<%BANNER%>

Engineering and Characterization of Hemicellulose Hydrolysate Stress Resistance in Escherichia coli

Permanent Link: http://ufdc.ufl.edu/UFE0024732/00001

Material Information

Title: Engineering and Characterization of Hemicellulose Hydrolysate Stress Resistance in Escherichia coli
Physical Description: 1 online resource (105 p.)
Language: english
Creator: Miller, Elliot
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: acetate, betaine, desiccation, e, ethanol, furfural, hydrolysate, lactate, osmotolerance, trehalose
Microbiology and Cell Science -- Dissertations, Academic -- UF
Genre: Microbiology and Cell Science thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: ENGINEERING AND CHARACTERIZATION OF HEMICELLULOSE HYDROLYSATE STRESS RESISTANCE IN ESCHERICHIA COLI By Elliot Miller August 2009 Chair: Lonnie Ingram Major: Microbiology and Cell Science Carbohydrate polymers that comprise the lignocellulosic matrix of plants are an abundant and renewable source of sugar for biocatalytic conversion into a range of commercially viable products. However, these carbohydrates must first be depolymerized to monomeric sugars prior to fermentation. Depolymerization of hemicellulose by treatment with dilute mineral acid is quite effective but also results in the formation of inhibitors such as furfural that retard growth and fermentation. To address this issue a series of studies were conducted focusing on osmotic and chemical stress found in hemicellulose syrups formed from dilute acid hydrolysis. To increase osmotic stress tolerance, the effect of two osmoprotectants, trehalose and betaine, were investigated. Trehalose was produced internally in high concentrations in Escherichia coli by expression of the otsAB operon through transposon insertion into the chromosome. In addition, the media was supplemented with 1 mM betaine and additive effects of the two osmoprotectants were investigated in the presence of osmotic stress agents. Individually, each osmoprotectant conferred increased tolerance to osmotic stress from sodium chloride, sodium lactate, glucose, xylose, and succinate, but not ethanol. In the cases of sodium chloride, sodium lactate, glucose, or xylose, the combination of trehalose over-production and betaine addition increased tolerance more than either osmoprotectant could alone. Three E. coli strains with increased trehalose production, EM2P (an ethanol producing derivative of KO11), EM2L (an ethanol producing derivative of LY163), and EM2T (a lactate producing derivative of TG106) were tested for desiccation survival. All strains with increased trehalose production had higher survival levels than the control. The growth sugar also impacted desiccation survival, with xylose yielding lowest survival, glucose providing intermediate survival, and sucrose providing the highest survival. Desiccating the cells in mid-log growth phase provided the highest survival levels compared to other growth phases. The highest overall survival rate (up to 80%) was achieved by over-producing trehalose while growing in sucrose and harvesting in mid-log phase of growth. In addition to osmotic stress, chemical stress caused by furfural was addressed. Ethanologenic E. coli, strain LY180, was transferred in fermentation vessels containing minimal salts medium AM1 with xylose as a carbon source, and furfural in order to obtain a furfural resistant mutant. Changes in global mRNA levels in response to furfural were compared in the mutant, EMFR9, and the parent, LY180. These studies revealed 8 genes encoding oxidoreductases with at least 2 fold increased expression and 4 genes with at least 2 fold decreased expression in EMFR9 relative to LY180. Expression from plasmid in LY180 of the 8 genes did not increase furfural tolerance. However, expression by plasmid in EMFR9 of the 4 genes conferred a decrease in furfural tolerance in the cases of yqhD, dkgA, and yqfA. YqhD and DkgA exhibited the most pronounced effects. These two enzymes were purified and shown to have NADPH dependent furfural reductase activity, with a low Km for NADPH (8 ?M and 23 ?M, respectively). Deletion of these two genes in LY180 increased furfural tolerance, supporting the idea that furfural reduction competes for NADPH needed for growth. Plasmid based expression of two native transhydrogenases, sthA and pntAB, in LY180 led to an increase in furfural tolerance with regard to pntAB, but sthA had no effect. Further analysis of microarray data revealed an increase in cysteine and methionine pathway mRNA levels in LY180 upon furfural addition. In order for sulfate, the only source of sulfur in AM1 medium, to be incorporated into cysteine, 4 NADPH are required. Supplementation with 0.5 mM L-cysteine, D-cysteine, or sodium thiosulfate increased furfural tolerance in LY180 but not in EMFR9, presumably by alleviating NADPH demand for sulfate incorporation. Supplementation with taurine, an alternative source that requires almost as much NADPH as sulfate to be incorporated, provided no benefit to furfural tolerance. Together, the data indicates that conversion of furfural to furfuryl alcohol by YqhD limits available NADPH required for biosynthesis of molecules such as cysteine, preventing growth.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Elliot Miller.
Thesis: Thesis (Ph.D.)--University of Florida, 2009.
Local: Adviser: Ingram, Lonnie O.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0024732:00001

Permanent Link: http://ufdc.ufl.edu/UFE0024732/00001

Material Information

Title: Engineering and Characterization of Hemicellulose Hydrolysate Stress Resistance in Escherichia coli
Physical Description: 1 online resource (105 p.)
Language: english
Creator: Miller, Elliot
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: acetate, betaine, desiccation, e, ethanol, furfural, hydrolysate, lactate, osmotolerance, trehalose
Microbiology and Cell Science -- Dissertations, Academic -- UF
Genre: Microbiology and Cell Science thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: ENGINEERING AND CHARACTERIZATION OF HEMICELLULOSE HYDROLYSATE STRESS RESISTANCE IN ESCHERICHIA COLI By Elliot Miller August 2009 Chair: Lonnie Ingram Major: Microbiology and Cell Science Carbohydrate polymers that comprise the lignocellulosic matrix of plants are an abundant and renewable source of sugar for biocatalytic conversion into a range of commercially viable products. However, these carbohydrates must first be depolymerized to monomeric sugars prior to fermentation. Depolymerization of hemicellulose by treatment with dilute mineral acid is quite effective but also results in the formation of inhibitors such as furfural that retard growth and fermentation. To address this issue a series of studies were conducted focusing on osmotic and chemical stress found in hemicellulose syrups formed from dilute acid hydrolysis. To increase osmotic stress tolerance, the effect of two osmoprotectants, trehalose and betaine, were investigated. Trehalose was produced internally in high concentrations in Escherichia coli by expression of the otsAB operon through transposon insertion into the chromosome. In addition, the media was supplemented with 1 mM betaine and additive effects of the two osmoprotectants were investigated in the presence of osmotic stress agents. Individually, each osmoprotectant conferred increased tolerance to osmotic stress from sodium chloride, sodium lactate, glucose, xylose, and succinate, but not ethanol. In the cases of sodium chloride, sodium lactate, glucose, or xylose, the combination of trehalose over-production and betaine addition increased tolerance more than either osmoprotectant could alone. Three E. coli strains with increased trehalose production, EM2P (an ethanol producing derivative of KO11), EM2L (an ethanol producing derivative of LY163), and EM2T (a lactate producing derivative of TG106) were tested for desiccation survival. All strains with increased trehalose production had higher survival levels than the control. The growth sugar also impacted desiccation survival, with xylose yielding lowest survival, glucose providing intermediate survival, and sucrose providing the highest survival. Desiccating the cells in mid-log growth phase provided the highest survival levels compared to other growth phases. The highest overall survival rate (up to 80%) was achieved by over-producing trehalose while growing in sucrose and harvesting in mid-log phase of growth. In addition to osmotic stress, chemical stress caused by furfural was addressed. Ethanologenic E. coli, strain LY180, was transferred in fermentation vessels containing minimal salts medium AM1 with xylose as a carbon source, and furfural in order to obtain a furfural resistant mutant. Changes in global mRNA levels in response to furfural were compared in the mutant, EMFR9, and the parent, LY180. These studies revealed 8 genes encoding oxidoreductases with at least 2 fold increased expression and 4 genes with at least 2 fold decreased expression in EMFR9 relative to LY180. Expression from plasmid in LY180 of the 8 genes did not increase furfural tolerance. However, expression by plasmid in EMFR9 of the 4 genes conferred a decrease in furfural tolerance in the cases of yqhD, dkgA, and yqfA. YqhD and DkgA exhibited the most pronounced effects. These two enzymes were purified and shown to have NADPH dependent furfural reductase activity, with a low Km for NADPH (8 ?M and 23 ?M, respectively). Deletion of these two genes in LY180 increased furfural tolerance, supporting the idea that furfural reduction competes for NADPH needed for growth. Plasmid based expression of two native transhydrogenases, sthA and pntAB, in LY180 led to an increase in furfural tolerance with regard to pntAB, but sthA had no effect. Further analysis of microarray data revealed an increase in cysteine and methionine pathway mRNA levels in LY180 upon furfural addition. In order for sulfate, the only source of sulfur in AM1 medium, to be incorporated into cysteine, 4 NADPH are required. Supplementation with 0.5 mM L-cysteine, D-cysteine, or sodium thiosulfate increased furfural tolerance in LY180 but not in EMFR9, presumably by alleviating NADPH demand for sulfate incorporation. Supplementation with taurine, an alternative source that requires almost as much NADPH as sulfate to be incorporated, provided no benefit to furfural tolerance. Together, the data indicates that conversion of furfural to furfuryl alcohol by YqhD limits available NADPH required for biosynthesis of molecules such as cysteine, preventing growth.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Elliot Miller.
Thesis: Thesis (Ph.D.)--University of Florida, 2009.
Local: Adviser: Ingram, Lonnie O.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0024732:00001


This item has the following downloads:


Full Text





ENGINEERING AND CHARACTERIZATION OF HEMICELLULOSE HYDROLYSATE
STRESS RESISTANCE IN ESCHERICHIA COLI





















By

ELLIOT MILLER


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2009


































2009 Elliot Miller


































To the efforts of those that came before, on which my accomplishments are founded, and to all
that tread thereafter.









ACKNOWLEDGMENTS

I thank my parents, Vanessa and James Miller, to whom I attribute a stalwart resolve in

my upbringing. I thank my brother, Gregory Miller, for an empathetic understanding that we as

siblings share. I also thank my mentor, Dr. Lonnie Ingram, and everyone in the department of

Microbiology and Cell Science for their commitment to the principles of continued education

and scientific research. I thank my entire graduate committee for lending the assistance and

direction required to fulfill my potential. I thank Jeremy Purvis for use of the trehalose over-

producing strain JP20 and for his guidance during my entry into the graduate program. I thank

Lorraine Yomano for providing the ethanologenic strain LY180 and for answering my many

questions. I thank Laura Jarboe, Pete Turner, and Priti Pharkya for their assistance and support

with microarray studies. Finally, I thank my beloved, Shaun'Ta Skaggs, for the warmth and

determination that she has instilled upon me.










TABLE OF CONTENTS

page

A CK N O W LED G M EN T S ............................................................................. 4

LIST OF TABLES .................... ........................ ................7

LIST OF FIGURES ........................................ ............................... ........8

ABSTRAC T ......... .................. ............... ................ .. ............... 10

CHAPTER

1 IN TRODU CTION ................... ......................................... .............. .............. 13

Hydrolysis of H em icellulose .................................................... ........... ....... 13
Ferm entation of H em icellulose Sugars........................................................................ .......... 16
Toxicity of Hemicellulose Hydrolysate........................................18
Types of Inhibitors ........... .......... ............. .... ................ ........... 18
Addressing Inhibitors ..................................................20
Objectives ............. ......... ... ........ ........................ ........ 23
Engineering Resistance to Osmotic Stress ..........................................23
Engineering Resistance to Desiccation ............................... ...............24
Engineering Resistance to Chemical Stress .............................................. ......24

2 INCREASING TOLERANCE TO OSMOTIC INHIBITORS ............................................26

Introduction ........................................... 26
M materials and M methods ........................................... ..............27
Results and D discussion ........................................... ..............27
Tolerance to Sugars ................................................ ..............28
Tolerance to Salt.................................... ........29
Tolerance to Organic A cids................................................ ........ 29
Tolerance to Alcohol ................................................ ..... .. 30
Conclusions............................................... .........30
Figures and Tables ............... ........................ .........31

3 INCREASING TOLERANCE TO DESICCATION .......................................33

Introduction............... ................... ............................................ 33
M materials and M methods ........................................... ..............34
Growth of Organism s ............................ ......................34
Over-Expression of Trehalose Production ..........................................34
T testing for D esiccation Survival ................................................................................ 35
Results and Discussion .............. ...... ....................... 36
Effect of Sugar Substrate on Survival .................................. ............... 36
Effect of Strain on Survival .................... ....... ........ 36










Effect of Trehalose Overproduction on Survival ................. ................. ............37
Effect of Growth Stage on Survival ........................................ ................. 38
M mechanism of Survival ..................................... ........... .......... ........ ... ..... 39
Effect of Desiccation on Fermentation............ .................... .......... 40
Conclusions............................................... .........40
Figures and Tables ......... ................. ........... ...............41

4 INCREASING TOLERANCE TO FURFURAL ........................................ ...... 46

Introduction........................................... 6
M materials and M methods ................ ............................. 47
Strains, M edia, and Growth Conditions .............................. ...............47
C construction of Strain L Y 180 ........................ ...........................................48
Growth-Based Selection for a Furfural Resistant Strain.......... ..............................49
Furfural Resistance and Metabolism During Fermentation ........................................49
Comparison of Hydrolysate Toxicity ... ........... ................. ........ 49
M icroarray Analysis .......................................... ........ ..............50
N etw ork Com ponent A analysis ............................................... ............... 50
C losing and D election of G enes .................. ................................................ ............... 5 1
Purification and Kinetic Analysis of YqhD and DkgA............... ......... ........... ..51
Whole-cell Assays of Furfural Metabolism in Vivo during Fermentation........... .......52
In Vitro Assay of Furfural Reduction............................... ......... 52
Analyses ...................................................... ........53
R results and D discussion ........................................53
Isolation and Initial Characterization of a Furfural-Resistant Mutant.............................53
Effect of Media Composition on Furfural Resistance.................................................55
Comparison of Oxidoreductase Expression by mRNA Microarray Analysis..............56
Characterization of YqhD and DkgA ................................................................... 57
Tolerance to Acid Hydrolysate of Hemicellulose ....................................................58
Global Effect of Furfural on the Transcriptome...............................................58
Effect of Furfural on Regulatory Activity .............................................. .................59
Effect of Furfural on Amino Acid Sulfur Assimilation Gene Expression ....................61
Effect of Amino Acid Supplements on Furfural Tolerance ............... ..... ..........61
Effect of Alternative Sulfur Sources on Furfural Tolerance .........................................63
Effect of Increasing Transhydrogenase Expression on Furfural Tolerance ....................64
Conclusions............................................... .........65
Figures and Tables ....................................................................... 70

5 GENERAL CONCLUSIONS AND FUTURE DIRECTIONS ............................ .............88

G en eral A ccom plishm ents................................................................................................. 88
Future Works ................................................... .........90

LIST OF REFEREN CES .............................................................................................................92

B IO G R A PH IC A L SK E T C H .......................................................................................................105




6









LIST OF TABLES


Table page

3-1 Desiccation of ethanol versus lactate producing E. coli..................................... 41

4-1 Bacterial strains, plasmids, and primers. ............................................. 70

4-2 Expression of oxidoreductase genes perturbed by furfural addition. .............................73

4-3 Gobal comparison of genes perturbed by furfural addition ....................................74

4-4 Regulators perturbed by furfural addition................................ ................. 75









LIST OF FIGURES


Figure page

2-1 Effect of betaine and trehalose on sugar tolerance ................. ................. ..... 31

2-2 Effect of betaine and trehalose on salt tolerance .........................................31

2-3 Effect of betaine and trehalose on organic acid tolerance ..................................... 32

2-4 Effect of betaine and trehalose on alcohol tolerance ................. ................. .........32

3-1 Growth substrate versus desiccation tolerance ..........................................41

3-2 Trehalose production and sugar addition's combined effect on desiccation tolerance .....42

3-3 Cell density's effect on desiccation tolerance............................. ............... 43

3-4 Growth sugar versus added sugar's affect on desiccation tolerance................ .............44

3-5 Effect of sugar addition directly prior to desiccation....... ........ ..... ................44

3-6 Sugar concentration versus desiccation tolerance......................................45

3-7 Ability of previously desiccated cells to ferment ........ ........... ...........45

4-1 Linear DNA fragments used in construction of LY180................................................76

4-2 Directed evolution of E. coli for furfural tolerance ................. ................. ...........77

4-3 Tolerance of furfural resistant strain EMFR9 versus LY180 .......................................78

4-4 Effect of media composition on furfural tolerance........... ......... ...............79

4-5 Effect of oxidoreductase expression on furfural tolerance. ........................................79

4-6 In vivo and in vitro furfural reduction comparison...................................................80

4-7 Effect of yqhD and/or dkgA deletion on furfural tolerance....................................81

4-8 Growth in hem icellulose hydrolysate ........................................................ 81

4-9 Partial regulatory response of LY180 to furfural.......................................................82

4-10 Histidine pathway genes perturbations upon furfural addition........................................83

4-11 Cysteine and methionine pathway gene perturbations upon furfural addition. .................84

4-12 Supplementation with specific metabolites increases furfural tolerance...........................85










4-13 Effect of increased transhydrogenase expression on furfural tolerance .........................86

4-14 Model of furfural challenge .............. .........................87









Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

ENGINEERING AND CHARACTERIZATION OF HEMICELLULOSE HYDROLYSATE
STRESS RESISTANCE IN ESCHERICHIA COLI

By

Elliot Miller

August 2009

Chair: Lonnie Ingram
Major: Microbiology and Cell Science

Carbohydrate polymers that comprise the lignocellulosic matrix of plants are an abundant

and renewable source of sugar for biocatalytic conversion into a range of commercially viable

products. However, these carbohydrates must first be depolymerized to monomeric sugars prior

to fermentation. Depolymerization of hemicellulose by treatment with dilute mineral acid is

quite effective but also results in the formation of inhibitors such as furfural that retard growth

and fermentation. To address this issue a series of studies were conducted focusing on osmotic

and chemical stress found in hemicellulose syrups formed from dilute acid hydrolysis.

To increase osmotic stress tolerance, the effect of two osmoprotectants, trehalose and

betaine, were investigated. Trehalose was produced internally in high concentrations in

Escherichia coli by expression of the otsAB operon through transposon insertion into the

chromosome. In addition, the media was supplemented with 1 mM betaine and additive effects

of the two osmoprotectants were investigated in the presence of osmotic stress agents.

Individually, each osmoprotectant conferred increased tolerance to osmotic stress from sodium

chloride, sodium lactate, glucose, xylose, and succinate, but not ethanol. In the cases of sodium

chloride, sodium lactate, glucose, or xylose, the combination of trehalose over-production and

betaine addition increased tolerance more than either osmoprotectant could alone.









Three E. coli strains with increased trehalose production, EM2P (an ethanol producing

derivative of KO 1l), EM2L (an ethanol producing derivative of LY163), and EM2T (a lactate

producing derivative of TG106) were tested for desiccation survival. All strains with increased

trehalose production had higher survival levels than the control. The growth sugar also impacted

desiccation survival, with xylose yielding lowest survival, glucose providing intermediate

survival, and sucrose providing the highest survival. Desiccating the cells in mid-log growth

phase provided the highest survival levels compared to other growth phases. The highest overall

survival rate (up to 80%) was achieved by over-producing trehalose while growing in sucrose

and harvesting in mid-log phase of growth.

In addition to osmotic stress, chemical stress caused by furfural was addressed.

Ethanologenic E. coli, strain LY180, was transferred in fermentation vessels containing minimal

salts medium AMI with xylose as a carbon source, and furfural in order to obtain a furfural

resistant mutant. Changes in global mRNA levels in response to furfural were compared in the

mutant, EMFR9, and the parent, LY180. These studies revealed 8 genes encoding

oxidoreductases with at least 2 fold increased expression and 4 genes with at least 2 fold

decreased expression in EMFR9 relative to LY180. Expression from plasmid in LY180 of the 8

genes did not increase furfural tolerance. However, expression by plasmid in EMFR9 of the 4

genes conferred a decrease in furfural tolerance in the cases of yqhD, dkgA, and yqfA. YqhD and

DkgA exhibited the most pronounced effects. These two enzymes were purified and shown to

have NADPH dependent furfural reductase activity, with a low Km for NADPH (8 [tM and 23

[aM, respectively). Deletion of these two genes in LY180 increased furfural tolerance,

supporting the idea that furfural reduction competes for NADPH needed for growth. Plasmid









based expression of two native transhydrogenases, sthA and pntAB, in LY180 led to an increase

in furfural tolerance with regard to pntAB, but sthA had no effect.

Further analysis of microarray data revealed an increase in cysteine and methionine

pathway mRNA levels in LY180 upon furfural addition. In order for sulfate, the only source of

sulfur in AMI medium, to be incorporated into cysteine, 4 NADPH are required.

Supplementation with 0.5 mM L-cysteine, D-cysteine, or sodium thiosulfate increased furfural

tolerance in LY180 but not in EMFR9, presumably by alleviating NADPH demand for sulfate

incorporation. Supplementation with taurine, an alternative source that requires almost as much

NADPH as sulfate to be incorporated, provided no benefit to furfural tolerance. Together, the

data indicates that conversion of furfural to furfuryl alcohol by YqhD limits available NADPH

required for biosynthesis of molecules such as cysteine, preventing growth.









CHAPTER 1
INTRODUCTION

Hydrolysis of Hemicellulose

Plants are perhaps the most abundant renewable resource on earth, covering its entire

surface and providing us with wood to build homes, chemicals from which herbal remedies can

be derived, and even oxygen that we as a species require to survive. Furthermore, the basic

materials necessary for the accumulation of flora are equally abundant; solar energy for

photosynthesis, minerals from the soil, and carbon dioxide from the atmosphere. Since this

natural commodity is so widespread it is no wonder that decades of scientific research have been

employed to make the most of its potential, with one resulting outlet being the formation of

hydrolysate.

Hydrolysate in general is simply a product of hydrolysis, and can be produced from any

number of materials, including fish (120), yeast (26), soy (107), and many others (21, 68, 122).

Hemicellulose hydrolysate is formed as a result of hydrolysis of the hemicellulose portion of the

lignocellulose that comprises a large portion of the plant (132). The lignocellulose itself can be

divided into three primary components: cellulose, hemicellulose, and lignin (132). The cellulose

is composed of repeating units of glucose that are linked in a 1,4-beta fashion to make them

inaccessible to digestion (40). The hemicellulose is composed of a variety of pentose and hexose

sugars, including xylose, arabinose, mannose, glucose, and galactose (21). Lignin is a polymer

of various aromatic compounds (syringic acid, hydroxybenzaldehyde, catechol, etc.) and aids in

giving the plant rigidity In addition to these polymers, the lignocellulose contains pectin, which

accounts for approximately 2-20% of the lignocellulosic content and is composed of galacturonic

acid and rhamnose. The hemicellulose sugars along with the glucose released from hydrolysis of

the cellulose provide a suitable set of substrates for microorganisms to metabolize into useful









products. However, before this can occur the sugars must be made accessible through a

pretreatment process.

Pretreatment of lignocellulose opens the crystalline structure, separating tightly packaged

lignin, hemicellulose, and cellulose polymers from each other, as well as in certain instances

partially hydrolyzing the cellulose and hemicellulose bonds (131). There are a number of

pretreatment approaches that can be taken, each with benefits and pitfalls (132). They include

dilute sulfuric acid pretreatment, dilute phosphoric acid pretreatment, flowthrough pretreatment,

pH controlled water pretreatment, ammonia fiber explosion pretreatment, ammonia recycle

percolation pretreatment, N-methylmorpholine-N-oxide pretreatment, and lime pretreatment.

Pretreatment by dilute sulfuric acid in conjunction with high temperatures and pressures

leads to the recovery of most of the hemicellulose as dissolved sugars along with hydrolysis of

part of the cellulose (21, 122, 131, 132). In addition, part of the lignin structure is disrupted,

allowing attack on the cellulose by enzymes (122, 131). The use of phosphoric acid pretreatment

also promotes cellulose hydrolysis, although not to the same degree as with sulfuric acid (122)

and the remaining phosphoric acid can be used as a source of phosphate for growth. Pressurized

liquid forced through biomass allows for disruption of the lignocellulosic structure, even without

acid addition (132), but unfortunately the high amounts of water and energy required make the

process difficult to use commercially. Maintaining the pH at 4-7 using water or stillage and

implementing high pressure and temperature can dissolve a large portion of the lignin and

hemicellulose, and cleave hemiacetyl linkages, thus freeing acids that can further degrade the

biomass (132).

In addition to acidic pretreatment methods, alkaline pretreatment has been shown to be

effective. Ammonia fiber explosion, or AFEX, decrystallizes cellulose so that it is more









accessible to enzymatic degradation, the ammonia is volatile enough that it can be quickly

recycled for further use, and remaining ammonia promotes fermentation (132). Ammonia

recycle percolation, or ARP, pushes aqueous ammonia though biomass at high temperatures,

breaking apart the lignin as well as the lignin-hemicellulose bonds for enzymatic digestion of the

hemicellulose (132). N-methylmorpholine N-oxide pretreatment, or NMMO pretreatment, uses

NMMO to dissolve the cellulose so it is susceptible to enzymatic attack, and most of the NMMO

can be readily recovered (61). Finally, addition of lime can be used for lignin removal, with the

added benefit of temperature versatility (132), meaning that the reaction can occur at

temperatures as low as 25 degrees Celsius so long as the pretreatment time is increased

accordingly.

After the biomass has been pretreated by one of the above techniques the remaining

cellulose and hemicellulose polymers, not completely digested but now readily accessible, need

to be broken into their component sugars so that they may be metabolized. To do this enzymes

such as cellulases and xylanases are employed. Cellulases hydrolyze the 1,4 linkages of

cellulose that join glucose monomers together, and are implemented by a variety of organisms

(27, 68, 76, 117). This often results in the formation of cellobiose that needs to be further broken

down by beta-glucosidases to form two glucose molecules (106). In addition, the hemicellulose

can be hydrolyzed by xylanases that release xylose present in the polymer (16, 27, 102).

In addition to hemicellulose hydolysate, hydrolysate from starch is commonly used in

industrial biocatalytic product formation (114). It is advantageous to use starch in that the

glucose that comprises the starch polymer is much more easily hydrolyzed to metabolizable

sugars than lignocellulose and so complex pretreatment processes are unnecessary. This means

that the cost of preparing the hydrolysate is lower, and the concentration of inhibitors formed and









released is much less. The starch, however, comes from materials such as corn that require

significant costs in nutrients to grow and are competed for commercially as a food commodity.

Fermentation of Hemicellulose Sugars

After the hydrolysate has been prepared it can used as a source of sugar for

microorganisms to grow and produce various chemical compounds. The microorganisms that

make these valuable commodities range in classification from bacteria, to eukaryotes, and even

archaeal species. Each of these domains have the ability to grow under a unique set of

conditions regarding media, temperature, aeration, substrate preference, and each can produce a

different but overlapping set of products. Furthermore, even within each domain organisms

differ with respect to the above criteria.

Bacteria can produce a wide range of commercially important products, including

ethanol, propanol, butanol, lactate, succinate, acetate, and pyruvate. Ethanol, an alternative fuel

source (40), is made as a product naturally in many bacteria fermentatively in order to achieve

redox balance (130). However, generally speaking, other products are also produced that lower

overall yield and complicate purification strategies. To alleviate this issue bacteria have been

developed though genetic engineering and directed evolution to make ethanol as their primary

product, with two of the most prominent being Escherichia coli and Klebsiella oxytoca (8, 51,

133). 1-butanol is made in Clostridium using acetone-butanol-ethanol fermentation (31, 67), and

certain species of Clostridium can make 1-propanol in low concentrations using threonine

catabolism (50). Heterologous expression of genes in E. coli has allowed it to produce

measurable quantities of both 1-butanol and 1-propanol (110). Genetic engineering of E. coli has

led to its ability to produce 1.2 M lactate--an acid useful in the formation of plastics and

pharmaceuticals (2, 44)--in minimal media, with high chiral purity (142). A number of other

bacteria, particularly those of the genera Bacillus, have been engineered to produce lactate









industrially (94). In addition, a derivative of E. coli C was engineered to make 0.7 M succinate

in minimal media (53). Other bacteria can make succinate effectively, including Actinobacillus

succinogenes and Enterecoccus flavescens (135). E. coli W3110 was engineered to make 0.9 M

acetate (18), and Acetobacter is a well-known acetate forming bacteria that uses ethanol as a

substrate under aerobic conditions. Pyruvate can be made in E. coli to a final yield of 0.8 M

(17), and can be used as a precursor in the formation of a number of amino acids.

Eukaryotic microorganisms that are engineered to make commercial products from

sugars found in hemicellulose hydrolysate are generally yeast. Saccharomyces cerevisiae is

perhaps the most well studied and implemented of these yeasts. It can use glucose, mannose,

and fructose via the Embden-Meyerhoff pathway of glycolysis, galactose using the Leloir

pathway, and xylose through metabolic engineering to express a xylose isomerase (126). These

and other strategies allow S. cerevisiae to make significantly higher concentrations of products,

particularly ethanol, than the parent strains (55). In addition, a number of other fungi have been

known to convert both glucose and xylose into ethanol, including Fusarium, Mucor, Rhizopus,

and Monila (96). S. cerevisiae has also been engineered to make optically pure D-Lactate from

glucose during batch fermentations (135).

Archaea are perhaps the least studied of the three groups, due in part to their lower degree

of prevalence, difficulty to cultivate, and absence of genetic manipulation tools compared to

bacteria and yeast. However, these microorganisms are interesting potential vessels for

commercial product formation from biomass for a number of reasons. Like members of the

other domains, archaea have the ability to implement a wide range of carbohydrates. Marine

archaea have been shown to be able to digest both alpha and beta linked glucans, including

starch, barley glucan, laminarin and chitin (12). As fascinating is their ability to grow at









temperatures that are permissible to enzymes which degrade lignocellulosic polymers but are not

desirable to growth of contaminanting microbes.

Toxicity of Hemicellulose Hydrolysate

Pretreatment of plant biomass hydrolyses a portion of the lignocellulose, freeing sugars

that can then be readily metabolized, and opens the crystalline structure to enzymatic attack for

further degradation. However, this process often leads to the release and formation of numerous

inhibitors, which can be broken into two major categories: osmotic inhibitors and chemical

inhibitors. These compounds, which retard cell growth and product formation (123, 136-138),

can be dealt with, either by their removal from the media prior to addition of the inoculum or

through the development of tolerant strains.

Types of Inhibitors

Osmotic inhibition results from hypertonic conditions imposed by components of the

hydrolysate, including sugars released from hydrolysis of the cellulose and hemicellulose, salts

formed from acid treatment as well as those released from the plant itself, and acids cleaved from

the lignocellulosic polymers. The resulting hypertonicity draws water out of the cell, leading to

plasmolysis of the membrane and disruption of cellular processes (23).

Chemical inhibitors affect the biocatalyst in a multitude of ways, with patterns of

inhibition linked to the class of inhibitor involved. The three major categories of inhibitors are

alcohols, acids, and aldehydes. Alcohols in hydrolysate result primarily from the release of

aromatic alcohols from lignin, as well as through the formation of furfuryl alcohol via

conversion of pentose sugars during pretreatment (64, 137). They include vanillyl alcohol,

methylcatechol, guaiacol, coniferyl alcohol, hydroquinone, furfuryl alcohol, and catechol (137).

Alcohols have been shown to act by solubilization of the cell membrane, and as such toxicity can

be directly correlated to hydrophobicity of the compound (137). Of the above alcohols,









methylcatechol was shown to be the most inhibitory to an ethanologenic strain of E. coli, with a

minimal inhibitory concentration, or MIC, of 1.5 g liter1 (137). Interestingly, inhibition of

alcohols present in pairs was fairly additive (137).

Organic acids present in hemicellulose hydrolysate come from numerous sites including

lignin, acetyl-xylan, and conversion of hydrolyzed sugars (121). Specific acids include ferulic,

gallic, furoic, formic, levulinic, and acetic acid (136). Acetate is thought to consistently be the

most abundant hemicellulose hydrolysate acid (136). Acids act by crossing the cell membrane in

neutral form and then disassociating, releasing a hydrogen ion and in turn collapsing the proton

motive force (136). Increasing the initial pH of the medium decreases toxicity in most instances,

most likely because a greater portion of the acids disassociate outside of the cell and thus are

unable to diffuse across the membrane (136). As with aldehydes, toxicity is related to

hydrophobicity, although acids do not appear to disrupt membrane integrity (136).

The effect of aldehydes on cell function appears to be more complicated than that of

either acids or alcohols and is not yet fully understood. Aldehydes present in hemicellulose

hydrolysate include soluble aromatic aldehydes released from lignin, hydroxymethyl furfural

from conversion of hexose sugars, and furfural from conversion of pentose sugars. Aromatic

aldehydes appear to be more toxic on a weight basis than furfural or hydroxymethyl furfural

(138). However, furfural generally exists in higher concentrations than any individual aromatic

aldehyde, its toxicity is uniquely synergistic, and it is the only tested aldehyde to strongly inhibit

ethanol production in KO11 and LYO 1 (138); these serve as indications that furfural is perhaps

the most important of inhibitory aldehydes. The inhibitory effects of furfural have been

extensively studied. Furfural has been shown to mutate DNA at and below 20 mM furfural (59),

can cause strand breaks in duplex DNA (39), and can react with the amino group of adenine to









form N-6-furfuryladenine (9). Furfural also effects enzyme function, reducing the activity of

alcohol dehydrogenase (82), aldehyde dehydrogenase (82), pyruvate dehydrogenase (82) at a

concentration of less than 2 mM furfural, and glucose phosphate isomerase (48), and glucose-6P-

dehydrogenase (48) at a concentration of 4 mM furfural. At high temperatures both 10 and 30

mM furfural were shown to interact chemically with lysine to form furpipate (83).

Hydroxymethyl furfural, while not as toxic as furfural, can also inhibit growth (138) and has

been shown to affect mammalian DNA polymerase X and the terminal

deoxynucleotidyltransferase, with an IC50 of 26.1 and 5.5 [aM, respectively, for these two

enxymes (81).

Addressing Inhibitors

Microorganisms respond to osmotic stress by the accumulation of various compatible solutes,

neutral molecules that can exist in the cytoplasm in high concentrations without harming cell

function (58). In E. coli, high concentrations of external osmolytes led to the uptake of

potassium ions, which in turn initiates the formation of the compatible solute glutamate (58).

Other compatible solutes, such as proline, are either made or taken into the cell through a set of

transporters (58). The non-reducing sugar trehalose is naturally produced in both prokaryotic

and eukaryotic organisms during osmotic stress using trehalose-6-phosphate synthase and

trehalose-6-phosphate phosphatase (47, 58); increasing trehalose production in E. coli by

expressing the otsAB operon on a plasmid led to enhanced osmotic stress resistance (103). In

addition, E. coli can take up the compatible solute betaine from the medium (19, 58, 98) or

produce it oxidatively in the presence of choline (58). Gram-positive bacteria have a similar

response mechanism, taking up and producing proline and betaine upon onset of hypertonicity

(58).









Chemical inhibitors present in hemicellulose hydrolysate can be managed either by

detoxification prior to culture addition or by engineering and selection of resistant strains. A

number of approaches have been taken to remove chemical inhibitors prior to inoculum addition,

including overliming, resin filtration, charcoal filtration, and selective hydrogenation.

Overliming, or the addition of calcium hydroxide to hot hydrolysate, leads to a significant

reduction in total furans and phenolic compounds (32, 73, 74), but also reduces overall sugar

concentrations (73). Treatment of hydrolysate with IRA-400 ion exchange resin removes a

portion of the acetate, furfural, sulfate, and phenolic compounds (32). Activated charcoal

functions in a similar fashion but removes less furfural (32) and less nitrogen (105). In both

cases, treatment allowed for an increase in carbohydrate utilized by Klebsiella pneumoniae to

make 2,3-butanediol (32). Increasing treatment temperature during implementation of charcoal

increases its effectiveness (79). While charcoal and resin provide an opportunity for removal of

inhibitors, costs of both are a factor to be taken into consideration. Additionally, although not

directly connected to hydrolysate remediation, conversion of furfural to the less toxic furfuryl

alcohol can be performed by selective hydrogenation using a copper oxide catalyst (42).

In addition to removing inhibitors from hydrolysate prior to culture addition, growth

conditions can be modified to allow for improved tolerance in the presence of inhibitors. One of

the primary means by which this is accomplished is through microaeration. Growth of E. coli

KO11 in waste house wood hydrolysate, or WHW, in the presence of small quantities of oxygen

led to an increase in xylose consumption and ethanol production (91). Other methods of this

nature include encapsulation of Saccharomyces cerevisae in an alginate matrix for protection

against inhibitors as well as an increase in capacity for in situ detoxification (119).









Alteration of the hydrolysate to become suitable for biocatalytic growth is a general

strategy that has been adopted in many instances, but adaptation of the organism itself to

hydrolysate inhibitors, either through genetic engineering or directed evolution, can be more

beneficial in that it reduces complication of hydrolysate preparation and sidesteps costs

associated with resin, alginate, and so forth. One means by which this can be achieved is

through selection of resistant strains by screening and transferring in media containing the

appropriate inhibitors. S. cerevisae, Pachysolen tannophilus, Brettanomyces custersii, Candida

shehatae, and Candida acidothermophilum have been screened for growth in dilute acid

softwood prehydrolysate (56), and various yeast have been adapted to hydrolysate inhibitors by

continuous cultivation in prehydrolysate and hydrolysate (56, 70, 71). S. cervisiae was adapted

to sugarcane bagasse hydrolysate by continuous cultivation in increasing concentrations of

phenolic compounds, furaldehydes, and aliphatic acids (71). Two yeast species, Pichia stipitis

and Trichoderma reesi, were adapted to grow in high concentrations of acetate (43, 88), a

common hemicellulose hydrolysate inhibitor. P. stipitis is particularly interesting as an ethanol

producing yeast due to its ability to utilize xylose (1).

With knowledge of the mechanisms by which hydrolysate inhibitors act, and the means

by which each biocatalyst attempts to tolerate them, genetic engineering of the biocatalyst can be

implemented to further promote growth and product formation. Laccase, an extracellular fungal

enzyme, has been demonstrated to oxidize phenolic compounds (63). Expression of laccase

from Trametes versicolor in S. cerevisae led to increased tolerance to coniferyl aldehyde when

oxygen is present (63). A mutation in the ABC transporter aatA in Acetobacter aceti was shown

to convey acetic acid, formic acid, propionic acid, and lactic acid sensitivity; expression of aatA

in the mutant restored acetate resistance, and expression of A. aceti aatA in E. coli increased









resistance to acetate (86). Furthermore, expression of aconitase in Acetobacter aceti has been

shown to increase acetate resistance (85). Multiple enzymes in S. cerevisiae have been shown to

reduce 5-hydroxymethyl furfural, including a mutated alcohol dehydrogenase 1 and alcohol

dehydrogenase 6 (5, 62, 99). In E. coli, a furfural reductase was purified that reduced furfural to

furfuryl alcohol using NADPH specifically as a co-factor (36). In S. cerevisiae, mutations in

four genes within the pentose phosphate pathway--zwf, gnd, rpe, tkl-led to furfural sensitivity,

and overexpression of zwf allowed for increased tolerance to furfural (34).

Objectives

The primary goal of this research project is to develop and analyze mechanisms in E. coli

that increase tolerance to inhibitors commonly found in hydrolysate. Doing so will lend a basic

scientific understanding of the inhibitors' action on the cell, as well as lead to a commercial

platform for overcoming the toxicity of these moieties. This approach will separately target

osmotic stess and chemical stress factors.

Engineering Resistance to Osmotic Stress

Osmotic stress is imposed upon the cell by salts and sugars found in hemicellulose

hydrolysate (23, 57, 100), in addition to products which accumulate during fermentation (103).

This study will test the ability of osmotic stress to be overcome in E. coli using two known

osmoprotectants, betaine and trehalose. Addition of ImM betaine to media containing separate

osmotic stress agents will be used to gauge its effect on osmotolerance through growth

measurements. The same approach will be implemented to test improved osmotic tolerance

through increased expression of the otsBA operon, genes necessary for trehalose production, by

random insertion in the host chromosome using a transposon. Finally, the conjoined effect of

betaine addition and increased trehalose production will be measured to test the ability of two

osmoprotectants to work synergistically.









Engineering Resistance to Desiccation

The ability of cultures to survive anhydrobiosis has been long studied (22, 101), and

stress factors that prevent survival are separate, but related, to those observed with omotic stress.

S. cerevisiae and other yeast exhibit increased survival by producing intracellular trehalose (22),

the same disaccaride used as an osmoprotectant, and drying in added trehalose or sucrose also

increases desiccation survival (65, 101). However, not all osmoprotectants serve as

anhydrobiotic protectants, as is the case with betaine (129). Using ethanol producing and lactate

producing E. coli strains with integrated otsBA operons under control of a tac promoter, this

study will determine if engineered intracellular production of trehalose leads to increases in

desiccation survival. The ability of added xylose, glucose, fructose, arabinose, lactose or

mannose will also be tested for its effect on desiccation tolerance, both alone and in conjunction

with increased intracellular trehalose production. In addition, the growth phase of harvested

cells with relation to survival will be assessed. Finally, the effect of desiccation on fermentation

of subsequently rehydrated cells will be determined.

Engineering Resistance to Chemical Stress

One of the primary chemical stress agents observed in hydrolysate is furfural, a

dehydration product of the pentose sugar xylose (64, 73, 138). This study will develop a furfural

resistant E. coli through selective evolution, growing batch cultures in minimal media containing

furfural and transferring to new media when growth is observed. The furfural resistant E. coli

will subsequently be subjected to a microarray comparison to the parent strain in order to

delineate evolved resistance mechanisms. E. coli has previously been demonstrated to contain a

furfural reductase (36), but no corresponding gene had been assigned. To attempt identification

of furfural reductases, putative and known oxidoreductases with perturbed mRNA expression

will be cloned and tested, both for furfural reductase activity as well as for their effect on furfural









tolerance. Oxidoreducatases with furfural reducing activity will subsequently be histidine tagged

by gene cloning into plasmid vector pET15b and purified on a nickel column to be subjected to

kinetic analysis. Finally, global gene expression analysis through microarray studies will be

used to group genes perturbed by furfural addition into functional categories. Together, the

gathered data will allow development of a model outlining furfural's inhibition mechanism.









CHAPTER 2
INCREASING TOLERANCE TO OSMOTIC INHIBITORS

Introduction

Current high costs of petroleum and petroleum-derived chemicals provide an opportunity

for the expansion of renewable microbial products from carbohydrate feedstocks. To be

competitive, microbial processes for bulk chemicals must be simple, robust, rapid, efficient, and

inexpensive. High product titers are desirable to minimize costs associated with water handling,

purification, and waste treatment. To achieve these titers in simple fermentations, microbial

biocatalysts must be able to tolerate osmotic and chemical stress from high concentrations of

carbohydrate substrates in the hydrolysate as well as accumulated products released from the

microorganism. Although the mechanism of osmotolerance is not fully understood, plants,

animals, and microbes utilize intracellular compatible osmolytes such as glutamate, betaine,

proline, and trehalose to counter osmotic stress from extracellular solutes (22, 23, 103). E. coli

can synthesize all of these compounds during oxidative metabolism provided choline is

available, but biosynthesis is limited to glutamate and trehalose during anaerobic growth.

Trehalose accumulation during fermentative growth is hindered by expression of catabolic

enzymes such as trehalase (14, 45).

Betaine has generally been regarded as a superior protective osmolyte for E. coli and has

been shown to increase tolerance to sugars, salts, and organic acids (23, 30, 58, 123, 141). This

compound is actively concentrated from the environment by a stress-inducible uptake system

(98, 124) and serves as a protective intracellular osmolyte. In E. coli, biosynthesis of trehalose is

also induced as part of the osmotic stress response (23, 58, 103). Uptake of betaine has been

shown to reduce the intracellular levels of trehalose, suggesting that these protective osmolytes

may be biologically interchangeable (19, 20, 100). Other studies have shown that over-









expression of trehalose biosynthetic genes can be used to increase trehalose levels above that of

wild type strains and increase osmotolerance to both salts and sugars (103).

Here I investigated the combined effects of genetically increasing trehalose biosynthesis

and supplementing the medium with betaine on osmotic tolerance to stress agents encountered

during fermentation in hydrolysate by measuring growth in mineral salts medium containing 20

g liter- (w/v) glucose as the primary carbon source.

Materials and Methods

Two E. coli strains were used in these studies: W3110 (wild type) and JP20 (103). Strain

JP20 is an isogenic derivative in which an IPTG-inducible operon for trehalose biosynthesis

(QampH:: lacIPtac-otsBA) has been chromosomally integrated into ampH, and the genes for

trehalose degradation (treA, treC, and treF) have been deleted. Levels of trehalose in JP20 were

previously shown to be elevated without induction due to leaky expression, and further increased

upon induction by IPTG (103).

Osmotolerance was examined as described by Purvis et al. (103). Tolerance was

investigated using M9 mineral salts medium containing 20 g liter- (111 mM) glucose, unless

indicated otherwise. Inocula were prepared by resuspending cells from fresh colonies on solid

medium in broth. Cultures were inoculated to provide an initial OD550 nm Of 0.03 (10 mg dcw 1-1).

Cell density was determined after incubation for 24 h at 370C. The minimum inhibitory

concentrations (MIC) for each stress agent was estimated by extrapolating plots of cell mass

versus solute concentration to zero growth.

Results and Discussion

Although the beneficial effects of intracellular trehalose and betaine during growth under

osmotic stress are well-established for sodium chloride and glucose (23, 58, 104), little work has

been reported concerning the combined effect of two intracellular osmolytes. Prior experiments









have established that 1 mM betaine is near the optimal concentration for osmotic tolerance in E.

coli for several stress agents (123). Previous studies in our laboratory have examined the effects

of different levels of trehalose on osmotolerance by comparing the wild type parent to an

isogenic strain (JP20) containing a chromosomally integrated, IPTG-inducible operon for

trehalose biosynthesis (103). Strain JP20 exhibits elevated levels of trehalose synthesis in the

absence of induction, and higher levels with added IPTG. Estimates of intracellular trehalose

levels for these strains were as follows: less thanI mM for W3110 (parent), 28 mM for JP20

without induction, and 360 mM for JP20 after induction (103). Based on these results,

experiments were designed to examine the combined effects of betaine (1 mM) and trehalose. A

qualitatively similar effect on trehalose biosynthesis (JP20 induced>JP20>W3110) was assumed

independent of stress agent.

Tolerance to Sugars

The addition of betaine to the media prior to growth led to a substainial increase in

tolerance to high concentrations of glucose, increasing the minimal inhibitory concentration

(MIC) from 0.7 to 1.1 M (Fig. 2-1A). As expected, JP20 also had increased tolerance to glucose

even in the absence of induction by IPTG (due to leaky expression of the otsAB operon), and

induction further enunciated this trend. Most interestingly, the combination of betaine addition

and increased trehalose production yielded a synergistic benefit above which either

osmoprotectant could provide alone.

A similar effect was observed in the presence of another sugar commonly found in

hydrolysate, xylose (Fig. 2-1B). Again, W3110 without betaine exhibited the least tolerance to

the osmolyte, with either betaine addition or increased trehalose expression separately providing

a benefit to tolerance. JP20 grown in the presence of betaine resulted in the highest tolerance to

xylose. Taken together the data serves as an indication that a synergistic osmoprotective effect is









observed with relation to betaine and trehalose in the presence of otherwise inhibitory sugar

concentrations.

Tolerance to Salt

The greatest benefit observed from the tested osmoprotectants was in the presence of

sodium chloride (Fig. 2-2). As shown with sugar tolerance assays, tolerance to NaCl increased

when cells were grown in the presence of 1 mM betaine. JP20, the strain developed for

increased trehalose production, also had improved tolerance to NaCl compared to W3110 in an

uninduced state, with induction by IPTG providing an added benefit. JP20 in the presence of

betaine exhibited the greatest tolerance to NaC1, although induction by IPTG in this instance did

provide an additional effect. This indicates that although betaine and trehalose can act

synergistingly, saturating osmoprotectant concentrations still exist, above which no further

benefit is observed.

Tolerance to Organic Acids

In addition to osmotic stress agents present in media prior to growth, E. coli releases

fermentation products that can have an osmotic effect, two of which being lactate and succinate.

By far the best osmoprotectant in the presence of lactate appears to be betaine, allowing growth

in up to 0.6 M lactate (Fig. 2-3A). Increased production of trehalose appeared to exhibit a minor

benefit. Unfortunately, no synergistic benefit was observed during growth in lactate.

Addition of betaine was most beneficial to succinate tolerance, increasing the MIC from

0.3 M to 0.6 M (Fig. 2-3B). Trehalose over-expression provided a noticeable advantage, but

again, no synergistic effect was observed between the two osmoprotectants. Interestingly, either

betaine addition or trehalose overproduction led to an increase in final cell density when grown

in low succinate concentrations compared with growth in the absense of succinate, indicating

that once osmotic hinderance has been overcome succinate can serve as a carbon source.









Tolerance to Alcohol

Unlike xylose, glucose, sodium chloride, lactate, or succinate, no beneficial effect was

observed by either osmoprotectant in the presence of ethanol (Fig. 2-4). This result is consistent

with the small size and previous reports of high cellular permeability (28, 29, 80). Other actions

such as metabolic stress or chemical stress are presumed to be important actions leading to

growth inhibition by ethanol. Oddly, osmprotectant addition led to a slight antogonistic effect on

growth, with this trend enuciated when the trehalose over-producing strain, JP20, was grown in

the presence of betaine.

Conclusions

A combination of supplementing fermentations with 1 mM betaine and enhancing

biosynthesis of trehalose by the biocatalyst may be more useful than either alone for increased

tolerance to sugars (glucose and xylose) and products such as sodium lactate. Although this

combination did not improve tolerance to ethanol, strain productivity may be improved in high

sugar environments. The molar toxicity of xylose was over 3-fold higher than glucose and NaCl.











Figures and Tables


1.5-


1.0-
-)

E 0.5-
-


n- n In


0.5 1.0
Glucose (M)


1.01


E 0.5-
-
"o


-. or 0


1.5 2.0


0.1 0.2
Xylose (M)


0.3 0.4


Figure 2-1. Effect of betaine and trehalose on sugar tolerance. Tolerance to (A) glucose, and
(B) xylose. A, W3110 without betaine; A, W3110 with 1 mM betaine; o, JP20
without betaine; e, JP20 with betaine; o, JP20 induced without betaine; ., JP20
induced with 1 mM betaine.


2.0






E


0.0-
0.0 0.5 1.0 1.5
NaCI (M)


Figure 2-2. Effect of betaine and trehalose on salt tolerance. Tolerance to NaCl. A, W31 10
without betaine; A, W3110 with 1 mM betaine; o, JP20 without betaine; 0, JP20
with betaine; o, JP20 induced without betaine; ., JP20 induced with 1 mM betaine.


%


r.
























Lactate (M)


0.00 0.25 0.50 0.75
Succinate (M)


Figure 2-3. Effect of betaine and trehalose on organic acid tolerance Tolerance to (A) lactate,
and (B) succinate. A, W3110 without betaine; A, W3110 with 1 mM betaine; o,
JP20 without betaine; *, JP20 with betaine; o, JP20 induced without betaine; .,
JP20 induced with 1 mM betaine.



1.25-



S0.75-

S0.50- '
E
) 0.25-


0.00 0.25 0.50 0.75 1.00
Ethanol (M)


Figure 2-4. Effect of betaine and trehalose on alcohol tolerance. Tolerance to ethanol. A,
W3110 without betaine; A, W3110 with 1 mM betaine; o, JP20 without betaine; *,
JP20 with betaine; o, JP20 induced without betaine; ., JP20 induced with 1 mM
betaine.









CHAPTER 3
INCREASING TOLERANCE TO DESICCATION

Introduction

Desiccation tolerance has been a field of much interest to researchers, with extensive

studies conducted on both bacterial and mammalian cells. This research has delineated

mechanisms allowing certain organisms to survive in an anhydrobiotic state and come away

unscathed. S. cerevisae, for instance, produces high levels of the disaccharide trehalose as well

as the osmoprotectant betaine in response to osmotic stress. E. coli can implement a similar

action of defense, producing trehalose and taking in betaine through a specific transport system

(20, 100). While betaine has been shown to act as an invaluable tool against high osmolyte

concentrations, its effects are not evident during desiccation (129). As such, trehalose, as well as

other disaccharides such as sucrose, serve as the prevailing protectors under these circumstances,

acting to take the place of water in order to prevent membrane fusion as well as protein

inactivation (65, 101). Efforts have been made in the past to further enhance the ability of these

organisms to survive the desiccation process, with E. coli being at the forefront of these ventures.

E. coli cells have been dried in trehalose solutions to increase extra-cellular trehalose while at the

same time intra-cellular levels were increased through osmotic induction, allowing for survival

levels up to approximately 80% after a week of desiccation (25). In addition, recombinant

expression of sucrose-6-phosphate synthase in E. coli using the spsA gene from Synechocystis

has been implemented as a means by which to allow the cells to produce sucrose as a protection

mechanism, increasing survival when desiccated over phosphorus pentoxide from approximately

2*10-4 % to 2.3% (11). This study looks to further expound upon the benefits provided by these

and other sugars by the recombinant over-expression of trehalose production in concert with









separate addition of xylose, glucose or sucrose, as well as gain insight into the mechanism by

which this effect occurs.

Materials and Methods

Growth of Organisms

LY163, an ethanologenic E. coli having all native fermentative routes for NADH

reoxidation replaced with the Zymomonas mobilis ethanol producing pathway (118), and its

derivatives were grown for desiccation in NBS minimal medium with the addition of 5 % w/v

xylose, sucrose or glucose prior to growth. Cultures were transferred on NBS agar plates

containing 2 percent glucose and were re-streaked using an applicator stick on a daily basis.

KO 11, a recombinant strain of E. coli containing the pdc and adh genes from Z. mobilis (90), and

its derivatives were grown in Corn Steep Liquor medium, also with the addition of 50 g liter-

xylose, glucose or sucrose prior to growth. Cultures were transferred daily on CSL plates

containing 20 g liter- xylose by restreaking via applicator stick. TG106, an E. coli B derivative

(pff,frd, adhE, ackA-, AldhA::ldhL mgsA-) made to produce L-lactate and EM2T, a further

derivative of TG106 made to over-express the genes for trehalose production were transferred on

NBS 20 g liter- glucose plates with 0.1 M MOPS, pH 7.0, on a daily basis. Organisms were

frozen for long-term storage by growing the cells to approximately 0.5 optical density (550 nm),

adding 0.75 mL of this culture to 0.75 mL 80% w/v glycerol stock and then placing the tube into

a Nalgene Cyro freezing container to be frozen at negative 75 degrees Celsius

Over-Expression of Trehalose Production

LY163, KO11, and TG106 were transformed with pLOI3650, a plasmid containing the

otsBA operon under control of a tac promoter that inserts the operon into the genome as a

transposon (103). Each strain was grown in 50 mL of LB medium in a 250 mL Erlenmeyer flask

after inoculation with a single colony and was grown to approximately 0.5 OD. The culture was









then centrifuged at 5,000 g for 5 minutes and the pellet was resuspended in 10 mL of 50 mM ice-

cold calcium chloride solution. 3 uL of plasmid was added to 200 uL of the resuspended cells

and this tube was held on ice for 30 minutes. The suspension was then placed in a 37-degree

water bath for 2 minutes and was then removed and held at room temperature for 5 minutes.

Subsequently, 1 mL of LB with 50 g liter- glucose was added to the suspension and this was

transferred to a 37 shaker for 1 hour. These cells were then plated and selected for kanamycin

resistance and ampicillin sensitivity to make sure that only the otsBA operon had been inserted.

Preliminary tests were then conducted on the resulting colonies with regard to desiccation

resistance when grown for 24 hours in either CSL (KO 11) or NBS (LY163 and TG106) with 50

g liter- glucose. The optimal strains were selected and designated EM2L for the LY163

derivative, EM2P for the KO11 derivative, and EM2T for the TG106 derivative.

Testing for Desiccation Survival

Cultures were grown in either NBS (for LY163) or CSL (for KO 1l)--neither medium

contained betaine--with 50 g liter- xylose, glucose, or sucrose for either 24 hours or to

approximately 7 OD. A sample of 10 uL of these cultures were then pipeted into 1.5 mL

microfuge tubes that were thereafter transferred to a Pyrex desiccation chamber containing

phosphorous pentoxide. Argon was added to the desiccator, via a tube which connected the

chamber to a gas tank, to purge the majority of the oxygen from the atmosphere in the chamber.

After 3 days of desiccation the cultures were resuspended in 1 mL of 50 g liter- xylose solution,

and appropriate dilutions were made in 50 g liter- xylose so that the colony forming units could

then be counted and compared to those of the non-desiccated cultures in order to determine

survival. To test for desiccation survival in TG106 and EM2T pH had to be maintained since the

organism produces high quantities of lactate. To do this, the cultures were first grown in fleakers









containing NBS with 1 mM betaine and 50 g liter1 of the appropriate sugar for 24 hours with pH

maintained at 7.0 by 6 N KOH addition prior to desiccation over phosphorus pentoxide.

Results and Discussion

Effect of Sugar Substrate on Survival

As a preliminary study KO 11 was grown in a variety of sugars and was then desiccated

for 3 days, at which point the cells were rehydrated and plated to obtain colony-forming unit

counts (Fig. 3-1). Growth in xylose led to the lowest levels of survival, with growth on glucose,

lactose, arabinose, fructose or mannose giving intermediate survival levels, and sucrose yielding

the highest percentage survival by far. From this data it was decided that xylose, glucose, and

sucrose be selected as the growth substrates for further investigation with regard to survival to

allow for a comprehensive comparison. Addition of 1 mM betaine to KO 11 cultures grown for

24 hours with 50 g liter- sucrose was also tested to see if it would improve survival, but survival

levels of cultures grown in betaine were actually slightly lower than if no betaine was added

(data not shown). This was not surprising since similar studies had shown this to be the case

under separate conditions (129), and serves as an indication that the principles cells use to cope

with osmotic stress as opposed to desiccation differ significantly.

Effect of Strain on Survival

When grown for 24 hours in NBS with 50 g litef1 xylose and subsequently rehydrated

after 3 days desiccation, extremely low survival was observed for the ethanol producing strains

KO11 and LY163 (Table 3-1). Growth in glucose for 24 hours prior to desiccation, compared to

xylose, led to slightly higher survival for these strains. Growth in 50 g liter-' sucrose prior to

desiccation led to the highest survival by far of all sugars tested for both strains, although

survival of KO 11 grown in sucrose was higher than that of LY163. One possible reason for this









discontinuity is that KO 11 was grown in corn steep liquor, which is undefined and contains

various osmoprotectants, whereas the NBS medium used to grow LY163 does not.

In addition to testing the ability of the ethanol-producing E. coli to survive the

desiccation process, it was also of interest to determine whether or not E. coli producing other

fermentation products could achieve similar levels of recovery. To do this the lactate producing

strain TG106 was desiccated after 24 hours growth in fleakers containing NBS with 1 mM

betaine and 50 g liter1 of either, xylose, glucose, or sucrose, and was then rehydrated after 3

days and plated to measure cell counts. As expected, desiccation in xylose led to the lowest

levels of survival of the three substrates, although survival was still considerably higher then

with either LY163 or KO 11. Interestingly, while addition of sucrose again allowed a higher

degree of survival than xylose, it was glucose in this instance that led to the highest levels of

survival.

Cell mass, product levels, remaining sugar, and pH were examined for clues to these

differences in survival. Higher survival after desiccation was generally associated with sucrose,

lactate instead of ethanol as a fermentation product, lower cell mass, and higher pH. Xylose as

the fermentable sugar and accumulated ethanol (above 6 g liter-) were associated with a

decrease in survival.

Effect of Trehalose Overproduction on Survival

Since it was evident that the sugar the cells were grown on had a profound impact on the

organism's survival, the question of whether or not increased production of a similar sugar

would also confer such tolerance to desiccation arose, and if this effect in conjunction with sugar

substrate would lead to further increases in survival. To test this KOl11, EM2P, and EM2P

induced were grown for 24 hours in CSL with 5 g liter1 of either xylose, glucose, or sucrose,

desiccated for 3 days, and then rehydrated. When grown on xylose, both KO11 and EM2P









exhibited very low levels of survival, but survival of EM2P was relatively higher, and trehalose

induction increased this trend (Fig. 3-2A,B,C). Survival was higher overall when the cultures

were grown in glucose, and even higher when the cultures were grown in sucrose, with a

combined benefit resulting from the overexpression of trehalose, as shown by higher survival

levels in EM2P in all instances compared to KO 11.

Over-expression of trehalose production in concert with growth on sucrose led to survival

levels higher than that which either could provide alone, so it seemed prudent to ask if this

phenomenon could be applied to other strains as well. To answer this question the same

transposon was inserted in LY163, producing EM2L. Although survival was slightly lower

overall in LY163 and its derivatives than with KOll and EM2P, possibly due to faster growth and

hence greater consumption of sucrose, inserting the genes and inducing them led to significantly

higher levels of survival than in the parent strain (Fig. 3-2E). Finally, this technique was applied

to the lactate producing organism, TG106, making EM2T. EM2T grown in sucrose had higher

levels of survival than TG106, with survival rising upon induction (Fig. 3-2F).

Effect of Growth Stage on Survival

From this data it became clear that growth in sucrose in conjunction with over-expression

of trehalose production led to levels of survival higher than that which either could provide

alone. The next pertinent question regarded the optimal growth point that E. coli cells should be

desiccated at in order to achieve optimal survival. To test this, EM2L was grown uninduced to a

range of optical densities. From this experiment it was determined that the optimal desiccation

point was late log phase or approximately 7 OD (Fig. 3-3).

Using this information LY163, EM2L, and EM2L induced were grown in NBS with 50 g

liter1 sucrose to approximately 7 OD and were then desiccated for three days before rehydration









and plating (Fig. 3-2D). This led to a significant increase in survival for both strains. Possible

reasons accounting for this outcome include higher levels of sucrose left in the medium due to

lower biomass and fermentation product production (which was shown to be the case by HPLC

measurements), as well as a decrease in waste product concentration that might hinder survival.

Mechanism of Survival

In order to begin to touch upon the mode by which survival is selectively conferred by

varying sugar substrates, LY163 was grown for 24hrs in NBS with 50 g liter- xylose, glucose, or

sucrose, and then directly prior to desiccation was centrifuged to allow for replacement of the

spent medium with fresh NBS with 30 g liter- xylose, glucose, or sucrose. Interestingly, it was

found that if the cultures were grown in xylose and then resuspended in sucrose, high levels of

survival were achieved (Fig. 3-4). Conversely, cultures grown in sucrose and then resuspended

in xylose had relatively poor levels of survival. This indicates that the mechanism by which the

sugar serves to protect the cell involves acting in a direct physiological fashion on the outer cell

membrane. Strangely, glucose added to xylose grown cultures also allowed for high survival

levels, which may be attributed to the replacement of the supernatant containing various waste

products that could have had a separate impact on survival.

To test to see if addition of supplemental sucrose directly prior to desiccation would

contribute to increased survival, EM2L uninduced was grown for 24 hours and either 0, 1, 2 or 5

percent additional sucrose was added to the culture before transfer to the desiccation chamber

(Fig. 3-5). The additional sucrose led to higher survival at all sucrose concentrations, although

this trend appeared to offer diminishing returns after the one percent sucrose addition. Since

percentage survival was higher than without additional sucrose, but lower than if desiccation

occurred at an early growth phase, it indicates that sugar levels are not the only factor involved.

Separate experiments were conducted in which KO11 was grown in CSL with 5% sucrose and









was then washed and resuspended in CSL with varying concentrations of sucrose prior to

desiccation (Fig. 3-6). This experiment indicates that the optimal concentration of sucrose prior

to desiccation to achieve a high level of survival is approximately 5 percent, and that over-

addition of sucrose (sucrose concentrations higher than 70 g liter-) leads to a decrease in

survival.

Effect of Desiccation on Fermentation

Desiccation had no measurable effect on growth and ethanol production by strain EM2L.

Fresh and desiccated cells grew to the same density in the seed fermentor and produced ethanol

at the same rate in the test fermentor with 100 g L-1 xylose (Fig. 3-7). Yields of over 90%

theoretical (0.51 g ethanol per g xylose) were achieved with both.

Conclusions

The choice of sugar substrate dramatically affected desiccation tolerance ofE. coli strains

engineered for ethanol production and for lactate production. Survival was highest with sucrose,

particularly for cells tested during log phase. Further improvements in desiccation tolerance

were obtained by increasing the expression of genes for trehalose biosynthesis (ostBA) or

resuspending cells in fresh medium to remove accumulated products of metabolism prior to

desiccation. The benefit of trehalose and sucrose for desiccation tolerance may result in part

from their unreactive nature. The presence of xylose, a reactive sugar, was detrimental for

tolerance during desiccation. For EM2L containing a second copy of otsBA, ethanol production

using desiccated inocula for seed fermentation were equivalent to that of undessicated inocula.










Figures and Tables


Table 3-1. Desiccation of ethanol versus lactate producing E. coli
Strain OD 550 nm Ethanol or Remaining pH % Survival
lactate (g liter ') sugar (g liter 1)
KO11
Xylose 10.1 12 14 4.1 <0.001
Glucose 9.5 12 14 3.7 <0.002
Sucrose 8.6 5 29 4.7 20+/- 2
LY163
Xylose 11.9 16 2 5.1 <0.02
Glucose 11.2 16 4 5.0 <0.20
Sucrose 10.9 6 24 5.6 5 +/- 1
TG106
Xylose 3.0 13 29 7.0 2+/-1
Glucose 5.5 26 7 7.0 9+/-5
Sucrose 3.6 15 22 7.0 8+/-4


1

0.1

0.01


0.001

0.0001


(D C) (D 0) 0) 0) (D
L) V) ) (V) V) V) t)
0 0 0 0 0 0 0
D) u (o = r
E
L_~


Figure 3-1. Growth substrate versus desiccation tolerance. Survival ofKO11 grown in CSL with
50 g liter- xylose, glucose, sucrose, lactose, arabinose, fructose, or mannose prior to
desiccation for 3 days and subsequent dehydration in 50 g liter- xylose and plating to
obtain colony-forming unit counts.





















KO11 EM2P EM2PInd


4-
3- T
2-
1 -
0-I
K01l1 EM2P EM2P Ind


75


50-

25-

0
LY163 EM2L EM2L Ind


LY163 EM2L EM2L Ind


TG106 EM2T EM2T Ind


Figure 3-2. Trehalose production and sugar addition's combined effect on desiccation tolerance.
Survival of KO 11, the ethanol producing parent strain, and EM2P, the derivative
over-expressing the genes for trehalose production, after being grown in CSL with 50
g liter- xylose (A), glucose (B), or sucrose (C) for 24 hrs prior to chemical
desiccation and subsequent rehydration and plating. Survival of LY163, the parent
ethanol producing strain, and EM2L, a derivative of LY163 over-expressing
trehalose, after being grown to 70D (D) or for 24 hrs (E) in NBS with 50 g liter-
sucrose prior to desiccation. (F) Survival of TG106, the parent lactate producing
strain, as well as EM2T, the derivative made to over-express the genes for trehalose
production, after growth in fleakers containing NBS with 1 mM betaine and 50 g liter
1 sucrose prior to subsequent desiccation.

























5 10 15 20 25
Time (hrs)


01-
0.0 2.5 5.0 7.5 10.0 12.5
OD550nm


1UU-


75-


50-


25-


0
0.0 2.5 5.0 7.5 10.0 12.l
OD550nm





7______


E 10-


5-,
0


0











200-


E

o 100-


U I I
0.0 2.5 5.0 7.5 10.0 1

OD550nm


Figure 3-3. Cell density's effect on desiccation tolerance. Survival of EM2L grown to a range
of optical densities in NBS with 50 g liter- sucrose prior to chemical desiccation for 3
days and subsequent rehydration and plating to measure colony-forming units.
Survival shown as either CFU per mL or percentage survival. Corresponding sucrose
levels as well as a growth curve of EM2L in 50 g liter-' sucrose are also depicted.


0
j500-
E


LL 250-
o


U



















S50-






x c x C D c( C 0 c6


Figure 3-4. Growth sugar versus added sugar's affect on desiccation tolerance. Survival of
LY163 after growth for 24 hours in NBS with 50 g liter' xylose, glucose, or sucrose,
with subsequent resuspension of cells--directly prior to desiccation-in 30 g liter' of
the indicated sugar xylosee, glucose, sucrose, or arabinose). For instance, gx-rx
means grown in xylose (gx) and resuspended in xylose (rx).


m
S50-
0)
03
(U

2 25-
a)
n

0-


0 10 20
Sucrose addition (g liter 1)


Figure 3-5. Effect of sugar addition directly prior to desiccation. Survival of EM2L grown in
NBS with 50 g liter' sucrose and subsequent addition of a range of sucrose
concentrations directly prior to chemical desiccation for 3 days followed by
rehydration and plating.


















Z5100- C0 20-
0-

O 10-


0 25 50 75 100 125 0 25 50 75 100 125
Sucrose (g liter- ) Sucrose (g liter-1)


Figure 3-6. Sugar concentration versus desiccation tolerance. Survival of KOl 1 grown in CSL
with 50 g liter- sucrose and then washed and resuspended in a range of sucrose
concentrations prior to chemical desiccation, rehydration, and plating, expressed as
either cfu per ml (A) or percentage survival (B).


0 25 50 75 100 125
time (hours)


0 25 50 75 100
time (hours)


50-


30
20- /
10- /

125 0 25 50 75 100 125
time (hours)


Figure 3-7. Ability of previously desiccated cells to ferment. Strain EM2L was grown overnight
as described for desiccation and used either directly to inoculate a seed fermentation
(3.5 ml, 1% by volume; NBS medium, 50 g liter- xylose) or dessicated (35 droplets
of 0.1 ml each on parafilm; stored for 3 days) prior to use in a second seed
fermentation. After 24 h incubation (37_C, 150 rpm, controlled at pH 6.5 with 2 M
KOH), each seed fermentation was used to inoculate a test fermentation containing
NBS media under the same conditions. Cell mass, base addition, and ethanol were
measured during a 96 h incubation. Symbols for all: previously dessicated EM2L (i)
versus undessicated EM2L (A).









CHAPTER 4
INCREASING TOLERANCE TO FURFURAL

Introduction

A wide variety of fermentation products can be made using sugars from lignocellulosic

biomass as a substrate (40, 51, 55, 135). Prior to fermentation, however, the carbohydrate

polymers cellulose and hemicellulose must be converted to soluble sugars using a combination

of chemical and enzymatic processes (122, 131). Chemical processes are accompanied by side

reactions that produce a mixture of minor products such as alcohols, acids, and aldehydes which

have a negative effect on the metabolism of microbial biocatalysts. Alcohols (catechol, syringol,

etc.) have been shown to act by permeablizing the cell membrane and toxicity correlates well

with the hydrophobicity of the molecule (137). Organic acids (acetate, format, etc.) are thought

to cross the membrane in neutral form and ionize within the cytoplasm, inhibiting growth by

collapsing the proton motive force (93, 136). The inhibitory mechanisms of aldehydes are more

complex. Aldehydes can react to form products with many cellular constituents in addition to

direct physical and metabolic effects (82, 113). In aggregate, these minor products from chemical

pretreatments can retard cell growth and slow the fermentation of biomass-derived sugars (46,

92).

Furfural (a dehydration product of pentose sugars) is of particular importance (3).

Furfural content in dilute acid hydrolysates of hemicellulose has been correlated with toxicity

(74). Removal of furfural by lime addition (pH 10) rendered hydrolysates readily fermentable

while re-addition of furfural restored toxicity (73). Furfural has also been shown to potentiate

the toxicity of other compounds known to be present in acid hydrolysates of hemicellulose (136-

138). Furfural has been reported to alter DNA structure and sequence (9, 59), inhibit glycolytic

enzymes (34), and slow sugar metabolism (48).









The ability of fermenting organisms to function in the presence of these inhibitors has

been researched extensively. Encapsulation of S. cerevisiae in alginate has been shown to be

protective and improve fermentation in acid hydrolysates of hemicellulose (119). Strains of S.

cerevisiae have been previously described with improved resistance to hydrolysate inhibitors (4,

71, 89). E. coli (36), S. cerevisiae (5) and other microorganisms (13) have been shown to

contain enzymes that catalyze the reduction of furfural to the less toxic product, furfuryl alcohol

(137). In E. coli, furfural reductase activity appears to be NADPH-dependent (36). An

NADPH-dependent furfural reductase was purified from E. coli although others may also be

present. An NADPH-dependent enzyme capable of reducing 5-hydroxymethyl furfural (a

dehydration product of hexose sugars) has been characterized in S. cerevisiae and identified as

the ADH6 gene (99).

Isolation of a furfural-resistant E. coli mutant (EMFR9) in which furfural reductase

activity is lower than that of the parent (LY180) due to decreased expression of yqhD and dkgA

is described in this section. The reduction of furfural by these two NADPH-dependent

oxidoreductases is proposed to inhibit growth by depleting NADPH needed for biosynthesis.

Thereafter, we use global transcript analysis to expand our investigations in order to include the

broader cellular response to added furfural using the parent organism, strain LY180.

Materials and Methods

Strains, Media, and Growth Conditions

Strains and plasmids used in this study are listed in Table 4-1. Plasmid and strain

constructions were made using Luria broth (78). Antibiotics were included as appropriate.

Temperature-conditional plasmids were grown at 300C; all others were grown at 370C.

Ethanologenic strains were maintained in AMI mineral salts medium (72) supplemented with 20

g liter- xylose for solid medium and 50 g liter- xylose or higher for liquid medium used in









fermentation experiments. E. coli strain LY168 (51) is a derivative of KO 1 and served as the

starting point for this investigation. Note that E. coli W (ATCC 9637) is the parent for strain

KO 11, initially reported to be a derivative of E. coli B (90).

Construction of Strain LY180

Strain LY168 has been previously described for the fermentation of sugars in

hemicellulose hydrolysates (51). Several modifications were made to improve substrate range

(restoration of lactose utilization, integration of an endoglucanase, and integration of cellobiose

utilization) resulting in LY180. Linear DNA fragments used for integration are shown in Figure

4-1 and have been deposited in GenBank. The FRT region in lacY was replaced with the native

E. coli ATCC 9637 sequence by double homologous recombination using Fragment A

containing lacZ lacY lacA cynX' (24, 53). Integrated strains were selected directly for lactose

fermentation. ThefrdBC region downstream fromfrdA::Zmfrg celY Ec (Erwinia c hly pin/whiui)

was deleted by double homologous recombination using a two step process (53). Fragment B

(frdB', a cat, sacB cassette, andfrdC') was integrated first with selection for chloramphenicol

resistance. The cat-sacB cassette was then replaced with Fragment C consisting offrdA', Z.

mobilis promoter fragment, E. c hi nhylwniwl celY, andfrdC'by selecting for resistance to

sucrose. This replacement also deleted an FRT site. The K. oxytoca genes encoding cellobiose

utilization (casAB) were inserted into IdhA by double homologous recombination also using a

two step process (53). Fragment D (IdhA', a cat-sacB cassette, casAB, and 'IdhA) was used to

replace the FRT site in IdhA with selection for resistance to chloramphenicol. The cat-sacB

cassette was then replaced with Fragment E consisting of IdhA', a promoter fragment from Z.

mobilis, and K. oxytoca casA'. Integrated strains were isolated by selecting directly for

cellobiose fermentation. All constructs were verified by analyses of phenotypes and PCR

products.









Growth-Based Selection for a Furfural Resistant Strain

LY180 was inoculated into a 500-mL vessel (initial inoculum of 50 mg dcw liter-)

containing 350 ml of AMI supplemented with 100 g litef1 xylose and 0.5 g liter- furfural (370C,

150 rpm, pH 6.5). Cultures were serially diluted into new fermentors at 24-h intervals, or when

cell mass exceeded 330 mg dcw liter-'. Furfural was gradually increased to 1.3 g liter- as

growth permitted. After 54 serial transfers, a resistant strain was isolated and designated EMFR9.

Furfural Resistance and Metabolism During Fermentation

Furfural resistance was compared in small fermentors (370C, 150 rpm, pH 6.5, 350-ml

working volume) using AMI medium (72) containing 100 g liter- xylose. Seed cultures were

inoculated to approximately 33 mg dcw liter-'. Samples were removed periodically to measure

cell mass, ethanol, and furfural.

Furfural toxicity (MIC) was also examined using tube cultures (13x100 mm) containing 4

ml of AMI broth with 50 g liter1 (wt/vol) filtered-sterilized sugar, furfural, and other

supplements. Cultures were inoculated to an initial density of 17 mg dcw liter-'. Cell mass was

measured after incubation at 370C for 24 h and 48 h.

Comparison of Hydrolysate Toxicity

A hemicellulose hydrolysate of sugar cane bagasse was produced using dilute sulfuric

acid at elevated temperature and pressure and supplied by Verenium Corporation (Boston, MA).

This hydrolysate contained 82 g liter1 total sugar (primarily xylose), 1.4 g liter- furfural, and

other constituents. Hydrolysate was supplemented with the mineral components of AMI

medium, adjusted to pH 6.5 using 45% KOH, and diluted with complete AMI (80 g liter-

xylose). Diluted samples of hydrolysate were distributed into 13 mm X 100 mm culture tubes (4

mL each), inoculated to an initial cell density of 17 mg dcw liter-', and incubated at 370C. Cell









mass (after centrifugation and resuspending in broth) and ethanol concentration were measured

after 48 h.

Microarray Analysis

Cultures were grown in small fermentors to a density of 670 mg dcw/L. An initial sample

was removed that served as a control. Furfural was immediately added from a 50 g L^aqueous

stock (0.5 g liter- final concentration) and incubation continued for 15 minutes prior to a second

sampling. Samples were rapidly cooled in an ethanol-dry ice bath, harvested by centrifugation at

40C, resuspended in Qiagen RNA Later and stored at -800C until RNA extraction. RNA was

purified using a Qiagen RNeasy Mini Kit, treated with DNase I and purified by

phenol/chloroform extraction and ethanol precipitation. RNA was sent to NimbleGen (Madison,

WI) for microarray comparisons using templates designed for E. coli K12. Each sample

consisted of pooled material from four fermentors. The complete experiment was performed

twice. Data was analyzed with ArrayStar software (DNA Star, Madison, WI), and by SimPheny

(Genomatica Inc., San Diego, CA). Expression ratios are presented as the average of the two-

pooled datasets, although it should be noted that the oxidoreductase experiments were based on

the initial microarray dataset only. A control experiment was performed during which water was

added. 54 genes (>2% of chromosome) changed more than 2-fold after water addition. Only 8 of

these were also affected by furfural addition indicating that the effect of disturbing the culture by

liquid addition was negligible for the furfural response.

Network Component Analysis

Network Component Analysis (NCA) calculates transcription factor activity ratios from

expression ratios and known regulatory connections and was performed as previously described

(49). The connectivity file was updated according to Regulon DB and Ecocyc (33, 54). The

regulon of the "stringent factor" was defined as previously described, via analysis of the 5-









minute response to serine starvation via serine hydroxamate treatment during mid-log growth of

BW25113 in MOPS glucose (49). Regulators with significantly altered regulatory activity were

identified by comparison to a null distribution and using a P-value cutoff of 0.05.

Cloning and Deletion of Genes

Oxidoreductase genes for expression studies (ribosomal-binding sites, coding regions,

and 200 base pair terminator regions) were amplified from strain LY180 genomic DNA using a

BioRad iCycler (Hercules, CA), ligated into pCR 2.1 TOPO vector, and cloned into E. coli

TOP10F' using an Invitrogen TOPO TA Cloning Kit (Carlsbad, CA). Plasmids were purified

using a QiaPrep Spin Mini Prep Kit. Gene orientation was established by PCR.

E. coli transhydrogenase genes were amplified (ribosomal-binding sites, coding regions,

and a 200 bp terminator region) from strain LY180 genomic DNA using a BioRad iCycler

(Hercules, CA) with primers that provided flanking HindIII sites. After digestion with HindIII,

the product was ligated into HindIII digested pTrc99a (vector) and transformed into E. coli

TOP10F' (Carlsbad, CA). Plasmids were purified using a QiaPrep Spin Mini Prep Kit (Valencia,

CA). Gene orientation was established by digestion with restriction enzymes and by polymerase

chain reaction.

A yqhD deletion was constructed in LY180 as described by Datsenko and Wanner (24)

using the plasmids pKD4 and pKD46. A dkgA deletion in LY180 was constructed as described

by Jantama et al. (53). A double mutant with deletions in both yqhD and dkgA was also

constructed. Repeated attempts to delete the yqfA gene were not successful.

Purification and Kinetic Analysis of YqhD and DkgA

Both the yqhD and dkgA genes were cloned into a Novagen pET-15b vector and

expressed as a His-tagged protein in E. coli BL21 (DE3). Cells were grown with IPTG to

approximately 1.3 g dcw liter-', washed with 100 mM phosphate buffer, and lysed using MP Fast









Prep-24 (MP Biomedical, Solon, OH) and Lysing Matrix B. Crude extracts were passed through

a 0.22 [tm PVDF filter and further purified using a 1 mL HiTrap nickel column. Purified

enzymes were dialyzed in 100 mM phosphate buffer using a Thermo Slide-A-Lyser and

quantified using a Thermo BCA Protein Assay Kit. Purity of YqhD and DkgA were estimated to

be greater than 90% by SDS-PAGE. A single band was observed for each in an SDS-PAGE gel.

Estimated sizes of the purified proteins were in agreement with predicted values of 43 kD and 31

kD, respectively. Apparent Kcat and apparent Km values were determined for both purified

enzymes using NADPH and furfural.

Whole-cell Assays of Furfural Metabolism in Vivo during Fermentation

Whole-cell furfural metabolism was measured using fermentors in which cultures were

grown to a density of 670 mg dcw liter- (mid log phase). Furfural was added to an initial

concentration of 0.5 g liter1. Samples were removed at zero time and after 15, 30, and 60 min of

incubation for the measurement of furfural and cell mass. The specific rate of furfural

metabolism was calculated using the average cell mass during each assay interval. Results are

expressed as moless min' mg dcw-1.

In Vitro Assay of Furfural Reduction

Anaerobic tube cultures were grown in AMI medium containing 50 g liter- xylose and

harvested in mid log phase (0.7-1.0 g dcw liter-'). Cells were washed once with 20 mL 100 mM

potassium phosphate buffer (pH 7.0), resuspended in phosphate buffer to approximately 6.5 g

dcw liter-', chilled on ice, and lysed for 20 sec using a FastPrep-24 cell disruptor and Lysing

Matrix B. Debris was removed by centrifugation (13,000 x g; 10 min) and the supernatant used

to measure furfural-dependent oxidation of NADH and NADPH. Assays contained 100 mM

phosphate buffer (pH 7.0), 20 mM furfural, and 0.2 mM reductant (NADPH or NADH).









Furfural-dependent activity molesls min' mg protein-) was measured as the change in

absorbance at 340nm. Greater than 80% of activity was NADPH-dependent.

Analyses

Ethanol was measured using an Agilent 6890N gas chromatograph (Palo Alto, CA)

equipped with flame ionization detectors and a 15-meter HP-PlotQ megabore column. Dry cell

weight was estimated by measuring optical density at 550nm using a Bausch & Lomb Spectronic

70 spectrophotometer. Each OD550nm is equivalent to approximately 333.3 mg dcw liter-'.

Furfural levels in AMI medium were measured by absorbance at OD284nm and OD320nm

(20). The accuracy of this method was confirmed by HPLC analysis. Furfural content of bagasse

hemicellulose hydrolysate was measured using an Agilent LC1100 liquid chromatograph

(refractive index monitor and UV detector) and an Aminex HPX-87P ion exclusion column

(BioRad, Hercules, CA) with water as the mobile phase

Furfural tolerance for growth was measured in standing tubes with 4 mL total volume of

AMI and 50 g liter- filter-sterilized xylose. Tubes were incubated at 370C and measured after 24

and 48 h. Values reported are an average of at least 3 measurements.

Results and Discussion

Isolation and Initial Characterization of a Furfural-Resistant Mutant

A furfural-resistant derivative of LY180 was isolated after 53 serial transfers in pH-

controlled fermentors (Fig. 4-2) containing AMI mineral salts medium with 100 g liter- xylose

and increasing concentrations of furfural (0.5 g liter- initially to final concentration of 1.3 g liter

1). Attempts to directly isolate mutants resistant to 1.0 g liter- furfural in a single step (solid

medium and broth) were not successful. Step-wise improvement in furfural tolerance was

observed during serial transfers, consistent with multiple changes. The resulting strain, EMFR9,

grew and fermented xylose in the presence of 1.0 g liter- furfural at a rate equivalent to the









parent LY180 in the absence of furfural (Fig. 4-3). Growth and ethanol production by EMFR9

also exceeded that of the parent LY180 in the absence of furfural.

Addition of a low furfural concentration (0.4 g liter1) to the parent LY180 caused an

initial lag in growth and ethanol production (Fig. 4-3A and 4-3B). During this lag, furfural was

chemically reduced to the less toxic furfuryl alcohol (137, 138) (Fig. 4-3C). Growth and

fermentation increased by more than 3-fold immediately following the complete removal of

furfural. Growth and ethanol production by LY180 were strongly inhibited by 1.0 g liter-'

furfural throughout the 72-h incubation (Fig. 4-3D and 4-3E). During this time, approximately

20% of the furfural was reduced indicating that LY180 remained metabolically active (Fig. 4-

3F). In contrast to LY180, EMFR9 was virtually unaffected by the presence of furfural (0.4 g

liter1 or 1.0 g liter-) (Fig. 4). The volumetric rate of furfural reduction was higher for EMFR9

than LY180 at both furfural concentrations (Figure 4-3C and 4-3F), primarily due to the larger

amount of cell mass (Fig. 4-3A). This was confirmed by further experiments in which the in vivo

rate of NADPH-dependent furfural reduction by EMFR9 (per mg dcw) was found to be about

half that of the parent LY180. In contrast to LY180, growth and fermentation of EMFR9 did not

require prior reductive removal of furfural. With EMFR9, both 0.4 g liter- and 1.0 g liter-

furfural were reduced to furfuryl alcohol concurrently with growth. Reduction by EMFR9 was

complete after 12 h and 18 h, respectively (Fig. 4-3C and 4-3F).

Together, these results suggest that the process of reducing furfural rather effects of the

compound itself may be the primary site of growth inhibition at low concentrations. The loss of

function, i.e. a decrease in furfural reducing activity, correlated with an increase in furfural

tolerance in the mutant. Based on these results, we propose that the inhibition of growth by









furfural results from competition between biosynthetic needs and furfural reduction for a limited

pool of NADPH.

Effect of Media Composition on Furfural Resistance (MIC)

Unlike glucose, the production of NADPH is problematic during xylose fermentation

(130) and offers an approach to test the NADPH-competition hypothesis by measuring the MIC

for furfural in different media. In mineral salts media with 50 g liter1 xylose (Fig. 4-4A), the

minimal inhibitory concentration (MIC) of furfural was approximately 1.0 g litef1 for LY180

(parent) and 2.0 g liter1 for the mutant EMFR9. Replacement of xylose with glucose would be

expected to increase the pool of NADPH. This change (Fig. 4-4B) increased the furfural MIC by

50% for LY180 (1.5 g litef1) and by 25% for EMFR9 (2.5 g liter1). Addition of a small amount

of yeast extract (1.0 g liter1) to xylose-mineral salts medium would be expected to decrease

biosynthetic demands for NADPH. This supplement (Fig. 4-4C) doubled the furfural MIC for the

parent LY180 (2.0 g liter1) and increased the MIC for EMFR9 (2.5 g liter1) by 25%. With all

media, EMFR9 was more resistant to furfural than the parent LY180. Both glucose (increased

NADPH production) and yeast extract (decreased need for biosynthesis) increased furfural

tolerance. However, this benefit was more pronounced for the parent, strain LY180, than for the

mutant EMFR9, consistent with the lower level of furfural reductase activity in EMFR9.

The MIC for three other compounds known to be present in hemicellulose hydrolysates

were also examined: 2-hydroxymethyl furfural (analogue, dehydration product of hexose

sugars), furfuryl alcohol (reduced product of furfural), and syringaldehyde (degradation product

of lignin). EMFR9 was slightly more tolerant to 2-hydroxymethyl furfural (MIC of 3.0 g liter1)

than LY180 (MIC of 2.5 g liter1). Both strains were equally sensitive to syringaldehyde (MIC

2.0 g liter1) and furfuryl alcohol (15 g liter1) (data not shown). The absence of an increase in









tolerance to other compounds in EMFR9 is consistent with a specific site or target for furfural

toxicity.

Comparison of Oxidoreductase Expression by mRNA Microarray Analysis

Previous studies have demonstrated that E. coli contains NADPH-dependent enzyme(s)

capable of reducing furfural to a less toxic compound (furfuryl alcohol) but no gene was

identified (36). The dependence of the parent LY180 on the complete reduction of furfural prior

to growth and the loss of this dependence by EMFR9 further implicates oxidoreductases as being

of primary importance for furfural sensitivity.

Microarray analysis of mRNA was used to identify candidate oxidoreductase genes for

furfural reduction. Cultures of LY180 and EMFR9 were grown to mid-log phase in pH-

controlled fermentations with 100 g liter1 (wt/vol) xylose. For this comparison, RNA was

isolated 15 min after the addition of 0.5 g liter- furfural. A total of 12 known and putative

oxidoreductases were found that differed by approximately 2-fold or higher (Table 4-2).

Four oxidoreductases were identified that were expressed at lower levels in EMFR9

(Table 4-2). Each of these four genes was cloned into plasmids and transformed into EMFR9.

When expressed from plasmids, three of these genes (dkgA, yqhD, and yqfA) were found to

decrease furfural tolerance (Fig. 4-5). Expression of yqhD and dkgA were most detrimental and

both were shown to increase furfural reductase activity in EMFR9 (Fig. 4-6). Expression of yqfA

did not restore furfural reductase activity of EMFR9 and its effect on growth inhibition may be

related to other functions. No detrimental effect on growth was observed foryjjN. Thus the

decrease in expression of yqhD, dkgA, and yqfA in EMFR9 can be inferred to be beneficial for

furfural tolerance. Silencing of yqhD and dkgA in EMFR9 would decrease the competition with

biosynthesis for NADPH during furfural reduction. It should be noted that effects seen under









uninduced conditions can be attributed to a leaky promoter that allows expression of each cloned

gene, in conjunction with the high copy number of the pCR2.1 TOPO vector.

The other eight genes were cloned from LY180 into pCR2.1 TOPO for expression.

These oxidoreductases had increased expression in EMFR9 (1.8-fold to 4.5 fold) relative to the

parent LY180. Plasmids containing each of these genes were transformed into LY180.

However, none of these 8 caused an increase or decrease furfural tolerance (data not shown).

To further examine the potential importance of yqhD, dkgA, and yqfA silencing, attempts

were made to delete each of these genes from LY180. Although deletions of both yqhD and

dkgA were readily recovered, similar methods were not successful with yqfA. In LY180, deletion

of yqhD alone or in combination with dkgA caused an increase in furfural tolerance (Fig. 4-7)

and a decrease in furfural reductase activity in vivo similar to that of EMFR9 (Fig. 4-6). Since

deletion of dkgA alone in LY180 did not lower the in vivo reductase activity or increase furfural

tolerance, YqhD is presumed to be the more important activity for growth inhibition by low

concentrations of furfural. The lowest furfural reductase activity was found after deletion of both

genes.

Characterization of YqhD and DkgA

The largest changes in gene expression among oxidoreductases were the silencing of

yqhD and dkgA. Both YqhD and DkgA were expressed as his-tagged proteins in BL21 (XDE3)

and purified to discernable homogeneity. Both enzymes catalyzed the NADPH-dependent

reduction of furfural to furfuryl alcohol. The apparent Km values for furfural were relatively high

for YqhD (9.0 mM) and DkgA (>130 mM). With such values, it is unlikely that furfural is the

native substrate of either enzyme. Reasonably assuming that cells are permeable to furfural, the

intracellular activities of YqhD and DkgA would be expected to vary over the range of furfural

concentrations used for selection (5-14 mM; 0.5-1.3 g liter1). The apparent Km values for









NADPH were quite low for both YqhD (8 [tM) and DkgA (23 [tM). In the presence of furfural,

the high affinity of both enzymes for NADPH would compete with biosynthetic reactions for

NADPH. Partitioning of NADPH among pathways would be determined by the Km for

NADPH, steady state pool size of NADPH, and the relative abundance of competing

oxidoreductase activities. Several key metabolic enzymes have a Km for NADPH higher than

that of YqhD (8 uM), including CysJ (80 uM), required for sulfate assimilation to form cysteine

and methionine, ThrA (90uM), required for the formation of threonine, and DapB (17 uM), for

lysine formation (109).

Tolerance to Acid Hydrolysate of Hemicellulose

Hemicellulose hydrolysates contain a mixture of compounds that act in combination to

inhibit microbial growth and fermentation (73, 74, 136-138). Growth and fermentation were

examined in dilutions of a neutralized hydrolysate that contained 1.4 g liter- furfural (Fig. 4-8).

Although the MIC values for growth and ethanol production were similar (30% hydrolysate),

EMFR9 grew to a 3-fold higher density and produced over 10-fold more ethanol in 20%

hydrolysate than the parent LY180. Selection of EMFR9 for increased resistance to furfural was

accompanied by an increase in resistance to hemicellulose hydrolysate, confirming the

importance of furfural as a component of hydrolysate toxicity.

Global Effect of Furfural on the Transcriptome

Message levels were compared in actively growing cells before and 15 min after the

addition of 0.5 g L-1 fufural. Expression levels for 412 genes (10% of the transcriptome) were

altered (2-fold or greater) by the addition of furfural. The distribution of these altered genes

varied widely among functional groups, providing useful insight into the mechanism of furfural's

action (Table 4-3). In most functional groups, expression levels of less than 10% of the gene

members were altered by 2-fold or greater. Groups with this low frequency of change included









cofactors, carbon compounds, regulatory, macromolecular synthesis (Cell structure, DNA,

Lipids, Transcription, and Translation), and others (Phage, Putative/IS, Regulatory, and

Unclassified/Unknown). Expression levels for 10% to 20% of the member genes were altered in

four groups (Cell processes, Central metabolism, Energy, and Transport). Most of the affected

genes associated with central metabolism, energy, and transport increased in expression upon

furfural addition. These changes could provide an opportunity to scavenge and metabolize

additional compounds that may be available and to increase carbon flow for energy production.

Although strain LY180 is non-motile, many of the altered genes concerned with cell processes

are involved in motility and chemotaxis and were not investigated further.

Expression levels for over 20% of the member genes in two functional groups were

altered by the addition of furfural, Amino acids and Nucleotides. In these groups, over 2/3 of the

altered genes were reduced by 2-fold or greater upon the addition of furfural. Expression levels

for individual genes affecting the biosynthesis of purines, pyrimidines, and every family of

amino acids were reduced by 2-fold or greater upon the addition of furfural. A single gene in

nucleotide metabolism and only a minority of genes involved in amino acid metabolism

exhibited a furfural-dependent increase in expression. Together, these changes agree well with

the generalized decrease in biosynthesis and growth observed upon the addition of furfural.

Effect of Furfural on Regulatory Activity

Network component analysis (NCA) was used to provide a global view of the cellular

response to furfural. This analysis uses known regulatory network structure to identify

regulators with perturbed activity from transcriptome data (15, 66). Of the 60 regulators

included in this analysis, 22 were identified as being altered in expression by furfural relative to

a random network (Table 4-4, Fig. 4-9). Perturbation of RpoS, a sigma factor that acts as a

signal for general stress response, indicates that the cell recognizes the presence of a stress-









inducing agent. Since up to 10% ofE. coli's genome is regulated in some fashion by RpoS (95,

128), it is difficult to determine a specific inhibitory response. RpoS-regulated genes with

increased expression upon furfural addition include poxB, involved in conversion of pyruvate

into acetate and CO2 (139), and otsA, required for trehalose protection during osmotic stress

response (115).

Regulators of cysteine and methionine biosynthesis (CysB and MetJ) as well as

repressors of amino acid (ArgR) and nucleotide biosynthesis (PurR) were also significantly

affected by furfural addition. The stringent factor, a collective indicator of the stringent response

(a diversion of resources away from growth to amino acid biosynthesis during amino acid and

carbon starvation) also shows activation consistent with stalled biosynthesis and an excess of

many intermediates. Together, these results indicate that the pools of many amino acids and

biosynthetic intermediates have been altered by furfural addition. The fact that expression of

genes concerned with cysteine and methionine biosynthesis increased while expression of other

biosynthesis pathways declined is consistent with a depletion of cysteine and methionine pools

as an early event resulting from a furfural challenge. Histidine may also be limited by the

addition of furfural. Genes (hisA, hisB, hisC, hisD, hisF, hisH, and hisl) under control of the His

regulator (histidinyl-tRNA) were generally increased after the addition of furfural, although less

than 2-fold (Fig. 4-10). The two terminal steps in histidine biosynthesis involve the reduction of

NAD+ to NADH, a reaction that may be slowed by the high NADH/NAD+ ratio associated with

fermentation.

The up-regulation of several glycerol metabolism genes (gIpT and glpD in Figure 4-9,

and gIpF and glpK in Table 4-3) led us to investigate the effect of glycerol supplementation on

furfural tolerance. However, the addition of glycerol (1.0 to 20 g liter1) had no effect on furfural









tolerance (data not included). Several other regulators, includingfis and crp, were found to be

significantly altered by NCA.

Effect of Furfural on Amino Acid Sulfur Assimilation Gene Expression

Genes concerned with sulfur assimilation into cysteine, and methionine are scattered

within several Functional groups (Amino acid, Central metabolism, Regulation, and Transport).

All that were perturbed by 2-fold or greater (Table 4-3) were increased by the addition of furfural

(cysC, cysH, cysl, cysM, cysN, cysQ, metA, metB, metC, metL, sbp, tauA, tauB, tauC and tauD).

Many additional genes involved in sulfur assimilation were also up-regulated less than 2-fold

and have been included to demonstrate the furfural response (Fig. 4-11). Sulfur is supplied as

sulfate in AMI medium and must be reduced to the level of hydrogen sulfide for incorporation,

an energy intensive reaction requiring 4 molecules of NADPH. The furfural-induced increase in

expression of these genes is in sharp contrast to the decreases observed for many other genes

concerned with the biosynthesis of amino acids, purines, and pyrimidines (Table 4-3).

Expression of the taurine transport genes (tauABCD; alternative source of sulfur), the sulfate-

binding transport protein (sbp), and the transcriptional activator of many cysteine biosynthetic

genes were increased by more than 5-fold in response to added furfural. Together, these results

suggest that the addition of furfural results in an intracellular deficit in sulfur-containing amino

acids (cysteine and methionine) which may be associated with the high NADPH requirement in

this pathway.

Effect of Amino Acid Supplements on Furfural Tolerance

All 20 amino acids were individually tested for their ability to improve the growth of

LY180 in AMI mineral salts medium (Fig. 4-12A, 4-12B). A concentration of 0.1 mM was

selected roughly based on the cellular content of individual amino acids (87). Only four amino

acids improved furfural resistance when supplied at this low concentration: cysteine >









methionine > serine, arginine > histidine. The two sulfur amino acids were clearly the most

beneficial for furfural resistance. When supplied at a 5-fold higher concentration (0.5 mM), all

amino acids were beneficial to some degree (Fig. 4-12B). However, cysteine remained the most

effective followed by serine, methionine, and arginine. A cysteine concentration of 0.05 mM

allowed LY180 to grow to a density of 1 g liter- in the presence of 1.0 g liter- furfural,

approximately equal to the total cellular sulfur (Fig. 4-12C). No measurable improvement in

furfural resistance was observed with 0.01 mM cysteine.

I considered the possibility that the protective effect of L-cysteine could result from a

chemical reaction with furfural in AMI medium. However, the protective concentration of

cysteine (0.05 mM) was 200-fold lower than that of 1.0 g litef1 furfural (10 mM) making this

unlikely. Furfural in mineral salts medium can be readily quantified by its characteristic

spectrum (75) and remained unchanged during a 48 hr incubation at 370C, consistent with

minimal chemical reactivity.

The beneficial effects of histidine, serine, and arginine for furfural tolerance are not

immediately apparent. Most genes concerned with histidine biosynthesis increased in response

to furfural addition, although less than 2-fold (Fig. 4-10). De novo biosynthesis of histidine

during fermentation may be constrained by the high NADH/NAD+ ratio during anaerobic growth

and the requirement for further reduction of NAD+ in the two terminal steps of biosynthesis.

Similarly, the first committed step in serine biosynthesis also involves the reduction of NAD+

and may be hindered during fermentation. Increasing serine may also increase the efficiency of

incorporating reduced sulfur from H2S into cysteine. Genes concerned with arginine biosynthesis

(argA, argB,, argC, argD, carA, carB, and argG) were generally lowered by the addition of

furfural. However, the expression level of speA encoding arginine decarboxylase was increased









by the addition of furfural. The degradation of arginine may provide useful intermediates and co-

factors for biosynthesis.

Effect of Alternative Sulfur Sources on Furfural Tolerance

The addition of furfural inhibited growth and increased the transcription of genes

concerned with sulfur assimilation. Genes involved in the uptake and incorporation of the

alternative sulfur compound, taurine (tauABC and tauD), were among the 10 genes with the

largest increases in expression. The tau genes are typically expressed only during sulfur

starvation (125). Since cysteine was effective in relieving furfural inhibition, the increased

expression of these genes can be presumed to result from a reduction in the pool of sulfur amino

acids by furfural. Furfural could inhibit sulfur amino acid biosynthesis either by limiting the

availability of reduced sulfur (H2S) from sulfate or by inhibiting the incorporation of reduced

sulfur into cysteine.

These possibilities were examined during growth in AMI medium containing 1.0 g liter-

furfural by comparing the effects of alternative sulfur sources (L-cysteine, D-cysteine, taurine,

sulfite, and sodium thiosulfate) that enter metabolism at different levels of reduction. Note that 4

NADPH molecules and two reductase enzymes (CysH and CysIJ) are required to fully reduce

sulfate prior to assimilation into cysteine. L-cysteine, D-cysteine and thiosulfate bypass both

reductase enzymes and all were effective at relieving furfural inhibition (Fig. 12D). D-cysteine

cannot be incorporated directly and is first catabolized to H2S. Thiosulfate also serves as a

source of reduced sulfur for incorporation by CysM (69). Taurine is catabolized to sulfite in the

cytoplasm and must be reduced by sulfite reductase (CysIJ and 3 NADPH molecules) prior to

assimilation into cysteine (111). Unlike cysteine and thiosulfate, taurine was not effective in

preventing the inhibition of growth by 1.0 g liter- furfural.

These results with alternative sulfur sources indicate that furfural acts to inhibit growth









by limiting the production of reduced H2S from sulfate rather than by inhibiting the incorporation

of reduced sulfur into cysteine. With taurine as a sulfur source, furfural must act at the level of

sulfite reductase (CysIJ). With sulfate as a sulfur source, further effects of furfural at earlier

steps in anabolism cannot be excluded.

Effect of Increasing Transhydrogenase Expression on Furfural Tolerance

Growth of LY180 is inhibited only while furfural is being metabolized and resumes after

complete reduction to furfuryl alcohol by NADPH-dependent enzymes. Silencing two genes

(yqhD and dkgA) encoding low Km, NADPH-dependent furfural reductases provided resistance

to over 1.0 g liter- furfural. Although furfural may inhibit sulfur amino acid production by

directly affecting enzymes concerned with the conversion of sulfate and sulfite to H2S, it is also

possible that the inhibition of this process results from an indirect effect of furfural on the

availability of NADPH. To test this hypothesis, the two E. coli transhydrogenases (SthA and

PntAB) were cloned into pTrc99a and confirmed by sequencing. The growth ofLY180 was

reduced on plates and in broth by the presence pTrc99a plasmids and antibiotics (antibiotics may

have forced the cells to maintain pTrc99a, depleting the cells of energy for other processes).

SthA is a cytoplasmic transhydrogenase with kinetic characteristics that promote function

primarily in the direction of NADPH oxidation (108). Expression of the sthA gene from a

plasmid did not alter furfural tolerance with or without IPTG induction (Fig. 4-13).

Functionality of the cloned gene was confirmed in vitro. Upon induction with 0.1 mM IPTG,

activity was found to increase from approximately 1.0 nmol min' mg protein' to 18 nmol min'

mg protein-'. PntAB is a proton translocating transhydrogenase that is not known to function

during fermentative growth but is potentially capable of increasing the pool of NADPH (108).

Leaky expression ofpntAB from an uninduced plasmid partially restored growth in the presence

of 1.0 g liter- furfural (Fig. 4-13). Adding IPTG to express higher levels of this enzyme









eliminated resistance to furfural and also inhibited the growth of cells in the absence of furfural.

Based on these results, furfural appears to inhibit growth by depleting the supply of NADPH

needed for biosynthesis. The large requirement of NADPH for sulfate assimilation, 4 per

cysteine equivalent, and the limited routes for NADPH production from xylose during

fermentation appear to have made the production of sulfur amino acids most vulnerable to

competition by furfural reductases for NADPH.

Conclusions

Furfural is a natural product of lignocellulosic decomposition. Furfural is also formed by

the dehydration of pentose sugars during the depolymerization of cellulosic biomass under acidic

conditions (3, 73). This compound is an important contributor to toxicity of hemicellulose

syrups, and increases the toxicity of other compounds (138). Selection for a furfural-resistant

mutant of E. coli during growth in xylose-mineral salts medium resulted in a strain (EMFR9)

with improved resistance to hemicellulose hydrolysate, confirming the practical importance of

this compound.

The ability to reduce furfural into the less toxic furfuryl alcohol is widely distributed in

nature (13). An enzyme has been purified from E. coli that catalyzes this reaction (36) and a gene

that reduces the analogue 5-hydroxymethyl furfural has been identified in S. cerevisiae (5). The

mRNA levels of oxidoreductases were compared in the furfural-resistant mutant EMFR9 and the

parent LY180. Twelve differed by 2-fold or more. Of these, 8 were higher in EMFR9 and 4

were lower in EMFR9. All were cloned and tested either for their ability to confer furfural

tolerance in LY180 or decrease furfural tolerance in EMFR9. None of these gene products

increased furfural tolerance when over-expressed from plasmids. Expression of three genes

(yqhD, dkgA, and yqfA) decreased the furfural tolerance of EMFR9. Contrary to initial

expectations that furfural tolerance would be improved by increased expression of reductase









activity, these results demonstrated that the increased tolerance in EMFR9 results in large part

from gene silencing (yqhD, dkgA) that decreased the level of NADPH-dependent furfural

reductase activities. Deletion of yqhD encoding the lower Km oxidoreductase (NADPH)

increased furfural tolerance in LY180 while deletion of dkgA had no effect. No change in

furfural reductase activity was detected from the over-expression of yqfA and the role of this

gene in furfural tolerance remains unknown. No mutation was found in these genes in EMFR9

and the mechanism of this gene silencing is under investigation.

The yqhD gene has been previously shown to encode an NADPH-dependent aldehyde

oxidoreductase (116) that can be used for the production of propanediol (84, 140). This gene has

also been shown to confer resistance to damage by reactive species of oxygen (97). The dkgA

gene has been shown to catalyze the reduction of 2,5-diketo-D-gluconic acid, a key step in the

production of ascorbic acid (38, 134). This enzyme is also thought to function in the reduction of

methylglyoxal (52, 60). The function of the yqfA gene is unknown but is proposed to be a

membrane subunit of an oxidoreductase that may be involved in fatty acid metabolism (77).

Enzymes encoded by yqhD and dkgA were purified and demonstrated to have NADPH-

dependent furfural reductase activities. Both YqhD and DkgA have low Kms for NADPH that

would allow competition with biosynthetic reactions. This competition for NADPH appears to

be the primary basis for growth inhibition by furfural. Growth of the parent resumed upon

complete reduction of added furfural. Replacing xylose with glucose and adding yeast extract to

xylose medium would be expected to increase the availability of NADPH and both changes

increased furfural tolerance. Deleting yqhD and dkgA in the parent LY180 increased furfural

tolerance, but not to the full extent present in the mutant EMFR9, indicating additional mutations

may also contribute to increased furfural tolerance in EMFR9.









These results show that the low concentration of furfural (up to about 1.5 g liter-) found

in hemicellulose hydrolysates of sugar cane bagasse is not inhibitory to the growth or

fermentation of ethanologenic strain EMFR9. The observed growth inhibition of the parent

LY180 appears to be due to the diversion of NADPH away from biosynthesis by enzymes such

as YqhD and DkgA.

Based on the transcriptional and regulatory changes that were observed in response to the

addition of furfural, a partial response map was assembled (Fig. 4-14). This map combined with

a summary of highly perturbed genes (Table 4-3) allowed the identification of sulfur assimilation

into amino acids as an early site of furfural action. Furfural increased the expression of many

genes and regulators concerned with sulfur assimilation into cysteine and methionine (Figure 4-

9), consistent with deficiency in these sulfur amino acids. In contrast, furfural lowered the

expression of many other biosynthetic genes for building block molecules, consistent with their

excess. Further, the addition of low concentrations (0.1 mM) of cysteine and methionine

relieved growth inhibition by 1.0 g liter- furfural (Fig. 4-12). The minimum effective level of

cysteine (0.05 mM) was similar to the estimated sulfur amino acid content of the cells that grew

in the presence of 1.0 g liter1 furfural.

Previous studies investigated the transcriptional response of E. coli strain K12 to sulfur

limitation during growth in minimal medium. Sulfur limitation was induced by replacing sulfate

with either 0.25 mM taurine or 0.25 mM glutathione (37). In their study, a sulfur limitation

reduced the rate of synthesis of cysteine and methionine and induced oxidative stress.

Interestingly, the sulfur limitation also increased the transcription of cbl and the taurine transport

genes (tauABC), two effects also observed in our furfural response data (Table 4-3).

At low concentrations, serine (a precursor of cysteine), histidine, and arginine were also









effective at reducing furfural inhibition of growth. All amino acids were effective to some extent

when added at a 5-fold higher concentration (0.5 mM). Intracellular pools of histidine and serine

may be limited to some extend during anaerobic growth since both biosynthetic pathways

include reactions that reduced NAD+ to NADH. These reactions may be hindered by the high

NADH/NAD+ ratios typical of fermentation, reducing pool sizes. The beneficial action of

arginine was surprising because expression levels for genes concerned with arginine biosynthesis

(argA, argB,, argC, argD, carA, carB, and argG) were lowered by the addition of furfural,

consistent with an excess of this amino acid. Furfural also increased the expression of arginine

decarboxylase (speA), an enzyme concerned with arginine increasing intracellular pH and

degradation. It is possible that degradation products of arginine increase furfural tolerance.

The inhibition of sulfur amino acid synthesis by furfural was localized to the steps prior

to sulfur assimilation into cysteine (Fig. 4-12). Alternative sulfur sources at differing degrees of

reduction were tested as supplements during growth with furfural (1.0 g liter1) (Fig. 4-12D).

The cytoplasmic degradation of D-cysteine and thiosulfate both provide a source of reduced

sulfur for direct incorporation into cysteine and both relieved the inhibition of growth by

furfural. Taurine is degraded intracellularly to sulfite, a partially reduced sulfur source that needs

further reduction by CysIJ prior to incorporation into cysteine. Unlike thiosulfate, the addition of

taurine had no effect on furfural tolerance despite the high expression levels of genes encoding

taurine transport (tauABC) and degradation (tauD). Together, these results indicate that furfural

inhibits sulfate assimilation by interfering with the reduction of sulfite by CysIJ. Additional

inhibitory effects may also be present at earlier steps and cannot be excluded.

The inhibition of sulfate reduction is unlikely to represent the initial action of furfural that

inhibits growth. Resistance appears to result from the silencing of two NADPH-dependent









enzymes (YqhD and DkgA) that reduce furfural to furfuryl alcohol, a less toxic compound (137,

138). Based on these results, furfural is proposed to inhibit growth by limiting the available

NADPH for biosynthesis. Results from our gene array studies provide further support for this

hypothesis. Sulfate assimilation, the most NADPH-intensive pathway in metabolism, was found

to the most vulnerable site for furfural action. Growth inhibition by 1.0 g liter1 furfural was

relieved by supplying reduced sulfur for amino acid biosynthesis. Many other NADPH-

dependent biosynthetic reactions would also be adversely affected by the NADPH-dependent

reduction of furfural. Supplying reduced sulfur for biosynthesis as well as other building block

metabolites would have a general sparing effect on the NADPH pool, consistent with the general

growth benefit provided by individual amino acids. A direct linkage between furfural inhibition

of growth and NADPH was further demonstrated by expression of the proton-translocating

transhydrogenase, pntAB. Low-level expression of these genes without inducer was shown to

increase furfural tolerance.

Depletion of cysteine and methionine levels by furfural would be expected to initiate a

cascade of cellular events (Fig. 4-14) including stalled ribosomes that trigger a stringent response

(35). The accumulation of other amino acids and nucleotides would activate repressors of

biosynthesis such as ArgR and PurR, and decrease expression of many biosynthetic pathways.

NADPH depletion can also explain the altered activity of ArcA and the resulting expression

increase of TCA-cycle related genes, as ArcAB activity is known to be sensitive to the cellular

redox ratio (127).










Figures and Tables


Table 4-1. Bacterial strains, plasmids, and primers.


Strain, plasmid, or
primer
Strains
LY168


LY180


EMFR9
EMFR9 AyqhD
EMFR9 AdkgA
EMFR9
AyqhD AdkgA
BL21 (XDE3)


E. coli TOP10F'


Plasmids'
PCR 2.1 TOPO


pLOI4301
pLOI4302
pLOI4303
pLOI4304
pLOI4305
pLOI4306
pLOI4307
pLOI4308
pLOI4309
pLOI4310
pLOI4311
pLOI4312
pLOI4313
PLOI4314
pET15b


pKD4
PKD46
pTrc99a
pLOI4315
pLOI4316


Relevant characteristics


frdA::(Zmfrg celYEcFRT) AldhA::FRT AadhE::(Zm frg
estZpp FRT) AackA::FRT rrlE::(pdc adhA adhB FRT)
lacY::FRT AmgsA::FRT,
AfrdBC::(Zmfrg celYEc) AldhA::(Zm frg casABKo)
adhE::(Zm frg estZpp FRT) AackA::FRT rriE::(pdc adhA
adhB FRT) AmgsA::FRT
LY180 improved for furfural tolerance
EMFR9 AyqhD:kan
EMFR9 AdkgA:cat sacB
EMFR9 AyqhD::kan, AdkgA::cat sacB

F ompT gal dcm ion hsdSB(rB- mB) X(DE3 [lacI lacUV5-
T7 gene 1 indl sam7 nin5])

F'ethanol mcrA A(mrr-hsdRMS-mcrBC) (801acZAM15
AlacX74 recAl araD139 A(ara-leu)7697 galU galK rpsL
endAl nupG

bla kan lacZP1ac


yqhD gene in pCR 2.1 TOPO
yjjN gene in pCR 2.1 TOPO
dkgA gene in pCR 2.1 TOPO
yqfA gene in pCR 2.1 TOPO
yajO gene in pCR 2.1 TOPO
ydhUgene in pCR 2.1 TOPO
ydhVgene in pCR 2.1 TOPO
ygcWgene in pCR 2.1 TOPO
nemA gene in pCR 2.1 TOPO
yjgB gene in pCR 2.1 TOPO
ydhS gene in pCR 2.1 TOPO
ydhY gene in pCR 2.1 TOPO
His-tagged yqhD in pET15b
His-tagged dkgA in pET15b
T7 promoter, bla, His-tag vector


FRT kan FRT
Para bla, red recombinase (y,p,exo)
Ptrc bla oriR rmrnB laclq
sthA gene in pTrc99a
pntAB in pTrc99a


Reference of
source

(51, 133)


This study


This study
This study
This study
This study

Promega
(Madison,
WI)
Invitrogen
(Carlsbad,
CA)

Invitrogen
(Carlsbad,
CA)
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
Novagen
(Madison,
WI)
(24)
(24)
(6)
This study
This study










Table 4-1. Continued


Strain, plasmid, or
primer
Primers2 (5' to 3')
yqhD cloning

yjjN cloning

dkgA cloning

yqfA cloning

yajO cloning

ydhU cloning

ydh V cloning

ygc W cloning

nemA cloning

yjgB cloning

ydhS cloning

ydhY cloning

Deletion of yqhD






Deletion of dkgA



yqhD cloning into
pET15b


dkgA cloning into
pET15b


Sequencing yqhD


Relevant characteristics


For-ACATCAGGCAGATCGTTCTC
Rev-CCACAGCTTAGTGGTGATGA
For-GGAGAGCCGAATCATGTCTA
Rev-CCGGAACCTGTCTCAACCAA
For-GCCTGCTCCGGTGAGTTCAT
Rev-CCGGCTCTGCATGATGATGT
For-GCTGGAGAGGTATACATGTG
Rev-GCCGTATTCGCTCGAAGAGT
For-CCGCAGCACATGCAACTTGA
Rev-ATGGCGCTGCCGACCAATGA
For-CCGCATCTGTATCGCCGGTT
Rev-GCCGATGCGAGCATGATTCGT
For-ATTATCGAGTGGAAAGATAT
Rev-CGTAGTCTCCGTTCTGCTTA
For-ACCTTTCTTTTTTTTTGCCT
Rev-TTACGACCGCTGCCGGAATC
For-TTATTGCGACGCCTGCCGTT
Rev-GTTCAATCACCGCTTCTTCG
For-CCTGCCATGCTCTACACTTC
Rev-CTGGTTAGATGGCGACTATG
For-AACTTATCTGATAACACTAA
Rev-CCAACAGCGGCGACAATGTA
For-TCAGGCTGCTGAATTGTCAG
Rev-GGCACCAGATCCAGTTAATG
For-GTTCTCTGCCCTCATATTGGCCC
AGCAAAGGGAGCAAGTAGTGTAGG
CTGGAGCTGCTTC
Rev-GACGAAATGCCCGAAAACGAA
AGTTTGAGGCGTAAAAAGCCATAT
GAATATCCTCCTTA
Outward 1-ACGGTTGGATTAGCCATACG
Outward 2-GACCAGTTCGGCGGCTAACA
For-GCCTGCTCCGGTGAGTTCAT
Rev-CCGGCTCTGCATGATGATGT
For-TGACTCTCGAGATGAACAACTT
TAATCTGCA
Rev-AGTCAGGATCCTTAGCGGGCG
GCTTCGTATA
For-ATATGCCTCGAGATGGCT
AATCCAACCGTTAT
Rev- CCGATAGGATCCTTAGCCGC
CGAACTGGTCAGG
yqhDforl CGGCGAGGTACTGGTGAC
yqhDrevI CATGTTAGCCGCCGAACT
yqhD seql TCATGTTGGCTTCTGCCG
yqhDseq2 GCGCAATCGCTGGTTTAC
yqhDseq3 GTTCCGATGATGAGCGTATTG
yqhD seq4 AGGCGTTTTCGATCAGAAAG


Reference of
source

This study

This study

This study

This study

This study

This study

This study

This study

This study

This study

This study

This study

This study






This study



This study



This study



This study











Table 4-1. Continued
Strain, plasmid, or Relevant characteristics Reference of
primer source
Sequencing dkgA dkgAforl CCAGCAACCGGTTCAGAAT This study
dkgA revI AACGCGTGAAAATAGCGACT

dkgA_seql GCGGTAAAGAGATTAAAAGCGC
dkgA_seq2 TATGGCTAATCCAACCGTTATTAAG
dkgA_seq3 CCCGCCCGTTGTTACTCT
Sequencing of yqfA pcr for: CCATCCGCGACGAGTCTGAA This study
per rev: GGTGAAGCGGAACTGAACAA
seql: CCATCCGCGACGAGTCTGAA
seq2: CGACGCTCTATCACGCCATT
Sequencing ofyjjN pcr_for: TGCGCTGTTTAAGATCGCT This study
pcr_rev CATGATTGCCTTCTCGGG
seql ACTGAGATGATCTCAAGCGATTG
seq2 GGAAACAACGCGAGATACCT
seq3 CCACGCTGGCAGAAACCTA

pntAB cloning For- This study
CTCTCTAAGCTTGCTTGTGTGGCTCCTGACAC
Rev-
CTCTCTAAGCTTGTTCAGTCCTCGCGGCAATC
sthA cloning For- This study
CTCTCTAAGCTTATGTTACCATTCTGTTGCTT
Rev-
CTCTCTAAGCTTGATGCTGGAAGATGGTCACT
The genes inserted into pCR 2.1 TOPO include a native ribosomal binding site and
transcriptional terminator. Expression is from the plasmid promoter (Plac).
2 Orientation of genes cloned into pCR 2.1 TOPO was verified by PCR analysis









Table 4-2. Expression of oxidoreductase genes perturbed by furfural addition.
Effect of over-expression of cloned genes on MIC for furfural
Transcripts that were approximately 2-fold or greater in EMFR9
relative to LY180
Gene Ascension Fold Expression in LY180
number increase
yajO b0419 1.9 No increase in MIC
ydhU b1670 1.8 No increase in MIC
ydhV b1673 2.0 No increase in MIC
ygcW b2774 2.1 No increase in MIC
nemA b1650 4.5 No increase in MIC
yjgB b4269 2.0 No increase in MIC
ydhS b1668 1. 9 No increase in MIC
ydhY b1674 1.9 No increase in MIC
Transcripts that were approximately 2-fold or more lower in
EMFR9 relative to LY180
Gene Ascension Fold Expression in EMFR9
number decrease
yqhD b3011 -48 Reduced MIC
dkgA b3012 -12 Reduced MIC
yjjN b4358 -4.4 No effect on MIC
yqfA b2899 -2.5 Reduced MIC
















Table 4-3. Gobal comparison of genes perturbed by furfural addition.


Differentially
Functional group Total regulated (no, %) Downregulated Upregulated


Amino acid biosynthesis and metabolism

Biosynthesis of cofactors, prosthetic
groups and carners


Carbon compound metabolism

Cell processes (ncl adaptation,
protection)


Cell structure


Central intermediary metabolism

DNA replication, recombination,
modification and repair


Energy metabolism


Fatty acid and phospholipid metabolism


Nucleotide biosynthesis and metabolism


Phage/IS


123 28,227


120 8,67


133 12,9


198 29, 146


114 8,70


162 27, 167


105 5,48


139 14, 101


42 3, 71


62 13,21


295 6, 2


Putative


Regulatory function

Transcription, RNA processing and
degradation

Translation, post-translational
modification





Transport


Unclassified






Unknown

Total


102, 87


18, 71


2, 33


8,43





69, 195


3, 21 4






57, 85

412, 98


argC, aroL, argA, tyrB, asnA argD, thrA, /vD,
trpD, argB, trpE, thrC, ivA, argG, aroH, thrB,
sdaB, dapB, ilvM, ivC


cysM, metC, IdcC, dadX, metA, metB, metL,
dadA


pdxA, ubiX, folC, bioD idi, trxC, pabC, ybdK

xdhB, acnB, gcd, xdhA amyA, dhaK, aldB, dhaL,
ygjG, fucO, treF, tauD

fliQ, fliJ fliE, fliP, fliL, fK, f liF, fiG, fliH, cspA, fliN, ibpA, yfiA, otsA osmC, sodC, hchA fic, b4411,
flgJ, ymcE, lpxP, flgK, fliO, fgH, flgL osmY, yqhD, nemA


mreC, mreD, rfaC, fliS, etk, yeiU, lpxB ybhO
poxB, cysQ, gabD, cysN, mqo, acnA, cysC,
aceB, aceA, cysl, cysH, dcyDaldA, gloA, g/pK
pykF, fumB, tktA, pyrH, ppa fumA, gIpD, sdhB, sdhC, sdhA sdhD, dkgA


rnhB, fliA, recG yjiD, aidB

cyoE, frmA, aceE, aceF, fdoH, fdoG, cyoD, cyoB,
hypC, ackA, hypB, atpC cyoA, cyoC


accC, accB fadl

pyrB, purE, carA, pyrD, purH, guaB, purF, purN,
purK, purD, carB, pyrE xdhC


ydfK, ynaE, cspB, cvpA cspl, ynfN

ycbB, paaY yjgH, ybiC, yeaQ, yecC, yqgD, ydjN,
yhbW, ybaT yagT yehZ, yfcG, ymgE, yhbO,
ygcE, yedY, sfsA, ydgD, nanK, yjiA, yohJ, yhiP,
ydcO, yiaG, yigM, yhjG, ydcN, yqfA, dhaM, ygeV,
ybaS, ydcT ynfM, ygiV, nanE, yqaE, yqeF, yfdY,
mltD, ydjH, fliR, yqel, yjP, ydjl, bioC, ynjE, yibK, yniA, ydcS, yncG, maeB, ybhP, ygaW, ybdH,
ydjJ ydjZ, ynjC, ykgK, flhA, dctR, yhgF, yejM, yohF, yhcO, ydcK, yddV, yclW, yeiA, sufB, ybeM,
ybjE, yfcC, ydgR, figl, sdaC, yhiD, ybhA, ecfG, yohC, ychH, yeT, yeeE, yhdW, yjfF, uspB, ytfT,
yibQ, ynjl, yliF, yliE, ydjK yjjB, yibA,yedV gIgS, yqhC, b4485, cstA, ytfQ, ydhM, yjiX

rssB, sbmC, sdiA, pdhR, crl, bolA, hcaR, metR,
adiY, evgS, cspG, suhB, cadC, flhC, fis phoU, galS, cbl


trmH, xseB


truC, rpsT, etp, rpsA msrB, msrA, cIpA, pphA
xylE, gabP, manX, nagE, araF, sufD, sufC, mntH,
artM, nikB, nikA, lysP, proV, artP, proW, nikD, ivH, kgtP, cysA, ssuC, blc, gItJ, cycA, yahN,
nikC, thiP, tyrP, proX, hisP, aroP, artl/, hisJ, nikE, pstA, pstC, g/pT glpF, argT, ssuA, pstB, g/tK, gItl
artQ, cusB, btuF, artJ, ampG, cusA, mtr dcuC, b4460, mtlA, pstS, narU, mdtM, sufA, dctA, mglC
narK, pitA, hisM, emrA, thiQ mglA, sbp, mglB, tauA, tauB, tauC


ssuD, ssuE, ybdL
yccT, ybiJ, yjdl, yahO, yjdN, yhcN, ybaA, yedK,
yqjD, eutQ, ybgS, yhhA, ompW, yhjY, yghX,
yqeB, rtcB, ygaU, erfK, yegS, yeeD, yhcH, ydhS,
yegP, yebV, yjfN, yehE, ydcJ, ygaM, yqeC, ybiL,
yiiQ, intG, fhE, ymdA, ynjB, ydjY, yeeN, ymcA, psiF, yhfG, yjfO, nIpA ybeH, ynhG, ycfR, yjiY,
yibL, yghG, b1172, yjaH yodD, csiD, yeaH,yedP, yeaG, ycgB











Table 4-4. Regulators perturbed by furfural addition.
Perturbation
Regulator direction Description Activation mechanism


ArcA

ArgR

BirA

CRP

CysB

DcuR

FIS

FlhDC

FliA


his


M etJ

NagC

PdhR

PhoB

PhoP

PurR

RpoH

RpoN

RpoS

FRtR

SF


down aerobic respi ration control

up repressor of arginine biosynthess

up repressor of biotin biosynthesis

global regulator of catabolit e-
sensitive operons

up regulator of cyst e in e biosynthesis

act iv at or of genes involved in C-4
unclear
dicarboxylate metabolism
global regulator associated with
down
nutritional upshift

down master motility regulator

minor sigmafactor, regulates
down
motility-associated genes
histidine, regulateshistidine
up biosynthesisviatranscriptional
att en u at ion
down repressor of methionine
down
biosynthesis
down coo r din ate sb i o synthe si s and
down
catabolism of amino sugars
repressor of pyruvate
dehydrogenase complex
regulator of i organic phop hate
uptake
regulator of divalent cation
starvation response
repressor of purine nucleotide
biosynthesis

up heatshodt sigmafactor

up nitrogen-related sigmafactor
general stress response sigmna
Fact or
proposed repressor ofpyrimidine
degradation

up lumped 'stringent factor"


p ho sph o ryl at i on by A rcB

binding of L-arginine

bindingofbio-5'-AM P

bindingofcAM P

b i n di n g of 0 -acety I-L-se ri n e

p ho sph o ryl at ion by DcuS

inherently active

[FlhD]4[Flhq2

inherently adive


inherently active


bindingof S-adenosyl-methi'

binding of GlcNAc-6-P

absence of binding by pyruva

p ho sph o ryl at ion by PhoR

p ho sph o ryl at ion by PhoQ

binding of hypoxanthine

inherently adive

inherently active

multiple mechanisms

unknown

amino add starvation













7acZ 8'ac Y 8acA cynX'


4,082 bps, Accession No. FJ404781


frdC'


sacB


3,621 bps, Accession No. FJ387231


'frdA


ZMpomo celY 'd(


3,151 bps, Accession No. FJ404780


D

dhA' cat sacB casA casB 7dhA



6,962 bps, Accession No. FJ404782


E

IdhA' casA'
Zm frg


1,960 bps, Accession No. FJ404783

Figure 4-1. Linear DNA fragments used in construction of LY180.


arbb ~aB~a~iH~a~aB~ ~ssmsssa~sssmsssa~sssmsssas~ ~ssl


lacZ


lacY


lacA


cynX'

























0 10 2D 3 to 50
Time (days)


-10



50 60 70 80
Ti me (days)


80 90 100 110 120
Time (days)


0 10 20 39 40 50
Time (days]


Time (days)


0 10 20 30
Time (days)


10 sD


Time (days)


Time (days)


SO 50 70
Ti me (days)


80 90 100 110 120
Time fdavs)
50

40





10

0
80 90 100 110 120
Time (days)

025-

020- .- .....

*B 0.15-

0 .10

0O05-


8s 90 10o lio 120
Time (days)


Figure 4-2. Directed evolution of E. coli for furfural tolerance. Cultures were grown

anaerobically in 100 g liter-1 xylose and AMI minimal media to 1-4 OD and

transferred to fresh media with increasing initial furfural concentrations as tolerance

to furfural increased. pH was maintained at 6.5 by automatic addition of 2N KOH.

Ethanol production, cell density, and KOH addition were measured at 0, 24, 48, and

72 hrs for each transfer.


S30

20

10





030

025

020

0.15

S0.10
0 Jl5


030

025

* 020

l 0.15

S0.10
0 fl






























0 12 24 36 48 60 72
Time (h)

B


0 12 24 36 48 60 72
Time (h)
C













0 12 24 36 48 60 72
Time (h)


1U


E
S0.1-
u.


-U------

0 12 24 36 48 60 72
Time (h)

E


01--u-M---.----- ------------- M.. I
0 12 24 36 48 60 72
Time (h)
F


I


1.00-

S0.75-

S0.50-

0.25-

0.00-


EL









0 12 24 36 48 60 72
Time (h)


Figure 4-3. Tolerance of furfural resistant strain EMFR9 versus LY180. Effect of furfural on pH-

controlled fermentation of 100 g liter' xylose. Fermentation with 0.4 g liter' furfural

(A, B, and C). Fermentations with 1.0 g liter' furfural (D, E, and F). For clarity, data
for EMFR9 and LY180 are connected by solid and broken lines, respectively.

Symbols for all: m, LY180 with furfural; A, EMFR9 with furfural; D, LY180 without

furfural; and A, EMFR9 without furfural.


U)
U)
E
* 0.1-
C)


,40-

= 30-

5 20-
-
S10-

0-






0.4-

S0.3-

0.2-

0.1-
0.0-
0.0-


bU
















2.0- \2.0- 2.0 ....
1.5- \ 1.5- \ .
t o*1.5 -o to



0.0 0.5 1.0 1.5 2.0 2.5 0.0 0.5 1.0 1.5 20 2.5 0 0 0. 5 10 15 20 25
Furfural (g liter 1) Furfural (g liter 1) Furfural (g liter 1)



Figure 4-4. Effect of media composition on furfural tolerance. A. AMI medium containing
xylose (50 g liter-'); B. AMI medium containing glucose; C. AMI medium
containing xylose and yeast extract (1.0 g liter1); Symbols for all: m, LY180 (dashed
line); and A, EMFR9 (solid line) after incubation for 48 hours.



A B


Furfural (g liter 1) Furfural (g liter 1)
C D
-----------------2 r--------------


Furfural (g liter 1)


0.0 0.5 1.0 1.5 2.0
Furfural (g liter )


Figure 4-5. Effect of oxidoreductase expression on furfural tolerance. In EMFR9, A. Expression
of dkgA; B. Expression of yqhD; C. Expression of yqfA; D. Expression ofyjjN.
Symbols for all: *, pCR2.1 control without insert; D, uninduced expression; A,
expression induced with 0.1 mM IPTG.












0.06-
o _--
* 0.05-
a 0.04-
10 E
''- 0.03-
4--a
>2 E 0.02-

E 0.01-
^


. 0.;

0.
0.

C)


E 0.

0.
oE 0
E 0.(


nE]


B
25-

20-

15-

10-

05-
, I F7_ _


S o"
0
cc^i


Figure 4-6. In vivo and in vitro furfural reduction comparison. A. In vivo activity of whole cells
during fermentation. LY180 and deleted derivatives are shown as open bars. The
furfural-resistant mutant, EMFR9 and EMFR9 (pLOI4301) expressing yqhD are
shown as shaded bars. B. Comparison of in vitro furfural-reducing activities in cell-
free extracts of EMFR9 harboring plasmids expressing cloned genes (forward
direction, induced with 0.1 mM IPTG).


[


J l-
















0)
S0.50-

U)
U)
E 0.25-

0)

0.00-


0.0 7


ANL ^ .


K
A
V <


Figure 4-7. Effect of yqhD and/or dkgA deletion on furfural tolerance. Growth after 48 hr
incubation in the presence of 1.0 g liter' furfural.


10-
L
ro
o 5-


0-


0 10 20 30
Hemicellulose Hydrolysate (%)


0 10 20 30 40
Hemicellulose Hydrolysate (%)


Figure 4-8. Growth in hemicellulose hydrolysate. Growth (A) and ethanol production (B) of
LY180 (i) and EMFR9 (A).






















81


99










ackA


lA D m 'c--mgL aigAC -4.
ADcuR Ayd gAtB
ALt4C n4acA s.pD st ch \




















identified by NCA with a P-value cutoff of 0.05 relative to a null distribution.
V al... O m.r EH
^dtc' A< -..........^ j "
























dashed lines indicate repression. Because the direction of perturbation for DcuR is
u nuclear, this regulator is shown in gray.
__flUDEFL argA C ^^

nrMC wIgE ioZDC pstS cMI taiLA








Figure 4-9. Partial regulatory response ofLY180 to furfural. Response map following challenge
with 0.5 g liter-' furfural. Regulatory genes that were significantly perturbed were
identified by NCA with a P-value cutoff of 0.05 relative to a null distribution.
Regulators with increased activity are shown in red with a solid border, regulators
with decreased activity are shown in green with a dashed border. Regulators that
showed a mixed activity are shown in grey. Representative genes that were perturbed
greater than 2-fold are shown, with red (green) indicating genes with increased
(decreased) expression. Solid lines indicate activation by the connected regulator,
dashed lines indicate repression. Because the direction of perturbation for DcuR is
unclear, this regulator is shown in gray.









phospho ribosyl-1-ribophosphate
psTPr hisG(-1.247)
phospho ribosyl-ATP
hisI (1.537)
phospho ribosyl-AMP
4 hisl( 1.537)
phospho ribosylformiminoAI CAR-phosphate
[ hisA (1.727)
phospho ribulosylforminino-AI CAR-P
his F (1.576),his H(1.375)
D-erythro-imidazole-glycerol-phosphate
mainimiaa crutcmiaidenbahfira & L.-gOfmat A hisB (1.382)
imidazole-acetol-phosphate
L-ilamt I
2a-acogman his C (1.386)
L-histidinol-phosphate
hisB (1.382)
NA histidinol
NAD 2 hisD (1.498)
histidinal
NAD ^hisD (1.498)
L-Histidine

Figure 4-10. Histidine pathway genes perturbations upon furfural addition. Changes in gene
transcipt levels in LY180 upon addition of 0.5 g liter- furfural as determined by
microarray analysis are listed quantitatively beside the corresponding gene.










Aspartate
metL
lysC
s NADPH
asd
thlrA V NADPH
t metA metB
homoserine y r
thrB sucCoA CoA suc

Threonine
ilvA
ilvM
ilvN ilvB


5,10-mTHF gIyA IPdA
NADPH \V r gcvPHT
5-mTHF THF metext
malY metNIQ
metC / mtH
Po hey E ethionine
p y r M M--
SmmuM
SMLM


4ivH ilv Cysteine
acetohydroxybutarate ace NADPH
ilvC cysMK O 2 cysH cysCND cysAWUP sbp
r NADPH A cyslJ 4 4 ext
ilvD S2032- tauD reduced
{ WE O-acetyl-L-serine thioredoxin (regenerated by 1 NADPH)
glu IGysE taurine4---- taurineext
Isoleucine Serine

Figure 4-11. Cysteine and methionine pathway gene perturbations upon furfural addition.
Furfural increased expression of most genes concerned with sulfur assimilation into
cysteine and methionine. Pathways for the synthesis of threonine and isoleucine from
aspartate are included for comparison. Genes up-regulated by 1.5-fold or greater are
shown in red. Genes down-regulated by 1.5-fold or greater are shown in green. All
others are shown in black.















1.2

1.0-

S0.8-

0.6-

E 0.4-

S0.2

0.0*-mm nnnnri inni


2 c ; 5
L)> E :E ', (L e
CL LM0-


2.0


1.5-


1.0-


0.5-








1.0









0.5


n n


I I


cP


I
e`E


Figure 4-12. Supplementation with specific metabolites increases furfural tolerance. Cultures
were compared after incubation for 48 hrs (AMI medium, 50 g liter' xylose, 1.0 g
liter' furfural, 370C). A. Addition of individual amino acids (0.1 mM each). B.
Addition of individual amino acids (0.5 mM each). C. Addition of cysteine. D.
Addition of alternative sulfur sources.











u I I


0.6-


2 0.4-
U)
a 0.3-

0.2-
o 0.1-
oko- r<,* r/6-l 'A,



,0








Figure 4-13. Effect of increased transhydrogenase expression on furfural tolerance. Cultures
were grown for 48 hrs in AMI minimal media containing 50 g liter- xylose and 1.0 g
liter- furfural. The empty vector served as a control. Inducer was added prior to
inoculation.
o" o <<2> <0 x <>













inoculation.















altered
furfurall red ox
ratio insufficient
So42- NADPH for
YqhD NADPH cys/met
DkgA biosynthesis

furfuryl H2S 40
alcohol c OALS

stalled cys/met cysteine
Translation depletion homoserine



Sbiosynthesis methionine
intermediate
accumulation SAM







Figure 4-14. Model of furfural challenge. Regulators with increased activity are shown in red
with a solid border, regulators with decreased activity are shown in green with a
dashed border. The addition of furfural induces two NADPH-dependent reductases
(yqhD and dkgA) that inhibit growth by out-competing essential biosynthetic
reactions. Assimilation of sulfur into amino acids requires 4 NADPH per cysteine
and appears to be the most vulnerable of these biosynthetic reactions. Secondary
consequences from furfural addition include depletion of sulfur amino acids and a
cascade of events from stalled translation and accumulation of many non-sulfur
building block intermediates to a more general stress response.









CHAPTER 5
GENERAL CONCLUSIONS AND FUTURE DIRECTIONS

General Accomplishments

Engineering tolerance of E. coli to hemicellulose hydrolysate inhibitors was conducted by

focusing separately on osmotic stress and chemical stress. E. coli was previously made to

produce an increased level of trehalose by transposon insertion of Ptac-otsBA and deletion of

treA, treC, and treF (strain JP20) (103). JP20 exhibited increased tolerance to sugars (glucose,

xylose), salt (sodium chloride), and organic acids (lactate, succinate) compare with parent strain

W3110. W3110 grown with ImM betaine also displayed increased tolerance to glucose, xylose,

sodium chloride, lactate, and succinate compared to W3110 without betaine. Overexpressing

trehalose during growth with betaine led to a greater benefit than either osmoprotectant could

provide alone in the cases of glucose, xylose, and sodium chloride.

In order to determine if the benefit of increased trehalose production on osmotolerance

extended to desiccation survival, three strains with transposon inserted Ptac-otsBA were tested,

EM2P (an ethanol producing KO 11 derivative), EM2L (an ethanol producing LY163 derivative),

and EM2T (a lactate producing TG106 derivative). In all cases, increased expression of the

trehalose producing genes otsBA promoted survival during desiccation. Growth sugar was also

found to impact survival, with survival during growth in xylose < glucose < mannose < fructose

< arabinose < lactose
harvesting prior to desiccation, and harvesting cells during mid-log phase when over-producing

trehalose and growing on sucrose together resulted in a combined benefit, leading to survival

levels as high as 80%. Desiccation did not impact the growth or fermentation of rehydrated

cells.









Furfural is one of the most significant chemical inhibitors present in hemicellulose

hydrolysate (39, 48, 73, 82, 138). A furfural tolerant E. coli was developed by growing and

transferring ethanologenic strain LY180 in fermentation vessels containing furfural. The furfural

tolerant strain (designated EMFR9) was shown to have a MIC towards furfural of 2.0 g liter1,

twice that of LY180. EMFR9 grew and reduced furfural simultaneously, whearas LY180 would

only grow after all furfural had been removed from the media. On a dcw basis, EMFR9 reduced

furfural at a lower rate than the parent. Growing cultures in glucose improved furfural tolerance

for LY180, and to a lesser extent EMFR9, compared to growth on xylose. Addition of yeast

extract to xylose grown cultures increased furfural tolerance of LY180, making it nearly as

tolerant as EMFR9. EMFR9 displayed an increased ability to grow in sulfuric acid treated

hemicellulose hydrolysate compared to LY180.

An NADPH dependent furfural reductase had previously been isolated in E. coli (36),

although a corresponding gene could not be determined. Messanger RNA microarray with

EMFR9 and LY180 was conducted, comparing genes transcript levels of cultures grown to 2 OD

before and 15 minutes after furfural addition. 8 known or putative oxidoreductases had at least 2

fold higher transcript levels in EMFR9 than LY180, while 4 displayed at least 2 fold lower

transcript levels in EMFR9 than LY180. Cloning the 8 genes into LY180 did not increase

furfural tolerance, but cloning the 4 genes into EMFR9 reduced furfural tolerance in the cases of

yqfA, yqhD, and dkgA. Deletion of yqhD from LY180 increased furfural tolerance, but deletion

of dkgA yielded no effect. By testing purified histidine tagged protein, YqhD and DkgA were

both shown to have NADPH dependent furfural reductase activity with a low Km for NADPH.

Microarray analysis revealed an increase in transcript abundance of genes related to

cysteine and methionine biosynthesis. 4 NADPH are required to reduce sulfate so that it can be









incorporated into cysteine, but in the presence of furfural this pool is redirected to forming

furfuryl alcohol. Addition of 500 uM alternative sulfur sources that require less NADPH to be

incorpated than sulfate (L-cysteine, D-cysteine, sodium thiosulfate) increased furfural tolerance

of LY180 but did not affect EMFR9. Histidine biosynthesis gene transcript levels also increased

in LY180 upon furfural addition. Growth of LY180 separately in 100 uM of each of 20 amino

acids revealed a benefit from cysteine, methionine, serine, histidine, and arginine. Increasing

amino acid concentrations to 500 um led to a more generalized benefit. Finally, over-expression

of the transhydrogenasepntAB in LY180 led to an increase in furfural tolerance. Taken together

it appears that NADPH dependent furfural reduction by YqhD and DkgA competes for NADPH

pools required for biosynthesis of cysteine, resulting in a stringent response which prevents cell

growth.

Future Works

In addition to furfural, other significant inhibitors are present in hemicellulose

hydrolysate that interfere with the growth of fermenting organisms. Acetate is one such

compound, an organic acid that is released from the cleavage of hemiacetyl groups (136). It has

the ability to collapse the proton motive force of the cell, preventing growth and fermentation

(136).

Acetate has been shown to impact cellular transcipt levels in E. coli including rpoS (7), a

sigma factor important in general stress response. E. coli tolerant to acid (112) and acetate (41)

have been evaluated, but the specific mechanisms that convey this tolerance remain unknown. A

segment of cbpA from E. coli that encodes a 24 amino acid proton buffering peptide was cloned

into Z mobilis, increasing tolerance to both hydrochloric acid and acetic acid (10). In addition,

the ABC acetate transporter AatA from Acetobacter aceti when cloned into E. coli conveyed











acetate resistance (86). Furthermore, increased expression of aconitase from A. aceti led to

increased acetate tolerance (85). This illustrates that bacteria already have strategies for coping

with acetate, which may be used as a platform for further increasing tolerance.

As with the engineering of furfural tolerance, acetic acid tolerance might be developed by

selectively evolving through continual transfers in the presence of acetate. Microarray analysis

can then be preformed in the presence and absence of acetate, and perturbed genes can be

expressed or deleted. Single Nucleotide Polymorphism analysis can also be implemented in

order to directly determine the location of mutations within the chromosome. These mutations

can be transferred into a clean genetic background using the parent organism, and resistance to

acetate can be determined.









LIST OF REFERENCES


1. Agbogbo, F. K., and G. Coward-Kelly. 2008. Cellulosic ethanol production using the
naturally occurring xylose-fermenting yeast, Pichia stipitis. Biotechnology Letters
30:1515-1524.

2. Agrawal, A. 2003. Advances in the production of poly(lactic acid) fibers. A review. J.
Macromol. Sci. Polym. Rev. 4:479-503.

3. Almeida, J. R. M., M. Bertilsson, M.F. Gorwa-Grauslund, S. Gorsich, G. Liden.
2009. Metabolic effects of furaldehydes and impacts on biotechnological processes.
Appl. Microbiol. Biotechnol. 82:625-638.

4. Almeida, J. R. M., T. Modig, A. Petersson, B. Hahn-Hagerdal, G. Liden, and M. F.
Gorwa-Grauslund. 2007. Increased tolerance and conversion of inhibitors in
lignocellulosic hydrolysates by Saccharomyces cerevisiae. J. Chem. Technol. Biotechnol.
82:340-349.

5. Almeida, J. R. M., A. Roder, T. Modig, B. Laadan, G. Liden, and M. F. Gorwa-
Grauslund. 2008. NADH- vs NADPH-coupled reduction of 5-hydroxymethyl furfural
(HMF) and its implications on product distribution in Saccharomyces cerevisiae. Appl.
Microbiol. Biotechnol. 78:939-945.

6. Amann, E., B. Ochs, and K. J. Abel. 1988. Tightly regulated tac promoter vectors
useful for the expression of unfused and fused proteins in Escherichia coli. Gene 69:301-
15.

7. Arnold, C. N., J. McElhanon, A. Lee, R. Leonhart, and D. A. Siegele. 2001. Global
analysis of Escherichia coli gene expression during the acetate-induced acid tolerance
response. J. Bacteriol. 183:2178-2186.

8. Asghari, A., R. J. Bothast, J. B. Doran, and L. 0. Ingram. 1996. Ethanol production
from hemicellulose hydrolysates of agricultural residues using genetically engineered
Escherichia coli strain KO 11. J. Indust. Microbiol. 16:42-47.

9. Barciszewski, J., G. E. Siboska, B. 0. Pedersen, B. F. C. Clark, and S. I. S. Rattan.
1997. A mechanism for the in vivo formation of N-6-furfuryladenine, kinetin, as a
secondary oxidative damage product of DNA. FEBS Lett. 414:457-460.

10. Baumler, D. J., K. F. Hung, J. L. Bose, B. M. Vykhodets, C. M. Cheng, K. C. Jeong,
and C. W. Kaspar. 2006. Enhancement of acid tolerance in Zymomonas mobilis by a
proton-buffering peptide. Appl. Biochem. Biotechnol. 134:15-26.

11. Billi, D., D. J. Wright, R. F. Helm, T. Prickett, M. Potts, and J. H. Crowe. 2000.
Engineering desiccation tolerance in Escherichia coli. Appl. Environ. Microbiol.
66:1680-1684.









12. Blumer-Schuette, S. E., I. Kataeva, J. Westpheling, M. W. W. Adams, and R. M.
Kelly. 2008. Extremely thermophilic microorganisms for biomass conversion: status and
prospects. Curr. Opin. Biotechnol. 19:210-217.

13. Boopathy, R., H. Bokang, and L. Daniels. 1993. Biotransformation of Furfural and 5-
Hydroxymethyl Furfural by Enteric Bacteria. J. Indust. Microbiol. 11:147-150.

14. Boos, W., U. Ehmann, E. Bremer, A. Middendorf, and P. Postma. 1987. Trehalase of
Escherichia-Coli Mapping and Cloning of Its Structural Gene and Identification of the
Enzyme as a Periplasmic Protein-Induced under High Osmolarity Growth-Conditions. J.
Biol. Chem. 262:13212-13218.

15. Boscolo, R., C. Sabatti, J. C. Liao, and V. P. Roychowdhury. 2005. A generalized
framework for Network Component Analysis. IEEE-ACM Trans. Comput. Biol.
Bioinform. 2:289-301.

16. Carapito, R., C. Carapito, J. M. Jeltsch, and V. Phalip. 2009. Efficient hydrolysis of
hemicellulose by a Fusarium graminearum xylanase blend produced at high levels in
Escherichia coli. Bioresour. Technol. 100:845-50.

17. Causey, T. B., K. T. Shanmugam, L. P. Yomano, and L. 0. Ingram. 2004.
Engineering Escherichia coli for efficient conversion of glucose to pyruvate. Proc. Natl.
Acad. Sci. USA 101:2235-40.

18. Causey, T. B., S. Zhou, K. T. Shanmugam, and L. 0. Ingram. 2003. Engineering the
metabolism of Escherichia coli W3110 for the conversion of sugar to redox-neutral and
oxidized products: homoacetate production. Proc. Natl. Acad. Sci. USA 100:825-32.

19. Cayley, S., B. A. Lewis, and M. T. Record. 1992. Origins of the Osmoprotective
Properties of Betaine and Proline in Escherichia Coli K-12. J. Bacteriol. 174:1586-1595.

20. Cayley, S., and M. T. Record. 2003. Roles of cytoplasmic osmolytes, water, and
crowding in the response of Escherichia coli to osmotic stress: Biophysical basis of
osmoprotection by glycine betaine. Biochemistry 42:12596-12609.

21. Cheng, K. K., B. Y. Cai, J. A. Zhang, H. Z. Ling, Y. H. Zhou, J. P. Ge, and J. M. Xu.
2008. Sugarcane bagasse hemicellulose hydrolysate for ethanol production by acid
recovery process. Biochem. Engin. J. 38:105-109.

22. Crowe, J. H., F. A. Hoekstra, and L. M. Crowe. 1992. Anhydrobiosis. Annual Review
of Physiology 54:579-599.

23. Csonka, L. N. 1989. Physiological and Genetic Responses of Bacteria to Osmotic-Stress.
Microbiol. Rev. 53:121-147.









24. Datsenko, K. A., and B. L. Wanner. 2000. One-step inactivation of chromosomal genes
in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97:6640-6645.

25. de Castro, A. G., H. Bredholt, A. R. Strom, and A. Tunnacliffe. 2000. Anhydrobiotic
engineering of gram-negative bacteria. Appl. Environ. Microbiol. 66:4142-4144.

26. Dehority, B. A., 0. G. Bentley, R. R. Johnson, and A. L. Moxon. 1957. Isolation and
Identification of Compounds from Autolyzed Yeast, Alfalfa Meal, and Casein
Hydrolysate with Cellulolytic Factor Activity for Rumen Microorganisms Invitro. J.
Anim. Sci. 16:502-514.

27. Deshpande, S. K., M. G. Bhotmange, T. Chakrabarti, and P. N. Shastri. 2008.
Production of cellulase and xylanase by Trichoderma reesei (QM 9414 mutant),
Aspergillus niger and mixed culture by solid state fermentation (SSF) of water hyacinth
(Eichhornia crassipes). Indian J. Chem. Technol. 15:449-456.

28. Dombek, K. M., and L. 0. Ingram. 1986. Determination of the Intracellular
Concentration of Ethanol in Saccharomyces Cerevisiae during Fermentation. Appl.
Environ. Microbiol. 51:197-200.

29. Dombek, K. M., and L. 0. Ingram. 1984. Effects of Ethanol on the Escherichia Coli
Plasma-Membrane. J. Bacteriol. 157:233-239.

30. Felitsky, D. J., J. G. Cannon, M. W. Capp, J. Hong, A. W. Van Wynsberghe, C. F.
Anderson, and M. T. Record. 2004. The exclusion of glycine betaine from anionic
biopolymer surface: Why glycine betaine is an effective osmoprotectant but also a
compatible solute. Biochemistry 43:14732-14743.

31. Formanek, J., R. Mackie, and H. P. Blaschek. 1997. Enhanced Butanol Production by
Clostridium beijerinckii BA101 Grown in Semidefined P2 Medium Containing 6 Percent
Maltodextrin or Glucose. Appl. Environ. Microbiol. 63:2306-2310.

32. Frazer, F. R., and T. A. Mccaskey. 1989. Wood Hydrolyzate Treatments for Improved
Fermentation of Wood Sugars to 2,3-Butanediol. Biomass 18:31-42.

33. Gama-Castro, S., V. Jimenez-Jacinto, M. Peralta-Gil, A. Santos-Zavaleta, M. I.
Penaloza-Spinola, B. Contreras-Moreira, J. Segura-Salazar, L. Muniz-Rascado, I.
Martinez-Flores, H. Salgado, C. Bonavides-Martinez, C. Abreu-Goodger, C.
Rodriguez-Penagos, J. Miranda-Rios, E. Morett, E. Merino, A. M. Huerta, L.
Trevino-Quintanilla, and J. Collado-Vides. 2008. RegulonDB (version 6.0): gene
regulation model of Escherichia coli K-12 beyond transcription, active (experimental)
annotated promoters and Textpresso navigation. Nucl. Acids Res. 36:D120-D124.









34. Gorsich, S. W., B. S. Dien, N. N. Nichols, P. J. Slininger, Z. L. Liu, and C. D. Skory.
2006. Tolerance to furfural-induced stress is associated with pentose phosphate pathway
genes ZWF], GND1, RPE1, and TKL1 in Saccharomyces cerevisiae. Appl. Microbiol.
Biotechnol. 71:339-349.

35. Gralla, J. D. 2005. Escherichia coli ribosomal RNA transcription: regulatory roles for
ppGpp, NTPs, architectural proteins and a polymerase-binding protein. Mol. Microbiol.
55:973-977.

36. Gutierrez, T., L. 0. Ingram, and J. F. Preston. 2006. Purification and characterization
of a furfural reductase (FFR) from Escherichia coli strain LYO1 An enzyme important
in the detoxification of furfural during ethanol production. J. Biotechnol. 121:154-164.

37. Gyaneshwar, P., 0. Paliy, J. McAuliffe, D. L. Popham, M. I. Jordan, and S. Kustu.
2005. Sulfur and nitrogen limitation in Escherichia coli K-12: Specific homeostatic
responses. J. Bacteriol. 187:1074-1090.

38. Habrych, M., S. Rodriguez, and T. D. Stewart. 2002. Purification and identification of
an Escherichia coli beta-keto ester reductase as 2,5-diketo-D-gluconate reductase YqhE.
Biotechnol. Prog. 18:257-261.

39. Hadi, S. M., Shahabuddin, and A. Rehman. 1989. Specificity of the Interaction of
Furfural with DNA. Mut. Res. 225:101-106.

40. Hahn-Hagerdal, B., M. Galbe, M. F. Gorwa-Grauslund, G. Liden, and G. Zacchi.
2006. Bio-ethanol--the fuel of tomorrow from the residues of today. Trends Biotechnol
24:549-56.

41. Han, Y., Z. M. Li, P. Du, R. B. Gan, and Q. Ye. 2007. Production of human epidermal
growth factor in fed-batch culture of acetate-tolerant Escherichia coli. Chin. J. Chem.
Engin. 15:760-764.

42. Hao, X. Y., W. Zhou, J. W. Wang, Y. Q. Zhang, and S. X. Liu. 2005. A novel catalyst
for the selective hydrogenation of furfural to furfuryl alcohol. Chem. Lett. 34:1000-1001.

43. Hayward, T. K., J. Hamilton, D. Templeton, E. Jennings, M. Ruth, A. Tholudur, J.
D. McMillan, M. Tucker, and A. Mohagheghi. 1999. Enzyme production, growth, and
adaptation of T. reesei strains QM9414, L-27, RL-P37, and Rut C-30 to conditioned
yellow poplar sawdust hydrolysate Scientific note. Appl. Biochem. Biotechnol. 77-
9:293-309.

44. Hofvendahl, K., and B. Hahn-Hagerdal. 2000. Factors affecting the fermentative lactic
acid production from renewable resources(l). Enzyme Microb. Technol. 26:87-107.









45. Horlacher, R., K. Uhland, W. Klein, M. Ehrmann, and W. Boos. 1996.
Characterization of a cytoplasmic trehalase of Escherichia coli. J. Bacteriol. 178:6250-
6257.

46. Horvath, I. S., M. J. Taherzadeh, C. Niklasson, and G. Liden. 2001. Effects of
furfural on anaerobic continuous cultivation of Saccharomyces cerevisiae. Biotechnol.
Bioeng. 75:540-549.

47. Hounsa, C. G., E. V. Brandt, J. Thevelein, S. Hohmann, and B. A. Prior. 1998. Role
of trehalose in survival of Saccharomyces cerevisiae under osmotic stress. Microbiology
144:671-680.

48. Hristozova, T., A. Angelov, B. Tzvetkova, D. Paskaleva, V. Gotcheva, S. Gargova,
and K. Pavlova. 2006. Effect of furfural on carbon metabolism key enzymes of lactose-
assimilating yeasts. Enzyme Microbial Technol. 39:1108-1112.

49. Hyduke, D. R., L. R. Jarboe, L. M. Tran, K. J. Y. Chou, and J. C. Liao. 2007.
Integrated network analysis identifies nitric oxide response networks and dihydroxyacid
dehydratase as a crucial target in Escherichia coli. Proc. Natl. Acad. Sci. USA 104:8484-
8489.

50. Janssen, P. H. 2004. Propanol as an end product of threonine fermentation. Arch.
Microbiol. 182:482-6.

51. Jarboe, L. R., T. B. Grabar, L. P. Yomano, K. T. Shanmugan, and L. 0. Ingram.
2007. Development of ethanologenic bacteria. Biofuels 108:237-261.

52. Jeudy, S., V. Monchois, C. Maza, J. M. Claverie, and C. Abergel. 2006. Crystal
structure of Escherichia coli DkgA, a broad-specificity aldo-keto reductase. Proteins
62:302-307.

53. Kaemwich Jantama, X. Z., J.C. Moore, K.T. Shanmugam, S.A. Svoronos, L.O.
Ingram. 2008. Eliminating Side Products and Increasing Succinate Yields in Engineered
Strains of Escherchia Coli C. Biotechnol. Bioeng. 101:881-893.

54. Karp, P. D., I. M. Keseler, A. Shearer, M. Latendresse, M. Krummenacker, S. M.
Paley, I. Paulsen, J. Collado-Vides, S. Gama-Castro, M. Peralta-Gil, A. Santos-
Zavaleta, M. I. Penaloza-Spinola, C. Bonavides-Martinez, and J. Ingraham. 2007.
Multidimensional annotation of the Escherichia coli K-12 genome. Nucleic Acids Res
35:7577-90.

55. Katahira, S., A. Mizuike, H. Fukuda, and A. Kondo. 2006. Ethanol fermentation from
lignocellulosic hydrolysate by a recombinant xylose- and cellooligosaccharide-
assimilating yeast strain. Appl. Microbiol. Biotechnol. 72:1136-1143.









56. Keller, F. A., D. Bates, R. Ruiz, and Q. Nguyen. 1998. Yeast adaptation on softwood
prehydrolysate. Appl. Biochem. Biotechnol. 70-2:137-148.

57. Kempf, B., and E. Bremer. 1998. Stress responses of Bacillus subtilis to high
osmolarity environments: Uptake and synthesis of osmoprotectants. J. Biosciences
23:447-455.

58. Kempf, B., and E. Bremer. 1998. Uptake and synthesis of compatible solutes as
microbial stress responses to high-osmolality environments. Arch. Microbiol. 170:319-
330.

59. Khan, Q. A., F. A. Shamsi, and S. M. Hadi. 1995. Mutagenicity of Furfural in Plasmid
DNA. Cancer Lett. 89:95-99.

60. Ko, J., I. Kim, S. Yoo, B. Min, K. Kim, and C. Park. 2005. Conversion of
methylglyoxal to acetol by Escherichia coli aldo-keto Reductases. J. Bacteriol. 187:5782-
5789.

61. Kuo, C. H., and C. K. Lee. 2009. Enhanced enzymatic hydrolysis of sugarcane bagasse
by N-methylmorpholine-N-oxide pretreatment. Bioresour. Technol. 100:866-71.

62. Laadan, B., J. R. M. Almeida, P. Radstrom, B. Hahn-Hagerdal, and M. Gorwa-
Grauslund. 2008. Identification of an NADH-dependent 5-hydroxymethylfurfural-
reducing alcohol dehydrogenase in Saccharomyces cerevisiae. Yeast 25:191-198.

63. Larsson, S., P. Cassland, and L. J. Jonsson. 2001. Development of a Saccharomyces
cerevisiae strain with enhanced resistance to phenolic fermentation inhibitors in
lignocellulose hydrolysates by heterologous expression of laccase. Appl. Environ.
Microbiol. 67:1163-1170.

64. Larsson, S., E. Palmqvist, B. Hahn-Hagerdal, C. Tengborg, K. Stenberg, G. Zacchi,
and N. 0. Nilvebrant. 1999. The generation of fermentation inhibitors during dilute acid
hydrolysis of softwood. Enzyme Microbial Technol. 24:151-159.

65. Leslie, S. B., E. Israeli, B. Lighthart, J. H. Crowe, and L. M. Crowe. 1995. Trehalose
and Sucrose Protect Both Membranes and Proteins in Intact Bacteria during Drying.
Appl. Environ. Microbiol. 61:3592-3597.

66. Liao, J. C., R. Boscolo, Y. L. Yang, L. M. Tran, C. Sabatti, and V. P.
Roychowdhury. 2003. Network component analysis: Reconstruction of regulatory
signals in biological systems. Proc. Natl. Acad. Sci. USA 100:15522-15527.

67. Lin, Y. L., and H. P. Blaschek. 1983. Butanol Production by a Butanol-Tolerant Strain
of Clostridium acetobutylicum in Extruded Corn Broth. Appl. Environ. Microbiol.
45:966-973.









68. Lo, C. M., Q. Zhang, P. Lee, and L. K. Ju. 2005. Cellulase production by Trichoderma
reesei using sawdust hydrolysate. Appl. Biochem. Biotechnol. 121:561-573.

69. Maier, T. H. P. 2003. Semisynthetic production of unnatural L-alpha-amino acids by
metabolic engineering of the cysteine-biosynthetic pathway. Nature Biotechnol. 21:422-
427.

70. Martin, C., 0. Almazan, M. Marcet, and L. J. Jonsson. 2007. A study of three
strategies for improving the fermentability of sugarcane bagasse hydrolysates for fuel
ethanol production. International Sugar J. 109:33-39.

71. Martin, C., M. Marcet, 0. Almazan, and L. J. Jonsson. 2007. Adaptation of a
recombinant xylose-utilizing Saccharomyces cerevisiae strain to a sugarcane bagasse
hydrolysate with high content of fermentation inhibitors. Bioresour. Technol. 98:1767-
1773.

72. Martinez, A., T. B. Grabar, K. T. Shanmugam, L. P. Yomano, S. W. York, and L.
0. Ingram. 2007. Low salt medium for lactate and ethanol production by recombinant
Escherichia coli B. Biotechnol. Lett. 29:397-404.

73. Martinez, A., M. E. Rodriguez, M. L. Wells, S. W. York, J. F. Preston, and L. 0.
Ingram. 2001. Detoxification of dilute acid hydrolysates of lignocellulose with lime.
Biotechnol. Prog. 17:287-293.

74. Martinez, A., M. E. Rodriguez, S. W. York, J. F. Preston, and L. 0. Ingram. 2000.
Effects of Ca(OH)(2) treatments ("overliming") on the composition and toxicity of
bagasse hemicellulose hydrolysates. Biotechnol. Bioeng. 69:526-536.

75. Martinez, A., M. E. Rodriguez, S. W. York, J. F. Preston, and L. 0. Ingram. 2000.
Use of UV absorbance to monitor furans in dilute acid hydrolysates of biomass.
Biotechnol. Prog. 16:637-641.

76. Mathew, G. M., R. K. Sukumaran, R. R. Singhania, and A. Pandey. 2008. Progress in
research on fungal cellulases for lignocellulose degradation. J. Sci. Indust. Res. 67:898-
907.

77. McCue, L. A., W. Thompson, C. S. Carmack, M. P. Ryan, J. S. Liu, V. Derbyshire,
and C. E. Lawrence. 2001. Phylogenetic footprinting of transcription factor binding
sites in proteobacterial genomes. Nucl. Acids Res. 29:774-782.

78. Miller, J. H. 1992. A short course in bacterial genetics : a laboratory manual and
handbook for Escherichia coli and related bacteria. Cold Spring Harbor Laboratory Press,
Plainview, N.Y.









79. Miyafuji, H., H. Danner, M. Neureiter, C. Thomasser, J. Bvochora, 0. Szolar, and
R. Braun. 2003. Detoxification of wood hydrolysates with wood charcoal for increasing
the fermentability of hydrolysates. Enzyme Microbial Technol. 32:396-400.

80. Mizoguchi, H., and S. Hara. 1998. Permeability barrier of the yeast plasma membrane
induced by ethanol. J. Ferment. Bioeng. 85:25-29.

81. Mizushina, Y., E. Yagita, K. Kuramochi, I. Kuriyama, N. Shimazaki, 0. Koiwai, Y.
Uchiyama, Y. Yomezawa, F. Sugawara, S. Kobayashi, K. Sakaguchi, and H.
Yoshida. 2006. 5-(Hydroxymethyl)-2-furfural: a selective inhibitor of DNA polymerase
lambda and terminal deoxynucleotidyltransferase. Arch. Biochem. Biophys. 446:69-76.

82. Modig, T., G. Liden, and M. J. Taherzadeh. 2002. Inhibition effects of furfural on
alcohol dehydrogenase, aldehyde dehydrogenase and pyruvate dehydrogenase. Biochem.
J. 363:769-776.

83. Murata, M., H. Totsuka, and H. Ono. 2007. Browning of furfural and amino acids, and
a novel yellow compound, furpipate, formed from lysine and furfural. Biosci. Biotechnol.
Biochem. 71:1717-1723.

84. Nakamura, C. E., and G. M. Whited. 2003. Metabolic engineering for the microbial
production of 1,3-propanediol. Curr. Opin. Biotechnol. 14:454-459.

85. Nakano, S., M. Fukaya, and S. Horinouchi. 2004. Enhanced expression of aconitase
raises acetic acid resistance in Acetobacter aceti. FEMS Microbiol. Lett. 235:315-322.

86. Nakano, S., M. Fukaya, and S. Horinouchi. 2006. Putative ABC transporter
responsible for acetic acid resistance in Acetobacter aceti. Appl. Environ. Microbiol.
72:497-505.

87. Neidhardt, F. C. 1987. Escherichia coli and Salmonella typhimurium: cellular and
molecular biology. American Society for Microbiology, Washington, D.C.

88. Nigam, J. N. 2001. Development of xylose-fermenting yeast Pichia stipitis for ethanol
production through adaptation on hardwood hemicellulose acid prehydrolysate. J. Appl.
Microbiol. 90:208-215.

89. Nilsson, A., M. F. Gorwa-Grauslund, B. Hahn-Hagerdal, and G. Liden. 2005.
Cofactor dependence in furan reduction by Saccharomyces cerevisiae in fermentation of
acid-hydrolyzed lignocellulose. Appl. Environ. Microbiol. 71:7866-7871.

90. Ohta, K., D. S. Beall, J. P. Mejia, K. T. Shanmugam, and L. 0. Ingram. 1991.
Genetic improvement of Escherichia coli for ethanol production: chromosomal
integration of Zymomonas mobilis genes encoding pyruvate decarboxylase and alcohol
dehydrogenase II. Appl. Environ. Microbiol. 57:893-900.









91. Okuda, N., K. Ninomiya, M. Takao, Y. Katakura, and S. Shioya. 2007. Microaeration
enhances productivity of bioethanol from hydrolysate of waste house wood using
ethanologenic Escherichia coli KO 1l. J. Biosci. Bioeng. 103:350-357.

92. Palmqvist, E., and B. Hahn-Hagerdal. 2000. Fermentation of lignocellulosic
hydrolysates. I: inhibition and detoxification. Bioresour. Technol. 74:17-24.

93. Palmqvist, E., and B. Hahn-Hagerdal. 2000. Fermentation of lignocellulosic
hydrolysates. II: inhibitors and mechanisms of inhibition. Bioresour. Technol. 74:25-33.

94. Patel, M. A., M. S. Ou, L. 0. Ingram, and K. T. Shanmugam. 2005. Simultaneous
saccharification and co-fermentation of crystalline cellulose and sugar cane bagasse
hemicellulose hydrolysate to lactate by a thermotolerant acidophilic Bacillus sp.
Biotechnol. Prog. 21:1453-60.

95. Patten, C. L., M. G. Kirchhof, M. R. Schertzberg, R. A. Morton, and H. E.
Schellhorn. 2004. Microarray analysis of RpoS-mediated gene expression in Escherichia
coli K-12. Mol. Genet. Genomics 272:580-591.

96. Pear P. Ueng, C.-s. G. 1982. Ethanol Production from pentoses and sugar-cane baggase
hemicellulose hydrolysate by Mucor and Fusarium species. Enzyme Microb. Technol.
4:169-171.

97. Perez, J. M., F. A. Arenas, G. A. Pradenas, J. M. Sandoval, and C. C. Vasquez.
2008. Escherichia coli YqhD exhibits aldehyde reductase activity and protects from the
harmful effect of lipid peroxidation-derived aldehydes. J. Biol. Chem. 283:7346-7353.

98. Perroud, B., and D. Lerudulier. 1985. Glycine Betaine Transport in Escherichia Coli -
Osmotic Modulation. J. Bacteriol. 161:393-401.

99. Petersson, A., J. R. M. Almeida, T. Modig, K Karhumaa, B. Hahn-Hagerdal, M. F.
Gorwa-Grauslund, and G. Liden. 2006. A 5-hydroxymethyl furfural reducing enzyme
encoded by the Saccharomyces cerevisiae ADH6 gene conveys HMF tolerance. Yeast
23:455-464.

100. Poolman, B., and E. Glaasker. 1998. Regulation of compatible solute accumulation in
bacteria. Mol. Microbiol. 29:397-407.

101. Potts, M. 1994. Desiccation Tolerance of Prokaryotes. Microbiol. Rev. 58:755-805.

102. Puchart, V., and P. Biely. 2008. Simultaneous production of endo-beta-1,4-xylanase and
branched xylooligosaccharides by Thermomyces lanuginosus. J. Biotechnol. 137:34-43.

103. Purvis, J. E., L. P. Yomano, and L. 0. Ingram. 2005. Enhanced trehalose production
improves growth of Escherichia coli under osmotic stress. Appl. Environ. Microbiol.
71:3761-3769.










104. Randall, K., M. Lever, B. A. Peddie, and S. T. Chambers. 1996. Natural and synthetic
betaines counter the effects of high NaCl and urea concentrations. Biochim. Biophys.
Acta 1291:189-194.

105. Rao, J. S., R. S. Singhal, and P. R. Kulkami. 1998. Xylose syrups: Purification of
cottonseed hull hydrolysate by combined treatment of activated carbon and ion exchange
resins. JSIR 57:377-382.

106. Reczey, K., A. Brumbauer, M. Bollok, Z. Szengyel, and G. Zacchi. 1998. Use of
hemicellulose hydrolysate for beta-glucosidase fermentation. Appl. Biochem. Biotechnol.
70-2:225-235.

107. Rham, 0. D., J. Kruseman, and J. Hidalgo. 1978. Non-Gelling Soy Protein
Hydrolysate for Use in Concentrated Fluid Complex Foods. J. Food Sci. 43:642-643.

108. Sauer, U., F. Canonaco, S. Heri, A. Perrenoud, and E. Fischer. 2004. The soluble and
membrane-bound transhydrogenases UdhA and PntAB have divergent functions in
NADPH metabolism of Escherichia coli. J. Biol. Chem. 279:6613-6619.

109. Schomburg, I., A. J. Chang, 0. Hofmann, C. Ebeling, F. Ehrentreich, and D.
Schomburg. 2002. BRENDA: a resource for enzyme data and metabolic information.
Trends Biochem. Sci. 27:54-56.

110. Shen, C. R., and J. C. Liao. 2008. Metabolic engineering of Escherichia coli for 1-
butanol and 1-propanol production via the keto-acid pathways. Metab. Eng. 10:312-20.

111. Siegel, L. M., P. S. Davis, and H. Kamin. 1974. Reduced Nicotinamide Adenine-
Dinucleotide Phosphate-Sulfite Reductase of Enterobacteria .3. Escherichia Coli
Hemoflavoprotein Catalytic Parameters and Sequence of Electron Flow. J. Biol. Chem.
249:1572-1586.

112. Sindt, J. J., J. S. Drouillard, H. Thippareddi, R. K. Phebus, D. L. Lambert, S. P.
Montgomery, T. B. Farran, H. J. LaBrune, J. J. Higgins, and R. T. Ethington. 2002.
Evaluation of finishing performance, carcass characteristics, acid-resistant E. coli and
total coliforms from steers fed combinations of wet corn gluten feed and steam-flaked
corn. J. Anim. Sci. 80:3328-3335.

113. Singh, N. P., and A. Khan. 1995. Acetaldehyde Genotoxicity and Cytotoxicity in
Human-Lymphocytes. Mutat. Res. 337:9-17.

114. Solomon, B. 0., S. K. Layokun, A. 0. Idowu, and M. 0. Ilori. 1994. Prospects for the
Utilization of the Endogenous Enzymes in Sorghum Malt in the Hydrolysis of Starch -
Case-Study with Utilization of Breadfruit Starch for Ethanol-Production. Food
Biotechnol. 8:243-255.









115. Strom, A. R., and I. Kaasen. 1993. Trehalose metabolism in Escherichia coli: stress
protection and stress regulation of gene expression. Mol. Microbiol. 8:205-10.

116. Sulzenbacher, G., K. Alvarez, R. H. H. van den Heuvel, C. Versluis, M. Spinelli, V.
Campanacci, C. Valencia, C. Cambillau, H. Eklund, and M. Tegoni. 2004. Crystal
structure of E. coli alcohol dehydrogenase YqhD: Evidence of a covalently modified
NADP coenzyme. J. Mol. Biol 342:489-502.

117. Szengyel, Z., G. Zacchi, and K. Reczey. 1997. Cellulase production based on
hemicellulose hydrolysate from steam-pretreated willow. Appl. Biochem. Biotechnol. 63-
5:351-362.

118. Talarico, L. A., M. A. Gil, L. P. Yomano, L. 0. Ingram, and J. A. Maupin-Furlow.
2005. Construction and expression of an ethanol production operon in Gram-positive
bacteria. Microbiology 151:4023-4031.

119. Talebnia, F., and M. J. Taherzadeh. 2006. In situ detoxification and continuous
cultivation of dilute-acid hydrolyzate to ethanol by encapsulated S. cerevisiae. J.
Biotechnol. 125:377-384.

120. Tarky, W., 0. P. Agarwala, and G. M. Pigott. 1973. Protein Hydrolysate from Fish
Waste. J. Food Sci. 38:917-918.

121. Tucker, M. P., J. D. Farmer, F. A. Keller, D. J. Schell, and Q. A. Nguyen. 1998.
Comparison of yellow poplar pretreatment between NREL digester and sunds hydrolyzer.
Appl. Biochem. Biotechnol. 70-2:25-35.

122. Um, B. H., M. N. Karim, and L. L. Henk. 2003. Effect of sulfuric and phosphoric acid
pretreatments on enzymatic hydrolysis of corn stover. Appl. Biochem. Biotechnol.
105:115-125.

123. Underwood, S. A., A. L. Buszko, K. T. Shanmugam, and L. 0. Ingram. 2004. Lack of
protective osmolytes limits final cell density and volumetric productivity of
ethanologenic Escherichia coli KOl11 during xylose fermentation. Appl. Environ.
Microbiol. 70:2734-2740.

124. van der Heide, T., M. C. A. Stuart, and B. Poolman. 2001. On the osmotic signal and
osmosensing mechanism of an ABC transport system for glycine betaine. EMBO J.
20:7022-7032.

125. van der Ploeg, J. R., M. A. Weiss, E. Saller, H. Nashimoto, N. Saito, M. A. Kertesz,
and T. Leisinger. 1996. Identification of sulfate starvation-regulated genes in
Escherichia coli: A gene cluster involved in the utilization of taurine as a sulfur source. J.
Bacteriol. 178:5438-5446.









126. van Maris, A. J., D. A. Abbott, E. Bellissimi, J. van den Brink, M. Kuyper, M. A.
Luttik, H. W. Wisselink, W. A. Scheffers, J. P. van Dijken, and J. T. Pronk. 2006.
Alcoholic fermentation of carbon sources in biomass hydrolysates by Saccharomyces
cerevisiae: current status. Antonie Van Leeuwenhoek 90:391-418.

127. Vemuri, G. N., E. Altman, D. P. Sangurdekar, A. B. Khodursky, and M. A. Eiteman.
2006. Overflow metabolism in Escherichia coli during steady-state growth:
Transcriptional regulation and effect of the redox ratio. Appl. Environ. Microbiol.
72:3653-3661.

128. Weber, H., T. Polen, J. Heuveling, V. F. Wendisch, and R. Hengge. 2005. Genome-
wide analysis of the general stress response network in Escherichia coli: sigma(S)-
dependent genes, promoters, and sigma factor selectivity. J. Bacteriol. 187:1591-1603.

129. Welsh, D. T., and R. A. Herbert. 1999. Osmotically induced intracellular trehalose, but
not glycine betaine accumulation promotes desiccation tolerance in Escherichia coli.
FEMS Microbiol. Lett. 174:57-63.

130. White, D. 2000. The physiology and biochemistry of prokaryotes, 2nd ed. Oxford
University Press, New York.

131. Wyman, C. E., B. E. Dale, R. T. Elander, M. Holtzapple, M. R. Ladisch, and Y. Y.
Lee. 2005. Comparative sugar recovery data from laboratory scale application of leading
pretreatment technologies to corn stover. Bioresour. Technol. 96:2026-2032.

132. Wyman, C. E., B. E. Dale, R. T. Elander, M. Holtzapple, M. R. Ladisch, and Y. Y.
Lee. 2005. Coordinated development of leading biomass pretreatment technologies.
Bioresour. Technol. 96:1959-1966.

133. Yomano, L. P., S. W. York, S. Zhou, K. T. Shanmugam, and L. 0. Ingram. 2008.
Re-engineering Escherichia coli for ethanol production. Biotechnol. Lett. 30:2097-2103.

134. Yum, D. Y., B. Y. Lee, and J. G. Pan. 1999. Identification of the yqhE and yaJB genes
encoding two 2,5-diketo-D-gluconate reductases in Escherichia coli. Appl. Environ.
Microbiol. 65:3341-3346.

135. Yutaka Tokiwa, B. P. C. 2008. Biological production of functional chemicals from
renewable resources. Can. J. Chem. 86:548-555.

136. Zaldivar, J., and L. 0. Ingram. 1999. Effect of organic acids on the growth and
fermentation of ethanologenic Escherichia coli LYO 1. Biotechnol. Bioeng. 66:203-210.

137. Zaldivar, J., A. Martinez, and L. 0. Ingram. 2000. Effect of alcohol compounds found
in hemicellulose hydrolysate on the growth and fermentation of ethanologenic
Escherichia coli. Biotechnol. Bioeng. 68:524-530.









138. Zaldivar, J., A. Martinez, and L. 0. Ingram. 1999. Effect of selected aldehydes on the
growth and fermentation of ethanologenic Escherichia coli. Biotechnol. Bioeng. 65:24-
33.

139. Zhang, T. F., and L. P. Hager. 1987. A single-step large-scale purification of pyruvate
oxidase. Arch. Biochem. Biophys. 257:485-487.

140. Zhang, X. M., Y. Li, B. Zhuge, X. M. Tang, W. Shen, Z. M. Rao, H. Y. Fang, and J.
Zhuge. 2006. Construction of a novel recombinant Escherichia coli strain capable of
producing 1,3-propanediol and optimization of fermentation parameters by statistical
design. World Journal of Microbiology & Biotechnology 22:945-952.

141. Zhou, S., T. B. Grabar, K. T. Shanmugam, and L. 0. Ingram. 2006. Betaine tripled
the volumetric productivity of D(-)-lactate by Escherichia coli strain SZ132 in mineral
salts medium. Biotechnol. Lett. 28:671-676.

142. Zhou, S., K T. Shanmugam, L. P. Yomano, T. B. Grabar, and L. 0. Ingram. 2006.
Fermentation of 12% (w/v) glucose to 1.2 M lactate by Escherichia coli strain SZ194
using mineral salts medium. Biotechnol. Lett. 28:663-670.









BIOGRAPHICAL SKETCH

Elliot Norman Miller was born in San Diego, CA, in the year 1982. He traveled the

countryside with his parents and brother, settling sporadically as the nature of his father's

military career necessitated. At age nine Mr. Miller became a resident of Florida and has

remained since. His education includes a high school diploma from Seminole High School in

Sanford, FL, as well as a bachelor's degree in microbiology from the University of Florida,

Gainesville, FL.





PAGE 1

ENGINEERING AND CHARACTERIZATION OF HEMICELLULOSE HYDROLYSATE STRESS RESISTANCE IN ESCHERICHIA COLI By ELLIOT MILLER A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2009 1

PAGE 2

2009 Elliot Miller 2

PAGE 3

To the efforts of those that came before, on which my accomplishments are founded, and to all that tread thereafter. 3

PAGE 4

ACKNOWLEDGMENTS I thank my parents, Vanessa and James Miller, to whom I attribute a stalwart resolve in my upbringing. I thank my brother, Gregory Mille r, for an empathetic understanding that we as siblings share. I also thank my mentor, Dr. Lonnie Ingram, and everyone in the department of Microbiology and Cell Science for their commitment to the principles of continued education and scientific research. I thank my entire graduate committee for lending the assistance and direction required to fullfill my potential. I thank Jeremy Purvis for use of the trehalose overproducing strain JP20 and for his guidance during my entry into the graduate program. I thank Lorraine Yomano for providing the ethanologeni c strain LY180 and for answering my many questions. I thank Laura Jarboe, Pete Turner, and Priti Pharkya for their assistance and support with microarray studies. Finally, I thank my beloved, ShaunTa Skaggs, for the warmth and determination that she has instilled upon me. 4

PAGE 5

TABLE OF CONTENTS page ACKNOWLEDGMENTS ...............................................................................................................4 LIST OF TABLES ...........................................................................................................................7 LIST OF FIGURES .........................................................................................................................8 ABSTRACT ...................................................................................................................................10 CHAPTER 1 INTRODUCTION................................................................................................................. .13 Hydrolysis of Hemicellulose ..................................................................................................13 Fermentation of Hemicellulose Sugars ...................................................................................16 Toxicity of Hemicellulose Hydrolysate ..................................................................................18 Types of Inhibitors ..........................................................................................................18 Addressing Inhibitors ......................................................................................................20 Objectives ...............................................................................................................................23 Engineering Resistance to Osmotic Stress ......................................................................23 Engineering Resistance to Desiccation ...........................................................................24 Engineering Resistance to Chemical Stress ....................................................................24 2 INCREASING TOLERANCE TO OSMOTIC INHIBITORS..............................................26 Introduction .............................................................................................................................26 Materials and Methods ...........................................................................................................27 Results and Discussion ...........................................................................................................27 Tolerance to Sugars .........................................................................................................28 Tolerance to Salt ..............................................................................................................29 Tolerance to Organic Acids .............................................................................................29 Tolerance to Alcohol .......................................................................................................30 Conclusions .............................................................................................................................30 Figures and Tables ..................................................................................................................31 3 INCREASING TOLERANCE TO DESICCATION.............................................................33 Introduction .............................................................................................................................33 Materials and Methods ...........................................................................................................34 Growth of Organisms ......................................................................................................34 Over-Expression of Trehalose Production ......................................................................34 Testing for Desiccation Survival .....................................................................................35 Results and Discussion ...........................................................................................................36 Effect of Sugar Substrate on Survival.............................................................................36 Effect of Strain on Survival .............................................................................................36 5

PAGE 6

Effect of Trehalose Overproduction on Survival ............................................................37 Effect of Growth Stage on Survival ................................................................................38 Mechanism of Survival ....................................................................................................39 Effect of Desiccation on Fermentation ............................................................................40 Conclusions .............................................................................................................................40 Figures and Tables ..................................................................................................................41 4 INCREASING TOLERANCE TO FURFURAL...................................................................46 Introduction .............................................................................................................................46 Materials and Methods ...........................................................................................................47 Strains, Media, and Growth Conditions ..........................................................................47 Construction of Strain LY180 .........................................................................................48 Growth-Based Selection for a Furfural Resistant Strain .................................................49 Furfural Resistance and Metabolism During Fermentation ............................................49 Comparison of Hydrolysate Toxicity ..............................................................................49 Microarray Analysis ........................................................................................................50 Network Component Analysis ........................................................................................50 Cloning and Deletion of Genes .......................................................................................51 Purification and Kinetic Analysis of YqhD and DkgA ...................................................51 Whole-cell Assays of Furfural Me tabolism in Vivo during Fermentation ......................52 In Vitro Assay of Furfural Reduction ..............................................................................52 Analyses ..........................................................................................................................53 Results and Discussion ...........................................................................................................53 Isolation and Initial Characterizatio n of a Furfural-Resistant Mutant .............................53 Effect of Media Composition on Furfural Resistance .....................................................55 Comparison of Oxidoreductase Ex pression by mRNA Microarray Analysis .................56 Characterization of YqhD and DkgA ..............................................................................57 Tolerance to Acid Hydrolysate of Hemicellulose ...........................................................58 Global Effect of Furfural on the Transcriptome ..............................................................58 Effect of Furfural on Regulatory Activity .......................................................................59 Effect of Furfural on Amino Acid Sulfur Assimilation Gene Expression ......................61 Effect of Amino Acid Supplem ents on Furfural Tolerance ............................................61 Effect of Alternative Sulfur Sources on Furfural Tolerance ...........................................63 Effect of Increasing Transhydrogenase Expression on Furfural Tolerance ....................64 Conclusions .............................................................................................................................65 Figures and Tables ..................................................................................................................70 5 GENERAL CONCLUSIONS AND FUTURE DIRECTIONS..............................................88 General Accomplishments ......................................................................................................88 Future Works ..........................................................................................................................90 LIST OF REFERENCES ...............................................................................................................92 BIOGRAPHICAL SKETCH .......................................................................................................105 6

PAGE 7

LIST OF TABLES Table page 3-1 Desiccation of ethanol versus lactate producing E. coli ....................................................41 4-1 Bacterial strains, plasmids, and primers. ...........................................................................70 4-2 Expression of oxidoreductase genes perturbed by furfural addition. ................................73 4-3 Gobal comparison of genes perturbed by furfural addition. ..............................................74 4-4 Regulators perturbe d by furfural addition. .........................................................................75 7

PAGE 8

LIST OF FIGURES Figure page 2-1 Effect of betaine and tr ehalose on sugar tolerance............................................................31 2-2 Effect of betaine and trehalose on salt tolerance...............................................................31 2-3 Effect of betaine and trehal ose on organic acid tolerance.................................................32 2-4 Effect of betaine and tr ehalose on alcohol tolerance.........................................................32 3-1 Growth substrate versus desiccation tolerance..................................................................41 3-2 Trehalose production and suga r additions combined effect on desiccation tolerance.....42 3-3 Cell densitys effect on desiccation tolerance....................................................................43 3-4 Growth sugar versus added suga rs affect on desiccation tolerance..................................44 3-5 Effect of sugar addition di rectly prior to desiccation.........................................................44 3-6 Sugar concentration vers us desiccation tolerance..............................................................45 3-7 Ability of previously desiccated cells to ferment..............................................................45 4-1 Linear DNA fragments used in construction of LY180.....................................................76 4-2 Directed evolution of E. coli for furfural tolerance...........................................................77 4-3 Tolerance of furfural resistan t strain EMFR9 versus LY180............................................78 4-4 Effect of media compos ition on furfural tolerance............................................................79 4-5 Effect of oxidoreductase expr ession on furfural tolerance................................................79 4-6 In vivo and in vitro furf ural reduction comparison............................................................80 4-7 Effect of yqhD and/or dkgA deletion on furfural tolerance................................................81 4-8 Growth in hemicellulose hydrolysate................................................................................81 4-9 Partial regulatory respon se of LY180 to furfural...............................................................82 4-10 Histidine pathway genes pert urbations upon furfural addition..........................................83 4-11 Cysteine and methionine pathway ge ne perturbations upon furfural addition..................84 4-12 Supplementation with specific metabolites increases furfural tolerance...........................85 8

PAGE 9

4-13 Effect of increased transhydrogena se expression on furfural tolerance............................86 4-14 Model of furfural challenge...............................................................................................87 9

PAGE 10

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy ENGINEERING AND CHARACTERIZATION OF HEMICELLULOSE HYDROLYSATE STRESS RESISTANCE IN ESCHERICHIA COLI By Elliot Miller August 2009 Chair: Lonnie Ingram Major: Microbiology and Cell Science Carbohydrate polymers that comprise the lignocellulosic matrix of plants are an abundant and renewable source of sugar for biocatalytic conversion into a range of commercially viable products. However, these carbohydrates must first be depolymerized to monomeric sugars prior to fermentation. Depolymerization of hemicellulose by treatment with dilute mineral acid is quite effective but also results in the formation of inhibitors such as furfural that retard growth and fermentation. To address this issue a series of studies were conducted focusing on osmotic and chemical stress found in hemicellulose syrups formed from dilute acid hydrolysis. To increase osmotic stress tolerance, the effect of two osmoprotectants, trehalose and betaine, were investigated. Trehalose was produced internally in high concentrations in Escherichia coli by expression of the otsAB operon through transposon insertion into the chromosome. In addition, the media was supplemented with 1 mM betaine and additive effects of the two osmoprotectants were investigated in the presence of osmotic stress agents. Individually, each osmoprotectant conferred increased tolerance to osmotic stress from sodium chloride, sodium lactate, glucose, xylose, and succinate, but not ethanol. In the cases of sodium chloride, sodium lactate, glucose, or xylose, the combination of trehalose over-production and betaine addition increased tolerance more than either osmoprotectant could alone. 10

PAGE 11

Three E. coli strains with increased trehalose production, EM2P (an ethanol producing derivative of KO11), EM2L (an ethanol produci ng derivative of LY163), and EM2T (a lactate producing derivative of TG106) were tested for desiccation survival. All strains with increased trehalose production had higher survival levels than the control. The growth sugar also impacted desiccation survival, with xylose yielding lowest survival, glucose providing intermediate survival, and sucrose providing the highest survival. Desiccating the cells in mid-log growth phase provided the highest survival levels compared to other growth phases. The highest overall survival rate (up to 80%) was achieved by over-producing trehalose while growing in sucrose and harvesting in mid-log phase of growth. In addition to osmotic stress, chemical stress caused by furfural was addressed. Ethanologenic E. coli, strain LY180, was transferred in fermentation vessels containing minimal salts medium AM1 with xylose as a carbon source, and furfural in order to obtain a furfural resistant mutant. Changes in global mRNA levels in response to furfural were compared in the mutant, EMFR9, and the parent, LY180. These studies revealed 8 genes encoding oxidoreductases with at least 2 fold increased expression and 4 genes with at least 2 fold decreased expression in EMFR9 relative to LY180. Expression from plasmid in LY180 of the 8 genes did not increase furfural tolerance. However, expression by plasmid in EMFR9 of the 4 genes conferred a decrease in furfural tolerance in the cases of yqhD dkgA and yqfA YqhD and DkgA exhibited the most pronounced effects. These two enzymes were purified and shown to have NADPH dependent furfural reductase activity, with a low Km for NADPH (8 M and 23 M, respectively). Deletion of these two genes in LY180 increased furfural tolerance, supporting the idea that furfural reduction comp etes for NADPH needed for growth. Plasmid 11

PAGE 12

based expression of two native transhydrogenases, sthA and pntAB in LY180 led to an increase in furfural tolerance with regard to pntAB, but sthA had no effect. Further analysis of microarray data revealed an increase in cysteine and methionine pathway mRNA levels in LY180 upon furfural addition. In order for sulfate, the only source of sulfur in AM1 medium, to be incorporated into cysteine, 4 NADPH are required. Supplementation with 0.5 mM L-cysteine, D-cysteine, or sodium thiosulfate increased furfural tolerance in LY180 but not in EMFR9, presumably by alleviating NADPH demand for sulfate incorporation. Supplementation with taurine, an alternative source that requires almost as much NADPH as sulfate to be incorporated, provided no be nefit to furfural tolerance. Together, the data indicates that conversion of furfural to furfuryl alcohol by YqhD limits available NADPH required for biosynthesis of molecules such as cysteine, preventing growth. 12

PAGE 13

CHAPTER 1 INTRODUCTION Hydrolysis of Hemicellulose Plants are perhaps the most abundant renewable resource on earth, covering its entire surface and providing us with wood to build homes, chemicals from which herbal remedies can be derived, and even oxygen that we as a species require to survive. Furthermore, the basic materials necessary for the accumulation of flora are equally abundant; solar energy for photosynthesis, minerals from the soil, and carbon dioxide from the atmosphere. Since this natural commodity is so widespread it is no wonder that decades of scientific research have been employed to make the most of its potential, with one resulting outlet being the formation of hydrolysate. Hydrolysate in general is simply a product of hydrolysis, and can be produced from any number of materials, including fish (120), yeas t (26), soy (107), and many others (21, 68, 122). Hemicellulose hydrolysate is formed as a result of hydrolysis of the hemicellulose portion of the lignocellulose that comprises a large portion of the plant (132). The lignocellulose itself can be divided into three primary components: cellulose, hemicellulose, and lignin (132). The cellulose is composed of repeating units of glucose that are linked in a 1,4-beta fashion to make them inaccessible to digestion (40). The hemicellulose is composed of a variety of pentose and hexose sugars, including xylose, arabinose, mannose, glucose, and galactose (21). Lignin is a polymer of various aromatic compounds (syringic acid, hydroxybenzaldehyde, catechol, etc.) and aids in giving the plant rigidity In addition to these polymers, the lignocellulose contains pectin, which accounts for approximately 2-20% of the lignocellulosic content and is composed of galacturonic acid and rhamnose. The hemicellulose sugars along with the glucose released from hydrolysis of the cellulose provide a suitable set of substrates for microorganisms to metabolize into useful 13

PAGE 14

products. However, before this can occur the sugars must be made accessible through a pretreatment process. Pretreatment of lignocellulose opens the crystalline structure, separating tightly packaged lignin, hemicellulose, and cellulose polymers from each other, as well as in certain instances partially hydrolyzing the cellulose and hemicellulose bonds (131). There are a number of pretreatment approaches that can be taken, each with benefits and pitfalls (132). They include dilute sulfuric acid pretreatment, dilute phosphor ic acid pretreatment, flowthrough pretreatment, pH controlled water pretreatment, ammonia fi ber explosion pretreatment, ammonia recycle percolation pretreatment, N-methylmorpholine-Noxide pretreatment, and lime pretreatment. Pretreatment by dilute sulfuric acid in conjunction with high temperatures and pressures leads to the recovery of most of the hemicellulo se as dissolved sugars along with hydrolysis of part of the cellulose (21, 122, 131, 132). In additi on, part of the lignin structure is disrupted, allowing attack on the cellulose by enzymes (122, 131). The use of phosphoric acid pretreatment also promotes cellulose hydrolysis, although not to the same degree as with sulfuric acid (122) and the remaining phosphoric acid can be used as a source of phosphate for growth. Pressurized liquid forced through biomass allows for disruption of the lignocellulosic structure, even without acid addition (132), but unfortunately the high amounts of water and energy required make the process difficult to use commercially. Maintaining the pH at 4-7 using water or stillage and implementing high pressure and temperature can dissolve a large portion of the lignin and hemicellulose, and cleave hemiacetyl linkages, thus freeing acids that can further degrade the biomass (132). In addition to acidic pretreatment methods, alkaline pretreatment has been shown to be effective. Ammonia fiber explosion, or AFEX, decrystallizes cellulose so that it is more 14

PAGE 15

accessible to enzymatic degradation, the ammonia is volatile enough that it can be quickly recycled for further use, and remaining ammonia promotes fermentation (132). Ammonia recycle percolation, or ARP, pushes aqueous ammonia though biomass at high temperatures, breaking apart the lignin as well as the lignin-hemicellulose bonds for enzymatic digestion of the hemicellulose (132). N-methylmorpholine N-oxide pretreatment, or NMMO pretreatment, uses NMMO to dissolve the cellulose so it is susceptib le to enzymatic attack, and most of the NMMO can be readily recovered (61). Finally, addition of lime can be used for lignin removal, with the added benefit of temperature versatility (132), meaning that the reaction can occur at temperatures as low as 25 degrees Celsius so long as the pretreatment time is increased accordingly. After the biomass has been pretreated by one of the above techniques the remaining cellulose and hemicellulose polymers, not completely digested but now readily accessible, need to be broken into their component sugars so that they may be metabolized. To do this enzymes such as cellulases and xylanases are employed. Cellulases hydrolyze the 1,4 linkages of cellulose that join glucose monomers together, and are implemented by a variety of organisms (27, 68, 76, 117). This often results in the formation of cellobiose that needs to be further broken down by beta-glucosidases to form two glucose molecules (106). In addition, the hemicellulose can be hydrolyzed by xylanases that release xylose present in the polymer (16, 27, 102). In addition to hemicellulose hydolysate, hydrolysate from starch is commonly used in industrial biocatalytic product formation (114). It is advantageous to use starch in that the glucose that comprises the starch polymer is much more easily hydrolyzed to metabolizable sugars than lignocellulose and so complex pretreatment processes are unnecessary. This means that the cost of preparing the hydrolysate is lower, and the concentration of inhibitors formed and 15

PAGE 16

released is much less. The starch, however, comes from materials such as corn that require significant costs in nutrients to grow and are competed for commercially as a food commodity. Fermentation of Hemicellulose Sugars After the hydrolysate has been prepared it can used as a source of sugar for microorganisms to grow and produce various chemical compounds. The microorganisms that make these valuable commodities range in classification from bacteria, to eukaryotes, and even archaeal species. Each of these domains have the ability to grow under a unique set of conditions regarding media, temperature, aeration, substrate preference, and each can produce a different but overlapping set of products. Furt hermore, even within each domain organisms differ with respect to the above criteria. Bacteria can produce a wide range of commercially important products, including ethanol, propanol, butanol, lactate, succinate, acetat e, and pyruvate. Ethanol, an alternative fuel source (40), is made as a product naturally in many bacteria fermentatively in order to achieve redox balance (130). However, generally speaking, other products are also produced that lower overall yield and complicate purification strategies. To alleviate this issue bacteria have been developed though genetic engineering and directed evolution to make ethanol as their primary product, with two of the most prominent being Escherichia coli and Klebsiella oxytoca (8, 51, 133). 1-butanol is made in Clostridium using acetone-butanol-ethanol fermentation (31, 67), and certain species of Clostridium can make 1-propanol in low concentrations using threonine catabolism (50). Heterologous expression of genes in E. coli has allowed it to produce measurable quantities of both 1-butanol and 1-propanol (110). Genetic engineering of E. coli has led to its ability to produce 1.2 M lactate--an acid useful in the formation of plastics and pharmaceuticals (2, 44)--in minimal media, with high chiral purity (142). A number of other bacteria, particularly those of the genera Bacillus have been engineered to produce lactate 16

PAGE 17

industrially (94). In addition, a derivative of E. coli C was engineered to make 0.7 M succinate in minimal media (53). Other bacteria can make succinate effectively, including Actinobacillus succinogenes and Enterecoccus flavescens (135). E. coli W3110 was engineered to make 0.9 M acetate (18), and Acetobacter is a well-known acetate forming bacteria that uses ethanol as a substrate under aerobic conditions. Pyruvate can be made in E. coli to a final yield of 0.8 M (17), and can be used as a precursor in the formation of a number of amino acids. Eukaryotic microorganisms that are engineered to make commercial products from sugars found in hemicellulose hydrolysate are generally yeast. Saccharomyces cerevisiae is perhaps the most well studied and implemented of these yeasts. It can use glucose, mannose, and fructose via the Embden-Meyerhoff pathway of glycolysis, galactose using the Leloir pathway, and xylose through metabolic engineering to express a xylose isomerase (126). These and other strategies allow S. cerevisiae to make significantly higher concentrations of products, particularly ethanol, than the parent strains (55) In addition, a number of other fungi have been known to convert both glucose and xylose into ethanol, including Fusarium Mucor, Rhizopus and Monila (96). S. cerevisiae has also been engineered to make optically pure D-Lactate from glucose during batch fermentations (135). Archaea are perhaps the least studied of the thr ee groups, due in part to their lower degree of prevalence, difficulty to cultivate, and absence of genetic manipulation tools compared to bacteria and yeast. However, these microorganisms are interesting potential vessels for commercial product formation from biomass for a number of reasons. Like members of the other domains, archaea have the ability to implement a wide range of carbohydrates. Marine archaea have been shown to be able to digest both alpha and beta linked glucans, including starch, barley glucan, laminarin and chitin (12). As fascinating is their ability to grow at 17

PAGE 18

temperatures that are permissible to enzymes which degrade lignocellulosic polymers but are not desirable to growth of contaminanting microbes. Toxicity of Hemicellulose Hydrolysate Pretreatment of plant biomass hydrolyses a portion of the lignocellulose, freeing sugars that can then be readily metabolized, and opens the crystalline structure to enzymatic attack for further degradation. However, this process often leads to the release and formation of numerous inhibitors, which can be broken into two major categories: osmotic inhibitors and chemical inhibitors. These compounds, which retard cell growth and product formation (123, 136-138), can be dealt with, either by their removal from the media prior to addition of the inoculum or through the development of tolerant strains. Types of Inhibitors Osmotic inhibition results from hypertonic conditions imposed by components of the hydrolysate, including sugars released from hydrolysis of the cellulose and hemicellulose, salts formed from acid treatment as well as those releas ed from the plant itself, and acids cleaved from the lignocellulosic polymers. The resulting hypertonicity draws water out of the cell, leading to plasmolysis of the membrane and disruption of cellular processes (23). Chemical inhibitors affect the biocatalyst in a multitude of ways, with patterns of inhibition linked to the class of inhibitor involved. The three major categories of inhibitors are alcohols, acids, and aldehydes. Alcohols in hydr olysate result primarily from the release of aromatic alcohols from lignin, as well as th rough the formation of furfuryl alcohol via conversion of pentose sugars during pretreatment (64, 137). They include vanillyl alcohol, methylcatechol, guaiacol, coniferyl alcohol, hydr oquinone, furfuryl alcohol, and catechol (137). Alcohols have been shown to act by solubilization of the cell membrane, and as such toxicity can be directly correlated to hydrophobicity of the compound (137). Of the above alcohols, 18

PAGE 19

methylcatechol was shown to be the most inhibitory to an ethanologenic strain of E. coli, with a minimal inhibitory concentration, or MIC, of 1.5 g liter -1 (137). Interestingly, inhibition of alcohols present in pairs was fairly additive (137). Organic acids present in hemicellulose hydrolysate come from numerous sites including lignin, acetyl-xylan, and conversion of hydrolyzed sugars (121). Specific acids include ferulic, gallic, furoic, formic, levulinic, and acetic acid (136). Acetate is thought to consistently be the most abundant hemicellulose hydrolysate acid (136). Acids act by crossing the cell membrane in neutral form and then disassociating, releasing a hydrogen ion and in turn collapsing the proton motive force (136). Increasing the initial pH of the medium decreases toxicity in most instances, most likely because a greater portion of the acids disassociate outside of the cell and thus are unable to diffuse across the membrane (136). As with aldehydes, toxicity is related to hydrophobicity, although acids do not appear to disrupt membrane integrity (136). The effect of aldehydes on cell function appears to be more complicated than that of either acids or alcohols and is not yet fully understood. Aldehydes present in hemicellulose hydrolysate include soluble aromatic aldehydes released from lignin, hydroxymethyl furfural from conversion of hexose sugars, and furfural from conversion of pentose sugars. Aromatic aldehydes appear to be more toxic on a weight basis than furfural or hydroxymethyl furfural (138). However, furfural generally exists in higher concentrations than any individual aromatic aldehyde, its toxicity is uniquely synergistic, and it is the only tested aldehyde to strongly inhibit ethanol production in KO11 and LY01 (138); these serv e as indications that furfural is perhaps the most important of inhibitory aldehydes. Th e inhibitory effects of furfural have been extensively studied. Furfural has been shown to mutate DNA at and below 20 mM furfural (59), can cause strand breaks in duplex DNA (39), and can react with the amino group of adenine to 19

PAGE 20

form N-6-furfuryladenine (9). Furfural also effects enzyme function, reducing the activity of alcohol dehydrogenase (82), aldehyde dehydrogenase (82), pyruvate dehydrogenase (82) at a concentration of less than 2 mM furfural, and glucose phosphate isomerase (48), and glucose-6Pdehydrogenase (48) at a concentration of 4 mM furfural. At high temperatures both 10 and 30 mM furfural were shown to interact chemically with lysine to form furpipate (83). Hydroxymethyl furfural, while not as toxic as fu rfural, can also inhibit growth (138) and has been shown to affect mammalian DNA polymerase and the terminal deoxynucleotidyltransferase, with an IC 50 of 26.1 and 5.5 M, respectively, for these two enxymes (81). Addressing Inhibitors Microorganisms respond to osmotic stress by the accumulation of various compatible solutes, neutral molecules that can exist in the cytoplasm in high concentrations without harming cell function (58). In E. coli, high concentrations of external osmolytes led to the uptake of potassium ions, which in turn initiates the formation of the compatible solute glutamate (58). Other compatible solutes, such as proline, are either made or taken into the cell through a set of transporters (58). The non-reducing sugar trehalose is naturally produced in both prokaryotic and eukaryotic organisms during osmotic stress using trehalose-6-phosphate synthase and trehalose-6-phosphate phosphatase (47, 58); increasing trehalose production in E. coli by expressing the otsAB operon on a plasmid led to enhanced osmotic stress resistance (103). In addition, E. coli can take up the compatible solute betaine from the medium (19, 58, 98) or produce it oxidatively in the presence of choline (58). Gram-positive bacteria have a similar response mechanism, taking up and producing proline and betaine upon onset of hypertonicity (58). 20

PAGE 21

Chemical inhibitors present in hemicellulose hydrolysate can be managed either by detoxification prior to culture addition or by engineering and selection of resistant strains. A number of approaches have been taken to remove chemical inhibitors prior to inoculum addition, including overliming, resin filtration, charcoal filtration, and selective hydrogenation. Overliming, or the addition of calcium hydroxide to hot hydrolysate, leads to a significant reduction in total furans and phenolic compounds (32, 73, 74), but also reduces overall sugar concentrations (73). Treatment of hydrolysate with IRA-400 ion exchange resin removes a portion of the acetate, furfural, sulfate, and phenolic compounds (32). Activated charcoal functions in a similar fashion but removes less furfural (32) and less nitrogen (105). In both cases, treatment allowed for an increase in carbohydrate utilized by Klebsiella pneumoniae to make 2,3-butanediol (32). Increasing treatment temperature during implementation of charcoal increases its effectiveness (79). While charcoal and resin provide an opportunity for removal of inhibitors, costs of both are a factor to be ta ken into consideration. Additionally, although not directly connected to hydrolysate remediation, conve rsion of furfural to the less toxic furfuryl alcohol can be performed by selective hydrogenation using a copper oxide catalyst (42). In addition to removing inhibitors from hydrolysate prior to culture addition, growth conditions can be modified to allow for improved tolerance in the presence of inhibitors. One of the primary means by which this is accomplished is through microaeration. Growth of E. coli KO11 in waste house wood hydrolysate, or WHW, in the presence of small quantities of oxygen led to an increase in xylose consumption and ethanol production (91). Other methods of this nature include encapsulation of Saccharomyces cerevisae in an alginate matrix for protection against inhibitors as well as an increase in capacity for in situ detoxification (119). 21

PAGE 22

Alteration of the hydrolysate to become suitable for biocatalytic growth is a general strategy that has been adopted in many instances, but adaptation of the organism itself to hydrolysate inhibitors, either through genetic engi neering or directed evolution, can be more beneficial in that it reduces complication of hydrolysate preparation and sidesteps costs associated with resin, alginate, and so forth. One means by which this can be achieved is through selection of resistant strains by screening and transferring in media containing the appropriate inhibitors. S. cerevisae, Pachysolen tannophilus Brettanomyces custersii, Candida shehatae and Candida acidothermophilum have been screened for growth in dilute acid softwood prehydrolysate (56), and various yeast ha ve been adapted to hydrolysate inhibitors by continuous cultivation in prehydrolysate and hydrolysate (56, 70, 71). S. cervisiae was adapted to sugarcane bagasse hydrolysate by continuous cultivation in increasing concentrations of phenolic compounds, furaldehydes, and aliphatic acids (71). Two yeast species, Pichia stipitis and Trichoderma reesi were adapted to grow in high concentrations of acetate (43, 88), a common hemicellulose hydrolysate inhibitor. P. stipitis is particularly interesting as an ethanol producing yeast due to its ability to utilize xylose (1). With knowledge of the mechanisms by which hydrolysate inhibitors act, and the means by which each biocatalyst attempts to tolerate them, genetic engineering of the biocatalyst can be implemented to further promote growth and product formation. Laccase, an extracellular fungal enzyme, has been demonstrated to oxidize phenolic compounds (63). Expression of laccase from Trametes versicolor in S. cerevisae led to increased tolerance to coniferyl aldehyde when oxygen is present (63). A mutation in the ABC transporter aatA in Acetobacter aceti was shown to convey acetic acid, formic acid, propionic acid, and lactic acid sensitivity; expression of aatA in the mutant restored acetate resistance, and expression of A. aceti aatA in E. coli increased 22

PAGE 23

resistance to acetate (86). Furthermore, expression of aconitase in Acetobacter aceti has been shown to increase acetate resistance (85). Multiple enzymes in S. cerevisiae have been shown to reduce 5-hydroxymethyl furfural, including a mutated alcohol dehydrogenase 1 and alcohol dehydrogenase 6 (5, 62, 99). In E. coli, a furfural reductase was purified that reduced furfural to furfuryl alcohol using NADPH specifi cally as a co-factor (36). In S. cerevisiae mutations in four genes within the pentose phosphate pathway-zwf gnd, rpe tklled to furfural sensitivity, and overexpression of zwf allowed for increased tolerance to furfural (34). Objectives The primary goal of this research project is to develop and analyze mechanisms in E. coli that increase tolerance to inhibitors commonly found in hydrolysate. Doing so will lend a basic scientific understanding of the inhibitors action on the cell, as well as lead to a commercial platform for overcoming the toxicity of these moieties. This approach will seperately target osmotic stess and chemical stress factors. Engineering Resistance to Osmotic Stress Osmotic stress is imposed upon the cell by salts and sugars found in hemicellulose hydrolysate (23, 57, 100), in addition to products which accumulate during fermentation (103). This study will test the ability of osmotic stress to be overcome in E. coli using two known osmoprotectants, betaine and trehalose. Addition of 1mM betaine to media containing seperate osmotic stress agents will be used to gauge its effect on osmotolerance through growth measurements. The same approach will be implemented to test improved osmotic tolerance through increased expression of the otsBA operon, genes necessary for trehalose production, by random insertion in the host chromosome using a transposon. Finally, the conjoined effect of betaine addition and increased trehalose production will be measured to test the ability of two osmoprotectants to work synergistically. 23

PAGE 24

Engineering Resistance to Desiccation The ability of cultures to survive anhydrobiosis has been long studied (22, 101), and stress factors that prevent survival are separate, but related, to those observed with omotic stress. S. cerevisiae and other yeast exhibit increased survival by producing intracellular trehalose (22), the same disaccaride used as an osmoprotectant, and drying in added trehalose or sucrose also increases desiccation survival (65, 101). However, not all osmoprotectants serve as anhydrobiotic protectants, as is the case with betaine (129). Using ethanol producing and lactate producing E. coli strains with integrated otsBA operons under control of a tac promotor, this study will determine if engineered intracellular production of trehalose leads to increases in desiccation survival. The ability of added xylose, glucose, fructose, arabinose, lactose or mannose will also be tested for its effect on desiccation tolerance, both alone and in conjunction with increased intracellular trehalose production. In addition, the growth phase of harvested cells with relation to survival will be assessed. Finally, the effect of desiccation on fermentation of subsequently rehydrated cells will be determined. Engineering Resistance to Chemical Stress One of the primary chemical stress agents observed in hydrolysate is furfural, a dehydration product of the pentose sugar xylose ( 64, 73, 138). This study will develop a furfural resistant E. coli through selective evolution, growing batch cultures in minimal media containing furfural and transferring to new media when growth is observed. The furfural resistant E. coli will subsequently be subjected to a microarray comparison to the parent strain in order to delineate evolved resistance mechanisms. E. coli has previously been demonstrated to contain a furfural reductase (36), but no corresponding gene had been assigned. To attempt identification of furfural reductases, putative and known oxi doreductases with perturbed mRNA expression will be cloned and tested, both for furfural reductase activity as well as for their effect on furfural 24

PAGE 25

tolerance. Oxidoreducatases with furfural reduc ing activity will subsequently be histidine tagged by gene cloning into plasmid vector pET15b and purified on a nickel column to be subjected to kinetic analysis. Finally, global gene expression analysis through microarray studies will be used to group genes perturbed by furfural addition into functional catagories. Together, the gathered data will allow development of a model outlining furfurals inhibition mechanism. 25

PAGE 26

CHAPTER 2 INCREASING TOLERANCE TO OSMOTIC INHIBITORS Introduction Current high costs of petroleum and petroleum-derived chemicals provide an opportunity for the expansion of renewable microbial products from carbohydrate feedstocks. To be competitive, microbial processes for bulk chemicals must be simple, robust, rapid, efficient, and inexpensive. High product titers are desirable to minimize costs associated with water handling, purification, and waste treatment. To achieve these titers in simple fermentations, microbial biocatalysts must be able to tolerate osmotic and chemical stress from high concentrations of carbohydrate substrates in the hydrolysate as well as accumulated products released from the microorganism. Although the mechanism of osmotolerance is not fully understood, plants, animals, and microbes utilize intracellular compatible osmolytes such as glutamate, betaine, proline, and trehalose to counter osmotic stress from extracellular solutes (22, 23, 103). E. coli can synthesize all of these compounds during oxidative metabolism provided choline is available, but biosynthesis is limited to glutamate and trehalose during anaerobic growth. Trehalose accumulation during fermentative growth is hindered by expression of catabolic enzymes such as trehalase (14, 45). Betaine has generally been regarded as a superior protective osmolyte for E. coli and has been shown to increase tolerance to sugars, salts, and organic acids (23, 30, 58, 123, 141). This compound is actively concentrated from the environment by a stress-inducible uptake system (98, 124) and serves as a protective intracellular osmolyte. In E. coli, biosynthesis of trehalose is also induced as part of the osmotic stress response (23, 58, 103). Uptake of betaine has been shown to reduce the intracellular levels of trehalose, suggesting that these protective osmolytes may be biologically interchangeable (19, 20, 100). Other studies have shown that over26

PAGE 27

expression of trehalose biosynthetic genes can be used to increase trehalose levels above that of wild type strains and increase osmotolerance to both salts and sugars (103). Here I investigated the combined effects of genetically increasing trehalose biosynthesis and supplementing the medium with betaine on osmotic tolerance to stress agents encountered during fermentation in hydrolysate by measuring growth in mineral salts medium containing 20 g liter -1 (w/v) glucose as the primary carbon source. Materials and Methods Two E. coli strains were used in these studies: W3110 (wild type) and JP20 (103). Strain JP20 is an isogenic derivative in which an IPTG-inducible operon for trehalose biosynthesis ( ampH:: lacI P tac otsBA ) has been chromosomally integrated into ampH, and the genes for trehalose degradation (treA, treC, and treF ) have been deleted. Levels of trehalose in JP20 were previously shown to be elevated without induction due to leaky expression, and further increased upon induction by IPTG (103). Osmotolerance was examined as described by Purvis et al. (103). Tolerance was investigated using M9 mineral salts medium containing 20 g liter -1 (111 mM) glucose, unless indicated otherwise. Inocula were prepared by resuspending cells from fresh colonies on solid medium in broth. Cultures were inoculated to provide an initial OD 550 nm of 0.03 (10 mg dcw l -1 ). Cell density was determined after incubation for 24 h at 37C. The minimum inhibitory concentrations (MIC) for each stress agent was estimated by extrapolating plots of cell mass versus solute concentration to zero growth. Results and Discussion Although the beneficial effects of intracellular trehalose and betaine during growth under osmotic stress are well-established for sodium chloride and glucose (23, 58, 104), little work has been reported concerning the combined effect of two intracellular osmolytes. Prior experiments 27

PAGE 28

have established that 1 mM betaine is near the optimal concentration for osmotic tolerance in E. coli for several stress agents (123). Previous studies in our laboratory have examined the effects of different levels of trehalose on osmotolerance by comparing the wild type parent to an isogenic strain (JP20) containing a chromosomally integrated, IPTG-inducible operon for trehalose biosynthesis (103). Strain JP20 exhibits elevated levels of trehalose synthesis in the absence of induction, and higher levels with a dded IPTG. Estimates of intracellular trehalose levels for these strains were as follows: less than1 mM for W3110 (parent), 28 mM for JP20 without induction, and 360 mM for JP20 after induction (103). Based on these results, experiments were designed to examine the combined effects of betaine (1 mM) and trehalose. A qualitatively similar effect on trehalose biosynthesis (JP20 induced>JP20>W3110) was assumed independent of stress agent. Tolerance to Sugars The addition of betaine to the media prior to growth led to a substainial increase in tolerance to high concentrations of glucose, increasing the minimal inhibitory concentration (MIC) from 0.7 to 1.1 M (Fig. 2-1A). As expecte d, JP20 also had increased tolerance to glucose even in the absence of induction by IPTG (due to leaky expression of the otsAB operon), and induction further enunciated this trend. Most in terestingly, the combination of betaine addition and increased trehalose production yielded a synergistic benefit above which either osmoprotectant could provide alone. A similar effect was observed in the presence of another sugar commonly found in hydrolysate, xylose (Fig. 2-1B). Again, W3110 without betaine exhibited the least tolerance to the osmolyte, with either betaine addition or increased trehalose expression seperately providing a benefit to tolerance. JP20 grown in the presen ce of betaine resulted in the highest tolerance to xylose. Taken together the data serves as an indication that a synergistic osmoprotective effect is 28

PAGE 29

observed with relation to betaine and trehalose in the presence of otherwise inhibitory sugar concentrations. Tolerance to Salt The greatest benefit observed from the tested osmoprotectants was in the presence of sodium chloride (Fig. 2-2). As shown with sugar tolerance assays, tolerance to NaCl increased when cells were grown in the presence of 1 mM betaine. JP20, the strain developed for increased trehalose production, also had improved tolerance to NaCl compared to W3110 in an uninduced state, with induction by IPTG providing an added benefit. JP20 in the presence of betaine exhibited the greatest tolerance to NaCl, although induction by IPTG in this instance did provide an additional effect. This indicates that although betaine and trehalose can act synergistingly, saturating osmoprotectant concentrations still exist, above which no further benefit is observed. Tolerance to Organic Acids In addition to osmotic stress agents present in media prior to growth, E. coli releases fermentation products that can have an osmotic e ffect, two of which being lactate and succinate. By far the best osmoprotectant in the presence of lactate appears to be betaine, allowing growth in up to 0.6 M lactate (Fig. 2-3A). Increased production of trehalose appeared to exhibit a minor benefit. Unfortunately, no synergistic benefit was observed during growth in lactate. Addition of betaine was most beneficial to succinate tolerance, increasing the MIC from 0.3 M to 0.6 M (Fig. 2-3B). Trehalose over-expr ession provided a noticeable advantage, but again, no synergistic effect was observed between the two osmoprotectants. Interestingly, either betaine addition or trehalose overproduction led to an increase in final cell density when grown in low succinate concentrations compared with growth in the absense of succinate, indicating that once osmotic hinderance has been overcome succinate can serve as a carbon source. 29

PAGE 30

Tolerance to Alcohol Unlike xylose, glucose, sodium chloride, lact ate, or succinate, no beneficial effect was observed by either osmoprotectant in the presence of ethanol (Fig. 2-4). This result is consistent with the small size and previous reports of high cellular permeability (28, 29, 80). Other actions such as metabolic stress or chemical stress are presumed to be important actions leading to growth inhibition by ethanol. Oddly, osmprotectant addition led to a slight antogonistic effect on growth, with this trend enuciated when the tr ehalose over-producing strain, JP20, was grown in the presence of betaine. Conclusions A combination of supplementing fermentations with 1 mM betaine and enhancing biosynthesis of trehalose by the biocatalyst may be more useful than either alone for increased tolerance to sugars (glucose and xylose) and products such as sodium lactate. Although this combination did not improve tolerance to ethanol, strain productivity may be improved in high sugar environments. The molar toxicity of xylose was over 3-fold higher than glucose and NaCl. 30

PAGE 31

Figures and Tables A 0.0 0.5 1.0 1.5 2.0 0.0 0.5 1.0 1.5 Glucose (M)Cell mass (g liter-1) B 0.0 0.1 0.2 0.3 0.4 0.0 0.5 1.0 1.5 Xylose (M)Cell mass (g liter-1) Figure 2-1. Effect of betaine and trehalose on sugar tolerance. Tolerance to (A) glucose, and (B) xylose. W3110 without betaine; W3110 with 1 mM betaine; JP20 without betaine; JP20 with betaine; JP20 induced without betaine; JP20 induced with 1 mM betaine. 0.0 0.5 1.0 1.5 0.0 0.5 1.0 1.5 2.0 NaCl (M)Cell mass (g liter-1) Figure 2-2. Effect of betaine and trehalose on salt tolerance. Tolerance to NaCl. W3110 without betaine; W3110 with 1 mM betaine; JP20 without betaine; JP20 with betaine; JP20 induced without betaine; JP20 induced with 1 mM betaine. 31

PAGE 32

A 0.00 0.25 0.50 0.75 0.00 0.25 0.50 0.75 1.00 Lactate (M)Cell mass (g liter-1) B 0.00 0.25 0.50 0.75 1.00 0.0 0.5 1.0 1.5 2.0Succinate (M)Cell mass (g liter-1) Figure 2-3. Effect of betaine and trehalose on organic acid tolerance Tolerance to (A) lactate, and (B) succinate. W3110 without betaine; W3110 with 1 mM betaine; JP20 without betaine; JP20 with betaine; JP20 induced without betaine; JP20 induced with 1 mM betaine. 0.00 0.25 0.50 0.75 1.00 0.00 0.25 0.50 0.75 1.00 1.25 Ethanol (M)Cell mass (g liter-1) Figure 2-4. Effect of betaine and trehalose on alcohol tolerance. Tolerance to ethanol. W3110 without betaine; W3110 with 1 mM betaine; JP20 without betaine; JP20 with betaine; JP20 induced without betaine; JP20 induced with 1 mM betaine. 32

PAGE 33

CHAPTER 3 INCREASING TOLERANCE TO DESICCATION Introduction Desiccation tolerance has been a field of much interest to researchers, with extensive studies conducted on both bacterial and mammalian cells. This research has delineated mechanisms allowing certain organisms to survive in an anhydrobiotic state and come away unscathed. S. cerevisae, for instance, produces high levels of the disaccharide trehalose as well as the osmoprotectant betaine in response to osmotic stress. E. coli can implement a similar action of defense, producing trehalose and taking in betaine through a specific transport system (20, 100). While betaine has been shown to act as an invaluable tool against high osmolyte concentrations, its effects are not evident during desiccation (129). As such, trehalose, as well as other disaccharides such as sucrose, serve as the prevailing protectors under these circumstances, acting to take the place of water in order to prevent membrane fusion as well as protein inactivation (65, 101). Efforts have been made in the past to further enhance the ability of these organisms to survive the desiccation process, with E. coli being at the forefront of these ventures. E. coli cells have been dried in trehalose solutions to increase extra-cellular trehalose while at the same time intra-cellular levels were increased through osmotic induction, allowing for survival levels up to approximately 80% after a week of desiccation (25). In addition, recombinant expression of sucrose-6-phosphate synthase in E. coli using the spsA gene from Synechocystis has been implemented as a means by which to allow the cells to produce sucrose as a protection mechanism, increasing survival when desiccated over phosphorus pentoxide from approximately 2*10 -4 % to 2.3% (11). This study looks to further expound upon the benefits provided by these and other sugars by the recombinant over-expression of trehalose production in concert with 33

PAGE 34

separate addition of xylose, glucose or sucrose, as well as gain insight into the mechanism by which this effect occurs. Materials and Methods Growth of Organisms LY163, an ethanologenic E. coli having all native fermentative routes for NADH reoxidation replaced with the Zymomonas mobilis ethanol producing pathway (118), and its derivatives were grown for desiccation in NBS minimal medium with the addition of 5 % w/v xylose, sucrose or glucose prior to growth. Cultures were transferred on NBS agar plates containing 2 percent glucose and were re-streaked using an applicator stick on a daily basis. KO11, a recombinant strain of E. coli containing the pdc and adh genes from Z. mobilis (90), and its derivatives were grown in Corn Steep Liquor medium, also with the addition of 50 g liter -1 xylose, glucose or sucrose prior to growth. Cultures were transferred daily on CSL plates containing 20 g liter -1 xylose by restreaking via applicator stick. TG106, an E. coli B derivative ( pfl frd adhE ackA ldhA ::ldhL mgsA ) made to produce L-lactate and EM2T, a further derivative of TG106 made to over-express the genes for trehalose production were transferred on NBS 20 g liter -1 glucose plates with 0.1 M MOPS, pH 7.0, on a daily basis. Organisms were frozen for long-term storage by growing the cells to approximately 0.5 optical density (550 nm), adding 0.75 mL of this culture to 0.75 mL 80% w/v glycerol stock and then placing the tube into a Nalgene Cyro freezing container to be frozen at negative 75 degrees Celsius Over-Expression of Trehalose Production LY163, KO11, and TG106 were transformed with pLOI3650, a plasmid containing the otsBA operon under control of a tac promoter that inserts the operon into the genome as a transposon (103). Each strain was grown in 50 mL of LB medium in a 250 mL Erlenmeyer flask after inoculation with a single colony and was grown to approximately 0.5 OD. The culture was 34

PAGE 35

then centrifuged at 5,000 g for 5 minutes and the pellet was resuspended in 10 mL of 50 mM icecold calcium chloride solution. 3 uL of plasmid was added to 200 uL of the resuspended cells and this tube was held on ice for 30 minutes. The suspension was then placed in a 37-degree water bath for 2 minutes and was then removed and held at room temperature for 5 minutes. Subsequently, 1 mL of LB with 50 g liter -1 glucose was added to the suspension and this was transferred to a 37 shaker for 1 hour. These cells were then plated and selected for kanamycin resistance and ampicillin sensitivity to make sure that only the otsBA operon had been inserted. Preliminary tests were then conducted on the resulting colonies with regard to desiccation resistance when grown for 24 hours in either CSL (KO11) or NBS (LY163 and TG106) with 50 g liter -1 glucose. The optimal strains were selected and designated EM2L for the LY163 derivative, EM2P for the KO11 derivative, and EM2T for the TG106 derivative. Testing for Desiccation Survival Cultures were grown in either NBS (for LY163) or CSL (for KO11)--neither medium contained betaine--with 50 g liter -1 xylose, glucose, or sucrose for either 24 hours or to approximately 7 OD. A sample of 10 uL of these cultures were then pipeted into 1.5 mL microfuge tubes that were thereafter transferred to a Pyrex desiccation chamber containing phosphorous pentoxide. Argon was added to the desiccator, via a tube which connected the chamber to a gas tank, to purge the majority of the oxygen from the atmosphere in the chamber. After 3 days of desiccation the cultures were resuspended in 1 mL of 50 g liter -1 xylose solution, and appropriate dilutions were made in 50 g liter -1 xylose so that the colony forming units could then be counted and compared to those of the non-desiccated cultures in order to determine survival. To test for desiccation survival in TG106 and EM2T pH had to be maintained since the organism produces high quantities of lactate. To do this, the cultures were first grown in fleakers 35

PAGE 36

containing NBS with 1 mM betaine and 50 g liter -1 of the appropriate sugar for 24 hours with pH maintained at 7.0 by 6 N KOH addition prior to desiccation over phosphorus pentoxide. Results and Discussion Effect of Sugar Substrate on Survival As a preliminary study KO11 was grown in a variety of sugars and was then desiccated for 3 days, at which point the cells were rehydr ated and plated to obtain colony-forming unit counts (Fig. 3-1). Growth in xylose led to the lowe st levels of survival, with growth on glucose, lactose, arabinose, fructose or mannose giving in termediate survival levels, and sucrose yielding the highest percentage survival by far. From this data it was decided that xylose, glucose, and sucrose be selected as the growth substrates for further investigation with regard to survival to allow for a comprehensive comparison. Addition of 1 mM betaine to KO11 cultures grown for 24 hours with 50 g liter -1 sucrose was also tested to see if it would improve survival, but survival levels of cultures grown in betaine were actually slightly lower than if no betaine was added (data not shown). This was not surprising since similar studies had shown this to be the case under separate conditions (129), and serves as an indication that the principles cells use to cope with osmotic stress as opposed to desiccation differ significantly. Effect of Strain on Survival When grown for 24 hours in NBS with 50 g liter -1 xylose and subsequently rehydrated after 3 days desiccation, extremely low survival was observed for the ethanol producing strains KO11 and LY163 (Table 3-1). Growth in glucose for 24 hours prior to desiccation, compared to xylose, led to slightly higher survival for these strains. Growth in 50 g liter -1 sucrose prior to desiccation led to the highest survival by far of all sugars tested for both strains, although survival of KO11 grown in sucrose was higher than that of LY163. One possible reason for this 36

PAGE 37

discontinuity is that KO11 was grown in corn steep liquor, which is undefined and contains various osmoprotectants, whereas the NBS medium used to grow LY163 does not. In addition to testing the ability of the ethanol-producing E. coli to survive the desiccation process, it was also of interest to determine whether or not E. coli producing other fermentation products could achieve similar levels of recovery. To do this the lactate producing strain TG106 was desiccated after 24 hours growth in fleakers containing NBS with 1 mM betaine and 50 g liter -1 of either, xylose, glucose, or sucrose, and was then rehydrated after 3 days and plated to measure cell counts. As expected, desiccation in xylose led to the lowest levels of survival of the three substrates, although survival was still considerably higher then with either LY163 or KO11. Interestingly, while addition of sucrose again allowed a higher degree of survival than xylose, it was glucose in this instance that led to the highest levels of survival. Cell mass, product levels, remaining sugar, and pH were examined for clues to these differences in survival. Higher survival after desiccation was generally associated with sucrose, lactate instead of ethanol as a fermentation product, lower cell mass, and higher pH. Xylose as the fermentable sugar and accumulated ethanol (above 6 g liter -1 ) were associated with a decrease in survival. Effect of Trehalose Overproduction on Survival Since it was evident that the sugar the cells were grown on had a profound impact on the organisms survival, the question of whether or not increased production of a similar sugar would also confer such tolerance to desiccation aros e, and if this effect in conjunction with sugar substrate would lead to further increases in survival. To test this KO11, EM2P, and EM2P induced were grown for 24 hours in CSL with 5 g liter -1 of either xylose, glucose, or sucrose, desiccated for 3 days, and then rehydrated. When grown on xylose, both KO11 and EM2P 37

PAGE 38

exhibited very low levels of survival, but survival of EM2P was relatively higher, and trehalose induction increased this trend (Fig. 3-2A,B,C). Survival was higher overall when the cultures were grown in glucose, and even higher when the cultures were grown in sucrose, with a combined benefit resulting from the overexpression of trehalose, as shown by higher survival levels in EM2P in all instances compared to KO11. Over-expression of trehalose production in concert with growth on sucrose led to survival levels higher than that which either could provide alone, so it seemed prudent to ask if this phenomenon could be applied to other strains as well. To answer this question the same transposon was inserted in LY163, producing EM2L. Although survival was slightly lower overall in LY163 and its derivatives than with KO ll and EM2P, possibly due to faster growth and hence greater consumption of sucrose, inserting the genes and inducing them led to significantly higher levels of survival than in the parent strain (Fig. 3-2E). Finally, this technique was applied to the lactate producing organism, TG106, making EM2T. EM2T grown in sucrose had higher levels of survival than TG106, with survival rising upon induction (Fig. 3-2F). Effect of Growth Stage on Survival From this data it became clear that growth in sucrose in conjunction with over-expression of trehalose production led to levels of survival higher than that which either could provide alone. The next pertinent question regarded the optimal growth point that E. coli cells should be desiccated at in order to achieve optimal survival. To test this, EM2L was grown uninduced to a range of optical densities. From this experiment it was determined that the optimal desiccation point was late log phase or approximately 7 OD (Fig. 3-3). Using this information LY163, EM2L, and EM2L induced were grown in NBS with 50 g liter -1 sucrose to approximately 7 OD and were then desiccated for three days before rehydration 38

PAGE 39

and plating (Fig. 3-2D). This led to a significant increase in survival for both strains. Possible reasons accounting for this outcome include higher levels of sucrose left in the medium due to lower biomass and fermentation product production (which was shown to be the case by HPLC measurements), as well as a decrease in waste product concentration that might hinder survival. Mechanism of Survival In order to begin to touch upon the mode by which survival is selectively conferred by varying sugar substrates, LY163 was grown for 24hrs in NBS with 50 g liter -1 xylose, glucose, or sucrose, and then directly prior to desiccation was centrifuged to allow for replacement of the spent medium with fresh NBS with 30 g liter -1 xylose, glucose, or sucrose. Interestingly, it was found that if the cultures were grown in xylose and then resuspended in sucrose, high levels of survival were achieved (Fig. 3-4). Conversely, cultures grown in sucrose and then resuspended in xylose had relatively poor levels of survival. This indicates that the mechanism by which the sugar serves to protect the cell involves acting in a direct physiological fashion on the outer cell membrane. Strangely, glucose added to xylose grown cultures also allowed for high survival levels, which may be attributed to the replacement of the supernatant containing various waste products that could have had a separate impact on survival. To test to see if addition of supplemental sucrose directly prior to desiccation would contribute to increased survival, EM2L uninduced was grown for 24 hours and either 0, 1, 2 or 5 percent additional sucrose was added to the culture before transfer to the desiccation chamber (Fig. 3-5). The additional sucrose led to higher survival at all sucrose concentrations, although this trend appeared to offer diminishing returns after the one percent sucrose addition. Since percentage survival was higher than without additional sucrose, but lower than if desiccation occurred at an early growth phase, it indicates that sugar levels are not the only factor involved. Separate experiments were conducted in which KO11 was grown in CSL with 5% sucrose and 39

PAGE 40

was then washed and resuspended in CSL with varying concentrations of sucrose prior to desiccation (Fig. 3-6). This experiment indicates that the optimal concentration of sucrose prior to desiccation to achieve a high level of survival is approximately 5 percent, and that overaddition of sucrose (sucrose concentrations higher than 70 g liter -1 ) leads to a decrease in survival. Effect of Desiccation on Fermentation Desiccation had no measurable effect on grow th and ethanol production by strain EM2L. Fresh and desiccated cells grew to the same density in the seed fermentor and produced ethanol at the same rate in the test fermentor with 100 g L -1 xylose (Fig. 3-7). Yields of over 90% theoretical (0.51 g ethanol per g xylose) were achieved with both. Conclusions The choice of sugar substrate dramatica lly affected desiccation tolerance of E. coli strains engineered for ethanol production and for lactate production. Survival was highest with sucrose, particularly for cells tested during log phase. Further improvements in desiccation tolerance were obtained by increasing the expression of genes for trehalose biosynthesis ( ostBA ) or resuspending cells in fresh medium to remove accumulated products of metabolism prior to desiccation. The benefit of trehalose and sucros e for desiccation tolerance may result in part from their unreactive nature. The presence of xyl ose, a reactive sugar, was detrimental for tolerance during desiccation. For EM2L containing a second copy of otsBA ethanol production using desiccated inocula for seed fermentation were equivalent to that of undessicated inocula. 40

PAGE 41

Figures and Tables Table 3-1. Desiccation of ethanol versus lactate producing E. coli Strain OD 550 nm Ethanol or lactate (g liter -1 ) Remaining sugar (g liter -1 ) pH % Survival KO11 Xylose 10.1 12 14 4.1 <0.001 Glucose 9.5 12 14 3.7 <0.002 Sucrose 8.6 5 29 4.7 20 +/2 LY163 Xylose 11.9 16 2 5.1 <0.02 Glucose 11.2 16 4 5.0 <0.20 Sucrose 10.9 6 24 5.6 5 +/1 TG106 Xylose 3.0 13 29 7.0 2 +/1 Glucose 5.5 26 7 7.0 9 +/5 Sucrose 3.6 15 22 7.0 8 +/4 Figure 3-1. Growth substrate versus desiccation tolerance. Survival of KO11 grown in CSL with 50 g liter -1 xylose, glucose, sucrose, lactose, arabinose, fructose, or mannose prior to desiccation for 3 days and subsequent dehydration in 50 g liter -1 xylose and plating to obtain colony-forming unit counts. 41

PAGE 42

A KO11EM2PEM2P Ind. 0.0000 0.0001 0.0002 0.0003 0.0004% Surivival D LY163EM2LEM2L Ind. 0 25 50 75% Survival B KO11EM2PEM2P Ind. 0 1 2 3 4 5% Survival E LY163EM2LEM2L Ind. 0 10 20 30% Survival C KO11EM2PEM2P Ind. 0 25 50 75% Surivival F TG106EM2TEM2T Ind. 0 10 20 30 40 50% Survival Figure 3-2. Trehalose production and sugar additions combined effect on desiccation tolerance. Survival of KO11, the ethanol producing parent strain, and EM2P, the derivative over-expressing the genes for trehalose production, after being grown in CSL with 50 g liter -1 xylose (A), glucose (B), or sucrose (C) for 24 hrs prior to chemical desiccation and subsequent rehydration and plating. Survival of LY163, the parent ethanol producing strain, and EM2L, a derivative of LY163 over-expressing trehalose, after being grown to 7OD (D) or for 24 hrs (E) in NBS with 50 g liter -1 sucrose prior to desiccation. (F) Survival of TG106, the parent lactate producing strain, as well as EM2T, the derivative made to over-express the genes for trehalose production, after growth in fleakers containing NBS with 1 mM betaine and 50 g liter 1 sucrose prior to subsequent desiccation. 42

PAGE 43

0 5 10 15 20 25 0 5 10 15 Time (hrs)OD550nm 0.0 2.5 5.0 7.5 10.0 12.5 0 25 50 75 100 OD550nm% Survival 0.0 2.5 5.0 7.5 10.0 12.5 0 100 200 OD550nm Sucrose (mM) 0.0 2.5 5.0 7.5 10.0 12.5 0 250 500 750 OD550nmCFU per mL *107 Figure 3-3. Cell densitys effect on desiccation tolerance. Survival of EM2L grown to a range of optical densities in NBS with 50 g liter -1 sucrose prior to chemical desiccation for 3 days and subsequent rehydration and plating to measure colony-forming units. Survival shown as either CFU per mL or percentage survival. Corresponding sucrose levels as well as a growth curve of EM2L in 50 g liter -1 sucrose are also depicted. 43

PAGE 44

Figure 3-4. Growth sugar versus added sugars affect on desiccation tolerance. Survival of LY163 after growth for 24 hours in NBS with 50 g liter -1 xylose, glucose, or sucrose, with subsequent resuspension of cells--directly prior to desiccationin 30 g liter -1 of the indicated sugar (xylose, glucose, sucrose, or arabinose). For instance, gx-rx means grown in xylose (gx) and resuspended in xylose (rx). 0102050 0 25 50 75 Sucrose addition (g liter-1)Percentage survival Figure 3-5. Effect of sugar addition directly pr ior to desiccation. Survival of EM2L grown in NBS with 50 g liter -1 sucrose and subsequent addition of a range of sucrose concentrations directly prior to chemical desiccation for 3 days followed by rehydration and plating. 44

PAGE 45

A 0 25 50 75 100 125 0 100 200 Sucrose (g liter-1)CFU per mL *107 B 0 25 50 75 100 125 0 10 20 30 40 Sucrose (g liter-1)% survival Figure 3-6. Sugar concentration versus desiccati on tolerance. Survival of KO11 grown in CSL with 50 g liter -1 sucrose and then washed and resuspended in a range of sucrose concentrations prior to chemical desiccation, rehydration, and plating, expressed as either cfu per ml (A) or percentage survival (B). A 0 25 50 75 100 125 0.0 2.5 5.0 7.5 10.0time (hours)OD550nm B 0 25 50 75 100 125 0 10 20time (hours)KOH (2N) C 0 25 50 75 100 125 0 10 20 30 40 50time (hours)Ethanol (g liter-1) Figure 3-7. Ability of previously desiccated cells to ferment. Strain EM2L was grown overnight as described for desiccation and used either directly to inoculate a seed fermentation (3.5 ml, 1% by volume; NBS medium, 50 g liter -1 xylose) or dessicated (35 droplets of 0.1 ml each on parafilm; stored for 3 days) prior to use in a second seed fermentation. After 24 h incubation (37 C, 150 rpm, controlled at pH 6.5 with 2 M KOH), each seed fermentation was used to inoculate a test fermentation containing NBS media under the same conditions. Cell mass, base addition, and ethanol were measured during a 96 h incubation. Symbols for all: previously dessicated EM2L ( ) versus undessicated EM2L ( ). 45

PAGE 46

CHAPTER 4 INCREASING TOLERANCE TO FURFURAL Introduction A wide variety of fermentation products can be made using sugars from lignocellulosic biomass as a substrate (40, 51, 55, 135). Prior to fermentation, however, the carbohydrate polymers cellulose and hemicellulose must be converted to soluble sugars using a combination of chemical and enzymatic processes (122, 131). Chemical processes are accompanied by side reactions that produce a mixture of minor products such as alcohols, acids, and aldehydes which have a negative effect on the metabolism of micr obial biocatalysts. Alcohols (catechol, syringol, etc.) have been shown to act by permeablizing the cell membrane and toxicity correlates well with the hydrophobicity of the molecule (137). Orga nic acids (acetate, formate, etc.) are thought to cross the membrane in neutral form and ionize within the cytoplasm, inhibiting growth by collapsing the proton motive force (93, 136). The inhibitory mechanisms of aldehydes are more complex. Aldehydes can react to form products with many cellular constituents in addition to direct physical and metabolic effects (82, 113). In aggregate, these minor products from chemical pretreatments can retard cell growth and slow the fermentation of biomass-derived sugars (46, 92). Furfural (a dehydration product of pentose sugars) is of particular importance (3). Furfural content in dilute acid hydrolysates of hemicellulose has been correlated with toxicity (74). Removal of furfural by lime addition (pH 10) rendered hydrolysates readily fermentable while re-addition of furfural restored toxicity (73). Furfural has also been shown to potentiate the toxicity of other compounds known to be present in acid hydrolysates of hemicellulose (136138). Furfural has been reported to alter DNA stru cture and sequence (9, 59), inhibit glycolytic enzymes (34), and slow sugar metabolism (48). 46

PAGE 47

The ability of fermenting organisms to function in the presence of these inhibitors has been researched extensively. Encapsulation of S. cerevisiae in alginate has been shown to be protective and improve fermentation in acid hydrolysates of hemicellulose (119). Strains of S. cerevisiae have been previously described with improved resistance to hydrolysate inhibitors (4, 71, 89). E. coli (36), S. cerevisiae (5) and other microorganisms (13) have been shown to contain enzymes that catalyze the reduction of furfural to the less toxic product, furfuryl alcohol (137). In E. coli, furfural reductase activity appears to be NADPH-dependent (36). An NADPH-dependent furfural reductase was purified from E. coli although others may also be present. An NADPH-dependent enzyme capab le of reducing 5-hydroxymethyl furfural (a dehydration product of hexose sugars) has been characterized in S. cerevisiae and identified as the ADH6 gene (99). Isolation of a furfural-resistant E. coli mutant (EMFR9) in which furfural reductase activity is lower than that of the parent (LY180) due to decreased expression of yqhD and dkgA is described in this section The reduction of furfural by these two NADPH-dependent oxidoreductases is proposed to inhibit growth by depleting NADPH needed for biosynthesis. Thereafter, we use global transcript analysis to expand our investigations in order to include the broader cellular response to added furfural using the parent organism, strain LY180. Materials and Methods Strains, Media, and Growth Conditions Strains and plasmids used in this study are listed in Table 4-1. Plasmid and strain constructions were made using Luria broth (78). Antibiotics were included as appropriate. Temperature-conditional plasmids were grown at 30 o C; all others were grown at 37 o C. Ethanologenic strains were maintained in AM1 mineral salts medium (72) supplemented with 20 g liter -1 xylose for solid medium and 50 g liter -1 xylose or higher for liquid medium used in 47

PAGE 48

fermentation experiments. E. coli strain LY168 (51) is a derivative of KO11 and served as the starting point for this investigation. Note that E. coli W (ATCC 9637) is the parent for strain KO11, initially reported to be a derivative of E. coli B (90). Construction of Strain LY180 Strain LY168 has been previously described for the fermentation of sugars in hemicellulose hydrolysates (51). Several modifications were made to improve substrate range (restoration of lactose utilization, integration of an endoglucanase, and integration of cellobiose utilization) resulting in LY180. Linear DNA fragme nts used for integration are shown in Figure 4-1 and have been deposited in GenBank. The FRT region in lacY was replaced with the native E. coli ATCC 9637 sequence by double homologous recombination using Fragment A containing lacZ lacY lacA cynX (24, 53). Integrated strains were selected directly for lactose fermentation. The frdBC region downstream from frdA::Zm frg celY Ec ( Erwinia chrysanthemi ) was deleted by double homologous recombination us ing a two step process (53). Fragment B ( frdB a cat, sacB cassette, and frdC ) was integrated first with selection for chloramphenicol resistance. The cat-sacB cassette was then replaced with Fragment C consisting of frdA Z. mobilis promoter fragment, E. chrysanthemi celY and frdC by selecting for resistance to sucrose. This replacement also deleted an FRT site. The K. oxytoca genes encoding cellobiose utilization (casAB ) were inserted into ldhA by double homologous recombination also using a two step process (53). Fragment D ( ldhA a cat-sacB cassette, casAB and ldhA ) was used to replace the FRT site in ldhA with selection for resistance to chloramphenicol. The cat-sacB cassette was then replaced with Fragment E consisting of ldhA a promoter fragment from Z. mobilis, and K. oxytoca casA. Integrated strains were isolated by selecting directly for cellobiose fermentation. All constructs were verified by analyses of phenotypes and PCR products. 48

PAGE 49

Growth-Based Selection for a Furfural Resistant Strain LY180 was inoculated into a 500-mL vessel (initial inoculum of 50 mg dcw liter -1 ) containing 350 ml of AM1 supplemented with 100 g liter -1 xylose and 0.5 g liter -1 furfural (37C, 150 rpm, pH 6.5). Cultures were serially diluted into new fermentors at 24-h intervals, or when cell mass exceeded 330 mg dcw liter -1 Furfural was gradually increased to 1.3 g liter -1 as growth permitted. After 54 serial transfers, a resi stant strain was isolated and designated EMFR9. Furfural Resistance and Metabolism During Fermentation Furfural resistance was compared in small fermentors (37C, 150 rpm, pH 6.5, 350-ml working volume) using AM1 medium (72) containing 100 g liter -1 xylose. Seed cultures were inoculated to approximately 33 mg dcw liter -1 Samples were removed periodically to measure cell mass, ethanol, and furfural. Furfural toxicity (MIC) was also examined using tube cultures (13x100 mm) containing 4 ml of AM1 broth with 50 g liter -1 (wt/vol) filtered-sterilized sugar, furfural, and other supplements. Cultures were inoculated to an initial density of 17 mg dcw liter -1 Cell mass was measured after incubation at 37C for 24 h and 48 h. Comparison of Hydrolysate Toxicity A hemicellulose hydrolysate of sugar cane bagasse was produced using dilute sulfuric acid at elevated temperature and pressure and supplied by Verenium Corporation (Boston, MA). This hydrolysate contained 82 g liter -1 total sugar (primarily xylose), 1.4 g liter -1 furfural, and other constituents. Hydrolysate was supplemented with the mineral components of AM1 medium, adjusted to pH 6.5 using 45% KOH, and diluted with complete AM1 (80 g liter -1 xylose). Diluted samples of hydrolysate were distributed into 13 mm X 100 mm culture tubes (4 mL each), inoculated to an initial cell density of 17 mg dcw liter -1 and incubated at 37C. Cell 49

PAGE 50

mass (after centrifugation and resuspending in brot h) and ethanol concentration were measured after 48 h. Microarray Analysis Cultures were grown in small fermentors to a density of 670 mg dcw/L. An initial sample was removed that served as a control. Furfural was immediately added from a 50 g L -1 aqueous stock (0.5 g liter -1 final concentration) and incubation continued for 15 minutes prior to a second sampling. Samples were rapidly cooled in an ethanol-dry ice bath, harvested by centrifugation at 4 0 C, resuspended in Qiagen RNA Later and stored at 0 C until RNA extraction. RNA was purified using a Qiagen RNeasy Mini Kit, treated with DNase I and purified by phenol/chloroform extraction and ethanol precip itation. RNA was sent to NimbleGen (Madison, WI) for microarray comparisons using templates designed for E. coli K12. Each sample consisted of pooled material from four fermentors. The complete experiment was performed twice. Data was analyzed with ArrayStar so ftware (DNA Star, Madison, WI), and by SimPheny (Genomatica Inc., San Diego, CA). Expression ratios are presented as the average of the twopooled datasets, although it should be noted that the oxidoreductase experiments were based on the initial microarray dataset only. A control experiment was performed during which water was added. 54 genes (>2% of chromosome) changed more than 2-fold after water addition. Only 8 of these were also affected by furfural addition indi cating that the effect of disturbing the culture by liquid addition was negligible for the furfural response. Network Component Analysis Network Component Analysis (NCA) calculates transcription factor activity ratios from expression ratios and known regulatory connections and was performed as previously described (49). The connectivity file was updated accord ing to Regulon DB and Ecocyc (33, 54). The regulon of the stringent factor was defined as previously described, via analysis of the 550

PAGE 51

minute response to serine starvation via serine hydroxamate treatment during mid-log growth of BW25113 in MOPS glucose (49). Regulators with significantly altered regulatory activity were identified by comparison to a null distribution and using a P-value cutoff of 0.05. Cloning and Deletion of Genes Oxidoreductase genes for expression studies (ribosomal-binding sites, coding regions, and 200 base pair terminator regions) were am plified from strain LY180 genomic DNA using a BioRad iCycler (Hercules, CA), ligated into pCR 2.1 TOPO vector, and cloned into E. coli TOP10F using an Invitrogen TOPO TA Cloning Kit (Carlsbad, CA). Plasmids were purified using a QiaPrep Spin Mini Prep Kit. Gene orientation was established by PCR. E. coli transhydrogenase genes were amplified (ribosomal-binding sites, coding regions, and a 200 bp terminator region) from strain LY180 genomic DNA using a BioRad iCycler (Hercules, CA) with primers that provided flanking HindIII sites. After digestion with HindIII, the product was ligated into HindIII digested pTrc99a (vector) and transformed into E. coli TOP10F (Carlsbad, CA). Plasmids were purified using a QiaPrep Spin Mini Prep Kit (Valencia, CA). Gene orientation was established by diges tion with restriction enzymes and by polymerase chain reaction. A yqhD deletion was constructed in LY180 as described by Datsenko and Wanner (24) using the plasmids pKD4 and pKD46. A dkgA deletion in LY180 was constructed as described by Jantama et al. (53). A double mutant with deletions in both yqhD and dkgA was also constructed. Repeated attempts to delete the yqfA gene were not successful. Purification and Kinetic Analysis of YqhD and DkgA Both the yqhD and dkgA genes were cloned into a Novagen pET-15b vector and expressed as a His-tagged protein in E. coli BL21 (DE3). Cells were grown with IPTG to approximately 1.3 g dcw liter -1 washed with 100 mM phosphate buffer, and lysed using MP Fast 51

PAGE 52

Prep-24 (MP Biomedical, Solon, OH) and Lysing Ma trix B. Crude extracts were passed through a 0.22 m PVDF filter and further purified using a 1 mL HiTrap nickel column. Purified enzymes were dialyzed in 100 mM phosphate buffer using a Thermo Slide-A-Lyser and quantified using a Thermo BCA Protein Assay Kit. Purity of YqhD and DkgA were estimated to be greater than 90% by SDS-PAGE. A single band was observed for each in an SDS-PAGE gel. Estimated sizes of the purified proteins were in agreement with predicted values of 43 kD and 31 kD, respectively. Apparent Kcat and apparent Km values were determined for both purified enzymes using NADPH and furfural. Whole-cell Assays of Furfural Metabolism in Vivo during Fermentation Whole-cell furfural metabolism was measured using fermentors in which cultures were grown to a density of 670 mg dcw liter -1 (mid log phase). Furfural was added to an initial concentration of 0.5 g liter -1 Samples were removed at zero time and after 15, 30, and 60 min of incubation for the measurement of furfural and cell mass. The specific rate of furfural metabolism was calculated using the average cell mass during each assay interval. Results are expressed as moles min -1 mg dcw -1 In Vitro Assay of Furfural Reduction Anaerobic tube cultures were grown in AM1 medium containing 50 g liter -1 xylose and harvested in mid log phase (0.7-1.0 g dcw liter -1 ). Cells were washed once with 20 mL 100 mM potassium phosphate buffer (pH 7.0), resuspended in phosphate buffer to approximately 6.5 g dcw liter -1 chilled on ice, and lysed for 20 sec using a FastPrep-24 cell disruptor and Lysing Matrix B. Debris was removed by centrifugation (13,000 x g; 10 min) and the supernatant used to measure furfural-dependent oxidation of NADH and NADPH. Assays contained 100 mM phosphate buffer (pH 7.0), 20 mM furfural, and 0.2 mM reductant (NADPH or NADH). 52

PAGE 53

Furfural-dependent activity ( moles min -1 mg protein -1 ) was measured as the change in absorbance at 340nm. Greater than 80% of activity was NADPH-dependent. Analyses Ethanol was measured using an Agilent 6890N gas chromatograph (Palo Alto, CA) equipped with flame ionization detectors and a 15-meter HP-PlotQ megabore column. Dry cell weight was estimated by measuring optical dens ity at 550nm using a Bausch & Lomb Spectronic 70 spectrophotometer. Each OD 550nm is equivalent to approximately 333.3 mg dcw liter -1 Furfural levels in AM1 medium were measured by absorbance at OD 284nm and OD 320nm (20). The accuracy of this method was confirmed by HPLC analysis. Furfural content of bagasse hemicellulose hydrolysate was measured us ing an Agilent LC1100 liquid chromatograph (refractive index monitor and UV detector) and an Aminex HPX-87P ion exclusion column (BioRad, Hercules, CA) with water as the mobile phase Furfural tolerance for growth was measured in standing tubes with 4 mL total volume of AM1 and 50 g liter -1 filter-sterilized xylose. Tubes were incubated at 37 0 C and measured after 24 and 48 h. Values reported are an average of at least 3 measurements. Results and Discussion Isolation and Initial Characterization of a Furfural-Resistant Mutant A furfural-resistant derivative of LY180 was is olated after 53 serial transfers in pHcontrolled fermentors (Fig. 4-2) containing AM1 mineral salts medium with 100 g liter -1 xylose and increasing concentrations of furfural (0.5 g liter -1 initially to final concentration of 1.3 g liter 1 ). Attempts to directly isolate mutants resistant to 1.0 g liter -1 furfural in a single step (solid medium and broth) were not successful. Step-w ise improvement in furfural tolerance was observed during serial transfers, consistent with multiple changes. The resulting strain, EMFR9, grew and fermented xylose in the presence of 1.0 g liter -1 furfural at a rate equivalent to the 53

PAGE 54

parent LY180 in the absence of furfural (Fig. 4-3). Growth and ethanol production by EMFR9 also exceeded that of the parent LY180 in the absence of furfural. Addition of a low furfural concentration (0.4 g liter -1 ) to the parent LY180 caused an initial lag in growth and ethanol production (Fig. 4-3A and 4-3B). During this lag, furfural was chemically reduced to the less toxic furfuryl alcohol (137, 138) (Fig. 4-3C). Growth and fermentation increased by more than 3-fold immediately following the complete removal of furfural. Growth and ethanol production by LY180 were strongly inhibited by 1.0 g liter -1 furfural throughout the 72-h incubation (Fig. 4-3D and 4-3E). During this time, approximately 20% of the furfural was reduced indicating that LY180 remained metabolically active (Fig. 43F). In contrast to LY180, EMFR9 was virtually unaffected by the presence of furfural (0.4 g liter -1 or 1.0 g liter -1 ) (Fig. 4). The volumetric rate of furfural reduction was higher for EMFR9 than LY180 at both furfural concentrations (Figur e 4-3C and 4-3F), primarily due to the larger amount of cell mass (Fig. 4-3A). This was confirmed by further experiments in which the in vivo rate of NADPH-dependent furfural reduction by EMFR9 (per mg dcw) was found to be about half that of the parent LY180. In contrast to LY180, growth and fermentation of EMFR9 did not require prior reductive removal of furfural. With EMFR9, both 0.4 g liter -1 and 1.0 g liter -1 furfural were reduced to furfuryl alcohol c oncurrently with growth. Reduction by EMFR9 was complete after 12 h and 18 h, respectively (Fig. 4-3C and 4-3F). Together, these results suggest that the process of reducing furfural rather effects of the compound itself may be the primary site of growth inhibition at low concentrations. The loss of function, i.e. a decrease in furfural reducing activity, correlated with an increase in furfural tolerance in the mutant. Based on these results, we propose that the inhibition of growth by 54

PAGE 55

furfural results from competition between biosynthetic needs and furfural reduction for a limited pool of NADPH. Effect of Media Composition on Furfural Resistance (MIC) Unlike glucose, the production of NADPH is problematic during xylose fermentation (130) and offers an approach to test the NADPH-competition hypothesis by measuring the MIC for furfural in different media. In mineral salts media with 50 g liter -1 xylose (Fig. 4-4A), the minimal inhibitory concentration (MIC) of furfural was approximately 1.0 g liter -1 for LY180 (parent) and 2.0 g liter -1 for the mutant EMFR9. Replacement of xylose with glucose would be expected to increase the pool of NADPH. This change (Fig. 4-4B) increased the furfural MIC by 50% for LY180 (1.5 g liter -1 ) and by 25% for EMFR9 (2.5 g liter -1 ). Addition of a small amount of yeast extract (1.0 g liter -1 ) to xylose-mineral salts medium would be expected to decrease biosynthetic demands for NADPH. This supplement (Fig. 4-4C) doubled the furfural MIC for the parent LY180 (2.0 g liter -1 ) and increased the MIC for EMFR9 (2.5 g liter -1 ) by 25%. With all media, EMFR9 was more resistant to furfural than the parent LY180. Both glucose (increased NADPH production) and yeast extract (decreased need for biosynthesis) increased furfural tolerance. However, this benefit was more pronounced for the parent, strain LY180, than for the mutant EMFR9, consistent with the lower level of furfural reductase activity in EMFR9. The MIC for three other compounds known to be present in hemicellulose hydrolysates were also examined: 2-hydroxymethyl furfur al (analogue, dehydration product of hexose sugars), furfuryl alcohol (reduced product of fu rfural), and syringaldehyde (degradation product of lignin). EMFR9 was slightly more tolerant to 2-hydroxymethyl furfural (MIC of 3.0 g liter -1 ) than LY180 (MIC of 2.5 g liter -1 ). Both strains were equally sensitive to syringaldehyde (MIC 2.0 g liter -1 ) and furfuryl alcohol (15 g liter -1 ) (data not shown). The absence of an increase in 55

PAGE 56

tolerance to other compounds in EMFR9 is consistent with a specific site or target for furfural toxicity. Comparison of Oxidoreductase Expression by mRNA Microarray Analysis Previous studies have demonstrated that E. coli contains NADPH-dependent enzyme(s) capable of reducing furfural to a less toxic compound (furfuryl alcohol) but no gene was identified (36). The dependence of the parent LY180 on the complete reduction of furfural prior to growth and the loss of this dependence by EMFR9 further implicates oxidoreductases as being of primary importance for furfural sensitivity. Microarray analysis of mRNA was used to identify candidate oxidoreductase genes for furfural reduction. Cultures of LY180 and EMFR9 were grown to mid-log phase in pHcontrolled fermentations with 100 g liter -1 (wt/vol) xylose. For this comparison, RNA was isolated 15 min after the addition of 0.5 g liter -1 furfural. A total of 12 known and putative oxidoreductases were found that differed by appr oximately 2-fold or higher (Table 4-2). Four oxidoreductases were identified that were expressed at lower levels in EMFR9 (Table 4-2). Each of these four genes was cloned into plasmids and transformed into EMFR9. When expressed from plasmids, three of these genes ( dkgA yqhD and yqfA ) were found to decrease furfural tolerance (Fig. 4-5). Expression of yqhD and dkgA were most detrimental and both were shown to increase furfural reductase activity in EMFR9 (Fig. 4-6). Expression of yqfA did not restore furfural reductase activity of EMFR9 and its effect on growth inhibition may be related to other functions. No detrimental effect on growth was observed for yjjN. Thus the decrease in expression of yqhD, dkgA and yqfA in EMFR9 can be inferred to be beneficial for furfural tolerance. Silencing of yqhD and dkgA in EMFR9 would decrease the competition with biosynthesis for NADPH during furfural reduction. It should be noted that effects seen under 56

PAGE 57

uninduced conditions can be attributed to a leaky promoter that allows expression of each cloned gene, in conjunction with the high copy number of the pCR2.1 TOPO vector. The other eight genes were cloned from LY180 into pCR2.1 TOPO for expression. These oxidoreductases had increased expression in EMFR9 (1.8-fold to 4.5 fold) relative to the parent LY180. Plasmids containing each of these genes were transformed into LY180. However, none of these 8 caused an increase or decrease furfural tolerance (data not shown). To further examine the potential importance of yqhD, dkgA and yqfA silencing, attempts were made to delete each of these genes from LY180. Although deletions of both yqhD and dkgA were readily recovered, similar methods were not successful with yqfA In LY180, deletion of yqhD alone or in combination with dkgA caused an increase in furfural tolerance (Fig. 4-7) and a decrease in furfural reductase activity in vivo similar to that of EMFR9 (Fig. 4-6). Since deletion of dkgA alone in LY180 did not lower the in vivo reductase activity or increase furfural tolerance, YqhD is presumed to be the more important activity for growth inhibition by low concentrations of furfural. The lowest furfural reductase activity was found after deletion of both genes. Characterization of YqhD and DkgA The largest changes in gene expression among oxidoreductases were the silencing of yqhD and dkgA Both YqhD and DkgA were expressed as his-tagged proteins in BL21 ( DE3) and purified to discernable homogeneity. Both enzymes catalyzed the NADPH-dependent reduction of furfural to furfuryl alcohol. The apparent K m values for furfural were relatively high for YqhD (9.0 mM) and DkgA (>130 mM). With such values, it is unlikely that furfural is the native substrate of either enzyme. Reasonably assuming that cells are permeable to furfural, the intracellular activities of YqhD and DkgA would be expected to vary over the range of furfural concentrations used for selection (5-14 mM; 0.5-1.3 g liter -1 ). The apparent Km values for 57

PAGE 58

NADPH were quite low for both YqhD (8 M) and DkgA (23 M). In the presence of furfural, the high affinity of both enzymes for NADPH would compete with biosynthetic reactions for NADPH. Partitioning of NADPH among pathways would be determined by the K m for NADPH, steady state pool size of NADPH, and the relative abundance of competing oxidoreductase activities. Several key metabolic enzymes have a Km for NADPH higher than that of YqhD (8 uM), including CysJ (80 uM), required for sulfate assimilation to form cysteine and methionine, ThrA (90uM), required for the formation of threonine, and DapB (17 uM), for lysine formation (109). Tolerance to Acid Hydrolysate of Hemicellulose Hemicellulose hydrolysates contain a mixture of compounds that act in combination to inhibit microbial growth and fermentation (73, 74, 136-138). Growth and fermentation were examined in dilutions of a neutralized hydrolysate that contained 1.4 g liter -1 furfural (Fig. 4-8). Although the MIC values for growth and ethanol production were similar (30% hydrolysate), EMFR9 grew to a 3-fold higher density and produced over 10-fold more ethanol in 20% hydrolysate than the parent LY180. Selection of EMFR9 for increased resistance to furfural was accompanied by an increase in resistance to hemicellulose hydrolysate, confirming the importance of furfural as a component of hydrolysate toxicity. Global Effect of Furfural on the Transcriptome Message levels were compared in actively growing cells before and 15 min after the addition of 0.5 g L -1 fufural. Expression levels for 412 genes (10% of the transcriptome) were altered (2-fold or greater) by the addition of fu rfural. The distribution of these altered genes varied widely among functional groups, providing useful insight into the mechanism of furfurals action (Table 4-3). In most functional groups, expression levels of less than 10% of the gene members were altered by 2-fold or greater. Groups with this low frequency of change included 58

PAGE 59

cofactors, carbon compounds, regulatory, macrom olecular synthesis (Cell structure, DNA, Lipids, Transcription, and Translation), and others (Phage, Putative/IS, Regulatory, and Unclassified/Unknown). Expression levels for 10% to 20% of the member genes were altered in four groups (Cell processes, Central metabolism, Energy, and Transport). Most of the affected genes associated with central metabolism, energy, and transport increased in expression upon furfural addition. These changes could provide an opportunity to scavenge and metabolize additional compounds that may be available and to increase carbon flow for energy production. Although strain LY180 is non-motile, many of the altered genes concerned with cell processes are involved in motility and chemotaxis and were not investigated further. Expression levels for over 20% of the member genes in two functional groups were altered by the addition of furfural, Amino acids and Nucleotides. In these groups, over 2/3 of the altered genes were reduced by 2-fold or greater upon the addition of furfural. Expression levels for individual genes affecting the biosynthesis of purines, pyrimidines, and every family of amino acids were reduced by 2-fold or greater upon the addition of furfural. A single gene in nucleotide metabolism and only a minority of genes involved in amino acid metabolism exhibited a furfural-dependent increase in expression. Together, these changes agree well with the generalized decrease in biosynthesis and growth observed upon the addition of furfural. Effect of Furfural on Regulatory Activity Network component analysis (NCA) was used to provide a global view of the cellular response to furfural. This analysis uses known regulatory network structure to identify regulators with perturbed activity from transc riptome data (15, 66). Of the 60 regulators included in this analysis, 22 were identified as being altered in expression by furfural relative to a random network (Table 4-4, Fig. 4-9). Perturbation of RpoS, a sigma factor that acts as a signal for general stress response, indicates that the cell recognizes the presence of a stress59

PAGE 60

inducing agent. Since up to 10% of E. colis genome is regulated in some fashion by RpoS (95, 128), it is difficult to determine a specific inhibitory response. RpoS-regulated genes with increased expression upon furfural addition include poxB involved in conversion of pyruvate into acetate and CO 2 (139), and otsA required for trehalose protection during osmotic stress response (115). Regulators of cysteine and methionine biosynthesis (CysB and MetJ) as well as repressors of amino acid (ArgR) and nucleotid e biosynthesis (PurR) were also significantly affected by furfural addition. The stringent factor a collective indicator of the stringent response (a diversion of resources away from growth to amino acid biosynthesis during amino acid and carbon starvation) also shows activation consistent with stalled biosynthesis and an excess of many intermediates. Together, these results indicate that the pools of many amino acids and biosynthetic intermediates have been altered by furfural addition. The fact that expression of genes concerned with cysteine and methionine biosynthesis increased while expression of other biosynthesis pathways declined is consistent with a depletion of cysteine and methionine pools as an early event resulting from a furfural challenge. Histidine may also be limited by the addition of furfural. Genes (hisA hisB hisC hisD hisF hisH and hisI ) under control of the His regulator (histidinyl-tRNA) were generally increased after the addition of furfural, although less than 2-fold (Fig. 4-10). The two terminal steps in histidine biosynthesis involve the reduction of NAD + to NADH, a reaction that may be slowed by the high NADH/NAD + ratio associated with fermentation. The up-regulation of several glycerol metabolism genes ( glpT and glpD in Figure 4-9, and glpF and glpK in Table 4-3) led us to investigate the effect of glycerol supplementation on furfural tolerance. However, the addition of glycerol (1.0 to 20 g liter -1 ) had no effect on furfural 60

PAGE 61

tolerance (data not included). Several other regulators, including fis and crp, were found to be significantly altered by NCA. Effect of Furfural on Amino Acid Sulfur Assimilation Gene Expression Genes concerned with sulfur assimilation into cysteine, and methionine are scattered within several Functional groups (Amino acid, Central metabolism, Regulation, and Transport). All that were perturbed by 2-fold or greater (Table 4-3) were increased by the addition of furfural ( cysC, cysH, cysI, cysM, cysN, cysQ, metA, metB metC metL, sbp, tauA, tauB, tauC and tauD ). Many additional genes involved in sulfur assimilation were also up-regulated less than 2-fold and have been included to demonstrate the furfural response (Fig. 4-11). Sulfur is supplied as sulfate in AM1 medium and must be reduced to the level of hydrogen sulfide for incorporation, an energy intensive reaction requiring 4 molecules of NADPH. The furfural-induced increase in expression of these genes is in sharp contrast to the decreases observed for many other genes concerned with the biosynthesis of amino acids, purines, and pyrimidines (Table 4-3). Expression of the taurine transport genes (tauABCD ; alternative source of sulfur), the sulfatebinding transport protein ( sbp), and the transcriptional activator of many cysteine biosynthetic genes were increased by more than 5-fold in response to added furfural. Together, these results suggest that the addition of furfural results in an intracellular deficit in sulfur-containing amino acids (cysteine and methionine) which may be associated with the high NADPH requirement in this pathway. Effect of Amino Acid Supplements on Furfural Tolerance All 20 amino acids were individually tested for their ability to improve the growth of LY180 in AM1 mineral salts medium (Fig. 4-12A, 4-12B). A concentration of 0.1 mM was selected roughly based on the cellular content of individual amino acids (87). Only four amino acids improved furfural resistance when supplied at this low concentration: cysteine > 61

PAGE 62

methionine > serine, arginine > histidine. The two sulfur amino acids were clearly the most beneficial for furfural resistance. When supplie d at a 5-fold higher concentration (0.5 mM), all amino acids were beneficial to some degree (Fig. 4-12B). However, cysteine remained the most effective followed by serine, methionine, and arginine. A cysteine concentration of 0.05 mM allowed LY180 to grow to a density of 1 g liter -1 in the presence of 1.0 g liter -1 furfural, approximately equal to the total cellular sulfur (Fig. 4-12C). No measurable improvement in furfural resistance was observed with 0.01 mM cysteine. I considered the possibility that the protective effect of L-cysteine could result from a chemical reaction with furfural in AM1 medium. However, the protective concentration of cysteine (0.05 mM) was 200-fold lower than that of 1.0 g liter -1 furfural (10 mM) making this unlikely. Furfural in mineral salts medium can be readily quantified by its characteristic spectrum (75) and remained unchanged during a 48 hr incubation at 37C, consistent with minimal chemical reactivity. The beneficial effects of histidine, serine, and arginine for furfural tolerance are not immediately apparent. Most genes concerned with histidine biosynthesis increased in response to furfural addition, although less than 2-fold (Fig. 4-10). De novo biosynthesis of histidine during fermentation may be constrained by the high NADH/NAD + ratio during anaerobic growth and the requirement for further reduction of NAD + in the two terminal steps of biosynthesis. Similarly, the first committed step in serine biosynthesis also involves the reduction of NAD + and may be hindered during fermentation. Increasing serine may also increase the efficiency of incorporating reduced sulfur from H 2 S into cysteine. Genes concerned with arginine biosynthesis ( argA, argB,, argC, argD, carA, carB, and argG ) were generally lowered by the addition of furfural. However, the expression level of speA encoding arginine decarboxylase was increased 62

PAGE 63

by the addition of furfural. The degradation of arginine may provide useful intermediates and cofactors for biosynthesis. Effect of Alternative Sulfur Sources on Furfural Tolerance The addition of furfural inhibited growth and increased the transcription of genes concerned with sulfur assimilation. Genes involved in the uptake and incorporation of the alternative sulfur compound, taurine ( tauABC and tauD ), were among the 10 genes with the largest increases in expression. The tau genes are typically expressed only during sulfur starvation (125). Since cysteine was effective in relieving furfural inhibition, the increased expression of these genes can be presumed to result from a reduction in the pool of sulfur amino acids by furfural. Furfural could inhibit sulf ur amino acid biosynthesis either by limiting the availability of reduced sulfur (H 2 S) from sulfate or by inhibiting the incorporation of reduced sulfur into cysteine. These possibilities were examined during growth in AM1 medium containing 1.0 g liter -1 furfural by comparing the effects of alternative su lfur sources (L-cysteine, D-cysteine, taurine, sulfite, and sodium thiosulfate) that enter metabolism at different levels of reduction. Note that 4 NADPH molecules and two reductase enzymes (CysH and CysIJ) are required to fully reduce sulfate prior to assimilation into cysteine. L-cysteine, D-cysteine and thiosulfate bypass both reductase enzymes and all were effective at relie ving furfural inhibition (Fig. 12D). D-cysteine cannot be incorporated directly and is first catabolized to H 2 S. Thiosulfate also serves as a source of reduced sulfur for incorporation by CysM (69). Taurine is catabolized to sulfite in the cytoplasm and must be reduced by sulfite reductase (CysIJ and 3 NADPH molecules) prior to assimilation into cysteine (111). Unlike cysteine and thiosulfate, taurine was not effective in preventing the inhibition of growth by 1.0 g liter -1 furfural. These results with alternative sulfur sources indicate that furfural acts to inhibit growth 63

PAGE 64

by limiting the production of reduced H 2 S from sulfate rather than by inhibiting the incorporation of reduced sulfur into cysteine. With taurine as a sulfur source, furfural must act at the level of sulfite reductase (CysIJ). With sulfate as a sulf ur source, further effects of furfural at earlier steps in anabolism cannot be excluded. Effect of Increasing Transhydrogenase Expression on Furfural Tolerance Growth of LY180 is inhibited only while furfural is being metabolized and resumes after complete reduction to furfuryl alcohol by NADP H-dependent enzymes. Silencing two genes ( yqhD and dkgA ) encoding low Km, NADPH-dependent furf ural reductases provided resistance to over 1.0 g liter -1 furfural. Although furfural may inhibit sulfur amino acid production by directly affecting enzymes concerned with the conversion of sulfate and sulfite to H 2 S, it is also possible that the inhibition of this process results from an indirect effect of furfural on the availability of NADPH. To test this hypothesis, the two E. coli transhydrogenases (SthA and PntAB) were cloned into pTrc99a and confirmed by sequencing. The growth of LY180 was reduced on plates and in broth by the presence pTrc99a plasmids and antibiotics (antibiotics may have forced the cells to maintain pTrc99a, depleting the cells of energy for other processes). SthA is a cytoplasmic transhydrogenase with kinetic characteristics that promote function primarily in the direction of NADPH oxidation (108). Expression of the sthA gene from a plasmid did not alter furfural tolerance w ith or without IPTG induction (Fig. 4-13). Functionality of the cloned gene was confirmed in vitro. Upon induction with 0.1 mM IPTG, activity was found to increase from approximately 1.0 nmol min -1 mg protein -1 to 18 nmol min -1 mg protein -1 PntAB is a proton translocating transhydrogenase that is not known to function during fermentative growth but is potentially capable of increasing the pool of NADPH (108). Leaky expression of pntAB from an uninduced plasmid partially restored growth in the presence of 1.0 g liter -1 furfural (Fig. 4-13). Adding IPTG to express higher levels of this enzyme 64

PAGE 65

eliminated resistance to furfural and also inhibited the growth of cells in the absence of furfural. Based on these results, furfural appears to inhibit growth by depleting the supply of NADPH needed for biosynthesis. The large requirement of NADPH for sulfate assimilation, 4 per cysteine equivalent, and the limited rout es for NADPH production from xylose during fermentation appear to have made the production of sulfur amino acids most vulnerable to competition by furfural reductases for NADPH. Conclusions Furfural is a natural product of lignocellulosic decomposition. Furfural is also formed by the dehydration of pentose sugars during the depolymerization of cellulosic biomass under acidic conditions (3, 73). This compound is an important contributor to toxicity of hemicellulose syrups, and increases the toxicity of other co mpounds (138). Selection for a furfural-resistant mutant of E. coli during growth in xylose-mineral salts medium resulted in a strain (EMFR9) with improved resistance to hemicellulose hydrolysate, confirming the practical importance of this compound. The ability to reduce furfural into the less toxic furfuryl alcohol is widely distributed in nature (13). An enzyme has been purified from E. coli that catalyzes this reaction (36) and a gene that reduces the analogue 5-hydroxymethyl furfural has been identified in S. cerevisiae (5). The mRNA levels of oxidoreductases were compared in the furfural-resistant mutant EMFR9 and the parent LY180. Twelve differed by 2-fold or more Of these, 8 were higher in EMFR9 and 4 were lower in EMFR9. All were cloned and tested either for their ability to confer furfural tolerance in LY180 or decrease furfural tolerance in EMFR9. None of these gene products increased furfural tolerance when over-expressed from plasmids. Expression of three genes ( yqhD, dkgA and yqfA ) decreased the furfural tolerance of EMFR9. Contrary to initial expectations that furfural tolerance would be improved by increased expression of reductase 65

PAGE 66

activity, these results demonstrated that the increased tolerance in EMFR9 results in large part from gene silencing ( yqhD, dkgA ) that decreased the level of NADPH-dependent furfural reductase activities. Deletion of yqhD encoding the lower K m oxidoreductase (NADPH) increased furfural tolerance in LY180 while deletion of dkgA had no effect. No change in furfural reductase activity was detected from the over-expression of yqfA and the role of this gene in furfural tolerance remains unknown. No mutation was found in these genes in EMFR9 and the mechanism of this gene silencing is under investigation. The yqhD gene has been previously shown to encode an NADPH-dependent aldehyde oxidoreductase (116) that can be used for the pr oduction of propanediol (84, 140). This gene has also been shown to confer resistance to damage by reactive species of oxygen (97). The dkgA gene has been shown to catalyze the reduction of 2,5-diketo-D-gluconic acid, a key step in the production of ascorbic acid (38, 134). This enzyme is also thought to function in the reduction of methylglyoxal (52, 60). The function of the yqfA gene is unknown but is proposed to be a membrane subunit of an oxidoreductase that may be involved in fatty acid metabolism (77). Enzymes encoded by yqhD and dkgA were purified and demonstrated to have NADPHdependent furfural reductase activities. Both YqhD and DkgA have low K ms for NADPH that would allow competition with biosynthetic reactions. This competition for NADPH appears to be the primary basis for growth inhibition by furfural. Growth of the parent resumed upon complete reduction of added furfural. Replacing xylose with glucose and adding yeast extract to xylose medium would be expected to increase the availability of NADPH and both changes increased furfural tolerance. Deleting yqhD and dkgA in the parent LY180 increased furfural tolerance, but not to the full extent present in the mutant EMFR9, indicating additional mutations may also contribute to increased furfural tolerance in EMFR9. 66

PAGE 67

These results show that the low concentration of furfural (up to about 1.5 g liter -1 ) found in hemicellulose hydrolysates of sugar cane bagasse is not inhibitory to the growth or fermentation of ethanologenic strain EMFR9. Th e observed growth inhibition of the parent LY180 appears to be due to the diversion of NADPH away from biosynthesis by enzymes such as YqhD and DkgA. Based on the transcriptional and regulatory changes that were observed in response to the addition of furfural, a partial response map was assembled (Fig. 4-14). This map combined with a summary of highly perturbed genes (Table 4-3) allowed the identification of sulfur assimilation into amino acids as an early site of furfural action. Furfural increased the expression of many genes and regulators concerned with sulfur assim ilation into cysteine and methionine (Figure 49), consistent with deficiency in these sulfur amino acids. In contrast, furfural lowered the expression of many other biosynthetic genes for building block molecules, consistent with their excess. Further, the addition of low concentrations (0.1 mM) of cysteine and methionine relieved growth inhibition by 1.0 g liter -1 furfural (Fig. 4-12). The minimum effective level of cysteine (0.05 mM) was similar to the estimated sulfur amino acid content of the cells that grew in the presence of 1.0 g liter 1 furfural. Previous studies investigated the transcriptional response of E. coli strain K12 to sulfur limitation during growth in minimal medium. Sulfur limitation was induced by replacing sulfate with either 0.25 mM taurine or 0.25 mM glutathione (37). In their study, a sulfur limitation reduced the rate of synthesis of cysteine and methionine and induced oxidative stress. Interestingly, the sulfur limitation also increased the transcription of cbl and the taurine transport genes ( tauABC ), two effects also observed in our furfural response data (Table 4-3). At low concentrations, serine (a precursor of cysteine), histidine, and arginine were also 67

PAGE 68

effective at reducing furfural inhibition of growth. All amino acids were effective to some extent when added at a 5-fold higher concentration (0.5 mM). Intracellular pools of histidine and serine may be limited to some extend during anaerobic growth since both biosynthetic pathways include reactions that reduced NAD + to NADH. These reactions may be hindered by the high NADH/NAD + ratios typical of fermentation, reducing pool sizes. The beneficial action of arginine was surprising because expression levels for genes concerned with arginine biosynthesis ( argA, argB,, argC, argD, carA, carB, and argG ) were lowered by the addition of furfural, consistent with an excess of this amino acid. Furf ural also increased the expression of arginine decarboxylase ( speA ), an enzyme concerned with arginine increasing intracellular pH and degradation. It is possible that degradation products of arginine increase furfural tolerance. The inhibition of sulfur amino acid synthesis by furfural was localized to the steps prior to sulfur assimilation into cysteine (Fig. 4-12). Alternative sulfur sources at differing degrees of reduction were tested as supplements during growth with furfural (1.0 g liter -1 ) (Fig. 4-12D). The cytoplasmic degradation of D-cysteine and thiosulfate both provide a source of reduced sulfur for direct incorporation into cysteine and both relieved the inhibition of growth by furfural. Taurine is degraded intracellularly to sulf ite, a partially reduced sulfur source that needs further reduction by CysIJ prior to incorporation into cysteine. Unlike thiosulfate, the addition of taurine had no effect on furfural tolerance despite the high expression levels of genes encoding taurine transport ( tauABC ) and degradation ( tauD ). Together, these results indicate that furfural inhibits sulfate assimilation by interfering with the reduction of sulfite by CysIJ. Additional inhibitory effects may also be present at earlier steps and cannot be excluded. The inhibition of sulfate reduction is unlikely to represent the initial action of furfural that inhibits growth. Resistance appears to resu lt from the silencing of two NADPH-dependent 68

PAGE 69

enzymes (YqhD and DkgA) that reduce furfural to furfuryl alcohol, a less toxic compound (137, 138). Based on these results, furfural is proposed to inhibit growth by limiting the available NADPH for biosynthesis. Results from our gene array studies provide further support for this hypothesis. Sulfate assimilation, the most NADPH-intensive pathway in metabolism, was found to the most vulnerable site for furfural action. Growth inhibition by 1.0 g liter -1 furfural was relieved by supplying reduced sulfur for am ino acid biosynthesis. Many other NADPHdependent biosynthetic reactions would also be adversely affected by the NADPH-dependent reduction of furfural. Supplying reduced sulfur fo r biosynthesis as well as other building block metabolites would have a general sparing effect on the NADPH pool, consistent with the general growth benefit provided by individual amino acids. A direct linkage between furfural inhibition of growth and NADPH was further demonstrated by expression of the proton-translocating transhydrogenase, pntAB Low-level expression of these genes without inducer was shown to increase furfural tolerance. Depletion of cysteine and methionine levels by furfural would be expected to initiate a cascade of cellular events (Fig. 4-14) including sta lled ribosomes that trigger a stringent response (35). The accumulation of other amino acids and nucleotides would activate repressors of biosynthesis such as ArgR and PurR, and decr ease expression of many biosynthetic pathways. NADPH depletion can also explain the altered activity of ArcA and the resulting expression increase of TCA-cycle related genes, as ArcAB activity is known to be sensitive to the cellular redox ratio (127). 69

PAGE 70

Figures and Tables Table 4-1. Bacterial strains, plasmids, and primers. Strain, plasmid, or primer Relevant characteristics Reference of source Strains LY168 frdA::(Zm frg celY Ec FRT ) ldhA:: FRT adhE::(Zm frg estZ Pp FRT) ackA ::FRT rrlE::(pdc adhA adhB FRT) lacY::FRT mgsA ::FRT, (51, 133) LY180 frdBC::(Zm frg celY Ec ) ldhA::(Zm frg casAB Ko ) adhE::(Zm frg estZ Pp FRT) ackA ::FRT rrlE::(pdc adhA adhB FRT) mgsA ::FRT This study EMFR9 LY180 improved for furfural tolerance This study EMFR9 yqhD EMFR9 yqhD:kan This study EMFR9 dkgA EMFR9 dkgA:cat sacB This study EMFR9 yqhD dkgA EMFR9 yqhD::kan, dkgA::cat sacB This study BL21 ( DE3) F ompT gal dcm lon hsdS B(r B B m B ) (DE3 [ lacI lacUV5T7 gene 1 ind1 sam7 nin5 ]) Promega (Madison, WI) E. coli TOP10F Fethanol mcrA (mrr-hsd RMSmcrBC) 80lac Z M15 lac X74 recA1 ara D139 (ara-leu )7697 gal U gal K rps L end A1 nupG Invitrogen (Carlsbad, CA) Plasmids 1 PCR 2.1 TOPO bla kan lacZ P lac Invitrogen (Carlsbad, CA) pLOI4301 yqhD gene in pCR 2.1 TOPO This study pLOI4302 yjjN gene in pCR 2.1 TOPO This study pLOI4303 dkgA gene in pCR 2.1 TOPO This study pLOI4304 yqfA gene in pCR 2.1 TOPO This study pLOI4305 yajO gene in pCR 2.1 TOPO This study pLOI4306 ydhU gene in pCR 2.1 TOPO This study pLOI4307 ydhV gene in pCR 2.1 TOPO This study pLOI4308 ygcW gene in pCR 2.1 TOPO This study pLOI4309 nemA gene in pCR 2.1 TOPO This study pLOI4310 yjgB gene in pCR 2.1 TOPO This study pLOI4311 ydhS gene in pCR 2.1 TOPO This study pLOI4312 ydhY gene in pCR 2.1 TOPO This study pLOI4313 His-tagged yqhD in pET15b This study PLOI4314 His-tagged dkgA in pET15b This study pET15b T7 promoter, bla His-tag vector Novagen (Madison, WI) pKD4 FRT kan FRT (24) PKD46 P ara bla, red recombinase ( ,exo) (24) pTrc99a Ptrc bla oriR rrnB lacIq (6) pLOI4315 sthA gene in pTrc99a This study pLOI4316 pntAB in pTrc99a This study 70

PAGE 71

Table 4-1. Continued Strain, plasmid, or primer Relevant characteristics Reference of source Primers 2 (5 to 3) yqhD cloning For-ACATCAGGCAGATCGTTCTC Rev-CCACAGCTTAGTGGTGATGA This study yjjN cloning For-GGAGAGCCGAATCATGTCTA Rev-CCGGAACCTGTCTCAACCAA This study dkgA cloning For-GCCTGCTCCGGTGAGTTCAT Rev-CCGGCTCTGCATGATGATGT This study yqfA cloning For-GCTGGAGAGGTATACATGTG Rev-GCCGTATTCGCTCGAAGAGT This study yajO cloning For-CCGCAGCACATGCAACTTGA Rev-ATGGCGCTGCCGACCAATGA This study ydhU cloning For-CCGCATCTGTATCGCCGGTT Rev-GCCGATGCGAGCATGATTCGT This study ydhV cloning For-ATTATCGAGTGGAAAGATAT Rev-CGTAGTCTCCGTTCTGCTTA This study ygcW cloning For-ACCTTTCTTTTTTTTTGCCT Rev-TTACGACCGCTGCCGGAATC This study nemA cloning For-TTATTGCGACGCCTGCCGTT Rev-GTTCAATCACCGCTTCTTCG This study yjgB cloning For-CCTGCCATGCTCTACACTTC Rev-CTGGTTAGATGGCGACTATG This study ydhS cloning For-AACTTATCTGATAACACTAA Rev-CCAACAGCGGCGACAATGTA This study ydhY cloning For-TCAGGCTGCTGAATTGTCAG Rev-GGCACCAGATCCAGTTAATG This study Deletion of yqhD For-GTTCTCTGCCCTCATATTGGCCC AGCAAAGGGAGCAAGTAGTGTAGG CTGGAGCTGCTTC Rev-GACGAAATGCCCGAAAACGAA AGTTTGAGGCGTAAAAAGCCATAT GAATATCCTCCTTA This study Deletion of dkgA Outward 1-ACGGTTGGATTAGCCATACG Outward 2-GACCAGTTCGGCGGCTAACA For-GCCTGCTCCGGTGAGTTCAT Rev-CCGGCTCTGCATGATGATGT This study yqhD cloning into pET15b For-TGACTCTCGAGATGAACAACTT TAATCTGCA Rev-AGTCAGGATCCTTAGCGGGCG GCTTCGTATA This study dkgA cloning into pET15b For-ATATGCCTCGAGATGGCT AATCCAACCGTTAT RevCCGATAGGATCCTTAGCCGC CGAACTGGTCAGG This study Sequencing yqhD yqhD _for1 CGGCGAGGTACTGGTGAC yqhD _rev1 CATGTTAGCCGCCGAACT yqhD _seq1 TCATGTTGGCTTCTGCCG yqhD _seq2 GCGCAATCGCTGGTTTAC yqhD _seq3 GTTCCGATGATGAGCGTATTG yqhD _seq4 AGGCGTTTTCGATCAGAAAG This study 71

PAGE 72

Table 4-1. Continued Strain, plasmid, or primer Relevant characteristics Reference of source Sequencing dkgA dkgA _for1 CCAGCAACCGGTTCAGAAT dkgA _rev1 AACGCGTGAAAATAGCGACT dkgA _seq1 GCGGTAAAGAGATTAAAAGCGC dkgA _seq2 TATGGCTAATCCAACCGTTATTAAG dkgA _seq3 CCCGCCCGTTGTTACTCT This study Sequencing of yqfA pcr_for: CCATCCGCGACGAGTCTGAA pcr_rev: GGTGAAGCGGAACTGAACAA seq1: CCATCCGCGACGAGTCTGAA seq2 : CGACGCTCTATCACGCCATT This study Sequencing of yjjN pcr_for: TGCGCTGTTTAAGATCGCT pcr_rev CATGATTGCCTTCTCGGG seq1 ACTGAGATGATCTCAAGCGATTG seq2 GGAAACAACGCGAGATACCT seq3 CCACGCTGGCAGAAACCTA This study pntAB cloning ForCTCTCTAAGCTTGCTTGTGTGGCTCCTGACAC RevCTCTCTAAGCTTGTTCAGTCCTCGCGGCAATC This study sthA cloning ForCTCTCTAAGCTTATGTTACCATTCTGTTGCTT RevCTCTCTAAGCTTGATGCTGGAAGATGGTCACT This study 1 The genes inserted into pCR 2.1 TOPO include a native ribosomal binding site and transcriptional terminator. Expression is from the plasmid promoter (P lac ). 2 Orientation of genes cloned into pCR 2.1 TOPO was verified by PCR analysis 72

PAGE 73

Table 4-2. Expression of oxidoreductase genes perturbed by furfural addition. Effect of over-expression of cloned genes on MIC for furfural Transcripts that were approximate ly 2-fold or greater in EMFR9 relative to LY180 Gene Ascension number Fold increase Expression in LY180 yajO b0419 1.9 No increase in MIC ydhU b1670 1.8 No increase in MIC ydhV b1673 2.0 No increase in MIC ygcW b2774 2.1 No increase in MIC nemA b1650 4.5 No increase in MIC yjgB b4269 2.0 No increase in MIC ydhS b1668 1. 9 No increase in MIC ydhY b1674 1.9 No increase in MIC Transcripts that were approximately 2-fold or more lower in EMFR9 relative to LY180 Gene Ascension number Fold decrease Expression in EMFR9 yqhD b3011 -48 Reduced MIC dkgA b3012 -12 Reduced MIC yjjN b4358 -4.4 No effect on MIC yqfA b2899 -2.5 Reduced MIC 73

PAGE 74

Table 4-3. Gobal comparison of genes perturbed by furfural addition. Functional group Total Differentially regulated (no, %) Downregulated Upregulated A mino acid biosynthesis and metabolism 123 28, 22.7 argC, aroL, argA, tyrB, asnA, argD, thrA, ilvD, trpD, argB, trpE, thrC, ilvA, argG, aroH, thrB, sdaB, dapB, ilvM, ilvC cysM, metC, IdcC, dadX, metA, metB, metL, dadA Biosynthesis of cofactors, prosthetic groups and carriers 120 8, 6.7 p dxA, ubiX, folC, bioD idi, trxC, pabC, ybdK Carbon compound metabolism 133 12, 9 x dhB, acnB, gcd, xdhA, amyA, dhaK, aldB, dhaL, ygjG, fucO, treF, tauD Cell processes (incl. adaptation, p rotection) 198 29, 14.6 fliQ, fliJ, fliE, fliP, fliL, fliK fliF, fliG, fliH, cspA, fliN, flgJ, ymcE, lpxP, flgK, fliO, flgH, flgL ibpA, yfiA, otsA, osmC, sodC, hchA, fic, b4411, osmY, yqhD, nemA Cell structure 114 8, 7.0 mreC, mreD, rfaC, fliS, etk, yeiU, lpxB ybhO Central intermediary metabolism 162 27, 16.7 p ykF, fumB, tktA, pyrH, ppa p oxB, cysQ, gabD, cysN, mqo, acnA, cysC, aceB, aceA, cysI, cysH, dcyD,aldA, gloA, glpK, fumA, glpD, sdhB, sdhC, sdhA, sdhD, dkgA DNA replication, recombination, modification and repair 105 5, 4.8 rnhB, fliA, recG yjiD, aidB Energy metabolism 139 14, 10.1 hypC, ackA, hypB, atpC cyoE, frmA, aceE, aceF, fdoH, fdoG, cyoD, cyoB, cyoA, cyoC Fatty acid and phospholipid metabolism 42 3, 7.1 accC, accB fadI Nucleotide biosynthesis and metabolism 62 13, 21 p yrB, purE, carA, pyrD, purH, guaB, purF, purN, p urK, purD, carB, pyr E x dh C Phage/IS 295 6, 2 ydfK, ynaE, cspB, cvpA, cspI, ynfN Putative 1167 102, 8.7 mltD, ydjH, fliR, yqeI, yijP, ydjI, bioC, ynjE, yibK, ydjJ, ydjZ, ynjC, ykgK, flhA, dctR, yhgF, yejM, ybjE, yfcC, ydgR, flgI, sdaC, yhiD, ybhA, ecfG, yibQ, ynjI, yliF, yliE, ydjK, yjjB, yibA, yedV ycbB, paaY, yjgH, ybiC, yeaQ, yecC, yqgD, ydjN, yhbW, ybaT, yagT, yehZ, yfcG, ymgE, yhbO, ygcE, yedY, sfsA, ydgD, nanK, yjiA, yohJ, yhiP, y dcO, yiaG, yigM, yhjG, ydcN, yqfA, dhaM, ygeV, y baS, ydcT, ynfM, ygiV, nanE, yqaE, yqeF, yfdY, yniA, ydcS, yncG, maeB, ybhP, ygaW, ybdH, y ohF, yhcO, ydcK, yddV, yciW, yeiA, sufB, ybeM, yohC, ychH, yeiT, yeeE, yhdW, yjfF, uspB, ytfT, glgS, yqhC, b4485, cstA, ytfQ, ydhM, yjiX Regulatory function 253 18, 7.1 adiY, evgS, cspG, suhB, cadC, flhC, fis rssB, sbmC, sdiA, pdhR, crl, bolA, hcaR, metR, p hoU, galS, cbl Transcription, RNA processing and degradation 61 2, 3.3 trmH, xseB Translation, post-translational modification 184 8, 4.3 truC, rpsT, etp, rpsA msrB, msrA, clpA, pphA Transport 353 69, 19.5 artM, nikB, nikA, lysP, proV, artP, proW, nikD, nikC, thiP, tyrP, proX, hisP, aroP, artI, hisJ, nikE, artQ, cusB, btuF, artJ, ampG, cusA, mtr, dcuC, narK, pitA, hisM, emrA, thiQ x ylE, gabP, manX, nagE, araF, sufD, sufC, mntH livH, kgtP, cysA, ssuC, blc, gltJ, cycA, yahN, p stA, pstC, glpT, glpF, ar gT, ssuA, pstB, gltK, glt I b4460, mtlA, pstS, narU, mdtM, sufA, dctA, mglC mglA, sbp, mglB, tauA, tauB, tauC Unclassified 14 3, 21.4 ssuD, ssuE, ybdL Unknown 681 57, 8.5 yiiQ, intG, flhE, ymdA, ynjB, ydjY, yeeN, ymcA, yibL, yghG, b1172, yjaH yccT, ybiJ, yjdI, yahO, yjdN, yhcN, ybaA, yedK, yqjD, eutQ, ybgS, yhhA, ompW, yhjY, yghX, y qeB, rtcB, ygaU, erfK, yegS, yeeD, yhcH, ydhS, yegP, yebV, yjfN, yehE, ydcJ, ygaM, yqeC, ybiL, p siF, yhfG, yjfO, nlpA, ybeH, ynhG, ycfR, yjiY, yodD, csiD, yeaH,yedP, yeaG, ycgB Total 4206 412, 9.8 74

PAGE 75

Table 4-4. Regulators perturbed by furfural addition. 75

PAGE 76

Figure 4-1. Linear DNA fragments used in construction of LY180. 76

PAGE 77

Figure 4-2. Directed evolution of E. coli for furfural tolerance. Cultures were grown anaerobically in 100 g liter -1 xylose and AM1 minimal media to 1-4 OD and transferred to fresh media with increasing initial furfural concentrations as tolerance to furfural increased. pH was maintined at 6.5 by automatic addition of 2N KOH. Ethanol production, cell density, and KOH addition were measured at 0, 24, 48, and 72 hrs for each transfer. 77

PAGE 78

A 0 12 24 36 48 60 72 0.1 1 10Time (h)Cell mass (g liter-1) D 0 12 24 36 48 60 72 0.1 1 10Time (h)Cell mass (g liter-1) B 0 12 24 36 48 60 72 0 10 20 30 40 50Time (h)Ethanol (g liter-1) E 0 12 24 36 48 60 72 0 10 20 30 40 50Time (h)Ethanol (g liter-1) C 0 12 24 36 48 60 72 0.0 0.1 0.2 0.3 0.4 Time (h)Furfural (g liter-1) F 0 12 24 36 48 60 72 0.00 0.25 0.50 0.75 1.00 1.25Time (h)Furfural (g liter-1) Figure 4-3. Tolerance of furfural resistant strain EMFR9 versus LY180. Effect of furfural on pHcontrolled fermentation of 100 g liter -1 xylose. Fermentation with 0.4 g liter -1 furfural (A, B, and C). Fermentations with 1.0 g liter -1 furfural (D, E, and F). For clarity, data for EMFR9 and LY180 are connected by solid and broken lines, respectively. Symbols for all: LY180 with furfural; EMFR9 with furfural; LY180 without furfural; and EMFR9 without furfural. 78

PAGE 79

A 0.0 0.5 1.0 1.5 2.0 2.5 0.0 0.5 1.0 1.5 2.0 2.5Furfural (g liter-1)Cell mass (g liter-1) B 0.0 0.5 1.0 1.5 2.0 2.5 0.0 0.5 1.0 1.5 2.0 2.5Furfural (g liter-1)Cell mass (g liter-1) C 0.0 0.5 1.0 1.5 2.0 2.5 0.0 0.5 1.0 1.5 2.0 2.5Furfural (g liter-1)Cell mass (g liter-1) Figure 4-4. Effect of media composition on furfur al tolerance. A. AM1 medium containing xylose (50 g liter -1 ); B. AM1 medium containing glucose; C. AM1 medium containing xylose and yeast extract (1.0 g liter -1 ); Symbols for all: LY180 (dashed line); and EMFR9 (solid line) after incubation for 48 hours. B 0.0 0.5 1.0 1.5 2.0 0 1 2Furfural (g liter-1)Cell mass (g liter-1) A 0.0 0.5 1.0 1.5 2.0 0 1 2Furfural (g liter-1)Cell mass (g liter-1) C 0.0 0.5 1.0 1.5 2.0 0 1 2Furfural (g liter-1)Cell mass (g liter-1) D 0.0 0.5 1.0 1.5 2.0 0 1 2Furfural (g liter-1)Cell mass (g liter-1) Figure 4-5. Effect of oxidoreductase expression on furfural tolerance. In EMFR9, A. Expression of dkgA ; B. Expression of yqhD ; C. Expression of yqfA ; D. Expression of yjjN. Symbols for all: pCR2.1 control without insert; uninduced expression; expression induced with 0.1 mM IPTG. 79

PAGE 80

A LY180 yqhD LY180 dkgA LY180 dkgA yqhD & L Y 180 EM FR 9 EM F R9 TO PO yqhD 0.00 0.01 0.02 0.03 0.04 0.05 0.06I n Vivo furfural reduction (mol min-1 mg dcw-1) B EMFR9 TOPO B lank EMFR9 TOP O yqfA EMFR9 TOPO yq hD. EMFR9 TOPO d kgA 0.00 0.05 0.10 0.15 0.20 0.25Furfural reduction in vitro (mol min-1 mg cellular protein-1) Figure 4-6. In vivo and in vitro fu rfural reduction comparison. A. In vivo activity of whole cells during fermentation. LY180 and deleted derivatives are shown as open bars. The furfural-resistant mutant, EMFR9 and EMFR9 (pLOI4301) expressing yqhD are shown as shaded bars. B. Comparison of in vitro furfural-reducing activities in cellfree extracts of EMFR9 harboring plasmi ds expressing cloned genes (forward direction, induced with 0.1 mM IPTG). 80

PAGE 81

LY180 dkgA: c at LY18 0 yqh D dkgA LY180 yqh D : ka n LY18 0 0.00 0.25 0.50 0.75Cell mass (g liter-1) Figure 4-7. Effect of yqhD and/or dkgA deletion on furfural tolerance. Growth after 48 hr incubation in the presence of 1.0 g liter -1 furfural. A 0 10 20 30 40 0.0 0.5 1.0 1.5 2.0 2.5Hemicellulose Hydrolysate (%)Cell mass (g liter-1) B 0 10 20 30 40 0 5 10 Hemicellulose Hydrolysate (%)Ethanol (g liter-1) Figure 4-8. Growth in hemicellulose hydrolysat e. Growth (A) and ethanol production (B) of LY180 () and EMFR9 ( ). 81

PAGE 82

Figure 4-9. Partial regulatory response of LY180 to furfural. Response map following challenge with 0.5 g liter -1 furfural. Regulatory genes that were significantly perturbed were identified by NCA with a P-value cutoff of 0.05 relative to a null distribution. Regulators with increased activity are shown in red with a solid border, regulators with decreased activity are shown in green with a dashed border. Regulators that showed a mixed activity are shown in grey. Representative genes that were perturbed greater than 2-fold are shown, with red (green) indicating genes with increased (decreased) expression. Solid lines indicate activation by the connected regulator, dashed lines indicate repression. Because the direction of perturbation for DcuR is unclear, this regulator is shown in gray. 82

PAGE 83

Figure 4-10. Histidine pathway genes perturbati ons upon furfural addition. Changes in gene transcipt levels in LY180 upon addition of 0.5 g liter -1 furfural as determined by microarray analysis are listed quantitatively beside the corresponding gene. 83

PAGE 84

Figure 4-11. Cysteine and methionine pathwa y gene perturbations upon furfural addition. Furfural increased expression of most genes concerned with sulfur assimilation into cysteine and methionine. Pathways for the synthesis of threonine and isoleucine from aspartate are included for comparison. Genes up-regulated by 1.5-fold or greater are shown in red. Genes down-regulated by 1.5-fold or greater are shown in green. All others are shown in black. 84

PAGE 85

A Control Tyrosine Phenylalanine Tryptophan Histidine Aspartate Asparagine Threonine Isoleucine Lysine Methionine Serine Cysteine Glycine Alanine Valine Leucine Glutamate Glutamine Proline Arginine 0.0 0.2 0.4 0.6 0.8 1.0 1.2Cell mass (g liter-1) B Control Tyrosine Phenylalanine Tryptophan Histidine Aspartate Asparagine Threonine Isoleucine Lysine Methionine Serine Cysteine Glycine Alanine Valine Leucine Glutamate Glutamine Proline Arginine 0.0 0.5 1.0 1.5 2.0Cell mass (g liter-1) C 1 000 u M cy stei ne 5 00 uM cy st eine 2 50 u M cy stei n e 1 00 u M cy stei ne 5 0 uM cy s teine 10 u M cy stei n e 0 uM cy stei ne 0 1 2Cell mass (g liter-1) D Con t rol L cyst ei n e D cysteine So di u m th io su lfate Taurin e 0.0 0.5 1.0 1.5Cell mass (g liter-1) Figure 4-12. Supplementation with specific metabolites increases furfural tolerance. Cultures were compared after incubation for 48 hrs (AM1 medium, 50 g liter -1 xylose, 1.0 g liter -1 furfural, 37C). A. Addition of individual amino acids (0.1 mM each). B. Addition of individual amino acids (0.5 mM each). C. Addition of cysteine. D. Addition of alternative sulfur sources. 85

PAGE 86

pTrc99a-control pTrc99a-sthA for pTrc99a-sthA f.+0.01 mM IPTG p T r c 99a-s th A f.+ 0.1 m M IPT G pTrc 9 9a-pntAB for p Trc 9 9a-pntAB f.+ 0 0 1 m M IPT G p Trc 9 9 a -p n tAB f. + 0.1 m M IPT G 0.0 0.1 0.2 0.3 0.4 0.5 0.6 0.7Cell mass (g liter-1) Figure 4-13. Effect of increased transhydrogenase expression on furfural tolerance. Cultures were grown for 48 hrs in AM1 minimal media containing 50 g liter -1 xylose and 1.0 g liter -1 furfural. The empty vector served as a control. Inducer was added prior to inoculation. 86

PAGE 87

Figure 4-14. Model of furfural challenge. Regulators with increased activity are shown in red with a solid border, regulators with decreased activity are shown in green with a dashed border. The addition of furfural induces two NADPH-dependent reductases ( yqhD and dkgA ) that inhibit growth by out-competing essential biosynthetic reactions. Assimilation of sulfur into amino acids requires 4 NADPH per cysteine and appears to be the most vulnerable of these biosynthetic reactions. Secondary consequences from furfural addition include depletion of sulfur amino acids and a cascade of events from stalled translation and accumulation of many non-sulfur building block intermediates to a more general stress response. 87

PAGE 88

CHAPTER 5 GENERAL CONCLUSIONS AND FUTURE DIRECTIONS General Accomplishments Engineering tolerance of E. coli to hemicellulose hydrolysate inhibitors was conducted by focusing seperately on osmotic stress and chemical stress. E. coli was previously made to produce an increased level of trehalose by transposon insertion of PtacotsBA and deletion of treA treC and treF (strain JP20) (103). JP20 exhibited increased tolerance to sugars (glucose, xylose), salt (sodium chloride), and organic acids (lactate, succinate) compare with parent strain W3110. W3110 grown with 1mM betaine also displayed increased tolerance to glucose, xylose, sodium chloride, lactate, and succinate compared to W3110 without betaine. Overexpressing trehalose during growth with betaine led to a greater benefit than either osmoprotectant could provide alone in the cases of glucose, xylose, and sodium chloride. In order to determine if the benefit of increased trehalose production on osmotolerance extended to desiccation survival, three strains with transposon inserted PtacotsBA were tested, EM2P (an ethanol producing KO11 derivative), EM2L (an ethanol producing LY163 derivative), and EM2T (a lactate producing TG106 derivative). In all cases, increased expression of the trehalose producing genes otsBA promoted survival during desiccation. Growth sugar was also found to impact survival, with survival during growth in xylose < glucose < mannose < fructose < arabinose < lactose
PAGE 89

Furfural is one of the most significant chemical inhibitors present in hemicellulose hydrolysate (39, 48, 73, 82, 138). A furfural tolerant E. coli was developed by growing and transferring ethanologenic strain LY180 in fermenta tion vessels containing furfural. The furfural tolerant strain (designated EMFR9) was shown to have a MIC towards furfural of 2.0 g liter -1 twice that of LY180. EMFR9 grew and reduced furfural simultaneously, whearas LY180 would only grow after all furfural had been removed from the media. On a dcw basis, EMFR9 reduced furfural at a lower rate than the parent. Growing cultures in glucose improved furfural tolerance for LY180, and to a lesser extent EMFR9, compared to growth on xylose. Addition of yeast extract to xylose grown cultures increased furf ural tolerance of LY180, making it nearly as tolerant as EMFR9. EMFR9 displayed an increased ability to grow in sulfuric acid treated hemicellulose hydrolysate compared to LY180. An NADPH dependent furfural reductase had previously been isolated in E. coli (36), although a corresponding gene could not be determined. Messanger RNA microarray with EMFR9 and LY180 was conducted, comparing genes transcript levels of cultures grown to 2 OD before and 15 minutes after furfural addition. 8 known or putative oxidoreductases had at least 2 fold higher transcript levels in EMFR9 than LY180, while 4 displayed at least 2 fold lower transcript levels in EMFR9 than LY180. Cloning the 8 genes into LY180 did not increase furfural tolerance, but cloning the 4 genes into EM FR9 reduced furfural tolerance in the cases of yqfA yqhD and dkgA Deletion of yqhD from LY180 increased furfural tolerance, but deletion of dkgA yielded no effect. By testing purified histidine tagged protein, YqhD and DkgA were both shown to have NADPH dependent furfural reductase activity with a low Km for NADPH. Microarray analysis revealed an increase in transcript abundance of genes related to cysteine and methionine biosynthesis. 4 NADPH ar e required to reduce sulfate so that it can be 89

PAGE 90

incorporated into cysteine, but in the presence of furfural this pool is redirected to forming furfuryl alcohol. Addition of 500 uM alternative sulfur sources that require less NADPH to be incorpated than sulfate (L-cysteine, D-cysteine, sodium thiosulfate) increased furfural tolerance of LY180 but did not affect EMFR9. Histidine bios ynthesis gene transcript levels also increased in LY180 upon furfural addition. Growth of LY 180 seperately in 100 uM of each of 20 amino acids revealed a benefit from cysteine, methionine, serine, histidine, and arginine. Increasing amino acid concentrations to 500 um led to a more generalized benefit. Finally, over-expression of the transhydrogenase pntAB in LY180 led to an increase in furfural tolerance. Taken together it appears that NADPH dependent furfural reduction by YqhD and DkgA competes for NADPH pools required for biosynthesis of cysteine, resulting in a stringent response which prevents cell growth. Future Works In addition to furfural, other significant inhibitors are present in hemicellulose hydrolysate that interfere with the growth of fermenting organisms. Acetate is one such compound, an organic acid that is released from the cleavage of hemiacetyl groups (136). It has the ability to collapse the proton motive force of the cell, preventing growth and fermentation (136). Acetate has been shown to impact cellular transcipt levels in E. coli including rpoS (7), a sigma factor important in general stress response. E. coli tolerant to acid (112) and acetate (41) have been evaluated, but the specific mechanisms that convey this tolerance remain unknown. A segment of cbpA from E. coli that encodes a 24 amino acid proton buffering peptide was cloned into Z. mobilis increasing tolerance to both hydrochloric acid and acetic acid (10). In addition, the ABC acetate transporter AatA from Acetobacter aceti when cloned into E. coli conveyed 90

PAGE 91

acetate resistance (86). Furthermore, increased expression of aconitase from A. aceti led to increased acetate tolerance (85). This illustrates that bacteria already have strategies for coping with acetate, which may be used as a platform for further increasing tolerance. As with the engineering of furfural tolerance, acetic acid tolerance might be developed by selectively evolving through continual transfers in the presence of acetate. Microarray analysis can then be preformed in the presence and absence of acetate, and perturbed genes can be expressed or deleted. Single Nucleotide Polymorphism analysis can also be implemented in order to directly determine the location of mutations within the chromosome. These mutations can be transferred into a clean genetic background using the parent organism, and resistance to acetate can be determined. 91

PAGE 92

LIST OF REFERENCES 1. Agbogbo, F. K., and G. Coward-Kelly. 2008. Cellulosic ethanol production using the naturally occurring xylose-fermenting yeast, Pichia stipitis. Biotechnology Letters 30: 1515-1524. 2. Agrawal, A. 2003. Advances in the production of poly( lactic acid) fibers. A review. J. Macromol. Sci. Polym. Rev. 4: 479-503. 3. Almeida, J. R. M., M. Bertilsson, M.F. Gorwa-Grauslund, S. Gorsich, G. Liden. 2009. Metabolic effects of furaldehydes a nd impacts on biotechnological processes. Appl. Microbiol. Biotechnol. 82: 625-638. 4. Almeida, J. R. M., T. Modig, A. Petersson, B. Hahn-Hagerdal, G. Liden, and M. F. Gorwa-Grauslund. 2007. Increased tolerance and conversion of inhibitors in lignocellulosic hydrolysates by Saccharomyces cerevisiae J. Chem. Technol. Biotechnol. 82: 340-349. 5. Almeida, J. R. M., A. Roder, T. Modig, B. Laadan, G. Liden, and M. F. GorwaGrauslund. 2008. NADHvs NADPH-coupled reduction of 5-hydroxymethyl furfural (HMF) and its implications on product distribution in Saccharomyces cerevisiae. Appl. Microbiol. Biotechnol. 78: 939-945. 6. Amann, E., B. Ochs, and K. J. Abel. 1988. Tightly regulated tac promoter vectors useful for the expression of unfused and fused proteins in Escherichia coli Gene 69: 30115. 7. Arnold, C. N., J. McElhanon, A. Lee, R. Leonhart, and D. A. Siegele. 2001. Global analysis of Escherichia coli gene expression during the acetate-induced acid tolerance response. J. Bacteriol. 183: 2178-2186. 8. Asghari, A., R. J. Bothast, J. B. Doran, and L. O. Ingram. 1996. Ethanol production from hemicellulose hydrolysates of agricultu ral residues using genetically engineered Escherichia coli strain KO11. J. Indust. Microbiol. 16: 42-47. 9. Barciszewski, J., G. E. Siboska, B. O. Pedersen, B. F. C. Clark, and S. I. S. Rattan. 1997. A mechanism for the in vivo formation of N-6-furfuryladenine, kinetin, as a secondary oxidative damage product of DNA. FEBS Lett. 414: 457-460. 10. Baumler, D. J., K. F. Hung, J. L. Bose, B. M. Vykhodets, C. M. Cheng, K. C. Jeong, and C. W. Kaspar. 2006. Enhancement of acid tolerance in Zymomonas mobilis by a proton-buffering peptide. Appl. Biochem. Biotechnol. 134: 15-26. 11. Billi, D., D. J. Wright, R. F. Helm, T. Prickett, M. Potts, and J. H. Crowe. 2000. Engineering desiccation tolerance in Escherichia coli Appl. Environ. Microbiol. 66: 1680-1684. 92

PAGE 93

12. Blumer-Schuette, S. E., I. Kataeva, J. We stpheling, M. W. W. Adams, and R. M. Kelly. 2008. Extremely thermophilic microorganism s for biomass conversion: status and prospects. Curr. Opin. Biotechnol. 19: 210-217. 13. Boopathy, R., H. Bokang, and L. Daniels. 1993. Biotransformation of Furfural and 5Hydroxymethyl Furfural by Enteric Bacteria. J. Indust. Microbiol. 11: 147-150. 14. Boos, W., U. Ehmann, E. Bremer, A. Middendorf, and P. Postma. 1987. Trehalase of Escherichia-Coli Mapping and Cloning of Its Structur al Gene and Identification of the Enzyme as a Periplasmic Protein-Induced under High Osmolarity Growth-Conditions. J. Biol. Chem. 262: 13212-13218. 15. Boscolo, R., C. Sabatti, J. C. Liao, and V. P. Roychowdhury. 2005. A generalized framework for Network Component Anal ysis. IEEE-ACM Trans. Comput. Biol. Bioinform. 2: 289-301. 16. Carapito, R., C. Carapito, J. M. Jeltsch, and V. Phalip. 2009. Efficient hydrolysis of hemicellulose by a Fusarium graminearum xylanase blend produced at high levels in Escherichia coli Bioresour. Technol. 100: 845-50. 17. Causey, T. B., K. T. Shanmugam, L. P. Yomano, and L. O. Ingram. 2004. Engineering Escherichia coli for efficient conversion of gl ucose to pyruvate. Proc. Natl. Acad. Sci. USA 101: 2235-40. 18. Causey, T. B., S. Zhou, K. T. Shanmugam, and L. O. Ingram. 2003. Engineering the metabolism of Escherichia coli W3110 for the conversion of sugar to redox-neutral and oxidized products: homoacetate production. Proc. Natl. Acad. Sci. USA 100: 825-32. 19. Cayley, S., B. A. Lewis, and M. T. Record. 1992. Origins of the Osmoprotective Properties of Betaine and Proline in Escherichia Coli K-12. J. Bacteriol. 174: 1586-1595. 20. Cayley, S., and M. T. Record. 2003. Roles of cytoplasmic osmolytes, water, and crowding in the response of Escherichia coli to osmotic stress: Biophysical basis of osmoprotection by glycine betaine. Biochemistry 42: 12596-12609. 21. Cheng, K. K., B. Y. Cai, J. A. Zhang, H. Z. Ling, Y. H. Zhou, J. P. Ge, and J. M. Xu. 2008. Sugarcane bagasse hemicellulose hydr olysate for ethanol production by acid recovery process. Biochem. Engin. J. 38: 105-109. 22. Crowe, J. H., F. A. Hoek stra, and L. M. Crowe. 1992. Anhydrobiosis. Annual Review of Physiology 54: 579-599. 23. Csonka, L. N. 1989. Physiological and Genetic Responses of Bacteria to Osmotic-Stress. Microbiol. Rev. 53: 121-147. 93

PAGE 94

24. Datsenko, K. A., and B. L. Wanner. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97: 6640-6645. 25. de Castro, A. G., H. Bredholt, A. R. Strom, and A. Tunnacliffe. 2000. Anhydrobiotic engineering of gram-negative bacteria. Appl. Environ. Microbiol. 66: 4142-4144. 26. Dehority, B. A., O. G. Bentley, R. R. Johnson, and A. L. Moxon. 1957. Isolation and Identification of Compounds from Autoly zed Yeast, Alfalfa Meal, and Casein Hydrolysate with Cellulolytic Factor Activ ity for Rumen Microorganisms Invitro. J. Anim. Sci. 16: 502-514. 27. Deshpande, S. K., M. G. Bhotmange, T. Chakrabarti, and P. N. Shastri. 2008. Production of cellulase and xylanase by Trichoderma reesei (QM 9414 mutant), Aspergillus niger and mixed culture by solid state fe rmentation (SSF) of water hyacinth ( Eichhornia crassipes). Indian J. Chem. Technol. 15: 449-456. 28. Dombek, K. M., and L. O. Ingram. 1986. Determination of the Intracellular Concentration of Ethanol in Saccharomyces Cerevisiae during Fermentation. Appl. Environ. Microbiol. 51: 197-200. 29. Dombek, K. M., and L. O. Ingram. 1984. Effects of Ethanol on the Escherichia Coli Plasma-Membrane. J. Bacteriol. 157: 233-239. 30. Felitsky, D. J., J. G. Cannon, M. W. Capp, J. Hong, A. W. Van Wynsberghe, C. F. Anderson, and M. T. Record. 2004. The exclusion of glycine betaine from anionic biopolymer surface: Why glycine betaine is an effective osmoprotectant but also a compatible solute. Biochemistry 43: 14732-14743. 31. Formanek, J., R. Mackie, and H. P. Blaschek. 1997. Enhanced Butanol Production by Clostridium beijerinckii BA101 Grown in Semidefined P2 Medium Containing 6 Percent Maltodextrin or Glucose. Appl. Environ. Microbiol. 63: 2306-2310. 32. Frazer, F. R., and T. A. Mccaskey. 1989. Wood Hydrolyzate Treatments for Improved Fermentation of Wood Sugars to 2,3-Butanediol. Biomass 18: 31-42. 33. Gama-Castro, S., V. Jimenez-Jacinto, M. Peralta-Gil, A. Santos-Zavaleta, M. I. Penaloza-Spinola, B. Contreras-Moreira, J. Segura-Salazar, L. Muniz-Rascado, I. Martinez-Flores, H. Salgado, C. Bonavides-Martinez, C. Abreu-Goodger, C. Rodriguez-Penagos, J. Miranda-Rios, E. Morett, E. Merino, A. M. Huerta, L. Trevino-Quintanilla, and J. Collado-Vides. 2008. RegulonDB (version 6.0): gene regulation model of Escherichia coli K-12 beyond transcription, active (experimental) annotated promoters and Textpre sso navigation. Nucl. Acids Res. 36: D120-D124. 94

PAGE 95

34. Gorsich, S. W., B. S. Dien, N. N. Nichols, P. J. Slininger, Z. L. Liu, and C. D. Skory. 2006. Tolerance to furfural-induced stress is associated with pentose phosphate pathway genes ZWF1, GND1, RPE1, and TKL1 in Saccharomyces cerevisiae. Appl. Microbiol. Biotechnol. 71: 339-349. 35. Gralla, J. D. 2005. Escherichia coli ribosomal RNA transcription: regulatory roles for ppGpp, NTPs, architectural proteins and a polymerase-binding protein. Mol. Microbiol. 55: 973-977. 36. Gutierrez, T., L. O. Ingram, and J. F. Preston. 2006. Purification and characterization of a furfural reductase (FFR) from Escherichia coli strain LYO1 An enzyme important in the detoxification of furfural during ethanol production. J. Biotechnol. 121: 154-164. 37. Gyaneshwar, P., O. Paliy, J. McAuliffe, D. L. Popham, M. I. Jordan, and S. Kustu. 2005. Sulfur and nitrogen limitation in Escherichia coli K-12: Specific homeostatic responses. J. Bacteriol. 187: 1074-1090. 38. Habrych, M., S. Rodriguez, and T. D. Stewart. 2002. Purification and identification of an Escherichia coli beta-keto ester reductase as 2,5-diketo-D-gluconate reductase YqhE. Biotechnol. Prog. 18: 257-261. 39. Hadi, S. M., Shahabuddin, and A. Rehman. 1989. Specificity of the Interaction of Furfural with DNA. Mut. Res. 225: 101-106. 40. Hahn-Hagerdal, B., M. Galbe, M. F. Go rwa-Grauslund, G. Liden, and G. Zacchi. 2006. Bio-ethanol--the fuel of tomorrow from the residues of today. Trends Biotechnol 24: 549-56. 41. Han, Y., Z. M. Li, P. Du R. B. Gan, and Q. Ye. 2007. Production of human epidermal growth factor in fed-batch culture of acetate-tolerant Escherichia coli Chin. J. Chem. Engin. 15: 760-764. 42. Hao, X. Y., W. Zhou, J. W. Wang, Y. Q. Zhang, and S. X. Liu. 2005. A novel catalyst for the selective hydrogenation of furfural to furfuryl alcohol. Chem. Lett. 34: 1000-1001. 43. Hayward, T. K., J. Hamilton, D. Templeton, E. Jennings, M. Ruth, A. Tholudur, J. D. McMillan, M. Tucker, and A. Mohagheghi. 1999. Enzyme production, growth, and adaptation of T. reesei strains QM9414, L-27, RL-P37, and Rut C-30 to conditioned yellow poplar sawdust hydrolysate Scientific note. Appl. Biochem. Biotechnol. 779: 293-309. 44. Hofvendahl, K., and B. Hahn-Hagerdal. 2000. Factors affecting the fermentative lactic acid production from renewable resources(1). Enzyme Microb. Technol. 26: 87-107. 95

PAGE 96

45. Horlacher, R., K. Uhland, W. Kle in, M. Ehrmann, and W. Boos. 1996. Characterization of a cytoplasmic trehalase of Escherichia coli J. Bacteriol. 178: 62506257. 46. Horvath, I. S., M. J. Taherzadeh C. Niklasson, and G. Liden. 2001. Effects of furfural on anaerobic continuous cultivation of Saccharomyces cerevisiae Biotechnol. Bioeng. 75: 540-549. 47. Hounsa, C. G., E. V. Brandt, J. Thevelein, S. Hohmann, and B. A. Prior. 1998. Role of trehalose in survival of Saccharomyces cerevisiae under osmotic stress. Microbiology 144: 671-680. 48. Hristozova, T., A. Angelov, B. Tzvetkova, D. Paskaleva, V. Gotcheva, S. Gargova, and K. Pavlova. 2006. Effect of furfural on carbon metabolism key enzymes of lactoseassimilating yeasts. Enzyme Microbial Technol. 39: 1108-1112. 49. Hyduke, D. R., L. R. Jarboe, L. M. Tran, K. J. Y. Chou, and J. C. Liao. 2007. Integrated network analysis identifies nitr ic oxide response networks and dihydroxyacid dehydratase as a crucial target in Escherichia coli Proc. Natl. Acad. Sci. USA 104: 84848489. 50. Janssen, P. H. 2004. Propanol as an end product of threonine fermentation. Arch. Microbiol. 182: 482-6. 51. Jarboe, L. R., T. B. Grabar, L. P. Yomano, K. T. Shanmugan, and L. O. Ingram. 2007. Development of ethanologenic bacteria. Biofuels 108: 237-261. 52. Jeudy, S., V. Monchois, C. Maza, J. M. Claverie, and C. Abergel. 2006. Crystal structure of Escherichia coli DkgA, a broad-specificity al do-keto reductase. Proteins 62: 302-307. 53. Kaemwich Jantama, X. Z., J.C. Moore, K.T. Shanmugam, S.A. Svoronos, L.O. Ingram. 2008. Eliminating Side Products and Increas ing Succinate Yields in Engineered Strains of Escherchia Coli C. Biotechnol. Bioeng. 101: 881-893. 54. Karp, P. D., I. M. Keseler, A. Shearer, M. Latendresse, M. Krummenacker, S. M. Paley, I. Paulsen, J. Collado-Vides, S. Gama-Castro, M. Peralta-Gil, A. SantosZavaleta, M. I. Penaloza-Spinola, C. Bonavides-Martinez, and J. Ingraham. 2007. Multidimensional annotation of the Escherichia coli K-12 genome. Nucleic Acids Res 35: 7577-90. 55. Katahira, S., A. Mizuike, H. Fukuda, and A. Kondo. 2006. Ethanol fermentation from lignocellulosic hydrolysate by a recombin ant xyloseand cellooligosaccharideassimilating yeast strain. Appl. Microbiol. Biotechnol. 72: 1136-1143. 96

PAGE 97

56. Keller, F. A., D. Bates, R. Ruiz, and Q. Nguyen. 1998. Yeast adaptation on softwood prehydrolysate. Appl. Biochem. Biotechnol. 70-2: 137-148. 57. Kempf, B., and E. Bremer. 1998. Stress responses of Bacillus subtilis to high osmolarity environments: Uptake and synthesis of osmoprotectants. J. Biosciences 23: 447-455. 58. Kempf, B., and E. Bremer. 1998. Uptake and synthesis of compatible solutes as microbial stress responses to high-osmo lality environments. Arch. Microbiol. 170: 319330. 59. Khan, Q. A., F. A. Shamsi, and S. M. Hadi. 1995. Mutagenicity of Furfural in Plasmid DNA. Cancer Lett. 89: 95-99. 60. Ko, J., I. Kim, S. Yoo, B. Min, K. Kim, and C. Park. 2005. Conversion of methylglyoxal to acetol by Escherichia coli aldo-keto Reductases. J. Bacteriol. 187: 57825789. 61. Kuo, C. H., and C. K. Lee. 2009. Enhanced enzymatic hydrolysis of sugarcane bagasse by N-methylmorpholine-N-oxide pretreatment. Bioresour. Technol. 100: 866-71. 62. Laadan, B., J. R. M. Almeida, P. Radstrom, B. Hahn-Hagerdal, and M. GorwaGrauslund. 2008. Identification of an NADH-de pendent 5-hydroxymethylfurfuralreducing alcohol dehydrogenase in Saccharomyces cerevisiae. Yeast 25: 191-198. 63. Larsson, S., P. Cassland, and L. J. Jonsson. 2001. Development of a Saccharomyces cerevisiae strain with enhanced resistance to phenolic fermentation inhibitors in lignocellulose hydrolysates by heterologous expression of laccase. Appl. Environ. Microbiol. 67: 1163-1170. 64. Larsson, S., E. Palmqvist, B. Hahn-Hagerdal, C. Tengborg, K. Stenberg, G. Zacchi, and N. O. Nilvebrant. 1999. The generation of fermentation inhibitors during dilute acid hydrolysis of softwood. Enzyme Microbial Technol. 24: 151-159. 65. Leslie, S. B., E. Israeli, B. Lighthart, J. H. Crowe, and L. M. Crowe. 1995. Trehalose and Sucrose Protect Both Membranes and Pr oteins in Intact Bacteria during Drying. Appl. Environ. Microbiol. 61: 3592-3597. 66. Liao, J. C., R. Boscolo, Y. L. Yang, L. M. Tran, C. Sabatti, and V. P. Roychowdhury. 2003. Network component analysis : Reconstruction of regulatory signals in biological systems. Proc. Natl. Acad. Sci. USA 100: 15522-15527. 67. Lin, Y. L., and H. P. Blaschek. 1983. Butanol Production by a Butanol-Tolerant Strain of Clostridium acetobutylicum in Extruded Corn Broth. Appl. Environ. Microbiol. 45: 966-973. 97

PAGE 98

68. Lo, C. M., Q. Zhang, P. Lee, and L. K. Ju. 2005. Cellulase production by Trichoderma reesei using sawdust hydrolysate. Appl. Biochem. Biotechnol. 121: 561-573. 69. Maier, T. H. P. 2003. Semisynthetic production of unnatural L-alpha-amino acids by metabolic engineering of the cysteine-b iosynthetic pathway. Nature Biotechnol. 21: 422427. 70. Martin, C., O. Almazan, M. Marcet, and L. J. Jonsson. 2007. A study of three strategies for improving the fermentability of sugarcane bagasse hydrolysates for fuel ethanol production. International Sugar J. 109: 33-39. 71. Martin, C., M. Marcet, O. Almazan, and L. J. Jonsson. 2007. Adaptation of a recombinant xylose-utilizing Saccharomyces cerevisiae strain to a sugarcane bagasse hydrolysate with high content of fermen tation inhibitors. Bioresour. Technol. 98: 17671773. 72. Martinez, A., T. B. Grabar, K. T. Shanm ugam, L. P. Yomano, S. W. York, and L. O. Ingram. 2007. Low salt medium for lactate a nd ethanol production by recombinant Escherichia coli B. Biotechnol. Lett. 29: 397-404. 73. Martinez, A., M. E. Rodriguez, M. L. We lls, S. W. York, J. F. Preston, and L. O. Ingram. 2001. Detoxification of dilute acid hydrol ysates of lignocellulose with lime. Biotechnol. Prog. 17: 287-293. 74. Martinez, A., M. E. Rodriguez, S. W. York, J. F. Preston, and L. O. Ingram. 2000. Effects of Ca(OH)(2) treatments ("overlim ing") on the composition and toxicity of bagasse hemicellulose hydrolysates. Biotechnol. Bioeng. 69: 526-536. 75. Martinez, A., M. E. Rodriguez, S. W. York, J. F. Preston, and L. O. Ingram. 2000. Use of UV absorbance to monitor furans in dilute acid hydrolysates of biomass. Biotechnol. Prog. 16: 637-641. 76. Mathew, G. M., R. K. Sukumaran, R. R. Singhania, and A. Pandey. 2008. Progress in research on fungal cellulases for lignocellulo se degradation. J. Sci. Indust. Res. 67: 898907. 77. McCue, L. A., W. Thompson, C. S. Carmack, M. P. Ryan, J. S. Liu, V. Derbyshire, and C. E. Lawrence. 2001. Phylogenetic footprinting of transcription factor binding sites in proteobacterial genomes. Nucl. Acids Res. 29: 774-782. 78. Miller, J. H. 1992. A short course in bacterial genetics : a laboratory manual and handbook for Escherichia coli and related bacteria. Cold Sp ring Harbor Laboratory Press, Plainview, N.Y. 98

PAGE 99

79. Miyafuji, H., H. Danner, M. Neureiter, C. Thomasser, J. Bvochora, O. Szolar, and R. Braun. 2003. Detoxification of wood hydrolysates with wood charcoal for increasing the fermentability of hydrolysates. Enzyme Microbial Technol. 32: 396-400. 80. Mizoguchi, H., and S. Hara. 1998. Permeability barrier of the yeast plasma membrane induced by ethanol. J. Ferment. Bioeng. 85: 25-29. 81. Mizushina, Y., E. Yagita, K. Kuramochi, I. Kuriyama, N. Shimazaki, O. Koiwai, Y. Uchiyama, Y. Yomezawa, F. Sugawara, S. Kobayashi, K. Sakaguchi, and H. Yoshida. 2006. 5-(Hydroxymethyl)-2-furfural: a sel ective inhibitor of DNA polymerase lambda and terminal deoxynucleotidyltransferase. Arch. Biochem. Biophys. 446: 69-76. 82. Modig, T., G. Liden, and M. J. Taherzadeh. 2002. Inhibition effects of furfural on alcohol dehydrogenase, aldehyde dehydrogenase and pyruvate dehydrogenase. Biochem. J. 363: 769-776. 83. Murata, M., H. Totsuka, and H. Ono. 2007. Browning of furfural and amino acids, and a novel yellow compound, furpipate, formed from lysine and furfural. Biosci. Biotechnol. Biochem. 71: 1717-1723. 84. Nakamura, C. E., and G. M. Whited. 2003. Metabolic engineering for the microbial production of 1,3-propanediol. Curr. Opin. Biotechnol. 14: 454-459. 85. Nakano, S., M. Fukaya, and S. Horinouchi. 2004. Enhanced expression of aconitase raises acetic acid resistance in Acetobacter aceti. FEMS Microbiol. Lett. 235: 315-322. 86. Nakano, S., M. Fukaya, and S. Horinouchi. 2006. Putative ABC transporter responsible for acetic acid resistance in Acetobacter aceti. Appl. Environ. Microbiol. 72: 497-505. 87. Neidhardt, F. C. 1987. Escherichia coli and Salmonella typhimurium : cellular and molecular biology. American Society for Microbiology, Washington, D.C. 88. Nigam, J. N. 2001. Development of xylose-fermenting yeast Pichia stipitis for ethanol production through adaptation on hardwood hemice llulose acid prehydrolysate. J. Appl. Microbiol. 90: 208-215. 89. Nilsson, A., M. F. Gorwa-Grauslund, B. Hahn-Hagerdal, and G. Liden. 2005. Cofactor dependence in furan reduction by Saccharomyces cerevisiae in fermentation of acid-hydrolyzed lignocellulose. Appl. Environ. Microbiol. 71: 7866-7871. 90. Ohta, K., D. S. Beall, J. P. Mejia, K. T. Shanmugam, and L. O. Ingram. 1991. Genetic improvement of Escherichia coli for ethanol production: chromosomal integration of Zymomonas mobilis genes encoding pyruvate decarboxylase and alcohol dehydrogenase II. Appl. Environ. Microbiol. 57: 893-900. 99

PAGE 100

91. Okuda, N., K. Ninomiya, M. Tak ao, Y. Katakura, and S. Shioya. 2007. Microaeration enhances productivity of bioethanol fr om hydrolysate of waste house wood using ethanologenic Escherichia coli KO11. J. Biosci. Bioeng. 103: 350-357. 92. Palmqvist, E., and B. Hahn-Hagerdal. 2000. Fermentation of lignocellulosic hydrolysates. I: inhibition and de toxification. Bioresour. Technol. 74: 17-24. 93. Palmqvist, E., and B. Hahn-Hagerdal. 2000. Fermentation of lignocellulosic hydrolysates. II: inhibitors and mechanisms of inhibition. Bioresour. Technol. 74: 25-33. 94. Patel, M. A., M. S. Ou, L. O. Ingram, and K. T. Shanmugam. 2005. Simultaneous saccharification and co-fermentation of crystalline cellulose and sugar cane bagasse hemicellulose hydrolysate to lactate by a thermotolerant acidophilic Bacillus sp. Biotechnol. Prog. 21: 1453-60. 95. Patten, C. L., M. G. Kirchhof, M. R. Schertzberg, R. A. Morton, and H. E. Schellhorn. 2004. Microarray analysis of RpoS -mediated gene expression in Escherichia coli K-12. Mol. Genet. Genomics 272: 580-591. 96. Pear P. Ueng, C.-s. G. 1982. Ethanol Production from pentoses and sugar-cane baggase hemicellulose hydrolysate by Mucor and Fusarium species. Enzyme Microb. Technol. 4: 169-171. 97. Perez, J. M., F. A. Arenas, G. A. Prad enas, J. M. Sandoval, and C. C. Vasquez. 2008. Escherichia coli YqhD exhibits aldehyde reductase activity and protects from the harmful effect of lipid peroxidation-derived aldehydes. J. Biol. Chem. 283: 7346-7353. 98. Perroud, B., and D. Lerudulier. 1985. Glycine Betaine Transport in Escherichia Coli Osmotic Modulation. J. Bacteriol. 161: 393-401. 99. Petersson, A., J. R. M. Almeida, T. Modi g, K. Karhumaa, B. Hahn-Hagerdal, M. F. Gorwa-Grauslund, and G. Liden. 2006. A 5-hydroxymethyl furfural reducing enzyme encoded by the Saccharomyces cerevisiae ADH6 gene conveys HMF tolerance. Yeast 23: 455-464. 100. Poolman, B., and E. Glaasker. 1998. Regulation of compatible solute accumulation in bacteria. Mol. Microbiol. 29: 397-407. 101. Potts, M. 1994. Desiccation Tolerance of Prokaryotes. Microbiol. Rev. 58: 755-805. 102. Puchart, V., and P. Biely. 2008. Simultaneous production of endo-beta-1,4-xylanase and branched xylooligosaccharides by Thermomyces lanuginosus. J. Biotechnol. 137: 34-43. 103. Purvis, J. E., L. P. Yomano, and L. O. Ingram. 2005. Enhanced trehalose production improves growth of Escherichia coli under osmotic stress. Appl. Environ. Microbiol. 71: 3761-3769. 100

PAGE 101

104. Randall, K., M. Lever, B. A. Peddie, and S. T. Chambers. 1996. Natural and synthetic betaines counter the effects of high NaCl and urea concentrations. Biochim. Biophys. Acta 1291: 189-194. 105. Rao, J. S., R. S. Singhal, and P. R. Kulkami. 1998. Xylose syrups: Purification of cottonseed hull hydrolysate by combined treatment of activated carbon and ion exchange resins. JSIR 57: 377-382. 106. Reczey, K., A. Brumbauer, M. Bollo k, Z. Szengyel, and G. Zacchi. 1998. Use of hemicellulose hydrolysate for beta-glucosida se fermentation. Appl. Biochem. Biotechnol. 70-2: 225-235. 107. Rham, O. D., J. Kruseman, and J. Hidalgo. 1978. Non-Gelling Soy Protein Hydrolysate for Use in Concentrated Fluid Complex Foods. J. Food Sci. 43: 642-643. 108. Sauer, U., F. Canonaco, S. Heri, A. Perrenoud, and E. Fischer. 2004. The soluble and membrane-bound transhydrogenases UdhA and PntAB have divergent functions in NADPH metabolism of Escherichia coli J. Biol. Chem. 279: 6613-6619. 109. Schomburg, I., A. J. Chang, O. Hofmann, C. Ebeling, F. Ehrentreich, and D. Schomburg. 2002. BRENDA: a resource for enzyme data and metabolic information. Trends Biochem. Sci. 27: 54-56. 110. Shen, C. R., and J. C. Liao. 2008. Metabolic engineering of Escherichia coli for 1butanol and 1-propanol production via the keto-acid pathways. Metab. Eng. 10: 312-20. 111. Siegel, L. M., P. S. Davis, and H. Kamin. 1974. Reduced Nicotinamide AdenineDinucleotide Phosphate-Sulfite Reductase of Enterobacteria .3. Escherichia Coli Hemoflavoprotein Catalytic Parameters and Sequence of Electron Flow. J. Biol. Chem. 249: 1572-1586. 112. Sindt, J. J., J. S. Drouillard, H. Thippareddi, R. K. Phebus, D. L. Lambert, S. P. Montgomery, T. B. Farran, H. J. LaBrune, J. J. Higgins, and R. T. Ethington. 2002. Evaluation of finishing performance, carcass characteristics, acid-resistant E. coli and total coliforms from steers fed combinations of wet corn gluten feed and steam-flaked corn. J. Anim. Sci. 80: 3328-3335. 113. Singh, N. P., and A. Khan. 1995. Acetaldehyde Genotoxicity and Cytotoxicity in Human-Lymphocytes. Mutat. Res. 337: 9-17. 114. Solomon, B. O., S. K. Layokun, A. O. Idowu, and M. O. Ilori. 1994. Prospects for the Utilization of the Endogenous Enzymes in Sor ghum Malt in the Hydrolysis of Starch Case-Study with Utilization of Breadfr uit Starch for Ethanol-Production. Food Biotechnol. 8: 243-255. 101

PAGE 102

115. Strom, A. R., and I. Kaasen. 1993. Trehalose metabolism in Escherichia coli : stress protection and stress regulation of gene expression. Mol. Microbiol. 8: 205-10. 116. Sulzenbacher, G., K. Alvarez, R. H. H. van den Heuvel, C. Versluis, M. Spinelli, V. Campanacci, C. Valencia, C. Camb illau, H. Eklund, and M. Tegoni. 2004. Crystal structure of E. coli alcohol dehydrogenase YqhD: Evidence of a covalently modified NADP coenzyme. J. Mol. Biol 342: 489-502. 117. Szengyel, Z., G. Zacchi, and K. Reczey. 1997. Cellulase production based on hemicellulose hydrolysate from steam-pretreated willow. Appl. Biochem. Biotechnol. 635: 351-362. 118. Talarico, L. A., M. A. Gil, L. P. Yoman o, L. O. Ingram, and J. A. Maupin-Furlow. 2005. Construction and expression of an ethanol production operon in Gram-positive bacteria. Microbiology 151: 4023-4031. 119. Talebnia, F., and M. J. Taherzadeh. 2006. In situ detoxification and continuous cultivation of dilute-acid hydrolyzate to ethanol by encapsulated S. cerevisiae. J. Biotechnol. 125: 377-384. 120. Tarky, W., O. P. Agarwala, and G. M. Pigott. 1973. Protein Hydrolysate from Fish Waste. J. Food Sci. 38: 917-918. 121. Tucker, M. P., J. D. Farmer, F. A. Keller, D. J. Schell, and Q. A. Nguyen. 1998. Comparison of yellow poplar pretreatment be tween NREL digester and sunds hydrolyzer. Appl. Biochem. Biotechnol. 70-2: 25-35. 122. Um, B. H., M. N. Karim, and L. L. Henk. 2003. Effect of sulfuric and phosphoric acid pretreatments on enzymatic hydrolysis of corn stover. Appl. Biochem. Biotechnol. 105: 115-125. 123. Underwood, S. A., A. L. Buszko, K. T. Shanmugam, and L. O. Ingram. 2004. Lack of protective osmolytes limits final cell density and volumetric productivity of ethanologenic Escherichia coli KO11 during xylose fermentation. Appl. Environ. Microbiol. 70: 2734-2740. 124. van der Heide, T., M. C. A. Stuart, and B. Poolman. 2001. On the osmotic signal and osmosensing mechanism of an ABC transport system for glycine betaine. EMBO J. 20: 7022-7032. 125. van der Ploeg, J. R., M. A. Weiss, E. Saller, H. Nashimoto, N. Saito, M. A. Kertesz, and T. Leisinger. 1996. Identification of sulfate starvation-regulated genes in Escherichia coli : A gene cluster involved in the utilization of taurine as a sulfur source. J. Bacteriol. 178: 5438-5446. 102

PAGE 103

126. van Maris, A. J., D. A. Abbott, E. Bellissimi, J. van den Brink, M. Kuyper, M. A. Luttik, H. W. Wisselink, W. A. Scheffers J. P. van Dijken, and J. T. Pronk. 2006. Alcoholic fermentation of carbon s ources in biomass hydrolysates by Saccharomyces cerevisiae: current status. Antonie Van Leeuwenhoek 90: 391-418. 127. Vemuri, G. N., E. Altman, D. P. Sangurde kar, A. B. Khodursky, and M. A. Eiteman. 2006. Overflow metabolism in Escherichia coli during steady-state growth: Transcriptional regulation and effect of the redox ratio. Appl. Environ. Microbiol. 72: 3653-3661. 128. Weber, H., T. Polen, J. Heuveling, V. F. Wendisch, and R. Hengge. 2005. Genomewide analysis of the general stress response network in Escherichia coli : sigma(S)dependent genes, promoters, and sigma factor selectivity. J. Bacteriol. 187: 1591-1603. 129. Welsh, D. T., and R. A. Herbert. 1999. Osmotically induced intracellular trehalose, but not glycine betaine accumulation promotes desiccation tolerance in Escherichia coli FEMS Microbiol. Lett. 174: 57-63. 130. White, D. 2000. The physiology and biochemistry of prokaryotes, 2nd ed. Oxford University Press, New York. 131. Wyman, C. E., B. E. Dale, R. T. Elander, M. Holtzapple, M. R. Ladisch, and Y. Y. Lee. 2005. Comparative sugar recovery data from laboratory scale application of leading pretreatment technologies to corn stover. Bioresour. Technol. 96: 2026-2032. 132. Wyman, C. E., B. E. Dale, R. T. Elander, M. Holtzapple, M. R. Ladisch, and Y. Y. Lee. 2005. Coordinated development of leadi ng biomass pretreatment technologies. Bioresour. Technol. 96: 1959-1966. 133. Yomano, L. P., S. W. York, S. Zhou, K. T. Shanmugam, and L. O. Ingram. 2008. Re-engineering Escherichia coli for ethanol production. Biotechnol. Lett. 30: 2097-2103. 134. Yum, D. Y., B. Y. Lee, and J. G. Pan. 1999. Identification of the yqhE and yafB genes encoding two 2,5-diketo-D-gluconate reductases in Escherichia coli Appl. Environ. Microbiol. 65: 3341-3346. 135. Yutaka Tokiwa, B. P. C. 2008. Biological production of functional chemicals from renewable resources. Can. J. Chem. 86: 548-555. 136. Zaldivar, J., and L. O. Ingram. 1999. Effect of organic acids on the growth and fermentation of ethanologenic Escherichia coli LY01. Biotechnol. Bioeng. 66: 203-210. 137. Zaldivar, J., A. Martinez, and L. O. Ingram. 2000. Effect of alcohol compounds found in hemicellulose hydrolysate on the grow th and fermentation of ethanologenic Escherichia coli Biotechnol. Bioeng. 68: 524-530. 103

PAGE 104

138. Zaldivar, J., A. Martinez, and L. O. Ingram. 1999. Effect of selected aldehydes on the growth and fermentation of ethanologenic Escherichia coli Biotechnol. Bioeng. 65: 2433. 139. Zhang, T. F., and L. P. Hager. 1987. A single-step large-scale purification of pyruvate oxidase. Arch. Biochem. Biophys. 257: 485-487. 140. Zhang, X. M., Y. Li, B. Zhuge, X. M. Ta ng, W. Shen, Z. M. Rao, H. Y. Fang, and J. Zhuge. 2006. Construction of a novel recombinant Escherichia coli strain capable of producing 1,3-propanediol and optimization of fermentation parameters by statistical design. World Journal of Microbiology & Biotechnology 22: 945-952. 141. Zhou, S., T. B. Grabar, K. T. Shanmugam, and L. O. Ingram. 2006. Betaine tripled the volumetric productivity of D(-)-lactate by Escherichia coli strain SZ132 in mineral salts medium. Biotechnol. Lett. 28: 671-676. 142. Zhou, S., K. T. Shanmugam, L. P. Yoma no, T. B. Grabar, and L. O. Ingram. 2006. Fermentation of 12% (w/v) glucose to 1.2 M lactate by Escherichia coli strain SZ194 using mineral salts medium. Biotechnol. Lett. 28: 663-670. 104

PAGE 105

BIOGRAPHICAL SKETCH Elliot Norman Miller was born in San Diego, CA, in the year 1982. He traveled the countryside with his parents and brother, settling sporadically as the nature of his fathers miltitary career necessitated. At age nine Mr. Miller became a resident of Florida and has remained since. His education includes a hi gh school diploma from Seminole High School in Sanford, FL, as well as a bachelors degree in microbiology from the University of Florida, Gainesville, FL. 105