<%BANNER%>

Identification of a Molecular Pathway Involving Caspase-11 and Caspase-1 in Sjogren's Syndrome

Permanent Link: http://ufdc.ufl.edu/UFE0024819/00001

Material Information

Title: Identification of a Molecular Pathway Involving Caspase-11 and Caspase-1 in Sjogren's Syndrome
Physical Description: 1 online resource (11 p.)
Language: english
Creator: Bulosan, Marievic
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: caspase, inflammasome, sjogren, syndrome
Medicine -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Sjo umlautgren's syndrome (SjS) is an autoimmune disorder that causes dry eyes and dry mouth disease due to inflammation of the salivary and lacrimal tissues in the body and occurs mainly in women over the age of 40. To date, little is known about the cause of this condition. This project utilizes various experimental methods to determine the presence of inflammatory-related components in the presence and absence of bacterial or viral stimul in both mouse models (in vivo) and cell lines (in vitro). This study aims to identify pathways that can be used to identify the causes of inflammation, and to utilize this information to advance strides in therapy or pharmaceutical manufacturing of medications that can be used to increase the quality of life in patients who are diagnosed with SjS, with the hopes to create target therapy that will prevent the progression of the disease.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Marievic Bulosan.
Thesis: Thesis (M.S.)--University of Florida, 2009.
Local: Adviser: Cha, Seunghee.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0024819:00001

Permanent Link: http://ufdc.ufl.edu/UFE0024819/00001

Material Information

Title: Identification of a Molecular Pathway Involving Caspase-11 and Caspase-1 in Sjogren's Syndrome
Physical Description: 1 online resource (11 p.)
Language: english
Creator: Bulosan, Marievic
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: caspase, inflammasome, sjogren, syndrome
Medicine -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Sjo umlautgren's syndrome (SjS) is an autoimmune disorder that causes dry eyes and dry mouth disease due to inflammation of the salivary and lacrimal tissues in the body and occurs mainly in women over the age of 40. To date, little is known about the cause of this condition. This project utilizes various experimental methods to determine the presence of inflammatory-related components in the presence and absence of bacterial or viral stimul in both mouse models (in vivo) and cell lines (in vitro). This study aims to identify pathways that can be used to identify the causes of inflammation, and to utilize this information to advance strides in therapy or pharmaceutical manufacturing of medications that can be used to increase the quality of life in patients who are diagnosed with SjS, with the hopes to create target therapy that will prevent the progression of the disease.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Marievic Bulosan.
Thesis: Thesis (M.S.)--University of Florida, 2009.
Local: Adviser: Cha, Seunghee.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0024819:00001


This item has the following downloads:


Full Text

PAGE 1

1 IDENTIFICATION OF A MOLECULAR PATHWAY INVOLVING CASPASE 11 AND CASPASE 1 IN SJ…GREN'S SYNDROME By MARIEVIC VICTORIA BULOSAN A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF TH E REQUIREMENTS FOR THE DEGREE OF MASTERS OF SCIENCE UNIVERSITY OF FLORIDA 2009

PAGE 2

2 2009 Marievic Victoria Bulosan

PAGE 3

3 To my grandparents, Antonio Madamba Tangonan and Martina Robles Tangonan, for their ever endur ing strength, perseverance and passion for having better lives for their children and future generations

PAGE 4

4 ACKNOWLEDGMENTS First and foremost I would like to acknowledge God, the ever forgiving and merciful Father. He has created and written this Book o f Life for me that went unnoticed in the past, but I have now realized that this master's degree is merely one of the chapters in my book where I would gain so much knowledge. I would also like to thank my parents, Hilario and Caridad Bulosan, for guiding me to focus my studies on science. Along with their constant support, they have taught me that you reap what you sow, and that doing your best will always benefit in the end. I would also like to show appreciation to my sister, Ate Marilyn, and the Horvit family for always having a home to go to for weekends and holidays. My friends have played an integral part in boosting my morale in times of struggle, so I would like to thank my V's, Teen, Brudder, Kevtin, Rachel, Ading Veejay, and wonderful brothers a nd sisters from Centerpoint Christian Fellowship and First Assembly of God for their constant outpour of love not only for each and every day of this process but for the entire time I have known each individual. I would also like to thank all of the membe rs of the Peck and Cha labs for helping me develop my skills and personality in these past four years of service in both labs. I could always count on Dr. Nguyen for tongue in cheek banter, Dr. Peck for the elaborate stories about his many travels, and Ms. Janet Cornelius for her meticulous lab managerial skills that I have tried my best to duplicate for the Cha lab. I appreciate my colleague, Kaleb, for being a precious asset our lab, speeding up our productivity, and contributing her knowledge to each and every troubleshooting experience that all of our lab members had experienced. I would also like to thank Ading Huy for enduring statistics class with me and having "sanity check sessions" over ropa vieja sandwiches at our favorite post class Latin cafe.

PAGE 5

5 Last but not least, I would like to thank my mentor, Seunghee Cha for even making this educational opportunity possible. She not only possesses the title of Principal Investigator and mentor, but also my boss, guide, role model, leader, friend and surrogat e mother. I appreciated her stern words when I was slow in completing my tasks as well as her encouragement not only when experiments faltered, but also for life in general. I recognize the value of this opportunity and only hope that I have reached expect ations as her "first" graduate student I would also like to thank anyone who I failed to mention specifically or non specifically, as it was a pleasure to receive a "Hello, how are you?" or a kind smile to get me through the window less workdays in the la b.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ ............... 4 TABLE OF CONTENTS ................................ ................................ ................................ ................. 6 LIST OF TABLES ................................ ................................ ................................ ........................... 8 ABSTRACT ................................ ................................ ................................ ................................ ... 10 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .................. 12 Sjšgren's Syndrome (SjS) and the SjS Mouse Model ................................ ............................ 12 The Developed C57BL/6.NOD Aec1Aec2 (B6DC) Mouse Strain ................................ 12 Caspase 11 as a Differentially Expressed Gene in B6DC Mouse Model During Pre Disease Stage ................................ ................................ ................................ ............... 13 Inflammatory Caspases ................................ ................................ ................................ ........... 14 Inflammasome and ASC ................................ ................................ ................................ ......... 15 The Inflammasome (Activation Scaffolds of Proinflammatory Caspases) ..................... 15 ASC ................................ ................................ ................................ ................................ 16 Activators of Inflammasome or ASC ................................ ................................ .............. 17 TLR 9 Activation in Response to Viral CpG ................................ ................................ ......... 18 Importance of Inflammatory Components in SjS ................................ ................................ ... 19 2 MATERIALS AND METHODS ................................ ................................ ........................... 22 Animals ................................ ................................ ................................ ................................ ... 22 Expression P rofiles of C aspase 11 and R elated M olecules by Semi Quantitative PC R ....... 22 Analysis of STAT 1 and NF B Transcriptional Activity by Electrophoretic Mobility Shift Assay (EMSA) ................................ ................................ ................................ ........... 23 Caspase Activity Assay ................................ ................................ ................................ .......... 24 Measurement of Apoptotic Cells by TUNEL Staining and Colocalization with Caspases .... 24 Identification of Caspase 11 Expressing Cells ................................ ................................ ....... 25 Measurement of IL 18 by Enzyme Linked Immunosorbent Assay (ELISA) ........................ 26 Cell Culture of HSG, THP 1 and RAW 264.7 Cell Lines ................................ ...................... 26 Detection of Apoptotic HSG Cells Cocultured with THP 1 Cells ................................ ......... 27 siRNA Transfection ................................ ................................ ................................ ................ 27 Cell Lysate Preparation ................................ ................................ ................................ ........... 28 Verification of siRNA Knockdown by Western Blotting ................................ ....................... 28 CpG ODN Treatment of RAW264.7 and THP 1 Cells ................................ .......................... 29 Measure of Activation of ASC and Gene Expression of Related Molecules Using Total RNA Isolation and Quantitative PCR and Confirmation of TLR 9 Gene Knockdown Using qPCR ................................ ................................ ................................ ......................... 30 In Cell Western Analysis of ASC and Caspase 11 Protein Expression ................................ 30

PAGE 7

7 Detection of ASC Activation Via Immunocytochemistry ................................ ...................... 31 Statistical Analyses ................................ ................................ ................................ ................. 31 3 RESULTS ................................ ................................ ................................ ............................... 32 Specific Aim 1 ................................ ................................ ................................ ........................ 32 Caspase 11 Gene E xpression is Upregulated in E xocrine G lands of SjS S usceptible M ice ................................ ................................ ................................ ............................. 32 Caspase 11 Expression is Detected in Macrophage and Dendritic Cells ........................ 32 STAT 1 but not NF B is Concomitantly Upregulated with Caspase 11 in the Salivary Glands of SjS Susceptible Mice ................................ ................................ .... 33 Caspase 11 Activates Caspase 1, but not Caspase 3 ................................ ...................... 34 Apoptosis is More Prevalent in the SMX of SjS Prone Mice Before Disease Onset in Comparison with Disease Free Mice ................................ ................................ ....... 34 Caspase 11 is not Detected in TUNEL Positive Acinar or Ductal Cells ........................ 35 Caspase 1 in Conjunction with IFN is Essential to Increased Apoptotic Cell Death of Human Salivary Gland Epithelial Cells ................................ ........................ 35 Specific Aim 2 ................................ ................................ ................................ ........................ 36 ASC and Caspase 11 are Upregulated in Murine RAW 264.7 Macrophages in the Presence of CpG ODN ................................ ................................ ................................ 36 Specific Aim 3 ................................ ................................ ................................ ........................ 37 TLR 9 siRNA Knockdown Reduces ASC Expression in THP 1 Cells .......................... 37 ASC Expression is Down Regulated in the Absence of TLR 9 ................................ ...... 38 4 DISCUSSION ................................ ................................ ................................ ......................... 39 LIST OF REFERENCES ................................ ................................ ................................ ............... 55 BIOGRAPHICAL SKETCH ................................ ................................ ................................ ......... 60

PAGE 8

8 LIST OF TABLES Table page 2 1 List of Semi quantitative PCR (RT PCR) designed for Mus musculus genes. .................. 23

PAGE 9

9 LIST OF F IGURES Figure page 3 1 Increased caspase 11 expression in the SMX of the SjS prone C57BL/6.NOD Aec1Aec2 mouse before lymphocytic infiltration. ................................ ............................. 46 3 2 Concomitant increase in STAT 1 acti vity in the SMX of C57BL/6.NOD Aec1Aec2 at 8 weeks. ................................ ................................ ................................ .......................... 47 3 3 Activation of caspase 1 mediated pathway in C57BL/6.NOD Aec1Aec2 before disease onset. ................................ ................................ ................................ ...................... 48 3 4 Increased epithelial cell death in the glan ds of disease prone mice at 8 weeks and lack of direct colocalization of caspase 11 with TUNEL positive cells. ........................... 49 3 5 Inhibition of apoptotic cell death of HSG cells by caspase 1 knockdown in THP 1 cells.. ................................ ................................ ................................ ................................ .. 50 3 6 Increased ASC and caspase 11 expression in RAW 264.7 macrophages in response to different conditions. ................................ ................................ ................................ ....... 51 3 7 Activation of ASC in RAW 264.7 cells by stimulation with pCpG. ................................ 52 3 8 Inhibition of TLR 9 (CpG DNA recognition) pathway via TLR 9 siRNA knockdown in THP 1 cells. ................................ ................................ ................................ 53 3 9 Schematic representation of the current working hypothesis. ................................ ........... 54

PAGE 10

10 Abstract of Thesis Presented t o the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Masters of Science IDENTIFICATION OF MOLECULAR PATHWAY INVOLVING CASPASE 11 AND CASPASE 1 IN SJ…GREN'S SYNDROME By Marievic Vic toria Bulosan August 2009 Chair: Seunghee Cha Major: Medical Sciences To date, little is known why exocrine glands are subject to immune cell infiltration s in Sjšgren's syndrome (Sj S). Studies with SjS prone C57BL/6.NOD Aec1Aec2 (B6DC) mice showed a lter ed glandular homeostasis in the submandibular glands (SMX) at 8 weeks prior to disease onset and suggested potential involvement of the inflammatory caspases, caspase 11 and caspase 1 To determine if inflammatory caspases are critical for the increased ep ithelial cell death prior to SjS like disease, this study investigated molecular events involving this caspase 11/caspase 1 axis Results revealed concurrent up regulation of caspase 1 1 in macrophages, STAT 1 activity caspase 1 activity and apoptotic epit helial cells in the SMX of C57BL/6.NOD Aec1Aec2 at 8 weeks C aspase 1, a critical factor for IL 1 and IL 18 secretion resulted in elevated level of IL 18 in saliva Interestingly, TUNEL positive cells in the SMX of C57BL/6.NOD Aec1Aec2 were not co localized with caspase 11, indicating that caspase 11 functions in a non cell autonomous manner. Increased apoptosis of a human salivary gland ( HSG ) cell line occurred only in the presence of LPS and IFN stimulated human monocytic THP 1 cells, which was reversed when caspase 1 in THP 1 cells was targeted by siRNA Furth er investigation of upstream stimuli suggest that HSV 1 CpG DNA stimulated ASC, a key adaptor molecule in the inflammasome, through TLR 9. This was further confirmed by TLR9 siRNA

PAGE 11

11 transfection where knockdown of TLR 9 abolished the induction of ASC. Taken together, this stud y discovered that inflammatory caspases are essential in promoting a pro inflammatory microenviro n ment and influencing increased epithelial cell death in the target of tissues in SjS before disease onset In addition, Herpes CpG DNA act ivation of TLR 9 can induce ASC, suggesting that viral DNA may play a role in triggering an inflammatory process through the inflammasome.



PAGE 1

1 IDENTIFICATION OF A MOLECULAR PATHWAY INVOLVING CASPASE 11 AND CASPASE 1 IN SJGRENS SYNDROME By MARIEVIC VICTORIA BULOSAN A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF TH E REQUIREMENTS FOR THE DEGREE OF MASTERS OF SCIENCE UNIVERSITY OF FLORIDA 2009

PAGE 2

2 2009 Marievic Victoria Bulosan

PAGE 3

3 To my grandparents, Antonio Madamba Tangonan and Martina Robles Tangonan, for their ever endur ing strength, perseverance and passion for having better lives for their children and future generations

PAGE 4

4 ACKNOWLEDGMENTS First and foremost I would like to acknowledge God, the ever forgiving and merciful Father. He has created and written this Book o f Life for me that went unnoticed in the past, but I have now realized that this masters degree is merely one of the chapters in my book where I would gain so much knowledge. I would also like to thank my parents, Hilario and Caridad Bulosan, for guiding me to focus my studies on science. Along with their constant support, they have taught me that you reap what you sow, and that doing your best will always benefit in the end. I would also like to show appreciation to my sister, Ate Marilyn, and the Horvit family for always having a home to go to for weekends and holidays. My friends have played an integral part in boosting my morale in times of struggle, so I would like to thank my Vs, Teen, Brudder, Kevtin, Rachel, Ading Veejay, and wonderful brothers a nd sisters from Centerpoint Christian Fellowship and First Assembly of God for their constant outpour of love not only for each and every day of this process but for the entire time I have known each individual. I would also like to thank all of the membe rs of the Peck and Cha labs for helping me develop my skills and personality in these past four years of service in both labs. I could always count on Dr. Nguyen for tongue in -cheek banter, Dr. Peck for the elaborate stories about his many travels, and Ms. Janet Cornelius for her meticulous lab managerial skills that I have tried my best to duplicate for the Cha lab. I appreciate my colleague, Kaleb, for being a precious asset our lab, speeding up our productivity, and contributing her knowledge to each and every troubleshooting experience that all of our lab members had experienced. I would also like to thank Ading Huy for enduring statistics class with me and having sanity check sessions over ropa vieja sandwiches at our favorite post -class Latin cafe.

PAGE 5

5 Last but not least, I would like to thank my mentor, Seunghee Cha for even making this educational opportunity possible. She not only possesses the title of Principal Investigator and mentor, but also my boss, guide, role model, leader, friend and surrogat e mother. I appreciated her stern words when I was slow in completing my tasks as well as her encouragement not only when experiments faltered, but also for life in general. I recognize the value of this opportunity and only hope that I have reached expect ations as her first graduate student I would also like to thank anyone who I failed to mention specifically or non-specifically, as it was a pleasure to receive a Hello, how are you? or a kind smile to get me through the window -less workdays in the la b.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS .................................................................................................................... 4 LIST OF TABLES ................................................................................................................................ 8 LIST OF FIGURES .............................................................................................................................. 9 ABSTRACT ........................................................................................................................................ 10 CHAPTER 1 INTRODUCTION ....................................................................................................................... 12 Sjgrens Syndrome (SjS) and the SjS M ouse Model .............................................................. 12 The Developed C57BL/6.NOD -Aec1Aec2 (B6DC) Mouse Strain ................................... 12 Caspase 11 as a Differentially Expressed Gene in B6DC Mo use Model During Pre Disease Stage .................................................................................................................... 13 Inflammatory Caspases ............................................................................................................... 14 Inflammasome and ASC ............................................................................................................. 15 The Inflammasome (Activation Scaffolds of Proinflammatory Caspases) ...................... 15 ASC ...................................................................................................................................... 16 Activators of Inflammasome or ASC ................................................................................. 17 TLR 9 Activation in Response to Viral CpG ............................................................................ 18 Importance of Inflammatory Components in SjS ..................................................................... 19 2 MATERIALS AND METHODS ............................................................................................... 22 Animals ........................................................................................................................................ 22 Expression Profiles of Caspase -11 and Related Molec ules by Semi Quantitative -PC R ....... 22 Analysis of STAT 1 and NF B Transcriptional Activity by Electrophoretic Mobility Shift Assay (EMSA) ................................................................................................................ 23 Caspase Activity Assay .............................................................................................................. 24 Measurement of Apoptotic Cells by TUNEL Staining and Colocalization with Caspases .... 24 Identification of Caspase 11 Expressing Cells .......................................................................... 25 Measurement of IL 18 by Enzyme Linked Immunosorbent Assay (ELISA) ......................... 26 Cell Culture of HS G, THP 1 and RAW 264.7 Cell Lines ........................................................ 26 Detection of Apoptotic HSG Cells Cocultured with THP 1 Cells ........................................... 27 siRNA Transfection .................................................................................................................... 27 Cell Lysate Preparation ............................................................................................................... 28 Verification of siRNA Knockdown by Western Blotting......................................................... 28 CpG ODN Treatment of RAW264.7 and THP 1 Cells ............................................................ 29 Measure of Activation of ASC and Gene Expression of Related Molecules Using Total RNA Isolation and Quantitative PCR and Confirmat ion of TLR 9 Gene Knockdown Using qPCR ............................................................................................................................. 30 In Cell Western Analysis of ASC and Caspase 11 Protein Expression .................................. 30

PAGE 7

7 Detection of ASC Activation Via Immunocytochemistry ........................................................ 31 Statistical Analyses ..................................................................................................................... 31 3 RESULTS .................................................................................................................................... 32 Specific Aim 1 ............................................................................................................................. 32 Caspase 11 Gene Expression is Upregulated in Exocrine Glands of SjS Susceptible M ice .................................................................................................................................. 32 Caspase 11 Expression is Detected in Macrophage and Dendritic Cells ......................... 32 STAT 1 but not NF B is Concomitantly Upregulated with Caspase 11 in the Salivary Glands of SjS Susceptible Mice ....................................................................... 33 Caspase 11 Activates Caspase 1, but not Caspase 3 ........................................................ 34 Apoptosis is More Prevalent in the SMX of SjS -Prone Mice Before Disease Onset in Comparison with Disease Free Mice ......................................................................... 34 Caspase 11 is not Detected in TUNEL Positive Acinar or Ductal Cells ......................... 35 Caspase 1 in Conjunction with IFN is Essential to Increased Apoptotic Cell Death of Human Salivary Gland Epithelial Cells .......................................................... 35 Specific Aim 2 ............................................................................................................................. 36 ASC and Caspa se 11 are Upregulated in Murine RAW 264.7 Macrophages in the Presence of CpG ODN .................................................................................................... 36 Specific Aim 3 ............................................................................................................................. 37 TLR 9 siRNA Knockdown Reduces ASC Expression in THP 1 Cells ........................... 37 ASC Expression is Down Regulated in the Absence of TLR 9 ....................................... 38 4 DISCUSSION .............................................................................................................................. 39 LIST OF REFERENCES ................................................................................................................... 55 BIOGRAPHICAL SKETCH ............................................................................................................. 61

PAGE 8

8 LIST OF TABLES Table page 2 1 List of Semi -quantitative PCR (RT PCR) designed for Mus musculus genes. .................. 23

PAGE 9

9 LIST OF FIGURES Figure page 3 1 In creased caspase 11 expression in the SMX of the SjS -prone C57BL/6.NOD Aec1Aec2 mouse before lymphocytic infiltration ................................................................ 46 3 2 Concomitant increase in STAT 1 activity in the SMX of C57BL/6.NOD -Ae c1Aec2 at 8 weeks ............................................................................................................................... 47 3 3 Activation of caspase 1 -mediated pathway in C57BL/6.NOD -Aec1Aec2 before disease onset ........................................................................................................................... 48 3 4 Increased epithelial cell death in the glands of disease -prone mice at 8 weeks and lack of direct colocalization of caspase 11 with TUNEL -positive cells ............................ 49 3 5 Inhibition of apoptotic cell death of HSG cells by caspase 1 knockdown in THP 1 cells ......................................................................................................................................... 50 3 6 Increased ASC and caspase 11 expression in RAW 264.7 macrophages in response to different conditions ............................................................................................................ 51 3 7 Activation of ASC in RAW 264.7 cells by stimulation with pCpG ................................... 52 3 8 Inhibition of TLR 9 (CpG DNA recognition) pathway via TLR 9 -siRNA knockdown in THP 1 cells .................................................................................................... 53 3 9 Schematic representation of the current working hypothesis. Inductive viral profile results in alterations in the target tissue through the activation of IFN -STAT and a subsequent induct ion of caspase 11 ...................................................................................... 54

PAGE 10

10 Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requir ements for the Degree of Master of Science IDENTIFICATION OF MOLE CULAR PATHWAY INVOLVING CASPASE 11 AND CASPASE 1 IN SJGRENS SYNDROME By Marievic Victoria Bulosan December 2009 Chair: Seunghee Cha Major: Medical Sciences To date, little is known why exocrine glands are subject to immune cell infiltrations in Sjgre ns syndrome (Sj S). Studies with SjS -prone -C57BL/6.NOD -Aec1Aec2 (B6DC) mice showed a ltered glandular homeostasis in the submandibular glands (SMX) at 8 weeks prior to disease onset and suggested potential involvement of the inflammatory caspases, caspase 1 1 and caspase 1 To determine if inflammatory caspases are critical for the increased epithelial cell death prior to SjS -like disease, this study investigated molecular events involving this caspase 11/caspase 1 axis Results revealed concurrent up regulat ion of caspase 1 1 in macrophages, STAT 1 activity caspase 1 activity and apoptotic epithelial cells in the SMX of C57BL/6.NOD Aec1Aec2 at 8 weeks C aspase 1, a critical factor for IL 18 secretion resulted in elevated level of IL 18 in saliva Interestingly, TUNEL -positive cells in the SMX of C57BL/6.NOD Aec1Aec2 were not co localized with caspase 11, indicating that caspase 11 functions in a non-cell autonomous manner. Increased apoptosis of a human salivary gland (HSG ) cell line occurred only i n the presence of LPS and IFN -stimulated human monocytic THP 1 cells, which was reversed when caspase 1 in THP 1 cells was targeted by siRNA Further investigation of upstream stimuli suggest that HSV 1 CpG -DNA stimulated ASC, a key adaptor molecule in the inflammasome, through TLR 9 This was further confirmed by TLR9siRNA

PAGE 11

11 transfection where knockdown of TLR 9 abolished the induction of ASC. Taken together, this stud y discovered that inflammatory caspases are essential in promoting a pro inflammatory microenviro n ment and influencing increased epithelial cell death in the target of tissues in SjS before disease onset In addition, Herpes CpG DNA activation of TLR 9 can induce ASC, suggesting that viral DNA may play a role in triggering an inflammatory process through the inflammasome

PAGE 12

12 CHAPTER 1 INTRODUCTION Sjgrens Syndrome (SjS) and the SjS Mouse Model Sjgren's syndrome (SjS) is a chronic autoimmune disease that targets the exocrine glands. It affects mainly the salivary and lacrimal glands, resulting in dry mouth and/or dry eye conditions as well as sub sequent complications in patients as a consequence of autoimmune responses to self antigens. Interestingly, epithelial cells in the target tissue are actively involved in the immune process by upregulating co -stimulatory molecule s and MHC class II molecules (1). Although involvement of a precise MHC locus has been suggested, SjS has shown weak familiarity, opposed to Type I diabetes. This highlights the importance of environmental factors su ch as viral infection in the initiation of the disease. Despite extensive research into the etiology of SjS focusing on genetic, environmental and/or immune factors, neither the triggering nor the disease initiating events in the target exocrine glands are known. Therefore, mechanisms are poorly defined due to lack of information on SjS pathogenesis during the pre -disease phaz es of SjS. To overcome this problem, investigations have turned to mouse models. The Developed C57BL/6.NOD -Aec1Aec2 (B6DC) Mouse Stra in Our earlier studies on susceptibility of genes for development of SjS like disease suggested that two genetic intervals control physiological deviations and immunological responses. Idd5 (insulin dependent diabetes) on chromosome 1 controls physiologica l aberrations while Idd3 locus on chromosome 3 controls the immunological responses (2). In addition, when these intervals were placed into disease -free C57BL/6 mice, this was sufficient to permit complete development of SjS like disease phenotype without developing Type I diabetes that is seen in the parental NOD mouse (3). The developed strain has been designated C57BL/6.NOD -Aec1Aec2

PAGE 13

13 (B6DC) and has been greatly beneficial to generate congenic, transgenic, or knockout strains with other mouse strains in part due to the wild -type C57BL/6 background. Our research examining the salivary glands of B6DC indicate the presence of multiple altera tions in glandular homeostasis even in the absence of infiltrating immune cells and before onset of clinical disease (4 6) These changes include altered cell proliferation at the time of birth, upregulated apoptosi s of acinar tissues, proteolysis of secreted proteins such as sPLUNC and increased expression of interferon-gamma (IFN g ). Caspase -11 as a Differentially Expr essed Gene in B6DC Mouse Model D uring P re-Disease S tage In an initial attempt to understand the und erlying molecular mechanisms for altered tissue homeostasis before disease onset in the NOD mouse model, experiments previously compared the differential gene expression profiles in the submandibular glands (SMX) of 8 and 12-week old B6DC, with those of C 57BL/6 mice (7). Use of B6DC, in place of the NOD mouse, permitted elimination of strain associated genes, and rather focused on collection of disease associated genes as the congenic strain has the same genetic bac kground as C57BL/6. The refore, the B6DC mouse strain enabled us to therefore investigate early pathogenesis of SjS without potential complications of Type 1 diabetes occurring in the NOD mouse strain. Hybridiations utilizing cDNA probes from respective submandibular glands revealed 75 differentially expressed genes involving fundamental cellular activities such as transcription, translation, DNA replication, and protein folding. Microarray analysis revealed that among the apoptosis related genes present in the microarrays, caspase 11 was significantly upregulated at 8 weeks of age in C57BL/6.NOD Aec1Aec2 mice, a time when increased apoptosis is seen in the salivary glands (indicative of chronic pro inflammatory stimuli in the salivary glands of SjS). However no significant differences were observed in either Bcl2 family genes or caspase 9 (7). Interestingly,

PAGE 14

14 what is known is that caspase 11 is expressed only under pathologic conditions, such as endotoxic shock, multip le sclerosis and brain ischemia. Inflammatory Caspases Recent studies imply that a subset of caspases is involved in the proteolytic maturation of inflammatory cytokines rather than causing apoptosis. Such caspases (human caspase 1, 4, and 5 and murine c aspase 11 and 12) were designated inflammatory caspases due to their main function of regulating inflammatory processes. Of note, t hese caspases also contain a CARD (caspase recruitment domain) at their N -terminus (8). Caspase 1 was initially identified as a result of attempts to purify the enzyme responsible for cleaving pro interleukin 1beta (pro -IL 1beta) (9) for its secretion. Additionally, caspase 1 activates interleukin 18 (IL 18), also referred to as interferon -gamma inducing factor. Although caspase 1 deficient mice have insufficiency in maturation of proinflammatory cytokines they show no eviden ce of a defect in apoptosis (10) Nevertheless, caspase 1 appears to engage neuronal cell death (11) potentially by secreting pro inflammatory cytokines rather than killing cells in a cell autonomous manner. Murine caspase 11 is a poorly characterized inflammatory caspase that is believed to be a dual activator of caspase 1 and/or caspase 3 (12) Caspase 11 is not expressed under normal conditions but is produced in many types of cells in response to cytotoxicity. Caspase 3 is an executi onary caspase for apoptotic cell death (apoptotic caspase), whereas caspase 1 and caspase 11 are involved in inflammator y process (inflammatory caspases). Activation of caspase 1 by caspase 11 can result in the synthesis of the mature form of proinflammatory cytokine interleukin (IL) 1beta and IL 18 in response to lipopolysaccharide (LPS) (13) ; thus, it is not surprising that mice deficie nt in caspase 11 exhibit a phenotype very similar to caspase 1 gene knockout mice. In addition, embryonic fibroblasts derived from caspase 11 gene knockout

PAGE 15

15 mice are resistant to apoptosis induced by ectopic expression of caspase 1, suggesting that caspase 11 is an upstream activator of caspase 1 (13) Beyaert et al. (14) reported that binding of nuclear factor B (NF -B) and signal transducers and activators of transcription 1 (STAT 1) to the cloned fragments of 5' -flanking promoter r egions of caspase 11 was necessary, respectively, for LPS and IFN -gamma -inducible expression of caspase 11 in macrophages. Although the human orthologue of caspase 11 has not yet been identified because of insufficient information about its expression, in duction and in vivo substrates of human proteases associated with caspase 1, it is assumed that caspase 4 or 5 plays a similar role based on sequence homologies (14, 15) To better understand the potential role of upregulated caspase 11 in the salivary glands of B6DC mice before onset of SjS like disease and to investigate whether the molecular events involving caspase 11 are critical for the altered glandular homeostasis, we have examined the expression and activit y of both upstream transcription factors and downstream target molecules of the caspase 11-mediated pathway both in vitro and in vivo determining the potential consequence of the activated pathway critical to producing a pathologic microenvironment that m ediates autoimmunity. Inflammasome and ASC The Inflammasome (Activation Scaffolds of Proinflammatory Caspases) In 2002, Jurg Tschopp and associates in Switzerland identified and designated a complex of proteins known as the inflammasome, that have disti nct roles in the innate defense system by regulating inflammatory caspase 1 activation (16) It has been determined that members of the NALP family of proteins are the main components of the inflammasome although de tails on the precise expression or associative bindings are unidentified. NALPs exhibit a tripartite PYD NACHT LRR structure, and bind to ASC (apoptosis associated speck-like protein containing a caspase activating domain (CARD). Such binding causes activa tion of caspase 1 upon over -

PAGE 16

16 expression. Stimulation of the inflammasome triggers a sequence of internal reactions that ultimately activates proteolytic processing of pro -IL1beta and IL 18 into mature IL 1beta and IL 18, respectively. The inflammasome is su ggested to act as early sensory machinery to detect danger signals within the cell as well as triggering the host defense system. However, events that trigger the assembly of the inflammasome are still mostly unknown (17) ASC ASC is a major adapter protein involved in cleavage of pro inflammatory cytokines. This cytoplasmic adapter protein is composed of an N -terminal pyrin -paad -dapin domain (PYD) and a C-terminal CARD domain. ASC links Ipaf (ICE -protease activating factor, a.k.a CARD12 or CLAN), a member of Apaf1 like proteins, to signal transduction pathways leading to cell death and nuclear factor kappa B (NF kB) activation (8). Ipaf 1 enables ASC to recruit NALP3 and Casp ase 1 through a CA RD CARD association, however to d ate, the activation mechanism remains unclear. Ipaf inflammasome molecules include NALP1, NALP3 (cryopyrin), pyrin, and ASC. The inflammasome pathway can be triggered by stimuli such as infection by bacter ia or activation by Toll like receptor agonists such as viral DNA (18) Once activated, the inflammasome causes pyroptosis, an inflammatory form of cell death as a result of activation of caspase 1. Such cell death is caus ed by oligomerization of ASC adapter protein and low intracellular ionic strength and potassium depletion. One can thus refer to ASC as a pyroptosome (18) since a mature ASC pyroptosome contains both oligomerized ASC dimer s and caspase 1, found downstream of the inflammasome. Pyrin is a direct activator of the ASC pyroptosome in innate immunity (19) ASC in particular participates in the immune response by regulating inflammation in response to bacterial and viral pathogens. Under normal conditions, ASC is localized in the cytoplasm. Under apoptotic conditions, ASC condenses to form ball like aggregates or speck like structures near the nuclear periphery (20)

PAGE 17

17 Activators of Inflammasome or ASC CpG rich DNA from bacteria and viruses stimulate den d ritic cells and macrophages to release increased amounts of interferon -gamma (IFN -gamma, Type 1) via activation of the Toll like receptor 9 (TLR9) pathway (21) CpG -rich DNA also causes an anti -viral response which is dependent on a strong pro -inflammatory component controlled by TNF and IL 1beta (22) Immune -stimulating activity requires short oligonucleotide sequences with unmethylated CpG dinucleotides, which are normally seen at lower frequency in mammalian DNA (23, 24) CpG induces activation of antigen presenting cells (APC) and T -cell proliferation as well as polylonal antibody production in B cells. Lipopolysaccharide (LPS) is a gram negative, enterobacterial product and a potent activator of mouse macropha ges (25) I t acts through Toll like receptor 4 (TLR 4) signaling. TLR 4 is a transmembrane protein that shares a high degree of homology with TLR 9 (26) In a study conducted by Gao, tumor necrosis factor alpha, caspase 11, IL 18 and IL 1beta were induced in mouse macrophages by CpG DNA in a manner similar to or greater than LPS In comparison to LPS as an activator of the immune response, CpG DNA inducible genes sol ely contain a subset of LPS -stimulated genes, which suggest that CpG DNA employ only a subset of LPS -induced signaling pathways. LPS activates additional signaling pathway(s) not engaged by CpG DNA (TLR 9) signaling (25) Therefore, Gao concluded that in the presence of CpG -DNA or LPS, macrophages respond rapidly by modifying expression of genes that encode factors responsible for controlling activity in the innate immune system. CpG D NA upregulates expression of MHC Class-II and respective co -stimulatory molecules, induces pr oduction by macrophages and dend ritic cells, as well as promotes polyclonal activation of B cells (27 29) CpG motifs were significantly suppressed in gammaherpesviruses, Epstien-Barr virus (EBV) and herpesvirus saimiri (HVS) compared to alphaherpesvirus (i.e. herpes simplex virus),

PAGE 18

18 in which CpG motifs were relatively enriched. Herpes simplex 1 virus (HSV 1) is a member of th e Herpesviridae family (30) HSV 1 infection causes potent caspase1 activation and pro IL 1beta maturation as DNA viruses in general a ctivate an IL 1beta based inflammatory response (17) Lundberg conducted experiments that studied HSV and herpes stromal keratitis (HSK). Lundberg concluded that HSV infected neurons latently in the eye, leading to HSK disease. It is also important to note the intrinsic immunostimulatory ability of HSV DNA and the tendency for HSV to persist and establish latency in a variety of tissues. HSV CpG DNA can activate macrophages to produce effector molecules that are nor mally induced following encounter with bacterial or viral pathogens or components derived from them. CpG dinucleotides are to a great extent undermethylated in HSV 1 DNA purified from virions. Macrophages and dendritic cells phagocytose dead cells that would activate these cells by their cargo of immunostimulatory HSV 1 DNA to produce proinflammatory cytokines (IL 12, IFN gamma, IL 6, ad TNF) and chemokines (31) Since macrophages and dendritic cells are fully competent to present antigen, the y might orchestrate an autoimmune attack on tissue by presenting cryptic antigens exposed as a consequence of cel lular damage to immune cells that escaped thymic or peripheral deletion (32) This may give rise to interesting and novel mechanism s by which HSV 1 and other viruses might contribute to or exacerbate autoimmune dise ases such as Sjogrens syndrome. TLR -9 Activation in Response to Viral CpG Toll like receptors regulate activation of the immune system after recognizing pathogens either intracellularly or extracellularly. Toll -like receptor 9 (TLR 9) is a DNA receptor pr otein for bacterial and viral CpG DNA released from microbes (33) to deliver intracellular signals (34 37) Expression of TLR 9 is therefore found in endosomal vesicles rathe r than on the cell surface. Instances such as tissue injury, inflammation or insufficient clearance of self -machinery

PAGE 19

19 can cause higher levels of circulating self antigens that may stimulate the TLR 9/MyD88mediated signaling pathway (38, 39) TLR 9 is located in the endoplasmic reticulum (ER) of resting macrophages and dendritic cells. Latz et al (33) reported that upon internalization of CpG DNA into the subcellular compartment, the TLR 9 receptor is translocated to the same compartment. With CpG DNA internalization, TLR 9 redistribution occurs, as a portion of the receptor protein travels first to early endosomes and progressively into the tubular lysosomal area. This TLR 9 m ovement to CpG rich locations enablesCpG TLR 9 binding and subsequent signal transduction initiation (33) As a consequence, CpG DNA activates MAP kinases that trigger kinase activation that in turn, activate transc ription factors NF kappaB and AP 1. The initiation of these transcription factors leads to enhanced expression of the genes that control immune cells (40) Unmethylated CpG motifs are another molecular mechanism to trigger the innate immune response via the TLR 9 -mediated pathway (41, 42) Importance of Inflammatory Components in SjS Originally described as IFN -gamma inducing factor, IL 18 is an effective inflammatory stimulan t produced by macrophages and dendritic cells (10) IL 18 protein is strongly expressed in periductal mononuclear cells that infiltrate the salivary glands of all SjS patients. Additionally, there are higher levels of IL 18 cytokine detected in patients with primary SjS (43) IL 1beta is one of the important mediators of the bodys response to microbial invasion, inflammation, immunological reactions, and tissue injury (44) This same cytokine is also known to be upregulated in sera and inflamed salivary glands of SjS patients (45) Such findings lead to the importance of analyzing inflammatory components at more refined levels, utilizing in vivo and in vitro methods to support a working hypothesis of an inductive stimulus triggering IFN -gamma to transcriptionally activate the STAT pathway. This

PAGE 20

20 in turn results in the induction of caspase 11, which activates the caspase1 pathway to cleave the pro -forms of IL 1beta and IL 18 into mature f orm to be secreted from the macrophages and dendritic cells Such a mechanism would initiate inflammation and apoptosis of epithelial cells. Whether caspase 11 activated caspase 1 is part of inflammasome is not known to date. Therefore, to investigate our hypothesis, three specific aims are proposed. The first specific aim is to identify molecules involved in elevated caspase 1 activation in the salivary gland macrophages of the SjS -prone mouse prior to disease onset. I hypothesize that inflammatory caspases are important in promoting a pro inflammatory rich microenvironment in the target tissues of Sj S prior to disease onset. This question will compare expression levels of inflammatory molecules between B6DC and wildtype B6 mice sera, saliva and tissue sam ples. For the second specific aim it is necessary to analyze the environment of salivary glands in vitro by investigating an inductive viral signal such as Herpes Simplex Virus Type 1 (which commonly infects salivary glands) to question whether CpG oligo nucleotide (CPG ODN) viral motif can play a role in the activation of a caspase 1 -mediated pathway in macrophages. F ocus is placed on the effects of CpG ODN on inducting inflammation and /or inflammasome components in vitro hypothesizing that p ersistent pres ence of viral DNA l eads to induction of proteins involved in caspase 1 -mediated pathways of macrophages The mouse macrophage RAW 264.7 cell line will be used to analyze cytokine levels of stimulated versus non -stimulated cell conditions. Finally, the thir d specific aim questions whether the TLR9 pathway is essential for CpG mediated ASC expression with subsequent inflammasome activation. I hypothesize that inhibition of the TLR 9 pathway will reduce inflammasome activation in salivary glands, thus preventi ng disease onset.

PAGE 21

21 All together, these specific aims will attempt to further identify the role of environmental factors in conjunction with the onset of disease in patients with Sjogrens syndrome. By shedding light on potential mechanisms that lead to infl ammation of epithelial cells in the salivary glands, such knowledge should expedite the ongoing research needed to alleviate or optimistically prevent autoimmune disease.

PAGE 22

22 CHAPTER 2 MATERIALS AND METHOD S A nimals C57BL/6J (B6), C57BL/6.NOD Aec1Aec2 (B6DC) a nd NOD/ Shi LtJ (NOD) (n=35 total) were bred and maintained under SPF conditions within the Animal Care Services at the University of Florida, Gainesville. The animals were maintained on a 12 -hour light -dark schedule and provided water and food ad libitum. F or this study, female mice were killed at either 8 or 12 weeks of age. Both breeding and use of these animals were approved by the University of Florida IACUC. The mice were killed using American Veterinary Medical Association approved procedures. Expressi on P rofiles of Caspase -11 and R elated M olecules by Semi -Quantitative -PC R Total RNA was prepared from freshly isolated SMX using the RNeasy Mini Kit (Qiagen, Valencia, CA, USA). Semiquantitative PCRs were carried out using 1 microgram (u g) of cDNA as the te mplate. Following an initial denaturation at 94 C for 4 min, each PCR was carried out for 34 cycles consisting of 94 C for 30 seconds, optimal annealing temperature for 30 seconds and 72 C for 1 minute. PCR products were analyzed by electrophoresis usin g 2% agarose gels. PCR band intensities were compared with beta actin using the Flourchem Imaging densitometer system (Alpha Innotech Corporation; San Leandro, CA, USA). The primer sequences can be found in Table 2 1.

PAGE 23

23 Table 2 1 List of Semi -quantitative PCR (RT -PCR) designed for Mus musculus genes. Gene Fragment size & Annealing Temperature Primer Sequence actin -forward 398 bp, 57 5 CCTGACCCTAAGGCCAACCG 3 actin reverse 5 GCTCATAGCTCTTCTCCAGGG 3 STAT1 forward 84 bp, 57 5' TCCCGTACAGATGTCC ATGA 3' STAT1 reverse 5' GCCTGATTAAATCTTTGGGCA 3' Caspase 11 forward 376 bp, 57 5' ATGGCCGTACACGAAAGGCTCTTA 3' Caspase 11 reverse 5' GCCTGCACAATGATGACTTTGGGT 3' NF B 1 forward 350 bp, 56 5' TGAAGCAGCTGACAGAAGACACGA 3' N F B 1 reverse 5' TTCATCT ATGTGCTGCCTCGTGGA 3' NF B2 -forward 336 bp, 61C 5' AGTTGACTGTGGAGCTGAAGTGGA 3' NF B2 reverse 5' TGGCCTCGGAAGTTTCTTTGGGTA 3' IL 1 forward 245 bp, 55C 5' CTCCATGAGCTTTGTACAAGG 3' IL 1 reverse 5' TGCTGATGTACCAGTTGGGG 3' IL 18 forward 434 bp, 55C 5' ACTGTACAACCGCAGTAATACGG 3' IL 18 reverse 5' AGTGAACATTACAGATTTATCCC 3' Analysis of STAT -1 and NF B Transcriptional Activity by Electrophoretic Mobility Shift Assay (EMSA) The SMX and lacrimal glands from SjS -prone B6DC, NOD and disease resistant B6 mice at 8 weeks were analyzed by EMSA. Pooled glands (0.5 ug) from each strain were used to obtain 5 10 micrograms per microliter (ug/ul) concentration of nuclear extract following the instructions in the Nuclear Extraction Kit (Panomics, Inc., Redwood City, CA, USA). Nuclear extracts were incubated with 2.0 ul of 5X binding buffer, 1.0 l of poly d (I C) (1 ug/ul), 1.0 ul of biotin labeled STAT 1 or NF B probe (10 ng/ul) and 5.0 ul of distilled water at 15 20 C for 30 min. For negative controls, an unla beled cold STAT 1 or NF B probe was added. Samples (5 10 ug per lane) were run on a 6.0% polyacrylamide gel at 4 C using 120 V. After electrophoresis, the samples were transferred onto Pall Biodyne B membranes (Pall Corporation, Ann Arbor, MI, USA) by ele ctroblotting (300 mA). The membrane was baked for 1 hour at 85 C in a dry oven for immobilization. Blocking, incubating with streptavidinHRP conjugate, washing, developing with hydrogen peroxide and luminol and membrane exposures on

PAGE 24

24 Hyperfilm ECL for 30 seconds were performed following the manufacturer's instruction for the EMSA kit (Panomics, Inc., Redwood, CA). Caspase Activity Assay The SMX from disease -prone B6DC, NOD and disease -resistant B6 mice were analyzed at 8 weeks. From each strain, 1 1 glands were used to acquire 3 7 ug/ul concentration of gland lysate following manufacturer's instructions from BioVision (Mountain View, CA, USA). Gland lysates (50 ug per well) were placed into a 96-well flat bottom plate and incubated in the dark with 50 ul o f 2X reaction buffer (containing 10 mm dithiothreitol) and 5.0 ul of either 1 mm YVAD -AFC (7 amino 4 trifluoromethyl coumarin) substrate (50 um final concentration) for caspase 1 or DEVD -AFC for caspase 3 followed by incubation at 37 C for 90 minutes. Ne gative controls consisted of the same reactions in the absence of gland lysate. After incubation, the samples were read in a microplate fluorometer equipped with a 400 -nm excitation filter and 505nm emission filter. Experiments were performed in triplicat e. M easurement of A poptotic Cells by TUNEL S taining and Colocalization with C aspases The SMX and lacrimal glands were freshly explanted and fixed in 10% neutral -buffered formalin for additional processing. After deparaffinization, slides were placed for a ntigen retrieval in 0.1 m citrate buffer, pH 6.0 (Biogenex, San Ramon, CA, USA), and microwaved (350 W) for 6 min. Slides were washed twice in phosphate -buffered saline and the tissues were stained following the instructions provided in the in situ Cell De tection Kit, TMR Red (Roche Applied Science, Indianapolis, IN, USA). Slides were analyzed under a fluorescent microscope using an excitation wavelength in the range of 520 560 nm (maximum 580 nm, red) (Carl Zeiss Inc., Thornwood, NY, USA). For colocalizati on with caspase 11, separate sets of TUNEL -stained slides were treated first with blocking buffer (Dako, Fort Collins, CO, USA), stained for 1 hour with rabbit anti -

PAGE 25

25 mouse caspase 11 antibody (Calbiochem, San Diego, CA, USA) diluted 1:50, and then developed for 45 minutes using a FITC -conjugated donkey anti rabbit IgG antibody (Molecular Probes, OR, USA) diluted 1:1000. As this antibody for murine caspase 11 is cross reactive with human caspase 4, slides with human breast cancer were used as positive control s following the manufacturer's guideline. For colocalization with caspase 3, TUNEL -stained slides were stained with rabbit anti-mouse caspase 3 antibody (Abcam, Cambridge, MA, USA) at 1:50 dilution for 1 hour, and then, incubated with FITC -conjugated donke y anti rabbit IgG antibody (Molecular Probes) at 1:1000 dilution for 45 minutes. Stained sections were mounted with 4',6 -diamidino 2 phenylindole mounting medium (Vector, Burlingame, CA, USA) and observed at 20x and 40x magnifications. Slides were analyz ed under a fluorescence microscope (Carl Zeiss) using an excitation wavelength in the range of 520 560 nm (maximum 580 nm, red) for TUNEL -positive cells and 488 nm range for caspase 11 or caspase 3 -positive cells. Identification of Caspase -11 Expressing C ell s Slides of freshly explanted SMX from female B6DC mice at 8 weeks of age were prepared for immunostaining as described above. Antigen retrieval was performed by incubating the slides in Trilogy (Cell Marque, Austin, TX, USA) for 30 minutes at 95 C. On e set of slides was incubated first with rabbit anti -mouse caspase 11 antibody (Calbiochem, San Diego, CA), followed by FITC -conjugated donkey anti rabbit IgG antibody, as described above. This set of slides was then counterstained with PE -conjugated hamst er anti -mouse CD11c antibody (BD Biosciences, San Jose, CA, USA) at 1:100 dilution for 45 minutes. A second set of slides was first incubated with a solution containing both rabbit anti -mouse caspase 11 antibody and rat anti -mouse F4/80 antibody (Serotec, Raleigh, NC, USA) at 1:50 dilution for 1 hour, then a solution containing both FITC conjugated donkey anti rabbit IgG antibody (Molecular Probes) at 1:1000 dilution and AffiniPure Texas Red conjugated rabbit anti rat IgG antibody (Jackson

PAGE 26

26 ImmunoResearch, W est Grove, PA, USA) at 1:100 dilution and incubated for 45 minutes. Stained sections were mounted with 4',6 -diamidino 2 -phenylindole mounting medium (Vector, Burlingame, CA) and observed at 20x and 40x magnifications. M easurement of IL -18 by Enzyme -Linke d Immunosorbent Assay (ELISA) Mouse sera and saliva from B6 and B6DC strains (n=5) at 8 and 12 weeks of age were tested for mouse IL 18 with a sandwich ELISA kit (MBL International, Woburn, MA, USA), following the manufacturer's instructions. RAW 264.7 cel l supernatants were also tested for mouse IL 18, while THP 1 cell supernatants were tested from human IL 18 using the HumanIL 18 sandwich kit from MBL International. Cell Culture of HSG, THP-1 and RAW 264.7 Cell Lines Human salivary gland cells (HSG) and murine RAW264.7 macrophages were maintained in DMEM media with 4.5g/l glucose and L -glutamine without sodium pyruvate (Meditatech, Manassas, VA). Media is supplemented with 10% heat -inactivated fetal bovine serum (FBS) (Mediatech, Manassas, VA), penicillin at 100 U/ml, and streptomycin at 100 ug/ml (Mediatech, Herndon, CA). Human monocytic cells (THP 1) grown in suspension were maintained in RPMI media (500 ml) supplemented with 10% FBS (50 ml), 1 mM sodium pyruvate (5 ml), Hepes buffer (5 ml), sodium pyruv ate (5 ml), 45% glucose (3 ml), beta -mercaptoethanol (2 ul), and penicillin/streptomycin (5 ml) (Mediatech, Manassas, CA). All cells are maintained in a humidified chamber at 37 C with 5% carbon dioxide. All cell culture flasks, cell scrapers and serologi cal pipette supplies were purchased from Fisher Scientific (Fisher, Savannah, GA).

PAGE 27

27 Detection of Apoptotic HSG Cells Cocultured with THP -1 Cell s THP 1 human monocytes obtained from American Type Culture Collection (Manassas, VA, USA) were cultured in RPMI 1 640 medium with supplements. HSG cells were seeded at 5 x 105 cells per well in 6 -well plates containing glass coverslips and cultured in complete media. The next day, HSG culture media were removed from the cells and 5 x 105 THP 1 cells in 1 ml THP 1 grow th media containing 2 ul LPS (Sigma, St Louis, MO, USA) and 10 ul IFN gamma (BD Biosciences) were added. The THP cells were incubated for 48 hours at 37 C before removal. HSG cells on coverslips were fixed in 4% paraformaldehyde for 1 hour and permeabiliz ed with 0.1% Triton X 100 in 0.1% sodium citrate buffer for 2 minutes on ice. To detect apoptotic cells, the In Situ Cell Death Detection Kit, TMR red (Roche Applied Science) was used according to the manufacturer's protocol. Fluorescence images were taken with Zeiss Axiovert 200 M microscope and a Zeiss AxioCam MRm camera using the 10 x 0.75 NA objectives. Color images were assessed using Adobe Photoshop version 7. Cells were counted using Cell -Profiler image analysis software (46) to detect 4',6 diamidino 2 phenylindole staining, and TUNEL -positive cells were counted using a cell counter. siRNA Transfection siRNAs targeting caspase 1 and TLR 9 were transfected into THP 1 cell s using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to manufacturer's instructions. The siRNA used for caspase 1 was purchased from Ambion (Austin, TX, USA), while siRNA used for THP 1 was purchased from Thermo Scientific (Dharmacon, Lafay ette, CO) and dissolved in nuclease -free water, and the resulting 20 u m stock was stored at 80 C before use. The sense and antisense strands for caspase 1 respectively, are as follows: 5' GGUUCGAUUUUCAUUUGAGtt 3' and 5' CUCAAAUGAAAAUCGAACCtt 3'. Th e target sequence for TLR 9 is CAGACUGGGUGUACAACGA.

PAGE 28

28 THP 1 cells transfected with caspase1 siRNA were incubated for 48 h, washed once in growth media, and then cocultured with HSG cells as described above. In separate experiments, THP 1 cells transfected with TLR 9 siRNA were incubated for 48 hours and protein analysis. Cell supernatants were saved for ELISA analysis. These TLR 9 transfected cells were also stimulated for 24 hours with NS, LPS, nCpG, and pCpG, respectively. Stimulated siRNA transfected cel ls were harvested after 24 hours to collect RNA, protein, and cell supernatant for further analysis. Cell Lysate Preparation RAW 264.7 macrophages and THP 1 monocytes were incubated for 24 hours with 1ug/ml LPS, 3 M of nCpG or 3 M pCpG. Three million cells from each condition were then washed with cold PBS and protein lysates were prepared by adding Cell Disruption Buffer using the mirVana Protein and RNA Isolation (PARIS) kit #AM1921 (Ambion, Austin, TX) following the manufacturers instruction. Bradford M ethod using BSA as a standard measured protein concentrations of samples to be analyzed by western blot. Verification of siRNA Knockdown by W estern B lotting For caspase 1 knockdown confirmation, THP 1 cells transfected with siRNA targeting caspase 1 were l ysed 48 hours after transfection, and cell extracts were loaded onto a 10% sodium dodecyl sulfate -PAGE gel and transferred to nitrocellulose. The following antibodies and dilutions were used: rabbit anti -caspase 1 antibodies at 1:50 (Abcam, Cambridge, MA) and rabbit anti -golgin 97 antibodies at 1:200 (47) Secondary goat anti rabbit antibodies conjugated to horseradish peroxidase were used at 1:10 000 dilutions (Southern Biotech, Birmingham, AL, USA). Caspase 1 protein levels were normalized to golgin 97 to determine knockdown efficiency. Densit ometric analysis of the developed films were performed using Image J software.

PAGE 29

29 THP 1 cells transfected with siRNA targeting TLR 9 were collected and processed in the cell lysate preparation mentioned above. Protein lysates were loaded onto a 4 20% Tris HCl gel and transferred to nitrocellulose. Rabbit anti TLR 9 antibody at 1:250 (ProSci, Poway, CA) and alkaline -phosphatase conjugated goat anti rabbit antibody (Sigma, St. Louis, MO) was used at 1:10000 dilutions. To analyze protein expression of siRNA trans fected and stimulated THP 1 cells, nitrocellulose membranes were treated with rabbit anti -ASC antibody at 1:100 dilution (Axxora, San Diego, CA) followed by secondary goat anti -rabbit antibody as mentioned above. Densitometric analyses of the developed fil ms were performed using the Fluorchem Imaging densitometer system. CpG -ODN Treatment of RAW264.7 and THP -1 Cells Cells were plated at one million cells in a well of 6 -well plates and set aside for 24 hours to ensure adherence to plate surface. At 80% confl uency, concentrations of immunostimulatory CPG ODN (pCpG, 3M) and negative CpG -ODN (nCpG, 3M) were added to respective cell culture wells for 24 hours. Sequences for the CPG ODN motifs are as follows: nCpG atAATAGAGCTTCAAGCaag; pCpG atAATCGACGTTCAAGC aag. In separate experimen ts, cells were incubated in 1ug /ml of E. coli LPS (InvivoGen, San Diego, CA) as well as non -stimulated conditions to serve as positive and negative controls. Stimulated RAW264.7 cells were harvested by scraping the well surface w ith a spatula and centrifuging to obtain cell pellets at 1500 rpm for 5 minutes. THP 1 cells incubated under the mentioned conditions were aspirated from wells and also centrifuged at 1500 rpm for 5 minutes to obtain cell pellets for protein and RNA isolat ion. Cell supernatants were saved for future analysis.

PAGE 30

30 Measure of Activation of ASC and Gene Expression of Related Molecules Using Total RNA Isolation and Quantitative PCR and Confirmation of TLR -9 Gene Knockdown Using qPCR Cells were washed with cold pho sphate buffered saline (PBS) and 300l Lysis Binding Buffer from Ambions mirVana kit to each well of a 6 -well plate to isolate total RNA following manufacturers protocol (Ambion, Austin, TX). Fifty nanograms of total RNA was reverse transcribed by Taqman reverse transcriptase (Applied Biosystems, Foster City, CA). Real time PCR analysis was performed using 2 ul cDNA per condition. Samples were run using the Taqman procedure and an ABI StepOne instrument (Applied Biosystems, Foster City, CA). Primers for P YCARD, Caspase 11, Caspase 1, TLR9, and glyceraldehyde 3 -phosphate dehydrogenase (GAPDH) were designed according to GenBank on the ABI website. Expression of mRNA values was calculated using the threshold cycle (Ct) value, or the number of PCR cycles at wh ich the fluorescent signal during the PCR reaches a fixed threshold. For each sample, t, sample was calculated by subtracting the Ct value of 18S, from that of each gene of interest to normalize the data. The expression levels relative to control were es timated by calculating t t, sample t, control ) and subsequently using the 2 method (48) In -Cell Western Analysis of ASC and C aspase -11 P rotein E xpression RAW 264.7 ells were fixed at 15,000 cells per well in a 96-well plate and stimulated with LPS, nCpG, and pCpG to perform a cell -based ELISA. Cells were stained overnight with rabbit derived primary antibodies specific for ASC and Caspase 11 molecules respectively at 1:50 dilutions The secondary antibody conjugated with fluorophore IR 800CW dye was then applied to cells for 1 hour. The Draq5 and Sapphire700 dyes were also used to stain cells in a non specific manner for normalization of values based on cell numbers. Red fluorescent dete ction revealed nonspecifically stain ing of all cells present in each well, while the green fluorophore

PAGE 31

31 staining represented detection of the molecule of interest Cells were imaged using a LI -COR Odyssey scanner (LI COR Biosciences, Lincoln, NE). Detection of ASC Activation Via Immunocytochemi s try RAW264.7 cells were seeded at 15,000 cells per chamber into an 8 -chamber slide (BD Falcon, Bedford, MA) and were given 24 hours to adhere to the slide surface. Cells were incuba ted for 24 hours with 1ug/ml LPS 3 M of nCpG and 3 M pCpG respectively. Staining reagents and protocol were provided by Cellnomics NF B Activation Kit (Cellnomics, Pittsburg, PA) but antibodies were replaced to analyze ASC protein (primary antibody: rabbit anti -ASC from Alexis Biochemica ls, San Diego, CA; secondary antibody: goat anti rabbit IgG conjugated with Alexa fluor 488 from Invitrogen, Carlsbad, CA). Reagents were scaled to correlate the volumes complementary to chamber area. Cells were fixed with warmed formaldehyde fixation sol ution for 10 minutes followed by washing and brief permeabilization. Cells were then incubated with rabbit anti -ASC primary antibody for one hour, rinsed with detergent buffer and wash buffer, and then treated with staining solution containing Alexa Fluor 488 secondary antibody for consecutive hour while covered with foil. After washing, excess well reagents were aspirated the plastic chamber was detached from the slide. Drops of DAPI mounting medium (Vector, Burlingame, CA) and a glass cover slide were pla ced on the 8 section slide and cells were viewed at 10X and 40X magnification using DAPI and FITC filters (Zeiss, Thornwood, NY). Whole cell fluorescent staining was analyzed with Image J software. Statistical Analyses Statistical significances were determ ined using the Student's t -test, Tukey Test, and one way ANOVA. P values less than 0.05 were considered statistically significant.

PAGE 32

32 CHAPTER 3 RESULTS Specific Aim 1 Caspase -11 Gene E xpression is Upregulated in E xocrine G lands of SjSS usceptible M ice To confirm earlier results (7) obtained with microarray analyses showing an increased gene expression of caspase 11 in the SMX of 8 -week old C57BL/6.NOD -Aec1Aec2 (B6DC) mice carrying the two NOD -derived susceptibility lo ci ( SjSs) (Figure 3 1a ), the levels of caspase 11 mRNA in both the SMX of 8 and 12-week old NOD /ShiLtJ (NOD) B6DC and C57BL/6 (B6) mice were determined by semiquantitative reverse transcription PCR. As presented in Figure 3 1b, caspase 11 expression was increased 4.6 -fold (P<0.01) in the SMX of B6DC mice compared with B6 mice at 8 weeks of age, decreasing slightly by 12 weeks of age (bar graphs). Interestingly, caspase 11 gene expression was also increased 1.7 -fold (P<0.05) and 1.8-fold (P<0.05) in the la crimal glands of both B6DC and NOD mice at 8 weeks of age, and remained elevated at 12 weeks of age (data not presented). To determine whether either of the known transcription factor s STAT 1 and /or NF k B for caspase 11 is concurrently upregulated with cas pase 11, their gene expressions were also measured (Figure 3 1b). Stat1 gene expression proved to be upregu lated in the SMX of both NOD and B6DC mice (2.3 -fold, P<0.01) at 8 weeks of age. Similarly, expression of Nfkb 1 (p50) was upregulated in the SMX of B6DC mice. In contrast, Nfkb 2 (p52) was slightly downregulated in the SMX of both B6DC and NOD mice at 8 weeks of age. By 12 weeks of age, Nfkb1 was downre gulated in the SMX, whereas Nfkb 2 remained at low levels. Caspase -11 Expression i s Detected in Macroph age and Dendritic Cells Caspase 11 protein expression was confirmed by immunohistochemistry on SMX of 8 week -old B6DC mice (Figure 3 1c). A slide of human breast cancer tissue was used as a positive

PAGE 33

33 control for anti -caspase 11 antibody activity (inset). To localize caspase 11 protein expression in the salivary glands, fluorescein isothiocyanate (FITC ) or phycoerytherin (PE -) (or Texas Red ) labeled antibodies were used for caspase 11 and other cell -type markers. Double -staining caspase 11 expressing cells with a dendritic cell (CD11c) or a macrophage (F4/80) cell marker revealed that caspase 11 was expressed by both cell s tainings showing positively stained cells in yellow when the images were merged (Figure 3 1d). Caspase 11 positive cells surrounded acin ar and/or ductal cell units as indicated by white arrows in Figure 3 1d. STAT -1 b ut n ot NF B is C oncomitantly U pregulated with C aspase -11 in the Salivary G lands of SjS -S usceptible M ice Elevated Stat 1 and NF -kB1 gene expression in the SMX of 8 -week -old B6D C mice raised the question, which transcription factor induces caspase 11 gene expression, leading us to perform electrophoretic gel mobility shift assays (EMSAs). Nuclear extracts were prepared from pooled SMX freshly explanted from 8 -week old female B6DC mice, incubated with biotin labeled oligonucleotides specific for the DNA binding site of either Stat 1 or Nfkb and separated by PAGE. As shown in Figure 3 2a and b, Nfkb showed no statistically significant increase in activity, whereas an upregulated Sta t 1 activity ( >20%) was found in the SMX of 8 -week old NOD/LtJ and C57BL/6.NOD -Aec1Aec2 mice, when compared with age and sex -matched C57BL/6 mice. Furthermore, a doubling of the amount of nuclear extract for the NF k B assay only slightly increased visuali zation. In the presence of unlabeled (or cold) oligonucleotide probe, binding was decreased indicating binding specificity. Unexpectedly, the binding activities of STAT 1 and NF k B in nuclear extracts prepared from B6DC lacrimal glands were consistently be low detection levels by EMSA, supporting the dichotomy observed in the underlying pathology and timing of SjS like disease progression within the SMX v ersus lacrimal glands of NOD and B6DC mice.

PAGE 34

34 Caspase -11 Activates Caspase -1, b ut n ot C aspase -3 To better d efine the consequences of elev ated caspase 11 in the SMX of the SjS mouse model during the preclinical phase of disease when apoptosis o f acinar tissue is prevalent, I analyzed the activity of caspase 1 and caspase 3. As shown in Figure 3 3a, caspase1, bu t not caspase 3, activity was upregulated in the SMX of 8 -week -old B6DC mice compared with C57BL/6 mice, although the baseline activities for caspase 3 were higher overall. To confirm activat ion of the caspase 1 pathway, I examined whether IL 1 and/or IL 1 8, two factors whose secretion is strongly regulated by the activation of caspase 1 (13) were also upregulated. Reverse transcription -PCR analyses indicated highly elevated IL 1 and IL 18 mRNA transcripts in the SMX of 8 -week -old B6DC mice (Figure 3 3b). Interestingly, a ctivation of caspase 1 in the local target tissue (that is, the salivary glands) of SjS corresponded with upregulated IL 18 cytokine expression in the saliva but not in sera before disease onset (Figure 3 3c). An increase in IL 18 production in saliva as w ell as sera was apparent at 12 weeks, which is the time when lymphocytes start infiltrating into the SMX. Apoptosis is M ore P revalent in the SMX of SjS-P rone M ice Before D isease Onset in Comparison with Di sease F ree M ice To identify whether activation of c aspase 11 with subsequent activation of the caspase 1 pathway is associated with apoptotic events in the exocrine glands of SjS like disease -susceptible mice, apoptotic cell death in the SMX of 8-week -old NOD and B6DC mice was examined. Histological sectio ns of salivary glands were prepared and transferase -mediated dUTP biotin nick end labeling (TUNEL) stained (Figures 3 4a and b). Visualization using a fluorescent microscope fitted with a red filter fo r Cy3 revealed that both NOD and B6DC mice showed more abundant apoptotic cell death than C57BL/6 control mice (Figure 3 4b). Nuclease -treated slides (PC in Figure 3 4a) served as a positive control.

PAGE 35

35 Ca s pase -11 is not Detected in TUNEL-Positive Acinar or Ductal Cells Experiments were carried out to investigate whether caspase 11 plays a direct role in increased apoptotic acinar cell death in the salivary glands before disease onset. Freshly prepared sections of SMX from 8 -week old C57BL/6.NOD -Aec1Aec2 mice, first treated to identify TUNEL -positive cells, were counterstained with FITC conjugated anti -mouse caspase 11 antibody. As presented in Figure 3 4c, caspase 11 (white arrow) was present in the cells located outside or between the acinar or ductal areas, whereas TUNEL positive cells (red arrows) were acinar o r ductal cells. Although these dying cells were colocalized with caspase 3 (Figure 3 4c a, yellow arrow) showing posit ivity inside the cytoplasm, findings indicate that not all TUNEL positive cells were positive for caspase 3. Caspa s e -1 in Conjunction with IFN is Essential to Increased Apoptotic Cell Death of Human Salivary Gland Epithelial Cells Lack of colocalization between caspase 11 and TUNEL -positive cells led us to hypothesize that caspase 11 functions in a non-cell autonomous manner, rather than directly killing the cells, by activating caspase 1 and a subsequent proinflammatory cytokine release into the microenvir onment, resulting in increased apoptotic cell death of salivary epithelial cells. This hypothesis was tested using a human salivary gl and (HSG) cell line (49) cocultured with a THP 1 human monocyte cell line, which was stimulated with LPS for the induction of IL 1 beta and IL 18 in the presence and absence of IFN -gamma in an attempt to duplicate observations in the in vivo envir onment. Earlier data from the SjS mouse model lacking IFN -gamma (5) showed the absence of disease and predisease phenot ype, clearly indicating that IFN -gamma is critical not only for the onset of the disease, but also for the predisease stage. In a ddition, in the NOD mouse, IFN -gamma was upregulated by two-fold in the SMX before disease onset (5). C urrent data indicate s that increased apoptosis of HSG cells occurred only in the presence of LPS -

PAGE 36

36 stimulated THP 1 cells when IFN -gamma was present (Figures 3 5a and b, P<0.01). The increased rate of apoptotic cell death was reversed to a n ormal level when caspase 1 expression in THP 1 cells was downregulated by siRNA (Figure 3 5). The normalized caspase 1 knockdown efficiency was greater than 70%, as shown in Figure 3 5c (P<0.01). This work was published in 2009 in the journal of Immunology and Cell Biology volume 87, pages 81 90. Specific Aim 2 ASC and Caspase -11 are Upregulated in Murine RAW 264.7 Macrophage s in the Presence of CpG -ODN Earlier data from the SjS mouse model revealed increased gene levels of ASC and Caspase 11, indicating t hat inflammatory molecules may be required for the disease onset of Sjogrens syndrome. In continuing investigation of inflammatory cytokines in macrophages, I moved onto in vitro cell lines to analyze inflammasome component ASC. As a reminder, ASC is an a dapter protein necessary for the complex of proteins coined as the inflammasome to form (18) Activation of ASC would thus lead to the recruitment of NALP3 and caspase 1 to trigger caspase 1 activation. Concomitant upre gulation of ASC in salivary glands of B6DC at both 8 and 20 weeks of age (data not shown here) prompted investigation of whether the presence of chronic stimulation such as herpes simplex virus (HSV) derived oligodeoxyribonucleotide CpG -DNA (CPG -ODN) can i nduce inflammasome components such as ASC, leading to subsequent inflammasome activation, resulting in increased IL 1beta and IL 18 cytokine production. The mouse macrophage cell line RAW 264.7 was stimulated for 24 hours in the presence of CpG ODN (pCpG, 3 uM) and negative CpG (nCpG, 3 uM) compared to non-stimulated cells and LPS -stimulated cells (1 ug/ml) as a positive control for inflammasome activation. To

PAGE 37

37 measure protein expression after CpG ODN stimulation, In -cell western (ICW) assay was applied. IC W is an immunocytochemical assay that uses an infrared imaging system to detect and quantify proteins in fixed cells. Antibodies to mouse ASC and caspases -11 were incubated at dilutions of 1:50 overnight followed by goat anti rabbit secondary antibody conj ugated with IR Dye 900CW (Li cor Biosciences, Lincoln, Nebraska). Analysis indicated upregulation of ASC and caspase 11 in mouse macrophages in response to pCpG and LPS stimulation when compared to the non -stimulated cells (Figure 3 6a and b). Further confirmation of the increased protein expression seen by In -cell western analysis was found by immunocytochemistry of RAW264.7 cells. Staining experiments were carried out to determine whether ASC expression of non-stimulated cells was significantly different than CpG ODN -stimulated cells. Roughly 15,000 cells were placed in an 8 -well chamber slide and stimulated over the course of 24 hours with NS, LPS, nCpG, and pCpG conditions. Cells were then fixed and stained with rabbit anti -ASC antibody followed by Alexa Fluor 488anti -mouse antibody. As presented in Figure 3 7a, ASC protein was highly expressed in LPS and pCpG treated cells when compared to non -stimulated cells. Image J analysis of whole cell fluorescent ASC staining revealed that pCpG had significantly different ( P <0.01) integrated densities of fluorescent protein when compared to that under non -stimulated condition (Figure 3 7b). Specific Aim 3 TLR -9 siRNA Knockdown Reduces ASC Expression in THP -1 Cells To better define the role of TLR 9 in increased ASC expression due to CpG -DNA stimulation, the following study analyzed the downstream effects of siRNA knockdown of the TLR 9 pathway. siRNA supplied by Applied Biosystems and Dharmacon were used to transfect THP 1 cells to knock down TLR 9 and GPADH gene expression, respectively. Cells were harvested for qPCR and as shown in Figure 3 8a, after 48 hours of transfection, normalized

PAGE 38

38 TLR 9 knockdown efficiency was 70.9% and 66.3% in GAPDH, which confirmed transfection of siRNA using Lipofectamine. ASC Expression is Down -Regulated in the Absence of TLR -9 Following confirmation of TLR 9 gene knockdown, TLR 9 transfected THP 1 cells were stimulated over the course of 24 hours under non-simulated or, LPS, nCpG, and pCpG stimulated conditions. Cells were then harve sted for qPCR analysis of ASC gene expression. Results revealed downregulated ASC expression in the absence of TLR 9, in comparison to the three -fold increased rate of expression in non -transfected stimulated cells. ASC gene expression seen in LPS, nCpG, and pCpG conditions were therefore returned to normal levels comparable to the non-stimulated cells (Figure 3 8b).

PAGE 39

39 CHAPTER 4 DISCUSSION Recent identification of caspase 11 as one of the differentially expressed genes at 8 weeks of age in SjS -prone C57BL/ 6.NOD -Aec1Aec2 (B6DC) mice, together with an abnormal glandular homeostasi s in pre -diseased NOD mice, led to the hypothesis that importance of intrinsic properties of target tissues (such as availability of antigen(s) and changed activity of antigen presen ting cells by pro inflammatory cytokines) contribute to the breakdown of peripheral tolerance and the activation of autoreactive immune cells (2, 4, 6, 7, 50) E fforts at understanding initial molecular events trigg eri ng onset of SjS identified five important findings pertaining to a caspase 11-mediated pathway in the salivary glands. First, caspase 11 expressed primarily in macrophages/dendritic cells is up regulated in the SMX before disease onset and is apparently associated with the enhanced transcriptional activity of STAT 1. Second, these events apparently initiate secretion of pro inflammatory cytokine s from the local tissue through caspase 1 activation, as indicated by elevated IL18 levels in saliva, an event capable of inducing increased epithelial cell death rather than cell autonomous killing of epithelial cells. Third, caspase 1 in macrophages/dendritic cells and IFN gamma in the salivary gland microenvironment play a critical role in the death of resident ial epithelial cells, shown in both in vivo and in vitro analyses. Fourth, a viral CPG DNA stimulus can induce gene and protein expression in macrophages or monocytes. Fifth, knockdown of the TLR 9 reduced ASC expression even in the presence of a viral CpG DNA stimulus, confirming that ASC induction by CpG DNA is mediated through TLR 9. This scheme is illustrated in Figure 3 9. Recently, it has been postulated that a potential signal for induction of STAT 1 transcriptional activity may come from latent/recurrent viral infection in the salivary glands, especially reactivation of endogenous virus in case of mice housed under specific pathogen-free

PAGE 40

40 (SPF) conditions, thus promoting interferon induction as an anti viral defense mechanism by epithelial cells or n atural killer cells in the glands. Increased IFN -gamma, known to be present in exocrine glands of NOD derived mice (5), can enhance the activity of macrophages and/or dendritic cells in the tissues, resulting in the production of caspase 11. This is supported by the fact that caspase 11 is known to be induced only when signals from IFN -gamma or LPS through the activation of STAT 1 or NF kappa B transcription factors are synthesized. A study on experimental autoimmune encephalomyelitis (EAE) indicates that caspase 11 is highly expressed in both oligodendrocytes and infiltrating cells and colocalized with activated caspase 3, suggesting that a pathway involving caspase 11 and caspase 3 is important in the execution of o ligodendrocyte death in EAE lesions (12) However, the role of caspase 11 found in the SMX o f SjS -prone B6DC mice differed from that in EAE models in that caspase 11 in the B6DC model was neither produced by dying cells nor co localized with caspase 3. In the SjS model, caspase 11 is apparently correlated with caspase 1 activity. Furthermore, abu ndant TUNEL -positive cells in the SMX of B6DC mice, together with decreased caspase 3 activity and the fact that not all TUNEL -positive cells were positive for caspase 3, suggest that acinar cell apoptosis induced by pro -inflammatory cytokines in the micro environment may involve a caspase 3 independent pathways, as well During early disease pathogenesis of SjS, the roles of IFN -gamma seem to be indispensable based on an earlier study (5) as well as current stud ies (51) IFN -gamma is required but not sufficient for the induction of increased cell death in the target tissue of SjS. I n addition, the earlier studies (5) indicate that in the absence of IFN -gamma, mice exhibited neither secretory dysfunction nor alterations in pre -disease markers, strongly conclusive of our current findings. The requirement for caspase 1 and IFN gamma in enhanced cell death, proven by in

PAGE 41

41 vitro co -culture studies with siRNA targeting caspase 1 in THP 1 cells, may originate from the fact that the IFN -gamma is essential for caspase1 activation, which cleaves pro -IL 1beta and IL 18 to produce mature forms of IL 1beta and IL 18 for its release (52) Therefore, synergistic effects between cytoki nes induced and cleaved by the activation of caspase -11 and caspase 1, and IFN -gamma/STAT 1 are essential for driving chronic inflammatory conditions in the targeted glands even before disease onset Increased expression of IL 1beta can cause the activatio n of the signal cascade leading to the activation of several transcription factors involved in inflammatory responses (53) IL 18, originally described as an IFN gamma inducing factor, is a potent inflammatory stimulant produced by macrophages and dendritic cells and is known to enhance antigen -specific clonal expansion of IFN -gamma producing T cells (54) suggesting that IL 18 may impact T -cell immunity in both nonlymphoid and lymphoid tissues by bridging the innate and adaptive arms of the immune system through IFN -gamma during th e early stage of SjS. A study also indicates that IL 18 produced by Kupffer cells stimulates TH1 and natural killer cell cytotoxic activity by increasing their production of FasL (CD 95), which ultimately induces apoptosis in Fas -bearing hepatocytes, causi ng liver injury (55) In a similar manner, IL 18 produced by phagocytic cells may upregulate FasL on natural killer cells and Fas on epithelial cells in the SMX through caspase 1 activation, resulting in subsequent apoptotic processes in the epithelial cells. Interestingly, IL 18 and IL 1beta have been reported to be up regulated in both sera and the SMX of SjS patients (56, 57) Considering the results of our current study, one might speculate that IL 1beta and IL 18 are up-regulated in the target tissue of SjS patients as well, starting at the early disease stage.

PAGE 42

42 Recent studies indicate that a set of caspases (that is, human caspase 1, caspase 4 and caspase 5, along with murine caspase 11 and caspase 12), considered to be 'inflammatory caspases', are involved in the proteolytic maturation of inflammatory cytokines (58, 59) Recent studies have identified a complex of proteins, referre d to as the 'inflammasome', functions in innate immunity by regulating inflammatory caspase 1 activation (16, 60, 61) Proteins that make up the inflammasomes are members of the NACHT LRR and PYD -containing prote ins (NALP) family of proteins, although information on its exact expression or binding partners is relatively scarce (62) The inflammasomes are hypothesized to act as an early sensor detecting danger signals because the stimulation of the inflammasome triggers a series of internal reactions that ultimately activates caspase 1, which subsequently produces mature IL -1beta and IL 18 for regulating immune cells. Important qu estions that are currently being investigated include whether caspase 1 1 activates caspase 1 a s a part of the inflammasome whether increased epithelial cell death in the target tissues confers target tissue specificity in autoimmune SjS and whether abnormal regulation of the inflammasome translates to SjS in humans. Our curr ent results seem to point to the potential existence of abnormal regulation of the inflammasome in the SMX of NOD -derived SjS like disease -susceptible mice (Figure 3 9 ). As it was mentioned in the results above, a caspase 1 -mediated pathway in macrophages residing in the salivary glands, plus an increased IL 18 secretion in saliva are seen in SjS -prone B6DC mice prior to disease onset. In addition, the expression of ASC, a key adaptor for inflammasome activation was also up regulated in the salivary glands of disease prone mice at 8 weeks. Since the salivary glands are one of the common reservoirs of chronic viral infection such as HSV, I investigated whether DNA derived from HSV is capable of inducing ASC expression, which may play a critical role in inflam masome activation in the salivary glands (data not

PAGE 43

43 presented). As might have been expected, viral CpG DNA derived from HSV 1 was able to up regulate ASC expression by 2.5 -fold (Figure 3 6b) similar to the increase by LPS stimulation (positive control for i nflammasome activation). A study conducted by Pelegrin et al (63) indicates that RAW 264.7 macrophages lack ASC and are therefore incapable of caspases 1 mediated processing and release of mature IL 1beta, suggesting that LPS primed cells are due to activation of a differential pathway (such as P2X7 Receptor -mediated activation). However, the current data clearly indicate that ASC is present and up regulated in RAW 264.7 cells following LPS stimulation, which differs from Pelegrins observations and ASC expression was upregulated in response to LPS and pCpG stimulation, which was detected by RT PCR and ICW analysis. Normalization of fluorescent readings to the non -stimulated cell condition revealed a 2.5 -fold increas e in both LPS and pCpG conditions. Experiments to further confirm ASC expression in RAW 264.7 utilized immunocytochemistry analysis, which revealed that LPS stimulation caused an approximate two -fold increase of ASC protein expression when compared to the non -stimulated condition. Furthermore, abundant ASC expression was also found in cells stimulated with pCpG, also suggesting that CpG DNA causes an increase in ASC protein expression, and that inflammasome activity can by observed via this mouse macrophage cell line. My data therefore, indicate that viral CpG DNAs can be an inductive signal for ASC, which is important for caspase 1 activation pathway (inflammasome) in macrophages. This finding supports the concept that chronic inflammation in SjS salivary glands prior to disease onset may be caused by chronic viral stimulation in the target tissue. ASC induction by CpG DNA was further confirmed by TLR 9 siRNA knockdown experiments where THP 1 cells were transfected with siRNA targeting TLR 9 and analyzed for ASC expression in the presence or absence of immunostimulatory viral CpG DNA. As shown,

PAGE 44

44 TLR 9 expression was significantly reduced by 70.9% and GAPDH expression was also down regulated by 66.3% with GAPDH siRNA. As expected, ASC expression in the TLR 9 tr ansfected cells stimulated with CpG DNA were significantly reduced. Interestingly, transfected THP 1 cells stimulated with nCpG also showed up regulated ASC expression, which is not consistent with our previous data. Although KPS contamination in this well is suspected, it certainly requires further confirmation. Nevertheless, current findings strongly suggest that ASC induction by CpG DNA is mediated through TLR 9. TLR 9 stimulation by CpG induces a signaling pathway involved in the activation of transcrip tion factor NF kB localized in the cellular endosomal compartments (and downstream of adapter MyD88) to induce pro -IL 1beta and IL 18 expression (64, 65) Therefore it is hypothesized that CpG -DNA stimulation may ev entually lead to ASC induction via the activation of NF kB, leading to cleavage of proIL 1beta and proIL 18 and subsequent release of mature cytokines. It will be interesting to identify exact molecular pathways involved in this process. In summary, this study shows that caspase 11 plays a critical role in the susceptibility of mice to SjS like disease by up regulating a caspase 1 -mediated pathway, which is vital for apoptotic cell death of the neighboring epithelial cells. In addition, the presence of IF N -gamma in the environment is essential for caspase 1 induced cell death of salivary epithelial cells. The repeated occurrence of pro -inflammatory cytokine secretion and apoptotic cell death following reactivation of latent or persistent viral infection ma y lead to chronic inflammatory conditions in salivary glands in SjS. STAT 1 activation rather than NF k B activation in the SMX of disease prone mice seems to be responsible for caspase 11 induction. ASC induction through TLR 9 in the presence of CpG DNA re vealed that CpG DNA can also induce activation of caspase 1

PAGE 45

45 inflammasome activation via ASC induction. Knockdown of the TLR 9 gene further confirmed that ASC induction by CpG DNA is through TLR 9 in THP 1 cells. This scheme is illustrated in Figure 3 9. Fu rther confirmation is required for analysis involving TLR 9 gene knockdown, as protein expression and cytokine production of IL 1beta and IL 18 have yet to be measured to confirm whether the final outcome of the caspases 1 activation pathway is inhibited w hen ASC expression by CpG -DNA stimulation is reduced by siRNA. Overall, our observations underscore the potentially critical roles of myeloid cell populations and of intracellular pattern recog nition through the inflammasome activation of caspase 1 in the early pathogenesis of SjS. Crossing knockouts onto the SjS -prone mouse strain will confirm critical roles of inflammatory caspases and their therapeutic values in delaying disease onset and progression of SjS. In addition, based on results found by in vitr o analysis, future studies would involve in vivo analysis of inflammasome related knockdown in SjS prone B6DC mice, in which siRNA targeting ASC or other molecules of interest could be adenovirus associated delivered using gene therapy techniques.

PAGE 46

46 Figure 3 1. Increased caspase 11 expression in the SMX of the SjS prone C57BL/6.NOD Aec1Aec2 mouse be fore lymphocytic infiltration. A ) Two NOD derived genetic intervals, namely autoimmune exocrine loci 1 and 2 on chromosomes 3 and 1, respectively, in the disease -prone C57BL/6.NOD -Aec1Aec2 mouse are depicted. B) Elevated caspase11, its major transcription factors STAT 1 and N F k B1 in the salivary glands of C57BL/6.NOD Aec1Aec2 were confirm ed by semiquantitative RT PCR. C) Caspase 11 in the SMX was stained with FITC labeled anti -mouse caspase 11 antibody in the C57BL/6.NOD Aec1Aec2 at 8 weeks. Arrows indicate positive staining for caspase 11. Magnification, times 20. D ) Double staining of caspase 11 with antiCd11c antibody (dendritic cells) and anti F4/80 a ntibody (macrophages) revealed that cells positive for caspase 11 were also positive for both cell types. Arrows indicate double -stained cells, which are shown in yellow. Magnifications, times 10 and times 40. Aec, autoimmune exocrine loci; RT PCR, reverse transcription -polymerase chain reaction; SjS, Sjgren's syndrome; SMX, submandibular glands; STAT, signal transducers and activators of transcription.

PAGE 47

47 Figure 3 2. Concomitant increase in STAT 1 activity in the SMX of C57BL/6.NO D -Aec1Aec2 at 8 weeks. A) Increased STAT 1 activity was detected by EMSA in the glands isolated at 8 weeks. Inhibition of binding is shown with a cold probe (unlabelled probe) incubation. The right panel indicates bar graphs generated by densitometer analy ses on EMSA results for NF kappaB. B) Absence of STAT 1 and NF -kB activity in the lacrimal gland (LAC) at 8 weeks was detected whereas elevated STAT 1 was shown in the SMX of C57BL/6.NOD -Aec1Aec2 and NOD/ShiLtJ mouse. Increased amount of nuclear extract (t en micrograms) isolated from 0.5 g of pooled glands (n=5 7 mice) was used per lane to enhance binding activity for NF kB. The right panel indicates bar graphs generated by densitometer analyses on EMSA results for STAT 1. The experiments were carried out t hree times per molecule of interest. *P<0.05 in comparison with C57BL/6. EMSA, electrophoretic gel mobility shift assay; NF kappaB, nuclear factor kappaB; SMX, submandibular glands; STAT, signal transducers and activators of transcription.

PAGE 48

48 Figure 3 3 Activation of caspase 1 mediated pathway in C57BL/6.NOD -Aec1Aec2 be fore disease onset. A ) Caspase 1 activity was upregulated significantly in the SMX of C57BL/6.NOD Aec1Aec2 at 8 weeks. Experiments were performed in triplicate. **P<0.0 1 in comparison with C57BL/6. B ) Genes downstream of caspase 1 such as IL 1beta and IL 18 in the C57BL/6.NOD Aec1Aec2 mouse at 8 weeks were analyzed by RT -PCR. The C57BL/6.NOD Aec1Aec2 mice were positive for these genes whereas the SMX from other mouse strains showed either ne gative or weak expression (n=5 7 female mice). beta actin was used as a control for normalization. C) IL 18 protein expression was elevated in the saliva from C57BL/6.NOD Aec1Aec2 at 8 weeks by ELISA. Pooled saliva and sera were used for ELISA (n=5 female mice). *P<0.05 and **P<0.01 in comparison with the age -matched C57BL/6 mouse. IL, interleukin; RT-PCR, reverse transcription -polymerase chain reaction; SMX, submandibular glands; ELISA, enzyme linked immunosorbent assay.

PAGE 49

49 Figure 3 4 Increased epithelial cell death in the glands of disease -prone mice at 8 weeks and lack of direct colocalization of caspase 11 with TUNEL -positive cells. A) TUNEL staining was performed on the prediseased salivary glands; upper panel at times 10 and lower panel at times 40 ma gnifications. B) Percentages of TUNEL -positive cells are shown as a bar graph. For each mouse, three slides were evaluated for TUNEL positive cells, which were counted using a cell counter. C) Caspase 3 positive cells (yellow arrows in b) were colocalized with TUNEL -positive cells (red arrows). White arrows indicate caspase 11-positive cell. Magnification, times 40. NC, negative control; PC, positive control treated with nuclease; TUNEL, transferase -mediated dUTP biotin nick end labeling.

PAGE 50

50 Figure 3 5 Inhibition of apoptotic cell death of HSG cells by caspase 1 knockdown in THP 1 cells. A ) HSG cells were cultured in the absence or presence of LPS and/or IFN gamma -stimulated THP 1 cells. After removing culture media or stimulated THP 1 cells from the cultu re, apoptotic HSG cells were analyzed by TUNEL assays. For the caspase 1 inhibition study, siRNA to caspase 1 was transfected into THP 1 cells before stimulation with LPS and IFN -gamma and cocultured with HSG cells. B ) Percent TUNEL -positive cells were pre sented as a bar graph. The experiment was repeated three times fo r reproducibility (**P<0.01). C ) Knockdown efficiency of caspase 1 was compared with a housekeeping protein golgin97 by western blotting and depicted as a bar graph. The experiment was repeated twice and caspase 1 protein level was normalized to golgin97. HSG, human salivary gland; IFN, interferon; LPS, lipopolysaccharide; TUNEL, transferase -mediated dUTP biotin nick end labeling.

PAGE 51

51 Figure 3 6 Increased ASC and caspase 11 expression in RA W 264.7 macrophages in response to different conditions. A) Image of In -cell Western (ICW) fluorescent imaging of rabbit anti -ASC cell staining. Red fluorophore dye stained all cells within each well non -specifically. Green fluorophore dye stained molecule (s) of interest. B) Elevated ASC and caspase 11 in mouse macrophage cells by ICW depicted as a bar graph.

PAGE 52

52 Figure 3 7 Activation of ASC in RAW 264.7 cells by stimulation with pCpG A) Microscope images of RAW 264.7 cells stained with housekeeping gene beta actin (top row) and ASC (bottom row). After stimulating cells for 24 hours under non-stimulated (NS), LPS, nCpG, and pCpG conditions, cells were fixed and stained with rabbit anti -beta actin and rabbit anti -ASC antibodies respectively. Cells were th en treated with goat anti rabbit IgG conjugated with AlexaFluor488 antibody. Images were taken at 20X magnification. B) Normalized density values of ASC protein expression in cells was measure using Image J analysis software and is depicted as a bar graph. (*P<0.05, **P<0.01)

PAGE 53

53 Figure 3 8 Inhibition of TLR 9 (CpG DNA recognition) pathway via TLR -9 -siRNA knockdown in THP 1 cells A) THP 1 cells were cultured in the absence (mock) and presence of siRNA specific to TLR 9 or GAPDH, respectively. Knockdown efficiency of TLR 9 was compared to a housekeeping gene GAPDH by qPCR and is depicted as bar graphs. B) ASC gene expression of stimulated mock and TLR 9 siRNA transfected cells represented as a bar graph. Gene expression levels were normalized to the non -s timulated (NS) mock condition (**P <0.01, P <0.05).

PAGE 54

54 Figure 3 9 Schematic representation of the current working hypothesis. Inductive viral profile results in alterations in the target tissue through the activation of IFN -STAT and a subsequent inductio n of caspase 11. Upregulated caspase 1 activity produces mature IL 1beta and IL 18 from macrophages and dendritic cells, which may play a role in the activation of caspase 3 or induction of caspase 3 independent apoptotic factors in neighboring acinar and/ or ductal cells. Elevated pro -inflammatory cytokines in the SMX enhances IFN gamma production by epithelial cells, resulting in further activation of macrophages. Areas where further investigation is needed for confirmation are depicted with dotted lines ( that is, questions as to whether caspase 11 is a constituent of the NALP inflammasome or why IFN -gamma and consequently STAT 1 are upregulated in the SMX before disease onset). The assembled proteins (the inflammasome) in response to signal recognition by LRR of the NALP leads to the activation of caspase 1, depicted in the bracket. Our current findings are depicted in bold arrows. ASC, apoptosis associated speck like protein containing a caspaseactivating recruitment domain; DC, dendritic cells; IFN, inte rferon; IL, interleukin; LRR, leucine rich repeats; NALP, NACHT LRR and PYD containing proteins; SMX, submandibular glands; STAT 1, signal transducers and activators of transcription.

PAGE 55

55 LIST OF REFERENCES 1 Mircheff, A. K., J. P. Gierow, T. Yang, J. Zhang R. L. Wood, A. M. Azzarolo, D. W. Warren, H. Zeng, Z. Guo, H. R. Kaslow, S. F. Hamm -Alvarez, C. T. Okamoto, and M. Bachmann. 1998. Sjogren's autoimmunity: how perturbation of recognition in endomembrane traffic may provoke pathological recognition at the cell surface. J Mol Recognit 11:4048. 2 Cha, S., H. Nagashima, V. B. Brown, A. B. Peck, and M. G. Humphreys -Beher. 2002. Two NOD Idd associated intervals contribute synergistically to the development of autoimmune exocrinopathy (Sjogren's syndrome) on a he althy murine background. Arthritis Rheum 46:13901398. 3 Cha, S., A. B. Peck, and M. G. Humphreys Beher. 2002. Progress in understanding autoimmune exocrinopathy using the nonobese diabetic mouse: an update. Crit Rev Oral Biol Med 13:516. 4 Robinson, C. P., H. Yamamoto, A. B. Peck, and M. G. Humphreys -Beher. 1996. Genetically programmed development of salivary gland abnormalities in the NOD (nonobese diabetic) -scid mouse in the absence of detectable lymphocytic infiltration: a potential trigger for sialoadeni tis of NOD mice. Clin Immunol Immunopathol 79:5059. 5 Cha, S., J. Brayer, J. Gao, V. Brown, S. Killedar, U. Yasunari, and A. B. Peck. 2004. A dual role for interferon -gamma in the pathogenesis of Sjogren's syndrome -like autoimmune exocrinopathy in the nonob ese diabetic mouse. Scand J Immunol 60:552565. 6 Cha, S., S. C. van Blockland, M. A. Versnel, F. Homo Delarche, H. Nagashima, J. Brayer, A. B. Peck, and M. G. Humphreys -Beher. 2001. Abnormal organogenesis in salivary gland development may initiate adult ons et of autoimmune exocrinopathy. Exp Clin Immunogenet 18:143160. 7 Killedar, S. J., S. E. Eckenrode, R. A. McIndoe, J. X. She, C. Q. Nguyen, A. B. Peck, and S. Cha. 2006. Early pathogenic events associated with Sjogren's syndrome (SjS) -like disease of the NOD mouse using microarray analysis. Lab Invest 86:12431260. 8 Masumoto, J., T. A. Dowds, P. Schaner, F. F. Chen, Y. Ogura, M. Li, L. Zhu, T. Katsuyama, J. Sagara, S. Taniguchi, D. L. Gumucio, G. Nunez, and N. Inohara. 2003. ASC is an activating adaptor for N F kappa B and caspase 8 -dependent apoptosis. Biochem Biophys Res Commun 303:6973. 9 Kumar, S. 2007. Caspase function in programmed cell death. Cell Death Differ 14:3243. 10. Ghayur, T., S. Banerjee, M. Hugunin, D. Butler, L. Herzog, A. Carter, L. Quintal, L. S ekut, R. Talanian, M. Paskind, W. Wong, R. Kamen, D. Tracey, and H. Allen. 1997. Caspase 1 processes IFN -gamma -inducing factor and regulates LPS induced IFN gamma production. Nature 386:619623.

PAGE 56

56 11. Pasinelli, P., D. R. Borchelt, M. K. Houseweart, D. W. Clevel and, and R. H. Brown, Jr. 1998. Caspase 1 is activated in neural cells and tissue with amyotrophic lateral sclerosis associated mutations in copper -zinc superoxide dismutase. Proc Natl Acad Sci U S A 95:1576315768. 12. Hisahara, S., H. Okano, and M. Miura. 20 03. Caspase -mediated oligodendrocyte cell death in the pathogenesis of autoimmune demyelination. Neurosci Res 46:387397. 13. Wang, S., M. Miura, Y. K. Jung, H. Zhu, E. Li, and J. Yuan. 1998. Murine caspase 11, an ICE interacting protease, is essential for the activation of ICE. Cell 92:501-509. 14. Schauvliege, R., J. Vanrobaeys, P. Schotte, and R. Beyaert. 2002. Caspase 11 gene expression in response to lipopolysaccharide and interferon -gamma requires nuclear factor kappa B and signal transducer and activator of transcription (STAT) 1. J Biol Chem 277:4162441630. 15. Lin, X. Y., M. S. Choi, and A. G. Porter. 2000. Expression analysis of the human caspase 1 subfamily reveals specific regulation of the CASP5 gene by lipopolysaccharide and interferon -gamma. J Biol Chem 275:3992039926. 16. Martinon, F., K. Burns, and J. Tschopp. 2002. The inflammasome: a molecular platform triggering activation of inflammatory caspases and processing of proIL beta. Mol Cell 10:417426. 17. Muruve, D. A., V. Petrilli, A. K. Zaiss, L. R. White, S. A. Clark, P. J. Ross, R. J. Parks, and J. Tschopp. 2008. The inflammasome recognizes cytosolic microbial and host DNA and triggers an innate immune response. Nature 452:103107. 18. Fernandes -Alnemri, T., and E. S. Alnemri. 2008. Assembly, purification, and a ssay of the activity of the ASC pyroptosome. Methods Enzymol 442:251270. 19. Yu, J. W., T. Fernandes -Alnemri, P. Datta, J. Wu, C. Juliana, L. Solorzano, M. McCormick, Z. Zhang, and E. S. Alnemri. 2007. Pyrin activates the ASC pyroptosome in response to engage ment by autoinflammatory PSTPIP1 mutants. Mol Cell 28:214227. 20. Sarkar, A., M. Duncan, J. Hart, E. Hertlein, D. C. Guttridge, and M. D. Wewers. 2006. ASC directs NF kappaB activation by regulating receptor interacting protein 2 (RIP2) caspase 1 interactions J Immunol 176:49794986. 21. Kawai, T., and S. Akira. 2006. TLR signaling. Cell Death Differ 13:816825. 22. Sergerie, Y., S. Rivest, and G. Boivin. 2007. Tumor necrosis factor alpha and interleukin 1 beta play a critical role in the resistance against lethal he rpes simplex virus encephalitis. J Infect Dis 196:853860. 23. Bird, A. P. 1993. Functions for DNA methylation in vertebrates. Cold Spring Harb Symp Quant Biol 58:281285.

PAGE 57

57 24. Hergersberg, M. 1991. Biological aspects of cytosine methylation in eukaryotic cells. Ex perientia 47:11711185. 25. Gao, J. J., V. Diesl, T. Wittmann, D. C. Morrison, J. L. Ryan, S. N. Vogel, and M. T. Follettie. 2002. Regulation of gene expression in mouse macrophages stimulated with bacterial CpG DNA and lipopolysaccharide. J Leukoc Biol 72:1234 1245. 26. Du, X., A. Poltorak, Y. Wei, and B. Beutler. 2000. Three novel mammalian toll -like receptors: gene structure, expression, and evolution. Eur Cytokine Netw 11:362371. 27. Krieg, A. M. 1999. CpG DNA: a novel immunomodulator. Trends Microbiol 7:6465. 28. Kr ieg, A. M., G. Hartmann, and A. K. Yi. 2000. Mechanism of action of CpG DNA. Curr Top Microbiol Immunol 247:121. 29. Krieg, A. M., A. K. Yi, S. Matson, T. J. Waldschmidt, G. A. Bishop, R. Teasdale, G. A. Koretzky, and D. M. Klinman. 1995. CpG motifs in bacter ial DNA trigger direct B -cell activation. Nature 374:546549. 30. Lundberg, P., P. Welander, X. Han, and E. Cantin. 2003. Herpes simplex virus type 1 DNA is immunostimulatory in vitro and in vivo. J Virol 77:1115811169. 31. Krieg, A. M. 2000. The role of CpG moti fs in innate immunity. Curr Opin Immunol 12:3543. 32. Segal, B. M., J. T. Chang, and E. M. Shevach. 2000. CpG oligonucleotides are potent adjuvants for the activation of autoreactive encephalitogenic T cells in vivo. J Immunol 164:56835688. 33. Latz, E., A. Scho enemeyer, A. Visintin, K. A. Fitzgerald, B. G. Monks, C. F. Knetter, E. Lien, N. J. Nilsen, T. Espevik, and D. T. Golenbock. 2004. TLR9 signals after translocating from the ER to CpG DNA in the lysosome. Nat Immunol 5:190198. 34. Hemmi, H., O. Takeuchi, T. Ka wai, T. Kaisho, S. Sato, H. Sanjo, M. Matsumoto, K. Hoshino, H. Wagner, K. Takeda, and S. Akira. 2000. A Toll -like receptor recognizes bacterial DNA. Nature 408:740745. 35. Hacker, H., H. Mischak, T. Miethke, S. Liptay, R. Schmid, T. Sparwasser, K. Heeg, G. B Lipford, and H. Wagner. 1998. CpG DNA-specific activation of antigen -presenting cells requires stress kinase activity and is preceded by non -specific endocytosis and endosomal maturation. EMBO J 17:62306240. 36. Stacey, K. J., M. J. Sweet, and D. A. Hume. 1 996. Macrophages ingest and are activated by bacterial DNA. J Immunol 157:21162122. 37. Yi, A. K., and A. M. Krieg. 1998. Rapid induction of mitogenactivated protein kinases by immune stimulatory CpG DNA. J Immunol 161:44934497.

PAGE 58

58 38. Gaipl, U. S., A. Sheriff, S. Franz, L. E. Munoz, R. E. Voll, J. R. Kalden, and M. Herrmann. 2006. Inefficient clearance of dying cells and autoreactivity. Curr Top Microbiol Immunol 305:161176. 39. Barrat, F. J., T. Meeker, J. Gregorio, J. H. Chan, S. Uematsu, S. Akira, B. Chang, O. Dur amad, and R. L. Coffman. 2005. Nucleic acids of mammalian origin can act as endogenous ligands for Toll like receptors and may promote systemic lupus erythematosus. J Exp Med 202:11311139. 40. Krieg, A. M. 2000. Signal transduction induced by immunostimulator y CpG DNA. Springer Semin Immunopathol 22:97105. 41. Aderem, A., and D. A. Hume. 2000. How do you see CG? Cell 103:993996. 42. Hacker, H., R. M. Vabulas, O. Takeuchi, K. Hoshino, S. Akira, and H. Wagner. 2000. Immune cell activation by bacterial CpG DNA through myeloid differentiation marker 88 and tumor necrosis factor receptor associated factor (TRAF)6. J Exp Med 192:595600. 43. Manoussakis, M. N., S. Boiu, P. Korkolopoulou, E. K. Kapsogeorgou, N. Kavantzas, P. Ziakas, E. Patsouris, and H. M. Moutsopoulos. 2007. R ates of infiltration by macrophages and dendritic cells and expression of interleukin18 and interleukin 12 in the chronic inflammatory lesions of Sjogren's syndrome: correlation with certain features of immune hyperactivity and factors associated with high risk of lymphoma development. Arthritis Rheum 56:39773988. 44. Chinnaiyan, A. M., M. Huber -Lang, C. Kumar -Sinha, T. R. Barrette, S. Shankar -Sinha, V. J. Sarma, V. A. Padgaonkar, and P. A. Ward. 2001. Molecular signatures of sepsis: multiorgan gene expression profiles of systemic inflammation. Am J Pathol 159:11991209. 45. Kobayashi, M., S. Kawano, S. Hatachi, C. Kurimoto, T. Okazaki, Y. Iwai, T. Honjo, Y. Tanaka, N. Minato, T. Komori, S. Maeda, and S. Kumagai. 2005. Enhanced expression of programmed death 1 (PD 1)/PD -L1 in salivary glands of patients with Sjogren's syndrome. J Rheumatol 32:21562163. 46. Carpenter, A. E., T. R. Jones, M. R. Lamprecht, C. Clarke, I. H. Kang, O. Friman, D. A. Guertin, J. H. Chang, R. A. Lindquist, J. Moffat, P. Golland, and D. M. Saba tini. 2006. CellProfiler: image analysis software for identifying and quantifying cell phenotypes. Genome Biol 7:R100. 47. Griffith, K. J., E. K. Chan, C. C. Lung, J. C. Hamel, X. Guo, K. Miyachi, and M. J. Fritzler. 1997. Molecular cloning of a novel 97 kd Golgi complex autoantigen associated with Sjogren's syndrome. Arthritis Rheum 40:16931702. 48. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real time quantitative PCR and the 2( Delta Delta C(T)) Method. Methods 25:402408.

PAGE 59

59 49. Sato, M., H. Yoshida, T. Yanagawa, Y. Yura, and M. Urata. 1982. Sensitivity of a neoplastic epithelial duct cell line from a human submandibular salivary gland to human leukocyte interferon as assessed by an in vitro semi -solid agar technique. Int J Oral Surg 11:183189. 50. Robinson, C. P., S. Yamachika, C. E. Alford, C. Cooper, E. L. Pichardo, N. Shah, A. B. Peck, and M. G. Humphreys -Beher. 1997. Elevated levels of cysteine protease activity in saliva and salivary glands of the nonobese diabetic (NOD) mouse model for Sjogren syndrome. Proc Natl Acad Sci U S A 94:57675771. 51. Bulosan, M., K. M. Pauley, K. Yo, E. K. Chan, J. Katz, A. B. Peck, and S. Cha. 2009. Inflammatory caspases are critical for enhanced cell death in the target tissue of Sjogren's syndrome before disease onset. Immunol Cell Biol 87:8190. 52. Fantuzzi, G., and C. A. Dinarello. 1999. Interleukin18 and interleukin1 beta: two cytokine substrates for ICE (caspase 1). J Clin Immunol 19:111. 53. Dinarello, C. A. 2000. Interleukin18, a proinflamma tory cytokine. Eur Cytokine Netw 11:483486. 54. Maxwell, J. R., R. Yadav, R. J. Rossi, C. E. Ruby, A. D. Weinberg, H. L. Aguila, and A. T. Vella. 2006. IL 18 bridges innate and adaptive immunity through IFN -gamma and the CD134 pathway. J Immunol 177:234245. 55. Tsutsui, H., K. Matsui, H. Okamura, and K. Nakanishi. 2000. Pathophysiological roles of interleukin 18 in inflammatory liver diseases. Immunol Rev 174:192209. 56. Bombardieri, M., F. Barone, V. Pittoni, C. Alessandri, P. Conigliaro, M. C. Blades, R. Priori, I. B. McInnes, G. Valesini, and C. Pitzalis. 2004. Increased circulating levels and salivary gland expression of interleukin 18 in patients with Sjogren's syndrome: relationship with autoantibody production and lymphoid organization of the periductal inflam matory infiltrate. Arthritis Res Ther 6:R447456. 57. Szodoray, P., P. Alex, J. G. Brun, M. Centola, and R. Jonsson. 2004. Circulating cytokines in primary Sjogren's syndrome determined by a multiplex cytokine array system. Scand J Immunol 59:592599. 58. Kuida, K ., J. A. Lippke, G. Ku, M. W. Harding, D. J. Livingston, M. S. Su, and R. A. Flavell. 1995. Altered cytokine export and apoptosis in mice deficient in interleukin1 beta converting enzyme. Science 267:20002003. 59. Li, P., H. Allen, S. Banerjee, S. Franklin, L. Herzog, C. Johnston, J. McDowell, M. Paskind, L. Rodman, J. Salfeld, and et al. 1995. Mice deficient in IL 1 beta -converting enzyme are defective in production of mature IL 1 beta and resistant to endotoxic shock. Cell 80:401411.

PAGE 60

60 60. Agostini, L., F. Marti non, K. Burns, M. F. McDermott, P. N. Hawkins, and J. Tschopp. 2004. NALP3 forms an IL 1beta -processing inflammasome with increased activity in Muckle Wells autoinflammatory disorder. Immunity 20:319325. 61. Martinon, F., and J. Tschopp. 2007. Inflammatory ca spases and inflammasomes: master switches of inflammation. Cell Death Differ 14:1022. 62. Drenth, J. P., and J. W. van der Meer. 2006. The inflammasome -a linebacker of innate defense. N Engl J Med 355:730732. 63. Pelegrin, P., C. Barroso Gutierrez, and A. Surpr enant. 2008. P2X7 receptor differentially couples to distinct release pathways for IL 1beta in mouse macrophage. J Immunol 180:71477157. 64. Miyazato, A., K. Nakamura, N. Yamamoto, H. M. Mora Montes, M. Tanaka, Y. Abe, D. Tanno, K. Inden, X. Gang, K. Ishii, K Takeda, S. Akira, S. Saijo, Y. Iwakura, Y. Adachi, N. Ohno, K. Mitsutake, N. A. Gow, M. Kaku, and K. Kawakami. 2009. Toll like receptor 9 dependent activation of myeloid dendritic cells by deoxynucleic acids from Candida albicans. Infect Immun 65. Mariathas an, S. 2007. ASC, Ipaf and Cryopyrin/Nalp3: bona fide intracellular adapters of the caspase 1 inflammasome. Microbes Infect 9:664671.

PAGE 61

61 BIOGRAPHICAL SKETCH Marievic Bulosan was born in Brooklyn, New York in July of 1983 and moved to Florida at the age of seven with aspirations to pursue a medical degree with specialization in dermatology and to start outreach clinics in third world countries. That dream went as far as her pre -med declaration during her freshman year at the University of Florida. Volunteer ing in the Department of Pathology in 2004 shifted her concentration to laboratory research, and she graduated in December 2006 with a Bachelor of Science in Microbiology and Cell Science. She became lab manager for Dr. Seunghee Cha in the Department of Oral and Maxillofacial Surgery and D iagnostic Sciences in June 2006 and was urged to pursue a Master s education. Marievic enrolled as a UF student once again in A ugust of 2007 in the Master s of Medical Science program through the College of Medicine. She was accepted into the joint degree pr ogram in July 2008 to complete an additional Master s degree in Educational Administration and Policy with hope to finish in May 2010. While she maintained lab proficiency among volunteers and staff, completed school coursework, and conducted experiments, Marievic co authored nine abstracts, eight posters, and four manuscripts in which she was primary author for one publication that is currently found in the Journal of Immunology and Cell Biology. Marievic also had the privilege of presenting her work for the International Association of Dental Research in Toronto, Canada in July 2008. Marievic aspires to become an administrator or director of instruction for community colleges or universities, focusing on improving student outcomes in professional schools. Her goal is to improve teacher accountability and efficacy and encourage professors to teach effectively not only in regards to science but in all course subjects. Later in life, she would like to teach science courses to high school students, to restart the cycle of inspiring students just as she

PAGE 62

62 had been inspired in the past to pursue careers in teaching. She also hopes one day to get married, start a family, and raise her children to have an eager passion for learning and teaching.