<%BANNER%>

Investigation into the Mechanisms of Hydrogen Sulfide Signaling in the Cardiovascular System and the Effects of Age and ...

Permanent Link: http://ufdc.ufl.edu/UFE0024790/00001

Material Information

Title: Investigation into the Mechanisms of Hydrogen Sulfide Signaling in the Cardiovascular System and the Effects of Age and Caloric Restriction
Physical Description: 1 online resource (104 p.)
Language: english
Creator: Predmore, Benjamin
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: aging, aorta, caloric, cbs, cse, endothelial, enos, hydrogen, liver, nitric, oxide, restriction, sulfide
Zoology -- Dissertations, Academic -- UF
Genre: Zoology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: The gasotransmitter hydrogen sulfide (H2S) modulates vascular tone in vertebrates. Hydrogen sulfide and hypoxia elicit similar contractile responses in vertebrate smooth muscle, while both H2S and nitric oxide (NO) elicit synergistic vasodilatory responses. Aging has negative impacts on the cardiovascular system, which can be attenuated by caloric restriction (CR). The mechanisms behind H2S and hypoxia signaling and the synergy with NO are unknown, as well as whether aging and CR affect hydrogen sulfide signaling. I investigated the mechanisms through which aorta rings respond to hydrogen sulfide and hypoxia, how hydrogen sulfide regulates endothelial NO production, and how aging and CR affect the H2S signaling system. I used bovine arterial endothelial cells and Fisher 344 x Brown Norway rats, 6-38 months of age, maintained on an ad libitum (AL) or CR diet. To investigate aging and CR, I measured protein and mRNA expression of the hydrogen sulfide producing enzymes cystathioneine gamma lyase (CSE) and cystathionine beta synthase (CBS) and the rate of hydrogen sulfide production from aorta and liver tissues, in addition to functional assessment using aorta rings. In the first study, I found that hypoxia and hydrogen sulfide elicit a triphasic, contraction-relaxation-contraction response. However, the mechanisms are not the same between hypoxia and hydrogen sulfide. In the second study, I found that hydrogen sulfide stimulated a two-fold increase in NO production from endothelial nitric oxide synthase (eNOS). Phosphorylation of eNOS at Ser 1177 was also significantly increased, and inhibition of Akt attenuated this. In the third study, I found that the first phase contraction increased in sensitivity to hydrogen sulfide with age, while CR increased the magnitude of all phases. AL aorta CSE and CBS protein expression increased with age, but remained unchanged with CR. Liver CSE and CBS protein expression remained constant with age. Aorta CSE and CBS mRNA expression was higher with CR. Hydrogen sulfide production was also higher with CR in aorta and liver. I conclude that in rat aorta the triphasic responses to hypoxia and H2S are mediated by different mechanisms, hydrogen sulfide up-regulates eNOS/NO production through an Akt-dependent mechanism, and the increased sensitivity to hydrogen sulfide and increased protein expression of CSE and CBS with age in aorta point to a drop in hydrogen sulfide bioavailability, while CR maintains CSE/CBS function. These studies reveal novel, age-sensitive mechanisms of hydrogen sulfide action to regulate vascular tone. They also illustrate the benefit of CR on the hydrogen sulfide signaling system. This is quite timely, given the emerging roles of hydrogen sulfide in cardiovascular pathologies.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Benjamin Predmore.
Thesis: Thesis (Ph.D.)--University of Florida, 2009.
Local: Adviser: Julian, David.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0024790:00001

Permanent Link: http://ufdc.ufl.edu/UFE0024790/00001

Material Information

Title: Investigation into the Mechanisms of Hydrogen Sulfide Signaling in the Cardiovascular System and the Effects of Age and Caloric Restriction
Physical Description: 1 online resource (104 p.)
Language: english
Creator: Predmore, Benjamin
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: aging, aorta, caloric, cbs, cse, endothelial, enos, hydrogen, liver, nitric, oxide, restriction, sulfide
Zoology -- Dissertations, Academic -- UF
Genre: Zoology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: The gasotransmitter hydrogen sulfide (H2S) modulates vascular tone in vertebrates. Hydrogen sulfide and hypoxia elicit similar contractile responses in vertebrate smooth muscle, while both H2S and nitric oxide (NO) elicit synergistic vasodilatory responses. Aging has negative impacts on the cardiovascular system, which can be attenuated by caloric restriction (CR). The mechanisms behind H2S and hypoxia signaling and the synergy with NO are unknown, as well as whether aging and CR affect hydrogen sulfide signaling. I investigated the mechanisms through which aorta rings respond to hydrogen sulfide and hypoxia, how hydrogen sulfide regulates endothelial NO production, and how aging and CR affect the H2S signaling system. I used bovine arterial endothelial cells and Fisher 344 x Brown Norway rats, 6-38 months of age, maintained on an ad libitum (AL) or CR diet. To investigate aging and CR, I measured protein and mRNA expression of the hydrogen sulfide producing enzymes cystathioneine gamma lyase (CSE) and cystathionine beta synthase (CBS) and the rate of hydrogen sulfide production from aorta and liver tissues, in addition to functional assessment using aorta rings. In the first study, I found that hypoxia and hydrogen sulfide elicit a triphasic, contraction-relaxation-contraction response. However, the mechanisms are not the same between hypoxia and hydrogen sulfide. In the second study, I found that hydrogen sulfide stimulated a two-fold increase in NO production from endothelial nitric oxide synthase (eNOS). Phosphorylation of eNOS at Ser 1177 was also significantly increased, and inhibition of Akt attenuated this. In the third study, I found that the first phase contraction increased in sensitivity to hydrogen sulfide with age, while CR increased the magnitude of all phases. AL aorta CSE and CBS protein expression increased with age, but remained unchanged with CR. Liver CSE and CBS protein expression remained constant with age. Aorta CSE and CBS mRNA expression was higher with CR. Hydrogen sulfide production was also higher with CR in aorta and liver. I conclude that in rat aorta the triphasic responses to hypoxia and H2S are mediated by different mechanisms, hydrogen sulfide up-regulates eNOS/NO production through an Akt-dependent mechanism, and the increased sensitivity to hydrogen sulfide and increased protein expression of CSE and CBS with age in aorta point to a drop in hydrogen sulfide bioavailability, while CR maintains CSE/CBS function. These studies reveal novel, age-sensitive mechanisms of hydrogen sulfide action to regulate vascular tone. They also illustrate the benefit of CR on the hydrogen sulfide signaling system. This is quite timely, given the emerging roles of hydrogen sulfide in cardiovascular pathologies.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Benjamin Predmore.
Thesis: Thesis (Ph.D.)--University of Florida, 2009.
Local: Adviser: Julian, David.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0024790:00001


This item has the following downloads:


Full Text





INVESTIGATION INTO THE MECHANISMS OF HYDROGEN SULFIDE SIGNALING IN
THE CARDIOVASCULAR SYSTEM AND THE EFFECTS OF AGE AND CALORIC
RESTRICTION



















By

BENJAMIN LEE PREDMORE


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2009



































O 2009 Benjamin Lee Predmore




































To my Grandparents, Roy and Dorothy Predmore and my Parents, Roy and Donna Predmore









ACKNOWLEDGMENT S

I would like to thank my committee for their valuable input throughout my work on this

dissertation: David Julian, Dave Evans, Lou Guillette, Christiaan Leeuwenburgh, and Charles

Wood. I thank my parents for their support of my academic pursuits. I would also like to thank

the members of the various labs I have worked in who have helped me to complete my work.

From the Julian lab, I thank Joanna Joyner-Matos, Jennessa Andrzej ewski, Maikel Alendy, and

Khadij a Ahmed. From the Leeuwenburgh lab, I thank Stephanie Wohlgemuth, Brian Bouverat,

Emanuele Marzetti, and Jinze Xu, and Hazel Lees. I thank Arturo Cardounel and from his lab Pat

Kearns, Kanchana Karuppiah, Scott Forbes, and Arthur Pope. I would also like to thank Christy

Carter, Drake Morgan, and Tom Foster for their donation of aorta tissue used in some of the

experiments. This work was supported in part by a Multidisciplinary Training Program in

Hypertension (NIH T32 HLO83810) through the UF Hypertension Center.












TABLE OF CONTENTS


Page

ACKNOWLEDGMENT S .............. ...............4.....


LI ST OF FIGURE S .............. ...............8.....


AB S TRAC T ................. ............... 10.............


CHAPTER


1 HYDROGEN SULFIDE: PAST, PRESENT AND FUTURE ................. ........_._ .........12

Introducti on ................. ... .... ............ .... ......... ..........1

Hydrogen Sulfide is an Environmental and Industrial Toxin .................. .......................12
Hydrogen Sulfide is an Energy Source for Chemosynthetic Communities ...........................14
Hydrogen Sulfide is a Gasotransmitter and Physiological Modulator ................. ...............15
Enzymatic Production of Hydrogen Sulfide ................. ...............16......__. ...
Regulation of Hydrogen Sulfide Production ................. ....__. ......... ...........1
Physiological Actions of Hydrogen Sulfide .............. ...............17....
Interactions between the Gasotransmitters .............. .... ...............21..

Hydrogen Sulfide Chemistry and Technical Considerations............... .............2

2 NITRIC OXIDE, ADENOSINE TRIPHOSPHAE (ATP)-SENSITIVE POTASSIUM
CHANNELS, AND ARACHIDONIC ACID METABOLITES MODULATE THE
TRIPHASIC RESPONSE TO HYPOXIA AND HYDROGEN SULFIDE IN RAT
AORTA. ............ ........... ...............26....


Ab stract ................. ...............26.................
Introducti on ................. ...............26.................
M materials and M ethods .............. ...............28....
Re sults ................ ...............3.. 1..............
Discussion ................. ............ ...............33.......
Initial Contraction Phase .............. ...............34....
Relaxation Phase .............. ...............35....
Second Contraction Phase .............. ...............36....
Conclusion ................. ...............37.................


3 HYDROGEN SULFIDE INCREASES NITRIC OXIDE PRODUCTION FROM
ENDOTHELIAL CELLS BY A PROTEIN KINASE B (AKT)-DEPENDENT
M ECHANISM ................. ...............44....... ......


Ab stract ................. ...............44......_._. .....
Introducti on .................. ...............44......... .....
M materials and M ethods .............. ...............45....
Chem icals .......................... .. .. ....................4
Bovine Arterial Endothelial Cell Culture ................ ...............45......__. ...












Hydrogen Sulfide Exposure .............. ...............46....
Akt Blockade ................ ... ............. ..... .... ... ..... ..........4
Electron Paramagnetic Resonance Detection of Nitric Oxide .................... ...............4
Western Blotting............... ...............47
Stati sti cs ................. ...............48........... ....
Re sults ................ ...............48.................
Discussion ................. ...............49.................


4 THE HYDROGEN SULFIDE SIGNALING SYSTEM: CHANGES DURING AGING
AND THE BENEFITS OF CALORIC RESTRICTION............... ..............5


Ab stract ................. ...............55.................
Introducti on ................. ...............56.................
Materials and Methods .............. ...............58....
Chem ical s .............. ...............58....
Animal s............... ...............58
Western Blotting............... ...............58
RNA Extraction ................. ...............59.......... .....
Real-Time PCR ................ ...............59...

Hydrogen Sulfide Production ................ ...............60........... ....
M yography .............. ...............62....
Stati sti cs ................. ...............63........... ....
R e sults................ ... ......... .. .... ........ ..... ...... .... .. ........6

Cystathionine Gamma-Lyase and Cystathionine Beta-Synthase Protein Expression.....63
Cystathionine Gamma-Lyase and Cystathionine Beta-Synthase Messenger
Ribonucleic Acid (mRNA) Expression .............. ...............64....
Hydrogen Sulfide Production .................. ... ......... ...............64......
Contractile Response to Hydrogen Sulfide in Aorta ................ ......... ................65
D discussion .................. .......... .. ................ .. .... ... .. .... ........6

Cystathionine Gamma-Lyase and Cystathionine Beta-Synthase Protein Expression.....66
Cystathionine Gamma-Lyase and Cystathionine Beta-Synthase mRNA Expression.....68
Hydrogen Sulfide Production............... ... .... ....... ...............69....
Contractile Response to Hydrogen Sulfide in Aorta ................ ....___ ................70
Conclusions .............. ...............71....


5 SYNTHESIS: UNDERSTANDING HYDROGEN SULFIDE SIGNALING IN
VASCULAR SMOOTH MUSCLE AND THE TRIPHASIC RESPONSE. ........................81


Introducti on .................. ... ... .... ....... .... ...............8 1....
What is Modulating Phase 1 of the Triphasic Response? ................ .......... ...............82
What is Modulating Phase 2 of the Triphasic Response? ................ .......... ...............83
What is Modulating Phase 3 of the Triphasic Response? ................ .......... ...............85
A Proposed Time-course and Mechanism of the Triphasic Response ................. ................85
Conclusions and Future Directions ................. ...............86................


LIST OF REFERENCES ................ .............89............ ....












BIOGRAPHICAL SKETCH ................. ...............104......... ......











LIST OF FIGURES


figure Page

1-1 Enzymatic production of hydrogen sulfide by cystathionine beta-synthase and
cystathionine gamma-lyase ................. ...............25.................

2-1 Representative tracings of the effect of hypoxia or hydrogen sulfide .............. .... ........._..38

2-2 Duration of the triphasic response to hypoxia or hydrogen sulfide ................. ................39

2-3 Magnitude of the first phase of the triphasic response to hypoxia or hydrogen sulfide
with inhibitors of nitric oxide, adenosine triphosphate (ATP)-sensitive potasium
channels, and arachadonic acid metabolites .............. ...............40....

2-4 Magnitude of the second phase of the triphasic response to hypoxia or hydrogen
sulfide with inhibitors of nitric oxide, ATP-sensitive potasium channels, and
arachadonic acid metabolites ................ ...............41........... ....

2-5 Magnitude of the third phase of the triphasic response to hypoxia or hydrogen sulfide
with inhibitors of nitric oxide, ATP-sensitive potasium channels, and arachadonic
acid m etabolites .............. ...............42....

2-6 Magnitude of the triphasic response to hypoxia or hydrogen sulfide with or without
an intact endothelium ................. ...............43........... ....

3-1 The effect of hydrogen sulfide on nitric oxide production by bovine arterial
endothelial cell s .............. ...............51....

3-2 The effect of hydrogen sulfide on endothelial nitric oxide phosphorylation....................52

3-3 The effect of Akt inhibition on hydrogen sulfide-stimulated nitric oxide production.......54

4-1 Effect of age and diet on cystathionine gamma-lyase and cystathionine beta-synthase
protein expression ................ ...............73.................

4-2 Effect of diet on cystathionine gamma-lyase and cystathionine beta-synthase mRNA
expression .............. ...............74....

4-3 Effect of diet on hydrogen sulfide production. ............. ...............75.....

4-4 Representative tension tracing of a rat aorta ring to hydrogen sulfide .............. ................76

4-5 Effect of age on potassium chloride- and norepinephrine-induced contractions and
the first phase contraction to hydrogen sulfide ................. ...............77........... ..

4-6 Effect of diet on potassium chloride-and norepinephrine-induced contractions. ........._....78











4-7 Effect of diet on hydrogen sulfide-induced contractions ................. ........................79









Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

INVESTIGATION INTO THE MECHANISMS OF HYDROGEN SULFIDE SIGNALING IN
THE CARDIOVASCULAR SYSTEM AND THE EFFECTS OF AGE AND CALORIC
RESTRICTION

By

Benj amin Lee Predmore

August 2009

Chair: David Julian
Major: Zoology

The gasotransmitter hydrogen sulfide (H2S) modulates vascular tone in vertebrates.

Hydrogen sulfide and hypoxia elicit similar contractile responses in vertebrate smooth muscle,

while both H2S and nitric oxide (NO) elicit synergistic vasodilatory responses. Aging has

negative impacts on the cardiovascular system, which can be attenuated by caloric restriction

(CR). The mechanisms behind H2S and hypoxia signaling and the synergy with NO are

unknown, as well as whether aging and CR affect hydrogen sulfide signaling. I investigated the

mechanisms through which aorta rings respond to hydrogen sulfide and hypoxia, how hydrogen

sulfide regulates endothelial NO production, and how aging and CR affect the H2S signaling

system. I used bovine arterial endothelial cells and Fisher 344 x Brown Norway rats, 6-3 8

months of age, maintained on an ad libitum (AL) or CR diet. To investigate aging and CR, I

measured protein and mRNA expression of the hydrogen sulfide producing enzymes

cystathioneine y-lyase (CSE) and cystathionine P-synthase (CBS) and the rate of hydrogen

sulfide production from aorta and liver tissues, in addition to functional assessment using aorta

rings. In the first study, I found that hypoxia and hydrogen sulfide elicit a triphasic, contraction-

relaxation-contraction response. However, the mechanisms are not the same between hypoxia









and hydrogen sulfide. In the second study, I found that hydrogen sulfide stimulated a two-fold

increase in NO production from endothelial nitric oxide synthase (eNOS). Phosphorylation of

eNOS at Ser 1 177 was also significantly increased, and inhibition of Akt attenuated this. In the

third study, I found that the first phase contraction increased in sensitivity to hydrogen sulfide

with age, while CR increased the magnitude of all phases. AL aorta CSE and CBS protein

expression increased with age, but remained unchanged with CR. Liver CSE and CBS protein

expression remained constant with age. Aorta CSE and CBS mRNA expression was higher with

CR. Hydrogen sulfide production was also higher with CR in aorta and liver. I conclude that in

rat aorta the triphasic responses to hypoxia and H2S are mediated by different mechanisms,

hydrogen sulfide up-regulates eNOS/NO production through an Akt-dependent mechanism, and

the increased sensitivity to hydrogen sulfide and increased protein expression of CSE and CBS

with age in aorta point to a drop in hydrogen sulfide bioavailability, while CR maintains

CSE/CBS function. These studies reveal novel, age-sensitive mechanisms of hydrogen sulfide

action to regulate vascular tone. They also illustrate the benefit of CR on the hydrogen sulfide

signaling system. This is quite timely, given the emerging roles of hydrogen sulfide in

cardiovascular pathologies.









CHAPTER 1
HYDROGEN SULFIDE: PAST, PRESENT AND FUTURE

Introduction

Hydrogen sulfide, a name often used to refer to sum of the chemical species H2S, HS- and

S2-, has had a long and interesting development in the scientific literature. The "face" of

hydrogen sulfide has changed within the last 40 years from an environmental and industrial

toxin, to an energy source for chemosynthetic communities, and most recently as a gaseous

physiological modulator, or gasotransmitter (Wang 2002), and a potential therapeutic agent in

medicine. To familiarize the reader with the many aspects of hydrogen sulfide, this chapter will

briefly examine the chemistry and toxicology of hydrogen sulfide as well as the chemosynthetic

communities that it fuels, and then focus on its recent induction into the gasotransmitter family

and its transition into biomedical research and therapeutic applications.

Hydrogen Sulfide is an Environmental and Industrial Toxin

There are many toxic and potentially lethal actions of hydrogen sulfide, the most

significant of which is the reversible inhibition of the electron transport chain via cytochrome c

oxidase (Nicholls 1975; Nicholls et al. 1982; Khan et al. 1990). This reversible inhibition can

occur at 1-40 CLM sulfide in isolated mitochondria (Nicholls et al. 1982; Bagarinao 1992), and is

mechanistically very similar to cyanide poisoning (Nicholls et al. 1982; Shepherd et al. 2008).

Other mechanisms of sulfide toxicity include opening of the mitochondrial permeability

transition pore (Eghbal et al. 2004; Julian et al. 2005a); increasing production of reactive oxygen

species (including superoxide) (Chen et al. 1972; Tapley et al. 1999; Eghbal et al. 2004; Julian et

al. 2005a); out-competing oxygen for hemoglobin binding, causing formation of sulfhemoglobin

(Bagarinao et al. 1992; Kraus et al. 1996; Voilkel et al. 2000); and inhibition of about 20 other

enzymes (Bagarinao 1992).









Various degrees of exposure to hydrogen sulfide can occur, and consequently the

observed or experienced side effects vary. The effects of exposure to hydrogen sulfide can range

from smelling a strong foul odor (> 3-5 ppm, described as the smell of rotten eggs), to olfactory

nerve paralysis (> 150 ppm), to a headache (> 500 ppm), to dizziness and eventually loss of

consciousness and death (500-1000 ppm or greater) (Beauchamp et al. 1984).

Hydrogen sulfide is produced in large quantities in some environments, and because of

this many animals are intermittently or chronically exposed to hydrogen sulfide. Environmental

hydrogen sulfide is a product of anaerobic, sulfate-reducing, bacterial metabolism (Bagarinao

1992; Attene-Ramos et al. 2007). Environments characterized by hydrogen sulfide include the

anoxic layer of marine sediments (i.e. beaches, coastal lagoons, mangrove swamps, and salt

marshes), stagnant basins and anoxic fj ords, and the digestive tract of animals (Bagarinao 1992;

Attene-Ramos et al. 2007). Hydrothermal vents and hydrocarbon seeps are also characterized by

hydrogen sulfide, but the source of hydrogen sulfide at these sites is a mixture of geological and

biological processes. These environments will be further characterized below.

Anthropogenic activities can also be large sources of hydrogen sulfide. Over 70

industries involve or produce concentrations of hydrogen sulfide that are often in toxic to lethal

doses (> 50 ppm) (Beauchamp et al. 1984). These range from paper mills, tanneries, large-scale

aquaculture, rayon production, petroleum and natural gas operations, sewage plants, and many

other industries that involve livestock (i.e. dairy and pig farms), where hydrogen sulfide is

produced from organic waste (Bagarinao 1992; Yalamanchili et al. 2008). Not surprisingly there

are numerous published case-studies of workers in these industries who have experienced highly

toxic yet sub-lethal doses (Tvedt et al. 1991; Fenga et al. 2002; Gangopadhyay et al. 2007), or

lethal doses of hydrogen sulfide (Tatsuno et al. 1986; Yalamanchili et al. 2008). Hydrogen









sulfide poisoning still remains an everyday risk for those working in the petroleum, sewer,

maritime, and mining industries (Yalamanchili et al. 2008).

Animals that are adapted to environments with hydrogen sulfide have avoidance

behaviors in addition to antioxidant defenses and detoxification mechanisms to protect

themselves from acute and/or chronic exposure to hydrogen sulfide (Bagarinao 1992). Most of

these animals have a very similar set of detoxification mechanisms, including specialized

hemoglobin that can bind both oxygen and hydrogen sulfide (Martineu et al. 1997; Zal et al.

1997; Zal et al. 1998; Hourdez et al. 2000), conversion of sulfide to thiosulfate (Levitt et al.

1999; Doeller et al. 2001), and storage of sulfide as both taurine and thiotaurine (Joyner et al.

2003). However, in some invertebrates, hydrogen sulfide can also be used as the terminal

electron acceptor in aerobic respiration (Doeller et al. 2001; Kraus et al. 2004).

Hydrogen Sulfide is an Energy Source for Chemosynthetic Communities

The discovery of hydrothermal vent communities in 1977 greatly increased the rate of

scientific publications regarding hydrogen sulfide (Lonsdale 1977). Not long after the discovery

of hydrothermal vent communities, hydrocarbon seep communities were discovered (Hecker

1985). At these sites geothermal and volcanic activities (McMullin et al. 2000), or the pressure

of rising salt-domes (Claypool et al. 1983), contribute to releasing hydrogen sulfide into the

water column. This hydrogen sulfide fuels a unique chemosynthetic ecosystem.

Many invertebrates thrive in hydrothermal vents, including several species of tubeworms,

such as Riftia pachyptila and Tevnia jerichonana, at the vents and Lamnellibrachia htymesi and

Seepiophila jonesi, at the seeps. These animals lack a mouth, gut and anus and instead live in a

chitonous tube that contains a sack-like structure termed the trophosome. This sack contains

bacterial symbionts that use energy from sulfide oxidation to fix carbon into organic molecules,

some of which are provided to the host tubeworm for its nutrition (Hand et al. 1983). These









tubeworms have specialized hemoglobin to transport oxygen and hydrogen sulfide from the

respiratory surface to the bacteria without the animal becoming poisoned itself (Martineu et al.

1997; Zal et al. 1997; Zal et al. 1998; Hourdez et al. 2000). In addition to specialized

hemoglobin, hydrocarbon seep tubeworms also have posterior extensions, termed "roots", to

obtain hydrogen sulfide from below the sediment-water interface (Julian et al. 1999).

Hydrogen Sulfide is a Gasotransmitter and Physiological Modulator

Since hydrogen sulfide has had a long history as a toxin, it was very surprising to Eind

that hydrogen sulfide can be endogenously produced in a variety of animal tissues and that it has

both neuromodulatory (Abe et al. 1996) and cardiovascular regulatory effects in mammals

(Hosoki et al. 1997). Since its discovery of its neuromodulatory abilities (Abe et al. 1996),

hydrogen sulfide has been added to the family of gasotransmitters (Wang 2002), which also

includes nitric oxide (NO) and carbon monoxide (CO).

The discovery of gasotransmitters began with the work on the actions of NO by Murad,

Furchgott and Ignarro from 1977-1986 (Furchgott 1999), who in 1988 shared the Nobel Prize in

Physiology or Medicine for their work. The discovery of the gasotransmitter function of CO by

Verma and colleagues followed shortly thereafter in 1993 (Verma et al. 1993). Finally,

investigations of hydrogen sulfide as a physiological modulator began in 1996-1997 with the

work of Abe and Kimura (Abe et al. 1996) and Hosoki, Matsuki and Kimura (Hosoki et al.

1997).

All three gasotransmitters, CO, NO and H2S, share several similarities. They are

endogenously produced, small gas molecules that are capable of physiological action (Wang

2002). They can easily diffuse across cell membranes to exert their function (Wang 2002). They

do not require a mechanism of degradation or reuptake because they are all very reactive, and

they use heme as a common sink (Wang 2002).









Enzymatic Production of Hydrogen Sulfide

All of the gasotransmitters are endogenously produced by enzymatic reactions. Nitric

oxide is produce from L-arginine by nitric oxide synthase (NOS). Carbon monoxide is produced

from heme by heme oxygenize (HO). In mammalian tissues, hydrogen sulfide is primarily

produced from L-cysteine by two PLP (pyridoxal-5' -phosphate)-dependent, cysteine metabolic

enzymes: cystathionine gamma-lyase (CSE) and cystathionine beta-synthase (CBS) (Julian et al.

2002; Zhao et al. 2003). However, several other enzymatic pathways exist for the production of

hydrogen sulfide, including via cysteine amino transferase or cysteine lyase (Julian et al. 2002).

CSE is expressed in endothelial cells and vascular smooth muscle cells (Hosoki et al. 1997;

Wang 2002; Wang 2003; Yang et al. 2008), and is the predominant enzyme for hydrogen sulfide

production in the cardiovascular system. In the CSE reaction (Figure 1-1), L-cysteine must first

dimerize to form cystine, which is then transformed into pyruvate, thiocystine and NH3 by CSE.

CSE can then catalyze the reaction of thiocystine with other thiol compounds to from H2S and

CysSR (Julian et al. 2002). Alternatively, thiocystine may form H2S and cystine non-

enzymatically (Cavallini et al. 1962). CBS is the predominant enzyme for hydrogen sulfide

production in the nervous system (Abe et al. 1996). In the CBS reaction (Figure 1-1), L-cysteine

is hydrolyzed to yield equimolar amounts of H2S and L-serine (Cavallini et al. 1962).

Julian and colleagues showed that hydrogen sulfide is produced in invertebrate tissues

from CBS and CSE (Julian et al. 2002), revealing that gasotransmitters have a deeper phylogenic

history than just vertebrates. Hydrogen sulfide has been shown to act as a signaling molecule in a

variety of invertebrates (Julian et al. 1998; Julian et al. 2002; Gainey et al. 2005; Julian et al.

2005b), as has nitric oxide (Gainey et al. 2003; Palumbo 2005).

Regulation of Hydrogen Sulfide Production

Hydrogen sulfide production by CBS and CSE can be physiologically regulated, although









the mechanisms are poorly understood. Sex hormones appear to regulate brain hydrogen sulfide

production by CBS, with males having higher hydrogen sulfide concentration in the brain than

females (Eto et al. 2002b). This can be reversed either by castration of males or by testosterone

inj section in females (Eto et al. 2002b). CB S activity in vitro can also be regulated by S-adenosyl-

methionine (SAM), an allosteric activator of CB S (Eto et al. 2002b). CSE also appears to be

calcium-calmodulin dependent, and can be stimulated through muscarinic receptor activation of

intracellular calcium (Yang et al. 2008).

Hydrogen sulfide production may also be regulated by the other gasotransmitters. NO and

CO may bind to and inactivate CB S, with CO being the more potent inactivator than NO (Taoka

et al. 2001; Puranik et al. 2006). In contrast, NO seems to stimulate hydrogen sulfide production

in the cardiovascular system (Lowicka et al. 2007): NO donors stimulate CSE-dependent

hydrogen sulfide production in aorta tissue homogenates in a cGMP-mediated manner (Zhao et

al. 2003), and incubation of vascular smooth muscle cells with NO donors increases CSE protein

and mRNA expression (Zhao et al. 2001). Sodium nitroprusside (SNP), an NO donor, increases

the activity of brain CBS in vitro, but this effect results from chemical modification of the

cysteine groups of CB S, rather than a direct action of NO itself (Eto et al. 2002a).

Physiological Actions of Hydrogen Sulfide

Abe and Kimura were the first to show a physiological role for hydrogen sulfide (Abe et

al. 1996). They demonstrated that hydrogen sulfide was not only produced in the brain by CBS,

but that it increased N-methyl-D-aspartic acid (NMDA) receptor-mediated responses and

facilitated hippocampal long-term potentiation (Abe et al. 1996). Since then many actions have

been reported. These include the ability to upregulate y-aminobutyric acid B (GABAB) receptors

in the brain (Han et al. 2005), regulate cerebrovascular circulation (Leffler et al. 2006) and play a









role in cerebral ischemic damage after a stroke (Qu et al. 2006), mediate learning and memory

formation (Partlo et al. 2001), stimulate L-type calcium channels in neurons (Garcia-Bereguiain

et al. 2008), negatively regulate the hypothalamo-pituitary-adrenal axis (Dello Russo et al. 2000),

and protect neurons from oxidative stress (Kimura et al. 2004; Kimura et al. 2006).

A multitude of functions for hydrogen sulfide have been reported in the cardiovascular

system, particularly in the vascular smooth muscle. One of the most important sites of action of

hydrogen sulfide is the ATP-sensitive K' channel (KATP) in Smooth muscle cells, which causes

hyperpolarization and relaxation (Zhao et al. 2001). However, hydrogen sulfide has also been

shown to cause contraction, relaxation or multiphasic responses in aorta (Hosoki et al. 1997;

Zhao et al. 2001; Dombkowski et al. 2005), mesenteric artery (Cheng et al. 2004; Tang et al.

2005), cerebral artery (Leffler et al. 2006), gastric artery (Kubo et al. 2007c), mammary artery

(Webb et al. 2008), and pulmonary arteries (Dombkowski et al. 2005; Wang et al. 2008). These

responses, however, all depend on the concentration of hydrogen sulfide and Oz, the specific

vessel examined, and the animal model used (Dombkowski et al. 2004; Dombkowski et al.

2005). Hydrogen sulfide has also been associated with the pathology of a number of

cardiovascular diseases, including hypertension and COPD (chronic obstructive pulmonary

disease), in addition to hydrogen sulfides involvement in septic shock (Chunyu et al. 2003; Du et

al. 2003; Hui et al. 2003; Yan et al. 2004; Chen et al. 2005). Additionally, hydrogen sulfide has

recently been implicated in vasodilation of the corpus cavernosum (Srilatha et al. 2007;

d'Emmanuele di Villa Bianca et al. 2009; Shukla et al. 2009) and the dysregulation of hydrogen

sulfide has been linked to erectile dysfunction (Srilatha et al. 2006).

Hydrogen sulfide also affects the heart itself. Hydrogen sulfide preconditioning of rat

cardiomyocytes induces a cardioprotection against ischemia and reperfusion injury (Hu et al.










2007). The proposed pathways in this protection include eNOS, KATP channels, protein kinase C,

extracellular signal regulated kinase (ERK 1/2), and phosphatidylinositol 3-kinase/proteine

kinase B (Akt) (Hu et al. 2007; Yong et al. 2008a). Other cardiovascular targets of hydrogen

sulfide are P-adrenergic receptors (Yong et al. 2008b), carotid sinus baroreceptor (Xiao et al.

2007), NADPH oxidase-1, and Rac(1) (Ras-related C3 botulinum toxin substrate 1) (Muzaffar et

al. 2008) and cyclooxygenase, potentially altering arachadonic acid metabolite levels as well

(Koenitzer et al. 2007).

Recent evidence also suggests that hydrogen sulfide acts as an oxygen sensor in

vertebrates and may be involved in vascular responses to hypoxia (Dombkowski et al. 2006;

Olson et al. 2006; Olson 2008). The rationale is that the low oxygen levels during hypoxia allow

accumulation of hydrogen sulfide in vascular tissue, which then modulates vascular tone.

A role for hydrogen sulfide in the gastrointestinal system has also been emerging. As in

other tissues, hydrogen sulfide is produced in gastric and intestinal tissues from CBS and CSE

(Fiorucci et al. 2006), and has had several demonstrated functions. Hydrogen sulfide has been

reported to protect gastric mucosal epithelium from oxidative stress (Yonezawa et al. 2007) and

enhance ulcer healing in rats (Wallace et al. 2007). Hydrogen sulfide also affects gut motility and

secretion (Kubo et al. 2007c), relaxation of ileum (Hosoki et al. 1997), and can also inhibit motor

patterns in human, rat and mouse colon (Gallego et al. 2008). In the liver, hydrogen sulfide

regulates perfusion and biliary bicarbonate secretion (Fiorucci et al. 2005b; Fujii et al. 2005).

In addition to actions of hydrogen sulfide in the nervous, cardiovascular, and

gastrointestinal systems, there is evidence that hydrogen sulfide is involved in insulin secretion,

also working through KATP (Yang et al. 2005), as well as leukocyte adhesion and trafficking, via

KATP (Zhang et al. 2007), and leukocyte-mediated inflammation (Zanardo et al. 2006).










Hydrogen sulfide has a protective role or antioxidant capacity in many systems.

Hydrogen sulfide will readily scavenge hydrogen peroxide, and increase intracellular levels of

reduced glutathione (GSH) (Kimura 2002; Pryor et al. 2006) and the hydrogen sulfide signaling

system (including CSE and CBS) has both anti-oxidant (Kimura et al. 2004; Whiteman et al.

2004a; Kimura et al. 2006; Yan et al. 2006; Jha et al. 2008) and anti-inflammatory (Fiorucci et

al. 2005a; Zanardo et al. 2006; Wallace 2007b) actions. Not surprisingly, there is large interest in

its potential role as an NSAID and therapeutic agent for a variety of disorders, including

hypertension (Fiorucci et al. 2007; Lowicka et al. 2007; Szabo 2007; Wallace 2007a; Wallace

2007b; Li et al. 2009). However, hydrogen sulfide is also reported to increase

lipopolysaccharide-induced inflammation (Li et al. 2005).

One of the more dramatic actions of hydrogen sulfide is greatly reducing metabolism in

mice, resulting in a suspended animation-like state (Blackstone et al. 2005). While the

possibility of inducing a suspended animation has tremendous potential, this has not yet been

duplicated in animals larger than the mouse (Haouzi et al. 2008). Nonetheless, this discovery has

led the creation of the Ikaria Corporation, a gas-drug company investigating both therapeutic

potential of NO and H2S. Ikaria has produced a more stable form of Na2S called IK-1001, which

is purportedly suitable for inj section, and INOmax@ which is nitric oxide for inhalation. IK-1001

has been used in several research applications and finished Phase I clinical trials in 2008 (Elrod

et al. 2007; Szabo 2007; Jha et al. 2008; Kiss et al. 2008). The metabolic effects of hydrogen

sulfide are also seen in the nematode Caenorhabditis elegan2s, in which hydrogen sulfide

increases thermotolerance and lifespan in (Miller et al. 2007). While still in research and

development, it is clear that hydrogen sulfide has a very high therapeutic potential, much like

NO and NO-donors.









Interactions between the Gasotransmitters

Hydrogen sulfide and the other gasotransmitters may interact with each other, but the

interactions have not been firmly established. The early work on the interactions of hydrogen

sulfide and NO indicated that the relationship was synergistic. In 1997 Hosoki et al showed that

hydrogen sulfide increased the effects of the NO donor SNP by up to 13-fold (Hosoki et al.

1997). Later, Julian et al. showed that SNP potentiates hydrogen sulfide-induced contractions in

the body wall of the echiuran worm Grechis caupo (Julian et al. 2005b)..

Not surprisingly, there have also been reports of negative interactions between the

gasotransmitters. At a direct chemical level hydrogen sulfide can react with NO to form a

nitrosothiol (Whiteman et al. 2006), and hydrogen sulfide can increase CO production from HO-

1, which can then inhibit NO production from iNOS (Oh et al. 2006). In studies of hypertension

and pulmonary vascular structural remodeling (PVSR), exogenous hydrogen sulfide inhibits the

NO/NOS pathway and upregulates the CO/HO-1 pathway (Qingyou et al. 2004; Li et al. 2006).

Moreover, during hypertension the expression and activity of CSE decreases with a concomitant

decrease in plasma hydrogen sulfide concentration (Qi et al. 2004; Xiaohui et al. 2005), while

plasma NO levels and eNOS expression levels increase (Zhong et al. 2003). Accordingly,

application of hydrogen sulfide (as NaHS) rescues rats from hypertension (Du et al. 2003;

Qingyou et al. 2004; Yan et al. 2004) and application of hydrogen sulfide lessens aorta structural

remodeling, decreases NO levels, and increases CO levels (Qingyou et al. 2004; Yan et al. 2004;

Li et al. 2006). Similarly, increasing expression of HO-1 prevents development of hypertension

and inhibits PVSR (Zhao et al. 2001).

However, data have been published that contradict many of the interactions reported

between the gasotransmitters and their respective enzymes. These discrepancies are likely the

result of using different experimental systems, as well as differences in methodologies and









techniques while working with hydrogen sulfide, which could alter or skew the results (see

Technical Considerations below). For example, while several studies have demonstrated the

positive effect of hydrogen sulfide on NO signaling and NO production (Chapter 3, Hosoki et al.

1997; Yong et al. 2008a), several other studies show negative effects of hydrogen sulfide on NO

production (Geng et al. 2007; Kubo et al. 2007b; Kubo et al. 2007c). This discrepancy is likely

because the latter investigators waited for hours to look for an effect of hydrogen sulfide, when

the positive effect on NO production can be observed in minutes (Chapter 3). The absence of a

sustained effect is likely because H2S is so volatile and can rapidly oxidize in solution (see

below).

It is also unclear whether the action of hydrogen sulfide on KATP is UniVersal. Rui Wang

and colleagues show that hydrogen sulfide causes a direct activation of KATP and that

glibenclamide (an KATP inhibitor) inhibits the action of hydrogen sulfide (Zhao et al. 2001; Wang

2002; Zhao et al. 2002; Tang et al. 2005; Yang et al. 2005). However, the precise mechanism for

this activation still remains unknown, and others, including myself (Chapter 2), have not seen the

same effect of glibenclamide. In these cases glibenclamide either does not work at all (Kiss et al.

2008), or only partially inhibits the relaxation to hydrogen sulfide (Chapter 2, Kubo et al. 2007a;

Kubo et al. 2007b; Kubo et al. 2007c; Webb et al. 2008).

An additional receptor of hydrogen sulfide, the Cl-/HCO3- exchanger, has recently been

revealed (Kiss et al. 2008). This receptor, when inhibited using the anion exchanger inhibitor

4,4'-Dii sothiocyanatostilbene-2,2'-di sulfonate (DID S), completely blocks the hydrogen sulfide

relaxation (Kiss et al. 2008). From this it is evident that hydrogen sulfide is likely working

through both KATP and the Cl-/HCO3- exchanger. However, these receptors only apply to the









relaxation observed to hydrogen sulfide. The mechanisms) behind the contractile, or multiphasic

responses to hydrogen sulfide have yet to be identified.

Hydrogen Sulfide Chemistry and Technical Considerations

Hydrogen sulfide exists as a gas (H2S, dihydrogen sulfide) and is a weak acid in solution,

dissociating into HS- and S2-. There are three commonly used methods to create hydrogen sulfide

solutions in the laboratory. One way is to bubble distilled water or a physiological buffer directly

with hydrogen sulfide gas. However, this method is not as accurate as using a known amount of

a chemical donor. Two chemical donors, sodium (Na2S) and sodium hydrosulfide (NaHS), are

widely used instead of hydrogen sulfide gas. Na2S crystals are clear, and once the oxidized

portions are rinsed from the crystals with distilled water, they can be measured out as any other

chemical. NaHS is in the form of yellow flakes, and the oxidized portions cannot be easily rinsed

before weighing since the flakes immediately dissolve upon contact with water. Na2S is argued

to be a better hydrogen sulfide donor than NaHS for making solutions because of its higher

purity. It is thought that oxidation products formed from the impurities in NaHS solutions may

interfere with physiological experiments (Koenitzer et al. 2007). However, Na2S is highly basic

and may cause confounding effects by altering pH of buffers if used in high concentrations.

Despite this, both donors have been commonly used in published studies. Working in a fume

hood is recommended when dealing with hydrogen sulfide because higher levels of hydrogen

sulfide can prevent its olfactory detection and these symptoms can rapidly progress during a

high, acute exposure. Therefore, it is important at first notice of hydrogen sulfide gas to move to

a well-ventilated area to avoid increased exposure and more severe symptoms.

In solution, hydrogen sulfide exists as three species: H2S, HS- and S2~ (See Equation 1).



H2S a HS- + H+ S2- + H+ (1)









Because the pKa for the first dissociation is 7.02-7.04 (Chen 1972; Beauchamp et al. 1984) and

the estimated pKa of the second dissociation is 12-15 (Chen 1972; Beauchamp et al. 1984;

Bagarinao 1992), at a physiological pH of 7.4 hydrogen sulfide exists as approximately 1/3 H2S

and 2/3 HS- with very little S2- (Beauchamp et al. 1984). This approximate relationship holds

true in fresh- and salt-water environments, although variation in pH will shift the H2S/HS-

equilibrium. Therefore when working with and discussing the effects of hydrogen sulfide, it is

important to take into account not only H2S gas, but the HS- anion. Throughout this dissertation

the term "hydrogen sulfide" will refer to the sum of the species H2S, HS- and S2 UnlCSS

otherwise specified.

Hydrogen sulfide gas is very volatile (Cline 1969; Julian et al. 1998; Dorman et al. 2002)

and will readily come out of solution, causing a net loss of hydrogen sulfide. This loss is

exacerbated by the fact that hydrogen sulfide will readily oxidize in the presence of divalent

metals and oxygen (Tapley et al. 1999), a condition that is prevalent in most physiological

buffers, blood, sea water, and extracellular fluid. Therefore, an additional complication that faces

the experimenter when working with hydrogen sulfide is its ephemeral nature. This not only

makes the detection of hydrogen sulfide in low quantities a challenge, but rigorous

deoxygenation measures must be taken to make accurate stock solutions of hydrogen sulfide for

experimentation. All solutions should also be made immediately prior to experimentation to

assure the hydrogen sulfide concentration has not changed significantly due to oxidation and

volatilization.











L-Serine + HS 4.2
Oa H



L-Cysteine


CysSR + H2S


R-SH


Figure 1-1.


Enzymatic production of hydrogen sulfide by cystathionine P-synthase (CBS) and
cystathionine y-lyase (CSE). Figure adapted from Julian et al. 2002. In the CBS
reaction (1), L-cysteine is hydrolyzed to yield equimolar amounts of H2S and L-
serine. In the CSE reaction (2), L-cysteine must first dimerize to form cystine, which
is then transformed into pyruvate, thiocystine and NH3 by CSE. CSE can then
catalyze the reaction of thiocystine with other thiol compounds to from H2S and
CysSR. Alternatively, thiocystine may form H2S and cystine non-enzymatically.


1)cystathionine (3-synthase (CBS)
2) cystathion ine-y-lyase (CS E)









CHAPTER 2
NITRIC OXIDE, ADENOSINE TRIPHOPHATE (ATP)-SENSITIVE POTASSIUM
CHANNELS, AND ARACHIDONIC ACID METABOLITES MODULATE THE TRIPHASIC
RESPONSE TO HYPOXIA AND HYDROGEN SULFIDE IN RAT AORTA

Abstract

Hypoxia and hydrogen sulfide elicit similar contractile responses in every vertebrate

smooth muscle thus far tested, but the mechanism of each is poorly understood. In aorta

preparations, the responses to hypoxia and hydrogen sulfide can be mediated by blockade of

nitric oxide (NO), ATP-sensitive potassium channels (KATP), and arachidonic acid metabolites,

but no study has determined whether the effects of blockade are similar in the same tissue

preparation. We tested this with aortic rings from Fisher 344 and Fisher 344 x Brown Norway

rats using standard vascular myography techniques. We found that both hypoxia and hydrogen

sulfide elicit a triphasic, contraction-relaxation-contraction response. The NO synthase inhibitor

L-NAME and the KATP inhibitor glibenclamide significantly reduced hypoxia-induced

contraction phases, while the hypoxia-induced relaxation phase was reduced only by

glibenclamide. An arachidonic acid metabolism inhibitor cocktail (AAM inhibitor cocktail) of

esculetin (to inhibit lipoxygenase), clotrimazole (to inhibit Cytochrome P-450) and indomethacin

(to inhibit cyclooxygenase) did not have an effect on either hypoxia-induced contraction or

relaxation. In contrast, the hydrogen sulfide response was affected only by the AAM inhibitor

cocktail, which reduced the second contraction phase. We conclude that in rat aortic smooth

muscle the triphasic responses to hypoxia and hydrogen sulfide are mediated by different

signaling mechanisms.

Introduction

Hydrogen sulfide (H2S) is the newest member of the gasotransmitter family, j oining nitric

oxide (NO) and carbon monoxide (CO) (Wang 2002; Wang 2003). Hydrogen sulfide is produced









from L-cysteine by cystathionine y-lyase in vascular smooth muscle and endothelial cells (Wang

2002; Wang 2003; Yang et al. 2008) and it elicits a variety of effects in the vasculature when

applied exogenously (Dombkowski et al. 2005). Furthermore, hydrogen sulfide may be intrinsic

to or interact with hypoxia signaling, since accumulation of endogenous hydrogen sulfide would

be favored by hypoxia and exogenous hydrogen sulfide mimics the effects of hypoxia in smooth

muscle (Olson et al. 2006). Consistent with this, the vascular response to hypoxia is decreased by

inhibitors of hydrogen sulfide production and enhanced by addition of L-cysteine (Olson et al.

2006; Olson et al. 2008).

The mechanisms underlying hypoxia-induced vascular responses, and whether they are

identical to hydrogen sulfide-induced responses, are poorly understood. Here we investigate the

mechanisms of the vascular responses to hypoxia and hydrogen sulfide in rat thoracic aorta by

blocking three potential downstream effectors: NO, which causes cyclic GMP-mediated

relaxation; ATP-sensitive potassium channels (KATP), which cause relaxation by hyperpolarizing

smooth muscle cells (Wang 2002; Wang 2003); and arachidonic acid metabolites (AAM), which

can be vasoconstrictors or vasodilators (Kompanowska-Jezierska et al. 2008). We hypothesized

that both hypoxia and hydrogen sulfide would cause a similar multiphasic response, potentially

mediated by NO, KATP, and AAM.

While the contractile responses to hypoxia and hydrogen sulfide may both result from a

reduction of bioavailable NO, the mechanisms may differ. Since NO synthase (NOS) is 02

dependent, hypoxia may reduce NO bioavailability (Besse et al. 2002) thereby increasing vessel

tension. Moreover, hypoxia may allow accumulation of endogenous hydrogen sulfide by

decreasing its spontaneous oxidation (Olson et al. 2006). Hydrogen sulfide may itself reduce NO

bioavailability by chemically reacting with NO to produce a nitrosothiol (Whiteman et al. 2006)









and reduce NO production by inhibiting NOS (Geng et al. 2007). Therefore, blockade of NO

production by inhibiting NOS should eliminate or reduce hypoxia- and hydrogen sulfide-induced

contractions if they are the result of inhibition of NOS and/or reduced NO bioavailability by

hypoxia and hydrogen sulfide. Furthermore, KATP channels hyperpolarize smooth muscle cells

and are activated by hydrogen sulfide (Wang 2002; Tang et al. 2005), so their blockade should

reduce relaxation. Finally, hydrogen sulfide may directly interact with the hemes of

cyclooxygenase and cytochrome P-450 (Koenitzer et al. 2007), potentially altering AAM

production and consequently vascular tone. Therefore blockade of AAM may affect hypoxia-

and hydrogen sulfide-induced responses.

Materials and Methods

Adult, male Fisher 344 x Brown Norway hybrid (N = 33) of ages 6-27 months of age were

housed individually under standard conditions and provided with food and water. Older animals

(19-27 mo) were used in the hypoxia and hydrogen sulfide inhibitor experiments, while younger

animals were used to investigate the role of the endothelium in the hydrogen sulfide response (6-

10 mo). There was no significant variability in the responses within these two age groups. To

reduce potential anesthesia artifacts on responses to hydrogen sulfide (Dombkowski et al. 2005),

euthanasia was performed by guillotine according to IACUC-approved methods. After

dissection, the thoracic aorta was carefully cleaned of fat and sectioned into 5 mm long rings.

Four rings were then randomly selected, with each receiving one of four treatments: control; 1

mmol/L L-NAME to block NOS; 1 Clmol/L glibenclamide (a sulfonylurea derivative) to block

KATP; Or an AAM inhibitor cocktail consisting of 10 Clmol/L each of esculetin, clotrimazole, and

indomethacin to block AAM (Dombkowski et al. 2004). Vessel rings were attached with

stainless steel wire to a force transducer and mounted in a tissue bath system (Radnoti Glass

Technology, Monrovia, CA) containing 370C Krebs bicarbonate buffer, pH 7.4, aerated with









95% air/ 5% CO2. A resting tension of 1.5 g was applied and maintained as vessels were allowed

to equilibrate for at least 1 h. This tension was found to give the best response based on a tension

-response curve was generated for the Fisher 344 x Brown Norway hybrid rat aorta.

At the start of each experiment, vessels were maximally contracted with 80 mmol/L KC1,

and subsequently washed twice with Krebs buffer. This was repeated after 30 min, at which

point the vessels had returned to resting tension of 1.5 g. This procedure ensures optimum in

vitro vessel activity (Dombkowski et al. 2005). The second KCl contraction was also used to

normalize the responses to the other agonists. To check for an intact endothelium, acetylcholine

(Ach, 10 Clmol/L) was then added to cause relaxation. Vessels that failed to contract to KCl or

relax to ACh were discarded. After two additional washes, the vessels were incubated with the

respective inhibitors for 30 min and the tension on all rings was continuously adjusted to 1.5 g.

To determine the response to hypoxia, vessels were precontracted with 1 Clmol/L phenylephrine

(PE) and the buffer aeration was switched from 95% air / 5% CO2 to 95% N2 / 5% CO2 after the

PE contraction had stabilized (approximately 5 min). To determine the response to hydrogen

sulfide, vessels were precontracted with PE, as above, but aeration with air was continued and

300 Clmol/L total hydrogen sulfide (referring to the sum of the chemical species: H2S, HS- and

S2-) was added to each bath as either sodium hydrosulfide (NaHS, N = 18) or sodium sulfide

(Na2S, N = 6). After the response completed and vessel tension had stabilized, baths were

washed twice and vessels returned to resting tension (30 min). Some experiments were

performed with the endothelium removed. To achieve this, the rings were gently rubbed on the

inside with a stainless steel wire (Chung et al. 2007). Rings were then checked to make sure

endothelium was removed by addition of 10 Clmol/L ACh. In some experiments the components

of the AAM inhibitor cocktail were added separately to investigate the individual contributions









of COX (indomethacin, N = 6), LOX (esculetin, N = 7), and Cyt P-450 (clotrimazole, N = 7). Of

the 33 animals tested, the final number that responded to both KCl and ACh, and therefore that

were used in subsequent statistical analysis were as follows: control treatment, N = 17 for

hypoxia and N = 20 for hydrogen sulfide; L-NAME treatment, N = 16 for hypoxia and N = 14

for hydrogen sulfide; glibenclamide treatment, N = 18 for hypoxia and N = 15 for hydrogen

sulfide; AAM inhibitor cocktail treatment, N = 14 for hypoxia and N = 11 for hydrogen sulfide;

removal of endothelium, N = 12 for hydrogen sulfide (hypoxia not tested).

The magnitude of the hypoxia- and hydrogen sulfide-induced triphasic responses for each

vessel were quantified in the following manner: the initial contraction was measured from the PE

pre-contracted tension to the peak of the first contraction, the relaxation was measured from the

peak of the first contraction to the base of the relaxation, and the second contraction was

measured from the base of the relaxation to the peak of the second contraction. The magnitude of

contractions and relaxations were subsequently normalized to the magnitude of the second KCl

contraction for that vessel (i.e., KCl contraction force = 100%). Significant differences from

control values were determined by one-way ANOVA with a Tukey post-hoc test. A two-tailed

Student' s t-test was used to compare the hypoxia-induced and hydrogen sulfide-induced control

phases. For each combination of treatment and inhibitor, at least 13 rings were used for analysis.

The statistical software used was JMP 7.0.1 (SAS Institute, Cary, NC USA), with p < 0.05

accepted as significant.

Total hydrogen sulfide concentrations were measured by a methylene blue assay (Gilboa-

Garber 1971) and were approximately 75% of calculated values (with the difference presumably

being due to volatilization and oxidation of sulfide). In physiological saline at pH 7.4, hydrogen

sulfide dissociation is approximately 1/3 H2S and 2/3 HS- (Beauchamp et al. 1984). Therefore the









true hydrogen sulfide gas (H2S) concentrations were typically ca. 75 Clmol/L. Chemicals were

purchased from Thermo Fisher Scientifie (Waltham, MA) or Sigma-Aldrich (St. Louis, MO).

Results

Isolated rat aorta rings exposed to hypoxi a alone showed a triphasi c contract on-rel axati on-

contraction response that was complete in ca. 90 min (Figure 2-la). Isolated rat aorta rings

exposed to hydrogen sulfide alone showed a similar triphasic contraction-relaxation-contraction

response (Figure 2-1b), although it was complete in ca. 30 min. The duration of all three phases

of the hypoxia-induced triphasic response was consistently, and significantly longer in duration

than the phases of the hydrogen sulfide -induced triphasic response (Figure 2-2; two-tail t-test, p

< 0.0001 for all). The triphasic response was the same when elicited by NaHS or Na2S as the

hydrogen sulfide donor. When the hypoxia-induced response was compared to the hydrogen

sulfide-induced response, the initial contraction and relaxation were significantly larger in

magnitude during hypoxia (Figure 2-3; two-tail t-test, p = 0.003 and Figure 2-4; two-tail t-test; p

< 0.001).

To test whether similar mechanisms are responsible for modulating the triphasic

responses to hypoxia and hydrogen sulfide, we inhibited NO production with L-NAME, KATP

channel opening with glibenclamide, and blocked AAM with an inhibitor cocktail of

indomethacin, esculetin, and clotrimazole, which inhibit cyclooxygenase, cytochrome P-450, and

lipoxygenase, respectively. When applied prior to hypoxia exposure, L-NAME significantly

reduced the initial contraction phase, but this phase was not significantly affected by

glibenclamide or the AAM inhibitor cocktail (Figure 2-3a, ANOVA, p = 0.0397). The relaxation

phase in response to hypoxia was not significantly affected by any of the inhibitors compared to

control, but glibenclamide significantly reduced the relaxation phase compared to L-NAME

(Figure 2-4a, ANOVA, p = 0.0340). The second contraction phase in response to hypoxia was










significantly reduced by L-NAME and glibenclamide, but not by the AAM inhibitor cocktail

(Figure 2-5a, ANOVA, p = 0.0215). In contrast, when applied prior to hydrogen sulfide

exposure, none of the inhibitors significantly affected the initial contraction phase (Figure 2-3b,

ANOVA, p = 0.272) or the relaxation phase (Figure 2-4b, ANOVA, p = 0.254). The second

contraction phase in response to hydrogen sulfide was not significantly affected by L-NAME or

glibenclamide, but was significantly reduced by the AAM inhibitor cocktail (Figure 2-5b,

ANOVA, p = 0.0176).

To further investigate the role of endothelium-derived products on the hydrogen sulfide-

induced response, we removed the endothelium from the aorta rings before experimentation.

There were significant differences in all three phases of the hydrogen sulfide-induced triphasic

response when comparing rings with no endothelium to control rings with an intact endothelium.

Compared to control rings, removal of the endothelium significantly reduced the magnitude of

the initial contraction phase (Figure 2-6, two-tail t-test, p = 0.0027), significantly increased the

magnitude of the relaxation phase (Figure 2-6, two-tail t-test, p = 0.0009), and significantly

reduced the magnitude of the second contraction phase (Figure 2-6, two-tail t-test, p < 0.0001).

To determine the effect of L-NAME without manipulating the tension before addition of

hydrogen sulfide as was done in the maj ority of the experiments, L-NAME was administered

after precontraction with PE and the ring was allowed to further constrict until stable. This

differed from the previous application of L-NAME which was 30 minutes before PE

preconstruction, and where the tension was adjusted back down to 1.5 g manually after L-NAME

was added. The initial contraction phase was significantly reduced while the second contraction

phase remained (N = 4, data not shown). Finally, when the AAM inhibitor cocktail components










were added separately, indomethacin, esculetin, and clotrimazole did not have a significant effect

on the second phase contraction (data not shown, N = 6-7, ANOVA, p = 0.157).

Discussion

This report demonstrates that hypoxia and hydrogen sulfide each elicit a characteristic,

triphasi c contract on-rel axati on-contracti on response in rat aorta. While others investigators have

reported mono- or biphasic responses to hydrogen sulfide (Hosoki et al. 1997; Dombkowski et

al. 2005; Koenitzer et al. 2007), this is the first report of a triphasic response to hydrogen sulfide

in aorta. However, a triphasic response has been reported in rat pulmonary artery (Dombkowski

et al. 2005) and in response to acute hypoxia in rat aorta (Besse et al. 2002). While aorta has

been used in this study, and is commonly used to elicit the vascular actions of hydrogen sulfide

(Hosoki et al. 1997; Zhao et al. 2001; Dombkowski et al. 2005; Olson et al. 2006; Koenitzer et

al. 2007; Yang et al. 2008), it should be noted that this is a conduit vessel, not a resistance vessel.

Changing the tone of the aorta will effectively alter blood pressure and flow to the entire vascular

system not specific vascular beds, and would therefore not be an effective means of regulating

blood flow, as it would in a resistance vessel. In preliminary experiments with pulmonary artery

and mesenteric artery, I observed the same triphasic response as in aorta rings (Predmore,

unpublished data). Therefore, the aorta is used here as an experimental proxy for the resistance

vessels.

The concentration of hydrogen sulfide that accumulates in the aorta rings during hypoxia is

unknown, and for that matter so is the hydrogen sulfide concentration during hypoxia in vivo.

Therefore the incubation bath hydrogen sulfide concentrations reported are approximations of

what may actually accumulate during hypoxia (300 Clmol/L total hydrogen sulfide or ca. 75

Clmol/L H2S). This is within the range of previously reported plasma hydrogen sulfide

concentrations, which range from 10 to 300 Clmol/L (Whitfield et al. 2008), although note that it









has recently been argued that free hydrogen sulfide is actually significantly lower (<100 nmol/L)

(Whitfield et al. 2008).

While the triphasic responses to hypoxia and hydrogen sulfide are broadly similar, they

differ temporally, in magnitude, and in their interaction with NO, KATP, and AAM. The hypoxia-

induced initial contraction and relaxation phases were significantly larger than the hydrogen

sulfide-induced counterparts, whereas the second contraction phase was similar. Interestingly,

the triphasic response to hydrogen sulfide is dose dependent: at concentrations of 100 and 600

Clmol/L total hydrogen sulfide, the magnitude of the triphasic responses were similar, but at 900

Clmol/L total hydrogen sulfide the magnitude of the phases increased slightly (data not shown).

Although all phases of the hypoxia-induced triphasic response could be reduced in magnitude by

one or more of the inhibitors, only the second contraction phase of the hydrogen sulfide-induced

triphasic response was significantly affected by inhibitors, suggesting that the triphasic responses

to hypoxia and hydrogen sulfide are differentially mediated.

Initial Contraction Phase

Our data suggest that the initial contraction phase in response to hypoxia is partially

mediated by NO bioavailability but not by KATP Or AAM, and that the initial contraction phase in

response to hydrogen sulfide is not primarily mediated by NO bioavailability, KATP Or AAM.

However, there must be some endothelium-derived factor mediating this response to hydrogen

sulfide, since removal of the endothelium severely reduced the initial contraction phase to

hydrogen sulfide.

In the initial experiments with L-NAME the baseline tension was maintained constant

throughout the incubation with L-NAME. Therefore any increase in tension after L-NAME

addition was reduced back to baseline before the addition of PE, hypoxia, or hydrogen sulfide.

The rationale behind this was to prevent the rings from maximally constricting after the PE was









added. If they were maximally constricted before addition of hypoxia or hydrogen sulfide, it

would be impossible to tell if it was an effect of NOS blockade, or simply the mechanical limits

of the rings to respond. In the experiments following when L-NAME was added after PE pre-

contraction, care was taken to ensure that the maximal tension, as determined from the KCl

contraction, was not reached before addition of hydrogen sulfide.

While the blockade of NO synthesis by L-NAME did not significantly alter the initial

contraction phase to hydrogen sulfide in the initial experiments, there was a non-signifieant

decrease in the hydrogen sulfide-induced initial contraction with L-NAME, similar to what was

observed with hypoxia (Fig. 2-3a vs. 2-3b). However, when L-NAME was added after the PE

precontraction, and the tension was not adjusted after L-NAME was added (which was the case

in the previous experiments), there was a significant reduction of the initial contraction phase to

hydrogen sulfide. Recent evidence also shows that hydrogen sulfide may cause a reduction of

cyclic AMP (cAMP) (Lim et al. 2008). This may occur in addition to the reduction of free NO

during hydrogen sulfide-induced contractions in vascular smooth muscle to mediate the observed

contractions.

Relaxation Phase

Our data suggest that the relaxation phase in response to hypoxia is partially mediated by

KATP, but not by NO or AAM, and that the relaxation phase in response to hydrogen sulfide is

not mediated by NO, KATP Or AAM. Glibenclamide significantly reduced the relaxation phase

during hypoxia when compared to the L-NAME treatment (Fig. 2-4a), but it did not affect the

response to hydrogen sulfide (Fig. 2-4b). This was surprising given that hydrogen sulfide

activates KATP (Wang 2002; Tang et al. 2005). However, the glibenclamide concentration we

used (1 Clmol/L) may have been higher than that required for specific blockade of KATP, and may









have also blocked Cl- channels (Sheppard et al. 1997). A blockade of Cl- efflux could prevent

depolarization of smooth muscle cells (Kitamura et al. 2001), thereby reducing the effects of

KATP blockade. However, 10-100 CIM glibenclamide is required for noticeable Cl- inhibition

(Sheppard et al. 1997; Robert et al. 2005). Recent evidence suggests that hydrogen sulfide-

induced vasorelaxation may be due to a reduction in ATP concentration by metabolic inhibition

followed by acidosis and activation of Cl /HCO3- exchangers (Kiss et al. 2008), and therefore

may not primarily rely on KATP channels. It remains to be tested whether this occurs during the

triphasic response for both hypoxia and hydrogen sulfide, since only a monophasic relaxation

was observed in the aforementioned study. It is also interesting to note that the magnitude of the

relaxation phase during hydrogen sulfide-induced responses increased when the endothelium was

removed. This may be the result of removing the source of AAM that are vasoconstrictive (i.e.

thromboxanes, and some prostaglandins) and that may interfere with the relaxation pathway(s)

initiated by hydrogen sulfide (see below).

Second Contraction Phase

Our data suggest that the second contraction phase in response to hypoxia is partially

mediated by NO bioavailability and potentially KATP, but not mediated by AAM, and that the

second contraction phase in response to hydrogen sulfide is mediated by AAM but not by NO

bioavailability or KATP. This could indicate that hypoxia continues to inhibit the NO/NOS

system, whereas hydrogen sulfide induces production of one or more AAM. Both of these

possibilities would lead to contraction. This is similar to the response of the initial contraction, in

which the hypoxia-induced contraction may result from a decrease in NO bioavailability,

whereas the hydrogen sulfide-induced contraction may result from an alternative pathway such

as vasoconstrictive AAM or by decreasing cAMP (Lim et al. 2008). This is supported by the

observation that removal of the endothelium significantly reduced the second contraction phase,









indicating that the response is derived from endothelium. While the involvement of specific

enzymes and their products (i.e. cyclooxygenase, lipoxygenase or Cytochrome P-450) could not

be determined by adding the components of the AAM inhibitor cocktail alone, there may be an

additive or combined effect of multiple AAM causing the second phase contraction to hydrogen

sulfide. Our data provide no support for a role for of KATP channels in hydrogen sulfide-induced

contractions, which is also supported by Lim and colleagues (Lim et al. 2008), but our data do

support a role for KATP channels in hypoxia-induced contractions. However, if glibenclamide

non-specifically blocked chloride channels, and therefore C1f efflux, in addition to KATP

(Sheppard et al. 1997; Kitamura et al. 2001), this could have artificially reduced the magnitude

of the hypoxia-induced second contractions.

Conclusion

Our data show that hypoxia and hydrogen sulfide produce similar responses in rat aorta

but that these responses result from different mechanisms. The data suggest that NO and KATP

contribute to the triphasic response to hypoxia, while AAM play a role in the hydrogen sulfide

response. However, no component of the triphasic response to any blockade was completely

eliminated, indicating that more signaling pathways are involved, potentially including, but

certainly not limited to, cAMP and metabolic inhibition. Additionally, the effect of the inhibitors

on higher or lower hydrogen sulfide concentrations remains to be determined, since we tested

only one concentration of hydrogen sulfide. Therefore, further investigations are warranted to

illuminate how these two signaling events are mediated and interconnected, and whether these

trends persist over a range of hydrogen sulfide concentrations.



























1D 0 in


H 2S


Figure 2-1.


Representative tracings of the effect of (a) hypoxia (95% N2/5% CO2) Or (b)
hydrogen sulfide (H2S; 300 Clmol/L NaHS or Na2S) on phenylephrine (PE) (1
Clmol/L) pre-contracted rat aorta rings. Both stimuli produced a triphasic contraction-
relaxation-contraction. Horizontal scale bar indicates time (min) and vertical scale
bar indicates aorta ring tension (g). To reduce noise, data were smoothed in Sigma
Plot using a negative exponential 1st degree polynomial function with a 0.02
(hypoxia) or 0.05 (hydrogen sulfide) sampling proportion and nearest neighbors
bandwidth method.


0.5 g

3 rnr































Second

Phase


Third


Figure 2-2.


Duration of the triphasic response of phenylephrine (1 Clmol/L) pre-contracted rat
aorta rings to hypoxia (95% N2/5% CO2, N = 40) and hydrogen sulfide (H2S; 300
Clmol/L NaHS or Na2S, N = 40). Treatment is on the X-axis, and response is on the
Y-axis as % of the KCl contraction. All panels show mean + SEM. Significant
differences (asterisks) were determined using a two-tailed Student' s t-test. The
duration of the hypoxia-induced triphasic response is significantly longer than the
hydrogen sulfide-induced triphasic response at every phase.


SHypoxia
SH2S














First



















.P
t;
m
L
~ o.zs
Q
u
Y



0.00


0.00


Ctrl L-NAME Glib Cocktail


Figure 2-3.


Magnitude of the initial contraction phase of the triphasic response of phenylephrine
(1 Clmol/L) pre-contracted rat aorta rings to hypoxia (95% N2/5% CO2) and hydrogen
sulfide (H2S; 300 Clmol/L NaHS or Na2S). Each ring received one of the following
treatments: no inhibitors (Control; N = 20 hypoxia, N = 23 hydrogen sulfide), L-
NAME (L-NAME; N = 18 hypoxia, N = 16 hydrogen sulfide), glibenclamide
(Glibenclamide; N = 20 hypoxia, N = 17 hydrogen sulfide), or an AAM inhibitor
cocktail of indomethacin, esculetin and clotrimazole (AAM inhibitor cocktail, N =
16 hypoxia, N = 13 hydrogen sulfide). Treatment is on the X-axis, and response is on
the Y-axis as % of the KCl contraction. All panels show mean + SEM, with hypoxia
data in panel a and hydrogen sulfide data in panel b. Significant differences
(different letters) were determined using one-way ANOVA with a Tukey post-hoc,
in addition to a two-tailed Student' s t-test (asterisks). Application of L-NAME 30
min prior to hypoxia significantly reduced the initial contraction phase (a). However,
application of inhibitors during the hydrogen sulfide response did not significantly
affect the initial contraction phase (b). The control hypoxia initial contraction was
significantly greater in magnitude than the control initial contraction to hydrogen
sulfide (a vs. b, asterisk).


O
tl
E
~ o.zs i
o
u

ap


Ctrl L-NAME Glib Cocktail

















II I


-~o


-0.25

-0.50 -

-0.75


-0.75


Ctrl L-NAME Glib Cocktail


Ctrl L-NAME Glib


Cocktail


Figure 2-4.


Magnitude of the relaxation phase of the triphasic response of phenylephrine (1
Clmol/L) pre-contracted rat aorta rings to hypoxia (95% N2/5% CO2) and hydrogen
sulfide (H2S; 300 Clmol/L NaHS or Na2S). Each ring received one of the following
treatments: no inhibitors (Control; N = 20 hypoxia, N = 23 hydrogen sulfide), L-
NAME (L-NAME; N = 18 hypoxia, N = 16 hydrogen sulfide), glibenclamide
(Glibenclamide; N = 20 hypoxia, N = 17 hydrogen sulfide), or an AAM inhibitor
cocktail of indomethacin, esculetin and clotrimazole (AAM inhibitor cocktail, N =
16 hypoxia, N = 13 hydrogen sulfide). Treatment is on the X-axis, and response is on
the Y-axis as % of the KCl contraction. All panels show mean + SEM, with hypoxia
data in panel a and hydrogen sulfide data in panel b. Significant differences
(different letters) were determined using one-way ANOVA with a Tukey post-hoc,
in addition to a two-tailed Student' s t-test (asterisks). Application of glibenclamide
30 min prior to hypoxia significantly reduced the relaxation phase compared to L-
NAME (a). However, application of inhibitors during the hydrogen sulfide response
did not significantly affect the relaxation phase (b. The control hypoxia relaxation
was significantly greater in magnitude than the control relaxation to hydrogen
sulfide (a vs. b).























a 0 ~


Figure 2-5.


Otrl L-NAME Glib Cocktail Ctrl L-NAME Glib Cocktail


Magnitude of the second contraction phase of the triphasic response of
phenylephrine (1 Clmol/L) pre-contracted rat aorta rings to hypoxia (95% N2/5%
CO2) and hydrogen sulfide (H2S; 300 Clmol/L NaHS or Na2S). Each ring received
one of the following treatments: no inhibitors (Control; N = 20 hypoxia, N = 23
hydrogen sulfide), L-NAME (L-NAME; N = 18 hypoxia, N = 16 hydrogen sulfide),
glibenclamide (Glibenclamide; N = 20 hypoxia, N = 17 hydrogen sulfide), or an
AAM inhibitor cocktail of indomethacin, esculetin and clotrimazole (AAM inhibitor
cocktail, N = 16 hypoxia, N = 13 hydrogen sulfide). Treatment is on the X-axis, and
response is on the Y-axis as % of the KCl contraction. All panels show mean +
SEM, with hypoxia data in panel a and hydrogen sulfide data in panel b. Significant
differences (different letters) were determined using one-way ANOVA with a Tukey
post-hoc. Application of L-NAME and glibenclamide 30 min prior to hypoxia
significantly reduced the second phase contraction (a). Application of the AAM
inhibitor cocktail 30 min prior to hydrogen sulfide significantly reduced the second
contraction phase (b).

















Jr

II -,


0.5 -


0.0 -


-0.5 -


-1.0 -


-1.5 -


-2.0 -


Second


Third


First


Phase
Magnitude of the triphasic response of phenylephrine (1 Clmol/L) pre-contracted rat
aorta rings to hydrogen sulfide (H2S; 300 Clmol/L NaHS or Na2S) with (N = 19) and
without (N = 12) an intact endothelium. Endothelium was removed by rubbing the
inside of the ring with stainless steel wire. Treatment is on the X-axis, and response
is on the Y-axis as % of the KCl contraction. All panels show mean + SEM.
Significant differences (asterisks) were determined using a two-tailed Student' s t-
test. Removal of the endothelium results in a significant reduction of the initial and
second contraction phases to hydrogen sulfide, while it significantly increases the
relaxation phase to hydrogen sulfide.


Figure 2-6.


m + Endo
m Endo









CHAPTER 3
HYDROGEN SULFIDE INCREASES NITRIC OXIDE PRODUCTION FROM
ENDOTHELIAL CELLS BY A PROTEINT KINASE B (AKT)-DEPENDENT MECHANISM

Abstract

Hydrogen sulfide (H2S) and nitric oxide (NO) are both gasotransmitters that can elicit

synergistic vasodilatory responses in the in the cardiovascular system, but the mechanisms

behind this synergy are unclear. In the current study we investigated the molecular mechanisms

through which hydrogen sulfide regulates endothelial NO production. Initial studies were

performed to establish the temporal and dose-dependent effects of hydrogen sulfide on NO

generation using EPR spin trapping techniques. H2S stimulated a two-fold increase in NO

production from endothelial nitric oxide synthase (eNOS), which was maximal 30 min after

exposure to 25-150 Clmol/L hydrogen sulfide. Following 30 min hydrogen sulfide exposure,

eNOS phosphorylation at Ser 1177 was significantly increased compared to control, consistent

with eNOS activation. Pharmacological inhibition of Akt, the kinase responsible for Ser 1 177

phosphorylation, attenuated the stimulatory effect of hydrogen sulfide on NO production. Taken

together, these data demonstrate that hydrogen sulfide up-regulates NO production from eNOS

through an Akt-dependent mechanism. These results implicate hydrogen sulfide in the regulation

of NO in endothelial cells, and suggest that deficiencies in hydrogen sulfide signaling can

directly impact processes regulated by NO.

Introduction

Hydrogen sulfide (H2S) and nitric oxide (NO) are both gasotransmitters that function in

the cardiovascular system (Hosoki et al. 1997; Wang 2003). Recent reports indicate that the NO

and hydrogen sulfide signaling pathways interact on a variety of levels (Geng et al. 2007; Kubo

et al. 2007b; Kubo et al. 2007d; Yong et al. 2008a). Hydrogen sulfide and NO interact

synergistically in vitro, with hydrogen sulfide enhancing NO-mediated relaxation up to 13 fold in









isolated rat aorta (Hosoki et al. 1997), and treatment of Langendorff-perfused Sprague-Dawley

rat hearts with hydrogen sulfide immediately following ischemia confers cardioprotection

through NOS activation (Yong et al. 2008a). In contrast, other in vitro studies indicate that

incubation with hydrogen sulfide decreases NO production in aortic rings (Geng et al. 2007;

Kubo et al. 2007b), cell culture (Geng et al. 2007), and recombinant eNOS (Kubo et al. 2007d).

However, in these studies hydrogen sulfide incubation occurred 1-6 h before measurement of NO

production. Consequently, since hydrogen sulfide is volatile and oxidizes rapidly in the presence

of oxygen and free divalent metals (Tapley et al. 1999), the key effects of hydrogen sulfide in

those studies may have occurred before NO measurement began. In the present study we

investigated the ability of hydrogen sulfide to acutely modulate NO production in the

endothelium, with a specific focus on the mechanism of action.

Materials and Methods

Chemicals

Endothelial cell growth supplement was purchased from Upstate (Temecula, CA USA).

All other chemicals were purchased from Sigma-Aldrich (St. Louis, MO, USA) and were of the

highest quality available, unless otherwise noted.

Bovine Arterial Endothelial Cell Culture

Bovine Arterial Endothelial Cells (BAECs) were cultured in DMEM (1.0 g/L glucose)

supplemented with 10% FBS, 1% penicillin/streptomycin and endothelial cell growth

supplement (5 mg/L). Culture flasks were maintained in a 370 C incubator at 5.0% CO2-

Adherent endothelial cells were grown in 6-well plates for EPR studies and in 100 mm dishes for

western blotting studies.









Hydrogen Sulfide Exposure

Sodium sulfide (Na2S), a hydrogen sulfide donor, was prepared as a saturated stock

solution in distilled water and maintained at 40 C. At this temperature, the concentration of a

saturated solution ofNa2S is 1.72 mol/L. From this stock, hydrogen sulfide dilutions were made

in Krebs buffer, of which 1.0 mL was added per well of a six-well plate, and 3.0 mL was added

per 100 mm Petri dish. The concentration of total hydrogen sulfide (H2S, HS- and S2-) in the

dilutions was determined using a methylene blue assay, with a standard curve generated with

deoxygenated, distilled water and Na2S as the reference (Gilboa-Garber 1971). After 30 min in a

370 C incubator, a 150 Clmol/L hydrogen sulfide solution prepared in Krebs buffer showed no

detectable hydrogen sulfide, indicating virtually complete loss of hydrogen sulfide, presumably

by oxidation and volatilization (data not shown).

Akt Blockade

The Akt inhibitor Triciribine was used to prevent the phosphorylation of eNOS (Dieterle

et al. 2009). Triciribine (5.0 Clmol/L) was added in Krebs buffer 30 min before experiments.

Cells were washed with PBS before and after addition of Triciribine.

Electron Paramagnetic Resonance Detection of Nitric Oxide

Spin-trapping measurements of NO were performed using a BrukerE-scan spectrometer

(BrukerBioSpin Corporation, Billerica, MA USA) with the iron spin trapping complex N-

methyl-D-glucaminedithiocarbamate (Fe-MGD) (Cardounel et al. 2002; Cardounel et al. 2007).

For measurements of NO produced by BAECs, cells were cultured as described above and spin

trapping was performed on cells grown in 6-well plates (1 x 106 CellS/ well). In these studies,

cells attached to the substratum were utilized since scraping or enzymatic removal leads to injury

and membrane damage with impaired NO generation. The medium from each well was removed

and the cells were washed with PBS (phosphate-bu-ffered saline, without CaCl2 Or MgCl2). Next,









0. 15 ml of Krebs buffer containing the NO spin trap FE-MGD (0.5 mmol/L Fe2+, 5.0 mmol/L

MGD), and calcium ionophore (A23187, 1 Clmol/L) was added to each well and the plates were

incubated at 370 C under a humidified environment containing 5% CO2 /95% 02 for 20 min

(Cardounel et al. 2002; Cardounel et al. 2007). Following incubation, the medium from two

wells was removed and pooled as one 0.3 ml sample, frozen in liquid nitrogen and stored at -800

C. This yielded three samples per plate. The frozen NO spin-trap samples are stable, and were

later individually thawed, and trapped NO in the supernatants was quantified using the electron

paramagnetic resonance technique. Spectra recorded were obtained using the following

parameters: microwave power; 20 mW, modulation amplitude 3.16 G and modulation frequency;

100 k
Western Blotting

BAECs from a 100 mm dish were scraped and suspended in 300 Cll

radioimmunoprecipitation assay (RIPA) buffer with Halt protease inhibitor cocktail (Thermo

Fisher Scientific, Rockford, IL USA), placed on ice, and sonicated to lyse the cells and suspend

the protein. The suspension was centrifuged at 12000 x g for 20 min at 40 C and the supernatant

removed, frozen in liquid nitrogen, and stored at -800 C. Western blotting was performed using

commercially-available polyclonal antibodies for eNOS and Ser 1177 eNOS (BD Biosciences,

San Jose, CA USA), monoclonal p-actin (Cell Signaling Technology, Danvers, MA USA) and

secondary antibody conjugated to alkaline phosphatase (Sigma-Aldrich St. Louis, MO USA).

Protein was separated using SDS-PAGE and transferred onto PVDF membrane (Immobilon P,

Millipore, Billerica, MA USA) using a semidry blotter (BioRad, Hercules, CA USA). Using the

Snap-ID system (Millipore, Billerica, MA USA), membranes were blocked in 0.05% non-fat

milk in PBST (PBS with 0.05% Tween-20), washed in PBST and incubated 10 min with










appropriate primary antibodies (diluted 1:333 in PBST). Membranes were then washed in PBST

four times and subsequently incubated 10 min with secondary antibody diluted 1:3,333 in

blocking solution. Membranes were then washed two times in PB ST, once in PB S, and once in

Tris-HCI (100 mmol/L, pH 9.5), after which chemiluminescence substrate was added (DuoLux

substrate, Vector Laboratories, Burlingame, CA USA). Images were captured with a digital

imager (GeneSnap, Syngene,Frederick, MD USA) and were analyzed using commercial software

(Quantity One,BioRad, Hercules, CA USA) to determine band intensity using local background

subtraction.

Statistics

All data were analyzed using one-way ANOVA with Dunnett' s post-hoc test for

significant differences from a control, with alpha < 0.05 considered significant (JMP 7.0, SAS

Institute, Cary, NC USA).

Results

Initial experiments were conducted to establish the time course of hydrogen sulfide effects

on endothelial NO production. BAECs were exposed to the hydrogen sulfide donor Na2S (100

Clmol/L) for 15, 30, 60, 120 and 240 min (Figure 3-1A). At each time point, endothelial-derived

NO production was measured using EPR. Peak NO production was observed at 30 min post

hydrogen sulfide treatment (ANOVA, p < 0.001); at which time mean NO production was

increased by 87%. This effect was not observed at later time points, suggesting a transient

activation of eNOS. To determine the dose-response to hydrogen sulfide, NO production was

measured 30 min after the addition of 5-600 Clmol/L Na2S (Figure 3-1B). Mean NO production

increased by 39-62% at Na2S concentrations between 40-150 Clmol/L (ANOVA, p = 0.001).

The transient nature of the hydrogen sulfide effects on endothelial NO production

suggested a change in eNOS phosphorylation status. Therefore, western blotting was used to









determine the phosphorylation state of eNOS after addition of hydrogen sulfide at 15 and 30 min.

Total eNOS expression was unchanged for all treatments (Figure 3-2A, ANOVA, p = 0.6727),

but after 30 min of incubation in the presence of 150 Clmol/L Na2S, eNOS phosphorylation at Ser

1177 increased by 88% compared to control (Figure 3-2B, ANOVA, p = 0.0031). Furthermore,

the ratio of phosphorylated Ser 1 177 eNOS to total eNOS increased by 148% after 30 min

compared to control (Figure 3-2C, ANOVA, p = 0.0033). To determine whether increased Ser

1177 phosphorylation was responsible for the augmented NO production, BAECs were

pretreated for 30 min with the Akt inhibitor Triciribine (5 Clmol/L), after which the cells were

exposed to 150 Clmol/L Na2S. Triciribine prevented the augmentation of endothelial NO

production (Figure 3-3, ANOVA, p = 0.003 8). These results clearly indicate that hydrogen

sulfide increases endothelial NO production through Akt activation and subsequent increased

phosphorylation of eNOS at Ser 1 177.

Discussion

Although an early study showed a synergistic effect of hydrogen sulfide on NO-induced

relaxation of blood vessel rings (Hosoki et al. 1997), later studies showed that hydrogen sulfide

inhibited eNOS-dependent NO production in aortic rings and cell culture, and from recombinant

proteins (Geng et al. 2007; Kubo et al. 2007b; Kubo et al. 2007d). However, these later studies

measured NO production 1-6 h after hydrogen sulfide addition. Since hydrogen sulfide is volatile

and rapidly oxidizes in the presence of oxygen and free divalent metals (Tapley et al. 1999), we

hypothesized that hydrogen sulfide acts within minutes of its application, and therefore that an

hour or longer delay between hydrogen sulfide application and measurement of NO production

could lead to a failure to detect an hydrogen sulfide effect. Here we demonstrate that hydrogen

sulfide up-regulates NO production from eNOS within 30 min. While we assume hydrogen









sulfide is causing this action, hydrogen sulfide in solution exists as H2S, HS-, and S2-. With the

extracellular ratio of H2S/HS- being between 1:3 and 1:5 and the intracellular ratio being

approximately equal (Olson et al. 2009), it is equally likely that HS- is causing the up-regulation.

To our knowledge, no one has yet definitively demonstrated that only H2S is causing the

observed effects of hydrogen sulfide, as opposed to HS-.

The comparatively rapid action led us to suspect that hydrogen sulfide was stimulating

phosphorylation of eNOS at Ser 1 177 (Mount et al. 2007). We investigated this using western

blotting to detect total eNOS and phosphorylated eNOS. While total eNOS remained constant

for all treatment groups, 30 min exposure to 150 Clmol/L hydrogen sulfide resulted in a

significant increase in both phosphorylated eNOS and the ratio of phosphorylated eNOS to total

eNOS. To confirm that hydrogen sulfide-induced NO production was dependent on eNOS

phosphorylation, we used Triciribine to block phosphorylation of eNOS at Ser 1 177, thereby

inhibiting Akt activation. This prevented the increase in NO production in cells exposed to

hydrogen sulfide, but did not significantly affect NO production in control cells.

These data suggest a novel mechanism of endogenous hydrogen sulfide signaling:

upregulation of NO production via Akt-dependent phosphorylation of eNOS at Ser1177. The

mechanism by which hydrogen sulfide activates Akt remains unknown. However, upstream

regulation of NO production by hydrogen sulfide could represent a novel and potentially

important regulatory mechanism in the control of NO signaling pathways, and could further

implicate defects of hydrogen sulfide signaling in cardiovascular pathologies.


































Crt 5 30 60 90 120 240

Time (min)


B

e
o
o
o

a
p

.n

e
p
o
z


*k


0 5to20 40to 150 300to600

Sulfide Range (CpM)


Figure 3-1.


The effect of H2S on NO production by BAECs. NO production was measured using

EPR spectroscopy. NO values (y-axis) are presented in arbitrary units and have been

normalized to control. Time (A) or hydrogen sulfide concentration range (B) are

shown on the x-axis. Data are shown as mean + SE. Statistical analysis was done

using a one-way ANOVA (p < 0.05) with Dunnett' s post-hoc. An asterisk denotes
values significantly different from control.





Ctrl 15 mn H2S 30 mn H2S


S020



Ll.
DD0s


Control 15 minRS


30 min H,S
T


15 m H2S 30 m H2S


SerilTI


urtuu -lallnlnpp Jvllnlnpp
~


Figure 3-2.


The effect of hydrogen sulfide on eNOS phosphorylation. Protein expression (y-axis,
normalized to p-actin) was measured from BAECs untreated (Ctrl), or exposed to 15
or 30 min of hydrogen sulfide (x-axis). Using western blotting techniques, total
eNOS expression (A), eNOS phosphorylated at Ser 1177 expression (B), and the
ratio of Ser 1177 phosphorylated eNOS/total eNOS (C) were determined. Data are
shown as mean + SE. Statistical analysis was done using a one-way ANOVA (p <
0.05) with Dunnett' s post-hoc. An asterisk denotes values significantly different
from control.





Co


5.

S4-







1-

D
Ctri 15mrnH2S 30 mH2S




Figure 3-2. Continued.
















'1.5-


1.0-


0.5-


0.0
Ctri Ctri + Tri. HS HS + Tr-i.


Figure 3-3.


The effect of Akt inhibition on hydrogen sulfide-stimulated NO production. NO
production was measured using EPR spectroscopy. NO values (y-axis) are presented
in arbitrary units and have been normalized to control. NO was measured from
untreated (Ctrl), Triciribine treated (Ctrl + Tri.), hydrogen sulfide treated (H2S) and
hydrogen sulfide treated with Triciribine (H2S + Tri.). Data are shown as mean & SE.
Statistical analysis was done using a one-way ANOVA (p < 0.05) with Dunnett' s
post-hoc. An asterisk denotes values significantly different from control.









CHAPTER 4
THE HYDROGEN SULFIDE SIGNALING SYSTEM: CHANGES DURING AGINTG AND
THE BENEFITS OF CALORIC RESTRICTION

Abstract

Hydrogen sulfide gas (H2S) has been proposed as an important signaling molecule, but

the effect of age on hydrogen sulfide signaling is unknown. Hydrogen sulfide causes diverse

effects in mammalian tissues, including relaxation in mammalian systemic vessels, and increased

perfusion and bicarbonate secretion in liver. Aging has negative impacts on the cardiovascular

system, whereas the liver is more resilient with age. Caloric restriction (CR) attenuates affects of

age in many tissues. This study investigates the effects of aging and CR on the hydrogen sulfide

signaling system in the aorta and liver of rats by determining the contractile response of aortic

rings to exogenous hydrogen sulfide, the protein and mRNA expression of the hydrogen sulfide

producing enzymes cystathionine y-lyase (CSE) and cystathionine P-synthase (CBS), and

hydrogen sulfide production rates. Tissue was collected from Fisher 344 x Brown Norway rats

from 8-38 months of age, maintained on an ad libitum (AL) or CR diet. Aortic rings exhibited a

triphasi c contract on-rel axati on-contracti on response to hydrogen sulfide. The hydrogen sulfi de-

sensitivity of the first phase contraction increased with age, while the magnitude of all three

phases increased with CR compared to AL. In aorta, CSE protein expression increased with age

on an AL diet, but this increase was attenuated with a CR diet. CBS expression showed the same

trends as CSE, but with lower expression levels. In liver, both CSE and CBS protein expression

remained relatively constant with age. In both aorta and liver, real-time PCR showed no changes

in CSE or CBS mRNA expression with age, but mRNA expression in aorta was higher on a CR

diet compared to AL. In both aorta and liver, hydrogen sulfide production did not change with

age, but did increase with CR. Overall, these data show a significant effect of age and diet on the

hydrogen sulfide signaling system in aorta, whereas liver was relatively unaffected. The









increased contractile sensitivity to hydrogen sulfide and increased protein expression of CSE and

CBS in aorta point to a drop in hydrogen sulfide bioavailability with age. Additionally, CR

seems to benefit CSE and CBS protein in both aorta and liver.

Introduction

Hydrogen sulfide (H2S) functions as a gasotransmitter in the nervous, cardiovascular, and

gastrointestinal systems. Abe and Kimura (Abe et al. 1996) first demonstrated that hydrogen

sulfide is produced in the brain and that it increases N-methyl-D-aspartic acid receptor-mediated

responses and facilitates hippocampal long-term potentiation. Since then a variety of

physiological roles have been proposed for hydrogen sulfide (Lowicka et al. 2007; Szabo 2007),

and at least some capacity for hydrogen sulfide production has been demonstrated in several

vertebrate tissues (Zhao et al. 2003; Olson 2005; Dombkowski et al. 2006; Olson et al. 2006).

When exogenously applied to isolated blood vessels of vertebrates, hydrogen sulfide elicits

responses that range from a monophasic relaxation or contraction, to multiphasic contraction-

relaxation-contraction responses, depending on the phylogenetic class and type of vessel

examined (Dombkowski et al. 2005). In the liver, hydrogen sulfide has been proposed to regulate

perfusion and maintain portal venous pressure, with deficiencies in hydrogen sulfide production

pathways resulting in increases in intra-hepatic resistance (Fiorucci et al. 2005b). Hydrogen

sulfide may also have a role in regulating biliary bicarbonate secretion in the liver (Fujii et al.

2005).

Hydrogen sulfide is endogenously produced from L-cysteine predominantly by the

enzymes cystathionine-y-lyase (CSE) and cystathionine-P-synthase (CBS) (Kimura 2000; Julian

et al. 2002; Wang 2002; Geng et al. 2004b; Fiorucci et al. 2005b; Gainey et al. 2005; Julian et al.

2005b; Kimura et al. 2005). In mammals, CSE and CBS are differentially expressed (Zhao et al.









2001; Zhao et al. 2003). CSE is the enzyme primarily expressed in the cardiovascular system,

whereas CBS is the enzyme primarily expressed in the nervous system (Hosoki et al. 1997; Geng

et al. 2004b; Ebrahimkhani et al. 2005; Kimura et al. 2005). In liver and kidney, CSE and CBS

are both expressed in relatively high amounts compared to other tissues (Fujii et al. 2005;

Lowicka et al. 2007).

Aging influences the action and/or efficacy of many signaling molecules, including

norepinephrine and nitric oxide (NO) (Lakatta 1993; van der Loo et al. 2000; Tanaka et al. 2006)

a gasotransmitter that is much better studied than hydrogen sulfide. A recent study of plasma

hydrogen sulfide concentration in humans over 50-80 years of age reported that hydrogen sulfide

levels may decline with age (Chen et al. 2005), but whether aging affects the hydrogen sulfide

signaling system is unknown. Furthermore, any affect of age on the hydrogen sulfide signaling

system may differ among tissues. For example, whereas the liver is relatively unaffected by age,

substantial physiological changes occur with age in the cardiovascular system, including fibrosis

of blood vessels leading to endothelial dysfunction (Castello et al. 2005), which affects

regulation of blood vessel tone (Kitani 1991; Kitani 1994; Anantharaju et al. 2002).

Caloric restriction (CR) is an intervention that attenuates many effects of aging (Labinskyy

et al. 2006; Leeuwenburgh et al. 2006), including cardiovascular morbidity (van der Loo et al.

2000), cross-linking of cardiac and skeletal muscle proteins (Leeuwenburgh et al. 1997),

mitochondrial dysfunction (Aspnes et al. 1997; Payne et al. 2003), loss of skeletal muscle mass

(van der Loo et al. 2000; Payne et al. 2003), and endothelial dysfunction (Gredilla et al. 2001;

Barja 2002; Gredilla et al. 2004; Castello et al. 2005; Taddei et al. 2006). CR attenuates the age-

related impairment of the NO signaling system (van der Loo et al. 2000; Marin et al. 2007)

(Yang et al. 2004; Minamiyama et al. 2007; Sharifl et al. 2008), but whether CR affects the










hydrogen sulfide signaling system, and whether CR specifically attenuates any affects of age on

the hydrogen sulfide signaling system, are all unknown.

In this study we investigated the effects of aging and CR on the hydrogen sulfide

signaling system in liver and aorta in the Fisher 344 x Brown Norway hybrid rat. Liver and aorta

tissue from rats of various ages were used to investigate CSE and CBS protein and mRNA

expression and hydrogen sulfide production rates. Contraction of aorta smooth muscle was used

as a functional indicator to investigate the effects of age and CR on functional responses to

hydrogen sulfide.

Materials and Methods

Chemicals

All chemicals were purchased from Sigma-Aldrich (St. Louis, MO, USA), unless

specifically noted.

Animals

Fisher 344 x Brown Norway hybrid rats of 8, 14, 18, 23, 27, 34 and 38 months of age were

singly housed under standard conditions and provided with food and water using either the

NIH31 diet ad libitum (AL) or the NIH31-NIA fortified diet at 40% CR. Myography studies

were performed on tissues from animals of 14, 27, and 34 months of age. All other studies were

performed on tissues from animals of 8, 18, 29, and 38 months of age.

Western Blotting

Liver and aorta were removed within 5 min of euthanasia, frozen in liquid nitrogen and

stored at -800 C. Samples were suspended in a lysis buffer consisting of 50 mmol/L Tris base,

2% (w/v) sodium dodecyl sulfate, 10 mmol/L ethylenediaminetetraacetic acid, 10 mmol/L

dithiothreitol, 0.5 mmol/L sodium tetraborate, and 1% (v/v) Halt protease inhibitor cocktail

(Thermo Fisher Scientific Rockford, IL USA). Western blotting was performed using









commercially available monoclonal antibodies for CSE and CBS (Abnova, Neihu District,

Taipei City, Taiwan), a monoclonal antibody for p-actin (Cell Signaling Technology, Danvers,

MA, USA) and a secondary antibody conjugated to alkaline phosphatase (Sigma-Aldrich St.

Louis, MO, USA). Protein was separated using SDS-PAGE and transferred onto PVDF

membrane (Immobilon P, Millipore, Billerica, MA USA) using a semidry blotter (BioRad,

Hercules, CA USA). Using the Snap-ID system (Millipore, Billerica, MA USA) at room

temperature, membranes were blocked in 0.05% non-fat milk in PBST (phosphate-buffered

saline with 0.05% Tween-20), washed in PB ST and incubated 10 min with appropriate primary

antibodies (diluted 1:333 in PBST). Membranes were then washed in PBST four times and

subsequently incubated 10 min with secondary antibody diluted 1:3,333 in blocking buffer.

Membranes were washed two times in PB ST, once in PBS, and once in Tris-HCI (100 mmol/L),

pH 9.5. Chemiluminescent substrate (DuoLux, Vector Laboratories, Burlingame, CA USA) was

used to generate a chemiluminescent signal, which was captured with a digital imager

(GeneSnap, Syngene, Frederick, MD USA). Images were analyzed using commercial software

(Quantity One, BioRad, Hercules, CA USA) to determine band intensity using local background

subtraction.

RNA Extraction

Liver and aorta tissues were disrupted into powder under liquid nitrogen. All samples for

each tissue were processed on the same day. For liver, total RNA was extracted using an Arum

total RNA mini kit (BioRad, Hercules, CA USA). For aorta, total RNA was extracted using Tri

reagent and a glass homogenizer (Kontes Glass, Vineland, NJ USA).

Real-Time PCR

Relative quantitative real time PCR was run in 96-well PCR plates in an Applied

Biosystems 7300 Real-time PCR system (Life Technologies, Carlsbad, CA USA). Primers were









designed using commercial software (Premier Biosoft International, Palo Alto, CA USA) and

synthesized by Integrated DNA Technologies (Coralville, IA USA). The primers used were as

follows: CSE sense 5'- TGGGCTTAGTGTCTGTTAATTCC -3', CSE antisense 5'-

GGCAGCAGAGGTAACAATCG 3', CBS sense 5'- TGCCTGAGAAGATGAGTATG -3',

CBS antisense 5'- GGTCCAGAATGTGAGAATTG 3', Actin sense 5'-

CTCCCAGCACACTTAACTTAG C -3', Actin antisense 5'- AAAGCC

ACAAGAAACACTCAGG 3', 18S rRNA sense 5'- CGAGGAATTCCCAGTAAGTGC -3',

18S rRNA antisense 5'- CCATCCAATCGCTAGTAGCG 3'.For both liver and aorta plates, a

standard curve for the housekeeping genes p-actin (run with CSE samples) or 18S rRNA (run

with CBS samples) was run with a standard curve for the gene of interest (GOI), with all samples

in triplicate. The remainder of the plate was filled with 8 random samples plus 1 calibrator

sample for plate to plate corrections, loaded in triplicate for both the housekeeping gene and the

GOI. Additional plates were run containing the calibrator sample on each plate until all samples

had been processed. All plates for a given tissue-GOI combination were made and run on the

same day, using the same real-time PCR machine.

Hydrogen Sulfide Production

Hydrogen sulfide production was measured essentially as previously described (Stipanuk

et al. 1982; Julian et al. 2002; Dombkowski et al. 2006). Frozen tissues were ground into a fine

powder under liquid nitrogen with mortar and pestle. For each sample, two small scoops (approx

50 mg wet weight) were added to 1.5 mL 100 mmol/L potassium phosphate buffer (pH 7.4) and

homogenized with a Polytron homogenizer (Kinematica, Bohemia, NY USA) for 30-60 s until

the solution was smooth. A 1 mL aliquot of this homogenate solution was then placed in the

outer well of a 25 mL glass flask containing an additional plastic center well (Kontes Glass,









Vineland, NJ USA). The center well was filled with 0.5 mL 1% (w/v) zinc acetate, and a piece of

chromatography paper (Whatman grade 31VMV Chr, Maldstone England) cut 2.5 cm by 4.5 cm

and folded into a fan shape was placed in the well to absorb the zinc acetate. The substrate L-

cysteine (10 mmol/L) and the cofactor pyridoxal-5 '-phosphate (PLP; 2 mmol/L) were added to

the outer well, after which the flask was sealed with a septum stopper and flushed with N2 gaS

for 30 s. Each flask was incubated on a shaker at 37 OC for 1.5 h for liver and 8 h for aorta. After

incubation, 1 mL 50% (w/v) trichloroacetic acid was added to the outer well to stop enzyme

activity and to convert all S2- and HS to H2S. The zinc acetate solution on the chromatography

paper reacts with volatilized H2S to form zinc sulfide, which is relatively stable. The flasks were

then incubated for an additional hour to allow remaining hydrogen sulfide to volatilize and form

zinc sulfide. The filter paper was then removed from the center well and placed in a test tube

containing 3.5 mL of de-ionized water, 0.4 mL 20 mmol/L N,N-dimethyl-p-phenylenediamine

oxalate in 7.2 mol/L HCI and 0.4 mL of 30 mmol/L FeCl3 in 1.2 mol/L HC1. The test tubes were

gently vortexed and incubated for 20 min at room temperature. Absorbance of the solution in the

test tube was read at 670 nm with a plate reader (BioTek Instruments, Inc., Winooski, VT USA).

Samples with an absorbance greater than 2 were diluted 10-fold with distilled water and the

absorbance re-measured. Absorbance measurements were calibrated against a standard curve

generated from NaHS in deoxygenated, de-ionized water added to the outside wells, incubated at

37 OC for 1.5 h, and assayed as above. To ensure that all measured hydrogen sulfide production

is by tissue enzymes, several controls were run in addition to sample homogenates: a negative

control of homogenate but no cofactors or substrate; and a blank of all cofactors and substrate in

phosphate buffer, but without homogenate. Inhibitors of CSE (20 mmol/L propargylglycine,

Pgly) and CBS (1 mmol/L aminooxyacetic acid, AOAA) were added to confirm the hydrogen









sulfide production was through these, and not alternate pathways (Julian et al. 2002). Protein

concentration was quantified with a NanoDrop 1000 (Thermo Fisher Scientifie, Waltham, MA

USA), to calculate nmol hydrogen sulfide production per hour per mg protein.

Myography

The effect of hydrogen sulfide on vascular tone was measured in 5mm long aorta rings

from 41 animals, with 5 to 8 rings tested for each age x diet treatment combination. To reduce

artifact from anesthesia (Dombkowski et al. 2005), euthanasia was by guillotine under IACUC-

approved methods. After dissection, aorta was cleaned of fat and connective tissue, and

myography was performed essentially as previously described (Dombkowski et al. 2005). Rings

were attached with stainless steel wire to force transducers and mounted in a 370C tissue bath

system (Radnoti Glass Technology, Monrovia, Ca USA) containing Kreb's bicarbonate buffer.

Rings were allowed to equilibrate after mounting for a minimum of 1 h, and a baseline tension of

1.5 g was maintained throughout each experiment. At the start of an experiment, each ring was

maximally contracted with two additions of 80 mmol/L KC1. After washing with Kreb's buffer

and returning to baseline tension, the rings were incubated with 10 Clmol/L propranolol (to block

P-adrenergic receptor relaxation and maximize ot-adrenergic receptor contraction), and

precontracted with 1 Clmol/L norepinephrine (NE). After the NE precontraction stabilized, rings

were exposed to 100 Clmol/L hydrogen sulfide. After 30-45 min, the tissue bath was drained and

the rings were washed twice with Kreb's buffer and allowed to return to baseline tension. This

sequence of propranolol, NE and hydrogen sulfide addition was repeated for 300, 600 and 900

Clmol/L hydrogen sulfide. Data for hydrogen sulfide-induced contractions for each aortic ring

were standardized to the weight of the ring.










Actual total hydrogen sulfide concentrations, as measured by a methylene blue assay

(Gilboa-Garber 1971), were approximately 75% of the predicted value (presumably due mostly

to oxidation). Note that in physiological saline at pH 7.4, the dissociation of hydrogen sulfide

results in approximately 1/3 of total hydrogen sulfide as H2S and 2/3 as HS- (Beauchamp et al.

1984).

Statistics

All statistics were run using JMP statistical software, (JMP 7.0, SAS Institute, Cary, NC

USA) with alpha < 0.05 considered significant. Two-way ANOVAs were run with a Tukey post-

hoc test, when possible. However, the functional response data were not always normally

distributed, and therefore violated the assumptions of the ANOVA. In those cases, significant

effects of age and diet were tested using the Kruskal-Wallis nonparametric ANOVA. When

fewer than three groups were compared, pooled (two-tailed) or one-tailed t-tests were used. For

real-time PCR, statistics were done on the average Ct of each sample, since the Cts are normally

distributed (Wood et al. 2005). Statistical tests are listed throughout preceding their respective p-

values.

Results

CSE and CBS Protein Expression

The relative expression of CSE and CBS protein differed between aorta and liver. In

aorta, CSE protein expression (relative to p-actin) was 1.43-fold higher than CBS protein

expression on average, whereas in liver, CBS protein expression (relative to p-actin) was 1.18-

fold higher than CSE protein expression, on average.

In both aorta and liver, CSE protein expression was significantly affected by an

interaction between age and diet (Figure 4-1A and 4-1B). In aorta, CSE protein expression









increased with age in AL animals, but it was unchanged with age in CR animals (Figure 4-1A,

bars; 2-way ANOVA with Tukey post-hoc, p < 0.0001). At ages 18, 29, and 38 months CR CSE

protein expression was significantly lower than AL at those ages, and was not significantly

different than CSE expression at 8 months on either a CR or AL diet (Figure 4-1A, asterisks). In

liver, CSE protein expression was unchanged with age in AL animals, but increased with age in

CR animals (Fig 4-1B, bars; 2-way ANOVA with Tukey post-hoc, p = 0.0041). At 38 months of

age AL CSE protein expression was significantly lower than CR (Figure 4-1B, asterisks).

In aorta but not liver, CBS expression was also significantly affected by an interaction

between age and diet (Figure 4-1C and 4-1D). In aorta, there was significantly higher CBS

protein expression in AL animals at 38 months compared to CR animals (Figure 4-1C, asterisks;

2-way ANOVA with Tukey post-hoc, p = 0.0056). In liver, there was no significant difference in

CBS expression at any age, and there was no effect of CR (Figure 4-1D, 2-way ANOVA, p >>

0.05).

CSE and CBS mRNA Expression

There were no interactions between age and diet on the mRNA expression of CSE and

CBS in aorta or liver (Figure 4-2). In aorta, the CR diet significantly increased expression of both

CSE mRNA (Figure 4-2A, one-tailed t-test, p = 0.0013) and CBS mRNA (Figure 4-2C, one-

tailed t-test, p = 0.0258) when compared to the AL diet. In liver, diet did not affect the

expression of either CSE mRNA (Figure 4-2B, one-tailed t-test, p >> 0.05) or CBS mRNA

(Figure 4-2D, one-tailed t-test, p >> 0.05).

Hydrogen Sulfide Production

There were no interactions between age and diet on capacity for hydrogen sulfide

production in aorta or liver (Figure 4-3), but the capacity for hydrogen sulfide production was

affected by diet. In aorta and liver hydrogen sulfide production was higher in tissues of CR









animals than AL animals (Figure 4-3A, one-tailed t-test, p = 0.0407 and Figure 4-3B, one-tailed

t-test, p = 0.041 1, respectively). Inhibitors of PLP-dependent enzymes were added to confirm

hydrogen sulfide production was not occurring through PLP-independent mechanisms. Addition

of the CSE inhibitor Pgly (20 mmol/L) decreased hydrogen sulfide production by 50% in aorta

and by 94% in liver (data not shown), whereas addition of the CBS inhibitor AOAA (1 mmol/L)

decreased hydrogen sulfide production by 57% in aorta and by 81% in liver (data not shown).

Contractile Response to Hydrogen Sulfide in Aorta

Application of hydrogen sulfide to isolated aorta rings typically elicited a triphasic,

contraction-relaxation-contraction response (Figure 4-4). The contraction in the third phase was

larger in magnitude and longer lasting than the contraction in the first phase, but at the lowest

hydrogen sulfide concentration used (100 Clmol/L) the response was typically very weak or

absent.

Age did not affect the response to KCl or norepinephrine (Figure 4-5A and 4-5B, One-way

ANOVA, p >> 0.05 for both), but age did have a significant effect on the first phase of the

triphasic response to hydrogen sulfide. The first phase contraction was stronger in rings from 34

mo rats than from 14 mo rats after application of 100 Clmol/L hydrogen sulfide (Figure 4-5C,

one-way ANOVA with Tukey post-hoc, p = 0.0062). However, the first phase contraction to

300-900 Clmol/L hydrogen sulfide did not significantly increase with age (Figure 4-5D, Kruskal-

Wallis ANOVA, p >> 0.05 for all). The second phase relaxation showed a significant effect of

age after application of 100 Clmol/L hydrogen sulfide (data not shown, Kruskal-Wallis ANOVA,

p = 0.03 8). However, post-hoc testing with a Wilcoxon non-parametric t-test between groups did

not show significant differences between the ages (p >> 0.05 for all). The third phase contraction

was not significantly affected by age (data not shown, Kruskal-Wallis ANOVA, p >> 0.05 for

all).










Overall, CR had a significant effect on all phases of the contract-relax-contract response to

hydrogen sulfide. Furthermore, the KCl and NE contractions were significantly stronger in rings

from CR rats than from AL rats (Figure 4-6A and 4-6B, one-tailed t-test, p = 0.0282 and <

0.0001, respectively). Compared to rings from AL rats, CR increased the magnitude of the first

phase contraction after application of 300 900 Clmol/L hydrogen sulfide (Figure 4-7A, pooled t-

test, p = 0.0006, p = 0.0079 and 0.0192, respectively), the magnitude of the second phase

relaxation after application of 300 and 600 Clmol/L hydrogen sulfide (Figure 4-7B, one-tailed t-

test, p = 0.0492 and Wilcoxon test, p = 0.0027, respectively), and the magnitude of the third

phase contraction after application of 300 900 Clmol/L hydrogen sulfide (Figure 4-7C, pooled t-

test, p < 0.0001, p = 0.0025, and p = 0.0008, respectively).

Discussion

CSE and CBS Protein Expression

In aorta, CSE expression increased with age on an AL diet, but remained constant on a

CR diet. Aorta CBS expression showed a similar trend, but with lower expression levels. CBS

expression was increased at age 38 months for AL animals, while CR animals had significantly

lower CBS expression at 38 months. It is perhaps not surprising that changes with age were more

evident for CSE than for CBS, since CSE is the expressed at higher levels in the endothelium and

smooth muscle cells of aorta and is also believed to have the most functional contribution to

regulating vascular tone (Hosoki et al. 1997; Zhao et al. 2001; Zhao et al. 2003; Wang et al.

2008). Therefore, CSE would be the more likely of the two enzymes to exhibit measurable

effects of age and diet. We have been able to measure CBS protein in aorta even though previous

researchers were only able to detect CSE mRNA and concluded there was no CBS in these

tissues (Hosoki et al. 1997; Zhao et al. 2001). However, the protein expression level of CBS was










much less than that of CSE, consistent with the assumption that CBS has a less important role in

the vasculature.

In aorta, the increase in CSE expression with age is similar to changes reported with age in

eNOS expression in peripheral arteries (Cernadas et al. 1998; van der Loo et al. 2000; Goettsch

et al. 2001; van der Loo et al. 2005), in which eNOS increased up to sevenfold with age. This

was attributed to a homeostatic attempt to correct for a decrease in the bioavailability of NO

caused by superoxide reacting with NO to form a peroxynitrite (van der Loo et al. 2000; van der

Loo et al. 2005). Since NO and hydrogen sulfide have been reported to interact synergistically,

changes in one system may impact the other (Hosoki et al. 1997; Wang et al. 2008).

Additionally, hydrogen sulfide may also react with, and be quenched by, increasing peroxynitrite

levels resulting from NO reacting with superoxide (Whiteman et al. 2004b). Furthermore, there

is limited evidence that hydrogen sulfide reacts with superoxide, which may also directly impact

hydrogen sulfide bioavailability (Geng et al. 2004a). CR has been hypothesized to prevent this

age-related endothelial dysfunction by preventing increases in superoxide levels with age,

thereby maintaining a more youthful state (Gredilla et al. 2001; Barj a 2002; Gredilla et al. 2004;

Castello et al. 2005; Taddei et al. 2006). Accordingly, CSE and, to a lesser extent, CBS

expression in CR animals did not significantly increase with age and were more similar to 8

month old AL animals, consistent with a protective effect of CR in aorta maintaining a youthful

state.

In liver, CSE expression increased with age in CR animals whereas CBS expression did

not change with age. Since both CBS and CSE are involved in cysteine metabolism in addition to

producing hydrogen sulfide (Zhao et al. 2001), they are present in relative abundance in the liver

compared to other tissues. However, CBS is the primary hydrogen sulfide producing enzyme in









the liver (Zhao et al. 2003), and therefore the increase in CSE expression with age may not

accurately reflect what is occurring to hydrogen sulfide levels as well as CBS expression does.

Liver enzymatic capacity does not change substantially with age, and this also appears to be true

for CBS (Kitani 1991; Kitani 1994; Anantharaju et al. 2002). Since the liver is functionally much

different than aorta, it is perhaps not surprising that age and diet do not affect the liver to the

same degree as the aorta.

The heterogeneity between tissue types observed between aorta and liver also occurs in the

NO signaling system. Even when comparing peripheral vessels to heart tissue in the circulatory

system, changes are seen in the vasculature even though no significant changes are observed in

the heart (van der Loo et al. 2005). Therefore, the age and diet affects on the hydrogen sulfide

signaling system may not be global events that occur during aging, but rather tissue-specific

effects.

CSE and CBS mRNA Expression

There were complex and dramatic changes with age and diet in CSE protein expression in

aorta and liver. There were no significant changes in the mRNA message for CSE or CBS with

age, although CR did increase CSE and CBS mRNA levels in aorta. This seems to contradict the

protein expression, in which CR reduced the expression of those proteins. Conversely, liver CSE

and CBS mRNA message did not significantly change with age or diet, which was more

consistent with the protein data. We cannot account for the discrepancy between mRNA and

protein data, except to note that mRNA message does not always translate directly into protein

(Gygi et al. 1999). We must conclude that while CR causes increases in mRNA for CSE and

CBS in the vasculature, this does not translate into the synthesis of more new protein.

Alternatively, CR may attenuate the need for new protein formation, but does not stop the

synthesis of mRNA, leading to the observed increase in mRNA expression.









Hydrogen Sulfide Production

Extracellular concentrations of total hydrogen sulfide (representing the sum of H2S, HS~

and S2-) have been reported in the range of 50-160 Clmol/L in the brain (Goodwin et al. 1989;

Abe et al. 1996) and ~50 Clmol/L in the plasma (Zhao et al. 2001). However, recent

measurements in plasma seem to indicate that true hydrogen sulfide concentrations are much

lower (<100 nmol/L) (Whitfield et al. 2008). This discrepancy is likely due to methodological

differences in how free hydrogen sulfide is differentiated from that which is bound or "acid-

labile" (Olson 2009).

Homogenates of aorta and liver both produced a consistent amount of hydrogen sulfide

regardless of age, but CR samples consistently showed a higher hydrogen sulfide production

rate. This is particularly interesting for the aorta, because our data indicate that it had lower

levels of the hydrogen sulfide producing enzymes. Therefore, it can produce more hydrogen

sulfide than the AL samples that have significantly more hydrogen sulfide producing enzymes.

Note that because the data were calculated as nmol hydrogen sulfide/hr/mg protein, production

rates for aorta and liver were very similar. When hydrogen sulfide production is instead

calculated as nmol hydrogen sulfide/hr/g tissue or nmol hydrogen sulfide/hr/ml ofhomogenate,

liver has a higher production rate than aorta.

Addition of AOAA and Pgly reduced hydrogen sulfide production in both aorta and liver,

but did not completely block production. This indicates that both CSE and CBS contribute to

hydrogen sulfide production in these tissues, but there may be a small contribution of"acid

labile" hydrogen sulfide contributing to these production rate measurements. It is important to

note that the recovery rate of hydrogen sulfide using the assay is not 100%, and is more likely

33-59% depending on the hydrogen sulfide production rate of the tissue (Julian et al. 2002).









Therefore, these rates should only be used as a comparison between the treatment groups in this

study and not as an absolute rate of hydrogen sulfide production from aorta and liver in the rat.

Contractile Response to Hydrogen Sulfide in Aorta

Although triphasic responses to hydrogen sulfide application have been reported in rat

pulmonary artery (Olson et al. 2006), previous studies of rat aorta have shown only a

monophasic relaxation or contraction with hydrogen sulfide (Zhao et al. 2002; Dombkowski et

al. 2005; Kubo et al. 2007b). We found that the development of all three phases typically

required 15-30 min to develop after a bolus of hydrogen sulfide. Consequently, the triphasic

response may have been masked in previous studies that did not allow sufficient time after

hydrogen sulfide addition. Additional methodological variations, such as tissue preparation (ring

vs. strip), method of euthanasia, and lag time between tissue dissection and hydrogen sulfide

application, may have also contributed to differences in aorta response.

It has been suggested that high 02 COncentrations in the tissue bath may lead to formation

of vasoactive hydrogen sulfide oxidation products (Koenitzer et al. 2007). Since our

experiments were run at ambient Ol COncentrations, oxidation products may have contributed to

the triphasic response. However, in dorsal aorta of cyclostomes hydrogen sulfide-induced

contractions are enhanced at low 02 COncentrations, suggesting that hydrogen sulfide oxidation

products are not the only cause of hydrogen sulfide-induced contractions (Olson et al. 2008).

Additionally, in rat aorta rings we see the same triphasic response during hypoxia (Dissertation

Chapter 2). This response to hypoxia is presumably mediated in part by hydrogen sulfide that is

not readily oxidized due to the extremely low oxygen levels (Olson et al. 2006).

Our data indicate that the response of rat aortic rings to hydrogen sulfide increases in

magnitude with age, with significant changes observed in the first phase contraction. The

triphasic response in aorta has not been reported previously, and it is not known what causes the









initial contraction phase. A likely candidate is the reaction of hydrogen sulfide with NO to form

a nitrosothiol (Whiteman et al. 2006), which has been suggested to reduce free NO and lead to

contraction at low levels of hydrogen sulfide (Ali et al. 2006), whereas higher hydrogen sulfide

concentrations may cause relaxation by activating KATP channels (Zhao et al. 2001). It is likely

that after application of the hydrogen sulfide donor, NO reacts quickly with hydrogen sulfide

causing contraction, which is followed by relaxation as KATP channels are activated. We have

shown evidence of this in aorta during hypoxia-induced responses (Chapter 2). If indeed this

NO-scavenging mechanism does mediate the first phase contraction, then the reduced

bioavailability of NO observed with age (Cernadas et al. 1998; van der Loo et al. 2000; Goettsch

et al. 2001; van der Loo et al. 2005) could cause the increase in sensitivity to hydrogen sulfide.

That is, the less free NO is available, the larger the effect on vascular tone for a given amount of

hydrogen sulfide.

Caloric restriction dramatically increased the response to hydrogen sulfide in all three

phases, as well as the response to KC1. Therefore, rather than representing a global effect on

hydrogen sulfide -signaling, the effect of CR may represent an overall enhancement of smooth

muscle tissue health, as has been reported in skeletal muscle (Payne et al. 2003),.

Conclusions

Our data show that age affects the hydrogen sulfide signaling system in the aorta, on both

the contractile response to hydrogen sulfide and the protein expression of CSE. Aorta responds

to hydrogen sulfide with a triphasic contract-relax-contract response, which becomes sensitized

to hydrogen sulfide with age. There was no age effect in the liver on the main hydrogen sulfide

producing enzyme CBS. CR benefits the hydrogen sulfide signaling system in the aorta. All

phases of the triphasic response were enhanced by CR, and CR maintained lower expression of

CSE and CBS proteins, which could produce more hydrogen sulfide than AL animals. CR has no










significant affect on CBS protein expression in the liver. Overall, aorta shows the most impact of

age and CR. While the effects of CR are likely due to maintenance of healthier tissue/proteins,

the sensitization with age on hydrogen sulfide signaling in aorta may owe to impacts of age on

NO. Therefore, the interactions of H2S, NO and CO are key to fully elucidating the ramifications

of these changes.
















III irr~l~ ~i~l: iYI~111~


51 Jr






2-1 1 I Jr


8 18 29 38 8 18 29 38

Age (mo)




41S lP


3-k


2-k


8 18 29 38


8 18 29 38


Age (mo)


8 18 29


38 8 18 29 38


8 18 29 38 8 18 29 38

Age (mo)


Age (mo)


Figure 4-1.


Effect of age and diet on CSE and CBS protein expression. CSE expression is shown

in aorta (A) and liver (B). CBS expression is shown in aorta (C) and liver (D). The

Y-axis shows CSE (A and B) or CBS (C and D) protein expression relative to P-

actin. The X-axis shows the age in months (mo). AL data are in white columns and

CR data are in grey columns. Representative blots are aligned along the top, above

each column. Data are represented as mean + SE and were analyzed by 2-way

ANOVA with Tukey post-hoc tests. Means that are significantly different are

indicated by different letters.


9



4-


A
~


B
a,
m
a,
[li
r
.P
cn
cn
a,
n
x
w









C
r


g
a,

a,
rr
r
o


a,
n
x
w


~ltc, -Ly II Uj~~lL)




I


k


k

* *
3;





























O'


AL


D7
i
I~
ct 6

85
a,
e4
a,
[LI 3
r
o
2
n
rl


AL CR


Diet


Figure 4-2.


Effect of diet on CSE and CBS mRNA expression. CSE expression is shown in aorta

(A) and liver (B). CBS expression is shown in aorta (C) and liver (D). The Y-axis
shows CSE (A and B) protein expression relative to p-actin and CBS (C and D)

protein expression relative to 18S rRNA. The X-axis shows the diet. AL data are in
white columns and CR data are in grey columns. Data are represented as mean + SE
and were analyzed by one-tailed t-tests. Means that are significantly different are
indicated by asterisks.


AL

Diet












S018 E3 020
rs) 016 -1 1 r

01 015-
E 012 -E
S 010 -

S006 -P
S004 0
S002- -
0 00 000
AL CR AL CR

Diet Diet

Figure 4-3. Effect of diet on hydrogen sulfide production. Hydrogen sulfide production rates are
shown in aorta (A) and liver (B). The Y-axis shows production as nmol H2S/hr/mg
protein. The X-axis shows the diet. AL data are in white columns and CR data are in
grey columns. Data are represented as mean + SE and were analyzed by one-tailed t-
tests. Means that are significantly different are indicated by asterisks.


















H2S


Figure 4-4. Representative tension tracing of a rat aorta ring pre-contracted with norepinephrine
(NE) and exposed to hydrogen sulfide (H2S, 300 Clmol/L). Scale bar shows time in
min and tension in grams.


60 sec

































100 umol/L 300 umol/L 600 umol/L 900 umol/L












14 27 34 14 27 34 14 27 34 14 27 34

Age (months)


A 0.4

8 0.3


.9 0.2

0
0 0.1


0.0







S0.20



P 0.15





0.05 -


S0.20


8 0.15
E

.P 0.10





0.00


14 27 34

Age


14 27 34


D 0.5

0.4 .

E 0.3-

.9 0.2

S0.1 -


Figure 4-5.


Effect of age on KCl- and norepinephrine (NE)-induced contractions and the first
phase contraction to hydrogen sulfide. Age has no effect on KCl- (A) or NE-induced
contractions (B). However, the first phase contraction to hydrogen sulfide (C)
significantly increases with age at 100 Clmol/L hydrogen sulfide addition. The first
phase contractions did not significantly increase at 300-900 Clmol/L hydrogen sulfide
addition (D). The Y-axis represents the hydrogen sulfide-induced tension of aortic
rings (g/mg). The X-axis shows the age (mo) (A-C) for each of the four hydrogen
sulfide concentrations, divided into four panels (D). The top labels represent the
concentration of hydrogen sulfide used for that panel (D). Data are presented as
means + SE (A-C) or as box plots showing the median, quartiles and outliers (D).
Data were analyzed by one-way ANOVA with Tukey post-hoc test. Means that are
significantly different are indicated by letters.













A 0.4


B 0.20


Ei 0.3 -
E

S0.2 -


0 0.1 -


0.0





Figure 4-6.


9 0.15


S0.10


O 0.05


0.00
AL CR AL CR
Diet Diet


Effect of diet on KCl-and norepinephrine (NE)-induced contractions. CR causes an
increase in contraction magnitude in response to KCl (A) and NE (B). The Y-axis
represents the tension of aortic rings (g/mg). The X-axis represents age diet: ad
libitum (AL) or caloric restricted (CR). AL data are in white columns and CR data
are in grey columns. Data are represented as mean + SE and were analyzed by one-
tailed or pooled t-tests. Means that are significantly different are indicated by
asteri sks.






















































Effect of diet on hydrogen sulfide-induced contractions. CR causes an increase in
contraction magnitude in response to hydrogen sulfide in the first phase contraction
(A), second phase relaxation (B) and third phase contraction (C). The Y-axis
represents the hydrogen sulfide-induced tension of aortic rings (g/mg). The X-axis
represents diet: ad libitum (AL, white) or caloric restricted (CR, grey) for each of the
four hydrogen sulfide concentrations, divided into four panels. The top labels
represent the concentration of hydrogen sulfide used for that panel. Data are
presented as medians, with error bars defining upper and lower quartiles. Data were
analyzed by one-tailed or pooled t-tests. Medians that are significantly different are
indicated by asterisks.


AL CR AL CR AL CR AL CR
Diet



100 umol/L 300 umol/L 600 umol/L 900 umol/L




-e J


-S~P"


100 umol/L 300 umol/L 600 umol/L 900 umol/L


0.5


S0.3

S0.2











- 0.3

-0.4






-0.5


AL CR AL CR AL CR
Diet


AL CR


Figure 4-7.

















C 0.7 100 umol/L 300 umol/L 600 umol/L 900 umol/L
0.6
8i 0.5

'8 0 4


0.3




AL CR AL CR AL CR AL CR

Diet


Figure 4-7. Continued.









CHAPTER 5
SYNTHESIS: UNDERSTANDING HYDROGEN SULFIDE SIGNALING IN VASCULAR
SMOOTH MUSCLE AND THE TRIPHASIC RESPONSE

Introduction

Through this work on hydrogen sulfide signaling it has become clear that there are many

pathways (potentially) involved in the vascular response. Some of these pathways have been

elucidated, others have not. When investigating in vessel preparations, predominantly aorta in

these studies, there is a distinct multiphasic contraction-relaxation-contraction response after

application of hydrogen sulfide to the tissue bath that takes 2-3 times longer than a maj ority of

the hydrogen sulfide actually remains in solution. Therefore hydrogen sulfide is most likely

activating a variety of pathways initially, which in turn modulate the phases after hydrogen

sulfide has been oxidized in the solution.

We also observe a similar contraction-relaxation-contraction response pattern in aorta rings

exposed to hypoxia. It has been hypothesized that hydrogen sulfide is mediating the hypoxia

response because hypoxia will allow the accumulation of hydrogen sulfide in tissues since there

is little oxygen to oxidize it. However, the time course is much slower in hypoxia responses, and

the mechanisms may not be the same.

Hydrogen sulfide also has a demonstrated effect on nitric oxide (NO) production from

endothelial nitric oxide synthase (eNOS). Within 30 min of application, hydrogen sulfide causes

an Akt-dependent increase in NO production via phosphorylation of Ser 1177 on eNOS. This

finding fits within a developing theme in the literature on gasotransmitters; that hydrogen sulfide

and NO having a synergistic relationship (Hosoki et al. 1997; Kimura 2002; Julian et al. 2005b;

Jeong et al. 2006). NO has also been demonstrated to increase hydrogen sulfide production from

cystathioniney-lyase (Zhao et al. 2001; Zhao et al. 2003). Therefore, another signal must be

present to quench their production, such as a feedback inhibition, or carbon monoxide (CO),









which can inhibit iNOS (Oh et al. 2006). However, hydrogen sulfide and NO can also chemically

interact to form a nitrosothiol, so they may quench each other' s signal as a form of regulation.

Age does change the initial contraction phase of the triphasic response to hydrogen

sulfide, and this is likely due to this contraction being partially mediated by the reaction of

hydrogen sulfide with NO, reducing free NO levels. The mechanisms underlying the initial

contraction phase are discussed further below. Caloric restriction (CR) is an intervention that

appears to reduce the increase in oxidative stress that occurs with age, which includes increased

superoxide production. For the aging studies, we hypothesized that CR would ameliorate any

changes we saw with age. While this was true in the case of cystathioniney-lyase (CSE) and

cystathioninep-sythase (CBS) protein expression, it was not true of the functional response

measurements (smooth muscle tone) in aorta rings. Here we observed an increase in

responsiveness to all stimuli: KC1, norepinephrine, and hydrogen sulfide. It is believed that CR

enhances the contractile function of smooth muscle, as is the case in skeletal muscle (Payne et al.

2003), and that this explains the increased general responsiveness. Therefore it is not a hydrogen

sulfide-specific effect, but rather a global benefit of the CR intervention.

What is Modulating Phase 1 of the Triphasic Response?

The chemical reaction between NO and hydrogen sulfide likely contributes to the initial

contraction phase by quickly reducing NO bioavailability (Whiteman et al. 2006; Whiteman et

al. 2009). However, since removal of the endothelium from the aorta rings does not completely

block the initial contraction phase from occurring, loss of NO bioavailability does not entirely

explain what happens at this initial contraction. If this phase were completely NO-dependent,

then removal of the endothelium, eNOS would be removed with the endothelium, and therefore

the initial contraction should be completely abolished because there should be no NO to









scavenge. This also assumes that there would be no iNOS activity in smooth muscle. Application

of the eNOS inhibitor L-NA1VE produced mixed results, depending on how it was added

experimentally. Adding L-NAME prior to the PE precontraction and adjusting the tension after

its application (to maintain 1.5 g tension) does not significantly reduce the initial contraction

phase to hydrogen sulfide, further supporting the proposition that the reaction with NO is not

solely responsible for causing this initial contraction. However, adding L-NAME after the PE

precontraction and allowing the ring to further constrict (but not beyond the maximum tension

developed by KC1) did significantly reduce the initial contraction when hydrogen sulfide was

added. L-NAME also significantly reduced the initial contraction phase to hypoxia when added

before the PE precontraction. This suggests that the initial contraction to hypoxia may be more

dependent on NO/NOS than hydrogen sulfide, and that hydrogen sulfide may not play a large

role in hypoxia signaling during this initial contraction phase.

The partial dependence of hydrogen sulfide on NO during the initial contraction is

consistent with the observation that the initial contraction increases in sensitivity with age.

Bioavailable NO declines with age due to increases in formation of superoxide, which can

scavenge NO to form a peroxynitrite (van der Loo et al. 2000). If hydrogen sulfide is reducing

bioavailable NO as well as by chemically reacting with it, then more hydrogen sulfide would be

needed to reduce the NO pool in younger animals compared to older animals. Looking at this

another way, comparing small and large NO pools, if one were to add the same amount of

hydrogen sulfide to both pools, the smaller pool will show a larger effect than the larger pool

because the proportion of NO removed would be greater.

What is Modulating Phase 2 of the Triphasic Response?

The relaxation of blood vessels and smooth muscle in general, to hydrogen sulfide has an

accepted mechanism. Patch-clamping studies show that hydrogen sulfide activates ATP-sensitive









potassium channels (KATP) (Zhao et al. 2001; Zhao et al. 2002). Although it remains to be

determined how this activation occurs, it is most likely a direct interaction with the channels

rather than changing the ADP/ATP status (Whiteman et al. 2009). Using glibenclamide, a KATP

inhibitor, we have not been able to statistically show that these channels are causing the

relaxation in our observed triphasic response. It is clearly not endothelium-dependent, since

removal of the endothelium does not affect the relaxation phase, and neither does adding L-

NAME before addition of hydrogen sulfide. Other investigators have been unable to

satisfactorily show the action of KATP channels in the relaxation caused by hydrogen sulfide, and

others have proposed that KATP Only partially mediates the relaxation (Kubo et al. 2007b).

We initially assumed that the discrepancy is related to dosage of glibenclimide. Our initial

studies used glibenclimide dosages that were comparatively high, which may affect not only

KATP, but chloride channels as well. Interestingly, this same dose did significantly reduce the

relaxation observed during hypoxia responses, while only causing a small, non-significant

decrease in the hydrogen sulfide treatments. This raises the question of what concentrations of

hydrogen sulfide are present during hypoxia, if at all? While a hydrogen sulfide-sensitive

electrode exists, no researchers have yet been able to perform these measurements. Therefore,

the true mechanism of the relaxation phase remains unknown, but it is likely at least partially

through KATP.

Recently however, a new mechanism of relaxation induced by hydrogen sulfide has been

uncovered: the Cl-/HCO3~ aniOn exchanger (Kiss et al. 2008). I performed preliminary

experiments with an anion channel blocker, 4,4'-Dii sothiocyanatostilbene-2,2'-di sulfonate

(DIDS), to inhibit this exchanger. When adding DIDS, there was a complete blockade of the

relaxation phase in the response to hydrogen sulfide. Therefore, it is quite likely that these anion









exchangers are activated by hydrogen sulfide. This activation would lead to a reduction in

intracellular pH (Lee et al. 2007), which in itself will cause relaxation of the smooth muscle and

may also activate KATP channels leading to the observed relaxation phase to hydrogen sulfide

(Kiss et al. 2008).

What is Modulating Phase 3 of the Triphasic Response?

The third phase contraction is almost certainly not directly mediated by hydrogen sulfide,

and is likely endothelially-derived. This conclusion is drawn simply from the oxidation rate of

hydrogen sulfide from the tissue bath compared to the time this contraction phase starts.

Hydrogen sulfide will be at least 50% oxidized by ten minutes after application. By fifteen

minutes, which is the point at which the third phase contraction usually begins, most of the

hydrogen sulfide will have disappeared. Additionally, removal of the endothelium significantly

reduces the third phase contraction. It is likely, then, that hydrogen sulfide is causing a change in

the concentration of another vasoactive agent produced in the endothelial cells. When we

investigated the contribution of arachadonic acid metabolites (AAM) by inhibition of

cyclooxygenase, lypoxygenase, and cytochrome P-450, we saw a significant reduction in the

third phase contraction when all three enzymes were inhibited. Which AAM is causing this

contraction remains to be elucidated, but it is likely a combination since inhibition of

cyclooxygenase, lypoxygenase and cytochrome P-450 individually did not significantly reduce

the third phase contraction. Interestingly in this case, the third phase contraction to hypoxia was

not reduced with inhibition of AAM, suggesting another difference between the two signaling

events .

A Proposed Time-course and Mechanism of the Triphasic Response

We can now attempt to piece together a model of the chain of events that occurs in a

blood vessel (in this case a precontracted ring of rat thoracic aorta) following the addition of










hydrogen sulfide. Upon addition of Na2S, it rapidly dissociates into H2S gas and HS-. The H2S

diffuses into the aorta ring and the vascular smooth muscle cells (VSMC). Here H2S comes into

contact with free NO, and reacts to form a nitrosothiol (a vasoactive molecule in itself which

may go on to cause downstream events (Henderson et al. 2005; Que et al. 2005)). This reduces

NO bioavalability, which causes the VSMC to constrict, thereby starting the first phase

contraction. At the same time this contraction begins, H2S starts to activate KATP channels (or the

Cl-/HCO3~ aniOn exchanger), causing the VSMC to hyperpolarize and begin to relax. This

relaxation continues for several minutes. Up to this point, the hydrogen sulfide has been

oxidizing steadily, and is by now at least half gone. However, from the very start, H2S has

caused a conformational change in cyclooxygenase, lipoxygenase and cytochrome P-450,

potentially by interacting with heme groups present in some of these enzymes, or by modifying

and/or making new thiol groups, causing conformational changes. This stimulates the production

of vasoconstricting AAMs, such as thromboxanes, leukotrienes, and prostaglandins (PGF2a). As

these AAMs accumulate, they override the KATP channel (or Cl-/HCO3~ aniOn exchanger)-

induced relaxation and start the third phase contraction, which eventually peaks, and comes back

to resting tension. This decrease to resting tension may also be aided by hydrogen sulfide

initiating the activation of eNOS via phosphorylation, which peaks at around 30 minutes. This

increases basal NO production, replenishing the NO that hydrogen sulfide initially scavenged,

thereby decreasing vascular tone.

Conclusions and Future Directions

While we have made a good start at understanding what is modulating the vascular

response to hydrogen sulfide, there is much to be learned. The triphasic response is likely the end

result of a multitude of changes resulting from the addition of hydrogen sulfide. Given the









extremely reactive nature of hydrogen sulfide, it is possible that many pathways are activated or

deactivated. This makes it difficult to isolate individual contributors within a given contraction or

relaxation phase. Even removal of the endothelium does not completely block any phase, despite

the maj ority of the response probably being endothelium-derived. Hydrogen sulfide likely acts

directly on the VSMCs as well. We also have not been able to completely block the relaxation

phase with KATP inhibitors, and therefore an additional mechanism probably contributes to the

relaxation phase.

Future work will be required to fully elucidate the mechanisms behind hydrogen sulfide

signaling in the cardiovascular system. A systematic, whole-animal approach would be helpful to

test the physiological relevance of the triphasic response. There is a consistent Einding of a

decrease in blood pressure when hydrogen sulfide donors are inj ected into whole animals (Zhao

et al. 2001; Zhong et al. 2003; Wang et al. 2008; Webb et al. 2008; Yang et al. 2008; Zhao et al.

2008). However, one group has observed a biphasic response in blood pressure to hydrogen

sulfide injection, with blood pressure showing an initial decrease followed by a transient increase

(Kubo et al. 2007c). This is consistent with our observed triphasic response, which would

initially cause a drop in blood pressure (assuming the initial contraction is too short and small in

magnitude to be detected) and then a rise in blood pressure as the second contraction phase

begins. Whole animal studies may also be useful for resolving the seemingly contradictory data

that hydrogen sulfide activates eNOS, but causes contraction in aorta. The activation of eNOS

does not occur until 30 minutes after hydrogen sulfide addition, and therefore it may contribute

to the attenuation of the third phase contraction, and thus recovery of the vessel to base tension.

This activation should be tested in vivo to determine whether application of hydrogen sulfide










after 30 minutes significantly alters blood pressure or enhances the response to acetylcholine

compared to controls.










LIST OF REFERENCES


Abe, K., Kimura, H., 1996. The possible role of hydrogen sulfide as an endogenous
neuromodulator. J Neurosci 16, 1066-1071.

Ali, M.Y., Ping, C.Y., Mok, Y.Y., Ling, L., Whiteman, M., Bhatia, M., Moore, P.K., 2006.
Regulation of vascular nitric oxide in vitro and in vivo; a new role for endogenous
hydrogen sulphide? Br J Pharmacol.

Anantharaju, A., Feller, A., Chedid, A., 2002. Aging Liver. A review. Gerontology 48, 343-353.

Aspnes, L.E., Lee, C.M., Weindruch, R., Chung, S.S., Roecker, E.B., Aiken, J.M., 1997. Caloric
restriction reduces fiber loss and mitochondrial abnormalities in aged rat muscle. Faseb J
11, 573-581.

Attene-Ramos, M.S., Wagner, E.D., Gaskins, H.R., Plewa, M.J., 2007. Hydrogen sulfide induces
direct radical-associated DNA damage. Mol Cancer Res 5, 455-459.

Bagarinao, T., 1992. Sulfide as an environmental factor and toxicant: tolerance and adaptations
in aquatic organisms. Aquatic Toxicol. 24, 21-62.

Bagarinao, T., Vetter, R.D., 1992. Sulfide-hemoglobin interactions in the sulfide-tolerant salt-
marsh resident, the California killifish Fundulus parvipinnis. J. Comp. Physiol. B 162,
614-624.

Barja, G., 2002. Endogenous oxidative stress: relationship to aging, longevity and caloric
restriction. Ageing Res Rev 1, 397-411.

Beauchamp, R.O., Bus, J.S., Popp, J.S., Boreiko, C.J., Andjelkovich, D.A., 1984. A critical
review of the literature on hydrogen sulfide toxicity. CRC Crit Rev Toxicol 13, 25-97.

Besse, S., Tanguy, S., Boucher, F., Bulteau, A.L., Riou, B., de Leiris, J., Swynghedauw, B.,
2002. Aortic vasoreactivity during prolonged hypoxia and hypoxia-reoxygenation in
senescent rats. Mech Ageing Dev 123, 275-285.

Blackstone, E., Morrison, M., Roth, M.B., 2005. H2S induces a suspended animation-like state
in mice. Science 308, 518.

Cardounel, A.J., Cui, H., Samouilov, A., Johnson, W., Kearns, P., Tsai, A.L., Berka, V., Zweier,
J.L., 2007. Evidence for the Pathophysiological Role of Endogenous Methylarginines in
Regulation of Endothelial NO Production and Vascular Function. J Biol Chem 282, 879-
887.

Cardounel, A.J., Zweier, J.L., 2002. Endogenous methylarginines regulate neuronal nitric-oxide
synthase and prevent excitotoxic injury. J Biol Chem 277, 33995-34002. Epub 32002 Jun
33928.










Castello, L., Froio, T., Cavallini, G., Biasi, F., Sapino, A., Leonarduzzi, G., Bergamini, E., Poli,
G., Chiarpotto, E., 2005. Calorie restriction protects against age-related rat aorta
sclerosis. Faseb J 19, 1863-1865.

Cavallini, D., Mondovi, B., De Marco, C., Sciosciasantoro, A., 1962. Inhibitory effect of
mercaptoethanol and hypotaurine on the desulfhydration of cysteine by cystathionase.
Arch Biochem Biophys 96, 456-457.

Cernadas, M.R., Sanchez de Miguel, L., Garcia-Duran, M., Gonzalez-Fernandez, F., Millas, I.,
Monton, M., Rodrigo, J., Rico, L., Fernandez, P., de Frutos, T., Rodriguez-Feo, J.A.,
Guerra, J., Caramelo, C., Casado, S., Lopez, F., 1998. Expression of constitutive and
inducible nitric oxide synthases in the vascular wall of young and aging rats. Circ Res 83,
279-286.

Chen KY, M.J., 1972. Kinetics of oxidation of aqueous sulfide by oxygen. Environ. Sci.
Technol. 6, 529-537.

Chen, K.Y., Morris, J.C., 1972. Oxidation of sulfide by Oz: catalysis and inhibition. J. San. Eng.
Div. Proc. Am. Soc. Civ. Eng. 98, 215-227.

Chen, Y.H., Yao, W.Z., Geng, B., Ding, Y.L., Lu, M., Zhao, M.W., Tang, C.S., 2005.
Endogenous hydrogen sulfide in patients with COPD. Chest 128, 3205-3211.

Cheng, Y., Ndisang, J.F., Tang, G., Cao, K., Wang, R., 2004. Hydrogen sulfide-induced
relaxation of resistance mesenteric artery beds of rats. Am J Physiol Heart Circ Physiol
287, H2316-2323.

Chung, A.W., Au Yeung, K., Cortes, S.F., Sandor, G.G., Judge, D.P., Dietz, H.C., van Breemen,
C., 2007. Endothelial dysfunction and compromised eNOS/Akt signaling in the thoracic
aorta during the progression of Marfan syndrome. Br J Pharmacol 150, 1075-1083.

Chunyu, Z., Junbao, D., Dingfang, B., Hui, Y., Xiuying, T., Chaoshu, T., 2003. The regulatory
effect of hydrogen sulfide on hypoxic pulmonary hypertension in rats. Biochem Biophys
Res Commun 302, 810-816.

Claypool, G.E., Kvenvolden, K.A., 1983. Methane and Other Hydrocarbon Gases in Marine
Sediment. Ann. Rev. Earth Planet Sci. 11, 299-327.

Cline, J.D., 1969. Spectrophotometric determination of hydrogen sulfide in natural waters.
Limnol. Oceanogr. 14, 454-458.

d'Emmanuele di Villa Bianca, R., Sorrentino, R., Maffia, P., Mirone, V., Imbimbo, C., Fusco, F.,
De Palma, R., Ignarro, L.J., Cirino, G., 2009. Hydrogen sulfide as a mediator of human
corpus cavernosum smooth-muscle relaxation. Proc Natl Acad Sci U S A.

Dello Russo, C., Tringali, G., Ragazzoni, E., Maggiano, N., Menini, E., Vairano, M., Preziosi,
P., Navarra, P., 2000. Evidence that hydrogen sulphide can modulate hypothalamo-










pituitary-adrenal axis function: in vitro and in vivo studies in the rat. J Neuroendocrinol
12, 225-233.

Dieterle, A., Orth, R., Daubrawa, M., Grotemeier, A., Alers, S., Ullrich, S., Lammers, R.,
Wesselborg, S., Stork, B., 2009. The Akt inhibitor triciribine sensitizes prostate
carcinoma cells to TRAIL-induced apoptosis. Int J Cancer.

Doeller, J.E., Grieshaber, M.K., Kraus, D.W., 2001. Chemolithoheterotrophy in a metazoan
tissue: thiosulfate production matches ATP demand in ciliated mussel gills. J Exp Biol
204, 3755-3764.

Dombkowski, R.A., Doellman, M.M., Head, S.K., Olson, K.R., 2006. Hydrogen sulfide mediates
hypoxia-induced relaxation of trout urinary bladder smooth muscle. J Exp Biol 209,
3234-3240.

Dombkowski, R.A., Russell, M.J., Olson, K.R., 2004. Hydrogen sulfide as an endogenous
regulator of vascular smooth muscle tone in trout. Am J Physiol Regul Integr Comp
Physiol 286, R678-685.

Dombkowski, R.A., Russell, M.J., Schulman, A.A., Doellman, M.M., Olson, K.R., 2005.
Vertebrate phylogeny of hydrogen sulfide vasoactivity. Am J Physiol Regul Integr Comp
Physiol 288, R243-252.

Dorman, D.C., Moulin, F.J.-M., McManus, B.E., Mahle, K.C., Arden James, R., Struve, M.F.,
2002. Cytochrome oxidation inhibition induced by acute hydrogen sulfide inhalation:
correlation with tissue sulfide concentrations in the rat brain, liver, lung, and nasal
epithelium. Toxicol Sci 65, 18-25.

Du, J., Yan, H., Tang, C., 2003. Endogenous H2S is involved in the development of spontaneous
hypertension. Beijing Da Xue Xue Bao 35, 102.

Ebrahimkhani, M.R., Mani, A.R., Moore, K., 2005. Hydrogen sulphide and the hyperdynamic
circulation in cirrhosis: a hypothesis. Gut 54, 1668-1671.

Eghbal, M.A., Pennefather, P.S., O'Brien, P.J., 2004. H2S cytotoxicity mechanism involves
reactive oxygen species formation and mitochondrial depolarisation. Toxicology 203, 69-
76.

Elrod, J.W., Calvert, J.W., Morrison, J., Doeller, J.E., Kraus, D.W., Tao, L., Jiao, X., Scalia, R.,
Kiss, L., Szabo, C., Kimura, H., Chow, C.W., Lefer, D.J., 2007. Hydrogen sulfide
attenuates myocardial ischemia-reperfusion injury by preservation of mitochondrial
function. Proc Natl Acad Sci U SA 104, 15560-15565.

Eto, K., Kimura, H., 2002a. A novel enhancing mechanism for hydrogen sulfide-producing
activity of cystathionine beta-synthase. J Biol Chem 277, 42680-42685.

Eto, K., Kimura, H., 2002b. The production of hydrogen sulfide is regulated by testosterone and
S-adenosyl-L-methionine in mouse brain. J. Neurochem. 83, 80-86.










Fenga, C., Cacciola, A., Micali, E., 2002. [Cognitive sequelae of acute hydrogen sulphide
poisoning. A case report]. Med Lay 93, 322-328.

Fiorucci, S., Antonelli, E., Distrutti, E., Rizzo, G., Mencarelli, A., Orlandi, S., Zanardo, R.,
Renga, B., Di Sante, M., Morelli, A., Cirino, G., Wallace, J.L., 2005a. Inhibition of
hydrogen sulfide generation contributes to gastric injury caused by anti-inflammatory
nonsteroidal drugs. Gastroenterology 129, 1210-1224.

Fiorucci, S., Antonelli, E., Mencarelli, A., Orlandi, S., Renga, B., Rizzo, G., Distrutti, E., Shah,
V., Morelli, A., 2005b. The third gas: H2S regulates perfusion pressure in both the
isolated and perfused normal rat liver and in cirrhosis. Hepatology 42, 539-548.

Fiorucci, S., Distrutti, E., Cirino, G., Wallace, J.L., 2006. The emerging roles of hydrogen sulfide
in the gastrointestinal tract and liver. Gastroenterology 131, 259-271.

Fiorucci, S., Santucci, L., Distrutti, E., 2007. NSAIDs, coxibs, CINTOD and H2S-releasing
NSAIDs: what lies beyond the horizon. Dig Liver Dis 39, 1043-1051.

Fujii, K., Sakuragawa, T., Kashiba, M., Sugiura, Y., Kondo, M., Maruyama, K., Goda, N.,
Nimura, Y., Suematsu, M., 2005. Hydrogen sulfide as an endogenous modulator of
biliary bicarbonate excretion in the rat liver. Antioxid Redox Signal 7, 788-794.

Furchgott, R.F., 1999. Endothelium-derived relaxing factor: discovery, early studies, and
identification as nitric oxide. Biosci Rep 19, 23 5-25 1.

Gainey, L.F., Jr., Greenberg, M.J., 2003. Nitric oxide mediates seasonal muscle potentiation in
clam gills. J Exp Biol 206, 3507-3520.

Gainey, L.F., Jr., Greenberg, M.J., 2005. Hydrogen sulfide is synthesized in the gills of the clam
Mercenaria mercenaria and acts seasonally to modulate branchial muscle contraction.
Biol Bull 209, 11-20.

Gallego, D., Clave, P., Donovan, J., Rahmati, R., Grundy, D., Jimenez, M., Beyak, M.J., 2008.
The gaseous mediator, hydrogen sulphide, inhibits in vitro motor patterns in the human,
rat and mouse colon and j ejunum. Neurogastroenterol Motil 20, 13 06-13 16.

Gangopadhyay, R.K., Das, S.K., 2007. Accident due to release of hydrogen sulphide in a
manufacturing process of cobalt sulphide case study. Environ Monit Assess 129, 133-
135.

Garcia-Bereguiain, M.A., Samhan-Arias, A.K., Martin-Romero, F.J., Gutierrez-Merino, C.,
2008. Hydrogen sulfide raises cytosolic calcium in neurons through activation of L-type
Ca2+ channels. Antioxid Redox Signal 10, 31-42.

Geng, B., Chang, L., Pan, C., Qi, Y., Zhao, J., Pang, Y., Du, J., Tang, C., 2004a. Endogenous
hydrogen sulfide regulation of myocardial injury induced by isoproterenol. Biochem
Biophys Res Commun 318, 756-763.










Geng, B., Cui, Y., Zhao, J., Yu, F., Zhu, Y., Xu, G., Zhang, Z., Tang, C., Du, J., 2007. Hydrogen
sulfide downregulates the aortic L-arginine/nitric oxide pathway in rats. Am J Physiol
Regul Integr Comp Physiol 293, R1608-1618.

Geng, B., Yang, J., Qi, Y., Zhao, J., Pang, Y., Du, J., Tang, C., 2004b. H2S generated by heart in
rat and its effects on cardiac function. Biochem Biophys Res Commun 313, 362-368.

Gilboa-Garber, N., 1971. Direct spectrophotometric determination of inorganic sulfide in
biological materials and in other complex mixtures. Analytical Biochemistry 43, 129-
133.

Goettsch, W., Lattmann, T., Amann, K., Szibor, M., Morawietz, H., Munter, K., Muller, S.P.,
Shaw, S., Barton, M., 2001. Increased expression of endothelin-1 and inducible nitric
oxide synthase isoform II in aging arteries in vivo: implications for atherosclerosis.
Biochem Biophys Res Commun 280, 908-913.

Goodwin, L.R., Francom, D., Dieken, F.P., Taylor, J.D., Warenycia, M.W., Reiffenstein, R.J.,
Dowling, G., 1989. Determination of sulfide in brain tissue by gas dialysis/ion
chromatography: postmortem studies and two case reports. J Anal Toxicol 13, 105-109.

Gredilla, R., Phaneuf, S., Selman, C., Kendaiah, S., Leeuwenburgh, C., Barja, G., 2004. Short-
term caloric restriction and sites of oxygen radical generation in kidney and skeletal
muscle mitochondria. Ann N Y Acad Sci 1019, 333-342.

Gredilla, R., Sanz, A., Lopez-Torres, M., Barja, G., 2001. Caloric restriction decreases
mitochondrial free radical generation at complex I and lowers oxidative damage to
mitochondrial DNA in the rat heart. Faseb J 15, 1589-1591.

Gygi, S.P., Rochon, Y., Franza, B.R., Aebersold, R., 1999. Correlation between protein and
mRNA abundance in yeast. Mol Cell Biol 19, 1720-1730.

Han, Y., Qin, J., Chang, X., Yang, Z., Bu, D., Du, J., 2005. Modulating effect of hydrogen
sulfide on gamma-aminobutyric acid B receptor in recurrent febrile seizures in rats.
Neurosci Res 53, 216-219.

Hand, S.C., Somero, G.N., 1983. Energy Metabolism Pathways of Hydrothermal Vent Animals:
Adaptations to a Food-Rich and Sulfide-Rich Deep-Sea Environment. Biol. Bull. 165,
167-181.

Haouzi, P., Notet, V., Chenuel, B., Chalon, B., Sponne, I., Ogier, V., Bihain, B., 2008. H2S
induced hypometabolism in mice is missing in sedated sheep. Respir Physiol Neurobiol
160, 109-115.

Hecker, B., 1985. Fauna from a cold sulfur-seep in the Gulf of Mexico: comparison with
hydrothermal vent communities and evolutionary implications. BULL. BIOL. SOC.
WASH. 6, 465-473.

Henderson, E.M., Gaston, B., 2005. SNOR and wheeze: the asthma enzyme? Trends Mol Med.










Hosoki, R., Matsuki, N., Kimura, H., 1997. The possible role of hydrogen sulfide as an
endogenous smooth muscle relaxant in synergy with nitric oxide. Biochem Biophys Res
Commun 237, 527-531.

Hourdez, S., Lallier, F.H., De Cian, M.C., Green, B.N., Weber, R.E., Toulmond, A., 2000. Gas
transfer system in Alvinella pompej ana (Annelida polychaeta, Terebellida): functional
properties of intracellular and extracellular hemoglobins. Physiol Biochem Zool 73, 365-
373.

Hu, Y., Chen, X., Pan, T.T., Neo, K.L., Lee, S.W., Khin, E.S., Moore, P.K., Bian, J.S., 2007.
Cardioprotection induced by hydrogen sulfide preconditioning involves activation of
ERK and PI3K/Akt pathways. Pflugers Arch.

Hui, Y., Du, J., Tang, C., Bin, G., Jiang, H., 2003. Changes in arterial hydrogen sulfide (H2S)
content during septic shock and endotoxin shock in rats. J Infect 47, 155-160.

Jeong, S.O., Pae, H.O., Oh, G.S., Jeong, G.S., Lee, B.S., Lee, S., Kim du, Y., Rhew, H.Y., Lee,
K.M., Chung, H.T., 2006. Hydrogen sulfide potentiates interleukin-1Ibeta-induced nitric
oxide production via enhancement of extracellular signal-regulated kinase activation in
rat vascular smooth muscle cells. Biochem Biophys Res Commun 345, 938-944.

Jha, S., Calvert, J.W., Duranski, M.R., Ramachandran, A., Lefer, D.J., 2008. Hydrogen sulfide
attenuates hepatic ischemia-reperfusion injury: role of antioxidant and antiapoptotic
signaling. Am J Physiol Heart Circ Physiol 295, H801-806.

Joyner, J.L., Peyer, S.M., Lee, R.W., 2003. Possible roles of sulfur-containing amino acids in a
chemoautotrophic bacterium-mollusc symbiosis. Biol Bull 205, 331-338.

Julian, D., April, K.L., Patel, S., Stein, J.R., Wohlgemuth, S.E., 2005a. Mitochondrial
depolarization following hydrogen sulfide exposure in erythrocytes from a sulfide-
tolerant marine invertebrate. J Exp Biol 208, 4109-4122.

Julian, D., Dallia, W.E., Arp, A.J., 1998. Neuromuscular Sensitivity to Hydrogen Sulfide in the
Marine Invertebrate Urechis caupo. The Journal of Experimental Biology 201, 1393-
1403.

Julian, D., Gail, F., Wood, E., Arp, A.J., Fisher, C.R., 1999. Roots as a site of hydrogen sulfide
uptake in the hydrocarbon seep vestimentiferan Lamellibrachia sp. The Journal of
Experimental Biology 202, 2245-2257.

Julian, D., Statile, J., Roepke, T.A., Arp, A.J., 2005b. Sodium nitroprusside potentiates
hydrogen-sulfide-induced contractions in body wall muscle from a marine worm. Biol
Bull 209, 6-10.

Julian, D., Statile, J.L., Wohlgemuth, S.E., Arp, A.J., 2002. Enzymatic hydrogen sulfide
production in marine invertebrate tissues. Comp Biochem Physiol A Mol Integr Physiol
133, 105-115.










Khan, A.A., Schuler, M.M., Prior, M.G., Yong, S., Coppock, R.W., Florence, L.Z., Lillie, L.E.,
1990. Effects of hydrogen sulfide exposure on lung mitochondrial respiratory chain
enzymes in rats. Toxicol Appl Pharmacol 103, 482-490.

Kimura, H., 2000. Hydrogen sulfide induces cyclic AMP and modulates the NMDA receptor.
Biochem Biophys Res Commun 267, 129-133.

Kimura, H., 2002. Hydrogen sulfide as a neuromodulator. Mol Neurobiol 26, 13-19.

Kimura, H., Nagai, Y., Umemura, K., Kimura, Y., 2005. Physiological roles of hydrogen sulfide:
synaptic modulation, neuroprotection, and smooth muscle relaxation. Antioxid Redox
Signal 7, 795-803.

Kimura, Y., Dargusch, R., Schubert, D., Kimura, H., 2006. Hydrogen sulfide protects HT22
neuronal cells from oxidative stress. Antioxid Redox Signal 8, 661-670.

Kimura, Y., Kimura, H., 2004. Hydrogen sulfide protects neurons from oxidative stress. Faseb J
18, 1165-1167.

Kiss, L., Deitch, E.A., Szabo, C., 2008. Hydrogen sulfide decreases adenosine triphosphate
levels in aortic rings and leads to vasorelaxation via metabolic inhibition. Life Sci.

Kitamura, K., Yamazaki, J., 2001. Chloride channels and their functional roles in smooth muscle
tone in the vasculature. Jpn J Pharmacol 85, 351-357.

Kitani, K., 1991. Aging of the liver: facts and theories. Arch Gerontol Geriatr 12, 133-154.

Kitani, K., 1994. Aging and the liver: functional aspects. Arch Gerontol Geriatr 19, 145-158.

Koenitzer, J.R., Isbell, T.S., Patel, H.D., Benavides, G.A., Dickinson, D.A., Patel, R.P., Darley-
Usmar, V.M., Lancaster, J.R., Jr., Doeller, J.E., Kraus, D.W., 2007. Hydrogen sulfide
mediates vasoactivity in an 02-dependent manner. Am J Physiol Heart Circ Physiol 292,
H1953-1960.

Kompanowska-Jezierska, E., Kuczeriszka, M., 2008. Cytochrome P-450 metabolites in renal
circulation and excretion--interaction with the nitric oxide (NO) system. J Physiol
Pharmacol 59 Suppl 9, 137-149.

Kraus, D.W., Doeller, J.E., 2004. Sulfide consumption by mussel gill mitochondria is not strictly
tied to oxygen reduction: measurements using a novel polarographic sulfide sensor. J Exp
Biol 207, 3667-3679.

Kraus, D.W., Doeller, J.E., Powell, C.S., 1996. Sulfide may directly modify cytoplasmic
hemoglobin deoxygenation in Solemya reidi gills. J. Exp. Biol. 199, 1343-1352.

Kubo, S., Doe, I., Kurokawa, Y., Kawabata, A., 2007a. Hydrogen Sulfide Causes Relaxation in
Mouse Bronchial Smooth Muscle. J Pharmacol Sci.










Kubo, S., Doe, I., Kurokawa, Y., Nishikawa, H., Kawabata, A., 2007b. Direct inhibition of
endothelial nitric oxide synthase by hydrogen sulfide: contribution to dual modulation of
vascular tension. Toxicology 232, 138-146.

Kubo, S., Kajiwara, M., Kawabata, A., 2007c. Dual modulation of the tension of isolated gastric
artery and gastric mucosal circulation by hydrogen sulfide in rats.
Inflammopharmacology 15, 288-292.

Kubo, S., Kurokawa, Y., Doe, I., Masuko, T., Sekiguchi, F., Kawabata, A., 2007d. Hydrogen
sulfide inhibits activity of three isoforms of recombinant nitric oxide synthase.
Toxicology 241, 92-97.

Labinskyy, N., Csiszar, A., Veress, G., Stef, G., Pacher, P., Oroszi, G., Wu, J., Ungvari, Z.,
2006. Vascular dysfunction in aging: potential effects of resveratrol, an anti-
inflammatory phytoestrogen. Curr Med Chem 13, 989-996.

Lakatta, E.G., 1993. Cardiovascular regulatory mechanisms in advanced age. Physiol Rev 73,
413-467.

Lee, S.W., Cheng, Y., Moore, P.K., Bian, J.S., 2007. Hydrogen sulphide regulates intracellular
pH in vascular smooth muscle cells. Biochem Biophys Res Commun 358, 1142-1147.

Leeuwenburgh, C., Prolla, T.A., 2006. Genetics, redox signaling, oxidative stress, and apoptosis
in Mammalian aging. Antioxid Redox Signal 8, 503-505.

Leeuwenburgh, C., Wagner, P., Holloszy, J.O., Sohal, R.S., Heinecke, J.W., 1997. Caloric
restriction attenuates dityrosine cross-linking of cardiac and skeletal muscle proteins in
aging mice. Arch Biochem Biophys 346, 74-80.

Leffler, C.W., Parfenova, H., Jaggar, J.H., Wang, R., 2006. Carbon monoxide and hydrogen
sulfide: gaseous messengers in cerebrovascular circulation. J Appl Physiol 100, 1065-
1076.

Levitt, M.D., Furne, J., Springfield, J., Suarez, F., DeMaster, E., 1999. Detoxifieation of
hydrogen sulfide and methanethiol in the cecal mucosa. J Clin Invest 104, 1107-1114.

Li, L., Bhatia, M., Zhu, Y.Z., Zhu, Y.C., Ramnath, R.D., Wang, Z.J., Anuar, F.B., Whiteman,
M., Salto-Tellez, M., Moore, P.K., 2005. Hydrogen sulfide is a novel mediator of
lipopolysaccharide-induced inflammation in the mouse. Faseb J 19, 1196-1198.

Li, X.H., Du, J.B., Bu, D.F., Tang, X.Y., Tang, C.S., 2006. Sodium hydrosulfide alleviated
pulmonary vascular structural remodeling induced by high pulmonary blood flow in rats.
Acta Pharmacol Sin 27, 971-980.

Li, Y.F., Xiao, C.S., Hui, R.T., 2009. Calcium sulfide (CaS), a donor of hydrogen sulfide
(H(2)S): A new antihypertensive drug? Med Hypotheses.










Lim, J.J., Liu, Y., Khin Sandar Win, E., Bian, J. S., 2008. Vasoconstrictive effect of hydrogen
sulfide involves downregulation of cAMP in vascular smooth muscle cells. Am J Physiol
Cell Physiol.

Lonsdale, P., 1977. Clustering of suspension-feeding macrobenthos near abyssal hydrothermal
vents at oceanic spreading centers. Deep-Sea Res. 24, 857-863.

Lowicka, E., Beltowski, J., 2007. Hydrogen sulfide (H2S) the third gas of interest for
pharmacologists. Pharmacol Rep 59, 4-24.

Marin, E., Sessa, W.C., 2007. Role of endothelial-derived nitric oxide in hypertension and renal
disease. Curr Opin Nephrol Hypertens 16, 105-110.

Martineu, P., Juniper, S.K., Fisher, C.R., Massoth, G.J., 1997. Sulfide binding in the body fluids
of hydrothermal vent alvinellid polychaetes. Physiol Zool 70, 578-588.

McMullin, E.R., Bergquist, D.C., Fisher, C.R., 2000. Metazoans in Extreme Environments:
Adaptations of Hydrothermal Vent and Hydrocarbon Seep Fauna. Gravitational and
Space Biology Bulletin 12, 13-24.

Miller, D.L., Roth, M.B., 2007. Hydrogen sulfide increases thermotolerance and lifespan in
Caenorhabditis elegans. Proc Natl Acad Sci U SA 104, 20618-20622.

Minamiyama, Y., Bito, Y., Takemura, S., Takahashi, Y., Kodai, S., Mizuguchi, S., Nishikawa,
Y., Suehiro, S., Okada, S., 2007. Calorie restriction improves cardiovascular risk factors
via reduction of mitochondrial reactive oxygen species in type II diabetic rats. J
Pharmacol Exp Ther 320, 535-543.

Mount, P.F., Kemp, B.E., Power, D.A., 2007. Regulation of endothelial and myocardial NO
synthesis by multi-site eNOS phosphorylation. J Mol Cell Cardiol 42, 271-279.

Muzaffar, S., Shukla, N., Bond, M., Newby, A.C., Angelini, G.D., Sparatore, A., Del Soldato, P.,
Jeremy, J.Y., 2008. Exogenous Hydrogen Sulfide Inhibits Superoxide Formation, NOX-1
Expression and Rac(1) Activity in Human Vascular Smooth Muscle Cells. J Vasc Res 45,
521-528.

Nicholls, P., 1975. The effect of sulphide on cytochrome aa3. Isosteric and allosteric shifts of the
reduced alpha-peak. Biochim Biophys Acta 396, 24-3 5.

Nicholls, P., Kim, J.K., 1982. Sulphide as an inhibitor and electron donor for the cytochrome c
oxidase system. Can J Biochem 60, 613-623.

Oh, G.S., Pae, H.O., Lee, B.S., Kim, B.N., Kim, J.M., Kim, H.R., Jeon, S.B., Jeon, W.K., Chae,
H.J., Chung, H.T., 2006. Hydrogen sulfide inhibits nitric oxide production and nuclear
factor-kappa B via heme oxygenase-1 expression in RAW264.7 macrophages stimulated
with lipopolysaccharide. Free Radical Biology and Medicine 41, 106-119.










Olson, K.R., 2005. Vascular actions of hydrogen sulfide in nonmammalian vertebrates. Antioxid
Redox Signal 7, 804-812.

Olson, K.R., 2008. Hydrogen sulfide and oxygen sensing: implications in cardiorespiratory
control. J Exp Biol 211, 2727-2734.

Olson, K.R., 2009. Is hydrogen sulfide a circulating "Gasotransmitter" in vertebrate blood?
Biochim Biophys Acta.

Olson, K.R., Dombkowski, R.A., Russell, M.J., Doellman, M.M., Head, S.K., Whitfield, N.L.,
Madden, J.A., 2006. Hydrogen sulfide as an oxygen sensor/transducer in vertebrate
hypoxic vasoconstriction and hypoxic vasodilation. J Exp Biol 209, 4011-4023.

Olson, K.R., Donald, J.A., 2009. Nervous control of circulation The role of gasotransmitters,
NO, CO, and H(2)S. Acta Histochem.

Olson, K.R., Forgan, L.G., Dombkowski, R.A., Forster, M.E., 2008. Oxygen dependency of
hydrogen sulfide-mediated vasoconstriction in cyclostome aortas. J Exp Biol 211, 2205-
2213.

Palumbo, A., 2005. Nitric oxide in marine invertebrates: a comparative perspective. Comp
Biochem Physiol A Mol Integr Physiol 142, 241-248.

Partlo, L.A., Sainsbury, R. S., Roth, S.H., 2001. Effects of repeated hydrogen sulfide (H2S)
exposure on learning and memory in the adult rat. Neurotoxicology 22, 177-189.

Payne, A.M., Dodd, S.L., Leeuwenburgh, C., 2003. Life-long calorie restriction in Fischer 344
rats attenuates age-related loss in skeletal muscle-specific force and reduces extracellular
space. J Appl Physiol 95, 2554-2562.

Pryor, W.A., Houk, K.N., Foote, C.S., Fukuto, J.M., Ignarro, L.J., Squadrito, G.L., Davies, K.J.,
2006. Free radical biology and medicine: it's a gas, man! Am J Physiol Regul Integr
Comp Physiol 291, R491-511.

Puranik, M., Weeks, C.L., Lahaye, D., Kabil, O., Taoka, S., Nielsen, S.B., Groves, J.T.,
Banerj ee, R., Spiro, T.G., 2006. Dynamics of carbon monoxide binding to cystathionine
beta-synthase. J Biol Chem 281, 13433-13438.

Qi, J., Du, J., Tang, X., Li, J., Wei, B., Tang, C., 2004. The upregulation of endothelial nitric
oxide synthase and urotensin-II is associated with pulmonary hypertension and vascular
diseases in rats produced by aortocaval shunting. Heart Vessels 19, 81-88.

Qingyou, Z., Junbao, D., Weijin, Z., Hui, Y., Chaoshu, T., Chunyu, Z., 2004. Impact of hydrogen
sulfide on carbon monoxide/heme oxygenase pathway in the pathogenesis of hypoxic
pulmonary hypertension. Biochem Biophys Res Commun 317, 30-37.

Qu, K., Chen, C.P., Halliwell, B., Moore, P.K., Wong, P.T., 2006. Hydrogen sulfide is a
mediator of cerebral ischemic damage. Stroke 37, 889-893.










Que, L.G., Liu, L., Yan, Y., Whitehead, G.S., Gavett, S.H., Schwartz, D.A., Stamler, J.S., 2005.
Protection from experimental asthma by an endogenous bronchodilator. Science 308,
1618-1621.

Robert, R., Norez, C., Becq, F., 2005. Disruption of CFTR chloride channel alters mechanical
properties and cAMP-dependent Cl- transport of mouse aortic smooth muscle cells. J
Physiol 568, 483-495.

Sharifi, A.M., Mohseni, S., Nekoparvar, S., Larijani, B., Fakhrzadeh, H., Oryan, S., 2008. Effect
of caloric restriction on nitric oxide production, ACE activity, and blood pressure
regulation in rats. Acta Physiol Hung 95, 55-63.

Shepherd, G., Velez, L.I., 2008. Role of hydroxocobalamin in acute cyanide poisoning. Ann
Pharmacother 42, 661-669.

Sheppard, D.N., Robinson, K.A., 1997. Mechanism of glibenclamide inhibition of cystic fibrosis
transmembrane conductance regulator Cl- channels expressed in a murine cell line. J
Physiol 503 (Pt 2), 333-346.

Shukla, N., Rossoni, G., Hotston, M., Sparatore, A., Del Soldato, P., Tazzari, V., Persad, R.,
Angelini, G.D., Jeremy, J.Y., 2009. Effect of hydrogen sulphide-donating sildenafil
(ACS6) on erectile function and oxidative stress in rabbit isolated corpus cavernosum and
in hypertensive rats. BJU Int.

Srilatha, B., Adaikan, P.G., Li, L., Moore, P.K., 2007. Hydrogen sulphide: a novel endogenous
gasotransmitter facilitates erectile function. J Sex Med 4, 1304-1311.

Srilatha, B., Adaikan, P.G., Moore, P.K., 2006. Possible role for the novel gasotransmitter
hydrogen sulphide in erectile dysfunction--a pilot study. Eur J Pharmacol 535, 280-282.

Stipanuk, M.H., Beck, P.W., 1982. Characterization of the enzymic capacity for cysteine
desulphhydration in liver and kidney of the rat. Biochem J 206, 267-277.

Szabo, C., 2007. Hydrogen sulphide and its therapeutic potential. Nat Rev Drug Discov 6, 917-
935.

Taddei, S., Virdis, A., Ghiadoni, L., Versari, D., Salvetti, A., 2006. Endothelium, aging, and
hypertension. Curr Hypertens Rep 8, 84-89.

Tanaka, Y., Funabiki, M., Michikawa, H., Koike, K., 2006. Effects of aging on alphal-
adrenoceptor mechanisms in the isolated mouse aortic preparation. J Smooth Muscle Res
42, 131-138.

Tang, G., Wu, L., Liang, W., Wang, R., 2005. Direct stimulation of K(ATP) channels by
exogenous and endogenous hydrogen sulfide in vascular smooth muscle cells. Mol
Pharmacol 68, 1757-1764.










Taoka, S., Banerj ee, R., 2001. Characterization of NO binding to human cystathionine beta-
synthase: possible implications of the effects of CO and NO binding to the human
enzyme. J Inorg Biochem 87, 245-251.

Tapley, D.W., Beuttner, G.R., Shick, J.M., 1999. Free radicals and chemiluminescence as
products of the spontaneous oxidation of sulfide in seawater, and their biological
implications. Biol. Bull. 196, 52-56.

Tatsuno, Y., Adachi, J., Mizoi, Y., Fujiwara, S., Nakanishi, K., Taniguchi, T., Yokoi, S.,
Shimizu, S., 1986. [Four cases of fatal poisoning by hydrogen sulfide. A study of
greenish discoloration of the skin and formation of sulfhemoglobin]. Nihon Hoigaku
Zasshi 40, 308-315.

Tvedt, B., Skyberg, K., Aaserud, O., Hobbesland, A., Mathiesen, T., 1991. Brain damage caused
by hydrogen sulfide: a follow-up study of six patients. Am J Ind Med 20, 91-101.

van der Loo, B., Bachschmid, M., Labugger, R., Schildknecht, S., Kilo, J., Hahn, R., Palacios-
Callender, M., Luscher, T.F., 2005. Expression and activity patterns of nitric oxide
synthases and antioxidant enzymes reveal a substantial heterogeneity between cardiac
and vascular aging in the rat. Biogerontology 6, 325-334.

van der Loo, B., Labugger, R., Skepper, J.N., Bachschmid, M., Kilo, J., Powell, J.M., Palacios-
Callender, M., Erusalimsky, J.D., Quaschning, T., Malinski, T., Gygi, D., Ullrich, V.,
Luscher, T.F., 2000. Enhanced peroxynitrite formation is associated with vascular aging.
J Exp Med 192, 1731-1744.

Verma, A., Hirsch, D.J., Glatt, C.E., Ronnett, G.V., Snyder, S.H., 1993. Carbon monoxide: a
putative neural messenger. Science 259, 381-384.

Voilkel, S., Berenbrink, M.K., 2000. Sulphaemoglobin formation in fish: A comparison between
the haemoglobin of the sulphide-sensitive rainbow traout (Oncorhynchus mykiss) and of
the sulphide-tolerant common carp (Cyprinus carpio). J. Exp. Biol. 203, 1047-1058.

Wallace, J.L., 2007a. Building a better aspirin: gaseous solutions to a century-old problem. Br J
Pharmacol 152, 421-428.

Wallace, J.L., 2007b. Hydrogen sulfide-releasing anti-inflammatory drugs. Trends Pharmacol
Sci 28, 501-505.

Wallace, J.L., Dicay, M., McKnight, W., Martin, G.R., 2007. Hydrogen sulfide enhances ulcer
healing in rats. Faseb J 21, 4070-4076.

Wang, R., 2002. Two's company, three's a crowd: can H2S be the third endogenous gaseous
transmitter? Faseb J 16, 1792-1798.

Wang, R., 2003. The gasotransmitter role of hydrogen sulfide. Antioxid Redox Signal 5, 493-
501.










Wang, Y.F., Mainali, P., Tang, C.S., Shi, L., Zhang, C.Y., Yan, H., Liu, X.Q., Du, J.B., 2008.
Effects of nitric oxide and hydrogen sulfide on the relaxation of pulmonary arteries in
rats. Chin Med J (Engl) 121, 420-423.

Webb, G.D., Lim, L.H., Oh, V.M., Yeo, S.B., Cheong, Y.P., Ali, M.Y., El Oakley, R., Lee, C.N.,
Wong, P.S., Caleb, M.G., Salto-Tellez, M., Bhatia, M., Chan, E.S., Taylor, E.A., Moore,
P.K., 2008. Contractile and vasorelaxant effects of hydrogen sulfide and its biosynthesis
in the human internal mammary artery. J Pharmacol Exp Ther 324, 876-882.

Whiteman, M., Armstrong, J.S., Chu, S.H., Jia-Ling, S., Wong, B.S., Cheung, N.S., Halliwell,
B., Moore, P.K., 2004a. The novel neuromodulator hydrogen sulfide: an endogenous
peroxynitrite 'scavenger'? J Neurochem 90, 765-768.

Whiteman, M., Armstrong, J.S., Chu, S.H., Jia-Ling, S., Wong, B.S., Cheung, N.S., Halliwell,
B., Moore, P.K., 2004b. The novel neuromodulator hydrogen sulfide: an endogenous
peroxynitrite 'scavenger'? Journal of Neurochemistry 90, 765-768.

Whiteman, M., Li, L., Kostetski, I., Chu, S.H., Siau, J.L., Bhatia, M., Moore, P.K., 2006.
Evidence for the formation of a novel nitrosothiol from the gaseous mediators nitric
oxide and hydrogen sulphide. Biochem Biophys Res Commun 343, 303-310.

Whiteman, M., Moore, P.K., 2009. Hydrogen Sulfide and the Vasculature: a Novel
Vasculoprotective Entity and Regulator of Nitric Oxide Bioavailability? J Cell Mol Med.

Whitfield, N.L., Kreimier, E.L., Verdial, F.C., Skovgaard, N., Olson, K.R., 2008. A Reappraisal
of H2S/sulfide concentration in vertebrate blood and its potential significance in ischemic
preconditioning and vascular signaling. Am J Physiol Regul Integr Comp Physiol.

Wood, C.E., Chen, G.F., Keller-Wood, M., 2005. Expression of nitric oxide synthase isoforms is
reduced in late-gestation ovine fetal brainstem. Am J Physiol Regul Integr Comp Physiol
289, R613-R619.

Xiao, L., Wu, Y.M., Wang, R., Liu, Y.X., Wang, F.W., He, R.R., 2007. Hydrogen sulfide
facilitates carotid sinus baroreceptor activity in anesthetized male rats. Chin Med J (Engl)
120, 1343-1347.

Xiaohui, L., Junbao, D., Lin, S., Jian, L., Xiuying, T., Jianguang, Q., Bing, W., Hongfang, J.,
Chaoshu, T., 2005. Down-regulation of endogenous hydrogen sulfide pathway in
pulmonary hypertension and pulmonary vascular structural remodeling induced by high
pulmonary blood flow in rats. Circ J 69, 1418-1424.

Yalamanchili, C., Smith, M.D., 2008. Acute hydrogen sulfide toxicity due to sewer gas exposure.
Am J Emerg Med 26, 518 e515-517.

Yan, H., Du, J., Tang, C., 2004. The possible role of hydrogen sulfide on the pathogenesis of
spontaneous hypertension in rats. Biochem Biophys Res Commun 313, 22-27.










Yan, S.K., Chang, T., Wang, H., Wu, L., Wang, R., Meng, Q.H., 2006. Effects of hydrogen
sulfide on homocysteine-induced oxidative stress in vascular smooth muscle cells.
Biochem Biophys Res Commun 351, 485-491.

Yang, G., Wu, L., Jiang, B., Yang, W., Qi, J., Cao, K., Meng, Q., Mustafa, A.K., Mu, W., Zhang,
S., Snyder, S.H., Wang, R., 2008. H2S as a physiologic vasorelaxant: hypertension in
mice with deletion of cystathionine gamma-lyase. Science 322, 587-590.

Yang, H., Shi, M., Story, J., Richardson, A., Guo, Z., 2004. Food restriction attenuates age-
related increase in the sensitivity of endothelial cells to oxidized lipids. J Gerontol A Biol
Sci Med Sci 59, 316-323.

Yang, W., Yang, G., Jia, X., Wu, L., Wang, R., 2005. Activation of KATP channels by H2S in
rat insulin-secreting cells and the underlying mechanisms. J Physiol 569, 519-531.

Yonezawa, D., Sekiguchi, F., Miyamoto, M., Taniguchi, E., Honjo, M., Masuko, T., Nishikawa,
H., Kawabata, A., 2007. A protective role of hydrogen sulfide against oxidative stress in
rat gastric mucosal epithelium. Toxicology 241, 11-18.

Yong, Q.C., Lee, S.W., Foo, C.S., Neo, K.L., Chen, X., Bian, J.S., 2008a. Endogenous hydrogen
sulphide mediates the cardioprotection induced by ischemic postconditioning. Am J
Physiol Heart Circ Physiol 295, H1330-H1340.

Yong, Q.C., Pan, T.T., Hu, L.F., Bian, J.S., 2008b. Negative regulation of beta-adrenergic
function by hydrogen sulphide in the rat hearts. J Mol Cell Cardiol 44, 701-710.

Zal, F., Leize, E., Lallier, F.H., Toulmond, A., Van Dorsselaer, A., Childress, J.J., 1998. S-
Sulfohemoglobin and disulfide exchange: the mechanisms of sulfide binding by Riftia
pachyptila hemoglobins. Proc Natl Acad Sci U SA 95, 8997-9002.

Zal, F., Suzuki, T., Kawasaki, Y., Childress, J.J., Lallier, F.H., Toulmond, A., 1997. Primary
structure of the common polypeptide chain b from the multi-hemoglobin system of the
hydrothermal vent tube worm Riftia pachyptila: an insight on the sulfide binding-site.
Proteins 29, 562-574.

Zanardo, R.C., Brancaleone, V., Distrutti, E., Fiorucci, S., Cirino, G., Wallace, J.L., 2006.
Hydrogen sulfide is an endogenous modulator of leukocyte-mediated inflammation.
Faseb J 20, 2118-2120.

Zhang, H., Zhi, L., Moochhala, S.M., Moore, P.K., Bhatia, M., 2007. Endogenous hydrogen
sulfide regulates leukocyte trafficking in cecal ligation and puncture-induced sepsis. J
Leukoc Biol 82, 894-905.

Zhao, W., Ndisang, J.F., Wang, R., 2003. Modulation of endogenous production of H2S in rat
tissues. Can J Physiol Pharmacol 81, 848-853.

Zhao, W., Wang, R., 2002. H(2)S-induced vasorelaxation and underlying cellular and molecular
mechanisms. Am J Physiol Heart Circ Physiol 283, H474-480.










Zhao, W., Zhang, J., Lu, Y., Wang, R., 2001. The vasorelaxant effect of H2S as a novel
endogenous gaseous KATP channel opener. Embo J 20, 6008-6016.

Zhao, X., Zhang, L.K., Zhang, C.Y., Zeng, X.J., Yan, H., Jin, H.F., Tang, C.S., Du, J.B., 2008.
Regulatory effect of hydrogen sulfide on vascular collagen content in spontaneously
hypertensive rats. Hypertens Res 31, 1619-1630.

Zhong, G., Chen, F., Cheng, Y., Tang, C., Du, J., 2003. The role of hydrogen sulfide generation
in the pathogenesis of hypertension in rats induced by inhibition of nitric oxide synthase.
J Hypertens 21, 1879-1885.









BIOGRAPHICAL SKETCH

Benjamin Predmore was born in Allentown, Pennsylvania in 1983. An only child, he grew

up in the rural area outside of Bangor, Pennsylvania, graduating from Bangor Area Senior High

School in 2001. He earned his bachelor' s degree in Biology from the Pennsylvania State

University (PSU) in 2005. While at PSU, he was active in research working in the lab of Dr.

Charles Fisher beginning in 2002.

While in the Fisher lab he participated in community ecology studies of the hydrocarbon

seep communities in the Gulf of Mexico. This afforded him the opportunity to participate in two

research cruises to the Gulf of Mexico during the summers of 2003 and 2004 onboard the R/V

Seward Johnson II. During these cruises he was able to make a total of dives on a variety of

hydrocarbon seep sites onboard the DSV Johnson Sea-link I. In addition to community ecology

work, he was also responsible for sampling the hydrogen sulfide concentrations around the water

column of these sites. Due to the volatility of hydrogen sulfide and it' s rapid oxidation in

seawater, this assay required strict attention to detail and had to be performed in very in a

nitrogen-filled glove bag in oxygen-free conditions. This experience primed him for his doctoral

work with hydrogen sulfide, and also allowed him to meet with Dr. David Julian of the

University of Florida who also worked extensively with hydrogen sulfide and gave Ben some

key troubleshooting techniques for his assay.

In 2005, Ben j oined the Doctor of Philosophy program in the Department of Zoology at the

University of Florida under the supervision of Dr. Julian working on the mechanisms of

hydrogen sulfide signaling in mammals. Upon completion of his doctorate, Ben will work as a

post-doctoral member in the laboratory of Dr. David Lefer at Emory University. There he will

learn new surgical techniques on murine, and porcine models, continuing investigation of

hydrogen sulfide signaling.





PAGE 1

1 INVESTIGATION INTO THE MECHANISMS OF HYDROGEN SULFIDE SIGNALING IN THE CARDIOVASCULAR SYSTEM AND THE EFFECTS OF AGE AND CALORIC RESTRICTION By BENJAMIN LEE PREDMORE A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2009

PAGE 2

2 2009 Benjamin Lee Predmore

PAGE 3

3 To my Grandparents, Roy and Dorothy Predmore andmyParents, Roy and Donna Predmore

PAGE 4

4 ACKNOWLEDGMENTS I would like to thank my committee for their valuable input throughout my work on this dissertation: David Julian, Dave Evans, Lou Guillette, Christiaan Leeuwenburgh, and Charles Wood. I thank my parents for their support of my academic pursuits. I would also like to thank the members of the various labs I have worked in who have helped me to complete my work. From the Julian lab, I thank Joanna Joyner-Matos, Jennessa Andrzejewski, Maikel Alendy, and Khadija Ahmed. From the Leeuwenburgh lab,I thank Stephanie Wohlgemuth, Brian Bouverat, Emanuele Marzetti, and Jinze Xu, and Hazel Lees. I thank Arturo Cardounel and from his lab Pat Kearns, Kanchana Karuppiah,Scott Forbes, and Arthur Pope. I would alsolike to thank Christy Carter, Drake Morgan, and Tom Foster for their donation of aorta tissue used in some of the experiments. This work was supported in part by a Multidisciplinary Training Program in Hypertension (NIH T32 HL083810)through the UF Hypertension Center.

PAGE 5

5 TABLE OF CONTENTS Page ACKNOWLEDGMENTS...............................................................................................................4 LIST OF FIGURES.........................................................................................................................8 ABSTRACT...................................................................................................................................10 CHAPTER 1 HYDROGEN SULFIDE: PAST,PRESENT AND FUTURE...............................................12 Introduction.............................................................................................................................12 Hydrogen Sulfide is an Environmental and Industrial Toxin.................................................12 Hydrogen Sulfide is an Energy Source for Chemosynthetic Communities...........................14 Hydrogen Sulfide is a Gasotransmitter and Physiological Modulator...................................15 Enzymatic Production of Hydrogen Sulfide...........................................................................16 Regulation of Hydrogen Sulfide Production..........................................................................16 Physiological Actions of Hydrogen Sulfide...........................................................................17 Interactions between the Gasotransmitters.............................................................................21 Hydrogen Sulfide Chemistry and Technical Considerations..................................................23 2 NITRIC OXIDE, ADENOSINE TRIPHOSPHAE (ATP)-SENSITIVE POTASSIUM CHANNELS, AND ARACHIDONIC ACID METABOLITES MODULATE THE TRIPHASIC RESPONSE TO HYPOXIA AND HYDROGEN SULFIDE IN RAT AORTA...................................................................................................................................26 Abstract...................................................................................................................................26 Introduction.............................................................................................................................26 Materials and Methods...........................................................................................................28 Results.....................................................................................................................................31 Discussion...............................................................................................................................33 Initial Contraction Phase.................................................................................................34 Relaxation Phase.............................................................................................................35 Second Contraction Phase...............................................................................................36 Conclusion.......................................................................................................................37 3 HYDROGEN SULFIDE INCREASES NITRIC OXIDE PRODUCTION FROM ENDOTHELIAL CELLS BY A PROTEIN KINASE B (AKT)-DEPENDENT MECHANISM........................................................................................................................44 Abstract...................................................................................................................................44 Introduction.............................................................................................................................44 Materials and Methods...........................................................................................................45 Chemicals........................................................................................................................45 Bovine ArterialEndothelial Cell Culture........................................................................45

PAGE 6

6 Hydrogen SulfideExposure............................................................................................46 Akt Blockade...................................................................................................................46 Electron Paramagnetic Resonance Detection of Nitric Oxide........................................46 Western Blotting..............................................................................................................47 Statistics...........................................................................................................................48 Results.....................................................................................................................................48 Discussion...............................................................................................................................49 4 THE HYDROGEN SULFIDE SIGNALING SYSTEM: CHANGES DURING AGING AND THE BENEFITSOF CALORIC RESTRICTION........................................................55 Abstract...................................................................................................................................55 Introduction.............................................................................................................................56 Materials and Methods...........................................................................................................58 Chemicals........................................................................................................................58 Animals............................................................................................................................58 Western Blotting..............................................................................................................58 RNA Extraction...............................................................................................................59 Real-Time PCR...............................................................................................................59 Hydrogen SulfideProduction..........................................................................................60 Myography......................................................................................................................62 Statistics...........................................................................................................................63 Results.....................................................................................................................................63 Cystathionine Gamma-Lyase and Cystathionine Beta-Synthase Protein Expression.....63 Cystathionine Gamma-Lyase and Cystathionine Beta-Synthase Messenger Ribonucleic Acid (mRNA) Expression.......................................................................64 Hydrogen SulfideProduction..........................................................................................64 Contractile Response to Hydrogen Sulfidein Aorta.......................................................65 Discussion...............................................................................................................................66 Cystathionine Gamma-Lyase and Cystathionine Beta-Synthase Protein Expression.....66 Cystathionine Gamma-Lyase and Cystathionine Beta-Synthase mRNA Expression.....68 Hydrogen SulfideProduction..........................................................................................69 Contractile Response to Hydrogen Sulfidein Aorta.......................................................70 Conclusions.....................................................................................................................71 5 SYNTHESIS: UNDERSTANDING HYDROGEN SULFIDE SIGNALING IN VASCULAR SMOOTH MUSCLE AND THE TRIPHASIC RESPONSE...........................81 Introduction.............................................................................................................................81 What is Modulating Phase 1 of the Triphasic Response?.......................................................82 What is Modulating Phase 2 of the Triphasic Response?.......................................................83 What is Modulating Phase 3 of the Triphasic Response?.......................................................85 A Proposed Time-course and Mechanism of the Triphasic Response...................................85 Conclusions and Future Directions.........................................................................................86 LIST OF REFERENCES...............................................................................................................89

PAGE 7

7 BIOGRAPHICAL SKETCH.......................................................................................................104

PAGE 8

8 LIST OF FIGURES Figure Page 1-1 Enzymatic production of hydrogen sulfide by cystathionine beta-synthase and cystathionine gamma-lyase................................................................................................25 2-1 Representative tracings of the effect of hypoxia or hydrogen sulfide...............................38 2-2 Duration of the triphasic response to hypoxia or hydrogen sulfide...................................39 2-3 Magnitude of the first phase of the triphasic response to hypoxia or hydrogen sulfide with inhibitors of nitric oxide, adenosine triphosphate (ATP)-sensitive potasium channels, and arachadonic acid metabolites......................................................................40 2-4 Magnitude of the second phase of the triphasic response to hypoxia or hydrogen sulfide with inhibitors of nitric oxide, ATP-sensitive potasium channels, and arachadonic acid metabolites.............................................................................................41 2-5 Magnitude of the third phase of the triphasic response to hypoxia or hydrogen sulfide with inhibitors of nitric oxide, ATP-sensitive potasium channels, and arachadonic acid metabolites.................................................................................................................42 2-6 Magnitude of the triphasic response to hypoxia or hydrogensulfide with or without an intact endothelium.........................................................................................................43 3-1 The effect of hydrogen sulfide on nitric oxide production by bovine arterial endothelial cells.................................................................................................................51 3-2 The effect of hydrogen sulfide on endothelial nitric oxide phosphorylation.....................52 3-3 The effect of Akt inhibition on hydrogen sulfide-stimulated nitric oxide production.......54 4-1 Effect of age and diet on cystathionine gamma-lyase and cystathionine beta-synthase protein expression..............................................................................................................73 4-2 Effect ofdiet on cystathionine gamma-lyase and cystathionine beta-synthase mRNA expression..........................................................................................................................74 4-3 Effect of diet on hydrogen sulfide production...................................................................75 4-4 Representative tension tracing of a rat aorta ring to hydrogen sulfide..............................76 4-5 Effect of age on potassium chloride-and norepinephrine-induced contractions and the first phase contraction to hydrogen sulfide..................................................................77 4-6 Effect of diet on potassium chloride-and norepinephrine-induced contractions...............78

PAGE 9

9 4-7 Effect of diet on hydrogen sulfide-induced contractions...................................................79

PAGE 10

10 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy INVESTIGATION INTO THE MECHANISMS OF HYDROGEN SULFIDE SIGNALING IN THE CARDIOVASCULAR SYSTEM AND THE EFFECTS OF AGE AND CALORIC RESTRICTION By Benjamin Lee Predmore August2009 Chair: David Julian Major: Zoology The gasotransmitter hydrogen sulfide (H 2 S) modulates vascular tone in vertebrates. Hydrogen sulfide and hypoxia elicit similar contractile responses in vertebrate smooth muscle, while both H 2 S and nitric oxide (NO) elicit synergistic vasodilatory responses. Aging has negativeimpacts on the cardiovascular system, which can be attenuated by caloric restriction (CR). The mechanisms behind H 2 S and hypoxia signaling and the synergy with NO are unknown, as well as whether aging and CR affect hydrogen sulfide signaling. I investigated the mechanisms through which aorta rings respond to hydrogen sulfideand hypoxia, how hydrogen sulfideregulates endothelial NO production, and how aging and CR affect the H2 S signaling system. I used bovine arterial endothelial cells and Fisher 344 x Brown Norway rats,6-38 months of age, maintained on an ad libitum (AL) or CR diet. To investigate aging and CR, I measured protein and mRNA expression of the hydrogen sulfide producing enzymes cystathioneine lyase (CSE) and cystathionine synthase (CBS)and the rate of hydrogen sulfide production from aorta and liver tissues, in addition to functional assessment using aorta rings. In the first study, I found that hypoxia and hydrogen sulfideelicit a triphasic, contractionrelaxation-contraction response. However, the mechanisms are not the same between hypoxia

PAGE 11

11 and hydrogen sulfide. In the second study, I found that hydrogen sulfidestimulated a two-fold increase in NO production from endothelial nitric oxide synthase (eNOS). Phosphorylation of eNOS at Ser 1177 was also significantly increased, and inhibition of Akt attenuated this. In the third study, I found that the first phase contraction increased in sensitivity to hydrogen sulfide with age, while CR increased the magnitude of all phases. AL aorta CSEand CBS protein expression increased with age, but remained unchanged with CR. Liver CSE and CBS protein expression remained constant with age. Aorta CSE and CBS mRNA expression was higher with CR. Hydrogen sulfide production was also higher with CR in aorta and liver. I conclude that in rat aorta the triphasic responses to hypoxia and H 2 S are mediated by different mechanisms, hydrogen sulfideup-regulates eNOS/NO production through an Akt-dependent mechanism, and the increased sensitivity to hydrogen sulfide and increased protein expression of CSE and CBS with age in aorta point to a drop in hydrogen sulfide bioavailability, while CR maintains CSE/CBS function. These studies reveal novel, age-sensitive mechanisms of hydrogen sulfide action to regulate vascular tone. They also illustrate the benefit of CR on the hydrogen sulfide signaling system. This is quite timely, given the emerging roles of hydrogen sulfide in cardiovascular pathologies.

PAGE 12

12 CHAPTER 1 HYDROGEN SULFIDE: PAST, PRESENT AND FUTURE Introduction Hydrogen sulfide, a name often used to refer to sum of the chemical species H 2 S, HS and S 2 has had a long and interesting development in the scientific literature. The face of hydrogen sulfide has changed within the last 40 years from an environmental and industrial toxin, to an energy source for chemosynthetic communities, and most recently as a gaseous physiological modulator, or gasotransmitter (Wang 2002), and a potential therapeutic agent in medicine. To familiarize the reader with the many aspects of hydrogensulfide, this chapter will briefly examine the chemistry and toxicology of hydrogen sulfide as well as the chemosynthetic communities that it fuels, and then focus on its recent induction into the gasotransmitter family and its transition into biomedical research and therapeutic applications. Hydrogen Sulfide is an Environmental and Industrial Toxin There are many toxic and potentially lethal actions of hydrogen sulfide, the most significant of which is the reversible inhibition of the electron transport chain via cytochrome c oxidase (Nicholls 1975; Nicholls et al. 1982; Khan et al. 1990). This reversible inhibition can occur at 1(Nicholls et al. 1982; Bagarinao 1992), and is mechanistically very similar to cyanide poisoning (Nicholls et al. 1982; Shepherd et al. 2008) Other mechanisms of sulfide toxicity include opening of the mitochondrial permeability transition pore (Eghbal et al. 2004; Julian et al. 2005a); increasing production of reactive oxygen species (including superoxide) (Chen et al. 1972; Tapley et al. 1999; Eghbal et al.2004; Julian et al. 2005a); out-competing oxygen for hemoglobin binding, causing formation of sulfhemoglobin (Bagarinao et al. 1992; Kraus et al. 1996; Vlkel et al. 2000); and inhibition of about 20 other enzymes (Bagarinao 1992).

PAGE 13

13 Various degrees of exposure to hydrogen sulfide can occur, and consequently the observed or experienced side effects vary. The effects of exposure to hydrogen sulfide can range from smelling a strong foul odor (> 3-5 ppm, described as the smell of rotten eggs), to olfactory nerve paralysis (> 150 ppm), to a headache (> 500 ppm), to dizziness and eventually loss of consciousness and death (500-1000 ppm or greater) (Beauchamp et al. 1984). Hydrogen sulfide is produced in large quantities in some environments, and because of this many animals are intermittently or chronically exposed to hydrogen sulfide. Environmental hydrogen sulfide is a product of anaerobic, sulfate-reducing, bacterial metabolism (Bagarinao 1992; Attene-Ramos et al. 2007). Environments characterized by hydrogen sulfide include the anoxic layer of marine sediments (i.e. beaches, coastal lagoons, mangrove swamps, and salt marshes), stagnant basins and anoxic fjords, and the digestive tract of animals (Bagarinao 1992; Attene-Ramos et al. 2007). Hydrothermal vents and hydrocarbon seeps are also characterized by hydrogen sulfide, but the source of hydrogen sulfide at these sites is a mixture of geological and biological processes. These environments will be further characterized below. Anthropogenic activities can also belarge sources of hydrogen sulfide. Over 70 industries involve or produce concentrations of hydrogen sulfide that are often in toxic to lethal doses (> 50 ppm) (Beauchamp et al. 1984). These range from paper mills, tanneries, large-scale aquaculture, rayon production, petroleum and natural gas operations, sewage plants, and many other industries that involve livestock (i.e. dairy and pig farms), where hydrogen sulfide is produced from organic waste (Bagarinao 1992; Yalamanchili et al. 2008). Not surprisingly there are numerous published case-studies of workers in these industries who have experienced highly toxic yet sub-lethal doses (Tvedt et al. 1991; Fenga et al. 2002; Gangopadhyay et al. 2007), or lethal doses of hydrogen sulfide (Tatsuno et al. 1986; Yalamanchili et al. 2008). Hydrogen

PAGE 14

14 sulfide poisoning still remains an everyday risk for those working in the petroleum, sewer, maritime, and mining industries (Yalamanchili et al. 2008). Animals that are adapted to environments with hydrogen sulfide have avoidance behaviors in addition to antioxidant defenses and detoxification mechanisms to protect themselves from acute and/or chronic exposure to hydrogen sulfide (Bagarinao 1992). Most of these animals have a very similar set of detoxification mechanisms, including specialized hemoglobin that can bind both oxygen and hydrogen sulfide (Martineu et al. 1997; Zal et al. 1997; Zal et al. 1998; Hourdez et al. 2000), conversion of sulfide to thiosulfate (Levitt et al. 1999; Doeller et al. 2001), and storage of sulfide as both taurine and thiotaurine (Joyner et al. 2003). However, in some invertebrates, hydrogen sulfide can also be used as the terminal electron acceptor in aerobic respiration (Doeller et al. 2001; Kraus et al. 2004). Hydrogen Sulfide is an Energy Source for Chemosynthetic Communities The discovery of hydrothermal vent communities in 1977greatly increased the rate of scientific publications regarding hydrogen sulfide (Lonsdale 1977). Not long after the discovery of hydrothermal vent communities, hydrocarbon seep communities were discovered (Hecker 1985). At these sites geothermal and volcanic activities (McMullin et al. 2000) or the pressure of rising salt-domes (Claypool et al. 1983) contribute to releasing hydrogen sulfide into the water column. This hydrogen sulfide fuels a unique chemosynthetic ecosystem. Many invertebrates thrive in hydrothermal vents, including several species of tubeworms, such as Riftia pachyptila and Tevnia jerichonana at the vents and Lamellibrachia luymesi and Seepiophila jonesi at the seeps. These animals lack a mouth, gut and anus and instead live in a chitonous tube that containsa sack-like structure termed the trophosome. This sack contains bacterialsymbionts that use energy from sulfide oxidation to fix carbon into organic molecules, some of which are provided to the host tubeworm for its nutrition (Hand et al. 1983). These

PAGE 15

15 tubeworms have specialized hemoglobin to transport oxygen and hydrogen sulfide from the respiratory surface to the bacteria without the animal becoming poisoned itself (Martineu et al. 1997; Zal et al. 1997; Zal et al. 1998; Hourdez et al. 2000). In addition to specialized hemoglobin, hydrocarbon seep tubeworms also have posterior extensions, termed roots, to obtain hydrogen sulfide from below the sediment-water interface (Julian et al. 1999). Hydrogen Sulfide is a Gasotransmitter and Physiological Modulator Since hydrogen sulfide has had a long history as a toxin, it was very surprising to find that hydrogen sulfide can be endogenously produced in a variety of animal tissues and that it has both neuromodulatory (Abe et al. 1996)and cardiovascular regulatory effects in mammals (Hosoki et al. 1997). Since its discovery of its neuromodulatory abilities (Abe et al. 1996), hydrogen sulfide has been added to the family of gasotransmitters (Wang 2002), which also includes nitric oxide (NO) and carbon monoxide (CO). The discovery of gasotransmitters began with the work on the actions of NO by Murad, Furchgott and Ignarro from 1977-1986 (Furchgott 1999), who in 1988shared the Nobel Prize in Physiology or Medicine for their work. The discovery of the gasotransmitter function of CO by Verma and colleagues followed shortly thereafter in 1993 (Verma et al. 1993) Finally, investigations of hydrogen sulfide as a physiological modulator began in 1996-1997 with the work of Abe and Kimura (Abe et al. 1996)and Hosoki, Matsuki and Kimura (Hosoki et al. 1997). All three gasotransmitters, CO, NO and H 2 S, share several similarities. They are endogenously produced, small gas molecules that are capable of physiological action (Wang 2002). They can easily diffuse across cell membranes to exert their function (Wang 2002). They do not require a mechanism of degradation or reuptake because they are all very reactive, and they use heme as a common sink (Wang 2002).

PAGE 16

16 Enzymatic Production of Hydrogen Sulfide All of the gasotransmitters are endogenously produced by enzymatic reactions. Nitric oxide is produce from L-arginine by nitric oxide synthase (NOS). Carbon monoxide is produced from heme by heme oxygenize (HO). In mammalian tissues, hydrogen sulfide is primarily produced from L-cysteine by two PLP (pyridoxal-5-phosphate)-dependent, cysteine metabolic enzymes: cystathionine gamma-lyase (CSE) and cystathionine beta-synthase (CBS) (Julian et al. 2002; Zhao et al. 2003). However, several other enzymatic pathways exist for the production of hydrogen sulfide, including via cysteine amino transferase or cysteine lyase (Julian et al. 2002). CSE is expressed in endothelial cells and vascular smooth muscle cells (Hosoki et al. 1997; Wang 2002; Wang 2003; Yang et al. 2008), and is the predominant enzyme for hydrogen sulfide production in the cardiovascular system. In the CSE reaction (Figure 1-1), L-cysteine must first dimerize to form cystine, which is then transformed into pyruvate, thiocystine and NH3 by CSE. CSE can then catalyze the reaction of thiocystine with other thiol compounds to from H 2 S and CysSR (Julian et al. 2002). Alternatively, thiocystine may form H 2 Sand cystine nonenzymatically (Cavallini et al. 1962). CBS is the predominant enzyme for hydrogen sulfide production in the nervous system (Abe et al. 1996). In the CBS reaction (Figure 1-1), L-cysteine is hydrolyzed to yield equimolar amounts of H 2 S and L-serine (Cavallini et al. 1962). Julian and colleaguesshowed that hydrogen sulfide is produced in invertebrate tissues from CBS and CSE (Julian et al. 2002) revealing that gasotransmitters have a deeper phylogenic history than just vertebrates. Hydrogen sulfide has been shown to act as a signaling molecule in a variety of invertebrates (Julian et al. 1998; Julian et al. 2002; Gainey et al. 2005; Julian et al. 2005b) as has nitric oxide (Gainey et al. 2003; Palumbo 2005). Regulation of Hydrogen Sulfide Production Hydrogen sulfide production by CBS and CSE can be physiologically regulated, although

PAGE 17

17 the mechanisms are poorly understood. Sex hormones appear to regulate brain hydrogen sulfide production by CBS, with males having higher hydrogen sulfide concentration in the brain than females (Eto et al. 2002b). This can be reversed either by castration of males or by testosterone injection in females (Eto et al. 2002b). CBS activity in vitro can also be regulated by S-adenosylmethionine (SAM), an allosteric activator ofCBS (Eto et al. 2002b).CSEalso appears to be calcium-calmodulin dependent, and can be stimulated through muscarinic receptor activation of intracellular calcium (Yang et al. 2008). Hydrogen sulfideproduction may also be regulated by the other gasotransmitters. NO and CO may bindto and inactivate CBS, with CO being the more potent inactivator than NO (Taoka et al. 2001; Puranik et al. 2006). In contrast, NO seems to stimulate hydrogen sulfide production inthe cardiovascular system (Lowicka et al. 2007): NO donors stimulate CSE-dependent hydrogen sulfide production in aorta tissue homogenates in a cGMP-mediated manner (Zhao et al. 2003), and incubation of vascular smooth muscle cells with NO donors increases CSE protein and mRNA expression (Zhao et al. 2001). Sodium nitroprusside (SNP), an NO donor, increases the activity of brain CBS in vitro butthis effect results from chemical modification of the cysteine groups of CBS, rather than a direct action of NO itself (Eto et al. 2002a). Physiological Actions of Hydrogen Sulfide Abeand Kimura were the first to show a physiological role for hydrogen sulfide (Abe et al. 1996). They demonstrated that hydrogen sulfide was not only produced in the brain by CBS, but that it increased N-methyl-D-aspartic acid(NMDA) receptor-mediated responses and facilitated hippocampal long-term potentiation (Abe et al. 1996). Since then many actions have been reported. These include the ability to upregulate -aminobutyric acid B (GABA B ) receptors in the brain (Han et al. 2005), regulate cerebrovascular circulation (Leffler et al. 2006)and play a

PAGE 18

18 role in cerebral ischemic damage after a stroke (Qu et al. 2006), mediate learning and memory formation (Partlo et al. 2001), stimulate L-type calcium channels in neurons (Garcia-Bereguiain et al. 2008), negatively regulate the hypothalamo-pituitary-adrenal axis (Dello Russo et al. 2000), and protect neurons from oxidative stress (Kimura et al. 2004; Kimura et al. 2006). A multitude of functions for hydrogen sulfide have been reported in the cardiovascular system, particularly in the vascular smooth muscle. One of the most important sites of action of hydrogen sulfide is the ATP-sensitive K + channel (K ATP) in smooth muscle cells, which causes hyperpolarization and relaxation (Zhao et al. 2001). However, hydrogen sulfide has also been shown to cause contraction, relaxation or multiphasic responses in aorta (Hosoki et al. 1997; Zhao et al. 2001; Dombkowski et al. 2005), mesenteric artery (Cheng et al. 2004; Tang et al. 2005), cerebral artery(Leffler et al. 2006), gastric artery (Kubo et al. 2007c), mammary artery (Webb et al. 2008), and pulmonary arteries (Dombkowski et al. 2005; Wang et al. 2008). These responses, however, all depend on the concentration of hydrogen sulfide and O 2 the specific vessel examined, and the animal model used (Dombkowski et al. 2004; Dombkowski et al. 2005).Hydrogen sulfide has also been associated with the pathology of a number of cardiovascular diseases, including hypertension and COPD (chronic obstructive pulmonary disease), in addition to hydrogen sulfides involvement in septic shock (Chunyu et al. 2003; Du et al. 2003; Hui et al. 2003; Yan et al. 2004; Chen et al. 2005).Additionally, hydrogen sulfide has recently been implicated in vasodilation of the corpus cavernosum (Srilatha et al. 2007; d'Emmanuele di Villa Bianca et al. 2009; Shukla et al. 2009)and the dysregulation of hydrogen sulfide has been linked to erectile dysfunction (Srilatha et al. 2006). Hydrogen sulfide also affects the heart itself. Hydrogen sulfide preconditioning of rat cardiomyocytes induces a cardioprotection against ischemia and reperfusion injury (Hu et al.

PAGE 19

19 2007). The proposed pathways in this protection include eNOS, K ATP channels, protein kinase C, extracellular signal regulated kinase (ERK 1/2), and phosphatidylinositol 3-kinase/proteine kinase B (Akt) (Hu et al. 2007; Yong et al. 2008a).Other cardiovascular targets of hydrogen sulfide are -adrenergic receptors (Yong et al. 2008b), carotid sinus baroreceptor (Xiao et al. 2007), NADPH oxidase-1, and Rac(1) (Ras-related C3 botulinum toxin substrate 1) (Muzaffar et al. 2008)and cyclooxygenase, potentially altering arachadonic acid metabolite levels aswell (Koenitzer et al. 2007). Recent evidence also suggests that hydrogen sulfideacts as an oxygen sensor in vertebrates and may be involved in vascular responses to hypoxia (Dombkowski et al. 2006; Olson et al. 2006; Olson 2008). The rationale is that the low oxygen levels during hypoxia allow accumulation of hydrogen sulfide in vascular tissue, which then modulates vascular tone. A role for hydrogen sulfidein the gastrointestinal system has also been emerging. As in other tissues, hydrogen sulfide is produced in gastric and intestinal tissues from CBS and CSE (Fiorucci et al. 2006), and has had several demonstrated functions. Hydrogen sulfide has been reportedto protect gastric mucosal epithelium from oxidative stress (Yonezawa et al. 2007)and enhance ulcer healing in rats (Wallace et al. 2007). Hydrogen sulfide also affects gut motility and secretion (Kubo et al. 2007c), relaxation of ileum (Hosoki et al. 1997), and can also inhibit motor patterns in human, rat and mouse colon (Gallego et al. 2008). In the liver, hydrogen sulfide regulates perfusion and biliary bicarbonate secretion (Fiorucci et al. 2005b; Fujii et al. 2005). In addition to actions of hydrogen sulfide in the nervous, cardiovascular, and gastrointestinal systems, there is evidence that hydrogen sulfide is involved in insulin secretion, also working through K ATP (Yang et al. 2005), as well as leukocyte adhesion and trafficking,via K ATP (Zhang et al. 2007),and leukocyte-mediated inflammation (Zanardo et al. 2006).

PAGE 20

20 Hydrogen sulfide has a protective role orantioxidant capacity in many systems. Hydrogen sulfide will readily scavenge hydrogen peroxide, and increase intracellular levels of reduced glutathione (GSH) (Kimura 2002; Pryor et al. 2006)and the hydrogen sulfide signaling system (including CSE and CBS) hasboth anti-oxidant (Kimura et al. 2004; Whiteman et al. 2004a; Kimura et al. 2006; Yan et al. 2006; Jha et al. 2008)and anti-inflammatory (Fiorucci et al. 2005a; Zanardo et al. 2006; Wallace 2007b)actions. Not surprisingly, there is large interest in its potential role as anNSAID and therapeutic agent for a variety of disorders, including hypertension (Fiorucci et al. 2007; Lowicka et al. 2007; Szabo 2007; Wallace 2007a; Wallace 2007b; Li et al. 2009). However, hydrogen sulfide is also reported to increase lipopolysaccharide-induced inflammation (Li et al. 2005). One of the more dramatic actions of hydrogen sulfide is greatly reducing metabolism in mice, resulting in a suspended animation-like state (Blackstone et al. 2005). While the possibility of inducing a suspended animation has tremendous potential, this has not yet been duplicated in animals larger than the mouse (Haouzi et al. 2008). Nonetheless, this discovery has led the creation of the Ikaria Corporation, a gas-drug company investigating both therapeutic potential of NO and H 2 S. Ikaria has produced a more stable form of Na 2 S called IK-1001, which is purportedly suitable for injection, and INOmax which is nitric oxide for inhalation. IK-1001 has been used in several research applications and finished Phase I clinical trials in 2008 (Elrod et al. 2007; Szabo 2007; Jha et al. 2008; Kiss et al. 2008). The metabolic effects of hydrogen sulfide are also seen in the nematode Caenorhabditis elegans in whichhydrogen sulfide increases thermotolerance and lifespan in (Miller et al. 2007). While still in research and development, it is clear that hydrogen sulfide has a very high therapeutic potential, much like NO and NO-donors.

PAGE 21

21 Interactions between the Gasotransmitters Hydrogen sulfide and the other gasotransmitters may interact with each other, but the interactions have not been firmly established. The early work on the interactions of hydrogen sulfide andNO indicated that the relationship was synergistic. In 1997 Hosoki et al showedthat hydrogen sulfide increasedthe effects of the NO donor SNP by up to 13-fold (Hosoki et al. 1997). Later, Julian et al. showed that SNP potentiates hydrogen sulfide-induced contractions in the body wall of the echiuran worm Urechis caupo (Julian et al. 2005b).. Not surprisingly, there have also been reports of negative interactions between the gasotransmitters. At a direct chemical level hydrogen sulfide can react with NO to form a nitrosothiol (Whiteman et al. 2006), and hydrogen sulfide can increase CO production from HO1, which can then inhibit NO production from iNOS (Oh et al. 2006). In studies of hypertension and pulmonary vascular structural remodeling (PVSR), exogenous hydrogen sulfide inhibits the NO/NOS pathway and upregulates the CO/HO-1 pathway (Qingyou et al. 2004; Li et al. 2006). Moreover, during hypertension the expression and activity of CSE decreases with a concomitant decrease in plasma hydrogen sulfide concentration (Qi et al. 2004; Xiaohui et al. 2005), while plasma NO levels and eNOS expression levels increase (Zhong et al. 2003). Accordingly, application of hydrogen sulfide (as NaHS) rescues rats from hypertension (Du et al. 2003; Qingyou et al. 2004; Yan et al. 2004)and application of hydrogen sulfide lessens aorta structural remodeling, decreases NO levels, and increases CO levels (Qingyou et al. 2004; Yan et al. 2004; Li et al. 2006). Similarly, increasing expression of HO-1 prevents development of hypertension and inhibits PVSR (Zhao et al. 2001). However, data have been published that contradict many of the interactions reported between the gasotransmitters and their respective enzymes. These discrepancies are likely the result of using different experimental systems, as well as differences in methodologies and

PAGE 22

22 techniques while working with hydrogen sulfide, which could alter or skew the results (see Technical Considerations below). For example, while several studies have demonstrated the positive effect of hydrogen sulfide on NO signaling and NO production (Chapter 3, Hosoki et al. 1997; Yong et al. 2008a), several other studies show negative effects of hydrogen sulfide on NO production (Geng et al. 2007; Kubo et al. 2007b; Kubo et al. 2007c). This discrepancy is likely because the latter investigators waited for hours to look for an effect of hydrogen sulfide, when the positive effect on NO production can be observed in minutes (Chapter 3). The absence of a sustained effect is likely because H 2 S is so volatile and can rapidly oxidize in solution (see below). It is also unclear whether the action of hydrogen sulfide on K ATPis universal. Rui Wang and colleagues show that hydrogen sulfide causes a direct activation of K ATP and that glibenclamide (an K ATP inhibitor) inhibits the action of hydrogen sulfide (Zhao et al. 2001; Wang 2002; Zhao et al. 2002; Tang et al. 2005; Yang et al. 2005). However, the precise mechanism for this activation still remains unknown, and others, including myself (Chapter 2), have not seen the same effect of glibenclamide. In these cases glibenclamide either does not work at all (Kiss et al. 2008), or only partially inhibits the relaxation to hydrogen sulfide (Chapter 2, Kubo et al. 2007a; Kubo et al. 2007b; Kubo et al. 2007c; Webb et al. 2008). An additional receptor of hydrogen sulfide, the Cl /HCO 3 exchanger, has recently been revealed (Kiss et al. 2008). This receptor, when inhibited using the anion exchanger inhibitor 4,4'-Diisothiocyanatostilbene-2,2'-disulfonate (DIDS), completely blocks the hydrogen sulfide relaxation (Kiss et al. 2008). From this it is evident that hydrogen sulfide is likely working through both K ATP and the Cl /HCO 3 exchanger. However, these receptors only apply to the

PAGE 23

23 relaxation observed to hydrogen sulfide. The mechanism(s) behind the contractile, or multiphasic responses to hydrogen sulfide have yet to be identified. Hydrogen Sulfide Chemistry and Technical Considerations Hydrogen sulfide exists as a gas (H 2 S, dihydrogen sulfide) and is a weak acid in solution, dissociating into HS and S 2 There are three commonly used methods to create hydrogen sulfide solutions in the laboratory. One way is to bubble distilled water or a physiological buffer directly with hydrogen sulfidegas. However, this method is not as accurate as using a known amount of a chemical donor. Two chemical donors, sodium(Na2 S) and sodium hydrosulfide (NaHS), are widely used instead of hydrogen sulfide gas. Na 2 S crystals are clear, and once the oxidized portions are rinsed from the crystals with distilled water, they can be measured out as any other chemical. NaHS is in the form of yellow flakes, and the oxidized portions cannot be easily rinsed before weighing since the flakes immediately dissolve upon contact with water. Na 2 S is argued to be a better hydrogen sulfide donor than NaHS for making solutions because of its higher purity. It is thought that oxidation products formed from the impurities in NaHS solutions may interfere with physiological experiments (Koenitzer et al. 2007). However, Na 2 S is highly basic and may cause confounding effects by altering pH of buffers if used in high concentrations. Despite this, both donors have been commonly used in published studies. Working in a fume hood is recommended when dealing with hydrogen sulfide because higher levels of hydrogen sulfide can prevent its olfactory detection and thesesymptoms can rapidly progress during a high, acute exposure. Therefore, it is important at first notice of hydrogen sulfide gas to move to a well-ventilated area to avoid increased exposure and more severe symptoms. In solution, hydrogen sulfide exists asthree species: H2 S, HS and S 2 (see Equation1). H 2 S HS + H + S 2 + H + (1)

PAGE 24

24 Because the pKa for the first dissociation is 7.02-7.04 (Chen1972; Beauchamp et al. 1984)and the estimated pKa of the second dissociation is 12-15 (Chen1972; Beauchamp et al. 1984; Bagarinao 1992), at a physiological pH of 7.4 hydrogen sulfide exists as approximately 1/3 H 2 S and 2/3 HS with very little S 2 (Beauchamp et al. 1984). This approximate relationship holds true in fresh-and salt-water environments, although variation in pH will shift the H2 S/HS equilibrium. Therefore when working with and discussing the effects of hydrogen sulfide, it is important to take into account not only H 2 S gas, but the HS anion. Throughout this dissertation the term hydrogen sulfide will refer to the sum of the species H 2 S, HS and S 2 unless otherwise specified. Hydrogen sulfidegas is very volatile (Cline 1969; Julian et al. 1998; Dorman et al. 2002) and will readily come out of solution, causing a net loss of hydrogen sulfide. This loss is exacerbated by the fact that hydrogen sulfide will readily oxidize in the presence of divalent metals and oxygen (Tapley et al. 1999), a condition that is prevalent in most physiological buffers, blood, sea water, and extracellular fluid. Therefore, an additional complication that faces the experimenter when working with hydrogen sulfide is its ephemeral nature. This not only makes the detection of hydrogen sulfide in low quantities a challenge, but rigorous deoxygenation measures must be taken to make accurate stock solutions of hydrogen sulfide for experimentation. All solutions should also be made immediately prior to experimentation to assure the hydrogen sulfide concentration has not changed significantly due to oxidation and volatilization.

PAGE 25

25 Figure 1-1. -synthase (CBS) and -lyase (CSE). Figure adapted from Julian et al. 2002. In the CBS reaction (1), L-cysteine is hydrolyzed to yield equimolar amounts of H 2 S and Lserine. In the CSE reaction (2), L-cysteine must first dimerize to form cystine, which is then transformed into pyruvate, thiocystine and NH 3 by CSE. CSE can then catalyze the reaction of thiocystine with other thiol compounds to from H 2 S and CysSR. Alternatively, thiocystine may form H 2 Sand cystine non-enzymatically.

PAGE 26

26 CHAPTER 2 NITRIC OXIDE, ADENOSINE TRIPHOPHATE (ATP)-SENSITIVE POTASSIUM CHANNELS,AND ARACHIDONIC ACIDMETABOLITES MODULATETHE TRIPHASIC RESPONSE TO HYPOXIA AND HYDROGEN SULFIDE IN RAT AORTAAbstract Hypoxia and hydrogen sulfide elicit similar contractile responses in every vertebrate smooth muscle thus far tested, but the mechanism of each is poorly understood. In aorta preparations, the responses to hypoxia and hydrogen sulfide can be mediated by blockade of nitric oxide (NO), ATP-sensitive potassium channels (K ATP ), and arachidonic acid metabolites, but no study has determined whether the effects of blockade are similar in the same tissue preparation. We tested this with aortic rings from Fisher 344 and Fisher 344 x Brown Norway rats using standard vascular myography techniques. We found that both hypoxia and hydrogen sulfide elicit a triphasic, contraction-relaxation-contraction response. The NO synthase inhibitor L-NAME and the K ATP inhibitor glibenclamide significantly reduced hypoxia-induced contraction phases, while the hypoxia-induced relaxation phase was reduced only by glibenclamide. An arachidonic acid metabolisminhibitor cocktail (AAM inhibitor cocktail) of esculetin (to inhibit lipoxygenase), clotrimazole (to inhibit Cytochrome P-450) and indomethacin (to inhibit cyclooxygenase) did not have an effect on either hypoxia-induced contraction or relaxation. In contrast, the hydrogen sulfide response was affected onlyby the AAM inhibitor cocktail, which reduced the second contraction phase. We conclude that in rat aortic smooth muscle the triphasic responses to hypoxia and hydrogen sulfide are mediated by different signaling mechanisms. Introduction Hydrogen sulfide (H 2 S) is the newest member of the gasotransmitter family, joining nitric oxide (NO) and carbon monoxide (CO) (Wang 2002; Wang 2003). Hydrogen sulfide is produced

PAGE 27

27 from L-cysteine by cystathionine -lyase in vascular smooth muscle and endothelial cells (Wang 2002; Wang 2003; Yang et al. 2008)and it elicits a variety of effects in the vasculature when applied exogenously (Dombkowski et al. 2005). Furthermore, hydrogen sulfide may be intrinsic to or interact with hypoxia signaling, since accumulation of endogenous hydrogen sulfide would be favored by hypoxia and exogenous hydrogen sulfide mimics the effects of hypoxia in smooth muscle (Olson et al. 2006). Consistent with this, the vascular response to hypoxia is decreased by inhibitors of hydrogen sulfide production and enhanced by addition of L-cysteine (Olson et al. 2006; Olson et al. 2008). The mechanisms underlying hypoxia-induced vascular responses, and whether they are identical to hydrogen sulfide-induced responses, are poorly understood. Here we investigate the mechanisms of the vascular responses to hypoxia and hydrogen sulfide in rat thoracic aorta by blocking three potential downstream effectors: NO, which causes cyclic GMP-mediated relaxation; ATP-sensitive potassium channels (K ATP ), which cause relaxation by hyperpolarizing smooth muscle cells (Wang 2002; Wang 2003); and arachidonic acid metabolites (AAM), which can be vasoconstrictors or vasodilators (Kompanowska-Jezierska et al. 2008). We hypothesized that both hypoxia and hydrogen sulfide would cause a similar multiphasic response, potentially mediated by NO, K ATP and AAM. While the contractile responses to hypoxia and hydrogen sulfide may both result from a reduction of bioavailable NO, the mechanisms may differ. Since NO synthase (NOS) is O 2 dependent, hypoxia may reduce NO bioavailability (Besse et al. 2002)thereby increasing vessel tension. Moreover, hypoxia may allow accumulation of endogenous hydrogen sulfide by decreasing its spontaneous oxidation (Olson et al. 2006). Hydrogen sulfide may itself reduce NO bioavailability by chemically reacting with NO to produce a nitrosothiol (Whiteman et al. 2006)

PAGE 28

28 and reduce NO production by inhibiting NOS (Geng et al. 2007). Therefore, blockade of NO production by inhibiting NOS shouldeliminate or reduce hypoxia-and hydrogen sulfide-induced contractions if they are the result of inhibition of NOS and/or reduced NO bioavailability by hypoxia and hydrogen sulfide. Furthermore, K ATP channels hyperpolarize smooth muscle cells and are activated by hydrogen sulfide (Wang 2002; Tang et al. 2005), so their blockade should reduce relaxation. Finally, hydrogen sulfide may directly interact with the hemes of cyclooxygenase and cytochrome P-450 (Koenitzer et al. 2007), potentially altering AAM production and consequently vascular tone. Therefore blockade of AAM may affect hypoxiaand hydrogen sulfide-induced responses. Materials and Methods Adult, male Fisher 344 x Brown Norway hybrid (N = 33) of ages 6-27 months of age were housed individually under standard conditionsand provided with food and water. Older animals (19-27 mo) were used in the hypoxia and hydrogen sulfide inhibitor experiments, while younger animals were used to investigate the role of the endothelium in the hydrogen sulfide response (610 mo). There was no significant variability in the responses within these two age groups. To reduce potential anesthesia artifacts on responses to hydrogen sulfide(Dombkowski et al. 2005), euthanasia was performed by guillotine according to IACUC-approved methods. After dissection, the thoracic aorta was carefully cleaned of fat and sectioned into 5 mm long rings. Four rings were then randomly selected, with each receiving one of four treatments: control; 1 mmol/L L-NAME to block NOS; 1 mol/L glibenclamide (a sulfonylurea derivative) to block K ATP ; or an AAM inhibitor cocktail consisting of 10 mol/L each of esculetin, clotrimazole, and indomethacin to block AAM (Dombkowski et al. 2004). Vessel rings were attached with stainless steel wire to a force transducer and mounted in a tissue bath system (Radnoti Glass Technology, Monrovia, CA) containing 37C Krebs bicarbonate buffer, pH 7.4, aerated with

PAGE 29

29 95% air/ 5% CO 2 A resting tension of 1.5 g was applied and maintained as vessels were allowed to equilibrate for at least 1 h. This tension was found to give the best response based on a tension response curve was generated for the Fisher 344 x Brown Norway hybrid rat aorta. At the start of each experiment, vessels were maximally contracted with 80 mmol/L KCl, and subsequently washed twice with Krebs buffer. This was repeated after 30 min, at which point the vessels had returned to resting tension of 1.5 g. This procedure ensures optimum in vitro vessel activity (Dombkowski et al. 2005). The second KCl contraction was also used to normalize the responses to the other agonists. To check for an intact endothelium, acetylcholine (Ach, 10 mol/L) was then added to cause relaxation. Vessels that failed to contract to KCl or relax to ACh were discarded. After two additional washes, the vessels were incubated with the respective inhibitors for 30 min and the tension on all rings was continuously adjusted to 1.5 g. Todetermine the response to hypoxia, vessels were precontracted with 1 mol/L phenylephrine (PE) and the buffer aeration was switched from 95% air / 5% CO 2 to 95% N 2 / 5% CO 2 after the PE contraction had stabilized (approximately 5 min). To determine the response to hydrogen sulfide, vessels were precontracted with PE, as above, but aeration with air was continued and 300 mol/L total hydrogen sulfide (referring to the sum of the chemical species: H 2 S, HS and S 2) was added to each bath as either sodium hydrosulfide (NaHS, N = 18) or sodium sulfide (Na 2 S, N = 6). After the response completed and vesseltension had stabilized, baths were washed twice and vessels returned to resting tension (30 min). Some experiments were performed with the endothelium removed. To achieve this, the rings were gently rubbed on the inside with a stainless steel wire (Chung et al. 2007). Rings were then checked to make sure endothelium was removed by addition of 10 mol/L ACh. In some experiments the components of the AAM inhibitor cocktail were added separately to investigate the individual contributions

PAGE 30

30 of COX (indomethacin, N = 6), LOX (esculetin, N = 7), and Cyt P-450 (clotrimazole, N = 7). Of the 33 animals tested, the final number that responded to both KCl and ACh, and therefore that were used in subsequent statistical analysis were as follows: control treatment, N = 17 for hypoxia and N = 20 for hydrogen sulfide; L-NAME treatment, N = 16 for hypoxia and N = 14 for hydrogen sulfide; glibenclamide treatment, N = 18 for hypoxia and N = 15 for hydrogen sulfide; AAM inhibitor cocktail treatment, N = 14 for hypoxia and N = 11 for hydrogen sulfide; removal of endothelium, N = 12 for hydrogen sulfide (hypoxia not tested). The magnitude of the hypoxia-and hydrogen sulfide-induced triphasic responses for each vessel were quantified in the following manner: the initial contraction was measured from the PE pre-contracted tension to the peak of the first contraction, the relaxation was measured from the peak of the first contraction to the base of the relaxation, and the second contraction was measured from the baseof the relaxation to the peak of the second contraction. The magnitude of contractions and relaxations were subsequently normalized to the magnitude of the second KCl contraction for that vessel (i.e., KCl contraction force = 100%). Significant differences from control values were determined by one-way ANOVA with a Tukey post-hoc test. A two-tailed Students t-test was used to compare the hypoxia-induced and hydrogen sulfide-induced control phases. For each combination of treatment and inhibitor, at least 13 rings were used for analysis. The statistical software used was JMP 7.0.1 (SAS Institute, Cary, NC USA), with p < 0.05 accepted as significant. Total hydrogen sulfide concentrations were measured by a methylene blue assay (GilboaGarber 1971)and were approximately 75% of calculated values (with the difference presumably being due to volatilization and oxidation of sulfide). In physiological saline at pH 7.4, hydrogen sulfide dissociation is approximately 1/3 H 2 S and 2/3 HS (Beauchamp et al. 1984). Therefore the

PAGE 31

31 true hydrogen sulfide gas (H 2 S) concentrations were typically ca 75 mol/L. Chemicals were purchased from Thermo Fisher Scientific (Waltham, MA) or Sigma-Aldrich (St. Louis, MO). Results Isolated rat aorta rings exposed to hypoxia alone showed a triphasic contraction-relaxationcontraction response that was complete in ca 90 min (Figure 2-1a). Isolated rat aorta rings exposed to hydrogen sulfide alone showed a similar triphasic contraction-relaxation-contraction response (Figure 2-1b), although it was complete in ca 30 min. The duration of all three phases of the hypoxia-induced triphasic response was consistently, and significantly longer in duration than the phases of the hydrogen sulfide -induced triphasic response (Figure 2-2; two-tail t-test, p < 0.0001 for all). The triphasic response was the same when elicited by NaHS or Na 2 S as the hydrogen sulfide donor. When the hypoxia-induced response was compared to the hydrogen sulfide-induced response, the initial contraction and relaxation were significantly larger in magnitude during hypoxia (Figure 2-3; two-tail t-test, p = 0.003 and Figure 2-4; two-tail t-test;p < 0.001). To test whether similar mechanisms are responsible for modulating the triphasic responses to hypoxia and hydrogen sulfide, we inhibited NO production with L-NAME, K ATP channel opening with glibenclamide, and blocked AAM with an inhibitor cocktail of indomethacin, esculetin, and clotrimazole, which inhibit cyclooxygenase, cytochrome P-450, and lipoxygenase, respectively. When applied prior to hypoxia exposure, L-NAME significantly reduced the initial contraction phase, but this phase was not significantly affected by glibenclamide or the AAM inhibitor cocktail (Figure 2-3a, ANOVA, p = 0.0397). The relaxation phase in response to hypoxia was not significantly affected by any of the inhibitors compared to control, but glibenclamide significantly reduced the relaxation phase compared to L-NAME (Figure 2-4a, ANOVA,p = 0.0340). The second contraction phase in response to hypoxia was

PAGE 32

32 significantly reduced by L-NAME and glibenclamide, but not by the AAM inhibitor cocktail (Figure 2-5a, ANOVA, p = 0.0215). In contrast, when applied prior to hydrogen sulfide exposure, none of the inhibitors significantly affected the initial contraction phase (Figure 2-3b, ANOVA, p = 0.272) or the relaxation phase (Figure 2-4b, ANOVA, p = 0.254). The second contraction phase in response to hydrogen sulfide was not significantly affected by L-NAME or glibenclamide, but was significantly reduced by the AAM inhibitor cocktail (Figure 2-5b, ANOVA, p = 0.0176). To further investigate the role of endothelium-derived products on the hydrogen sulfideinduced response, we removed the endothelium from the aorta rings before experimentation. There were significant differences in all three phases ofthe hydrogen sulfide-induced triphasic response when comparing rings with no endothelium to control rings with an intact endothelium. Compared to control rings, removal of the endothelium significantly reduced the magnitude of the initial contraction phase (Figure 2-6, two-tail t-test, p = 0.0027), significantly increased the magnitude of the relaxation phase (Figure 2-6, two-tail t-test, p = 0.0009), and significantly reduced the magnitude of the second contraction phase (Figure 2-6, two-tail t-test, p < 0.0001). To determine the effect of L-NAME without manipulating the tension before addition of hydrogen sulfide as was done in the majority of the experiments, L-NAME was administered after precontraction with PE and the ring was allowed to further constrict until stable. This differed from the previous application of L-NAME which was 30 minutes before PE preconstruction, and where the tension was adjusted back down to 1.5 g manually after L-NAME was added. The initial contraction phase was significantly reduced while the second contraction phase remained (N = 4, data not shown). Finally, when the AAM inhibitor cocktail components

PAGE 33

33 were added separately, indomethacin, esculetin, and clotrimazole did not have a significant effect on the second phase contraction (data not shown, N = 6-7, ANOVA, p = 0.157). Discussion This report demonstrates that hypoxia and hydrogen sulfide each elicit a characteristic, triphasic contraction-relaxation-contraction response in rat aorta. While others investigators have reportedmono-or biphasic responses to hydrogen sulfide (Hosoki et al. 1997; Dombkowski et al. 2005; Koenitzer et al. 2007), this is the first report of a triphasic response to hydrogen sulfide in aorta. However, a triphasic response has been reported in rat pulmonary artery (Dombkowski et al. 2005)and in response to acute hypoxia in rat aorta (Besse et al. 2002). While aorta has been used in this study, and is commonly used to elicit the vascular actionsof hydrogen sulfide (Hosoki et al. 1997; Zhao et al. 2001; Dombkowski et al. 2005; Olson et al. 2006; Koenitzer et al. 2007; Yang et al. 2008), it should be noted that this is a conduit vessel, not a resistance vessel. Changing the tone of the aorta will effectively alter blood pressure and flow to the entire vascular system not specific vascular beds, and would therefore not be an effective means of regulating blood flow, as it would in a resistance vessel. In preliminary experiments with pulmonary artery and mesenteric artery, I observed the same triphasic response as in aorta rings (Predmore, unpublished data). Therefore, the aorta is used here as an experimental proxy for the resistance vessels. The concentration of hydrogen sulfide that accumulates in the aorta rings during hypoxia is unknown, and for that matter so is the hydrogen sulfide concentration during hypoxia in vivo. Therefore the incubation bath hydrogen sulfide concentrations reported are approximations of what may actually accumulate during hypoxia(300 mol/L total hydrogen sulfide or ca. 75 mol/L H 2 S). This is within the range of previously reported plasma hydrogen sulfide concentrations, which range from 10 to 300 mol/L (Whitfield et al. 2008), although note that it

PAGE 34

34 has recently been argued that free hydrogen sulfide is actually significantly lower (<100 nmol/L) (Whitfield et al. 2008). While the triphasic responses to hypoxia and hydrogen sulfide are broadly similar, they differ temporally, in magnitude, and in their interaction with NO, K ATP, and AAM. The hypoxiainduced initial contraction and relaxation phases were significantly larger than the hydrogen sulfide-induced counterparts, whereas the second contraction phase was similar. Interestingly, the triphasic response to hydrogen sulfide is dose dependent: at concentrations of 100 and 600 mol/L total hydrogen sulfide, the magnitude of the triphasic responses were similar, but at 900 mol/L total hydrogensulfide the magnitude of the phases increased slightly (data not shown). Although all phases of the hypoxia-induced triphasic response could be reduced in magnitude by one or more of the inhibitors, only the second contraction phase of the hydrogen sulfide-induced triphasic response was significantly affected by inhibitors, suggesting that the triphasic responses to hypoxia and hydrogen sulfide are differentially mediated. Initial Contraction Phase Our data suggest that the initial contraction phase in response to hypoxia is partially mediated by NO bioavailability but not by K ATP or AAM, and that the initial contraction phase in response to hydrogen sulfide is not primarily mediated by NO bioavailability, K ATP or AAM. However, there must be some endothelium-derived factor mediating this response to hydrogen sulfide, since removal of the endothelium severely reduced the initial contraction phase to hydrogen sulfide. In the initial experiments with L-NAME the baseline tension was maintained constant throughout the incubation with L-NAME. Therefore any increase in tension after L-NAME addition was reduced back to baseline before the addition of PE, hypoxia, or hydrogen sulfide. The rationale behind this was to prevent the rings from maximally constricting after the PE was

PAGE 35

35 added. If they were maximally constricted before addition of hypoxia or hydrogen sulfide, it would be impossible to tell if it was an effect of NOS blockade, or simply the mechanical limits of the rings to respond. In the experiments following when L-NAME was added after PE precontraction, care was taken to ensure that the maximal tension, as determined from the KCl contraction, was not reached before addition of hydrogen sulfide. While the blockade of NO synthesis by L-NAME did not significantly alter the initial contraction phase to hydrogen sulfide in the initial experiments, there was a non-significant decrease in the hydrogen sulfide-induced initial contraction with L-NAME, similar to what was observed with hypoxia (Fig. 2-3a vs. 2-3b). However, when L-NAME was added after the PE precontraction, and the tension was not adjusted after L-NAME was added (which was the case in the previous experiments), there was a significant reduction of the initial contraction phase to hydrogen sulfide. Recent evidence also shows that hydrogen sulfide may cause a reduction of cyclic AMP (cAMP) (Lim et al. 2008). This may occur in addition to the reduction of free NO during hydrogen sulfide-induced contractions in vascular smooth muscle to mediate the observed contractions. Relaxation Phase Our data suggest that the relaxation phase in response to hypoxia is partially mediated by K ATP but not by NO or AAM, and that the relaxation phase in response to hydrogen sulfide is notmediated by NO, KATP or AAM. Glibenclamide significantly reduced the relaxation phase during hypoxia when compared to the L-NAME treatment (Fig. 2-4a), but it did not affect the response to hydrogen sulfide(Fig. 2-4b). This was surprising given that hydrogen sulfide activates K ATP (Wang 2002; Tang et al. 2005). However, the glibenclamide concentration we used (1 mol/L) may have been higher than that required for specific blockade of KATP and may

PAGE 36

36 have also blocked Cl channels (Sheppard et al. 1997). A blockade of Cl efflux could prevent depolarization of smooth muscle cells (Kitamura et al. 2001), thereby reducing the effects of K ATP blockade. However, 10-100 M glibenclamide is required for noticeable Cl inhibition (Sheppard et al. 1997; Robert et al. 2005). Recent evidence suggests that hydrogen sulfideinduced vasorelaxation may be due to a reduction in ATP concentration by metabolic inhibition followed by acidosis and activation of Cl /HCO 3 exchangers (Kiss et al. 2008), and therefore may not primarily rely on K ATP channels. It remains to be tested whether this occurs during the triphasic response for both hypoxia and hydrogen sulfide, since only a monophasic relaxation was observed in the aforementioned study. It is also interesting to note that the magnitude of the relaxation phase during hydrogen sulfide-induced responses increased when the endothelium was removed. This may be the result of removing the source of AAM that are vasoconstrictive (i.e. thromboxanes, and some prostaglandins) and that may interfere with the relaxation pathway(s) initiated by hydrogen sulfide (see below). Second Contraction Phase Our data suggest that the second contraction phase in response to hypoxia is partially mediated by NO bioavailability and potentially K ATP but not mediated by AAM, and that the second contraction phase in response to hydrogen sulfide is mediated by AAM but not by NO bioavailability or K ATP This could indicate that hypoxia continues to inhibit the NO/NOS system, whereas hydrogen sulfide induces production of one or more AAM. Both of these possibilities would lead to contraction.This is similar to the response of the initial contraction, in which the hypoxia-induced contraction may result from a decrease in NO bioavailability, whereas the hydrogen sulfide-induced contraction may result from an alternative pathway such as vasoconstrictive AAM or by decreasing cAMP(Lim et al. 2008). This is supported by the observationthat removal of the endotheliumsignificantly reducedthe second contraction phase,

PAGE 37

37 indicating that the response is derived from endothelium. While the involvement of specific enzymes and their products(i.e. cyclooxygenase, lipoxygenase or Cytochrome P-450) could not be determined by adding the components of the AAM inhibitor cocktail alone, there may be an additive or combined effect of multiple AAM causing the second phase contraction to hydrogen sulfide. Our data provide no support for a role for of K ATPchannels in hydrogen sulfide-induced contractions, which is also supported byLim and colleagues (Lim et al. 2008), but our data do support a role for K ATP channels in hypoxia-induced contractions. However, if glibenclamide non-specifically blocked chloride channels, and therefore Cl efflux, in addition to K ATP (Sheppard et al. 1997; Kitamura et al. 2001), thiscould have artificially reducedthe magnitude ofthe hypoxia-induced second contractions.Conclusion Our data showthat hypoxia and hydrogen sulfide produce similar responses in rat aorta but that these responses result from different mechanisms. The data suggest that NO and K ATP contribute to the triphasic response to hypoxia, while AAM play a role in the hydrogen sulfide response. However, no component of the triphasic response to any blockade was completely eliminated, indicating that more signaling pathways are involved, potentially including, but certainly not limited to, cAMP and metabolic inhibition. Additionally, the effect of the inhibitors on higher or lower hydrogen sulfide concentrations remains to be determined, since we tested only oneconcentration of hydrogen sulfide. Therefore, further investigations are warranted to illuminate how these two signaling events are mediated and interconnected, and whether these trends persist over a range of hydrogen sulfide concentrations.

PAGE 38

38 Figure 2-1.Representative tracings of the effect of (a ) hypoxia (95% N 2 /5% CO 2 ) or ( b ) hydrogen sulfide (H 2 S; 300 mol/L NaHS or Na 2 S) on phenylephrine (PE) (1 mol/L) pre-contracted rat aorta rings. Both stimuli produced a triphasic contractionrelaxation-contraction. Horizontal scale bar indicates time (min) and vertical scale bar indicates aorta ring tension (g). To reduce noise, data were smoothed in Sigma Plot using a negative exponential 1 st degree polynomial function with a 0.02 (hypoxia) or 0.05 (hydrogen sulfide) sampling proportion and nearest neighbors bandwidth method.

PAGE 39

39 Phase First Second Third D u r a t i o n o f P h a s e ( m i n ) 0 10 20 30 40 50 60 70 Hypoxia H 2 S Figure 2-2.Duration of the triphasic response of phenylephrine (1 mol/L) pre-contracted rat aorta rings to hypoxia (95% N 2 /5% CO 2 N = 40) and hydrogen sulfide (H2 S; 300 mol/L NaHS or Na 2 S, N = 40). Treatment is on the X-axis, and response is on the Y-axis as % of the KCl contraction. All panels show mean SEM. Significant differences (asterisks) were determined using a two-tailed Students t-test. The duration of the hypoxia-inducedtriphasic response is significantly longer than the hydrogen sulfide-induced triphasic response at every phase.

PAGE 40

40 Ctrl L-NAMEGlib Cocktail % K C l C o n t r a c t i o n 0.00 0.25 0.50 Ctrl L-NAMEGlib Cocktail % K C l C o n t r a c t i o n 0.00 0.25 0.50 b a A A,B B A,B Figure 2-3.Magnitude of theinitial contraction phase of thetriphasic response of phenylephrine (1 mol/L) pre-contracted rat aorta rings to hypoxia (95% N 2 /5% CO 2 ) and hydrogen sulfide (H 2 S; 300 mol/L NaHS or Na 2 S). Each ring received one of the following treatments: no inhibitors (Control; N = 20 hypoxia, N = 23 hydrogen sulfide), LNAME (L-NAME; N =18 hypoxia, N = 16 hydrogen sulfide), glibenclamide (Glibenclamide; N = 20 hypoxia, N = 17 hydrogen sulfide), or an AAM inhibitor cocktail of indomethacin, esculetin and clotrimazole (AAM inhibitor cocktail, N = 16 hypoxia, N = 13 hydrogen sulfide). Treatment is on the X-axis, and response is on the Y-axis as % of the KCl contraction. All panels show mean SEM, with hypoxia data in panel a and hydrogen sulfide data in panel b Significant differences (different letters) were determined using one-way ANOVAwith a Tukey post-hoc, in addition to a two-tailed Students t-test (asterisks). Application of L-NAME 30 min prior to hypoxia significantly reduced the initial contraction phase ( a ). However, application of inhibitors during the hydrogen sulfide responsedid not significantly affect the initial contraction phase ( b ).The control hypoxia initial contraction was significantly greater in magnitude than the control initial contraction to hydrogen sulfide ( a vs. b asterisk).

PAGE 41

41 Ctrl L-NAME Glib Cocktail % K C l C o n t r a c t i o n -0.75-0.50-0.250.00 0.25 b Ctrl L-NAME Glib Cocktail % K C l C o n t r a c t i o n -0.75 -0.50 -0.25 0.00 0.25 a A,B B A A,B Figure 2-4.Magnitude of the relaxation phase of the triphasic response of phenylephrine (1 mol/L) pre-contracted rat aorta rings to hypoxia (95% N 2 /5% CO 2 ) and hydrogen sulfide (H 2 S; 300 mol/L NaHS or Na 2 S). Each ring received one of the following treatments: no inhibitors (Control; N = 20 hypoxia, N = 23 hydrogen sulfide), LNAME (L-NAME; N = 18 hypoxia, N = 16 hydrogen sulfide), glibenclamide (Glibenclamide; N = 20 hypoxia, N = 17 hydrogen sulfide), or an AAM inhibitor cocktail of indomethacin, esculetin and clotrimazole (AAM inhibitor cocktail, N = 16 hypoxia, N = 13 hydrogen sulfide). Treatment is on the X-axis, and response is on the Y-axis as % of the KCl contraction. All panels show mean SEM, with hypoxia data in panel a and hydrogen sulfide data in panel b Significant differences (different letters) were determined using one-way ANOVA with a Tukey post-hoc, in addition to a two-tailed Students t-test (asterisks). Application of glibenclamide 30 min prior to hypoxia significantly reduced the relaxation phase compared to LNAME ( a ). However, application of inhibitors during the hydrogen sulfide response did not significantly affect the relaxation phase ( b .The control hypoxia relaxation was significantly greater in magnitude than the control relaxation to hydrogen sulfide ( a vs. b ).

PAGE 42

42 Ctrl L-NAME Glib Cocktail % K C l C o n t r a c t i o n 0.00 0.25 0.50 0.75 b Ctrl L-NAME Glib Cocktail % K C l C o n t r a c t i o n 0.00 0.25 0.50 0.75 a A A,B A,B B A B B A,B Figure 2-5.Magnitude of thesecond contraction phase of the triphasic response of phenylephrine (1 mol/L) pre-contracted rat aorta rings to hypoxia (95% N 2 /5% CO 2 ) and hydrogen sulfide (H 2 S; 300 mol/L NaHS or Na 2 S). Each ring received one of the following treatments: no inhibitors (Control; N = 20 hypoxia, N = 23 hydrogen sulfide), L-NAME (L-NAME; N = 18 hypoxia, N = 16 hydrogen sulfide), glibenclamide (Glibenclamide; N =20 hypoxia, N = 17 hydrogen sulfide), or an AAM inhibitor cocktail of indomethacin, esculetin and clotrimazole (AAM inhibitor cocktail, N = 16 hypoxia, N = 13 hydrogen sulfide). Treatment is on the X-axis, and response is on the Y-axis as % of the KCl contraction. All panels show mean SEM, with hypoxia data in panel a and hydrogen sulfide data in panel b Significant differences (different letters) were determined using one-way ANOVA with a Tukey post-hoc. Application of L-NAME and glibenclamide 30 min prior to hypoxia significantly reduced the second phase contraction ( a ). Application of the AAM inhibitor cocktail 30 min prior to hydrogen sulfide significantly reduced the second contraction phase ( b ).

PAGE 43

43 Phase First Second Third % K C l C o n t r a c t i o n -2.0 -1.5 -1.0 -0.5 0.0 0.5 1.0 + Endo Endo Figure 2-6.Magnitude of the triphasic response of phenylephrine (1 mol/L) pre-contracted rat aorta rings to hydrogen sulfide (H 2 S; 300 mol/L NaHS or Na 2 S) with (N = 19) and without (N = 12) an intact endothelium. Endothelium was removed by rubbing the inside of the ring with stainless steel wire. Treatment is on the X-axis, and response is on the Y-axis as % of the KCl contraction. All panels show mean SEM. Significant differences (asterisks) were determined using a two-tailed Students ttest. Removal of the endothelium results in a significant reduction of the initial and second contraction phases to hydrogen sulfide, while it significantly increases the relaxation phase to hydrogen sulfide.

PAGE 44

44 CHAPTER 3 HYDROGEN SULFIDE INCREASES NITRIC OXIDE PRODUCTION FROM ENDOTHELIAL CELLS BYAPROTEIN KINASE B (AKT)-DEPENDENT MECHANISMAbstract Hydrogen sulfide (H 2 S) and nitric oxide (NO) are both gasotransmitters that can elicit synergistic vasodilatory responses in the in the cardiovascular system, but the mechanisms behind this synergy are unclear. In the current study we investigated the molecular mechanisms through which hydrogen sulfideregulates endothelial NO production. Initial studies were performed to establish the temporal and dose-dependent effects of hydrogen sulfideon NO generation using EPR spin trapping techniques. H 2 S stimulated a two-fold increase in NO production from endothelial nitric oxide synthase (eNOS), which was maximal 30 min after exposure to 25-150 mol/L hydrogen sulfide. Following 30 min hydrogen sulfideexposure, eNOS phosphorylation at Ser 1177 was significantly increased compared to control, consistent with eNOS activation. Pharmacological inhibition of Akt, the kinase responsible for Ser 1177 phosphorylation, attenuated the stimulatory effect of hydrogen sulfideon NO production. Taken together, these data demonstrate that hydrogen sulfideup-regulates NO production from eNOS through an Akt-dependent mechanism. These results implicate hydrogen sulfidein the regulation of NO in endothelial cells, and suggest that deficiencies in hydrogen sulfidesignaling can directly impact processes regulated by NO. Introduction Hydrogen sulfide (H 2 S) and nitric oxide (NO) are both gasotransmitters that function in the cardiovascular system (Hosoki et al. 1997; Wang 2003). Recent reports indicate that the NO and hydrogen sulfidesignaling pathways interact on a variety of levels (Geng et al. 2007; Kubo et al. 2007b; Kubo et al. 2007d; Yong et al. 2008a). Hydrogen sulfideand NO interact synergistically in vitro with hydrogen sulfideenhancing NO-mediated relaxation up to 13 fold in

PAGE 45

45 isolated rat aorta (Hosoki et al. 1997), and treatment of Langendorff-perfused Sprague-Dawley rat hearts with hydrogen sulfideimmediately following ischemia confers cardioprotection through NOS activation (Yong et al. 2008a). In contrast, other in vitro studies indicate that incubation with hydrogen sulfidedecreases NO production in aortic rings (Geng et al. 2007; Kubo et al. 2007b), cell culture (Genget al. 2007), and recombinant eNOS (Kubo et al. 2007d). However, in these studies hydrogen sulfideincubation occurred 1-6 h before measurement of NO production. Consequently,since hydrogen sulfideis volatile and oxidizes rapidly in the presence of oxygen and free divalent metals (Tapley et al. 1999), the key effects of hydrogen sulfidein those studies may have occurred before NO measurement began. In the present study we investigated the ability of hydrogen sulfideto acutely modulate NO production in the endothelium, with a specific focus on the mechanism of action. Materials and Methods Chemicals Endothelial cell growth supplement was purchased from Upstate (Temecula, CA USA). All other chemicals were purchased from Sigma-Aldrich (St. Louis, MO, USA) and were of the highest quality available, unless otherwise noted. Bovine Arterial Endothelial Cell Culture Bovine Arterial Endothelial Cells (BAECs) were cultured in DMEM (1.0 g/L glucose) supplemented with 10% FBS, 1% penicillin/streptomycin and endothelial cell growth supplement (5 mg/L). Culture flasks were maintained in a 37 C incubator at 5.0% CO 2 Adherent endothelial cells were grown in 6-well plates for EPR studies and in 100 mm dishes for western blotting studies.

PAGE 46

46 Hydrogen SulfideExposureSodium sulfide (Na 2 S), a hydrogen sulfidedonor, was prepared as a saturated stock solution in distilled water and maintained at 4 C. At this temperature, the concentration of a saturated solution of Na 2 S is 1.72 mol/L. From this stock, hydrogen sulfidedilutions were made in Krebs buffer, of which 1.0 mL was added per well of a six-well plate, and 3.0 mL was added per 100 mm Petri dish. The concentration of total hydrogen sulfide (H 2 S, HS and S 2) in the dilutions was determined using a methylene blue assay, with a standard curve generated with deoxygenated, distilled water and Na 2 S as the reference (Gilboa-Garber 1971). After 30 min in a 37 C incubator, a 150 mol/L hydrogen sulfidesolution prepared in Krebs buffer showed no detectable hydrogen sulfide, indicating virtually complete loss of hydrogen sulfide, presumably by oxidation and volatilization (data not shown). Akt Blockade The Akt inhibitor Triciribine was used to prevent the phosphorylation of eNOS (Dieterle et al. 2009). Triciribine (5.0 mol/L) was added in Krebs buffer 30 min before experiments. Cells were washed with PBS before and after addition of Triciribine. Electron Paramagnetic ResonanceDetection of Nitric OxideSpin-trapping measurements of NO were performed using a BrukerE-scan spectrometer (BrukerBioSpin Corporation, Billerica, MA USA) with the iron spin trapping complex Nmethyl-D-glucaminedithiocarbamate (Fe-MGD) (Cardounel et al. 2002; Cardounel et al. 2007). For measurements of NO produced by BAECs, cells were cultured as described above and spin trapping was performed on cells grown in 6-well plates (1 x 10 6 cells/ well). In these studies, cells attached to the substratum were utilized since scraping or enzymatic removal leads to injury and membrane damage with impaired NO generation. The medium from each well was removed and the cells were washed with PBS (phosphate-buffered saline, without CaCl 2 or MgCl 2 ). Next,

PAGE 47

47 0.15 ml of Krebs buffer containing the NO spin trap FE-MGD (0.5 mmol/L Fe 2+ 5.0 mmol/L MGD), and calcium ionophore (A23187, 1 mol/L) was added to each well and the plates were incubated at 37 C under a humidified environment containing 5% CO 2 /95% O 2 for 20 min (Cardounel et al. 2002; Cardounel et al. 2007). Following incubation, the medium from two wells was removed and pooled as one 0.3 ml sample, frozen in liquid nitrogen and stored at -80 C. This yielded three samples per plate. The frozen NO spin-trap samples are stable, and were later individually thawed, and trapped NO in the supernatants was quantified usingtheelectron paramagnetic resonancetechnique. Spectra recorded were obtained using the following parameters: microwave power; 20 mW, modulation amplitude 3.16 G and modulation frequency; 100 kHz. Western Blotting BAECs from a 100 mm dish were scraped and suspended in 300 l radioimmunoprecipitation assay (RIPA) buffer with Halt protease inhibitor cocktail (Thermo Fisher Scientific, Rockford, IL USA), placed on ice, andsonicated to lyse the cells and suspend the protein. The suspension was centrifuged at 12000 g for 20 min at 4 C and the supernatant removed, frozen in liquid nitrogen, and stored at -80 C. Western blotting was performed using commercially-available polyclonal antibodies for eNOS and Ser 1177 eNOS (BD Biosciences, San Jose, CA USA), monoclonal -actin (Cell Signaling Technology, Danvers, MA USA) and secondary antibody conjugated to alkaline phosphatase (Sigma-Aldrich St. Louis, MO USA). Protein was separated using SDS-PAGE and transferred onto PVDF membrane (Immobilon P, Millipore, Billerica, MA USA) using a semidry blotter (BioRad, Hercules, CA USA). Using the Snap-ID system (Millipore, Billerica, MA USA), membranes were blocked in 0.05% non-fat milk in PBST (PBS with 0.05% Tween-20), washed in PBST and incubated 10 min with

PAGE 48

48 appropriate primary antibodies (diluted 1:333 in PBST). Membranes were then washed in PBST four times and subsequently incubated 10 min with secondary antibody diluted 1:3,333 in blocking solution. Membranes were then washed two times in PBST, once in PBS, and once in Tris-HCl (100 mmol/L, pH 9.5), after which chemiluminescence substrate was added (DuoLux substrate, Vector Laboratories, Burlingame, CA USA). Images were captured with a digital imager (GeneSnap, Syngene,Frederick, MD USA) and were analyzed using commercial software (Quantity One,BioRad, Hercules, CA USA) to determine band intensity using local background subtraction. Statistics All data were analyzed using one-way ANOVAwith Dunnetts post-hoc test for significant differences from a control, with alpha 0.05 considered significant (JMP 7.0, SAS Institute, Cary, NC USA). Results Initial experiments were conducted to establish the time course of hydrogen sulfideeffects on endothelial NO production. BAECs were exposed to the hydrogen sulfidedonor Na2 S (100 mol/L) for 15, 30, 60, 120 and 240 min (Figure 3-1A). At each time point, endothelial-derived NO production was measured using EPR. Peak NO production was observed at 30 min post hydrogen sulfidetreatment (ANOVA, p < 0.001); at which time mean NO production was increased by 87%. This effect was not observed at later time points, suggesting a transient activation of eNOS. To determine the dose-response to hydrogen sulfide, NO production was measured 30 min after the addition of 5-600 mol/L Na 2 S (Figure 3-1B). Mean NO production increased by 39-62% at Na 2 S concentrations between 40-150 mol/L (ANOVA, p = 0.001). The transient nature of the hydrogen sulfideeffects on endothelial NO production suggested a change in eNOS phosphorylation status. Therefore, western blotting was used to

PAGE 49

49 determine the phosphorylation state of eNOS after addition of hydrogen sulfideat 15 and 30 min. Total eNOS expression was unchanged for all treatments (Figure 3-2A, ANOVA, p = 0.6727), but after 30 min of incubation in the presence of 150 mol/L Na 2 S, eNOS phosphorylation at Ser 1177 increased by 88% compared to control (Figure 3-2B, ANOVA, p = 0.0031). Furthermore, the ratio of phosphorylatedSer 1177 eNOS to total eNOS increased by 148% after 30 min compared to control (Figure 3-2C, ANOVA, p = 0.0033). To determine whether increased Ser 1177 phosphorylation was responsible for the augmented NO production, BAECs were pretreated for 30 min withthe Akt inhibitor Triciribine (5 mol/L), after which the cells were exposed to 150 mol/L Na 2 S. Triciribine prevented the augmentation of endothelial NO production (Figure 3-3, ANOVA, p = 0.0038). These results clearly indicate that hydrogen sulfideincreases endothelial NO production through Akt activation and subsequent increased phosphorylation of eNOS at Ser 1177. Discussion Although an early study showed a synergistic effect of hydrogen sulfideon NO-induced relaxation of blood vessel rings (Hosoki et al. 1997), later studies showed that hydrogen sulfide inhibited eNOS-dependent NO production in aortic rings and cell culture, and from recombinant proteins (Geng et al. 2007; Kubo et al. 2007b; Kubo et al. 2007d). However, these later studies measured NO production 1-6 h after hydrogen sulfideaddition. Since hydrogen sulfideis volatile and rapidly oxidizes in the presence of oxygen and free divalent metals (Tapley et al. 1999), we hypothesized that hydrogen sulfideacts within minutes of its application, and therefore that an hour or longer delay between hydrogen sulfideapplication and measurement of NO production could lead to a failure to detect an hydrogen sulfideeffect. Here we demonstrate that hydrogen sulfideup-regulates NO production from eNOS within 30 min. While we assume hydrogen

PAGE 50

50 sulfideis causing this action, hydrogen sulfide in solution exists as H2 S, HS and S 2 With the extracellular ratio of H 2 S/HS being between 1:3 and 1:5 and the intracellular ratio being approximately equal (Olson et al. 2009), it is equally likely that HS is causing the up-regulation. To our knowledge, no one has yet definitively demonstrated that only H 2 S is causing the observed effects of hydrogen sulfide, as opposed to HS The comparatively rapid action led us to suspect that hydrogen sulfidewas stimulating phosphorylation of eNOS at Ser 1177 (Mount et al. 2007). We investigated this using western blotting to detect total eNOS and phosphorylated eNOS. While total eNOS remained constant for all treatment groups, 30 min exposure to 150 mol/L hydrogen sulfideresulted in a significant increase in both phosphorylated eNOS and the ratio of phosphorylated eNOS to total eNOS. To confirm that hydrogen sulfide-induced NO production was dependent on eNOS phosphorylation, we used Triciribine to block phosphorylation of eNOS at Ser 1177, thereby inhibiting Akt activation. This prevented the increase in NO production in cells exposed to hydrogen sulfide, but did not significantly affect NO production in control cells. These data suggest a novel mechanism of endogenous hydrogen sulfidesignaling: upregulation of NO production via Akt-dependent phosphorylation of eNOS at Ser1177. The mechanism by which hydrogen sulfideactivates Akt remains unknown. However, upstream regulation of NO production by hydrogen sulfidecould represent a novel and potentially important regulatory mechanism in the control of NO signaling pathways, andcould further implicate defects of hydrogen sulfidesignaling in cardiovascular pathologies.

PAGE 51

51 Time (min) Crtl 5 30 60 90 120 240 N O P r o d u c t i o n a s P e r c e n t o f C o n t r o l 0.00.51.01.52.02.5 A Sulfide Range ( M) 0 5 to 2040 to 150300 to 600 N O P r o d u c t i o n a s P e r c e n t o f C o n t r o l 0.00.20.40.60.81.01.21.41.61.8 B Figure 3-1.The effect of H2 S on NO production by BAECs. NO production was measured using EPR spectroscopy. NO values (y-axis) are presented in arbitrary units and have been normalized to control. Time (A) or hydrogen sulfideconcentration range (B) are shown on the x-axis. Data are shown as mean SE. Statistical analysis was done using a one-way ANOVA (p < 0.05) with Dunnetts post-hoc. An asterisk denotes values significantly different from control.

PAGE 52

52 Figure 3-2.The effect of hydrogen sulfide on eNOS phosphorylation. Protein expression (y-axis, -actin) was measured from BAECs untreated (Ctrl), or exposed to 15 or 30 min of hydrogen sulfide(x-axis). Using western blotting techniques, total eNOS expression (A), eNOS phosphorylated at Ser 1177 expression (B), and the ratio of Ser 1177 phosphorylated eNOS/total eNOS (C) were determined. Data are shown asmean SE. Statistical analysis was done using a one-way ANOVA (p < 0.05) with Dunnetts post-hoc. An asterisk denotes values significantly different from control.

PAGE 53

53 Figure 3-2.Continued.

PAGE 54

54 Figure 3-3.The effect of Akt inhibition on hydrogen sulfide-stimulated NO production. NO production was measured using EPR spectroscopy. NO values (y-axis) are presented in arbitrary units and have been normalized to control. NO was measured from untreated (Ctrl), Triciribine treated (Ctrl + Tri.), hydrogen sulfide treated (H2 S) and hydrogen sulfide treated with Triciribine (H 2 S + Tri.). Data are shown as mean SE. Statistical analysis was done using a one-way ANOVA (p < 0.05) with Dunnetts post-hoc. An asterisk denotes values significantly different from control.

PAGE 55

55 CHAPTER 4 THE HYDROGEN SULFIDESIGNALING SYSTEM: CHANGES DURING AGING AND THE BENEFITS OF CALORIC RESTRICTION Abstract Hydrogen sulfide gas (H 2 S) has been proposed as an important signaling molecule, but the effect of age on hydrogen sulfide signaling is unknown. Hydrogen sulfide causes diverse effects in mammalian tissues, including relaxation in mammalian systemic vessels, and increased perfusion and bicarbonate secretion in liver. Aging has negative impacts on the cardiovascular system, whereas the liver is more resilient with age. Caloric restriction (CR) attenuates affects of age in many tissues. This study investigates the effects of aging and CR on the hydrogen sulfide signaling system in the aorta and liver of rats by determining the contractile response of aortic rings to exogenous hydrogen sulfide, the protein and mRNA expression of the hydrogen sulfide producing enzymes cystathionine lyase (CSE) and cystathionine synthase (CBS), and hydrogen sulfide production rates. Tissue was collected from Fisher 344 x Brown Norway rats from 8-38 months of age, maintained on an ad libitum (AL) or CR diet. Aortic rings exhibited a triphasic contraction-relaxation-contraction response to hydrogen sulfide. The hydrogen sulfidesensitivity of the first phase contraction increased with age, while the magnitude of all three phases increased with CR compared to AL. In aorta, CSE protein expression increased with age on an AL diet, but this increase was attenuated with a CR diet. CBS expression showed the same trends as CSE, but with lower expression levels. In liver, both CSE and CBS protein expression remained relatively constant with age. In both aorta and liver, real-time PCR showed no changes in CSE or CBS mRNA expression with age, but mRNA expression in aorta was higher on a CR diet compared to AL. In both aorta and liver, hydrogen sulfide production did not change with age, but did increase with CR. Overall, these data show a significant effect of age and diet on the hydrogen sulfide signaling system in aorta, whereas liver was relatively unaffected. The

PAGE 56

56 increased contractile sensitivity to hydrogen sulfide and increased protein expression of CSE and CBS in aorta point to a drop in hydrogen sulfide bioavailability with age. Additionally, CR seems to benefit CSE and CBS protein in both aorta and liver. Introduction Hydrogen sulfide (H 2 S) functions as a gasotransmitter in the nervous, cardiovascular, and gastrointestinal systems. Abe and Kimura (Abe et al. 1996)first demonstrated that hydrogen sulfideis produced in the brain and that it increases N-methyl-D-aspartic acidreceptor-mediated responses and facilitates hippocampal long-term potentiation. Since then a variety of physiological roles have been proposed for hydrogen sulfide(Lowicka et al. 2007; Szabo 2007), and at least some capacity for hydrogen sulfideproduction has been demonstrated in several vertebrate tissues (Zhao et al. 2003; Olson 2005; Dombkowski et al. 2006; Olson et al. 2006). When exogenously applied to isolated blood vessels of vertebrates, hydrogen sulfideelicits responses that range from a monophasic relaxation or contraction, to multiphasic contractionrelaxation-contraction responses, depending on the phylogenetic class and type of vessel examined (Dombkowski et al. 2005). In the liver, hydrogen sulfidehas been proposed to regulate perfusion and maintain portal venous pressure, with deficiencies in hydrogen sulfide production pathways resulting in increases in intra-hepatic resistance (Fiorucci et al. 2005b). Hydrogen sulfidemay also have a role in regulating biliary bicarbonate secretion in the liver (Fujii et al. 2005). Hydrogen sulfideis endogenously produced from L-cysteine predominantly by the enzymes cystathionine-lyase (CSE) and cystathionine-synthase (CBS) (Kimura 2000; Julian et al. 2002; Wang 2002; Geng et al. 2004b; Fiorucci et al. 2005b; Gainey et al. 2005; Julian et al. 2005b; Kimura et al. 2005). In mammals, CSE and CBS are differentially expressed (Zhao et al.

PAGE 57

57 2001; Zhao et al. 2003). CSE is the enzyme primarily expressed in the cardiovascular system, whereas CBS is the enzyme primarily expressed in the nervous system (Hosoki et al. 1997; Geng et al. 2004b; Ebrahimkhani et al. 2005; Kimura et al. 2005). In liver and kidney, CSE and CBS are both expressed in relatively high amounts compared to other tissues (Fujii et al. 2005; Lowicka et al. 2007). Aging influences the action and/or efficacy of many signaling molecules, including norepinephrine and nitric oxide (NO) (Lakatta 1993; van der Loo et al. 2000; Tanaka et al. 2006) a gasotransmitter that is much better studied than hydrogen sulfide. A recent study of plasma hydrogen sulfideconcentration in humans over 50-80 years of age reported that hydrogen sulfide levels may decline with age (Chen et al. 2005), but whether aging affects the hydrogen sulfide signaling system is unknown. Furthermore, any affect of age on the hydrogen sulfidesignaling system may differ among tissues. For example, whereas the liver is relatively unaffected by age, substantial physiological changes occur with age in the cardiovascular system, including fibrosis of blood vessels leading to endothelial dysfunction (Castello et al. 2005), which affects regulation of blood vessel tone (Kitani 1991; Kitani 1994; Anantharaju et al. 2002). Caloric restriction (CR) is an intervention that attenuates many effects of aging (Labinskyy et al. 2006; Leeuwenburgh et al. 2006), including cardiovascular morbidity (van der Loo et al. 2000), cross-linking of cardiac and skeletal muscle proteins (Leeuwenburgh et al. 1997), mitochondrial dysfunction (Aspnes et al. 1997; Payne et al. 2003), loss of skeletal muscle mass (van der Loo et al. 2000; Payne et al. 2003), and endothelial dysfunction (Gredilla et al. 2001; Barja 2002; Gredilla et al. 2004; Castello et al. 2005; Taddei et al. 2006). CR attenuates the agerelated impairment of the NO signaling system (van derLoo et al. 2000; Marin et al. 2007) (Yang et al. 2004; Minamiyama et al. 2007; Sharifi et al. 2008), but whether CR affects the

PAGE 58

58 hydrogen sulfide signaling system, and whether CR specifically attenuates any affects of age on the hydrogen sulfidesignaling system, are all unknown. In this study we investigated the effects of aging and CR on the hydrogen sulfide signaling system in liver and aorta in the Fisher 344 Brown Norway hybrid rat. Liver and aorta tissue from rats of various ages were used to investigate CSE and CBS protein and mRNA expression and hydrogen sulfideproduction rates. Contraction of aorta smooth muscle was used asa functional indicator to investigate the effects of age and CR on functional responses to hydrogen sulfide. Materials and Methods Chemicals All chemicals were purchased from Sigma-Aldrich (St. Louis, MO, USA), unless specifically noted. Animals Fisher 344 Brown Norway hybrid rats of 8, 14, 18, 23, 27, 34 and 38 months of age were singly housed under standard conditions and provided with food and water using either the NIH31 diet ad libitum (AL) or the NIH31-NIAfortified diet at 40% CR. Myography studies were performed on tissues from animals of 14, 27, and 34 months of age. All other studies were performed on tissues from animals of 8, 18, 29, and 38 months of age. Western Blotting Liver and aorta were removed within 5 min of euthanasia, frozen in liquid nitrogenand stored at -80 C. Samples were suspended in a lysis buffer consisting of 50 mmol/L Tris base, 2% (w/v) sodium dodecyl sulfate, 10 mmol/L ethylenediaminetetraacetic acid, 10 mmol/L dithiothreitol, 0.5 mmol/L sodium tetraborate, and 1% (v/v) Halt protease inhibitor cocktail (Thermo Fisher Scientific Rockford, IL USA). Western blotting was performed using

PAGE 59

59 commercially available monoclonal antibodies for CSE and CBS(Abnova, Neihu District, Taipei City, Taiwan), a monoclonal antibody for -actin(Cell Signaling Technology, Danvers, MA, USA) and a secondary antibody conjugated to alkaline phosphatase (Sigma-Aldrich St. Louis, MO, USA). Protein was separated using SDS-PAGE and transferred onto PVDF membrane (Immobilon P, Millipore, Billerica, MA USA) using a semidry blotter (BioRad, Hercules, CA USA). Using the Snap-ID system (Millipore, Billerica, MA USA) at room temperature, membranes were blocked in 0.05% non-fat milk in PBST (phosphate-buffered saline with 0.05% Tween-20), washed in PBST and incubated 10 min with appropriate primary antibodies (diluted 1:333 in PBST). Membranes were then washed in PBST four times and subsequently incubated 10 min with secondary antibody diluted 1:3,333 in blocking buffer. Membranes were washed two times in PBST, once in PBS, and once in Tris-HCl (100 mmol/L), pH 9.5. Chemiluminescent substrate (DuoLux, Vector Laboratories, Burlingame, CA USA) was used to generate a chemiluminescent signal, which was captured with a digital imager (GeneSnap, Syngene, Frederick, MD USA). Images were analyzed using commercial software (Quantity One, BioRad, Hercules, CA USA) to determine band intensity using local background subtraction. RNA Extraction Liver and aorta tissues were disrupted into powder under liquid nitrogen. All samples for each tissue were processed on the same day. For liver, total RNA was extracted using an Arum total RNA mini kit (BioRad, Hercules, CA USA). For aorta, total RNA was extracted using Tri reagent and a glass homogenizer (Kontes Glass, Vineland, NJ USA). Real-Time PCR Relative quantitative real time PCR was run in 96-well PCR plates in an Applied Biosystems 7300 Real-time PCR system (Life Technologies, Carlsbad, CA USA). Primers were

PAGE 60

60 designed using commercial software (Premier Biosoft International, Palo Alto, CA USA) and synthesized by Integrated DNA Technologies (Coralville, IA USA). The primers used were as follows: CSE sense 5-TGGGCTTAGTGTCTGTTAATTCC -3, CSE antisense 5GGCAGCAGAGGTAACAATCG 3, CBS sense 5-TGCCTGAGAAGATGAGTATG -3, CBS antisense 5-GGTCCAGAATGTGAGAATTG3, Actin sense 5CTCCCAGCACACTTAACTTAG C -3, Actin antisense 5-AAAGCC ACAAGAAACACTCAGG 3, 18S rRNA sense 5-CGAGGAATTCCCAGTAAGTGC -3, 18S rRNA antisense5-CCATCCAATCGCTAGTAGCG 3.For both liver and aorta plates, a standard curve for the housekeeping genes -actin (run with CSE samples) or 18S rRNA (run with CBS samples) was run with a standard curve for the gene of interest (GOI), with all samples in triplicate. The remainder of the plate was filled with 8 random samples plus 1 calibrator sample for plate to plate corrections, loaded in triplicate for both the housekeeping gene and the GOI. Additional plates were run containing the calibrator sample on each plate until all samples had been processed. All plates for a given tissue-GOI combination were made and run on the same day, using the same real-time PCR machine. Hydrogen SulfideProductionHydrogen sulfideproduction was measured essentially as previously described (Stipanuk et al. 1982; Julian et al. 2002; Dombkowski et al. 2006). Frozen tissues were ground into a fine powder under liquid nitrogen with mortar and pestle. For each sample, two small scoops (approx 50 mg wet weight) were added to 1.5 mL 100 mmol/L potassium phosphate buffer (pH 7.4) and homogenized with a Polytron homogenizer (Kinematica, Bohemia, NY USA) for 30 s until the solution was smooth. A 1 mL aliquot of this homogenate solution was then placed in the outer well of a 25 mL glass flask containing an additional plastic center well (Kontes Glass,

PAGE 61

61 Vineland, NJ USA). The center well was filled with 0.5mL 1% (w/v) zinc acetate, and a piece of chromatography paper (Whatman grade 3MM Chr, Maldstone England) cut 2.5 cm by 4.5 cm and folded into a fan shape was placed in the well to absorb the zinc acetate. The substrate Lcysteine (10 mmol/L) and the cofactor pyridoxal-5 -phosphate (PLP; 2 mmol/L) were added to the outer well, after which the flask was sealed with a septum stopper and flushed with N 2 gas for 30 s. Each flask was incubated on a shaker at 37 C for 1.5 h for liver and 8 h for aorta. After incubation, 1 mL 50% (w/v) trichloroacetic acid was added to the outer well to stop enzyme activity and to convert all S 2 and HS to H 2 S. The zinc acetate solution on the chromatography paper reacts with volatilized H 2 Sto form zinc sulfide, which is relatively stable. The flasks were then incubated for an additional hour to allow remaining hydrogen sulfideto volatilize and form zinc sulfide. The filter paper was then removed from the center well and placed in a test tube containing 3.5 mL of de-ionized water, 0.4 mL 20 mmol/L N N -dimethylp -phenylenediamine oxalate in 7.2 mol/L HCl and 0.4 mL of 30 mmol/L FeCl 3 in 1.2 mol/L HCl. The test tubes were gently vortexed and incubated for 20 min at room temperature. Absorbance of the solution in the test tube was read at 670 nm with a plate reader (BioTek Instruments, Inc., Winooski, VT USA). Samples with an absorbance greater than 2 were diluted 10-fold with distilled water and the absorbance re-measured. Absorbance measurements were calibrated against a standard curve generated from NaHS in deoxygenated, de-ionized water added to the outside wells, incubated at 37 C for 1.5 h, and assayed as above. To ensure that all measured hydrogen sulfideproduction is by tissue enzymes, several controls were run in addition to sample homogenates: a negative control of homogenate but no cofactors or substrate; and a blank of all cofactors and substrate in phosphate buffer, but without homogenate. Inhibitors of CSE (20 mmol/L propargylglycine, Pgly) and CBS (1 mmol/L aminooxyacetic acid, AOAA) were added to confirm the hydrogen

PAGE 62

62 sulfide production was through these, and not alternate pathways (Julian et al. 2002) Protein concentration was quantified with a NanoDrop 1000 (Thermo Fisher Scientific, Waltham, MA USA), to calculate nmol hydrogen sulfideproduction per hour per mg protein.Myography The effect of hydrogen sulfide on vascular tone was measured in 5mm long aorta rings from 41 animals, with 5 to 8 rings tested for each age diet treatment combination. To reduce artifact from anesthesia (Dombkowski et al. 2005), euthanasia was by guillotine under IACUCapproved methods. After dissection, aorta was cleaned of fat and connective tissue, and myography was performed essentially as previously described (Dombkowski et al. 2005). Rings were attached with stainless steel wire to force transducers and mounted in a 37C tissue bath system (Radnoti Glass Technology,Monrovia, Ca USA) containing Krebs bicarbonate buffer. Rings were allowed to equilibrate after mounting for a minimum of 1 h, and a baseline tension of 1.5 g was maintained throughout each experiment. At the start of an experiment, each ring was maximally contracted with two additions of 80 mmol/L KCl. After washing with Krebs buffer and returning to baseline tension, the rings were incubated with 10 mol/L propranolol (to block -adrenergic receptor relaxation and maximize -adrenergic receptor contraction), and precontracted with 1 mol/L norepinephrine (NE). After the NE precontraction stabilized, rings were exposed to 100 mol/L hydrogen sulfide. After 30-45 min, the tissue bath was drained and the rings were washed twice with Krebs buffer and allowed to return to baseline tension. This sequence of propranolol, NE and hydrogen sulfideaddition was repeated for 300, 600 and 900 mol/L hydrogen sulfide. Data for hydrogen sulfide-induced contractions for each aortic ring were standardized to the weight of the ring.

PAGE 63

63 Actual total hydrogen sulfide concentrations, as measured by a methylene blue assay (Gilboa-Garber 1971), were approximately 75% of the predicted value (presumably due mostly to oxidation). Note that in physiological saline at pH 7.4, the dissociation of hydrogen sulfide results in approximately 1/3 of total hydrogen sulfide as H 2 S and 2/3 as HS (Beauchamp et al. 1984). Statistics All statistics were run using JMP statistical software, (JMP 7.0, SAS Institute, Cary, NC USA) with alpha 0.05 considered significant. Two-way ANOVAs were run with a Tukey posthoc test, when possible. However, the functional response data were not always normally distributed, and therefore violated the assumptions of the ANOVA. In those cases, significant effects of age and diet were tested using the Kruskal-Wallis nonparametric ANOVA. When fewer than three groups were compared, pooled (two-tailed) or one-tailed t-tests were used. For real-time PCR, statistics were done on the average Ct of each sample, since the Cts are normally distributed (Wood et al. 2005). Statistical tests are listed throughout preceding their respective pvalues. Results CSE and CBS Protein Expression The relative expression of CSE and CBS protein differed between aorta and liver. In aorta, CSE protein expression (relative to -actin) was 1.43-fold higher than CBS protein expression on average, whereas in liver, CBS protein expression (relative to -actin) was 1.18fold higher than CSE protein expression, on average. In both aorta andliver, CSE protein expression was significantly affected by an interaction between age and diet (Figure 4-1A and 4-1B). In aorta, CSE protein expression

PAGE 64

64 increased with age in AL animals, but it was unchanged with age in CR animals (Figure 4-1A, bars; 2-way ANOVA with Tukey post-hoc, p < 0.0001). At ages 18, 29, and 38 months CR CSE protein expression was significantly lower than AL at those ages, and was not significantly different than CSE expression at 8 months on either a CR or AL diet (Figure 4-1A, asterisks). In liver, CSE protein expression was unchanged with age in AL animals, but increased with age in CR animals (Fig 4-1B, bars; 2-way ANOVA with Tukey post-hoc, p = 0.0041). At 38 months of age AL CSE protein expression was significantly lower than CR (Figure 4-1B, asterisks). In aorta but not liver, CBS expression was also significantly affected by an interaction between age and diet (Figure 4-1C and 4-1D). In aorta, there was significantly higher CBS protein expression in AL animals at 38 months compared to CR animals (Figure 4-1C, asterisks; 2-way ANOVA with Tukey post-hoc, p = 0.0056). In liver, there was no significant difference in CBS expression at any age, and there was no effect of CR (Figure 4-1D, 2-way ANOVA, p >> 0.05). CSE and CBS mRNA Expression There were no interactions between age and diet on the mRNA expression of CSE and CBS in aorta or liver (Figure 4-2). In aorta, the CR diet significantly increased expression of both CSE mRNA (Figure 4-2A, one-tailed t-test, p = 0.0013) and CBS mRNA (Figure 4-2C, onetailed t-test, p = 0.0258) when compared to the AL diet. In liver, diet did not affect the expression of either CSE mRNA (Figure 4-2B, one-tailed t-test, p >> 0.05) or CBS mRNA (Figure 4-2D, one-tailed t-test, p >> 0.05). Hydrogen SulfideProductionThere were no interactions between age and diet on capacity for hydrogen sulfide production in aorta or liver (Figure 4-3), but the capacity for hydrogen sulfideproduction was affected by diet. In aorta and liver hydrogen sulfide production was higher in tissues of CR

PAGE 65

65 animals than AL animals (Figure 4-3A, one-tailed t-test, p = 0.0407 and Figure 4-3B, one-tailed t-test, p = 0.0411, respectively). Inhibitors of PLP-dependent enzymes were added to confirm hydrogen sulfideproduction was not occurring through PLP-independent mechanisms. Addition of the CSE inhibitor Pgly (20 mmol/L) decreased hydrogen sulfideproduction by 50% in aorta and by 94% in liver (data not shown), whereas addition of the CBS inhibitor AOAA (1 mmol/L) decreased hydrogen sulfideproduction by 57% in aorta and by 81% in liver (data not shown).Contractile Response to Hydrogen Sulfidein AortaApplication of hydrogen sulfideto isolated aorta rings typically elicited a triphasic, contraction-relaxation-contraction response(Figure 4-4). The contraction in the third phase was larger in magnitude and longer lasting than the contraction in the first phase, but at the lowest hydrogen sulfideconcentration used (100 mol/L) the response was typically very weak or absent. Age did not affect the response to KCl or norepinephrine (Figure 4-5A and 4-5B, One-way ANOVA, p >> 0.05 for both), but age did have a significant effect on the first phase of the triphasic response to hydrogen sulfide.The first phase contraction was stronger in rings from 34 mo rats than from 14 mo rats after application of100 mol/L hydrogen sulfide(Figure 4-5C, one-way ANOVA with Tukey post-hoc, p = 0.0062). However, the first phase contraction to 300-900mol/L hydrogen sulfidedid not significantly increase with age (Figure 4-5D, KruskalWallis ANOVA, p >> 0.05 for all). The second phase relaxation showed a significant effect of age after application of100mol/L hydrogen sulfide(data not shown, Kruskal-Wallis ANOVA, p = 0.038). However, post-hoc testingwith a Wilcoxon non-parametric t-test between groups did not show significant differences between the ages (p >> 0.05 for all). The third phase contraction was not significantly affected by age (data not shown, Kruskal-Wallis ANOVA, p >> 0.05 for all).

PAGE 66

66 Overall, CR had a significant effect on all phases of the contract-relax-contract response to hydrogen sulfide. Furthermore, the KCl and NE contractions were significantly stronger in rings from CR rats than from AL rats (Figure 4-6A and 4-6B, one-tailed t-test, p = 0.0282 and < 0.0001, respectively). Compared to rings from AL rats, CR increased the magnitude of the first phase contraction after application of 300900mol/L hydrogen sulfide(Figure 4-7A, pooled ttest, p = 0.0006, p = 0.0079 and 0.0192, respectively), the magnitude of the second phase relaxation after application of 300 and 600mol/L hydrogen sulfide(Figure 4-7B, one-tailed ttest, p = 0.0492 and Wilcoxon test, p = 0.0027, respectively), and the magnitude of the third phase contraction after application of 300 -900mol/L hydrogen sulfide(Figure 4-7C, pooled ttest, p < 0.0001, p = 0.0025, and p = 0.0008, respectively). Discussion CSE and CBS Protein Expression In aorta, CSE expression increased with age on an AL diet, but remained constant on a CR diet. Aorta CBS expression showed a similar trend, but with lower expression levels. CBS expression was increased at age 38 months for AL animals, while CR animals had significantly lower CBS expression at 38 months. It is perhaps not surprising that changes with age were more evident for CSE than for CBS, since CSE is the expressed at higher levels in the endothelium and smooth muscle cells of aorta and is also believed to have the most functional contribution to regulating vascular tone (Hosoki et al. 1997; Zhao et al. 2001; Zhao et al. 2003; Wang et al. 2008). Therefore, CSE would be the more likely of the two enzymes to exhibit measurable effects of age and diet. We have been able to measure CBS protein in aorta even though previous researchers were only able to detect CSE mRNA and concluded there was no CBS in these tissues (Hosoki et al. 1997; Zhao et al. 2001). However, the protein expression level of CBS was

PAGE 67

67 much less than that of CSE, consistent with the assumption that CBS has a less importantrole in the vasculature. In aorta, the increase in CSE expression with age is similar to changes reported with age in eNOS expression in peripheral arteries (Cernadas et al. 1998; van der Loo et al. 2000; Goettsch et al. 2001; van der Loo et al. 2005), in which eNOS increased up to sevenfold with age. This was attributed to a homeostatic attempt to correct for a decrease in the bioavailability of NO caused by superoxide reacting with NO to form a peroxynitrite (van der Loo et al. 2000; van der Loo et al. 2005). Since NO and hydrogen sulfidehave been reported to interact synergistically, changes in one system may impact the other (Hosoki et al. 1997; Wang et al. 2008). Additionally, hydrogen sulfidemay also react with, and be quenched by, increasing peroxynitrite levels resulting from NO reacting with superoxide (Whiteman et al. 2004b). Furthermore, there is limited evidence that hydrogen sulfidereacts with superoxide, which may also directly impact hydrogen sulfidebioavailability (Geng et al. 2004a). CR has been hypothesized to prevent this age-related endothelial dysfunction by preventing increases in superoxide levels with age, thereby maintaining a more youthful state (Gredilla et al. 2001; Barja 2002; Gredilla et al. 2004; Castello et al. 2005; Taddei et al. 2006). Accordingly, CSE and, to a lesser extent, CBS expressionin CR animals did not significantly increase with age and were more similar to 8 month old AL animals, consistent with a protective effect of CR in aorta maintaining a youthful state. In liver, CSE expression increased with age in CR animals whereas CBS expression did not change with age. Since both CBS and CSE are involved in cysteine metabolism in addition to producing hydrogen sulfide(Zhao et al. 2001), they are present in relative abundance in the liver compared to other tissues. However, CBS is the primary hydrogen sulfideproducing enzymein

PAGE 68

68 the liver (Zhao et al. 2003), and therefore the increase in CSE expression with age may not accurately reflect what is occurring to hydrogen sulfidelevels as well as CBS expression does. Liver enzymatic capacity does not change substantially with age, and this also appears to be true for CBS (Kitani 1991; Kitani 1994; Anantharaju et al. 2002). Since the liver is functionally much different than aorta, it is perhaps not surprising that age and diet do not affect the liver to the same degree as the aorta. The heterogeneity between tissue types observed between aorta and liver also occurs in the NO signaling system. Even when comparing peripheral vessels to heart tissue in the circulatory system, changes are seen in the vasculature even though no significant changes are observed in the heart (van der Loo et al. 2005). Therefore, the age and diet affects on the hydrogen sulfide signaling system may not be global events that occur during aging, but rather tissue-specific effects. CSE and CBS mRNA Expression There were complex and dramatic changes with age and diet in CSE protein expression in aorta and liver. There were no significant changes in the mRNA message for CSE or CBS with age, although CR did increase CSE and CBS mRNA levels in aorta. This seems to contradict the protein expression, in which CR reduced the expression of those proteins. Conversely, liver CSE and CBS mRNA message did not significantly change with age or diet, which was more consistent with the protein data. We cannot account for the discrepancy between mRNA and protein data, except to note that mRNA message does not alwaystranslate directly into protein (Gygi et al. 1999). We must conclude that while CR causes increases in mRNA for CSE and CBS in the vasculature, this does not translate into the synthesis of more new protein. Alternatively, CR may attenuate the need for new protein formation, but does not stop the synthesis of mRNA, leading to the observed increase in mRNA expression.

PAGE 69

69 Hydrogen SulfideProductionExtracellular concentrations of total hydrogen sulfide (representing the sum of H 2 S, HS and S 2) have been reported in the range of 50-160 mol/L in the brain (Goodwin et al. 1989; Abe et al. 1996)and ~50 mol/L in the plasma (Zhao et al. 2001). However, recent measurements in plasma seem to indicate that true hydrogen sulfideconcentrations are much lower (<100 nmol/L) (Whitfield et al. 2008). This discrepancy is likely due to methodological differences in how free hydrogen sulfide is differentiated from that which is bound or acidlabile (Olson 2009). Homogenates of aorta and liver both produced a consistent amount of hydrogen sulfide regardless of age, but CR samples consistently showed a higher hydrogen sulfideproduction rate. This is particularly interesting for the aorta, because our data indicate that it had lower levels of the hydrogen sulfide producing enzymes. Therefore, it can produce more hydrogen sulfidethan the AL samples that have significantly more hydrogen sulfideproducing enzymes. Note that because the data were calculated as nmol hydrogen sulfide/hr/ mg protein production rates for aorta and liver were very similar. When hydrogen sulfideproduction is instead calculated as nmol hydrogen sulfide/hr/ g tissue or nmol hydrogen sulfide/hr/ ml of homogenate liver has a higher production rate than aorta. Addition of AOAA and Pgly reduced hydrogen sulfideproduction in both aorta and liver, but did not completely block production. This indicates that both CSE and CBS contribute to hydrogen sulfideproduction in these tissues, but there may be a small contribution of acid labile hydrogen sulfide contributing to these production rate measurements. It is important to note that the recovery rate of hydrogen sulfideusing the assay is not 100%, and is more likely 33-59% depending on the hydrogen sulfide production rate of the tissue (Julian et al. 2002).

PAGE 70

70 Therefore, these rates should only be used as a comparison between the treatment groups in this study and not as an absolute rate of hydrogen sulfide production from aorta and liver in the rat. Contractile Response to Hydrogen Sulfidein AortaAlthough triphasic responses to hydrogen sulfideapplication have been reported in rat pulmonary artery (Olson et al. 2006), previous studies of rat aorta have shown only a monophasic relaxation or contraction with hydrogen sulfide(Zhao et al.2002; Dombkowski et al. 2005; Kubo et al. 2007b). We found that the development of all three phases typically required 15-30 min to develop after a bolus of hydrogen sulfide. Consequently, the triphasic response may have been masked in previous studies that did not allow sufficient time after hydrogen sulfideaddition. Additional methodological variations, such as tissue preparation (ring vs. strip), method of euthanasia, and lag time between tissue dissection and hydrogen sulfide application, may have also contributed to differences in aorta response. It has been suggested that high O 2 concentrations in the tissue bath may lead to formation of vasoactive hydrogen sulfideoxidation products (Koenitzer et al. 2007). Since our experiments were run at ambient O 2 concentrations, oxidation products may have contributed to the triphasic response. However, in dorsal aorta of cyclostomes hydrogen sulfide-induced contractions are enhanced at low O 2 concentrations, suggesting that hydrogen sulfide oxidation products are not the only cause of hydrogen sulfide-induced contractions(Olson et al. 2008). Additionally, in rat aorta rings we see the same triphasic response during hypoxia (Dissertation Chapter 2). This response to hypoxia is presumably mediated in part by hydrogen sulfide that is not readily oxidized due to the extremely low oxygen levels (Olson et al. 2006). Our data indicate that the response of rat aortic rings to hydrogen sulfide increases in magnitude with age, withsignificant changes observed in the first phase contraction. The triphasic response in aorta has not been reported previously, and it is not known what causes the

PAGE 71

71 initial contraction phase. A likely candidate is the reaction of hydrogen sulfidewith NO toform a nitrosothiol (Whiteman et al. 2006), which has been suggested to reduce free NO and lead to contraction at low levels of hydrogen sulfide(Ali et al. 2006), whereas higher hydrogen sulfide concentrations may cause relaxation by activating K ATP channels (Zhao et al. 2001). It is likely that after application of the hydrogen sulfidedonor, NO reacts quickly with hydrogen sulfide causing contraction, which is followed by relaxation as K ATPchannels are activated. We have shown evidence of this in aorta during hypoxia-induced responses (Chapter 2). If indeed this NO-scavenging mechanism does mediate the first phase contraction, then the reduced bioavailability of NO observed with age (Cernadas et al. 1998; van der Loo et al. 2000; Goettsch et al. 2001; van der Loo et al. 2005)could cause the increase in sensitivity to hydrogen sulfide. That is, the less free NO is available, the larger the effect on vascular tone for a given amount of hydrogen sulfide. Caloric restriction dramatically increased the response to hydrogen sulfidein all three phases, as well as the response to KCl. Therefore, rather than representing a global effect on hydrogen sulfide -signaling, the effect of CR may represent an overall enhancement of smooth muscle tissue health, as has been reported in skeletal muscle (Payne et al. 2003),. Conclusions Our data show that age affects the hydrogen sulfide signaling system in the aorta, on both the contractile response to hydrogen sulfideand the protein expression of CSE. Aorta responds to hydrogen sulfide with a triphasic contract-relax-contract response, which becomes sensitized to hydrogen sulfidewith age. There was no age effect in the liver on the main hydrogen sulfide producing enzyme CBS. CR benefits the hydrogen sulfide signaling system in the aorta. All phases of the triphasic response were enhanced by CR, and CR maintained lower expression of CSE and CBS proteins, which could produce more hydrogen sulfide than AL animals. CR has no

PAGE 72

72 significant affect on CBS protein expression in the liver. Overall, aorta shows the most impact of age and CR. While the effects of CR are likely due to maintenance of healthier tissue/proteins, the sensitization with age on hydrogen sulfidesignaling in aorta may owe to impacts of age on NO. Therefore, the interactions of H 2 S, NO and CO are key to fully elucidating the ramifications of these changes.

PAGE 73

73 A Age (mo) 8 18 29 38 8 18 29 38 E x p e r e s s i o n R e l a t i v e t o A c t i n 0 1 2 3 4 5 6 7 8 9 * B Age (mo) 8 18 29 38 8 18 29 38 E x p e r e s s i o n R e l a t i v e t o A c t i n 0 1 2 3 4 5 6 7 C Age (mo) 8 18 29 38 8 18 29 38 E x p e r e s s i o n R e l a t i v e t o A c t i n 0 1 2 3 4 D Age (mo) 8 18 29 38 8 18 29 38 E x p e r e s s i o n R e l a t i v e t o A c t i n 0 2 4 6 8 10 Figure 4-1.Effect of age and diet on CSE and CBS protein expression. CSE expression is shown in aorta (A) and liver (B). CBS expression is shown in aorta (C) and liver (D). The Y-axis shows CSE (A and B) or CBS (C and D) protein expression relative to actin. The X-axis shows the age in months (mo). AL data are in white columns and CR data are in grey columns. Representative blots are aligned along the top, above each column. Data are represented as mean SE and were analyzed by 2-way ANOVA with Tukey post-hoc tests. Means that are significantly different are indicated by different letters.

PAGE 74

74 Diet AL CR E x p r e s s i o n R e l a t i v e t o A c t i n 0 1 2 3 4 5 A Diet AL CR E x p r e s s i o n R e l a t i v e t o A c t i n 0 1 2 3 4 5 B Diet AL CR E x p r e s s i o n R e l a t i v e t o A c t i n 0 1 2 3 C Diet AL CR E x p r e s s i o n R e l a t i v e t o A c t i n 0 1 2 3 4 5 6 7 *Y-axis has to be multiplied by 10,000D Figure 4-2.Effect of diet on CSE and CBS mRNA expression. CSE expression is shown in aorta (A) and liver (B). CBS expression is shown in aorta (C) and liver (D). The Y-axis shows CSE (A and B) protein expression relative to -actin and CBS (C and D) protein expression relative to 18S rRNA. The X-axis shows the diet. AL data are in white columns and CR data are in grey columns. Data are represented as mean SE and were analyzed by one-tailed t-tests. Means that are significantly different are indicated by asterisks.

PAGE 75

75 Diet AL CR P r o d u c t i o n R a t e n m o l / h r / m g 0.00 0.02 0.04 0.06 0.08 0.10 0.12 0.14 0.16 0.18 A Diet AL CR P r o d u c t i o n R a t e n m o l / h r / m g 0.00 0.05 0.10 0.15 0.20 B Figure 4-3.Effect of diet on hydrogen sulfideproduction. Hydrogen sulfideproduction rates are shown in aorta (A) and liver (B). The Y-axis shows production as nmol H 2 S/hr/mg protein. The X-axis shows the diet. AL data are in white columns and CR data are in grey columns. Data are represented as mean SE and were analyzed by one-tailed ttests. Means that are significantly different are indicated by asterisks.

PAGE 76

76 Figure 4-4.Representative tension tracing of a rat aorta ring pre-contracted with norepinephrine (NE) and exposed to hydrogen sulfide (H 2 S, 300 mol/L). Scale bar shows time in min and tension in grams.

PAGE 77

77 Age 14 27 34 C o n t r a c t i o n ( g / m g ) 0.0 0.1 0.2 0.3 0.4 A Age 14 27 34 C o n t r a c t i o n ( g / m g ) 0.00 0.05 0.10 0.15 0.20 B Age 14 27 34 C o n t r a c t i o n ( g / m g ) 0.00 0.05 0.10 0.15 0.20 a b b C Age (months) 142734142734142734142734 C o n t r a c t i o n ( g / m g ) 0.0 0.1 0.2 0.3 0.4 0.5 a b b 100 umol/L300 umol/L600 umol/L900 umol/L D Figure 4-5.Effect of age on KCl-and norepinephrine (NE)-induced contractions and the first phase contraction to hydrogen sulfide. Age has no effect on KCl-(A) or NE-induced contractions (B). However, the first phase contraction to hydrogen sulfide(C) significantly increases with age at 100 mol/L hydrogen sulfideaddition. The first phase contractions did not significantly increase at 300-900 mol/L hydrogen sulfide addition (D). The Y-axis represents the hydrogen sulfide-induced tension of aortic rings (g/mg). The X-axis shows the age (mo) (A-C) for each of the four hydrogen sulfideconcentrations, divided into four panels (D). The top labels represent the concentration of hydrogen sulfideused for that panel (D). Data are presented as means SE (A-C) or as box plots showing the median, quartiles and outliers (D). Data were analyzed by one-way ANOVA with Tukey post-hoc test. Means that are significantly different are indicated by letters.

PAGE 78

78 Diet AL CR C o n t r a c t i o n ( g / m g ) 0.0 0.1 0.2 0.3 0.4 A Diet AL CR C o n t r a c t i o n ( g / m g ) 0.00 0.05 0.10 0.15 0.20 B Figure 4-6.Effect of diet on KCl-and norepinephrine (NE)-induced contractions. CR causes an increase in contraction magnitude in response to KCl ( A ) and NE ( B ). The Y-axis represents the tension of aortic rings (g/mg). The X-axis represents age diet: ad libitum (AL) or caloric restricted (CR). AL data are in whitecolumns and CR data are in grey columns. Data are represented as mean SE and were analyzed by onetailed or pooled t-tests. Means that are significantly different are indicated by asterisks.

PAGE 79

79 Figure 4-7.Effect of diet on hydrogensulfide-induced contractions. CR causes an increase in contraction magnitude in response to hydrogen sulfidein the first phase contraction (A), second phase relaxation (B) and third phase contraction (C). The Y-axis represents the hydrogen sulfide-induced tension of aortic rings (g/mg). The X-axis represents diet: ad libitum (AL, white) or caloric restricted (CR, grey) for each of the four hydrogen sulfideconcentrations, divided into four panels. The top labels represent the concentration of hydrogen sulfideused for that panel. Data are presented as medians, with error bars defining upper and lower quartiles. Data were analyzed by one-tailed or pooled t-tests. Medians that are significantly different are indicated by asterisks. Diet AL CR AL CR AL CR AL CR C o n t r a c t i o n ( g / m g ) 0.0 0.1 0.2 0.3 0.4 0.5 100 umol/L300 umol/L600 umol/L900 umol/LA Diet AL CR AL CR AL CR AL CR R e l a x a t i o n ( g / m g ) -0.5 -0.4 -0.3 -0.2 -0.1 0.0 100 umol/L300 umol/L600 umol/L900 umol/L* B

PAGE 80

80 Diet AL CR AL CR AL CR AL CR C o n t r a c t i o n ( g / m g ) 0.0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 C 100 umol/L300 umol/L600 umol/L900 umol/L* Figure 4-7. Continued.

PAGE 81

81 CHAPTER 5 SYNTHESIS: UNDERSTANDING HYDROGEN SULFIDE SIGNALING IN VASCULAR SMOOTH MUSCLE AND THE TRIPHASIC RESPONSE Introduction Through this work on hydrogen sulfide signaling it has become clear that there are many pathways (potentially) involved in the vascular response. Some of these pathways have been elucidated, others have not. When investigating in vessel preparations, predominantly aorta in these studies, there is a distinct multiphasic contraction-relaxation-contraction response after application of hydrogen sulfide to the tissue bath that takes 2-3 times longer than a majority of the hydrogen sulfide actually remains in solution. Therefore hydrogen sulfide is most likely activating a variety of pathways initially, which in turn modulate the phases after hydrogen sulfide has been oxidized in the solution. We also observe a similar contraction-relaxation-contraction response pattern in aorta rings exposed to hypoxia. It has been hypothesized that hydrogen sulfide is mediating the hypoxia response because hypoxia will allow the accumulation of hydrogen sulfide in tissues since there is little oxygen to oxidize it. However, the time course is much slower in hypoxia responses, and the mechanisms may not be the same. Hydrogen sulfide also has a demonstrated effect on nitric oxide (NO) production from endothelial nitric oxide synthase (eNOS). Within 30 min of application, hydrogen sulfide causes an Akt-dependent increase in NO production via phosphorylation of Ser 1177 on eNOS. This finding fitswithin a developing theme in the literature on gasotransmitters; that hydrogen sulfide and NO having a synergistic relationship (Hosoki et al. 1997; Kimura 2002; Julian et al. 2005b; Jeong et al. 2006). NO has also been demonstrated to increasehydrogen sulfide production from cystathionine -lyase(Zhao et al. 2001; Zhao et al. 2003). Therefore, another signal must be present to quench their production, such as a feedback inhibition, or carbon monoxide (CO),

PAGE 82

82 which can inhibit iNOS (Oh et al. 2006). However, hydrogen sulfide and NO can also chemically interact to form a nitrosothiol, so they may quench each others signal as a form of regulation. Age does change the initial contraction phase of the triphasic response to hydrogen sulfide, and this is likely due to this contraction being partially mediated by the reaction of hydrogen sulfide with NO, reducing free NO levels. The mechanisms underlying the initial contraction phase are discussed further below. Caloric restriction (CR) is an intervention that appears to reduce the increase in oxidative stress that occurs with age, which includesincreased superoxide production. For the aging studies, we hypothesized that CR would ameliorate any changes we saw with age. While this was true in the case of cystathionine -lyase (CSE) and cystathionine -sythase (CBS) protein expression, it was not true of the functional response measurements (smooth muscle tone) in aorta rings. Here we observed an increase in responsiveness to all stimuli: KCl, norepinephrine, and hydrogen sulfide. It is believed that CR enhances the contractile function of smooth muscle, as is the case in skeletal muscle (Payne et al. 2003), and that this explains the increased general responsiveness. Therefore it is not a hydrogen sulfide-specific effect, but rather a global benefit of the CR intervention. What is Modulating Phase 1 of the Triphasic Response? The chemical reaction between NO and hydrogen sulfide likely contributes to the initial contraction phase by quickly reducing NO bioavailability (Whiteman et al. 2006; Whiteman et al. 2009). However, since removal of the endothelium from the aorta rings does not completely block the initial contraction phase from occurring, loss of NO bioavailability does not entirely explain what happens at this initial contraction. If this phase were completely NO-dependent, then removal of the endothelium, eNOS would be removed with the endothelium, and therefore the initial contraction should be completely abolished because there should be no NO to

PAGE 83

83 scavenge. This also assumes that there would be no iNOS activity in smooth muscle. Application of the eNOS inhibitor L-NAME produced mixed results, depending on how it was added experimentally. Adding L-NAME prior to the PE precontraction and adjusting the tension after its application (to maintain 1.5 g tension) does not significantly reduce the initial contraction phase to hydrogen sulfide, further supporting the proposition that the reaction with NO is not solely responsible for causing this initial contraction. However, adding L-NAME after the PE precontraction and allowing the ring to further constrict (but not beyond the maximum tension developed by KCl) did significantly reduce the initial contraction when hydrogen sulfide was added. L-NAME also significantly reduced the initial contraction phase to hypoxia when added before the PE precontraction. This suggests that the initial contraction to hypoxia may be more dependent on NO/NOS than hydrogen sulfide, and that hydrogen sulfide may not play a large role in hypoxia signaling during this initial contraction phase. The partial dependence of hydrogen sulfide on NO during the initial contraction is consistent with the observation that the initial contraction increases in sensitivity with age. Bioavailable NO declines with age due to increases in formation of superoxide, whichcan scavenge NO to form a peroxynitrite (van der Loo et al. 2000). If hydrogen sulfide is reducing bioavailable NO as well as by chemically reacting with it, then more hydrogen sulfide would be needed to reduce the NO pool in younger animals compared to older animals. Looking at this another way, comparing small and large NO pools, if one were to add the same amount of hydrogen sulfide to both pools, the smaller pool will show a larger effect than the larger pool because the proportion of NO removed would be greater. What is Modulating Phase 2 of the Triphasic Response? The relaxation of blood vessels and smooth muscle in general, to hydrogen sulfide has an accepted mechanism. Patch-clamping studies show that hydrogen sulfide activates ATP-sensitive

PAGE 84

84 potassium channels (K ATP ) (Zhao et al. 2001; Zhao et al. 2002). Although it remains to be determined how this activation occurs, it is most likely a direct interaction with the channels rather than changing the ADP/ATP status (Whiteman et al. 2009). Using glibenclamide, a K ATP inhibitor, we have not been able to statistically show that these channels are causing the relaxation in our observed triphasic response. It is clearly not endothelium-dependent, since removal of the endothelium does not affect the relaxation phase, and neither does adding LNAME before addition of hydrogen sulfide. Other investigators have been unable to satisfactorily show the action of K ATP channels in the relaxation caused by hydrogen sulfide, and others have proposed that K ATP only partially mediates the relaxation (Kubo et al. 2007b). We initially assumed that the discrepancy is related to dosage of glibenclimide. Our initial studies used glibenclimide dosages that were comparatively high, which may affect not only K ATP but chloride channels as well. Interestingly, this same dose did significantly reduce the relaxation observed during hypoxia responses, while only causing a small, non-significant decrease in the hydrogen sulfide treatments. This raises the question of what concentrations of hydrogen sulfide are present during hypoxia, if at all? While a hydrogen sulfide-sensitive electrode exists, no researchers have yet been able to perform these measurements. Therefore, the true mechanism of the relaxation phase remains unknown, but it is likelyat least partially through K ATP Recently however, a new mechanism of relaxation induced by hydrogen sulfide has been uncovered: the Cl /HCO 3 anion exchanger (Kiss et al. 2008). I performed preliminary experiments with an anion channel blocker, 4,4'-Diisothiocyanatostilbene-2,2'-disulfonate (DIDS), to inhibit this exchanger. When adding DIDS, there was a complete blockade of the relaxation phase in the response to hydrogen sulfide. Therefore, it is quite likely that these anion

PAGE 85

85 exchangers are activated by hydrogen sulfide. This activation would lead to a reduction in intracellular pH (Lee et al. 2007), which in itself will cause relaxation of the smooth muscle and may also activate K ATP channels leading to the observed relaxation phase to hydrogen sulfide (Kiss et al. 2008). What is Modulating Phase 3 of the Triphasic Response? The third phase contraction is almost certainly not directly mediated by hydrogen sulfide, and is likely endothelially-derived. This conclusion is drawn simply from the oxidation rate of hydrogen sulfide from the tissue bath compared to the time this contraction phase starts. Hydrogen sulfide will be at least 50% oxidized by ten minutes after application. By fifteen minutes, which is the point at which the third phase contraction usually begins, most of the hydrogen sulfide will have disappeared. Additionally, removal of the endothelium significantly reduces the third phase contraction. It is likely, then, that hydrogen sulfide is causing a change in the concentration of another vasoactive agent produced in the endothelial cells. When we investigated the contribution of arachadonicacid metabolites (AAM) by inhibition of cyclooxygenase, lypoxygenase, and cytochrome P-450, we saw a significant reduction in the third phase contraction when all three enzymes were inhibited. Which AAMis causing this contraction remains to be elucidated, but it is likely a combination since inhibition of cyclooxygenase, lypoxygenase and cytochrome P-450 individually did not significantly reduce the third phase contraction. Interestingly in this case, the third phase contraction to hypoxia was not reducedwith inhibition of AAM, suggesting another difference between the two signaling events. A Proposed Time-course and Mechanism of the Triphasic Response We can now attempt to piece together a model of the chain of events that occurs in a blood vessel (in this case a precontracted ring of rat thoracic aorta) following the addition of

PAGE 86

86 hydrogen sulfide. Upon addition of Na 2 S, it rapidly dissociates into H2 S gas and HS The H 2 S diffuses into the aorta ring and the vascular smooth muscle cells (VSMC). Here H 2 Scomes into contact with free NO, and reacts to form a nitrosothiol (a vasoactive molecule in itself which may go on to cause downstream events (Henderson et al. 2005; Que et al. 2005)). This reduces NO bioavalability, which causes the VSMC to constrict, thereby starting the first phase contraction. At the same time this contraction begins, H 2 S starts to activate K ATP channels(or the Cl /HCO 3 anion exchanger), causing the VSMC to hyperpolarize and begin to relax. This relaxation continues for several minutes. Up to this point, the hydrogen sulfide has been oxidizing steadily, and is by now at least half gone. However, from the very start, H2 S has caused a conformational change in cyclooxygenase, lipoxygenase and cytochrome P-450, potentially by interacting with heme groups present in some of these enzymes, or by modifying and/or making new thiol groups, causing conformational changes. This stimulates the production of vasoconstricting AAMs, such as thromboxanes, leukotrienes, and prostaglandins (PGF 2 ). As these AAMs accumulate, they override the K ATP channel(or Cl/HCO 3 anion exchanger)induced relaxation and start the third phase contraction, which eventually peaks, and comes back to resting tension. This decrease to resting tension may also be aided by hydrogen sulfide initiating the activation of eNOS via phosphorylation, which peaks at around 30 minutes. This increases basal NO production, replenishing the NO that hydrogen sulfide initially scavenged, thereby decreasing vascular tone. Conclusions and Future Directions While we have made a good start at understanding what is modulating the vascular response to hydrogen sulfide, there is much to be learned. The triphasic response is likely the end result of a multitude of changes resulting from the addition of hydrogen sulfide. Given the

PAGE 87

87 extremely reactive nature ofhydrogen sulfide, it is possible that many pathways are activated or deactivated. This makes it difficult to isolate individual contributors within a given contraction or relaxation phase. Even removal of the endothelium does not completely block any phase, despite the majority of the response probably being endothelium-derived. Hydrogen sulfide likely acts directly on the VSMCs as well. We also have not been able to completely block the relaxation phase with K ATP inhibitors, and therefore an additional mechanism probably contributes to the relaxation phase. Future work will be required to fully elucidate the mechanisms behind hydrogen sulfide signaling in the cardiovascular system. A systematic, whole-animal approach would be helpful to test the physiological relevance of the triphasic response. There is a consistent finding of a decrease in blood pressure when hydrogen sulfide donors are injected into whole animals (Zhao et al. 2001; Zhong et al. 2003; Wang et al. 2008; Webb et al. 2008; Yang et al. 2008; Zhao et al. 2008). However, one group has observed a biphasic response in blood pressure to hydrogen sulfide injection, with blood pressure showing an initial decrease followed by a transient increase (Kubo et al. 2007c). This is consistent with our observed triphasic response, which would initially cause a drop in blood pressure (assuming the initial contraction is too short and small in magnitude to be detected) and then a rise in blood pressure as the second contraction phase begins. Whole animal studies may also be useful for resolving the seemingly contradictory data that hydrogen sulfide activates eNOS, but causes contraction in aorta. The activation of eNOS does not occur until 30 minutes after hydrogen sulfide addition, and therefore it may contribute to the attenuation of the third phase contraction, and thus recovery of the vessel to base tension. This activation should be tested in vivo to determine whether application of hydrogen sulfide

PAGE 88

88 after 30 minutes significantly alters blood pressure or enhances the response to acetylcholine compared to controls.

PAGE 89

89 LIST OF REFERENCES Abe, K., Kimura, H., 1996. The possible role of hydrogen sulfide as an endogenous neuromodulator. J Neurosci 16, 1066-1071. Ali, M.Y., Ping, C.Y., Mok, Y.Y., Ling, L., Whiteman, M., Bhatia, M., Moore, P.K., 2006. Regulation of vascular nitric oxide in vitro and in vivo; a new role for endogenous hydrogen sulphide? Br J Pharmacol. Anantharaju, A., Feller, A., Chedid, A., 2002. Aging Liver. A review. Gerontology 48, 343-353. Aspnes, L.E., Lee, C.M., Weindruch, R., Chung, S.S., Roecker, E.B., Aiken, J.M., 1997. Caloric restriction reduces fiber loss and mitochondrial abnormalities in aged rat muscle. Faseb J 11, 573-581. Attene-Ramos, M.S., Wagner, E.D., Gaskins, H.R., Plewa, M.J., 2007. Hydrogen sulfide induces direct radical-associated DNA damage. Mol Cancer Res 5, 455-459. Bagarinao, T., 1992. Sulfide as an environmental factor and toxicant: tolerance and adaptations in aquatic organisms. Aquatic Toxicol. 24, 21-62. Bagarinao, T., Vetter, R.D., 1992. Sulfide-hemoglobin interactions in the sulfide-tolerant saltmarsh resident, the California killifish Fundulus parvipinnis J. Comp. Physiol.B 162, 614-624. Barja, G., 2002. Endogenous oxidative stress: relationship to aging, longevity and caloric restriction. Ageing Res Rev 1, 397-411. Beauchamp, R.O., Bus, J.S., Popp, J.S., Boreiko, C.J., Andjelkovich, D.A., 1984. A critical review of the literature on hydrogen sulfide toxicity. CRC Crit Rev Toxicol 13, 25-97. Besse, S., Tanguy, S., Boucher, F., Bulteau, A.L., Riou, B., de Leiris, J., Swynghedauw, B., 2002. Aortic vasoreactivity during prolonged hypoxia and hypoxia-reoxygenation in senescent rats. Mech Ageing Dev 123, 275-285. Blackstone, E., Morrison, M., Roth, M.B., 2005. H2S induces a suspended animation-like state in mice. Science 308, 518. Cardounel, A.J., Cui, H., Samouilov, A., Johnson, W., Kearns, P., Tsai, A.L., Berka, V., Zweier, J.L., 2007. Evidence for the Pathophysiological Role of Endogenous Methylarginines in Regulation of Endothelial NO Production and Vascular Function. J Biol Chem 282, 879887. Cardounel, A.J., Zweier, J.L., 2002. Endogenous methylarginines regulate neuronal nitric-oxide synthase and prevent excitotoxic injury. J Biol Chem 277, 33995-34002. Epub 32002 Jun 33928.

PAGE 90

90 Castello, L., Froio, T., Cavallini, G., Biasi, F., Sapino, A., Leonarduzzi, G., Bergamini, E., Poli, G., Chiarpotto, E., 2005. Calorie restriction protects against age-related rat aorta sclerosis. Faseb J 19, 1863-1865. Cavallini, D., Mondovi, B., De Marco, C., Sciosciasantoro, A., 1962. Inhibitory effect of mercaptoethanol and hypotaurine on the desulfhydration of cysteine by cystathionase. Arch Biochem Biophys 96, 456-457. Cernadas, M.R., Sanchez de Miguel, L., Garcia-Duran, M., Gonzalez-Fernandez, F., Millas, I., Monton, M., Rodrigo, J., Rico, L., Fernandez, P., de Frutos, T., Rodriguez-Feo, J.A., Guerra, J., Caramelo, C., Casado, S., Lopez, F., 1998. Expression of constitutive and inducible nitric oxide synthases in the vascular wall of young and aging rats. Circ Res 83, 279-286. Chen KY, M.J., 1972. Kinetics of oxidation of aqueous sulfide by oxygen. Environ. Sci. Technol. 6, 529-537. Chen, K.Y., Morris, J.C., 1972. Oxidation of sulfide by O 2 : catalysis and inhibition. J. San. Eng. Div. Proc. Am. Soc. Civ. Eng. 98, 215-227. Chen, Y.H., Yao, W.Z., Geng, B., Ding, Y.L., Lu, M., Zhao, M.W., Tang, C.S., 2005. Endogenous hydrogen sulfide in patients with COPD. Chest 128, 3205-3211. Cheng, Y., Ndisang, J.F., Tang, G., Cao, K., Wang, R., 2004. Hydrogen sulfide-induced relaxation of resistance mesenteric artery beds of rats. Am J Physiol Heart Circ Physiol 287, H2316-2323. Chung, A.W., Au Yeung, K., Cortes, S.F., Sandor, G.G., Judge, D.P., Dietz, H.C., van Breemen, C., 2007. Endothelial dysfunction and compromised eNOS/Akt signaling in the thoracic aorta during the progression of Marfan syndrome. Br J Pharmacol 150, 1075-1083. Chunyu, Z., Junbao, D., Dingfang, B., Hui, Y., Xiuying, T., Chaoshu, T., 2003. The regulatory effect of hydrogen sulfide on hypoxic pulmonary hypertension in rats. Biochem Biophys Res Commun 302, 810-816. Claypool, G.E., Kvenvolden, K.A., 1983. Methane and Other Hydrocarbon Gases in Marine Sediment. Ann. Rev. Earth Planet Sci. 11, 299-327. Cline, J.D., 1969. Spectrophotometric determination of hydrogen sulfide in natural waters. Limnol. Oceanogr. 14, 454-458. d'Emmanuele di Villa Bianca, R., Sorrentino, R., Maffia, P., Mirone, V., Imbimbo, C., Fusco, F., De Palma, R., Ignarro, L.J., Cirino, G., 2009. Hydrogen sulfide as a mediator of human corpus cavernosum smooth-muscle relaxation. Proc Natl Acad Sci U S A. Dello Russo, C., Tringali, G., Ragazzoni, E., Maggiano, N., Menini, E., Vairano, M., Preziosi, P., Navarra, P., 2000. Evidence that hydrogen sulphide can modulate hypothalamo-

PAGE 91

91 pituitary-adrenal axis function: in vitro and in vivo studies in the rat. J Neuroendocrinol 12, 225-233. Dieterle, A., Orth, R., Daubrawa, M., Grotemeier, A., Alers, S., Ullrich, S., Lammers, R., Wesselborg, S., Stork, B., 2009. The Akt inhibitor triciribine sensitizes prostate carcinoma cells to TRAIL-induced apoptosis. Int J Cancer. Doeller, J.E., Grieshaber, M.K., Kraus, D.W., 2001. Chemolithoheterotrophy in a metazoan tissue: thiosulfate production matches ATP demand in ciliated mussel gills. J Exp Biol 204, 3755-3764. Dombkowski, R.A., Doellman, M.M., Head, S.K., Olson, K.R., 2006. Hydrogen sulfide mediates hypoxia-induced relaxation of trout urinary bladder smooth muscle. J Exp Biol 209, 3234-3240. Dombkowski, R.A., Russell, M.J., Olson, K.R., 2004. Hydrogen sulfide as an endogenous regulator of vascular smooth muscle tone in trout. Am J Physiol Regul Integr Comp Physiol 286, R678-685. Dombkowski, R.A., Russell, M.J., Schulman, A.A., Doellman, M.M., Olson, K.R., 2005. Vertebrate phylogeny of hydrogen sulfide vasoactivity. Am J Physiol Regul Integr Comp Physiol 288, R243-252. Dorman, D.C., Moulin, F.J.-M., McManus, B.E., Mahle, K.C., Arden James, R., Struve, M.F., 2002. Cytochrome oxidation inhibition induced by acute hydrogen sulfide inhalation: correlation with tissue sulfide concentrations in the rat brain, liver, lung, and nasal epithelium. Toxicol Sci 65, 18-25. Du, J., Yan, H., Tang, C., 2003. Endogenous H 2 S is involved in the development of spontaneous hypertension. Beijing Da Xue Xue Bao 35, 102. Ebrahimkhani, M.R., Mani, A.R., Moore, K., 2005. Hydrogen sulphide and the hyperdynamic circulation in cirrhosis: a hypothesis. Gut 54, 1668-1671. Eghbal, M.A., Pennefather, P.S., O'Brien, P.J., 2004. H2S cytotoxicity mechanism involves reactive oxygen species formation and mitochondrial depolarisation. Toxicology 203, 6976. Elrod, J.W., Calvert, J.W., Morrison, J., Doeller, J.E., Kraus, D.W., Tao, L., Jiao, X., Scalia,R., Kiss, L., Szabo, C., Kimura, H., Chow, C.W., Lefer, D.J., 2007. Hydrogen sulfide attenuates myocardial ischemia-reperfusion injury by preservation of mitochondrial function. Proc Natl Acad Sci U S A 104, 15560-15565. Eto, K., Kimura, H., 2002a. A novel enhancing mechanism for hydrogen sulfide-producing activity of cystathionine beta-synthase. J Biol Chem 277, 42680-42685. Eto, K., Kimura, H., 2002b. The production of hydrogen sulfide is regulated by testosterone and S -adenosyl-L-methionine in mouse brain. J. Neurochem. 83, 80-86.

PAGE 92

92 Fenga, C., Cacciola, A., Micali, E., 2002. [Cognitive sequelae of acute hydrogen sulphide poisoning. A case report]. Med Lav 93, 322-328. Fiorucci, S., Antonelli, E., Distrutti, E., Rizzo, G., Mencarelli, A., Orlandi, S., Zanardo, R., Renga, B., Di Sante, M., Morelli, A., Cirino, G., Wallace, J.L., 2005a. Inhibition of hydrogen sulfide generation contributes to gastric injury caused by anti-inflammatory nonsteroidal drugs. Gastroenterology 129, 1210-1224. Fiorucci, S., Antonelli, E., Mencarelli, A., Orlandi, S., Renga, B., Rizzo, G., Distrutti, E., Shah, V., Morelli, A., 2005b. The third gas: H2S regulates perfusion pressure in both the isolated and perfused normal rat liver and in cirrhosis. Hepatology 42, 539-548. Fiorucci, S.,Distrutti, E., Cirino, G., Wallace, J.L., 2006. The emerging roles of hydrogen sulfide in the gastrointestinal tract and liver. Gastroenterology 131, 259-271. Fiorucci, S., Santucci, L., Distrutti, E., 2007. NSAIDs, coxibs, CINOD and H2S-releasing NSAIDs:what lies beyond the horizon. Dig Liver Dis 39, 1043-1051. Fujii, K., Sakuragawa, T., Kashiba, M., Sugiura, Y., Kondo, M., Maruyama, K., Goda, N., Nimura, Y., Suematsu, M., 2005. Hydrogen sulfide as an endogenous modulator of biliary bicarbonate excretionin the rat liver. Antioxid Redox Signal 7, 788-794. Furchgott, R.F., 1999. Endothelium-derived relaxing factor: discovery, early studies, and identification as nitric oxide. Biosci Rep 19, 235-251. Gainey, L.F., Jr., Greenberg, M.J., 2003. Nitric oxide mediates seasonal muscle potentiation in clam gills. J Exp Biol 206, 3507-3520. Gainey, L.F., Jr., Greenberg, M.J., 2005. Hydrogen sulfide is synthesized in the gills of the clam Mercenaria mercenaria and acts seasonally to modulate branchial muscle contraction. Biol Bull 209, 11-20. Gallego, D., Clave, P., Donovan, J., Rahmati, R., Grundy, D., Jimenez, M., Beyak, M.J., 2008. The gaseous mediator, hydrogen sulphide, inhibits in vitro motor patterns in the human, rat and mouse colon and jejunum. Neurogastroenterol Motil 20, 1306-1316. Gangopadhyay, R.K., Das, S.K., 2007. Accident due to release of hydrogen sulphide in a manufacturing process of cobalt sulphide -case study. Environ Monit Assess 129, 133135. Garcia-Bereguiain, M.A., Samhan-Arias, A.K., Martin-Romero, F.J., Gutierrez-Merino, C., 2008. Hydrogen sulfide raises cytosolic calcium in neurons through activation of L-type Ca2+ channels. Antioxid Redox Signal 10, 31-42. Geng, B., Chang, L., Pan, C., Qi, Y., Zhao, J., Pang, Y., Du, J., Tang, C., 2004a. Endogenous hydrogen sulfide regulation of myocardial injury induced by isoproterenol. Biochem Biophys Res Commun 318, 756-763.

PAGE 93

93 Geng, B., Cui, Y., Zhao, J., Yu, F., Zhu, Y., Xu, G., Zhang, Z., Tang, C., Du, J., 2007. Hydrogen sulfide downregulates the aortic L-arginine/nitric oxide pathway in rats. Am J Physiol Regul Integr Comp Physiol 293, R1608-1618. Geng, B., Yang, J., Qi, Y., Zhao, J., Pang, Y., Du, J., Tang, C., 2004b. H2S generated by heart in rat and its effects on cardiac function. Biochem Biophys ResCommun 313, 362-368. Gilboa-Garber, N., 1971. Direct spectrophotometric determination of inorganic sulfide in biological materials and in other complex mixtures. Analytical Biochemistry 43, 129133. Goettsch, W., Lattmann, T., Amann, K., Szibor, M., Morawietz, H., Munter, K., Muller, S.P., Shaw, S., Barton, M., 2001. Increased expression of endothelin-1 and inducible nitric oxide synthase isoform II in aging arteries in vivo: implications for atherosclerosis. Biochem Biophys Res Commun 280, 908-913. Goodwin, L.R., Francom, D., Dieken, F.P., Taylor, J.D., Warenycia, M.W., Reiffenstein, R.J., Dowling, G., 1989. Determination of sulfide in brain tissue by gas dialysis/ion chromatography: postmortem studies and two case reports. J Anal Toxicol 13, 105-109. Gredilla, R., Phaneuf, S., Selman, C., Kendaiah, S., Leeuwenburgh, C., Barja, G., 2004. Shortterm caloric restriction and sites of oxygen radical generation in kidney and skeletal muscle mitochondria. Ann N Y Acad Sci 1019, 333-342. Gredilla, R., Sanz, A., Lopez-Torres, M., Barja, G., 2001. Caloric restriction decreases mitochondrial free radical generation at complex I and lowers oxidative damage to mitochondrial DNA in the rat heart. Faseb J 15, 1589-1591. Gygi, S.P., Rochon, Y., Franza, B.R., Aebersold, R.,1999. Correlation between protein and mRNA abundance in yeast. Mol Cell Biol 19, 1720-1730. Han, Y., Qin, J., Chang, X., Yang, Z., Bu, D., Du, J., 2005. Modulating effect of hydrogen sulfide on gamma-aminobutyric acid B receptor in recurrent febrile seizures in rats. Neurosci Res 53, 216-219. Hand, S.C., Somero, G.N., 1983. Energy Metabolism Pathways of Hydrothermal Vent Animals: Adaptations to a Food-Rich and Sulfide-Rich Deep-Sea Environment. Biol. Bull. 165, 167-181. Haouzi, P., Notet, V., Chenuel, B., Chalon, B., Sponne, I., Ogier, V., Bihain, B., 2008. H2S induced hypometabolism in mice is missing in sedated sheep. Respir Physiol Neurobiol 160, 109-115. Hecker, B., 1985. Fauna from a cold sulfur-seep in the Gulf of Mexico: comparison with hydrothermal vent communities and evolutionary implications. BULL. BIOL. SOC. WASH. 6, 465-473. Henderson, E.M., Gaston, B., 2005. SNOR and wheeze: the asthma enzyme? Trends Mol Med.

PAGE 94

94 Hosoki, R., Matsuki, N., Kimura, H., 1997. The possible role of hydrogen sulfide as an endogenous smooth muscle relaxant in synergy with nitric oxide. Biochem Biophys Res Commun 237, 527-531. Hourdez, S., Lallier, F.H., De Cian, M.C., Green, B.N., Weber, R.E., Toulmond, A., 2000. Gas transfer system in Alvinella pompejana (Annelida polychaeta, Terebellida): functional properties of intracellular and extracellular hemoglobins. Physiol Biochem Zool 73, 365373. Hu, Y., Chen, X., Pan, T.T., Neo, K.L., Lee, S.W., Khin, E.S., Moore, P.K., Bian, J.S., 2007. Cardioprotection induced by hydrogen sulfide preconditioning involves activation of ERK and PI3K/Akt pathways. Pflugers Arch. Hui, Y., Du, J., Tang, C., Bin, G., Jiang, H., 2003. Changes in arterial hydrogen sulfide (H 2 S) content during septic shock and endotoxin shock in rats. J Infect 47, 155-160. Jeong, S.O., Pae, H.O., Oh, G.S., Jeong, G.S., Lee, B.S., Lee, S., Kim du, Y., Rhew, H.Y., Lee, K.M., Chung, H.T., 2006. Hydrogen sulfide potentiates interleukin-1beta-induced nitric oxide production via enhancement of extracellular signal-regulated kinase activation in rat vascular smooth muscle cells. Biochem Biophys Res Commun 345, 938-944. Jha, S., Calvert, J.W., Duranski, M.R., Ramachandran, A., Lefer, D.J., 2008. Hydrogen sulfide attenuates hepatic ischemia-reperfusion injury: role of antioxidantand antiapoptotic signaling. Am J Physiol Heart Circ Physiol 295, H801-806. Joyner, J.L., Peyer, S.M., Lee, R.W., 2003. Possible roles of sulfur-containing amino acids in a chemoautotrophic bacterium-mollusc symbiosis. Biol Bull 205, 331-338. Julian, D., April, K.L., Patel, S., Stein, J.R., Wohlgemuth, S.E., 2005a. Mitochondrial depolarization following hydrogen sulfide exposure in erythrocytes from a sulfidetolerant marine invertebrate. J Exp Biol 208, 4109-4122. Julian, D., Dallia, W.E., Arp, A.J., 1998. Neuromuscular Sensitivity to Hydrogen Sulfide in the Marine Invertebrate Urechis caupo. The Journal of Experimental Biology 201, 13931403. Julian, D., Gail, F., Wood, E., Arp, A.J., Fisher, C.R., 1999. Roots as a site of hydrogen sulfide uptake in the hydrocarbon seep vestimentiferan Lamellibrachia sp. The Journal of Experimental Biology 202, 2245-2257. Julian, D., Statile, J., Roepke, T.A., Arp, A.J., 2005b. Sodium nitroprusside potentiates hydrogen-sulfide-induced contractions in body wall muscle from a marine worm. Biol Bull 209, 6-10. Julian, D., Statile, J.L., Wohlgemuth, S.E., Arp, A.J., 2002. Enzymatic hydrogen sulfide production in marine invertebrate tissues. Comp Biochem Physiol A Mol Integr Physiol 133, 105-115.

PAGE 95

95 Khan, A.A., Schuler, M.M., Prior, M.G., Yong, S., Coppock, R.W., Florence, L.Z., Lillie, L.E., 1990. Effects of hydrogen sulfide exposure on lung mitochondrial respiratory chain enzymes in rats. Toxicol Appl Pharmacol 103, 482-490. Kimura, H., 2000. Hydrogen sulfide induces cyclic AMP and modulates the NMDA receptor. Biochem Biophys Res Commun 267, 129-133. Kimura, H., 2002. Hydrogen sulfide as a neuromodulator. Mol Neurobiol 26, 13-19. Kimura, H., Nagai, Y., Umemura, K., Kimura, Y., 2005. Physiological roles of hydrogen sulfide: synapticmodulation, neuroprotection, and smooth muscle relaxation. Antioxid Redox Signal 7, 795-803. Kimura, Y., Dargusch, R., Schubert, D., Kimura, H., 2006. Hydrogen sulfide protects HT22 neuronal cells from oxidative stress. Antioxid Redox Signal 8, 661-670. Kimura, Y., Kimura, H., 2004. Hydrogen sulfide protects neurons from oxidative stress. Faseb J 18, 1165-1167. Kiss, L., Deitch, E.A., Szabo, C., 2008. Hydrogen sulfide decreases adenosine triphosphate levels in aortic rings and leads to vasorelaxation via metabolic inhibition. Life Sci. Kitamura, K., Yamazaki, J., 2001. Chloride channels and their functional roles in smooth muscle tone in the vasculature. Jpn J Pharmacol 85, 351-357. Kitani, K., 1991. Aging of the liver: facts and theories. Arch Gerontol Geriatr 12, 133-154. Kitani, K., 1994. Aging and the liver: functional aspects. Arch Gerontol Geriatr 19, 145-158. Koenitzer, J.R., Isbell, T.S., Patel, H.D., Benavides, G.A., Dickinson, D.A., Patel, R.P., DarleyUsmar, V.M., Lancaster, J.R., Jr., Doeller, J.E., Kraus, D.W., 2007. Hydrogen sulfide mediates vasoactivity in an O 2 -dependent manner. Am J Physiol Heart Circ Physiol 292, H1953-1960. Kompanowska-Jezierska, E., Kuczeriszka, M., 2008. Cytochrome P-450 metabolites in renal circulation and excretion--interaction with the nitric oxide (NO) system. J Physiol Pharmacol 59 Suppl 9, 137-149. Kraus, D.W., Doeller, J.E., 2004. Sulfide consumption by mussel gill mitochondria is not strictly tied to oxygen reduction: measurements using a novel polarographic sulfide sensor. J Exp Biol 207, 3667-3679. Kraus, D.W., Doeller, J.E., Powell, C.S., 1996. Sulfide may directly modify cytoplasmic hemoglobin deoxygenation in Solemya reidi gills. J. Exp. Biol. 199, 1343-1352. Kubo, S., Doe, I., Kurokawa, Y., Kawabata, A., 2007a. Hydrogen Sulfide Causes Relaxation in Mouse Bronchial Smooth Muscle. J Pharmacol Sci.

PAGE 96

96 Kubo, S., Doe, I., Kurokawa, Y., Nishikawa, H., Kawabata, A., 2007b. Direct inhibition of endothelial nitric oxide synthase by hydrogen sulfide: contribution to dual modulation of vascular tension. Toxicology 232, 138-146. Kubo, S., Kajiwara, M., Kawabata, A., 2007c. Dual modulation of the tension of isolated gastric artery and gastric mucosal circulation by hydrogen sulfide in rats. Inflammopharmacology 15, 288-292. Kubo, S., Kurokawa, Y., Doe, I., Masuko, T., Sekiguchi, F., Kawabata, A., 2007d. Hydrogen sulfide inhibits activity of three isoforms of recombinant nitric oxide synthase. Toxicology 241, 92-97. Labinskyy, N., Csiszar, A., Veress, G., Stef, G., Pacher, P., Oroszi, G., Wu, J., Ungvari, Z., 2006. Vascular dysfunction in aging: potential effects of resveratrol, an antiinflammatory phytoestrogen. Curr Med Chem 13, 989-996. Lakatta, E.G., 1993. Cardiovascular regulatory mechanisms in advanced age. Physiol Rev 73, 413-467. Lee, S.W., Cheng, Y., Moore, P.K., Bian, J.S., 2007. Hydrogen sulphide regulates intracellular pH in vascular smooth muscle cells. Biochem Biophys Res Commun 358, 1142-1147. Leeuwenburgh, C., Prolla, T.A., 2006. Genetics, redox signaling, oxidative stress, and apoptosis in Mammalian aging. Antioxid Redox Signal 8, 503-505. Leeuwenburgh, C., Wagner, P., Holloszy, J.O., Sohal, R.S., Heinecke, J.W., 1997. Caloric restriction attenuates dityrosine cross-linking of cardiac and skeletal muscle proteins in aging mice. Arch Biochem Biophys 346, 74-80. Leffler, C.W., Parfenova, H., Jaggar, J.H., Wang, R., 2006. Carbon monoxide and hydrogen sulfide: gaseous messengers in cerebrovascular circulation. J Appl Physiol 100, 10651076. Levitt, M.D., Furne, J., Springfield, J., Suarez, F., DeMaster, E., 1999. Detoxification of hydrogen sulfide and methanethiol in the cecal mucosa. J Clin Invest 104, 1107-1114. Li, L., Bhatia, M., Zhu, Y.Z., Zhu, Y.C., Ramnath, R.D., Wang, Z.J., Anuar, F.B., Whiteman, M., Salto-Tellez, M., Moore, P.K., 2005. Hydrogen sulfide is a novel mediator of lipopolysaccharide-induced inflammation in the mouse. Faseb J 19, 1196-1198. Li, X.H., Du, J.B., Bu, D.F., Tang, X.Y., Tang, C.S., 2006. Sodium hydrosulfide alleviated pulmonary vascular structural remodeling induced by high pulmonary blood flow in rats. Acta Pharmacol Sin 27, 971-980. Li, Y.F., Xiao, C.S., Hui, R.T., 2009. Calcium sulfide (CaS), a donor of hydrogen sulfide (H(2)S): A new antihypertensive drug? Med Hypotheses.

PAGE 97

97 Lim, J.J., Liu, Y., Khin Sandar Win, E., Bian, J.S., 2008. Vasoconstrictive effect of hydrogen sulfide involves downregulation of cAMP in vascular smooth muscle cells. Am J Physiol Cell Physiol. Lonsdale, P., 1977. Clustering of suspension-feeding macrobenthos near abyssal hydrothermal vents at oceanic spreading centers. Deep-Sea Res. 24, 857-863. Lowicka, E., Beltowski, J., 2007. Hydrogen sulfide (H2S) -the third gas of interest for pharmacologists. Pharmacol Rep 59, 4-24. Marin, E., Sessa, W.C., 2007. Role of endothelial-derived nitric oxide in hypertension and renal disease. Curr Opin Nephrol Hypertens 16, 105-110. Martineu, P., Juniper, S.K., Fisher, C.R., Massoth, G.J., 1997. Sulfide binding in the body fluids of hydrothermal vent alvinellid polychaetes. Physiol Zool 70, 578-588. McMullin, E.R., Bergquist, D.C., Fisher, C.R., 2000. Metazoans in Extreme Environments: Adaptations of Hydrothermal Vent and Hydrocarbon Seep Fauna. Gravitational and Space Biology Bulletin 12, 13-24. Miller, D.L., Roth, M.B., 2007. Hydrogen sulfide increases thermotolerance and lifespan in Caenorhabditis elegans. Proc Natl Acad Sci U S A 104, 20618-20622. Minamiyama, Y., Bito, Y., Takemura, S., Takahashi, Y., Kodai, S., Mizuguchi, S., Nishikawa, Y., Suehiro, S., Okada, S., 2007. Calorie restriction improves cardiovascular risk factors via reduction of mitochondrial reactive oxygen species in type II diabetic rats. J Pharmacol Exp Ther 320, 535-543. Mount, P.F., Kemp, B.E., Power, D.A., 2007. Regulation of endothelial and myocardial NO synthesisby multi-site eNOS phosphorylation. J Mol Cell Cardiol 42, 271-279. Muzaffar, S., Shukla, N., Bond, M., Newby, A.C., Angelini, G.D., Sparatore, A., Del Soldato, P., Jeremy, J.Y., 2008. Exogenous Hydrogen Sulfide Inhibits Superoxide Formation, NOX-1 Expression and Rac(1) Activity in Human Vascular Smooth Muscle Cells. J Vasc Res 45, 521-528. Nicholls, P., 1975. The effect of sulphide on cytochrome aa3. Isosteric and allosteric shifts of the reduced alpha-peak. Biochim Biophys Acta 396, 24-35. Nicholls, P., Kim, J.K., 1982. Sulphide as an inhibitor and electron donor for the cytochrome c oxidase system. Can J Biochem 60, 613-623. Oh, G.S., Pae, H.O., Lee, B.S., Kim, B.N., Kim, J.M., Kim, H.R., Jeon, S.B., Jeon, W.K., Chae, H.J., Chung, H.T., 2006. Hydrogen sulfide inhibits nitric oxide production and nuclear factor-kappa B via heme oxygenase-1 expression in RAW264.7 macrophages stimulated with lipopolysaccharide. Free Radical Biology and Medicine 41, 106-119.

PAGE 98

98 Olson, K.R., 2005. Vascular actions of hydrogen sulfide in nonmammalian vertebrates. Antioxid Redox Signal 7, 804-812. Olson, K.R., 2008. Hydrogen sulfide and oxygen sensing: implications in cardiorespiratory control. J Exp Biol 211, 2727-2734. Olson, K.R., 2009. Is hydrogen sulfide a circulating "Gasotransmitter" in vertebrate blood? Biochim Biophys Acta. Olson, K.R., Dombkowski, R.A., Russell, M.J., Doellman, M.M., Head, S.K., Whitfield, N.L., Madden, J.A., 2006. Hydrogen sulfide as an oxygen sensor/transducer in vertebrate hypoxic vasoconstriction and hypoxic vasodilation. J Exp Biol 209, 4011-4023. Olson, K.R., Donald, J.A., 2009. Nervous control of circulation -The role of gasotransmitters, NO, CO, and H(2)S. Acta Histochem. Olson, K.R., Forgan, L.G., Dombkowski, R.A., Forster, M.E., 2008. Oxygen dependency of hydrogen sulfide-mediated vasoconstriction in cyclostome aortas. J Exp Biol 211, 22052213. Palumbo, A., 2005. Nitric oxide in marine invertebrates: a comparative perspective. Comp Biochem Physiol A Mol Integr Physiol 142, 241-248. Partlo, L.A., Sainsbury, R.S., Roth, S.H., 2001. Effects of repeated hydrogen sulfide (H2S) exposure on learning and memory in the adult rat. Neurotoxicology 22, 177-189. Payne, A.M., Dodd, S.L., Leeuwenburgh, C., 2003. Life-long calorie restriction in Fischer 344 rats attenuates age-related loss in skeletal muscle-specific force and reduces extracellular space. J Appl Physiol 95, 2554-2562. Pryor, W.A., Houk, K.N., Foote, C.S., Fukuto, J.M., Ignarro, L.J., Squadrito, G.L., Davies, K.J., 2006. Free radical biology and medicine: it's a gas, man! Am J Physiol Regul Integr Comp Physiol 291, R491-511. Puranik, M., Weeks, C.L., Lahaye, D., Kabil, O., Taoka, S., Nielsen, S.B., Groves, J.T., Banerjee, R., Spiro, T.G., 2006. Dynamics of carbon monoxide binding to cystathionine beta-synthase. J Biol Chem 281, 13433-13438. Qi, J., Du, J., Tang, X., Li, J., Wei, B., Tang, C., 2004. The upregulation of endothelial nitric oxide synthase and urotensin-II is associated with pulmonary hypertension and vascular diseases in rats produced by aortocaval shunting. Heart Vessels 19, 81-88. Qingyou, Z., Junbao, D., Weijin, Z., Hui, Y., Chaoshu, T., Chunyu, Z., 2004. Impact of hydrogen sulfide on carbon monoxide/heme oxygenase pathway in the pathogenesis of hypoxic pulmonary hypertension. Biochem Biophys Res Commun 317, 30-37. Qu, K., Chen, C.P., Halliwell, B., Moore, P.K., Wong, P.T., 2006. Hydrogen sulfide is a mediator of cerebral ischemic damage. Stroke 37, 889-893.

PAGE 99

99 Que, L.G., Liu, L., Yan, Y., Whitehead, G.S., Gavett, S.H., Schwartz, D.A., Stamler, J.S., 2005. Protection from experimental asthma by an endogenous bronchodilator. Science 308, 1618-1621. Robert, R., Norez, C., Becq, F., 2005. Disruption of CFTR chloride channel alters mechanical properties and cAMP-dependent Cl-transport of mouse aortic smooth muscle cells. J Physiol 568, 483-495. Sharifi, A.M., Mohseni, S., Nekoparvar, S., Larijani, B., Fakhrzadeh, H., Oryan, S., 2008. Effect of caloric restriction on nitric oxide production, ACE activity, and blood pressure regulation in rats. Acta Physiol Hung 95, 55-63. Shepherd, G., Velez, L.I., 2008. Role of hydroxocobalamin in acute cyanide poisoning. Ann Pharmacother 42, 661-669. Sheppard, D.N., Robinson, K.A., 1997. Mechanism of glibenclamide inhibition of cystic fibrosis transmembrane conductance regulator Cl-channels expressed in a murine cell line. J Physiol 503 ( Pt 2), 333-346. Shukla, N., Rossoni, G., Hotston, M., Sparatore, A., Del Soldato, P., Tazzari, V., Persad, R., Angelini, G.D., Jeremy, J.Y., 2009. Effect of hydrogen sulphide-donating sildenafil (ACS6) on erectile function and oxidative stress in rabbit isolated corpus cavernosum and in hypertensive rats. BJU Int. Srilatha, B., Adaikan, P.G., Li, L., Moore, P.K., 2007. Hydrogen sulphide: a novel endogenous gasotransmitter facilitates erectile function. J Sex Med 4, 1304-1311. Srilatha, B., Adaikan, P.G., Moore, P.K., 2006. Possible role for the novel gasotransmitter hydrogen sulphide in erectile dysfunction--a pilot study. Eur J Pharmacol 535, 280-282. Stipanuk, M.H., Beck, P.W.,1982. Characterization of the enzymic capacity for cysteine desulphhydration in liver and kidney of the rat. Biochem J 206, 267-277. Szabo, C., 2007. Hydrogen sulphide and its therapeutic potential. Nat Rev Drug Discov 6, 917935. Taddei, S., Virdis, A., Ghiadoni, L., Versari, D., Salvetti, A., 2006. Endothelium, aging, and hypertension. Curr Hypertens Rep 8, 84-89. Tanaka, Y., Funabiki, M., Michikawa, H., Koike, K., 2006. Effects of aging on alpha1adrenoceptor mechanisms in the isolated mouse aortic preparation. J Smooth Muscle Res 42, 131-138. Tang, G., Wu, L., Liang, W., Wang, R., 2005. Direct stimulation of K(ATP) channels by exogenous and endogenous hydrogen sulfide in vascular smooth muscle cells. Mol Pharmacol 68, 1757-1764.

PAGE 100

100 Taoka, S., Banerjee, R.,2001. Characterization of NO binding to human cystathionine betasynthase: possible implications of the effects of CO and NO binding to the human enzyme. J Inorg Biochem 87, 245-251. Tapley, D.W., Beuttner, G.R., Shick, J.M., 1999. Free radicals and chemiluminescence as products of the spontaneous oxidation of sulfide in seawater, and their biological implications. Biol. Bull. 196, 52-56. Tatsuno, Y., Adachi, J., Mizoi, Y., Fujiwara, S., Nakanishi, K., Taniguchi, T., Yokoi, S., Shimizu, S., 1986. [Four cases of fatal poisoning by hydrogen sulfide. A study of greenish discoloration of the skin and formation of sulfhemoglobin]. Nihon Hoigaku Zasshi 40, 308-315. Tvedt, B., Skyberg, K., Aaserud, O., Hobbesland, A., Mathiesen, T., 1991. Brain damage caused by hydrogen sulfide: a follow-up study of six patients. Am J Ind Med 20, 91-101. van der Loo, B., Bachschmid, M., Labugger, R., Schildknecht, S., Kilo, J., Hahn, R., PalaciosCallender, M., Luscher, T.F., 2005. Expression and activity patterns of nitric oxide synthases and antioxidant enzymes reveal a substantial heterogeneity between cardiac and vascular aging in the rat. Biogerontology 6, 325-334. van der Loo, B., Labugger, R., Skepper, J.N., Bachschmid, M., Kilo, J., Powell, J.M., PalaciosCallender, M., Erusalimsky, J.D., Quaschning, T., Malinski, T., Gygi, D., Ullrich, V., Luscher, T.F., 2000. Enhanced peroxynitrite formation is associated with vascular aging. J Exp Med 192, 1731-1744. Verma, A., Hirsch, D.J., Glatt, C.E., Ronnett, G.V., Snyder, S.H., 1993. Carbon monoxide: a putative neural messenger. Science 259, 381-384. Vlkel, S., Berenbrink, M.K., 2000. Sulphaemoglobin formation in fish: A comparison between the haemoglobin of the sulphide-sensitive rainbow traout ( Oncorhynchus mykiss ) and of the sulphide-tolerant common carp ( Cyprinus carpio ). J. Exp. Biol. 203, 1047-1058. Wallace, J.L., 2007a. Building a better aspirin: gaseous solutions to a century-old problem. Br J Pharmacol 152, 421-428. Wallace, J.L., 2007b. Hydrogen sulfide-releasing anti-inflammatory drugs. Trends Pharmacol Sci 28, 501-505. Wallace, J.L., Dicay, M., McKnight, W., Martin, G.R., 2007. Hydrogen sulfide enhances ulcer healing in rats. Faseb J 21, 4070-4076. Wang, R., 2002. Two's company, three's a crowd: can H2S be the third endogenous gaseous transmitter? Faseb J 16, 1792-1798. Wang, R., 2003. The gasotransmitter role of hydrogen sulfide. Antioxid Redox Signal 5, 493501.

PAGE 101

101 Wang, Y.F., Mainali, P., Tang, C.S., Shi, L., Zhang, C.Y., Yan, H., Liu, X.Q., Du, J.B., 2008. Effects of nitric oxide and hydrogen sulfide on the relaxation of pulmonary arteries in rats. Chin Med J (Engl) 121, 420-423. Webb, G.D., Lim, L.H., Oh, V.M., Yeo, S.B., Cheong, Y.P., Ali, M.Y., El Oakley, R., Lee, C.N., Wong, P.S., Caleb, M.G., Salto-Tellez, M., Bhatia, M., Chan, E.S., Taylor, E.A., Moore, P.K., 2008. Contractile and vasorelaxant effects of hydrogen sulfide and its biosynthesis in the human internal mammary artery. J Pharmacol Exp Ther 324, 876-882. Whiteman, M., Armstrong, J.S., Chu, S.H., Jia-Ling, S., Wong, B.S., Cheung, N.S., Halliwell, B., Moore, P.K., 2004a. The novel neuromodulator hydrogen sulfide: an endogenous peroxynitrite 'scavenger'? J Neurochem 90, 765-768. Whiteman, M., Armstrong, J.S., Chu, S.H., Jia-Ling, S., Wong, B.S., Cheung, N.S., Halliwell, B., Moore, P.K., 2004b. The novel neuromodulator hydrogen sulfide: an endogenous peroxynitrite 'scavenger'? Journal of Neurochemistry 90, 765-768. Whiteman, M., Li, L., Kostetski, I., Chu, S.H., Siau, J.L., Bhatia, M., Moore, P.K., 2006. Evidence for the formation of a novel nitrosothiol from the gaseous mediators nitric oxide and hydrogen sulphide. Biochem Biophys Res Commun 343, 303-310. Whiteman, M., Moore, P.K., 2009. Hydrogen Sulfide and the Vasculature: a Novel Vasculoprotective Entity and Regulator of Nitric Oxide Bioavailability? J Cell Mol Med. Whitfield, N.L., Kreimier, E.L., Verdial, F.C., Skovgaard, N., Olson, K.R., 2008. A Reappraisal of H2S/sulfide concentration in vertebrate blood and its potential significance in ischemic preconditioningand vascular signaling. Am J Physiol Regul Integr Comp Physiol. Wood, C.E., Chen, G.F., Keller-Wood, M., 2005. Expression of nitric oxide synthase isoforms is reduced in late-gestation ovine fetal brainstem. Am J Physiol Regul Integr Comp Physiol 289, R613-R619. Xiao, L., Wu, Y.M., Wang, R., Liu, Y.X., Wang, F.W., He, R.R., 2007. Hydrogen sulfide facilitates carotid sinus baroreceptor activity in anesthetized male rats. Chin Med J (Engl) 120, 1343-1347. Xiaohui, L., Junbao, D., Lin, S., Jian, L., Xiuying, T., Jianguang, Q., Bing, W., Hongfang, J., Chaoshu, T., 2005. Down-regulation of endogenous hydrogen sulfide pathway in pulmonary hypertension and pulmonary vascular structural remodeling induced by high pulmonary blood flow in rats. Circ J 69, 1418-1424. Yalamanchili, C., Smith, M.D., 2008. Acute hydrogen sulfide toxicity due to sewer gas exposure. Am J Emerg Med 26, 518 e515-517. Yan, H., Du, J., Tang, C., 2004. The possible role of hydrogen sulfide on the pathogenesis of spontaneous hypertension in rats.Biochem Biophys Res Commun 313, 22-27.

PAGE 102

102 Yan, S.K., Chang, T., Wang, H., Wu, L., Wang, R., Meng, Q.H., 2006. Effects of hydrogen sulfide on homocysteine-induced oxidative stress in vascular smooth muscle cells. Biochem Biophys Res Commun 351, 485-491. Yang,G., Wu, L., Jiang, B., Yang, W., Qi, J., Cao, K., Meng, Q., Mustafa, A.K., Mu, W., Zhang, S., Snyder, S.H., Wang, R., 2008. H2S as a physiologic vasorelaxant: hypertension in mice with deletion of cystathionine gamma-lyase. Science 322, 587-590. Yang, H.,Shi, M., Story, J., Richardson, A., Guo, Z., 2004. Food restriction attenuates agerelated increase in the sensitivity of endothelial cells to oxidized lipids. J Gerontol A Biol Sci Med Sci 59, 316-323. Yang, W., Yang, G., Jia, X., Wu, L., Wang, R., 2005.Activation of KATP channels by H2S in rat insulin-secreting cells and the underlying mechanisms. J Physiol 569, 519-531. Yonezawa, D., Sekiguchi, F., Miyamoto, M., Taniguchi, E., Honjo, M., Masuko, T., Nishikawa, H., Kawabata, A., 2007. A protective role of hydrogen sulfide against oxidative stress in rat gastric mucosal epithelium. Toxicology 241, 11-18. Yong, Q.C., Lee, S.W., Foo, C.S., Neo, K.L., Chen, X., Bian, J.S., 2008a. Endogenous hydrogen sulphide mediates the cardioprotection induced by ischemic postconditioning. Am J Physiol Heart Circ Physiol 295, H1330-H1340. Yong, Q.C., Pan, T.T., Hu, L.F., Bian, J.S., 2008b. Negative regulation of beta-adrenergic function by hydrogen sulphide in the rat hearts. J Mol Cell Cardiol 44, 701-710. Zal, F., Leize, E., Lallier, F.H., Toulmond, A., Van Dorsselaer, A., Childress, J.J., 1998. SSulfohemoglobin and disulfide exchange: the mechanisms of sulfide binding by Riftia pachyptila hemoglobins. Proc Natl Acad Sci U S A 95, 8997-9002. Zal, F., Suzuki, T., Kawasaki,Y., Childress, J.J., Lallier, F.H., Toulmond, A., 1997. Primary structure of the common polypeptide chain b from the multi-hemoglobin system of the hydrothermal vent tube worm Riftia pachyptila: an insight on the sulfide binding-site. Proteins 29, 562-574. Zanardo, R.C., Brancaleone, V., Distrutti, E., Fiorucci, S., Cirino, G., Wallace, J.L., 2006. Hydrogen sulfide is an endogenous modulator of leukocyte-mediated inflammation. Faseb J 20, 2118-2120. Zhang, H., Zhi, L., Moochhala, S.M., Moore, P.K., Bhatia,M., 2007. Endogenous hydrogen sulfide regulates leukocyte trafficking in cecal ligation and puncture-induced sepsis. J Leukoc Biol 82, 894-905. Zhao, W., Ndisang, J.F., Wang, R., 2003. Modulation of endogenous production of H2S in rat tissues. Can J Physiol Pharmacol 81, 848-853. Zhao, W., Wang, R., 2002. H(2)S-induced vasorelaxation and underlying cellular and molecular mechanisms. Am J Physiol Heart Circ Physiol 283, H474-480.

PAGE 103

103 Zhao, W., Zhang, J., Lu, Y., Wang, R., 2001. The vasorelaxant effect of H 2 S asa novel endogenous gaseous K ATP channel opener. Embo J 20, 6008-6016. Zhao, X., Zhang, L.K., Zhang, C.Y., Zeng, X.J., Yan, H., Jin, H.F., Tang, C.S., Du, J.B., 2008. Regulatory effect of hydrogen sulfide on vascular collagen content in spontaneously hypertensive rats. Hypertens Res 31, 1619-1630. Zhong, G., Chen, F., Cheng, Y., Tang, C., Du, J., 2003. The role of hydrogen sulfide generation in the pathogenesis of hypertension in rats induced by inhibition of nitric oxide synthase. J Hypertens 21, 1879-1885.

PAGE 104

104 BIOGRAPHICAL SKETCH Benjamin Predmore was bornin Allentown, Pennsylvaniain 1983. An only child, he grew up in the rural area outside of Bangor, Pennsylvania, graduating from Bangor Area Senior High School in 2001. He earned his bachelors degree in Biology from the Pennsylvania State University (PSU) in 2005. While at PSU, he was active in research working in the lab of Dr. Charles Fisher beginning in 2002. While in the Fisher lab he participated in community ecology studies of the hydrocarbon seep communities in the Gulf of Mexico. This afforded him the opportunity to participate in two research cruises to the Gulf of Mexico during the summers of 2003 and 2004 onboard the R/V Seward Johnson II. During these cruises he was able to make a total of dives on a variety of hydrocarbon seep sites onboard the DSV Johnson Sea-link I. In addition to community ecology work, he was also responsible for sampling the hydrogen sulfide concentrations around the water column of these sites. Due to the volatility of hydrogen sulfide and its rapid oxidation in seawater, this assay required strict attention to detail and had to be performed in very in a nitrogen-filled glove bag in oxygen-free conditions. This experience primed him for his doctoral work with hydrogen sulfide, and also allowed him to meet with Dr. David Julian of the University of Florida who also worked extensively with hydrogen sulfide and gave Ben some key troubleshooting techniques for his assay. In 2005,Ben joined the Doctor of Philosophyprogram inthe Department of Zoology at the University of Florida under the supervision of Dr. Julian working on the mechanisms of hydrogen sulfide signaling in mammals. Upon completion of his doctorate, Ben will work as a post-doctoral member in the laboratory of Dr. David Lefer at Emory University. There he will learn new surgical techniques on murine, and porcine models, continuing investigation of hydrogen sulfide signaling.