<%BANNER%>

Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2011-08-31.

Permanent Link: http://ufdc.ufl.edu/UFE0024727/00001

Material Information

Title: Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2011-08-31.
Physical Description: Book
Language: english
Creator: Koya, Vijay
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: Molecular Cell Biology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Statement of Responsibility: by Vijay Koya.
Thesis: Thesis (Ph.D.)--University of Florida, 2009.
Local: Adviser: Yang, Lijun.
Electronic Access: INACCESSIBLE UNTIL 2011-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0024727:00001

Permanent Link: http://ufdc.ufl.edu/UFE0024727/00001

Material Information

Title: Record for a UF thesis. Title & abstract won't display until thesis is accessible after 2011-08-31.
Physical Description: Book
Language: english
Creator: Koya, Vijay
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: Molecular Cell Biology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Statement of Responsibility: by Vijay Koya.
Thesis: Thesis (Ph.D.)--University of Florida, 2009.
Local: Adviser: Yang, Lijun.
Electronic Access: INACCESSIBLE UNTIL 2011-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0024727:00001


This item has the following downloads:


Full Text

PAGE 1

1 PDX1 PROTEIN THERAPY: A NOVEL APPROACH FOR TREATMENT OF DIABETES By VIJAY KOYA A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2009

PAGE 2

2 2009 Vijay Koya

PAGE 3

3 To my brother and parents, for their support and appreciation for higher education, and to my wife for her support all through my graduate schoo l.

PAGE 4

4 ACKNOWLEDGMENTS I have spent last 4 years at the University of Florida working towards my doctoral degree. In the process I had opportunity to learn, explore, and teach. I have had unique experiences that helped me to develop as an individual and helped me plan my career for the future. There have many people who have influenced my thought process, my behavior and my interaction. During this 4 year long journey, I have been helped by many people to successfully reach my research goals. Firstly, I w ould like to thank my mentor, Dr. Lijun Yang for giving me an opportunity to conduct research in her lab. She has been exceptionally helpful in achieving my research goals. She has supported me in every possible way to have an enjoyable experience in her lab. Her unwavering support has helped me to achieve my goal to obtain admission into residency program. Her enthusiasm and perseverance has motivated me to work extra hard. Next, I would like to than k my supervisory committee Dr. Daniell Purich, Dr. Lung-j i Chang, Dr. Chen Liu, and Dr. Sally litherland. Their insight has helped me to accelerate my research progress and made sure I am progressing in right direction. I should thank Dr. Purich for his personal advice. Conversation with him has been inspiring and motivates me to achieve greater heights in s cience. I should thank Dr. Lung-ji Chang for providing with reagents necessary for my experiments. Next, I would like to thank Dr. Shiwu Li (expert in Molecular biology) for his constant support technically and intellectually. Working with him has been a memorable experience. He has been a constant backbone for my research achievements. He has optimized to generate high quality Pdx1 protein, the most valuable reagent that shaped my research projects. He is very approachable person, has a great knowledge in various fields of biomedical sciences, technically sound, and has a great sense of humor. He has been a constant source to clarify my doubts.

PAGE 5

5 I would like to thank Dr. Shun Lu for his help with the Balb/C mice project. I would like to thank Dr. Chang Qing and Dr. Dongqi Tang for teaching me techniques related to animal surgery and dissection. I would like to thank my lab colleagues Cathy and Hong Fong for their technical assistance with the experiments. I wo uld like to thank William Donlean for his assistance with lab ordering, lab maintenance and equipment handling. He is a great person to work and having him around is always fun. I should thank Michael lagoe and Adam Kenney, undergraduates in the lab who have been a helping hand in conducting some of my experiments. Mike is a fun guy to work with. He has shown extreme level of dedication towards the experiments that I have assigned to him. I would like to thank Fred Hutchinson for his help in the mouse colony. He has been exceptionally helpful in maintaining my mouse colonies. I would like to thank Sushama (my wife), Dr. Satish Medisetty, Suntiha, Karthik, Rushi and Will for proof-reading my dissertation. I would like to thank all my friends and colleagues in the PhD program for their support and encouragement through all these years. I would like to thank my family for their constant support and encouragement all these years. I would like to thank my wife for her exceptional support with both academic and no-academic affairs. I would like to thank the IDP and MCB program directors for making it an enjoyable learning experience.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS ...............................................................................................................4 LIST OF TABLES .........................................................................................................................10 LIST OF FIGURES .......................................................................................................................11 LIST OF ABBREVIATIONS ........................................................................................................14 ABSTRACT ...................................................................................................................................16 CHAPTER 1 INTRODUCTION ..................................................................................................................18 Diabetes ..................................................................................................................................18 Ty pe 1 Diabetes ...............................................................................................................18 Type 2 Diabetes ...............................................................................................................19 Current Treatment Options ..............................................................................................20 Novel Approaches for Treatment of Diabetes .................................................................21 Pancreatic Duodenal Homeobox 1 (Pdx1) .............................................................................21 Function of Pdx1 in Pancreatic Beta Cells ......................................................................22 Protein Transduction Domain (PTD) ..............................................................................23 Beta Cell Regeneration ....................................................................................................24 Liver Cell Transdifferentiation into insulin -producing cells (IPCs) ...............................24 Significance ............................................................................................................................26 2 GENERAL METHODS .........................................................................................................27 Recombinant DNA Technology .............................................................................................27 Plasmid Isolation .............................................................................................................27 Preparation of LB Broth ..................................................................................................27 Agar Gel Electrophoresis ................................................................................................27 Polymerase Chain Reaction .............................................................................................27 Restricti on D igestion .......................................................................................................28 DNA L igation ..................................................................................................................28 Transformation of Competent E.coli Cells ......................................................................28 Protein Expression, Purification and Analysis .......................................................................29 Protein Expression in Bacteria ........................................................................................29 Protein Purification ..........................................................................................................29 Dialysis of the Purified Protein .......................................................................................30 Sodium Dodecylsulphate Polyacrylamide Gel Electrophoresis (SDS PAGE) .............31 Western Blotting ..............................................................................................................31 Mammalian Cell Culture Protocols ........................................................................................32

PAGE 7

7 Cell Culture .....................................................................................................................32 Transfection of Plasmid in Mammalian Cells .................................................................32 RNA Isolation from Cells/Tissue ....................................................................................33 c DNA Synthesis ..............................................................................................................33 Measurement of Luciferase Activity ...............................................................................34 Extraction and Measurement of Insulin ..................................................................................34 Serum Sample Collection for Measurement of Insulin by ELISA ..................................34 Tissue Sample Collection for Measurement of Insulin by ELISA ..................................34 ELISA for Measurement of Insulin .................................................................................35 Procedures for Imaging ...........................................................................................................35 Haematoxylin and Eosin (H &E) Staining ......................................................................35 Immunofluroscence .........................................................................................................36 General Animal Procedures ....................................................................................................36 Animal Housing ...............................................................................................................36 Collection of Blood .........................................................................................................37 Tissue Sample Collection for Histology ..........................................................................37 Measurement of Blood Glucose ......................................................................................37 Tissue Sample Collection for RNA Isolation ..................................................................37 Anesthesia ........................................................................................................................38 Pancreatectomy ................................................................................................................38 Splenectomy ....................................................................................................................38 3 REVERSAL OF STREPTOZOTOCIN INDUCED DIABETES IN MICE BY CELLULAR TRANSDUCTION WITH RECOMBINANT PANCREATIC TRANSCRIPTION FACTOR PANCREATIC DUODENAL HOMEOBOX-1 ...................40 Introduction .............................................................................................................................40 Mater ials and Methods ...........................................................................................................41 Construction and Production of rPdx1, PTDGreen Fluorescent Protein, and Mutant Pdx1 Fusion Proteins .......................................................................................41 Cell Entry and Immunoblotting .......................................................................................42 rPdx1 Functional Analyses Using NeuroD-Luciferase Reporter Construct ....................43 Animal Studies ................................................................................................................43 Low-Dose Streptozotocin-Induced Diabetes ...................................................................43 Intraperitoneal Glucose Tolerance Test ...........................................................................44 Pdx1 Protein in vivo Kinetics and Tissue Distribution ....................................................44 RT PCR ...........................................................................................................................44 Quantitative RealTime RT PCR Analysis .....................................................................45 Immunohistochemistry and Immunofluorescence ..........................................................46 Tissue and Serum Insulin Measurements by Enzyme-Linked Immunosorbent Assay ...47 Statistical Analysis ..........................................................................................................47 Results .....................................................................................................................................47 Generation of Recombinant Fusion Prote ins ...................................................................47 Characterization of Recombinant Fusion Proteins ..........................................................48 In vivo Kinetics and Tissue Distribution .........................................................................49 In vivo Effects of rPdx1 on Blood Glucose Levels in Diabetic Mice .............................50

PAGE 8

8 Pdx1 Treatment Promoting Endogenous beta cell Regeneration ....................................51 Pdx1 Treatment Promoting Liver Cell Transdifferentiation into IPCs ...........................52 Relationship b etween Pancreas and Liver at Tissue Insulin Levels ................................53 Discussion ...............................................................................................................................54 4 PDX1 PROTEIN THERAPY PREVENTS THE ONSET OF TYPE 1 DIABETES IN NOD MICE .............................................................................................................................79 Introduction .............................................................................................................................79 Materials and Methods ...........................................................................................................80 Animal Studies ................................................................................................................80 Intraperitoneal Glucose Tolerance Test (IPGTT) ............................................................80 Serum Insulin Measurements ..........................................................................................81 Construction of Truncated Pdx1 Proteins ........................................................................81 Extraction of Splenocytes from the Spleen .....................................................................82 Lymphocyte Proliferation Assay .....................................................................................82 BDC 2.5 Mice Splenocyte Transfer ................................................................................83 Results .....................................................................................................................................83 Administration of rPdx1 to NOD Mice Prevents the Onset of Diabetes .........................83 Beta cell Functional Analysis and Determination of Tissue Insulin Levels ...................84 Pdx1 Treatment Preserves Islet Mass Possibly by Beta cell regeneration and Promotes Liver Cell Transdifferentiation into Insulin -Producing Cells. .....................84 Detection of Pdx1 Antibodies in Serum Samples of rPdx1/Salinetreated Mice ............85 Determination of Antigenic Epitope of Pdx1 Protein .....................................................85 PAA emerge before the onset of diabetes. ......................................................................86 Demonstration of Autoreactive Lymphocytes Against Pdx1 Protein in NOD Mice ......87 Decreased Proliferation of Donor Derived BDC2.5 CD4+ Lymphocytes in Pancreatic Lymph N ode ...............................................................................................87 Effect of Mutant -rPdx1 On the Onset of Diabetes in NOD mice ....................................88 Discussion ...............................................................................................................................88 5 MOLECULAR MECHANISM OF THE ROLE OF PDX1 IN BETA CELL PROLIFERATION ...............................................................................................................112 Introduction ...........................................................................................................................112 Materials and Methods .........................................................................................................113 Cell Culture ...................................................................................................................113 Design of siRNA for the Pdx1 Transcript .....................................................................113 siRNA Mediated Knockdown of Pdx1 Transcript in INS1 Cells ................................113 Western Blotting with Anti-Pdx1 and Anti-tubulin Antibody ......................................114 B rdU Proliferation Assay ..............................................................................................114 Real Time PCR ..............................................................................................................115 Construction of pGL4.10-Cyclin B1 PromoterLuciferase Vector ...............................116 Analysis of Promoter Constructs for Activation by Pdx1 or Nkx6.1 using Luciferase Reporter Assays .......................................................................................116 Results ...................................................................................................................................117

PAGE 9

9 Phenotype of INS-1 Cells Treated with Pdx1 siRNA ...................................................117 siRNA-mediated Knockdown of Pdx1 Transcripts in INS1 Cells ...............................117 Decrease in Cell Proliferation of Pdx1 Knockdown Cells ............................................117 Analysis of the Gene Expression of Beta Cell Specific transcription factors and Cell Cycle Genes........................................................................................................118 Analysis of Cyclin B1 Promoter using CMV Pdx1 .......................................................118 Nkx6.1 Activation of Cyclin B1 Promoter ....................................................................118 Pdx1 Activation of Nkx6.1 Promoter ............................................................................119 Discussion .............................................................................................................................119 6 FUTURE STUDIES .............................................................................................................132 Reversal of Streptozotocin -induced Diabetes in Mice by Cellular Transduction with Recombinant Pancreatic Transcription Factor, Pancreatic Duodenal Homeobox -1 .........132 Future Studies ................................................................................................................132 Pdx1 Protein Therapy for the Treatment of Type 1 Diabetes in NOD Mice ........................134 Future Studies ................................................................................................................134 Molecular Mechanism of the Role of Pdx1 in Beta C ell Proliferation .................................135 Future Studies ................................................................................................................135 APPENDIX A NOD MICE TRIAL 1 ...........................................................................................................136 B NOD MICE TRIAL 2 ...........................................................................................................137 REFERENCES ............................................................................................................................138 BIOGRAPHICAL SKETCH .......................................................................................................152

PAGE 10

10 LIST OF TABLES Table page Table 3 -1. Primer name, sequences, size, GenBank #, and PCR condition ...................................59 Table 3 -2. Real time PCR Primer name, sequences, size, GenBank #, and PCR condition ..........60 Table 5 1. Real time PCR Primer name, sequences, size, GenBank #, and PCR condition ........122 Table A 1. Mice database of trial 1 .............................................................................................136 Table B 1. Mice database of trial 2 ..............................................................................................137

PAGE 11

11 LIST OF FIGURES Figure page 3-1 Cloning, expression, purification, and characterization of rat Pdx1, PTD-GFP, and rPdx1-mut fusion proteins. ...............................................................................................61 3-2 Time course of cell entry of rPdx1 and rPdx1-mut proteins. .............................................62 3-3 Functional analysis of rPdx1 protein. ................................................................................63 3-4 In vivo kinetics and tissue distribution of rPdx1 following intra-peritoneal injection. .....64 3-5 In vivo tissue distribution of rPdx1 following intrape ritoneal injection. ...........................65 3-6 Experimental timeline for rPdx1 treatment. .......................................................................66 3-7 In vivo effects of rPdx1 protein on blood glucose l evels. ..................................................67 3-8 Intraperitoneal glucose tolerance test. ................................................................................68 3-9 Comparison of average blood glucose and Insulin levels between rPdx1 treated and untreated control mice. .......................................................................................................69 3-10 Histology of pancreatic islets. ............................................................................................70 3-11 Immunostaining with anti-KI67 antibody and anti-insulin antibody. ................................71 3-12 Quantitative Realtime PCR analyses of pancreatic tissue between rPdx1 treated and control mice. ......................................................................................................................72 3-13 Insulin immunohistochemical staining of liver tissue. ......................................................73 3-14 RT PCR analysis of the expression of pancreatic genes in the liver.. ...............................74 3-15 Quantitative Real Time PCR analyses of pancreatic gene expression in liver.. ................75 3-16 Expression of pancreatic genes in other organs.. ...............................................................76 3-17 Pancreatic tissue insulin measurements as determined by ELISA. ...................................77 3-18 Liver tissue insulin measurements as determined by ELISA. ...........................................78 4-1 Time line for the experimental plan for treatment of NOD mice. .....................................92 4-2 Effect of rPdx1 (12weeks) on the onset of diabetes in NOD mice. ..................................93 4-3 Blood glucose levels of rPdx1 (12weeks) treated NOD mice. .........................................94

PAGE 12

12 4-4 Body weights of rPdx1 (12weeks) treated NOD mice. ....................................................95 4-5 Effect of short term rPdx1treatment (4 weeks) on the onset of diabetes in NOD mice. ...96 4-6 Blood glucose levels of rPdx1 (4weeks) treated N OD mice. ...........................................97 4-7 Effect of short term rPdx1treatment (8 weeks) on the onset of diabetes in NOD mice. ...98 4-8 Blood glucose levels of rPdx1 (8weeks) treated NOD mice. ...........................................99 4-9 Intraperitoneal glucose tolerance test. IPGTT (n=4/group). ...........................................100 4-10 Serum insulin m easurements as determined by ELISA ................................................101 4-11 Haematoxylin & Eosin staining and immunohistochemistry of pancreatic tissue sections. ............................................................................................................................102 4-12 Pancreas and liver tissue insulin levels as determined by ELISA. ................................103 4-13 Detection of Pdx1 antibodies by ELISA in the NOD mice. ............................................104 4-14 Confirmation of anti-Pdx1 antibody in the NOD mice by western blotting. ...................105 4-15 Determination of antigenic epitope by western blot. .......................................................106 4-16 Relationship between Pdx1 autoantibody levels and onset of diabetes. ..........................107 4-17 Antigen-stimulated lymphocyte proliferation. .................................................................108 4-18 Transfer of splenocytes from donor BDC2.5 mice to the recipient NOD mice. .............109 4-19 Illustration of Pdx1 and mutant Pdx1proteins. ..............................................................110 4-20 Effects of mutant -Pdx1 on the onset of diabetes. .........................................................111 5-1 Location of 21 mer siRNAs on Pdx1 mRNA transcript. .................................................123 5-2 Phenotype of INS1 cells treated with Pdx1 siRNA.. .......................................................124 5-3 Confirmation of Pdx1 knockdown using western blotting. .............................................125 5-4 Measurement of INS -1 cell proliferation using BrdU incorporation. ..............................126 5-5 Analysis of relative change in the gene expression. ........................................................127 5-6 Analysis of cyclin B1 promoter using CMV Pdx1 .........................................................128 5-7 Nkx6.1 activation of Cyclin B1promoter .........................................................................129 5-8 Pdx1 activation of Nkx6.1 promoter. ...............................................................................130

PAGE 13

13 5-9 T cell cycle progression.. .....................131

PAGE 14

14 LIST OF ABBREVIATIONS BrdU B romo -deoxyuridine CFSE Carboxyfluorescein diacetate, succinimidyl ester CMV Cauliflower mosaic virus ELISA Enzyme linked immunosorbance assay GAD Glutamic acid decarboxylase GFP Green f luorescent protein GLP -1 Glucagonlike p eptide -1 GST Glutathione transferase H&E Hematoxylin & eosin HRP Horse radish peroxidase Hsp H eat shock protein IAA Insulin auto antibody IACUC I nstitutional animal care & use committee IAPP Islet amyloid polypeptide ICA Islet cell autoantibody IDDM Insulin dependent diabetes mellitus IgG Immunoglobulin G INGAP I slet neogenesis associated protein INS -1 Insulinoma cell line IP Intra peritoneal IPCs Insulin -producing cells IPGTT Intraperitoneal glucose tolerance test NOD Nonobese diabetic

PAGE 15

15 NIDDM Non -insulin dependent diabetes mellitus PAGE Poly acrylamide gel electrophoresis PBS Phosphatebuffered saline Pdx1 Pancreat ic duodenal homeobox-1 PTD Protein transduction domain rPdx1 Recombinant Pancreatic duodenal homeobox-1 RT PCR Reverse transcriptase polymerase chain reaction SDS Sodium dodecyl-sulphate STZ Streptozotocin

PAGE 16

16 Abstract of Dissertation Presented to th e Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy PDX1 PROTEIN THERAPY: A NOVEL APPROACH FOR TREATMENT OF DIABETES By Vijay Koya August 2009 Chair: Lijun Yan g Major: Medical Sciences Molecular Cell Biology Diabetes is a metabolic disorder characterized by hyperglycemic condition that occurs due to insulin deficiency (autoimmune type 1 diabetes) or insulin resistance (type 2 diabetes). Pdx1 is widely regarded as a master transcriptional regulator of the pancreas and is critical for development, regeneration, and maintenance of beta-cell function. Pdx1 protein possesses a protein transduction domain (PTD) sequence that f acilitates its entry into cells This stu dy, therefore, sought to evaluate the capacity of in vivo administered recombinant Pdx1 (rPdx1) in an effort to ameliorate hyperglycemia in mice with streptozotocin ( STZ)-induced diabetes. Administration of rPdx1 into STZ-induced diabetic mice led to resto ration of euglycemia. Insulin, glucagon, and Ki67 immunostaining revealed increased islet cell number and proliferation in islets of pancreata of rPdx1 treated mice. Analysis of liver tissue by RT PCR and insulin immunostaining demonstrated that the rPdx1 treatment promoted liver cell reprogramming into insulin-producing cells. This novel PTD-based protein therapy offers a promising way to treat patients with diabetes while circumventing the potential side effects associated with the use of viral vectors. We further investigated the therapeutic effects of rPdx1 in NOD mice (t ype 1 diabetic mouse model). Administration of rPdx1 to prediabetic NOD mice prevented the onset of

PAGE 17

17 diabetes. The c haracterization of NOD mice revealed the presence of anti -Pdx1 autoantibodies in pre-diabetic mice indicating the possible role of Pdx1 as an autoantigen. The role of Pdx1 as an autoantigen was confirmed by demonstration of Pdx1 dependent activation of lymphocytes and mapping of the epitope region responsible for autoantibody production. Decreased proliferation of CD4 + T lymphocytes in the pancreatic lymph nodes of rPdx1treated mice, confirmed the role of rPdx1 in immunomodulation. In conclusion, Pdx1 is a novel autoantigen and rPdx1 antigenbased immunotherapy could serve as an effective strategy for prevention of the onset of diabetes. In order to understand the role of Pdx1 in beta cell regeneration, we explored to study the siRNA mediated knockdown of Pdx1 in rat insulinoma cells (INS 1cells). The BrdU proliferation as say demonstrated a decrease in the proliferation of cells treated with Pdx1 siRNA. The knockdown studies suggested that beta cell specific transcription factors and cell cycle regulato rs may be involved in regulation of beta cell proliferation. Molecular s tudies indicated that Pdx1 promotes beta cell cycle progression by activation of cyclin B1 expression via Nkx6.1. In conclusion, these studies investigated the role of Pdx1 in promoting beta cell regeneration, liver cell transdifferentiation and immunomo dulation towards the treatment of diabetes.

PAGE 18

18 CHAPTER 1 INTRODUCTION Diabetes Diabetes is a metabolic disorder characterized by hyperglycemic condition. The symptoms include frequent urination (polyuria), excessive thirst (polydipsia), extreme hunger (polyphagia), increased fatigue and unusual weight loss. According to the estimates by the American Diabetic Association, there are 20.8 million children and adults in the United States, or 7% of the population suffering with diabetes. The exact cause of diabetes continues to be a mystery, it has been demonstrated that both genetic and environmental factors play a role in causing the disease (1 5) Diabetes is classified into two types, type 1 (insulin dependent diabetes mellitus or IDDM) and type 2 (noninsulin dependent diabetes mellitus or NIDDM). Type 1 Diabetes IDDM occurs due to an absol ute deficiency of the insulin hormone. It occurs mostly in children and young adults, hence, termed as juvenile diabetes. The disease is characterized by the autoimmune destruction of pancreatic beta cells (6) Predisposition to a given autoimmune response requires the requisite allele(s) that controls antigen presentation by antigen-presenting cells for T -cell recognition. The main susceptibility genes code for polymorphic HLA molecules and in particular alleles of class II MHC genes (DR, DQ and DP). Polymorphisms of individual genes outside the MHC also contribute to diabetes risk but recent evidence suggests that there are additional non HLA genes determining suscep tibility l inked to the MHC (7). Some autoimmune responses emerge following infection by a pathogen, whose protein(s) possess structural similarities in some of its epitopes to regions on proteins of the host(2). Thus, antibodies evoked against a pathogen might crossreact with a self protein and act as autoantibodies, and the involved autoantigen then provides a source for persistent stimulation.

PAGE 19

19 Proteins to which the immune system is ordinarily self tolerant might, if altered, elicit auto immune responses. Environmental factors appear to play an important role in the pathogenesis of childhoodons et type 1 diabetes(2) The most important factors are thought to be infectious, dietary, perinatal, and psychosocial. Enteroviruses (especially Coxsackie B virus), breastfeeding, the early presence or lack of certain foods, birth weight, childhood overnutrition, maternal islet autoimmunity, and negative stress events have been shown to be related to the prevalence of type 1 diabetes. However, clear conclusions to date are limited (8). It has been r eported that approximately 50% of the genetic risk for type 1 diabetes can be attributed to the HLA region. The highest risk HLA-DR3/4 DQ8 genotype has been shown to be highly associated with betacell autoimmunity. The first antibodies described in associat ion with the development of type 1 diabetes were islet cell autoantibodies (ICA) (9) Subsequently, antibodies to insulin (IAA)(10), glut amic acid decarboxylase ( GAD) (11) and protein tyrosine phosphatase (IA2 or ICA512) have all been characterized (12) Several studies have been conducted in nonobese diabetic ( NOD ) mice to understa nd the antigen based immunotherapeutic strategies to suppress beta cell auto immunity. Much success has been achieved in NOD mice using administration of autoantigens such as insulin (13;14), GAD65 (11;15-19) and H sp60(20;21). Few of the antigen m olecules have been tested in human patients with limited success. The Insulin antigen based clinical trials were conducted in the pre diabetic human patients in Diabetes Prevention Trail 1 (DPT -1), however the treatment had limited or no significant effect s(22;23). Similarly inconclusive results were obtai ned with clinical trials using H sp, P27-peptide in human subjects(24). Type 2 Diabetes Type 2 or non-insulin dependent diabetes mellitus (NIDDM) accounts for 90% of cases and is characterized by a triad of (1) resistance to insulin action on glucose uptake in peripheral

PAGE 20

20 tissues, especially skeletal muscle and adipocytes, (2) impaired insulin action to inhibit hepatic glucose production, and (3) dysregulated insulin secretion (25) In most cases, Type 2 diabetes is a polygenic disease with complex inheritance patterns (4;25). Environmental factors, especially diet, physical activity, and age interact with genetic predisposition to affect disease prevalence. (26). Type 2 diabetes is often accompanied by other conditions, including hypertension, high serum low-density-lipoprotein (LDL) cholesterol concentrations, and low serum high-densitylipoprotein (H DL) cholesterol concentrations Hyperinsulinemia occurring in response to insulin resistance may play an important role in the genesis of these abnormalities. Increased free fatty acid levels, inflammatory cytokines from fat, and oxidative factors, have al l been implicated in the pathogenesis of type 2 diabetes. I nsulin insensitivity is an early phenom enon partly related to obesity and pancreas beta-cell function declines gradually over time already before the onset of clinical hyperglyc emia. Several mechanisms have been proposed, including increased nonesterified fatty acids, inflammatory cytokines, adipokines, and mitochondrial dysfunction for insulin resistance, glucotoxicity, lipotoxicity, and amyloid formation for beta-cell dysfunction (27). Current Treatment Options The most common method of treatment of both type 1 and type 2 diabetes is Insulin replacement therapy. Insulin replacement therapy was first initiated du ring 1920s and continues to be the most common approach to overcome adverse effects of the diabetic condition. However, insulin replacement therapy remains to be a management drug that can ameliorate the symptoms but is not considered a true remedy (28). Alt hough it is the most common approach for the management of diabet es, it has several complications Acute complications include dosage i ssue where in patients may be at a risk of overdose leading to hypoglycemia. Chronic

PAGE 21

21 complications are associated with aberrant glucose metabolism that include retinopathy, nephropathy and cardiovascular problems (29). With the development of Edmonton protocol for islet transplantation, it gained importance as an alternative long term therapy for type1 diabetes patients. The treatment regimen also included long term use of immunosuppressive drugs sirolimus and tacrolimus. Patients did achieve insulin independence only for a short period of time (1 year) (30). The long term usage of immunosuppressive drugs and insufficient number of donor cadavers for transplantation procedures has put the brakes on this approach. Novel Approaches for Treatment of Diabetes With the advancements in stem cell technologies, the cell based therapy has become a promising avenue for treatment of diabetes. Transdifferentiation of b one marrow derived cells into betalike cells has been achieved with limited success in mice models(31). Autologous hematopoietic stem cell transplantation approach is currently under clinical trial in Brazil. The newly onset diabetic patients (15 patients) were identified and administered with immunemodulatory drugs and GM-CSF to mobilize bone marrow cells(32) The patients could achieve insulin independence for over a period of 3 years. Efforts have been made to engineer cord blood stem cells into insulin producing beta like cells, however the complexity of this approach has significantly slowed down the progress in this area(33). A ma jor mile stone has been achieved recently in cell based therapy with the engineering of glucose responsive insulin secreting cell from embryonic cells (34) Pancreatic Duodenal H omeobox 1 ( Pdx1) Pdx1 is a transcriptional factor, plays crucial role in pancreas development and beta cell differentiation during embryogenesis(35;36). Its role in post nata l stage is maintaining mature beta cell function and regulating gene expression of several important genes in the

PAGE 22

22 pancreas(3 5;37;38). During embryogenesis, Pdx1 expression domain appears in the duodenum early in development along with Hlxb9 and demarcates a population of cells that represent the earliest pancreatic precursors. Later it is expressed in all cells differentiating toward the exocrine and endocrine components of the pancreas where it triggers the genetic cascade necessary for differentiation of precursor cells into different cell types in the pancreas. In the adult pancreas, Pdx1 expression is predominantly restric ted to the insulin producing islet beta cells and a subset of somatostatin producing delta cells (39 -41). Pdx1 null mutant resulted in agenesis of pancreas with hyperglycemia and did not survive after birth(35). Pdx1 has been found to play key role in beta cell neogenesis and insulin production (38). Function of Pdx1 in P ancreatic Beta C ells In mature beta cells, Pdx1 transactivates the insulin gene and islet amyloid polypeptide (IAPP) and other genes involved in glucose sensing and metabolism, such as GLUT2(35;42) and glucokinase(35;43). Pdx 1 regulates the pancreasspecific expression of other transcriptional factors such as Pax4 Nkx6.1 and Pdx1 itself. Pdx 1 cooperates with Hnf -3b to autoactivate its own transcription (44) During regeneration of the islets, either from duct cells or by replication, Pdx1 is plays a major role by triggering the genetic ca scade of differentiation (45). Pdx 1 protein possesses N terminal region tran sactivation domain, in the middle region, an antennapedialike homeodomain consisting of 3 helices. The homeodomain of the Pdx1 protein plays a critical role in DNA binding and proteinprotein interactions as a transcriptional activation mechanism. Furthermore, it contains a protein transduction domain within the helix 3 region consisting of 7 amino acids (RRMKWKK) that is conserved in mice, rats, and humans (46) This sequence plays a major role in nuclear entry of the Pdx1 protein to perform its major transcriptional events occurring in the pancreas.

PAGE 23

23 Protein Transduction D om ain (PTD) The protein transduction domains are short peptides with rich basic amino acids such as arginine and lysine, help facilitate binding to negatively charged heparin sulphate proteoglycans on the lipids membrane followed by internalization via receptor -independent macropinocytosis into the cytoplasmic and nuclear compartments (47 -49). This phenomemon was first reported in HIV Tat transactivator (50;51). Later such transduction domains were discovered in homeodomain region of the antennapedia, a transcriptional factor of the Drosophila melanogaster (47;52). The protein transduction domain has been proved to successfully carry protein into the cells and be functional. The artif icial engineered protein transduction domains were covalently linked the macromolecules to transduce the macromolecule into the cell. Site specific recombination in human embryonic stem cells was demonstrated using the PTD mediated Cre recombinase(53). The protein transduction domain has been exploited successfully to deliver wide variety of molecules such as antigenic epitopes(54) and large protein molecules (55;56). Most recently recombinant proteins with protein transduction domains were used for generation of induced pluripotent stem cells(57). The first in vivo studies of PTDs were demonstrated by engineering beta-gal molecule to the PTD(58). Protein transduction domains were engineered with therapeutic molecules demonstrated their biological activity in disease models of asthma (59), Inf lammation (60) cancer (61), Stroke(61;62). Pdx1 protein has its own inbuilt antennapedia like protein transduction domain(63;64) that will help the protein to enter the cells in a receptor independent manner by lipid raft dependent macropinocytosis(65;66) The Pdx 1 protein has been used to transduce into pancreatic duct cells and di fferentiate them into insulin -producing cells in vitr o(63) Despite several studies in vitro showing functional significance of PTD in P dx1, in vivo functional studies are yet to be explored.

PAGE 24

24 Beta Cell R egeneration P dx1 is regarded as a master transcriptional regulator of pancreas development and is critically needed for the development, regeneration, and function of islet cells. Beta cell regeneration has been known to occur during pregnancy, initial stages of insulin resistance to meet the insulin demands, early stages of beta cell destruction, partial pancreatectomy. During post natal condition, the primary mechanism by which new beta cells are formed is by self duplication or replication of the existing cells (67;68) and/or differentiation of beta cell from duct cell progenitors (neogenesis). Pancreatic duodenal homeobox (Pdx1) is the key transcriptional factor controlling the beta cell regeneration (37;39;68). However, the mole cular mechanism associated with the role of Pdx1 in beta cell regeneration is yet to be investigated. In vivo regeneration of residual islet cells appear to be linked to increased biosynthesis of the pancreatic duodenal homeobox-1 (Pdx1) transcription fa ctor (45). However, P dx1 mediated regeneration mechanism is severely hinder ed during diabetic condition due to the oxidative stress(45;69-71) Previous studies in HIT T15 cells and zucker diabetic rats have shown that oxidative stress causes post transcriptional defect in Pdx1 mRNA processing (69;72) One possible approach to overcome the diabetic condition could be restoring and/or expediting the beta cell replication mechanism by aug menting the Pdx1 expression. The mechanism of beta cell replication in hyperglycemic state could be enhanced by hyperexpression of key transcription factors such as factor pa ncre atic duodenal homeobox (Pdx1) necessary for beta cell regeneration. Liver Cell T ransdifferentiation into insulin producing cells ( IPCs ) Liver and pancreas are closely related both developmentally and phylogenetically. Liver and pancreas are derived from appendages of the upper primitive foregut endoderm. It has been suggested that the late separation of liver and pancreas during organogenesis in primitive ventral

PAGE 25

25 endoderm might have left both tissues with pluripotent cells that are capable of giving rise to both hepatic and pancreatic lineages. In lower organisms, such as worms and fish, the two organs never gets separated during organogenesis and the hepato pancreas functions as both liver and pancreas (73-76). Tissues of both the organs have some metabolical similarities such as responsiveness to glucose, and both express a l arge group of specific transcription factors such hat are known to control the Pdx 1 expression in pancreatic cells and cou ld cooperate other wise silent Pdx1 expression during transdifferentiation (39;44;74) Under the experimental and pathological conditions such as cancer, transconversion of pancreatic acinar cells and hepatocytes in both rodents and humans has been reported (77). Mounting evidence indicates that liver stem cells (78;79) and adult hepatocytes (80) can be reprogrammed into IPCs by ectopic overexpression of Pdx 1 that restore euglycemia in diabetic mice (81). Pdx1 induces developmental redirection from hepatic to pancreatic lineage by repressing the expression of key hepatic transcription factor CCAAT/enhancer -bi ( ) (82) Liver cell transdifferentiation into IPCs was achieved in both in vitro and in vivo conditions by hyper expressing Pdx1 via gene transfer approach using lentivirus or adenovirus(78;83-85). T ransi ent over expression of Pdx 1 using adenovirus gene therapy in the liver in vivo has led to transdifferentiaton of liver cells into insulin -producing cells. This remarkable approach has several advantages such as IPCs derived from liver cell do have resistance against the autoimmune attack unlike the beta cells in islets (86). However, studies from other groups using gene therapy resulted in hepatitis(86;87) and development of tumors which limited the feasibility to apply for human subjects. The alternative approach using protein therapy using protein transduction domain could be a safe and efficient approac h for the production of insulinproducin g cells. A safe and ef ficient method of delivering Pdx 1 to

PAGE 26

26 reprogram the target cells would eventually make this approach more feasible for the clinical setup. Investigations are underway to characterize the cell types within liver that are susceptible to transdifferentiation. It was demonstrated that hepatocyte proliferation induced by partial hepatectomy and enforced ectopic Pdx1 expression using gene therapy accelerate transdifferentiation process in liver (88) Recent studies have used DDC mouse model for demonstrating the transdifferentiation of oval cells into IPCs(89). Significance Given its key role in pancreatic development, islet cell regeneration, liverto -endocrine pancreas transdifferentiation as we ll as its ability to autoregulate itself, Pdx1 protein is an ideal candidate for protein therapy, especially because of its antennapedialike PTD, permitting its rapid entry into cells. We therefore aim to test the hypothesis that effective in vivo delivery of recombinant Pdx1 protein (rPdx1) will allow its entry into pancreatic or liver progenitor/adult cells, where it can exert transcriptional control on its target genes, leading to restoration of normoglycemia in S treptozotocin -induced diabetic mouse model and delay in the onset of diabetes in Nonobese diabetic mouse model. We believe that the proposed study will serve as a model system to design a rational protocol for preclinical investigation using protein based approach for the treatment of diabetes. This approach will eliminate the need for gene therapy that is facing severe challenges in clinical trials.

PAGE 27

27 CHAPTER 2 GENERAL METHODS T his chapter discusses general methodologies and materials that are common used in the laboratory. However, specific experimental procedures in re lation to the specific aims are described in detail in respective chapters. Recombinant DNA Technology Plasmid Isolation The DNA plasmid was isolated and purified using Qiagen plasmid miniprep kit or Qiagen plasmid midi kit. P reparation of LB Broth Ten LB medium capsules (Lennox) in 500 mL dd water were used in 2 L flask to make 500 mL of media. The flask was autoclaved and cooled to room temperature before use. Agar Gel E lectrophoresis For 1% agarose gel, 1 gram of electrophoresis grade agarose (Biorad) was mixed in 1X TAE buffer (Tris acetic acid -EDTA). The mix was boiled for 1 min 30 sec in a microwave. The solution was allowed to cool at room temperature. 5 L of ethidium bromide (10,000X) was added to the solution and mi xed well. The mix was poured onto the gel casting apparatus and it was allowed it to solidify. The gel was placed in an electrophoresis tank with 1X TAE buffer. After loading the samples, the gel was run at 100 V. Polymerase Chain R eaction All reactions were performed using a standard procedure with variation in annealing temperature. 95C denaturing temperature 5 min, followed by 30 cycles of 94C denaturing temperature for 30 sec, 55 -58C of annealing temperature for 30 sec and 72C extension temperature for 30 sec. The reaction ended with final extension temperature of 72C for 7 min.

PAGE 28

28 Taq polymerase (Eppendorf ) was used for all the PCR reactions. Restriction D igestion Approximately 0.5-1 g of DNA was used for digestion in a 20 L reaction. For each 20 L reaction 2 of 10X buffer (New England Biolabs NEB of restriction enzyme (N EB) and sterile dH2O to make up the volume to 20 was used in the reaction The reaction was incubated for 3 hours at 37C. 0.2 100X BSA was used for certain enzym e digestions recommended by NEB catalog. For double digestions, compatible buffer was used based on NEB catalog recommendations. DNA Ligation Approximately 100 ng of digested DNA was used for a 20 L ligation reaction. For each 20 L reaction, 2 L of T4 DNA ligase buffer, 10X (Invitrogen) and 1 of ligase enzyme and sterile dH2O to make up the volume to 20 was used in the reaction. The reaction was incubated at 16C overnight. Transformation of C ompetent E. coli C ells O T1 chemically competent cells (Invitrogen, CA ) were used for the transformation of bacteria. The competent cells were stored at -80C. The cells were thawed on ice (50 L total). 1-50 ng DNA was added to the tube containing cells, gently swirled and incubated on ice f or 30 min. The cells were treated with heat shock by placing the tube in water bath at 42C for 1 min. The cells were then immediately placed on ice for 2 min. 250-450 L S.O.C. medium (Invitrogen, CA) was added to the tube and incubated at 37C for 1 hour on a shaker at 225-250 rpm. Finally, 20 L and 100 L of tube mix were plated on separate LB agar plates containing ampicillin. The plates were incubated overnight at 37C. The plates were stored at 4C in plastic wrap to prevent dehydration.

PAGE 29

29 Protein Expression, Purification and Analys is Protein Expression in Bacteria A s ingle isolated clone was obtained and grown in 20 mL LB broth with 20 L of 0.1% kanamycin (100 g/ mL ) (Sigma). The culture was allowed to grow overnight on a shaker at 220 rpm a nd 37C. The entire culture was transfer red to a large flask containing 500 mL of LB broth. After growth at 37C to an optical density (OD600) of 0.8, culture was incubated at room temperature for another 18 h ours in the presence of 0.5 mmol/L (final concentration) isopropylD-1-thiogalactopyranoside ( Fisher Scientific Stock: IPTG 1 g/ 4.2 mL ddH2O). The bacteria culture was pelleted by centrifugation at 6000 rpm for 30 min. The supernatant wa s discarded and pellet was stored at -80C. Protein Purification The purification protocol was optimize d for 3 L bacterial culture. T he bacterial pellet was stored at -80C. After thawing at room temperature 50 mL of 5 mM imidazole (Sigma) buffer with 1 tablet of protease inhibitor cocktail (Roche, CA ) a nd 0.2 g lysozyme ( Sigma) was added The lysozyme was first dissolved in water before the i midazole was added. This allow ed the lysozyme to dissolve completely. 500 mL of Buffer A ( 10 mL of 1 M Tri/HCL pH.8, 50 mL of 5 M NaCl, 0.5 mL of Triton X-114, 800 L of 3 M Imidazole added ddH2O to bring the volume to 500 mL ) solution was prepared and stored at 4C. 100 mL of Buffer A was added to the bacterial pellet and left on ice for 30 min, this was followed by vigorous vortexing for 30 min. At this point the highly viscous sticky mix was formed. Later, the mix was transfer red to two centrifuge tubes and the solution was sonicated for 15 sec X 4 times each on ice. After sonication, the solution became less sticky. The tubes were balanced and centrifuged at 12000 rpm for 30 min 4C. The supernatant was saved. (If the supernatant wasn't clear the centrifugation step was repeated ). While centrifugation, NiNTA agarose bead (Invitrogen) was

PAGE 30

30 w ashed with ddH2O first and then equilibrated with 5 mM imida zole solution. The clear supernatant obtained by centrifugat ion in the earlier step was mixed with ready to use NiNTA before leaving it on the spinner at 4 C for 30 min. The column with NI-NTA and supernatant mix was placed on the stand and allowed to drip down. 150 mL of 40 mM imidazole washing solution (1.74 mL of 3 M imidazole into 150 mL of buffer A) was added to the column for washing unwanted proteins. This was followed by another wash step with 150 mL of 40 mM imidazole solution (1.74 mL of 3 M imida zole into 150 mL of 5 mM i midazole buffer). This step was incorporated to get rid of the triton X-114 used in an earlier step. At the last wash, the protein content was checked by mixing 25 L sample with 500 L Bradford solution ( Bio Rad Protein Assay (5X) 10 mL + 40 mL ddH2O). If the color was brown, the washin g step was discontinued. The target His tagged protein was eluted by adding 60 mL of 300 mM i midazole elution buffer (Elution buffer: 3 mL of 3 M imidazole + 27 mL of 5 mM imidazole. The samples were collected in eppendorf tubes and checked t he target pro tein by mixing 25 L sample with 500 L Bradford solution. In order to check the purity, SDS (Sodium Dodecylsulphate) gel was run with 25 L sample + 25 L 2X sample buffer ( Bio Rad Laemmli Sample Buffer). Each lane was loaded with 30 L and the gel was ru n at 80 V until the dye front migrated through the gel. The gel was later separated from the cast and washed with water on a shaker for 1 hour. The gel was finally stained with Coomassie blue ( Bio Rad Bio safe Coomassie). Dialysis of the Purifi ed Protein In order to eliminate the imidazole from the purified protein, the elute was dialyzed against the PBS. First the di alysis tubing was boiled at 95 C in ddH2O for 5 min to make it flexible 2 L of PBS was prepared using ddH2O and chilled by plac ing it in the refrigerator. The s ample was placed into the dialysis tubing and dialyzed against 1 L of 1X PBS while stirring overnight. The

PAGE 31

31 next morning, PBS was changed and d ialyzed for 3-4 hours. Finally the protein concentration was m easured and stored at -80C by adding 10% (v/v) of glycerol Sodium Dodecylsulphate Poly a crylamide Gel E lectrophoresis (SDS PAGE) The SDS-PAGE was performed using a mini gel electrophoresis apparatus (Bio Rad). The precast polyacrylamide gels (Bio -Rad) were used to run the samples. The samples were diluted in 2X sample loading buffer (Laemmli loading dye, Bio Rad). Composition: 62.5 mM TrisHCl, pH6.8, 2% SDS, 25% Glycerol, 0.01% Bromophenol Blue. 50 L mercaptothanol was added to 950 L of 2X sample loding buffer. The gel was run using 1x TGS buffer, 25 mM Tris, 192 mM Glycine, 0.1 % SDS, pH 8.3, (Bio -Rad). Equal volumes of the sample and 2x sample loading buffer were mixed and boiled at 95C for 5 min. The electrodes of the apparatus were connected to the power pack (Bio -Rad) and run at 80 V for 1 -2 hours. Western B lotting Transfer buffer with 15% methanol (100 mL 1x TGS buffer, 150 mL methanol, and 750 mL ddH2O was used to transfer the proteins onto the nitrocellulose membrane. A t ransfer sandwich was prepa red by encasing the gel and nitrocellulose membrane between the filter paper and sponge (sponge filter paper gel PVDF membrane filter paper sponge). Then the transfer sandwich was placed in the electrophoresis tank. The apparatus was run at 80 volts for 1.5 hours. The membrane was washed in 1x TBST by combining 100 mL 10x TBS, 1 mL Tween 20, and 899 mL ddH2O. The membrane was then blocked with blocking buffer using TBST with 5% nonfat dry milk (50 mL TBST + 2.5g dry milk) for 1 hour at room tem perature or at 4C overnight with gentle rotation. The p rimary antibody was diluted (as per companys recommendation) in 10 mL of blocking buffer with 1% non-fat dry milk and incubated at room temperature for 1 hour or at 4C overnight with gentle rotatio n. The membrane was washed with approximately 30 mL 1x TBST buffer for 15 min followed by 2

PAGE 32

32 washes for 10 min each. The membrane was then incubated with the secondary antibody with HRP conjugation (diluted as per companys recommendation) in blocking buffer with 1% nonfat dry milk and incubated at room temperature for 0.5-1 hour with gentle rotation. The membrane was finally washed with 30 mL 1x TBST buffer for 15 min, followed by 2 washes for 10 min each. The membrane was dried by blotting the corner on a paper towel for 5 seconds. One mL each of western blotting detection ECL reagents 1 and 2 ( Amersham Biosciences) was mixed. The membrane was placed on parafilm or polyvinyl wrap and covered evenly with western blotting reagent mixture and incubated at room temperature for 1 -2 min. The xray film was developed in the dark room by exposing it for appropriate amount of time depending on the signal. Mam malian Cell C ulture Protocols Cell Culture The INS -1 cells were grown in RPMI 1640 ( Sigma ) (430 mL ) with 10% fetal bovine serum supplemented with 5 mL of HEPES (1M), 5 mL of L -glutamine (200mM), 5 mL of Sodium pyruvate (100 mM), 5 mL of Pen/Strep, 454 L of 2 -Mercaptoethanol (1000x) and 2 mL Kanamycin (Stock: 50 mg/ mL ) per bottle of media. 3T3 cells were grown in Dulbecco's Modified Eagle Medium ( Sigma ) 500 mL bottle supplemented with 10% FBS (55 mL ) and 2 mL Kanamycin (50 mg/mL ). Transfection of P lasmid in Mammalian C ells Approximately 2 of serum free medium ( Gibco ) in a microfuge t ube for each well. In a separate tube 4 (Invitrogen ) was added to 100 of serum free medium for each well. The tubes were vortexed and incubated for 5 min at room temperature. The lipofectamine and plasmid preparations were mixed tog ether, vortexed, and incubated for 20 min at room temperature. The cell medium was changed immediately

PAGE 33

33 before adding transfection medium. One preparation transfection medium (200 ) was added directly to the normal medium (1 mL ) for each well and i ncubated for 4 -6 hours at 37C. The transfection medium wa s aspirate d and 1 mL of normal medium was added to each well. The cells were incubated for 24 hours hours at 37C. RNA Isolation from Cells/T issue The cells or tissue were homogenized and mixed with triz ol reagent (Invitrogen, CA). For 1 mL of trizol mix, 0.2 mL of chloroform ( Fisher S cientific ) was added and mixed vigorously and allowed to incubate at room temperature for 15 min. The mix was then centrifuged at 12,000 rpm for 15 min at 4C. The supernata nt aqueous phase was transferred to a clean tube and RNA was precipitated by adding 0.5 mL of isoproponal ( Sigma ) and mixing well. The solution was allowed to incubate for 10 min at room temperature. This was followed by centrifugation at 12,000 rpm for 8 min at 4C. The supernatant was discarded and the pellet was washed with 1 mL of 75% ethanol and centrifuged at 7,500 rpm for 15 min. The supernatant was discarded and the pellet was allowed to dry for 10 min under the fume hood. The pellet was resuspended in 50 of RNAse free DEPC water ( Invitrogen), the concentration was measured and stored at 80C. cDNA S ynthesis Total of 2 was used to synthesize the cDNA. Random hexamers (Invitrogen ) was used and the volume was brought up to 11 L with RNAse free DEPC water. The mix was incubated at 70C for 5 min followed by 5 min on ice. A cocktail mix was prepared with 5xfirst strand buffer (4 l/sample) DTT (2 l/sample) dNTP (2 L/sample) and 1 unit of superscript II reverse transcriptase (Invitrogen) 9 l of mix per sample was added to the RNA mix previously incubated on ice. The f inal mix was placed in PCR machine and run at 25C for

PAGE 34

34 10 min followed by 42C for 50 min. The enzyme was finally inactivated by heating at 65C for 10 min. Measurement of Luciferase Activity Dual Luciferase Reporter Assay System ( Promega) was used for the assay. Luciferase assays were performed, using a luminometer tube for each sample and 100 L of the Luciferase Assay Reagent was loaded into each tube. The l uminometer was programmed with a 2 second measurement delay followed by a 10 second measurement read for luciferase activity. Next, 20 L of cell lysate was added to the luminometer tube containing the Luciferase Assay Reagent and it was mixed by pipetting three times. The tube was placed in the luminometer and the reading was initiated and designated as M1 Next the tube was reloaded with 100 L of Stop and Glo buffer and placed in the luminometer and the reading was initiated and designated as M2. The r atio of M1/M2 determined the ratio of luciferase activity (promoter) vs renilla activity (internal control). Extraction and Measurement of Insulin Serum Sample Collection for Measurement of Insulin by ELISA The mice were starved for 6 hours before blood collection. The mice were weighed and 2 mg/g body weight glucose was injected intraperitoneally. After 15 min of delivering the glucose bolus, blood was collected from the retro-orbital sinus using a pasture pipette. The blood was stored on ice for 30 min. The serum was extracted by centrifuging at 10,000 rpm for 10 min. The supernatant was collected and stored at -80C. Tissue Sample Collection for Measurement of Insulin by ELISA All the organs with major focus on the pancreas and liver were collected and weighed. The organs were collected in ice cold Acid -ethanol solution (180 mM HCL in 70% ethanol (500 mL ) 350 mL ethanol + 7.76 mL HCL + 142.24 mL H2O). The mechanical tissue homogenizer

PAGE 35

35 was used to mince the tissue into tiny particles. The suspension was allowed to rotate on a mechanical rotor overnight for the release of tissue extract into the solution. The suspension was centri fuged at 6000 rpm for 15 min. The supernatant was collected and stored at -80C. ELISA for M easurement of Insulin ELISA was perfo rmed to measure the insulin levels using Mouse ultra se nsitive enzyme immunoassay (Alpco Diagnostics) according to the manufacturer's protocol. The protocol was modified slightly to suit our experimental objectives. 5 of tissue extracts were used for the assay. H ighconcentration samples such as pancreas extract were diluted 50~500 times with Calibrator '0'. 25 L of Calibrator 0 was added to each well of the coated plate, then 5 L of Calibrator s 3-7 or unknown samples were added to e ach well (duplicate for each c alibrator or sample). Then 50 L of enzyme conjugate solution was added to each well. T he plate was sealed with plastic film and incubated on shaker at 800 rpm for 2 hours. M icroplate washer was used to wash the plate 6 times using an inbuilt program. After washing, 200 l of substrate solution was added to each well and incubated for 30 min. The plate was covered with aluminum foil to a void light. The reaction was stopped using 50 l stop solution. The plate was then read on m icroplate reader (Bio -rad) at 450 nm wavelength. The standard curve and unknown samples concentrations were analyzed using software (Microplate manager) Procedures for Imaging Haematoxylin and Eosin (H &E) Staining For the H & E staining, the following steps were followed 3 x 5 min Xylene 2 x 2 min 100% ethanol 1 x 2 min 95% ethanol 1 x 2 min deionized H2O Hematoxalin staining 1 x 2.25 min Hematoxali n ( Vector Laboratories CA), 1 x 15 s ec deionized water 1 x 1 min deionized water 1 x 1 min Blueing 1 x 1 min Deioni zed water 1x 1.5 min Eosin ( Fisher S cientific ) 95%

PAGE 36

36 ethanol 2 dips 1 x 30s 95% ethanol 1 x 1 min 100% ethanol, 3 x 1 min Xylene. Finally the slides were covered with c overslip slides using permount medium ( Fisher Scientific). Immunofluroscence The p araffin sections were first de-paraffinized and rehydrated using the following steps. ( Xylene: 5 min, Xylene: 5 min, 100% alcohol: 3 min, 100% alcohol: 3 min, 95% alcohol: 3 min, 70% alcohol: 15 dips. These steps were followed by rinsing for 5 min in tap w ater. For staining for nuclear antigens, the slides were incubated in 95C Preheated Trilogy (fresh) solution for 30 min. Later the slides were washed with distilled water for 5 min. Chilled 0.5% Triton-X100 (triton -X100 250 L+50 mL TBS-0.5% Triton) in TB S was added on the slides and incubated for 5 min and rinsed for 5 minutes in tap water, followed by wash step with TBS for 5 minutes. This was followed by Block step for 20 min with serum (15 serum in 1 mL TBS) Serum must be from the same species as the one in secondary antibody. This was followed by incubation with primary antibody (diluted appropriately accor ding to manufacturer's recommen dations) for 1 hour at room temperature or 4 C ov ernight. This was followed by wash step with TBS for 5 min. Next, the tissue sections were incubated with s econdary antibody (diluted appropriately according to manufacturer's recommendations) for 45 min. A final wash with TBS was continued for 5 min. The slides were mounted with Vectashield with Dapi ( Vector Laboratories, Burlingame, CA) and the coverslips were applied. General Animal Procedures Animal Housing Balb/ c mice were bred in pathology mouse colony, University of Florida), and housed in SPF condi tions. NOD female mice, 8 weeks old age were ordered from Jackson labs (Bar Harbor, ME, USA) and housed in SPF conditions in pathology mouse colony. All procedures were carried out as described in approved Institutional Animal Care & Use Committee (IACUC) protocols.

PAGE 37

37 Collection of Blood Blood was collected from the mice through retro orbital bleeding. The mice were anesthetized using isoflu rane. The mice was held with the left hand and a glass capillary tube was placed on the medial aspect of the right eye and gent ly rolled until the blood started flowing through the tube. A maximum of 100 L blood was collected for mice under experimentation, while a maximum of 400 L was collected from mice designated for terminal bleeding. Tissue Sample Collection for Histology The mice were sacrificed according to the University of Florida, IACUC guidelines. The mice were sprayed with 70% ethanol. A mid-ventral incision was made using scissors, followed by collection of organ samples such as pancreas, liver, small intes tine, kidneys, spleen, heart, lung, and brain. The organ samples were preserved in 10% formalin for 24 hours and later transferred to PBS. The organs were cut into small pieces and placed in cassettes for paraffin embedding at the pathology core facility. The paraffin blocks were cut into 5 m sections. Measurement of Blood Glucose The mice were either fasted or non fasted before measuring the blood glucose. Before measuring IPGTT, the mice were fasted for 6 hours. For measurement of fasting blood glucose l evels, the BALB/C mice were fasted for 8 10 hours. The mice were pricked with a 22 guage needle on the tip of the tail. A drop of blood was squeezed from the tip of the tail The gluc ometer ( Accu Che k ) was used to measure the blood glucose. The glucose str ip was inserted into the glucometer and a drop of blood was collected in a slot on the strip. The glucometer displayed readings with units of mg/dL. Tissue Sample Collection for RNA Isolation The mice were sacrificed according to the University of Florida, IACUC guidelines. For the large organs such as liver, the tissue samples were cut into small pieces. Several pieces were

PAGE 38

38 collected from various liver lobes. For smaller organs such as kidney, spleen, the organs were cut into 23 pieces. The tissue samples were wrapped in aluminum foil and snap frozen by dropping them in liquid nitrogen. T he samples were later stored at -80C. Anesthesia The mice were given general anesthesia using isoflurane placed under isoflurane assembly unit with nose cone apparatus as per IACUC guidelines. Pancreatectomy The mice were anaesthetized using an isoflurane assembly unit with nose cone apparatus. Toe pinch method was used to verify if the mice was under anesthetic condition. The anesthesia was maintained until the end of procedure. The anes thetized mouse was laid on its right lateral side. The abdominal area of the left lateral side was wiped with 70% ethanol. An incision was made on left lateral abdominal area where pancreas is located. Following incision, the peritoneal ca vity was exposed, pancreas was located and pulled out using forceps The head of the pancreas is attached to the duodenum and the tail is attached to the spleen. A nylon suture material was used to tie a knot on the blood vessel running between spleen and tail of pancreas. Another knot wa s tied at the head of the pancreas. Knot wa s tied deep in order to gain access to as much pancreas as possible. The tail of the pancreas wa s then cut. The knot tied at the head of the pancreas is pulled gently in order to gain access closer to the head. Another deep knot wa s tied closer to the head of the pancreas. A cut was made between two knots that are tied close to the head of pancreas. A major chunk of pancreas was isolated The mouse incision was closed using staples. The mouse was monitored until it recovered its consciousness. The staples were removed after 7 days. Splenectomy The mice were anaesthetized using an isoflurane assembly unit with nose cone apparatus. Toe pinch method was used to verify if the mice was under anesthetic condition. The anesthetized mouse

PAGE 39

39 was laid on their right lateral side. An incision was made on left lateral abdominal area where spleen is located. Following incision, the peritoneal cavity was exposed spleen was located and pulled out using forceps. A knot was tied at both the ends of the spleen in order to prevent internal bleeding. The spleen was slowly separated by cutting at both the ends of spleen and the mesenteric connections. The associated organs such as pancreas are pushed back gently into the abdominal cavity. The mouse incision was closed using staples. The mouse was monitored until it recovered its consciousness. The staples were removed after 7 days.

PAGE 40

40 CHAPTER 3 REVERSAL OF STREPTOZOTOCIN INDUCED DIABETES IN MICE BY CELLULAR TRANSDUCTION WITH RE COMBINANT PANCREATIC TRANSCRIPTION FACTOR PANCREATIC DUODENAL HOMEOBOX-1 Introduction Type 1 diabetes is a metabolic disorder resulting from the autoimmune destruction of pancreatic betacells. An intense research effort has been directed at identifying a means for restoring beta cell mass as well as glucose-regulated insulin production through islet cell transplantation (90).Though progress has been made, the scarcity of donor islets and the potential need for lifelong immunosuppression will, in theory, greatly limit its potentia l for widespread application (91). Many alternate strategies have been pursued including vector-mediated delivery of panc reatic transcription factors that allow for conversion of adult cells into insulin-producing cells (IPCs) and for use of cocktails of betacell growth factors to promote differentiation of embryonic stem cells into tissues capable of producing insulin (92). In vivo regeneration of residual islet beta cells (90) has been noted to occur with a variety of betacell growth factors including glucagonlike peptide -1 (93;94), exendin-4 (95;96), and the islet neogenesis associated protein (INGAP)(97) These outcomes appear linked to an increased biosynthesis of the pancreatic duodenal homeobox1 (Pdx1) transcriptio n factor (45;93;94;96;98). Pdx1 is widely regarded as a master transcriptional regulator of the pancreas and is critical for development (35;99;100), regeneration (37;45) and ma intenance of betacell function (37). Liver stem cells (101) and adult hepatocytes (84;86) reportedly have been reprogrammed by ectopic overexpression of Pdx 1 into insulinproducing cells ( IPCs ) tha t are also capable of restoring euglycemia in diabetic mice. However, the strategies involving the use of viruses as a means for gene delivery in these studies raise safety concerns. An alternative delivery strategy has recently been identified wherein short, highly basic peptide sequences called protein

PAGE 41

41 transduction domains (PTD) act as molecular passports for facile penetration of cellular membranes by proteins (49). Indeed, studies seeking to understand the cell internalization of antennapedia-like homeodomain peptides, a form of PTD, support the view that transcription factors can be transferred from cell to cell, possibly with direct paracrine activity (47;102). The likely mechanism of cell entry by PTDcontaining proteins relies on strong electrostatic interactions of the cationic PTD with phospholipid elements residing in the plasma membrane, followed by macropinocytosis and eventual release into the cytoplasm (49;103). Once internalized, the protein is then free to exert its bi ological activity on susceptible targets. Given its key role in pancreatic development, islet betacell regeneration, and liver to -endocrine pancreas transdifferentiation, Pdx1 represents an ideal candidate for protein therapy, especially since its antenna pedialike domain is a PTD, mediating its rapid entry into cells (63;65;66). Previous in vitro studies involving pancreatic duct and islet cells (63) as well as embryonic stem cells (104) have demonstrated that Pdx1 protein cell entry induces insulin gene expression and positive autoregulation of Pdx1 gene expression (63;104). Therefore, the ability of Pdx1 to stimulate insulin gene transcription in vivo renders it a highly attractive approach as a potential treatment for diabetes. This study investigated the therapeutic effects of rPdx1 in the Stz -induced diabetic mouse model. Materials and Methods Construction and Production of rPdx1, PTD Green F luor escent Protein, and Mutant Pdx1 Fusion Proteins To express recombinant rat Pdx1His6 (hereafter designated rPdx1), full-length rat Pdx 1 cDNA wa s amplified by PCR and subcloned using NdeI and XhoI sites in pET28b (Novagen, Madison, WI). To express PTDgreen fluorescent protein (PTDGFP) His6 (hereafter designated PTD GFP), the PTD GFP plasmid containing the coding sequence for the 11residue

PAGE 42

42 (YGRKKRRQRRR) PTD of HIV-1 TAT positioned at the NH2 -terminus of green fluorescent protein was constructed by PCR and cloned into a pT7/CT-TOPO expression plasmid (Invitrogen, Carlsbad, CA). To prepare the 16 residue PTD -deletion mutant of rPdx1His6 (rPdx1mut ), a mutant rat Pdx 1 expression plasmid missing PTD residues 188 (RHIKIWFQNRRMKWKK) within the rPdx1 homeodomain was constructed using PCR amplification with appropriate primers containing sequences before and after the PTD of Pdx 1 cDNA. The two PCR pr oducts were subsequently ligated to generate the PTD deletion mutant. After confirmation of the cDNA sequence, the resulting mutant Pdx 1 cDNA subcloned into the Nde I and Xho I sites of pET28b (Novagen). After growth at 37C to an optical density (OD600) of 0.8, plasmid -containing BL21 (DE3) cells were incubated at room temperature for another 18 hours in the presence of 0.5 mmol/l (final concentration) isopropyl-D-1-thiogalactopyranoside. Bacteria were lysed by pulse sonication in buffer A (20 mmol/l Tris/HCI pH 8.0, 500 mmol/l NaCl, and 0.1% Triton X-100) containing 5 mmol/l imidazole and proteinase inhibitors (Roche Diagnostics, Basel, Switzerland). After centrifugation, the cell free supernatant was applied to a column of Ninitrilotriacetate agarose (Invi trogen) and washed with several volumes of buffer A containing 25 mmol/l imidazole. The protein was eluted by buffer A containing 250 mmol/l imidazole. The purity of the eluted rPdx1, PTD-GFP, and rPdx1-mut fusion proteins were characterized by SDS PAGE/Co omassie Blue staining following dialysis against PBS. Cell Entry and I mmunoblotting Rat liver epithelial stem cells (WB cells) (105;106) at 70% confluence were treated with purified rPdx1 or rPdx1mut at a 1 m concentration for various time points, and the cells were washed three times with P BS, harvested in lysis buffer (150 mmol/l NaCl, 50 mmol/l Tris HCl, pH 7.5, 500 mol/ l EDTA, 1.0% Triton X-100, and 1% sodium deoxycholate) containing a protease inhibitor cocktail (Roche Diagnostics). For Western blotting (27,31), antibodies against

PAGE 43

43 rPdx1 (rabbit serum, 1:1,000 dilution), his-tag (1:2000; Invitrogen), or actin (1:2000; DAKO, Carpinteria, CA) were used to detect rPdx1, rPdx1-mut, actin, or PTD-GFP fusion protein in cell rPdx1 Functional Analyses Using NeuroDLuciferase Reporter Construct 3T3 cells were co transfected with NeuroD -l uciferase reporter construct (1g) and Tk renilla reporter construct (0.5 g ), followed by either transfection with Pdx1 cDNA ( 0.5 g) or transduction with rPDx1 protein (10 m). 50 Choloroquine, lysosomotropic agent was added to the all the wells for the release of protein from the lysosomes. The luminescence was measured using luminometer after 24 hours incubation. Animal Studies BALB/c mice (8 weeks-old, University of Florida, pathology mouse colony) were injected with 50 mg/kg body wt streptozotocin (Sigma-Aldrich, St. Louis, MO) for 5 consecutive days to induce diabetes (27,31). Animals with fasting blood glucose levels for two consecutive readings of above 250300 mg/dL received protein treatment. The diabetic mice were intraperitoneally injected with either rPdx1 or PTD -GFP protein (0.1 mg /day/ mouse) for 10 consecutive days. Fasting blood glucose levels were measured regularly using a glucometer after the mice were fasted for 6 hours The sequential experimental events of the animal studies are summarized in Fig. 3-6. Low Dose Streptozotocin -I nduced Diabetes 1.47 grams of sodium citrate (Fisher S cientific) was dissolved in 50 mL of distilled water. The pH was adjusted to 4.5 and stored at room temperature. Appropria te amount of streptozotocin (STZ ), depending on the number of animals, was weighed and dissolved in right amount of sodium citrate solution so that final concentration is 7.5 mg/ mL

PAGE 44

44 Appropriate amount of STZ Na citrate was intra -peritoneally injected so that the final concentration is 50 mg/kg.bdwt of mouse. The m ice were injected daily with STZ and blood glucose was measured before the injection. The dosage was continued until the blood glucose levels reach more than 250 mg/dL. The maximum number of doses was limited to five. Once the hyperglycemia was confirmed, the treatment with rPdx1 was begun immediately. Intrape ritoneal Glucose Tolerance Test The normal, rPdx1, or PTDGFP treated mice ( n > 4 for each group) were fasted for 6 hours following intraperitoneal injection with glucose (1 mg/g body weight), and blood glucose levels were measured at 5, 15, 30, 60, and 120 min postinjection. Subtotal pancreatectomy (~8090%) ( n >4) was performed at day 30 posttreatment under general anesthesia. The mice were killed at two time points (days 14 or 40 post-treatment), and organs and blood were collected for evaluation of histology, gene expression, serum, and tissue insulin levels. Pdx1 P rotein in vivo Kinetics a nd Tissue Distribution Mice were injected intraperitoneally with rPdx1 (0.1 or 1 mg). Blood samples were drawn at 0.25, 0.5, 1, 2, 6, and 24 hours. Tissues from normal and rPdx1treated mice were harvested at 1 or 24 hours, fixed in 10% formalin, and embedded in paraffin for Pdx1 immunohistochemistry using rabbit anti -Pdx1 antibody (1:3,000; a gift of Dr. Christopher V. Wright, Vanderbilt Univ ersity). RTPCR Total RNA was prepared from mouse tissues of the pancreas and liver using TRIZOL reagent and cDNA synthesized using Superscript II reverse transcriptase (Invitrogen) with random hexamer primers. Liver gene expression was determined by RT -PCR as previously described (31). The forward and reverse PCR primers were designed to be intron spanning, and their sequences and conditions are listed in Table 3 -1. To eliminate false positives, no reverse

PAGE 45

45 transcriptase, positive, or blank controls were included. All data represent at least three measurements from at least four mice. Quantitative Real Time RTPCR Anal ysis cDNA from pancreatic and liver tissues was subjected to three independent PCR reactions. Each reaction was performed in duplicate or triplicate in a Thermocycler Sequence detection system (DNA engine opticon 2; MJ Research, Springfield, MO) using SYBR green (Qiagen, Valencia, CA). Total pancreatic and liver RNA was used as templates for preparing cDNA. Tissues were snap -frozen in liquid nitrogen and RNA was extracted in RNase free tubes using Trizol reagent ( Invitrogen). The integrity and stability of the RNAs from both pancreas and liver were confirmed by demonstrating the intact 28s and 18s bands on gel electrophoresis. cDNA was synthesized from 5 g total RNA using Superscript reverse transcriptase enzyme (Invitrogen) with random hexamer primers according to the manufacturers protocol. Amplication of the correct product was confirmed by gel electrophoresis. Conditions for realtime PCR were as follows: after initial denaturation at 95C for 15 min to activate the enzyme, 38 cycles of PCR (denaturation 0.5 min at 94C, annealing 0.5 min at 61C [for liver] or 56C [for pancreas], and elongation 0.5 min at 72C with a final extension 5 min at 72C) were carried out. Each gene was tested three times (3 mice/group). Relative gene expression in mouse pancreas treated by rPdx-1 and PTD-GFP on day 14 was calculated by 2Ct method. We used actin as internal control and PTD GFP treated day 14 pancreas cDNA as calibrator. First, both threshold cycle (CT) values of target gene from rPdx1treated day 14 pancreas cDNA ( n =3) and PTDGFP treated day 14 pancreas cDNA ( n =4) were normalized by CT value of the rPdx1/GFP (CT,Target CT,Actin)rPdx1 (CT,Target CT, Actin)GFP rPdx1treated day -14 liver cDNA ( n =3) and rP DX1 treated day -40 liver cDNA ( n

PAGE 46

46 14/day 40 (CT, Target CT,Actin) day 14 (CT,Target CT, Actin fold change of gene expression, was plotted into the figure. The primers were designed in accordance to the real time PCR conditions, and the sequences are listed in Table 3 2. Immunohistoc hemistry and Immunofluorescence Paraffin blocks containing the pancreas and liver were obtained from at least 5 mice/group. Antigen retrieval from paraffin sections was done in trilogy solution (Cell Marque, Rocklin, CA) at 95C for 30 min for unmasking nuclear antigens such as Pdx1 and Ki-67. Paraffin sections (5 m) were incubated with anti -swine insulin (1:1,000), rabbit anti-Pdx1 (1:5,000), rabbit an ti-human Ki67 (1:100; Novus Biologicals, Littleton, CO), and goat antiglucagon (1:200) antibodies, followed by incubation with anti-mouse or rabbit IgG (1 :5,000) conjugated with HRP and detection with DAB substrate kit (Vector Laboratories, Burlingame, CA) as previously described (31). For double immunofluorescence, tissue sections were incubated with anti swine insulin (1:200; Dako, CA) and goat anti -glucagon (1:150; Santa Cruz Biotechnology, Santa Cruz, CA) primary antibody overnight at 4C, followed by donkey anti guinea pig IgG conjugated with fluorescein isothiocyanate (1:1,000; RDI Research Diagnostics, Concord, MA) and donkey anti-goat IgG with Alexa flour 594 flourochrome (1:500; Invitrogen). For Ki67/insulin sequential immunostaining, the paraffin sections from pancreas were first immunostained for Ki67 nuclear antigen and developed in brown color using the HRP/DAB system. After being counterstained with hematoxylin to highlight cell nuclei (blue), the slides were immunostained for insulin using guinea pig antiporcine insulin (cross react w ith mouse insulin) antibody (Dako) at a dilution of 1:200 for 16 min. Presence of insulin in pancreatic islet beta cells was visualized in red color with the Ventana Ultra View red detection kit (Ventana Medical S ystem, Tucson, AR).

PAGE 47

47 Tissue and Serum Insulin Measurements by E n zyme Linked Immunosorbent Assay Whole pancreas and liver organs were obtained from at least five mice/group. They were harvested, weighed, and immediately placed in acidethanol solution (180 m mol/l HCl in 70% ethanol) on ice with a corresponding tissue volume (1 mL buffer/0.1 g liver or 0.05 g pancreas) in accordance with a previously published procedure, with minor modifications (32). Tissue insulin levels were measured using an ultrasensitive mouse insulin enzyme linked immunosorbent assay (ELISA) kit (ALPCO, Diagnostics, Salem NH). Absorbance was measured using a BIO RAD 3550 UV microplate reader, with final results converted to nanograms insulin/milligrams pancreas tissue or nanograms insuli n/grams liver. For measurement of serum insulin, both normal and treated mice were first fasted for 6 h our s, and blood samples were collected at 15 -min intervals following intraperitoneal glucose (1 mg/g body wt) stimulation. Serum insulin levels were dete rmined by ELISA. Statistical Analysis Statistical significance was analyzed using an independent sample t test, requiring a P value <0.05 for the data to be considered statistically significant. Results Generation of Recombinant Fusion Proteins The expression plasmids containing rat Pdx 1, rat Pdx 1-mut, or PTD GFP cDNA were constructed, each containing an additional nucleotide sequence coding for a His6 tag for rapid purification using Ni2+-nitrilotriacetate columns. To obtain nearly homogeneous proteins in sufficient amounts for the in vitro and in vivo animal studies, bacterial expression conditions were optimised to yield 10 mg highly pure rPdx1 per liter of growth medium. Figure 3-1A shows the structural organization of rPdx1 ( a), PTD GFP ( b), and r Pdx 1mut ( c ) and a Coomassie blue stained SDS gel for rPdx1, PTD-GFP, and rPdx1-mut fusion proteins. These proteins consistently

PAGE 48

48 had purity >90%, based on densitometry. The rPdx1, rPdx1-mut, and PTDGFP proteins was confirmed by Western blotting with antiPdx1 or anti histidine tag antibody. Characterization of Recombinant Fusion Proteins To confirm that rPdx1 protein possessed the ability to penetrate cells due to antennapedialike PTD within the homeodomain of Pdx1, WB cells were incubated with rPdx1 or rPdx1mut protein (1 mol/l) for specified times, after which the cells were washed three times with PBS. Cell lysates were separated by SDS-PAGE and blotted with anti-Pdx1 and antiactin antibodies. The relative amount of rPdx1 in the cell b lots was quantified by densitometry and normalized relative to actin. As shown in Fig. 3-2a, rPdx1 protein entry commenced within 5 min. As rPdx1 incorporation proceeded, cellular rPdx1 protein level reached peak values at 1 hours and began to fall by 6 hours. In contrast, rPdx1mut with deletion of the 16aa antennapedialike PTD failed to enter the cells, even though the cell culture medium still contained high levels of rPdx1mut protein (Fig. 3 -2b). Since this assay cannot distinguish genuine rPdx1 pr otein entry versus nonspecific binding to cell membrane surface, it was determined whether internalized rPdx1 protein was biologically active. To test the transcriptional function of the rPdx1 protein, 3T3 cells were transfected with pNeuroD luciferase rep orter plasmid with or without rPdx1. NeuroD is direct downstream target gene of Pdx1 protein. The cells were incubated in the presence or absence of rPdx1 (10 m). 3T3 cells co transfection with CMV -Pdx1 plasmid for 24hours served as a positive control. A comparable transcription efficacy for CMV Pdx1 treated cells and rPdx1 protein treated cells after 24 hrs was observed (Fig. 3-3) Both treatments showed statistically significant differences when compared with control cells containing pNeuroDluciferase plasmid alone. These results clearly demonstrated that rPdx1 rapidly entered cells and efficiently activated its downstream Neuro -D target gene.

PAGE 49

49 In vivo Kinetics and Tissue D istribution While the antennapedialike PTD allows in vitro administered rPdx1 to enter into the cells, the in vivo tissue distribution and kinetics of rPdx1 were unknown. To examine rPdx1 distribution and kinetics, BALB/c mice were intraperitoneally injected with 0.1 or 1 mg rPdx1 protein, blood samples were collected at various times, and rPdx1 was detected in sera by antiPdx1 immunoblotting. The rPdx1 became evident in sera as early as 1 h our postinjection, reaching peak values at 2 h and then markedly falling by 6 hours No rPdx1 protein was detectable in the 24 -hour serum samples (Fig. 3-4 ). Major organs were harvested at 1 or 24 h our after intraperitoneal injection and probed with anti-Pdx1 antibody. As shown in the representative images of liver, pancreas, and kidney tissues (Fig. 3-5), the rPdx1 was concentrated mainly in the nuclei of hepatocytes, and the greatest intensity of Pdx1positive cells was found nearest the hepatic terminal veins. This distribution pattern is consistent with the predicted pathway for rapidly internalized rPdx1 via the portal vein system. The rPdx1 w as also detected in peripheral acinar cells of the pancreas, possibly as a result of direct uptake or through local circulation along pancreatic terminal capillaries. In kidneys, rPdx1 was mostly concentrated in brush borders of proximal tubular cells. Little protein was seen in the cytoplasm and none in the nuclei. At 24 hours postinjection, only faint rPdx1 protein was focally detected in liver, pancreas, and kidney tissue sections. A low level of rPdx1 was also detected in the tissues of the spleen, hear t, lung, and brain at 1 h our postinjection, but it became undetectable at 24 hours postinjection (data not shown). Similar findings were also noted in mice treated with 1 mg rPdx1 protein. Control mice showed no detectable rPdx1 protein in any tissue section except for pancreatic islet beta cells. On the basis of these findings, the 0.1-mg rPdx1 at 24 hours intervals was chosen for in vivo condition for assessing in vivo effects of rPdx1 on mice with streptozotocin induced diabetes.

PAGE 50

50 In vivo Effects of rPdx 1 on Blood Glucose Levels in D iabetic M ice With this, an experimental timeline was designed for rPdx1 protein administration (Fig. 36) in mice with streptozotocin -induced diabetes. Diabetic BALB/c mice (body weights 20 g) were intraperitoneally administe red with 0.1 mg rPdx1 or nontherapeutic PTD GFP protein (negative control) over 10 consecutive days. Fasting blood glucose levels were monitored as indicated. Mice receiving rPdx1 injections achieved near normoglycemia within 2 weeks of first injection (Fi g.3-7); however, no amelioration of hyperglycemia was observed in control mice receiving the PTD GFP. At days 14 and 40 postinjection, intraperitoneal glucose tolerance test (IPGTT) (Fig. 3-8) showed that the mice receiving rPdx1 injection, in contrast to those diabetic mice receiving PTD GFP, exhibited a much improved, nearly normal IPGTT curve. To further assess the ability of glucosestimulated insulin release in the rPdx1treated diabetic mice, healthy normal and treated mice were challenged at days 14 and 40 post -rPdx1 orPTD GFP injection with intraperitoneal bolus of glucose. Sera collected from normal, rPdx1treated, or PTD GFP treated mice at 15 min postglucose injection were assayed for insulin and glucose (Fig. 3-9). Serum insulin levels in rPdx1treated mice were 6.9 times higher at day 14 and 11.3 times higher at day 40 than those in the PTD GFP treated group (Fig. 3-9), indicating a significant improvement in the ability of the rPdx1treated mice to handle glucose challenge. Overall, the serum insulin levels were inversely related to the blood glucose levels on days 14 and 40 postinjection in mice treated with rPdx1 or PTD GFP protein. Although near euglycemia was achieved at day 40 in rPdx1treated mice, the released insulin (2.6 g/l) followin g 15 min of glucose stimulation was still much lower than that in normal nondiabetic mice (5.7 g/l), suggesting either functional immaturity of newly formed islet beta cells or suboptimal beta cell mass in the pancreas or IPCs in nonpancreatic tissues for glucose homeostasis.

PAGE 51

51 Pdx1 Treatment Promoting Endogenous beta cell R egeneration To explore whether rPdx1mediated normoglycemia resulted from islet beta cell regeneration, rPdx1treated mice were subjected to subtotal (>90%) pancreatectomy at day 30 ( n = 4) postinjection. Blood glucose levels rose sharply following subtotal pancreatectomy (Fig. 37), indicating that pancreatic cells (presumably the islet beta cells) played a dominant role in restoring normoglycemia at 30 days postrPdx1 injection. To further determine the role of the pancreas at earlier stages of blood glucose normalization, subtotal pancreatectomy was performed at day 12 postinjection in rPdx1treated mice ( n = 4) and resulted in elevated blood glucose levels: from an average of 170 to 350 mg/dL within 48 hours postoperation. These results raise the distinct possibility that in vivo delivery of rPdx1 promoted endogenous beta cell regeneration. Immunohistochemical examination confirmed vigorous islet beta cell regeneration, with larger and more abundant islets evident in rPdx1treated mouse pancreata, in contrast to rare and scattered small islets in PTD GFP treated mice (Fig. 3-10A). Such findings indicate that when administered in vivo in multiple doses, rPdx1 appears to promote endogenous beta cell regeneration via an as yet undefined molecular/cellular mechanism. To further characterize the regenerated islets, double immunofluorescence studies were conducted with anti-glucagon and anti-insulin antibodies. Significantly, a change in the a lpha cell to beta cell ratio and distribution patterns was noted ( Fig. 3-10B) consistent with a dynamic process of islet cell regeneration and maturation. To determine the proliferation rate in the newly regenerated islets following rPdx1 treatment, Ki67 s taining was sequentially performed, followed by insulin immunostaining, on pancreas sections from various groups of animals. As shown in Fig. 3-11, representative micrographs indicate that Ki67positive pancreatic islet cells from normal mice were rarely seen (0 1 Ki6 7 positive cell/islet (Fig. 3-11). Although few proliferating pancreatic islet cells were

PAGE 52

52 observed in the PTD GFP treated mice, it was difficult to identify normalsized islets except for scant scattered small islets (Fig. 3-11). However, Ki67positive islet cells were markedly increased in the newly regenerated islets in the pancreata of the rPdx1treated mice compared with those of control mice (Fig. 311 ). Sequential double Ki67/insulin immunostaining (Fig. 311) showed that both insulin-pos itive islet beta -cells and nonbetacells were proliferating in islets from tissues obtained at days 14 and 40 postrPdx1 treatment. To determine the molecular events underlying rPdx1mediated islet beta cell regeneration, real time RT PCR was used to examine the expression of key genes relevant to pancreas regeneration. rPdx1 treatment of diabetic mice (Fig. 3-12) at day 14 resulted in markedly upregulated levels of INS -I (21.3 times), Pdx 1 (3.8 times), INGAPrP (14.5 times), Reg3 (6.8 times), and PAP (34.3 times) relative to their corresponding control values (PTD GFP treated pancreas). A similar pattern of upregulation of the aforementioned genes was observed at day 40 post-treatment. Interestingly, expression of PAP, although upregulated at day 14 when compared with that in PTD GFP treated mice, was noticeably reduced at day 40 posttreatment. These results indicate that rPdx1 protein can promote islet beta cell regeneration, possibly by upregulating genes involved in pancreatic cell regeneration. Pdx1 T reatment Promoting Liver Cell Transdifferentiation into IPCs To access, whether in vivo intraperiteonal rPdx1 delivery affects the liver, presence of IPCs were detected in treated mice at days 14 and 40 postinjection. Representative liver images from mice treated with PTD -GFP or rPdx1 at day 14 posttreatment (Fig. 3-13 ) indicate that most of the scattered insulin staining positive liver cells were distributed along the edges of hepatic terminal veins (H.T.V.), a pattern consistent with rPdx1 tissue distribution in the liver (Fig. 3-13). There were scattered individual insulin-positive hepatocytes (arrows) having small bilobed nuclei and

PAGE 53

53 dark condensed chromatin, hinting at a more mature cell pattern. No IPCs were observed in the control GFP -treated mouse liv er. The expression profiles of pancreatic ge nes were investigated for rPdx1 and PTD GFP treated livers (Fig. 3-14). As expected, the rPdx1treated livers at day 14 posttreatment (lane 6) expressed many Pdx1target pancreatic genes, including Pdx 1, INS -I G LUC, ELAS, and IAPP. Upregulation of other pancreatic endocrine genes ( INS -II, SOM, NeuroD, and ISL-I ) and pancreatic exocrine genes ( p48 and AMY), was noted in the livers of the rPdx1treated mice compared with that in the PTD GFP treated mice. However, Ngn3 gene expression was not detectable at either time point. Interestingly, by day 40, INS I, GLUC, ELAS, and IAPP gene expression became undetectable, whereas expression of the aforementioned pancreatic genes continued, albeit at reduced levels. To quanti tatively compare the changes of the pancreatic genes in the livers between days 14 and 40, realtime RT PCR was performed for selected mRNAs including I ns -i Gluc, Pdx1, p48, A my and Elas. As indicated in Fig. 3-15, a several fold increase was noted at day 14 vs. day 40 mice postrPdx1 treatment. Given the intrinsic ability of rPdx1 protein to penetrate cells indiscriminately, the tissue specificity of rPdx1's effect on expression of pancreatic Pdx1, InsI, Gluc and A my genes was examined by RTPCR Litt le or no pancreatic gene activation was detected at day 14 post rPdx1 treatment in kidney, brain, heart, lung, small bowel, or spleen (Fig. 3-16). These results suggest that rPdx1 selectively promotes liver expression of pancreatic genes and pancreatic bet a cell regeneration without detectable evidence of undesired expression in other tissues. Relationship Between Pancreas and Liver at Tissue Insulin Levels To determine the relative contribution of pancreas and liver tissue derived insulin to ameliorating blood glucose levels following rPdx1 treatment, pancreas and liver tissue insulin content of both normal and treated mice was measured at day 14 or 40 by ELISA. Pancreatic

PAGE 54

54 insulin content in rPdx1treated diabetic mice at days 14 and 40 postinjection was 44 and 68%, respectively, of the normal pancreatic levels (Fig. 3-17). These levels were also 6.7 times higher at day 14 ( P < 0.01, Student's t-test) and 15.8 times higher at day 40 ( P < 0.001) posttreatment compared with those in the PTDGFP treated diabetic mice. There is a marked increase ( 16 times) in the liver tissue insulin content at day 14 posttreatment in the rPdx1 treated mice over that of the PTD GFP treated mice ( P < 0.001) and nearly a nine fold increase over that of normal liver (Fig. 3-18) Interestingly, there was sharply reduced liver insulin content at day 40 postrPdx1 treatment, although it was still 7.3 times higher than that in PTD GFP treated mice ( P < 0.01) and 2 times higher than that in normal liver. These findings confirmed tha t in vivo rPdx1 treatm ent promoted pancreatic islet beta cell regeneration and transient liver cell transdifferentiation into IPCs, suggesting that liver and pancreas both contributed to achieving glucose homeostasis in a compensatory fashion. Discussion Given that absolute and relative insulin deficiencies, respectively, form the basis of type 1 and 2 diabetes, the identification of a means for restoring functional beta cell mass would hold immense promise as a means for curing these disorders. In this st udy, several novel findings were observed: 1) in vivo administration of rPdx1 ameliorates hyperglycemia in diabetic mice, 2) amelioration of hyperglycemia is attended by both pancreatic beta cell regeneration and liver cell transdifferentiation, and 3) the observed therapeutic effect is likely to require Pdx1 to have an intact protein transduction domain. These experiments therefore constitute a proof-of-principle demonstration that protein therapy in the form of in vivo Pdx1 delivery to animals can be a highly effective therapeutic strategy, one that exploits intrinsic properties of a naturally occurring pancreatic transcription factor and that avoids undesirable effects typically associated with viral vectormediated gene therapies.

PAGE 55

55 Specifically, these re sults indicate that in vivo delivery of rPdx1 can promote both beta cell regeneration as well as liver cell transdifferentiation into IPCs. Pdx1mediated pancreatic islet beta cell regeneration appears to be the dominant effect on glucose homeostasis, sinc e marked hyperglycemia was observed in mice receiving nearly total pancreatectomy. Although the exact cellular and molecular events responsible for rPdx1 mediated beta cell regeneration and liver cell transdifferentiation remain to be defined, based on the findings, rPdx1 protein enters the circulation via terminal veins and capillaries and penetrates cellular membranes to gain nucleus entry into target cells in the liver and pancreas (Fig. 3-5), resulting in activation of rPdx1 dependent transcription fact or cascade. The notion that rPdx1 promotes pancre atic beta cell regeneration is supported by the presence of numerous pancreatic large islets ( Fig. 3-10), an increasing number of proliferating islet cells (Fig. 3-11), an ensuing increase in the level of pa ncreatic tissue insulin ( Fig. 3-17), and the significant upregulation of several key genes related to pancreatic cell regeneration in rPdx1 treated mice ( Fig. 312 ). The fact that rPdx1 vigorously promoted pancreatic islet cell proliferation and regeneration raises intriguing questions about the type of pancreatic cells that are the targets of rPdx1 (e.g., what is the cell origin for the newly regenerated islets?). Possible mechanisms include residual islet cell proliferation, exocrine acinar cell transdiff erentiation, and pancreatic ductal/stem cell neogenesis. Presently, this approach limits the tracking of the cells of origin into/within the target tissue, resulting in the newly formed islets. Several genes ( INGAPrP Reg -3 and PAP) upregulated by rPdx1 treatment are members of the pancreatic regenerating ( Reg ) gene family originally identified in animal models of beta cell regeneration (107). Their gene products play important roles in the maintenance of progenitors in the process of pancreas regeneration. Despite variation between individual

PAGE 56

56 samples, expression leve ls of the Reg genes determined by RTPCR correlated well with an earlier study involving conditional expression of Pdx 1 in a transgenic mouse model (37). The observed functional effects of rPdx1 on the liver are consistent with the published results of ectopic expression of Pdx 1 gene via adenovirus vectors resulting in liver cell transdifferentiation (83;84). In the current experimental model liver and pancreas appear to work in a sequential, compensatory manner to ameliorate hyperglycemia and ultimately to restore euglycemia in rPdx1treated mice. The kinship between the liver and pancreas in controlling glucose homeostasis is also supported by a recent study using liver and pancreas doubleinjury animal models (89) The early phase of rPdx1-induced hepatic insulin production is supported by an intense expression of the insulin I gene (Fig. 3-14) and a nearly 18fold increase in liver tissue insulin in comparison with that of control liver (Fig. 3-15). While the precise mechanism underlying the rPdx1-mediated surge in hepatic insulin during early stage glucose homeostasis remains to be elucidated, possible explanations include the following: 1 ) action of hepatic insulin on pancreatic progenitor cells via the insulin signaling pathway to promote beta cell regeneration via IRS2 Akt -Pdx1mediated signal transduction (108) ; 2 ) insulin mediated facilitation of beta cell neogenesis, involving amelioration of hyperglycemic toxic effects on residua l beta cell regeneration (109); and 3 ) rPdx1-mediated hepatic insulin production, resulting in an increased rate of glucose clearance by the liver, perhaps by promoting glucokinase expression and/or by insulin's stimulatory action on glycogen synthase, thereby lowering blood glucose levels (110). Pdx1 gene expression has also been reported to be associated wit h beta cell neogenesis in rodent pancreas injury models (37;45;108;111). Alt hough this study showed roughly a 2 to 4x increase of Pdx 1 gene expression in the pancreas of rPdx1over PTD GFP treated mice, pancreatic beta cell function appears to be exquisitely sensitive to small changes in Pdx 1 gene

PAGE 57

57 expression levels in both humans and mice (111;112). The rPdx1 protein can positively regulate Pdx 1 gene expression, as evidenced by upregulation of endogenous Pdx 1 gene expression in the livers of rPdx1treated mice. These observations are consistent with the findings of others indicating that Pdx1 protein binds to its own promoter and positively regulates its own gene expression (44) These results suggest that rPdx1 -based protein therapy may not require a largedose or long-term treatment and, thus, may reduce or eliminate potential dosagerelated systemic toxicity. Although in this study it was shown that rPdx1 effectively reverses hyperglycemia in diabetic mice, there are potential obstacles to clinical translation. One concern is that rPdx1 could be partially degraded by serum proteases. To assess this possibility, further studies on rPdx1 stability in whole blood and plasma would be helpful. Moreover, detailed pharmacokinetic studies are needed to optimize dosages, routes of delivery, and the interval between treatments. The polyclonal anti-Pdx1 antiserum used in this study precludes distinguishing between intact and any partially degraded rPdx1 protein. Significantly, the ability of rPdx1 to ameliorate hyperglycemia in diabetic mice, along with its nuclear localization in liver and pancreatic acinar cells ( Fig. 3-5), indicates in vivo availability of a sufficient amount of intact rPdx1 protein or biologically active degradation products capable of translocation into cells. Another concern is the potential toxicity of rPdx1 to offtarget organs via its PTD, since the rPdx1 protein has the potential to enter almost any tissue or cell type. We can, however, exclude the activation of rPdx1 target genes in tissues other than liver and pancreas at day 14 posttreatment. Moreover, the animals appeared normal, without evidence of weight loss or abnormal organ morphology. In fact, the diabetic mice treated with rPdx1 gained body weight, showed an improved IPGTT, and exhibited markedly reduced blood glucose levels. Nonetheless, a full toxicity profile of rPdx1,

PAGE 58

58 especially at earlier time points, is required to address this question. These studies are beyond the scope of the present manuscript and will be pursued in the future. Interestingly, the distribution of rPdx1 in the kidney is quite different from that in the liver and pancreas at the early 1 -hour time point (Fig. 3-5). Inste ad of being present in the cell nuclei, rPdx1 was localized near the brush border of the proximal tubular cells. Such a distribution was not observed at 24 hours. As the rPdx1 protein rapidly enters the bloodstream (Fig. 3-4) after intraperitoneal injectio n, it may be filtered through glomerular capillaries into the urinary spaces via the fenestrated capillary endothelial cells and glomerular basement membrane. Alternatively, rPdx1 may gain entry via cells by virtue of its on-board PTD. Once in the urinary spaces, it would not be surprising if the cationic rPdx1 protein interacts electrostatically with polyanions (e.g., sialic acid and phopholipids) present on the apical surface of proximal tubular epithelial cells. In conclusion, this demonstration that in vivo rPdx1 delivery into diabetic mice rapidly restores euglycemia exploits the intrinsic properties of this key pancreatic transcription factor (e.g., its builtin antennapedia -like PTD, its positive autoregulation,(113) its vital role in pancreatic cell development and regeneration (37;45), and its role in maintaining pancreatic beta cell function) (37;114;115). Indeed, it is possible that that Pdx1based protein therapy should allow for a redirection (or reactivation) of pancreatic stem/precursor cell differentiation and transdifferentiation (or reprogramming) from nonpancreatic cells along pancreatic beta cell developmental pathways, a feature that could prove beneficial in treating patients with diabetes.

PAGE 59

59 Table 3 -1. Primer name, sequences, size, GenBank #, and PCR condition Genes Forward primer Reverse primer PCR size GenBank Tm Cycle (bp) Acc. No. (C) No. HPRT CTCGAAGTGTTGGATACAGG TGGCCTATAGGCTCATAGTG 350 NM_01355 6 56 40 INS I TAGTGACCAGCTATAATCAGAG CAGTAGTTCTCCAGCTGGTA 372 NM_00838 6 56 40 INS -II GCTCTTCCTCTGGGAGTCCCAC CAGTAGTTCTCCAGCTGGTA 288 NM_00838 7 56 40 GLUC TGAAGACCATTTACTTTGTGGCT TGGTGG CAAGATTGTCCAGAAT 492 NM_00810 0 57 40 SOM CTCTGCATCGTCCTGGCTTTG GGCTCCAGGGCATCATTCTCT 173 NM_00921 5 56 40 IAPP TGAACCACTTGAGAGCTACAC TCACCAGAGCATTTACACATA 282 NM_01049 1 55 40 Glut 2 CGGTGGGACTTGTGCTGCTGG GAAGACGCCAGGAATTCCAT 412 NM_03119 7 56 40 P48 CCC AGAAGGTTATCATCTGCC CGTACAATATGCACAAAGACG 245 NM_01880 9 57 40 ELAS AATGACGGCACCGAGCAGTATGT CCATCTCCACCAGCGCACAC 344 NM_03361 2 57 40 AMY TGGGTGGTGAGGCAATTAAAG TGGTCCAATCCAGTCATTCTG 371 NM_00966 9 56 40 PDX1 ACCGCGTCCAGCTCCCTTTC CCGAGGTCACCGCACAATCT 357 N M_00881 4 57 40 NeuroD 1 CATCAATGGCAACTTCTCTTT TGAAACTGACGTGCCTCTAAT 257 NM_01089 4 56 40 ISL-I AGACCACGATGTGGTGGAGAG GAAACCACACTCGGATGACTC 296 NM_02145 9 56 40 NGN3 TGGCACTCAGCAAACAGCGA AGATGCTTGAGAGCCTCCAC 516 NM_00971 9 56 40 INS I = Insulin I, INS II = insulinII, GLUC = glucagon, SOM = somatostatin, ELAS = elastase, AMY = amylase. NGN3 = neurogenin 3, IAPP = islet amyloid polypeptide, Glut2 = glucose transporter -2, ISLI = islet -1.

PAGE 60

60 Table 3-2. Real time PCR Primer name, sequences, size, GenBank #, and PCR condition Genes Forward primer Reverse primer PCR size GenBank Acc. No Tm (C) Cycle No. Actin ACCACACCTTCTACAATGAGC GGTACGACCAGAGGCATACA 185 NM_007393 56 38 INS I GCCCTTAGTGACCAGCTAT GGA CCA CAA AGA TGC TGT TT 167 NM_008386.2 56 38 PDX1 ATGAAATC CACCAAAGCTCAC AGTTCAACATCACTGCCAGCT 190 NM_008814.2 56 38 INGAPrP GCTCTTATCTCAGGTTCAAGG AGATACGAGGTGTCCTCCAGG 178 NM_013893.1 56 38 Reg3 CATGACCCGACACTGGGCTATG GCAGACATAGGGTAACTCTAAG 190 NM_011260.1 56 38 PAP AATACACTTGGATTGGGCTCC CCTCACATGTCATATCTCTC C 195 NM_011036.1 56 38 INS I+ insulin, INGAPrP= Islet neogenesis associated protein -related protein, Reg3 = regenerating islet -derived 3 gamma, PAP = pancreatitis associated protein

PAGE 61

61 Fi gure 3-1. Cloning, expression, purification, and characterization of rat Pdx1, PTD-GFP, and rPdx1-mut fusion proteins. The Pannel (A C) represents the schematic structures of fusion proteins of rPdx1, PTD-GFP, and rPdx1-mut. The cDNAs coding rPdx1, mutant Pdx1, or PTD-GFP were cloned into the expression plasmid. Pr oteins were expressed and purified by an Ni-column. The purified proteins were run in a 10% SDS -PAGE gel stained with Coomassie Blue and confirm ed by Western blotting using anti-Pdx1 antibody and antihis-tag antibody.

PAGE 62

62 Figure 3-2. Time course of cell entry of rPdx1 and rPdx1-mut proteins. WB cells were incubated with rPdx1 or rPdx1mut at a final concentration of 1 mol/l for indicated times. Proteins were detected by Western blotting with rabbit anti -Pdx1 (1:1,000) or antiactin (1:5,000) antibodies. The relative amount of cellular rPdx1 protein was quantified by densitometry and the values normalized to actin The cells treated with rPdx1mut shows the protein levels in the culture medium by the end of the treatment.

PAGE 63

63 Figure 3-3. Functional analysis of rPdx1 protein. 3T3 cells were cotransfected with NeuroDpromoter with luciferase and Tk renilla plasmid constructs. The cells were either treated with CMV Pdx 1 or transduced with 10 m of rPdx1. A comparable transcription efficacy for CMV Pdx 1treated cells and rPdx1 proteintreated cells was observed after 24 hou rs compared to the untreated cells.

PAGE 64

64 Figure 3-4. In vivo kinetics and tissue distribution of rPdx1 following intra-peritoneal injection. Normal BALB/c mice were injected intraperitoneally with rPdx1 protein (0.1 mg/mouse). Blood samples were collected at indicated times, and 20 L serum/lane was loaded in SDS-PAGE gels. The rPdx1 was detected by Western blotting with anti-Pdx1 antibody.

PAGE 65

65 Figure 3-5. In vivo tissue distribution of rP dx1 following intraperitoneal injection. Liver, pancreas, and kidney tissues were harvested at 1 or 24 h after rpdx1 intraperitoneal injection a nd fixed in 10% formalin. Paraffin sections were immunostained with antiPdx1 antibody (1:1,000). Typical distribution patterns of rpdx1 protein in liver (1, 4, and 7), pancreas (2, 5, and 8), and kidney (3, 6, and 9) were visualized by light microscopy at 1 h and 24 h posttreatment. Pdx1 immunostaining of the liver, pancreas, and kidney tissue sections from normal mice is indicated in the bottom row (1012). The arrow in panel 2 indicates a small islet in the pancreas with strong nuclear Pdx1 immunostaining.

PAGE 66

66 Figure 3-6. Experimental timeline for rP dx1 treatment. Timing of streptozotocin (Stz) treatment followed by treatment with rP dx1 or PTD GFP proteins and selective pancreatectomy are indicated The timing of blood glucose determinations and the measurement of blood insulin levels, IPGTT, measurement of tissue insulin, and the determination of gene expression by RTPCR were shown.

PAGE 67

67 Figure 3-7. In vivo effects of rPdx1 protein on blood glucose levels. Diabetic BALB/c mice were treated with daily intraperitoneal injections of 0.1 mg rPdx1 or PTD -GFP for 10 consecutive days (long arrow), and blood glucose levels were determined by glucometer. The blood glucose levels of rPdx1 treated mice demonstrated amelioration in hyperglycemic condition compared to the PTDGFP treated that remained hyperglycemic. Nearly total pancreatectomy was performed in selected control and rPdx1treated mice at day 30 (short arrow).

PAGE 68

68 Figure 3-8. Intraperitoneal glucose tolerance test. The IPGTT was performed by i.p. injected with 1mg/g bd.wt of glucose, and blood glucose was measured at 0, 15, 30, 60, and 120 min in normal, rPdx1, or PTD GFP trea ted mice. The mice treated with rPdx1 had better glucose handling ability than PTDGFP treated mice. rPdx1 treated mice had better glucose handling ability at day 40 compared to day 14.

PAGE 69

69 Figure 3-9. Comparison of average blood glucose and Insulin levels between rPdx1 treated and untreated control mice. Glucose and insulin levels were measured in rPdx1and PTD GFP treated mice 15 min after IPGTT on days 14 and 40 posttreatment (n = 5 mice per group). **P < 0.05; ***P < 0.001 (Student's t test).

PAGE 70

70 Figure 3-10. Histology of pancreatic islets. A. Insulin immunohistochemistry of pancreatic tissue. Representative picture of immunohistochemsitry of Paraf fin -embedded pancreas tissues from mice treated with either PTD GFP or rPdx1 were sectioned and immunostained with anti-insulin antibody (1:1,000). The Islets in rPdx1 treated mice are relatively larger in size with more insulin -producing beta cells compared to the i slets in PTD GFP treated mice. B. Paraffin sections from PTD GFP and rPdx1treated mouse pancreas tissues were immunostained with both rabbit anti glucagon/phycoethrin (red) and Guinea pig antiinsulin/FITC (green) and visualized under fluoresce nce microscopy. There is change in the ratio of alphacell to betacell ratio and distribution patterns.

PAGE 71

71 Figure 3-11. Immunostaini ng with anti -KI67 antibody and anti-insulin antibody. The islets were stained with Ki-67(brown colour) from tissues of normal mice (1), PTDGFP treated (2), rPdx1 treated (5, 6). The islets of rPdx1 treated mice were also stained for insulin (Red colour) (7) and double stained for Ki-67 and Insulin (7a)

PAGE 72

72 Figur e 3 -12. Quantitative Realtime PCR analyses of pancreatic tissue betw een rPdx1 treated and control mice. Total RNA from diabetic mouse pancreas (days 14 and 40 post rPdx1 or PTD GFP treatment) was used for real time PCR analysis of INS -I, Pdx1, INGA rP, R eg3 and Pap gene expression. Expression levels are normalized to actin gene expression. Data are from 3 mice/group. INGAPrP, islet neogenesisassociated protein related protein; PAP, pancreatitis associated protein; Reg3 regenerating islet-derived 3

PAGE 73

73 Figure 3-13. Insulin immunohistochemical staining of liver tissue. Paraffin sections from liver were stained with anti -insulin antibody (1:250). Representative images were taken a t 40x or 100x magnification. Insulinpositive cells are seen in the rPdx1 treated mouse liver section at day 14 post-treatment. Arrow, condensed nuclear chromatin of a bilobednucleated insulin -expressing liver cell. HTV, hepatic terminal vein.

PAGE 74

74 Figure 3-14. RT -PCR analysis of the expression of pancreatic genes in the liver. Expression of pancreatic genes in the liver. RT PCR amplification of RNA extracted from livers of normal, PTDGFP or rPdx1treated mic e were analyzed by agarose gel electrophoresis. RNA from mouse pancreas was used as a positive control. For Ngn3 RT PCR analysis, Ngn3 cDNA plasmid (*) was used as positive control because adult pancreas does not express this gene. No RT, no reverse transcription.

PAGE 75

75 Figure 3-15. Quantitative Real Time PCR analyses of pancreatic gene expression in liver. T otal RNA from diabetic mouse liver (days 14 and 40 postrPdx1 treatment) was analyzed by real-time PCR for the expression of five Pdx1 target genes ( INS I, Gluc, Pdx1, p48, Amy, Elas ). Expression levels are normalized to actin gene expression. Fold changes (D14 over D40) are representative of data from 3 mice/group.

PAGE 76

76 Figure 3-16. Expression of pancreatic gene s in other organs. Total RNA from other organs of rPdx1treated diabetic mice at day 14 post treatment and expression o f four key pancreatic genes ( Ins-I, Gluc, Amy, and Pdx1) were examined by RTPCR. Pancreatic gene expression was observed only in Liver and not in other organs. Data are from 3 mice/group and are representative of three independent experiments.

PAGE 77

77 Figure 3-17. Pancreatic tissue insulin measurements as determined by ELISA. Pancreatic in sulin content in rPdx1treated diabetic mice at days 14 postinjection was 6.7 times higher at day 14 and 15.8 times higher at day 40 posttreatment compared with those in the PTD GFP treated diabetic mice. ** = p<0.05. *** = p<0.001.

PAGE 78

78 Figure 3-18. Liver tissue insulin measurements as determined by ELISA. There is insulin expression of day 14 in significant levels (16 times) compared to normal and PTDGFP group. However, the insulin levels have reduced by day 40. ** = p<0.05. *** = p<0.001.

PAGE 79

79 CHAPTER 4 PDX1 PROTEIN THERAPY PREVENTS THE ONSET OF TYPE 1 DIABETES IN NOD MICE Introduction Type 1 D iabetes is an autoimmune disorder characterized by the lymphocyte infiltration into the pancreatic islets resulting in decrease d beta cell mass. T he treatment of type 1 diabetes has been cha llenging due to lack of complete understanding of disease pathogenesis. The key elements that need to be addressed in order to cure type 1 diabetes include 1) successful manipulation of immune system(116), and 2) r estoration of beta cell mass(117). It has been reported that approximately 50% of the genetic risk for type 1 diabetes can be attributed to the HLA region. The highest risk HLA-DR3/4 DQ8 genotype has been shown to be frequently associated with beta cell autoimmunity (3;7). The first antibodies described in association with the development of type 1 diabetes were islet cell autoantibodies (ICA) (9). Subsequently, antibodies to insulin (IAA) (10), glutamic acid decarboxylase (GAA or GAD) and protein tyrosine phosphatase (IA2 or ICA512) have been characterized (12). Non obese diabetes (NOD) mouse is an animal model for investigating the human juvenile type 1 diabetes. Female NOD mouse (Jackson labs) spontaneously becomes hyperglycemic accompanied by polyuria, polydipsia, glucosuria, hypercholesteremia and rapid weight loss. The incidence of diabetes onset is 80 % by 30 weeks of age. Histologica l examination of pancreas reveals lymphocyte infiltration around and/or into the islets. This pathological nature can be observed as early as five weeks of age. The number and size of the isle ts are markedly reduced in overt diabetic mice. Although the mechanism of pathogenesis is not clear yet, the NOD mouse has been extensively used as an animal model for investigating the human juvenile type 1 diabetes(118).

PAGE 80

80 Previous studies have shown that GLP-1R analog (Extendin4) delays the onset of diabetes i n NOD mice (119;120). Studies by other groups in NOD mice have shown that GLP 1 improves glucose sensitivity in beta cells (121), and protects beta cells from cytokine induced apoptosis and necrosis (122) GLP -1 is not only an incretin horm one but also a modulator of cellular immune system The multiple pleiotropic effects such as glucoregulatory, proliferative, and cytoprotective actions of G LP-1 on beta cell s are essentially dependent on beta cell Pdx1 gene expression (122). The studies conducted in STZ-induced diabetic mice demonstrated that rPdx1 via its protein transduction domain can enter the targets cells such as pancreatic islets and l iver hepatocytes to promote beta cell regeneration and liver cell transdifferentiation into insulin producing cells ( IPC s) towards treatment of diabetes(123). This study is aimed at investigating the therapeutic effects of rPdx1 treatment in NOD type 1 diabetes mouse model. Materials and Methods Animal Studies Ten week old female NOD mice (Jackson labs, USA) were injected i.p. daily with 0.1 mg of rPdx1 (n=20) for 12 weeks or with saline (n=20). Blood glucose (mg/dL) and body weight ( grams) were monitored weekly Blood gl ucose was measured using glucometer (Accu Chek ). IPGTT, serum insulin levels, morphology, and tissue insulin content were examined in NOD mice between 22-25 weeks of age. I ntraperitoneal Glucose Tolerance Test (IPGTT) Both the rPdx1treated and saline tre ated (n=4 per group) were fasted for six hours before injecting glucose. To prepare glucose solution, 1 gram of dextrose (Fisher Scientific ) was dissolved in 10 mL of distilled water to make 100 mg/mL solution. After 6 hours of fasting, a fasting glucose level was obtained using glucometer. Tail tip was pricked with needle to draw

PAGE 81

81 drop of blood. The mice were weighed. 2 mg/g body weight glucose was injected intraperitoneally. Blood glucose values were obtained at 5, 15 30, 60, and 120 min. Serum Insulin Measurements The mice were injected with 2 mg/g bd.wt of glucose ( Stock -100 mg/ mL ). S erum samples were collected after 15 min of glucose injection from rPdx1treated NOD mice (22 weeks ), diabetic control NOD mice (22 weeks ), and normal NOD mice (9 weeks ) ; n=4 per group. The ins ulin levels were measured using ultra sensitive mouse ELISA kit ( Alpco Diagnostics) according the manufacturers instructions as described earlier Construction of Truncated Pdx1 Proteins Site directed mutagenesis was performed by use of a QuikChange sitedirected mutagenesis kit (Stratagene). The introduction of a stop codon (TAG) mutations into Pdx1 cDNA at the position of the 120th, 160th or 200th amino acid, residue respectively, was achieved by the use of pET28 rPdx -1 expression vector as template DNA together with the following pairs of mutagenic primers: for Pdx 1-120, fwd( 5'gcgttcatct ccctttc tag aggatgaaat ccaccaaagctcac) and rev (5' ttggtggatttcatcctctag aaagggagatgaacgcggc); for Pdx1-160, fwd (5'cgggccca gctgctc tagatggagaagg aattcttatttaac ) and rev (aataagaattccttctccatctag agcagctggg cccgagtgtagg); for Pdx1-200, fwd (5'tccaaaaccg tcgcatctagaggaagaaag aggaagataagaaacgtag ) and rev (5'ttatcttcctctttcttcctctag atgcgacggttttggaaccag ); (the nucleotide changes g iving the appropriate mutations are shown in bold). After initial denaturation at 95C for 3 min, the cycling parameters were 0.5 min at 95C followed by 1.0 min at 55C and 7 min at 72C (30 cycles).The parental, supercoiled doublestranded DNA in the PCR react ion mixture was digested with DpnI at 37C for 40 min before being transformed into competent E. coli BL21(DE3) cells. The cDNA with Mutations were ve rified by DNA sequencing. The

PAGE 82

82 expression and purification of the each pdx-1 truncated protein was done as our previously reported. Extraction of Splenocytes from the Spleen The mice were sacrificed and spleen was extracted immediately. The spleen was placed in a Petri dish with ice cold PBS. Spleen was then minced into fine pieces by placing it between the t issue section slides. The entire procedure was conducted in sterile conditions under the laminar flow hood. The fine particles in saline solution were filtered through the tissue strainer ( Fisher Scientific ). The solution collected under the strainer was c entr ifuged at 1000 rpm for 5 min at 4C. Supernatant was discarded and the cells were resuspended in 2 mL RBS lysis buffer ( BD pharmingen) and followed by incubation at room temperature for 10 min. The cells were centrifuged again at 1000 rpm for 5 min at 4C.The supernatant was discarded and the pellet was resuspended in DMEM with 10% fetal bovine serum. Lymphocyte Proliferation Assay Splenocytes were harvested from the normoglycemic rPdx1treated and control mice. Splenocytes were resuspended in 10 mL of PBS. 10 L of suspension was taken and added to 90 L trypan blue (10 fold dilution). The cells were counted on hemocytometer in the four quadrants. The average of the four quadrants was multiplied by dilution factor (10) and total volume 10 mL 1000. [No. of Cells = Avg. Dil. Fac* vol* 1000.] One million cells were seeded into a 96 well plate in triplicates using DMEM with 10% FBS. The cells were treated with Glutathione transferase (GST), anti-CD3, insulin, or rPdx1 (40 ) for 48 hours followed by incubation with [3H] thymidine (1microcurie per well) for an additional 24 hours. After 72 hours, the plate was washed and the radioactivity was measured using scintillation counter (Beckman Coulter).

PAGE 83

83 BDC 2.5 Mice Splenocyte Transfer Sple nocytes were co llected from BDC2.5 TCR donor mice(124). The cells were labeled with carboxyfluorescein diacetate, succinimidyl ester (CFSE) label. 1 million cells were inje cted into the age matched rPdx1treated and contro l mice (non -diabetic). After 3 days, the lymphocytes were collected from the pancreatic, cervical and inguinal lymph nodes of rPdx1 treated mice (4 weeks) and control mice. Lymphocytes were analyzed with flow cytometry for the donor derived CD4 + population. Results Administration of rPdx1 to NOD Mice Prevents the Onset of Diabetes An experimental timeline was designed for rPdx1 protein administration ( Fig. 4-1) in pre diabetic NOD mice of 10 weeks age group. Mice were intraperitoneally administered with 0.1 mg rPdx1/mouse/day or saline (negative control) for 12 weeks. Random blood glucose levels (Fig 4-3) and body weights (Fig. 44) were monitored weekly for 40 weeks. 70% of the NOD mice receiving rPdx1 injections remained normoglycemic until the end of the 40 weeks study ( Fig 4-2); however, 95% of the NOD mice that received saline became hyperglycemic by 25 weeks of age. These results demonstrated that rPdx1 can significantly prevent the onset of NOD mice. In order to determine if short course of treatmen t can achieve results similar to 12 week long treatment, NOD mice (n=10) of 10 weeks age were administered with rPdx1 i.p for 4 and 8 weeks. Random blood glucose levels were monitored until the end of 30 weeks of age (Fig. 4-6, 4-8). 70% of the mice that received rPdx1 for 4 and 8 weeks maintained normoglycemia (Fig. 45 and 4-7), while 80% of the saline-treated control mice became hyperglycemic by the end of 30 week study.

PAGE 84

84 Beta cell Functional Analysis and Determination of Tissue Insulin L evels Intraperitoneal glucose tolerance test (IPGTT) (Fig. 4-9) at 25 weeks of age showed that the mice receiving rPdx1 injection, in contrast to m ice that received saline and became diabetic, exhibited a better, nearly normal IPGTT curve. To further assess the ability of glucosestimulated insulin release in the rPdx1treated and salinetreated mice they were challenged with intraperitoneal bolus of glucose. Sera collected from rPdx1-treated, or salinetreated mice at 15 min post glucose injection were assayed for insuli n (Fig. 4-9). Serum insulin levels in rPdx1treated mice were 7.5 times higher compared to the saline treated group (Fig. 4-10), indicating a significant difference in the ability of the rPdx1 treated mice to handle glucose challenge. Pdx1 Treatment Preserves Islet Mass Possibly by Beta cell regeneration and Promotes Liver Cell Tr ansdifferentiation into Insulin Producing Cells. To explore whether treatment of NOD mice with rPdx1 has resulted in preserved islet cell mass, pancreatic histology and insulin l evels were analyzed at 22 weeks age. H&E staining and immunohistochemical examination confirmed the presence of more number of larger size islets evident in the pancreata of rPdx1treated mice, in contrast to rare and scattered small islets in salinetreat ed mice (Fig. 411). To further characterize the islets, immunohisto chemical studies were conducted with anti-insulin and anti-glucagon antibodies. M ore insulin positive cells and organized glucagon positive cells were observed in islets of rPdx1treated mice compared to the islets from control mice (Fig. 411). In the H& E stained tissues, there was evidence of peri insulitis (T cell infiltration along the perimeter of the islet) in the pancreatic sections of rPdx1 treated mice ( Fig. 411) while the panc r eatic sections of the saline treated mice showed extreme insulitis (invasion and destruction of islet by Tcell infiltration). The insulin levels were determined in the extracts of both pancreas and liver by ELISA and the levels were significantly higher i n rPdx1treated mice compared to saline treated mice (Fig. 4 -12 ). These results indicate

PAGE 85

85 that rPdx1 treatment preserves beta cell mass and promotes liver cell transdifferentiation into IPCs. Detection of Pdx1 Antibodies in Serum Samples of rPdx1/Saline treated M ice Administration of rPdx1 to the mice could result in production of anti-Pdx1 antibodies. ELISA was performed in or der to determine the presence of anti -Pdx1 antibodies in the serum As expected there were detectable levels of antibodies against rPdx1 protein in the rPdx1treated mice, S urprisingly there were detectable levels of ant i-Pdx1 antibodies in the salinetreated mice (Fig. 4-13, pane l A ). In order to determine if this phenomenon was specific for NOD mice, ELISA was performed using several sera samples from various mouse strains such as BALB/C, C57/B6, NODSCID and NOD mice. The results indeed confirmed the presence of anti-Pdx1 antibodies specifically in NOD mice ( Fig. 4-13, pane l B ). To further validate the observations, w estern blot was p erformed to determine the specificity of the assay. rPdx1 protein was run on SDS -polyacrylamide gel. Following transfer onto the nitrocellulose membrane, the membranes were probed with either serum from BALB/C (negative control), or NOD mous e sera that tes ted positive or negative for Pdx1 antibody by ELISA. The 41 kDa band was detectable only in the ser um samples of NOD mice that were determined positi ve by ELISA (Fig. 4-14) The se results validate d the presence of anti -Pdx1 antibodies in the sera of NOD mi ce. Determination of Antigenic Epitope of Pdx1 P rotein To determine if anti -Pdx1 antibody is generated as a result of autoimmunity against Pdx1 protein or due to secondary immune as a result of immune cell infiltration into the already injured beta cells. The autoantibodies that are generated as a result of autoimmunity usually have a specific antigenic determinant and have a monoclonal antibody production while the antibodies that are formed as a result of secondary immune response are usually polyclonal in nature. To determine the position of the antigenic epitope, recombinant truncated proteins were ge nerated

PAGE 86

86 by introducing a stop codon at the end of 119, 159, or 199 amino acids. The full-length and truncated proteins were run on SDS-polyacrylamide gel. Following transfer, the membrane was incubated with antiPdx1 polyclonal rabbit sera or sera from NOD mice. As expected the polyclonal rabbit sera recognized full-length protein as well as truncated proteins. However, the serum from NOD mice could recognize only the fulllength protein ( Fig 4-15, panel A ). This result indicates that the antigenic epitope is located in the C -terminal portion of the Pdx1 protein between 200-283 amino acids. In order to demonstrate that the sera from NOD mice can recognize the 83 amino acids at the C terminus a GST fusion protein with C -terminal 83 amino acid portion (P83) was generat ed. Western blot using NOD mous e serum was able to recognize the Cterminal 83 amino acid fragment of the Pdx1 protein ( Fig .4-15, panel B ). Thes e results also indicate that sera from NOD mice could be monoclonal which strongly suggests the autoimmune origin of the antibody. PAA emerge before the onset of diabetes. To determine whether the Pdx1 autoantibody can predict disease ons et, the relation ship between Pdx1 autoantibody and hyperglycemia was explored (Fig.4-16). Fiveweek old female NOD mice (n = 20) were studied longitudinally and blood samples were taken biweekly until the onset of diabetes. Blood glucose levels were monitored weekly beginning at 10 weeks of age. Pdx1 autoantibodies were first detected at ages ranging from 5 to15 weeks, and their levels gradually increased, peaked, and then declined over the next 2-3 months. Pdx1 autoantibody often decreased to lower positive levels or disappeared completely after the onset of diabetes and the peak levels often preceded disease onset. In general, there was an inverse correlation over time between peak time of Pdx1 autoantibody and blood glucose levels in individual mice. However, some mic e m aintained high levels of Pdx1 autoantibody after the onset of diabetes. Figure 416 illustrates the relationship between levels of Pdx1 autoantibody and blood glucose in

PAGE 87

87 three mice. As noted, in two mice Pdx1 autoantibody levels peaked prior to the onset o f diabetes. In the third mouse (m19L), low levels were observed consistently without an apparent peak; this mouse remained normoglycemia at 25 weeks. These results suggest that Pdx1 autoantibody could be used as diagnostic marker for prediction of the onset of type 1 diabetes in NOD mice. Demonstration of Autoreactive Lymphocytes Against Pdx1 Protein in NOD Mice The presence of autoreactive T lymphocytes is the hallmark of an autoimmune disease. Immunotherapy with the soluble autoantigen promotes immunomodulation as observed in previously known autoantigens such as insulin (125) and GAD (11). Lymphocyte proliferation assay was per formed to demonstrate the presence of Pdx1 autoreactive T-lymphocytes in the NOD mice and to o bserve if rPdx1 therapy promoted immunomodulation. The splenocytes extra cted from both rPdx1 and salinetreated mice were treated with CD3, g luthathionetransferase (GST), i nsulin, rPdx1, or P83. The splenocytes derived from salinetreated contro l mice showed increased antigen -dependent proliferation when treated with insulin, rPdx1, and P83 suggesting the lymphocyte response to autoantigen. There was decreased pr oliferation in splenocytes derived from rPdx1treated mice when treated with insulin, rPdx1 and P83 suggesting the role of rPdx1 treatment in immunomodulation (Fig. 4-17). These results confirm the presence of pathogenic reactive lymphocytes that get activ ated in response to the Pdx1 antigen. Decreased P roliferation of Donor Derived BDC2.5 CD4+ Lymphocytes in Pancreatic L ymph node To determine if rPdx1 treatment in the NOD mice has promoted immunomodulation, the donor derived CD4+ lymphocytes specific to an islet antigen were analyzed for the proliferation in the pancreatic lymph node. The BDC2.5 donor mice splenocytes labeled with carboxyfluorescein diacetate, succin imidyl ester dye (CFSE) were transplanted into the recipient

PAGE 88

88 NOD mice pre treated with rPdx 1 or saline for 4 weeks. Flowcytometric analysis of the donor derived CD4+ lymphocytes in the pancreatic lymph node demonstrated 39% CD4 + donor cell population, while the rPdx1 mice showed a 15.1% CD4+ donor cell population. (Fig. 4-18). This result indica tes that the immunomodulatory effect of rPdx1 treatment is due to decrease in proliferation of islet antigen specific CD4 + T lymphocytes within the pancreatic lymph node. There was no significant difference in the CD4 + T cell population in cervical and in guinal lymph nodes indicating the immunomodulatory effect was restricted to islet antigen reactive CD4 + Tcells in the pancreatic lymph node. Effect of Mutant rPdx1 On the O n set of Diabetes in NOD mice To confirm the immunomodulatory role of rPdx1 protein, the mutant protein (rPdx1mut ) was generated by deletion of 188-203 amino acids. Deletion of these amino acids eliminated the DNA binding domain (191-196 amino acids ) and antennapedia -like protein transduction domain (188-203 amino acids ), thus making the protein biologically inactive. However, the antigenic determinant region (203 283 amino acids ) remained intact, thus preserving the immunologically active component of the rPdx1 protein (Fig. 4-19). To de termine the efficacy of the rPdx1mut protein, N OD mice were treated daily with 0.1 mg of either fulllength rPdx1 or rPdx1 mut protein for 8 weeks. After 30 weeks of follow up, 70% of mice remained normoglycemic with no significant difference in the onset of diabetes between both the groups (Full leng th rPdx1 and rPdx1mut ) by 30 weeks of age (Fig. 4-20), thus indicating the predominant immunomodulatory role of rPd x1 in the prevention of diabetes in the NOD mice. Discussion This study demonstrates that daily administration of rPdx1 in NOD mice prevents the onset of d iabetes. There is slight difference in onset of diabetes between long-term (12 weeks) and shortterm (4 and 8 weeks) treatment by 30 weeks of age. The long term treatment maintained

PAGE 89

89 normoglycemia in 90% of mice (Fig. 4-2), however short term treatment maintained normoglycemia in 70% of the mice at 30 weeks of age (Fig. 4-5, 4-7. In the process of understanding the therapeutic effects of rPdx1 in NOD mice, this study has directed us towards discovering of a novel Pdx1 autoantigen. Detection of Pdx1 autoantibodies in the cont rol untreated NOD mice (Fig. 4 -13, panel A ) has indicated the possible role of Pdx1 as an autoantigen. There have been extensive studies on the role of autoantibodies such as islet cell autoantibodies (9) insulin autoantibodies (10) and GAD autoantibodies in the pathogenesis of type 1 diabetes. In thi s study, we di scovered the presence of Pdx1 autoantibodies in NOD mice and correlated its presence with the onset of diabetes (Fig. 4 -16) It is important to differentiate between the pathogenic autoantibody and the antibodies that are formed as a secondar y immune response due to infiltration of antigen presenting cells into the already injured beta cells. In case of autoimmunity, a small peptide epitope region usually evokes a monoclonal antibody response while the antibodies developed due to immune cell infiltration into injured beta cells are polyclonal in nature. The fact that NOD serum antibody can recognize only the cterminal epitope region indicates the monoclonal and autoimmune nature of the antibody and the possible role of B-cells in pathogenesis of type 1 diabetes (126). The in vitro lymphocyte proliferation assay demonstrated a de crease in the proliferation of lymphocytes derived from rPdx1treated mice upon stimulation with Pdx1 autoantigen. This reduced proliferation was not only limited to stimulation with Pdx1 autoantigen but also spread to other known beta cell autoantigens s uch as i nsulin ( Fig. 417 ). This phenomenon of bystander suppression could possibly be due to production of regulatory cytokines as a result of administration of rPdx1 soluble antigen (127). These regulatory cytokines produced within the target tissue (islets) or local lymph node (pancre atic lymph node) are directed against the other

PAGE 90

90 locally expressed autoantigens (128). Pancreati c lymph node serves as the hub for autoimmunity directed against islet antigens with CD4+ T lymphocytes as mediators. The splenocyte tra nsfer study from donor BDC2.5 TCR mice (124;129) into recipient NOD mice demonstrated a decreased proliferation of CD4+ lymphocytes in rPdx1treated mice ( Fig. 4-18), thus demonstrating specifically the immunomodulatory role of rPdx1 on the CD4+ lymphocytes residing within the pancreatic lymph node. In this study we employed three distinct approaches to demonstrate that that Pdx1 is a novel autoantigen. Firstly, demonstration of anti-Pdx1 antibodies specifically in NOD mice indicates the involvement of Blymp hocytes (Fig. 4-13, panel B ). Secondly, mapping out the epitope region responsible for the antibody production (Fig. 4-15). Thirdly, demonstration of antigen mediated lymphocyte proliferation in response to Pdx1 antigen (Fig. 4-17). Besides these, the immu nomodulatory role of rPdx1 in the NOD mice corroborates the above findings (Fig. 4-2, 4-20). The previously known autoantigens such as Insulin(125) GAD(11), Hsp90(12), and Znt80 (130) have guided in designing effective therapeutic strategies using soluble antigens (11;14;20;131). On similar lines, treatment of NOD mice with soluble rPdx1 serves as an effective immunotherapeutic strategy to prev ent the onset of diabetes. The treatment with rPdx1 over a period of time could possibly induce immune tolerance as observed in immunotherapeutic strategies using other soluble autoantigens. The induction of tolerance could be due to the stimulation of specialized subpopulation of T cells (CD4+, CD25+, FoxP3+ regulatory T cells) (28;132) resulting in a shift in the balance from Th1 proinflammat ory to Th2 antiinflammatory cytokine release (133). Previous studies have shown that the administration of soluble autoantigens such as GAD (16) and H sp60 (20) lead s to shift in immune response towards Th2-

PAGE 91

91 dependent Tcell cytokine release with preferential production of IL-4, IL-5, and IL10 production (127;128). We expect a similar phenomenon with the rPdx1 immunotherapy. The other mechanism by which immune tolerance may be achieved is likely by clonal deletion or anergy, where frequent administration of the soluble antigen will familiarize the immune system to recognize Pdx1 as self antigen, thus resu lting in peripheral clonal deleti on. (131;134). The antigen induced tolerance was previously studied using e vidence in TCR transgenic mice models (127) hence future studies with Pdx1 antigen specifi c TCR would reveal the role of P dx1 antigen in the pathogenesis of type 1 diabetes. The treatment of NOD mice with rPdx mut protein (with no biological function but intact immunologically active component (Fig. 4-19) has demonstrated incidence of d iabetes similar to the wild type rPdx1 (Fig. 4-20). This suggests the predominant immunomodulatory role of rPdx1 to prevent the onset of type 1 diabetes. However, the contribution of rPdx1 in promoting bet a cell regeneration should not be ignored as in case of prevention trials, there is minimal requirement for regeneration component fo r the maintenance of islet mass. I PC s derived by transdifferentiation of liver hepatocytes should play a minor role in contributing towards glucose sensitive insulin secretion. In conclusion, this study shows that Pdx1 is a novel auto antigen that could have an active role in the p athogenesis of type 1 diabetes. Pdx1 autoantibodies could serve as an effective biomarker for prediction of the disease and Pdx1 antigenbased immunotherapy could serve as an effective strategy for prevention of the onset of diabetes.

PAGE 92

92 10510152025303540 2 3PDx1 treatment (100ug/mouse/day. 1 2 3Pre -diabetic stage. IPGTT Insulin levels, Histology, Lymphocyte assayAge in weeks 10510152025303540 2 3PDx1 treatment (100ug/mouse/day. 1 2 3Pre -diabetic stage. IPGTT Insulin levels, Histology, Lymphocyte assay 10510152025303540 2 3PDx1 treatment (100ug/mouse/day. 1 2 3Pre -diabetic stage. IPGTT Insulin levels, Histology, Lymphocyte assay 0510152025303540 2 3PDx1 treatment (100ug/mouse/day. 1 2 3Pre -diabetic stage. IPGTT Insulin levels, Histology, Lymphocyte assayAge in weeks Figure 4-1. Time line for the experimental plan for treatment of NOD mice. Ten week -old female NOD mice were in jected i.p. daily with 0.1 mg of rPdx1 (n=20) for 12 weeks or with saline (n=20). Blood glucose and body weight were monitored regularly. IPGTT, serum insulin levels, morphology and tissue insulin content were examined in NOD mice between 20 25 weeks of age.

PAGE 93

93 Incidence of Diabetes 0 20 40 60 80 100 13579 1113151719212325272931 Time in weeks Percentage Diabetic Pdx1 group Ctrl group 10 15 20 25 30 35 40 Pdx1 treatment Incidence of Diabetes 0 20 40 60 80 100 13579 1113151719212325272931 Time in weeks Percentage Diabetic Pdx1 group Ctrl group 10 15 20 25 30 35 40 Incidence of Diabetes 0 20 40 60 80 100 13579 1113151719212325272931 Time in weeks Percentage Diabetic Pdx1 group Ctrl group 10 15 20 25 30 35 40 Incidence of Diabetes 0 20 40 60 80 100 13579 1113151719212325272931 Time in weeks Percentage Diabetic Pdx1 group Ctrl group Incidence of Diabetes 0 20 40 60 80 100 13579 1113151719212325272931 Time in weeks Percentage Diabetic Pdx1 group Ctrl group 10 15 20 25 30 35 40 Pdx1 treatment Figure 4-2. Effect of rPdx1 (12weeks) on the onset of diabetes in NOD mice. Daily treatment of prediabetic female NOD mice with rPdx1 for 12 weeks resulted in significant protection of the mice from the onset of diabetes (90% at 33 weeks, and 80% at 39 weeks, and 70% at 40 weeks). The saline control mice became 95% hyperglycemic (diabetic) at age of 25 week.

PAGE 94

94 Figure 4-3. Blood glucose levels of rPdx1 (12weeks) treated NOD mice. Daily treatment of prediabetic female NO D mice with rPdx1 for 12 weeks resulted in maintenance of normoglycemia in 70% of mice at 40 weeks. 3 out of 10 mice became hyperglycemic (>250 mg/dL) at age 17, 35 and 40 weeks ( Panel A). The salinetreated control mice became 95% hyperglycemic (diabetic) at the age of 25 weeks (Panel B) A B

PAGE 95

95 Figure. 4-4. Body weights of rPdx1 (12weeks) treated NOD mice. Daily treatment of pre diabetic female NOD mice with rPdx1 for 12 weeks resulted in increase in body weight (P anel A). The saline treated control mice progressively lost body weights or could not maintain their body weights (P anel B ). 0 5 10 15 20 25 30 10121416182022242628303234363840 1L 1R 1B 1N 2L 2R 2B 2N 3L 3R 0 5 10 15 20 25 30 101112131415161718192021222324 6L 6R 6B 6N 7L 7R 7B 7N 8L 8R 8B 8N 9L 9R 9B 9N 10L 10R 10B 10N Time points in weeks Time points in weeksBody weights Body weights 0 5 10 15 20 25 30 10121416182022242628303234363840 1L 1R 1B 1N 2L 2R 2B 2N 3L 3R 0 5 10 15 20 25 30 101112131415161718192021222324 6L 6R 6B 6N 7L 7R 7B 7N 8L 8R 8B 8N 9L 9R 9B 9N 10L 10R 10B 10N 0 5 10 15 20 25 30 10121416182022242628303234363840 1L 1R 1B 1N 2L 2R 2B 2N 3L 3R 0 5 10 15 20 25 30 101112131415161718192021222324 6L 6R 6B 6N 7L 7R 7B 7N 8L 8R 8B 8N 9L 9R 9B 9N 10L 10R 10B 10N Time points in weeks Time points in weeksBody weights Body weights A B

PAGE 96

96 Pdx1 treatment (4 wks) 0 20 40 60 80 100 123456789 101112131415161718192021 Percentage Diabetic Pdx1 (4 wks) Ctrl Pdx1 treatment 10 15 20 25 30 Pdx1 treatment (4 wks) 0 20 40 60 80 100 123456789 101112131415161718192021 Percentage Diabetic Pdx1 (4 wks) Ctrl Pdx1 treatment Pdx1 treatment (4 wks) 0 20 40 60 80 100 123456789 101112131415161718192021 Percentage Diabetic Pdx1 (4 wks) Ctrl Pdx1 treatment (4 wks) 0 20 40 60 80 100 123456789 101112131415161718192021 Percentage Diabetic Pdx1 (4 wks) Ctrl Pdx1 treatment Pdx1 treatment 10 15 20 25 30 Figure 4-5. Effect of short term rPdx1treatment (4 weeks) on the onset of diabetes in NOD mice. To determine if shortterm treatment with rPdx1 could prevent the onset of diabetes, ten week old female NOD mice were administered 0.1 mg rPdx1 i.p. for 4 weeks (n=10). Daily treatment of pre diabetic female NOD mice with rPdx1 for 4 weeks resulted in significant protection of the mice from the onset of diabetes (70% at 30 weeks).

PAGE 97

97 Figure 4-6. Blood glucose levels of rPdx1 (4weeks) treated NOD mice. Daily treatment of pre diabetic female NOD mice with rPdx1 for 4 weeks resulted in maintenance of normoglycem ia in 70% of mice at 3 0 weeks.

PAGE 98

98 Pdx1 treatment (8 wks) 0 20 40 60 80 100 123456789 101112131415161718192021 Percentage Diabetic Pdx1 (8wks) Ctrl 10 15 20 25 30 Pdx1 treatment Pdx1 treatment (8 wks) 0 20 40 60 80 100 123456789 101112131415161718192021 Percentage Diabetic Pdx1 (8wks) Ctrl 10 15 20 25 30 Pdx1 treatment (8 wks) 0 20 40 60 80 100 123456789 101112131415161718192021 Percentage Diabetic Pdx1 (8wks) Ctrl 10 15 20 25 30 Pdx1 treatment (8 wks) 0 20 40 60 80 100 123456789 101112131415161718192021 Percentage Diabetic Pdx1 (8wks) Ctrl 10 15 20 25 30 Pdx1 treatment (8 wks) 0 20 40 60 80 100 123456789 101112131415161718192021 Percentage Diabetic Pdx1 (8wks) Ctrl 10 15 20 25 30 Pdx1 treatment Figure 4-7. Effect of short term rPdx1treatment (8 weeks) on the onset of diabetes in NOD mice To determine if short-term treatment with rPdx1 could prevent the onset of diabetes, ten week old female NOD mice were administered 0.1 mg rPdx1 i.p. for 8 weeks (n=10). 70% of the rPdx1-treated mice maintained normoglycemia upto 30 weeks.

PAGE 99

99 Figure 4-8. Blood glucose levels of rPdx1 (8weeks) treated NOD mice. Daily treatment of prediabetic female NOD mice with rPdx1 for 8 weeks resulted in maintenance of normoglycemia in 70% of mice at 30 weeks. (Panel A). The salinetreated control mice became 90% hyperglycemic (diabetic) at the age of 30 weeks (Panel B). A B A B

PAGE 100

100 IPGTT 0 50 100 150 200 250 300 350 400 450 05 153060120 Time in minutes Blood Glucose (mg/dl) Pdx1 Ctrl Figure 4-9. Intraperitoneal glucose tolerance test IPGTT (n=4/group). Mice were injected with 2 mg/g of glucose i.p. Blood glucose was monitored at 0, 5, 15, 30, 60, 120 min. The rPdx1 treated mice at 22 weeks demonstrated better glucos e handling ability than the agematched diabetic control mice.

PAGE 101

101 Serum Insulin levels 0 1 2 3 4 5 6 Normal Pdx1 Ctrl Serum Insulin (ug/L) Serum Insulin levels 0 1 2 3 4 5 6 Normal Pdx1 Ctrl Serum Insulin (ug/L) * Figure 4-10. Serum insulin measurements as determined by ELISA Glucosestimulated (15 min) serum samples were collected from rPdx1 treated NOD mice (22 wks ), diabetic control NOD mice (22 wks), and normal NOD mice (9 wks). rPdx1treated mice have an 8-fold higher serum insulin level compared with the diabetic control mice. (n=4/group) ** = P<0.05; Students ttest.

PAGE 102

102 Fig ure 4-11. Haematoxylin & Eosin staining and immunohistochemistry of pancreatic tissue sections. H & E staining of pancreatic tissue sections from rPdx1 treated mice showed many large islets with numerous insulinstained beta cells. On the contrary, contr ol mice had much fewer and smaller islets and most of the islet cells contained glucagonpositive cells

PAGE 103

103 Pancreatic insulin content 0 500 1000 1500 2000 2500 Insulin content (ng) Normal mice Pdx1 group Ctrl group Liver insulin content 0 100 200 300 400 500 600 700 800 Insulin content (ng/g) Ctrl Pdx1 Liver insulin content 0 100 200 300 400 500 600 700 800 Insulin content (ng/g) Ctrl Pdx1 * Figure 4-12. Pancreas and liver tissue insulin levels as determined by ELISA. Tissue insulin was extracted from whole organs of pancreases and livers, measured by ELISA, and normalized with wet tissue weight. Insulin measurements in the pancreas ( Left ) and liver (right ) extracts of rPdx1treated mice (n=4) are significantly higher than the control diabetic mice. ** = P<0.05; Students ttest. A B

PAGE 104

104 Figure 413. Detection of Pdx1 antibodies by ELISA in the NOD mice. Serum samples were collected from both female control NOD and preand postPdx1 treated NOD mice at indicated ages. Presence of anti -Pdx1 antibodies was determined by ELISA. High levels of Pdx1 antibodies were detected in Pdx1treated mice. However, control mice also had various levels of anti-Pdx1 autoantibodies (A) ( panel A ). To determine if the antibodies are specific to NOD autoimmune diabetic mouse model, serum samples were collected from other mouse strains such as NOD -SCID, C57/B6 and Balb/C ( Pane l B ). The anti-Pdx1 autoantibodies were highly specific to NOD strain as determined by ELISA. A B

PAGE 105

105 rPdx1 Balb/c Western blottingCoomassie blue gel Pdx1 AA( -) Pdx1 AA(+) ELISA Pdx1 AA( -) NOD mouse sera 1 23rPdx1 rPdx1 Balb/c Western blottingCoomassie blue gel Pdx1 AA( -) Pdx1 AA(+) ELISA Pdx1 AA( -) NOD mouse sera 1 23rPdx1 Figure 4-14. Co nfirmation of antiPd x1 antibody in the NOD mice by western blotting. AntiPdx1 antibody was confirmed by western blot using purified Pdx1 protein as antigen. The membrane was probed with control serum with high-titer for Pdx1 antibody (lane 2) and serum with basal titer (Lane 3). A m ouse serum from BALB/c mice was used as negative control for Pdx1 antibody.

PAGE 106

106 Figure 4-15. Determination of antigenic epitope by western blot. I llustration of full-length Pdx1 and truncated prot eins A mix of full -length and truncated proteins was run on SDSgel. The membrane was probed with either rabbit polyclonal serum, or sera from NOD mice (6L, 4L). The polyclonal sera detected all the proteins bands while the NOD sera detected only the full-length indicating that the epitope is in the Cterminal 83 amino acids ( panel A ). The C-terminal 83 amino acid portion was expres sed as GST fusion protein. P anel B is Coomassie blue stained gel and th e results of blotting that were using two autoantibody A(+) mouse sera. Arrows indicate the positions of Pdx1, P83GST or GST A B

PAGE 107

107 Fig ure.4-16. Relationship between Pdx1 autoantibody l evels and onset of diabetes. 5 -week old female NOD mice were purchased (n=20) and serum samples were collected biweekly. Pd1 autoantibodies were detected by ELISA and expressed in OD values at 450 nM. Blood glucose levels were monitored weekly via tail vein snipping. Three representative mice data is shown here.

PAGE 108

108 T-cell proliferation assay 0 2000 4000 6000 8000 10000 12000 14000 16000 18000 None CD3 GST Ins Pdx1 P83 cpm Pdx1 Ctrl Figure 4-17. Antigenstimulated l ymphocyte proliferation. Splenocytes were harvested from the rPdx1treated and control mice. One million cells were seeded into a 96 well plate in triplicates. The cells were treated with anti -CD3, insulin, and Pdx1 for 48 hours followed by incubation with [3H] thymidine for an additional 24 hours. Splenic Tcell lymphocyte proliferation was st imulated in control mice by rPdx1 and insulin, whereas antigen stimulated splenic T -cell lymphocyte proliferation was significantly lower in 4 week -rPdx1treated mice c ompared with control mice.

PAGE 109

109 Figure 4-18. Transfer of splenocytes from donor BDC2.5 mice to the recipient NOD mice. The transfer of CFSE labeled splenocytes from donor BDC2.5 mice into the recipient NOD mice pretre ate d with rPdx1 or saline (4 weeks) demonstrated a decrease in donorderived CD4 -T-cell proliferation in the draining pancreatic lymph nodes of rPdx1 treated mice.

PAGE 110

110 Pdx1 1 283 188 203 1 79 transactivation 146 206 homeobox 191 196 DNA Binding Antennapedia domain Pdx1 1 283 Pdx1 Pdx1 1 283 188 203 188 203 1 79 transactivation 1 79 transactivation 146 206 homeobox 191 196 DNA Binding Antennapedia domain 146 206 homeobox 146 206 homeobox 191 196 DNA Binding 191 196 DNA Binding Antennapedia domain Figure 4-19. Illustration of Pdx1 and mutant Pdx1proteins. A short 16 amino acid sequence was deleted between amino acids 188 -203 of the Pdx1 protein, which eliminated both DNA binding and the antennapedia-like protein transduction domain. Thus a biologically inactive mutant Pdx1 protein was produced.

PAGE 111

111 mut-Pdx1 treatment (8 wks) 0 20 40 60 80 100 123456789 101112131415161718192021 Percentage Diabetic mut-Pdx1 (8wks) Ctrl Pdx1(8 Wks) 10 15 20 25 30 mut-Pdx1 treatment (8 wks) 0 20 40 60 80 100 123456789 101112131415161718192021 Percentage Diabetic mut-Pdx1 (8wks) Ctrl Pdx1(8 Wks) 10 15 20 25 30 Figure 4-20. Effects of mutant -Pdx1 on the onset of diabetes. Ten week old female NOD mice were treated with full-length Pdx1 (n=10), mutant Pdx1 (n=10), or saline (n=10). Incidence of diabetes was monitored until 30 weeks. By 30 wks, both full-length Pdx1and mut-Pdx1 treatments prevented/delayed the onset of diabetes in 70% of NOD mice whereas 80% of the control mice became diabetic.

PAGE 112

112 CHAPTER 5 MOLECULAR MECHANISM OF THE ROLE OF PDX1 IN BETA CELL PROLIFERATION Introduction Pancreatic and duodenal homeobox 1(Pdx1) is a transcriptional factor that plays a crucial role in pancreas development and beta cell differentiation during embryogenesis(35;36) It plays a m ajor role in be ta cell ma turation, maintenance and regulation of gene expression in the beta cell (35;37;38). During embryogenesis, Pdx1 gene expression appears in the duodenum e arly in development while in the adult pancreas, Pdx1 gene expression is predominantly restricted to the insulin producing islet beta cells and a subset of somatostatin producing delta cells(39-41). Mice with a n ull mutant of Pdx1 resulted in agenesis of pancreas with hyperglycemia and could not survive after birth (35). Pdx1 heterozygous mutant mice failed to increase betacell mass in response to insulin resistance (112). Pdx1 has been found to play key role in beta cell neogenesis and insulin production(38). Pdx1 is a homeodomain transcription factor that binds to specific sequences of its target genes and activates them by recruiting other co transcriptional factors such as NeuroD MafA, and Pax4. Conditional expression of Pdx1 in transgenic mice demonstrated its role in beta cell regeneration (37) Previous studies using growth factors such as GLP -1, extendin4, and INGA P have shown that beta cell regeneration is accompanied by increase in levels of Pdx1 protein (98;135). Our previous studies using the STZ-induced diabetic mouse model demonstrated that rPdx1 treatment promoted beta cell proliferation (123). Studies on partial pancreatect omy have demonstrated an increased Pdx1 expression is associated with beta cell proliferation (45;108). However the molecular mechanism s of the role of Pdx1 in beta cell regeneration is not known yet. Several studies were conducted to understand the functional role of cell cycle proteins of the beta cells which include cyclins, c yclin -dependent kinases, and c yclin dependent kinase

PAGE 113

113 inhibitors(136;137) There is an age dependent decline in the beta cell self renewal capacity (138) due to the activation of Ink inhibitors with increasing age (139). Pr evious studies have shown that cyclin A2 (135), cyclin B1 (140), cyclin E1 (141), and cyclin D2 (142) are invo lved in beta cell proliferation However the assoc iation between Pdx1 protein and cyclins in beta cell regeneration is not established yet Materials and Methods Cell Culture INS -1 cells were grown in RPMI 1640 (Sigma ) (430 mL ) with 10% fetal bovine serum supplemented with 5 mL of HEPES (1M), 5 mL of L -glutamine (200 mM), 5 mL of Sodium pyruvate (100 mM), 5 mL of Pen/Strep, 454 L of 2 -Mercaptoethanol (1000x) and 2 mL Kanamycin (50 mg/mL ) per each bottle (430 mL ) of media. 3T3 cells were grown in Dulbecco's Modified Eagle Medium (Sigma) supplemented with 10% FBS (55 mL ) and 2 mL Kanamycin (50 mg/mL ). Design of siRNA for the Pdx1 T ranscript 21mer siRNA was designed for specific binding to mRNA at three different locations (Fig. 5-1). Sense Strand (A): GGAAGAUAAGAAACGUAGUUU mRNA loc. 712 Sense Strand (B): GGAUCAUGAGGCUUAACCUUU mRNA loc. 1033 Sense Strand (C): CGAGCAAUCUAAGGUUGAGUU mRNA loc. 1336 siRNA M ediated Knockdown of Pdx1 Transcript in INS1 Cells The INS1 cells (2 x 105 cells) were grown upto 60% confluence in 6 well plates at 37 C in a 5% CO2 incubator. CA) was diluted ( amine free minimal medium in a separate tube. Next the siRNA solution was added directly to the

PAGE 114

114 diluted t ransfection r eagent. The solution was mixed gently by pipetting the solution up and down and incubated for 30 minutes at room temperature. The cells were washed once with 2 mL of serum free minimal medium. The medium was aspirated before proceed ing to the next step. For e ach transfection, 0.8 mL of siRNA t ransfection mix was added to each well. The cells were incubated for 5-7 hours at 37 C in a 5% CO2 incubator Later the t ransfection mix was removed and replaced with normal growth medium. The cells were harvested at the end of 48, 72, and 96 hours. Western B lotting with anti Pdx1 and anti tubulin Antibody The cellular protein lysates from 6 well plates were c ollected using cell lysis RIPA buffer after 72 and 96 hours of treatment with siRNA The cellular total protein content was quantified using spectrophotometer. 50 g of protein ( from cel ls treated with Pdx1 siRNA and C trl siRNA ) was loaded onto SDS -gel. The gel was run at 80V until the dye front migrated through the gel. After transfer and overnight blocking (1% milk powder in PBST ), the membrane was incubated with rabbit polyclonal anti-Pdx1 antibody (1:1000) for 1hr at room temperature. After washing the membrane with PBS for 15 min, it was incubated with anti-rabbit IgG conjugated to HRP (1:20,000) (Amersham Biosciences) for 1 hour at room temperature. After development, the membrane was stripped off with strip buffer ( 2% SDS, 100 mM beta-mercaptoethanol, 50 mM Tris, pH 6.8) by incubating at 70C for 30 min. The membrane was then blocked over night and incubated with anti-t ubulin antibody ( 1:5000; Abcam ) followed by anti-mouseIgG conjugated with HRP (1:5000; Cayman Chemicals). BrdU Proliferation A ssay Four thousand cells were plated in 96 well plate s in triplicates and allowed to grow until they became 50% confluent. 0.75 g of siRNA w as added to each well in triplicates and the cells were incubated for 48 or 72 hours depending on the preferred harvesting time. 50 M of

PAGE 115

115 BrdU was added before the last 18 hours of incubation. The cells were fixed with 4% paraformaldehyde in vitro for 30 min at 4C. Next, the samples were incubated in 0.1 M PBS (pH 7.4) + 1% Triton X-100 + 1M Glycine + 5% goat serum for 1 hour prior to overnight incubation at 4C with mouse antiBrdU (1:100; BD biosciences). The plate was washed gently thrice with PBS followed by incubation with secondary anti -mouse IgG conjugated with HRP (1:4000; Cayman Chemical Laboratories). The we lls were then incubated with TMB solution (Cell signaling) for 10 min. The reaction was stopped with stop solution (Cell signaling). The plate was read at 450 nm using 650 nm as reference wave length. Real Time PCR cDNA from INS 1 cel ls (b oth Pdx1 siRNA and C trl siRNA treated) was subjected to three independent PCR reactions. Each reaction w as performed in duplicate in a thermocycler sequence detection system (DNA engine opticon 2; MJ Research, Springfield, MO) using SYBR green (Qiagen, Valencia, CA). RNA was extracted in RNase free tubes using Trizol reagent (Invitrogen). cDNA was synthesized from 2 g of total RNA using S uperscript reverse transcriptase enzyme (Invitrogen) with random hexamer primers according to the manufacturers protocol. The expected amplified product using specific primers listed in Table 5 -1, was confirmed by agarose gel electrophoresis. Conditions for realtime PCR were as follows: after initial denaturation at 95C for 15 min to activate the enzyme, 35 cycles of PCR (denaturation 0.5 min at 94C, annealing 0.5 min at 58C, and elongation 0.5 min at 72C with a final extension for 5 min at 72C) were carried out. Each gene was tested three times. The single band amplification was verified by observing the melting curve and by agaros e gel electrophoresis. Relative gene expression in INS -1 cells treated by Pdx 1 siRNA and Ctrl siRNA was calculated by the 2Ct method. More details about calculations were discussed in c hapter 3.

PAGE 116

116 Construction of pGL4.10Cyclin B1 PromoterLuciferase V ector The -991 bp sequence of the human c yclin B1 promoter was amplified using following primers Forward CTCGAGGCTGGTGTGT TTTGA GGAGTA; ReverseAGATCTCCAAGGACCTACACC CAGCAG. Human genomic DNA was used as a template for PCR amplification. Restrict ion sites Xho1 and BglII were introduced using forward and reverse primers respectively. Annealing temperature was programmed at 56C for 30 s ec and the amplification for 30 cycles. The PCR product (~1000 bp) was cloned into the XhoI and BglII site s of the pGL4.10 luciferase reporter vector. The shorter version ( -551 bp cyclin B1 cloned into pGL2 vector ) was a kind gift from Dr. Karen Katula, Univ. of North Carolina, Greensboro, NC. The Nkx6.1 promoter with l uciferase reporter and CMV-human Nkx6.1 constructs were obtained as gift from Dr. Raghavendra Mirmiras lab and CMV-human Pdx1 was purchased from O pen biosystems AL Analysis of Promote r Constructs for Activation by Pdx1 or Nkx6.1 u sing L uciferase Reporter Assay s NIH 3T3 cells were grown in 6 well plates until they became 50% confluent. For each well, the cells were co -transfected with 0.5 g of Tk renilla plasmid (as internal control) a nd 1 g of Nkx6.1/ cyclin B1 promoter driven luciferase plasmid. The cells were treated with 0.5 g of test plasmids ( CMV -Pdx1, CMV -Nkx6.1) or pcDNA3 vector control. The cells were harvested after 24 hrs in passive lysis buffer (Promega) The lysates were analyzed using dual luciferase assay k it (Promega ). Details of the transfection protocol and luciferase activity measurements were described in chapter 2.

PAGE 117

117 Results Phenotype of INS1 Cells Treated with Pdx1 siRNA INS 1 cells were treated with 1 g of ei ther C t rl siRNA or Pdx1 siRNA. A phenotype change was observed in cells treated with Pdx1 siRNA from flat and polygonal to round and smaller cells as shown in Fig. 5.2. T he cells treated with Ctrl siRNA remained flat and polygonal. The phenotypes become more pronounced from 24 hours to 72 hours. This indicates the possibili ty of cell cycle arrest mediated by Pdx1 siRNA. siRNAmediated Knockdown of Pdx1 Transcript s in INS 1 Cells To study the eff ects of Pdx1 protein on cell cycle regulation, Pdx1 gene expre ssion was depleted in INS 1 cells using siRNA against Pdx1 transcript. The decre ase in gene expression was of Pdx1 was observed at both the transcript and protein level using real time PCR (Fig. 5.5) and western blot ting (Fig. 5.3) respectively Both real time PCR and western blot ting confirmed more than 70% decrease in the gene expression Decrease in Cell Proliferation of Pdx1 K nockdown Cells In order to study if knockdown of Pdx1 has any significant effect on cell proliferation, an in vitro proliferatio n assay was conducted using the BrdU incorporation method. I NS 1 cells were treated with 1 g of Pdx1 siRNA or Ctrl siRNA for a period of 48 or 72 hours. The final 18 hours were incubated with BrdU The BrdU proliferation assay demonstrated that the Pdx1 siRNA treated cells showed decrease in the proliferation to 59.84% and 70% at 48 and 72 hours respectively as shown in Fig. 5.4. This validates that the knockdown of Pdx1 gene expression indeed reduced proliferation of INScells, thus demonstrating th at Pdx1 is essential for the beta cell proliferation

PAGE 118

118 Analysis of th e Gene Expression of Beta Cell Specific transcription factors and Cell Cycle G enes The decrease i n the cell proliferation of Pdx1 knockdown cells could be attributed to decreased activity of cell cycle proteins and other bet a cell specific transcription factors involved in cell cycle progression, perhaps at the gene expression level In order to study the effects of Pdx1 siRNA, specific primers were designed to observe the downstream effects on beta cell specific transcription factors and cyclin genes. In order to study the association of Pdx1 protein with cell cycle regulators cDNA was synthesized from the RNA extracted from the cells treated with either Pdx1 siRNA or c trl siRNA. The r eal time PCR assay demonstrated a significant decrease in the gene expression of beta cell transcription factors such as Nkx6.1 (50%) and cyclin genes such as c yclin B1 (40%) and c yclin E1 (65%) (Fig. 5-5). Analysis of Cyclin B1 Promoter using CMVPdx1 Bioinf ormatic analysis of the human cyclin B1 promoter has revealed multiple potential Pdx1 protein binding sites. In order to verify this observation experimentally, NIH -3T3 mouse fibroblast cells were transfected with the 1 g of cyclin B1 promoterluciferase reporter vector. Th ese cells were simultaneously co transfected with pcDNA3 null vector or CMV Pdx1 plasmid We observed no change in the activity of cyclin B1 promoter when cotransfected with CMV Pdx1 ( Fig. 5-6) suggesting that Pdx1 protein may not inter act directly with cyclin B1 promoter. Nkx6.1 Activation of C yclin B1 Promoter Bioinformatic analysis of the human cyclin B1 promoter has revealed potential binding sites for Nkx6.1. We also observed a decrease in the transcript levels of Nkx6.1 in Pdx1 knockdown cells (Fig. 5-5). We therefore sought to determine the association between Nkx6.1 and cyclin B1 promoter. Cyclin B1 promoter (-991bp) luciferase reporter vector was co t ransfected with either pcDNA3 null vector or CMV -Nkx6.1 plasmid. A 5 fold increase in cyclin

PAGE 119

119 B1 promoter activity was observed when cotransfected with CMV Nk x6.1 plasmid (Fig. 5-7) demonstrating that Nkx6.1 protein could bind to the c yclin B1 promoter. A truncated version of the cyclin B1 promoter (-551bp) with no putative binding site for Nkx6.1, when cotransfected with either pcDNA3 or with CMV -Nkx6.1 plasmid did not demonstrate any i ncrease in activity (Fig. 5-7). Pdx1 A ctivation of Nkx6.1 Promoter We determined that Pdx1 did not activate cyclin B1 directly, however, Nkx6.1 could directly activate cyclin B1 promoter. In order to determine the association between Pdx1 and Nkx6.1, the Nkx 6.1 promoter was studie d using luciferase assay in NIH 3T3 fibroblast cel ls. Nkx6.1 promoterluciferase reporter vector was co transfected with either pcDNA3 null vector or CMV Pdx1 plasmid. There was a 2.5 fold increase in the Nkx6.1 promoter activity when cotransfected with Pdx1 plasmid demonstrating that Pdx1 protein activates Nkx6.1 promoter (Fig. 5-8). Discussion Pdx1 is a beta cell specif ic transcriptional factor required for the regeneration and maintenance of beta cell in the adult stage Du ring the post natal stage, beta cells within a normal islet have a finite life span with slow turn over and with majority of the cells in the restin g phase of cell cycle However, the dynamics of beta cell proliferation dramatically change upon injury or mitogenic stimulation (143). P roliferation of beta cells is triggered by mitogens that in turn initiate an intracellular signaling between set of beta cell specific transcriptional factors and cell cycle machinery. One such important signaling pathway is the i nsulin signaling pathway where insulin binds to the insulin receptor that leads to phosphorylation of tyrosine residues This further leads to the activation of the PI -3 kinase-Akt signaling pathway which in turn phosphorylates FoxO protein and results in the activation of Pdx1 gene expression.

PAGE 120

120 Previous studies on partial pancreatectomy have demonstrated that an increased Pdx1 expression is associated with beta cell prol iferation (45). T reatment of diabetic animal models with mitogenic agents such as GLP -1 (121;122), Extendin4 (120) INGAP (98) or rPdx1(123), results in upregulation of Pdx1. All these studies suggest that local upregulation of Pdx1 above a threshold level is ne cessary to activate downstream events that regulate beta cell proliferation. The question that remains to be investigated is how Pdx1 interacts with beta cell cycle ma chinery to induce proliferation. Pdx1 is a homeodomain transcription factor that interac ts with other transcription factors and cofactors such as E47/Pan1, BETA2/NeuroD, p300, hnf1, and Pax6 (144 -148) to perform specific functions within beta cell T he r eal time PCR has demonstrated a significant decrease in the levels of Nkx6.1, cyclin B1, and cyclin E1 in the Pdx1 knockdown c ells ( Fig 5-5). However, the other cyclins such as cyclin A2 and c yclin D1 m ay be playing a ro le in beta cell regeneration through multiple signaling pathways involving other beta cell specific transcription factors. Cyclin B1 is the regulatory subunit of serine/threonine kinase Cdc2 (cdk1) and is essential for the entry into mitosis. Our stud ies have shown that Pdx1 does not have a direct interaction with cyclin B1 (Fig. 5-6), however, Nkx6.1 can activate cyclin B1 promoter (Fig. 5-7). At the upstream of Nkx6.1, Pdx1 can activate Nkx6.1 promoter activity (Fig -58). These observations may be one among several other cell cycle events that could be occurring within the islet beta cells. This does not however, rule out the possibility of involvement of other s ignaling pathways and transcriptional factor s in beta cell proliferation. We conclude that beta cell proliferation is induced by local upregulation of Pdx1 protein by upstream mitogenic signals. Pdx1 protein further autoregulates its own gene expression which results in amplified levels of Pdx1 protein (113;123). Once the levels reach above the threshold level Pdx1 activates Nkx6.1 gene expression that results in increased levels of Nkx6.1 protein

PAGE 121

121 which in turn interacts with cy clin B1 promoter to trigger cell entry into the mitotic phase (Fig. 5-9).

PAGE 122

122 Table 5 -1. Real time PCR Primer name, sequences, size, GenBank #, and PCR condition Genes Forward primer Reverse primer PCR size GenBank Acc. No Tm (C) Cycle No. Actin ATTGAAC ACGGCATTGTCACCA CTGGATGGCTACGTACATGGCT 200 NM_031144. 2 58 35 Nkx6.1 AAACGAAGTACTTGGCAGGACC TAATCGTCGTCGTCCTCCTCGTT 167 NM_031737. 1 58 35 PDX1 TCCACCAAAGCTCACGCGTGG GAATTCCTTCTCCAGCTCCAGCAG 190 NM_022852. 3 58 35 Cyclin A2 TGAAGAGGCAACCAGACATCAC AGCCAAAT GCAGGGTCTCAT 178 NM_053702. 2 58 35 Cyclin B1 TGAGCCTGAGCCTGAACCTG CTGCATCTACATCACTCACTGC 200 NM_171991. 2 58 35 Cyclin D2 CTGCAGAACCTGTTGACTATCGAGC GGTAATTCATGGCCAGAGGAAAG 194 NM_022267 .1 58 35 Cyclin E1 GCAATAGAGAAGAGGTCTGGAGGAT GTCCTGTGCCAAGTAGAATGTCT CT 182 NC_005100 58 35

PAGE 123

123 Figur es Figure 5-1. Location of 21 mer siRNAs on Pdx1 mRNA transcript. (A): GGAAGAUAAGAAACGUAGUUU mRNA loc. 712 (B): GGAUCAUGAGGCUUAACCUUU mRNA loc. 1033 (C): CGAGCAAUCUAAGGUUGAGUU mRNA loc. 1336

PAGE 124

124 Figure 5-2. Phenotype of INS1 cells treated with Pdx1 siRNA. The INS1 cells grown in serum free minimal medium w ere treated with Ctrl siRNA and Pdx1 siRNA for 48 hours. The cells treated with Pdx1 siRNA morphologically appeared round and small while the Ctrl siRNA treated cells appeared flat and polygonal (normal).

PAGE 125

125 Figure 5-3. Confirmation of Pdx1 knockdown using western blotting. INS 1 cells treated with ctrl siRNA and Pdx1 siRNA for 72 and 96 hours. The cell lysates were analyzed for Pdx1 protein l evels using anti -Pdx1 antibody and anti-tubulin antibody as loading control. 1 2 3 4

PAGE 126

126 Brdu proliferation assay 100 100 59.84 70 0 20 40 60 80 100 120 48 72 Time points (hrs) Percentage proliferation Ctrl siRNA Pdx1 siRNA Figure 5-4. Measurement of INS -1 cell proliferation using BrdU incorporation. INS1 cells were treated with Ctrl or Pdx1 siRNA for 48 and 72hrs. The final 18 hours were incubated with BrdU The cells were measured for BrdU incorporation as measured by ELISA using antiBrdU antibody.

PAGE 127

127 Change in Gene expression of cells treated with Pdx1 siRNA 0 0.2 0.4 0.6 0.8 1 1.2 Pdx1 Nkx6.1 Cyc A2 Cyc B1 Cyc D2 C yc E1 Relative change Ctrl siRNA PDx1 siRNA Figure 5-5. Analysis of relative change in the gene expression. Real time PCR was performed using specific primers to analyze the change in gene expression in cells treated with actin primers were used as internal control.

PAGE 128

128 Figure 5-6. Analysis of cyclin B1 promoter using CMV Pdx1 The 3T3 cells were transfected with c yclin B 1 promoter (-991 bp) driving l uciferase gene construct. The cells were co transfected with either CMV Pdx1 plasmid. No change in the activity levels was observed with increased concentration of CMV -Pdx1 plasmid. 0 0.2 0.4 0.6 0.8 1 1.2 1.4 0 0.10.5 125 CMV-Pdx1 Concentration (ug) Relative Luciferase Value

PAGE 129

129 pcDNA3 + 521CycB1Luc Nkx6.1+ 521CycB1Luc pcDNA3 + 521CycB1Luc Nkx6.1+ 521CycB1Luc pcDNA3 + 521CycB1Luc Nkx6.1+ 521CycB1Luc pcDNA3 + 521CycB1Luc Nkx6.1+ 521CycB1Luc Figure 5-7. Nkx6.1 activation of Cyclin B1promoter ( Panel A ) The 3T3 cells were transfected with c yclin B 1 promoter (-991 bp) driving l uciferase gene construct. The cells were co transfected with either pcDNA3 null vector or Nkx6.1 cDNA plasmid. I ncreased activation was observed in cells treated with Pdx1 cDNA plasmid). ( Panel B ) The 3T3 cells were transfected wi th c yclin B1 short promoter (-551 bp) driving l uciferase gene construct. The cells were co transfected with either pcDNA3 null vector or Nk x6.1 cDNA plasmid. No change in the activity levels wa s observed between the two treatments pcDNA3 + 921CycB1Luc Nkx6.1 (0.5ug) + 921CycB1Luc pcDNA3 + 921CycB1Luc Nkx6.1 (0.5ug) + 921CycB1Luc pcDNA3 + 921CycB1Luc Nkx6.1 (0.5ug) + 921CycB1Luc A B

PAGE 130

130 Figure 5-8. Pdx1 activation of Nkx6.1 promoter. The 3T3 cells were transfected with Nkx6.1 promoter driving l uciferase reporter construct. The cells were co transfected with either (1) pcDNA3 null vector or (2) Pdx 1 cDNA plasmid. I ncreased activation was observed in cells treated with Pdx 1 cDNA plasmid.

PAGE 131

131 Figure 5-9. Chain of events triggered by Pdx1 towards beta cell cycle pr ogression. Pdx1 protein activates its own promoter to increase Pdx1 levels. The increased pdx1 levels in turn activate Nkx6.1 promoter which further binds to cyclin B1 promoter to promote cell cycle progression into mitotic phase. Pdx1 promo ter

PAGE 132

132 CHAPTER 6 FUTURE STUDI ES Reversal of Streptozotocin induced Diabetes in Mice by Cellular Transduction with Recombinant Pancreatic Transcription Factor, Pancreatic Duodenal H omeobox-1 Future Studies This study explored a novel approach for treatment of diabetes in STZ -induced diabete s mod el. This approach has exploited three properties of Pdx1 protein 1) It is a transcription factor that promotes beta cell regeneration and liver cell transdifferentiation into IPCs 2) It has a 16 amino acid inbuilt protein transduction domain, and 3) It has ability to autoregulate its own gene expression. All the abov e properties make Pdx1 protein an ideal candidate molecule to promote beta cell regeneration and liver cell transdifferentiation into IPCs. Beta cell regeneration is an intriguing p henomenon that dramatically shifts the abil ity of the body to maintain glucose homeostasis. There are multiple theories regarding the pattern of beta cell regeneration. Of these, self duplication/replication of existing beta cells(67;149) and neogenesis from pancreatic ducts (150 -152) are believed to be the most common ways by which beta cell mass increases. The other theories include recapitulation of embryonic development(153;154) extra pancreatic stem cell source such as bone marrow (31), and exocrine cell transdifferentation into beta cell (155) It would be interesting to dissect the p attern of beta cell regeneration induced by rPdx1 protein therapy. The Cre -Lox and /or PulseChase approaches in transgenic mice will provide an unambiguous conclusion of the pattern of beta cell regeneration. In a clinical setup, Pdx1 therapy would be ideal for type 2 diabetes patients. However, the STZ-induced diabetic model does not entirely simulate the type 2 diabetic condition. The future study should determine the therapeutic effects of Pdx1 protein in type 2 diabetic mouse models such as BB rat, Ob/Ob mice and db/db mice. These are genetic models of type 2 diabetes with

PAGE 133

133 leptin or leptin receptor deficiency The homozygotes of the ob/ob strains are leptin deficient mice. They become obese and severely diabetic consequencing in the regression of islet s and die prematurely They also exhibit hyperphagia, glucose intolerance, elevated plasma insulin, subfertility and impaired wound healing. Injection of recombinant leptin into obese homozygotes sharply reduces their body weight, decreases food intake, i ncreases energy expenditure, and restores fertility in male mice. db/db homozygous mice become diabetic due to spontaneous mutation in the leptin receptor around three to four weeks of age. The mice become hyperglycemic at 4 -8 weeks of age. Homozygous mutant mice exhibit polyphagia, polydipsia, and polyuria. The other pathological findings exhibited include obesity, uncontrolled rise in blood sugar, and severe depletion of the insulin-producing betacells of the pancreatic islets with death occurring by 10 months of age. However, studies in genetic models of type 2 diabetes may be challenging due to the complexity of the disease pathogenesis. There are several factors that need to be considered such as insulin resistance, obesity, and beta cell stress. In order to characterize the therapeutic effects, a detailed metabolic profile including body weight, plasma insulin, blood glucose, cholesterol, tri -glycerides, and basic metabolic rate should be evaluated. Transdifferentiation of cells from one cell type to another(155) and induction of pluripotent stem cells from adult cells (156-159) have opened a new era for cell based therap y. However, extensive studies on the epigenetic modifications are yet to be conducted before we come out with therapeutic implication s(160;161) Similarly, i t will be interesting to understand the epigenetic changes that occur within the chromatin of the hepatocytes that transdifferentiated into IPCs This could be initiated by isolating transdifferentiated cells by laser capture micro dissection Epigenetic modifications that occur on Pdx1 as well as the i nsulin promoter and

PAGE 134

134 the role of histone acetyl transferases, deacetylases, and methyltransfera ses will provide insight into the mechanism of transdifferentiation Pdx1 Protein T herapy for the Treatmen t of Type 1 Diabetes in NOD M ice Future Studies This study has lead to the discovery of a novel autoantigen that could play a major role in the pathogenesis of type 1 diabetes. Immunotherapy with rPdx1 provides us with clues that Pd x1 autoantigen has a role in the pathogenesis of type 1 diabetes. We need to determine if Pdx1 is a primary auto antigen. The future studies should focus on extraction of Tcell clones with receptor s for the Pdx1 peptide. Adoptive transfer studies using such homogenous Tcell clones would lead to better understanding of the pathogenesis of type 1 diabetes. The discovery of a novel autoantigen in NOD mice will prove useful if we observe similar findings in human patients. A screening method needs to be de signed with hundreds of human serum samples. Based on the interpretations from NOD mice it is importan t to obtain the serum samples from high risk patients even before the onset of diabetes. The current screening methods include evaluation of insulin, GAD and islet cell a utoa ntibodies(162). Multiple antibody screening a pproaches are engaged in patients for better specificity, sensitivity and posi tive predictive value (163). However, the current screening methods can be enhanced with the discovery of new autoantibodies. It is therefore worthwhile to evaluate if anti-Pdx1 antibodies can be used as a potential biomarker marker for screening the onset of diabetes in population at risk A m echanism of induction of tolerance with rPdx1 immun otherapy needs to be established. Previous studies using Insulin (125) and GAD (11) immunotherapy have demonstrated the role of CD4 + CD25 +, Foxp3+ regulatory Tcells. Induction of t olerance is also mediated by the shif t in balance from the Th1 proinflammat ory immune response to Th2 antiinflammatory immune

PAGE 135

135 response. A detailed cytokine analysis of both pro-and antiinflammatory m ediators using the serum obtained from peripheral blood or i n vitro cytokine stimulation from the splenocytes or lymph nodes should be determined. Molecular Mechanism of the R ole of Pdx1 in B eta C ell P roliferation Future Studies Th e experiments to unders tand the role of Pdx1 in beta cell prolifera tion were conducted using Rat INS -1 beta cell line. It is a transformed cell line (164) where variation s in the activity of cell cycle machinery compared to the pancreatic i slet cells are possible. The future studies should inclu de Pdx1 knockdown studies in human pancreatic islets. In order to knockdown Pdx1 in pancreatic islets, a more efficient siRNA approach using viral vectors as opposed to use of oligomers must be designed to attain better knockdowns. Similarly, it is well k nown that the rate of beta cell replication decreases with increasing age (138;143). It is important to study how the cell cycle events differ between islets from young m ice and older mice with respect to Pdx1 interaction with cell cycle machinery. These in vitro studies must be further continued to understand the role of Pdx1 in beta cell replication in vivo The Pdx1 gene conditional knockout mouse would be an ideal model that will have synergistic advantages to providing insights into the role of Pdx1 in beta cell regeneration.

PAGE 136

136 APPENDIX A NOD MICE TRIAL 1 Table A -1. Mice database of trial 1 Animal Number Trial 1 Rx Duration of Rx Blood glucose before Sac Time of S ac Serum Formalin Fix Frozen Liver Insulin Ext Splenocytes 1L Pdx1 12 wks 96 40 wks Yes Yes Yes 1R Pdx1 12 wks 147 32 wks Yes Yes Yes 1B Pdx1 12 wks 600 35 wks 1N Pdx1 12 wks 600 20 wks Yes Yes Yes Yes 2L Pdx1 12 wks 117 33 w/die 2R Pd x1 12 wks 127 40 wks Yes Yes Yes 2B Pdx1 12 wks 122 22 wks Yes Yes 2N Pdx1 12 wks 318 40 wks Yes Yes Yes 3L Pdx1 12 wks 122 40 wks Yes Yes Yes 3R Pdx1 12 wks 134 40 wks Yes Yes Yes 3B Pdx1 16 wks 103 34 w/ die 3N Pdx1 16 wks 110 32 wks 4L Pdx1 16 wks 123 32 wks Yes Yes Yes 4R Pdx1 16 wks 412 35 w/ die 4B Pdx1 16 wks 600 40 wks Yes Yes Yes 4N Pdx1 16 wks 174 38 wks Yes 5L Pdx1 16 wks 136 32 wks Yes Yes Yes 5R Pdx1 16 wks 530 17 wks Yes Yes Yes 5B Pdx1 16 wks 97 25 w/die 5N Pdx1 16 wks 121 32 wks Yes 6L Saline 10 wks 600 20 wks Yes Yes Yes 6R Saline 12 wks 600 22 wks Yes Yes Yes 6B Saline 12 wks 327 23 wks Yes 6N Saline 12 wks 316 23 wks Yes 7L Saline 12 wks 600 22 wks Yes Yes Yes 7R Saline 12 wks 435 22 wks Yes Yes Yes 7B Saline 7 wks 528 17 wks Yes Yes Yes 7N Saline 11 wks 600 21 wks Yes Yes Yes 8L Saline 12 wks 94 24 wks Yes Yes 8R Saline 7 wks 600 17 wks Yes Yes Yes 8B Saline 8 wks 600 18 wks Yes Yes Yes 8N S aline 11 wks 600 21 wks Yes Yes Yes 9L Saline 12 wks 330 22 wks Yes Yes Yes 9R Saline 7 wks 600 17 wks Yes Yes Yes 9B Saline 8 wks 600 18 w/die 9N Saline 8 wks 600 18 w/die 10L Saline 8 wks 600 18 wks Yes Yes Yes 10R Saline 12 wks 6 00 22 wks Yes Yes Yes 10B Saline 12 wks 241 22 wks Yes Yes Yes 10N Saline 12 wks 600 22 wks Yes Yes Yes

PAGE 137

137 APPENDIX B NOD MICE TRIAL 2 Table B 1. Mice database of trial 2 Animal Number Trial 2 Rx Duration of Rx Blood glucose before Sac Time of Sac Serum Formalin Fix Frozen Liver Insulin Ext Splenocytes 11L Pdx1 4 wks 118 27 wks Yes Yes Yes 11R Pdx1 4 wks 112 28 wks Yes Yes Yes 11B Pdx1 4 wks 600 27 wks Yes Yes 11N Pdx1 4 wks 131 30 wks Yes Yes Yes 12L Pdx1 4 wks 124 20 wks Yes Yes Ye s, LNs 12R Pdx1 4 wks 108 20 wks Yes Yes Yes, LNs 12B Pdx1 4 wks 600 23 w/die 12N Pdx1 4 wks 102 20 wks Yes Yes Yes, LNs 13L Pdx1 4 wks 122 13R Pdx1 4 wks 415 23 wks 13B Pdx1 4 wks 103 13N Pdx1 8wks 110 14L Pdx1 8wks 146 32 wks Yes Yes Yes, LNs 14R Pdx1 8wks 118 20 wks Yes Yes Yes, LNs 14B Pdx1 8wks 252 20 wks Yes 14N Pdx1 8wks 109 20 wks Yes Yes Yes, LNs 15L Pdx1 8wks 124 25w/die 15R Pdx1 8wks 600 26 wks Yes 15B Pdx1 8wks 203 30 wks Yes Yes Y es 15N Pdx1 8wks 121 30 wks Yes Yes Yes 16L Mutant 8wks 154 30 wks Yes Yes Yes 16R Mutant 8wks 136 34 wks Yes Yes Yes 16B Mutant 8wks 600 26 wks Yes Yes 16N Mutant 8wks 199 30 wks Yes Yes Yes 17L Mutant 8wks 121 30 wks 17R Mutant 8 wks 106 30 wks Yes Yes Yes 17B Mutant 8wks 600 24 wks 17N Mutant 8wks 600 27 wks 18L Mutant 8wks 134 34 wks Yes Yes Yes 18R Mutant 8wks 131 34 wks Yes Yes Yes 18B Mutant 8wks 116 34wks Yes Yes Yes 18N Saline 11 wks 540 24 wks 19L Saline 12 wks 113 28 wks Yes Yes Yes 19R Saline 7 wks 336 17 wks 19B Saline 8 wks 546 16 wks 19N Saline 8 wks 248 28 wks Yes Yes Yes 20L Saline 8 wks 262 22 wks 20R Saline 12 wks 600 23 wks 20B Saline 12 wks 560 17 wks 20N Saline 12 wks 600 16 wks Yes

PAGE 138

138 REFERENCES 1. Atkinson,M.A. and Eisenbarth,G.S. 2001. Type 1 diabetes: N ew perspectives on disease pathogenesis and treatment. Lancet 358:221-229. 2. Wilson,K. and Eisenbarth,G.S. 1990. Immunopathogenesis and immunotherapy of type 1 diabetes. Annu.Rev.Med. 41:497-508. 3. Jahromi,M.M. and Eisenbarth,G.S. 2006. Genetic determinants of type 1 diabetes across populations. Ann.N.Y.Acad.Sci. 1079:289-299. 4. Kahn,C.R., Vicent,D., and Doria,A. 1996. Genetics of noninsulin -dependent (typeII) diabetes mellitus. Annu.Rev.Med. 47:509-531. 5. Doria,A., Patti,M.E., and Kahn,C.R. 2008. The emerging genetic architecture of type 2 diabetes. Cell Metab 8:186-200. 6. Yoon,J.W. and Jun,H.S. 2001. C ellular and molecular pathogenic mechanisms of insulin dependent diabetes mellitus. Ann.N.Y.Acad.Sci. 928:200-211. 7. Jahromi,M.M. and Eisenbarth,G.S. 2007. Cellular and molecular pathogenesis of type 1A diabetes. Cell Mol.Life Sci. 64:865-872. 8. Peng ,H. and Hagopian,W. 2006. Environmental factors in the development of Type 1 diabetes. Rev.Endocr.Metab Disord. 7:149-162. 9. Bottazzo,G.F., Florin-Christensen,A., and Doniach,D. 1974. Isletcell antibodies in diabetes mellitus with autoimmune polyendocr ine deficiencies. Lancet 2:1279-1283. 10. Miao,D., Yu,L., and Eisenbarth,G.S. 2007. Role of autoantibodies in type 1 diabetes. Front Biosci. 12:1889-1898. 11. Kaufman,D.L., Clare-Salzler,M., Tian,J., Forsthuber,T., Ting,G.S., Robinson,P., Atkinson,M.A., Sercarz,E.E., Tobin,A.J., and Lehmann,P.V. 1993. Spontaneous loss of T-cell tolerance to glutamic acid decarboxylase in murine insulindependent diabetes. Nature 366:69-72. 12. Taplin,C.E. and Barker,J.M. 2008. Autoantibodies in type 1 diabetes. Autoimmunity 41:11-18. 13. Daniel,D. and Wegmann,D.R. 1996. Intranasal administration of insulin peptide B: 923 protects NOD mice from diabetes. Ann.N.Y.Acad.Sci. 778:371-372. 14. Daniel,D. and Wegmann,D.R. 1996. Protection of nonobese diabetic mice from di abetes by intranasal or subcutaneous administration of insulin peptide B(9 -23). Proc.Natl.Acad.Sci.U.S.A 93:956-960.

PAGE 139

139 15. Tian,J., Clare-Salzler,M., Herschenfeld,A., Middleton,B., Newman,D., Mueller,R., Arita,S., Evans,C., Atkinson,M.A., Mullen,Y. et al 1996. Modulating autoimmune responses to GAD inhibits disease progression and prolongs islet graft survival in diabetesprone mice. Nat.Med. 2:1348-1353. 16. Tian,J., Atkinson,M.A., Clare-Salzler,M., Herschenfeld,A., Forsthuber,T., Lehmann,P.V., and Kaufman,D.L. 1996. Nasal administration of glutamate decarboxylase (GAD65) peptides induces Th2 responses and prevents murine insulin-dependent diabetes. J.Exp.Med. 183:1561-1567. 17. Tisch,R., Yang,X.D., Singer,S.M., Liblau,R.S., Fugger,L., and McDevitt,H.O. 1993. Immune response to glutamic acid decarboxylase correlates with insulitis in non -obese diabetic mice. Nature 366:72-75. 18. Tisch,R., Wang,B., Atkinson,M.A., Serreze,D.V., and Friedline,R. 2001. A glutamic acid decarboxylase 65specific Th2 cell clone immunoregulates autoimmune diabetes in nonobese diabetic mice. J.Immunol. 166:6925-6936. 19. Tisch,R., Liblau,R.S., Yang,X.D., Liblau,P., and McDevitt,H.O. 1998. Induction of GAD65 specific regulatory T -cells inhibits ongoing autoimmune diabetes in nonobese diabetic mice. Diabetes 47:894-899. 20. Elias,D., Reshef,T., Birk,O.S., van der,Z.R., Walker,M.D., and Cohen,I.R. 1991. Vaccination against autoimmune mouse diabetes with a T -cell epitope of the human 65kDa heat shock protein. Proc.Natl.Acad.Sci.U.S.A 88:3088-3091. 21. Bowman,M. and Atkinson,M.A. 2002. Heat shock protein therapy fails to prevent diabetes in NOD mice. Diabetologia 45:1350-1351. 22. Skyler,J.S., Krischer,J.P., Wolfsdorf,J., Cowie,C., Palmer,J.P., Greenbaum,C., Cuthbertson,D., Rafkin -Mervis,L.E., Chase,H.P., and Leschek,E. 2005. Effects of oral insulin in relatives of patients with type 1 diabetes: The Diabetes Prevention Trial--Type 1. Diabetes Care 28:1068-1076. 23. 2002. Effects of insulin in relatives of patients with type 1 diabetes mellitus. N.Engl.J.Med. 346:1685-1691. 24. Raz,I., Avron,A., Tamir,M., Metzger,M., Symer,L., Eldor,R., Cohen,I.R., and Elias,D. 2007. Treatment of new-onset type 1 diabetes with peptide DiaPep277 is safe and associated with preserved beta-cell function: extension of a randomized, doubleblind, phase II trial. Diabetes Metab Res.Rev. 23:292-298. 25. DeFronzo,R.A. 1997. Insulin resistance: a multifaceted syndrome responsible for NIDDM, obesity, hypertension, dyslipidaemia and atherosclerosis. Neth.J.Med. 50:191197. 26. Kahn,B.B. and Rossetti,L. 1998. Type 2 diabetes --who is conducting the orchestra? Nat.Genet. 20:223-225.

PAGE 140

140 27. Stumvoll,M., Goldstein,B.J., and van Haeften,T.W. 2005. Type 2 diabetes: Principles of pathogenesis and therapy. Lancet 365:1333-1346. 28. Li,L., Yi,Z., Tisch,R., and Wang,B. 2008. Immunotherapy of type 1 diabetes. Arch.Immunol.Ther.Exp.(Warsz.) 56:227-236. 29. Sari,R. and Balci,M.K. 2005. Relationship between C peptide and chronic complications in type-2 diabete s mellitus. J.Natl.Med.Assoc. 97:1113-1118. 30. Shapiro,A.M., Ricordi,C., Hering,B.J., Auchincloss,H., Lindblad,R., Robertson,R.P., Secchi,A., Brendel,M.D., Berney,T., Brennan,D.C. et al 2006. International trial of the Edmonton protocol for islet trans plantation. N.Engl.J.Med. 355:1318-1330. 31. Ianus,A., Holz,G.G., Theise,N.D., and Hussain,M.A. 2003. In vivo derivation of glucosecompetent pancreatic endocrine cells from bone marrow without evidence of cell fusion 250. J.Clin.Invest 111:843-850. 32. Voltarelli,J.C., Couri,C.E., Stracieri,A.B., Oliveira,M.C., Moraes,D.A., Pieroni,F., Coutinho,M., Malmegrim,K.C., Foss-Freitas,M.C., Simoes,B.P. et al 2007. Autologous nonmyeloablative hematopoietic stem cell transplantation in newly diagnosed type 1 diabetes mellitus. JAMA 297:1568-1576. 33. Denner,L. and Urban,R.J. 2008. Critical issues for engineering cord blood stem cells to produce insulin. Expert.Opin.Biol.Ther. 8:1251-1254. 34. Kroon,E., Martinson,L.A., Kadoya,K., Bang,A.G., Kelly,O.G., Eli azer,S., Young,H., Richardson,M., Smart,N.G., Cunningham,J. et al 2008. Pancreatic endoderm derived from human embryonic stem cells generates glucoseresponsive insulin secreting cells in vivo. Nat.Biotechnol. 26:443-452. 35. Jonsson,J., Carlsson,L., Edlund,T., and Edlund,H. 1994. Insulin-promoterfactor 1 is required for pancreas development in mice. Nature 371:606-609. 36. Offield,M.F., Jetton,T.L., Labosky,P.A., Ray,M., Stein,R.W., Magnuson,M.A., Hogan,B.L., and Wright,C.V. 1996. PDX-1 is required for pancreatic outgrowth and differentiation of the rostral duodenum. Development 122:983-995. 37. Holland,A.M., Gonez,L.J., Naselli,G., MacDonald,R.J., and Harrison,L.C. 2005. Conditional expression demonstrates the role of the homeodomain transcription factor Pdx1 in maintenance and regeneration of betacells in the adult pancreas. Diabetes 54:2586-2595. 38. Sharma, A. and Stein, R. Glucose-induced transcription of the insulin gene is mediated by factors required for betacell type specific expression. Mol.Cell Biol. 14(2), 871-879. 1994. 39. Gerrish,K., Gannon,M., Shih,D., Henderson,E., Stoffel,M., Wright,C.V., and Stein,R. 2000. Pancreatic beta cell specific transcription of the pdx -1 gene. The role of conserved

PAGE 141

141 upstream control regions and their hepatic nuclear factor 3beta sites. J.Biol.Chem. 275:3485-3492. 40. Guz,Y., Montminy,M.R., Stein,R., Leonard,J., Gamer,L.W., Wright,C.V., and Teitelman,G. 1995. Expression of murine STF-1, a putative insulin gene transcription factor, in beta cells of pancreas, duodenal epithelium and pancreatic exocrine and endocrine progenitors during ontogeny. Development 121:1118. 41. Habener, J. F., Kemp, D. M., and Thomas, M. K. Minireview: transcriptional regulation in pancreatic development. Endocrinology 146(3), 1025-1034. 2005. 42. Waeber, G., Thompson, N., Nicod, P., and Bonny, C. Transcriptional activation of the GLUT2 gene by the IPF1/STF1/IDX -1 homeobox factor. Mol.Endocrinol. 10(11), 1327-1334. 1996. 43. Watada, H., Kajimoto, Y., Miyagawa, J., Hanafusa, T., Hamaguchi, K., Matsuoka, T., Yamamoto, K., Matsuzawa, Y., Kawamori, R., and Yamasaki, Y. PDX1 induces insulin and glucokinase gene expressions in alphaTC1 clone 6 cells in the presence of betacellulin. Diabetes 45(12), 1826-1831. 1996. 44. Gerrish,K., Cissell,M.A., and Stein,R. 2001. The role of hepatic nuclear factor 1 alpha and PDX-1 in transcriptional regulation of the pdx-1 gene. J.Biol.Chem. 276:4777547784. 45. Sharma,A., Zangen,D.H., Reitz,P., Taneja,M., Lissauer,M.E., Miller,C.P., Weir,G.C., Habener,J.F., and Bonner-Weir,S. 1999. The homeodomain protein IDX1 increases after an early burst of proliferation during pancreatic regeneration. Diabetes 48:507-513. 46. Ashizawa, S., Brunicardi, F. C., and Wang, X. P. PDX-1 and the panc reas. Pancreas 28(2), 109-120. 2004. 47. Joliot,A. and Prochiantz,A. 2004. Transduction peptides: from technology to physiology. Nat.Cell Biol. 6:189-196. 48. Sandgren, S., Cheng, F., and Belting, M. Nuclear targeting of macromolecular polyanions by an HIV-Tat derived peptide. Role for cell-surface proteoglycans. J.Biol.Chem. 277(41), 38877-38883. 10-11-2002. 49. Wadia,J.S., Stan,R.V., and Dowdy,S.F. 2004. Transducible TAT-HA fusogenic peptide enhances escape of TAT fusion proteins after lipid raf t macropinocytosis. Nat.Med. 10:310-315. 50. Frankel, A. D. and Pabo, C. O. Cellular uptake of the tat protein from human immunodeficiency virus. Cell 55(6), 1189-1193. 12-23-1988.

PAGE 142

142 51. Green,M. and Loewenstein,P.M. 1988. Autonomous functional domains of chemically synthesized human immunodeficiency virus tat trans -activator protein. Cell 55:11791188. 52. Joliot, A. Transduction peptides within naturally occurring proteins. Sci.STKE. 2005(313), e54. 12-6-2005. 53. Nolden,L., Edenhofer,F., Haupt,S., Koch,P., Wunderlich,F.T., Siemen,H., and Brustle,O. 2006. Site-specific recombination in human embryonic stem cells induced by cellpermeant Cre recombinase. Nat.Methods 3:461-467. 54. Shibagaki, N. and Udey, M. C. Dendritic cells transduced with protein antigens induce cytotoxic lymphocytes and elicit antitumor immunity. J.Immunol. 168(5), 2393-2401. 31-2002. 55. Krosl,J., Austin,P., Beslu,N., Kroon,E., Humphries,R.K., and Sauvageau,G. 2003. In vitro expansion of hematopoietic stem cells by recombinant TAT-HOXB4 protein. Nat.Med. 9:1428-1432. 56. Nagahara,H., Vocero-Akbani,A.M., Snyder,E.L., Ho,A., Latham,D.G., Lissy,N.A., Becker -Hapak,M., Ezhevsky,S.A., and Dowdy,S.F. 1998. Transduction of full-length TAT fusion proteins into mammalian cells: TAT -p27Kip1 induces cell migration. Nat.Med. 4:1449-1452. 57. Zhou,H., Wu,S., Joo,J.Y., Zhu,S., Han,D.W., Lin,T., Trauger,S., Bien,G., Yao,S., Zhu,Y. et al 2009. Generation of Induced Pluripotent Stem Cells Using Recombinant Proteins. Cell Stem Cell. 58. Schwarze, S. R. and Dowdy, S. F. In vivo protein transduction: intracellular delivery of biologically active proteins, compounds and DNA. Trends Pharmacol.Sci. 21(2), 45-48. 2000. 59. Myou, S., Zhu, X., Myo, S., Boetticher, E., Meliton, A. Y., Liu, J., Munoz, N. M., and Leff, A. R. Blockade of airway inflammation and hyperresponsiveness by HIVTAT dominant negative Ras. J.Immunol. 171(8), 4379-4384. 10-15-2003. 60. Bucci, M., Gratton, J. P., Rudic, R. D., Acevedo, L., Roviezzo, F., Cirino, G., a nd Sessa, W. C. In vivo delivery of the caveolin-1 scaffolding domain inhibits nitric oxide synthesis and reduces inflammation. Nat.Med. 6(12), 1362-1367. 2000. 61. Shibagaki, N. and Udey, M. C. Dendritic cells transduced with TAT protein transduction domain containing tyrosinase -related protein 2 vaccinate against murine melanoma. Eur.J.Immunol. 33(4), 850-860. 2003. 62. Asoh, S. and Ohta, S. [Protein transduction and protection of cells against apoptosis]. Seikagaku 76(7), 654-658. 2004.

PAGE 143

143 63. No guchi,H., Kaneto,H., Weir,G.C., and Bonner-Weir,S. 2003. PDX-1 protein containing its own antennapedia-like protein transduction domain can transduce pancreatic duct and islet cells. Diabetes 52:1732-1737. 64. Noguchi,H. and Matsumoto,S. 2006. Protein transduction technology: a novel therapeutic perspective. Acta Med.Okayama 60:1-11. 65. Noguchi,H., Matsushita,M., Matsumoto,S., Lu,Y.F., Matsui,H., and Bonner-Weir,S. 2005. Mechanism of PDX1 protein transduction. Biochem.Biophys.Res.Commun. 332:68-74. 66. Noguchi,H., Matsumoto,S., Okitsu,T., Iwanaga,Y., Yonekawa,Y., Nagata,H., Matsushita,M., Wei,F.Y., Matsui,H., Minami,K. et al 2005. PDX -1 protein is internalized by lipid raftdependent macropinocytosis. Cell Transplant. 14:637-645. 67. Dor,Y., Brown,J., Martinez,O.I., and Melton,D.A. 2004. Adult pancreatic betacells are formed by self-duplication rather than stemcell differentiation. Nature 429:41-46. 68. Nir, T., Melton, D. A., and Dor, Y. Recovery from diabetes in mice by beta cell regeneration. J.Clin.Invest 117(9), 2553-2561. 9-4-2007. 69. Harmon,J.S., Gleason,C.E., Tanaka,Y., Oseid,E.A., Hunter-Berger,K.K., and Robertson,R.P. 1999. In vivo prevention of hyperglycemia also prevents glucotoxic effects on PDX -1 and insulin gene expression. Diabetes 48:1995-2000. 70. Robertson,R., Zhou,H., Zhang,T., and Harmon,J.S. 2007. Chronic oxidative stress as a mechanism for glucose toxicity of the beta cell in Type 2 diabetes. Cell Biochem.Biophys. 48:139-146. 71. Robertson,R.P. and Harmon,J.S. 2006. Diabetes, glucose toxicity, and oxidative stress: A case of double jeopardy for the pancreatic islet beta cell. Free Radic.Biol.Med. 41:177184. 72. Sharma,A., Olson,L.K., Robertson,R.P., and Stein,R. 1995. The reduction of insulin gene transcription in HIT -T15 beta cells chronically exposed to high glucose concentration is associated with the loss of RIPE3b1 and STF-1 transcription factor expression. Mol.Endocrinol. 9:1127-1134. 73. Kito, H., Ose, Y., Mizuhira, V., Sato, T., Ishikawa, T., and Tazawa, T. Separation and purification of (Cd, Cu, Zn)-metallothionein in carp hepato-pancreas. Comp Biochem.Physiol C. 73(1), 121-127. 1982. 74. Meivar -Levy, I. and Ferber, S. New organs from our own tissues: liverto pancreas transdifferentiation. Trends En docrinol.Metab 14(10), 460-466. 2003. 75. Michalopoulos,G.K. and DeFrances,M.C. 1997. Liver regeneration. Science 276:6066.

PAGE 144

144 76. Yang, H., Morrison, C. M., Conlon, J. M., Laybolt, K., and Wright, J. R., Jr. Immunocytochemical characterization of the pancreatic islet cells of the Nile Tilapia (Oreochromis niloticus). Gen.Comp Endocrinol. 114(1), 47-56. 1999. 77. Wolf,H.K., Burchette,J.L., Jr., Garcia,J.A., and Michalopoulos,G. 1990. Exocrine pancreatic tissue in human liver: a metaplastic process? Am.J.Surg.Pathol. 14:590-595. 78. Tang,D.Q., Lu,S., Sun,Y.P., Rodrigue,E., Chou,W., Yang,C., Chang,L.J., and Yang,L.J. 2006. Reprogramming LiverStem WB Cells into Functional Insulin -Producing Cells by Persistent Expression of Pdx1and Pdx1-VP16 Mediated by Lentiviral Vectors. Lab Invest 86:83-93. 79. Tang,D.Q., Cao,L.Z., Chou,W., Shun,L., Farag,C., Atkinson,M.A., Li,S.W., Chang,L.J., and Yang,L.J. 2006. Role of Pax4 in Pdx1VP16 mediated liver to -endocrine pancreas transdifferentiation. Lab Invest 86:829 -841. 80. Fodor, A., Harel, C., Fodor, L., Armoni, M., Salmon, P., Trono, D., and Karnieli, E. Adult rat liver cells transdifferentiated with lentiviral IPF1 vectors reverse diabetes in mice: an ex vivo gene therapy approach. Diabetologia 50(1), 121-130. 2007. 81. Yechoor,V., Liu,V., Espiritu,C., Paul,A., Oka,K., Kojima,H., and Chan,L. 2009. Neurogenin3 is sufficient for transdetermination of hepatic progenitor cells into neo islets in vivo but not transdifferentiation of hepatocytes. Dev.Cell 16:3 58-373. 82. Meivar -Levy,I., Sapir,T., Gefen-Halevi,S., Aviv,V., Barshack,I., Onaca,N., Mor,E., and Ferber,S. 2007. Pancreatic and duodenal homeobox gene 1 induces hepatic dedifferentiation by suppressing the expression of CCAAT/enhancer-binding protein beta. Hepatology 46:898-905. 83. Ber,I., Shternhall,K., Perl,S., Ohanuna,Z., Goldberg,I., Barshack,I., Benvenisti-Zarum,L., Meivar -Levy,I., and Ferber,S. 2003. Functional, persistent, and extended liver to pancreas transdifferentiation. J.Biol.Chem. 278:31950-31957. 84. Ferber,S., Halkin,A., Cohen,H., Ber,I., Einav,Y., Goldberg,I., Barshack,I., Seijffers,R., Kopolovic,J., Kaiser,N. et al 2000. Pancreatic and duodenal homeobox gene 1 induces expression of insulin genes in liver and ameliorates streptozot ocin-induced hyperglycemia. Nat.Med. 6:568-572. 85. Sapir,T., Shternhall,K., Meivar-Levy,I., Blumenfeld,T., Cohen,H., Skutelsky,E., Eventov-Friedman,S., Barshack,I., Goldberg,I., Pri-Chen,S. et al 2005. Cellreplacement therapy for diabetes: Generating functional insulin-producing tissue from adult human liver cells. Proc.Natl.Acad.Sci.U.S.A 102:7964-7969. 86. Shternhall-Ron,K., Quintana,F.J., Perl,S., Meivar-Levy,I., Barshack,I., Cohen,I.R., and Ferber,S. 2007. Ectopic PDX1 expression in liver ameliorates type 1 diabetes. J.Autoimmun.

PAGE 145

145 87. Kojima,H., Fujimiya,M., Matsumura,K., Younan,P., Imaeda,H., Maeda,M., and Chan,L. 2003. NeuroDbetacellulin gene therapy induces islet neogenesis in the liver and reverses diabetes in mice. Nat.Med. 9:596-603. 88. Koizumi,M., Doi,R., Toyoda,E., Tulachan,S.S., Kami,K., Mori,T., Ito,D., Kawaguchi,Y., Fujimoto,K., Gittes,G.K. et al 2004. Hepatic regeneration and enforced PDX-1 expression accelerate transdifferentiation in liver. Surgery 136:449-457. 89. Kim,S., Shin,J.S., Fisher,R.C., Lee,M.J., and Kim,K.W. 2007. Streptozotocin-induced diabetes can be reversed by hepatic oval cell activation through hepatic transdifferentiation and pancreatic islet regeneration. Lab Invest In press. 90. Bonner-Weir,S. and Weir,G.C. 2005. New sources of pancreatic betacells. Nat.Biotechnol. 23:857-861. 91. Meier,J.J., Bhushan,A., and Butler,P.C. 2006. The potential for stem cell therapy in diabetes. Pediatr.Res. 59:65R-73R. 92. Trucco,M. 2006. Is facilitating pancreatic beta cell regeneration a valid option for clinical therapy? Cell Transplant. 15 Suppl 1:S75-S84. 93. Perfetti,R., Zhou,J., Doyle,M.E., and Egan,J.M. 2000. Glucagonlike peptide -1 induces cell proliferation and pancreatic duodenum homeobox-1 expression and i ncreases endocrine cell mass in the pancreas of old, glucoseintolerant rats 31. Endocrinology 141:4600-4605. 94. Stoffers,D.A., Kieffer,T.J., Hussain,M.A., Drucker,D.J., Bonner-Weir,S., Habener,J.F., and Egan,J.M. 2000. Insulinotropic glucagon-like peptide 1 agonists stimulate expression of homeodomain protein IDX1 and increase islet size in mouse pancreas. Diabetes 49:741-748. 95. Xu,G., Stoffers,D.A., Habener,J.F., and Bonner-Weir,S. 1999. Exendin4 stimulates both beta-cell replication and neogenes is, resulting in increased beta -cell mass and improved glucose tolerance in diabetic rats 1. Diabetes 48:2270-2276. 96. Zhou,J., Pineyro,M.A., Wang,X., Doyle,M.E., and Egan,J.M. 2002. Exendin-4 differentiation of a human pancreatic duct cell line into endocrine cells: Involvement of PDX-1 and HNF3beta transcription factors. J.Cell Physiol 192:304-314. 97. Pittenger,G.L., Taylor-Fishwick,D.A., Johns,R.H., Burcus,N., Kosuri,S., and Vinik,A.I. 2007. Intramuscular injection of islet neogenesisassociated protein peptide stimulates pancreatic islet neogenesis in healthy dogs. Pancreas 34:103-111. 98. Gagliardino,J.J., Del Zotto,H., Massa,L., Flores,L.E., and Borelli,M.I. 2003. Pancreatic duodenal homeobox-1 and islet neogenesisassociated protein: a possibl e combined marker of activateable pancreatic cell precursors. J.Endocrinol. 177:249-259.

PAGE 146

146 99. Holland,A.M., Hale,M.A., Kagami,H., Hammer,R.E., and MacDonald,R.J. 2002. Experimental control of pancreatic development and maintenance. Proc.Natl.Acad.Sci.U.S.A 99:12236-12241. 100. Stoffers,D.A., Zinkin,N.T., Stanojevic,V., Clarke,W.L., and Habener,J.F. 1997. Pancreatic agenesis attributable to a single nucleotide deletion in the human IPF1 gene coding sequence. Nat.Genet. 15:106-110. 101. Yang,L.J. 2006. L iver stem cell -derived betacell surrogates for treatment of type 1 diabetes. Autoimmun.Rev. 5:409-413. 102. Prochiantz,A. and Joliot,A. 2003. Can transcription factors function as cellcell signalling molecules? Nat.Rev.Mol.Cell Biol. 4:814-819. 103. Noguchi, H. and Matsumoto, S. Protein transduction technology offers a novel therapeutic approach for diabetes. J.Hepatobiliary.Pancreat.Surg. 13(4), 306-313. 2006. 104. Jin, L. H., Bahn, J. H., Eum, W. S., Kwon, H. Y., Jang, S. H., Han, K. H., Kang, T. C., Won, M. H., Kang, J. H., Cho, S. W., Park, J., and Choi, S. Y. Transduction of human catalase mediated by an HIV -1 TAT protein basic domain and arginine-rich peptides into mammalian cells. Free Radic.Biol.Med. 31(11), 1509-1519. 12-1-2001. 105. Coleman,W.B., McCullough,K.D., Esch,G.L., Faris,R.A., Hixson,D.C., Smith,G.J., and Grisham,J.W. 1997. Evaluation of the differentiation potential of WBF344 rat liver epithelial stem like cells in vivo. Differentiation to hepatocytes after transplantation into dipeptidylpeptidaseIV deficient rat liver. Am.J.Pathol. 151:353-359. 106. Couchie,D., Holic,N., Chobert,M.N., Corlu,A., and Laperche,Y. 2002. In vitro differentiation of WBF344 rat liver epithelial cells into the biliary lineage. Differentiation 69:209-215. 107. Narushima,Y., Unno,M., Nakagawara,K., Mori,M., Miyashita,H., Suzuki,Y., Noguchi,N., Takasawa,S., Kumagai,T., Yonekura,H. et al 1997. Structure, chromosomal localization and expression of mouse genes encoding type III Reg, RegIII alpha, RegIII beta, RegIII gamma. Gene 185:159-168. 108. Peshavaria,M., Larmie,B.L., Lausier,J., Satish,B., Habibovic,A., Roskens,V., Larock,K., Everill,B., Leahy,J.L., and Jetton,T.L. 2006. Regulation of pancreatic betacell regeneration in the normoglycemic 60% partialpancreatectomy mouse. Diabetes 55:3289-3298. 109. Guz,Y., Nasir,I., and Teitelman,G. 2001. Regeneration of pancreatic beta cells from intraislet precursor cells in an experimental model of diabetes. Endocrinology 142:4956-4968. 110. O'Doherty,R.M., Lehman,D.L., Telemaque-Potts,S., and Newgard,C.B. 1999. Metabolic impact of glucokinase overexpression in liver: lowering of blood glucose in fed rats is accompanied by hyperlipidemia. Diabetes 48:2022-2027.

PAGE 147

147 111. Waguri,M., Yamamoto,K., Miyagawa,J.I., Tochino,Y., Yamamori,K., Kajimoto,Y., Nakajima,H., Watada,H., Yoshiuchi,I., Itoh,N. et al 1997. Demonstration of two different processes of beta-cell regeneration in a new diabetic mouse model induced by selective perfusion of alloxan. Diabetes 46:1281-1290. 112. Kulkarni,R.N., Jhala,U.S., Winnay,J.N., Krajewski,S., Montminy,M., and Kahn,C.R. 2004. PDX1 haploinsufficiency limits the compensatory islet hyperplasia that occurs in response to insulin resistance. J.Clin.Invest 114:828-836. 113. Marsh ak,S., Benshushan,E., Shoshkes,M., Havin,L., Cerasi,E., and Melloul,D. 2000. Functional conservation of regulatory elements in the pdx1 gene: PDX -1 and hepatocyte nuclear factor 3beta transcription factors mediate beta cell specific expression 37. Mol.Ce ll Biol. 20:7583-7590. 114. Kushner,J.A., Ye,J., Schubert,M., Burks,D.J., Dow,M.A., Flint,C.L., Dutta,S., Wright,C.V., Montminy,M.R., and White,M.F. 2002. Pdx1 restores beta cell function in Irs2 knockout mice. J.Clin.Invest 109:1193-1201. 115. Hui,H. and Perfetti,R. 2002. Pancreas duodenum homeobox1 regulates pancreas development during embryogenesis and islet cell function in adulthood. Eur.J.Endocrinol. 146:129-141. 116. Sherry,N.A., Kushner,J.A., Glandt,M., Kitamura,T., Brillantes,A.M., and Herold,K.C. 2006. Effects of autoimmunity and immune therapy on beta-cell turnover in type 1 diabetes. Diabetes 55:3238-3245. 117. Ablamunits,V., Sherry,N.A., Kushner,J.A., and Herold,K.C. 2007. Autoimmunity and Beta cell regeneration in mouse and human type 1 diabetes: the peace is not enough. Ann.N.Y.Acad.Sci. 1103:19-32. 118. Makino,S., Kunimoto,K., Muraoka,Y., Mizushima,Y., Katagiri,K., and Tochino,Y. 1980. Breeding of a nonobese, diabetic strain of mice. Jikken Dobutsu 29:1-13. 119. Zhang,J., Tokui,Y., Yamagata,K., Kozawa,J., Sayama,K., Iwahashi,H., Okita,K., Miuchi,M., Konya,H., Hamaguchi,T. et al 2007. Continuous stimulation of human glucagonlike peptide 1 (7 -36) amide in a mouse model (NOD) delays onset of autoimmune type 1 diabetes. Diabetologia 50:1900-1909. 120. Hadjiyanni,I., Baggio,L.L., Poussier,P., and Drucker,D.J. 2008. Exendin4 modulates diabetes onset in nonobese diabetic mice. Endocrinology 149:1338-1349. 121. Linn,T., Schneider,K., Goke,B., and Federlin,K. 1996. Glucagonlike pept ide-1 (736) amide improves glucose sensitivity in betacells of NOD mice. Acta Diabetol. 33:1924. 122. Li,Y., Cao,X., Li,L.X., Brubaker,P.L., Edlund,H., and Drucker,D.J. 2005. beta-Cell Pdx1 expression is essential for the glucoregulatory, proliferative, and cytoprotective actions of glucagonlike peptide -1. Diabetes 54:482-491.

PAGE 148

148 123. Koya,V., Lu,S., Sun,Y.P., Purich,D.L., Atkinson,M.A., Li,S.W., and Yang,L.J. 2008. Reversal of streptozotocin induced diabetes in mice by cellular transduction with recom binant pancreatic transcription factor pancreatic duodenal homeobox-1: a novel protein transduction domain-based therapy. Diabetes 57:757-769. 124. Katz,J.D., Wang,B., Haskins,K., Benoist,C., and Mathis,D. 1993. Following a diabetogenic T cell from genes is through pathogenesis. Cell 74:1089-1100. 125. Zhang,L., Nakayama,M., and Eisenbarth,G.S. 2008. Insulin as an autoantigen in NOD/human diabetes. Curr.Opin.Immunol. 20:111-118. 126. Wong,F.S., Wen,L., Tang,M., Ramanathan,M., Visintin,I., Daugherty,J., Hannum,L.G., Janeway,C.A., Jr., and Shlomchik,M.J. 2004. Investigation of the role of B-cells in type 1 diabetes in the NOD mouse. Diabetes 53:2581-2587. 127. Bach,J.F. and Chatenoud,L. 2001. Tolerance to islet autoantigens in type 1 diabetes. Annu.Rev.Immunol. 19:131-161. 128. Bach,J.F. 2001. Immunotherapy of insulindependent diabetes mellitus. Curr.Opin.Immunol. 13:601-605. 129. Hoglund,P., Mintern,J., Waltzinger,C., Heath,W., Benoist,C., and Mathis,D. 1999. Initiation of autoimmune diabetes by de velopmentally regulated presentation of islet cell antigens in the pancreatic lymph nodes. J.Exp.Med. 189:331-339. 130. Wenzlau,J.M., Juhl,K., Yu,L., Moua,O., Sarkar,S.A., Gottlieb,P., Rewers,M., Eisenbarth,G.S., Jensen,J., Davidson,H.W. et al 2007. The cation efflux transporter ZnT8 (Slc30A8) is a major autoantigen in human type 1 diabetes. Proc.Natl.Acad.Sci.U.S.A 104:17040-17045. 131. Tisch,R. and McDevitt,H.O. 1994. Antigenspecific immunotherapy: is it a real possibility to combat Tcell -mediated autoimmunity? Proc.Natl.Acad.Sci.U.S.A 91:437438. 132. Pasquali,L., Giannoukakis,N., and Trucco,M. 2008. Induction of immune tolerance to facilitate beta cell regeneration in type 1 diabetes. Adv.Drug Deliv.Rev. 60:106-113. 133. Raz,I., Eldor,R., and Naparstek,Y. 2005. Immune modulation for prevention of type 1 diabetes mellitus. Trends Biotechnol. 23:128-134. 134. Liblau,R.S., Pearson,C.I., Shokat,K., Tisch,R., Yang,X.D., and McDevitt,H.O. 1994. High -dose soluble antigen: peripheral Tcell prolifera tion or apoptosis. Immunol.Rev. 142:193-208. 135. Song,W.J., Schreiber,W.E., Zhong,E., Liu,F.F., Kornfeld,B.D., Wondisford,F.E., and Hussain,M.A. 2008. Exendin-4 stimulation of cyclin A2 in beta-cell proliferation. Diabetes 57:2371-2381.

PAGE 149

149 136. Lee,Y.C. and Nielsen,J.H. 2009. Regulation of beta cell replication. Mol.Cell Endocrinol. 297:18-27. 137. Heit,J.J., Karnik,S.K., and Kim,S.K. 2006. Intrinsic regulators of pancreatic betacell proliferation. Annu.Rev.Cell Dev.Biol. 22:311-338. 138. Rankin,M.M. and Kushner,J.A. 2009. ADAPTIVE BETA CELL PROLIFERATION IS SEVERELY RESTRICTED WITH ADVANCED AGE. Diabetes 139. Krishnamurthy, J., Ramsey, M. R., Ligon, K. L., Torrice, C., Koh, A., Bonner-Weir, S., and Sharpless, N. E. p16INK4a induces an agedependent decline in islet regenerative potential. Nature 443(7110), 453-457. 9-28-2006. 140. Schisler,J.C., Fueger,P.T., Babu,D.A., Hohmeier,H.E., Tessem,J.S., Lu,D., Becker,T.C., Naziruddin,B., Levy,M., Mirmira,R.G. et al 2008. Stimulation of human and rat islet beta-cell proliferation with retention of function by the homeodomain transcription factor Nkx6.1. Mol.Cell Biol. 28:3465-3476. 141. Cozar -Castellano,I., Harb,G., Selk,K., Takane,K., Vasavada,R., Sicari,B., Law,B., Zhang,P., Scott,D.K., FiaschiTaesch,N. et al 2008. Lessons from the first comprehensive molecular characterization of cell cycle control in rodent insulinoma cell lines. Diabetes 57:3056-3068. 142. Kushner,J.A., Ciemerych,M.A., Sicinska,E., Wartschow,L.M., Teta,M., Long,S.Y., Sicinski,P., and White,M.F. 2005. Cyclins D2 and D1 are essential for postnatal pancreatic beta-cell growth. Mol.Cell Biol. 25:3752-3762. 143. Teta,M., Long,S.Y., Wartschow,L.M., Rankin,M.M., and Kushner,J.A. 2005. Very slow turnover of beta cell s in aged adult mice. Diabetes 54:2557-2567. 144. Andersen, F. G., Jensen, J., Heller, R. S., Petersen, H. V., Larsson, L. I., Madsen, O. D., and Serup, P. Pax6 and Pdx1 form a functional complex on the rat somatostatin gene upstream enhancer. FEBS Lett. 445(2-3), 315-320. 2-26-1999. 145. Goudet,G., Delhalle,S., Biemar,F., Martial,J.A., and Peers,B. 1999. Functional and cooperative interactions between the homeodomain PDX1, Pbx, and Prep1 factors on the somatostatin promoter. J.Biol.Chem. 274:4067407 3. 146. Peers, B., Sharma, S., Johnson, T., Kamps, M., and Montminy, M. The pancreatic islet factor STF-1 binds cooperatively with Pbx to a regulatory element in the somatostatin promoter: importance of the FPWMK motif and of the homeodomain. Mol.Cell Bi ol. 15(12), 7091-7097. 1995. 147. Qiu,Y., Sharma,A., and Stein,R. 1998. p300 mediates transcriptional stimulation by the basic helix -loop-helix activators of the insulin gene. Mol.Cell Biol. 18:2957-2964.

PAGE 150

150 148. Qiu,Y., Guo,M., Huang,S., and Stein,R. 2002. Insulin gene transcription is mediated by interactions between the p300 coactivator and PDX-1, BETA2, and E47. Mol.Cell Biol. 22:412-420. 149. Teta,M., Rankin,M.M., Long,S.Y., Stein,G.M., and Kushner,J.A. 2007. Growth and regeneration of adult beta cells does not involve specialized progenitors. Dev.Cell 12:817-826. 150. Bonner-Weir, S., Toschi, E., Inada, A., Reitz, P., Fonseca, S. Y., Aye, T., and Sharma, A. The pancreatic ductal epithelium serves as a potential pool of progenitor cells. Pediatr. Diabetes 5 Suppl 2, 16-22. 2004. 151. Bonner-Weir,S. and Sharma,A. 2002. Pancreatic stem cells. J.Pathol. 197:519-526. 152. Dor,Y. and Melton,D.A. 2008. Facultative endocrine progenitor cells in the adult pancreas. Cell 132:183-184. 153. BonnerWe ir,S., Baxter,L.A., Schuppin,G.T., and Smith,F.E. 1993. A second pathway for regeneration of adult exocrine and endocrine pancreas. A possible recapitulation of embryonic development. Diabetes 42:1715-1720. 154. Gu,G., Dubauskaite,J., and Melton,D.A. 2002. Direct evidence for the pancreatic lineage: NGN3+ cells are islet progenitors and are distinct from duct progenitors 3. Development 129:2447-2457. 155. Zhou,Q., Brown,J., Kanarek,A., Rajagopal,J., and Melton,D.A. 2008. In vivo reprogramming of adult pancreatic exocrine cells to beta cells. Nature 455:627-632. 156. Yamanaka,S. and Takahashi,K. 2006. [Induction of pluripotent stem cells from mouse fibroblast cultures]. Tanpakushitsu Kakusan Koso 51:2346-2351. 157. Takahashi,K. and Yamanaka,S. 2006. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126:663-676. 158. Lewitzky,M. and Yamanaka,S. 2007. Reprogramming somatic cells towards pluripotency by defined factors. Curr.Opin.Biotechnol. 18:467-473. 159. Wernig,M., Meissner,A., Foreman,R., Brambrink,T., Ku,M., Hochedlinger,K., Bernstein,B.E., and Jaenisch,R. 2007. In vitro reprogramming of fibroblasts into a pluripotent ES cell like state. Nature 448:318-324. 160. Maherali,N., Sridhara n,R., Xie,W., Utikal,J., Eminli,S., Arnold,K., Stadtfeld,M., Yachechko,R., Tchieu,J., Jaenisch,R. et al 2007. Directly reprogrammed fibroblasts show global epigenetic remodeling and widespread tissue contribution. Cell Stem Cell 1:55-70.

PAGE 151

151 161. Mikkelsen,T.S., Ku,M., Jaffe,D.B., Issac,B., Lieberman,E., Giannoukos,G., Alvarez,P., Brockman,W., Kim,T.K., Koche,R.P. et al 2007. Genomewide maps of chromatin state in pluripotent and lineagecommitted cells. Nature 448:553-560. 162. Korhonen,S., Knip,M.M., Kulmala,P., Savola,K., Akerblom,H.K., and Knip,M. 2002. Autoantibodies to GAD, IA-2 and insulin in ICApositive first degree relatives of children with type 1 diabetes: a comparison between parents and siblings. Diabetes Metab Res.Rev. 18:4348. 163. Knip,M. 2002. Can we predict type 1 diabetes in the general population? Diabetes Care 25:623-625. 164. Hohmeier,H.E. and Newgard,C.B. 2004. Cell lines derived from pancreatic islets. Mol.Cell Endocrinol. 228:121-128.

PAGE 152

152 BIOGRAPHICAL SKETCH Vijay Koya was born in India, in 1978. H e graduated from Jubilee Hills Public School in 1993. Following high school, he enrolled into two year college program in bi ological s ciences. In 1996, he was admitted into Acharya N.G. Ranga Agriculture University. He completed his ba chelor s degree in veterinary m edicine in 2001. Due to his interest in basic sciences, he moved on to pursue graduate studies in United States. In the spring of 2002, he was admitted into m asters p rogram in the Department of Molecular B iology & Microbiolo gy at the University of Central Florida, Orlando. In the summer of 2002, Vijay joined Dr. Henry Daniell s laboratory to conduct research on the development of new generation anthrax vaccine in transgenic plants. Besides research, he has actively participa ted in teaching human anatomy for premedical students. During his m aster s program, he received University Merit Scholar Award for academic excellence. Vijay graduat ed with MS de gree in m olecular biology& microbiology in fall 2004 and continued to work in Dr. Henry Daniells lab until the end of summer 2005. During this period he worked on developing a prototype model for oral delivery of plant expressed therapeutic proteins. In the fall of 2005, he was admitted into the Interdisciplinary Program (IDP) in Biomedical Sciences at the College of Medicine at the University of Florida. Vijay joined Dr. Lijun Yangs lab in the Department of Pathology to conduct doctoral research. He investigated on the Pdx1 protein therapy; a novel approach for the treatmen t o f diabetes. He has received Scientific Achievement Award for the best abstract, at the Annual Rachmiel Levine Symposium, for two consecutive years 2008 and 2009. He received Ph.D from the University of Florida in the summer of 2009.