<%BANNER%>

Regulation of the Steroidogenic Acute Regulatory Protein by Nuclear Receptor Signaling Pathways and by Endocrine Disrupt...

Permanent Link: http://ufdc.ufl.edu/UFE0024917/00001

Material Information

Title: Regulation of the Steroidogenic Acute Regulatory Protein by Nuclear Receptor Signaling Pathways and by Endocrine Disrupting Chemicals in Largemouth Bass (Micropterus salmoides)
Physical Description: 1 online resource (148 p.)
Language: english
Creator: Prucha, Melinda
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: ar, edc, er, fish, ocp, orphan, promoter, receptors, reproduction, star, steroidogenesis, transcription, xenobiotic
Physiology and Pharmacology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: REGULATION OF THE STEROIDOGENIC ACUTE REGULATORY PROTEIN BY NUCLEAR RECEPTOR SIGNALING PATHWAYS AND BY ENDOCRINE DISRUPTING CHEMICALS IN LARGEMOUTH BASS (Micropterus salmoides) By Melinda Sue Prucha August 2009 Chair: Nancy D. Denslow Major: Medical Sciences ? Physiology and Pharmacology Lake Apopka, a federally-appointed Superfund site in Florida, is contaminated with organochlorine pesticides (OCPs) that have been implicated in disrupting sex steroid levels in aquatic wildlife. Largemouth bass (Micropterus salmoides; LMB) inhabit Lake Apopka and are subject to exposure to the contaminants. Several of the OCPs in the lake have been reported to disrupt molecules important in steroid hormone biosynthesis, including the steroidogenic acute regulatory (StAR) protein. StAR protein shuttles cholesterol, the precursor of all steroid hormones, to the inner mitochondrial membrane for processing into steroid hormones. The mechanisms through which OCPs disrupt StAR protein are not known. The hypotheses of these studies are that OCPs disrupt gonad-specific StAR mRNA expression and that the activity of the LMB StAR gene promoter is regulated by nuclear receptor signaling, which may mediate the disruption by OCPs. Gene expression changes that encompass the LMB reproductive cycle were examined and gonadal StAR mRNA levels varied significantly dependent upon reproductive stage. To characterize the LMB StAR gene, a segment of its promoter was cloned and its.activity was measured using transfections in gonadal and adrenal cell lines. Gonadotropin and cAMP exposure stimulated promoter activity and mutation of several putative transcriptional elements resulted in a loss of response to cAMP, including a site for the orphan nuclear receptors ROR alpha and rev-erb alpha. ROR alpha and rev-erb alpha regulate genes involved in mammalian peripheral circadian rhythm. ROR alpha and rev-erb alpha bind the LMB StAR promoter, implicating the proteins play a role in regulating its activity. It was confirmed that another nuclear receptor, estrogen receptor alpha? can bind to an element in the StAR promoter. OCPs are known to disrupt nuclear receptor signaling pathways; thus I investigated gonad-specific StAR mRNA expression in response to ex vivo OCP exposure. Several OCPs disrupted StAR mRNA levels, however, transfections with the LMB StAR promoter indicated that the OCPs disrupt StAR mRNA levels at levels either at an upstream site or by indirect mechanisms. Altogether, these studies have provided insight into the regulation of the StAR gene in LMB and have verified that StAR mRNA expression is directly targeted by OCPs in the gonads of LMB.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Melinda Prucha.
Thesis: Thesis (Ph.D.)--University of Florida, 2009.
Local: Adviser: Denslow, Nancy D.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0024917:00001

Permanent Link: http://ufdc.ufl.edu/UFE0024917/00001

Material Information

Title: Regulation of the Steroidogenic Acute Regulatory Protein by Nuclear Receptor Signaling Pathways and by Endocrine Disrupting Chemicals in Largemouth Bass (Micropterus salmoides)
Physical Description: 1 online resource (148 p.)
Language: english
Creator: Prucha, Melinda
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: ar, edc, er, fish, ocp, orphan, promoter, receptors, reproduction, star, steroidogenesis, transcription, xenobiotic
Physiology and Pharmacology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: REGULATION OF THE STEROIDOGENIC ACUTE REGULATORY PROTEIN BY NUCLEAR RECEPTOR SIGNALING PATHWAYS AND BY ENDOCRINE DISRUPTING CHEMICALS IN LARGEMOUTH BASS (Micropterus salmoides) By Melinda Sue Prucha August 2009 Chair: Nancy D. Denslow Major: Medical Sciences ? Physiology and Pharmacology Lake Apopka, a federally-appointed Superfund site in Florida, is contaminated with organochlorine pesticides (OCPs) that have been implicated in disrupting sex steroid levels in aquatic wildlife. Largemouth bass (Micropterus salmoides; LMB) inhabit Lake Apopka and are subject to exposure to the contaminants. Several of the OCPs in the lake have been reported to disrupt molecules important in steroid hormone biosynthesis, including the steroidogenic acute regulatory (StAR) protein. StAR protein shuttles cholesterol, the precursor of all steroid hormones, to the inner mitochondrial membrane for processing into steroid hormones. The mechanisms through which OCPs disrupt StAR protein are not known. The hypotheses of these studies are that OCPs disrupt gonad-specific StAR mRNA expression and that the activity of the LMB StAR gene promoter is regulated by nuclear receptor signaling, which may mediate the disruption by OCPs. Gene expression changes that encompass the LMB reproductive cycle were examined and gonadal StAR mRNA levels varied significantly dependent upon reproductive stage. To characterize the LMB StAR gene, a segment of its promoter was cloned and its.activity was measured using transfections in gonadal and adrenal cell lines. Gonadotropin and cAMP exposure stimulated promoter activity and mutation of several putative transcriptional elements resulted in a loss of response to cAMP, including a site for the orphan nuclear receptors ROR alpha and rev-erb alpha. ROR alpha and rev-erb alpha regulate genes involved in mammalian peripheral circadian rhythm. ROR alpha and rev-erb alpha bind the LMB StAR promoter, implicating the proteins play a role in regulating its activity. It was confirmed that another nuclear receptor, estrogen receptor alpha? can bind to an element in the StAR promoter. OCPs are known to disrupt nuclear receptor signaling pathways; thus I investigated gonad-specific StAR mRNA expression in response to ex vivo OCP exposure. Several OCPs disrupted StAR mRNA levels, however, transfections with the LMB StAR promoter indicated that the OCPs disrupt StAR mRNA levels at levels either at an upstream site or by indirect mechanisms. Altogether, these studies have provided insight into the regulation of the StAR gene in LMB and have verified that StAR mRNA expression is directly targeted by OCPs in the gonads of LMB.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Melinda Prucha.
Thesis: Thesis (Ph.D.)--University of Florida, 2009.
Local: Adviser: Denslow, Nancy D.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0024917:00001


This item has the following downloads:


Full Text

PAGE 1

1 REGULATION OF THE STEROIDOGENIC ACUTE REGULATORY PROTEIN BY NUCLEAR RECEPTOR SIGNALING PATHWAYS AND BY ENDOCRINE DISRUPTING CHEMICALS IN LARGEMOUTH BASS ( Micropterus salmoides ) By MELINDA SUE PRUCHA A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2009

PAGE 2

2 2009 Melinda Sue Prucha

PAGE 3

3 To Doris White y ou r strength to prevail through cancer at such a young age has inspired me more than you could ever fathom. In support of this work, you once stated that you were my biggest fan; well Ill have you know that I am yours.

PAGE 4

4 A CKNOWLEDGMENTS I would like to ac knowledge my dear parents and brother Donald and Suzanne Prucha and Daniel Prucha respectively, for their loving support and advice M y parents have always supported my personal and career decisions and have always emphasized the importance of holding o nto my character and personality, no matter where life leads me. Tenacity and patience are traits that are required to complete a Ph.D. and my parents have taught me that it is worth the effort to foster these attributes in order to achieve your goals M y brother Dan has taught me how to be strong and to have conviction; we have encountered some trying times over the years, but in the end, the bond between a brother and sister always won I could have never asked for a better family and I love them with all of my heart. I must acknowledge my graduate advisor, Dr. Nancy D. Denslow. Without her support and gui dance throughout my graduate career, I would have never achieved this milestone without her efforts In addition, Nancy taught me the extreme value of creativity in sc ience; she has been and will conti nue to be a profound influence on my scientific career I wish to acknowledge my graduate advisory committee for their continued support and advice. Drs. Barber, Chegini, and Shiverick, you have been a constant asset in the progress of my scientific thinking and have kept me on course to my degree I am very grateful. I must acknowledge Dr. Jannet Kocerha, a former graduate student in our lab. I wish to thank her for her friendship and guidance over th e years Jannet b egan the roots of this project a number of years ago and did a superb job developing many of the assays and reagents that were used throughout the completion of my dissertation work Many thanks to Kevin Kroll; the manager of the Denslow laboratory and the beacon of monetary support, saving the lab from financial crisis amidst a time when funding was very

PAGE 5

5 limited Kevin has been a great teacher and a very good friend; and I thank him for a ll of his guidance and support. I would also like to thank Dr. Jason Blum, a former graduate student from our laboratory that provided much of my training at the bench and was always there to help if I had a question or concern. He is a good friend and I am thankful for his continuous advice Last but c ertainly not least, I acknowledge the support and camaraderie of my closest friends: Meaghan Zerfas, Doris White, Dr. Carla Cuda, Tim othy Jones, Dr. Chris topher Martyniuk, April Feswick, Rudy Salas, Dr. Shannon Janssen, Ryan Mahoney, Kelly Gierhar t, and Ke ely Fielding. All of these individuals have provided invaluable insight and support throughout the years. I would have never been able to survive the past eleven years of higher education without the relief of laughter shared with each of them .

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS .................................................................................................................... 4 ABSTRACT ........................................................................................................................................ 12 CHAPTER 1 INTRODUCTION AND LITERATURE REVIEW ................................................................. 14 Introduction ................................................................................................................................. 14 Literature Review ........................................................................................................................ 14 Endocrine Disruption........................................................................................................... 14 Largemouth Bass (LMB) as a Model for Endocrine Disruption ...................................... 17 Folliculogenesis and oogenesis in female LMB ......................................................... 18 Spermatogenesis in male LMB ................................................................................... 19 Sex Steroid Hormone Biosynthesis in LMB .............................................................. 21 Nuclear Recep tor Signaling in Reproduction .................................................................... 23 Estrogen receptors (ERs) and androgen receptors (ARs) .......................................... 24 Orphan nuclear receptors: retinoic aci d related receptors (RORs) and rev -erb receptors .................................................................................................................... 26 Steroidogenic Acute Regulatory (StAR) Protein ............................................................... 27 Transcriptional regulation of the StAR gene ............................................................... 29 Post -transcriptional regulation of StAR protein ......................................................... 32 Mechanisms of OCP Toxicity in LMB .............................................................................. 33 Research Objectives .................................................................................................................... 34 2 MATERIALS AND METHODS ............................................................................................... 38 Animals ........................................................................................................................................ 38 Wild LMB Seasonal Study.................................................................................................. 38 Captive LMB ........................................................................................................................ 39 Methods ....................................................................................................................................... 39 Ribonucleic Acid (RNA) Purification ................................................................................ 39 Quantitative Reverse Transcriptase Real Time PCR (qPCR) .......................................... 40 Cloning of the 5.6 kb LMB StAR Gene Promoter ............................................................. 41 In silico Transcription Factor Analyses .............................................................................. 42 Culturing of MA 10 Mouse Leydig Tumor Cells .............................................................. 42 Culturing of Y 1 Mouse Adrenocortical Cells ................................................................... 42 Isolation of Nuclear Extracts ............................................................................................... 43 Oligonucleotide Annealing Reactions for Electromobility Shift Assays ......................... 44 Electromobility Shift Assays (EMSA) ............................................................................... 44 Ex vivo Testis and Ovarian Tissue Cultures ....................................................................... 45 Chromatin Immunoprecipitation (ChIP) Assays ............................................................... 46

PAGE 7

7 Transient Transfection Ass ays in MA 10 Cells ................................................................. 49 Luciferase Measurements .................................................................................................... 49 Green Fluorescent Protein (GFP) Imaging ........................................................................ 50 Statistical Testing ................................................................................................................. 50 3 SEASONAL EXPRESSION OF THE STEROIDOGENIC ACUTE REGULATORY PROTEIN AND SEX STEROID HORMONE RECEPTORS IN THE GONADS OF WILD LARGEMOUTH BASS .................................................................................................. 57 Introduction ................................................................................................................................. 57 Results .......................................................................................................................................... 59 Gonadosomatic Indices and Water Tem perature ............................................................... 59 Staging of Gonads from Male and Female LMB Throughout the Reproductive Season ............................................................................................................................... 60 StAR, AR, and ER mRNA Expression in LMB Ovary and Testes by Month .................. 61 StAR, AR, and ER mRNA Expression in LMB Ovary and Testes by Reproductive Stage .................................................................................................................................. 62 Ex Vivo Expo sure of LMB Testis to E2 and ICI 182,780 Alters StAR mRNA Expression ........................................................................................................................ 63 In Silico Analysis of the LMB StAR Gene Promoter Reveals Putative ER responsive transcriptional elements ................................................................................ 64 EMSA Analysis of ERE/ 2678 in the LMB StAR Promoter ............................................. 64 Discussion .................................................................................................................................... 64 4 REGUL ATION OF THE STEROIDOGENIC ACUTE REGULATORY PROTEIN BY ORPHAN NUCLEAR RECEPTOR SIGNALING PATHWAYS IN LARGEMOUTH BASS ............................................................................................................................................ 82 Introduction ................................................................................................................................. 82 Results .......................................................................................................................................... 83 Previous Studies Reveal Multiple Putative Transcriptional Elements may be Involved in Mediating cAMP -Induced Activity of the StAR Promoter (89, 90) ......... 83 ChIP Verification of ROR /rev -erb Proteins Binding to the ROR/ 1969 Element in the LMB StAR Promoter and to the ROR / 634 in the Murine StAR Promoter. ....... 85 EMSA Analysis of ROR 4 Binding to the ROR/ 1969 Element .................................... 86 EMSA analysis of ROR/ 1969 Activity in Y 1 Adrenocortical Cells ............................. 86 Discussion .................................................................................................................................... 87 5 STEROIDOGENIC ACUTE REGULATORY PROTEIN AS A TARGET FOR ORGANOCHLORINE PESTICIDES IN LARGEMOUTH BASS ........................................ 96 Introdu ction ................................................................................................................................. 96 Results .......................................................................................................................................... 98 Gene Expression Changes in Ovarian Tissue upon Ex Vivo Exposure to OCPs under Basal Conditions .................................................................................................... 98 Gene Expression Changes in Ovarian Tissue upon Ex Vivo Exposure to OCPs under hCG -Stimulated Conditions .................................................................................. 98

PAGE 8

8 Gene Expression Changes in LMB Testis Tissue upon Ex Vivo Exposure to OCPs under Basal Conditions .................................................................................................... 99 Gene Expression Changes in LMB Testis Tissue upon Ex Vivo Exposure to OCPs under hCG -Stimulated Conditions ................................................................................ 100 Changes in Testosterone (T) Production by Ex Vivo Ovarian and Testis Cultures Following Exposure to OCPs under Basal and hCG -Stimulated Conditions (193) .. 100 Transfections with the 2.9 kb LMB StAR Promoter in MA 10 Leydig Cells ................ 101 Discussion .................................................................................................................................. 102 6 OVERALL DISCUSSION AND FUTURE DIRECTION .................................................... 115 APPENDIX A SUPPLEMENTARY DATA AND FIGURES ....................................................................... 124 LIST OF REFERENCES ................................................................................................................. 130 BIOGRAPHICAL SKETCH ........................................................................................................... 148

PAGE 9

9 LIST OF TABLES Table P age 1 1 Specific stages and steps in the female LMB ovary througho ut the r eproductive season (42) .............................................................................................................................. 35 2 1 List of primer sequences used for qPCR analysis of LMB mRNA expression ................. 52 2 2 List of primer sequ ences used to clone the proximal 2.9 kb and distal 2.6 kb (total 5.6 kb) LMB StAR gene promoter ............................................................................................... 53 2 3 List of PCR thermal cycler parameters used to clone the proximal 2.9 kb and distal 2.6 kb (total 5.6 kb) StAR gene promoter ............................................................................. 54 2 4 List of oligonucleotide sequences used in EMSA experiments .......................................... 55 2 5 List of qPCR p rimers used in ChIP experiments ................................................................. 56 3 1 Pearson correlations for seasonal transcript levels in the gonad of female LMB .............. 71 3 2 Pearson correlations for seasonal transcript levels in the gonad of male LMB ................. 72 5 1 Summary of changes observed in LMB gonads in ex vivo versus in vivo DDE and DIEL exposure ..................................................................................................................... 108

PAGE 10

10 LIST OF FIGURES Figure P age 1 1 Chemical structures and repr oductive targets of select OCPs ............................................. 36 1 2 Reproduct ive steroid hormone biosynthesis in teleost fishes .............................................. 37 3 1 Variations in gonadosomal indices of wild LMB and water temperature in Welaka, FL ............................................................................................................................................ 73 3 2 Representative histological micrograp hs of female LMB ovarian stages .......................... 74 3 3 Representative histological micrographs of male LMB testicular stages ........................... 75 3 4 Monthly StAR, AR, and ER mRNA expression in the female LMB gonad as determined by qPCR .............................................................................................................. 76 3 5 Monthly steroidogenic StAR, AR, and ER mRNA expression in the male LMB gonad as determined by qPCR .......................................................................................................... 77 3 6 Stage -specific StAR, AR, and ER mRNA expression in female LM B gonad as determined by qPCR .............................................................................................................. 78 3 7 Stage -specific StAR, AR, and ER mRNA expression in male LMB gonad as determined by qPCR .............................................................................................................. 79 3 8 Changes in testicular StAR mRNA expression upon exposure to vehicle, ICI 182,780 or E2 under basal and hCG -stimulated conditions ............................................................... 80 3 9 ER from MA 10 mouse Leydig cells binds to ERE/ 2678 in the LMB StAR gene promoter in vitro ..................................................................................................................... 81 4 1 In silico comparison of the StAR promoter across species .................................................. 92 4 2 Functional analysis of ROR and rev erb by ChIP .......................................................... 93 4 3 Functional analysis of ROR by EMSA with recombinant ROR 4 protein ..................... 94 4 4 EMSA with basal and d bcAMP induced nuclear fractions ................................................. 95 5 1 LMB ovarian gene expression changes in response to ex vivo OCP exposure under basal conditions .................................................................................................................... 109 5 2 LMB ovarian gene expression changes in response to ex vivo OCP exposure under hCG -stimulate d conditions .................................................................................................. 110

PAGE 11

11 5 3 LMB testis gene expression changes in response to ex vivo OCP ex posure under basal conditions .................................................................................................................... 111 5 4 LMB testis gene expression changes in response to ex vivo OCP exposure under hCG -stimulated conditio ns .................................................................................................. 112 5 5 Response of 2.9 kb LMB StAR gene promoter to treatment with OCPs under basal conditions .............................................................................................................................. 113 5 6 Response of 2.9 kb LM B StAR gene promoter to treatment with OCPs under hCG stimulated conditions ........................................................................................................... 114 6 1 Figure depicting projected model of the regulation of StAR protein in LMB gonads .... 123 A 1 Representative scan of a 1% agarose/ethidium bromide gel confirming RNA integrity ................................................................................................................................. 125 A 2 Verification of oligonucleotide annealing for EMS A ........................................................ 126 A 3 Verification of high transfection efficiency in Y 1 mouse adrenocortical cells transfected using FugeneHD and a GFP construct ............................................................ 127 A 4 Verification of optimal sonication of chromatin used in ChIP assays .............................. 128 A 5 Verification of high transfection efficiency in MA 10 mouse Leydig tumor cells transfected using FugeneHD and a GFP construct ............................................................ 129

PAGE 12

12 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy REGULATION OF THE STEROIDOGENIC ACUTE REGULATORY PROTEIN BY NUCLEAR RECEPTOR SIGNALING PATHWAYS AND BY ENDOCRINE DISRUPTING CHEMICALS IN LARGEMOUTH BASS ( Micropterus salmoides ) By Melinda Sue Prucha August 2009 Chair: Nancy D. Denslow Major: Medical Sciences Phys iology and Pharmacology Lake Apopka, a federally appointed Superfund site in Florida is contaminated with organochlorine pesticides (OCPs) that have been implicated in disrupting sex steroid levels in aquatic wildlife Largemouth bass ( Micropterus salmo ides ; LMB) inhabit Lake Apopka and are subject to exposure to the contaminants Several of the OCPs in the lake have been reported to disrupt molecules important in steroid hormone biosynthesis, including the steroidogenic acute regulatory (StAR) protein StAR protein shuttles cholesterol, the precursor of all steroid hormones, to the inner mitochondrial membrane for processing into steroid hormones. The mechanisms through which OCPs disrupt StAR protein are not known. The hypotheses of these studies ar e that OCPs disrupt gonad -specific StAR mRNA expression and that the activity of the LMB StAR gene promoter is regulated by nuclear receptor signaling, which may mediate the disruption by OCPs. Gene expression changes that encompass the LMB reproductive cy cle were examined and gonadal StAR mRNA levels varied significantly dependent upon reproductive stage To characterize the LMB StAR gene a segment of its promoter was cloned and its. activity was

PAGE 13

13 measured using transfections in gonadal and adrenal cell li nes Gonadotropin and cAMP exposure stimulated promoter activity and mutation of several putative transcriptional elements resulted in a loss of response to cAMP including a site for the orphan nuclear receptors ROR and rev -erb ROR and rev erb regulate genes involved in mammalian peripheral circadian rhythm ROR and rev -erb bind the LMB StAR promoter implicating the proteins play a role in regulating its activity It was confirmed that another nuclear receptor, estrogen receptor can bind to an element in the StAR promoter. OCPs are known to disrupt nuclear receptor signaling pathways ; thus I investigated gonad -specific StAR mRNA expression in response to ex vivo OCP exposure. Several OCPs disrupted StA R mRNA levels, however, transfections with the LMB StAR promoter indicated that the OCPs disrupt StAR mRNA levels at levels either at an upstream site or by indirect mechanisms. Altoget her, these studies have provide d insight in to the regulation of the St AR gene in LMB and have verified that StAR mRNA expression is directly targeted by OCPs in the gonads of LMB.

PAGE 14

14 CHAPTER 1 INTRODUCTION AND LITERATURE REVIEW Introduction As human beings, we produce and expel mass quantities of chemicals into the environment ; hence, it is no surprise that many of these chemicals have the capacity to negatively impact wildlife and humans. Endocrine disruption occurs when chemicals in the environment elicit a response in an organism that alters normal function of the endocrine system, which can result in reproductive, developmental, and other abnormalities. Much controversy surrounds the discussion of endocrine disruption in the environment. R ecent reports in the United States and in other countries have revealed that several species of male fish, including largemouth bass (LMB, Micropterus salmoides ), have been identified in the wild that bear intersex qualities (both eggs and sperm present in the gonad). It is highly speculated that the presence of intersex species is causa lly linked to exposure to xenoestrogenic compo unds in the aquatic environment. However, t he exact mechanisms that contaminants found in the waters employ remain unresolved (1, 2) Reproductive success is vital to the survival of all species and is fundamental to sustaining biodiversity on the planet. Numerous environmental and physiological factors affect the growth, development, and reproductive success of an individual and it is important to understand the factor s that control these physiological processes. Literature Review Endocrine Disruption Endocrine disrupting chemicals (EDCs) encompass a very broad class of compounds that disrupt normal endocrine function in a wide range of species. Hormones control reproduction

PAGE 15

15 and development, and disruption of endocrine function can severely impair the development and reproductive capability in an organism. EDCs can impact reproduction and steroid hormone synthesis by mimicking the actions of en dogenous androgens or estr ogens or by disrupting the synthesis or metabolism of these key reproductive hormones. There is substantial evidence that links exposure of humans and wildlife to EDCs with changes in steroidogenic capacity, secondary sex characteris tics, gonad development and production and size of eggs and sperm (3 15) EDCs are ubiquitous in the environment and include a multitude of different compounds, ranging from pesticides and fungicides and their metabolites (16 20) to chemicals found in plastics (21 23) papermill effluent (24, 25) and sewage wastewaters (26) Hundreds of studies report that a large number of species exhibit reproductive and developmental abnormalities upon exposure to EDCs, i ncluding humans, mammals, amphibians, reptiles, birds, invertebrates, and fish (reviewed in (9)). Many EDCs are quite stable and persist in the environment and the main sink for many EDCs is in freshwater lakes and rivers; soluble compound s aggregate in the surface waters, whereas less soluble compounds collect in the sediments. It is for this reason that numerous aquatic vertebrates, including multiple species of fish (reviewed in (27) ), are at high risk for exposure to EDCs and are susceptible to reproductive abnormalities. One of the major abnormalities reported in wildlife exposed to EDCs is the pres ence of intersex fish in the environment; that is, the presence of male fish bear ing both immature eggs and sperm in the ir gonad. Intersex fish species have been identified in freshwater and marine environments on a widespread basis some of which include lar gemouth and smallmouth bass in the Potomac River in the United States (2, 28) white perch from the Great Lakes (29) roach fish

PAGE 16

16 from Denmark (30) and the United Kingdom (31) and the three -spined stickleback from Germany (32) The feminization of fish in the wild has been correlated with the presence of x enoestrogens in the environment. X enoestrogens are EDCs that act as estrogens or as anti androgens, disrupting normal steroid hormone homeostasis The United States Geologi cal Survey reported the presence of intersex male LMB in the Potomac River in the United States (28) yet the exact causes of the reproductive abnormalities observed have not been resolved. Recent studies by the U.S. Fish and Wildlife Service have revealed that many environmental contaminants were found at multiple sites at which intersex LMB were observed in the Potomac River, including many xenoestrogenic agricultural pesticides (1, 2) It is postulated that these chemicals, which are concentrated most near points of release of a local wastewater treatment facility, may be responsible for the reproductive abnormalities observed in the bass, though research efforts are ongoing and mechanisms are unclear (1, 2, 28) Lake Apopka (Apopka, FL, USA) is the fourth largest lake in Florida and has been appointed by the U.S. Environmental Protection Agency (EPA) as a Superfund cleanup s ite. Decades ago, the serious spill of the organochlorine pe sticides (OCPs) dicofol and dichlorodiphenyltrichloroethane ( DDT ) by the Tower Chemical Company prompted the EPAs designation of the lake as a Superfund site. H igh levels of the contaminants seeped into the surrounding aquifers, contaminating the waters and sediments of Lake Apopka. In addition to the spill muck farms lined the shores of Lake Apopka years ago where multiple OCPs were used to control pest growth, including the compounds DDT, toxaphene (TOX) dieldrin (DIEL) and methoxychlor (MXC) among st others At the Lake Apopka site p,p dichlorodiphenydichloroethylene ( DDE, the persistent and stable breakdown product of DDT ),

PAGE 17

17 TOX, DIEL, and MXC have been reported to constitute a predominant part of the OCP load in the sediment, in fish, and in all igators (33 36) Research by a number of investigators has strongly supported the hypothesis that the multitude of OCPs present at this site are to blame for t he altered reproductive status and altered circulating steroid hormone levels observed in fish (37 39) turtles (40) and alligators (40, 41) T he continued presence of persistent OCPs and their metabolites in Lake Apopka poses an ongoing potential threat to area wildlife. The OCPs that contaminate Lake Apopka vary substantially, both by mode of action and by chemical structure (Figure 11); h ence, i t is important to understand how these chemicals function and disrupt reproduction and development. Largemouth Bass (LMB) as a Model for Endocrine Disruption LMB are one of the many species of fish that are susceptible to the deleterious effects of EDCs. LMB, a species of game fish important both commercially and eco logically are found throughout bodies of freshwater throughout North America, including Lake Apopka in Florida and the Potomac River in Maryland The effects of many EDCs tend to biomagnify as an organism moves up rank in the food chain, and since LMB are considered a top predator, they are especially susceptible to the effects of high levels of EDCs in the environment and prone to biomagnification of contaminants. Thus, LMB serve as a good model when studying the effects of EDCs in the laboratory. LMB are a species of teleost fish that reproduce semi -synchronously in the wild, making isolation of various stages of reproduction in male and female LMB generally feasible. It is because of this that LMB make a useful model for the st udy of EDCs and their mechanisms of action. In order to assess the effects and mechanisms of action that EDCs exert in LMB

PAGE 18

18 reproduction, it is important to gain specific knowledge on the complexities surrounding their reproductive cycles. The reproductive cycles of female and male teleost fish species have been well characterized previously (42, 43) although a detailed reproductive stage-specific study of gonadal gene expression changes, gonad staging, and other physiological endpoints in wild LMB has not been reported to date. It must be noted that a previous study in pond reared LMB was conducted that spanned several months of a projected spawning season; plasma steroid hormone levels and various gene expression profiles from different tissues were character ized (44, 45) These previous studies did not examine any reproductive stage -specific gene expression in either sex and did not characterize the entire reproductive cycle of LMB LMB that reside in Florida typica lly spawn in the wild a few times per year, and the spawning season usually falls between the months of late January and early May (45) ; however spawning is controlled by several environmental and physiological cues, including photoperiod, temperature, courtship behavior, and endogenous hormonal triggers (46) It is important to have a firm understanding of the predominant reproductive stages and steroidogenesis in both sexes of LMB in order to understand levels of vulnerability to the disruptive effects of EDCs in the environment. Folliculogenesis and o ogenesis in female LMB The reproductive cycles of female teleost fishes are quite complex; there are multiple stages and sub -sta ges that occur throughout the season and these vary greatly across species. Female LMB typically have two ovaries that are suspended in the dorsal part of the abdomen that are linked by a gonoduct to the genital pore. In female LMB, as plasma sex steroid hormones and vitellogenin (VTG; egg yolk precursor protein) profiles increase, the onset of reproduction occurs. In general, increasing plasma concentrations of VTG, 17 -estradiol (E2), 17 ,20 -

PAGE 19

19 dihydroxy 4 -pregnen3 -one (P4), and testosterone (T) are highly involved in the growth and development of the ovaries (45, 47) In a study conduct ed throughout the projected spawning season in pondreared LMB, plasma sex steroid hormone and VTG level s were quantified and analyzed. T he study revealed that E2 and T levels peaked in February and March and plasma VTG peaked during December February. V TG, E2, and T gradually decreased concomi tantly through May and remained constitutively low after spawning (45) As defin ed by Grier et al. (42) the female teleost reproductive cycle is encompassed by six distinct stages, including: proliferation of oogonia (during adolescence), chromatin nucleolus (CN), primary growth (PG), secondary growth (vitellogenesis; SG), oocyte maturation (OM), and ovulation (OV). Details of the stages and descriptions from Griers system are outlined in Table 1 1 below (42) In LMB inhabiting Florida f ollowing ovulation and when water temperatures rise t o > 75 F follicles are resorbed and the ovaries undergo atresia. Although there are multiple sub -stages assigned to each of the reproductive stages, it is often quite difficult to isolate specific steps in the reproductive cycle of wild LMB due to the f act that the species isnt completely synchronous in its reproductive capacity The reproductive cycle of female LMB is extremely complex and highly controlled by physiological and environmental parameters. Spermatogenesis in m ale LMB Slightly less comple x than the reproductive cycle of female LMB, but still interspersed with multiple stages and tightly controlled physiological changes, is the reproductive cycle of male teleost fishes. Male LMB typically bear two testes, both attached to the dorsal wall i n the abdomen of the fish; the testes converge into a central efferent duct system which is linked to the exterior of the body at the urogenital pore. In males, increases in plasma T and 11 -

PAGE 20

20 ketotestosterone (11-KT) are associated with the growth and devel opment of the testes throughout the reproductive cycle (47) 11-KT has been identified as the predominant male hormone, and consistently peaks in several teleost species during final reproduction and spawning (45, 48) In the study of pondreared LMB conducted by Gross et al in 2002, plasma levels of 11 -KT and T in male LMB peaked in February and March, respectively, and circulating levels of both hormones diminished as water temperatures exceeded 75 F in the summer months (45) In all male teleost species, the testes form spermatozoa during spermatogenesis, deliver them to the efferent ducts du ring spermiation, and secrete male sex hormones (49) Similar to the reproductive cycles of female LMB, male LMB undergo a n umber of physiological changes throughout spermatogenesis. As described by Grier and Aranzbal, there are distinct stages that the testes undergo throughout spermatogenesis, including: early germinal epithelium (GE) development, mid GE development, and la te GE development. Early GE development is characterized by the presence of spermatogonia and spermatocytes; mid GE development is characterized by the presence of spermatids, as well as spermatogonia and spermatocytes. During late GE, spermatozoa are pr oduced in pockets in the testes in preparation for spermiation during spawning (43) Altogether, the reproductive cycle s in both female and mal e LMB are tightly controlled by physiological and hormonal cues, and each distinct stage of reproductive development is characterized by the presence and variable abundance of several different types of cells Sex steroid hormones tightly control reproduc tion in both female and male LMB. With much variation in cell type population and in plasma sex steroid hormone levels throughout LMB

PAGE 21

21 reproductive cycling, it is likely that susceptibility to the disruptive effects of xenoestrogenic OCPs in the environment varies as well. Sex Steroid Hormone Biosynthesis in LMB In all vertebrates, development, homeostatic regulation, and reproduction are essential and complex physiological processes that are all t ightly regulated by steroid hormones. S teroid hormones are small, cholesterol -derived molecules, which are produced by specialized cells in different steroidogenic tissues. The t wo major organs in fish that are responsible for steroid hormone biosynthesis are the gonads and the head kidney. In mammals, the gonads and the adren al cortex produce steroid hormones (reviewed in (50) ). There are five major types of steroid hormones, including glucocorticoids and mineralocorticoids (involved in stress response and homeostatic maintenance), progestagens, androgens, and estrogens (involved in sexual development and reproduction). All five classes of steroid hormones play complex and integral roles in the survival of an organism. H owever, because many OCPs including those found at the Lake Apopka site, have been reported to alter plasma sex steroid hormone levels and disrupt other reproduc tive parameters in LMB and in other species, it is important to have a solid understanding of sex steroid hormone biosynthesis in LMB. Reproductive success in all vertebrates is dependent upon an intricate balance of circulating sex steroid hormones. Sex steroid hormone biosynthesis is acutely regulated by tropic hormones released by the anterior pituitary, including luteinizing hormone (LH) and follicle stimulating hormone (FSH). Sex steroid hormones control the expression of genes involved in a number o f physiological processes, including reproduction. In general, sex steroid hormones bind to and activate specific nuclear receptor proteins resulting in receptor dimerization and translocation into the nucleus of a cell where the receptor complex and other

PAGE 22

22 transcription factors control the expression of target genes (51) N uclear receptor s control the expression of genes centrally involved in reproduction, and these important and complex pathways and genes will be discussed in further detail in the next section. Relative to reproduction in adult vertebrates (including LMB), t here are three major classe s of sex steroid hormones including estrogens, androgens, and progestogens. Sex steroid hormones are produced by specialized cells found in the go nad; theca and granulosa cells ( in the female ovary) and Sertoli and Leydig cells (in the male testis) work in a concerted manner to generate sex steroid hormones from cholesterol (reviewed in (50) ). These specialized cells express tightly regulated steroidogenic enzymes that are involved in the processing and modulation of cholesterol, the precursor m olecule of all steroid hormones, into p rogestogens, androgens, and estrogens, w hich in turn regulate progression and cycling of LMB reproduction A generalized diagr am depicting the major steps and enzymes involved in teleost steroid hormone biosynt hesis can be found in Figure 1 2 It has been well characterized in all vertebrates t hat t he production of different classes of steroid hormones hinges on the delivery of cholesterol to the inner mitochondrial membrane, where P450 side chain -cleavage ( P450scc) enzyme metabolizes cholesterol into pregnenolone (the basal steroid that is meta bolized into other steroid hormones) In mammals, the sterol transfer protein required to deliver cholesterol to the inner mitochondrial mem brane was first purified and sequenced in steroidogenic cells in 1994 by Clark et al (52) ; this protein was termed the steroidogenic acute regulatory (StAR) protein and it controls the rate -limiting step in steroid hormone biosynthesis StAR protein is acutely regulated protein responsible for the translocation of cholesterol a cross the outer mitochondrial membrane prior to enzymatic cleavage into steroid hormones. Other proteins work together with StAR protein at the

PAGE 23

23 mitochondrial membrane, including an essential complex of protein kinases (53) voltage dependent anion channel 1, the peripheral benzodiazepine receptor, hormone -sensitive lipase, among others (reviewed in (54) ). StAR protein activity is hig hly regulated by the Protein Kinase A (PKA) pathway; in general, binding of tropic hormones ( produce d by the pituitary ) to membrane bound tropic hormone receptors in steroidogenic cells activates the PKA pathway. PKA with help from Protein Kinase C (PKC) and other pathways, phosphorylates StAR protein, resulting in its activation (55 59) Because StAR protein plays such an integral and essential role in steroid hormone biosynthesis, further discussion regarding it s regulation at the transcriptional and translational levels will be addressed in more detail later in this chapter. Altogether, t he biosynthesis of sex steroid hormones is a complex process and involves multiple signaling pathways and numerous different signaling molecules and enzymes. Because sex steroid hormone biosynthesis is so complex and so tightly regulated, it is likely that OCPs known to alter the levels of circulat ing sex steroid hormones in LMB disrupt the biosynthetic process at multiple step s. Nuclear Receptor Signaling in Reproduction Nuclear receptor signaling pathways play integral roles in controlling the expression of genes involved in a number of physiological processes, including those central to reproduction and development (51) Nuclear receptors have been extensively researched and reviewed in the literature, and the information discussed here is a conglomeration of a huge subset of data most recently reviewed on the superfamily (60, 61) Nuclear receptors have the capacity to bind directly to DNA sequences as monomers, homodimers, and hete rodimers, and are considered to be one of the most diverse and important families of transcription factors involved in controlling gene expression. In general, nuclear receptors are composed of six functional domains (A -F from the N terminal to the C ter minal

PAGE 24

24 end ), and each domain is responsible for a specific part of receptor function. The poor l y defined and highly variable A/B domains contain an act ivation function (AF 1) domain. T he highly conserved C domain contains regions that are responsible for receptor dim erization and for DNA binding. T he poorly conserved D domain is the hinge region which c ontains a localization signal. T he functionally complex E domain is the region that binds ligands and also plays an integral role in receptor dimerization and the F domain is thought to contain a modulator y fun ction that mediates how ligands affect the transcriptional activity of nuclear receptors in cells (reviewed in (60, 6264) ). Currently, there are roughly 50 di fferent types (each type having multiple isoforms) of functional nuclear receptors identified in vertebrates This family includes two general types of receptors, including l igand -dependent receptors and orphan nuclear receptors ( for which no ligand is known or may not exist ). Bearing in mind that nuclear receptor signaling controls the expression of numerous genes and is integral to multiple physiological processes; t his review will focus on a few key players of the nuclear receptor superfamily including both ligan d -mediated and orphan receptors. These receptors have been implicated in the control of genes that are fundamentally involved in reproduction. When trying to assess how xenoestrogenic EDCs in the environment disrupt reproduction, it is vital t o have a solid understanding of the endogenous signaling pathways involved in regulating genes that control reproductive functions Estrogen receptors (ERs) and a ndrogen r eceptor s (ARs) ERs and ARs belonging to the ligand dependent subset of the nuclear r eceptor superfamily are key players in mediating the transcriptional control of genes in response to hormonal cues central to reproduction in all vertebrates However the two sex steroid hormone

PAGE 25

25 receptors vary substantially with regards to isoform expre ssion, ligand binding, and functional specificity ERs have been extensively investigated and well -characterized in many species including many species of fish (44, 65 67) In mammals, there are two known isoforms of ERs, including ER and ER Each of the two ERs is transcribed from a unique gene and multiple isoforms are expressed in a tissue -specific manner throughout the body Similar to mammals, fish also express two main classes of ERs, each class encompass ing multiple isoforms of each receptor. It is now well understood that many teleost species, including LMB, express three unique isoforms of ERs that are products of different genes, and these include ER ER a, and ER b (44, 66, 6872) Work by Sabo -Attwood et al. showed that the three ERs in LMB are expressed in the liver and in the gonad; however ER a and ER b were more highly expressed in the gonad, whereas ER was more highly expressed in the liver (44) Equally as important in controlling signal transduction, ARs have been well characterized. In mammals, two isoforms of ARs have been described, including AR -A and AR -B; AR -A is an N terminal truncated version of the full length AR B isoform, and both isoforms have been reported to function in a similar manner (73 75) Similarly, two distinct AR isoforms have been characterized in several speci es of fish (76 81) including AR and AR ( synonymous with AR1 and AR2); however, it has been projected that, due to the lack of sequence homology between the two isoforms, each isoform is likely transcribed from its own gene rather than a single gene as observed in mammals In addition 11-KT is an additional functional androgen in fish and it has been reported that a variant of AR binds preferentially to this important signaling steroid (82) It is likely that LMB also express two isoforms, th ough the fragment that has been

PAGE 26

26 sequenced in our laboratory is located in a very highly conserved region (homologous in all isoforms of AR in fish). In fish and mammals, ERs and ARs mediate the expression of reproductive genes in response to sex steroid hormonal cues throughout the reproductive cycle. Regulation of genes via classical genomi c signaling entail s the binding of a dimerized, sex steroid hormone -bound receptor complex to a hormone response element (H RE) found in the promoter of a target gene, i nducing activa tion/repression of expression (reviewed in (60) ); ERs bind to estrogen response elements (EREs) and ARs bind to androgen response elements (AREs). However, nume rous studies have shown that both ERs and ARs can influence gene expression in multiple other nonclassical ways by interacting with and infl uencing the actions of other transcription factors that differentially alter the expression of target gene s (reviewed in (83, 84) ). Signaling mechanisms surrounding ER and AR -mediated gene expression are extremely complex and have yet to be perfectly understood. ERs and ARs are integrally involved in the control of genes involved in reproduction, and it is vital to have an understanding of those genes and the pathways that regulate them, especially when considering the effects of EDCs on reproduction in the environment. Orphan nuclear r eceptors: retinoic acid -related receptors (RORs) and rev -e rb r eceptors Orphan nuclear receptors are extensively similar in structure to all members of the nuclear receptor family; ho wever, orphan receptors are receptors that were identified without any prior knowledge of their association with a ligand (reviewed in (61) ). In addition to sex steroid hormone receptor signaling, less thoroughly understood o rphan nuclear receptor signa ling has also been implicated in the regulation of expression of many genes that are critical to reproduction in mammals.

PAGE 27

27 Circadian c ontrol of gene expression at the cellular level is important in regulating steroid hormone production in vertebrates It i s known that the orphan receptors ROR and rev -erb are two signaling proteins that play integral roles in controlling genes central to the circadian cascade (85 87) ROR and rev -erb both bind to similar core sequences (ROR element s RORE s ), howeve r they induce opposing effects on the transcription of target genes (61) Interestingly, the recently completed crystal structure of human ROR revealed cholesterol in its binding pocket (88) Cholesterol is the backbone to all steroid hormones, and cholesterol as a putative ligand for ROR implicates that the molecule may play an interesting role in regulating steroid hormone biosynthesis. Steroidogenic Acute Regulatory (StAR) Protein StAR protein, a rapidly synthesized 37 kDa mitochondrial phosphoprotein, is responsible for the translocat ion of cholesterol, the precursor of all steroid hormones, from the outer mitochondrial membrane to the inner membrane where it is converted into pregnenolone by P450scc (52, 56) Importantly, StAR protein, in conc ert with other co -factors, controls the first and rate -limiting step in steroidogenesis in all vertebrates Based on previous studies in our laboratory, it is likely that StAR protein plays the same integral role in LMB (89, 90) Numerous studies have shown that the StAR protein plays an integral role in the biosynthesis of hormones essential to surv ival (adrenal hormones) and reproduction (gonadal hormones) in vertebrates (52, 91, 92) The critical role that StAR protein plays in proper development and steroid hormone production is evident upon examination of patients that suffer from lipoid congenital dyspla sia (lipoid CAH). Lipoid CAH is an autosomal recessive disorder which is characterized by severely impaired adrenal and gonadal steroid hormone productive capacities (58, 93) In studies

PAGE 28

28 where the expression of th e StAR gene was disrupted in the mouse, the same phenotype was observed in the experimental model that is observed in patients that suffer from lipoid CAH (94, 95) Proper StAR protein function is essential for ste roid hormone production in vertebrates and steroid hormones control both reproduction and survival in an organism. In mammals, StAR protein expression is primarily associated with steroidogenic tissues, including the adrenal cortex, gonad, placenta, and br ain (reviewed in (54) ); however, it has been shown that StAR protein is also minimally expressed in the liver (96) It is only in t he last several years that researchers have begun to characterize StAR protein and StAR gene expression in different fish species (90, 97 107) In the limited studies that have examined the tissue distribution of S tAR mRNA in teleost species, StAR mRNA expression was as observed in mammals, limited to the ovary, testis, head kidney (analogous to the adrenal cortex in mammals) and, to a lesser extent, the liver (100, 107) Previous work in our laboratory has confirmed expression of StAR mRNA in female LMB ovaries (90) and it is likely that the tissue distribution of StAR mRNA in LMB is isolated to steroidogenic tissues in a manner similar to th at observed in other fish and mammalian studies. In steroidogenic tissues, acute steroidogenesis is mediated by multiple complex mechanisms (inc luding pathways stimulated by gonadotropin signaling) that alter the transcription, translation, or the function ality of StAR protein (55, 108, 109) However, in mammalian systems, it has been shown that inhibition of the StAR protein at any level, transcriptional or translational, substantially decreases the capacity for st eroid biosynthesis and approximately only 10 % of steroid hormone production can occur via StAR protein -independent mechanisms (58, 110, 111)

PAGE 29

29 It has been shown in multiple studies that StAR protein is a target of various EDCs in many different species (reviewed in (112) ). For example, i n vivo exposure of male and female LMB to the OCPs DDE and DIEL caused altered steady -state StAR mRNA levels in the testis and o vary, respectively (113) although the tissue -specific responses have not yet been elucidated. In a study conducted in goldfish, in vivo exposure to the phytosterol -sitosterol yielded changes in gonadal StAR transcript levels in male fish (114) It is underst ood that a wide array of compounds have been shown to disrupt StAR gene expression at the transcriptio nal level, inclu ding the pesticides Roundup (19) dimethoate (115) and lindane (20) though the mechanisms through which these contaminants act to disrupt StAR mR NA expression and gene transcription are unresolved. Thus, it is possible that EDCs target StAR protein expression at a multitude of different levels. It is evident that the StAR protein is very important in steroid hormone production in vertebrates, and further discussion of its regulation at the tr anscriptional, translational, and post translational levels is necessary in order to understand how various EDCs may impact the expression of the vital protein. Transcription al r egulation of the StAR g ene Tran scriptional regulation of the StAR gene is a key control mechanism in vertebrate reproduction and it is mediated by a large family of cyclic adenosine monophosphate (cAMP) responsive nuclear factors that act in response to the stimulation of the adenylate cyclase signaling pathway. It has been well established that StAR gene transcription and activation of its promoter are highly stimulated by cAMP signaling; StAR gene transcription is also highly responsive to other agents that stimulate the adenylate cy clase pathway via G -protein coupled receptor -mediated signaling, including LH FSH adrenocorticotropin hormone (ACTH), human

PAGE 30

30 chorionic gonadotropin (hCG) retinoic acid, amongst many others (reviewed in (116) ). However, t he exact mechanisms that are involved in the cAMP -mediated activation of the StAR promoter are not completely understood. Although the activation of transcription by cAMP signaling is classically mediated through the interaction of the cAMP response element (CRE) binding protein (CREBP) with a conserved CRE sequence located in the promoters of cAMP responsive genes, mammalian StAR promoters lack perfect CRE sequences (52, 117, 118) It is apparent that other signaling components must be responsible for the activation of the StAR promoter. The promoter for the StAR gene has been extensively characterized in mammalian systems, and research has implicated that there are numerous pathways involved in mediating the cAMP induced activation of the very complex promoter (reviewed in (54) ). Previous work in our laborator y investigating the activity of a 2.9 kb portion of the StAR gene promoter cloned from LMB revealed that, as observed with mammalian StAR gene promoters, the LMB StAR promoter is inducible by dibutyr y l cAMP (dbcAMP), a stable homolog of cAMP (90) T he complete cDNA coding region of the StAR gene from LMB and a 2.9 kb fragment of its promoter were previously cloned and sequenced in our laboratory. Sequence alignment of the cDNA with the sequences of other species revealed high homology, thus, it is possible that the signal transduction pathways that control the promoters for the StAR gene are similar and evolutionarily conserved. Multiple signaling pathways are involved in the regulation of cAMP induced StAR promoter activati on in mammalian models. Ini tially, the interaction of tropic ho rmones (LH /ACTH (91, 119) ) with specific membrane bound gonadotropin receptors initiates the activation of G protein coupled receptor signaling pathway s, which turns on the membrane associated enzyme adenylyl cyclase that generates the second me ssenger cAMP cAMP

PAGE 31

31 activates the PKA pathway, which stimulates the phosphorylation and consequent activation of numerous transcription factors that mediate the a ctivation and activity of the StAR promoter (reviewed in (54) ). In addition to the PKA/PKC induced activation of the StAR gene promoter, the arachidonic acid signaling pathw ay is integrally involved in StAR gene expression; studies have demonstrated that tropic hormone stimulation causes both the formation of cAMP and the release of arachidonic acid from phospholipids and that both molecules are necessary for proper activatio n of StAR gene expression (120123) Other studies have shown that steroid hormones, including E2 and T can stimulate and/or repress StAR gene expression (124, 125) ; howeve r the mechanisms by which steroid hormones impact the expression of the StAR gene are not currently understood. Extensive studies indicate that numerous transcription factors (TFs) and signal transduction pathways mediate the regulation of the StAR gene promoter. Several TFs have been identified that function to activate the mammalian StAR promoter, inclu ding CREBP and steroidogenic factor 1 (SF 1) (108, 126, 127) activator protein 1 (AP 1) and Sp1 (128, 129) GATA 4 and CCAAT/enhancer binding protein (C/EBP) (130, 131) Clock/Bmal1 (132) aryl hydrocarbon receptor (AhR) (133) and sterol regul atory element -binding protein (SREBP) (134) Although less extensively studied, some negative regulators of the StAR gene promoter have been identified, including yin yang 1 (YY1) (135) DAX1 (136) and AP 1/c -fos (137) Interestingly, SF 1, AhR, and DAX 1 are consi dered orphan nuclear receptors. Based upon the promiscuous activities surrounding nuclear receptor signaling, it is likely that othe r nuclear receptor pathways function in the complex regulation of the StAR gene promoter. Altogether, it

PAGE 32

32 is well recognized that the StAR promoter is regulated in a very complex manner involving multiple signal transduction pathways Post -transcriptional r egulation of StAR p rotein It is apparent that transcriptional regulation of the StAR gene is critical in controlling the tissue -specific expression of the protein. However, recent research has implicated that a number of post transcriptional processes fu nction to regulate StAR protein -mediated steroidogenesis including factors that alter the stability of StAR mRNA and post translational modifications of StAR protein (reviewed in (54) ). In mammals, there is only one isoform of StAR protein, yet northern blots for human StAR mRNA commonly show the presence of at least two predominant speci es of mRNA; the predominant 1.7 kb transcript is present in both the adrenal and gonads and the longer 2.4 and 4.4 kb transcripts present in the adrenal and gonads, respectively (117, 127) The absence of the poly -A 3 tail found in the longer StAR mRNA transcripts has been shown to be highly correlat ed with increased StAR protein expression (138) Since the stability and localizatio n of many mRNAs are influenced by sequences found in their 3UTR and because the longer 3UTR in StAR mRNA results in reduced protein expression, it is likely that StAR mRNA stability is tightly controlled by a number of mechanisms (reviewed in (54) ). Due to the high evolutionary conservation of StAR protein function, it is likely that StAR mRNA is regulated in a similar manner in LMB. A great deal of research has shown that following translation from mRNA to protein, StAR protein interacts with a number of different factors that enhance the delivery of cholesterol to the mitochondrial membrane. Some of the proteins that have been identified to act in concert with StAR prot ein in mammals include the peripheral benzodiazepine receptor (139) and hormone sensitive lipase, amongst others (140, 141) In addition, it is well known that, in order

PAGE 33

33 to support cholesterol transport at its fully capacity, StAR protein must be phosphorylated by PKA pathways (142) Although StAR protein has been studied at the transcriptional, translational, and post translational levels, the exact mechanisms of regulation of the protein that is so critically involved in steroid hormone biosynthesis remain unresolved Seemingly, StAR protein is a target of various EDCs and fur ther characterization of the regulation of the critical protein is essential in order to understand how it is that EDCs disrupt its expression. Mechanisms of OCP Toxicity in LMB Many laboratory studies have attempted to identify the mechanisms which OCPs present in Lake Apopka employ to adversely affect sex steroid hormone levels in wildlife but to this day, mechanisms of action ar e not well defined. T he OCPs present at the Lake Apopka site are likely not restricted to a single mode of action. There is s ignificant evidence that implicates the OCPs DDE, MXC, DIEL, and TOX as xenoestrogenic and/or anti androgenic by nature, and that they can exert numerous effects acting on both ER signaling pathways and/or on AR signaling pathways (4, 11, 65, 143151) Previous work that examined gene expression profiles of pondreared LMB throughout a portion of the reproductive cycle in female LMB revealed that ER mRNA expression varied significantly over time (44) ; thus it is likely that ER mRNA expression varies by reproductive stage. Intuitively, if xenoestr ogens, such as the OCPs found in Lake Apopka and the Potomac River, disrupt ER signaling, then sus ceptibility to the effects of the EDCs will likely vary throughout the reproductive cycle in LMB. Classically, research in the field of endocrine disruption has focused on how EDCs target ER and AR -signaling pathways. However, more recent research has sh own that the expression of key steroidogenic enzymes, including those involved in the metabolism and production of steroid hormones can be significantly impacted by multiple EDCs (3, 13, 19, 25, 112115, 152-

PAGE 34

34 158) Thus, it is likely that OCPs, such as those found at the Superfund site in Lake Apopka, could impact the expression of such enzymes in addition to the classical ER and AR -signaling pathways. Although it is well understood that OCPs can significantly alter steroid hormone production and reproduction in LMB, no individual study has been able to replicate the reproductive abnormalities exhibited by LMB that inhabit OCP -contaminated waters, implicating that pathways in steroidogenesis (other than those already investigated) are likely to be involved in further mediating the effects of EDCs in the species. Research Objectives The objectives of the research discussed in this dissertation are: 1) to characterize the natural reproductive cycle of a wild subset of LM B, analyzing gonadal changes both morphologically and at the level of critically regulated gene expression centrally involved in reproduction, 2) to characterize the StAR gene in LMB at the mRNA and promoter levels to gain a better understanding of how thi s protein, vital to steroid hormone production in vertebrates, is acutely regulated in LMB, and 3) to examine the potential for several xenoestrogenic OCPs to impact the StAR gene and other classical steroid hormone receptor signaling pathways in the gonad s of LMB.

PAGE 35

35 Table 1 1. Specific stages and steps in the female LMB ovary throughout the reproductive season (42) Stage Sub Stages/Steps Oogonia Proliferate (OP) Frequently form cell nests Chromatin Nucleolus (CN) Leptoten Zygotene Pachytene Early diplotene Primary Growth (PG) One nucleolus Multiple nucleoli Perinucleolar Circumnuclear oil droplets Cortical alveoli Secondary Growth: Vitellogenesis (SG) Early secondary growth Late secondary growth Full grown oocyte Oocyte Maturation (OM) Eccentric germinal vesicle (oil drops coalesce) Germinal vesicle migration t o animal pole Germinal vesicle breakdown (oocyte hydrated) Meiosis resumes, 2 nd arrest Ovulation (OV) Oocyte emerges from follicle becoming an egg

PAGE 36

36 Figure 1 1: Chemical structures and reproductive targets of select OCPs.

PAGE 37

37 Figure 1 2 : Reproductiv e ste roid hormone biosynthesis in teleost fishes

PAGE 38

38 CHAPTER 2 MATERIALS AND METHOD S The overall aims of this project were collectively to characterize the regulation and expression of StAR mRNA levels in the gonads of a healthy subset of wild LMB and usin g a multitude of molecular techniques, to characterize novel regulatory mechanisms involved in the activation of the LMB StAR gene promoter. The potential for OCPs to disrupt StAR expression at the mRNA and gene promot er levels (and steroidogenesis) was a lso investigated using a variety of molecular biological techniques. Animals Wild LMB Seasonal Study Male and female LMB were collected from the St. Johns River in Welaka, FL once per month, ranging from October 2005 to September 2006. The period between sampling events ranged from 3 5 weeks. Additional details of the study site can also be found in (159) Ap proxi mately 10 males and 10 females were collected each month. Body weight, body length (tip of the mouth to tip of the tail), gonad weight and age were recorded. Gonadosomatic indices (GSI) were calculated for all individuals used in this study as [absolute gonad weight/absolute body weight] X 100. Approximately 3 5 mL of blood was drawn from the caudal vei n using a heparinized vacutainer and stored for later studies. Fish were euthanized with a blow to the head and gonad samples (along with other tissues) were collected, rapidly dissected, and snap -frozen in liquid N2. All samples were stored at 80C unt il processed A gonad sample was collected for histological exam ination and placed in buffered formalin (Protocol, Fisher Scientific, Waltham, MA USA) to determine the reproductive stage of the animal. Gonads were plastic embedded and cut to 5 10 micron sections. Staining of the gonad sample was done with standard hematox yl in (basophilic dye) and eosin (acidophilic dye) staining

PAGE 39

39 protocols. Vitellogenic oocytes are acidic and stain more red with eosin. Female histological samples were examined under a microscope and each individual used in this study were categorized into one of six predominant stages; perinuclear (PN), cortical alveoli (CA), early vitellogenic (EV), late vitellogenic (LV), maturation (M), and atresia (AT). Male t estes histological sam ples were also examined under a microscope and were categorized into one of four predominant reproductive stages; spermatogonia (SG), spermatocytes (SC), < 50% spermato z oa (SZ), and >50% SZ. Figures 3 2 (female) and 3 3 (male) contain representative image s of each reproductive stage classification including labels of characteristic cell types indicative of each distinct stage throughout the reproductive cycle Captive LMB LMB used in all ex vivo testis and ovary culture experiments were purchased from Ame rican Sport Fish Hatchery (Montgomery, AL). All fish were housed in the Aquatic Toxicology Facilities in the Center for Environmental and Human Toxicology at the University of Florida in accordance with the National Institute for Health (NIH) Guide for th e Care and Use of Laboratory Animals. Methods Ribonucleic Acid (RNA) Purification For each experiment, tissues (stored at 80 C until RNA was processed) were homogenized in a 2 mL microcentrifuge tube in the phenol -based RNA isolation reagent STAT60TM (Te l Test, Inc., Friendswood, TX, USA) using a fine tipped tissue homogenizer (IKA Works, Inc., Wilmington, NC, USA). RNA was extracted by adding chloroform, vortexing briefly, and incubating at room temperature for 5 minutes. Each sample was then centrifug ed for 15 minutes at 14,000 rpm at 4 C in a refrigerated microcentrifuge. The organic layer (containing proteins) was discarded and the aqueous layer that contained the RNA was then re -

PAGE 40

40 extracted by repeating the same procedure. Following the second extr action, RNA was precipitated out of the aqueous solution by add ing isopropanol followed by storage overnight at 20 C. The next day, samples were spun at 14,000 rpm at 4 C for 45 minutes to pellet the RNA. Each pellet was washed twice with 75% ethanol, dried, and resuspended in the appropriate amount of RNA secureTM (Ambion, Inc., Austin, TX, USA) to yield a final concentration of ~ 1 g/ L. All residual deoxyribonucleic acid ( DNA ) contamination was removed from each sample using the DNAfreeTM kit accor ding to the manufacturers protocol (Ambion, Inc., Austin, TX, USA). Purified RNA samples were stored at 80 C. Prior to use, RNA concentrations were quantified by spectrophotometer analysis and RNA integrity was verified by 260/280 Absorbance ratios an d by agarose/ethidium bromide electrophoresis. A representative image of a typical denaturing agarose/ethidium bromide gel can be found in Appendix A, Figure A 1. Quantitative Reverse Transcriptase Real Time P olymerase C hain R eaction (qPCR) Primers used to amplify all genes of interest in this study have been previously published in (44, 90, 113, 144) and are listed in Table 2 1 Standard curves relating initial template copy number to fluorescence and amplificati on cycle were generated using pGEM -T easy vector (Promega Corp., Madison, WI, USA) containing the gene of interest as a template. The equation used to calculate copy number is as follows : Standard curves ranged from 1 x 109 to 1 x 102 copies. Standard curves ranged between 95105% efficiency and were linear at R2>0.99. qPCR analysis of gene expression was conducted in duplicate from each sample, each reaction containing 1 X iQ SYBR Green Supermix (Bio Rad Laboratories, Inc., Hercules, CA, USA ), 100 ng fi rst -strand cDNA derived from DNase -treated RNA samples corresponding { 6 X 10 23 l)}/molecular weight of the plasmid (g/mol) = copies/ l

PAGE 41

41 forward and reve rse primers ( se quences and final concentrations located below in Table 2 1 ), and nuclease -free water in a final reaction volume of 25 L per reaction The two step thermal cycling parameters were as follows; initial 1 cycle Taq activation at 95 C for 3 minutes, followed by 40 cycles of 95 C for 15 seconds and 60C for 1 minute. After 40 cycles, a dissociation curve was produced start ing at 55 C (+1 C/30 seconds) to 95 C. qPCR expression was assayed on an iC ycler Thermal Cycler (Bio Rad Inc. ). All gene expression values are reported as absolute copy number per g total RNA, and all values were normalized to ribosomal 18S. Cloning of the 5.6 kb LMB StAR Gene Promoter 2.9 kb of the LMB StAR gene promoter was cloned and methods were described previously in (90) The cloning of the remaining distal 2.6 kb of the promoter was done using high quality genomic DNA isolated from 50 mg of LMB ovarian tissue using the Wizard Genomic DNA Isolation Kit according to the manufacturers protocol (Promega Corp., Madison, WI, USA ). The genomic DNA was purified twice by phenol/chloroform extraction to ensure all residual protein was removed. The genomic DNA pellet was resuspended in TE buffer (10 mM Tris HCl, pH 7.3; 1 mM EDTA). Using the G enomeWalker Kit (Clontech Mountain View, CA, USA ), three digested genomic DNA libraries were generate d using the restriction enzymes FspI, HpaI, and NaeI and l igated to adaptor primers for polymerase chain reaction (PCR) amplification according to the manufacturers protocol. PCR amplification of the LMB StAR gene promoter from the restriction libraries was done using a combination of the adaptor primers included in the kit and gene specific primers. Two different gene specific primers were used; one primer started closer to the 5 end of the 2.9 kb promoter piece than the other (primary PCR), which yielded overlapping sequences and provided for further sequence verification. Nested

PAGE 42

42 gene specific primers were used to r educe non -specific amplification (secondary PCR) All gene specific primer sequences for cloning both the 2.9 kb proximal and the 2.6 kb distal promot e r segments are l isted in Table 2 2 All secondary PCR reactions using the nested primers were performed using a 1:50 dilution of the primary PCR product in a final volume of 50 l. Thermocycler conditions for the amplification are listed in Table 2 3 below PCR product s were cloned into the pGEM T Easy Vector (Promega Corp., Madison, WI, USA ). The 5.6 kb promoter for the LMB StAR gene has been deposited in the GenBank database under GenBank Accession Number DQ166819. In silico Transcription Factor Analyses Putative transcription factor binding elements were identified using MatInspector Release Professional (version 7.4.8.2, July 2007) published by Genomatix, Inc. The 2.9 kb or 5.6 kb LMB StAR promoter consensus sequences were input into the software program and mult iple putative elements were identified. All elements reported carried vertebrate consensus sequence. Culturing of MA -10 Mouse Leydig Tumor Cells MA 10 mouse Leydig tumor cells were generously provided by Dr. Mario Ascoli (160) MA 10 cells were cultured in RPMI 1640 culture medium s upplemented with 15% horse serum, 20 mM HEPES pH 7.2, and 50 g/mL gentamicin, pH 7.7. Cells were grown in 100 mm culture plates (Corning) coated with 0.1% gelatin. The cells were passaged every 5 6 days and never exceeded 10 passages before a new vial w as thawed. Cells were grown and maintained at 37 C in a humidified 5% CO2 cell culture incubator Culturing of Y -1 Mouse Adrenocortical Cells Y 1 mouse adrenocortical cells purchased from ATCC (Manassas, VA, USA) were cultured in Hams F12K culture medium containing 2 mM L -glutamine, supplemented with 1.5

PAGE 43

43 g/L sodium bicarbonate, 15 % horse serum, 2.5 % FBS; and 1 % penicillin -streptomycin mix The cells were passaged every 4 5 days and never exceeded 20 passages before a new vial was thawed. The cells were grown at 37 C in a humidified 5 % CO2 cell culture incubator Isolation of Nuclear Extracts MA 10 mouse Leydig cells were plated on 100 mm cell culture plates coated with 0.1% gelatin (dissolved in 1X calcium and magnesium -free phosphobuffered sali ne ( 44 g/L KH2PO4, 9 g/L NaCl, 0.795 g/L Na2HPO4, pH 7.4; PBS ), allowed to grow to ~80% confluence, and either untreated or treated with 500 nM E2 in growth medium for 20 hours. Y 1 mouse adrenocortical cells were plated on 100 mm cell culture plates, all owed to grow to ~80% confluence, and either untreated or treated with 1 mM dbcAMP in growth medium for 20 hours. Nuclear fractions were prepared from basal and treated cells using a Nuclear Extract Isolation Kit (Panomics Inc., Fremont, CA, USA) accordin g to the manufacturers protocol. Specifically, following preparation of Buffers A and B (addition of protease and phosphatase inhibitors and dithiothreitrol to provided buffers), the cell culture medium was aspirated from each plate and each plate was wa shed twice with ice cold 1X PBS 1 mL of ice cold prepared Buffer A was added to each 100 mm plate followed by incubation on ice on a rocking platform at 200 rpm for 10 minutes. Following incubation, cells were scraped with a sterile disposable cell scra per. The cells were pipetted up and down to remove clumps and transferred to a 1.5 mL microcentrifuge tube. Samples were spun at 14,000 x g for 3 minutes at 4 C in a refrigerated microcentrifuge. The supernatants were removed and discarded and the pell ets were kept on ice. 150 L of prepared Buffer B was added to each tube and vortexed for 10 seconds on the highest setting. The tubes were placed on ice for 60 minutes; each tube was gently agitated by hand every 20 minutes. Following incubation, all s amples were spun at 14,000 x g for 5 minutes at 4 C in a

PAGE 44

44 refrigerated microcentrifuge. The supernatants (containing the nuclear extracts) were then aliquotted and stored immediately at 80 C. The concentrations of all nuclear extracts were quantified b y Bradford assay using Coomassie Plus Reagent (Pierce Inc., Rockford, IL, USA ) and UV spectrophotometry. Oligonucleotide Annealing Reactions for Electromobility Shift Assays Sense and anti -sense oligonucleotides designed against the ERE/ 2678 element and t he ROR/ 1969 element were generated based on bioinformatic analysis of the LMB StAR promoter. Several control probes were used, including one designed against a perfect human RORE (161) and one designed against a perfect canonical mouse ERE (provided by Panomics, Inc. Fremont, CA, USA ). All oligonucleotide sequences are listed in Table 2 4 below P robes were prepared and obtained commercially ( Eurofins MWG Operon Huntsville, AL, USA ). The probes were biotinylat ed only at the 5 end of each sense strand; cold probes lacked biotinylation. Sense and anti -sense oligos were annealed by adding equimolar amounts of each probe to a reaction containing 10 mM Tris, pH 8.0, 1 mM EDTA, 20 mM NaCl, 10 mM MgCl2, and 5 mM D TT. The reactions were boiled for 10 minutes at 95 C, allowed to gradually return to room temperature, and stored at 4 C for use within 48 hours. A polyacrylamide gel stained with SYBR green was run on the annealed oligonucleotides to confirm annealing (Appendix A, Figure A 2). Electromobility Shift Assays (EMSA) Fluorescence -based EMSAs were conducted using a modification of the commercially available EMSA Gel Shift Kit protocol (Panomics Inc., Fremont, CA, USA ) with double stranded oligonucleotides ( described above) and freshly prepared nuclear fractions from either Y 1 mouse adrenocortical or MA 10 mouse Leydig tumor cells. In EMSA/supershift experiments conducted with MA 10 nuclear extracts, 10 g of nuclear extract and 1 g of poly

PAGE 45

45 d(I C) were utilized in each binding reaction. In the instances where antibody was added, 1 g of ER (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA ) antibody was used per reaction. In experiments conducted wi th Y 1 nuclear extracts, 5 g of nuclear extract and 1 g of poly d(I C) were utilized in each binding reaction. When recombinant ROR protein was used in place of nuclear extracts, 1 g of protein was used in place of the nuclear extracts. In the instances where an antibody was used, 1 g of ROR antibody was added to the reaction; Lechtken et al. have previously described the recombinant protein and antibody used in these experiments (161) For all experiments, p rior to the addition of double -stranded probes encompassing each site the binding reactions were incubated overnight at 4 C. The next day, the concentration of each of the double -stranded probes was quantified using a spectrophotometer; biotinylated pro bes were diluted to 10 ng/ l and 10 ng of probe was added to each reaction. If a competition assay was performed, th e cold probes were diluted to 1000 ng/ l prior to adding 1000 ng of cold probe to the specified reaction. The binding reaction co nditions are outlined in detail in the manufacturers protocol. Once the probes were added, the binding reactions were incubated at 17.5 C for 30 minutes. A 6% non-denaturing T ris borate EDTA (TBE) polyacrylamide gel was then prepared and pre run in pre -chilled 0.5X TBE for 10 minutes at 120 V at 4 C. Once loaded, gels were electrophoresed for 20 minutes at 60 V at 4C, followed by 80 minutes at 100 V at 4 C. The EMSA Gel Shift Kit protocol and reagents from the manufacturer were used for the remainder of the EMSA /Supershift. All blo ts were visualized using a gel and blot photo docking system ( Bio Rad Laboratories, Inc., Hercules, CA, USA ). Ex vivo Testis and Ovarian Tissue Cultures Ovarian and testis tissue cultures from LMB were cultured to detect tissue -specific responses to hCG in combination with E2, ICI 182,780, and a number of OCPs. Following

PAGE 46

46 humane euthanasia by exposure to MS 222, gonads from male and female LMB were minced into ~20 mg pieces and carefully cultured in 1 mL L 15 culture medium ( supplemented with 1 % antibiotic antimycotic solution) in 24 well plates Tissues were immediately pre -exposed for 2 hours to 100 M doses of each OCP (DDE, DIEL, MXC, TOX ) or 10 M ICI 182,780 and 100 nM E2 followed by e xposure to either me dium alone or medium supplemented with 1 or 1 0 U/ mL hCG for either 6 or 20 hours (in addition to the same chemical and dose during pre exposure). All exposures were conducted at ambient temperature and in the dark on a rocking platform, ensuring proper aeration and mixing. Each treatment was condu cted in duplicate from four individual LMB per sex Tissues were snap -frozen in liquid N2 and stored at 80 C until RNA was processed, while culture medium was aliquotted into 2 mL low adhesion microcentrifuge tubes and stored at 20 C fo r future T analysis Chromatin Immunoprecipitation (ChIP) Assays Y 1 cells were plated on 2 x 100 mm cell culture plates and allowed to grow to ~70% confluency. Each plate was transfected with the 2.9 kb LMB StAR gene promoter plasmid using Fugene HD (Roche Diagostics, Indianapolis, IN). For ChIP assays, transfection efficiency must be high, and transfections using GFP in the Y 1 cells confirmed high transfection efficiency (Appendix A Figure A 3). After transfecting overnig ht, medium was changed and 1 of the transfected plates was treated with 1 mM dbcAMP for 20 hours. Samples were processed for ChIP analysis using a modif ied version of the ChIP IT Kit protocol (Active Motif, Carlsbad, CA ). Following two washes with 10 mL ice cold 1X PBS, each plate was fixed for 10 minutes on a rocking platform at room temperature. The fixation solution consisted of formaldehyde diluted in serum -free and antibiotic -free culture medium ([formaldehydeFinal] = 0.01%) Following fixation, the used fixation solution was aspirated and each plate was washed with 10

PAGE 47

47 mL ice cold 1X PBS and the wash was discarded. To stop the fixation reaction, 10 mL of Glycine Stop-Fix Solution were added to each plate and each plate was incubated on a rocking platform for 5 minutes at room temperature. The solutions were aspirated following the incubation and each plate was wa shed with ice cold 1X PBS one final time. 2 mL of Cell Scraping Solution (1X PBS containing PMSF) were added to each plate and cells were scraped using a sterile disposable cell scraper Cells from each treat ment (1 plate basal and 1 plate stimulated) were pooled into multiple 2 mL low adhesion microcent rifuge tubes and centrifuged at 2,500 rpm at 4 C to gently pellet the cells. The supernatant from each tube was discarded. The pellets from each individual treatment were pooled into one tube by resuspending all individual pellets in a t otal of 333 L of ice cold Cell Lysis Buffer (supplemented with PMSF and protease inhibitor cocktail) and placed on ice for 30 minutes. Each cell suspension was then transferred to a pre chilled 2 mL dounce homogenizer and dounced on ice with 10 strokes to help aid i n the release of the nuclei from the cells. The lysed cells were then t ransferred to 1.5 mL low adhesion microcentrifuge tube s and centrifuged at 5,000 rpm for 10 minutes at 4 C The supernatant was carefully removed and each nuclei pellet was resuspended in 333 L Shearing Buffer (supplemented with protease inhibitor cocktail). C hromatin was sheared using a Fisher Sonic Dismembrator (25% power; 20 second pulse, 30 second rest in ethanol ice bath, repeated 5X). Shearing efficiency was checked on an agarose/ethid ium bro mide gel (Appendix A; Figure A 4 ). Crosslinked sheared chromatin obtained from both treatments was pre -cleared with Protein G agarose beads for 2 hours at 4 C on a rotating mixer. Samples were spun briefly to collect beads and the remaining super natant ( pre -cleared chromatin ) from both treatments was split equally into 4 individual low adhesion 0.6 mL tubes. 10 L of the pre -cleared chromatin from each treatment was frozen at 20 C for use as input control (used to normalize and control

PAGE 48

48 for the amount of DNA input into each immunoprecipitation reaction under different conditions) later in the protocol. All samp les were immunoprecipitated at 4C overnight on a rotating wheel, each containing 2 g of antibody ( against either IgG, ROR (Santa Cruz Biotechnology, Santa Cruz, CA), or rev -erb (Cell Signaling Technology, Beverly, MA) ), or with no antibody (background control) The next day, Protein G agarose beads were added to each sample and samples were incubated on a rotating wheel at 4 C for 1.5 hours. Beads were pelleted by brief centrifugation and the supernatants were discarded. Collected bead -protein -DNA c omplexes were washed (2 minutes per wash on rotating mixer at room temperature) with ChIP IP Buffer 1X, Wash Buffer 1 4X, Wash Buffer 2 1X, and Wash Buffer 3 2X. Bound protein DNA complexes were eluted from the beads by adding ChIP Elution Buffer (contain ing NaHCO3 and SDS) to each sample and rotating on a rotating mixer at room temperature for 15 minutes. Elution was repeated to maximize yield. C rosslinks were then reversed and protein and RNA were digested from each sample. DNA was column purified and q PCR was run on eac h sample as described above. D ata was normalized to a 1:10 dilution of the DNA input control (pre cleared chromatin collected from each treatment immediately following agarose bead pre clearing) The primers used in qPCR to detect ChI P enriched DNA are listed in Table 2 5 The mouse primers were designed against a putative RORE (mROR/ 634) identified in the mouse StAR gene promoter using the Genomatix MatInspector software as described in the in silico analysis section above. The put ative site was located between bp 619 and -641 is relative to the transcriptional start site of the gene. Each assay was repeated at least twice to verify results observed.

PAGE 49

49 Transient Transfection Assays in MA -10 Cells 100,000 cells/well were plated in 24-well culture plates coated with 0.1 % gelatin (dissolved i n 1X PBS) and allowed to grow for 24 hours prior to treatment with chemicals Transfe ction reactions consisted of a 4:1 ratio of Fu GENE HD (Roche Diagnostics, Indianapolis, IN ) to plasmid DNA (2 l FuGENE HD/ 0.5 g total DNA per well in a 24 well plate ) suspended in 25 l media with no serum or antibiotics. All transfections were carried out for 24 hours and nor malized to Renilla luciferase (ratio of the mass of LMB StAR gene promoter construct: R enilla luciferase construct used was 0.49875 g: 0.00125 g, or approximately 400:1). 24 hours post transfection, cells were treated for 20 hours with either DMSO (vehicle), or with 1 or 10 M of each OCP followed by a 4 hour exposure to growth medium a lone or growth medium supplemented with 10 U/mL hCG Firefly and Renilla luciferase were quantified following transfection s and exposures. Note: the set of experiments presented in Chapter 5 were only replicated one time due to the lack of significant re sponse by the promoter observed in response to OCP exposure. Luciferase Measurements In MA 10 cells transfected and treated with various chemicals, the Dual Luciferase Kit (Promega Corp. Madison, WI USA) was used to quantify Renilla and F irefly lucifera se values. Immediately following exposure, each well was washed twice with 200 L 1X PBS and 2 00 L of 1X passive lysis buffer (Promega Corp., Madison, WI, USA) was added. Plates were placed on a shaking platform (~50 rpm) for 2030 minutes at room tempe rature. Using sterile pipette tips, each wells layer of cells was agitated and scraped to ensure all cells were lysed and detached. Following lysis, the lysates were transferred to low adhesion 1.5 mL microcentrifuge

PAGE 50

50 tubes. To remove any residual gelat in or cell debris contamination, all lysates were centrifuged at 3,000 x g for 3 minutes at 4 C. 120 L of each lysate was transferred to new tubes. Luciferase measurements were made using reagents from the Dual Luciferase Kit (Promega Corp., Madison, WI, USA ) and a 96 well plate reading luminometer (LMax II384, Molecular Devices, Sunnyvale, CA). 20 l o f each cell lysate (from each well of a 24 well plate transfected and treated) was added per we ll in a 96 well plate. First, F irefly luciferase was measured ; 50 L of Firefly Luciferase Reagent was injected into an individual well. Following a 10 second delay, Firefly L uciferase activity was quantified (corresponding to LMB StAR gene promoter activity), followed by the immediate addition of 50 L of Stop & Glo Substrate, which con tains reagents that quench the F irefly reaction and contains the substrate t o quantify the Renilla luciferase (transf ection control). The ratio of Firefly luciferase/R enilla luciferase was used to generate graphs reported in Re lative Luciferase Units (RLUs). Green Fluorescent Protein (GFP) Imaging Optimization of trans fections in MA 10 cells and in Y 1 cells was conducted using a green fluorescent protein construct (pEGFP, Clontech, Mountain View, CA, USA ). Briefly, for MA 10 cells, Thermanox (NUNC) coverslips were placed in 24 -well plates and coated with 0.1 % gelatin. Cells we re transfected as described earlier and GFP was visualiz ed using fluorescent microscopy for verification of high transfection efficiency. R epresentative image s of these optimization experiments for Y 1 cells (Figure A 3 ) and for MA 10 cells (Figure A 5 ) c an be found in Appendix A. Statistical Testing For statistical testing of all data generated in the wild LMB seasonal studies, a one -way analysis of variance (ANOVA) followed by a Tukeys HSD post hoc pairwise multiple

PAGE 51

51 com parison was performed on log -trans formed expression data (JMP v7, SAS Cary, NC, USA ) to determine statistical differences between individual stages and months. All results are plotted as mean copy number/ g total RNA standard error mean ( SEM ) of untransformed data (n = 3 4/month per se x). LMB were also grouped according to gonad stage and results are plotted as mean copy number/ g total RNA SEM of untransformed data. Body weight, length, gonad weight, GSI, age, and expression data for each transcript throughout the year were determi ned to be normally distributed and Pearson multivariate correlations were performed for all variables followed by a p-value correction for multiple tests. All differences were considered significant with a p -value < 0.05. For all qPCR experiments on LMB e x vivo gonad cultures, a one -way ANOVA followed by post hoc Dunnetts pairwise multiple comparison were performe d on log -transformed gene expression data All analyses were performed using JMPGenomics (SAS, Cary, NC, USA).

PAGE 52

52 Table 2 1. List of primer se quences used for qPCR analysis of LMB mRNA expression. Gene Forward Strand (5 3) Reverse Strand (5 3 ) [Final] in Reaction LMB AR CACCACAGAGAATGTGCCTGA AATGCCGCGTGAGTGGAC 400 nM each LMB ER CGACGTGCTGGAACCAATGACAGAG ACCTCCTCCTTTTAGTAGTCACTGGCCT 4 00 nM each LMB ER a GTGACCCGTCTGTCCACA AGAGGACGTGACTGGGGTCT 200 nM each LMB ERb CCGACACCGCCGTGGTGGACTC AACTCCGAGGGGAACGGGGCGA 200 nM each LMB StAR ACCCCTCTGCTCAGGCATTT GTTCTTCGTCCACCTCGGG 400 nM each

PAGE 53

53 Table 2 2 List of primer sequences used to clone the proximal 2.9 kb and distal 2.6 kb (total 5.6 kb ) LMB StAR gene promoter. Segment Reaction Sequence (5 3 ) Additional Comments 2.9 kb (proximal) Primary PCR CAGGCAACATCTTACTCAGG ACTTTGTC See reference (90) for further i nfo. 2.9 kb (proximal) Secondary PCR TCACCTTGCTTCACATAAGACATCTCT See reference (90) for further info. 2.9 kb (proximal) Primary PCR TTCCACTCCCCCATTTGCTC CATATTT See reference (90) for further in fo. 2.9 kb (proximal) Secondary PCR CAGGCAACATCTTACTCAGGACTTTGTCC See reference (90) for further info. 2.6 kb (distal) Primary PCR TGGCGTTTATGGACCTTGTGAAACACA 2.6 kb (distal) Secondary PCR GGGGGGAAAACTCAGTCCTCACTCTGT

PAGE 54

54 Ta ble 2 3 List of PCR thermal cycler parameters used to clone the proximal 2.9 kb and distal 2.6 kb (total 5.6 kb) StAR gene promoter. Primary PCR Conditions Secondary PCR Conditions 7 cycles: 94 C/2 seconds, 72 C/3 minutes 5 cycles: 94 C/2 seconds, 72 C/3 minutes 37 cycles: 94 C/2 seconds, 67 C/3 minutes 24 cycles: 94 C/2 seconds, 67 C/3 minutes Hold: 67 C/4 minutes Hold: 67 C/4 minutes

PAGE 55

55 Table 2 4 List of oligonucleotide sequences used in EMSA experiments. Site Encompassed Species Forward S trand (5 3) Complementary Strand (5 3 ) Perfect ERE Mouse GTCCAAAGTCAGGTCACAGTGACCTGATCAAAGTT AACTTTGATCAGGTCACTGTGACCTGACTTTGGAC ERE/ 2678 LMB AGCGCCTTTCTAGTCTTTTTGACCACTCAAAGCGC GCGCTTTGAGTGGTCAAAAAGACTAGAAAGGCGCT Perfect RORE Human TCGAGTCGTA TAACTAGGTCAAGCGCTGGAC GTCCAGCGCTTGACCTAGTTATACGACTCGA ROR / 1969 LMB AATAGGCATATGACCTACTTTGGCTC GAGCCAAAGTAGGTCATATGCCTATT Scrambled RORE LMB CCTCTATAACGGGTCGGATACTATTA TAATAGTATCCGACCCGTTATAGAGG

PAGE 56

56 Table 2 5 List of qPCR primers used in ChIP experiment s. Site Encompassed Species Forward Primer (5 3) Reverse Primer (5 3 ) mROR / 634 Mouse AGAGTGGAGTTGGTATCAATGGGT TGGCTCAAAGACAAACAGGATG ROR / 1969 LMB AGGTTCTCACACCCTTGCTAGAAA TCTCTTCTGCCGTAAAGCTCTTTT

PAGE 57

57 CHAPTER 3 SEASONAL EXPRESSION OF THE STEROI DOGENIC ACUTE REGULATORY PROTEIN AND SEX STEROID HORMONE RECE PTORS IN THE GONADS OF WILD LARGEMOUTH BASS1 Introduction Normal steroid hormone synthesis is a critical component of reproductive success in all vertebrates and for many years the signaling path ways involved in steroid hormone production have been extensively studied and well characterized in vertebrates, including multiple species of fish. The ER and AR are two of many steroid hormone receptor proteins that play critical roles in the regulation of a wide array of genes involved in steroid hormone synthesis and reproduction. Current understanding in the literature is that there are multiple isoforms of ERs ( a, and b) (44, 66, 68 72) and ARs (A and B in mammals ; and or 1 and 2 in teleosts, respectively synonymous (75, 77 82) ) in fish, implicating that signaling pathways are intricate and quite complex. The StAR protein a more recently identified protein (52), is the protein that facilitates the rate limiting step in steroid hormone production in all vertebrates, and has only recently been characterized in teleost fishes (89, 100, 104, 106, 162164) StAR protein transports cholesterol across the outer mitochondrial membrane where it is cleaved into pregnenolone and subsequently into other steroid hormones, and is found predominantly in reproductive tissues (116) ERs and ARs are essential transcriptional factors that control the expression of gene s involved in steroid hormo ne production and reproduction; StAR protein is a critical player in steroid hormone biosynthesis. ERs, ARs, and StAR protein have all been identified as targets of a number of EDCs in the environment (112, 165) EDCs are chemicals that disrupt normal 1Pruc ha MS, Martyniuk CJ, Kroll KJ, Porak W, Grier H, and Denslow ND. Seasonal Expression of the mRNA Encoding the Steroidogenic Acute Regulatory (StAR) Protein and Nuclear Receptors in the Gonads of Wild Largemouth Bass ( Micropterus salmoides ). 2009. Prepared for submission to J Mol Endo

PAGE 58

58 endocrine function through a number of mechanisms, including altering steroid hormone levels by disrupting the expression of different genes and proteins involved in steroidogenesis. LMB in habit the greater part of North American freshwater systems and is highly susceptible to the negative effects of a number of EDCs (14, 67, 113, 144, 166) LMB are a commercially important game fish and are consider ed top predators in the food chain, making the species highly prone to bioaccumulation of contaminants and toxicants in the environment. In the Potomac River in Maryland (USA), intersex male smallmouth bass and LMB (bearing both eggs and sperm in testes) have been reported and research has linked the high occurrence of this abnormality with EDCs in the watershed (28) The reproductive cycles of female and male teleost species have been well characterized previously (42, 43) Egg and sperm production in teleost fish is tight ly controlled by physiological and environmental cues, and each distinct stage of reproductive development is characterized by the presence and variable abundance of several different types of cells in both sexes. The reproductive cycle s of LMB are semi -s ynchronous and reproductive progression is predominantly dependent upon water temperature, photoperiod, and steroi d hormone synthesis. Plasma sex steroid hormones, includ ing 11-KT and E2, tightly control the expression of genes centrally involved in repro duction via genomic (AR and ER -mediated) and non -genomic signaling. S tudies have shown that ER, AR and StAR mRNA expression levels fluctuate throughout the reproductive cycles of teleost fish (44, 89, 105, 106, 167). Our laboratory has previously cloned the entire gene coding region for LMB ER, ERa and ERb (44) and StAR (90) as well as a partial region of the AR ( identical between isoforms) coding region. However, reproductive stage -specif ic expression profiles of these genes are not known for LMB.

PAGE 59

59 Interestingly, s tudies have shown that estrogens and androgens regulate the expression of the StAR gene (102, 114, 124) but the mechanisms underlying thi s regulation are currently undefined. Our laboratory has previously characterized the LMB StAR gene promoter (89) and its regulation is extr emely complex. It was hypothesized that a direct interaction between an ER isoform with a putative element in the very complex LMB StAR gene promoter is possible and that ERs may play a role in controlling StAR gene expression. This is the first study to characterize ER, AR and StAR mRNA levels in the gonads of a wild subset of male and female LMB. In addition, this study examine s changes in StAR mRNA expression in LMB testis cultures in response to E2 and ICI 182,780 (ICI, a potent ER inhibitor ) under basal and hCG stimulated conditions to identify potential ER involvement i n StAR gene transcription. A 5.6 kb portion of the LMB StAR promoter was cloned and, using computer software, multiple putative ER/AR elements were identified In addition, in vitro binding of ER to a putative ER binding element in the LMB StAR gene promoter is confirmed Results Gonadosomatic Indices and Water T emperature Both female (Figure 3 1A) and male (Figure 3 1B) LMB GSI reached maximum levels when the water temperature was between 66 71 F in the St. Johns River in Welaka, FL. Female GSI peaked in February and March (~ 3.4 4.0% 0.5%); however, male GSI distinctly peaked in February (~ 0.5% 0.05%). During the summer months, when water temperature exceeded 80 85 F, both male and fem ale GSIs plummeted, indicating regression of the gonads throughout the summer season, as expected. The GSI throughout the year ranged from 0.22 3.96% for females and 0.020.52% for males Data graphed in this figure included values from

PAGE 60

60 all individuals whose gonads were utilized for gene expression data analysis in this study (approximately 4 individuals per month per sex). Staging of G onads from Male and Female LMB Throughout the Reproductive Season Representative samples from gonads of fishes exhibiting each major stage of reproduction were collected for histological screening. Micrographs from female (Figure 3 2) and male (Figure 3 3) gonads exhibit distinct cellular and morphological characteristics that vary greatly throughout various reproductive s tages and the staging of all individuals in these studies was done in a similar manner described by Grier et al. (42, 43) For females (Figure 3 2) stages are categorized as follows: perinucleolar (PN; panel A), cortical alveoli (CA; panel B), early vitello genesis (EV; panel C), late vitellogenesis (LV; panel D), maturation (M; panel E), and atresia (AT; panel F). The PN and CA stages are characterized by the presence of primary ~100 200 M growth follicles (PG F s), however presence of oil droplets and CA ma rk the CA stage. In EV, the follicles start to grow bigger, numerous oil droplets (ODs) begin to accumulate, and the germinal vesicle (GV) stains darkly. In LV, the follicle has grown to its maximum size and yolk globules (YGs) populate the follicle, whe re you can begin to see the development of the zona pellucida (ZP) and germinal epithelium (GE). During M, there are many different sub -stages, however, for the purpose of this study, females were classified into one group. M is characterized by the coal escence of all oil droplets into an oil globule (OG), GV migration, and ovulation. AT is the stage at which follicles of all stages are resorbed and the cycle restarts. For males (Figure 3 3), reproductive stages were classified into four categories, including the stage ( marked by the predominance of spermatagonia (SG; panel A) ) the stage (at which spermatocytes (SC; panel B) become present ), and the and stages at which spermatozoa

PAGE 61

61 (SZ) and spermatids (ST) are present (panels C and D). In the stage, SZ composed < 50% of the area view, whereas in the stage, SZ composed > 50% of the area. In both sexes of LMB, different stages are represented by a number of different cell types that are differentially involved in the reproductive cycle. StAR AR a nd ER mRNA E xpression in LMB Ovary and Testes by Month In the LMB ovary (Figure 3 4), StAR ((3 4 A); d.f = 11; F = 8.31; p < 0.0001), ERa ((3 4 D); d.f. = 11; F = 2.50; p < 0.05), and ERb ((3 4 E); d.f. = 11; F = 2.63; p < 0 05) transcripts varied signifi cantly by month, whereas AR (3 4 B) and ER (3 4 C) did not vary significantly throughout the year. In the LMB testes (Figure 3 5), StAR ((3 5A); d.f. = 11; F = 2.67; p < 0 05), AR ((3 5B); d.f. = 11; F = 5.12; p < 0.0001), ER ((3 5C); d.f. = 11; F = 2.80; p < 0.05), ERa ((3 5D); d.f. = 11; F = 5.71; p < 0.0001), and ERb ((3 5E); d.f. = 11; F = 6.67; p < 0.0001) all varied significantly throughout the year. Notably, StAR transcript levels were lower in the females than in the males, and there was, on ave rage, 10 -fold less copies of StAR mRNA in both sexes when compared to the other genes quantified. StAR mRNA levels peaked significantly in February in the females, whereas StAR didnt peak during any month in the males, although a trend for higher express ion occurred January through March. Throughout the entire year, StAR mRNA levels in the testes were at least 2 -fold more abundant than levels observed in the ovary. Interestingly, AR mRNA was more abundant in the ovary than in the testes. ER mRNA didnt vary significantly throughout the year in the ovary; however, in the testes ER peaked in August and decreased in September. ERa mRNA levels in the ovary peaked in October and diminished throughout the rest of the months until gradually inc reasing in August -September. In the males, ERa transcript levels were consistently much lower than the levels observed in the females. In the females, ERb mRNA peaked in October and decreased throughout the year until gradually

PAGE 62

62 increasing in August th rough September. ERb mRNA levels in the males remained fairly consistent from October -March, increased significantly in August, and returned to the levels observed in earlier months until transcript levels diminished in September ERb transcript levels peaked at higher levels throughout the year in the testes than the values observed in the ovary. Altogether, several of the genes quantified varied significantly throughout the year in both sexes. StAR AR and ER mRNA Expression in LMB O vary an d Testes by Reproductive S tage Based upon reproductive stage in the females (Figure 3 6), StAR ((3 6A); d.f. = 5; F = 18.65; p < 0.0001), ERa ((3 6D); d.f. = 5; F = 7.39; p < 0.0001), and ERb ((3 6E); d.f. = 5; F = 4.54; p < 0.01) mRNA levels varied significantly throughout the different stages, while AR (3 6B) and ER (3 6C) mRNA levels did not vary significantly. There was a trend in all ER isoforms to be highest expressed during earlier stages and less expressed during vitellogenesis and maturation. In the ovary, StAR mRNA was very minimally expressed through the perinucleolar, cortical alveoli, and early vitellogenic stages. StAR mRNA increased gradually through the late vitellogenic stage and peaked at maturation. As expected, StAR mRNA decreased when follicles were undergoing atresia and the spawning season was over During the perinucleolar and cortical alveoli stages, ERa mRNA levels were approximately 3 -fold greater than ERb mRNA levels. During maturation and atresia, the levels of both ER transcripts were relatively even. In the testes of the males (Figure 3 7), StAR (( 3 7A); d.f. = 3; F = 9.84; p < 0.0001), AR ((3 7B); d.f. = 3; F = 14.97; p < 0.0001), ERa ((3 7D); d.f. = 3; F = 5.21; p < 0.01), and ERb ((3 7E); d.f. = 3; F = 6.30; p < 0.01) varied significantly through different reproductive stages, while ER (3 7C) did not significantly vary. Again, there was a trend for all ER isoforms to be

PAGE 63

63 expressed during earlier reproductive stages and to taper off during the later stages of spermatogenesis and reproduction. StAR transcript levels did not change during the and stages, whereas there was an approximately 3 -fold increase in the and stages. AR, ERa and ERb mRNA levels in the males were significantly decreased during the stage when compa red to the rest of the stages. Ex Vivo Exposure of LMB Testis to E2 and ICI 182,780 Alters StAR mRNA Expression To investigate the potential for ER involvement in regulating StAR mRNA expression, 15 25 mg pieces of testis tissue were cultured ex vivo from four individual male LMB and treated with vehicle, E2, or ICI, under basal and hCG -stimulated conditions. Cu ltures were pre treated for 2 hours with vehicle, 100 nM E2, or 10 M ICI, followed by supplementation with fresh medium containing the same doses of vehicle, ICI, or E2 alone or in combination with hCG ([final] = 1 U/mL). Cultures were incubated for 6 and 20 hours and StAR mRNA levels were quantified by qPCR (Figure 3 8, A and B, respectively). 6 hour exposures were carried out to examine the acute response of the chemicals, whereas the 20 hour exposures were conducted to characterize the longer -term, more genomic responses. 6 hour exposure to hCG revealed a 2 fold in duction of StAR mRNA levels and E2 slightly stimulated StAR mRNA levels above levels observed in the vehicle controls under basal conditions only. 6 hour E2 and ICI exposure did not alter StAR mRNA expression under hCG -stimulated conditions. As expected, the induction of StAR mRNA by hCG exposure was diminished after 20 hours. Interestingly, concomitant exposure of ICI with hCG for 20 hours induced StAR mRNA levels greater than 2 -fold relative to control levels. Altogether, these experiments examined th e testis -specific changes in StAR mRNA expression upon exposure to chemicals known to impact ER signaling, and changes in

PAGE 64

64 StAR mRNA expression indicate that ER pathways may be involved in controlling transcription of the StAR gene in LMB. In S ilico Analysi s of the LMB StAR G e ne Promoter Reveals P utative ER responsive transcriptional elements Using computer software designed to analyze DNA sequences for putative transcriptional elements, multiple putative estrogen responsive elements (EREs) were identified i n the 5.6 kb LMB StAR gene promoter. With greater than 80% homology to consensus vertebrate core element sequences, 3 ER bin ding elements and 8 AP 1 elemen ts were identified in the StAR gene promoter, raising the possibility that the StAR promoter may be regulated by ER signaling EMSA Analysis of ERE/ -2678 in the LMB StAR P romoter The presence of bands seen by EMSA analysis using probes designed against the ERE/ 2678 element in the LMB StAR promoter (putative ERE located at 2678 bp from the start of the codin g sequence for the gene; Table 2 4 ) and nuclear fractions isolated from MA 10 mouse Leyd ig tumor cells under basal and E2 treated conditions suggests that a protein binds to the ERE/ 2678 in the LMB StAR promoter (Figure 3 9 ). Probes designed against a perfect mouse ERE were used as a positive control. A distinct band is present in lanes where ERE/ 2678 is represented; the band intensifies when bound to E2treated nuclear extracts. When a cold unlabeled probe was added in excess of the labeled ERE/ 2678 probe, the band disappeared, confirming specificity of the probe. Addition of an ER antibody to the binding reaction (last lane) displaced the specific band, suggesting that ER is capable of binding the ERE/ 2678 element in the LMB StAR promoter. Discussion This study investigated the seasonal expression of ER, AR, and StAR transcripts throughout the reproductive season by month and by reproductive stage in female and male LMB, and

PAGE 65

65 searched for possible relationships between the expression of these genes and other physiological parameters. T he distal portion of the 5.6 kb LMB StAR gene promoter was cloned and multiple putative EREs were identified in t he DNA sequence. As confirmed by EMSA, mammalian ER is capable of binding to the ERE/ 2678 element in the LMB StAR promoter in vitro The reproductive cycle of LMB is complex and is controlled by many environmental and physiological cues, so gene expression was analyzed by both month and by reproductive s tage. LMB in Florida typically reproduce in late spring; reproduction is greatly dependent upon water temperature. Throughout the summer months when water temperatures are high, female LMB reabsorb follicles (atresia) and male LMB testes regress, stoppin g spermatogenesis. It was observed that gene expression analyzed from later reproductive stages in both female and male LMB was very similar to the expression levels o bserved in February and March (S pring). Grouping the individuals by reproductive stage distinguished trends observed in gene expression by month into significant observations dependent upon gonad stage, therefore all subsequent discussion will focus on stage -specific gene expression. In both female and male LMB, the expression profiles of all ER isoforms were highly correlated with one another throughout the various stages of each reproductive cycle (Tables 3 1 and 3 2, respectively ); these data parallel previous work conducted using pond -reared LMB (44) In the ovary, the ER isoforms were highly expressed during the early stages of reproduction and minimally expressed during the late vitellogenic and maturation stages. In male LMB, expression of the ERa and ERb remained fairly steady throughout each stage, except during t he reproductive stage when spermatocytes were predominantly present and spermatids and spermatozoa were not. Few studies have been conducted characterizing ER expression in the teleost testes, however, a recent study in sea bass by Vinas and Piferrer ex amined ER mRNA

PAGE 66

66 expression in specific testicular cell types using laser microdissection (spermatogonia, spermatocyte s, spermatids, spermatozoa ) by stage, and all ER isoforms decreased throughout spermatogenesis (168) In LMB, spermatogenesis proceeds in a cystic mode; specifically, as spermatogenesis advances through late reproduction, the cells populating the testes and their ratios vary greatly (169) and our data encompass all cell types present in the testis at a given stage. When spermatids and spermatozoa are present (late stage s), it is apparent that the area occupied by different cell types varies greatly upon examination of histological micrographs of the LMB testes (Figure 3 3). Altogether, our data suggest that all ER isoforms are likely to play unique and complex roles in regulating genes involved in female and male reproductive progression and cycling. In this study, AR expression was analyzed in the gonads of wild female and male LMB. Multiple studies have indicated that there are two isoforms of ARs in teleosts, though the functionality, ligand binding properties, and tissue distribution of both isoforms vary greatly between i ndividual species; however, both isoforms of AR receptors have been detected in the gonads in multiple fish species (76 78, 80, 81) While LMB are likely to contain two isoforms of AR as shown for other fish, so far, only a fragment of one isoform which is in a region that is highly homologous among all AR isoforms has been cloned In rainbow trout, it was r eported that AR -A is more highly expressed in the ovaries whereas AR -B is a more testes -specific isoform (80) The potential for differential regulation of genes by different AR isoforms is likely and it would be interesting to further investigate this i n LMB. Overall, the roles that ARs play in controlling genes in the LMB testes and ovary are intricate, and further research is warranted to better understand complex AR signaling pathways.

PAGE 67

67 In the LMB ovary, AR mRNA was highly abundant (> 2 x 106 copies/ g total RNA throughout all stages), however, transcripts did not vary significantly between stages or by month in the females. In the LMB testes, AR mRNA was notably less abundant (> 2X less copies than observed in females throughout all stages). AR tran scripts were significantly less abundant during the stage, when spermatocytes were present and spermatids and spermatozoa were not, as observed with ERa and ERb mRNA. Again, this could be due, in part, to the different populations of different cell types, as discussed earlier regarding ER mRNA levels i n the testis. StAR mRNA abundance in the LMB ovary and testes peaked markedly during late reproductive stages (late vitellogenesis and maturation in female and and (spermiogenic stages) in the testes), as expected. Gonadal StAR expression has been characterized throughout the reproductive stages of multiple fish species (97, 106, 167) and all studies report an increase in StAR expression during the later reproductive stages in both sexes, as observed in our study. StAR mRNA was less abundant in the ovary than in the testes. In the females, StAR increased nearly 3 -fold during early vitellogenesis and 9-fold during maturation from levels observed during the other reproductive stages. Notably, there is a si gnificant peak in February when StAR expression is plotted by month, giving strong indication that at least one round of spawning likely occurred in late February or early March given that StAR levels are the highest during maturation. In the males, StAR increased > 2.5 -fold during spermiation from the levels seen when no spermatids or spermatozoa were present. The acute upregulation of StAR mRNA during the beginning stages of reproduction reinforce s the idea that the StAR protein plays a critical role i n steroid hor mone synthesis and reproduction in LMB. StAR mRNA levels increase dramatically in the later stages of reproduction as well, indicating that the expression of StAR

PAGE 68

68 mRNA must increase several fold in order to accommodate the surge of sex steroi d hormones required for spermiation and ovulation. Physiological parameters (body length, gonad weight GSI, and a ge) within each sex were predominantly positively correlated with one another All ER isoforms and AR mRNA levels were significantly positive ly correlated with one another in both sexes as well. In the ovary, ERa and ERb were negatively correlated with StAR expres sion, whereas in the testis ERa and AR were positively correlated with StAR expression. Studies have shown that E2 and T exposure causes a decrease in StAR gene expression (102, 114, 124) and it is possible that ER and AR signaling may mediate the reported repression. To investigate the potential for ER regulation of LMB StAR mRNA, LMB tes tis tissue was treated with E2 and ICI 182,780 under basal and hCG -stimulated conditions. Treatment for 6 hours with hCG elicited a 2 -fold induction of StAR mRNA and treatment with E2 slightly stimulated StAR mRNA levels under basal conditions Interesti ngly, 20 hour exposure of testis tissue to hCG in combination with ICI 182,780 was the only treatment that stimulated StAR mRNA levels Although ICI 182,780 has been characterized as an ER antagonist, recent studies have shown that the compound can actual ly act as a selective ER modulator and agonize estrogenic pathways by activating AP 1/Sp1 signaling (170) The membrane-bound G protein coupled receptor 30, a potential membrane -bound ER, is activated by ICI 182,780 and other ER an tagonists (171) In addition, i t has been reported that ER has the potential to activate the promoter for retinoic acid receptor by binding Sp1 sites when bound to ICI 182,780 and other antagonists, but not when bound to E2 (172) The slight stimulation of StAR mRNA upon treatment with E2 and the interesting results obtained with IC I 182,780 and hCG indicate

PAGE 69

69 potential for ER regulation of the StAR gene promoter, either by nuclear ERs or by pathways controlled by membrane -bound ERs Our laboratory previously cloned a 2.9 kb segment of the LMB StAR promoter (89) and an additional 2.6 kb of the distal region of the promoter was cloned in this study Upon examina tion of the promoter for putative ER, Sp1, and AP 1 sites several putative elements that may be involved in mediating the effects observed in our experiments were identified using MatInspector TF Search softwar e No Sp1 sites were identified but several putative AP 1 and ER sites were identified, including one located 2678 bp upstream from the transcriptional start site (ERE/ 2678). The ERE/ 2678 site exhibited the highest homology with the core mammalian ERE sequence (~87%). Interestingly, upon exami nation of the StAR promoter sequences from brook trout and multiple other vertebrates, only the fish promoters contained a putative canonical ER binding site. Because ERa transcript levels were highly correlated with StAR transcript levels in both male a nd female LMB gonads and the putative ERE located in the LMB StAR promoter was most homologous to the core mammalian ERE sequence, the potential for ER to bind to the ERE/ 2678 site was analyzed by EMSA/supershift. The presence of multiple bands indicate d that proteins and/or protein complexes can, indeed, bind to the ERE/ 2678 site in vitro When an antibody against ER was added to the reaction, one of the bands was completely displaced, implicating that ER is capable of binding to the element. The a ntibody selected was designed against a peptide that spanned into the DNA binding domain of ER so displacement of the band verifies specificity of ER for the ERE/ 2678 probe The presence of putative AP 1 sites and other putative ER sites in combinatio n with the results observed in our ex vivo experiments implicate that ERs may interact with a number of different elements in the StAR promoter; however, t he binding of ER to the ERE/2678 element in the LMB StAR promoter in

PAGE 70

70 vitro is supportive of the ide a that ERs can directly bind to the StAR gene promoter and control its activation though further functional studies are warranted. In summary, this study describes transcript levels for genes important for reproduction in the gonad of wild female and male LMB throughout the year, and characterizes the seasonal and stage -specific differenc es between the mRNA expression of the ER isoforms, AR and StAR. Our in vitro work suggests that ERs may play a role in regulating the LMB StAR gene promoter; however, further research investigating the functionality of the putative regulation is warranted. Altogether, this study provides novel information regarding the relationship between ER/AR and StAR mRNA expression in teleost fish and implicates that reproductive signaling pathways in LMB are extremely complex.

PAGE 71

71 Table 3 1 : Pearson correlations for seasonal transcript levels in the gonad of fe male LMB. (p<0.05*, p<0.01**, p<0.001***) BW Length Gonad GSI Age StAR ER ER a AR A BW 1 Length 0.802*** 1 Gonad 0.492*** 0.418** 1 GSI 0.291 0.279 0.947*** 1 Age 0.778*** 0.658*** 0.574*** 0.424** 1 StAR 0.085 0.092 0.727*** 0.807*** 0.173 1 ER 0.248 0.417** 0.048 0.05 7 0.301 0.106 1 ER a 0.390* 0.391* 0.593*** 0.589*** 0.431** 0.436** 0.560*** 1 ER b 0.406** 0.442** 0.529*** 0.548*** 0.412** 0.321* 0.634*** 0.879*** 1 AR 0.292 0.324* 0.168 0.070 0.335* 0.075 0.352* 0.449** 0.423** 1

PAGE 72

72 Table 3 2 : Pearson correlations for seasonal tran script levels in the gonad of male LMB. (p<0.05*, p<0.01**, p<0.001***) BW Length Gonad GSI Age StAR ER ER a AR A BW 1 Length 0.958*** 1 Gonad 0.587*** 0.561*** 1 GSI 0.129 0.13 6 0.819*** 1 Age 0.806*** 0.821*** 0.569*** 0.304 1 StAR 0.021 0.101 0.328* 0.425** 0.007 1 ER 0.104 0.069 0.211 0.210 0.213 0.285 1 ER a 0.139 0.162 0.275 0.243 0.127 0.428** 0.702*** 1 ER b 0.131 0.066 0.086 0.050 0 .023 0.244 0.635*** 0.630*** 1 AR 0.144 0.174 0.389** 0.410** 0.245 0.613*** 0.536*** 0.813*** 0.557*** 1

PAGE 73

73 Figure 3 1 Variations in gonadosomal indices of wild LMB and water temperature in Welaka, FL. A) Female LMB and B) male LMB. Gonadosomal indi ces are represented by the black lines and water temperatures are represented by the gray lines. Each point (GSI) is representative of the mean GSI SEM (n=3 4 individuals per month).

PAGE 74

74 Figure 3 2: Representative histological micrographs of female LMB ovarian stages Female stages were classified based on the predominant stage and are as follows: A) perinucle ol ar (PN); B) cortical alveoli (CA); C) early vitellogenic (EV); D) late vitellogenic (LV); E) maturation (M); and F) atresia ( AT). Scal e bars co rrespond to 200 Abbreviations are as follows: germinal vesicle (GV); nucleolus (N); primary growth follicle (PGF); ovarian lumen (OL); oil droplet (OD); cortical alveoli (CA); germinal epithelium (GE); zona pellucida (ZP); and yolk globule (YG).

PAGE 75

75 Figure 3 3: Repre sentative histological micrographs of male LMB testicular stages. Male stages were classified based on the predominant stage and are as follows; A) spermatagonia (SG); B) spermatocytes (SC); C) spermatids (SD) and <50% spermatozoa (SZ); and D) SD and >50% SZ. Scale bars correspond to

PAGE 76

76 Figure 3 4: Monthly StAR, AR, and ER mRNA expression in the female LMB gonad as determined by q PCR. Each bar re presents the mean copy number SEM of untransformed data followed by ANOVA with a Tukeys post hoc test (n=3 4 individuals/month). Graphs are as follows; A) StAR mRNA; B) AR mRNA; C) ER mRNA; D) ERa mRNA; and E) ERb mRNA. All mRNA expression data were normalized to ribosomal 18S rRNA copy number Different letters indicate statistical differences among groups (P <0.05).

PAGE 77

77 Figure 3 5: Monthly steroidogenic StAR, AR and ER mRNA expression in the male LMB gonad as determined by q PCR. Each bar represents the mean copy number SEM of untransformed data followed by ANOVA with a Tukeys post hoc test (n=3 4 individuals/month) Graphs are as follows; A) StAR mRNA; B) AR mRNA; C) ER mRNA; D) ERa mRNA; and E) ERb mRNA. All mRNA expression data were normalized to ribosomal 18S rRNA copy number. Different letters indicate statistical differences among groups (P <0.05).

PAGE 78

78 Figure 3 6: Stage -specific StAR, AR and ER mRNA express ion in female LMB gonad as determined by qPCR. Each bar re presents the mean copy number SEM of untransformed data followed by ANOVA with a Tukeys post hoc test (n=3 9 individuals/month). Graphs are as follows; A) StAR mRNA; B) AR mRNA; C) ER mRNA; D) ERa mRNA; and E) ERb mRNA. All mRNA expression data was normalized to ribosomal 18S rRNA copy number. Different letters indicate statistical differences among groups (P <0.05).

PAGE 79

79 Figure 3 7: Stage -specific StAR, AR and ER mRNA expression in male LMB gonad as determined by q PCR. Each bar re presents the mean copy number SEM of untransformed data followed by ANOVA with a Tukeys post hoc test (n=7 17 individuals/month). Graphs are as follows; A) StAR mRNA; B) AR mRNA; C) ER mRNA; D) ERa mRNA; and E) ERb mRNA. All mRNA expression data was normalized to ribosomal 18S rRNA copy number. Different letters indicate statistical differences among groups (P <0.05).

PAGE 80

80 Figure 3 8: Changes in testicular StAR mRNA expression upon exposure to vehicle, ICI 182,780 or E2 under basal and hCG stimu lated conditions for (A) 6 hours and (B) 20 hours 15 25 mg slices of testis tissue were c ultured in L 15 medium in duplicate in a 24 well plate and pre -exposed to 0.1% vehicle, 10 M ICI 182,780, or 100 nM E2 fo r 2 hours, followed by a change in medium containing the same treatment, under both basal and hCG -stimulated conditions ([final] = 1 U/mL) for 6 hours (A) and 20 hours (B) RNA was isolated from the tissue and reverse transcribed for analysis by qPCR Al l data was normalized to 18S rRNA. Each bar represents mean copy number SEM collected from two individual males (cultured in duplicate).

PAGE 81

81 Figure 3 9 : ER from MA 10 mouse Leydig cells binds to ERE/ 2678 in the LMB StAR gene promoter in vitro Probes designed against the ER element located 2678 bp upstream from the start of the gene coding sequence (ERE/ 2678) were combined with nuclear extracts isolated from MA 10 mouse Leydig tumor cells isolated from either basal (arrow A) or E2 treated conditions (arrow B). Non -biotinylated probes (cold) were used to confer specificity of DNA -protein interaction. An ER antibody was added in the last lane (arrow C) to determine which isoform of ER bound the LMB ERE/ 2678 element in the LMB StAR promoter in vitro A B C

PAGE 82

82 CHAPTER 4 REGULATION OF THE ST EROIDOGE NIC ACUTE REGULATORY PROTEIN BY ORPHAN NUCLEAR RECEP TOR SIGNALING PATHWA YS IN LARGEMOUTH BASS1 Introduction Identific ation of the StAR protein in 1994 significantly advanced the field of cholesterol metabolism (52) It has now been well characterized in multiple mammalian species that StAR transports cholesterol across the mitoch ondrial membrane and controls the rate limiting step for steroidogenesis (56, 92) Regulation of steroidogenesis occurs in a tissue -specific manner and involves multiple signaling pathways, including PKA and PK C, a mongst others, and this appears to be conserved across most vertebrate species (57, 92, 109, 173, 174) It is known that ACTH, an upstream regulator of the cAMP response, induces StAR mRNA expression in rainbow trout and in eel (175177) Binding elements for transcription factors known to mediate cAMP responses, such as SF 1 and CREB, have been identified in the mammalian StAR gene promoter, however the promoter is very com plex with many transcriptional elements for which the functions are still unknown (178) Although genome sequencing and expressed sequence tag (EST) projects are underway for many fish species, including LMB, there are no previous publications citing i n silico or function al promoter analysis of the StAR gene in any fish model. Mammals and lower vertebrates are likely to exhibit similar transcriptional regulatory mechanisms for the StAR gene. It is well established that the StAR gene is highly regulate d by the cAMP/PKA pathway across multiple species and that this pathway is important in reproduction. The transcriptional mechanisms controlling this gene in lower vertebrate animals 1 Kocerha RJ*, Prucha MS*, Kroll KJ, Steinhilber D, and Denslow ND. 2009. Regulation of the Steroidogenic Acute Regulatory (StAR) Protein by Orphan Nuclear Receptor Signaling Pathways in Largemouth Bass ( Micropterus salmoides ) Submitted to Endocrinology, under review. *Both authors contributed equally to the preparation of this manuscript.

PAGE 83

83 such as in fish have not been investigated and could provide much needed insight into the complex networks involved in the regulation of steroidogenesis. Circadian rhythm plays an important role in reproduction in vertebrates, and it exists centrally, in peripheral tissues, and even within individual cells (179) Control of gene expression at the cellular level is important in regulating reproductive processes, including steroid hormone production. It is known that ROR and rev -erb are two signaling proteins that play integral roles in controlling genes central to the circadian cascade (85 87) ROR and rev erb both bind to similar core sequences (ROR element RORE), however they induce opposing effects on the transcription of target genes (61) The aims of this study were to clone and characterize the LMB StAR gene and promoter at the tissue and cellular levels, respectively. We also attempted to identify and characterize elements in the LMB StAR promoter tha t are putatively involved in the transcriptional activation of the LMB StAR promoter. Our results show that ROR and rev -erb are both capable of binding a core sequence in the LMB StAR promoter and interestingly, that rev -erb binds to a core sequence in the mouse StAR promoter. Altogether, our study presents a novel mechanism through which the StAR promoter is c ontrolled. Results Previous Studies Reveal Multiple Put ative Transcriptional Elements may be Involved in Mediating cAMP -Induced Activity of the StAR Promoter (89, 90) Dr. Jannet Kocer ha, a former graduate student that completed her Ph.D. in our laboratory, cloned the coding region for the LMB StAR gene and optimized a qPCR assay using primers designed against the LMB StAR coding region. It was shown that ex vivo treatment of LMB ovarian follicles with 1 mM dbcAMP stimulated StAR mRNA levels nearly 10 -fold above basal levels. In addition, it was also reported that StAR mRNA levels vary in the ovaries of female

PAGE 84

84 LMB throughout reproduction, pa ralleling variations in plasma E2 levels observed in the same individuals (44) To investigate the transcriptional regulation of the LMB StAR gene, a 2.9 kb segment of the LMB StAR gene promo ter was previously cloned. Using MatInspector TF Search software, in silico analysis of the 2.9 kb LMB StAR promoter for transcriptional elements revealed a number of putative sites located th roughout the promoter sequence, including elements for 2 SF 1, 6 GATA, 1 ER, 3 ROR / rev -erb 1 YY 1, and 1 SREBP (Figure 4 1) Promoter sequences (including the 5 UTR) for the StAR gene from LMB (Acc. No. DQ166819), brook trout (Acc. No. AY308064), rat (Acc. No. AB006007), mouse (180) and hum an (Acc. No. U29098) were aligned based on the transcriptional start sites for the gene. The sites selected for mapping had transcription factor sequence. Using transient transfection assays in Y 1 mouse adrenocortical cells, Dr. Kocerha showed that the 2.9 kb LMB StAR promoter was dose responsive to dbcAMP and that there were several putative elements in the 5 distal segment of the promoter that may be involved in regulating this response. To investigate the potential role that the distal 1 kb of the LMB StAR promoter might play in dbcAMP -induced activ ity of the promoter, Dr. Kocerha generated a 1.86 kb promoter construct that lacked the 5 distal region of the promoter and examined its response to dbcAMP in Y 1 cells. It was observed that the deletion of the 5 distal region of the promoter segment significantly impaired induction of promoter activity nearly 80% of that observed using the 2.9 kb promoter construct implicating that the distal 1 kb may be important in mediating dbcAMP response Dr. Kocerha generated point mutation constructs to investigate the potential roles that some of the putative elements may play in regulating the dbcAMP induced activity of the LMB

PAGE 85

85 StAR promoter. Mutation of a putative RORE locat ed in the dist al segment of the promoter, ROR/ 1969, yielded a similar impairment of dbcAMP induced activity when the construct was transfected in Y 1 cells. Alteration of the ROR/ 1969 site reduced the dbcAMP induction by approximately 80 % The data rep orted by Dr. Kocerha implicated that the putative ROR / 1969 element could be involved in mediating the LMB StAR promoter response to dbcAMP in Y 1 cells ChIP V erification of ROR / rev -erb Proteins binding to the ROR/ -1969 E lement in the LMB StAR Promoter and to the ROR / -634 in the M urine StAR P romoter. To verify that ROR and r ev -erb bind to the ROR/ 1969 element in the LMB StAR promoter, ChIP assays were run with Y 1 cells tran sfected with the StAR promoter and cultured under both basal and dbcAMP -induced conditions. The transfected cells were fixed with formaldehyde and chromatin was prepared as per protocol. After immunoprecipitation with a polyclonal antibody against either mouse IgG (non-specific control), ROR or rev -erb DNA was purified and qPCR was run on each sample using primers encompassing either the ROR/ 1969 element in the LMB StAR promoter (Figure 4 2A ) or the mROR/ 634 element in the murine StAR promoter (Figure 4 2 B). Note: asterisks in Figure 6 B indicate that DNA was below detection limits. In both species, the DNA encompassing each of the ROREs was highly enriched under basal conditions when pulled down with the antibody for rev -erb implicating that rev erb binds to the LMB ROR/ 1969 element and to the mROR/ 634 element in the StAR promoter of each species under basal conditions. Upon treatment with dbcAMP, the enrichment of DNA bound to rev -erb observed under basal conditions diminished to non-specific levels observed with the IgG antibody with both the LMB and mouse elements. Concomitantly with this decrease, a slight increase was seen for the LMB element when the ROR antibody was used,

PAGE 86

86 whereas there was no detectable enrichment above the non-specific IgG control with the mROR/ 634 eleme nt. EMSA A nalysis of ROR 4 Binding to the ROR/ -1969 Element In order to assess whether recombinant ROR 4 protein could bind to the ROR/ 1969 transcriptional site in the LMB StAR promoter, an EMSA was performed using the specific probes for this promoter si te and recombinant human ROR 4 protein (Fig 43 ). The recombinant protein bound to the ROR/ 1969 probe, producing a single band. Addition of both the ROR antibody and the cold unlabeled probe verified the specificity of the ROR/ 1969ROR 4 interaction. Further verification of specificity was exhibited by the use of a scrambled probe, which did not bind the protein. A perfect human RORE probe was run as a positive control, yielding a band that ran at the same size as that seen with ROR/ 1969. EMSA analy sis of ROR/ -1969 Activity in Y -1 Adrenocortical C ells To further verify the activity of the ROR/ 1969 site in the LMB StAR promoter, proteinDNA interactions were examined by EMSA using Y 1 nuclear extracts obtained from both basal and dbcAMP induced cells and a probe encompassing the ROR/ 1969 site in the LMB StAR promoter (Fig 4 4 ). A similar banding pattern was observed between the basal versus dbcAMP induced nuclear fractions, however, one band appeared more prominent (denoted by the arrow) under basal conditions when compared to dbcAMP induced conditions. The presence of multiple bands indicates that the ROR/ 1969 site is capable of binding proteins found in Y 1 cells. The addition of a cold unlabeled probe quenched the bands seen with ROR/ 1969, ver ifying that proteins/complexes are capable of binding specifically to the site in the LMB StAR promoter.

PAGE 87

87 Discussion We report the first in -depth study on transcriptional regulation of the StAR gene in a fish model, LMB. The StAR cDNA and a large portion of its promoter were cloned to study its regulation in vivo and ex vivo in LMB ovarian follicle cultures, and then, ultimately, for more comprehensive examination of regulation of StAR transcription with transfection assays. Our data show that LMB StAR is transcriptionall y regulated by dbcAMP and that rev -erb and ROR play critical roles in the activation of the LMB StAR promoter. In vivo and ex vivo examination of LMB StAR established a functional correlation of StAR mRNA expression with steroidogenesis i n LMB. An increase in StAR mRNA levels in vivo paralleled the levels of E2 detected in the plasma, suggesting that the connection between StAR mRNA synthesis and the biosynthesis of steroids from cholesterol occurs in LMB as it does in mammals. The regul ation and metabolism of steroid hormones is very complex in all vertebrates and, although we associate an increase in StAR mRNA ab undance with increased plasma the activities of other key enzymes, such as P450 aromatase and enzymes involved in Phase II metabolism in the liver are important factors that control plasma levels of steroid hormones. The upregulation of LMB StAR mRNA by dbcAMP in ex vivo cultures of LMB ovarian follicles implicates that important signaling mechanisms which transactivate StAR may be conserved across species. To identify the transcriptional elements involved in the regulation of StAR transcription in lower vertebrates, a 2.9 kb porti on of the LMB StAR promoter was cloned for sequence analysis and used in transfection assays. In silico analysis revealed multiple putative transcriptional elements that appeared to be conserved in the promoters of fish and mammals, although the specific positions in the sequence didnt always correspond. The professional web -based

PAGE 88

88 programs identified various potential response elements in the LMB StAR promoter, including sites for 2 SF 1, 6 GATA, 1 ERE, 3 ROR /rev -erb 1 YY 1, and 1 SREBP (Fig 4 1) all with >80% homology with core sequences for mammalian transcription factors. Other sequences that predict binding by CRE and AP1 transcription factors as shown in the mammalian StAR promoter were predicted but with less than 80% homology and these are not included in the figure. The putat ive elements plotted in Figure 4 1 arent necessarily functional elements involved in the regulation of the StAR promoter; determination of their functionality will require further experimentation. Critical elements invol ved in dbcAMP regulation of LMB StAR transcription are located in the distal portion of the promoter. The 2.9 kb LMB StAR promoter was induced >2 -fold in response to 1 mM dbcAMP, which mirrored results published for the human StAR promoter in Y 1 cells (129) However, deletion of 1 kb from the 5 end of the LMB 2.9 kb promoter significantly diminished the inducti on by dbcAMP. The re are putative AP 1, SF 1, ROR/rev erb, and ERE sites as well as others within this region, which could be critically involved in regulating StAR transcription. SF 1 and AP 1 sites have been well studied and their roles in cAMP activation have been well defined (129, 137, 181) We focused our investigation on characterizing the potential roles that ROR and rev -erb could play in regulating transcriptional activity of the StAR promoter. Site -directed mutation of the putative ROR/ 1969 element (located between the 1.86 and 2.9 kb region of the LMB StAR promoter) diminished the response of the promoter to dbcAMP, suggesting potentially new signaling mechanisms for dbcAMP regulation of StAR transcription. Direct roles for ROR and rev -erb in steroidogenesis hav e not previously been reported; therefore, we pursued a functional analysis of their regulati on and binding interaction with the

PAGE 89

89 LMB StAR promoter. ROR is a nuclear factor involved in the transcriptional activation of genes involved in multiple physiological processes, including those central to controlling peripheral circadian rhythm (182) There a re four isoforms of ROR that arise from alternative promoter usage and alternative splicing. ROR 1 and 4 are ubiquitously expressed. It is notable that cholesterol has been identified as a ligand for ROR in recent studies (88, 183) suggesting that it may be a key player in steroid production. I n addition, rev -erb has been reported to competitively bind the same element as ROR disallowing the activation of target genes by ROR (184) The possibility that ROR and rev -erb regulate steroidogenesis is strongly supported by the presence of the element at position 1969 in the LMB StAR promoter. Indeed, bioi nformatic analysis also revealed high affinity sites for ROR in several mammalian species, in cluding human, rat, and mouse. Site -specific mutation of the putative ROR rev -erb element in the LMB promoter repressed the dbcAMP activation in transfection as says by greater than 80%. Noting that ROR and rev -erb bind to the same core sequence, mutation of the ROR/ 1969 site in the LMB StAR promoter disallowed the binding of either protein under basal and dbcAMP -stimulated conditions. This may account for th e loss of response to dbcAMP observed upon mutation, especially if ROR s presence mediates the activation of t he promoter induced by dbcAMP. Additionally endogenous binding of ROR and rev -erb to the LMB ROR/ 1969 element and of rev -erb to the mouse mR OR/ 634 element were verified by ChIP, implicating that these proteins play significant roles in controlling the transcriptional activation of the promoters in both species. The mouse StAR promoter has been very well characterized (185) and it has been reported that negative regulatory elements may lie between base pairs 966 and 254 relative to the transcriptional start site (180) Our studies have shown that rev -erb binds to the mouse

PAGE 90

90 ROR/ 634 element (located approximately 634 bp upstream of the transcriptional start site) under basal conditions and that the protein does not a ssociate with the element under dbcAMP stimulat ed conditions, signifying that rev -erb may play an important role in the basal control of the promoters in LMB and mice. Interestingly, ROR is involved in the control of circadian rhythms and these experime nts implicate a causal link between circadian clock and control of steroidogenesis through ROR / rev -erb signaling pathways. Because the enrichment of ROR in the ChIP studies on the LMB ROR/ 1969 element was not as profound when compared to the results with rev -erb we chose to conduct EMSA experiments to further investigate the putative role of ROR in regulating promoter activity. We verified that human ROR 4 protein is ca pable of binding to the LMB ROR / 1969 site; these studies further adv ocate that the ROR and rev -erb members of the orphan nuclear receptors family play an integral role in modulating steroidogenesis. Putative identification and subsequent functional analysis of the RORE site further support our findings that the distal region of the StAR promoter is important in regulation of the StAR gene and is controlled by potent signaling molecules. The combination of ovarian follicle, promoter deletion, and site -directed mutation data implies that transcriptional elements between 1.86 kb to 2 .9 kb of the promoter are required for cAMP induced activation of the StAR promoter in LMB. The mutation data revealed that over 80% loss in transcriptional activity of the LMB StAR promoter can be attributed to an RORE upstream from 2 kb of this region. ChIP and EMSA analyses i n our studies reveal that both rev erb and ROR may play integral roles in the control of the activation of the LMB StAR promoter. Additionally, it appears that regulation of StAR transcription is conserved from

PAGE 91

91 mammals to lower vertebrates, and that non -classical species such as LMB are inc reasingly pertinent model systems for comparative studies.

PAGE 92

92 Figure 4 1 : In silico comparison of the StAR promoter across species. Promoter sequences (including the 5 UTR) for the StAR gene promoters from LMB and brook trout (Acc. No. AY308064), and the StAR gene promoters from rat (Acc. No. AB006007), mouse (180) and human (Acc. No. U29098) were aligned based on the transcriptional start sites for the gene. Putative transcriptional elements were identified usin g Genomatix MatInspector online software. The sites selected for mapping had response element binding protein site, (2) AP 1 site, (3) SF 1 site, (4) GATA binding factor site, (5 ) ROR / rev -erb site, (6) ER site, (7 ) Y in and Yang 1 site, (8 ) Sterol regulatory element binding protein, ( 9 ) CCAAT enhancer binding protein

PAGE 93

93 A B Fi gure 4 2 : Functional analysis of ROR and rev -erb by ChIP A) q PCR results of ChIP usi ng primers designed against the ROR/ 1969 element in the LMB StAR promoter. B) qP CR results of ChIP using primers designed against the RORE in the mouse StAR promoter. Plates of Y 1 cells were transfected for 18 hours and treated either without or with 1 mM dbcAMP for 20 hours. ChIP was run on each sample with an antibody specific to mouse IgG (non -specific control), ROR or rev erb and following incubation with Protein G agarose beads and multiple washes, complexes were eluted and DNA was purified. q PCR was run on each sample and results are reported graphically as % enrichment to a 1:10 dilution of each input control Note: asterisks (*) indicate that the DNA was below detectable limit by qPCR. Each figure is representative of one of three replicated experiments. *

PAGE 94

94 Figure 4 3 : Functional analysis of ROR by EMSA with recombinant ROR 4 protein. ROR/ 1969 and a perfect human RORE were added to recombinant human ROR 4 protein in 1X binding buffer (A and D, respectively) Addition of an antibody specific to ROR to the reaction diminished the banding pattern observed in the lanes containing ROR 4 protein w ith the LMB probe and human probe (B and E, respectively). A scrambled probe was combined with the ROR 4 protein and yielded no band (C) verifying specificity of the protein DNA interaction in vitr o A B C D E

PAGE 95

95 Figure 4 4 : EMSA with basal and dbcAMP -induced nucl ear fractions. The putative LMB RORE (ROR/ 1969) was added to either basal or cAMP induced Y 1 nuclear fractions in 1X binding buffer. The reactions were separated on a native gel and transferred to a membrane for EMSA analysis using chemiluminescence.

PAGE 96

96 CHAPTER 5 STEROIDOGENIC ACUTE REGULATORY PROTEIN A S A TARGET FOR ORGANOCHLORINE PESTI CIDES IN LARGEMOUTH BASS Introduction EDCs can negatively impact reproduction and development in wildlife and in humans by mimicking or altering the actions of endogenou s steroid hormones, or by disrupting the synthesis or metabolism of circulating steroid hormones There is substantial evidence that links exposure of humans and wildlife to EDCs with changes in steroidogenic capacity, secondary sex characteristics, gonad development, and production and size of eggs and sperm (3 15) EDCs are ubiquitous in the environment and include many different types of compounds, including pesticides, fungicides and their metabolites (16 20) plasticizers (2123) papermill effluent (24, 25) pharmaceuticals in sewage wastewaters (26) and others Hu ndreds of studies report that many different species exhibit reproductive and developmental abnormalities upon exposur e to EDCs, including humans, mammals, amphibians, reptiles, birds, invertebrates, and fish (reviewed in (9)). Many EDCs are very stable and persist in the environment, and the main sink for many EDCs is in freshwat er lakes and rivers; soluble compounds aggregate in the surface waters, whereas less soluble compounds collect in the sediments. It is for this reason that numerous aquatic vertebrates, including multiple species of fish, are at high risk for exposure to EDCs and susceptible to reproductive abnormalities (reviewed in (27) ). L MB are a freshwater teleost species and have been reported to exhibit alt ered gene expression and distorted circulating steroid hormone levels in response to exposure to EDCs, both in a controlled laboratory setting and in the wild. (2, 3, 16, 25, 28, 65, 67, 113, 144, 158, 186188) Mul tiple OCPs have been associated with endocrine disruption in LMB, including DDE, DIEL, MXC, and TOX, amongst others Many studies have shown that these OCPs have the

PAGE 97

97 capacity to disrupt ER and AR expression in LMB (65, 113, 144, 188, 189) ; however select stud ies have shown that other genes involved in the production and metabolism of steroid hormones are subject to altered expression levels, including the gene encoding the StAR protein (3, 113, 144) StAR protein controls one of the rate -limiting steps in steroid hormone production in all vertebrates and is responsible for the delivery of cholesterol to the outer mitochondrial membrane prior to conversion into steroid hormone s in steroidogenic tissues (52) In mammals, t he StAR gene has been identified as a target of a number of pesticides including Roundup (19) dimethoate (115) and lindane (20) Additionally, i t has been reported that i n vivo exposure of LMB to DDE DIEL and MXC resulted in altered StAR mRNA levels in the gonads ; however the mechanism s through which the ch emicals disrupted StAR mRNA levels have not yet been elucidated. StAR protein is an integral player in the s teroi d biosynthetic pathway; however, there are multiple enzymes that are important in producing sex steroid hormones, including the enzyme P450 aro matase ( Cyp19); Cyp19a is the isoform of P450 aromatase responsible for the metabolism of androgens into estrogens in the gonads of vertebrates, including LMB. In mammalian studies, Cyp19a gene expression has been shown to be disrupted in the gonad upon e x vivo exposure to DDE (150, 190) In terestingly Cyp19a has been reported to be a target of some of the same pesticides reported to disrupt the StAR gene in mammalian systems, including both lindane (191) and Roundup (glyphosate) (192) The aim of our current study was to examine gonad -specific gene expression changes in the genes encoding StAR, E Rs a and b (highly expressed in the gonad), AR and Cyp19a, in LMB gonads in response to ex vivo exposure to DDE, DIEL, MXC, and TOX under basal and

PAGE 98

98 tropic hormone induced conditions We attempt to isol ate tissue -specific responses to gain a better unders tanding of the mechanisms of action of OCPs in changing StAR gene expression and steroid hormone levels in LMB. Results Gene Expression Changes in O varian Tissue upon Ex Vivo Exposure to OCPs under Basal C onditions To examine ovarian -specific gene expressi on responses to OCP exposure, 15 25 mg pieces of LMB ovary from recrudescent LMB were cultured for ex vivo analysis This experiment represents the combined data from four individual LMB cultured in duplicate. Cultures were pre -exposed to medium contai ning vehicle or 100 M doses of DDE, DIEL, MXC, or TOX for 2 hours followed by a change to fresh culture medium and subsequent incubation for 20 hours. RNA was extracted from each sample and gene expression analysis of StAR, ERa, ERb, AR and Cyp19a mR NA levels was performed using qPCR (Figure 5 1) No statistically significant changes were detected among treatments. Results are represented as fold change from basal v ehicle treated control values. Gene E xpression C hanges in Ovarian Tissue upon Ex Vivo Exposure to OCPs under hCG Stimulated Conditions Since hCG is a tropic hormone known to stimulate steroidogenic pathways in vertebrates, the impact of OCP exposure in ovarian-specific gene expression was examined by qPCR under hCG -stimulated conditions. 15 25 mg pieces of LMB ovary were cultured from the same individuals used in the female basal experiments and used for ex vivo gene expression analysis. This experiment represents the combined data from the same four individuals used to investigate basa l gene expression responses. Cultures were pre -exposed to medium containing vehicle or 100 M doses of DDE, DIEL, MXC, or TOX for 2 hours, followed by a subsequent change to

PAGE 99

99 fresh medium containing 10 U/mL hCG Following RNA purification, StAR, ERa, ERb, AR and Cyp19a mRNA levels were examined by qPCR (Figure 5 2 ). Results are reported in f old change from the respective basal vehicle control Pre -treatment with vehicle followed by exposure to 10 U/mL hCG revealed a nearly 12 -fold induction of StAR mRNA and a 2.5 -fold induction of AR mRNA. P re treatment with both DDE and DIEL yielded a near ly 25-fold induction of StAR mRNA expression in response to hCG ; nearly double the induction observed in controls. ERa and ERb mRNA expression profiles were not significantly changed upon exposure to hCG in combination with vehicle or any contaminant. AR mRNA expression was significantly stimulated ~2 -fold by hCG upon pre -exposure to vehicle, DIEL, and TOX, whereas pr e treatment with DDE and MXC diminished the hCG -induction to insignificant levels. Cyp19a mRNA levels showed no significant response to any treatment. Gene Expression Changes in LMB Testis Tissue upon Ex Vivo Exposure to OCPs under Basal Conditions To elu cidate testis -specific responses to OCP exposure, 15 25 mg slices of testis tissue dissected from spermiating male LMB were cultured for ex vivo analysis. This experiment represents the combined data collected from four individual recrudescent male LMB cultured in duplicate. Cultures were pre -exposed to medium supplemented with either vehicle or with 100 M doses of each OCP for 2 hours, followed by a change to fresh culture medium and subsequent incubation for 20 hours. RNA was isolated from each samp le and qPCR analysis was conducted to determine the tissue -specific expression of StAR, ERa, ERb, AR and Cyp19a mRNA levels in response to OCP exposure (Figure 5 3 ). T reatment with DDE and DIEL stimulated StAR mRNA and ERb mRNA expression levels nearl y 3-fold and 2 -fold above the levels observed in the control s, respectively. However, due to inter individual variation, only DIEL exposure resulted in significant stimulation of StAR mRNA expression

PAGE 100

100 above basal levels. Only treatment with DDE significan tly stimulated Cyp19a mRNA levels above those observed in the vehicle control. No significant changes were detected in ERa mRNA expression in response to exposure to any OCP. Gene Expression Changes in LMB Testis Tissue upon Ex Vivo Exposure to OCPs under hCG -Stimulated Conditions To investigate the testis -specific gene expression responses to OCP exposure under stimulated conditions, 15 25 mg pieces of LMB slices of testis tissue were cultured from the same individuals used in the basal experiments. This experiment represents the combined data from the same four LMB used to investigate basal gene expression responses C ultures were pre exposed to medium containing vehicle or 100 M doses of DDE, DIEL, MXC, or TOX for 2 hours, followed by a subsequent change to fresh medium containing 10 U/mL hCG. Following RNA purification, StAR, ERa, ERb, AR and Cyp19a mRNA levels were examined by qPCR (Figure 5 4 ). Results are reported in f old change from the respective basal vehicle control. Tissues treated with vehicle and hCG revealed a 2 -fold induction of StAR mRNA, although results were not significant upon comparison to basal control levels. However, pre treatment with both DDE and D IEL showed a significant induction of StAR mRNA upon exposure to hCG that increased ~4 -fold above basal control levels. Treatment with all OCPs and hCG yielded no significant changes to the expression of AR ERa ERb or Cyp19a transcripts. Changes in Testosterone (T) P roduction by Ex V ivo O varian and Testis Cultures Following Exposure to OCPs under Basal and hCG -Stimulated C onditions (193) To comple ment the gene expression profiles of the ovarian and testis tissue s exposed to OCPs under both basal and hCG -stimulated conditions, T levels in the culture medium that the pieces of tissue were cultured in were analyzed by RIA (data not shown).

PAGE 101

101 In ovarian tissues, t reatment with DDE under both basal and stimulated conditions yielded a slight reduction in T produc tion relative to controls. Treatment with DIEL yielded little change in basal T production, however, under stimulated conditions DIEL stimulated T production ~120% above the hCG control. Interestingly, MXC exposure severely impaired T production by the cultured ovarian tissue under basal and stimulated conditions, reducing levels to nearly 20% of respective controls. Exposure to TOX also critically impaired ovarian T production to only 60% of that observed in the basal controls and 20% of the levels obse rved in the hCG controls. In t estis exposed to DDE a marked decrease in T production was observed. T produced by the DDE -treated tissue was reduced to 80% and 55% with respect to controls, under basal and hCG -stimulated conditions, respectively. DIEL ex posure did not alter T production more than 10% relative to controls under both conditions. Under basal conditions, MXC exposure did not affect T production by the testis; however, under stimulated conditions, T levels were only ~75% of those observed in the hC G controls, though the results were quite variable. TOX exposure did not affect T production under basal conditions, whereas T production was decreased to ~60% of that observed in the stimulated controls Transfections with the 2.9 kb LMB StAR Promot er in MA -10 Leydig C ells In order to determine whether the promoter for the LMB StAR gene was targeted directly by the OCPs investigated in this study, steroidogenic cells were transfected with a 2.9 kb portion of the StAR gene promoter and subsequently exposed to DMSO (vehicle), 1 M or 10 M doses of each OCP for 20 hours, followed by exposure to fresh growth medium alone (Figure 5 5 ) or medium supplemented with 10 U/mL hCG (Figure 5 6 ) for 4 hours. In addition, ICI 182,780, a potent ER antagonist, was added ([final]: 10 M) in ad dition to a 10 M dose of each individual OCP to determine if ER signaling may be involved in mediating any effects observed in StAR

PAGE 102

102 promoter activity. No significant change was observed upon treatment with any OCP; however, the LMB StAR promoter did appe ar to be stimulated by hCG by approximately 2 -fold. Discussion Reproduction, gonadal growth, and steroidogenesis in vertebrates, including LMB, are highly controlled by the hypothalamus pituitary gonadal (HPG) axis. Because OCPs can disrupt circulating st eroid hormone levels and gonadal StAR mRNA expression in LMB and the mechanisms through which this occurs are not well understood, the current study attempted to simplify things and examined gonad-specific changes in StAR mRNA expression in response to acu te ex vivo exposure to DDE, DIEL, MXC, and TOX. Gonadotropins released from the pituitary, including LH ( teleost GHT II) and FSH ( teleost GHTI), tightly control gonadal steroidogenesis; therefore in order to mimic quiescent and stimulated in vivo stages, ex vivo exposures to OCPs were conducted, under both basal and hCG -stimulated conditions. StAR mRNA levels varied significantly among treatments, so the capacity of OCPs to disrupt the activity of LMB StAR promoter was investigated using transient transf ections. Surprisingly, none of OCPs disrupted transcriptional activation of the 2.9 kb LMB StAR promoter in transfections in MA 10 cells DDE, DIEL, MXC, and TOX have different modes of action (MOA) and as expected, differentially impacted gene expressio n in the LMB gonad. Several studies have characterized the MOA of DDE. DDE has been reported to be a potent AR antagonist and weak ER agonist (4, 11, 194) In addition, DDE can activate non genomic signaling pathw ays ; DDE has been shown to inhibit the generation of cAMP in granulosa cells (17) activate membrane ER related pathways (195) and to activate extracellular signaling kinase 1 and 2 (ERK1/2) pathways (195, 196) In our study, ex vivo gonadal treatment with DDE caused a moderate decrease in T production by the ovary and testis and a moderate i ncrease in Cyp19a mRNA in the testis under basal conditions. The induction of StAR mRNA by

PAGE 103

103 hCG was substantially exacerbated in the ovary and testis exposed to DDE. Transfections with the 2.9 kb StAR promoter in MA 10 cells suggested that the elevated le vels of StAR mRNA were not a result of increased activity at the gene promoter level In vertebrates, ERK phosphorylation is required for the activation of a number of proteins and transcription factors including the StAR protein; it is also known that ER K docks itself on the StAR protein at the mitochondria, critically enhancing the transport of cholesterol across the mitochondrial membrane (197, 198) Intuitively, because DDE has been shown to activate ERK signal ing, it is possible that DDE disrupts proper ERK function in LMB gonads, which could mediate the observed accumulation of StAR mRNA in t he LMB gonads treated with DDE. DIEL, although very different structurally from DDE, can also potently activate ERK1/2 p athways (196) In this study, DIEL exposure, like DDE, highly enhanced the levels of StAR mRN A in the LMB gonads; however, this was observed under both basal and hCG induced conditions. The results observed in our experiments with MXC and TOX were quite different than those seen with DDE and DIEL. In the ovary, there was no change in StAR mRNA l evels but the response of AR mRNA stimulation by hCG was blocked by MXC. Treatment with MXC and TOX severely impaired T production by the ovary and testis (data not shown) Stimulation of StAR mRNA by hCG was completely compromised upon pre -exposure to t he two contaminants in the testis Transfections with the LMB StAR promoter revealed that neither MXC nor TOX affect the activity of the StAR promoter under basal or hCG -induced conditions. It is evident that MXC and TOX disrupt pathways distal to StAR tr anscriptional activation by hCG. The MOA of MXC has been extensively characterized; however the MOA of TOX is not well understood. MXC, very similar in structure to DDE, has been characterized as an AR -

PAGE 104

104 antogonist and ER agonist in mammals and fish (65, 151, 194) In addition, MXC has been reported to inhibit steroid hormone production at a point distal to cAMP synthesis in gonadal cells (17) Recent work in mammalian granulosa cells has shown that expression of the LH receptor is significantly decreased upon in vitro exposure to the MXC metabolite HPTE (199) ; it has also been reported that in vivo exposure to MXC and HPTE in male rats caused a significant decrease in plasma T, but no change in the plasma levels of LH and FSH (200) Additional research in rats reported that in vivo MXC exposure resulted in decreased circulating progesterone and increased circulating LH levels, as well as decreased LH receptor levels in large antral follicles (201) hCG, a potent analog of LH, activates LH receptor signaling which is highly involved in the activation of expression of the StAR gene. Recent studies have examined LH and FSH receptor expression in the gonads of LMB and sea bass, and it was observed that expression of the FSH receptor was connected with early stages of gonadal development, and also with the spermiation/maturation -ovulation peri ods, whereas LH receptor expression was highly associated with the final stages of gamete maturation and spermiation/ovulation (106, 202). The male LMB used in our study were spermiating (mature) and the females were still undergoing vitellogenesis ( SG ). Based upon reproductive stage -specific expression of the gonadotropin receptors, it is possible that the testis tissue expressed highe r ratio of LH/FSH receptors than the ovaries did in our ex vivo studies. Intuitively, it is possible that LH/FSH metabolism and/or LHR/FSHR expression in the L MB gonad may be targeted by MXC. It is likely that MXC may disrupt gonadal LHR or FSHR expressi on and/or ligand activation. In addition, it is possible that TOX may disrupt similar pathways; however, further studies are warranted to validate these hypotheses.

PAGE 105

105 A study that was conducted previously by Garcia -Reyero et al. examined gene expression and plasma steroid hormone levels in LMB fed foo d laced with DDE and DIEL for 120 days (113) Many of the results observed in our studies with DDE and DIEL parallel the results observed in the feeding study. A summar y of both studies is listed in Table 5 1. Garcia -Reyero et al. reported that expression of StAR mRNA in the ovary and testis was stimulated several fold higher in LMB exposed to the contaminants when compared to the levels observed in control animals. Ou r study showed a very similar stimulation in the gonads treated ex vivo with DDE and DIEL, suggesting that StAR expression in the gonad is one gene that is truly targeted by DDE and DIEL. Garcia Reyero et al. also reported that circulating plasma 11 -KT an d E2 levels were altered from control levels. T production by the LMB ovarian and testis tissue cultured in these experiments was decreased upon exposure to DDE. Ex vivo DIEL exposure did not change T production by the testis and stimulated T production in the ovaries under hCG -stimulated conditions. The biosynthesis of steroid hormones is highly controlled by the HPG axis and regulation of sex steroid hormone levels depend upon a number of hormones released by the pituitary, including LH and FSH, among others. The study by Garcia Reyero et al. reported a several fold decrease in ER and Cyp19a mRNA in DDE -fed LMB, and also showed that Cyp19a was stimulated in the ovary and repressed in the testis of fish fed DIEL. In our study, it was observed that ERa and ERb mRNA levels were not affected by DDE and DIEL exposure and Cyp19a levels were significantly increased only in testis tissue treated with DDE under basal conditions. The study by Garcia Reyero et al. was a long term study that examined the effe cts of chronic exposure to the contaminants in the whole animal whereas this study examined gonad -specific effects upon acute exposure to the OCPs. It is no surprise that the changes observed are not the same,

PAGE 106

106 however the elevated levels of StAR mRNA in bot h studies is suggestive of the idea that the two OCPs are capable of disrupting StAR expression directly at the gonadal level. Collectively, these studies indicate that StAR mRNA levels are targeted in the gonad upon ex vivo exposure to DDE and DIEL, where as hCG induction of StAR mRNA was targeted upon ex vivo exposure to MXC and TOX T ransfections with the 2.9 kb StAR promoter construct in mouse MA 10 Leydig cells revealed no alteration in transcriptional activity in response to treatment with any of the OCPs; however, it must be noted that trans activation of gene promoters is extremely complex, and, although it is unlikely, it is possible that the 2.9 kb fragment does not encompass the entire functional region of the LMB StAR promoter. Numerous studies o n the mammalian StAR promoter have confirmed that the proximal 3001000 bp of the StAR promoter is ample in activating the StAR gene (126, 128, 178, 180, 185, 203) ; thus, it is likely that the effects on StAR transc ript levels observed in the ex vivo cultures treated with DDE and DIEL are due to the disruption of signaling pathway s involved in modulating the activity of StAR mRNA or protein. These experiments suggest that MXC and TOX disrupt hCG induced activation o f StAR mRNA by altering expression of gonadotropin receptors or disrupting the binding of gonadotropins to receptors in the LMB gonad. Further studies are warranted to investigate these hypotheses. Altogether, my data on StAR ER AR, and Cyp19a gene expr ession in response to ex vivo LMB gonad expo sure yields some insight as to the tissue -specific mechani sms underlying the alteration of plasma sex steroid hormone levels in LMB exposed t o these EDCs. While the original proposal was that OCPs directly regul ate LMB StAR promoter activity, it now seems more likely that the mechanisms through which the OCPs disrupt StAR gene expression are

PAGE 107

107 found further upstream in gonadotropin signaling and/or further downstream in post transcriptional and post translational r egulatory cascades

PAGE 108

108 Table 5 1: Summary of changes observed in LMB gonads in ex vivo versus in vivo DDE and DIEL exposure The in vivo data summarized here was published previously by Garcia Reyero, et al. (113) E x Vivo Response In Vivo Response Ovary Testis Ovary Testis DDE Exposure Basal hCG Basal hCG StAR mRNA N.C. N.C. ER a mRNA N.C N.C. N.C. N.C. N.C. ER b mRNA N.C. N.C. N.C. N.C. AR mRNA N.C. N.C. N.C. N.C. Cyp19a mRNA N. C. N.C. N.C. Hormone synthesis E2, 11 KT 11 KT DIEL Exposure StAR mRNA N.C. ER a mRNA N.C. N.C. N.C. N.C. ERb mRNA N.C. N.C. N.C. N.C. AR mRNA N.C. N.C. N.C. N.C. Cyp19a mRNA N.C. N.C. N.C. N.C. Hormone synthesis N.C. N.C. N.C. E2, 11 KT E2, 11 KT

PAGE 109

109 Figure 5 1: LMB ovarian gene expression changes in response to ex vivo OCP exposure under basal conditions. Minced ovarian tissue from four individual female LMB were cultured in duplicate in a 24 well culture plate and exposed to 100 M doses of each OCP for 2 hours, followed by a change to fresh medium and incubated for 20 hours. RNA was isolated from the tissues and reverse transcribed for analysis by qPCR. Each b ar represents the fold chang e from basal control of mean copy number SEM of untransformed data O ne -way ANOVA followed by post hoc Dunnetts pairwise multiple comparison were performe d on log transformed gene expression data and an asterisk (*) denotes a significant difference (P <0.05)

PAGE 110

110 Figure 5 2: LMB ovarian gene expression changes in response to ex vivo OCP exposure under hCG -stimulated conditions. Minced ovarian tissue from four individual female LMB were cultured in duplicate in a 24 well cultu re plate and exposed to 100 M doses of each OCP for 2 hours, followed by a change to fresh medium and incubated for 20 hours. RNA was isolated from the tissues and reverse transcribed for analysis by qPCR. Each bar represents the fold change from basal control of mean copy number SEM of untransformed data O ne -way ANOVA followed by post hoc Dunnetts pairwise multiple comparison were performe d on logtransformed gene expression data and an asterisk (*) denotes a significant difference (P <0.05)

PAGE 111

111 Fi gure 5 3: LMB testis gene expression changes in response to ex vivo OCP exposure under basal conditions. Testis tissue from four individual male LMB was sliced and cultured in duplicate in a 24 well culture plate and exposed to 100 M doses of each OCP for 2 hours, followed by a change to fresh medium and incubated for 20 hours. RNA was isolated from the tissues and reverse transcribed for analysis by qPCR. Each bar represents the fold chang e from basal control of mean copy number SEM of untransformed data O ne -way ANOVA followed by post hoc Dunnetts pairwise multiple comparison were performe d on log transformed gene expression data and an asterisk denotes a significant difference (P <0.05)

PAGE 112

112 Figure 5 4: LMB testis gene expres sion changes in response to ex vivo OCP exposure under hCG -stimulated conditions. Testis tissue from four individual male LMB was cultured in duplicate in a 24 well culture plate and exposed to 100 M doses of each OCP for 2 hours, followed by a change to fresh medium and incubated for 20 hours. RNA was isolated from the tissues and reverse transcribed for analysis by qPCR. Each bar represents the fold chang e from basal control of mean copy number SEM of untransformed data O ne -way ANOVA followed by post hoc Dunnetts pairwise multiple comparison were performe d on log transformed gene expression data and an asterisk (*) denotes a significant difference (P <0.05)

PAGE 113

113 Figure 5 5 : Response of 2.9 kb LMB StAR gene promoter to treatment with OCPs under basal conditions MA 10 mouse Leydig cells plated in 24 well plates were transfected with the 2.9 kb LMB StAR gene promoter incorporated into a Firefly Luciferase reporter plasmid and a controlled amount of Renilla Luciferase construct for data normalization. 24 hours post transfection, transfected cells were exposed (in triplicate) to either 0.1 % DMSO, 1 mM OCP, 10 M OCP, or 10 M OCP + 10 M ICI 182,780. After 20 hours, growth medium was changed and the same treatment was administered for 4 hours. Cells were lysed and luciferase quantities were analyzed. Data are plotted in Relative Luciferase Units (Firefly/Renilla Luciferase ratios).

PAGE 114

114 Figure 5 6 : Response of 2.9 kb LMB StAR gene promoter to tr eatment with OCPs under hCG stimulated conditions. MA 10 mouse Leydig cells plated in 24 well plates were transfected with the 2.9 kb LMB StAR gene promoter incorporated into a Firefly Luciferase reporter plasmid and a controlled amount of Renilla Lucifer ase construct for data normalization. 24 hours post transfection, transfected cells were exposed (in triplicate) to either 0.1 % DMSO, 1 mM OCP, 10 M OCP, or 10 M OCP + 10 M ICI 182,780. After 20 hours, fresh growth medium was added containing the sam e treatment in combination with hCG ([final] = 10 U/mL) for 4 hours. Cells were lysed and luciferase quantities were analyzed. Data are plotted in Relative Luciferase Units (Firefly/Renilla Luciferase ratios).

PAGE 115

115 CHAPTER 6 OVERALL DISCUSSION AND FUTURE DIRE CTION Endocrine disruption has been a topic of much controversy and debate throughout the past decade. Numerous EDCs have been identified, including many OCPs and these chemicals not only have the capacity to harm wildlife, but also humans. Lake Apopka, a federally appointed Superfund site in Florida, is known to be extensively contaminated with OCPs including DDE, DIEL, MXC, and TOX These OCPs are considered xenoestrogens (capable of disrupting ER and AR signaling) and their presence in Lake Apopka h as been highly associated with the disruption of normal reproductive function and physiology in wildlife that inh abit the area. LMB are abundant in Lake Apopka and exhibit altered plasma sex steroid hormone levels upon in vivo exposure to a number of OCPs ; sex steroid hormones tightly regulate reproduction in vertebrates, and disbalance of these hormones can lead to reproductive failure, or even death. This yields great concern, because the maintenance of biodiversity and life on earth is reliant upon suc cessful reproduction. It is important to understand the mechanisms of action of OCPs mediating this disruption in order to gain a better understanding on the potential effects they may have on other wildlife and humans. The StAR protein is a protein criti cally involved in st eroid hormone biosynthesis in vertebrates, and likely in LMB, due to the conservation of gene regulation observed in these studies. Many OCPs found in the environment have been reported to disrupt the expression of this important prote in in laboratory studies and in the wild. It is important to understand how the StAR gene is regulated under normal conditions in healthy LMB. It is also important to understand how OCPs disrupt the StAR gene in the gonad of LMB, because this is the main site of sex steroid hormone synthesis in LMB. The research presented and discussed in this dissertation encompasses the extensive characterization of the endogenous regulation of the

PAGE 116

116 LMB StAR gene. In addition, the capacity for the LMB StAR gene to be r egulated in LMB gonads by DDE, DIEL, MXC, and TOX was investigated in order to gain insight as to how these OCPs actually disrupt steroidogenesis in LMB In order to obtain understanding of the normal gene expression profiles in the gonads of healthy LMB, the expression of ER, AR and StAR transcripts were characterized throughout the reproductive season by month and by reproductive stage in female and male LMB gonads collected from the St. Johns River in Welaka, FL. Grouping the individuals by reproduct ive stage distinguished trends observed in gene expression by month into significant observat ions dependent upon gonad stage. In both female and male LMB, all ER mRNA and AR mRNA levels were significantly positively correlated with one another. The data collected on gonadal ER and AR mRNA expression throughout the reproductive cycles of male and female LMB isoforms suggest that sex steroid hormone nuclear receptors play important and complex roles in regulating genes involved in female and male reproducti ve progression and cycling. To gain further insight into the importance of AR expression in the LMB gonad, it would be interesting to clone individual AR isoforms from LMB and characterize the isoform -specific variations in gene expression in the gonad. In the seasonal study, StAR mRNA levels were also characterized in both sexes. The abundance of StAR mRNA in the LMB ovary and testes peaked markedly during late reproductive stages ( maturation in female and spermiogenesis in the te stes). This phenomenon parallels studies on StAR mRNA levels throughout mammalian reproduction, and t he acute upregulation of StAR mRNA during the later stages of reproduction reinforce s the idea that the StAR protein plays a critical role in steroid hor mone synthesis and reprod uction in all vertebrates, including LMB. In the ovary, ERa and ERb were negatively correlated with StAR

PAGE 117

117 expres sion, whereas in the testis ERa and AR were positively correlated with StAR expression. Studies have shown that E2 exposure causes a decrea se in StAR gene expression (102, 114, 124) so in this work, ex vivo gonad cultures were treated with E2 (potent ER agonist) and ICI 182,780 (a potent ER antagonist) and StAR mRNA expression was investigated in the gonad tissue. It was observed that concomitant treatment with ICI 182,780 and hCG caused a sustained elevation of StAR mRNA levels after 20 hours of treatment. Interestingly, it has been shown that ICI 182,780 can activate membrane -bound ERs, resulting i n stimulation of downstream signal transduction pathways (171) In the LMB gonad, it is possible that ICI 182,780 agonizes membrane bound ER pathways, acting as a selective ER modulator rather than a receptor antagonist. In additions, it has been reported that ER has the potential to activate the promoter for some genes by binding Sp1 sites when bound to ICI 182,780 and other antagonists, but not when bound to E2 (172) Further experimentation using the StAR promoter and inhibitors of the MAPK pathways stimulated by membrane -bound receptors could yield insight as to which signal transduction pathways are involved in mediating the observations made in the ex vivo experiments from my work. It is possible that membrane bound ER signaling could be involved in the regulation of LMB StAR mRNA expression. Our laboratory previously cloned 2.9 kb of the LMB StAR promoter (89, 90) and I cloned an additional 2.6 kb of the distal region of the promoter in an attempt to examine the distal region for putative elements that may be involved in the transcriptional regulation of the StAR gene. Several putative EREs were identified in t he 2.9 kb StAR promo ter using computer software, a nd, usin g EMSAs I showed that mammalian ER is capable of binding to an element in the LMB StAR promoter in vitro However, t he presence of several other putative EREs (including sites for ER and AP 1) suggest that ERs could potentially interact with a number of

PAGE 118

118 different elements in the StAR promoter T he binding of ER to the element in the LMB StAR promoter in vitro is supportive of the idea that ERs can directly bind to the StAR gene promoter and control its activation, though further functional studies including ChIP assays and investigatio n of the activity of other putative EREs, are warranted. Because studies on mammalian StAR promoters have indicated that the ample region for activation of the StAR gene lies in the 300 1000 bp proximal promoter segment, upstream from the transcription al start site (126, 128, 178, 180, 185, 203) I pursued all further characterization of the regulation of the LMB StAR promoter using the 2.9 kb construct. When the 2.9 kb construct was analyzed, putative EREs were abundant; interestingly so were hundreds of other putative binding sites some of which were extremely interesting Dr. Jannet Kocerha, a former graduate student in our laboratory, made a significant contribution into the characterization of the 2.9 kb L MB StAR promoter. She showed that, as observed in mammals, the LMB StAR promoter is stimulated by cAMP in a dose responsive manner. She also conducted transient transfections with variations of the 2.9 kb promoter construct, including point mutation and deletion constructs examining cAMP response She determined that point mutation of several elements located in the distal portion of the promoter diminished the activation of the promoter by cAMP. This is quite fascinating considering that many researc hers assert that the main regulatory regions of the mammalian StAR promoter lie within < 1 kb of the transcriptional start site of the StAR gene. One of the site s that, upon mutation, ablated cAMP response included a putative site for ROR and rev -erb ROR/ 1969. It is notable that cholesterol has been identified as a ligand for (88, 183) suggesting that it may be a key player in steroid production. In addition, rev erb has been reported to competitively bind the same element as ROR

PAGE 119

119 disallowing the activation of target genes by ROR (184) Because ROR and rev -erb have been associated in regulation of genes involved in peripheral circadian rhythm (85 87) and my study of StAR mRNA expressi on in LMB gonads throughout the reproductive cycle implicated that StAR mRNA expression is highly dependent on reproductive stage, I pursued further characterization of this site. F unctional assessment of the ROR / 1969 site was warranted, so using EMSAs an d ChIP assays, I confirmed that in mouse Y 1 adrenocortical cells transfected with the LMB StAR promoter, rev -erb and ROR bind to ROR / 1969 under basal and cAMP -stimulated conditions, respectively. In order to investigate if the role these proteins play in regulating the StAR promoter is conserved between higher and lower vertebrates, I also pursued functional ana lysis of a putative RORE located in the mouse StAR promoter (mROR/ 634). It was determined that rev erb and possibly ROR bind to this element, indicating t hat these orphan nuclear receptors may play an evolutionarily conserved role in regulating th e a ctivity of the StAR promoters in vertebrates. In the EMSAs conducted examining the in vitro binding activity of the ROR / 1969 site with Y 1 nuclear fractions, there were several bands present. The presence of bands implies that several proteins and/or com plexes have the capacity to bind the element. Future work is necessary to identify the proteins that are binding the element. Using the same probes used in the EMSAs, it is possible to add the nuclear fractions directly to the probe and to pull down th e proteins that bind to the probe. Following rigorous washes, mass spectrometry could be used to identify the protein s that are binding to the ROR / 1969, helping identify novel proteins that may be involved in regulating the StAR promoter.

PAGE 120

120 There is no dou bt that the LMB StAR promoter is regulated in an acute and highly complex manner, involving a number of different transcription factors. Because the StAR gene is a known target of OCPs, the complexity surrounding the regulation of the StAR promoter only f urther complicates our understanding of how OCPs disrupt the StAR gene in intact LMB. To add even more complication, reproduction, gonadal growth, and steroidogenesis are highly controlled by the hypo thalamus -pituitary -gonadal HPG axis in intact organisms opening up many pathways that could be targeted that mediate the effects of OCPs Because OCPs disrupt circulating steroid hormone levels and gonadal StAR mRNA expression in LMB and the mechanisms through which this occurs are not well understood, I exa mined gonad -specific changes in StAR mRNA expression and hormone production in response to acute ex vivo exposure to DDE, DIEL, MXC, and TOX under basal and hCG -induced conditions. StAR mRNA levels varied significantly among treatments, so we examined th e capacity of OCPs to disrupt the activity of LMB StAR promoter in transient transfections. Surprisingly, none of the OCPs disrupted transcriptional activation of the 2.9 kb LMB StAR promoter in transfections in MA 10 cells. It must be noted that transcr iptional activation of gene promoters is extremely complex, and, although it is unlikely based upon mammalian studies of the StAR promoter, it is possible that the 2.9 kb fragment does not encompass the entire functional region of the LMB StAR promoter. F urther investigation using the expanded 5.6 kb LMB StAR promoter would help clarify if OCPs impact StAR promoter activity. DDE, DIEL, MXC, and TOX all employ different modes of ac tion and as expected, each of the OCPs differentially impacted StAR mRNA expr ession and T production in the female and male LMB gonads. Collectively, my ex vivo studies indicate that StAR mRNA levels are

PAGE 121

121 targeted in the gonad upon ex vivo exposure to DDE and DIEL, whereas hCG induction of StAR mRNA was targeted upon ex vivo exposure to MXC and TOX. Based on extensive review of the literature, it is likely that the elevated levels of StAR transcript observed in the ex vivo cultures treated with DDE and DIEL are likely due to the disruption of signaling pathways involved in modulat ing the activity of StAR mRNA or protein. Future work analyzing StAR protein levels (phosphorylated and unphosphorylated) in ex vivo treated tissues could help clarify if the protein levels are affected by the contaminants. Recent studies have shown that both DDE and DIEL can disrupt ERK1/2 signaling pathways pathways (195, 196) which play a role in controlling StAR protein activity (197, 198) If it is determined that StA R protein expression is also elevated, the use of MAPK/ERK inhibitors could help determine if MAPK pathways are directly targeted by DDE and DIEL, and if they mediate the effects on StAR mRNA levels observed in this study. Because MXC and TOX disrupt hCG i nduced activation of StAR mRNA in LMB gonads, it is likely that they disrupt pathways that are distal to StAR promoter activation. Although research on the modes of action of TOX is minimal, many studies on MXC and it metabolites have shown that LH recept or expression is significantly downregulated in granulosa cells treated with the contaminants (199) It is possible that MXC, and potentially TOX based on similar results from this study, alter the expression of gonadotropin receptors in the gonad or disrupt the binding of gonadotropin s to receptors in t he LMB gonad. Further work characterizing the expression of LH receptors in the gonads of LMB is warranted. qPCR analysis of the levels of LH receptor in gonad tissues exposed to MXC and TOX could yield insight into if these compounds are acting at the gonadotropin receptor level. If it is observed that LH receptor

PAGE 122

122 expression is impaired, further experimentation would be warranted investigating the potential for the compounds to downregulate LH receptor activity and expression. Altogether, the data prese nted and discussed throughout this dissertation provide valuable information on how the StAR gene is regulated by nuclear receptor signaling pathways in LMB and how this regulation may be evolutionarily conserved between higher and lower vertebrates. In a ddition, the characterization of the normal reproductive cycle s of a subset of healthy wild LMB provided a baseline for gene expression profiles and how they vary throughout reproductive stages in healthy male and female LMB. This is important when one tr ies to assess the mechanisms through which EDC s, such as thos e present in Lake Apopka, act in disrupting circulating steroid hormone levels and potentially reproduction in LMB. The studies examining the tissue -specific response of LMB gonads to OCPs provi des new information on how DDE, DIEL, TOX, and MXC function to disrupt StAR mRNA in LMB gonads although further experiments are warranted in verifying the pathways suspected. Figure 61 is depicts the projected model of the regulation of the LMB StAR gen e by nuclear receptor signaling pathways and by EDCs in the environment.

PAGE 123

123 Figure 6 1: Figure depicting projected model of the regulation of StAR protein in LMB gonads The interaction of LH / FSH with membrane receptors results in G coupled protein receptors (G) activation, which activates adenylyl cyclase (AC), catalyzing cAMP formation. Arachidonic acid (AA) is produced by phospholipase C (PLC); AA and cAMP activate PK A and PKC PKA/PKC regulate transcriptional activity of the StAR promoter via transc ription factors. Ca2+ signaling has been shown to be involved in modulating LH/FSH stimulated steroidogenesis. Epidermal growth factor (EGF), insulinlike growth factor (IGF), prolactin (PRL), and gonadotropin releasing hormone (GnRH) activate protein ki nase cascades (Ras/Raf/others; MAPK/ERK1/2) and may function in regulating steroid biosynthesis. Red boxes outline projected targets of disruption by the OCPs studied in my work.

PAGE 124

124 APPENDIX A SUPPLEMENTARY DATA A ND FIGURES Miscellaneous figures: t his appen dix contains graphs and figures that, although were only briefly mentioned in the body of the text of this document, were excluded from the main body of this dissertation. Optimization of any scientific protocol is a very daunting task, and there are many points at which a researcher must assess the quality and integrity to ensure that a given experiment is running optimally

PAGE 125

125 Figure A 1: Representative scan of a 1% agarose/ethidium bromide gel confirming RNA integrity. For each experiment requiring the use of high quality purified RNA, following spectrophometric analysis to determine concentration, multiple samples were selected at random and electrophoresed on a 1% agarose/ethidium bromide gel. Approximately 0.5 g of purified RNA was diluted in RNA loading dye and loaded per lane. The presence of RNA is confirmed by the two distinct bands (18S and 28S ribosomal RNA), and integrity and purity of the RNA is confirmed by the absence of smearing and extra banding.

PAGE 126

126 Figure A 2: Verification of oligonucleotide annealing for EMSA. A 6% TBE DNA gel was run and stained with SYBR green to examine the results of the annealing reaction for EMSA.

PAGE 127

127 Figure A 3: Verification of high transfection efficiency in Y 1 mouse adrenocortical cells transfected using FugeneHD and a GFP construct. (A) White light image and (B) fluorescent image captured of same field by microscope. A B

PAGE 128

128 Figure A 4: Verification of optimal sonication of chromatin used in ChIP assays. A 1% agarose/TB E/ethidium bromide gel was run and the image of the gel was captured under UV light to ensure optimal shearing conditions for ChIP.

PAGE 129

129 Figure A 5 : Verification of high transfection efficiency in MA 10 mouse Leydig tumor cells transfected using FugeneHD and a GFP construct. (A) White light image and (B) fluorescent image captured of same field by microscope A B

PAGE 130

130 LIST OF REFERENCES 1. Alvarez DA, Cranor WL, Perkins SD, Schroeder VL, Iwanowicz LR, Clark RC, Guy CP, Pinkney AE, Blazer VS, M ullican JE 2009 Reproductive Health of Bass in the Potomac, USA, Drainage: Part 2. Seasonal Occurrence of Persistent and Emerging Organic Contaminants. Environ Toxicol Chem 28:1084 1095 2. Iwanowicz LR, Blazer VS, Guy CP, Pinkney AE, Mullican JE, Alvarez D A 2008 Reproductive Health of Bass in the Potomac, USA Drainage: Part 1. Exploring the Effects of Proximity to Wastewater Treatment Plant Discharge. Environ Toxicol Chem:1 3. Barber DS, McNally AJ, Garcia Reyero N, Denslow ND 2007 Exposure to p,p' DDE or dieldrin during the reproductive season alters hepatic CYP expression in largemouth bass (Micropterus salmoides). Aquat Toxicol 81:2735 4. Kelce WR, Wilson EM 1997 Environmental antiandrogens: developmental effects, molecular mechanisms, and clinical impli cations. J Mol Med 75:198207 5. Henley DV, Lipson N, Korach KS, Bloch CA 2007 Prepubertal gynecomastia linked to lavender and tea tree oils. N Engl J Med 356:479485 6. Gray LE, Ostby J, Furr J, Wolf CJ, Lambright C, Parks L, Veeramachaneni DN, Wilson V, Price M, Hotchkiss A, Orlando E, Guillette L 2001 Effects of environmental antiandrogens on reproductive development in experimental animals. Hum Reprod Update 7:248264 7. Meyer K, Usleber E, Martlbauer E, Bauer J 2000 [Occurrence of zearalenone, alpha a nd beta -zearalenol in bile of breeding sows in relation to reproductive performance]. Berl Munch Tierarztl Wochenschr 113:374379 8. Steinberger EaL, J.A. 1985 In Chemicals Affecting the Development of Reproductive Capacity. New York: Raven Press 9. Hotchk iss AK, Rider CV, Blystone CR, Wilson VS, Hartig PC, Ankley GT, Foster PM, Gray CL, Gray LE 2008 Fifteen years after "Wingspread" --environmental endocrine disrupters and human and wildlife health: where we are today and where we need to go. Toxicol Sci 105 :235259 10. Monosson E, Kelce WR, Lambright C, Ostby J, Gray LE, Jr. 1999 Peripubertal exposure to the antiandrogenic fungicide, vinclozolin, delays puberty, inhibits the development of androgendependent tissues, and alters androgen receptor function in the male rat. Toxicol Ind Health 15:6579 11. Kelce WR, Stone CR, Laws SC, Gray LE, Kemppainen JA, Wilson EM 1995 Persistent DDT metabolite p,p' -DDE is a potent androgen receptor antagonist. Nature 375:581585

PAGE 131

131 12. Stoker TE, Cooper RL, Lambright CS, Wilson VS, Furr J, Gray LE 2005 In vivo and in vitro anti androgenic effects of DE 71, a commercial polybrominated diphenyl ether (PBDE) mixture. Toxicol Appl Pharmacol 207:7888 13. Fisher JS 2004 Are all EDC effects mediated via steroid hormone receptors? Toxi cology 205:3341 14. Hinck JE, Blazer VS, Denslow ND, Echols KR, Gale RW, Wieser C, May TW, Ellersieck M, Coyle JJ, Tillitt DE 2008 Chemical contaminants, health indicators, and reproductive biomarker responses in fish from rivers in the Southeastern Unite d States. Sci Total Environ 390:538557 15. Matsumura N, Ishibashi H, Hirano M, Nagao Y, Watanabe N, Shiratsuchi H, Kai T, Nishimura T, Kashiwagi A, Arizono K 2005 Effects of nonylphenol and triclosan on production of plasma vitellogenin and testosterone i n male South African clawed frogs (Xenopus laevis). Biol Pharm Bull 28:17481751 16. Muller JK, Johnson, K. G., Sepulveda, M. S., Borgert, C. J., Gross, T. S. 2004 Accumulation of dietary DDE and dieldrin by largemouth bass, Micropterus salmoides floridanu s. Bull Environ Contam Toxicol 73:10781085 17. Chedrese PJ, Feyles F 2001 The diverse mechanism of action of dichlorodiphenyldichloroethylene (DDE) and methoxychlor in ovarian cells in vitro. Reprod Toxicol 15:693698 18. Monod G, Rime H, Bobe J, Jalabert B 2004 Agonistic effect of imidazole and triazole fungicides on in vitro oocyte maturation in rainbow trout (Oncorhynchus mykiss). Mar Environ Res 58:143146 19. Walsh LP, McCormick C, Martin C, Stocco DM 2000 Roundup inhibits steroidogenesis by disruptin g steroidogenic acute regulatory (StAR) protein expression. Environ Health Perspect 108:769776 20. Walsh LP, Stocco DM 2000 Effects of lindane on steroidogenesis and steroidogenic acute regulatory protein expression. Biol Reprod 63:10241033 21. Davis BJ, Maronpot RR, Heindel JJ 1994 Di (2 -ethylhexyl) phthalate suppresses estradiol and ovulation in cycling rats. Toxicol Appl Pharmacol 128:216223 22. Lovekamp -Swan T, Davis BJ 2003 Mechanisms of phthalate ester toxicity in the female reproductive system. En viron Health Perspect 111:139145 23. Thompson CJ, Ross SM, Gaido KW 2004 Di(n-butyl) phthalate impairs cholesterol transport and steroidogenesis in the fetal rat testis through a rapid and reversible mechanism. Endocrinology 145:12271237

PAGE 132

132 24. Oakes KD, He witt LM, McMaster ME, Wood C, Munkittrick KR, Van Der Kraak GJ 2005 Oxidative stress and sex steroid levels in fish following short term exposure to pulp -mill effluents. J Toxicol Environ Health A 68:267286 25. Denslow ND, Kocerha J, Sepulveda MS, Gross T Holm SE 2004 Gene expression fingerprints of largemouth bass (Micropterus salmoides) exposed to pulp and paper mill effluents. Mutat Res 552:1934 26. Noaksson E, Linderoth M, Gustavsson B, Zebuhr Y, Balk L 2005 Reproductive status in female perch (Perca fluviatilis) outside a sewage treatment plant processing leachate from a refuse dump. Sci Total Environ 340:97112 27. Kloas W, Urbatzka R, Opitz R, Wurtz S, Behrends T, Hermelink B, Hofmann F, Jagnytsch O, Kroupova H, Lorenz C, Neumann N, Pietsch C, Trubiroha A, Van Ballegooy C, Wiedemann C, Lutz I 2009 Endocrine disruption in aquatic vertebrates. Ann N Y Acad Sci 1163:187200 28. U.S.G.S. 2008 Intersex in Smallmouth Bass Coincident with Population and Agriculture in Potomac Watershed. In: U.S. Department of the Interior USGS ed. Reston, VA: www.usgs.gov/newsroom 29. Kavanagh RJ, Balch GC, Kiparissis Y, Niimi AJ, Sherry J, Tinson C, Metcalfe CD 2004 Endocrine disruption and altered gonadal development in white perch (Morone americana) from the lower Great Lakes region. Environ Health Perspect 112:898902 30. Bjerregaard LB, Korsgaard B, Bjerregaard P 2006 Intersex in wild roach (Rutilus rutilus) from Danish sewage effluent receiving streams. Ecotoxicol Environ S af 64:321328 31. Jobling S, Williams R, Johnson A, Taylor A, Gross -Sorokin M, Nolan M, Tyler CR, van Aerle R, Santos E, Brighty G 2006 Predicted exposures to steroid estrogens in U.K. rivers correlate with widespread sexual disruption in wild fish populat ions. Environ Health Perspect 114 Suppl 1:3239 32. Gercken J, Sordyl H 2002 Intersex in feral marine and freshwater fish from northeastern Germany. Mar Environ Res 54:651655 33. Durrell G, Ceric A, Uhler AD 2004 Assessing the occurrence and significance of DDT contamination in sediments: Lake Apopka and the upper Ocklawaha River chain -of lakes. Remediation Weekly 1 34. Guillette LJ, Jr., Brock JW, Rooney AA, Woodward AR 1999 Serum concentrations of various environmental contaminants and their relationship to sex steroid concentrations and phallus size in juvenile American alligators. Arch Environ Contam Toxicol 36:447455

PAGE 133

133 35. Heinz GH, Percival, H.F., Jennings, M.L. 1991 Contaminants in American alligator eggs from Lake Apopka, Lake Griffin, and Lake Okeec hobee, Florida. Environ Monitor Assess:277 285 36. Sepulveda MS, Wiebe JJ, Honeyfield DC, Rauschenberger HR, Hinterkopf JP, Johnson WE, Gross TS 2004 Organochlorine pesticides and thiamine in eggs of largemouth bass and American alligators and their relati onship with early life -stage mortality. J Wildl Dis 40:782 786 37. Gallagher EP, Gross TS, Sheehy KM 2001 Decreased glutathione S transferase expression and activity and altered sex steroids in Lake Apopka brown bullheads (Ameiurus nebulosus). Aquat Toxico l 55:223237 38. Kristensen T, Edwards TM, Kohno S, Baatrup E, Guillette LJ, Jr. 2007 Fecundity, 17beta -estradiol concentrations and expression of vitellogenin and estrogen receptor genes throughout the ovarian cycle in female Eastern mosquitofish from thr ee lakes in Florida. Aquat Toxicol 81:245255 39. Toft G, Edwards TM, Baatrup E, Guillette LJ, Jr. 2003 Disturbed sexual characteristics in male mosquitofish (Gambusia holbrooki) from a lake contaminated with endocrine disruptors. Environ Health Perspect 111:695701 40. Guillette LJ, Jr., Gross TS, Masson GR, Matter JM, Percival HF, Woodward AR 1994 Developmental abnormalities of the gonad and abnormal sex hormone concentrations in juvenile alligators from contaminated and control lakes in Florida. Environ Health Perspect 102:680688 41. Guillette LJ, Jr., Pickford DB, Crain DA, Rooney AA, Percival HF 1996 Reduction in penis size and plasma testosterone concentrations in juvenile alligators living in a contaminated environment. Gen Comp Endocrinol 101:3242 42. Grier HJ, Aranzabal MCU, Patino R 2009 The Ovary, Folliculogenesis, and Oogenesis in Teleosts. In: Jamieson BGM ed. Reproductive Biology and Phylogeny of Fish (Agnathans and Bony Fishes). Enfield, USA: Science Publishers, Inc. 43. Grier HJ, Aranzabal M CU 2009 The Testis and Spermatogenesis in Teleosts. In: Jamieson BGM ed. Reproductive Biology and Phylogeny of Fish (Agnathans and Bony Fishes). Enfield, USA: Science Publishers, Inc. 44. Sabo Attwood T, Kroll KJ, Denslow ND 2004 Differential expression of largemouth bass (Micropterus salmoides) estrogen receptor isotypes alpha, beta, and gamma by estradiol. Mol Cell Endocrinol 218:107 118 45. Gross TS, Sepulveda MS, Wieser CM, Wiebe JJ, Schoeb TR, Denslow ND 2002 Characterization of annual reproductive cyc les for pond reared Florida largemouth bass (Micropterus salmoides floridanus). Am Fish Soc Symp 31:205 212

PAGE 134

134 46. Patino R 1997 Manipulations of the reproductive system of fishes by means of exogenous chemicals. The Progressive Fish-Culturist:118 128 47. Goe tz FW 1983 Hormonal control of oocyte final maturation and ovulation in fishes. New York: Academic Press 48. Mayer I, Liley NR, Borg B 1994 Stimulation of spawning behavior in castrated rainbow trout (Oncorhynchus mykiss) by 17 alpha,20 beta -dihydroxy 4 -pr egnen3 -one, but not by 11ketoandrostenedione. Horm Behav 28:181190 49. Pudney J 1995 Spermatogenesis in nonmammalian vertebrates. Microsc Res Tech 32:459497 50. Young G, Kusakabe M, Nakamura I, Lokman PM, Goetz FW 2005 Gonadal Steroidogenesis in Teleos t Fish. In: Melamed P, Sherwood N eds. Molecular Aspects of Fish and Marine Biology: Hormones and their Receptors in Fish Reproduction: World Scientific Publishing Co.; 155 223 51. Alberts J, Lewis, Raff, Roberts, and Walter 2002 Molecular Biology of the C ell. Fourth ed. New York: Garland Publishing, Inc. 52. Clark BJ, Wells J, King SR, Stocco DM 1994 The purification, cloning, and expression of a novel luteinizing hormone induced mitochondrial protein in MA 10 mouse Leydig tumor cells. Characterization of the steroidogenic acute regulatory protein (StAR). J Biol Chem 269:2831428322 53. Paz C, Poderoso C, Maloberti P, Maciel FC, Mendez C, Poderoso JJ, Podesta EJ 2009 Detection of a mitochondrial kinase complex that mediates PKA MEK ERK dependent phosphoryla tion of mitochondrial proteins involved in the regulation of steroid biosynthesis. Methods Enzymol 457:169192 54. Manna PR, Dyson MT, Stocco DM 2009 Regulation of the steroidogenic acute regulatory protein gene expression: present and future perspectives. Mol Hum Reprod 15:321333 55. Clark BJ, Soo SC, Caron KM, Ikeda Y, Parker KL, Stocco DM 1995 Hormonal and developmental regulation of the steroidogenic acute regulatory protein. Mol Endocrinol 9:13461355 56. Clark BJ, Stocco DM 1995 Expression of the ste roidogenic acute regulatory (StAR) protein: a novel LH induced mitochondrial protein required for the acute regulation of steroidogenesis in mouse Leydig tumor cells. Endocr Res 21:243257 57. Jo Y, King SR, Khan SA, Stocco DM 2005 Involvement of protein kinase C and cyclic adenosine 3',5' -monophosphate -dependent kinase in steroidogenic acute regulatory protein expression and steroid biosynthesis in Leydig cells. Biol Reprod 73:244 255

PAGE 135

135 58. Lin D, Sugawara T, Strauss JF, 3rd, Clark BJ, Stocco DM, Saenger P, Rogol A, Miller WL 1995 Role of steroidogenic acute regulatory protein in adrenal and gonadal steroidogenesis. Science 267:18281831 59. Manna PR, Huhtaniemi IT, Stocco DM 2004 Detection of hCG Responsive Expression of the Steroidogenic Acute Regulatory Pr otein in Mouse Leydig Cells. Biol Proced Online 6:8393 60. Germain P, Staels B, Dacquet C, Spedding M, Laudet V 2006 Overview of nomenclature of nuclear receptors. Pharmacol Rev 58:685704 61. Giguere V 1999 Orphan nuclear receptors: from gene to function Endocr Rev 20:689725 62. Giguere V, Hollenberg SM, Rosenfeld MG, Evans RM 1986 Functional domains of the human glucocorticoid receptor. Cell 46:645 652 63. Green S, Kumar V, Krust A, Walter P, Chambon P 1986 Structural and functional domains of the estr ogen receptor. Cold Spring Harb Symp Quant Biol 51 Pt 2:751758 64. Krust A, Green S, Argos P, Kumar V, Walter P, Bornert JM, Chambon P 1986 The chicken oestrogen receptor sequence: homology with v -erbA and the human oestrogen and glucocorticoid receptors. EMBO J 5:891897 65. Blum JL, James MO, Stuchal LD, Denslow ND 2008 Stimulation of transactivation of the largemouth bass estrogen receptors alpha, beta a, and beta b by methoxychlor and its mono and bis demethylated metabolites in HepG2 cells. J Steroid Biochem Mol Biol 108:5563 66. Sabo Attwood T 2003 Characterization of estrogen receptor isotypes in largemouth bass. In: Department of Pharmacology. Gainesville: University of Florida 67. Sabo Attwood T, Blum JL, Kroll KJ, Patel V, Birkholz D, Szabo NJ, Fisher SZ, McKenna R, Campbell -Thompson M, Denslow ND 2007 Distinct expression and activity profiles of largemouth bass (Micropterus salmoides) estrogen receptors in response to estradiol and nonylphenol. J Mol Endocrinol 39:223237 68. Halm S, Martinez -Ro driguez G, Rodriguez L, Prat F, Mylonas CC, Carrillo M, Zanuy S 2004 Cloning, characterisation, and expression of three oestrogen receptors (ERalpha, ERbeta1 and ERbeta2) in the European sea bass, Dicentrarchus labrax. Mol Cell Endocrinol 223:6375 69. Haw kins MB, Thomas P 2004 The unusual binding properties of the third distinct teleost estrogen receptor subtype ERbetaa are accompanied by highly conserved amino acid changes in the ligand binding domain. Endocrinology 145:29682977

PAGE 136

136 70. Hawkins MB, Thornton JW, Crews D, Skipper JK, Dotte A, Thomas P 2000 Identification of a third distinct estrogen receptor and reclassification of estrogen receptors in teleosts. Proc Natl Acad Sci U S A 97:1075110756 71. Menuet A, Pellegrini E, Anglade I, Blaise O, Laudet V, Kah O, Pakdel F 2002 Molecular characterization of three estrogen receptor forms in zebrafish: binding characteristics, transactivation properties, and tissue distributions. Biol Reprod 66:18811892 72. Pinto PI, Passos AL, Martins Deborah MPRS, Canario AV 2006 Characterization of estrogen receptor betab in sea bream (Sparus auratus): phylogeny, ligand -binding, and comparative analysis of expression. Gen Comp Endocrinol 145:197207 73. Prins GS, Putz O 2008 Molecular signaling pathways that regulate prostat e gland development. Differentiation 76:641659 74. Prins GS, Korach KS 2008 The role of estrogens and estrogen receptors in normal prostate growth and disease. Steroids 73:233244 75. Harbott LK, Burmeister SS, White RB, Vagell M, Fernald RD 2007 Androgen receptors in a cichlid fish, Astatotilapia burtoni: structure, localization, and expression levels. J Comp Neurol 504:5773 76. Ikeuchi T, Todo T, Kobayashi T, Nagahama Y 1999 cDNA cloning of a novel androgen receptor subtype. J Biol Chem 274:2520525209 77. Ikeuchi T, Todo T, Kobayashi T, Nagahama Y 2001 Two subtypes of androgen and progestogen receptors in fish testes. Comp Biochem Physiol B Biochem Mol Biol 129:449455 78. Sperry TS, Thomas P 1999 Characterization of two nuclear androgen receptors in At lantic croaker: comparison of their biochemical properties and binding specificities. Endocrinology 140:16021611 79. Sperry TS, Thomas P 1999 Identification of two nuclear androgen receptors in kelp bass (Paralabrax clathratus) and their binding affinitie s for xenobiotics: comparison with Atlantic croaker (Micropogonias undulatus) androgen receptors. Biol Reprod 61:11521161 80. Takeo J, Yamashita S 1999 Two distinct isoforms of cDNA encoding rainbow trout androgen receptors. J Biol Chem 274:56745680 81. Todo T, Ikeuchi T, Kobayashi T, Nagahama Y 1999 Fish androgen receptor: cDNA cloning, steroid activation of transcription in transfected mammalian cells, and tissue mRNA levels. Biochem Biophys Res Commun 254:378383

PAGE 137

137 82. Olsson PE, Berg AH, von Hofsten J, Grahn B, Hellqvist A, Larsson A, Karlsson J, Modig C, Borg B, Thomas P 2005 Molecular cloning and characterization of a nuclear androgen receptor activated by 11 ketotestosterone. Reprod Biol Endocrinol 3:37 83. Bjornstrom L, Sjoberg M 2005 Mechanisms of e strogen receptor signaling: convergence of genomic and nongenomic actions on target genes. Mol Endocrinol 19:833842 84. Li J, Al Azzawi F 2009 Mechanism of androgen receptor action. Maturitas 63:142148 85. Nakajima Y, Ikeda M, Kimura T, Honma S, Ohmiya Y Honma K 2004 Bidirectional role of orphan nuclear receptor RORalpha in clock gene transcriptions demonstrated by a novel reporter assay system. FEBS Lett 565:122126 86. Preitner N, Damiola F, Lopez -Molina L, Zakany J, Duboule D, Albrecht U, Schibler U 2 002 The orphan nuclear receptor REV ERBalpha controls circadian transcription within the positive limb of the mammalian circadian oscillator. Cell 110:251 260 87. Sato TK, Panda S, Miraglia LJ, Reyes TM, Rudic RD, McNamara P, Naik KA, FitzGerald GA, Kay SA Hogenesch JB 2004 A functional genomics strategy reveals Rora as a component of the mammalian circadian clock. Neuron 43:527537 88. Kallen J, Schlaeppi JM, Bitsch F, Delhon I, Fournier B 2004 Crystal structure of the human RORalpha Ligand binding domain in complex with cholesterol sulfate at 2.2 A. J Biol Chem 279:1403314038 89. Kocerha J, Prucha MS, Kroll KJ, Steinhilber D, Denslow ND 2009 Regulation of the Steroidogenic Acute Regulatory (StAR) Protein by cAMP Responsive Transcriptional Elements in Lar gemouth Bass ( Micropterus salmoides ). Submitted to Endocrinology 90. Kocerha RJ 2005 Regulation of the Steroidogenic Acute Regulatory (StAR) Protein by cAMP and TGF -beta Dependent Pathways. In: Department of Biochemistry and Molecular Biology. Gainesville: University of Florida 91. Stocco DM, Clark BJ 1996 Role of the steroidogenic acute regulatory protein (StAR) in steroidogenesis. Biochem Pharmacol 51:197205 92. Manna PR, Stocco DM 2005 Regulation of the steroidogenic acute regulatory protein expression: functional and physiological consequences. Curr Drug Targets Immune Endocr Metabol Disord 5:93108 93. Bose HS, Sugawara T, Strauss JF, 3rd, Miller WL 1996 The pathophysiology and genetics of congenital lipoid adrenal hyperplasia. International Congenital Lipoid Adrenal Hyperplasia Consortium. N Engl J Med 335:18701878

PAGE 138

138 94. Caron KM, Soo SC, Wetsel WC, Stocco DM, Clark BJ, Parker KL 1997 Targeted disruption of the mouse gene encoding steroidogenic acute regulatory protein provides insights into congenital lipoid adrenal hyperplasia. Proc Natl Acad Sci U S A 94:1154011545 95. Hasegawa T, Zhao L, Caron KM, Majdic G, Suzuki T, Shizawa S, Sasano H, Parker KL 2000 Developmental roles of the steroidogenic acute regulatory protein (StAR) as revealed by StAR knock out mice. Mol Endocrinol 14:14621471 96. Hall EA, Ren S, Hylemon PB, Rodriguez Agudo D, Redford K, Marques D, Kang D, Gil G, Pandak WM 2005 Detection of the steroidogenic acute regulatory protein, StAR, in human liver cells. Biochim Biophys Acta 1733:111119 97. Campbell B, Dickey J, Beckman B, Young G, Pierce A, Fukada H, Swanson P 2006 Previtellogenic oocyte growth in salmon: relationships among body growth, plasma insulin like growth factor 1, estradiol 17beta, follicle -stimulating hormone and expressio n of ovarian genes for insulin -like growth factors, steroidogenic acute regulatory protein and receptors for gonadotropins, growth hormone, and somatolactin. Biol Reprod 75:3444 98. Geslin M, Auperin B 2004 Relationship between changes in mRNAs of the genes encoding steroidogenic acute regulatory protein and P450 cholesterol side chain cleavage in head kidney and plasma levels of cortisol in response to different kinds of acute stress in the rainbow trout (Oncorhynchus mykiss). Gen Comp Endocrinol 135:70-8 0 99. Giorgi G, Palumbo Piccionello A, Pace A, Buscemi S 2008 Effect of protonation and deprotonation on the gas phase reactivity of fluorinated 1,2,4-triazines. J Am Soc Mass Spectrom 19:686694 100. Goetz FW, Norberg B, McCauley LA, Iliev DB 2004 Charact erization of the cod (Gadus morhua) steroidogenic acute regulatory protein (StAR) sheds light on StAR gene structure in fish. Comp Biochem Physiol B Biochem Mol Biol 137:351362 101. Ings JS, Van Der Kraak GJ 2006 Characterization of the mRNA expression of StAR and steroidogenic enzymes in zebrafish ovarian follicles. Mol Reprod Dev 73:943 954 102. Kortner TM, Rocha E, Arukwe A 2009 Previtellogenic oocyte growth and transcriptional changes of steroidogenic enzyme genes in immature female Atlantic cod (Gadus morhua L.) after exposure to the androgens 11 ketotestosterone and testosterone. Comp Biochem Physiol A Mol Integr Physiol 152:304313 103. Kusakabe M, Todo T, McQuillan HJ, Goetz FW, Young G 2002 Characterization and expression of steroidogenic acute reg ulatory protein and MLN64 cDNAs in trout. Endocrinology 143:20622070

PAGE 139

139 104. Kusakabe M, Zuccarelli MD, Nakamura I, Young G 2009 Steroidogenic acute regulatory protein in white sturgeon (Acipenser transmontanus): cDNA cloning, sites of expression and transcr ipt abundance in corticosteroidogenic tissue after an acute stressor. Gen Comp Endocrinol 105. Nakamura I, Evans JC, Kusakabe M, Nagahama Y, Young G 2005 Changes in steroidogenic enzyme and steroidogenic acute regulatory protein messenger RNAs in ovarian f ollicles during ovarian development of rainbow trout (Oncorhynchus mykiss). Gen Comp Endocrinol 106. Rocha A, Zanuy S, Carrillo M, Gomez A 2009 Seasonal changes in gonadal expression of gonadotropin receptors, steroidogenic acute regulatory protein and ste roidogenic enzymes in the European sea bass. Gen Comp Endocrinol 107. von Hofsten J, Karlsson J, Jones I, Olsson PE 2002 Expression and regulation of fushi tarazu factor 1 and steroidogenic genes during reproduction in Arctic char (Salvelinus alpinus). Biol Reprod 67:12971304 108. Manna PR, Dyson MT, Eubank DW, Clark BJ, Lalli E, Sassone -Corsi P, Zeleznik AJ, Stocco DM 2002 Regulation of steroidogenesis and the steroidogenic acute regulatory protein by a member of the cAMP response -element binding protein family. Mol Endocrinol 16:184199 109. Manna PR, Chandrala SP, Jo Y, Stocco DM 2006 cAMP independent signaling regulates steroidogenesis in mouse Leydig cells in the absence of StAR phosphorylation. J Mol Endocrinol 37:8195 110. Clark BJ, Combs R, Hales K H, Hales DB, Stocco DM 1997 Inhibition of transcription affects synthesis of steroidogenic acute regulatory protein and steroidogenesis in MA 10 mouse Leydig tumor cells. Endocrinology 138:48934901 111. Manna PR, Kero J, TenaSempere M, Pakarinen P, Stocc o DM, Huhtaniemi IT 2001 Assessment of mechanisms of thyroid hormone action in mouse Leydig cells: regulation of the steroidogenic acute regulatory protein, steroidogenesis, and luteinizing hormone receptor function. Endocrinology 142:319331 112. Clark BJ Cochrum RK 2007 The steroidogenic acute regulatory protein as a target of endocrine disruption in male reproduction. Drug Metab Rev 39:353370 113. Garcia -Reyero N, Barber DS, Gross TS, Johnson KG, Sepulveda MS, Szabo NJ, Denslow ND 2006 Dietary exposure of largemouth bass to OCPs changes expression of genes important for reproduction. Aquat Toxicol 78:358 369 114. Sharpe RL, Woodhouse A, Moon TW, Trudeau VL, MacLatchy DL 2007 Beta sitosterol and 17beta -estradiol alter gonadal steroidogenic acute regulato ry protein (StAR) expression in goldfish, Carassius auratus. Gen Comp Endocrinol 151:3441

PAGE 140

140 115. Walsh LP, Webster DR, Stocco DM 2000 Dimethoate inhibits steroidogenesis by disrupting transcription of the steroidogenic acute regulatory (StAR) gene. J Endocr inol 167:253263 116. Stocco DM 2001 StAR protein and the regulation of steroid hormone biosynthesis. Annu Rev Physiol 63:193213 117. Sugawara T, Holt JA, Driscoll D, Strauss JF, 3rd, Lin D, Miller WL, Patterson D, Clancy KP, Hart IM, Clark BJ, et al. 1995 Human steroidogenic acute regulatory protein: functional activity in COS 1 cells, tissue -specific expression, and mapping of the structural gene to 8p11.2 and a pseudogene to chromosome 13. Proc Natl Acad Sci U S A 92:47784782 118. Sandhoff TW, Hales DB Hales KH, McLean MP 1998 Transcriptional regulation of the rat steroidogenic acute regulatory protein gene by steroidogenic factor 1. Endocrinology 139:48204831 119. Reyland ME, Evans R, White E 2000 Lipoproteins regulate expression of the Steroidogenic Acute Regulatory Protein in mouse adrenocortical cells. J Biol Chem 275:3663736644 120. Wang X, Walsh LP, Reinhart AJ, Stocco DM 2000 The role of arachidonic acid in steroidogenesis and steroidogenic acute regulatory (StAR) gene and protein expression. J Biol Chem 275:2020420209 121. Wang X, Stocco DM 1999 Cyclic AMP and arachidonic acid: a tale of two pathways. Mol Cell Endocrinol 158:712 122. Wang X, Walsh LP, Stocco DM 1999 The role of arachidonic acid on LH stimulated steroidogenesis and steroidogen ic acute regulatory protein accumulation in MA 10 mouse Leydig tumor cells. Endocrine 10:712 123. Wang XJ, Dyson MT, Mondillo C, Patrignani Z, Pignataro O, Stocco DM 2002 Interaction between arachidonic acid and cAMP signaling pathways enhances steroidoge nesis and StAR gene expression in MA 10 Leydig tumor cells. Mol Cell Endocrinol 188:5563 124. Houk CP, Pearson EJ, Martinelle N, Donahoe PK, Teixeira J 2004 Feedback inhibition of steroidogenic acute regulatory protein expression in vitro and in vivo by a ndrogens. Endocrinology 145:12691275 125. Nakamura I, Kusakabe M, Young G 2009 Differential suppressive effects of low physiological doses of estradiol 17beta in vivo on levels of mRNAs encoding steroidogenic acute regulatory protein and three steroidogenic enzymes in previtellogenic ovarian follicles of rainbow trout. Gen Comp Endocrinol

PAGE 141

141 126. Manna PR, Eubank DW, Lalli E, Sassone -Corsi P, Stocco DM 2003 Transcriptional regulation of the mouse steroidogenic acute regulatory protein gene by the cAMP respons e -element binding protein and steroidogenic factor 1. J Mol Endocrinol 30:381 397 127. Clark BJ, Combs R 1999 Angiotensin II and cyclic adenosine 3',5' -monophosphate induce human steroidogenic acute regulatory protein transcription through a common steroid ogenic factor 1 element. Endocrinology 140:43904398 128. Manna PR, Eubank DW, Stocco DM 2004 Assessment of the role of activator protein1 on transcription of the mouse steroidogenic acute regulatory protein gene. Mol Endocrinol 18:558573 129. Sugawara T Saito M, Fujimoto S 2000 Sp1 and SF 1 interact and cooperate in the regulation of human steroidogenic acute regulatory protein gene expression. Endocrinology 141:28952903 130. Nishida H, Miyagawa S, Vieux -Rochas M, Morini M, Ogino Y, Suzuki K, Nakagata N, Choi HS, Levi G, Yamada G 2008 Positive regulation of steroidogenic acute regulatory protein gene expression through the interaction between Dlx and GATA 4 for testicular steroidogenesis. Endocrinology 149:20902097 131. Silverman E, Yivgi-Ohana N, Sher N, Bell M, Eimerl S, Orly J 2006 Transcriptional activation of the steroidogenic acute regulatory protein (StAR) gene: GATA 4 and CCAAT/enhancer -binding protein beta confer synergistic responsiveness in hormone treated rat granulosa and HEK293 cell models Mol Cell Endocrinol 252:92-101 132. Nakao N, Yasuo S, Nishimura A, Yamamura T, Watanabe T, Anraku T, Okano T, Fukada Y, Sharp PJ, Ebihara S, Yoshimura T 2007 Circadian clock gene regulation of steroidogenic acute regulatory protein gene expression in pre ovulatory ovarian follicles. Endocrinology 148:30313038 133. Sugawara T, Nomura E, Sakuragi N, Fujimoto S 2001 The effect of the arylhydrocarbon receptor on the human steroidogenic acute regulatory gene promoter activity. J Steroid Biochem Mol Biol 78:253260 134. Christenson LK, Osborne TF, McAllister JM, Strauss JF, 3rd 2001 Conditional response of the human steroidogenic acute regulatory protein gene promoter to sterol regulatory element binding protein 1a. Endocrinology 142:2836 135. Nackley AC, Shea -Eaton W, Lopez D, McLean MP 2002 Repression of the steroidogenic acute regulatory gene by the multifunctional transcription factor Yin Yang 1. Endocrinology 143:10851096 136. Zazopoulos E, Lalli E, Stocco DM, Sassone -Corsi P 1997 DNA binding and transcrip tional repression by DAX 1 blocks steroidogenesis. Nature 390:311 315

PAGE 142

142 137. Shea -Eaton W, Sandhoff TW, Lopez D, Hales DB, McLean MP 2002 Transcriptional repression of the rat steroidogenic acute regulatory (StAR) protein gene by the AP 1 family member c Fos Mol Cell Endocrinol 188:161170 138. Devoto L, Kohen P, Gonzalez RR, Castro O, Retamales I, Vega M, Carvallo P, Christenson LK, Strauss JF, 3rd 2001 Expression of steroidogenic acute regulatory protein in the human corpus luteum throughout the luteal pha se. J Clin Endocrinol Metab 86:56335639 139. Hauet T, Yao ZX, Bose HS, Wall CT, Han Z, Li W, Hales DB, Miller WL, Culty M, Papadopoulos V 2005 Peripheral type benzodiazepine receptor -mediated action of steroidogenic acute regulatory protein on cholesterol entry into leydig cell mitochondria. Mol Endocrinol 19:540554 140. Bose M, Whittal RM, Miller WL, Bose HS 2008 Steroidogenic activity of StAR requires contact with mitochondrial VDAC1 and phosphate carrier protein. J Biol Chem 283:88378845 141. Liu J, R one MB, Papadopoulos V 2006 Protein-protein interactions mediate mitochondrial cholesterol transport and steroid biosynthesis. J Biol Chem 281:3887938893 142. Baker BY, Epand RF, Epand RM, Miller WL 2007 Cholesterol binding does not predict activity of th e steroidogenic acute regulatory protein, StAR. J Biol Chem 282:1022310232 143. Baatrup E, Junge M 2001 Antiandrogenic pesticides disrupt sexual characteristics in the adult male guppy Poecilia reticulata. Environ Health Perspect 109:10631070 144. Blum J L, Nyagode BA, James MO, Denslow ND 2008 Effects of the pesticide methoxychlor on gene expression in the liver and testes of the male largemouth bass (Micropterus salmoides). Aquat Toxicol 86:459469 145. Bonefeld Jorgensen EC, Autrup H, Hansen JC 1997 Eff ect of toxaphene on estrogen receptor functions in human breast cancer cells. Carcinogenesis 18:16511654 146. Lemaire G, Mnif W, Mauvais P, Balaguer P, Rahmani R 2006 Activation of alpha and beta -estrogen receptors by persistent pesticides in reporter ce ll lines. Life Sci 79:11601169 147. Lemaire G, Terouanne B, Mauvais P, Michel S, Rahmani R 2004 Effect of organochlorine pesticides on human androgen receptor activation in vitro. Toxicol Appl Pharmacol 196:235246 148. Scippo ML, Argiris C, Van De Weerdt C, Muller M, Willemsen P, Martial J, Maghuin-Rogister G 2004 Recombinant human estrogen, androgen and progesterone

PAGE 143

143 receptors for detection of potential endocrine disruptors. Anal Bioanal Chem 378:664669 149. Wojtowicz AK, Gregoraszczuk EL, Ptak A, Faland ysz J 2004 Effect of single and repeated in vitro exposure of ovarian follicles to o,p' -DDT and p,p' -DDT and their metabolites. Pol J Pharmacol 56:465 472 150. Wojtowicz AK, Kajta M, Gregoraszczuk EL 2007 DDT and DDE -induced disruption of ovarian steroidogenesis in prepubertal porcine ovarian follicles: a possible interaction with the main steroidogenic enzymes and estrogen receptor beta. J Physiol Pharmacol 58:873885 151. Gaido KW, Maness SC, McDonnell DP, Dehal SS, Kupfer D, Safe S 2000 Interaction of m ethoxychlor and related compounds with estrogen receptor alpha and beta, and androgen receptor: structure activity studies. Mol Pharmacol 58:852 858 152. Akgul Y, Derk RC, Meighan T, Rao KM, Murono EP 2008 The methoxychlor metabolite, HPTE, directly inhibits the catalytic activity of cholesterol side -chain cleavage (P450scc) in cultured rat ovarian cells. Reprod Toxicol 25:6775 153. Gunderson MP, Kohno S, Blumberg B, Iguchi T, Guillette LJ, Jr. 2006 Upregulation of the alligator CYP3A77 gene by toxaphene and dexamethasone and its short term effect on plasma testosterone concentrations. Aquat Toxicol 78:272283 154. King SR, Matassa AA, White EK, Walsh LP, Jo Y, Rao RM, Stocco DM, Reyland ME 2004 Oxysterols regulate expression of the steroidogenic acute reg ulatory protein. J Mol Endocrinol 32:507517 155. Thibaut R, Porte C 2004 Effects of endocrine disrupters on sex steroid synthesis and metabolism pathways in fish. J Steroid Biochem Mol Biol 92:485494 156. Wang YB, Song L, Cui LB, Hong X, Zhang ZD, Wang X R 2007 Monobutyl phthalate inhibits steroidogenesis by downregulating steroidogenic acute regulatory protein expression in mouse Leydig tumor cells (MLTC 1). J Toxicol Environ Health A 70:947955 157. Zachow R, Uzumcu M 2006 The methoxychlor metabolite, 2, 2 -bis (p -hydroxyphenyl) 1,1,1 trichloroethane, inhibits steroidogenesis in rat ovarian granulosa cells in vitro. Reprod Toxicol 22:659665 158. Larkin P, Sabo Attwood T, Kelso J, Denslow ND 2003 Analysis of gene expression profiles in largemouth bass expos ed to 17-beta -estradiol and to anthropogenic contaminants that behave as estrogens. Ecotoxicology 12:463468 159. Sepulveda MS, Johnson WE, Higman JC, Denslow ND, Schoeb TR, Gross TS 2002 An evaluation of biomarkers of reproductive function and potential c ontaminant effects

PAGE 144

144 in Florida largemouth bass ( Micropterus salmoidesfloridanus) sampled from the St. Johns River. Sci Total Environ 289:133144 160. Ascoli M 1981 Characterization of several clonal lines of cultured Leydig tumor cells: gonadotropin recept ors and steroidogenic responses. Endocrinology 108:8895 161. Lechtken A, Zundorf I, Dingermann T, Firla B, Steinhilber D 2006 Overexpression, refolding, and purification of polyhistidine -tagged human retinoic acid related orphan receptor RORalpha4. Protei n Expr Purif 49:114120 162. Nunez BS, Evans AN 2007 Hormonal regulation of the steroidogenic acute regulatory protein (StAR) in gonadal tissues of the Atlantic croaker (Micropogonias undulatus). Gen Comp Endocrinol 150:495504 163. Arukwe A 2005 Modulation of brain steroidogenesis by affecting transcriptional changes of steroidogenic acute regulatory (StAR) protein and cholesterol side chain cleavage (P450scc) in juvenile Atlantic salmon (Salmo salar) is a novel aspect of nonylphenol toxicity. Environ Sci Technol 39:97919798 164. Bauer MP, Bridgham JT, Langenau DM, Johnson AL, Goetz FW 2000 Conservation of steroidogenic acute regulatory (StAR) protein structure and expression in vertebrates. Mol Cell Endocrinol 168:119125 165. Filby AL, Thorpe KL, Maack G Tyler CR 2007 Gene expression profiles revealing the mechanisms of anti androgenand estrogen induced feminization in fish. Aquat Toxicol 81:219231 166. Sepulveda MS, Quinn BP, Denslow ND, Holm SE, Gross TS 2003 Effects of pulp and paper mill effluents on reproductive success of largemouth bass. Environ Toxicol Chem 22:205213 167. Kusakabe M, Nakamura I, Evans J, Swanson P, Young G 2006 Changes in mRNAs encoding steroidogenic acute regulatory protein, steroidogenic enzymes and receptors for gonadotropi ns during spermatogenesis in rainbow trout testes. J Endocrinol 189:541554 168. Vinas J, Piferrer F 2008 Stage -specific gene expression during fish spermatogenesis as determined by laser -capture microdissection and quantitative -PCR in sea bass (Dicentrarc hus labrax) gonads. Biol Reprod 79:738747 169. Loir M, Sourdaine P, Mendis -Handagama SM, Jegou B 1995 Cell cell interactions in the testis of teleosts and elasmobranchs. Microsc Res Tech 32:533552 170. Safe S, Kim K 2008 Nonclassical genomic estrogen receptor (ER)/specificity protein and ER/activating protein 1 signaling pathways. J Mol Endocrinol 41:263275

PAGE 145

145 171. Thomas P, Pang Y, Filardo EJ, Dong J 2005 Identity of an estrogen membrane receptor coupled to a G protein in human breast cancer cells. Endocr inology 146:624632 172. Zou A, Marschke KB, Arnold KE, Berger EM, Fitzgerald P, Mais DE, Allegretto EA 1999 Estrogen receptor beta activates the human retinoic acid receptor alpha 1 promoter in response to tamoxifen and other estrogen receptor antagonists but not in response to estrogen. Mol Endocrinol 13:418430 173. Aesoy R, Mellgren G, Morohashi K, Lund J 2002 Activation of cAMP -dependent protein kinase increases the protein level of steroidogenic factor 1. Endocrinology 143:295303 174. Clem BF, Hudso n EA, Clark BJ 2005 Cyclic adenosine 3',5' -monophosphate (cAMP) enhances cAMP -responsive element binding (CREB) protein phosphorylation and phosphoCREB interaction with the mouse steroidogenic acute regulatory protein gene promoter. Endocrinology 146:13481356 175. Hagen IJ, Kusakabe M, Young G 2006 Effects of ACTH and cAMP on steroidogenic acute regulatory protein and P450 11beta -hydroxylase messenger RNAs in rainbow trout interrenal cells: relationship with in vitro cortisol production. Gen Comp Endocrin ol 145:254262 176. Li YY, Inoue K, Takei Y 2003 Steroidogenic acute regulatory protein in eels: cDNA cloning and effects of ACTH and seawater transfer on its mRNA expression. Zoolog Sci 20:211219 177. Aluru N, Vijayan MM 2006 Aryl hydrocarbon receptor ac tivation impairs cortisol response to stress in rainbow trout by disrupting the rate limiting steps in steroidogenesis. Endocrinology 147:18951903 178. Stocco DM, Wang X, Jo Y, Manna PR 2005 Multiple signaling pathways regulating steroidogenesis and stero idogenic acute regulatory protein expression: more complicated than we thought. Mol Endocrinol 19:26472659 179. Dolatshad H, Davis FC, Johnson MH 2009 Circadian clock genes in reproductive tissues and the developing conceptus. Reprod Fertil Dev 21:1 9 180. Caron KM, Ikeda Y, Soo SC, Stocco DM, Parker KL, Clark BJ 1997 Characterization of the promoter region of the mouse gene encoding the steroidogenic acute regulatory protein. Mol Endocrinol 11:138147 181. Lopez D, Nackley AC, Shea -Eaton W, Xue J, Schimme r BP, McLean MP 2001 Effects of mutating different steroidogenic factor 1 protein regions on gene regulation. Endocrine 14:353362

PAGE 146

146 182. Ueda HR, Hayashi S, Chen W, Sano M, Machida M, Shigeyoshi Y, Iino M, Hashimoto S 2005 System level identification of tra nscriptional circuits underlying mammalian circadian clocks. Nat Genet 37:187192 183. Kallen JA, Schlaeppi JM, Bitsch F, Geisse S, Geiser M, Delhon I, Fournier B 2002 X ray structure of the hRORalpha LBD at 1.63 A: structural and functional data that chol esterol or a cholesterol derivative is the natural ligand of RORalpha. Structure 10:16971707 184. Moraitis AN, Giguere V 1999 Transition from monomeric to homodimeric DNA binding by nuclear receptors: identification of RevErbAalpha determinants required f or RORalpha homodimer complex formation. Mol Endocrinol 13:431439 185. Manna PR, Wang XJ, Stocco DM 2003 Involvement of multiple transcription factors in the regulation of steroidogenic acute regulatory protein gene expression. Steroids 68:11251134 186. Blum JL, Knoebl I, Larkin P, Kroll KJ, Denslow ND 2004 Use of suppressive subtractive hybridization and cDNA arrays to discover patterns of altered gene expression in the liver of dihydrotestosterone and 11 ketotestosterone exposed adult male largemouth ba ss (Micropterus salmoides). Mar Environ Res 58:565569 187. Borgert CJ, Gross TS, Guiney PD, Osimitz TG, Price B, Wells C 2004 Interactive effects of p,p' -dichlorodiphenyldichloroethylene and methoxychlor on hormone synthesis in largemouth bass ovarian cul tures. Environ Toxicol Chem 23:19471956 188. Garcia -Reyero N, Barber D, Gross T, Denslow N 2006 Modeling of gene expression pattern alteration by p,p' -DDE and dieldrin in largemouth bass. Mar Environ Res 62 Suppl:S415419 189. Folmar LC, Hemmer MJ, Denslo w ND, Kroll K, Chen J, Cheek A, Richman H, Meredith H, Grau EG 2002 A comparison of the estrogenic potencies of estradiol, ethynylestradiol, diethylstilbestrol, nonylphenol and methoxychlor in vivo and in vitro. Aquat Toxicol 60:101110 190. Wojtowicz AK, Milewicz T, Gregoraszczuk EL 2007 DDT and its metabolite DDE alter steroid hormone secretion in human term placental explants by regulation of aromatase activity. Toxicol Lett 173:2430 191. Nativelle -Serpentini C, Richard S, Seralini GE, Sourdaine P 2003 Aromatase activity modulation by lindane and bisphenol -A in human placental JEG 3 and transfected kidney E293 cells. Toxicol In Vitro 17:413422 192. Gasnier C, Dumont C, Benachour N, Clair E, Chagnon MC, Seralini GE 2009 Glyphosate -based herbicides are to xic and endocrine disruptors in human cell lines. Toxicology

PAGE 147

147 193. Rees WJ 2007 Unpublished Data. 194. Maness SC, McDonnell DP, Gaido KW 1998 Inhibition of androgen receptor dependent transcriptional activity by DDT isomers and methoxychlor in HepG2 human hepatoma cells. Toxicol Appl Pharmacol 151:135 142 195. Watson CS, Bulayeva NN, Wozniak AL, Alyea RA 2007 Xenoestrogens are potent activators of nongenomic estrogenic responses. Steroids 72:124134 196. Bulayeva NN, Watson CS 2004 Xenoestrogen-induced ERK 1 and ERK 2 activation via multiple membrane initiated signaling pathways. Environ Health Perspect 112:14811487 197. Poderoso C, Converso DP, Maloberti P, Duarte A, Neuman I, Galli S, Maciel FC, Paz C, Carreras MC, Poderoso JJ, Podesta EJ 2008 A mitochond rial kinase complex is essential to mediate an ERK1/2 -dependent phosphorylation of a key regulatory protein in steroid biosynthesis. PLoS One 3:e1443 198. Poderoso C, Maloberti P, Duarte A, Neuman I, Paz C, Maciel FC, Podesta EJ 2009 Hormonal activation of a kinase cascade localized at the mitochondria is required for StAR protein activity. Mol Cell Endocrinol 300:37 42 199. Harvey CN, Esmail M, Wang Q, Brooks AI, Zachow R, Uzumcu M 2009 Effect of the methoxychlor metabolite HPTE on the rat ovarian granulos a cell transcriptome in vitro. Toxicol Sci 110:95106 200. Murono EP, Derk RC, Akgul Y 2006 In vivo exposure of young adult male rats to methoxychlor reduces serum testosterone levels and ex vivo Leydig cell testosterone formation and cholesterol side -chai n cleavage activity. Reprod Toxicol 21:148153 201. Armenti AE, Zama AM, Passantino L, Uzumcu M 2008 Developmental methoxychlor exposure affects multiple reproductive parameters and ovarian folliculogenesis and gene expression in adult rats. Toxicol Appl P harmacol 233:286296 202. Martyniuk CJ 2009 Unpublished data. 203. Jo Y, Stocco DM 2004 Regulation of steroidogenesis and steroidogenic acute regulatory protein in R2C cells by DAX 1 (dosage -sensitive sex reversal, adrenal hypoplasia congenita, critical r egion on the X chromosome, gene 1). Endocrinology 145:56295637

PAGE 148

148 BIOGRAPHICAL SKETCH Melinda S. Prucha was born in the greater metropolitan area of Detroit, Michigan, USA. Her zest for science commenced early in her childhoo d as she attended grade sch ool and quickly excelled in the physical sciences throughout middle and high school Melinda graduated high school in the top 3% of her class in 1998, receiving departmental awards in both environmen tal sciences and in orchestra. Melinda although presented with an opportunity to pursue musical studies, decided to pursue a career in the natural sciences In order to fund her undergraduate education, she worked full time as an assistant chief financial officer for a small business for several years while pursuing her Bachelor of Science degree in Environmental Health. I n her final year, she performed duties as both a teaching and research assistant, and she graduated with honors from Oakland University in Rochester Hills, Michigan in May 2003. Immediatel y following her undergraduate degree, Melinda decided to continue her education and she moved to Gainesville, Florida where she began graduate studies in the Interdisciniplinary Program in Biomedical Sciences in the College of Medicine at the University of Florida. She pursued course studies in the Department of Pharmacology and Therapeutics, and added on an additional specialization in Toxicology when she joined the laboratory of Dr. Nancy D. Denslow, where she completed her doctoral research. Working wi th Dr. Denslow, Melinda has furthered the understanding of the molecular signaling pathways involved in regulating the expression of key genes involved in steroid hormone biosynthesis in both fish and mammals. Melinda received her Ph.D. in Biomedical Scie nces from University of Florida in August 2009 and will be continuing her training as a post doctoral fellow under the direction of Dr. Nasser Chegini in the Department of Obstetrics and Gynecology in the College of Me dicine at University of Florida