<%BANNER%>

Role of Asymmetric Dimethylarginine(ADMA)in the Regulation of Endothelial Derived Nitric Oxide

Permanent Link: http://ufdc.ufl.edu/UFE0024902/00001

Material Information

Title: Role of Asymmetric Dimethylarginine(ADMA)in the Regulation of Endothelial Derived Nitric Oxide
Physical Description: 1 online resource (202 p.)
Language: english
Creator: Pope, Arthur
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: adma, ddah, endothelial, nitric, oxide, superoxide, tetrahydrobiopterin
Physiology and Pharmacology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: The endogenous NOS inhibitor Asymmetric Dimethylarginine (ADMA) has been demonstrated to be an independent cardiovascular disease risk factor. However, the mechanisms regarding how ADMA levels are modulated and what role they play in disease progression are not clearly understood. Dimethylarginine dimethylaminohydrolase (DDAH) is the enzyme responsible for ADMA metabolism however, how it is regulate in the disease state is unclear. Therefore, we hypothesize that decreased DDAH expression/activity may be involved in the vascular pathophysiology observed in a variety of cardiovascular disease. Here we present findings that each isoform of the DDAH enzyme regulates endothelial NO production. Over-expression of either DDAH-1 or DDAH-2 was found to increase endothelial NO production. Gene silencing of either isoform attenuated endothelial DDAH activity. Interestingly, dual silencing of the enzymes did not result in an additive effect on DDAH activity suggesting the existence of an alternative pathway of methylarginine metabolism. Furthermore, gene silencing of either isoform results in decreased endothelial NO production. Subsequent studies aimed at investigating mechanisms of DDAH regulation in a disease state demonstrated that cells exposed to 4-HNE exhibit decreased endothelial NO production and these effects were mediated through increased ADMA levels and decreased DDAH activity. In addition to methylarginine regulation of NO, it has been hypothesized the ADMA may be involved in the phenomenon of eNOS uncoupling wherein the enzyme switches form an NO producing enzyme to an superoxide producing enzyme. Investigations into this pathway revealed that methylarginines caused a dose dependent increase in eNOS derived superoxide. Interestingly, L-arginine also increased eNOS derived superoxide in a dose dependent manner. In addition to ADMA accumulation, oxidative stress has also been associated with endothelial dysfunction. The presence of reactive oxygen and nitrogen species decreased the activity of the salvage pathway enzyme, dihydrofolate reductase (DHFR) which regulates the conversion of H2B to H4B Physiological levels of OONO- increases enzyme activity. Furthermore, using the diabetic db/db mouse model of diabetes it was observed that DHFR activity was decreased and that these mice had impaired vascular function. These findings demonstrate that the DDAH-ADMA pathway and oxidative stress plays a critical role in the development of endothelial dysfunction.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Arthur Pope.
Thesis: Thesis (Ph.D.)--University of Florida, 2009.
Local: Adviser: Cardounel, Arturo J.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0024902:00001

Permanent Link: http://ufdc.ufl.edu/UFE0024902/00001

Material Information

Title: Role of Asymmetric Dimethylarginine(ADMA)in the Regulation of Endothelial Derived Nitric Oxide
Physical Description: 1 online resource (202 p.)
Language: english
Creator: Pope, Arthur
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: adma, ddah, endothelial, nitric, oxide, superoxide, tetrahydrobiopterin
Physiology and Pharmacology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: The endogenous NOS inhibitor Asymmetric Dimethylarginine (ADMA) has been demonstrated to be an independent cardiovascular disease risk factor. However, the mechanisms regarding how ADMA levels are modulated and what role they play in disease progression are not clearly understood. Dimethylarginine dimethylaminohydrolase (DDAH) is the enzyme responsible for ADMA metabolism however, how it is regulate in the disease state is unclear. Therefore, we hypothesize that decreased DDAH expression/activity may be involved in the vascular pathophysiology observed in a variety of cardiovascular disease. Here we present findings that each isoform of the DDAH enzyme regulates endothelial NO production. Over-expression of either DDAH-1 or DDAH-2 was found to increase endothelial NO production. Gene silencing of either isoform attenuated endothelial DDAH activity. Interestingly, dual silencing of the enzymes did not result in an additive effect on DDAH activity suggesting the existence of an alternative pathway of methylarginine metabolism. Furthermore, gene silencing of either isoform results in decreased endothelial NO production. Subsequent studies aimed at investigating mechanisms of DDAH regulation in a disease state demonstrated that cells exposed to 4-HNE exhibit decreased endothelial NO production and these effects were mediated through increased ADMA levels and decreased DDAH activity. In addition to methylarginine regulation of NO, it has been hypothesized the ADMA may be involved in the phenomenon of eNOS uncoupling wherein the enzyme switches form an NO producing enzyme to an superoxide producing enzyme. Investigations into this pathway revealed that methylarginines caused a dose dependent increase in eNOS derived superoxide. Interestingly, L-arginine also increased eNOS derived superoxide in a dose dependent manner. In addition to ADMA accumulation, oxidative stress has also been associated with endothelial dysfunction. The presence of reactive oxygen and nitrogen species decreased the activity of the salvage pathway enzyme, dihydrofolate reductase (DHFR) which regulates the conversion of H2B to H4B Physiological levels of OONO- increases enzyme activity. Furthermore, using the diabetic db/db mouse model of diabetes it was observed that DHFR activity was decreased and that these mice had impaired vascular function. These findings demonstrate that the DDAH-ADMA pathway and oxidative stress plays a critical role in the development of endothelial dysfunction.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Arthur Pope.
Thesis: Thesis (Ph.D.)--University of Florida, 2009.
Local: Adviser: Cardounel, Arturo J.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0024902:00001


This item has the following downloads:


Full Text





ROLE OF ASYMMETRIC DIMETHYLARGININE (ADMA) IN THE REGULATION OF
ENDOTHELIAL DERIVED NITRIC OXIDE























By

ARTHUR JAMES JARAE POPE


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA
2009




































2009 Arthur James Jarae Pope


































To Mom, Dad, Damecko, and Dannae thank you all for your love and support









ACKNOWLEDGMENTS

First and foremost, I would like to thank my mentor Dr. AJ Cardounel, without whom the

work presented in this dissertation would not be possible. I thank your patience and guidance

throughout these past four years. Your enthusiasm about science and our work really motivated

me to work harder and to become the scientist that I am today. I am not only grateful for the

mentorship you have provided me but, also the friendship. I could not have asked for a better

mentor!

I would also like to thank my committee: Dr. Chris Baylis, Dr. Tom Clanton and Dr. Peter

Sayeski. Though I have only known you all for a short period of time, your guidance has really

help to shape the last two years of my graduate experience and I thank you for that.

Thank you to all the members of the Cardounel lab, Scott, Kanchana, Patrick and our

former postdoc Dr. Jorge Guzman. I would also like to thank Dr. Larry Druhan at Ohio State for

his technical support.

I would like to also thank my friends and family for their love and continuous support.

Shante, Kenny, Nick, Natasha, Wilton, Amanda, David, Levy, Inimary thank you all for your

listening ear and support during my time in graduate school. I could not have done it without

you all. To my brothers Dannae and Damecko, thanks for supporting your little brother

throughout all these years of schooling. I promise I am done! To Aunt Diane thank you for all

your support throughout the years. Last but certainly not least, thank you Mom and Dad for

allowing me to purse my passion no matter where it has taken me.










TABLE OF CONTENTS

page

A C K N O W L E D G M E N T S ..............................................................................................................4

LIST OF TABLES.............. .................. ........ .................... ........8

LIST OF FIGURES ................................... ............ .. .............................9

ABSTRACT ........... ................................ ...... ................ ............... 1

CHAPTER

1 IN TRODU CTION ................... .......................................... .. ........ ..............13

R rationale for Study ................... ............................................. .. .............18

2 REVIEW OF LITERATURE ................................................................. .. ......... 20

Nitric Oxide .............................................. ..........20
N itric Oxide Synthase Enzym e .............................................. ............... 21
M editors of N O R release ...................................................................................................22
Actions of Nitric Oxide ........................ ............ ...... ...............22
Regulation of NOS ...................... ............................... 25
A rg in in e ...................................... ................................................ 2 5
A rginine T transportation .............................................................26
Arginine M etabolism .................. ............................. ...... .. .......................... 27
Arginase ................................... ....... ....... ... .. ........ ........ 27
Arginine:Glycine Amindotransferase and Arginine Decarboxylase.............................28
NOS Cofactor and Protein-Protein Interactions. .............................................. .....29
T etrahydrobipterin(H 4B ) .............................................................29
H sp90 .......... ..... .... ......... .................................32
eN O S-H sp90.................................................................. 32
Calm odulin ...................................................... ........ 33
Caveolae ..........................................................33
Caveolin-1 and eN O S.................. ............ .............. 33
eNOS Posttranslational Modifcations..........................................34
Myristoylation and Palmitoylation ............... ..........................34
eNOS Phosphorylation ......................... .................35
Ser 1177/1179 ....................................... ..........35
Thr 495/497 ..................................................... .........36
Ser 633/635 ........................................ ..........36
Ser 615/617 ....................................... ...........37
Ser 114/116 ....................................... ...........37
Pathophysiology ........................ ... .................................. 38
Pathways Leading to Oxidative Stress Generation............... .....................................39
NADPH Oxidase ................................................39










eN O S U ncoupling ...................................................... .40
DDAH ADMA Pathway............... ................. ..................42
PRM T .......................... .............. ................. 43
M ethylarginine B iochem istry ..................................................................................... 44
Metabolism of Methylarginines ........................................47
In Vivo and In Vitro Significance of DDAH ................ ....................... 49
ADMA Independent Mechanisms of DDAH........................................................51
Regulation of DDAH Activity................. ........ ..... ........52
Pathophysiology ................................................... .........53

3 ROLE OF DDAH-1 AND DDAH-2 IN THE REGULATION OF ENDOTHELIAL NO
PRODUCTION...................................... .................. ............... ........58

Introduction................... ...................................................... .........58
M materials and M methods .................. ........................... 59
Cell Culture ......................... ................................. 59
EPR Spectroscopy and Spin Trapping ................................ ............... 59
HPLC ............................... ..........................60
DDAH-1 and 2 Gene Silencing..... ........... ......... .... ........60
DDAH Activity ........................................ ........61
D D A H O ver-Expression ........................ ........ ... .......... ...............62
Assessment of mRNA Levels Following DDAH Gene Silencing ................................63
eN O S A activity ....................................................... 63
R esults................... ................................................................. ....... ........64
Effects of DDAH 1 and 2 Over- Expression on Endothelial NO Production ..............64
Effects of DDAH-1 and DDAH-2 Over-Expression on ADMA Inhibition................65
Effects of DDAH 1 and 2 Silencing on Endothelial NO Production ..............................65
Effects on DDAH Gene Silencing on Methylarginine Metabolism...........................68
Effects of DDAH 1 and 2 Gene Silencing on eNOS Activity..................68
D discussion ............... ................................................. ......... 69

4 ROLE OF DDAH-1 IN THE 4-HYDROXY-2-NONENAL MEDIATED INHIBTION
OF ENDOTHELIAL NITRIC OXIDE GENERATION............ ................... 87

Introduction........... .. ...... ......... ... ................... .87
M materials and M methods .................. ........................... 89
Materials ........... ............. ...... ..........................89
Cell Culture ......................... ................................. 89
Epr Spectroscopy and Spin Trapping ......... .............................. 89
Measurement of Endothelial Cell ADMA and L-Arg Levels .......................................90
DDAH-1 and eNOS Expression................ ..... ............. ........90
DDAH Activity ......................................................90
R esults........................ .. .. ........... ... ............91
Effects of 4-HNE on Endothelial Cell NO Production .......................91
Effect of 4-HNE on eNOS Expression.................. ........................ 92
Restoring NO Generation from Cells ..................................92
Effects of 4-HNE on Superoxide Production and Nitrotyrosine Formation ...................93


6










Effects of 4-HNE on Cellular ADMA Levels ............... ...............................94
Effect of 4-HNE on DDAH Expression and Activity .........................94
Effects of DDAH Over-Expression on Endothelial NO Production Following
Exposure to 4-HNE ........... ..... ........ ..........95
Discussion ...................................... ...... ...........97

5 REGULATION OF ENDOTHELIAL DERVIED SUPEROXIDE BY THE
M ETHYLARGININES .................................................................. 116

Introduction................ ............................................. .............. ........ 116
M materials and M ethods .................. ........... .... .. ... .... ................................ .. ............. ................ .. 118
Expression and Purification of the Human Full Length eNOS and eNOS Oxygenase
D om ain (eN O S ,,ox). ................... ..1..8..........................................
EPR Spectroscopy and Spin Trapping ........................................................................119
NADPH Consumption by eNOS ............................................................... .. ..........120
UV/Visible Spectroscopy .....................................120
Resu ts ..............Spectroscop........ ... ... .... ................................................ ...............120
Effects of Methylarginines on 02'O Production from H4B Free eNOS ..........................120
Effects of methylarginines and L-Arginine on NADPH Consumption from H4B-
F ree eN O S ................................. ........................ 122
Effects of Methylarginines on the Heme of eNOSox............. ..... ...............123
Discussion ............................ ........... ................. ........ 123

6 REGULATION OF DIHYDROFOLATE REDUCTASE IN THE DIABETIC
ENDOTHELIUM ................................................... .............138

Introduction................ ............................................. .............. ........ 138
M materials an d M eth o d s. ................................................................................................... 14 0
M materials ......................................................... ............... .........140
D H FR A activity A ssay.................................................... 140
Tissue DHFR Activity ................. ......... ..................140
HPLC Techniques ......................................................141
Vascular Reactivity .......................................................... 141
EPR Spin Trapping Studies ..............................................................................141
Resu tszym e Kinetics............. .. .... ............................................................142
Enzyme Kinetics of DHFR........... ..... ......... ....... ........142
Effect of Oxidants on DHFR Activity..................................142
Effects of the Diabetic State on In-Vivo DHFR Activity.................................143
Effects of the Diabetic State on Vascular Reactivity ....................................................144
Effects of the Diabetic State on eNOS Derived 02' Production in the Aorta.............144
Discussion ............... .................................................. ........ 144

7 D ISCU SSIO N ............... ...................................................................... 158

L IST O F R EFR EN C E S ...............................................................174

BIO GR A PH ICA L SK ETCH ...............................................................202









LIST OF TABLES


Table page


3-1 L-N M M A M etabolism .............................................................86

5-1 Effects of Methylarginines and L-arg on NADPH consumption from H4B-free
eN O S (100 nM ) ................................................... 137









LIST OF FIGURES


Figure page

3-1 D D A H over-expression. ..............................................................75

3-2 Effects of adDDAH-1 over expression on endothelial cell NO production. ................76

3-3 Effects of adDDAH-2 over expression on endothelial cell NO production. ................77

3-4 Effects of DDAH-1 and DDAH-2 over-expression on ADMA mediated inhibtion of
endothelial NO production ...................................................................... ....... ................... 78

3-5 Effects of DDAH gene silencing on DDAH mRNA expression. .............................79

3-6 Effects of DDAH gene silencing on endothelial cell DDAH activity .............................80

3-7 Effects of DDAH-1 gene silencing on endothelial cell NO production. ........................81

3-8 Effects of DDAH-2 gene silencing on endothelial cell NO production. ...........................82

3-9 Effects of DDAH-1 and DDAH-2 gene silencing on endothelial cell NO production......83

3-10 Effects of ADMA on endothelial cell NO production.................................................84

3-11 Effects of DDAH gene silencing on endothelial cell eNOS activity.............................85

4-1 Effects of 4-HNE on NO production. .................................. ..... ............... 103

4-2 Effects of Hexanol on NO production. ................ ............... 104

4-3 4-HNE effects on eNOS expression and phosphorylation....................................105

4-4 Effects of 4-HNE on Serl 179 phophorylation following calcium ionphore (5 [iM,
A 23 187) stim ulation. ................... ............... ............... ............................ ........ ....... 105

4-5 Effects of L-arginine and GSH supplementation on NO generation............................ 106

4-6 Effects on 4-HNE on the levels of ADMA in BAECs.................................................107

4-7 4-HNE effects on DDAH expression.................... ............ ..................107

4-8 4-HNE effects on DDAH activity.......................... ...........108

4-9 Effects of DDAH over-expression on endothelial cell NO production following 4-
HNE challenge.. ........................................................ 109

4-10 Effects of 4-HNE on endothelial cell DDAH activity. .... ......... .... ...............110









4-11 Effects 4-HNE on nitrotyrsoine formation in BAECs. ............................111

4-12 Effects 4-HNE on ROS formation from BAECs. ......... .....................112

4-13 Effects of Hexanol on DDAH-1 activity. .......................................... 113

4-14 MS/MS spectra of of a tryptic peptide generating the sequence b/y-ion series from
the in-gel digest of the hDDAH-1 reacted with 4-HNE. ................................ ..............114

4-15 Adenoviral transduction of hDDAH-1 in BAECs. ............... .................115

5-1 Inhibition ofNOS-derived 02.- from H4B depleted eNOS. .....................130

5-2 Effects of ADM A on eNOS-derived 02 ...................................................... ............... 131

5-3 Effects of L-NMM A on eNOS-derived 02 ......................................... .........................132

5-4 Effects of L-arg on eN O S-derived 02 ...................................................................... 133

5-5 Effects of ADMA on 2O production from H4B-depleted NOS in the presence of L-
arg. ............................................................................ 134

5-6 Effects of NMMA on NOS-derived 02'_ in the presence of L-arg................................135

5-7 M ethylarginines alter the eNOS-bound heme............................................................... 136

6-1 H4B biosynthesis pathway. .............. ................. .....................149

6-2 DH FR enzym e kinetics. .............................................................150

6-3 Effects of Nitric Oxide on hDHFR activity. ........................................151

6-4 Effects of H202 on hDHFR activity............. ... .................152

6-5 Effect of 02 'on DHFR activity. ........................................ ................ 153

6-6 Effects of OONO- on hDHFR activity. .......................................154

6-7 Effects of the diabetic condition on in-vivo DHFR activity.............. ................... .....155

6-8 Effects of the diabetic state on vascular reactivity...........................................................156

6-9 Effects of the diabetic condition on eNOS derived 02'_ in the aorta.................. ...........157









Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

ROLE OF ADMA IN THE REGULATION OF ENDOTHELIAL DERIVED NITRIC OXIDE

By

Arthur James Jarae Pope

August 2009

Chair: Arturo Cardounel
Major: Medical Sciences-Physiology and Pharmacology


The endogenous NOS inhibitor Asymmetric Dimethylarginine (ADMA) has been

demonstrated to be an independent cardiovascular disease risk factor. However, the mechanisms

regarding how ADMA levels are modulated and what role they play in disease progression are

not clearly understood. Dimethylarginine dimethylaminohydrolase (DDAH) is the enzyme

responsible for ADMA metabolism however, how it is regulate in the disease state is unclear.

Therefore, we hypothesize that decreased DDAH expression/activity may be involved in the

vascular pathophysiology observed in a variety of cardiovascular disease.

Here we present findings that each isoform of the DDAH enzyme regulates endothelial NO

production. Over-expression of either DDAH-1 or DDAH-2 was found to increase endothelial

NO production. Gene silencing of either isoform attenuated endothelial DDAH activity.

Interestingly, dual silencing of the enzymes did not result in an additive effect on DDAH activity

suggesting the existence of an alternative pathway of methylarginine metabolism. Furthermore,

gene silencing of either isoform results in decreased endothelial NO production.

Subsequent studies aimed at investigating mechanisms of DDAH regulation in a disease

state demonstrated that cells exposed to 4-HNE exhibit decreased endothelial NO production and

these effects were mediated through increased ADMA levels and decreased DDAH activity. In









addition to methylarginine regulation of NO, it has been hypothesized the ADMA may be

involved in the phenomenon of eNOS uncoupling wherein the enzyme switches form an NO

producing enzyme to an superoxide producing enzyme. Investigations into this pathway revealed

that methylarginines caused a dose dependent increase in eNOS derived superoxide.

Interestingly, L-arginine also increased eNOS derived superoxide in a dose dependent manner.

In addition to ADMA accumulation, oxidative stress has also been associated with

endothelial dysfunction. The presence of reactive oxygen and nitrogen species decreased the

activity of the salvage pathway enzyme, dihydrofolate reductase (DHFR) which regulates the

conversion of H2B to H4B Physiological levels of OONO- increases enzyme activity.

Furthermore, using the diabetic db/db mouse model of diabetes it was observed that DHFR

activity was decreased and that these mice had impaired vascular function.

These findings demonstrate that the DDAH-ADMA pathway and oxidative stress plays a

critical role in the development of endothelial dysfunction.









CHAPTER 1
INTRODUCTION

In the United States it is estimated that 80,000,000 or 1 in 3 Americans have

cardiovascular disease [1]. Data from the Framingham Heart Study demonstrates that 2 out of 3

men and 1 in 2 women will have cardiovascular disease in their lifetime [1]. Of those who have

cardiovascular disease, 73,600,000 have high blood pressure, which is defined as having a

systolic pressure >140 mm Hg or a diastolic pressure > 90 mm Hg. In 2005, cardiovascular

disease was the underlying cause for 35.3% of all deaths in the United States [1]. The number of

deaths due to cardiovascular disease surpasses the total number of deaths due to cancer, diabetes,

and accidents combined. Of those who die as a result of cardiovascular disease, 52% died as a

result of coronary heart disease [1]. However, recent studies have shown that from the years

1980-2000, there was a substantial decrease in the number of deaths due to cardiovascular

disease. Furthermore, almost half of the reduction in deaths can be attributed to advances in the

treatment of cardiovascular disease, while the other half is due to maintaining a healthy lifestyle

[1].

Despite the drop in deaths due to heart disease, it is still the number one cause of death in

the United States, and providing care to these patients results in an enormous cost to the health

care system. In 2005, 1 out of every 6 hospital stays was related to coronary heart disease and

the total cost of hospital care was 71.2 billion dollars. The projected indirect and direct cost for

the treatment of cardiovascular disease is expected to rise to 475.3 billion dollars in 2009 [1].

The most prevalent form of heart disease is coronary artery disease (CAD). CAD is

caused by the build up of plaque in the coronary artery, which leads to lumen narrowing and a

decreased supply of oxygen rich blood to the heart. This pathological process of arterial

narrowing and impaired blood flow is termed atherosclerosis and is the most common cause of









coronary heart disease. Coronary heart disease, if untreated, can eventually lead to a heart attack

and subsequently heart failure [1]. CAD is the result of various risk factors, including genetics,

high blood pressure, smoking and diabetes.

Familial hypercholesterolemia (FH) is an inherited disorder that is caused by a deficiency

in the clearance of the Low Density Lipoprotein (LDL). Hypercholesterolemia is defined as

having a total serum cholesterol level > 240 mg/dl. Initially, it was believed that familial

hypercholesterolemia was caused by the increased production of cholesterol. However, this

proved not to be the cause with the discovery of the LDL receptor (LDLR) by Brown and

Goldstein in 1973 [2, 3]. Their studies revealed that patients who suffered from FH had

dysfunctional LDLRs, therefore, leading to the increased accumulation of cholesterol [2, 3]. The

risk of cardiac events in this population has been greatly reduced with the development of stations.

Additional major risk factors taken into account to determine risk for CAD included

diabetes, smoking, and high blood pressure. The Framingham Heart Study defines individuals

having a blood pressure of <120/80 mm Hg, total serum cholesterol levels <180 mg/dL, non

diabetics and non smokers as those who are least likely to develop CAD [4]. High risk

individuals are those who have total serum cholesterol levels that are > 240 mg/dl, hypertension,

diabetes and smokers. The risk factors for developing CAD increases with age, however if a

healthy lifestyle is maintained the risk remains low. At 50 years of age men have a 5.2% chance

and women have a 8.2% chance of developing CAD if they maintain a healthy lifestyle [4].

However, having two or more of the associated risk factors (i.e. hypertension, diabetes)

increases the risk of developing CAD to 68.9% for men and to 50% for women [4]. Although

increased serum cholesterol levels and the associated risk factors outlined by the Framingham









Heart Study are known to increase the risk of coronary artery disease, it is not just a disease of

high cholesterol.

Atherogenesis, once considered mainly a disease of cholesterol storage, is now understood

as a complex disease of many interacting risk factors which include cells of the artery wall, the

blood and the molecular messengers exchanged between the two. It is now becoming clear that

inflammation plays a critical role in atherogenesis [5-9]. It also plays a key role in the local,

myocardial and systemic complications associated with atherosclerosis [6, 8, 10].

Dyslipidemia, vasoconstrictive hormones associated with hypertension, and

proinflammatory cytokines derived from excess adipose tissue, enhance the expression of

adhesion molecules that promote the sticking of blood leukocytes to the inner surface of the

vascular wall [6, 8, 10]. Once inside the intima, blood leukocytes activate the smooth muscle

cells (SMCs) resulting in their migration to the intima. The SMCs continue to proliferate leading

to the creation of a complex extracellular matrix [7, 11-15]. Proteoglycans of the extracellular

matrix bind to lipoproteins extending their stay within the intima therefore increasing their

chances of becoming oxidized. LDLs undergo oxidative alteration leading to the formation of

oxLDL in the arterial wall. Other cellular lipids also undergo redox modifications, which result

in the formation of lipid hydroperoxides. These oxidatively modified lipids have been

demonstrated to play an important role in the pathogenesis of atherosclerosis [16-21]. Among

the mechanisms proposed, Nitric Oxide Synthase (NOS) dysregulation and decreased Nitric

Oxide (NO) bioavailability have been implicated as a central mechanism in vascular endothelial

dysfunction associated with atherosclerosis.

NO is a potent vasodilator and critical effector molecule that helps the endothelium

maintain vascular homeostasis through its anti-proliferative and anti-thrombotic effects. NO is









derived from the oxidation of L-Arginine (L-Arg) and catalyzed by the constitutively expressed

enzyme endothelial nitric oxide synthase (eNOS). NO freely diffuses across the vascular

endothelium to the vascular smooth muscle cell layer where it activates guanylate cyclase

leading to smooth muscle cell relaxation [22, 23]. In addition to its effects on vascular tone, NO

also helps to maintain the anti-atherogenic properties of the vascular wall. NO, in association

with other cell signaling molecules promotes smooth muscle cell quiescence counteracting pro-

proliferative molecules specifically those involved with athero-proliferative disorders [24-29].

Therefore, loss of NO bioavailability is an early symptom of endothelial dysfunction and is

implicated as the pathogenic trigger leading to atherosclerosis.

Among the proposed mechanisms that lead to decrease NO bioavailability, is the

accumulation of the endogenous NOS inhibitors asymmetric dimethylarginine (ADMA) and NG-

monomethyl-L-arginine (L-NMMA) [30-34]. ADMA and L-NMMA are both competitive

inhibitors of eNOS. ADMA and L-NMMA are derived from the proteolysis of methylated

arginine residues on various proteins. Methylation is carried out by a group of enzymes referred

to as protein-arginine methyl transferase's (PRMT's). Upon proteolysis of methylated proteins,

free methylarginines are released where they can then inhibit eNOS activity. The free

methylarginines are subsequently hydrolyzed by Dimethylarginine Dimethylaminohydrolase

(DDAH) to citrulline, and mono and dimethylarginine [35-37]. Recent studies from our lab and

others have shown that the methylarginines ADMA and L-NMMA play a critical role in vascular

function and that the dysregulation of the enzymes responsible for metabolizing the

methylarginines play an essential role in endothelial dysfunction [38].

In support of this hypothesis several studies from both human and animal models of

atherosclerosis have demonstrated that L-Arg enhances the anti-atherogenic properties of the









endothelium by increasing NO bioavailability. Oral L-Arg supplementation has been

demonstrated to restore endothelium dependent vasorelaxation in both hyperlipidemic animals

and humans [30, 34, 35, 39, 40]. Additionally, oral L-Arg has also been shown to prevent the

development of atherosclerosis in LDL receptor knockout mice (LDLR) [30]. The beneficial

effects observed following L-Arg supplementation could be explained by the fact there is

increased substrate for the NOS enzyme. However, intracellular levels of L-Arg are 50 times

above the Km value for the enzyme therefore, increased NO generation would not be expected as

a result of L-Arg supplementation [41]. It has been hypothesized that basal levels of

methylarginines can inhibit NOS activity and L-Arg supplementation is able to improve vascular

function simply by overcoming the inhibitory effects of the methylarginines [42].

Another potential mechanism for reduced NO bioavailability is through direct scavenging

of NO by reactive oxygen species (ROS) [43]. Growing evidence has demonstrated that

oxidative stress is associated with the pathogenesis of diseases including hypercholesterolemia,

diabetes and hypertension [44-47]. In healthy tissues, superoxide anion (02f) is dismutated into

hydrogen peroxide (H202) and oxygen by the enzyme superoxide dismutase (SOD). The

enzyme, Catalase further reduces H202 to water and oxygen [48]. Increases in oxidative stress

seen in the pathological states overwhelm the antioxidant defense systems resulting in an

oxidative environment. Failure of the antioxidant system can also lead to the generation of

peroxynitrite (OONO-), which is a potent oxidant known to cause damage to proteins and tissues

[43]. In this regard, a human variant of ecSOD has been observed in 5% of the population. This

ecSOD variant is associated with decreased SOD activity, increased oxidative stress and

increased inactivation of NO [49].









Alternatively it has been proposed that increased oxidative stress results in the uncoupling

of the NOS enzyme turning it into a superoxide generating enzyme. In vitro studies have

demonstrated that eNOS depleted of its essential cofactor, tetrahydrobiopterin (H4B), readily

makes superoxide [50, 51]. Futhermore, it is also known that H4B is highly redox sensitive and

can be readily oxidized to its inactive form dihydrobiopterin (H2B). H4B is produced via two

pathways in the endothelial cell, the de novo synthesis pathway and the salvage pathway. De

novo biosynthesis of H4B is a magnesium, zinc and NADPH dependent pathway. The first step

requires the conversion of GTP to 7,8-dyhydroneopterin triphosphate. This reaction is catalyzed

by the enzyme GTP cyclohydrolase I (GTPCH), and it is the rate limiting step in H4B

biosynthesis [52]. Following the GTPCH enzyme reaction pyruvoyl tetrahydropterin synthase

(PTPS) converts 7,8 dihydroneopterin triphosphate into 6-pryuvoyl-5,6,7,8-tetrahydropterin.

Alternatively, the salvage pathway enzyme Dihydrofolate reductase (DHFR) is a NADPH

dependent enzyme that catalyzes the conversion of H2B to H4B.

NOS uncoupling has also been demonstrated to occur in both animal and human models of

diseases associated with oxidative stress. In this regard, oral supplementation of H4B was

demonstrated to improve endothelial dependent vascular function in the apoE KO mouse model

of hypercholesterolemia. In addition to improved vascular function, a reduction in vascular

superoxide production was also observed following oral H4B supplementation [53]. Moreover,

endothelial function has been shown to improve in patients who are chronic smokers, type II

diabetics and those with CAD following H4B supplementation [54, 55].

Rationale for Study

It is clear that the mechanisms that lead to vascular endothelial dysfunction are quite

complicated. Though the evidence laid out in the introduction points to two possibilities. First,

increasing levels of methylarginines have been demonstrated to be an independent risk factor in









the development of cardiovascular disease. However, how methylarginines are modulated and

what role they play in disease progression is poorly understood. Additionally, how DDAH is

regulated and what role it plays in endothelial dysfunction needs to be explored further. Because

NO possess both anti-proliferative and anti-atherogenic properties, methylarginine accumulation

in response to decreased DDAH expression and activity has been proposed to be involved in the

vascular pathophysiology observed in a variety of cardiovascular disease.

In addition to the accumulation of ADMA, the altered redox status of the endothelium has

also been implicated as a central mechanism in endothelial dysfunction associated with

cardiovascular disease. Previous studies have demonstrated that in diseases such as diabetes

there is an accumulation of H2B, the inactive oxidized form of the NOS cofactor H4B. This

increase has also been associated with increased superoxide production and vascular endothelial

dysfunction. However, it is unclear as to what leads to this accumulation, because DHFR should

reduce H2B back to H4B. Therefore, I hypothesized that DHFR activity may decrease in

oxidative stress situations. While it may appear that ADMA and oxidative stress are unrelated, it

has been suggested that ADMA also plays a role in NOS uncoupling.

Therefore to better establish the role of ADMA in the regulation of endothelial derived NO

and vascular endothelial dysfunction, the following aims will be carried out:

Aim 1: To determine the role of DDAH in the regulation endothelial derived NO

Aim 2: To determine the effects of the methylarginines on eNOS derived superoxide.

Aim 3: To determine the effects of oxidative stress on DHFR activity in vitro and in vivo.









CHAPTER 2
REVIEW OF LITERATURE

Endothelial cells were once considered to be a population of elongated cells that were

homogenous in nature and that their main function was to serve as a barrier between the vascular

space and interstitium. Florey demonstrated in the late 60's that the endothelium was a

permeability barrier and served a much bigger role than previous thought [56]. Subsequently,

intense research began to determine the role endothelial cells and their effects on vascular

function. Furchgott and Zawadzi were the first to describe that the endothelial layer was

necessary for acetylcholine (Ach) mediated vascular relaxation in rabbit aortic rings. Their

studies demonstrated that when the endothelial layer was removed, the vessel lost its ability to

relax in response to Ach and in fact it resulted in overt vasoconstriction [57]. Moncada, and

Ignarro, independently established that the effector previously described by Furchgott and

Zawadzi as endothelial derived relaxing factor (EDRF), was in fact NO [58, 59]. A year later, L-

Arg was discovered to be the substrate from which NO was synthesized [60]. Since then it has

been established that NO is one of the most important regulators of vascular homeostasis and

that decreased bioavailability of NO is involved in the endothelial dysfunction observed in

cardiovascular disease.

Nitric Oxide

Endothelial derived Nitric Oxide is synthesized from the oxidation of the guanidino carbon

of the amino acid L-Arg to NO and L-Cit by the enzyme eNOS [60]. The half life of NO is in

the range of 3-5 seconds in the presence of hemoglobin and can undergo rapid oxidation by

oxyhemoproteins to nitrate (NO3) and nitrite (NO2) [61]. One of the primary functions of NO in

the vasculature is to cause vascular smooth muscle cell (VSMC) relaxation. NO does this by

freely diffusing from the endothelium into the VSMC layer where it binds to the heme group of









the enzyme guanylate cyclase. Guanylate cyclase then catalyzes the reaction of guanosine

triphosphate (GTP) to cyclic guanosine 3'5'-monophosphate (cGMP) and inorganic phosphate

[22, 59]. cGMP then activates protein kinaseG (PKG) resulting in the phosphorylation of

myosin light chain phosphatase. Myosin light chain phosphatase then dephosphorylates myosin

light chain, resulting in vascular smooth muscle cell relaxation. NO in concert with various cell

signaling molecules, has been demonstrated to maintain smooth muscle cell quiescence and as

such, counteracts pro-proliferative agents, specifically those involved in the propagation of

athero-proliferative disorders [25].

Nitric Oxide Synthase Enzyme

There are three isoforms of the NOS enzyme, neuronal nitric oxide synthase (nNOS),

inducible nitric oxide synthase (iNOS) and endothelial nitric oxide synthase (eNOS). The

cofactors required for the full enzymatic activity of all NOS enzymes are the flavin (FAD, FMN)

[28], heme, calmodulin (CaM) and tetrahydrobiopterin (H4B). The enzyme has three domains

which are required for catalytic activity, the reductase domain, CaM binding domain and

oxygenase domain [62-64]. The cofactors FAD and FMN are located within the reductase

domain and in concert with NADPH shuttle electrons to the heme binding site in the oxygenase

domain [62-64]. The oxygenase domain contains the heme, H4B, and arginine binding sites [65,

66]. eNOS and nNOS are activated by calcium-calmodulin binding to the CaM binding domain

of the enzyme. The binding of calcium-calmodulin to NOS activates the transfer of electrons

from the flavin to heme, where oxidation of L-Arg to NO and L-Cit occurs [67, 68].

eNOS, when inactive, is located within invaginations of the plasma membrane called

caveolae [69]. Specifically, it has been demonstrated that eNOS binds to caveolin-1 (CAV-1)

and that this interaction is inhibitory to enzyme activity [69]. Dissociation of the CAV/eNOS

complex occurs when excess amounts of calcium enter the cell and binds to CaM. The resulting









Ca-CaM complex facilitates the dissociation of eNOS from Cav-1 resulting in eNOS activation

and NO production.

Mediators of NO Release

The release of NO from the vascular endothelium can be activated through both Ca2

dependent and independent mechanisms. The binding of substances such as acetylcholine (Ach),

and bradykinin to their respective receptors activate NOS through a Ca2+ dependent mechanism

[70-72]. All of these substances mediate their effects on eNOS activity through phospholipase C

(PLC). Activation of PLC results in increased intracellular Ca2+, which subsequently leads to the

activation of eNOS [70-73].

Alternatively, laminar shear stress generated by blood flowing over the endothelial cell,

which is the main physiological way in which eNOS is activated, and vascular endothelial

growth factor (VEGF) can also stimulate the release of NO in a Ca2+ independent manner. Shear

stress and VEGF activate the phosphatidylinostiol-3-kinase (PI3K) pathway leading to the

activation of AKT consequently resulting in eNOS phosphorylation and activation [74].

Actions of Nitric Oxide

In addition to modulating vascular tone through VSMC relaxation, NO is also important

for maintaining vascular homeostasis through its anti-thrombotic, anti-proliferative and anti-

atherogenic effects. NO and prostaglandin (PGI) act in a synergistic manner through a cGMP

dependent mechanism to prevent platelet aggregation in the endothelium [75]. It has been

demonstrated in both human and animal models that NO is key in preventing platelet

aggregation. In this regard, it was observed in a rat model of common carotid artery thrombosis,

platelet aggregation increased at the site of the thrombosis following administration of the NOS

inhibitor Nitro-L-Arg methyl ester (L-NAME) [76]. Furthermore, studies involving healthy









human volunteers have demonstrated that when the NOS inhibitor L-NMMA is given

intravenously bleeding times are decreased [77].

In addition to its anit-thrombotic effects, NO is known for its anti-atherogenic properties.

Endothelial cell activation is a process that involves the up regulation of transcription of a

number of pro-inflammatory genes, and adhesion molecules such as E and P selection, VCAM-1

and ICAM-1. Addtionally, chemokines such as MCP-1 and IL-1 also increase during endothelial

cell activation. Taken together these adhension molecules and chemokines, increase leukocyte

rolling and adhension to the endothelium. NO through its inhibitory effects on the NF kappa B

signaling pathway prevents leukocyte adhesion to the endothelial cell monolayer. Thus,

resulting in the inhibition of the pro-atherogenic adhesion molecules P-selectin, E-selectin, and

VCAM-1 [78, 79].

The anti-proliferative properties of the endothelium are maintained through a NO mediated

mechanism in concert with various other signaling molecules. Balloon angioplasty is a standard

treatment for coronary artery stenosis caused by CAD. An unfortunate side effect to this

treatment is restenosis, which is caused by VSMC proliferation in response to vascular injury.

Several studies have demonstrated that in both human and animal models of restenosis,

increasing NO reduces neointimal hyperplasia [80-82]. Though it has been known for quite

some time that NO prevents VSMC proliferation, the molecular mechanism of how this occurs

was largely unknown. Recently it has been demonstrated that NO inhibits cell cycle progression

of VSCMs in the S phase by inducing down-regulation of cyclin-dependent kinase 2 (cdk2)

activity and cyclin A gene transcription [83].

In addition to its effects on the endothelium, NO has also emerged as a protein post

translational modifier. Several studies have demonstrated that endogenous and exogenous NO









and its oxidative products NO3 and NO2 can S-nitrosylate proteins at active cysteine residues

altering their function. The exact function of protein S-nitrosylation (SNO) is not clearly

defined, however, it has been suggested that it may be involved in storage and transportation of

the NO molecule [84]. In support of this hypothesis it has been demonstrated that glutathione

and NO interact to form S-nitrosoglutathione (GSNO). GSNO is the most abundant SNO and in-

vitro its decomposition has been shown to generate NO [85].

The formation of SNO is prevented during high antioxidant activity. However, when the

antioxidant defense system is overwhelmed during times of oxidative stress, SNO formation

could be a key in preventing further oxidative damage [86]. SNO has also been shown to

partially mediate the antioxidant effects of stations in the endothelial cell by activating the

antioxidant enzyme thioredoxin [87].

SNO can also modulate the activity of enzymes important for regulating vascular

homeostasis. SNO formation has been demonstrated to occur in the catalytic triad of the DDAH

enzyme at cysteine 249 rendering the enzyme inactive [88]. Argininosuccinate synthetase, the

enzyme responsible for converting citrulline to argininosuccinate can also undergo SNO

formation also inhibiting its activity [89]. In-vitro studies using NO donors demonstrate that

formation of SNO on eNOS targets two cysteine residues at 96 and 101 rendering the enzyme

inactive [90]. Furthermore, it has been demonstrated in Bovine Aortic Endothelial Cells

(BAECs) that SNO formation on eNOS also occurs ,but can be rapidly denitrosylated in the

presence of VEGF [91]. Though eNOS can be self regulated through SNO formation, it is also

regulated by posttranslational modifications, substrate availability and protein-protein

interactions.









Regulation of NOS

The role of eNOS in the regulation of cardiovascular function has been the focus of

extensive research efforts. Results have demonstrated that eNOS enzymatic activity is regulated

by a variety of factors including substrate/inhibitor bioavailability, protein-protein interactions

and post-translation modifications. In addition to being a substrate for NOS, L-Arg is also

metabolized through various pathways in the cell. Arginine is predominantly metabolized by the

enzyme arginase and its activity could play a key role in regulating eNOS. eNOS's interactions

with other proteins and cofactors have been well documented as ways in which eNOS can be

regulated. Hsp90, CaM, H4B all promote increased enzyme activity and NO production. On the

other hand, eNOS's interaction with Cav-1 results in the inhibition of enzyme activity. eNOS is

also regulated by post-translational modifications. Among them, phosphorylation of eNOS is

most extensively studied and has been demonstrated to result in both site specific activation and

inactivation of the enzyme. Finally, the last known post translational modification of eNOS that

occurs is myristoylation and palmitoylation. Myristoylation and plamitoylation of the enzyme

causes it to be targeted to the plasma membrane where it will interact with CAV-1 inhibting

enzymatic activity.

Arginine

The discovery in 1987 that Endothelial Dervied Relaxing Factor (EDRF) was NO was an

important milestone in understanding how vascular tone was regulated. However, it was not

until a year later that the substrate for eNOS was discovered to be the amino acid arginine [86].

Arginine is available from three main sources; dietary intake, endogenous biosynthesis, and

protein turnover. 40% of the arginine that we ingest through our diet is catabolized in the

intestine before reaching the whole body [92]. During fasting states, 85% of our circulating

arginine is derived from protein turn-over and the rest comes from endogenous biosynthesis [93].









The endogenous biosynthesis of arginine in healthy adult humans is enough that it is not an

essential amino acid in the diet. However, in infants, growing children, and adults with kidney

or intestinal dysfunction, endogenous arginine synthesis is not enough. Therefore, it is classified

as a conditionally essential dietary amino acid [94].

Whole body arginine synthesis occurs primarily between the interaction of the small

intestine and the kidney and it is referred to as the gut-kidney axis. Citrulline is produced from

glutamine and proline in the small intestine. The kidney then takes up citrulline where it is

converted to arginine. A large amount of arginine synthesis also takes place in the liver,

however, it is not a significant source as arginine is quickly hydrolyzed to urea and omithine

therefore not contributing a lot to the whole body [95].

Although the primary means of arginine synthesis occurs in the kidney renal tubules, the

majority of cell types have the ability to synthesize arginine. Arginine synthesis from citrulline

occurs via the synergistic action of argininosuccinate synthase and argininosuccinate lyase

(ASL). ASL is the rate-limiting step in the conversion of citrulline to arginine, and it requires

aspartate, citrulline and ATP as cofactors for full activity [95]. The citrulline-NO cycle, much

like the urea cycle, is recognized as an alternative means to produce arginine in the cell.

However, only a fraction of the citrulline produced by eNOS oxidation of arginine is recycled via

the citrulline-NO cycle [93].

Arginine Transportation

Transportation of the cationic amino acid arginine from the plasma into the cell occurs

though the sodium (Na ) independent transport system y+ The y+ transport system family

consists of 3 cationic amino acid transporters (CAT) CAT-1, CAT-2 and CAT-3, each having

distinct tissue distribution. CAT-1 is ubiquitously expressed, CAT-2A expression is found in the

liver, skin and skeletal muscle, and CAT-3 expression is exclusively expressed to the brain. The









amino acids lysine, ornithine and the methylarginines compete with arginine for transport

through the CAT transport system. Although intracellular arginine appears to be the most

important source of eNOS derived NO, there is evidence to support a role for CAT in the

regulation of endothelial NOS [95].

The y+ Km for arginine is within the physiological range of plasma arginine levels and

therefore arginine transportation into the cell maybe an important regulator of NOS. Kinetic

studies have demonstrated that the Km of eNOS for arginine is 2-3 [iM. L-Arg intracellular

levels are in the range of 100 [iM. Therefore, substrate availability should not be a limiting

factor in NO synthesis [96]. However, studies have clearly demonstrated in both animal and

human models that arginine supplementation leads to increases in NO generation. This

phenomenon has been termed the "L-Arg paradox" and has been hypothesized that perhaps

increased uptake through the y+ transport system may play a role in this paradox [93, 95].

Arginine Metabolism

Arginase

Arginase is the key urea cycle enzyme involved in arginine metabolism and is responsible

for the hydrolysis reaction of arginine to urea, and ornithine. There are two isoforms of arginase

that are expressed in the body. The type I isoform is located in the liver and is responsible for

the majority of arginase activity. The type II isoform is predominantly expressed as a

mitochondrial protein and is expressed in a variety of tissues with the highest expression

localized to the kidney, and the lowest in the liver [93].

Recently, several studies have demonstrated that arginase is present in the vasculature and

may serve a regulatory role in vasomotor tone. VSMC only express type I, while endothelial

cells express both isoforms. The aortic smooth muscle cells of rats were observed to have high

arginase activity. Addtionally, transforming growth factor-beta (TGF-P) up-regulates the









expression and activity of arginase I in these cells [97]. Furthermore, it has been demonstrated

that both isoforms are expressed in the aorta, carotid artery and pulmonary artery [98].

Considering that arginine is also a substrate for arginase, it has been suggested that

arginase may compete with NOS for substrate binding. The Km for arginine for eNOS and

arginase are 2 .iM and 1-5 mM respectively. Although, arginine has a higher affinity for NOS,

the activity of the arginase enzyme is 1000 fold greater therefore suggesting that at physiological

levels arginase can compete with NOS for substrate binding [93, 99]. In support of this

hypothesis, it was demonstrated in macrophages that L-Arg supplementation resulted in greater

urea production, than NO generation [100]. It has also been demonstrated in endothelial cells that

over-expression of either arginase isoforms resulted in decreased eNOS derived NO. In

microvascular endothelial cells isolated from Dahl salt sensitive rats, the increase in arginase

activity counteracts NO mediated relaxation, thus suggestive of a vasoconstrictive role [101]. In

contrast, inhibition of arginase activity has been demonstrated to increase endothelial NO

production in cultured endothelial cells [102]. Although arginase is the main pathway in which

arginine is metabolized; there are other pathways in which its metabolism can also occur.

Arginine:Glycine Amindotransferase and Arginine Decarboxylase

The arginine:glycine amidotransferase [103] enzyme catalyzes the first step and it is also

the rate limiting step in creatine formation. In the first step of creatine synthesis arginine donates

an amidino group to glycine to form guanidinoacetate and omithine. The guanidionacetate is

then methylated to form S-Adenosylhomocysteine and creatine. Creatine negatively feedbacks

to inhibit enzyme activity [104]. Ornithine made from this pathway can be used by ornithine

decarboxlyase (ODC) to make polyamines.

Arginine Decarboxylase (ADC) catalyzes the reaction of arginine to carbon dioxide and

agmatine. Agmatine is further metabolized into putrescine and urea. Putrescine is used in the









synthesis of polyamines, which are important for cell division [105]. Although AGAT, ADC,

and ODC do not appear to compete with NOS for substrate binding, they can play a role in

vascular remolding as polyamines are important for cell division and proliferation [74]

NOS Cofactor and Protein-Protein Interactions.

Tetrahydrobipterin(H4B)

First described as an essential cofactor for the aromatic amino acid hydroxylases,

tetrahydrobipterin (H4B) is also a essential cofactor for all three NOS isoforms [106-108]. The

role that H4B plays in NOS regulation has only recently become more defined. Located within

each domain of eNOS is a binding site for a H4B molecule. In vitro studies demonstrate that

H4B stabilizes and donates electrons to the ferrous-dioxygen complex in the oxygenase domain

to help initiate the oxidation of L-Arg [109-111]. Loss of H4B leads to the phenomenon of

"NOS uncoupling" which has been documented in a variety of cardiovascular related diseases

[53, 112, 113]. H4B depletion leads to the dissociation of the ferrous-dioxygen complex and

electrons from the flavin domain are donated to molecular oxygen instead, leading to the

production of superoxide from the oxygenase domain [50, 51].

As previously stated, H4B is an essential cofactor for the aromatic amino acid hydroxylases

and NOS. The synthesis of H4B occurs via three pathways in the cell, the de novo pathway, the

salvage pathway, and recycling pathway. In the recycling pathway, the oxidized product of H4B,

tetrhydrobiopterin-4alpha-carbinolamine, is recycled back to H4B in a two step enzymatic

process. First Pterin-4alpha-carbionolamine dehydratase (PCD) reduces tetrahydrobiopterin-4

alpha-carbinolamine to a quinonoid dihydrobiopterin intermediate which is then further reduced

by dihydropteridine reductase (DHRP) to H4B [114, 115]. The recycling pathway has not been

shown to represent a critical pathway for production of H4B in the endothelial cell, nor does it

have an effect on eNOS activity [110, 116].









De novo biosynthesis of H4B is a magnesium, zinc and NADPH dependent pathway. The

first step requires the conversion of GTP to 7,8-dyhydroneopterin triphosphate. This reaction is

catalyzed by the enzyme GTP cyclohydrolase I (GTPCH), and it is the rate limiting step in H4B

biosynthesis [52]. GTPCH can be regulated at both the gene and protein level. Cytokines such

as Tumor Necrosis Factor Alpha (TNF-a) and Interferon (IFN-y) increase GTPCH activity

resulting in increased H4B levels in human endothelial cells [117-119]. Platelet-derived growth

factor and angiotensin II (Ang II) have both been demonstrated to increase GTPCH activity by

phosphorylation in rat mesangial cells via a phosphokinsae C (PKC) dependent pathway.

However, this mechanism has not been observed in endothelial cells [120]. Over-expression of

GTPCH has been demonstrated to increase the levels of H4B by ten fold in human endothelial

cells [121]. Laminar shear stress also leads to increased GTPCH activity and H4B production in

the vascular endothelium [122]. Additionally, endothelial specific GTPCH transgenic mice have

been observed to have a two fold increase in NO synthesis compared to wild type litter mates

[123].

GTPCH activity is also regulated by its physical interaction with the GTPCH feedback

regulator protein (GFRP). H4B exerts its inhibitory effects on GTPCH by binding to GFRP[124].

Following exposure to H202 GFRP mRNA levels have been observed to decrease resulting in

increased GTPCH activity and H4B levels. However, the decrease in GFRP mRNA expression

has no effect on NO production [125]. What role if any GFRP plays in regulating eNOS is

unknown, however, in a yeast 2-hybrid studies the activator of heat shock protein 90 (Ahal) was

recently shown to be a binding partner in the N-terminal region of the GFRP protein [126]. HSP

90 is a known cofactor of the eNOS enzyme, and it's binding to eNOS results in enhanced

enzyme activity (149). Because GFRP binds in a region that is not required for HSP 90









activation it has been proposed that GFRP binding to Ahal functions to help support local

changes in eNOS derived NO generation [126].

Following the GTPCH enzyme reaction, pyruvoyl tetrahydropterin synthanse (PTPS)

converts 7,8 dihydroneopterin triphosphate into 6-pryuvoyl-5,6,7,8-tetrahydropterin. In

macrophages, induction by cytokines leads to increased GTPCH activity however, the activity of

PTPS remains unchanged [127, 128]. Under these conditions PTPS becomes the rate limiting

enzyme for H4B synthesis, and as a result the 7, 8 dihydroneopterin triphosphate intermediate

accumulates and can become oxidized to neopterin. Neopterin is a stable metabolite that can be

detected in the plasma and used clinically as a marker of inflammation in CAD [129]. The final

step in the de novo synthesis pathway involves the NADPH dependent sepiapterin reductase

enzyme catalyzing the reaction of 6-pyruvoyl-5,6,7,8-tetrahydropterin to the final product of de

novo synthesis, H4B [130]. A mouse SPR KO model has been generated and this model shows

impaired synthesis of H4B. To date however, no studies have been done to gather what effect

this may have on the vascular endothelial function of these mice [131]. The salvage pathway is

another in which H4B can be synthesized. One way in which the salvage pathway works is

through the conversion of exogenous sepiapterin. Sepiapterin is metabolized to H2B by

sepiapterin reductase and subsequently to H4B by the enzyme dihydrofolate redutase (DHFR).

Alternatively, when H4B is oxidized to H2B, DHFR reduces it back to H4B [132]. Recently the

role of endothelial DHFR in BAECs as it relates to H4B and NO bioavailability was investigated.

As a result of DHFR gene silencing, endothelial NO production and H4B levels in endothelial

cell decreased [133]. Additionally, DHFR expression was observed to decrease in BAECs

following exposure to H202. Following Ang II mediated stimulation of NADPH, increases in

eNOS derived 02' were observed. DHFR gene over-expression was able to restore H4B and NO









bioavailability. It also resulted in decreased eNOS derived 02' in ANG II treated cells. Overall,

this study demonstrates the importance of DHFR in maintaining endothelial H4B and NO

bioavailability. Moreover, under conditions of oxidative stress the salvage pathway maybe

critical in maintaining endothelial H4B and NO production [133].

Hsp90

Hsp 90 is a chaperone protein that is among the most abundant proteins in eukaryotic cells

accounting for 1-2 percent of total cytosolic protein [134]. It exists in two isoforms, Hsp90 alpha

and HSP90 beta and it is mostly localized to the cytoplasm with a marginal amount found in the

nucleus [134]. The role of Hsp90 in the cell is to promote protein folding by preventing protein

aggregation of unfolded protein [135, 136]. In addition to promoting protein folding, there is

evidence to suggest that Hsp 90 is important for signal transduction in all cell types. In support

of this, a variety of signaling proteins including v-Src, Raf-1 and MEK have been shown to

interact with Hsp 90 [137-139]

eNOS-Hsp90

eNOS was initially shown to interact with a 90 kDa tyrosine phosphorylated protein

following bradykinin stimulation in BAECs and this promoted translocation of eNOS to the

cytoskeleton [140, 141]. It was later shown that this protein termed endothelial nitric oxide

synthase associated protein (ENAP-1) was in fact HSP90 [140, 141]. Hsp90 is recruited for

binding to eNOS following VEGF, histamine and fluid shear stress stimulation and enhances the

activity of the enzyme [141]. Geldanamycin (GA) is a ansamycin antibiotic that binds to the

ATP binding site of Hsp90 preventing the ATP/ADP cycle that is required for protein-protein

interactions [142]. In support of Hsp 90 being critical to eNOS activity, it has been shown that

GA treatment in isolated mesenteric arteries and rat aortas decreases NO generation [141, 143].

Furthermore, Hsp 90 inhibition by GA has been shown to increase eNOS derived superoxide









production [144]. Recent studies have demonstrated that there is an Hsp90 binding domain

present on eNOS. Site directed mutagenesis of this site yields an eNOS mutant that has a weak

binding affinity to HSP90 and increased generation of 02' [145]. These observations suggest

that Hsp90 binding is not only important for enhancing enzyme activity, but that it can also be

important in modulating the balance between NO and 02-generation from eNOS.

Calmodulin

In addition to HSP 90, calmodulin has been known to have a positive regulatory effect on

eNOS activity [67] and was the first protein known to be involved in eNOS regulation. CaM

binding to its binding motif on eNOS displaces the auto-inhibitory loop on eNOS allowing the

electrons to flow from the reductase domain to the oxygenase domain [146].

Caveolae

Caveolae are small (50-100 nm) cholesterol rich invaginations located on the surface of the

cell membrane. They are found in practically every cell type and are found in copious amounts

in VSMC, endothelial cells and adipocytes. The major structural protein of caveolae is caveolin.

The caveolin family consists of three protein isoforms, Caveolin-1 (Cav-1), Caveolin-2 (Cav-2)

and Caveolin-3 (Cav-3). Cav-1 is expressed in most cell types including adipocytes, endothelial

cells and VSMC [147]. Cav-2 is found in the same cell types as Cav-1. In fact Cav-1, and Cav-2

co-localization is required in order for Cav-2 to make caveolae [147, 148]. Furthermore, without

Cav-1, Cav-2 is localized to the Golgi complex where it is degraded [148]. Cav-3 expression is

limited to muscle tissue and it is found in skeletal, cardiac and smooth muscle cells [149].

Caveolin-1 and eNOS

As previously stated, abundant amounts of Cav-1 are present in the endothelial cell.

Numerous studies have demonstrated in vivo and in vitro that Cav-1 is a negative regulator of

eNOS activity [150, 151]. eNOS contains a consensus binding sequence for Cav-1 at amino









acids 350-358. In this regard, studies done using a scaffolding peptide corresponding to the

consensus sequence have been shown to cause inhibition of enzyme activity [151]. Additionally,

it has been demonstrated in cellular studies that over-expression of Cav-1 results in reduced

eNOS activity [150]. In further support of its inhibitory effects, in vivo studies using the Cav-1

scaffolding peptide was demonstrated to inhibit endothelial dependent vasorelaxation following

Ach stimulation [152]. In contrast, site directed mutagenesis of the Cav-1 consensus sequence

inhibits Cav-1 binding and suppression of eNOS activity [151]. Moreover, Cav-1 KO mice

exhibit enhanced endothelial dependent vasodilatation in response to acetylcholine stimulation

[153, 154].

The inhibitory effects of Cav-1 on eNOS activity can be overcome exogenously with the

addition of calmodulin, suggesting a reciprocal relationship between the two proteins [150, 155-

157]. In support of this, co-immunoprecipitation experiments demonstrate that in the absence of

calcium eNOS remains abound to Cav-1. However, stimulation of cells with calcium ionophore

results in reduced formation of the eNOS-Cav-1 complex [150].

eNOS Posttranslational Modifcations

Myristoylation and Palmitoylation

Myristoylation is important for the subcellular targeting of proteins to membranes. eNOS

is the only NOS isoform to posses an N-myristoylation consensus sequence [158-162]. Glycine

2 (Gly-2) and serine 6 (ser-6) are the preferred substrate binding sites for N-myristoyltransferase

[163]. In this regard, site directed mutagenesis studies have demonstrated that mutation of Gly-2

converts the eNOS membrane bound protein to the cytosolic form [164-166]. However,

inhibiting N-myristoylation of eNOS does not effect enzyme activity [166]. eNOS

palmitoylation unlike myristoylation is a reversible process. In order for eNOS to be targeted to

the plasma membrane myristoylation must precede palmitoylation [167]. Palmitoylation occurs









at the cysteine residues 15 and 26. Mutations at these sites do not affect eNOS activity or protein

trafficking to the plasma membrane [167]. The role of palmitoylation is to specifically target

eNOS to caveolae. In support of this experiments done using wild type-eNOS and a

palmitoylation mutant form of the enzyme, showed that the wild type enzyme colocalized with

caveolin while the mutant form did not [69, 168]. Therefore, it appears that the first step in eNOS

protein localization to the plasma membrane requires myristoylation, which is then followed by

palmitoylation, which stabilizes the enzyme and targets it to the caveolae.

eNOS Phosphorylation

Phosphorylation of eNOS typically occurs at serine (Ser) residues, and less frequently at

tyrosine (Tyr) and threonine (Thr) residues. Currently five sites on eNOS have been identified as

targets for protein phosphorylation, Ser 1177 (human)/Ser 1179 (bovine), Ser 633 (H)/Ser 635

(B), Ser 615(H)/Ser 617 (B), Thr 495 (H)/Thr 497 (B), and Ser 114 (H)/Ser 116 (B).

Ser 1177/1179

The phosphatidylinositol 3-kinase (P13K) pathway was first shown to be involved in eNOS

phosphorylation when it was demonstrated that VEGF or insulin stimulated release of NO was

attenuated by the pharmacological inhibitors of P13K wortmannin and LY298004 [169, 170].

The protein kinase Akt is known to be activated by P13K and to target phosphorylation sites with

the particular consensus sequence of RXRXXXS/T which have been identified on eNOS [171].

Two groups independently demonstrated that Akt could directly phosphorylate eNOS at Ser 179

resulting in its activtion [172, 173]. Various stimuli including shear stress, bradykinin, VEGF

and insulin activate Ser 1179 phosphorylation. It has been hypothesized that the activation of

eNOS by Ser 1179 phosphorylation causes a conformational change in the enzyme similar to the

effects caused by calmodulin binding [174]. Because of the wide variety of stimulators that can

activate Ser 1179, it appears that it is the most important site in the regulation of eNOS activity.









In support of these observations, it has been demonstrated that mutating the Ser 1179 site to an

alanine thus preventing phosphorylation, leads to a reduction in basal and stimulated release of

NO [175]. Additionally, mutating the Ser 1179 site to aspartate to mimic the negative charge of

phosphorylation, results in increased eNOS activity when stimulated with low levels of calcium

[172]. Furthermore, it has been demonstrated that adenoviral mediated over-expression of Akt in

rabbit femoral arteries resulted in increased resting diameter of the artery [176]. Moreover, the

HmG CoA reductase inhibitor simvastatin has been shown to activate Akt leading to increased

eNOS phosphorylation at Ser 1179 [177].

Thr 495/497

Phosphorylation of eNOS does not only result in activation of the enzyme, as evident by

the inhibitory effects of phosphorylation of Thr 495. The phosphorylation of Thr 495 is

mediated through the PKC pathway [178-181]. The site of Thr 495 phosphorylation is located

within the Ca2+/CaM binding domain, and it appears that this interferes with the binding of

Ca2+/CaM to eNOS [179, 180]. The basal level of Thr 495 phosphorylation is high in cultured

endothelial cells [179-181]. Various agonists of eNOS such as bradykinin, VEGF and calcium

ionophore have been shown to cause dephosphorylation of Thr 495 [180, 182, 183]. Also, it has

been suggested that in order for eNOS activation to occur Thr 495 dephosphorylation must

precede Ser 1179 phosphorylation [180-184].

Ser 633/635

Phosphorylation at the Ser 633 site also enhances the activity of eNOS. The

phosphorylation site is located within the CaM autoinhibitory sequence of eNOS contained

within the FMN binding domain [181]. There have been several studies to suggest that Protein

Kinase A [74] phosphorylates Ser 633 [181, 182, 185, 186]. The same agonists that lead to the

activation of NO via Ser 1177 phosphorylation also stimulate Ser 633 phosphorylation. The rate









of phosphorylation of Ser 633 is much slower than that of Ser 1177 after agonist stimulation.

Additionally, phosphorylation of Ser 633 by PKA in endothelial cells can increase NO

production without requiring increased intracellular Ca2+ levels [186].

Ser 615/617

Ser 617 phosphorylation also occurs in the CaM autoinhibitory sequence of the CaM

binding domain, however there is controversy over its function [181]. Various eNOS agonists

similar to the ones that trigger enzyme Ser 633 and Ser 1179 phosphorylation also increase

phosphorylation at the Ser 617 site [175, 181, 182]. One study showed that mimicking the

phosphorylation of Ser 617 with a serine to aspartate mutation increases Ca2+/CaM sensitivity of

eNOS, but not the overall activity of the enzyme [181]. In contrast, another study demonstrated

that phosphorylation at Ser 615 does increase eNOS activity. However, it was observed in the

same study that the serine to alanine mutation mimicking dephosphorylation also increased

enzyme activity [175]. Moreover, the dephosphorylation of Ser 615, led to increased recruitment

of Hsp 90 and Akt both which are know to activate eNOS [175]. These observations suggest that

the role of Ser 615 phosphorylation is to facilitate eNOS interaction with other proteins and

regulate phosphorylation at other sites.

Ser 114/116

The final identified site of eNOS phosphorylation occurs at Ser 116 and it is the only

known phosphorylation site in the oxygenase domain of eNOS. Currently, its role in eNOS

activity much like Ser 615 phosphorylation is controversial. eNOS activation due to VEGF is

associated with Ser 116 dephosphorylation [187]. Laminar shear stress and HDL exposure on

the other hand have been reported to cause phosphorylation of Ser 116 leading to eNOS

activation [188, 189]. Reports on Ser 114 to alanine mutations mimicking dephosphorylation

also conflict, with one study showing increased activity and the other reporting no change in









activity, but increased NO release [175, 187]. These conflicting results suggest that further

studies need to be done to elucidate the role of Serl 14/116 phosphorylation

Overall the regulation of eNOS has developed into this complex story that involves

protein-protein interactions, substrate ability and protein posttranslational modifications. This

tight regulation is necessary to maintain vascular homeostasis. However, loss of this regulation

has been implicated in the pathology of many diseases that eventually lead to vascular

endothelial dysfunction, CAD, myocardial infractions, heart failure and even death.

Pathophysiology

As previously stated, eNOS and its product NO are important for maintaining vascular

homeostasis. Given its significance it is important that a healthy environment is maintained

within the endothelium. However, it is known that in a variety of conditions such as diabetes,

chronic smoking, hypertension, and hypercholesterolemia the endothelium environment loses its

anti-atherogenic, anti-proliferative, and anti-thrombotic properties. Vascular endothelial

dysfunction is the common link seen in the pathology of all of these diseases and it is the

underlying cause to the more serious vascular disease, atherosclerosis. The exact mechanism as

to how endothelial dysfunction is caused is not known. However, there is growing evidence that

oxidative stress which subsequently leads to the loss of NO plays a significant role. Although

oxidative stress can be caused by a variety of ROS generating enzymes, studies have implicated

NAPDH oxidase as the main source of ROS in vascular diseases. The increase in ROS

generated from NADPH oxidase has also been implicated in playing a role in NOS uncoupling

by causing the oxidation of the essential NOS cofactor H4B. The depletion of H4B results in

decreased NO bioavailability and increased eNOS derived superoxide. This loss of NO

bioavailability and the increase in superoxide production results in an endothelium that is no

longer able to maintain homeostasis. Moreover, this change in vascular homeostasis results in









impaired vascular relaxation and increased vascular damage eventually leading to vascular

remolding, which are all characteristic signs of endothelial dysfunction.

Pathways Leading to Oxidative Stress Generation

NADPH Oxidase

The NADPH Oxidase (NOX) isoforms NOX-2 and NOX-4 are both found to be highly

expressed in the endothelial cell. NOX-2 requires the translocation of many regulatory subunits

to the cytosol to become active, those subunits include p22phox, p47phox, Rac, p67phox and

p40phox [190]. Upon assembly of the complex, electrons from NADPH are transferred to

molecular oxygen to form 02-.NOX-4 expression on the other hand is greater than NOX-2 in the

endothelial cell. It also appears that NOX-4 is a constitutively active enzyme [191].

Furthermore, it does not require any of the cytosolic subunits that are required for NOX-2

activation [192]. Though ROS can be generated from other superoxide generating enzymes,

NOX has emerged as the main culprit, because its activity can be stimulated by many of the

substrates involved in vascular endothelial dysfunction such as oxLDL, ANG II, and TNF alpha.

In the endothelial cell a key event leading to NOX-2 activation is the phosphorylation of

p47phox [193]. The phosphorylation of this subunit has been shown to occur in the response to

ANG II, TNF alpha and VEGF [193-195].

In arteries of atherosclerotic patients NOX-2 and NOX-4 expression is increased

particularly in the shoulder region of the plaque. The increased expression of these isoforms

may also contribute to plaque erosion [196]. Furthermore, there is evidence to support that there

is a local increase in the renin angiotensin system in the tissue periphery associated with

hypercholesterolemia, as increased concentrations of Ang II are also observed the shoulder

region of plaques [197, 198]. Moreover, the expression of the angiotensin type I receptor is

increased in the platelets of hypercholesterolemic patients [199].









In addition to being a producer of 02', NOX derived 02' can also quench eNOS derived

NO, resulting in the formation of OONO. OONO can subsequently oxidize lipoproteins in the

vasculature, which become trapped in the endothelium, leading to endothelial activation. This

activation causes an increase in expression of atherogenic proteins such as VCAM-1, P and E

selection, and chemoattactants thus continuing the cycle of vascular injury and repair resulting in

atherosclerosis [200]. Additionally OONO- has been demonstrated to cause eNOS uncoupling

by directly oxidizing the NOS cofactor H4B [201].

eNOS Uncoupling

eNOS uncoupling was first shown to occur by two independent groups using purified

eNOS. Both groups demonstrated that eNOS depleted of H4B could catalyze 02- formation

primarily from the oxygenase domain [50, 51]. Furthermore, the first evidence of eNOS

uncoupling in-vivo was generated with the desoxycorticosterone acetate (DOCA) salt induced

model of hypertension demonstrating that vascular superoxide production was increased ,which

could be attenuated by the NOS inhibitor L-NAME [202]. Besides hypertension there is

evidence to support a role for eNOS uncoupling to occur in the pathology of diabetes, and

hypercholesterolemia.

Studies carried out in endothelial cells derived from diabetic mice provided early evidence

for altered H4B metabolism and NO production in diabetes. Despite having normal eNOS

protein levels, cells derived from the diabetic mice had decreased NO production and H4B levels.

Moreover, supplementation with the H4B precursor was able to reverse these effects [203].

Additional studies carried out in human aortic endothelial cells (HAECs) demonstrated that

following 48 hours of exposure to high glucose media, eNOS expression was increased while

H4B levels were decreased and eNOS derived 02 was increased. Adenoviral mediated over-

expression of GTPCH I was able restore NO and H4B levels and suppress 02' generation [121].









In vivo studies have also provided further evidence that diabetes can result in altered H4B levels

and increased 02.' generation. In this regard, endothelium specific GTCPH transgenic mice

have been generated. These mice have been observed to have increased H4B levels in vascular

tissue [49]. To evaluate the effect of H4B bioavailability, diabetes was induced using the

streptoztocin experimental model. The vasculature of both control and diabetic mice exhibited

increased oxidative stress. While H4B levels were undetectable in control diabetic mice, the

GTPCH tg diabetic mice maintained modest H4B levels. Moreover, these mice exhibited

decreased eNOS dependent 02. generation in the vascular endothelium and increased

endothelium dependent vasorelaxtion in response to acetylcholine (Ach) [204]. Finally in

patients with Type II diabetes, H4B infusion has been shown to reverse vascular endothelial

dysfunction via a NO-dependent mechanism [205]. In addition to being observed in both in-vivo

and in-vitro models of diabetes, several studies have also demonstrated that eNOS uncoupling

occurs in atherosclerosis.

The pathology of hypercholesterolemia is associated with impaired vascular function,

atherosclerosis, decreased H4B bioavailability and increased 02~ generation. In this regard, the

hypercholesterolaemic ApoE KO mice exhibit impaired vascular relaxation and increased

vascular superoxide production. Both of which can be attenuated by oral H4B supplementation

[53]. Furthermore, when ApoE KO mice are crossed with GTPCHtg mice, these mice were

observed to have a improved vascular relaxation response to Ach. Additionally these mice had

increased H4B levels and decreased 02' generation in the vascular endothelium [206].

Moreover, when eNOS tg mice are crossed with ApoE KO mice, the progression of

atherosclerosis is accelerated and these mice also have increased 02' generation, which is

improved following H4B supplementation [207]. In addition to the animal studies,









administration of H4B in patients with hypercholesterolemia has been shown to improve vascular

endothelial dysfunction [103].

The ratio between H4B and H2B is another important trigger for eNOS uncoupling.

Recently, it has been demonstrated that H4B and H2B can bind eNOS with equal affinity.

Additionally, intracellular levels of H2B increased 40% after 48 hours of high glucose treatment

and this was associated with reduced NO activation and increased eNOS dependent 02-

production. [208]. Over all these studies suggest that it is not only important to maintain the

levels of H4B, but the ratio of H4B/ H2B may also be important in maintain NO production.

Over all the studies presented in the section demonstrate that oxidative stress plays a

significant role in vascular endothelial dysfunction. However, increasing evidence also supports

the role for the endogenous NOS inhibitors the methylarginines ADMA and L-NMMA in the

pathophysiology of endothelial dysfunction.

DDAH ADMA Pathway

The endogenous NOS inhibitor AMDA has been demonstrated to be an independent

cardiovascular disease risk factor. However, the mechanisms regarding how ADMA levels are

modulated and what role they play in disease progression are not clearly understood. Therefore,

ADMA accumulation in response to decreased DDAH expression/activity has been proposed to

be involved in the vascular pathophysiology observed in a variety of cardiovascular disease. The

following section will describe the production and function of the methylarginines. Futhermore,

the significance of the methylarginine metabolizing enzyme DDAH will be described. Finally,

this section will end with studies describing the pathophysiology associated with increased levels

of methylarginines and decreased DDAH activity.









PRMT

The methylation of protein arginine residues is carried out by a group of enzymes referred

to as protein-arginine methyl transferase's (PRMT's). To date, nine different isoforms of the

enzyme have been identified with each subtype exhibiting various levels of activity, substrate

specificity and tissue distribution. During PRMT catalysis S-adenosylmethionine serves as its

substrate (SAM) and is then subsequently converted to S-adenosylhomocysteine (SAH), which is

then enzymatically converted to homocysteine, which is either further metabolized, or

remethylated [5]. PRMT's are separated into two classes depending on what type of

methylarginine they generate. In mammalian cells, these enzymes have been classified into type

I (PRMT1, 3, 4, 6, and 8) and type II (PRMT5, 7, and FBXO11) enzymes, depending on their

specific catalytic activity. Both types of PRMT, however, catalyze the formation of mono-

methylarginine (MMA) from L-Arg. In a second step, type I PRMT's produce asymmetric

dimethylarginine (ADMA), while type II PRMT catalyzes symmetric dimethylarginine (SDMA)

[209]. Arginine methylation by both type of PRMT's enzyme occurs mostly in the arginine-

glycine rich sequences of proteins [210, 211]. PRMT 1 is a member of the type I class of

PRMT's and it specifically catalyzes the formation of L-NMMA and ADMA [212].The PRMT 1

enzyme is mostly expressed in the heart and testis [213]. Intracellularly, PRMT 1 is expressed

predominantly in the nucleus with partial expression in the cytoplasm [214]. During

development the expression of PRMT1 is essential, as PRMT1 KO mice have been observed to

be embryonically lethal [215]. Until recently protein arginine methylation was thought to be

irreversible. Recently, the Jumonji domain-containing protein 6 (JMJD6) has been identified as

a histone arginine demethylase, whether or not this has implications for intracellular protein

arginine methylation is unknown [216]. The relationship between PRMT1 activity, expression

and ADMA synthesis has been demonstrated in several studies. Specifically, it has been









observed in HAEC's following 24 hour incubation with either LDL or OxLDL within the

pathological range of 200-300 mg/dl that PRMT 1 mRNA expression increases 1.5-2.5 fold.

Furthermore, ADMA released into the media increased 2 fold following the 24 hour incubation

period. The increase in ADMA could be attenuated in the presence of the PRMT inhibitor SAH

[217]. In human umbilical vein endothelial cells (HUVECs) exposure to shear stress has been

demonstrated to increase gene expression of PRMT-1. Furthermore, low levels of shear stress

(5-15 dynes/cm2) increases ADMA release from HUVEC cells after 3-6 hours of exposure. In

contrast, high shear stress (25 dynes/cm2) does not result in increased release of ADMA. [218].

Methylarginine Biochemistry

The free methylarginines ADMA, L-NMMA, and SDMA are all transported through the y

CAT transport system. However, only ADMA and L-NMMA competitively compete with L-

Arg for binding to eNOS, resulting in its inhibition. Inhibition of eNOS activity by the

methylarginines is reversible, but only under conditions in which excess L-Arg is added. In

support of the role of methylarginines in eNOS inhibition, several studies have reported that L-

Arg supplementation enhances endothelium dependent relaxation through increased NO

generation. However, considering that the intracellular concentrations of L-Arg is 50 times

higher than the Km for eNOS, increased NO generation would not be expected with L-Arg

supplementation; this phenomenon has been termed the "L-Arg paradox" [38]. Therefore, it is

hypothesized that L-Arg supplementation overcomes the endogenous inhibitory actions of

cellular methylarginines ADMA and NMMA [42]. However, whether or not these endogenous

methylarginines are present at concentrations sufficient to regulate eNOS is unclear. In this

regard, it has been reported that plasma levels of ADMA and L-NMMA are in the range of 0.5-

1 IM in healthy individuals [219]. We have demonstrated in studies from our lab that the basal

endothelial cells level of ADMA and L-NMMA were 3.6 [iM and 2.9 [iM respectively.









Furthermore, our kinetic studies using purified eNOS demonstrated that the Ki for ADMA and L-

NMMA were 0.9[iM and 1.1 iM respectively [38]. Therefore, it is expected that under normal

physiological conditions that methylarginines would not have a significant affect on endothelial

NO production. In support of this, it has been demonstrated that at low concentrations of

methylarginines modest inhibition of NO production is observed. In isolated human blood

vessels, 1 [iM of L-NMMA leads to inhibition of bradykinin induced vasodilatation by 20%

[220]. Simlar reports from a study using plasma from end stage renal paitents have shown that

plasma levels of ADMA of 2[iM, can have a significant inhibitory effect on endothelial NO

production [221]. Additionally, in the circulation of the guinea-pig 10 [iM ADMA was observed

to increase blood pressure by 15% [222]. Although, studies have demonstrated modest

inhibition of eNOS at physiological concentrations of methylarginines, there have been several

reports of increased methylarginine levels in various disease states including

hypercholesterolemia, diabetes and end stage renal disease.

In the disease state plasma methylarginine levels have been reported to increase 3 to 9 fold

[38]. It remains unclear whether or not increases in methylarginine levels will result in

significant inhibition of endothelial NO production. Recently, we have addressed this question

in cellular studies in an effort to determine the dose dependent effects of the methylarginines on

endothelial NO production. Previous studies suggest that compartmentalization of eNOS or L-

Arg may occur in the endothelial cell, limiting the ability of L- Arg to overcome the inhibition of

methylarginines on eNOS activity. Therefore, cellular studies were carried out in order to

determine the effective concentration of cellular methylarginines necessary to cause eNOS

inhibition in BAECs. Our results demonstrated that ADMA dose dependently inhibited eNOS

derived NO generation as 5 uM and 100 uM ADMA elicited a 38% and 74% inhibition,









respectively. Similar results were obtained with L-NMMA, as 42% and 81% inhibition was seen

with 5 [iM and 100 [iM L-NMMA respectively. In the presence of L-Arg these effects were less

prominent. ADMA dose dependently inhibited eNOS derived NO 24% at 10[M ADMA and

52% at 100 [iM. Similar results were obtained for L-NMMA with 17% inhibition observed at 10

[IM L-NMMA and 63% at 100 [iM. These results were surprising to us because based on kinetic

studies we did not expect to see such robust inhibition of endothelial NO production. This led us

to speculate that endothelial cells are able to concentrate methylarginines. Therefore, cellular

uptake studies were preformed. Our results demonstrated that in the absence of physiological

levels of L-Arg, 10 [iM of exogenous ADMA resulted in intracellular ADMA concentration of

68.4 [iM. When this same experiment was repeated in the presence of L-Arg (100 [iM), 10 [iM

ADMA resulted in a markedly lower intracellular ADMA concentration of 23.5 [iM [38].

Additional studies were also performed with L-NMMA. Intracellular concentrations of L-

NMMA sometimes reach as much as 7 times higher than outside the cell. Moreover, L-NMMA

(10 [iM) uptake was only inhibited by 65% in the presence of L-Arg (100 [iM). As previously

mentioned the methylarginines along with L-Arg are all transported through the y+ transporter.

Therefore our results would indicate that even in the presence of L-Arg, elevated plasma levels

of methylarginines would result in increased uptake through the y transporter resulting in even

higher intracellular levels. Moreover, this increased uptake through the y transporter represents

a novel mechanism by which methylarginines can modulate eNOS activity and endothelial NO

production.

Overall our studies suggest that under pathological conditions such as

hypercholesterolemia, and diabetes where methylarginine levels are increased, methylarginines

can modulate eNOS activity. Because NO is known to possess anti-proliferative and anti-









atherogenic properties, methylarginine accumulation could play a significant role in development

of atherosclerosis.

Metabolism of Methylarginines

Initially it was believed that after proteolysis, free methylated arginine residues were

released and excreted through the kidney [223]. On the contrary, subsequent studies into

methylarginine metabolism in rabbits demonstrated that the urinary excretion of SDMA was 30

times greater than ADMA and L-NMMA excretion. This led to the assumption that ADMA and

L-NMMA were being metabolized through alternate pathways [224]. These early studies led to

further investigations into the metabolic fate of C14 labeled ADMA and SDMA. Sasaoka et al.

demonstrated that while both dimethylarginines could be metabolized by the Dimethylarginine:

pyruvate Aminotransferase pathway, there existed a specific pathway for ADMA metabolism. In

support of this they found that the radioactivity that remained in the tissue of rats injected with

14C ADMA consisted mainly of citrulline, in complete contrast to rats injected with 14C SDMA

[225].

After the identification of this alternative pathway, DDAH was identified as the

metabolizing enzyme of ADMA and was purified from the rat kidney [226]. It was

demonstrated that DDAH specifically hydrolyzed ADMA and L-NMMA to citrulline, and mono

and dimethylamine. Until recently, DDAH enzyme activity studies have only been performed on

bacterial sources and tissue homogenates from either rat kidney or porcine brain. Those studies

reported that DDAH hydrolyzes ADMA at a faster rate than L-NNMA with reported Km values

of 0.18 and 0.36 mM respectively and that it is responsible for >90% of ADMA metabolism

[224, 225, 227]. We have recently purified the human isoform ofDDAH-1 (hDDAH-1) and in

contrast to previous studies we observed that hDDAH-1 hydrolyzes ADMA and L-NNMA at

similar rates 68.7 [iM and 53.6 [iM respectively [228]. Furthermore, we observed that hDDAH-









1 is maximally active at pH 8.5, contrasting earlier reports that enzyme maximum activity at pH

5.2 to 6.5 [225, 229]. DDAH-1 contains a Zinc (II) binding site, with endogenous bound

Zinc(II) inhibiting its catalytic activity [230]. Birdsey et al. and Murray-Rust et al. were the first

to demonstrate that ADMA and not SDMA could be metabolized intracellularly [231, 232].

Additional studies by Murray-Rust et al, demonstrated that steric hindrance caused by the methyl

groups on both nitrogens of SDMA prevents its binding to the active site of DDAH, therefore it

is unable to hydrolyze it [232].

In observance that DDAH expression did not correlate to activity, Leiper et al. discovered

a second isoform of DDAH, DDAH-2. DDAH-2 has a 63% homology to hDDAH-1. Currently

there are no studies on the enzymatic activity of human DDAH-2, as the only study that has been

done uses recombinant bacterial lysates that express DDAH-2. Enzyme activity from bacterial

lysates demonstrated that DDAH-2 hydrolyzed L-NMMA at the comparable rates to reported

DDAH-1 in bacterial lysates [36].

DDAH-1 and 2 are predominantly located in the cytoplasm, DDAH-1 has also been found

in membrane fractions of endothelial cell lysates [231]. DDAH-1 is predominately expressed in

the liver and kidney which are major sites of ADMA metabolism [233, 234]. It is also expressed

strongly in the aorta and equally in adult and fetal tissues [235, 236]. DDAH-2 expression is

predominant in fetal tissues. However, expression decreases and becomes more tissue specific in

adults with DDAH-2 expression predominately in the vascular endothelium, kidney, heart, and

placenta [36]. DDAH-1 while it is also expressed in the endothelium, studies of mesenteric

resistance arteries demonstrate that DDAH-2 mRNA expression is 5.1 fold greater than that of

DDAH-1 suggesting an important role for DDAH-2 in the resistance vessels [237].









In Vivo and In Vitro Significance of DDAH

The first functional studies of DDAH-1 were done using the inhibitor S-2-amino-4 (3-

methylguanidino) butanoic acid (4124W). Treatment with 4124W in cultured human endothelial

cells led to accumulation of ADMA in the supernatant thus demonstrating that the role of

DDAH-1 was to prevent the accumulation of ADMA. Ex-vivo studies using rat aortic rings

demonstrated that inhibition of DDAH-1 by 4124W caused vasoconstriction. However, this

effect was reversed in the presence of L-Arg. Additional studies done on human saphenous

veins demonstrated that inhibition of DDAH-1, led to the loss of the bradykinin mediated

relaxation response [238]. These studies were among the first to demonstrate that DDAH could

be important in the regulation of endothelial NOS activity and vascular function. Recently, the

in-vivo significance of DDAH-1 has been described by two independent groups using both

transgenic and knockout mice [239, 240].

Dayoub et al. described the effects of DDAH -1 over-expression in-vitro and in-vivo, with

the creation of DDAH-1 transgenic mouse model. Cellular studies performed in human

microvascular endothelial cells and murine endothelial cells demonstrated that over-expression

of DDAH-1 yields a 2-fold increase in NO activity and Nitrogen Oxides (NOx) released into the

culture media. The in-vivo studies demonstrate that DDAH-1 tg mice have increased NOS

activity in the heart and skeletal muscle however, no change was seen in the aorta. DDAH-1 tg

mice also have decreased mean arterial blood pressure (MAP). The systemic vascular resistance

(SVR) and cardiac contractility are also decreased in response to an increase in NO production.

Furthermore, it was observed in DDAH-1 tg mice, that urinary excretion of NOx was increased 2

fold, and this corresponded to a 2-fold drop in plasma ADMA levels [239]. Additional studies

done by Jacobi et al. demonstrated that DDAH-1 tg mice exhibit enhanced angioadapatation in

response to hind limb ischemia [241]. Subsequent studies by Tanaka and Sydow et al.,









demonstrated in a cardiac transplantation model that DDAH-1 tg mice exhibit suppressed

immune responses as result of increased cardiac NO generation and decreased superoxide

production. Also, these mice exhibited less graft coronary artery disease, and improved function

of the allograft [242].

In more recent studies, Lieper et al have demonstrated the in-vivo effects of DDAH-1 gene

deletion in mice. The first significant finding of this study was that homozygous deletion of the

DDAH-1 gene was embryonically lethal. Demonstrating that DDAH-1 is essential to normal

embryonic development. Therefore, subsequent studies where performed with DDAH 1+/- mice.

The DDAH-1 +/- mice exhibit increased plasma levels of ADMA, indicative of DDAH's role in

regulating ADMA levels. DDAH-2 expression was not altered by the drop in DDAH-1

expression. Tissue DDAH activity in the kidney, lung, and liver was decreased by

approximately 50% suggesting that DDAH-2 is not the principle methylarginine metabolizing

enzyme in these tissues. Additionally, it was observed that these mice exhibited impaired

vascular relaxation in response to Ach treatment. Moreover, hemodynamic studies reveal that

mean arterial blood pressure (MAP), systemic vascular resistance (SVR) and right ventricular

pressure are all increased in the DDAH 1 +/- mice [240].

Hasegawa et al recently created a transgenic mouse over-expressing the DDAH-2 gene.

They have reported that DDAH-2 tg mice have reduced plasma ADMA levels and an elevation

in cardiac NO levels. However, in contrast to DDAH-1 mice, there was no change in systemic

blood pressure. The difference seen in two models is likely to be due to the fact that plasma

ADMA levels are vastly different in these two mice. In the DDAH-ltg ADMA plasma levels

decreased by 60%, whereas DDAH-2 tg mice plasma ADMA levels were only reduced by 26%.

This further provides evidence that DDAH-1 is the principle methylarginine metabolizing









enzyme. The expression ofDDAH-2 was significantly increased in the heart, skeletal muscle

and brown adipose tissue. They also reported that DDAH-2 over-expression did not alter the

expression of DDAH-1. Furthermore, ADMA induced vascular lesions were attenuated in the

DDAH-2tg mice, which they attributed to decrease in angiotensin converting enzyme expression

[243]. ANG II infusion over a two week period induced increased medial thickening and

perivascular fibrosis in coronary microvessels of WT mice, however this response was

attenuated in DDAH-2 tg mice [244].

Studies done by Wang et al. reported that in-vivo DDAH-2 gene silencing in rat mesenteric

arteries caused almost complete inhibition of the NO response to Ach in vascular reactivity

studies. They also reported DDAH-1 gene silencing increased ADMA, however it had no effect

on vascular relaxation in response to Ach [237]. As demonstrated in the previous study by

Hasegawa et al., this study provides more evidence that DDAH-1 is the predominate

metabolizing enzyme of ADMA. In addition, this study provides some evidence that DDAH-2

regulates endothelial NO production independent of ADMA, because ADMA levels did not rise

following DDAH-2 gene silencing.

ADMA Independent Mechanisms of DDAH

Wang et al. reported that DDAH-2 gene silencing in mesenteric resistance vessels lead to a

significant down-regulation of eNOS mRNA and protein expression [237]. Smith et al. observed

that DDAH-2 over-expression in HUVEC cells lead to a 2-fold increase in VEGF mRNA

expression [245]. Later it was reported by Hasegawa et al. that DDAH-2 over-expression in

BAECs increased transcriptional activation of VEGF, without increasing NO generation. In this

study they observed that DDAH-2 mediated its effects by directly binding PKA leading to the

phosphorylation of the transcription factor specificity protein 1 (Spl). Spl translocates to the

nucleus and binds the promoter region of VEGF activating its transcription. They also









demonstrated that the DDAH-2 effect on VEGF transcription is blocked by gene silencing of Spl

[246]. Tokuo et al. reported that DDAH-1 in a similar fashion, binds to nuerofibromin 1 (NF-1)

in a region coinciding specific sites ofPKA phosphorylation. DDAH-1 binding to NF-1

increases NF-1 phosphorylation by PKA. Overall these studies demonstrate that DDAH can

mediate its effects independent of ADMA [247].

Regulation of DDAH Activity

Given the importance that DDAH plays in maintaining NO levels in the vascular

endothelium, extensive research efforts have been undertaken to study its regulation. Leiper et

al. were the first to report that NO could inactivate DDAH-1 by SNO of a cysteine (Cys) residue.

Cys 249 is located with in the active site of the DDAH-1 enzyme. It was observed in this study

using recombinant bacterial protein expressing DDAH-1 that SNO occurs at the Cys 249 residue,

rendering the enzyme inactive [88]. Additional studies done using mouse endothelial cells over-

expressing DDAH-2 demonstrated that cytokine mediated induction of iNOS resulted in the

SNO of DDAH-2 [88]. Thus, under conditions of enhanced immune response which leads to

iNOS induction, inhibiting DDAH activity would be beneficial; because of the accumulation of

ADMA which would be expected to inhibit iNOS derived NO. Knipp et al. observed that

DDAH-1 in its native form, Zn (II) bound, is resistant to SNO and it is the zinc depleted form

that is susceptible to [248]. It has also been suggested that DDAH activity maybe sensitive to

oxidative stress. However, studies from our lab and others have shown that DDAH is largely

resistance to oxidative species at pathophysiological levels [228, 249].

Studies by Scalera et al. demonstrated that the anti-hypertensive drug, Telmisartan, can

positively regulate DDAH. Although Telmisartin is known to function as an ANG II type 1

receptor blocker, it has also been found to activate PPAR y. PPAR y signaling is associated with

increased NO formation. In this study they observed that in the presence of Telmisartin, DDAH









activity increased and DDAH-2 expression also increased. However, PPARy inactivation either

pharmacologically or by gene silencing mitigated the effects on DDAH activity and expression

[250]. Yin et al. reported that pravastatin a cholesterol lowering drug, restores DDAH activity

and endothelium relaxation in the rat aorta following exposure to glycated bovine serum albumin

(AGE-BSA) [251]. Achan et al. reported that all-trans-retinoic acid could transcriptionally

regulate DDAH II, increasing its mRNA expression in HUVECs [252]. Additional studies by

Jones et al. demonstrated that there are six single nucleotide polymorphisms(SNP) in the

promoter region of the DDAH-2 gene [253]. Furthermore, they observed that the 6G/7G

insertion/deletion SNP at position -871 in the promoter region of the DDAH-2 gene, resulted in

enhanced promoter activity [253]. Valkonen et al. observed in the Kuopio Ischemic Risk Factor

Study that 13 male patients were carriers of a of DDAH-1 gene varient that put them at 50 times

greater risk for cardiovascular disease [254].

Overall these studies suggest that ADMA and DDAH may play a role in endothelial

dysfunction. The next section will help to provide further evidence as to the excat role of ADMA

and DDAH in the disease state.

Pathophysiology

Clinical syndromes involving defective NO productions underscore the importance of

eNOS and NO in the maintenance of normal vascular function. Although it is well established

that NO is a critical effector molecule in the maintenance of vascular tone, NO also maintains the

non-atherogenic character of the normal vessel wall. Several studies have linked ADMA and L-

NMMA as key players in endothelial dysfunction.

Epidemiological studies have demonstrated a strong correlation between plasma ADMA

and incidence of cardiovascular disease. Initial studies by Boger et al. demonstrated that the

plasma ADMA levels of young hypercholesterolemic individuals were double that of









normocholesterolemic patients [255]. The increase in ADMA in the hypercholesterolemic

patients resulted in impaired endothelium dependent response and reduced nitrate urinary

excretion. The effects on nitrate urinary excretion and vascular function, improved following L-

Arg supplementation [255]. Subsequent studies by Zoccali et al. were the first to establish

ADMA as an independent risk factor for cardiovascular disease in patients with chronic kidney

disease [256]. Lu et al. observed in patients following angioplasty that ADMA was the sole

predictor of future cardiovascular events [257]. Studies by Valkonen et al. demonstrated that in

healthy non smoking men, those in the highest quartile of ADMA plasma levels, had a 3.9 fold

increase in risk of acute coronary events [254]. Studies by Abbasi et al. reported that type II

diabetic patients, have increased ADMA plasma levels in comparison to healthy individuals.

Additional studies of obese woman found that women who are insulin resistant and obese have

higher plasma ADMA levels and that ADMA levels decreased following weight loss [258]. In

support of these epidemiological studies, in vitro and in vivo data has shown similar effects of

ADMA on endothelial function in several disease states.

Chan et al. demonstrated that blood monocytes from hypercholesterolemic individuals

adhered to human endothelial cells in culture greater than normocholesterolemic [259]. This

increase in adhesion of monocytes is one of the initial steps in the progression of endothelial

dysfunction and atherosclerosis. Furthermore, they observed that the adhesion was related to the

L-Arg/ADMA ratio. In support of this, monocytoid cells were co-cultured with BAECs exposed

to the corresponding L-Arg/ADMA ratios of the hypercholesterolemic patients. It was observed

that the adhesion of monocytoid cells increased in a dose dependent manner. Following the

initial adhesion studies patients were placed on 12-weeks of L-Arg supplementation which

resulted in the normalization of monocyte adhesion [259]. Studies by Azuma et al. demonstrated









that ADMA and L-NMMA levels were increased in regenerated endothelial cells following

balloon angioplasty of the rabbit carotid artery. Furthermore, L-Arg levels were significantly

depleted in regenerated endothelial cells which resulted in increased neointima formation. The

accumulation of ADMA and L-NMMA in these regenerated cells led to decreased endothelium

dependent relaxation, which was attenuated with L-Arg supplementation [260]. Overall these

studies suggest that the L-Arg/ADMA ratio is an important predictor of endothelial dysfunction.

To add physiological relevance to our biochemistry studies discussed earlier, we wanted to

examine whether or not methylarginines inhibition on eNOS could modulate a physiological

response. Therefore changes in vascular reactivity in rat carotid rings under varying

concentrations of ADMA (1-500 iM) were observed. ADMA dose dependently inhibited the

Ach mediated relaxation response with a 52% reduction seen at 5 gtM ADMA and a 95%

reduction at 500 gM, in the absence of L-Arg. In the presence of L-Arg 10 [iM ADMA inhibited

the Ach mediated relaxation response by 7%, and an 84% reduction was seen at 500 iM.

Because our studies in vitro and ex vivo demonstrated that ADMA could inhibit eNOS, it was

unclear if this could occur in-vivo. Using the balloon model of carotid injury we observed that

intracellular methylarginine levels increased 4 fold and resulted in a 50% loss of vasculature

relaxation response. Overall these results demonstrated that intracellular methylarginine levels

are elevated in pathological conditions and that the levels reach high enough to inhibit

endothelial NOS activity and vascular function. In addition to increased plasma ADMA levels,

dysfunction of the DDAH enzyme and its ADMA independent effects on NO have become a

potential mechanism by which endothelial dysfunction can occur.

Ito et al. demonstrate in HUVEC cells that following 48 hours of exposure to either oxLDL

or TNFalpha the activity of DDAH decreased but expression remained unchanged [261].









Furthermore, they observed in-vivo that New Zealand White rabbits fed on high-cholesterol diet

had significantly reduced aortic, renal, and hepatic DDAH activity [261]. These studies were the

first to demonstrate that DDAH activity could be modulated under pathological conditions.

In transplant patients there is an increased incidence of transplant atherosclerosis as a result

of the cytomegalovirus (CMV), which is known to promote atherogenesis [262].Weis et al.

demonstrated that human microvascular cells infected with CMV, resulted in increased ADMA

and decreased cellular DDAH activity [263]. Therefore, these studies demonstrate that CMV

infection contributes to endothelial dysfunction and transplant atherosclerosis that is observed in

heart transplant patients by modulating the DDAH-ADMA pathway.

Although previous studies using purfied human DDAH enzyme have demonstrated that

DDAH was largely resistant to reactive oxygen and nitrogen species, it may be the oxidatively

modified products of these reactions that influence DDAH activity [249]. 4-hyrdoxy-2-nonenal

(4-HNE) is a lipid hydroperoxide that is biologically active and known to accumulate in

membranes at concentrations 10 [iM to 5 mM. Mounting evidence suggests that reactive

aldehydes such as 4-HNE play a role in the progression of atherosclerosis. We have

demonstrated using purified hDDAH-1 that 4-HNE inhibits DDAH activity by binding a

histidine residue in the catalytic triad of the enzyme [228]. Therefore, this may represent a novel

mechanism by which 4-HNE causes impairment of endothelial NO production, by directly

inhibiting DDAH activity. In contrast to our studies, Tain et al reported that DDAH activity was

signficaltny inhibited in the presence of NO and 02' The differences could be attributed using

either using purified recombinant enzyme, or species differences as their studies were done using

kidneys from rats [264]









Recent evidence suggests that the DDAH-ADMA pathway may also play a significant role

in endothelial dysfunction associated with diabetes. Lin et al. demonstrated that in VSMC and

HUVECs cellular ADMA levels increased and DDAH activity decreased following 48 hours of

exposure to high glucose media. Furthermore, they observed in vivo that rats placed on a high

fat diet and injected with streptozotcin to induce type II diabetes, had elevated plasma ADMA

levels. Moreover, these diabetic rats had decreased tissue DDAH activity [265]. Sorrenti et al.

demonstrated that DDAH-2 expression and DDAH activity were decreased in human iliac artery

cells following five days of exposure to high glucose condition media [266].

Overall, these studies suggest that methylarginines are key in regulating eNOS in a disease

state. Based on cellular kinetic studies from our group, a 3-4 fold increase in cellular

methylarginines would be expected to inhibit NOS activity by greater than 50%.

It is evident that that NO bioavailability is key to maintaining the anti-atherogenic state of

the vascular wall. Furthermore, DDAH and ADMA have emerged as critical factors in diseases

associated with increased cardiovascular risk. It is also evident that oxidative stress also plays a

significant role in endothelial dysfunction observed in such diseases as hypertension and diabetes.

The observations provided in this dissertation could be of potential clinical importance as

CAD is the number cause of all deaths in the United States. Therefore, elucidating the

mechanisms) of how eNOS is modulated by both methylarginines and oxidative stress may

provide knowledge for potential therapeutic targets in the treatment of athero-proliferative

disorders such as atherosclerosis.









CHAPTER 3
ROLE OF DDAH-1 AND DDAH-2 IN THE REGULATION OF ENDOTHELIAL NO
PRODUCTION

Introduction

Endothelium-derived Nitric Oxide (NO) is a potent vasodilator that plays a critical role in

maintaining vascular homeostasis through its anti-atherogenic and anti-proliferative effects on

the vascular wall. Altered NO biosynthesis has been implicated in the pathogenesis of

cardiovascular disease and evidence from animal models and clinical studies suggest that

accumulation of the endogenous nitric oxide synthase (NOS) inhibitors, asymmetric

dimethylarginine (ADMA) and NG-monomethyl arginine (L-NMMA) contribute to the reduced

NO generation and disease pathogenesis. ADMA and L-NMMA are derived from the

proteolysis of methylated arginine residues on various proteins. The methylation is carried out

by a group of enzymes referred to as protein-arginine methyl transferase's (PRMT's) [35].

Protein arginine methylation has been identified as an important post-translational modification

involved in the regulation of DNA transcription, protein function and cell signaling. Upon

proteolysis of methylated proteins, free methylarginines are released which can then metabolized

to citrulline through the activity of Dimethylarginine Dimethylamino Hydrolase (DDAH).

Currently there are two known isoforms of DDAH each having different tissue specificity.

DDAH-1 is thought to be associated with tissues that express high levels of Neuronal Nitric

Oxide (nNOS), while DDAH-2 is thought be associated with tissues that express eNOS.

Decreased DDAH expression/activity is evident in disease states associated with endothelial

dysfunction and is believed to be the mechanism responsible for increased methylarginines and

subsequent ADMA mediated eNOS impairment. However, the contribution of each enzyme to

the regulation of endothelial NO production has yet to be elucidated.









The strongest evidence for DDAH involvement in endothelial dysfunction has come from

studies using DDAH gene silencing techniques and DDAH transgenic mice. Specifically, Cooke

et.al. has demonstrated that DDAH-1 transgenic mice are protected against cardiac transplant

vasculopathy [241, 242]. Using in-vivo siRNA techniques, Wang et.al. demonstrated that

DDAH-1 gene silencing increased plasma levels of ADMA by 50%, but this increase had no

effect on endothelial dependent relaxation. Conversely, in-vivo DDAH2 gene silencing had no

effect on plasma ADMA, but reduced endothelial dependent relaxation by 40% [237]. These

latter findings are particularly intriguing and demonstrate that elevated plasma ADMA is not

associated with impaired endothelial dependent relaxation while loss of DDAH-2 activity is

associated with impaired endothelial dependent relaxation, despite the fact the plasma ADMA

levels are not increased [237]. Given the obvious inconsistencies in the literature regarding the

individual roles of DDAH-1 and DDAH-2, the current study establishes the specific role of each

DDAH isoform in the regulation of endothelial NO production and its potential role in disease

pathogenesis.

Materials and Methods

Cell Culture

Bovine aortic endothelial cells (BAECs) were purchased from Cell-Systems and cultured

in MEM (Sigma, St Louis,MO) containing 10% FBS, 1% NEAA, 0.2% Endothelial Cell Growth

Factor Supplement (ECGS) and 1% Antibotic-Antimyotic (Gibco,Carsbad,CA)and incubated at

370 5% CO2 -95% 02.

EPR Spectroscopy and Spin Trapping

Spin-trapping measurements of NO were performed using a Bruker Escan spectrometer

with FE-MGD as the spin trap (22,38). For Measurements of NO produced by BAECs, cells

were cultured as described above and spin trapping experiments were performed on cells grown









in 6 well plates. Attached cells were studied since scraping or enzymatic removal leads to injury

and membrane damage with impaired NO generation. The media from approximately Ixl06cells

attached to the surface of the 6 well plates was removed and the cells were washed 3 x in

KREBS and incubated at 370 C 5% CO2 in 0.2 ml of KRBES buffer containing the spin trap

complex FE-MGD (0.5 mM Fe2+, 5.0 mM) was added and the cells stimulated with calcium

ionophore (1 uM). Subsequent measurements of NO production were performed following a 30

min incubation period. Spectra recorded from cellular preparations were obtained using the

following parameters: microwave power; 20 mW, modulation amplitude 3.00 G and modulation

frequency; 86 kHZ.

HPLC

BAEC's were collected from confluent 75 mm culture flask and sonicated in PBS followed

by extraction using a cation exchange column. Samples were derivatized with OPA and

separated on a Supelco LC-DABS column (4.6 mm x 25 cm i.d., 5 [m particle size) and

methylarginines were separated and detected using an ESA (Chelmsford, MA) HPLC system

with electrochemical detection at 400mV. Homoarginine was added to the homogenate as an

internal standard to correct for the efficiency of extraction. The mobile phase consisted of buffer

A (50 mM KH2PO4 pH 7.0) and buffer B (ACN/MeOH 70:30) run at room temperature with a

flow rate of 1.3 mL/min. The following gradient method was used 0-10 min 90% A 10-40 min a

linear gradient from 90% A to 30% A (22,39).

DDAH-1 and 2 Gene Silencing

21-bp siRNA nucleotide sequences targeting the coding sequences for DDAH-1 (accession

no. NM_001102201) and DDAH-2 (accession no. NM_001034704) were purchased from

Ambion. Control cells received GAPDH siRNA also purchased from Invitrogen. 400 [l of

nuclease free water was added to the dried oligonucleotides to obtain a final concentration of 100









pM. Transfections were done using the lipid mediated transfection reagent RNAiMax

(Invitrogen). The procedure was as follows, 240 nM or 5 ul of siRNA per well of a six well plate

was diluted into 250 [l of Opti MEM (Invitrogen) and 5 ul of RNAiMax was diluted in 250 [l of

Opti MEM. The siRNA and RNAiMax were then combined into one Eppendorfftube and then

incubated at room temperature for 20 minutes. Following the 20 minute incubation period, the

RNAi MAX-siRNA complexes were added to each well of a six well plate. The mixture was

rocked back and forth to allow for coating of the entire well. BAECs were trypsinized and spun

down at 1000 x g for 4 minutes and then resuspended in 1.5 mls of Opti MEM + 10% MEM

medium containing 10% FBS, 1% NEAA, 0.2% Endothelial Cell Growth Factor. The cells were

then added on top of the RNAiMAX-siRNA complexes and incubated at 370 5% CO2 -95% 02

for 6 hours. After the 6 hour incubation period, 1ml of MEM medium containing 10% FBS, 1%

NEAA, 0.2% Endothelial Cell Growth Factor was added. 24 hours later 1ml of MEM medium

containing 10% FBS, 1% NEAA, 0.2% Endothelial Cell Growth Factor was added. At 48 hours

2 ml of medium was removed and replaced with fresh MEM medium containing 10% FBS, 1%

NEAA, 0.2% Endothelial Cell Growth Factor and the transfection was continued for another 24

hours.

DDAH Activity

DDAH activity was measured from the conversion of L-[3H]L-NMMA to L-[3H]citrulline.

A T-75 flask was used for each measurement, BAECs were trypsinized, pelleted and

resuspended in 150 |pL of 50mM Tris (pH 7.4). The cells were then sonicated 3 x 2 seconds and

150 |pL of reaction buffer (50 mM Tris, 20 [LM L-[3 H]L-NMMA, 180 [LM L-NMMA, pH 7.4)

was added. The samples were then incubated in a water bath at 370C for 90 minutes. Following

the 90 minute incubation, the reaction was stopped with 1 ml of ice-cold stop buffer using 20









mM N-2 Hydroxyethylpiperazine-N'-2 ethanesulfonic acid (HEPES) with 2 mM EDTA, pH 5.5

(15) Separation of L-[14C]citrulline from L-[3 H]L-NMMA was performed using the cation

exchange resin Dowex AG50WX-8 (0.5 ml, Na+ form, Pharmacia). The L-[14C]citrulline in the

eluent was then quantitated using a liquid scintillation counter.

DDAH Over-Expression

Following the 48 hours of adDDAH-1 or adDDAH-2 transduction, cells were trypsinized

and spun down at 1000 x g for 4 minutes. The cell pellet was then washed Ix with PBS and then

centrifuged at 1000 x g for an additional 4 minutes. The cell pellet was then homogenized using

RIPA buffer containing sodium orthovanadate (2 mM), phenylmethylsulphonyl fluoride (1 mM),

and protease inhibitor cocktail (Santa Cruz biotechnology). Following homogenization the cell

pellet was briefly sonicated 2 x 2 sec. Protein concentration was quantified using the Bradford

assay. Ix sample buffer containing DTT was added to 40 |jg of protein and boiled at 950 for 3

minutes and then spun down briefly and cooled for 2 minutes. The samples were then loaded on

to a SDS Tris -Glycine gradient gel 4-12% (Invitrogen) and run at 130V for 2 hours. The gel

was then removed and the protein was transferred on to a nitrocellulose membrane using the

semi dry transfer blot system (BioRad). Following the transfer, the nitrocellulose membrane was

blocked for 1 hour in Tris Buffer Saline and 0.05% Tween (TBST) with 5% milk powder. After

the blocking period was over the membrane was washed 3x for 5 minutes with TBST and then

the respective primary antibody was added and incubated over night at 40C. DDAH was

detected by anti-DDAH-1 and DDAH-2 rabbit IgG obtained from Dr. Renke Mass (Hamburg,

Germany) and diluted 1:1000. Following the overnight incubation with the primary antibody the

membrane was washed for 15 minutes 3x with TBST and the secondary goat-anti rabbit hrp tag

antibody diluted 1:2000 was added. After 1 hour of incubation at room temperature, detection









was preformed using an enhanced chemiluminescence kit purchased from Amersham

Biosciences.

Assessment of mRNA Levels Following DDAH Gene Silencing

Following the 72 hour siRNA transduction period, BAECs were trypsinized and spun

down at 1000 x g for 4 minutes. The cell pellet was then wash 1 x with PBS and centrifuged at

1000 x g for an additional 4 minutes. The cell pellet was then homogenized in lysis buffer from

the Qiagen (Valencia,CA) RNAeasy Mini Kit. Following lysis, RNA was extracted using a

Qiagen (Valencia,CA) RNAeasy Mini Kit. cDNA was then isolated using the Invitrogen

(Carsbad,CA) One Step RT-PCR kit. Semiquantive PCR was preformed in order to detect

changes in mRNA expression following DDAH-1 or DDAH-2 gene silencing. Bovine Primers

for DDAH-1 Forward (GAGGAAGGAGGCTGACATGA), DDAH-1 Reverse

(TTCAAGTGCAAAGCATCCAC), and DDAH-2 Forward

(CTAGCCAAAGCTCAGAGGGACAT), DDAH-2 Reverse

(TCAGTCAACACTGCCATTGCCCT) were purchased from Invitrogen (Carsbad, CA).

eNOS Activity

eNOS activity was measured from the conversion of L-[14C] arginine to L-[14C]citrulline.

A T-75 flask was used for each measurement, BAECs were trypsinized, pelleted and

resuspended in 132 |pL of 50 mM Tris (pH 7.4). The cells were then sonicated 3 x 2 seconds and

28 |pL of reaction buffer (50 mM Tris containing 5 pM L-[14 C] arginine, 50 pM L-arginine 500

IM NADPH/50 pM CaCl2/50 [iM H4B pH 7.4) The samples were then incubated in a water bath

at 37 C for 30 minutes. Following the 30 minute incubation the reaction was stopped with 1ml

of ice-cold stop buffer using 20 mM N 2-Hydroxyethlypiperazine-N'-2 ethansulfonic acid

(HEPES) with 2mM EDTA, pH 5.5. Separation of L- [14 C] arginine from to L-[14C]citrulline









was performed using the cation exchange resin Dowex AG50WX-8 (0.5ml Na form,

Pharmacia). The L- [14C] citrulline in the eluent was then quantitated using a liquid scintillation

counter

Results

Effects of DDAH 1 and 2 Over- Expression on Endothelial NO Production

Previous studies have demonstrated that both DDAH-1 and DDAH-2 are expressed in the

vasculature. However, it is presently unknown which of the DDAH isoforms is responsible for

the regulation of endothelial NO. Therefore, studies were carried out using adenoviral mediated

over-expression of both DDAH-1 and DDAH-2 in order to determine which isoform is

responsible for endothelial methylarginine metabolism and NO regulation. Endothelial cells

were grown to 90% confluency and then transduced with either ad-DDAH-1 (50 MOI) or ad-

DDAH-2 (50 MOI) for 48 hours. Western blot analysis demonstrated robust increases in

endothelial expression of both DDAH-1 and DDAH-2 following respective adenoviral treatment

(Figure 3-1) At the end of the 48 hour period NO production was measured by EPR as

previously described. Results demonstrated that following 48 hours of transduction, adDDAH-1

mediated over-expression resulted in a 24% increase in NO production over basal NO levels

(Figure 3-2). It was anticipated that if DDAH over-expression is increasing NO through the

metabolism of basal methylarginines, then L-arg supplementation should prevent the increase.

Endothelial cells were transduced with adDDAH-1 for 48 hours as previously described. After

the 48 hour exposure the media was removed and BAECs were incubated with L-Arg (100 C[m)

for 30 minutes in KREBS-HEPES buffer. Results demonstrated that L-Arg supplementation

alone resulted in a 30% increase in basal NO production in control cells (Figure 3-2). Moreover,

in the presence of DDAH-1 over-expression, L-arginine supplementation resulted in an additive

effect with a 13% increase in NO compared to L-arg supplementation alone.









Similar to adDDAH-1, DDAH-2 over-expression resulted in an 18% increase in

endothelial cell NO production (Figure 3-3). Similar results were obtained with L-arginine

supplementation of DDAH-2 over-expressing cells in which we observed a 45% increase NO

production following the addition of L-arg compared to a 28% increase with L-arg

supplementation alone (Figure 3-3). The observation that the effects of L-arg supplementation

on NO production are not attenuated in the presence of DDAH-1 or DDAH-2 over-expression

possibly demonstrates that ADMA is not responsible for the "arginine paradox" as has been

proposed.

Effects of DDAH-1 and DDAH-2 Over-Expression on ADMA Inhibition

The previous studies assessed the effects of DDAH over-expression on NO production in

the presence of normal physiological levels of methylarginine. Given that normal intracellular

methylarginines are in the low micromolar range it would not be expected that physiological

levels of these competitive NOS inhibitors would elicit pathological eNOS inhibition.

Therefore, additional studies were performed in the presence of exogenously added ADMA to

assess whether DDAH over-expression can overcome ADMA accumulation at levels observed

with cardiovascular disease states [96]. Results demonstrated that exogenously added ADMA

(10 iM) resulted in 40% inhibition of endothelial cell NO production from BAECs and that

over-expression of either DDAH-1 or DDAH-2 was able to restore 50% of the loss in endothelial

NO production (Figure 3-4). These results indicate that both DDAH-1 and DDAH-2 may serve

as potential therapeutic targets for the treatment of diseases associated with elevated ADMA.

Effects of DDAH 1 and 2 Silencing on Endothelial NO Production

Previous studies have suggested that a decrease in DDAH activity, as has been observed in

vascular disease, contributes to endothelial dysfunction through a mechanism involving

increased cellular ADMA levels. In support, ADMA levels are an independent risk factor for









cardiovascular disease and results from numerous clinical and basic science studies have

revealed increased ADMA levels in a variety of diseases including diabetes, pulmonary

hypertension, coronary artery disease and atherosclerosis [240, 241, 249, 265, 267-269].

However, whether loss of DDAH activity is directly responsible for the impaired NO production

and which specific isoform is responsible for NO regulation in the endothelium are unknown.

Therefore, in order to determine the role of each DDAH isoform in the regulation of endothelial

NO, cellular studies were performed using BAECs to asses the effects of DDAH-1 and 2 gene

silencing on NO production. Bovine aortic endothelial cells were cultured in 6 well plates and

using the reverse transfection protocol described in the methods, DDAH -1 and DDAH-2 genes

were silenced with specific siRNA's. The degree of gene knock-down was evaluated using

semi-quantitative PCR analysis of DDAH-1 and DDAH-2 mRNA expression. This approach

was used in lieu of protein analysis because basal levels of DDAH-2 are undetectable by western

blot. Results demonstrated that DDAH-1 and DDAH-2 silencing resulted in greater than 70%

reduction in mRNA expression for the respective gene (Figure 3-5). In addition to DDAH

mRNA expression, the effects of siRNA mediated DDAH gene silencing on endothelial DDAH

activity was measured. Following 72 hours of DDAH-1, DDAH-2 or dual silencing, BAECs

were assessed for DDAH activity by measuring the conversion of L-[3H]NMMA to L-

[3H]Citrulline. Results demonstrated that DDAH-1 gene silencing resulted in a 64% decrease in

totally DDAH activity. DDAH-2 gene silencing resulted in a 48% decrease in total DDAH

activity (Figure 3-6). Interestingly, silencing of both DDAH-1 and DDAH-2 resulted in only a

50% drop in total DDAH activity suggesting that other methylarginine metabolic pathways may

be invoked as a consequence of loss of DDAH activity (Figure 3-6).









The functional effects of DDAH gene silencing were assessed using EPR spin trapping to

measure endothelial derived NO production. Results demonstrated that DDAH-1 silencing

reduced endothelial NO production by 27% (Figure 3-7). In order to determine whether the

effects of DDAH gene silencing on NO production resulted from increased intracellular levels of

ADMA, L-arg supplementation experiments were carried out to assess the ability of L-arg to

overcome ADMA mediated eNOS inhibition. Specifically, DDAH gene silencing studies were

carried out in the presence of L-arg (100 [iM). Results demonstrated that L-arginine (100 pM)

supplementation restored 50% of the siDDAH-1 mediated loss of endothelial NO production

(Figure 3-7). DDAH-2 gene silencing resulted in a 57% reduction in endothelial NO production.

L-arginine supplementation did not increase endothelial NO production in DDAH-2 silenced

BAEC's (Figure 3-8). These results suggest that the effects of DDAH-2 silencing on endothelial

NO production are independent of ADMA-mediated eNOS inhibition. Additional studies were

performed in which both genes were silenced. Silencing of both the DDAH-1 and DDAH-2

genes resulted in 55% inhibition which was not increased with L-arg supplementation (Figure 3-

9).

These results are surprising given that L-arg would be expected to overcome the

accumulation of methlyarginines. Therefore, to confirm that L-arg supplementation can in fact

ameliorate ADMA mediated inhibition, additional studies were carried out with cells treated with

exogenous ADMA and the ability of L-arg supplementation to overcome eNOS inhibition was

measured. Cellular studies were carried out using BAEC's stimulated by calcium inonophore

A23187 (1 iM). EPR-based NO measurements were preformed in modified KREBS buffer (0.5

mM Fe2+ and 5 mM MGD) in the presence or absence of L-arg (100 iM). The dose-dependent

effects of ADMA (0-10 iM) were then measured. Results demonstrated that ADMA dose-









dependently inhibited eNOS-derived NO production with 5 M ADMA eliciting 46% inhibition

and 10 iM ADMA, exhibiting 58% inhibition in the absence of L-arg. In the presence of

physiologically relevant L-arg levels (100 [iM), ADMA treatment resulted in a dose-dependent

inhibition of endothelial NO with < 20 % inhibition seen at ADMA concentrations of 5 iM.

Overall these results demonstrate that L-arg supplementation can only partially restore the loss in

NO production occurring after ADMA administration. Although the addition of exogenous L-

arg would be expected to fully restore ADMA mediated eNOS inhibition, these results are

consistent with previous studies demonstrating partial restoration of endothelial NO with L-arg

following exposure to exogenous ADMA [96] (Figure 3-10).

Effects on DDAH Gene Silencing on Methylarginine Metabolism

As demonstrated earlier, when both DDAH-1 and DDAH-2 were silenced, total DDAH

activity was only inhibited by 50%, suggesting the endothelium may possess alternate metabolic

pathways for methylarginine metabolism. These are unexpected results given that DDAH is

considered to be the principle metabolic pathway for ADMA metabolism and was previously

demonstrated to mediate >80% of cellular methylarginine metabolism [267]. Therefore, studies

were carried out using HPLC techniques with radiolabeled NMMA to assess the metabolites of

methylarginine metabolism. Results demonstrated that in BAECs that were not silenced three

radiolabled peaks were identified, arginine, citrulline and L-NMMA. However, in BAECs that

were silenced an additional unidentified radiolabled peak was observed suggestive of induction

of an alternate metabolic pathway. Furthermore, following dual gene silencing the concentration

of the unknown metabolite increased 2-fold (Table 3-1). These results would suggest that

BAECs have an alternate inducible pathway for methylarginine metabolism in response to loss

of DDAH activity or methylarginine accumulation.

Effects of DDAH 1 and 2 Gene Silencing on eNOS Activity









The studies on DDAH silencing demonstrate that loss of DDAH-2 expression/activity may

elicit ADMA independent effects given that L-arg supplementation was not able to enhance

endothelial NO production from DDAH-2 silenced cells. Therefore, studies were carried out in

order to determine whether gene silencing has any direct effects on eNOS activity independent of

ADMA. Studies were performed measuring the conversion of L- [14C] Arginine to L- [14C]

Citrulline from BAEC homogenates following DDAH gene silencing. Results demonstrated that

DDAH-1, DDAH-2 and dual silencing resulted in no change in total eNOS activity based on L-

NAME inhibitable counts (Figure 3-11).

Discussion

ADMA plasma levels have been shown to be elevated in diseases related to endothelial

dysfunction including hypertension, hyperlipidemia, diabetes mellitus, and others [267, 268,

270-272]. Moreover, it has been shown that ADMA predicts cardiovascular mortality in patients

who have coronary heart disease (CHD). Recent evidence published from the multicenter

Coronary Artery Risk Determination investigating the Influence of ADMA Concentration

(CARDIAC) study has indicated that ADMA is indeed an independent risk factor for CAD

[273]. There is a growing body of evidence implicating ADMA as a key player in endothelial

dysfunction and a independent risk factor involved in the pathophysiology of a variety of

cardiovascular diseases including hypertension, and atherosclerosis (21-26). Recently several

groups have demonstrated that modulating DDAH activity can have a profound effect on

endothelial NO production [237, 240]. In this regard, our group and others have shown that

over-expression of DDAH-1 results in increased NO production [242, 274]. Furthermore,

OxLDL and TNFac have been shown to decrease DDAH activity leading to decreased endothelial

NO production [275]. It has also been demonstrated that 4-hyrdoxy-nonenal (4-HNE), the









highly reactive oxidant product of lipid peroxidation, inhibits DDAH activity and leads to

impaired NO generation through the formation of Michael addition products in the catalytic triad

of DDAH [274]. Thus, evidence suggests that DDAH-1 activity is under redox control and loss

of enzyme function impairs endothelial NO generation.

Whether the increased risk associated with elevated ADMA is a direct result of NOS

impairment is an area of controversy. Significant debate about the contribution of ADMA to the

regulation of NOS-dependent NO production has been initiated. In pathological conditions such

as pulmonary hypertension, coronary artery disease, diabetes and hypertension, plasma ADMA

levels have been shown to increase from an average of -0.4 [iM to -0.8 [iM [269, 272, 273, 276-

278]. Given that these values are at least 2 orders of magnitude lower than the plasma L-arg

levels it is unlikely that elevated plasma ADMA can significantly regulate eNOS activity. It is

more likely that elevated plasma ADMA levels reflect increased endothelial concentrations of

ADMA. In support of this hypothesis, we and others have demonstrated that endothelial ADMA

levels increase 3-4 fold in restenotic lesions and in the ischemia reperfused myocardium [96,

279]. Based on the kinetics of cellular inhibition, these concentrations of ADMA would be

expected to elicit a 30-40% inhibition in NOS activity [96]. These studies however involve

lesion specific increases in ADMA and are not associated with increased plasma levels of

ADMA and would not be expected to contribute to systemic cardiovascular pathology. In this

regard, there is little direct evidence that elevated plasma ADMA levels are associated with

increased endothelial ADMA nor is it clear whether ADMA directly contributes to the NOS

inhibition observed in chronic cardiovascular diseases. The current hypothesis in the field

suggests that decreased DDAH activity, as has been observed in cardiovascular disease, results

in impaired endothelial methylarginine metabolism with subsequent elevation in ADMA leading









to NOS inhibition. However, identification of the endothelial DDAH isoform responsible for

NOS regulation and direct evidence for its role in modulating endothelial NO production has not

been demonstrated. Therefore, the current study was undertaken to evaluate the roles of both

DDAH-1 and DDAH-2 in the regulation of methylarginine metabolism and endothelial NO

production.

Initial studies were carried out to determine how cellular endothelial NO production is

regulated by the DDAH isoforms. DDAH-1 and DDAH-2 over-expression was induced using an

adenoviral construct carrying either the human DDAH-lgene (adDDAH-1) or DDAH-2 gene

(adDDAH2). Results demonstrated that adenoviral mediated overexpression of both DDAH-1

and DDAH-2 increased cellular endothelial NO production. These initial studies were done in

the presence of basal methylarginine levels and demonstrate that normal endogenous levels of

these NOS inhibitors are present at concentration sufficient to regulate eNOS activity. It had

previously been proposed that ADMA may be responsible for the "arginine paradox" and these

studies would appear to support the hypothesis. However, subsequent studies using L-arg

supplementation with DDAH over-expression demonstrated an additive effect which suggests

that ADMA is not involved in the "arginine paradox".

It has been estimated that more than 80% of ADMA is metabolized by DDAH [267],

however, it is unclear which DDAH isoform represents the principal methylarginine

metabolizing enzyme. PCR and western blot analysis revealed that the endothelium contains

mRNA and protein for both DDAH-1 and DDAH-2. However, in order to assess the relative

contribution of each isoform a detailed analysis of the enzyme kinetics of each isoform is

necessary. Unfortunately, detailed biochemical studies have only been published for DDAH-1

[228, 249]. Using purified recombinant hDDAH-1 we and others have demonstrated the precise









enzyme kinetics of this isoform and results demonstrated Km values of 68.7 and 53.6 [tM and

Vmax values of 356 and 154 nmols/mg/min for ADMA and L-NMMA, respectively [228, 249]. In

regards to DDAH-2, previous attempts at purifying the protein have been unsuccessful primarily

due to solubility issues with recombinant enzyme. Therefore, to investigate the role of the

DDAH isoforms in the regulation of endothelial NO production, studies were performed using

siRNA to silence both the DDAH-1 and DDAH-2 genes in BAECs. It was anticipated that

silencing of DDAH would lead to increased cellular methylarginines and decreased endothelial

NO production. Results supported this prediction and demonstrated that DDAH-1 silencing

reduced endothelial NO production by 27% while DDAH-2 silencing reduced it by 57%. These

studies were then repeated with L-arg supplementation in order to establish the ADMA

dependence of the DDAH effects. The addition of L-arg (100 [iM) was able to restore ~ 50% of

the loss of endothelial NO generation observed with DDAH-1 silencing. Although it may be

predicted that L-arg supplementation should completely restore NO production given that

ADMA is a competitive inhibitor of NOS, these result are consistent with previously published

studies and suggest that DDAH-1 silencing may lead to ADMA accumulation in sites that are not

freely exchangeable with L-arg. In support of this hypothesis it has been demonstrated by Simon

et al. that within the endothelial cell exists two pools of arginine both of which eNOS has access

to. Pool I is largely made up of extracellular cationic amino acids transported through the CAT

transport system, however Pool II does not freely exchange with extracellular cationic amino

acids. Furthermore they also demonstrated that Pool II is separated into two components. Pool

II A participates in the recycling of citrulline to arginine, while Pool II B is occupied by protein

derived by-products. It is within this Pool II B where the methylarginines are likely to

accumulate, thus rending its inhibitory effects on eNOS [280]. Alternatively, ADMA and/or









DDAH may elicit effects that are independent of NOS, this appears to be the most plausible

explanation with regards to DDAH-2 wherein loss of activity reduced endothelial NO production

by greater than 50% and the loss was unaffected by L-arg supplementation. This is strong

evidence that DDAH may elicit effects that are independent of ADMA. Although this may

represent an overall paradigm shift with regards to the role of DDAH in the endothelium, it is not

with out support. The most convincing evidence that DDAH may regulate cellular function

through mechanisms independent of ADMA mediated NOS inhibition come from data on the

DDAH-1 knockout mouse. Homozygous null mice for DDAH-1 are embryonic lethal while the

NOS triple knockout mice are viable [240]. This further supports are hypothesis that DDAH

effects are not limited to ADMA dependent regulation of eNOS.

It has been widely reported that DDAH-2 is the predominant DDAH isoform in the

vascular endothelium; however these studies have widely relied on assessing the expression of

the DDAH isoforms in various cell and tissue types [237, 240, 281, 282]. Consequently, studies

were carried out in BAECs to determine which isoform is responsible for the majority of the

DDAH activity in the endothelial cell. DDAH-1 and DDAH-2 gene silencing decreased total

DDAH activity by 64% and 48%, respectively. Additional studies demonstrated that dual gene

silencing only resulted in a 50% loss total DDAH activity in BAECs thus suggesting that other

methylarginine metabolic pathways may be invoked as a consequence of loss of DDAH activity.

To investigate the possibility that loss of DDAH activity may lead to the induction of other

methyalrginine metabolic enzymes we used HPLC techniques to measure the metabolic products

of 14C-L-NMMA. In control cells we observed 3 peaks with radioactive counts and they were

identified as L-NMMA, L-arginine and L-cittruline. The formation of radiolablled L-citrtruline

is likely from the metabolism of L-NMMA by DDAH while radioactive L-arg is generated from









citrulline recycling through ASS and ASL. In contrast, results from DDAH-1 and DDAH-2

silenced cells indicated the presence of 4 radioactive peaks including L-NMMA, L-arginine, L-

cittruline and a yet unidentified peak. The concentration of this unidentified peak increased 2

fold in the dual silencing group as compared to the levels in either the DDAH-1 or DDAH-2

silencing groups alone. Initial mass spec analysis has been unsuccessful in identifying the

unknown species and is currently an area of active investigation in our lab. Regardless, the

results clearly indicate that the endothelium possesses an alternate inducible pathways for

metabolizing methylarginies. Together, these results demonstrate that both DDAH-1 and

DDAH-2 are involved in the regulation of endothelial NO production. However, while DDAH-1

effects are largely ADMA-dependent, DDAH-2 effects appear to be ADMA-independent.

To determine whether the ADMA-independent effects of DDAH silencing on endothelial

NO production involved changes in eNOS protein, we measured eNOS activity from BAEC

homogenates following DDAH-1, DDAH-2 and dual silencing. Analysis of eNOS activity

demonstrated that DDAH gene silencing had no effect on the enzyme. These experiments were

carried out in the presence of saturating concentrations of substrate and cofactors and can rule

out DDAH effects on endothelial substrate/cofactor bioavailability.

Overall these results demonstrate that loss of DDAH activity, as has been demonstrated in

a number of cardiovascular diseases, leads to significant inhibition of endothelial NO production.

Moreover, the effect of DDAH-1 and DDAH-2 on endothelial NO appear to manifest through

very different mechanisms. DDAH-1 appears to be largely and ADMA dependent effect, while

DDAH-2 appears mostly to mediate its effects independent of ADMA. Moreover, we have

demonstrated for the first time an alternative pathway through which methlyarginines can be

metabolized.









Multiplicity of Infection (MOI)


0 10


w


.--- .... DDAH-2




Figure 3-1. DDAH Over-expression. DDAH-1 and DDAH-2 expression was measured by
western blot techniques from BAECs transduced for 48-hours with adDDAH-
1(10,25,50 MOI) and adDDAH-2(10,25,50 MOI)


SW 4- DDAH-1















400

300

200

100

0


*


T1


Control OAA


adDDAH-1



Control+ L-arg



adDDAH-1 + L-arg


1 1 I I I I


3370


3420
Magnetic Field (Gauss)


3470


L-Arg(lOO pM)


Figure 3-2. Effects of adDDAH-1 over expression on endothelial cell NO production. NO generation from calcium ionophore
A23187 (1 giM) stimulated BAECs (1x106) was measured by EPR spin trapping with the Fe2+-MGD complex. The left side
of the panel represents the amplitude of the NO triplicate EPR spectra of a 30 consecutive 20 second scans following a 30
minute incubation period.B)The right panel represents the characteristic triplicate NO spectra and the effects of adDDAH-1
over-expression on NO production. Results are means SD. Significance at p<0.05 as compared to the control. n=9











Control



adDDAH-2


Control+ L-arg



adDDAH-2 + L-arg


I Il I I I


Magnetic Field (Gauss)


L-Arg (100 pM)


Figure 3-3. Effects of adDDAH-2 over expression on endothelial cell NO production. NO generation from calcium ionophore
A23187 (1 gM) stimulated BAECs (1x106) was measured by EPR spin trapping with the Fe2+-MGD complex. The left
side of the panel represents the amplitude of the NO triplicate EPR spectra of a 30 consecutive 20 second scans following a
30 minute incubation period. The right panel represents the characteristic triplicate NO spectra and the effects of
adDDAH-2 over-expression on NO production. Results are means SD as compared to the control. Significance at
p<0.05 as compared to the control. n=9


*


ns
Tf


ff


3370


3420


3470









200


*m


-I


iT


T


T


150 -



100 -



S50 0




Cont ADMA Cont ADMA
I I
adGFP adDDAH1


-,-
I


Cont ADMA Cont ADMA
I I
adGFP adDDAH2


Figure 3-4. Effects of DDAH-1 and DDAH-2 over-expression on ADMA mediated inhibtion of endothelial NO production. NO
generation from calcium ionophore A23187 (1 giM) stimulated BAECs (1x106) was measured by EPR spin trapping with
Fe2+-MGD complex. Experimental groups consisted of adGFP (control) adDDAH-1 and adDDAH-2. These experiments
were preformed in the absence and presence of ADMA (5 giM). Results are SD Significance at p<0.05 as compared to
the respective control.


250


200


150-


100-


50









siDDAHI
I


siDDAH2
I


4-DDAH2
4-" DDAH1





Figure 3-5. Effects of DDAH gene silencing on DDAH mRNA expression. DDAH mRNA
expression was measured by semi quantitative PCR, and ran on an agarose gel to
check for differences in DDAH expression following siRNA treatment. Experimental
groups consist of 60 nM siRNA (DDAH-1, DDAH-2) and 240 nM siRNA (DDAH-1
and DDAH









2500


2000



1500 -



1000 *



500

00
0










Figure 3-6. Effects of DDAH gene silencing on endothelial cell DDAH activity. DDAH activity was measured from BAEC
homogenates following 72 hours of DDAH gene silencing. Experimental groups consisted of si-DDAH-1, si-DDAH-2, si-
DDAH1/2. Results are means SD. Significance at p<0.05 as compared to the control. n=3









Control


siDDAH-1


250


200


150


100 *


50 .


0.0


Magnetic Field (Gauss)


Figure 3-7. Effects of DDAH-1 gene silencing on endothelial cell NO production. NO generation from calcium ionophore A23187 (1
IM) stimulated BAECs (1x106) was measured by EPR spin trapping with the Fe2+-MGD complex. Experimental groups consisted of
scrambled siRNA (control), and si-DDAH-1.These experiments were preformed both in the presence and absence of L-arginine
(100CiM). Results are means SD. Significance at p<0.05 as compared to the respective control.n=9


Control+ L-Arg



siDDAH-1 + L-Arg


*


-I-


3370


3420


3470















Control


siDDAH2


Cuntrul+L-ArK


*


siDDAH-2+L-Arg


Magnetic Field (Gauss)


Figure 3-8. Effects of DDAH-2 gene silencing on endothelial cell NO production. NO generation from calcium ionophore A23187 (1
IM) stimulated BAECs (1x106) was measured by EPR spin trapping with the Fe2+-MGD complex. Experimental groups
consisted of scrambled siRNA (control) and siDDAH-2.These experiments were preformed both in the presence and
absence ofL-arginine (100 [iM). Results are means SD. Significance at P<0.05 as compared to the respective control.
n=9


200


160

S120

I 80










Control


siDDAH1/2


Control + ]



siDDAH-1/2 +


+a +


3
33r


0I
70


3420 3470


Magnetic Field (Gauss)


Figure 3-9. Effects of DDAH-1 and DDAH-2 gene silencing on endothelial cell NO production. NO generation from calcium
ionophore A23187 (1 giM) stimulated BAECs (1x106) was measured by EPR spin trapping with the Fe2+-MGD complex.
Experimental groups consisted of scrambled siRNA (control) and siDDAH-2.These experiments were preformed both in
the presence and absence ofL-arginine (100 iM). Results are means SD. Significance at p<0.05 as compared to the
respective control.n=9


vov" ^









SL-Ag (N L-arg(DpM)

L-Arg (100CM)


250

200

150

100

50

0.


L-arg(100pM)


A A ^ t Control A



5IWM ADMA


10MM ADMA
^^V\A^^ vVVU/v-


3370
3370


3420


3470 3370


3420


3470


ADMA(QM)


Magnetic Field (Gauss)


Magnetic Field (Gauss)


Figure3-10. Effects of ADMA on endothelial cell NO production. NO generation from calcium ionophore A23187 (1 giM) stimulated
BAECs (1x106) was measured by EPR spin trapping with the Fe2+-MGD complex. Experimental groups consisted of
control (0 giM), 5 giM and 10 giM ADMA. These experiments were preformed both in the presence and absence of L-
arginine (100 iM). Results are means SD. Significance at p<0.05 as compared to the respective control. n=9


10


i
5









1000



800






C 400 *



200












Figure 3-11. Effects of DDAH gene silencing on endothelial cell eNOS activity. eNOS activity was measured from BAEC
homogenates following 72 hours of DDAH gene silencing. Experimental groups consisted of si-DDAH-1,si-DDAH-2,si-
DDAH1/2 Results are means SD. n=3










Table 3-1. L-NMMA Metabolism


Arginine Citrulline Unknown
Control 5.5 [M 4.07 [iM 0 [iM
siDDAH-1 5 [M 1.5 iM 2.2 [iM
siDDAH-2 4.25 [M 2.05 [M 2.8 [M
siDDAH-1/2 5.1 [M 1.27 [M 4.4 [M
BAECs were cultured in 6 well plates and transfected with siRNA. Following the 72 hour transfection period, cellular amino acid
content was measured and quantified using HPLC techniques with ESA peak integration software.






00
0









CHAPTER 4
ROLE OF DDAH-1 IN THE 4-HYDROXY-2-NONENAL MEDIATED INHIBTION OF
ENDOTHELIAL NITRIC OXIDE GENERATION

Introduction

Endothelium-derived nitric oxide (NO) is a potent vasodilator that plays a critical role in

maintaining vascular homeostasis through its anti-atherogenic and anti-thrombotic effects on the

vascular wall [283-285]. In this regard, impaired endothelial derived NO production has been

implicated in the pathogenesis of atheroproliferative disorders [286]. Among the proposed

mechanisms for the impaired NOS activity observed in these conditions are the elevated levels of

oxidatively modified lipids [287, 288]. Polyunsaturated fats in cholesterol esters, phospholipids

and triglycerides are subjected to free radical initiated oxidation. These polyunsaturated fatty

acid peroxides can yield a variety of highly reactive smaller molecules such as the aldehyde 4-

hydroxy-2-nonenal (4-HNE) upon further oxidative degradation [289]. 4-HNE is a major

biologically active aldehyde formed during lipid peroxidation of w6 polyunsaturated fatty acids

which has been shown to accumulate in membranes at concentrations from 10 |jm to 5 mM

[290]. There is a body of evidence which suggests that reactive aldehydes such as 4-HNE play a

role in the progression of atherosclerosis. Plasma concentrations of these reactive aldehydes are

known to increase relative to the progression of aortic atherosclerosis, and during the oxidation

of LDL high concentrations of the reactive aldehydes are generated [291, 292]. It has been

suggested that the elevations in these highly reactive lipid hydroperoxide degradation products

result in impaired endothelial function and atherosusceptibility, secondary to NOS impairment

[288, 293, 294]. In support of the importance of the reactive aldehyde involvement in

endothelial dysfunction, here we demonstrate that exposure of aortic endothelial cells to 4-HNE

dose-dependently inhibits NO bioavailability. We hypothesize that the decrease in NO









bioavailability is a result of increased levels of the NOS inhibitors, asymmetric dimethly arginine

(ADMA) and NG monomethyl arginine (L-NMMA).

ADMA has been shown to be increased in conditions associated with increased risk of

atherosclerosis and independently predicts total and cardiovascular mortality in individuals with

angiographic coronary artery disease [31, 34, 273, 295-297]. However, little is known with

regards to the pathways leading to the methylarginine accumulation observed in cardiovascular

diseases. These endogenous inhibitors of NOS are derived from the proteolysis of methylated

arginine residues in various proteins. The methylation is carried out by a group of enzymes

referred to as protein-arginine methyl transferase's (PRMT's). Subsequent proteolysis of

proteins containing methylarginine groups leads to the release of free methylarginine into the

cytoplasm where NO production from NOS is inhibited [35, 298, 299]. These methylarginines

are subsequently degraded by the enzyme DDAH which hydrolyzes the conversion of ADMA to

L-citrulline and dimethylamine [36, 300]. The activity of DDAH has been shown to be

decreased by oxidized LDL and tumor necrosis factor (TNF-a), yielding increased

methylarginine levels with subsequent impairment of NOS-derived NO generation [239, 261,

301, 302]. Because NO is known to possess anti-proliferative and anti-atherogenic properties,

methylarginine accumulation in response to the decreased DDAH expression/activity has been

proposed to be involved in the vascular pathophysiology observed in a variety of cardiovascular

diseases [35, 96, 303-305]. However, the mechanisms as to how methylarginines are modulated

and what role they play in disease progression are not understood. Therefore, the current studies

were performed in order to establish the effects of the lipid peroxidation degradation product 4-

HNE on NO production and determine if methylarginines are involved in the lipid peroxidation

mediated pathogenesis of endothelial dysfunction.









Materials and Methods


Materials

4-HNE was purchased form Biomol (Plymouth Meeting, PA). BAECs were purchased

form Cell-Systems (Kirkland, WA). All other reagents were purchased from Sigma (St.Louis,

MO).

Cell Culture

Bovine aortic endothelial cells (BAECs) were purchased from Cell-Systems and cultured

in DMEM containing 10% FBS, 1% NEAA, 0.2% endothelial cell growth factor supplement and

1% antibotic-antimyotic and incubated at 370C under a humidified environment containing 5%

CO2 95% 02. For experiments involving exposure to 4-HNE, 4-HNE was prepared as a stock

solution in ethanol at a concentration of 50 mM. The 4-HNE was then added to the media of

BAECs and incubated for 24 hrs. Dilutions of 4-HNE were performed in order to maintain the

final ethanol concentration below 0.2%.

Epr Spectroscopy and Spin Trapping

Spin-trapping measurements of NO were performed using a Bruker ESP 300E

spectrometer with Fe-MGD as the spin trap [96, 306]. For Measurements of NO produced by

BAECs cells were cultured as described above and spin trapping experiments were performed

on cells grown in 6-well plates (1 x 106 cells/ well). In these studies, cells attached to the

substratum were utilized since scraping or enzymatic removal leads to injury and membrane

damage with impaired NO generation. The medium from each well was removed and the cells

were washed 3 x with PBS (w/o CaCl2 or MgCl2). Next, 0.3 ml of PBS containing glucose (1

g/L), CaCl2, MgCl2, the NO spin trap FE-MGD (0.5 mM Fe2+, 5.0 mM MGD), and calcium

ionophore (1 [pM) was added to each well and the plates were incubated at 37 C under a

humidified environment containing 5% CO2 95% 02 for 30 min. Following incubation, the









medium from each well was removed and the trapped NO in the supernatants was quantified

using EPR. Spectra recorded from these cellular preparations were obtained using the following

parameters: microwave power; 20 mW, modulation amplitude; 3.16 G and modulation

frequency; 100 kHZ.

Measurement of Endothelial Cell ADMA and L-Arg Levels

BAEC's were collected from confluent 75 cm2 culture flask by gentle scraping followed by

sonication in PBS followed by extraction using a cation-exchange column. Samples were

derivatized with OPA and separated on a Supelco LC-DABS column (4.6 mm x 25 cm i.d.,5 C[m

particle size) and L-Arg and methylarginines separated and detected using an ESA (Chelmsford,

MA) HPLC system with electrochemical detection at 400 mV [306]. Intracellular levels of L-

Arg and methylarginines were determined from values derived from standard curves of each

analyte using the ESA peak integration software assuming the endothelial cell intracellular water

content of 2 pL.

DDAH-1 and eNOS Expression

DDAH-1 was detected by anti-DDAH-1 goat IG purchased from IMGENEX and diluted

1:2000 (San Diego, CA). eNOS was detected using an anti-eNOS antibody purchased from

Calbiochem (San Diego, CA). The secondary antibodies were donkey anti-goat IgG-HRP and

goat anti-rabbit IgG-HRP, respectively, and purchased from Santa Cruz (Santa Cruz, CA). The

secondary antibodies were diluted 1:2000. Western blot detection was performed using an

enhanced chemiliumnesece kit purchased from Amersham Biosciences (Piscataway, NJ).

DDAH Activity

DDAH activity was measured from the conversion of L-[14C]L-NMMA to L-[14C]

citrulline. BAECs grown to confluence in T-75 flasks were trypsinized, pelleted and

resuspended in 150 upL of 50 mM Tris (pH 7.4). The cells were then sonicated 4 x 2 seconds and









150 |pL of the reaction buffer (50 mM Tris, 20 [LM L-[14C]L-NMMA, 180 [LM L-NMMA, pH

7.4) was added to each sample. The samples were then incubated in a water bath at 37 C for 90

minutes. Following the incubation, the reaction was stopped with 1 ml of ice-cold stop buffer

using 20 mM N-2 Hydroxyethylpiperazine-N'-2 ethanesulfonic acid (HEPES) with 2 mM

EDTA, pH 5.5. Separation of L-[14C]citrulline from L-[14C]L-NMMA was performed using the

cation exchange resin Dowex AG50WX-8 (0.5 ml, Na+ form, Pharmacia). The L- [14C]

citrulline in the eluent was then determined using a liquid scintillation counter.

Results

Effects of 4-HNE on Endothelial Cell NO Production

Previous studies have demonstrated that lipid hydroperoxide levels are elevated in

atherosclerotic lesions and the presence of these oxidized lipid congeners may contribute to the

endothelial dysfunction observed in CAD [291, 292]. Therefore, in order to determine the

effects of lipid hydroperoxides on endothelial function, cellular studies were carried out using

BAECs stimulated with calcium ionophore to assess the effects of 4-HNE on NO production

from endothelial cells. Endothelial cells were cultured in 6 well plates and upon reaching

confluence were exposed to 4-HNE (10-100 pM) for 24 hours. 4-HNE was dissolved in ethanol

and added directly to the media (0.1 % EtOH). This compound is highly lipophilic and readily

crosses cellular membranes, as such no carrier is needed to deliver this agent into the cell [307].

At the end of the incubation period, EPR spin trapping measurements were performed to

measure endothelial-derived NO production. Results demonstrated that 4-HNE dose

dependently inhibited NO generation from BAECs, with 10 pLM 4-HNE inhibiting NO

generation by 14%, 50 [LM inhibited NO generation by 45% and at 100 [LM a 72% inhibition was

observed (Figure 4-1). Results from these studies demonstrated that 4-HNE, at pathologically









relevant levels, dose-dependently inhibited eNOS-derived NO generation. Measurements of cell

viability demonstrated no increase in cell death with 4-HNE doses up to 50 riM, however, at 100

[iM 4-HNE cell viability decreased by 18 % following 24-hours of 4-HNE exposure. Thus all

subsequent studies were performed using 4-HNE concentrations < 50 riM. Control studies using

the non-oxidized carbonyl hexanol demonstrated no significant inhibition in cellular NO

production with concentrations up to 50 iM (Figure 4-2). The concentration of 4-HNE (50 iM)

used for subsequent studies represents pathologically relevant levels of this reactive lipid

oxidation product as previous studies have shown concentrations exceeding 50 iM 4-HNE in the

plasma of dogs following reperfusion injury [308, 309].

Effect of 4-HNE on eNOS Expression

In order to determine whether the inhibitory effects of 4-HNE on cellular NO production

were due to alterations in eNOS expression, western blot analysis was performed and

measurements of eNOS expression were carried out (Figure 4-3). NOS phosphorylation status

was measured using the western blotting techniques with anti-pSerl 179 and pThr-497 antibodies

(Figure 4-3). In addition, because calcium ionophore stimulation is known to alter Ser 179

phosphorylation, western blot experiments were also performed on A23187 stimulated BAECs

following 4-HNE treatment (Figure 4-4). Results demonstrated that the loss of NOS activity was

independent of both eNOS protein expression and phosphorylation status as both of these

outcomes were unchanged following exposure to 4-HNE.

Restoring NO Generation from Cells

Because the observed NO inhibition did not result from changes in protein expression or

phosphorylation state, we carried out additional studies aimed at assessing whether substrate or

cofactor depletion was involved in the observed decrease in NO bioavailability. In this regard,

oxidant stress, which has been shown to occur following exposure to lipid oxidation products,









has been shown to reduce the bioavailability of the critical NOS cofactor H4B [290, 310, 311].

Loss of this cofactor results in NOS uncoupling with the enzyme primarily generating

superoxide. Moreover, oxidant injury has also been demonstrated to increase cellular levels of

the endogenous methylarginine, ADMA [88]. Therefore, cellular studies were carried out to

investigate the effects of adding both an antioxidant to prevent H4B oxidation as well as the

eNOS substrate L-Arginine, to overcome endogenous methylarginine mediated NOS inhibition.

Results demonstrated that 24 hour exposure of BAECs to 50 [LM 4-HNE resulted in a 51%

decrease in endothelial NO generation (Figure 4-5). When these experiments were repeated in

the presence of GSH (1 mM) or with L-Arg supplementation (1 mM), NO production increased

by 26% and 7% respectively. Moreover, when these experiments were repeated in the presence

of both GSH and L-Arg, endothelial cell NO production was restored to near normal levels (87%

of control) (Figure 4-5). These results suggest that 4-HNE-mediated effects on NO production

involve multiple mechanisms which include elevated levels of methylarginines.

Effects of 4-HNE on Superoxide Production and Nitrotyrosine Formation

Because our previous results demonstrated that GSH was able to partially restore NO production

in BAEC treated with 4-HNE, studies were done in order to determine the effects of 4-HNE on

superoxide production (Figure 4-12). Following 24 hours of 4-HNE (50KM) treatment, resulted

in increased superoxide production in our BAEC cells. The superoxide signal was largely

quenched by the SOD mimetic. Furthermore, because it is know that oxidative stress can

increase eNOS derived by causing the oxidation of the essetinal NOS cofactor H4B we then

repeated these studies in the presence of the NOS inhibitor L-NAME. Results demonstrated that

following 24 hours of 4-HNE exposure, L-NAME treatment caused a 20% reduction in

superoxide production (Figure 4-12). Finally, because increases in superoxide production are









also know to increase OONO- production which can result in increased protein nitrosylation,

western blot analysis was done to measure nitrotyrosine formation. Results demonstrated that

there were no significant changes in protein nitrotyrosine formation. (Figure 4-11)

Effects of 4-HNE on Cellular ADMA Levels

Our observation that 4-HNE treatment impairs cellular NO production and that this

inhibitory effect can be reversed with L-Arg administration suggests that intracellular levels of

the NOS inhibitor ADMA may be elevated. In order to confirm this hypothesis, cellular levels of

ADMA and L-Arg were measured following exposure of BAECs to 50 pM 4-HNE for 24 hours.

Results demonstrated that at 24 hours post-exposure to 4-HNE, endothelial cell concentrations of

ADMA increased from 3.2 0.5 to 6.5 0.7, while L-Arg levels were not significantly different

(Figure 4-6). These results support our conclusion that the inhibitory effects of 4-HNE on

endothelial NO production are due, at least in part, to the increased levels of the competitive

NOS inhibitor, ADMA .

Effect of 4-HNE on DDAH Expression and Activity

Cellular methylarginine levels are regulated by DDAH, the enzyme responsible for the

metabolism of both ADMA and L-NMMA. Recent studies have demonstrated that the

expression and activity of this methylarginine-regulating enzyme decreases in variety of

cardiovascular diseases. Therefore, to determine whether the observed elevations in intracellular

ADMA were a result of changes in DDAH, measurements of DDAH expression and activity

were performed following exposure of BAECs to 4-HNE. BAECs were treated with 4-HNE (50

pM) followed by western blotting and enzyme activity assays. Results demonstrated that

exposure of endothelial cells to 4-HNE did not affect the protein expression (Figure 4-7), but

resulted in a 40% decrease in cellular DDAH activity (Figure 4-8). Studies were then performed









with purified recombinant hDDAH-1 to evaluate whether the observed cellular inhibition of

DDAH activity was a result of direct 4-HNE effects on the enzyme. Incubation of purified

hDDAH-1 with 50 [pM 4-HNE resulted in a 41% decrease in activity from the purified enzyme

(Figure 4-8). This loss in activity was largely restored by GSH (1 mM) pre-incubation.

Together, these results demonstrate that 4-HNE directly inhibits DDAH activity resulting in

increased methylarginine levels and thus impaired eNOS-derived NO.

Effects of DDAH Over-Expression on Endothelial NO Production Following Exposure to 4-
HNE

Our results have demonstrated that the exposure of BAECs to the lipid peroxidation

product, 4-HNE, results in the impaired NO production and accumulation of ADMA, secondary

to the loss of DDAH activity. Therefore, studies were carried out in order to determine whether

over-expression of DDAH-1 could restore endothelial NO production following 4-HNE

challenge. BAECs were grown to 80% confluence and then transduced with adDDAH-1 (25

MOI) which resulted in a 3-fold increase in DDAH 1 expression. After 24 hours of adenoviral

transfection, cells were challenged with 4-HNE and allowed to incubate for an additional 24

hours. At the end of the 24 hour challenge, EPR analysis of NO production was carried out as

described in the Material and Methods. Results demonstrated that exposure to 4-HNE (50 [pM)

resulted in a 36% decrease in NO generation in cells transduced with a control vector (Figure 4-

9). Cells over-expressing DDAH-1 demonstrated a 22% basal increase in NO generation as

compared to the control vector, suggesting that the endogenous levels of methylarginine are

sufficient to significantly inhibit cellular NO production (Figure 4-9). Exposure of cells over-

expressing DDAH-1 to 4-HNE (50 [pM) resulted in a 58% decrease in NO production, thus

demonstrating that DDAH alone cannot restore eNOS function. However, when these

experiments were repeated in the presence of GSH, DDAH over-expression was able to almost









completely restore NO production following 4-HNE challenge, while GSH alone had only

modest effect (Figure 4-9).

In order to confirm that these NO-restoring effects were dependent on increased DDAH

activity, studies were performed measuring the conversion of L-[14C]NMMA to L-[ 14C]citrulline

in BAECs. We found that exposure of BAECs to 4-HNE (50 [LM) resulted in a 38% decrease in

DDAH activity, supporting our previous HPLC results (Figure 4-10). Over-expression of

DDAH-1 increased DDAH activity by ~ 50% and this increase in activity was reduced by 25%

following exposure of BAECs to 4-HNE. Although DDAH activity was significantly higher in

the DDAH over-expressing cells exposed to 4-HNE as compared to the control, this increase in

DDAH activity was not accompanied by an in increased NO production (Figure4-9). Treatment

of BAECs with the antioxidant GSH had modest effect on the DDAH activity and did not

significantly prevent the loss of DDAH activity following 4-HNE challenge, while the

combination of DDAH over-expression and GSH increased DDAH activity by ~50% (Figure 4-

10) with near complete restoration of NO production (Figure 4-9). These results suggest that 4-

HNE causes NOS impairment through multiple mechanisms the first involving methylarginine

accumulation. The second one being NOS uncoupling, because of its known oxidative effects on

H4B(Vivar Vasquez). Evidence for NOS uncoupling is supported by our data demonstrating that

DDAH over-expression in the presence of 4-HNE actually exacerbates the effects of 4-HNE on

NO production (Figure 4-9). In this regard, we have previously reported that methylarginines

inhibit nNOS derived superoxide, and as such, over-expression of DDAH would reduce this

inhibitory effect resulting in increased NOS derived superoxide and reduced NO bioavailability

[312]. Evidence for the multiple mechanisms through which 4-HNE mediates its effects are

supported by our results demonstrating that GSH treatment alone or DDAH over-expression









alone has only moderate protection from 4-HNE induced NOS dysfunction. However, in

combination, these two treatments largely restored endothelial NO generation (Figure 4-9).

Therefore, complete protection of endothelial-derived NO generation from 4-HNE damage can

only be achieved by both preventing NOS uncoupling and oxdiase generation from other

oxidative soruces (GSH treatment) and methylarginine accumulation (DDAH over-expression).

Discussion

There is a growing volume of literature implicating ADMA as a key player in endothelial

dysfunction and strong correlative data suggesting that ADMA is involved in the

pathophysiology of a variety of cardiovascular diseases including; hypertension and

atherosclerosis [35, 303]. More recently we and others have shown that methylarginines are

elevated in response to vascular injury and that this elevation in ADMA and L-NMMA results in

impaired endothelial function [96, 313]. In addition to mechanical injury, studies have also

demonstrated that exposure of endothelial cells to pro-atherogenic lipoproteins such as LDL,

results in increased cellular ADMA levels [261]. Polyunsaturated fats in cholesterol esters,

phospholipids and triglycerides are subjected to free radical oxidation. These polyunsaturated

fatty acids can yield a variety of lipid hydroperoxides and highly reactive lipid peroxidation

products such as the aldehyde 4-hydroxy-2-nonenal (4-HNE). During inflammation and

oxidative stress levels of 4-HNE have been shown to accumulate in membranes at concentrations

from 10 |tm to 5 mM [290]. Moreover, studies have suggested that reactive aldehydes/carbonyls

such as 4-HNE may play a critical role in the progression of atherosclerosis [291, 292]. Plasma

concentrations of these lipid peroxidation products are known to increase relative to the

progression of atherosclerosis, and during the oxidation of LDL high concentrations of these

reactive aldehydes/carbonyls are formed. We thus hypothesized that elevations in lipid









peroxidation products may result in impaired endothelial function and atherosusceptibility,

secondary to NOS impairment.

Therefore, studies were performed in order to determine the effects of the highly reactive

lipid peroxidation product, 4-HNE, on endothelial-derived NO generation. Results demonstrated

that the exposure of BAECs to 4-HNE caused a dose-dependent inhibition of cellular NO

production. The observed 4-HNE effects were independent of changes in either NOS expression

or phosphorylation state, as the Western blotting analysis revealed no changes in either endpoint.

These results suggested that the observed NOS impairment involved mechanisms other than

those related to protein expression. As such, subsequent experiments were performed in order to

determine whether alterations in NOS cofactors or substrate may be involved in the decreased

NO bioavailability. In this regard, oxidant stress, which has been shown to occur following

exposure to lipid peroxidation products, has been shown to reduce the bioavailability of the

critical NOS cofactor, H4B [290, 311]. Loss of this cofactor results in NOS uncoupling evident

by impaired NO synthesis and enhanced superoxide production from the enzyme [310].

Moreover, oxidant injury has also been demonstrated to increase the cellular levels of the

endogenous methylarginine, ADMA [35]. Therefore, cellular studies were carried out to

investigate the effects of adding both an antioxidant (GSH) to prevent H4B oxidation as well as

the eNOS substrate L-Arginine to overcome endogenous methylarginine-mediated NOS

inhibition. Our data demonstrate that the addition of either GSH or L-Arginine alone had only

modest NO-enhancing effects, however, co-incubation with both GSH and L-Arg was able to

almost completely restore endothelial NO production. These data suggest that the observed NOS

impairment involves both oxidant induced NOS inhibition (alleviated by the addition of GSH) as

well as methylarginine accumulation (alleviated by the addition of excess substrate).









Direct measurement of ADMA levels and DDAH activity within cells by HPLC

demonstrated that following 4-HNE challenge intracellular ADMA levels were increased greater

than 2-fold. Based on previously published studies demonstrating the kinetics of ADMA

mediated cellular inhibition, a 2 fold increase in methylarginine levels would be expected to

inhibit NOS dependent NO generation by 20-30 % [96]. The additional inhibition observed

could be due to compartmentalization or NOS uncoupling and increased NOS derived

superoxide production in the presence of ADMA. To test this hypothesis, western blotting

studies to measure nitrotyrosine formation (Figure 4-11). Although no significant increase in

ONOO- formation was observed, this does not rule out NOS uncoupling as superoxide

generation from the enzyme is likely below detection limits. In this regard, we have also

employed EPR spin-trapping techniques to measure eNOS derived endothelial superoxide

production. These studies demonstrated increased levels of oxygen radicals which were

inhibited by ~ 20% by L-NAME (Figure 4-12). L-NAME is currently the only known specific

inhibitor of NOS derived superoxide production, however, this observation is based primarily on

studies from purified enzyme. Because L-NAME is a methyl ester and is subject to modification

by cellular esterases, its intracellular kinetics on NOS derived superoxide production are not well

characterized. Nevertheless, increased endothelial superoxide production was observed from

BAECs exposed to 4-HNE, however not all can be contributed to eNOS derived superoxide

To determine whether the increased levels of ADMA observed following 4-HNE exposure

resulted from changes in the activity of the ADMA metabolizing enzyme DDAH, its activity was

measured. Studies of DDAH activity demonstrated a 40% decrease in hydrolytic activity,

suggesting that the mechanism for the observed 4-HNE-directed NOS impairment was via an

inhibition of DDAH. Additional studies were performed on purified recombinant hDDAH-1 in









order to determine whether 4-HNE effects were through direct interaction with the enzyme.

Results demonstrated that incubation of hDDAH-1 with 4-HNE (50 [pM) resulted in a > 40%

decrease in enzyme activity. These effects were specific to 4-HNE as incubation with the non-

oxidized carbonyl hexanol (10-500 [iM) had no effect on DDAH activity (Figure 4-13). Similar

studies were performed with purified recombinant eNOS and no inhibition was observed

following 4-HNE exposure. 4-HNE forms Michael adducts with histidine and cysteine residues

on proteins. In this regard, the catalytic triad of DDAH contains both cysteine and histidine

residues and mutation of either amino acid has been demonstrated to render the enzyme inactive

(Figure 4-14) [314-316].

As further support to the role of DDAH in mediating the inhibitory effects of 4-HNE on

endothelial NO production, studies were performed using DDAH over-expressing BAECs.

Over-expression of DDAH should lead to a decrease in cellular methylarginines with the

concomitant increase in NOS-derived NO. DDAH over-expression was induced using an

adenoviral construct carrying the human DDAH-1 gene (adDDAH1) (Figure 4-15). Preliminary

studies demonstrated that incubation of BAECs with adDDAH1 at 25 MOI, resulted in a 3-fold

increase in protein expression and a > 50% increase in DDAH activity following a 48 hour

incubation. DDAH over-expression increased cellular DDAH activity in control cells by 50%

and resulted in a 22% increase in cellular NO production (Figures 4-9 and 4-10), demonstrating

that the endogenous levels of ADMA and L-NMMA are sufficient to significantly inhibit

endothelial NO generation. If one then considers the 2-fold increase in the levels of ADMA

observed following the 4-HNE treatment, a ~40 % inhibitory effect would be predicted [96].

Subsequently, a series of studies were performed using this same transduction protocol to

examine the effects of DDAH over-expression on 4-HNE mediated endothelial NO inhibition.









Although DDAH over-expression did increase DDAH activity and decrease endogenous

methylarginines, the over-expression of the enzyme alone was not sufficient to prevent the 4-

HNE-induced decrease in NO production. In fact, our results demonstrated that exposure of

DDAH over-expressing cells to 4-HNE resulted in worsened outcome as NO levels were

significantly lower than that in the control cells exposed to 4-HNE. Although these results may

appear contradictory to our hypothesis, they in fact support it and demonstrate that NOS

uncoupling is likely occurring. We have previously demonstrated that ADMA inhibits nNOS-

derived superoxide, and as such, DDAH over-expression in the presence of uncoupled NOS

would be expected to eliminate ADMA and thus prevent ADMA mediated inhibition of NOS-

derived superoxide. The outcome of this would be reduced NO bioavailability through the

reaction of available NO with superoxide, a reaction which occurs at diffusion limited rates.

Our hypothesis would predict that treatment of DDAH over-expressing cells with an

antioxidant would restore NO to levels similar to those observed with L-Arg and GSH treatment,

if in fact methylarginines are contributing to the inhibition in NO generation seen with 4-HNE

challenge. Indeed, we have demonstrated almost complete protection of cellular NO production

following 4-HNE challenge using a combination of viral over-expression of DDAH and

treatment with GSH, when compared to the respective control. These results would indicate that

GSH alone reduces NOS uncoupling but not the methylarginine accumulation, while L-Arg

supplementation and/or DDAH over-expression overcomes the 4-HNE-induced increase in

methylarginines but not the NOS uncoupling.

In conclusion, our results demonstrate for the first time that the lipid peroxidation product

4-HNE can inhibit the endothelial NO production. The doses used in this study represent

pathological levels of this highly reactive lipid peroxidation product and suggest that this









bioactive molecule may play a critical role in the endothelial dysfunction observed in a variety of

cardiovascular diseases. The inhibitory effects of 4-HNE appear to be mediated through both

oxidant stress and elevated levels of the endogenous NOS inhibitors ADMA and L-NMMA, as

either L-Arg supplementation or DDAH over-expression in the presence of an anti-oxidant were

able to restore NO production. Together, these results represent a major step forward in our

understanding of the regulation, impact, and role of methylarginines and lipid peroxidation in

cardiovascular disease.









250


Control

200



150VV





S50 IM HNE
50

o 100M HNE A

Control 10 50 100 1 1 I 1 I 1 I I I
3370 3420 3470
HNEOMdNO Magnetic Field


Figure 4-1. Effects of 4-HNE on NO production. NO generation from BAECs stimulated with calcium ionophore A23187 (1 [LM)
was measured by EPR spin trapping with the Fe-MGD complex. The left panel shows the amplitude of the NO triplicate
EPR spectrum over 10 consecutive 1 minute scans after a 30 minute incubation period. The right panel shows the EPR
spectra and the dose dependent effects of the 4-HNE treatment on NO production. Results represent the mean SD. *
indicates significance at p<0.05










200 -


Control


S


50 pM I



100 pM




L
3370


I I I I I


I I


3420


I
Homoncl (IN)


Magnetic Field


Figure 4-2. Effects of Hexanol on NO production. NO generation from BAECs stimulated with calcium ionophore A23187 ( 1 LM)
was measured by EPR spin trapping with the Fe-MGD complex. The left panel shows the amplitude of the NO triplicate
EPR spectrum over 10 consecutive 1 minute scans after a 30 minute incubation period. The right panel shows the EPR
spectra and the dose dependent effects of the 4-Hexanol treatment on NO production. Results represent the mean SD. *
indicates significance at p<0.05


T.


150 -




100 -




50 -


Control


3470










HNE (jM)
0 1 5 10 50

amwm m +- 4 eNOS

-^ +- Ser 1179

JI wg= vW sm 4 Thr 497

m-r *- -- tubulin


Figure 4-3. 4-HNE effects on eNOS expression and phosphorylation. Protein was obtained
from BAECs treated with varying concentrations (1-50 [LM) of 4-HNE for 24 hours.
For measurements of eNOS, p-eNOSserl 179 and p-eNOSthr 497 expression, 30 |tg
of protein was loaded into each well, Lane 1 is non treated cells, Lanes 2-5 are cells
treated with 4-HNE.






0 A23187 (5 uM)







___ Ser 1179

- -eNOS

A-W.-tubulin

Figure 4-4. Effects of 4-HNE on Serl 179 phophorylation following calcium ionphore (5 riM,
A23187) stimulation. Protein was obtained from BAECs treated with varying
concentrations (1-50 [LM) of 4-HNE for 24 hours. For measurements of eNOS and,
p-eNOSserl 179 expression, 30 |tg of protein was loaded into each well. Lane 1 is the
cells treated with A23187, Lane 2 is non treated cells, Lanes 3-6 are cells treated with
4-HNE









100



80 Control



60 HNE V


HNE + GSH



2 HNE + L-erg
20

o\ HNE+ GSH +L-arg
0 Q
Control HNE GSH L-arg L-arg
GSH
3370 3420 3470
HNE Magnetic Field


Figure 4-5. Effects of L-arginine and GSH supplementation on NO generation. NO generation from BAECs stimulated with calcium
ionophore A23187 (1 [LM) was measured by EPR spin trapping with the Fe-MGD complex. Experimental groups
consisted of untreated (Control); 1 mM L-arginine supplementation (L-arg); 1 mM GSH supplementation (GSH); and 1
mM L-Arg with 1 mM GSH (L-arg + GSH) These experienments were performed both in the presence and absence of 4-
HNE (50utM). Results represent the mean SD. indicates significance at p<0.05











6-

5-




3-




1 -

0 ---- -- ---- i
Control HNE


Figure 4-6. Effects on 4-HNE on the levels of ADMA in BAECs. BAEC's were cultured in T-
75 flasks and exposed to 50 [LM 4-HNE for 24 hours. Total cellular ADMA levels
were measured using HPLC techniques and concentrations were determined as a
factor of cell amount, cell volume and protein amount. Results represent the mean +
SD. indicates significance at p<0.05.


Control 4-HNE

Sr_ DDAH
1-3 Actin



Figure 4-7. 4-HNE effects on DDAH expression. DDAH-1 expression was measured by
western blot techniques from BAECs treated with 50 [LM 4-HNE for 24 hours










100 *


80


4 60


40


Q n


- Cellular DDAH activity
- Purified recombinant hDDAH-1 activity


-I


4-HNE


4-HNE + GSH


Figure 4-8. 4-HNE effects on DDAH activity. I DDAH activity was measured from BAEC homogenates following a 24 hour
incubation with 4-HNE (50 [LM) M DDAH activity was measured from purified recombinant hDDAH-1 (5 [tg)
following a 60 minute incubation with 50 [iM 4-HNE. Experimental groups consisted of 50 [LM 4-HNE (4-HNE) and 50
[LM 4-HNE + 1 mM GSH (GSH). Results represent the mean SD. indicates significance at p<0.05.


T


























Control HkE


120 -


100 -


80


60 -


40


20


DDAH DDAH
HNE


I


*


GSH GSH
HNE


I


DDAH DDAH
GSH GSH
HNE


Figure 4-9. Effects of DDAH over-expression on endothelial cell NO production following 4-HNE challenge. NO generation BAECs
stimulated with calcium ionophore A23187 (1 [LM) was measured by EPR spin trapping with the Fe-MGD complex.
Experimental groups consisted control vector (Control), DDAH over-expressing (DDAH), glutathione (1 mM) treated
(GSH) and DDAH over-expression with GSH (1 mM) treatment (DDAH + GSH). These experiments were performed
both in the presence and absence of 4-HNE (50 [IM). Results represent the mean SD. indicates significance at p<0.05.


*


- "

















T


100 -


80 -


60 -


40 -


20 -


Control HNE


*


DDAH DDAH
+HNE
HNE


I


GSH OSH

HNE


Figure 4-10. Effects of 4-HNE on endothelial cell DDAH activity. DDAH activity was assessed by measuring the conversion of C14-
L-NMMA to C14-Citrulline. Experimental groups consisted control vector (Control); DDAH over-expressing (DDAH); 1
mM glutathione supplementation (GSH); and DDAH over-expression with 1 mM GSH treatment (DDAH + GSH). These
experiments were performed both in the presence and absence of 4-HNE (50 [LM). Results represent the mean SD. *
indicates significance at p<0.05





-3'-


DDAH
GSH


DDAH
+
GSH
HNE












Ii
z
S
ta








a--'
'*~~LLL
U 0






-: rca
U LO*



















Figure 4-11. Effects 4-HNE on nitrotyrsoine formation in BAECs. BAECs were treated with 50
gIM 4-HNE for 24 hours. Following the incubation period, cells were stimulated with
calcium ionophore (5 giM A23187) and homogenized for western blot analysis.
Results demonstrate no significant increase in protein tyrosine nitration.













HNE


HNE + SOD




HNE +
L-NAME


3430
3430


3480
Magnetic Field


3530


Figure 4-12. Effects 4-HNE on ROS formation from BAECs. BAECs were treated with 50 [iM 4-HNE for 24 hours. Following the
incubation period, cells were stimulated with calcium ionophore (5 [iM A23187) and EPR measurements were performed
using the spin trap DMPO (50 mM). Results demonstrated an increase in the DMPO-OH adduct following 4-HNE
treatment. This adduct was superoxide derived as it was largely quenched by the SOD mimetic M40403 (10 FiM). The
DMPO-OH adduct was inhibited by ~ 20% with L-NAME. 4's indicates the four peaks corresponding to the DMPO-OH
adduct. The other 3 peaks are consistent with a carbon center radical.


Control | .
I^V4A1


~c~c.









400




300




S200 -




100
0



C 10 50 100 500


Hexanol (pM)


Figure 4-13. Effects of Hexanol on DDAH-1 activity. DDAH activity was measured from purified recombinant hDDAH-1 (5 [ig)
following 60 minute incubation with Hexanol (10-500 giM). Results represent the mean SD. indicates significance at
p<0.05.













SAbSl b6b be b8 b1 b11b12 b13lb1] b T 1b1Bfb1t7 b24 b2O
150G A E |1 I 4 BL D FPK D YY1 A1 1 TYV P|V|A|D |G |L 1R'17 1 M K17K
yZ0 y ylyLL y9LyULy7 L [ 1 .s L .3V


Intensity X 10


553.56
y3


484.22
b5


bf.t.. L


400


1105.5S


b13 838.48 918.28
bG
723.47
y5
\747.81* 1909.57 1046.38
.6B70.21 b144 V7 blO
b7
.51 | 10B. -

S O5 J -8
Vi 11 .


600bo


800


11li




,bi


1000 m


1314.A442
b24
\ 1371.2W
b25
1204.73
y 0 0
S1324.4A1
bi2

I.B 1305.

yl iA


1200


1


Intensity X 6


1392.52
Vl2


1484AS




b14


14a1.5
Y13


I" 1-


400


1581.50 182.58
b15 b16
.. -I I I


1600


Figure 4-14. MS/MS spectra of of a tryptic peptide generating the sequence b/y-ion series from the in-gel digest of the hDDAH-1

reacted with 4-HNE. The peptide observed at m/z 969.9+3 corresponds to the aa sequence 150-175 with H173 modified

by HNE with the y3 yl3, y15 and y 20 ions labeled along with the corresponding b4 b17, b24 b25 ions labeled.


1781.60
b17







1800


''















DDAH 1- -


MOI

50 25 10


_ --- +r 37 kd.


Figure 4-15. Adenoviral transduction of hDDAH-1 in BAECs. BAECs were treated with
adDDAH-1 at various MOI (10-50) to determine optimum viral titer. Results
demonstrate a dose dependent increase in DDAH-1 expression at 48 hours post
infection.




































CHAPTER 5









REGULATION OF ENDOTHELIAL DERVIED SUPEROXIDE BY THE
METHYLARGININES

Introduction

The biological significance of guanidino-methylated arginine derivatives has been known

since the inhibitory actions of NG monomethyl-L-Arginine (L-NMMA) on macrophage induced

cytotoxicity were first demonstrated. This naturally occurring arginine analog together with its

structural congener asymmetric dimethylarginine (ADMA), are L-Arginine derivatives that are

intrinsically present in tissues and they have the ability to regulate the L-Arginine:NO pathway.

These two compounds, along with N nitro-L-Arginine methyl ester (L-NAME), have been

shown to be potent inhibitors of eNOS activity [35, 298, 306, 317].

NO has been demonstrated as a critical effector molecule in the maintenance of vascular

function [318-320]. In the vasculature, NO is derived from the oxidation of L-Arginine (L-Arg),

catalyzed by the constitutively expressed enzyme, eNOS [158, 162, 321]. This endothelial-

derived NO diffuses from the vascular endothelium and exerts its effects on the smooth muscle

cell layer where it activates guanylate cyclase leading to smooth muscle cell relaxation [318-

320]. In addition to its role in the maintenance of vascular tone, NO helps to maintain the anti-

atherogenic character of the normal vascular wall. NO, in concert with various cell signaling

molecules, has been demonstrated to maintain smooth muscle cell quiescence and as such,

counteracts pro-proliferative agents, specifically those involved in the propagation of athero-

proliferative disorders [24-29, 322]. As such, eNOS dysfunction is an early symptom of vascular

disease and is manifested through insufficient NO bioavailability. Among the potential

mechanisms proposed for this NO deficiency is the uncoupling of NOS and subsequent

production of superoxide anion radical (02)









Our laboratory and others have demonstrated that when cells are depleted of the NOS

substrate L-Arginine (L-Arg) or the cofactor tetrahydrobiopterin (H4B), NOS switches from

production of NO to 02' [310, 323-329]. In the absence of either of these requisite substrates or

co-factors, NOS mediated NADPH oxidation is uncoupled from NO synthesis and results in the

reduction of 02- to form 02'- [323, 324, 328, 330]. 02' exerts cellular effects on signaling and

function that are quite different and often opposite to those of NO. Thus, 02' is another very

important NOS product, and its production may also be regulated by methylarginines.

Furthermore, in view of their strong inhibition of NO generation, methylarginines could

profoundly modulate the balance of NO and 02' generation from the enzyme.

ADMA and L-NMMA are derived from the proteolysis of various proteins containing

methylated arginine residues. The methylation is carried out by a group of enzymes referred to

as protein-arginine methyl transferases (PRMTs). Subsequent proteolysis of proteins containing

methylarginine groups leads to the release of free methylarginine into the cytoplasm where NO

production from NOS is inhibited [35, 298, 317]. In addition to inhibition of NO generation,

methylarginines may have other important effects on NOS function.

Cytosolic L-Arg concentrations are generally in the range of 100 to 200 pM, and moderate

L-Arg depletion has been observed in conditions such as wound healing and aging [306, 331-

336]. The redox active cofactor H4B has been shown to be highly susceptible to oxidative stress.

Oxidation of H4B has been shown to result in NOS-derived 02' generation [326, 327]. We have

previously reported on the effects of methylarginines on nNOS-derived 02' generation, however,

little is known regarding the effects on eNOS [312]. Although L-NAME has been shown to

block 02 production from eNOS, studies using L-NMMA have suggested that this endogenous

methylarginine does not appear to inhibit 02' generation [324, 328, 329]. Furthermore, the









effects of ADMA on 02' release from eNOS have not been reported. In addition, there have

been no studies of the effects of endogenous methylarginines on the 02' production that occur in

H4B -depleted enzyme. Therefore, critical questions remain regarding the fundamental effects of

methylarginine analogues on eNOS function and the process of 02~ release from the enzyme.

Since the levels of the intrinsic methylarginines, L-NMMA and ADMA, have been shown to be

sufficient to modulate basal eNOS function in a variety of cardiovascular disease settings, it is

critical to understand the concentration-dependent effect of these compounds on 02' generation

from the enzyme.

Therefore, in the present study, we have applied EPR spectroscopy and spin trapping

techniques to measure the dose-dependent effects of ADMA and L-NMMA on the rates of 02

production from eNOS under conditions of H4B depletion with normal or depleted levels of L-

Arg. We observe that while both of these endogenous methylarginines inhibit NO formation

from H4B -repleat eNOS, in the presence of uncoupled-eNOS they significantly enhance eNOS-

derived 02'. In addition, we observed that the native NOS substrate, L-Arg, also enhances

eNOS-derived 02'. All of these substrates, result in enhanced NADPH consumption and shift in

heme spin state of eNOS resulting in increased eNOS derived 02'. This observation has

important pathological relevance as NOS uncoupling is know to occur in a variety of

cardiovascular diseases.

Materials and Methods

Expression and Purification of the Human Full Length eNOS and eNOS Oxygenase
Domain (eNOSox)

Human eNOS and eNOSox were expressed in E. coli similar to that previously described

[337] and purified using metal affinity chromatography on a HisTrap FF column (GE

Biosciences), followed by size exclusion chromatography using a HiLoad 16/60 Superdex 200









column (GE Biosciences). Full-length human eNOS and eNOSox expressed in bacteria are

devoid of biopterin. All eNOS preparations were stored at liquid nitrogen temperature in buffer

containing 50 mM HEPES, pH 7.5, 10% glycerol, and 0.15 M NaCl. H4B (+) eNOS and H4B (+)

eNOS,,ox were prepared by anaerobic incubation of purified proteins with 1 mM H4B and 1 mM

L-Arginine overnight at 4 C. Excess H4B and L-Arginine were removed by gel filtration through

a HiTrap desalting column at 4 C. Protein fractions were pooled, concentrated by Centriprep 30

(Amicon), and stored at liquid nitrogen temperature in the buffer described above. Typical NO

generation activity of the final purified eNOS ranged between 80-120 nmol/mg/min, with eNOS

concentration based upon heme content as determined by the pyridine hemochromogen assay.

EPR Spectroscopy and Spin Trapping

Spin-trapping measurements of NO and oxygen radical generation was performed using a

either a Bruker ER 300 or a Bruker EMX spectrometer. The reaction mixture consisted of

purified eNOS (50 nM) in 50 mM Tris, pH 7.4, containing 1 mM NADPH, 1 mM Ca2+, 30 [LM

EDTA, 10 [tg/ml calmodulin, and 10 [M H4B. For NO measurements, 25 nM eNOS and 100

[LM L-Arg was added to the reaction system with Fe2+-MGD (0.5 mM Fe2+ and 5.0 mM MGD)

used to trap NO, as previously described [338]. The samples were measured at X-band in a

TM110 cavity. Spectra were obtained using the following parameters: microwave power; 20 mW,

modulation amplitude; 3.16 G, modulation frequency; 100 kHz. For the detection of 02', eNOS

(50 nM) was used in a reaction system containing 10 mM DEPMPO as the spin-trap. Spectra

were obtained using the following parameters: microwave power; 20 mW, modulation

amplitude; 0.5 G, modulation frequency; 100 kHz. Although multiple EPR spectrometers were

used for the studies, quantitation of the free radical signals was normalized to each system by

comparing the double integral of the observed signal with that of a known concentration of









TEMPO free radical in aqueous solution. To quantify rates of 02' generation, adduct signals

were corrected for trapping efficiency and decay rate as previously described [339, 340]. Rates

of 02' formation were determined from the DEPMPO-OOH signal over the first 20 minutes of

acquisition.

NADPH Consumption by eNOS

NADPH oxidation was followed spectrophotometrically at 340 nm [326]. The reaction

systems were the same as described in EPR measurements, and the experiments were run at room

temperature. The rate of NADPH oxidation was calculated using an extinction coefficient of

6.22 mM"1 cm1.

UV/Visible Spectroscopy

Spectra were recorded on H4B-free eNOSox (7.5 iM) in 50 mM sodium phosphate (pH

7.4) from 300 to 800 nm, and then again in the presence of either ADMA (500 uM) or L-NMMA

(500 uM) using an Agilent 8453 diode array spectrophotometer.

Results

Effects of Methylarginines on 02' Production from H4B Free eNOS

We have previously reported that in the absence of H4B, NOS generates 02' [328].

Therefore, to measure NOS-derived 02' EPR measurements were carried out as previously

described with the nitrone spin-trap DEPMPO, which forms a stable 2O adduct with half life of

~16 minutes [340]. Initial studies were performed in the presence of L-Arg in order to determine

the ability of H4B-free eNOS to generate 02'. EPR results demonstrated a significant DEPMPO

02'- adduct which was inhibited by >80% in the presence of L-NAME (1 mM) and imidazole (5

mM). In addition, in the absence of Ca2+, 02 generation was almost completely blocked (Figure

5-1). These results demonstrate that the observed 02' generation is eNOS-dependent and largely

generated from the oxygenase domain, as the signal was quenched with imidazole.









Subsequent studies were performed in order to determine the concentration-dependent

effects of ADMA, L-NMMA and L-Arginine on 02 production from eNOS. EPR spin-trapping

measurements were performed on H4B -free eNOS as described in the methods. Purified eNOS

was incubated in L-Arginine free buffer in the presence of NOS cofactors (NADPH, calmodulin,

calcium). In the absence of L-Arg, eNOS gave rise to a strong DEPMPO-OOH signal

characteristic of trapped 02' (Figure 5- 2). The effects of ADMA on 02' release were then

determined by adding varying concentrations of ADMA (1.0 to 100 pM). ADMA dose-

dependently increased NOS-derived 02'' generation, with a 43 % increase at 1.0 pM, a 125 %

increase at 10 [LM, and a 151 % increase at 100 [LM ADMA (Figure 5-2). Experiments were

repeated in the presence of L-NMMA (1.0-100 pM). L-NMMA dose-dependently increased

NOS-derived 02' -generation similar to that observed with ADMA, with a 18 % increase at 1.0

[iM, a 80 % increase at 10 [iM, and a 102 % increase at 100 [M L-NMMA (Figure 5- 3). A final

set of experiments were carried out to examine previous observations that the native substrate L-

Arginine is capable of increasing eNOS-derived 02' (21). Results demonstrated that L-Arginine

dose-dependently increased eNOS-derived 02' with a 26 % increase at 1.0 [LM, a 116 % increase

at 10 [LM, and a 152 % increase at 100 [M L-Arginine (Figure 5-4). These results demonstrate

that when eNOS is depleted of the critical cofactor H4B, as has been shown to occur under

conditions of oxidative stress, ADMA, L-NMMA and L-Arginine enhance 02'O generation.

Subsequent studies were then performed using an in-vitro system which could more

closely mimic the disease setting wherein eNOS is uncoupled through reduced H4B

bioavailability and cellular methylarginines are elevated in the presence of normal physiological

levels of L-Arginine. Using this model, we measured the effects of ADMA and L-NMMA on

H4B-free eNOS-derived 02 production in the presence of physiological levels of L-Arg (100









pM). As expected exposure to L-Arginine increased the rate of 02~ production 3 fold, and this

increase was only mildly affected by the addition of ADMA (0.1 100 pM) (Figure 5-5). In

contrast, L-NMMA (0.1 -100 pM) inhibited the formation of the observed 02. adduct, with a

-30 % inhibition of the arginine-induced increase at 100 pM L-NMMA (Figure 5-6). Taken

together, these results suggest that L-Arginine, ADMA, and L-NMMA, independently increase

eNOS-derived 02'. However, in the presence of physiological levels of L-Arginine, ADMA has

little effect on eNOS-derived 02', while L-NMMA inhibits 02'. We hypothesized that these

effects are mediated through alterations in the heme reduction potential upon ligand binding,

leading to a faster transfer of electrons from the reductase domain to the heme. If so, we would

then expect to observe an increase in NADPH consumption rate as a consequence of increased

electron flow through the heme.

Effects of methylarginines and L-Arginine on NADPH Consumption from H4B-Free eNOS

Experiments were performed to determine the effects of ADMA, L-NMMA and L-Arg on

NADPH consumption rate from H4B-free eNOS. Results demonstrated that ADMA dose-

dependently increased the rate of NADPH consumption from H4B-free eNOS from an initial rate

of 55 nmols/mg/min at 0 pM ADMA to 86 nmols/mg/min at 10 pM (Table 5-1). L-NMMA also

dose-dependently increased NADPH consumption rate with values of 79 nmols/mg/min

observed in the presence of 10 pM L-NMMA (Table 5-1). L-Arginine had the most pronounced

effects and like the methylarginines dose-dependently increased the rate of NADPH

consumption with an observed rate of 92 nmols/mg/min at 10 pM L-Arginine (Table 5-1).

Results from these studies support our previous observations that methylarginines and L-

Arginine enhance electron flux through the H4B -free enzyme, thus increasing 02' generation.









Effects of Methylarginines on the Heme of eNOS,,o

L-Arginine and L-NMMA binding to NOS is known to alter the spin-state of the heme

iron, and this change in spin-state is accompanied by a blue-shift in the Sorret absorbance peak

of the NOS heme [341-344]. By using only the oxygenase domain we can remove any spectral

contributions due to the flavins. Additionally, expression of eNOSox is much more robust than

the full length enzyme. Therefore, studies were performed in order to measure the effects of

methylarginine binding on the heme spin-state of the eNOS-oxygenase domain. Results

demonstrated that, both ADMA and L-NMMA caused a blue-shift in the Soret absorbance, from

a -412 nm in the resting eNOSox to -397 nm (Figure 5-7). Thus, just as for arginine and L-

NMMA, binding of ADMA produces a shift in the eNOS heme spin state to high-spin.

In summary, these results demonstrate for the first time that the methylarginines as well as

the native NOS susbtrate, L-Arginine, enhance 02' generation from H4B -free eNOS. We

hypothesize that these effects are mediated through increased electron transfer to the heme via a

mechanism involving a change in the heme spin-state and the associated increase in the heme

reduction potential that occurs upon inhibitor/substrate binding.

Discussion

It is well known that the endogenous methylarginine derivatives, ADMA and L-NMMA,

are capable of regulating NO generation from purified eNOS, and we have previously shown that

their intrinsic levels in the endothelium are ~10 pM and are able to basally regulate endothelial

NO production [306]. However, their role in controlling 02' release from the enzyme was

unknown. Therefore, the current studies were carried out in order to characterize and quantify

the dose-dependent effects of L-Arginine and the endogenous methylarginines on the 02

generation from eNOS.









Over the last several years, studies have shown that in addition to producing NO, NOS is

also capable of producing 02' under conditions of L-Arginine or tetrahydrobiopterin depletion

[310, 324-328]. In the endothelium, this 'O02 generation has been shown to be a significant

mechanism of cellular injury [306, 328]. Although questions remain regarding the severity of

these conditions that arise in normal cells, there is evidence that normal cellular oxidation of H4B

can increase 02' release [327]. Furthermore, a range of disease conditions favor H4B depletion.

These include hypertension, diabetes, ischemia/reperfusion injury, and inflammatory processes

[331-333, 345-349].

While prior studies have demonstrated that loss of the critical NOS cofactor, H4B, results

in NOS uncoupling and subsequent 02. generation from the enzyme, the effects of the native

substrate L-Arginine and its methylated NOS inhibitors, ADMA and L-NMMA, on eNOS-

derived 02-' have been previously unknown. Prior studies from our laboratory have

characterized the effects of ADMA and L-NMMA on nNOS-derived 02'. Results from the

neuronal isoform demonstrated that that the endogenous methylarginines, ADMA and L-NMMA

modulate NO production and that their effects on 2O generation are H4B dependent. In the

presence of H4B, ADMA selectively inhibited 02.' generation from the enzyme, while L-NMMA

had no effect despite their structural similarities. However, when NOS was depleted of H4B,

ADMA no longer had any effect on 2O production, while L-NMMA treatment resulted in a

marked increase in 2O production from the enzyme. Based on these observations, we carried

out an extensive set of studies aimed at establishing the role of the methylarginines in regulating

eNOS-derived 02.

Initial experiments were carried out in order to determine the ability of eNOS to produce

02'-. Results demonstrated that in the absence of H4B, eNOS gave rise to a strong DEPMPO-









OOH adduct characteristic of 02'. This signal was calcium-dependent and largely quenched in

the presence of L-NAME (1 mM) and imidazole (5 mM). Thus the observed 02~ generation is

eNOS-dependent and largely generated from the heme of the oxygenase domain as the signal

was quenched with imidazole.

We observed that both ADMA and L-NMMA dose-dependently enhanced 02 generation

from eNOS in the absence of H4B. A significant, (43%) enhancement, of NOS-derived 02 was

seen with 1 |JM ADMA, increasing to a 151% enhancement at 100 pM. Of note, this 02'

production is blocked by imidazole indicating that the observed increase is due to an increase in

heme-derived 02'. Results obtained using L-NMMA demonstrated that the monomethylarginine

also enhanced heme-dependent '02 production with an 18% increase observed at 1.0 [LM

reaching a maximum of 102% at 100 pM.

Furthermore, the native eNOS substrate, L-Arg, which had been previously thought to

reduce NOS generated 02', also significantly enhanced 02 production from H4B-free eNOS in a

dose-dependent manner. At 1 [LM, L-Arginine increases NOS-derived '02- generation by 26%,

116% at 10 [LM and by 152% at 100 pM. In support of our observations, it has recently been

reported that the oxygen consumption of H4B -replete eNOS is also stimulated by the addition of

arginine [350, 351]. These results have important pathophysiological relevance, as normal

cellular levels of L-Arg exceed 100 [LM and would thus be expected to significantly augment

NOS-derived 02' under conditions of reduced H4B bioavailability. This raises important

questions with regards to the current practice of nutraceutical supplementation with L-Arg in the

treatment of cardiovascular diseases such as hypertension and atherosclerosis in which NOS-

uncoupling is known to occur through oxidative loss of the cofactor H4B. In this setting, L-









Arginine supplementation may actually exacerbate the disease resulting in increased NOS-

derived 02-' and further reduced NO bioavailability.

Next we performed studies to determine the effects of the ADMA and L-NMMA on

eNOS-derived 02'~ in the presence of physiological levels of L-Arg (100 [pM). Results from

these studies demonstrated that the addition of ADMA and L-NMMA did not further increase

NOS-derived 02' and in fact, L-NMMA decreased 02' with a -30% reduction observed at 100

[LM L-NMMA. Thus, as arginine is replaced by L-NMMA there is decreased enhancement of

the eNOS-derived 02', because L-NMMA binding produces less stimulation of the eNOS-

derived 02' compared to the stimulation induced by L-Arginine binding. ADMA competition

has very little effect because ADMA and L-Arginine binding produce very similar levels of

stimulation of eNOS-derived 02'. It should be noted that the precise interpretation of the

competition data must include differences in binding affinities and binding cooperatively for L-

Arg, ADMA, and L-NMMA. Nevertheless, our results suggest that under normal or pathological

conditions wherein total methylarginines would not be expected to exceed 20-30 [LM, their major

effect on eNOS would be to inhibit NO generation with only modest effect on NOS-derived 02.

However, if L-Arginine levels are low, the methylarginines would then increase NOS-derived

02' from uncoupled eNOS. These results differ significantly from what was previously observed

with nNOS, wherein we demonstrated that only L-NMMA was capable of enhancing nNOS-

derived 02. generation. In this previously published study [312], we demonstrated that L-

Arginine and ADMA had no effect on nNOS-derived 02' under conditions of H4B /L-Arg

depletion, while L-NMMA increased 02' production by greater than 2 fold. Moreover, when

experiments were carried out using H4B -free nNOS in presence of L-Arg (100 [iM), L-NMMA









effects were maintained and 02' generation dose-dependently increased with L-NMMA

concentration, while ADMA had no effect [312].

The mechanism of 02 production from the heme in NOS first requires the transfer of an

electron from the reductase domain to the heme, generating the ferrous iron which can bind

oxygen. Subsequently, the one electron reduced 02 can dissociate, regenerating the ferric heme.

The rate limiting step in this process for eNOS is the initial reduction of the heme [352, 353]. As

such, if the reduction of the heme is made more favorable, then the rate of 02' production will be

increased. It has been shown that binding of arginine and L-NMMA to the NOS isoforms

produces a shift in heme spin-state, which can be monitored spectrophotometrically. This

arginine-induced shift in spin-state is accompanied by an increase in the NOS heme redox

potential to less negative values [354], theoretically this would produce an increased rate of

electron transfer from the reductase domain to the heme. This correlation between spin-state and

heme midpoint potential is also found in the related cytochrome P450 family [355, 356].

Furthermore, it is known that the less negative heme redox potential produced by L-Arginine

binding to the inducible NOS (iNOS) is accompanied by an increase in NADPH oxidase activity

[357]. Thus, we hypothesized that the mechanism for the observed arginine and methylarginine-

enhanced O' production was via an increase in electron flow through eNOS produced by a

change in the heme redox potential in response to a ligand-induced change in heme spin-state.

Indeed, we found that just like L-Arginine and L-NMMA, ADMA binding to eNOS

produced a shift in the heme to the high-spin state, which in turn will result in a less negative

heme redox potential. Results from the NADPH consumption studies supported this hypothesis

and demonstrated that ADMA, L-NMMA and L-Arginine dose-dependently increased electron

transfer through the heme, consistent with a ligand-induced increase in heme reduction potential.









The rate of NADPH consumption increased in the following order: no-substrate < L-NMMA <

ADMA < L-Arg. These data support the hypothesis that the inhibitory actions of the

methylarginines on 02' generation in the presence of L-Arginine resulted from less enhancement

of electron transfer relative to L-Arginine. Thus, taken together our data support the hypothesis

that ligand-induced changes in the heme spin-state induced by L-Arginine and the

methylarginines are at least partially responsible for the observed increase in eNOS-derived 02'

However, it is clear that there are other factors to consider.

L-NAME, which also induces the formation of the high-spin eNOS upon binding, very

effectively inhibits 02' formation from eNOS. This discrepancy has been noted for iNOS, and it

was proposed that an electrostatic interaction between an electron rich ligand and the NOS heme

inhibits reduction of the NOS heme and thus decreases NADPH oxidation [358]. Conversely, an

electrostatic interaction between a positively charged arginine or methylarginine side chain and

the heme iron, would theoretically favor the ferrous form of the heme, producing a less negative

midpoint potential, and thus increasing the rate of electron transfer to the heme. Additionally,

substrate binding is known to stabilize the dimeric form of the enzyme, and since heme reduction

is via an inter-monomer electron transfer, this ligand-induced structural stabilization could affect

the rate of this transfer.

It has been proposed that the NOS isoforms can produce H202 via a two electron reduction

of molecular oxygen [351, 359, 360]. For this to occur, the rate of transfer of a second electron

to the ferrous-heme 2O complex, either from H4B or from the reductase domain, must exceed

the rate of superoxide release. It has been demonstrated that in the absence of L-Arginine (or

other substrate) the sole product of H4B -free eNOS is 02'_ [351]. It is possible that our proposed

substrate-induced increase in reductase-to-heme transfer rate in the H4B-free eNOS could allow









for the direct production of H202. However, in preliminary experiments comparing 02'

consumption to NADPH oxidation of the H4B -free enzyme, the addition of substrates produced

similar increases in both 2O consumption and NADPH oxidation (unpublished results). Thus,

although more definitive work is necessary, we have found no evidence for the

substrate/inhibitor-induced direct production of H202 from uncoupled eNOS.

In conclusion, the substrate L-Arginine, and the endogenous inhibitors ADMA and L-

NMMA, increase the 02 'generation from uncoupled eNOS by making the transfer of electrons to

the heme more favorable via mechanisms involving the modulation of the heme spin-state,

altering the electrostatic environment of the heme, and/or by altering the structural stability of

the active dimer. These findings have important clinical implications as methylarginine levels

have been demonstrated to be elevated in a variety of cardiovascular diseases associated with

oxidative stress. In addition, L-Arginine supplementation in these conditions may exacerbate the

NOS uncoupling observed in these conditions.








Control

1 .5- 4VVVVVK
Imidazole
1.0 -


1 0.5 -



3428 3488 3548
i/ i Magnetic Field

Figure 5-1. Inhibition of NOS-derived 02.- from H4B depleted eNOS. EPR spin-trapping measurements of 02.- production from
eNOS (50 nM) were performed in the presence of L-arg (100 [iM) as described in Methods. The right panel shows the
spectra of the 02.- adduct observed. The left panel shows the total amount of NOS-derived 02.-generation occurring over
a 30-minute period. The results show the effects of L-NAME (500 [LM), Imidazole (1 mM) and Ca2+-CAM removal on
NOS-derived 02.- production. Both inhibitors largely blocked NOS-derived 02.- generation. In the absence of calcium
and calmodulin, no signal was observed. Results shown represent the mean SEM of 5 experiments.










Contro--l[-



10 pM ADMA

10 W ADMA A A A nA~


100 pM ADMA


3428


Time (min)


3488
Magnetic Field


3548


Figure 5-2. Effects of ADMA on eNOS-derived 02'. EPR spin-trapping measurements of 02' production from H4B-free eNOS (50
nM) were performed with the addition of ADMA (0.01-100 pM) and NOS cofactors as described in Figure 5-1. The right
panel shows the spectra observed after 30 min. The DEPMPO-OOH adduct signal was clearly seen. The left panel shows
the time-course of NOS-derived 02'~ generation determined from the observed EPR spectra recorded over a 40-minute
period in a series of experiments. Results graphed are the mean SEM. In the absence of H4B, NOS gave rise to a
prominent DEPMPO-OOH signal characteristic of 02 and this was dose-dependently increased by ADMA (1.0 pM-100
|^M).


I I _









25




10 M NMM.OMNMMAA




10 -


5 n100 pM I NMMA



3428 3488 3548
0 10 20 30 40
Magnetic Field




Figure 5-3. Effects of L-NMMA on eNOS-derived 02'- EPR spin-trapping measurements of 02' production from H4B-free eNOS (50
nM) were performed with the addition of L-NMMA (0.01-100 [LM) and NOS cofactors as described in Figure 5-1. The
right panel shows the spectra observed after 30 min. The DEPMPO-OOH adduct signal was clearly seen. The left panel
shows the time-course of NOS-derived 02 generation determined from the observed EPR spectra recorded over a 40-
minute period in a series of experiments. Results graphed are the mean SEM. In the absence of H4B, NOS gave rise to a
prominent DEPMPO-OOH signal characteristic of 02 and this was dose-dependently increased by L-NMMA (1.0 [LM-
100 [LM).













1 CaM L-rg


10 pM


100 pM L-ug


10 20 30 40


3428


Time (mih)


3488
Mgnetio Field


Figure 5-4. Effects of L-arg on eNOS-derived 02' EPR spin-trapping measurements of 0'2 production from H4B-free eNOS (50 nM)
were performed with the addition of L-arg (0.01-100 [LM) and NOS cofactors as described in Figure 5-1. The right panel
shows the spectra observed after 30 min. The DEPMPO-OOH adduct signal was clearly seen. The left panel shows the
time-course of NOS-derived O'20 generation determined from the observed EPR spectra recorded over a 40-minute period
in a series of experiments. Results graphed are the mean SEM. In the absence of H4B, NOS gave rise to a prominent
DEPMPO-OOH signal characteristic of 02 and this was dose-dependently increased by L-arg (1.0 [LM-100 [LM).


3548

















15 M L-arg + 10 pM ADMA
OE L-arg + 100 pM ADMA



10










0 2 4 6 8 10 12 14 16

Time (min)


Figure 5-5. Effects of ADMA on 02. production from H4B-depleted NOS in the presence of L-arg. EPR spin-trapping
measurements of 0'2 production from eNOS (50 nM) were performed in the presence of 100 [LM L-arg, with the addition
of ADMA (0.1-100 pM) and NOS cofactors (w/o H4B) as described in Figure 5-1. Results show the time-course of NOS-
derived 02' generation determined from the observed EPR spectra recorded in a series of experiments. H4B depleted
eNOS gave rise to a prominent DEPMPO-OOH signal characteristic of 02', which was increased in the presence of L-arg
and unaffected by ADMA (0.1-100 pM). Results graphed are the mean SEM.














15- U L-arg + 10 pM NMMA
El L-arg+100pMNMMA
-- Plot 1 Regr


10




5-





0 2 4 6 8 10 12 14 16
Time (min)


Figure 5-6. Effects of NMMA on NOS-derived 02' in the presence of L-arg. EPR spin-trapping measurements of 02 production
from eNOS (50 nM) were performed in the absence of 100 pM L-arg, with the addition of NMMA (0.1-100 pM) and NOS
cofactors as described in Figure 5-1. Results show the time-course of NOS-derived 02' generation determined from the
observed EPR spectra recorded in a series of experiments. H4B-depleted eNOS gave rise to a prominent DEPMPO-OOH
signal characteristic of 02', which was increased in the presence of L-arg and unaffected by ADMA (0.1-100 pM). Results
graphed are the mean SEM.









0.8 -
eNOSox + NMMA
0.6 eNOSox


0.4 -


0 .2

0.8
0.8 -- e NOSox + ADMA
0.6 / \ -- _- eNOSox




0.2


0.0
300 400 500 600 700 800
Wavelength (nm)


Figure 5-7. Methylarginines alter the eNOS-bound heme. The UV/Vis spectrum for the eNOS oxygenase domain (7.5 giM) in 50 mM
sodium phosphate (pH 7.4) was recorded from 300 to 800 nm, and then again in the presence of either ADMA (500 uM) or
NMMA (500 uM).









Table 5-1. Effects of Methylarginines and L-arg on NADPH consumption from H4B-free eNOS (100 nM)

Substrate 0.0 [iM 0.1 [M 1.0 [M 10.0 [M
L-arginine 552 673 793 924
ADMA 552 622 743 862
L-NMMA 552 613 704 793
The dose-dependent effects of ADMA, L-NMMA and L-arg on NADPH oxidation was followed spectrophotometrically at 340 nm
[326]. The reaction systems were the same as described in EPR measurements, and the experiments were run at room temperature for
2 minutes. Results are SEM.









CHAPTER 6
REGULATION OF DIHYDROFOLATE REDUCTASE IN THE DIABETIC ENDOTHELIUM

Introduction

Endothelial derived Nitric Oxide (NO) is synthesized from the oxidation of the guanidino

carbon of the amino acid L-Arginine to NO and L-citrulline. This reaction is catalyzed by the

enzyme nitric oxide synthase (NOS). NO is a potent vasodilator and critical effector molecule

involved in the maintainence of vascular homeostasis, through its anti-proliferative and anti-

thrombotic effects. NO, in concert with various cell signaling molecules, has been demonstrated

to maintain vascular smooth muscle cell quiescence and as such, counteracts pro-proliferative

agents specifically those involved in the propagation of athero-proliferative disorders. Diabetes

has long been associated with increased oxidative stress and impaired vascular function. NOS

dysregulation and decreased NO bioavailability have been implicated as a central mechanism in

vascular endothelial dysfunction observed in diabetes. Several studies have demonstrated that

while eNOS protein levels are increased in the diabetic state, NO bioavailability decreases and

superoxide production increases [361]. Among the proposed mechanisms that lead to decreased

NO bioavailability and eNOS uncoupling is oxidation of the essential NOS cofactor

Tetrahydrobipetrin (H4B). In vitro studies have demonstrated that H4B stabilizes and donates

electrons to the ferrous-dioxygen complex in the oxygenase domain of eNOS to help facilitate

the oxidation of the substrate L-Arginine. Furthermore, studies have demonstrated that depletion

of H4B causes electrons to be donated to molecular oxygen, turning NOS from a NO generating

enzyme to an oxidase. This phenomenon has been termed "NOS uncoupling" and it has been

documented in the pathophysiology of various diseases including atherosclerosis and diabetes

(56,119,120). H4B is highly redox sensitive and can be readily oxidized to its inactive form

dihydrobiopterin (H2B). Therefore, it is likely that during increased oxidative stress intracellular









levels of H4B fall leading to NOS uncoupling and the enzyme primarily being a 02- generating

enzyme.

The synthesis of H4B occurs via two pathways in the endothelial cell, the de novo and

salvage pathways (Figure 6-1). De novo biosynthesis of H4B is a magnesium, zinc and NADPH

dependent pathway. The first step requires the conversion of GTP to 7,8-dyhydroneopterin

triphosphate. This reaction is catalyzed by the enzyme GTP cyclohydrolase I (GTPCH), and it is

the rate limiting step in H4B biosynthesis [52]. Following the GTPCH enzyme reaction

pyruvoyl tetrahydropterin synthase (PTPS) converts 7,8 dihydroneopterin triphosphate into 6-

pryuvoyl-5,6,7,8-tetrahydropterin. Alternatively, the salvage pathway enzyme dihydrofolate

reductase (DHFR) is a NADPH dependent enzyme that catalyzes the conversion of H2B to H4B

(140). The functionality of the DHFR enzyme in the endothelial cell was unknown until

recently. The strongest evidence for the involvement of DHFR involvement in regulating

endothelial NO production has come from DHFR gene silencing studies. Specifically,

Chalupsky et al. demonstrated that DHFR gene silencing resulted in a significant reduction in

H4B levels, as well as a 50% reduction in endothelial NO production [133]. Furthermore, DHFR

over-expression was able to abolish the production of 02' in angiotensin II stimulated cells

[133]. Because DHFR activity has been demonstrated to be involved in the regulation of NO

bioavailability, it is important to understand how the enzyme activity is affected in disease states.

Therefore, studies were carried out to determine the effects of oxidative stress and

metabolic dysregulation on DHFR activity. We observed that DHFR is highly resistant to most

oxidants at concentrations within the pathophysiological range. We also observed that at low

concentrations of OONO- DHFR activity is significantly increased. Additionally, using the

diabetic db/db mouse model we observed reduced DHFR activity, impaired vascular function









and increased eNOS derived superoxide in the aorta. These observations have important

implications for the role of oxidative stress and its effects on DHFR activity as it relates to the

diabetic state.

Materials and Methods.

Materials

DHFR, H202, Xanthine and Xanthine Oxidase were purchased from Sigma-Aldrich (St

Louis, MO). Peroxynitrate was purchased from Millipore(Lake Placid,NY) Diethylamine

NONOate was purchased from Sigma=Aldrich(St.Louis, MO)

DHFR Activity Assay

For kinetic measurements of enzyme activity, human recombinant DHFR (6.0 ug) was

incubated for 5 minutes at 250C in 50 mM Tris buffer (pH 7.5) in the presence of .01-1000 [iM

substrate with a total reaction volume of 100 il. Following incubation each sample was added to

a 96 well plate and NADPH consumption was measured at 340 nM. The rate of NADPH

consumption was calculated using an extinction coefficient of 6.22 mM1cm1.

Tissue DHFR Activity

For kinetic measurements of tissue DHFR activity, kidneys were removed from age

matched control mice and db/db mice on a C57/Blk6 background. The samples were

homogenized in diionized water with ascorbic acid (1 mg/ml) to prevent auto-oxidation. Protein

concentration was measured by the Bradford assay. 250 pg of protein, 200 pm H2B and 1 mM

NADPH were incubated together for 30 minutes at 370C in a water bath. Following the

incubation the samples were then loaded into a Centricon filter with a 3,000 molecular weight

cut off and centrifuged at 10,000 x g, 40 C for 60 minutes.









HPLC Techniques

DHFR activity assay was performed by measuring the conversion of H2B to H4B using

HPLC techniques.20 [tl of the filtrate was then injected into onto the HPLC column using an

ESA HPLC with electrochemical gradient detection a 400 mV and 800 mV. The mobile phase

consisted of Buffer A (100 mM KH2 P04,25 mM octyl sodium sulfate,0.6 mM EDTA PH 2.5),

Buffer B (2% MeOH) run at room temperature with a flow rate of 1.3 ml/ml

Vascular Reactivity

Contraction and relaxation of isolated aortic rings were measured in an organ bath

containing modified Krebs-Henseleit buffer (118 mM NaCl,24 mM NaHC03,4.6 mM KC1, 1.2

mM NaH2PO4,1.2 mM CaCl2,4.6 mM HEPES and 18 mM glucose) aerated with

95%C02/5%02,370C. Aortic rings were cut inton 2-to3 mm segments and mounted on a wire

myograph (Danish Myo, Aarhus, Denmark). Contraction was measured via a force transducer

interfaced with Chart software for data analysis. Following a 30-min incubation equilibration

period, the rings were stretched to generate a tension of 0.5 g. The optimum resting force of the

aortic rings was determined by comparing the force developed by 40 mM KCL under varying

resting force. Aortic rings were preconstricted with 1 [iM phenylephrine. The vascular relxation

response was determined using increasing concentrations of acetylcholine (0.1 nM to 10 [iM)

EPR Spin Trapping Studies

Given the millisecond-range half-life of superoxide in situ, electron paramagnetic

resonance (EPR) assay involves the approach of using the superoxide spin-trap, 1-hydroxy-3-

methoxycarbonyl-2,2,5,5-tetramethyl pyrrolidine HCI (CMH hydrochloride; Axxora) (8, 9, 11,

16, 18) to generate a stable chemical product, 3-methoxycarbonyl- proxyl, by a general method.

Stock solution of CMH (10 mM) dissolved in EPR buffer [PBS containing 2[iM

Diethyldithiocarbamate (Sigma-Aldrich) and 50 [iM Desferrioxamine (Sigma-Aldrich)] and









purged with Nitrogen, were prepared daily and kept under nitrogen on ice. Six aortic ring

segments (1 mm) were placed in EPR buffer. CMH at a concentration of 50 [iM was then added

and incubated at 37 C for 60 min with and without L-NAME (1 mM). Frozen samples were

analyzed with a Benchtop ESR Spectrometer (Bruker Biospin) in a finger Dewar filled with

liquid nitrogen with following EPR settings: microwave frequency 9.7 GHz, microwave power

1.2 mW, modulation amplitude 6.7 G, conversion time 10.3 ms and time constant 40.96 ms.

Results

Enzyme Kinetics of DHFR

Enzyme kinetic studies were performed to establish the Km and Vmax values for H2B. The

kinetic activity of human DHFR (hDHFR) was measured by the detection of NADPH

consumption as described under the "Material and Methods." Km and Vmax values were derived

using the Michaelis-Menten equation and generated values of 48 |^M and 6.7 imols/mg/min,

respectively (Figure 6-2).

Effect of Oxidants on DHFR Activity

Previous studies have demonstrated that DHFR expression can be affected following

exposure to H202. Because H4B is known to be highly sensitive to oxidants leading to its

oxidation to H2B, it may also be possible that DHFR is modulated by the redox environment

which could result in impaired H4B recycling. Therefore, we carried out a series of studies

aimed at determining the dose dependent effects of NO, OONO-, H202, and 02 'on DHFR

activity. NO studies were carried out using the NO donor compound DEANONate (1 iM-1

mM). H202 (1 iM-1 mM) and OONO- (0.01 iM-1 mM) studies were carried out using the

authentic oxidant. For 02-, we used a generating system consisting of xanthine and xanthine

oxidase (1 ptM-i mM). In order to prevent Fenton type reactions in the H202 experiments, the Fe

chelator DTPA (100 |^M) was added. The exposure of DHFR to oxidants was found to have a









modest effect on enzyme activity. Results demonstrated that following exposure to NO, hDHFR

activity was dose dependently reduced with 38 % inhibition observed at 100 [iM NO and 53%

inhibition observed at 1 mM (Figure 6-3). Results also demonstrated that exposure to H202 dose

dependently decreased activity with 31% inhibition at 100 [iM H202 and 53% inhibition at 1 mM

(Figure 6-4). Furthermore, O2-dose dependently inhibited hDHFR activity as 1 iM and 1 mM

elicited a 28% and 70% inhibition respectively (Figure 6-5). Additional studies demonstrated

that hDHFR activity was significantly increased 56-58% following exposure to 0.01 [iM and 1

IM of OONO- (Figure 6-6). In contrast, at the 10 [iM and 100 [iM concentrations no significant

changes in activity were observed. However, exposure to 1 mM OONO- resulted in a modest

inhibition of 24%.

Effects of the Diabetic State on In-Vivo DHFR Activity

Previous studies have suggested that increases in oxidative stress, as have been observed in

diabetes, contribute to decreased endothelial NO generation through a mechanism involving the

loss of H4B. In support, it has been observed in several studies that H4B supplementation

restores endothelial NO generation (56,54,209). However, whether DHFR activity is also

sensitive to the redox environment is unknown. Therefore, in order to determine the effects of

the diabetic disease state on DHFR activity, basal activity in the kidney of db/db mice and age

matched controls was measured. Using HPLC techniques, hDHFR activity was measured as

described in the "Materials and Methods". Results demonstrated that db/db mice had

significantly more H2B than the age matched control mice. Furthermore, the control mice

produced significantly more H4B than the db/db mice (Figure 6-7). Overall, these results suggest

that the diabetic condition of the db/db mice results in a significant decrease in DHFR activity,

which is likely involved in eNOS uncoupling as a result of altered B2H/B4H ratios. To confirm









this, we preformed additional studies to determine the effects of decreased DHFR activity on

vascular function.

Effects of the Diabetic State on Vascular Reactivity

Our previous results demonstrated that tissue DHFR activity was reduced in the diabetic

db/db mouse model, which resulted in reduced levels of H4B. Therefore, vascular studies were

performed using mouse aortic rings and the vascular relaxation in response to acetylcholine (1

IM) was measured. The percent relaxation to 1 iM Ach was then compared among the control

and db/db groups. Results demonstrated that db/db mice had a 35% reduction in vascular

relaxation in response to 1 .iM Ach, when compared to their aged matched controls (Figure 6-8).

Effects of the Diabetic State on eNOS Derived 02 Production in the Aorta

Previous studies have demonstrated that depletion of H4B under oxidative stress conditions

increases the production of eNOS derived superoxide in the vasculature (54,211). Although our

data demonstrated that db/db mice have a significant reduction in DHFR activity and impaired

vascular function, we wanted to examine whether the loss of DHFR activity would also resulted

in increased vascular eNOS derived 02'-. Therefore, EPR spin trapping studies were carried out

to measure eNOS derived 02-' in the aorta. Results demonstrated that the aorta of db/db mice

produced significant 02', while in wt type age matched controls it was undetectable. This

increase in 02' production was attenuated following exposure to the NOS inhibitor L-NAME

(Figure 6-9). Overall, these studies support the hypothesis that loss of DHFR activity is involved

in the endothelial dysfunction associated with diabetes and that loss of DHFR activity increases

eNOS derived 02'- in the aorta.

Discussion

There is a growing body of evidence indicating that the increased cardiovascular risks

associated with diabetes are due to oxidative stress and eNOS dysfucntion. In support, several









studies have reported that the pathology of diabetes results in decreased endothelial NO

production, impaired vascular function, and increases in eNOS derived 02' generation

(54,56,211). The primary pathway way for H4B synthesis is through the de novo pathway which

involves the rate limiting enzyme GTPCH I. Previous studies have demonstrated that inhibiting

GTPCH I leads to impaired vascular relaxation in response to Ach. Over-expression of GTPCH

I was found to partially restore vascular function in diabetic mice (208). However, under

pathological conditions in which oxidative stress increases and in which H4B can be readily

oxidized, DHFR activity maybe critically important in maintaining H4B levels and endothelial

NO production. Therefore, studies were carried out in order to investigate the redox regulation

of DHFR and its role in diabetic vasculopathy.

Despite its importance of H4B regulation during oxidative stress, few studies have been

done regarding the enzymatic activity of DHFR. Furthermore, the few studies which exist have

been conducted using rat brain homogenates. In this regard, we have recently measured the

kinetic parameters of the human isoform of DHFR. Results from these studies demonstrated the

Km value of 48 iM and Vmax value of 6.7 pmols/mg/min for H2B. The Km value obtained

correlates well with the previously published report in which the value of 88 [iM was reported.

However, the maximal enzymatic activity that we report here differs from the previously

published using DHFR from rat brain, in which a value of 30 pmole/mg/min was reported,

however this was for dihydrofolate metabolism, as DHFR is also known to be an important

enzyme in folate metabolism [362].

Cai et al. demonstrated that following exposure to H202, DHFR expression decreased in

cultured endothelial cells [133]. These studies suggest that DHFR activity may be modulated by

the redox environment. Therefore, studies were conducted in order to determine the effect of









various reactive oxygen and nitrogen species on DHFR activity. Following exposure of DHFR

to NO, OONO-, H202, 02-, we observed that at concentrations between 1 [IM -100 riM, NO

elicited a 31-38% decrease in DHFR activity. Additionally, at the 1 mM concentration a 53%

loss in enzyme activity was observed. In support of our results, previous studies have

demonstrated that following exposure to NO, proteins can be s-nitrosylated at active cysteine

residues resulting in altered enzyme activity (95,96,97). Similar effects on DHFR activity were

observed following exposure to H202. We also observed a dose dependent decrease in DHFR

activity in the presence of 02'- with 1 [iM and ImM eliciting a 28% and 70% decrease in enzyme

activity respectively. Additional studies exposing DHFR to OONO- at low pathophsyiologicaly

relevant concentrations (0.1 .iM- 1 .iM) demonstrated a significant increase DHFR activity.

This result was surprising as OONO- has been demonstrated to increased eNOS derived

superoxide production in vascular aortic rings, suggesting it has a role in eNOS uncoupling

[363]. In contrast, higher pathophysiological concentrations of OONO-(10-100 iM) resulted in

no change to DHFR activity. Only a modest inhibition of 24% was observed following exposure

to 1 mM OONO- however, this does not represent physiological or pathophysiological relevant

concentrations. Overall these results suggest that the DHFR enzyme is moderatley sensitive to

ROS mediated inhibition in the pathophysiological/physiological relevant dose ranges.

However, OONO- at pathophysiologically relevant levels induced a significant increase DHFR

activity. This is an intriguing finding given that ONOO- has been shown to be the most potent

oxidizer of H4B and may represent a novel compensatory mechanism for the cell to maintain

adequate H2B / H4B ratios.

In prior studies it has been observed that diabetes is associated with increased oxidative

stress, and NOS uncoupling. However, no studies to date have examined the role of diabetes and









its effects on DHFR activity. Therefore, we carried out in vivo studies in order to determine the

effects of the diabetic state on tissue DHFR activity. We observed that in the kidney of db/db

mice, DHFR activity was significantly inhibited when compared to wt age matched control. This

decrease in DHFR activity resulted in increased H2B levels in db/db mice. Our findings are in

line with previous reports of increased H2B levels in diabetic mice [361, 364]. In addition,

previous reports have also demonstrated that alterations in the H2B/ H4B ratio is an important

trigger in NOS uncoupling [208]. Taken together these results represent a potential mechanism

linking diabetes to vascular endothelial dysfunction.

Next, we carried out studies to determine the effect of the loss of DHFR activity on aortic

vascular relaxation. Results demonstrated a 35% impairment of the NO mediated vascular

relaxation in db/db mice when compared to the wt age matched controls. Additional studies

were carried out to determine the effect of decreased DHFR activity and eNOS derived 02' in

the aorta. In contrast to the wild type mice, resulted demonstrated that eNOS derived 02' was

detectable in the isolated aorta of db/db mice. In support of our findings, in the streptozotocin

induced model of diabetes, mice were observed to have impaired vascular function and increased

aortic eNOS derived 02'- that was attenuated in the presence of H4B [204].

Overall these results provide evidence for our hypothesis that loss of DHFR activity leads

to endothelial dysfunction in diabetes. Future studies using a gene therapy approach will be

carried out in order to provide further evidence for the importance of the modulation of DHFR

activity and its role in vascular endothelial dysfunction. In addition to animal studies, cellular

studies will examine the effects of the H2B/ H4B ratio in regards to preserving endothelial NO

production. We hypothesis that adenoviral mediated over expression of the DHFR gene will









result in improved vascular endothelial function and endothelial NO generation in the diabetic

condition.

In conclusion, this is the first study to demonstrate that DHFR can be regulated by redox

environment in vivo. However, most oxidants have a modest effect on DHFR activity. Also, we

have demonstrated for the first time that OONO- increases DHFR activity, which could

potentially be protective mechanism in which the cell acts to preserve endothelial NO generation.

Furthermore, we have also demonstrated that the loss of DHFR in db/db mice results in impaired

vascular relaxation and increased eNOS derived 02'. Moreover, the loss of DHFR activity may

represent a novel mechanism in endothelial dysfunction associated with diabetes.












y-'NH
0 0
o o o N


de novo pathway rTP

salvage pathway | QTP oyolohydrolmsa I
blopterin recycling (TPC



H H
DIhydronmoptrln trphamphmt
Pyruvayl tatrahydropterin
.yithme (PTPa)

Seplapterin synthase


S*plap'terin 6-Pyruvoyl ttrahydroptmrln
aSplapterin reduote | Seplapterin reductase
(UOR) I (SR)

SDIhydrofolate reductma N
HN iN (DPFR) HN&N-
n N II
BH Dhydroptridin Aromatic amino acid
IRductuse (DHPR) hydroxylaes
SPterln-carblnolarnlne
N dahydratame (PCD) )N

MHN gN NNHIN N
M M H H
quinold BH, Tatrahydroblopterin-
4a- carblnolamine


Figure 6-1. H4B biosynthesis pathway. H4B is synthesized in the endothelial cell by either the de novo or salvage pathway.









8000




6000





40Km=48 pM

Vmax=6.7 pmolsmgfnmin

2000 -





0





0.0 0.2 0.4 0.6 0.8 1.0 1.2


HB (mM)


Figure 6-2. DHFR enzyme kinetics. hDHFR was incubated in the presence of varying concentrations of B2H(1 giM-l mM). DHFR
activity was measured by the rate of NADPH consumption as measured by absorbance at 340 nm. The Km and Vmax
were fitted using the Michaelis-Menton equation. The Km was found to be 48 giM and the Vmax was found to be 6.7
gmols/mg/min









0.05


0.04 -



0.03 -



Q 0.02 -



0.01 -



0.00C

1-

NO


Figure 6-3. Effects of Nitric Oxide on hDHFR activity. hDHFR was exposed to varying
concentrations (1 iM-1 mM) of Nitric Oxide. hDHFR activity measured by the rate of NADPH
consumption as measured by absorbance at 340 nm. Nitric oxide was found to dose dependently
reduce hDHFR activity with 38 % inhibition observed at 100 [IM NO and 53% inhibition
observed at ImM. Results represent the mean SD n=3









0.05


0.04 -


0.03 -


S 0.02 -


0.01 -


0.00 -




Ha2


Figure 6-4. Effects of H202 on hDHFR activity. hDHFR was exposed to varying concentrations
(1 giM-l mM) of H202. hDHFR activity measured by the rate of NADPH
consumption as measured by absorbance at 340 nm. H202 dose dependently
decreased hDHFR activity with 31% inhibition at 100 gIM H202 and 53% inhibition
at 1 mM. Results represent the mean SD n=3









0.05


0.04 -



0.03 -



0.02 -



0.01 -



0.00 -







Figure 6-5. Effect of 02' on dDHFR activity. hDHFR was exposed to varying concentrations of
(0.01 iM-1 mM).of Xanthine Oxidase and Xanthine(1 unit/mg) to generate 02O
hDHFR activity was measured by NADPH consumption as measured by absorbance
at 340 nm. 02' was demonstrated to dose dependently inhibit DHFR activity with 1
[iM and 1 mM eliciting a 28% and 70% inhibition respectively. Results represent the
mean SD. indicates significance at p<0.05. n=3









0.12


0.10


I 0.08

0.06

0.04

0.02

0.00


C


NI









0





0


*











aq.


OONO-


Figure6-6. Effects of OONO- on hDHFR activity. hDHFR was exposed to varying
concentrations of (0.01 iM-1 mM).of OONO-. hDHFR activity was measured by
NADPH consumption as measured by absorbance at 340 nm. OONO- was observed
to increase DHFR activity 56-58% following exposure to 0.01 [iM and 1 riM.
Exposure to 1 mM OONO- resulted in a modest inhibition of 24%. Results represent
the mean SD. indicates significance at p<0.05. n=3




















8.0 V



6.0 I I

BH2

4.C


2.0



C.C [400 mV


0.00 5.00 10.00 15.00 20.00 25.00

Retention time (minutes)


Figure 6-7. Effects of the diabetic condition on in-vivo DHFR activity. HPLC studies were carried out the measure basal DHFR
activity in the kidneys of db/db and wild type age matched control mice. DHFR activity was observed to be significantly
decreased in the db/db mice population (2) vs. the age matched controls (1) Peak (3) is a H2B standard.









80-
-- wt
-A- db'db

60-








20



> 0 I I
le-8 le-7 le-6

Ach (M)

Figure 6-8. Effects of the diabetic state on vascular reactivity. The effects of the diabetic state on vascular relaxation response to
AcH(0.1-1 giM) were determined using mice aortic rings from db/db mice and age matched wild type controls. Following
phenylephrine-induced constriction, Ach (0.1 nM to 10 giM) was added to the bath and the relaxation response was
measured. Results represent the mean SD. indicates significance at p<0.05. n=4













WT + L-NAME



dbWdI


db/db + L-NAME



positive control



3400 3450 3500
Magnetic Field


Figure 6-9. Effects of the diabetic condition on eNOS derived 02'_ in the aorta. EPR spin-trapping measurements of 02- production
from mouse aortic rings were performed. The panel shows the spectra of the 02- adduct observed. The results show the
effects of L-NAME (500 gLM) on eNOS derived 02. production, which blocked eNOS derived 02'.









CHAPTER 7
DISCUSSION

ADMA and L-NMMA are endogenous NOS inhibitors derived from the proteolysis of

methylated arginine residues on various proteins. The methylation is carried out by a group of

enzymes referred to as protein-arginine methyl transferase's (PRMT's) [35]. In mammalian

cells, these enzymes have been classified into type I (PRMT1, 3, 4, 6, and 8) and type II

(PRMT5, 7, and FBXO11) enzymes, depending on their specific catalytic activity. Both types of

PRMT, however, catalyze the formation of mono-methylarginine (MMA) from L-arginine (L-

Arg). In a second step, type I PRMT's produce asymmetric dimethylarginine (ADMA), while

type II PRMT catalyzes symmetric dimethylarginine (SDMA) [365, 366]. Subsequent

proteolysis of proteins containing methylarginine groups leads to the release of free

methylarginine into the cytoplasm where NO production from NOS can be inhibited. Free

cytoplasmic MMA and ADMA are degraded to citrulline and mono- or dimethylamines by

dimethylarginine dimethylaminohydrolases (DDAH) [367]. While on the other minor clearance

of unchanged plasma methylarginines are cleared from the circulation by renal excretion and

hepatic metabolism [304, 367]. In addition to the DDAH pathway, ADMA can also be

converted to a-keto valeric acid by alanine:glyoxylate aminotransferase [368], although the

influence of this pathway on total ADMA metabolism has not been extensively studied thus far.

Moreover, the demethylation of methylarginines is believed to be restricted to free

methylarginines, as a potential mechanism for possible demethylation of protein-incorporated

methylarginines in situ have not yet been identified. It should be noted, however, that the

conversion of protein-incorporated L-NMMA to citrulline by peptidylarginine deiminase 4 was

recently demonstrated, which prevented histone methylation by PRMT 1 and 4 [369, 370]. This

may influence protein methylation directly, as L-NMMA deimination will decrease the amount









of protein-incorporated MMA that is available for dimethylation by PRMT, but the relevance of

protein deimination of protein-incorporated MMA by PAD enzymes has been challenged recent

[369].

Asymmetric dimethylarginine (ADMA) plasma levels have been shown to be elevated in

diseases related to endothelial dysfunction including hypertension, hyperlipidemia, diabetes

mellitus, and others [267, 268, 270-272]. Moreover, it has been shown that ADMA predicts

cardiovascular mortality in patients who have coronary heart disease (CHD). Recent evidence

published from the multicenter Coronary Artery Risk Determination investigating the Influence

of ADMA Concentration (CARDIAC) study has indicated that ADMA is indeed an independent

risk factor for CAD [273]. However, whether the increased risk associated with elevated ADMA

is a direct result of NOS impairment is an area of controversy. Significant debate about the

contribution of ADMA to the regulation of NOS-dependent NO production has been initiated.

In pathological conditions such as pulmonary hypertension, coronary artery disease,

diabetes and hypertension, plasma ADMA levels have been shown to increase from an average

of -0.4 [iM to -0.8 [iM [269, 272, 273, 276-278]. Given that these values are at least 2 orders of

magnitude lower than the plasma L-arg levels it is unlikely that elevated plasma ADMA can

significantly regulate eNOS activity. It is more likely that elevated plasma ADMA levels reflect

increased endothelial concentrations of ADMA. In support of this hypothesis, we and others

have demonstrated that endothelial ADMA levels increase 3-4 fold in restenotic lesions and in

the ischemia reperfused myocardium [96, 279]. Based on cellular kinetic inhibtion studies from

our lab in which we observed sigfinciant inhibtion of NO production at 5[M ADMA, these

concentrations of ADMA would be expected to elicit a 30-40% inhibition in NOS activity [96].

These studies however involve lesion specific increases in ADMA and are not associated with









increased plasma levels of ADMA and would not be expected to contribute to systemic

cardiovascular pathology. In this regard, there is little direct evidence that elevated plasma

ADMA levels are associated with increased endothelial ADMA nor is it clear whether plasma

ADMA directly contributes to the NOS inhibition observed in chronic cardiovascular diseases

and other disease such as end stage renal disease.

The principal mechanism put forth to explain the pathological role of ADMA in

cardiovascular diseases has focused on DDAH. It has been demonstrated that diabetes and

hypertension are associated with reduced DDAH activity which is believed to result in ADMA

accumulation to levels associated with NOS inhibition. However, a direct cause-effect

relationship between DDAH activity and NOS inhibition has not been demonstrated. It has been

estimated that more than 80% of ADMA is metabolized by DDAH [267], however, it is unclear

which DDAH isoform represents the principal methylarginine metabolizing enzyme. PCR and

western blot analysis has revealed that the endothelium contains mRNA and protein for both

DDAH-1 and DDAH-2. However, in order to assess the relative contribution of each isoform a

detailed analysis of the enzyme kinetics of each isofrom is necessary. Unfortunately, detailed

biochemical studies have only been published for DDAH-1. Using purified recombinant

hDDAH-1 we and others have demonstrated the precise enzyme kinetics of this isofrom and

results demonstrated Km values of 68.7 and 53.6 [tM and Vmax values of 356 and 154

nmols/mg/min for ADMA and L-NMMA, respectively [228, 249]. In regards to DDAH-2,

previous attempts at purifying the protein have been unsuccessful primarily due to solubility

issues with recombinant enzyme expressed in e.coli. Recently we have successfully purified

recombinant human DDAH-2 from bacterial inclusion bodies using a protein refolding method

with L-arginine and cyclodextrin. Initial results demonstrate a Km value of 16 uiM and Vmax









value of 14.8 nmols.mg/min for ADMA (unpublished results). Thus the apparent rate of ADMA

metabolism for DDAH-2 is almost 10 times less than that of DDAH-1. Based on these enzyme

kinetics, DDAH-1 is likely the principal ADMA metabolizing pathway in the endothelium.

Nevertheless, there is significant controversy in the field regarding which DDAH isoform is

responsible for endothelial methylarginine metabolism. Along these same lines, it is also unclear

whether diseases associated with reduced DDAH activity represent loss of DDAH-1 or DDAH-2

activity. Therefore, the studies described in chapter 3 were carried out in order to address these

issues and identify the role of DDAH-1 and DDAH-2 in the regulation of endothelial NO

production.

It has been widely reported that DDAH-2 is the predominant DDAH isoform in the

vascular endothelium; however these studies have widely relied on assessing the expression of

the DDAH isoforms in various cell and tissue types [237, 240, 281, 282]. Consequently, studies

were carried out in BAECs to determine which isoform is responsible for the majority of the

DDAH activity in the endothelial cell. DDAH-1 and DDAH-2 gene silencing decreased total

DDAH activity by 64% and 48%, respectively. There is a possibility that DDAH-2 gene

silencing could have an effect on DDAH-1 but further studies need to be done. Additional

studies demonstrated that dual gene silencing only resulted in a 50% loss total DDAH activity in

BAECs thus suggesting that other methylarginine metabolic pathways may be invoked as a

consequence of loss of DDAH activity. To investigate the possibility that loss of DDAH activity

may lead to the induction of other methyalrginine metabolic enzymes we used HPLC techniques

to measure the metabolic products of 14C-L-NMMA. In control cells we observed 3 peaks with

radioactive counts and they were identified as L-NMMA, L-arginine and L-citrulline. The

formation of radiolablled L-citrulline is likely from the metabolism of L-NMMA by DDAH









while radioactive L-arg is generated from citrulline recycling through ASS and ASL. In contrast,

results from DDAH-1 and DDAH-2 silenced cells indicated the presence of 4 radioactive peaks

including L-NMMA, L-arginine, L-citrulline and a yet unidentified peak. The concentration of

this unidentified peak increased 2 fold in the dual silencing group as compared to the levels in

either the DDAH-1 or DDAH-2 silencing groups alone. Initial mass spec analysis has been

unsuccessful in identifying the unknown species and is currently an area of active investigation

in our lab. Regardless, the results clearly indicate that the endothelium possesses alternate

inducible pathways for metabolizing methylarginines.

Subsequent studies were carried out to assess the role of DDAH-1 and DDAH-2 in the

regulation of endothelial NOS activity. Results demonstrated that adenoviral mediated over-

expression of both DDAH-1 and DDAH-2 increased cellular endothelial NO production. These

initial studies were done in the presence of basal methylarginine levels and demonstrate that

normal endogenous levels of these NOS inhibitors are present at concentration sufficient to

regulate eNOS activity. It had previously been proposed that ADMA may be responsible for the

"arginine paradox" and these studies would appear to support the hypothesis. However,

subsequent studies using L-arg supplementation with DDAH over-expression demonstrated an

additive effect which clearly indicates that ADMA is not involved in the "arginine paradox".

Studies were then performed using siRNA to silence both the DDAH-1 and DDAH-2

genes in BAECs. It was anticipated that silencing of DDAH would lead to increased cellular

methylarginines and decreased endothelial NO production. Results supported this prediction and

demonstrated that DDAH-1 silencing reduced endothelial NO production by 27% while DDAH-

2 silencing reduced it by 57%. These studies were then repeated with L-arg supplementation in

order to establish the ADMA dependence of the DDAH effects. The addition of L-arg (100 [M)









was able to restore -50% of the loss of endothelial NO generation observed with DDAH-1

silencing. Although it may be predicted that L-arg supplementation should completely restore

NO production given that ADMA is a competitive inhibitor of NOS, these result are consistent

with previously published studies and suggest that DDAH-1 silencing may lead to ADMA

accumulation in sites that are not freely exchangeable with L-arg. In support of this hypothesis it

has been demonstrated by Simon et al. that within the endothelial cell exists two pools of

arginine both which eNOS has access to. Pool I is largely made up of extracellular cationic

amino acids transported through the CAT transport system, however Pool II does not freely

exchange with extracellular cationic amino acids. Furthermore they also demonstrated that Pool

II is separated into two components. Pool II A participates in the recycling of citrulline to

arginine, while Pool II B is occupied by protein derived by-products. It is within this Pool II B

where the methylarginines are likely to accumulate, thus rending its inhibitory effects on eNOS

[280]. Futhermore, the studies were only done using one concentration of L-Arg, it would be

interesting to see what effects higher doses would have endothelial NO production.

Alternatively, ADMA and/or DDAH may elicit effects that are independent of NOS, this appears

to be the most plausible explanation with regards to DDAH-2 wherein loss of activity reduced

endothelial NO production by greater than 50% and the loss was unaffected by L-arg

supplementation. This is strong evidence that DDAH may elicit effects that are independent of

ADMA. Although this may represent an overall paradigm shift with regards to the role of

DDAH in the endothelium, it is not with out support. Specifically, Cooke et al. have

demonstrated that DDAH-1 transgenic mice are protected against cardiac transplant

vasculopathy [241, 242]. Using in-vivo siRNA techniques, Wang et al. demonstrated that

DDAH-1 gene silencing increased plasma levels of ADMA by 50% but this increase had no









effect on endothelial dependent relaxation. Conversely, in vivo DDAH-2 gene silencing had no

effect on plasma ADMA, but reduced endothelial dependent relaxation by 40% [237]. These

latter findings are particularly intriguing and demonstrate that elevated plasma ADMA is not

associated with impaired endothelial dependent relaxation while loss of DDAH-2 activity is

associated with impaired endothelial dependent relaxation, despite the fact the plasma ADMA

levels are not increased (40). This provides strong evidence that DDAH effects are not limited to

ADMA dependent regulation of eNOS.

The most convincing evidence that DDAH may regulate cellular function through

mechanisms independent of ADMA mediated NOS inhibition come from data on the DDAH-1

knockout mouse. Homozygous null mice for DDAH-1 are embryonic lethal while the NOS

triple knockout mice are viable [240]. This provides strong evidence that DDAH effects are not

limited to ADMA dependent regulation of eNOS. Using DDAH1 heterozygous mice, which are

viable, Leiper et al. demonstrated that reduced DDAH-1 activity leads to accumulation of plasma

ADMA and a reduction in NO signaling. These animals exhibited a 50% decrease in DDAH

activity which was associated with a 20% increase in plasma and tissue ADMA levels [240].

This in turn was associated with vascular pathology, including endothelial dysfunction, increased

systemic vascular resistance and elevated systemic and pulmonary blood pressure. Given that

the intracellular concentrations of ADMA are 1-3 [iM, it is unlikely that a 20% increase in

ADMA could be responsible for the 40% reduction in endothelial dependent relaxation observed

with the DDAH+' mice. Moreover, the addition of exogenous L-arg to the organ chambers only

partially restored the loss in endothelial relaxation [240]. These results further support the

hypothesis that DDAH modulates endothelial function through both ADMA-NOS dependent









pathways as well as independent. Although this represents an overall paradigm shift, it is not

surprising given the lethality of the DDAH-1 knockout mouse.

Together, these results demonstrate that both DDAH-1 and DDAH-2 are involved in the

regulation of endothelial NO production; however, while DDAH-1 effects are largely ADMA-

dependent, DDAH-2 effects appear to be ADMA-independent. In this regard, elevated plasma

ADMA may serve as a marker of impaired methylarginine metabolism and the pathology

previously attributed to elevated ADMA may be manifested, atleast in part, through altered

activity of the enzymes involved in ADMA regulation, specifically DDAH and PRMT.

Although increased plasma levels of ADMA are associated with cardiovascular disease, it

is the endothelial ADMA levels that are implicated in the regulation of NOS activity. It is

therefore surprising that, to date, there have been no studies examining the cellular kinetics of

ADMA synthesis and metabolism in the endothelium. It is generally accepted that PRMT's

synthesize methylarginines on proteins using the methyl donor SAM and L-arg as the terminal

methyl acceptor. It is then believed that normal protein turnover releases free methylarginines

which are then metabolized to citrulline by DDAH. In this regard, loss of DDAH activity has

been implicated as the molecular trigger for ADMA accumulation and subsequent endothelial

dysfunction. It is our hypothesis that there is crosstalk among these pathways and that the levels

of both free and protein incorporated methylarginines play important roles in regulating

endothelial function, including but not limited to eNOS regulation. In summary, dysregulation

of the PRMT-DDAH-ADMA axis has now been shown to contribute to the pathogenesis of

several cardiovascular disorders, in experimental animal models as well as human disease.

Causal relationships between dysregulated arginine-methylation and the initiation, progression,

or therapy of disease, however, remain to be dissected. Future investigations into arginine-









methylation and DDAH dynamics in disease states are clearly needed in order elucidate the role

of this post-translational modification in the pathogenesis of cardiovascular disease.

The results from chapter 3 clearly demonstrated that loss of DDAH activity was associated

with NOS impairment. This raises a critical question regarding the mechanisms of DDAH

regulation in disease. Among the mechanisms proposed for the loss of DDAH activity

associated with cardiovascular disease is redox modification of DDAH in response to oxidative

stress. In support, Leiper et al. have demonstrated that NO inhibits the activity of DDAH-1

through a mechanism involving the formation of S-nitrosyl complexes within the catalytic

domain of DDAH-1. Therefore, in chapter 4 we carried out a series of studies to investigate the

effects of altered redox state and oxidative stress on DDAH activity and endothelial NO

production. Using purified human recombinant DDAH-1, our lab and others have previously

demonstrated that hDDAH-1 was largely resistant to oxidants (ONOO-, H202, OH, 02') as

concentrations exceeding 100 [iM were needed to elicit any significant inhibition [228, 249].

However, significant inhibition was seen with the lipid peroxidation product 4-HNE and the

inhibition occurred at concentrations associated with pathological conditions.

Results demonstrated that the exposure of BAECs to 4-HNE caused a dose-dependent

inhibition of cellular NO production. The observed 4-HNE effects were independent of changes

in either NOS expression or phosphorylation state, as the Western blotting analysis revealed no

changes in either endpoint. These results suggested that the observed NOS impairment involved

mechanisms other than those related to protein expression. As such, subsequent experiments

were performed in order to determine whether alterations in NOS cofactors or substrate may be

involved in the decreased NO bioavailability. In this regard, oxidant stress, which has been

shown to occur following exposure to lipid peroxidation products, has been shown to reduce the









bioavailability of the critical NOS cofactor, H4B [290, 311]. Loss of this cofactor results in NOS

uncoupling evident by impaired NO synthesis and enhanced superoxide production from the

enzyme [310]. Moreover, oxidant injury has also been demonstrated to increase the cellular

levels of the endogenous methylarginine, ADMA [35]. Therefore, cellular studies were carried

out to investigate the effects of adding both an antioxidant (GSH) to prevent H4B oxidation as

well as the eNOS substrate L-Arginine to overcome endogenous methylarginine-mediated NOS

inhibition. Our data demonstrate that the addition of either GSH or L-Arginine alone had only

modest NO-enhancing effects, however, co-incubation with both GSH and L-Arg was able to

almost completely restore endothelial NO production. These data suggest that the observed NOS

impairment involves both oxidant induced NOS inhibition (alleviated by the addition of GSH) as

well as methylarginine inhibitory effects (alleviated by the addition of excess substrate).

Direct measurement of ADMA levels and DDAH activity within cells by HPLC

demonstrated that following 4-HNE challenge intracellular ADMA levels were increased greater

than 2-fold. Based on previously published studies demonstrating the kinetics of ADMA

mediated cellular inhibition, a 2 fold increase in methylarginine levels would be expected to

inhibit NOS dependent NO generation by 20-30 % [96]. The additional inhibition observed

could be due to compartmentalization or NOS uncoupling and increased NOS derived

superoxide production in the presence of ADMA. To determine whether the increased levels of

ADMA observed following 4-HNE exposure resulted from changes in the activity of the ADMA

metabolizing enzyme DDAH, its activity was measured. Studies of DDAH activity

demonstrated a 40% decrease in hydrolytic activity, suggesting that the mechanism for the

observed 4-HNE-directed NOS impairment was via an inhibition of DDAH. Additional studies

were performed on purified recombinant hDDAH-1 in order to determine whether 4-HNE effects









were through direct interaction with the enzyme. Results demonstrated that incubation of

hDDAH-1 with 4-HNE (50 [LM) resulted in a > 40% decrease in enzyme activity. These effects

were specific to 4-HNE as incubation with the non-oxidized carbonyl hexanol (10-500 iM) had

no effect on DDAH activity. Similar studies were performed with purified recombinant eNOS

and no inhibition was observed following 4-HNE exposure. 4-HNE forms Michael adducts with

histidine and cysteine residues on proteins. In this regard, the catalytic triad of DDAH contains

both cysteine and histidine residues and mutation of either amino acid has been demonstrated to

render the enzyme inactive. [314-316].

As further support to the role of DDAH in mediating the inhibitory effects of 4-HNE on

endothelial NO production, studies were performed using DDAH over-expressing BAECs.

Over-expression of DDAH should lead to a decrease in cellular methylarginines with the

concomitant increase in NOS-derived NO. DDAH over-expression was induced using an

adenoviral construct carrying the human DDAH-1 gene. DDAH over-expression increased

cellular DDAH activity in control cells by 50% and resulted in a 22% increase in cellular NO

production. If one then considers the 2-fold increase in the levels of ADMA observed following

the 4-HNE treatment, a -40 % inhibitory effect would be predicted [96].

Subsequently, a series of studies were performed using this same transduction protocol to

examine the effects of DDAH over-expression on 4-HNE mediated endothelial NO inhibition.

Although DDAH over-expression did increase DDAH activity and decrease endogenous

methylarginines, the over-expression of the enzyme alone was not sufficient to prevent the 4-

HNE-induced decrease in NO production. In fact, our results demonstrated that exposure of

DDAH over-expressing cells to 4-HNE resulted in worsened outcome as NO levels were

significantly lower than that in the control cells exposed to 4-HNE. Although these results may









appear contradictory to our hypothesis, they in fact support it and demonstrate that NOS

uncoupling is likely occurring. The mechanism involved methylarginine mediated regulation of

eNOS derived superoxide. These findings are consistent with studies presented in chapter 5

wherin using electron paramagnetic resonance spin trapping techniques we measured the dose

dependent effects of ADMA and L-NMMA on O production from eNOS under conditions of

H4B depletion. In the absence of H4B, ADMA dose dependently increased NOS derived 02'

generation, with a maximal increase of 151 % at 100 JiM ADMA. L-NMMA also dose

dependently increased NOS derived 02'-, but to a lesser extent, demonstrating a 102 % increase

at 100 JiM L-NMMA. Moreover, the native substrate L-arginine also increased eNOS derived

02-, exhibiting a similar degree of enhancement as that observed with ADMA. Measurements of

NADPH consumption from eNOS demonstrated that binding of either L-arginine or

methylarginines increased the rate of NADPH oxidation. Spectrophotometric studies suggest,

just as for L-arginine, that binding of ADMA and L-NMMA shift the eNOS heme to the high-

spin state, indicative of a more positive heme redox potential, enabling enhanced electron

transfer from the reductase to the oxygenase site. These results demonstrate that the

methylarginines can profoundly shift the balance of NO and 2O generation from eNOS. These

observations have important implications with regard to the therapeutic use of L-arginine and the

methylarginine-NOS inhibitors in the treatment of disease. While these studies were done using

prufied enzyme, in the cell, eNOS is known to have various cofactors that may play a role in

eNOS derived superoxide. Currently, the effects of methylarginines on cellular eNOS derived

superoxide are an area of active investigation in our lab.

Based on the results presented thus far, our hypothesis would predict that treatment of

DDAH over-expressing cells with an antioxidant would restore NO to levels similar to those









observed with L-Arg and GSH treatment, if in fact methylarginines are contributing to the

inhibition in NO generation seen with 4-HNE challenge. Indeed, we demonstrated almost

complete protection of cellular NO production following 4-HNE challenge using a combination

of viral over-expression of DDAH and treatment with GSH, when compared to the respective

control. These results would indicate that GSH alone reduces NOS uncoupling, but not the

methylarginine accumulation, while L-Arg supplementation and/or DDAH over-expression

overcomes the 4-HNE-induced increase in methylarginines but not the NOS uncoupling.

The research presented demonstrates for the first time that the lipid peroxidation product 4-

HNE can inhibit the endothelial NO production. The doses used in this study represent

pathological levels of this highly reactive lipid peroxidation product and suggest that this

bioactive molecule may play a critical role in the endothelial dysfunction observed in a variety of

cardiovascular diseases. The inhibitory effects of 4-HNE appear to be mediated through both

oxidant stress and elevated levels of the endogenous NOS inhibitors ADMA and L-NMMA, as

either L-Arg supplementation or DDAH over-expression in the presence of an anti-oxidant were

able to restore NO production. Together, these results represent a major step forward in our

understanding of the regulation, impact, and role of methylarginines and lipid peroxidation in

cardiovascular disease.

Altered redox status of the endothelium has been implicated as a central mechanism in the

endothelial dysfunction associated with cardiovascular diseases. Based on the results described

in these studies, we propose that loss of DDAH activity under conditions of oxidative stress

contributes to the pathogenesis of cardiovascular disease through its effects on NOS derived NO

and superoxide production. Specifically, we believe that decreased DDAH activity inhibits

eNOS derived NO production through both ADMA-dependent and independent pathways.









Moreover, the ADMA accumulation that occurs as a result of loss of DDAH activity is also

involved in the perpetuation of eNOS derived superoxide which likely contributes to the NO

inactivation observed in cardiovascular disease.

Biochemical studies using recombinant NOS have demonstrated that eNOS, in the absence

of H4B, has the potential to be a major source of superoxide with catalytic rates approaching

those of NADPH Oxidase and Xanthine Oxidase [371]. However, cellular studies of eNOS

derived superoxide have revealed that H4B depletion alone does not significantly increase

superoxide fluxes [372, 373]. Instead, it appears that increased levels of the H4B oxidation

product, H2B, is the molecular trigger for eNOS uncoupling. Evidence for this hypothesis is

supported by our data as well as work from Gross et al. in which they demonstrated 48-h

exposure to diabetic glucose levels (30 mM) caused H2B levels to increase from undetectable to

40% of total biopterin. This H2B accumulation was associated with diminished NO activity and

accelerated superoxide production. However, it is unclear why H2B accumulates in cellular and

animal models of diabetes. Bioaccumulation of H2B or quinoid H2B following oxidation of H4B

would not be expected to occur in the endothelium as the combination of dihydrofolate reductase

and dihydropteridine reductase should efficiently reduce these oxidized pterins back to H4B.

Given that numerous studies have clearly identified increased H2B formation in diabetes suggests

that these conditions are likely associated with impaired pterin salvage or recycling pathways.

Therefore, we hypothesized that in diabetes, enzymes involved in either the H4B salvage or

recycling pathways are impaired resulting in an inability to maintain adequate H4B levels. The

result is eNOS uncoupling and altered NO and ROS signaling which leads to diabetic vascular

dysfunction.









Therefore, the studies described in chapter 6 were carried out to investigate pterin

regulation in diabetes. Initial studies were conducted in order to determine the effect of ROS and

RNS on DHFR activity. These studies demonstrated that the DHFR enzymatic activity is

sensitive to ROS with significant inhibition observed with pathophysiologically relevant doses of

superoxide, NO and H202. In contrast, OONO- at pathophysiologically relevant levels induced a

significant increase DHFR activity. This is an intriguing finding given that ONOO- has been

shown to be the most potent oxidizer of H4B and may represent a novel compensatory

mechanism for the cell to maintain adequate H2B / H4B ratios.

Although previous studies have clearly demonstrated increased oxidative stress and NOS

uncoupling in diabetes, no studies to date have examined the role of DHFR in this process.

Therefore, we carried out in vivo studies in order to determine the effects of the diabetic state on

tissue DHFR activity. We observed that in the kidney of db/db mice, DHFR activity was

significantly inhibited when compared to wt age matched controls. This decrease in DHFR

activity resulted in increased H2B levels in db/db mice. Functional studies were also performed

to determine the effect of the loss of DHFR activity on aortic vascular relaxation. Results

demonstrated a 35% impairment of the NO mediated vascular relaxation in db/db mice when

compared to the wt age matched controls. This decreased endothelial dependent relaxation was

associated with increased eNOS derived 02-' in the aorta as measured by EPR. In contrast to the

wild type mice, eNOS derived 02- was detectable in the isolated aorta of db/db mice. These

findings are in line with previous reports of increased H2B levels in diabetic mice [361, 364] and

implicate DHFR as a key regulatory element involved in eNOS dysregulation.

In summary, the data presented in this thesis demonstrate a critical role for the DDAH-

ADMA axis in the pathogenesis of endothelial dysfunction associated with cardiovascular









diseases. Evidence suggests that DDAH is capable of modulating both eNOS derived NO and

superoxide generation through ADMA-dependent as well as independent pathways.









LIST OF REFERENCES


1. Lloyd-Jones, D., et al., Heart Disease and Stroke Statistics--2009 Update: A Report From
the American Heart Association Statistics Committee and Stroke Statistics Subcommittee.
Circulation, 2009. 119(3): p. 480-486.

2. Goldstein, J.L. and M.S. Brown, Familial hypercholesterolemia: identification of a defect
in the regulation of 3-hydroxy-3-methylglutaryl coenzyme A reductase activity associated
with overproduction of cholesterol. Proc Natl Acad Sci US A, 1973. 70(10): p. 2804-8.

3. Brown, M.S. and J.L. Goldstein, Receptor-mediated endocytosis: insights from the
lipoprotein receptor system. Proc Natl Acad Sci U S A, 1979. 76(7): p. 3330-7.

4. Lloyd-Jones, D.M., et al., Prediction of lifetime risk for cardiovascular disease by risk
factor burden at 50 years of age. Circulation, 2006. 113(6): p. 791-8.

5. Baldwin, G.S. and P.R. Carnegie, Specific Enzymic Methylation of an Arginine in the
Experimental Allergic Encephalomyelitis Protein from Human Myelin. Science, 1971.
171(3971): p. 579-581.

6. Corti, R., et al., Evolving concepts in the triad of atherosclerosis, inflammation and
thrombosis. J Thromb Thrombolysis, 2004. 17(1): p. 35-44.

7. Gutierrez, J., et al., Free radicals, mitochondria, and oxidized lipids: the emerging role in
signal transduction in vascular cells. Circ Res, 2006. 99(9): p. 924-32.

8. Libby, P., Vascular biology of atherosclerosis: overview and state of the art. Am J Cardiol,
2003. 91(3A): p. 3A-6A.

9. Stary, H.C., et al., A definition of advanced types of atherosclerotic lesions and a
histological classification of atherosclerosis. A report from the Committee on Vascular
Lesions of the Council on Arteriosclerosis, American Heart Association. Circulation, 1995.
92(5): p. 1355-74.

10. Libby, P., Inflammation and cardiovascular disease mechanisms. Am J Clin Nutr, 2006.
83(2): p. 456S-460S.

11. Azevedo, L.C., et al., Oxidative stress as a signaling mechanism of the vascular response
to injury: the redox hypothesis of restenosis. Cardiovasc Res, 2000. 47(3): p. 436-45.

12. Bauters, C. and J.M. Isner, The biology of restenosis. Prog Cardiovasc Dis, 1997. 40(2): p.
107-16.

13. Ferns, G.A., et al., Inhibition of neointimal smooth muscle accumulation after angioplasty
by an antibody to PDGF. Science, 1991. 253(5024): p. 1129-32.

14. Heckenkamp, J., M. Gawenda, and J. Brunkwall, Vascular restenosis. Basic science and
clinical implications. J Cardiovasc Surg (Torino), 2002. 43(3): p. 349-57.









15. Libby, P. and H. Tanaka, The molecular bases of restenosis. Prog Cardiovasc Dis, 1997.
40(2): p. 97-106.

16. Galle, J., et al., Impact of oxidized low density lipoprotein on vascular cells.
Atherosclerosis, 2006. 185(2): p. 219-26.

17. Hamilton, C.A., Low-density lipoprotein and oxidised low-density lipoprotein: their role in
the development of atherosclerosis. Pharmacol Ther, 1997. 74(1): p. 55-72.

18. Heinecke, J.W., Is the emperor wearing clothes? Clinical trials of vitamin E and the LDL
oxidation hypothesis. Arterioscler Thromb Vasc Biol, 2001. 21(8): p. 1261-4.

19. Navab, M., et al., HDL and the inflammatory response induced by LDL-derived oxidized
phospholipids. Arterioscler Thromb Vasc Biol, 2001. 21(4): p. 481-8.

20. Spiteller, G., The relation of lipid peroxidation processes with atherogenesis: a new theory
on atherogenesis. Mol Nutr Food Res, 2005. 49(11): p. 999-1013.

21. Uchida, K., et al., Michael addition-type 4-hydroxy-2-nonenal adducts in modified low-
density lipoproteins: markers for atherosclerosis. Biochemistry, 1994. 33(41): p. 12487-94.

22. Arnold, W.P., et al., Nitric oxide activates guanylate cyclase and increases guanosine 3':5'-
cyclic monophosphate levels in various tissue preparations. Proc Natl Acad Sci U S A,
1977. 74(8): p. 3203-7.

23. Palmer, R.M., D.S. Ashton, and S. Moncada, Vascular endothelial cells synthesize nitric
oxide from L-arginine. Nature, 1988. 333(6174): p. 664-6.

24. Jeremy, J.Y., et al., Oxidative stress, nitric oxide, and vascular disease. J Card Surg, 2002.
17(4): p. 324-7.

25. Sarkar, R. and R.C. Webb, Does nitric oxide regulate smooth muscle cell proliferation? A
critical appraisal. J Vasc Res, 1998. 35(3): p. 135-42.

26. Cooke, J.P. and R.K. Oka, Atherogenesis and the arginine hypothesis. Curr Atheroscler
Rep, 2001. 3(3): p. 252-9.

27. Holm, A.M., et al., Effects of L-arginine on vascular smooth muscle cell proliferation and
apoptosis after balloon injury. Scand Cardiovasc J, 2000. 34(1): p. 28-32.

28. Le Tourneau, T., et al., Role of nitric oxide in restenosis after experimental balloon
angioplasty in the hypercholesterolemic rabbit: effects on neointimal hyperplasia and
vascular remodeling. J Am Coll Cardiol, 1999. 33(3): p. 876-82.

29. Janero, D.R. and J.F. Ewing, Nitric oxide and postangioplasty restenosis: pathological
correlates and therapeutic potential. Free Radic Biol Med, 2000. 29(12): p. 1199-221.









30. Aji, W., et al., L-arginine prevents xanthoma development and inhibits atherosclerosis in
LDL receptor knockout mice. Circulation, 1997. 95(2): p. 430-7.

31. Boger, R.H., et al., Dietary L-arginine reduces the progression of atherosclerosis in
cholesterol-fed rabbits: comparison with lovastatin. Circulation, 1997. 96(4): p. 1282-90.

32. Boger, R.H., et al., Plasma concentration of asymmetric dimethylarginine, an endogenous
inhibitor of nitric oxide synthase, is elevated in monkeys with hyperhomocyst(e)inemia or
hypercholesterolemia. Arterioscler Thromb Vasc Biol, 2000. 20(6): p. 1557-64.

33. Kielstein, J.T., et al., Relationship of asymmetric dimethylarginine to dialysis treatment
and atherosclerotic disease. Kidney Int Suppl, 2001. 78: p. S9-13.

34. Miyazaki, H., et al., Endogenous nitric oxide synthase inhibitor: a novel marker of
atherosclerosis. Circulation, 1999. 99(9): p. 1141-6.

35. Leiper, J. and P. Vallance, Biological significance of endogenous methylarginines that
inhibit nitric oxide synthases. Cardiovasc Res, 1999. 43(3): p. 542-8.

36. Leiper, J.M., et al., Identification of two human dimethylarginine
dimethylaminohydrolases with distinct tissue distributions and homology with microbial
arginine deiminases. Biochem J, 1999. 343(Pt 1): p. 209-14.

37. Tang, J., et al., PRMT 3, a type I protein arginine N-methyltransferase that differs from
PRMT1 in its oligomerization, subcellular localization, substrate specificity, and
regulation. J Biol Chem, 1998. 273(27): p. 16935-45.

38. Cardounel, A.J., et al., Evidence for the pathophysiological role of endogenous
methylarginies in regulation of endothelial NO production and vascular function. J Biol
Chem, 2006.

39. White, C.R., et al., L-Arginine inhibits xanthine oxidase-dependent endothelial dysfunction
in hypercholesterolemia. FEBS Lett, 2004. 561(1-3): p. 94-8.

40. Wu, Z., et al., Long-term oral administration of L-arginine enhances endothelium-
dependent vasorelaxation and inhibits neointimal thickening after endothelial denudation
in rats. Chin Med J (Engl), 1996. 109(8): p. 592-8.

41. Cardounel, A.J. and J.L. Zweier, Endogenous methylarginines regulate neuronal nitric-
oxide synthase and prevent excitotoxic injury. J Biol Chem, 2002. 277(37): p. 33995-4002.

42. Tsikas, D., et al., Endogenous nitric oxide synthase inhibitors are responsible for the L-
arginine paradox. FEBS Lett, 2000. 478(1-2): p. 1-3.

43. Cai, H. and D.G. Harrison, Endothelial dysfunction in cardiovascular diseases: the role of
oxidant stress. Circ Res, 2000. 87(10): p. 840-4.









44. Durante, W., A.K. Sen, and F.A. Sunahara, Impairment of endothelium-dependent
relaxation in aortae from spontaneously diabetic rats. Br J Pharmacol, 1988. 94(2): p. 463-
8.

45. Lockette, W., Y. Otsuka, and 0. Carretero, The loss of endothelium-dependent vascular
relaxation in hypertension. Hypertension, 1986. 8(6 Pt 2): p. 1161-6.

46. Oyama, Y., et al., Attenuation of endothelium-dependent relaxation in aorta from diabetic
rats. Eur J Pharmacol, 1986. 132(1): p. 75-8.

47. Winquist, R.J., et al., Decreased endothelium-dependent relaxation in New Zealand genetic
hypertensive rats. J Hypertens, 1984. 2(5): p. 541-5.

48. Fukai, T., et al., Extracellular superoxide dismutase and cardiovascular disease. Cardiovasc
Res, 2002. 55(2): p. 239-49.

49. Juul, K., et al., Genetically reduced antioxidative protection and increased ischemic heart
disease risk: The Copenhagen City Heart Study. Circulation, 2004. 109(1): p. 59-65.

50. Xia, Y., et al., Superoxide generation from endothelial nitric-oxide synthase. A
Ca2+/calmodulin-dependent and tetrahydrobiopterin regulatory process. J Biol Chem,
1998. 273(40): p. 25804-8.

51. Vasquez-Vivar, J., et al., Superoxide generation by endothelial nitric oxide synthase: the
influence of cofactors. Proc Natl Acad Sci US A, 1998. 95(16): p. 9220-5.

52. Burg, A.W. and G.M. Brown, The biosynthesis of folic acid. 8. Purification and properties
of the enzyme that catalyzes the production of format from carbon atom 8 of guanosine
triphosphate. J Biol Chem, 1968. 243(9): p. 2349-58.

53. Laursen, J.B., et al., Endothelial regulation of vasomotion in apoE-deficient mice:
implications for interactions between peroxynitrite and tetrahydrobiopterin. Circulation,
2001. 103(9): p. 1282-8.

54. Heitzer, T., et al., Tetrahydrobiopterin improves endothelium-dependent vasodilation in
chronic smokers : evidence for a dysfunctional nitric oxide synthase. Circ Res, 2000.
86(2): p. E36-41.

55. Settergren, M., et al., 1-Arginine and tetrahydrobiopterin protects against
ischemia/reperfusion-induced endothelial dysfunction in patients with type 2 diabetes
mellitus and coronary artery disease. Atherosclerosis, 2008.

56. Jennings, M.A. and L. Florey, An investigation of some properties of endothelium related
to capillary permeability. Proc R Soc Lond B Biol Sci, 1967. 167(6): p. 39-63.

57. Furchgott, R.F. and J.V. Zawadzki, The obligatory role of endothelial cells in the
relaxation of arterial smooth muscle by acetylcholine. Nature, 1980. 288(5789): p. 373-6.









58. Ignarro, L.J., et al., Endothelium-derived relaxing factor produced and released from artery
and vein is nitric oxide. Proc Natl Acad Sci U S A, 1987. 84(24): p. 9265-9.

59. Palmer, R.M., A.G. Ferrige, and S. Moncada, Nitric oxide release accounts for the
biological activity of endothelium-derived relaxing factor. Nature, 1987. 327(6122): p.
524-6.

60. Palmer, R.M., D.S. Ashton, and S. Moncada, Vascular endothelial cells synthesize nitric
oxide from L-arginine. Nature, 1988. 333(6174): p. 664-6.

61. Ignarro, L.J., et al., Oxidation of nitric oxide in aqueous solution to nitrite but not nitrate:
comparison with enzymatically formed nitric oxide from L-arginine. Proc Natl Acad Sci U
S A, 1993. 90(17): p. 8103-7.

62. Masters, B.S., et al., Neuronal nitric oxide synthase, a modular enzyme formed by
convergent evolution: structure studies of a cysteine thiolate-liganded heme protein that
hydroxylates L-arginine to produce NO. as a cellular signal. FASEB J, 1996. 10(5): p. 552-
8.

63. Mayer, B. and B. Hemmens, Biosynthesis and action of nitric oxide in mammalian cells.
Trends Biochem Sci, 1997. 22(12): p. 477-81.

64. Stuehr, D.J., Structure-function aspects in the nitric oxide synthases. Annu Rev Pharmacol
Toxicol, 1997. 37: p. 339-59.

65. Abu-Soud, H.M. and D.J. Stuehr, Nitric oxide synthases reveal a role for calmodulin in
controlling electron transfer. Proc Natl Acad Sci U S A, 1993. 90(22): p. 10769-72.

66. White, K.A. and M.A. Marletta, Nitric oxide synthase is a cytochrome P-450 type
hemoprotein. Biochemistry, 1992. 31(29): p. 6627-31.

67. Bredt, D.S. and S.H. Snyder, Isolation of nitric oxide synthetase, a calmodulin-requiring
enzyme. Proc Natl Acad Sci US A, 1990. 87(2): p. 682-5.

68. Knowles, R.G., et al., Formation of nitric oxide from L-arginine in the central nervous
system: a transduction mechanism for stimulation of the soluble guanylate cyclase. Proc
Natl Acad Sci U S A, 1989. 86(13): p. 5159-62.

69. Garcia-Cardena, G., et al., Targeting of nitric oxide synthase to endothelial cell caveolae
via palmitoylation: implications for nitric oxide signaling. Proc Natl Acad Sci U S A,
1996. 93(13): p. 6448-53.

70. Goetz, R.M., et al., Estradiol induces the calcium-dependent translocation of endothelial
nitric oxide synthase. Proc Natl Acad Sci U S A, 1999. 96(6): p. 2788-93.

71. Loscalzo, J. and G. Welch, Nitric oxide and its role in the cardiovascular system. Prog
Cardiovasc Dis, 1995. 38(2): p. 87-104.









72. Fujimoto, T., et al., Localization of inositol 1,4,5-trisphosphate receptor-like protein in
plasmalemmal caveolae. J Cell Biol, 1992. 119(6): p. 1507-13.

73. Siddhanta, U., et al., Heme iron reduction and catalysis by a nitric oxide synthase
heterodimer containing one reductase and two oxygenase domains. J Biol Chem, 1996.
271(13): p. 7309-12.

74. Li, H., et al., Regulatory role of arginase I and II in nitric oxide, polyamine, and proline
syntheses in endothelial cells. Am J Physiol Endocrinol Metab, 2001. 280(1): p. E75-82.

75. Radomski, M.W., R.M. Palmer, and S. Moncada, The anti-aggregating properties of
vascular endothelium: interactions between prostacyclin and nitric oxide. Br J Pharmacol,
1987. 92(3): p. 639-46.

76. Stagliano, N.E., et al., The effect of nitric oxide synthase inhibition on acute platelet
accumulation and hemodynamic depression in a rat model of thromboembolic stroke. J
Cereb Blood Flow Metab, 1997. 17(11): p. 1182-90.

77. Simon, D.I., et al., Effect of nitric oxide synthase inhibition on bleeding time in humans. J
Cardiovasc Pharmacol, 1995. 26(2): p. 339-42.

78. Lefer, A.M. and X.L. Ma, Decreased basal nitric oxide release in hypercholesterolemia
increases neutrophil adherence to rabbit coronary artery endothelium. Arterioscler Thromb,
1993. 13(6): p. 771-6.

79. Peng, H.B., P. Libby, and J.K. Liao, Induction and stabilization of I kappa B alpha by
nitric oxide mediates inhibition of NF-kappa B. J Biol Chem, 1995. 270(23): p. 14214-9.

80. Lablanche, J.M., et al., Effect of the direct nitric oxide donors linsidomine and
molsidomine on angiographic restenosis after coronary balloon angioplasty. The
ACCORD Study. Angioplastic Coronaire Corvasal Diltiazem. Circulation, 1997. 95(1): p.
83-9.

81. Janssens, S., et al., Human endothelial nitric oxide synthase gene transfer inhibits vascular
smooth muscle cell proliferation and neointima formation after balloon injury in rats.
Circulation, 1998. 97(13): p. 1274-81.

82. Varenne, 0., et al., Local adenovirus-mediated transfer of human endothelial nitric oxide
synthase reduces luminal narrowing after coronary angioplasty in pigs. Circulation, 1998.
98(9): p. 919-26.

83. Guo, K., V. Andres, and K. Walsh, Nitric Oxidefilnduced Downregulation of Cdk2
Activity and Cyclin A Gene Transcription in Vascular Smooth Muscle Cells. Circulation,
1998. 97(20): p. 2066-2072.

84. Muller, B., et al., Nitric oxide transport and storage in the cardiovascular system. Ann N Y
Acad Sci, 2002. 962: p. 131-9.









85. Xu, A., J.A. Vita, and J.F. Keaney, Jr., Ascorbic acid and glutathione modulate the
biological activity of S-nitrosoglutathione. Hypertension, 2000. 36(2): p. 291-5.

86. Beltran, B., et al., Oxidative stress and S-nitrosylation of proteins in cells. Br J Pharmacol,
2000. 129(5): p. 953-60.

87. Haendeler, J., et al., Antioxidant Effects of Statins via S-Nitrosylation and Activation of
Thioredoxin in Endothelial Cells: A Novel Vasculoprotective Function of Statins.
Circulation, 2004. 110(7): p. 856-861.

88. Leiper, J., et al., S-nitrosylation of dimethylarginine dimethylaminohydrolase regulates
enzyme activity: further interactions between nitric oxide synthase and dimethylarginine
dimethylaminohydrolase. Proc Natl Acad Sci U S A, 2002. 99(21): p. 13527-32.

89. Hao, G., L. Xie, and S.S. Gross, Argininosuccinate synthetase is reversibly inactivated by
S-nitrosylation in vitro and in vivo. J Biol Chem, 2004. 279(35): p. 36192-200.

90. Ravi, K., et al., S-nitrosylation of endothelial nitric oxide synthase is associated with
monomerization and decreased enzyme activity. Proc Natl Acad Sci U S A, 2004. 101(8):
p. 2619-24.

91. Erwin, P.A., et al., Receptor-regulated Dynamic S-Nitrosylation of Endothelial Nitric-
oxide Synthase in Vascular Endothelial Cells. J. Biol. Chem., 2005. 280(20): p. 19888-
19894.

92. Wu, G., Intestinal mucosal amino acid catabolism. J Nutr, 1998. 128(8): p. 1249-52.

93. Wu, G. and S.M. Morris, Jr., Arginine metabolism: nitric oxide and beyond. Biochem J,
1998. 336 (Pt 1): p. 1-17.

94. Morris, S.M., Jr., Arginine metabolism in vascular biology and disease. Vasc Med, 2005.
10 Suppl 1: p. S83-7.

95. Hallemeesch, M.M., W.H. Lamers, and N.E. Deutz, Reduced arginine availability and
nitric oxide production. Clin Nutr, 2002. 21(4): p. 273-9.

96. Cardounel, A.J., et al., Evidence for the pathophysiological role of endogenous
methylarginines in regulation of endothelial NO production and vascular function. J Biol
Chem, 2007. 282(2): p. 879-87.

97. Durante, W., et al., Transforming Growth Factor-{beta} 1 Stimulates L-Arginine Transport
and Metabolism in Vascular Smooth Muscle Cells : Role in Polyamine and Collagen
Synthesis. Circulation, 2001. 103(8): p. 1121-1127.

98. Durante, W., F.K. Johnson, and R.A. Johnson, Arginase: a critical regulator of nitric oxide
synthesis and vascular function. Clin Exp Pharmacol Physiol, 2007. 34(9): p. 906-11.









99. Reczkowski, R.S. and D.E. Ash, Rat liver arginase: kinetic mechanism, alternate
substrates, and inhibitors. Arch Biochem Biophys, 1994. 312(1): p. 31-7.

100. Chang, C.I., J.C. Liao, and L. Kuo, Arginase modulates nitric oxide production in activated
macrophages. Am J Physiol, 1998. 274(1 Pt 2): p. H342-8.

101. Johnson, F.K., et al., Arginase inhibition restores arteriolar endothelial function in Dahl
rats with salt-induced hypertension. Am J Physiol Regul Integr Comp Physiol, 2005.
288(4): p. R1057-62.

102. Chicoine, L.G., et al., Arginase inhibition increases nitric oxide production in bovine
pulmonary arterial endothelial cells. Am J Physiol Lung Cell Mol Physiol, 2004. 287(1): p.
L60-8.

103. Fukuda, Y., et al., Tetrahydrobiopterin restores endothelial function of coronary arteries in
patients with hypercholesterolaemia. Heart, 2002. 87(3): p. 264-9.

104. Walker, J.B., Creatine: biosynthesis, regulation, and function. Adv Enzymol Relat Areas
Mol Biol, 1979. 50: p. 177-242.

105. Morris, S.M., Jr., Enzymes of arginine metabolism. J Nutr, 2004. 134(10 Suppl): p. 2743S-
2747S; discussion 2765S-2767S.

106. Kwon, N.S., C.F. Nathan, and D.J. Stuehr, Reduced biopterin as a cofactor in the
generation of nitrogen oxides by murine macrophages. J Biol Chem, 1989. 264(34): p.
20496-501.

107. Tayeh, M.A. and M.A. Marletta, Macrophage oxidation of L-arginine to nitric oxide,
nitrite, and nitrate. Tetrahydrobiopterin is required as a cofactor. J Biol Chem, 1989.
264(33): p. 19654-8.

108. Kaufman, S., Studies on the mechanism of the enzymatic conversion of phenylalanine to
tyrosine. J Biol Chem, 1959. 234: p. 2677-82.

109. Vasquez-Vivar, J., et al., The ratio between tetrahydrobiopterin and oxidized
tetrahydrobiopterin analogues controls superoxide release from endothelial nitric oxide
synthase: an EPR spin trapping study. Biochem J, 2002. 362(Pt 3): p. 733-9.

110. Hurshman, A.R., et al., Formation of a pterin radical in the reaction of the heme domain of
inducible nitric oxide synthase with oxygen. Biochemistry, 1999. 38(48): p. 15689-96.

111. Schmidt, P.P., et al., Formation of a protonated trihydrobiopterin radical cation in the first
reaction cycle of neuronal and endothelial nitric oxide synthase detected by electron
paramagnetic resonance spectroscopy. J Biol Inorg Chem, 2001. 6(2): p. 151-8.

112. Cai, S., et al., GTP cyclohydrolase I gene transfer augments intracellular
tetrahydrobiopterin in human endothelial cells: effects on nitric oxide synthase activity,
protein levels and dimerisation. Cardiovasc Res, 2002. 55(4): p. 838-49.









113. Hattori, Y., et al., Oral administration of tetrahydrobiopterin slows the progression of
atherosclerosis in apolipoprotein E-knockout mice. Arterioscler Thromb Vasc Biol, 2007.
27(4): p. 865-70.

114. Kaufman, S., A protein that stimulates rat liver phenylalanine hydroxylase. J Biol Chem,
1970. 245(18): p. 4751-9.

115. Nakanishi, N., H. Hasegawa, and S. Watabe, A new enzyme, NADPH-dihydropteridine
reductase in bovine liver. J Biochem, 1977. 81(3): p. 681-5.

116. Vasquez-Vivar, J., et al., Reaction of tetrahydrobiopterin with superoxide: EPR-kinetic
analysis and characterization of the pteridine radical. Free Radic Biol Med, 2001. 31(8): p.
975-85.

117. Katusic, Z.S., A. Stelter, and S. Milstien, Cytokines stimulate GTP cyclohydrolase I gene
expression in cultured human umbilical vein endothelial cells. Arterioscler Thromb Vasc
Biol, 1998. 18(1): p. 27-32.

118. Linscheid, P., et al., Regulation of 6-pyruvoyltetrahydropterin synthase activity and
messenger RNA abundance in human vascular endothelial cells. Circulation, 1998. 98(17):
p. 1703-6.

119. Huang, A., et al., Cytokine-stimulated GTP cyclohydrolase I expression in endothelial
cells requires coordinated activation of nuclear factor-kappaB and Statl/Stat3. Circ Res,
2005. 96(2): p. 164-71.

120. Lapize, C., et al., Protein kinase C phosphorylates and activates GTP cyclohydrolase I in
rat renal mesangial cells. Biochem Biophys Res Commun, 1998. 251(3): p. 802-5.

121. Cai, S., et al., GTP cyclohydrolase I gene transfer augments intracellular
tetrahydrobiopterin in human endothelial cells: effects on nitric oxide synthase activity,
protein levels and dimerisation. Cardiovasc Res, 2002. 55(4): p. 838-849.

122. Widder, J.D., et al., Regulation of Tetrahydrobiopterin Biosynthesis by Shear Stress. Circ
Res, 2007. 101(8): p. 830-838.

123. Bendall, J.K., et al., Stoichiometric Relationships Between Endothelial
Tetrahydrobiopterin, Endothelial NO Synthase (eNOS) Activity, and eNOS Coupling in
Vivo: Insights From Transgenic Mice With Endothelial-Targeted GTP Cyclohydrolase 1
and eNOS Overexpression. Circ Res, 2005. 97(9): p. 864-871.

124. Harada, T., H. Kagamiyama, and K. Hatakeyama, Feedback regulation mechanisms for the
control of GTP cyclohydrolase I activity. Science, 1993. 260(5113): p. 1507-10.

125. Ishii, M., et al., Reduction of GTP cyclohydrolase I feedback regulating protein expression
by hydrogen peroxide in vascular endothelial cells. J Pharmacol Sci, 2005. 97(2): p. 299-
302.









126. Swick, L. and G. Kapatos, A yeast 2-hybrid analysis of human GTP cyclohydrolase I
protein interactions. J Neurochem, 2006. 97(5): p. 1447-55.

127. Kaspers, B., et al., Coordinate induction of tetrahydrobiopterin synthesis and nitric oxide
synthase activity in chicken macrophages: upregulation of GTP-cyclohydrolase I activity.
Comp Biochem Physiol B Biochem Mol Biol, 1997. 117(2): p. 209-15.

128. Werner, E.R., et al., Biochemistry and function of pteridine synthesis in human and murine
macrophages. Pathobiology, 1991. 59(4): p. 276-9.

129. Gupta, S., et al., Serum neopterin in acute coronary syndromes. Lancet, 1997. 349(9060):
p. 1252-3.

130. Curtius, H.C., et al., Biosynthesis of tetrahydrobiopterin in man. J Inherit Metab Dis, 1985.
8 Suppl 1: p. 28-33.

131. Yang, S., et al., A murine model for human sepiapterin-reductase deficiency. Am J Hum
Genet, 2006. 78(4): p. 575-87.

132. Nichol, C.A., et al., Biosynthesis of tetrahydrobiopterin by de novo and salvage pathways
in adrenal medulla extracts, mammalian cell cultures, and rat brain in vivo. Proc Natl Acad
Sci U S A, 1983. 80(6): p. 1546-50.

133. Chalupsky, K. and H. Cai, Endothelial dihydrofolate reductase: critical for nitric oxide
bioavailability and role in angiotensin II uncoupling of endothelial nitric oxide synthase.
Proc Natl Acad Sci U S A, 2005. 102(25): p. 9056-61.

134. Czar, M.J., M.J. Welsh, and W.B. Pratt, Immunofluorescence localization of the 90-kDa
heat-shock protein to cytoskeleton. Eur J Cell Biol, 1996. 70(4): p. 322-30.

135. Wiech, H., et al., Hsp90 chaperones protein folding in vitro. Nature, 1992. 358(6382): p.
169-70.

136. Hutchison, K.A., M.J. Czar, and W.B. Pratt, Evidence that the hormone-binding domain of
the mouse glucocorticoid receptor directly represses DNA binding activity in a major
portion of receptors that are "misfolded" after removal of hsp90. J Biol Chem, 1992.
267(5): p. 3190-5.

137. Oppermann, H., W. Levinson, and J.M. Bishop, A cellular protein that associates with the
transforming protein of Rous sarcoma virus is also a heat-shock protein. Proc Natl Acad
Sci U S A, 1981. 78(2): p. 1067-71.

138. Stancato, L.F., et al., The hsp90-binding antibiotic geldanamycin decreases Raf levels and
epidermal growth factor signaling without disrupting formation of signaling complexes or
reducing the specific enzymatic activity of Raf kinase. J Biol Chem, 1997. 272(7): p. 4013-
20.









139. Stancato, L.F., et al., Raf exists in a native heterocomplex with hsp90 and p50 that can be
reconstituted in a cell-free system. J Biol Chem, 1993. 268(29): p. 21711-6.

140. Venema, V.J., M.B. Marrero, and R.C. Venema, Bradykinin-stimulated protein tyrosine
phosphorylation promotes endothelial nitric oxide synthase translocation to the
cytoskeleton. Biochem Biophys Res Commun, 1996. 226(3): p. 703-10.

141. Garcia-Cardena, G., et al., Dynamic activation of endothelial nitric oxide synthase by
Hsp90. Nature, 1998. 392(6678): p. 821-4.

142. Stebbins, C.E., et al., Crystal structure of an Hsp90-geldanamycin complex: targeting of a
protein chaperone by an antitumor agent. Cell, 1997. 89(2): p. 239-50.

143. Shah, V., et al., Hsp90 regulation of endothelial nitric oxide synthase contributes to
vascular control in portal hypertension. Am J Physiol, 1999. 277(2 Pt 1): p. G463-8.

144. Pritchard, K.A., Jr., et al., Heat Shock Protein 90 Mediates the Balance of Nitric Oxide and
Superoxide Anion from Endothelial Nitric-oxide Synthase. J. Biol. Chem., 2001. 276(21):
p. 17621-17624.

145. Xu, H., et al., A heat shock protein 90 binding domain in endothelial nitric-oxide synthase
influences enzyme function. J Biol Chem, 2007. 282(52): p. 37567-74.

146. Nishida, C.R. and P.R. Ortiz de Montellano, Autoinhibition of endothelial nitric-oxide
synthase. Identification of an electron transfer control element. J Biol Chem, 1999.
274(21): p. 14692-8.

147. Scherer, P.E., et al., Cell-type and tissue-specific expression of caveolin-2. Caveolins 1 and
2 co-localize and form a stable hetero-oligomeric complex in vivo. J Biol Chem, 1997.
272(46): p. 29337-46.

148. Li, S., et al., Mutational analysis of caveolin-induced vesicle formation. Expression of
caveolin-1 recruits caveolin-2 to caveolae membranes. FEBS Lett, 1998. 434(1-2): p. 127-
34.

149. Song, K.S., et al., Expression of caveolin-3 in skeletal, cardiac, and smooth muscle cells.
Caveolin-3 is a component of the sarcolemma and co-fractionates with dystrophin and
dystrophin-associated glycoproteins. J Biol Chem, 1996. 271(25): p. 15160-5.

150. Michel, J.B., et al., Reciprocal regulation of endothelial nitric-oxide synthase by Ca2+-
calmodulin and caveolin. J Biol Chem, 1997. 272(25): p. 15583-6.

151. Garcia-Cardena, G., et al., Dissecting the interaction between nitric oxide synthase (NOS)
and caveolin. Functional significance of the nos caveolin binding domain in vivo. J Biol
Chem, 1997. 272(41): p. 25437-40.

152. Bucci, M., et al., In vivo delivery of the caveolin-1 scaffolding domain inhibits nitric oxide
synthesis and reduces inflammation. Nat Med, 2000. 6(12): p. 1362-7.









153. Drab, M., et al., Loss of caveolae, vascular dysfunction, and pulmonary defects in
caveolin-1 gene-disrupted mice. Science, 2001. 293(5539): p. 2449-52.

154. Razani, B., et al., Caveolin-1 null mice are viable but show evidence of hyperproliferative
and vascular abnormalities. J Biol Chem, 2001. 276(41): p. 38121-38.

155. Feron, 0., et al., Dynamic regulation of endothelial nitric oxide synthase: complementary
roles of dual acylation and caveolin interactions. Biochemistry, 1998. 37(1): p. 193-200.

156. Feron, 0., et al., The endothelial nitric-oxide synthase-caveolin regulatory cycle. J Biol
Chem, 1998. 273(6): p. 3125-8.

157. Michel, J.B., et al., Caveolin versus calmodulin. Counterbalancing allosteric modulators of
endothelial nitric oxide synthase. J Biol Chem, 1997. 272(41): p. 25907-12.

158. Janssens, S.P., et al., Cloning and expression of a cDNA encoding human endothelium-
derived relaxing factor/nitric oxide synthase. J Biol Chem, 1992. 267(21): p. 14519-22.

159. Lamas, S., et al., Endothelial nitric oxide synthase: molecular cloning and characterization
of a distinct constitutive enzyme isoform. Proc Natl Acad Sci U S A, 1992. 89(14): p.
6348-52.

160. Marsden, P.A., et al., Molecular cloning and characterization of human endothelial nitric
oxide synthase. FEBS Lett, 1992. 307(3): p. 287-93.

161. Nishida, K., et al., Molecular cloning and characterization of the constitutive bovine aortic
endothelial cell nitric oxide synthase. J Clin Invest, 1992. 90(5): p. 2092-6.

162. Sessa, W.C., et al., Molecular cloning and expression of a cDNA encoding endothelial cell
nitric oxide synthase. J Biol Chem, 1992. 267(22): p. 15274-6.

163. Gordon, J.I., et al., Protein N-myristoylation. J Biol Chem, 1991. 266(14): p. 8647-50.

164. Busconi, L. and T. Michel, Endothelial nitric oxide synthase. N-terminal myristoylation
determines subcellular localization. J Biol Chem, 1993. 268(12): p. 8410-3.

165. Liu, J. and W.C. Sessa, Identification of covalently bound amino-terminal myristic acid in
endothelial nitric oxide synthase. J Biol Chem, 1994. 269(16): p. 11691-4.

166. Sessa, W.C., C.M. Barber, and K.R. Lynch, Mutation of N-myristoylation site converts
endothelial cell nitric oxide synthase from a membrane to a cytosolic protein. Circ Res,
1993. 72(4): p. 921-4.

167. Liu, J., G. Garcia-Cardena, and W.C. Sessa, Biosynthesis and palmitoylation of endothelial
nitric oxide synthase: mutagenesis of palmitoylation sites, cysteines-15 and/or -26, argues
against depalmitoylation-induced translocation of the enzyme. Biochemistry, 1995. 34(38):
p. 12333-40.









168. Shaul, P.W., et al., Acylation targets emdothelial nitric-oxide synthase to plasmalemmal
caveolae. J Biol Chem, 1996. 271(11): p. 6518-22.

169. Papapetropoulos, A., et al., Nitric oxide production contributes to the angiogenic properties
of vascular endothelial growth factor in human endothelial cells. J Clin Invest, 1997.
100(12): p. 3131-9.

170. Zeng, G. and M.J. Quon, Insulin-stimulated production of nitric oxide is inhibited by
wortmannin. Direct measurement in vascular endothelial cells. J Clin Invest, 1996. 98(4):
p. 894-8.

171. Fulton, D., J.P. Gratton, and W.C. Sessa, Post-translational control of endothelial nitric
oxide synthase: why isn't calcium/calmodulin enough? J Pharmacol Exp Ther, 2001.
299(3): p. 818-24.

172. Dimmeler, S., et al., Activation of nitric oxide synthase in endothelial cells by Akt-
dependent phosphorylation. Nature, 1999. 399(6736): p. 601-5.

173. Fulton, D., et al., Regulation of endothelium-derived nitric oxide production by the protein
kinase Akt. Nature, 1999. 399(6736): p. 597-601.

174. Lane, P. and S.S. Gross, Disabling a C-terminal autoinhibitory control element in
endothelial nitric-oxide synthase by phosphorylation provides a molecular explanation for
activation of vascular NO synthesis by diverse physiological stimuli. J Biol Chem, 2002.
277(21): p. 19087-94.

175. Bauer, P.M., et al., Compensatory Phosphorylation and Protein-Protein Interactions
Revealed by Loss of Function and Gain of Function Mutants of Multiple Serine
Phosphorylation Sites in Endothelial Nitric-oxide Synthase. J. Biol. Chem., 2003. 278(17):
p. 14841-14849.

176. Luo, Z., et al., Acute modulation of endothelial Akt/PKB activity alters nitric oxide-
dependent vasomotor activity in vivo. J Clin Invest, 2000. 106(4): p. 493-9.

177. Kureishi, Y., et al., The HMG-CoA reductase inhibitor simvastatin activates the protein
kinase Akt and promotes angiogenesis in normocholesterolemic animals. Nat Med, 2000.
6(9): p. 1004-10.

178. Chen, Z.P., et al., AMP-activated protein kinase phosphorylation of endothelial NO
synthase. FEBS Lett, 1999. 443(3): p. 285-9.

179. Matsubara, M., et al., Regulation of endothelial nitric oxide synthase by protein kinase C. J
Biochem, 2003. 133(6): p. 773-81.

180. Fleming, I., et al., Phosphorylation of Thr(495) regulates Ca(2+)/calmodulin-dependent
endothelial nitric oxide synthase activity. Circ Res, 2001. 88(11): p. E68-75.









181. Michell, B.J., et al., Coordinated control of endothelial nitric-oxide synthase
phosphorylation by protein kinase C and the cAMP-dependent protein kinase. J Biol
Chem, 2001. 276(21): p. 17625-8.

182. Harris, M.B., et al., Reciprocal phosphorylation and regulation of endothelial nitric-oxide
synthase in response to bradykinin stimulation. J Biol Chem, 2001. 276(19): p. 16587-91.

183. Lin, M.I., et al., Phosphorylation of threonine 497 in endothelial nitric-oxide synthase
coordinates the coupling of L-arginine metabolism to efficient nitric oxide production. J
Biol Chem, 2003. 278(45): p. 44719-26.

184. Thomas, S.R., K. Chen, and J.F. Keaney, Jr., Hydrogen peroxide activates endothelial
nitric-oxide synthase through coordinated phosphorylation and dephosphorylation via a
phosphoinositide 3-kinase-dependent signaling pathway. J Biol Chem, 2002. 277(8): p.
6017-24.

185. Boo, Y.C., et al., Shear stress stimulates phosphorylation of eNOS at Ser(635) by a protein
kinase A-dependent mechanism. Am J Physiol Heart Circ Physiol, 2002. 283(5): p.
H1819-28.

186. Boo, Y.C., et al., Endothelial NO synthase phosphorylated at SER635 produces NO
without requiring intracellular calcium increase. Free Radic Biol Med, 2003. 35(7): p. 729-
41.

187. Kou, R., D. Greif, and T. Michel, Dephosphorylation of endothelial nitric-oxide synthase
by vascular endothelial growth factor. Implications for the vascular responses to
cyclosporin A. J Biol Chem, 2002. 277(33): p. 29669-73.

188. Gallis, B., et al., Identification of flow-dependent endothelial nitric-oxide synthase
phosphorylation sites by mass spectrometry and regulation of phosphorylation and nitric
oxide production by the phosphatidylinositol 3-kinase inhibitor LY294002. J Biol Chem,
1999. 274(42): p. 30101-8.

189. Drew, B.G., et al., High-density lipoprotein and apolipoprotein Al increase endothelial NO
synthase activity by protein association and multisite phosphorylation. Proc Natl Acad Sci
US A, 2004. 101(18): p. 6999-7004.

190. Babior, B.M., NADPH oxidase. Curr Opin Immunol, 2004. 16(1): p. 42-7.

191. Ago, T., et al., Nox4 as the major catalytic component of an endothelial NAD(P)H
oxidase. Circulation, 2004. 109(2): p. 227-33.

192. Martyn, K.D., et al., Functional analysis of Nox4 reveals unique characteristics compared
to other NADPH oxidases. Cell Signal, 2006. 18(1): p. 69-82.

193. Dworakowski, R., S.P. Alom-Ruiz, and A.M. Shah, NADPH oxidase-derived reactive
oxygen species in the regulation of endothelial phenotype. Pharmacol Rep, 2008. 60(1): p.
21-8.









194. Frey, R.S., et al., PKCzeta regulates TNF-alpha-induced activation of NADPH oxidase in
endothelial cells. Circ Res, 2002. 90(9): p. 1012-9.

195. Li, J.M. and A.M. Shah, Mechanism of endothelial cell NADPH oxidase activation by
angiotensin II. Role of the p47phox subunit. J Biol Chem, 2003. 278(14): p. 12094-100.

196. Sorescu, D., et al., Superoxide production and expression of nox family proteins in human
atherosclerosis. Circulation, 2002. 105(12): p. 1429-35.

197. Ohishi, M., et al., Enhanced expression of angiotensin-converting enzyme is associated
with progression of coronary atherosclerosis in humans. J Hypertens, 1997. 15(11): p.
1295-302.

198. Diet, F., et al., Increased accumulation of tissue ACE in human atherosclerotic coronary
artery disease. Circulation, 1996. 94(11): p. 2756-67.

199. Nickenig, G., et al., Statin-sensitive dysregulated ATI receptor function and density in
hypercholesterolemic men. Circulation, 1999. 100(21): p. 2131-4.

200. Bevilacqua, M.P., Endothelial-leukocyte adhesion molecules. Annu Rev Immunol, 1993.
11: p. 767-804.

201. Kuzkaya, N., et al., Interactions of peroxynitrite, tetrahydrobiopterin, ascorbic acid, and
thiols: implications for uncoupling endothelial nitric-oxide synthase. J Biol Chem, 2003.
278(25): p. 22546-54.

202. Landmesser, U., et al., Oxidation of tetrahydrobiopterin leads to uncoupling of endothelial
cell nitric oxide synthase in hypertension. J Clin Invest, 2003. 111(8): p. 1201-9.

203. Meininger, C.J., et al., Impaired nitric oxide production in coronary endothelial cells of the
spontaneously diabetic BB rat is due to tetrahydrobiopterin deficiency. Biochem J, 2000.
349(Pt 1): p. 353-6.

204. Cai, S., et al., Endothelial nitric oxide synthase dysfunction in diabetic mice: importance of
tetrahydrobiopterin in eNOS dimerisation. Diabetologia, 2005. 48(9): p. 1933-40.

205. Heitzer, T., et al., Tetrahydrobiopterin improves endothelium-dependent vasodilation by
increasing nitric oxide activity in patients with Type II diabetes mellitus. Diabetologia,
2000. 43(11): p. 1435-8.

206. Takaya, T., et al., A specific role for eNOS-derived reactive oxygen species in
atherosclerosis progression. Arterioscler Thromb Vasc Biol, 2007. 27(7): p. 1632-7.

207. Ozaki, M., et al., Overexpression of endothelial nitric oxide synthase accelerates
atherosclerotic lesion formation in apoE-deficient mice. J Clin Invest, 2002. 110(3): p.
331-40.









208. Crabtree, M.J., et al., Ratio of 5,6,7,8-tetrahydrobiopterin to 7,8-dihydrobiopterin in
endothelial cells determines glucose-elicited changes in NO vs. superoxide production by
eNOS. Am J Physiol Heart Circ Physiol, 2008. 294(4): p. H1530-40.

209. Miranda, T.B., et al., Yeast Hsl7 (histone synthetic lethal 7) catalyses the in vitro
formation of omega-N(G)-monomethylarginine in calf thymus histone H2A. Biochem J,
2006. 395(3): p. 563-70.

210. Gary, J.D. and S. Clarke, RNA and protein interactions modulated by protein arginine
methylation. Prog Nucleic Acid Res Mol Biol, 1998. 61: p. 65-131.

211. Rawal, N., et al., Structural specificity of substrate for S-adenosylmethionine:protein
arginine N-methyltransferases. Biochim Biophys Acta, 1995. 1248(1): p. 11-8.

212. Gary, J.D., et al., The predominant protein-arginine methyltransferase from
Saccharomyces cerevisiae. J Biol Chem, 1996. 271(21): p. 12585-94.

213. Chen, S.L., et al., The coactivator-associated arginine methyltransferase is necessary for
muscle differentiation: CARM1 coactivates myocyte enhancer factor-2. J Biol Chem,
2002. 277(6): p. 4324-33.

214. Tang, J., et al., PRMT 3, a type I protein arginine N-methyltransferase that differs from
PRMT1 in its oligomerization, subcellular localization, substrate specificity, and
regulation. J Biol Chem, 1998. 273(27): p. 16935-45.

215. Pawlak, M.R., et al., Arginine N-methyltransferase 1 is required for early postimplantation
mouse development, but cells deficient in the enzyme are viable. Mol Cell Biol, 2000.
20(13): p. 4859-69.

216. Chang, B., et al., JMJD6 is a histone arginine demethylase. Science, 2007. 318(5849): p.
444-7.

217. Boger, R.H., et al., LDL Cholesterol Upregulates Synthesis of Asymmetrical
Dimethylarginine in Human Endothelial Cells : Involvement of S-Adenosylmethionine-
Dependent Methyltransferases. Circ Res, 2000. 87(2): p. 99-105.

218. Osanai, T., et al., Effect of Shear Stress on Asymmetric Dimethylarginine Release From
Vascular Endothelial Cells. Hypertension, 2003. 42(5): p. 985-990.

219. MacAllister, R.J., et al., Concentration of dimethyl-L-arginine in the plasma of patients
with end-stage renal failure. Nephrol Dial Transplant, 1996. 11(12): p. 2449-52.

220. MacAllister, R.J., et al., Metabolism of methylarginines by human vasculature;
implications for the regulation of nitric oxide synthesis. Br J Pharmacol, 1994. 112(1): p.
43-8.

221. Xiao, S., et al., Circulating endothelial nitric oxide synthase inhibitory factor in some
patients with chronic renal disease. Kidney Int, 2001. 59(4): p. 1466-72.









222. Vallance, P., et al., Accumulation of an endogenous inhibitor of nitric oxide synthesis in
chronic renal failure. Lancet, 1992. 339(8793): p. 572-5.

223. Kakimoto, Y. and S. Akazawa, Isolation and identification ofN-G,N-G- and N-G,N'-G-
dimethyl-arginine, N-epsilon-mono-, di-, and trimethyllysine, and glucosylgalactosyl- and
galactosyl-delta-hydroxylysine from human urine. J Biol Chem, 1970. 245(21): p. 5751-8.

224. McDermott, J.R., Studies on the catabolism of Ng-methylarginine, Ng, Ng-
dimethylarginine and Ng, Ng-dimethylarginine in the rabbit. Biochem J, 1976. 154(1): p.
179-84.

225. Ogawa, T., et al., Metabolism of NG,NG-and NG,N'G-dimethylarginine in rats. Arch
Biochem Biophys, 1987. 252(2): p. 526-37.

226. Ogawa, T., M. Kimoto, and K. Sasaoka, Purification and properties of a new enzyme,
NG,NG-dimethylarginine dimethylaminohydrolase, from rat kidney. J Biol Chem, 1989.
264(17): p. 10205-9.

227. Tran, C.T., J.M. Leiper, and P. Vallance, The DDAH/ADMA/NOS pathway. Atheroscler
Suppl, 2003. 4(4): p. 33-40.

228. Forbes, S.P., et al., Mechanism of 4-HNE mediated inhibition of hDDAH-1: implications
in no regulation. Biochemistry, 2008. 47(6): p. 1819-26.

229. Okubo, K., et al., Role of asymmetrical dimethylarginine in renal microvascular
endothelial dysfunction in chronic renal failure with hypertension. Hypertens Res, 2005.
28(2): p. 181-9.

230. Braun, 0., et al., Specific reactions of S-nitrosothiols with cysteine hydrolases: A
comparative study between dimethylargininase-1 and CTP synthetase. Protein Sci, 2007.
16(8): p. 1522-34.

231. Birdsey, G.M., J.M. Leiper, and P. Vallance, Intracellular localization of dimethylarginine
dimethylaminohydrolase overexpressed in an endothelial cell line. Acta Physiol Scand,
2000. 168(1): p. 73-9.

232. Murray-Rust, J., et al., Structural insights into the hydrolysis of cellular nitric oxide
synthase inhibitors by dimethylarginine dimethylaminohydrolase. Nat Struct Biol, 2001.
8(8): p. 679-83.

233. Nijveldt, R.J., et al., The liver is an important organ in the metabolism of asymmetrical
dimethylarginine (ADMA). Clin Nutr, 2003. 22(1): p. 17-22.

234. Nijveldt, R.J., et al., Elimination of asymmetric dimethylarginine by the kidney and the
liver: a link to the development of multiple organ failure? J Nutr, 2004. 134(10 Suppl): p.
2848S-2852S; discussion 2853S.









235. Tran, C.T., et al., Chromosomal localization, gene structure, and expression pattern of
DDAH1: comparison with DDAH2 and implications for evolutionary origins. Genomics,
2000. 68(1): p. 101-5.

236. Kimoto, M., et al., Detection of NG,NG-dimethylarginine dimethylaminohydrolase in the
nitric oxide-generating systems of rats using monoclonal antibody. Arch Biochem
Biophys, 1993. 300(2): p. 657-62.

237. Wang, D., et al., Isoform-specific regulation by N(G),N(G)-dimethylarginine
dimethylaminohydrolase of rat serum asymmetric dimethylarginine and vascular
endothelium-derived relaxing factor/NO. Circ Res, 2007. 101(6): p. 627-35.

238. MacAllister, R.J., et al., Regulation of nitric oxide synthesis by dimethylarginine
dimethylaminohydrolase. Br J Pharmacol, 1996. 119(8): p. 1533-40.

239. Dayoub, H., et al., Dimethylarginine dimethylaminohydrolase regulates nitric oxide
synthesis: genetic and physiological evidence. Circulation, 2003. 108(24): p. 3042-7. Epub
2003 Nov 24.

240. Leiper, J., et al., Disruption of methylarginine metabolism impairs vascular homeostasis.
Nat Med, 2007. 13(2): p. 198-203.

241. Jacobi, J., et al., Overexpression of dimethylarginine dimethylaminohydrolase reduces
tissue asymmetric dimethylarginine levels and enhances angiogenesis. Circulation, 2005.
111(11): p. 1431-8.

242. Tanaka, M., et al., Dimethylarginine dimethylaminohydrolase overexpression suppresses
graft coronary artery disease. Circulation, 2005. 112(11): p. 1549-56.

243. Cardounel, A.J., W.A. Wallace, and C.K. Sen, Proximal middle cerebral artery occlusion
surgery for the study of ischemia-reoxygenation injury in the brain. Methods Enzymol,
2004. 381: p. 416-22.

244. Hasegawa, K., et al., Role of Asymmetric Dimethylarginine in Vascular Injury in
Transgenic Mice Overexpressing Dimethylarginie Dimethylaminohydrolase 2. Circ Res,
2007. 101(2): p. e2-10.

245. Smith, C.L., et al., Dimethylarginine dimethylaminohydrolase activity modulates ADMA
levels, VEGF expression, and cell phenotype. Biochem Biophys Res Commun, 2003.
308(4): p. 984-9.

246. Hasegawa, K., et al., Dimethylarginine dimethylaminohydrolase 2 increases vascular
endothelial growth factor expression through Spl transcription factor in endothelial cells.
Arterioscler Thromb Vasc Biol, 2006. 26(7): p. 1488-94.

247. Tokuo, H., et al., Phosphorylation of neurofibromin by cAMP-dependent protein kinase is
regulated via a cellular association of N(G),N(G)-dimethylarginine
dimethylaminohydrolase. FEBS Lett, 2001. 494(1-2): p. 48-53.









248. Knipp, M., et al., Zn(II)-free dimethylargininase-1 (DDAH-1) is inhibited upon specific
Cys-S-nitrosylation. J Biol Chem, 2003. 278(5): p. 3410-6.

249. Hong, L. and W. Fast, Inhibition of human dimethylarginine dimethylaminohydrolase-1 by
S-nitroso-L-homocysteine and hydrogen peroxide. Analysis, quantification, and
implications for hyperhomocysteinemia. J Biol Chem, 2007. 282(48): p. 34684-92.

250. Scalera, F., et al., Effect of telmisartan on nitric oxide--asymmetrical dimethylarginine
system: role of angiotensin II type 1 receptor gamma and peroxisome proliferator activated
receptor gamma signaling during endothelial aging. Hypertension, 2008. 51(3): p. 696-703.

251. Yin, Q.F. and Y. Xiong, Pravastatin restores DDAH activity and endothelium-dependent
relaxation of rat aorta after exposure to glycated protein. J Cardiovasc Pharmacol, 2005.
45(6): p. 525-32.

252. Achan, V., et al., all-trans-Retinoic acid increases nitric oxide synthesis by endothelial
cells: a role for the induction of dimethylarginine dimethylaminohydrolase. Circ Res,
2002. 90(7): p. 764-9.

253. Jones, L.C., et al., Common genetic variation in a basal promoter element alters DDAH2
expression in endothelial cells. Biochem Biophys Res Commun, 2003. 310(3): p. 836-43.

254. Valkonen, V.P., T.P. Tuomainen, and R. Laaksonen, DDAH gene and cardiovascular risk.
Vasc Med, 2005. 10 Suppl 1: p. S45-8.

255. Boger, R.H., et al., Asymmetric dimethylarginine (ADMA): a novel risk factor for
endothelial dysfunction: its role in hypercholesterolemia. Circulation, 1998. 98(18): p.
1842-7.

256. Zoccali, C., et al., Plasma concentration of asymmetrical dimethylarginine and mortality in
patients with end-stage renal disease: a prospective study. Lancet, 2001. 358(9299): p.
2113-7.

257. Lu, T.M., et al., Plasma levels of asymmetrical dimethylarginine and adverse
cardiovascular events after percutaneous coronary intervention. Eur Heart J, 2003. 24(21):
p. 1912-9.

258. McLaughlin, T., et al., Plasma asymmetric dimethylarginine concentrations are elevated in
obese insulin-resistant women and fall with weight loss. J Clin Endocrinol Metab, 2006.
91(5): p. 1896-900.

259. Chan, J.R., et al., Asymmetric Dimethylarginine Increases Mononuclear Cell Adhesiveness
in Hypercholesterolemic Humans. Arterioscler Thromb Vasc Biol, 2000. 20(4): p. 1040-
1046.

260. Azuma, H., et al., Accumulation of endogenous inhibitors for nitric oxide synthesis and
decreased content of L-arginine in regenerated endothelial cells. Br J Pharmacol, 1995.
115(6): p. 1001-4.









261. Ito, A., et al., Novel mechanism for endothelial dysfunction: dysregulation of
dimethylarginine dimethylaminohydrolase. Circulation, 1999. 99(24): p. 3092-5.

262. Shahgasempour, S., S.B. Woodroffe, and H.M. Garnett, Alterations in the expression of
ELAM-1, ICAM-1 and VCAM-1 after in vitro infection of endothelial cells with a clinical
isolate of human cytomegalovirus. Microbiol Immunol, 1997. 41(2): p. 121-9.

263. Weis, M., et al., Cytomegalovirus infection impairs the nitric oxide synthase pathway: role
of asymmetric dimethylarginine in transplant arteriosclerosis. Circulation, 2004. 109(4): p.
500-5.

264. Tain, Y.L. and C. Baylis, Determination of dimethylarginine dimethylaminohydrolase
activity in the kidney. Kidney Int, 2007. 72(7): p. 886-9.

265. Lin, K.Y., et al., Impaired nitric oxide synthase pathway in diabetes mellitus: role of
asymmetric dimethylarginine and dimethylarginine dimethylaminohydrolase. Circulation,
2002. 106(8): p. 987-92.

266. Sorrenti, V., et al., High glucose-mediated imbalance of nitric oxide synthase and
dimethylarginine dimethylaminohydrolase expression in endothelial cells. Curr Neurovasc
Res, 2006. 3(1): p. 49-54.

267. Achan, V., et al., Asymmetric dimethylarginine causes hypertension and cardiac
dysfunction in humans and is actively metabolized by dimethylarginine
dimethylaminohydrolase. Arterioscler Thromb Vasc Biol, 2003. 23(8): p. 1455-9.

268. Boger, G.I., et al., Asymmetric dimethylarginine determines the improvement of
endothelium-dependent vasodilation by simvastatin: Effect of combination with oral L-
arginine. J Am Coll Cardiol, 2007. 49(23): p. 2274-82.

269. Maas, R., et al., Asymmetric dimethylarginine, smoking, and risk of coronary heart disease
in apparently healthy men: prospective analysis from the population-based Monitoring of
Trends and Determinants in Cardiovascular Disease/Kooperative Gesundheitsforschung in
der Region Augsburg study and experimental data. Clin Chem, 2007. 53(4): p. 693-701.

270. Maas, R., et al., Asymmetrical dimethylarginine (ADMA) and coronary endothelial
function in patients with coronary artery disease and mild hypercholesterolemia.
Atherosclerosis, 2007. 191(1): p. 211-9.

271. Maas, R., et al., Elevated plasma concentrations of the endogenous nitric oxide synthase
inhibitor asymmetric dimethylarginine predict adverse events in patients undergoing
noncardiac surgery. Crit Care Med, 2007. 35(8): p. 1876-81.

272. Boger, R.H., et al., Plasma concentration of asymmetric dimethylarginine, an endogenous
inhibitor of nitric oxide synthase, is elevated in monkeys with hyperhomocyst(e)inemia or
hypercholesterolemia. Arterioscler Thromb Vasc Biol, 2000. 20(6): p. 1557-64.









273. Schulze, F., et al., Asymmetric dimethylarginine is an independent risk factor for coronary
heart disease: results from the multicenter Coronary Artery Risk Determination
investigating the Influence of ADMA Concentration (CARDIAC) study. Am Heart J,
2006. 152(3): p. 493 el-8.

274. Pope, A.J., et al., Role of DDAH-1 in lipid peroxidation product-mediated inhibition of
endothelial NO generation. Am J Physiol Cell Physiol, 2007. 293(5): p. C1679-86.

275. Ito, A., et al., Novel mechanism for endothelial dysfunction: dysregulation of
dimethylarginine dimethylaminohydrolase. Circulation, 1999. 99(24): p. 3092-5.

276. Zakrzewicz, D. and 0. Eickelberg, From arginine methylation to ADMA: a novel
mechanism with therapeutic potential in chronic lung diseases. BMC Pulm Med, 2009. 9:
p. 5.

277. Zoccali, C., et al., Asymmetric dimethyl-arginine (ADMA) response to inflammation in
acute infections. Nephrol Dial Transplant, 2007. 22(3): p. 801-6.

278. Vallance, P. and J. Leiper, Asymmetric dimethylarginine and kidney disease--marker or
mediator? J Am Soc Nephrol, 2005. 16(8): p. 2254-6.

279. Stuhlinger, M.C., et al., Asymmetric dimethyl L-arginine (ADMA) is a critical regulator of
myocardial reperfusion injury. Cardiovasc Res, 2007. 75(2): p. 417-25.

280. Simon, A., et al., Role of neutral amino acid transport and protein breakdown for substrate
supply of nitric oxide synthase in human endothelial cells. Circ Res, 2003. 93(9): p. 813-
20.

281. Gray, G.A., et al., Immunolocalisation and activity of DDAH I and II in the heart and
modification post-myocardial infarction. Acta Histochem, 2009.

282. Leiper, J.M., et al., Identification of two human dimethylarginine
dimethylaminohydrolases with distinct tissue distributions and homology with microbial
arginine deiminases. Biochem J, 1999. 343 Pt 1: p. 209-14.

283. Guerra, R., Jr., et al., Mechanisms of abnormal endothelium-dependent vascular relaxation
in atherosclerosis: implications for altered autocrine and paracrine functions of EDRF.
Blood Vessels, 1989. 26(5): p. 300-14.

284. Palmer, R.M., A.G. Ferrige, and S. Moncada, Nitric oxide release accounts for the
biological activity of endothelium-derived relaxing factor. Nature, 1987. 327(6122): p.
524-6.

285. Radomski, M.W. and S. Moncada, Regulation of vascular homeostasis by nitric oxide.
Thromb Haemost, 1993. 70(1): p. 36-41.

286. Cohen, R.A., The role of nitric oxide and other endothelium-derived vasoactive substances
in vascular disease. Prog Cardiovasc Dis, 1995. 38(2): p. 105-28.









287. Keaney, J.F., Jr., et al., Dietary probucol preserves endothelial function in cholesterol-fed
rabbits by limiting vascular oxidative stress and superoxide generation. J Clin Invest, 1995.
95(6): p. 2520-9.

288. Yla-Herttuala, S., et al., Evidence for the presence of oxidatively modified low density
lipoprotein in atherosclerotic lesions of rabbit and man. J Clin Invest, 1989. 84(4): p. 1086-
95.

289. Jurgens, G., et al., Immunostaining of human autopsy aortas with antibodies to modified
apolipoprotein B and apoprotein(a). Arterioscler Thromb, 1993. 13(11): p. 1689-99.

290. Usatyuk, P.V., N.L. Parinandi, and V. Nataraj an, Redox regulation of 4-hydroxy-2-
nonenal-mediated endothelial barrier dysfunction by focal adhesion, adherens, and tight
junction proteins. J Biol Chem, 2006. 281(46): p. 35554-66.

291. Chisolm, G.M. and D. Steinberg, The oxidative modification hypothesis of atherogenesis:
an overview. Free Radic Biol Med, 2000. 28(12): p. 1815-26.

292. Quinn, M.T., et al., Oxidatively modified low density lipoproteins: a potential role in
recruitment and retention of monocyte/macrophages during atherogenesis. Proc Natl Acad
Sci U S A, 1987. 84(9): p. 2995-8.

293. Sawamura, T., et al., An endothelial receptor for oxidized low-density lipoprotein. Nature,
1997. 386(6620): p. 73-7.

294. Simon, B.C., L.D. Cunningham, and R.A. Cohen, Oxidized low density lipoproteins cause
contraction and inhibit endothelium-dependent relaxation in the pig coronary artery. J Clin
Invest, 1990. 86(1): p. 75-9.

295. Meinitzer, A., et al., Asymmetrical dimethylarginine independently predicts total and
cardiovascular mortality in individuals with angiographic coronary artery disease (the
Ludwigshafen Risk and Cardiovascular Health study). Clin Chem, 2007. 53(2): p. 273-83.

296. Smith, C.L., et al., Effects of ADMA upon gene expression: an insight into the
pathophysiological significance of raised plasma ADMA. PLoS Med, 2005. 2(10): p. e264.

297. Tsao, P.S. and J.P. Cooke, Endothelial alterations in hypercholesterolemia: more than
simply vasodilator dysfunction. J Cardiovasc Pharmacol, 1998. 32 Suppl 3: p. S48-53.

298. Boger, R.H., P. Vallance, and J.P. Cooke, Asymmetric dimethylarginine (ADMA): a key
regulator of nitric oxide synthase. Atheroscler Suppl, 2003. 4(4): p. 1-3.

299. Cooke, J.P., Does ADMA cause endothelial dysfunction? Arterioscler Thromb Vasc Biol,
2000. 20(9): p. 2032-7.

300. Kimoto, M., et al., Purification, cDNA cloning and expression of human NG,NG-
dimethylarginine dimethylaminohydrolase. Eur J Biochem, 1998. 258(2): p. 863-8.









301. Chen, Y., et al., Dimethylarginine dimethylaminohydrolase and endothelial dysfunction in
failing hearts. Am J Physiol Heart Circ Physiol, 2005. 289(5): p. H2212-9.

302. Leiper, J.M., The DDAH-ADMA-NOS pathway. Ther Drug Monit, 2005. 27(6): p. 744-6.

303. Boger, R.H., J.P. Cooke, and P. Vallance, ADMA: an emerging cardiovascular risk factor.
Vasc Med, 2005. 10 Suppl 1: p. S1-2.

304. Vallance, P. and J. Leiper, Cardiovascular biology of the asymmetric
dimethylarginine:dimethylarginine dimethylaminohydrolase pathway. Arterioscler Thromb
Vasc Biol, 2004. 24(6): p. 1023-30.

305. Wojciak-Stothard, B., et al., The ADMA/DDAH pathway is a critical regulator of
endothelial cell motility. J Cell Sci, 2007. 120(Pt 6): p. 929-42.

306. Cardounel, A.J. and J.L. Zweier, Endogenous methylarginines regulate neuronal nitric-
oxide synthase and prevent excitotoxic injury. J Biol Chem, 2002. 277(37): p. 33995-4002.
Epub 2002 Jun 28.

307. Esterbauer, H., R.J. Schaur, and H. Zollner, Chemistry and biochemistry of 4-
hydroxynonenal, malonaldehyde and related aldehydes. Free Radic Biol Med, 1991. 11(1):
p. 81-128.

308. Lieners, C., et al., Lipidperoxidation in a canine model of hypovolemic-traumatic shock.
Prog Clin Biol Res, 1989. 308: p. 345-50.

309. Siakotos, A.N., et al., 4-Hydroxynonenal: a specific indicator for canine neuronal-retinal
ceroidosis. Am J Med Genet Suppl, 1988. 5: p. 171-81.

310. Xia, Y., et al., Superoxide generation from endothelial nitric-oxide synthase. A
Ca2+/calmodulin-dependent and tetrahydrobiopterin regulatory process. J Biol Chem,
1998. 273(40): p. 25804-8.

311. Landmesser, U., et al., Oxidation of tetrahydrobiopterin leads to uncoupling of endothelial
cell nitric oxide synthase in hypertension. J Clin Invest, 2003. 111(8): p. 1201-9.

312. Cardounel, A.J., Y. Xia, and J.L. Zweier, Endogenous methylarginines modulate
superoxide as well as nitric oxide generation from neuronal nitric-oxide synthase:
differences in the effects of monomethyl- and dimethylarginines in the presence and
absence of tetrahydrobiopterin. J Biol Chem, 2005. 280(9): p. 7540-9.

313. Konishi, H., K. Sydow, and J.P. Cooke, Dimethylarginine dimethylaminohydrolase
promotes endothelial repair after vascular injury. J Am Coll Cardiol, 2007. 49(10): p.
1099-105.

314. Frey, D., et al., Structure of the mammalian NOS regulator dimethylarginine
dimethylaminohydrolase: A basis for the design of specific inhibitors. Structure, 2006.
14(5): p. 901-11.









315. Stone, E.M., et al., Substrate-assisted cysteine deprotonation in the mechanism of
dimethylargininase (DDAH) from Pseudomonas aeruginosa. Biochemistry, 2006. 45(17):
p. 5618-30.

316. Uchida, K., 4-Hydroxy-2-nonenal: a product and mediator of oxidative stress. Prog Lipid
Res, 2003. 42(4): p. 318-43.

317. Cooke, J.P., Does ADMA cause endothelial dysfunction? Arterioscler Thromb Vasc Biol,
2000. 20(9): p. 2032-7.

318. Arnold, W.P., et al., Nitric oxide activates guanylate cyclase and increases guanosine 3':5'-
cyclic monophosphate levels in various tissue preparations. Proc Natl Acad Sci U S A,
1977. 74(8): p. 3203-7.

319. Gruetter, D.Y., et al., Activation of coronary arterial guanylate cyclase by nitric oxide,
nitroprusside, and nitrosoguanidine--inhibition by calcium, lanthanum, and other cations,
enhancement by thiols. Biochem Pharmacol, 1980. 29(21): p. 2943-50.

320. Martin, W., et al., Selective blockade of endothelium-dependent and glyceryl trinitrate-
induced relaxation by hemoglobin and by methylene blue in the rabbit aorta. J Pharmacol
Exp Ther, 1985. 232(3): p. 708-16.

321. Hecker, M., D.T. Walsh, and J.R. Vane, On the substrate specificity of nitric oxide
synthase. FEBS Lett, 1991. 294(3): p. 221-4.

322. Sarkar, R., et al., Cell cycle effects of nitric oxide on vascular smooth muscle cells. Am J
Physiol, 1997. 272(4 Pt 2): p. H1810-8.

323. Pou, S., et al., Generation of superoxide by purified brain nitric oxide synthase. J Biol
Chem, 1992. 267(34): p. 24173-6.

324. Pou, S., et al., Mechanism of superoxide generation by neuronal nitric-oxide synthase. J
Biol Chem, 1999. 274(14): p. 9573-80.

325. Rosen, G.M., et al., The role of tetrahydrobiopterin in the regulation of neuronal nitric-
oxide synthase-generated superoxide. J Biol Chem, 2002. 277(43): p. 40275-80. Epub
2002 Aug 14.

326. Vasquez-Vivar, J., et al., Superoxide generation by endothelial nitric oxide synthase: the
influence of cofactors. Proc Natl Acad Sci US A, 1998. 95(16): p. 9220-5.

327. Vasquez-Vivar, J., et al., Tetrahydrobiopterin-dependent inhibition of superoxide
generation from neuronal nitric oxide synthase. J Biol Chem, 1999. 274(38): p. 26736-42.

328. Xia, Y., et al., Nitric oxide synthase generates superoxide and nitric oxide in arginine-
depleted cells leading to peroxynitrite-mediated cellular injury. Proc Natl Acad Sci U S A,
1996. 93(13): p. 6770-4.









329. Xia, Y. and J.L. Zweier, Superoxide and peroxynitrite generation from inducible nitric
oxide synthase in macrophages. Proc Natl Acad Sci U S A, 1997. 94(13): p. 6954-8.

330. Nishida, C.R. and P.R. Ortiz de Montellano, Electron transfer and catalytic activity of
nitric oxide synthases. Chimeric constructs of the neuronal, inducible, and endothelial
isoforms. J Biol Chem, 1998. 273(10): p. 5566-71.

331. Witte, M.B. and A. Barbul, Arginine physiology and its implication for wound healing.
Wound Repair Regen, 2003. 11(6): p. 419-23.

332. Witte, M.B., et al., L-Arginine supplementation enhances diabetic wound healing:
involvement of the nitric oxide synthase and arginase pathways. Metabolism, 2002.
51(10): p. 1269-73.

333. Reckelhoff, J.F., et al., Changes in nitric oxide precursor, L-arginine, and metabolites,
nitrate and nitrite, with aging. Life Sci, 1994. 55(24): p. 1895-902.

334. Hasegawa, T., et al., Impairment of L-arginine metabolism in spontaneously hypertensive
rats. Biochem Int, 1992. 26(4): p. 653-8.

335. Albina, J.E., et al., Temporal expression of different pathways of 1-arginine metabolism in
healing wounds. J Immunol, 1990. 144(10): p. 3877-80.

336. Hecker, M., et al., The metabolism of L-arginine and its significance for the biosynthesis
of endothelium-derived relaxing factor: cultured endothelial cells recycle L-citrulline to L-
arginine. Proc Natl Acad Sci U S A, 1990. 87(21): p. 8612-6.

337. Rodriguez-Crespo, I. and P.R. Ortiz de Montellano, Human endothelial nitric oxide
synthase: expression in Escherichia coli, coexpression with calmodulin, and
characterization. Arch Biochem Biophys, 1996. 336(1): p. 151-6.

338. Xia, Y., et al., Electron paramagnetic resonance spectroscopy with N-methyl-D-glucamine
dithiocarbamate iron complexes distinguishes nitric oxide and nitroxyl anion in a redox-
dependent manner: applications in identifying nitrogen monoxide products from nitric
oxide synthase. Free Radic Biol Med, 2000. 29(8): p. 793-7.

339. Souza, H.P., et al., Quantitation of superoxide generation and substrate utilization by
vascular NAD(P)H oxidase. Am J Physiol Heart Circ Physiol, 2002. 282(2): p. H466-74.

340. Roubaud, V., et al., Quantitative measurement of superoxide generation and oxygen
consumption from leukocytes using electron paramagnetic resonance spectroscopy. Anal
Biochem, 1998. 257(2): p. 210-7.

341. Chen, P.F., et al., Effects of Asp-369 and Arg-372 mutations on heme environment and
function in human endothelial nitric-oxide synthase. J Biol Chem, 1998. 273(51): p.
34164-70.









342. Salerno, J.C., et al., Characterization by electron paramagnetic resonance of the
interactions of L-arginine and L-thiocitrulline with the heme cofactor region of nitric oxide
synthase. J Biol Chem, 1995. 270(46): p. 27423-8.

343. Du, M., et al., Redox properties of human endothelial nitric-oxide synthase oxygenase and
reductase domains purified from yeast expression system. J Biol Chem, 2003. 278(8): p.
6002-11.

344. Salerno, J.C., et al., Substrate and substrate analog binding to endothelial nitric oxide
synthase: electron paramagnetic resonance as an isoform-specific probe of the binding
mode of substrate analogs. Biochemistry, 1997. 36(39): p. 11821-7.

345. Tiefenbacher, C.P., et al., Restoration of endothelium-dependent vasodilation after
reperfusion injury by tetrahydrobiopterin. Circulation, 1996. 94(6): p. 1423-9.

346. Tiefenbacher, C.P., et al., Endothelial dysfunction of coronary resistance arteries is
improved by tetrahydrobiopterin in atherosclerosis. Circulation, 2000. 102(18): p. 2172-9.

347. Tiefenbacher, C.P., et al., Sepiapterin reduces postischemic injury in the rat heart. Pflugers
Arch, 2003. 447(1): p. 1-7. Epub 2003 Aug 5.

348. Setoguchi, S., et al., Tetrahydrobiopterin improves endothelial dysfunction in coronary
microcirculation in patients without epicardial coronary artery disease. J Am Coll Cardiol,
2001. 38(2): p. 493-8.

349. Maier, W., et al., Tetrahydrobiopterin improves endothelial function in patients with
coronary artery disease. J Cardiovasc Pharmacol, 2000. 35(2): p. 173-8.

350. Gao, Y.T., et al., Oxygen metabolism by neuronal nitric-oxide synthase. J Biol Chem,
2007. 282(11): p. 7921-9.

351. Gao, Y.T., et al., Oxygen metabolism by endothelial nitric-oxide synthase. J Biol Chem,
2007. 282(39): p. 28557-65.

352. Abu-Soud, H.M., et al., Electron transfer, oxygen binding, and nitric oxide feedback
inhibition in endothelial nitric-oxide synthase. J Biol Chem, 2000. 275(23): p. 17349-57.

353. Berka, V., et al., Redox function of tetrahydrobiopterin and effect of L-arginine on oxygen
binding in endothelial nitric oxide synthase. Biochemistry, 2004. 43(41): p. 13137-48.

354. Gao, Y.T., et al., Thermodynamics of oxidation-reduction reactions in mammalian nitric-
oxide synthase isoforms. J Biol Chem, 2004. 279(18): p. 18759-66.

355. Sligar, S.G., Coupling of spin, substrate, and redox equilibria in cytochrome P450.
Biochemistry, 1976. 15(24): p. 5399-406.

356. Sligar, S.G., et al., Spin state control of the hepatic cytochrome P450 redox potential.
Biochem Biophys Res Commun, 1979. 90(3): p. 925-32.









357. Presta A, W.-M.A., Stankovich M, Stuehr D, Comparative Effects of Substrates and Pterin
Cofactor on the Heme Midpoint Potential in Inducible and Neuronal Nitric Oxide
Synthases. J. Am. Chem. Soc., 1997. 120 (37): p. 9460 -9465.

358. Sennequier, N. and D.J. Stuehr, Analysis of substrate-induced electronic, catalytic, and
structural changes in inducible NO synthase. Biochemistry, 1996. 35(18): p. 5883-92.

359. Rosen, G.M., et al., The role of tetrahydrobiopterin in the regulation of neuronal nitric-
oxide synthase-generated superoxide. J Biol Chem, 2002. 277(43): p. 40275-80.

360. Weaver, J., et al., A comparative study of neuronal and inducible nitric oxide synthases:
generation of nitric oxide, superoxide, and hydrogen peroxide. Biochim Biophys Acta,
2005. 1726(3): p. 302-8.

361. Sasaki, N., et al., Augmentation of vascular remodeling by uncoupled endothelial nitric
oxide synthase in a mouse model of diabetes mellitus. Arterioscler Thromb Vasc Biol,
2008. 28(6): p. 1068-76.

362. Abelson, H.T., et al., Kinetics of tetrahydrobiopterin synthesis by rabbit brain
dihydrofolate reductase. Biochem J, 1978. 171(1): p. 267-8.

363. Laursen, J.B., et al., Endothelial Regulation of Vasomotion in ApoE-Deficient Mice :
Implications for Interactions Between Peroxynitrite and Tetrahydrobiopterin. Circulation,
2001. 103(9): p. 1282-1288.

364. Alp, N.J., et al., Tetrahydrobiopterin-dependent preservation of nitric oxide-mediated
endothelial function in diabetes by targeted transgenic GTP-cyclohydrolase I
overexpression. J Clin Invest, 2003. 112(5): p. 725-35.

365. Bedford, M.T. and S. Richard, Arginine methylation an emerging regulator of protein
function. Mol Cell, 2005. 18(3): p. 263-72.

366. Boulanger, M.C., et al., Methylation of Tat by PRMT6 regulates human immunodeficiency
virus type 1 gene expression. J Virol, 2005. 79(1): p. 124-31.

367. Tran, C.T., J.M. Leiper, and P. Vallance, The DDAH/ADMA/NOS pathway. Atheroscler
Suppl, 2003. 4(4): p. 33-40.

368. Ogawa, T., M. Kimoto, and K. Sasaoka, Dimethylarginine:pyruvate aminotransferase in
rats. Purification, properties, and identity with alanine:glyoxylate aminotransferase 2. J
Biol Chem, 1990. 265(34): p. 20938-45.

369. Thompson, P.R. and W. Fast, Histone citrullination by protein arginine deiminase: is
arginine methylation a green light or a roadblock? ACS Chem Biol, 2006. 1(7): p. 433-41.

370. Wang, Y., et al., Human PAD4 regulates histone arginine methylation levels via
demethylimination. Science, 2004. 306(5694): p. 279-83.









371. Regulation of eNOS-derived superoxide by endogenous methylarginines. Biochemistry.,
2008. 47(27): p. 7256-63. Epub 2008 Jun 14.

372. The ratio between tetrahydrobiopterin and oxidized tetrahydrobiopterin analogues controls
superoxide release from endothelial nitric oxide synthase: an EPR spin trapping study.
Biochem J., 2002. 362(Pt 3): p. 733-9.

373. Ratio of 5,6,7,8-tetrahydrobiopterin to 7,8-dihydrobiopterin in endothelial cells determines
glucose-elicited changes in NO vs. superoxide production by eNOS. Am J Physiol Heart
Circ Physiol., 2008. 294(4): p. H1530-40. Epub 2008 Jan 11.











BIOGRAPHICAL SKETCH

Arthur Pope was born in 1982 in Chicago, IL. He graduated from the Illinois Mathematics

and Science Academy in 2001. Following graduation, he attended the University of Illinois at

Urbana Champaign and obtained a B.S. degree in Chemistry in 2005. He then enrolled in the

Integrated Biomedical Science Program at The Ohio State University College of Medicine in

June of 2005 to obtain his doctorate of philosophy. In January 2006 he joined Dr AJ Cardounel's

lab and in June of 2007 he relocated with his mentor to the University of Florida joining the

Interdisplenary Program in Biomedical Sciences where he obtained his doctorate of philosophy

in August of 2009. During his graduate training he received a pre-doctoral fellowship award

from the NIH National Heart Lung and Blood Institute. Arthur has also been the first author on

three publications, and co-author on two others. He also has presented his research at several

conferences and has had two invited talks.





PAGE 1

1 ROLE OF ASYMMETRIC DIMETHYLARGINI NE (ADMA) IN THE REGULATION OF ENDOTHELIAL DERIVED NITRIC OXIDE By ARTHUR JAMES JARAE POPE A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2009

PAGE 2

2 2009 Arthur James Jarae Pope

PAGE 3

3 To Mom, Dad, Damecko, and Dannae thank you all for your love and support

PAGE 4

4 ACKNOWLEDGMENTS First and foremost, I would like to thank my mentor Dr. AJ Cardounel, without whom the work presented in this dissert ation would not be possible. I thank your patience and guidance throughout these past four years. Your enthusiasm about science and our work really motivated me to work harder and to become the scientist that I am today. I am not only grateful for the mentorship you have provided me but, also the friendship. I could not have asked for a better mentor! I would also like to thank my committee: Dr. Chris Baylis, Dr. Tom Clanton and Dr. Peter Sayeski. Though I have only known you all for a short period of time, you r guidance has really help to shape the last two years of my gr aduate experience and I thank you for that. Thank you to all the members of the Cardounel lab, Scott, Kanchana, Patrick and our former postdoc Dr. Jorge Guzman. I would also lik e to thank Dr. Larry Druhan at Ohio State for his technical support. I would like to also thank my friends and fam ily for their love and continuous support. Shant, Kenny, Nick Natasha, Wilton, Amanda, David, Levy, Inimary thank you all for your listening ear and support during my time in graduate school. I could not have done it without you all. To my brothers Dannae and Damecko, thanks for supporting your little brother throughout all these years of schooling. I promise I am done! To Aunt Diane thank you for all your support throughout the years. Last but certainly not least, thank you Mom and Dad for allowing me to purse my passion no matter where it has taken me.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS...............................................................................................................4 LIST OF TABLES................................................................................................................. ..........8 LIST OF FIGURES.........................................................................................................................9 ABSTRACT...................................................................................................................................11 CHAPTER 1 INTRODUCTION..................................................................................................................13 Rationale for Study.................................................................................................................18 2 REVIEW OF LITERATURE.................................................................................................20 Nitric Oxide............................................................................................................................20 Nitric Oxide Synthase Enzyme.......................................................................................21 Mediators of NO Release................................................................................................ 22 Actions of Nitric Oxide...................................................................................................22 Regulation of NOS.............................................................................................................. ...25 Arginine...........................................................................................................................25 Arginine Transportation.................................................................................................. 26 Arginine Metabolism..............................................................................................................27 Arginase...........................................................................................................................27 Arginine:Glycine Amin dotransferase and Argini ne Decarboxylase.............................. 28 NOS Cofactor and ProteinProtein Interactions..................................................................... 29 Tetrahydrobipterin(H4B).................................................................................................29 Hsp90...............................................................................................................................32 eNOS-Hsp90....................................................................................................................32 Calmodulin..................................................................................................................... .33 Caveolae..........................................................................................................................33 Caveolin-1 and eNOS...................................................................................................... 33 eNOS Posttranslational Modifcations..................................................................................... 34 Myristoylation and Palmitoylation.................................................................................. 34 eNOS Phosphorylation....................................................................................................35 Ser 1177/1179..................................................................................................................35 Thr 495/497.....................................................................................................................36 Ser 633/635......................................................................................................................36 Ser 615/617......................................................................................................................37 Ser 114/116......................................................................................................................37 Pathophysiology.....................................................................................................................38 Pathways Leading to Oxidative Stress Generation.................................................................39 NADPH Oxidase.............................................................................................................39

PAGE 6

6 eNOS Uncoupling...........................................................................................................40 DDAH ADMA Pathway.........................................................................................................42 PRMT..............................................................................................................................43 Methylarginine Biochemistry.......................................................................................... 44 Metabolism of Methylarginines...................................................................................... 47 In Vivo and In Vitro Significance of DDAH.................................................................. 49 ADMA Independent Mechanisms of DDAH..................................................................51 Regulation of DDAH Activity.........................................................................................52 Pathophysiology.....................................................................................................................53 3 ROLE OF DDAH-1 AND DDAH-2 IN THE REGULATION OF E NDOTHELIAL NO PRODUCTION..................................................................................................................... ..58 Introduction................................................................................................................... ..........58 Materials and Methods...........................................................................................................59 Cell Culture................................................................................................................... ..59 EPR Spectroscopy and Spin Trapping............................................................................ 59 HPLC...............................................................................................................................60 DDAH-1 and 2 Gene Silencing.......................................................................................60 DDAH Activity...............................................................................................................61 DDAH Over-Expression.................................................................................................62 Assessment of mRNA Levels Foll owing DDAH Gene Silencing.................................. 63 eNOS Activity.................................................................................................................63 Results.....................................................................................................................................64 Effects of DDAH 1 and 2 OverExpression on Endothelial NO Production.................64 Effects of DDAH-1 and DDAH-2 Ov er-Expression on ADMA Inhibition .................... 65 Effects of DDAH 1 and 2 Silenc ing on Endothelial NO Production.............................. 65 Effects on DDAH Gene Silencing on Methylarginine Metabolism................................ 68 Effects of DDAH 1 and 2 Gene Silencing on eNOS Activity......................................... 68 Discussion...............................................................................................................................69 4 ROLE OF DDAH-1 IN THE 4-HYDRO XY-2-NONENAL MEDIATE D INHIBTION OF ENDOTHELIAL NITRIC OXIDE GENERATION........................................................ 87 Introduction................................................................................................................... ..........87 Materials and Methods...........................................................................................................89 Materials..........................................................................................................................89 Cell Culture................................................................................................................... ..89 Epr Spectroscopy and Spin Trapping.............................................................................89 Measurement of Endothelial Cell ADMA and L-Arg Levels......................................... 90 DDAH-1 and eNOS Expression...................................................................................... 90 DDAH Activity...............................................................................................................90 Results.....................................................................................................................................91 Effects of 4-HNE on Endothelial Cell NO Production................................................... 91 Effect of 4-HNE on eNOS Expression............................................................................ 92 Restoring NO Generation from Cells.............................................................................. 92 Effects of 4-HNE on Superoxide Pro duction and Nitrotyrosine Formation ................... 93

PAGE 7

7 Effects of 4-HNE on Cellular ADMA Levels.................................................................94 Effect of 4-HNE on DDAH Expression and Activity.....................................................94 Effects of DDAH Over-Expression on Endothelial NO Production Following Exposure to 4-HNE...................................................................................................... 95 Discussion...............................................................................................................................97 5 REGULATION OF ENDOTHELIAL DE RV IED SUPEROXIDE BY THE METHYLARGININES........................................................................................................116 Introduction................................................................................................................... ........116 Materials and Methods.........................................................................................................118 Expression and Purification of the Huma n Full Length eNOS and eNOS Oxygenase Dom ain (eNOSox).......................................................................................................118 EPR Spectroscopy and Spin Trapping.......................................................................... 119 NADPH Consumption by eNOS...................................................................................120 UV/Visible Spectroscopy.............................................................................................. 120 Results...................................................................................................................................120 Effects of Methylarginines on O2 .Production from H4B Free eNOS.......................... 120 Effects of methylargini nes and L-Arginine on NADPH Cons umption from H4BFree eNOS..................................................................................................................122 Effects of Methylarginines on the Heme of eNOSox.....................................................123 Discussion.............................................................................................................................123 6 REGULATION OF DIHYDROFOLATE REDUCTASE IN THE DIABETIC ENDOTHELIUM................................................................................................................. 138 Introduction................................................................................................................... ........138 Materials and Methods.........................................................................................................140 Materials........................................................................................................................140 DHFR Activity Assay.................................................................................................... 140 Tissue DHFR Activity...................................................................................................140 HPLC Techniques.........................................................................................................141 Vascular Reactivity....................................................................................................... 141 EPR Spin Trapping Studies...........................................................................................141 Results...................................................................................................................................142 Enzyme Kinetics of DHFR............................................................................................ 142 Effect of Oxidants on DHFR Activity...........................................................................142 Effects of the Diabetic St ate on In-Vivo DHFR Activity.............................................. 143 Effects of the Diabetic St ate on Vascular Reactivity.................................................... 144 Effects of the Diabetic State on eNOS Derived O2 .Production in the Aorta...............144 Discussion.............................................................................................................................144 7 DISCUSSION.......................................................................................................................158 LIST OF REFRENCES...............................................................................................................174 BIOGRAPHICAL SKETCH.......................................................................................................202

PAGE 8

8 LIST OF TABLES Table page 3-1 L-NMMA Metabolism................................................................................................. 86 5-1 Effects of Methylarginines and L-arg on NADPH consumption from H4B-free eNOS (100 nM)............................................................................................................137

PAGE 9

9 LIST OF FIGURES Figure page 3-1 DDAH over-expression..................................................................................................... 75 3-2 Effects of adDDAH-1 over expressi on on endothelial cell NO production. ................... 76 3-3 Effects of adDDAH-2 over expressi on on endothelial cell NO production. ................... 77 3-4 Effects of DDAH-1 and DDAH-2 over-expression on ADMA me diated inhibtion of endothelial NO production................................................................................................. 78 3-5 Effects of DDAH gene sile ncing on DDAH mRNA expression....................................... 79 3-6 Effects of DDAH gene silenc ing on endothelial cell DDAH activity............................... 80 3-7 Effects of DDAH-1 gene silenci ng on endothelial cell NO production............................81 3-8 Effects of DDAH-2 gene silenci ng on endothelial cell NO production............................82 3-9 Effects of DDAH-1 and DDAH-2 gene silencing on e ndothelial cell NO production...... 83 3-10 Effects of ADMA on endothelial cell NO production....................................................... 84 3-11 Effects of DDAH gene silencing on endothelial cell eNOS activity................................. 85 4-1 Effects of 4-HNE on NO production. ............................................................................ 103 4-2 Effects of Hexanol on NO production.............................................................................104 4-3 4-HNE effects on eNOS e xpression and phosphorylation............................................... 105 4-4 Effects of 4-HNE on Ser1179 phophoryla tion following calcium ionphore (5 M, A23187) stimulation. .......................................................................................................105 4-5 Effects of L-arginine and GS H supplementation on NO generation ............................... 106 4-6 Effects on 4-HNE on the levels of ADMA in BAECs..................................................... 107 4-7 4-HNE effects on DDAH expression...............................................................................107 4-8 4-HNE effects on DDAH activity....................................................................................108 4-9 Effects of DDAH over-expression on e ndothelial cell NO production following 4HNE challenge................................................................................................................. 109 4-10 Effects of 4-HNE on endothelial cell DDAH activity..................................................... 110

PAGE 10

10 4-11 Effects 4-HNE on nitrotyrsoine formation in BAECs.....................................................111 4-12 Effects 4-HNE on ROS form ation from BAECs............................................................. 112 4-13 Effects of Hexanol on DDAH-1 activity......................................................................... 113 4-14 MS/MS spectra of of a tryptic peptide generating the sequence b/y-ion series from the in -gel digest of the hDDAH-1 reacted with 4-HNE.................................................. 114 4-15 Adenoviral transduction of hDDAH-1 in BAECs. .......................................................... 115 5-1 Inhibition of NOS-derived O2.from H4B depleted eNOS. ........................................... 130 5-2 Effects of ADMA on eNOS-derived O2 .-.........................................................................131 5-3 Effects of L-NMMA on eNOS-derived O2 .-....................................................................132 5-4 Effects of L-arg on eNOS-derived O2 .-............................................................................133 5-5 Effects of ADMA on O2 .production from H4B-depleted NOS in the presence of Larg....................................................................................................................................134 5-6 Effects of NMMA on NOS-derived O2 .in the presence of L-arg................................... 135 5-7 Methylarginines alter the eNOS-bound heme..................................................................136 6-1 H4B biosynthesis pathway. ............................................................................................149 6-2 DHFR enzyme kinetics.................................................................................................... 150 6-3 Effects of Nitric Oxide on hDHFR activity.....................................................................151 6-4 Effects of H2O2 on hDHFR activity.................................................................................152 6-5 Effect of O2 .-on DHFR activity. .....................................................................................153 6-6 Effects of OONOon hDHFR activity............................................................................154 6-7 Effects of the diabetic co ndition on in-vivo DHFR activity............................................ 155 6-8 Effects of the diabetic state on vascular reactivity........................................................... 156 6-9 Effects of the diabetic condition on eNOS derived O2 .in the aorta................................ 157

PAGE 11

11 Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy ROLE OF ADMA IN THE REGULATION OF ENDOTHELIAL DERIVED NITRIC OXIDE By Arthur James Jarae Pope August 2009 Chair: Arturo Cardounel Major: Medical Sciences-Physiology and Pharmacology The endogenous NOS inhibitor Asymmetric Dimethylarginine (ADMA) has been demonstrated to be an independent cardiovascular disease risk factor. However, the mechanisms regarding how ADMA levels are modulated and what role they play in disease progression are not clearly understood. Dime thylarginine dimethylaminohydr olase (DDAH) is the enzyme responsible for ADMA metabolism however, how it is regulate in the disease state is unclear. Therefore, we hypothesize that decreased DDAH expression/activ ity may be involved in the vascular pathophysiology observed in a variety of cardiovascular disease. Here we present findings that each isoform of the DDAH enzyme regulates endothelial NO production. Over-expression of either DDAH-1 or DDAH-2 was found to increase endothelial NO production. Gene silencing of either isof orm attenuated endothelial DDAH activity. Interestingly, dual silencing of the enzymes did not result in an additive effect on DDAH activity suggesting the existence of an alternative pathwa y of methylarginine metabolism. Furthermore, gene silencing of either isoform results in decreased endothe lial NO production. Subsequent studies aimed at investigating mechanisms of DDAH regulation in a disease state demonstrated that cells exposed to 4HNE exhibit decreased endothelial NO production and these effects were mediated through increased ADMA levels and decreased DDAH activity. In

PAGE 12

12 addition to methylarginine re gulation of NO, it has been hypothesized the ADMA may be involved in the phenomenon of eNOS uncoupling wherein the enzyme switches form an NO producing enzyme to an superoxide producing enzyme Investigations into this pathway revealed that methylarginines caused a dose dependent increase in eNOS derived superoxide. Interestingly, L-arginine also increased eNOS derived superoxide in a dose dependent manner. In addition to ADMA accumulation, oxidative stress has also been associated with endothelial dysfunction. The presence of react ive oxygen and nitrogen species decreased the activity of the salvage pathway enzyme, dihydrofolate reduct ase (DHFR) which regulates the conversion of H2B to H4B Physiological levels of OONOincreases enzyme activity. Furthermore, using the diabetic db/db mouse model of diabetes it was observed that DHFR activity was decreased and that these mice had impaired vascular function. These findings demonstrate that the DDAH-ADMA pathway and oxidative stress plays a critical role in the development of endothelial dysfunction.

PAGE 13

13 CHAPTER 1 INTRODUCTION In the United States it is estimated that 80,000,000 or 1 in 3 Americans have cardiovascular disease [1]. Data from the Fram ingham Heart Study demonstrates that 2 out of 3 men and 1 in 2 women will have cardiovascular dis ease in their lifetime [1]. Of those who have cardiovascular disease, 73,600,000 have high blo od pressure, which is defined as having a systolic pressure 140 mm Hg or a diastolic pressure 90 mm Hg. In 2005, cardiovascular disease was the underlying cause for 35.3% of all deat hs in the United States [1]. The number of deaths due to cardiovascular disease surpasses the total number of deaths due to cancer, diabetes, and accidents combined. Of those who die as a re sult of cardiovascular disease, 52% died as a result of coronary heart disease [1]. However, recent studies have shown that from the years 1980-2000, there was a substantial decrease in the number of deaths due to cardiovascular disease. Furthermore, almost half of the reductio n in deaths can be attributed to advances in the treatment of cardiovascular disease, while the other half is due to maintaining a healthy lifestyle [1]. Despite the drop in deaths due to heart disease, it is still the number one cause of death in the United States, and providing care to these patient s results in an enormous cost to the health care system. In 2005, 1 out of every 6 hospital st ays was related to coronary heart disease and the total cost of hospital care was 71.2 billion dollars. The projected indirect and direct cost for the treatment of cardiovascular disease is expected to rise to 475.3 billi on dollars in 2009 [1]. The most prevalent form of heart disease is coronary artery disease (CAD). CAD is caused by the build up of plaque in the coronary artery, which leads to lumen narrowing and a decreased supply of oxygen rich bl ood to the heart. This path ological process of arterial narrowing and impaired blood flow is termed athe rosclerosis and is the most common cause of

PAGE 14

14 coronary heart disease. Coronary heart disease, if untreated, can eventually lead to a heart attack and subsequently heart failure [1]. CAD is the re sult of various risk factors, including genetics, high blood pressure, smoking and diabetes. Familial hypercholesterolemia (FH) is an inherited disorder that is caused by a deficiency in the clearance of the Low Density Lipoprotein (LDL). Hypercholesterolemia is defined as having a total serum cholesterol level 240 mg/dl. Initially, it wa s believed that familial hypercholesterolemia was caused by the increased pr oduction of cholesterol. However, this proved not to be the cause with the discovery of the LDL receptor (LDLR) by Brown and Goldstein in 1973 [2, 3]. Their studies revealed that patien ts who suffered from FH had dysfunctional LDLRs, therefore, leading to the in creased accumulation of cholesterol [2, 3]. The risk of cardiac events in this population has been gr eatly reduced with the deve lopment of statins. Additional major risk factor s taken into account to dete rmine risk for CAD included diabetes, smoking, and high blood pressure. The Framingham Heart Study defines individuals having a blood pressure of <120/80 mm Hg, total serum cholesterol levels <180 mg/dL, non diabetics and non smokers as those who are least likely to develop CAD [4]. High risk individuals are those who have total serum cholesterol levels that are 240 mg/dl, hypertension, diabetes and smokers. The risk factors for developing CAD increases with age, however if a healthy lifestyle is maintained the risk remains low. At 50 years of age men have a 5.2% chance and women have a 8.2% chance of developing CAD if they maintain a healthy lifestyle [4]. However, having two or more of the associat ed risk factors (i.e. hypertension, diabetes) increases the risk of developing CAD to 68.9% for men and to 50% fo r women [4]. Although increased serum cholesterol levels and the asso ciated risk factors ou tlined by the Framingham

PAGE 15

15 Heart Study are known to increase the risk of coronary artery diseas e, it is not just a disease of high cholesterol. Atherogenesis, once considered mainly a dis ease of cholesterol storage, is now understood as a complex disease of many interacting risk fact ors which include cells of the artery wall, the blood and the molecular messengers exchanged between the two. It is now becoming clear that inflammation plays a critical role in atherogenesis [5-9]. It also plays a key role in the local, myocardial and systemic complications a ssociated with athero sclerosis [6, 8, 10]. Dyslipidemia, vasoconstrictive hormone s associated with hypertension, and proinflammatory cytokines derived from exce ss adipose tissue, enhance the expression of adhesion molecules that promote the sticking of blood leukocytes to the inner surface of the vascular wall [6, 8, 10]. Once inside the intima, blood leukocytes activate the smooth muscle cells (SMCs) resulting in their migration to the in tima. The SMCs continue to proliferate leading to the creation of a complex extracellular matrix [7, 11-15]. Proteoglycans of the extracellular matrix bind to lipoproteins extending their stay within the intima therefore increasing their chances of becoming oxidized. LDLs undergo oxid ative alteration leading to the formation of oxLDL in the arterial wall. Other cellular lipids also undergo redox modifications, which result in the formation of lipid hydroperoxides. Th ese oxidatively modified lipids have been demonstrated to play an important role in th e pathogenesis of atherosclerosis [16-21]. Among the mechanisms proposed, Nitric Oxide Syntha se (NOS) dysregulation and decreased Nitric Oxide (NO) bioavailability have been implicated as a central mechanism in vascular endothelial dysfunction associated with atherosclerosis. NO is a potent vasodilator and critical eff ector molecule that helps the endothelium maintain vascular homeostasis through its anti-p roliferative and anti-thrombotic effects. NO is

PAGE 16

16 derived from the oxidation of L-Arginine (L-A rg) and catalyzed by the constitutively expressed enzyme endothelial nitric oxide synthase (e NOS). NO freely diffuses across the vascular endothelium to the vascular smooth muscle cel l layer where it activates guanylate cyclase leading to smooth muscle cell rela xation [22, 23]. In addition to its effects on vascular tone, NO also helps to maintain the anti-atherogenic prop erties of the vascular wall. NO, in association with other cell signaling molecules promotes smooth muscle cell quiescence counteracting proproliferative molecules specifica lly those involved with athero-p roliferative disorders [24-29]. Therefore, loss of NO bioavailability is an ea rly symptom of endotheli al dysfunction and is implicated as the pathogenic trigge r leading to atherosclerosis. Among the proposed mechanisms that lead to decrease NO bioavailability, is the accumulation of the endogenous NOS inhibitors as ymmetric dimethylarginine (ADMA) and NGmonomethyl-L-arginine (L-N MMA) [30-34]. ADMA and LNMMA are both competitive inhibitors of eNOS. ADMA and L-NMMA are de rived from the proteolysis of methylated arginine residues on various protei ns. Methylation is carried out by a group of enzymes referred to as protein-arginine methyl transferases (PRMTs). Upon prot eolysis of methylated proteins, free methylarginines are released where they can then inhibit eNOS activity. The free methylarginines are subsequently hydrolyzed by Dimethylarginine Dimethylaminohydrolase (DDAH) to citrulline, and mono a nd dimethylarginine [35-37]. Recent studies from our lab and others have shown that the met hylarginines ADMA and L-NMMA play a critical role in vascular function and that the dysregulation of the enzymes responsible for metabolizing the methylarginines play an essential role in endothelial dysfunction [38]. In support of this hypothesis several studies from both human and animal models of atherosclerosis have demonstrated that L-Arg enhances the anti -atherogenic properties of the

PAGE 17

17 endothelium by increasing NO bioavailabilit y. Oral L-Arg supplementation has been demonstrated to restore endothe lium dependent vasorelaxation in both hyperlipidemic animals and humans [30, 34, 35, 39, 40]. Additionally, oral L-Arg has also been shown to prevent the development of atherosclerosis in LDL recep tor knockout mice (LDLR) [30]. The beneficial effects observed following L-Arg supplementation could be explained by the fact there is increased substrate for the NOS enzyme. However, intracellular levels of L-Arg are 50 times above the Km value for the enzyme therefore, increased NO generation would not be expected as a result of L-Arg supplementation [41]. It has been hypothesized that basal levels of methylarginines can inhibit NOS activity and L-Arg supplementation is able to improve vascular function simply by overcoming the inhibitory effects of the methylarginines [42]. Another potential mechanism for reduced NO bi oavailability is thr ough direct scavenging of NO by reactive oxygen species (ROS) [43]. Grow ing evidence has demonstrated that oxidative stress is associated with the pathogenesis of diseas es including hypercholesterolemia, diabetes and hypertension [44-47]. In healthy tissues, superoxide anion (O2 .-) is dismutated into hydrogen peroxide (H2O2) and oxygen by the enzyme superoxide dismutase (SOD). The enzyme, Catalase further reduces H2O2 to water and oxygen [48]. Increases in oxidative stress seen in the pathological stat es overwhelm the antioxidant de fense systems resulting in an oxidative environment. Failure of the antioxida nt system can also lead to the generation of peroxynitrite (OONO-), which is a potent oxidant known to cause damage to proteins and tissues [43]. In this regard, a human va riant of ecSOD has been observed in 5% of the population. This ecSOD variant is associated with decreased SOD activity, increased oxidative stress and increased inactivation of NO [49].

PAGE 18

18 Alternatively it has been propos ed that increased oxidative stress results in the uncoupling of the NOS enzyme turning it into a superoxide generating enzyme. In vitro studies have demonstrated that eNOS depleted of its essential cofactor, tetrahydrobiopterin (H4B), readily makes superoxide [50, 51]. Futher more, it is also known that H4B is highly redox sensitive and can be readily oxidized to its inactive form dihydrobiopterin (H2B). H4B is produced via two pathways in the endothelial ce ll, the de novo synthesis pathway and the salavage pathway. De novo biosynthesis of H4B is a magnesium, zinc and NADPH dependent pathway. The first step requires the conversion of GTP to 7,8-dyhydroneopterin triphosphate. This reaction is catalyzed by the enzyme GTP cyclohydrolase I (GTPCH), and it is the rate limiting step in H4B biosynthesis [52]. Following th e GTPCH enzyme reaction pyruvoyl tetrahydropterin synthase (PTPS) converts 7,8 dihydroneopterin triphosphate into 6-pry uvoyl-5,6,7,8-tetra hydropterin. Alternatively, the salvage pathway enzyme Dihydrofolate reductase (DHFR) is a NADPH dependent enzyme that catalyzes the conversion of H2B to H4B. NOS uncoupling has also been demonstrated to occur in both animal and human models of diseases associated with oxidative stress. In this regard, oral supplementation of H4B was demonstrated to improve endothe lial dependent vascular functi on in the apoE KO mouse model of hypercholesterolemia. In a ddition to improved vascular function, a reduction in vascular superoxide production was also observed following oral H4B supplementation [53]. Moreover, endothelial function has been shown to improve in patients who are chronic smokers, type II diabetics and those with CAD following H4B supplementation [54, 55]. Rationale for Study It is clear that the mechanisms that lead to vascular endothelial dysfunction are quite complicated. Though the evidence laid out in the introduction points to two possibilities. First, increasing levels of methylarginines have been demonstrated to be an independent risk factor in

PAGE 19

19 the development of cardiovascular disease. Ho wever, how methylarginines are modulated and what role they play in di sease progression is poorly unders tood. Additionally, how DDAH is regulated and what role it plays in endothelial dysfunction needs to be explored further. Because NO possess both anti-proliferative and anti-atheroge nic properties, methylarginine accumulation in response to decreased DDAH expression and activ ity has been proposed to be involved in the vascular pathophysiology observed in a va riety of cardiovascular disease. In addition to the accumulation of ADMA, the altered redox status of the endothelium has also been implicated as a central mechanis m in endothelial dysfunction associated with cardiovascular disease. Previous studies have demonstrated that in diseases such as diabetes there is an accumulation of H2B, the inactive oxidized form of the NOS cofactor H4B. This increase has also been associat ed with increased superoxide pr oduction and vascul ar endothelial dysfunction. However, it is unclear as to what leads to this accumulation, because DHFR should reduce H2B back to H4B. Therefore, I hypothesized that DHFR activity may decrease in oxidative stress situations. While it may appear that ADMA and oxidative stress are unrelated, it has been suggested that ADMA also plays a role in NOS uncoupling. Therefore to better esta blish the role of ADMA in the re gulation of endothelial derived NO and vascular endothelial dysfunction, th e following aims will be carried out: Aim 1: To determine the role of DDAH in the regulation endothelial derived NO Aim 2: To determine the effects of the methylarginines on eNOS derived superoxide. Aim 3: To determine the effects of oxidative stress on DHFR activity in vitro and in vivo.

PAGE 20

20 CHAPTER 2 REVIEW OF LITERATURE Endothelial cells were once considered to be a population of elongated cells that were homogenous in nature and that th eir main function was to serve as a barrier between the vascular space and interstitium. Florey demonstrated in the late 60s that the endothelium was a permeability barrier and served a much bigger role than previous thought [56]. Subsequently, intense research began to dete rmine the role endothelial cells and their effects on vascular function. Furchgott and Zawadzi were the first to describe that the endothelial layer was necessary for acetylcholine (Ach) mediated vascul ar relaxation in rabbit aortic rings. Their studies demonstrated that when the endothelial layer was removed, the vessel lost its ability to relax in response to Ach and in fact it resulted in overt vaso constriction [57]. Moncada, and Ignarro, independently established that the e ffector previously described by Furchgott and Zawadzi as endothelial derived re laxing factor (EDRF), was in fact NO [58, 59]. A year later, LArg was discovered to be the substrate from wh ich NO was synthesized [60]. Since then it has been established that NO is one of the most im portant regulators of va scular homeostasis and that decreased bioavailability of NO is involved in the endo thelial dysfunction observed in cardiovascular disease. Nitric Oxide Endothelial derived Nitric Oxide is synthesi zed from the oxidation of the guanidino carbon of the amino acid L-Arg to NO and L-Cit by the en zyme eNOS [60]. The half life of NO is in the range of 3-5 seconds in the presence of hemoglobin and can undergo rapid oxidation by oxyhemoproteins to nitrate (NO3) and nitrite (NO2) [61]. One of the primary functions of NO in the vasculature is to cause vascular smooth muscle cell (VSMC) relaxation. NO does this by freely diffusing from the endothelium into the VS MC layer where it binds to the heme group of

PAGE 21

21 the enzyme guanylate cyclase. Guanylate cycl ase then catalyzes the reaction of guanosine triphosphate (GTP) to cyclic guanosine 3 -monophosphate (cGMP) and inorganic phosphate [22, 59]. cGMP then activates protein kina seG (PKG) resulting in the phosphorylation of myosin light chain phosphatase. Myosin light chain phosphatase then dephosphorylates myosin light chain, resulting in vascular smooth muscle cell relaxation. NO in c oncert with various cell signaling molecules, has been demonstrated to maintain smooth muscle cell quiescence and as such, counteracts pro-proliferative agents, spec ifically those involved in the propagation of athero-proliferative disorders [25]. Nitric Oxide Synthase Enzyme There are three isoforms of the NOS enzyme neuronal nitric oxide synthase (nNOS), inducible nitric oxide synthase (iNOS) and e ndothelial nitric oxide synthase (eNOS). The cofactors required for the full en zymatic activity of all NOS enzymes are the flavin (FAD, FMN) [28], heme, calmodulin (CaM) and tetrahydrobiopterin (H4B). The enzyme has three domains which are required for catalytic activity, the reductase dom ain, CaM binding domain and oxygenase domain [62-64]. The cofactors FAD and FMN are located within the reductase domain and in concert with NADPH shuttle electr ons to the heme binding site in the oxygenase domain [62-64]. The oxygenase domain contains the heme, H4B, and arginine binding sites [65, 66]. eNOS and nNOS are activated by calcium -calmodulin binding to the CaM binding domain of the enzyme. The binding of calcium-calmodulin to NOS activat es the transfer of electrons from the flavin to heme, where oxidation of L-Arg to NO and L-Cit occurs [67, 68]. eNOS, when inactive, is located within invaginations of the pl asma membrane called caveolae [69]. Specifically, it has been demonstrated that eNOS binds to caveolin-1 (CAV-1) and that this interaction is inhibitory to enzy me activity [69]. Dissociation of the CAV/eNOS complex occurs when excess amounts of calcium en ter the cell and binds to CaM. The resulting

PAGE 22

22 Ca-CaM complex facilitates the dissociation of eNOS from Cav-1 result ing in eNOS activation and NO production. Mediators of NO Release The release of NO from the vascular endothelium can be activ ated through both Ca2+ dependent and independent mechanisms. The bindi ng of substances such as acetylcholine (Ach), and bradykinin to their respective receptors activate NOS through a Ca2+ dependent mechanism [70-72]. All of these substances mediate thei r effects on eNOS activity through phospholipase C (PLC). Activation of PLC results in increased intracellular Ca2+, which subsequently leads to the activation of eNOS [70-73]. Alternatively, laminar shear stress generate d by blood flowing over th e endothelial cell, which is the main physiological way in which eNOS is activated, and vascular endothelial growth factor (VEGF) can also st imulate the release of NO in a Ca2+ independent manner. Shear stress and VEGF activate the phosphatidylinostiol-3-kinase (P I3K) pathway leading to the activation of AKT consequently resulting in eNOS phosphorylation and activation [74]. Actions of Nitric Oxide In addition to modulating vascular tone th rough VSMC relaxation, NO is also important for maintaining vascular homeos tasis through its anti-thrombotic anti-prolifera tive and antiatherogenic effects. NO and pr ostaglandin (PGI) act in a s ynergistic manner through a cGMP dependent mechanism to prevent platelet aggregation in the endothelium [75]. It has been demonstrated in both human and animal mode ls that NO is key in preventing platelet aggregation. In this regard, it was observed in a rat model of common carotid artery thrombosis, platelet aggregation increased at the site of the thrombosis fo llowing administration of the NOS inhibitor Nitro-L-Arg methyl es ter (L-NAME) [76]. Furthermor e, studies involving healthy

PAGE 23

23 human volunteers have demonstr ated that when the NOS i nhibitor L-NMMA is given intravenously bleeding times are decreased [77]. In addition to its anit-thrombotic effects, NO is known for its anti-atherogenic properties. Endothelial cell activation is a process that involves the up regul ation of transcription of a number of pro-inflammatory genes, and adhesi on molecules such as E and P selectin, VCAM-1 and ICAM-1. Addtionally, chemokines such as MCP1 and IL-1 also increase during endothelial cell activation. Taken together these adhension molecules and chemokines, increase leukocyte rolling and adhension to the endothelium. NO th rough its inhibitory effects on the NF kappa B signaling pathway prevents leukocyte adhesion to the endothelial cell monolayer. Thus, resulting in the inhibition of the pro-atherogeni c adhesion molecules P-selectin, E-selectin, and VCAM-1 [78, 79]. The anti-proliferative pr operties of the endothelium are ma intained through a NO mediated mechanism in concert with various other signaling molecu les. Balloon angioplas ty is a standard treatment for coronary artery stenosis caused by CAD. An unfortunate side effect to this treatment is restenosis, which is caused by VSMC proliferation in response to vascular injury. Several studies have demonstrated that in bo th human and animal models of restenosis, increasing NO reduces neointimal hyperplasi a [80-82]. Though it has been known for quite some time that NO prevents VSMC proliferation, the molecular mechanism of how this occurs was largely unknown. Recently it has been demonstr ated that NO inhibits cell cycle progression of VSCMs in the S phase by inducing down-regulation of cyclin-dependent kinase 2 (cdk2) activity and cyclin A gene transcription [83]. In addition to its effects on the endotheliu m, NO has also emerged as a protein post translational modifier. Severa l studies have demonstrated that endogenous and exogenous NO

PAGE 24

24 and its oxidative products NO3 and NO2 can S-nitrosylate proteins at active cysteine residues altering their function. The exact function of protein S-nitros ylation (SNO) is not clearly defined, however, it has been suggested that it ma y be involved in storage and transportation of the NO molecule [84]. In support of this hypothesis it has been demonstrated that glutathione and NO interact to form S-nitr osoglutathione (GSNO). GSNO is the most abundant SNO and invitro its decomposition has been shown to generate NO [85]. The formation of SNO is prevented during hi gh antioxidant activity. However, when the antioxidant defense system is overwhelmed dur ing times of oxidative stress, SNO formation could be a key in preventing fu rther oxidative damage [86]. SNO has also been shown to partially mediate the antioxidant effects of statins in the endothelial cell by activating the antioxidant enzyme thioredoxin [87]. SNO can also modulate the activity of en zymes important for regulating vascular homeostasis. SNO formation has been demonstrat ed to occur in the cat alytic triad of the DDAH enzyme at cysteine 249 rendering the enzyme inac tive [88]. Argininosucci nate synthetase, the enzyme responsible for converting citrulline to argininosuccinate can also undergo SNO formation also inhibiting its activity [89]. In -vitro studies using NO donors demonstrate that formation of SNO on eNOS targets two cystei ne residues at 96 and 101 rendering the enzyme inactive [90]. Furthermore, it has been demons trated in Bovine Aortic Endothelial Cells (BAECs) that SNO formation on eNOS also occurs ,but can be rapidly de nitrosylated in the presence of VEGF [91]. Though eNOS can be se lf regulated through SNO formation, it is also regulated by posttranslational modifications, substrate availability and protein-protein interactions.

PAGE 25

25 Regulation of NOS The role of eNOS in the regulation of cardi ovascular function has been the focus of extensive research efforts. Results have demonstr ated that eNOS enzymatic activity is regulated by a variety of factors including s ubstrate/inhibitor bioavailability, protein-protein interactions and post-translation modifications In addition to being a subs trate for NOS, L-Arg is also metabolized through various pathways in the cell. Arginine is predominantly metabolized by the enzyme arginase and its activity could play a key role in regulating eNOS. eNOSs interactions with other proteins and cofactors have been well documented as ways in which eNOS can be regulated. Hsp90, CaM, H4B all promote increased enzyme activity and NO production. On the other hand, eNOSs interaction with Cav-1 results in the inhibition of enzyme activity. eNOS is also regulated by post-translational modificat ions. Among them, phosphorylation of eNOS is most extensively studied and has been demonstrated to result in both site specific activation and inactivation of the enzyme. Finall y, the last known post translational modification of eNOS that occurs is myristoylation and palmitoylation. My ristoylation and plamitoylation of the enzyme causes it to be targeted to the plasma membra ne where it will interact with CAV-1 inhibting enzymatic activity. Arginine The discovery in 1987 that Endothelial Derv ied Relaxing Factor (EDRF) was NO was an important milestone in understa nding how vascular tone was re gulated. However, it was not until a year later that the substrate for eNOS was discovered to be the amino acid arginine [86]. Arginine is available from three main sources; dietary intake, endogenous biosynthesis, and protein turnover. 40% of the ar ginine that we ingest through our diet is catabolized in the intestine before reaching the whole body [92]. During fasting st ates, 85% of our circulating arginine is derived from protein turn-over and the rest comes from endogenous biosynthesis [93].

PAGE 26

26 The endogenous biosynthesis of arginine in heal thy adult humans is enough that it is not an essential amino acid in the diet. However, in infants, growing children, and adults with kidney or intestinal dysfunction, endogenous arginine synthesis is not enough. Therefore, it is classified as a conditionally essentia l dietary amino acid [94]. Whole body arginine synthesis occurs primar ily between the inter action of the small intestine and the kidney and it is referred to as the gut-kidney axis. Citr ulline is produced from glutamine and proline in the small intestine. The kidney then takes up citrulline where it is converted to arginine. A large amount of arginine synthesis also takes place in the liver, however, it is not a significant source as argini ne is quickly hydrolyzed to urea and ornithine therefore not contri buting a lot to the whole body [95]. Although the primary means of arginine synthesis occurs in the kidney renal tubules, the majority of cell types have the ability to synthesi ze arginine. Arginine sy nthesis from citrulline occurs via the synergistic action of argininosuc cinate synthase and argininosuccinate lyase (ASL). ASL is the rate-limiting step in the conv ersion of citrulline to arginine, and it requires aspartate, citrulline and ATP as cofactors for full activity [95]. The citrulline-NO cycle, much like the urea cycle, is recognized as an altern ative means to produce arginine in the cell. However, only a fraction of the citrulline produced by eNOS oxidation of argi nine is recycled via the citrulline-NO cycle [93]. Arginine Transportation Transportation of the cationic amino acid argini ne from the plasma into the cell occurs though the sodium (Na+) independent transport system y+ The y+ transport system family consists of 3 cationic amino acid transporte rs (CAT) CAT-1, CAT-2 and CAT-3, each having distinct tissue dist ribution. CAT-1 is ubiquitously expressed, CAT-2A expression is found in the liver, skin and skeletal muscle, and CAT-3 expression is exclusivel y expressed to the brain. The

PAGE 27

27 amino acids lysine, ornithine and the methylar ginines compete with arginine for transport through the CAT transport system. Although intr acellular arginine appears to be the most important source of eNOS derived NO, there is evidence to support a role for CAT in the regulation of endothelial NOS [95]. The y+ Km for arginine is within the physiologica l range of plasma arginine levels and therefore arginine transportati on into the cell maybe an importa nt regulator of NOS. Kinetic studies have demonstrated that the Km of eNOS for arginine is 23 M. L-Arg intracellular levels are in the range of 100 M. Therefore, substrate availability should not be a limiting factor in NO synthesis [96]. However, studies have clearly demonstrated in both animal and human models that arginine supplementation leads to increases in NO generation. This phenomenon has been termed the L-Arg para dox and has been hypothesized that perhaps increased uptake through the y+ transport system may play a role in this paradox [93, 95]. Arginine Metabolism Arginase Arginase is the key urea cycle enzyme involve d in arginine metabolism and is responsible for the hydrolysis reaction of argini ne to urea, and ornithine. Ther e are two isoforms of arginase that are expressed in the body. The type I isoform is located in the liver and is responsible for the majority of arginase activity. The type II isoform is predominantly expressed as a mitochondrial protein and is expressed in a va riety of tissues with the highest expression localized to the kidney, and the lowest in the liver [93]. Recently, several studies have demonstrated that arginase is present in the vasculature and may serve a regulatory role in vasomotor tone. VSMC only express type I, while endothelial cells express both isoforms. The aortic smooth mu scle cells of rats were observed to have high arginase activity. Addtionally, tran sforming growth factor-beta (TGF) up-regulates the

PAGE 28

28 expression and activity of arginase I in these cell s [97]. Furthermore, it has been demonstrated that both isoforms are expressed in the aort a, carotid artery and pulmonary artery [98]. Considering that arginine is also a substr ate for arginase, it has been suggested that arginase may compete with NOS for substrate binding. The Km for arginine for eNOS and arginase are 2 M and 1-5 mM respectively. Although, arginine has a higher affinity for NOS, the activity of the arginase enzyme is 1000 fold gr eater therefore suggesting that at physiological levels arginase can compete with NOS for s ubstrate binding [93, 99]. In support of this hypothesis, it was demonstrated in macrophages th at L-Arg supplementation resulted in greater urea production, than NO generation [100]. It has al so been demonstrated in endothelial cells that over-expression of either arginase isoforms re sulted in decreased eNOS derived NO. In microvascular endothelial cells isol ated from Dahl salt sensitive rats, the increase in arginase activity counteracts NO mediated relaxation, thus s uggestive of a vasoconstric tive role [101]. In contrast, inhibition of arginase activity has been demonstrat ed to increase endothelial NO production in cultured endothelial cells [102]. A lthough arginase is the main pathway in which arginine is metabolized; there are other pathways in which its metabolism can also occur. Arginine:Glycine Amindotransferase and Arginine Decarboxylase The arginine:glycine amidotransferase [103] en zyme catalyzes the first step and it is also the rate limiting step in creatine formation. In the first step of creatine synthesis arginine donates an amidino group to glycine to form guanidinoacet ate and ornithine. The guanidionacetate is then methylated to form S-Adenosylhomocysteine and creatine. Creatine negatively feedbacks to inhibit enzyme activit y [104]. Ornithine made from this pathway can be used by ornithine decarboxlyase (ODC) to make polyamines. Arginine Decarboxylase (ADC) catalyzes the reaction of arginine to carbon dioxide and agmatine. Agmatine is further metabolized into put rescine and urea. Putrescine is used in the

PAGE 29

29 synthesis of polyamines, which are important for cell division [105]. Although AGAT, ADC, and ODC do not appear to compete with NOS fo r substrate binding, they can play a role in vascular remolding as polyamines are important for cell division and proliferation [74] NOS Cofactor and Protein-Protein Interactions. Tetrahydrobipterin(H4B) First described as an essential cofactor for the aromatic amino acid hydroxylases, tetrahydrobipterin (H4B) is also a essential cofactor for all three NOS isoforms [106-108]. The role that H4B plays in NOS regulation has only recently become more defined. Located within each domain of eNOS is a binding site for a H4B molecule. In vitro studies demonstrate that H4B stabilizes and donates electrons to the fe rrous-dioxygen complex in the oxygenase domain to help initiate the oxidati on of L-Arg [109-111]. Loss of H4B leads to the phenomenon of NOS uncoupling which has been documented in a variety of cardiovascular releated diseases [53, 112, 113]. H4B depletion leads to the dissociation of the ferrous-dioxygen complex and electrons from the flavin do main are donated to molecular oxygen instead, le ading to the production of superoxide from the oxygenase domain [50, 51]. As previously stated, H4B is an essential cofactor for the aromatic amino acid hydroxylases and NOS. The synthesis of H4B occurs via three pathways in the cell, the de novo pathway, the salvage pathway, and recycling pathway. In the recycling pathway, the oxidized product of H4B, tetrhydrobiopterin-4alpha -carbinolamine, is recycled back to H4B in a two step enzymatic process. First Pterin-4alpha-c arbionolamine dehydratase (PCD) reduces tetrahydrobiopterin-4 alpha-carbinolamine to a quinonoid dihydrobiopterin intermediate wh ich is then further reduced by dihydropteridine reductase (DHRP) to H4B [114, 115]. The recycling pathway has not been shown to represent a critical pathway for production of H4B in the endothelial cell, nor does it have an effect on eNOS activity [110, 116].

PAGE 30

30 De novo biosynthesis of H4B is a magnesium, zinc and NADPH dependent pathway. The first step requires the conversion of GTP to 7,8-dyhydroneopterin triphosphate. This reaction is catalyzed by the enzyme GTP cyclohydrolase I (G TPCH), and it is the rate limiting step in H4B biosynthesis [52]. GTPCH can be regulated at both the gene and protein level. Cytokines such as Tumor Necrosis Factor Alpha (TNF-a) and Interferon (IFN-y) increase GTPCH activity resulting in increased H4B levels in human endothelial cells [117-119]. Platelet-derived growth factor and angiotensin II (Ang II) have both been demonstrated to increase GTPCH activity by phosphorylation in rat mesangial cells via a phosphokinsae C (PKC) dependent pathway. However, this mechanism has not been observed in endothelial cells [120 ]. Over-expression of GTPCH has been demonstrated to increase the levels of H4B by ten fold in human endothelial cells [121]. Laminar shear stress also leads to increased GTPCH activity and H4B production in the vascular endothelium [122]. Additionally, endothelial specif ic GTPCH transgenic mice have been observed to have a two fold increase in NO synthesis compared to wild type litter mates [123]. GTPCH activity is also regulat ed by its physical interacti on with the GTPCH feedback regulator protein (GFRP). H4B exerts its inhibitory effects on GTPCH by binding to GFRP[124]. Following exposure to H2O2 GFRP mRNA levels have been obs erved to decrease resulting in increased GTPCH activity and H4B levels. However, the decrease in GFRP mRNA expression has no effect on NO production [125]. What role if any GFRP plays in regulating eNOS is unknown, however, in a yeast 2-hybrid studies the activator of heat shock protein 90 (Aha1) was recently shown to be a binding partner in the N-te rminal region of the GFRP protein [126]. HSP 90 is a known cofactor of the eNOS enzyme, a nd its binding to eNOS results in enhanced enzyme activity (149). Because GFRP binds in a region that is not required for HSP 90

PAGE 31

31 activation it has been proposed that GFRP binding to Aha1 functions to help support local changes in eNOS derived NO generation [126]. Following the GTPCH enzyme reaction, pyruvo yl tetrahydropterin synthanse (PTPS) converts 7,8 dihydroneopterin triphosphate in to 6-pryuvoyl-5,6,7,8-tetrahydropterin. In macrophages, induction by cytokines leads to increased GTPCH activ ity however, the activity of PTPS remains unchanged [127, 128]. Under thes e conditions PTPS becomes the rate limiting enzyme for H4B synthesis, and as a result the 7, 8 di hydroneopterin triphosphate intermediate accumulates and can become oxidized to neopterin. Neopterin is a stable metabolite that can be detected in the plasma and used clinically as a marker of inflammation in CAD [129]. The final step in the de novo synthesis pathway involve s the NADPH dependent se piapterin reductase enzyme catalyzing the reaction of 6-pyruvoyl-5,6,7,8tetrahydropterin to th e final product of de novo synthesis, H4B [130]. A mouse SPR KO model has b een generated and this model shows impaired synthesis of H4B. To date however, no studies have been done to gather what effect this may have on the vascular endothelial functio n of these mice [131]. The salvage pathway is another in which H4B can be synthesized. One way in which the salvage pathway works is through the conversion of exogenous sepiapteri n. Sepiapterin is metabolized to H2B by sepiapterin reductase and subsequently to H4B by the enzyme dihydrofolate redutase (DHFR). Alternatively, when H4B is oxidized to H2B, DHFR reduces it back to H4B [132]. Recently the role of endothelial DHFR in BAECs as it relates to H4B and NO bioavailability was investigated. As a result of DHFR gene sile ncing, endothelial NO production and H4B levels in endothelial cell decreased [133]. Additionally, DHFR expre ssion was observed to decrease in BAECs following exposure to H2O2. Following Ang II mediated stim ulation of NADPH, increases in eNOS derived O2 .were observed. DHFR gene over-e xpression was able to restore H4B and NO

PAGE 32

32 bioavailability. It also resulte d in decreased eNOS derived O2 .in ANG II treated cells. Overall, this study demonstrates the importance of DHFR in maintaining endothelial H4B and NO bioavailability. Moreover, under conditions of oxidative stress the salvage pathway maybe critical in maintaining endothelial H4B and NO production [133]. Hsp90 Hsp 90 is a chaperone protein that is among the most abundant proteins in eukaryotic cells accounting for 1-2 percent of total cytosolic protei n [134]. It exists in two isoforms, Hsp90 alpha and HSP90 beta and it is mostly localized to the cytoplasm with a marginal amount found in the nucleus [134]. The role of Hsp90 in the cell is to promote protein folding by preventing protein aggregation of unfolded protein [135, 136]. In addition to promo ting protein folding, there is evidence to suggest that Hsp 90 is important for signal transduction in all cell types. In support of this, a variety of signaling proteins includ ing v-Src, Raf-1 and MEK have been shown to interact with Hsp 90 [137-139] eNOS-Hsp90 eNOS was initially shown to interact w ith a 90 kDa tyrosine phosphorylated protein following bradykinin stimulation in BAECs and this promoted translocation of eNOS to the cytoskeleton [140, 141]. It was later shown that this protein termed endothelial nitric oxide synthase associated protein (ENAP-1) was in fact HSP90 [140, 141]. Hsp90 is recruited for binding to eNOS following VEGF, histamine and fluid shear stress stimulation and enhances the activity of the enzyme [141]. Geldanamycin (GA) is a ansamycin antibiotic that binds to the ATP binding site of Hsp90 preventing the ATP/ADP cycle that is require d for protein-protein interactions [142]. In support of Hsp 90 being critical to eNOS activity, it has been shown that GA treatment in isolated mesent eric arteries and rat aortas decreases NO generation [141, 143]. Furthermore, Hsp 90 inhibition by GA has been shown to increase eNOS derived superoxide

PAGE 33

33 production [144]. Recent studies have demonstrated that there is an Hsp90 binding domain present on eNOS. Site directed mu tagenesis of this site yields an eNOS mutant that has a weak binding affinity to HSP90 and increased generation of O2 .[145]. These observations suggest that Hsp90 binding is not only important for enhanc ing enzyme activity, but that it can also be important in modulating the balance between NO and O2-generation from eNOS. Calmodulin In addition to HSP 90, calmodulin has been known to have a positive regulatory effect on eNOS activity [67] and was the first protein known to be involved in eNOS regulation. CaM binding to its binding motif on eNOS displaces the auto-inhibitory loop on eNOS allowing the electrons to flow from the reductase domain to the oxygenase domain [146]. Caveolae Caveolae are small (50-100 nm) cholesterol rich invaginations locate d on the surface of the cell membrane. They are found in practically ev ery cell type and are found in copious amounts in VSMC, endothelial cells and ad ipocytes. The major structural protein of caveolae is caveolin. The caveolin family consists of three protein isoforms, Caveolin-1 (Cav-1), Caveolin-2 (Cav-2) and Caveolin-3 (Cav-3). Cav-1 is expressed in most cell types including adipocytes, endothelial cells and VSMC [147]. Cav-2 is found in the same cell types as Cav-1. In fact Cav-1, and Cav-2 co-localization is required in order for Cav-2 to make caveolae [147, 148]. Furthermore, without Cav-1, Cav-2 is localized to the Golgi complex wh ere it is degraded [148]. Cav-3 expression is limited to muscle tissue and it is found in skeletal, cardiac and smooth muscle cells [149]. Caveolin-1 and eNOS As previously stated, abundant amounts of Cav-1 are present in the endothelial cell. Numerous studies have demonstrated in vivo and in vitro that Cav-1 is a negative regulator of eNOS activity [150, 151]. eNOS contains a co nsensus binding sequence for Cav-1 at amino

PAGE 34

34 acids 350-358. In this regard, studies done us ing a scaffolding peptid e corresponding to the consensus sequence have been shown to cause in hibition of enzyme activity [151]. Additionally, it has been demonstrated in cellular studies that over-expression of Cav-1 results in reduced eNOS activity [150]. In further suppor t of its inhibitory effects, in vivo studies using the Cav-1 scaffolding peptide was demonstrated to inhib it endothelial dependent vasorelaxation following Ach stimulation [152]. In contrast, site direct ed mutagenesis of the Cav-1 consensus sequence inhibits Cav-1 binding and suppression of eNOS activity [151 ]. Moreover, Cav-1 KO mice exhibit enhanced endothelial depe ndent vasodilatation in response to acetylcholine stimulation [153, 154]. The inhibitory effects of Cav-1 on eNOS ac tivity can be overcome exogenously with the addition of calmodulin, suggesti ng a reciprocal rela tionship between the two proteins [150, 155157]. In support of this, co-imm unoprecipitation experiments demons trate that in the absence of calcium eNOS remains abound to Cav-1. However, stimulation of cells with calcium ionophore results in reduced formation of the eNOS-Cav-1 complex [150]. eNOS Posttranslational Modifcations Myristoylation and Palmitoylation Myristoylation is important for the subcellular targeting of proteins to membranes. eNOS is the only NOS isoform to posses an N-myrist oylation consensus sequence [158-162]. Glycine 2 (Gly-2) and serine 6 (ser-6) are the preferred substrate binding sites for N-myristoyltransferase [163]. In this regard, site directed mutagenesis studies have demonstrated that mutation of Gly-2 converts the eNOS membrane bound protein to the cytosolic form [164-166]. However, inhibiting N-myristoylation of eNOS does not effect enzyme activity [166]. eNOS palmitoylation unlike myristoylation is a reversible pr ocess. In order for eNOS to be targeted to the plasma membrane myristoylation must preced e palmitoylation [167]. Palmitoylation occurs

PAGE 35

35 at the cysteine residues 15 and 26. Mutations at these sites do not affect eNOS activity or protein trafficking to the plasma membrane [167]. The ro le of palmitoylation is to specifically target eNOS to caveolae. In support of this e xperiments done using wild type-eNOS and a palmitoylation mutant form of the enzyme, showed that the wild type enzyme colocalized with caveolin while the mutant form did not [69, 168]. Ther efore, it appears that th e first step in eNOS protein localization to the plasma membrane re quires myristoylation, which is then followed by palmitoylation, which stabilizes the enzy me and targets it to the caveolae. eNOS Phosphorylation Phosphorylation of eNOS typically occurs at se rine (Ser) residues, and less frequently at tyrosine (Tyr) and threonine (Thr) residues. Curr ently five sites on eNOS have been identified as targets for protein phosphorylation, Ser 1177 (h uman)/Ser 1179 (bovine), Ser 633 (H)/Ser 635 (B), Ser 615(H)/Ser 617 (B), Thr 495 (H)/Thr 497 (B), and Ser 114 (H)/Ser 116 (B). Ser 1177/1179 The phosphatidylinositol 3-kinase (PI3K) pathwa y was first shown to be involved in eNOS phosphorylation when it was demons trated that VEGF or insulin stimulated release of NO was attenuated by the pharmacological inhibito rs of PI3K wortmannin and LY298004 [169, 170]. The protein kinase Akt is known to be activated by PI3K and to target phosphorylation sites with the particular consensus sequen ce of RXRXXXS/T which have been identified on eNOS [171]. Two groups independently demonstrated that Ak t could directly phosphorylate eNOS at Ser1179 resulting in its activtion [172, 173]. Various s timuli including shear stress, bradykinin, VEGF and insulin activate Ser 1179 phosphorylation. It has been hypothesized that the activation of eNOS by Ser 1179 phosphorylation causes a conformati onal change in the enzyme similar to the effects caused by calmodulin binding [174]. Because of the wide variety of stimulators that can activate Ser 1179, it app ears that it is the most im portant site in the regulation of eNOS activity.

PAGE 36

36 In support of these observations, it has been dem onstrated that mutating the Ser 1179 site to an alanine thus preventing phosphorylation, leads to a reduction in ba sal and stimulated release of NO [175]. Additionally, mu tating the Ser 1179 site to aspartate to mimic the negative charge of phosphorylation, results in increased eNOS activity when stimulated with low levels of calcium [172]. Furthermore, it has been demonstrated th at adenoviral mediated ove r-expression of Akt in rabbit femoral arteries resulted in increased resting diameter of the artery [176]. Moreover, the HmG CoA reductase inhibitor simvastatin has been shown to activate Akt leading to increased eNOS phosphorylation at Ser 1179 [177]. Thr 495/497 Phosphorylation of eNOS does not only result in activation of the enzyme, as evident by the inhibitory effects of phosphorylation of Thr 495. The phosphorylation of Thr 495 is mediated through the PKC pathway [178-181]. Th e site of Thr 495 phosphorylation is located within the Ca2+/CaM binding domain, and it appears that this interferes with the binding of Ca2+/CaM to eNOS [179, 180]. The basal level of Thr 495 phosphorylation is high in cultured endothelial cells [179-181]. Vari ous agonists of eNOS such as bradykinin, VEGF and calcium ionophore have been shown to cause dephosphory lation of Thr 495 [180, 182, 183]. Also, it has been suggested that in order for eNOS ac tivation to occur Thr 495 dephosphorylation must precede Ser 1179 phosphorylation [180-184]. Ser 633/635 Phosphorylation at the Ser 633 site also enhances the activit y of eNOS. The phosphorylation site is located within the CaM autoinhibitory sequen ce of eNOS contained within the FMN binding domain [181]. There have been several studies to suggest that Protein Kinase A [74] phosphorylates Ser 633 [181, 182, 185, 186]. The same agonists that lead to the activation of NO via Ser 1177 phosphorylation also stimulate Ser 633 phosphorylation. The rate

PAGE 37

37 of phosphorylation of Ser 633 is much slower th an that of Ser 1177 after agonist stimulation. Additionally, phosphorylation of Ser 633 by PKA in endotheli al cells can increase NO production without requiring increased intracellular Ca2+ levels [186]. Ser 615/617 Ser 617 phosphorylation also occurs in the CaM autoinhibitory sequence of the CaM binding domain, however there is controversy over its function [181]. Various eNOS agonists similar to the ones that trigger enzyme Se r 633 and Ser 1179 phosphorylation also increase phosphorylation at the Ser 617 site [175, 181, 182]. One study showed that mimicking the phosphorylation of Ser 617 with a serine to aspartate mutation increases Ca2+/CaM sensitivity of eNOS, but not the overall activity of the enzyme [181]. In contrast, another study demonstrated that phosphorylation at Ser 615 doe s increase eNOS activity. However, it was observed in the same study that the serine to alanine muta tion mimicking dephosphorylation also increased enzyme activity [175]. Moreover, the dephosphoryl ation of Ser 615, led to increased recruitment of Hsp 90 and Akt both which are know to activat e eNOS [175]. These observations suggest that the role of Ser 615 phosphorylation is to facilitate eNOS inter action with other proteins and regulate phosphorylation at other sites. Ser 114/116 The final identified site of eNOS phosphoryl ation occurs at Ser 116 and it is the only known phosphorylation site in the oxygenase domain of eNOS. Currently, its role in eNOS activity much like Ser 615 phosphorylation is contr oversial. eNOS activation due to VEGF is associated with Ser 116 dephosphorylation [187]. Laminar shear stress and HDL exposure on the other hand have been reported to cause phosphorylation of Ser 116 leading to eNOS activation [188, 189]. Reports on Ser 114 to al anine mutations mimicking dephosphorylation also conflict, with one study showing increased activity and the other re porting no change in

PAGE 38

38 activity, but increased NO rel ease [175, 187]. These conflicting results suggest that further studies need to be done to elucidat e the role of Ser 114/116 phosphorylation Overall the regulation of eNOS has develope d into this complex story that involves protein-protein interactions, substrate ability and protein posttranslational modifications. This tight regulation is necessary to maintain vascular homeostasis. However, loss of this regulation has been implicated in the pathology of many diseases that eventually lead to vascular endothelial dysfunction, CAD, myocardial infractions, he art failure and even death. Pathophysiology As previously stated, eNOS and its product NO are important for maintaining vascular homeostasis. Given its significance it is important that a healthy environment is maintained within the endothelium. However, it is known that in a variety of conditions such as diabetes, chronic smoking, hypertension, and hypercholesterolemia the endothelium environment loses its anti-atherogenic, anti-proliferative, and anti-thrombotic properties. Vascular endothelial dysfunction is the common link seen in the pathology of all of th ese diseases and it is the underlying cause to the more seriou s vascular disease, atherosclerosis. The exact mechanism as to how endothelial dysfunction is caused is not kn own. However, there is growing evidence that oxidative stress which subsequently leads to th e loss of NO plays a significant role. Although oxidative stress can be caused by a variety of ROS generating en zymes, studies have implicated NAPDH oxidase as the main source of ROS in vascular diseases. The increase in ROS generated from NADPH oxidase ha s also been implicated in pl aying a role in NOS uncoupling by causing the oxidation of th e essential NOS cofactor H4B. The depletion of H4B results in decreased NO bioavailability and increased e NOS derived superoxide. This loss of NO bioavailability and the increase in superoxide production results in an endothelium that is no longer able to maintain homeosta sis. Moreover, this change in vascular homeostasis results in

PAGE 39

39 impaired vascular relaxation and increased vasc ular damage eventually leading to vascular remolding, which are all characteristic signs of endothelial dysfunction. Pathways Leading to Oxid ative Stress Generation NADPH Oxidase The NADPH Oxidase (NOX) isof orms NOX-2 and NOX-4 are both found to be highly expressed in the endothe lial cell. NOX-2 requires the transl ocation of many regulatory subunits to the cytosol to become active, t hose subunits include p22phox, p47phox, Rac, p67phox and p40phox [190]. Upon assembly of the complex, electrons from NADPH are transferred to molecular oxygen to form O2 -.NOX-4 expression on the other ha nd is greater than NOX-2 in the endothelial cell. It also app ears that NOX-4 is a constitutively active enzyme [191]. Furthermore, it does not require any of the cy tosolic subunits that are required for NOX-2 activation [192]. Though ROS can be generated from other superoxide generating enzymes, NOX has emerged as the main culprit, because its activity can be stimulated by many of the substrates involved in vascular endothelial dysfunction such as oxLDL, ANG II, and TNF alpha. In the endothelial cell a key event leading to NOX-2 activati on is the phosphorylation of p47phox [193]. The phosphorylation of this subunit has been shown to occu r in the response to ANG II, TNF alpha and VEGF [193-195]. In arteries of atherosclerotic patient s NOX-2 and NOX-4 expression is increased particularly in the shoulder region of the plaque. The increased expression of these isoforms may also contribute to plaque erosion [196]. Fu rthermore, there is evid ence to support that there is a local increase in the renin angiotensin system in the tissue peri phery associated with hypercholesterolemia, as increased concentratio ns of Ang II are also observed the shoulder region of plaques [197, 198]. Moreover, the expr ession of the angiotensin type I receptor is increased in the platelets of hypercholesterolemic patients [199].

PAGE 40

40 In addition to being a producer of O2 .-, NOX derived O2 .can also quench eNOS derived NO, resulting in the formation of OONO-. OONOcan subsequently oxidize lipoproteins in the vasculature, which become trapped in the endot helium, leading to endothelial activation. This activation causes an increase in expression of atherogenic prot eins such as VCAM-1, P and E selectin, and chemoattactants thus continuing the cy cle of vascular injury and repair resulting in atherosclerosis [200]. Additionally OONOhas been demonstrated to cause eNOS uncoupling by directly oxidizing the NOS cofactor H4B [201]. eNOS Uncoupling eNOS uncoupling was first shown to occu r by two independent groups using purified eNOS. Both groups demonstrated that eNOS depleted of H4B could catalyze O2formation primarily from the oxygenase domain [50, 51]. Fu rthermore, the first evidence of eNOS uncoupling in-vivo was generated with the desoxy corticosterone acetate (DOCA) salt induced model of hypertension demonstrating that vascular superoxide production was increased ,which could be attenuated by the NOS inhibitor LNAME [202]. Besides hypertension there is evidence to support a role for eNOS uncoupling to occur in the pathology of diabetes, and hypercholesterolemia. Studies carried out in endothe lial cells derived from diabe tic mice provided early evidence for altered H4B metabolism and NO producti on in diabetes. Despite having normal eNOS protein levels, cells derived from the di abetic mice had decreased NO production and H4B levels. Moreover, supplementation with the H4B precursor was able to re verse these effects [203]. Additional studies carried out in human aortic endothelial cell s (HAECs) demonstrated that following 48 hours of exposure to high glucose me dia, eNOS expression was increased while H4B levels were decreased and eNOS derived O2 .was increased. Adenoviral mediated overexpression of GTPCH I wa s able restore NO and H4B levels and suppress O2 .generation [121].

PAGE 41

41 In vivo studies have also provi ded further evidence that diabetes can result in altered H4B levels and increased O2 .generation. In this regard, endothel ium specific GTCPH transgenic mice have been generated. These mice have been observed to have increased H4B levels in vascular tissue [49]. To evaluate the effect of H4B bioavailability, diabetes was induced using the streptoztocin experimental model. The vasculat ure of both control and diabetic mice exhibited increased oxidative stress. While H4B levels were undetectable in control diabetic mice, the GTPCH tg diabetic mice maintained modest H4B levels. Moreover, these mice exhibited decreased eNOS dependent O2 .generation in the vascular endothelium and increased endothelium dependent vasorelaxtion in respons e to acetylcholine (Ach ) [204]. Finally in patients with Type II diabetes, H4B infusion has been shown to reverse vascular endothelial dysfunction via a NO-dependent mechanism [205]. In addition to being observed in both in-vivo and in-vitro models of diabetes several studies have also demonstrated that eNOS uncoupling occurs in atherosclerosis. The pathology of hypercholesterolemia is asso ciated with impaired vascular function, atherosclerosis, decreased H4B bioavailability and increased O2 .generation. In this regard, the hypercholesterolaemic ApoE KO mice exhibit im paired vascular relaxation and increased vascular superoxide production. Both of which can be attenuated by oral H4B supplementation [53]. Furthermore, when ApoE KO mice are crossed with GTPCHtg mice, these mice were observed to have a improved vascular relaxatio n response to Ach. Additionally these mice had increased H4B levels and decreased O2 .generation in the vasc ular endothelium [206]. Moreover, when eNOS tg mice are crosse d with ApoE KO mice, the progression of atherosclerosis is accelerated and these mice also have increased O2 .generation, which is improved following H4B supplementation [207]. In a ddition to the animal studies,

PAGE 42

42 administration of H4B in patients with hypercholesterolemia has been shown to improve vascular endothelial dysfunction [103]. The ratio between H4B and H2B is another important trigger for eNOS uncoupling. Recently, it has been de monstrated that H4B and H2B can bind eNOS with equal affinity. Additionally, intracellu lar levels of H2B increased 40% after 48 hour s of high glucose treatment and this was associated with reduced NO activation and increased eNOS dependent O2production. [208]. Over all these studies suggest that it is not only important to maintain the levels of H4B, but the ratio of H4B/ H2B may also be important in maintaing NO production. Over all the studies presented in the secti on demostrate that oxi dative stress plays a significant role in vascular endothelial dysfunc tion. However, increasing evidence also supports the role for the endogenous NOS inhibitors the methylarginines ADMA and L-NMMA in the pathophysiology of endothelial dysfunction. DDAH ADMA Pathway The endogenous NOS inhibitor AMDA has been demonstrated to be an independent cardiovascular disease risk fact or. However, the mechanisms regarding how ADMA levels are modulated and what role they play in disease progression are not clearly understood. Therefore, ADMA accumulation in response to decreased DDAH expression/activity has been proposed to be involved in the vascular pat hophysiology observed in a variety of cardiovascular disease. The following section will describe th e production and function of the methylarginines. Futhermore, the signficance of the methylarginine metabolizing enzyme DDAH will be described. Finally, this section will end with studies describing the pathophysiology associated with increased levels of methylarginines and decreased DDAH activity.

PAGE 43

43 PRMT The methylation of protein ar ginine residues is carried ou t by a group of enzymes referred to as protein-arginine methyl transferases (PRM Ts). To date, nine di fferent isoforms of the enzyme have been identified with each subtype exhibiting various levels of activity, substrate specificity and tissue distribution. During PRMT catalysis S-adenosylmethionine serves as its substrate (SAM) and is then subsequently conv erted to S-adenosylhomoc ysteine (SAH), which is then enzymatically converted to homocysteine, which is either further metabolized, or remethylated [5]. PRMTs are separated into two classes depe nding on what type of methylarginine they generate. In mammalian cells, these enzymes have been classified into type I (PRMT1, 3, 4, 6, and 8) and type II (PRMT 5, 7, and FBXO11) enzymes, depending on their specific catalytic activity. Both types of PRMT, however, catalyze the formation of monomethylarginine (MMA) from L-Arg. In a s econd step, type I PRMTs produce asymmetric dimethylarginine (ADMA), while type II PRMT catalyzes symmetric dimethylarginine (SDMA) [209]. Arginine methylation by bo th type of PRMTs enzyme o ccurs mostly in the arginineglycine rich sequences of prot eins [210, 211]. PRMT 1 is a me mber of the type I class of PRMTs and it specifically cata lyzes the formation of L-NMMA and ADMA [212].The PRMT 1 enzyme is mostly expressed in the heart and testis [213]. Intracellularl y, PRMT 1 is expressed predominantly in the nucleus with partial expression in the cytoplasm [214]. During development the expression of PRMT1 is essential, as PRMT1 KO mice have been observed to be embryonically lethal [215]. Until recently pr otein arginine methylation was thought to be irreversible. Recently, the Jumonji domain-contai ning protein 6 (JMJD6) has been identified as a histone arginine demethylase, whether or not this has implications for intracellular protein arginine methylation is unknown [216]. The relationship between PRMT1 activity, expression and ADMA synthesis has been demonstrated in several studies. Specifically, it has been

PAGE 44

44 observed in HAECs following 24 hour incubatio n with either LDL or OxLDL within the pathological range of 200-300 mg/dl that PRMT 1 mRNA expression in creases 1.5-2.5 fold. Furthermore, ADMA released into the media in creased 2 fold following the 24 hour incubation period. The increase in ADMA coul d be attenuated in the presence of the PRMT inhibitor SAH [217]. In human umbilical vein endothelial cells (HUVECs) expos ure to shear stress has been demonstrated to increase gene expression of PRMT-1. Furthermore, low levels of shear stress (5-15 dynes/cm2) increases ADMA release from HUVEC cells after 3-6 hours of exposure. In contrast, high shear stress (25 dynes/cm2) does not result in increased release of ADMA. [218]. Methylarginine Biochemistry The free methylarginines ADMA, L-NMMA, a nd SDMA are all transported through the y+ CAT transport system. However, only ADMA and L-NMMA competitively compete with LArg for binding to eNOS, resulting in its in hibition. Inhibition of eNOS activity by the methylarginines is reversible, but only under co nditions in which excess L-Arg is added. In support of the role of methylarginines in eNOS inhibition, several studies have reported that LArg supplementation enhances endothelium dependent relaxation through increased NO generation. However, considering that the intracellula r concentrations of L-Arg is 50 times higher than the Km for eNOS, increased NO generation would not be expected with L-Arg supplementation; this phenomenon has been termed the L-Arg paradox [38]. Therefore, it is hypothesized that L-Arg supplementation overcom es the endogenous inhibitory actions of cellular methylarginines ADMA and NMMA [42]. However, whether or not these endogenous methylarginines are present at conc entrations sufficient to regula te eNOS is unclear. In this regard, it has been reported that plasma leve ls of ADMA and L-NMMA are in the range of 0.51M in healthy individuals [219]. We have demo strated in studies from our lab that the basal endothelial cells level of ADMA and L-N MMA were 3.6 M and 2.9 M respectively.

PAGE 45

45 Furthermore, our kinetic studies using purified eNOS demonstrated that the Ki for ADMA and LNMMA were 0.9M and 1.1M respectively [38]. Theref ore, it is expected that under normal physiological conditions that met hylarginines would not have a si gnificant affect on endothelial NO production. In support of this, it has been demonstrated that at low concentrations of methylarginines modest inhibi tion of NO production is observed. In isolated human blood vessels, 1 M of L-NMMA leads to inhibition of bradykinin induced vasodilatation by 20% [220]. Simlar reports from a study using plasma from end stage renal paitents have shown that plasma levels of ADMA of 2M, can have a si gnificant inhibitory effect on endothelial NO production [221]. Additionally, in the circula tion of the guinea-pig 10 M ADMA was observed to increase blood pressure by 15% [222]. A lthough, studies have demonstrated modest inhibition of eNOS at physiological concentrations of methylargini nes, there have been several reports of increased methyl arginine levels in various disease states including hypercholesterolemia, diabetes and end stage renal disease. In the disease state plasma met hylarginine levels have been re ported to increase 3 to 9 fold [38]. It remains unclear whether or not increas es in methylarginine levels will result in significant inhibition of endothe lial NO production. Recently, we have addressed this question in cellular studies in an effort to determine th e dose dependent effects of the methylarginines on endothelial NO production. Previous studies suggest that compartmentalization of eNOS or LArg may occur in the endothelial cell, limiting the ability of LAr g to overcome the inhibition of methylarginines on eNOS activity. Therefore, cellular studies we re carried out in order to determine the effective concentration of cellu lar methylarginines necessary to cause eNOS inhibition in BAECs. Our resu lts demonstrated that ADMA dos e dependently inhibited eNOS derived NO generation as 5 M and 100 M ADMA elicited a 38% and 74% inhibition,

PAGE 46

46 respectively. Similar results were obtained wi th L-NMMA, as 42% and 81 % inhibition was seen with 5 M and 100 M L-NMMA respectively. In the presence of L-Arg these effects were less prominent. ADMA dose dependently inhibi ted eNOS derived NO 24% at 10M ADMA and 52% at 100 M. Similar results were obtained fo r L-NMMA with 17% inhibition observed at 10 M L-NMMA and 63% at 100 M. These results we re surprising to us because based on kinetic studies we did not expect to see such robust in hibition of endothelial NO production. This led us to speculate that endothelial cells are able to concentrate methylarginine s. Therefore, cellular uptake studies were preformed. Our results dem onstrated that in the absence of physiological levels of L-Arg, 10 M of exogenous ADMA resulted in intracellular AD MA concentration of 68.4 M. When this same experiment was repeat ed in the presence of L-Arg (100 M), 10 M ADMA resulted in a markedly lower intracellu lar ADMA concentration of 23.5 M [38]. Additional studies were also performed with L-NMMA. Intracellular concentrations of LNMMA sometimes reach as much as 7 times highe r than outside the cell Moreover, L-NMMA (10 M) uptake was only inhibited by 65% in the presence of L-Arg (100 M). As previously mentioned the methylarginines along with L-Arg are all tran sported through the y+ transporter. Therefore our results would indicate that even in the presence of L-Arg, elevated plasma levels of methylarginines would result in increased uptake through the y+transporter resulting in even higher intracellular levels Moreover, this increased uptake through the y+ transporter represents a novel mechanism by which methylarginines ca n modulate eNOS activity and endothelial NO production. Overall our studies sugg est that under pathological conditions such as hypercholesterolemia, and diabetes where methylar ginine levels are incr eased, methylarginines can modulate eNOS activity. Because NO is known to possess anti-proliferative and anti-

PAGE 47

47 atherogenic properties, methylarginine accumulation could play a significant role in development of atherosclerosis. Metabolism of Methylarginines Initially it was believed that after proteoly sis, free methylated arginine residues were released and excreted through the kidney [223]. On the contrary, subsequent studies into methylarginine metabolism in rabbits demonstrat ed that the urinary excretion of SDMA was 30 times greater than ADMA and L-NMMA excretion. This led to the assumption that ADMA and L-NMMA were being metabolized through alternate pathways [224]. These early studies led to further investigations into the metabolic fate of C14 labeled ADMA and SDMA. Sasaoka et al. demonstrated that while both di methylarginines could be metabol ized by the Dimethylarginine: pyruvate Aminotransferase pathway, there existe d a specific pathway for ADMA metabolism. In support of this they found that the radioactivity that remained in the tissue of ra ts injected with 14C ADMA consisted mainly of citrulline, in co mplete contrast to rats injected with 14C SDMA [225]. After the identification of this alternative pathway, DDAH was identified as the metabolizing enzyme of ADMA and was purif ied from the rat kidney [226]. It was demonstrated that DDAH specifically hydrolyzed ADMA and L-NMMA to citrulline, and mono and dimethylamine. Until recently, DDAH enzyme activity studies have only been performed on bacterial sources and tissue homogenates from eith er rat kidney or porcine brain. Those studies reported that DDAH hydrolyzes ADMA at a faster rate than L-NNMA with reported Km values of 0.18 and 0.36 mM respectively and that it is responsible for >90% of ADMA metabolism [224, 225, 227]. We have recently purified the human isoform of DDAH-1 (hDDAH-1) and in contrast to previous studies we observe d that hDDAH-1 hydrolyzes ADMA and L-NNMA at similar rates 68.7 M and 53.6 M respectively [ 228]. Furthermore, we observed that hDDAH-

PAGE 48

48 1 is maximally active at pH 8.5, c ontrasting earlier reports that enzyme maximum activity at pH 5.2 to 6.5 [225, 229]. DDAH-1 contains a Zinc (II) binding site, with endogenous bound Zinc(II) inhibiting its catalytic activity [230]. Birdsey et al and Murray-Rust et al. were the first to demonstrate that ADMA and not SDMA coul d be metabolized intracellularly [231, 232]. Additional studies by Murray-Rust et al, demonstrat ed that steric hindrance caused by the methyl groups on both nitrogens of SDMA prevents its binding to the activ e site of DDAH, therefore it is unable to hydrolyze it [232]. In observance that DDAH expression did not corr elate to activity, Leiper et al. discovered a second isoform of DDAH, DDAH-2. DDAH-2 ha s a 63% homology to hDDAH-1. Currently there are no studies on the enzyma tic activity of human DDAH-2, as the only study that has been done uses recombinant bacterial lysates that e xpress DDAH-2. Enzyme activity from bacterial lysates demonstrated that DDAH2 hydrolyzed L-NMMA at the co mparable rates to reported DDAH-1 in bacterial lysates [36]. DDAH-1 and 2 are predominantly located in the cytoplasm, DDAH-1 has also been found in membrane fractions of endothelial cell lysate s [231]. DDAH-1 is pred ominately expressed in the liver and kidney which are major sites of ADM A metabolism [233, 234]. It is also expressed strongly in the aorta and equally in adult a nd fetal tissues [235, 236]. DDAH-2 expression is predominant in fetal tissues. However, expression decreases and becomes more tissue specific in adults with DDAH-2 expression pr edominately in the vascular endothelium, kidney, heart, and placenta [36]. DDAH-1 while it is also expresse d in the endothelium, studies of mesenteric resistance arteries demonstrat e that DDAH-2 mRNA expr ession is 5.1 fold greater than that of DDAH-1 suggesting an important role for DDAH-2 in the resistance vessels [237].

PAGE 49

49 In Vivo and In Vitro Significance of DDAH The first functional studies of DDAH-1 were done using the inhibitor S-2-amino-4 (3methylguanidino) butanoic acid (4124W). Treat ment with 4124W in cultured human endothelial cells led to accumulation of ADMA in the supern atant thus demonstrati ng that the role of DDAH-1 was to prevent the accumulation of ADMA. Ex-vivo studies using rat aortic rings demonstrated that inhibition of DDAH-1 by 4124W caused vasoconstriction. However, this effect was reversed in the presence of LArg. Additional studies done on human saphenous veins demonstrated that inhibition of DDAH-1, led to the loss of the bradykinin mediated relaxation response [238]. These studies were among the first to demonstrate that DDAH could be important in the regulation of endothelial NOS activity and vascular function. Recently, the in-vivo significance of DDAH-1 has been desc ribed by two independent groups using both transgenic and knockout mice [239, 240]. Dayoub et al described the effects of DDAH -1 over-e xpression in-vitro and in-vivo, with the creation of DDAH-1 transgen ic mouse model. Cellular studies performed in human microvascular endothelial cells and murine endo thelial cells demonstrated that over-expression of DDAH-1 yields a 2-fold increase in NO activity and Nitrogen Oxides (NOX) released into the culture media. The in-vivo studies demons trate that DDAH-1 tg mice have increased NOS activity in the heart and skeletal muscle however, no change was seen in the aorta. DDAH-1 tg mice also have decreased mean arterial blood pressu re (MAP). The systemic vascular resistance (SVR) and cardiac contractility are also decreas ed in response to an increase in NO production. Furthermore, it was observed in DDAH-1 tg mice, that urinary excretion of NOX was increased 2 fold, and this corresponded to a 2-fold drop in plasma ADMA levels [239]. Additional studies done by Jacobi et al. demonstrated that DDAH-1 tg mice exhibit enhanced angioadapatation in response to hind limb ischemia [241]. Subse quent studies by Tanaka and Sydow et al.,

PAGE 50

50 demonstrated in a cardiac transplantation model that DDAH-1 tg mice exhibit suppressed immune responses as result of increased ca rdiac NO generation and decreased superoxide production. Also, these mice exhibi ted less graft coronary artery disease, and improved function of the allograft [242]. In more recent studies, Lieper et al have de monstrated the in-vivo effects of DDAH-1 gene deletion in mice. The first si gnificant finding of this study wa s that homozygous deletion of the DDAH-1 gene was embryonically lethal. Demons trating that DDAH-1 is essential to normal embryonic development. Therefore, subsequent studies where performed with DDAH 1+/mice. The DDAH-1 +/mice exhibit increased plasma leve ls of ADMA, indicative of DDAHs role in regulating ADMA levels. DDAH-2 expressi on was not altered by the drop in DDAH-1 expression. Tissue DDAH activity in the kidney, lung, and liver was decreased by approximately 50% suggesting that DDAH-2 is not the principle methylarginine metabolizing enzyme in these tissues. Additionally, it was observed that these mice exhibited impaired vascular relaxation in response to Ach treatment. Moreover, hemodynamic studies reveal that mean arterial blood pressure (MAP), systemic vascular resistance (SVR ) and right ventricular pressure are all increased in the DDAH 1 +/mice [240]. Hasegawa et al recently created a transg enic mouse over-expressing the DDAH-2 gene. They have reported that DDAH-2 tg mice have reduced plasma ADMA levels and an elevation in cardiac NO levels. However, in contrast to DDAH-1 mice, there was no change in systemic blood pressure. The difference seen in two models is likely to be due to the fact that plasma ADMA levels are vastly different in these tw o mice. In the DDAH-1tg ADMA plasma levels decreased by 60%, whereas DDAH-2 tg mice plasma ADMA levels were only reduced by 26%. This further provides evidence that DDAH-1 is the principle methylarginine metabolizing

PAGE 51

51 enzyme. The expression of DDAH2 was significantly increased in the heart, skeletal muscle and brown adipose tissue. They also reporte d that DDAH-2 over-expression did not alter the expression of DDAH-1. Furthermore, ADMA induced vascular lesions were attenuated in the DDAH-2tg mice, which they attributed to decrease in angiotensin converting enzyme expression [243]. ANG II infusion over a tw o week period induced increas ed medial thickening and perivascular fibrosis in co ronary microvessels of WT mice, however this response was attenuated in DDAH-2 tg mice [244]. Studies done by Wang et al. repor ted that in-vivo DDAH-2 gene silencing in rat mesenteric arteries caused almost complete inhibition of the NO response to Ach in vascular reactivity studies. They also reported DDAH-1 gene sile ncing increased ADMA, however it had no effect on vascular relaxation in respons e to Ach [237]. As demonstrated in the previous study by Hasegawa et al., this study provides more evidence that DDAH-1 is the predominate metabolizing enzyme of ADMA. In addition, th is study provides some evidence that DDAH-2 regulates endothelial NO production independent of ADMA, because ADMA levels did not rise following DDAH-2 gene silencing. ADMA Independent Mechanisms of DDAH Wang et al. reported that DDAH-2 gene silencing in mesenteric resistance vessels lead to a significant down-regulation of eNOS mRNA and protein expression [237]. Smith et al. observed that DDAH-2 over-expression in HUVEC cells lead to a 2-fold increase in VEGF mRNA expression [245]. Later it was reported by Ha segawa et al. that DDAH-2 over-expression in BAECs increased transcriptional activation of VE GF, without increasing NO generation. In this study they observed that DDAH-2 mediated its effects by directly binding PKA leading to the phosphorylation of the transcription factor specificity protein 1 (S p1). Sp1 translocates to the nucleus and binds the promoter region of VEGF activating its transcription. They also

PAGE 52

52 demonstrated that the DDAH-2 effect on VEGF transcription is bloc ked by gene silencing of Sp1 [246]. Tokuo et al reported that DDAH-1 in a similar fashion, binds to nuerofibromin 1 (NF-1) in a region coinciding specific sites of PKA phosphorylation. DDA H-1 binding to NF-1 increases NF-1 phosphorylation by PKA. Overall these studies demonstrate that DDAH can mediate its effects indepe ndent of ADMA [247]. Regulation of DDAH Activity Given the importance that DDAH plays in ma intaining NO levels in the vascular endothelium, extensive research efforts have been undertaken to study its re gulation. Leiper et al. were the first to report th at NO could inactivate DDAH-1 by SNO of a cysteine (Cys) residue. Cys 249 is located with in the active site of th e DDAH-1 enzyme. It wa s observed in this study using recombinant bacterial protein expressing D DAH-1 that SNO occurs at the Cys 249 residue, rendering the enzyme inactive [88]. Additional studies done usi ng mouse endothelial cells overexpressing DDAH-2 demonstrated that cytokine mediated induc tion of iNOS resulted in the SNO of DDAH-2 [88]. Thus, under conditions of enhanced immune response which leads to iNOS induction, inhibiting DDAH activity would be beneficial; because of the accumulation of ADMA which would be expected to inhibit iNOS derived NO. Knipp et al. observed that DDAH-1 in its native form, Zn (II) bound, is resistan t to SNO and it is the zinc depleted form that is susceptible to [248]. It has also b een suggested that DDAH activity maybe sensitive to oxidative stress. However, studies from our lab and others have shown that DDAH is largely resistance to oxidative species at pathophysiological levels [228, 249]. Studies by Scalera et al. demonstrated that the anti-hypertensive drug, Telmisartan, can positively regulate DDAH. Although Telmisartin is known to function as an ANG II type 1 receptor blocker, it has also been found to activ ate PPAR y. PPAR y signaling is associated with increased NO formation. In this study they observed that in the pr esence of Telmisartin, DDAH

PAGE 53

53 activity increased and DDAH-2 expression also in creased. However, PPARy inactivation either pharmacologically or by gene silencing mitigat ed the effects on DDAH activity and expression [250]. Yin et al. reported that pravastatin a cholesterol lowering drug, restores DDAH activity and endothelium relaxation in the rat aorta follow ing exposure to glycated bovine serum albumin (AGE-BSA) [251]. Achan et al. re ported that all-trans-retinoic acid could transcriptionally regulate DDAH II, increasing its mRNA expression in HUVECs [252]. Additional studies by Jones et al. demonstrated that there are si x single nucleotide polym orphisms(SNP) in the promoter region of the DDAH-2 gene [253]. Furthermore, they observed that the 6G/7G insertion/deletion SNP at position -871 in the prom oter region of the DDAH-2 gene, resulted in enhanced promoter activity [253]. Valkonen et al. observed in the Kuopio Ischemic Risk Factor Study that 13 male patients were carriers of a of DDAH-1 gene varient that put them at 50 times greater risk for cardiova scular disease [254]. Overall these studies suggest that ADMA a nd DDAH may play a role in endothelial dysfunction. The next section will help to provide further evidence as to the excat role of ADMA and DDAH in the disease state. Pathophysiology Clinical syndromes involving defective NO productions underscore the importance of eNOS and NO in the maintenance of normal vascular function. Although it is well established that NO is a critical effector molecule in the ma intenance of vascular t one, NO also maintains the non-atherogenic character of the normal vessel wa ll. Several studies have linked ADMA and LNMMA as key players in endothelial dysfunction. Epidemiological studies have demonstrated a strong correlation between plasma ADMA and incidence of cardiovascular disease. Initia l studies by Boger et al. demonstrated that the plasma ADMA levels of young hypercholesterolemic individuals were double that of

PAGE 54

54 normocholesterolemic patients [255]. The in crease in ADMA in the hypercholesterolemic patients resulted in impaired endothelium depe ndent response and reduced nitrate urinary excretion. The effects on nitrate urinary excre tion and vascular function, improved following LArg supplementation [255]. Subsequent studies by Zoccali et al. were the first to establish ADMA as an independent risk factor for cardiovasc ular disease in patien ts with chronic kidney disease [256]. Lu et al. observed in patients following angiop lasty that ADMA was the sole predictor of future cardiovascular events [257]. Studies by Valkone n et al. demonstrated that in healthy non smoking men, those in the highest quartile of ADMA plasma levels, had a 3.9 fold increase in risk of acute coronary ev ents [254]. Studies by Abbasi et al. reported that type II diabetic patients, have increased ADMA plasma levels in comparison to healthy individuals. Additional studies of obese woman found that wo men who are insulin resi stant and obese have higher plasma ADMA levels and that ADMA levels decreased following weight loss [258]. In support of these epidemiological studies, in vitr o and in vivo data has shown similar effects of ADMA on endothelial function in several disease states. Chan et al. demonstrated that blood monoc ytes from hypercholesterolemic individuals adhered to human endothelial cells in culture greater than normo cholesterolemic [259]. This increase in adhesion of monocytes is one of th e initial steps in the pr ogression of endothelial dysfunction and atherosclerosis. Furthermore, they observed that the adhesion was related to the L-Arg/ADMA ratio. In support of this, monocytoi d cells were co-culture d with BAECs exposed to the corresponding L-Arg/ADMA ratios of the hype rcholesterolemic patients. It was observed that the adhesion of monocytoid cells increa sed in a dose dependent manner. Following the initial adhesion studies patients were placed on 12-weeks of L-Arg supplementation which resulted in the normalization of monocyte adhesi on [259]. Studies by Azuma et al. demonstrated

PAGE 55

55 that ADMA and L-NMMA levels were increased in regenerated endothelial cells following balloon angioplasty of the rabbit carotid artery. Furthermore, L-Arg levels were significantly depleted in regenerated endothelial cells which resulted in increased neointima formation. The accumulation of ADMA and L-NMMA in these rege nerated cells led to decreased endothelium dependent relaxation, which was attenuated with L-Arg supplem entation [260]. Overall these studies suggest that the L-Arg/ADMA ratio is an important pred ictor of endothelial dysfunction. To add physiological relevance to our biochemist ry studies discussed earlier, we wanted to examine whether or not methyl arginines inhibition on eNOS could modulate a physiological response. Therefore changes in vascular r eactivity in rat carotid rings under varying concentrations of ADMA (1-500 M) were obs erved. ADMA dose dependently inhibited the Ach mediated relaxation response with a 52% reduction seen at 5 M ADMA and a 95% reduction at 500 M, in the absence of L-Arg. In the presence of L-Arg 10 M ADMA inhibited the Ach mediated relaxation response by 7%, a nd an 84% reduction was seen at 500 M. Because our studies in vitro and ex vivo dem onstrated that ADMA could inhibit eNOS, it was unclear if this could occur in-vivo. Using the balloon model of carotid injury we observed that intracellular methylarginine levels increased 4 fo ld and resulted in a 50% loss of vasculature relaxation response. Overall these results demonstr ated that intracellular methylarginine levels are elevated in pathological conditions and that the levels reach high enough to inhibit endothelial NOS activity and vasc ular function. In addition to increased plasma ADMA levels, dysfunction of the DDAH enzyme and its ADMA independent effects on NO have become a potential mechanism by which endothelial dysfunction can occur. Ito et al. demonstrate in HUVEC cells that following 48 hours of exposure to either oxLDL or TNFalpha the activity of DDAH decreased but expression remained unchanged [261].

PAGE 56

56 Furthermore, they observed in-vivo that New Zealand White rabbits fed on high-cholesterol diet had significantly reduced aortic, renal, and he patic DDAH activity [261]. These studies were the first to demonstrate that DDAH activity could be modulated under pathological conditions. In transplant patients there is an increased incidence of transplant atherosclerosis as a result of the cytomegalovirus (CMV), which is know n to promote atherogenesis [262].Weis et al. demonstrated that human microvascular cells in fected with CMV, resulted in increased ADMA and decreased cellular DDAH activ ity [263]. Therefore, these studies demonstrate that CMV infection contributes to endotheli al dysfunction and transplant athe rosclerosis that is observed in heart transplant patients by m odulating the DDAH-ADMA pathway. Although previous studies using purfied human DDAH enzyme have demonstrated that DDAH was largely resistant to reactive oxygen and nitrogen speci es, it may be the oxidatively modified products of these reactions that influence DDAH activity [249]. 4-hyrdoxy-2-nonenal (4-HNE) is a lipid hydroperoxide that is bi ologically active and known to accumulate in membranes at concentrations 10 M to 5 mM. Mounting evidence s uggests that reactive aldehydes such as 4-HNE play a role in the progression of atherosclerosis. We have demonstrated using purified hDDAH-1 that 4-HNE inhibits DDAH activity by binding a histidine residue in the catalytic triad of the enzyme [228]. Ther efore, this may represent a novel mechanism by which 4-HNE causes impairment of endothelial NO production, by directly inhibiting DDAH activity. In contrast to our studi es, Tain et al reported that DDAH activity was signficaltny inhibited in the presence of NO and O2 .. The differences could be attributed using either using purified recombinant enzyme, or speci es differences as their studies were done using kidneys from rats [264]

PAGE 57

57 Recent evidence suggests that the DDAH-ADMA pathway may also play a significant role in endothelial dysfunction associated with diabetes Lin et al. demonstrated that in VSMC and HUVECs cellular ADMA levels increased and DDAH activity decreased following 48 hours of exposure to high glucose media. Furthermore, they observed in vivo that rats placed on a high fat diet and injected with stre ptozotcin to induce type II diab etes, had elevated plasma ADMA levels. Moreover, these diabetic rats had decr eased tissue DDAH activity [265]. Sorrenti et al. demonstrated that DDAH-2 expression and DDAH ac tivity were decreased in human iliac artery cells following five days of exposure to high glucose conditio n media [266]. Overall, these studies suggest that methylargi nines are key in regulating eNOS in a disease state. Based on cellular kine tic studies from our group, a 3-4 fold increase in cellular methylarginines would be expected to i nhibit NOS activity by greater than 50%. It is evident that that NO bioavailability is key to maintaining the anti-atherogenic state of the vascular wall. Furthermore, DDAH and ADMA have emerged as critical factors in diseases associated with increased cardiovascular risk. It is also evident that oxid ative stress also plays a significant role in endothelial dys function observed in such dieases as hypertension and diabetes. The observations provided in th is dissertation could be of pot ential clinical importance as CAD is the number cause of all deaths in the United States. Theref ore, elucidating the mechanism(s) of how eNOS is modulated by bo th methylarginines and oxidative stress may provide knowledge for potential therapeutic targets in the treatment of athero-proliferative disorders such as atherosclerosis. .

PAGE 58

58 CHAPTER 3 ROLE OF DDAH-1 AND DDAH-2 IN THE REGULATION OF ENDOTHELIAL NO PRODUCTION Introduction Endothelium-derived Nitric Oxide (NO) is a potent vasodilator th at plays a critical role in maintaining vascular homeostasis through its an ti-atherogenic and anti-p roliferative effects on the vascular wall. Altered NO biosynthesis has been implicated in the pathogenesis of cardiovascular disease and evidence from animal models and clinical studies suggest that accumulation of the endogenous nitric oxide synthase (NOS) inhibitors, asymmetric dimethylarginine (ADMA) and NG-monomethyl arginine (L-NMMA) contribute to the reduced NO generation and disease pathogenesis. ADMA and L-NMMA are derived from the proteolysis of methylated arginine residues on various proteins. The methylation is carried out by a group of enzymes referred to as protein-arginine methyl transferases (PRMTs) [35]. Protein arginine methylation has been identified as an important post-translational modification involved in the regulation of DNA transcrip tion, protein function a nd cell signaling. Upon proteolysis of methylated proteins, free methylarginines are releas ed which can then metabolized to citrulline through th e activity of Dimethylarginine Dimethylamino Hydrolase (DDAH). Currently there are two known isoforms of D DAH each having different tissue specificity. DDAH-1 is thought to be associated with tissues that express high leve ls of Neuronal Nitric Oxide (nNOS), while DDAH-2 is thought be associ ated with tissues that express eNOS. Decreased DDAH expression/activity is evident in disease states associated with endothelial dysfunction and is believed to be the mechanism responsible for increased methylarginines and subsequent ADMA mediated eNOS impairment. Ho wever, the contribution of each enzyme to the regulation of endothelial NO pr oduction has yet to be elucidated.

PAGE 59

59 The strongest evidence for DDAH involvement in endothelial dysfunction has come from studies using DDAH gene silenci ng techniques and DDAH transgenic mice. Specifically, Cooke et.al. has demonstrated that DDAH-1 transgenic mice are protected agai nst cardiac transplant vasculopathy [241, 242]. Using in-vivo siRNA t echniques, Wang et.al. demonstrated that DDAH-1 gene silencing increase d plasma levels of ADMA by 50%, but this increase had no effect on endothelial dependent relaxation. Conversely, in-v ivo DDAH2 gene silencing had no effect on plasma ADMA, but re duced endothelial de pendent relaxation by 40% [237]. These latter findings are particularly intriguing and demonstrate that elevated plasma ADMA is not associated with impaired endothelial depende nt relaxation while loss of DDAH-2 activity is associated with impaired endothelial dependent relaxation, despite the fact the plasma ADMA levels are not increased [237]. Given the obvious inconsistencies in the li terature regarding the individual roles of DDAH-1 and DDAH-2, the curre nt study establishes the specific role of each DDAH isoform in the regulation of endothelial NO production and its potential role in disease pathogenesis. Materials and Methods Cell Culture Bovine aortic endothelial cells (BAECs) were purchased from Cell-Systems and cultured in MEM (Sigma, St Louis,MO) containing 10% FBS, 1% NEAA, 0.2% Endothelial Cell Growth Factor Supplement (ECGS) and 1% Antibotic-Antimyotic (Gibco,Carsbad,CA)and incubated at 37 5% CO2 -95% O2 EPR Spectroscopy and Spin Trapping Spin-trapping measurements of NO were pe rformed using a Bruker Escan spectrometer with FE-MGD as the spin trap (22,38). For Measurements of NO produced by BAECs, cells were cultured as described above and spin tr apping experiments were performed on cells grown

PAGE 60

60 in 6 well plates. Attached cells were studied since scraping or enzymatic removal leads to injury and membrane damage with impaired NO ge neration. The media from approximately 1x106cells attached to the surface of the 6 well plates wa s removed and the cells were washed 3 x in KREBS and incubated at 37 C 5% CO2 in 0.2 ml of KRBES buffer containing the spin trap complex FE-MGD (0.5 mM Fe2+, 5.0 mM) was added and the cells stimulated with calcium ionophore (1 uM). Subsequent measurements of NO production were performed following a 30 min incubation period. Spectra recorded from ce llular preparations were obtained using the following parameters: microwave power; 20 mW, modulation amplitude 3.00 G and modulation frequency; 86 kHZ. HPLC BAECs were collected from confluent 75 mm culture flask and sonicated in PBS followed by extraction using a cation exchange column. Samples were derivatized with OPA and separated on a Supelco LC-DABS column ( 4.6 mm x 25 cm i.d., 5 m particle size) and methylarginines were separated and detected using an ESA (Chelmsf ord, MA) HPLC system with electrochemical detection at 400mV. Homoarginine was added to the homogenate as an internal standard to correct for the efficiency of extraction. The mobile phase consisted of buffer A (50 mM KH2PO4 pH 7.0) and buffer B (ACN/MeOH 70:30) run at room temperature with a flow rate of 1.3 mL/min. The following gradie nt method was used 0-10 min 90% A 10-40 min a linear gradient from 90% A to 30% A (22,39). DDAH-1 and 2 Gene Silencing 21-bp siRNA nucleotide sequences targeti ng the coding sequences for DDAH-1 (accession no. NM_001102201) and DDAH-2 (accession no. NM_001034704) were purchased from Ambion. Control cells received GAPDH siRNA also purchased from Invitrogen. 400 l of nuclease free water was added to the dried oligonucleot ides to obtain a fina l concentration of 100

PAGE 61

61 M. Transfections were done using the li pid mediated transfection reagent RNAiMax (Invitrogen). The procedure was as follows, 240 nM or 5 ul of siRNA per well of a six well plate was diluted into 250 l of Opti MEM (Invitrogen) and 5 ul of RNAiMax was diluted in 250 l of Opti MEM. The siRNA and RNAiMax were then combined into one Eppendorff tube and then incubated at room temperature for 20 minutes Following the 20 minute incubation period, the RNAi MAX-siRNA complexes were added to each well of a six well plate. The mixture was rocked back and forth to allow for coating of th e entire well. BAECs were trypsinized and spun down at 1000 x g for 4 minutes and then resu spended in 1.5 mls of Opti MEM + 10% MEM medium containing 10% FBS, 1% NEAA, 0.2% Endothelial Cell Growth Fact or. The cells were then added on top of the RNAiMAX-siR NA complexes and inc ubated at 37 5% CO2 -95% O2 for 6 hours. After the 6 hour incubation period, 1ml of MEM medium containing 10% FBS, 1% NEAA, 0.2% Endothelial Cell Grow th Factor was added. 24 hours later 1ml of MEM medium containing 10% FBS, 1% NEAA, 0.2% Endothelia l Cell Growth Factor was added. At 48 hours 2 ml of medium was removed and replaced with fresh MEM me dium containing 10% FBS, 1% NEAA, 0.2% Endothelial Cell Growth Factor and the transfection was continued for another 24 hours. DDAH Activity DDAH activity was measured from the conversion of L-[3H]L-NMMA to L-[3H]citrulline. A T-75 flask was used for each measurement, BAECs were trypsinized, pelleted and resuspended in 150 L of 50mM Tris (pH 7.4). The cells were then sonicated 3 x 2 seconds and 150 L of reaction buffer (50 mM Tris, 20 M L-[3 H]L-NMMA, 180 M L-NMMA, pH 7.4) was added. The samples were then incubated in a water bath at 37C for 90 minutes. Following the 90 minute incubation, the react ion was stopped with 1 ml of ice-cold stop buffer using 20

PAGE 62

62 mM N-2 Hydroxyethylpiperazine-N -2 ethanesulfonic acid (HEPES ) with 2 mM EDTA, pH 5.5 (15) Separation of L-[14C]citrulline from L-[3 H]L-NMMA was performed using the cation exchange resin Dowex AG50WX-8 (0.5 ml, Na+ form, Pharmacia). The L-[14C]citrulline in the eluent was then quantitated using a liquid scintillation counter. DDAH Over-Expression Following the 48 hours of adDDAH-1 or adDDAH2 transduction, cells were trypsinized and spun down at 1000 x g for 4 minutes. The cell pellet was then washed 1x with PBS and then centrifuged at 1000 x g for an additional 4 minutes The cell pellet was then homogenized using RIPA buffer containing sodium orthovanadate (2 mM), phenylm ethylsulphonyl fluoride (1 mM), and protease inhibitor cocktail (Santa Cruz biotechnology). Following homogenization the cell pellet was briefly sonicated 2 x 2 sec. Protein concentration was quantif ied using the Bradford assay. 1x sample buffer cont aining DTT was added to 40 g of protein and boiled at 95 for 3 minutes and then spun down briefly and cooled fo r 2 minutes. The samples were then loaded on to a SDS Tris -Glycine gradient gel 4-12% (Invitrogen) and run at 130V for 2 hours. The gel was then removed and the protein was transferre d on to a nitrocellulose membrane using the semi dry transfer blot system (BioRad). Followi ng the transfer, the nitrocellulose membrane was blocked for 1 hour in Tris Buffer Saline and 0.05% Tween (TBST) with 5% milk powder. After the blocking period was over the membrane was washed 3x for 5 minutes with TBST and then the respective primary antibody was added and incubated over night at 4C. DDAH was detected by anti-DDAH-1 and DDAH-2 rabbit IgG obtained fr om Dr. Renke Mass (Hamburg, Germany) and diluted 1:1000. Following the over night incubation with the primary antibody the membrane was washed for 15 minutes 3x with TB ST and the secondary go at-anti rabbit hrp tag antibody diluted 1:2000 was added. After 1 hour of incubation at room temperature, detection

PAGE 63

63 was preformed using an enhanced chemilu minescence kit purchased from Amersham Biosciences. Assessment of mRNA Levels Foll owing DDAH Gene Silencing Following the 72 hour siRNA transduction pe riod, BAECs were tr ypsinized and spun down at 1000 x g for 4 minutes. The cell pellet wa s then wash 1 x with PBS and centrifuged at 1000 x g for an additional 4 minutes. The cell pe llet was then homogenized in lysis buffer from the Qiagen (Valencia,CA) RNAeasy Mini Kit. Following lysis, RNA was extracted using a Qiagen (Valencia,CA) RNAeasy Mini Kit. cDNA was then isolated using the Invitrogen (Carsbad,CA) One Step RT-PCR kit. Semiquant ive PCR was preformed in order to detect changes in mRNA expression following DDAH-1 or DDAH-2 gene silencing. Bovine Primers for DDAH-1 Forward (GAGGAAGGAG GCTGACATGA), DDAH-1 Reverse (TTCAAGTGCAAAGCATCCAC), and DDAH-2 Forward (CTAGCCAAAGCTCAGAGGGACAT), DDAH-2 Reverse (TCAGTCAACACTGCCATTGCCCT) were purchas ed from Invitrogen (Carsbad, CA). eNOS Activity eNOS activity was measured from the conversion of L-[14C] arginine to L-[14C]citrulline. A T-75 flask was used for each measurement, BAECs were trypsinized, pelleted and resuspended in 132 L of 50 mM Tris (pH 7.4). The cells we re then sonicated 3 x 2 seconds and 28 L of reaction buffer (50 mM Tris containing 5 M L-[14 C] arginine, 50 M L-arginine 500 M NADPH/50 M CaCl2/50 M H4B pH 7.4) The samples were then incubated in a water bath at 37C for 30 minutes. Following the 30 minute incubation the reaction was stopped with 1ml of ice-cold stop buffer using 20 mM N 2-Hydroxyethlypiperazine-N-2 ethansulfonic acid (HEPES) with 2mM EDTA, pH 5.5. Separation of L[14 C] arginine from to L-[14C]citrulline

PAGE 64

64 was performed using the cation excha nge resin Dowex AG50WX-8 (0.5ml Na+ form, Pharmacia). The L[14C] citrulline in the eluent was then quantitated using a liquid scintillation counter Results Effects of DDAH 1 and 2 OverExpressi on on Endothelial NO Production Previous studies have dem onstrated that both DDAH-1 and DDAH-2 are expressed in the vasculature. However, it is presently unknown which of the DDA H isoforms is responsible for the regulation of endothelial NO. Therefore, st udies were carried out us ing adenoviral mediated over-expression of both DDAH-1 and DDAH-2 in order to determine which isoform is responsible for endothelial me thylarginine metabolism and NO regulation. Endothelial cells were grown to 90% confluency and then tran sduced with either ad -DDAH-1 (50 MOI) or adDDAH-2 (50 MOI) for 48 hours. We stern blot analysis demons trated robust increases in endothelial expression of both DDAH-1 and DDAH-2 following respective adenoviral treatment (Figure 3-1) At the end of the 48 hour period NO production was measured by EPR as previously described. Results demonstrated that following 48 hours of transduction, adDDAH-1 mediated over-expression result ed in a 24% increase in NO production over basal NO levels (Figure 3-2). It was anticipa ted that if DDAH over-expression is increasing NO through the metabolism of basal methylarginines, then L-ar g supplementation should prevent the increase. Endothelial cells were transduced with adDDAH-1 for 48 hours as previously described. After the 48 hour exposure the media was removed and BAECs were incubated with L-Arg (100 m) for 30 minutes in KREBS-HEPES buffer. Results demonstrated that L-Arg supplementation alone resulted in a 30% increase in basal NO production in control cells (Figure 3-2). Moreover, in the presence of DDAH-1 over-expression, L-arginine supplementation resulted in an additive effect with a 13% increase in NO comp ared to L-arg supplementation alone.

PAGE 65

65 Similar to adDDAH-1, DDAH-2 over-expression resulted in an 18% increase in endothelial cell NO production (Fig ure 3-3). Similar results we re obtained with L-arginine supplementation of DDAH-2 over-expressing cells in which we observed a 45% increase NO production following the addition of L-arg compared to a 28% increase with L-arg supplementation alone (Figure 3-3). The observa tion that the effects of L-arg supplementation on NO production are not attenuated in the presence of DDAH-1 or DDAH-2 over-expression possibly demonstrates that ADMA is not respon sible for the arginine paradox as has been proposed. Effects of DDAH-1 and DDAH-2 Over-Ex pression on ADMA Inhibition The previous studies assessed the effect s of DDAH over-expression on NO production in the presence of normal physiologi cal levels of methylarginine. Given that normal intracellular methylarginines are in the low micromolar range it would not be expect ed that physiological levels of these competitive NOS inhibitors would elicit pathological eNOS inhibition. Therefore, additional studies were performed in the presence of exogenously added ADMA to assess whether DDAH over-expression can overc ome ADMA accumulation at levels observed with cardiovascular disease states [96]. Results demonstrated that exogenously added ADMA (10 M) resulted in 40% inhibition of endothe lial cell NO production from BAECs and that over-expression of either DDAH-1 or DDAH-2 was ab le to restore 50% of the loss in endothelial NO production (Figure 3-4). Thes e results indicate that bot h DDAH-1 and DDAH-2 may serve as potential therapeutic targets for the treatment of diseases associated with elevated ADMA. Effects of DDAH 1 and 2 Silencing on Endothelial NO Production Previous studies have suggested that a decrease in DDAH activ ity, as has been observed in vascular disease, contributes to endothe lial dysfunction through a mechanism involving increased cellular ADMA levels. In support, ADMA levels are an indepe ndent risk factor for

PAGE 66

66 cardiovascular disease and results from numerous clinical and basic science studies have revealed increased ADMA levels in a variet y of diseases including diabetes, pulmonary hypertension, coronary arte ry disease and atheroscle rosis [240, 241, 249, 265, 267-269]. However, whether loss of DDAH activity is dire ctly responsible for the impaired NO production and which specific isoform is responsible fo r NO regulation in the endothelium are unknown. Therefore, in order to determine the role of each DDAH isoform in the re gulation of endothelial NO, cellular studies were performed using BAEC s to asses the effects of DDAH-1 and 2 gene silencing on NO production. Bovine aortic endothelia l cells were cultured in 6 well plates and using the reverse transfection protocol described in the me thods, DDAH -1 and DDAH-2 genes were silenced with specific siRNAs. The degree of gene knock-down was evaluated using semi-quantitative PCR analysis of DDAH-1 a nd DDAH-2 mRNA expressi on. This approach was used in lieu of protein analysis because ba sal levels of DDAH-2 are undetectable by western blot. Results demonstrated that DDAH-1 and DD AH-2 silencing resulted in greater than 70% reduction in mRNA expression for the respectiv e gene (Figure 3-5). In addition to DDAH mRNA expression, the effects of siRNA mediated DDAH gene silencing on endothelial DDAH activity was measured. Following 72 hours of DDAH-1, DDAH-2 or dua l silencing, BAECs were assessed for DDAH activity by measuring the conversion of L-[3H]NMMA to L[3H]Citrulline. Results demonstrated that DDAH-1 gene silencing resulted in a 64% decrease in totally DDAH activity. DDAH-2 gene silencing resulted in a 48% decrease in total DDAH activity (Figure 3-6). Interest ingly, silencing of both DDAH-1 and DDAH-2 resulted in only a 50% drop in total DDAH activity suggesting that other methylarginine metabolic pathways may be invoked as a consequence of lo ss of DDAH activity (Figure 3-6).

PAGE 67

67 The functional effects of DDAH gene silencing were assessed using EPR spin trapping to measure endothelial derived NO production. Re sults demonstrated th at DDAH-1 silencing reduced endothelial NO production by 27% (Figure 3-7). In order to determine whether the effects of DDAH gene silencing on NO production resulted from incr eased intracellula r levels of ADMA, L-arg supplementation experiments were carri ed out to assess the ability of L-arg to overcome ADMA mediated eNOS inhibition. Sp ecifically, DDAH gene s ilencing studies were carried out in the presence of L-arg (100 M). Results demonstrated that L-arginine (100 M) supplementation restored 50% of the siDDAH-1 mediated loss of endothelial NO production (Figure 3-7). DDAH-2 gene sile ncing resulted in a 57% reduc tion in endothelial NO production. L-arginine supplementation di d not increase endothelial NO production in DDAH-2 silenced BAECs (Figure 3-8). These resu lts suggest that the effects of DDAH-2 silencing on endothelial NO production are independent of ADMA-mediated eNOS inhibition. Additional studies were performed in which both genes were silen ced. Silencing of both the DDAH-1 and DDAH-2 genes resulted in 55% inhibition which was not increased with L-arg supplementation (Figure 39). These results are surprising given that Larg would be expected to overcome the accumulation of methlyarginines. Therefore, to confirm that L-arg supplementation can in fact ameliorate ADMA mediated inhibiti on, additional studies were carried out with cells treated with exogenous ADMA and the ability of L-arg suppl ementation to overcome eNOS inhibition was measured. Cellular studies were carried out using BAECs stimulated by calcium inonophore A23187 (1 M). EPR-based NO measurements we re preformed in modified KREBS buffer (0.5 mM Fe2+ and 5 mM MGD) in the presence or absence of L-arg (100 M). The dose-dependent effects of ADMA (0-10 M) were then meas ured. Results demonstrated that ADMA dose-

PAGE 68

68 dependently inhibited eNOS-derived NO producti on with 5M ADMA elicit ing 46% inhibition and 10 M ADMA, exhibiting 58% inhibition in the absence of L-arg. In the presence of physiologically relevant L-arg levels (100 M), ADMA treatment resulted in a dose-dependent inhibition of endothelial NO with < 20 % inhibition seen at ADMA concentrations of 5M. Overall these results demonstrate that L-arg supp lementation can only partially restore the loss in NO production occurring after ADMA administrati on. Although the addition of exogenous Larg would be expected to fully restore ADMA mediated eNOS inhibition, these results are consistent with previous studies demonstrating partial restoration of endothelial NO with L-arg following exposure to exogenous ADMA [96] (Figure 3-10). Effects on DDAH Gene Silencing on Methylarginine Metabolism As demonstrated earlier, when both DDA H-1 and DDAH-2 were silenced, total DDAH activity was only inhibited by 50% suggesting the endot helium may possess al ternate metabolic pathways for methylarginine metabolism. Th ese are unexpected results given that DDAH is considered to be the principle metabolic pa thway for ADMA metabolism and was previously demonstrated to mediate >80% of cellular methyl arginine metabolism [267]. Therefore, studies were carried out using HPLC techniques with ra diolabeled NMMA to assess the metabolites of methylarginine metabolism. Results demonstrated that in BAECs that were not silenced three radiolabled peaks were identifie d, arginine, citrulline and L-NMMA. However, in BAECs that were silenced an additional unidentified radi olabled peak was observed suggestive of induction of an alternate metabolic pathway. Furthermore, following dual gene sile ncing the concentration of the unknown metabolite increased 2-fold (Table 3-1). These results would suggest that BAECs have an alternate inducible pathway for methylarginine metabolism in response to loss of DDAH activity or methylarginine accumulation. Effects of DDAH 1 and 2 Gene Silencing on eNOS Activity

PAGE 69

69 The studies on DDAH silencing demonstrate that loss of DD AH-2 expression/activity may elicit ADMA independent effects given that Larg supplementation was not able to enhance endothelial NO production from DDAH2 silenced cells. Therefore, studies were carried out in order to determine whether gene silencing has an y direct effects on eNOS activity independent of ADMA. Studies were performed m easuring the conversion of L[14C] Arginine to L[14C] Citrulline from BAEC homogenates following DDAH gene silencing. Results demonstrated that DDAH-1, DDAH-2 and dual silencing resulted in no change in total eNOS activity based on LNAME inhibitable counts (Figure 3-11). Discussion ADMA plasma levels have been shown to be elevated in diseases re lated to endothelial dysfunction including hypertension, hyperlipidem ia, diabetes mellitus, and others [267, 268, 270-272]. Moreover, it has been shown that ADMA predicts cardiovascular mortality in patients who have coronary heart disease (CHD). R ecent evidence published from the multicenter Coronary Artery Risk Determination invest igating the Influence of ADMA Concentration (CARDIAC) study has indicated that ADMA is i ndeed an independent risk factor for CAD [273]. There is a growing body of evidence implicating ADMA as a key player in endothelial dysfunction and a independent ri sk factor involved in the pathophysiology of a variety of cardiovascular diseases including hypertension, a nd atherosclerosis (21-26). Recently several groups have demonstrated that modulati ng DDAH activity can have a profound effect on endothelial NO production [ 237, 240]. In this regard, our group and others have shown that over-expression of DDAH-1 results in increa sed NO production [242, 274]. Furthermore, OxLDL and TNF have been shown to decrease DDAH activ ity leading to decreased endothelial NO production [275]. It has also been demonstrated that 4-hyrdoxy-nonenal (4-HNE), the

PAGE 70

70 highly reactive oxidant product of lipid peroxi dation, inhibits DDAH ac tivity and leads to impaired NO generation through the formation of Mi chael addition products in the catalytic triad of DDAH [274]. Thus, evidence suggests that DDAH-1 activity is under redox control and loss of enzyme function impair s endothelial NO generation. Whether the increased risk associated with elevated ADMA is a direct result of NOS impairment is an area of controversy. Significan t debate about the contribution of ADMA to the regulation of NOS-dependent NO production has been initiated. In pathological conditions such as pulmonary hypertension, coronary artery disease, diabetes and hypertension, plasma ADMA levels have been shown to increase from an average of ~0.4 M to ~0.8 M [269, 272, 273, 276278]. Given that these values are at least 2 or ders of magnitude lower than the plasma L-arg levels it is unlikely that elevated plasma ADMA can significantly regulate eNOS activity. It is more likely that elevated plasma ADMA levels reflect increased endotheli al concentrations of ADMA. In support of this hypothesis, we and ot hers have demonstrated that endothelial ADMA levels increase 3-4 fold in re stenotic lesions and in the isch emia reperfused myocardium [96, 279]. Based on the kinetics of cellular inhibi tion, these concentrati ons of ADMA would be expected to elicit a 30-40% i nhibition in NOS activity [96]. These studies however involve lesion specific increases in ADMA and are not as sociated with increased plasma levels of ADMA and would not be expected to contribute to systemic cardiovascular pathology. In this regard, there is little direct evidence that elevated plasma ADMA levels are associated with increased endothelial ADMA nor is it clear whether ADMA directly co ntributes to the NOS inhibition observed in chronic cardiovascular diseases. The current hypothesis in the field suggests that decreased DDAH activ ity, as has been observed in car diovascular disease, results in impaired endothelial methyl arginine metabolism with subsequent elevation in ADMA leading

PAGE 71

71 to NOS inhibition. However, identification of the endothelial DDAH is oform responsible for NOS regulation and direct evidence for its role in modulating endotheli al NO production has not been demonstrated. Therefore, the current st udy was undertaken to evaluate the roles of both DDAH-1 and DDAH-2 in the regulation of met hylarginine metabolis m and endothelial NO production. Initial studies were carried out to determine how cellula r endothelial NO production is regulated by the DDAH isoforms. DDAH-1 and DDAH-2 over-expression was induced using an adenoviral construct carrying either the human DDAH-1gene (adDDAH-1) or DDAH-2 gene (adDDAH2). Results demonstrated that ade noviral mediated overe xpression of both DDAH-1 and DDAH-2 increased cellular endothelial NO produc tion. These initial studies were done in the presence of basal methylar ginine levels and demonstrate that normal endogenous levels of these NOS inhibitors are present at concentratio n sufficient to regulate eNOS activity. It had previously been proposed that ADMA may be re sponsible for the arginine paradox and these studies would appear to support the hypothesis. However, s ubsequent studies using L-arg supplementation with DDAH over-expression demonstr ated an additive effect which suggests that ADMA is not involved in the arginine paradox. It has been estimated that more than 80% of ADMA is metabolized by DDAH [267], however, it is unclear which DDAH isoform re presents the principal methylarginine metabolizing enzyme. PCR and western blot anal ysis revealed that the endothelium contains mRNA and protein for both DDAH-1 and DDAH-2. However, in order to assess the relative contribution of each isoform a detailed analysis of the enzyme kinetic s of each isoform is necessary. Unfortunately, detailed biochemical studies have only been published for DDAH-1 [228, 249]. Using purified recombinant hDDAH-1 we and others have demonstrated the precise

PAGE 72

72 enzyme kinetics of this isoform and results demonstrated Km values of 68.7 and 53.6 M and Vmax values of 356 and 154 nmols/mg/min for AD MA and L-NMMA, respectively [228, 249]. In regards to DDAH-2, previous attempts at purifyi ng the protein have been unsuccessful primarily due to solubility issues with recombinant enzyme. Therefore, to invest igate the role of the DDAH isoforms in the regulation of endotheli al NO production, studies were performed using siRNA to silence both the DDAH-1 and DDAH-2 genes in BAECs. It was anticipated that silencing of DDAH would lead to increased cellular methylargini nes and decreased endothelial NO production. Results supported this predicti on and demonstrated that DDAH-1 silencing reduced endothelial NO production by 27% while DDAH-2 silencing reduced it by 57%. These studies were then repeated with L-arg s upplementation in order to establish the ADMA dependence of the DDAH effects. The addition of L-arg (100 M) was able to restore ~ 50% of the loss of endothelial NO generation observe d with DDAH-1 silencing. Although it may be predicted that L-arg supplementation should completely restore NO production given that ADMA is a competitive inhibitor of NOS, these resu lt are consistent with previously published studies and suggest that DDAH-1 silencing may lead to ADMA accumulation in sites that are not freely exchangeable with L-arg. In support of this hypothesis it has been demonstrated by Simon et al. that within the endothelial cell exists two pools of arginine both of which eNOS has access to. Pool I is largely made up of extracellular cationic amino ac ids transported through the CAT transport system, however Pool II does not fr eely exchange with extracellular cationic amino acids. Furthermore they also demonstrated that Pool II is separated into two components. Pool II A participates in the recycling of citrulline to arginine, while P ool II B is occupied by protein derived by-products. It is w ithin this Pool II B where the methylarginines are likely to accumulate, thus rending its inhibitory effect s on eNOS [280]. Alternatively, ADMA and/or

PAGE 73

73 DDAH may elicit effects that are independent of NOS, this appear s to be the most plausible explanation with regards to DDAH-2 wherein loss of activity reduced endothelial NO production by greater than 50% and the lo ss was unaffected by L-arg supple mentation. This is strong evidence that DDAH may elicit effects that ar e independent of ADMA. Although this may represent an overall paradigm shift with regards to the role of DDAH in the endothelium, it is not with out support. The most convincing ev idence that DDAH may regulate cellular function through mechanisms independent of ADMA mediat ed NOS inhibition come from data on the DDAH-1 knockout mouse. Homozygous null mice for DDAH-1 are embryonic lethal while the NOS triple knockout mice are viable [240]. Th is further supports are hypothesis that DDAH effects are not limited to ADMA dependent regulation of eNOS. It has been widely reported that DDAH-2 is the predominant DDAH isoform in the vascular endothelium; however these studies have widely relie d on assessing the expression of the DDAH isoforms in various cell and tissue types [237, 240, 281, 282]. Consequently, studies were carried out in BAECs to determine which isoform is responsible fo r the majority of the DDAH activity in the endotheli al cell. DDAH-1 and DDAH-2 gene silencing decreased total DDAH activity by 64% and 48%, resp ectively. Additional studies de monstrated that dual gene silencing only resulted in a 50% loss total DDAH activity in BA ECs thus suggesting that other methylarginine metabolic pathways may be invo ked as a consequence of loss of DDAH activity. To investigate the possibility that loss of DDAH activity may lead to the induction of other methyalrginine metabolic enzymes we used HPLC techniques to measure the metabolic products of 14C-L-NMMA. In cont rol cells we observed 3 peaks with radioactive counts and they were identified as L-NMMA, L-arginine and L-cittruline. The formati on of radiolablled L-citrtruline is likely from the metabolism of L-NMMA by DDAH while radioactive L-arg is generated from

PAGE 74

74 citrulline recycling through A SS and ASL. In contrast, results from DDAH-1 and DDAH-2 silenced cells indicated the presence of 4 ra dioactive peaks including L-NMMA, L-arginine, Lcittruline and a yet unidentified peak. The conc entration of this uniden tified peak increased 2 fold in the dual silencing group as compared to the levels in either the DDAH-1 or DDAH-2 silencing groups alone. Initial mass spec analysis has been unsuccessful in identifying the unknown species and is currently an area of active investigation in our lab. Regardless, the results clearly indicate that the endothelium possesses an alte rnate inducible pathways for metabolizing methylarginies. Together, thes e results demonstrate that both DDAH-1 and DDAH-2 are involved in the regulation of e ndothelial NO production. However, while DDAH-1 effects are largely ADMA-depe ndent, DDAH-2 effects appear to be ADMA-independent. To determine whether the ADMA-independent effects of DDAH silencing on endothelial NO production involved changes in eNOS protein, we measured eNOS activity from BAEC homogenates following DDAH-1, DDAH-2 and dual silencing. Analysis of eNOS activity demonstrated that DDAH gene silencing had no e ffect on the enzyme. These experiments were carried out in the presence of saturating concentr ations of substrate and cofactors and can rule out DDAH effects on endothelial substrate/cofactor bioavailability. Overall these results demonstr ate that loss of DDAH activity, as has been demonstrated in a number of cardiovascular diseas es, leads to significant inhibi tion of endothelial NO production. Moreover, the effect of DDA H-1 and DDAH-2 on endothelial NO appear to manifest through very different mechanisms. DDAH-1 appears to be largely and ADMA dependent effect, while DDAH-2 appears mostly to mediate its effects independent of ADMA. Moreover, we have demonstrated for the first time an alternative pathway through which methlyarginines can be metabolized.

PAGE 75

75 Figure 3-1. DDAH Over-expre ssion. DDAH-1 and DDAH-2 e xpression was measured by western blot techniques from BAECs transduced for 48-hours with adDDAH1(10,25,50 MOI) and adDDAH-2(10,25,50 MOI)

PAGE 76

76 Figure 3-2. Effects of adDDA H-1 over expression on endothelial cell NO pr oduction. NO generation from calcium ionophore A23187 (1 M) stimulated BAECs (1x106) was measured by EPR spin trapping with the Fe2+-MGD complex. The left side of the panel represents the amplitude of the NO triplicate EPR spectra of a 30 consecutive 20 second scans following a 30 minute incubation period.B)The right panel represents the characterist ic triplicate NO spectra a nd the effects of adDDAH-1 over-expression on NO production. Results ar e means SD. Significance at p<0.05 as compared to the control. n=9

PAGE 77

77 Figure 3-3. Effects of adDDA H-2 over expression on endothelial cell NO pr oduction. NO generation from calcium ionophore A23187 (1 M) stimulated BAECs (1x106) was measured by EPR spin trapping with the Fe2+-MGD complex. The left side of the panel represents the amplit ude of the NO triplicate EPR spectra of a 30 consecutive 20 second scans following a 30 minute incubation period. The right pane l represents the characte ristic triplicate NO spectra and the effects of adDDAH-2 over-expression on NO produc tion. Results are means SD as compar ed to the control. Significance at p<0.05 as compared to the control. n=9

PAGE 78

78 Figure 3-4. Effects of DDAH1 and DDAH-2 over-expression on ADMA mediated inhibtion of endothelial NO production. NO generation from calcium ionophore A 23187 (1 M) stimulated BAECs (1x106) was measured by EPR spin trapping with Fe2+-MGD complex. Experimental groups consisted of adG FP (control) adDDAH-1 and ad DDAH-2. These experiments were preformed in the absence and presence of ADMA (5 M). Results are SD *Significance at p<0.05 as compared to the respective control.

PAGE 79

79 Figure 3-5. Effects of DDAH gene sile ncing on DDAH mRNA expr ession. DDAH mRNA expression was measured by semi quantitative PCR, and ran on an agarose gel to check for differences in DDAH expression fo llowing siRNA treatment. Experimental groups consist of 60 nM siRNA (DDAH1, DDAH-2) and 240 nM siRNA (DDAH-1 and DDAH

PAGE 80

80 Figure 3-6. Effects of DDAH gene sile ncing on endothelial cell DDAH activity. DDAH activity was measured from BAEC homogenates following 72 hours of DDAH gene silencing. Experimental groups consisted of si-DDAH-1, si-DDAH-2, siDDAH1/2. Results are means SD. Significance at p<0.05 as compared to the control. n=3

PAGE 81

81 Figure 3-7. Effects of DDAH-1 gene silencing on endothelial cell NO production. NO generation from calcium ionophore A23187 ( 1 M) stimulated BAECs (1x106) was measured by EPR spin trapping with the Fe2+ -MGD complex. Experimental groups consisted of scrambled siRNA (control), and si-DDAH-1.These experiments were preformed both in th e presence and absence of L-arginine (100M). Results are means SD. Significance at p<0.05 as compared to the respective control.n=9

PAGE 82

82 Figure 3-8. Effects of DDAH-2 gene silencing on endothelial cell NO production. NO generation from calcium ionophore A23187 ( 1 M) stimulated BAECs (1x106) was measured by EPR spin trapping with the Fe2+-MGD complex. Experimental groups consisted of scrambled siRNA (control) and siDDAH-2.These experiments were preformed both in the presence and absence of L-arginine (100 M). Results are means SD. Significance at P<0.05 as compared to the respective control. n=9

PAGE 83

83 Figure 3-9. Effects of DDAH1 and DDAH-2 gene silencing on endothelial cell NO production. NO generation from calcium ionophore A23187 (1 M) stimulated BAECs (1x106) was measured by EPR spin trapping with the Fe2+-MGD complex. Experimental groups consisted of scrambled siRNA (contro l) and siDDAH-2.These experiments were preformed both in the presence and absence of L-arginine (100 M). Results are means SD. Signi ficance at p<0.05 as compared to the respective control.n=9

PAGE 84

84 Figure3-10. Effects of ADMA on endothelial cell NO production. NO generation from calcium ionophore A23187 (1 M) stimulated BAECs (1x106) was measured by EPR spin trapping with the Fe2+-MGD complex. Experiment al groups consisted of control (0 M), 5 M and 10 M ADMA. These experiments were preformed both in th e presence and absence of Larginine (100 M). Results are means SD. Significance at p<0.05 as compared to th e respective control. n=9

PAGE 85

85 Figure 3-11. Effects of DDAH ge ne silencing on endothelial cell eNOS activity. eNOS activ ity was measured from BAEC homogenates following 72 hours of DDAH ge ne silencing. Experimental groups consisted of si-DDAH-1,si-DDAH-2,siDDAH1/2 Results are means SD. n=3

PAGE 86

86Table 3-1. L-NMMA Metabolism Arginine Citrulline Unknown Control 5.5 M 4.07 M 0 M siDDAH-1 5 M 1.5 M 2.2 M siDDAH-2 4.25 M 2.05 M 2.8 M siDDAH-1/2 5.1 M 1.27 M 4.4 M BAECs were cultured in 6 well plates and transfected with siRNA. Following the 72 hour transfection period, cellular amino aci d content was measured and quantified using HPLC t echniques with ESA peak integration software.

PAGE 87

87 CHAPTER 4 ROLE OF DDAH-1 IN THE 4-HYDROXY-2-NONENAL MEDI ATED INHIBTION OF ENDOTHELIAL NITRIC OXIDE GENERATION Introduction Endothelium-derived nitric oxide (NO) is a poten t vasodilator that play s a critical role in maintaining vascular homeostasis through its anti -atherogenic and anti-thrombotic effects on the vascular wall [283-285]. In this regard, impa ired endothelial derive d NO production has been implicated in the pathogenesis of atheroprol iferative disorders [286] Among the proposed mechanisms for the impaired NOS activity observed in these conditions are the elevated levels of oxidatively modified lipids [287, 288]. Polyunsatur ated fats in cholesterol esters, phospholipids and triglycerides are subjected to free radical initiated oxidation. These polyunsaturated fatty acid peroxides can yield a variety of highly reactive smaller molecules such as the aldehyde 4hydroxy-2-nonenal (4-HNE) upon further oxidativ e degradation [289]. 4-HNE is a major biologically active aldehyde form ed during lipid peroxidation of w6 polyunsaturated fatty acids which has been shown to accumulate in membranes at concentrations from 10 m to 5 mM [290]. There is a body of evidence which suggests that reactive aldehydes such as 4-HNE play a role in the progression of atherosclerosis. Plas ma concentrations of these reactive aldehydes are known to increase relative to the progression of aortic atherosclerosis, and during the oxidation of LDL high concentrations of the reactive aldehydes are generated [291, 292]. It has been suggested that the elevations in these highly reactive lipid hydroperoxide degradation products result in impaired endothelial function and atherosus ceptibility, secondary to NOS impairment [288, 293, 294]. In support of the importance of the reactive aldehyde involvement in endothelial dysfunction, here we demonstrate that expos ure of aortic endothelial cells to 4-HNE dose-dependently inhibits NO bi oavailability. We hypothesize that the decrease in NO

PAGE 88

88 bioavailability is a result of incr eased levels of the NOS inhibitors asymmetric dimethly arginine (ADMA) and NG monomethyl arginine (L-NMMA). ADMA has been shown to be increased in condi tions associated with increased risk of atherosclerosis and independently predicts total and cardiovascular mortality in individuals with angiographic coronary artery disease [31, 34, 273, 295-297]. However, little is known with regards to the pathways leading to the methyl arginine accumulation observed in cardiovascular diseases. These endogenous inhibitors of NOS ar e derived from the proteolysis of methylated arginine residues in various proteins. The me thylation is carried out by a group of enzymes referred to as protein-arginine methyl transferases (PRMTs). Subsequent proteolysis of proteins containing methylarginine groups leads to the releas e of free methylarginine into the cytoplasm where NO production from NOS is i nhibited [35, 298, 299]. These methylarginines are subsequently degraded by the enzyme DDA H which hydrolyzes the conversion of ADMA to L-citrulline and dimethylamine [36, 300]. Th e activity of DDAH has been shown to be decreased by oxidized LDL and tumor necrosis factor (TNF), yielding increased methylarginine levels with subsequent im pairment of NOS-derived NO generation [239, 261, 301, 302]. Because NO is known to possess anti-pro liferative and anti-atherogenic properties, methylarginine accumulation in response to the decreased DDAH expression/activity has been proposed to be involved in the vascular pathophy siology observed in a variety of cardiovascular diseases [35, 96, 303-305]. However, the mechanisms as to how methylarginines are modulated and what role they play in disease progression are not understood. Therefore, the current studies were performed in order to establish the effect s of the lipid peroxidation degradation product 4HNE on NO production and determine if methylargi nines are involved in the lipid peroxidation mediated pathogenesis of endothelial dysfunction.

PAGE 89

89 Materials and Methods Materials 4-HNE was purchased form Biomol (Plymout h Meeting, PA). BAECs were purchased form Cell-Systems (Kirkland, WA). All other re agents were purchased from Sigma (St.Louis, MO). Cell Culture Bovine aortic endothelial cells (BAECs) were purchased from Cell-Systems and cultured in DMEM containing 10% FBS, 1% NEAA, 0.2% e ndothelial cell growth factor supplement and 1% antibotic-antimyotic and incubated at 37C under a humidified environment containing 5% CO2 95% O2. For experiments involving exposure to 4-HNE, 4-HNE was prepared as a stock solution in ethanol at a concentration of 50 mM. The 4-HNE was then added to the media of BAECs and incubated for 24 hrs. Dilutions of 4HNE were performed in order to maintain the final ethanol concentration below 0.2%. Epr Spectroscopy and Spin Trapping Spin-trapping measurements of NO we re performed using a Bruker ESP 300E spectrometer with Fe-MGD as the spin trap [96, 306]. For Measurements of NO produced by BAECs cells were cultured as described above and spin trapping experiments were performed on cells grown in 6-well plates (1 x 106 cells/ well). In these studi es, cells attached to the substratum were utilized since scraping or en zymatic removal leads to injury and membrane damage with impaired NO generation. The medi um from each well was removed and the cells were washed 3 x with PBS (w/o CaCl2 or MgCl2). Next, 0.3 ml of PBS containing glucose (1 g/L), CaCl2, MgCl2, the NO spin trap FE-MGD (0.5 mM Fe2+, 5.0 mM MGD), and calcium ionophore (1 M) was added to each well and the plates were incubated at 37C under a humidified environm ent containing 5% CO2 95% O2 for 30 min. Following incubation, the

PAGE 90

90 medium from each well was removed and the tr apped NO in the supernatants was quantified using EPR. Spectra recorded from these cellula r preparations were obt ained using the following parameters: microwave power; 20 mW, m odulation amplitude; 3.16 G and modulation frequency; 100 kHZ. Measurement of Endothelial Cell ADMA and L-Arg Levels BAECs were collected from confluent 75 cm2 culture flask by gentle scraping followed by sonication in PBS followed by extraction using a cation-exchange column. Samples were derivatized with OPA and separated on a Supe lco LC-DABS column (4.6 mm x 25 cm i.d.,5 m particle size) and L-Arg and me thylarginines separated and dete cted using an ESA (Chelmsford, MA) HPLC system with electroc hemical detection at 400 mV [306] Intracellular levels of LArg and methylarginines were determined from values derived from standard curves of each analyte using the ESA peak integration software assuming the endothelial ce ll intracellular water content of 2 pL. DDAH-1 and eNOS Expression DDAH-1 was detected by anti-DDAH-1 goat IG purchased from IMGENEX and diluted 1:2000 (San Diego, CA). eNOS was detected using an anti-eNOS antibody purchased from Calbiochem (San Diego, CA). The secondary antibodies were donkey anti-goat IgG-HRP and goat anti-rabbit IgG-HRP, respectively, and purchas ed from Santa Cruz (Santa Cruz, CA). The secondary antibodies were diluted 1:2000. West ern blot detection was performed using an enhanced chemiliumnesece kit purchased from Amersham Biosciences (Piscataway, NJ). DDAH Activity DDAH activity was measured from the conversion of L-[14C]L-NMMA to L-[14C] citrulline. BAECs grown to confluence in T-75 flasks were trypsinized, pelleted and resuspended in 150 L of 50 mM Tris (pH 7.4). The cells we re then sonicated 4 x 2 seconds and

PAGE 91

91 150 L of the reaction buffer (50 mM Tris, 20 M L-[14C]L-NMMA, 180 M L-NMMA, pH 7.4) was added to each sample. The samples we re then incubated in a water bath at 37C for 90 minutes. Following the incubation, the reaction was stopped with 1 ml of ice-cold stop buffer using 20 mM N-2 Hydroxyethylpiperazine-N-2 ethanesulfonic acid (HEPES) with 2 mM EDTA, pH 5.5. Separation of L-[14C]citrulline from L-[14C]L-NMMA was performed using the cation exchange resin Dowex AG50WX-8 (0.5 ml, Na+ form, Pharmacia). The L[14C] citrulline in the eluent was then determ ined using a liquid scintillation counter. Results Effects of 4-HNE on Endothelial Cell NO Production Previous studies have demons trated that lipid hydroperoxi de levels are elevated in atherosclerotic lesions and the presence of these oxidized lip id congeners may contribute to the endothelial dysfunction observed in CAD [291, 292]. Therefore, in order to determine the effects of lipid hydroperoxides on endothelial function, cellular studies were carried out using BAECs stimulated with calcium ionophore to assess the effects of 4-HNE on NO production from endothelial cells. Endothelial cells we re cultured in 6 well plates and upon reaching confluence were exposed to 4-HNE (10-100 M) for 24 hours. 4-HNE was dissolved in ethanol and added directly to the media (0.1 % EtOH). This compound is highly lipophilic and readily crosses cellular membranes, as such no carrier is n eeded to deliver this agen t into the cell [307]. At the end of the incubation period, EPR spin trapping measurements were performed to measure endothelial-derived NO production. Results demonstrated that 4-HNE dose dependently inhibited NO generation from BAECs, with 10 M 4-HNE inhibiting NO generation by 14%, 50 M inhibited NO generation by 45% and at 100 M a 72% inhibition was observed (Figure 4-1). Results from these studie s demonstrated that 4HNE, at pathologically

PAGE 92

92 relevant levels, dose-dependently inhibited eNOS-derived NO generation. Measurements of cell viability demonstrated no increase in cell deat h with 4-HNE doses up to 50 M, however, at 100 M 4-HNE cell viability decreased by 18 % fo llowing 24-hours of 4-HNE exposure. Thus all subsequent studies were perfor med using 4-HNE concentrations 50 M. Control studies using the non-oxidized carbonyl hexanol demonstrat ed no significant inhi bition in cellular NO production with concentrations up to 50 M (Figure 4-2). The concentration of 4-HNE (50 M) used for subsequent studies represents patholog ically relevant levels of this reactive lipid oxidation product as previous studies have shown concentrations exceeding 50 M 4-HNE in the plasma of dogs following repe rfusion injury [308, 309]. Effect of 4-HNE on eNOS Expression In order to determine whether the inhibito ry effects of 4-HNE on cellular NO production were due to alterations in eNOS expressi on, western blot analysis was performed and measurements of eNOS expression were carried out (Figure 4-3). NOS phosphorylation status was measured using the western blotting techniques with anti-p Ser1179 and pThr-497 antibodies (Figure 4-3). In addition, because calcium ionophore stimulation is known to alter Ser1179 phosphorylation, western blot experiments were also performed on A23187 stimulated BAECs following 4-HNE treatment (Figure 4-4). Results demonstrated that the loss of NOS activity was independent of both eNOS protein expression and phosphorylation status as both of these outcomes were unchanged following exposure to 4-HNE. Restoring NO Generation from Cells Because the observed NO inhibi tion did not result from chan ges in protein expression or phosphorylation state, we carried out additional st udies aimed at assessing whether substrate or cofactor depletion was involved in the observed decrease in NO bi oavailability. In this regard, oxidant stress, which has been shown to occur following exposure to lipid oxidation products,

PAGE 93

93 has been shown to reduce the bioavailability of the critical NOS cofactor H4B [290, 310, 311]. Loss of this cofactor results in NOS uncoup ling with the enzyme primarily generating superoxide. Moreover, oxidant in jury has also been demonstrated to increase cellular levels of the endogenous methylarginine, ADMA [88]. Theref ore, cellular studies were carried out to investigate the effects of adding both an antioxidant to prevent H4B oxidation as well as the eNOS substrate L-Arginine, to overcome endogenous methylarginine mediated NOS inhibition. Results demonstrated that 24 hour exposure of BAECs to 50 M 4-HNE resulted in a 51% decrease in endothelial NO genera tion (Figure 4-5). When these experiments were repeated in the presence of GSH (1 mM) or with L-Arg supplementation (1 mM), NO production increased by 26% and 7% respectively. Moreover, when thes e experiments were repeated in the presence of both GSH and L-Arg, endothelial cell NO production was restored to near normal levels (87% of control) (Figure 4-5). Th ese results suggest that 4-HNE -mediated effects on NO production involve multiple mechanisms which include elevated levels of methylarginines. Effects of 4-HNE on Superoxide Pro duction and Nitrotyrosine Formation Because our previous results demonstrated that GSH was able to partially restore NO production in BAEC treated with 4-HNE, studies were done in order to determine the effects of 4-HNE on superoxide production (Figure 412). Following 24 hours of 4-HNE (50M) treatment, resulted in increased superoxide produc tion in our BAEC cells. The s uperoxide signal was largely quenched by the SOD mimetic. Furthermore, b ecause it is know that oxidative stress can increase eNOS derived by causing the oxidation of the essetinal NOS cofactor H4B we then repeated these studies in the presence of the NOS inhibitor L-NAME. Results demostrated that following 24 hours of 4-HNE exposure, L-NAM E treatment caused a 20% reduction in superoxide production (Figure 4-12 ). Finally, because increases in superoxide production are

PAGE 94

94 also know to increase OONOproduction which can result in increased protein nitrosylation, western blot analysis was done to measure nitrotyrosine formation. Results demonstrated that there were no significant cha nges in protein nitrotyrosin e formation. (Figure 4-11) Effects of 4-HNE on Cellular ADMA Levels Our observation that 4-HNE treatment impa irs cellular NO production and that this inhibitory effect can be reversed with L-Arg ad ministration suggests that intracellular levels of the NOS inhibitor ADMA may be elevated. In order to confirm this hypothesis, cellular levels of ADMA and L-Arg were measured fo llowing exposure of BAECs to 50 M 4-HNE for 24 hours. Results demonstrated that at 24 hours post-exposu re to 4-HNE, endothelial cell concentrations of ADMA increased from 3.2 0.5 to 6.5 0.7, while L-Arg levels were not significantly different (Figure 4-6). These results support our conclusi on that the inhibitory effects of 4-HNE on endothelial NO production ar e due, at least in part, to the in creased levels of the competitive NOS inhibitor, ADMA Effect of 4-HNE on DDAH Expression and Activity Cellular methylarginine levels are regulated by DDAH, the enzyme responsible for the metabolism of both ADMA and L-NMMA. Recent studies have demonstrated that the expression and activity of this methylarginine-regulating enzyme decreases in variety of cardiovascular diseases. Therefore, to determine whether the observed elevations in intracellular ADMA were a result of change s in DDAH, measurements of DDAH expression and activity were performed following exposure of BAECs to 4-HNE. BAECs were treated with 4-HNE (50 M) followed by western blotting and enzyme ac tivity assays. Results demonstrated that exposure of endothelial cells to 4-HNE did not affect the prot ein expression (Figure 4-7), but resulted in a 40% decrease in cellular DDAH activ ity (Figure 4-8). Studies were then performed

PAGE 95

95 with purified recombinant hDDAH-1 to evaluate whether the observed cellular inhibition of DDAH activity was a result of direct 4-HNE eff ects on the enzyme. Incubation of purified hDDAH-1 with 50 M 4-HNE resulted in a 41% decrease in activity from the purified enzyme (Figure 4-8). This loss in activity was larg ely restored by GSH (1 mM) pre-incubation. Together, these results demonstrate that 4-HNE directly inhibits DDAH activity resulting in increased methylarginine levels and thus impaired eNOS-derived NO. Effects of DDAH Over-Expression on Endothelial NO Production Following Exposure to 4HNE Our results have demonstrated that the e xposure of BAECs to the lipid peroxidation product, 4-HNE, results in the impaired NO production and accumulation of ADMA, secondary to the loss of DDAH activity. Therefore, studies were carried out in order to determine whether over-expression of DDAH-1 could restore endothelial NO production following 4-HNE challenge. BAECs were grown to 80% conflu ence and then transduced with adDDAH-1 (25 MOI) which resulted in a 3-fold increase in DDAH 1 expression. After 24 hours of adenoviral transfection, cells were challenged with 4-HNE and allowed to incubate for an additional 24 hours. At the end of the 24 hour challenge, EP R analysis of NO production was carried out as described in the Material and Methods. Results demonstrated that exposure to 4-HNE (50 M) resulted in a 36% decrease in NO generation in ce lls transduced with a control vector (Figure 49). Cells over-expressing DDAH-1 demonstrated a 22% basal increase in NO generation as compared to the control vector suggesting that the endogenous levels of methylarginine are sufficient to significantly inhibit cellular NO prod uction (Figure 4-9). Exposure of cells overexpressing DDAH-1 to 4-HNE (50 M) resulted in a 58% decrease in NO production, thus demonstrating that DDAH alone cannot restor e eNOS function. However, when these experiments were repeated in the presence of GSH, DDAH over-expression was able to almost

PAGE 96

96 completely restore NO production following 4HNE challenge, while GSH alone had only modest effect (Figure 4-9). In order to confirm that these NO-restoring effects were depe ndent on increased DDAH activity, studies were performed measuring the conversion of L-[14C]NMMA to L-[14C]citrulline in BAECs. We found that e xposure of BAECs to 4-HNE (50 M) resulted in a 38% decrease in DDAH activity, supporting our previous HPLC re sults (Figure 4-10). Over-expression of DDAH-1 increased DDAH activity by 50% and this increase in activity was reduced by 25% following exposure of BAECs to 4-HNE. Alth ough DDAH activity was si gnificantly higher in the DDAH over-expressing cells exposed to 4-HNE as compared to the control, this increase in DDAH activity was not accompanied by an in in creased NO production (Figure4-9). Treatment of BAECs with the antioxidant GSH had mode st effect on the DDAH activity and did not significantly prevent the loss of DDAH activ ity following 4-HNE challenge, while the combination of DDAH over-expressi on and GSH increased DDAH activity by 50% (Figure 410) with near complete restoration of NO producti on (Figure 4-9). These results suggest that 4HNE causes NOS impairment through multiple mech anisms the first involving methylarginine accumulation. The second one being NOS uncoupli ng, because of its known oxidative effects on H4B(Vivar Vasquez). Evidence for NOS uncoupling is supported by our data demonstrating that DDAH over-expression in the presen ce of 4-HNE actually exacerba tes the effects of 4-HNE on NO production (Figure 4-9). In th is regard, we have previously reported that methylarginines inhibit nNOS derived superoxide, and as suc h, over-expression of D DAH would reduce this inhibitory effect resulting in increased NOS derived superoxide and reduced NO bioavailability [312]. Evidence for the multiple mechanisms through which 4-HNE mediates its effects are supported by our results demonstrating that GSH treatment alone or DDAH over-expression

PAGE 97

97 alone has only moderate protection from 4HNE induced NOS dysfunction. However, in combination, these two treatments largely restor ed endothelial NO gene ration (Figure 4-9). Therefore, complete protection of endothelial -derived NO generation from 4-HNE damage can only be achieved by both preventing NOS uncou pling and oxdiase generation from other oxidative soruces (GSH treatment) and met hylarginine accumulati on (DDAH over-expression). Discussion There is a growing volume of literature implicating ADMA as a key player in endothelial dysfunction and strong correlative data s uggesting that ADMA is involved in the pathophysiology of a variety of cardiovascul ar diseases including; hypertension and atherosclerosis [35, 303]. More recently we and others have shown that methylarginines are elevated in response to vascular injury and that this elevation in ADMA and L-NMMA results in impaired endothelial function [96, 313]. In add ition to mechanical inju ry, studies have also demonstrated that exposure of endothelial cells to pro-atherogenic lipopr oteins such as LDL, results in increased cellular ADMA levels [261]. Polyunsaturated fats in cholesterol esters, phospholipids and triglycerides ar e subjected to free radical ox idation. These polyunsaturated fatty acids can yield a variety of lipid hydrope roxides and highly reactive lipid peroxidation products such as the aldehyde 4-hydroxy-2-none nal (4-HNE). During inflammation and oxidative stress levels of 4-HNE have been show n to accumulate in membranes at concentrations from 10 m to 5 mM [290]. Moreover, studies have suggested that reac tive aldehydes/carbonyls such as 4-HNE may play a critical role in th e progression of atherosclerosis [291, 292]. Plasma concentrations of these lipid peroxidation pr oducts are known to incr ease relative to the progression of atherosclerosis, and during the oxidation of LDL high concentrations of these reactive aldehydes/carbonyls are formed. We thus hypothesized that elevations in lipid

PAGE 98

98 peroxidation products may result in impaired endothelial function a nd atherosusceptibility, secondary to NOS impairment. Therefore, studies were performed in order to determine the effects of the highly reactive lipid peroxidation product, 4-HNE, on endothelial-derived NO generation. Results demonstrated that the exposure of BAECs to 4-HNE cause d a dose-dependent inhibition of cellular NO production. The observed 4-HNE eff ects were independent of cha nges in either NOS expression or phosphorylation state, as the Western blotting an alysis revealed no changes in either endpoint. These results suggested that the observed NOS impairment involved mechanisms other than those related to protein expressi on. As such, subsequent experime nts were performed in order to determine whether alterations in NOS cofactors or substrate may be invo lved in the decreased NO bioavailability. In this regard, oxidant st ress, which has been shown to occur following exposure to lipid peroxidation products, has been shown to reduce the bioavailability of the critical NOS cofactor, H4B [290, 311]. Loss of this cofactor results in NOS uncoupling evident by impaired NO synthesis and enhanced supero xide production from the enzyme [310]. Moreover, oxidant injury has also been demons trated to increase the cellular levels of the endogenous methylarginine, ADMA [ 35]. Therefore, cellular st udies were carried out to investigate the effects of adding both an antioxidant (GSH) to prevent H4B oxidation as well as the eNOS substrate L-Arginine to overco me endogenous methylarginine-mediated NOS inhibition. Our data demonstrate that the addition of either GS H or L-Arginine alone had only modest NO-enhancing effects, however, co-incubation with bot h GSH and L-Arg was able to almost completely restore endothelial NO producti on. These data suggest that the observed NOS impairment involves both oxidant induced NOS i nhibition (alleviated by th e addition of GSH) as well as methylarginine accumulation (allevia ted by the addition of excess substrate).

PAGE 99

99 Direct measurement of ADMA levels and DDAH activity within cells by HPLC demonstrated that following 4-HNE challenge intracellular ADMA levels were increased greater than 2-fold. Based on previously published studies demonstrating the kinetics of ADMA mediated cellular inhibition, a 2 fold increase in methylarginine levels would be expected to inhibit NOS dependent NO generation by 20-30 % [96]. The additional inhibition observed could be due to compartmentalization or NOS uncoupling and increased NOS derived superoxide production in the presence of ADMA. To test this hypothesis, western blotting studies to measure nitrotyrosin e formation (Figure 4-11). A lthough no significant increase in ONOOformation was observed, this does not rule out NOS uncoupling as superoxide generation from the enzyme is likely below dete ction limits. In this regard, we have also employed EPR spin-trapping techniques to m easure eNOS derived endothelial superoxide production. These studies demonstrated incr eased levels of oxygen radicals which were inhibited by ~ 20% by L-NAME (Figure 4-12). L-NAME is currently the only known specific inhibitor of NOS derived super oxide production, however, this obs ervation is based primarily on studies from purified enzyme. Because L-NAME is a methyl ester and is subject to modification by cellular esterases, its intrace llular kinetics on NOS derived supe roxide production are not well characterized. Nevertheless, increased endothe lial superoxide production was observed from BAECs exposed to 4-HNE, however not all can be contributed to eNOS derived superoxide To determine whether the increased levels of ADMA observed following 4-HNE exposure resulted from changes in the activity of the ADMA metabolizing enzyme DDAH, its activity was measured. Studies of DDAH activity demonstrated a 40% decrease in hydrolytic activity, suggesting that the mechanism for the observe d 4-HNE-directed NOS impairment was via an inhibition of DDAH. Additional studies were performed on purified recombinant hDDAH-1 in

PAGE 100

100 order to determine whether 4-HNE effects were through direct interact ion with the enzyme. Results demonstrated that incubation of hDDAH-1 with 4-HNE (50 M) resulted in a > 40% decrease in enzyme activity. These effects we re specific to 4-HNE as incubation with the nonoxidized carbonyl hexanol (10-500 M) had no effect on DDAH activity (Figure 4-13). Similar studies were performed with purified recombinant eNOS and no inhibition was observed following 4-HNE exposure. 4-HNE forms Michael a dducts with histidine a nd cysteine residues on proteins. In this regard, th e catalytic triad of DDAH contai ns both cysteine and histidine residues and mutation of either amino acid has been demonstrated to render the enzyme inactive (Figure 4-14) [314-316]. As further support to the role of DDAH in me diating the inhibitory effects of 4-HNE on endothelial NO production, studies were performed using DDAH over-expressing BAECs. Over-expression of DDAH should lead to a decr ease in cellular methyl arginines with the concomitant increase in NOS-derived NO. DDAH over-expression was induced using an adenoviral construct carrying the human DDAH-1 gene (adDDAH1) (Figure 4-15). Preliminary studies demonstrated that incubation of BAECs with adDDAH1 at 25 MOI, resulted in a 3-fold increase in protein expression and a > 50% increase in DDAH activity following a 48 hour incubation. DDAH over-expression increased cellular DDAH activity in control cells by 50% and resulted in a 22% increase in cellular NO production (Figures 4-9 and 4-10), demonstrating that the endogenous levels of ADMA and L-N MMA are sufficient to significantly inhibit endothelial NO generation. If one then consider s the 2-fold increase in the levels of ADMA observed following the 4-HNE treatment, a 40 % inhibitory effect would be predicted [96]. Subsequently, a series of studies were perfor med using this same transduction protocol to examine the effects of DDAH over-expression on 4-HNE mediated endot helial NO inhibition.

PAGE 101

101 Although DDAH over-expression did increase DDAH activity and decrease endogenous methylarginines, the over-expres sion of the enzyme alone was not sufficient to prevent the 4HNE-induced decrease in NO production. In fact, our results demonstrated that exposure of DDAH over-expressing cells to 4-HNE resulted in worsened outcome as NO levels were significantly lower than that in the control cells exposed to 4HNE. Although these results may appear contradictory to our hypothesis, they in fact support it and demonstrate that NOS uncoupling is likely occurring. We have previous ly demonstrated that ADMA inhibits nNOSderived superoxide, and as such, DDAH over-e xpression in the presence of uncoupled NOS would be expected to eliminate ADMA and thus prevent ADMA mediated inhibition of NOSderived superoxide. The outcome of this w ould be reduced NO bioavailability through the reaction of available NO with superoxide, a reaction which occurs at diffusion limited rates. Our hypothesis would predict that treatment of DDAH ove r-expressing cells with an antioxidant would restore NO to levels similar to those observed with L-Arg and GSH treatment, if in fact methylarginines are contributing to the inhibition in NO generation seen with 4-HNE challenge. Indeed, we have demonstrated almo st complete protection of cellular NO production following 4-HNE challenge using a combina tion of viral over-expression of DDAH and treatment with GSH, when compared to the respec tive control. These resu lts would indicate that GSH alone reduces NOS uncoupling but not th e methylarginine accumulation, while L-Arg supplementation and/or DDAH over-expression overcomes the 4-HNE-induced increase in methylarginines but not the NOS uncoupling. In conclusion, our results demonstrate for the first time that the lipid peroxidation product 4-HNE can inhibit the endothelial NO productio n. The doses used in this study represent pathological levels of this highly reactive lipid peroxidation product and suggest that this

PAGE 102

102 bioactive molecule may play a crit ical role in the endothelial dys function observed in a variety of cardiovascular diseases. The inhibitory effects of 4-HNE appear to be mediated through both oxidant stress and elevated levels of the endogenous NOS inhibitors ADMA and L-NMMA, as either L-Arg supplementation or DDAH over-expressi on in the presence of an anti-oxidant were able to restore NO production. Together, these re sults represent a major step forward in our understanding of the regulation, im pact, and role of methylargini nes and lipid peroxidation in cardiovascular disease.

PAGE 103

103 Figure 4-1. Effects of 4-HNE on NO produc tion. NO generation from BAECs stimul ated with calcium ionophore A23187 (1 M) was measured by EPR spin trapping with the Fe-MGD complex. The left panel shows the amplitude of the NO triplicate EPR spectrum over 10 consecutive 1 minute scans after a 30 minute incubation period. The right panel shows the EPR spectra and the dose dependent effects of the 4-HNE treatment on NO production. Results represent the mean SD. indicates significance at p<0.05

PAGE 104

104 Figure 4-2. Effects of Hexanol on NO pr oduction. NO generation from BAECs stimul ated with calcium ionophore A23187 ( 1 M) was measured by EPR spin trapping with the Fe-MGD complex. The left panel shows the amplitude of the NO triplicate EPR spectrum over 10 consecutive 1 minute scans after a 30 minute incubation period. The right panel shows the EPR spectra and the dose dependent effects of the 4-Hexanol treatment on NO production. Results represent the mean SD. indicates significance at p<0.05

PAGE 105

105 Figure 4-3. 4-HNE effects on eNOS expression and phosphoryla tion. Protein was obtained from BAECs treated with va rying concentrations (1-50 M) of 4-HNE for 24 hours. For measurements of eNOS, p-eNOS ser1179 and p-eNOSthr 497 expression, 30 g of protein was loaded into each well, Lane 1 is non treated cells, Lanes 2-5 are cells treated with 4-HNE. Figure 4-4. Effects of 4-HNE on Ser1179 phophor ylation following calcium ionphore (5 M, A23187) stimulation. Protein was obtained from BAECs treated with varying concentrations (1-50 M) of 4-HNE for 24 hours. For measurements of eNOS and, p-eNOSser1179 expression, 30 g of protein was loaded into each well. Lane 1 is the cells treated with A23187, Lane 2 is non treate d cells, Lanes 3-6 are cells treated with 4-HNE

PAGE 106

106 Figure 4-5. Effects of L-argini ne and GSH supplementation on NO generation. NO ge neration from BAECs stimulated with calcium ionophore A23187 (1 M) was measured by EPR spin trapping with the Fe-MGD complex. Experimental groups consisted of untreated (Control); 1 mM L-arginine supplem entation (L-arg); 1 mM GSH supplementation (GSH); and 1 mM L-Arg with 1 mM GSH (L-arg + GSH) These experienment s were performed both in th e presence and absence of 4HNE (50 M). Results represent the mean SD. indicates significance at p<0.05

PAGE 107

107 Figure 4-6. Effects on 4-HNE on the levels of AD MA in BAECs. BAECs were cultured in T75 flasks and exposed to 50 M 4-HNE for 24 hours. Total cellular ADMA levels were measured using HPLC techniques and concentrations were determined as a factor of cell amount, cell volume and protein amount. Results represent the mean SD. indicates significance at p<0.05. Figure 4-7. 4-HNE effects on DDAH expression. DDAH-1 e xpression was measured by western blot techniques fr om BAECs trea ted with 50 M 4-HNE for 24 hours

PAGE 108

108 Figure 4-8. 4-HNE effects on DDAH activity. DDAH activity was measured from BAEC homogenates following a 24 hour incubation with 4-HNE (50 M) DDAH activity was measured from purified recombinant hDDAH-1 (5 g) following a 60 minute incubation with 50 M 4-HNE Experimental groups consisted of 50 M 4-HNE (4-HNE) and 50 M 4-HNE + 1 mM GSH (GSH). Results represent the mean SD. indicates sign ificance at p<0.05.

PAGE 109

109 Figure 4-9. Effects of DDAH ove r-expression on endothelial cell NO production following 4-HNE challenge. NO generation BAECs stimulated with calcium ionophore A23187 (1 M) was measured by EPR spin trapping with the Fe-MGD complex. Experimental groups consisted control vector (Control), DDAH over-expressing (DDAH), glutathione (1 mM) treated (GSH) and DDAH over-expression with GS H (1 mM) treatment (DDAH + GSH). These experiments were performed both in the presence and absence of 4-HNE (50 M). Results represent the mean SD. indicates significance at p<0.05.

PAGE 110

110 Figure 4-10. Effects of 4-HNE on endothe lial cell DDAH activity. DDAH activity was a ssessed by measuring the conversion of C14L-NMMA to C14-Citrulline. Experimental groups consisted control vector (Cont rol); DDAH over-expressing (DDAH); 1 mM glutathione supplementation (GSH); and DDAH over-expr ession with 1 mM GSH trea tment (DDAH + GSH). These experiments were performed both in th e presence and absence of 4-HNE (50 M). Results represent the mean SD. indicates significance at p<0.05

PAGE 111

111 Figure 4-11. Effects 4-HNE on nitrotyrsoine forma tion in BAECs. BAECs were treated with 50 M 4-HNE for 24 hours. Following the incu bation period, cells were stimulated with calcium ionophore (5 M A23187) and hom ogenized for western blot analysis. Results demonstrate no significant incr ease in protein tyrosine nitration.

PAGE 112

112 Figure 4-12. Effects 4-HNE on ROS formation from BAECs. BA ECs were treated with 50 M 4HNE for 24 hours. Following the incubation period, cells were stimulated with calcium ionophore (5 M A23187) a nd EPR measurements were performed using the spin trap DMPO (50 mM). Results demonstr ated an increase in the DMPO-OH adduct following 4-HNE treatment. This adduct was superoxide derived as it wa s largely quenched by the SOD mimetic M40403 (10 M). The DMPO-OH adduct was inhibite d by ~ 20% with L-NAME. s indicates the four peaks corresponding to the DMPO-OH adduct. The other 3 peaks are consistent with a carbon center radical.

PAGE 113

113 Figure 4-13. Effects of Hexanol on DDA H-1 activity. DDAH activity was measured from purified recombinant hDDAH-1 (5 g) following 60 minute incubation with Hexanol (1 0-500 M). Results represent the mean SD. indicates significance at p<0.05.

PAGE 114

114 Figure 4-14. MS/MS spectra of of a tryptic peptide generating th e sequence b/y-ion series from the in-gel digest of the hDDAH1 reacted with 4-HNE. The pe ptide observed at m/z 969.9+3 corresponds to the aa sequence 150-175 with H173 modified by HNE with the y3 y13, y15 and y 20 ions labeled al ong with the corresponding b4 b17, b24 b25 ions labeled.

PAGE 115

115 Figure 4-15. Adenoviral transduction of hDDAH -1 in BAECs. BAECs were treated with adDDAH-1 at various MOI (1050) to determine optimum viral titer. Results demonstrate a dose dependent increase in DDAH-1 expression at 48 hours post infection. CHAPTER 5

PAGE 116

116 REGULATION OF ENDOTHELIAL DE RVIED SUPEROXIDE BY THE METHYLARGININES Introduction The biological significance of guanidino-methyl ated arginine deriva tives has been known since the inhibitory actions of NGmonomethyl-L-Arginine (L-NMMA) on macrophage induced cytotoxicity were first demonstrated. This natu rally occurring arginine analog together with its structural congener asymmetric dimethylarginine (ADMA), are LArginine derivatives that are intrinsically present in tissues and they have th e ability to regulate the L-Arginine:NO pathway. These two compounds, along with NGnitro-L-Arginine methyl ester (L-NAME), have been shown to be potent inhibitors of eNOS activity [35, 298, 306, 317]. NO has been demonstrated as a critical effector molecule in the maintenance of vascular function [318-320]. In the vasculature, NO is deri ved from the oxidation of L-Arginine (L-Arg), catalyzed by the constitutively expressed en zyme, eNOS [158, 162, 321]. This endothelialderived NO diffuses from the vascular endothelium and exerts its effects on the smooth muscle cell layer where it activates gua nylate cyclase leading to sm ooth muscle cell relaxation [318320]. In addition to its role in the maintenance of vascular tone, NO helps to maintain the antiatherogenic character of the normal vascular wall. NO, in concert with various cell signaling molecules, has been demonstrated to maintain smooth muscle cell quiescence and as such, counteracts pro-proliferative agents, specifically those involved in the propagation of atheroproliferative disorders [24-29, 322]. As such, eNOS dysfunction is an early symptom of vascular disease and is manifested through insuffici ent NO bioavailability. Among the potential mechanisms proposed for this NO deficiency is the uncoupling of NOS and subsequent production of superoxide anion radical (O2 .-)

PAGE 117

117 Our laboratory and others have demonstrated that when cells are depleted of the NOS substrate L-Arginine (L-Arg) or the cofactor tetrahydrobiopterin (H4B), NOS switches from production of NO to O2 .[310, 323-329]. In the absence of either of these requisite substrates or co-factors, NOS mediated NADPH oxidation is uncoupled from NO s ynthesis and results in the reduction of O2to form O2 .[323, 324, 328, 330]. O2 .exerts cellular effects on signaling and function that are quite different and of ten opposite to those of NO. Thus, O2 .is another very important NOS product, and its production may also be regulated by methylarginines. Furthermore, in view of their strong inhi bition of NO generation, methylarginines could profoundly modulate the balance of NO and O2 .generation from the enzyme. ADMA and L-NMMA are derived from the proteolysis of va rious proteins containing methylated arginine residues. The methylation is carried out by a group of enzymes referred to as protein-arginine methyl transferases (PRMTs). Subsequent proteolysi s of proteins containing methylarginine groups leads to the release of fr ee methylarginine into the cytoplasm where NO production from NOS is inhibited [35, 298, 317]. In addition to inhibi tion of NO generation, methylarginines may have other im portant effects on NOS function. Cytosolic L-Arg concentrations are generally in the range of 100 to 200 M, and moderate L-Arg depletion has been observed in conditi ons such as wound healing and aging [306, 331336]. The redox active cofactor H4B has been shown to be highly susceptible to oxidative stress. Oxidation of H4B has been shown to result in NOS-derived O2 .generation [326, 327]. We have previously reported on the effects of methylarginines on nNOS-derived O2 .generation, however, little is known regarding the effects on eNOS [312]. Although L-NAME has been shown to block O2 .production from eNOS, studies using L-N MMA have suggested that this endogenous methylarginine does not appear to inhibit O2 .generation [324, 328, 329]. Furthermore, the

PAGE 118

118 effects of ADMA on O2 .release from eNOS have not been reported. In addition, there have been no studies of the effects of endogenous methylarginines on the O2 .production that occur in H4B -depleted enzyme. Therefore, critical questi ons remain regarding the fundamental effects of methylarginine analogues on eNOS function and the process of O2 .release from the enzyme. Since the levels of the intrinsic methylarginine s, L-NMMA and ADMA, have been shown to be sufficient to modulate basal eNOS function in a variety of cardiova scular disease settings, it is critical to understand the concentration-dependent effect of these compounds on O2 .generation from the enzyme. Therefore, in the present study, we have applied EPR spectroscopy and spin trapping techniques to measure the dose-dependent e ffects of ADMA and L-NMMA on the rates of O2 .production from eNOS under conditions of H4B depletion with normal or depleted levels of LArg. We observe that while bo th of these endogenous methyl arginines inhibit NO formation from H4B -repleat eNOS, in the presence of uncoupled -eNOS they significantly enhance eNOSderived O2 .-. In addition, we observed that the na tive NOS substrate, L-Arg, also enhances eNOS-derived O2 .-. All of these substrates, result in enhanced NADPH consumption and shift in heme spin state of eNOS resulting in increased eNOS derived O2 .-. This observation has important pathological relevance as NOS unc oupling is know to occur in a variety of cardiovascular diseases. Materials and Methods Expression and Purification of the Huma n Full Length eNOS and eNOS Oxygenase Domain (eNOSox) Human eNOS and eNOSox were expressed in E. coli similar to that previously described [337] and purified using metal affinity chromatography on a HisTrap FF column (GE Biosciences), followed by size exclusion chromatography using a HiLoad 16/60 Superdex 200

PAGE 119

119 column (GE Biosciences). Full-length human eNOS and eNOSox expressed in bacteria are devoid of biopterin. All eNOS pr eparations were stored at liqu id nitrogen temperature in buffer containing 50 mM HEPES, pH 7.5, 10% glycerol, and 0.15 M NaCl. H4B (+) eNOS and H4B (+) eNOSox were prepared by anaerobic incubati on of purified proteins with 1 mM H4B and 1 mM L-Arginine overnight at 4C. Excess H4B and L-Arginine were removed by gel filtration through a HiTrap desalting column at 4C. Protein fractions were pool ed, concentrated by Centriprep 30 (Amicon), and stored at liquid nitrogen temperature in the bu ffer described above. Typical NO generation activity of the final purified eNOS ranged between 80-120 nmol/mg/min, with eNOS concentration based upon heme content as de termined by the pyridine hemochromogen assay EPR Spectroscopy and Spin Trapping Spin-trapping measurements of NO and oxygen radical generation was performed using a either a Bruker ER 300 or a Bruker EMX spectro meter. The reaction mixture consisted of purified eNOS (50 nM) in 50 mM Tris, pH 7.4, containing 1 mM NADPH, 1 mM Ca2+, 30 M EDTA, 10 g/ml calmodulin, and 10 M H4B. For NO measurements, 25 nM eNOS and 100 M L-Arg was added to the reaction system with Fe2+-MGD (0.5 mM Fe2+ and 5.0 mM MGD) used to trap NO, as previously described [338] The samples were measured at X-band in a TM110 cavity. Spectra were obtaine d using the following paramete rs: microwave power; 20 mW, modulation amplitude; 3.16 G, modulation fre quency; 100 kHz. For the detection of O2 .-, eNOS (50 nM) was used in a reaction system containi ng 10 mM DEPMPO as the spin-trap. Spectra were obtained using the following paramete rs: microwave power; 20 mW, modulation amplitude; 0.5 G, modulation frequency; 100 kHz. Although multiple EPR spectrometers were used for the studies, quantitation of the free radical signals was normalized to each system by comparing the double integral of the observed signal with that of a known c oncentration of

PAGE 120

120 TEMPO free radical in aqueous solution. To quantify rates of O2 .generation, adduct signals were corrected for trapping efficiency and decay rate as previously described [339, 340]. Rates of O2 .formation were determined from the DEPM PO-OOH signal over the first 20 minutes of acquisition. NADPH Consumption by eNOS NADPH oxidation was followed spectrophotometri cally at 340 nm [ 326]. The reaction systems were the same as described in EPR measurements, and the experiments were run at room temperature. The rate of NADPH oxidation was calculated using an extinction coefficient of 6.22 mM-1 cm-1. UV/Visible Spectroscopy Spectra were recorded on H4B-free eNOSox (7.5 M) in 50 mM sodium phosphate (pH 7.4) from 300 to 800 nm, and then again in th e presence of either ADMA (500 uM) or L-NMMA (500 uM) using an Agilent 8453 diode array spectrophotometer. Results Effects of Methylarginines on O2 .Production from H4B Free eNOS We have previously reported that in the absence of H4B, NOS generates O2 .[328]. Therefore, to measure NOS-derived O2 .EPR measurements were car ried out as previously described with the nitrone spin-tra p DEPMPO, which forms a stable O2 .adduct with half life of 16 minutes [340]. Initial studies were performed in the presence of L-Arg in order to determine the ability of H4B-free eNOS to generate O2 .-. EPR results demonstrated a significant DEPMPO O2 .adduct which was inhibited by >80% in the presence of L-NAME (1 mM) and imidazole (5 mM). In addition, in the absence of Ca2+, O2 .generation was almost co mpletely blocked (Figure 5-1). These results demonstrate that the observed O2 .generation is eNOS-dependent and largely generated from the oxygenase domain, as the signal was quenched with imidazole.

PAGE 121

121 Subsequent studies were performed in orde r to determine the concentration-dependent effects of ADMA, L-NMMA and L-Arginine on O2 .production from eNOS. EPR spin-trapping measurements were performed on H4B -free eNOS as described in the methods. Purified eNOS was incubated in L-Arginine free buffer in th e presence of NOS cofactors (NADPH, calmodulin, calcium). In the absence of L-Arg, eNOS gave rise to a strong DEPMPO-OOH signal characteristic of trapped O2 .(Figure 52). The effects of ADMA on O2 .release were then determined by adding varying concentrations of ADMA (1.0 to 100 M). ADMA dosedependently increased NOS-derived O2 .generation, with a 43 % increase at 1.0 M, a 125 % increase at 10 M, and a 151 % increase at 100 M ADMA (Figure 5-2). Experiments were repeated in the presence of L-NMMA (1.0-100 M). L-NMMA dose-de pendently increased NOS-derived O2 .generation similar to that observed w ith ADMA, with a 18 % increase at 1.0 M, a 80 % increase at 10 M, and a 102 % increase at 100 M L-NMMA (Figure 53). A final set of experiments were carried out to examine pr evious observations that the native substrate LArginine is capable of increasing eNOS-derived O2 .(21). Results demonstrated that L-Arginine dose-dependently increased eNOS-derived O2 .with a 26 % increase at 1.0 M, a 116 % increase at 10 M, and a 152 % increase at 100 M L-Arginine (Figure 5-4). These results demonstrate that when eNOS is depleted of the critical cofactor H4B, as has been shown to occur under conditions of oxidative stress, ADMA, L-NMMA and L-Arginine enhance O2 .generation. Subsequent studies were then performed us ing an in-vitro system which could more closely mimic the disease setting wher ein eNOS is uncoupled through reduced H4B bioavailability and cellular methyl arginines are elevated in the presence of normal physiological levels of L-Arginine. Using this model, we measured the effects of ADMA and L-NMMA on H4B-free eNOS-derived O2 .production in the presence of phys iological levels of L-Arg (100

PAGE 122

122 M). As expected exposure to LArginine increased the rate of O2 .production 3 fold, and this increase was only mildly affected by the addition of ADMA (0.1 100 M) (Figure 5-5). In contrast, L-NMMA (0.1 -100 M) inhibited the formation of the observed O2 .adduct, with a ~30 % inhibition of the argi nine-induced increase at 100 M L-NMMA (Figure 5-6). Taken together, these results suggest that L-Argini ne, ADMA, and L-NMMA, independently increase eNOS-derived O2 .-. However, in the presence of physiol ogical levels of LArginine, ADMA has little effect on eNOS-derived O2 .-, while L-NMMA inhibits O2 .-. We hypothesized that these effects are mediated through alterations in the heme reduction potential upon ligand binding, leading to a faster transfer of electrons from th e reductase domain to the heme. If so, we would then expect to observe an increase in NADPH consumption rate as a consequence of increased electron flow through the heme. Effects of methylarginines and L-Ar ginine on NADPH Consumption from H4B-Free eNOS Experiments were performed to determine the effects of ADMA, L-NMMA and L-Arg on NADPH consumption rate from H4B-free eNOS. Results demonstrated that ADMA dosedependently increased the rate of NADPH consumption from H4B-free eNOS from an initial rate of 55 nmols/mg/min at 0 M ADMA to 86 nmols/mg/min at 10 M (Table 5-1). L-NMMA also dose-dependently increased NADPH consumption rate with values of 79 nmols/mg/min observed in the presence of 10 M L-NMMA (Table 5-1). L-Arginine had the most pronounced effects and like the methylarginines dosedependently increased the rate of NADPH consumption with an observed rate of 92 nmols/mg/min at 10 M L-Arginine (Table 5-1). Results from these studies support our previo us observations that methylarginines and LArginine enhance electron flux through the H4B -free enzyme, thus increasing O2 .generation.

PAGE 123

123 Effects of Methylarginines on the Heme of eNOSox L-Arginine and L-NMMA binding to NOS is known to alter th e spin-state of the heme iron, and this change in spin-state is accompanie d by a blue-shift in the Sorret absorbance peak of the NOS heme [341-344]. By using only the oxygenase domain we can remove any spectral contributions due to the flavins. Additionally, expression of eNOSox is much more robust than the full length enzyme. Therefore, studies were performed in order to measure the effects of methylarginine binding on the heme spin-sta te of the eNOS-oxygenase domain. Results demonstrated that, both ADMA and L-NMMA caused a blue-shift in the Soret absorbance, from a ~412 nm in the resting eNOSox to ~397 nm (Figure 5-7). Thus, just as for arginine and LNMMA, binding of ADMA produces a shift in th e eNOS heme spin state to high-spin. In summary, these results demonstrate for the first time that the methylarginines as well as the native NOS susbtrate, L-Arginine, enhance O2 .generation from H4B -free eNOS. We hypothesize that these effects are mediated through increased electr on transfer to the heme via a mechanism involving a change in the heme spin-s tate and the associated increase in the heme reduction potential that occurs upon inhibitor/substrate binding. Discussion It is well known that the endogenous methylarginine deri vatives, ADMA and L-NMMA, are capable of regulating NO genera tion from purified eNOS, and we have previously shown that their intrinsic levels in the endothelium are 10 M and are able to basally regulate endothelial NO production [306]. However, th eir role in controlling O2 .release from the enzyme was unknown. Therefore, the current studies were carri ed out in order to characterize and quantify the dose-dependent effects of L-Arginine and the endogenous met hylarginines on the O2 .generation from eNOS.

PAGE 124

124 Over the last several years, studies have s hown that in addition to producing NO, NOS is also capable of producing O2 .under conditions of L-Arginine or tetrahydrobiopterin depletion [310, 324-328]. In the endothelium, this O2 generation has been shown to be a significant mechanism of cellular injury [ 306, 328]. Although questions remain regarding the severity of these conditions that arise in normal cells, there is evidence that normal cellular oxidation of H4B can increase O2 .release [327]. Furthermore, a ra nge of disease conditions favor H4B depletion. These include hypertension, diabetes, ischemia/rep erfusion injury, and inflammatory processes [331-333, 345-349]. While prior studies have demonstrated th at loss of the critical NOS cofactor, H4B, results in NOS uncoupling and subsequent O2 .generation from the enzyme, the effects of the native substrate L-Arginine and its methylated NOS inhibitors, ADMA and L-NMMA, on eNOSderived O2 .have been previously unknown. Prio r studies from our laboratory have characterized the effects of ADMA and L-NMMA on nNOS-derived O2 .-. Results from the neuronal isoform demonstrated that that the endogenous methylargini nes, ADMA and L-NMMA modulate NO production and th at their effects on O2 .generation are H4B dependent. In the presence of H4B, ADMA selectively inhibited O2 .generation from the enzyme, while L-NMMA had no effect despite their stru ctural similarities. However, when NOS was depleted of H4B, ADMA no longer had any effect on O2 .production, while L-NMMA treatment resulted in a marked increase in O2 .production from the enzyme. Based on these observations, we carried out an extensive set of studies aimed at establishing the role of the methylarginines in regulating eNOS-derived O2 .-. Initial experiments were carried out in order to determine the ability of eNOS to produce O2 .-. Results demonstrated that in the absence of H4B, eNOS gave rise to a strong DEPMPO-

PAGE 125

125 OOH adduct characteristic of O2 .-. This signal was calcium-depe ndent and largely quenched in the presence of L-NAME (1 mM) and imidazole (5 mM). Thus the observed O2 .generation is eNOS-dependent and largely generated from th e heme of the oxygenase domain as the signal was quenched with imidazole. We observed that both ADMA and LNMMA dose-dependently enhanced O2 .generation from eNOS in the absence of H4B. A significant, (43%) enhancement, of NOS-derived O2 .was seen with 1 M ADMA, increasing to a 151% enhancement at 100 M. Of note, this O2 .production is blocked by imidazole indicating that the observed increase is due to an increase in heme-derived O2 .-. Results obtained using L-NMMA demons trated that the monomethylarginine also enhanced heme-dependent O2 production with an 18% increase observed at 1.0 M reaching a maximum of 102% at 100 M. Furthermore, the native eNOS substrate, L-Arg, which had been previously thought to reduce NOS generated O2 .-, also significantly enhanced O2 .-production from H4B-free eNOS in a dose-dependent manner. At 1 M, L-Arginine increases NOS-derived O2 generation by 26%, 116% at 10 M and by 152% at 100 M. In support of our obse rvations, it has recently been reported that the oxygen consumption of H4B -replete eNOS is also s timulated by the addition of arginine [350, 351]. These results have impor tant pathophysiological relevance, as normal cellular levels of L-Arg exceed 100 M and would thus be expect ed to significantly augment NOS-derived O2 .under conditions of reduced H4B bioavailability. This raises important questions with regards to the cu rrent practice of nutraceutical s upplementation with L-Arg in the treatment of cardiovascular dise ases such as hypertension and atherosclerosis in which NOSuncoupling is known to occur through oxidative loss of the cofactor H4B. In this setting, L-

PAGE 126

126 Arginine supplementation may actually exacerbate the disease resulting in increased NOSderived O2 .and further reduced NO bioavailability. Next we performed studies to determin e the effects of the ADMA and L-NMMA on eNOS-derived O2 .in the presence of physiol ogical levels of L-Arg (100 M). Results from these studies demonstrated that the addition of ADMA and L-NMMA did not further increase NOS-derived O2 .and in fact, L-NMMA decreased O2 .with a ~30% reduction observed at 100 M L-NMMA. Thus, as arginine is replaced by L-NMMA there is decreased enhancement of the eNOS-derived O2 .-, because L-NMMA binding produces less stimulation of the eNOSderived O2 .compared to the stimulation induced by L-Arginine binding. ADMA competition has very little effect becaus e ADMA and L-Arginine binding produce very similar levels of stimulation of eNOS-derived O2 .-. It should be noted that the precise interpretation of the competition data must include differences in binding affinities and binding cooperatively for LArg, ADMA, and L-NMMA. Nevertheless, our resu lts suggest that under nor mal or pathological conditions wherein total me thylarginines would not be expected to exceed 20-30 M, their major effect on eNOS would be to inhibit NO generation with only modest effect on NOS-derived O2 .-. However, if L-Arginine levels are low, the methylarginines would then increase NOS-derived O2 .from uncoupled eNOS. These results differ si gnificantly from what was previously observed with nNOS, wherein we demonstrated that on ly L-NMMA was capable of enhancing nNOSderived O2 .generation. In this previously publis hed study [312], we demonstrated that LArginine and ADMA had no effect on nNOS-derived O2 .under conditions of H4B /L-Arg depletion, while L-NMMA increased O2 .production by greater than 2 fold. Moreover, when experiments were carried out using H4B -free nNOS in presence of L-Arg (100 M), L-NMMA

PAGE 127

127 effects were maintained and O2 .generation dose-dependently increased with L-NMMA concentration, while ADMA had no effect [312]. The mechanism of O2 .production from the heme in NOS first requires the transfer of an electron from the reductase domain to the he me, generating the ferrous iron which can bind oxygen. Subsequently, the one electron reduced O2 .can dissociate, regenerating the ferric heme. The rate limiting step in this pro cess for eNOS is the initial reduc tion of the heme [352, 353]. As such, if the reduction of the heme is ma de more favorable, then the rate of O2 .production will be increased. It has been shown that binding of arginine and L-NMMA to the NOS isoforms produces a shift in heme spin-state, which can be monitored spectrophotometrically. This arginine-induced shift in spin-state is acco mpanied by an increase in the NOS heme redox potential to less negative values [354], theoretically this would produce an increased rate of electron transfer from the reducta se domain to the heme. This correlation between spin-state and heme midpoint potential is also found in the re lated cytochrome P450 family [355, 356]. Furthermore, it is known that the less negativ e heme redox potential produced by L-Arginine binding to the inducible NOS (i NOS) is accompanied by an increase in NADPH oxidase activity [357]. Thus, we hypothesized that the mechanism for the observed arginine and methylarginineenhanced O 2 production was via an increase in el ectron flow through eNOS produced by a change in the heme redox potential in response to a ligand-induced change in heme spin-state. Indeed, we found that just like L-Arginine and L-NMMA, ADMA binding to eNOS produced a shift in the heme to the high-spin stat e, which in turn will result in a less negative heme redox potential. Results from the NADPH consumption studies supported this hypothesis and demonstrated that ADMA, L-NMMA and L-Ar ginine dose-dependen tly increased electron transfer through the heme, consis tent with a ligand-induced incr ease in heme reduction potential.

PAGE 128

128 The rate of NADPH consumption increased in th e following order: no-s ubstrate < L-NMMA < ADMA < L-Arg. These data support the hypothesi s that the inhibitory actions of the methylarginines on O2 .generation in the presence of L-Argi nine resulted from less enhancement of electron transfer rela tive to L-Arginine. Thus, taken to gether our data s upport the hypothesis that ligand-induced changes in the heme sp in-state induced by L-Arginine and the methylarginines are at least partially responsib le for the observed increase in eNOS-derived O2 .-. However, it is clear that there are other factors to consider. L-NAME, which also induces the formation of the high-spin eNOS upon binding, very effectively inhibits O2 .formation from eNOS. This discre pancy has been noted for iNOS, and it was proposed that an electrostati c interaction between an electr on rich ligand and the NOS heme inhibits reduction of the NOS heme and thus decreases NADPH oxidation [ 358]. Conversely, an electrostatic interaction between a positively char ged arginine or methylarginine side chain and the heme iron, would theoretically favor the ferr ous form of the heme, producing a less negative midpoint potential, and thus increasing the rate of electron transfer to the heme. Additionally, substrate binding is known to stabilize the dime ric form of the enzyme, and since heme reduction is via an inter-monomer electron tr ansfer, this ligand-induc ed structural stabilization could affect the rate of this transfer. It has been proposed that the NOS isoforms can produce H2O2 via a two electron reduction of molecular oxygen [351, 359, 360]. Fo r this to occur, the rate of transfer of a second electron to the ferrous-heme O2 .complex, either from H4B or from the reductase domain, must exceed the rate of superoxide release. It has been demonstrated that in the absence of L-Arginine (or other substrate) the sole product of H4B -free eNOS is O2 .[351]. It is possible that our proposed substrate-induced increase in reduct ase-to-heme transfer rate in the H4B-free eNOS could allow

PAGE 129

129 for the direct production of H2O2. However, in preliminary experiments comparing O2 .-consumption to NADPH oxidation of the H4B -free enzyme, the addition of substrates produced similar increases in both O2 .-consumption and NADPH oxidation (unpublished results). Thus, although more definitive work is necessary, we have found no evidence for the substrate/inhibitor-induced direct production of H2O2 from uncoupled eNOS. In conclusion, the substrate L-Arginine and the endogenous inhibitors ADMA and LNMMA, increase the O2 .-generation from uncoupled eNOS by ma king the transfer of electrons to the heme more favorable via mechanisms invol ving the modulation of the heme spin-state, altering the electrostatic environm ent of the heme, and/or by alteri ng the structural stability of the active dimer. These findings have important c linical implications as methylarginine levels have been demonstrated to be elevated in a va riety of cardiovascular diseases associated with oxidative stress. In addition, LArginine supplementation in thes e conditions may exacerbate the NOS uncoupling observed in these conditions.

PAGE 130

130 Figure 5-1. Inhibition of NOS-derived O2.from H4B depleted eNOS. EPR spin-trappi ng measurements of O2.production from eNOS (50 nM) were performed in the presence of L-arg (100 M) as described in Methods. The right panel shows the spectra of the O2.adduct observed. Th e left panel shows the total amount of NOS-derived O2.-generation occurring over a 30-minute period. The results s how the effects of L-NAME (500 M), Imidazole (1 mM) and Ca2+-CAM removal on NOS-derived O2.production. Both inhibi tors largely blocked NOS-derived O2.generation. In the absence of calcium and calmodulin, no signal was observed. Results shown represent the mean SEM of 5 experiments.

PAGE 131

131 Figure 5-2. Effects of ADMA on eNOS-derived O2 .-. EPR spin-trapping measurements of O2 .production from H4B-free eNOS (50 nM) were performed with the addition of ADMA (0.01-100 M) and NOS cofactors as descri bed in Figure 5-1. The right panel shows the spectra observed after 30 min. The DEPMPO-OOH adduct signal was clearly seen. The left panel shows the time-course of NOS-derived O2 .generation determined from the observe d EPR spectra record ed over a 40-minute period in a series of experiments. Results graphed are the mean SEM. In the absence of H4B, NOS gave rise to a prominent DEPMPO-OOH signal characteristic of O2 .and this was dose-dependent ly increased by ADMA (1.0 M-100 M).

PAGE 132

132 Figure 5-3. Effects of LNMMA on eNOS-derived O2 .EPR spin-trapping measurements of O2 .production from H4B-free eNOS (50 nM) were performed with the addition of L-NMMA (0.01-100 M) and NOS cofactors as described in Figure 5-1. The right panel shows the spectra observed af ter 30 min. The DEPMPO-OOH adduct signal was clearly seen. The left panel shows the time-course of NOS-derived O2 .generation determined from the obs erved EPR spectra recorded over a 40minute period in a series of experime nts. Results graphed are the mean SEM. In the absence of H4B, NOS gave rise to a prominent DEPMPO-OOH signal characteristic of O2 .and this was dose-dependently increased by L-NMMA (1.0 M100 M).

PAGE 133

133 Figure 5-4. Effects of L-arg on eNOS-derived O2 .EPR spin-trapping measurements of O 2 production from H4B-free eNOS (50 nM) were performed with the addition of L-arg (0.01-100 M) and NOS cofactors as described in Figure 5-1. The right panel shows the spectra observed after 30 min. The DEPMPO-OOH adduct signal was clea rly seen. The left panel shows the time-course of NOS-derived O 2 generation determined from the observed EPR spectra recorded over a 40-minute period in a series of experiments. Results graphed are the mean SEM. In the absence of H4B, NOS gave rise to a prominent DEPMPO-OOH signal characteristic of O2 .and this was dose-dependent ly increased by L-arg (1.0 M-100 M).

PAGE 134

134 Figure 5-5. Effects of ADMA on O2 .production from H4B-depleted NOS in the presence of L-arg. EPR spin-trapping measurements of O 2 production from eNOS (50 nM) were performed in the presence of 100 M L-arg, with the addition of ADMA (0.1-100 M) and NOS cofactors (w/o H4B) as described in Figure 5-1. Re sults show the time-course of NOSderived O2 .generation determined from the observed EPR spect ra recorded in a series of experiments. H4B depleted eNOS gave rise to a prominent DE PMPO-OOH signal characteristic of O2 .-, which was increased in the presence of L-arg and unaffected by ADMA (0.1-100 M). Results graphed are the mean SEM.

PAGE 135

135 Figure 5-6. Effects of NMMA on NOS-derived O2 .in the presence of L-arg. EP R spin-trapping measurements of O2 .production from eNOS (50 nM) were perf ormed in the absence of 100 M L-arg, with the addition of NMMA (0.1-100 M) and NOS cofactors as described in Fi gure 5-1. Results show the time-course of NOS-derived O2 .generation determined from the observed EPR spectra recorded in a series of experiments. H4B-depleted eNOS gave rise to a prominent DEPMPO-OOH signal characteristic of O2 .-, which was increased in the presence of L-arg and unaffected by ADMA (0.1-100 M). Results graphed are the mean SEM.

PAGE 136

136 Figure 5-7. Methylarginines a lter the eNOS-bound heme. The UV/Vis spectrum for the eNOS oxygenase domain (7.5 M) in 50 mM sodium phosphate (pH 7.4) was recorded from 300 to 800 nm, a nd then again in the presence of either ADMA (500 uM) or NMMA (500 uM).

PAGE 137

137Table 5-1. Effects of Methylarginines and L-arg on NADPH consumption from H4B-free eNOS (100 nM) Substrate 0.0 M 0.1 M 1.0 M 10.0 M L-arginine 55 67 79 92 ADMA 55 62 74 86 L-NMMA 55 61 70 79 The dose-dependent effects of ADMA, L-NMMA and L-arg on NADPH oxidation was follo wed spectrophotometrically at 340 nm [326]. The reaction systems were the same as described in EPR measurements, and the experiments were run at room temperature for 2 minutes. Results are SEM.

PAGE 138

138 CHAPTER 6 REGULATION OF DIHYDROFOLATE REDUCT ASE IN THE DIABETIC ENDOTHELIUM Introduction Endothelial derived Nitric Oxide (NO) is s ynthesized from the oxidation of the guanidino carbon of the amino acid L-Arginine to NO and L-citrulline. This reaction is catalyzed by the enzyme nitric oxide synthase (NOS). NO is a pot ent vasodilator and critical effector molecule involved in the maintainence of vascular homeost asis, through its anti-p roliferative and antithrombotic effects. NO, in concert with various cell signaling molecules, has been demonstrated to maintain vascular smooth muscle cell quies cence and as such, counteracts pro-proliferative agents specifically those involved in the propagation of athero-proli ferative disorders. Diabetes has long been associated with increased oxidative stress and impaired va scular function. NOS dysregulation and decreased NO bioavailability have been implicated as a central mechanism in vascular endothelial dysfunction observed in diabet es. Several studies have demonstrated that while eNOS protein levels are increased in the diabetic state, NO bioava ilability decreases and superoxide production increases [361]. Among the proposed mechanisms that lead to decreased NO bioavailability and eNOS uncoupling is oxidation of the essential NOS cofactor Tetrahydrobipetrin (H4B). In vitro studies have demonstrated that H4B stabilizes and donates electrons to the ferrous-dioxygen complex in the oxygenase domain of eNOS to help facilitate the oxidation of the substrate L-Arginine. Furtherm ore, studies have demonstrated that depletion of H4B causes electrons to be donated to molecu lar oxygen, turning NOS from a NO generating enzyme to an oxidase. This phenomenon has been termed NOS uncoupling and it has been documented in the pathophysiology of various diseases including atherosclerosis and diabetes (56,119,120). H4B is highly redox sensitive and can be readily oxidized to its inactive form dihydrobiopterin (H2B). Therefore, it is likely that during increased oxidative stress intracellular

PAGE 139

139 levels of H4B fall leading to NOS uncoupling and the enzyme primarily being a O2generating enzyme. The synthesis of H4B occurs via two pathways in th e endothelial cell, the de novo and salvage pathways (Figure 6-1) De novo biosynthesis of H4B is a magnesium, zinc and NADPH dependent pathway. The first step require s the conversion of GTP to 7,8-dyhydroneopterin triphosphate. This reaction is catalyzed by the enzyme GTP cyclohydrolase I (GTPCH), and it is the rate limiting step in H4 B biosynthesis [52]. Following the GTPCH enzyme reaction pyruvoyl tetrahydropterin synthase (PTPS) converts 7,8 dihydrone opterin triphosphate into 6pryuvoyl-5,6,7,8-tetrahydropterin. Alternatively, the salvage pa thway enzyme dihydrofolate reductase (DHFR) is a NADPH dependent enzy me that catalyzes the conversion of H2B to H4B (140). The functionality of the DHFR en zyme in the endothelial cell was unknown until recently. The strongest evidence for the invol vement of DHFR involve ment in regulating endothelial NO production has come from DHFR gene silencing studies. Specifically, Chalupsky et al. demonstrated that DHFR gene silencing resulted in a significant reduction in H4B levels, as well as a 50% reduction in endot helial NO production [133]. Furthermore, DHFR over-expression was able to abolish the production of O2 .in angiotensin II stimulated cells [133]. Because DHFR activity has been demonstr ated to be involved in the regulation of NO bioavailability, it is important to understand how the enzyme activity is affected in disease states. Therefore, studies were carri ed out to determine the effects of oxidative stress and metabolic dysregulation on DHFR activity. We observed that DHFR is highly resistant to most oxidants at concentrations within the pathophysiological range. We also observed that at low concentrations of OONODHFR activity is sign ificantly increased. Additionally, using the diabetic db/db mouse model we observed reduced DHFR activity, impaired vascular function

PAGE 140

140 and increased eNOS derived superoxide in the aorta. These observations have important implications for the role of oxidative stress a nd its effects on DHFR activity as it relates to the diabetic state. Materials and Methods. Materials DHFR, H2O2, Xanthine and Xanthine Oxidase were purchased from Sigma-Aldrich (St Louis, MO). Peroxynitrate was purchased fr om Millipore(Lake Placid,NY) Diethylamine NONOate was purchased from Sigma=Aldrich(St.Louis, MO) DHFR Activity Assay For kinetic measurements of enzyme ac tivity, human recombinant DHFR (6.0 ug) was incubated for 5 minutes at 25C in 50 mM Tris buffer (pH 7.5) in the presence of .01-1000 M substrate with a total reaction volume of 100 l. Following incubation each sample was added to a 96 well plate and NADPH consumption was measured at 340 nM. The rate of NADPH consumption was calculated using an extinction coefficient of 6.22 mM-1cm-1. Tissue DHFR Activity For kinetic measurements of tissue DHFR activity, kidneys were removed from age matched control mice and db/db mice on a C57/Blk6 background. The samples were homogenized in diionized water with ascorbic acid (1 mg/ml) to prevent auto-oxidation. Protein concentration was measured by the Bradford assay. 250 g of protein, 200 m H2B and 1 mM NADPH were incubated together for 30 minutes at 37C in a water bath. Following the incubation the samples were then loaded into a Centricon filter with a 3,000 molecular weight cut off and centrifuged at 10,000 x g, 4 C for 60 minutes.

PAGE 141

141 HPLC Techniques DHFR activity assay was performed by measuring the conversion of H2B to H4B using HPLC techniques.20 l of the filtrate was then injected into onto the HPLC column using an ESA HPLC with electrochemical gradient dete ction a 400 mV and 800 mV. The mobile phase consisted of Buffer A (100 mM KH2 PO4,25 mM octyl sodium sulfate,0.6 mM EDTA PH 2.5), Buffer B (2% MeOH) run at room temper ature with a flow rate of 1.3 ml/ml Vascular Reactivity Contraction and relaxation of isolated aortic rings were measured in an organ bath containing modified Krebs-Henseleit buffer (118 mM NaCl,24 mM NaHCO3,4.6 mM KCl,1.2 mM NaH2PO4,1.2 mM CaCl2,4.6 mM HEPES and 18 mM glucose) aerated with 95%CO2/5%O2,37C. Aortic rings were cut inton 2to3 mm segments and mounted on a wire myograph (Danish Myo, Aarhus, Denmark). Cont raction was measured via a force transducer interfaced with Chart software for data anal ysis. Following a 30-min incubation equilibration period, the rings were stretched to generate a tension of 0.5 g. Th e optimum resting force of the aortic rings was determined by comparing th e force developed by 40 mM KCL under varying resting force. Aortic rings were preconstricted w ith 1 M phenylephrine. The vascular relxation response was determined using increasing concentrations of acetylcholine (0.1 nM to 10 M) EPR Spin Trapping Studies Given the millisecond-range half-life of superoxide in situ electron paramagnetic resonance (EPR) assay involves the approach of using the su peroxide spin-trap, 1-hydroxy-3methoxycarbonyl-2,2,5,5-tetramethyl pyrrolidine HC l (CMH hydrochloride; Axxora) (8, 9, 11, 16, 18) to generate a stable chemical product, 3-methoxycarbonylproxyl, by a general method. Stock solution of CMH (10 mM) dissolved in EPR buffer [PBS containing 2M Diethyldithiocarbamate (Sigma-Aldrich) and 50 M Desferrioxamine (Sigma-Aldrich)] and

PAGE 142

142 purged with Nitrogen, were prepared daily and kept under nitrogen on ice. Six aortic ring segments (1 mm) were placed in EPR buffer. CM H at a concentration of 50 M was then added and incubated at 37C for 60 min with and without L-NAME (1 mM). Frozen samples were analyzed with a Benchtop ESR Spectrometer (Bruker Biospin) in a finger Dewar filled with liquid nitrogen with following EPR settings: microwave frequency 9.7 GHz, microwave power 1.2 mW, modulation amplitude 6.7 G, conversio n time 10.3 ms and time constant 40.96 ms. Results Enzyme Kinetics of DHFR Enzyme kinetic studies were performed to establish the Km and Vmax values for H2B. The kinetic activity of human DHFR (hDHFR) was measured by the detection of NADPH consumption as described under the Material and Methods. Km and Vmax values were derived using the Michaelis-Menten equation and genera ted values of 48 M and 6.7 mols/mg/min, respectively (Figure 6-2). Effect of Oxidants on DHFR Activity Previous studies have dem onstrated that DHFR expressi on can be affected following exposure to H2O2. Because H4B is known to be highly sensitive to oxidants leading to its oxidation to H2B, it may also be possible that DHFR is modulated by the redox environment which could result in impaired H4B recycling. Therefore, we ca rried out a series of studies aimed at determining the dose dependent effects of NO, OONO-, H2O2, and O2 .-on DHFR activity. NO studies were carried out us ing the NO donor compound DEANONate (1 M-1 mM). H2O2 (1 M-1 mM) and OONO(0.01 M-1 mM) studies were carried out using the authentic oxidant. For O2, we used a generating system cons isting of xanthine and xanthine oxidase (1 M-1 mM). In order to prevent Fenton type reactions in the H2O2 experiments, the Fe chelator DTPA (100 M) was added. The exposure of DHFR to oxidants was found to have a

PAGE 143

143 modest effect on enzyme activity. Results demo nstrated that following exposure to NO, hDHFR activity was dose dependently re duced with 38 % inhibition observed at 100 M NO and 53% inhibition observed at 1 mM (Figure 6-3). Re sults also demonstrated that exposure to H2O2 dose dependently decreased activity w ith 31% inhibition at 100 M H2O2 and 53% inhibition at 1 mM (Figure 6-4). Furthermore, O2-dose dependently inhibited hDHFR activity as 1 M and 1 mM elicited a 28% and 70% inhibition respectively (Figure 6-5). A dditional studies demonstrated that hDHFR activity was significantly increase d 56-58% following exposure to 0.01 M and 1 M of OONO(Figure 6-6). In contrast, at the 10 M and 100 M concentra tions no significant changes in activity were observed. However, ex posure to 1 mM OONOresulted in a modest inhibition of 24%. Effects of the Diabetic Stat e on In-Vivo DHFR Activity Previous studies have suggested that increases in oxidative stre ss, as have been observed in diabetes, contribute to decrea sed endothelial NO generation through a mechanism involving the loss of H4B. In support, it has been obse rved in several studies that H4B supplementation restores endothelial NO generation (56,54,209). However, whether DHFR activity is also sensitive to the redox environmen t is unknown. Therefore, in orde r to determine the effects of the diabetic disease state on DHFR activity, basal activity in the kidney of db/db mice and age matched controls was measured. Using HPLC techniques, hDHFR activity was measured as described in the Materials and Methods. Results demonstrated that db/db mice had significantly more H2B than the age matched control mice. Furthermore, the control mice produced significantly more H4B than the db/db mice (Figure 6-7). Overall, these results suggest that the diabetic condition of the db/db mice results in a si gnificant decrease in DHFR activity, which is likely involved in eNOS uncoupling as a result of altered B2H/B4H ratios. To confirm

PAGE 144

144 this, we preformed additional studies to dete rmine the effects of decreased DHFR activity on vascular function. Effects of the Diabetic Stat e on Vascular Reactivity Our previous results demonstrated that tissue DHFR activity was reduced in the diabetic db/db mouse model, which result ed in reduced levels of H4B. Therefore, vascular studies were performed using mouse aortic rings and the vascul ar relaxation in response to acetylcholine (1 M) was measured. The percent relaxation to 1 M Ach was then compared among the control and db/db groups. Results demonstrated that db/db mice had a 35% reduction in vascular relaxation in response to 1 M Ac h, when compared to their aged matched controls (Figure 6-8). Effects of the Diabetic State on eNOS Derived O2 .Production in the Aorta Previous studies have demons trated that depletion of H4B under oxidative stress conditions increases the production of eNOS derived supe roxide in the vasculat ure (54,211). Although our data demonstrated that db/db mice have a sign ificant reduction in DHFR activity and impaired vascular function, we wanted to examine whether the loss of DHFR activity would also resulted in increased vascular eNOS derived O2 .-. Therefore, EPR spin trap ping studies were carried out to measure eNOS derived O2 .in the aorta. Results demonstrated that the aorta of db/db mice produced significant O2 .-, while in wt type age matched co ntrols it was undetectable. This increase in O2 .production was attenuated following exposure to the NOS inhibitor L-NAME (Figure 6-9). Overall, these st udies support the hypothe sis that loss of DHFR activity is involved in the endothelial dysfunction asso ciated with diabetes and that loss of DHFR activity increases eNOS derived O2 .in the aorta. Discussion There is a growing body of ev idence indicating that the in creased cardiovascular risks associated with diabetes are due to oxidative stress and eNOS dysfucntion. In support, several

PAGE 145

145 studies have reported that the pathology of di abetes results in decr eased endothelial NO production, impaired vascular function, and increases in eNOS derived O2 .generation (54,56,211). The primary pathway way for H4B synthesis is through th e de novo pathway which involves the rate limiting enzyme GTPCH I. Previ ous studies have demonstrated that inhibiting GTPCH I leads to impaired vascular relaxation in response to Ach. Over-expression of GTPCH I was found to partially restore vascular func tion in diabetic mice (208). However, under pathological conditions in which oxidative stress increases and in which H4B can be readily oxidized, DHFR activity maybe critically important in maintaining H4B levels and endothelial NO production. Therefore, studies were carried ou t in order to investigate the redox regulation of DHFR and its role in diabetic vasculopathy. Despite its importance of H4B regulation during oxidative st ress, few studies have been done regarding the enzymatic activ ity of DHFR. Furthermore, the few studies which exist have been conducted using rat brain homogenates. In this regard, we have recently measured the kinetic parameters of the human isoform of DHFR Results from these studies demonstrated the Km value of 48 M and Vmax value of 6.7 mols/mg/min for H2B. The Km value obtained correlates well with the previously published re port in which the value of 88 M was reported. However, the maximal enzymatic activity that we report here differs from the previously published using DHFR from rat brain, in whic h a value of 30 pmole/mg/min was reported, however this was for dihydrofolate metabolism, as DHFR is also known to be an important enzyme in folate metabolism [362]. Cai et al. demonstrated th at following exposure to H2O2, DHFR expression decreased in cultured endothelial cells [133]. These studies suggest that DHFR activity may be modulated by the redox environment. Therefore, studies were conducted in order to de termine the effect of

PAGE 146

146 various reactive oxygen and nitr ogen species on DHFR activity. Following exposure of DHFR to NO, OONO-, H2O2, O2-, we observed that at concentr ations between 1 M -100 M, NO elicited a 31-38% decrease in DHFR activity. Additionally, at the 1 mM concentration a 53% loss in enzyme activity was observed. In s upport of our results, previous studies have demonstrated that following exposure to NO, protei ns can be s-nitrosylat ed at active cysteine residues resulting in altered enzy me activity (95,96,97). Similar effects on DHFR activity were observed following exposure to H2O2. We also observed a dose dependent decrease in DHFR activity in the presence of O2 .with 1 M and 1mM eliciting a 28% and 70% decrease in enzyme activity respectively. Ad ditional studies exposing DHFR to OONOat low pathophsyiologicaly relevant concentrations (0.1 M1 M) demons trated a significant increase DHFR activity. This result was surprising as OONOhas been demonstrated to increased eNOS derived superoxide production in vascular aortic rings, suggesting it has a role in eNOS uncoupling [363]. In contrast, higher pathophys iological concentrations of OONO-(10-100 M) resulted in no change to DHFR activity. Only a modest inhibition of 24% was observed following exposure to 1 mM OONOhowever, this does not represent physiological or pathophysiological relevant concentrations. Overall these results suggest that the DHFR enzyme is moderatley sensitive to ROS mediated inhibition in the pathophysiolo gical/physiological relevant dose ranges. However, OONOat pathophysiologically relevant levels induced a significant increase DHFR activity. This is an intriguing finding given that ONOOhas been shown to be the most potent oxidizer of H4B and may represent a novel compensatory mechanism for the cell to maintain adequate H2B / H4B ratios. In prior studies it has been obs erved that diabetes is associ ated with increased oxidative stress, and NOS uncoupling. Howeve r, no studies to date have examined the role of diabetes and

PAGE 147

147 its effects on DHFR activity. Therefore, we carried out in vivo studies in order to determine the effects of the diabetic state on tissue DHFR activ ity. We observed that in the kidney of db/db mice, DHFR activity was significantl y inhibited when compared to wt age matched control. This decrease in DHFR activity resulted in increased H2B levels in db/db mice. Our findings are in line with previous reports of increased H2B levels in diabetic mice [361, 364]. In addition, previous reports have also demons trated that alterations in the H2B/ H4B ratio is an important trigger in NOS uncoupling [208]. Taken together these results represent a potential mechanism linking diabetes to vascular endothelial dysfunction. Next, we carried out studies to determine the effect of the loss of DHFR activity on aortic vascular relaxation. Results demonstrated a 35% impairment of the NO mediated vascular relaxation in db/db mice when compared to the wt age matched controls. Additional studies were carried out to determine the effect of decreased DHFR activity and eNOS derived O2 .in the aorta. In contrast to the wild type mice, resulted demonstrated that eNOS derived O2 .was detectable in the isolated aorta of db/db mice. In support of our findings, in the streptozotocin induced model of diabetes, mice were observed to have impaired vascular function and increased aortic eNOS derived O2 .that was attenuated in the presence of H4B [204]. Overall these results provide evidence for our hypothesis that loss of DHFR activity leads to endothelial dysfunction in diabetes. Future studies using a gene therapy approach will be carried out in order to provide further eviden ce for the importance of the modulation of DHFR activity and its role in vascular endothelial dysfunction. In addition to animal studies, cellular studies will examine the effects of the H2B/ H4B ratio in regards to preserving endothelial NO production. We hypothesis that adenoviral medi ated over expression of the DHFR gene will

PAGE 148

148 result in improved vascular endothelial function and endothelial NO generation in the diabetic condition. In conclusion, this is the first study to de monstrate that DHFR can be regulated by redox environment in vivo. However, most oxidants ha ve a modest effect on DHFR activity. Also, we have demonstrated for the first time that OONOincreases DHFR activity, which could potentially be protective mechanism in which th e cell acts to preserve endothelial NO generation. Furthermore, we have also demonstrated that th e loss of DHFR in db/db mice results in impaired vascular relaxation and in creased eNOS derived O2 .-. Moreover, the loss of DHFR activity may represent a novel mechanism in endothelia l dysfunction associated with diabetes.

PAGE 149

149 Figure 6-1. H4B biosynthesis pathway. H4B is synthesized in the endothelial cell by either the de novo or salvage pathway.

PAGE 150

150 Figure 6-2. DHFR enzyme kine tics. hDHFR was incubated in the pres ence of varying concentrations of B2H(1 M-1 mM). DHFR activity was measured by the rate of NADPH consumption as measured by absorbance at 340 nm. The Km and Vmax were fitted using the Michaelis-Menton equation. The Km was found to be 48 M and the Vmax was found to be 6.7 mols/mg/min

PAGE 151

151 Figure 6-3. Effects of Nitric Oxide on hDHFR activity. hDHFR was exposed to varying concentrations (1 M-1 mM) of Nitric Oxide. hDHFR activity measured by the rate of NADPH consumption as measured by absorbance at 340 nm Nitric oxide was found to dose dependently reduce hDHFR activity with 38 % inhibition ob served at 100 M NO and 53% inhibition observed at 1mM. Results represent the mean SD n=3

PAGE 152

152 Figure 6-4. Effects of H2O2 on hDHFR activity. hDHFR was expos ed to varying concentrations (1 M-1 mM) of H2O2. hDHFR activity measured by the rate of NADPH consumption as measured by absorbance at 340 nm. H2O2 dose dependently decreased hDHFR activity with 31% inhibition at 100 M H2O2 and 53% inhibition at 1 mM. Results represent the mean SD n=3

PAGE 153

153 Figure 6-5. Effect of O2 .on dDHFR activity. hDHFR was exposed to varying concentrations of (0.01 M-1 mM).of Xanthine Oxidase and Xanthine(1 unit/mg) to generate O2 ..hDHFR activity was measured by NADPH c onsumption as measured by absorbance at 340 nm. O2 .was demonstrated to dose depende ntly inhibit DHFR activity with 1 M and 1 mM eliciting a 28% and 70% inhibi tion respectively. Results represent the mean SD. indicates signi ficance at p<0.05. n=3

PAGE 154

154 Figure6-6. Effects of OONOon hDHFR ac tivity. hDHFR was exposed to varying concentrations of (0.01 M-1 mM).of OO NO-. hDHFR activity was measured by NADPH consumption as measured by abso rbance at 340 nm. OONOwas observed to increase DHFR activity 56-58% follo wing exposure to 0.01 M and 1 M. Exposure to 1 mM OONOresulted in a modest inhibition of 24%. Results represent the mean SD. indicates significance at p<0.05. n=3

PAGE 155

155 Figure 6-7. Effects of the diab etic condition on in-vivo DHFR activity. HPLC studies were carried out the measure basal DHFR activity in the kidneys of db/db and wild type age matched control mice. DHF R activity was observed to be significantly decreased in the db/db mice populat ion (2) vs. the age matched c ontrols (1) Peak (3) is a H2B standard. 3 2 1

PAGE 156

156 Figure 6-8. Effects of the diabetic state on vascular reactivity. The effects of th e diabetic state on vascular relaxation re sponse to AcH(0.1-1 M) were determined using mice aortic rings from db/db mice and age matched wild type controls. Following phenylephrine-induced constriction, Ach (0.1 nM to 10 M) was added to the ba th and the relaxation response was measured. Results represent the mean SD. indicates significance at p<0.05. n=4

PAGE 157

157 Figure 6-9. Effects of the diab etic condition on eNOS derived O2 .in the aorta. EPR spin-t rapping measurements of O2production from mouse aortic rings were performed. The panel shows the spectra of the O2 .adduct observed. The results show the effects of L-NAME (500 M) on eNOS derived O2 .production, which blocked eNOS derived O2 .-.

PAGE 158

158 CHAPTER 7 DISCUSSION ADMA and L-NMMA are endogenous NOS inhibitors derived from the proteolysis of methylated arginine residues on various proteins. The methylation is carried out by a group of enzymes referred to as protein-arginine methyl transferases (PRMTs) [35]. In mammalian cells, these enzymes have been classified into type I (PRMT1, 3, 4, 6, and 8) and type II (PRMT5, 7, and FBXO11) enzymes, depending on thei r specific catalytic ac tivity. Both types of PRMT, however, catalyze the fo rmation of mono-methylarginine (MMA) from L-arginine (LArg). In a second step, type I PRMTs produ ce asymmetric dimethylar ginine (ADMA), while type II PRMT catalyzes symmetric dimet hylarginine (SDMA) [365, 366]. Subsequent proteolysis of proteins cont aining methylarginine groups l eads to the release of free methylarginine into the cytoplasm where NO production from NOS can be inhibited. Free cytoplasmic MMA and ADMA are degraded to ci trulline and monoor dimethylamines by dimethylarginine dimethylami nohydrolases (DDAH) [367]. While on the other minor clearance of unchanged plasma methylargini nes are cleared from the circ ulation by renal excretion and hepatic metabolism [304, 367]. In additi on to the DDAH pathwa y, ADMA can also be converted to -keto valeric acid by alanine:glyoxylat e aminotransferase [368], although the influence of this pathway on total ADMA metabolism has not been extensively studied thus far. Moreover, the demethylation of methylarginines is believed to be restricted to free methylarginines, as a potential mechanism for po ssible demethylation of protein-incorporated methylarginines in situ have not yet been identified. It should be noted, however, that the conversion of protein-incorporated L-NMMA to citrulline by pe ptidylarginine deiminase 4 was recently demonstrated, which prevented histone methylation by PRMT 1 and 4 [369, 370]. This may influence protein methylation directly, as L-NMMA deimination will decrease the amount

PAGE 159

159 of protein-incorporated MMA that is available for dimethylati on by PRMT, but the relevance of protein deimination of proteinincorporated MMA by PAD enzymes has been challenged recent [369]. Asymmetric dimethylarginine ( ADMA) plasma levels have been shown to be elevated in diseases related to endothe lial dysfunction including hyperten sion, hyperlipidemia, diabetes mellitus, and others [267, 268, 270-272]. Moreover, it has been shown that ADMA predicts cardiovascular mortality in patients who have co ronary heart disease (CHD). Recent evidence published from the multicenter Coronary Artery Ri sk Determination investigating the Influence of ADMA Concentration (CARDIAC) study has indi cated that ADMA is indeed an independent risk factor for CAD [273]. However, whether th e increased risk associated with elevated ADMA is a direct result of NOS impairment is an ar ea of controversy. Significant debate about the contribution of ADMA to the regulation of NOS-d ependent NO production has been initiated. In pathological conditions such as pulmonary hypertension, coronary artery disease, diabetes and hypertension, plasma ADMA levels ha ve been shown to increase from an average of ~0.4 M to ~0.8 M [269, 272, 273, 276-278]. Given th at these values are at least 2 orders of magnitude lower than the plasma L-arg levels it is unlikely that elevated plasma ADMA can significantly regulate eNOS activity. It is more li kely that elevated plasma ADMA levels reflect increased endothelial concentrations of ADMA. In support of this hypothesis, we and others have demonstrated that endothelial ADMA levels increase 3-4 fold in re stenotic lesions and in the ischemia reperfused myocar dium [96, 279]. Based on cellular kinetic inhibtion studies from our lab in which we observed sigfinciant inhibtion of NO production at 5M ADMA, these concentrations of ADMA would be expected to elicit a 30-40% inhibition in NOS activity [96]. These studies however involve le sion specific increases in ADMA and are not associated with

PAGE 160

160 increased plasma levels of ADMA and would not be expected to contribute to systemic cardiovascular pathology. In this regard, there is little direct evidence that elevated plasma ADMA levels are associated with increased en dothelial ADMA nor is it clear whether plasma ADMA directly contributes to the NOS inhibition observed in chronic ca rdiovascular diseases and other disease such as end stage renal disease. The principal mechanism put forth to expl ain the pathological role of ADMA in cardiovascular diseases has focused on DDAH. It has been demonstrated that diabetes and hypertension are associated w ith reduced DDAH activity which is believed to result in ADMA accumulation to levels associated with NOS inhibition. However, a direct cause-effect relationship between DDAH activity a nd NOS inhibition has not been demonstrated. It has been estimated that more than 80% of ADMA is metabolized by DDAH [267], however, it is unclear which DDAH isoform represents the principal methylarginine metabolizing enzyme. PCR and western blot analysis has revealed that the endothelium contains mRNA and protein for both DDAH-1 and DDAH-2. However, in order to assess the relative contribution of each isoform a detailed analysis of the enzyme kinetics of each isofrom is necessary. Unfortunately, detailed biochemical studies have only been published for DDAH-1. Using purified recombinant hDDAH-1 we and others have demonstrated the precise enzyme kinetics of this isofrom and results demonstrated Km values of 68.7 and 53.6 M and Vmax values of 356 and 154 nmols/mg/min for ADMA and L-NMMA, respectively [228, 249]. In regards to DDAH-2, previous attempts at purifying the protein have been unsuccessful primar ily due to solubility issues with recombinant enzyme expressed in e.coli. Recently we have successfully purified recombinant human DDAH-2 from bacterial incl usion bodies using a protein refolding method with L-arginine and cyclodextrin. Initial results demonstrate a Km value of 16 M and Vmax

PAGE 161

161 value of 14.8 nmols.mg/min for ADMA (unpublished results). Thus the a pparent rate of ADMA metabolism for DDAH-2 is almost 10 times less than that of DDAH-1. Based on these enzyme kinetics, DDAH-1 is likely the principal ADMA metabolizing pathway in the endothelium. Nevertheless, there is significant controversy in the field regarding which DDAH isoform is responsible for endothelial methyl arginine metabolism. Along these same lines, it is also unclear whether diseases associated with reduced DDAH activity represent lo ss of DDAH-1 or DDAH-2 activity. Therefore, the studies described in chapter 3 were carried out in order to address these issues and identify th e role of DDAH-1 and DDAH-2 in th e regulation of endothelial NO production. It has been widely reported that DDAH-2 is the predominant DDAH isoform in the vascular endothelium; however these studies have widely relie d on assessing the expression of the DDAH isoforms in various cell and tissue types [237, 240, 281, 282]. Consequently, studies were carried out in BAECs to determine which isoform is responsible fo r the majority of the DDAH activity in the endotheli al cell. DDAH-1 and DDAH-2 gene silencing decreased total DDAH activity by 64% and 48%, respectively. Th ere is a possibility that DDAH-2 gene silencing could have an eff ect on DDAH-1 but further studies need to be done. Additional studies demonstrated that dual ge ne silencing only resulted in a 50% loss total DDAH activity in BAECs thus suggesting that other methylarginine metabolic pathways may be invoked as a consequence of loss of DDAH activity. To investig ate the possibility that loss of DDAH activity may lead to the induction of other methyalrginine metabolic enzymes we used HPLC techniques to measure the metabolic products of 14C-L-NMMA. In control cells we observed 3 peaks with radioactive counts and they we re identified as L-NMMA, L-ar ginine and L-citrulline. The formation of radiolablled L-citrulline is likely from the metabolism of L-NMMA by DDAH

PAGE 162

162 while radioactive L-arg is generated from citrulli ne recycling through ASS and ASL. In contrast, results from DDAH-1 and DDAH-2 silenced cells indicated the presence of 4 radioactive peaks including L-NMMA, L-arginine, Lcitrulline and a yet unidentified peak. The concentration of this unidentified peak increased 2 fold in the dua l silencing group as compared to the levels in either the DDAH-1 or DDAH-2 silencing groups alone. Initial mass spec analysis has been unsuccessful in identifying the unkn own species and is currently an area of active investigation in our lab. Regardless, the results clearly indi cate that the endothel ium possesses alternate inducible pathways for metabo lizing methylarginines. Subsequent studies were carri ed out to assess the role of DDAH-1 and DDAH-2 in the regulation of endothelial NOS activity. Results demonstrated that adenoviral mediated overexpression of both DDAH-1 and DDAH-2 increased cellular endot helial NO production. These initial studies were done in the presence of basal methylarginine levels and demonstrate that normal endogenous levels of these NOS inhibitors are present at concentration sufficient to regulate eNOS activity. It had previously been proposed that ADMA may be responsible for the arginine paradox and these st udies would appear to suppor t the hypothesis. However, subsequent studies using L-ar g supplementation with DDAH over-expression demonstrated an additive effect which clearly i ndicates that ADMA is not involv ed in the arginine paradox. Studies were then performed using siRNA to silence both the DDAH-1 and DDAH-2 genes in BAECs. It was anticipated that sile ncing of DDAH would lead to increased cellular methylarginines and decreased endothelial NO pr oduction. Results supported this prediction and demonstrated that DDAH-1 silencing reduced endothelial NO production by 27% while DDAH2 silencing reduced it by 57%. These studies we re then repeated with L-arg supplementation in order to establish the ADMA dependence of the DDAH effects. The addition of L-arg (100 M)

PAGE 163

163 was able to restore ~50% of the loss of endothelial NO generation observed with DDAH-1 silencing. Although it may be predicted that L-arg supplementation should completely restore NO production given that ADMA is a competitive inhibitor of NOS, these result are consistent with previously published studies and suggest that DDAH-1 silencing may lead to ADMA accumulation in sites that are not freely exchangeab le with L-arg. In support of this hypothesis it has been demonstrated by Simon et al. that within the endothelial ce ll exists two pools of arginine both which eNOS has access to. Pool I is largely made up of extracellular cationic amino acids transported through the CAT trans port system, however Pool II does not freely exchange with extracellular cationic amino acids. Furthermore they also demonstrated that Pool II is separated into two components. Pool II A pa rticipates in the recyc ling of citrulline to arginine, while Pool II B is occupi ed by protein derived by-products. It is within this Pool II B where the methylarginines are likely to accumulate thus rending its inhibitory effects on eNOS [280]. Futhermore, the studies were only done using one concentration of L-Arg, it would be interesting to see what effects higher doses would have endothelial NO production. Alternatively, ADMA and/or DDAH may elicit effect s that are independent of NOS, this appears to be the most plausible explanation with regards to DDAH-2 wh erein loss of activity reduced endothelial NO production by gr eater than 50% and the loss was unaffected by L-arg supplementation. This is strong evidence that DDAH may elicit effects that are independent of ADMA. Although this may represent an overall paradigm shift with regards to the role of DDAH in the endothelium, it is not with out su pport. Specifically, Cooke et al. have demonstrated that DDAH-1 transgenic mice ar e protected against cardiac transplant vasculopathy [241, 242]. Using in-vivo siRNA t echniques, Wang et al. demonstrated that DDAH-1 gene silencing increase d plasma levels of ADMA by 50% but this increase had no

PAGE 164

164 effect on endothelial dependent relaxation. Conversely, in vivo DDAH-2 gene silencing had no effect on plasma ADMA, but re duced endothelial de pendent relaxation by 40% [237]. These latter findings are particularly intriguing and demonstrate that elevated plasma ADMA is not associated with impaired endothelial depende nt relaxation while loss of DDAH-2 activity is associated with impaired endothelial dependent relaxation, despite the fact the plasma ADMA levels are not increased (40). This provides strong evidence that DDAH effects are not limited to ADMA dependent regulation of eNOS. The most convincing evidence that DDAH may regulate cellular function through mechanisms independent of ADMA mediated NOS inhibition come fr om data on the DDAH-1 knockout mouse. Homozygous null mice for DD AH-1 are embryonic lethal while the NOS triple knockout mice are viable [240]. This pr ovides strong evidence that DDAH effects are not limited to ADMA dependent regulation of eNOS. Using DDAH1 heterozygous mice, which are viable, Leiper et al. demonstr ated that reduced DDAH-1 activity leads to accumulation of plasma ADMA and a reduction in NO signaling. These an imals exhibited a 50% decrease in DDAH activity which was associated with a 20% increa se in plasma and tissue ADMA levels [240]. This in turn was associated with vascular pathology, including endotheli al dysfunction, increased systemic vascular resistance a nd elevated systemic and pulmonary blood pressure. Given that the intracellular concentrations of ADMA are 1-3 M, it is unlikely that a 20% increase in ADMA could be responsible for the 40% reducti on in endothelial dependent relaxation observed with the DDAH+/mice. Moreover, the addition of exoge nous L-arg to the organ chambers only partially restored the loss in endothelial relaxation [240]. These results further support the hypothesis that DDAH modulates endothelial function throu gh both ADMA-NOS dependent

PAGE 165

165 pathways as well as independent. Although this represents an overa ll paradigm shift, it is not surprising given the lethality of the DDAH-1 knockout mouse. Together, these results demonstrate that both DDAH-1 and DDAH-2 are involved in the regulation of endothelial NO production; howev er, while DDAH-1 effects are largely ADMAdependent, DDAH-2 effects appear to be ADMA-independent. In this regard, elevated plasma ADMA may serve as a marker of impaired methylarginine metabolism and the pathology previously attributed to elevated ADMA may be manifested, atleast in part, through altered activity of the enzymes involved in ADM A regulation, specifically DDAH and PRMT. Although increased plasma levels of ADMA are associated with cardiovascular disease, it is the endothelial ADMA levels that are implicat ed in the regulation of NOS activity. It is therefore surprising that, to date, there have b een no studies examining the cellular kinetics of ADMA synthesis and metabolism in the endothelium. It is generally accepted that PRMTs synthesize methylarginines on prot eins using the methyl donor SA M and L-arg as the terminal methyl acceptor. It is then believed that normal protein turnover releases free methylarginines which are then metabolized to citrulline by DDA H. In this regard, loss of DDAH activity has been implicated as the molecular trigger for ADMA accumulation and subsequent endothelial dysfunction. It is our hypothesis that there is crosstalk among thes e pathways and that the levels of both free and protein incor porated methylarginines play important roles in regulating endothelial function, including but not limited to eNOS regulation. In summary, dysregulation of the PRMT-DDAH-ADMA axis has now been s hown to contribute to the pathogenesis of several cardiovascular disorders, in experimental animal models as well as human disease. Causal relationships between dysregulated argi nine-methylation and the initiation, progression, or therapy of disease, however, remain to be dissected. Future inves tigations into arginine-

PAGE 166

166 methylation and DDAH dynamics in di sease states are clearly needed in order elucidate the role of this post-translational modification in th e pathogenesis of cardiovascular disease. The results from chapter 3 clearly demonstrat ed that loss of DDAH activity was associated with NOS impairment. This raises a critic al question regarding the mechanisms of DDAH regulation in disease. Among the mechan isms proposed for the loss of DDAH activity associated with cardiovascular disease is re dox modification of DDAH in response to oxidative stress. In support, Leiper et al. have demonstrated that NO inhibits the activity of DDAH-1 through a mechanism involving the formation of S-nitrosyl complexes within the catalytic domain of DDAH-1. Therefore, in chapter 4 we ca rried out a series of st udies to investigate the effects of altered redox state and oxidative stress on DDAH activity and endothelial NO production. Using purified human recombinant DDA H-1, our lab and others have previously demonstrated that hDDAH-1 was la rgely resistant to oxidants (ONOO-, H2O2, OH., O2 .-) as concentrations exceeding 100 M were needed to elicit any significant inhibition [228, 249]. However, significant inhibition was seen with the lipid peroxidation product 4-HNE and the inhibition occurred at concen trations associated with pathological conditions. Results demonstrated that the exposure of BAECs to 4-HNE caused a dose-dependent inhibition of cellular NO production. The observe d 4-HNE effects were independent of changes in either NOS expression or phosphorylation state, as the Western blotting analysis revealed no changes in either endpoint. Thes e results suggested that the observed NOS impairment involved mechanisms other than those related to protei n expression. As such, subsequent experiments were performed in order to determine whether al terations in NOS cofactor s or substrate may be involved in the decreased NO bioavailability. In this regard, oxidant stress, which has been shown to occur following exposure to lipid pero xidation products, has been shown to reduce the

PAGE 167

167 bioavailability of the critical NOS cofactor, H4B [290, 311]. Loss of this cofactor results in NOS uncoupling evident by impaired NO synthesis and enhanced superoxide production from the enzyme [310]. Moreover, oxidant injury has al so been demonstrated to increase the cellular levels of the endogenous methylar ginine, ADMA [35]. Therefore, cellular studies were carried out to investigate the effects of adding both an antioxidant (GSH) to prevent H4B oxidation as well as the eNOS substrate L-Arginine to ove rcome endogenous methylarginine-mediated NOS inhibition. Our data demonstrate that the addition of either GS H or L-Arginine alone had only modest NO-enhancing effects, however, co-incubation with bot h GSH and L-Arg was able to almost completely restore endothelial NO producti on. These data suggest that the observed NOS impairment involves both oxidant induced NOS i nhibition (alleviated by th e addition of GSH) as well as methylarginine inhibito ry effects (alleviated by the ad dition of excess substrate). Direct measurement of ADMA levels and DDAH activity within cells by HPLC demonstrated that following 4-HNE challenge intracellular ADMA levels were increased greater than 2-fold. Based on previously published studies demonstrating the kinetics of ADMA mediated cellular inhibition, a 2 fold increase in methylarginine levels would be expected to inhibit NOS dependent NO generation by 20-30 % [96]. The additional inhibition observed could be due to compartmentalization or NOS uncoupling and increased NOS derived superoxide production in the pres ence of ADMA. To determine wh ether the increa sed levels of ADMA observed following 4-HNE exposure resulted from changes in the activity of the ADMA metabolizing enzyme DDAH, its activity was measured. Studies of DDAH activity demonstrated a 40% decrease in hydrolytic ac tivity, suggesting that the mechanism for the observed 4-HNE-directed NOS impairment was via an inhibition of DDAH. Additional studies were performed on purified recombinant hDDAH-1 in order to determine whether 4-HNE effects

PAGE 168

168 were through direct interaction with the enzy me. Results demonstrated that incubation of hDDAH-1 with 4-HNE (50 M) resulted in a > 40% decrease in enzyme activity. These effects were specific to 4-HNE as incubation with the non-oxidized carbonyl he xanol (10-500 M) had no effect on DDAH activity. Similar studies were performed with purified recombinant eNOS and no inhibition was observed following 4-HNE e xposure. 4-HNE forms Michael adducts with histidine and cysteine residues on proteins. In this re gard, the catalytic triad of DDAH contains both cysteine and histidine residues and mutation of either amino acid has been demonstrated to render the enzyme inactive. [314-316]. As further support to the role of DDAH in me diating the inhibitory effects of 4-HNE on endothelial NO production, studies were performed using DDAH over-expressing BAECs. Over-expression of DDAH should lead to a decr ease in cellular methyl arginines with the concomitant increase in NOS-derived NO. DDAH over-expression was induced using an adenoviral construct carryi ng the human DDAH-1 gene. DDAH over-expression increased cellular DDAH activity in control cells by 50% a nd resulted in a 22% increase in cellular NO production. If one then considers the 2-fold incr ease in the levels of ADMA observed following the 4-HNE treatment, a 40 % inhibitory effect would be predicted [96]. Subsequently, a series of studies were perfor med using this same transduction protocol to examine the effects of DDAH over-expression on 4-HNE mediated endot helial NO inhibition. Although DDAH over-expression did increase DDAH activity and decrease endogenous methylarginines, the over-expres sion of the enzyme alone was not sufficient to prevent the 4HNE-induced decrease in NO production. In fact, our results demonstrated that exposure of DDAH over-expressing cells to 4-HNE resulted in worsened outcome as NO levels were significantly lower than that in the control cells exposed to 4HNE. Although these results may

PAGE 169

169 appear contradictory to our hypothesis, they in fact support it and demonstrate that NOS uncoupling is likely occurring. The mechanism involved methylarginine me diated regulation of eNOS derived superoxide. These findings are c onsistent with studies presented in chapter 5 wherin using electron paramagnetic resonance sp in trapping techniques we measured the dose dependent effects of ADMA and L-NMMA on O2 production from eNOS under conditions of H4B depletion. In the absence of H4B, ADMA dose dependently increased NOS derived O2 generation, with a maximal increase of 151 % at 100 M ADMA. L-NMMA also dose dependently increased NOS derived O2 .-, but to a lesser extent, demonstrating a 102 % increase at 100 M L-NMMA. Moreover, the native substrate L-arginine also increased eNOS derived O2 -, exhibiting a similar degree of enhancement as that observed with ADMA. Measurements of NADPH consumption from eNOS demonstrated that binding of either L-arginine or methylarginines increased the rate of NADPH oxidation. Spectrophotometric studies suggest, just as for L-arginine, that binding of ADMA and L-NMMA shif t the eNOS heme to the highspin state, indicative of a more positive he me redox potential, enabling enhanced electron transfer from the reductase to the oxygenase site. These results demonstrate that the methylarginines can profoundly sh ift the balance of NO and O2 .-generation from eNOS. These observations have important implications with rega rd to the therapeutic us e of L-arginine and the methylarginine-NOS inhibitors in the treatment of disease. While these studies were done using prufied enzyme, in the cell, eNOS is known to ha ve various cofactors that may play a role in eNOS derived superoxide. Currently, the effect s of methylarginines on cellular eNOS derived superoxide are an area of ac tive investigation in our lab. Based on the results presented thus far, our hypothesis would predic t that treatment of DDAH over-expressing cells with an antioxidant would restore NO to levels similar to those

PAGE 170

170 observed with L-Arg and GSH treatment, if in fact methylarginines are contributing to the inhibition in NO generation seen with 4-HNE challenge. Indeed, we demonstrated almost complete protection of cellular NO production fo llowing 4-HNE challenge using a combination of viral over-expression of DDAH and treatment with GSH, when compared to the respective control. These results would indicate that GSH alone reduces NOS uncoupling, but not the methylarginine accumulation, while L-Arg supplementation and/or DDAH over-expression overcomes the 4-HNE-induced increase in met hylarginines but not th e NOS uncoupling. The research presented demonstrates for the fi rst time that the lipid peroxidation product 4HNE can inhibit the endothelial NO production. The doses used in this study represent pathological levels of this highly reactive lipid peroxidation product and suggest that this bioactive molecule may play a crit ical role in the endothelial dys function observed in a variety of cardiovascular diseases. The inhibitory effects of 4-HNE appear to be mediated through both oxidant stress and elevated levels of the endogenous NOS inhibitors ADMA and L-NMMA, as either L-Arg supplementation or DDAH over-expressi on in the presence of an anti-oxidant were able to restore NO production. Together, these re sults represent a major step forward in our understanding of the regulation, im pact, and role of methylargini nes and lipid peroxidation in cardiovascular disease. Altered redox status of the endothelium has been implicated as a central mechanism in the endothelial dysfunction associated with cardiovascular diseases. Based on the results described in these studies, we propose that loss of DDAH activity under conditions of oxidative stress contributes to the pathogenesis of cardiovasc ular disease through its effects on NOS derived NO and superoxide production. Specifically, we be lieve that decreased DDAH activity inhibits eNOS derived NO production through both ADM A-dependent and independent pathways.

PAGE 171

171 Moreover, the ADMA accumulation that occurs as a result of loss of DDAH activity is also involved in the perpetuation of eNOS derived superoxide whic h likely contributes to the NO inactivation observed in car diovascular disease. Biochemical studies using recombinant NOS have demonstrated that eNOS, in the absence of H4B, has the potential to be a major source of superoxide with catalytic rates approaching those of NADPH Oxidase and Xanthine Oxidase [371]. However, cellu lar studies of eNOS derived superoxide have revealed that H4B depletion alone does not significantly increase superoxide fluxes [372, 373]. Instead, it a ppears that increased levels of the H4B oxidation product, H2B, is the molecular trigger for eNOS unc oupling. Evidence for this hypothesis is supported by our data as well as work from Gross et al. in which they demonstrated 48-h exposure to diabetic glucos e levels (30 mM) caused H2B levels to increase from undetectable to 40% of total biopterin. This H2B accumulation was associated with diminished NO activity and accelerated superoxide production. However, it is unclear why H2B accumulates in cellular and animal models of diabetes. Bioaccumulation of H2B or quinoid H2B following oxidation of H4B would not be expected to occur in the endothelium as the combination of dihydrofolate reductase and dihydropteridine reductase should efficiently reduce thes e oxidized pterins back to H4B. Given that numerous studies have clearly identified increased H2B formation in diabetes suggests that these conditions are likely associated with impaired pterin salvage or recycling pathways. Therefore, we hypothesized that in diabetes, enzymes involved in either the H4B salvage or recycling pathways are impaired resulting in an inability to maintain adequate H4B levels. The result is eNOS uncoupling and al tered NO and ROS signaling which leads to diabetic vascular dysfunction.

PAGE 172

172 Therefore, the studies described in chapter 6 were carried out to investigate pterin regulation in diabetes. Initial studies were conducted in order to determine the effect of ROS and RNS on DHFR activity. These studies demonstrated that the DHFR enzymatic activity is sensitive to ROS with significan t inhibition observed with pathophys iologically relevant doses of superoxide, NO and H2O2. In contrast, OONOat pathophysiol ogically relevant levels induced a significant increase DHFR activity. This is an intriguing finding give n that ONOOhas been shown to be the most potent oxidizer of H4B and may represent a novel compensatory mechanism for the cell to maintain adequate H2B / H4B ratios. Although previous studies have clearly demons trated increased oxidative stress and NOS uncoupling in diabetes, no studies to date have examined the role of DHFR in this process. Therefore, we carried out in vivo studies in order to determine the effects of the diabetic state on tissue DHFR activity. We observed that in the kidney of db/db mice, DHFR activity was significantly inhibited when compared to wt ag e matched controls. Th is decrease in DHFR activity resulted in increased H2B levels in db/db mice. Functional studies were also performed to determine the effect of the loss of DHFR ac tivity on aortic vascular relaxation. Results demonstrated a 35% impairment of the NO medi ated vascular relaxation in db/db mice when compared to the wt age matched controls. This decreased endothelial dependent relaxation was associated with increased eNOS derived O2 .in the aorta as measured by EPR. In contrast to the wild type mice, eNOS derived O2was detectable in the isolated aorta of db/db mice. These findings are in line with prev ious reports of increased H2B levels in diabetic mice [361, 364] and implicate DHFR as a key regulatory elem ent involved in eNOS dysregulation. In summary, the data presented in this th esis demonstrate a critical role for the DDAHADMA axis in the pathogenesis of endothelial dysfunction associated with cardiovascular

PAGE 173

173 diseases. Evidence suggests that DDAH is capab le of modulating both eNOS derived NO and superoxide generation through ADMA-dependent as well as independent pathways.

PAGE 174

174 LIST OF REFRENCES 1. Lloyd-Jones, D., et al., Heart Disease and Stroke Statistics--2009 Update: A Report From the American Heart Association Statistics Co mmittee and Stroke Statistics Subcommittee. Circulation, 2009. 119(3): p. 480-486. 2. Goldstein, J.L. and M.S. Brown, Familial hype rcholesterolemia: identif ication of a defect in the regulation of 3-hydroxy3-methylglutaryl coenzyme A reductase activity associated with overproduction of cholesterol. Proc Natl Acad Sci U S A, 1973. 70(10): p. 2804-8. 3. Brown, M.S. and J.L. Goldstein, Receptormediated endocytosis: insights from the lipoprotein receptor system. Proc Natl Acad Sci U S A, 1979. 76(7): p. 3330-7. 4. Lloyd-Jones, D.M., et al., Prediction of lif etime risk for cardiovascular disease by risk factor burden at 50 years of age. Circulation, 2006. 113(6): p. 791-8. 5. Baldwin, G.S. and P.R. Carnegie, Specific En zymic Methylation of an Arginine in the Experimental Allergic Encephalomyelitis Protein from Human Myelin. Science, 1971. 171(3971): p. 579-581. 6. Corti, R., et al., Evolving concepts in th e triad of atherosclerosis, inflammation and thrombosis. J Thromb Thrombolysis, 2004. 17(1): p. 35-44. 7. Gutierrez, J., et al., Free radicals, mitochondr ia, and oxidized lipids: the emerging role in signal transduction in vascul ar cells. Circ Res, 2006. 99(9): p. 924-32. 8. Libby, P., Vascular biology of athe rosclerosis: overview and state of the art. Am J Cardiol, 2003. 91(3A): p. 3A-6A. 9. Stary, H.C., et al., A definition of advan ced types of atherosc lerotic lesions and a histological classification of atherosclero sis. A report from the Committee on Vascular Lesions of the Council on Arteriosclerosis, American Heart Associ ation. Circulation, 1995. 92(5): p. 1355-74. 10. Libby, P., Inflammation and cardiovascular di sease mechanisms. Am J Clin Nutr, 2006. 83(2): p. 456S-460S. 11. Azevedo, L.C., et al., Oxidative stress as a signaling mechanism of the vascular response to injury: the redox hyp othesis of restenosis. Cardiovasc Res, 2000. 47(3): p. 436-45. 12. Bauters, C. and J.M. Isner, The biol ogy of restenosis. Prog Cardiovasc Dis, 1997. 40(2): p. 107-16. 13. Ferns, G.A., et al., Inhibition of neointimal smooth muscle accumulation after angioplasty by an antibody to PDGF. Science, 1991. 253(5024): p. 1129-32. 14. Heckenkamp, J., M. Gawenda, and J. Brunkwal l, Vascular restenos is. Basic science and clinical implications. J Cardiovasc Surg (Torino), 2002. 43(3): p. 349-57.

PAGE 175

175 15. Libby, P. and H. Tanaka, The molecular base s of restenosis. Prog Cardiovasc Dis, 1997. 40(2): p. 97-106. 16. Galle, J., et al., Impact of oxidized lo w density lipoprotein on vascular cells. Atherosclerosis, 2006. 185 (2): p. 219-26. 17. Hamilton, C.A., Low-density lipoprotein and oxid ised low-density lipoprotein: their role in the development of atherosc lerosis. Pharmacol Ther, 1997. 74(1): p. 55-72. 18. Heinecke, J.W., Is the emperor wearing clothe s? Clinical trials of vitamin E and the LDL oxidation hypothesis. Arterios cler Thromb Vasc Biol, 2001. 21(8): p. 1261-4. 19. Navab, M., et al., HDL and the inflammatory response induced by LD L-derived oxidized phospholipids. Arterioscler Thromb Vasc Biol, 2001. 21(4): p. 481-8. 20. Spiteller, G., The relation of lipid peroxidati on processes with atherogenesis: a new theory on atherogenesis. Mol Nutr Food Res, 2005. 49(11): p. 999-1013. 21. Uchida, K., et al., Michael addition-type 4-hydroxy-2-nonenal adducts in modified lowdensity lipoproteins: markers for atherosclerosis. Biochemistry, 1994. 33(41): p. 12487-94. 22. Arnold, W.P., et al., Nitric oxide activates guanylate cyclase and increases guanosine 3':5'cyclic monophosphate levels in various tissu e preparations. Proc Natl Acad Sci U S A, 1977. 74(8): p. 3203-7. 23. Palmer, R.M., D.S. Ashton, and S. Moncada, Vascular endothelial ce lls synthesize nitric oxide from L-arginine. Nature, 1988. 333(6174): p. 664-6. 24. Jeremy, J.Y., et al., Oxidative stress, nitric oxide, and vascular disease. J Card Surg, 2002. 17(4): p. 324-7. 25. Sarkar, R. and R.C. Webb, Does nitric oxide regulate smooth muscle cell proliferation? A critical appraisal. J Vasc Res, 1998. 35(3): p. 135-42. 26. Cooke, J.P. and R.K. Oka, Atherogenesis a nd the arginine hypothe sis. Curr Atheroscler Rep, 2001. 3(3): p. 252-9. 27. Holm, A.M., et al., Effects of L-arginine on vascular smooth muscle cell proliferation and apoptosis after balloon injur y. Scand Cardiovasc J, 2000. 34(1): p. 28-32. 28. Le Tourneau, T., et al., Role of nitric oxi de in restenosis afte r experimental balloon angioplasty in the hypercholesterolemic ra bbit: effects on neointimal hyperplasia and vascular remodeling. J Am Coll Cardiol, 1999. 33(3): p. 876-82. 29. Janero, D.R. and J.F. Ewing, Nitric oxide and postangioplasty rest enosis: pathological correlates and therapeutic poten tial. Free Radic Biol Med, 2000. 29(12): p. 1199-221.

PAGE 176

176 30. Aji, W., et al., L-arginine prevents xanthom a development and inhibits atherosclerosis in LDL receptor knockout mice. Circulation, 1997. 95(2): p. 430-7. 31. Boger, R.H., et al., Dietary L-arginine re duces the progression of atherosclerosis in cholesterol-fed rabbits: comparison with lovastatin. Circulation, 1997. 96(4): p. 1282-90. 32. Boger, R.H., et al., Plasma concentration of asymmetric dimethylarginine, an endogenous inhibitor of nitric oxide synt hase, is elevated in monkeys with hyperhomocyst(e)inemia or hypercholesterolemia. Arterios cler Thromb Vasc Biol, 2000. 20(6): p. 1557-64. 33. Kielstein, J.T., et al., Relationship of asymme tric dimethylarginine to dialysis treatment and atherosclerotic disease. Kidney Int Suppl, 2001. 78: p. S9-13. 34. Miyazaki, H., et al., Endogenous nitric oxi de synthase inhibitor: a novel marker of atherosclerosis. Circulation, 1999. 99(9): p. 1141-6. 35. Leiper, J. and P. Vallance, Biological si gnificance of endogenous methylarginines that inhibit nitric oxide syntha ses. Cardiovasc Res, 1999. 43(3): p. 542-8. 36. Leiper, J.M., et al., Identification of two human dimethylarginine dimethylaminohydrolases with distinct tissue distributions and homology with microbial arginine deiminases. Biochem J, 1999. 343(Pt 1): p. 209-14. 37. Tang, J., et al., PRMT 3, a type I protein argi nine N-methyltransferase that differs from PRMT1 in its oligomerization, subcellular localization, substrate specificity, and regulation. J Biol Chem, 1998. 273(27): p. 16935-45. 38. Cardounel, A.J., et al., Evidence for th e pathophysiological role of endogenous methylarginies in regulation of endothelia l NO production and vascular function. J Biol Chem, 2006. 39. White, C.R., et al., L-Arginine inhibits xa nthine oxidase-dependent endothelial dysfunction in hypercholesterolemia. FEBS Lett, 2004. 561(1-3): p. 94-8. 40. Wu, Z., et al., Long-term oral administra tion of L-arginine enhances endotheliumdependent vasorelaxation and inhibits neointimal thicke ning after endothelial denudation in rats. Chin Med J (Engl), 1996. 109 (8): p. 592-8. 41. Cardounel, A.J. and J.L. Zweier, Endogenous methylarginines regul ate neuronal nitricoxide synthase and prevent excito toxic injury. J Biol Chem, 2002. 277(37): p. 33995-4002. 42. Tsikas, D., et al., Endogenous nitric oxide s ynthase inhibitors are responsible for the Larginine paradox. FEBS Lett, 2000. 478 (1-2): p. 1-3. 43. Cai, H. and D.G. Harrison, Endothelial dysfunction in cardiovascular di seases: the role of oxidant stress. Circ Res, 2000. 87(10): p. 840-4.

PAGE 177

177 44. Durante, W., A.K. Sen, and F.A. Sunaha ra, Impairment of endothelium-dependent relaxation in aortae from spontaneously diabetic rats. Br J Pharmacol, 1988. 94(2): p. 4638. 45. Lockette, W., Y. Otsuka, and O. Carreter o, The loss of endothelium-dependent vascular relaxation in hypertension. Hypertension, 1986. 8(6 Pt 2): p. II61-6. 46. Oyama, Y., et al., Attenuation of endothelium -dependent relaxation in aorta from diabetic rats. Eur J Pharmacol, 1986. 132(1): p. 75-8. 47. Winquist, R.J., et al., Decreased endotheliumdependent relaxation in New Zealand genetic hypertensive rats. J Hypertens, 1984. 2(5): p. 541-5. 48. Fukai, T., et al., Extracellular superoxide di smutase and cardiovascular disease. Cardiovasc Res, 2002. 55(2): p. 239-49. 49. Juul, K., et al., Genetically reduced antioxi dative protection and increased ischemic heart disease risk: The Copenhagen City Heart Study. Circulation, 2004. 109(1): p. 59-65. 50. Xia, Y., et al., Superoxide generation from endothelial nitric-oxide synthase. A Ca2+/calmodulin-dependent and tetrahydrobiop terin regulatory process. J Biol Chem, 1998. 273(40): p. 25804-8. 51. Vasquez-Vivar, J., et al., S uperoxide generation by endotheli al nitric oxide synthase: the influence of cofactors. Proc Natl Acad Sci U S A, 1998. 95(16): p. 9220-5. 52. Burg, A.W. and G.M. Brown, The biosynthesis of folic acid. 8. Purifi cation and properties of the enzyme that catalyzes the production of formate from carbon atom 8 of guanosine triphosphate. J Biol Chem, 1968. 243 (9): p. 2349-58. 53. Laursen, J.B., et al., Endothelial regulati on of vasomotion in apoE-deficient mice: implications for interactions between peroxynitrite and te trahydrobiopterin. Circulation, 2001. 103(9): p. 1282-8. 54. Heitzer, T., et al., Tetrahydrobiopterin impr oves endothelium-depende nt vasodilation in chronic smokers : evidence for a dysfunctiona l nitric oxide synthase. Circ Res, 2000. 86(2): p. E36-41. 55. Settergren, M., et al., l-Arginine an d tetrahydrobiopterin protects against ischemia/reperfusion-induced endothelial dysf unction in patients with type 2 diabetes mellitus and coronary artery disease. Atherosclerosis, 2008. 56. Jennings, M.A. and L. Florey, An investigation of some properties of endothelium related to capillary permeability. Proc R Soc Lond B Biol Sci, 1967. 167(6): p. 39-63. 57. Furchgott, R.F. and J.V. Zawadzki, The obligatory role of endothelial cells in the relaxation of arterial smooth muscle by acetylcholine. Nature, 1980. 288(5789): p. 373-6.

PAGE 178

178 58. Ignarro, L.J., et al., Endothelium-derived relaxi ng factor produced and released from artery and vein is nitric oxide. Proc Natl Acad Sci U S A, 1987. 84(24): p. 9265-9. 59. Palmer, R.M., A.G. Ferrige, and S. Moncad a, Nitric oxide rele ase accounts for the biological activity of endothelium-derived relaxing factor. Nature, 1987. 327(6122): p. 524-6. 60. Palmer, R.M., D.S. Ashton, and S. Moncada, Vascular endothelial ce lls synthesize nitric oxide from L-arginine. Nature, 1988. 333(6174): p. 664-6. 61. Ignarro, L.J., et al., Oxidation of nitric oxide in aqueous solution to ni trite but not nitrate: comparison with enzymatically formed nitric oxide from L-arginine. Proc Natl Acad Sci U S A, 1993. 90 (17): p. 8103-7. 62. Masters, B.S., et al., Neuronal nitric oxi de synthase, a modular enzyme formed by convergent evolution: structure studies of a cysteine thiolate-liganded heme protein that hydroxylates L-arginine to produce NO. as a cellula r signal. FASEB J, 1996. 10(5): p. 5528. 63. Mayer, B. and B. Hemmens, Biosynthesis a nd action of nitric oxide in mammalian cells. Trends Biochem Sci, 1997. 22(12): p. 477-81. 64. Stuehr, D.J., Structure-functi on aspects in the nitric oxide synthases. Annu Rev Pharmacol Toxicol, 1997. 37: p. 339-59. 65. Abu-Soud, H.M. and D.J. Stuehr, Nitric oxide synthases reveal a ro le for calmodulin in controlling electron transfer. Pr oc Natl Acad Sci U S A, 1993. 90(22): p. 10769-72. 66. White, K.A. and M.A. Marletta, Nitric oxi de synthase is a cytochrome P-450 type hemoprotein. Biochemistry, 1992. 31(29): p. 6627-31. 67. Bredt, D.S. and S.H. Snyder, Isolation of nitric oxide synthetase, a calmodulin-requiring enzyme. Proc Natl Acad Sci U S A, 1990. 87(2): p. 682-5. 68. Knowles, R.G., et al., Formation of nitric oxide from L-arginine in the central nervous system: a transduction mechanism for stimula tion of the soluble guanylate cyclase. Proc Natl Acad Sci U S A, 1989. 86(13): p. 5159-62. 69. Garcia-Cardena, G., et al., Targ eting of nitric oxide synthase to endothelial cell caveolae via palmitoylation: implications for nitric oxide signaling. Proc Natl Acad Sci U S A, 1996. 93(13): p. 6448-53. 70. Goetz, R.M., et al., Estradiol induces the ca lcium-dependent translocation of endothelial nitric oxide synthase. Proc Natl Acad Sci U S A, 1999. 96(6): p. 2788-93. 71. Loscalzo, J. and G. Welch, Nitric oxide and its role in the cardiovascular system. Prog Cardiovasc Dis, 1995. 38(2): p. 87-104.

PAGE 179

179 72. Fujimoto, T., et al., Localization of inosito l 1,4,5-trisphosphate receptor-like protein in plasmalemmal caveolae. J Cell Biol, 1992. 119(6): p. 1507-13. 73. Siddhanta, U., et al., Heme iron reduction and catalysis by a nitr ic oxide synthase heterodimer containing one reductase and two oxygenase domains. J Biol Chem, 1996. 271(13): p. 7309-12. 74. Li, H., et al., Regulatory role of arginase I and II in nitr ic oxide, polyamine, and proline syntheses in endothelial cells. Am J Physiol Endocrinol Metab, 2001. 280(1): p. E75-82. 75. Radomski, M.W., R.M. Palmer, and S. M oncada, The anti-aggregating properties of vascular endothelium: interactions between pr ostacyclin and nitric oxide. Br J Pharmacol, 1987. 92(3): p. 639-46. 76. Stagliano, N.E., et al., The effect of nitric oxide synthase inhibi tion on acute platelet accumulation and hemodynamic depression in a rat model of thromboembolic stroke. J Cereb Blood Flow Metab, 1997. 17(11): p. 1182-90. 77. Simon, D.I., et al., Effect of nitric oxide synthase inhibition on bleeding time in humans. J Cardiovasc Pharmacol, 1995. 26(2): p. 339-42. 78. Lefer, A.M. and X.L. Ma, Decreased basal nitric oxide re lease in hypercholesterolemia increases neutrophil adherence to rabbit coronary artery endoth elium. Arterioscler Thromb, 1993. 13(6): p. 771-6. 79. Peng, H.B., P. Libby, and J.K. Liao, Induction and stabilization of I kappa B alpha by nitric oxide mediates inhibition of NF-kappa B. J Biol Chem, 1995. 270(23): p. 14214-9. 80. Lablanche, J.M., et al., Effect of th e direct nitric oxide donors linsidomine and molsidomine on angiographic restenosis after coronary ballo on angioplasty. The ACCORD Study. Angioplastic Coronaire Co rvasal Diltiazem. Circulation, 1997. 95(1): p. 83-9. 81. Janssens, S., et al., Human endothelial nitric oxi de synthase gene transf er inhibits vascular smooth muscle cell proliferation and neointim a formation after balloon injury in rats. Circulation, 1998. 97(13): p. 1274-81. 82. Varenne, O., et al., Local adenovirus-mediated transfer of human endot helial nitric oxide synthase reduces luminal narrowing after cor onary angioplasty in pigs. Circulation, 1998. 98(9): p. 919-26. 83. Guo, K., V. Andres, and K. Walsh, Nitr ic OxideInduced Downregulation of Cdk2 Activity and Cyclin A Gene Transcription in Vascular Smooth Muscle Cells. Circulation, 1998. 97(20): p. 2066-2072. 84. Muller, B., et al., Nitric oxide transport a nd storage in the cardiova scular system. Ann N Y Acad Sci, 2002. 962: p. 131-9.

PAGE 180

180 85. Xu, A., J.A. Vita, and J.F. Keaney, Jr., Ascorbic acid and glutathione modulate the biological activity of S-nitros oglutathione. Hypertension, 2000. 36(2): p. 291-5. 86. Beltran, B., et al., Oxidative st ress and S-nitrosylation of proteins in cells. Br J Pharmacol, 2000. 129(5): p. 953-60. 87. Haendeler, J., et al., Antioxidant Effects of Statins via S-Nitrosylation and Activation of Thioredoxin in Endothelial Ce lls: A Novel Vasculoprotect ive Function of Statins. Circulation, 2004. 110(7): p. 856-861. 88. Leiper, J., et al., S-nitros ylation of dimethylarginine dimethylaminohydrolase regulates enzyme activity: further interactions between nitric oxide synthase and dimethylarginine dimethylaminohydrolase. Proc Natl Acad Sci U S A, 2002. 99 (21): p. 13527-32. 89. Hao, G., L. Xie, and S.S. Gross, Argininosucci nate synthetase is reversibly inactivated by S-nitrosylation in vitro a nd in vivo. J Biol Chem, 2004. 279(35): p. 36192-200. 90. Ravi, K., et al., S-nitrosylati on of endothelial nitric oxide synthase is associated with monomerization and decreased enzyme ac tivity. Proc Natl Acad Sci U S A, 2004. 101(8): p. 2619-24. 91. Erwin, P.A., et al., Receptor-regulated Dyna mic S-Nitrosylation of Endothelial Nitricoxide Synthase in Vascular Endothe lial Cells. J. Biol. Chem., 2005. 280(20): p. 1988819894. 92. Wu, G., Intestinal mucosal am ino acid catabolism. J Nutr, 1998. 128(8): p. 1249-52. 93. Wu, G. and S.M. Morris, Jr., Arginine meta bolism: nitric oxide and beyond. Biochem J, 1998. 336 ( Pt 1) : p. 1-17. 94. Morris, S.M., Jr., Arginine metabolism in vascular biology and disease. Vasc Med, 2005. 10 Suppl 1: p. S83-7. 95. Hallemeesch, M.M., W.H. Lamers, and N.E. Deutz, Reduced arginine availability and nitric oxide production. Clin Nutr, 2002. 21(4): p. 273-9. 96. Cardounel, A.J., et al., Evidence for th e pathophysiological role of endogenous methylarginines in regulation of endothelia l NO production and vascular function. J Biol Chem, 2007. 282(2): p. 879-87. 97. Durante, W., et al., Transforming Growth F actor-{beta}1 Stimulates L-Arginine Transport and Metabolism in Vascular Smooth Muscle Cells : Role in Polyamine and Collagen Synthesis. Circulation, 2001. 103(8): p. 1121-1127. 98. Durante, W., F.K. Johnson, and R.A. Johnson, Argi nase: a critical regulator of nitric oxide synthesis and vascular function. Clin Exp Pharmacol Physiol, 2007. 34(9): p. 906-11.

PAGE 181

181 99. Reczkowski, R.S. and D.E. Ash, Rat liver arginase: kinetic mechanism, alternate substrates, and inhibitors Arch Biochem Biophys, 1994. 312(1): p. 31-7. 100. Chang, C.I., J.C. Liao, and L. Kuo, Arginase modulates nitric oxide production in activated macrophages. Am J Physiol, 1998. 274 (1 Pt 2): p. H342-8. 101. Johnson, F.K., et al., Arginase inhibition restores arteriolar endothelial function in Dahl rats with salt-induced hype rtension. Am J Physiol Regul Integr Comp Physiol, 2005. 288(4): p. R1057-62. 102. Chicoine, L.G., et al., Arginase inhibition increases nitric oxide production in bovine pulmonary arterial endothelial cells. Am J Physiol Lung Cell Mol Physiol, 2004. 287(1): p. L60-8. 103. Fukuda, Y., et al., Tetrahydrobiopterin restores endothelial function of coronary arteries in patients with hypercholesterolaemia. Heart, 2002. 87(3): p. 264-9. 104. Walker, J.B., Creatine: biosynthesis, regulation, and func tion. Adv Enzymol Relat Areas Mol Biol, 1979. 50: p. 177-242. 105. Morris, S.M., Jr., Enzymes of arginine metabolism. J Nutr, 2004. 134(10 Suppl): p. 2743S2747S; discussion 2765S-2767S. 106. Kwon, N.S., C.F. Nathan, and D.J. Stuehr, Reduced biopterin as a cofactor in the generation of nitrogen oxides by murine macrophages. J Biol Chem, 1989. 264(34): p. 20496-501. 107. Tayeh, M.A. and M.A. Marletta, Macrophage oxidation of L-arginine to nitric oxide, nitrite, and nitrate. Tetrahydrobiopterin is required as a cofactor. J Biol Chem, 1989. 264(33): p. 19654-8. 108. Kaufman, S., Studies on the mechanism of th e enzymatic conversion of phenylalanine to tyrosine. J Biol Chem, 1959. 234: p. 2677-82. 109. Vasquez-Vivar, J., et al., The rati o between tetrahydrobiopterin and oxidized tetrahydrobiopterin analogues controls supero xide release from endothelial nitric oxide synthase: an EPR spin tr apping study. Biochem J, 2002. 362(Pt 3): p. 733-9. 110. Hurshman, A.R., et al., Formation of a pterin radical in the reaction of the heme domain of inducible nitric oxide syntha se with oxygen. Biochemistry, 1999. 38(48): p. 15689-96. 111. Schmidt, P.P., et al., Formation of a protonate d trihydrobiopterin radical cation in the first reaction cycle of neuronal a nd endothelial nitric oxide s ynthase detected by electron paramagnetic resonance spectrosc opy. J Biol Inorg Chem, 2001. 6(2): p. 151-8. 112. Cai, S., et al., GTP cyclohydrolase I gene transfer augments intracellular tetrahydrobiopterin in human endothelial cells: effects on nitr ic oxide synthase activity, protein levels and dimerisation. Cardiovasc Res, 2002. 55(4): p. 838-49.

PAGE 182

182 113. Hattori, Y., et al., Oral administration of tetrahydrobiopterin slows the progression of atherosclerosis in apolipoprotein E-knockout mice. Arterioscl er Thromb Vasc Biol, 2007. 27(4): p. 865-70. 114. Kaufman, S., A protein that stimulates rat liver phenylal anine hydroxylase. J Biol Chem, 1970. 245(18): p. 4751-9. 115. Nakanishi, N., H. Hasegawa, and S. Wa tabe, A new enzyme, NADPH-dihydropteridine reductase in bovine liver. J Biochem, 1977. 81(3): p. 681-5. 116. Vasquez-Vivar, J., et al., Reaction of tetr ahydrobiopterin with superoxide: EPR-kinetic analysis and characterization of the pt eridine radical. Free Radic Biol Med, 2001. 31(8): p. 975-85. 117. Katusic, Z.S., A. Stelter, and S. Milstie n, Cytokines stimulate GT P cyclohydrolase I gene expression in cultured human umbilical vein endothelial cells. Arterioscler Thromb Vasc Biol, 1998. 18(1): p. 27-32. 118. Linscheid, P., et al., Regulation of 6-pyr uvoyltetrahydropterin synt hase activity and messenger RNA abundance in human vascul ar endothelial cel ls. Circulation, 1998. 98(17): p. 1703-6. 119. Huang, A., et al., Cytokine-stimulated GT P cyclohydrolase I expres sion in endothelial cells requires coordinated activ ation of nuclear factor-kappa B and Stat1/Stat3. Circ Res, 2005. 96(2): p. 164-71. 120. Lapize, C., et al., Protein kinase C phosphorylates and act ivates GTP cyclohydrolase I in rat renal mesangial cells. Biochem Biophys Res Commun, 1998. 251(3): p. 802-5. 121. Cai, S., et al., GTP cyclohydrolase I gene transfer augments intracellular tetrahydrobiopterin in human endothelial cells: effects on nitr ic oxide synthase activity, protein levels and dimerisation. Cardiovasc Res, 2002. 55(4): p. 838-849. 122. Widder, J.D., et al., Regulation of Tetrahydrobiopterin Biosynthesis by Shear Stress. Circ Res, 2007. 101(8): p. 830-838. 123. Bendall, J.K., et al., Stoichiometric Relationships Between Endothelial Tetrahydrobiopterin, Endotheli al NO Synthase (eNOS) Activity, and eNOS Coupling in Vivo: Insights From Transgenic Mice W ith Endothelial-Targeted GTP Cyclohydrolase 1 and eNOS Overexpression. Circ Res, 2005. 97(9): p. 864-871. 124. Harada, T., H. Kagamiyama, and K. Hatakeyama, Feedback regulation mechanisms for the control of GTP cyclohydrolase I activity. Science, 1993. 260(5113): p. 1507-10. 125. Ishii, M., et al., Reduction of GTP cyclohydrolase I feedback regulating protein expression by hydrogen peroxide in vasc ular endothelial cells. J Pharmacol Sci, 2005. 97(2): p. 299302.

PAGE 183

183 126. Swick, L. and G. Kapatos, A yeast 2-hybr id analysis of human GTP cyclohydrolase I protein interactions. J Neurochem, 2006. 97(5): p. 1447-55. 127. Kaspers, B., et al., Coordinate induction of tetrahydrobiopterin synthe sis and nitric oxide synthase activity in chicken macrophages: upr egulation of GTP-cycl ohydrolase I activity. Comp Biochem Physiol B Biochem Mol Biol, 1997. 117(2): p. 209-15. 128. Werner, E.R., et al., Biochemistry and functi on of pteridine synthesi s in human and murine macrophages. Pathobiology, 1991. 59(4): p. 276-9. 129. Gupta, S., et al., Serum neopterin in acute coronary syndromes. Lancet, 1997. 349(9060): p. 1252-3. 130. Curtius, H.C., et al., Biosynthesis of tetra hydrobiopterin in man. J Inherit Metab Dis, 1985. 8 Suppl 1: p. 28-33. 131. Yang, S., et al., A murine model for human sepiapterin-reductase deficiency. Am J Hum Genet, 2006. 78(4): p. 575-87. 132. Nichol, C.A., et al., Biosynthesis of tetra hydrobiopterin by de novo and salvage pathways in adrenal medulla extracts, mammalian cell cult ures, and rat brain in vivo. Proc Natl Acad Sci U S A, 1983. 80(6): p. 1546-50. 133. Chalupsky, K. and H. Cai, Endothelial dihydro folate reductase: critical for nitric oxide bioavailability and role in angiotensin II unc oupling of endothelial ni tric oxide synthase. Proc Natl Acad Sci U S A, 2005. 102(25): p. 9056-61. 134. Czar, M.J., M.J. Welsh, and W.B. Pratt, Immunofluorescence localization of the 90-kDa heat-shock protein to cytoskeleton. Eur J Cell Biol, 1996. 70(4): p. 322-30. 135. Wiech, H., et al., Hsp90 chaperones pr otein folding in vitro. Nature, 1992. 358(6382): p. 169-70. 136. Hutchison, K.A., M.J. Czar, and W.B. Pratt, Evidence that the hormone-binding domain of the mouse glucocorticoid receptor directly represses DNA binding activity in a major portion of receptors that are "misfolded" after removal of hs p90. J Biol Chem, 1992. 267(5): p. 3190-5. 137. Oppermann, H., W. Levinson, and J.M. Bishop, A cellular protein that associates with the transforming protein of Rous sarcoma virus is also a heat-shock protein. Proc Natl Acad Sci U S A, 1981. 78(2): p. 1067-71. 138. Stancato, L.F., et al., The hsp90-binding antibi otic geldanamycin decreases Raf levels and epidermal growth factor signaling without di srupting formation of signaling complexes or reducing the specific enzymatic activity of Raf kinase. J Biol Chem, 1997. 272(7): p. 401320.

PAGE 184

184 139. Stancato, L.F., et al., Raf exists in a nativ e heterocomplex with hsp90 and p50 that can be reconstituted in a cell-fr ee system. J Biol Chem, 1993. 268(29): p. 21711-6. 140. Venema, V.J., M.B. Marrero, and R.C. Vene ma, Bradykinin-stimulat ed protein tyrosine phosphorylation promotes endothelial nitric oxide synthase translocation to the cytoskeleton. Biochem Biophys Res Commun, 1996. 226(3): p. 703-10. 141. Garcia-Cardena, G., et al., Dynamic activati on of endothelial nitr ic oxide synthase by Hsp90. Nature, 1998. 392 (6678): p. 821-4. 142. Stebbins, C.E., et al., Crystal structure of an Hsp90-geldanamycin co mplex: targeting of a protein chaperone by an antitumor agent. Cell, 1997. 89(2): p. 239-50. 143. Shah, V., et al., Hsp90 regulation of endotheli al nitric oxide synthase contributes to vascular control in portal hypertension. Am J Physiol, 1999. 277 (2 Pt 1): p. G463-8. 144. Pritchard, K.A., Jr., et al., Heat Shock Protein 90 Mediates the Balance of Nitric Oxide and Superoxide Anion from Endothelial Nitric-oxide Synthase. J. Biol. Chem., 2001. 276(21): p. 17621-17624. 145. Xu, H., et al., A heat shock protein 90 binding domain in endothelial nitric-oxide synthase influences enzyme function. J Biol Chem, 2007. 282(52): p. 37567-74. 146. Nishida, C.R. and P.R. Ortiz de Montella no, Autoinhibition of endothelial nitric-oxide synthase. Identification of an electron transfer control element. J Biol Chem, 1999. 274(21): p. 14692-8. 147. Scherer, P.E., et al., Cell-type and tissue-sp ecific expression of caveolin-2. Caveolins 1 and 2 co-localize and form a stable hetero-oli gomeric complex in vivo. J Biol Chem, 1997. 272(46): p. 29337-46. 148. Li, S., et al., Mutational analysis of cav eolin-induced vesicle formation. Expression of caveolin-1 recruits caveolin-2 to caveolae membranes. FEBS Lett, 1998. 434(1-2): p. 12734. 149. Song, K.S., et al., Expression of caveolin-3 in skeletal, cardiac, and smooth muscle cells. Caveolin-3 is a component of the sarcolem ma and co-fractionate s with dystrophin and dystrophin-associated glycopr oteins. J Biol Chem, 1996. 271 (25): p. 15160-5. 150. Michel, J.B., et al., Recipro cal regulation of endothelial n itric-oxide synthase by Ca2+calmodulin and caveolin. J Biol Chem, 1997. 272 (25): p. 15583-6. 151. Garcia-Cardena, G., et al., Dissecting the interaction between nitric oxide synthase (NOS) and caveolin. Functional signifi cance of the nos caveolin binding domain in vivo. J Biol Chem, 1997. 272(41): p. 25437-40. 152. Bucci, M., et al., In vivo delivery of the caveoli n-1 scaffolding domain inhibits nitric oxide synthesis and reduces in flammation. Nat Med, 2000. 6(12): p. 1362-7.

PAGE 185

185 153. Drab, M., et al., Loss of caveolae, vasc ular dysfunction, and pulmonary defects in caveolin-1 gene-disrupted mice. Science, 2001. 293(5539): p. 2449-52. 154. Razani, B., et al., Caveolin-1 null mice are viable but show evidence of hyperproliferative and vascular abnormalities. J Biol Chem, 2001. 276 (41): p. 38121-38. 155. Feron, O., et al., Dynamic regulation of endot helial nitric oxide synthase: complementary roles of dual acylation and caveoli n interactions. Biochemistry, 1998. 37(1): p. 193-200. 156. Feron, O., et al., The endothelial nitric-oxide synthase-caveolin regulatory cycle. J Biol Chem, 1998. 273(6): p. 3125-8. 157. Michel, J.B., et al., Caveolin versus calmodulin. Counterbalancing allosteric modulators of endothelial nitric oxide synthase. J Biol Chem, 1997. 272(41): p. 25907-12. 158. Janssens, S.P., et al., Cloning and expre ssion of a cDNA encoding human endotheliumderived relaxing factor/nitric oxi de synthase. J Biol Chem, 1992. 267(21): p. 14519-22. 159. Lamas, S., et al., Endothelial nitric oxide synthase: molecular cloning and characterization of a distinct constitutive enzyme is oform. Proc Natl Acad Sci U S A, 1992. 89(14): p. 6348-52. 160. Marsden, P.A., et al., Molecular cloning and characterization of huma n endothelial nitric oxide synthase. FEBS Lett, 1992. 307 (3): p. 287-93. 161. Nishida, K., et al., Molecular cloning and char acterization of the constitutive bovine aortic endothelial cell nitric oxide synthase. J Clin Invest, 1992. 90(5): p. 2092-6. 162. Sessa, W.C., et al., Molecular cloning and expression of a cDNA encoding endothelial cell nitric oxide syntha se. J Biol Chem, 1992. 267(22): p. 15274-6. 163. Gordon, J.I., et al., Protein Nmyristoylation. J Biol Chem, 1991. 266(14): p. 8647-50. 164. Busconi, L. and T. Michel, Endothelial nitr ic oxide synthase. N-te rminal myristoylation determines subcellular lo calization. J Biol Chem, 1993. 268(12): p. 8410-3. 165. Liu, J. and W.C. Sessa, Identification of cova lently bound amino-terminal myristic acid in endothelial nitric oxide synthase. J Biol Chem, 1994. 269(16): p. 11691-4. 166. Sessa, W.C., C.M. Barber, and K.R. Lynch, Mutation of N-myristoylation site converts endothelial cell nitric oxide s ynthase from a membrane to a cytosolic protein. Circ Res, 1993. 72(4): p. 921-4. 167. Liu, J., G. Garcia-Cardena, and W.C. Sessa, Biosynthesis and palmit oylation of endothelial nitric oxide synthase: mutagenesis of palmit oylation sites, cysteine s-15 and/or -26, argues against depalmitoylation-induced transloc ation of the enzyme. Biochemistry, 1995. 34 (38): p. 12333-40.

PAGE 186

186 168. Shaul, P.W., et al., Acylati on targets emdothelial nitric-oxide synthase to plasmalemmal caveolae. J Biol Chem, 1996. 271(11): p. 6518-22. 169. Papapetropoulos, A., et al., Nitric oxide production contributes to th e angiogenic properties of vascular endothelial growth factor in human endothelial cell s. J Clin Invest, 1997. 100(12): p. 3131-9. 170. Zeng, G. and M.J. Quon, Insulin-stimulated pr oduction of nitric oxide is inhibited by wortmannin. Direct measurement in vascular endothelial cells. J Clin Invest, 1996. 98(4): p. 894-8. 171. Fulton, D., J.P. Gratton, and W.C. Sessa, Post -translational control of endothelial nitric oxide synthase: why isn't calcium/calm odulin enough? J Pharmacol Exp Ther, 2001. 299(3): p. 818-24. 172. Dimmeler, S., et al., Activation of nitric oxide synthase in endothelial cells by Aktdependent phosphorylation. Nature, 1999. 399(6736): p. 601-5. 173. Fulton, D., et al., Regulation of endothelium-derived nitric oxide production by the protein kinase Akt. Nature, 1999. 399(6736): p. 597-601. 174. Lane, P. and S.S. Gross, Disabling a C-te rminal autoinhibitory control element in endothelial nitric-oxide synt hase by phosphorylation provides a molecular explanation for activation of vascular NO synthesis by diverse physiological stimuli. J Biol Chem, 2002. 277(21): p. 19087-94. 175. Bauer, P.M., et al., Compensatory Phosphor ylation and Protein-Pr otein Interactions Revealed by Loss of Function and Gain of Function Mutants of Multiple Serine Phosphorylation Sites in Endothelial Nitr ic-oxide Synthase. J. Biol. Chem., 2003. 278(17): p. 14841-14849. 176. Luo, Z., et al., Acute modulation of endothelial Akt/PKB activity alters nitric oxidedependent vasomotor activity in vivo. J Clin Invest, 2000. 106 (4): p. 493-9. 177. Kureishi, Y., et al., The HM G-CoA reductase inhibitor simvastatin activates the protein kinase Akt and promotes angiogenesis in normocholesterolemic animals. Nat Med, 2000. 6(9): p. 1004-10. 178. Chen, Z.P., et al., AMP-activated prot ein kinase phosphoryla tion of endothelial NO synthase. FEBS Lett, 1999. 443(3): p. 285-9. 179. Matsubara, M., et al., Regulation of endothelial nitric oxide s ynthase by protein kinase C. J Biochem, 2003. 133(6): p. 773-81. 180. Fleming, I., et al., Phosphorylation of Th r(495) regulates Ca(2+)/calmodulin-dependent endothelial nitric oxide synt hase activity. Circ Res, 2001. 88(11): p. E68-75.

PAGE 187

187 181. Michell, B.J., et al., Coordinated cont rol of endothelial nitric-oxide synthase phosphorylation by protein kinase C and the cAMP-dependent protein kinase. J Biol Chem, 2001. 276(21): p. 17625-8. 182. Harris, M.B., et al., Reciprocal phosphorylati on and regulation of e ndothelial nitric-oxide synthase in response to bradyki nin stimulation. J Biol Chem, 2001. 276(19): p. 16587-91. 183. Lin, M.I., et al., Phosphorylation of threonine 497 in endothelial ni tric-oxide synthase coordinates the coupling of L-arginine meta bolism to efficient ni tric oxide production. J Biol Chem, 2003. 278(45): p. 44719-26. 184. Thomas, S.R., K. Chen, and J.F. Keaney, Jr., Hydrogen peroxide activates endothelial nitric-oxide synthase through coordinate d phosphorylation and dephosphorylation via a phosphoinositide 3-kinase-dependent signaling pathway. J Biol Chem, 2002. 277(8): p. 6017-24. 185. Boo, Y.C., et al., Shear stress stimulates phos phorylation of eNOS at Ser(635) by a protein kinase A-dependent mechanism. Am J Physiol Heart Circ Physiol, 2002. 283(5): p. H1819-28. 186. Boo, Y.C., et al., Endothelial NO synthase phosphorylated at SER635 produces NO without requiring intrace llular calcium increase. Free Radic Biol Med, 2003. 35(7): p. 72941. 187. Kou, R., D. Greif, and T. Michel, Dephosphoryl ation of endothelial ni tric-oxide synthase by vascular endothelial growth factor. Implications for the vascular responses to cyclosporin A. J Biol Chem, 2002. 277 (33): p. 29669-73. 188. Gallis, B., et al., Identification of flow-dependent endothelial nitric-oxide synthase phosphorylation sites by mass spectrometry and regulation of phosphorylation and nitric oxide production by the phosphatidylinositol 3-kinase inhibitor LY294002. J Biol Chem, 1999. 274(42): p. 30101-8. 189. Drew, B.G., et al., High-density lipoprotein and apolipoprotein AI increase endothelial NO synthase activity by protein association a nd multisite phosphorylation. Proc Natl Acad Sci U S A, 2004. 101(18): p. 6999-7004. 190. Babior, B.M., NADPH oxidase. Curr Opin Immunol, 2004. 16(1): p. 42-7. 191. Ago, T., et al., Nox4 as the major catalyt ic component of an endothelial NAD(P)H oxidase. Circulation, 2004. 109(2): p. 227-33. 192. Martyn, K.D., et al., Functional analysis of Nox4 reveals unique characteristics compared to other NADPH oxidases. Cell Signal, 2006. 18(1): p. 69-82. 193. Dworakowski, R., S.P. Alom-Ruiz, and A. M. Shah, NADPH oxidase-derived reactive oxygen species in the regulation of e ndothelial phenotype. Pharmacol Rep, 2008. 60(1): p. 21-8.

PAGE 188

188 194. Frey, R.S., et al., PKCzeta regulates TNFalpha-induced activation of NADPH oxidase in endothelial cells. Circ Res, 2002. 90(9): p. 1012-9. 195. Li, J.M. and A.M. Shah, Mechanism of endothelial cell NADPH oxidase activation by angiotensin II. Role of the p47phox subunit. J Biol Chem, 2003. 278(14): p. 12094-100. 196. Sorescu, D., et al., Superoxide production a nd expression of nox family proteins in human atherosclerosis. Circulation, 2002. 105(12): p. 1429-35. 197. Ohishi, M., et al., Enhanced expression of angiotensin-conv erting enzyme is associated with progression of coronary atherosc lerosis in humans. J Hypertens, 1997. 15(11): p. 1295-302. 198. Diet, F., et al., Increased accumulation of ti ssue ACE in human atherosclerotic coronary artery disease. Circulation, 1996. 94(11): p. 2756-67. 199. Nickenig, G., et al., Statin-sensitive dysre gulated AT1 receptor function and density in hypercholesterolemic men. Circulation, 1999. 100(21): p. 2131-4. 200. Bevilacqua, M.P., Endothelial-leukocyte a dhesion molecules. Annu Rev Immunol, 1993. 11: p. 767-804. 201. Kuzkaya, N., et al., Interactions of peroxyni trite, tetrahydrobiopte rin, ascorbic acid, and thiols: implications for uncoupling endothelial nitric-oxide syntha se. J Biol Chem, 2003. 278(25): p. 22546-54. 202. Landmesser, U., et al., Oxidation of tetra hydrobiopterin leads to uncoupling of endothelial cell nitric oxide synthase in hypertension. J Clin Invest, 2003. 111(8): p. 1201-9. 203. Meininger, C.J., et al., Impaired nitric oxide production in coronary endothelial cells of the spontaneously diabetic BB rat is due to te trahydrobiopterin defici ency. Biochem J, 2000. 349(Pt 1): p. 353-6. 204. Cai, S., et al., Endothelial nitric oxide synthase dysfunction in diabet ic mice: importance of tetrahydrobiopterin in eNOS dimerisation. Diabetologia, 2005. 48(9): p. 1933-40. 205. Heitzer, T., et al., Tetrahydrobiopterin im proves endothelium-depe ndent vasodilation by increasing nitric oxide activity in patients with Type II diabetes mellitus. Diabetologia, 2000. 43(11): p. 1435-8. 206. Takaya, T., et al., A specific role for eNOS-derived reactive oxygen species in atherosclerosis progre ssion. Arterioscler Th romb Vasc Biol, 2007. 27(7): p. 1632-7. 207. Ozaki, M., et al., Overexpression of endot helial nitric oxide synthase accelerates atherosclerotic lesion formation in apoE -deficient mice. J Clin Invest, 2002. 110(3): p. 331-40.

PAGE 189

189 208. Crabtree, M.J., et al., Ratio of 5,6,7,8-tetra hydrobiopterin to 7,8dihydrobiopterin in endothelial cells determines glucose-elicited changes in NO vs. superoxide production by eNOS. Am J Physiol Heart Circ Physiol, 2008. 294(4): p. H1530-40. 209. Miranda, T.B., et al., Yeast Hs l7 (histone synthetic lethal 7) catalyses the in vitro formation of omega-N(G)-monomethylarginine in calf thymus histone H2A. Biochem J, 2006. 395(3): p. 563-70. 210. Gary, J.D. and S. Clarke, RNA and protein interactions modulated by protein arginine methylation. Prog Nucleic Acid Res Mol Biol, 1998. 61: p. 65-131. 211. Rawal, N., et al., Structural specificity of substrate for S-adenos ylmethionine:protein arginine N-methyltransferas es. Biochim Biophys Acta, 1995. 1248(1): p. 11-8. 212. Gary, J.D., et al., The predominant pr otein-arginine methyltransferase from Saccharomyces cerevisiae. J Biol Chem, 1996. 271 (21): p. 12585-94. 213. Chen, S.L., et al., The coactivator-associated arginine methyltransferase is necessary for muscle differentiation: CARM1 coactivates myocyte enhancer factor-2. J Biol Chem, 2002. 277(6): p. 4324-33. 214. Tang, J., et al., PRMT 3, a type I protein argi nine N-methyltransferase that differs from PRMT1 in its oligomerization, subcellular localization, substrate specificity, and regulation. J Biol Chem, 1998. 273(27): p. 16935-45. 215. Pawlak, M.R., et al., Arginine N-methyltransferase 1 is required for early postimplantation mouse development, but cells deficient in the enzyme are viable. Mol Cell Biol, 2000. 20(13): p. 4859-69. 216. Chang, B., et al., JMJD6 is a histone arginine demethylase. Science, 2007. 318(5849): p. 444-7. 217. Boger, R.H., et al., LDL Cholesterol Upregulates Synthesis of Asymmetrical Dimethylarginine in Human Endothelial Cell s : Involvement of S-AdenosylmethionineDependent Methyltransf erases. Circ Res, 2000. 87(2): p. 99-105. 218. Osanai, T., et al., Effect of Shear Stress on Asymmetric Dimethylar ginine Release From Vascular Endothelial Cells. Hypertension, 2003. 42(5): p. 985-990. 219. MacAllister, R.J., et al., C oncentration of dimethyl-L-argin ine in the plasma of patients with end-stage renal failure. Nephrol Dial Transplant, 1996. 11 (12): p. 2449-52. 220. MacAllister, R.J., et al., Metabolism of methylargini nes by human vasculature; implications for the regulation of nitric oxide synthesis. Br J Pharmacol, 1994. 112(1): p. 43-8. 221. Xiao, S., et al., Circulating endothelial nitric oxide synthase inhibitory factor in some patients with chronic rena l disease. Kidney Int, 2001. 59(4): p. 1466-72.

PAGE 190

190 222. Vallance, P., et al., Accumulation of an endoge nous inhibitor of nitr ic oxide synthesis in chronic renal failure. Lancet, 1992. 339(8793): p. 572-5. 223. Kakimoto, Y. and S. Akazawa, Isolation and identification of N-G,N-Gand N-G,N'-Gdimethyl-arginine, N-epsilon-mono-, di-, and trimethyllysine, and glucosylgalactosyland galactosyl-delta-hydroxylysine from human urine. J Biol Chem, 1970. 245 (21): p. 5751-8. 224. McDermott, J.R., Studies on the cata bolism of Ng-methylarginine, Ng, Ngdimethylarginine and Ng, Ng-dimethylar ginine in the rabbit. Biochem J, 1976. 154(1): p. 179-84. 225. Ogawa, T., et al., Metabolism of NG,NG-a nd NG,N'G-dimethylarginine in rats. Arch Biochem Biophys, 1987. 252(2): p. 526-37. 226. Ogawa, T., M. Kimoto, and K. Sasaoka, Pu rification and properties of a new enzyme, NG,NG-dimethylarginine dime thylaminohydrolase, from rat kidney. J Biol Chem, 1989. 264(17): p. 10205-9. 227. Tran, C.T., J.M. Leiper, and P. Vallan ce, The DDAH/ADMA/NOS pathway. Atheroscler Suppl, 2003. 4(4): p. 33-40. 228. Forbes, S.P., et al., Mechanism of 4-HNE me diated inhibition of hDDAH-1: implications in no regulation. Biochemistry, 2008. 47(6): p. 1819-26. 229. Okubo, K., et al., Role of asymmetrical dimethylarginine in renal microvascular endothelial dysfunction in ch ronic renal failure with hype rtension. Hypertens Res, 2005. 28(2): p. 181-9. 230. Braun, O., et al., Specific reactions of S-nitrosothiols with cy steine hydrolases: A comparative study between dimethylargininase -1 and CTP synthetase. Protein Sci, 2007. 16(8): p. 1522-34. 231. Birdsey, G.M., J.M. Leiper, and P. Vallance, Intracellular lo calization of dimethylarginine dimethylaminohydrolase overexpressed in an en dothelial cell line. Acta Physiol Scand, 2000. 168(1): p. 73-9. 232. Murray-Rust, J., et al., Struct ural insights into the hydrolys is of cellular nitric oxide synthase inhibitors by dimethylarginine di methylaminohydrolase. Nat Struct Biol, 2001. 8(8): p. 679-83. 233. Nijveldt, R.J., et al., The liver is an impor tant organ in the metabolism of asymmetrical dimethylarginine (ADMA). Clin Nutr, 2003. 22(1): p. 17-22. 234. Nijveldt, R.J., et al., Elimination of asym metric dimethylarginine by the kidney and the liver: a link to the development of multiple organ failure? J Nutr, 2004. 134 (10 Suppl): p. 2848S-2852S; discussion 2853S.

PAGE 191

191 235. Tran, C.T., et al., Chromosomal localization, gene structure, and e xpression pattern of DDAH1: comparison with DDAH2 and implications for evolutionary origins. Genomics, 2000. 68(1): p. 101-5. 236. Kimoto, M., et al., Detection of NG,NG-dime thylarginine dimethyl aminohydrolase in the nitric oxide-generating systems of rats using monoclonal antibody. Arch Biochem Biophys, 1993. 300(2): p. 657-62. 237. Wang, D., et al., Isoform-specific re gulation by N(G),N(G)-dimethylarginine dimethylaminohydrolase of rat serum asymmetric dimethylarginine and vascular endothelium-derived relaxing factor/NO. Circ Res, 2007. 101(6): p. 627-35. 238. MacAllister, R.J., et al., Regulation of nitric oxide s ynthesis by dimethylarginine dimethylaminohydrolase. Br J Pharmacol, 1996. 119(8): p. 1533-40. 239. Dayoub, H., et al., Dimethylar ginine dimethylaminohydrolas e regulates nitric oxide synthesis: genetic and physiol ogical evidence. Circulation, 2003. 108(24): p. 3042-7. Epub 2003 Nov 24. 240. Leiper, J., et al., Disruption of methylarginine metabolism im pairs vascular homeostasis. Nat Med, 2007. 13(2): p. 198-203. 241. Jacobi, J., et al., Overexpr ession of dimethylarginine dimethylaminohydrolase reduces tissue asymmetric dimethylarginine levels and enhances angiogenesis. Circulation, 2005. 111(11): p. 1431-8. 242. Tanaka, M., et al., Dimet hylarginine dimethylaminohydrol ase overexpression suppresses graft coronary artery disease. Circulation, 2005. 112(11): p. 1549-56. 243. Cardounel, A.J., W.A. Wallace, and C.K. Se n, Proximal middle cerebr al artery occlusion surgery for the study of ischemia-reoxygenati on injury in the brain. Methods Enzymol, 2004. 381: p. 416-22. 244. Hasegawa, K., et al., Role of Asymmetric Dimethylarginine in Vascular Injury in Transgenic Mice Overexpressing Dimethylar ginie Dimethylaminohydrolase 2. Circ Res, 2007. 101(2): p. e2-10. 245. Smith, C.L., et al., Dimet hylarginine dimethylaminohydrol ase activity modulates ADMA levels, VEGF expression, and cell ph enotype. Biochem Bi ophys Res Commun, 2003. 308(4): p. 984-9. 246. Hasegawa, K., et al., Dimethylarginine dimethylaminohydrolase 2 increases vascular endothelial growth factor expr ession through Sp1 tran scription factor in endothelial cells. Arterioscler Thromb Vasc Biol, 2006. 26(7): p. 1488-94. 247. Tokuo, H., et al., Phosphorylation of neurofib romin by cAMP-dependent protein kinase is regulated via a cellula r association of N(G),N(G)-dimethylarginine dimethylaminohydrolase. FEBS Lett, 2001. 494(1-2): p. 48-53.

PAGE 192

192 248. Knipp, M., et al., Zn(II)-free dimethylargininase-1 (DDAH-1) is inhibited upon specific Cys-S-nitrosylation. J Biol Chem, 2003. 278(5): p. 3410-6. 249. Hong, L. and W. Fast, Inhibi tion of human dimethylargini ne dimethylaminohydrolase-1 by S-nitroso-L-homocysteine and hydrogen peroxide. Analysis, quantification, and implications for hyperhomocysteinemia. J Biol Chem, 2007. 282(48): p. 34684-92. 250. Scalera, F., et al., Effect of telmisartan on nitric oxide--asymmetr ical dimethylarginine system: role of angiotensin II type 1 receptor gamma and peroxisome proliferator activated receptor gamma signaling during endot helial aging. Hypertension, 2008. 51(3): p. 696-703. 251. Yin, Q.F. and Y. Xiong, Pravastatin rest ores DDAH activity and endothelium-dependent relaxation of rat aorta after exposure to glycated protein. J Cardiovasc Pharmacol, 2005. 45(6): p. 525-32. 252. Achan, V., et al., all-trans-Retinoic acid incr eases nitric oxide synthesis by endothelial cells: a role for the induction of dimethylar ginine dimethylaminohydr olase. Circ Res, 2002. 90(7): p. 764-9. 253. Jones, L.C., et al., Common genetic variati on in a basal promoter element alters DDAH2 expression in endothelial cells Biochem Biophys Res Commun, 2003. 310(3): p. 836-43. 254. Valkonen, V.P., T.P. Tuomainen, and R. L aaksonen, DDAH gene and ca rdiovascular risk. Vasc Med, 2005. 10 Suppl 1 : p. S45-8. 255. Boger, R.H., et al., Asymmetric dimethyl arginine (ADMA): a nove l risk factor for endothelial dysfunction: its role in hypercholesterolemia. Circulation, 1998. 98(18): p. 1842-7. 256. Zoccali, C., et al., Plasma concentration of as ymmetrical dimethylarginine and mortality in patients with end-stage renal dise ase: a prospective study. Lancet, 2001. 358(9299): p. 2113-7. 257. Lu, T.M., et al., Plasma levels of as ymmetrical dimethylarginine and adverse cardiovascular events after percutaneous coronary intervention. Eur Heart J, 2003. 24(21): p. 1912-9. 258. McLaughlin, T., et al., Plasma asymmetric dime thylarginine concentrat ions are elevated in obese insulin-resistant women and fall with weight loss. J Clin Endocrinol Metab, 2006. 91(5): p. 1896-900. 259. Chan, J.R., et al., Asymmetric Dimethylar ginine Increases Mononuc lear Cell Adhesiveness in Hypercholesterolemic Humans. Ar terioscler Thromb Vasc Biol, 2000. 20(4): p. 10401046. 260. Azuma, H., et al., Accumulation of endogenous inhibitors for nitric oxide synthesis and decreased content of L-arginine in regene rated endothelial cells. Br J Pharmacol, 1995. 115(6): p. 1001-4.

PAGE 193

193 261. Ito, A., et al., Novel mechanism for endothelial dysfuncti on: dysregulation of dimethylarginine dimethylam inohydrolase. Circulation, 1999. 99(24): p. 3092-5. 262. Shahgasempour, S., S.B. Woodroffe, and H.M. Garnett, Alterations in the expression of ELAM-1, ICAM-1 and VCAM-1 after in vitro inf ection of endothelial cells with a clinical isolate of human cytomegalovirus. Microbiol Immunol, 1997. 41(2): p. 121-9. 263. Weis, M., et al., Cytomegalovirus infection impa irs the nitric oxide s ynthase pathway: role of asymmetric dimethylarginine in tran splant arterioscler osis. Circulation, 2004. 109(4): p. 500-5. 264. Tain, Y.L. and C. Baylis, Determination of dimethylarginine dimethylaminohydrolase activity in the kidne y. Kidney Int, 2007. 72(7): p. 886-9. 265. Lin, K.Y., et al., Impaired nitric oxide synt hase pathway in diabetes mellitus: role of asymmetric dimethylarginine and dimethylar ginine dimethylaminohydrolase. Circulation, 2002. 106(8): p. 987-92. 266. Sorrenti, V., et al., High glucose-mediated imbalance of nitric oxide synthase and dimethylarginine dimethylaminohydrolase expres sion in endothelial cells. Curr Neurovasc Res, 2006. 3(1): p. 49-54. 267. Achan, V., et al., Asymmetric dimet hylarginine causes hype rtension and cardiac dysfunction in humans and is activel y metabolized by dimethylarginine dimethylaminohydrolase. Arterios cler Thromb Vasc Biol, 2003. 23(8): p. 1455-9. 268. Boger, G.I., et al., Asymmetric dimethyl arginine determines the improvement of endothelium-dependent vasodila tion by simvastatin: Effect of combination with oral Larginine. J Am Coll Cardiol, 2007. 49(23): p. 2274-82. 269. Maas, R., et al., Asymmetric dimethylarginine, smoking, and risk of coronary heart disease in apparently healthy men: prospective analysis from the population-based Monitoring of Trends and Determinants in Cardiovascular Disease/Kooperative Gesundheitsforschung in der Region Augsburg study and experimental data. Clin Chem, 2007. 53(4): p. 693-701. 270. Maas, R., et al., Asymmetrical dimethylar ginine (ADMA) and co ronary endothelial function in patients with coronary artery disease and mild hypercholesterolemia. Atherosclerosis, 2007. 191 (1): p. 211-9. 271. Maas, R., et al., Elevated plasma concentra tions of the endogenous ni tric oxide synthase inhibitor asymmetric dimethylarginine pred ict adverse events in patients undergoing noncardiac surgery. Crit Care Med, 2007. 35(8): p. 1876-81. 272. Boger, R.H., et al., Plasma concentration of asymmetric dimethylarginine, an endogenous inhibitor of nitric oxide synt hase, is elevated in monkeys with hyperhomocyst(e)inemia or hypercholesterolemia. Arterios cler Thromb Vasc Biol, 2000. 20(6): p. 1557-64.

PAGE 194

194 273. Schulze, F., et al., Asymmetric dimethylarginine is an independent risk factor for coronary heart disease: results from the multicenter Coronary Artery Risk Determination investigating the Influence of ADMA Con centration (CARDIAC) study. Am Heart J, 2006. 152(3): p. 493 e1-8. 274. Pope, A.J., et al., Role of DDAH-1 in lipid peroxidation product-m ediated inhibition of endothelial NO generation. Am J Physiol Cell Physiol, 2007. 293(5): p. C1679-86. 275. Ito, A., et al., Novel mechanism for endothelial dysfuncti on: dysregulation of dimethylarginine dimethylam inohydrolase. Circulation, 1999. 99(24): p. 3092-5. 276. Zakrzewicz, D. and O. Eickelberg, From arginine methylation to ADMA: a novel mechanism with therapeutic potential in chr onic lung diseases. BMC Pulm Med, 2009. 9: p. 5. 277. Zoccali, C., et al., Asymmetric dimethyl-a rginine (ADMA) response to inflammation in acute infections. Nephrol Dial Transplant, 2007. 22(3): p. 801-6. 278. Vallance, P. and J. Leiper, Asymmetric di methylarginine and kidne y disease--marker or mediator? J Am Soc Nephrol, 2005. 16(8): p. 2254-6. 279. Stuhlinger, M.C., et al., Asymme tric dimethyl L-arginine (ADMA) is a critical regulator of myocardial reperfusion inju ry. Cardiovasc Res, 2007. 75(2): p. 417-25. 280. Simon, A., et al., Role of neutral amino acid transport and protein breakdown for substrate supply of nitric oxide synthase in human endothelial cells. Circ Res, 2003. 93(9): p. 81320. 281. Gray, G.A., et al., Immunolo calisation and activity of DD AH I and II in the heart and modification post-myocardial in farction. Acta Histochem, 2009. 282. Leiper, J.M., et al., Identification of two human dimethylarginine dimethylaminohydrolases with distinct tissue distributions and homology with microbial arginine deiminases. Biochem J, 1999. 343 Pt 1: p. 209-14. 283. Guerra, R., Jr., et al., Mechanisms of abnor mal endothelium-dependent vascular relaxation in atherosclerosis: implications for altere d autocrine and paracrine functions of EDRF. Blood Vessels, 1989. 26(5): p. 300-14. 284. Palmer, R.M., A.G. Ferrige, and S. Moncad a, Nitric oxide rele ase accounts for the biological activity of endothelium-derived relaxing factor. Nature, 1987. 327(6122): p. 524-6. 285. Radomski, M.W. and S. Mon cada, Regulation of vascular homeostasis by nitric oxide. Thromb Haemost, 1993. 70(1): p. 36-41. 286. Cohen, R.A., The role of nitric oxide and ot her endothelium-derived vasoactive substances in vascular disease. Prog Cardiovasc Dis, 1995. 38(2): p. 105-28.

PAGE 195

195 287. Keaney, J.F., Jr., et al., Diet ary probucol preserves endotheli al function in cholesterol-fed rabbits by limiting vascular oxid ative stress and superoxide generation. J Clin Invest, 1995. 95(6): p. 2520-9. 288. Yla-Herttuala, S., et al., Evidence for the presence of oxidatively modified low density lipoprotein in atherosclerotic lesions of rabbit and man. J Clin Invest, 1989. 84(4): p. 108695. 289. Jurgens, G., et al., Immunosta ining of human autopsy aortas with antibodies to modified apolipoprotein B and apoprotein (a). Arterioscler Thromb, 1993. 13(11): p. 1689-99. 290. Usatyuk, P.V., N.L. Parinandi, and V. Natarajan, Redox regulation of 4-hydroxy-2nonenal-mediated endothelial barrier dysfunc tion by focal adhesion, adherens, and tight junction proteins. J Biol Chem, 2006. 281(46): p. 35554-66. 291. Chisolm, G.M. and D. Steinberg, The oxidati ve modification hypothesi s of atherogenesis: an overview. Free Radic Biol Med, 2000. 28(12): p. 1815-26. 292. Quinn, M.T., et al., Oxidatively modified low density lipoproteins: a potential role in recruitment and retention of monocyte/macrophages during athe rogenesis. Proc Natl Acad Sci U S A, 1987. 84(9): p. 2995-8. 293. Sawamura, T., et al., An endothelial receptor for oxidized low-density lipoprotein. Nature, 1997. 386(6620): p. 73-7. 294. Simon, B.C., L.D. Cunningham, and R.A. Cohe n, Oxidized low density lipoproteins cause contraction and inhibit endotheli um-dependent relaxation in the pig coronary artery. J Clin Invest, 1990. 86(1): p. 75-9. 295. Meinitzer, A., et al., Asymmetrical dimet hylarginine independently predicts total and cardiovascular mortality in individuals with angiographic coronary artery disease (the Ludwigshafen Risk and Cardiovasc ular Health study). Clin Chem, 2007. 53(2): p. 273-83. 296. Smith, C.L., et al., Effects of ADMA upon gene expression: an insight into the pathophysiological signif icance of raised plasma ADMA. PLoS Med, 2005. 2(10): p. e264. 297. Tsao, P.S. and J.P. Cooke, Endothelial alterations in hypercholesterolemia: more than simply vasodilator dysfunction. J Cardiovasc Pharmacol, 1998. 32 Suppl 3: p. S48-53. 298. Boger, R.H., P. Vallance, and J.P. Cooke, Asymmetric dimethylar ginine (ADMA): a key regulator of nitric oxide s ynthase. Atheroscler Suppl, 2003. 4(4): p. 1-3. 299. Cooke, J.P., Does ADMA cause endothelial dys function? Arterioscler Thromb Vasc Biol, 2000. 20(9): p. 2032-7. 300. Kimoto, M., et al., Purification, cDNA cloning and expression of human NG,NGdimethylarginine dimethylami nohydrolase. Eur J Biochem, 1998. 258(2): p. 863-8.

PAGE 196

196 301. Chen, Y., et al., Dimethylarginine dimet hylaminohydrolase and endothelial dysfunction in failing hearts. Am J Physiol Heart Circ Physiol, 2005. 289(5): p. H2212-9. 302. Leiper, J.M., The DDAH-ADMA-NOS pathway. Ther Drug Monit, 2005. 27(6): p. 744-6. 303. Boger, R.H., J.P. Cooke, and P. Vallance, ADMA: an emerging cardiovascular risk factor. Vasc Med, 2005. 10 Suppl 1 : p. S1-2. 304. Vallance, P. and J. Leiper, Cardi ovascular biology of the asymmetric dimethylarginine:dimethylargi nine dimethylaminohydrolase pa thway. Arterioscler Thromb Vasc Biol, 2004. 24(6): p. 1023-30. 305. Wojciak-Stothard, B., et al., The ADMA/DDAH pathway is a critical regulator of endothelial cell motility. J Cell Sci, 2007. 120(Pt 6): p. 929-42. 306. Cardounel, A.J. and J.L. Zweier, Endogenous methylarginines regul ate neuronal nitricoxide synthase and prevent excito toxic injury. J Biol Chem, 2002. 277(37): p. 33995-4002. Epub 2002 Jun 28. 307. Esterbauer, H., R.J. Schaur, and H. Zo llner, Chemistry and biochemistry of 4hydroxynonenal, malonaldehyde and relate d aldehydes. Free Radic Biol Med, 1991. 11(1): p. 81-128. 308. Lieners, C., et al., Lipidp eroxidation in a canine model of hypovolemic-traumatic shock. Prog Clin Biol Res, 1989. 308: p. 345-50. 309. Siakotos, A.N., et al., 4-Hydroxynonenal: a spec ific indicator for can ine neuronal-retinal ceroidosis. Am J Med Genet Suppl, 1988. 5: p. 171-81. 310. Xia, Y., et al., Superoxide generation from endothelial nitric-oxide synthase. A Ca2+/calmodulin-dependent and tetrahydrobiop terin regulatory process. J Biol Chem, 1998. 273(40): p. 25804-8. 311. Landmesser, U., et al., Oxidation of tetra hydrobiopterin leads to uncoupling of endothelial cell nitric oxide synthase in hypertension. J Clin Invest, 2003. 111(8): p. 1201-9. 312. Cardounel, A.J., Y. Xia, and J.L. Zw eier, Endogenous methylarginines modulate superoxide as well as nitric oxide generation from neur onal nitric-oxide synthase: differences in the effects of monomethyland dimethylarginines in the presence and absence of tetrahydrobiop terin. J Biol Chem, 2005. 280(9): p. 7540-9. 313. Konishi, H., K. Sydow, and J.P. Cooke, Dimethylarginine dimethylaminohydrolase promotes endothelial repa ir after vascular injury J Am Coll Cardiol, 2007. 49(10): p. 1099-105. 314. Frey, D., et al., Structure of the ma mmalian NOS regulator dimethylarginine dimethylaminohydrolase: A basis for the desi gn of specific inhibito rs. Structure, 2006. 14(5): p. 901-11.

PAGE 197

197 315. Stone, E.M., et al., Substrate-assisted cy steine deprotonation in the mechanism of dimethylargininase (DDAH) from Ps eudomonas aeruginosa. Biochemistry, 2006. 45(17): p. 5618-30. 316. Uchida, K., 4-Hydroxy-2-nonenal: a product and mediator of oxidative stress. Prog Lipid Res, 2003. 42(4): p. 318-43. 317. Cooke, J.P., Does ADMA cause endothelial dys function? Arterioscler Thromb Vasc Biol, 2000. 20(9): p. 2032-7. 318. Arnold, W.P., et al., Nitric oxide activates guanylate cyclase and increases guanosine 3':5'cyclic monophosphate levels in various tissu e preparations. Proc Natl Acad Sci U S A, 1977. 74(8): p. 3203-7. 319. Gruetter, D.Y., et al., Activation of coronary arterial guanylate cyclase by nitric oxide, nitroprusside, and nitrosoguani dine--inhibition by calcium, lanthanum, and other cations, enhancement by thiols. Biochem Pharmacol, 1980. 29(21): p. 2943-50. 320. Martin, W., et al., Selective blockade of endothelium-depe ndent and glyceryl trinitrateinduced relaxation by hemoglobin and by methylene blue in the rabbit aorta. J Pharmacol Exp Ther, 1985. 232(3): p. 708-16. 321. Hecker, M., D.T. Walsh, and J.R. Vane, On the substrate specificity of nitric oxide synthase. FEBS Lett, 1991. 294(3): p. 221-4. 322. Sarkar, R., et al., Cell cycle effects of nitr ic oxide on vascular smoot h muscle cells. Am J Physiol, 1997. 272(4 Pt 2): p. H1810-8. 323. Pou, S., et al., Generation of superoxide by purified brain nitric oxide synthase. J Biol Chem, 1992. 267(34): p. 24173-6. 324. Pou, S., et al., Mechanism of superoxide generation by neuronal nitric-oxide synthase. J Biol Chem, 1999. 274(14): p. 9573-80. 325. Rosen, G.M., et al., The role of tetrahydrobi opterin in the regulati on of neuronal nitricoxide synthase-generated s uperoxide. J Biol Chem, 2002. 277 (43): p. 40275-80. Epub 2002 Aug 14. 326. Vasquez-Vivar, J., et al., S uperoxide generation by endotheli al nitric oxide synthase: the influence of cofactors. Proc Natl Acad Sci U S A, 1998. 95(16): p. 9220-5. 327. Vasquez-Vivar, J., et al., Tetrahydrobi opterin-dependent inhibition of superoxide generation from neuronal nitric oxide synthase. J Biol Chem, 1999. 274(38): p. 26736-42. 328. Xia, Y., et al., Nitric oxide synthase genera tes superoxide and nitric oxide in argininedepleted cells leading to peroxynitrite-mediated cellular injury. Proc Na tl Acad Sci U S A, 1996. 93(13): p. 6770-4.

PAGE 198

198 329. Xia, Y. and J.L. Zweier, S uperoxide and peroxynitrite gene ration from inducible nitric oxide synthase in macrophages. Proc Natl Acad Sci U S A, 1997. 94(13): p. 6954-8. 330. Nishida, C.R. and P.R. Ortiz de Montella no, Electron transfer and catalytic activity of nitric oxide synthases. Chimeric constructs of the neuronal, induc ible, and endothelial isoforms. J Biol Chem, 1998. 273(10): p. 5566-71. 331. Witte, M.B. and A. Barbul, Arginine phys iology and its implication for wound healing. Wound Repair Regen, 2003. 11(6): p. 419-23. 332. Witte, M.B., et al., L-Arginine supplementation enhances diabetic wound healing: involvement of the nitric oxide synthase and arginase pathways. Metabolism, 2002. 51(10): p. 1269-73. 333. Reckelhoff, J.F., et al., Changes in nitric oxide precursor, L-arginine, and metabolites, nitrate and nitrite, with aging. Life Sci, 1994. 55(24): p. 1895-902. 334. Hasegawa, T., et al., Impairment of L-argi nine metabolism in spontaneously hypertensive rats. Biochem Int, 1992. 26(4): p. 653-8. 335. Albina, J.E., et al., Temporal expression of di fferent pathways of 1arginine metabolism in healing wounds. J Immunol, 1990. 144(10): p. 3877-80. 336. Hecker, M., et al., The metabolism of L-arginine and its significan ce for the biosynthesis of endothelium-derived relaxing factor: cultured endothelial cells recycle L-citrulline to Larginine. Proc Natl Acad Sci U S A, 1990. 87(21): p. 8612-6. 337. Rodriguez-Crespo, I. and P.R. Ortiz de Montellano, Human endothe lial nitric oxide synthase: expression in Escherichia coli, coexpression with calmodulin, and characterization. Arch Biochem Biophys, 1996. 336(1): p. 151-6. 338. Xia, Y., et al., Electron paramagnetic res onance spectroscopy with N-methyl-D-glucamine dithiocarbamate iron complexes distinguishes nitric oxide and nitr oxyl anion in a redoxdependent manner: applications in identifyi ng nitrogen monoxide products from nitric oxide synthase. Free Radic Biol Med, 2000. 29(8): p. 793-7. 339. Souza, H.P., et al., Quantitation of superoxide generation and s ubstrate utilization by vascular NAD(P)H oxidase. Am J P hysiol Heart Circ Physiol, 2002. 282(2): p. H466-74. 340. Roubaud, V., et al., Quantitative measurem ent of superoxide generation and oxygen consumption from leukocytes using electr on paramagnetic resonance spectroscopy. Anal Biochem, 1998. 257(2): p. 210-7. 341. Chen, P.F., et al., Effects of Asp-369 and Arg-372 mutations on heme environment and function in human endothelial nitric -oxide synthase. J Biol Chem, 1998. 273 (51): p. 34164-70.

PAGE 199

199 342. Salerno, J.C., et al., Characterization by electron paramagneti c resonance of the interactions of L-arginine and L-thiocitrulline with the heme cofactor region of nitric oxide synthase. J Biol Chem, 1995. 270(46): p. 27423-8. 343. Du, M., et al., Redox properties of human endothelial nitric-oxide synthase oxygenase and reductase domains purified from yeast expression system. J Biol Chem, 2003. 278(8): p. 6002-11. 344. Salerno, J.C., et al., Substrate and substrat e analog binding to endot helial nitric oxide synthase: electron paramagnetic resonance as an isoform-specific probe of the binding mode of substrate analogs. Biochemistry, 1997. 36 (39): p. 11821-7. 345. Tiefenbacher, C.P., et al., Restoration of endothelium-depende nt vasodilation after reperfusion injury by tetrahydrobiopterin. Circulation, 1996. 94 (6): p. 1423-9. 346. Tiefenbacher, C.P., et al., Endothelial dysf unction of coronary resi stance arteries is improved by tetrahydrobiopterin in atherosclerosis. Circulation, 2000. 102(18): p. 2172-9. 347. Tiefenbacher, C.P., et al., Sepiapterin reduces postischemic injury in th e rat heart. Pflugers Arch, 2003. 447(1): p. 1-7. Epub 2003 Aug 5. 348. Setoguchi, S., et al., Tetra hydrobiopterin improves endotheli al dysfunction in coronary microcirculation in patients without epicardial coronary artery disease. J Am Coll Cardiol, 2001. 38(2): p. 493-8. 349. Maier, W., et al., Tetrahydrobiopterin improves endothelial function in patients with coronary artery disease. J Cardiovasc Pharmacol, 2000. 35(2): p. 173-8. 350. Gao, Y.T., et al., Oxygen metabolism by neur onal nitric-oxide synthase. J Biol Chem, 2007. 282(11): p. 7921-9. 351. Gao, Y.T., et al., Oxygen metabolism by endothe lial nitric-oxide synthase. J Biol Chem, 2007. 282(39): p. 28557-65. 352. Abu-Soud, H.M., et al., Electron transfer oxygen binding, and nitric oxide feedback inhibition in endothelial nitric-o xide synthase. J Biol Chem, 2000. 275(23): p. 17349-57. 353. Berka, V., et al., Redox function of tetrahydrob iopterin and effect of L-arginine on oxygen binding in endothelial nitric oxi de synthase. Biochemistry, 2004. 43(41): p. 13137-48. 354. Gao, Y.T., et al., Thermodynamics of oxidation-reduction reactions in mammalian nitricoxide synthase isoforms. J Biol Chem, 2004. 279(18): p. 18759-66. 355. Sligar, S.G., Coupling of spin, substrate, and redox equilibria in cytochrome P450. Biochemistry, 1976. 15(24): p. 5399-406. 356. Sligar, S.G., et al., Spin state control of the hepatic cytochrome P450 redox potential. Biochem Biophys Res Commun, 1979. 90(3): p. 925-32.

PAGE 200

200 357. Presta A, W.-M.A., Stankovich M, Stuehr D, Comparative Effects of Substrates and Pterin Cofactor on the Heme Midpoint Potential in Inducible and Neuronal Nitric Oxide Synthases. J. Am. Chem. Soc., 1997. 120 (37): p. 9460 -9465. 358. Sennequier, N. and D.J. Stuehr, Analysis of substrate-induced elec tronic, catalytic, and structural changes in inducibl e NO synthase. Biochemistry, 1996. 35(18): p. 5883-92. 359. Rosen, G.M., et al., The role of tetrahydrobi opterin in the regulati on of neuronal nitricoxide synthase-generated s uperoxide. J Biol Chem, 2002. 277 (43): p. 40275-80. 360. Weaver, J., et al., A comparative study of neuronal and induci ble nitric oxide synthases: generation of nitric oxide, superoxide, and hydrogen peroxide. Biochim Biophys Acta, 2005. 1726(3): p. 302-8. 361. Sasaki, N., et al., Augmentation of vascular remodeling by uncoupled endothelial nitric oxide synthase in a mouse model of diabetes mellitus. Arterioscler Thromb Vasc Biol, 2008. 28(6): p. 1068-76. 362. Abelson, H.T., et al., Kinetics of tetr ahydrobiopterin synthesis by rabbit brain dihydrofolate reductase. Biochem J, 1978. 171(1): p. 267-8. 363. Laursen, J.B., et al., Endothelial Regulation of Vasomotion in ApoE-Deficient Mice : Implications for Interactions Between Per oxynitrite and Tetrahydrobi opterin. Circulation, 2001. 103(9): p. 1282-1288. 364. Alp, N.J., et al., Tetrahydrobiopterin-depende nt preservation of n itric oxide-mediated endothelial function in diabetes by targeted transgenic GTP-cyclohydrolase I overexpression. J Clin Invest, 2003. 112 (5): p. 725-35. 365. Bedford, M.T. and S. Richard, Arginine me thylation an emerging regulator of protein function. Mol Cell, 2005. 18(3): p. 263-72. 366. Boulanger, M.C., et al., Methylation of Tat by PRMT6 regulates human immunodeficiency virus type 1 gene expression. J Virol, 2005. 79(1): p. 124-31. 367. Tran, C.T., J.M. Leiper, and P. Vallan ce, The DDAH/ADMA/NOS pathway. Atheroscler Suppl, 2003. 4(4): p. 33-40. 368. Ogawa, T., M. Kimoto, and K. Sasaoka, Dime thylarginine:pyruvate aminotransferase in rats. Purification, properties, and identity wi th alanine:glyoxylate aminotransferase 2. J Biol Chem, 1990. 265(34): p. 20938-45. 369. Thompson, P.R. and W. Fast, Histone citrul lination by protein arginine deiminase: is arginine methylation a green light or a roadblock? ACS Chem Biol, 2006. 1(7): p. 433-41. 370. Wang, Y., et al., Human PAD4 regulates hi stone arginine met hylation levels via demethylimination. Science, 2004. 306(5694): p. 279-83.

PAGE 201

201 371. Regulation of eNOS-derived superoxide by endogenous methylargini nes. Biochemistry., 2008. 47(27): p. 7256-63. Epub 2008 Jun 14. 372. The ratio between tetrahydrobiopterin and oxi dized tetrahydrobiopterin analogues controls superoxide release from endot helial nitric oxide synthase : an EPR spin trapping study. Biochem J., 2002. 362(Pt 3): p. 733-9. 373. Ratio of 5,6,7,8-tetrahydrobiopterin to 7,8-dihydr obiopterin in endothelial cells determines glucose-elicited changes in NO vs. superoxi de production by eNOS. Am J Physiol Heart Circ Physiol., 2008. 294(4): p. H1530-40. Epub 2008 Jan 11.

PAGE 202

202 BIOGRAPHICAL SKETCH Arthur Pope was born in 1982 in Chicago, IL. He graduated from the Illinois Mathematics and Science Academy in 2001. Following graduation, he attended the Univer sity of Illinois at Urbana Champaign and obtained a B.S. degree in Chemistry in 2005. He then enrolled in the Integrated Biomedical Science Program at The Oh io State University College of Medicine in June of 2005 to obtain his doctorate of philosophy. In January 2006 he joined Dr AJ Cardounels lab and in June of 2007 he relocat ed with his mentor to the Univ ersity of Flor ida joining the Interdisplenary Program in Biomedical Sciences where he obtained his doctorate of philosophy in August of 2009. During his graduate training he received a pre-doc toral fellowship award from the NIH National Heart Lung and Blood Institute Arthur has also been the first author on three publications, and co-author on two others. He also has pres ented his research at several confrences and has had two invited talks.