug delivery. Both tubes were secured with tape to the base of the tail and rats were contained in a

PAGE 33

33 plastic restraining device. The balloon was then maintained at a basal pressure of 10 mmH g. Contractions were recorded for 5 minutes before and after applying 0.2 mL of NMDA (14.3 mg / mL) or MK 801 (1.7 mg / mL) diluted in sterile saline (0.9% NaCl). Each trial was followed by a 3 minute 0.5 mL wash with saline. Data was analyzed using the Data T rax 2 software (World Precision Instruments, Sarasota, FL) and then transferred to an Excel spreadsheet and the area under the contraction peaks was integrated. Statistical Analyses Data was analyzed using ANOVAs. Post hoc tests were either Dunnetts or Bo nferronis tests. P values < 0.05 were considered to be significant and n values represent individual animals. GraphPad Prism software (version 4.0 for Windows, GraphPad Software, San Diego, CA) was used for all analyses.

PAGE 34

34 Table 2 1 RT PCR Primers Sequence s. All primers were purchased from GenoMechanix (Gainesville, Fl). RT PCR reactions were carried out using Access RT PCR System from Promega ( Madison, WI ) with the following cycle conditions: 1 cycle at 48C for 45 min, 94C for 2 min and 72C for 1 min, 3 5 cycles of PCR (94C for 30 sec, 60C for 1 min, 72C for 2 min) and a final elongation period of 7 min at 72C. Primer name Forward sequence Fwd Tm Reverse sequence Rev Tm Product length General NR1 general cagaaacccctcagacaagttc 59 o C cttctgtgaag cctcaaactcc 59 o C 213bp NR1 generic ccctcagacaagttcatctacgc 61 o C aggttcttcctccacacgttcac 61 o C 563bp GAPDH ccttcattgacctcaactacatggtcta 63 o C tagcccaggatgcccttt 55 o C 720bp Exon 5 or N1 NR1a Exon 5 ( ) NR1b Exon 5 (+) gcgagtctacaactggaaccac 61 o C ctcgc ttgcagaaaggatgatg 59 o C 170bp 235bp Exon 5+ inside ggaactatgaaaacctcgacc 58 o C NR1b Exon 5 Reverse 59 o C 158bp N1+ ( 1 N1+) accacttcactcccacccctgtctcctac 72 o C gtccgcgcttgttgtcata 61 o C 330bp N1 ( 1 N1 ) agctcaacgccacttctgtc 61 o C caccttctctgccttggactcac 6 5 o C 407bp Exon 21 or C1 C1 Use NR1 general Fwd or NR1 generic Fwd 59 o C 61 o C gttttgcaaagcgccgcgtcca 63 o C 717bp 710bp C1+ ( 1 C1+) tgtgtccctgtccatactcaag 60 o C gtcgggctctgctctaccac 62 o C 307bp Exon 22 or C2 NR1 Exon 22 catggcaggggtcttcatgctg 63 o C gaacacagctgcagctggccct 65 o C 318bp NR2 NR2A tatagagggtaaatgttgga 50 o C agaaactgtgaggcatttct 52 o C 322bp NR2B actgtgacaacccacccttc 58 o C cggaactggtccaggtagaa 58 o C 400bp NR2C tgtgtcaggccttagtgaca 56 o C ccacactgtctccagcttct 58 o C 402bp NR2D aagaagatcgat ggcgtctg 56 o C ggatttcccaatggtgaagg 56 o C 353bp All primers from GenoMechanix, Gainesville, Fl.

PAGE 35

35 Table 2 2 Antibodies used for Western Blots and Immunohistochemical Assays. Antibodies were purchased from different vendors and dilutions were prepared accor ding to vendors specifications. Incubation time for primary antibodies was 24 hours and 1 hour for secondary antibodies. Antibody Company Cat. No. Primary Antibodies Actin Mouse Chemicon, Temecula, CA. MAB1501 Neurofilament Mouse Sigma, Saint Louis, Missouri. N 5389 NR1 Mouse BD Biosciences Pharmigen, San Diego, CA. 556308 NR1 Rabbit Santa Cruz Biotechnology, Santa Cruz, CA. SC 9058 NR1 splice variants Rabbit Provided by Dr. Iadarola, NIDCR, Bethesda, MD. N/A NR2B Rabbit Santa Cruz Biotechnolo gy, Santa Cruz, CA. SC 9057 NR2B Mouse BD Biosciences Pharmigen, San Diego, CA. 610417 NR2D Rabbit Santa Cruz Biotechnology, Santa Cruz, CA. SC 10727 Protein Gene Product 9.5 Rabbit Chemicon, Temecula, CA. AB1761 Fluorescent Secondary Antibodies Ale xa Fluor 488 Mouse Molecular Probes, Eugene, OR. A21202 Alexa Flour 488 Rabbit Molecular Probes, Eugene, OR. A21206 Alexa Fluor 594 Mouse Molecular Probes, Eugene, OR. A21201 Alexa Flour 594 Rabbit Molecular Probes, Eugene, OR. A21442

PAGE 36

36 Figure 2 1. Clear colon tissue for whole mount preparations. (A) Colon tissue was pinned to silicon. (B) Using serial dilutions of potassium hydroxide (KOH) and glycerin, tissues were made almost completely transparent for whole mount immunohistochemistry.

PAGE 37

37 F igure 2 2. Immunohistochemistry negative controls. Colon tissue sections (20 m) were incubated with only secondary antibodies, either Alexa fluor 488 or Alexa fluor 594, and omitting primary antibodies L= lumen, M = mucosa, SP = submucosal plexus, CM = circula r muscle, MP = myenteric plexus, LM = longitudinal muscle.

PAGE 38

38 CHAPTER 3 EXPRESSION OF THE N METHYL D ASPARTATE RECEPTOR N R1 SPLICE VARIANTS AND NR2 SUB UNIT SUBTYPES IN THE RAT COLON Introduction The most clearly described ionotropic glutamate receptor subtyp e is the N methyl D aspartate (NMDA) receptors. NMDA receptors h ave two subunit families designated NR1 and NR2 [1] Functional NMDA receptors in mammals are heteromeric complexes containing NR1 and NR2 subunits [2] The NR1 subunit (Fig. 1 1) has only one gene which has three regions of alterna tive splicing, named the N1, C1 and C2 cassettes and results in eight possible splice variants. The N1 (exon 5) and C1 (exon 21) cassettes may be either present or absent without having an effect on the remaining NR1 structure Once the C2 cassette (exon 2 2) is spliced out the first stop codon is lost, resulting in the expression of the C2 cassette. The N1 cassette is located extracellularly and interacts with various p harmacological modulators of the channel, including zinc, protons and polyamines [6] The C terminal cassettes of the protein are localized intracellularly and control cell surface expression of NR1 P roteins with the shortest C terminal region (lacking the C1 cassette and containing C2 ; NR1 x00 ) show the highest cell surface expression [7] There are four members in the NR2 subunit family; NR2A, 2B, 2C and 2D. Expression of different NR2 subunits determines the ligand affin ity, antagonist sensitivity and deactivation kinetics of the NMDA receptors [2;9] The presence of L glutamate rec eptors, presumably of the NMDA type, was documented in the myenteric plexus of the guinea pig [44 48] Furthermore, the expression of the NMDA receptor NR1 subunit was characterized by in situ hybridization

PAGE 39

39 and PCR techniques in both the rat and guinea pig enteric plexuses [30;31] Also g lutamatergic receptors, including the NMDA type, were found in the enteric plexuses of the human colon [32] These findings together established the presence of NMDA receptors in the enteric nervous system (ENS). However, the roles of these enteric NMDA receptors are still not fully understood. Here we studied t he expression of the NMDA receptor NR1 protein splice variants and the NR2 subunit subtypes in the rat colon by using reverse transcription polymerase chain reaction (RT PCR), Western blot and immunohistochemistry. Results Expression of NR 1 P rot ein in the Rat Colon. T he expression of NR1 was examined in the rat colon (Fig. 3 1 ). W e used two different sets of primers to amplify by RT PCR (Fig. 3 1 A) the RNA extracted from intestine and brain tissues These primers (arbitrarily named NR1 general and generic) recognize d areas in the NR1 outside the spliced exons. The expression of NR1 was evid ent in the colon tissue (gastrointestinal, GI ) and the rat brain Rat brain was used as a positive control. S ample integrity and reaction reliability were validated with t he expression of the housekeeping gene, Glyceraldehyde 3 phosphate dehydrogenase (GAPDH ) in both the GI and the brain tissues. A n egative control ( RT) that lacked reverse transcriptase using GAPDH primers was included to control for genomic DNA contaminat ion. Protein expression was confirmed by western blot analyses that showed the NR1 protein in GI and brain tissues using general mouse NR1 antibody which recognize d a site outside of the alternatively spliced cassettes (Fi g. 3 1B, Top panel). T o control f or sample loading purposes, an antibody against A c tin was used.

PAGE 40

40 Furthermore, we visualized the double label of the NR1 protein with the neuronal markers; Protein Gene Product 9.5 (PGP 9.5) (Fig. 3 2A) and neurofilament (NF) (Fig. 3 2B) in the rat myenteric and submucosal plexuses using immunohistochemistry The co labeling of NR1 and the neuronal markers PGP and neurofilament verified that NR1 is localized in enteric neurons. E xpression of S splice V ariants of the NR 1 P rotein. After verifying the general exp ression of NR1 protein in the rat intestine, we examined the expression of the splice variants of NR1 using specific primers and antibodies with RT PCR and western blots R at brain contains all splice variant isoforms [49;50] thus, this tissue was used as a control in all our assays. Expression of the N1 C assette (exon 5) in the Rat C olon NR1 protein containing and lacking the N1 cassette wa s known to be present in both ra t brain [49;50] and spinal cord [38;51] T o analyze the expression of the N1 cassette in rat colon we performed RT PCR (Fig. 3 3 A) using four different set s of primers ( Table 2 1 ); NR1a(b), which pr oduced two different sized products, a 2 74 bp band in the presence of exon 5 or a 211 bp band in the absence of this cassette. Primers exon 5+ and N1+ that were designed inside the N1 cassette and only showed a band if this cassette wa s present. A lter natively N1 primers only showed a band if exon 5 wa s not present While brain samples expressed both the N1 splice variants, the rat colon only expressed the variant that lack ed N1 (NR1 0yz ). To verify these findings at the protein level western blot as says were performed. T he expected NR1 band around 118 kDa wa s present in brain but it was lacking in GI tissues (Fig. 3 3B). These results further suggested that only splice variants without the N1 cassette (NR1 0yz ) we re present in the rat colon

PAGE 41

41 Expressio n of C T erminal C assette s in the R at C olon. We analyze d the expression of the rat colon C1 cassette by RT PCR, using two sets of primers; C1 (with NR1 generic, see Table 2 1) and the C1+ primers [52] We fou nd with both sets of primers that the expected C1 band was present in brain but was absent from the rat colon ( Fig. 3 3C ) To confirm these findings, we blotted using an antibody targeted towards the C1 cassette We observed the expression of C1 containin g NR1 protein in brain but not in GI (Fig. 3 3D) Whe reas bands corresponding to the C1 cassette in both RT PCR and western blot analyses were present as expected in brain, none w ere visible in GI, suggesting that only the NR1 splice variants that lack ed t he C1 cassette (NR1 x0z ) were present in the rat colon RT PCR and western blot were used to assess the expression of the C2 and C2cassettes. RT PCR with primers for exon 22 showed a band for both GI and brain (Fig. 3 3E). For the western blot analyses we employ ed two different antibodies ; the C2+ antibody which target ed the C2 cassette and t he C2 antibody di rected against the C2 cassette. These antibodies showed expression of both the C2 and C2 cassettes in the rat brain and colon (Fig. 3 3F). T h e s e re sults suggest ed that both NR1 splice variants, the one that has the C2 cassette and the one that contains the C2 cassette (NR1 xx0 and NR1 xx1 ) we re present in the rat colon. These variants were visualized in the rat myenteric plexus by immunohistochemistry with Alexa fluor linked antibodies (Fig. 3 4). E xpression of NR2 P rotein S ubtypes. We used RT PCR with four different sets of primers to assess the expression the NR2 subunits (Fig. 3 5 A). Analyses of NR2A and NR2C demonstrated no bands for GI, while both NR2B and NR2 D were evident in GI and brain tissues. These results suggest ed that only NR2 B and NR2 D were present in the rat colon. These subunits were

PAGE 42

42 visualized in the rat myenteric plexus by immunohistochemistry with Alexa fluor linked antibodies (Fig. 3 5B). Moreover, we were able to visualize the double label of the NR 2B protein with the neuronal marker; Protein Gene Product 9.5 (PGP 9.5) (Fig. 3 5C) using immunohistochemistry The co labeling of NR2B and the neuronal marker PGP further verified that N R2B was localized in enteric neurons. Co labeling of NR1 with NR2B and NR2D in the Rat C olon In order to verify if NR2B and NR2D were co localize d with NR1 in the rat colon we used specific antibodies targeted to NR1, NR2B and NR2D. We visualized the dou ble labeling of NR1 with both NR2B and NR2D with immunohistochemistry using Alexa fluor linked secondary antibodies (Fig. 3 6). The co localization of NR1 with NR2B and NR2D suggest ed there were heteromeric complexes of these NR2 subtypes with NR1 in the r at colon Discussion Our studies confirmed the expression of NR1 protein in the rat myenteric and submucosal plexuses. We found that only the N R1 splice variants that contained the C2 o r the C2 cassette (NR1 000 and NR1 001 ) we re present in the rat colon. A lso, the NR2B and NR2D subunits we re the only NR2 subunit subtypes found in the rat colon The NMDA receptors in the rat colon were arranged in heteromeric complexes including the NR1 with NR2B and NR2D subunits. Lastly, these NMDA receptors co label with neuronal makers, PGP and Neurofilament, confirming their presence in the enteric neurons. The presence of the N1 cassette is known to cause a decrease in the open time of the NMDA receptor channel [53] and decrease the ability o f spermine to potentiate NMDA mediated currents [54] Since these enteric receptors lack ed the N1 cassette they

PAGE 43

43 would show an increase d pH, Zn 2+ and spermine s ensitivity similar to receptors with mutations at the N1 cassette [55] NR1 proteins with the shortest C terminal region (lackin g the C1 cassette and containing C2; NR1 x00 ) show ed the highest cell surface expression [7] The lack of the C 1 cassette also affect ed the PKC potentiation [4;56;57] and the calmodulin dependent inhibition [58] of these receptors currents. Recep tor clustering may be affected also, since the C1 cassette was shown to have speci fi c interactions with multiple intracellular proteins, including neuro fi lament L [59] and the cytoskeletal protein yotiao [60] Therefore these enteric NMDA recep tors which lacked both the N1 and C1 cassette may have an increased cell surface expression but poor clustering properties. Moreover, prior studies found that NR1 000 receptors were markedly less active than other splice forms like NR1 111 [4] in dicating that the NMDA receptors in the nave colon may not produce large currents in the neurons when activated. NR2A and NR2C are widely expressed throughout the whole brain, while the expression of NR2B shows differences in the intensity and distributio n [61] The NR2D expression is very faint and mutant mice defective in NR2D expression appear to develop normally [8] Not only the intensity and distribution of expression of the NR2 subunits is uni que, but their functional behavior differs. The offset decay time constant of the NRl/NR2B channel is ~400 msec, while the NR1/NR2D channel shows a very long offset decay time constant (~5000 msec) [9] Therefore, these NMDA receptors found in the nave colon are going to show different expression and fun ctional behavior depending if they contain NR2B or NR2D.

PAGE 44

44 To our knowledge th is is the first comprehensive analysis of the expression of the NMDA receptor NR1 protein splice variants and the NR2 subunit subtypes in the rat colon Therefore, more studies ar e needed to determine the specific properties of these receptors both in normal and pathological conditions.

PAGE 45

45 Figure 3 1. Expression of NR1 in the rat colon. (A) RT PCR analyses of NR1 in rat colon (named GI, for gastrointestinal) and brain tissues using two different set of primers; NR1 general and NR1 generic, that recognize areas in the NR1 outside the spliced exons. Assessment of housekeeping gene, GAPDH (Glyceraldehyde 3 phosphate dehydrogenase) was included as a control for sample integrity and reac tion fidelity. A negative control ( RT) was included which lacks Reverse transcriptase and uses GAPDH primers. (B) Top panel, western blot showing broad expression of NR1 protein in GI and brain tissues using general mouse NR1 antibody that recognizes a si te outside of the alternatively spliced cassettes. Bottom panel, an antibo dy against A ctin was use as a control for loading purposes

PAGE 46

46 Figure 3 2. Visualization of NR1 protein and neuronal markers; PGP and neurofilament in the rat colon. Immunohistochemi stry with Alexa fluor linked antibodies on transverse colon sections showing NR1 protein and neuronal marker protein gene product 9.5 (PGP 9.5) co expression (A) and NR1 protein and neuronal marker Neurofilament (NF) co labeling (B). Scale bar = 50 m. Sec tion thickness = 10 m. L = lumen, M = mucosa, SM = submucosal plexus, CM = circular muscle, MP = myenteric plexus, LM = longitudinal muscle, Arrow = ganglia, Arrow head = single cells.

PAGE 47

47 Figure 3 3. Expression of N R1 splice variants in the r at colon. (A ) Expression of N1 cassette (exon 5) in the rat colon RT PCR analyses of N1 cassette (exon 5) expression in rat colon and brain tissues using four different set s of primers; NR1a(b) ex on 5+, N1+ and N1 (B) Western Blot showing expression of N1 cassette containing NR1 protein in GI and brain tissues using antibody a gainst N1. (C) Expression of C1 cassette (exon 21) in the rat colon RT PCR results of C1 cassette (exon 21) expression in rat colon and brain tissues using two different set of primer s; C1 and C1+. (D ) W estern blot showing expression of C1 cassette containing NR1 protein using antibody targeted towards the C terminal of the C1 cassett e (exon 21). (E) Expression of C2 cassette (exon 22) in the rat colon RT PCR results of C2 cassette ( exon 22) expression in rat colon and brain tissues using primer s targeted to the C2 cassette. ( F ) W estern blot showing probing of C 2+ antibody which is targeted to the C2 cassette and C2 antibody directed against the C2 cassette Exon 5+ and NR1a(b) Exon 5+ and NR1a(b)

PAGE 48

48 Figure 3 4 Visualiza tion of the C2 and C2cassette s in the rat myenteric plexus. Whole mount immunohistochemistry showing the C2 cassette expression and the C2 cassette expression in the rat myenteric plexus using an Alexa fluor antibody. Scale bar = 50 m.

PAGE 49

49 Figure 3 5 Expression of NR2 subtypes in the rat colon. (A) RT PCR analyses of NR2A, NR2B, NR2C and NR2D expression in the rat colon and brain tissues using primers to detect the presence of each different NR2 subtype respectively. (B) Whole mount immunohistochemistr y showing the presence of the NR2B and NR2D proteins in the rat myenteric plexus using Alexa fluor linked ant ibodies. (C) Double labeling of NR2B and neuronal marker PGP 9.5. Scale bar = 5 0 m. Exon 5+ and NR1a(b)

PAGE 50

50 Figure 3 6. Co labeling of NR1 with NR2B and NR2D subunits in the rat colon. Transverse colon sections showing co labeling of the NR1 and NR2B (A) and the NR1 and NR2D proteins (B) in the rat colon using Alexa fluor linked antibodies. Scale bar = 50 m. M = mucosal crypts, CM = circular muscle, MP = myenteric plex us, LM = longitudinal muscle, Arrow = ganglia, Arrow head = single cells Exon 5+ and NR1a(b)

PAGE 51

51 CHAPTER 4 NMDA RECEPTOR MEDIAT ED CHANGES IN CONTRA CTILITY AFTER TNBS INDUCED COLITIS. Introduction Bowel disorders like i nflammatory bowel disease (IBD) and irritable bowel syndrom e (IBS) are one of the main reasons for visiting a gastroenterologist in America. IBS afflicts 12% of adults in the US. IBD, which refers to two chronic diseases that cause intestinal inflammation: ulcerati ve colitis and Crohn's disease, affect up to 1.4 m illion Americans. The most common symptoms of these disorders are alterations in bowel movements and the associated pain Th e NMDA receptor NR1 subunit is of particular interest because it is critical for the function of the NMDA receptor [62] NR1 has been characterized by in situ hybridization and PCR techniques in the rat [30] guinea pig [31] and human [32] enteric plexuses. NR1 was also co labeled with vasoactive intestinal peptide (VIP) in enteric neurons of the rat using double in situ hybridization [33] NMDA receptors are also expressed in postganglionic parasympathetic neurons of the rat larynx and esophag us and their activation may be associate d with VIP or NO release [34] Moreover, NMDA altered the c olonic peristaltic reflex in an in vitro model that retained sympathetic and parasympathetic innerv ations [35] NMDA produced concentration dependent tonic contractions of the rat rectum [36] Shafton et al. found that peripherally admini stered NMD A receptor antagonist ketamine reduces visceromotor responses and motility reflexes in vivo [37] These findings suggest that NMDA receptors are likely to be involved in peristalsis. We previously reported the expression of the N MD A receptor NR1 subunit splice variants in the rat myenteric plexus before and during inflammation. It was found that in

PAGE 52

52 untreated animals the NR1 splice variants are NR1 001 and NR1 000 [63] After trinitrobenzene sulfonic acid (TNBS) induced colitis the expression of NR1 protein and splice variants NR1 011 and NR1 111 wer e notably increased [43] The purpose of the current study was to determine the role of NMDA receptors in motility in normal and inflamed colons. R esults Inflammation after TNBS T reatment Inflammation in the TNBS induced model of coli tis has several indicators including transient weight loss after treatment. Animals treated with TNBS lost weight (13.7 3.2 g) during the first 2 7 days after the enema compared to controls (Fig. 4 1). Previous studies [41;64] found similar results indicating that colitis was effectively induced by TNBS. Treated animals stopped losing weight after day 14 and showed weights undistinguishable from controls by day 21 (Fig. 4 1). Visceral hypersensitivity to colo re ctal distension was increased in TNBS treated rats at 7, 14 and 21 days following TNBS administration when compared to controls and resolve d by day 28 (Fig. 4 2). Moreover, somatic hypersensitivity to m echanical threshold testing on hind Von Frey, was inc reased at 14 days after TNBS but not at 21 or 28 days (Fig. 4 3). These results are comparable to previous findings [43;65] Another marker of inflammation is an increase in the a ctivity of myeloperoxidase (MPO). MPO is an enzyme found in the intracellular granules of neutrophils and it is used as an indicator of neutrophil infiltration. The levels of MPO activity were significantly elevated 2 days after vehicle (ethanol saline, 1: 1) administration and 2,7 and 14 days after TNBS treatment when compared to control (nave) and 28 days (Fig. 4 4 ). This is in agreement to previous results reported by Krauter et al [41]

PAGE 53

53 NMDA R eceptors C o l ocalize with VIP and NOS in the R at C olon after C olitis. Here we found u sing i mmunohistochemistry that VIP co localizes with Nitric Oxide S ynthase ( NOS, Fig. 4 5 A C) VIP also co localizes with the NMDA receptors; NR1 C1 (NR1 x1x Fig. 4 5 D F) and NR1 N1 (NR1 1xx Fig. 4 5 G I) in the inflamed colon, 14 days after TNBS treatment Similar to our previous findings, NR1 C1 ( Fig. 4 5 J L) and NR1 N1 ( Fig. 4 5 M O) expression is barely detectable in non inflamed colons. Therefore, the NMDA receptors present after inflammation are localized in VIP/NOS containing neurons. Changes in VIP Concentration F ollowing TNBS T reatment Plasma concentration of the vasoactiv e intestinal peptide (VIP) was assessed using a peptide enzyme immunoassay (Bachem Group, San Carlos, CA) before, 2 hours and 14 days after TNBS treatment. VIP plasma concentration was significantly increased 2 hours following TNBS enema when compared to n ave animals and animals 14 days after TNBS treatment ( Fig. 4 6 ). We also looked at the effect of NMDA and MK 801 in the release of the VIP. Colon segments (2 cm) were incubated with either saline, NMDA 1X (200 M), NMDA 10X (2 mM), MK 801 (10 M), NMDA 1 X + MK 801 and NMDA 10X + MK 801. Similar to plasma results, VIP release in colons incubated in saline was significantly increased 2 hrs after TNBS when compared to nave animals and 14 days after TNBS. This enhanced VIP release was significantly inhibite d by NMDA (Fig. 4. 8 ). While, MK 801 seems to promote VIP release 14 days after TNBS induced colitis (4.9). NMDA R eceptor M ediated C hanges in M otility after TNBS C olitis E x vivo circular muscle contractility was studied u sing isolated col on segments from na ve and TNBS treated rats at 7, 14 21 and 28 days using a MYOBATH II multi

PAGE 54

54 channel bath system (World Precision Instruments, Sarasota, FL). No significant (P values > 0.05) differences were found between the circular muscle contractility of inflamed and control colons when activated with acetylcholine (ACh, 200 M ). Moreover, when circular muscle contractions were recorded in the presence of NMDA (200 M ) and the NMDA receptor antagonist MK 801 (10 M ) no differences were noticed ( Fig. 4 9 ). Employing a b as ic colo rectal manometry device the contractions of nave and 14 days TNBS treated rat colons were studied in vivo Contractions were recorded at a basal pressure of 10 mmHg and in the presence of NMDA (14.3 mg /mL ) or MK 801 (1.7 mg / mL). TNBS treated ani mals contractility was significantly increased when NMDA was administered locally compared to controls. Moreover, this effect was reversed by MK 801 ( Fig. 4 10 ). Since these effects were not seen in the circular muscle contractility of isolated colon segm ents it suggest s that NMDA receptor mediated changes in colonic motility after colitis requires extrinsic neuronal input. Discussion The purpose of this investigation was to determine the effects of NMDA and the NMDA receptor antagonist MK 801 in rat colo nic contractility following inflammation For this, we used the trinitrobenzene sulfonic acid (TNBS) induced colitis model. Following TNBS treatment rats showed transient weight loss, indicating that inflammation was effectively induced. We found as well t hat visceral hypersensitivity and somatic hypersensitivity were i ncreased in the inflamed animals, which is in agreement with our previous work [43] Also, the levels of myeloperoxidase (MPO) activity were augmented after TNBS administration. These results were similar to Krauter et al. findings [41] even though our MPO maximum values were slightly higher.

PAGE 55

55 This is most likely due to differ ences in the severity of the inflammatory insult (7.5 mg TNBS in 30% ethanol VS. 15 mg TNBS in 50% ethanol). We found that after TNBS treatment NR1 C1 and NR1 N1 co localize in the VIP/NOS containing neurons. The expression of both VIP and NOS was previou sly found in the enteric inhibitory motor neurons [66] They are also present in the intestino fugal neurons that project to the celiac and the inferior mesenteric ganglia [67 69] VIP and NOS have also been characterized in a unique population of neurons, colospinal afferent neurons (CANs), with a direct projection from the enteric nervous system to the central nervous system [13] Other studies have shown that VIP and NOS are pres ent on parasy mpathetic nerves that innervate the uterus the larynx and the esophagus [70;71] Moreover, activation of N MDA receptors expressed in post ganglionic parasympathetic neurons may be associate d with VIP or NO release [34] We also reported that VIP plasma concentration was significantly increased 2 hours following TNBS enema when compared to nave animals and animals 14 days after TNBS treatment. This is consistent with clinical studies in which the levels of VIP in fasting plasma were higher in IBS patients than in control group [72] Also, NMDA inhibits VIP release in vitro 2 hours after inflammation, while MK 801 promotes VIP release 14 days after TNBS treatment. The refore, alterations of VIP may play a role in the pathogenesis of inflammation and bowel disorders like IBS. We found using restrained, non anesthetized animals that inflamed colon contractility was significantly increased when NMDA was delivered in the l umen T his altered contractility was reversed by MK 801. T hese effects were not observed when circular muscle contractility was assessed in isolated colon segments Cosentino et al.

PAGE 56

56 found that NMDA altered peristalsis in their in vitro model, which was dep endent on the integrity of parasympathetic and sympathetic pathways [35] While, in an in vivo model Shafton et al. found that the NMDA receptor antagonist ketamine had an i nhibitory effect in motility reflexes [37] In conclusion, NMDA receptors were found to have role in contractility following colitis This NMDA receptor mediated effect in colonic motility requires modulation of VIP release.

PAGE 57

57 F igure 4 1 Weight loss following trinitrobenzene sulfonic acid (TNBS) administration. Graph shows the weight change in grams after TNBS treatment. Animals lost more weight at 2 days and 7 days after TNBS compared to 14 days, 21 days and control animals (n = 20 for control, n = 20 for Day 0, n = 20 for Day 2, n = 20 for Day 7, n = 12 for Day 14, n = 5 for Day 21; **P < 0.001, when compared to controls; ANOVA with Bonferronis posttests).

PAGE 58

58 Figure 4 2 Visceral hypersensitivity after TNBS treatment. Graph represent ing colo rectal distension scores in mmHg before and after TNBS. Animals show visceral hypersensitivity at 7, 14 and 21 days after TNBS which seems to resolve by 28 days after TNBS, compared to controls (n = 10 for 7 days, n = 15 for 14 days, n = 5 for 21 days, n = 8 for 28 days; *p < 0.05, **P < 0.001, when compared to controls; ANOVA with Bonferroni's posttests).

PAGE 59

59 Figure 4 3. Somatic hypersensitivity after TNBS treatment. Graph representing the m echanical threshold te sting on hind Von Frey, scores in grams of force Animals show somatic hypersensitivit y at 14 days after TNBS but not at 21and 28 days after TNBS ( n = 1 8 for 14 days, n = 12 for 21 days, n = 42 for 28 days; *p < 0.05, when compared to controls; ANOVA with Bonferroni's posttests). Mechanical threshold testing on hind paws following TNBS treatment Control 14 days TNBS 14 days Control 21 days TNBS 21 days Control 28 days TNBS 28 days 0 10 20 30 40 50Control TNBS Force / g

PAGE 60

60 Figure 4 4 Myeloperoxidase (MPO) activity following TNBS induced colitis. Graph shows the average myeloperoxidase (MPO) activity, indicating that the activity is elevated at 2 days after vehicle (ethanol) and at 2, 7 and 14 da y s after TNBS. MPO activity also remains slightly elevated 28 days after TNBS (for all conditions, n = 3 each with 8 replicates; *p < 0.05, **p < 0.01, when compared to controls; ANOVA with Dunnett s posttests).

PAGE 61

61 Figure 4 5 NMDA receptors present in th e VIP /NOS neurons of the rat myenteric plexus 14 days following TNBS treatment (A) Shows labeling for vasoactive intestinal peptide (VIP) in rat colon after TNBS (B) Labels for nitric oxide synthase (NOS) in rat colon after TNBS (C) Shows VIP and NOS co l abeled cells in yellow and DAPI nuclear stain in blue. (D) Labels for VIP in rat colon after TNBS (E) Labels for NMDA receptor NR1 C1 in rat colon after TNBS (F) Shows VIP and NR1 C1 co labeled cells in yellow and DAPI nuclear stain in blue. (G) Labels f or VIP in rat colon after TNBS (H) Labels for NMDA receptor NR1 N1 in rat colon after TNBS (I) Shows VIP and NR1 N1 co labeled cells in yellow and DAPI nuclear stain in blue. ( J ) Labels for VIP in nave rat colon ( K ) Labels for NMDA receptor NR1 C1 in n ave rat colon ( L ) Shows VIP and NR1 C1 co labeled cells in yellow and DAPI nuclear stain in blue. ( M ) Labels for VIP in nave rat colon ( N ) Labels for NMDA receptor NR1 N1 in nave rat colon. ( O ) Shows VIP and NR1 N1 co labeled cells in yellow and DAPI nuclear stain in blue. Scale bar 50 m.

PAGE 62

62 Figure 4 6 VIP in plasma after TNBS treatment. Plasma concentration of VIP was assessed in nave animals and after TNBS treatment at the 2 hours and 14 days time points using a peptide enzyme immunoassay (n = 4 for all conditions, *p < 0.05, when compared to controls; ANOVA with Dunnett s posttests)

PAGE 63

63 Figure 4 7 NMDA receptor effect in VIP release 2 hours after TNBS treatment. VIP released from colon segments was assessed in nave an imals and 2 hours after TNBS treatment in the presence of NMDA (200 M) and MK 801 (10 M) using a peptide enzyme immunoassay (n = 4 for all conditions, *p < 0.05, when compared to controls; ANOVA with Dunnetts posttests).

PAGE 64

64 Fi gure 4 8 NMDA receptor effect i n VIP release 14 days after TNBS treatment. VIP released from colon segments was assessed in nave animals and 14 days after TNBS treatment in the presence of NMDA (200 M) and MK 801 (10 M) using a peptide enzyme immunoass ay (n = 4 for all conditions, *p < 0.0 01 when compared to controls; ANOVA with Dunnetts posttests).

PAGE 65

65 Figure 4 9 Ex Vivo contractility follo wing TNBS induced colitis. (A) Shows an example of the contraction recordings of colon segments in control anima ls or 14 days after TNBS treatment. Contractions were recorded in the presence of 200 mol L 1 acetylcholine (ACh) alone or combined with 200 mol L 1 NMDA and 10 mol L 1 MK 801. (B) Graph ical representations of recordings of colon segments contractility at 7 days (n=23 for nave, n=24 for TNBS), 14 days (n=16 for nave, n=17 for TNBS) 21 days (n=44 for nave, n=41 for TNBS), and 28 days (n=30 for nave, n=29 for TNBS) after treatment. Data is shown as the integrated area under the contraction peaks ( No s ignificant differences found if P < 0.0 5 when compared to controls; ANOVA with Bonferronis posttests).

PAGE 66

66 Figure 4 10 Colo rectal Manometry: In Vivo motility after TNBS. (A) Shows an example of the contraction recordings at 10 mmHg and in the presence of NMDA or MK 801 in control and 14 days TNBS treated rats. (B) Graph demonstrates the combined contractility of five rats. Animals were restrained and non anesthetized during colo rectal manometry. Data is shown as the integrated area under the contractio n peaks (n = 5, *p < 0.05, when compared to controls; ANOVA with Bonferronis posttests).

PAGE 67

67 CHAPTER 5 CONCLUSIONS AND FUTU RE CONSIDERATIONS NMDA Receptors in the Enteric Nervous System in the Nave Rat Colon We confirmed the expression of NR1 protein in th e nave rat myenteric and submucosal plexuses Our studies reported that only the N R1 splice variants that contained the C2 o r the C2 cassette (NR1 000 and NR1 001 ) we re present in the nave rat colon Also, the only NR2 subunit subtypes found in the nave rat colon were the NR2B and NR2D subunits. Moreover the se NMDA receptors were arranged in heteromeric complexes including the NR1 with NR2B and NR2D subunits. The N1 cassette is known to cause a decrease in the open time of the NMDA receptor channel [53] and decrease s the ability of spermine to potentiate NMDA mediated currents [54] Since these enteric receptors lack ed the N1 cassette they would show an increase d pH, Zn 2+ and spermine s ensitivity similar to r eceptors with mutations at the N1 cassette [55] NR1 proteins with the shortest C terminal region (lacking the C1 cassette and containing C2; NR1 x00 ) have the highest cell surface expression [7] The absence of the C 1 cassette also affect s the PKC potentiation [4;56;57] receptor clustering and the calmodulin dependent inhibition [58] of these receptors currents In addition, the C1 cassette affects r ecep tor clustering. [59;60] C onsequently these enteric NMDA receptors lacking the N1 and C1 cassette may have an increased cell surface expression but poor clustering prop erties. Furthermore, previous studies found that NR1 000 receptors were markedly less active than other splice forms like NR1 111 [4] indicating that enteric NMDA receptors in the nave colon may not produce large currents when activated.

PAGE 68

68 Funct ional NMDA receptor channels in mammals are considered to be produced only when the NR1 subunit is expressed together with one or more of the four NR2 sub units [2] While the NR1 is widely expressed throughout the whole brain, the expression of the NR2 subunits is highly regulated. The distributions of NR2A and NR2C have temporal and spatial similarities to that of NR1, while the expression of NR2B shows differences in the intensity and distribution [61] NR2D expression in the brain is very faint compared to other NR2s, and mutant mice defective in NR2D expressi on appear to develop normally [8] Not only the intensity and distribution of expression of the NR2 subunits is unique, but their functional behavior differs. The offse t decay time constant of the NRl/NR2B channel is ~400 msec, while the NR1/NR2D channel shows a very long offset decay time constant (~5000 msec) [9] Therefore, these NMDA receptors found in the nave colon are going to show different expression and functional behavior depending if they contain NR2B or NR 2D. NMDA Receptors in the Enteric Nervous System after TNBS Induced Colitis Based on our previous findings [43;63] the hypothesis for this portion of our work was that NMDA receptors expression in the rat colon changes after trinitrobenzene sulfonic acid (TNBS) induced colitis. These changes in NMDA receptor expression would then medi ate changes in colonic motility. Regulation of colonic contractility through NMDA receptors could then modulate bowel function and relieve pain T o determine the effects of NMDA and the NMDA receptor antagonist MK 801 in rat colonic contractility following inflammation we used the TNBS induced colitis model. After TNBS enema, rats showed weight loss, which is an indication that inflammation was effectively induced. We reported an increase in visceral hypersensitivity in response to colo rectal distension in the animals with colitis, which is

PAGE 69

69 in agreement with our previous work [43] Moreover, the levels of myeloperoxidase (MPO) activity were higher after TNBS administration, similar to prior reports [41] We also found that after TNBS treatment, NR1 C1 and NR1 N1 co label with the VIP/NOS containing neurons. VIP and NOS expression was previously characterized in the enteric inhibitory motor n eurons [66] intestino fugal neurons [67 69] colospinal afferent neurons (CANs) [13] and parasy mpathetic nerves [70;71] Furthermore, activati on of N MDA receptors expressed in post ganglionic parasympathetic neurons may be associate d with VIP or NO release [34] We reported that VIP plasma concentration was significantly increased 2 hours following TNBS enema. Moreover, similar to plasma results, VIP in vitro release in colon segments was significantly increased 2 hrs after inflammation when compared to nave animals and 14 days after TNBS. This enhanced VIP release was significantly inhi bited by NMDA. While, MK 801 promotes VIP release 14 days after TNBS induced colitis. This is consistent with clinical studies in which the levels of VIP in fasting plasma were higher in IBS patients than in control group [72] Therefore, alterations of VIP may play a ro le in the pathogenesis of inflammation and bowel disorders like IBS. Our in vivo manometry studies showed that inflamed colon contractility was significantly increased in the presence of NMDA and this effect was reversed by MK 801. However, when circular m uscle contractility was assessed in isolated colon segments the se effects were not observed. Literature shows that NMDA can alter peristalsis in an in vitro model, which was dependent on the integrity of parasympathetic and sympathetic pathways [35] While, Shafton et al. found in their in vivo model that the NMDA receptor antagonist ketamine had an inhibitory effect in motility reflexes [37]

PAGE 70

70 These results taken together suggest that NMDA receptor mediated changes in intestinal motility are mediated by extrinsic neuronal input. These NMDA receptors could be localized in parasympathetic neurons or colospinal afferent neurons that activate excitatory m otor neurons via intrinsic interneurons Excitatory motor neuron activation then increases contractility. If conversely, these NMDA receptors were localized in the inhibitory motor neurons or sympathetic neurons we would have expected to see a decrease in contractility. In conclusion, NMDA receptors in the nave colon are heteromeric complexes of either NR1 000 or NR1 001 with NR2B and/or NR2D The enteric NMDA receptors were also co labeled with the vasoactive intestinal peptide (VIP). W e know that an inflam matory process like the TNBS enema induces an increase in contractility, diarrhea, in order to prevent further damage. We propose that in order revert this exacerbated motility, 2 hours after TNBS treatment, VIP release in the colon is increased to promote relaxation. Then, 14 days after TNBS inflammation, NMDA receptor expression changes and more active splice variants ( NR1 000 or NR1 001 ) are present in the colon. Activation of these NMDA receptors inhibits the now pathological VIP release and encourages c ontractility (Fig. 5 1) Therefore, after colitis, NMDA receptor activation increases contractility by inhibiting relaxation (VIP release). While, MK 801 decreases colon motility by promoting VIP release. Clinical Implications S elective changes in the expr ession of the NR1 splice variants and possibly the NR2 subunit subtypes of the NMDA receptors may be an element for the ongoing visceral hypersensitivity in conditions such as inflammatory bowel disease (IBD) and irritable bowel syndrome (IBS) Previous st udies using NMDA receptor antagonists

PAGE 71

71 showed promising inhibitory effects on models of visceral hypersensivity [32;76 78] The intravenous administration of NMDA receptor antagonist m emantine inhibited pain responses to noxious mechanical stimuli [77] Intrathecal administration (10 nmol) of MK 801 was sufficient to significantly attenuate the hyperalgesic visceromotor responses to colonic distention after zymosan induced inflammation [76] In a similar inflammat ion model, the administration of both intrathecal MK 801 (1.5 nmol) and i ntraperitoneal MK 801 (0.15 mg/kg) completely abolished the colorectal distension induced hypersensitivity of both noxious and innocuous stimuli [78] The drugs in these studies seemed to be working at the levels of the spinal cord and primary afferent neurons. Future Considerations More studies are needed to determine the specific properties of the NMDA receptors, both in normal and pathological conditions. Zhou et al. 2008, found that 16 weeks after TNBS treatment, after inflammation resolution, 24% of the treated rats still exhibit visceral and somatic hypersensitivity [79] It would be interesting to see if this subset of animals also contain s the NMDA receptor splice variants present only after inflammation (NR1 011 and NR1 111 ). Moreover, we could study i f these also retain the NMDA mediated ch anges in colonic contractility and VIP release. Changes in NMDA receptor subtype expression can also be studied in colonic biopsies of patients with irritable bowel syndrome (IBS). Finally bowel disorders like irri table bowel syndrome has an incidence among women twice as high as men [19] in the US. It would be interesting to see if there are biological sex differences in the colonic motility before and after TNBS treatment.

PAGE 72

72 Therefore, a better understanding of the expression, physiology and pharmacological properties of the NMDA receptors present in the enteric nervous system could lead to the development of drugs that selectiv ely modulate the bowel function and inhibits visceral pain.

PAGE 73

73 Figure 5 1. Mechanism Model NMDA receptors in the nave colon contain NR1 000 or NR1 001 with NR2B and/or NR2D The enteric NMDA receptors were also co labeled with the vasoactive intestinal peptide ( VIP). We know that an inflammatory process like the TNBS enema induces an increase in contractility, diarrhea, in order to prevent further damage. We propose that in order revert this exacerbated motility, 2 hours after TNBS treatment, VIP release in the c olon is increased to promote relaxation. Then, 14 days after TNBS inflammation, NMDA receptor expression changes and more active splice variants ( NR1 000 or NR1 001 ) are present in the colon. Activation of these NMDA receptors inhibits the now pathological VIP release and encourages contractility (Fig. 5 1). Therefore, after colitis, NMDA receptor activation increases contractility by inhibiting relaxation (VIP release). While, MK 801 decreases colon motility by promoting VIP release. Nave 2 hours 14 days TNBS enema induced colitis Increas ed VIP release Increase relaxation Normal state, low activity NMDARs: NR1 000 + NR1 001 Diseased state, high activity NMDARs: NR1 011 + NR1 111 Vasoactive intestinal peptide (VIP) Diarrhea Increased motility Increased NMDARs express ion Splice variant switch More active NMDARs TIME Decreased motility VIP release inhibition NMDA MK 801 VIP inhibition Increased contractility VIP release Decreased contractility

PAGE 74

74 LIST OF REFERENCES 1. Mi chaelis,E.K., Two different families of NMDA receptors in mammalian brain: physiological function and role in neuronal development and degeneration, Adv. Exp. Med. Biol., 341 (1993) 119 128. 2. McBain,C.J., Mayer,M.L., N methyl D aspartic acid receptor struc ture and function, Physiol Rev., 74 (1994) 723 760. 3. Yamakura,T., Shimoji,K., Subunit and site specific pharmacology of the NMDA receptor channel, Prog. Neurobiol., 59 (1999) 279 298. 4. Durand,G.M., Bennett,M.V., Zukin,R.S., Splice variants of the N methyl D aspartate receptor NR1 identify domains involved in regulation by polyamines and protein kinase C, Proc. Natl. Acad. Sci. U. S. A, 90 (1993) 6731 6735. 5. Zukin,R.S., Bennett,M.V., Alternatively spliced isoforms of the NMDARI receptor subunit, Trends Neurosc i., 18 (1995) 306 313. 6. Dingledine,R., Borges,K., Bowie,D., Traynelis,S.F., The glutamate receptor ion channels, Pharmacol. Rev., 51 (1999) 7 61. 7. Okabe,S., Miwa,A., Okado,H., Alternative splicing of the C terminal domain regulates cell surface expression of the NMDA receptor NR1 subunit, J. Neurosci., 19 (1999) 7781 7792. 8. Ikeda,K., Araki,K., Takayama,C., Inoue,Y., Yagi,T., Aizawa,S., Mishina,M., Reduced spontaneous activity of mice defective in the epsilon 4 subunit of the NMDA receptor channel, Brain Res. M ol. Brain Res., 33 (1995) 61 71. 9. Mori,H., Mishina,M., Structure and function of the NMDA receptor channel, Neuropharmacology, 34 (1995) 1219 1237. 10. Woolf,C.J., Thompson,S.W., The induction and maintenance of central sensitization is dependent on N methyl D aspartic acid receptor activation; implications for the treatment of post injury pain hypersensitivity states, Pain, 44 (1991) 293 299. 11. Willert,R.P., Woolf,C.J., Hobson,A.R., Delaney,C., Thompson,D.G., Aziz,Q., The development and maintenance of human visc eral pain hypersensitivity is dependent on the N methyl D aspartate receptor, Gastroenterology, 126 (2004) 683 692. 12. Furness,J.B., The Enteric Nervous System, Blackwell Publishing, Inc., 2006. 13. Suckow,S.K., Caudle,R.M., Identification and immunohistochemical characterization of colospinal afferent neurons in the rat, Neuroscience, 153 (2008) 803 813.

PAGE 75

75 14. Costa,M., Furness,J.B., Neuronal peptides in the intestine, Br. Med. Bull., 38 (1982) 247 252. 15. Waterman,S.A., Tonini,M., Costa,M., The role of ascending excitato ry and descending inhibitory pathways in peristalsis in the isolated guinea pig small intestine, J. Physiol, 481 ( Pt 1) (1994) 223 232. 16. Waterman,S.A., Costa,M., The role of enteric inhibitory motoneurons in peristalsis in the isolated guinea pig small int estine, J. Physiol, 477 ( Pt 3) (1994) 459 468. 17. Sanders,K.M., Koh,S.D., Ward,S.M., Interstitial cells of cajal as pacemakers in the gastrointestinal tract, Annu. Rev. Physiol, 68 (2006) 307 343. 18. Schmidt,C., Stallmach,A., Etiology and pathogenesis of inflam matory bowel disease, Minerva Gastroenterol. Dietol., 51 (2005) 127 145. 19. Mertz,H.R., Irritable bowel syndrome, N. Engl. J. Med., 349 (2003) 2136 2146. 20. O'Sullivan,M.A., Mahmud,N., Kelleher,D.P., Lovett,E., O'Morain,C.A., Patient knowledge and educational ne eds in irritable bowel syndrome, Eur. J. Gastroenterol. Hepatol., 12 (2000) 39 43. 21. Spiller,R.C., Inflammation as a basis for functional GI disorders, Best. Pract. Res. Clin. Gastroenterol., 18 (2004) 641 661. 22. Parry,S., Forgacs,I., Intestinal infection and irritable bowel syndrome, Eur. J. Gastroenterol. Hepatol., 17 (2005) 5 9. 23. Thompson,W.G., Longstreth,G.F., Drossman,D.A., Heaton,K.W., Irvine,E.J., Muller Lissner,S.A., Functional bowel disorders and functional abdominal pain, Gut, 45 Suppl 2 (1999) II43 II 47. 24. Mayer,E.A., Raybould,H.E., Role of visceral afferent mechanisms in functional bowel disorders, Gastroenterology, 99 (1990) 1688 1704. 25. Mayer,E.A., Gebhart,G.F., Basic and clinical aspects of visceral hyperalgesia, Gastroenterology, 107 (1994) 271 293. 26. V erne,G.N., Robinson,M.E., Price,D.D., Hypersensitivity to visceral and cutaneous pain in the irritable bowel syndrome, Pain, 93 (2001) 7 14. 27. Verne,G.N., Price,D.D., Irritable bowel syndrome as a common precipitant of central sensitization, Curr. Rheumatol. Rep., 4 (2002) 322 328. 28. Verne,G.N., Himes,N.C., Robinson,M.E., Gopinath,K.S., Briggs,R.W., Crosson,B., Price,D.D., Central representation of visceral and cutaneous hypersensitivity in the irritable bowel syndrome, Pain, 103 (2003) 99 110.

PAGE 76

76 29. Talley,N.J., Dru g therapy options for patients with irritable bowel syndrome, Am. J. Manag. Care, 7 (2001) S261 S267. 30. Burns,G.A., Stephens,K.E., Benson,J.A., Expression of mRNA for the N methyl D aspartate (NMDAR1) receptor by the enteric neurons of the rat, Neurosci. Let t., 170 (1994) 87 90. 31. Broussard,D.L., Li,X., Pritchett,D.B., Lynch,D., Bannermann,P.G., Pleasure,D., The expression of a NMDA receptor gene in guinea pig myenteric plexus, Neuroreport, 5 (1994) 973 976. 32. Giaroni,C., Zanetti,E., Chiaravalli,A.M., Albarello,L ., Dominioni,L., Capella,C., Lecchini,S., Frigo,G., Evidence for a glutamatergic modulation of the cholinergic function in the human enteric nervous system via NMDA receptors, Eur. J. Pharmacol., 476 (2003) 63 69. 33. Burns,G.A., Stephens,K.E., Expression of m RNA for the N methyl D aspartate (NMDAR1) receptor and vasoactive intestinal polypeptide (VIP) co exist in enteric neurons of the rat, J. Auton. Nerv. Syst., 55 (1995) 207 210. 34. Robertson,B.S., Satterfield,B.E., Said,S.I., Dey,R.D., N methyl D aspartate rec eptors are expressed by intrinsic neurons of rat larynx and esophagus, Neurosci. Lett., 244 (1998) 77 80. 35. Cosentino,M., De Ponti,F., Marino,F., Giaroni,C., Leoni,O., Lecchini,S., Frigo,G., N methyl D aspartate receptors modulate neurotransmitter release an d peristalsis in the guinea pig isolated colon, Neurosci. Lett., 183 (1995) 139 142. 36. Jankovic,S.M., Milovanovic,D., Matovic,M., Iric Cupic,V., The effects of excitatory amino acids on isolated gut segments of the rat, Pharmacol. Res., 39 (1999) 143 148. 37. Sh afton,A.D., Bogeski,G., Kitchener,P.D., Sanger,G.J., Furness,J.B., Shimizu,Y., Effects of NMDA receptor antagonists on visceromotor reflexes and on intestinal motility, in vivo, Neurogastroenterol. Motil., 19 (2007) 617 624. 38. Prybylowski,K.L., Grossman,S.D. Wrathall,J.R., Wolfe,B.B., Expression of splice variants of the NR1 subunit of the N methyl D aspartate receptor in the normal and injured rat spinal cord, J. Neurochem., 76 (2001) 797 805. 39. Ness,T.J., Gebhart,G.F., Colorectal distension as a noxious visc eral stimulus: physiologic and pharmacologic characterization of pseudaffective reflexes in the rat, Brain Res., 450 (1988) 153 169. 40. Wesselmann,U., Czakanski,P.P., Affaitati,G., Giamberardino,M.A., Uterine inflammation as a noxious visceral stimulus: behav ioral characterization in the rat, Neurosci. Lett., 246 (1998) 73 76.

PAGE 77

77 41. Krauter,E.M., Strong,D.S., Brooks,E.M., Linden,D.R., Sharkey,K.A., Mawe,G.M., Changes in colonic motility and the electrophysiological properties of myenteric neurons persist following r ecovery from trinitrobenzene sulfonic acid colitis in the guinea pig, Neurogastroenterol. Motil., 19 (2007) 990 1000. 42. Rosa Molinar,E., Proskocil,B.J., Ettel,M., Fritzsch,B., Whole mount procedures for simultaneous visualization of nerves, neurons, cartilag e and bone, Brain Res. Brain Res. Protoc., 4 (1999) 115 123. 43. Zhou,Q., Caudle,R.M., Price,D.D., Valle Pinero,A.Y., Verne,G.N., Selective up regulation of NMDA NR1 receptor expression in myenteric plexus after TNBS induced colitis in rats, Mol. Pain, 2 (200 6) 3. 44. Moroni,F., Luzzi,S., Franchi Micheli,S., Zilletti,L., The presence of N methyl D aspartate type receptors for glutamic acid in the guinea pig myenteric plexus, Neurosci. Lett., 68 (1986) 57 62. 45. Luzzi,S., Zilletti,L., Franchi Micheli,S., Gori,A.M., Mo roni,F., Agonists, antagonists and modulators of excitatory amino acid receptors in the guinea pig myenteric plexus, Br. J. Pharmacol., 95 (1988) 1271 1277. 46. Shannon,H.E., Sawyer,B.D., Glutamate receptors of the N methyl D aspartate subtype in the myenteric plexus of the guinea pig ileum, J. Pharmacol. Exp. Ther., 251 (1989) 518 523. 47. Alesiani,M., Pellegrini Giampietro,D.E., Cherici,G., Galli,A., Moroni,F., The guinea pig myenteric plexus as a tool to characterize drugs active at the glycine recognition site of the NMDA receptors, Pharmacol. Res., 22 Suppl 1 (1990) 15 16. 48. Wiley,J.W., Lu,Y.X., Owyang,C., Evidence for a glutamatergic neural pathway in the myenteric plexus, Am. J. Physiol, 261 (1991) G693 G700. 49. Sugihara,H., Moriyoshi,K., Ishii,T., Masu,M., Nakani shi,S., Structures and properties of seven isoforms of the NMDA receptor generated by alternative splicing, Biochem. Biophys. Res. Commun., 185 (1992) 826 832. 50. Laurie,D.J., Putzke,J., Zieglgansberger,W., Seeburg,P.H., Tolle,T.R., The distribution of splice variants of the NMDAR1 subunit mRNA in adult rat brain, Brain Res. Mol. Brain Res., 32 (1995) 94 108. 51. Tolle,T.R., Berthele,A., Laurie,D.J., Seeburg,P.H., Zieglgansberger,W., Cellular and subcellular distribution of NMDAR1 splice variant mRNA in the rat lu mbar spinal cord, Eur. J. Neurosci., 7 (1995) 1235 1244. 52. Liesi,P., Stewart,R.R., Akinshola,B.E., Wright,J.M., Weaver cerebellar granule neurons show altered expression of NMDA receptor subunits both in vivo and in vitro, J. Neurobiol., 38 (1999) 441 454.

PAGE 78

78 53. R umbaugh,G., Prybylowski,K., Wang,J.F., Vicini,S., Exon 5 and spermine regulate deactivation of NMDA receptor subtypes, J. Neurophysiol., 83 (2000) 1300 1306. 54. Mott,D.D., Doherty,J.J., Zhang,S., Washburn,M.S., Fendley,M.J., Lyuboslavsky,P., Traynelis,S.F., D ingledine,R., Phenylethanolamines inhibit NMDA receptors by enhancing proton inhibition, Nat. Neurosci., 1 (1998) 659 667. 55. Traynelis,S.F., Burgess,M.F., Zheng,F., Lyuboslavsky,P., Powers,J.L., Control of voltage independent zinc inhibition of NMDA receptor s by the NR1 subunit, J. Neurosci., 18 (1998) 6163 6175. 56. Logan,S.M., Rivera,F.E., Leonard,J.P., Protein kinase C modulation of recombinant NMDA receptor currents: roles for the C terminal C1 exon and calcium ions, J. Neurosci., 19 (1999) 974 986. 57. Zheng,X., Zhang,L., Wang,A.P., Bennett,M.V., Zukin,R.S., Ca2+ influx amplifies protein kinase C potentiation of recombinant NMDA receptors, J. Neurosci., 17 (1997) 8676 8686. 58. Ehlers,M.D., Zhang,S., Bernhadt,J.P., Huganir,R.L., Inactivation of NMDA receptors by dire ct interaction of calmodulin with the NR1 subunit, Cell, 84 (1996) 745 755. 59. Ehlers,M.D., Fung,E.T., O'Brien,R.J., Huganir,R.L., Splice variant specific interaction of the NMDA receptor subunit NR1 with neuronal intermediate filaments, J. Neurosci., 18 (199 8) 720 730. 60. Lin,J.W., Wyszynski,M., Madhavan,R., Sealock,R., Kim,J.U., Sheng,M., Yotiao, a novel protein of neuromuscular junction and brain that interacts with specific splice variants of NMDA receptor subunit NR1, J. Neurosci., 18 (1998) 2017 2027 61. Takai, H., Katayama,K., Uetsuka,K., Nakayama,H., Doi,K., Distribution of N methyl D aspartate receptors (NMDARs) in the developing rat brain, Exp. Mol. Pathol., 75 (2003) 89 94. 62. Ishii,T., Moriyoshi,K., Sugihara,H., Sakurada,K., Kadotani,H., Yokoi,M., Akazawa,C., Shigemoto,R., Mizuno,N., Masu,M., ., Molecular characterization of the family of the N methyl D aspartate receptor subunits, J. Biol. Chem., 268 (1993) 2836 2843. 63. Del Valle Pinero,A.Y., Suckow,S.K., Zhou,Q., Perez,F.M., Verne,G.N., Caudle,R.M., Iadarola,M. J., Expression of the N methyl D aspartate receptor NR1 splice variants and NR2 subunit subtypes in the rat colon, Neuroscience, 147 (2007) 164 173.

PAGE 79

79 64. Lomax,A.E., O'Hara,J.R., Hyland,N.P., Mawe,G.M., Sharkey,K.A., Persistent alterations to enteric neural sig naling in the guinea pig colon following the resolution of colitis, Am. J. Physiol Gastrointest. Liver Physiol, 292 (2007) G482 G491. 65. Zhou,Q., Price,D.D., Caudle,R.M., Verne,G.N., Visceral and somatic hypersensitivity in TNBS induced colitis in rats, Dig. Dis. Sci., 53 (2008) 429 435. 66. Costa,M., Furness,J.B., Pompolo,S., Brookes,S.J., Bornstein,J.C., Bredt,D.S., Snyder,S.H., Projections and chemical coding of neurons with immunoreactivity for nitric oxide synthase in the guinea pig small intestine, Neurosci. Lett., 148 (1992) 121 125. 67. Dalsgaard,C.J., Hokfelt,T., Schultzberg,M., Lundberg,J.M., Terenius,L., Dockray,G.J., Goldstein,M., Origin of peptide containing fibers in the inferior mesenteric ganglion of the guinea pig: immunohistochemical studies with anti sera to substance P, enkephalin, vasoactive intesti nal polypeptide, cholecystokinin and bombesin, Neuroscience, 9 (1983) 191 211. 68. Costa,M., Furness,J.B., The origins, pathways and terminations of neurons with VIP like immunoreactivity in the guinea pig sma ll intestine, Neuroscience, 8 (1983) 665 676. 69. Barbiers,M., Timmermans,J.P., Scheuermann,D.W., Adriaensen,D., Mayer,B., Groodt Lasseel,M.H., Nitric oxide synthase containing neurons in the pig large intestine: topography, morphology, and viscerofugal projec tions, Microsc. Res. Tech., 29 (1994) 72 78. 70. Papka,R.E., McCurdy,J.R., Williams,S.J., Mayer,B., Marson,L., Platt,K.B., Parasympathetic preganglionic neurons in the spinal cord involved in uterine innervation are cholinergic and nitric oxide containing, Ana t. Rec., 241 (1995) 554 562. 71. Papka,R.E., McNeill,D.L., Thompson,D., Schmidt,H.H., Nitric oxide nerves in the uterus are parasympathetic, sensory, and contain neuropeptides, Cell Tissue Res., 279 (1995) 339 349. 72. Zhang,H., Yan,Y., Shi,R., Lin,Z., Wang,M., Li n,L., Correlation of gut hormones with irritable bowel syndrome, Digestion, 78 (2008) 72 76. 73. Hulten,L., Extrinsic nervous control of colonic motility and blood flow. An experimental study in the cat, Acta Physiol Scand. Suppl, 335 (1969) 1 116. 74. Rostad,H., Extrinsic and central nervous control of colonic motility. A survey of previous and new concepts based on experimental results, J. Oslo. City Hosp., 23 (1973) 65 75.

PAGE 80

80 75. De Groat,W.C., Krier,J., The sacral parasympathetic reflex pathway regulating colonic moti lity and defaecation in the cat, J. Physiol, 276 (1978) 481 500. 76. Coutinho,S.V., Meller,S.T., Gebhart,G.F., Intracolonic zymosan produces visceral hyperalgesia in the rat that is mediated by spinal NMDA and non NMDA receptors, Brain Res., 736 (1996) 7 15. 77. M cRoberts,J.A., Coutinho,S.V., Marvizon,J.C., Grady,E.F., Tognetto,M., Sengupta,J.N., Ennes,H.S., Chaban,V.V., Amadesi,S., Creminon,C., Lanthorn,T., Geppetti,P., Bunnett,N.W., Mayer,E.A., Role of peripheral N methyl D aspartate (NMDA) receptors in visceral nociception in rats, Gastroenterology, 120 (2001) 1737 1748. 78. Gaudreau,G.A., Plourde,V., Involvement of N methyl d aspartate (NMDA) receptors in a rat model of visceral hypersensitivity, Behav. Brain Res., 150 (2004) 185 189. 79. Zhou,Q., Price,D.D., Caudle,R.M ., Verne,G.N., Visceral and somatic hypersensitivity in a subset of rats following TNBS induced colitis, Pain, 134 (2008) 9 15.

PAGE 81

81 BIOGRAPHICAL SKETCH Arseima Del Valle Pinero was born in 1977 in San Juan, Puerto Rico In 1995, she was accepted into the Depa rtment of Natural Sciences of the University of Puerto Rico. In 1997 Dr. Del Valle joined the laboratory of Dr. Jose A. Las alde, as a research assistant. From 1997 to 2000, she was awarded with undergraduate research funding from the NSF EPSCoR (National Science Foundations Experimental Program to Stimulate Competitive Research), PR AMP (Puerto Rico Alliance for Minority Participation), R.I.S.E (Research Initiative for Scientific Enhancement Program) and the Howard Hughes Program. In 2000, Arseima was th e winner of the PR AMP Academic Excellence Award for Low Income Students. In June 2000, Arseima graduated from the University of Puerto Rico with a Bachelor of Science degree. To expand her academic horizons, Arseima decided to purse graduate studies in th e United States. She was accepted in August 2003 into the Ph.D. program at Interdisciplinary Biomedical Sciences Program (IDP) of the College of Medicine at the University of Florida. In 2004, she joined the laboratory of Dr. Robert Caudle. Since then she has published several manuscripts and abstracts. In 1997, her paper entitled: Expression of the N methyl D aspartate receptor NR1 splice variants and NR2 subunit subtypes in the rat colon, published in N euroscience was featured in the cover of that issue ( 147:1). Arseima was awarded in 2008 with the 2nd Place at the 6th Annual UFCD Research Day Poster Competition. Also in 2008, she became the recipient of a Ruth L. Kirschstein National Research Service Awards for Individual Predoctoral Fellowships to Promot e Diversity in Health Related Research from the National Institute of Diabetes and Digestive and Kidney Disease. Arseima obtained a Ph.D. in Biomedical Sciences in August 2009 and plans on pursuing a post doctoral degree in the near future