<%BANNER%>

Metabolic Engineering of Microbial Biocatalysts for Fermentative Production of Next Generation Biofuels

Permanent Link: http://ufdc.ufl.edu/UFE0024891/00001

Material Information

Title: Metabolic Engineering of Microbial Biocatalysts for Fermentative Production of Next Generation Biofuels
Physical Description: 1 online resource (175 p.)
Language: english
Creator: Do, Phi
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: biocatalyst, butanol, butyrate, escherichia, hydrogen, hydrogenosome, production
Microbiology and Cell Science -- Dissertations, Academic -- UF
Genre: Microbiology and Cell Science thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: With increasing demand for fuel and a finite supply of petroleum, alternative renewable sources of energy need to be generated in order to free the world from the bond of fossil fuels. New transportation fuels currently in development include hydrogen and higher chain alcohols such as butanol. This study focuses on metabolic engineering of Escherichia coli as a microbial biocatalyst for fermentative production of these high energy alternative fuels towards identifying the rate-limiting steps in achieving high product yields. For production of hydrogen at high yield from fermentable sugars, the reducing potential from reduced nicotinamide adenine dinucleotide (NADH) produced during fermentation also needs to be converted to hydrogen. The gene encoding the first enzyme in the NADH-dependent hydrogen pathway, NADH-ferredoxin oxidoreductase (NDH), was cloned from an anaerobic protozoan, Trichomonas vaginalis, and expressed. The NDH protein purified from the recombinant E. coli and biochemically characterized. The recombinant enzyme reduced several low-potential electron acceptors such as ferredoxin and viologens with NADH as electron donor. The Fe-S cluster composition of this heterodimer is apparently responsible for this unique catalytic property. Attempts to couple NADH oxidation to hydrogen production using NDH, methyl viologen and native hydrogenase 3 were not successful due to thermodynamic constraints, which proved to be difficult to overcome in vivo. Although several microbes produce butanol as a fermentation product, none of them produce butanol as sole fermentation product. Towards constructing a recombinant E. coli that produces butanol as the main fermentation product, the genes encoding the enzymes minimally needed for converting acetyl-CoA to butanol were cloned from Clostridium acetobutylicum and Streptomyces avermitilis and expressed in E. coli. The encoded proteins upon purification and mixing in vitro established the butanol pathway and converted acetyl-CoA to butanol. E. coli carrying the butanol pathway genes produced butanol but the yield of butanol was only about 2 mM. One of the rate-limiting steps in achieving higher yield butanol production was identified as the butyryl-CoA dehydrogenase complex. Other rate-limiting steps in butanol production were the competition for acetyl-CoA between ethanol and butanol pathways as well as generating sufficient amounts of appropriate reductants to support the activity of various enzymes in the butanol pathway while also maintaining proper redox balance.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Phi Do.
Thesis: Thesis (Ph.D.)--University of Florida, 2009.
Local: Adviser: Shanmugam, Keelnatham T.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0024891:00001

Permanent Link: http://ufdc.ufl.edu/UFE0024891/00001

Material Information

Title: Metabolic Engineering of Microbial Biocatalysts for Fermentative Production of Next Generation Biofuels
Physical Description: 1 online resource (175 p.)
Language: english
Creator: Do, Phi
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: biocatalyst, butanol, butyrate, escherichia, hydrogen, hydrogenosome, production
Microbiology and Cell Science -- Dissertations, Academic -- UF
Genre: Microbiology and Cell Science thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: With increasing demand for fuel and a finite supply of petroleum, alternative renewable sources of energy need to be generated in order to free the world from the bond of fossil fuels. New transportation fuels currently in development include hydrogen and higher chain alcohols such as butanol. This study focuses on metabolic engineering of Escherichia coli as a microbial biocatalyst for fermentative production of these high energy alternative fuels towards identifying the rate-limiting steps in achieving high product yields. For production of hydrogen at high yield from fermentable sugars, the reducing potential from reduced nicotinamide adenine dinucleotide (NADH) produced during fermentation also needs to be converted to hydrogen. The gene encoding the first enzyme in the NADH-dependent hydrogen pathway, NADH-ferredoxin oxidoreductase (NDH), was cloned from an anaerobic protozoan, Trichomonas vaginalis, and expressed. The NDH protein purified from the recombinant E. coli and biochemically characterized. The recombinant enzyme reduced several low-potential electron acceptors such as ferredoxin and viologens with NADH as electron donor. The Fe-S cluster composition of this heterodimer is apparently responsible for this unique catalytic property. Attempts to couple NADH oxidation to hydrogen production using NDH, methyl viologen and native hydrogenase 3 were not successful due to thermodynamic constraints, which proved to be difficult to overcome in vivo. Although several microbes produce butanol as a fermentation product, none of them produce butanol as sole fermentation product. Towards constructing a recombinant E. coli that produces butanol as the main fermentation product, the genes encoding the enzymes minimally needed for converting acetyl-CoA to butanol were cloned from Clostridium acetobutylicum and Streptomyces avermitilis and expressed in E. coli. The encoded proteins upon purification and mixing in vitro established the butanol pathway and converted acetyl-CoA to butanol. E. coli carrying the butanol pathway genes produced butanol but the yield of butanol was only about 2 mM. One of the rate-limiting steps in achieving higher yield butanol production was identified as the butyryl-CoA dehydrogenase complex. Other rate-limiting steps in butanol production were the competition for acetyl-CoA between ethanol and butanol pathways as well as generating sufficient amounts of appropriate reductants to support the activity of various enzymes in the butanol pathway while also maintaining proper redox balance.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Phi Do.
Thesis: Thesis (Ph.D.)--University of Florida, 2009.
Local: Adviser: Shanmugam, Keelnatham T.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0024891:00001


This item has the following downloads:


Full Text





METABOLIC ENGINEERING OF MICROBIAL BIOCATALYSTS FOR FERMENTATIVE
PRODUCTION OF NEXT GENERATION BIOFUELS




















By

PHI MINH DO


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2009


































2009 Phi Minh Do


































To my friends, family, colleagues, mentors, and especially Ming Dang for their support and
motivation for making this possible









ACKNOWLEDGMENTS

I would like to thank my committee chair, Dr. K.T. Shanmugam and my committee

members, Dr. Ingram, Dr. Maupin-Furlow, Dr. Stewart, and Dr. Romeo, for their guidance over

these many years, and my lab mates for their time and assistance. I would also like to extend a

special thanks to Dr. Hrdy and Dr. Scharf for T. vaginalis NADH-dehydrogenase (NDH) DNA

and termite gut [Fe]-hydrogenase DNA, respectively, Dr. Angerhofer for conducting Electron

Paramagnetic Resonance (EPR) experiments, and the entire Department of Microbiology and

Cell Science at the University of Florida for making this a positive experience.









TABLE OF CONTENTS

page

A C K N O W L E D G M E N T S .................................................................................................................... 4

L IST O F T A B L E S ... .. .................... ..... ..................................................................... .............. ....... 8

L IST O F F IG U R E S ................................................................. 9

L IST O F A B B R E V IA T IO N S ....................................................................... ............................... 11

A B STR A CT ...................... ...................... .......... ................ 17

CHAPTER

1 INTRODUCTION AND SIGNIFICANCE............................................................. ............... 19

F u el C crisis ..................................19............... 19
R enew able B iom ass to E thanol ...................................................................... ...................... 20
Second G generation R enew able Fuels.................................................. ............................. 26
H y d ro g en ................... ................... ...................2.........6
B utanol ...................................... ............... ...... 27

2 BACKGROUND ON HYDROGEN PRODUCTION ........... .................. ..... ............28

Current H ydrogen Production M ethods........................................ ......................................... 28
M ethane Steam R reform ing ...................................................... ..................................... 2 8
C o a l G a sificatio n ................................................................................................................. 2 8
H y dro g en fro m H 20 ............................................................................................................ 2 9
B iom ass C conversion to H ydrogen............................................................................... 32
M icrobial H ydrogen Production...................................................................... ............... 33
H isto ry .................... .... ................................................ 3 3
Photosynthetic H ydrogen Production...................................................... .... .. ............... 34
Fermentative Hydrogen Production....................... ...... ............................ 38
H ydrogenase B iochem istry ................................................... ........................................ 43
[N iF e]-hy drog enase....................................................................... ......................... 4 4
[F e]-hydrogenase ..................................................... 45
NADH-Dependent Hydrogen Producing Pathway ................................... .................... 47

3 BACKGROUND ON BUTANOL PRODUCTION.............. .... .............. 53

Fossil Fuel-B ased Butanol Production................................................ ........................... 53
M icrobial B utanol P reduction ............... ................................................................................. 53
H isto ry ................... ............................................................................................................... 5 3
Butanol Ferm entation ...................................................... ......................................... 55
Molecular Organization of Butanol Production Pathway .............................................. 58




5









Advances in Metabolic Engineering of Bacteria for Butanol Production........................... 59
Engineering Escherichia coli for Butanol Production............................................................63

4 M A TER IA L S A N D M ETH O D S ............................................. ............................................ 69

General Methods .................................... ............. ................ 69
M materials .................... ... ........ ... ......... .... ..................................... 6 9
Bacterial strains, Bacteriophages, Plasmids, and Primers Used.................................... 69
M edia and G row th C onditions................................................... ................... ............... 69
Fermentation ................. ........................ ..... ........ ........... 70
D N A Extraction and Purification ................................................. .......................... 70
Polym erase C hain R action (PC R )......................................... ........................................ 71
D N A M odificatio n .................................................................................... .......... ........... 7 1
T ran sform action ................................................................................ 7 1
T ra n sd u ctio n ................................................................................................. ..................... 7 2
G ene D elections ............................... ................. ............... .............................72
Construction of Plasmid pET 15b Based T7 Expression Plasmids .............................. 72
Protein Production Using pET 15b Based T7 Expression ...........................................73
H is-tagged Protein Purification .................................................. ............................ 73
A naly tical M eth od s............... .............................................................................................. 74
M methods for H hydrogen Production............. ..... ............................ ................. .............. 75
Construction of Tandem T7 Expression ofndhE and ndhF Subunits.............................. 75
Construction of Tandem trc Promoter Controlled Expression of ndhE and ndhF..........75
NADH-Dehydrogenase (NDH) Enzymatic Activity .................................................... 76
Clostridium Ferredoxin Purification........................................... 77
(Electron Paramagnetic Resonance) EPR Measurements..............................................77
Selection of Methyl Viologen (MV) Resistant E. coli ............................................. 77
D election of H hydrogen Production.......................................................... ............... 78
E lectrochem ical P otential................................................................................. ............. 7 8
Cloning of [Fe]-Hydrogenase Isolated from Termite Gut ..............................................79
M methods for B utanol Production ........................................ ................................................... 79
Construction of Plasmid pET15b Derivatives for the Expression of Enzymes in the
Butanol Pathw ay .......................................... ...... .......... 79
Enzym e A says for B utanol Pathw ay...................................................... ... ... ............... 80
In Vitro B utanol P reduction .................................................... ...................................... 80
Enzym e A ssay from Crude Extract ............... ........................................................... 81
Plasmid Construction for Butanol Production .........................................................81
E. coli Strain Construction for Butanol/Butyrate Production ....................................... 84

5 RESULTS AND DISSCUSSION .............. ............. ................... .......................... 103

Biochemical Characterization of Recombinant NADH-Ferredoxin Oxidoreductase
(NFOR; NDH) from Trichomonas vaginalis.................... ........................................ 103
Expression and Purification of NDH ............. ......................................... 103
Enzymatic Activities / Kinetics of NDH..................................................... ............... 104
Iron / Sulfur D term nation ......... ................. ............... .................... ............... 105









EPR Determination of Iron / Sulfur Clusters................................................ ............. 106
Potential Use of NDH for H2 Production................................... ...............107
NADH-Dependent Hydrogen Production....................... ......... ....... .......... .. 109
Reduced Methyl Viologen Coupled to E. coli Hydrogenase-3 (HYD3) Isoenzyme..... 109
Reduced Methyl Viologen Coupled to [Fe]-Hydrogenase ............................ ....... 110
T herm odynam ic B carrier .................... .......................................................................... 112
Production of 1-Butanol by Recombinant E. coli .............................................................. 116
In Vitro Production of Butanol from Acetyl-CoA Using Recombinant Proteins.......... 116
Plasmid Expression of Butanol Pathway ................................................ 118
Chromosomal Insertion of Butanol Pathway into E. coli......................................... 121
Additional Insertion ofbcd-etfBA Transcriptionally Controlled by E. coli adhE
P rom other ................................................................. .............. 12 3

6 SUMMARY AND CONCLUSIONS .............................. .. .................................... 148

Hydrogen ...................................................... ......... 148
Butanol ............... ............................................................................. .... 151

APPENDIX REPRINT PERMISSION OF PUBLISHED MATERIAL.............................. 155

L IST O F R E F E R E N C E S ................................................................................................................. 156

B IO G R A PH IC A L SK E T C H ...................................................... ............................................... 175









LIST OF TABLES


Table page

4-1 Bacterial strains, bacteriophages, and plasmids............................................ ......... 89

4-2 List of PCR primers used in this study. .............. .. ........................................... 92

4-3 Standard redox potential of electron donor / electron acceptor couple ............................96

5-1 Purification of recombinant NADH-dehydrogenase (NDH) produced in Escherichia
coli with isopropyl P-D-1-thiogalactopyranoside (IPTG) or arabinose as an inducer..... 125

5-2 Specific activity of recombinant Trichomonas vaginalis hydrogenosome NDH
produced in E. coli with arabinose as inducer ............. ............................................ 126

5-3 Kinetic properties of recombinant T vaginalis hydrogenosome NDH purified from
E coli ................................................ 127

5-4 Specific activities of recombinant enzymes in butanol production pathway ................ 128

5-5 Specific activity of butanol pathway enzymes in the crude extract of JM107
(pCBEHTCB) ............................ ............. ................ 129

5-6 Specific activity of AtoB and AdhE2 in the crude extracts of JM107 (pAA) .................. 130

5-7 Butanol production by various mutant strains ofE. coli bearing pCBEHCU and pAA.. 131

5-8 Effect of various plasmids on the production of butanol by different E. coli strains. ..... 132

5-9 Effect of a second chromosomal insertion of butyryl-CoA synthesis (BCS) operon
transcriptionally controlled by pflB promoters......... ......... ...... ................... 133









LIST OF FIGURES


Figure page

2-1 Photosynthetic electron transport pathways for hydrogen production in green algae.......50

2-2 NADH-dependent reduction of ferredoxin by Clostridium kluyveri Bcd/EtfBA
(clostridial NFOR) coupled to crotonyl-CoA to butyryl-CoA reaction.............................. 51

2-3 NADH-dependent hydrogen producing pathway....................................... ..............52

3-1 C. acetobutylicum ferm entative pathway................................................... ............... 66

3-2 Molecular organization of genes encoding butanol/solvent pathway in C.
acetobutylicum ........................................................................ ......... 67

3-3 Escherichia coli m ixed acid ferm entation........................................ .......................... 68

4-1 Trichomonas vaginalis NADH-dehydrogenase (NDH) T7 expression plasmid................97

4-2 C on struction of pB utanol ......................................................................... ........................ 98

4-3 C on struction of pB utyrate............................................................ .................................... 99

4-4 Construction of pTrc99a derived plasmids.............................................. .............. 100

4-5 Consolidation of butanol pathway genes into a single low-copy vector pACYC 184 ..... 101

4-6 Chromosomal insertion of C. acetobutylicum butyryl-CoA synthesis (BCS) operon
replacing E co li pflB ......... .. ....... ....................... ......................................................... 102

5-1 Native molecular weight of NDH as determined by gel filtration .................................... 135

5-2 Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) of
recombinant NDH expressed in E. coli induced by isopropyl 3-D-1-
thiogalactopyranoside (IPTG) or arabinose............................ .... ................ 136

5-3 pH profile of ND H activity in phosphate buffer ................................................................ 137

5-4 Absorption spectrum of recombinant T. vaginalis hydrogenosome NDH or NDH-
sm all su bu nit............................................................ ........... ...... 13 8

5-5 Electron paramagnetic resonance (EPR) spectrum of the recombinant T. vaginalis
hydrogenosome NDH holoenzyme produced in E. coli.............................. ................. 139

5-6 EPR spectrum of NdhE (small subunit) of the T vaginalis NDH produced in E. coli.... 140

5-7 Effect of NDH on whole cell reduction of methyl viologen (MV) and H2 evolution in
overnight cultures of MV resistant PMD45 ........................................................ 141









5-8 Primary sequence alignment of HydA from C. acetobutylicum, T vaginalis, P.
grassii, and a symbiont from the hindgut of R.flavipes ...... .... ................................... 142

5-9 Effect of NDH and GutHyd on hydrogen production........................................................ 143

5-10 Effect of NDH and GutHyd on fermentation profile ofE. coli strain PMD45 ................ 144

5-11 High performance liquid chromatography (HPLC) profile of in vitro production of 1-
butanol from acetyl-C oA ............... ............................................. ....................... ...... 145

5-12 Relative specific activities of functionally expressed recombinant enzymes inE. coli.. 146

5-13 Growth, pH, pyruvate, and butyrate production from PMD76 with pH control.............. 147

6-1 Thermodynamics of the NADH-dependent hydrogen production pathway...... ....... 154












Aad

A

ABE

Adc

ADH

ADP

amp
R
amp

ATCC

AtoB

ATP

Bcd

Bcd/EtfBA

BCA

BCS

Bdh

bp

BSA

BTU

but'



BV

cal


LIST OF ABBREVIATIONS

Alcohol-aldehyde dehydrogenase

Absorbance

Acetone butanol ethanol fermentation

Acetoacetyl-CoA decarboxylase

Alcohol dehydrogenase

Adenosine-5'-diphosphate

Ampicillin

Ampicillin resistant

American type culture collection

E. coli thioloase

Adenosine-5'-triphosphate

Butyryl-CoA dehydrogenase

Butyryl-CoA dehydrogenase electron transfer flavoprotein complex

Bicinchoninic acid protein determination assay

Butyryl-CoA synthesis pathway from acetoacetyl-CoA to butyryl-CoA

Butanol dehydrogenase

Base pair

Bovine serum albumin

British thermal unit; equals 1.053 kJ of energy

E. coli strain carrying butanol biosynthesis genes (chromosomal insertion
of spcR-Ptrc-adhE2-Ptrc-atoB-Ptrc-crt-bcd-eBA-hbd-
Ptrc-ccrA-udhA)

Benzyl viologen

Calories; equal to 4.184 J









CcrA Crotonyl-CoA reductase from Streptomyces

CoA Coenzyme-A

Crt Crotonase

CSC Commercial solvent corporation

CTAB Cetyl trimethylammonium bromide

CtfAB Coenzyme-A transferase

DCPIP 2,6-dichlorophenolindophenol

DNA Deoxyribonucleic acid

dNTP Deoxyribonucleotide

DOE United States Department of Energy

DTT Dithiothreitol

E Actual concentration-dependent redox potential

e- Electron

E10 Gasoline blend; 10 % ethanol, 90 % gasoline

E85 Gasoline blend; 85 % ethanol, 15 % gasoline

Eo' Standard redox midpoint potential

EIA Energy Information Administration; branch of DOE

EPR Electron paramagnetic resonance

Etf Electron transfer flavoprotein

etfBA Genes AB encoding electron transfer flavoprotein subunits

Evalue Statistical expect value

F Faraday constant (96,500 C mol-1)

FAD Flavin adenine dinucleotide

Fd Ferredoxin









FDH Formate dehydrogenase

[Fe-S] Iron-sulfur cluster

FHL Formate hydrogen-lyase

FMN Flavin mononucleotide; riboflavin-5'-phosphate

FRT Flippase recognition target

G3P Glyceraldehyde-3 -phosphate

GC Gas chromatograph

GRAS Generally regarded as safe

GutHyd Symbiont [Fe]-hydrogenase from R. flavipes hindgut

H Proton

Hbd Hydroxybutyryl-CoA dehydrogenase

HPLC High-performance liquid chromatography; High-pressure liquid
chromatography

Hrs Hours

HYD Hydrogenase

HYD3 E. coli hydrogenase isoenzyme 3

IPTG Isopropyl P-D-1-thiogalactopyranoside

J Joules; equals to 0.239 cal (kg m2 S-2)

kan Kanamycin

kanR Kanamycin resistant

Kcat Turnover rate; number of enzymatic reactions catalyzed per second (sec1)

kDa Kilodaltons (1000 molecular weight)

KFeCN Potassium ferricyanide; K3Fe(CN)6

Km Michaelis constant; substrate concentration that yields /2Vmax of enzyme
activity









LB Luria-Bertani medium

LHC Light harvesting complex

Lpd Dihydrolipoamide dehydrogenase; E3 component of PDH

lpd O1* E. coli lpdA with point mutation E354K

M Molar concentration (mol L1)

mol Mole; quantity equal to 6.022 x 1023 atoms or molecules (Avogadro
number)

MTT 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide

MV Methyl viologen

MVR Methyl viologen resistance

n Number of electrons as in Nernst equation

Nla [2Fe-2S] cluster of small subunit ofNDH

N3 [4Fe-4S] cluster of large subunit of NDH

NAD+ Nicotinamide adenine dinucleotide

NADH Reduced nicotinamide adenine dinucleotide

NADP+ Nicotinamide adenine dinucleotide phosphate

NADPH Reduced nicotinamide adenine dinucleotide phosphate

ND Not detected or not determined

NDH NADH dehydrogenase

NEB New England Biolabs, Inc.

NFOR NADH-ferredoxin oxidoreductase

OD Optical density

Ox Oxidized

PCR Polymerase chain reaction









PDH

PEP

PFOR

PS

PT7

Ptrc

quad


R

Red

Redox

RNA

S-200

SD

SDS

SDS-PAGE

Sp. Act.

spc

spcR

T

TCA

Thl

U

V


Pyruvate dehydrogenase

Phosphoenolpyruvate

Pyruvate-ferredoxin oxidoreductase

Photosystem

T7 promoter

trc promoter

Quadrillion BTU; 1015 BTU; equivalent to about 8 billion gallons of
gasoline

Ideal gas constant (8.314 J K-1 mol-1)

Reduced

Reduction / oxidation

Ribonucleic acid

Sephacryl-200 gel filtration matrix

Shine-Dalgamo sequence

Sodium dodecyl sulfate

Sodium dodecyl sulfate polyacrylamide gel electrophoresis

Specific activity (U (mg protein)-1)

Spectinomycin

Spectinomycin resistance

Temperature (K)

Tricarboxylic acid cycle; citric acid cycle; Kreb's cycle

Thioloase; ThlA and ThlB

Unit of enzyme activity ([tmole min1)

Volt (J C-1; Kg m2 s-2 C-1 )









Vmax Enzymes maximum velocity (U (mg protein)-1)

A Gene deletion

AE Change in redox potential; Eproduct Ereactant

AG Gibbs free energy (J mol-1 or cal mol-1)

E Molar extinction coefficient









Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

METABOLIC ENGINEERING OF MICROBIAL BIOCATALYSTS FOR FERMENTATIVE
PRODUCTION OF NEXT GENERATION BIOFUELS

By

Phi Minh Do

August 2009

Chair: Name K.T. Shanmugam
Major: Microbiology and Cell Science

With increasing demand for fuel and a finite supply of petroleum, alternative renewable

sources of energy need to be generated in order to free the world from the bond of fossil fuels.

New transportation fuels currently in development include hydrogen and higher chain alcohols

such as butanol. This study focuses on metabolic engineering ofEscherichia coli as a microbial

biocatalyst for fermentative production of these high energy alternative fuels towards identifying

the rate-limiting steps in achieving high product yields. For production of hydrogen at high yield

from fermentable sugars, the reducing potential from reduced nicotinamide adenine dinucleotide

(NADH) produced during fermentation also needs to be converted to hydrogen. The gene

encoding the first enzyme in the NADH-dependent hydrogen pathway, NADH-ferredoxin

oxidoreductase (NDH), was cloned from an anaerobic protozoan, Trichomonas vaginalis, and

expressed. The NDH protein purified from the recombinant E. coli and biochemically

characterized. The recombinant enzyme reduced several low-potential electron acceptors such as

ferredoxin and viologens with NADH as electron donor. The [Fe-S] cluster composition of this

heterodimer is apparently responsible for this unique catalytic property. Attempts to couple

NADH oxidation to hydrogen production using NDH, methyl viologen and native hydrogenase 3

were not successful due to thermodynamic constraints, which proved to be difficult to overcome









in vivo. Although several microbes produce butanol as a fermentation product, none of them

produce butanol as sole fermentation product. Towards constructing a recombinant E. coli that

produces butanol as the main fermentation product, the genes encoding the enzymes minimally

needed for converting acetyl-CoA to butanol were cloned from Clostridium acetobutylicum and

Streptomyces avermitilis and expressed in E. coli. The encoded proteins upon purification and

mixing in vitro established the butanol pathway and converted acetyl-CoA to butanol. E. coli

carrying the butanol pathway genes produced butanol but the yield of butanol was only about 2

mM. One of the rate-limiting steps in achieving higher yield butanol production was identified

as the butyryl-CoA dehydrogenase complex. Other rate-limiting steps in butanol production were

the competition for acetyl-CoA between ethanol and butanol pathways as well as generating

sufficient amounts of appropriate reductants to support the activity of various enzymes in the

butanol pathway while also maintaining proper redox balance.









CHAPTER 1
INTRODUCTION AND SIGNIFICANCE

Fuel Crisis

The United States consumes more energy than it produces, importing 34 % of its total

energy needs (65). In 2007, imports accounted for 58.6 % of the petroleum consumed,

indicating our dependency on foreign energy suppliers. In order to increase this nation's energy

security, there needs to be a shift from foreign imports to domestic production of energy. As of

2007, 40.0 % of the energy consumed by the US was derived from petroleum followed by 23.3

% natural gas, 22.3 % coal, 8.3 % nuclear, and 5.9 % renewable energy (65). Fossil fuel

accounts for 85.6 % of the total energy used. Of the petroleum consumed, 58.6 % of the

petroleum was imported and 42.4 % and 15.9 % of the total petroleum consumed was used for

transportation in the form of gasoline and diesel, respectively (65).

In 2007, The United States consumed 40.75 quadrillion British Thermal Unit (BTU)

(quad) of petroleum per year with the predicted increase to 41.60 quad of petroleum per year in

2030 where 1 quad is equivalent to about 8 billion gallons of gasoline (65). The price of crude

oil is projected to almost double from $73.33 to $130.43 per barrel in the same time period.

However, crude oil price reached higher than $140 per barrel in 2008, 22 years ahead of this

prediction. The predicted cost reflects global supply/demand and does not account for instability

in the global economy which could radically fluctuate prices. For example, from $137.11 in July

2008 the price declined to $35.70 per barrel five months later in December 2008 (65). With the

increase in demand and higher price for oil, domestic production of petroleum is optimistically

projected to increase from the current 10.73 to 15.96 quad per year in 2030. This projection of

increased production is expected to decrease the petroleum import from the current 28.87 to

21.72 quad per year. In the transportation sector, the expected decrease in use of gasoline for









transportation from 17.29 to 14.49 quad of petroleum per year will be due to a projected use of

E85 blends up to 2.18 quad per year in 2030. This 13 % reduction in the transportation gasoline

demand outlines the country's anticipated shift to a renewable fuel (65).

Combustion of fossil fuels produces heat plus carbon dioxide, carbon monoxide, and other

waste products depending on the fuel source. These undesirable greenhouse gases are released

into the atmosphere, which is reported to cause global temperature increase. Alternate sources of

energy that are CO2 neutral are being explored to mitigate these problems associated with fossil

fuel use. The ideal fuel would be renewable, domestically produced, non-polluting, and cost

effective.

Renewable Biomass to Ethanol

Renewable energy is derived from sources that are constantly replenished by natural

processes such as wind, water, geothermal, and solar. Energy from these sources can be

converted to a usable form such as electricity. Among these, solar energy can be directly

converted to electricity or indirectly to combustible fuels, such as ethanol, H2, biodiesel, etc.

During the process of photosynthesis, plants collect and store solar energy as carbohydrates,

lipids, and plant materials. Crude petroleum, a primary source of our present energy, is indeed a

derivative of plant materials generated by photosynthesis eons ago and processed at high

temperature and pressure. The CO2 trapped in these plant materials is currently being released

into the atmosphere during the liberation of the stored energy. Global warming observed today

due to CO2 release in this loop is caused by the time between the capture and release of this CO2.

By using biomass instead of fossil fuels, plant materials can, once again, serve as the energy

intermediate to meet the current energy demand without enhancing CO2 concentration in the

atmosphere that leads to global warming.









As the plants grow, they utilize energy from the sun to fix CO2 into sugars, which

polymerize to form starch and lignocellulosic biomass, the structural components of stalks,

stems, and leaves (31). Starch, which is the storage components of plants, is made up of two

components, amylose and amylopectin. Amylose polymers are long chains of glucose linked by

a-1,4 glycosidic bonds. Amylopectin, the other component of starch, consists of amylose with

branched a-1,6 glycosidic bonds of glucose polymers occurring every after 24-30 glucose units

(149). Lignocellulosic biomass is composed of three major components: cellulose,

hemicellulose, and lignin (77, 188). The largest fraction, cellulose, which makes up about 20-50

% of biomass, comprises long polymers of glucose linked by 3-1,4 glycosidic linkages.

Hydrogen bonding between cellulose polymers results in insoluble and anhydrous crystalline

structure (188). Hemicellulose, which comprises about 20-40 % of biomass, is relatively shorter,

and is a highly branched polymer of mainly D-xylose with varying amounts ofL-arabinose, D-

galactose, D-glucose, and D-mannose (97, 98, 230). Higher percentages of hemicellulose are

found in hard woods and lesser percentages are found in soft plants. The other major

component, lignin makes up 10-20 % of biomass and is a polymer of mostly aromatic

compounds (188).

Starch, cellulose, and hemicellulose can serve as feedstock for ethanol fermentation. The

polymers must first be hydrolyzed into their monomeric carbohydrate constituents that are the

usable substrates for the ethanol producing microbial biocatalyst. The a-1,4 and a-1,6 glycosidic

linkage of starch is easily hydrolyzed by a-amylase, glycoamylase, and pullulanase releasing

glucose (149). Hydrolysis of the P-1,4 glycosidic linkage in cellulose is catalyzed by a class of

enzymes called cellulases (134, 191). There are different types of cellulases classified by their

activities (15). Endocellulases are enzymes that hydrolyze internal 3-1,4 glycosidic linkages









producing smaller chains of the cellulose polymer (131, 134). Exocellulase (cellobiohydrolase)

hydrolyzes the P-1,4 linkages near the ends of the native cellulose polymer and polymers

produced by endocellulase releasing 2, 3, or 4 linked glucose units called cellobiose, cellotriose,

or cellotetrose, respectively (134). Cellobiase or P-glucosidase hydrolyzes the exocellulase

products such as cellobiose into individual glucose monosaccharides (134). The structural

complexity of cellulose hinders the accessibility of cellulases to the polymer, thus requiring

pretreatment of the polymer and a higher level of enzymes than used for starch hydrolysis to

hydrolyze cellulose to glucose (15, 230). Current hemicellulose hydrolysis involves a non-

enzymatic approach. Hemicellulose is hydrolyzed by dilute acid at high temperature and steam

treatments (191). This process releases the monomeric carbohydrates; however, due to the harsh

conditions needed to hydrolyze hemicellulose, small amounts of the sugars and aromatic

compounds oflignin are converted to other compounds that are inhibitory to fermenting

organisms. These inhibitory compounds include, but are not limited to, acetate, furfural, 5-

hydroxymethylfurfural (HMF), p-hydroxybenzoic acid, vanillin, and syringaldehyde (4, 191,

230, 231). There are several studies that are focused on reducing the production of inhibitors

and/or increasing the tolerance of fermenting organisms to such compounds (79, 191, 193).

Currently in the United States, greater than 93 % of ethanol production utilizes corn starch

as feedstock (31, 77, 127). Other countries with warmer climates such as Brazil, mainly use

sucrose from sugarcane; whereas, more temperate regions use sucrose from sugar beets as

feedstock (11, 19, 50, 125). Since these dominant feedstock sources are also food items, the

increase in global ethanol demand shifts the use of these food items to fuel thus increasing global

food prices (31, 91). In order for ethanol to be an economically favorable fuel, its feedstock









must be derived from non-food sources such as lignocellulose cellulose and hemicellulose

fractions ofbiomass (77, 127, 188).

Yeast, such as Saccharomyces cerevisiae, are the industrial ethanol producers (50, 127,

202). S. cerevisiae 's historical prevalence and industrial knowledge still makes it the organism

of choice for ethanol fermentation; however, its substrate utilization limitations may suggest a

shift to non-traditional fermentative organisms. S. cerevisiae naturally ferments glucose but not

pentoses such as xylose, the second most abundant carbohydrate found in biomass (106, 156,

202, 227). Other yeast, such as Pichia stipitis and Candida tropicalis, can ferment xylose;

however, their low ethanol yields with xylose and inability to ferment other hemicellulose sugars

has hindered further strain development (77, 105, 106). Expression of xylose reductase and

xylitol dehydrogenase from P. stipitis in recombinant strains of S. cerevisiae was only partially

successful due to the inherent redox constraints of this pathway, which resulted in undesirable

byproduct formation, such as xylitol, in the absence of oxygen (7, 115, 181, 203). To mediate

this problem, xylose isomerase from yeast Piromyces sp. E2 and Thermus thermophilus were

cloned and expressed in S. cerevisiae resulting in strains with similar ethanol yields on xylose as

with glucose (25, 36, 203). Attempts in engineering S. cerevisiae to ferment pentose such as L-

arabinose were less successful due to the poor expression of bacterial source genes in this

eukaryote (25, 36, 80, 216, 218).

Bacterial ethanol fermentation also has potential industrial applications. Zymomonas

mobilis is a traditional bacterial ethanol producer used for fermentation of alcoholic beverages

such as tequila. Z mobilis metabolizes sugars by Entner-Doudoroff pathway and produces only

ethanol as fermentation product. Advantages ofZ. mobilis include, but are not limited to, high

ethanol production yield of up to 120 g L-1, high ethanol tolerance, and high specific ethanol









productivity (139, 170, 184). Z. mobilis' inability to utilize other sugars found in biomass

hinders the industrial use of this organism for production of fuels. Like yeast, recombinant

strains of Z mobilis were constructed for utilization of xylose and arabinose resulting in strains

with broader substrate capability while retaining high ethanol yields; yet, problems of long

fermentation times due to low productivity has hindered the development of these strains (30, 54,

127).

Escherichia coli is a Gram-negative facultative anaerobe that catalyzes mixed acid

fermentation. The vast accumulated knowledge and available genetic tools makes this organism

a feasible platform for metabolic engineering for production of ethanol or other valuable

chemicals. This organism has a broad range of substrate utilization, can naturally ferment all

carbohydrates found in lignocellulose, and can grow in minimal salts medium which reduces cost

of product production. To date, one of the most promising ethanologenic E. coli, strain KO 11,

has a chromosomally integrated pyruvate decarboxylase gene (pdc) and alcohol dehydrogenase

gene (adhB) from ethanologenic bacterium Zymomonas mobilis (97, 155, 227). Strain KO11 has

the same ethanol specific productivity as yeast using glucose as a substrate and can utilize

extremely high xylose concentrations of over 100 g L-1 (96-98, 227, 235). However,

disadvantage of this recombinant strain include low ethanol tolerance of about 5 % which was

about one-third that of yeast's ethanol tolerance.

Problems with ethanol: Ethanol is the first widely used commercially available

renewable transportation fuel. The use of ethanol is a first step away from the dependence on

fossil fuels and towards a new era of clean, sustainable energy. Ethanol as a fuel however, is not

perfect. Pure ethanol cannot be combusted in modern automotive engines due to its chemical

properties (199). Ethanol has a higher vapor pressure than gasoline, which at operating









temperatures, could produce vapor bubbles within the fuel lines. The "vapor lock" can cause the

car to hesitate and stall due to inadequate fuel delivery. Another main concern with ethanol is

that it has a higher latent heat of vaporization which requires more heat to vaporize the ethanol

fuel than gasoline which can reduce the ability of the car's engine to ignite the fuel at lower

temperatures. High ethanol containing fuels may be a problem for older cars with carburetors

due to inadequate fuel delivery if they are not adjusted for the lower combustional energy.

Modern fuel injection delivery systems sense the lower energy and adjust by increasing fuel

delivery; however, this in turn lower fuel efficiency. Most internal combustion engines can

operate with 10 % ethanol mixtures with 90 % gasoline without modifications, but only new

engines especially modified for E85 can utilize 85 % ethanol, 15 % gasoline mixture. The

chemical properties of ethanol also make ethanol incompatible with current fuel transportation

infrastructure and utilization. Ethanol's lower solubility in gasoline, high solubility in water, and

hygroscopic nature present an immense problem in fuel transportation (199). Currently, gasoline

is primarily transported through pipelines. Moisture that seeps into transportation pipelines is

normally not a problem due to water's low solubility in gasoline. Since ethanol is hygroscopic, a

gasoline/ethanol mixture permits water contamination in fuel which may cause damage to engine

parts. The polar nature of ethanol molecules creates strong hydrogen bonds with water. Since

water easily separates from gasoline, water contamination causes a temperature dependent phase

separation of gasoline and ethanol/water mixture (199). Low temperature is a major concern

since it increases phase separation of water contaminated gasoline/ethanol mixture which may

lead to frozen fuel lines during the winter. The added corrosiveness of ethanol and water also

makes it less suitable for pipeline transportation. To mediate this problem, ethanol requires its









own separate transportation system and needs to be mixed with gasoline at the pumping station

to avoid water contamination and fuel separation.

Another problem with ethanol is that current production requires use of food items as

feedstock which in turn drives up the cost of both food and fuel. A shift to lignocellulosic

ethanol would remedy this problem; however, more research will be needed to develop improved

processes and microbes to handle the harsh scale of industrial fermentation ofbiomass.

Continual usage of ethanol as a fuel will require a drastic overhaul of the fuel infrastructure. A

shift to a new "second" generation renewable fuel may be required to move beyond the problems

associated with ethanol use. The new fuel must be clean, cost-effective, high in energy, and/or

does not require much change in current delivery systems. Potential next generation renewable

fuels are hydrogen and butanol.

Second Generation Renewable Fuels

Hydrogen

The use of hydrogen as a fuel has been of great interest since its combustion produces only

heat and water, although shift to H2 as a fuel would also require a new infrastructure. Hydrogen

provides more energy per unit mass than all other combustional energy sources (57). The

combustional energy of hydrogen is 52,200 BTU/lb whereas gasoline, compressed natural gas,

propane, and ethanol yield only 18,600 BTU/lb, 20,200 BTU/lb, 19,900 BTU/lb, and 11,600

BTU/lb, respectively (57). During the energy crisis of the 1970s, hydrogen sources and

applications were explored. Hydrogen was, at the time, believed to be the "fuel of the future".

Most of the funds for hydrogen research diminished after oil price dropped but resurfaced again

in the 1990s with the concern about the greenhouse effect of net CO2 release into the atmosphere

from fossil fuel use (20). In 2003, President Bush announced a $1.2 billion hydrogen fuel









initiative for developing technology associated with creating, storing, distributing, and utilizing

hydrogen in fuel cells bringing hydrogen to the fore-front again (41).

Butanol

The current shift to using ethanol as a fuel additive is an important progression towards the

utilization of renewable fuels. The use of butanol as a fuel additive has been of great interest

because of its advantages over ethanol. Butanol has a low solubility in water. It is also

hydrophobic and has complete solubility with gasoline at any ratio (168). Gasoline/butanol

mixtures could be pumped in pipelines without further modification and this approach do not

require a separate mixing station. Butanol also provides higher energy per unit mass than

ethanol with a value closer to gasoline (86 %). The combustional energy of butanol is 16,000

BTU/lb whereas gasoline and ethanol yields are 18,600 BTU/lb and 11,600 BTU/lb, respectively

(168). Since butanol's properties resemble those of gasoline, 100 % butanol could be used in

automotive engines, even on older cars built in the early 1990's, without any modification (168).

The history of biological production of butanol dates back to its discovery by Pasteur in the

mid 1800's. Industrial ABE fermentations were greatly employed from the 1910's to the late

1940's as a source of solvents and synthetic rubber (107). The emergence of the, at the time

plentiful and cheap, petrochemical based solvent production in the 1940's led to the demise of

ABE fermentations. Sixty years later, as the petroleum cost and reserves reached problematic

levels, butanol fermentations are being explored again as a source of renewable energy.









CHAPTER 2
BACKGROUND ON HYDROGEN PRODUCTION

Current Hydrogen Production Methods

As mentioned before, hydrogen is an excellent fuel whose combustion only releases heat

and water. This section will briefly summarize current technology in hydrogen production from

both fossil fuel and renewable sources. I will also introduce biological sources and microbial

biocatalysts available for both photosynthetic and fermentative hydrogen production.

Methane Steam Reforming

At present, hydrogen is produced by a process called steam reforming which utilizes the

water-gas-shift reaction (Equation 2-1)

CH4 + H20 CO + 3H2 (700 1,100 C) (2-1)
CO + H20 C02 + H2 (130 C)

CH4 +2H20 -> CO2 + 4H2

When compared with other fossil fuels, methane, commonly known as natural gas, is currently

the most favorable feedstock for hydrogen production because of its availability and its high

hydrogen to carbon ratio, which minimizes the yield of CO2 (152). The disadvantage of this

method is that it uses a fossil fuel. In 2007, US imported 19.9 % of its natural gas needs which

was about 4.8 % higher than in 2004 (65). Using this method for production of hydrogen for fuel

production would require additional import of natural gas and would only increase this country's

dependence on foreign energy imports.

Coal Gasification

United States has a abundant supply of coal with estimated reserves lasting for an

additional 200 years at the current rate of use (42). The shift towards hydrogen production from

coal will decrease energy import. The production of hydrogen from coal involves a process

called gasification. This process comprises partial oxidation of coal with oxygen and steam in a









high temperature and pressure reactor (141). This process, like the steam reforming of natural

gas, produces a mixture of carbon monoxide and hydrogen in which the CO can be used to make

additional hydrogen. One concern with coal as a feedstock is that this process releases a

significant amount of CO2 due to its high carbon to hydrogen ratio compared to methane. Using

current technology, the combustion of coal produces 19 kg of CO2 per kg hydrogen produced

compared to the combustion of natural gas that produces 10 kg of CO2 per kg hydrogen produced

(152). Coal also contains impurities that would be released into the environment such as sulfur

oxides, nitrogen oxides, lead, and mercury. These concerns are being met with clean coal

technologies that reduce plant emissions and increase plant thermal efficiencies. Further

improvements in these technologies could enhance coal's future as a source of hydrogen.

However, the collected toxic materials still need to be disposed in an environmentally safe

manner. The cost of hydrogen production from coal is one of the lowest only if the demands for

hydrogen are sufficient to construct a centralized plant and a large distribution system (152). In

2003, then President Bush announced that the United States would be the first to sponsor a $1

billion, 10-year demonstration project to create world's first coal-based, zero-emission electricity

and hydrogen plant. This technology is expected to accelerate the commercialization of

hydrogen fuel by 2020 (42).

Hydrogen from H20

Hydrogen could be generated by splitting water into its two elemental components:

hydrogen and oxygen, with input of energy. This process, termed electrolysis, involves passing

an electric current through water. The water molecule dissociates producing hydrogen at the

cathode and oxygen at the anode. The electrolysis efficiency ranges from 75-80 % with the

remainder of the energy lost as heat (152). Increasing the operating temperatures could increase

the efficiency to 85-90 %; however, certain challenges such as electrode and proton exchange









membrane stabilities must be overcome. Currently, the cost of the energy input into the system

outweighs the value of the hydrogen evolved (152). This technology could be coupled with the

electricity produced from nuclear and renewable resources as discussed below for H2 production.

Nuclear power could also serve as the source of energy for hydrogen production reactions.

The heat produced from the nuclear fission reaction could be coupled to steam reforming and

gasification processes of natural gas and coal, respectively. As a heating source, this would

reduce the CO2 emission from natural gas steam reforming by 40 %. The electricity produced by

nuclear power could be used in electrolysis of water although the efficiency of electrolysis makes

it uneconomical (210). At high temperatures thermal-chemical water splitting reactions can be

used to catalyze the dissociation of water. One example of this is the sulfur-iodine cycle (39)

(Equation 2-2):

12 + SO2 + 2 H20 2 HI + H2SO4 (120 C) (2-2)
H2SO4 S02 + H20 + /2 02 (830 C 900 C)
2 HI I2 + H2 (300 C 400 C)

H20 H2 + /2 02

As with all nuclear technologies, there are also disadvantages of high capital cost and nuclear

waste storage and disposal (152).

The use of renewable energy is the ultimate goal in sustainable hydrogen production.

Wind energy is often viewed as an excellent source for renewable hydrogen production in a mid-

term time span (152). Wind energy is pollution-free and requires no feed. The electricity

produced from the wind turbines could be used to electrolyze water. In order for this technology

to be economical, there needs to be a reduction in the cost of electricity produced by the wind

powered turbines, a reduction in the cost of the electrolyzers, and optimization in hydrogen

storage systems (152). The cost of electricity produced by wind could be attributed to the cost









and efficiency of the wind turbines. Location plays an important role in site selection and cost.

The site must have powerful wind throughout the year, be located near existing distribution

networks, and be economically competitive for land use. The variability of wind intensity may

affect electricity output, thus affecting the sustainability of electricity and hydrogen production.

This problem could be solved with a backup power grid, which supplies electricity when wind

power is less than sufficient; however, this adds additional capital cost. Other disadvantages of

wind power are the high noise generated by the turbines, impact on local bird life, visual esthetic

of the landscape, and interference to electromagnetic signals (152).

Solar energy could also be used for hydrogen production. One method of producing

"solar-hydrogen" utilizes photovoltaic cells that capture solar energy and convert it to electricity.

This electricity could again be used to produce hydrogen by electrolysis. Currently, the cost of

electricity from a photovoltaic cell module is 6 to 10 times that of electricity from coal or natural

gas (152). Significant cost reduction is required if solar energy is to be used for electricity and

hydrogen production.

Another method of hydrogen production from solar energy that is being researched utilizes

photoelectrochemical cells for the direct production of hydrogen from water without using an

intermediate electrical current. This requires a submersed solid inorganic oxide electrode

catalyst that is capable of splitting the water molecule directly when light energy is absorbed.

Potential candidate materials are SrTiO3, KTaO3, Sn02, and Fe203. Stability and catalytic

efficiencies require further optimizations (126, 152). As with wind power, this renewable energy

is not without its own problems. Solar output changes both daily and seasonally. Backup

systems must be set up to supply energy when solar energy is not sufficient or absent to meet

demands. This requires about four to six times more solar modules than needed during peak









operations. The surplus energy produced is stored for hydrogen production during less favorable

conditions. Land considerations are similar to that of wind power: the site must have intense

year-round sunlight, be located near existing distribution networks, and be economically

competitive for land use. Other concerns with solar energy are the possible release of toxic

materials such as cadmium in the production and disposal of photovoltaic cells (152).

Moving beyond inorganic catalysts, biocatalyst such as cyanobacteria and algae could

evolve hydrogen by using solar energy coupled with photosynthesis. This process is presented in

greater detail in a later section.

Biomass Conversion to Hydrogen

In association with solar energy, photons could be captured by biological processes to

produce biomass via photosynthesis. Biomass could then be processed thermochemically by

gasification/pyrolysis processes followed by steam reforming similar to hydrogen production

from coal (10). Biomass conversion is renewable and non-polluting. Any CO2 released from

this process is fixed by recent photosynthesis; thus, zero net CO2 is produced within this short

time frame. However, this does not account for the CO2 produced from the needed heating

processes such as the burning of fossil fuels and this can be mitigated by the use of biomass.

There are two general types of biomass that could be used: primary biomass and biomass residue

(152). Primary biomass includes energy crops such as switchgrass, poplar, and willow. These

are dedicated plants grown for energy production. Biomass residues include agricultural and

municipal waste. The problems currently associated with biomass gasification/pyrolysis include

variable efficiencies, tar production, and catalyst erosion (10, 152). In addition to

gasification/pyrolysis of biomass, biological processes utilizing microbes could also yield

hydrogen directly by fermentation (20).









Microbial Hydrogen Production


History

Hydrogen production by photosynthetic cyanobacterium Anabaena was first reported by

Jackson and Ellms in 1896 (102). Hydrogen was later found, in 1901, to be also produced from

light-independent anaerobic fermentation from formic acid (86, 157). In 1931, Stephenson and

Strickland identified the enzyme responsible for reversible hydrogen production from enteric

bacteria which they termed hydrogenase (186, 187). In 1949, Gest and Kamen demonstrated that

hydrogen evolution by photosynthetic bacterium Rhodospirillum rubrum was dependent on

nitrogen fixation, which was later determined to be from the nitrogenase reaction (71). In 1942,

Gaffron observed that green alga Scenedesmus obliquus, in the presence of light, could use H2 as

an electron donor for CO2 fixation in a process he named photoreduction (92, 136). Gaffron and

Rubin also reported that S. obliquus could release molecular H2 and CO2 in the dark after

adaptation in a nitrogen atmosphere (70). To prevent photoreduction and CO2 fixation from

occurring when the algae were exposed to light, they trapped the CO2 released by the algae to

produce a C02-free environment. Under these conditions, S. obliquus continually produced

hydrogen in the presence of light at a 10-fold higher rate compared to the cultures without CO2

trapping. Using electron-transport inhibitors, Gaffron concluded that the algae tested produced

hydrogen via a non-cyclic electron flow through photosystems II and I to hydrogenase (189,

190). Arnon and Tagawa identified ferredoxin as the electron donor for hydrogenase, thereby

linking photosynthesis to hydrogen production (192). In vitro experiments conducted by

Benemann and others demonstrated hydrogen evolution by spinach chloroplasts mixed with

Clostridium kluyveri hydrogenase and ferredoxin (21). It has been well established that microbes

produce hydrogen by either photosynthetic or fermentative processes (9, 82). Photobiological

hydrogen production utilizes H20 as a source of electrons for the reduction of protons whereas









fermentative hydrogen production by algae obtains its reducing power from carbon storage

compounds.

Photosynthetic Hydrogen Production

Members from both eukaryotes and prokaryotes carry out photobiological hydrogen

production. Of the prokaryotes, cyanobacteria and photosynthetic bacteria carry out oxygenic

photosynthesis and anoxygenic photosynthesis, respectively, utilizing either hydrogenase or

nitrogenase as the terminal enzyme. In these processes, light provides the energy for both

hydrogenase and nitrogenase based H2 production (165). Eukaryotic hydrogen production is

restricted to green algae and hydrogenase. In oxygenic photosynthesis, cyanobacteria and algae

utilize chlorophyll as light harvesting pigments and water as the source of electrons (189, 190).

Anoxygenic photosynthesis differs in that photosynthetic bacteria utilize bacteriochlorophylls as

the light-harvesting pigments and either inorganic or organic compounds serve as the reductant

for hydrogen production (151).

The underlying process of photosynthesis is well understood. Oxygenic photosynthesis

revolves around the two photochemical reaction centers: Photosystems (PS) I and II (the

classical Z scheme; Figure 2-1). These photosystems are located within the thylakoid of

chloroplast or the membranes of cyanobacteria. Splitting of water is mediated by the excitation

of an electron at PS II P680 reaction center or light harvesting complex (LHC-II) by the

absorption of a photon. The electron passes through the membrane via electron carriers

generating membrane potentials transferring electron to reaction center P700 (LHC-I) ofPS I.

P700 then absorbs another photon and the energized electron passes though additional membrane-

bound carriers to soluble ferredoxin (Fd). Reduced Fd is the electron donor for Fd- nicotinamide

adenine dinucleotide phosphate (NADP ) oxidoreductase that produces reduced nicotinamide









adenine dinucleotide phosphate (NADPH) for CO2 fixation (169). Under anaerobic conditions,

the reduced Fd is also the electron donor for hydrogenase mediated hydrogen production.

There are two types of photobiological hydrogen production from water in green algae:

direct and indirect biophotolysis. Direct biophotolysis involves both PS II and PS I

simultaneously and electrons from water are transferred directly to hydrogenase for hydrogen

production. The problem with direct biophotolysis is that the 02 evolved by PS II inactivates

hydrogenase, the H2 producing enzyme. Indirect biophotolysis occurs in two stages. In the first

stage, NADPH is produced from reduced Fd. NADPH and adenosine-5'-triphosphate (ATP) are

used to fix CO2 to carbohydrates. In the second stage, PS II activity is reduced to the level of

respiration either by low light or by sulfur depletion, and the carbohydrates produced during

photosynthesis stage are metabolized producing NAD(P)H. Electrons from NAD(P)H feed into

quinone-Cytb complex, then to PS I which leads to the reduction of Fd with the absorption of a

photon (Figure 2-1). Reduced Fd then transfers its electrons to hydrogenase for hydrogen

production. The advantage of indirect biophotolysis is that it temporally separates the production

of 02 and H2 and eliminates hydrogenase inactivation by 02. Another advantage is that the gas

mixture produced in the second stage is composed of CO2 and H2, which is far less dangerous to

handle compared to the explosive mixture 02 and H2 from direct biophotolysis (165). In

addition, in indirect biophotolysis, H2 production can proceed until all the stored carbohydrates

have been converted to H2 due to the stability of hydrogenase. In a similar experiment using

cyanobacteria, Mitsui and his coworkers temporally separated carbohydrate production in the

light and conversion to H2 in the dark through nitrogenase (140). This light-dark cycle can be

repeated several times.









Hydrogenase- and nitrogenase- based hydrogen production systems. The enzymes

mediating the conversion of protons and electrons to molecular hydrogen are hydrogenase and

nitrogenase. Hydrogenase is present in both eukaryotic and prokaryotic microorganisms whereas

nitrogenase, an ATP-dependent enzyme, is restricted to bacterial and archaeal systems. These

enzymes from different organisms range from moderately to extremely oxygen sensitive which

causes a problem for oxygenic photosynthesis. The oxygen-sensitivity of hydrogenase is

overcome by Scenedesmus by producing the enzyme only during dark anaerobic conditions (70).

This allows Scenedesmus to temporally separate hydrogen production from photosynthesis;

however, upon introduction of light, hydrogen production decreases dramatically within a short

period of time due to inactivation of hydrogenase. Sustainability of H2 production is increased

by depriving the alga Chlamydomonas reinhardtii of sulfur-containing compounds (223). The

deprivation of inorganic sulfur decreases oxygenic photosynthesis (PS II) without affecting PS I

or the rate of cellular respiration. The absolute rate of photosynthesis mediated 02 production

decreases below the rate of respiration 24 to 30 hours (hrs) after S-depletion creating an

anaerobic environment that is suitable for sustained hydrogen production (137).

Even with the use of cyclical sulfur availability, the algal culture is limited to producing

hydrogen only during periods of sulfur deprivation. Ideally, a commercially viable photo-

hydrogen producing system should simultaneously and continuously operate PS II and

hydrogenase (direct biophotolysis). Much time and effort have been invested in producing an

oxygen-stable hydrogenase with little success (40, 46). The Department of Energy (DOE)

Hydrogen R&D Program does not believe that there is at present a plausible approach to

overcome the 02 inhibition of hydrogenase in a direct biophotolysis process and does not

recommend further effort to pursue this area of research (22). Other research in this area









includes reducing the number of light harvesting pigments or antenna size per photosystem to

increase photosynthetic efficiency. Individual algal cells exhibit maximal rate of photosynthesis

at low light intensity of only 10 to 20 % of sunlight. Higher light intensities are not utilized due

to the slow electron transfer rate between PS II and PS I resulting in an energy loss as heat or

fluorescence (27, 29, 143). By combining the shading effects of the culture and the individual

cell's efficiency, it was calculated that up to two-third of the light absorbed is wasted due to the

light saturation effect (22). Current commercial algal production systems with Spirulina operate

only at 1 % of total solar energy conversion. The goal of the DOE is to reach 10 % solar

conversion efficiency (22).

The principal role of nitrogenase in the cell is to reduce molecular nitrogen to ammonia.

Nitrogenase also produces molecular hydrogen with different stoichiometric yields along with

NH3 depending on the metal within the active center (63, 165) (Equation 2-3):

Molybdenum nitrogenase: N2 + 8 H+ + 8 e- 2 NH3 + 1 H2 (2-3)
Vanadium nitrogenase: N2 + 12 H+ + 12 e- > 2 NH3 + 3 H2
Iron nitrogenase: N2 + 21 H+ + 21 e- > 2 NH3 + 7.5 H2

Nitrogenases are classified by the metals found in the active site such as molybdenum,

vanadium, or iron. Although V- and Fe- nitrogenases are found in the N2-fixing bacteria, their

concentration in the cell is significantly low compared to Mo-nitrogenase, even when these

alternate nitrogenases are maximally induced. Only the structure of molybdenum nitrogenase

has been solved; however, amino acid sequences reveal similarities between the other forms

(116, 176).

In the absence of N2, H2 is the only product of nitrogenase. These reactions are energy

intensive requiring 2 moles ATP per mole electron transferred (63). Unlike hydrogenase

hydrogen production by nitrogenase is thermodynamically favorable due to the of hydrolysis of









ATP. With nitrogenase, hydrogen production continues at hydrogen pressures of up to at least

50 atmospheres (180). Hydrogen production by N2-fixing bacteria is also associated with a

hydrogen uptake hydrogenase reoxidizing H2 with a net decrease in yield. Mutations in uptake

hydrogenase are found to increase hydrogen yields (110).

Nitrogenases also exhibit varying levels of 02 sensitivity. Through evolution, various

organisms developed different mechanisms of separating oxygen from 02 sensitive nitrogenase.

In cyanobacteria, such as Anabaena, under nitrogen-limitation conditions, a fraction (-8-12 %)

of the filament differentiates into a morphological state known as heterocyst which contains

nitrogenase. Heterocysts lack the oxygen-evolving PS II and receive nutrients and reductant

from adjoining vegetative cells (74). Protection mechanisms have also been discovered in

nonheterocystous filamentous cyanobacteria such as Trichodesmium (23). In this organism, the

nitrogenase is localized in subsets of consecutively arranged cells in each filament, which

accounts for about 15-20 % of all the cells. Unlike heterocysts, these cells also contain PS II

components. During times of increased nitrogen fixation, PS II components were found to be

down regulated and vice versa. This allows Trichodesmium to spatially and temporally segregate

nitrogen fixation and hydrogen evolution from oxygenic photosynthesis.

Fermentative Hydrogen Production

According to Gray and Gest (76), all prokaryotes that produce hydrogen belong to four

groups: strict anaerobic heterotrophs that do not contain a cytochrome system (Clostridium),

heterotrophic facultative anaerobes that contain cytochromes and use format to produce

hydrogen (E. coli), strict anaerobes with a cytochrome system (Desulfovibrio), and

photosynthetic bacteria with light-dependent evolution of hydrogen (Rhodospirillum). They

suggested the first group of organisms produce hydrogen as a way to dispose of electrons

coupled to energy yielding oxidation of carbohydrates. Hydrogen production from the second









group was proposed to promote energy-yielding oxidations by removing the end-product

format. Group three organisms are believed to possess both mechanisms for hydrogen

production (146). The only group three organism known is Desulfovibrio sp. (16). Group four

organisms use light as the energy source for hydrogen production; however, unlike cyanobacteria

and algae, electrons come from organic or inorganic substrates instead of water. The first three

groups of bacteria use hydrogenase for hydrogen production while the primary enzyme of

photosynthetic bacteria for hydrogen production is nitrogenase. Beyond prokaryotes, strict

anaerobic protozoa also posses hydrogen producing capabilities within the hydrogenosome.

Hydrogenosomal hydrogen production is mechanistically similar to that of group one organisms.

Strict anaerobes such as Clostridium sp. lack a cytochrome system for oxidative

phosphorylation so all ATP generation must be from substrate level phosphorylation during

fermentation. During glycolysis, glucose is oxidized to pyruvate producing ATP and reduced

nicotinamide adenine dinucleotide (NADH). Pyruvate is further oxidized by pyruvate-ferredoxin

oxidoreductase (PFOR) into acetyl-CoA, C02, and the electrons are transferred to Fd. Reduced

Fd provides electrons for hydrogen production through a soluble [Fe]-hydrogenase. Initially, it

was believed that NADH produced by 3-P-glyceraldehyde dehydrogenase during glycolysis is

also used to reduce Fd by a putative NADH-ferredoxin oxidoreductase (NFOR) as described by

Thauer etal. (82, 146, 215). Competing routes of NADH oxidation are the reduction of acetyl-

CoA to ethanol, reduction of pyruvate to lactate, and conversion of acetyl-CoA to butyryl-CoA

with an ATP yielding formation ofbutyrate catalyzed by phosphotransbutyrylase and butyrate

kinase. Lactate or ethanol production does not yield ATP. ATP could also be generated from

acetyl-CoA by phosphotransacetylase (PTA) and acetate kinase in the production of acetate. The

maximum theoretical yield of 4 moles H2 per mole glucose can be achieved in bacteria if acetate









is the sole fermentation product and all the NADH produced during glycolysis is converted to

H2. The yield is only 2 moles H2 per glucose ifbutyrate is the sole end product. The observed

yield is typically between 40-50 % (-1.5-2.0 H2/glucose) of the theoretical maximum (4

H2/glucose) for wild type Clostridium producing both acetate and butyrate as major fermentation

products (146). This suggests that NADH is not a preferred reductant for H2 production in

Clostridium, although an NADH dependent H2 production was demonstrated in cell extracts.

My own studies also confirmed the existence of an NADH-dependent H2 evolution activity in C.

acetobutylicum. This reaction had a requirement for acetyl-CoA. However, an NADH-

ferredoxin oxidoreductase was never isolated after several attempts by various investigators,

including myself.

Recently, Thauer et al. discovered that the clostridial NADH-dependant ferredoxin

reduction activity is actually a coupled reaction with crotonyl-CoA reduction by butyryl-CoA

dehydrogenase/ETF (electron transfer flavoprotein) complex, thus, requiring butyrate producing

pathway for NFOR activity (124). This explanation accounts for the lower observed hydrogen

yield and also the need for acetyl-CoA in cell extract. Strict anaerobic protozoan hydrogen

production is mechanistically similar to that of Clostridium. Protozoan hydrogen production is

compartmentalized within a specialized energy producing organelle called the hydrogenosome.

In this organelle, pyruvate, which was derived from glucose, is metabolized to acetyl-CoA, CO2,

and H2 by PFOR and hydrogenase in the same manner as clostridia. However, protozoa such as

Trichomonas have an NADH-dehydrogenase that is homologous to mitochondrial complex I

capable of reducing low potential electron acceptors such as ferredoxin (94).

Heterotrophic facultative anaerobes such as E. coli produce hydrogen using the format

hydrogen-lyase (FHL). FHL complex consists of two enzymes, format dehydrogenase (FDH-









H), [NiFe]-hydrogenase isoenzyme 3 (HYD3), and electron carriers connecting the two. FDH-H

converts format to C02, 2H and 2e-. The electrons are transferred to HYD3 for hydrogen

production (28). Theoretically, E. coli could produce 2 moles H2 per mole glucose through

glycolysis, pyruvate formate-lyase and FHL; however, the observed net H2 yields are only about

60 % of the theoretical maximum (146) suggesting that some of the format or H2 is consumed

by other reactions in the cell. Another facultative anaerobe with higher hydrogen yield is

Enterobacter aerogenes. Mutations leading to decreased c-acetolactate synthase activity have

been shown to increase H2 yield from 0.8 H2/glucose to 1.8 H2/glucose when compared to wild-

type strain HU101 (101). Ogino and coworkers compared different strains of Clostridium

butyricum to E. aerogenes and found that E. aerogenes is not sensitive to oxygen, has a broad

range of substrate utilization, and has comparable hydrogen yields with C. butyricum. E.

aerogenes also grows in mineral salts medium and does not require expensive reducing agents in

growth medium which lowers the cost of hydrogen production (153).

According to an economic analysis submitted to the National Renewable Energy

Laboratory, production of hydrogen by fermentation is expected to be cost effective if the

organism could produce a yield of 10 moles H2 per mole of glucose (64). This takes into account

capital cost of plant, plant production rate, cost of substrates, and H2 market value.

Theoretically, up to 12 moles H2 could be produced from a mole of glucose by complete

oxidation (Equation 2-4)

C6H1206 + 6 H20 12 H2 + 6 C02 (2-4)

Only an in vitro enzymatic reaction was reported to produce this higher yield although low rates

and the high cost of the enzymes makes this method impractical for large-scale application (219,

220, 233). None of the whole cell based H2 production methods could reach this minimum









requirement of 10 H2 per glucose for cost effective hydrogen production due to physiological and

thermodynamic barriers. Strict anaerobes have the ability to couple NADH to H2 production but

lack the capability to fully oxidize acetyl-CoA to CO2 due to an incomplete tricarboxylic acid

(TCA) cycle. Most of the carbons and associated reductants are lost as fermentation products.

As for facultative anaerobes, format appears to be the sole substrate for hydrogen production.

Although these organisms do have a complete TCA cycle, the inability to convert NADH

directly or indirectly to H2, lowers the yield to only 2 H2/glucose.

In order to approach the goal of 10 H2/glucose, a hybrid hydrogen producing system would

be required, combining the pathways of facultative and strict anaerobic organisms. E. coli

produces 10 NAD(P)H from glucose during aerobic conditions from the following reactions: 2

NADH from 3-P-glyceraldehyde dehydrogenase; 2 NADH from pyruvate dehydrogenase; 2

NADH from ca-ketoglutarate dehydrogenase; 2 NADH from malate dehydrogenase; and 2

NADPH from isocitrate dehydrogenase. Transcriptional regulation of TCA cycle genes is

effected by the ArcAB and FNR systems. During anaerobic conditions, a membrane bound

ArcB senses the redox state, perhaps from increased concentrations of reduced electron carriers

from NADH dehydrogenase to quinones and activates ArcA by phosphorylation (215). ArcA-P

is a global regulator that represses transcription of the genes for many TCA cycle enzymes. FNR

is also activated under anaerobic conditions and regulates arcA transcription (183). The role of

FNR is to induce genes encoding anaerobic respiration proteins and repress some of the aerobic

genes (215). Unlike the two-component regulatory system of ArcAB, FNR is activated by the

reduction of a bound [Fe-S] cluster, causing a conformational change in the protein (215). If an

electron sink that could actively convert electrons from NADH to hydrogen is active in the cell,

the NADH/NAD+ ratio will be kept low allowing the TCA cycle to be active even under









anaerobic conditions. In this case, the electron sink would be NADH-dependant hydrogen

production pathway, such as the one from Trichomonas, transferred to the facultative anaerobe

E. coli.

The thermodynamics of hydrogenase could hinder the NADH-dependent hydrogen

pathway in E. coli. The enzyme hydrogenase catalyzes a simple reaction (Equation 2-5):

2 H+ + 2 e- < H2 (2-5)

The E'o for H2 oxidation is -420 mV and that for the clostridial ferredoxin (source of electrons

for hydrogenase) is about -390 mV. The equilibrium constant for the above reaction is close to 1

so hydrogenase is said to be "reversible" (195). In order for hydrogen to be produced from

NADH, the NADH/NAD ratio must be increased to higher levels to lower the Eo' of the

NAD+/NADH couple from -320 mV to that of Fd and H2. This could conflict with the activation

of the above described anaerobic TCA cycle. Since the hydrogenase reaction is reversible,

hydrogen production is subjected to product inhibition at increasing hydrogen levels. This

requires continual removal of the produced hydrogen to maintain high rates of H2 production,

leading to a dilute stream of H2 mixed with other gases.

Hydrogenase Biochemistry

There are three classes of hydrogenases: [Fe], [NiFe], and metal-free hydrogenase. Each

of these is characterized by a distinctive functional core, which is conserved within each class.

[Fe] and [NiFe]-hydrogenase structures have been solved by x-ray crystallography (90, 159,

207). The active sites of these two classes of hydrogenases show some similarities in their

structural framework and chemistry, which support the idea of convergent evolution. Based on

amino acid sequence analysis, the third class of metal-free hydrogenases lacks any resemblance









to the two metal containing classes. Even though they are classified as metal-free, these

hydrogenases do contain heme clusters (207).

[NiFe]-hydrogenase

[NiFe]-hydrogenases are generally ap-heterodimers and many of them are associated with

membranes and H2 uptake. The large a-subunit is about 60 kDa and contains the [NiFe] active

site. The small P-subunit, about 30 kDa, holds the [Fe-S] clusters. Using sequence analysis,

[NiFe]-hydrogenases were separated into four different groups (207, 222). Group one [NiFe]-

hydrogenases are membrane bound respiratory enzymes that link the oxidation of H2 to the

reduction of electron acceptors such as 02, NO3-, SO42-, fumarate, or CO2. Examples include

Wolinella succinogenes (59) and E. coli HYD2 isoenzyme (28) reducing fumarate or inorganic

oxidants, Ralstonia eutropha (24) reducing 02, and methanogenic archaeon 1 A'/t/h/Ill,\i L ilha

mazei (95) reducing CO2 from H2. Group two represents cytoplasmic H2 sensors and the

cyanobacterial uptake hydrogenases such as in Anabaena variabilis (85). H2 signaling

hydrogenases, found in Rhodobacter capsulatus (66) and Bradyrhizobiumjaponicum (26), are

involved in hydrogenase gene regulation in response to H2. Group three enzymes are bi-

directional heteromultimeric cytoplasmic [NiFe]-hydrogenases. In this group, the dimeric

hydrogenase is associated with other subunits that are capable of binding cofactors such as F420

(Methanococcus voltae (38)), NAD+ (R. eutropha (177)), or NADP+ (Pyrococcusfuriosus

(130)). Group 4 are hydrogen evolving membrane-associated hydrogenases. E. coli HYD3

along with many archaeal hydrogenases such as the ones from .1 A'//hmi\ il i barkeri and P.

furious belong to this group. These enzymes are energy-conserving, meaning that they reduce

protons in order to dispose of excess reducing equivalents produced by anaerobic oxidation of

low potential Cl compounds with associated proton gradient generation (208).









[Fe]-hydrogenase

[Fe]-hydrogenases are the main interest of this study since these enzymes are cytoplasmic

and couple ferredoxin to H2 evolution. [Fe]-hydrogenases are mainly monomeric proteins

containing the H-cluster active site. The H-cluster consists of a binuclear [Fe] center bound by a

[4Fe-4S] cluster. This H-cluster is coordinated by a non-protein dithiolate bridging ligand, CN-

ligand, and CO ligand. The composition of the dithiolate linkage is not known experimentally

but has been proposed to be either SCH2CH2CH2S (PDT) or SCH2NHCH2S (DTN) (160).

[Fe]-hydrogenases are found in anaerobic bacteria such as Clostridium sp. and sulfate

reducers and in lower eukaryotes such as Trichomonas vaginalis and green algae. [Fe]-

hydrogenases, the predominant form of hydrogenase found in eukaryotes, are only found in

either hydrogenosomes or chloroplasts. The smallest [Fe]-hydrogenases are found in green algae

Scenedesmus obliquus, Chlamydomonas reinhardtii, and C. fusca. These hydrogenases are

about 45-48 kDa in size and only contain the H-cluster (84). Clostridial [Fe]-hydrogenases, in

addition to the H-cluster, contain three other domains: a [2Fe-2S] ferredoxin-like domain, a

[4Fe-4S] cluster fold, and a 2[4Fe-4S] domain (150, 159).

Biosynthesis of the [Fe] active site is not known. The [Fe]-hydrogenase from C.

pasteurianum has been crystallized and its structure was solved (159). The corresponding gene

was cloned and was functionally expressed in a cyanobacterium Synechococcus PCC7942 that

also produces a [Fe]-hydrogenase indicating the flexibility of the activation enzymes (8). C.

acetobutylicum was also found to heterologously express algal [Fe]-hydrogenase from C.

reinhardtii and S. obliquus with high specific activities (72). However, the cyanobacterial

hydrogenase was not functionally expressed in a non-[Fe]-hydrogenase producing organism such

as E. coli (8). In the organisms investigated, the genes coding for the structural genes and the

accessory genes are not clustered. Recently, Posewitz et al. identified three novel proteins,









HydEF and HydG, that are required for the assembly of an active [Fe]-hydrogenase in C.

reinhardtii (164). Through sequence homology, these enzymes were suggested to be members

of radical S-adenosylmethionine (SAM) proteins. These proteins were purified and

characterized from Thermatoga maritima (171). HydE and HydG were able to reductively

cleave SAM when reduced by dithionite confirming that they are radical SAM enzymes. The

characterization of HydF revealed its ability to hydrolyze GTP (37). Using known models, such

as the radical dependent sulfur insertion of LipA and BioB in the biosynthesis of lipoic acid and

biotin, Peter et al. proposed a H-cluster biosynthesis mechanism involving the HydEFG proteins

(160). They suggested that HydE and HydG form the dithiolate ligand to a [2Fe-2S] cluster from

either amino acid or glycolytic intermediates. The role of HydF could be the translocation and

insertion of the [2Fe-2S] cluster into the apohydrogenase. The incorporation of genes encoding

these proteins along with [Fe]-hydrogenase from C. reinhardtii into a non-[Fe]-hydrogenase

producing organism such as E. coli supported small (but variable) amount of active hydrogenase

(164). Upon purification, recombinant [Fe]-hydrogenases from various organisms coexpressed

with C. acetobutylicum HydEFG in E. coli yielded active enzymes with low specific activities

(113). These results suggest that HydEFG are the minimally required accessory proteins for

[Fe]-hydrogenase activation. However, just after the establishment of the required maturation

accessory proteins for [Fe]-hydrogenase, Inoue et al. expressed a [Fe]-hydrogenase gene from a

symbiotic anaerobic protozoan, Pseudotrichonympha grassii, found in the digestive hindgut of

the termite Coptotermesformosanus without the accessory genes and purified a active

recombinant [Fe]-hydrogenase from E. coli (99). Purified recombinant P. grassii [Fe]-

hydrogenase produced in E. coli without added accessory genes was about 30 times more active

than recombinant clostridial [Fe]-hydrogenase with HydEFG also purified from E. coli (99, 113).









These results suggest that although the HydEFG proteins are required to activate [Fe]-

hydrogenase, a [Fe]-hydrogenase can be produced in an active form in E. coli using only the

native proteins to activate the enzyme.

NADH-Dependent Hydrogen Producing Pathway

There are two demonstrated NADH-dependent H2 production reactions; a clostridial

pathway and a hydrogenosomal pathway. NADH-dependent production of H2 was demonstrated

using crude extracts of C. kluyveri as well as other clostridia with acetyl-CoA as an activator

(108, 197). It was believed that NADH is oxidized by NADH-ferredoxin oxidoreductase

(NFOR) which reduces ferredoxin (108, 163). Reduced ferredoxin transfers electrons to [Fe]-

hydrogenase for H2 production. However, recently, the same group that first detected NADH to

H2 activity in C. kluyveri extracts, purified the key enzyme responsible for the NADH-dependent

reduction of ferredoxin (124). Their results show that the initially discovered NFOR activity was

a coupled side reaction of crotonyl-CoA reduction by butyryl-CoA dehydrogenase/electron

transfer flavoprotein (Bcd/Etf) complex (Figure 2-2) (Equation 2-6).

NADH + Fdox -, NAD+ + Fdred AG = +4.15 kcal mol-1 (2-6)
NADH + crotonyl-CoA -NAD+ + butyryl-CoA AGo = -14.31 kcal mol-1

2 NADH+crotonyl-CoA+Fdox-2 NAD++butyryl-CoA+Fdred AGo =-10.16 kcal mol-1

Using the E1 (-60 mV) and E2 (-430 mV) redox potential of Acidaminococcusfermentans

flavodoxin (83, 121, 124, 224), NADH (-320 mV) dependent reduction of ferredoxin (-410 mV)

appears to be thermodynamically favorable when coupled to crotonyl-CoA reduction (-10 mV)

where electrons from the E2 state (FADH/FADH2) were transferred to ferredoxin and El state

(FAD/FADH) was transferred to crotonyl-CoA. Acetyl-CoA, required in the initial studies, turns

out to be a precursor of the substrate crotonyl-CoA and not an activator. Diez-Gonzalez et al.

also partially purified Bcd from C. acetobutylicum and determined that crotonyl-CoA reduction









could also use electron donors from reduced dyes such as 3-(4,5-dimethylthiazol-2-yl)-2,5-

diphenyltetrazolium bromide (MTT) (Eo'= -110 mV), 2,6-dichlorophenolindophenol (DCPIP)

(Eo'= +217 mV), and methyl viologen (MV) (Eo'= -440 mV) where MV based activity was 18-

fold higher than observed with MTT (55). This recent information clearly shows that a

clostridial NADH-dependent system may not be prudent for the construction of a biocatalyst for

hydrogen production, using NADH as the reductant, since for every H2 produced, a molecule of

butyryl-CoA will also produced. This loss of carbon and energy will significantly lower the H2

per glucose yield and the overall process will be uneconomical.

The alternative NADH to H2 pathway starts with NFOR, a hydrogenosomal enzyme in

anaerobic protozoan. T vaginalis NFOR is a heterodimer consisting of a small (NdhE) and a

large (NdhF) subunit and these proteins have high homology to mitochondrial 24-kDa and 51-

kDa subunits of NADH-dehydrogenase (NDH) of respiratory complex I (94). Unlike other

known respiratory NDH enzymes, the anaerobically produced T. vaginalis NDH has a unique

capability for reduction of low potential electron acceptors such as its native [2Fe-2S] ferredoxin

(Eo'= -347 mV) and MV (Eo'= -440 mV) (94). This difference in electron acceptors is expected

to reside in the structural components of the T vaginalis NDH, such as FMN, [Fe-S] clusters,

etc. In this study, I purified the NDH heterodimer, as well as the individual subunits and

biochemically characterized them to elucidate the mechanism by which the recombinant enzyme

utilizes low potential electron carriers as substrate.

It has been previously demonstrated that chemically reduced viologen dyes can couple to

hydrogenase for hydrogen production both in vivo and in vitro (17, 81, 117, 174). Since T

vaginalis NDH has been demonstrated to readily reduce methyl viologen (Eo'= -440 mV) (94),

which has a lower redox potential than hydrogen (Eo'= -420 mV), the reduced MV produced in









vivo by T vaginalis NDH (expressed in E. coli) can potentially couple NADH oxidation to

hydrogen production (Figure 2-3). This pathway has the potential to increase hydrogen yield

beyond the theoretical 2 mol per mol glucose in E. coli and other facultative anaerobes.












-800

-600

-400

-200

0 .

200o


400 e- PC






PS I
1200 2H20


Figure 2-1. Photosynthetic electron transport pathways for hydrogen production in green algae.
Electrons may originate from photo-oxidation of water at PS II or at the
plastoquinone pool from the oxidation of endogenous substrates such as glycogen and
starch. Reduced Fd from PS I could transfer electrons to hydrogenase for hydrogen
production, or to FNOR to generate NADPH for CO2 fixation. TCA, Tricarboxylic
acid cycle; P680, photoreaction center of PS II; Q, primary electron acceptor of
photosystems; PQ, plastoquinone; Cyt, cytochrome; PC, plastocyanin; Fd, ferredoxin;
Red, NAD(P)H quinone oxidoreductase; HYD, hydrogenase; FNOR, ferredoxin-
NADP oxidoreductase [Adapted from Melis, A., and T. Happe. 2001. Hydrogen
production. Green algae as a source of energy. Plant Physiol 127:740-748 (Page 743,
Figure 2)]









2NADH

IE = -320 mV

4e-+ 4H+

2 FADH2

FdOX

2 FAD |- ------ Y|- ----- |
FAD E = -430mV E -410 mV



E, E -60 m Fdred

2 FADH


2e"+ 2H+

SE' = -10 mV |

Crotonyl-CoA Butyryl-CoA

Figure 2-2. NADH-dependent reduction of ferredoxin by C. kluyveri Bcd/EtfBA (clostridial
NFOR) coupled to crotonyl-CoA to butyryl-CoA reaction. The E1 and E2 redox
potential of FADH and FADH2 was an estimate based on Acidaminococcus
fermentans flavodoxin which had similar properties to electron transfer flavoproteins
(124). The energetic of this ferredoxin reduction is thermodynamically favorable by
coupling crotonyl-CoA reduction (Equation 2-6). [Adapted from Li, F., J.
Hinderberger, H. Seedorf, J. Zhang, W. Buckel, and R. K. Thauer. 2008. Coupled
ferredoxin and crotonyl coenzyme A (CoA) reduction with NADH catalyzed by the
butyryl-CoA dehydrogenase/etf complex from Clostridium kluyveri. J Bacteriol
190:843-850. (Page 848, Figure 3]








NADH HFd So H2



NADO Fdred 2H-

NFOR Hyd
Figure 2-3. NADH-dependent hydrogen producing pathway. NADH is oxidized by NADH-
ferredoxin oxidoreductase (NFOR) which reduces ferredoxin (Fd). Reduced Fd is the
electron donor for hydrogenase (Hyd) for H2 production.









CHAPTER 3
BACKGROUND ON BUTANOL PRODUCTION

Although H2 is a more desired transportation fuel, other next generation fuels such as

butanol may become a reality before the H2 economy is realized. As stated before, butanol has

several advantages over ethanol as a transportation fuel. Butanol fermentation has a long history

and modification of microbial biocatalysts for butanol production is being attempted by several

laboratories around the world. In this section, the current status of butanol fermentation is

presented.

Fossil Fuel-Based Butanol Production

Currently, the majority of butanol is produced by the conversion of petroleum-based

hydrocarbon to butanol by a process called hydroformylation followed by hydrogenation.

Hydroformylation is defined as the addition of a formyl group to a double bond of a hydrocarbon

by reaction with a mixture of carbon monoxide and hydrogen in the presence of a catalyst. For

butanol production, the formyl group is added to the double bond of propylene producing

butyraldehyde (194). Butyraldehyde is reduced to butanol by a hydrogenation reaction (200).

This process yields both n-butanol and isobutanol, which is separated by distillation (148).

Microbial Butanol Production

History

Microbial butanol fermentation was first described by Pasteur in 1861 (107). In 1905,

Schardinger discovered that butanol fermentation included the co-production of acetone (107).

At the beginning of the 20th century, with an increase in the automotive industry, a shortage in

natural rubber for the fabrication of tires sparked an interest in butanol fermentation for the

production of synthetic rubber from butadiene (68, 69). In 1910, an English firm, Strange and

Graham Ltd., was on a venture for the production of synthetic rubber. They recruited the work of









Weizmann and Perkins of Manchester University, UK and later Fernbach and Schoen of Pasteur

Institute, France. In 1911, Fernbach isolated a bacillus culture that was able to produce butanol

from potato starch but not from corn (68, 69, 107). Weizmann left Strange and Graham Ltd. in

1912 to continue his research at Manchester University. By 1914, Weizmann isolated strain BY

that was more robust in butanol production than Fernbach's bacillus and used many different

sources of starch such as from corn (107). This strain was later renamed as C. acetobutylicum.

At the time, C. acetobutylicum gained global attention due to its ability to produce acetone,

which is used as a solvent for cordite production. During World War I, cordite was used as the

main constituent in explosives and gun powder which consists of 58 % nitroglycerine, 37 %

guncotton, and 5 % vaseline (198). With high demands for cordite and promising results for the

production of acetone by the Weizmann process, England constructed a plant for the production

of acetone at the Royal Naval Cordite Factory at Poole in Dorest and adapted six distilleries in

Great Britain for the production of acetone using the Weizmann process (107). A shortage of

grain due to war efforts forced Great Britain to move the fermentation process to plants in

Canada. In 1917, upon the United States' entry into World War I, United States decided to

produce acetone in the Midwest corn belt at Terre Haute, Indiana where substrates are readily

available (107). The fermentation production was continued until November 1918 when all

plants were closed due to the end of the war.

Butanol, the other product of C. acetobutylicum fermentation was stored until after the end

of the war. At that time, the automotive industry was rapidly expanding and was in need of a

quick drying lacquer. E. I. du Pont de Nemours & Co. developed a nitrocellulose lacquer which

required butanol and butyl-acetate as solvents. With the increase in demand for butanol instead

of acetone, the plants at Terre Haute reopened under the newly formed Commercial Solvent









Corporation (CSC) of Maryland in 1920, which operated under the U.S. license for the

Weizmann process patent issued in 1919. To meet rapidly growing demands, CSC acquired

another plant in Peoria, IL (68, 107).

In the 1930s, a new method using petroleum to produce synthetic solvents posed a threat to

the butanol fermentation industry. In efforts to improve the fermentation processes, research was

initially dedicated to the isolation of a strain, which could use higher concentrations of starch

with limited results. Research efforts were then shifted to the fermentation of carbohydrates

such as readily available molasses, which at the time, cost less than starch. CSC strain number 8,

later known as C. saccharoacetobutylicum, was able to ferment up to 6.5 % sugars producing up

to 2 % total solvents that lowered the distillation cost by half (68, 107).

The start of World War II once again catapulted the demands for acetone for munitions.

Plants were built in a number of countries around the world including Japan, India, Australia,

China, USSR, and South Africa. By the end of the war in 1945, about two-thirds of the butanol

in the United States and one-tenth of acetone were produced by fermentation (107). However, a

rapidly growing petro-chemical industry in the 1950s, in addition to an increase in molasses

usage as cattle feed made butanol-acetone fermentation no longer cost-effective; thus, by 1960

almost all butanol-acetone fermentation ceased in the United States and Great Britain (107).

Butanol Fermentation

Unlike hydrogen production, microbial butanol production is more restricted to few

members of the clostridia class, Clostridiaceae family, and more specifically the genus

Clostridium; however, some members of the Lachnospiraceae family such as Butyrivibrio

fibrisolvens contain most of the butanol biochemical pathway, producing butyric acid. Members

of the Clostridium genus are anaerobic, Gram-positive, spore-forming, rod-shaped bacteria. Of

the clostridia, C. acetobutylicum, C. beijerinckii, C. saccharobutylicum, and C.









saccharoperbutylacetonicum are primary solvent producers (60, 120). The most studied

clostridia is C. acetobutylicum which was the strain originally isolated by Weizmann in 1914

(107). C. acetobutylicum possesses a 210 kb megaplasmid, pSoll, which was originally named

for its ability to produce solvents (48). Strains lacking pSoll are unable to produce solvents (48).

During normal growth, C. acetobutylicum undergoes two defined growth phases: acidogenesis

and solventogenesis (78). C. acetobutylicum during exponential growth exhibits acidogenesis

where the major fermentation products are acetate, butyrate, hydrogen, and carbon dioxide. At

the onset of stationary phase triggered by a drop in pH, C. acetobutylicum shifts to

solventogenesis where it takes up the acids produced during acidogenesis and produces solvents

such as acetone, butanol, and ethanol (ABE) (78). Depending on the fermentation conditions,

wild type C. acetobutylicum produces from 5.5 to 11.0 g L-1 butanol (87, 88, 120, 145, 234). The

typical molar ratio of acetone : butanol : ethanol in the fermentation broth is about 3:6:1,

respectively (166). Mutations up-regulating butanol dehydrogenase and/or down-regulating

solR (repressor of the sol operon) and acid production genes have led to concentrations up to

17.8 g L-1 butanol (87, 88, 120, 145, 234). Hyper-butanol producing mutant C. beijerinckii

BA101 can produce over 20 g L-1 butanol and 33 g L-1 total solvents in batch fermentations (44,

120, 166). When compared with wild-type parent, C. beijerinckii NCIMB 8052, transcriptional

analysis of mutant strain C. beijerinckii BA101 revealed a decrease in sporulation efficiency and

PTS sugar transport and an increase in several metabolic genes encoding butanol production

(179).

The metabolic pathway for butanol production has been well studied (5, 48, 62, 68, 78,

107, 142, 145) (Figure 3-1). Under exponential growth conditions and acidogenesis, C.

acetobutylicum consumes glucose via glycolysis to produce 2 pyruvate and 2 NADH (215).









Pyruvate is then converted to acetyl-CoA and CO2 by pyruvate-ferredoxin oxidoreductase

(PFOR) which is coupled to ferredoxin reduction and hydrogen production (215). Acetyl-CoA

could be converted to acetate for ATP production (phosphotransacetylase, pta and acetate kinase,

ack) (33) or two acetyl-CoA can be condensed into one acetoacetyl-CoA by thiolase (thiA and

thiB) (217). Acetoacetyl-CoA is reduced by hydroxybutyryl-CoA dehydrogenase (hbd) coupled

to NADH oxidation to produce hydroxybutyryl-CoA (32, 229). Hydroxybutyryl-CoA is then

converted to crotonyl-CoA via a dehydration reaction catalyzed by crotonase (crt) (32, 213).

Butyryl-CoA dehydrogenase (bcd) and electron transfer flavoprotein (etfBA) complex catalyzes

the conversion of crotonyl-CoA to butyryl-CoA coupled to ferredoxin reduction using two

NADH (32, 124). Analogues of Bcd that are capable of catalyzing the same reaction have been

identified as crotonyl-CoA reductase (ccrA and ccrB) in some Streptomyces species. Crotonyl-

CoA reductase converts crotonyl-CoA to butyryl-CoA coupled to NADPH oxidation. A

coenzyme-A phosphotransbutyrylase converts butyryl-CoA to butyryl-phosphate (ptb) and

butyrate kinase (buk) transforms butyryl-phosphate to butyrate and ATP (5, 215).

The shift to stationary phase triggers an 1,200-fold up regulation of the sol operon located

on pSoll megaplasmid (5, 61, 145). The sol operon has two promoters. The first promoter

controls genes encoding an alcohol-aldehyde dehydrogenase (aad) and coenzyme-A transferase

(ctfA and ctfB). The second promoter transcribes acetoacetate decarboxylase (adc) downstream

of the first promoter on the complimentary strand. CtfAB transfers the CoA from acetoacetyl-

CoA to either acetate or butyrate producing acetoacetate and acetyl-CoA or butyryl-CoA,

respectively. Adc decarboxylates acetoacetate to produce acetone and CO2. Aad catalyzes two

reactions: the first is the reduction of acetyl-CoA to acetaldehyde and ethanol. The second









reaction reduces butyryl-CoA to butyraldehyde and 1 -butanol (67, 144). Each reaction is coupled

to the oxidation of NADH.

Molecular Organization of Butanol Production Pathway

C. acetobutylicum has two thiolase homologues; the first gene, thlA (CAC2873), is located

on the chromosome and the second gene, thlB (CA P0078) is located on the pSoll megaplasmid.

Northern blot analysis revealed high levels of thlA transcripts during acidogenesis and decreasing

levels to minimal expression about 3 to 7 hrs after induction of solventogenesis (217). There is a

c70 consensus sequence upstream of thlA controlling the transcription of a 1.4kb monocistronic

message. Genetic organization of thlB suggests that it forms an operon with two other genes,

thlC and a possible regulator thlR (Figure 3-2). Transcriptional analysis of thlB showed very low

expression relative to thlA during both acidogenesis and solventogenesis. This study also

determined that thlA is the main gene encoding thiolase in all phases, and the physiological

function of thlB is yet to be identified (217).

In C. acetobutylicum, crt, bcd, etfB, etfA, and hbd genes (CAC2712, CAC2711, CAC2710,

CAC2709, and CAC2708 respectively) are arranged in a single polycistronic butyryl-CoA

synthesis (BCS) operon (32, 142) (Figure 3-2). The BCS operon was expressed inE. coli and an

increase in Crt and Hbd activity was detected in the crude extract; however, no Bcd/EtfBA

activity was detected at that time. The same operon over-expressed from a plasmid in C.

acetobutylicum had about a 2-fold increase in activity for all three enzymes including the

Bcd/EtfBA complex which by far has the lowest activity indicating that it could be the rate

limiting step of the butanol fermentation pathway (32).

The last reaction of the pathway converts butyryl-CoA into butanol. C. acetobutylicum is

the first bacterium identified with two bifunctionally active Fe- aldehyde-alcohol

dehydrogenases that are capable of catalyzing this reaction (67). The first of this type, aad









(adhE1, CAP0162), was identified originally as a part of the sol operon (144). Aad has 74 %

similarity and 56 % identity with E. coli AdhE. The expression of aad and the sol operon

coincides with the start of solventogenesis (5, 61, 145). The second gene product, AdhE2

(adhE2, CAP0035), is 77 % similar and 58 % identical to E. coli AdhE. The adhE2 gene is

expressed only in alcohologenic cultures and not in solventogenic culture (67). C.

acetobutylicum also has two adjacent independently transcribed chromosomally located Zn-

butanol dehydrogenases genes (bdhA-CAC2399 and bdhB-CAC2398) and their expression

coincides with solventogenesis (5, 62, 161, 162, 212). The bdhB is induced prior to the

induction of the sol operon and was found to have a 2.3 fold higher expression than aad (5,

161). It is proposed that aad and bdhB are the two major alcohol dehydrogenase genes

responsible for butanol production (62).

Advances in Metabolic Engineering of Bacteria for Butanol Production

For over 50 years, from the 1910's to the 1960's, C. acetobutylicum was used in industrial

ABE fermentation (107). Since then, there has not been much advancement in strain

development for increasing butanol yield; instead, most studies are concentrated on butanol

extraction and purification (120). Even though simple genetic tools are available for C.

acetobutylicum, e.g. plasmid vectors, transformation protocols, and gene knockouts, the

anaerobic physiology of this organism makes it difficult to work with for cost effective fuel

production. Clostridium requires a relatively rich growth medium with an abundant supply of

nitrogen and reducing agents which add to production costs (12, 120, 153, 166). Solvent

producing clostridia utilize less than 25 % of carbon from glucose for butanol production. The

rest of the carbon is used for the co-production of acetone, ethanol, and residual acids. The

combustional energy from acetone, butanol, and ethanol is about 12,500 BTU/lb, 16,000 BTU/lb,

and 11,500 BTU/lb, respectively. Thus, co-production of acetone and ethanol leads to a loss of









carbon to lesser energy containing molecules. Ideally, butanol should be the sole fermentation

product of this process. For over 20 years, much work has been done towards the construction of

a Clostridium for homo-butanol production by mutating competing pathways but with only

limited success.

Towards the goal of generating a homo-butanol producing organism, it may be easier to

recombinantly express the butanol production pathway in other commonly used microbes.

Genes in the butanol production pathway have been cloned and expressed to produce active

proteins in other microorganisms such as S. cerevisiae and E. coli (12, 100, 185). In these

experiments, Steen et al. cloned the BCS operon and aad2 from C. beijerinckii, atoB (thiolase)

from E. coli, and ccrA from Streptomyces collins into S. cerevisiae resulting in the production

of about 2.5 mg L-1 (0.034 mM or 0.00025 %) butanol (185).

To date, there are only two published reports on butanol producing E. coli (12, 100).

Atsumi et al. was the first to demonstrate the production of butanol in E. coli using the clostridial

pathway (12). Atsumi et al. cloned the same genes as Steen et al. and functionally expressed

them in various E. coli mutants deficient in native fermentation pathways. Atsumi et al.

identified three possible rate limiting steps: thiolase, butyryl-CoA dehydrogenase, and the

aldehyde-alcohol dehydrogenase reactions. Using their parent strain, which has a wild-type

fermentation profile, with the entire butanol pathway genes expressed from plasmids, they

compared the productivity of E. coli thiolase, atoB, and C. acetobutylicum thlA under different

growth conditions. Strains with over-expressed atoB produced about 4 times more butanol (70

mg L-1; 0.94 mM butanol) than with thlA (18 mg L-1; 0.24 mM butanol) alone under 02-limiting

conditions. Atsumi et al. then tested the effect ofbutyryl-CoA dehydrogenase by replacing C.

acetobutylicum bcd-etfBA with Megasphaera elsdenii bcd-etfBA or S. coelicolor ccr. An E. coli









mutant lacking native fermentative pathways (AadhE AldhA AfrdBC Afnr Apta) bearing C.

acetobutylicum bcd-etfBA produced more butanol (-155 mg L-1; 2.09 mM) than the ones with M.

elsdenii bcd-etfBA (-18 mg L-1; 0.24 mM) or S. coelicolor ccr (-2 mg L-1; 0.03 mM) under 02-

limiting conditions. An E. coli fermentation defective mutant expressing atoB, C.

acetobutylicum bcd-etfBA, crt, hbd, and aad2 was able to produce 552 mg L-1 (7.45 mM) butanol

in rich medium with glycerol as a carbon source and 113 mg L-1 (1.52 mM) butanol in M9

minimal medium with glucose as a carbon source under 02-limiting condition (12).

Inui et al., cloned the BCS operon from C. acetobutylicum along with thlA and compared

the difference in the two aldehyde-alcohol dehydrogenases aad] and adhE2 (100). E. coli

strain JM109 (wild-type fermentation) was transformed with compatible plasmids expressing the

above genes with either aad] or adhE2. In crude extract, they detected an increase in activity for

all enzymes tested. Bcd/EtfBA activity still appeared to be the rate limiting process. AdhE2 had

a 27-fold higher butyraldehyde dehydrogenase activity specific for butyryl-CoA as substrate than

Aadl for butyryl-CoA as substrate. Both enzymes preferentially reduced acetyl-CoA to ethanol

rather than butyryl-CoA to butanol. Aadl and AdhE2 had about a 14-fold and a 2-fold,

respectively, higher specific activity using acetyl-CoA as substrate than butyryl-CoA as

substrate. High density cultures of JM109 with BCS, thiolase, and adhE2 genes (OD660nm = 20;

pH 6.5) in an anaerobic chamber with an atmosphere comprising of 95 % nitrogen and 5 %

hydrogen, were able to produce up to 16 mM (1185 mg L1) butanol and 5 mM butyrate;

whereas, aad] containing JM109 instead of adhE2 only produced 3.5 mM (259 mg L-1) butanol

and 1 mM butyrate in 60 hrs at 30C (100). The fermentation balance was not presented;

however, one can assume this strain also produced high concentrations of lactate, acetate,









ethanol, format, and succinate since strain JM109 still contained all the native fermentation

pathways.

Based on the pathway presented in Figure 3-1, the reduction of 2 acetyl-CoA to butanol

will require 4-5 NAD(P)H depending on the enzyme used for the conversion of crotonyl-CoA to

butyryl-CoA. Since E. coli can only produce 2 NADH per glucose under anaerobic conditions, it

lacks the reducing equivalents needed for homo-butanol production anaerobically. This is also

apparent in the work of nui et al. where a high density culture co-produced both butanol and

butyrate indicating the inability of the bacterium to operate the entire butanol pathway (100).

The availability of hydrogen in the gas phase may be beneficial for butanol production because

hydrogen is a known electron donor for fumarate reductase (119, 221). Since Bcd/EtfBA is a

flavoprotein and reduces a C=C bond in a manner that is similar to fumarate reductase, hydrogen

uptake may also supply the needed additional reducing power to aid the conversion of crotonyl-

CoA to butyryl-CoA.

According to Knoshaug et al., higher butanol concentration could inhibit growth (114).

Butanol at a concentration of 1.0 % lowers the relative growth of the yeast studied to about 60 %

and no growth was observed at 2.0 % butanol (114). Lactobacillus spp. were found to be more

tolerant to butanol than yeast. The two strains tested, L. delbrueckii and L. brevis, had 60 % of

the growth rate compared to the control without butanol at 2.0 % butanol in the medium. L.

brevis had the highest butanol tolerance of all the strains tested having a 35 % growth rate at 3.0

% butanol compared to butanol-less control. E. coli butanol tolerance appears to be temperature

dependent. E. coli strain W3110 has a 25 % and 75 % relative growth rate of the control cultures

at 37C and 30C, respectively, in 1.0 % butanol (114). According to Atsumi et al., E. coli can

tolerate up to 1.5 % butanol, which is within the range of clostridial butanol tolerance (12).









Engineering Escherichia coli for Butanol Production

E. coli is one of the most studied organisms in the world. Nonpathogenic E. coli strains

such as K12, C, and B strains are classified as a GRAS (Generally Regarded As Safe) organism

and its physiology makes it an ideal model organism to study. E. coli is a Gram-negative, non-

sporulating, facultative anaerobe and has the ability to utilize a vast array of carbon sources and

can grow in minimal salts medium (135). E. coli has many industrial applications which include

the production of insulin, amino acids, pyruvate, lactate, succinate, and ethanol (43, 75, 103, 104,

209,228,232).

E. coli fermentation products are a mixture of acids and ethanol (Figure 3-3) (215). Under

anaerobic conditions, glucose is consumed and is converted to 2 moles phosphoenolpyruvate

(PEP) and then to 2 moles pyruvate during glycolysis. One NADH is produced during the

oxidation of glyceraldehyde-3-phosphate (G3P) to 1-3-bisphosphoglycerate by G3P

dehydrogenase of the glycolysis pathway (2 per glucose). Pyruvate is converted to acetyl-CoA

and format by pyruvate formate-lyase (pflB) or reduced to lactate coupled to NADH oxidation

by lactate dehydrogenase. Acetyl-CoA is further reduced to acetaldehyde and then to ethanol

using 2 moles NADH by alcohol dehydrogenase (adhE). Acetyl-CoA is also converted to

acetate by phosphotransferase (pta) and acetate kinase (ack) for the production of 1 ATP.

Succinate is produced by the carboxylation of PEP to oxaloacetate. Oxaloacetate is reduced to

malate by malate dehydrogenase consuming one NADH. Malate is dehydrated by fumarase to

produce fumarate. Fumarate is then reduced by a membrane bound fumarate reductase

(frdABCD) for succinate production. The standard mid-point potential for reduction of fumarate

to succinate is +31 mV. Of all the reactions of anaerobic glycolysis and fermentation, the

fumarate reductase is the only enzyme that is membrane-bound. NADH is not an electron donor









for fumarate reduction in vitro. This flavoprotein apparently utilizes electrons from an unknown

source and not directly from NADH in vivo also (215).

As noted earlier, E. coli generates only 2 moles NADH per mole glucose under anaerobic

condition from the G3P dehydrogenase activity. Kim et al. described a strain of E. coli with a

mutation in dihydrolipoamide dehydrogenase (lpdA), the E3 component of pyruvate

dehydrogenase (PDH), that alters the NADH sensitivity of PDH (111, 112). PDH, like PFL,

catalyzes the conversion of pyruvate to acetyl-CoA; however, PDH releases CO2 and couples the

reaction with reduction of NAD+ to NADH instead of producing format. The inherent

sensitivity of this enzyme to high NADH concentrations under anaerobic conditions inhibit PDH

activity. Point mutation E354K in IpdA (lpdO1 *) lowers NADH sensitivity of the PDH

complex (112). The lower NADH sensitivity of the mutated form of the PDH increases PDH

activity during anaerobic growth leading to an additional 2 NADHs per glucose (112). This

critical mutation is required to produce a more reduced product such as butanol.

Another problem to address in engineering E. coli for butanol production is the activity of

Bcd/EtfBA complex. The low activity of Bcd/EtfBA in recombinant E. coli is an inherent

characteristic of this enzyme and not because of recombinant expression in E. coli. This reaction

may also be the rate limiting reaction in clostridia (32). Prior attempts to increase the conversion

of crotonyl-CoA to butyryl-CoA in E. coli included expressing Streptomyces CcrA and

Bcd/EtfBA from other organisms without significant success (100, 185). Streptomyces CcrA

uses NADPH instead of NADH. Lower levels of NADPH under anaerobic conditions make this

reaction less favorable. To increase CcrA activity in E. coli, higher NADPH pool will be

required. Overexpression of E. coli transhydrogenase, udhA (sthA) andpntAB, has been found to

increase NADPH levels (109, 172, 214).









Bcd/EtfBA activity in E. coli could be increased by using succinate producing strains. As

mentioned before, succinate is produced from the reductive branch of the anaerobic TCA cycle.

Succinate is produced by the reduction of fumarate by fumarate reductase coupled to the

oxidation of an unknown electron carrier. E. coli strain KJ104 (103) produces near theoretical

yields of succinate producing up to 1.30 mol succinate per mol glucose. This high succinate

production raises the possibility that an unknown electron-transport pathway was elevated in this

strain to reduce fumarate by fumarate reductase, which is a flavoprotein with unique electron

carriers like the Bcd/EtfBA complex. Perhaps this specific electron carrier could also function

with the clostridial Bcd/EtfBA and the succinate production strain described by Jantama, et al.

(103) carrying the butanol pathway and appropriate mutations to knock out succinate production

could increase the activity of Bcd/EtfBA and butanol production.

This study will evaluate the potential of E. coli as a biocatalyst for butanol production.

Since E. coli with an NADH-insensitive PDH can generate 4 NADH per glucose, this strain is an

ideal choice for further engineering for butanol production. Towards this objective, recombinant

C. acetobutylicum enzymes as well as Streptomyces CcrA in the butanol pathway will be

expressed in E. coli to identify the enzymes (genes) that are minimally needed to catalyze the

conversion of acetyl-CoA to butanol. Demonstration of the in vitro enzyme-catalyzed butanol

production will provide the proof of principle that when produced in E. coli these enzymes can

support production of butanol as a fermentation product. Furthermore, in this study, I will also

attempt to optimize the carbon flux to butanol and identify the rate limiting steps in this pathway.

An understanding of the recombinant butanol pathway in E. coli will serve as a foundation for

engineering E. coli for homo-butanol production.

























Acetor


Butyrai


Glucose
2 NAD-
2 NADH
NAD- NADH NAD
Lactate 2 Pyruvate
,,-2Fdo, -<- 2 H2
ATP ADP 2CO2 2,2Fdr-" 4H NADH NAD-
P tCoA Pi oad \
Acetate A P2 Acetyl-CoA --Acetaldehyde -d Ethanol
thl NADH I
aodc NAD-
--- Acetoacetate ---- Acetoacetyl-CoA
ctfAB h NADH
2 NADH
ie+ CO2 \ C NAD'
Hydroxybutyryl-CoA
% crt
Crotonyl-CoA
Fdo /-2NADH
Fdred* NAD
SATP ADPCoA bcd/etA NADH
te Butyryl-P C Butyryl-CoA Butyralehyde -- Butanol
NADH NAD*


Figure 3-1. C. acetobutylicum fermentative pathway. Solid lines represent fermentative
pathway during exponential growth (acidogenesis). Dashed lines represent the
metabolic pathway during the onset of stationary phase (solventogenesis). During
acidogenesis phase, C. acetobutylicum produces primarily acetate, butyrate,
hydrogen, and carbon dioxide. Solventogenesis phase is a shift in cellular
metabolism when cells take up acids and hydrogen produced during acidogenesis,
followed by further reduction of the metabolites to produce acetone, butanol, and
ethanol (ABE). thl, thiolase; hbd, hydroxybutyryl-CoA dehydrogenase; crt,
crotonase; bcd, butyryl-CoA dehydrogenase; etfBA, electron transfer flavoprotein;
ctfAB, coenzyme-A transferase; adc, acetoacetate decarboxylase; aad, alcohol-
aldehyde dehydrogenase. [Adapted from Jones, D. T., and D. R. Woods. 1986.
Acetone-butanol fermentation revisited. Microbiol Rev 50:484-524 (Page 494, Figure
1)]











thlA

























bdhA bdhB Termin aoTranscriptional


Figure 3-2. Molecular organization of genes encoding butanol/solvent pathway in C.
acetobutylicum. C. acetobutylicu has two thiolases encoded by thlA and thlB. thlA
is in a single gene operon whereas thlB is transcribed with two adjacent genes: thlR
and thlC. The butyryl-CoA synthesis (BCS) operon consists of five genes, crt
(crotonase), bcd (butyryl-CoA dehydrogenase), etB (electron transfer flavoprotein
subunit B), etfA (electron transfer flavoprotein subunit A), and hbd (hydroxybutyryl-
CoA dehydrogenase), for the conversion of acetoacetyl-CoA to butyryl-CoA. The
BCS operon is transcribed as a single polycistronic mRNA controlled by a promoter
upstream of crt. The sol operons responsible for majority of solvent production have
two promoters. The first promoter controls the transcription ofaad (aldehyde-alcohol
dehydrogenase), ctfA (coenzyme A transferase), and ctfB. The second promoter
transcribes adc (acetoacetate decarboxylase) on the complimentary strand. C.
acetobutylicum has an additional aldehyde-alcohol dehydrogenase (aad2) transcribed
in its own operon. In addition to the aldehyde-alcohol dehydrogenase, C.
acetobutylicum has two butanol dehydrogenases, bdhA and bdhB, which are
transcribed independently in tandem.
transcribed independently in tandem.








Y Glucose

SNAD-
SNADH
CO,
I-.-...-....-.. PEP
PPEP
I ppc
I NADH NAD'

Oxaloacetate Pyruvate Lactate
Oxaloacetate IdhA
mdh NADH pfI p
SNAD
Malate Acetyl-CoA + Formate FHL H2+ CO2
adhE
fum 4.
NADH
Fumarate Acetyl-P NAD- Acetaldehyde
SdABCDk ADP odhE NADH
frdABCD iAT P NAD"
Succinate Acetate Ethanol

Figure 3-3. E. coli mixed acid fermentation. Under anaerobic conditions, glucose is converted
to PEP and then to pyruvate. Pyruvate could be reduced to produce lactate or could
be converted to acetyl-CoA and format. Formate could be broken down to hydrogen
and carbon dioxide. Acetyl-CoA could either be reduced to produce ethanol or be
converted to acetate for ATP production. Succinate is produced from the
carboxylation of PEP followed by further reduction. IdhA, lactate dehydrogenase;
pflB, pyruvate formate-lyase; FHL, format hydrogen-lyase; adhE, alcohol
dehydrogenase; pta, phosphotransacetylase; ack, acetate kinase; ppc, PEP
carboxylase; mdh, malate dehydrogenase; fum, fumarase; frdABCD, fumarate
reductase.









CHAPTER 4
MATERIALS AND METHODS

General Methods

Materials

Biochemicals were purchased from Sigma-Aldrich (St. Louis, MO) and Fisher Scientific

(Pittsburg, PA). Phusion DNA polymerase, DNA restriction endonuclease, T4 DNA ligase, and

Klenow were purchased from New England Biolabs, Inc (Ipswich, MA). Oligonucletides were

synthesized by Invitrogen (Carlsbad, CA). Plasmid extraction kit and DNA gel-extraction kit

were purchased from Qiagen Inc (Germantown, MD) or Bio-Rad Laboratories, Inc. (Hercules,

CA).

Bacterial strains, Bacteriophages, Plasmids, and Primers Used

The bacterial strains, bacteriophages and plasmids used in this study are listed in Table 4-

1. All primers used in this study are listed in Table 4-2.

Media and Growth Conditions

Luria broth was prepared as described previously (158). Glucose-mineral salts medium

contained 10 g glucose, 6.25 g Na2HPO4, 0.75 g KH2PO4, 2.0 g NaC1, 10 mg FeSO4*7H20, 10

mg Na2MoO4*2H20, 0.2 g MgSO4*7H20, and 1.0 g (NH4)2SO4 in 1 L of deionized water.

Glucose, MgSO4*7H20, and (NH4)2SO4 were added after autoclaving basal salts solution. Solid

medium was prepared by the addition of 15 g L-1 agar into liquid medium. Antibiotics used for

selection were added to medium after autoclaving. Typical antibiotics and concentrations used

in this study were ampicillin (100 mg L-1), kanamycin (50 mg L-1), chloramphenicol (15 mg L-1),

tetracycline (15 mg L-1), and spectinomycin (100 mg L-1).









Fermentation

Batch fermentations without pH control were carried out in a 13 x 100 mm screw-cap

tubes filled to the top with appropriate medium. An inoculum was grown aerobically for about

16 hrs at 37C in a rotator (80 rpm) and was inoculated into the tubes at a concentration of 1 %

(v/v). Microaerobic batch fermentation was carried out in 13 x 100 mm screw cap tubes (9 ml

capacity); however, the tube contained 4-7 ml of appropriate medium depending on the desired

oxygen concentration. The microaerobic culture tubes were incubated in a rotator (80 rpm) at

37C. pH-controlled fermentations were conducted at 370C in 500 ml fleaker vessels containing

250 ml of the corresponding medium along with a custom-made pH-stat. pH was controlled with

0.5 NKOH (96).

DNA Extraction and Purification

Plasmid DNA was extracted with Qiagen QIAprep Spin Miniprep Kits. DNA extracted

from agarose after electrophoresis was purified by either Qiagen QIAquick Gel Extraction Kits

or Bio-Rad Freeze 'N Squeeze spin columns followed by ethanol precipitation as previously

described (14). PCR-DNA purification was done with Qiagen QIAquick PCR Purification Kits.

Genomic DNA was extracted with a modified protocol as described by Ausubel et al. (14). Two

ml of an overnight culture grown at 370C aerobically was pelleted and resuspended in 567 pl of

P1 buffer with the addition of RNase from QIAprep Spin Miniprep Kit instead of TE buffer,

followed by the addition of 50 pl 10 % sodium dodecyl sulfate (SDS). The cell lysate/SDS

solution was mixed by inversion and then incubated at 600C for 5 minutes to increase cell lysis.

120 pl of 5 M NaCl was then added, mixed by inversion, followed by 1 minute incubation at

60C. Then, 80 [l of cetyl trimethylammonium bromide (CTAB)/NaCl solution (14) preheated

to 600C was added, mixed thoroughly by inversion, and incubated at 600C for 5 more minutes.

The lysate was extracted with Tris-saturated phenol, pH 8.0, followed by phenol:chloroform:









isoamyl alcohol (25:24:1) extraction. DNA was then precipitated with 0.7 volume isopropyl

alcohol, pelleted by centrifugation, and washed with 600 tl of 70 % ethanol. DNA was pelleted

again and the ethanol was carefully decanted. The DNA pellet was allowed to dry briefly at

42C and then dissolved in 100 tl TE buffer. Genomic DNA was incubation at 500C to

completely dissolve the DNA as needed.

Polymerase Chain Reaction (PCR)

Polymerase Chain Reaction (PCR) was performed using Phusion High-Fidelity DNA

Polymerase (NEB). A 50 tl reaction typically contained lx High Fidelity (HF) buffer, 200 [iM

each of the four dNTPs, 0.4 [iM of each forward and reverse primer, and 0.5 units of Phusion

polymerase. Denaturing temperature was set at 980C (20 sec), annealing temperatures were set

at 5C below the lowest primer Tm (15 sec), and elongation was at 720C (30 sec per 1 kb).

DNA Modification

Digestion conditions and ligation were as modified from manufacturers' recommendations.

Typically, a 20 tl digestion reaction consisted of 0.5 tg DNA, lx buffer, 1 pl BSA (1 mg ml-1),

and 0.5 [il restriction endonuclease. 10 units or 100 units of T4 ligase was typically used per

"sticky" end or blunt end ligation reaction, respectively, at 160C for at least 12 hrs.

Transformation

Chemical transformation was carried out as described previously with minor modification

(133). Cells were cultured in a 125 ml flask containing 5 ml Luria-Bertani (LB) medium and a

1.0 % inoculum of an overnight, culture at 37C for about 1.5 hrs or until the OD420nm = 0.2 .

Cells were harvested and resuspended in 0.2 ml of cold 0.1 M CaC12. About 0.5 tg of plasmid

DNA was then added to the cell suspension. The cell and DNA mixture was incubated on ice for

15 minutes and heat-shocked for 1 minute at 42C. After heat-shock, the cell/DNA mixture was

immediately transferred to ice for additional 10 minutes. Two ml of LB was added to the









reaction mixture and this was incubated for 1 hour at 37C. Electroporation was conducted as

recommended by Bio-Rad Laboratories (MicroPulser electroporation apparatus operating

instructions and applications guide).

Transduction

Gene transfer mediated by bacteriophage P1 mediated transduction was performed as

described by Miller (138).

Gene Deletions

Method used for gene deletion in E. coli was as described by Datsenko et al. (51). Using

plasmid pKD4 as template, PCR primers with 50 bases homologous to the gene of interest were

designed to amplify FRT:kanamycin resistance cassette (kanR):FRT. The resulting PCR product,

gene':FRT:kanR:FRT:'gene, was electroporated into strain BW25113 containing plasmid pKD46

which encodes an arabinose inducible Red recombinase. Transformants harboring deletion of the

targeted gene were selected for kanamycin resistance located within the deleted gene. PCR was

used to confirm the deletion. P1 phage transduction was used to transfer the deleted gene to

other strains of interest. The kanamycin cassette was removed by transforming in a temperature

sensitive plasmid, pCP20, harboring yeast FLP recombinase gene leaving an 84 bp insert of a

single FRT sequence at the site of deletion.

Construction of Plasmid pET15b Based T7 Expression Plasmids

Protein over-expression was mediated by plasmid pET 15b based T7 expression system.

Primers were designed to PCR amplify the gene of interest with 5' extension of CATATG on the

forward primer and GGATCC on the reverse primer corresponding to the Ndel and BamHI

endonuclease recognition sites, respectively. The underlined ATG correspond to an overlapping

translation start initiation codon of the gene of interest. Xhol recognition sequence (CTCGAG)

was substituted for Ndel or BamHI site if these recognition sequences appeared within the gene









of interest (see Table 4-2 for complete list of primer sequences). PCR products and plasmid

pET15b (Novogen) were digested with the respective enzymes, ligated, and transformed into E.

coli strain TOP10. Transformants were selected as ampicillin resistant colonies. Plasmid was

extracted and the presence of insert was confirmed by PCR with gene specific primers. Plasmids

with appropriate insert DNA were transformed into Rosetta (XDE3) bearing plasmid pRARE

encoding rare E. coli codon tRNAs for recombinant expression of heterologous proteins in E.

coli. Proteins were expressed as N-terminal His6-thrombin recognition site protein fusions.

Protein Production Using pET15b Based T7 Expression

A few colonies of freshly transformed Rosetta strain bearing pET 15b derived plasmid were

inoculated into 20 ml of LB-amp (250 ml flask) and incubated at 37C (200 rpm) shaking for

about 15 hrs. Fifteen ml of this culture was transferred to 1.0 L LB-amp medium in a 2.8 L

Fernbach flask. This culture was incubated for 2 hrs at 37C (250 rpm) or until OD420nm reached

~ 0.60. Arabinose was added to a final concentration of 1.5 % and incubation was continued at

room temperature with the same shaking rate for an additional 4 hrs. Cells were harvested by

centrifugation and washed twice with 40 ml of cold 50 mM KPO4 buffer pH 7.5 with 0.1 M

NaCl (Buffer A). The cells were collected, and stored at -200C until use.

His-tagged Protein Purification

Frozen cells were thawed on ice in 10 ml of Buffer A. All purification steps were

performed at 40C or on ice. The cells were disrupted by passing through a French pressure cell

operating at 20,000 psi. 100 units of DNaseI was added to reduce viscosity and the lysate was

incubated on ice for 10 minutes. The lysate was centrifuged at 30,000 x g for 45 min. The

supernatant was filtered using a 0.2 |tm syringe filter. The filtered crude extract was then loaded

on a 1 ml HiTrap Chelating column (GE) (1 ml min'1 flow rate) that was pre-washed with Ni+2

(0.1 M NiC12 in Buffer A) followed by 20 volumes of Buffer A to remove excess nickel. The









protein-bound column was washed with 5 volumes of Buffer A followed by 10 volumes of

Buffer A with 50 mM imidazole. The His-tagged protein was eluted with Buffer A containing

150 mM imidazole at a flow rate of 0.5 ml min-1 and 1 ml fractions were collected. Fractions

with the highest protein concentration determined by Bradford assay (14) were separated by

sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) to determine purity.

Highest purity fractions were combined and digested with 50-100 units ofthrombin to remove

the His-tag while being dialyzed in 4 L Buffer A with 0.5 mM DTT for 16 hrs. The dialyzed

protein and thrombin mixture were separated on HiPrep 26/60 Sephacryl S-200 HR (GE) gel

filtration column (pre-equilibrated with Buffer A containing 0.5 mM DTT) with a flow rate of

0.5 ml min-1 and 3.75 ml fractions were collected. Fractions with the highest purity as

determined by SDS-PAGE were combined. Glycerol was added to the purified protein to a final

concentration of 20 %, flash frozen in liquid nitrogen, and stored at -750C until use.

Analytical Methods

Protein concentration was determined using Coomassie blue (Bradford reagent) or

bicinchoninic acid (BCA) assays (14, 34, 182) with bovine serum albumin as standard. SDS-

PAGE utilized 12.5 % gels as per Laemmli (118). The protein standards used in SDS-PAGE

(Bio-Rad Laboratories, Hercules, CA) were aprotinin (6.5 kDa), lysozyme (14.4 kDa), trypsin

inhibitor (21.5 kDa), carbonic anhydrase (31.0 kDa), ovalbumin (45.0 kDa), serum albumin

(66.2 kDa), phosphorylase b (97.4 kDa), P-galactosidase (116.3 kDa), and myosin (200 kDa).

Protein standards used to calibrate Hi Prep Sephacryl S-200 HR column used for gel filtration

(Sigma Chemical Co., St. Louis, MO) were bovine carbonic anhydrase (29.0 kDa), ovalbumin

(45.0 kDa), bovine serum albumin (66.0 kDa), and yeast alcohol dehydrogenase (150 kDa).

Non-heme iron was determined as described by Harvey et al. (89), and sulfur was determined

using the method described by Cline (45). Organic acids and sugars were analyzed by high-









performance liquid chromatography (HPLC, Hewlett Packard 1090 series II chromatograph

equipped with refractive index and UV detectors) with a Bio-Rad Aminex HPX-87H ion

exclusion column. Hydrogen gas was measured by gas chromatography (Gow Mac series 580,

GOW-MAC Instrument Co., Bethlehem, PA) using a thermal conductivity detector and a

stainless steel column (1.8 m x 3.2 mm) packed with molecular sieve 5 A, using N2 as the carrier

gas. Optical density of the cultures grown in 13 x 100 mm tubes were measured with a Bausch

& Lomb Spectronic 20 at 420 nm. Analytical spectrophotometric measurements were performed

in a Beckman DU 640 spectrophotometer.

Methods for Hydrogen Production

Construction of Tandem T7 Expression of ndhE and ndhF Subunits

T vaginalis ndhE and ndhF DNA were received from Dr. Hrdy at Charles University,

Czech Republic. T. vaginalis ndhE and ndhF were each cloned into pET 15b as previously

described producing pET15b-ndhE and pET15b-ndhF plasmids (Figure 4-1) (56). The entire T7

expression operon from pET15b-ndhF including T7 promoter and T7 terminator was PCR

amplified using primers "pET15b-T7 F (HindIII)" and "pET15b-T7 R (HindIII)" and the purified

PCR product was digested and cloned into the HindIII site on pET15b-ndhE (pPMD38)

producing pET15b-ndhE-ndhF (pPMD40). The resulting plasmid was digested with Xhol to

confirm the orientation of the insert. The plasmid pPMD40 has the two genes, ndhE and ndhF,

encoding the two subunits ofNDH expressed in tandem by independent T7 promoters.

Construction of Tandem trc Promoter Controlled Expression of ndhE and ndhF

T vaginalis ndhE and ndhF were cloned into plasmid pTrc99a as described above in the

construction of plasmid pPMD40 with independent T7 promoters. Genes encoding ndhE and

ndhF were independently cloned into the Ncol and BamHI sites in pTrc99a using PCR primers

"ndhE F (Ncol)" / "ndhE R (BamHI) and "ndhF F (Ncol)" / "ndhF R (BamHI)", respectively.









Using pTrc99a-ndhF as template, ndhF including the trc promoter was PCR amplified with

primers "pTrc99a F (Xbal-trc)" / "ndhF R (HindIII)" and the resulting product was cloned into

Xbal and HindIII site of pTrc99a-ndhE producing pTrc99a-ndhEF. Plasmid pTrc99a-ndhEF

harbors two independently expressed trc promoters and a rho-independent terminator (rrnB)

downstream of the last gene, ndhF.

NADH-Dehydrogenase (NDH) Enzymatic Activity

NDH activity was determined spectrophotometrically using NADH as the electron donor

and various artificial electron acceptors. Standard reaction mixture consisted ofK-phosphate

buffer (50 mM, pH 7.5), NADH (1 mM), and benzyl viologen (1 mM). Reaction mixture in a

13 x 100 mm tube was sealed with a serum stopper, and the gas phase was replaced by evacuation

and refill with N2. Enough sodium dithionite was added to the reaction mixture to titrate out the

residual 02. Reaction was initiated by the addition of enzyme, and BV reduction was monitored

continuously at 600 nm at room temperature. Although the small amount of added dithionite

will reduce both the Fe-S cluster and flavin in the protein, the presence of excess BV in the

reaction mixture is expected to reoxidize these cofactors and not interfere with the assay. Under

these conditions, the small amount of added dithionite did not affect the kinetics of BV

reduction. With ferricyanide as electron acceptor, assays were under aerobic condition.

Concentrations ofBV, methyl viologen, and K-ferricyanide were 1.00 mM in the experiments

leading to determination ofKm of NADH. Molar extinction coefficients used for BV and MV

are 7,800 and 6,300, respectively, at 600 nm with 1.00 cm path length. Ferricyanide-dependent

NDH activity was determined in the same buffer as the BV assay (410 nm; extinction coefficient

of 1,020 M-1 cm-1). Ferredoxin-dependent NDH activity was determined in the same buffer with

0.10 mM NADH and 40 tM C. acetobutylicum ferredoxin by following the oxidation of reduced

NADH at 340 nm. One unit of enzyme activity is defined as 1 [tmol substrate oxidized min1.









Clostridium Ferredoxin Purification

C. acetobutylicum strain 824 (NRRL B-23491) obtained from USDA-ARS (Peoria, IL)

was cultured in Reinforced Clostridial Medium (Oxoid, Cambridge, UK) without the agar in 12

L carboys for 16 hrs at 370C. Ferredoxin was isolated from the cells as described previously for

C. pasteurianum ferredoxin (167, 178). Protein concentration was determined from the molar

extinction coefficient of 30,600 cm-1 at 390 nm, a value reported for C. pasteurianum ferredoxin

(167).

(Electron Paramagnetic Resonance) EPR Measurements

EPR experiments were performed by Dr. Angerhofer, Department of Chemistry,

University of Florida. Cw-EPR spectra of the NDH complex at cryogenic temperatures were

determined using a commercial EPR spectrometer (Bruker Elexsys E580) equipped with an

Oxford Instruments ESR900 helium-flow cryostat and the standard TE102 mode rectangular

cavity (Bruker ER4102ST). EPR samples were placed in a Wilmad 3 x4 (IDxOD)-mm quartz

tubes (CFQ), prefrozen in liquid nitrogen, before insertion into the precooled cryostat.

Selection of Methyl Viologen (MV) Resistant E. coli

MV resistant E. coli was selected by serial transfers with increasing concentrations of MV.

Ten ml of LB supplemented with 10 atM MV in a 125 ml Erlenmeyer flask was inoculated with

1.0 % of an overnight culture of E. coli strain PMD45 grown in LB at 370C. The culture with

MV was incubated for 16 hrs at 370C with shaking (250 rpm). This culture was sequentially

transferred to 10 ml fresh LB medium with 100 atM MV at a 1.0 % inoculum level and each

transfer was incubated for 16 hrs. After which, it was used as an inoculum for 10 ml LB with 1.0

mM MV. As needed, a culture at an OD420nm of 0.6 was diluted and plated on LB agar plates

supplemented with 1.0 mM MV and incubated aerobically overnight at 370C. Colonies that

formed were selected, streaked on the same solid medium supplemented with glucose and were









incubated at 37C in an anaerobic jar. After 48 hrs, colonies that were resistant to 1 mM MV

under anaerobic growth conditions were replicated onto the same solid medium and incubated

aerobically for 8 hrs. Over 95 % of the colonies that were resistant to MV anaerobically were

killed by the switch to an oxygenic atmosphere. Colonies that survived were selected and

anaerobic/aerobic cycle was repeated two more times until a more stable E. coli strain was

recovered that was resistant to 1 mM MV and could survive the transition from anaerobic to

aerobic conditions.

Detection of Hydrogen Production

Overnight cultures were used as a 1.0 % inoculum for 1 ml LB with 0.3 % glucose

supplemented with the appropriate antibiotics and electron acceptors in a 12 x 75 mm heavy wall

tube sealed with a rubber stopper. Electron acceptors tested were 1.0 mM of each MV, BV, and

DCPIP. The tubes were degassed and filled with N2 and incubated at 370C. Hydrogen

production was determined after injecting 50 or 100 ul gas sample with a Hamilton gas tight

syringe into a gas chromatograph.

Electrochemical Potential

The electrochemical potential of a redox couple was calculated using the Nernst equation

(Equation 4-1):

S, RT [Oxidized]
E = Eo + RT In [Oxidized] (4-1)
nF I [Reduced]

Where E = concentration dependent redox potential (V); Eo' = midpoint standard redox potential

(V) (Table 4-3); R = 8.314 JK-1 mol-1 (ideal gas constant); T = temperature (K); F= 96,500

Coulombs mol-1 (Faraday constant); n = number of e. The Nernst equation has been simplified

by calculating the constants listed at standard temperature (298K) and converting natural log

(In) to logo as follows (Equation 4-2):











0.0592 V [Oxidized] (4-2)
E = Eo' + log ([Reduced]
n [Reduced]

Free energy was calculated using a derivation of Gibbs free energy (Equation 4-3):

AG = -nFAE (4-3)

Where AG is the change in free energy (J mol-1) and AE is the change in redox potential (Eproduct

- Ereactant; V). Joules can be converted to calories using the conversion factor 1 cal = 4.18 J.

Cloning of [Fe]-Hydrogenase Isolated from Termite Gut

[Fe]-hydrogenase genes from the symbionts present in the digestive tract of Reticulitermes

flavipes were received from Dr. Mike Scharf, Department of Entomology and Nematology,

University of Florida. The ORFs were fully sequenced and the putative gene was identified after

BLAST alignment as [Fe]-hydrogenases. Protein alignments were performed with ClustalG ver.

1.5. The gene encoding the [Fe]-hydrogenase most similar to the published enzyme from P.

grassii (99) was subcloned into pET15b and pTrc99a using PCR primers "gutHydF

(NdeI)"/"gutHyd R (BamHI)" and "gutHyd F (NcoI)"/"gutHyd R (BamHI)", respectively.

gutHyd including the trc promoter was subcloned into NdeI and PflMI sites of pTrc99a-ndhEF

using PCR primers "gutHyd trc F (Ndel)"/"gutHydR (PflMI)" resulting in plasmid pTrc99a-

ndhEF-gutHyd.

Methods for Butanol Production

Construction of Plasmid pET15b Derivatives for the Expression of Enzymes in the Butanol
Pathway

All butanol genes were amplified from C. acetobutylicum American Type Culture

Collection (ATCC) 824D genomic DNA obtained from ATCC using the respective PCR primers

listed in Table 4-2. The gene ccrA was PCR amplified from Streptomyces avermitilis ATCC









31267D-5 genomic DNA obtained from ATCC. Amplified PCR products were cloned into

plasmid pET15b for expression and purification of His-tagged fusion proteins. E. coli strain

Rosetta (XDE3) bearing the appropriate plasmid pET15b-derivatives were induced with

arabinose, and protein was purified as described in the section on NDH.

Enzyme Assays for Butanol Pathway

The enzymes that constitute the butanol pathway were produced in recombinant E. coli and

purified. Specific activities of these enzymes was determined spectrophotometrically using

NAD(P)H as the electron donor and the appropriate CoA derived intermediates or aldehydes as

acceptors. All assays were performed in 1 ml of 50 mM K-P04 buffer pH 7.5 and 0.1 mM

NAD(P)H at room temperature. Enzyme kinetics were determined by measuring NAD(P)H

oxidation (molar extinction coefficient of 6,220 M-1 cm-1 at 340 nm). Thiolase (0.5-1.0 pg of

ThlA or ThlB) activity was determined by using 0.1 mM acetyl-CoA as substrate in a coupled

reaction with NADH oxidation by Hbd (6kg) (217). Hbd (0.1-0.2 pg) activity was determined

using 0.2 mM acetoacetyl-CoA as substrate (32, 47, 229). Crt (2-5 ng) activity was determined

using 0.1 mM hydroxybutyryl-CoA as substrate in a coupled reaction with NADPH oxidation by

CcrA (2 pg) (32). Bcd-EtfBA (10 pg Bcd-complex) and CcrA (0.2-2.0 pg) activity were

determined by measuring oxidation of NADH or NADPH, respectively, using 0.1 mM crotonyl-

CoA as substrate. Aldehyde-alcohol dehydrogenase (10 pg of Aad or AdhE2) activity was

determined by measuring the oxidation of NADH using 0.1 mM butyryl-CoA and 2.5 mM

butyraldehyde, respectively (67, 144).

In Vitro Butanol Production

Based on the specific activates of the recombinant enzymes, 1 unit ([tmol min-) of each

purified enzyme in the butanol pathway from acetyl-CoA up to butyryl-CoA (ThlA, Hbd, Crt,

and CcrA) was added to 0.5 ml assay buffer containing a final concentration of 50 mM K-P04









pH 7.6, 5 mM acetyl-CoA, 10 mMNADH, and 10 mMNADPH. The reaction mixture was

incubated at 37C for 30 minutes after which a 100 il sample was removed for analysis. One

unit of AdhE2 and 10 mM NADH were then added and incubated for an additional 30 minutes at

37C. H2SO4 was added to final concentration of 0.1 M to stop the reaction and to hydrolyze the

CoA releasing free acids. The final mixture and the starting and intermediate sample were

analyzed by HPLC for butanol and other intermediates.

Enzyme Assay from Crude Extract

E. coli strain JM107 bearing the plasmid(s) pCBEHTCB and/or pAA were grown and the

enzymes were induced with IPTG as described above for T7-based expression of the same genes.

Induced cells were disrupted in the same manner as described for T7-based protein production.

The cell lysate was clarified by ultracentrifugation at 100,000 x g for 1 hr to minimize

membrane-bound NADH dehydrogenase activity. Enzyme assays were performed as described

above.

Plasmid Construction for Butanol Production

Construction of pButanol: Genes from C. acetobutylicum butanol production pathway

were cloned into plasmid pTrc99a (Figure 4-2). The BCS operon was PCR amplified using "crt

F (Ncol)" and "hbdR (BamHI)" primers producing PCR product that has a Ncol site extension

on the 5' and a BamHI site attached to the 3' end. The gene encoding AdhE2 was amplified with

"adhE2 F (BamHI)" and "adhE2 R (Xhol)" primers producing a PCR product that has a BamHI

site extension on the 5' and Xhol site attached to the 3' end. The adhE2 PCR product also

includes the native 18 bp region upstream of the gene that contains the Shine-Dalgarno (SD)

sequence. The gene encoding ThlA was amplified with "thlA SD F (Xhol)" and "thlA R

(HindIII)" producing a PCR product that has a Xhol site extended on the 5' and a HindIII site

attached to the 3' end. Since thlA does not have a good E. coli SD sequence immediately









upstream of the gene, a 16 bp region was added through primer "thlA SD F (Xhol)" that contains

an optimized E. coli SD sequence in addition to the Xhol site. The resulting PCR products were

digested with the respective enzymes and ligated all together into the Ncol and HindIII site of

pTrc99a resulting in the plasmid pButanol. Plasmid pButanol contains all the genes necessary

for production of butanol expressed as a single synthetic polycistronic operon controlled by

IPTG inducible trc promoter.

Construction of pButyrate: To construct a plasmid for the production ofbutyrate, adhE2

was removed from pButanol and replaced with a FRT:KanR:FRT cassette (Figure 4-3). Primers

"pKD4 F (BamHI)" and "pKD4 R (Xhol)" were used to PCR amplify the FRT:KanR:FRT

cassette with the addition ofBamHI and Xhol sites on the 5' and 3'ends, respectively. The

resulting PCR product was cloned into the BamHI and Xhol restriction sites of pButanol

replacing the adhE2 gene. The resulting plasmid, pButyrate, has the BCS operon expressed from

an IPTG inducible trc promoter. The thlA gene is still expected to be expressed by the plasmid

from the kanR cassette.

Construction of pTrc99a derived plasmids: The vector pTrc99a was used to express

various individual steps of butanol pathway (Figure 4-4) (6). The first gene, adhE2, was

amplified from pButanol with PCR primers "adhE2 F (Ncol)" and "adhE2 R (Xmal)" to produce

a PCR product with Ncol site on the 5' and Xmal sites on the 3', respectively. The adhE2 PCR

product was cloned into Ncol and Xmal site within the pTrc99a multiple cloning site resulting in

pTrc99a-adhE2. E. coli thiolase gene, atoB, was amplified from E. coli W3110 genomic DNA

with primers "atoB F (Kpnl)" and "atoB R (HindIII)" to produce a product that includes 11 bp

upstream of atoB containing its native SD sequence and KpnI and HindIII sites at the 5' and 3'

ends, respectively. This PCR product was cloned into KpnI and HindIII site in pTrc99a resulting









in pTrc99a-atoB. The plasmid pTrc99a-atoB was then used as template for PCR using "pTrc99a

F (Xmal)" and "atoB R (HindIII)" to amplify atoB with the trc promoter and Xmal and HindIII

sites at the 5' and 3' ends, respectively. The atoB with its own trc promoter was then cloned into

the Xmal and HindIII sites of pTrc99a to produce pAA, where both genes were expressed

independently by tandem trc promoters. The gene ccrA2 was PCR amplified from S. avermitilis

genomic DNA using primers "ccrA2 F (Ncol)" and "ccrA2 R (Xbal)" to produce a PCR product

with Ncol and Xbal sites at the 5' and 3' ends, respectively. E. coli soluble transhydrogenase

gene, udhA, was amplified from W3110 genomic DNA with primers "udhA F (Xbal)" and "udhA

R (HindIII)" to produce a PCR product with Xbal and HindIII sites at the 5' and 3' ends,

respectively. The primer "udhA F (Xbal)" also replaced udhA upstream region with a more

optimal SD sequence for improved translation. PCR products of ccrA2 and udhA were digested

with the respective endonucleases and were all ligated into Ncol and HindIII site of pTrc99a

resulting in pTrc99a-ccrA2-udhA plasmid where ccrA2 and udhA were expressed as a single

polycistronic synthetic operon.

Consolidation of pTrc99a derived plasmids into a single low copy number plasmid:

Large plasmids with high copy number replication systems tend to result in reduced plasmid

stability and/or retention. Therefore the trc operons constructed previously we cloned into a low

copy number plasmid vector (pACYC184) to improve stability (Figure 4-5). The BCS operon

including trc promoter from pButanol was amplified using "pTrc99a F (EagI)" and "hbdR

(BamHI)" primers and cloned into EagI and BamHI endonuclease restriction sites on

pACYC184, producing pCBEH. Using pTrc99a-ccrA2-udhA as template, PCR primers

"pTrc99a F (BamHI)" and "udhA R (Xbal)" were used to amplify the Ptrc-ccrA2-udhA operon

and the PCR product was cloned into BamHI and Xbal endonuclease sites on pCBEH to make









pCBEHCU. Using pTrc99a-AA as template, PCR primers "pTrc99a F (Bsu36I)" and "atoB R

(EagI)" were used to amplify the laclq-Ptc-adhE2-Ptrc-udhA operon and the PCR product was

cloned into Bsu36I and EagI endonuclease sites on pCBEHCU to make pAACBEHCU. The

plasmid pAACBEHCU contains all the genes required to produce butanol from acetyl-CoA on a

low-copy plasmid with pl5a origin of replication. Genes with lower specific activities (adhE2,

atoB, bcd/etfBA, and ccrA2) were expressed independently by individual trc promoters.

Another plasmid, pCBEHTCB, was constructed in a similar manner. A three gene

synthetic operon was constructed with thlA, ccrA, and bdhB. The three genes, thlA, ccrA, and

bdhB, were PCR amplified with primer sets "thlA F (Ncol)"/"thlA R (Xhol)", "ccrA F

(XhoI)"/"ccrA R (SexAI)", and "bdhB F (SexAI)/"bdhB R (Sbfl)", respectively. The resulting

PCR products were digested with their respective enzymes and ligated all together into the Ncol

and Sbfl site of plasmid pTrc99a resulting in plasmid pTCB in a similar manner as Figure 4-2.

The whole operon including the trc promoter was PCR amplified from plasmid pTCB using

primers "pTrc99a F (BamHI)"/"bdhB R (Clal)" and cloned into the BamHI and Clal restriction

sites of pCBEH resulting in pCBEHTCB.

E. coli Strain Construction for Butanol/Butyrate Production

Strain KJ104 (E. coli ATCC 8739 AldhA A(focA-pflB) AadhE AackA AmgsA ApoxB

AtdcDE AcitF), a microbial biocatalyst developed for succinate production (103), was used as

the starting strain for engineering a butanol-producing strain To eliminate succinate production,

a deletion infrdBC was introduced into strain KJ104 to disrupt fumarate reductase activity. The

resulting strain, PMD71, cannot grow anaerobically due to the inability to oxidize NADH

generated during glycolysis.

Integration of plasmid pAACBEHCU into E. coli chromosome: Even though the

butanol genes were on a low-copy plasmid, the large size (15,550 bp) and repeat trc promoter









sequences could lower plasmid stability. To stabilize the genes, the entire plasmid was

integrated into E. coli chromosome via single recombination. The plasmid pAACBEHCU was

digested with BstBI, which removed pl5a origin of replication and the chloramphenicol

resistance gene (Cm). The linearized DNA was then treated with Klenow fragment to fill in the

5' overhang left over from BstBI digestion to produce blunt ends. The spectinomycin resistance

gene (spcR) from pAW016 was PCR amplified using primers "spc F" and "spc R". The resulting

PCR product was ligated to the linearized pAACBEHCU to produce a circular DNA that has no

origin of replication. The resulting DNA was electroporated into BW25113/pKD46 expressing

red recombinase. Genomic DNA was extracted from colonies that were resistant to

spectinomycin (100 tg ml-1), and PCR was performed using genomic DNA as template and

appropriate primers to confirm the integration ofadhE2-atoB, crt-hbd, and ccrA2-udhA. PCR

using primers "adhE-atoB F" and "adhE-atoB R", "crt-hbdF" and "crt-hbdR", and "ccrA2-

udhA F" and "ccrA2-udhA R" produced fragments of 3,487 bp, 4,042 bp, and 2,195 bp

respectively, confirming the presence of the butanol genes in the chromosome. The colony with

all three correct size PCR products was noted to have chromosomal insertion of pAACBEHCU

(but+) and the genes were transduced to strain PMD50 and PMD71 resulting in PMD70 and

PMD72, respectively. The site for chromosomal integration is yet to be determined; however,

possible recombination sites were atoB, udhA, and lacF since these E. coli genes were present in

the circular DNA used for integration.

Chromosomal insertion of BCS operon atpflB: PCR using primers "focA F (HindIII)"

and "pflA R (Xmal)" were used to amplify pflB including 389 bp and 643 bp upstream and

downstream DNA, respectively, with the addition of HindIII and Xmal sites to the primers

(Figure 4-6). The 3.4kb PCR product was cloned into HindIII and Xmal sites of pUC19. The









resulting plasmid, pUC19-'focA-pflA', was used as template for outward PCR using primers

"focA out (Blunt)" and "pflA out (Xhol)" producing a 3704 bp PCR product with a blunt 3' end

near the end offocA and Xhol site at the 3' end near the start ofpflA. Primers labeled with

"Blunt" had a 5' phosphorylation modification during synthesis. At the same time, pButyrate

was used as template for PCR using primers "crt F (Blunt)" and "pKD4 R (Xhol)" to produce a

6214 bp PCR product of the promoterless BCS operon upstream of a kanamycin cassette. The

two PCR products, BCS-kan and pUC19-'focA-pflA' outward PCR, were then digested with

Xhol and ligated together to produce the final plasmid pUC19-ApflB-BCS-kanR. Plasmid

pUC19-ApflB-BCS-kanR was then doubly digested with Nrul and Acc65I producing 7171 bp and

2729 bp DNA fragments. The larger fragment was gel purified with Qiagen Gel Extraction Kit

and the purified DNA was electroporated into BW25113/pKD46 as described in Datsenko et al.

(51). The digested DNA fragment had 312 bp and 643 bp region of homology to the upstream

and downstream regions ofpflB respectively. Colonies that were resistant to kanamycin were

selected and grown anaerobically for 24 hrs at 37C. HPLC was used to analyze fermentation

products. Cultures with lactate as a major fermentation product with little or no format, acetate

and ethanol were noted to have a BCS operon replacingpflB. The ATG start codon of the first

gene, crt, replaced the ATG ofpflB; thus the BCS operon should now be transcriptionally

regulated by all ofpflB's seven promoters (173). Genomic DNA was extracted and PCR was

performed with primers "crt-hbd F" and "crt-hbd R" (4042 bp) to confirm chromosomal

insertion. P1 phage was used to transfer ApflB-BCS-kanR to strain PMD72 resulting in strain

PMD74.

Production of butyrate: PCR was performed using pKD4 as template and "spc-adhE2 F

(pKD4 F)" and "spc-adhE2 R (pKD4 R)" primers to amplify FRT:KanR:FRT cassette with 50 bp









up and downstream homologous to 5' of spcR gene and 3' ofadhE2. E. coli strain

PMD52/pKD46 was electroporated with the derived linear PCR product and transformants were

selected for kanamycin resistance and spectinomycin sensitivity. The resulting strain, PMD75,

had a A (adhE2-spcR) mutation.

Integration of an additional copy of C. acetobutylicum bcd-etfBA replacing E. coli

adhE: An additional copy of bcd/etBA was used to replace E. coli adhE in a similar manner as

the BCS operon integration replacingpflB. E. coli adhE was PCR amplified from W3110

genomic DNA using "adhE F (Sbfl)" and "adhE R (Xmal)" primers including 279 bp and 239

bp upstream and downstream of adhE, respectively. This DNA was cloned into Sbfl and Xmal

sites ofpUC19. At the same time, the FRT:KanR:FRT cassette was also amplified from plasmid

pKD4 with "pKD4 F (BamHI)" and "pKD4 R (Xhol)". This PCR product was digested with

only BamHI leaving the 3' end undigested (blunt) and was cloned into BamHI and Scal (blunt)

restriction sites on pTrc99a-bcd-etfBA introducing a kanamycin resistance cassette directly

downstream of the bcd-etBA operon. The bcd-etfBA-kanR operon was amplified using "bcd-

etfBA-kan F homologyy)" and "bcd-etBA-kan R homologyy)" primers. Using pUC19-adhE as

template, "pUC19-adhE F OUT" and "pUC19-adhE R OUT" primers, which bind directly

upstream and downstream, respectively, of adhE were used to amplify outward away from adhE.

These primers also include 20 bases 5' extensions of sequences homologous to "bcd-etBA-kan F

homologyy)" and "bcd-et/BA-kan R homologyy)" for homologues recombination cloning by

CloneEZTM Kit (GenScript Corp) for seamless cloning without restriction enzyme and ligation.

Cloning was performed as described by GenScript Corp. The resulting plasmid, pUC19-AadhE-

bcd-etfBA-kanR, had bcd-etfBA-kanR flanked by 279 bp and 239 bp E. coli adhE up and

downstream regions, respectively. The plasmid pUC19-AadhE-bcd-et/BA-kanR was then









digested with Sbfl and Xmal and the purified product was used for double recombination cross-

over in BW25113/pKD46 expressing red recombinase. Colonies that were resistant to

kanamycin were grown anaerobically in liquid media and were tested by HPLC for ethanol

production deficient phenotype. P1 transduction was used to transfer AadhE-bcd-etfBA-kanR into

strain PMD75 resulting in strain PMD76.









Table 4-1. Bacterial strains, bacteriophages, and plasmids
Strains Genotype


W3110
TOP10

JM107

JM109

BL21 (XDE3)
JM109 (XDE3)
Rosetta (XDE3)
PMD40
PMD42
PMD43
PMD44
PMD45
PMD46
PMD47
PMD48
PMD50
PMD51
PMD52
PMD53
PMD54
KJ104

PMD70
PMD71


Wild-type
F- mcrA A(mrr-hsdRMAS-mcrBC) 4801acZAM15 AlacX74 recAl araA139 A
(ara-leu) 7697 galU galK rpsL (StrR) endA nupG
endAl glnV44 thi-1 relA1 gyrA96 A(lac-proAB) [F' traD36proAB+ lacfl
lacZAM15] hsdR17(RK mK+) X
endAl glnV44 thi-1 relAl gyrA96 recAl mcrB+ A(lac-proAB) el4- [F'
traD36proAB+ lacf lacZAM15] hsdR17(rKmK+)
F ompTgal dcm Ion hsdSB(rB mB-) X(DE3 [acI /acUV5 -T7 gene 1 indl
sam7 nin5])
JM109 X(DE3 [/acllacUV5-T7 gene 1 indl sam7 nin5])
BL21 (XDE3) / pRARE
W3110 AldhA
W3110 AldhA A(focA-pflB)
W3110 AldhA AadhE
W3110 AldhA AadhE AfrdBC
W3110 AldhA AadhE AfrdBC AmgsA
W3110 AldhA A(focA-pflB) lpd]O *
W3110 AldhA A(focA-pflB) lpdOl AmgsA
W3110 AldhA A(focA-pflB) lpd]Ol* AmgsA AtcdE
JM107 AldhA
JM107 AldhA A(focA-pflB)
JM107 AldhA A(focA-pflB) 1pd]O *
JM107 AldhA A(focA-pflB) 1pdO1 AtcdE
JM107 AldhA A(focA-pflB) 1pdO1 AadhE
E. coli ATCC 8739 AldhA A (focA-pflB) AadhE AackA AmgsA ApoxB
AtdcDE AcitF
JM107 AldhA but+ [spcR-Ptrc-adhE2-Ptrc-atoB-Ptr-crt-bcd-etfBA-hbd-Ptrc-
ccrA-udhA]
KJ104 AfrdBC


ATCC
Invitrogen

Lab collection

NEB

Lab collection
Lab collection
Novagen

Anaerobic (-)
Anaerobic (-)
PMD43 AfrdBC
PMD44 AmgsA
PMD42 IpdJO1*
PMD46 AmgsA
PMD47 AtcdE
This study
Anaerobic (-)

Anaerobic (-)
Anaerobic (-)
(103) Succinate strain

PMD50 but+


Notes









Table 4-1. Continued
Strains Genotype Notes
PMD72 KJ104 AfrdBC but [spcR-Ptrc-adhE2-Ptrc-atoB-Ptc-crt-bcd-etfBA-hbd-Ptc- PMD71 but+
ccrA-udhA]
PMD73 JM107 AldhA but ApflB-crt-bcd-etfB-etfA-hbd PMD70 ApflB-BCS
PMD74 KJ 104 AfrdBC but+ ApflB-crt-bcd-etfB-etfA-hbd PMD72 ApflB-BCS
PMD75 KJ104 AfrdBC but+[AadhE2-spcR] ApflB-crt-bcd-etfB-etfA-hbd Butyrate strain
PMD76 KJ104 AfrdBC but+[AadhE2-spcR] ApflB-crt-bcd-etB-etfA-hbd AadhE-bcd- PMD75 AadhE-bcd-
etfB-etfA etB-etfA
Bacteriophages Genotype Notes
P1 clrlOO dam rev6
Plasmid Genotype Notesa
DUC19 bla


pET 15b
pTrc99a
pPMD38
pPMD39
pPMD40
pTrc99a-ndhEF
pET 15b-gutHyd

pTrc99a-gutHyd
pTrc99a-ndhEF-gutHyd
pET15b-adhE2
pET 15b-aad
pET 15b-thlA
pET 15b-thlB
pET 15b-hbd
pET 15b-crt
pET 15b-bcd-etfBA
pET 15b-bcd
pET15b-etfB


PT7
Ptrc
pET 15b-ndhE (PT7-ndhE)
pET 15b-ndhF (PT7-ndhF)
pET 1 5b-ndhEF (PT7-ndhE PT7-ndhF)
Ptrc-ndhE Ptrc-ndhF
PT7-gutHyd

Ptrc-gutHyd
Ptc-ndhE Ptrc-ndhF Prc-gutHyd
PT7-adhE2
PT7-aad
PT7-thlA
PT7-thlB
PT7-hbd
PT7-crt
PT7-bcd-etfBA
PT7-bcd
PT7-etfB


Novagen
Lab collection
from T vaginalis
from T vaginalis
Figure 4-1
This study
Symbiont [Fe]-
hydrogenase
This study
This study
C. acetobutylicum
C. acetobutylicum
C. acetobutylicum
C. acetobutylicum
C. acetobutylicum
C. acetobutylicum
C. acetobutylicum
C. acetobutylicum
C. acetobutylicum









Table 4-1. Continued
Plasmid
pET15b-etfA
pET15b-etfBA
pET 15b-ccrA
pET 15b-ccrA2
pET 1b-bdhA
pET 15b-bdhB
pButanol
pButyrate


Genotype
PT7-etfA
PT7-etfBA
PT7-ccrA
PT7-ccrA2
PT7-bdhA
PT7-bdhB
Ptrc-crt-bcd-etfB-etfA-hbd-adhE2-thlA
Ptrc-crt-bcd-etfB-etfA-hbd-FRT :KanR: FRT-thlA


pTrc99a-adhE2 Ptrc-adhE2
pTrc99a-atoB Pt,- atoB
pTrc99a-ccrA-udhA Ptrc-ccrA-udhA
pAA Ptrc-adhE2 Ptrc-atoB
pCBEH Ptrc-crt-bcd-etfB-etfA-hbd
pCBEHCU Ptrc-crt-bcd-etfB-etfA-hbd Ptrc-ccrA-udhA
pCBEHTCB Ptrc-crt-bcd-etfB-etfA-hbd Ptrc-thlA-ccrA-bdhB
pAACBEHCU Ptrc-adhE2 Ptrc-atoB Ptrc-crt-bcd-etfB-etfA-hbd Ptrc-ccrA-udhA
pUC19-'focA-pflA' 'focA-pflB-pflA'
pUC19-ApflB-BCS-kanR focA-crt-bcd-etfB-etfA-hbd-pflA'
pUC 19-adhE adhE+
pUC 19-AadhE-bcd- AadhE-bcd-et/BA-kanR
et/BA-kanR
aThe name of the organism in the Notes column indicates the source of the cloned DNA.


Notes
C. acetobutylicum
C. acetobutylicum
S. avermitilis
S. avermitilis
C. acetobutylicum
C. acetobutylicum
Figure 4-2
Figure 4-3
Figure 4-4
Figure 4-4
Figure 4-4
Figure 4-4
Figure 4-5
Figure 4-5

Figure 4-5
Figure 4-6
Figure 4-6









Table 4-2. List of PCR primers used in this study.
Primer Name Vector/Note
ndhE F (XhoI) pET15b
ndhE R (BamHI) pET 15b
ndhFF (Xhol) pET15b
ndhF R (BamHI) pET 15b


pET15b-T7 F (HindIII)
pET15b-T7 R (HindIII)
ndhE F (NcoI)

ndhE R (BamHI)
ndhFF (Ncol)

ndhF R (BamHI)

pTrc99a F (Xbal-trc)
ndhF R (HindIII)
gutHyd F (Ndel)
gutHyd F (NcoI)
gutHyd R (BamHI)
gutHyd trc F (Ndel)
gutHyd R (PflMI)

adhE2 F (Xhol)
adhE2 R (BamHI)
adhE2 F (Ndel)
adhE2 R (Xhol)
thlA F (Xhol)
thlA R (BamHI)


pET 15b-ndhF
pET 15b-ndhF
pTrc99a

pTrc99a
pTrc99a

pTrc99a

pTrc99a-ndhF
pTrc99a-ndhF
pET15b
pTrc99a
pET15b, pTrc99a
pTrc99a-ndhEF
pTrc99a-ndhEF

pET15B
pET15B
pET15B
pET15B
pET15B
pET15B


Primer Sequence
GGAGCCTCGAGATGAACAAGAAGTCTGTTCT
CGGCGGATCCTTATGGGAGTGGTCTTGGTG
GCCGCTCGAGATGCAGACAAAATTCCTTGA
CGGCGATATCGGATCCTTACTCAGCGACGCAAGCC
T
CGGCAAGCTTCCACGATGCGTCCGGCGTAG
GCCGAAGCTTTTGGTTATGCCGGTACTGCC
GCGACCATGGAGAAGGAGATAT ACCATGAACAAG
AAGTCTGTTCT
CGGCGGATCCTTATGGGAGTGGTCTTGGTG
GCGACCATGGAGAAGGAGATATACCATGCAGACA
AAATTCCTTGA
CGGCGATATCGGATCCTTACTCAGCGACGCAAGCC
T
CGGCGTCTAGACGACTGCACGGTGCACCAATG
CGCCGAAGCTTTTACTCAGCGACGCAAGCCT
GCAATAACATATGAAAATTGATTCTTCTTCGTT
GCAATAACCATGGAAATTGATTCTTCTTCGTTTT
GCAATAAGGATCCTTACTTGGTCTTTCGATTCG
GCAATAACATATGCGACTGCACGGTGCACCAAT
GCAATAACCATTCGATGGTTACTTGGTCTTTCGATT
CG
GCAACTCGAGATGAAAGTTACAAATCAAAA
GCAAGGATCCTTAAAATGATTTTATATAGA
GCAACATATGAAAGTCACAACAGTAAA
GCAACTCGAGGAAGGTTTAAGGTTGTTTTT
GCAACTCGAGATGAAAGAAGTTGTAATAGC
GCAAGGATCCCTAGCACTTTTCTAGCAATA









Table 4-2. Continued
Primer Name
thlB F (Xhol)
thlB R (BamHI)
hbd F (XhoI)
hbd R (BamHI)
crt F (XhoI)
crt R (BamHI)
Bcd-etfBA F (Xhol)
Bcd-etfBA R (BamHI)
Bcd R (BamHI)
EtfB F (Xhol)
EtfB R (BamHI)
EtfA F (Xhol)
ccrA1 F (Ndel)
ccrA1 R (BamHI)
ccrA2 F (Ndel)
ccrA2 R (BamHI)
bdhA F (Xhol)
bdhA R (BamHI)
bdhB F (Xhol)
bdhB R (BamHI)
crt F (Ncol)
hbd R (BamHI)
adhE2 F (BamHI)
adhE2 R (Xhol)
thlA SD F (Xhol)
thlA R (HindIII)
pKD4 F (BamHI)
pKD4 R (Xhol)


Vector/Note
pET15B
pET15B
pET15B
pET15B; pCBEH
pET15B
pET15B
pET15B
pET15B
pET15B
pET15B
pET15B
pET15B
pET15B
pET15B
pET15B
pET15B
pET15B
pET15B
pET15B
pET15B
pButanol
pButanol
pButanol
pButanol
pButanol
pButanol
pButyrate
pButyrate; pUC19-ApflB-BCS-Kan


Primer Sequence
GCAACTCGAGATGAGAGATGTAGTAATAGT
GCAAGGATCCTTAGTCTCTTTCAACTACGA
GCAACTCGAGATGAAAAAGGTATGTGTTAT
GCAAGGATCCTTATTTTGAATAATCGTAGA
GCAACTCGAGATGGAACTAAACAATGTCAT
GCAAGGATCCCTATCTATTTTTGAAGCCTT
GCAACTCGAGATGGATTTTAATTTAACAAG
GCAAGGATCCTTAATTATTAGCAGCTTTAA
GCAAGGATCCTTATCTAAAAATTTTTCCTG
GCAACTCGAGATGAATATAGTTGTTTGTTT
GCAAGGATCCTTAAATATAGTGTTCTTCTT
GCAACTCGAGATGAATAAAGCAGATTACAA
GCAACATATGAAGGAAATCCTGGACGC
GCAAGGATCCTCAGATGTTCCGGAAGCGGT
GCAACATATGAAGGAAATCCTGGACGC
GCAAGGATCCTCAGATGTTCCGGAAGCGGT
GCAACTCGAGATGCTAAGTTTTGATTATTC
GCAAGGATCCTTAATAAGATTTTTTAAATA
GCAACTCGAGGTGGTTGATTTCGAATATTC
GCAAGGATCCTTACACAGATTTTTTGAATA
GATTAGCCATGGAACTAAACAATGTCAT
CGAATGGATCCTTATTTTGAATAATCGTAGA
TGCATTGGATCCATAAAGGAGTGTATATAAATG
GGAAGTCTCGAGTTAAAATGATTTTATATAGA
GGAAGTCTCGAGTAGGAGGAGTAAAACATGAG
ATTGGTAAGCTTTTAGTCTCTTTCAACTACGA
GCAATAGGATCCGTGTAGGCTGGAGCTGCTTC
GCAATACTCGAGCATATGAATATCCTCCTTAG









Table 4-2. Continued
Primer Name
focA F (HindIII)

pflA R (Xmal)
focA out (Blunt)
pflA out (Xhol)

crt F (Blunt)
crt-hbd F
crt-hbd R
adhE2-atoB F
adhE2-atoB R
ccrA2-udhA F
ccrA2-udhA R
adhE2 F (Ncol)
adhE2 R (Xmal)
atoB F (Kpnl)

atoB R (HindIII)
pTrc99a F (Xmal)
ccrA2 F (Ncol)
ccrA2 R (Xbal)
udhA F (Xbal)

udhA R (HindIII)
pTrc99a F (EagI)
hbd R (BamHI)
pTrc99a F (BamHI)
udhA R (Xbal)


Vector/Note
pUC19

pUC19
pUC 19-ApflB-BCS-Kan
pUC 19-ApflB-BCS-Kan

pUC 19-ApflB-BCS-Kan
confirmation of gene insertion
confirmation of gene insertion
confirmation of gene insertion
confirmation of gene insertion
confirmation of gene insertion
confirmation of gene insertion
pTrc99a-adhE2
pTrc99a-adhE2
pTrc99a-atoB

pTrc99a-atoB; pTrc99a-adhE2-atoB
pTrc99a-adhE2-atoB
pTrc99a-ccrA-udhA
pTrc99a-ccrA-udhA
pTrc99a-ccrA-udhA

pTrc99a-ccrA-udhA
pCBEH
pET15b; pCBEH
pCBEHCU; pCBEHTCB
pCBEHCU


Primer Sequence
GCAATAAAGC T T GGTATGT C T GGCAGTATGGATGA
GTTATT
GCAATAACC CGGGCAGCGTGCGGTGGTTGGAAA
GTAACACCTACCTTCTTAAGTGGATTT
GCAATACTCGAGTTAGATTTGACTGAAATCGTACA
GTA
ATGGAACTAAACAATGTCATCCTT
GCAACGCAAGATTTGGTCAA
GGTGCTTCTGCTACTTCTACA
TGAGCCATCAATAGAACTTT
TGCCAGCCCCAGCGTTTTAT
CAAGGACGAGACGGAGATGTT
TGTGGCTGTGCGGTCTGATA
GCAAATGCCATGGAAGTTACAAATCAAAAAGAA
GCAATACC CGGGTTAAAATGATTTTATATAGA
GCAAAGGTACCTAAGAGGAGGAATATAAAATGAA
AAATTGT
GCAAAAAGCTTTTAATTCAACCGTTCAATCA
GCAATACCCGGGCGACTGCACGGTGCACCAATG
GCAATCCATGGAGGAAATCCTGGACGCGATT
GCAATTCTAGATCAGATGTTCCGGAAGCGGT
GCAATTCTAGAAATAATTTTGTTTAACTTTAAGAAG
GAGATATACCATGCCACATTCCTACGATTA
GCAATAAGCTTTTAAAACAGGCGGTTTAAAC
GAATAGCGGCCGCGACTGCACGGTGCACCAAT
GCAAGGATCCTTATTTTGAATAATCGTAGA
GCAATGGATCCCGACTGCACGGTGCACCAAT
GCAACTCTAGATTAAAACAGGCGGTTTAAACCGT









Table 4-2. Continued
Primer Name
thlA F (Ncol)
thlA R (Xhol)
ccrA F (Xhol)

ccrA R (SexAl)
bdhB F (SexAl)

bdhB R (Sbfl)
bdhB R (Clal)
spc F
spc R
adhE F (Sbfl)

adhE R (XmaI)
pUC 19-adhE F OUT

pUC19-adhER OUT

bcd-etfBA-kan R
homologyy)
bcd-etfBA-kan F
homologyy)
spc-adhE2 F (pKD4 F)


Vector/Note
pTCB
pTCB
pTCB

pTCB
pTCB

pTCB
pCBEHTCB
spectinomycin cassette
spectinomycin cassette
pUC19

pUC19
pUC 19-adhE

pUC 19-adhE

pTrc99a-bcd-etfBA

pTrc99a-bcd-etfBA

pKD4


Primer Sequence
GCAACCATGGAAGAAGTTGTAATAGCTAGT
GCAACTCGAGCTAGCACTTTTCTAGCAATA
GCAACTCGAGAGAGGA GGCAAACCATGAAGGAAA
TCCTGGACGC
GCAAACCTGGTTCAGATGTTCCGGAAGCGGT
GCAAAACCAGGTTATTAAGGAGGA AGAAATATAT
GGTTGATTTCGAATATTCAATACC
GCAATGCCTGCAGGTTACACAGATTTTTTGAATA
GCAATCATCGATTTACACAGATTTTTTGAATA
CTTTTCTACGGGGTCTGACGCT
GCAAGGAACAATTTCTTTCTATTTTC
GCAATACCTGCAGGTGGCGAAAAGCGATGCTGAA
A
GCAATACCCGGGAGCGTCAGGCAGTGTTGTATCC
CTTGTTAAATTAAAATCCATAATGCTCTCCTGATAA
TGTT
AAGGAGGATATTCATATGCTTCAGTAGCGCTGTCT
GGCAA
ATGGATTTTAATTTAACAAG

AGCATATGAATATCCTCCTT

ATGACCAATTTGATTAACGGAAAAATACCAAATCA
AGCGATTCAAACATTAGTGTAGGCTGGAGCTGCTT


spc-adhE2 R (pKD4 R) pKD4 TTAAAATGATTTTATATAGATATCCTTAAGTTCACT
TATAAGTGGATACCTCATATGAATATCCTCCTTAGT
Primers were listed with the respective plasmid vector the PCR product was cloned into unless otherwise noted. The underlined
sequences represent the endonuclease recognition site indicated by the primer name. Bold sequence represents the ATG translation
start site. Italicized sequences represent the Shine-Dalgarno sequence.









Table 4-3. Standard redox potential of electron donor / electron
Redox Couple Eo' (V)
MVox / MVred -0.440
Flavodoxinox / Flavodoxinred (A. fermentans) -0.430
CO2 / Formate -0.420
H+ / H2 -0.420
Ferredoxinox / Ferredoxinred (C. pasteurianum) -0.398
N aox / N armed (T thermophilus NDH) -0.370
BVox / BVred -0.360
Ferredoxinox / Ferredoxinred (T vaginalis) -0.347
NADP /NADPH -0.324
NAD / NADH -0.320
Crotonyl-CoA / Butyryl-CoA -0.010
Methylene Blueox/ Methylene Bluered +0.011
DCPIPox / DCPIPred +0.217
Fe(CN)6-3 / Fe(CN)6-4 +0.360
02 / H20 +0.816


acceptor couple
Reference
(128)
(83, 121, 124, 224)
(128)
(128)
(196)
(175)
(128)
(205,206)
(128)
(128)
(128)
(128)
(128)
(128)
(128)









Xhol


BamHI


ndhE


Hindll
, Xhol


pPMD40

7924 bps


STT. /- BamHI


o rio la Hindll



Figure 4-1. T. vaginalis NDH T7 expression plasmid.










Ncol <--- ......


A.


pTrc99a
-l" 4176 bps


" Ncol BamHI

crt bcd en effA hb ;
BamHl .."Xhol

adhE2
..... .....................
X io l *.*
k J i Hindill
thlA :


Ncol


Hindill


Figure 4-2. Construction ofpButanol. A) PCR products used to clone C. acetobutylicum BCS
operon. B) pButanol. pButanol contains all the genes necessary for production of
butanol from acetyl-CoA expressed as a single synthetic polycistronic operon
controlled by an IPTG inducible trc promoter.













/ V Iac9f" ct Digested with /
oR \cd Xhol/BamHI
oriR \ and Ligated orR
the Two 'io
3 eBa \Fragments
bap l 'B Fragments pButyrate eS
bla D p blae
12642 bps e 11524 bps
rrnlB Mo e\A I a
\rrnB et



thladh Kan" A
Xhol BamHI FR
Xhol BamHI
Xhol BamHI

FRT Kan" FRT

Figure 4-3. Construction of pButyrate. PCR was used to amplify the FRT:KanR:FRT cassette
from pKD4 with the addition of BamHI and Xhol endonuclease site on the 5' and 3',
respectively. The resulting PCR product was cloned into BamHI and Xhol restriction
sites of pButanol replacing the adhE2 gene. The resulting plasmid, pButyrate, has the
genes necessary to produce up to butyryl-CoA from acetyl-CoA controlled by an
IPTG inducible trc promoter.










Ncol
Kpnl
P Xmal
S Hindll





1 Digested with / p =
PCR Product Ncol/Xmal
r* aa i*_ pTrc99a-atoB
oriR c34 bps E
aanc


Hindlll Xmal in

Xmal ~ pnl
Digested with i
PCR Product Kpnl/Hindilll n
arA2 n and Lgated a
KpnI Hindll pTrc99a-catod ba




Xbal Hin"I X ba
a 6902 bps
Hinddlll



PCR Products col
Ncol Xbal Digested with
vI I* Ncol/Xbal/Hindlll Iwo
ccrA2 and Ligated ccrA2
X ..***' Hind *. ii pTrc99a-ccrA2-udhA
X b Ak HindIII M. bps
orIR

HudtAd

Hindlll


rXrial Hindll
-R I ,I
#V cP atoB


Figure 4-4. Construction ofpTrc99a derived plasmids. C. acetobutylicum adhE2, E. coli atoB,
S. avermitilis ccrA2, and E. coli udhA were cloned into plasmid pTrc99a and
expressed from an IPTG inducible trc promoter. Clostridial adhE was cloned into
Ncol and Xmal sites ofpTrc99a producing pTrc99a-adhE2. E. coli atoB was cloned
into the KpnI and HindIII sites to pTrc99a resulting in pTrc99a-atoB. Using
pTrc99a-atoB as template, PCR was used to amplify atoB including the entire trc
promoter with Xmal and HindIII on the 5' and 3', respectively. This PCR product
was then cloned into Xmal and HindIII site of pTrc99a-adhE2 producing pAA. The
plasmid pAA contains adhE and atoB which are both independently expressed by
tandem trc promoters. S. avermitilis ccrA2, and E. coli udhA were PCR amplified
with addition of Ncol and Xbal, and Xbal and HindIII restriction sites respectively.
The PCR products were digested with the respective endonucleases and cloned into
Ncol and HindIII sites of pTrc99a resulting in pTrc99a-ccrA2-udhA which expressed
both genes as a single synthetic operon controlled by trc promoter.













pACYC184
4245bps pli3

\ /

Digested with Eagi BamHI
Eagl/Bam HI
ac ct PCR Adding and Ligated
oriR bcd Eagi and BamHI
SpButanol e Site EagI Bam I
6'1 12642bps I d I -
rr"B / P. cr, x'd &MBS ea nW Eagl w / m
*tB Ofti Eagi Cm Pita
pCBEH


face
P ccrA2\
"A 2
Trc99a-ccrA2-udh
oriR 6902 bps
OnmR


PCR Adding
BamHI and Xbal
Sites
BamHI Xbal

S ccrA2 udhA


Digested v
BamHI/Xb
and Ligat


ith \ d e4fA
ial erf
ed


PCR Adding
Bsu361 and Eagl
Sites
Bsu361

-- > e L


P, adhE2


Figure 4-5. Consolidation of butanol pathway genes into a single low-copy vector pACYC184.
The BCS operon including trc promoter from pButanol was cloned into EagI and
BamHI endonuclease restriction sites on pACYC184 producing pCBEH. Using
pTrc99a-ccrA2-udhA as template, the Ptc-ccrA2-udhA operon was PCR amplified
with the addition of BamHI and Xbal restriction sites and was cloned into the
respective endonuclease sites on pCBEH to make pCBEHCU. Using pTrc99a-
AA as template, the laclq- Ptrc -adhE2- Pt, -udhA PCR product with Bsu36I and
EagI sites was cloned into the respective endonuclease sites on pCBEHCU to
make the final resulting plasmid pAACBEHCU.


Xbal
ramHI


--












Xmal

/KZ ^\ Hindill bii 'fa S UC19 Digested with Xhol
2688 bps Xmal/Hindll pU 9- fl' PR Outward PCR

ancA pfiLig p pUC9flA'-' PCR
5975 bps

XmaI Hindll Wfl A

Y*ocA ple Blunt End
Digested
with Xhol
Blunt End and Ugated Nu


bcd
onR d bla c
PCR L" d ba
S 11524 bpsB n pUC19-pfllB::BCS-KmR
6214 bps
ern ef 9900 bps eits


K/an Acc651 eVA

Xhol Xhol K

Digested with Nrul/Acc651


VocA crt cd et/ effA h FRT Kan FIRT A
Nrul _Acc651


focA pflB pA
SDouble Recombination

FRT FRT
focA crt bcd eiB efA hft Kan pflA


Figure 4-6. Chromosomal insertion of C. acetobutylicum BCS operon replacing E. colipflB. E.
colipflB including 389 bp and 643 bp upstream and downstream, respectively, was
PCR amplified with the addition ofHindIII and Xmal restriction sites and was cloned
into the respective sites within pUC19. The resulting plasmid, pUC19-'focA-pflA',
was used as template for outward PCR amplifying everything exceptpflB with an
addition of XhoI site near the 5' ofpflA. PCR was used to amplify the BCS operon
and a kanamycin gene cassette from pButyrate with the addition of XhoI site at the 3'
end. The two PCR products were ligated together resulting in pUC19-ApflB-BCS-
kanR. The plasmid, pUC19-ApflB-BC S-kanR, was then digested with Nrul and
Acc65I and the larger DNA fragment (7171 bp) with 312 bp and 643 bp region of
homology to the upstream and downstream regions ofpflB respectively was used to
electroplorate into BW25113/pKD46 bearing red recombinase. Kanamycin was used
to select for double recombination replacingpflB with the entire BCS operon which is
now transcriptionally regulated bypflB seven promoters (P) upstream of crt.









CHAPTER 5
RESULTS AND DISCUSSION

Biochemical Characterization of Recombinant NADH-Ferredoxin Oxidoreductase (NFOR;
NDH) from Trichomonas vaginalis'

Expression and Purification of NDH

Converting all the energy in glucose to H2 as a potential fuel using biological systems

requires that the energy stored in NADH that is produced during oxidation of glucose carbon to

CO2 be transferred to an appropriate electron carriers such as ferredoxin that can support

hydrogenase activity. There are two known NADH-dependent ferredoxin reductases, an NFOR

from the hydrogenosomes and a crotonyl-CoA-dependent clostridial reaction. The

hydrogenosomal NFOR was chosen as the primary enzyme in an attempt to engineer E. coli for

higher H2 yield. In contrast to the hydrogenosomal NFOR, the clostridial enzyme requires the

production of crotonyl-CoA in the cell and the end products of glucose fermentation besides H2

and CO2 are butyrate and acetate. This reaction, although it could increase the H2 yield per

glucose to 2.7, which is higher than the theoretical maximum of E. coli, has no potential to

elevate the H2 yield/glucose to 10 due to loss of glucose carbon as butyrate and acetate. The

hydrogenosomal NFOR has the demonstrated ability of transferring the reductant in NADH to

ferredoxin (94).

NFOR is the key first step of the NADH dependent hydrogen production pathway in the

hydrogenosomes of T vaginalis. NDH from T vaginalis is the only member of the NFOR class

of proteins that is capable of oxidizing NADH coupled to the reduction of low potential electron

carriers such as ferredoxin. The NDH from Trichomonas has not been produced in E. coli. As

the first step in engineering E. coli for high yield H2 production, the conditions needed for

1 A portion of the Biochemical Characterization of NFOR (NDH) from T. vaginalis was published by Springer
Science + Business Media and Copyright Clearance Center's Rightlink. See Appendix A for publication
permissions.









production of Trichomonas hydrogenosomal NDH in E. coli in active form were established by

this study. A plasmid that encodes the two subunits of the enzyme, pPMD40, was introduced

into strain Rosetta (XDE3) or JM109 (XDE3) bearing plasmid pRARE and the transformants

were induced with either IPTG or L-arabinose for production of NDH from tandem T7

promoters.

Expression with IPTG (50 [M) as an inducer supported significant amount of NDH protein

synthesis; however, high recombinant protein production rate led to low specific activity of 2.4 U

(mg protein)-1 (Table 5-1). This value was less than 1 % of the activity of the native NDH

isolated from T vaginalis hydrogenosome. In order to produce the protein with specific activity

close to that of the native protein, arabinose was used as an inducer for production of T7-

polymerase from the lac promoter in XDE3. Arabinose is not a known inducer of lac promoter;

however, a metabolic product of arabinose appears to induce the lac promoter at a lower level

(147). The low level of induction led to an increase in specific activity to 582 U (mg protein)-'

(Table 5-1), a value that is similar to native enzyme values possibly due to an increase in folding

efficiencies and/or complete cofactor insertion (94). The protein migrated through the gel

filtration column as a heterodimer with a molecular mass of 69,100 (Figure 5-1) and SDS-PAGE

(Figure 5-2) revealed that the two subunits corresponding to NdhE (22 kDa) and NdhF (47 kDa).

Enzymatic Activities / Kinetics of NDH

The specific activity of the recombinant enzyme was highest with ferricyanide as the

electron acceptor (Table 5-2) consistent with the behavior observed for the native enzyme

described by Hrdy et al. (94). The specific activity of the enzyme with benzyl viologen as

electron acceptor was comparable to that of the value with ferricyanide. The recombinant

protein also reduced methyl viologen (about 65 % of the ferricyanide specific activity). The

activity of the recombinant protein with methyl viologen as the electron acceptor was









significantly higher than that of the enzyme purified directly from the hydrogenosome. In

addition, the enzyme also reduced clostridial ferredoxin. These results show that the

recombinant NDH reduces low-potential electron acceptors such as methyl viologen (Eo' of -0.44

V) readily and heterologous ferredoxin.

NDH had an optimal pH of about 7.5 8.0 for activity (Figure 5-3). Apparent Km for

NADH for the recombinant enzyme was dependent on the electron acceptor and varied between

0.10 mM with BV and 0.31 mM with ferricyanide (Table 5-3). These values were significantly

higher than the 0.021 mM (NADH) reported for the native enzyme with ferricyanide as the

electron acceptor (94). The affinity of the recombinant protein to ferricyanide was significantly

higher than that of the native protein purified from the hydrogenosome (Km of 0.06 vs 0.29 mM)

(94). The Km for BV was about threefold higher than that of ferricyanide and the electron

acceptor with the highest Km was methyl viologen. The reaction rate was also highest with

ferricyanide as the electron acceptor although the Vmax with the other two acceptors was similar.

These results show that the T vaginalis hydrogenosome NDH produced in E. coli is capable of

reducing electron acceptors with standard redox potentials that are significantly lower than that

of NADH such as methyl viologen.

Iron / Sulfur Determination

The holoenzyme had a spectrum typical of Fe-S proteins with absorbance peaks at 326,

420, 463, and 551 nm (Figure 5-4). Upon reduction with dithionite, the peaks at 420 and 463 nm

disappeared, and the absorbance at 551 nm was lower than the protein as purified. Oxidation of

the reduced protein by air restored the original spectrum. A spectrum similar to that of the

holoenzyme was also obtained with the small subunit NdhE alone that was purified separately

(Figure 5-4). These spectra resemble the spectra of the corresponding flavoprotein subcomplex

of respiratory NADH dehydrogenase complex I and the 25 kDa subunit of the same complex









from Paracoccus denitrificans (225, 226) and also a [2Fe-2S] clostridial hydrogenase N-terminal

domain (13). The active NDH had 2.15 non-heme iron and 1.95 acid-labile sulfur atoms per

heterodimer. The NdhE protein expressed and purified separately also had Fe and acid-labile

sulfur at the same level. These results suggest that the holoenzyme contains a [2Fe-2S] cluster

that is located in the small subunit.

The absence of Fe/S in the large subunit of NDH is unique since the NdhF homologs from

respiratory chain complex I contain a [4Fe-4S] cluster (154, 225) and the cysteines implicated in

liganding the tetranuclear [Fe-S] cluster in these proteins are conserved in the Trichomonas

protein. The presence of only [2Fe-2S] cluster in the recombinant holoenzyme indicates that the

NdhF component lacks the anticipated tetranuclear N3 cluster. In agreement with this, the NdhF

protein expressed and purified separately also did not have any detectable Fe and labile S.

This lack of the tetranuclear [Fe-S] cluster in the large subunit could account for the about

15-fold higher Km for NADH in the recombinant enzyme compared to the native enzyme.

However, it is not known whether the native NDH contains the tetranuclear [Fe-S] cluster.

EPR Determination of Iron / Sulfur Clusters

In order to confirm that the binuclear Fe-S cluster was the only Fe-S cluster in the purified

NDH, EPR spectra of the protein were obtained. The purified protein did not show an EPR

spectrum but reduction with dithionite generated a spectrum that was rhombic in symmetry with

gyz values corresponding to 1.917, 1.951, and 2.009 (Figure 5-5). Although NADH was a

substrate for the enzyme, NADH failed to reduce it to an EPR-active form. An EPR signal

corresponding to a tetranuclear [Fe-S] cluster N3 (gyz=1.87, 1.94, and 2.04) found in

homologous 54 kDa proteins of the respiratory complex I (225) was not detected in this

Trichomonas NDH purified from E. coli. The NdhE subunit by itself also produced an EPR

spectrum that was similar to the holoenzyme upon reduction by dithionite (gxyz = 1.92, 1.953,









and 2.008; Figure 5-6). These EPR spectra support the conclusion that the heterodimeric protein

contains only the binuclear [Fe-S] cluster corresponding to Nia in the small subunit of NDH

from respiratory complex. It is unlikely that an additional [Fe-S] cluster is present in the

holoenzyme that is not reduced by dithionite to a paramagnetic state for detection by EPR since

the visible spectrum of the holoenzyme in the 400-500 nm range was completely bleached by

dithionite, indicating complete reduction of the [Fe-S] clusters in the protein (Figure 5-4). In

addition, the Fe content of the purified protein was only 2 per heterodimer.

Potential Use of NDH for H2 Production

The hydrogenosomal NADH dehydrogenase is the only known enzyme with a predicted

physiological role of coupling NADH oxidation to H2 evolution that has been purified and

biochemically characterized (94). As a first step in our attempt to engineer E. coli for production

of H2 at a higher yield, we have developed methods for optimum expression of the protein in an

active form in E. coli. The purified protein reduced ferredoxin, and it is likely that the NDH

reduces ferredoxin in vivo also as an intermediate in H2 evolution pathway. In metabolic

engineering ofE. coli for H2 production, the other components of the hydrogenosome pathway,

ferredoxin, and hydrogenase need to be cloned and expressed in E. coli. In the interim, the

ability of the NDH to reduce viologen dyes leads to the possibility of using these intermediate

electron carriers to couple the recombinant NDH with the native hydrogenase 3 isoenzyme of E.

coli for H2 evolution. E. coli whole cells as well as isolated membranes are known for their

ability to utilize BV or MV as an intermediate electron carrier in coupling dithionite to HYD-3

for H2 evolution (17, 81, 117, 174) and this reaction could replace the need for ferredoxin and

hydrogenase from the hydrogenosome. The [NADH]/[NAD ] ratio of anaerobic E. coli is also

significantly higher than that of an aerobically growing E. coli (52) and this could lead to a

reduction in the in vivo midpoint redox potential of the NADH/NAD+ couple (less than the Eo' of









-0.32 V) to facilitate reduction of viologen dyes by NDH in vivo. However, this requires

complete removal of 02 from the fermenting E. coli since the reduced viologen dyes react with

02 to generate superoxide radicals that are detrimental to the cell. An alternate possibility is to

engineer the bacterium to be less sensitive to superoxide.

The tetranuclear N3 cluster that plays a critical role in electron transport to ubiquinone (35,

154, 175) in all homologs of the respiratory complex I is absent in the recombinant T. vaginalis

NDH produced in E. coli. This is similar to the observed lack of the tetranuclear N3 cluster in

the recombinant Paracoccus denitrificans NDH produced in E. coli (225). In contrast to the

recombinant T. vaginalis NDH protein of this study, the recombinant P. denitrificans NDH

protein also lacked FMN and NADH-dependent enzyme activity. Reconstitution of the

recombinant P. denitrificans protein with FMN alone (without the N3 cluster but with Nia

cluster) only produced about 25 % of the NADH-dependent ferricyanide reduction activity of a

complex that was reconstituted with FMN, iron, and sulfur. This raises the possibility that a

specific chaperone may be needed for insertion of the N3 cluster in heterologous NDH produced

in E. coli. The absence of the N3 cluster in the recombinant T. vaginalis NDH is not due to high

level of expression of the protein in E. coli as shown by the presence of N3 cluster in

recombinant NuoF subunit of E. coli (204). However, it should be noted that the T. vaginalis

protein produced in E. coli, although lacking the N3 cluster, did reduce several electron

acceptors at rates that are comparable to the native enzyme isolated from the hydrogenosome

(Table 5-2). The reported midpoint redox potential of FMN (-340 mV) in the respiratory

complex I (154) may not suggest efficient electron flow from FMNH2 to the Nia cluster of the

recombinant T. vaginalis NDH. However, the higher [NADH]/[NAD+] ratio of the anaerobic

cell coupled with an increase in the ratio of [FMNH2]/[FMN] may lower the redox potential









sufficiently to facilitate transfer of electrons to the [2Fe-2S] cluster at a midpoint potential of

about -0.37 V. With the anticipated physiological role in NADH oxidation to H2 production in a

microbial biocatalyst such as recombinant E. coli, the tetranuclear cluster N3, if present in the

flavoprotein of the NDH, would drain electrons from NADH to a more oxidized form (-0.25 V)

that is not energetically favorable to H2 production.

NADH-Dependent Hydrogen Production

Reduced Methyl Viologen Coupled to E. coli Hydrogenase-3 (HYD3) Isoenzyme

The ability of T. vaginalis NDH to reduce low potential electron carriers such as ferredoxin

and viologen dyes could play an important role in NADH-dependent hydrogen production.

Reduced viologen dyes are known for their ability to serve as intermediate electron carriers

coupling dithionite to HYD-3 for H2 evolution (17, 81, 117, 174); thus, in theory, NDH could

couple NADH oxidation to H2 production in E. coli with MV as an intermediate electron carrier.

The use of viologen dyes such as MV or BV could be problematic in growing cultures due

to the reactivity of the dyes to oxygen generating superoxide radicals. To remedy this, E. coli

strain PMD45 was serially transferred in medium with increasing MV concentrations under

aerobic growth condition selecting for MV resistance. MV resistance under aerobic conditions

often does not translate to MV resistance under anaerobic conditions, probably due to varying

levels of expression of superoxide dismutase and catalase under those conditions (53). Strains

that were resistant to 1 mM MV were transformed with pTrc99a-ndhEF and incubated

anaerobically in the presence of 1 mM MV. Strains bearing plasmids encoding NDH were

screened for increased ability to reduce MV identified by color change of growth media. Strains

bearing T vaginalis NDH reduced more MV than vector plasmid alone; however, there was no

significant difference in H2 evolution (Figure 5-7). Strains with NDH also grew to slightly

higher OD probably due to the use of MV as an electron sink. Electron transfer from MV to









HYD3 may be the limiting step in these cultures or the concentration of reduced MV may not be

sufficient to drive the reaction to H2. The use of BV led to BV reduction that was higher than the

upper limit of spectrophotometer since BV is a preferred substrate for NDH; however, this

higher amount of reduced BV also failed to couple to H2 production. In fact, BV led to a lower

H2 evolution with NDH than without indicating an electron sink in BV for format oxidation.

Since HYD3 is a membrane associated, multi-subunit complex, the accessibility of reduced

viologen dyes to the HYD3 active site maybe a limiting factor in this coupled H2 evolution

reaction. A more accessible soluble [Fe]-hydrogenase may be required for NADH-dependent

hydrogen production.

Reduced Methyl Viologen Coupled to [Fe]-Hydrogenase

It is known that the maturation of [Fe]-hydrogenase requires at least three accessory

proteins HydE, HydF, and HydG (37, 113, 164, 171). The genes encoding these proteins are

conserved among [Fe]-hydrogenase bearing organisms. The expression of [Fe]-hydrogenase in

recombinant bacteria that lack the genes encoding these accessory proteins such as E. coli yields

inactive [Fe]-hydrogenase polypeptide. Even with over-expression of HydEFG in E. coli, the

specific activity of [Fe]-hydrogenase was extremely low compared to hydrogenases from the

native organism. In vitro hydrogen production from NADH using purified C. acetobutylicum

[Fe]-hydrogenase, NDH, and MV, BV, or C. acetobutylicum ferredoxin yielded also extremely

low hydrogen. The replacement of NDH and NADH with dithionite supported detectable levels

of H2 indicating that the hydrogenase was not irreversibly inactivated during the assay. Further

examination of the two enzymes in this coupled reaction revealed that clostridial hydrogenase as

well as many others had an optimal pH around 6.0 for H2 evolution (1, 2, 58, 73, 93) and an

optimal pH of 8 10 for H2 oxidation/uptake (1, 2, 73, 93); whereas, T vaginalis NDH optimal









pH was about 7.5 8.0 for NADH oxidation (Figure 5-3). The pH incompatibilities of the two

systems may contribute to the very low H2 evolution.

One possible substitution for clostridial [Fe]-hydrogenase could be a [Fe]-hydrogenase and

ferredoxin from T vaginalis that would reconstitute the native NADH-H2 pathway in E. coli. An

alternative set of components could be the proteins from another hydrogenosomal protozoan

Pseudotrichonympha grassii from digestive hindgut of the termite Coptotermesformosanus (99).

According to Inoue et al., a non-hydrogen producing strain of E. coli expressing only the [Fe]-

hydrogenase structural gene, hydA, from P. grassii (without the accessory maturation proteins)

evolved hydrogen indicating that this hydrogenase can be activated by E. coli proteins. Purified

recombinant P. grassii [Fe]-hydrogenase from E. coli was about 30 times more active than

recombinant clostridial [Fe]-hydrogenase with HydEFG (99, 113). Furthermore, protozoan

hydrogenase has an optimal pH of 8.0 that is compatible with T vaginalis NDH.

Reticulitermesflavipes, is a native species of the State of Florida and is in the same family

of subterranean termites, Rhinotermitidae, such as C. formosanus. Of the entire cDNA library of

this termite gut symbiont, five genes in the expressed sequence tags (EST) were annotated as

possible [Fe]-hydrogenase by Dr. Scharf and his colleagues who kindly provided these DNA for

this study. One [Fe]-hydrogenase in particular had an Evalue of 4 x 10-174 with 67 % identity and

81 % overall similarity to [Fe]-hydrogenase to P. grassii (Figure 5-8). This hydrogenase

sequence also had high similarity to T. vaginalis HydA (Evalue = 1 x 10-127) and to a lesser extent

to C. acetobutylicum (Evalue = 3 x 10-88). The high homology to P. grassii hydrogenase as well as

others makes this hydrogenase a good candidate to further examine its potential to couple NADH

oxidation to hydrogen evolution.









The ORF encoding the unknown symbiont [Fe]-hydrogenase without hydrogenosomal N-

terminal signal peptide (first 28 amino acids), referred to here as gutHyd, was cloned into

plasmid pET15b as well as plasmid pTrc99a for expression in T7 and non-T7 (trc)E. coli

expression systems, respectively. The truncated gene gutHyd was designed in accordance to

truncated P. grassii [Fe]-hydrogenase (09A82) described by Inoue et al. (99). Non-hydrogen-

producing strains BL21 (XDE3) and PMD45 bearing pET 15b-gutHyd and pTrc99a-gutHyd,

respectively, failed to evolve H2.

To rule out that the failure of these recombinant E. coli strains to produce hydrogen was

due to inactive enzyme and not from the inability of the cell to supply reductant, gutHyd, under

control of trc promoter, was subcloned from pTrc99a-gutHyd into pTrc99a-ndhEF resulting in

plasmid pTrc99a-ndhEF-gutHyd. For expression, pTrc99a-ndhEF-gutHyd was transformed into

PMD45. Strain PMD45 could not grow anaerobically due to the inability to reoxidize NADH.

Plasmid with ndhEF and gutHyd did not restore anaerobic growth; however, this plasmid did

increase slightly hydrogen production over strains carrying plasmid vector (Figure 5-9). The

fermentation profile of the cultures indicated that the difference in H2 evolution between the

NDH/GutHyd and vector was probably due to the format hydrogen-lyase (Figure 5-10).

Thermodynamic Barrier

PMD45 could not grow anaerobically because of its inability to oxidize NADH during

fermentation. The expression ofNDH and GutHyd did not alleviate the imbalance in redox

state. Ideally, if the activities of NDH and GutHyd using MV as an intermediate electron carrier,

created an alternate electron pathway, NADH produced during glycolysis would be oxidized to

H2 enabling growth to proceed. Its inability to do so maybe because of the thermodynamics of

H2 (-0.42 V) production from NADH (-0.32 V). The free energy for this reaction could be

calculated using Equation 4-3. Using n equals 2 (number of electrons transferred from NADH to









2H+ to make H2), F (Faraday's constant) equals 96,500 C mol-1 and the standard redox potential

Eo' of -0.42 V and -0.32 V for H2 and NADH, respectively, the free energy for this reaction

could be calculated as follows (Equation 5-1):

AG = -(2) (96,500) (-0.42 V -(-0.32 V)) (5-1)
AG = +19300 Jmol = +19.3 kJ mol1 +4.62 kcal mol1

The production of H2 from NADH is an endothermic reaction requiring +4.62 kcal mol1 of

energy for the reaction to proceed. Internal ratios of [NAD+]/[NADH] could effect its redox

potential. The internal [NAD+]/[NADH] ratio differs depending on availability of oxygen or

external electron acceptors. Internal [NAD+]/[NADH] ratios had been previously determined to

range between 10.6 aerobically and between 1.0 to 4.5 anaerobically where strains with a ratio of

1.00 carry mutations in global regulators such as ArcA and Fnr which is known to increase

NADH levels (3, 122, 123). Internal potential (E) of [NAD+]/[NADH] in anaerobically growing

cells could be calculated using the simplified Nernst equation previously described in Equation

4-2. Using wild-type E. coli strain DC271 anaerobic NAD+/NADH ratio of 4.5 (122), the Nernst

equation could be solved as follows (Equation 5-2):

E = -0.320 V + (0.0596/2) log (4.5) (5-2)
E = -0.301V

With appropriate mutations in ArcA and Fnr, [NAD+]/[NADH] ratios had been

demonstrated to reach a low as 1.0 (3, 123), bringing E to its midpoint potential of -0.32 V. A

[NAD+]/[NADH] ratio of lower than 1.0 shifts the redox potential to a more negative value

closer to that of H2. For example, if the [NAD+]/[NADH] ratio was 0.1, then the redox potential

shifts to -0.35 V and then the AG would lower to +3.23 kcal mol1 from the +4.62 kcal mol1

standard. In order for the reaction to be spontaneous, there must be a negative (-) AG value or

more specifically, E(NAD+/NADH) must be more negative than E(H+/H2). To calculate the









[NAD ]/[NADH] ratio that is minimally required for a thermodynamic equilibrium reaction of

NADH to H2, the Nernst equation could be setup as follows (Equation 5-3):

Eo' (H+/H2) > Eo'(NAD/NADH) + 0.0296 log ([NAD+]/[NADH]) (5-3)
-0.420 V > -0.320 V + 0.0296 log ([NAD+]/[NADH])
-3.378 V > log ([NAD+]/[NADH])
4.184 x 10-4 > [NAD+]/[NADH]
2390 > [NADH]/[NAD+]

To reach an internal redox potential of -0.42V for the NAD+/NADH couple, the same as

the hydrogen electrode potential at pH 7.0, the NADH concentration in the cell should be at least

2,390 fold higher than the NAD+ concentration. Of course, this ratio should be even higher for

the reaction from NADH to H2 to be thermodynamically favorable. Although MV was readily

reduced by NDH in vitro, the reduced MV concentration of an anaerobic bacterial cell

suspension was only 60 [tM in the presence of 1 mM total MV added to the culture. It appears

that NDH can only generate an in vivo ratio of [MVred]/[MVoxi] of 0.06 using NADH as the

electron donor and this ratio may not be high enough to drive the electrons to hydrogen. The 1

mM MV is at least 2-times higher than the NDH Km value of 0.44 mM for this substrate (Table

5-3) and thus may not be limiting as a substrate. With the assumption that the external

concentrations of oxidized and reduced MV represent the internal concentrations of these two,

the calculated redox potential for the MV couple in this culture is -0.404 V. The intracellular

ratio of reduced vs oxidized MV needs to be at least 5-times higher than the observed value for

thermodynamically favorable coupling of reduced MV to H2 production. This is in agreement

with the ease with which MV that is reduced by dithionite donates electrons to HYD3 for H2

evolution.

An alternate way of coupling NADH to H2 production with the same components, NDH,

MV and HYD3, would be to increase the internal redox potential of the H+/H2 couple by rapidly









removing the H2 produced by the hydrogenase by sparging with N2. Lowering the partial

pressure of dissolved H2 had been demonstrated to increase hydrogen production by lowering

product inhibition (129, 132, 201). The amount of dissolved H2 in aqueous solution saturates at

about 1.4 mg L-1 (700 [M) at 370C (18, 49). Given the [H+] at pH 7.0 is 1 x 10-7 or 0.1 aM, the

redox potential of [H+]/[H2] in water at pH 7.0 is -0.534 V with H2 saturation. By lowering the

dissolved [H2] at pH 7.0 or at pH 6.0 to 2.0 nM, or 200 nM, respectively, the redox potential will

shift to -0.37 V, the reported redox potential ofNla cluster ofNDH homologs. With these

conditions, the use of recombinant NDH and MV may be favorable for H2 production. This

would indeed lead to a highly dilute H2 gas stream and may not be an economical H2

fermentation process.

The results presented in this section show that the hydrogenosomal NDH can couple to E.

coli HYD3 with MV as an intermediate electron carrier but at a very low rate. Replacing the

native HYD3 and MV with Trichomonas ferredoxin and [Fe]-hydrogenase may not be able to

overcome some of the constraints discussed above. It is possible that in the Trichomonas

hydrogenosome the various components of the NADH to H2 pathway are compartmentalized and

the H2 is rapidly removed from the microenvironment of hydrogenosome to support this reaction.

Such a compartmentalization of the components, substrates and products may not be achievable

in a bacterial cell for cost-effective conversion of glucose to H2 at high yield without energy

input either in the form of electricity, sun light, etc.

Due to the constraints on H2 production by dark fermentation discussed above, the

potential of engineering E. coli for the production of the other alternate next generation biofuel,

butanol was evaluated.









Production of 1-Butanol by Recombinant E. coli

Another potential next generation biofuel is butanol. Butanol is produced by several

clostridia during later stages of growth and fermentation. However, due to the need to maintain

redox balance, acetone and ethanol are also co-produced with butanol. In this section, I am

presenting my studies aimed at transferring the genes encoding the enzymes that constitute the

butanol pathway in C. acetobutylicum into E. coli to identify the critical rate-limiting steps in the

butanol pathway towards producing butanol as the sole fermentation product. In addition, I also

evaluated potential alternate choices in both enzymes and strains to overcome these rate-limiting

steps.

In Vitro Production of Butanol from Acetyl-CoA Using Recombinant Proteins

E. coli, like C. acetobutylicum, has a natural ability to produce two moles acetyl-CoA from

one mole glucose. In order to produce butanol in E. coli, the rest of the butanol fermentation

pathway must be introduced from C. acetobutylicum. The first step is to assess ifE. coli is

capable of producing the enzymes in the clostridial butanol pathway in active form. To do so, all

the enzymes that catalyze each reaction from acetyl-CoA to butanol were cloned into plasmid

pET15b and expressed from T7 promoter in E. coli. The enzymes were purified to homogeneity

and assayed for activity (Table 5-4).

Of the two clostridial thiolases, ThlA appears to have higher activity than ThlB when

expressed in recombinant E. coli. Since it is believed that ThlA is the main thiolase in C.

acetobutylicum for the condensation of acetyl-CoA (217), this is in agreement with the higher

activity of ThlA. Recombinant Hbd had a significantly higher specific activity compared to

ThlA and this is similar to Hbd purified from C. beijerinckii (47). Crt activity was determined to

be the highest of all the enzymes of this pathway. The reduction of crotonyl-CoA to butyryl-

CoA was catalyzed by Bcd/EtfBA complex in clostridial systems. Purified recombinant









Bcd/EtfBA enzyme complex had no detectable activity although Bcd activity in recombinant E.

coli crude extract has been previously reported (12, 32, 100). It should be pointed that an active

Bcd enzyme complex from E. coli has yet to be purified. To overcome this limitation, the S.

avermitilis gene encoding CcrA was cloned and the protein was purified. The CcrA protein

catalyzes the same reaction as Bcd/EtfBA except it uses NADPH instead of NADH (211). The

specific activity of the recombinant CcrA was twice of the reported value of the native enzyme

from Streptomyces collins probably due to the difference in species (Table 5-4) (211). The last

two steps of the pathway could be catalyzed by both Aad and AdhE2; however, only AdhE2

seems to have detectable activity for butyraldehyde to butanol. Fontaine et al. also purified an

active recombinant AdhE2 from E. coli with similar activities (67).

Since all the predicted enzymes that catalyze the production of butanol from acetyl-CoA

were produced in E. coli in an active form, the next step was to determine if these enzymes could

constitute the butanol pathway in vitro. One unit ([tmole min-) of each enzyme (ThlA, Hbd, Crt,

CcrA, and AdhE2) in the presence of 5 mM acetyl-CoA, 10 mM NADH, and 10 mM NADPH

catalyzed the sequential reactions from acetyl-CoA to butanol (Figure 5-11 and 5-12). The

butanol concentration of 0.5 mM in this experiment represented about 20 % of the acetyl-CoA

added as the starting substrate. In addition, other intermediates of the pathway were also

detected, although at significantly lower levels.

This experiment clearly shows that the minimal set of enzymes needed for conversion of

acetyl-CoA to butanol can be produced in E. coli in active form. It should be pointed out that the

clostridial butyryl-CoA dehydrogenase (Bcd) complex was replaced in this in vitro pathway by

the crotonyl-CoA reductase (CcrA) from S. avermitilis (Figure 5-12). Although both enzymes

catalyze the reduction of crotonyl-CoA to butyryl-CoA, the clostridial Bcd has additional









substrate requirements in addition to NADH and crotonyl-CoA for catalysis. These are

ferredoxin and soluble Fe-hydrogenase which would also need to be produced as active proteins

in recombinant E. coli. As I presented in the previous section, production of active Fe-

hydrogenase in E. coli is still a work in progress. Although Bcd complex utilized NADH as an

electron donor in vitro, the actual electron donor in vivo is yet to be established. Coupling these

enzymes with appropriate substrates, acetyl-CoA, NADH, and NADPH, is expected to support

butanol biosynthesis in vivo in E. coli.

Plasmid Expression of Butanol Pathway

The detection of active recombinant enzymes that catalyzed the production of butanol from

acetyl-CoA in vitro was instrumental for designing an in vivo butanol pathway. Assuming that

enzyme activity was not lost during the purification process, if all the genes were expressed at a

1:1 ratio to each other, there will be severe bottlenecks in the later steps of the pathway (Figure

5-12). Higher levels of Bcd/EtfBA or CcrA and AdhE2 activities will be needed to increase flux

through the pathway since these appear to be rate limiting steps. Also, higher thiolase activity

may be needed to direct acetyl-CoA to this pathway and away from the alcohol dehydrogenase

(ethanol production) activity of AdhE2 since no alcohol dehydrogenase that is specific for

butyryl-CoA to butanol has been reported. All alcohol dehydrogenase enzymes that reduce

butyryl-CoA also reduce acetyl-CoA to ethanol. During normal fermentative growth, NADPH-

dependent CcrA cannot overcome this Bcd/EtfBA step due to a limitation of NADPH in the

anaerobic E. coli. Previous attempts to utilize CcrA as a substitute for Bcd/EtfBA resulted in

little to no butanol produced (12, 100).

The first plasmid constructed for butanol production, pButanol, had crt, bcd, etfB, etfA,

hbd, adhE2, and thlA arranged in that respective order in a single operon controlled by an IPTG

inducible trc promoter upstream of crt. Production of butanol by E. coli with pButanol plasmid









appeared to be strain dependent. Wild-type W3110 did not produce any detectable butanol.

Since Inui et al. used JM109 for butanol production, strain JM107, a recA+ parent strain of

JM109, was tested for its ability to produce butanol with plasmid pButanol (100). JM107

bearing pButanol produced 0.20 + 0.11 mM butanol with all fermentation pathways intact. Since

all the genes were transcribed from a single promoter, differential translation efficiencies of the

various genes in the multicistronic mRNA maybe the cause of low yields. A new expression

system was constructed to optimize transcription.

To increase plasmid stability, all the genes were subcloned into a low copy vector

pACYC184 with pl5a origin of replication that is compatible with ColEl plasmids. Instead of

one trc promoter controlling transcription, the genes encoding enzymes with lower specific

activities (thlA, ccrA, bdhB) were transcribed from their own tandem trc promoter. The gene

bdhB was included in this construct instead of adhE2 because previous reports indicated that it

was functionally expressed in E. coli and BdhB had lower affinity to acetyl-CoA than AdhE2

(67, 144, 212). Strain JM107 bearing the new construct, pCBEHTCB, did not produce butanol.

To determine the metabolic rate-limiting step in JM107 (pCBEHTCB), crude extract was tested

for activity of each of the enzyme encoded in the plasmid (Table 5-5). Enzyme assays revealed

the absence of BdhB activity and lower than expected CcrA and ThlA activities. Since butyrate

was also not detected in JM107 (pCBEHTCB) fermentations, the rate-limiting reaction was

probably the first step, ThlA activity. Higher thiolase activity may be needed to increase flux

through the butanol pathway and away from ethanol production.

The plasmid pAA was constructed to increase AdhE2 and thiolase levels in the cell. Both

adhE2 and E. coli thiolase, atoB, were expressed from independent trc promoters. JM107 (pAA)

produced significantly higher levels of both enzymes upon induction with IPTG especially for









AtoB (Table 5-6). The higher thiolase activity is expected to therefore increase carbon flux

through butanol pathway, and away from the competing pathways to ethanol and acetic acid.

Based on this information, the plasmid pCBEHTCB was revised by removing the two

genes with low or no activity (thlA and bdhB) and adding udhA (sthA) since previous studies had

demonstrated an increase in NADPH level by over expression of this soluble trans-hydrogenase

(172). JM107 bearing this construct, pCBEHCU, and pAA produced 0.21 0.02 mM butanol

and the crude extract had similar enzyme activities as detected in Table 5-5 and Table 5-6.

Low butanol yield could be attributed to the presence of intact native fermentation

pathways in JM107 that divert carbon and reductant away from butanol pathway. To improve

butanol yield, various native fermentation pathway enzymes were deleted in both W3110 and

JM107 (Table 5-7). JM107 derivatives were inherently better at producing butanol than W3110

based strains. The highest butanol detected was 1.90 + 0.06 mM from PMD50 (JM107AldhA).

PMD52 (JM107 AldhA ApflB with IpdJO1*) mutation reduced butanol production to 0.92 mM.

Mutation in IpdlO1* was expected to increase NADH yield to 4 per glucose; thus, theoretically

increasing butanol yield by supplying all the required reducing equivalents. However, in the

case of JM107, its incorporation in addition to a deletion inpflB reduced butanol production by

50 %. The highest value obtained thus far was still about half of the value reported by Atsumi et

al. (12).

The observed strain-dependent variation in butanol yield led to an E. coli C based strain, in

particular, an evolved strain developed for succinate production (103). Bcd/EtfBA activity in E.

coli could perhaps be increased by using succinate producing strains. Succinate is produced by

the reduction of fumarate by fumarate reductase coupled to the oxidation of an unknown electron

carrier. E. coli strain KJ104 (103) produces near theoretical yields of succinate producing up to









1.30 mol succinate per mol glucose. This high succinate production raises the possibility that a

unique electron-transport pathway was elevated to reduce fumarate reductase. Since fumarate

reductase is a flavoprotein with its own unique electron carriers that reduces C=C bond in

fumarate to succinate, it is possible that the same electron transport components feeding

electrons to fumarate reductase could provide the needed reductant to Bcd complex, another

flavoprotein that also reduces a C=C bond in crotonyl-CoA to butyryl-CoA. The succinate-

production strain, KJ104, has either elevated this unique electron transport pathway to fumarate

reductase or adapted other components of the cell to support high carbon flux through fumarate

reductase. In this study, I tested if this high flux through fumarate reductase could be adapted to

support carbon flux through the rate-limiting step at the Bcd complex in butanol production.

Chromosomal Insertion of Butanol Pathway into E. coli

Traditional directed evolution of E. coli which has been proved to be very successful at

increasing fermentation yield (43, 103, 104, 111, 135, 227, 231, 235) could not be employed in

this situation due to plasmid stability and plasmid retention. Chromosomal insertion of butanol

pathway genes may be necessary for evolution of these strains for production of butanol.

Plasmid pAACBEHCU was constructed by combining pCBEHCU and pAA into a single larger

plasmid. The origin of replication and chloramphenicol resistance gene were replaced with

spectinomycin resistance. Single recombination of the entire plasmid lacking the replicon was

selected for by spectinomycin resistance and chromosomal insertion ofspcR-Ptrc-adhE2-Ptrc-

atoB-Ptrc-crt-bcd-etfBA-hbd-Ptc-ccrA-udhA and the strain was designated as but+. Chromosomal

insertion of the full plasmid was confirmed by PCR. The site for chromosomal integration is yet

to be determined; however, possible recombination sites were atoB, udhA, and lac since these

were E. coli genes. JM107 AldhA with but+ (PMD70) insertion did not produce butanol or

butyrate (Table 5-8). Succinate producer KJ104 withAfrdBC and but+ (PMD72) insert also









yielded similar results. The addition of pCBEHCU alone without pAA as a plasmid into these

strains supported butanol production with yields of 0.30 + 0.02 mM suggesting that this strain

may have ample thiolase and butanol dehydrogenase activity and the rate-limiting reaction may

be the reduction of crotonyl-CoA to butyryl-CoA. PMD70 bearing pButyrate (pButanol without

adhE2) was able to produce 1.10 + 0.05 mM butanol and 1.22 0.02 mM butyrate. Since the

strain without plasmid did not produce butyrate and the plasmid supplementation supported

production of butyrate as well as butanol, the rate limited step may be Bcd/EtfBA and the genes

expressed in trans from a low copy plasmid were able to overcome the low activity of the but

insert.

A second chromosomal insertion was made to remedy the poor butanol yield of but+

strains. The BCS operon was inserted in the chromosome replacingpflB which places the entire

operon under the control ofpflB native promoters. By replacing/deletingpflB in addition to

AldhA, these strains are no longer capable of growing anaerobically. Micro-aerobic conditions

that support PDH activity to produce acetyl-CoA were needed to assess the fermentation profiles.

Strain PMD73 produced 0.16 mM butanol without plasmids (Table 5-9). PMD74 had a slightly

higher flux through the pathway producing 0.31 mM butyrate and about 0.10 mM butanol. The

inability of the cell to convert all butyrate to butanol could be because of an inadequate supply of

NADH to complete the reduction of butyryl-CoA to butanol. Another possible reason could be

an insufficient activity of AdhE2 which was part of the initial but insert. The key to increasing

butanol production is apparently to increase flux through the rate limiting Bcd/EtfBA reaction.

The most direct way to increase flux through Bcd/EtfBA was to initially focus on the

production of butyrate not butanol since butanol production requires additional NADH that

requires further engineering. The production of butyrate requires 2 reducing equivalents which









were readily supplied by glycolysis. In addition, increasing AdhE2 level may compete with

thiolase for acetyl-CoA with production of ethanol as a co-product. Since PMD74 has the

highest flux and the lowest co-production of other fermentation products, it will be used as the

base strain for further genetic manipulations.

By deleting adhE2 from the original but+ insert, no butanol and only trace amounts of

ethanol were produced. The new strains still lacked the ability to grow anaerobically and had no

significant increase in butyrate production. pTrc99a based plasmids encoding enzymes of

butyrate production pathway were inserted into these strains (Table 5-10). Plasmids pTrc99a-

atoB and pTrc99a-ccrA-udhA had minimal effect on butyrate production. Plasmids pTrc99a-

bcd/etBA and pButyrate increased butyrate yield from 0.20 + 0.07 mM butyrate to 3.08 0.21

mM to 2.47 + 0.10 mM butyrate, respectively. By increasing Bcd/EtfBA levels, the flux to

butyrate correspondingly increased. The effect of Bcd/EtfBA analogue, CcrA, was insignificant

on butyrate production probably due to low NADPH pools which negates any positive effect of

CcrA's higher activity. These results confirm that Bcd/EtfBA activity needs to be elevated in

order to increase butyrate production.

Additional Insertion of bcd-etfBA Transcriptionally Controlled by E. coli adhE Promoter

Low butyrate yields could be the result of inadequate activity of chromosomally expressed

Bcd/EtfBA. To overcome the low activity, a third copy of bcd-etBA was inserted into the

chromosome replacing E. coli adhE similar to that of the previously described chromosomal

insertion replacingpflB. Since adhE had higher promoter activity under anaerobic condition, the

additional adhE promoter fusion is expected to increase overall Bcd/EtfBA activity in the cell.

The third bcd-etfBA insertion into adhE promoter led to an increase in butyrate production

to 2.0 + 0.50 mM under micro-aerobic fermentation condition. To further analyze these cultures,

pH controlled fleaker fermentations were used to examine growth characteristics. Cultures of









PMD76 were inoculated into 1 % glucose minimal medium with an initial pH of 7.0 (Figure 5-

13). pH controllers with set values of 7.0, 6.5, 6.0, and 5.0 were used to prevent pH from

decreasing below the respective set values. Two different phases of growth were observed with

cultures set to a minimum pH of 7.0 or 6.5. After the initial phase in which all four cultures

grew at about the same level, the pH 7.0 and 6.5 cultures grew to a higher cell density. During

the initial growth phase, pyruvate was accumulated by the cultures and it was consumed by the

two cultures during the second phase of growth. The other two cultures with a set minimum pH

of 5.0 and 6.0 continued to accumulate pyruvate and butyric acid. Accumulation of pyruvic acid

by these cultures suggests that even with oxygen provided by mixing the cultures in air, acetyl-

CoA that is required to drive the butyrate pathway is limiting in thispfl mutant. This requires

reintroduction of PFL activity or increasing the PDH activity with the IpdlO1 mutation to

enhance the PDH activity of the anaerobic culture before attempting to overcome other rate-

limiting steps in this pathway. Further metabolic engineering coupled with long-term metabolic

evolution is apparently required to overcome the rate-limiting step(s) by activating native E. coli

genes to channel glucose carbon to butyric acid followed by redirection of the butyryl-CoA to

butanol.









Table 5-1. Purification of recombinant NDH produced in E. coli with IPTG or arabinose as an
inducer.
Indu n S e Total Total Sp. Purification Yd
Induction Sample A a b T- Yield %
[Protein] Activitya Activityb Fold
IPTG Crude extract 63.83 16.0 0.25 1.00 100.0 %
Ni-affinity 5.76 4.9 0.85 3.40 30.7 %
Gel filtration 2.21 5.4 2.4 9.72 33.7 %
Arabinose Crude extract 157.76 506 3.21 1.00 100.0 %
Ni-affinity 2.32 501 216 67.4 99.1%
Gel filtration 0.72 419 582 181 82.8 %
Activity was determined using 50 mM K-P04 buffer pH 7.5, 5 mM benzylviologen (BV), and 1
mM NADH, under anaerobic condition. The reaction was monitored at 600nm (BV reduction)
and the activity as calculated from the initial rate of reaction.
a Total activity: atmole min-1
b Sp. Activity: Lamole min'1 (mg protein)-'









Table 5-2. Specific activity of recombinant T vaginalis hydrogenosome NDH produced in E.
coli with arabinose as inducer
Electron acceptor Specific activity ([tmole min-' mg protein-)

Arabinose-induced Nativea
Ferricyanide 604 24 690
Benzyl viologen 582 + 44 ND
Methyl viologen 392 + 19 262
Ferredoxin 24 0.2b 48c
[Reprinted with permission from Do, P.M., A. Angerhofer, I. Hrdy, L. Bardonova, L.O. Ingram,
and K.T. Shanmugam. 2009. Engineering Escherichia coli for fermentative dihydrogen
production: potential role ofNADH-ferredoxin oxidoreductase from the hydrogenosome of
anaerobic protozoa. Appl Biochem Biotechnol 153:21-33. (Page 27, Table 1)]
a Values for the native enzyme isolated from Trichomonas vaginalis hydrogenosomes were from
Hrdy et al. (94).
bClostridium acetobutylicum ferredoxin
c T vaginalis ferredoxin
ND not determined.









Table 5-3. Kinetic properties of recombinant T. vaginalis hydrogenosome NDH purified from E. coli
_i


Induction Reaction Km (donor) Km (acceptor) Vmax Keat
(mM NADH) (mM) (s-1)
IPTG NADH -BVa 0.35 0.41 3.69 4.14
NADH MVa 0.36 2.41 3.78 4.24
NADH KFeCNa ND ND ND ND
Arabinose NADH BVb 0.10 0.17 645 725
NADH MVb 0.22 0.44 570 650
NADH KFeCNc 0.31 0.06 870 1170
Km for NADH was determined in assay mixture containing 50 mM K-phosphate buffer, pH 7.5 with 5 mM benzyl viologen, 20 mM
methyl viologen or 1 mM potassium ferricyanide. Km for electron acceptors was determined in a reaction mixture containing 50 mM
phosphate buffer, pH 7.5, 1 mM NADH and the electron acceptor at various concentrations. The reaction was followed by the
reduction of electron acceptor [Adapted from Do, P.M., A. Angerhofer, I. Hrdy, L. Bardonova, L.O. Ingram, and K.T. Shanmugam.
2009. Engineering Escherichia coli for fermentative dihydrogen production: potential role ofNADH-ferredoxin oxidoreductase from
the hydrogenosome of anaerobic protozoa. Appl Biochem Biotechnol 153:21-33 (Page 28, Table 2)]
a6.29 tg protein was used in the reduction
b0.15 tg protein was used in these assays
'0.45 tg protein was used in these reactions
dtmole (min mg protein)-1









Table 5-4. Specific activities of recombinant enzymes in butanol production pathway
Enzyme Reaction Specific Activity Keat
(U mg protein-1) (s-1)
ThlA Acetyl-CoA Acetoacetyl-CoA 14.00 + 1.88 85.62
ThlB Acetyl-CoA Acetoacetyl-CoA 4.09 + 1.01 23.19
Hbd Acetoacetyl-CoA- Hydroxybutyryl-CoA 209.5 + 15.46 (349)a 459.1
Crt Hydroxybutyryl-CoA- Crotonyl-CoA 799.5 + 15.79 1572
Bcd/EtfBA Crotonyl-CoA- Butyryl-CoA ND ND
CcrA Crotonyl-CoA- Butyryl-CoA 7.59 0.68 (2.89)b 11.23
Aad Butyryl-CoA-- Butyraldehyde ND ND
Butyraldehyde -- Butanol ND ND
AdhE2 Butyryl-CoA-- Butyraldehyde (0.74)c ND
Butyraldehyde -- Butanol 0.86 0.22 (0.18)c ND
All enzymes were purified from recombinant E. coli. The number in parentheses represents
reported values for enzymes from the respective native organism. Under the conditions assayed,
Bcd/EtfBA had no detectable activity. ND: not detected.
a Specific activity ofHbd purified from C. beijerinckii (47)
b Specific activity of CcrA purified from S. collins (211)
c Specific activity of C. acetobutylicum AdhE2 purified from E. coli (67)









Table 5-5. Specific activity of butanol pathway enzymes in the crude extract of JM107
(pCBEHTCB)
STesd TG Specific Activity
Enzyme Tested IP(mU mg protein1 )
ThlA + 11.2 2.3
ND
Hbd + 908.8 81.6
19.47 + 2.4
Bcd (NADH) + ND
ND
CcrA (NADPH) + 11.8 1.3
ND
BdhB + ND
ND
Crude extracts from JM107 bearing pCBEHTCB uninduced and induced with IPTG were
assayed for the enzymes indicated. Values are the average of three independent experiments.
ND: not detected.









Table 5-6. Specific activity of AtoB and AdhE2 in the crude extracts ofJM107 (pAA)
STestd IG Specific Activity
Enzyme Tested IPT(mU mg protein1)
AtoB + 22,130 + 802
ND
AdhE2 + 25.62 + 3.3
ND
Crude extracts from JM107 (pAA) uninduced and induced with IPTG were extracted and
assayed for AdhE2 and AtoB. ND: not detected.









Butanol production by various mutant strains ofE. coli bearing pCBEHCU and pAA


Parent Butanol
Strain Strain AldhA A(focA-pflB) lpd]01* AmgsA AtcdE AadhE (mM)
Strain (MM)


W3110 <0.10
PMD40 W3110 X 0.45 0.13
PMD42 W3110 X X ND
PMD46 W3110 X X X ND
PMD47 W3110 X X X X ND
PMD48 W3110 X X X X X ND
JM107 0.21 + 0.02
PMD50 JM107 X 1.90 + 0.06
PMD51 JM107 X X ND
PMD52 JM107 X X X 0.92 0.11a
PMD53 JM107 X X X X NDa
PMD54 JM107 X X X X 0.21 0.09a
Cultures bearing both pCBEHCU and pAA were grown anaerobically in LB-ampicillin, chloramphenicol with 0.3 % glucose at 37C
for 96 hrs. ND, not detected. (n=3)
a Grown in a pH stat at pH 7.0 with 02-limitation at 370C.


Table 5-7.









Table 5-8. Effect of various plasmids on the production of butanol by different E. coli strains.
Butanol [mM]
Plasmid(s)
PMD50 PMD70a PMD72 a,b
No Plasmid ND ND ND
pCBEHCU 0.21 + 0.01 0.30 + 0.02 0.16 + 0.09
pAA ND ND ND
pAA + pCBEHCU 0.17 0.13 0.21 0.05 0.20 0.02
pButanol 1.93 0.05 2.20 0.07 1.15 0.40
pButyrate 1.22 0.02 (1.42 0.03)c 1.10 0.05 (1.22 0.03)c 0.82 0.23 (0.37 0.02)c
Different E. coli strains bearing various plasmids were tested for butanol production in LB with 0.3 % glucose at 370C for 48 hrs. ND,
not detected. (n=2)
a Contains but+ chromosomal integration of butanol pathway genes
b Cultures were grown micro-aerobically
' The values in parentheses represent butyrate concentration









Table 5-9. Effect of a second chromosomal insertion ofBCS operon transcriptionally controlled by pflB promoters.
Glucose consumed Fermentation Products
Strain
[mM] Succ Lac For Ace EtOH Butyrate BuOH

PMD70 a 55.31 0.00 11.6 0.21 ND ND 38.10 3.26 66.1 4.69 ND ND
PMD73 b 28.20 + 6.24 4.89 0.03 1.75 + 0.61 ND 1.86 + 0.56 18.8 + 3.42 ND 0.16 + 0.00
PMD72 b 12.52 4.98 7.12 0.21 0.85 0.11 ND 5.84 0.64 0.56 0.34 ND ND
PMD74 b 19.58 2.36 6.03 0.53 1.56 0.12 ND 4.73 1.89 0.32 0.16 0.31 0.11 <0.10
Succ, succinate; lac, lactate; for, format; ace, acetate; EtOH, ethanol; BuOH, butanol; ND, not detected. (n=2)
a Cultured anaerobically in LB-ampicillin, 1.0 % glucose at 370C for 72hrs
b Cultured micro-aerobically in the same medium









Table 5-10. Effect of plasmids encoding intermediate reactions for butyrate production on E. coli strain PMD75.

Glucose Fermentation Products [mM]
Plasmid consumed
[mM] Succ Lac For Ace Acetoin EtOH Butyrate

pTrc99a-vector 17.06 + 4.19 5.58 + 0.54 1.55 + 0.02 ND 1.04 + 0.78 ND ND 0.20 + 0.07
pTrc99a-atoB 27.18 6.12 2.54 0.51 0.75 0.04 ND 5.84 2.21 ND ND 0.39 0.04
pTrc99a-ccrA-udhA 23.21 + 2.65 2.89 0.02 1.39 0.08 ND 4.72 + 1.86 ND ND 0.31 + 0.02
pTrc99a-bcd/etfBA 29.30 + 3.87 1.05 + 0.02 1.08 + 0.09 ND 7.03 2.98 0.28 + 0.11 ND 3.08 + 0.21
pButyrate 31.73 4.72 ND 1.64 0.02 ND 12.77 2.11 0.53 0.00 0.68 0.02 2.47 0.10
E. coli strain PMD75 bearing the above plasmids were grown micro-aerobically in LB- ampicillin with 1.0 % glucose in partially
filled tubes at 37C for 72 hrs. Succ, succinate; lac, lactate; for, format; ace, acetate; EtOH, ethanol; ND, not detected.
























90 100 110 120 130 140 150 16


Elution Volume (ml)


Alcohol Dehydrogenase
150 kDa BSA
66.2 kDa Albumin
-42 kDa
4^ -- Carbonic
f ^ Anhydrase
NDH 29 kDa

0 100 110 120 130 140 150 160


Elution Volume (ml)

Figure 5-1. Native molecular weight ofNDH as determined by gel filtration. Sephacryl S-200
column was pre-equilibrated with 50 mM K-P04 buffer pH 7.5, 0.1 MNaC1, and 0.5
mM DTT at 4C. 5 ml of protein sample was loaded with the flow rate of 0.5 ml min-1
and 3.75 ml fractions were collected. NDH eluted as a heterodimer with a measured
molecular weight of 69.1 kDa.


1.E+06


1.E405


1.E+04









97.4 kDa
66.2 kDa llMi..

45.0 kDa -- N

SLkD NdhE


21.5 kDa -

14.4 kDa ---
1 2 3 4 5 6 7 8 9

Figure 5-2. SDS-PAGE of recombinant NDH expressed in E. coli induced by IPTG or
arabinose. Rosetta (XDE3) bearing pPMD40 was induced with IPTG (lanes 1-6) or
arabinose (lanes 7-9). Proteins were separated by reducing SDS-PAGE (12.5 %
acrylamide). Lane 1, Protein standards; Lane 2, uninduced cells; Lane 3, IPTG
induced cells; Lane 4, soluble crude extract (10 jig); Lane 5, after Ni2+ column (5 jig);
Lane 6, after Thrombin digestion followed by Sephacryl S-200 gel filtration (5 itg);
Lane 7, arabinose induced soluble crude extract (5 jig); Lane 8, after Ni2+ column (1
itg); Lane 9, after Thrombin digestion followed by Sephacryl S-200 gel filtration (1
Itg).









13

12

11



E1
8 -

| 7

^ 6 ----
6.5 6.75 7 7.25 7.5 7.75 8

pH

Figure 5-3. pH profile ofNDH activity in phosphate buffer. Activity was determined as
described in Table 5-1. Optimal pH for NDH activity was determined to be about 7.5
-8.0 in phosphate buffer.












0.12
0.4


.0.3C



-0.1
| 0 0
S Reoxidizedduced
0.02- Reduced Reduced 0.1


300 350 400 450 500 550 600 300 350 400 450 500 550 600
Wavelength (nm) Wavelength (nm)


Figure 5-4. Absorption spectrum of recombinant T vaginalis hydrogenosome NDH or NDH-
small subunit. Native spectrum represents the protein as purified. Reduced spectrum
was obtained after titrating the protein with sodium dithionite. Reoxidized spectrum
was obtained after gently mixing the reduced protein with air. [Reprinted with
permission from Do, P. M., A. Angerhofer, I. Hrdy, L. Bardonova, L. O. Ingram, and
K. T. Shanmugam. 2009. Engineering Escherichia coli for fermentative dihydrogen
production: potential role ofNADH-ferredoxin oxidoreductase from the
hydrogenosome of anaerobic protozoa. Appl Biochem Biotechnol 153:21-33. (Page
28, Figure 2)]
















1.0


6-W
S0.5



5 -0.5

-1.0
S1.951
-1.5
I I 11.917
320 340 360 380
Magnetic Field [mT]


Figure 5-5. EPR spectrum of the recombinant T. vaginalis hydrogenosome NDH holoenzyme
produced in E. coli. Spectrum of the holoenzyme (123.3 LM) was recorded at a
microwave power of 2.0 mW after reducing the protein with sodium dithionite. EPR
conditions: sample temperature, 250K; microwave frequency, 9.45801 GHz;
modulation amplitude, 5G; modulation frequency, 100 kHz; time constant, 80 ms;
scan rate, 160 ms/data point for 4.9 G/s, 0.78 G/data point, receiver gain 60 dB.
Wavy lines represent the experimental data and the smooth line is the simulation of
the spectrum. [Reprinted with permission from Do, P. M., A. Angerhofer, I. Hrdy, L.
Bardonova, L. O. Ingram, and K. T. Shanmugam. 2009. Engineering Escherichia coli
for fermentative dihydrogen production: potential role ofNADH-ferredoxin
oxidoreductase from the hydrogenosome of anaerobic protozoa. Appl Biochem
Biotechnol 153:21-33 (Page 29, Figure 3)]













4 ~Iuiauon I










2 -

1.953
-4
1.920

320 340 360 380
Magnetic Field [mT]


Figure 5-6. EPR spectrum of NdhE (small subunit) of the T vaginalis NDH produced in E. coli.
Spectrum of the small subunit (121.0 [tM) was obtained after reducing the protein
with sodium dithionite. Other conditions were as listed for Figure 5-5. [Reprinted
with permission from Do, P. M., A. Angerhofer, I. Hrdy, L. Bardonova, L. O. Ingram,
and K. T. Shanmugam. 2009. Engineering Escherichia coli for fermentative
dihydrogen production: potential role ofNADH-ferredoxin oxidoreductase from the
hydrogenosome of anaerobic protozoa. Appl Biochem Biotechnol 153:21-33 (Page
30, Figure 4)]











-0
O 0.9

















O
> 0.8 --
LU
N
XI 0.7 -----
oJ
o 0.6 --







OD @ 420 nm Abs. @ 600 mole H EvolpTrc99a-NdhEF
0.4

0.3

0u0.2

C. 0.1
0
0
OD @ 420 nm Abs. @ 600 pmole H2 Evolved

Figure 5-7. Effect ofNDH on whole cell reduction of methyl viologen and H2 evolution in
overnight cultures of MV resistant PMD45. MV resistant cells with indicated
plasmids were inoculated in 1 ml of LB, 0.3 % glucose, 100 tg ml-1 ampicillin, and 1
mM MV in 13 x 100 mm tubes which were sealed with a rubber stopper and N2 as the
gas phase. The cultures were incubated for 17hrs at 37C. Optical densities of
cultures were determined at 420 nm and 600 nm. Since cells naturally scatter light at
600 nm, measurements at 600 nm were adjusted for reduced MV by subtracting the
OD contributed by the cells. (n=4)












#...... .. : ..... *:.:. *.* .... .. **.::., #:. ## *.# ..*# ... *# # .......... # ......................... ## ..... # ...... # ........... ... #.
C.acetobuty -------- ILNGHN NXDDITILE- ------- NNDIMLCFLXDCG- G--KC- C-G 4 G. CGDGMI SDf7 I S|LLDKH CGQCSNK~C IaII3KEKSgCl DD 129
T.vaginalis BS K ------------ --- AN- -- SL-K--D---YB-- -GIQCIN-CQ- -C--T- N-------------- ----------- *Q- N -----------L---KS 54
P.graUssi -------- QS -G-- ---- -- CLSL- ---- D---LSSSBF F-NQA--CVTG-C- --- -- C-------- N ----------------------- Q-----N -----.---------- -K- 60
Unknown -------- --------- --------------------D---SSSFY-NQA--CT-C- ----- C--I- ------- --- -------------Q----- ----- ----------- 40
1... ... .10........20...... 30....... .40........50........60........70........80........90 .......100.......110 ...... 120 .......130.......140.......150



..: ........ ::.:#.#. .... *.... :.#....*...... ...... : .. # .* # #*,####...# #:*:.. #:... ...... # *..# ..*.#.. ##..#.* : # ....#. #. .*. ##.. :*#...###
C.acetobuty Nfl4D^SIi U fiE lCLC PCE NII Q SC GIDG Dq-CLDDSB-I-CLLCOQCV IC- L-KHI--EKVQTL--NE --KHI-ST I-gGY--z -- LY- LRML 262
T.vaginalis -N------S---l --- -- ---T------G------ ---L--A iCISCOQ CLl -l l---INOR-L N L--- L LKRLD 150
P.grassii ----T----- ID-S --- --D ---I---------G- -L-- -NCIGCGQ-i--EI--ILSL-KN--KKG- Q NLSF--- G-- UG S-LKXI 155
Unknown ----N------GA--- -- --I----T-IR---I----H- -----ID---L-- CIGCGQCUDI-cG --DDV- -KLWKNL-KN- -QG -V llNI L---GL G GNS --GIL -SlLKLG1D 134
... ...160 .......170.......180.......190.......200 .......210 ...... 220.......230.......240 .......250.......260 .......270 .......280.......290.......300



*###..#.####.###### *.# #:.**" ########### ....##* #,.**.###*.##*.*..... #...*... .. :..#: ::#:####..##...#.. ..#.. # ..... ..# # ###...
C.acetobuty I I l LL NN-- N NGIQNYH---- ELLDNLSSAK QIFG-- GI--- ---Y NDTDI N--LDID--S 386
T.vaginalis lLSDiKN- icc ----N C -O---I -DK--IYL R---D--- -ISPTNIDGEQ- 276
P.grassii LU: --K-0 ----N- D:L::CK A I--I-L SG-Q- 279
Unknown TD ILT0NI- ----N... L- -NL fl----9-- ---D---- I ALANDG-N I LIL 259
... ...310 .......320.......330 .......340....... 350.......360.......370 .......380 .......390.......400.......410. ......420 .......430.......440.......450



##..## #....*#.. .# .#. ##...#:#.t'# :####t###.##.*: *.*:#...# ..!:# #.. .#.#! .##!. #...##.:# ..#....' **! #. .#... # .########*.
C.acetobuty IIIKI --KDLDGII~DD-.- -G|YSGI Gl G lK A-E NILNVD-Y -GIKE-- 1 N- -KLIlNG-S ------- SG ----KM- -- NEEKQYHI GCIN 504
T.vaginalis IKE KINFE-- -D -TPCDNFYS S--U- CGG VsYI- LKLAPID-LQD -G-VASGVIDITGK- -AHGIKE- TLIKKI-KSGQED-- ---K---V 398
P.grassii ISKIDY -KYDKLY- -EYG - IGSlSG6 YO-I S ALSQLDIL- l G-ID-GI INGST- -CQ -- --KKLVEKIOK-- - GGN 401
Unknown IKQQKIDYSB-- LD -I|DKLY- -lI--GS--G q IGSSG I IIEYGI -II4NLD-IIUG-K- DGT- Ta INGQKIX- -CQGG- --S-LLSXI-KS----- NL--- c N 381
... ...460 ......470.......480...... .490...... .500.......510.......520 ... ... 530 ...... 540 .......550.......560 ...... .570...... .580.......590.......600



###. ..... #...*.# .... # :.# # .. #: ...# #.#.*#..!: #. .... # ..##..##.. .#.-. #...#..
C.acetobuty GGGH LDREN --DYK -L-L- YNQDKNLS- --I SHDNAII .------- KMYDSY -(G-3GV KLLIKYlD- -- -KNSKH l 582
T.vaginalis GGG ---KTKI -QA --- ----L YSIDKSY -S--KHTSQANL--L-Q--LYK CGK --GHV- -HLLH-- -Y---KNR-KVLS 468
P.grassii GGG0 -- N -QD---- GA-L--- --SNLKBvSLDNSLLYRSL-KG----- ---- L-- KB--S---- 467
Unknown GGGU L--SK ---- EQB-L---YSIDAA--S|Y--IE BH ILYQJYL-K ---- ----I LL---I IKT--K--- 449
......610 .......620.......630.......640.......650.......660.......670.......680 .......690 .......700.





Figure 5-8. Primary sequence alignment of HydA from C. acetobutylicum, T vaginalis, P. grassii, and a symbiont from the hindgut
of R.flavipes. The isolated hydrogenase gene from the unknown symbiont had an Evalue of 4 x 10-174 with 67 % amino acid
identity and 81 % overall similarity to [Fe]-hydrogenase to P. grassii. The isolated hydrogenase also had high similarity to
T vaginalis HydA (Evalue = 1 x 10-127) and to a lesser extent to C. acetobutylicum (Evalue = 3 x 10-88). Protein alignment was
performed with ClustalG ver. 1.5. Symbol legend: #, fully conserved; *, highly conserved; :, moderately conserved;.,
weakly conserved or not significant; -, gap.














14


12


a" 10
0

I8





2


2


20 40 60 80 100


Time (hrs)

Figure 5-9. Effect of NDH and GutHyd on hydrogen production. E. coli strain PMD45 with
pTrc99a-ndhEF-gutHyd or pTrc99a vector control were grown in 5 ml LB-amp-kan
with 0.3 % glucose in 9 ml vial sealed with rubber septum and degassed with N2. The
cultures were incubated at 370C and H2 in the gas phase was determined by GC.
Fermentation profile of these cultures was determined by HPLC after 120 hrs (Figure
5-10). (n=2)


* pTrc99a
* pTrc99a-ndhEF-gutHyd


















* pTrc99a
* pTrc99a-ndhEF-gutHyd


Figure 5-10. Effect ofNDH and GutHyd on fermentation profile ofE. coli strain PMD45. The
fermentation products are from cultures after 120 hrs. (Figure 5-9) of incubation at
37C.


L

































Figure 5-11. HPLC profile of in vitro production of 1-butanol from acetyl-CoA. 1 unit ([tmole
min-) of each enzyme listed in Table 5-4 minus ThlB and AdhE2 were incubated
together in 0.5 ml 50 mM K-P04 pH 7.6 assay buffer containing 5 mM acetyl-CoA,
10 mM NADH, and 10 mM NADPH. The reaction mixture was incubated at 37C
for 30 minutes, after which 1 unit of AdhE2 and 10 mM additional NADH were
added and the reaction was continued for an additional 30 minutes. Samples were
taken before enzymes were added, prior to the addition of AdhE2, and at the end of
incubation with all enzymes. HPLC was used to determine the production of butanol
and pathway intermediates.








Sp. Activity (Kcat)b


2 Acetyl-CoA
ThIA I
Acetoacetyl-CoA
Hbd _-NADH
T NAD-
Hydroxybutyryl-CoA


Crotonyl-CoA
CcrA NAD(P)H
r: NAD(P)'
Butyryl-CoA
'L- NADH
AdhE2 7 NAD-

Butyraldehyde
AdhE2 NADH
NAD"
Butanol


14.0(85.6)


209.5 (459.1)


799.5 (1572)


7.59(11.2)



0.7


0.7


Figure 5-12. Relative specific activities of functionally expressed recombinant enzymes in E.
coli. Relative activities listed in Table 5-4 are pictorially represented by the thickness
of the arrow. Since Bcd/EtfBA had no detectable activity, it was replaced by its
analogue, NADPH-dependent CcrA from S. avermitilis. The pathway is now
complete and can be combined to produce butanol in vitro. atmole min' mg protein-';
b -1
S














* **.., ..,
', .. .. ..


3 r

.5


0 50 100


150 200


0 50 100


150 200


Time (hours)


Time (hours)


I \
-^


E 1.5
4-


Cu


0 50 100 150


A ii--I



/ r
^* :^
,..*;;


0 50 100


150 200


Time (hours)


Time (hours)


Figure 5-13. Growth, pH, pyruvate, and butyrate production from PMD76 with pH control.
Cultures were grown in 1 % glucose minimal medium starting at pH 7.0. pH
controllers set to 7.0 (diamonds), 6.5 (circles), 6.0 (triangles), and 5.0 (squares).


-A ------ A------A ------ A ---------


------------I
'%

-- .....! .........


7 a:. *
""::g
a


25

S20

15
L1


+111. A









CHAPTER 6
SUMMARY AND CONCLUSIONS

Increasing demand for fuel and a finite supply of petroleum reserve dictate that a new

alternative renewable energy sources be developed in order to free the world from the bond of

fossil fuels. Current use of ethanol as a gasoline additive is an excellent step towards an energy

independent country and a "greener" future; however, physical constraints of ethanol as a fuel

along with the higher cost of transportation makes ethanol a less desirable transportation fuel.

New fuels currently in development that could replace gasoline include hydrogen and higher

chain alcohols such as butanol.

Hydrogen

The development of hydrogen as a fuel has been a work in progress for over 30 years.

Hydrogen is a highly attractive energy source due to the extremely high energy content and clean

combustion producing water as the only product. Currently, hydrogen is primarily produced by

steam reforming of methane, a limited fossil fuel. Biological production of hydrogen may serve

as a renewable source of fuel since it involves the conversion of solar energy either directly

(photosynthetic hydrogen production) or indirectly fermentativee hydrogen production from

biomass). Fermentative hydrogen production involves the conversion of sugars, the monomeric

units of biomass, to hydrogen.

Fermentative hydrogen production could be economical if yields of 10 H2 per glucose

could be achieved (64); however, maximal theoretical yields of only 2 and 4 H2 per glucose

could be reached by facultative and strict anaerobic microbes, respectively. Facultative

anaerobes such as E. coli have the natural ability to fully oxidize glucose to CO2 producing up to

10 NAD(P)H as reducing equivalents. Strict anaerobes such as C. acetobutylicum and T.

vaginalis possess the ability to couple NADH oxidation to hydrogen evolution but cannot fully









oxidize all the carbons from glucose to CO2. The absence of a complete TCA cycle in strict

anaerobes limits the NADH production to only glycolysis. By combining the two systems,

NADH-dependent hydrogen production from strict anaerobes with the full TCA cycle from

facultative anaerobes, higher hydrogen yields of up to 10 H2 per glucose could be achieved.

Hydrogen production by strict anaerobes generally involves intermediate electron carriers such

as ferredoxin transferring electrons to soluble [Fe]-hydrogenase for H2 evolution. Pyruvate

oxidation by PFOR is the primary source of reduced ferredoxin produced in a coupled reaction.

The lesser known NFOR could directly couple NADH oxidation to ferredoxin. However, NFOR

activity is limited to few anaerobes; Clostridium (108, 124, 197) and anaerobic protozoan such as

Trichomonas (56, 94). Clostridial NFOR activity was recently determined to be a side reaction

of Bcd/EtfBA reduction of crotonyl-CoAto butyryl-CoA (55, 124). Since clostridial systems do

not have a true NFOR, the only other source of NFOR is the anaerobic protozoan.

The unique ability of this NDH to couple NADH oxidation to directly reduce a broad range

of electron acceptors including low potential ferredoxin, MV, and BV makes T vaginalis NDH

the only known member of NFOR class of enzymes. NDH is a heterodimer consisting of a

small (NdhE) and large (NdhF) subunit which have high homology to mitochondrial 24-kDa and

51-kDa subunits of NADH-dehydrogenase (NDH) of respiratory complex I (94). Recombinant

T vaginalis NDH expressed in E. coli also reduced these low potential electron acceptors (56).

H2 production from NADH using MV as an electron carrier may also require recombinant

expression of [Fe]-hydrogenase which currently only been accomplished with low activity.

Compatibility issues with traditional clostridial [Fe]-hydrogenase due to pH differences makes

its use with T vaginalis NDH less ideal. Hydrogenase from P. grassii isolated from termite

hindgut may serve as a possible alternative (99). The high activity of this hydrogenase without









maturation accessory proteins in E. coli may be more compatible with NDH since both enzymes

were hydrogenosome based in their native organisms. The best candidate for [Fe]-hydrogenase

cloned from symbiont portion ofR. flavipes hindgut had an Evalue of 4 x 10-174 with 67 % identity

and 81 % overall similarity to [Fe]-hydrogenase from P. grassii. This high homology did not

translate into functional expression of active enzyme without accessory proteins. It may be

essential to clone and express the hydrogenosomal proteins NDH, Fd, Fe-hydrogenase, and

accessory proteins together in E. coli to establish an NADH to H2 pathway in E. coli.

The thermodynamics of producing H2 from NADH is unfavorable requiring about +4.62

kcal mol-1 (AGo) (Equation 5-1) (Figure 6-1). The [NADH]/[NAD+] ratio required for

thermodynamically favorable reaction is 2390. The internal [NAD+]/[NADH] ratios appears to

be inadequate to shift the reaction to reduce sufficient amount of MV required to drive

continuous H2 evolution by HYD3. Overnight cultures of E. coli expressing NDH contained

only 0.060 mM reduced MV in a total of 1.0 mM MV. The actual redox potential (E) of MV at

this equilibrium ratio is -404 mV (Eo' = -440 mV). NDH needs to generate a MVred/MVox ratio

at least three to four fold higher to drive the electrons to hydrogenase and to H2 production, at an

Eo' of -420 mV.

This study attempted to improve hydrogen production by E. coli utilizing hydrogenosome

based NDH to couple NADH oxidation to low potential viologen dye reduction. Although

reduced methyl viologen failed to support high level of hydrogen production, this study

expanded our understanding of hydrogenosomal NDH from T vaginalis by providing an insight

of its capability and limitation in heterologous hosts. Future work in this area may involve

recombinant expression of enzymes/proteins from the same organism since they normally have

better protein-protein interactions than with heterologous enzymes. The expression of T.









vaginalis hydrogenosome ferredoxin (-347 mV) and a [Fe]-hydrogenase in an active form may

be required to achieve NADH dependent H2 production; however, given the thermodynamic

constraints of the system, in vivo NADH to H2 may still be difficult to accomplish even with

continuous H2 removal.

Butanol

Butanol is a 4-carbon alcohol that has many physical properties similar to gasoline. Its

high combustional energy yield and renewable biological production is of great interest in recent

years as a gasoline additive or even as a potential gasoline replacement. Butanol is produced by

fermentation by some members of the genus Clostridium, where the model organism is C.

acetobutylicum. Production of butanol is always accompanied by co-production of lower energy

value compounds such as acetone and ethanol. Attempts to eliminate side products and produce

a robust homo-butanol fermentating Clostridium had been unsuccessful (44, 87, 88, 120, 145,

234). The limited available genetic tools and fastidious nature of the strict anaerobes makes it a

less than ideal organism to engineer. An alternative to engineering clostridia for homo-butanol

production is to introduce the entire butanol pathway into a well-known non-producing organism

that is easy to manipulate. In this study, I explored the potential of E. coli to produce butanol as

a sole fermentation product.

The established butanol pathway enzymes were produced in a recombinant E. coli and

these enzymes did catalyze the sequential reactions from acetyl-CoA to butanol, in vitro.

However, in vivo, crotonyl-CoA reduction was found to be a rate-limiting step in this pathway

due to a unique need for alternative electron donor that is yet to be identified. Alternative

enzyme such as CcrA is fraught with NADPH requirement since the pool of NADPH in an

anaerobic cell is not high enough to drive this reaction towards high butanol yield. However, the

in vitro production of butanol provided the proof of principle that E. coli could functionally









produce the enzymes required for the production of butanol from acetyl-CoA, provided

appropriate electron donors can be generated in vivo.

pH controlled fermentations revealed the optimal pH for butyrate production was about 6.0

producing about three times more butyrate than at pH 7.0. Multiple copies of bcd-etfBA

improved butyrate production suggesting that Bcd/EtfBA protein level was not at par with the

rest of the pathway. One proposed method for increasing butyrate production was to insert

additional copies of bcd-etfBA into the chromosome under control of highly expressed

promoters.

Directed evolution had been an instrument used for strain development for industrial grade

production of compounds and adaptation to less than desirable media conditions (43, 103, 104,

111, 135, 227, 231, 235). Since the chromosomal inserts of the butanol pathway are stable,

directed evolution by serial transfers could be implemented to select for improved productivity

with the key focus on enhancing Bcd/EtfBA protein level and activity. The recombinant E. coli

with butanol/butyrate genes produced in this study could be a good platform organism for the

evolution of a biocatalyst for butyrate/butanol production.

Future work in this area may include the identification of the specific Bcd/EtfBA electron

donor. The expression of clostridial ferredoxin may be required for effective Bcd activity. Li et

al. demonstrated that the Bcd/EtfBA complex couples NADH-dependent reduction of crotonyl-

CoA and ferredoxin (124) and suggest ferredoxin may perhaps serve as an electron bridge

between Bcd and EtfBA components. Reduced electron carriers such as MV and DCPIP has

been demonstrated to couple to crotonyl-CoA reduction (55). Since T vaginalis NDH reduced

these electron carriers, the use of NDH with the appropriate electron carrier may increase Bcd

activity. Mutations in IpdA has been demonstrated to increase the PDH activity under anaerobic









growth condition supplying an additional 2 NADH (111, 112) that could help maintain redox

balance during butanol production. An alcohol dehydrogenase specific for butyryl-

CoA/butyraldehyde may need to be engineered to eliminate co-production of ethanol with

butanol. Overcoming these rate-limiting steps is expected to yield a microbial biocatalyst that

can catalyze the production of butanol as the main fermentation product and at high yield from

biomass-derived sugars.








AG= +2.31 kcal mol- AG= +3.23 kcal mol-1 AG= -0.92 kcal mol-1
NADH --- NFOR MV HYD3


(-320 mV)


(-370 mV)b


(-440 mV)


AG= -1.06 kcal mol


(-33


-1 AG= -0.92 kcal mol-1
AG= +3.37 kcal mol-1
Fd -- [Fe]-Hyd H2
17 mV)a (-420 mV)


LG= +4.62 kcal mol-i

Figure 6-1. Thermodynamics of the NADH-dependent hydrogen production pathway. The
values in parentheses represent the standard midpoint potential (Eo') of the respective
component. H2 from NADH is a thermodynamically unfavorable reaction with AG of
+4.62 kcal mol-1. a T. vaginalis ferredoxin (205, 206); b NDH N1a cluster









APPENDIX
REPRINT PERMISSION OF PUBLISHED MATERIALS

A portion of the Chapter 5: Results Biochemical Characterization ofNFOR (NDH) from

T vaginalis was previously published by Springer Science + Business Media and Copyright

Clearance Center's Rightslink1 (56). Written permission from the publisher was given on June

17 and 22, 2009 to reproduce text, excerpts, and figures (Figures 5-4, 5-5, and 5-6 and Tables 5-2

and 5-3) with license numbers 2214350581080, 2211440942274, and 2211440754680,

respectively, for use in the doctoral dissertation of Phi Minh Do, the first author of the above

publication.































1 Do, P. M., A. Angerhofer, I. Hrdy, L. Bardonova, L. O. Ingram, and K. T. Shanmugam. 2009. Engineering
Escherichia coli for fermentative dihydrogen production: potential role of NADH-ferredoxin oxidoreductase from
the hydrogenosome of anaerobic protozoa. Appl BiochemBiotechnol 153:21-33.









LIST OF REFERENCES


1. Adams, M. W., and L. E. Mortenson. 1984. The physical and catalytic properties of
hydrogenase II of Clostridium pasteurianum. A comparison with hydrogenase I. J Biol
Chem 259:7045-7055.

2. Adams, M. W., L. E. Mortenson, and J. S. Chen. 1980. Hydrogenase. Biochim
Biophys Acta 594:105-176.

3. Alexeeva, S., K. J. Hellingwerf, and M. J. Teixeira de Mattos. 2003. Requirement of
ArcA for redox regulation in Escherichia coli under microaerobic but not anaerobic or
aerobic conditions. J Bacteriol 185:204-209.

4. Almeida, J. R., M. Bertilsson, M. F. Gorwa-Grauslund, S. Gorsich, and G. Liden.
2009. Metabolic effects of furaldehydes and impacts on biotechnological processes. Appl
Microbiol Biotechnol 82:625-638.

5. Alsaker, K. V., and E. T. Papoutsakis. 2005. Transcriptional program of early
sporulation and stationary-phase events in Clostridium acetobutylicum. J Bacteriol
187:7103-7118.

6. Amann, E., B. Ochs, and K. J. Abel. 1988. Tightly regulated tac promoter vectors
useful for the expression ofunfused and fused proteins in Escherichia coli. Gene 69:301-
315.

7. Amore, R., P. Kotter, C. Kuster, M. Ciriacy, and C. P. Hollenberg. 1991. Cloning
and expression in Saccharomyces cerevisiae of the NAD(P)H-dependent xylose
reductase-encoding gene (XYL1) from the xylose-assimilating yeast Pichia stipitis. Gene
109:89-97.

8. Asada, Y., Y. Koike, J. Schnackenberg, M. Miyake, I. Uemura, and J. Miyake. 2000.
Heterologous expression of clostridial hydrogenase in the cyanobacterium Synechococcus
PCC7942. Biochim Biophys Acta 1490:269-278.

9. Asada, Y., and J. Miyake. 1999. Photobiological hydrogen production. J Biosci Bioeng
88:1-6.

10. Asadullah, M., S. Ito, K. Kunimori, M. Yamada, and K. Tomishige. 2002. Energy
efficient production of hydrogen and syngas from biomass: development of low-
temperature catalytic process for cellulose gasification. Environ Sci Technol 36:4476-
4481.

11. Atiyeh, H., and Z. Duvnjak. 2002. Production of fructose and ethanol from sugar beet
molasses using Saccharomyces cerevisiae ATCC 36858. Biotechnol Prog 18:234-239.

12. Atsumi, S., A. F. Cann, M. R. Connor, C. R. Shen, K. M. Smith, M. P. Brynildsen,
K. J. Chou, T. Hanai, and J. C. Liao. 2008. Metabolic engineering of Escherichia coli
for 1-butanol production. Metab Eng 10:305-311.









13. Atta, M., M. E. Lafferty, M. K. Johnson, J. Gaillard, and J. Meyer. 1998.
Heterologous biosynthesis and characterization of the [2Fe-2S]-containing N-terminal
domain of Clostridium pasteurianum hydrogenase. Biochemistry 37:15974-15980.

14. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. A. Smith, J. G. Seidman,
and K. Struhl. 1987. Current Protocols in Molecular Biology. Greene Publishing
Associates and Wiley-Interscience, Brooklyn, NY.

15. Badger, P. C. 2002. Ethanol from cellulose: A General Review, p. 17-21. In J. J. and W.
A. (ed.), Trends in new crops and new uses. ASHA Press, Alexandria, VA.

16. Badziong, W., R. K. Thauer, and J. G. Zeikus. 1978. Isolation and characterization of
Desulfovibrio growing on hydrogen plus sulfate as the sole energy source. Arch
Microbiol 116:41-49.

17. Ballantine, S. P., and D. H. Boxer. 1986. Isolation and characterisation of a soluble
active fragment of hydrogenase isoenzyme 2 from the membranes of anaerobically grown
Escherichia coli. Eur J Biochem 156:277-284.

18. Baranenko, V. I., and V. S. Kirov. 1989. Solubility of hydrogen in water in a broad
temperature and pressure range. Atomic Energy 66:24-28.

19. Basso, L. C., H. V. de Amorim, A. J. de Oliveira, and M. L. Lopes. 2008. Yeast
selection for fuel ethanol production in Brazil. FEMS Yeast Res 8:1155-1163.

20. Benemann, J. 1996. Hydrogen biotechnology: progress and prospects. Nat Biotechnol
14:1101-1103.

21. Benemann, J. R., J. A. Berenson, N. O. Kaplan, and M. D. Kamen. 1973. Hydrogen
evolution by a chloroplast-ferredoxin-hydrogenase system. Proc Nat Acad Sci 70:2317-
2320.

22. Benemann, J. R., and A. San Pietro. 2001. Technical workshop on biological hydrogen
production, Final Report to the US Department of Energy, Hydrogen R&D Program,
Bethesda, MD.

23. Berman-Frank, I., P. Lundgren, Y. B. Chen, H. Kupper, Z. Kolber, B. Bergman,
and P. Falkowski. 2001. Segregation of nitrogen fixation and oxygenic photosynthesis in
the marine cyanobacterium Trichodesmium. Science 294:1534-1537.

24. Bernhard, M., B. Benelli, A. Hochkoeppler, D. Zannoni, and B. Friedrich. 1997.
Functional and structural role of the cytochrome b subunit of the membrane-bound
hydrogenase complex ofAlcaligenes eutrophus H16. Eur J Biochem 248:179-186.

25. Bettiga, M., B. Hahn-Hagerdal, and M. F. Gorwa-Grauslund. 2008. Comparing the
xylose reductase/xylitol dehydrogenase and xylose isomerase pathways in arabinose and
xylose fermenting Saccharomyces cerevisiae strains. Biotechnol Biofuels 1:16.









26. Black, L. K., C. Fu, and R. J. Maier. 1994. Sequences and characterization of hupU
and hup V genes of Bradyrhiobiumjaponicum encoding a possible nickel-sensing
complex involved in hydrogenase expression. J Bacteriol 176:7102-7106.

27. Blankenship, R. E., P. Cheng, T. P. Causgrove, D. C. Brune, S.-H. Wang, J. U.
Choh, and J. Wang. 1993. Redox regulation of energy transfer efficiency in antennas of
green photosynthetic bacteria. Photochem Photobiol 57:103-107.

28. Bick, A., and G. Sawers. 1996. Fermentation, p. 262-282. In F. C. Neidhardt, et al.
(ed.), Escherichia coli and Salmonella: Cellular and Molecular Biology, 2nd ed. ASM
Press, Washington, DC.

29. Bonaventura, C., and J. Myers. 1969. Fluorescence and oxygen evolution from
Chlorellapyrenoidosa. Biochim Biophys Acta 189:366-383.

30. Bothast, R. J., N. N. Nichols, and B. S. Dien. 1999. Fermentations with new
recombinant organisms. Biotechnol Prog 15:867-875.

31. Bothast, R. J., and M. A. Schlicher. 2005. Biotechnological processes for conversion of
corn into ethanol. Appl Microbiol Biotechnol 67:19-25.

32. Boynton, Z. L., G. N. Bennet, and F. B. Rudolph. 1996. Cloning, sequencing, and
expression of clustered genes encoding beta-hydroxybutyryl-coenzyme A (CoA)
dehydrogenase, crotonase, and butyryl-CoA dehydrogenase from Clostridium
acetobutylicum ATCC 824. J Bacteriol 178:3015-3024.

33. Boynton, Z. L., G. N. Bennett, and F. B. Rudolph. 1996. Cloning, sequencing, and
expression of genes encoding phosphotransacetylase and acetate kinase from Clostridium
acetobutylicum ATCC 824. Appl Environ Microbiol 62:2758-2766.

34. Bradford, M. M. 1976. A rapid and sensitive method for the quantitation of microgram
quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248-
254.

35. Brandt, U. 2006. Energy converting NADH:quinone oxidoreductase (complex I). Annu
Rev Biochem 75:69-92.

36. Brat, D., E. Boles, and B. Wiedemann. 2009. Functional expression of a bacterial
xylose isomerase in Saccharomyces cerevisiae. Appl Environ Microbiol 75:2304-2311.

37. Brazzolotto, X., J. K. Rubach, J. Gaillard, S. Gambarelli, M. Atta, and M.
Fontecave. 2006. The [Fe-Fe]-hydrogenase maturation protein HydF from Thermotoga
maritima is a GTPase with an iron-sulfur cluster. J Biol Chem 281:769-774.

38. Brodersen, J., G. Gottschalk, and U. Deppenmeier. 1999. Membrane-bound F420H2-
dependent heterodisulfide reduction in Methanococcus voltae. Arch Microbiol 171:115-
121.









39. Brown, L. C., R. D. Lentsch, G. E. Besenbruch, and K. R. Schultz. 2003. Alternative
flowsheets for the sulfur-iodine thermochemical hydrogen cycle, Spring 2003 National
Meeting of American Insitute of Chemical Engineers. GA- A24266, New Orleans, La.

40. Buhrke, T., O. Lenz, N. Krauss, and B. Friedrich. 2005. Oxygen tolerance of the H2-
sensing [NiFe] hydrogenase from Ralstonia eutropha H16 is based on limited access of
oxygen to the active site. J Biol Chem 280:23791-23796.

41. Bush, G. W. 2003. Fact Sheet: Hydrogen Fuel: a clean and secure energy future.:[
http://www.whitehouse.gov/news/releases/2003/02/20030206-2.html ].

42. Bush, G. W. Feb 27, 2003. Statement by the president.: [
http://www.whitehouse.gov/news/releases/2003/02/20030227-1 1.html ].

43. Causey, T. B., K. T. Shanmugam, L. P. Yomano, and L. O. Ingram. 2004.
Engineering Escherichia coli for efficient conversion of glucose to pyruvate. Proc Natl
Acad Sci 101:2235-2240.

44. Chen, C. K., and H. P. Blaschek. 1999. Acetate enhances solvent production and
prevents degeneration in Clostridium beijerinckii BA101. Appl Microbiol Biotechnol
52:170-173.

45. Cline, J. D. 1969. Spectrophotometric determination of hydrogen sulfide in natural
waters. Limnology and Oceanography 14:454-458.

46. Cohen, J., K. Kim, P. King, M. Seibert, and K. Schulten. 2005. Finding gas diffusion
pathways in proteins: application to 02 and H2 transport in CpI [FeFe]-hydrogenase and
the role of packing defects. Structure 13:1321-1329.

47. Colby, G. D., and J. S. Chen. 1992. Purification and properties of 3-hydroxybutyryl-
coenzyme A dehydrogenase from Clostridium beijerinckii ("Clostridium butylicum")
NRRL B593. Appl Environ Microbiol 58:3297-3302.

48. Cornillot, E., R. V. Nair, E. T. Papoutsakis, and P. Soucaille. 1997. The genes for
butanol and acetone formation in Clostridium acetobutylicum ATCC 824 reside on a
large plasmid whose loss leads to degeneration of the strain. J Bacteriol 179:5442-5447.

49. Crozier, T. E., and S. Yamamoto. 1974. Solubility of hydrogen in water, seawater, and
NaCl solutions. J Chem Eng Data 19:242-244.

50. da Silva Filho, E. A., H. F. de Melo, D. F. Antunes, S. K. dos Santos, A. do Monte
Resende, D. A. Simoes, and M. A. de Morais, Jr. 2005. Isolation by genetic and
physiological characteristics of a fuel-ethanol fermentative Saccharomyces cerevisiae
strain with potential for genetic manipulation. J Ind Microbiol Biotechnol 32:481-486.

51. Datsenko, K. A., and B. L. Wanner. 2000. One-step inactivation of chromosomal genes
in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci 97:6640-6645.









52. de Graef, M. R., S. Alexeeva, J. L. Snoep, and M. J. Teixeira de Mattos. 1999. The
steady-state internal redox state (NADH/NAD) reflects the external redox state and is
correlated with catabolic adaptation in Escherichia coli. J Bacteriol 181:2351-2357.

53. Demple, B. 1991. Regulation of bacterial oxidative stress genes. Annu Rev Genet
25:315-337.

54. Dien, B. S., M. A. Cotta, and T. W. Jeffries. 2003. Bacteria engineered for fuel ethanol
production: current status. Appl Microbiol Biotechnol 63:258-266.

55. Diez-Gonzalez, F., J. B. Russell, and J. B. Hunter. 1997. NAD-independent lactate and
butyryl-CoA dehydrogenases of Clostridium acetobutylicum P262. Curr Microbiol
34:162-166.

56. Do, P. M., A. Angerhofer, I. Hrdy, L. Bardonova, L. O. Ingram, and K. T.
Shanmugam. 2009. Engineering Escherichia coli for fermentative dihydrogen
production: potential role ofNADH-ferredoxin oxidoreductase from the hydrogenosome
of anaerobic protozoa. Appl Biochem Biotechnol 153:21-33.

57. DOE. 2005. Property of Fuels. Department of Energy:
[http://www.eere.energy.gov/afdc/pdfs/fueltable.pdf].

58. Doherty, G. M., and S. G. Mayhew. 1992. The hydrogen-tritium exchange activity of
Megasphaera elsdenii hydrogenase. Eur J Biochem 205:117-126.

59. Dross, F., V. Geisler, R. Lenger, F. Theis, T. Krafft, F. Fahrenholz, E. Kojro, A.
Duchene, D. Tripier, and K. Juvenal. 1992. The quinone-reactive Ni/Fe-hydrogenase
of Wolinella succinogenes. Eur J Biochem 206:93-102.

60. Diirre, P. 2005. Formation of solvents in clostridia, p. 671-685. In P. Dtirre (ed.),
Handbook on Clostridia. CRC Press, Boca Raton.

61. Diirre, P., M. Bohringer, S. Nakotte, S. Schaffer, K. Thormann, and B. Zickner.
2002. Transcriptional regulation of solventogenesis in Clostridium acetobutylicum. J Mol
Microbiol Biotechnol 4:295-300.

62. Diirre, P., R. J. Fischer, A. Kuhn, K. Lorenz, W. Schreiber, B. Sturzenhofecker, S.
Ullmann, K. Winzer, and U. Sauer. 1995. Solventogenic enzymes of Clostridium
acetobutylicum: catalytic properties, genetic organization, and transcriptional regulation.
FEMS Microbiol Rev 17:251-262.

63. Eady, R. R. 1996. Structure function relationships of alternative nitrogenases. Chem.
Rev. 96:3013-3030.

64. Eggeman, T. 2004. Boundary analysis for H2 production by fermentation. National
Renewable Energy Laboratory:NREL/SR-560-36129.









65. EIA. 2009. Appendix A:reference case, p. 109-150, Annual energy outlook 2009: with
projections to 2030. Energy Information Administration, Washington D.C. : DOE/EIA-
0383(2009).

66. Elsen, S., A. Colbeau, J. Chabert, and P. M. Vignais. 1996. The hupTUVoperon is
involved in negative control of hydrogenase synthesis in Rhodobacter capsulatus. J
Bacteriol 178:5174-5181.

67. Fontaine, L., I. Meynial-Salles, L. Girbal, X. Yang, C. Croux, and P. Soucaille. 2002.
Molecular characterization and transcriptional analysis ofadhE2, the gene encoding the
NADH-dependent aldehyde/alcohol dehydrogenase responsible for butanol production in
alcohologenic cultures of Clostridium acetobutylicum ATCC 824. J Bacteriol 184:821-
830.

68. Gabriel, C. L. 1928. Butanol fermentation process. Ind. Eng. Chem. 20:1063-1067.

69. Gabriel, C. L., and F. M. Crawford. 1930. Development of the butyl-acetonic
fermentation industry. Ind. Eng. Chem. 22:1163-1165.

70. Gaffron, H., and J. Rubin. 1942. Fermentative and photochemical production of
hydrogen in algae. J. Gen. Physiol. 20:219-240.

71. Gest, H., and M. D. Kamen. 1949. Studies on the metabolism of photosynthetic
bacteria. J Bacteriol 58:239-245.

72. Girbal, L., G. von Abendroth, M. Winkler, P. M. Benton, I. Meynial-Salles, C.
Croux, J. W. Peters, T. Happe, and P. Soucaille. 2005. Homologous and heterologous
overexpression in Clostridium acetobutylicum and characterization of purified clostridial
and algal Fe-only hydrogenases with high specific activities. Appl Environ Microbiol
71:2777-2781.

73. Gitlitz, P. H., and A. I. Krasna. 1975. Structural and catalytic properties of hydrogenase
from Chromatium. Biochemistry 14:2561-2568.

74. Golden, J. W., and H. S. Yoon. 2003. Heterocyst development in Anabaena. Curr Opin
Microbiol 6:557-563.

75. Grabar, T. B., S. Zhou, K. T. Shanmugam, L. P. Yomano, and L. O. Ingram. 2006.
Methylglyoxal bypass identified as source of chiral contamination in L(+) and D(-)-
lactate fermentations by recombinant Escherichia coli. Biotechnol Lett 28:1527-1535.

76. Gray, C. T., and H. Gest. 1965. Biological formation of molecular hydrogen. Science
148:186-192.

77. Gray, K. A., L. Zhao, and M. Emptage. 2006. Bioethanol. Curr Opin Chem Biol
10:141-146.









78. Grupe, H., and G. Gottschalk. 1992. Physiological events in Clostridium
acetobutylicum during the shift from acidogenesis to solventogenesis in continuous
culture and presentation of a model for shift induction. Appl Environ Microbiol 58:3896-
3902.

79. Gutierrez, T., L. O. Ingram, and J. F. Preston. 2006. Purification and characterization
of a furfural reductase (FFR) from Escherichia coli strain LYO l--an enzyme important in
the detoxification of furfural during ethanol production. J Biotechnol 121:154-164.

80. Hahn-Hagerdal, B., K. Karhumaa, M. Jeppsson, and M. F. Gorwa-Grauslund. 2007.
Metabolic engineering for pentose utilization in Saccharomyces cerevisiae. Adv Biochem
Eng Biotechnol 108:147-177.

81. Hallahan, D. L., V. M. Fernandez, and D. O. Hall. 1987. Reversible activation of
hydrogenase from Escherichia coli. Eur J Biochem 165:621-625.

82. Hallenbeck, P. C. 2005. Fundamentals of the fermentative production of hydrogen.
Water Sci Technol 52:21-29.

83. Hans, M., E. Bill, I. Cirpus, A. J. Pierik, M. Hetzel, D. Alber, and W. Buckel. 2002.
Adenosine triphosphate-induced electron transfer in 2-hydroxyglutaryl-CoA dehydratase
from Acidaminococcusfermentans. Biochemistry 41:5873-5882.

84. Happe, T., and J. D. Naber. 1993. Isolation, characterization and N-terminal amino acid
sequence of hydrogenase from the green alga Chlamydomonas reinhardtii. Eur J
Biochem 214:475-481.

85. Happe, T., K. Schutz, and H. Bohme. 2000. Transcriptional and mutational analysis of
the uptake hydrogenase of the filamentous cyanobacterium Anabaena variabilis ATCC
29413. J Bacteriol 182:1624-1631.

86. Harden, A. 1901. The chemical action of Bacillus coli communis and similar organisms
on carbohydrates and allied compounds. J. Chem. Soc 79:601-618.

87. Harris, L. M., L. Blank, R. P. Desai, N. E. Welker, and E. T. Papoutsakis. 2001.
Fermentation characterization and flux analysis of recombinant strains of Clostridium
acetobutylicum with an inactivated solR gene. J Ind Microbiol Biotechnol 27:322-328.

88. Harris, L. M., R. P. Desai, N. E. Welker, and E. T. Papoutsakis. 2000.
Characterization of recombinant strains of the Clostridium acetobutylicum butyrate
kinase inactivation mutant: need for new phenomenological models for solventogenesis
and butanol inhibition? Biotechnol Bioeng 67:1-11.

89. Harvey, A. E. J., J. A. Smart, and E. S. Amis. 1955. Simultaneous spectrophotometric
determination of iron(II) and total Iron with 1,10-phenanthroline. Anal. Chem. 27:26-29.









90. Higuchi, Y., H. Ogata, K. Miki, N. Yasuoka, and T. Yagi. 1999. Removal of the
bridging ligand atom at the Ni-Fe active site of [NiFe] hydrogenase upon reduction with
H2, as revealed by X-ray structure analysis at 1.4 A resolution. Structure 7:549-556.

91. Hill, J., E. Nelson, D. Tilman, S. Polasky, and D. Tiffany. 2006. Environmental,
economic, and energetic costs and benefits ofbiodiesel and ethanol biofuels. Proc Natl
Acad Sci 103:11206-11210.

92. Homann, P. H. 2003. Hydrogen metabolism of green algae: discovery and early research
a tribute to Hans Gaffron and his coworkers. Photosynth Res 76:93-103.

93. Houchins, J. P., and R. H. Burris. 1981. Comparative characterization of two distinct
hydrogenases from Anabaena sp. strain 7120. J Bacteriol 146:215-221.

94. Hrdy, I., R. P. Hirt, P. Dolezal, L. Bardonova, P. G. Foster, J. Tachezy, and T. M.
Embley. 2004. Trichomonas hydrogenosomes contain the NADH dehydrogenase module
of mitochondrial complex I. Nature 432:618-622.

95. Ide, T., S. Baumer, and U. Deppenmeier. 1999. Energy conservation by the
H2:heterodisulfide oxidoreductase from '/lethmi,\ L ilma mazei Gol: identification of two
proton-translocating segments. J Bacteriol 181:4076-4080.

96. Ingram, L. O., H. C. Aldrich, A. C. Borges, T. B. Causey, A. Martinez, F. Morales,
A. Saleh, S. A. Underwood, L. P. Yomano, S. W. York, J. Zaldivar, and S. Zhou.
1999. Enteric bacterial catalysts for fuel ethanol production. Biotechnol Prog 15:855-866.

97. Ingram, L. O., T. Conway, D. P. Clark, G. W. Sewell, and J. F. Preston. 1987.
Genetic engineering of ethanol production in Escherichia coli. Appl Environ Microbiol
53:2420-2425.

98. Ingram, L. O., P. F. Gomez, X. Lai, M. Moniruzzaman, B. E. Wood, L. P. Yomano,
and S. W. York. 1998. Metabolic engineering of bacteria for ethanol production.
Biotechnol Bioeng 58:204-214.

99. Inoue, J., K. Saita, T. Kudo, S. Ui, and M. Ohkuma. 2007. Hydrogen production by
termite gut protests: characterization of iron hydrogenases of Parabasalian symbionts of
the termite Coptotermesformosanus. Eukaryot Cell 6:1925-32.

100. Inui, M., M. Suda, S. Kimura, K. Yasuda, H. Suzuki, H. Toda, S. Yamamoto, S.
Okino, N. Suzuki, and H. Yukawa. 2008. Expression of Clostridium acetobutylicum
butanol synthetic genes in Escherichia coli. Appl Microbiol Biotechnol 77:1305-1316.

101. Ito, T., Y. Nakashimada, T. Kakizono, and N. Nishio. 2004. High-yield production of
hydrogen by Enterobacter aerogenes mutants with decreased alpha-acetolactate synthase
activity. J Biosci Bioeng 97:227-232.









102. Jackson, D. D., and J. W. Ellms. 1896. On odors and taste of surface waters with
special reference to Anabaena, a microscopical organism found in certain water supplies
of Massachusetts. Rep Mass State Board Health.

103. Jantama, K., X. Zhang, J. C. Moore, K. T. Shanmugam, S. A. Svoronos, and L. O.
Ingram. 2008. Eliminating side products and increasing succinate yields in engineered
strains of Escherichia coli C. Biotechnol Bioeng 101:881-893.

104. Jarboe, L. R., T. B. Grabar, L. P. Yomano, K. T. Shanmugan, and L. O. Ingram.
2007. Development of ethanologenic bacteria. Adv Biochem Eng Biotechnol 108:237-
261.

105. Jeffries, T. W. 2006. Engineering yeasts for xylose metabolism. Curr Opin Biotechnol
17:320-6.

106. Jeffries, T. W., and Y. S. Jin. 2004. Metabolic engineering for improved fermentation
of pentoses by yeasts. Appl Microbiol Biotechnol 63:495-509.

107. Jones, D. T., and D. R. Woods. 1986. Acetone-butanol fermentation revisited. Microbiol
Rev 50:484-524.

108. Jungermann, K., R. K. Thauer, G. Leimenstoll, and K. Decker. 1973. Function of
reduced pyridine nucleotide-ferredoxin oxidoreductases in saccharolytic clostridia.
Biochim Biophys Acta 305:268-280.

109. Kabus, A., T. Georgi, V. F. Wendisch, and M. Bott. 2007. Expression of the
Escherichia colipntAB genes encoding a membrane-bound transhydrogenase in
Corynebacterium glutamicum improves L-lysine formation. Appl Microbiol Biotechnol
75:47-53.

110. Kern, M., W. Klipp, and J. H. Klemme. 1994. Increased nitrogenase-nependent H2
photoproduction by hup mutants ofRhodospirillum rubrum. Appl Environ Microbiol
60:1768-1774.

111. Kim, Y., L. O. Ingram, and K. T. Shanmugam. 2007. Construction of an Escherichia
coli K-12 mutant for homoethanologenic fermentation of glucose or xylose without
foreign genes. Appl Environ Microbiol 73:1766-1771.

112. Kim, Y., L. O. Ingram, and K. T. Shanmugam. 2008. Dihydrolipoamide
dehydrogenase mutation alters the NADH sensitivity of pyruvate dehydrogenase complex
ofEscherichia coli K-12. J Bacteriol 190:3851-3858.

113. King, P. W., M. C. Posewitz, M. L. Ghirardi, and M. Seibert. 2006. Functional studies
of [FeFe] hydrogenase maturation in an Escherichia coli biosynthetic system. J Bacteriol
188:2163-72.

114. Knoshaug, E. P., and M. Zhang. 2008. Butanol tolerance in a selection of
microorganisms. Appl Biochem Biotechnol 153:13-20.









115. Kotter, P., R. Amore, C. P. Hollenberg, and M. Ciriacy. 1990. Isolation and
characterization of the Pichia stipitis xylitol dehydrogenase gene, XYL2, and construction
of a xylose-utilizing Saccharomyces cerevisiae transformant. Curr Genet 18:493-500.

116. Krahn, E., R. Weiss, M. Krockel, J. Groppe, G. Henkel, P. Cramer, X. Trautwein,
K. Schneider, and A. Muller. 2002. The Fe-only nitrogenase from Rhodobacter
capsulatus: identification of the cofactor, an unusual, high-nuclearity iron-sulfur cluster,
by Fe K-edge EXAFS and 57Fe Mossbauer spectroscopy. J Biol Inorg Chem 7:37-45.

117. Krasna, A. I. 1984. Mutants of Escherichia coli with altered hydrogenase activity. J Gen
Microbiol 130:779-787.

118. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of
bacteriophage T4. Nature 227:680-685.

119. Lambden, P. R., and J. R. Guest. 1976. Mutants of Escherichia coli K12 unable to use
fumarate as an anaerobic electron acceptor. J Gen Microbiol 97:145-160.

120. Lee, S. Y., J. H. Park, S. H. Jang, L. K. Nielsen, J. Kim, and K. S. Jung. 2008.
Fermentative butanol production by clostridia. Biotechnol Bioeng 101:209-228.

121. Lehman, T. C., and C. Thorpe. 1990. Alternate electron acceptors for medium-chain
acyl-CoA dehydrogenase: use of ferricenium salts. Biochemistry 29:10594-105602.

122. Leonardo, M. R, Y. Dailly, and D. P. Clark. 1996. Role of NAD in regulating the
adhE gene of Escherichia coli. J Bacteriol 178:6013-6018.

123. Levanon, S. S., K. Y. San, and G. N. Bennett. 2005. Effect of oxygen on the
Escherichia coli ArcA and FNR regulation systems and metabolic responses. Biotechnol
Bioeng 89:556-564.

124. Li, F., J. Hinderberger, H. Seedorf, J. Zhang, W. Buckel, and R. K. Thauer. 2008.
Coupled ferredoxin and crotonyl coenzyme A (CoA) reduction with NADH catalyzed by
the butyryl-CoA dehydrogenase/etf complex from Clostridium kluyveri. J Bacteriol
190:843-850.

125. Liang, L., Y. P. Zhang, L. Zhang, M. J. Zhu, S. Z. Liang, and Y. N. Huang. 2008.
Study of sugarcane pieces as yeast supports for ethanol production from sugarcane juice
and molasses. J Ind Microbiol Biotechnol 35:1605-1613.

126. Licht, S. 2005. Thermochemical solar hydrogen generation. Chem Commun
(Camb):4635-4646.

127. Lin, Y., and S. Tanaka. 2006. Ethanol fermentation from biomass resources: current
state and prospects. Appl Microbiol Biotechnol 69:627-642.

128. Loach, P. A. 1968. Oxidation-reduction potentials, aborbance bands and molar
absorbance of compounds used in biochemical studies, p. J27-J34. In H. A. Sober (ed.),









Handbook of Biochemistry: Selected Data for Molecular Biology. The Chemical Rubber
Co., Cleveland, OH.

129. Logan, B. E., S. E. Oh, I. S. Kim, and S. Van Ginkel. 2002. Biological hydrogen
production measured in batch anaerobic respirometers. Environ Sci Technol 36:2530-
2535.

130. Ma, K., Z. H. Zhou, and M. W. Adams. 1994. Hydrogen production from pyruvate by
enzymes purified from hyperthermophilic archaeon, Pyrococcusfuriosus: A key role for
NADPH. FEMS Microbio Lett 122:245-250.

131. Macarron, R., C. Acebal, M. P. Castillon, J. M. Dominguez, I. de la Mata, G.
Pettersson, P. Tomme, and M. Claeyssens. 1993. Mode of action of endoglucanase III
from Trichoderma reesei. Biochem J 289 (Pt 3):867-873.

132. Mandal, B., K. Nath, and D. Das. 2006. Improvement ofbiohydrogen production under
decreased partial pressure of H2 by Enterobacter cloacae. Biotechnol Lett 28:831-835.

133. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular Cloning. Cold Spring
Harbor Laboratory, New York.

134. Markov, A. V., A. V. Gusakov, E. G. Kondratyeva, O. N. Okunev, A. O.
Bekkarevich, and A. P. Sinitsyn. 2005. New effective method for analysis of the
component composition of enzyme complexes from Trichoderma reesei. Biochemistry
(Mosc) 70:657-663.

135. Martinez, A., T. B. Grabar, K. T. Shanmugam, L. P. Yomano, S. W. York, and L.
O. Ingram. 2007. Low salt medium for lactate and ethanol production by recombinant
Escherichia coli B. Biotechnol Lett 29:397-404.

136. Melis, A., and T. Happe. 2004. Trails of green alga hydrogen research from Hans
Gaffron to new frontiers. Photosynth Res 80:401-409.

137. Melis, A., L. Zhang, M. Forestier, M. L. Ghirardi, and M. Seibert. 2000. Sustained
photobiological hydrogen gas production upon reversible inactivation of oxygen
evolution in the green alga Chlamydomonas reinhardtii. Plant Physiol 122:127-136.

138. Miller, J. H. 1992. A Short Course in Bacterial Genetics-A Laboratory Manual and
Handbook for Escherichia coli and Related Bacteria. Cold Spring Harbor Laboratory
Press, New York, NY.

139. Millichip, R. J., and H. W. Doelle. 1989. Large-scale ethanol production from Mil
(Sorghum) using Zymomonas mobilis. Process Biochem 24:141-145.

140. Mitsui, A., and S. Suda. 1995. Alternative and cyclic appearance of H2 and 02
photoproduction activities under non-growing conditions in an aerobic nitrogen-fixing
unicellular cyanobacterium Synechococcus sp. Curr Microbio 30:1-6.









141. Moock, N., B. Trapp, and D. Gallaspy. 2005. Presented at the Power-Gen International
Conference, Las Vegas, NV.

142. Mullany, P., C. L. Clayton, M. J. Pallen, R. Slone, A. al-Saleh, and S. Tabaqchali.
1994. Genes encoding homologues of three consecutive enzymes in the butyrate/butanol-
producing pathway of Clostridium acetobutylicum are clustered on the Clostridium
difficile chromosome. FEMS Microbiol Lett 124:61-67.

143. Murata, N. 1969. Control of excitation transfer in photosynthesis. I. Light-induced
change of chlorophyll a fluorescence in Porphyridium cruentum. Biochim Biophys Acta
172:242-251.

144. Nair, R. V., G. N. Bennett, and E. T. Papoutsakis. 1994. Molecular characterization of
an aldehyde/alcohol dehydrogenase gene from Clostridium acetobutylicum ATCC 824. J
Bacteriol 176:871-885.

145. Nair, R. V., E. M. Green, D. E. Watson, G. N. Bennett, and E. T. Papoutsakis. 1999.
Regulation of the sol locus genes for butanol and acetone formation in Clostridium
acetobutylicum ATCC 824 by a putative transcriptional repressor. J Bacteriol 181:319-
330.

146. Nandi, R., and S. Sengupta. 1998. Microbial production of hydrogen: an overview. Crit
Rev Microbiol 24:61-84.

147. Narayanan, N., M. Y. Hsieh, Y. Xu, and C. P. Chou. 2006. Arabinose-induction of lac-
derived promoter systems for penicillin acylase production in Escherichia coli.
Biotechnol Prog 22:617-625.

148. Nehring, R., M. zur Hausen, and W. Neumann. 1980. Process for working up
distillation residues from the hydroformylation of propene. US Patent number 4,190,731;
Ap. number 05/940,294.

149. Niba, L. L. 2005. Carbohydrates: starch. In Y. H. Hui (ed.), Handbook of food science,
technology, and engineering, vol. 1. Taylor and Francis, New York.

150. Nicolet, Y., C. Cavazza, and J. C. Fontecilla-Camps. 2002. Fe-only hydrogenases:
structure, function and evolution. J Inorg Biochem 91:1-8.

151. Nozaki, M., K. Tagawa, and D. I. Arnon. 1961. Noncyclic photophosphorylation in
photosynthetic bacteria. Proc Natl Acad Sci 47:1334-1340.

152. NRC, and NAE. 2004. The Hydrogen Economy: Opportunities, Cost, Barriers, and R&D
Needs. The National Academies Press, Washington, DC.

153. Ogino, H., T. Miura, K. Ishimi, M. Seki, and H. Yoshida. 2005. Hydrogen production
from glucose by anaerobes. Biotechnol Prog 21:1786-1788.









154. Ohnishi, T. 1998. Iron-sulfur clusters/semiquinones in complex I. Biochim Biophys Acta
1364:186-206.

155. Ohta, K., D. S. Beall, J. P. Mejia, K. T. Shanmugam, and L. O. Ingram. 1991.
Genetic improvement ofEscherichia coli for ethanol production: chromosomal
integration of Zymomonas mobilis genes encoding pyruvate decarboxylase and alcohol
dehydrogenase II. Appl Environ Microbiol 57:893-900.

156. Ostergaard, S., L. Olsson, and J. Nielsen. 2000. Metabolic engineering of
Saccharomyces cerevisiae. Microbiol Mol Biol Rev 64:34-50.

157. Pakes, W. C. C., and W. H. Jollyman. 1901. The bacterial decomposition of formic
acid into carbon dioxide and hydrogen. J. Chem. Soc 79:386-391.

158. Patel, M. A., M. S. Ou, R. Harbrucker, H. C. Aldrich, M. L. Buszko, L. O. Ingram,
and K. T. Shanmugam. 2006. Isolation and characterization of acid-tolerant,
thermophilic bacteria for effective fermentation ofbiomass-derived sugars to lactic acid.
Appl Environ Microbiol 72:3228-3235.

159. Peters, J. W., W. N. Lanzilotta, B. J. Lemon, and L. C. Seefeldt. 1998. X-ray crystal
structure of the Fe-only hydrogenase (CpI) from Clostridium pasteurianum to 1.8
angstrom resolution. Science 282:1853-1858.

160. Peters, J. W., R. K. Szilagyi, A. Naumov, and T. Douglas. 2006. A radical solution for
the biosynthesis of the H-cluster of hydrogenase. FEBS Lett 580:363-367.

161. Petersen, D. J., R. W. Welch, F. B. Rudolph, and G. N. Bennett. 1991. Molecular
cloning of an alcohol butanoll) dehydrogenase gene cluster from Clostridium
acetobutylicum ATCC 824. J Bacteriol 173:1831-1834.

162. Petersen, D. J., R. W. Welch, K. A. Walter, L. D. Mermelstein, E. T. Papoutsakis, F.
B. Rudolph, and G. N. Bennett. 1991. Cloning of an NADH-dependent butanol
dehydrogenase gene from Clostridium acetobutylicum. Ann N Y Acad Sci 646:94-98.

163. Petitdemange, H., C. Cherrier, R. Raval, and R. Gay. 1976. Regulation of the NADH
and NADPH-ferredoxin oxidoreductases in clostridia of the butyric group. Biochim
Biophys Acta 421:334-337.

164. Posewitz, M. C., P. W. King, S. L. Smolinski, L. Zhang, M. Seibert, and M. L.
Ghirardi. 2004. Discovery of two novel radical S-adenosylmethionine proteins required
for the assembly of an active [Fe] hydrogenase. J Biol Chem 279:25711-25720.

165. Prince, R. C., and H. S. Kheshgi. 2005. The photobiological production of hydrogen:
potential efficiency and effectiveness as a renewable fuel. Crit Rev Microbiol 31:19-31.

166. Qureshi, N., and H. P. Blaschek. 2001. ABE production from corn: a recent economic
evaluation. J Ind Microbiol Biotechnol 27:292-297.









167. Rabinowitz, J. 1972. Preparation and properties of clostridial ferredoxins. Methods
Enzymol 24:431-446.

168. Ramey, D. E. 2007. Butanol: the other alternative fuel, p. 137-147, Agricultural
Biofuels: Technology, Sustainability and Profitability. ButylFuel, LLC, Blacklick, OH.

169. Randt, C., and H. Senger. 1985. Participation of the two photosystems in light
dependent hydrogen evolution in Scenedesmus obliquus. Photochem. Photobiol. 42:553-
557.

170. Rogers P. L. K, L. J., Skotnicki M. L. and Tribe D. E. 1982. Ethanol production by
Zymomonas mobilis. Advances Biochem. Eng 23:37-84.

171. Rubach, J. K., X. Brazzolotto, J. Gaillard, and M. Fontecave. 2005. Biochemical
characterization of the HydE and HydG iron-only hydrogenase maturation enzymes from
Thermatoga maritima. FEBS Lett 579:5055-5060.

172. Sanchez, A. M., J. Andrews, I. Hussein, G. N. Bennett, and K. Y. San. 2006. Effect of
overexpression of a soluble pyridine nucleotide transhydrogenase (UdhA) on the
production of poly(3-hydroxybutyrate) in Escherichia coli. Biotechnol Prog 22:420-425.

173. Sawers, G., and B. Suppmann. 1992. Anaerobic induction of pyruvate formate-lyase
gene expression is mediated by the ArcA and FNR proteins. J Bacteriol 174:3474-3478.

174. Sawers, R. G., and D. H. Boxer. 1986. Purification and properties of membrane-bound
hydrogenase isoenzyme 1 from anaerobically grown Escherichia coli K12. Eur J
Biochem 156:265-275.

175. Sazanov, L. A. 2007. Respiratory complex I: mechanistic and structural insights
provided by the crystal structure of the hydrophilic domain. Biochemistry 46:2275-2288.

176. Schindelin, H., C. Kisker, J. L. Schlessman, J. B. Howard, and D. C. Rees. 1997.
Structure of ADP AIF4- stabilized nitrogenase complex and its implications for signal
transduction. Nature 387:370-376.

177. Schneider, K., and H. G. Schlegel. 1976. Purification and properties of soluble
hydrogenase from Alcaligenes eutrophus H 16. Biochim Biophys Acta 452:66-80.

178. Shanmugam, K. T., B. B. Buchanan, and D. I. Arnon. 1972. Ferredoxins in light- and
dark-grown photosynthetic cells with special reference to Rhodospirillum rubrum.
Biochim Biophys Acta 256:477-486.

179. Shi, Z., and H. P. Blaschek. 2008. Transcriptional analysis of Clostridium beijerinckii
NCIMB 8052 and the hyper-butanol-producing mutant BA101 during the shift from
acidogenesis to solventogenesis. Appl Environ Microbiol 74:7709-14.

180. Simpson, F. B., and R. H. Burris. 1984. A nitrogen pressure of 50 atmospheres does not
prevent evolution of hydrogen by nitrogenase. Science 224:1095-1097.









181. Slininger, P. J., Bothast, R. J. Okos, M. R. and Ladisch, M. R. 1985. Comparative
evaluation of ethanol production by xylose-fermenting yeasts presented high xylose
concentrations. Biotechnol. Lett 7:431-436.

182. Smith, P. K., R. I. Krohn, G. T. Hermanson, A. K. Mallia, F. H. Gartner, M. D.
Provenzano, E. K. Fujimoto, N. M. Goeke, B. J. Olson, and D. C. Klenk. 1985
Measurement of protein using bicinchoninic acid. Anal Biochem 150:76-85.

183. Spiro, S., and J. R. Guest. 1991. Adaptive responses to oxygen limitation in Escherichia
coli. Trends Biochem Sci 16:310-314.

184. Sprenger, G. A. 1996. Carbohydrate metabolism in Zymomonas mobilis: a catabolic
highway with some scenic routes. FEMS. Microbiol Lett 145:301-307.

185. Steen, E. J., R. Chan, N. Prasad, S. Myers, C. J. Petzold, A. Redding, M. Ouellet,
and J. D. Keasling. 2008. Metabolic engineering of Saccharomyces cerevisiae for the
production of n-butanol. Microb Cell Fact 7:36-42.

186. Stephenson, M., and L. H. Stickland. 1931. Hydrogenase: a bacterial enzyme activating
molecular hydrogen. I. The properties of the enzyme. Biochem. J 25:205-214.

187. Stephenson, M., and L. H. Stickland. 1932. Hydrogenlyases. Bacterial enzymes
liberating molecular hydrogen. Biochem. J. 26:712-724.

188. Sticklen, M. 2006. Plant genetic engineering to improve biomass characteristics for
biofuels. Curr Opin Biotechnol 17:315-319.

189. Stuart, T. S., and H. Gaffron. 1972. The mechanism of hydrogen photoproduction by
several algae. I. The effect of inhibitors of photophosphorylation. Planta (Berlin) 106:91-
100.

190. Stuart, T. S., and H. Gaffron. 1972. The mechanism of hydrogen photoproduction by
several algae. II. The contribution of Photosystem II. Planta (Berlin) 106:101-112.

191. Sun, Y., and J. Cheng. 2002. Hydrolysis oflignocellulosic materials for ethanol
production: a review. Bioresour Technol 83:1-11.

192. Tagawa, K., and D. I. Arnon. 1962. Ferredoxins as electron carriers in photosynthesis
and in the biological production and consumption of hydrogen gas. Nature 195:537-543.

193. Takahashi, C. M., D. F. Takahashi, M. L. Carvalhal, and F. Alterthum. 1999. Effects
of acetate on the growth and fermentation performance of Escherichia coli KO 11. Appl
Biochem Biotechnol 81:193-203.

194. Takai, M., N. Iwao, T. Tooru, T. Yoshiyuki, U. Hisao, and N. Akio. 2001. Process for
producing aldehyde. US Patent number 6,291,717; Ap. number 09/457,742.









195. Tatsumi, H., K. Takagi, M. Fujita, K. Kano, and T. Ikeda. 1999. Electrochemical
study of reversible hydrogenase reaction of Desulfovibrio vulgaris cells with methyl
viologen as an electron carrier. Anal Chem 71:1753-1759.

196. Thauer, R. K., K. Jungermann, and K. Decker. 1977. Energy conservation in
chemotrophic anaerobic bacteria. Bacteriol Rev 41:100-180.

197. Thauer, R. K., K. Jungermann, E. Rupprecht, and K. Decker. 1969. Hydrogen
formation from NADH in cell-free extracts of Clostridium kluyveri. Acetyl coenzyme A
requirement and ferredoxin dependence. FEBS Lett 4:108-112.

198. Thorpe, E. 1921. A dictionary of applied chemistry, vol. II. Longmans, Green and Co.,
London.

199. Tshiteya, R. M., E. N. Vermiglio, and S. Tice. 1991. Compatibility of alcohols with
other fuels in blends, p. 5-1:5-10. In J. H. Ashworth (ed.), Properties of alcohol
transportation fuels: alcohol fuels reference work #1. Meridian Corporation, Alexandria,
VA.

200. Ueda, A., F. Yuichi, A. Atsuhiro, and E. Hiroki. 2002. Process for producing alcohols.
US Patent number 6,455,743; App. number 09/450,123.

201. Valdez-Vazquez, I., E. Rios-Leal, A. Carmona-Martinez, K. M. Munoz-Paez, and H.
M. Poggi-Varaldo. 2006. Improvement ofbiohydrogen production from solid wastes by
intermittent venting and gas flushing of batch reactors headspace. Environ Sci Technol
40:3409-3415.

202. van Maris, A. J., D. A. Abbott, E. Bellissimi, J. van den Brink, M. Kuyper, M. A.
Luttik, H. W. Wisselink, W. A. Scheffers, J. P. van Dijken, and J. T. Pronk. 2006.
Alcoholic fermentation of carbon sources in biomass hydrolysates by Saccharomyces
cerevisiae: current status. Antonie Van Leeuwenhoek 90:391-418.

203. van Maris, A. J., A. A. Winkler, M. Kuyper, W. T. de Laat, J. P. van Dijken, and J.
T. Pronk. 2007. Development of efficient xylose fermentation in Saccharomyces
cerevisiae: xylose isomerase as a key component. Adv Biochem Eng Biotechnol
108:179-204.

204. Velazquez, I., E. Nakamaru-Ogiso, T. Yano, T. Ohnishi, and T. Yagi. 2005. Amino
acid residues associated with cluster N3 in the NuoF subunit of the proton-translocating
NADH-quinone oxidoreductase from Escherichia coli. FEBS Lett 579:3164-3168.

205. Vidakovic, M., C. R. Crossnoe, C. Neidre, K. Kim, K. L. Krause, and J. P.
Germanas. 2003. Reactivity of reduced [2Fe-2S] ferredoxins parallels host susceptibility
to nitroimidazoles. Antimicrob Agents Chemother 47:302-308.

206. Vidakovic, M. S., G. Fraczkiewicz, and J. P. Germanas. 1996. Expression and
spectroscopic characterization of the hydrogenosomal [2Fe-2S] ferredoxin from the
protozoan Trichomonas vaginalis. J Biol Chem 271:14734-14739.









207. Vignais, P. M., B. Billoud, and J. Meyer. 2001. Classification and phylogeny of
hydrogenases. FEMS Microbiol Rev 25:455-501.

208. Vignais, P. M., and A. Colbeau. 2004. Molecular biology of microbial hydrogenases.
Curr Issues Mol Biol 6:159-188.

209. Villa-Komaroff, L., S. Broome, S. P. Naber, A. Efstratiadis, P. Lomedico, R. Tizard,
W. L. Chick, and W. Gilbert. 1980. The synthesis of insulin in bacteria: a model for the
production of medically useful proteins in prokaryotic cells. Birth Defects Orig Artic Ser
16:53-68.

210. Waldron, M., and T. Welch. 2004. DOE researchers demonstrate feasibility of efficient
hydrogen production from nuclear energy. Department of Energy:
[http://www.energy.gov/news/1545.htm].

211. Wallace, K. K., Z. Y. Bao, H. Dai, R. Digate, G. Schuler, M. K. Speedie, and K. A.
Reynolds. 1995. Purification of crotonyl-CoA reductase from Streptomyces collins and
cloning, sequencing and expression of the corresponding gene in Escherichia coli. Eur J
Biochem 233:954-962.

212. Walter, K. A., G. N. Bennett, and E. T. Papoutsakis. 1992. Molecular characterization
of two Clostridium acetobutylicum ATCC 824 butanol dehydrogenase isozyme genes. J
Bacteriol 174:7149-7158.

213. Waterson, R. M., and R. S. Conway. 1981. Enoyl-CoA hydratases from Clostridium
acetobutylicum and Escherichia coli. Methods Enzymol 71 Pt C:421-430.

214. Weckbecker, A., and W. Hummel. 2004. Improved synthesis of chiral alcohols with
Escherichia coli cells co-expressing pyridine nucleotide transhydrogenase, NADP+-
dependent alcohol dehydrogenase and NAD+-dependent format dehydrogenase.
Biotechnol Lett 26:1739-1744.

215. White, D. 2000. Fermentations, p. 363-383, The Physiology and Biochemistry of
Prokaryotes, 2nd ed. Oxford University Press, New York.

216. Wiedemann, B., and E. Boles. 2008. Codon-optimized bacterial genes improve L-
arabinose fermentation in recombinant Saccharomyces cerevisiae. Appl Environ
Microbiol 74:2043-2050.

217. Winzer, K., K. Lorenz, B. Zickner, and P. Durre. 2000. Differential regulation of two
thiolase genes from Clostridium acetobutylicum DSM 792. J Mol Microbiol Biotechnol
2:531-541.

218. Wisselink, H. W., M. J. Toirkens, M. del Rosario Franco Berriel, A. A. Winkler, J.
P. van Dijken, J. T. Pronk, and A. J. van Maris. 2007. Engineering of Saccharomyces
cerevisiae for efficient anaerobic alcoholic fermentation ofL-arabinose. Appl Environ
Microbiol 73:4881-4891.









219. Woodward, J., N. I. Heyer, J. P. Getty, H. M. O'Neill, E. Pinkhassik, and B. R.
Evans. 2002. Efficient hydrogen production using enzymes of the pentose phosphate
pathway. Proceedings of the 2002 U.S. DOE Hydrogen Program Review:NREL/CP-610-
32405.

220. Woodward, J., M. Orr, K. Cordray, and E. Greenbaum. 2000. Enzymatic production
of biohydrogen. Nature 405:1014-1015.

221. Wu, L. F., and M. A. Mandrand-Berthelot. 1986. Genetic and physiological
characterization of new Escherichia coli mutants impaired in hydrogenase activity.
Biochimie 68:167-179.

222. Wu, L. F., and M. A. Mandrand. 1993. Microbial hydrogenases: primary structure,
classification, signatures and phylogeny. FEMS Microbiol Rev 10:243-269.

223. Wykoff, D. D., J. P. Davies, A. Melis, and A. R. Grossman. 1998. The regulation of
photosynthetic electron transport during nutrient deprivation in Chlamydomonas
reinhardtii. Plant Physiol 117:129-139.

224. Yang, K. Y., and R. P. Swenson. 2007. Modulation of the redox properties of the flavin
cofactor through hydrogen-bonding interactions with the N(5) atom: role of alpha-Ser254
in the electron-transfer flavoprotein from the methylotrophic bacterium W3A1.
Biochemistry 46:2289-2297.

225. Yano, T., V. D. Sled, T. Ohnishi, and T. Yagi. 1996. Expression and characterization of
the flavoprotein subcomplex composed of 50-kDa (NQO1) and 25-kDa (NQO2) subunits
of the proton-translocating NADH-quinone oxidoreductase ofParacoccus denitrificans. J
Biol Chem 271:5907-5713.

226. Yano, T., V. D. Sled, T. Ohnishi, and T. Yagi. 1994. Expression of the 25-kilodalton
iron-sulfur subunit of the energy-transducing NADH-ubiquinone oxidoreductase of
Paracoccus denitrificans. Biochemistry 33:494-499.

227. Yomano, L. P., S. W. York, and L. O. Ingram. 1998. Isolation and characterization of
ethanol-tolerant mutants of Escherichia coli KO 11 for fuel ethanol production. J Ind
Microbiol Biotechnol 20:132-138.

228. Yomano, L. P., S. W. York, S. Zhou, K. T. Shanmugam, and L. O. Ingram. 2008.
Re-engineering Escherichia coli for ethanol production. Biotechnol Lett 30:2097-2103.

229. Youngleson, J. S., D. T. Jones, and D. R. Woods. 1989. Homology between
hydroxybutyryl and hydroxyacyl coenzyme A dehydrogenase enzymes from Clostridium
acetobutylicum fermentation and vertebrate fatty acid beta-oxidation pathways. J
Bacteriol 171:6800-6807.

230. Zaldivar, J., and L. O. Ingram. 1999. Effect of organic acids on the growth and
fermentation of ethanologenic Escherichia coli LY01. Biotechnol Bioeng 66:203-210.









231. Zaldivar, J., A. Martinez, and L. O. Ingram. 2000. Effect of alcohol compounds found
in hemicellulose hydrolysate on the growth and fermentation of ethanologenic
Escherichia coli. Biotechnol Bioeng 68:524-530.

232. Zhang, X., K. Jantama, J. C. Moore, K. T. Shanmugam, and L. O. Ingram. 2007.
Production of L-alanine by metabolically engineered Escherichia coli. Appl Microbiol
Biotechnol 77:355-366.

233. Zhang, Y. H., B. R. Evans, J. R. Mielenz, R. C. Hopkins, and M. W. Adams. 2007.
High-yield hydrogen production from starch and water by a synthetic enzymatic pathway.
PLoS One 2:e456.

234. Zhao, Y., C. A. Tomas, F. B. Rudolph, E. T. Papoutsakis, and G. N. Bennett. 2005.
Intracellular butyryl phosphate and acetyl phosphate concentrations in Clostridium
acetobutylicum and their implications for solvent formation. Appl Environ Microbiol
71:530-537.

235. Zhou, S., F. C. Davis, and L. O. Ingram. 2001. Gene integration and expression and
extracellular secretion of Erwinia ci lyn/wlhini endoglucanase CelY (celY) and CelZ
(celZ) in ethanologenic Klebsiella oxytoca P2. Appl Environ Microbiol 67:6-14.









BIOGRAPHICAL SKETCH

Phi Minh Do was born in 1981 in Vietnam. Shortly after birth, Phi, accompanied by his

parents and two brothers, immigrated to the United States of America as a post-Vietnam War

refugee with a port of entry date of February 1982. Phi spent most of his childhood in Panama

City, Florida where he graduated from Bay High School in 1999 at the top of his class. He later

earned a Bachelor of Science with honors in microbiology and cell science from the Department

of Microbiology and Cell Science at the University of Florida in 2003.

Upon graduating with his B.S., Phi was accepted into the Ph.D. graduate program in the

same department under the advisement of Dr. K.T. Shanmugam with focus on microbial

production of renewable fuels and chemicals. Phi's passion for teaching led to mentoring

numerous of undergraduates as well as being guest lecturers in both undergraduate and graduate

courses. In addition to his graduate studies, Phi was an advocate for student rights and fought to

make changes in departmental policies. In 2006 and 2007, he was elected vice-president and

president, respectively, of the Microbiology Society for Graduate Students at the University of

Florida where he coordinated the annual Graduate Symposium.

Upon completion of his Ph.D., Phi continued as a post-doctoral research associate with Dr.

Lonnie Ingram, a world-renowned expert in the development of biocatalysts for renewable fuels

and chemicals, where he hopes to continue the development of his academic career towards

making a global impact on renewable energy.





PAGE 1

1 METABOLIC ENGINEERING OF MICROBIAL BIOCATALYSTS FOR FERMENTATIVE PRODUCTION OF NEXT GENERATION BIOFUELS By PHI MINH DO A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2009

PAGE 2

2 2009 Phi Minh Do

PAGE 3

3 To my friends, family, colleagues, mentors, and especially Ming Dang for their support and motivation for making this possible

PAGE 4

4 ACKNOWLEDGMENTS I would like to thank my committee chair, Dr. K.T. Shanmugam and my committee members, Dr. Ingram, Dr. Maupin -Furlow, Dr. Stewart, and Dr. Romeo, for the ir guidance over these many years, and my lab mates for their time and assistance. I would also like to extend a special thanks to Dr. Hrdy and Dr. Scharf for T. vaginalis NADH -dehydrogenase ( NDH) DNA and termite gut [Fe] hydrogenase DNA, respectively, Dr. Angerhofer for conducting Electr on Paramagnetic Resonance ( EPR ) experiments, and the entire Department of Microbiology and Cell Science at the University of Florida for making this a positive experience.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS .................................................................................................................... 4 LIST OF TABLES ................................................................................................................................ 8 LIST OF FIGURES .............................................................................................................................. 9 LIST OF ABBREVIATIONS ............................................................................................................ 11 ABSTRACT ........................................................................................................................................ 17 CHAPTER 1 INTRODUCTION AND SIGNIFICANCE ............................................................................... 19 Fuel Crisis .................................................................................................................................... 19 Renewable Biomass to Ethanol .................................................................................................. 20 Second Generation Renewable Fuels ......................................................................................... 26 Hydrogen .............................................................................................................................. 26 Butanol ................................................................................................................................. 27 2 BACKGROUND ON HYDROGEN PRODUCTION ............................................................. 28 Current Hydrogen Production Methods ..................................................................................... 28 Methane Steam Reforming ................................................................................................. 28 Coal Gasification ................................................................................................................. 28 Hydrogen from H2O ............................................................................................................ 29 Biomass Conversion to Hydrogen ...................................................................................... 32 Mi crobial Hydrogen Production ................................................................................................. 33 History .................................................................................................................................. 33 Photosynthetic Hydrogen Production ................................................................................. 34 Fermentative Hydrogen Production.................................................................................... 38 Hydrogenase Biochemistry ................................................................................................. 43 [NiFe] -hydrogenase ...................................................................................................... 44 [Fe] hydrogenase .......................................................................................................... 45 NADH Dependent Hydrogen Producing Pathway ................................................................... 47 3 BACKGROUND ON BUTANOL PRODUCTION ................................................................. 53 Fossil Fuel -Based Butanol Production ....................................................................................... 53 Microbial Butanol Production .................................................................................................... 53 Hist ory .................................................................................................................................. 53 Butanol Fermentation .......................................................................................................... 55 Molecular Organization of Butanol Production Pathway ................................................. 58

PAGE 6

6 Advances in Metabolic Engineering of Bacteria for Butanol Production ............................... 59 Engineering Escherichia coli for Butanol Production .............................................................. 63 4 MATERIALS AND METHODS ............................................................................................... 69 General Methods ......................................................................................................................... 69 Materials ............................................................................................................................... 69 Bacterial strains, Bacteriophages, Plasmids, and Primers Used ....................................... 69 Media and Growth Conditions ............................................................................................ 69 Fermentation ........................................................................................................................ 70 DNA Extraction and Purification ....................................................................................... 70 Polymerase Chain Reaction (PCR) ..................................................................................... 71 DNA Modification ............................................................................................................... 71 Transformation ..................................................................................................................... 71 Transduction ......................................................................................................................... 72 Gene Deletions ..................................................................................................................... 72 Construction of Pl asmid pET15b Based T7 Expression Plasmids ................................... 72 Protein Production Using pET15b Based T7 Expression ................................................. 73 His -tagged Protein Purification .......................................................................................... 73 Analytical Methods .............................................................................................................. 74 Methods for Hydrogen Production............................................................................................. 75 Construction of Tandem T7 Expression of ndhE and ndhF Subunits .............................. 75 Construction of Tandem trc Promoter Controlled Expression of ndhE and ndhF .......... 75 NADH Dehydrogenase (NDH) Enzymatic Activity ......................................................... 76 Clostridium Ferredoxin Purification ................................................................................... 77 (Electron Paramagnetic Resonance) EPR Measurements ................................................. 77 Selection of Methyl Viologen (MV) Resistant E. coli ...................................................... 77 Detection of Hydrogen Production ..................................................................................... 78 Electrochemical Potential .................................................................................................... 78 Cloning of [Fe] -Hydrogenase Isolated from Termite Gut ................................................ 79 Methods for Butanol Production ................................................................................................ 79 Co nstruction of Plasmid pET15b Derivatives for the Expression of Enzymes in the Butanol Pathway .............................................................................................................. 79 Enzyme Assays for Butanol Pathway................................................................................. 80 In Vitro Butanol Production ................................................................................................ 80 Enzyme Assay from Crude Extract .................................................................................... 81 Plasmid Construction for Butanol Production ................................................................... 81 E. coli Strain Construction for Butanol/Butyrate Production ........................................... 84 5 RESULTS AND DISSCUSSION ............................................................................................ 103 Bioche mical Characterization of Recombinant NADH Ferredoxin Oxi doreductase (NFOR; NDH) from Trichomonas vaginalis ....................................................................... 103 Expression and Purif ication of NDH ................................................................................ 103 Enzymatic Activities / Kinetics of NDH .......................................................................... 104 Iron / Sulfur Determination ............................................................................................... 105

PAGE 7

7 EPR Determination of Iron / Sulfur Clusters ................................................................... 106 Potential Use of NDH for H2 Production ......................................................................... 107 NADH Dependent Hydrogen Production................................................................................ 109 Reduced Methyl Viologen Coupled to E. coli Hydrogenase 3 (HYD3) Isoenzyme ..... 1 09 Reduced Methyl Viologen Coupled to [Fe] Hydrogenas e .............................................. 110 Thermodynamic Barrier .................................................................................................... 112 Production of 1-Butanol by Recombinant E. coli ................................................................... 116 In Vitro Production of Butanol from Acetyl -CoA Using Recombinant Proteins .......... 116 Plasmid Expression of Butanol Pathway ......................................................................... 118 Chromosomal Insertion of Butanol Pathway into E. coli ................................................ 121 Additional Insertion of bcd etfBA Transcriptionally Controlled by E. coli adhE Promoter ......................................................................................................................... 123 6 SUMMARY AND CONCLUSIONS ...................................................................................... 148 Hydrogen ................................................................................................................................... 148 Butanol ....................................................................................................................................... 151 APPENDIX REPRINT PERMISSION OF PUBLISHED MATERIAL .................................. 155 LIST OF REFERENCES ................................................................................................................. 156 BIOGRAPHICAL SKETCH ........................................................................................................... 175

PAGE 8

8 LIST OF TABLES Table page 4 1 Bacterial strains, bacteriophages, and plasmids ................................................................... 89 4 2 List of PCR primers used in this study. ................................................................................ 92 4 3 Standard redox potential of electron donor / electron acceptor couple .............................. 96 5 1 Purification of recomb inant NADH -dehydrogenase ( NDH) produced in Escherichia coli with i D 1 thiogalactopyranoside ( IPTG ) or arabinose as an inducer. .... 125 5 2 Specific activity of recombinant T richomonas vaginalis hydrogenosome NDH produced in E. coli with arabinose as inducer .................................................................... 126 5 3 Kinetic properties of recombinant T. vaginalis hydrogenosome NDH purified from E. coli .................................................................................................................................... 127 5 4 Specific activities of recombinant enzymes in butanol production pathway ................... 128 5 5 Specific activity of butanol pathway enzymes in the crude extract of JM107 (pCBEHTCB) ....................................................................................................................... 129 5 6 Specific activity of AtoB and AdhE2 in the crude extracts of JM107 (pAA) .................. 130 5 7 Butanol production by various mutant strains of E. coli bearing pCBEHCU and pAA .. 131 5 8 Effect of various plasmids on the production of butanol by different E. coli strains. ..... 132 5 9 Effect of a second chromosomal insertion of butyryl CoA synthesis ( BCS ) operon tra nscriptionally controlled by pflB promoters. .................................................................. 133

PAGE 9

9 LIST OF FIGURES Figure page 2 1 Photosynthetic electron transport pathways for hydrogen production in green algae ....... 50 2 2 NADH -dependent reduction of ferredoxin by Clostridium kluyveri Bcd/EtfBA (clostridial NFOR) coupled to crotonyl -CoA to butyryl CoA reaction .............................. 51 2 3 NADH -dependent hydrogen producing pathway ................................................................. 52 3 1 C. acetobutylicum fermentative pathway .............................................................................. 66 3 2 Molecular organization of genes encoding butanol/solvent pathway in C. acetobutylicum ........................................................................................................................ 67 3 3 E scherichia coli mixed acid fermentation ............................................................................ 68 4 1 T richomonas vaginalis NADH -dehydrogenase ( NDH) T7 expression plasmid. ............... 97 4 2 Construction of pButanol ....................................................................................................... 98 4 3 Construction of pButyrate ...................................................................................................... 99 4 4 Construction of pTrc99a derived plasmids ......................................................................... 100 4 5 Consolidation of butanol pathway genes into a single low -copy vector pACYC184 ..... 101 4 6 Chromosomal insertion of C. acetobutylicum butyryl -CoA synthesis ( BCS ) operon replacing E. coli pflB ............................................................................................................ 102 5 1 Native molecular weight of NDH as determined by gel filtration .................................... 135 5 2 Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS -PAGE ) of recombinant NDH expressed in E. coli induced by D 1 thiogalactopyranoside (IPTG ) or arabinose ........................................................................ 136 5 3 pH profile of NDH activity in phosphate buffer ................................................................ 137 5 4 Absorption spectrum of recombinant T. vaginalis hydrogenosome NDH or NDH small subunit ......................................................................................................................... 138 5 5 Electron paramagnetic resonance ( EPR ) spectrum of the recombinant T. vaginalis hydrogenosome NDH holoenzyme produced in E. coli .................................................... 139 5 6 EPR spectrum of NdhE (small subunit) of the T. vaginalis NDH produced in E. coli .... 140 5 7 Effect of NDH on whole cell reduction of methyl viologen (MV) and H2 evolution in overnight cultures of MV resistant PMD45 ....................................................................... 141

PAGE 10

10 5 8 Primary sequence alignment of HydA from C. acetobutylicum T. vaginalis P. grassii and a symbiont from the hindgut of R. flavipes .................................................... 142 5 9 Effect of NDH and GutHyd on hydrogen production ........................................................ 143 5 10 Effect of NDH and GutHyd on fermentation profile of E. coli strain PMD45 ................ 144 5 11 High performance liquid chromatography ( HPLC ) profile of in vitro production of 1 butanol from acetyl CoA ..................................................................................................... 145 5 12 Relative specific activities of functionally expressed recombinant enzymes in E. coli .. 146 5 13 Growth, pH, pyruvat e, and butyrate production from PMD76 with pH control .............. 147 6 1 Thermodynamics of the NADH -dependent hydrogen production pathway ..................... 154

PAGE 11

11 LIST OF ABBREVIATIONS Aad Alcohol aldehyde dehydrogenase A Absorbance ABE Acetone butanol ethanol fermentation Adc Acetoacetyl CoA decarboxylase ADH Alcohol dehydrogenase ADP Adenosine 5' di phosphate amp Ampicillin amp R Ampicillin resistant ATCC American type culture collection AtoB E. coli thioloase ATP Adenosine 5' triphosphate Bcd Butyryl CoA dehydrogenase Bcd/EtfBA Butyryl CoA dehydrogenase electron transfer flavoprotein complex BCA Bicinchoninic acid protein determination assay BCS Butyryl CoA synthesis pathway from acetoacetyl CoA to butyryl CoA Bdh Butanol dehydrogenase bp Base pair BSA Bovine serum albumin BTU British therm al unit; equals 1.0 53 kJ of energy but + E. coli strain carrying butanol biosynthesis genes (chromosomal insertion of spcR-PtrcadhE2PtrcatoB -Ptrccrt bcd etfBA hbdPtrcccrA udhA ) BV Benzyl viologen cal Calories; equal to 4.184 J

PAGE 12

12 CcrA Crotonyl CoA reductase from Streptomyces CoA Coenzyme A Crt Crotonase CSC Commercial s olvent c orporation CTAB Cetyl trimethylammonium bromide CtfAB Coenzyme A transferase DCPIP 2,6 dichlorophenolindophenol DNA Deoxyribonucleic acid dNTP Deoxyribonucleotide DOE United States Department of Energy DTT Dithiothreitol E Actual concentration dependent redox potential e E lectron E10 Gasoline blend; 10 % ethanol, 90 % gasoline E85 Gasoline blend; 85 % ethanol, 15 % gasoline E o Standard redox midpoint potential EIA Energy Information Administration; branch of DOE EPR Electro n paramagnetic resonance Etf Electron transfer flavoprotein e t f BA Genes AB encoding electron transfer flavoprotein subunits E value Statistical e xpect value F Faraday constant (96,500 C mol 1 ) FAD F lavin adenine dinucleotide Fd Ferredoxin

PAGE 13

13 FDH Formate dehydrogenase [Fe S] Iron sulfur cluster FHL Formate hydrogen lyase FMN Flavin mononucleotide; riboflavin 5 phosphate FRT Flippase r ecognition t arget G3P Glyceraldehyde 3 phosphate GC Gas chromatograph GRAS Generally regarded as safe GutHyd Symbiont [Fe] hydrogenase from R. flavipes hindgut H + Proton Hbd Hydroxybutyryl CoA dehydrogenase HPLC High performance liquid chromatography; High pressure liquid chromatography Hrs Hours H YD Hydrogenase HYD3 E. coli hydrogenase isoenzyme 3 IPTG D 1 thiogalactopyranoside J Joules; equals to 0.239 cal (kg m 2 s 2 ) kan Kanamycin kan R Kanamycin resistant K cat Turnover rate; number of enzymatic reactions catalyzed per second (sec 1 ) kDa Kilodaltons (1000 molecular weight) KFeCN Potassium ferricyanide; K 3 Fe(CN) 6 K m Michaelis constant; substrate concentration that yields V max of enzyme activity

PAGE 14

14 LB Luria Bertani medium LHC Light harvesting complex Lpd Dihydrolipoamide dehydrogenase; E3 component of PDH lpd101* E. coli lpd A with point mutation E354K M Molar concentration (mol L 1 ) mol Mole; quantity equal to 6.022 x 10 23 atoms or molecules (Avogadro number) MTT 3 (4,5 Dimethylthiazol 2 yl) 2,5 diphenyltetrazolium bromide MV Methyl viologen MV R Methyl viologen resistance n Number of electrons as in Nernst equation N1a [2Fe 2S] cluster of small subunit of NDH N3 [4Fe 4S] cluster of large subunit of NDH NAD + Nicotinamide adenine dinucleotide NADH Reduced nicotinamide adenine dinucleotide NADP + Nicotinamide adenine dinucleotide phosphate NADPH Reduced nicotinamide adenine dinucleotide phosphate ND Not detected or not determined NDH NADH dehydrogenase NEB New England Biolabs Inc. NFOR NADH ferredoxin oxidoreductase OD Optical density Ox Oxidized PCR Polymerase chain reaction

PAGE 15

15 PDH Pyruvate dehydrogenase PEP Phosphoenolpyruvate PFOR Pyruvate ferredoxin oxidoreductase PS Photosystem P T7 T7 promoter P trc trc promoter quad Quadrillion BTU; 10 15 BTU; equivalent to about 8 billion gallons of gasoline R Ideal gas constant (8.314 J K 1 mol 1 ) Red Reduced Redox Reduction / oxidation RNA Ribonucleic acid S 200 Sephacryl 200 gel filtration matrix SD Shine Dalgarno sequence SDS Sodium dodecyl sulfate SDS PAGE Sodium dodecyl sulfate polyacrylamide gel electrophoresis Sp. Act. Specific activity (U (mg protein) 1 ) spc Spectinomycin spc R Spectinomycin resistance T Temperature (K) TCA Tricarboxylic acid cycle; c itric acid cycle; Krebs cycle Thl Thioloase; ThlA and ThlB U 1 ) V Volt (J C 1 ; Kg m 2 s 2 C 1 )

PAGE 16

16 V max Enzymes maximum velocity (U (mg protein) 1 ) Gene deletion Change in redox potential; E product E reactant Gibbs free energy (J mol 1 or cal mol 1 ) Molar extinction coefficient

PAGE 17

17 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy METABOLIC ENGINEERING OF MICROBIAL BIOCATALYSTS FOR FERMENTATIVE PRODUCTION OF NEXT GENERATION BIOFUELS By Phi Minh Do August 2009 Chair: Name K.T. Shanmugam Major: Microbiology and Cell Science With increasing demand for fuel and a finite supply of petroleum, alternative renewable sources of energy need to be generated in order to free the world from the bond of fossil fuels New transportation fuels currently in development include hydrogen and higher chain alcohols such as butanol This study focuses on metabolic engineering of Escherichia coli as a microbial biocatalyst for fermentative production of these high energy alternative fuels towards identifying the rate limiting steps in achieving high product yields For production of hydrogen at high yield from fermentable sugars, the reducing potential from reduced nicotinamide adenine dinucleotide (NADH) produced during fermentation also needs to be converted to hydrogen. The gene encoding the first enzyme in the NADH -dependent hydrogen pathway, NADH -ferredoxin oxidoreductase (NDH), was cloned from an anaerobic protozoan, Trichomonas vaginalis and expressed T he NDH protein purified from the recombinant E. coli and biochemically characterized. The recombinant enzyme reduced several low -potential electron acceptors such as ferredoxin and viologens with NADH as electron donor. The [Fe S] cluster composition of th is heterodimer is apparently responsible for this unique catalytic property. Attempts to couple NADH oxidation to hydrogen production using NDH, methyl viologen and native hydrogenase 3 were not successful due to thermodynamic constraints, which proved to be difficult to overcome

PAGE 18

18 in vivo Although several microbes produce butanol as a fermentation product, none of them produce butanol as sole fermentation product Towards constructing a recombinant E. coli that produces butanol as the main fermentation product, the genes encoding the enzymes minimally needed for converting acetyl -CoA to butanol were cloned from Clostridium acetobutylicum and Streptomyces avermitilis and expressed in E. coli The encoded proteins upon purification and mixing in vitro esta blished the butanol pathway and converted acetyl CoA to butanol E. coli carrying the butanol pathway genes produced butanol but the yield of butanol was only about 2 mM One of the rate -limiting steps in achieving higher yield butanol production was ide ntified as the butyryl -CoA dehydrogenase complex. Other rate limiting steps in butanol production were the competition for acetyl -CoA between ethanol and butanol pathways as well as generating sufficient amount s of appropriate reductant s to support the act ivity of various enzymes in the butanol pathway while also maintaining proper redox balance.

PAGE 19

19 CHAPTER 1 INTRODUCTION AND SIGNIFICANCE Fuel Crisis The United States consumes more energy than it produces importing 34 % of its total energy need s (65) In 2007 imports accounted for 5 8.6 % of the petroleum consumed, indicating our dependency on foreign energy suppliers. In order to increase this nations energy security, there needs to be a shift from foreign imports to domestic production of energy As of 2007 40. 0 % of the energy consumed by the US was derived from petroleum followed by 23. 3 % natural gas, 22. 3 % coal, 8.3 % nuclear, and 5.9 % renewable energy (65) Fossil fuel accounts for 85. 6 % of the total energy used. Of the petroleum consumed, 58.6 % of the petroleum was imported and 42.4 % and 15.9 % of the tot al petroleum consumed was used for transportation in the form of gasoline and diesel, respectively (65) In 2007, The United States consumed 40.75 quadrillion British Thermal Unit ( BTU ) (quad) of petroleum per year with the predicted increase to 41.60 quad of petroleum per year in 2030 where 1 quad is equivalent to about 8 billion gallons of gasoline (65) The p rice of crude oil is projected to almost double from $73.33 to $130.43 per barrel in the same time period. However, crude oil price reached higher than $140 per barrel in 2008, 22 years ahead of this predict ion. The predicted cost reflects global supply/demand and does not account for instability in the global economy which could radically fluctuate prices F or example, from $137.11 in July 2008 the price declined to $35.70 per barrel five months later in D ecember 2008 (65) With the increase i n demand and higher price for oil, domestic production of petroleum is optimistically projected to increase from the current 10.73 to 15.96 quad per year in 2030. This projection of increased production is expected to decrease the petroleum import from th e current 28.87 to 21.72 quad per year In the transportation sector, the expected decrease in use of gasoline for

PAGE 20

20 transportation from 17.29 to 14.49 quad of petroleum per year will be due to a projected use of E85 blends up to 2.18 quad per year in 2030. This 13 % reduction in the transportation gasoline demand outlines the countrys anticipated shift to a renewable fuel (65) Combustion of fossil fuels produces heat plus carbon dioxide, carbon monoxide, and other waste products depending on the fuel source. These undesirable greenhouse gas es are released into the atmosphere, which is reported to cause global temperature increase. Alternate sources of energy that are CO2 neutral are being explored to mitigate these problems associated with fossil fuel use. The ideal fuel would be renewable domestically produced, non -pollut ing and cost effective. Renewable Biomass to Ethanol Renewable energ y is derived from sources that are constantly replenished by natural processes such as wind, water, geothermal, and solar. Energy from these sources can be converted to a usable form such as electricity. Among these, solar energy can be directly converted to electricity or indirectly to combustible fuels, such as ethanol, H2, biodiesel, etc. During the process of photosynthesis, plants collect and store solar energy as carbohydrates, lipids, and plant materials. Crude petroleum, a primary source of our present energy, is indeed a derivative of plant materials generated by photosynthesis eons ago and processed at high temperature and pressure. The CO2 trapped in these plant materials is currently being released into the atmosphere during the liberation of the stored energy. Global warming observed today due to CO2 release in this loop is caused by the time between the capture and release of this CO2. By using biomass instead of fossil fuels, p lant materials can, once again, serve as the energy intermediate to meet the current energy demand without enhancing CO2 concentration in the atmosphere that leads to global warming.

PAGE 21

21 As the plants grow, they u tilize energy from the sun to fix CO2 into sugars which polymerize to form starch and lignocellulos ic biomass the structural components of stalks, stems, and leaves (31) Starch, which is the storage components of plants, is made up of two components, amylose and amylopectin. Amylose polymers are long chain s of glucose linked by 1 ,4 glycosidic bonds. Amylopectin, the other component of starch, consists of amylose with branched 1, 6 glycosidic bonds of glucose polymers occurr ing every after 24 30 glucose units (149) Lignocellulos ic biomass is composed of three major components: cellulose, hemicellulose, and lignin (77, 188) The largest fraction, cellulose, which makes up about 20 50 1 4 glycosidic linkage s H ydrogen bonding between cellulose polymers results in insoluble and anhydrous crystalline structure (188) Hemicellulose, which comprise s about 2040 % of biomass, is relatively shorter, and is a highly branched polymer of mainly D xylose with varying amounts of L arabinose, D galactose, D glucose, and D -mannose (97, 98, 230) Higher percentages of hemicellulose are found in hard wood s and lesser percentages are fou nd in soft plants The other major component lignin makes up 1020 % of biomass and is a polymer of mostly aromatic compounds (188) Starch, cellulose, and hemicellulose can serve as feedstock for ethanol fermentation T he polymers must f irst be hydrolyzed into their monomeric carbohydrate constituents that are the usable substrates for the ethanol producing microbial biocatalyst. 1,4 and 1, 6 glycosidic amylase glycoamylase and pullulanase releasing glucose (149) 1,4 glycosidic linkage in cellulose is catalyzed by a class of enzymes called cellulases (134, 191) There are different types of cellulases classified by their activit ies (15) Endocellulases are enzy 1,4 glycosidic linkages

PAGE 22

22 producing smaller chains of the cellulose polymer (131, 134) Exocellulase (c ellobiohydrolase) 1,4 linkages near the ends of the native cellulose polymer and polymers produced by endocellulase releasing 2, 3, or 4 linked glucose units called cellobiose, cellotriose, or cellotetrose, respectively (134) Cellobiase or -glucosidase hydrolyz es the exocellulase products such as cellobios e into individual glucose monosaccharides (134) The structural comple xity of cellulose hinders the accessibility of cellulases to the polymer, thus requiring pretreatment of the polymer and a higher level of enzymes than used for starch hydrolysis to hydrolyze cellulose to glucose (15, 230) Current hemicellulose hydrolysis involves a nonenzymatic approach. Hemicellulose is hydrolyzed by dilute acid at high temperature and steam treatments (191) This process releases the monomeric carbohydrates; however, due to the har sh conditions need ed to hydrolyze hemicellulose, small amount s of the sugars and aromatic compounds of lignin are converted to other compounds that are inhibitory to fermenting organisms. These inhibitory compounds include, but are not limited to, acetate furfural, 5 hydroxymethylfurfural (HMF), p hydroxybenzoic acid, vanillin, and syringaldehyde (4, 191, 230, 231) There are several studies that are focused on reducing the production of inhibitors and/or increas ing the tolerance of fermenting organisms to such compounds (79, 191, 193) Currently in the United States, greater than 93 % of ethanol production utilizes corn starch as feedstock (31, 77, 127) Other countries with warmer climates such as Brazil, mainly use sucrose from sugarcane; whereas, more temperate regions use sucrose from sugar beets as feedstock (11, 19, 50, 125) Since these dominant feedstock sources are also food items, the increase in global ethanol demand shifts the use of these food items to fuel thus increasing global food prices (31, 91) In order for ethanol to be an economically favorable fuel, its feedstock

PAGE 23

23 must be derived from non -food sources su ch as lignocellulose cellulose and hemicellulose fractions of biomass (77, 127, 188) Yeast, such as Saccharomyces cerevisiae are the industrial ethanol producers (50, 127, 202) S. cerevisiae s historical prevalence and industrial knowledge still makes it the organism of choice for ethanol fermentation; however, its substrate utilization limitation s may suggest a shift to non traditional fermentative organisms. S. cerevisiae naturally ferment s glucose but not pentoses such as xylose, the second most abundant carbohydrate found in biomass (106, 156, 202, 227) Other yeast, such as Pichia stipitis and Candida tropicalis, can ferment xylose; however, their low ethanol yields with xylose and inability to ferment other hemicellulose sugars has hinder ed further strain development (77, 105, 106) Expression of xylose reductase and xylitol dehydrogenase from P. stipitis in recombinant strains of S. cerevisiae was only partially successful due to the inherent redox constraints of this pathway which resulted in undesirable byproduct formation, such as x ylitol, in the absence of oxygen (7, 115, 181, 203) To mediate this problem, xylose isomerase from yeast Piromyces sp E2 and Thermus thermophilus w ere cloned and expressed in S. cerevisiae resulting in strains with similar ethanol yields on xylose as with glucose (25, 36, 203) Attempts in engineering S. cerevisiae to ferment pentose such as L arabinose w ere less successful due to the poor expression of bacterial source genes in this eukaryote (25, 36, 80, 216, 218) Bacterial ethanol fermentation also has potential industrial applications. Zymomonas mobilis is a traditional bacterial ethanol producer used for fermentation of alcoholic beverages such as tequila. Z mobilis metabolizes sugars by Entner -Doudoroff pathway and produces only ethanol as fermentation product. Advantages of Z. mobilis include, but are not limited to, high ethanol production yield of up to 120 g L1, high ethanol tolerance, and high specific ethanol

PAGE 24

24 productivity (139, 170, 184) Z. mobilis inability to utilize other sugars found in biomass hinders the industrial use of this organism for production of fuels Like yeast, recombinant strains of Z. mobilis were constructed for utilization of xylose and arabinose resulting in strains with broader substrate capability while retaining high ethanol yields; yet, problems of long fermentation times due to low produc tivity has hinder ed the development of these strains (30, 54, 127) Escherichia coli is a G ram -negative facultative anaerobe that catalyzes mixed acid fermentation. The vast accumulated knowledge and available genetic tools makes this organism a feasible platform for metabolic engineering for production of ethanol or other valuable chemicals. This organism has a broad range of substrate utilization, can naturally ferment all carbohydrates found in lignocellulose, and can grow in minimal salt s medi um which reduces cost of product production. To date, one of the most promising ethanologenic E. coli, strain KO11 has a chromosomally integrated pyruvate decarboxylase gene ( pdc ) and alcohol dehydrogenase gene ( adhB ) from ethanologenic bacterium Zymomonas mobilis (97, 155, 227) Strain KO11 has the same ethanol specific productivity as yeast using glucose as a substrate and can utilize extremely high xylose concentrations of over 100 g L1 (96 98, 227, 235) However, disadvantage of this recombinant stra in include low ethano l tolerance of about 5 % which was about one -third that of yeast s ethanol tolerance Problems with e thanol : Ethanol is the first widely used commercially available renewable transportation fuel. The use of ethanol is a first step aw ay from the dependence on fossil fuels and towards a new era of clean, sustainable energ y Ethanol as a fuel however, is not perfect. Pure ethanol cannot be combusted in modern automotive engines due to its chemical properties (199) Ethanol has a higher vapor pressure than gasoline, which at operating

PAGE 25

25 temperatures, could produce vapor bubbles within the fuel lines. The vapor lock can cause the car to hesitate and stall due to inadequate fuel delivery. Another main concern with ethanol is that it has a higher latent heat of vaporiz ation which requires more heat to vaporize the ethanol fuel than gasoline which can reduce the ability of the cars engine to ignite the fuel at lower temperatures. High ethanol containing fuels may be a problem for older cars with carburetors due to inad equate fuel delivery if they are not adjusted for the lower combustional energy. Modern fuel injection delivery systems sense the lower energy and adjust by increasing fuel delivery; however, this in turn lower fuel efficiency. Most internal combustion e ngines can operate with 10 % ethanol mixtures with 90 % gasoline without modifications but only new engines especially modified for E85 can utilize 85 % ethanol 15 % gasoline mixture. The chemical properties of ethanol also make ethanol incompatible wit h current fuel transportation infrastructure and utilization. Ethanols low er solubility in gasoline, high solubility in water, and hygroscopic nature present an immense problem in fuel transportation (199) Currently, gasoline is primarily transported through pipelines. Moisture that se ep s into transportation pipelines is normally not a problem due to waters low solubility in gasoline. Since ethanol is hygroscopic, a gasoline/ethanol mixture permits water contamination in fuel which may cause damage to engine parts. The p olar nature o f ethanol molecules creates strong hydrogen bonds with water. Since water easily separates from gasoline, water contamination causes a temperature dependent phase separation of gasoline and ethanol/water mixture (199) Low temperature is a major concern since it increases phase separation of water contaminated gasoline/ethanol mixture which may lead to frozen fuel lines during the winter. The added corrosiveness of ethanol and water also makes it less suitable for pipeline transportation. To mediate this problem, ethanol requires its

PAGE 26

26 own separate transportation system and needs to be mixed with gasoline at the pumping station to avoid water contamination and fuel separation. Another problem with ethanol is that current production requires use of food items as feedstock which in turn dri ves up the cost of both food and fuel. A shift to lignocellulosic ethanol would remedy th is problem; however, more research will be needed to develop improved processes and microbes to handle the harsh scale of industrial fermentation of biomass. Continu al usage of ethanol as a fuel will require a drastic overhaul of the fuel infrastructure. A shift to a new second generation renewable fuel may be required to move beyond the problems associated with ethanol use The new fuel must be clean, cost -effective, high in energy, and/or does not require much change in current delivery systems. Potential next generation renewable fuels are hydrogen and butanol. Second Generation Renewable Fuels Hydrogen The use of hydrogen as a fuel has been of great interest since its combustion produces only heat and water although shift to H2 as a fuel would also require a new infrastructure Hydrogen provides more energy per unit mass than all other combustional energy sources (57) The combustional en ergy of hydrogen is 5 2 200 BTU /lb whereas gasoline, compressed natural gas, propane, and ethanol yield only 18, 6 00 B TU /lb, 2 0 2 00 B TU /lb, 19, 9 00 B TU /lb, and 11, 6 00 BTU /lb, respectively (57) During the energy crisis of the 1970s, hydrogen sources and applications were explored. Hydrogen was, at the time, believed to be the fuel of the future. Most of the funds for hydrogen research diminished after oil price dropped but resurfaced again in the 1990s with the concern about the greenhouse effect of net CO2 r elease into the atmosphere from fossil fuel use (20) In 2003, President Bush announced a $1.2 billion hydrogen fuel

PAGE 27

2 7 initiative for developing technology associated with creating, storing, distributing, and utili zing hydrogen in fuel cells bringing hydrogen to the fore -front again (41) But anol The current shift to using ethanol as a fuel additive is an important progression towards the utilization of renewable fuels. The use of butanol as a fuel additive has been of great interest because of its advantages over ethanol. Butanol has a low solubility in water It is also hydrophobic and has complete solubility with gasoline at any ratio (168) Gasoline/butanol mixture s could be pumped in pipelines without further modification and this approach do not require a separate mixing station. Butanol also provides higher energy per unit mass than ethanol with a value closer to gasoline ( 86 % ). The combustional energy of butanol is 16,000 BTU /lb whereas gasoline and ethanol yields are 18, 6 00 B TU /lb and 11, 6 00 B TU /lb, respectively (168) Since butanols properties resemble those of gasoline, 100 % butanol could be used in automotive engines even on older cars built in the early 1990s, without any modification (168) The history of biological production of butanol dates back to its discovery by Pasteur in the mid 1800s I ndustrial ABE fermentations were greatly employed from the 1910s to the late 1940s as a source of solvents and synthetic rubber (107) The emergence of the, at the time plentiful and cheap, petrochemical based solvent production in the 1940s led to the demise of ABE fermentations. Sixty years later as the petroleum cost and reserves reached problematic levels, buta nol fermentations are being explored again as a source of renewable energy.

PAGE 28

28 CHAPTER 2 BACKGROUND ON HYDROGEN PRODUCTION Current H ydrogen P roduction M ethods As mentioned before, hydrogen is an excellent fuel whose combustion only releases heat and water. This section will briefly summarize current technology in hydrogen production from both fossil fuel and renewable sources. I will also introduce biological sources and microbial biocatalysts available for both ph otosynthetic and fermentative hydrogen production. Methane S team R eforming At present, hydrogen is produced by a process called steam reforming which utilizes the water -gas -shift reaction (Equation 2 1) CH4 + H2O CO + 3H2 (700 1,100 oC) (2 1 ) CO + H2O CO2 + H2 (130 oC) CH4 +2H2O CO2 + 4H2 When compared with other fossil fuels, methane, commonly known as natural gas is currently the most favorable feedstock for hydrogen production because of its availability and its high hydrogen to carbon ratio, which minimizes the yield of CO2 (152) The disadvantage of this method is that it uses a fossil fuel. In 200 7 US imported 19.9 % of its natural gas needs which was about 4.8 % higher than in 2004 (65) Using this method for production of hydrogen for fuel production would require additional import of natural gas and would only increase this countrys dependence on foreign energy imports. Coal G asification United States has a abundant supply of coal with estimated reserves lasting for an additional 20 0 years at the current rate of use (42) The shift towards hydrogen production from coal will decrease energy import. The production of hydrogen from coal involves a process called gasif ication. This process comprises partial oxidation of coal with oxygen and steam in a

PAGE 29

29 high temperature and pressure reactor (141) This process, like the steam reforming of natural gas, produces a mixture of carbon monoxide and hydrogen in which the CO can be used to make additional hydrogen. One concern with coal as a feedstock is that this process release s a significant amount of CO2 due to its high carbon to hydrogen ratio compared to methane Using current technology, the combustion of coal produces 19 kg of CO2 per kg hydrogen produced compared to the combustion of natural gas that produces 10 kg of CO2 per kg hydrogen produced (152) Coal also contains impurities that would be released into the environment such as sulfur oxides, nitrogen oxides, lead, and mercury. These concerns are being met with clean coal technologies that reduce plant emissions and increase plant thermal efficiencies. Further improvements in these technologies could enhance coals future as a source of hydrogen. However, the collected toxic materials still need to be disposed in an environmentally safe manner. The cost of hydrogen production from coal is one of the lowest only if the demands for hydrogen are sufficient to construct a centralized plant and a large distribution system (152) In 2003, then President Bus h announced that the United States would be the first to sponsor a $1 b illion, 10 -year demonstration project to create worlds first coal -based, zero -emission electricity and hydrogen plant. This technology is expected to accelerate the commercialization of hydrogen fuel by 2020 (42) Hydrogen from H2O Hydrogen could be generated by splitting water into its two elemental components: hydrogen and oxygen, with input of energy. This proces s termed electrolysis, involves passing an electric current through water. The water molecule dissociates producing hydrogen at the cathode and oxygen at the anode. The electrolysis efficiency ranges from 7580 % with the remainder of the energy lost as heat (152) Increasing the operating temperatures could increase the efficiency to 8590 % ; how ever, certain challenges such as electrode and proton exchange

PAGE 30

30 membrane stabilities must be overcome. Currently, the cost of the energy input into the system outweighs the value of the hydrogen evolved (152) This technology could be coupled with the electricity produced from nuclear and renewable resources as discussed below for H2 production. Nucl ear power could also serve as the source of energy for hydrogen production reactions. The heat produced from the nuclear fission reaction could be coupled to steam reforming and gasification processes of natural gas and coal, respectively. As a heating s ource, this would reduce the CO2 emission from natural gas steam reforming by 40 % The electricity produced by nuclear power could be used in electrolysis of water although the efficiency of electrolysis makes it uneconomical (210) At high temperatures thermal -chemical water splitting reactions can be used to catalyze the dissociation of water. One example of this is the sulfur -iodine cycle (39) (Equation 2 2) : I2 + SO2 + 2 H2O 2 HI + H2SO4 (120 oC) (2 2 ) H2S O4 SO2 + H2O + O2 (830 oC 900 oC) 2 HI I2 + H2 (300 oC 400 oC) H2O H2 + O2 As with all nuclear technologies, there are also disadvantages of high capital cost and nuclear waste storage and disposal (152) The use of renewable energy is the ultimate goal in sustainable hydrogen production. Wind energy is often viewed as an excellent source for renewable hydrogen production in a mid term time span (152) Wind energy is pollution-free and requires no feed. The electricity produced from the wind turbines could be used to electrolyze water. In order for this technology to be economical, there needs to be a reduction in the cost of electricity produced by the wind powered turbines, a reduction in the cost of the electrolyzers, and optimization in hydrogen storage systems (152) The cost of electricity produced by wind could be attributed to the cost

PAGE 31

31 and efficiency of the wind turbines. Location plays an important role in site selection and cost. The site must have powerful wind throughout the year, be located near existing distribution networks, and be economically competitive for land use. The variability of wind intensity may affect electricity output, thus affecting the sustainability of electricity and hydrogen production. This problem could be s olved with a backup power grid, which supplies electricity when wind power is less than sufficient; however, this adds additional capital cost. Other disadvantages of wind power are the high noise generated by the turbines, impact on local bird life, visu al esthetic of the landscape, and interferences to electromagnetic signals (152) Solar energy co uld also be used for hydrogen production. One method of producing solar hydrogen utilizes photovoltaic cells that capture solar energy and convert it to electricity. This electricity could again be used to produce hydrogen by electrolysis. Currently, the cost of electricity from a photovoltaic cell module is 6 to 10 times that of electricity from coal or natural gas (152) Significant cost reduction is required if solar energy is to be used for electricity and hydrogen production. Another method of hydrogen production from solar energy that is being researched utilizes photoelectrochemical cell s for the direct production of hydrogen from water without using an intermediate electrical current. This requires a submersed solid inorganic oxide electrode catalyst that is capable of splitting the water molecule directly when light energy is absorbed. Potential candidate materials are SrTiO3, KTaO3, SnO2, and Fe2O3. Stability and catalytic efficiencies require further optimizations (126, 152) As with wind power, this renewable energy is not without its own problems. Solar output changes both daily and seasonally. Backup systems must be set up to supply energy when solar energy is not sufficient or absent to meet demands. This requires about four to six times more solar modules than needed during peak

PAGE 32

32 operations. The surplus energy produced is stored for hydrogen production during less favo rable conditions. Land considerations are similar to that of wind power: the site must have intense year -round sunlight, be located near existing distribution networks, and be economically competitive for land use. Other concerns with solar energy are the possible release of toxic materials such as cadmium in the production and di sposal of photovoltaic cells (152) Moving beyond inorganic catalysts, biocatalyst such as cyanobacteria and algae could evolve hydrogen by using solar energy couple d with photosynthesis. This process is presented in greater detail in a later section. Biomass C onversion to H ydrogen In association with solar energy, photons could be captured by biol ogical processes to produce biomass via photosynthesis. Biomass could then be processed thermochemically by gasification/pyrolysis processes followed by steam reforming similar to hydrogen production from coal (10) Biomass conversion is renewable and non-pollut ing Any CO2 released from this process is fixed by recent photosynthesis; thus, zero net CO2 is produced within this short time f rame. However, this does not account for the CO2 produced from the needed heating processes such as the burning of fossil fuels and this can be mitigated by the use of biomass. There are two general types of biomass that could be used: primary biomass and biomass residue (152) Primary biomass includes energy crops such as switchgrass, poplar, and willow. These are dedicated plants grown for energy production. Biomass residues include agricultural and municipal waste. The problems currently associated with biomass gasification/pyrolysis include variable efficiencies, tar production, and catalyst erosion (10, 152) In addition to gasification/pyrolysis of biomass, biological processes utilizing microbes could also yield hydrogen directly by fermentation (20)

PAGE 33

33 Microbial Hydrogen Production History Hydrogen production by photosynthetic cyanobacterium Anabaena was first reported by Jackson and Ellms in 1896 (102) Hydrogen was later found, in 1901, to be also produced from light independent anaerobic fermentation from formic acid (86, 157) In 1931, Stephenson and Strickland identified the enzyme responsible for reversible hydrogen production from enteric bacteria which they termed hydrogenase (186, 187) In 1949, Gest and Kamen demonstrated that hydrogen evolution by photosynthetic bacterium Rhodospirillu m rubrum was dependent on nitrogen fixation, which was later determined to be from the nitrogenase reaction (71) In 1942, Gaffron observed that green alga Scenedesmus obliquus in the presence of light, could use H2 as an electron donor for CO2 fixation in a process he named photoreduction (92, 136) Gaffron and Rubin also reported that S. obliquus could release molecular H2 and CO2 in the dark after adaptation in a nitrogen atmosphere (70) To prevent photoreduction and CO2 fixation from occurring when the algae were exposed to light, they trapped the CO2 released by the algae to pr oduce a CO2-free environment. Under these conditions, S. obliquus continually produced hydrogen in the presence of light at a 10 -fold higher rate compared to the cultures without CO2 trapping. Using electron -transport inhibitors, Gaffron concluded that t he algae tested produced hydrogen via a non -cyclic electron flow through photosystems II and I to hydrogenase (189, 190) Arnon and Tagawa id entified ferredoxin as the electron donor for hydrogenase thereby linking photosynthesis to hydrogen production (192) In vitro experiments conducted by Benemann and others demonstrated hydrogen evolution by spinach chloroplasts mixed with Clostridium kluyveri hy drogenase and ferredoxin (21) It has been well established that microbes produce hydrogen by e ither photosynthetic or fermentative processes (9, 82) Photobiological hydrogen production utilizes H2O as a source of electrons for the reduction of protons whereas

PAGE 34

34 fermentative hydrogen production by algae obtains its reducing power from carbon storage compounds Photosynthetic H ydrogen P roduction Members from both eukaryot es and prokaryot es carry out photobiological hydrogen production. Of the prokaryotes, cyanobacteria and photosynthetic bacteria carry out oxygenic photosynthesis and anoxygenic photosynthesis, respectively, utilizing either hydrogenase or nitrogenase as the terminal enzyme. In these processes, light provides the energy for both hydrogenase and nitrogenase based H2 production (165) Eukaryotic hydrogen production is restricted to green algae and hydrogenase. In oxygenic photosynthesis, cyanobacteria and a lgae utilize chlorophyll as light harvesting pigments and water as the source of electrons (189, 190) Anoxygenic photosynthesis differs in that photosynthetic ba cteria utilize bacteriochlorophylls as the light -harvesting pigments and either inorganic or organic compounds serve as the reductant for hydrogen production (151) The underlying process of photosynthesis is well understood. Oxygenic photosynthesis revolves around the two photochemical reaction centers: Photosystems (PS) I and II (the classical Z scheme; Figure 2 1 ). These photosystems are located within the thylakoid of chloroplast or the membranes of cyanobacteria. Splitting of water is mediated by the excitation of an electron at PS II P680 reaction center or light harvesting complex (LHC II) by the absorption of a photon. The electron passes through the membrane via electron carriers generating membrane potentials transferring electron to reaction center P700 (LHC I) of PS I. P700 then absorbs another photon and the energized electron passes though additional membrane bound carriers to soluble ferredoxin (Fd). Reduced Fd is the electron donor for Fd n icotinamide adenine dinucleotide phosphate (NADP+) oxidoreductase that produces reduced n icotinamide

PAGE 35

35 adenine dinucleotide phosphate (NADPH ) for CO2 fixation (169) Under anaerobic conditions, the reduced Fd is also the electron donor for hydrogenase mediated hydrogen production. There are two types of photobiological hydrogen production from water in green algae: direct and indirect b iophotolysis. Direct biophotolysis involves both PS II and PS I simultaneously and electrons from water are transferred directly to hydrogenase for hydrogen production. The problem with direct biophotolysis is that the O2 evolved by PS II inactivates hydrogenase, the H2 producing enzyme. Indirect biophotolysis occurs in two stages. In the first stage, NADPH is produced from reduced Fd. NADPH and a denosine 5' triphosphate ( ATP ) are used to fix CO2 to carbohydrates. In the second stage, PS II activity i s reduced to the level of respiration either by low light or by sulfur depletion, and the carbohydrates produced during photosynthesis stage are metabolized producing NAD(P)H. Electrons from NAD(P)H feed into quinone -Cyt b6f complex, then to PS I which lea ds to the reduction of Fd with the absorption of a photon (Figure 2 1) Reduced Fd then transfers its electrons to hydrogenase for hydrogen production. The advantage of indirect biophotolysis is that it temporally separates the production of O2 and H2 an d eliminates hydrogenase inactivation by O2. Another advantage is that the gas mixture produced in the second stage is composed of CO2 and H2, which is far less dangerous to handle compared to the explosive mixture O2 and H2 from direct biophotolysis (165) In addition, in indirect biophotolysis, H2 production can proceed until all the stored carbohydrates have been converted to H2 due to the stability of hydrogenase. In a similar experiment using cyanobacteria, Mitsui and his coworkers temporally separated carbohydrate pro duction in the light and conversion to H2 in the dark through nitrogenase (140) This light -dark cycle can be repeated several times.

PAGE 36

36 Hydrogenase and nitrogenase based hydrogen production systems. The enzymes med iating the conversion of protons and electrons to molecular hydrogen are hydrogenase and nitrogenase. Hydrogenase is present in both eukaryotic and prokaryotic microorganisms whereas nitrogenase, an ATP -dependent enzyme, is restricted to bacterial and arc haeal systems. These enzymes from different organisms range from moderately to extremely oxygen sensitive which causes a problem for oxygenic photosynthesis. The oxygen-sensitivity of hydrogenase is overcome by Scenedesmus by producing the enzyme only du ring dark anaerobic conditions (70) This allow s Scenedesmus to temporally separate hydrogen production from photosynthesis; however, upon introduction of light, hydrogen production decrease s dramatically within a short period of tim e due to inactivation of hydrogenase. Sustainability of H2 production is increased by depriving the alga Chlamydomonas reinhardtii of sulfur containing compounds (223) The deprivation of inorganic sulfur decrease s oxygenic photosynthesis (PS II) without affecting PS I or the rate of cellular respiration. The absolute rate of photosynthesis mediated O2 production decrease s below the rate of respiration 24 to 30 hours ( h rs ) after S -depletion creating an anaerobic environment that is suitable for sustained hydrogen production (137) Even with the use of cyclical sulfur availability, the algal culture is limited to producing hydrogen only during p eriods of sulfur deprivation. Ideally, a commercially viable photohydrogen producing system should simultaneously and continuously operate PS II and hydrogenase (direct biophotolysis). Much time and effort have been invested in producing an oxygen -stabl e hydrogenase with little success (40, 46) The Department of Energy (DOE) Hydrogen R&D Program does not believe that there is at present a plausible approach to overcome the O2 inhibition of hydrogenase in a direct biophotolysis process and does not recommen d further effort to pursue this area of research (22) Other research in this area

PAGE 37

37 includes reducing the number of light harvesting pigments or antenna size per photosystem to increase photosynthetic efficiency. Individual algal cells exhibit maximal rate of photosynthesis at low light intensity of only 10 to 20 % of sunlight. Higher light intensities are not utilized due to the slow electron transfer rate between PS II and PS I resulting in an energy loss as heat or fluorescence (27, 29, 143) By combining the shading effects of the culture and the individual cells efficiency, it was calculated that up to two third of the light absorbed is wasted due to the light saturation effect (22) Current commercial algal production systems with Spirulina operate only at 1 % of tota l solar energy conversion. The goal of the DOE is to reach 10 % solar conversion efficiency (22) The principal role of nitrogenase in the cell is to reduce molecular nitrogen to ammonia. Nitrogenase also produces molecular hydrogen with different stoichiometric yields along with NH3 depending on the metal within the active center (63, 165) (Equation 2 3) : Molybdenum nitrogenase: N2 + 8 H+ + 8 e2 NH3 + 1 H2 (2 3 ) Vanadium nitrogenase: N2 + 12 H+ + 12 e2 NH3 + 3 H2 Iron nitrogenase: N2 + 21 H+ + 21 e2 NH3 + 7.5 H2 Nitrogenases are classified by the metals found in the active site such as molybdenum, vanadium or iron Although V and Fe nitrogenases are found in the N2-fixing bacteria, their concentration in the cell is significantly low compared to Mo nitrogenase, even when these alternate nitrogenases are maximally induced. Only the structure of molybdenum nitrogenase has been solved; however, amino acid sequences reveal similarities between the other forms (116, 176) In the absence of N2, H2 is the only product of nitrogenase. These reactions are energy intensive requiring 2 moles ATP per mole electron transferred (63) U nlike hydrogenase hydrogen pr oduction by nitrogenase is thermodynamically favorable due to the of hydrolysis of

PAGE 38

38 ATP With nitrogenase, hydrogen production continues at hydrogen pressures of up to at least 50 atmospheres (180) Hydrogen production by N2-fixing bacteria is also associated with a hydrogen uptake hydrogenase reoxidizing H2 with a net decrease in yield. Mutations in uptake hydrogenase are found to in crease hydrogen yields (110) Nitrogenases also exhibit varying levels of O2 sensitivity. Through evolution, various organisms developed different mechanisms of separating oxygen from O2 sensitive nitrogenase. In cyanobacteria, such as Anabaena, under nitrogen-limitation conditions, a fraction (~8 12 % ) of the filament differentiates into a morphological state known as heterocyst which contains nitrogenase. Hete rocyst s lack the oxygen-evolving PS II and receive nutrients and reductant from adjoining vegetative cells (74) Protection mechanisms have also been discovered in nonheterocystous filamentous cyanobacteria such as Trichodesmium (23) In this organism, the nitroge nase is localized in subsets of consecutively arranged cells in each filament, which accounts for about 15 20 % of all the cells. Unlike heterocysts, these cells also contain PS II components. During times of increased nitrogen fixation, PS II components were found to be down regulated and vice versa. This allows Trichodesmium to spatially and temporally segregate nitrogen fixation and hydrogen evolution from oxygenic photosynthesis. Fermentative H ydrogen P roduction According to Gray and Gest (76) all prokaryotes that produce hydrogen belong to four groups: strict anaerobic heterotrophs that do not contain a cytochrome system ( Clostridium ), heterotrophic facultative anaerobes that contain cytochromes and use formate to produce hydrogen ( E. coli), strict anaerobes with a cytochrome system ( Desulfovibrio ), and photosynthetic bacteria with light -dependent evolution of hydroge n ( Rhodospirillum ). They suggested the first group of organisms produce hydrogen as a way to dispose of electrons coupled to energy yielding oxidation of carbohydrates. Hydrogen production from the second

PAGE 39

39 group was proposed to promote energy -yielding oxi dations by removing the end -product formate. Group three organisms are believed to possess both mechanisms for hydrogen production (146) The only group three organism known is Desulfovibrio sp. (16) Group four organisms use light as the energy source for hydrogen production; however, unlike cyanobacteria and algae, electrons come from organic or inorganic substrates instead of water. The first three groups of bacteria use hydrogenase for hydrogen production while the primary enzyme of photosynthetic bacteria for hydrogen production is nitrogenase. Beyond prokaryotes, strict anaerobic protozoa also po sses hydrogen producing capabilities within the hydrogenosome. Hydrogenosomal hydrogen production is mechanistically similar to that of group one organisms. Strict anaerobes such as Clostridium sp. lack a cytochr ome system for oxidative phosphorylation so all ATP generation must be from substrate level phosphorylation during fermentation. During glycolysis, glucose is oxidized to pyruvate producing ATP and reduced n icotinamide adenine dinucleotide ( NADH ). Pyruva te is further oxidized by pyruvate -ferredoxin oxidoreductase (PFOR) into acetyl CoA, CO2, and the electrons are transferred to Fd. Reduced Fd provides electrons for hydrogen production through a soluble [Fe] hydrogenase. Initially, it was believed that N ADH produced by 3 -P glyceraldehyde dehydrogenase during glycolysis is also used to reduce Fd by a putative NADH -ferredoxin oxidoreductase (NFOR) as described by Thauer et al. (82, 146, 215) Competing routes of NADH oxidation are the reduction of acetyl CoA to ethanol, reduction of pyruvate to lactate, and conversion of acety l CoA to butyryl CoA with an ATP yielding formation of butyrate catalyzed by phosphotrans butyrylase and butyrate kinase L actate or ethanol production does not yield ATP. ATP could also be generated from acetyl CoA by phosphotransacetylase (PTA) and acet ate kinase in the production of acetate. The maximum theoretical yield of 4 moles H2 per mole glucose can be achieved in bacteria if acetate

PAGE 40

40 is the sole fermentation product and all the NADH produced during glycolysis is converted to H2. T he yield is onl y 2 moles H2 per glucose if butyrate is the sole end product. The observed yield is typically between 40 50 % (~1.5 2.0 H2/glucose) of the theoretical maximum (4 H2/glucose) for wild type Clostridium producing both acetate and butyrate as major fermentation products (146) This suggests that NADH is not a preferred reductant for H2 production in Clostridium although an NADH dependent H2 producti on was demonstrated in cell extracts. My own studies also confirmed the existence of an NADH -dependent H2 evolution activity in C. acetobutylicum This reaction had a requirement for acetyl CoA. However, an NADH ferredoxin oxidoreductase was never isola ted after several attempts by various investigators, including myself. Recently, Thauer et al. discovered that the clostridial NADH dependant ferredoxin reduction activit y is actually a coupled reaction with crotonyl CoA reduction by butyryl CoA dehydrogen ase/ETF (electron transfer flavoprotein) complex thus, requiring butyrate producing pathway for NFOR activit y (124) This explanation account s for the lower observed hydrogen yield and also the need for acetyl -CoA in cell extract Strict anaerobic protozoan hydrogen production is mechanistically similar to that of Clostridium Protozoan hydrogen production is compartmentalized within a specialized energy producing organelle called the hydrogenosome. In this organelle, pyruvate, which was derived from glucose, is metabolized to acetyl CoA, CO2, and H2 by PFOR and hydrogenase in the same manner as clostridia However, protozoa such as Trichomonas have a n NADH dehydrogenase that is homolog ous to mitochondrial complex I capable of reducing low potential electron acceptors such as ferredoxin (94) Heterotrophic facultative anaerobes such as E coli produce hydrogen using the formate hydrogen lyase (FHL). FHL complex consists of two enzymes, formate dehydrogenase (FDH -

PAGE 41

41 H), [NiFe] hydrogenase isoenzyme 3 (HYD3), and electron carriers connecting the two. FDH H converts formate to CO2, 2H+ and 2e-. The electrons are transferred to HYD3 for hydrogen production (28) The oretically, E. coli could produce 2 moles H2 per mole glucose through glycolysis, pyruvate formate -lyase and FHL; however, the observed net H2 yields are only about 60 % of the theoretical maximum (146) suggesting that some of the formate or H2 is consumed by other reactions in the cell Another facultative anaerobe with higher hydrogen yield is Enterobacter aerogenes Mutations leading to decreased acetolactate synthase activity have been shown to increase H2 yield from 0.8 H2/glucose to 1.8 H2/glucose when compared to wild type strain HU101 (101) Ogino and coworkers compared different strains of Clostridium butyricum to E. aerogenes and found that E. aerogenes is not sensitive to oxygen, has a broad range of substrate utilization, and has comparable hydrogen yiel ds with C. butyricum. E. aerogenes also grows in mineral salts medium and does not require expensive reducing agents in growth medium which lowers the cost of hydrogen production (153) According to an economic analysis submitted to the National Renewable Energy Laboratory, production of hydrogen by fermentation is expected to be cost effective if the organism could produce a yield of 10 moles H2 per mole of glucose (64) This takes into account capital cost of plant, plant production rate, cost of substrates, and H2 market value. Theoretically, up to 12 moles H2 could be produced from a mole of glucose by complete oxidation (Equation 2 4) C6H12O6 + 6 H2O 2 + 6 CO2 (2 4 ) Only an in vitro enzymatic reaction was reported to produce this higher yield although low rates and the high cost of the enzymes makes this method impractical for large -scale application (219, 220, 233) None of the whole cell based H2 production methods could reach this minimum

PAGE 42

42 requirement of 10 H2 per glucose for cost effective hydrogen production due to physiological and thermodynamic barriers. Strict anaerobes have the ability to couple NADH to H2 production but lack the capabili ty to fully oxidize acetyl CoA to CO2 due to an incomplete t ricarboxylic acid (TCA ) cycle. Most of the carbons and associated reductants are lost as fermentation products. As for facultative anaerobes, formate appears to be the sole substrate for hydroge n production. Although these organisms do have a complete TCA cycle, the inability to convert NADH directly or indirectly to H2, lowers the yield to only 2 H2/glucose. In order to approach the goal of 10 H2/glucose, a hybrid hydrogen producing system wo uld be required, combining the pathways of facultative and strict anaerobic organisms. E. coli produces 10 NAD(P)H from glucose during aerobic conditions from the following reactions : 2 NADH from 3 -P -glyceraldehyde dehydrogenase; 2 NADH from pyruvate dehydrogenase; 2 NADH from ketoglutarate dehydrogenase; 2 NADH from malate dehydrogenase; and 2 NADPH from isocitrate dehydrogenase. Transcriptional regulation of TCA cycle genes is effected by the ArcAB and FNR systems. During anaerobic conditions, a membr ane bound ArcB senses the redox state, perhaps from increas ed concentrations of reduced electron carriers from NADH dehydrogenase to quinones and activates ArcA by phosphorylation (215) ArcA -P is a globa l regulator that represses transcription of the genes for many TCA cycle enzymes. FNR is also activated under anaerobic conditions and regulates arcA transcription (183) The role of FNR is to induce genes encoding anaerobic respiration proteins and repress some of the aerobic genes (215) Unlike the two -component regulatory system of ArcAB, FNR is activated by the reduction of a bound [Fe -S] cluster, causing a conformational change in the protein (215) If an electron sink that could actively convert electrons from NADH to hydrogen is active in the cell, the NADH/NAD+ ratio will be kept low allowing the TCA cycle to be active even under

PAGE 43

43 anaerobic conditions. In this case, the electron sink would be NADH dependant hydrogen production pathway, such as the one from Trichomonas transferred to the facultative anaerobe E. coli. The thermodynamics of hyd rogenase could hinder the NADH dependent hydrogen pathway in E. coli. The enzyme hydrogenase catalyzes a simple reaction (Equation 2 5) : 2 H+ + 2 eH2 (2 5 ) The E o for H2 oxidation is 420 mV and that for the clostridial ferredoxin (source of electrons for hydrogenase) is about 390 mV. The equilibrium constant for the above reaction is close to 1 so hydrogenase is said to be reversible (195) In order for hydrogen to be produced from NADH the NADH/NAD+ ratio must be increased to higher levels to lower the Eo of the NAD+/NADH couple from 320 mV to that of Fd and H2. This could conflict with the activation of the above described anaerobic TCA cycle. Since the hydrogenase reaction is reversible, hydrogen productio n is subjected to product inhibition at increasing hydrogen levels. This requires continual removal of the produced hydrogen to maintain high rates of H2 production leading to a dilute stream of H2 mixed with other gases Hydrogenase Biochemistry There are three classes of hydrogenases: [Fe], [NiFe], and metal -free hydrogenase. Each of these is characterized by a distinctive functional core, which is conserved within each class. [Fe] and [NiFe] -hydrogenase structures have been solved by x ray crystall ography (90, 159, 207) The active sites of these two classes of hydrogenases show some similarities in their structural framework and chemistry, which support the idea of convergent evolution. Based on amino acid sequence analysis, the third class of metal -free hydrogenase s lack s any resemblance

PAGE 44

44 to the two metal containing classes. Even though they are classified as metal -free, these hydrogenase s do c ontain heme clusters (207) [NiFe] -h ydrogenase [NiFe] -hydrogenases are generally -heterodimers and many of them are associated with membranes and H2 uptake. The large -subunit is about 60 kDa and contains the [NiFe] active site. The small -subunit, about 30 kDa, holds the [Fe -S] clusters. Using sequence analysis, [NiFe] -hydrogenases were separated into four different groups (207, 222) Group one [NiFe] hydrogenases are membrane bound respiratory enzymes that link the oxidation of H2 to the reduction of electron acceptors such as O2, NO3 -, SO4 2-, fumarate, or CO2. Examples include Wolinella succinogenes (59) and E. coli HYD2 isoenzyme (28) reducing fumarate or inorganic oxidants, Ralstonia eutropha (24) reducing O2, and methanogenic archaeon Methanosarcina mazei (95) reducing CO2 from H2. Group two represents cytoplasmic H2 sensors and the cyanobacterial uptake hydrogenases such as in Anabaena variabilis (85) H2 signaling hydrogenases, found in Rhodobacter capsulatus (66) and Bradyrhizobium japonicum (26) are involved in hydrogenase gene regulation in response to H2. Group three enzymes are bi directional heteromultimeric cytoplasmic [NiFe] -hydrogenases. In this group, the dimeric hydrogenase is associated with other subunits that are capable of binding cofactors such as F420 (Methanococ cus voltae (38) ), NAD+ (R. eutropha (177) ), or NADP+ ( Pyrococcus furiosus (130) ). Group 4 are hydrogen evolving membrane associated hydrogenases. E. coli HYD3 along with many archaeal hydrogenases such as the ones from Methanosarcina barkeri and P. furiosus belong to this group. These enzymes are energy -conserving, meaning that they reduce protons in order to dispose of excess reducing equivalents produced by anaerobic oxidation of low potential C1 compounds with associated proton gradient generatio n (208)

PAGE 45

45 [Fe] -hydrogenase [Fe] hydrogenases are the main interest of this study since these enzymes are cytoplasmic and couple ferredoxin to H2 evol ution [Fe] -hydrogenases are mainly monomeric proteins containing the H -cluster active site. The H -cluster consists of a binuclear [Fe] center bound by a [4Fe 4S] cluster. This H -cluster is coordinated by a non protein dithiolate bridging ligand, CNligand, and CO ligand. The composition of the dithiolate linkage is not known experimentally but has been proposed to be either SCH2CH2CH2S (PDT) or SCH2NHCH2S (DTN) (160) [Fe] hydrogenases are found in anaerobic bacteria such as Clostridium sp. and sulfate reducers and in lower eukaryotes such as Trichomonas vaginalis and green algae. [Fe] hydrogenases, the predominant form of hydrogenase found in eukaryotes, are only found in either hydrogenosomes or chloroplasts. The smallest [Fe] -hydrogenases are found in green algae Scenedesmus obliquus Chlamydomonas reinhardtii and C. fusca These hydrogenases are about 45 48 kDa in size and only contain the H -cluster (84) Clostridial [Fe] -hydrogenases, in addition to the H -cluster, contain three other domains: a [2Fe 2S] ferredoxinlike domain, a [4Fe 4S] cluster fold, and a 2[4Fe 4S] domain (150, 159) Biosynthesis of the [Fe] active site is not known. The [Fe] -hydrogenase from C. pasteurianum has been crystallized and its structure was solved (159) The corresponding gene was cloned and was functionally expressed in a cyanobacterium Synechococcus PCC7942 that also produces a [F e] -hydrogenase indicating the flexibility of the activation enzymes (8). C. acetobutylicum was al so found to heterologously express algal [Fe] -hydrogenase from C. reinhardtii and S. obliquus with high specific activities (72) However, the cyanobacterial hydrogenase was not functionally expressed in a non -[Fe] -hydrogenase producing organism such as E. coli (8). In the organisms investigated, the genes coding for the structural genes and the accessory genes are not clustered. Recently, Posewitz et al. identified three novel proteins,

PAGE 46

46 HydEF and HydG, that are required for the assembly of an active [Fe] -hydrogenase in C. reinhardtii (164) Through sequence homology, these enzymes were suggested to be members of radical S adenosylmethionine (SAM) proteins. These proteins wer e purified and characterized from Thermatoga maritima (171) HydE and HydG were able to reductively cleave SAM when reduced by dithionite con firming that they are radical SAM enzymes. The characterization of HydF revealed its ability to hydrolyze GTP (37) Using known models, such as the ra dical dependent sulfur insertion of LipA and BioB in the biosynthesis of lipoic acid and biotin, Peter et al proposed a H -cluster biosynthesis mechanism involving the HydEFG proteins (160) They suggested that Hyd E and HydG form the dithiolate ligand to a [2Fe 2S] cluster from either amino acid or glycolytic intermediates. The role of HydF could be the translocation and insertion of the [2Fe 2S] cluster into the apohydrogenase. The incorporation of genes encoding these proteins along with [Fe] -hydrogenase from C. reinhardtii into a non [Fe] -hydrogenase producing organism such as E. coli supported small (but variable) amount of active hydrogenase (164) Upon purification, recombinant [Fe] -hydrogenases from various organisms coexpressed wit h C. acetobutylicum HydEFG in E. coli yielded active enzymes with low specific activities (113) These results suggest that HydEFG are the minimally required accessory proteins for [Fe] hydrogenase activation. However, just after the establishment of the required maturation accessory proteins for [Fe] -hydrogenase, Inoue et al. expressed a [Fe] -hydrogenase gene from a symbiotic anaerobic protozoan, Pse udotrichonympha grassii found in the digestive hindgut of the termite Coptotermes formosanus without the accessory genes and purified a active recombinant [Fe] -hydrogenase from E. coli (99) Purified recomb inant P. grassii [Fe] hydrogenase produced in E. coli without added accessory genes was about 30 times more active than recombinant clostridial [Fe] -hydrogenase with HydEFG also purified from E. coli (99, 113)

PAGE 47

47 These results suggest that although the HydEFG proteins are required to activate [Fe] hydrogenase, a [Fe] -hydrogenase can be produced in an active form in E. coli using only the native proteins to activate the enzyme. NADH -Dependent Hydrogen Producing Pathway There are two demonstrated NADH dependent H2 production reactions; a clostridial pathway and a hydrogenosomal pathway. NADH -dependent production of H2 was demonstrated using crude extracts of C. kluyveri as well as other clostridia with acetyl CoA as an activator (108, 197) It was believed that NADH is oxidized by NADH -ferredoxin oxidoreductase (NFOR) which reduces ferredoxin (108, 163) Reduced ferredoxin transfer s electrons to [Fe] hydrogenase for H2 production. However, recently, the same group that first detected NADH to H2 activity in C. kluyveri extracts, purified the key enzyme re sponsible for the NADH -dependent reduction of ferredoxin (124) Their results show that the initially discovered NFOR activity was a coupled side reaction of crotonyl CoA reduction by butyryl -CoA dehydrogenase/ electron transfer flavoprotein (Bcd/Etf) complex (F igure 2 2 ) (Equation 2 6) NADH + Fdox + + Fdred o = +4.15 kcal mol1 (2 6) NADH + crotonyl CoA + + butyryl -CoA o = 14.31 kcal mol1 2 NADH+crotonyl CoA+Fdox NAD++butyryl CoA+Fdred o = 10.16 kcal mol1 Using t he E1 ( 60 mV) and E2 ( 430 mV) redox potential of Acidaminococcus fermentans flavodoxin (83, 121, 124, 224) NADH ( 320 mV) dependent reduction of ferredoxin ( 410 mV) appears to be thermodynamically favorable when coupled to crotonyl -CoA reduction ( 10 mV) where electrons from the E2 state (FADH/FADH2) w ere transferred to ferredoxin and E1 state (FAD/FADH) was transferred to crotonyl -CoA. Acetyl -CoA, required in the initial studies, turns out to be a precursor of the substrate crotonyl -CoA and not an activator. Diez Gonzalez et al. also partially purified Bcd from C. acetobutylicum and determined that crotonyl CoA reduction

PAGE 48

48 could also use electron donors from reduced dyes such as 3-(4,5 -d imethylthiazol2 -yl) 2,5 diphenyltetrazolium bromide (MTT) (Eo= 110 mV), 2,6 dichlorophenolindophenol (DCPIP) (Eo= +2 17 mV), and methyl viologen ( MV ) (Eo= 440 mV) where MV based activity was 18 fold higher than observed with MTT (55) This recent information clearly shows that a clostridial NADH -dependent system may not be prudent for the construction of a biocatalyst for hydrogen production, using NADH as the reductant, since for every H2 produced, a molecule of butyryl -CoA will also p roduced. This loss of carbon and energy will significantly lower the H2 per glucose yield and the overall process will be uneconomical. The alternative NADH to H2 pathway starts with NFOR, a hydrogenosomal enzyme in anaerobic protozoan. T. vaginalis NF OR is a heterodimer consisting of a small (NdhE) and a large (NdhF) subunit and these proteins have high homology to mitochondrial 24 kDa and 51 kDa subunits of NADH -dehydrogenase (NDH) of respiratory complex I (94). Unlike other known respiratory NDH enzymes the anaerobically produced T. vaginalis NDH has a unique capability for reduction of low potential electron acceptors such as its native [2Fe 2S] ferredoxin (Eo= 347 mV) and MV (Eo= 440 mV) (94) This difference in electron acceptors is expected to reside in the structural components of the T. vaginalis NDH, such as FMN, [Fe -S] clusters, etc. In this study, I purified the NDH heterodimer, as well as the individual subunits and biochemically characterized them to elucidate the mechanism by which the recombinant enzyme utilizes low potential electron carriers as substrate. It has been previously demonstrated that chemically reduced viologen d yes can couple to hydrogenase for hydrogen production both in vivo and in vitro (17, 81, 117, 174) Since T. vaginalis NDH ha s been demonstrated to readily reduce methyl viologen (Eo= 440 mV) (94) which has a lower redox potential than hydrogen (Eo= 420 mV), the reduced MV produced in

PAGE 49

49 vivo by T. vaginalis NDH (expressed in E. coli ) can potentially couple NADH oxidation to hydrogen production (Figure 2 3). T his pathway has the potential to increase hydrogen yield beyond the theoretical 2 mol per mol glucose in E. coli and other facultative anaerob es .

PAGE 50

50 Figure 2 1 Photosynthetic electron transport pathways for hydrogen production in green algae. Electrons may originate from photo oxidation of water at PS II or at the plastoquinone pool from the oxidation of endogenous substrates such as glycogen and starch. Reduced Fd from PS I could transfer electrons to hydrogenase for hydrogen production, or to FN O R to generate NADPH for CO2 fixation. TCA, Tricarboxylic acid cycle; P680, photoreaction center of PS II; Q, primary electron acceptor of photosyst ems; PQ, plastoquinone; Cyt, cytochrome; PC, plastocyanin; Fd, ferredoxin; Red, NAD(P)H quinone oxidoreductase; H YD, hydrogenase; FN O R, ferredoxin NADP+ oxidoreductase [Adapted from Melis, A., and T. Happe. 2001. Hydrogen production. Green algae as a source of energy. Plant Physiol 127: 740748 (Page 743, Figure 2)]

PAGE 51

51 Figure 2 2 NADH -dependent reduction of ferredoxin by C. kluyveri Bcd/EtfBA ( c lostridial NFOR) coupled to crotonyl -CoA to butyryl -CoA reaction The E1 and E2 redox potential of FADH and FADH2 was an estimate based on Acidaminococcus fermentans flavodoxin which ha d similar properties to electron transfer flavoproteins (124) The energetics of this ferredoxin reduction is thermodynamically favorable by coupling crotonyl CoA reduction (Equation 2 6) [Adapted from Li, F., J. Hinderberger, H. Seedorf, J. Zhang, W. Buckel, and R. K. Thauer. 2008. Coupled ferredoxin and crotonyl coenzyme A (CoA) reduction with NADH catalyzed by the butyryl -CoA dehydrogenase/ e tf complex from Clostridium kluyveri. J Bacteriol 190: 843 850. (Page 848, Fig ure 3 ]

PAGE 52

52 Figure 2 3 NADH -dependent hydrogen producing pathway. NADH is oxidized by NADH ferredoxin oxidoreductase (NFOR) which reduces ferredoxin (Fd). Reduced Fd is the electron donor for hydrogenase (Hyd) for H2 production.

PAGE 53

53 CHAPTER 3 BACKGROUND ON BUTANOL PRODUCTION Although H2 is a more desired transportation fuel, other next generation fuels such as butanol may become a reality before the H2 economy is realized. As stated before, butanol has several advantages over ethanol as a transportation fuel. Butanol fermentation has a long history and modification of microbial biocatalysts for butanol production is being attempted by several laboratories around the world. In this section, the current status of butanol fermentation is presented Fossil Fuel -B ased Butanol P roduction Currently, the majority of butanol is produced by the conversion of petro leum -based hydrocarbon to butanol by a process called hydro formylation followed by hydrogenation. Hydroformylation is defined as the addition of a formyl group to a double bond of a hydrocarbon by reaction with a mixture of carbon monoxide and hydrogen in the presence of a catalyst. For butanol production, the f ormyl group is added to the double bond of propylene producing butyraldehyde (194) Butyraldehyde is reduced to butanol by a hydrogenation reaction (200) This process yields both n -butanol and isobutanol which is separated by distillation (148) Microbial B utanol P roduction History Microbial butanol fermentation was first described by Pasteur in 1861 (107) In 1905, Schardinger discovered that butanol fermentation included the co -production of acetone (107) At the beginning of the 20th century with an increase in the automotive industry, a shortage in natural ru bber for the fabrication of tires sparked an interest in butanol fermentation for the production of synthetic rubber from butadiene (68, 69) In 1910, an English firm, Strange and Graham Ltd., was on a venture for the production of synthetic rubber. They recruited the work of

PAGE 54

54 Weizmann and Perkins of Manchester University UK and later Fernbach and Schoen of Pasteur Institute France In 1911, Fernbach isolated a bacillus culture that was able to produce butanol from potato starch but not from corn (68, 69, 107) Weizmann left Strange and Graham Ltd. in 1912 to continue his research at Manchester University. By 1914, Weizmann isolated strain BY that was more robust in butanol production than Fernbachs bacillus and use d many different sources of starch such as from corn (107) This strain was later renamed as C. ace tobutylicum At the time, C. acetobutylicum gain ed global attention due to its ability to produce acetone, which is used as a solvent for cordite production. During World War I, cordite was used as the main constituent in explosives and gun powder which consists of 58 % nitroglycerine, 37 % guncotton, and 5 % vaseline (198) With high demands for cordite and promising results for the production of acetone by the Weizmann process, England constructed a plant for the production of acetone at the Royal Naval Cordite Factor y at Poole in Dorest and adapted six distilleries in Great Britain for the production of acetone using the Weizmann process (107) A shortage of grain due to war efforts forced Great Britain to move the fermentation process to plants in Canada. In 1917, upon the United States entry into World War I, United States decided to produce acetone in th e Midwest corn belt at Terre Haute, Indiana where substrates are readily available (107) The fermentation production was continued until November 1918 when all plants were closed due to the end of the war. Butanol, the other product of C. acetobutylicum fermentation was stored until after the end of the war. At that time, the automotive industry was rapidly expanding and was in need of a quick drying lacquer. E. I. du Pont de Nemours & Co. developed a nitrocellulose lacquer which required butanol and butyl acetate as solvents. With the increase in demand for butanol instead of acetone, the plan ts at Terre Haute reopened under the newly formed Commercial Solvent

PAGE 55

55 Corporation (CSC) of Maryland in 1920, which operated under the U.S. license for the Weizmann process patent issued in 1919. To meet rapidly growing demands, CSC acquired another plant i n Peoria, IL (68, 107) In the 1930s, a new method using petroleum to produce synthetic solvents posed a threat to the butanol fermentation industry. In efforts to improve the fermentation processes, research was initially dedicated to the isolation of a strain, which could use higher concentrations of starch with limited result s Research efforts were then shifted to the fermentation of carbohydrates such as readily available molasses, which at the time, cost less than starch. CSC strain number 8, later known as C. saccharoace tobutylic um was able to fermen t up to 6.5 % sugars producing up to 2 % total solvents that lower ed the distillation cost by half (68, 107) The start of World War I I once again catapulted the demands for acetone for munitions. Plants were built in a number of countries around the world including Japan, India, Australia, China, USSR, and South Africa. By the end of the war in 1945, about twothirds of the butanol in the United States and one tenth of acetone were produced by fermentation (107) However, a rapidly growing petro-chemical industry in the 1950s in addition to an increase in molasses usage as cattle feed made butanol acetone fermentation no longer cost effective; thus, by 1960 almost all butanol acetone fermentation ceased in the United States a nd Great Britain (107) Butanol F ermentation Unlike hydrogen production, microbial butanol pro duction is more restricted to few members of the c lostridia class, Clostridiaceae family, and more specifically the genus Clostridium ; however, some members of the Lachnospiraceae family such as Butyrivibrio fibrisolvens contain most of the butanol biochemical pathway producing butyric acid. Members of the Clostridium genus are anaerobic G ram -positive, spore -forming, rod -shaped bacteri a Of the c lostridia, C. acetobutylicum C. beijerinckii C. saccharobutylicum and C.

PAGE 56

56 saccharoperbutylacetonicum are primary solvent producers (60, 120) The most studied c lostridia is C. acetobutylicum which was the strain originally i solated by Weizmann in 1914 (107) C. acetobutylicum possesses a 210 kb megaplasmid, pSol1, w hich was originally named for its ability to produce solvents (48) Strains lacking pSol1 a re unable to produce solvents (48) During normal growth, C. acetobutylicum undergoes two define d growth phases: acidogenesis and solventogenesis (78) C. acetobutylicum during exponential growth exhibit s acidogenesis where the major fermentation products are acetate, butyrate, hydrogen, and carbon dioxide. At the onset of stationary pha se triggered by a drop in pH, C. acetobutylicum shifts to solventogenesis where it takes up the acids produced during acidogenesis and produce s solvents such as acetone, butanol, and ethanol (ABE) (78) Depending on the fermentation conditions, wil d type C. acetobutylicum produces from 5.5 to 11.0 g L1 butanol (87, 88, 120, 145, 234) The t ypical molar ratio of acetone : butanol : ethanol in the fermentation broth is about 3:6:1 respectively (166) Mutations up-regulating butanol dehydrogenase and/or downregulating solR (repressor of th e sol operon) and acid production genes have led to concentrations up to 17.8 g L1 butanol (87, 88, 120, 145, 234) Hyper -butanol producing mutant C. beijerinckii BA101 can produce over 20 g L1 butanol and 33 g L1 total solvents in batch fermentations (44, 120, 166) When compared with wild -type parent, C. beijerinckii NCIMB 8052, transcriptional analysis of mutant strain C. beijerinckii BA101 revea led a decrease in sporulation efficiency and PTS sugar transport and an increase in several metabolic genes encoding butanol production (179) The metabolic pathway for butanol production has been well studied (5, 48, 62, 68, 78, 107, 142, 145) (Figure 3 1 ). Under exponential growth conditions and acidogenesis, C. acetobutylicum consumes glucose via glycolysis to produce 2 pyruvate and 2 NADH (215)

PAGE 57

57 Pyruvate is then converted to acetyl CoA and CO2 by pyruvate -ferredoxin oxidoreductase (PFOR) which is coupled to ferredoxin reduction and hydrogen production (215) Acetyl CoA could be converted to acetate for ATP production (phosphotrans acetylase pta and acetate kinase, ack ) (33) or two acetyl CoA can be condensed into one acetoacetyl CoA by thiolase ( thiA and thiB) (217) Acetoacetyl -CoA is reduced by hydroxybutyryl CoA dehydrogenase ( hbd) coupled to NADH oxidation to produce hydroxybutyryl -CoA (32, 229) Hydroxybutyryl CoA is then converted to crotonyl CoA via a dehydration reaction catalyzed by crotonase ( crt ) (32, 213) Butyryl CoA dehydrogenase ( bcd ) and electron transfer flavoprotein (etfBA) complex catalyzes the conversion of crotonyl CoA to butyryl CoA coupled to ferredoxin reduction using two NADH (32, 124) Analogues of Bcd that are capable of catalyzing the same reaction ha ve been identified as crotonyl -CoA reductase (ccrA and ccrB ) in some Streptomyces species. Crotonyl CoA reductase converts crotonyl CoA t o butyryl CoA coupled to NADPH oxidation. A coenzyme -A phosphotrans butyrylase converts butyryl CoA to butyryl -phosphate ( ptb ) and butyrate kinase (buk ) transforms butyryl -phosphate to butyrate and ATP (5, 215) The shift to stationary phase triggers an 1,200-fold u p regulation of the sol operon located on pSol1 megaplasmid (5, 61, 145) The sol operon has two promoters. The first promoter controls genes encoding an alcohol aldehyde dehydrogenase ( aad) and coenzyme-A transferase (ctfA and ctfB). The second promoter transcribes acetoacetate decarboxylase ( adc ) downstream of the first promoter on the complimentary strand. CtfAB transfers the CoA from acetoacety l CoA to either acetate or butyrate producing acetoacetate and acetyl CoA or butyryl -CoA, respectively. Adc decarboxylates acetoacetate to produce acetone and CO2. Aad catalyzes two reactions: the first is the reduction of acetyl -CoA to acetaldehyde and ethanol. The second

PAGE 58

58 reaction reduces butyryl CoA to butyraldehyde and 1 -butanol (67, 144) Each reaction is coupled to the oxidation of NADH. Molecular O rganization of B utanol P roduction P athway C. acetobutylicum has two thiolase homologues; t he first gene, thlA (CAC2873), is located on the chromosome and the second gene, thlB (CA_P0078) is located on the pSol1 megaplasmid. Northern blot analysis reveal ed high levels of thlA transcripts during acidogenesis and decreasing levels to minimal expression about 3 to 7 hrs after induction of solventogenesis (217) There is a 70 consensus sequence upstream of thlA controlling the transcription of a 1.4kb monocistronic message. Genetic organization of thlB suggests th at it forms an operon with two other genes, thlC and a possible regulator thlR (Figure 3 2 ). Transcriptional analysis of thlB showed very low expression relative to thlA during both acidogenesis and solventogenesis. This study also determined that thlA i s the main gene encoding thiolase in all phases and the physiological function of thlB is yet to be identified (217) In C acetobutylicum crt bcd etfB etfA, and hbd genes (CAC2712, CAC2711, CAC2710, CAC2709, and CAC2708 respectively) are arranged in a single polycistronic butyryl -CoA synthesis (BCS) operon (32, 142) (Figure 3 2 ). The BCS operon was expressed in E. coli and an increase in Crt and Hbd activity was detected in the crude extract; however, no Bcd/EtfBA act ivity was detected at that time. The same operon over -expressed from a plasmid in C. acetobutylicum had about a 2 -fold increase in activity for all three enzymes including the Bcd/EtfBA complex which by far has the lowest activity indicating that it could be the rate limiting step of the butanol fermentation pathway (32) The last reaction of the pathway converts butyryl -CoA into butanol. C. acetobutylicum is the fi rst bacterium identified with two bifunctionally active Fe aldehyde alcohol dehydrogenases that are capable of catalyzing this reaction (67) The first of this type, aad

PAGE 59

59 (adhE1, CA_P0162), was identified originally as a part of the sol operon (144) Aad has 74 % similarity and 56 % identit y with E. coli AdhE. The expression of aad and the sol operon coincide s with the start of solventogenesis (5, 61, 145) The second gene product, Ad hE2 (adhE2, CA_P0035), is 77 % similar and 58 % identical to E. coli AdhE The a dhE2 gene is expressed only in alcohologenic cultures and not in solventogenic culture (67) C. acetobutylicum also ha s two adjacent independently transcribed chromosomal ly located Zn butanol dehydrogenases genes (bdhA -CAC2399 an d bdhB CAC2398) and their expression coincide s with solventogenesis (5, 62, 161, 162, 212) The bdhB is induced prior to the induction of the sol operon and was found to have a 2.3 fold higher expression th an aad (5, 161) It is proposed that aad and bdhB are the two major alcohol dehydrogenase genes responsible for butanol production (62) Advances in Metabolic E ngineering of Bacteria for Butanol Production For over 50 years, from the 1910s to the 1960s, C. acetobutylicum was used in industrial ABE fermentation (107) Since then, there has not been much advancement in strain development for increasing butanol yield; instead, most studies are concentrated on butanol extraction and purification (120) Even though simple genetic tools are available for C. acetobutylicum e g plasmid vectors transformation protocols and gene knockouts the anaerobic physiology of this organism makes it difficult to work with for cost effect ive fuel production. Clostridium require s a relatively rich growth medi um with an abundant supply of nitrogen and reducing agents which add to production cost s (12, 120, 153, 166) Solvent producing clostridia utilize less than 25 % of carbon from glucose for butanol production. The rest of the carbon is used for the co -production of acetone, ethanol, and residual acids. The combustional energy from aceto ne, butanol, and ethanol is about 12,500 B TU /lb, 16,000 B TU /lb, and 11,500 B TU /lb respectively. Thus, co production of acetone and ethanol leads to a los s of

PAGE 60

60 carbon to lesser energy containing molecules. Ideally, butanol should be the sole fermentation product of this process For over 20 years, much work has been done towards the construct ion of a Clostridium for homo-butanol production by mutating competing pathways but with only limited success Towards the goal of generating a homo -butanol produc ing organism, it may be easier to recombinantly express the butanol production pathway in other commonly used microbes. Genes in the butanol production pathway have been cloned and expressed to produce active proteins in other microorganisms such as S. cerevisiae and E. coli (12, 100, 185) In these experiments, Steen et al. cloned the BCS operon and aad2 from C. beijerinckii atoB (thiolase) from E. coli and ccrA from Streptomyces collinus into S. cerevisiae resulting in the production of about 2.5 mg L1 (0.034 mM or 0.00025 % ) butanol (185) To date, there are only two published reports on butanol producing E. coli (12, 100) Atsumi et al. was the first to demonstrate the production of bu tanol in E. coli using the clostridial pathway (12) Atsumi et al. clone d the same genes as Steen et al. and functionally expressed them in various E. coli mutants deficient in native fermentation pathway s Atsumi et al. identified three possible rate limiting steps: thiolase, butyryl CoA dehydrogenase, and the aldehyde alcohol dehydrogenase reactions. Using their parent strain, which has a wild type fermentation profile, with the entire butanol pathway genes expressed from plasmids, they compared the productivity of E. coli thiolase, atoB and C. acetobutylicum thlA under different growth conditions. Strains with over -expressed atoB produced about 4 times more butanol (70 mg L1; 0.94 mM butanol) than with thlA (18 mg L1; 0.24 mM butanol) alone under O2limiting conditions Atsumi et al. then tested the effect of butyryl CoA dehydrogenase by replacing C. acetobutylicum bcd -etfBA with Megasphaera elsdenii bcd -etfBA or S. coelicolor ccr An E. coli

PAGE 61

61 mutant lacking native adhE ldhA frdBC fnr pta ) b ea r ing C. acetobutylicum bcd -etfBA produced more butanol (~155 mg L1; 2.09 mM) than the ones with M. elsdenii bcd -etfBA (~18 mg L1; 0.24 mM) or S. coelicolor ccr (~2 mg L1; 0.03 mM) under O2limiting conditions. An E. coli fermentation defective mutant expressing atoB C. acetobutylicum bcd -e t fBA, crt hbd, and aad2 was able to produce 552 mg L1 (7.45 mM) butanol in rich medi um with glycerol as a carbon source and 113 mg L1 (1.52 mM) butanol in M9 minimal medi um with glucose as a carbon source u nder O2limiting condition (12) Inui et al. cloned the BCS operon from C. acetobutylicum along with thlA and compared the difference in the two aldehyde alcohol dehydrogenases aad1 and a dhE2 (100) E. coli strain JM109 (wildtype fermentation) was transformed with compatible plasmids expressing the above genes with either aad1 or a dhE2. In crude extract, they detected an increase in activity for all enzymes tested. Bcd/EtfBA activity still appeared to be the rate limiting process. AdhE2 ha d a 27 -fold higher b utyraldehyde dehydrogenase activity specific for butyryl -CoA as substrate th an Aad1 for butyryl CoA as substrate Both enzymes preferentially reduced acetyl CoA to ethanol rather than butyryl CoA to butanol. Aad1 and AdhE2 ha d about a 14 -fold and a 2 -fold respectively higher specific activity using acetyl CoA as substrate than butyryl CoA as substrate H igh density culture s of JM109 with BCS, thiolase, and a dhE2 genes (OD660 nm = 20; pH 6.5) in an anaerobic chamber with an atmosphere comprising of 95 % nitrogen and 5 % hydrogen, w ere able to produce up to 16 mM (1185 mg L1) butanol and 5 mM butyrate; whereas, aad1 containing JM109 instead of adhE2 only produce d 3.5 mM (259 mg L1) butanol and 1 mM butyrate in 60 hrs at 30oC (100) The fermentation balance was not presented; however, one can assume this strain also produced high concentrations of lactate, acetate,

PAGE 62

62 ethanol, formate, and succinate since strain JM109 still contained all the native fermentati on pathw ays. Based on the pathway presented in Figure 3 1 the reduction of 2 acetyl -CoA to butanol will require 4 5 NAD (P)H depending on the enzyme used for the conversion of crotonyl -CoA to butyryl -CoA Since E. coli can only produce 2 NADH per glucose under anaerobic condition s it lacks the reducing equivalents needed for homobutanol production anaerobically. This is also apparent in the work of Inui et al. where a high density culture coproduced both butanol and butyrate indicating the inability of the bacterium to operate the entire butanol pathway (100) The availability of hydrogen in the gas ph ase may be beneficial for butanol production because hydrogen is a known electron donor for fumarate reductase (119, 221) Since Bcd/EtfBA is a flavoprotein and reduces a C=C bond in a manner that is similar to fumarate reductase hydrogen uptake may also supply the needed additional reducing power to aid the conversion of crotonyl CoA to butyryl CoA. According to Knoshaug et al. higher butanol concentration could inhibit growth (114) Butanol at a concentration of 1.0 % lowers the relative growth of the yeast studied to about 60 % and no growth was observed at 2.0 % butanol (114) Lactobacillus spp. were found to be more tolerant to butanol than yeast. T he two strains tested, L. delbrueckii and L. brevis ha d 60 % of the growth rate compared to the control without butanol at 2.0 % butanol in the medium L. brevis had the highest butanol tolerance of all the strains tested having a 35 % growth rate at 3.0 % butanol compared to butanol -less control E. coli butanol tolerance appears t o be temperature dependent E. coli strain W3110 has a 25 % and 75 % relative growth rate of the control cultures at 37oC and 30oC, respectively in 1.0 % butanol (114) According to Atsumi et al. E. coli can tolerate up to 1.5 % butanol which is within the range of clostridial butanol tolera nce (12)

PAGE 63

63 Engineering Escherichia coli for Butanol Production E. coli is one of the most studied organisms in the world. Nonpathogenic E. coli strains such as K12, C, and B strains are classified as a GRAS (Generally Regarded As Safe) organism and its physiology makes it an ideal model organism to study. E. coli is a G ram -negative, non sporulating, facultative anaerobe and has the ability to utilize a vast array of carbon sources and c an grow in minimal salts medi um (135) E. coli ha s many industrial applications which include the production of insulin, amino acids, pyruvate, lactate, succinate, and ethanol (43, 75, 103, 104, 209, 228, 232) E. coli fermentation products are a mixture of acids and ethanol (Figure 3 3 ) (215) Under anaerobic conditions glucose is consumed and is converted to 2 moles phosphoenolpyruvate (PEP) and then to 2 moles pyruvate during glycolysis. One NADH is produced during the oxidation of glyceraldehyde 3 phosphate (G3P) to 1 3 bisphosphoglycerate by G3P dehydrogenase of the glycolysis pathway (2 per glucose). Pyruvate is converted to acetyl CoA and formate by pyruvate formate lyase ( pflB) or reduced to lactate coupled to NADH oxidation by lactate dehydrogenase. Acetyl CoA is further reduced to acetaldehyde and then to etha nol using 2 moles NADH by alcohol dehydrogenase ( adhE ). Acetyl CoA is also converted to acetate by phosphotransferase ( pta ) and acetate kinase ( ack ) for the production of 1 ATP. Succinate is produce d by the carboxylation of PEP to oxaloacetate. Oxaloace tate is reduced to malate by malate dehydrogenase consuming one NADH. Malate is dehydrated by fumarase to produce fumarate. Fumarate is then reduced by a membrane bound fumarate reductase (frdABCD ) for succinate production. The standard mid point potent ial for reduction of fumarate to succinate is +31 mV. Of all the reactions of anaerobic glycolysis and fermentation, the fumarate reductase is the only enzyme that is membranebound. NADH is not an electron donor

PAGE 64

64 for fumarate reduction in vitro This flavoprotein apparently utilizes electrons from an unknown source and not directly from NADH in vivo also (215) As noted earlier, E. coli generates only 2 moles NADH per mole glucose under anaerobi c condition from the G3P dehydrogenase activity. Kim et al. described a strain of E. coli with a mutation in dihydrolipoamide dehydrogenase ( lpdA ), the E3 component of pyruvate dehydrogenase (PDH), that alters the NADH sensitivity of PDH (111, 112) PDH, like PFL, catalyze s the conversion of pyruvate to acetyl CoA; however, PDH releases CO2 and couples the reaction with reduction of NAD+ to NADH instead of producing formate. The inherent sensitivity of this enzyme to high NADH concentrations under anaerobic conditions inhibit PDH activity. Point mutation E354K in lpdA (lpd101* ) lower s NADH sensitivity of the PDH complex (112) The lower NADH sensitivity of the mutated form of the PDH increase s PDH activity during an aerobic growth leading to an additional 2 NADH s per glucose (112) This critical mutation is req uired to produce a more reduced product such as butanol. Another problem to address in engineering E. coli for butanol production is the activity of Bcd/EtfBA complex. The low activity of Bcd/EtfBA in recombinant E. coli is an inherent characteristic of t his enzyme and not because of recombinant expression in E. coli. T his reaction may also be the rate limiting reaction in c lostridia (32) Prior attempts to increase the conversion of crotonyl CoA to butyryl CoA in E. coli include d expressing Streptomyces CcrA and Bcd/EtfBA from other organism s without significant success (100, 185) Streptomyces CcrA uses NADPH instead of NADH. Lower levels of NADPH under anaerobic conditions make this reaction less favorable. To increase CcrA activity in E. coli, higher NADPH pool will be required. Overexpression of E. coli transhydrogenase, udhA (sthA) and p ntAB, has been found to increase NADPH levels (109, 172, 214)

PAGE 65

65 Bcd/EtfBA activity in E. coli could be increase d by using succinate producing strains. As mentioned before, succinate is produced from the reductive branch of the anaerobic TCA cycle. S uccinate is produced by the reduction of fumarate by fumarate reductase coupled to the oxidation of an unknown electron carrier. E. coli strain KJ104 (103) produces near theoretical yields of succ inate producing up to 1.30 mol succinate per mol glucose. This high succinate production raises the possibility that an unknown electron transport pathway was elevated in this strain to reduce fumarate by fumarate reductase, which is a flavoprotein with u nique electron carriers like the Bcd/EtfBA complex. Perhaps this specific electron carrier could also function with the clostridial Bcd/EtfBA and the succinate production strain described by Jantama, et al. (103) carrying the butanol pathway and appropriate mutations to knock out succinate pr oduction could increase the activity of Bcd/EtfBA and butanol production. This study will evaluate the potential of E. coli as a biocatalyst for butanol production. Since E. coli with an NADH -insensitive PDH can generate 4 NADH per glucose, this strain is an ideal choice for further engineering for butanol production. Towards this objective, r ecombinant C. acetobutylicum enzymes as well as Streptomyces CcrA in the butanol pathway will be expressed in E. coli to identify the enzymes (genes) that are mini mally needed to catalyze the conversion of acetyl -CoA to butanol. Demonstration of the in vitro enzyme -catalyzed butanol production will provide the proof of principle that when produced in E. coli these enzymes can support production of butanol as a fermentation product. Furthermore, in this study, I will also attempt to optimize the carbon flux to butanol and identify the rate limiting steps in th is pathway. An understanding of the recombinant butanol pathway in E. coli will serve as a foundat ion for engineering E. coli for homo -butanol production.

PAGE 66

66 Figure 3 1 C. acetobutylicum fermentative pathway. Solid lines represent fermentative pathway during exponential growth (acidogenesis). Dashed lines represent the metabolic pathway during the onset of stationary phase (solventogenesis). During acidogenesis phase, C. acetobutylicum produces primarily acetate, butyrate, hydrogen, and carbon dioxide. Solventogenesis phase is a shift in cellular metabolism when cells take up acids and hydrogen pr oduced during acidogenesis, followed by further reduction of the metabolite s to produce acetone, butanol, and ethanol (ABE). thl, thiolase; hbd, hydroxybutyryl -CoA dehydrogenase; crt crotonase; bcd butyryl -CoA dehydrogenase; etfBA electron transfer flavoprotein; ctfAB, coenzyme -A transferase; adc acetoacetate decarboxylase; aad, alcohol aldehyde dehydrogenase. [Adapted from Jones, D. T., and D. R. Woods. 1986. Acetone -butanol fermentation revisited. Microbiol Rev 50: 484524 (Pa g e 494, Fig ure 1 )]

PAGE 67

67 Figure 3 2 Molecular organization of genes encoding butanol/solvent pathway in C. acetobutylicum C. acetobutylicum has two thiolases encoded by thlA and thlB. thlA is in a single gene operon whereas thlB is transcribed with two adjacent genes: thlR and thlC The butyryl -CoA synthesis (BCS) operon consists of five genes, crt (crotonase) bcd (butyryl -CoA dehydrogenase) etfB (electron transfer flavoprotein subunit B ), etfA (electron transfer flavoprotein subunit A) and hbd (hydroxybutyryl CoA dehydrogenase), for the conversion of acetoacetyl CoA to butyryl CoA. The BCS operon is transcribed as a single polycistronic mRNA controlled by a promoter upstream of crt The sol operons responsible for majority of solvent productio n have two promoters. The first promoter controls the transcription of aad (aldehyde alcohol dehydrogenase), ctfA (coenzyme A transferase), and ctfB. The second promoter transcribes adc (acetoacetate decarboxylase) on the complimentary strand. C. acetob utylicum has an additional aldehyde alcohol dehydrogenase ( aad2) transcribed in its own operon. In addition to the aldehyde alcohol dehydrogenase, C. acetobutylicum has two butanol dehydrogenases, bdhA and bdhB which are transcribed independently in tandem.

PAGE 68

68 Figure 3 3 E. coli mixed acid fermentation. Under anaerobic conditions, glucose is converted to PEP and then to pyruvate. Pyruvate could be reduced to produce lactate or could be converted to acetyl -CoA and formate. Formate could be broken down to hydrogen and carbon dioxide. Acetyl -CoA could either be reduced to produce ethanol or be converted to acetate for ATP production. Succinate is produced from the carboxylation of PEP followed by further reduction. ldhA lactate dehydrogenase; pflB, p yruvate formate lyase; FHL, formate hydrogen-lyase; adhE alcohol dehydrogenase; pta phosphotransacetylase; ack, acetate kinase; ppc PEP carboxylase; mdh malate dehydrogenase; fum fumarase; frdABCD fumarate reductase.

PAGE 69

69 CHAPTER 4 MATERIALS AND METHODS General Methods Materials Biochemicals were purchased from Sigma -Aldrich (St. Louis, MO) and Fisher Scientific (Pittsburg, PA) Phusion DNA polymerase, DNA restriction endonuclease, T4 DNA ligase, and Klenow were purchased from New E ngland Biolabs Inc (Ipswich, MA). Oligonucletides were synthesized by Invitrogen (Carlsbad, CA). Plasmid extraction kit and DNA gel -extraction kit were purchased from Qiagen Inc (Germantown, MD) or Bio -Rad Laboratories, Inc. (Hercules, CA) Bacterial st rains, B acteriophages, P lasmids, and P rimers Used The bacterial strains, bacteriophages and plasmids used in this study are listed in Table 4 1 All primers used in this study are listed in Table 4 2 Media and Growth Conditions Luria broth was prepared a s described previously (158) Glucose -mineral salts medium contained 10 g glucose, 6.25 g Na2HPO4, 0.75 g KH2PO4, 2.0 g NaCl, 10 mg FeSO4 7H2O, 10 mg Na2MoO4 2H2O, 0.2 g MgSO4 7H2O, and 1.0 g (NH4)2SO4 in 1 L of deionized water. Glucose, MgSO4 7H2O, and (NH4)2SO4 were added after autoclaving basal salts solution. Solid medium was prepared by the addition of 15 g L1 agar into liquid medium. Antibiotics used for selection were added to medium after autoclaving. Typical antibiotics and concentrations used in this study were ampicillin (100 mg L1), kanamycin (50 mg L1), chloramphenicol (15 mg L1), tetracycline (15 mg L1), and spectinomycin (100 mg L1).

PAGE 70

70 Fermentation Batch fermentation s without pH control w ere carried out in a 13 x 100 mm screw -cap tube s filled to the top with appropriate medium. An inoculum was grown aerobically for about 16 hrs at 37oC in a rotator (80 rpm) and was inoculated into the tubes at a concentration of 1 % (v/v). Microaerobic batch fermentation was carried out in 13 x 100 mm screw cap tubes (9 ml capacity); however, the tube contained 4 7 ml of appropriate medium depending on the desired oxygen concentration. The microaerobic culture tubes were incubated in a rotator (80 rpm) at 37oC. pH -controlled fermentation s w ere conducted at 37oC in 500 ml fleaker vessel s containing 250 ml of the corresponding medium along with a custom -made pH -stat. pH was controlled with 0.5 N KOH (96) DNA Extraction and P urification Plasmid DNA was extracted with Qiagen QIAprep Spin Miniprep Kit s DNA extracted from agarose after electrophoresis was purified by either Qiagen QIAquick Gel Extraction Kit s or Bio -Rad Freeze N Squeeze spin column s followed by ethanol precipitation as previously described (14) PCR DNA purification was done with Qiagen QIAquick PCR Purification Kit s Genomic DNA was extracted with a modified protocol as described by Ausubel et al. (14) Two ml of an overnight culture grown at 37oC aerobically was pelleted and resuspended in 567 l of P1 buffer with the addition of RNase from QIAprep Spin Miniprep Kit instead of TE buffer, followed by the addition of 50 l 10 % s odium dodecyl sulfate (SDS ) The cell lysate/SDS solution was mixed by inversion and then incubated at 60oC for 5 minutes to increase cell lysis. 120 l of 5 M NaCl was then added, mixed by inversion, followed by 1 minute incubation at 60o c etyl trimethylammonium bromide (CTAB )/NaCl solution (14) preheated to 60oC was added, mixed thoroughly by inversion, and incubated at 60oC for 5 more minutes. The lysate was extracted with Tris -saturated phenol, pH 8.0, followed by phenol:chloroform:

PAGE 71

71 isoamyl alcohol (2 5:24:1) extraction. DNA was then precipitated with 0.7 volume isopropyl alcohol, pelleted by centrifugation, and washed with 600 l of 70 % ethanol. DNA was pelleted again and the ethanol was carefully decanted. The DNA pellet was allowed to dry briefly at 42oC and then dissolved in 100 l TE buffer. Genomic DNA was incubation at 50oC to completely dissolve the DNA as needed Polymerase Chain Reaction (PCR) Polymerase Chain Reaction (PCR) was performed using Phusion High -Fidelity DNA Polymerase ( NEB ). A 50 l reaction typically contained 1x High Fidelity ( HF ) buffer, 200 M each of the four dNTPs, 0.4 M of each forward and reverse primer, and 0.5 units of Phusion polymerase. Denaturing temperature was set at 98oC (20 sec), annealing temperatures were set at 5oC below the lowest primer Tm (15 sec), and elongation was at 72oC (30 sec per 1 kb). DNA M odification Digestion conditions and ligation were as modified from m anufacturers recommendations. Typically, a 20 l digestion reaction consisted of 0. 5 g DNA, 1x buffer, 1 l BSA (1 mg ml1), and 0.5 l restriction endonuclease. 10 units or 100 units of T4 ligase was typically used per sticky end or blunt end ligation reaction, respectively, at 16oC for at least 12 hrs Transformation Chemical tran sformation was carried out as described previously with minor modification (133) Cells were cultured in a 125 ml flask containing 5 ml Luria Bertani ( LB ) medium and a 1.0 % inoculum of an overnight culture at 37oC for about 1.5 hrs or until the OD420 nm = 0.2 Cells were harvested and resuspended in 0.2 ml of cold 0.1 M CaCl2. About 0.5 g of plasmid DNA was then added to the cell suspension. The c ell and DNA mixture w as incubated on ice for 15 minutes and heat -shocked for 1 minute at 42oC. After hea t -shock, the cell/DNA mixture was immediately transferred to ice for additional 10 minute s Two ml of LB was added to the

PAGE 72

72 reaction mixture and this was incubated for 1 hour at 37oC. Electroporation was conducted as recommended by Bio Rad Laboratories (Mi croPulser electroporation apparatus operating instructions and applications guide). Transduction Gene transfer mediated by bacteriophage P1 mediated transduction was performed as described by Miller (138) Gene Deletions Method used for gene deletion in E. coli was as described by Datsenko et al. (51) Using plasmid pKD4 as template, PCR primers with 50 bases homologous to the gene of interest were designed to amplify FRT:kanamycin resistance cassette (kanR):FRT. The resulting PCR product, gene:FRT:kanR:FRT:gene, was electroporated into strain BW25113 containing plasmid pKD46 which encodes an arabinose inducible Red recombinase. Transformants harboring deletion of the targeted gene were selected for kanamycin resistance located within the deleted gene. PCR was used to confirm the deletion. P1 phage transduction was used to transfer the deleted gene to other strains of interest. The k anamycin cassette was removed by transform ing in a temperature sensitive plasmid, pCP20, harboring yeast FLP recombinase gene leaving an 84 bp insert of a single FRT sequence at the site of deletion Construction of Plasmid pET15b B ased T7 Expression Plasmids Protein over -expression was mediated by plasmid pET15b based T7 expression system. Primers were designed to PCR amplify the gene of interest with 5 extension of CAT ATG on the forward primer and GGATCC on the reverse primer corresponding to the NdeI and BamHI endonuclease recognition sites, respectively. The underlined ATG correspond to an overlapping translation start initiation codon of the gene of interest. XhoI recognition sequence (CTCGAG) was substituted for NdeI or BamHI site if these recognition sequences appeared within the gene

PAGE 73

73 o f interest (see Table 4 2 for complete list of primer sequences). PCR product s and plasmid pET15b (Novogen) were digested with the respective enzymes, ligated, and transformed into E. coli strain TOP10. Transformants were selected as ampicillin resistant colonies. Plasmid was extracted and the presence of insert was confirmed by PCR with gene specific primers. Plasmids encoding rare E. coli codon tRNAs for recombinan t expression of heterologous proteins in E. coli. Proteins were expressed as N terminal His6-thrombin recognition site protein fusions Protein Production U sing pET15b Based T7 E xpression A f ew colonies of freshly transformed Rosetta strain bearing pET1 5b derived plasmid were inoculated into 20 ml of LB amp (250 ml flask) and incubated at 37oC (200 rpm) shaking for about 15 hrs. Fifteen ml of this culture was transferred to 1.0 L LB amp medium in a 2.8 L Fernbach flask. This culture was incubated for 2 hrs at 37oC (250 rpm) or until OD420nm reached ~ 0.60. Arabinose was added to a final concentration of 1.5 % and incubation was continued at room temperature with the same shaking rate for an additional 4 hrs. Cells were harvested by centrifugation and washed twice with 40 ml of cold 50 mM KPO4 buffer pH 7.5 with 0.1 M NaCl (Buffer A). The cells were collected, and stored at 20oC until use His -tagged P rotein P urification Frozen cells were thawed on ice in 10 ml of Buffer A. All purification steps w ere performed at 4oC or on ice. The cells were disrupted by passing through a French pressure cell operating at 20,000 psi. 100 units of DNaseI was added to reduce viscosity and the lysate w as incubated on ice for 10 minutes. The lysate was centrifuged at 30,000 x g for 45 min. The supernatant was filtered using a 0.2 m syringe filter. The filtered crude extract was then loaded on a 1 ml HiTrap Chelating column (GE) (1 ml min1 flow rate) that was pre -washed with Ni+2 (0.1 M NiCl2 in Buffer A) followe d by 20 volumes of Buffer A to remove excess nickel. The

PAGE 74

74 protein -bound column was washed with 5 volumes of Buffer A followed by 10 volumes of Buffer A with 50 mM imidazole. The His tagged protein was eluted with Buffer A containing 150 mM imidazole at a flow rate of 0.5 ml min1 and 1 ml fractions were collected. Fractions with the highest protein concentration determined by Bradford assay (14) were separated by s odium dodecyl sulfate polyacrylamide gel electrophoresis ( SDS -PAGE ) to determine purity. Highest purity fractions were combined and digested with 50 100 units of t hrombin to remove the His -tag while being dialyzed in 4 L Buffer A with 0.5 mM DTT for 16 hrs. The dialyzed protein and t hrombin mixture were separated on HiPrep 26/60 Sephacryl S -200 HR (GE) gel filtration column (pre -equilibrated with Buffer A containi ng 0.5 mM DTT) with a flow rate of 0.5 ml min1 and 3.75 ml fractions were collected. Fractions with the highest purity as determined by SDS -PAGE were combined. Glycerol was added to the purified protein to a final concentration of 20 % flash frozen in liquid nitrogen, and stored at 75oC until use Analytical Methods Protein concentration was determined using Coomassie blue (Bradford reagent) or bicinchoninic acid (BCA ) assay s (14, 34, 182) with bovine serum albumin as standard. SDS PAGE utilized 12.5 % gel s as per L aemmli (118) The protein standards used in SDS -PAGE (Bio -Rad Laboratories, Hercules, CA) were aprotinin (6 5 k Da), lysozyme (14. 4 k Da), tryp sin inhibitor (21 5 k Da), carbonic anhydrase (31 0 k Da), ovalbumin (45. 0 k Da), serum albumin (66 2 k Da), phosphorylase b (97 4 k -galactosidase (116 .3 k Da), and myosin (200 k Da). Protein standards used to calibrate Hi Prep Sephacryl S 200 HR column used for gel filtration (Sigma Chemical Co., St. Louis, MO) were bovine carbonic anhydrase (29. 0 k Da), ovalbumin (45 0 k Da), bovine serum albumin (66 0 k Da), and yeast alcohol dehydrogenase (150 k Da). Non -heme iron was determined as described by Harvey et al. (89) and sulfur was determined using the method descr ibed by Cline (45) Organic acids and sugars were analyzed by high -

PAGE 75

75 performance liquid chromatography (HPLC, Hewlett Packard 1090 series II chromatograph equipped with refractive index and UV detectors) with a Bio Rad Aminex HPX 87H ion exclusion column. Hydrogen gas was measured by gas chromatograph y (Gow Mac series 580, GOW MAC Instrument Co., Bethlehem, PA) using a thermal conductivity detector and a stainless steel column (1.8 m 3.2 mm) packed with molecular sieve 5 using N2 as the carrier gas. Optical density of the cultures grown in 13 x 100 mm tubes were measured with a Bausch & Lomb Spectronic 20 at 420 nm. Analytical spectrophotometric measurements were performed in a Beckman DU 640 spectrophotometer. Methods for Hydrogen Production Construction of Tandem T7 Expression of ndhE and ndhF S ubunits T. vaginalis ndhE and ndhF DNA were received from Dr. Hrdy at Charles University, Czech Republic. T vaginalis ndhE and ndhF were each cloned into pET15b as previously described producing pET15bndhE and pET15bndhF plasmids (Figure 4 1 ) (56) The entire T7 expression operon from pET15b ndhF including T7 promoter and T7 terminator was PCR amplified using primers pET15b T7 F ( HindIII) and pET15b T7 R (HindIII) and the purified PCR product was digested and cloned into the HindIII site on pET15bndhE (pPM D38) producing pET15b ndhE -ndhF (pPMD40). The resulting plasmid was digested with XhoI to confirm the orientation of the insert. The plasmid pPMD40 has the two genes ndhE and ndhF encoding the two subunits of NDH e xpressed in tandem by independent T7 promoters. Construction of Tandem trc P romoter C ontrolled E xpression of ndhE and ndhF T. vaginalis ndhE and ndhF were cloned into plasmid pTrc99a as described above in the construction of plasmid pPMD40 with independent T7 promoters. Genes encoding ndhE and ndhF were independently cloned into the NcoI and BamHI sites in pTrc99a using PCR primers ndhE F ( NcoI ) / ndhE R (BamHI ) and ndhF F ( NcoI ) / ndhF R (BamHI) respectively.

PAGE 76

76 Using pTrc99a ndhF as template, ndhF including the trc promoter was PCR a mplified with primers pTrc99a F ( XbaI trc ) / ndhF R (HindIII) and the resulting product was cloned into XbaI and HindIII site of pTrc99a ndhE producing pTrc99a ndhEF Plasmid pTrc99a ndhEF harbors t w o independently expressed trc promoters and a rho -in dependent terminator ( rrnB ) downstream of the last gene, ndhF NADH -Dehydrogenase ( N DH ) Enzymatic A ctivity NDH activity was determined spectrophotometrically using NADH as the electron donor and various artificial electron acceptors. Standard reaction mixture consisted of K -phosphate buffer (50 mM, pH 7.5), NADH (1 mM), and benzyl viologen (1 mM). Reaction mixture in a 13100 mm tube was sealed with a serum stopper, and the gas phase was replaced by evacuation and refill with N2. Enough sodium dithionite was added to the reaction mixture to titrate out the residual O2. Reaction was initiated by the addition of enzyme, and BV reduction was monitored continuously at 600 nm at room temperature. Although the small amount of added dithionite will reduce both the Fe -S cluster and flavin in the protein, the presence of excess BV in the reaction mixture is expected to reoxidize these cofactors and not interfere with the assay. Under these conditions, the small amount of added dithionite did not affect the kinet ics of BV reduction. With ferricyanide as electron acceptor, assays were under aerobic condition. Concentrations of BV, methyl viologen, and K -ferricyanide were 1.00 mM in the experiments leading to determination of Km of NADH. Molar extinction coefficie nts used for BV and MV are 7,800 and 6,300, respectively, at 600 nm with 1.00 cm path length. Ferricyanide dependent NDH activity was determined in the same buffer as the BV assay (410 nm; extinction coefficient of 1,020 M1 cm1). Ferredoxin -dependent NDH activity was determined in the same buffer with C. acetobutylicum ferredoxin by following the oxidation of reduced substrate oxidized min1.

PAGE 77

77 Clostridium F erredoxin P u rification C. acetobutylicum strain 824 (NRRL B 23491) obtained from USDA -ARS (Peoria, IL) was cultured in Reinforced Clostridial Medium (Oxoid, Cambridge, UK ) without the agar in 12 L carboys for 16 hrs at 37oC. Ferredoxin was isolated from the cells as described previously for C. pasteurianum ferredoxin (167, 178) Protein concentration was determined from the molar extinction coefficient of 30,600 cm1 at 390 nm, a value reported for C. pasteurianum ferredoxin (167) (Electron Pa ramagnetic Resonance ) EPR M easurements EPR experiments were performed by Dr. Angerhofer Department of Chemistry, University of Florida. Cw EPR spectra of the NDH complex at cryogenic temperatures were determined using a commercial EPR spectrometer (Bruker Elexsys E580) equipped with an Oxford Instruments ESR900 helium -flow cryostat and the standard TE102 mode rectangular cavity (Bruker ER4102ST). EPR samples were placed in a Wilmad 34 (IDOD) -mm quartz tubes (CFQ), prefrozen in liquid nitrogen, before insertion into the precooled cryostat. Selection of M ethyl V iologen (MV) R esistant E. coli MV resistant E. coli was selected by serial transfers with increasing concentrations of MV. as inoculated with 1.0 % of an overnight culture of E. coli strain PMD45 grown in LB at 37oC. The culture with MV was incubated for 16 hrs at 37oC with shaking (250 rpm). This culture was sequentially t a 1.0 % inoculum level and each transfer was incubated for 16 hrs. After which, it was used as an inoculum for 10 ml LB with 1.0 mM MV. As needed, a culture at an OD420nm of 0.6 was diluted and plated on LB agar plates supplemented with 1.0 mM MV and i ncubated aerobically overnight at 37oC. Colonies that formed were selected, streaked on the same solid medium supplemented with glucose and were

PAGE 78

78 incubated at 37oC in an anaerobic jar After 48 hrs colonies that were resistant to 1 mM MV under anaerobic growth conditions were replicated onto the same solid medium and incubated aerobically for 8 hrs Over 95 % of the colonies that were resistant to MV anaerobically were killed by the switch to an oxygenic atmosphere. Colonies that survived were selected and anaerobic/aerobic cycle was repeated two more times until a more stable E. coli strain was recovered that was resistant to 1 mM MV and could survive the transition from anaerobic to aerobic conditions. Detection of Hydrogen Production Overnight cult ures were used as a 1.0 % inoculum for 1 ml LB with 0.3 % glucose supplemented with the appropriate antibiotics and electron acceptors in a 12 x 75 mm heavy wall tube sealed with a rubber stopper. Electron acceptors tested we re 1.0 mM of each MV, BV, and DCPIP The tubes were degassed and filled with N2 and incubated at 37oC. Hydrogen syringe into a gas chromatograph. Electrochemical P otential The electrochemical potential of a redox couple was calculated using the Nernst equation (Equation 4 1): (4 1 ) Where E = concentration dependent redox potential (V); Eo = midpoint standard redox potential (V) (Table 4 3 ); R = 8.314 J K1 mol1 (ideal gas constant); T = temperature (K); F = 96,500 Coulombs mol1 (Faraday constant); n = number of e-. The Nernst equation has been simplified by calculating the constants listed at standard temperature (298oK) and converting natural log (ln ) to log10 as follows (Equation 4 2): E = Eo + R T ln ( [Oxidized] ) n F [Reduced]

PAGE 79

79 (4 2 ) Free energy was calculated using a derivation of Gibbs free energy (Equation 4 3): = nF (4 3 ) Where is the change in free energy (J mol1) and is the change in redox potential ( Eproduct Ereactant; V ). Joules can be converted to calories usi ng the conversion factor 1 cal = 4.18 J. Cloning of [Fe] -Hydrogenase Isolated from Termite Gut [Fe] hydrogenase genes from the symbionts present in the digestive tract of Reticulitermes flavipes were received from Dr. Mike Scharf, Department of Entomology and Nematology, University of Florida. The ORFs were fully sequenced and the putative gene was identified after BLAST alignment as [Fe] -hydrogenases. Protein alignment s were performed with ClustalG ver. 1.5. The gene encoding the [Fe] -hydrogenase most similar to the published enzyme from P. grassii (99) was subcloned into pET15b and pTrc99a using PCR primers gutHyd F (NdeI)/ gutHyd R (BamHI) and gutHyd F ( N coI )/ gutHyd R (BamHI ), respectively. gutHyd including the trc promoter was subcloned into NdeI and PflMI sites of pTrc99a ndhEF using PCR primers gutHyd trc F (NdeI)/ gutHyd R (PflMI) resulting in plasmid pTrc99a ndhEF -gutHyd. Methods for Butanol Pr oduction Construction of Plasmid pET15b Derivatives for the Expression of Enzymes in the Butanol Pathway All butanol genes were amplified from C. acetobutylicum American T ype C ulture Collection ( ATCC ) 824D genomic DNA obtained from ATCC using the respective PCR primers listed in Table 4 2. The gene ccrA was PCR amplified from Streptomyces avermitilis ATCC E = Eo + 0.0592 V log ( [Oxidized] ) n [Reduced]

PAGE 80

80 31267D 5 genomic DNA obtained from ATCC. Amplified PCR products were cloned into plasmid pET15b for expression and purification of His -tagged fusion proteins E. coli strain the appropriate plasmid pET15b derivative s w ere induced with arabinose and protein was purified as described in the section on NDH. Enzym e A ssays for Butanol P athway The enzymes that constitute the butanol pathway were produced in recombinant E. coli and purified. Specific activit ies of these enzymes was determined spectrophotometrically using NAD(P)H as the electron donor and the appropriate CoA derived intermediates or aldehydes as acceptors All assays were performed in 1 ml of 50 mM K -PO4 buffer pH 7.5 and 0.1 mM NAD(P)H at room temperature. Enzym e kinetics were determined by measuring NAD(P)H oxidation (molar extinction coefficient of 6,220 M1 cm1 at 3 4 0 nm). Thiolase (0.5 1.0 g of ThlA or ThlB) activity was determined by using 0.1 mM acetyl CoA as substrate in a coupled reaction with NADH oxidation by Hbd (6g) (217) Hbd (0.1 0. 2 g) activity was determined using 0.2 mM acetoacetyl -CoA as substrate (32, 47, 229) Crt (2 5 ng ) activity was determined using 0.1 mM hydroxybutyryl CoA as substrate in a coupled reaction with NADPH oxidation by CcrA (2 g) (32) Bcd -EtfBA (10 g Bcd -complex) and CcrA (0.22.0 g) activity were determined by measuring oxidation of NADH or NADPH, respectively, using 0.1 mM crotonyl CoA as substrate. Aldehyde alcohol dehydrogenase (10 g of Aad or AdhE2) activity was determined by measuring the oxidation of NADH using 0.1 mM butyryl CoA and 2.5 mM butyraldehyde, respectively (67, 144) In V itro Butanol P roduction Based on the specific activates of the recombinant enzymes 1 unit ( mol min1) of each purified enzyme in the butanol pathway from acetyl -CoA up to butyryl CoA (ThlA, Hbd, Crt, and CcrA) w as added to 0.5 m l assay buffer con taining a final concentration of 50 mM K -PO4

PAGE 81

81 pH 7.6, 5 mM acetyl CoA, 10 mM NADH, and 10 mM NADPH. The reaction mixture was incubated at 37oC for 30 minutes after which a 100 l sample was removed for analysis One unit of AdhE2 and 10 mM NADH were then added and incubated for an additional 30 minutes at 37oC. H2SO4 was added to final concentration of 0.1 M to stop the reaction and to hydrolyze the CoA releasing free acids. The final mixture and the starting and intermediate sample were analyzed by HPLC for butanol and other intermediates Enzyme Assay from Crude Extract E. coli strain JM107 bearing the plasmid(s) pCBEHTCB and/or pAA were grown and the enzymes were induced with IPTG as described above for T7-based expression of the same g enes. Induced cells were disrupted in the same manner as described for T7 -based protein production. The cell lysate was clarified by ultracentrifugation at 100,000 x g for 1 hr to minimize membrane bound NADH dehydrogenase activity. Enzyme assays were pe rformed as described above Plasmid C onstruction for Butanol P roduction Construction of pButanol : Genes from C. acetobutylicum butanol production pathway were cloned into plasmid pTrc99a (Figure 4 2 ). The BCS operon was PCR ampl ified using crt F (NcoI) and hbd R (BamHI) primers producing PCR product that has a NcoI site exten sion on the 5 and a BamHI site attached to the 3 end The gene encoding AdhE2 was amplified with adhE2 F (BamHI) and adhE2 R (XhoI) primers producing a PCR product that has a BamHI site exten sion on the 5 and XhoI site attached to the 3 end The adhE2 PCR product also includes the native 18 bp region upstream of the gene that contains the Shine Dalgarno (SD) sequence. Th e gene encoding ThlA was amplified with thlA SD F (XhoI) and thlA R (HindIII) producing a PCR product that has a XhoI site extended on the 5 and a HindIII site attached to the 3 end Since thlA does not have a good E. coli SD sequence immediately

PAGE 82

82 up stream of the gene, a 16 bp region was added through primer t hlA SD F (XhoI) that contains an optimized E. coli SD sequence in addition to the XhoI site. The resulting PCR products were digested with the respective enzymes and ligated all together into the NcoI and HindIII site of pTrc99a resulting in the plasmid pButanol. Plasmid pButanol contains all the genes necessary for production of butanol expressed as a single synthetic polycistronic operon controlled by IPTG inducible trc promoter. Construct ion of pButyrate : To construct a plasmid for the production of butyrate, adhE2 was removed from pButanol and replaced with a FRT : KanR: FRT cassette (Figure 4 3 ). Primers pKD4 F (BamHI) and pKD4 R (XhoI) were used to PCR amplify the FRT : KanR: FRT cassette with the addition of BamHI and XhoI sites on the 5 and 3 ends, respectively. The resulting PCR product was cloned into the BamHI and XhoI restriction sites of pButanol replacing the adhE2 gene. The resulting plasmid, pB utyrate, has the BCS operon expressed from an IPTG inducible trc promoter. The thlA gene is still expected to be expressed by the plasmid from the kanR cassette. Construction of pTrc99a derived plasmids : The vector pTrc99a was used to express various individual steps of butanol pathway (Figure 4 4 ) (6). The first gene, adhE2, was amplified from pButanol with PCR primers adhE2 F (NcoI) and adhE2 R (XmaI) to produce a PCR product with NcoI site on the 5 and XmaI site s on the 3 respectively The adhE2 PCR product was cloned into NcoI and XmaI site within the pTrc99a multiple cloning site resulting in pTrc99a adhE2. E. coli thiolase gene atoB was amplified from E. coli W3110 genomic DNA with primers atoB F (KpnI) and atoB R (HindIII) to produce a product that includes 11 bp upstream of atoB containing its native SD sequence and KpnI and HindIII site s at the 5 and 3 ends respectively. This PCR product was cloned into KpnI and HindIII site in pTrc99a resulting

PAGE 83

83 in pTrc99a atoB The plasmid pTrc99a atoB was then used as template for PCR using pTrc99a F (XmaI) and atoB R (HindIII) to amplify atoB with the trc promoter and XmaI and HindIII site s at the 5 and 3 ends respectively. The atoB with its own trc promoter was then cloned into the XmaI and HindIII site s of pTrc99a to produce pAA where both genes were expressed independently by tandem trc promoters. The gene ccrA2 was PCR amp lified from S. avermitilis genomic DNA using primers ccrA2 F (NcoI) and ccrA2 R (XbaI) to produce a PCR product with NcoI and XbaI site s at the 5 and 3 ends respectively. E. coli soluble transhydrogenase gene udhA was amplified from W3110 genomic DNA with primers udhA F (XbaI) and udhA R (HindIII) to produce a PCR product with XbaI and HindIII site s at the 5 and 3 ends respectively. The primer udhA F (XbaI) also replace d udhA upstream region with a more optimal SD sequence for improved t ranslation. PCR products of ccrA2 and udhA were digested with the respective endonucleases and were all ligated into NcoI and HindIII site of pTrc99a resulting in pTrc99a ccrA2 udhA plasmid where ccrA2 and udhA were expressed as a single polycistronic synthetic operon. Consolidation of pTrc99a derived plasmids into a single low copy number plasmid: Large plasmids with high copy number replication system s tend to result in reduce d plasmid stability and/or ret ention. Therefore the trc operons constructed previously we cloned into a low copy number plasmid vector (pACYC184) to improve stability (Figure 4 5 ). The BCS operon including trc promoter from pButanol was amplified using pTrc99a F ( EagI ) and hbd R (BamHI ) primers and cloned into EagI and BamHI endonuclease restriction sites on pACYC184, producing pCBEH. Using pTrc99a ccrA2 udhA as template, PCR primers pTrc99a F ( BamHI ) and udhA R ( XbaI ) w ere used to amplify the Ptrc-ccrA2 -udhA operon and the PCR product was cloned into BamHI and XbaI endonuclease sites on pCBEH to make

PAGE 84

84 pCBEHCU. Using pTrc99a -AA as template, PCR primers pTrc99a F ( Bsu36I ) and atoB R (EagI ) w ere used to amplify the lacIq-Ptrc-adhE2-Ptrc-udhA operon and the P CR product was cloned into Bsu36I and EagI endonuclease sites on pCBEHCU to make pAACBEHCU. The plasmid pAACBEHCU contains all the genes required to produce butanol from acetyl -CoA on a low -copy plasmid with p15a origin of replication. Genes with lower s pecific activities ( adhE2, atoB bcd/etfBA, and ccrA2 ) were expressed independently by individual trc promoter s Another plasmid, pCBEHTCB, was constructed in a similar manner. A three gene synthetic operon was constructed with thlA, ccrA and bdhB T he three genes, thlA ccrA and bdhB were PCR amplified with primer sets thlA F (NcoI)/ thlA R (XhoI), ccrA F (XhoI)/ ccrA R (SexAI), and bdhB F (SexAI)/ bdhB R (SbfI), respectively. The resulting PCR products were digested with the ir respective enzyme s and ligated all together into the NcoI and SbfI site of plasmid pTrc99a resul ting in plasmid pTCB in a similar manner as Figure 4 2 The whole operon including the trc promoter was PCR amplified from plasmid pTCB using primers pTrc99a F ( BamHI )/ bdhB R (ClaI) and cloned into the BamHI and ClaI restriction sites of pCBEH resulting in pCBEHTCB. E. coli S train C onstruction for Butanol/ B utyrate P roduction Strain KJ104 ( E. coli ATCC 8739 ldhA focA-pflB) adhE ackA mgsA poxB tdcDE citF ), a microbial biocatalyst developed for succinate production (103) was used as the starting strain for engineering a butanol producing strain To eliminate succinate production, a deletion in frdBC was introduced into strain KJ104 to disrupt fumarate reductase activity. The resulting strain, PMD71, cannot grow anaerobically due to the inability to oxidize NADH generated during glycolysis Integration of plasmid pAACBEHCU into E. coli chromosome : Even though the butanol genes were on a low -copy plasmid the large size (15,550 bp) and repeat trc promoter

PAGE 85

85 sequences could lower plasmid stability. To stabilize the genes, the entire plasmid was integrated into E. coli chromosome via single recombination. The plasmid pAACBEHCU was digested with BstBI which removed p15a origin of replication and the chloramphenicol resistance gene (Cm ). The linearized DNA was then treated with Klenow fragment to fill in the 5 overhang left over from BstBI digestion to produce blunt ends. The s pectinomycin resistance gene (s pcR) from pAW016 was PCR amplified using primers spc F and spc R. T he resulting PCR product was ligated to the linearized pAACBEHCU to produce a circular DNA that has no origin of replication. The resulting DNA was electroporated into BW25113/pKD46 expressing red recombinase. Genomic DNA was extracted from colonies that were resistant to spectinomycin (100 g ml1), and PCR was performed using genomic DNA as template and appropriate primers to confirm the integration of adhE2atoB crt hbd, and ccrA 2 udhA PCR using primers adhE atoB F and adhE atoB R, crt hbd F and crt hbd R, and ccrA2 udhA F and ccrA2 udhA R produced fragments of 3,487 bp, 4,042 bp, and 2,195 bp respectively confirming the presence of the butanol genes in the chromosome. The colony with all three correct size PCR products was noted to have chromosomal insertion of pAACBEHCU (but+) and the genes were transduced to strain PMD50 and PMD71 resulting in PMD70 and PMD72, respectively. The site for chromosomal integration is yet to be determined; however, possible recombination sites were atoB udhA and lacIq since these E. coli genes were present in the circular DNA used for integration Chromosomal insertion of BCS operon at pflB : PCR using primers focA F ( HindIII) and pflA R ( XmaI ) w ere used to amplify pflB including 389 bp and 643 bp upstream and downstream DNA, respectively with the addition of HindIII and XmaI sites to the primers (Figure 4 6 ). The 3.4kb PCR product was cloned into HindIII and XmaI site s of pUC19. The

PAGE 86

86 resulting plasmid, pUC19 focA-pflA, was used as template for outward PCR using primers focA out (Blunt) and pflA out ( XhoI ) producing a 3704 bp PCR produc t with a blunt 3 end near the end of focA and XhoI site at the 3 end near the start of pflA. Primers labeled with Blunt had a 5 phosphorylation modification during synthesis. At the s ame time, pButyrate was used as template for PCR using primers crt F (Blunt) and pKD4 R ( XhoI ) to produce a 6214 bp PCR product of the promoterless BCS operon upstream of a kanamycin cassette. The two PCR products, BCS kan and pUC19-focA-pflA outwar d PCR, were then digested with XhoI and ligated together to produce the final plasmid pUC19 pflB -BCS kanR. Plasmid pUC19pflB -BCS kanR was then doubl y digested with NruI and Acc65I producing 7171 bp and 2729 bp DNA fragments. The larger fragment was ge l purified with Qiagen Gel Extraction Kit and the purified DNA was electroporated into BW25113/pKD46 as described in Datsenko et al. (51) The digested DNA fragment had 312 bp and 643 bp region of homology to the upstream and downstream regions of pflB respectively. Colonies that were resistant to kanamycin were selected and grown anaerobically for 24 hrs at 37oC. HPLC was used to analyze fermentation products. Cultures with lactate as a major fermentation product with little or no formate, acetate and ethanol were noted to have a BCS operon replacing pflB. The ATG start codon of the first gene, crt replaced the ATG of pflB; thus the BCS operon should now be transcriptionally regulated by all of pflBs seven promoters (173) Genomic DNA was extracted and PCR was performed with primers crt -hbd F and crt -hbd R (4042 bp) to confirm chromosomal pflB BCS kanR to strain PMD 72 resulting in strain PMD 74. Production of butyrate : PCR was performed using pKD4 as template and spc -adhE2 F (pKD4 F) and spc -adhE2 R (pKD4 R) primers to amplify F RT: KanR: F RT cassette with 50 bp

PAGE 87

87 up and downstream homologous to 5 of spcR gene and 3 of adhE2. E. coli strain PMD52/pKD46 was electroporated with the derived linear PCR product and transformants were selected for kanamycin resistance and spectinomycin sensitivity. The resulting strain, PMD 75, had a (adhE2-spcR) mutation Integration of an additional copy of C. acetobutylicum bcd -et fBA replacing E. coli adhE : An additional copy of bcd/etfBA was used to replace E. coli adhE in a similar manner as the BCS operon integration replacing pflB. E. coli adhE was PCR amplified from W3110 genomic DNA using adhE F ( SbfI ) and adhE R ( XmaI ) primers including 279 bp and 239 bp upstream and downstream of adhE respectively This DNA was cloned into SbfI and XmaI site s of pUC19. At the same time, the F RT: KanR: F RT cassette was also amplified from plasmid pKD4 w ith pKD4 F ( BamHI ) and pKD4 R ( XhoI ). This PCR product was digested with only Bam HI leaving the 3 end undigested (blunt) and was cloned into BamHI and ScaI (blunt) restriction site s on pTrc99a bcd etfBA introducing a kanamycin resistance cassette dir ectly downstream of the bcd -etfBA operon. The bcd etfBA kanR operon was amplified using bcd etfBA kan F (homology) and bcd -etfBA kan R (homology) primers. Using pUC19adhE as template, pUC19 adhE F OUT and pUC19adhE R OUT primers, which bind directly upstream and downstream, respectively, of adhE were used to amplify outward away from adhE These primers also include 20 bases 5 extensions of sequences homologous to bcd -etfBA kan F (homology) and bcd -etfBA kan R (homology) for homologues recombination cloning by CloneEZTM Kit (GenScript Corp) for seamless cloning without restriction enzyme and ligation. Cloning was performed as described by GenScript Corp. The resulting plasmid, pUC19 adhE bcd -etfBAkanR, had bcd -etfBA kanR flanked by 279 bp and 239 bp E. coli adhE up and downstream regions, respectively. The plasmid pUC19 adhE bcd -etfBA kanR was then

PAGE 88

88 digested with SbfI and XmaI and the purified product was used for double recombination cross over in BW25113/pKD46 expressing red recombinase. Colonies that were resistant to kanamycin were grown anaerobically in liquid media and were tested by HPLC for ethanol adhE bcd -etfBA kanR into strai n PMD 75 resulting in strain PMD 76.

PAGE 89

89 Table 4 1 Bacterial strains, bacteriophages, and plasmids Strains Genotype Notes W3110 Wild type ATCC TOP10 F mcr A ( mrr hsd RMS mcr BC ) 80 la c Z M15 lac X74 rec A1 ara 139 ( ara leu ) 7697 gal U gal K rps L (Str R ) end A1 nup G Invitrogen JM107 end A1 gln V44 thi 1 rel A1 gyr A96 lac proAB ) [F' tra D36 proAB + lacI q lac Z M15 ] hsd R17 ( R K m K + Lab collection JM109 end A1 gln V44 thi 1 rel A1 gyr A96 rec A1 mcrB + lac pro AB ) e14 [F' tra D36 proAB + lac I q lac Z M15 ] hsd R17 (r K m K + ) NEB F omp T gal dcm lon hsd S B (r B m B lac I la cUV5 T7 gene 1 ind1 sam 7 nin 5]) Lab collection JM109 lacI la cUV5 T7 gene 1 ind1 sam 7 nin 5]) Lab collection Rosetta ( BL21 ( / pRARE Novagen PMD40 ldhA PMD42 ldhA ( focA pflB ) Anaerobic ( ) PMD43 ldhA adhE Anaerobic ( ) PMD44 ldhA adhE frdBC PMD43 frdBC PMD45 ldhA adhE frdBC mgsA PMD44 mgsA PMD46 ldhA focA pflB ) lpd101* PMD42 lpd101* PMD47 ldhA focA pflB ) lpd101* mgsA PMD46 mgsA PMD48 ldhA focA pflB ) lpd101* mgsA tcdE PMD47 tcdE PMD50 JM107 ldhA This study PMD51 ldhA focA pflB ) Anaerobic ( ) PMD52 JM107 ldhA focA pflB ) lpd101* PMD53 ldhA focA pflB ) lpd101* tcdE Anaerobic ( ) PMD54 ldhA focA pflB ) lpd101* adhE Anaerobic ( ) KJ104 E. coli ATCC 8739 ldhA ( focA pflB ) adhE ackA mgsA poxB tdcDE citF (103) Succinate strain PMD70 JM107 ldhA but + [ spc R P trc adhE2 P trc atoB P trc crt bcd etfBA hbd P trc ccrA udhA ] PMD50 but+ PMD71 KJ104 frdBC

PAGE 90

90 Table 4 1. Continued Strains Genotype Notes PMD72 frdBC but + [ spc R P trc adhE2 P trc atoB P trc crt bcd etfBA hbd P trc ccrA udhA ] PMD71 but + PMD73 JM107 ldhA but + pflB crt bcd etfB etfA hbd PMD70 pflB BCS PMD74 KJ104 frdBC but + pflB crt bcd etfB etfA hbd PMD7 2 pflB BCS PMD75 frdBC but + [ adhE2 spc R ] pflB crt bcd etfB etfA hbd Butyrate strain PMD76 frdBC but + adhE2 spc R pflB crt bcd etfB etfA hbd adhE bcd etfB-etfA PMD75 adhE bcd etfB-etfA Bacteriophages Genotype Notes P1 clr 100 dam rev6 Plasmid Genotype Note s a pUC19 bla + pET15b P T7 Novagen pTrc99a P trc Lab collection pPMD38 pET15b ndhE (P T7 ndhE ) from T. vaginalis pPMD39 pET15b ndhF (P T7 ndhF ) from T. vaginalis pPMD40 pET15b ndhEF ( P T7 ndhE P T7 ndhF ) Figure 4 1 pTrc99a ndhEF P trc ndhE P trc ndhF This study pET15b gutHyd P T7 gutHyd Symbiont [Fe] hydrogenase pTrc99a gutHyd P trc gutHyd This study pTrc99a ndhEF gutHyd P trc ndhE P trc ndhF P trc gutHyd This study pET15b adhE2 P T7 adhE2 C. acetobutylicum pET15b aad P T7 aad C. acetobutylicum pET15b thlA P T7 thlA C. acetobutylicum pET15b thlB P T7 thlB C. acetobutylicum pET15b hbd P T7 hbd C. acetobutylicum pET15b crt P T7 crt C. acetobutylicum pET15b bcd etfBA P T7 bcd etfBA C. acetobutylicum pET15b bcd P T7 bcd C. acetobutylicum pET15b etfB P T7 etfB C. acetobutylicum

PAGE 91

91 Table 4 1. Continued Plasmid Genotype Note s a pET15b etfA P T7 etfA C. acetobutylicum pET15b etfBA P T7 etfBA C. acetobutylicum pET15b ccrA1 P T7 ccrA1 S. avermitilis pET15b ccrA2 P T7 ccrA2 S. avermitilis pET15b bdh A P T7 bdh A C. acetobutylicum pET15b bdhB P T7 bdhB C. acetobutylicum pButanol P trc crt bcd etfB etfA hbd adhE2 thlA Figure 4 2 pButyrate P trc crt bcd etfB etfA hbd FRT : Kan R :FRT thlA Figure 4 3 pTrc99a adhE2 P trc adhE2 Figure 4 4 pTrc99a atoB P trc atoB Figure 4 4 pTrc99a ccrA udhA P trc ccrA udhA Figure 4 4 p AA P trc adhE2 P trc atoB Figure 4 4 pCBEH P trc crt bcd etfB etfA hbd Figure 4 5 pCBEHCU P trc crt bcd etfB etfA hbd P trc ccrA udhA Figure 4 5 pCBEHTCB P trc crt bcd etfB etfA hbd P trc thlA ccrA bdhB pAACBEHCU P trc adhE2 P trc atoB P trc crt bcd etfB etfA hbd P trc ccrA udhA Figure 4 5 pUC19 focA pflA focA pflB pflA Figure 4 6 pUC19 pflB BCS kan R focA crt bcd etfB etfA hbd pflA Figure 4 6 pUC19 adhE adhE + pUC19 adhE bcd etfBA kan R adhE bcd etfBA kan R aThe name of the organism in the Notes column indicates the source of the cloned DNA.

PAGE 92

92 Table 4 2 List of PCR primers used in this study. Primer Name Vector/Note Primer Sequence ndhE F (XhoI) pET15b GGAGC CTCGAG ATG AACAAGAAGTCTGTTCT ndhE R (BamHI) pET15b CGGC GGATCC TTATGGGAGTGGTCTTGGTG ndhF F (XhoI) pET15b GCCG CTCGAG ATG CAGACAAAATTCCTTGA ndhF R (BamHI) pET15b CGGCGATATC GGATCC TTACTCAGCGACGCAAGCC T pET15b T7 F (HindIII) pET15b ndhF CGGC AAGCTT CCACGATGCGTCCGGCGTAG pET15b T7 R (HindIII) pET15b ndhF GCCG AAGCTT TTGGTTATGCCGGTACTGCC ndhE F (NcoI) pTrc99a GCGA CCATGG AGA AGGAG ATATACC ATG AACAAG AAGTCTGTTCT ndhE R (BamHI) pTrc99a CGGC GGATCC TTATGGGAGTGGTCTTGGTG ndhF F (NcoI) pTrc99a GCGA CCATGG AGA AGGAG ATATACC ATG CAGACA AAATTCCTTGA ndhF R (BamHI) pTrc99a CGGCGATATC GGATCC TTACTCAGCGACGCAAGCC T pTrc99a F (XbaI trc ) pTrc99a ndhF CGGCG TCTAGA CGACTGCACGGTGCACCAATG ndhF R (HindIII) pTrc99a ndhF CGCCG AAGCTT TTACTCAGCGACGCAAGCCT gutHyd F (NdeI) pET15b GCAATAA CAT ATG AAAATTGATTCTTCTTCGTT gutHyd F (NcoI) pTrc99a GCAATAA CC ATG G AAATTGATTCTTCTTCGTTTT gutHyd R (BamHI) pET15b, pTrc99a GCAATAA GGATCC TTACTTGGTCTTTCGATTCG gutHyd trc F (Ndel) pTrc99a ndhEF GCAATAA CAT ATG CGACTGCACGGTGCACCAAT gutHyd R (PflMI) pTrc99a ndhEF GCAATAA CCATTCGATGG TTACTTGGTCTTTCGATT CG adhE2 F (XhoI) pET15B GCAA CTCGAG ATG AAAGTTACAAATCAAAA adhE2 R (BamHI) pET15B GCAA GGATCC TTAAAATGATTTTATATAGA a dhE2 F (NdeI) pET15B GCAA CAT ATG AAAGTCACAACAGTAAA a dhE2 R (XhoI) pET15B GCAA CTCGAG GAAGGTTTAAGGTTGTTTTT thlA F (XhoI) pET15B GCAA CTCGAG ATG AAAGAAGTTGTAATAGC thlA R (BamHI) pET15B GCAA GGATCC CTAGCACTTTTCTAGCAATA

PAGE 93

93 Table 4 2. Continued Primer Name Vector/Note Primer Sequence thlB F (XhoI) pET15B GCAA CTCGAG ATG AGAGATGTAGTAATAGT thlB R (BamHI) pET15B GCAA GGATCC TTAGTCTCTTTCAACTACGA hbd F (XhoI) pET15B GCAA CTCGAG ATG AAAAAGGTATGTGTTAT hbd R (BamHI) pET15B; pCBEH GCAA GGATCC TTATTTTGAATAATCGTAGA crt F (XhoI) pET15B GCAA CTCGAG ATG GAACTAAACAATGTCAT crt R (BamHI) pET15B GCAA GGATCC CTATCTATTTTTGAAGCCTT Bcd e t f BA F (XhoI) pET15B GCAA CTCGAG ATG GATTTTAATTTAACAAG Bcd e t f BA R (BamHI) pET15B GCAA GGATCC TTAATTATTAGCAGCTTTAA Bcd R (BamHI) pET15B GCAA GGATCC TTATCTAAAAATTTTTCCTG Etf B F (XhoI) pET15B GCAA CTCGAG ATG AATATAGTTGTTTGTTT EtfB R (BamHI) pET15B GCAA GGATCC TTAAATATAGTGTTCTTCTT EtfA F (XhoI) pET15B GCAA CTCGAG ATG AATAAAGCAGATTACAA ccrA1 F (NdeI) pET15B GCAA CAT ATG AAGGAAATCCTGGACGC ccrA1 R (BamHI) pET15B GCAA GGATCC TCAGATGTTCCGGAAGCGGT ccrA2 F (NdeI) pET15B GCAA CAT ATG AAGGAAATCCTGGACGC ccrA2 R (BamHI) pET15B GCAA GGATCC TCAGATGTTCCGGAAGCGGT bdhA F (XhoI) pET15B GCAA CTCGAG ATG CTAAGTTTTGATTATTC bdhA R (BamHI) pET15B GCAA GGATCC TTAATAAGATTTTTTAAATA bdhB F (XhoI) pET15B GCAA CTCGAG GTG GTTGATTTCGAATATTC bdhB R (BamHI) pET15B GCAA GGATCC TTACACAGATTTTTTGAATA crt F (NcoI) pButanol GATTAG CC ATG G AACTAAACAATGTCAT hbd R (BamHI) pButanol CGAAT GGATCC TTATTTTGAATAATCGTAGA adhE2 F (BamHI) pButanol TGCATT GGATCC ATAAA GGAG TGTATATAA ATG adhE2 R (XhoI) pButanol GGAAGT CTCGAG TTAAAATGATTTTATATAGA thlA SD F (XhoI) pButanol GGAAGT CTCGAG T AGGAGGAG TAAAAC ATG AG thlA R (HindIII) pButanol ATTGGT AAGCTT TTAGTCTCTTTCAACTACGA pKD4 F (BamHI) pButyrate GCAATA GGATCC GTGTAGGCTGGAGCTGCTTC pKD4 R (XhoI) pButyrate; pUC19 pflB BCS Kan GCAATA CTCGAG CATATGAATATCCTCCTTAG

PAGE 94

94 Table 4 2. Continued Primer Name Vector/Note Primer Sequence focA F (HindIII) pUC19 GCAATA AAGCTT GGTATGTCTGGCAGTATGGATGA GTTATT pflA R (XmaI) pUC19 GCAATAA CCCGGG CAGCGTGCGGTGGTTGGAAA focA out (Blunt) pUC19 pflB BCS Kan GTAACACCTACCTTCTTAAGTGGATTT pflA out (XhoI) pUC19 pflB BCS Kan GCAATA CTCGAG TTAGATTTGACTGAAATCGTACA GTA crt F (Blunt) pUC19 pflB BCS Kan ATG GAACTAAACAATGTCATCCTT crt hbd F confirmation of gene insertion GCAACGCAAGATTTGGTCAA crt hbd R confirmation of gene insertion GGTGCTTCTGCTACTTCTACA adhE2 atoB F confirmation of gene insertion TGAGCCATCAATAGAACTTT adhE2 atoB R confirmation of gene insertion TGCCAGCCCCAGCGTTTTAT ccrA2 udhA F confirmation of gene insertion CAAGGACGAGACGGAGATGTT ccrA2 udhA R confirmation of gene insertion TGTGGCTGTGCGGTCTGATA adhE2 F (NcoI) pTrc99a adhE2 GCAAATG CC ATG G AAGTTACAAATCAAAAAGAA adhE2 R (XmaI) pTrc99a adhE2 GCAATA CCCGGG TTAAAATGATTTTATATAGA atoB F (KpnI) pTrc99a atoB GCAAA GGTACC TAAGAG GAGGA ATATAAA ATG AA AAATTGT atoB R (HindIII) pTrc99a atoB ; pTrc99a adhE2 atoB GCAAA AAGCTT TTAATTCAACCGTTCAATCA pTrc99a F (XmaI) pTrc99a adhE2 atoB GCAATA CCCGGG CGACTGCACGGTGCACCAATG ccrA2 F (NcoI) pTrc99a ccrA udhA GCAAT CC ATG G AGGAAATCCTGGACGCGATT ccrA2 R (XbaI) pTrc99a ccrA udhA GCAAT TCTAGA TCAGATGTTCCGGAAGCGGT udhA F (XbaI) pTrc99a ccrA udhA GCAAT TCTAGA AATAATTTTGTTTAACTTTAAGA AG GAG ATATACC ATG CCACATTCCTACGATTA udhA R (HindIII) pTrc99a ccrA udhA GCAAT AAGCTT TTAAAACAGGCGGTTTAAAC pTrc99a F (EagI) pCBEH GAATAG CGGCCG CGACTGCACGGTGCACCAAT hbd R (BamHI) pET15b; pCBEH GCAA GGATCC TTATTTTGAATAATCGTAGA pTrc99a F (BamHI) pCBEHCU ; pCBEHTCB GCAAT GGATCC CGACTGCACGGTGCACCAAT udhA R (XbaI) pCBEHCU GCAAC TCTAGA TTAAAACAGGCGGTTTAAACCGT

PAGE 95

95 Table 4 2. Continued Primer Name Vector/Note Primer Sequence thlA F (NcoI) pTCB GCAA CC ATG G AAGAAGTTGTAATAGCTAGT thlA R (XhoI) pTCB GCAA CTCGAG CTAGCACTTTTCTAGCAATA ccrA F (XhoI) pTCB GCAA CTCGAG A GAGGA GGCAAACC ATG AAGGAAA TCCTGGACGC ccrA R (SexAI) pTCB GCAA ACCTGGT TCAGATGTTCCGGAAGCGGT bdhB F (SexAI) pTCB GCAAA ACCAGGT TATTAAG GAGGA AGAAATAT AT G GTTGATTTCGAATATTCAATACC bdhB R (SbfI) pTCB GCAATG CCTGCAGG TTACACAGATTTTTTGAATA bdhB R (ClaI) pCBEHTCB GCAATC ATCGAT TTACACAGATTTTTTGAATA spc F spectinomycin cassette CTTTTCTACGGGGTCTGACGCT spc R spectinomycin cassette GCAAGGAACAATTTCTTTCTATTTTC adhE F (SbfI) pUC19 GCAATA CCTGCAGG TGGCGAAAAGCGATGCTGAA A adhE R (XmaI) pUC19 GCAATA CCCGGG AGCGTCAGGCAGTGTTGTATCC pUC19 adhE F OUT pUC19 adhE CTTGTTAAATTAAAATCCATAATGCTCTCCTGATAA TGTT pUC19 adhE R OUT pUC19 adhE AAGGAGGATATTCATATGCTTCAGTAGCGCTGTCT GGCAA bcd etfBA kan R (homology) pTrc99a bcd etfBA ATG GATTTTAATTTAACAAG bcd etfBA kan F (homology) pTrc99a bcd etfBA AGCATATGAATATCCTCCTT spc a dhE2 F (pKD4 F) pKD4 ATGACCAATTTGATTAACGGAAAAATACCAAATCA AGCGATTCAAACATTAGTGTAGGCTGGAGCTGCTT C spc a dhE2 R (pKD4 R) pKD4 TTAAAATGATTTTATATAGATATCCTTAAGTTCACT TATAAGTGGATACCTCATATGAATATCCTCCTTAGT Primers were listed with the respective plasmid vector the PCR product was cloned into unless otherwise noted. The underline d sequences represent the endonuclease recognition site indicated by the primer name. Bold sequence represents the ATG translation start site. Italicized sequences represent the Shine Dalgarno sequence.

PAGE 96

96 Table 4 3 Standard r edox potential of electron donor / electron acceptor couple Redox Couple E o (V) Reference MV ox / MV red 0.440 (128) Flavodoxin ox / Flavodoxin red ( A. fermentans ) 0.430 (83, 121, 124, 224) CO 2 / Formate 0.420 (128) H + / H 2 0.420 (128) Ferredoxin ox / Ferredoxin red ( C. pasteurianum ) 0.398 (196) N1a ox / N1a red ( T. thermophilus NDH) 0.370 (175) BV ox / BV red 0.360 (128) Ferredoxin ox / Ferredoxin red ( T. vaginalis ) 0.347 (205, 206) NADP + / NADPH 0.324 (1 28) NAD + / NADH 0.320 (128) Cr otonyl CoA / Butyryl CoA 0.010 (128) Methylene Blue ox / Methylene Blue red +0.011 (128) DCPIP ox / DCPIP red +0.217 (128) Fe(CN) 6 3 / Fe(CN) 6 4 +0.360 (128) O 2 / H 2 O +0.816 (1 28)

PAGE 97

97 Figure 4 1 T. vaginalis NDH T7 expression plasmid.

PAGE 98

98 Figure 4 2 Construction of pButanol. A) PCR products used to clone C. acetobutylicum BCS operon B) pButanol. pButanol contains all the genes necessary for production of butanol from acetyl CoA expressed as a single synthetic polycistronic operon controlled by an IPTG inducible trc promoter.

PAGE 99

99 Figure 4 3 Construction of pButyrate. PCR was us ed to amplify the F RT : KanR: F RT cassette from pKD4 with the addition of BamHI and XhoI endonuclease site on the 5 and 3 respectively. The resulting PCR product was cloned into BamHI and XhoI restriction site s of pButanol replacing the adhE2 gene. The r esulting plasmid, pButyrate, has the genes necessary to produce up to butyryl -CoA from acetyl -CoA controlled by an IPTG inducible trc promoter.

PAGE 100

100 Figure 4 4 Construction of pTrc99a derived plasmids. C. acetobutylicum adhE2, E. coli atoB S. avermitilis ccrA2 and E. coli udhA were cloned into plasmid pTrc99a and expressed from an IPTG inducible trc promoter. Clostridial adhE was cloned into NcoI and XmaI site s of pTrc99a producing pTrc99a adhE2. E. coli atoB was cloned into the KpnI and Hin dIII sites to pTrc99a resulting in pTrc99a atoB Using pTrc99a atoB as template, PCR was used to amplify atoB including the entire trc promoter with XmaI and HindIII on the 5 and 3 respectively. This PCR product was then cloned into XmaI and HindIII s ite of pTrc99a adhE2 producing pAA. The plasmid pAA contains adhE and atoB which are both independently expressed by tandem trc promoters. S. avermitilis ccrA2 and E. coli udhA were PCR amplified with addition of NcoI and XbaI, and XbaI and HindIII rest riction sites respectively. The PCR products were digested with the respective endonucleases and cloned into NcoI and HindIII sites of pTrc99a resulting in pTrc99a ccrA2 udhA which expressed both gene s as a single synthetic operon controlled by trc promoter.

PAGE 101

101 Figure 4 5 Consolidation of butanol pathway genes into a single low -copy vector pACYC184. The BCS operon including trc promoter from pButanol was cloned into EagI and BamHI endonuclease restriction sites on pACYC184 producing pCBEH. Usi ng pTrc99a ccrA2 udhA as template, the Ptrc-ccrA2 -udhA operon was PCR amplified with the addition of BamHI and XbaI restriction sites and was cloned into the respective endonuclease sites on pCBEH to make pCBEHCU. Using pTrc99a AA as template, the lacIqPtrc -adhE2Ptrc -udhA PCR product with Bsu36I and EagI sites was cloned into the respective endonuclease sites on pCBEHCU to make the final resulting plasmid pAACBEHCU.

PAGE 102

102 Figure 4 6 Chromosomal insertion of C. acetobutylicum BCS operon replacing E. coli pflB. E. coli pflB including 389 bp and 643 bp upstream and downstream respectively was PCR amplified with the addition of HindIII and XmaI restriction sites and was cloned into the respective sites within pUC19. The resulting plasmid, pUC19 foc A -pflA, was used as template for outward PCR amplifying everything except pflB with an addition of XhoI site near the 5 of pflA. PCR was used to amplify the BCS operon and a kanamycin gene cassette from pButyrate with the addition of XhoI site at the 3 end. The two PCR products were ligated together resulting in pUC19pflB BCS kanR. The plasmid, pUC19 pflB BCS kanR, was then digested with NruI and Acc65I and the larger DNA fragment (7171 bp) with 312 bp and 643 bp region of homology to the upstream and downstream regions of pflB respectively was used to electroplorate into BW25113/pKD46 bearing red recombinase. Kanamycin was used to select for double recombination replacing pflB with the entire BCS operon which is now transcriptionally regulat ed by pflB seven promoters () upstream of crt

PAGE 103

103 CHAPTER 5 RESULTS AND DISSCUSS ION Biochemical Characterization of Recombinant NADH -Ferredoxin Oxidoreductase (NFOR ; NDH) from T richomonas vaginalis1 Expression and Purification of NDH Converting all the energy in glucose to H2 as a potential fuel using biological systems requires that the energy stored in NADH that is produced during oxidation of glucose carbon to CO2 be transferred to an appropriate electron carrier s such as ferredoxin that can support hydrogenase activity. T here are two known NADH -dependent ferredoxin reductases an NFOR from the hydrogenosomes and a crotonyl CoA -dependent clostridial reaction T he hydrogenosomal NFOR was chosen as the primary enzyme in an attempt to engineer E. coli for higher H2 yield. In contrast to the hydrogenosomal NFOR, t he clostridial enzyme requires the production of cr o tonyl CoA in the cell and the end products of glucose fermentation besides H2 and CO2 are butyrate and acetate. This reaction although it could increase the H2 yield per glucose to 2.7, which is higher than the theoretical maximum of E. coli has no potential to elevate the H2 yield/glucose to 10 due to loss of glucose carbon as butyrate and acetate. The hydrogenosomal NFOR has the demonstr ated ability of transferring the reductant in NADH to ferredoxin (94) NFOR is the key first step of t he NADH dependent hydrogen production pathway in the hydrogenosomes of T. vaginalis NDH from T. vaginalis is the only member of the NFOR class of proteins that is capable of oxidizing NADH coupled to the reduction of low potential electron carriers such as ferredoxin. The NDH from Trichomonas has not been produced in E. coli. As the first step in engineering E. coli for high yield H2 production, the conditions needed for 1 A portion of the Biochemical Characterization of NFOR (NDH) from T. vaginalis was published by Springer Science + Business Media and Copyright Clearance Centers Rightlink. See Appendix A for publication permissions.

PAGE 104

104 production of Trichomonas hydrogenosomal NDH in E. coli in active form were establi shed by this study A plasmid that encodes the two subunits of the enzyme, pPMD40, was introduced were induced with either IPTG or L arabinose for production of NDH from tandem T7 promoters synthesis; however, high recombinant protein production rate led to low specific activity of 2.4 U (mg protein)1 (Table 5 1). This value was less than 1 % of the activity of the native NDH isolated from T. vaginalis hydrogenosome. In order to produce the protein with specific activity close to that of the native protein, arabinose was used as an inducer for production of T7 polymerase from th e lac lac promoter; however, a metabolic product of arabinose appears to induce the lac promoter at a lower level (147) The low level of induction led to an increase in specific activity to 582 U (mg protein)1 (Table 5 1 ), a value that is similar to native enzyme values possibly due to an increase in folding efficiencies and/or complete cofactor insertion (94) The protein migrated through the gel filtration column as a heterodimer with a molecular mass of 69,100 (Figure 5 1 ) and SDS -PAGE (Figure 5 2 ) revealed that the two subunits correspon ding to NdhE (22 kDa) and NdhF (47 kDa). Enzymatic Activities / Kinetics of NDH The specific activity of the recombinant enzyme was highest with ferricyanide as the electron acceptor (Table 5 2 ) consistent with the behavior observed for the native enzyme described by Hrdy et al. (94) The specific activity of the enzyme with benzyl viologen as electron a cceptor was comparable to that of the value with ferricyanide. The recombinant protein also reduced methyl viologen (about 65 % of the ferricyanide specific activity ). The activity of the recombinant protein with methyl viologen as the electron acceptor was

PAGE 105

105 significantly higher than that of the enzyme purified directly from the hydrogenosome. In addition, the enzyme also reduced clostridial ferredoxin. These results show that the recombinant NDH reduces low -potential electron acceptors such as methyl viologen (Eo 0.44 V) readily and heterologous ferredoxin. NDH had an optimal pH of about 7.5 8.0 for activity (Figure 5 3). Apparent Km for NADH for the recombinant enzyme was dependent on the electron acceptor and varied between 0.10 mM with BV and 0.31 mM with ferricyanide (Table 5 3 ). These values were significantly higher than the 0.021 mM (NADH) reported for the native enzyme with f erricyanide as the electron acceptor (94) The affinity of the recombinant protein to ferricyanide was significantly higher than that of the native protein purified from the hydrogenosome ( Km of 0.06 vs 0.29 mM) (94) The Km for BV was about threefold higher than that of ferricyanide and the electron acceptor with the highest Km was methyl viologen. The reaction rate was also highest with ferricyanide as the electron acceptor although the Vmax with the ot her two acceptors was similar. These results show that the T. vaginalis hydrogenosome NDH produced in E. coli is capable of reducing electron acceptors with standard redox potentials that are significantly lower than that of NADH such as methyl viologen. Iron / Sulfur Determination The holoenzyme had a spectrum typical of Fe -S proteins with absorbance peaks at 326, 420, 463, and 551 nm (Figure 5 4 ). Upon reduction with dithionite, the peaks at 420 and 463 nm disappeared, and the absorbance at 551 nm was lower than the protein as purified. Oxidation of the reduced protein by air restored the original spectrum. A spectrum similar to that of the holoenzyme was also obtained with the small subunit NdhE alone that was purified separately (Figure 5 4 ). These spectra resemble the spectra of the corresponding flavoprotein subcomplex of respiratory NADH dehydrogenase complex I and the 25 kDa subunit of the same complex

PAGE 106

106 from Paracoccus denitrificans (225, 226) and also a [2Fe 2S] clostridial hydrogenase N terminal domain (13) The active NDH had 2.15 nonheme iron and 1.95 acidlabile sulfur atoms per heterodimer. The NdhE protein expressed and purified separately also had Fe and acid labile sulfur at the same level. These results suggest that the holoenzyme contains a [2Fe 2S] cluster that is located in the small subunit. The absence of Fe/S in the large subunit of NDH is unique since the NdhF homologs from respiratory chain complex I contain a [4Fe 4S] cluster (154, 225) and the cysteines implicated in liganding the tetranuclear [ Fe -S ] cluster in these proteins are conser ved in the Trichomonas protein. The presence of only [2Fe 2S] cluster in the recombinant holoenzyme indicates that the NdhF component lacks the anticipated tetranuclear N3 cluster. In agreement with this, the NdhF protein expressed and purified separatel y also did not have any detectable Fe and labile S. This lack of the tetranuclear [Fe S] cluster in the large subunit could account for the about 15-fold higher Km for NADH in the recombinant enzyme compared to the native enzyme. However, it is not known whether the native NDH contains the tetranuclear [Fe -S] cluster. EPR Determination of Iron / Sulfur Clusters In order to confirm that the binuclear Fe S cluster was the only Fe -S cluster in the purified NDH, EPR spectra of the protein were obtained. The p urified protein did not show an EPR spectrum but reduction with dithionite generated a spectrum that was rhombic in symmetry with gxyz values corresponding to 1.917, 1.951, and 2.009 (Figure 5 5 ). Although NADH was a substrate for the enzyme, NADH failed t o reduce it to an EPR active form. An EPR signal corresponding to a tetranuclear [ Fe -S ] cluster N3 (gxyz=1.87, 1.94, and 2.04) found in homologous 54 kDa proteins of the respiratory complex I (225) was not detected in this Trichomonas NDH purified from E. coli. The NdhE subunit by itself also produced an EPR spectrum that was similar to the holoenzyme upon reduction by dithionite (gxyz = 1.92, 1.953,

PAGE 107

107 and 2.008; Figure 5 6 ). These EPR spectra support the conclusion that the heterodime ric protein contains only the binuclear [ Fe S ] cluster corresponding to N1a in the small subunit of NDH from respiratory complex. It is unlikely that an additional [ Fe S ] cluster is present in the holoenzyme that is not reduced by dithionite to a paramagnetic state for detection by EPR since the visible spectrum of the holoenzyme in the 400500 nm range was completely bleached by dithionite, indicating complete reduction of the [Fe -S ] clusters in the protein (Figure 5 4 ). In addition, the Fe content of the purified protein was only 2 per heterodimer. Potential Use of NDH for H2 Production The hydrogenosomal NADH dehydrogenase is the only known enzyme with a predicted physiological role of coupling NADH oxidation to H2 evolution that has been purified and b iochemically characterized (94) As a first step in our attempt to engineer E. coli for production of H2 at a higher yield, we have developed methods for optimum expression of the protein in an active form in E. coli The purified protein reduced ferredoxin, and it is likely that the NDH reduces ferredoxin in vivo also as an intermediate in H2 evolution p athway. In metabolic engineering of E. coli for H2 production, the other components of the hydrogenosome pathway, ferredoxin, and hydrogenase need to be cloned and expressed in E. coli. In the interim, the ability of the NDH to reduce viologen dyes leads to the possibility of using these intermediate electron carriers to couple the recombinant NDH with the native hydrogenase 3 isoenzyme of E. coli for H2 evolution. E. coli whole cells as well as isolated membranes are known for their ability to utilize BV or MV as an intermediate electron carrier in coupling dithionite to HYD 3 for H2 evolution (17, 81, 117, 174) and this reaction could replace the need for ferredoxin and hydrogenase from the hydrogenosome. The [NADH]/[NAD+] ratio of anaerobic E. coli is also significantly higher than that of an aerobically growing E. coli (52) and this could lead to a reduction in the in vivo midpoint redox potential of the NADH/NAD+ couple (less than the Eo of

PAGE 108

108 0.32 V) to facilitate reduction of viologen dyes by NDH in vivo However, this requires complete removal of O2 from the fermenting E. coli since the reduced viologen dyes react with O2 to generate superoxide radicals that are detrimental to the cell. An alternate possibility is to engineer the bacterium to be less sensitive to superoxide. The tetranuclear N3 cluster that plays a critical role in electron transport to ubiquinone (35, 154, 175) in all homologs of the respiratory complex I is absent in the recombinant T. vaginalis NDH produced i n E. coli This is similar to the observed lack of the tetranuclear N3 cluster in the recombinant Paracoccus denitrificans NDH produced in E. coli (225) In contrast to the recombinant T. vaginalis NDH protein of this study, the recombinant P. denitrificans NDH protein also lacked FMN and NADH -dependent enzyme activity. Reconstitution of the recombinant P. denitrificans protein with FMN alone (without the N3 cluster but with N1a cluster) only produced about 25 % of the NADH dependent ferricyanide reduction activity of a complex that was reconstituted with FMN, iron, and sulfur. This raises the possibility that a specific chaperone may be needed for insertion of the N3 cluster in heterologous NDH produced in E. coli The absence of the N3 cluster in the recombinant T. vaginalis NDH is not due to high level of expression of the protein in E. coli as shown by the presence of N3 cluster in recombinant NuoF subunit of E. coli (204) However, it should be noted that the T. vaginalis protein produced in E. coli although lacking the N3 cluster, did reduce several electron acceptors at rates that are comparable to the nat ive enzyme isolated from the hydrogenosome (Table 5 2 ). The reported midpoint redox potential of FMN ( 340 mV) in the respiratory complex I (154) may not suggest efficient electron flow from FMNH2 to the N1a cluster of the recombinant T. vaginalis NDH. However, the higher [NADH]/[NAD+] ratio of the anaerobic cell coupled with an increase in the ratio of [FMNH2]/[FMN] may lower the redox potential

PAGE 109

109 sufficiently to facilitate transfer of electrons to the [2Fe 2S] cluster at a midpoint potential of about 0.37 V. With t he anticipated physiological role in NADH oxidation to H2 production in a microbial biocatalyst such as recombinant E. coli the tetranuclear cluster N3, if present in the flavoprotein of the NDH, would drain electrons from NADH to a more oxidized form ( 0 .25 V) that is not energetically favorable to H2 production. NADH -Dependent Hydrogen Production Reduced Methyl V iologen Coupled to E. coli Hydrogenase -3 (HYD3 ) Isoenzyme The ability of T. vaginalis NDH to reduce low potential electron carriers such as ferredoxin and viologen dyes could play an important role in NADH -dependent hydrogen production. Reduced viologen dyes are known for their ability to serve as intermediate electron carriers coupling dithionite to HYD 3 for H2 evolution (17, 81, 117, 174) ; thus, in theory, NDH could couple NADH oxidation to H2 production in E. coli with MV as an intermediate electron carrier. The use of viologen dyes s uch as MV or BV could be problematic in growing cultures due to the reactivity of the dyes to oxygen generating superoxide radicals. To remedy this, E. coli strain PMD45 w as serially transferred in medium with increasing MV concentrations under aerobic gr owth condition selecting for MV resistance. MV resistance under aerobic conditions often does not translate to MV resistance under anaerobic conditions probably due to varying level s of expression of superoxide dismutase and catalase under those conditions (53) Strains that were resistant to 1 mM MV were transformed with pTrc99a ndhEF and incubated anaerobically in the presences of 1 mM MV. Strains bearing plasmids encoding NDH were screened for increased ability to reduce MV identified by color change of growth media. Strains bearing T. vaginalis NDH reduced more MV than vector plasmid alone; however, there was no significant difference in H2 evolution (Figure 5 7 ). Strain s with NDH also grew to slightly higher OD probably due to the use of MV as an electron sink. Electron transfer from MV to

PAGE 110

110 HYD3 may be the limiting step in these culture s or the concentration of reduced MV may not be sufficient to drive the reaction to H2. The use of BV led to BV reduction that was higher than the upper limit of spectrophotometer since BV is a preferred substrate for NDH; however, this higher amount of reduced BV also failed to couple to H2 production. In fact, BV led to a lower H2 evolu tion with NDH than without indicating an electron sink in BV for formate oxidation. Since HYD3 is a membrane associated, multi -subunit complex, the accessibility of reduced viologen dyes to the HYD3 active site maybe a limiting factor in this coupled H2 ev olution reaction. A more accessible soluble [Fe] -hydrogenase may be required for NADH -dependent hydrogen production. Reduced Methyl V iologen Coupled to [Fe] -Hydrogenase It is known that the maturation of [Fe] -hydrogenase requires at least three accessory proteins HydE, HydF, and HydG (37, 113, 164, 171) The genes enco ding these proteins are conserved among [Fe] -hydrogenase bearing organisms. The expression of [Fe] -hydrogenase in recombinant bacteria that lack the genes encoding these accessory proteins such as E. coli yields inactive [Fe] -hydrogenase polypeptide. Eve n with over -expression of HydEFG in E. coli the specific activity of [Fe] -hydrogenase was extremely low compared to hydrogenases from the native organism. In vitro hydrogen production from NADH using purified C. acetobutylicum [Fe] hydrogenase, NDH, and MV, BV, or C. acetobutylicum ferredoxin yielded also extremely low hydrogen. The replacement of NDH and NADH with dithionite supported detectable levels of H2 indicating that the hydrogenase was not irreversibly inactivated during the assay. Further examination of the two enzymes in this coupled reaction revealed that clostridial hydrogenase as well as many others had an optimal pH around 6.0 for H2 evolution (1, 2, 58, 73, 93) and an optimal pH of 8 10 for H2 oxidation/uptake (1, 2, 73, 93) ; whereas, T. vaginalis NDH optimal

PAGE 111

111 pH was about 7.5 8.0 for NADH oxidation (Figur e 5 3 ). The pH incompatibilities of the two systems may contribute to the very low H2 evolution. One possible substitution for clostridial [Fe] hydrogenase could be a [Fe] -hydrogenase and ferredoxin from T. vaginalis that would reconstitute the native N ADH H2 pathway in E. coli An alternative set of components could be the proteins from another hydrogenosomal protozoan Pseudotrichonympha grassii from digestive hindgut of the termite Coptotermes formosanus (9 9) According to Inoue et al. a non -hydrogen producing strain of E. coli expressing only the [Fe] hydrogenase structural gene, hydA from P. grassii (without the accessory maturation proteins) evolved hydrogen indicating that this hydrogenase can be a ctivated by E. coli proteins. Purified recombinant P. grassii [Fe] hydrogenase from E. coli was about 30 times more active than recombinant clostridial [Fe] -hydrogenase with HydEFG (99, 113) Furthermore, protozoan hydrogenase has an optimal pH of 8.0 that is compatible with T. vaginalis NDH. Reticulitermes flavipes is a native species of the S tate of Florida and is in the same family of subterranean termites, Rhinotermitidae such as C. formosanus Of the entire cDNA library of this termite gut symbiont, five genes in the expressed sequence tags (EST) were annotated as possible [Fe] -hydrogenas e by Dr. Scharf and his colleagues who kindly provided these DNA for this study. One [Fe] -hydrogenase in particular had an Evalue of 4 x 10174 with 67 % identity and 81 % overall similarity to [Fe] -hydrogenase to P. grassii (Figure 5 8 ). This hydrogenas e sequence also had high similarity to T. vaginalis HydA (Evalue = 1 x 10127) and to a lesser extent to C. acetobutylicum (Evalue = 3 x 1088). The high homology to P. grassii hydrogenase as well as others makes this hydrogenase a good candidate to furth er examine its potential to couple NADH oxidation to hydrogen evolution.

PAGE 112

112 The ORF encoding the unknown symbiont [Fe] -hydrogenase without hydrogenosomal N terminal signal peptide (first 28 amino acids), referred to here as gutHyd, was cloned into plasmid pET 15b as well as plasmid pTrc99a for expression in T7 and nonT7 ( trc ) E. coli expression systems, respectively. The truncated gene gutHyd was designed in accordance to truncated P. grassii [Fe] -hydrogenase (09A82) described by Inoue et al. (99) Non -hydrogengutHyd and pTrc99a gutHyd, respectively, failed to evolve H2. To rule out that the failure of these recombinant E. coli strains to produce hydrogen was due to inactive enzyme and not from the inability of the cell to supply reductant, gutHyd, under control of trc promoter, was subcloned from pTrc99a gutHyd into pTrc99a -ndhEF resulting in plasmid pTrc99a ndhEF gutHyd. For expression, pTrc99a ndhEF gutHyd was transformed into PMD45. Strain PMD45 could not grow anaerobically due to the inability to reoxidize NADH. Plasmid with ndhEF and gutHyd did not restore anaerobic growth; however, this plasmid did increase slightly hyd rogen production over strains carrying plasmid vector (Figure 5 9 ). The fermentation profile of the cultures indicated that the difference in H2 evolution between the NDH/GutHyd and vector was probably due to the formate hydrogen lyase (Figure 5 10). Th ermodynamic Barrier PMD45 could not grow anaerobically because of its inability to oxidize NADH during fermentation. The expression of NDH and GutHyd did not alleviate the imbalance in redox state. Ideally, if the activities of NDH and GutHyd using MV as an intermediate electron carrier, created an alternate electron pathway, NADH produced during glycolysis would be oxidized to H2 enabling growth to proceed. Its inability to do so maybe because of the thermodynamics of H2 ( 0.42 V) production from NADH ( 0.32 V). The free energy for this reaction could be calculated using Equation 4 3 Using n equals 2 (number of electrons transferred from NADH to

PAGE 113

113 2H+ to make H2), F (Faradays constant) equals 96,500 C mol1 and the standard redox potential Eo of 0 42 V and 0.32 V for H2 and NADH, respectively the free energy for this reaction could be calculated as follows (Equation 5 1): = (2) (96,500) (0.42 V ( 0.32 V)) (5 1 ) + 19300 J mol1 = + 19.3 kJ mol1 = + 4.62 kcal mol1 The production of H2 from NADH is an endothermic reaction requiring + 4.62 kcal mol1 of energy for the reaction to proceed. Internal ratios of [NAD+]/[NADH] could effect its redox potential. The internal [NAD+]/[NADH] ratio differs depen ding on availability of oxygen or external electron acceptors. Internal [NAD+]/[NADH] ratios had been previously determined to range between 10.6 aerobically and between 1.0 to 4.5 anaerobically where strains with a ratio of 1.00 carry mutations in global regulators such as ArcA and Fnr which is known to increase NADH levels (3, 122, 123) Internal potential (E) of [NAD+]/[NADH] in anaerobically growing cells could be calculated using the simplified Nernst equation previously described in Equation 4 2 Using wild type E. coli strain DC271 anaerobic NAD+/NADH ratio of 4.5 (122) the Nernst equation could be solved as follows (Equation 5 2): E = 0.320 V + (0.0 596/2) log (4.5) (5 2 ) E = 0.301 V With appropriate mutations in ArcA and Fnr, [NAD+]/[NADH] ratios had been demonstrated to reach a low as 1.0 (3, 123) bringing E to its midpoint potential of 0.32 V. A [NAD+]/[NADH] ratio of lower than 1.0 shifts the redox potential to a more negative value closer to that of H2. For example, if the [NAD+]/[NADH] ratio was 0.1, then the redox potential shifts to + 3.23 kcal mol1 from the + 4.62 kcal mol1 standard. In order for the reaction to be spontaneous, there must be a negative ( alue or more specifically, E(NAD+/NADH) must be more negative than E(H+/H2). To calculate the

PAGE 114

114 [NAD+]/[NADH] ratio that is minimally required for a thermodynamic equilibrium reaction of NADH to H2, the Nernst equation could be setup as follows (Equation 5 3): Eo (H+/H2) > Eo(NAD/NADH) + 0.0296 log ([NAD+]/[NADH]) (5 3 ) 0.420 V > 0.320 V + 0.0296 log ([NAD+]/[NADH]) 3.378 V > log ([NAD+]/[NADH]) 4.184 x 104 > [NAD+]/[NADH] 2390 > [NADH]/[NAD+] To reach an internal redox potential of 0.42V for the NAD+/NADH couple, the same as the hydrogen electrode potential at pH 7.0, the NADH concentration in the cell should be at least 2,390 fold higher than the NAD+ concentration. Of course, this ratio should be even higher for the reaction from NADH to H2 to be thermodynamically favorable. Although MV was readily reduced by NDH in vitro the reduced MV concentration of an anaerobic bacterial cell suspension was only 60 M in the presence of 1 mM total MV added to the culture. It appears that NDH can only generate an in vivo ratio of [MVred]/[MVoxi] of 0.06 using NADH as the electron donor and this ratio may not be high enough to drive the electrons to hydrogen. The 1 mM MV is at least 2 times higher than the NDH Km value of 0.44 mM for this substrate (Table 5 3 ) and thus may not be limiting as a substrate. With the assumption that the external concentrations of oxidized and reduced MV represent the internal concentration s of these two, the calculated redox potential for the MV couple in this culture is 0.404 V. The intracellular ratio of reduced vs oxidized MV needs to be at least 5 times higher than the observed value for thermodynamically favorable coupling of reduced MV to H2 production. This is in agreement with the ease with which MV that is reduced by dithionite donates electrons to HYD3 for H2 evolution. An alternate way of coupling NADH to H2 production with the same components, NDH, MV and HYD3, would be to incr ease the internal redox potential of the H+/H2 couple by rapidly

PAGE 115

115 removing the H2 produced by the hydrogenase by sparging with N2. Low er ing the partial pressure of dissolved H2 had been demonstrated to increase hydrogen production by lowering product inhibition (129, 132, 201) The amount of dissolved H2 in aqueous solution saturates at about 1.4 mg L1 oC (18, 49) Given the [H+] at pH 7.0 is 1 x 107 redox potential of [H+]/[H2] in water at pH 7.0 is 0.534 V with H2 saturation By lowering the dissolved [H2] at pH 7.0 or at pH 6.0 to 2.0 nM, or 200 nM, respectively, the redox potential will shift to 0.37 V, the reported redox potential of N1a cluster of NDH homologs With these conditions, the use of recombinant NDH and MV may be favorable for H2 production. This would indeed lead to a highly dilute H2 gas stream and may not be an economical H2 fermentation process. The results presented in this section show that the hydrogenosomal NDH can couple to E. coli HYD3 with MV as an intermediate electron carrier but at a very low rate. Replacing the native HYD3 and MV with Trichomonas ferredoxin and [Fe] -hydrogenase may not be able to overcome some of the constraints discussed above. It is possible that in the Trichomonas hydrogenosome the various components of the NADH to H2 pathway are compartmentalized and the H2 is rapidly removed from the microenvironment of hydrogenosome to support this reaction. Such a compartmentalization of the components substrates and products may not be achievable in a bacterial cell for cost -effective conversion of glucose to H2 at high yield without energy input either in the form of electricity, sun light, etc. Due to the constraints on H2 production by dark ferme ntation discussed above, the potential of engineering E. coli for the production of the other alternate next generation biofuel, butanol was evaluated

PAGE 116

116 Production of 1-Butanol by Recombinant E. coli Another potential next generation biofuel is butanol. Butanol is produced by several clostridia during later stages of growth and fermentation. However, due to the need to maintain redox balance, acetone and ethanol are also co -produced with butanol. In this section, I am presenting my studies aimed at transf erring the genes encoding the enzymes that constitute the butanol pathway in C. acetobutylicum into E. coli to identify the critical rate limiting steps in the butanol pathway towards producing butanol as the sole fermentation product. In addition, I also evaluated potential alternate choices in both enzymes and strains to overcome these ratelimiting steps. In V itro Production of Butanol from Acetyl -CoA Using Recombinant Proteins E. coli, like C. acetobutylicum has a natural ability to produce two moles acetyl CoA from one mole glucose. In order to produce butanol in E. coli, the rest of the butanol fermentation pathway must be introduced from C. acetobutylicum The first step is to assess if E. coli is capable of producing the enzymes in the clostridial butanol pathway in active form. To do so, all the enzymes that catalyze each reaction from acetyl -CoA to butanol were cloned into plasmid pET15b and expressed from T7 promoter in E. coli The enzyme s were purified to homogeneity and assayed for activity (Table 5 4) Of the two clostridial thiolase s ThlA appears to have higher activity than ThlB when expressed in recombinant E. coli Since it is believed that ThlA is the main thiolase in C. acetobut ylicum for the condensation of acetyl CoA (217) this is in agreement with the higher activity of ThlA. Recombinant Hbd had a significant ly higher specific activity compared to ThlA and this is similar to Hbd purified from C. beijerinckii (47) Crt activity was determined to be the highest of all the enzymes of this pathway. The reduction of crotonyl CoA to butyryl CoA was catalyzed by Bcd/EtfBA complex in clostridial systems. Purified recombinant

PAGE 117

117 Bcd/EtfBA enzyme complex had no detectable activity although Bcd activity in recombinant E. coli crude extract has been previously reported (12, 32, 100) It should be pointed that an active Bcd enzyme complex from E. coli ha s yet to be purified. To overcome this limitation, the S. avermitilis gene encoding CcrA was cloned and the protein was purified The CcrA protein catalyze s the same reaction as Bcd/EtfBA except it uses NADPH instead of NADH (211) The specific activity of the recombinant CcrA was twice of the reported value of the native enzyme from Streptomyces collinus probably due to the difference in species (Table 5 4 ) (2 11) The last two steps of the pathway could be catalyzed by both Aad and AdhE2; however, only AdhE2 seems to have detectable activity for b utyraldehyde to butanol. Fontaine et al. also purified an active recombinant AdhE2 from E. coli with similar ac tivities (67) Since all the predicted enzymes that cataly ze the production of butanol from acetyl CoA were produced in E. coli in an active form, the next step was to determine if these enzymes could constitute the butanol pathway in vitro 1) of each enzyme (ThlA, Hbd, Crt, CcrA, and AdhE2) in the presence of 5 mM acetyl CoA, 10 mM NADH, and 10 mM NADPH catalyzed the sequential reactions from acetyl CoA to butanol (Figure 5 11 and 5 12). The butanol concentration of 0.5 mM in this experiment represent ed about 20 % of the acetyl CoA added as the starting substrate. In addition, other intermediates of the pathway were also detected, although at significantly lower levels This experiment clearly shows that the minimal set of enzymes needed for conversion of acetyl CoA to butanol can be pro duced in E. coli in active form. It should be pointed out that the clostridial butyryl CoA dehydrogenase (Bcd) complex was replaced in this in vitro pathway by the crotonyl CoA reductase (CcrA) from S. avermitilis (Figure 5 12). Although both enzymes catalyze the reduction of crotonyl CoA to butyryl CoA, the clostridial Bcd has additional

PAGE 118

118 substrate requirements in addition to NADH and crotonyl -CoA for catalysis. These are ferredoxin and soluble Fe hydrogenase which would also need to be produced as active proteins in recombinant E. coli. As I presented in the previous section, production of active Fe hydrogenase in E. coli is still a work in progress. Although Bcd complex utilized NADH as an electron donor in vitro the actual electron donor in vivo is yet to be established. Coupling these enzymes with appropriate substrates, acetyl -CoA, NADH, and NADPH is expected to support butanol biosynthesis in vivo in E. coli. Plasmid Expression of Butanol Pathway The detection of ac tive recombinant enzymes that catalyze d the production of butanol from acetyl CoA in vitro was instrumental for designing an in vivo butanol pathway. Assuming that enzyme activity was not lost during the purification process, if all the genes were express ed at a 1:1 ratio to each other there will be severe bottlenecks in the later steps of the pathway (Figure 5 12). Higher levels of Bcd/EtfBA or CcrA and AdhE2 activities will be needed to increase flux through the pathway since these appear to be rate li mit ing step s Also, higher thiolase activity may be needed to direct acetyl -CoA to this pathway and away from the alcohol dehydrogenase (ethanol production) activity of AdhE2 since no alcohol dehydrogenase that is specific for butyryl -CoA to butanol has been reported. All alcohol dehydrogenase enzymes that reduce butyryl -CoA also reduce acetyl -CoA to ethanol. During normal fermentative growth, NADPH dependent CcrA cannot overcome this Bcd/EtfBA step due to a limitation of NADPH in the anaerobic E. coli Previous attempts to utilize CcrA as a substitute for Bcd/EtfBA resulted in little to no butanol produced (12, 100) The first plasmid constructed for butanol production, pButanol, had crt bcd etfB et f A hbd, adhE2, and thlA arranged in that respective order in a single operon controlled by an IPTG inducible trc promoter upstream of crt Production of butanol by E. coli with pButanol plasmid

PAGE 119

119 appear ed to be strain dependent. Wild type W3110 did not produce any detectable butanol. Since Inui et al. used JM109 for butanol production, strain JM107, a recA+ parent strain of JM109, was tested for its ability to produce butanol with plasmid pButanol (100) JM107 bearing pButanol produced 0.2 0 0.11 mM butanol with all fermentation pathways intact. Since all the genes were transcribed from a single promoter, differential translation effi ciencies of the various genes in the multicistronic mRNA maybe the cause of low yields. A new expression system was constructed to optimize transcription. To increase plasmid stability, all the genes were subcloned into a low copy vector pACYC184 with p 15a origin of replication that is compatible with ColE1 plasmids. Instead of one trc promoter controlling transcription, the genes encoding enzymes with lower specific activities ( thlA ccrA bdhB ) were transcribed from their own tandem trc promoter. The gene bdhB was included in this construct instead of adhE2 because previous reports indicated that it was functionally expressed in E. coli and BdhB had lower affinity to acetyl -CoA than AdhE2 (67, 144, 212) Strain JM107 bearing the new construct, pCBEHTCB, did not produce butanol. To determine the metabolic rate limiting step in JM107 (pCBEHTCB), crude extrac t was tested for activity of each of the enzyme encoded in the plasmid (Table 5 5 ). Enzyme assays revealed the absence of BdhB activity and lower than expected CcrA and ThlA activities. Since butyrate was also not detected in JM107 (pCBEHTCB) fermentations, the rate -limiting reaction was probably the first step, ThlA activity. Higher thiolase activity may be needed to increase flux through the butanol pathway and away from ethanol production. The plasmid pAA was constructed to increase AdhE2 and thiolase levels in the cell. Both adhE2 and E. coli thiolase, atoB were expressed from independent trc promoters. JM107 (pAA) produced significantly higher levels of both enzymes upon induction with IPTG especially for

PAGE 120

120 AtoB (Table 5 6 ). The higher thiolase act ivity is expected to therefore increase carbon flux through butanol pathway, and away from the competing pathways to ethanol and acetic acid. Based on this information, the plasmid pCBEHTCB was revised by removing the two genes with low or no activity ( thlA and bdhB ) and adding udhA (sthA) since previous studies had demonstrated an increase in NADPH level by over expression of this soluble trans -hydrogenase (172) JM107 bearing this construct, pCBEHCU, and pAA produced 0.21 0.02 mM butanol and the crude extract had similar enzyme activities as detected in Table 5 5 and Table 5 6 Low butanol yield could be attributed to the presence of intact native fermentation pathways in JM107 that divert carbon and reductant away from butanol pathway. To improve butanol yield, various native fermentation pathway enzymes were deleted in both W3110 and JM107 (Table 5 7 ). JM107 derivative s were inherently better at producing butanol than W3110 based strains. The highest butanol detected was 1.90 0.06 mM from PMD50 (JM107 ldhA ). PMD52 (JM107 ldhA pflB with lpd101*) mutation reduced butanol production to 0.92 mM. Mutation in lpd101* was expected to increase NADH yield to 4 per glucose; thus, theoretically increasing butanol yield by supplying all the required reducing equivalents. However, in the case of JM107, its incorporation in addition to a deletion in pflB reduced butanol pro duction by 50 % The highest value obtained thus far was still about half of the value reported by Atsumi et al. (12) The observed strain -dependent variation in butanol yield led to an E. coli C based strain, in particular, an evolved strain developed for succinate production (103) Bcd/EtfBA activity in E. coli could perhaps be increased by using succinate producing strains. Succinate is produced by the reduction of fumarate by fumarate reductase coupled to the oxidation of an unknown electron carrier. E. coli strain KJ104 (103) produces near theoretical yields of succinate producing up to

PAGE 121

121 1.30 mol succinate per mol glucose. This high succinate production raises the possibility that a unique electron -transport pathway was elevated to reduce fumarate reductase. Since fumarate reductase is a flavoprotein with its own unique electron carriers that re duces C=C bond in fumarate to succinate, it is possible that the same electron transport components feeding electrons to fumarate reductase could provide the needed reductant to Bcd complex, another flavoprotein that also reduces a C=C bond in crot onyl CoA to butyryl CoA. The succinate production strain, KJ104, has either elevated this unique electron transport pathway to fumarate reductase or adapted other components of the cell to support high carbon flux through fumarate reductase. In this study, I tes ted if this high flux through fumarate reductase could be adapted to support carbon flux through the rate -limiting step at the Bcd complex in butanol production. Chromosomal Insertion of Butanol Pathway into E. coli Traditional directed evolution of E. coli which has been proved to be very successful at increasing fermentation yield (43, 103, 104, 111, 135, 227, 231, 235) could not be employed in t his situation due to plasmid stability and plasmid retention. Chromosomal insertion of butanol pathway genes may be necessary for evolution of these strains for production of butanol. Plasmid pAACBEHCU was constructed by combining pCBEHCU and pAA into a single larger plasmid. The origin of replication and chloramphenicol resistance gene were replaced with spectinomycin resistance. Single recombination of the entire plasmid lacking the replicon was selected for by spectinomycin resistance and chromosomal insertion of spcR-PtrcadhE2 PtrcatoB -Ptrccrt bcd etfBA hbdPtrcccrA udhA and the strain was designated as but+. Chromosomal insertion of the full plasmid was confirmed by PCR. The site for chromosomal integration is yet to be determined; however, pos sible recombination sites were atoB udhA and lacI since these were E. coli genes. JM107 ldhA with but+ (PMD70) insertion did not produce butanol or butyrate (Table 5 8 ). Succinate producer KJ104 with frdBC and but+ (PMD72) insert also

PAGE 122

122 yield ed similar results. The addition of pCBEHCU alone without pAA as a plasmid into these strains supported butanol production with yields of 0.30 0.02 mM suggesting that this strain may have ample thiolase and butanol dehydrogenase activity and the rate -limi ting reaction may be the reduction of crotonyl -CoA to butyryl CoA. PMD70 bearing pButyrate (pButanol without adhE2) was able to produce 1.10 0.05 mM butanol and 1.22 0.02 mM butyrate. Since the strain without plasmid did not produce butyrate and the plasmid supplementation supported production of butyrate as well as butanol, the rate limited step may be Bcd/EtfBA and the genes expressed in trans from a low copy plasmid were able to overcome the low activity of the but+ insert. A second chromosomal ins ertion was made to remedy the poor butanol yield of but+ strains. The BCS operon was inserted in the chromosome replacing pflB which places the entire operon under the control of pflB native promoters. By replacing/deleting pflB in addition to ldhA the se strains are no longer capable of growing anaerobically. Micro-aerobic conditions that support PDH activity to produce acetyl -CoA were needed to assess the fermentation profiles. Strain PMD73 produced 0.16 mM butanol without plasmids (Table 5 9). PMD7 4 had a slightly higher flux through the pathway producing 0.31 mM butyrate and about 0.10 mM butanol The inability of the cell to convert all butyrate to butanol could be because of an inadequate supply of NADH to complete the reduction of butyryl CoA t o butanol. Another possible reason could be an insufficient activity of AdhE2 which was part of the initial but+ insert. The key to increasing butanol production is apparently to increase flux through the rate limiting Bcd/EtfBA reaction. The most direct way to increase flux through Bcd/EtfBA was to initially focus on the production of butyrate not butanol since butanol production requires additional NADH that requires further engineering. The production of butyrate requires 2 reducing equivalents which

PAGE 123

123 were readily supplied by glycolysis. In addition, increas ing AdhE2 level may compete with thiolase for acetyl CoA with production of ethanol as a coproduct. Since PMD74 has the highest flux and the lowest co-production of other fermentation products, it will be used as the base strain for further genetic manip ulations. By deleting adhE2 from the original but+ insert, no butanol and only trace amounts of ethanol were produced. The new strains still lacked the ability to grow anaerobically and had no significant increase in butyrate production. pTrc99a based plasmids encoding enzymes of butyrate production pathway were inserted into these strains (Table 5 10). Plasmids pTrc99a atoB and pTrc99a ccrA -udhA had minimal effect o n butyrate production. Plasmids pTrc99a bcd/etfBA and pButyrate increased butyrate yie ld from 0. 2 0 0.07 mM butyrate to 3.08 0.21 mM to 2.47 0.10 mM butyrate, respectively. By increasing Bcd/EtfBA levels, the flux to butyrate correspondingly increased. The effect of Bcd/EtfBA analogue, CcrA, was insignificant on butyrate production probably due to low NADPH pools which negates any positive effect of CcrAs higher activity. These results confirm that Bcd/EtfBA activity needs to be elevated in order to increase butyrate production. Additional Insertion of bcd -etfBA Transcriptionally Co ntrolled by E. coli adhE Promoter Low butyrate yields could be the result of inadequate activity of chromosomally expressed Bcd/EtfBA. To overcome the low activity, a third copy of bcd -etfBA was inserted into the chromosome replacing E. coli adhE similar to that of the previously described chromosomal insertion replacing pflB. Since adhE had higher promoter activity under anaerobic condition, the additional adhE promoter fusion is expected to increase overall Bcd/EtfBA activity in the cell. The third bc d -etfBA insertion into adhE promoter led to an increase in butyrate production to 2.0 0.50 mM under micro aerobic fermentation condition. To further analyze these cultures, pH controlled fleaker fermentations were used to examine growth characteristics. Cultures of

PAGE 124

124 PMD76 were inoculated into 1 % glucose minimal medium with an initial pH of 7.0 (Figure 5 13). pH controllers with set values of 7.0, 6.5, 6.0, and 5.0 were used to prevent pH from decreasing below the respective set values. Two different p hases of growth were observed with cultures set to a minimum pH of 7.0 or 6.5. After the initial phase in which all four cultures grew at about the same level, the pH 7.0 and 6.5 cultures grew to a higher cell density. During the initial growth phase, pyruvate was accumulated by the cultures and it was consumed by the two cultures during the second phase of growth. The other two cultures with a set minimum pH of 5.0 and 6.0 continued to accumulate pyruvate and butyric acid. Accumulation of pyruvic acid b y these cultures suggests that even with oxygen provided by mixing the cultures in air, acetyl CoA that is required to drive the butyrate pathway is limiting in this pfl mutant. This requires reintroduction of PFL activity or increasing the PDH activity wi th the lpd101* mutation to enhance the PDH activity of the anaerobic culture before attempting to overcome other rate limiting steps in this pathway. Further metabolic engineering coupled with long term metabolic evolution is apparently required to overcome the rate limiting step(s) by activating native E. coli genes to channel glucose carbon to butyric acid followed by redirection of the butyryl CoA to butanol.

PAGE 125

125 Table 5 1 Purification of recombinant NDH produced in E. coli with IPTG or arabino se as an inducer. Induction Sample Total [Protein] Total Activity a Sp. Activity b Purification Fold Yield % IPTG Crude extract 63.83 16.0 0.25 1.00 100.0 % Ni affinity 5.76 4.9 0.85 3.40 30.7 % Gel filtration 2.21 5.4 2.4 9.72 33.7 % Arabinose Crude extract 157.76 506 3.21 1.00 100.0 % Ni affinity 2.32 501 216 67.4 99.1 % Gel filtration 0.72 419 582 181 82.8 % Activity was determined using 50 mM K -PO4 buffer pH 7.5, 5 mM benzylviologen (BV), and 1 mM NADH, under anaerobic condition. The reaction was monitored at 600nm (BV reduction) and the activity as calculated from the initial rate of reaction. a 1 b min1 (mg protein)1

PAGE 126

126 Table 5 2 Specific activity of recombinant T. vaginalis hydrogenosome NDH produced in E. coli with arabinose as inducer Electron acceptor 1 mg protein1) __________________________________ __________________ Arabinose induced Nativea Ferricyanide 604 24 690 Benzyl viologen 582 44 ND Methyl viologen 392 19 262 Ferredoxin 24 0.2b 48c [Reprinted with permission from Do, P. M., A. Angerhofer, I. Hrdy, L. Bardonova, L.O. Ingram, and K.T. Shanmugam. 2009. Engineering Escherichia coli for fermentative dihydrogen production: potential role of NADH -ferredoxin oxidoreductase from the hydrogenosome of anaerobic protozoa. Appl Biochem Biotechnol 153:21 33. (Page 2 7 Table 1) ] a Values for the native enzyme isolated from Trichomonas vaginalis hydrogenosomes were from Hrdy et al. (94) bClostridium acetobutylicum ferredoxin c T. vaginalis ferredoxin ND not determined.

PAGE 127

127 Table 5 3 Kinetic properties of recombinant T. vaginalis hydrog enosome NDH purified from E. coli Induction Reaction Km (donor) Km (acceptor) Vmax d Kcat (mM NADH) (mM) (s 1 ) IPTG NADH a 0.35 0.41 3.69 4.14 NADH a 0.36 2.41 3.78 4.24 NADH a ND ND ND ND Arabinose NADH b 0.10 0.17 645 725 NADH b 0.22 0.44 570 650 NADH c 0.31 0.06 870 1170 Km for NADH was determined in assay mixture containing 50 mM K -phosphate buffer, pH 7.5 with 5 mM benzyl viologen, 20 mM methyl viologen or 1 mM potassium ferricyanide. Km for electron acceptors was determined in a reaction mixture containing 50 mM phosphate buffer, pH 7.5, 1 mM NADH and the electron acceptor at various concentrations. The reaction was followed by the reduction of electron acceptor [ Adapted from Do, P. M., A Angerhofer, I. Hrdy, L. Bardonova, L.O. Ingram, and K.T. Shanmugam. 2009. Engineering Escherichia coli for fermentative dihydrogen production: potential role of NADH -ferredoxin oxidoreductase from the hydrogenosome of anaerobic protozoa. Appl Biochem Bio technol 153:21 33 (Page 28, Table 2)] a6.29 g protein was used in the reduction b0.15 g protein was used in these assays c0.45 g protein was used in these reactions dmole (min mg protein)1

PAGE 128

128 Table 5 4 Specific activities of recombinant enzymes in butanol production pathway Enzyme Reaction Specific Activity K cat (U mg protein 1 ) (s 1 ) ThlA Acetyl CoA CoA 14.00 1.88 85.62 ThlB Acetyl CoA CoA 4.09 1.01 23.19 Hbd Acetoacetyl CoA CoA 209.5 15.46 (349) a 459.1 Crt Hydroxybutyryl CoA CoA 799.5 15.79 1572 Bcd/EtfBA Crotonyl CoA CoA ND ND CcrA Crotonyl CoA CoA 7.59 0.68 (2.89) b 11.23 Aad Butyryl CoA Butyraldehyde ND ND Butyraldehyde ND ND AdhE2 Butyryl CoA Butyraldehyde (0.74) c ND Butyraldehyde 0. 86 0.22 (0.18) c ND All enzymes were purified from recombinant E. coli. The number in parentheses represents reported values for enzymes from the respective native organism. Under the conditions assayed, Bcd/EtfBA had no detect able activity. ND: not detected. a Specific activity of Hbd purified from C. beijerinckii (47) b Specific activity of CcrA purified from S. collinus (211) c Specific activity of C. acetobutylicum AdhE2 purified from E. coli (67)

PAGE 129

129 Table 5 5 Specific activity of butanol pathway enzymes in the crude extract of JM107 (pCBEHTCB) Enzyme Tested IPTG Spe cific Activity (mU mg protein1) ThlA + 11.2 2.3 ND Hbd + 908.8 81.6 19.47 2.4 Bcd (NADH) + ND ND CcrA (NADPH) + 1 1 .8 1.3 ND BdhB + ND ND Crude extracts from JM107 bearing pCBEHTCB uninduced and induced with IPTG were assayed for the enzymes indicated. Values are the average of three independent experiments. ND: not detected.

PAGE 130

130 Table 5 6 Specific activity of AtoB and AdhE2 in the crude extracts of JM107 (pAA) Enzyme Tested IPTG Specific Activity (mU mg protein 1 ) AtoB + 22, 130 802 ND AdhE2 + 25.62 3.3 ND Crude extracts from JM107 (pAA) uninduced and induced with IPTG were extracted and assayed for AdhE2 and AtoB. ND: not detected.

PAGE 131

131 Table 5 7 Butanol production by various mutant strain s of E. coli bearing pCBEHCU and pAA Strain Parent Strain ldhA (focA pflB) lpd101* mgsA tcdE adhE Butanol (mM) W3110 <0.10 PMD40 W3110 X 0.45 0.13 PMD42 W3110 X X ND PMD46 W3110 X X X ND PMD47 W3110 X X X X ND PMD48 W3110 X X X X X ND JM107 0.21 0. 0 2 PMD50 JM107 X 1.90 0. 0 6 PMD51 JM107 X X ND PMD52 JM107 X X X 0.92 0.11 a PMD53 JM107 X X X X ND a PMD54 JM107 X X X X 0.21 0.09 a Cultures bearing both pCBEHCU and pAA were grown anaerobically in LB ampicillin, chloramphenicol with 0.3 % glucose at 37oC for 96 hrs ND, not detected. (n=3) a Grown in a pH stat at pH 7.0 with O2limitation at 37oC.

PAGE 132

132 Table 5 8 E ffect of various plasmids on the production of butanol by different E. coli strains. Plasmid(s) Butanol [mM] PMD50 PMD70 a PMD72 a,b No Plasmid ND ND ND pCBEHCU 0.21 0.01 0.30 0.02 0.16 0.09 pAA ND ND ND pAA + pCBEHCU 0.17 0.13 0.21 0.05 0.20 0.02 pButanol 1.93 0.05 2.20 0.07 1.15 0.40 pButyrate 1.22 0.02 (1.42 0.03 ) c 1.10 0.05 (1.22 0.03 ) c 0.82 0.23 (0.37 0.02 ) c Different E. coli strains bearing various plasmids were tested for butanol production in LB with 0.3 % glucose at 37oC for 48 hrs ND, not detected. (n=2) a Contains but+ chromosomal integration of butanol pathway genes b Cultures were grown micro aerobically c The values in parentheses represent butyrate concentration

PAGE 133

133 Table 5 9 E ffect of a second chromosomal insertion of BCS operon transcriptionally controlled by pflB promoters. Strain Glucose consumed [mM ] Fermentation Products Succ Lac For Ace EtOH Buty rate BuOH PMD70 a 55.31 0.00 11.6 0.21 ND ND 38.1 0 3.26 66.1 4.69 ND ND PMD73 b 28.20 6.24 4.89 0.03 1.75 0.61 ND 1.86 0.56 18. 8 3.42 ND 0.16 0.00 PMD72 b 12.52 4.98 7.12 0.21 0.85 0.11 ND 5.84 0.64 0.56 0.34 ND ND PMD74 b 19.58 2.36 6.03 0.53 1.56 0.12 ND 4.73 1.89 0.32 0.16 0.31 0.11 <0.10 Succ, succinate; lac, lactate; for, formate; ace, acetate; EtOH, ethanol; BuOH, butanol; ND, not detected. (n=2) a Cultured anaerobically in LB ampicillin, 1.0 % glucose at 37oC for 72hrs b Cultured micro aerobically in the same medium

PAGE 134

134 Table 5 10. Effect of plasmids encoding intermediate reactions for butyrate production on E. coli strain PMD75 Plasmid Glucose c ons umed [mM] Fermentation Products [mM] Succ Lac For Ace Acetoin EtOH Buty rate pTrc99a vector 17.06 4.19 5.58 0.54 1.55 0.02 ND 1.04 0.78 ND ND 0.20 0.07 pTrc99a atoB 27.18 6.12 2.54 0.51 0.75 0.04 ND 5.84 2.21 ND ND 0.39 0.04 pTrc99a ccrA udhA 23.21 2.65 2.89 0.02 1.39 0.08 ND 4.72 1.86 ND ND 0.31 0.02 pTrc99a bcd/etfBA 29.30 3.87 1.05 0.02 1.08 0.09 ND 7.03 2.98 0.28 0.11 ND 3.08 0.21 pButyrate 3 1 .73 4.72 ND 1.64 0.02 ND 12.77 2.11 0.53 0.00 0.68 0.02 2.47 0.10 E. coli strain PMD75 bearing the above plasmids were grown microaerobically in LB ampicillin with 1.0 % glucose in partially filled tubes at 37oC for 72 hrs Succ, succinate; lac, lactate; for, formate; ace, acetate; EtOH, ethanol; ND, not detected.

PAGE 135

135 Figure 5 1 Native molecular weight of NDH as determined by gel filtration. Sephacryl S 200 column was pre -equilibrated with 50 mM K PO4 buffer pH 7.5, 0.1 M NaCl, and 0.5 mM DTT at 4oC. 5 ml of protein sample was loaded with the flow rate of 0.5 ml min1 and 3.75 ml fractions w ere collected. NDH eluted as a heterodimer with a measured molecular weight of 69.1 kDa.

PAGE 136

136 Figure 5 2 SDS -PAGE of recombinant NDH expressed in E. coli induced by IPTG or arabinose. 6) or arabinose (lanes 7 9). Proteins were separated by reducing SDS -PAGE (12.5 % acrylamide). Lane 1, Protein standards; Lane 2, uninduced cells; Lane 3, IPTG induced cells; Lane 4, soluble cr ude extract (10 g); Lane 5, after Ni2+ column (5 g); Lane 6, after Thrombin digest ion followed by Seph acryl S 200 gel filtration (5 g); Lane 7, arabinose induced soluble crude extract (5 g); Lane 8, after Ni2+ column (1 g); Lane 9, after Thrombin dige st ion followed by Sephacryl S 200 gel filtration ( 1 g).

PAGE 137

137 Figure 5 3 pH profile of NDH activity in phosphate buffer. Activity was determined as described in Table 5 1. Optimal pH for NDH activity was determined to be about 7.5 8.0 in phosphate buff er.

PAGE 138

138 Figure 5 4. Absorption spectrum of recombinant T. vaginalis hydrogenosome NDH or NDH small subunit. Native spectrum represents the protein as purified. Reduced spectrum was obtained after titrating the protein with sodium dithionite. Reoxidized spectrum was obtained after gently mixing the reduced protein with air. [Reprinted with permission from Do, P M., A. Angerhofer, I. Hrdy, L. Bardonova, L. O. Ingram, and K. T. Shanmugam. 2009. Engineering Escherichia coli for fermentative dihydrogen production: potential role of NADH -ferredoxin oxidoreductase from the hydrogenosome of anaerobic protozoa. Appl Bi ochem Biotechnol 153 : 2133. (Pa g e 28, Fig ure 2 )]

PAGE 139

139 Figure 5 5. EPR spectrum of the recombinant T. vaginalis hydrogenosome NDH holoenzyme produced in E. coli. microwave power of 2.0 mW after reduc ing the protein with sodium dithionite. EPR conditions: sample temperature, 25K; microwave frequency, 9.45801 GHz; modulation amplitude, 5G; modulation frequency, 100 kHz; time constant, 80 ms; scan rate, 160 ms/data point for 4.9 G/s, 0.78 G/data point, receiver gain 60 dB. Wavy lines represent the experimental data and the smooth line is the simulation of the spectrum. [Reprinted with permission from Do, P. M., A. Angerhofer, I. Hrdy, L. Bardonova, L. O. Ingram, and K. T. Shanmugam. 2009. Engineering Es cherichia coli for fermentative dihydrogen production: potential role of NADH -ferredoxin oxidoreductase from the hydrogenosome of anaerobic protozoa. Appl Biochem Biotechnol 153 : 2133 (Pa g e 29, Fig ure 3 )]

PAGE 140

140 Figure 5 6. EPR spectrum of NdhE (small subunit) of the T. vaginalis NDH produced in E. coli with sodium dithionite. Other conditions were as listed for Figure 5 5. [Reprinted with permission from Do, P. M., A. Angerhofer, I. Hrdy, L. Bardonova, L. O. Ingram, and K. T. Shanmugam. 2009. Engineering Escherichia coli for fermentative dihydrogen production: potential role of NADH -ferredoxin oxidoreductase from the hydroge nosome of anaerobic protozoa. Appl Biochem Biotechnol 153 : 2133 (Pa g e 30, Fig ure 4 )]

PAGE 141

141 Figure 5 7. E ffect of NDH on whole cell reduction of methyl viologen and H2 evolution in overnight cultures of MV resistant PMD45. MV resistant cells with indicated plasmids were inoculated in 1 ml of LB, 0.3 % 1 ampicillin, and 1 mM MV in 13 x 100 mm tubes which were sealed with a rubber stopper and N2 as the gas phase. The cultures were incubated for 17hrs at 37oC. Optical densities of cultures were determined at 420 nm and 600 nm. Since cells naturally scatter light at 600 nm, measurements at 600 nm were adjusted for reduced MV by subtracting the OD contributed by the cells. (n=4)

PAGE 142

142 Figure 5 8. Primary sequence alignment of HydA from C. acetobutylicum T. vaginalis P. grassii and a symbiont from the hindgut of R. flavipes The isolated hydrogenase gene from the unknown symbiont had an Evalue of 4 x 10174 with 67 % amino acid identity and 81 % overall similarity to [Fe] -hydrogenase to P. grassii. The isolated hydrogenase also had high similarity to T. vaginalis HydA (Evalue = 1 x 10127) and to a lesser extent to C. acetobutylicum (Evalue = 3 x 1088). Protein alignment was performed with Cl ustalG ver. 1.5. Symbol legend: #, fully conserved; *, highly conserved; :, moderately conserved; ., weakly conserved or not significant; -, gap.

PAGE 143

143 Figure 5 9. E ffect of NDH and GutHyd on hydrogen production. E. coli strain PMD45 with pTrc99a ndhEF gutH yd or pTrc99a vector control were grown in 5 ml LB amp kan with 0.3 % glucose in 9 ml vial sealed with rubber septum and degassed with N2. The cultures were incubated at 37oC and H2 in the gas phase was determined by GC. Fermentation profile of these cul tures was determined by HPLC after 120 hrs (Figure 5 10). (n=2)

PAGE 144

144 Figure 5 10. E ffect of NDH and GutHyd on fermentation profile of E. coli strain PMD45 The fermentation products are from cultures after 120 hrs. (Figure 5 9) of incubation at 37oC.

PAGE 145

145 Figure 5 11. HPLC profile of in vitro production of 1-butanol from acetyl min1) of each enzyme listed in Table 5 4 minus ThlB and AdhE2 were incubated together in 0.5 ml 50 mM K -PO4 pH 7.6 assay buffer containing 5 mM acetyl CoA, 10 mM NADH, and 10 mM NADPH The reaction mixture was incubated at 37oC for 30 minutes, after which 1 unit of AdhE2 and 10 mM additional NADH were added and the reaction was continued for an additional 30 minutes. Samples were taken before enzymes were added prior to the addition of AdhE2, and at the end of incubation with all enzymes. HPLC was used to determine the production of butanol and pathway intermediates.

PAGE 146

146 Figure 5 12. Relative specific activities of functionally expressed recombinant enzymes in E. coli. Relative activities listed in Table 5 4 are pictorially represented by the thickness of the arrow. Since Bcd/EtfBA had no detectable activity, it was replaced by its analogue, NADPH -dependent CcrA from S. avermitilis The pathway is now com plete and can be combined to produce butanol in vitro a1 mg protein1; bs1

PAGE 147

147 Figure 5 13. Growth pH, pyruvate, and butyrate production from PMD76 with pH control. Cultures were grown in 1 % glucose minimal medium starting at pH 7.0. pH controllers set to 7.0 (diamonds), 6.5 (circles), 6.0 (triangles), and 5.0 (squares)

PAGE 148

148 CHAPTER 6 SUMMARY AND CONCLUSI ONS Increasing demand for fuel and a finite supply of petroleum reserve dictate that a new alternative renewable energy sources be developed in order to free the world from the bond of fossil fuels. Current use of ethanol as a gasoline additive is an excellent step towards an energy independent country and a greener future; however, physical constraints of ethanol as a fuel along with the higher cost of transportation makes ethanol a less desirable transportation fuel. New fuels currently in development that could replace gasoline include hydrogen and higher chain a lcohols such as butanol. Hydrogen The development of hydrogen as a fuel has been a work in progress for over 30 years. Hydrogen is a highly attractive energy source due to the extremely high energy content and clean combustion producing water as the onl y product. Currently, hydrogen is primarily produced by steam reforming of methane, a limited fossil fuel. Biological production of hydrogen may serve as a renewable source of fuel since it involves the conversion of solar energy either directly (photosynthetic hydrogen production) or indirectly (fermentative hydrogen production from biomass). Fermentative hydrogen production involves the conversion of sugars, the monomeric units of biomass, to hydrogen. Fermentative hydrogen production could be econom ical if yields of 10 H2 per glucose could be achieved (64) ; however, maximal theoretical yields of only 2 and 4 H2 per glucose could be reached by facultative and strict anaerobic microbes, respectively. Facultative anaerobes such as E. coli have the natural ability to fully oxidize glucose to CO2 producing up to 10 NAD (P)H as reducing equivalents. Strict anaerobes such as C. acetobutylicum and T. vaginalis possess the ability to couple NADH oxidation to hydrogen evolution but cannot fully

PAGE 149

149 oxidize all the carbons from glucose to CO2. The absence of a complete TCA cycle in strict anaerobes limits the NADH production to only glycolysis. By combining the two systems, NADH -dependent hydrogen production from strict anaerobes with the full TCA cycle from facultative anaerobes, higher hydrogen yields of up to 10 H2 per glucose could be achieved. Hydrogen production by str ict anaerobes generally involves intermediate electron carriers such as ferredoxin transferring electrons to soluble [Fe] -hydrogenase for H2 evolution. Pyruvate oxidation by PFOR is the primary source of reduced ferredoxin produced in a couple d reaction. The lesser known NFOR could directly couple NADH oxidation to ferredoxin. However, NFOR activity is limited to few anaerobes; Clostridium (108, 124, 197) and anaerobic protozoan such as Trichomonas (56, 94) Clostridial NFOR activity was recently determined to be a side reaction of Bcd/EtfBA reduction of crotonyl CoA to butyryl CoA (55, 124) Since clostridial systems do not have a true NFOR, the only other source of NFOR is the anaerobic protozoan. The unique ability of this NDH to couple NADH oxidation to directly reduce a broad range of electron acceptors including low potential ferredoxin, MV, and BV makes T. vaginalis NDH the only known member of NFOR class of enzyme s NDH is a heterodimer consisting of a small (NdhE) and large (NdhF) subuni t which have high homology to mitochondrial 24 kDa and 51kDa subunits of NADH -dehydrogenase ( NDH) of respiratory complex I (94) Recombinant T. vaginalis NDH expressed in E. coli also reduced these low potential electron acceptors (56) H2 produc tion from NADH using MV as an electron carrier may also require recombinant expression of [Fe] -hydrogenase which currently only been accomplished with low activity. Compatibility issues with traditional clostridial [Fe] -hydrogenase due to pH differences m akes its use with T. vaginalis NDH less ideal. Hydrogenase from P. grassii isolated from termite hindgut may serve as a possible alternative (99) The high activity of this hydrogenase without

PAGE 150

150 maturation ac cessory proteins in E. coli may be more compatible with NDH since both enzymes were hydrogenosome based in their native organisms The best candidate for [Fe] -hydrogenase cloned from symbiont portion of R. flavipes hindgut had an Evalue of 4 x 10174 with 67 % identity and 81 % overall similarity to [Fe] -hydrogenase from P. grassii This high homology did not translate into functional expression of active enzyme without accessory proteins. It may be essential to clone and express the hydrogenosomal prote ins NDH, Fd, Fe -hydrogenase, and accessory protein s together in E. coli to establish an NADH to H2 pathway in E. coli The thermodynamics of producing H2 from NADH is unfavorable requiring about + 4.62 kcal mol1 o) (Equation 5 1) (Figure 6 1). The [N ADH]/[NAD+] ratio required for thermodynamically favorable reaction is 2390. The internal [NAD+]/[NADH] ratios appears to be inadequate to shift the reaction to reduce sufficient amount of MV required to drive continuous H2 evolution by HYD3. Overnight c ultures of E. coli expressing NDH contained only 0.060 mM reduced MV in a total of 1.0 mM MV. The actual redox potential (E) of MV at this equilibrium ratio is 404 mV (Eo = 440 mV). NDH needs to generate a MVred/MVox ratio at least three to four fold higher to drive the electrons to hydrogenase and to H2 production, at an Eo of 420 mV. This study attempted to improve hydrogen production by E. coli utilizing hydrogenosom e based NDH to couple NADH oxidation to low potential viologen dye reduction. A lthough reduced methyl viologen failed to support high level of hydrogen production, this study expanded our understanding of hydrogenosomal NDH from T. vaginalis by providing an insight of its capability and limitation in heterologous hosts Future work in this area may involve recombinant expression of e nzymes/proteins from the same organism since they normally have better protein protein interactions than with heterologous enzymes. The expression of T.

PAGE 151

151 vaginalis hydrogenosome ferredoxin ( 347 mV) and a [Fe] -hydrogenase in an active form may be required to achieve NADH dependent H2 production; however, given the thermodynamic constraints of the system, in vivo NADH to H2 may still be difficult to accomplish even with continuous H2 removal. Butanol Buta nol is a 4 -car b o n alcohol that has many physical properties similar to gasoline. Its high combustional energy yield and renewable biological production is of great interest in recent years as a gasoline additive or even as a potential gasoline replacement. Butanol is produced by fermentation by some members of the genus Clostridium where the model organism is C. acetobutylicum Production of butanol is always accompanied by co-production of lower energy value compounds such as acetone and ethanol. Atte mpts to eliminate side products and produce a robust homobutanol fermentating Clostridium had been unsuccessful (44, 87, 88, 120, 145, 234) The limited available genetic tools and fastidious nature of the strict anaerobes makes it a less than ideal organism to engineer. An alternative to eng ineering clostridia for homo -butanol production is to introduce the entire butanol pathway into a well known non -producing organism that is easy to manipulate. In this study, I explored the potential of E. coli to produce butanol as a sole fermentation pr oduct. The established butanol pathway enzymes were produced in a recombinant E. coli and these enzymes did catalyze the sequential reactions from acetyl CoA to butanol, in vitro However, in vivo crotonyl -CoA reduction was found to be a rate -limiting step in this pathway due to a unique need for alternative electron donor that is yet to be identified. Alternative enzyme such as CcrA is fraught with NADPH requirement since the pool of NADPH in an anaerobic cell is not high enough to drive this reactio n towards high butanol yield. However, the in vitro production of butanol provided the proof of principle that E. coli could functionally

PAGE 152

152 produce the enzymes required for the production of butanol from acetyl CoA, provided appropriate electron donors can be generated in vivo pH controlled fermentations revealed the optimal pH for butyrate production was about 6.0 producing about three times more butyrate than at pH 7.0. Multiple copies of bcd -etfBA improved butyrate production suggesting that Bcd/EtfBA protein level was not at par with the rest of the pathway. One proposed method for increasing butyrate production was to insert additional copies of bcd -etfBA into the chromosome under control of highly expressed promoters. Directed evolution had been an instrument used for strain development for industrial grade production of compounds and adaptation to less than desirable media conditions (43, 103, 104, 111, 135, 227, 231, 235) Since the chromosomal inserts of the butanol pathway are stable, directed evolution by serial transfers could be implemented to select for improve d productivity with the key focus on enhancing Bcd/EtfBA protein level and activity. The recombinant E. coli with butanol/butyrate genes produced in this study could be a good platform organism for the evolution of a biocatalyst for butyrate/butanol production. Future work in this area may include the identification of the specific Bcd/EtfBA electron donor. The expression of clostridial ferredoxin may be required for effective Bcd activity. Li et al. demonstrated that the Bcd/EtfBA complex couples NADH dependent reduction of crotonyl CoA and ferredoxin (124) and suggest f erredoxin may perhaps serve as an electron bridge between Bcd and EtfBA components. Reduced electron carriers such as MV and DCPIP has been demonstrated to couple to crotonyl CoA reduction (55) Since T. vaginalis NDH reduced these electron carriers, the use of NDH with the appropriate electron carrier may increase Bcd activity. Mutations in lpd A has been demonstrated to increase the PDH activity under anaerobic

PAGE 153

153 growth condition supplying an additional 2 NADH (111, 112) that could help maintain redox balance during butanol production. An alcohol dehydrogenase specific for butyryl CoA/butyraldehyde may need to be engineered to eliminate co-pro duction of ethanol with butanol. Overcoming these rate limiting steps is expected to yield a microbial biocatalyst that can catalyze the production of butanol as the main fermentation product and at high yield from biomass -derived sugars.

PAGE 154

154 Figure 6 1. Thermodynamics of the NADH -dependent hydrogen production pathway. The values in parentheses represent the standard midpoint potential (Eo) of the respective component. H2 + 4.62 kcal mol1. a T. vaginalis ferredoxin (205, 206) ; b NDH N1a cl uster

PAGE 155

155 APPENDIX REPRINT PERMISSION OF PUBLISHED MATERIALS A portion of the Chapter 5: Results Biochemical Characterization of NFOR (NDH) from T. vaginalis was previously published by Springer Science + Business Media and Copyright Clearance Center's Rightslink1 (56) Written permission from the pu blisher was given on June 17 and 22, 2009 to reproduce text, excerpts, and figures (Figures 5 4, 5 5, and 56 and Tables 5 2 and 5 3) with license numbers 2214350581080, 2211440942274, and 2211440754680, respectively, for use in the doctoral dissertation o f Phi Minh Do, the first author of the above publication. 1 Do, P. M., A. Angerhofer, I. Hrdy, L. Bardonova, L. O. Ingram, and K. T. Shanmugam 2009. Engineering Escherichia coli for fermentative dihydrogen production: potential role of NADH ferredoxin oxidoreductase from the hydrogenosome of anaerobic protozoa. Appl Biochem Biotechnol 153: 2133.

PAGE 156

156 LIST OF REFERENCES 1. Adams, M. W., and L. E. Mortenson. 1984. The physical and catalytic properties of hydrogenase II of Clostridium pasteurianum A comparison with hydrogenase I. J Biol Chem 259: 70457055. 2. Adams, M. W., L. E. Mortenson, and J. S. Chen. 1980. Hydrogenase. Biochim Biophys Acta 594: 105176. 3. Alexeeva, S., K. J. Hellingwerf, and M. J. Teixeira de Mattos. 2003. Requirement of ArcA for redox regulation in Escherichia coli under microaerobic but not anaerobic or aerobic conditions. J Bacteriol 185: 204209. 4. Almeida, J. R., M. Bertilsson, M. F. Gorwa Grauslund, S. Gorsich, and G. Liden. 2009. Metabolic effects of furaldehydes and impacts on biotechnologi cal processes. Appl Microbiol Biotechnol 82: 625638. 5. Alsaker, K. V., and E. T. Papoutsakis. 2005. Transcriptional program of early sporulation and stationary -phase events in Clostridium acetobutylicum J Bacteriol 187: 71037118. 6. Amann, E., B. Ochs, a nd K. J. Abel. 1988. Tightly regulated tac promoter vectors useful for the expression of unfused and fused proteins in Escherichia coli. Gene 69: 301315. 7. Amore, R., P. Kotter, C. Kuster, M. Ciriacy, and C. P. Hollenberg. 1991. Cloning and expression in Saccharomyces cerevisiae of the NAD(P)H -dependent xylose reductase -encoding gene ( XYL1) from the xylose assimilating yeast Pichia stipitis Gene 109: 89 97. 8. Asada, Y., Y. Koike, J. Schnackenberg, M. Miyake, I. Uemura, and J. Miyake. 2000. Heterologous ex pression of clostridial hydrogenase in the cyanobacterium Synechococcus PCC7942. Biochim Biophys Acta 1490: 269278. 9. Asada, Y., and J. Miyake. 1999. Photobiological hydrogen production. J Biosci Bioeng 88: 1 6. 10. Asadullah, M., S. Ito, K. Kunimori, M. Y amada, and K. Tomishige. 2002. Energy efficient production of hydrogen and syngas from biomass: development of low temperature catalytic process for cellulose gasification. Environ Sci Technol 36: 44764481. 11. Atiyeh, H., and Z. Duvnjak. 2002. Production of fructose and ethanol from sugar beet molasses using Saccharomyces cerevisiae ATCC 36858. Biotechnol Prog 18: 234239. 12. Atsumi, S., A. F. Cann, M. R. Connor, C. R. Shen, K. M. Smith, M. P. Brynildsen, K. J. Chou, T. Hanai, and J. C. L iao. 2008. Metabolic engineering of Escherichia coli for 1 -butanol production. Metab Eng 10: 305311.

PAGE 157

157 13. Atta, M., M. E. Lafferty, M. K. Johnson, J. Gaillard, and J. Meyer. 1998. Heterologous biosynthesis and characterization of the [2Fe 2S] -containing N t erminal domain of Clostridium pasteurianum hydrogenase. Biochemistry 37: 1597415980. 14. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. A. Smith, J. G. Seidman, and K. Struhl. 1987. Current Protocols in Molecular Biology. Greene Publishing Assoc iates and Wiley Interscience, Brooklyn, NY. 15. Badger, P. C. 2002. Ethanol from cellulose: A General Review, p. 1721. In J. J. and W. A. (ed.), Trends in new crops and new uses. ASHA Press, Alexandria, VA. 16. Badziong, W., R. K. Thauer, and J. G. Zeikus 1978. Isolation and characterization of Desulfovibrio growing on hydrogen plus sulfate as the sole energy source. Arch Microbiol 116: 4149. 17. Ballantine, S. P., and D. H. Boxer. 1986. Isolation and characterisation of a soluble active fragment of hydrogenase isoenzyme 2 from the membranes of anaerobically grown Escherichia coli. Eur J Biochem 156: 277284. 18. Baranenko, V. I., and V. S. Kirov. 1989. Solubility of hydrogen in wate r in a broad temperature and pressure range. Atomic Energy 66: 2428. 19. Basso, L. C., H. V. de Amorim, A. J. de Oliveira, and M. L. Lopes. 2008. Yeast selection for fuel ethanol production in Brazil. FEMS Yeast Res 8: 11551163. 20. Benemann, J. 1996. Hydr ogen biotechnology: progress and prospects. Nat Biotechnol 14: 11011103. 21. Benemann, J. R., J. A. Berenson, N. O. Kaplan, and M. D. Kamen. 1973. Hydrogen evolution by a chloroplast -ferredoxin -hydrogenase system. Proc Nat Acad Sci 70: 23172320. 22. Benema nn, J. R., and A. San Pietro. 2001. Technical workshop on biological hydrogen production, Final Report to the US Department of Energy, Hydrogen R&D Program, Bethesda, MD. 23. Berman -Frank, I., P. Lundgren, Y. B. Chen, H. Kupper, Z. Kolber, B. Bergman, and P. Falkowski. 2001. Segregation of nitrogen fixation and oxygenic photosynthesis in the marine cyanobacterium Trichodesmium Science 294: 15341537. 24. Bernhard, M., B. Benelli, A. Hochkoeppler, D. Zannoni, and B. Friedrich. 1997. Functional and structural role of the cytochrome b subunit of the membrane -bound hydrogenase complex of Alcaligenes eutrophus H16. Eur J Biochem 248: 179 186. 25. Bettiga, M., B. Hahn -Hagerdal, and M. F. Gorwa Grauslund. 2008. Comparing the xylose reductase/xylitol dehydrogenase an d xylose isomerase pathways in arabinose and xylose fermenting Saccharomyces cerevisiae strains. Biotechnol Biofuels 1: 16.

PAGE 158

158 26. Black, L. K., C. Fu, and R. J. Maier. 1994. Sequences and characterization of hupU and hupV genes of Bradyrhiobium japonicum enco ding a possible nickel -sensing complex involved in hydrogenase expression. J Bacteriol 176: 71027106. 27. Blankenship, R. E., P. Cheng, T. P. Causgrove, D. C. Brune, S. -H. Wang, J. U. Choh, and J. Wang. 1993. Redox regulation of energy transfer efficiency in antennas of green photosynthetic bacteria. Photochem Photobiol 57: 103107. 28. Bck, A., and G. Sawers. 1996. Fermentation, p. 262282. In F. C. Neidhardt, et al. (ed.), Escherichia coli and Salmonella: Cellular and Molecular Biology, 2nd ed. ASM Press, Washington, DC. 29. Bonaventura, C., and J. Myers. 1969. Fluorescence and oxygen evolution from Chlorella pyrenoidosa. Biochim Biophys Acta 189: 366383. 30. Bothast, R. J., N. N. Nichols, and B. S. Dien. 1999. Fermentations with new recombinant organisms. Biotechnol Prog 15: 867875. 31. Bothast, R. J., and M. A. Schlicher. 2005. Biotechnological processes for conversion of corn into ethanol. Appl Microbiol Biotechnol 67: 1925. 32. Boynton, Z. L., G. N. Bennet, and F. B. Rudolph. 1996. Cloning, sequencing, and expression of clustered genes encoding beta -hydroxybutyryl -coenzyme A (CoA) dehydrogenase, crotonase, and butyryl CoA dehydrogenase from Clostridium acetobutylicum ATCC 824. J Bacteriol 178: 30153024. 33. Boynton, Z. L., G. N. Bennett, and F. B. Rudolp h. 1996. Cloning, sequencing, and expression of genes encoding phosphotransacetylase and acetate kinase from Clostridium acetobutylicum ATCC 824. Appl Environ Microbiol 62: 27582766. 34. Bradford, M. M. 1976. A rapid and sensitive method for the quantitati on of microgram quantities of protein utilizing the principle of protein -dye binding. Anal Biochem 72: 248254. 35. Brandt, U. 2006. Energy converting NADH:quinone oxidoreductase (complex I). Annu Rev Biochem 75: 6992. 36. Brat, D., E. Boles, and B. Wiedema nn. 2009. Functional expression of a bacterial xylose isomerase in Saccharomyces cerevisiae Appl Environ Microbiol 75: 23042311. 37. Brazzolotto, X., J. K. Rubach, J. Gaillard, S. Gambarelli, M. Atta, and M. Fontecave. 2006. The [Fe -Fe] -hydrogenase matura tion protein HydF from Thermotoga maritima is a GTPase with an iron -sulfur cluster. J Biol Chem 281: 769774. 38. Brodersen, J., G. Gottschalk, and U. Deppenmeier. 1999. Membrane -bound F420H2dependent heterodisulfide reduction in Methanococcus voltae Arch Microbiol 171: 115121.

PAGE 159

159 39. Brown, L. C., R. D. Lentsch, G. E. Besenbruch, and K. R. Schultz. 2003. Alternative flowsheets for the sulfur iodine thermochemical hydrogen cycle, Spring 2003 National Meeting of American Insitute of Chemical Engineers. GA A24 266, New Orleans, La. 40. Buhrke, T., O. Lenz, N. Krauss, and B. Friedrich. 2005. Oxygen tolerance of the H2sensing [NiFe] hydrogenase from Ralstonia eutropha H16 is based on limited access of oxygen to the active site. J Biol Chem 280: 2379123796. 41. Bu sh, G. W. 2003. Fact Sheet: Hydrogen Fuel: a clean and secure energy future.:[ http://www.whitehouse.gov/news/releases/2003/02/200302062.html ]. 42. Bush, G. W. Feb 27, 2003. St atement by the president.: [ http://www.whitehouse.gov/news/releases/2003/02/2003022711.html ]. 43. Causey, T. B., K. T. Shanmugam, L. P. Yomano, and L. O. Ingram. 2004. Engineering Escherichia coli for efficient conversion of glucose to pyruvate. Proc Natl Acad Sci 101: 22352240. 44. Chen, C. K., and H. P. Blaschek. 1999. Acetate enhances solvent production and prevents degeneration in Clostridium beijerinckii BA101. Appl Microbiol Biotechnol 52: 170 173. 45. Cline, J. D. 1969. Spectrophotometric determination of hydrogen sulfide in natural waters. Limnology and Oceanography 14: 454458. 46. Cohen, J., K. Kim, P. King, M. Seibert, and K. Schulten. 2005. Finding gas diffusion pathways in proteins: application to O2 and H2 transport in CpI [FeFe] -hydrogenase and the role of packing defects. Structure 13: 13211329. 47. Colby, G. D., and J. S. Chen. 1992. Purification and properties of 3 hydroxybutyryl coenzyme A dehy drogenase from Clostridium beijerinckii (" Clostridium butylicum ") NRRL B593. Appl Environ Microbiol 58: 32973302. 48. Cornillot, E., R. V. Nair, E. T. Papoutsakis, and P. Soucaille. 1997. The genes for butanol and acetone formation in Clostridium acetobuty licum ATCC 824 reside on a large plasmid whose loss leads to degeneration of the strain. J Bacteriol 179: 54425447. 49. Crozier, T. E., and S. Yamamoto. 1974. Solubility of hydrogen in water, seawater, and NaCl solutions. J Chem Eng Data 19: 242244. 50. da Silva Filho, E. A., H. F. de Melo, D. F. Antunes, S. K. dos Santos, A. do Monte Resende, D. A. Simoes, and M. A. de Morais, Jr. 2005. Isolation by genetic and physiological characteristics of a fuel-ethanol fermentative Saccharomyces cerevisiae strain wit h potential for genetic manipulation. J Ind Microbiol Biotechnol 32: 481486. 51. Datsenko, K. A., and B. L. Wanner. 2000. One -step inactivation of chromosomal genes in Escherichia coli K 12 using PCR products. Proc Natl Acad Sci 97: 66406645.

PAGE 160

160 52. de Graef, M. R., S. Alexeeva, J. L. Snoep, and M. J. Teixeira de Mattos. 1999. The steady -state internal redox state (NADH/NAD) reflects the external redox state and is correlated with catabolic adaptation in Escherichia coli. J Bacteriol 181: 23512357. 53. Demple, B. 1991. Regulation of bacterial oxidative stress genes. Annu Rev Genet 25: 315 337. 54. Dien, B. S., M. A. Cotta, and T. W. Jeffries. 2003. Bacteria engineered for fuel ethanol production: current status. Appl Microbiol Biotechnol 63: 258266. 55. Diez Gon zalez, F., J. B. Russell, and J. B. Hunter. 1997. NAD -independent lactate and butyryl -CoA dehydrogenases of Clostridium acetobutylicum P262. Curr Microbiol 34: 162 166. 56. Do, P. M., A. Angerhofer, I. Hrdy, L. Bardonova, L. O. Ingram, and K. T. Shanmugam. 2009. Engineering Escherichia coli for fermentative dihydrogen production: potential role of NADH -ferredoxin oxidoreductase from the hydrogenosome of anaerobic protozoa. Appl Biochem Biotechnol 153: 2133. 57. DOE. 2005. Property of Fuels. Department of Ene rgy: [http://www.eere.energy.gov/afdc/pdfs/fueltable.pdf] 58. Doherty, G. M., and S. G. Mayhew. 1992. The hydrogen-tritium exchange activity of Megasphaera elsdenii hydrogenase. Eur J Biochem 205: 117126. 59. Dross, F., V. Geisler, R. Lenger, F. Theis, T. Krafft, F. Fahrenholz, E. Kojro, A. Duchene, D. Tripier, and K. Juvenal. 1992. The quinone reactive Ni/Fe -hydrogenase of Wolinella succinogenes Eur J Biochem 206: 9 3 102. 60. Drre, P. 2005. Formation of solvents in clostridia, p. 671685. In P. Drre (ed.), Handbook on Clostridia. CRC Press, Boca Raton. 61. Drre, P., M. Bohringer, S. Nakotte, S. Schaffer, K. Thormann, and B. Zickner. 2002. Transcriptional regulatio n of solventogenesis in Clostridium acetobutylicum J Mol Microbiol Biotechnol 4: 295300. 62. Drre, P., R. J. Fischer, A. Kuhn, K. Lorenz, W. Schreiber, B. Sturzenhofecker, S. Ullmann, K. Winzer, and U. Sauer. 1995. Solventogenic enzymes of Clostridium ac etobutylicum : catalytic properties, genetic organization, and transcriptional regulation. FEMS Microbiol Rev 17: 251262. 63. Eady, R. R. 1996. Structure function relationships of alternative nitrogenases. Chem. Rev. 96: 30133030. 64. Eggeman, T. 2004. Bo undary analysis for H2 production by fermentation. National Renewable Energy Laboratory:NREL/SR 56036129.

PAGE 161

161 65. EIA. 2009. Appendix A:reference case, p. 109150, Annual energy outlook 2009: with projections to 2030. Energy Information Administration, Washington D.C. : DOE/EIA 0383(2009). 66. Elsen, S., A. Colbeau, J. Chabert, and P. M. Vignais. 1996. The hupTUV operon is involved in negative control of hydrogenase synthesis in Rhodobacter capsulatus J Bacteriol 178: 51745181. 67. Fontaine, L., I. Meynial Sa lles, L. Girbal, X. Yang, C. Croux, and P. Soucaille. 2002. Molecular characterization and transcriptional analysis of adhE2, the gene encoding the NADH -dependent aldehyde/alcohol dehydrogenase responsible for butanol production in alcohologenic cultures o f Clostridium acetobutylicum ATCC 824. J Bacteriol 184: 821830. 68. Gabriel, C. L. 1928. Butanol fermentation process. Ind. Eng. Chem. 20: 10631067. 69. Gabriel, C. L., and F. M. Crawford. 1930. Development of the butyl acetonic fermentation industry. Ind. Eng. Chem. 22: 11631165. 70. Gaffron, H., and J. Rubin. 1942. Fermentative and photochemical production of hydrogen in algae. J. Gen. Physiol. 20: 219240. 71. Gest, H., and M. D. Kamen. 1949. Studies on the metabolism of photosynthetic bacteria. J Bacteriol 58: 239245. 72. Girbal, L., G. von Abendroth, M. Winkler, P. M. Benton, I. Meynial -Salles, C. Croux, J. W. Peters, T. Happe, and P. Soucaille. 2005. Homologous and heterologous overex pression in Clostridium acetobutylicum and characterization of purified clostridial and algal Fe -only hydrogenases with high specific activities. Appl Environ Microbiol 71: 27772781. 73. Gitlitz, P. H., and A. I. Krasna. 1975. Structural and catalytic properties of hydrogenase from Chromatium Biochemistry 14: 25612568. 74. Golden, J. W., and H. S. Yoon. 2003. Heterocyst development in Anabaena. Curr Opin Microbiol 6: 557563. 75. Grabar, T. B., S. Zhou, K. T. Shanmugam, L P. Yomano, and L. O. Ingram. 2006. Methylglyoxal bypass identified as source of chiral contamination in L(+) and D( ) lactate fermentations by recombinant Escherichia coli. Biotechnol Lett 28: 15271535. 76. Gray, C. T., and H. Gest. 1965. Biological form ation of molecular hydrogen. Science 148: 186 192. 77. Gray, K. A., L. Zhao, and M. Emptage. 2006. Bioethanol. Curr Opin Chem Biol 10: 141 146.

PAGE 162

162 78. Grupe, H., and G. Gottschalk. 1992. Physiological events in Clostridium acetobutylicum during the shift from a cidogenesis to solventogenesis in continuous culture and presentation of a model for shift induction. Appl Environ Microbiol 58: 38963902. 79. Gutierrez, T., L. O. Ingram, and J. F. Preston. 2006. Purification and characterization of a furfural reductase ( FFR) from Escherichia coli strain LYO1 -an enzyme important in the detoxification of furfural during ethanol production. J Biotechnol 121: 154164. 80. Hahn -Hagerdal, B., K. Karhumaa, M. Jeppsson, and M. F. Gorwa Grauslund. 2007. Metabolic engineering for p entose utilization in Saccharomyces cerevisiae. Adv Biochem Eng Biotechnol 108: 147177. 81. Hallahan, D. L., V. M. Fernandez, and D. O. Hall. 1987. Reversible activation of hydrogenase from Escherichia coli. Eur J Biochem 165: 621625. 82. Hallenbeck, P. C. 2005. Fundamentals of the fermentative production of hydrogen. Water Sci Technol 52: 2129. 83. Hans, M., E. Bill, I. Cirpus, A. J. Pierik, M. Hetzel, D. Alber, and W. Buckel. 2002. Adenosine triphosphate induced electron transfer in 2 -hydroxyglutaryl CoA dehydratase from Acidaminococcus fermentans Biochemistry 41: 58735882. 84. Happe, T., and J. D. Naber. 1993. Isolation, characterization and N -terminal amino acid sequence of hydrogenase from the green alga Chlamydomonas reinhardtii Eur J Biochem 214: 475481. 85. Happe, T., K. Schutz, and H. Bohme. 2000. Transcriptional and mutational analysis of the uptake hydrogenase of the filamentous cyanobacterium Anabaena variabilis ATCC 29413. J Bacteriol 182: 16241631. 86. Harden, A. 1901. The chemical action of B acillus coli communis and similar organisms on carbohydrates and allied compounds. J. Chem. Soc 79: 601618. 87. Harris, L. M., L. Blank, R. P. Desai, N. E. Welker, and E. T. Papoutsakis. 2001. Fermentation characterization and flux analysis of recombinant strains of Clostridium acetobutylicum with an inactivated solR gene. J Ind Microbiol Biotechnol 27: 322328. 88. Harris, L. M., R. P. Desai, N. E. Welker, and E. T. Papoutsakis. 2000. Characterization of recombinant strains of the Clostridium acetobutylicum butyrate kinase inactivation mutant: need for new phenomenological models for solventogenesis and butanol inhibition? Biotechnol Bioeng 67: 1 11. 89. Harvey, A. E. J., J. A. Smart, and E. S. Amis. 1955. Simultaneous spectrophotometric determination of iron(II) and total Iron with 1,10 phenanthroline. Anal. Chem. 27: 2629.

PAGE 163

163 90. Higuchi, Y., H. Ogata, K. Miki, N. Yasuoka, and T. Yagi. 1999. Removal of the bridging ligand atom at the Ni Fe active site of [NiFe] hydrogenase upon reduction with H2, as revealed by X ray structure analysis at 1.4 resolution. Structure 7: 549556. 91. Hill, J., E. Nelson, D. Tilman, S. Polasky, and D. Tiffany. 2006. Environmental, economic, and energetic costs and benefits of biodiesel and ethanol biofuels. Proc Natl Acad Sci 103: 1120611210. 92. Homann, P. H. 2003. Hydrogen metabolism of green algae: discovery and early research a tribute to Hans Gaffron and his coworkers. Photosynth Res 76: 93103. 93. Houchins, J. P., and R. H. Burris. 1981. Comparative characterization of two distinct hydrogenases from Anabaena sp. strain 7120. J Bacteriol 146: 215221. 94. Hrdy, I., R. P. Hirt, P. Dolezal, L. Bardonova, P. G. Foster, J. Tachezy, and T. M. Embley. 2004. Trichomonas hydrog enosomes contain the NADH dehydrogenase module of mitochondrial complex I. Nature 432: 618622. 95. Ide, T., S. Baumer, and U. Deppenmeier. 1999. Energy conservation by the H2:heterodisulfide oxidoreductase from Methanosarcina mazei Go1: identification of two protontranslocating segments. J Bacteriol 181: 40764080. 96. Ingram, L. O., H. C. Aldrich, A. C. Borges, T. B. Causey, A. Martinez, F. Morales, A. Saleh, S. A. Underwood, L. P. Yomano, S. W. York, J. Zaldivar, and S. Zhou. 1999. Enteric bacterial catal ysts for fuel ethanol production. Biotechnol Prog 15: 855866. 97. Ingram, L. O., T. Conway, D. P. Clark, G. W. Sewell, and J. F. Preston. 1987. Genetic engineering of ethanol production in Escherichia coli. Appl Environ Microbiol 53: 24202425. 98. Ingram, L. O., P. F. Gomez, X. Lai, M. Moniruzzaman, B. E. Wood, L. P. Yomano, and S. W. York. 1998. Metabolic engineering of bacteria for ethanol production. Biotechnol Bioeng 58: 204214. 99. Inoue, J., K. Saita, T. Kudo, S. Ui, and M. Ohkuma. 2007. Hydrogen prod uction by termite gut protists: characterization of iron hydrogenases of Parabasalian symbionts of the termite Coptotermes formosanus Eukaryot Cell 6: 192532. 100. Inui, M., M. Suda, S. Kimura, K. Yasuda, H. Suzuki, H. Toda, S. Yamamoto, S. Okino, N. Suzu ki, and H. Yukawa. 2008. Expression of Clostridium acetobutylicum butanol synthetic genes in Escherichia coli. Appl Microbiol Biotechnol 77: 13051316. 101. Ito, T., Y. Nakashimada, T. Kakizono, and N. Nishio. 2004. High-yield production of hydrogen by Ente robacter aerogenes mutants with decreased alpha acetolactate synthase activity. J Biosci Bioeng 97: 227232.

PAGE 164

164 102. Jackson, D. D., and J. W. Ellms. 1896. On odors and taste of surface waters with special reference to Anabaena, a microscopical organism found in certain water supplies of Massachusetts. Rep Mass State Board Health. 103. Jantama, K., X. Zhang, J. C. Moore, K. T. Shanmugam, S. A. Svoronos, and L. O. Ingram. 2008. Eliminating side products and increasing succinate yields in engineered strains of Es cherichia coli C. Biotechnol Bioeng 101: 881893. 104. Jarboe, L. R., T. B. Grabar, L. P. Yomano, K. T. Shanmugan, and L. O. Ingram. 2007. Development of ethanologenic bacteria. Adv Biochem Eng Biotechnol 108: 237261. 105. Jeffries, T. W. 2006. Engineering yeasts for xylose metabolism. Curr Opin Biotechnol 17: 320 6. 106. Jeffries, T. W., and Y. S. Jin. 2004. Metabolic engineering for improved fermentation of pentoses by yeasts. Appl Microbiol Biotechnol 63: 495509. 107. Jones, D. T., and D. R. Woods. 1986. Acetone -butanol fermentation revisited. Microbiol Rev 50: 484524. 108. Jungermann, K., R. K. Thauer, G. Leimenstoll, and K. Decker. 1973. Function of reduced pyridine nucleotide -ferredoxin oxidoreductases in saccharolytic clostridia. Biochim Biophys Acta 305: 268280. 109. Kabus, A., T. Georgi, V. F. Wendisch, and M. Bott. 2007. Expression of the Escherichia coli pntAB genes encoding a membrane -bound transhydrogenase in Corynebacterium glutamicum improves L lysine formation. Appl Microbiol Biotechnol 75: 4753. 110. Kern, M., W. Klipp, and J. H. Klemme. 1994. Increased nitrogenase -nependent H2 photoproduction by hup mutants of Rhodospirillum rubrum Appl Environ Microbiol 60: 17681774. 111. Kim, Y., L. O. Ingram, and K. T. Shanmugam. 2007. Construction of an Escherichia coli K 12 mutant for homoethanologenic fermentation of glucose or xylose without foreign genes. Appl Environ Microbiol 73: 17661771. 112. Kim, Y., L. O. Ingram, and K. T. Shanmugam. 2008. Dihydrolipoamide dehydrogenase mutation alters the NADH sensitivity of pyruvate dehydrogenase complex of Escherichia coli K 12. J Bacteriol 190: 38513858. 113. King, P. W., M. C. Posewitz, M. L. Ghirardi, and M. Seibert. 2006. Functional studies of [FeFe] hydrogenase maturation in an Escherichia coli bios ynthetic system. J Bacteriol 188: 216372. 114. Knoshaug, E. P., and M. Zhang. 2008. Butanol tolerance in a selection of microorganisms. Appl Biochem Biotechnol 153: 1320.

PAGE 165

165 115. Kotter, P., R. Amore, C. P. Hollenberg, and M. Ciriacy. 1990. Isolation and char acterization of the Pichia stipitis xylitol dehydrogenase gene, XYL2 and construction of a xylose utilizing Saccharomyces cerevisiae transformant. Curr Genet 18: 493500. 116. Krahn, E., R. Weiss, M. Krockel, J. Groppe, G. Henkel, P. Cramer, X. Trautwein, K. Schneider, and A. Muller. 2002. The Fe -only nitrogenase from Rhodobacter capsulatus : identification of the cofactor, an unusual, high nuclearity iron -sulfur cluster, by Fe K -edge EXAFS and 57Fe Mossbauer spectroscopy. J Biol Inorg Chem 7: 3745. 117. Kra sna, A. I. 1984. Mutants of Escherichia coli with altered hydrogenase activity. J Gen Microbiol 130: 779787. 118. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680685. 119. Lambden, P. R., and J. R. Guest. 1976. Mutants of Escherichia coli K12 unable to use fumarate as an anaerobic electron acceptor. J Gen Microbiol 97: 145160. 120. Lee, S. Y., J. H. Park, S. H. Jang, L. K. Nielsen, J. Kim, and K. S. Jung. 2008. Fermentative butanol production by clostridia. Biotechnol Bioeng 101: 209228. 121. Lehman, T. C., and C. Thorpe. 1990. Alternate electron acceptors for medium -chain acyl CoA dehydrogenase: use of ferricenium salts. Biochemistry 29: 10594105602. 122. Leonardo, M. R., Y. Dailly, and D. P. Clark. 1996. Role of NAD in regulating the adhE gene of Escherichia coli. J Bacteriol 178: 60136018. 123. Levanon, S. S., K. Y. San, and G. N. Bennett. 2005. Effect of oxygen on the Escherichia coli ArcA and FNR regul ation systems and metabolic responses. Biotechnol Bioeng 89: 556564. 124. Li, F., J. Hinderberger, H. Seedorf, J. Zhang, W. Buckel, and R. K. Thauer. 2008. Coupled ferredoxin and crotonyl coenzyme A (CoA) reduction with NADH catalyzed by the butyryl -CoA de hydrogenase/etf complex from Clostridium kluyveri. J Bacteriol 190: 843 850. 125. Liang, L., Y. P. Zhang, L. Zhang, M. J. Zhu, S. Z. Liang, and Y. N. Huang. 2008. Study of sugarcane pieces as yeast supports for ethanol production from sugarcane juice and molasses. J Ind Microbiol Biotechnol 35: 16051613. 126. Licht, S. 2005. Thermochemical solar hydrogen generation. Chem Commun (Camb):46354646. 127. Lin, Y., and S. Tanaka. 2006. Ethanol fermentation from biomass resources: current state and prospects. Appl Microbiol Biotechnol 69: 627642. 128. Loach, P. A. 1968. Oxidationreduction potentials, aborbance bands and molar absorbance of compounds used in biochemi cal studies, p. J27 J34. In H. A. Sober (ed.),

PAGE 166

166 Handbook of Biochemistry: Selected Data for Molecular Biology. The Chemical Rubber Co., Cleveland, OH. 129. Logan, B. E., S. E. Oh, I. S. Kim, and S. Van Ginkel. 2002. Biological hydrogen production measured i n batch anaerobic respirometers. Environ Sci Technol 36: 25302535. 130. Ma, K., Z. H. Zhou, and M. W. Adams. 1994. Hydrogen production from pyruvate by enzymes purified from hyperthermophilic archaeon, Pyrococcus furiosus : A key role for NADPH. FEMS Microb io Lett 122: 245250. 131. Macarron, R., C. Acebal, M. P. Castillon, J. M. Dominguez, I. de la Mata, G. Pettersson, P. Tomme, and M. Claeyssens. 1993. Mode of action of endoglucanase III from Trichoderma reesei Biochem J 289 ( Pt 3): 867873. 132. Mandal, B ., K. Nath, and D. Das. 2006. Improvement of biohydrogen production under decreased partial pressure of H2 by Enterobacter cloacae Biotechnol Lett 28: 831835. 133. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular Cloning. Cold Spring Harbor L aboratory, New York. 134. Markov, A. V., A. V. Gusakov, E. G. Kondratyeva, O. N. Okunev, A. O. Bekkarevich, and A. P. Sinitsyn. 2005. New effective method for analysis of the component composition of enzyme complexes from Trichoderma reesei Biochemistry (Mosc) 70: 657663. 135. Martinez, A., T. B. Grabar, K. T. Shanmugam, L. P. Yomano, S. W. York, and L. O. Ingram. 2007. Low salt medium for lactate and ethanol production by recombinant Escherichia coli B. Biotechnol Lett 29: 397404. 136. Melis, A., and T. H appe. 2004. Trails of green alga hydrogen research from Hans Gaffron to new frontiers. Photosynth Res 80: 401409. 137. Melis, A., L. Zhang, M. Forestier, M. L. Ghirardi, and M. Seibert. 2000. Sustained photobiological hydrogen gas production upon reversi ble inactivation of oxygen evolution in the green alga Chlamydomonas reinhardtii Plant Physiol 122: 127136. 138. Miller, J. H. 1992. A Short Course in Bacterial Genetics -A Laboratory Manual and Handbook for Escherichia coli and Related Bacteria. Cold Spring Harbor Laboratory Press, New York, NY. 139. Millichip, R. J., and H. W. Doelle. 1989. Large -scale ethanol production from Mil (Sorghum) using Zymomonas mobilis Process Biochem 24: 141145. 140. Mitsui, A., and S. Suda. 1995. Alternative and cyclic appearance of H2 and O2 photoproduction activities under non-growing conditions in an aerobic nitrogen-fixing unicellular cyanobacterium Synechococcus sp. Curr Microbio 30: 1 6.

PAGE 167

167 141. Moock, N., B. Trapp, and D. Gallaspy. 2005. Pre sented at the Power -Gen International Conference, Las Vegas, NV. 142. Mullany, P., C. L. Clayton, M. J. Pallen, R. Slone, A. al -Saleh, and S. Tabaqchali. 1994. Genes encoding homologues of three consecutive enzymes in the butyrate/butanol producing pathway of Clostridium acetobutylicum are clustered on the Clostridium difficile chromosome. FEMS Microbiol Lett 124: 6167. 143. Murata, N. 1969. Control of excitation transfer in photosynthesis. I. Light induced change of chlorophyll a fluorescence in Porphyridi um cruentum Biochim Biophys Acta 172: 242 251. 144. Nair, R. V., G. N. Bennett, and E. T. Papoutsakis. 1994. Molecular characterization of an aldehyde/alcohol dehydrogenase gene from Clostridium acetobutylicum ATCC 824. J Bacteriol 176: 871885. 145. Nair, R. V., E. M. Green, D. E. Watson, G. N. Bennett, and E. T. Papoutsakis. 1999. Regulation of the sol locus genes for butanol and acetone formation in Clostridium acetobutylicum ATCC 824 by a putative transcriptional repressor. J Bacteriol 181: 319330. 146. Nandi, R., and S. Sengupta. 1998. Microbial production of hydrogen: an overview. Crit Rev Microbiol 24: 6184. 147. Narayanan, N., M. Y. Hsieh, Y. Xu, and C. P. Chou. 2006. Arabinose induction of lac derived promoter systems for penicillin acylase productio n in Escherichia coli. Biotechnol Prog 22: 617625. 148. Nehring, R., M. zur Hausen, and W. Neumann. 1980. Process for working up distillation residues from the hydroformylation of propene. US Patent number 4,190,731; Ap. number 05/940,294. 149. Niba, L. L. 2005. Carbohydrates: starch. In Y. H. Hui (ed.), Handbook of food science, technology, and engineering, vol. 1. Taylor and Francis, New York. 150. Nicolet, Y., C. Cavazza, and J. C. Fontecilla -Camps. 2002. Fe only hydrogenases: structure, function and evolution. J Inorg Biochem 91: 1 8. 151. Nozaki, M., K. Tagawa, and D. I. Arnon. 1961. Noncyclic photophosphorylation in photosynthetic bacteria. Proc Natl Acad Sci 47: 13341340. 152. NRC, and NAE. 2004. The Hydrogen Economy: Opportunities, Cost, Barriers, and R&D Needs. The National Academies Press, Washington, DC. 153. Ogino, H., T. Miura, K. Ishimi, M. Seki, and H. Yoshida. 2005. Hydrogen production from glucose by anaerobes. Biotechnol Prog 21: 1 7861788.

PAGE 168

168 154. Ohnishi, T. 1998. Iron-sulfur clusters/semiquinones in complex I. Biochim Biophys Acta 1364: 186206. 155. Ohta, K., D. S. Beall, J. P. Mejia, K. T. Shanmugam, and L. O. Ingram. 1991. Genetic improvement of Escherichia coli for ethanol production: chromosomal integration of Zymomonas mobilis genes encoding pyruvate decarboxylase and alcohol dehydrogenase II. Appl Environ Microbiol 57: 893900. 156. Ostergaard, S., L. Olsson, and J. Nielsen. 2000. Metabolic engineering of Sacc haromyces cerevisiae Microbiol Mol Biol Rev 64: 3450. 157. Pakes, W. C. C., and W. H. Jollyman. 1901. The bacterial decomposition of formic acid into carbon dioxide and hydrogen. J. Chem. Soc 79: 386391. 158. Patel, M. A., M. S. Ou, R. Harbrucker, H. C. A ldrich, M. L. Buszko, L. O. Ingram, and K. T. Shanmugam. 2006. Isolation and characterization of acid-tolerant, thermophilic bacteria for effective fermentation of biomass -derived sugars to lactic acid. Appl Environ Microbiol 72: 32283235. 159. Peters, J. W., W. N. Lanzilotta, B. J. Lemon, and L. C. Seefeldt. 1998. X ray crystal structure of the Fe -only hydrogenase (CpI) from Clostridium pasteurianum to 1.8 angstrom resolution. Science 282: 18531858. 160. Peters, J. W., R. K. Szilagyi, A. Naumov, and T. Dou glas. 2006. A radical solution for the biosynthesis of the H -cluster of hydrogenase. FEBS Lett 580: 363367. 161. Petersen, D. J., R. W. Welch, F. B. Rudolph, and G. N. Bennett. 1991. Molecular cloning of an alcohol (butanol) dehydrogenase gene cluster from Clostridium acetobutylicum ATCC 824. J Bacteriol 173: 18311834. 162. Petersen, D. J., R. W. Welch, K. A. Walter, L. D. Mermelstein, E. T. Papoutsakis, F. B. Rudolph, and G. N. Bennett. 1991. Cloning of an NADH -dependent butanol dehydrogenase gene from Clo stridium acetobutylicum Ann N Y Acad Sci 646: 9498. 163. Petitdemange, H., C. Cherrier, R. Raval, and R. Gay. 1976. Regulation of the NADH and NADPH -ferredoxin oxidoreductases in clostridia of the butyric group. Biochim Biophys Acta 421: 334337. 164. Pose witz, M. C., P. W. King, S. L. Smolinski, L. Zhang, M. Seibert, and M. L. Ghirardi. 2004. Discovery of two novel radical S adenosylmethionine proteins required for the assembly of an active [Fe] hydrogenase. J Biol Chem 279: 2571125720. 165. Prince, R. C., and H. S. Kheshgi. 2005. The photobiological production of hydrogen: potential efficiency and effectiveness as a renewable fuel. Crit Rev Microbiol 31: 1931. 166. Qureshi, N., and H. P. Blaschek. 2001. ABE production from corn: a recent economic evaluatio n. J Ind Microbiol Biotechnol 27: 292297.

PAGE 169

169 167. Rabinowitz, J. 1972. Preparation and properties of clostridial ferredoxins. Methods Enzymol 24: 431446. 168. Ramey, D. E. 2007. Butanol: the other alternative fuel, p. 137147, Agricultural Biofuels: Technology, Sustainability and Profitability. ButylFuel, LLC, Blacklick, OH. 169. Randt, C., and H. Senger. 1985. Participation of the two photosystems in light dependent hydrogen evolution in Scenedesmus obliquus Photochem. Photobiol. 42: 553557. 170. Rogers P. L K, L. J., Skotnicki M. L. and Tribe D. E. 1982. Ethanol production by Zymomonas mobilis Advances Biochem. Eng 23: 3784. 171. Rubach, J. K., X. Brazzolotto, J. Gaillard, and M. Fontecave. 2005. Biochemical characterization of the HydE and HydG iron -only hydrogenase maturation enzymes from Thermatoga maritima. FEBS Lett 579: 50555060. 172. Sanchez, A. M., J. Andrews, I. Hussein, G. N. Bennett, and K. Y. San. 2006. Effect of overexpression of a soluble pyridine nucleotide transhydrogenase (UdhA) on the production of poly(3 -hydroxybutyrate) in Escherichia coli. Biotechnol Prog 22: 420 425. 173. Sawers, G., and B. Suppmann. 1992. Anaerobic induction of pyruvate formate lyase gene expression is mediated by the ArcA and FNR proteins. J Bacteriol 174: 34743478. 174. Sawers, R. G., and D. H. Boxer. 1986. Purification and properties of membrane -bound hydrogenase isoenzyme 1 from anaerobically grown Escherichia coli K12. Eur J Biochem 156: 265275. 175. Sazanov, L. A. 2007. Respiratory complex I: mechanistic and structural insights provided by the crystal structure of the hydrophilic domain. Biochemistry 46: 22752288. 176. Schindelin, H., C. Kisker, J. L. Schlessman, J. B. Howard, and D. C. Rees. 1997. Structure of ADP AIF4stabilized nitrogenase complex and its implications for signal transduction. Nature 387: 370376. 177. Schneider, K., and H. G. Schlegel. 1976. Purification and properties of soluble hydrogenase from Alcaligenes eutrophus H 16. Biochim Biophys Ac ta 452: 6680. 178. Shanmugam, K. T., B. B. Buchanan, and D. I. Arnon. 1972. Ferredoxins in light and dark -grown photosynthetic cells with special reference to Rhodospirillum rubrum Biochim Biophys Acta 256: 477486. 179. Shi, Z., and H. P. Blaschek. 2008. Transcriptional analysis of Clostridium beijerinckii NCIMB 8052 and the hyper -butanol -producing mutant BA101 during the shift from acidogenesis to solventogenesis. Appl Environ Microbiol 74: 770914. 180. Simpson, F. B., and R. H. Burris. 1984. A nit rogen pressure of 50 atmospheres does not prevent evolution of hydrogen by nitrogenase. Science 224: 10951097.

PAGE 170

170 181. Slininger, P. J., Bothast, R. J. Okos, M. R. and Ladisch, M. R. 1985. Comparative evaluation of ethanol production by xylose -fermenting yeas ts presented high xylose concentrations. Biotechnol. Lett 7: 431436. 182. Smith, P. K., R. I. Krohn, G. T. Hermanson, A. K. Mallia, F. H. Gartner, M. D. Provenzano, E. K. Fujimoto, N. M. Goeke, B. J. Olson, and D. C. Klenk. 1985. Measurement of protein usi ng bicinchoninic acid. Anal Biochem 150: 7685. 183. Spiro, S., and J. R. Guest. 1991. Adaptive responses to oxygen limitation in Escherichia coli. Trends Biochem Sci 16: 310314. 184. Sprenger, G. A. 1996. Carbohydrate metabolism in Zymomonas mobilis : a cat abolic highway with some scenic routes. FEMS. Microbiol Lett 145: 301307. 185. Steen, E. J., R. Chan, N. Prasad, S. Myers, C. J. Petzold, A. Redding, M. Ouellet, and J. D. Keasling. 2008. Metabolic engineering of Saccharomyces cerevisiae for the production of n -butanol. Microb Cell Fact 7: 3642. 186. Stephenson, M., and L. H. Stickland. 1931. Hydrogenase: a bacterial enzyme activating molecular hydrogen. I. The properties of the enzyme. Biochem. J 25: 205214. 187. Stephenson, M., and L. H. Stickland. 1932. Hydrogenlyases. Bacterial enzymes liberating molecular hydrogen. Biochem. J. 26: 712724. 188. Sticklen, M. 2006. Plant genetic engineering to improve biomass characteristics for biofuels. Curr Opin Biotechnol 17: 315319. 189. Stuart, T. S., and H. Gaffr on. 1972. The mechanism of hydrogen photoproduction by several algae. I. The effect of inhibitors of photophosphorylation. Planta (Berlin) 106: 91100. 190. Stuart, T. S., and H. Gaffron. 1972. The mechanism of hydrogen photoproduction by several algae. II. The contribution of Photosystem II. Planta (Berlin) 106: 101 112. 191. Sun, Y., and J. Cheng. 2002. Hydrolysis of lignocellulosic materials for ethanol production: a review. Bioresour Technol 83: 1 11. 192. Tagawa, K., and D. I. Arnon. 1962. Ferredoxins as electron carriers in photosynthesis and in the biological production and consumption of hydrogen gas. Nature 195: 537 543. 193. Takahashi, C. M., D. F. Takahashi, M. L. Carvalhal, and F. Alterthum. 1999. Effects of acetate on the growth and fermentation performance of Escherichia coli KO11. Appl Biochem Biotechnol 81: 193203. 194. Takai, M., N. Iwao, T. Tooru, T. Yoshiyuki, U. Hisao, and N. Akio. 2001. Process for producing aldehyde. US Patent numbe r 6,291,717; Ap. number 09/457,742.

PAGE 171

171 195. Tatsumi, H., K. Takagi, M. Fujita, K. Kano, and T. Ikeda. 1999. Electrochemical study of reversible hydrogenase reaction of Desulfovibrio vulgaris cells with methyl viologen as an electron carrier. Anal Chem 71: 17531759. 196. Thauer, R. K., K. Jungermann, and K. Decker. 1977. Energy conservation in chemotrophic anaerobic bacteria. Bacteriol Rev 41: 100180. 197. Thauer, R. K., K. Jungermann, E. Rupprecht, and K. Decker. 1969. Hydrogen formation from NADH in cell -free extracts of Clostridium kluyveri. Acetyl coenzyme A requirement and ferredoxin dependence. FEBS Lett 4: 108112. 198. Thorpe, E. 1921. A dictionary of applied chemistry, vol. II. Longmans, Green and Co., London. 199. Tshiteya, R. M., E. N. Vermiglio, and S Tice. 1991. Compatibility of alcohols with other fuels in blends, p. 5 1:5 10. In J. H. Ashworth (ed.), Properties of alcohol transportation fuels: alcohol fuels reference work #1. Meridian Corporation, Alexandria, VA. 200. Ueda, A., F. Yuichi, A. Atsuhi ro, and E. Hiroki. 2002. Process for producing alcohols. US Patent number 6,455,743; App. number 09/450,123. 201. Valdez Vazquez, I., E. Rios -Leal, A. Carmona -Martinez, K. M. Munoz Paez, and H. M. Poggi -Varaldo. 2006. Improvement of biohydrogen production from solid wastes by intermittent venting and gas flushing of batch reactors headspace. Environ Sci Technol 40: 34093415. 202. van Maris, A. J., D. A. Abbott, E. Bellissimi, J. van den Brink, M. Kuyper, M. A. Luttik, H. W. Wisselink, W. A. Scheffers, J. P. van Dijken, and J. T. Pronk. 2006. Alcoholic fermentation of carbon sources in biomass hydrolysates by Saccharomyces cerevisiae : current status. Antonie Van Leeuwenhoek 90: 391418. 203. van Maris, A. J., A. A. Winkler, M. Kuyper, W. T. de Laat, J. P. van Dijken, and J. T. Pronk. 2007. Development of efficient xylose fermentation in Saccharomyces cerevisiae : xylose isomerase as a key component. Adv Biochem Eng Biotechnol 108: 179 204. 204. Velazquez, I., E. Nakamaru -Ogiso, T. Yano, T. Ohnishi, and T. Yagi. 2 005. Amino acid residues associated with cluster N3 in the NuoF subunit of the protontranslocating NADH -quinone oxidoreductase from Escherichia coli. FEBS Lett 579: 3164 3168. 205. Vidakovic, M., C. R. Crossnoe, C. Neidre, K. Kim, K. L. Krause, and J. P. G ermanas. 2003. Reactivity of reduced [2Fe 2S] ferredoxins parallels host susceptibility to nitroimidazoles. Antimicrob Agents Chemother 47: 302308. 206. Vidakovic, M. S., G. Fraczkiewicz, and J. P. Germanas. 1996. Expression and spectroscopic characterization of the hydrogenosomal [2Fe 2S] ferredoxin from the protozoan Trichomonas vaginalis J Biol Chem 271: 1473414739.

PAGE 172

172 207. Vignais, P. M., B. Billoud, and J. Meyer. 2001. Classification and phylogeny of hydrogenases. FEMS Microbiol Rev 25: 455501. 208. Vignais, P. M., and A. Colbeau. 2004. Molecular biology of microbial hydrogenases. Curr Issues Mol Biol 6: 159188. 209. Villa -Komaroff, L., S. Broome, S. P. Naber, A. Efstratiadis, P. Lomedico, R. Tizard, W. L. Chick, and W. Gilbert. 1980. The synthesis of insulin in bacteria: a model for the production of medically useful proteins in prokaryotic cells. Birth Defects Orig Artic Ser 16: 5368. 210. Waldron, M., and T. Welch. 2004. DOE researchers demonstrate feasibility of efficient hydrogen production from nuclear energy. Department of Energy: [http://www.energy.gov/news/1545.htm] 211. Wallace, K. K., Z. Y. Bao, H. Dai, R. Digate, G. Schuler, M. K. Speedie, and K. A. Reynolds. 1995. Purification of crotonyl -CoA reductase from Streptomyces collinus and cloning, sequencing and expression of the corresponding gene in Escherichia coli. Eur J Biochem 233: 954962. 212. Walter, K. A., G. N. Bennett, and E. T. Papoutsaki s. 1992. Molecular characterization of two Clostridium acetobutylicum ATCC 824 butanol dehydrogenase isozyme genes. J Bacteriol 174: 71497158. 213. Waterson, R. M., and R. S. Conway. 1981. Enoyl CoA hydratases from Clostridium acetobutylicum and Escherichi a coli Methods Enzymol 71 Pt C: 421430. 214. Weckbecker, A., and W. Hummel. 2004. Improved synthesis of chiral alcohols with Escherichia coli cells co -expressing pyridine nucleotide transhydrogenase, NADP+dependent alcohol dehydrogenase and NAD+-dependen t formate dehydrogenase. Biotechnol Lett 26: 17391744. 215. White, D. 2000. Fermentations, p. 363383, The Physiology and Biochemistry of Prokaryotes, 2nd ed. Oxford University Press, New York. 216. Wiedemann, B., and E. Boles. 2008. Codon-optimized bacter ial genes improve L arabinose fermentation in recombinant Saccharomyces cerevisiae. Appl Environ Microbiol 74: 20432050. 217. Winzer, K., K. Lorenz, B. Zickner, and P. Durre. 2000. Differential regulation of two thiolase genes from Clostridium acetobutylic um DSM 792. J Mol Microbiol Biotechnol 2: 531541. 218. Wisselink, H. W., M. J. Toirkens, M. del Rosario Franco Berriel, A. A. Winkler, J. P. van Dijken, J. T. Pronk, and A. J. van Maris. 2007. Engineering of Saccharomyces cerevisiae for efficient anaerobic alcoholic fermentation of L arabinose. Appl Environ Microbiol 73: 48814891.

PAGE 173

173 219. Woodward, J., N. I. Heyer, J. P. Getty, H. M. O'Neill, E. Pinkhassik, and B. R. Evans. 2002. Efficient hydrogen production using enzymes of the pentose phosphate pathway. Pro ceedings of the 2002 U.S. DOE Hydrogen Program Review :NREL/CP 61032405. 220. Woodward, J., M. Orr, K. Cordray, and E. Greenbaum. 2000. Enzymatic production of biohydrogen. Nature 405: 10141015. 221. Wu, L. F., and M. A. Mandrand -Berthelot. 1986. Genetic a nd physiological characterization of new Escherichia coli mutants impaired in hydrogenase activity. Biochimie 68: 167179. 222. Wu, L. F., and M. A. Mandrand. 1993. Microbial hydrogenases: primary structure, classification, signatures and phylogeny. FEMS Mi crobiol Rev 10: 243269. 223. Wykoff, D. D., J. P. Davies, A. Melis, and A. R. Grossman. 1998. The regulation of photosynthetic electron transport during nutrient deprivation in Chlamydomonas reinhardtii Plant Physiol 117: 129139. 224. Yang, K. Y., and R. P. Swenson. 2007. Modulation of the redox properties of the flavin cofactor through hydrogen-bonding interactions with the N(5) atom: role of alpha -Ser254 in the electron transfer flavoprotein from the methylotrophic bacterium W3A1. Biochemistry 46: 22892297. 225. Yano, T., V. D. Sled, T. Ohnishi, and T. Yagi. 1996. Expression and characterization of the flavoprotein subcomplex composed of 50 kDa (NQO1) and 25 kDa (NQO2) subunits of the proton-translocating NADH -quinone oxidoreductase of Paracoccus denitrif icans J Biol Chem 271: 59075713. 226. Yano, T., V. D. Sled, T. Ohnishi, and T. Yagi. 1994. Expression of the 25-kilodalton iron -sulfur subunit of the energy-transducing NADH ubiquinone oxidoreductase of Paracoccus denitrificans Biochemistry 33: 494499. 227. Yomano, L. P., S. W. York, and L. O. Ingram. 1998. Isolation and characterization of ethanol tolerant mutants of Escherichia coli KO11 for fuel ethanol production. J Ind Microbiol Biotechnol 20: 132138. 228. Yomano, L. P., S. W. York, S. Zhou, K. T. S hanmugam, and L. O. Ingram. 2008. Re -engineering Escherichia coli for ethanol production. Biotechnol Lett 30: 20972103. 229. Youngleson, J. S., D. T. Jones, and D. R. Woods. 1989. Homology between hydroxybutyryl and hydroxyacyl coenzyme A dehydrogenase enz ymes from Clostridium acetobutylicum fermentation and vertebrate fatty acid beta -oxidation pathways. J Bacteriol 171: 68006807. 230. Zaldivar, J., and L. O. Ingram. 1999. Effect of organic acids on the growth and fermentation of ethanologenic Escherichia c oli LY01. Biotechnol Bioeng 66: 203210.

PAGE 174

174 231. Zaldivar, J., A. Martinez, and L. O. Ingram. 2000. Effect of alcohol compounds found in hemicellulose hydrolysate on the growth and fermentation of ethanologenic Escherichia coli. Biotechnol Bioeng 68: 524530. 2 32. Zhang, X., K. Jantama, J. C. Moore, K. T. Shanmugam, and L. O. Ingram. 2007. Production of L alanine by metabolically engineered Escherichia coli. Appl Microbiol Biotechnol 77: 355366. 233. Zhang, Y. H., B. R. Evans, J. R. Mielenz, R. C. Hopkins, and M. W. Adams. 2007. High yield hydrogen production from starch and water by a synthetic enzymatic pathway. PLoS One 2: e456. 234. Zhao, Y., C. A. Tomas, F. B. Rudolph, E. T. Papoutsakis, and G. N. Bennett. 2005. Intracellular butyryl phosphate and acetyl phosphate concentrations in Clostridium acetobutylicum and their implications for solvent formation. Appl Environ Microbiol 71: 530 537. 235. Zhou, S., F. C. Davis, and L. O. Ingram. 2001. Gene integration and expression and extracellular secretion of Erwinia chrysanthemi endoglucanase CelY ( celY ) and CelZ (celZ ) in ethanologenic Klebsiella oxytoca P2. Appl Environ Microbiol 67: 6 14.

PAGE 175

175 BIOGRAPHICAL SKETCH Phi Minh Do was born in 1981 in Vietnam. Shortly after birth, Phi, accompanied by h is parents and two brothers, immigrated to the United States of America as a post -Vietnam War refugee with a port of entry date of February 1982. Phi spent most of his childhood in Panama City, Florida where he graduated from Bay High School in 1999 at th e top of his class. He later earned a Bachelor of Science with honors in m icrobiology and c ell s cience from the Department of Microbiology and Cell Science at the University of Florida in 2003. Upon graduating with his B.S., Phi was accepted into the Ph.D. graduate program in the same department under the advisement of Dr. K.T. Shanmugam with focus on microbial production of renewable fuels and chemicals. Phis passion for teaching led to mentor ing numerous of undergraduates as well as being guest lecturers in both undergraduate and graduate courses. In addition to his graduate studies, Phi was an advocate for student rights and fought to make changes in departmental policies. In 2006 and 2007, he was elected vice president and president, respectively, of the Microbiology Society for Graduate Students at the University of Florida where he coordinated the annual Graduate Symposium. Upon completion of his Ph.D., Phi continue d as a post -doctoral research associate with Dr. Lonnie Ingram, a worldrenowned expert in the development of biocatalysts for renewable fuels and chemicals, where he hopes to continue the development of his academic career towards making a global impact on renewable energy.


xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20101221_AAAADR INGEST_TIME 2010-12-22T04:39:16Z PACKAGE UFE0024891_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
FILE SIZE 145824 DFID F20101221_AABZPC ORIGIN DEPOSITOR PATH do_p_Page_169.jpg GLOBAL false PRESERVATION BIT MESSAGE_DIGEST ALGORITHM MD5
ad8c9bf34da25758265b8832fc493d10
SHA-1
a21f5d3430b2b19952c4c14989e1b92fb2c3b03b
113059 F20101221_AABZOO do_p_Page_086.jpg
87884a0e62241c4b8a366a9f0bf595b0
cc4314d666d1c12c57f2fd745dd51f38d8b9e402
56049 F20101221_AABZNZ do_p_Page_014.jpg
a247c26a6a0a3879aa878aa46c5851a8
ddd7a88aeba09c22eefe7a2436a4b51b62442e4e
1051980 F20101221_AABYKX do_p_Page_009.jp2
d46f21d00841dc68f1b3a82e7d2b9944
67c70758d1041a6bdb21e2b68a1598e9d2347b19
35129 F20101221_AABYMA do_p_Page_065.QC.jpg
92e0b5fba269dc6b3ea6fa629e28918e
1ef760bc33155ef09f9a848c1ea7eaea4db643bf
134571 F20101221_AABYLM do_p_Page_172.jpg
0cfe1888d395b1e37543d53c53a24469
e0a245ccd0b6fa06c0fb6dab7385bd926343674f
137132 F20101221_AABZPD do_p_Page_170.jpg
18ea498bd919e802bd4923b8d6a40326
08ef0853780b692e7b739ff54096560378be0b8d
113480 F20101221_AABZOP do_p_Page_087.jpg
b84af4e30f0905a61dbc6a29dfae79a7
a4a64700fc674c5052f35f52906e3adc108066a0
2186 F20101221_AABYKY do_p_Page_046.txt
96dc4f6183fcb2e8436d43856d3b0b31
2f8f886d4a5beca3095e7ded8019c1eb73c2126a
5348 F20101221_AABYMB do_p_Page_135thm.jpg
1afab2ea038634d4b66f87e45df08736
4ff96db836f07a12c500ea09b4f309ac0adb9d61
57845 F20101221_AABYLN do_p_Page_107.pro
36700d0362726599bc8c5c24b64bd8ac
1ba9933864241dfb231e0459ce3c2247e3159141
144174 F20101221_AABZPE do_p_Page_171.jpg
84ee57b256c8a86288709beb1e3edd85
bf1d671c027a38cc2c0fcada36597d60affcd03a
52727 F20101221_AABZOQ do_p_Page_090.jpg
48913e858b16dd6663178b879d63e5a2
2a4f31c61f3728e119c41e0083b7855bbb9793b8
309 F20101221_AABYKZ do_p_Page_016.txt
0624a1c6287452ad48d6666a638c2327
319bcca02b00e362069cb04dcb0a05b674eaac1e
33232 F20101221_AABYMC do_p_Page_030.QC.jpg
c89a0e181773f21773182ee0a252301d
eb21fc6fa217f3f0029aaae03d260873f8cab01c
9066 F20101221_AABYLO do_p_Page_060thm.jpg
55949cd262523f74a57857cc689edc59
ea27adf3057dc1233b7901df4df2b7934c9ea4a5
264233 F20101221_AABZPF do_p_Page_001.jp2
1b89254f0b631fbba08374a66e4e9070
d2dcff745c0286f8c362149f51a9dde5d99b44d8
74299 F20101221_AABZOR do_p_Page_092.jpg
654f235a6b396b7a51c3575e494fd048
7e69ec3ac81958eb4ec2a4468da70a8c6596fe3a
957 F20101221_AABYMD do_p_Page_010.txt
a5b19bdf194ab3e445a55af2c2d15055
d76fac97f61af05ffe8c32556aba2141362d658c
48038 F20101221_AABYLP do_p_Page_053.pro
81f26f147f273e970f116d6cadb0e781
0a4f8fc2c917800bcb6dc413817223ddacda5409
123424 F20101221_AABZPG do_p_Page_016.jp2
91b67488a6315ba5f85bd5beabef803c
9549783e0f33c2c21d8e21f8d911dbe34c04ff31
53695 F20101221_AABZOS do_p_Page_099.jpg
039518e4ac9c0ed20435be23f434b8b9
fcb4a421d6e99064211fee2447b097d9fc717faf
25271604 F20101221_AABYME do_p_Page_087.tif
bf95d2a3bd93c51bd2531351a6558394
61bb73d29691cfd3455039bb2c8c7d4e9b540173
50812 F20101221_AABYLQ do_p_Page_034.pro
d5172946531c8117be7929021d2487e9
d1c1a2d041f79d8e2c238a6192e6cab4fa127303
1051955 F20101221_AABZPH do_p_Page_017.jp2
d3f642bd7ae192730b34b5ad0377e709
69d97a96316ecb9589168bfe56790b23e1149c08
111042 F20101221_AABZOT do_p_Page_105.jpg
d0a6747ec5d00ba80868d68b722060e6
4d77132b29c843af89f95d5cd281968b4afea9de
55740 F20101221_AABYMF do_p_Page_106.pro
3aa94e31ecd29f9e9a5541dc175dac23
946c753667ff910f0c4adbbfdb0fad9fc3987842
38695 F20101221_AABYLR do_p_Page_076.QC.jpg
1374594b6d44403dc4657d47dcda2c45
1880273680cd42f207bf019e42a551d58c9299bf
664752 F20101221_AABZPI do_p_Page_018.jp2
ad4dd622dbe0a74a40358ca5c3032439
96fb6239c8115cb6f97b0656c1e290e94cb158b8
114967 F20101221_AABZOU do_p_Page_109.jpg
49c41bea07e96f21c64cd055d6bb0584
dbec939a33c85af24ba24dcd5e5c3f6fa9a63861
F20101221_AABYMG do_p_Page_071.tif
20f3c882f1f0ffddb73e60a8a7162ff7
57e98d8c127d01fc754471a41d758371c452af75
1051970 F20101221_AABYLS do_p_Page_026.jp2
98c38ca38678dd09e1997df90a3c6040
7a3360cbcf0073c27d392960d15d7d243ff2c7f4
1051975 F20101221_AABZPJ do_p_Page_021.jp2
7bf80d3435e422c6dec07bcccaeb8d2c
4f64b991653b34c43802fc6d76d9a00af68e3388
107347 F20101221_AABZOV do_p_Page_114.jpg
e04d04bbe2387ab9056a5779e7c69baf
a6b501da52884b6fcacbbb8b0322daf582b20eb2
35251 F20101221_AABYMH do_p_Page_044.QC.jpg
60d7ef866cf261b202a93292910fc3dc
8f777d10bf6f8dda59f5d042461f4314e71ad9b8
F20101221_AABYLT do_p_Page_144.tif
8579e7172d718c53ad8fa20455c8deae
d04cbee82ffb8bce98457394b0a66bc025242a40
F20101221_AABZPK do_p_Page_025.jp2
5fb72c941883e7a9eef8fa714d7d1fb6
e6e4247b329b2563b4753ddab0054468f8197120
76003 F20101221_AABZOW do_p_Page_139.jpg
197e277f761df4fb061b44cedd877eb7
6cf8b3d863d0d1b66d5397e32ad3ccc9c973caa4
F20101221_AABYMI do_p_Page_017.tif
51a2321bd2cc7f0024ad1ad87444c66d
06c3b5fbe62d02b15335a2d540fe60191adcf4d0
105880 F20101221_AABYLU do_p_Page_037.jpg
79da51b8237d0c77ed47689af5151c38
e9a3fb09df1501e29f47292128ffaf1d400672ea
1051919 F20101221_AABZPL do_p_Page_029.jp2
09154ae4c098e23fc0bb9f35567e987a
37274cf2386c1a301e4fded711149c3b1c890b2f
56910 F20101221_AABZOX do_p_Page_141.jpg
ae8f812584b4117ba851e0f3d24c2557
3069a3121bb5d393ffc250399cde07633772e050
8971 F20101221_AABYMJ do_p_Page_082thm.jpg
af97f329c7e3c32dc7ae45cfe96f5c80
28bdb7aa25c5428ee168b45a1fd131af70c22f23
836917 F20101221_AABYLV do_p_Page_124.jp2
37341e21db02018dab6ebac84cf23a51
4594c43d8c9675fa78f5febed76afbc7e481c3b1
474154 F20101221_AABZQA do_p_Page_099.jp2
4be2fdc986afbf20664f9c52803ac8e1
fd4d6c87d0d5e7e262302959997ebef4f41fb149
1051942 F20101221_AABZPM do_p_Page_030.jp2
f87de0be4209d431f9355ee445e10e46
6a81db9de472fe1a934489e52aa681321637eb44
131388 F20101221_AABZOY do_p_Page_160.jpg
ec8c5c3658a17f41ebc548776c8061fb
79bc31d5722c0cc9d9149695490a8e3d66a8fd56
28559 F20101221_AABYMK do_p_Page_175.QC.jpg
b0ce0fb9d5b9b06341ee3b79378b38c3
5e26dd6f3a52412c52456f9c80b2973fc612b1c1
F20101221_AABYLW do_p_Page_039.tif
83c0e119546a63d1d32a0ec4f140723c
6e56a245eb49f6cf9f2c1f1125dcaeb64af50c43
1010594 F20101221_AABZQB do_p_Page_100.jp2
d328cf29391c7d4d0ec1195617aeb95b
8e88cb510201d53337f1957ecd2a04060bc6a33b
1051948 F20101221_AABZPN do_p_Page_036.jp2
301d5e26940d6c3a2765b81b6bb569c7
081e518d18547976c250bf1edc870ebb7ace6a5d
142868 F20101221_AABZOZ do_p_Page_165.jpg
00a2188fa5824387dd20dddc2f64d27a
a4386372f6c64114ac0d5b1832bd0ded97b312d1
2768 F20101221_AABYML do_p_Page_157.txt
3f6270ec2a05dc08415eec1bf52268fb
d6090875b9c0a4d78ee80ad93767e0c56c3005ea
59677 F20101221_AABYLX do_p_Page_161.pro
5a1afe9486f1b13e780712a2185162cc
9f350b26b181ff20f028dc8dc179bd527ad21942
859532 F20101221_AABZQC do_p_Page_101.jp2
f483ace738f218d56d1672b218feeddd
0e6e0d576ce6bd9aa27ad01b44fe9c500a150026
1051963 F20101221_AABZPO do_p_Page_038.jp2
afc44b51d6bb69ae7934b7f7b7e16366
2d4e3c12d9824d390cb22045522bf5efe04856a8
4816 F20101221_AABYNA do_p_Page_012thm.jpg
42eb5f060b204bbb6b965fb9accf94c4
b1fefafbfa6592426a11d9b4f263b495a14fa8c6
2004 F20101221_AABYMM do_p_Page_026.txt
a18f472f50bb13e4ac3cc36ed54f6c22
badfb7401646aee9c0096db603a8908058fd50d4
1051901 F20101221_AABZQD do_p_Page_104.jp2
37b682411f2baa6b6fc74c7386c35790
1761cfa99ac2b8818a45d9155f62c2270b667c6f
173927 F20101221_AABZPP do_p_Page_049.jp2
f9c05d917a1ae744c0fb8ac087a48d39
30433088ba3ad1253e12d66f5ad237fb2f79aa59
F20101221_AABYNB do_p_Page_113.tif
6ca06c3a815b5cfeb63ea8565f6b495f
508bcb457013bb78df7d97fd0a79870fb18cc559
55347 F20101221_AABYMN do_p_Page_108.pro
bb01ba5e877eff5dddd13e62d562c67e
a1096499ea322f6c340a31ee05fb59b70dc7abe9
F20101221_AABYLY do_p_Page_056.jp2
d5fc4ce6ae8d9e0064d56bd363c3e954
e83ee6c29c2a4b38bc199fa83f77ce33e29e1c5a
F20101221_AABZQE do_p_Page_111.jp2
fbe9eef143cb48ece77fb1650924c4bb
3f0418bad4f65482cbfa7aaa4577e7e09c2ee525
F20101221_AABZPQ do_p_Page_055.jp2
151e35c8167b252065896e1b1cf00653
d70aa9c26fbb803e334358cc80a528affb2dab20
34832 F20101221_AABYNC do_p_Page_111.QC.jpg
bef0736a488a4d1f83062c047bb7dace
1c80b417e20d301e8bab95d5af4e893fc225f7ae
F20101221_AABYMO do_p_Page_126.tif
67f2b70d15e7e19cc7171593d657baa6
976d1778bb6501e6684940e4e40f0a299d039372
1051929 F20101221_AABYLZ do_p_Page_113.jp2
85f08a22e9818b2766afa650d3301293
ba9bcfe1547712ee8313bc06dac4803330eb8f40
1051931 F20101221_AABZQF do_p_Page_115.jp2
81e52c50c539958e19fa6f734c996f85
695c2110e415f4f36bc94fd60c068f2b57dc5a30
1051972 F20101221_AABZPR do_p_Page_065.jp2
08c273cf23d02df07e872d1cd2ed5b61
064c2e9929f4d1494e06d4a76ab321d03f3e8083
F20101221_AABYND do_p_Page_037.tif
3c4f1c1b0d4151f4ffc57a65eaf87cd6
650e71df0668b3aad461b95bcbeb84adad5a627d
36843 F20101221_AABYMP do_p_Page_167.QC.jpg
3840367645e185bf83b15534a8e20cc8
ad232914fb4c524900e63c57fda4a76b1cdc94f7
1051958 F20101221_AABZQG do_p_Page_118.jp2
d53819229f15fb89eb6b874670e77e2a
d650c2cdb78f2b0023f630dda04d921350afda24
1051937 F20101221_AABZPS do_p_Page_071.jp2
45ce8bbe71bd33edc51f9e8d8d4fd140
8e75053ba51c3e3b093611cb73956f77c33b785f
1051961 F20101221_AABYNE do_p_Page_087.jp2
56542325f9d41fbc59d2083e8189b619
9464da35b69ede0ae74a69490a05d55be2e470b0
F20101221_AABYMQ do_p_Page_165.tif
fbc94bfb9b4c2815fdbb8462fbca314f
504f0d751ee5fc9a5e141d22c49e4e32f7ca8ea8
463254 F20101221_AABZQH do_p_Page_125.jp2
4303a129a40dbe2aea094351782a4129
b6966fff7785e65f47ee06f5fede1c78cb5d4abd
F20101221_AABZPT do_p_Page_076.jp2
388bca0cff1a1fefbdb9e836203ce5fe
30edb2e651dc2528fc4614431aa04b0aaa456090
1051976 F20101221_AABYNF do_p_Page_059.jp2
f6bb8362e83c010ac42582f272536115
ad928275264809901ae1431f207bd8ad0600dd0e
16900 F20101221_AABYMR do_p_Page_089.QC.jpg
d629bcb7817a14c0d6b453b3f3786cbb
13d9a5cd825847db9d0f12708eb0bc7b31012e6b
540461 F20101221_AABZQI do_p_Page_126.jp2
a14b7a15bbf5f0de8c385f42ba7ff19a
edbe20c4957e7d9e4ee89f707b8b32c03ef40fbc
1051956 F20101221_AABZPU do_p_Page_082.jp2
a80ca0af33085bd188a770b9cdba0813
65395a40897e56387c337446689ce5d53881f071
27512 F20101221_AABYNG do_p_Page_142.QC.jpg
637c233c7ef3a329a3474a6d25a1b9ce
95eb570c6ab54c284b0fc9f441ee96eba3b6056d
7455 F20101221_AABYMS do_p_Page_067thm.jpg
e0556623c232db9e361444a38626ce57
a4485618e2dcd121189e4bbc6c84b52d7cb5b7bb
307409 F20101221_AABZQJ do_p_Page_129.jp2
40bc48b283dd81ea3e8a95b44a82cf3f
5b5ead3b3695ee2ae4035928f98ebd065fea8fca
1051951 F20101221_AABZPV do_p_Page_084.jp2
2fa8bf3b2f3ee24b18936ab962957c8f
2dd26beaf1e37546ad0d4d154022e4aecfb5ce66
112572 F20101221_AABYNH do_p_Page_119.jpg
e2facd4a35eccd059550c34c2c5d6223
46b755dc44c80422b7bc8a996db3c7aa98c9b010
1051979 F20101221_AABYMT do_p_Page_085.jp2
d6e4a911222fb6c201457492ce26a165
bb8545e05ea1190c9a4e77b29a1e214098d427c7
221634 F20101221_AABZQK do_p_Page_130.jp2
03d4fd9e703f4934d0e22a4e2695393f
2f32daaa37596b429a71e3b7056953873f1a5964
257922 F20101221_AABZPW do_p_Page_088.jp2
a32e0b83105e619c8ae3b49d0912f400
2b56dac9ef372c4c8ea90fb086e04738e405170f
1051965 F20101221_AABYNI do_p_Page_008.jp2
06844e68762181651738d8f7041704d5
a9340021be9133baaf5f5e4a5210e77d947393c4
27010 F20101221_AABYMU do_p_Page_012.pro
09608e0e417d7022d44a7fb43dc63387
373b1125ee24323542d5b053e40abe8cc3d1422a
465329 F20101221_AABZQL do_p_Page_131.jp2
2480410c15aca7ed8e04d2f97c3b537b
d26604dd70b35d8c545d8510046c0e6f916d2fbf
1051978 F20101221_AABZPX do_p_Page_094.jp2
8e00add4fabfd3ec129268cd4288c384
7a34df94dc31f580c228a5681664e2b270dd17cd
22716 F20101221_AABYNJ do_p_Page_139.QC.jpg
6f50d7ae35a9b0f727120c5d2f7b6383
8086d42d03b216a40e6ca46a0506908261574dda
F20101221_AABYMV do_p_Page_115.tif
605bb3a3725dc5f7e1ea8905aea1e6dc
d09993ec1053fd0d19bf1b39843e6bf1dc222bf5
F20101221_AABZRA do_p_Page_021.tif
2897e29c6c3d2467fff1fdff5fc630eb
4db07f469d572268433322494292441370f1340e
465647 F20101221_AABZQM do_p_Page_132.jp2
80eba5655c2ea6c141c4f683dfc5d311
c1060de2e699b6627907f2e0201c9490a247d5e3
1051974 F20101221_AABZPY do_p_Page_095.jp2
b70b0a369b9ccb1fd064ab2ea2db0575
7375d890caf42dd465800d9bf7da3f15e9bea155
1875 F20101221_AABYNK do_p_Page_131.txt
0d30014840e7a1542d3d318c793e580c
b40d705f7ca9063d99936a329b37b1b045a9339e
1051981 F20101221_AABYMW do_p_Page_093.jp2
d8572f81e87d8eef21e02aa19f2d29df
b9311dadd0bb75ee870022f6ffb0b2c6328e7ffb
F20101221_AABZRB do_p_Page_023.tif
8c709383f7203ea4a288e71232879853
d034029bd3929b6355a393a57350a7465363ae0e
259591 F20101221_AABZQN do_p_Page_137.jp2
e03675d63c23b68f65a6be1be05f7364
98f1b6f82111638e9ce66ba91979d75d06ec626e
436857 F20101221_AABZPZ do_p_Page_098.jp2
22ea0f79c96ba6775ecbb4e67ea15063
29dc4200836a43fa60343ad1dc0a4b85379b57ef
4444 F20101221_AABYNL do_p_Page_097.pro
331ff43b5cee106027194db06c77557c
ab79b242b6ea850f4ecad42271762711a6548220
953829 F20101221_AABYMX do_p_Page_175.jp2
9424b4fc35727be321cde1ed00cae3c4
1dfd68539d7ec688823866dcda8de6d04660969f
F20101221_AABZRC do_p_Page_024.tif
860c98c992237c07e7cc96a6148dd40c
2cb473a4574c98019eb9f0b0d6e7d3afb41efebf
512991 F20101221_AABZQO do_p_Page_141.jp2
3dd261563ee78b83ea9093c967727ee1
19f98cd8fdac405b4c2e4667e4b1e70c02557c1d
53932 F20101221_AABYNM do_p_Page_058.pro
7b818677f2b1dfa66a11854e682b9ef9
ac90b39724b914d4b73d961879fa63055501d0a4
9107 F20101221_AABYMY do_p_Page_086thm.jpg
7debe4b886f4edef8f79d5d343b5716b
7084cc627b7e98c280bbfe13bd07390d92375fcc
22566 F20101221_AABYOA do_p_Page_147.QC.jpg
c438675dd80bc7459cface4aa8673353
29c91a06bb4ace49751fa2b6f3d5f264bc61aa91
F20101221_AABZRD do_p_Page_031.tif
6b2bef63ed99733c51df00c77817c2b7
6f6e02fe09357ac4515b9f3264ee78a066b668ab
1051936 F20101221_AABZQP do_p_Page_148.jp2
6771a61a90c59d6737259caa00e9fccb
df1906f7fca210850624fe7d3ca803f4f3c4189b
4137 F20101221_AABYNN do_p_Page_090thm.jpg
b1c50c1ba3d4fe5417ff60c27a26fea2
beb32b10ee98ad06043834941690e3b666842432
F20101221_AABYOB do_p_Page_075.tif
9d717e7727d2c4f0a7e32742808f5dc5
54ef39a84f3abb58c5ffac877bd8bc0bea7cf9d3
F20101221_AABZRE do_p_Page_032.tif
aa5702c1610ce2e9671c605b9c37665d
56824f13ef946f17b3e2c3cb2c2bd06ef4befc32
363222 F20101221_AABZQQ do_p_Page_154.jp2
8dbdf54981ad9124eb58dfbfabf112eb
f55f9a2a766c821824922e5ff8b88bd9cc7f5b13
F20101221_AABYNO do_p_Page_038.tif
4e939715bea3e1a92ef21e6f2852f661
65672e1b49426891c50c32c33b2ab859dca53f25
8740 F20101221_AABYMZ do_p_Page_064thm.jpg
bc890e644577fd5cccb10bc8da28cf4f
71370f4e91be55313f0c1ed90066e4de37ce9f0c
F20101221_AABYOC do_p_Page_047.tif
54e22ea3a9911f04e426cb94ccabead0
991d29bcdd5fa4b3431566e92f182c397b0f4693
F20101221_AABZRF do_p_Page_033.tif
6d190bb86567b187818ffa271e1e9b21
fa692b0e817147b1dbef0475b39da8b5d1cfb10f
1051938 F20101221_AABZQR do_p_Page_157.jp2
e790a1800d381c5fbbd88f1bac4730a3
9d424f2006680742365262e9fc8a35755c009636
55114 F20101221_AABYNP do_p_Page_036.pro
6d1d00cb197ef85b291b9c3e50cf157c
144281d733d92293367401d3fc75b0094ee9640c
F20101221_AABYOD do_p_Page_148.tif
4d4106671ed15d80e5dc97cec70c428f
6af0102cdd241e36e1c04ac1cb61704246cde571
F20101221_AABZRG do_p_Page_035.tif
8c4301e57bc03d8a4a6d620efdb02a9a
1f27402d751067e238d6be206985012768e357d4
F20101221_AABZQS do_p_Page_159.jp2
6e498815ab13c5a6421d2a18d5254636
d1736302293bacd864079d9aadd98ca97c87cb56
1051917 F20101221_AABYNQ do_p_Page_105.jp2
59bbfc5c5fc6d891d597544dccb7078e
c4c7976dcb072e1efb4e658639cf4f739ca222d2
2989 F20101221_AABYOE do_p_Page_009.txt
b968fbe39bb1d27b5c6c7ed1571fc705
ba82eda5d94c44bdcf4f6d30b0a9d0a0fa46bb4e
F20101221_AABZRH do_p_Page_042.tif
94c9eecffc9e0a5109f5c226d2fae83f
642f0f7b043c69a2959d6b7d74588ede9224dc73
1051909 F20101221_AABZQT do_p_Page_162.jp2
d3b8d0a28de31964caee29da6e0859e3
2f9479e11b5baaa568d220ff9f2da9caff4fc781
36521 F20101221_AABYNR do_p_Page_031.QC.jpg
c9049c53d0940032f641b85e2adc29df
2feed4987488d978c98a879ce559d976d84e68f1
F20101221_AABYOF do_p_Page_004.tif
80804476cd1a0623e5104b06e8b9c18e
219fa704e516b945b99686f0de18ce906686cc9e
F20101221_AABZRI do_p_Page_043.tif
7bd8b7be0c70105664d27fad5482aebb
459f712dacc1ca425ce6cd144f30b280827b145f
1051977 F20101221_AABZQU do_p_Page_164.jp2
dca2ae38f841162f609e6ae2e66205d6
51df68e799c605f634cf40ae92396b19d4318e56
2123 F20101221_AABYNS do_p_Page_105.txt
ac503401ce2877101469d57999a7b23c
14e6c790f5ff7fab05a3da56405f03b96a519e1b
38981 F20101221_AABYOG do_p_Page_074.QC.jpg
243c9bdd35bde7b877f1284a0dd7bc25
db6b9b79e4b933092a302e3563d209511fe7260a
F20101221_AABZRJ do_p_Page_044.tif
86e138ffc9b3d7418178a5576893bad1
9772e555d9352d602a3cf937f619aec45d3d674d
1051962 F20101221_AABZQV do_p_Page_167.jp2
4db9ebdae00e1d9d6efb5b6c570fcb48
4e162b2a9dd6ee372aa93cba3b1562a5ecd01f91
55697 F20101221_AABYNT do_p_Page_076.pro
44a8d4e3bd5a67090f5f9568f61e4567
3b8e5617c3bd3d81ca4ae83b3874ce291b0c0606
113541 F20101221_AABYOH do_p_Page_033.jpg
13e41e42b591414dec9022174a03b765
d16f182c10890c4369ea37f894d1554da7d3500d
F20101221_AABZRK do_p_Page_046.tif
37e67bb48e044998a0c3462e3d283af3
7759825ae0340e518c10780c568536fd75984010
1051925 F20101221_AABZQW do_p_Page_169.jp2
bef471b396ad95985a7d158f857cddd9
e70281141afa6cd789336570e506cfa1ae798509
8848 F20101221_AABYNU do_p_Page_031thm.jpg
2ceb57409128678ee05e753e34651505
5a62270550826a13a4abafd04faafd63f2d26b87
12749 F20101221_AABYOI do_p_Page_096.QC.jpg
82365f0cd2a808e132155d125f7d6d3f
213b781ca3e45f379db3ca4bc3d66bdf2e9d580e
F20101221_AABZRL do_p_Page_050.tif
50ebbf09f76943268f4a5a6872ba9ecf
726275cacfbf413e57d72eeddfb03eb42aeacf62
F20101221_AABZQX do_p_Page_007.tif
6821fa0b962ed69c87fd5e5364d5b4e6
d2af20cb104d0eea7576fefe01a5af0613d8c3cb
84706 F20101221_AABYNV do_p_Page_069.jpg
440c94d5815d7ce67aff1765febbd5e1
5cffa2a5ad43c9ff3975717419f6d52c763ca0a3
15831 F20101221_AABYOJ do_p_Page_155.QC.jpg
8a26aeda3dc5c367af0fb99dc0583fa2
08c82c62acac87a9ff18fef8a939be001183d010
25265604 F20101221_AABZSA do_p_Page_134.tif
b396b76355378143ed46031819d51556
748776b05a4fdbe7f9f679c9a3ec7430531ed569
F20101221_AABZRM do_p_Page_051.tif
eb32aaab07092d1cd4b7926856e6b058
4186ad6053c62733461042fd250b767485e5ae1b
F20101221_AABZQY do_p_Page_014.tif
c5eaedf05e0e3de5f4b2bdb0eef5792d
01cd7a0c8dee2af9fe89643d1432dd0ccb024419
F20101221_AABYNW do_p_Page_019.tif
ad6eb55b63880e9985b07bbc1d1ad22d
5951425a0945a300a445dcd34322216534ca987b
4827 F20101221_AABYOK do_p_Page_094thm.jpg
3d9003a7b63f9641b90f392e9be48e3f
3712e97e5a4416910b1eb488862aa8916a642565
F20101221_AABZSB do_p_Page_138.tif
9799136f3442464999e66600be433008
b46a3ae1df62bdffe34d7f1711767c43915bb09b
F20101221_AABZRN do_p_Page_052.tif
c238805b0a03725f548f5850bb19c03c
ed908c37c0b99ac1173a904cb276752491c64ef5
F20101221_AABZQZ do_p_Page_015.tif
8370da9290284a3203a741eb347b7fa3
d1bb710eec1802918369d67a1608727ad56ffbf3
36934 F20101221_AABYNX do_p_Page_048.QC.jpg
8a0613fe8226afbb74f528f6cc92df0d
22fa992b3f525cb5fc95cdd9ff23a281517251b3
107588 F20101221_AABYOL do_p_Page_035.jpg
de0a5f89c90e50e8e37cbc51cd434b5d
6ad9cf01426b7a5fd9063537a26a7b38a94ff195
F20101221_AABZSC do_p_Page_139.tif
0db8a68794f37428727bbc2f6dcc264a
a932e71862ca292cca565f1603480c2061d206a4
F20101221_AABZRO do_p_Page_054.tif
c2ccf6e972f06a7638bf127458fe227a
7e4a2f25302170bea85d4b83898fa6644308b03a
1485 F20101221_AABYNY do_p_Page_124.txt
86d19daa8d314b3192f5b46423bd5609
7b3f705632e5e3beab701c0be02ab50a1a34ef38
78011 F20101221_AABYPA do_p_Page_124.jpg
e5d61eeff504077950997ce14d3aeffe
f8ea6fbb30d892df49caf101814b4c340785b12c
F20101221_AABYOM do_p_Page_135.tif
7c0c3795783f5b4aaa71fce1d48ce8e2
5456673c564fa59047c3db581dbc169487403992
F20101221_AABZSD do_p_Page_142.tif
5aee6c55c74f694b7bc3d1f4d4ee5828
cdc4b25158933dfc7e82bec57488730644eff7e1
F20101221_AABZRP do_p_Page_064.tif
c919c062c786da63bc1a40d9ca682076
a3512dfd609d941471da4ff6ad313aa25439c16c
163988 F20101221_AABYNZ do_p_Page_006.jpg
38a79539e832e465d9734ad8dd1c630b
f20d5883411da50ca2239a3950ae1f4d2c5ade18
F20101221_AABYPB do_p_Page_028.tif
79f824d77b3df158447b9c670b157d16
9cbc4ffcf8b58a097304de28b5afe9e02a878372
F20101221_AABYON do_p_Page_124.tif
208ae258cded22c8b22e54d15b004cb4
2ea0b74ceb2379e31d72d2db57d36dbc4718d010
F20101221_AABZSE do_p_Page_155.tif
0d6e0bc6df3f87e3b3129d778b90aea0
d9f0d1609843d9da5c56fecaeafab06456b12bb5
F20101221_AABZRQ do_p_Page_068.tif
296ac1dbfcc6d943d0098760b88dec73
9c89f4067675ea7ee3af4a8b959ad8b1aa9c818c
F20101221_AABYPC do_p_Page_034.tif
29f10219432ec884db862ab47ae781e9
e8015a84b37755b72314b340b4bfac6b0df95d8e
27464 F20101221_AABYOO do_p_Page_139.pro
a5c079701c51a8876fe7a9afffdaae5f
055687c9b01ffd18a71dcccd897afc63585e2be7
F20101221_AABZSF do_p_Page_159.tif
21e62a9d81d52ad0168f225db56ceec0
bd1a552fa58ad4cd2a1ed68e594a087e2efd3525
F20101221_AABZRR do_p_Page_070.tif
55244ff428a34de5aa0d85cc14788e50
51d145db6b820d7c86a011ef2cdf0aef6f92ef8a
51972 F20101221_AABYPD do_p_Page_035.pro
3478a2a208d06d82de2949dd21ca82f3
668319ff4f977639a0b97031a83cf3b9e8c912e3
16721 F20101221_AABYOP do_p_Page_135.QC.jpg
ab06b1cad9598c827891817d5bb45630
1394c7a5a95cdeb6af198e51482362bdb63c011a
F20101221_AABZSG do_p_Page_163.tif
f92f5997bfeca6aaa010448312c8f5f3
ff7901f06303ebaa76668dee3222ad9ce329a818
F20101221_AABZRS do_p_Page_073.tif
4e72144af2a5864c1fd8bf139a9cd209
f8239479bcea1708a4c297daf601199fe32cbe3a
107114 F20101221_AABYPE do_p_Page_065.jpg
3a3386c82fd8b735e4fde451ed3d4370
5681cf86c02e9a0a01030a457afcfd6a4464fa07
140304 F20101221_AABYOQ do_p_Page_163.jpg
43d0e4748b333d4067a3c364766f7f6a
9c2ef5c6bf40ab251e83e05fc0a73ce3c8e97c02
F20101221_AABZSH do_p_Page_164.tif
54e74417e1d3d440797733a80f9dfa08
96ce665e4a90d237bd6a9684bcc6e7d4161ddef3
F20101221_AABZRT do_p_Page_100.tif
726c0459166052b302aff1111531bde8
be39309abad21571a5c96d559b0906a60e211b5c
7280 F20101221_AABYPF do_p_Page_049.pro
a4a86ebad380744c9bb27c47a05e5608
7194d952471890b4798d5b83c8d446d7f6975ea3
F20101221_AABYOR do_p_Page_042.jp2
7b3c875a6a28f24d7190c6980367c0a4
0fc034eefa0230632c890059dc0faaf93f5a888d
F20101221_AABZSI do_p_Page_171.tif
a5d43e5a0277d0630922db1a9377cfe9
3ec5f523747ab34cbe7212bc063c7d42abced92d
F20101221_AABZRU do_p_Page_102.tif
359825b2cdcc901f6e4b633ac35b74f8
c99728bce5830705d64f40adbe2a53f6c45fb3b9
2172 F20101221_AABYPG do_p_Page_029.txt
19b3a96a21d8d26ead5f52d1dd4e23e2
3968d5bb6931336f929ab9e71e921f920dcedf01
51692 F20101221_AABYOS do_p_Page_080.pro
78b72e878d1923df10ba0e1d63deb98e
fccfdba2aebbbd19b397376efe5f6574a2a24a6e
8758 F20101221_AABZSJ do_p_Page_001.pro
04e27e5b435937ce9927905b19df6332
8dc62edecee42f9b3d9a3bfc4b83d91ce2a60cf9
F20101221_AABZRV do_p_Page_114.tif
fe4e46e12f2d420b225e3ffdbc0fd726
5e290ddfbe4e4a8318d29fae8531550145796f6c
1051865 F20101221_AABYPH do_p_Page_158.jp2
6f37ec0748bba56eb98ecce8b0d710fc
6c69cda5c671feb091abd0d95bb41a4425f0a17e
65986 F20101221_AABYOT do_p_Page_158.pro
e6c3cba80ef0d4a05905d6b792bf3b7e
05de917a1359ce399dda3dc0f18b64a33c6b77ea
3573 F20101221_AABZSK do_p_Page_003.pro
3ba1350ca5d175a4897c846ad2167df4
72fede704c4bbd05c4f72bf46455dae51a1014ad
F20101221_AABZRW do_p_Page_118.tif
cbb27fcefbc188b083b70c514c8dac92
d96a2e0d0f638721e7409be68d5b3f10eea7f35d
52828 F20101221_AABYPI do_p_Page_084.pro
4c4e01710c35904bbb0a91d61c4ecea4
34d61d68b5fa1e9a33674fb47c460e17186ea376
1012620 F20101221_AABYOU do_p_Page_079.jp2
25b5d88d31c6c29c9773d47a67e22ce3
57705e16eb51f87af3d3e39abfa27259b85bb972
74213 F20101221_AABZSL do_p_Page_009.pro
f12c88d21c88ceb2e5fa3cca0fa0cd70
6138b22bea6f31d3b96f1dedbf97da1592600850
F20101221_AABZRX do_p_Page_119.tif
469c553bbd46d38aaa8188c97841fa8c
5dcb06e7cb0a701f1877a4ecbe636f7a23d90505
11776 F20101221_AABYPJ do_p_Page_134.QC.jpg
3d7b029872ef696761d2aa6ac9fa5205
0e4688f1a490a00aa2ad995b974e676da70c7716
F20101221_AABYOV do_p_Page_093.tif
d79a32ad9c67a6fb466a3694e4650ee7
00de7b420d6b5c715e42c764b3ca88b38256f096
49144 F20101221_AABZTA do_p_Page_072.pro
5bb3f082c828adc9cbfd76ce1c79a858
0bccd754a7e56ffb7043ab84d17d42cdd87d519b
24116 F20101221_AABZSM do_p_Page_011.pro
530244c63c40a2eb8b091313250d57af
3de30aa3e86c5ba83f3926a67bd838e0048436f1
F20101221_AABZRY do_p_Page_123.tif
847040d4c61bd91d521c04bffd4a4ac7
f3afdf8d7ea4587d20a73d783ea3d6a3789aa83a
63327 F20101221_AABYPK do_p_Page_147.jpg
9d730abb29e184bb007922eabe59c1e2
91434f264bbef86629cc06882d13f51312ce7982
F20101221_AABYOW do_p_Page_103.jp2
6e84bc6de6a163f57f03eb9fcf6daab0
e93c54a8d44ab30dd23eff2ab8be08fe5dc91348
51602 F20101221_AABZTB do_p_Page_077.pro
f9292e787b0e2863576b6a3c553ef258
ebfb37f15ee8c7905fc0737d483b4153ddadb48e
28470 F20101221_AABZSN do_p_Page_014.pro
d4e682b57c15924a10cd7c23e345aade
74ba31d94df2300ff54db57e4ff9d7ac0eea3b78
F20101221_AABZRZ do_p_Page_127.tif
a6f19b227ee3904e689d852d63efc025
cec37bbe8115e36c21b5e386b23dc83a3c394ee5
1437 F20101221_AABYPL do_p_Page_099.txt
2d7deb39f190396d34dddff2467fbc92
f2a7d6e353e70106eaeafc6403670380deff9a1f
3138 F20101221_AABYOX do_p_Page_091thm.jpg
f10f2dcba5f46748adfe5ab7bf6a3a00
4818329d07402c2a6e91815117ae0270d160d91c
52906 F20101221_AABZTC do_p_Page_085.pro
23b9272e0c8379a7b36a8bf4ef3f175f
c09cd1da62554b6a8bf44731fa69d36466ed1d47
21029 F20101221_AABZSO do_p_Page_015.pro
e261784c3ad34bdcba7c9d92bd9168a1
e52f9f97aceae94b94743d6c71511867f11e3471
23882 F20101221_AABYQA do_p_Page_099.pro
8d3f510317ae42bf8b356aae26367f3f
cdc6e7d0a1abb7fae36c9c46217fd3917181f81c
F20101221_AABYPM do_p_Page_110.tif
efab7a1f9b78de113c9cd0c55a2af990
0bff981be24413710aedfd9fbe14ef542da7838d
8267 F20101221_AABYOY do_p_Page_072thm.jpg
7b679569ae199f0022ffa400230e3430
63412360066678d6d8971db2efcf081764f23a71
40650 F20101221_AABZTD do_p_Page_092.pro
2b34d17334618ee5ceb569360326e7e9
3903af4660123cfc457b0ba1e08f8c72801452a1
6367 F20101221_AABZSP do_p_Page_016.pro
194ec23338ba5079d95745308afab5a3
a897ea9016b3971f37c6fbc09f702a6ffe83f6d3
3008 F20101221_AABYQB do_p_Page_102.txt
21e01d97291473ad17b6ba0cf856fd62
92399cba99afc9f9ca2511251f2721f99e43dca2
1051985 F20101221_AABYPN do_p_Page_120.jp2
7f7f9c58dd9c193ba1c08f5000570058
60d5c1fbaea961645e30bcf4b4a3395a433b6d84
62370 F20101221_AABYOZ do_p_Page_160.pro
5beef25ad8665773e6c103a669b9d378
27b953cf4ef4459d9107520603cb3d726018aa09
43639 F20101221_AABZTE do_p_Page_093.pro
a5335a20d4a50b2c6d8657c35fa30608
a5f6847b0f5cb23889c0708873f88f7afb94d3e2
51359 F20101221_AABZSQ do_p_Page_020.pro
09dcbfe878f1d69875bece03df3588cb
f7a0007befa22b48fbf2a96baacd05d8bd45f8a7
43791 F20101221_AABYQC do_p_Page_027.pro
343dad4b3eb809b3565d09357e4382c3
61a2de22ebb03f16c539cdbff56689c8737fd752
941964 F20101221_AABYPO do_p_Page_067.jp2
5e1c028d0260aaed1218193ac490781f
4e5f7cd8847e43825d04af36d43f6eb4709c9b68
54232 F20101221_AABZTF do_p_Page_119.pro
a0a42552f141d9070de2195790329b32
0dcda9f6c94c1b2c0b66ee483bd5dfd306f4e44f
54434 F20101221_AABZSR do_p_Page_023.pro
a00dfd690ffa95007d55a92319e1c368
bf159a9b845a4a007b0fcd9be1e0ed15bee61778
4511 F20101221_AABYQD do_p_Page_092thm.jpg
ac011c2c89b6256514aadc932387f94e
a7b05ba4088ddbbb6ce755c2cbadd7fc7067d650
F20101221_AABYPP do_p_Page_036.tif
ce8789d9b528588aa738749c51af6cc0
a267d82ea81896d643653d35ed990b7dd791b0aa
57978 F20101221_AABZTG do_p_Page_121.pro
036abbead69adfaa322d4d1518720927
9ff92332dbd5a5bef45a926bdfcca271ca34f2b5
55230 F20101221_AABZSS do_p_Page_025.pro
18d194b2135c2625c33a23391ceae2cf
7085ce755792a07e10eaa4a45146732391322028
981753 F20101221_AABYQE do_p_Page_027.jp2
f3b76ee9850fe05613abfa3b6ee2808c
4af62665640fc48dbb74d92f102143eb6b946d6a
2224 F20101221_AABYPQ do_p_Page_088thm.jpg
d5b797af5bb34c6166869faa2ff9d5cb
2909baa892616bfc1a43d1b135ae13da80c0e092
24562 F20101221_AABZTH do_p_Page_126.pro
d4d63dde7188c13849e6e124f1f9a045
ac7bacf3d5f1f626648e39b32a9d9697f9c08394
51015 F20101221_AABZST do_p_Page_030.pro
7d860ab403783c6d59027b18d65d63dc
c734181f447e3e8cfc8a72cf7b956bc74094ffd5
50215 F20101221_AABYPR do_p_Page_026.pro
20c0f77a21a722bbf40c61458acf95e5
ef8c1efce7f0b60b00ff4ad7e0ab260565eda9ac
52994 F20101221_AABYQF do_p_Page_083.pro
7d0c9418e6209f46ad61c17d740ec00e
5f0341691145132ecc9d0b0da47e167fd6428e66
39387 F20101221_AABZTI do_p_Page_127.pro
80a7d32714aa8c674546bf739541b854
dc579ce47957d4cd596727f3e688e8ee78f4c637
55274 F20101221_AABZSU do_p_Page_042.pro
888767579eaf94fbaca31d04227d7882
4c873b727bd45c601cd755d385bb0f49fb15482e
37006 F20101221_AABYPS do_p_Page_055.QC.jpg
c8da84d3f758c3e0ffdebe50cb43cc7b
9d3d484eab50d08c3b48e8682cc2d81e5c61bbf7
F20101221_AABYQG do_p_Page_080.tif
f6fd8bebeb2c83eab96895e37fc8dcfc
60bb75a624788c8255da771cdbc6b7d8d51a7130
22505 F20101221_AABZTJ do_p_Page_133.pro
3dcc9346d9eb5d57f92c0763c2f3ca9f
51655474afe6a30183384baafb729f5d3d927a8e
51782 F20101221_AABZSV do_p_Page_044.pro
f6030d44491f165c253a43277d8ada73
06eb0b9cfe311751d62217c8d3b0af6941d8621b
706317 F20101221_AABYPT do_p_Page_091.jp2
a203fbca6f22f593ac8b5122c3a57fd7
e43aafd15d1e14b35eba588648f896c99fe58245
673049 F20101221_AABYQH do_p_Page_174.jp2
d5d03e7413ad9d6445ffdcab4ceca865
f8f4ffe5666746f9afd977388b01e87fdf20c255
8360 F20101221_AABZTK do_p_Page_137.pro
5c9298e6018ec7cb86db654a9b62d591
767da2cd74db3be2d7094db00d638c38c42d7082
52553 F20101221_AABZSW do_p_Page_057.pro
ca8005a08002208eba5d376f2ef4d9bd
bbf602cf837fb004a9d93021db2207a631ab1f89
116779 F20101221_AABYPU do_p_Page_074.jpg
eeae5574f8fca882e4a41f7f8b2312f8
f630d1f6321882b9b9279cc6abf11cb47e54d84b
F20101221_AABYQI do_p_Page_083.tif
ab757c41b5c00df9ea49bee03180e01b
ff713c67931a2f7b49b82562ed2883a518b5b1da
18777 F20101221_AABZTL do_p_Page_140.pro
b4cc8aa276f68f73784c1140ecbd86d3
730cfcc33184d204d3a1c32e7d7587fb917e80c0
53539 F20101221_AABZSX do_p_Page_060.pro
9e742a11029f86ad9d44ec58cc137d55
fea5b937a4199f96519cbdc3ab0d8a81ab33a0e5
F20101221_AABYPV do_p_Page_107.tif
f954db680361d29de150bb681f00dc1d
4f5773a9e8b2c10e8c1eed2e8b5d17b5ebfea538
106165 F20101221_AABYQJ do_p_Page_041.jpg
9b9b533cbd3d9f2c2989f789a6b702e7
72bb5a4e773eab46d1c94ac7e76704903e9d12d8
1135 F20101221_AABZUA do_p_Page_018.txt
fed7016be7f3e1fd27677e28074793e2
4e41c4985a0698f3de893d0ac41b331926a2ff7f
123220 F20101221_AABZTM do_p_Page_142.pro
b67092ce933035be6b6675c7c3b11c7c
12d528818050c7a4c539b2791f90dafe4261ea38
52469 F20101221_AABZSY do_p_Page_064.pro
30cf6bb40dc9f56bf5e9f4274733bca0
95891ecae553427efbfcd29ef862fac080178527
F20101221_AABYPW do_p_Page_133.tif
1f54a360fb2716756ff0a3534f5430c3
32265422f3316823948878c85e537de72d3b9963
2357 F20101221_AABYQK do_p_Page_066.txt
68d106d2bcd34fc857202434ba6ee76b
15edd64cdeec9e87ccfe0c85b2b76ae849189e46
2167 F20101221_AABZUB do_p_Page_019.txt
544004363e6589bb4685bb868246b15f
2a50dfab5f53c68fe2e2dfccc7f442530e54e7a2
53650 F20101221_AABZTN do_p_Page_151.pro
b17d38aa057156296436a5085cdd1b06
071ed337d7108b6ca0f8affcc4f62b226699f4d2
52836 F20101221_AABZSZ do_p_Page_070.pro
4a5b05209f36b929895dad24c766b8ff
8e3e309065d4f3c52478eea8aaea09248303cabb
8343 F20101221_AABYPX do_p_Page_034thm.jpg
35e57b1e926e47f4a251e9681a13f985
18e66197ba2cafb70ee93d2bf611f5891a7d351e
51440 F20101221_AABYQL do_p_Page_032.pro
398ff3010ad05c396fb9a015e0784e94
3cff05609134057cd9d1de93f8760247480ddb55
2053 F20101221_AABZUC do_p_Page_020.txt
545a98707914524e5118bcfe2935022c
946acb8875fb062f2ed83d941187b064d8675fe2
17825 F20101221_AABZTO do_p_Page_154.pro
386991c645f3e18fe3d735b40f960004
8f61d206f36abcfdfee2d174907a4a82866ade96
38335 F20101221_AABYPY do_p_Page_046.QC.jpg
976fd71c468ccd6722b3effcb9652e8c
04a0e5555b1cfdb9b21f73b54a23a598ec8bdeaf
52716 F20101221_AABYRA do_p_Page_063.pro
5261b970e395e1b2bba3d28f53ad9a01
fd3d5099307d2af95bdf62a5af870fe37faf9bec
1392 F20101221_AABYQM do_p_Page_139.txt
aa4217691eebd99a29399fccec80475e
d77a50b2133d877514276978a32f713ed2eee946
2027 F20101221_AABZUD do_p_Page_032.txt
2a26ac232c78f548f61147a2e386a2a8
ea5e13204aee09c104efdf5b2531593e75f0ff4a
67286 F20101221_AABZTP do_p_Page_157.pro
f70734d5ad430df44bfb917681a6dd86
37670b9fdca56771539c8bb7f884eae49de18001
35957 F20101221_AABYPZ do_p_Page_060.QC.jpg
54433020807a99db0d7210b30a55ec16
aa7b5ec6d4a5590d0da81269abc5b88d322156f8
110912 F20101221_AABYRB do_p_Page_021.jpg
b8b27ed4eae4a181d442ebff3ded649c
f6d5e5327a9fa4e05dfff2aa229edb4f207db818
8333 F20101221_AABYQN do_p_Page_052.pro
7ee3ef6e0e29ed9ecab5baf8028122d5
481bbf442d82275e2769008df98196e24b5c7afd
1998 F20101221_AABZUE do_p_Page_034.txt
84097054d3348940e37bffaf0784d1a8
8aa0c9bfbbf95a82ee8f7847c08b6300588098f5
69923 F20101221_AABZTQ do_p_Page_159.pro
763555d58a4671390bda5a3ddc5037eb
3e92560462d50ad2551c1d96c4ce9bb5ade8555b
2175 F20101221_AABYRC do_p_Page_076.txt
92b605540ea54b81d5022361e0a304c3
b01081a360475b20cc44d0c697ff997cae9522b1
52077 F20101221_AABYQO do_p_Page_075.pro
31c89257976f5d0660e0c88642540249
3bbd5018de51a3ed80ad544ca9ad4c89f154a50b
2165 F20101221_AABZUF do_p_Page_036.txt
9de8570eaa6aecba4ee75fedd39276c8
d4012088ba563cf7fa00487d6872015452cd83a3
62913 F20101221_AABZTR do_p_Page_164.pro
9823b21cd8c339cb5bd4f8dc7579e636
aa8e413063b5d7acd873ea34978dbb54cf6f44f4
F20101221_AABYRD do_p_Page_169.tif
26c193deb9f85becb4c23b84e44634bc
8e604a4af1a486d77f15145ff72620d0983d19fd
49020 F20101221_AABYQP do_p_Page_007.pro
7049ad2a8b12f3e810007826812300d4
57f712bbba63271c9e508bcec2960b6cf8b2dc8c
2170 F20101221_AABZUG do_p_Page_038.txt
bca589a120667078d2f598df3831b6bb
41a24aea7133440f2657e9a35ec92b1e30db9d3b
61340 F20101221_AABZTS do_p_Page_167.pro
d024e956f350d94ac629dc5a4f718973
7af9ccf2f3e1201f36e6fb5ce2cd1f43984ea23f
110985 F20101221_AABYRE do_p_Page_110.jpg
7f2e8106cde31ebefb3c6183f9fafd2f
4cfac6b55980b7d37d43eda7436ea39fb9dc0ff1
F20101221_AABYQQ do_p_Page_022.tif
42784d59bf5218b9a2d0f4dc38ab998f
349956248d27a4af275a9766c8752480d7b5f05d
2174 F20101221_AABZUH do_p_Page_045.txt
9bdb89662c3a951e29ad8ea6adcb343b
97ff8c9aa8687536200f24501ba3b06750e65a3c
64490 F20101221_AABZTT do_p_Page_172.pro
3fa89210348f0e231159a1779b8c5473
a388b24677cbbfc74ce38e78e62632d123b9a912
9794 F20101221_AABYRF do_p_Page_165thm.jpg
8e793c8b61bf2ca5e058dc15fd22c469
fcbcd30c9f7624fa03d846791326e7ea56ae912e
49673 F20101221_AABYQR do_p_Page_148.pro
aad5e6c4aab6d2791f077fd6865a692b
6451342500ae106ae42b7cfbb9c85b5f3fe90ecc
2109 F20101221_AABZUI do_p_Page_048.txt
576bef1812a9bcf6911c026d83231b1d
cb877783b10834370c02f25c4b98f3c938c9444c
41347 F20101221_AABZTU do_p_Page_175.pro
cf7079d64652ed65a2a7c5863a8c4df4
b503dc9fe5a004d7cca100190cc295a61d761de1
8590 F20101221_AABYRG do_p_Page_019thm.jpg
3866b8b461607ba6bf0d91a5d88599db
e052f12d0603258512c822b89fa421e3bab75fb9
2114 F20101221_AABYQS do_p_Page_017.txt
5486f4cc47ac0c2743cd2204a2af00f1
8cd13ceea2dcfd67a083990293bc4aa2cf4e1fb7
291 F20101221_AABZUJ do_p_Page_049.txt
036503341aa275a46a848cd1168cd236
d7b7d04e265fcbc23311f3f7788e9e030248d2bf
87 F20101221_AABZTV do_p_Page_002.txt
a42a0c4526c036a24630a4061af5945f
84929ecc07de99a07d4ae828360b50c61630f31c
2619 F20101221_AABYRH do_p_Page_003.QC.jpg
ae7bb92814feb3b4ef4a6d24ec00ef26
63a99e3ed557b87e6616e88a19fbb63689c73f45
23908 F20101221_AABYQT do_p_Page_010.pro
2b81b094632a6c06ec10299ec6344dcf
5ab6914d48436032511a8d5207403c4632b996ef
2064 F20101221_AABZUK do_p_Page_057.txt
942be7b64d81a4350a120abf5ae9c45b
48fcf9c07411c3255ac8f2de2795faf67d9a603c
4994 F20101221_AABZTW do_p_Page_006.txt
c5378b17fbd98d0388d3d14a9fff0842
d1ca39b0357171cb864882c710303c907a78fd12
5262 F20101221_AABYRI do_p_Page_068thm.jpg
9106dced4a1edc868d0c74989bf4c9b5
8eb17ac8e65ca502f2b8be694071050fba9e4834
573943 F20101221_AABYQU do_p_Page_140.jp2
a74f7fc973b052352f13d894aaa8d1c7
4efb90e1b11d738c69441a8dc5709b459a8947b8
1107 F20101221_AABZVA do_p_Page_126.txt
8bc50ee356b9d68acbe88554d4817e5e
a1e908d4bd6c5732541118a601bd098c5fb75a49
2181 F20101221_AABZUL do_p_Page_059.txt
ae15267527bbd07b17ed7c7b1b941259
0c798c911a0b57656ebf226820c442a03036be11
2006 F20101221_AABZTX do_p_Page_007.txt
c34fbf92870ab488f6c03bdfc35aad8f
fc244f60fd6f0b3db54bc7001c72216191fc2674
52531 F20101221_AABYRJ do_p_Page_019.pro
db1661198801a5eb4f2b3a211f80b9a1
e3dbce9738e9210e9cff8d59e2b491c311d890f6
56166 F20101221_AABYQV do_p_Page_123.pro
03d853d5c23e781edfda118959b36cc9
e962ae363784eabc459c1db631310402f76bf0b8
2063 F20101221_AABZUM do_p_Page_061.txt
8a9834ba3a802acf478371cb08836a19
e949150f9a9be13d9d36e6aad166de6cc12ab151
1812 F20101221_AABZTY do_p_Page_008.txt
6d139a4c300c36315636743ed1548eec
d5bde51e7e91261b899e6b17d86e8cb730607cbb
1051966 F20101221_AABYRK do_p_Page_007.jp2
f3bbc61f8f1b672325e80c2bb1add4fa
a38aaf4e5477c59704680c5757c86c5d98473739
67844 F20101221_AABYQW do_p_Page_163.pro
2a98bf5446f2b087c8531efcb435e199
0033bd89e20f86ea556c482b89c3ebd621c6f607
594 F20101221_AABZVB do_p_Page_130.txt
fa82ab46ad84a7af94956e462646c10d
c79fbe6a68893194761562230b18deeb111cb98b
2089 F20101221_AABZUN do_p_Page_063.txt
f5f772886c99aa09522d82729779ef28
457b50ee37dd98cfa54284a317f4811db0fa2393
1291 F20101221_AABZTZ do_p_Page_012.txt
5dd8fb693f51064f1b6b9461896d6d2c
1d5f21885e10155a6221773cb1f76d78b0e94ab0
F20101221_AABYRL do_p_Page_049.tif
223aaa46e7bf0f8c658d561636ad741d
6d974defebf351cd2599b19015eb14803b093cc8
F20101221_AABYQX do_p_Page_149.jp2
2136e279f1611994948a4911048e57ea
cc2efa530a1c5bfd39062dfbb34ffe3d6724f4f3
1395 F20101221_AABZVC do_p_Page_138.txt
43c3d98ac1b88e0eeaadac1d0dc31c01
025d686642ec19ddc4f572f92b6112d7c2ddf92f
1629 F20101221_AABZUO do_p_Page_069.txt
23369da2a922b388b6990265d486e20b
fbdffe93025fd3c6397e5daf58751867c9412a01
510 F20101221_AABYSA do_p_Page_002thm.jpg
704b78c3731dba986e5684ef8f31401d
fbff7ea95e3dd7f59ff37e0761b7292805b5587d
28668 F20101221_AABYRM do_p_Page_001.jpg
84bd887fe27fb275147655209bfaac90
883216e0a96e70d58fc0a7fa5904702f06937b96
117062 F20101221_AABYQY do_p_Page_005.jpg
d67abaf81ea21a46f818b813a47b422d
91bc7265aac8a0728bc3e05c68d5a5b162a18ad7
1056 F20101221_AABZVD do_p_Page_140.txt
9f835e35f9c015fd0126c1ec112732b8
46d1b454a228baad997e12fe5b9f81e143d9cf54
2078 F20101221_AABZUP do_p_Page_070.txt
abee68d29548be222ea5938d7d9833ba
a519f24437a731b723635e744e373f5b36b3731e
9299 F20101221_AABYSB do_p_Page_162thm.jpg
f9aaeb0ea8aebede85e1b4427edd3b55
05df17beb5f89b6356d6462b444a399fc7366535
1051941 F20101221_AABYRN do_p_Page_040.jp2
1e31efafa84cc089c19164b1067196c3
a286e737f92ca723983f85bb6b7de21f51ed6a9b
7687 F20101221_AABYQZ do_p_Page_028thm.jpg
1433965c1ffd1e390540e6680c4f5229
028eb3fb484077cc51df2f377d00928b437f4a79
4970 F20101221_AABZVE do_p_Page_142.txt
6411558cbbcc38828af6a2422a76a34e
4737940bc43443d55e189e082a1fa2eb30d907e4
2036 F20101221_AABZUQ do_p_Page_080.txt
3e8a1fed1f01bf7241adcf41ef0fd98f
d97eca0b18738d9b6c304551d028a8cc232fb0bf
3924 F20101221_AABYSC do_p_Page_137thm.jpg
8f33134143b892b98daa9e1a3dafdb15
65e199c7195540b6d80b823b8264a113c17d0a47
55350 F20101221_AABYRO do_p_Page_045.pro
19468da80649f079df2c9b4dbf2e4c91
30a4afdaab009302672b087105aea455b263eff2
284 F20101221_AABZVF do_p_Page_144.txt
ccdb6a57c8e1143e876e55b9a47f9ce7
fc26a4779436aa2aca10b9500db043a7a64986e2
2018 F20101221_AABZUR do_p_Page_081.txt
977bcea8588ad7c082c6b8a490ba8765
7219573eb39432b3be74781d418276dfd915d04a
37824 F20101221_AABYSD do_p_Page_164.QC.jpg
b10313a8328511a4973dc554e83a2935
d0399303db85414a8bb959669780b1f505b99d4c
F20101221_AABYRP do_p_Page_091.tif
f376e4c0fc2bbf832df5039532c120ce
85b06c236b8d1d7ca14b4f5941dbaeb07231051a
2639 F20101221_AABZVG do_p_Page_166.txt
8e186f16b51ac5c315a3f2f28f619f3b
6b8de82a1bcee5a5ad7fa873b11ee1f1e1541fb8
2074 F20101221_AABZUS do_p_Page_085.txt
0449ac35f1d8d6912c748221dcb3cb95
407adb679386c6c70cf9d3ee196a61f1f3dd10f9
111872 F20101221_AABYSE do_p_Page_122.jpg
2ab15a068b8dd775d78c3cc727d012c6
f60f8e475dac621a8dbc3193f934dfe623c0e841
F20101221_AABYRQ do_p_Page_030.tif
8e8794502136a3efad7f16ddefc27554
fa98b93984506977b58002ffdb4f2de8c9400099
2778 F20101221_AABZVH do_p_Page_168.txt
62d047a0f8229aa0773d16337165575b
0b23cb1dd4e8eabdbda5b642985baa5be21cfd7a
2067 F20101221_AABZUT do_p_Page_086.txt
a5c4d2bd740a1439ebf434d29c537000
61994ffc325e6bad1ec10f8b8b1e6f22c4125a4f
1051905 F20101221_AABYSF do_p_Page_075.jp2
4e28e1a8cd73e6d1454a0c6a19281055
0c891c0de0478dd7e81f258e944e3ed4b4141f4f
32146 F20101221_AABYRR do_p_Page_053.QC.jpg
274e18bfd69ef41ffd2af3651bd063b0
af4763af60b3bc4b285aca0ddf21c70521d0711f
2877 F20101221_AABZVI do_p_Page_171.txt
5fd4e621e9fe5b416b1877f942336b32
74d854935b65c6be9f99ee6adbf163fdbcb4e777
1603 F20101221_AABZUU do_p_Page_092.txt
75ce3e7b62e00ed484151ac9bab494ca
12362116c609515347f10ddc7a96096cecc4e639
32478 F20101221_AABYSG do_p_Page_129.jpg
9d81cdacc6c789db42d8279172b4660e
ac5a253ec70d587d72068fc6ec4df30cf129ad4f
9010 F20101221_AABYRS do_p_Page_110thm.jpg
ca0876da9853003175976d3beac8f7c2
7c58ad5d696b86bd65fe72775f2791742d925469
8202 F20101221_AABZVJ do_p_Page_130.QC.jpg
237a4c9116d12c8e6ccdc3ece8d5a5bb
0de694d34d7bb005c3a50f0d40f324a676d99f8e
1781 F20101221_AABZUV do_p_Page_094.txt
253d5bbbcf58dff64063dec09b9b2370
d54f523c268cab18de30d1ff924bb2b02f5b335c
113242 F20101221_AABYSH do_p_Page_036.jpg
91af28b0e6a2987e0a17c04d84081c42
7166568d0caf8c9d6b71a0a531f02509e43730ce
16271 F20101221_AABYRT do_p_Page_136.QC.jpg
af6daed8215e6d0b8ba0e7e372221f97
16eb6c35b584ef0e8c4234110faefe415a5540c8
6802 F20101221_AABZVK do_p_Page_069thm.jpg
63ae9665b7393cfb48cddf2846e907a6
78d8122f0945b6b47618afd7181e5d5c3a532354
1297 F20101221_AABZUW do_p_Page_096.txt
d7cdee38dd7a88150f89a359813433c2
3a41343711e2a263e6fb5c7ee6887fb5a6c22546
F20101221_AABYSI do_p_Page_025.tif
a2f3634c79c54d1ed9b9f33ce139b88c
c8882ffb79e20f397a6304ac0d514802b01417ea
16086 F20101221_AABYRU do_p_Page_098.QC.jpg
c49baa695c1b4995ba44460fc5881f7d
97763b5d080eaaca5c84067a97d8bc1a2de3f9f7
7233 F20101221_AABZWA do_p_Page_027thm.jpg
837e38450f275d0bc403b44f0de38158
bc73ee4b28ae5869fda7b22c0364f5ac0bf451ed
5016 F20101221_AABZVL do_p_Page_138thm.jpg
26b5bbf9fa0ef47f63b5dbede41a3ef9
d6430e15bf1e09039bc8a877d0f128ae851c085a
2009 F20101221_AABZUX do_p_Page_101.txt
06030e0d7524aa8965ed85f2bd2acfce
bb0c5f66e6f6a1348720cdd89f47f92736c0ce14
F20101221_AABYSJ do_p_Page_003.tif
7059c1624cf3e0fb4e8bd2ced4a82469
34beaa07e0726e5234425ec323a3609e2a96aaa9
132291 F20101221_AABYRV do_p_Page_166.jpg
1f8c9a9d960aeb1a09e24b5fc013facc
c90ab973cf7c160460f32a33666a0457bea17055
32361 F20101221_AABZWB do_p_Page_028.QC.jpg
cc628256582b83c78cd49b7a740cbea8
ef5bc1ebaf9622dd49e3a797a60c18aac9dc3ee3
36808 F20101221_AABZVM do_p_Page_077.QC.jpg
2d7cae473edc61fde5c386d752dd6048
068b2ba33728cf16c11059a3fb50df4ae7d173ce
2215 F20101221_AABZUY do_p_Page_109.txt
1717e79e917ec1bb10ace77d933ba759
c8b5d5458b871d44eea2d862bcf1ce92ff3cdf77
F20101221_AABYSK do_p_Page_062.jp2
876c5f38e1646d3ba16263537840fd79
8ba25a98f5c10926985057c49c058d5831b6a112
F20101221_AABYRW do_p_Page_153.tif
c2e890a99eeec020b1aa4c55282c9bfb
20cee0252a18ac994914f43a5d216e78d1d2abf1
35970 F20101221_AABZVN do_p_Page_161.QC.jpg
fc5a55f617c97e9e6eea144375c6aad5
80659f84040df4ab8634285bd4bee36a582aac2d
2131 F20101221_AABZUZ do_p_Page_120.txt
a8afa41eb19513e11bed4c0ec19b279f
073d119df60fb719853c95d3a336593c4fef23ea
55488 F20101221_AABYSL do_p_Page_149.pro
aaf4d8b55fa09045d68913806e2dd473
68003f762dbb8a9fe159f11197bf16181a827722
F20101221_AABYRX do_p_Page_170.tif
d25c5ec6dabdb48b8211cd938426747a
4fddb2343ff52c59598847b52743ef6c0fb6e713
34780 F20101221_AABZWC do_p_Page_032.QC.jpg
0d603670bf46550222a6db754100a1a4
51d7cc2da5ced7a7d9d4cbab8850a3dcb65b41b7
41229 F20101221_AABZVO do_p_Page_159.QC.jpg
f727ed9fd2c295ad6cc961296489b83a
881e6384196e2d87c69604f31b18d07e4be1a1b5
35655 F20101221_AABYSM do_p_Page_062.QC.jpg
1234a3d34b9a12a620b27f41792019a9
ba48621cce1f4bad03121d96a3e5d86a4ae9c02c
4088 F20101221_AABYRY do_p_Page_005.txt
fea0a4c363cae0ed726af2d11b8ce076
635e74aeb0b161bb767cea67a544747e3ec715cd
1051957 F20101221_AABYTA do_p_Page_092.jp2
07b497809230e5946a5bef8a6bfcf41b
f7d0686c68b201ee19670b458c8016b92c65ff97
37086 F20101221_AABZWD do_p_Page_036.QC.jpg
e8f09a772f5e41d0910776ac76037250
730f9838674a18efe5377f68db8812a5945328dd
256476 F20101221_AABZVP UFE0024891_00001.xml FULL
6017fd3d987a2e98e903d1dec93bd14d
53888a6f7b699ad6b79b58fafa5c0f651244edc5
BROKEN_LINK
do_p_Page_008.tif
35863 F20101221_AABYSN do_p_Page_035.QC.jpg
7e649a14657f536ef1fd6e064d092491
3aeba94ce187d0d30121cb0da051fc616505cad6
9097 F20101221_AABYRZ do_p_Page_106thm.jpg
b9d3dd18e2013f3aae08e92fed17e71a
b34865665c3bdb427a95c1ba78ffc87d571c1591
1051982 F20101221_AABYTB do_p_Page_006.jp2
c0e07fcd3cda0d5cce94ee002f707b03
dfa18c1901e2653a9044abf3e6386ebbdf4e8209
8948 F20101221_AABZWE do_p_Page_038thm.jpg
6878b1a9c3ae33cbd7736ca0a169472a
2c1e808598aa5fa7640500d5764b9490bbe6f240
2118 F20101221_AABZVQ do_p_Page_001thm.jpg
6d33c5fbf3874d0fb25718262269e321
8dfe25c44a0ea525bfe45ce7f265a04ea286fcf9
52598 F20101221_AABYSO do_p_Page_103.pro
69d1f6f42f815831ab6a247c9f852b24
a61afeb0629681be33de3f2e98e4f7694cd32eb5
114076 F20101221_AABYTC do_p_Page_112.jpg
99fe834d10cb6c9d46f0b0956ac4e962
97418328998ebdfb7eeca3209b1f83b8679d7487
37993 F20101221_AABZWF do_p_Page_039.QC.jpg
868f5dd420f7b81cc41d3393f81aaf1f
41c02ba15bef6f708a6246109f0082c89a79926f
12505 F20101221_AABZVR do_p_Page_004.QC.jpg
1c29608e241ea116f2b19378fd7161bf
3baeac3a47710166d0a6bd1ac0ba62433cd714bf
37511 F20101221_AABYSP do_p_Page_042.QC.jpg
747668ac2e9bd1e2efccdfcc63bd1b74
9afaf40bd1103a6aa79d4c7f741369c4c1f7c11d
43438 F20101221_AABYTD do_p_Page_154.jpg
4ed3c35f941bb1092a889ead4ebf3b52
03bfc7bd42cb0c9cc0c7c4c6cd49d8e9d7cec3ab
35989 F20101221_AABZWG do_p_Page_040.QC.jpg
ef648cef84c667d21fd4b0bdd4fa9c6c
4b4e7c9e9e2f6296f485e96cecab1c716bff0785
8309 F20101221_AABZVS do_p_Page_006thm.jpg
74a60915ed04f5d53c40a9daf273c893
370cd83f9fa7e76c679ac0172fc97b7a605e63ec
F20101221_AABYSQ do_p_Page_073.jp2
4ae245164a8332044777114cfa0b7a7c
3c5986e9d1f58c3fb41ee60a17458a7e4bd874e4
2594 F20101221_AABYTE do_p_Page_160.txt
c0cd562d22ba944304680fdb02b46130
eaf8d408f5f41d2949c6fa4a3e7dcf7c147ff26b
34906 F20101221_AABZWH do_p_Page_041.QC.jpg
f2c7c6e21aaf83231dba8d4861d73e87
2d641c040500a2e79c73fe9f980f229afffc541d
25843 F20101221_AABZVT do_p_Page_008.QC.jpg
b0fbc21e311c28cb3b49c215674e1861
4d7f4d4e7fa57d21e18c2d4c2ee1437ec49f29a2
10291 F20101221_AABYSR do_p_Page_132.QC.jpg
347410754a2ebb979e701b2e25a16b73
2947258a48468de1e278f9537daf560e689fa39f
8788 F20101221_AABYTF do_p_Page_061thm.jpg
11f8c23e29015f935fd06d364b2a862f
76b7084dca6e149a21dd7ea267c7f3d2a8da0147
9058 F20101221_AABZWI do_p_Page_042thm.jpg
cddf75f8643f48fde80efcfa9276f7a3
ab04641a017dd3ac358d5e21594640c94fb68018
4984 F20101221_AABZVU do_p_Page_013thm.jpg
4e69ef09611f5ad8b26c2a5ebd1de4c5
bfd16872cfed5411314436176888650cd9100350
1347 F20101221_AABYSS do_p_Page_013.txt
0f3472cb59d2d3ef71627639ced20d93
cf615663d3fdfe7a07b2c2bc76bd1340e3773b45
2121 F20101221_AABYTG do_p_Page_022.txt
dce6fdaaa7dff72879d259f77865fb26
1df250c69951ec3a11a3b975180cc1d924a1b596
31589 F20101221_AABZWJ do_p_Page_043.QC.jpg
39cc8658ac24944b240e0e89fccd5314
8c51cf23d5ee85b46500a620c6144184ea3843a0
5102 F20101221_AABZVV do_p_Page_014thm.jpg
5bb5d618ebb9c17167672ff5b3e90aa8
e58ff96a1095b06d20700fd6d9fb97abd7134f2d
9164 F20101221_AABYST do_p_Page_084thm.jpg
797981b928ebb36a76bc1d107dcbb2b0
67ea322fa9c84a6e7f7f60fd6066b8d3869ad0dc
905676 F20101221_AABYTH do_p_Page_069.jp2
7ffdcff13fd72eebe7359aa9e4b834be
d7cfd3920ec797035dfbaf410ff1734cc804d540
37916 F20101221_AABZWK do_p_Page_047.QC.jpg
be495a9d3b98b5e1ab565b6b750d4f5d
f149a6f2113073076015c829d815f7cc552d478b
20642 F20101221_AABZVW do_p_Page_018.QC.jpg
e622c55916f9ef2c9ed54481ca792be6
e2a00a4f17ec85372f292f1e5c57b190c2a645fb
2188 F20101221_AABYSU do_p_Page_073.txt
3fc68be1717b0d7e1777198b47975e8f
4834347681ff727e7ef214f96f8cf6ff65698572
37506 F20101221_AABYTI do_p_Page_124.pro
20903de491d03cc26af65328f43a79de
767f0faf2c6864a619225ffc9c2f0b89f9938980
9019 F20101221_AABZXA do_p_Page_085thm.jpg
d2591603a7ac071ccfd9a76b895849be
2e2a951f3d65f0fe16985e0064cc36b7f6a8a926
19221 F20101221_AABZWL do_p_Page_051.QC.jpg
447de3f8ead907e19eae4c31930ae475
ba35f51dbb2aa8919a9dea4551a404add3a634f7
4841 F20101221_AABZVX do_p_Page_018thm.jpg
8c8c0d74e7c2f2bae4169586d08686fa
8f6a12c8bebe6ebaad9f7637ec04bba953a2873c
116097 F20101221_AABYSV do_p_Page_076.jpg
336d4495d4b202c23c053e7b3b3fe217
c524ae30e340d4da8accaa1847f9aacc0a0fd370
2115 F20101221_AABYTJ do_p_Page_037.txt
465177abaef41caca73338d565c56c34
591706697e0aefae7d018fb3165404bcf6aac603
37576 F20101221_AABZXB do_p_Page_087.QC.jpg
8f68b25a23c26ba53cd9513db6a4ded0
7b24d7b93f95e26f42da5551d1a1cf1a7911ce4a
8767 F20101221_AABZWM do_p_Page_056thm.jpg
b1a94fb811edbd20bc31953c455ce975
c512b2c6aab04172a65edd5940bf2bdaed95d01b
36165 F20101221_AABZVY do_p_Page_021.QC.jpg
69181361b33c88b56ba4be78dc6b0871
11e47504e71651d4c32b7032ce31c50493b56872
37811 F20101221_AABYSW do_p_Page_109.QC.jpg
98c495604d7eac8fa7a8900182f3ce7c
07755a112ae08fe42f9a2b4e33dadfe928d19b44
133118 F20101221_AABYTK do_p_Page_164.jpg
5bea9c21d9a645decefa3445c07cc5a6
6b0e38c9c07cfdb46f454c81fb0f45ed327e3153
8655 F20101221_AABZXC do_p_Page_088.QC.jpg
f68ef7c01f5feeb2df104936882c68c8
d8fb7013fc985ace06fa4b0f4a7d2262b20f560d
36519 F20101221_AABZWN do_p_Page_057.QC.jpg
cf0ae3c08d28e267c5039bfcb4f3c080
2a06f05b4ab0eaa4ab25d8efd646836e60137cec
34608 F20101221_AABZVZ do_p_Page_024.QC.jpg
1ec2c21feab9eb84c648cb82391a34fb
3026a87a45367db63b8adfc95a65ccaa4ffde2dd
45133 F20101221_AABYSX do_p_Page_094.pro
04fd9055aa0885612427a5254c195dbc
13b7fb6fa539ceef0732f72f4c445990bf3e8490
399739 F20101221_AABYUA do_p_Page_004.jp2
0c4ea56e43776fdfa67686ff79fac386
1c659ad7a159695f9f519d5e9e5bf07b90559f70
433754 F20101221_AABYTL do_p_Page_146.jp2
79483b4753759f97786ae0cc7a7869f7
a4ad9a89a64073faea7463fd3e95705befd5ca78
8762 F20101221_AABZWO do_p_Page_058thm.jpg
fcc031645124332d41fe47d467863b52
9b24b989421d4c9486a4187e2f5c0e6ce9a44308
2160 F20101221_AABYSY do_p_Page_025.txt
3bb7694c3d268072b44cd55e2d53f537
d1c3e71fdc4865b0ebd907faf0dde5292986d5bc
F20101221_AABYTM do_p_Page_170.jp2
d13045b55d9699eb2d76696583dd9746
e63c57e80836fb513d69ae61f57d4cd3cb6f7d99
4539 F20101221_AABZXD do_p_Page_089thm.jpg
573ca744995980cfefcaaaca4f50e2c5
d56735b3fec1448c9b79042d3eeb8b5a866d45ef
36154 F20101221_AABZWP do_p_Page_063.QC.jpg
7f1c458eed1e85c3b27a26e7e26641ff
b142331b71b97d7f4cef43b72ecbaa6a28dfb15e
111701 F20101221_AABYSZ do_p_Page_085.jpg
6b19764169c6b0bb3dd4e7a7c76c6a5a
fc9c0e0838b344ba144695ef8c89e507b551498f
F20101221_AABYUB do_p_Page_152.jp2
0e3a78a6e8670b2677e95e181a2938c5
7fc2a4d3bd4143423dc07cec310b01a38c836d5f
102386 F20101221_AABYTN do_p_Page_142.jpg
89e51466a2753958c34304385bf2dbb3
4c4b17e3c914b9709815953b854a5fc124fed2d0
14401 F20101221_AABZXE do_p_Page_090.QC.jpg
6a98b8fcfa05727a5d9037db2f2956ce
27f0280e9fd0b14ffb8e6f7ae8661b10a26311ad
8694 F20101221_AABZWQ do_p_Page_063thm.jpg
9ed423a495483ac268010ad945acdd26
89c17b8cadf487278b7b2d69099e971ca8b29db7
F20101221_AABYUC do_p_Page_005.tif
983e3d9488b9a7bdbb4b3a50f2c1c13e
196b3d41daef85ee7f562c59a1f1a71f1bae4512
9806 F20101221_AABYTO do_p_Page_157thm.jpg
d3251b2da821228496ff89a66232212c
2abe0c4d30d5c46f28a2d709cda415d23dcd0c27
19925 F20101221_AABZXF do_p_Page_092.QC.jpg
4899b86e73dc398708c1367868b1d804
b1af19c53e16816fb333ce10b2bbe202783b42ed
27741 F20101221_AABZWR do_p_Page_067.QC.jpg
5cf57a3396625a39b6f968c8cd7a3b1a
4b1122a118be1ed3407bc2e87f4a71e7a413a800
F20101221_AABYUD do_p_Page_056.tif
01189e6ee18cedb0e428f9f64e8e03a9
ee2750c2abb8aaf649b4abd789638814c454c59c
7600 F20101221_AABYTP do_p_Page_097.QC.jpg
e9f158face398a8423204079a322ee2e
32d88ea7f6c4f345c530041387696dd71545333e
20905 F20101221_AABZXG do_p_Page_094.QC.jpg
50aef58b9c11604c1ee300d1488501de
4b8046b2ae525d8d74be6dc1769ed32ef8f056b3
27519 F20101221_AABZWS do_p_Page_069.QC.jpg
3ed18c53669402b5803f7907b584fc3a
19009913b04a8ced02687375d9e9aeb661d73d02
9187 F20101221_AABYUE do_p_Page_117thm.jpg
f107ae23361e5317258426d3ee72b9b7
97f18355066455ea2c7597b54acf0ff7352a8efc
24878 F20101221_AABYTQ do_p_Page_130.jpg
2406b3c0fe7c4af49fe8a707ad51463a
bc65d2414fe316efe9b63caf40359246e2246679
3244 F20101221_AABZXH do_p_Page_096thm.jpg
b10b412ff10c63f525a11f5f07d43f25
bc3dfb71e393e0d0f5000d0cde2954b6ed0ff174
34624 F20101221_AABZWT do_p_Page_072.QC.jpg
c0d50da3b65375839ff6894e520b0dea
cca7412169ff29ddb9db45629d3826e737731862
22086 F20101221_AABYUF do_p_Page_066.QC.jpg
da3b405bf47b55952b21fffb89a57b82
2f36cd3d7f4015b6456a732c9d0c137cfd11a1a1
2144 F20101221_AABYTR do_p_Page_117.txt
78afe8b7f8a6576768fe5b8934ddb764
5fa9241a8784e086b6391a5ee6f0b2d23fc06e11
18141 F20101221_AABZAA do_p_Page_174.QC.jpg
5e94c72bd57020f8dc01ca1befe0aa13
ac91de2accd9e44361a20899c233824be521f9c5
4962 F20101221_AABZXI do_p_Page_099thm.jpg
6457a6da2c39807e0d0387f1fe86bb37
25cfb0945f690a76aca9fbeb0635e056efc67312
39142 F20101221_AABZWU do_p_Page_073.QC.jpg
25eab0564313759f86d6ce2e1ebba4dc
3dbfaf962645bd270ff1f73bcabf94a77b868273
296682 F20101221_AABYUG do_p_Page_153.jp2
bd81144363727d6d79ee3f7b44032039
f6dc4f7fab34ab2315b0dc8df881e3b359edd3c3
62013 F20101221_AABYTS do_p_Page_156.pro
8c4dfc30b32197e440801d54c2df35b0
cae9c844f81d87e41bd3c62e630fb37b7984c47f
2090 F20101221_AABZAB do_p_Page_040.txt
9ba84cd3ddca1e9abfdc396ef22ba5ff
c37accf5a80b9f609f5349ce41d74a4e4571a0e2
27445 F20101221_AABZXJ do_p_Page_100.QC.jpg
f18c61df8174a88998145affde45ca30
4294586904faa1ad9a1fe62fee3ab07fc543e09e
8545 F20101221_AABZWV do_p_Page_077thm.jpg
1bf001e886300e2fdc763d1f70124345
cc871f87c2f79a128156c5ef0652b74bbaef789a
10069 F20101221_AABYUH do_p_Page_159thm.jpg
caa6640a18c83433408c5d9dd5a9ec04
1cf37b5afc483fdf12a8362d4187f48647dd48b2
8458 F20101221_AABYTT do_p_Page_035thm.jpg
53bafaa7a859e4824da9bfa2d4ef94eb
8ae91ef1743476d3531764c18d3b1b89070f2fef
33918 F20101221_AABZAC do_p_Page_026.QC.jpg
5f44553906c370ad116b7e84b1729e0c
b6e97d98ee50335d51a7ed11c0fa85de8ce5bc76
29889 F20101221_AABZXK do_p_Page_102.QC.jpg
48f4d7f60f0e66a8dcd2d946f80a47b6
e32a42b0ed9a4154cc7192e8413e557a0324c7d2
30728 F20101221_AABZWW do_p_Page_078.QC.jpg
2a2e769fa3db1f3b8610cd8d4015f6e7
5dbf55df2deb2698c0840c538686a4d6a2f0802c
39477 F20101221_AABYUI do_p_Page_157.QC.jpg
191b5697660a97c606a9ae8bd5338de8
b903db7048459251f5e961d505f1d60eb326b25e
2062 F20101221_AABYTU do_p_Page_082.txt
858d5da9f8403b1ab391514f8e51a947
753e24a64f939b5133ae58d3833d5828687ae96e
F20101221_AABZAD do_p_Page_175.tif
807f7fcc9ac632f5e7d2271ccb661e4c
4edd550e955749c736ac62eca36d7cc8e12df257
21334 F20101221_AABZYA do_p_Page_145.QC.jpg
bd19e9c7a40a80362d69b65f925ca4a9
5a5be65c7d76e742fa112cc7f8ed6675b9a3f372
7830 F20101221_AABZXL do_p_Page_102thm.jpg
2d97729ded14c2fb246ab02904faa48e
3cf1e0453ac89af84eb64fc7fbcb061b6362ea9f
37307 F20101221_AABZWX do_p_Page_083.QC.jpg
13be3b4f81af559b340962eabcd04cc6
da49d2eb141f2bdb2fd390a3b34af3103b38351a
F20101221_AABYUJ do_p_Page_010.tif
a77dac4dd03de15ee919bc6ddd7fc0c9
7567fc7552469574a1b1a4285e731f8cd143c66e
2163 F20101221_AABYTV do_p_Page_118.txt
12aa871708bca289dc45d10280230031
3d99c854c443fae1d03370d04507e6856ced0106
8564 F20101221_AABZAE do_p_Page_057thm.jpg
a33d9026e9cd22c869a1aee41191cdff
f83f8f05a4d50a55b13ce9df54f950c2f858cab2
5640 F20101221_AABZYB do_p_Page_145thm.jpg
362721099d8cb830d444105f20d5ea97
d91804f1bc9bc23ade87174031de49b870772133
34374 F20101221_AABZXM do_p_Page_103.QC.jpg
3203de6dd6f9f28ac95cdc3fab622e49
ad15dd8fe1b8bf192df6f7d1d0e1680383367948
9165 F20101221_AABZWY do_p_Page_083thm.jpg
482a6d26ceab5e6f04422d6e4f23f8bd
851f6f6907e98dc18acdc9860d5817514f8a7dac
F20101221_AABYUK do_p_Page_081.jp2
6856c943b04e1525c5eb200cc08d35b0
d197f3f48446b10f7208ad118e83bf3b3567c95b
55331 F20101221_AABYTW do_p_Page_038.pro
ef6e95324ea1192e1d4c29f1336abece
03641488547939eaf621a80760c5fe241bdc4be4
30740 F20101221_AABZAF do_p_Page_079.QC.jpg
6ac17c24fcdf6729ceb152b29c3efeef
82bf0ea3fb390a0bf529eeb3c3e84e2e65de5d1d
32891 F20101221_AABZYC do_p_Page_148.QC.jpg
900e881b17691e87576a21cd1940f14e
43ff8476d97a1be20e7c279430ad3b55f57b5617
37522 F20101221_AABZXN do_p_Page_104.QC.jpg
52842e43ea78387b44520a3ab8d0c997
531f8a6fb8e185583088bd75287ee5184d315ead
38467 F20101221_AABZWZ do_p_Page_084.QC.jpg
7ceafb32cf9655a65cc9b97e2788049b
e7fc8914e72ed9c1681d10e8a90d7b705fac335f
1051959 F20101221_AABYVA do_p_Page_057.jp2
1f7034b5e957af8392d7c18bd067b11f
56c13bb1fe7afad3c27b14610199975a4d9a4430
8736 F20101221_AABYUL do_p_Page_062thm.jpg
60eda03023eaf8691bbc63b4c5bc02db
f0709afd5a8b0812e31a069e0a3ceb98bf8e8d7e
F20101221_AABYTX do_p_Page_077.jp2
523d5e9fe6ac1fe1aa9aa70dad36816d
53510277ddecf8afc66cf9692bab62a30dbabb29
2648 F20101221_AABZAG do_p_Page_172.txt
2819fe427ed56d30ccbbdbcab2e5e2e8
bc40b09717df86fd668cdb392d47e53c25fb9df8
8146 F20101221_AABZYD do_p_Page_148thm.jpg
bffe52f6fbd9414be0171c9dd6fc7e8d
23b89e5feee3b814c4fe209e5712c19343bb4bf1
38596 F20101221_AABZXO do_p_Page_112.QC.jpg
c06ee6bd96fb717c9c8f6921bc6083e9
c99cd152e474ead777c57a5fb0fe2167affe0d32
16741 F20101221_AABYVB do_p_Page_004.pro
25c1b160802d58c2a9bfacc00270ad39
9c18e0559bb7a7117ddc6d4ceb49b7f41efdab4e
8194 F20101221_AABYUM do_p_Page_115thm.jpg
de69d8e7bdff69d34d513a0463122dc6
d11866f22181c1b829192e3b70a5fe67b4adc692
F20101221_AABYTY do_p_Page_105.tif
e2765ee11bb774e1fbb12d8588589827
23025e6850726fcc6342f819681748ad58b8751e
F20101221_AABZAH do_p_Page_123.jp2
1e3ddb28f1359511c07f25d221999aab
bb0069f7852b1fc0ad558437d7b14e346b025a84
9055 F20101221_AABZXP do_p_Page_120thm.jpg
ec1b47477c5f75f8a19f7ba8d5b7df27
1627a6fccd06d10e8a76fd4c37ba86dbb991e327
1051872 F20101221_AABYUN do_p_Page_165.jp2
57030587f55ccc8f4026820c22520a4d
ee217950ee4e1682252c93ec689dda63e5861c00
F20101221_AABYTZ do_p_Page_055.tif
1c6b59ba200e2a04ff68e67aff849c82
bee0930e5cb253575e6dbe46b589a3ba00824c15
25065 F20101221_AABZAI do_p_Page_050.QC.jpg
9dfd7d210b09a13afc1e3cac6fb7e4c5
203748bc3491d4a7a6865fb926902d249ecfa0a0
36275 F20101221_AABZYE do_p_Page_150.QC.jpg
34e212d133740e2db98cbbaf0d339771
ddf922be1c28d275bd9538525765741a96b2c535
39097 F20101221_AABZXQ do_p_Page_123.QC.jpg
fecb6aa7cb685f32c616f73e20d25ec6
6f8e32394c392fc930827e25342de3c4d77b1485
F20101221_AABYUO do_p_Page_099.tif
ed7bb56ed9ebab5986ecbe3c4b99646e
7084b95f6a046132556ec140a36b3f3f8cd9ab9b
37917 F20101221_AABZAJ do_p_Page_106.QC.jpg
f6f45919a24f04152a7f26c59fad38db
8dbfe188be5f68d0ac8f61a6a3ea9d473d78cbba
106558 F20101221_AABYVC do_p_Page_103.jpg
406eb093ca28d36ec7607cd4d2a9355d
b87638004dbd777e7a1fd1e7f6f8668a89f15158
2373 F20101221_AABZYF do_p_Page_153thm.jpg
c411074ab5216f621c23fe98685a225d
b0e1fa3357c8dbed1b7ba164dcb35d7eefbd0811
3556 F20101221_AABZXR do_p_Page_126thm.jpg
44afcf8306cd65b4306e2e584fe0facd
34ba1b216e460532e0a2655f78d81b2268789126
2171 F20101221_AABYUP do_p_Page_031.txt
c84ce696f9370889a0874fd29856340c
1c75c471b5cbd437d4c620c336078a20e0eab6e6
49184 F20101221_AABZAK do_p_Page_017.pro
ca5250033e74ac96f529f1e5d8f03dfe
75948bc86376c0a2e5ad6ded7375f486be346619
2763 F20101221_AABYVD do_p_Page_173.txt
f6fb21bbf2127f29173bee276f1a471b
6e2f4f4dec6832671e91033d17f804b7d87eb3e1
4238 F20101221_AABZYG do_p_Page_154thm.jpg
d1c9dde68dcb3ad589524d4a24d09fdc
a8d2ad03d1a6a8b8514a31f8e267c1bba09ab28a
2811 F20101221_AABZXS do_p_Page_129thm.jpg
0579de2c4bf39ed241d08a06d3d8a8d2
2d49f1e37d6a164b98e742b0c1951e6590ff0ed2
4901 F20101221_AABYUQ do_p_Page_016.QC.jpg
f98effbf72fd9d3aff80322317698924
957169f951b091c9432bba63705539d092dc233e
F20101221_AABZAL do_p_Page_122.tif
bf31077fef06fc31d33ba5f16de97be0
a23d7ecd313ed39e2e66acd80b7c97720b5183c4
F20101221_AABYVE do_p_Page_065.tif
704df7bbf4124eef82b093e98e053949
e868e33feaded55d58dc92a8f4ebb4bbc1202624
4125 F20101221_AABZYH do_p_Page_155thm.jpg
4b217922b8e9b17772d6d7ed94825fb5
a4a977ab1cfe37165abc10c570d6e7304c9542c8
2638 F20101221_AABZXT do_p_Page_131thm.jpg
24589ffd87ef3dffd33022eeee256b73
97607e1f4de20b228775ad5e0c792a8b54ba12e9
49855 F20101221_AABYUR do_p_Page_146.jpg
a786f7842da8275adcfe37d674f98bb7
b57d8a703ebc7f6566d1927113ef5995d6246702
10664 F20101221_AABZBA do_p_Page_088.pro
97e82368437020f331b7de5054f02b4d
c9f5ffa0d95a21d6e4f587687de8da1b871b8823
79887 F20101221_AABYVF do_p_Page_093.jpg
9ebcaa8f0445c4c2a97caea728053f53
a9e69e7f39a7834f759033fead23eb647458d0a7
37936 F20101221_AABZYI do_p_Page_162.QC.jpg
b75281130ad8ccd8857e3654ab39aac2
40f02e4e4b00fb3448a81c65fb6c02935be249ed
2672 F20101221_AABZXU do_p_Page_132thm.jpg
c62f33d3884f750a3076070906e1ebce
0638e73f241a8e64b8e7fa5f7786c51c102d706e
1051908 F20101221_AABYUS do_p_Page_122.jp2
c8bf79c65b4089ed0874c32f61ee96ae
a1caf9aca00898ee38d81c086664ca8dd75f6c34
F20101221_AABZBB do_p_Page_046.jp2
ccd4497484611e2c5bf399231aebd3f0
04efdbe0a273385151ca7bac75ec72ee4534bcb1
19313 F20101221_AABZAM do_p_Page_146.pro
c9647db862b3215b791de18d711feeb4
00460c08530ff0043cfc631fff7e4192958cb2c8
1710 F20101221_AABYVG do_p_Page_049thm.jpg
e3da166058a0c3ae52b1856558b8c84f
b7bfa73e54603c538be4b4cd161ea086b32219a5
9660 F20101221_AABZYJ do_p_Page_163thm.jpg
affd2821081cf4cca23c03f019acb76f
d50ac24818fbf1e84a7ce6677d39f8687bb7960a
10474 F20101221_AABZXV do_p_Page_133.QC.jpg
48ae9b0c1fba1a9dd8b0428c16952318
20a47ce4b586e4cb043c69a8d5b2b3b1b1d80f3a
2508 F20101221_AABYUT do_p_Page_167.txt
9427c6225b9b19ae5be7f6257b23d5c6
754d1f33f3c230e899983ddb2855a45d8bf9de96
8785 F20101221_AABZBC do_p_Page_151thm.jpg
2cbad137665c41541d4017eb49b107d3
9dfffa5364844a3656d2bcee7ec613899ff52f0a
6232 F20101221_AABZAN do_p_Page_008thm.jpg
7e800c4f84b97cd17af8150fce26b9f8
458898d415bd52fb2f705ee8d0717bee3bfbc226
170304 F20101221_AABYVH do_p_Page_097.jp2
b3154b34c96c3268bd979330adf47550
a6c08c02ae7177b8905289df5a719af8819435cb
40927 F20101221_AABZYK do_p_Page_169.QC.jpg
a8716cc503c013e90093e7c7a391634b
30cab7cb31a176649a901c6fac490826ab80098f
17461 F20101221_AABZXW do_p_Page_140.QC.jpg
7c4562bc43bd203c44b785c5cb74f5cb
b241661a44eb2ef33efa972dbfa991b8b4873ba3
102067 F20101221_AABYUU do_p_Page_030.jpg
7dca7a9467c0e0166e608549444c9879
797640d42e5f4b98cee05fc514ff97449bfc9277
36088 F20101221_AABZBD do_p_Page_082.QC.jpg
d176c0734d5e317458f2a8f5ccf5b53d
83a827fd68123965489a0b62048a52f8f86e0914
8609 F20101221_AABZAO do_p_Page_081thm.jpg
9de26f26c4559800bc0a41d382deb2e9
7eb78fae6495889af6210084022e03e4d720d41a
114288 F20101221_AABYVI do_p_Page_059.jpg
f1e15eaaa7de8fd218b2d9c96d8f4d18
143a58a6916fb83ff21a4c5e01edeac87c7ed549
39062 F20101221_AABZYL do_p_Page_170.QC.jpg
94515ab4045508ab83b7ea028d376d67
6d57a959a209fa8ebf0d4486691691550aa078d2
7060 F20101221_AABZXX do_p_Page_142thm.jpg
ed1c758fbe624ab10599f3f7384510d4
752a88f1fe46aebff7990c4a0da2e57af7caa457
F20101221_AABYUV do_p_Page_173.tif
ffc9aed05f03ca6cdb2d6b9c16b1c81a
8c8ca4b695086474e58a61a784de07609b5d5f68
8341 F20101221_AABZBE do_p_Page_032thm.jpg
10fef6b8f7b3986d79a1998b2bd0c992
1e67cf22e4f75adb738422dc3f03cb70e7b9006e
146140 F20101221_AABZAP do_p_Page_159.jpg
22437d12c038542a46604e834263c484
17e0b51ea983e29d5edbecf3b4d60f6004c3a51e
F20101221_AABYVJ do_p_Page_125.tif
f074fcf19b13640f51476d12c07811ea
441f2ea33e5d59ea87f5355ee26ca70a709cc86a
38272 F20101221_AABZYM do_p_Page_172.QC.jpg
827663d329fa5c24721d61b3447d4957
0d4d478950f23aefde4cc6cb5f837ea04a8c99be
4487 F20101221_AABZXY do_p_Page_143thm.jpg
bb5c9e11d5ed208780f12e46a9ae296c
2f5a5c34e68d4c74aa8efcbf8f1b294943b25802
2137 F20101221_AABYUW do_p_Page_023.txt
2ff69a758f13712ae3e01a19066603d6
676f1389fbfcfb98a8bff9c52343e576126f9fdf
F20101221_AABZBF do_p_Page_149.tif
9f95a2476bc6dd649be5f57765ff18e4
4bea0b2cb1203825769564d1283e0d6471de8179
1048 F20101221_AABZAQ do_p_Page_011.txt
47e218cc996dc7f5b50f2bc8fc25c459
2552ab14620f68655ec8f9d71678c4aff016769b
1051943 F20101221_AABYVK do_p_Page_163.jp2
2036ec4739b69cceed9b4e9188dff338
2d4134810557a4bf10e4b0c6ff3eb46d5a55d73f
6886 F20101221_AABZYN do_p_Page_175thm.jpg
3b931678b3978f6f562269590d6cc746
02660ee0de8a2254d0f9d70dc47ed547954b9829
13802 F20101221_AABZXZ do_p_Page_144.QC.jpg
6c0b90f364c82ee92279f9853549e932
51cc35e9ed1ece14b18f2ce23c8fcee43bab2f3a
2047 F20101221_AABYUX do_p_Page_087.txt
c096f3e268738a362ca643949a616f16
00d99bb860e600cd025311f4d76d17dce8cded08
9782 F20101221_AABZBG do_p_Page_168thm.jpg
8d406bdec27267edf6379d4e9f9f79b8
511b31cb596a5bf417d161381ad46782a9b1237d
55055 F20101221_AABYWA do_p_Page_104.pro
5b9f8901ef425d66fe647426148e1b08
f80f7a60518f1ce39489865c66fae50da085725e
51524 F20101221_AABZAR do_p_Page_111.pro
8d032cd05a09ea5df735f936c4170dc0
78c46535e097c43ca8e247969e8586e71e203d76
1051933 F20101221_AABYVL do_p_Page_048.jp2
00ea36732096c62af29a0ff03cfbe7b6
b30912ce84a9691150d6f2645ec00631de709895
1499 F20101221_AABYUY do_p_Page_051.txt
d97b09b38e89f9e546fc15d72c3c81d1
f4011b7c7a999a7c3ba9bd9549c08a4496814329
36849 F20101221_AABZBH do_p_Page_067.pro
b8839886bcd51cbcaab5c0b9e390e36b
6d6c038aeca8ed6003feebf8c6e9514bf10eaf0e
F20101221_AABYWB do_p_Page_116.tif
62692b1b6ee6311a5dc7bf0fdb70f4c9
2e7c0de41980d6fe711e8616b86faf66e0ed8d6f
2071 F20101221_AABZAS do_p_Page_075.txt
9523525403930a6d05530e0d81e50752
afd73e82df79754b99c62213d9bb6503eca80065
555776 F20101221_AABYVM do_p_Page_134.jp2
80efad54fdfba357ef630faddf8581be
a6fa41b04704514c78d63d6be94b8e5cce123414
53442 F20101221_AABYUZ do_p_Page_110.pro
56c0ff3da887766569c6a0c27f39e882
c3876e7ec8af7b5ad57f98912b1995d5b97eb73a
559756 F20101221_AABZBI do_p_Page_136.jp2
72bea378f3da04fe0ce32f1e5fc7f076
08ad25048b242554edb6c6231bec8a72a0ac2184
54283 F20101221_AABYWC do_p_Page_122.pro
ff9edbec50b0a158ab68ef62614d135c
87eb2e410a69f31924f7a20e2b51a72ad9980f65
51548 F20101221_AABZAT do_p_Page_114.pro
9773ce4f0009b23e8647db4ad5cc4cb9
5deba1c9a01e8a59599868b0762cdd6e815b1448
79600 F20101221_AABYVN do_p_Page_066.jpg
73c78826ea890c19f67f763f96db38c3
426f2cacfe2905fece0cdbf8926a28148d8cf5f5
2567 F20101221_AABZBJ do_p_Page_156.txt
9663071769691a63c3af08d7cb1f8100
3f57d97a0c5dad8fa3ff01c7c3b6f548857b58b4
39281 F20101221_AABZAU do_p_Page_121.QC.jpg
6806458c5fb1523441a643bd0809bc5d
2c4c2bd1d6b5a2840ddf17dbc6f5f360caef4811
67245 F20101221_AABYVO do_p_Page_173.pro
817b1aa5cf3bc8e3bad0ae5c6c916ebf
ed96b30f23a3ed63cb6e843c6f6e7f441374eb2f
F20101221_AABZBK do_p_Page_053.jp2
b8b2015ec2fb30f4cb6561d70cf9316c
06c83ac94b996072f1cae703cb5713e0f33e226e
68120 F20101221_AABYWD do_p_Page_165.pro
33c844b4de0cdd13a0d3d42db5646c57
1794748f8c5f641ae339b39ee3d4b495d41011e1
F20101221_AABZAV do_p_Page_117.tif
0b9e9ba43bb9c56209f848b7eb717c16
74bd28f9d2f98ebab10c3ddbd63d9690427de528
F20101221_AABYVP do_p_Page_161.tif
45ac51588e42ba5b0942f91c922a2b75
33235725fec9136a6dc1dc414f67d24580e2ce48
17542 F20101221_AABZBL do_p_Page_128.QC.jpg
707a0bf6ca5ae9872f92aa0113327fc5
a0e66e97dab23bb69809fd3fe6c70ecb77cb5d0a
6915 F20101221_AABYWE do_p_Page_050thm.jpg
3f0fb1c7535d75e7dbb8136024a6c72a
044309e1de182c6075308a1ddd21e6e3acd65d4a
2571 F20101221_AABZAW do_p_Page_164.txt
1218e3a30c8d17751e739993a33b69a6
abbfb83f57a93435d4bbfc8ef8e28a6c75dae65e
2475 F20101221_AABYVQ do_p_Page_161.txt
82a2371aafdfa35decc682d179163d0e
3f3b29b86c19b902f481e438fe221334ded6e4fd
39627 F20101221_AABZBM do_p_Page_107.QC.jpg
473be11324b2cd769204c5ed201c9266
2aa943ce8e822d3d971bc3634e97444abf267754
64351 F20101221_AABYWF do_p_Page_174.jpg
5c2b8cfe114bf508d0b7965f863fcbcb
d37346c59ef563fc7b0d6f9d177a69ee7e15c8eb
55856 F20101221_AABZAX do_p_Page_039.pro
6bf7f875a471e5c6f82136651e57c583
5b827101dbdec8f6953163c3fbb25a91ad923a72
13762 F20101221_AABYVR do_p_Page_098.pro
1a78c292871ead9c398c0cdecdcbc62b
7a5813e03354ee358623dece86c92d9a1d82ba3c
52286 F20101221_AABZCA do_p_Page_041.pro
aa12b4f7e1b8c0ce14ea5e847feeea05
aa56e71bd8ff38637140aecea980b00219411488
24753 F20101221_AABYWG do_p_Page_005.QC.jpg
f1303363123f4de9d7156d009d1d6c26
ade54a76631424655efef48faa17a602190232c9
F20101221_AABZAY do_p_Page_078.tif
4d25f775a4e4e92c127242f79cd24862
1e39451d43277c68626e338920c2def387f1a88b
110686 F20101221_AABYVS do_p_Page_031.jpg
f4e6f2b44686d4ee63af414fec09d717
6390042378a60057a9d8ca18aa5bded23eee40b3
39209 F20101221_AABZCB do_p_Page_173.QC.jpg
688363ada05039693b0a90d996f1f03c
c006ecec8dfc586e38078d6a240b37c5b4825671
50130 F20101221_AABZBN do_p_Page_135.jpg
87f1683d998db6a1c8932a7633001a98
f1b01ed315e532db020e94f8a2268e0fde9382f6
1051945 F20101221_AABYWH do_p_Page_074.jp2
33a88014cd699c9f3dab973591a015e2
7d030a0fa77d0306a09694e10098f8b6fbc96092
6525 F20101221_AABZAZ do_p_Page_049.QC.jpg
54765b0ce2b63367118d2f46e8bd7d04
77ef60cbdb7a39df37cfedd4efb70814d240871b
43276 F20101221_AABYVT do_p_Page_096.jpg
d6c7f16d07a79e2abd464ef8248abde4
7dda8cbbb74519d9e23585876027c514b8e68fad
42409 F20101221_AABZCC do_p_Page_090.pro
6f923d33431fd60e1d6e9ef7f4a3aa89
039f64627c6c8d55d9bd1c7672a493b63eeee674
426 F20101221_AABZBO do_p_Page_088.txt
49e13b08fe63cfcb1078f1177591e92b
12697ca4e4ca83e536fececa791536e1c6a16f5d
1124 F20101221_AABYWI do_p_Page_050.txt
075404734cae3a63f9baae5333595cff
7eedeaa71a639cd4fe0393f0b2adaf642b705172
F20101221_AABYVU do_p_Page_107.jp2
27e357e5b45914268ddcc2d20d707326
58dda8e9346a50bbd51296fd516ac6780bfcdad0
66463 F20101221_AABZCD do_p_Page_162.pro
5fc5313551ca3e6a47ed6c3041daa5b3
dbe2e74aa66c2e7a17b8880ca57096308374861c
F20101221_AABZBP do_p_Page_160.jp2
ab64c9854d429307ddab72d758bb2d81
ae572da620ccf097ac3429592b2fe6ff574cfaa4
6075 F20101221_AABYWJ do_p_Page_144.pro
fd96abba9a369bb1631c41669ddebdb0
d7fc9569dcdf3a06970ad2ec0baa6d20ae519d05
35544 F20101221_AABYVV do_p_Page_023.QC.jpg
a35f2f44a1ce16d9a6a9acd5b561bf87
f0f1c19dd2476ca19c43a8cd577f7690ca1d2816
2154 F20101221_AABZCE do_p_Page_116.txt
1fa50437268c22f6126989e8fb599aa3
6b2c3d4442456b4dc0a85b60eb25077228a2a03d
F20101221_AABZBQ do_p_Page_131.tif
7ba35fd1362979d5b452dbfe50f831e7
4c3b183b167820ba5ea5d4a95f63f31fd8cafde8
102565 F20101221_AABYWK do_p_Page_020.jpg
6bb9dc9fb52144d1188f08639b8e9af7
7505a136ec0cc8b9ba6cf10126b0b33425ac1cf4
9110 F20101221_AABYVW do_p_Page_073thm.jpg
d2b40b8ef763ee7028037891a20af553
eedbc46ac7f153d79e9ecb5f54aea92465256fdc
112372 F20101221_AABZCF do_p_Page_029.jpg
7469d7d990ff5fdf5c36bf24bf9264eb
c19b69f8e250e7b2c234cae91329f8c2ea77b87a
F20101221_AABYXA do_p_Page_151.jp2
c3b8262a9e21d11877c88aeda92c28a9
bce60343767f39d4ab8085863da03ec016c7e01a
8079 F20101221_AABZBR do_p_Page_079thm.jpg
32540b56285b65c0618fecdfc24c71cf
03d6094bc4dea10d1b4864b36c0a8eb43c9d6461
8853 F20101221_AABYWL do_p_Page_033thm.jpg
a5957f5a2a037ddd0e95a48881266af7
6964035da504cc93dc0865f1032a7a284054c3bf
37170 F20101221_AABYVX do_p_Page_058.QC.jpg
7d59c2a2046be83b1dd1e63d5b299898
ff2e4312a0446430ea9da88cf054f2dfc418da28
35984 F20101221_AABZCG do_p_Page_081.QC.jpg
45b64ff367d3a4c46013b32a9c84340e
873eeb3e34ea61cd0b2fb655cb04ad6895dbdf88
1051902 F20101221_AABYXB do_p_Page_054.jp2
07728f27b21d02a5fa3ccbb44d396da3
db747316de5041df335747c328eb6ae843213001
2168 F20101221_AABZBS do_p_Page_074.txt
8253490d03b18f7629a4c8a04146e900
237c95265c02663219df68ca0128cddd7d29355f
19468 F20101221_AABYWM do_p_Page_014.QC.jpg
b0b59720d60ed7c7d35bf3ee39685540
09efa4c5b2d2d98dff076e5e175021ed4ce21ce0
1061 F20101221_AABYVY do_p_Page_155.txt
f201309a3f24a6ea4bcdb9f7a57fd0e0
cb19ad75ddce79e19f836b7a9819c87632b90f71
1101 F20101221_AABZCH do_p_Page_002.QC.jpg
273b567d4ce014208c6540101a2d50a8
63f7f80ca39dc4ace284268d63814f05b7deea84
34385 F20101221_AABYXC do_p_Page_037.QC.jpg
dae97075e884f1ea7b4983be4e48b654
a0a3e27864a37a9a1685b82d3161f4041c00e080
9648 F20101221_AABZBT do_p_Page_173thm.jpg
aa51b5a407a59b5fa15a1318ff4b4309
35b550e1eae239c9d217053ec11ac8cfbab61d20
1051921 F20101221_AABYWN do_p_Page_116.jp2
6e5d7b2937ba515ffba8b391be7b5291
403315ce08d40f3e0997e7ca01c1e059b5877ad8
576940 F20101221_AABYVZ do_p_Page_013.jp2
4d3e18837301e2c31b1982d21a72d9c6
5efe2e3cb33b7b19ce943e6ee8fcd54e16321e22
F20101221_AABZCI do_p_Page_071.txt
7cb9009c755929db807b3ee3d4de92bc
e57777297b69e2ade42551b5412946cfc6cfffd7
F20101221_AABYXD do_p_Page_122thm.jpg
d9dec9f4df4e3aa4fda6cdff685f19d1
2167ede89989ce25dd0f7122ed3deeb66f3b810d
9420 F20101221_AABZBU do_p_Page_158thm.jpg
5eb08b166674836853a9fe71caa208b6
6acc3baf4b244d513f73f310bd4754f882befb90
18071 F20101221_AABYWO do_p_Page_147.pro
c6550ce144d508d54b502aa8f79bf658
113d0a28ab1fa82f3a2f10f434b16396b45a0696
53215 F20101221_AABZCJ do_p_Page_047.pro
83cf54e90f6dedcd347716c6348c6da8
5426df0cb08dd9c957304e79daafe5192501864f
103164 F20101221_AABZBV do_p_Page_102.jpg
e64ad817c0383c08117d83117fed1c46
21f4cc6f9c18b862a79aa42d04d220dbb507ab6e
91447 F20101221_AABYWP do_p_Page_027.jpg
154b3d4a37ae46a4c2bc2ad76cbb8083
6e581d6b0ce304ccdcd07967abac0f52aa57a3fd
14732 F20101221_AABZCK do_p_Page_126.QC.jpg
9a2d41a911be9b19122a05b212bddfca
7b438c57be1eced4358f9183f0115bf44dd893d1
2135 F20101221_AABYXE do_p_Page_112.txt
e1cd6847d8ad914ee975b318a88890e0
352b0eb5b0865f11bcd85cc4b99b53be34000ece
588421 F20101221_AABZBW do_p_Page_138.jp2
4f5826255e2ea4fad2c46902683b5669
69c7e7b25fd0859c5ac43a4a8770f68e1db33fcd
F20101221_AABYWQ do_p_Page_040.tif
3bd3efbb851d7453f96520989545e466
a2924ee5e27722f34a29ad5d406e9d59cf56bd33
1681 F20101221_AABZCL do_p_Page_095.txt
4cf2b548c90bc519d33de26bbd536464
6649608c484f93eb02ed869af25901176b13bc35
F20101221_AABYXF do_p_Page_077.tif
28056af823655519fd7f15e6af938443
b23ec62c0f1618f31597a5a80d961afec5b9e408
2551 F20101221_AABZBX do_p_Page_100.txt
736e266f31689e5ad0d956d2dbe33dbe
78d9dcca219721a5ffe3effb6ac31506bd8c27d1
F20101221_AABYWR do_p_Page_089.tif
39b65068b289164c700421fe2127cae2
d618854dc8e8c6ee71d5fd8ba4bd6a465a674aab
F20101221_AABZDA do_p_Page_111.tif
e6a6e9a4065619105eb2f3461a78e166
2b86d4a23cc8c227ce6814a009d067ff7455a20e
F20101221_AABZCM do_p_Page_089.jp2
2e4e2cee47dc36a5451fc368dc084b18
9e1d1b7b0f4972359f4f218adc3dc397df3b0541
105188 F20101221_AABYXG do_p_Page_113.jpg
67a9a5e28090bd3e7d5378fbcf18ea8d
601c08b5705e14a0ffe4ecf33e2942722270770d
8983 F20101221_AABZBY do_p_Page_040thm.jpg
8511d4076510d5ba80e793855c5d2b91
4a80c36cd698b91395a4ca4360a7ed8eebc5c6b4
112651 F20101221_AABYWS do_p_Page_054.jpg
f7482c50aab4891cad76cfb8e6edc97a
036548a4855973cba8b6eb3bda70b0f04ab36adf
1051924 F20101221_AABZDB do_p_Page_058.jp2
7fd29a8f9cd8286a73378bb868e2a050
32f4df30fa9a97345c4f055a44ee1f1c386721a2
35755 F20101221_AABZCN do_p_Page_019.QC.jpg
eecd7f0c54843409b38474d5299da171
a24f5c518b61d2eb21bf00b3ce6370b72f1ad759
44570 F20101221_AABYXH do_p_Page_079.pro
4646db59727afe24fd36039c3caadb02
026031872a86b01c8d2c25f3eb02636e55f517b0
F20101221_AABZBZ do_p_Page_088.tif
748ad0343e117709ae62cb932c258297
c3bde5d378d8da47fdb204efc3d6551ce565ee2d
F20101221_AABYWT do_p_Page_104.tif
c8992ce2fffb65dcdd32f5bd177096be
283d108628f745b160b38bd4ac7901c946e2f278
272 F20101221_AABZDC do_p_Page_097.txt
4f3824b69bf8a9a6eb67d042d34dfa3e
07eb6b75500bae75157a9169c6ed7d37533d51f8
23622 F20101221_AABYXI do_p_Page_096.pro
9545571c170927d5fe514bd033f41085
f4757df74cde3b8c6eaa0ec86233f0139015aa01
8637 F20101221_AABYWU do_p_Page_001.QC.jpg
1b15ba09373fe6ec32dcce6c7ca239cf
c7187721d0d6fe61a97cdece1a0c495401ae210a
55616 F20101221_AABZDD do_p_Page_029.pro
764e8df36c50caaaddc39047cefcbb6c
7134531fef82761b19f7f76d75fb6dd75dcbbf68
36580 F20101221_AABZCO do_p_Page_151.QC.jpg
f07ffe944572b72b6ca4218d236f835c
4fd4386b831c7876d3b39afcb2f4ddc321148793
37986 F20101221_AABYXJ do_p_Page_029.QC.jpg
2c2ce3d31021b3a77c28b8bffc4527c4
4f9293b17e5af244d7f0b13d20da1478724babe5
4884 F20101221_AABYWV do_p_Page_095thm.jpg
dc8242e0853ce2a2dde7d557917c4304
f6cdea76e20960388e47a67ae1b20d6c6cd0aae9
F20101221_AABZDE do_p_Page_023.jp2
fe384c8d4e6edca8482d6bbbc126d4f5
24353847cf2ac911029a1797973afbbbc9596ee7
F20101221_AABZCP do_p_Page_082.tif
109e8c21077cfabee1429fed0381d1f1
ba7d32ac049673f9fb1753f0a0ea96ced5675ddc
2103 F20101221_AABYXK do_p_Page_060.txt
0f302a44d1f6948d25f16e46575323f0
30c27c4c0b5f344bd166401d325c8246fc0e975f
F20101221_AABYWW do_p_Page_110.jp2
e8df094f2b8de43f1ffe29743d5f5972
88fc37536f00cc0ca6f440c71fbed3fd4bc7378c
807 F20101221_AABZDF do_p_Page_154.txt
91ba5a4c81d7ea0f84993b7d964453e9
ff7891988d236da96d344e62d383712780ca3551
130074 F20101221_AABZCQ do_p_Page_162.jpg
ce6d1f4cfcb8673f78ea4f2b787ef15f
171d23b5463bfb7073d3c49fa2be36f2035200b6
38389 F20101221_AABYXL do_p_Page_160.QC.jpg
8801c4a21a274329cc83030d6ebe1750
da5d8a4c7f87775dfd5cc7f31b8de29080fcd30b
22785 F20101221_AABYWX do_p_Page_136.pro
a7b2fced3bd577f17f45a243babd2231
c41b86abdb3b56971c53e1b321f2d64d95026178
75517 F20101221_AABZDG do_p_Page_145.jpg
1416208968bdbc669b8ed5bb2e22bfda
e324315b662b3494cbc70d47857f50bae0dde91c
113734 F20101221_AABYYA do_p_Page_106.jpg
cb0d85d0fc56ef26bb31389d4478c0c2
1e55df5150c7533dbf99cc801ffd9d03803ee88e
F20101221_AABZCR do_p_Page_168.jp2
3c6e96ac89b0c76b5d80e4be64e250c4
59aa858f915beaca1547b58b824d1f8902de1c14
1916 F20101221_AABYXM do_p_Page_090.txt
9f485beb13c7d53f42acd339546439c7
a295bbcb2ad268b59a94308ee0168b6fd1edcd50
F20101221_AABYWY do_p_Page_150.tif
d3b8f6f8d6c8cda58d7ad56295f0f13b
661c06e7a437bcec6406da34920e29c1f23f2246
60691 F20101221_AABZDH do_p_Page_089.jpg
3d6d22eea59af1bc4e3e92033cdfdc07
95dcaaad12e33e3bebab2fa14df154327169dd9d
24009 F20101221_AABYYB do_p_Page_050.pro
b902fba6c523f99bc2d9d051d1a052d8
c5686ccf8557f4bcd16365435fa7c1d952f7107b
F20101221_AABZCS do_p_Page_157.tif
b166c4451fdce335496bc6fac6bc39a8
372bfd5bc355e472256ce32950273bfed6194d86
1262 F20101221_AABYXN do_p_Page_132.txt
ae0d2d59a84fc24caca46cd57cad0368
f6eeb1ad986bfa012aeb7530ed69f08e287bbd2b
F20101221_AABYWZ do_p_Page_009.QC.jpg
8e66c32388f3d79f93530835afb2f407
65e660fadd95838eac428c6e52fdb54fa4b27c09
122473 F20101221_AABZDI do_p_Page_006.pro
65c5e113a380c7358ceaaff738413149
0e2d4bd2acc7e68dc9523e3d94aef73aa24528d4
F20101221_AABYYC do_p_Page_146.tif
cf844e7c899a627dbdc24023ef169207
87a0cab957b88b37f8ac40506ca4b57e214bec3d
33474 F20101221_AABZCT do_p_Page_017.QC.jpg
2e10963ed9d6a55ca9f29a54043f72bd
3a3bb6d9eaaafd844c2b0a9067f7e4f58ab2df7a
24273 F20101221_AABYXO do_p_Page_155.pro
cfc633ca213205c1394db699ab5c6b79
049c5cd664e1d9438ba2c6592f7a8c6de8bc79b2
9171 F20101221_AABZDJ do_p_Page_046thm.jpg
e3df77326ef0112cff54de93f8935385
dd76c20b1231b4619b3c69af0dab9d17f8f49d06
F20101221_AABYYD do_p_Page_172.tif
226e5353c4d949ab5958ee0408117777
4351bd8f9df45bd24d96bb4b29fc5cdd112440df
F20101221_AABZCU do_p_Page_145.tif
d6cfb68c8ad4c3a8da35f1025c376f5f
0be7d80e7228230c32207ee476de98c4be1026bd
111193 F20101221_AABYXP do_p_Page_150.jpg
0a757d80d4aeea3ab3ccd07d1c75d61a
9375c654ffc1a8d5ecb001a99141510b27d47aed
1050 F20101221_AABZDK do_p_Page_141.txt
af7f54d68dc6772b415b291e0e1ed137
6c8524eaf45c9fe0a48e8a708acb6c619343304c
F20101221_AABYYE do_p_Page_021.txt
28f8133bfe5fc7101893614462b7a098
c0eec2fac62a182918c38a9abd01bb358e1fed9e
2092 F20101221_AABZCV do_p_Page_110.txt
0ced1bddd117bd40bf2706ae911e0606
0cb775039e39fb295dd98924a57f05241612a5da
54137 F20101221_AABYXQ do_p_Page_120.pro
444d197ac408d990732251d7152ecb9b
9fb5c6aff1915ae69c401a419e9a3a5f3e7ca8bf
8720 F20101221_AABZDL do_p_Page_020thm.jpg
a6e296ee7a6e6dfd5e97ff12b56d1d08
49d194848db8ded37ce82225972cb7d80738a2f9
103628 F20101221_AABZCW do_p_Page_072.jpg
9a4243f4e577d762c6edb3dda124b959
a142e5ec7dec91d9cc80152da89b953832b8db1d
F20101221_AABYXR do_p_Page_022.jp2
a101aa367318e722033909f656048d3d
073755e7c85db13cc3e249fd427e1925a85d2814
F20101221_AABZEA do_p_Page_056.txt
d4ed1c071a0bf13cd371a0d9e49a9d4d
0282e6f79f6127ffd017b122c8c409bcc914aec1
15543 F20101221_AABZDM do_p_Page_146.QC.jpg
d75110ab1a17e173bafd258a0d378892
7cf23382a24d6973ddf5a63c094217024459f144
99072 F20101221_AABYYF do_p_Page_005.pro
96015d2e001f4bc226b7dc223ecc047c
a5e7d32cc385ea2c1246a9398ee16e853d46a9e5
32470 F20101221_AABZCX do_p_Page_068.pro
575b7b115d9d53c359f9e229ecb8082e
ebbb17fc170966827ca577da80e52a84693c810b
26132 F20101221_AABYXS do_p_Page_124.QC.jpg
1f79178fcdbace1e6db3b34d1c9a4941
52b306750333bf04100eb7b3da2877ff60b31d90
107533 F20101221_AABZEB do_p_Page_062.jpg
919315d9080417d1410a0a5d126603da
de9c3e7efd6fb94bb1cf8cc752688b9870f78d64
112627 F20101221_AABZDN do_p_Page_108.jpg
4fb486919b93b4a8c5496f317a19557e
dbf530cc7ea783fd4dd676a2da64583166fc8481
2180 F20101221_AABYYG do_p_Page_054.txt
f1ae813369952c51580bbcc47cfcd0b7
f19bbd409702f691a1f8e8d93d83c0eb05aa3116
112817 F20101221_AABZCY do_p_Page_117.jpg
e624cc237a4fb2663d9b123932045e65
8656d86cb66cc62935ed38e5b3c3f771824bdcc1
1032346 F20101221_AABYXT do_p_Page_028.jp2
dc3946ecd752f355d6d2682377a9f242
47df3815f9ce081280445c6901599aadf34b1db7
2767 F20101221_AABZEC do_p_Page_052thm.jpg
5ea167a71746b4e1fdf30af982f5db77
f223ca56f924041568dce74929956d64d1756179
533937 F20101221_AABZDO do_p_Page_155.jp2
87c3596694191c286b30210ff0e9b534
7a50b557ba36ff22bc68004ce3498d1ded945b45
9106 F20101221_AABYYH do_p_Page_105thm.jpg
ad596c8a6e7d6fc550c350b100fc8f2f
cd8e69ab5918f90ed14169bdbd845c3253a58b1e
54082 F20101221_AABZCZ do_p_Page_021.pro
99f7cf47a6866a98b998091c93df737b
d8e2dd19a6d86e6b6c7b14cf24e2d1379b97e7b4
F20101221_AABYXU do_p_Page_001.tif
1050dadd182ccce45bb257b076559561
c8002f150e4b89b1bdb6b6fbb55364e2e3c03c82
F20101221_AABZED do_p_Page_167.tif
20918c9c11b223c1f2027037cf89e638
7c25de7f004918406771786f4ba3134d69dea80f
4975 F20101221_AABYYI do_p_Page_140thm.jpg
b97e1e257ffe9fce9189319cfbe82ea9
46faa71665ebc5b950db50bdf36f2f13cee1c44c
45134 F20101221_AABYXV do_p_Page_127.jpg
f06cd0798802fd6e7f60ebf26565b8a1
ec0538464fdb32550a0fdace18de46d6b29a453b
41560 F20101221_AABZEE do_p_Page_134.jpg
1a6e6dff2833fff1a5450c8c6d2461e4
20d26621d8563642955155db5a0ae819421782a1
491354 F20101221_AABZDP do_p_Page_015.jp2
e82ddba75bada6566ba48eb3c6e06d62
0d78b43b368274ab37a46d8d722a17ea99c8d454
52881 F20101221_AABYYJ do_p_Page_065.pro
b3dd73cdb33ed654e1bb542745c4fdd0
6a4aeeeb37ef0b80fc11c655d780590eb5d9ccb4
132865 F20101221_AABYXW do_p_Page_158.jpg
57b4749348a75114ad3540f05e8bf6fa
6faef3040e97cfe9e8d16a4a746e20454e3ab3fc
35742 F20101221_AABZEF do_p_Page_114.QC.jpg
b803f3f99c59f71758eddc2b09b08101
04cd018e6705667ac1ec9956bf6a92ac2a20a355
53125 F20101221_AABZDQ do_p_Page_150.pro
877e16810303810d8f283ad6a9e9b24e
d150a9382ec3e02c6ea282efc1adea251632516a
46357 F20101221_AABYYK do_p_Page_125.jpg
46d561bd483ebb1ed6cb3ba29e25f527
e0a774aa7db9197c360e3bd6806a643dba991eb6
2161 F20101221_AABYXX do_p_Page_055.txt
36893cf776cb3080ac5cda578063c644
fe40f528b35faac43ab38ef38b503f60ec7fb8e0
F20101221_AABZEG do_p_Page_018.tif
2aea46883a98b38d0ac6977bb942e4aa
6b39810f1f58c691db00b9ab44dd7350d4b44a14
770386 F20101221_AABYZA do_p_Page_127.jp2
2258f3e1c17c46a769adf31a9ae05528
81dc0d6f308b2ed3686d6182b0f44151fe1cf651
F20101221_AABZDR do_p_Page_097.tif
b8cd4976109f94991a4110b0e1d75e83
e6777d478048df5317ae345f1588bd65342c3976
855914 F20101221_AABYYL do_p_Page_050.jp2
da9efe53a6b3fc0edf2931b9218dc432
e43cb77190791590946159540b9bef1a05420512
702 F20101221_AABYXY do_p_Page_143.txt
59b894502290979c640c7b64bfca25d9
5ce0e9bdc03e33b215bf5e7c9ede8e5944e98201
1011386 F20101221_AABZEH do_p_Page_078.jp2
0ef57fdd3c9f311be04b5e2df577b3a3
9faaa58f437553d97bf38dc6e9793bec319e998e
2258 F20101221_AABYZB do_p_Page_107.txt
12979cb1eebfac13008369033f94ae81
048be032ec0788b79a4e6320d5ebea5252602ef7
5052 F20101221_AABZDS do_p_Page_141thm.jpg
854227da5be471973126ee7fc85c9528
a7c719c2d162778e92d725f56cb874705405510c
F20101221_AABYYM do_p_Page_064.jp2
4a8676c5902839fa3eacfdbdbb412a73
733290dfcff5c9ff4b5207cf3dc756c80e90fbde
1051984 F20101221_AABYXZ do_p_Page_034.jp2
8152b7852cf6db6b1c72a22247c0d763
ce3df7938eabbe34ded0b9ac2962faad0f94e3e6
55494 F20101221_AABZEI do_p_Page_074.pro
15ca11460a0c5d2cffc149584c06499d
f863ba621da21e6abc1a13a4a18ceb8cdc534eb1
110570 F20101221_AABYZC do_p_Page_040.jpg
e234c974e475cbb7fb72fc7f58792550
ef22ff752499fec955ff5518b19c0ba8083e7ab8
139491 F20101221_AABZDT do_p_Page_173.jpg
eeb8d9c45d231b24b1b82c7c69c5af18
e1607a8dabd27603b46f086fd6fc432880f2fd74
2615 F20101221_AABYYN do_p_Page_170.txt
12f14fb8fb909f7ee49cdddba772a690
e44585e09821144f68c9b6ab36e676326806ff86
3497 F20101221_AABZEJ do_p_Page_125thm.jpg
d06d9722da3c371431509dad6759dcf1
95c55186fffdb80c136eac1601ca8f08c89bb0cf
641739 F20101221_AABYZD do_p_Page_147.jp2
cd8a77e03309deca9e38ec3815ea0709
f87b38d5e846140efc84d39fad34af079881ae6e
56563 F20101221_AABZDU do_p_Page_136.jpg
3c667e8744c9234ae2f85700670fcfc2
c1a06ac619fab9f53d82c1eb1f4fbffa8560897b
1685 F20101221_AABYYO do_p_Page_175.txt
51799b1e9be9394688811a65ce042641
86ab8d6ff8b975bd61fb0aa63cfc473c934fa53c
37210 F20101221_AABZEK do_p_Page_054.QC.jpg
66d338a1465f92a889fefcb00e516f01
dc516942de6080d40246d0e3c1a3a2c72e27e89a
8886 F20101221_AABYZE do_p_Page_119thm.jpg
2d3e01c41598956be74a5b9ed1426825
614310ab420663485e6ada219d3480a0d195ed2a
116194 F20101221_AABZDV do_p_Page_107.jpg
011618b1be2e83a282a468531e42c247
1ed43e96780789d472dfae1130081420d9e32b7b
21896 F20101221_AABYYP do_p_Page_141.pro
476eae5122d2bfeb2a5b92fc1c653485
aaafcb4a5a6fd740d299492c500b1e991e29f896
2084 F20101221_AABZEL do_p_Page_114.txt
6056b0ce1311a2ab23bd849a0d48b958
fff5b2431bb50c6359eb3cf99ecd9b913162351f
F20101221_AABYZF do_p_Page_112.jp2
1f41f9788d8e343a42a46b8274c7c2bc
738fbc4b4bbfa6974d137ec3566fde3f0de49b06
108006 F20101221_AABZDW do_p_Page_151.jpg
68ad394b0bdd49efae00c32b40285b63
b03eab6067ed637a2cb913d33d22fc8689fb128d
F20101221_AABYYQ do_p_Page_006.tif
b80b26418b929d9b9347dc40f0b5cda5
1ce3118bc9ad400556facbfaa8feb4cb2b2565fb
11877 F20101221_AABZEM do_p_Page_127.QC.jpg
d48f123604b3e05e27d152a3c64c9510
6cbd86ef890ea9dc0897c56b2e08c1e4b434808f
38393 F20101221_AABZDX do_p_Page_118.QC.jpg
3a763e14ee38a949ad0ff9bb1fd13ab7
1c56be3747e87f562cf9c04487d62da1821c23c0
37710 F20101221_AABYYR do_p_Page_086.QC.jpg
f2e36ff69b0c999f976714cbaf38ca7a
f8de050bb4a09ead754b370d59e39333404d328f
9175 F20101221_AABZFA do_p_Page_123thm.jpg
4e100f5581b389e443f93b1c4eb8e4c3
5095e71efc9bb9d7f965294aa9ba12dda7060fb1
112595 F20101221_AABZEN do_p_Page_047.jpg
78b38fded29b27abad34051841523829
12f58d0303f7ffbc0383d046e79795b5997c6254
22935 F20101221_AABYZG do_p_Page_002.jp2
b38df518156d9a2de5cd80a19629fc67
2dd68a217fee935bab2de42ec899b0903645369d
F20101221_AABZDY do_p_Page_148.txt
c648ee6b5237897271fc62529ade44fa
21c2b96ee713023666a22b404d39234b8cd7eecb
F20101221_AABYYS do_p_Page_044.jp2
e45305ce926cbf66b84f63a6503790ca
69eb25e4897ffa74e593005695f04f3e51a49914
594172 F20101221_AABZFB do_p_Page_014.jp2
fa5c01c56326fe921387a9f294e64b3b
bac1fbe29549b74695c0b928ef9a3699dc223e64
113422 F20101221_AABZEO do_p_Page_045.jpg
38df835278a2bc3b69ca9e4000bcd8cd
d5155b2b56032184c9a25b54e1ea412551fb7d41
101044 F20101221_AABYZH do_p_Page_115.jpg
c1a73941446dea9d7b835551e8ff9532
9f7ac3bb5f4f8eba99e551990fce7649b4f622af
64500 F20101221_AABZDZ do_p_Page_170.pro
930d96d7da61894a367b684029dcefeb
dea78662956e0d0ffe95911adfc1d23e4f0f80f7
9073 F20101221_AABYYT do_p_Page_076thm.jpg
00fc8c2708622bb2f19c74be3fdef62b
4c543565016782ceac75b3ecccbd6fa562bccd91
21403 F20101221_AABZFC do_p_Page_097.jpg
95c55b9b622275e0dbb18711ef26ace3
ce005c1a0f2690ca83707f0984c03a05cd8f600b
3205 F20101221_AABZEP do_p_Page_004thm.jpg
4f67b94c33df74a628f632ea56efce69
fad8212e40874fd9de02232e7b54e70b3ff13f6d
36622 F20101221_AABYZI do_p_Page_133.jpg
11cac7d0d3fb53d8f2c5fc7d322c5185
9f375e9e711fd4f3a0bcb4e68cc8bb429454dde6
F20101221_AABYYU do_p_Page_037.jp2
77a8da9b428bbcc3b06d38fd52cde536
ffbd2048c2eb7aa460190d873b43c65ec2cecdf4
1352 F20101221_AABZFD do_p_Page_014.txt
e44f263a169dea23bc6bfbb354761c42
dc0f28b6840870b1adb7faa82d769564dfef2aa5
2079 F20101221_AABYZJ do_p_Page_024.txt
12bab33eeff63f3c73ff2c067d9a37a0
3d36944b918c33e0fd5f14a33f2fbfbdf819978c
F20101221_AABYYV do_p_Page_080.jp2
05c5bb10b33e13760a48c8d6e70cf6f5
71a8bfa39c5e217ad8bb59bd3f6dc85770b800e4
24334 F20101221_AABZFE do_p_Page_138.pro
a8ccc522c2a593360e20b0cba66353c2
2dd03215e9c1de99b88719681866807e3f43fac7
104570 F20101221_AABZEQ do_p_Page_034.jpg
3ca0abfa9ae53990c05f6d0a9aa95166
bf69e6a98c4a6fa34cca8becff2fa10f33775464
456721 F20101221_AABYZK do_p_Page_143.jp2
5398046a6dc18d44dc18b64b8dcd62fe
cc4e359ee313255b4831dad681df89beb2ddc7de
F20101221_AABYYW do_p_Page_062.tif
10a6c9a5517d75d891dc73e72633cc1c
1021b9dc669dddc4004815c89c5b99adda6f8801
1223 F20101221_AABZFF do_p_Page_174.txt
56a69d214d97c8628d3be7e62c35e69a
ddf705263855a36bc4f19a4a84c0345fb1a99ea8
110034 F20101221_AABZER do_p_Page_082.jpg
35a6b0e034aa478534d159efb00770d2
7ffb5707b6ad92342c5d5b2a079d9eb132c6f169
41258 F20101221_AABYZL do_p_Page_091.jpg
a6265f18bc2d021b400502e6854e160e
51accbf9d1a9b314ec4e484d8ca09762dbce5c4a
2961 F20101221_AABYYX do_p_Page_134thm.jpg
07877c58d0aea94a26e633b6e94a9b95
ad7b3f46548b80a012ff4be6fcc542138ef4f532
34118 F20101221_AABZFG do_p_Page_020.QC.jpg
2edf853715df68515765bd2c4a7ca5e5
010da61f6589efe691d6bcfd821d853beda395be
F20101221_AABZES do_p_Page_149thm.jpg
25bad7c37f8482b9206458930bc08898
79fc856ba0a09de658a6143632e5b87b1295c039
F20101221_AABYZM do_p_Page_061.tif
3fe4bf1f72974a874825f1deeeb04f94
c386e77cbe70a152e5f1cabf88505671534ad0c7
22990 F20101221_AABYYY do_p_Page_052.jpg
967cca9e5bdb4c93c49f345de4230fb2
8283d36c4ae82a7c975125ad2450a22d514b9c14
F20101221_AABZFH do_p_Page_151.tif
8896080b697f3a2940bee6fbc82b3fe5
10cf57f56199cb5eded2fbe620d5e927eed32baa
F20101221_AABZET do_p_Page_117.jp2
f5cceef430586f73b4ac9b3871465f94
996375726cda8ad536637a9c51d47309626555a3
476898 F20101221_AABYZN do_p_Page_133.jp2
67685d3cc06904080e3543472669c9b2
df10d672dfe78bdf96db4992f37cc0e4adf37444
F20101221_AABYYZ do_p_Page_103.txt
f049302f2e46b38b2bdc6f5e88cb26d0
6905e189f6e61cf55f7b9349bb00e17e75888a70
59946 F20101221_AABZFI do_p_Page_138.jpg
f5856ddf7130fe00eb712f8a33fce542
3e34e3e2873d7a4689b97936f7319ccdfa77685c
F20101221_AABZEU do_p_Page_133thm.jpg
d5b264620d3ce2446d9fbac0151342e1
14c16d5fc5d7b96080a82091607d92a8472f1b31
2082 F20101221_AABYZO do_p_Page_041.txt
feabe75a9b5cc2a3496960910de03737
8123bd6e31f0b79db4934bda4863a008c0b24445
1907 F20101221_AABZFJ do_p_Page_078.txt
507a3a2f9bbcb05f3f566a6e42c66135
5d2dbec9ba346b577a13ed3d7f67ac20e0880a54
53730 F20101221_AABZEV do_p_Page_048.pro
1e8e11875913edd91ddb741af4731642
b9ffa40cf9cea843f244e968f6084d4f2f03a305
87674 F20101221_AABYZP do_p_Page_003.jp2
77ddaad6de615b895359bd1cecf716c7
aac47254f29208126afa2c1342de0f21624f2d8c
4407 F20101221_AABZFK do_p_Page_146thm.jpg
148a1c48fa3f5aa6981b2978ad711f5d
40aa793cbba36049ae1e75e80e58657909aca4da
38486 F20101221_AABZEW do_p_Page_166.QC.jpg
631318d75ee5d05b8f3aac6d198d0506
da0bae62c7c39a19acf4cc2e7bc5cfb58077f200
696 F20101221_AABYZQ do_p_Page_098.txt
d395f0ccfa2b49c2c10bf602fd2c0bf9
b4ef7b1d05095730418cc431bdb88e239b6bc954
115780 F20101221_AABZFL do_p_Page_149.jpg
ea2b5a038878c609ccab0a74f8916241
a41a8077f9d6b63cf093038e8fffccf84a6e7d37
F20101221_AABZEX do_p_Page_029.tif
da2307606ab90a7d2ee26ef204bd69d1
610166aa2e6f8e7e3ad91c31b025e9cc1d4127c5
54190 F20101221_AABYZR do_p_Page_105.pro
ddec36146bd6030ae501aba2392f7d36
2cad17675a35e717c149ed46a138e3a44b04b356
54412 F20101221_AABZGA do_p_Page_013.jpg
b852abe9de9c3ab87a8a4412fb5f521b
084d77f7439ed583f583ce2eff67fa376aeb24ac
2105 F20101221_AABZFM do_p_Page_062.txt
0fe589b0150b9f03dd1fb3826ac70901
acf5b1450e5f9dc8a9eac49aa0de9d5326be4709
54189 F20101221_AABYZS do_p_Page_116.pro
2a5032990c84b0eed50615db1325cb32
e020b2625cde79127376fa2a5cf0dba5b3d618b0
3165 F20101221_AABZGB do_p_Page_127thm.jpg
c370cfabb7d965f93b234d433239c85b
86c1cc3c9e087ae086146c327e21a51f002051f5
14106 F20101221_AABZFN do_p_Page_125.QC.jpg
de2ebafa7d3d3001bb693deaf05405d9
709082e753ac676af5401cf68b6bd9fa27425c85
303079 F20101221_AABZEY do_p_Page_144.jp2
3057178cdb79275ed9aefa6be5a62d42
68458b7c610ffd47314f600500529641ebfba07b
95802 F20101221_AABYZT do_p_Page_028.jpg
9cbff67cec238bfe6e372a6adba7764e
3b8e219159fbd79513b389fc726ff9f9409f8d69
55839 F20101221_AABZGC do_p_Page_109.pro
e6f8d9371a455bb8c03dba9c9848ad35
f52986c2859c8d4bb89f105c04311274b17e212e
8749 F20101221_AABZFO do_p_Page_045thm.jpg
a28834a403980d8b6764d1bd347032db
ade4fdd2a60edbc0261d25ef9bbf8d81cc514ff8
112772 F20101221_AABZEZ do_p_Page_083.jpg
59eb04ab6735df51ddf792b6dd5e7bd8
9c638ea0bbb010c7639255b30d36bb994acab2ff
F20101221_AABYZU do_p_Page_150.jp2
d2e5c24922c4efc20e057560291b7453
672a0d3d051a6eda159b40013102c673fd14e671
8430 F20101221_AABZGD do_p_Page_030thm.jpg
ddf9244de09b5261cbf00e174237e79e
b8ea3f8864995fedb235920ab8c82fa25cd2502d
F20101221_AABZFP do_p_Page_128.tif
b20bbefef75e7d64df22456b0e6a50f7
98397292848654062463760374009fcad0b8ecb3
F20101221_AABYZV do_p_Page_085.tif
aa5c794cf151fb4f5613aec1e15354d6
e22612a0f8cecbcf4441b8f498fbe16d49eaabb7
35558 F20101221_AABZGE do_p_Page_056.QC.jpg
cda94d99c750013ff6e1912cd4434d11
bd2a68751083f45bccd254f38146e5ee341407a7
1051953 F20101221_AABZFQ do_p_Page_031.jp2
b292378accd9819b82f2f8b0ff892a7e
7643c604f6bd5dd6dd1b1e9122e8178bb65133f5
36931 F20101221_AABYZW do_p_Page_085.QC.jpg
5115b3e29445d55e8abdc4b3e9dfdb91
3e171cdf06da7877cc9b6b9937b0b0dd96a5b70e
F20101221_AABZGF do_p_Page_084.tif
9dd166d013fce1cff35fbcd8bcb4adfc
4c250a72beada55f14a38929703da994d184e12e
1642 F20101221_AABYZX do_p_Page_067.txt
1a5560b29a9735af43faf0cf86648c23
a5263953fde8f727bac4d534863fc7b537bf2d60
8979 F20101221_AABZGG do_p_Page_104thm.jpg
eda293bca0dd0c62c18e227217632d24
cec71a9ceb1cb002d328fa4dd2e8551003500731
F20101221_AABZFR do_p_Page_012.tif
7b4f083478de6aff626a82193b76314a
f6bd78c0a6eac53b883c3030c9d82e9f662ea7de
37836 F20101221_AABYZY do_p_Page_158.QC.jpg
10b0d975b3f316923948a30e3a4fb327
c4a25a9111cda8fd431e44c3f20ee5e1f5a48e8d
1921 F20101221_AABZGH do_p_Page_079.txt
a8079441a8d6cc3e9a17b7e9724f1847
4daa90f42fbe1feb85ba1479d9c6c32a3efcca3a
1049 F20101221_AABZFS do_p_Page_135.txt
3e591c23efbc0e0fdf851d44f2d23a02
940fff619d5283b0f90224707052980e2ecc2ede
F20101221_AABYZZ do_p_Page_156.tif
ed6aa3a0ce9ad63ae5c915c7d6b5e0ac
8661e8b534e1ccfe983573e6e140695497a408bd
1051967 F20101221_AABZGI do_p_Page_041.jp2
5ff5b2eb3e0ffedc76e0c5e1da723fba
5816563c6b121799199febea06915d9a1803611a
35736 F20101221_AABZFT do_p_Page_070.QC.jpg
b787154a7ad1eebca637237c2bc93451
176b969edf87d5c3362466dfa0ec8f036d59a530
F20101221_AABYDH do_p_Page_158.tif
a7b03b9b146b919164422d72089571df
c481248df7cb5a6772d46cade619b59dfe5e842f
29377 F20101221_AABZGJ do_p_Page_174.pro
5a2a7514be831a52ecf3e30cc3899a58
65ff72ceff1e14657af096d1915ca2866e072efd
55115 F20101221_AABZFU do_p_Page_118.pro
d8f2e3f639912a6f8018797309b85618
e9ce73f04537ddc0c2824a169885d99d08481cc7
F20101221_AABYDI do_p_Page_137.tif
22a31f4c1c14603431f8ece33ae2852f
a9122a633bcced0bad99f9d187b62383c263b0a2
1051896 F20101221_AABZGK do_p_Page_114.jp2
12f675fc588d34e3ee165990c857cc00
9ef47df5eca5ab72f76c6b952d6f330c24340828
55728 F20101221_AABZFV do_p_Page_054.pro
ca4fb08f4b940ce40fd83f54d11a67f7
eccfb4e43985d0d862c5b97f438fcab59224d5d9
2264 F20101221_AABYDJ do_p_Page_121.txt
56899cd81cc8afc0a426ef7c7e201604
04f68b785bba26ff909e6fbc78b4f7f048f658ae
F20101221_AABZGL do_p_Page_019.jp2
9c0f3483b8629cdb9032ba934fd5e197
45b43f66ccf4a84c04689a8947866010abc9a1b4
1034 F20101221_AABZFW do_p_Page_133.txt
bd94cd6c56e963c832fcb31975c5e1f5
e63ade66f50cd4204f7151ab3b12998b9987d915
41041 F20101221_AABYDK do_p_Page_095.pro
973ae92d8e1214c30e81a9e5ab452bff
9bffb53cd90e835b47d89b02edb1fa4a96063fbb
48675 F20101221_AABZGM do_p_Page_115.pro
1347098acdea2401c40b0bd593249cf1
5193cae5aab6c94ce4b77972821b3e004bb62512
8935 F20101221_AABZFX do_p_Page_116thm.jpg
42e8d48505129a498cb225ef139c8c17
2c478396fb43fdd7d9887844bf5bc532891f1cbc
8920 F20101221_AABZHA do_p_Page_029thm.jpg
c81bdaea2cfe74ac644cf13e415a603c
a7f1cc209493cb36bc4d344cb842c5dac0a3fadd
8972 F20101221_AABYDL do_p_Page_047thm.jpg
ac26f1ef8daa508423a4791a7352585a
baeb928799ceeee7505747da4995d43f4dc7d9cb
38168 F20101221_AABZGN do_p_Page_038.QC.jpg
a4fbc261682aa38ce387c9a5ae0e6e64
87b2bba1f6a834609be84c7576c93048cb22c17c
F20101221_AABZFY do_p_Page_095.tif
bf945b50c20846e80ab7042142ae079d
fddd4910b58e00111e0a04b56f064cc246c49b13
139666 F20101221_AABZHB do_p_Page_157.jpg
666bc91b230f5ad0927fc8b56b578d1c
9d8a2bfcff19fdf7bc0093b7a7a49dfe692e0c0c
37136 F20101221_AABYDM do_p_Page_033.QC.jpg
1d6b9f14f904ccccf00347590ad5e327
9ae60b1d83ce0c457af42c4127f7d56ec93fd0e2
F20101221_AABZGO do_p_Page_048.tif
39f32c8e96baca4b53f74aa8c43fb216
017cf240f887b58671c9d4f495875f61684eeddd
50482 F20101221_AABZFZ do_p_Page_102.pro
13c1148de7999ce6fb77ab132df55b9e
dc12bf845ceb6e979780b6a172168afb6322ce7c
41664 F20101221_AABYEA do_p_Page_089.pro
39b62d87e0682bb495783b21ed6aea91
c133744f074b36f2171c6cd69078369b81a904a0
2010 F20101221_AABZHC do_p_Page_053.txt
6498804b5d242c807a894a33719f8aab
51251c36a9d38937c2f5cc57dffeb3e3df9712dc
118309 F20101221_AABYDN do_p_Page_121.jpg
5e9096d7b7937fcec60433662280e251
11e953a9526499265523712804aea6a52b494b67
49761 F20101221_AABZGP do_p_Page_155.jpg
6eb5f7b556097d854ad5e9288f84c9c3
b21a85ae7f542a87bc71ead021c81690baae462c
5034 F20101221_AABYEB do_p_Page_098thm.jpg
3e23a7703beb9a7b8a362f79fd8c01a2
1ab4bbb5800d6a2cb3da506244da0d50e36d2b00
31180 F20101221_AABZHD do_p_Page_091.pro
3b01bc0cd021b4e664dcf2c106f94bc2
61171d11fa0f59125c7a8940688f5f411c4e0dba
4480 F20101221_AABYDO do_p_Page_015thm.jpg
7e8425be87ecde3dbd9909e90caa7ac5
9377b94971289988f82fe1d7dba3479f842de5c2
1051971 F20101221_AABZGQ do_p_Page_047.jp2
38f2c43f9d8adc22d7354e21ab116b24
abd4014557868faa4b5b7fceed59e9069b49ca60
18935 F20101221_AABYEC do_p_Page_135.pro
6d95367fb13b8d52b180f11ae00486b9
a7f739acf928ca1611ad24edb55fe90c0e83648d
F20101221_AABZHE do_p_Page_108.jp2
f7e0d3345dcae5de897a1bf71fa37562
09fd6a78e74e1a9a73ba6c7f0d9a426f6d8969f6
F20101221_AABYDP do_p_Page_090.tif
f1fc5bf11b0b2a9e8e5a488be3fefe9b
47127ce3d851f6cfb522055e030126d2d847c5a9
2046 F20101221_AABZGR do_p_Page_152.txt
0a8833755c4a1fd74ae3b8cab64997a1
ea93be1789420dd7a418b0992a85a94c6f830828
1051934 F20101221_AABYED do_p_Page_032.jp2
4ce53fa9f87ea7ee19a84232f39a3685
3c71b0aa02988121ada609e0bb90c0a0073e09d2
64669 F20101221_AABZHF do_p_Page_166.pro
13c8128adf1e9e1fa11759577897d6ae
5144b04c54b907cb7fd08e2808c0586db2daf81e
61593 F20101221_AABYEE do_p_Page_018.jpg
dc0902a995d2028ccbe8d2573361d7e1
3a074e9f78bdb42b65ee024aded8cf719ada3dba
61510 F20101221_AABZHG do_p_Page_128.jpg
c01a42dc650ccb4fd98664eb08742abb
a263858be878ba7893694919e55347937a2a2047
55704 F20101221_AABYDQ do_p_Page_073.pro
987251bb66a42c2e2cba96ee304619bc
2a4ace93a9915774119e00d632a8da84fdbc0eca
9914 F20101221_AABZGS do_p_Page_169thm.jpg
6e14f9550f25555aebf23fae66880e5b
6513f63aec80fa6d4e38f989c6fe12d02c11cc0f
9079 F20101221_AABYEF do_p_Page_075thm.jpg
0c5e4a3796ba2f0bfa124bb4cc17b5b8
837cf307e93465d7f90001392d66510d50384202
743294 F20101221_AABZHH do_p_Page_145.jp2
9a244b1d90d7bfabbe1104000469cb7d
f39d181bd78bb75ee7c2c5b857ce50c545b98c42
8807 F20101221_AABYDR do_p_Page_118thm.jpg
37ca7e766d050bd41742faa1f7d33d5b
95538baf3dd511cd50befc8e3ad94b3132c17bdc
79458 F20101221_AABZGT do_p_Page_094.jpg
ef6b9917174e7a881f46bcf43b93e2fe
db914a04f7d90d29c24c63f2fd110d58dfb3024b
8565 F20101221_AABYEG do_p_Page_041thm.jpg
58df6df5ee20ff27ca76dc6057f3261e
6b6a31f9b706eb7eb13b23703e45aeb37ca19d5e
1073 F20101221_AABZHI do_p_Page_129.txt
b1b62972f4d9997621026398ba30d2b5
a21192be2601845d1cc3143665466c4717a80170
26751 F20101221_AABYDS do_p_Page_134.pro
40ba321e847bb5f3959bc591c1d61bb9
ff88ce7967089c6b5f9c241f09ed80d7921e08bd
18913 F20101221_AABZGU do_p_Page_068.QC.jpg
5add73e49b1147c308a069ea8901c02d
f4ba4ac4a408c6a124daa5629a052436416a438a
2776 F20101221_AABYEH do_p_Page_169.txt
fadb471f484ad9bc98b926109849a586
1a31c832168819872468504b3ec9683f2978bfce
621193 F20101221_AABZHJ do_p_Page_068.jp2
15257dd51d6f5f6aef2d27b70d21c5ca
5bbc87fef1fc0f0de346ec477be2c68c4bccefb5
110289 F20101221_AABYDT do_p_Page_055.jpg
f3ca2dd353fbd0eca5b389a50e4a7373
ac3d6616e8d9bfdc3fe7ee6e1b0f1e2c4ae24048
17772 F20101221_AABZGV do_p_Page_145.pro
1e6e45d13f6cc8e930a515b16cba6c29
3c03d657fa4420823205d76f3c71e95f4a3d4442
106118 F20101221_AABYEI do_p_Page_152.jpg
9da6bf499a0188a9a8e64c4d80035923
956f5f11cc08136193140be06ec23cebf185a9be
111898 F20101221_AABZHK do_p_Page_120.jpg
66115c2f29844294c265fe70ebde036a
2ed659ce499bb2bb69b5729d0e423eb282f04ee9
2157 F20101221_AABYDU do_p_Page_104.txt
ce96f5f310a681a4668d2beea511c846
54c0528acb2e814e95cff0eeb54eec292b642946
2766 F20101221_AABZGW do_p_Page_163.txt
8d8c27778faf1d560a8a03cb18b90d31
a946f6c429c22bc81e2e1f9036bc1611eaa745c1
2593179 F20101221_AABYEJ do_p.pdf
d6eeaf93914e307320114dfefd5cc6fb
402ae4727110b480a9a739a971c8c18cf60e8750
917677 F20101221_AABZHL do_p_Page_090.jp2
d58952eda10cd785a78aba841736639d
c8fd244db21a5bee29a8c006125fc8ebfef48826
18433 F20101221_AABZIA do_p_Page_011.QC.jpg
009d02d735147bc997cfa815a956f799
83d028c7420f2990dc3b3f26dd24a5c18f51fae8
28658 F20101221_AABYDV do_p_Page_018.pro
61acd6d9b1a579df620091eed6796120
bd3b6657903853ee6ef9d5a8729952af0de27e1d
F20101221_AABZGX do_p_Page_072.tif
311b73a9117980d51ca22d3f9803f2cd
ee8c91ed3585a8e98662b6723b94601ebef56aac
F20101221_AABYEK do_p_Page_166.tif
0a19f18a40cf5effb3fa2fe6699f479f
f8e7ae3bb41f3d4cd9529e7bb7e9ab0d4dc26e9d
3716 F20101221_AABZHM do_p_Page_002.jpg
15dddea6d61e30bdd07cdd3cd5352d39
dd894ae87dd85d7f150c955df85117fcb10d6841
1925 F20101221_AABZIB do_p_Page_115.txt
686cdaa932e87e3ec6e9a1a0b75e1a11
460255f773ccf5df0a3dadb88445145e1f97b1bf
F20101221_AABZHN do_p_Page_141.tif
da353b15d3d54685f74cdf0c0458ed16
a02830fbe85bc1564f50f8368d1565f5b7b7486d
54055 F20101221_AABYDW do_p_Page_022.pro
b91ca774e83de5e303a305bb75c8b1ec
c88625c29df685fe1a61361b194b3843a84533b4
F20101221_AABZGY do_p_Page_121.tif
d240a0128801f23b24828cb900ad4a11
1ce3691838a2e0bd276a06833701a5b727e07765
17043 F20101221_AABYEL do_p_Page_015.QC.jpg
7ebd84fa61dbac08037291c8895b72cf
aa75aced18b93b4f29a7652650053e6d287b5398
9612 F20101221_AABZIC do_p_Page_156thm.jpg
44499b40d218084b2cbac5d7ef7b23e0
541e832e52fd9ccf137278cb865b646006feb1fe
37433 F20101221_AABZHO do_p_Page_117.QC.jpg
1fb6c57ddfbe2b15f35c70d242f0e45f
f49562b974220f597946b134842bf98858688480
34959 F20101221_AABYDX do_p_Page_006.QC.jpg
203d5f332fa1b4764b28c399524c2f22
2621a70155c187c728cb47ef455f5881e1eb0355
9361 F20101221_AABZGZ do_p_Page_170thm.jpg
42ff3fedaa3adf2a27441489b319e9c8
c1654ba2c5d17174393ff289efd6db479fd9d9ca
F20101221_AABYFA do_p_Page_058.tif
c668486493bcdca2031cc1e937aa9e0c
2e02bdabab5037b589a6328718d6058fa69053c0
2207 F20101221_AABYEM do_p_Page_123.txt
d1e72961057b37fc7a557f32be02ed95
0509c8438030939ae77d665dbc15a5f3c499a7e4
F20101221_AABZID do_p_Page_120.tif
91eb65c31101c8bb98870ca7899db815
34a80a81537161928f26f491c25b0857dd449e0e
114155 F20101221_AABZHP do_p_Page_123.jpg
f5a521f5a32616ad5d8527133b6d66bf
4b1872f4af49ae749026cb8ed6fd80fc918e1507
57440 F20101221_AABYDY do_p_Page_140.jpg
275627ccb55efa4c57cf6f04c19d0f1f
a4ab5ce636bdc8e75ce191a944c1ff9433111841
F20101221_AABYFB do_p_Page_156.jp2
954ab2b7d010dde62080ebe60287b4b0
e470549d1cf59be1f554f34f9155310d7b76fe31
54967 F20101221_AABYEN do_p_Page_055.pro
e2c4456e68eba0cf3a64a9c476cef3cb
3f2ce941f2ea0920a35dfa5415a9db431d3a2015
F20101221_AABZIE do_p_Page_101.tif
60286513a84931da36bc8c1fa64481cf
f6f44488a4cf362ee4c5f357fcd08244e5b80cf8
51003 F20101221_AABZHQ do_p_Page_012.jpg
7d19383cdfed4fa177ea2fb8001d4204
fc6f9a18710281974ece057a56f26ef5d2006f38
35948 F20101221_AABYDZ do_p_Page_116.QC.jpg
9843bf49f3d2c6650b5b4a46bd65a834
e76630d754faa2c37920c21657289040e2d00dc6
F20101221_AABYFC do_p_Page_147.tif
9ed2468f8578bd8f74286ed982576dbd
2bc1878ba8dd01cca64cb847962b1c1100a6bfd0
51308 F20101221_AABYEO do_p_Page_081.pro
eca39f07a03abb5ced93c4fea715661c
686a32e586941119b12700586d40a2aaceb1a778
53793 F20101221_AABZIF do_p_Page_056.pro
81c1c259247f702df3e01abae5015d02
c82cc2ae251e94bbaef83f937e7dc74f9fc3c7a5
F20101221_AABZHR do_p_Page_081.tif
59cb7767619baeede179e9a5378e03cd
fa4dffdc976fa69dbbe374be5253ed5f4a736798
39588 F20101221_AABYFD do_p_Page_163.QC.jpg
2f33680be1e07b27a621ef5920fdf8e9
999fa60b6abb13750cedc6e8983e13314352409b
436 F20101221_AABYEP do_p_Page_052.txt
dcfa4013009e6fbf826d1604c43a8e53
7aae31fcc5efd6c08849a46a89971ce6fd9ec6fb
52681 F20101221_AABZIG do_p_Page_037.pro
bb036d7bf77e984ee625d2f7dd511aad
1ed6769cc230505aa8ea8bc4248b0b149d3ade7a
F20101221_AABZHS do_p_Page_041.tif
bb94aa3f68716f93dd59acb6f4f319f6
009de5592098bfd8cd3cea338840eeabf080b67f
55594 F20101221_AABYFE do_p_Page_059.pro
027c89db375580b534d3d17d91ccdc3f
ed794d9fe90f1b093454f0a85fe1b7cd53d95961
111226 F20101221_AABYEQ do_p_Page_118.jpg
9f21f470a74f684c027de7713e7712bb
bfb7cbe854d3601e458a2300c4f19c267a2ed7c7
4132 F20101221_AABZIH do_p_Page_128thm.jpg
4b9d542bbd927da1897dfd9095b43ee8
5bd88598397878e6f7bb37577cbe3703385dd507
17630 F20101221_AABYFF do_p_Page_138.QC.jpg
cde3094b6d209e6727d82ae8334d8fcd
07e15b7e75869dc255b815e56a5b9e92ef749d1a
35933 F20101221_AABZII do_p_Page_101.pro
9de92a4aed4ed02c5f435325ee1c4aee
6da852c26559f40863235fa3c00579198931bf55
33453 F20101221_AABZHT do_p_Page_132.jpg
939a637ad248c30fb853e0976d7758cd
158af34c6573c5fb73170551a19b31e79fbe8d18
8652 F20101221_AABYFG do_p_Page_044thm.jpg
691d484a46a1319c73b3dfb1c737eb4c
1334fe74cbf7bd57bc0b64fa813100828951bccb
1051927 F20101221_AABYER do_p_Page_083.jp2
62eec886d75ebca8e1676a875e0dc938
f00b69d982ee1209fc5049173bb20ec2d2d789cb
12723 F20101221_AABZIJ do_p_Page_137.QC.jpg
d7cefe996b2bebb41a9c753a32bffb1a
9a8b013fb0a124008eddf2f9181780b87b6c6998
F20101221_AABZHU do_p_Page_028.txt
3bc72fb6ae9340d0335cfb3ba47e94df
ac8d83497aafa6affef7b942250830046154d9e5
2191 F20101221_AABYFH do_p_Page_106.txt
dde8be67d359f9828d4cbe252802f5a1
5258b8baa82f47d2442e442f23bfe3a3533247b9
18686 F20101221_AABYES do_p_Page_007.QC.jpg
10c8c67b105284e6f28a52dd034deefe
d908e00ac32952b1edc6d26e483355511e546e26
70426 F20101221_AABZIK do_p_Page_171.pro
774fc2605ad112387e78730ba7c86f02
9bd66f0a2fa120d296f69a06d7f3b8092dd4fe11
8392 F20101221_AABZHV do_p_Page_037thm.jpg
72e378b6be451a54a0c9d20fba06e9e9
4bd0c8ebc2537752cd6ace1f9eb7d2995f8b0a28
24708 F20101221_AABYFI do_p_Page_132.pro
9e815953add342441f1934538639aa24
4a79784c5f23871e5613e91c92d55de1cb504498
F20101221_AABYET do_p_Page_160.tif
e7d9e2d833535b27d142045e1e1d8328
84a73257f924392deef84cfc7262cbabdffec054
25499 F20101221_AABZIL do_p_Page_051.pro
97d918775c3b203eb69731ab42a7b5ec
61260600d74308787bbd95b7be13a3766ac4e357
124270 F20101221_AABZHW do_p_Page_156.jpg
6536bd6b20afda9fef95eced06a6cb74
b720b4cc8ca26d43c79da45082b14f799b004b22
9060 F20101221_AABYFJ do_p_Page_021thm.jpg
fba27c15863eb0442155176ea503449d
a337550483fe19c95f32b17e4559ed7a4a65b6fb
F20101221_AABYEU do_p_Page_002.tif
57fe3f279ff1bc3e32dd36e25f6acdf2
1011235221f9768d144709f6dcf474f5b609b7d7
9161 F20101221_AABZJA do_p_Page_108thm.jpg
730ede4aa0ebfbc47a4f2efebe80db43
7944610182f08ad2db0b432c8b6a82c604cbd3c5
5372 F20101221_AABZIM do_p_Page_051thm.jpg
fcb9497d945ac50353d37c8bd6b18f07
5e82a7c9363556dbf16e2cfc8ab0988859dc44d1
102065 F20101221_AABZHX do_p_Page_026.jpg
13881c98795b841bfde903214a36eae0
e455d94a04d7a46c61fbac27051a3d531ef38f25
1051973 F20101221_AABYFK do_p_Page_106.jp2
5f72147fb97b0d57588a95589d9fc9c0
55b4da55f671b39b16b416e2be0aa2f2c8f54370
8506 F20101221_AABYEV do_p_Page_152thm.jpg
a7fb20232a0f8af50da5243ced92962e
d2f9598364fd06c39159fb0002a67c6c90ff0fa2
F20101221_AABZJB do_p_Page_103.tif
978d78d4b79a1b27b9616745dc4ad0d3
9d2f4c32ac7a6d0bd1628f42bf5e9e18b096d9fe
9615 F20101221_AABZIN do_p_Page_164thm.jpg
abcfb3d61af9833ac8f770a73c98e296
c6f0c5697e214eebf37bb8dd85876fbc3272ccea
8877 F20101221_AABZHY do_p_Page_048thm.jpg
bc0de2f261780621011ff9b8382b4709
ff4f6cfad5dd512edb70e7570d25d1e0db54f50f
10587 F20101221_AABYFL do_p_Page_129.QC.jpg
06c75a6f2925be057025240a3dfc9e70
4445c0f305d27d90e5489cb6068683ded5d8328b
2178 F20101221_AABYEW do_p_Page_149.txt
42f06fdc3944569e4bec4376b133aa2e
ce0befb759f2fc0f4307464010b41d10dc6e2ecf
8557 F20101221_AABZJC do_p_Page_114thm.jpg
5687ecb462195039feaf77175c56cfcd
d0bb2a64558bb776da3f6f41df0cde7667c1b639
7506 F20101221_AABZIO do_p_Page_100thm.jpg
fb14a2f0ea499ebf0b8a20792272d584
27d3d1531eb224372a39fbcfe0d4c3d9e998d38e
4631 F20101221_AABZHZ do_p_Page_174thm.jpg
9a1ee43bfeef84bf7f04fe088216c052
eaa3bc03682f47f5cf588384d6507b48ad8fea15
F20101221_AABYGA do_p_Page_152.tif
949ad89b15f710ca08b6a251e84735bb
46b92bc59455e2a29ba900752ffce0e2257d3112
F20101221_AABYFM do_p_Page_084.txt
78210ccb3fce154110f0292951eb4582
30fd1c614a7689d6cca52870e24a5334182ed107
662968 F20101221_AABYEX do_p_Page_128.jp2
0defb75941b47c674045e09ab67dcd85
b57197f1d45f6bfc2e2d4ca93b08c111483d1386
51633 F20101221_AABZJD do_p_Page_126.jpg
c4b033fabcb667d39918520740119d61
6f59206319e522b7972c75b7fba209f79e83b6bd
2801 F20101221_AABZIP do_p_Page_097thm.jpg
ba10a2335e4799245739ede7ed2d94c8
a45aa2b750aa20452c42ce688f2d33391a1eae9b
110182 F20101221_AABYGB do_p_Page_116.jpg
13c197e7ba773d66c417286fbb6daac7
8792f46646d46b4e4a47486f64091ff710cf7671
45591 F20101221_AABYFN do_p_Page_028.pro
93799bc98e6fa5f3b0cf5061fc1a324e
dc6f5d7cf4b2b418415ab3be7440391f2dff67a6
F20101221_AABYEY do_p_Page_083.txt
0adce36c60585f1abadac006ea07d580
2cba461ade199457dfa6c0721519eb7d1faf5b37
2076 F20101221_AABZJE do_p_Page_030.txt
4113c1952a27f47acf849411c462176e
f21593640677b4c1d52835d2c07cac1a09ea3aff
1937 F20101221_AABZIQ do_p_Page_072.txt
3b4ad5ad0317494dcad0e397ee8366e8
5b1b88a6b10ccc5bc8c919a134ca12cc02334b5d
1051916 F20101221_AABYGC do_p_Page_020.jp2
4cb2000c8cda46e2ae666f8cc37db052
f020e8de1abfc263b6b531eca858d43c9dab57dc
30981 F20101221_AABYFO do_p_Page_131.jpg
7949fe2b7131c430b8134e9c530339c9
36fbbbceea8c00e14a463a8be3646611232a2424
8330 F20101221_AABYEZ do_p_Page_053thm.jpg
6ef5046806adb224163833def45079eb
4b00079667477dc0f69ecccfdc02c0708192fa20
8857 F20101221_AABZJF do_p_Page_023thm.jpg
32584db60b3246640279f4cfa65586ef
5f27bc29bc4baff1cd1314ea951408c20c27344e
F20101221_AABZIR do_p_Page_035.jp2
35f37fd998337c249ab249265f4171a8
ad6682e507e1627cc895483b10f9d2206db7ca69
7201 F20101221_AABYGD do_p_Page_101thm.jpg
0dce095f3679aaefb638543ead698552
9cd41b4732fe6ff4c45ed0c11fd7c078ec1756f8
39912 F20101221_AABYFP do_p_Page_168.QC.jpg
35a3096d4de6d84ed869f07d2477e4ef
421ea7a831e32ff8e7bcdc272af3ef4caedaa1c2
37305 F20101221_AABZJG do_p_Page_045.QC.jpg
a2a38941c58c91f72e6ec2f2f30272e0
c56fd9a8b0e80f001512e925cb7d13e58913305c
37091 F20101221_AABZIS do_p_Page_144.jpg
eec0183b94dbd70bd4b645778fc91703
65737a812b82b8f97766258085fa864314a27f78
901 F20101221_AABYGE do_p_Page_147.txt
d237afd2c7697b5251049f0505566680
b232e516018e4ccc56bd4889e97d16ce5227555c
1771 F20101221_AABYFQ do_p_Page_068.txt
5d5839fcef135e7fbf0d2552f632e990
348f89c3bbfdc961931f19f72ed384c372bd10b3
36987 F20101221_AABZJH do_p_Page_110.QC.jpg
4cae532a269be59d117be31cf9ba2b0e
76414bf55d7d3bcdd644381831a78e6292635a5b
9054 F20101221_AABZIT do_p_Page_161thm.jpg
4311f36c7e10a5db7a1a5e342b1328f2
9f0e99407a9c758b8aca7f870c5d7bf4ee399289
4120 F20101221_AABYGF do_p_Page_144thm.jpg
96e5e2d0507cc9b619e9cb3c0a6ff3d6
46db3d20bf295ef85140c3fd6eb0256953ba19c7
810756 F20101221_AABYFR do_p_Page_066.jp2
72fc3d399c091af939ae7be4cf988756
aec79118c6f9bcf54a837670df276ebd0f2889b5
8053 F20101221_AABZJI do_p_Page_078thm.jpg
66235aba412b151dbcf8b6e4ccb74812
d849484a1aa562b8ac3985d7ed06fcd3a75eed27
28162 F20101221_AABYGG do_p_Page_013.pro
8d5775077e3dd463f0dd231be3deaa4b
b7fdea368844c0fc7619f15eb57b3f8d318bb289
4557 F20101221_AABZJJ do_p_Page_007thm.jpg
e6d1484cece1bb890c40cf9ff865fe25
b79ed2033b0a7c4b2750d0ffc2449bc62cff6b95
37299 F20101221_AABZIU do_p_Page_080.QC.jpg
4ce42c6eff5f3cf1e47bffe1d458b2db
601f705c1c527bb76c38e97298eb62833ab69b33
F20101221_AABYGH do_p_Page_166.jp2
60847248c0c41bb86773aedddca4a7f4
fb745d111c5667218ff541606fcc977faf3ba553
1708 F20101221_AABYFS do_p_Page_093.txt
72520edc2e4625a077fae07a2f73624a
157841efbf9993c5bb33f9e8fb435b20b6914171
F20101221_AABZJK do_p_Page_004.txt
402278133a5ba237fc1337cedfb77a62
e7e3b0356676cdf26f09b2ea761e5c0a2affb43c
46199 F20101221_AABZIV do_p_Page_078.pro
9eca8b307e8e3b54aff30ff1aa757419
9868e83d9ff522b676dc40fad769a09c7946efe5
537827 F20101221_AABYGI do_p_Page_012.jp2
ab0f5152ed7f52bb79ab419c4ddbfe07
77982ea166accdb73e612a98424779833da1b743
8850 F20101221_AABYFT do_p_Page_025thm.jpg
8de1bb5c859e968a19062de1ef441a3c
f9a476e974fb474273def8a8f823a194f685f4fa
38159 F20101221_AABZJL do_p_Page_059.QC.jpg
71f95b285b735e5f805101036e0e4b64
998b4a24bbca70751d6fa3494a49e8a5fbab19e1
8591 F20101221_AABZIW do_p_Page_065thm.jpg
5f48120e21a48f9a72b43988cb7843ac
79c774336b20ef0972aec5abbade0b908593f12d
F20101221_AABYGJ do_p_Page_098.tif
702a8eba15359cd645c8849d3cbe7897
083203a9ad64f46ec4670c343ca11bfd908555a6
6987 F20101221_AABYFU do_p_Page_147thm.jpg
57df8ebb2773f2c3d82a5057c3598d22
406729142dfb9710eaeeb957a5648fae3bc5bc87
9575 F20101221_AABZKA do_p_Page_166thm.jpg
f11bad94c557f77b6f581d3103d440fc
3bc929eff3442be4bdf356a4f8c8c90f11dbc84f
8888 F20101221_AABZJM do_p_Page_112thm.jpg
f5ad61be3c2e2bdc5ecda0796c334de0
f7b0c2272ad649d72e9a405cb17faba45eb9022f
111081 F20101221_AABZIX do_p_Page_025.jpg
5663dca95ec9be1addbb9fd3c16b495f
d0c73e32c53885bc6b67edbf1e66505fb98ce4e5
104814 F20101221_AABYGK do_p_Page_071.jpg
9d27b3f3d4fc140786b541712f63fa80
48d3820ad40f1271d244af7f42e91be4c1e084e0
9705 F20101221_AABYFV do_p_Page_171thm.jpg
75fea2f6d102f745584b6d90c8ce3c58
08e4f7a993cd4c2ef127090fbd9ef44077389bb4
2136 F20101221_AABZKB do_p_Page_047.txt
cc4514adbccabcf01ab03a1a44d9cd63
0172ad57dd087483cb584793009fd5a4de56b0ba
53183 F20101221_AABZJN do_p_Page_040.pro
e02607e66789e771b057519da40018dd
01d9d2975d477c85998a65dc9686b1fad0b8860a
34641 F20101221_AABZIY do_p_Page_034.QC.jpg
22e078a6517caed27b97ce051eddaebf
2b81c047155aad68d83fb2f3e8aad9090231e8f7
1051935 F20101221_AABYFW do_p_Page_033.jp2
932c64b0e666ee40b093479ca3ce1499
77fdfe754fb36867bc26ba408cd13a13cfe3e5e2
107279 F20101221_AABYGL do_p_Page_024.jpg
8adffef72b064edab71f82d4fb92e9f4
5dee66e35aa274f986dcef89d794528f8cae0349
116835 F20101221_AABZKC do_p_Page_046.jpg
eebfb4a1a6de60de4000678840715739
db2cc30b7a68ddc89a063f69b79c1f9e1634d714
32998 F20101221_AABZJO do_p_Page_115.QC.jpg
4a2a47ee54c471cd19384fcc29010680
25b6409364386bcd17e6f9851ed8eee231e93d2a
47356 F20101221_AABZIZ do_p_Page_043.pro
9d018b17940a678d70aa7662845c2236
331d0f43083ef16cc5cfa8afa1b72068b3301ed0
916 F20101221_AABYFX do_p_Page_015.txt
21908459a06372bbf42cd44b7ec0d0e0
981d808707898418c8bd34c986c87ecf7c12727f
68590 F20101221_AABYHA do_p_Page_169.pro
a0441b6350475b0c2936f816645976df
9612dfb7d223b16ee5bbe172415bb708074cab39
F20101221_AABYGM do_p_Page_108.txt
af023f2e1a39d9a75ddb00c5fbd3d8f0
47a7f7dc2c1a140413e697142ff94b5774fad873
35301 F20101221_AABZKD do_p_Page_131.pro
59d17a207be92d127e5590414711ea9d
c1154a4abbcd307cad23a037c69d39300a35ec0a
8481 F20101221_AABZJP do_p_Page_111thm.jpg
0de01e04a943bc654e1a4edf6483a716
bd3486559fa356bd37b74d88c904668a7a8376ce
108825 F20101221_AABYFY do_p_Page_019.jpg
5934496161850c30f5d49260c7a9b478
b88421d57917dd0848ddea46819cada941e6ee17
105162 F20101221_AABYHB do_p_Page_017.jpg
0e9f42a9e69c3f1933db268122cabdd2
2cadbc4bb01ab96c2910a77b6c3012739de8bdaa
24307 F20101221_AABYGN do_p_Page_125.pro
3bf599be76456713d22b3fdfb9dd1f1a
45d4baa50026323a25e914e8b95508fec1dc12df
40350 F20101221_AABZKE do_p_Page_165.QC.jpg
73f1f2581f1292b8818f715d3da5bcec
56e00a51b19d9c98fd65be965a4790c38010ba6f
219 F20101221_AABZJQ do_p_Page_003.txt
92bf055829d985c09271e08ff232ce3b
0176f68935e60d5921304c7d4c05c041c4cac90e
8706 F20101221_AABYFZ do_p_Page_080thm.jpg
64a36303858503a36c3d387ec0eca97f
efc408aaa5bdabbd36daa1239c932fea510fce1d
8813 F20101221_AABYHC do_p_Page_103thm.jpg
66a61ec598ff6f5d9afbfb81a313ae3f
cf1a306f50ef93b23aebd5b99459c69d5d50648b
14309 F20101221_AABYGO do_p_Page_143.pro
118508be141d3df70765418aa165c8a2
d1e23acff02153316d79caa21728d7237777ddbf
108940 F20101221_AABZKF do_p_Page_023.jpg
94a52430b3321cc4a88bd54ea38c7a92
6614a9c4111644c9581173b7e0d746b4f18f173b
16269 F20101221_AABZJR do_p_Page_129.pro
96c3ac49fd53bdc4b30b66b66c199231
50e113ea3ad39f479b0c13a7394fc90eb411b48f
1091 F20101221_AABYHD do_p_Page_136.txt
da16f8d2f6cb7243c0d9f7c0922cedf6
492b4414bb5bdf7d594e71b1b9d353860de0b9af
8981 F20101221_AABYGP do_p_Page_036thm.jpg
3942e623dc03c9544207aef7704564cc
f005879016fe50f8f24943fc5705d8accb1563a8
3950 F20101221_AABZKG do_p_Page_010thm.jpg
7fbd82b12708d19cf05f9a52f2237769
8f97ee09c364178737a54d4f1a328bfe56deeb0f
2159 F20101221_AABZJS do_p_Page_033.txt
ee16911acbf0361607be432ae50d30a8
e335853794e7f378f3135e48e37aaccf8da2649b
4863 F20101221_AABYHE do_p_Page_136thm.jpg
df543333e3f4f9e1ad592f2f547a6b61
ffbb66fa02e24768557ff2d3461c55da126fc472
F20101221_AABYGQ do_p_Page_094.tif
ed99b83ef921e1caab27af2e29456166
605a69f72c0f47eab4f2f7c2522c74727b4ad64c
104422 F20101221_AABZKH do_p_Page_032.jpg
6aa2fbf4629d170bfeec7ad6bb1a5506
29f58517e5fb5f8233ec7dd310719dbeb3df9410
603411 F20101221_AABZJT do_p_Page_051.jp2
02424ca7a1d7d5472bb173d3f2ffc0fd
4534ecc7627a351aa6a07ebc518870cd21e3b50c
38378 F20101221_AABYHF do_p_Page_075.QC.jpg
0da3eb736db2d636b64c794131ce761f
9fa3fb385949c29383c26ffec68274c855a60367
45544 F20101221_AABYGR do_p_Page_143.jpg
51c799bb0fa2601728fc1cba7f41c75e
162ab68eef6779431927b7221683ce99d61852cf
F20101221_AABZKI do_p_Page_013.tif
ed9bb38884e179c92f6c3ccd8c3b1cac
aaa7c781f53e8bd8866d301215b04b716ebbc66a
9311 F20101221_AABZJU do_p_Page_087thm.jpg
5e450b144dd65f1d65553dbaebe0a4a8
3cb395ca070a0f1ab6e8fbb1177248c41279922a
7942 F20101221_AABYHG do_p_Page_052.QC.jpg
3bf755fbc989faafac85fa668df80e06
be81e9276531b5b3d70842135a7a708a20f3c2e3
2122 F20101221_AABYGS do_p_Page_130thm.jpg
146625230d15a6f10b825e078b51fdc9
c6a6ee1f00e558e5253c1db0bb59724b99da638e
36299 F20101221_AABZKJ do_p_Page_064.QC.jpg
e93615b8dd8daef6d946940b6e4f4d37
c273768adfb5a3be6b1b43c920e32cdbf6528286
F20101221_AABYHH do_p_Page_162.tif
841559892e10eaca9910471976c4c912
74053b049b964eee0e62c85c342264b82f32bd03
F20101221_AABZKK do_p_Page_042.txt
03af9fe754b5d7a986668fe8394552f4
efbad88bbafe2ca24dcd5330f9cc9715936ad781
2030 F20101221_AABZJV do_p_Page_077.txt
963082908c247572fc8c424f2883718f
97b9dd29e493a06de06a50107b9e8d6495cbd71e
88232 F20101221_AABYHI do_p_Page_175.jpg
7bd6718b8e90628239983025394a3085
cf9d5bae9452a904e7a4e6757ce09310e4f39c0c
106549 F20101221_AABYGT do_p_Page_111.jpg
bb65f87f768263fa9c5fec32a96ae290
92c91c7671aca2510eb117e44f4666535c08618b
F20101221_AABZKL do_p_Page_108.tif
00f5703be0de3d6f6ece1d68f019f83e
285f899d8c2fad7d4861669810fa16a9f136558a
1655 F20101221_AABZJW do_p_Page_089.txt
79cb9a919c305d0527f301fcc70eefd5
527664277893cf998885649a4de1dfca2f616eff
F20101221_AABYHJ do_p_Page_171.jp2
826a721f1bd3deae75c2f373917ca821
992178c4118328b4ead1a7ec1a195bb315b5e607
28729 F20101221_AABYGU do_p_Page_153.jpg
67c8834a53b4093f1ee8b1b36ec78932
2f59ed9970ef7f2f254d7b45bf05a567c95f8bfb
F20101221_AABZLA do_p_Page_060.tif
e9e1d746e09dcd277c570e568019a4d1
ffaa60f6a9f5095a54ec304f0ece9cee10abcaae
37149 F20101221_AABZKM do_p_Page_122.QC.jpg
1ca346241895fc5e2fba63d6a2a24620
f21943c37db0a6788e2155b7365be43047ca295b
F20101221_AABZJX do_p_Page_039.txt
10925575198ff12d8fd4d469a89e4590
0ddc4355d3bc1889d37b0d99a964d6828048ad76
108157 F20101221_AABYHK do_p_Page_081.jpg
b99918104e48b1f4204e8cb995b73a65
cd2aafdeba72eb742b3111d6649f0702ca639429
1941 F20101221_AABYGV do_p_Page_127.txt
ea324d47c36ff17e050e8e2bf7845432
4888a74ccb0e0c85410189cd223fdb100293aa4f
752 F20101221_AABZLB do_p_Page_002.pro
d0492c116f7ec33c979fc1352a149e40
1c5a3df4807ee42df511915465c0aecc8d485063
9826 F20101221_AABZKN do_p_Page_153.QC.jpg
dfc4a05628b269e63bdf7fff685ee278
b523ee502c7cfa5ad08aa7cb347d7e6b44bf1fcd
35511 F20101221_AABZJY do_p_Page_071.QC.jpg
cd376b4f678b257010086448298a5300
f0c57e0777e1a992a05b958bc67e79ed69274afc
53522 F20101221_AABYHL do_p_Page_062.pro
4125aeb29b5e7099e8c31d831e61a26e
ffd6fd2d9c01b1e6b4fc8478138c55a56582bc80
52214 F20101221_AABYGW do_p_Page_087.pro
919505e115b955a2c58b358891c7ad6c
5da38a3f2a60db3681a5922ed03226860d0272c9
F20101221_AABZLC do_p_Page_045.jp2
6d5734f3ce2a18c4c407214787759598
1abeb53b1752eb4cb1908b89e12282bc8506aa6a
32430 F20101221_AABZKO do_p_Page_128.pro
6362e80d184c7b4de040f7a61808c4c8
a92e1af6764642b5d088992c96dbf43f59c4d992
50066 F20101221_AABZJZ do_p_Page_100.pro
98964637239dffd091589ef9be98ed8e
592b3f4bb8de9172adcb57a11d08a17bdafe5f18
943 F20101221_AABYIA do_p_Page_146.txt
04c2c6f4b729aca3388c5130f4dc9132
e467f49e3c171a5def6a7f92998e5cd03b4358dc
48891 F20101221_AABYHM do_p_Page_098.jpg
917ac07146bf95a0ac5c1aa8160403ab
ce938b12d93e3e3bea3401cc9f0c94098fbbbefd
18683 F20101221_AABYGX do_p_Page_141.QC.jpg
98609f305eeb7102276ab1648d9593a5
f47dd49221613547605912f663fedaf6ac3a309a
1051950 F20101221_AABZLD do_p_Page_039.jp2
1b3ab100948c6a7210cc439ab600be57
b78f8b9e75665e459131eec0ab57777743942d8d
1051949 F20101221_AABZKP do_p_Page_063.jp2
934c0512e02a3511e2e86b398a1a52bb
a899c84929422970963144ebe84c78ddf331fe75
55214 F20101221_AABYIB do_p_Page_033.pro
51e34ff5a93bac491900f27fb0832c2b
d5e5b5103fae4c0fa5fafdf38e682785f498a2e9
112090 F20101221_AABYHN do_p_Page_038.jpg
7ffb8d84cf805731f390a5d3610db616
7d5a04e182b5458a537ce7fdd99b4a83037c27ad
F20101221_AABYGY do_p_Page_016.tif
16ed385e159876748e1c524cb9221e27
2ec33c78371507f4ec2a8d23a562cd51841c06d4
F20101221_AABZLE do_p_Page_096.tif
3033c6c8126b2ad56bc8ba21fd9ad99f
f78b56860cf410b0543c729b7b74bf32639dcf21
52529 F20101221_AABZKQ do_p_Page_086.pro
5b7e6a3155e1fd662206c606a436dc7a
9005a45188fbda90d8407c560dedbd36cb6dfe8d
989136 F20101221_AABYIC do_p_Page_010.jp2
fcde5008247a5b393f7eddba88fba2d8
e5dba24c3ee9051d296d582d7b1eea29e9e870fd
63963 F20101221_AABYHO do_p_Page_068.jpg
dca86d82244cc45928c89933bd63092d
fe7b71c922d8cb91fd3811ca51a72fc003e98bd4
218553 F20101221_AABYGZ do_p_Page_052.jp2
bb744d596f4b44ca13bd5f5c00e340cd
45fe592a65ede74da62f4e665042f2a5b8ee7770
F20101221_AABZLF do_p_Page_154.tif
18839f1babf4f176b69440c7cc5691db
2d0044bd832f4b3a81357feaccce16fb31406ebe
14785 F20101221_AABZKR do_p_Page_143.QC.jpg
75496238f54cce83c5617896801b4421
db6fcd55720a89084e956ff23b4ea6406b04b6ff
9177 F20101221_AABYID do_p_Page_039thm.jpg
1e7371e9e053fd7bed38dc1ff85e527f
fea002510123effc7b7278a42312baf64f46d7ef
F20101221_AABYHP do_p_Page_112.tif
bf1d80e5960b105e6e8d7cba64897166
11510e0e394d90472acaaca33c66ed76b3064ffc
19156 F20101221_AABZLG do_p_Page_013.QC.jpg
a253487cd7efaccf507a72b8daf139f5
da293306604cf00396745ef2e10d249c8c059fed
97033 F20101221_AABZKS do_p_Page_100.jpg
c9214156e9eeb5c9f146642f640019f8
9196424398b9d48da14a92c900e9d2e303cc8f50
15972 F20101221_AABYIE do_p_Page_010.QC.jpg
6f155fe551ee9143ec299589ca820bf5
1e8201ed523d4444d738b9b755e26ca2833611e1
54349 F20101221_AABYHQ do_p_Page_112.pro
c1d959ac6146cab9d50fbf136a9f5866
8b9e557ce055c1e120be34972502438d5c9fcbfd
9410 F20101221_AABZLH do_p_Page_160thm.jpg
ae540515c41a74166c206dbf1763c084
8b6fe43b81aa66fb764cefe3f13029cbd3e6af17
F20101221_AABZKT do_p_Page_079.tif
e474616515371148d7b9e62f205db634
b9878726739adf20b6d4bf626d7c565a60f98c9b
F20101221_AABYIF do_p_Page_035.txt
859810c32e0d1851509341108ddad97a
48dc8d709f6a4831d254336085c51dc4e30561d9
52464 F20101221_AABYHR do_p_Page_061.pro
b1ba43dff43871a12529a3f1bc444a87
115b519c3948997a7976cb1208e2dfd08f277846
8973 F20101221_AABZLI do_p_Page_109thm.jpg
8e612c1f2a2b8795bffbab4a75cd5ddd
130ebbc52a7d23a0e786bf2b0d4b2474abc7b185
F20101221_AABZKU do_p_Page_092.tif
028a075e926b7bc33037efd78dcc75f9
0e821f3f1a42e1aacc911b8f76920fe3246454ab
8368 F20101221_AABYIG do_p_Page_026thm.jpg
45ac9e9c2a0deb0c8fda39beb8ac45a4
db522fa3af35bbd072ffb84a4c720dfcfa56d6c2
55995 F20101221_AABYHS do_p_Page_046.pro
8e92caebd666aba314de6e3fb916959d
3085dbe6a5adee821271c53781c96d61ccfcf861
2035 F20101221_AABZLJ do_p_Page_111.txt
b4122e98123e058b446d8888632c43be
d9279650facf051ef6892bcfefcc8f3915ec0b80
36998 F20101221_AABZKV do_p_Page_120.QC.jpg
f2632a2b60accb0c439c07b3b1239a86
a6ba3f8db1fb0459ee5dc305ace1cea67457d35f
38308 F20101221_AABYIH do_p_Page_105.QC.jpg
30692560e393696fc932a69c7e8e79ae
ca74c3f74d9f3348e0029b09da1e19aa562d1666
F20101221_AABYHT do_p_Page_070.jp2
60ca2d276e125daf405270b340c485ee
fba908de2a851fe559f677f098837366e7c3e9bb
8625 F20101221_AABZLK do_p_Page_070thm.jpg
e7ca0f106bfbf0e2c6a36941a012d805
f6335794e29b69d1cec38e948602226fd4c03749
26228 F20101221_AABYII do_p_Page_101.QC.jpg
a5edd91ae47747164113dd044e15506d
7afac8662d23a4f84a832485efbd016c346b091a
80985 F20101221_AABZLL do_p_Page_050.jpg
3c2b48c74750b8d14e56ec4cdf91bce2
623b9c1e42e50e3b21a532b1211433d49353ef18
F20101221_AABZKW do_p_Page_151.txt
75a29f8789570176602bb014568cb2f5
2820bac506c51121f1c73e93b59497e59460b7cd
F20101221_AABYIJ do_p_Page_027.tif
4f9853037261206975b83eb4ae5cc285
a2f0d62564f77d8933f67989e0ff930b0c763b71
11568 F20101221_AABYHU do_p_Page_091.QC.jpg
9a8566cbf1158ddc2f538c5622dcba5a
965c0e736d6ec2ced89b9271e8d7867ad400e464
5931 F20101221_AABZMA do_p_Page_139thm.jpg
b72931b9457e231a80ae45c70e854de9
7a807d72349ffc19346ecbc4b08f92d5f8bf31a7
43560 F20101221_AABZLM do_p_Page_008.pro
3f0da5fd178bd9122a3cf3ef41a64403
576fd469b0206696f9999e1cc63748e3ccf0def4
8070 F20101221_AABZKX do_p_Page_017thm.jpg
c999f72eb6bb903eda02480a836c37a5
aee3196f5d1f1f4051112d9670de23a9191437a5
20154 F20101221_AABYIK do_p_Page_095.QC.jpg
bd509209efb2fd8420d79af888f94dc4
30533d5ab9e974acb721742f9650dcd7be59ecb6
F20101221_AABYHV do_p_Page_053.tif
2fc92dfee1d6ba887828bab9761dd605
b6624fc16bb711caf0798057c4bb5b12cf207434
8242 F20101221_AABZMB do_p_Page_043thm.jpg
bd566bfb49f68ff1a9b0cfd61052aa88
1aa92c8aebc8fa92932b61ff0088d56fe9802448
F20101221_AABZLN do_p_Page_130.tif
e47df709f7e5b37acf93cbf6067eb270
1f34d1e8aeeff8a14f8a003bde203b2a243c792c
9075 F20101221_AABZKY do_p_Page_150thm.jpg
18b4f83de3ad2d6c0458c8e3af7db990
e2bb20c02ad4092a5ad1ea71f8a15f0b739c6721
F20101221_AABYIL do_p_Page_174.tif
42a3f44dd7c951cbf8633a22836b2fb9
8abac0434ad460c3ff57975c464fd70427a8df59
113776 F20101221_AABYHW do_p_Page_073.jpg
2cd63266353713291706453b5747e3ff
5674bd1b12dd9a46472ce3ac2be35a786bffab5e
112969 F20101221_AABZMC do_p_Page_084.jpg
ee92d0dc5561acee1e2122c5687f2f2d
78efb7bf6747b7b833308cd875e9f764e5b743a8
823 F20101221_AABZLO do_p_Page_145.txt
a5aeb7d41582de578627242edbeeab89
63f5fd469a9bcecc039f6bef5ba1445305c697ca
19756 F20101221_AABZKZ do_p_Page_093.QC.jpg
fb79d55d947ffcb9e76fc5b069902d06
4af888218bb439450a07e57917db2b33e7a944fd
2086 F20101221_AABYIM do_p_Page_150.txt
c4f48cea38056460f76d0afa3ae9a039
39a2f014a7a6c7e212c9444dc7b5b663bb8a4382
53790 F20101221_AABYHX do_p_Page_011.jpg
d168f4ccc8c77cfde58bc65fa8c3639d
60c3a41246e81ab9eda792f113db14fb8fd66980
F20101221_AABYJA do_p_Page_020.tif
c10857838bcf1377ff0ebd8f66eb26bb
ddbf9fdd4d4ccfa774a1a6d50f5fe89bab8c6a8d
32737 F20101221_AABZMD do_p_Page_137.jpg
6babe7c3c2cb6bf724acf644131c4333
04936003cd767c620942673a8f991e99acce6ea7
51883 F20101221_AABZLP do_p_Page_152.pro
f8d2a8ae6565b0b263838cb68112f430
3786bcd38285eb9bb834e12e3ca294f6e09d2364
98275 F20101221_AABYIN do_p_Page_053.jpg
c84bdd67611f19dc1e36d86c2f71a2d6
8cea4358145dd80b8924ed9f19729af283a11015
1237 F20101221_AABYHY do_p_Page_134.txt
edf4d251cd2c723c4f940c11434cacab
5720ae7f3c264bccd422d8b9703c622d18da9226
1368 F20101221_AABYJB do_p_Page_016thm.jpg
8c7ff51e531e0602f3756988794e3256
91ad3cd79bbd046fda209e6133294ea9669ba3e7
12655 F20101221_AABZME do_p_Page_153.pro
ace923234ccc9306bcf82a4a1cf39008
cf6b61ce328ee711f3d85d3cc0406e6bb69acc95
8599 F20101221_AABZLQ do_p_Page_022thm.jpg
a1d8947eee28f74bbdba2ed49df4ac5b
e18929daa38c5447e11ba9a09bb36dc50eae4f73
9247 F20101221_AABYIO do_p_Page_121thm.jpg
b4388d392d3493d5000eba1308c9fd1b
551c223fa2cd98de818ff5c75f17fc6b6f0e8ddc
2761 F20101221_AABYHZ do_p_Page_165.txt
df4c13113d42eca572caba04bb147af6
09fe33d59781fe1516e07e9fac749822f6f23185
17929 F20101221_AABYJC do_p_Page_012.QC.jpg
f8219a9b08778e2a0430c0e998dbf456
9a31c45565543777009892579e3775ae8ece70d4
2110 F20101221_AABZMF do_p_Page_113.txt
0b4c329b0c0801e72a405040bac302c5
04b17cab451b4636a89ec359696e348c1f786207
36721 F20101221_AABZLR do_p_Page_156.QC.jpg
6d5c9cecbac6af1676c17196bef2a7ea
a3b50761f43d82643535d8ee2f0b24f921480780
445954 F20101221_AABYIP do_p_Page_135.jp2
ff1ef9070c1e4d3dfac53cc8738464ad
d47a086913f713c1caa354688e67f913d6218273
110747 F20101221_AABYJD do_p_Page_061.jpg
74434b450ee72301ca978f41627a8706
551bcaffb5020f3e46a7007ad01149430056c683
109237 F20101221_AABZMG do_p_Page_064.jpg
f591319fb26d60f46e0e636215e36ea9
bd1f6cacc1a31aaa4e933a3b70025841a0219732
2874 F20101221_AABZLS do_p_Page_159.txt
1908ed9fda9048a7004a20770d18a141
625bce022827f1631af02a73a8925818e84a1ab8
578796 F20101221_AABYIQ do_p_Page_011.jp2
e46b449bbb94c0eedb8f7b9f557807c1
279ff17db4c1d3aa024b5b5118250759085ca248
F20101221_AABYJE do_p_Page_009.tif
dc3109a2cdf86e9dc3eb29b409260047
a1d4b2ce35389d04b16a639cab048f2a64712022
5713 F20101221_AABZMH do_p_Page_066thm.jpg
708665c18b834aa6c350655c185e73f8
82b28f90bb966a7b3b732cc674ab913d5fb00b75
34963 F20101221_AABZLT do_p_Page_152.QC.jpg
a0c9e72eea71c4b4ab942669ee478b90
330de974c494a003dba77b2f662f95127b332512
F20101221_AABYIR do_p_Page_140.tif
b5671537bd9c45d048ed03c07a721117
a5cd8f7a363807d8663ee12522c860654fe90dc2
F20101221_AABYJF do_p_Page_173.jp2
91ef35304961b08f10bb5716a27d4828
4f50537b81f1ebf28cf3ea3d0fcc4a7b2856ccc5
962 F20101221_AABZMI do_p_Page_003thm.jpg
3031f3dd8301d519b4ea89c2e72e5a25
66592fa9b311d2b6a453790f3870b1f7419f0d53
F20101221_AABZLU do_p_Page_005.jp2
ac95398bf02cbb127fb7baf2112889e7
424477626da0757287fa0e31a82f91fef8f53add
1294 F20101221_AABYIS do_p_Page_091.txt
4d84d3d9ea8ef07d3f9c8dc4e82f0305
57d7e16b3c55711f2e9e369ad5ecb09793f9ebcc
68508 F20101221_AABYJG do_p_Page_168.pro
e8dcd09df534cfcb8646f707c462b5ff
d02f0dc94e5c29e03cefe6f27e3b8c9fa09768c7
9077 F20101221_AABZMJ do_p_Page_107thm.jpg
bca20ba1336d65ac46570291c52bb769
69327f8a172a1e8d7c83ce1232d07f95651adc25
F20101221_AABZLV do_p_Page_121.jp2
586d5b384463d9f6e4db31e318aba9f0
bc581cb46debd70064c4a59e28e4c6189e9762ea
6289 F20101221_AABYIT do_p_Page_124thm.jpg
5e29ef2ad51474ccf568524a565dd92b
30d12f72f5d10d3ed95ada515a408c36043a96dd
505 F20101221_AABYJH do_p_Page_153.txt
35a6355adf9205f3fc55a9ba6a6ba0ae
a00791bd15caba6497ff5da2f552309ce7e94b82
F20101221_AABZMK do_p_Page_060.jp2
43e9baeee3828dbc1edeb874355fd676
dbd62444542060e8e0c7ca4e260de8fd12575c05
110247 F20101221_AABZLW do_p_Page_077.jpg
c85218f4e9d95d0008bbb0cd90f30de8
dbb865238c0e084d37ca240e2fe60898fba85f55
F20101221_AABYIU do_p_Page_136.tif
0502f6bee1d3c59409c4635c8d69d5ce
f24a0681ea796ad2caad0db6b71b2edf3ed4918a
F20101221_AABYJI do_p_Page_059.tif
4b58e0a1b2648c90a8f1d416c6dd0be6
4ef624d5ffc655059c38a7576e1b74f09253405d
F20101221_AABZML do_p_Page_063.tif
60d81188f6cabf3de5ba441f0e6e6294
ffca817a252a14ae5afe2df7290732f2c1efca63
30151 F20101221_AABYJJ do_p_Page_027.QC.jpg
b06eb7f2dea2863c0765895052cddc83
3e180b946e3dd9adfb5a9a355c6c36c7a8c69cd5
116455 F20101221_AABZNA do_p_Page_039.jpg
a9666a70fbbb7cb5cfd0ab6fb9a42487
2248b533ada7b7093d5861bd24969f1ec936fd37
F20101221_AABZMM do_p_Page_119.jp2
55ea68eb76619dd50d5b1503bb257fad
4b752076b7568884f538e691f7330d41a90724da
F20101221_AABZLX do_p_Page_086.jp2
5cc9066e98422828483b0ab39400b03a
f5f17f059de653f6335f40123def0d9f9621bb9b
501 F20101221_AABYIV do_p_Page_001.txt
1f8d2eb4aac135b4e9696ea71675d671
a77b4b28fcf4d2e1427d56f1bab461a782964fc4
F20101221_AABYJK do_p_Page_109.tif
4c43f59a24017eef30c1d2038224ee0e
20879453e8f372d34025f38371110f40fd1e4cc9
2085 F20101221_AABZNB do_p_Page_065.txt
33b846526e75bd6c93349ead554aaa67
47249db51a779ff042ae00239a5662e90ff4cb54
F20101221_AABZMN do_p_Page_066.tif
3bf3edd3c02c0c73645d55bc0c929adf
50fef6c93be2ce3fd125de7f2f6c6dd185a9b6af
F20101221_AABZLY do_p_Page_064.txt
a83e62534bcc31997393a802bc0d44ca
875977cea07f5085f45599b59f19b17792511cdc
F20101221_AABYIW do_p_Page_106.tif
e5b19a24b590813cbdbec8ce596657e2
e7a4174ad71e0630231bce59fa54cf51cdf63239
8713 F20101221_AABYJL do_p_Page_113thm.jpg
a7d897599d279d69447192dd8993a13d
a7c563a5f16f3a6606ea818e21d7bfc375f7302a
111499 F20101221_AABZNC do_p_Page_057.jpg
e06a80fae190f1f397e11d9e646632b5
640734eb6f685d1f023695a6e9d6e7f3beffd451
9871 F20101221_AABZMO do_p_Page_172thm.jpg
e5a6c1b7d5d5d9deb4cb501e45a23fc7
075d1f12148fac10a8aabedc5c84e04be4a5b1d4
F20101221_AABZLZ do_p_Page_168.tif
c80876e71c38793f7026e0f3505f3962
6f7caeae92acd7457766ad35bd4678a15ee86ced
F20101221_AABYIX do_p_Page_026.tif
f2193cae151cf9b8cea9e5e25f4103ab
111ce51f0e1373cc038bb2384f9ce286737e4263
485 F20101221_AABYKA do_p_Page_137.txt
fbc90ec72f0c1650ac9c4eb6cdf18311
678dbae871f0d401b1919d6a858fcd82164121bb
51759 F20101221_AABYJM do_p_Page_113.pro
9e64dee2d57369092c17431069690771
8f586ebec941e4e3a58aa0f4a9ac39fd0fce5558
110322 F20101221_AABZND do_p_Page_022.jpg
09cdf36e327042fe63af3c503808ea71
397d8215dae7f23c7d99ad1a7e341bddf0ac4a7a
10488 F20101221_AABZMP do_p_Page_130.pro
4b12f706d61ec2d2ca21b679cd4cacff
eb97cb67b72c988b6c6a2d5e1ab1cf83375a38b1
8746 F20101221_AABYIY do_p_Page_071thm.jpg
0f9b0e44fef4c6903ee034dc65d7c109
0e2ad989c0f9df91f9d79082e410f808015633c9
F20101221_AABYKB do_p_Page_074.tif
25c52c586772293fd4dab546adad2cc2
696e9e9b838a64bbe7bf1e3a33b10a751c0dda58
38266 F20101221_AABYJN do_p_Page_069.pro
99725991633655471c196ad15bee856b
db6e54f4f414d6409314c9c3d71924f7db01d7f3
F20101221_AABZNE do_p_Page_057.tif
26d42acd40030feede2639f9f61fce21
ee20b63f478129f5fd33684b5436223ba75d3156
F20101221_AABZMQ do_p_Page_076.tif
c121ea5f0c96881ac9dff90821c1ec03
d98b972bf9cd9909f178807559906a157c2f4b8e
F20101221_AABYIZ do_p_Page_045.tif
bd2af0b1cd5c8a27c7cf962867623b62
9dac19a30c244515bf926161cd61636e72d11ced
8913 F20101221_AABYKC do_p_Page_009thm.jpg
d7cc42cf56938d2b771c2a83655cafe9
0b868f475010003b15e0c286a44576e4e2a13b06
9358 F20101221_AABYJO do_p_Page_167thm.jpg
21d5c0906a4a2de900bcd159a0db89b0
3805f0728ea425932de77d41368ce1bef7467ebc
37127 F20101221_AABZNF do_p_Page_108.QC.jpg
70ef82d199411a35eb648e888d33adbf
70e351f45bc938e3a855024a1ac594e2acc49042
F20101221_AABZMR do_p_Page_143.tif
088050f3d22d5fc592be4d862f914aa0
9da4319e81b33a4c0a9fd74c9a91e9828a398879
55298 F20101221_AABYKD do_p_Page_031.pro
3bfd399893f7e8452e107ca05fd3cb64
b591c9de5ed8b93e7f7c3f7d518a9f5921be3f33
1051928 F20101221_AABYJP do_p_Page_102.jp2
06e48bd9cb450894cbadcc7a1cc014d2
1ff9715a8089e097d1cc7bc588806ddc9f5f357e
40256 F20101221_AABZNG do_p_Page_171.QC.jpg
24793aa994603ed17201a2cc8ee95398
f844dfcca45b2ec188426afa147d644d277088d0
2134 F20101221_AABZMS do_p_Page_122.txt
a71fd1c40f09c93e08564cbc0376688b
1df2cc8239886190acd8209e108c4e37a4f7ebf8
435916 F20101221_AABYKE do_p_Page_096.jp2
ee277ebd108a7120b93f0b2f7d078173
cf0798ce7949553c8ff46e5ef714f9ec4ac8b601
51309 F20101221_AABYJQ do_p_Page_071.pro
71f465abfdac78e014b65b4a287abbb8
9084fa880eb19e6c0bb5bb9030e4e9af05be0a1a
119854 F20101221_AABZNH do_p_Page_161.jpg
382f17169b29e73738f5d55d8500ec4c
7e58814c23cd23efc8becf9126d134d5028b904d
108666 F20101221_AABZMT do_p_Page_060.jpg
5eca9742dd3ac63942262c66f08f85af
456c3ed61da1a9618432ea19b6022f225f00cd1b
794574 F20101221_AABYKF do_p_Page_139.jp2
936053c162499cfad57c6c171d4add1a
b0bb65739f7810b5af63ae0f583868ea8b9ecce2
9057 F20101221_AABYJR do_p_Page_055thm.jpg
24cf168fb46e4c401beee5bcc6db1835
34340e29065056ce81dcefb76904584687be27ad
F20101221_AABZNI do_p_Page_072.jp2
b4d8f5a5a4aadfacba6e1f15617ffe95
0d5a7d14ac8716be7b8a24cad63edd9a4311c42a
F20101221_AABZMU do_p_Page_161.jp2
c09e307cbda7fb9635f1fabfc84e7583
ca9cc9ca8957e09ad793778ffbfc32addac67f40
F20101221_AABYKG do_p_Page_109.jp2
3b6e424fe619f9b7f1e84a9a2bcf87fe
f41b9cab4b5263bdbf657fa3862954c5a4599c53
110131 F20101221_AABYJS do_p_Page_070.jpg
8f432ab35ed642c8de59753c3767cda2
f77c1c6ac25768d9986ac29755bd27a8c44cdfee
1051986 F20101221_AABZNJ do_p_Page_024.jp2
decf4e676a4af2c8b1676251c02507ab
b6d4d181a6c81822c122d27b77dd941cf9b2ab07
35889 F20101221_AABZMV do_p_Page_022.QC.jpg
0b1201f9b10624c57d4faa856515943d
353ed497ed29d6527cfc48afd6a8647d8692afbe
1537 F20101221_AABYKH do_p_Page_128.txt
3841b1816d22cc746e1faa33b7d766bb
0ddf4a3cdc8886057fba6d727f6ee484308fe75e
F20101221_AABYJT do_p_Page_132.tif
40733195cd57314caa646b6b9607db52
d16bc636500df5efe1471eb69cc604c16b9085ce
36175 F20101221_AABZNK do_p_Page_061.QC.jpg
723af1ebe097404df96d137404b7e66b
3ecc0a130e01b605f6e052fbe9c92c5f0684ad42
2728 F20101221_AABZMW do_p_Page_158.txt
8c552020e0910c8d4158c199834d661d
928c31b1a81160a1860c92045a3b6c567130820a
34717 F20101221_AABYKI do_p_Page_113.QC.jpg
a1262e801d9b085dd9bf6b22fe681980
e8dd8322fb245b4573cd658faf617c258828dd72
2748 F20101221_AABYJU do_p_Page_162.txt
2972845d1afb62d33cd7d55eb20ae678
b0e70fe1f1385e11d5c1005aaebff343b5f0d298
9213 F20101221_AABZNL do_p_Page_054thm.jpg
11c00b0869052472ca3c838ea58acd1f
8575924a0ebd3f787de7f8ddfcc212d490cd3e82
1051918 F20101221_AABZMX do_p_Page_061.jp2
fd25dca99ecc1e9244035530a67375ce
7b4834cb2ecaea640df43f6ef14b9b96f737f37d
1229 F20101221_AABYKJ do_p_Page_125.txt
7eab860735a0f11ad5a0a1057ea94a74
206fe69f45f872bbd2ebed6b3bf339321d7af805
8757 F20101221_AABYJV do_p_Page_074thm.jpg
48efad9ee208bbe4303969df7cfed59c
ca8e55c4493437ef851a72b0e119dbf3f64674cd
48054 F20101221_AABZOA do_p_Page_015.jpg
91caef96c86d08585791e9a644e001ce
3e836a0b0e414360d5f3cdb978248f40a36265e6
115756 F20101221_AABZNM do_p_Page_042.jpg
395edeac69f85fefe53281822f508abb
23df55bcb0479489f4a7264b83f1dabab7bd54a2
2132 F20101221_AABYKK do_p_Page_119.txt
3fa8e3028dbdb0765b43e300f10fa1a0
ba74a7925bafbf6a597284473cbd414bbe6827ef
13461 F20101221_AABZOB do_p_Page_016.jpg
4b76f7a16da213c3fe98e18ea1e01b8e
f48a1de467490990c324bfb98e84e4964b099d65
71683 F20101221_AABZNN do_p_Page_095.jpg
cf7dab23319385a36d657cf79b9a20a7
a91b563d8c8a902a6e3e05649bf0e0458ae29cfa
54603 F20101221_AABZMY do_p_Page_117.pro
80512f353133026eb018702b2a584acf
0227daa1d64c63372ca57096587eefd72d41cb2b
97415 F20101221_AABYKL do_p_Page_043.jpg
77540b9cba16053dc0c0c57c00eb6579
96c0767c891a9d1c0990bd23c2af2cd159aef248
39794 F20101221_AABYJW do_p_Page_004.jpg
15ed8de0e953bf4fbf9f3a8bd233faef
97f36cf8680ac004b7f5d20b0c47475431f76ecd
107659 F20101221_AABZOC do_p_Page_044.jpg
63707afa802cbd49a138771f226a3ec8
9370a2631a77af1bfcfdd44270f3004b000daea5
F20101221_AABZNO do_p_Page_059thm.jpg
8ca6173677169b96366b3525ac8955cf
dadc0a8223d489805b80ad511ab854d5b874bfdb
52517 F20101221_AABZMZ do_p_Page_082.pro
2b1805e6b0bbeeb5f087e6515ef0b715
cac3ab266d931ee5666140718897c0d10f83334b
8657 F20101221_AABYLA do_p_Page_024thm.jpg
f7dcdf3fee79591659b7c2ea762d61eb
65ee22433a26cd24326acf3499aa839681e7aac4
6634 F20101221_AABYKM do_p_Page_005thm.jpg
f4ba56a22245a0b591d850425db3357e
f1b3462ed5b63e4726638d510095630c014c6383
F20101221_AABYJX do_p_Page_067.tif
d0d63220b58c91ea321b216b8aa28301
66dfc372112c8bb8b10b7e6ae6f95252c41bbf61
111580 F20101221_AABZOD do_p_Page_048.jpg
6d89407a34079bf24fe05e363d975ecc
c51f71235d258c801e6e266fa9e53517dfbbcae0
112568 F20101221_AABZNP do_p_Page_104.jpg
9dd48812548e98112279c4bf4d215075
f7647738499dc25840005a94877b500accc2cb2d
102873 F20101221_AABYLB do_p_Page_148.jpg
0b0bb5ae162a91ced7d024a91a151040
497645b84be568de20aff48c14d8c328a398ac44
9458 F20101221_AABYKN do_p_Page_131.QC.jpg
12f304ee9ecc45fef8e3b5cee7802a63
d6cebaf335ffc933e5f1a0bb67e927ba1e4ae92c
36030 F20101221_AABYJY do_p_Page_025.QC.jpg
0311d5a4551d585248f102fdefcd07b1
3cb57aa2099222f1d79befad4154d109ff00ac91
17788 F20101221_AABZOE do_p_Page_049.jpg
9e0cbbbf8d401448dd2aebf0b623dbf1
1343a6b9275138b73f9c2838aa67fe8a97e1e214
F20101221_AABZNQ do_p_Page_129.tif
034ca2b615427d78c24523631602215e
7996bd517881e2b47001716219b7472da6ef1890
F20101221_AABYLC do_p_Page_069.tif
52d6d85f1c82d338f56cb609bffb49ea
db8899f4b05353eeec045fb7e0ba1c71bf81687d
2124 F20101221_AABYKO do_p_Page_058.txt
22c01939a7e704081f8c5997a662121f
afdae1206b3f4123944b55eda3445e033afa733a
52949 F20101221_AABYJZ do_p_Page_024.pro
a4380d8f2e86fe551ac1260f14b0ed18
edd1dc8d672c2abd41184794284ebd1ee0d69f6c
63151 F20101221_AABZOF do_p_Page_051.jpg
c17c85fd2de581749e75233b44eeebb5
3b46f1d98214a38439cfedc1a676ecd6296e9c4e
198211 F20101221_AABZNR UFE0024891_00001.mets
42cdc164b5186844bdca4bbabdf393f5
049980cc7652a8ddbed917cdf9610ae8453407a0
do_p_Page_008.tif
36704 F20101221_AABYLD do_p_Page_119.QC.jpg
b44255344be8d5a04759c663f0e1a4e9
dcd40b068d8648aa7f9fb7a46fc8a68ff92a1bf9
F20101221_AABYKP do_p_Page_086.tif
a8a265c199062e254a619c1bc015931d
3bd50b7046fa9633d40efc5a4254d7943274a940
109645 F20101221_AABZOG do_p_Page_056.jpg
6141d705b1710945df3882e02045ec58
1558853b719bc9ef3acac86560c044bd02abe945
41233 F20101221_AABYLE do_p_Page_066.pro
7e393fff29bf122ba62a120e01eac4a7
7bd2182149f7f240b6fc7a1c855639c02fb9037d
16615 F20101221_AABYKQ do_p_Page_099.QC.jpg
49fbb78dd2e46b1c471375d3cdf8cdc3
ccf1095abbbb640fd4427c8b2abeb51ba2dfa15e
110277 F20101221_AABZOH do_p_Page_058.jpg
026881396a0187b6ea68f2c47d7983a2
8c3aa50c668726ba8941ee8eeffa91ba2b11800f
F20101221_AABYLF do_p_Page_172.jp2
82484b3d3a7e94236264791daafe59e2
e54d28d9633e2b07c90e6852a5df802fc68944b4
F20101221_AABYKR do_p_Page_043.txt
9befc0acacdf4a793e8251d4ffaae276
099025ec6d18be7aa63586372b5d49ed698fa152
109119 F20101221_AABZOI do_p_Page_063.jpg
129d7143af0ba135606efe5dfd608ce6
3af111dd7e4ef4fe1dc6f9fefe9d60f3b5c4fe7a
10422 F20101221_AABZNU do_p_Page_003.jpg
7879ad74cccf26442763ce8e2ba14e44
0e1e3d63c8fec3d1b7402b1fbd43620755423a8b
F20101221_AABYLG do_p_Page_043.jp2
f3d6e4d05139b9c2cfba601e7af3e8e2
17695a39d27e89ff09c7b7619adc26c137a6680e
2031 F20101221_AABYKS do_p_Page_044.txt
2e9fcb753100cab6aad4aa4a983120f1
d2b8370fce0960a8faef70a6ca508b6c7903beb9
93885 F20101221_AABZOJ do_p_Page_067.jpg
38e7e77ed0e13dfeac31752aabc637c4
cbbc2bfa92ab933dda206936d6787d1758fb853b
77023 F20101221_AABZNV do_p_Page_007.jpg
eba208a81bd79e828ceed91fc87e81da
d2574f410276f460edb3139837493a1357d90511
F20101221_AABYLH do_p_Page_142.jp2
89c9a09f2e3ef8db9d066cd07158fa14
5f87bbd41b43eb5842240443c8401df2fb294a9c
4959 F20101221_AABYKT do_p_Page_011thm.jpg
7c03fa997cf39091aca4de7b1e652028
03f8e56a1ed433d0ab661ca4442042d00eb5b882
112921 F20101221_AABZOK do_p_Page_075.jpg
183e3437a6319833f7cf0eb403890401
6c92b92e16dca14724be9e25432b280fecf0c971
91775 F20101221_AABZNW do_p_Page_008.jpg
6ca1cfb19060a129ef36095343ac4a11
f25e32deea4018dd943ddbd54d6a92753652f0b9
1746 F20101221_AABYKU do_p_Page_027.txt
30b7e6fd0d09c85f5aaac7460beaac4b
85a16d424ebac56282c1102947895d3569cca2f3
85556 F20101221_AABYLI do_p_Page_101.jpg
e946cb7b62a5f7c55512c78c48ff38ba
06c133f0fa8e17de65253228d7cc51af3c833b44
92464 F20101221_AABZOL do_p_Page_078.jpg
26b186cf1a79ea1d8fa1f3805d520181
e7f41fdb0cefd9f99db7e5085b414d44b299fcae
133797 F20101221_AABZNX do_p_Page_009.jpg
5666481c517dc06a4a21cdff6808825a
8652cad57731cce2ef8cfbd334a28a7612b536cf
F20101221_AABYKV do_p_Page_093thm.jpg
2ce415f628e855a57d8edc7f07addeb1
077a292a12dcd65cf0cab8f5df4e674c09d2ba51
13659 F20101221_AABYLJ do_p_Page_154.QC.jpg
3ad83306b78090ccbf0efde9197e3618
fe1f54d1b6e17e84d5dacc2903d0c6fed7acf5f1
125075 F20101221_AABZPA do_p_Page_167.jpg
af4a456ea54448f48a4d222e70046172
ce780545ecd4e7d5058bc69bef3be40690f8791e
95370 F20101221_AABZOM do_p_Page_079.jpg
c004dc01a7821f45ce5964a168a27a40
520ca4b0c930a4d470548f4de1b49f4ed547a212
54056 F20101221_AABZNY do_p_Page_010.jpg
16fc3196045ed216112be94c33139440
67275b5ec628e53b1e68e4b5e14c3c917714b4d6
25685 F20101221_AABYKW do_p_Page_088.jpg
a268216e0d2142988607d4436f164bd6
9773c2189e948e590ef84b807f54a0abc9e0c7b0
37932 F20101221_AABYLK do_p_Page_149.QC.jpg
f7f797fdcd5edd4aba9c37eb1c4f26af
4cd4a0cd35feffe2ad29589bad924c378214264c
138851 F20101221_AABZPB do_p_Page_168.jpg
f146ac492807c95e83f4058307282c02
b9c4281112ee72c2c9451eaaf04ff245c830007e
110969 F20101221_AABZON do_p_Page_080.jpg
42a23f35522a04c576b083809c1515f5
ae2c5d501bfe5b44f64868ce40c24dcc398f28b7
F20101221_AABYLL do_p_Page_011.tif
054584095d820e340b6be9be72979a81
7d87969dbb0e65ecbfef6a1ed42c92b7aba4adc0