<%BANNER%>

Isolation and Characterization of Equine Umbilical Cord Blood Derived Stem Cells

Permanent Link: http://ufdc.ufl.edu/UFE0024724/00001

Material Information

Title: Isolation and Characterization of Equine Umbilical Cord Blood Derived Stem Cells
Physical Description: 1 online resource (171 p.)
Language: english
Creator: Reed, Sarah
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: foal, horse, oct4, stem, tendon, umbilical
Animal Molecular and Cellular Biology -- Dissertations, Academic -- UF
Genre: Animal Molecular and Cellular Biology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Musculoskeletal injuries are responsible for a large portion of wastage in sport horses. Mesenchymal stem cells (MSCs) offer promise as therapeutic aids in the repair of tendon, ligament, and bone damage suffered by these horses. The objective of these studies was to identify and characterize stem-like cells from newborn foal umbilical cord blood (UCB). UCB was collected and MSC isolated using human reagents. The cells exhibit a fibroblast-like morphology and express the stem cell markers Oct4, SSEA-1, Tra1-60 and Tra1-81. UCB express transcripts implicated in embryonic stem (ES) cell pluripotency, namely Oct4, nanog, Sox2, Klf4 and c-myc. Culture of the cells in tissue-specific differentiation media leads to the formation of cell types characteristic of mesodermal and endodermal origins including chondrocytes, osteocytes, and hepatocytes. Limited adipogenic and myogenic differentiation occurred. Population doubling time and the presence of Oct4, nanog and Sox2 transcripts were used to determine culture conditions that promoted the proliferation of a stem cell population. Culture on a protein matrix (gelatin, collagen or fibronectin) shortened population doubling time compared to growth on uncoated plasticware. Inclusion of fibroblast growth factor 2 (FGF2) in the growth media slowed proliferation. The persistence of Oct4, nanog and Sox2 expression was monitored over time in culture in UCB stem cells. Oct4 was detected throughout the duration of the experiment. Sox2 and nanog expression declined with time in culture. Finally, the effect of culture conditions on expression of tendon markers was assessed. Initial stem cell populations express scleraxis, an early marker of tenocytic differentiation. Culture on collagen coated beads did not affect scleraxis levels; however culture in 30% Matrigel significantly increased levels of the transcript. This change was accompanied by differences in morphology. Cells grown in Matrigel formed tight colonies reminiscent of ES cell colonies while those on collagen coated beads maintained a fibroblast-like morphology. In conclusion, we have isolated a population of stem cells from equine umbilical cord blood that possess a number of stem cell markers, can be expanded in culture, and can differentiate into a variety of potentially useful cell types.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Sarah Reed.
Thesis: Thesis (Ph.D.)--University of Florida, 2009.
Local: Adviser: Johnson, Sally.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0024724:00001

Permanent Link: http://ufdc.ufl.edu/UFE0024724/00001

Material Information

Title: Isolation and Characterization of Equine Umbilical Cord Blood Derived Stem Cells
Physical Description: 1 online resource (171 p.)
Language: english
Creator: Reed, Sarah
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: foal, horse, oct4, stem, tendon, umbilical
Animal Molecular and Cellular Biology -- Dissertations, Academic -- UF
Genre: Animal Molecular and Cellular Biology thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Musculoskeletal injuries are responsible for a large portion of wastage in sport horses. Mesenchymal stem cells (MSCs) offer promise as therapeutic aids in the repair of tendon, ligament, and bone damage suffered by these horses. The objective of these studies was to identify and characterize stem-like cells from newborn foal umbilical cord blood (UCB). UCB was collected and MSC isolated using human reagents. The cells exhibit a fibroblast-like morphology and express the stem cell markers Oct4, SSEA-1, Tra1-60 and Tra1-81. UCB express transcripts implicated in embryonic stem (ES) cell pluripotency, namely Oct4, nanog, Sox2, Klf4 and c-myc. Culture of the cells in tissue-specific differentiation media leads to the formation of cell types characteristic of mesodermal and endodermal origins including chondrocytes, osteocytes, and hepatocytes. Limited adipogenic and myogenic differentiation occurred. Population doubling time and the presence of Oct4, nanog and Sox2 transcripts were used to determine culture conditions that promoted the proliferation of a stem cell population. Culture on a protein matrix (gelatin, collagen or fibronectin) shortened population doubling time compared to growth on uncoated plasticware. Inclusion of fibroblast growth factor 2 (FGF2) in the growth media slowed proliferation. The persistence of Oct4, nanog and Sox2 expression was monitored over time in culture in UCB stem cells. Oct4 was detected throughout the duration of the experiment. Sox2 and nanog expression declined with time in culture. Finally, the effect of culture conditions on expression of tendon markers was assessed. Initial stem cell populations express scleraxis, an early marker of tenocytic differentiation. Culture on collagen coated beads did not affect scleraxis levels; however culture in 30% Matrigel significantly increased levels of the transcript. This change was accompanied by differences in morphology. Cells grown in Matrigel formed tight colonies reminiscent of ES cell colonies while those on collagen coated beads maintained a fibroblast-like morphology. In conclusion, we have isolated a population of stem cells from equine umbilical cord blood that possess a number of stem cell markers, can be expanded in culture, and can differentiate into a variety of potentially useful cell types.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Sarah Reed.
Thesis: Thesis (Ph.D.)--University of Florida, 2009.
Local: Adviser: Johnson, Sally.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-08-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0024724:00001


This item has the following downloads:


Full Text
xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20110216_AAAAIU INGEST_TIME 2011-02-17T03:38:27Z PACKAGE UFE0024724_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
FILE SIZE 12082 DFID F20110216_AACEFJ ORIGIN DEPOSITOR PATH reed_s_Page_075.QC.jpg GLOBAL false PRESERVATION BIT MESSAGE_DIGEST ALGORITHM MD5
7eb8c8ce694d79b8bb6fda728ab64d76
SHA-1
f0f9cb4b88ff7acf529eef340dd1fc9ff2bed0ff
99082 F20110216_AACEEU reed_s_Page_063.jpg
934c52a84282a5bdf168b070ead98e0f
5b56f6e2d8af7ece528e30582843ca99c989378a
9199 F20110216_AACDZO reed_s_Page_099.pro
ba748df9c7c319c5822cbf891749a923
594f97b146a19f6e0347931bbd3575dd98cdf894
8252 F20110216_AACDCH reed_s_Page_118.pro
9fa71cc4a6fcd3ad4301dc02a452f455
ae4395da1a9d581ddd156ae2c7b5750f009014f1
34279 F20110216_AACDBS reed_s_Page_079.QC.jpg
d1dce8da9fdec704dded70b108fbbf05
e4a1542d7eb72ae86a9ebc76aaf1260fc226468c
18605 F20110216_AACEFK reed_s_Page_076.QC.jpg
8f01871478155970e72ea1d8db12a248
fc4743901c50d6ddda12ae9c77dbddc89e165262
32108 F20110216_AACEEV reed_s_Page_063.QC.jpg
10a1c39844e4747f7bbaca9af903bddc
f820d49975d1bc4cffd9b0edd58900133e6b4944
54868 F20110216_AACDZP reed_s_Page_101.pro
12c1d2611734a7cce4a607acf9cfbd8a
784371066afb21866b5d58fa7e9f0ec61b6df124
31792 F20110216_AACDCI reed_s_Page_056.jp2
dbe35704b32cf0784f4be034681096f6
acafb315a2c2f3998f81fbf70b3251517eb77a75
9254 F20110216_AACDBT reed_s_Page_166thm.jpg
f20f2145f2011b3b86f90c02902c9028
ed41531a2659eca6050d7c6f02e19eea07fc5897
14137 F20110216_AACEFL reed_s_Page_077.QC.jpg
31ed66fd3164d51819a5a98fa49e433d
0bc2ced255751bb5604ae8efb0c7ee0130ce2422
35379 F20110216_AACEEW reed_s_Page_064.QC.jpg
d3e93b322b0d97cde4165717ce08d808
fdcf50132a7ea51f4f0647da6e012a55ab18d4f0
55070 F20110216_AACDZQ reed_s_Page_102.pro
830b8c8dd6a5b3d9c3c87b575394b33c
c32cb1b35645dab108ab61e9f475ccd239209206
9360 F20110216_AACDCJ reed_s_Page_163thm.jpg
b8e33e3653bfcddc41b031fb0330f3ac
069d088128fb13ebc64a017e1fcb1648060fa600
1053954 F20110216_AACDBU reed_s_Page_040.tif
dc78aeb454a551b848be752c16a2e3b4
ea6575288a9ee67e3bf119e8575a0deebe046383
35376 F20110216_AACEGA reed_s_Page_089.QC.jpg
5d533144a654c6fe123f3008c5b56080
ff12c6517988144c013600adc9ec9f6003bc67e4
36802 F20110216_AACEFM reed_s_Page_078.QC.jpg
3c0ebb65f9c9f6f84bba1743d8129f1c
21b70d4349bd31976543576ac1af031472a5ad21
106651 F20110216_AACEEX reed_s_Page_066.jpg
73982f58e98a05148167bd8b5e74fa48
e16731955925c95fa2522640540a97dc496c1ef2
51171 F20110216_AACDZR reed_s_Page_104.pro
2549591e5f4b0cab878e0a3e391199f0
132571f8e7c017d5d11073bdc140c7e9a2fd4393
8355 F20110216_AACDCK reed_s_Page_082thm.jpg
7d3c11d6e48088f3d71c5df5587f3b01
0d2fa2a7bffb2369598dd99942eae228aa2a924d
55245 F20110216_AACDBV reed_s_Page_029.pro
054a22f7e6b6a762836f59e2349c3e00
d10e53e5a8a3e4671e727aa503d67d12c3105128
10699 F20110216_AACEGB reed_s_Page_090.jpg
9d2fe6ba588613352a2a8bcad26b27b3
e6b6f34eec3e4049c86dbc6d122023795c51ba3a
102743 F20110216_AACEFN reed_s_Page_079.jpg
4fa8a52605df86b02300102c10090695
49527024bd2e0b78aecdf4386696b2b84e8ca2ec
35208 F20110216_AACEEY reed_s_Page_066.QC.jpg
cf4811c3fb3a5cbeff327a6883fa1e88
fa444c5a751163ccb504ec9edb447f733775f287
47522 F20110216_AACDZS reed_s_Page_105.pro
19d57245daaec460dba5438d76d66e7c
ffcdf5960c64ed30865b3fd70cc6106f47e672fe
49900 F20110216_AACDCL reed_s_Page_084.pro
9eb2196a7af22369c8842e33347237df
408e8758c375a254c37231856b51c1332934a2d7
76710 F20110216_AACDBW reed_s_Page_159.pro
1ce3670972996d5cf9f8ba1b8039d8aa
77541db5ca325d1ff7dff1f170e6cb6b2608c923
3980 F20110216_AACEGC reed_s_Page_090.QC.jpg
be9fc65558c315c2b116073a23caca60
a01bf82d9314eb5943c506e29d3751dfdf88c3ed
113986 F20110216_AACEFO reed_s_Page_080.jpg
ae0c5d0218e7bdca01b1e304ae48b63a
14c4f50ea4a5c6706f57dc18106173369d78abc5
113872 F20110216_AACEEZ reed_s_Page_068.jpg
611fdf8e1203cdbd37e0829b9af1622e
80c6a39dfedc7b5ed7298e941be8a1353cf333df
52860 F20110216_AACDZT reed_s_Page_107.pro
0b8d429383f0197328b27c7a1b7d36c5
bb1b6585fdf07be9e3e3941663a401e0787fa1fc
119663 F20110216_AACDDA reed_s_Page_101.jp2
adb89406bf3f5ddc99a9577e6f2d1e96
c8cebea31b9806e60a8c2f9d975c628d5a478562
F20110216_AACDCM reed_s_Page_022.tif
20aa3b00e1eb1ef286ab501f2a6eda0f
0ad0b169e101d16226bf151623491001a61a4982
51729 F20110216_AACDBX reed_s_Page_069.pro
cedb2b50d8cc24ae0f53b4c25289e7bf
195ae9cbeff10351d8f0c804525d5dab78f80955
13654 F20110216_AACEGD reed_s_Page_091.QC.jpg
d0d1c555832e923c37baaf1df95f209b
0b8ce04cbb4f7f75754e17070aa5f688403afcad
72530 F20110216_AACDDB reed_s_Page_167.pro
12542e6d13201406fba8f3e9da7e7c01
343a977b79ab75b0c28ea7a4f55440e2f1483798
9090 F20110216_AACDBY reed_s_Page_164thm.jpg
d686c123febf2e6522b4702a53f63591
02c33095eaf5ff2c8ddbcc4775a96fca58a946af
48539 F20110216_AACDZU reed_s_Page_108.pro
a87c14d0f23a24136f8088d3726fcb00
0d46123e2456b3b41959062d4933db6d5e2d20b2
35721 F20110216_AACEGE reed_s_Page_092.jpg
d261c9358b42edb23ff9ff7c73021f75
d9be5100556937e70808f6d4ac82ae91173b5d51
112131 F20110216_AACEFP reed_s_Page_081.jpg
9c594f2535674e6768c05d74f7174c1a
17b0cfbe4f6dd062a4e2feb2c9c3d276255d203c
56389 F20110216_AACDDC reed_s_Page_074.jpg
998c4f0ad29b57b02c6774e4c11d1f5e
043654caceed222dd4d006cec2e8cde560f02d74
F20110216_AACDCN reed_s_Page_136.tif
3c30c6954857899063471e13fb197a5f
25fa23bfa1accc92302638e99f86e34fecc1a5b3
17392 F20110216_AACDBZ reed_s_Page_126.QC.jpg
2b1d454412f6621f4c8fe3083cf831e5
d90f6c51b147014c509f1fff1238e55c89a06c48
56064 F20110216_AACDZV reed_s_Page_109.pro
24e4645c5784e32cbd081e9554acf4e9
d55802db6026eba8680b8d44dbd4bb49390fb04f
11080 F20110216_AACEGF reed_s_Page_092.QC.jpg
d7c9615979e06525e91aacdb11e03feb
5ea38aad6d8d3cc102bc4cc73aefab7cacc7a8c5
106581 F20110216_AACEFQ reed_s_Page_082.jpg
3a975bb0df202e16384847c3e85418c3
d89551c0089c302aa5946c0e0720d0385c9095b4
37370 F20110216_AACDDD reed_s_Page_021.QC.jpg
7c7a6824a2f7695a58e0d4517b9a6134
df0435e195f5f19ec43772da7f57797f5735f471
F20110216_AACDCO reed_s_Page_158.tif
689f4dc63a4ae4a74870da52e073cb54
88b9bb9b336c34e38239aa9c17d8a3ff884fdd5d
52148 F20110216_AACDZW reed_s_Page_110.pro
885720cbaef5a05f668a166440aa6760
7ba1fac93f6a6434e7d08e8b972b7cc963b7bbc2
44870 F20110216_AACEGG reed_s_Page_093.jpg
8f8b063725c6e894f5b37663a3982a7e
f9f8740b8d6a7525dbda2cf69c9ffb8ece682ae7
35767 F20110216_AACEFR reed_s_Page_082.QC.jpg
9a2807f0aea4d63f3f6864171c769844
384cf4abb6a4a99739d1a8309ed76be6bcb008d3
F20110216_AACDDE reed_s_Page_151.tif
c24654ce1466128e125be6d2b6de944d
c5de298e74f7ba322aa7f3d4e85658ac0cb1f94d
2792 F20110216_AACDCP reed_s_Page_092thm.jpg
ada85a1ecc607a62c7815c1660f7999c
36f491984f7bdbaab26fe6a3924f3b4e2f7edeb4
51665 F20110216_AACDZX reed_s_Page_111.pro
9c66793a2d3b6d9d4dbe4dd699f7aed4
20d6d352df5d05f4fdd42f266f9966095005d378
19911 F20110216_AACEGH reed_s_Page_095.jpg
6f74a6cd1a9278ba9c81d1d98985556d
52b34267c249aa79667b889330a25bef0d3a7877
101465 F20110216_AACEFS reed_s_Page_083.jpg
6d12f359524e020db616ab6bd9beb170
7442d136a6160972b595cf3dd4a64062b103f4d0
30440 F20110216_AACDDF reed_s_Page_055.QC.jpg
03f2b522ea442b2da76a8cd62c922796
fe5fa4c88ea798131fce260fefbfd39b805280ac
F20110216_AACDCQ reed_s_Page_165.tif
8a602b8c3d63f5e6b475552d5c577b1c
a5f9fca27928054a0a2d140efb0f998170e33be5
55968 F20110216_AACDZY reed_s_Page_112.pro
bce5f5a81c8ff3b0af887dc4879d0312
a11c5faf52256e085f030e0274123c3afcaf05a2
6535 F20110216_AACEGI reed_s_Page_095.QC.jpg
4d8cf94cf8dc6cc8c8887e5825eccb98
84f81657b105eaf360331c706e3f473ca215345b
103226 F20110216_AACEFT reed_s_Page_084.jpg
5f86ba74f1e3c012575a3161557957e6
252c4d9a8dd842180eb966d4964e6a1666a912f5
113527 F20110216_AACDDG reed_s_Page_113.jpg
b2d5d0b9a20e162f42da01e7c3fb6067
b289408d3f217204fde87ffb743ddd4a5957fd96
2212 F20110216_AACDCR reed_s_Page_048.txt
e50053a599e61ace5681e117894f512c
4bf836c76f7f908666a06decb3f8912371fbadeb
54685 F20110216_AACDZZ reed_s_Page_113.pro
d26a428c99c40afb4542c2a05857cad8
4dedeb6e92cf0abe9b01ca886e564159ca729636
38347 F20110216_AACEGJ reed_s_Page_096.jpg
e9e52d6166ee494e0f8b6ee64ebce043
40bbbf2d5b021d23185d9e384cc34d7bd4e98e98
34712 F20110216_AACEFU reed_s_Page_084.QC.jpg
7ccc368292aa60959924d1619e778015
65fced2a9212e49f68948159cb2fc3ae7b68f9d3
12324 F20110216_AACDCS reed_s_Page_122.QC.jpg
8942582df6f976f3e842c8de130b76c8
1bb2cba9e97a78c6a0a64f1180237e1d659f9e99
F20110216_AACDDH reed_s_Page_143.tif
afe67d94bb36f96c2f8f77d7b04de2ad
27a64465a10651a6dc103aea2e0ff5ab5e39257c
12359 F20110216_AACEGK reed_s_Page_096.QC.jpg
5124db0d0344d6a97afed15ad156a2f4
dff5ada55eee1a56b0e763a6307edb9344eb5116
106129 F20110216_AACEFV reed_s_Page_085.jpg
a2c67297acbb0a02209b0c17001f31df
6eb1cd02de89ace42e80ac3f5e8448b0f173f3ab
8968 F20110216_AACDCT reed_s_Page_081thm.jpg
dec02e221bf168ca62e1385029631a10
8bcbc1cd5683a9ff7ab035f95ea9a7df5eae6ef6
150771 F20110216_AACDDI reed_s_Page_157.jp2
0a9129a62c2786ed174ec139758f7f53
1e0286f9739eafaecabd87478604ab9bd427447f
29949 F20110216_AACEGL reed_s_Page_097.jpg
17689f70ba30aadfe6d0da9614c3a4a0
d587a92e4cbf36baa826415d313b2c0d79942d45
106253 F20110216_AACEFW reed_s_Page_086.jpg
babc78bf832c4769b8e22800317591f3
4108ba46775342068f291b76e6fac367733bd120
2240 F20110216_AACDCU reed_s_Page_052.txt
43afb11fea8020c7a1a64d0233013808
55b2712fa99cbc5b6031928f44962fdd46595cc4
46510 F20110216_AACDDJ reed_s_Page_127.jpg
fcaeb202291a4833a5e73df3d2279da2
3c078806fe9743035e35808dee2df4140a9bb454
32872 F20110216_AACEHA reed_s_Page_106.QC.jpg
51974139b5d74a1d1d87773fab339ce0
a90bbabc59a013dcd032bf1341b1661c1af9e9f5
9278 F20110216_AACEGM reed_s_Page_097.QC.jpg
b9631fd0003a9a9540918495b03a24c9
8f44cc6ff04ecdaecb4d504cbb29095cf2295ae1
34471 F20110216_AACEFX reed_s_Page_086.QC.jpg
5daa1a5b568560d4b774a66a03e97f35
75a816d4038e182ab32a2dca3ff567cddd789ceb
F20110216_AACDCV reed_s_Page_086.tif
aea5234fd25fa20fa32e48ac45d9afd1
b870c7d8bf79c42ab7c87932710a7d084cf8368d
47616 F20110216_AACDDK reed_s_Page_106.pro
80934395a0a7dd7c7318fd4aae94d537
f98d35ef8c8b5025ead8cf7a4aa0e3bdb2a02a11
107097 F20110216_AACEHB reed_s_Page_107.jpg
a3ff3d5f9c4176c51fded2ac984ce1af
d7acb53ad45c78651e44cb6b641602c34af151e8
10722 F20110216_AACEGN reed_s_Page_098.QC.jpg
56209dcdf223ae876f94c5cad0e452a9
b9a6f53a0913c6662f99802ca0ec91d09a351afe
110064 F20110216_AACEFY reed_s_Page_088.jpg
b371b8aaee9079e9ab32f0fad4a484d8
8d25d0e3cbbc9b8f7f931f08c50107fa4f77b6d7
575 F20110216_AACDCW reed_s_Page_124.txt
51fbb5ff92fb3a97f283340982535fd2
e2f07f04b16031be037a4b0effb97182389c64a9
135121 F20110216_AACDDL reed_s_Page_152.jpg
5a20404874c244779a8104be95872dd1
51dfd0498353b8de7f0d086841d797a084978816
36212 F20110216_AACEHC reed_s_Page_107.QC.jpg
f5b3b580ab21e923196af58e5e25bc66
3ffe61acca4fb3148be8e6fcaba42237b14fb160
21395 F20110216_AACEGO reed_s_Page_099.jpg
00104588d85f2a2cf82bf78ca369dfcf
f982a1ffb947fbc52dc2e14113ba10ee5c2502b5
35788 F20110216_AACEFZ reed_s_Page_088.QC.jpg
ceeb24755f912f1568c9ccfaca08eb56
3f4a8ad0b4b439bccf425f9db0a375ed79fa7122
F20110216_AACDCX reed_s_Page_167.tif
e51dabe5d2800f70aeb9a80a5c4f361f
3e53b7558591f511767c11ea4a881b43b9335fef
114038 F20110216_AACDEA reed_s_Page_066.jp2
41e419ec9d3b4cd330f6d7e7296dcfd5
8720cc9162241d28af75b0e3c1ee87d300f5cf6e
39632 F20110216_AACDDM reed_s_Page_163.QC.jpg
b908615fabda069aed7ff22be799fb8c
197721b8c6d62aea116fa2d9474d61f253b612cc
102409 F20110216_AACEHD reed_s_Page_108.jpg
12b2126042a3639399c3151cd6665bca
79676ca81de36f06912c9ebbd34d6e72a2df4c37
7275 F20110216_AACEGP reed_s_Page_099.QC.jpg
afc3fbfdb0f2efb4b5b7badbe69087d7
8e2088be57fa3696cddcaf1a82c492655c0dcbc5
114945 F20110216_AACDCY reed_s_Page_032.jp2
92ff6fdb0441eb2ef77263d3c14a5054
d14ade8a8e761824d7e46ded85e39d727d7eefe4
142785 F20110216_AACDEB reed_s_Page_169.jp2
aa46495aec1ee1ab9446012384c26ab8
046f97e1fa59607ba779f8751512c159063e5a03
36315 F20110216_AACDDN reed_s_Page_087.QC.jpg
9012bcbb290a4a0b80bf6b324175b417
8d4256ae0de3037fe3c3bf6b56fcd868a37a34f6
39462 F20110216_AACEHE reed_s_Page_109.QC.jpg
780169d919dd46e2481b4d992ffa2dec
add772e0cda9bbf6f2b7af4ffc9ce6b2ef5247e2
34920 F20110216_AACDCZ reed_s_Page_032.QC.jpg
92d7a031c47c12ef14c1472d42ffba0c
f227679e23f54af90e312125c151814ff2c6c74f
520844 F20110216_AACDEC reed_s_Page_073.jp2
698ddddb4e9b9f64bd13812bbceace18
46d3089e9785d85f3bc4faa77948918b15e01410
109773 F20110216_AACEHF reed_s_Page_110.jpg
c6a2ae6378dbaceaea32554727f83b67
d06f0b5e861ace0d82619fc4c3d1dcd91fea54b0
56680 F20110216_AACEGQ reed_s_Page_100.jpg
557af6233ec447cf01356af7ebe938d1
bafb512bb987d15f69e623f6dc453f1dfd3b22ad
394736 F20110216_AACDED reed_s_Page_119.jp2
2e833a660a6070222ef2778de17da838
49605fd4c19262274e69f9dc20e5132335826b29
F20110216_AACDDO reed_s_Page_088.tif
e3e3c9e577ef7c64ce11c39b66866a9d
daade3e917ed407a20a1d1f00e805a3220d9dce4
36026 F20110216_AACEHG reed_s_Page_110.QC.jpg
ea4a1967af4c20da756afa16355a7616
9ecb3cdb62bf3e61563139dfaaef5520249a8a54
16457 F20110216_AACEGR reed_s_Page_100.QC.jpg
007aba17c21dddb35baed6e7783176e0
f3033b6b0beabf126a81130bbf83883117ae3b02
8585 F20110216_AACDEE reed_s_Page_132thm.jpg
1cd426df99ca241adb877158051fe103
90361f75c9b3fb4abf3d5fcb0540cdd9d0bfa33d
F20110216_AACDDP reed_s_Page_169.tif
5e1028cce2845b5af9e53fbd4d6fe5d9
0a01cdda0dbaf62710d4531cde12bf5ac2d75654
108588 F20110216_AACEHH reed_s_Page_111.jpg
d44f1a146e33cb9c81e4758bb4638416
95bf84efbd486197688c3cb13630a05e83f2b757
112562 F20110216_AACEGS reed_s_Page_101.jpg
a06c1a885ec0c6b637c53922c3745ab7
2be77d4daf8ad2d499f6c3d1c8727f1c78dd8876
109895 F20110216_AACDEF reed_s_Page_089.jpg
f3dce6c3b31f92e49d85b6644e71a41e
45148507275a9bf6eafe55517f15db91dba44c5a
F20110216_AACDDQ reed_s_Page_081.tif
3e795d9b4dfa943db2ab75781891eb6a
6b6b0b817d801a4313a2ad469b149705be0611dd
36471 F20110216_AACEHI reed_s_Page_111.QC.jpg
47de38300d9c48acb0410e185f2f72b5
dcad375a7de568c0bafaa7107bf074d57189c5e6
37521 F20110216_AACEGT reed_s_Page_101.QC.jpg
b9e506341f6575bea5b3a143e2c1db88
ea2d634d9d0c12341c6252a309596327bcfc537e
8664 F20110216_AACDEG reed_s_Page_107thm.jpg
3aa36f39066989363c9a3fd5d8750cda
cb00378e6560da62deba1617930eebe1c773696b
9007 F20110216_AACDDR reed_s_Page_065thm.jpg
1113ba7cec88d1682aba8444cabff82f
62f95701d2f3f11f563f2a484c2ca9570b9abeb0
113299 F20110216_AACEHJ reed_s_Page_112.jpg
0bc5df4b1c1abfcc16cba8ccb9a0bbe0
6ba211555c0a9070103d64bb8af5ce42c1584173
36304 F20110216_AACEGU reed_s_Page_102.QC.jpg
1355685adb16aaaba9ef90c9995ced77
ee247f6184ab747824ee135beb6923ffca1ab072
77299 F20110216_AACDEH reed_s_Page_145.pro
b19d4e04f987930895ffb61dc46b68a5
b8a31551a134a431dc47e0eb28a5a09eefbfce42
F20110216_AACDDS reed_s_Page_120.tif
b2348944d41ae08e69f9684d6b703daa
500470a5d976aa67d00107cdf7829644c1b0417c
37013 F20110216_AACEHK reed_s_Page_112.QC.jpg
ea271616ef025d56065802ad68dd8f6b
6f0fb8fe2d33be2ef8da6176f5eb0eb46d1d975b
104540 F20110216_AACEGV reed_s_Page_103.jpg
6bf8be30abdecd2558fd2318c8eaaa3b
7570fafa9eb4e979c0af86d4afa0a445f3f32508
1969 F20110216_AACDEI reed_s_Page_103.txt
393e0d4d722459ee27377a0c5e8ced9a
062c7417a3ece89e85f69e79c33755d18a67c73d
416779 F20110216_AACDDT reed_s_Page_075.jp2
6625731b22a21400a6bb4a8ef612831e
882e1f71d4135358906be78badcd4f56799b1bb5
37298 F20110216_AACEHL reed_s_Page_113.QC.jpg
cddf046bc4f1ec104f00caedec3c3db7
67220d5b7e039c38acde7d6331c5f38aa55980c5
34715 F20110216_AACEGW reed_s_Page_103.QC.jpg
1fc3f42b374eecc10edd1adc9693d555
c9710cc221685874a1e58e1a313d4b817d2f99b5
52511 F20110216_AACDEJ reed_s_Page_022.pro
57fb0cb76cb9453e8f1be20526e6774d
d2fe85d27fca563ae2ee6bb86424f350b53d7c08
2980 F20110216_AACDDU reed_s_Page_161.txt
7cb3e54db2908590c0add52679e96e78
4d6f03c6642ac57948b1f299e79a4cc3bc55823b
53675 F20110216_AACEIA reed_s_Page_124.jpg
b8199398d81dc7752ff8cd882ec05318
0c198b36387f414496cea32bee9016ed0924bede
115554 F20110216_AACEHM reed_s_Page_114.jpg
a48c3c8f19f5ec4dd38e533c4fc53041
9ad64666ddad707e444a818198bdc0910e3e5484
36055 F20110216_AACEGX reed_s_Page_104.QC.jpg
a0d64cdddaf92e83ceeb3c446ad86113
e304d8db0342b53abc9e067c97f8ee6c85ed7ccd
1051921 F20110216_AACDEK reed_s_Page_008.jp2
932ddd49f6f09ddedbcfa16b0aad52ec
2baa15db76e6d9c110a3f8d58f5085cf2ad0414f
2220 F20110216_AACDDV reed_s_Page_023.txt
eef0760a99b2d5404344ec00c70e3212
12958cb44400f96669b756c90347adaf27fd4749
16212 F20110216_AACEIB reed_s_Page_124.QC.jpg
89c35749da38bb2b2a378008f641282e
993cd0617905b37bbd792baa43f96a9759876ecb
37372 F20110216_AACEHN reed_s_Page_114.QC.jpg
3455fc24c9f5da4e61f573cbbee8a8a8
cbb0698324ddcc75db74880baf6f03175d912b0a
33523 F20110216_AACEGY reed_s_Page_105.QC.jpg
51fcbfee83094000378216ad042179f0
193f067d8ebe33ee64473338e28f475b7951be8a
37945 F20110216_AACDEL reed_s_Page_150.QC.jpg
0e67c1d64795b0188b9110d5a74dee0f
17cf456b28ab3233be8eb4c4a9290b3bf8daf2aa
8306 F20110216_AACDDW reed_s_Page_137thm.jpg
663260e28bb4b7cef3180f1712c0f50b
7a630348a08d5131e76977142067de45e45eef43
13912 F20110216_AACEIC reed_s_Page_125.QC.jpg
54e674cd867b7b24eb666dfbb248a54e
a42f20acc8a8fe235385bbf929049880995c9b10
26640 F20110216_AACEHO reed_s_Page_115.jpg
c51a6f7e75047af82f761bf3d9f3b905
e4779c44bd30d170c2a44cdff21690a136fe783e
101762 F20110216_AACEGZ reed_s_Page_106.jpg
99a01c634303cb81de9d104438f3225f
78d96ac31917b0993bdcb58681edc9b4a592ef81
2175 F20110216_AACDFA reed_s_Page_017.txt
81b7c8f368167f1b4c2ee81d44a4efe1
abd9e4c6095c846e8479b7d690ec754d23f575e5
114221 F20110216_AACDEM reed_s_Page_065.jpg
12e180faded25cc274bab8f78a986962
6204b57d16c57acfb3cea4e2f985146d18306180
2258 F20110216_AACCZF reed_s_Page_026.txt
0a8574ce17cd24423a6e8e0f1547c2db
903cc2f9c025bf0733eb8933adc5c25792655062
9110 F20110216_AACDDX reed_s_Page_158thm.jpg
a2e2d1dcbdd23dd5cead4128b3f174f9
58e385177d9c0010e4ed2e1ace5440a78c633456
53025 F20110216_AACEID reed_s_Page_126.jpg
c765bea786d5b08d4fc0c5206aaf42c2
253928447bd9e30991164e03724ab859f430c9b0
9003 F20110216_AACEHP reed_s_Page_115.QC.jpg
0c49dad9e9c4e736eab155def3ca3b6f
32ed83b466b15f21675a7ed3a7f77ac43241eb92
49091 F20110216_AACDFB reed_s_Page_103.pro
e00f9531cefee6a9c66a1baa5ec36635
7fa938a6755bdfb71bff0f12fb0591157f6fb782
39215 F20110216_AACDEN reed_s_Page_094.jpg
e494479ef3853c8736da976cf5ffdd32
9186651629b0a2c11a8eb94ab42e270e4befd314
18682 F20110216_AACCZG reed_s_Page_125.pro
5ab03441e189135dd4d616ec2d9338a1
b7c57183ab383b9537550be4d385d89cef5f1ce2
2113 F20110216_AACDDY reed_s_Page_030.txt
efe02f981449f8cf3e11926634f10d33
557a5ac78f000159cab51bb81ca13c34977a7e1f
14858 F20110216_AACEIE reed_s_Page_127.QC.jpg
23f0be09674f017cce4645e35ee3e720
c737d980ad69793cf92b9770fc2b2e80f22aa4df
25356 F20110216_AACEHQ reed_s_Page_117.jpg
34fdad8ddf441f8af4489e22647d2d84
8b2e1244a18318173e535ad70ea1aefb817c7672
108815 F20110216_AACDFC reed_s_Page_108.jp2
7e71fdaaf828f9162afc98459bbe3556
fce9cabcea7a256ea898b57ffd04867d9d1e8f5a
2056 F20110216_AACDEO reed_s_Page_110.txt
9bc2a09a19f70b49b208392a543d4fec
8835b3b3d17919deb8d2deb96b31971b1cbf3f12
48856 F20110216_AACCZH reed_s_Page_073.jpg
2c27207e74f58e4e848a28aba809e1bb
c529cb9dd1c77cf432075927009963e0b3100eba
35658 F20110216_AACDDZ reed_s_Page_043.QC.jpg
cf2ac1177b2d22ba4e03790d7e6dd637
365bf4b6aa0effe78a071b8eada6349b507bb5a7
67944 F20110216_AACEIF reed_s_Page_128.jpg
5c2a7dac607d9367504c07c3c62a596e
eaa11914abdb7f6490267910fc836f8ee933544a
17233 F20110216_AACDFD reed_s_Page_143.pro
19b64311a6ddf9d70ef3f1ae37b38a8b
dcd3078e3918827c3094ef7e6c9c4c51691d1221
102864 F20110216_AACCZI reed_s_Page_007.pro
a6f29d1c2dca70bfac6d149efb735ab4
9ae497b4a487053f65e820cb57661b916e14fdc8
22149 F20110216_AACEIG reed_s_Page_128.QC.jpg
c7f2a4ef74e0f8a121fee6adeff62673
3443e3a146756bb788d22e2c8b50d902fc3049a2
25530 F20110216_AACEHR reed_s_Page_118.jpg
41712d8f88586ba246274b6dc1f1de0d
5bd2ea6c284a6a86abc6177db7ef057e8a0d4404
8890 F20110216_AACDFE reed_s_Page_047thm.jpg
1ff7fe48e7bc5f1f3efa29fb751fa1ae
c38acf5d3698e2c38fb930940df3da5ac992e09b
37923 F20110216_AACDEP reed_s_Page_023.QC.jpg
edeff954f70aea9e84582abeccbde482
298b22859f327777c4c866b78d4cc6b05e2c2c99
2817 F20110216_AACCZJ reed_s_Page_169.txt
bf86200ce109fff4b34b368ea2dea8f9
c8d579aef0a1fe9ed0d1ba6da05406e7625f91b4
64571 F20110216_AACEIH reed_s_Page_129.jpg
6935a149e5b717f6f3c4feb6b521e1f3
ab0609a72b19711de4fa06df13a970339d1a548a
8386 F20110216_AACEHS reed_s_Page_118.QC.jpg
6b74483fc441d7185e230117849c0f4d
e0efd1636b13dd7677ebcba1f6e6a1293d3e25f9
51367 F20110216_AACDFF reed_s_Page_066.pro
937255155ce426da0e6c1c976a5aecdd
3ac1ef4146e0ef6389c894eb745f1b0e7bee65d1
8538 F20110216_AACDEQ reed_s_Page_010thm.jpg
63f09b0d2ba0e167de577169299010d9
e078bd0be3471084e32220e82c5b71c4d3050530
112437 F20110216_AACCZK reed_s_Page_102.jpg
74f73579b917388b322f2e20b47ad2b2
7b6e5e10e23739601eb42315a8c724e0a41663e8
21391 F20110216_AACEII reed_s_Page_129.QC.jpg
7924cad04ba045e30385c8fb49472ac1
ff4fc1a5eb8c8ccc03a310cf73393318b8d53c6b
50837 F20110216_AACEHT reed_s_Page_119.jpg
6c35ce9dbf12bb601a2bbebe8f4b3a37
8bb70213ed8417ee9d02dd826f7c0546ba665c94
8803 F20110216_AACDFG reed_s_Page_030thm.jpg
160c656d385eca0dc7b2e8c3180c7c07
d5604cc0dc7b8dc855ed688e4d7378c49ad34908
33037 F20110216_AACDER reed_s_Page_137.QC.jpg
2b6f3e17cb301e49625ec01f27ba28ac
57caf28cdab2be5d2d33d35072c584729e549349
9439 F20110216_AACCZL reed_s_Page_157thm.jpg
21370d67d569a22105e186bc68128111
952349812a21c64cd365c3407f09253ca0db3e85
36374 F20110216_AACEIJ reed_s_Page_130.jpg
773e6c5d8b62776b8e32a0dcd090cb66
4bcdb5b5f67a03e78b93224593c14d5f639c04bc
15517 F20110216_AACEHU reed_s_Page_119.QC.jpg
9ddf2e9dd847e68343e378c5b6227604
3b516f80be425f3de344ff8f85b3a64bf4a7420c
9230 F20110216_AACDFH reed_s_Page_114thm.jpg
57b1fc2dbccd7a56584b402279bd932e
e6579733524f197a0e9704fd15c950fcaa3923ed
F20110216_AACDES reed_s_Page_013.tif
91778f90d6110b539a45e765da5e471a
857f3712a781138449ba3a56a4c029f7a9f62175
117242 F20110216_AACCZM reed_s_Page_017.jp2
40cb6e64eec8e52a0f32c8ccfbe690df
ae546776d5fb83a9f7631abd85662e300cfbbaa5
11848 F20110216_AACEIK reed_s_Page_130.QC.jpg
307a741c844848d77e51127a45bab21d
a0fefca9ea05b8b4449cbdf4e401149d4e569b7b
103356 F20110216_AACEHV reed_s_Page_120.jpg
3124376955f646f88023cbb8a5da983d
e5e8a6fa35b494c4f40a2f23932ed3f5d1036f0e
112368 F20110216_AACDFI reed_s_Page_134.jp2
a5668335d2b8950e3b92e86ed9e3c086
1ff73057a0f3a90f5ee682d77ab3bb03a7b2bb93
9834 F20110216_AACDET reed_s_Page_156thm.jpg
7e9827e72033a1ca747ea1a86c956321
64deccfc6bceefd3615d25c8d1a8d619d7f08fc3
42980 F20110216_AACCZN reed_s_Page_077.jpg
86387a2f751f5a1d9740f10c8a69f5ad
4cc35ecf29d56740c5a818c206b586c2c702e2a1
112383 F20110216_AACEIL reed_s_Page_131.jpg
cf500f023ff66b52bfdcaa42fd8ccd58
cd91035ec63e89628618324b769c5eaa8bc20dae
30243 F20110216_AACEHW reed_s_Page_120.QC.jpg
3f21da7f329ac4f1a68eb266a2478632
9f6707810157730bb5a67e989f3c4e2523e18c6b
109751 F20110216_AACDFJ reed_s_Page_064.jpg
eecdf8e64c0a233abd359bf3978f3803
e26e7593b4ed1fed73b16d38c6578d40a73dd390
155800 F20110216_AACDEU reed_s_Page_159.jp2
71dcc833aad3c57e7a86a450abd4a350
be4a0daead70a641312df70a44511aaa2b898396
149934 F20110216_AACCZO reed_s_Page_155.jpg
f321e082ccab55641525ed5baf024079
db973a0a58034b23fde0a512259221a34f0bbf44
42235 F20110216_AACEJA reed_s_Page_141.jpg
e26cdbbe8ba247507c46bf11808927cc
4520f531137142138574ee4dc0a0fb7f025ca5d7
36703 F20110216_AACEIM reed_s_Page_131.QC.jpg
afaf7b5d8fc01cffe6c909573a3a2052
f34eee55f9f94eb50a95f6882495d1faf0d12181
97429 F20110216_AACEHX reed_s_Page_121.jpg
5e360965a5274269cd2567c17e6c7c52
75f87e7dcd246d7ca188bbbeb907b2640ad85c5b
148857 F20110216_AACDFK reed_s_Page_158.jp2
0d958e00d7bc743dc5cdc477b3f64203
cb90374c6e672b84de48030a69cd5b0c9cc51224
98283 F20110216_AACDEV reed_s_Page_006.pro
2dd222d73f93955f54932567e5866635
ad6cb93140160431cf71545cebc58efc56a77b9a
48041 F20110216_AACCZP reed_s_Page_013.jpg
faac928e06226bab4a842ab8d86dfd8e
a63312b62bd13d6653f45d6523125e0901ede122
13836 F20110216_AACEJB reed_s_Page_141.QC.jpg
d164066d841ed17516a93c7d246034b8
ba1d3e849bf398a348415528bf957d738574cecb
103619 F20110216_AACEIN reed_s_Page_132.jpg
8d6277a78628d14e5c92c16bf187b7d6
cfd248a8a1922e0cb3b82104fa29ca6664062318
28285 F20110216_AACEHY reed_s_Page_121.QC.jpg
f8ea0542fceb7187928f4b9335113304
e271df17a702824c110c0a50dfdbbbd57e4d9430
F20110216_AACDFL reed_s_Page_070.tif
7b794f5c5f65370eedf6e550dfe38abc
c34f024e2a6f1a6152bdf61fa216b861e18fd941
F20110216_AACDEW reed_s_Page_154.tif
abdb267b49fc4bebffd199706ce4fa95
ea65cdb64b112496b53cbea41c72705e3d7ccbb2
47547 F20110216_AACCZQ reed_s_Page_091.jpg
14894f5ecfe2865d0638b59517c17081
fd52d6e79c8282e24379e6f5c424b72d13e66ada
130882 F20110216_AACEJC reed_s_Page_142.jpg
d08583c062b9521e4a6d0a01a5e35d09
0b10de42f8bc0b32d904a40c12b657f80dc9ea8f
33628 F20110216_AACEIO reed_s_Page_132.QC.jpg
71ade830e6064ea07e63f0e4967b19b6
32f35e27accd21755f1cbd58a71535106ff09e5f
22579 F20110216_AACEHZ reed_s_Page_123.jpg
45075f7cf46afdb4d02dda816ce77537
3dfc9b78b0aaa4800030b8c499ca1cc351ba75d8
36736 F20110216_AACDFM reed_s_Page_081.QC.jpg
2b8cccedf4633cf2c248b67df0c1c46e
eb77a2b6d0da51f99a0a2658fed442f52a67e36f
1051936 F20110216_AACDEX reed_s_Page_060.jp2
d8da96f47196bedfd0063f865e26b1d2
7370de49679e41ded21bb24d553c24a03451742b
109292 F20110216_AACCZR reed_s_Page_084.jp2
2de1c1ae66c90e53fdc5563202e24af2
d80620f78191b5f01147fcf93734c85f8cc4ce7d
153737 F20110216_AACDGA reed_s_Page_151.jp2
d519c7cf0bf4d2c0be77f565b29f2e03
6f0b38244900b9d38846975053e0ad34c91cd216
50828 F20110216_AACEJD reed_s_Page_143.jpg
9af2506807870a9fb202e1abccbc3928
3ad7220e0df778350db477e34ddfc177dc899623
113892 F20110216_AACEIP reed_s_Page_133.jpg
86f1de5cad3cc92d3f0e47e3f39ddfbd
a50741117c9da7ff0927206959997340b33884f8
4381 F20110216_AACDFN reed_s_Page_135thm.jpg
343c6e704de67abbe2caa60cc1bf92d6
98693bfc91bdd6240f288a22082c50144e860a9b
13255 F20110216_AACDEY reed_s_Page_056.pro
8f1767faee219ac64837b22cb8c79201
aff39e55469b43dd08ed3905fd7855a713e7084c
9087 F20110216_AACCZS reed_s_Page_133thm.jpg
aff197f7b1aebe7381038f5e96f40e57
bd785acf197add7e4e6943f80422528b42198142
8170 F20110216_AACDGB reed_s_Page_079thm.jpg
af7744e1b928733ec82f2e90cb9cab15
be7846d218340356af288d862a96fc7af72f77e1
15207 F20110216_AACEJE reed_s_Page_143.QC.jpg
6fd2da033c4110c7e32f5243819ea2c5
e87ce3758c88203fcf863ff657ab60be6d5c7e2a
37104 F20110216_AACEIQ reed_s_Page_133.QC.jpg
077d22a32cbaa2e5da794456759d3173
42afe853290c780e0e9072df4640609d76daf81d
804 F20110216_AACDFO reed_s_Page_119.txt
4f087d5260c7f0574aefec306d6e6222
148090e9162bb02a8c2e5f2740338e3f345c1839
34726 F20110216_AACDEZ reed_s_Page_085.QC.jpg
28aa756aed044805ad794021c536a1d9
40ec265620e7acdcd820db417b596bab113eadc2
8856 F20110216_AACCZT reed_s_Page_041thm.jpg
38a4dc7ee1be93c7c09e91d1bdfc37f8
79484d8a79f9462503ded8d7c4ad66403200af6c
115753 F20110216_AACDGC reed_s_Page_006.jpg
906977d26fe500d0e2c6b442f21417b2
50830526cff8ba4a55dd5c6c6b64e6b6792a9e05
135022 F20110216_AACEJF reed_s_Page_144.jpg
e18009905c60d06401b7f095836a41cc
60942a3a403302d0ac26014a1d8ef04456430bbf
105747 F20110216_AACEIR reed_s_Page_134.jpg
8031c5070f212aed02300e0a5c9e609b
c0e939c98896e029bf10b14a2fb693cb6ab30457
F20110216_AACDFP reed_s_Page_020.tif
2bbd42705038ee5e90ae2f10b9e97bee
7067fde83a33622c0a14f613bdae3138bacf314f
F20110216_AACCZU reed_s_Page_105.tif
27c7ce4a9a6deecb7a10f8285a1bc4fa
6dc51dfd03ac5181d51e5f1b552e77905f37f369
2974 F20110216_AACDGD reed_s_Page_162.txt
34240f78d7b6606f1e39f136971778bc
6101e033d7716a20e3aed5d4ce2c63b85cb3e177
41151 F20110216_AACEJG reed_s_Page_145.QC.jpg
f18085c36ce585e46e47cbc79761de2a
aa99565b91e7be2ecebc7c8f32775b4ad38bc9c9
2012 F20110216_AACCZV reed_s_Page_104.txt
dbfc69ad2cf4c15baaeb6880cc850e86
e24fdcae9586db472fbe8f0ac0e255312622faf3
33332 F20110216_AACDGE reed_s_Page_062.QC.jpg
d39fd1d94b0f745788d00fedd731a29e
c5f53d40335945f2e4e84936f8356606f51fe141
139363 F20110216_AACEJH reed_s_Page_146.jpg
6024e5108b23d8c7021672734e8a004f
d5e473416a87a33c0a16aee157b7ebd943d26e69
34800 F20110216_AACEIS reed_s_Page_134.QC.jpg
5e9eac0408b209caa27089cadcfe5b2b
aee91720fad30ee0362b16621ddd570322e6ead4
1051938 F20110216_AACDFQ reed_s_Page_069.jp2
982168def6445753d05b9cb5c4a51c4c
4ca0ab3ed6b18de739157f7bc8af4270a34684e5
F20110216_AACCZW reed_s_Page_160.tif
70f3b4c7d22e69678c3af9ab666882cb
0a8765192e13ef1a011105c42db91c340b292b8b
F20110216_AACDGF reed_s_Page_057.tif
b712f6496409e65bcd4d140d00bfe9fb
7411ce1135395903b37900b2c5bdbbe3e0ed9a78
147828 F20110216_AACEJI reed_s_Page_147.jpg
15874e34e54e889b6068e4f406ef3c88
0ad18486b9e97808cb3695382e4cff1bd127d33b
52198 F20110216_AACEIT reed_s_Page_135.jpg
75d85f473d3bab2c7e2b9a5fdf57a67a
adb842363c0de1cf081de7ce4aa03a128911c0ab
6102 F20110216_AACDFR reed_s_Page_006thm.jpg
7ad75d315f9728a644646ba178a161da
a7f6a671da04c83176315837c12cfc44853456b4
11521 F20110216_AACCZX reed_s_Page_094.QC.jpg
450810d50cfe2b48f25ce33cf95e3828
1bbf2c73032011c8200fd1a08ae2f569c2d2a694
5104 F20110216_AACDGG reed_s_Page_002.jp2
0245dd7fe920ed339c734b92e989a549
b10e4ba72f16b1fde3e7205725cb4fee6b19fcfe
41493 F20110216_AACEJJ reed_s_Page_147.QC.jpg
a0fefa1c8f69d285f5233127c66264bb
8c7d53d3827af256099e9cf2bc927672c02921b6
17259 F20110216_AACEIU reed_s_Page_135.QC.jpg
26775692593e456a0098359499f1858c
9ebebb08c4e41389d86b316b4ce67131408ca163
3235 F20110216_AACDFS reed_s_Page_098thm.jpg
a33a097f5cd78d54b402ee58154c3e77
a6ff57f3353c85105ce9ec5ab7769e2a3cdac41c
117459 F20110216_AACCZY reed_s_Page_039.jpg
9cba9882277e9f32139a62d457792994
1299e682b63304563f14b7e1f02057ba94983922
8339 F20110216_AACDGH reed_s_Page_103thm.jpg
25e401055a2f501cabd2ae60f065c75d
cd15e7c6bcf34644ea3c6d3569b3cd03d370faca
131727 F20110216_AACEJK reed_s_Page_149.jpg
e1d4572a48c1963c7504f41e89022a1a
2996affb341dd93c31517fff085ec3da5e5476d2
103502 F20110216_AACEIV reed_s_Page_136.jpg
e0623fb89be4576a1a18df154e25e16c
e019e55a15d90a0e10039989f716524bc4fce07c
F20110216_AACDFT reed_s_Page_023.tif
e16a01702041b94c2415864d7ee2132c
71706bd102ae082888646681b254c208dc836997
108390 F20110216_AACCZZ reed_s_Page_138.jpg
78b7dad699138d480ec3d77c8286cc64
e93e83ea1cf2a7017f5d4ef0d72db624ba154faa
142507 F20110216_AACDGI reed_s_Page_153.jpg
10bd3a854e524400022df218e7527c19
7a2bf7bdc2b2ea661c550902fc7beb581c4f5ba1
133091 F20110216_AACEJL reed_s_Page_150.jpg
edb419a3bfe5a1879dac591ba62002b6
940970f1a6df7bda4518e2201ff1b8329de08241
99918 F20110216_AACEIW reed_s_Page_137.jpg
381b6b7827f08cb93fada75cfed2435e
cb4936d909eb54080e017154bff5159faaed3382
F20110216_AACDFU reed_s_Page_131.tif
61ee38075673700fe4d0512a66f02114
27951eec3c61fe542627e50e1110998f4b648617
F20110216_AACDGJ reed_s_Page_159.tif
c9937e41b9a9aa5352a98b57de8644ba
f83446eca601c7adcc7c431231b9b544657b7671
40419 F20110216_AACEKA reed_s_Page_159.QC.jpg
57009dde9e7097bba622231ca14e243e
6bd06891801798020e41000b377e347d30f86482
146692 F20110216_AACEJM reed_s_Page_151.jpg
81be89b4398654ac36a4a44e04a5942f
46dbf92e2b40aa2859980a6c16b6b8e715ba350e
35817 F20110216_AACEIX reed_s_Page_138.QC.jpg
7752fc59a91afbc54e6d70c669e2e9ff
2c0be05235bc6b3d88c9e6b851698b6821f15dc6
F20110216_AACDFV reed_s_Page_135.tif
d0b17e4876a87505254dced40f6e00cd
37bf1615b934a833afeb2ed2a8a0336f7583cec2
2938 F20110216_AACDGK reed_s_Page_163.txt
c45403a609915bcd5834e7ee2169af2c
11276a16333f737e45a1151293077317b7fbec56
144704 F20110216_AACEKB reed_s_Page_160.jpg
4cbe886bb4c473036ee9caf340b2abf1
b81f5d2a5fb65d4208af75813e6c539cd19105cf
40614 F20110216_AACEJN reed_s_Page_151.QC.jpg
f71361866dd9bebd097b3f70156a99a1
5a8195180c3468969d497b6aa96e98cd7731f853
15397 F20110216_AACEIY reed_s_Page_139.QC.jpg
c89cd8eff04e04791db7ca544cda8e34
5b7b9758f018ca3c8655a30b231fdb935506f600
123933 F20110216_AACDFW reed_s_Page_050.jp2
bf9780c2cef5e59c52cfa5f9445a6b7c
bd5f4b3ced46bdd5a3c9c14ce93411050174b8ea
25271604 F20110216_AACDGL reed_s_Page_140.tif
43d98474d9f74261d0ef6b5a5237a669
7893caec238e29470c5ddedf6c3ebeacb040a602
39656 F20110216_AACEKC reed_s_Page_160.QC.jpg
cbab2e0aa01d660d97b02b26440ef77a
e270a33215aaeb5ce6c2f48e25ca1383cc3c298d
38794 F20110216_AACEJO reed_s_Page_152.QC.jpg
f623e36a55c6c162778e570e83d68fa0
9e5d7bf9178d07842dd1de147ca5455ac7ac0860
48027 F20110216_AACEIZ reed_s_Page_140.jpg
c09b0a9b48c8a62211bb4ccbc39bff3f
a1373d3861504c939e0f399d5f3bb51fe04f6b69
113862 F20110216_AACDFX reed_s_Page_040.jpg
c0aa956dc7b417ead1d6b0255d77fbcb
731c29a0b993848adef28076f4d88db628d55fc2
1895 F20110216_AACDHA reed_s_Page_099thm.jpg
2b953146f6a9f7b8cf22d87d5d5527e4
f010a85d3ef5d3f02780135358c93860a1faaaf4
F20110216_AACDGM reed_s_Page_039.tif
8e4acc4d64097b264825be4236b4ba41
6fb31641c9a2b96381cc2806ae44611826d5df5f
141472 F20110216_AACEKD reed_s_Page_161.jpg
39afa5110bcbd25d2112d4bbc990a789
c4815fb1146dc60fedaade5937ff245df9ab9d00
39950 F20110216_AACEJP reed_s_Page_153.QC.jpg
244787f71968a255826672135a717987
871b5ced5cf6463d8803595ea90e5eca576a8047
8520 F20110216_AACDFY reed_s_Page_060thm.jpg
e3a79c10b4c4a7ad2ae3b37879f00b39
84088a257bcda3e7b8e2d6da62ec9f68adbfc33c
9040 F20110216_AACDHB reed_s_Page_051thm.jpg
f0e082889c46555600f7416ebaf740ec
364da4b72c4a6067008b6e32cea63a2035ccedc8
39275 F20110216_AACDGN reed_s_Page_148.QC.jpg
362805aa873fadadbea5a9b9b11b0b4c
74e3e67d3f6d42281384eeca61aae8cd0b08432b
39334 F20110216_AACEKE reed_s_Page_161.QC.jpg
6c50f257b3249a5448b32e288b7adbc3
ac015092b02fd4915c3d34d9e580e29cfdeae63a
134836 F20110216_AACEJQ reed_s_Page_154.jpg
81c7c99e93ec901b99e3980f4a8e9816
eff8310f92ef5e159a129dad11901225f368f4ce
F20110216_AACDFZ reed_s_Page_132.tif
ef259c2503e4738ac94ef49c01477e84
091eecf83a011b7ea99f8034652c8b56de32e149
2060 F20110216_AACDHC reed_s_Page_085.txt
4f1df48e9523979c6a95fe85a301dbfa
3c5419f5cac6d03c8d2ec87d78a820a865107d3e
10093 F20110216_AACDGO reed_s_Page_072.pro
a5d14686ea2642f5ff9899f10d212abb
defdd424552479c477759af30e9aebcf24ef49bc
139933 F20110216_AACEKF reed_s_Page_162.jpg
5c4b9e7a6da977777f22eee8fd4fd525
b8b9b300671a3da70402dccdbdd5ba6287726446
37253 F20110216_AACEJR reed_s_Page_154.QC.jpg
77eff0cb39e8e0a08207c7e976566395
174d58e4537aff8604942849579c16fa44e3f721
116295 F20110216_AACDHD reed_s_Page_070.jpg
5d56e2a5fe217ff19732bea3d4459792
089ade7d56a3cc5dd32deac660636c87827a14c9
33601 F20110216_AACDGP reed_s_Page_136.QC.jpg
7ca098720fc46d5e650654031a6b0b5c
306e9f28d874225b44c757782b2fc048f2241b2e
141993 F20110216_AACEKG reed_s_Page_163.jpg
f1100509712550a2abf3b0367eeb60e2
12ddd643e7a0c5dfa102397c17a91c59d1359dd7
41406 F20110216_AACEJS reed_s_Page_155.QC.jpg
66d8349c3e2f65eadf493056dd039066
5dc1db3f9ebb00282af05c20e19f36ec18e7e63e
109110 F20110216_AACDHE reed_s_Page_078.jpg
05d722a93b5e119c94bb06cb579ab43c
6c5bff923e67f5cd9e381649282f1fba55451ee9
149775 F20110216_AACDGQ reed_s_Page_160.jp2
d52044794d780184e71c8976a60ac5b0
ef6ec3b4efa4a25e8d0d43683355f2de9b1e2dfd
38578 F20110216_AACEKH reed_s_Page_164.QC.jpg
993abc62428f9f957b44ae014eeb2718
def0d7e4ccef0b53f726453dce8af104eb9e9cbb
F20110216_AACDHF reed_s_Page_046.tif
d51595a73fad0d987acfc8e53f3eb89d
9791fd938e34baa7ee09142597b911bd484cbd8b
145914 F20110216_AACEKI reed_s_Page_165.jpg
e25cb46bab0e1ea042e675ad119b2784
10b11bc10bdb820fd603a98196b933c30b72ba30
147882 F20110216_AACEJT reed_s_Page_156.jpg
51295d039d167560c3ae7e3c917ad871
7097389e5f0819f63bdd82f3f2e71344b5edca1a
38093 F20110216_AACDHG reed_s_Page_053.QC.jpg
90a0d3e818a746f7c3efb0c1fe92f33c
4a36a25c06b2e743d92b45398a5f3e86d3689ab0
8247 F20110216_AACDGR reed_s_Page_084thm.jpg
41b8c71dc29859d6f33de22b7eef7bfa
238423d000f5e3cd9d8e2d3a0aae6880e3bb8b51
146050 F20110216_AACEKJ reed_s_Page_166.jpg
ca965901c2e306a85f072e5684e2cc6b
fba7bb67fe58f67b5010ac40a68e116710698095
40566 F20110216_AACEJU reed_s_Page_156.QC.jpg
2dd6addc0896ecc9ca9bb26c641a7d35
2626cdd7630a6d6bec559174d0bd58d7cf0f2f23
38062 F20110216_AACDHH reed_s_Page_019.QC.jpg
3cdf6883135e6f00554ae72c81807f00
ed6fe47dbec1f4d6a68ee2daa80fad005cd7ce75
6753 F20110216_AACDGS reed_s_Page_123.QC.jpg
5ab4086c6b31727188461537cf974e3c
bd5663f1219d1af79fe8a37809de17eae9a28582
40569 F20110216_AACEKK reed_s_Page_166.QC.jpg
30909dafdba8b60f366bae67512b6b2b
49e82bc4e4aa20fa5a06710b0f5df20ebb9ce63c
144192 F20110216_AACEJV reed_s_Page_157.jpg
2a73f1230ff7d3b4081417902aeb2a14
02379c6258801a1963859a4de8856cf49cc1714e
46158 F20110216_AACDHI reed_s_Page_055.pro
1f5bc5c2efe794f6469a024eae101f0e
b154b54267957b1490270a33a5a6db6cff51ca1b
F20110216_AACDGT reed_s_Page_014.tif
0aeee50f1341f6db33bd65e81042c991
1e203184ec3cd3704673340176aa5b26c17c7df2
142719 F20110216_AACEKL reed_s_Page_167.jpg
e4287598a428243eee237cf5b2ce7fca
57ea96927676f8e7f4a317c427ca3eaff6eb9979
40106 F20110216_AACEJW reed_s_Page_157.QC.jpg
6cfb5edf243dcde2a389323340b933d0
3b42eb236d14b7645d1fad717785b379e2b204f8
2173 F20110216_AACDHJ reed_s_Page_020.txt
37ce76cec14776d8a5af4b1a4f5e579a
6c2ed0e6de41985c44d139c5ea9c05fbf6f1edcd
50246 F20110216_AACDGU reed_s_Page_027.pro
2bbc97e55a6e9fe551af4be39be40b4f
2dec181201f92f7620d576959fdd714139802f69
51481 F20110216_AACELA reed_s_Page_013.jp2
ab31bff76e2fc3895b3474fee7b745d9
7bf307f2e900e163426268d56aa1f5dc3b3e1cc7
39827 F20110216_AACEKM reed_s_Page_167.QC.jpg
6ce8376e12ce8e3be6c9f5f9ef080858
81837b8795d062c543f94fbb9e3188dd599a598a
144664 F20110216_AACEJX reed_s_Page_158.jpg
0575a4aa5dde5ea2746f7084a43ea664
b04a15946f46ab8699600a247c8244df99d4efc5
38189 F20110216_AACDHK reed_s_Page_065.QC.jpg
37f20d37419a0cc42b1ded52a0a428c6
7dcba78e6785cf73a086656aaafb1527b278af90
73582 F20110216_AACDGV reed_s_Page_153.pro
d99cf6ef3e1ec6b0034ed6c52e585cda
b6b1da11cb80970bb1fcb57a52e4daa899b68aad
110445 F20110216_AACELB reed_s_Page_014.jp2
5ddb4bfdd3e3950b0646985f69388a19
1126762f41da2561a4369f859b3d4c1b397f7858
132751 F20110216_AACEKN reed_s_Page_168.jpg
90e347703c7f8f498a61a9781c2b727a
f335fed2c3e1788af8c103818f8e228fd75cdb84
39422 F20110216_AACEJY reed_s_Page_158.QC.jpg
e6a8f9c0bfca2625762f8460bf48ff9b
790f31d97ddb857b1cb966924c1b2260377b2f0c
34051 F20110216_AACDHL reed_s_Page_027.QC.jpg
bfc1601b1c3a6d39aabbea2fc3edcf0f
db2e358e57b5a39ae9897633d71a35b71778d4c9
110661 F20110216_AACDGW reed_s_Page_004.jpg
caa9edaee6085bac6321df12569914af
0659bd715aaf01f347e0f18732ed5792b5f6489c
119287 F20110216_AACELC reed_s_Page_015.jp2
5e7afcbd6a0d786899fdb2e0ab79e78f
6aab29c444bf2a587a17182a173f0bf00d0da610
37786 F20110216_AACEKO reed_s_Page_168.QC.jpg
7a69b19be4963b03d65ec62b45fb36a3
c9db00ea4516ce4e0041db443521bff0d7999387
143755 F20110216_AACEJZ reed_s_Page_159.jpg
dc577580f6a8c6af5d2a811deb2d6a6c
ac5cdd2dd0b21b5a97343673333837352fa7448f
9279 F20110216_AACDIA reed_s_Page_052thm.jpg
c229dc27ad51008cdb2cbc16728538fc
96220e1a04176a1acb807b9d1f2a158e3e76de06
51988 F20110216_AACDHM reed_s_Page_116.jpg
f8d3a19b2c6cfd3664c7ab53376737d9
18b9cc3b2603e361c5c8c11921a4dec43d55d77f
49094 F20110216_AACDGX reed_s_Page_142.pro
ebd2a35a9e7b3e5619dec29054f143e8
1b85948b04e3f18c545b57106ffccd5b693ec4b5
122755 F20110216_AACELD reed_s_Page_016.jp2
e915175a34c2729886a830ec67c7a57d
191022561af28d5c16a1a8f85e9bc5dfb824ddc5
37960 F20110216_AACEKP reed_s_Page_169.QC.jpg
ab8d3eb910264a9d2133554fefc2e2a8
5a816f24fe07f563beba7594bc37e14283e80293
10609 F20110216_AACDIB reed_s_Page_003.jp2
ddb14171a5d56263b87e0dbe07e67827
e0fefb2e4444873980583cff6b0f064e2e5f2b45
51348 F20110216_AACDHN reed_s_Page_086.pro
5f6cbbb02edc74e3763ebeb29243a8c3
cce9e7386f0360ff7b59ae1b04530eb01e09ffe1
46922 F20110216_AACDGY reed_s_Page_139.jpg
4da63e78909b66780d5ad027677f067e
fa4b3001fc7d03ed0a37ae426b4804844bbe95a2
118442 F20110216_AACELE reed_s_Page_018.jp2
472ec6a02221a34d0750086b3795c0e5
127de6dede4fe1f6399ecb8f2e39402b4b254084
25606 F20110216_AACEKQ reed_s_Page_170.jpg
ea33a748b3ff0e2f85cfdfcac7adea5e
b3e8ac89c71300e31bf8e1f0a1ffcc31a91b2c9e
F20110216_AACDIC reed_s_Page_171.tif
8b2b595abebb6f9aa546785cf885c1df
cf4a95e5abfd5eb52801038f650c2cee4661bd83
107358 F20110216_AACDHO reed_s_Page_034.jpg
b67825c3dd05a6499a5ade3fe527f1e8
eb35dd0545b6620750927f0682dc2cf2b260f17b
35854 F20110216_AACDGZ reed_s_Page_022.QC.jpg
2b784adfdcf1f4fe298125ce0b598dd6
ed5c0a8c5a3233bd36602ece26bb6b9b5953889b
120403 F20110216_AACELF reed_s_Page_019.jp2
8f5056032a7742059c42f09f628fa4c4
89e0e82369f3100419adef6584344202ea97471d
7104 F20110216_AACEKR reed_s_Page_170.QC.jpg
2fbf0c0a7808b7a598ce52a96098ac8b
65836300b3889a42485aa4a44ade30c5a224feff
902 F20110216_AACDID reed_s_Page_139.txt
84e1b132a2e5c8acf7b1103c4d6c6e0c
792a6e5b036f5f81331682fc789c3cf6ca56d567
56422 F20110216_AACDHP reed_s_Page_070.pro
713a4ab2988923312599ee0a8ce90aed
d345f9ec57efd60e9419a56c0ed2398437c8b6da
122561 F20110216_AACELG reed_s_Page_020.jp2
2c4c0b2773db6e8a8ba40a1f8311acf3
a4fc61f0fd03935cfb405ae99c1762cb905a1c05
92511 F20110216_AACEKS reed_s_Page_171.jpg
5a076b485441634b13349baa762acea4
586ba3ced0d31fc27b99c3da55bba50c9237eb28
F20110216_AACDHQ reed_s_Page_155.tif
22c1e2fc5f32fc0a750f8b0dd48fbe00
ae2aaff2f172e5b67658ababe9fdab5306439d42
3093 F20110216_AACDIE reed_s_Page_165.txt
545af4e1e20d4881e6943e45ad9abd39
f8e852e4d4a56a3046c13ffe5132e8eac96c7eef
121250 F20110216_AACELH reed_s_Page_021.jp2
30b7589525abae77163813835ab5c2c1
0dbd61199fef4c6f2ec3bbd4adc8174d44803388
29911 F20110216_AACEKT reed_s_Page_171.QC.jpg
9adc14d3e56e65fc8c2dacdf7cfd6905
ee78b25a73ac41cde89cca8f9ed6eeb267706cd1
123589 F20110216_AACDHR reed_s_Page_109.jp2
c74769dcbc89ab4cf3566ee4d3d123ed
49a91a24831a1c254928102eaac34b0beaec7999
F20110216_AACDIF reed_s_Page_129.tif
3f04bd5dc2984188676ee9d905528891
daab994a40da99518e1283a19881a4ca87cf680b
115981 F20110216_AACELI reed_s_Page_022.jp2
dea93603fe1c0fd468ca28751012a98a
89e9d33ac038fa55e336e1fdf09499fe4bf2e630
2061 F20110216_AACDIG reed_s_Page_022.txt
01ec607d60a83a40815eab25bfb67658
3a912cfd121c0736bc4dfc523730c95d49695986
120347 F20110216_AACELJ reed_s_Page_023.jp2
5354c416b7c5ff9051661d90a3ff76f8
430d27af0459f8d8769869031fdbfccf7bdb5115
24938 F20110216_AACEKU reed_s_Page_001.jp2
9539a1f40baae5c5e956ceed38a93786
32bd3d17b10155d3194cf21d4547c072848d463a
784099 F20110216_AACDHS reed_s_Page_129.jp2
df85a0c563b64b4df360fb7a86b4d7f3
34e3d22a01485ace4a99ae2ae3b5f7ad4d45b1f1
8930 F20110216_AACDIH reed_s_Page_150thm.jpg
fd64a2dfc18636f7779f526f81260387
d3855bd21dd27bd387f1280c6ea13708ddf43132
112611 F20110216_AACELK reed_s_Page_025.jp2
64ba89d31d83c0c94e8c01af3a843d81
a1772fb4c0042602678d2f4374bdbaa2cd88b9cb
114791 F20110216_AACEKV reed_s_Page_004.jp2
a064ae8cf79c3aa72b4a70eea36048bd
763d1a68f4bce8070a94e759e5451dd9f5618d12
612 F20110216_AACDHT reed_s_Page_129.txt
8fa938d01352d8f78dea79ab85078131
5910c232c52f7936f5498f43f145d50edc71d75a
2058 F20110216_AACDII reed_s_Page_032.txt
e201bef03e62c789a04712b2b937719c
0a0eb0f75539d83f3ba477223bf398e2f294b7f9
121978 F20110216_AACELL reed_s_Page_026.jp2
7b82218fe9f97398aa9328cb71569059
447dfc2ba2d09d04e113b1389ae99ef8b809089f
30583 F20110216_AACEKW reed_s_Page_005.jp2
112836bae8ee016ed9984eb6b7f2b992
d46de7fb7b78505a24b1789c33505e5f2e62e918
34685 F20110216_AACDHU reed_s_Page_071.pro
7ee6f0da220c5ec1a025bba6d2d395cb
a7f967f7f4207078177a36106affd55d65d7e4f7
36861 F20110216_AACDIJ reed_s_Page_142.QC.jpg
d5170d60aa0403159081f2d3c9de201e
ca2a7c2557ff713f33520803d3e99e65fb0a0db4
120895 F20110216_AACEMA reed_s_Page_046.jp2
bd53c3bed85ad35b8f83cf24e29ec251
1507cac5f3af7063b0002c93c41c74bc62cf9817
109446 F20110216_AACELM reed_s_Page_027.jp2
e027f6d892ece979dd78466deb473dc0
c8470a40761fd8af0032d11fa08eb24a5664fdf4
812669 F20110216_AACEKX reed_s_Page_009.jp2
1c3b44ae167ac5b7ccb34083af5c0bc9
6471499751d67eb17824e692fa89e4b13bfcc067
F20110216_AACDHV reed_s_Page_133.txt
39a4602b0ad2493663fb59e950d03100
92ca3020323caf228a2c5d22ada0b7e387d08753
4284 F20110216_AACDIK reed_s_Page_100thm.jpg
97a1abb1d7c67b17daa9ec212b08060b
86263b132f21cfc4eae1c50a9713287081f5c821
121889 F20110216_AACEMB reed_s_Page_047.jp2
a3b1ac8a7d627aa7f6188bcc698a438b
0f578dbdc2fb2e45c3acc37826409c3e416772dc
117806 F20110216_AACELN reed_s_Page_028.jp2
30f52c146c09c3adde4722f3061ad2ab
c8a8ec2369ddfb2a6e88e5b3aecb1fe3b498724f
1051942 F20110216_AACEKY reed_s_Page_010.jp2
f0b3ca2f529e2ef515f89996df737d59
0b3493eb810da67d925b4ebce87c99d43f26efe4
2224 F20110216_AACDHW reed_s_Page_016.txt
b01e1a790b3a96b9efcbcee1a5ae2587
5d912ec7c280422a2ac396f8d9e0746cecf42a79
109225 F20110216_AACDIL reed_s_Page_104.jpg
654eeb53ab6f0c7e8836c7595de612aa
cf8ebc3a26973679167676ca6e14934cb73a7c3e
120813 F20110216_AACEMC reed_s_Page_049.jp2
4667c74257784f0928ea26a815ea82a7
2f8ebd73e8ce98230498b1e60fbb469233d25693
119334 F20110216_AACELO reed_s_Page_029.jp2
fb6de5d3bc61c72887539d4bf90f1855
248005bf072ee97081b9ce8d93cab9f54017f492
107467 F20110216_AACEKZ reed_s_Page_012.jp2
8637d836c8dd78f2691252117084c62e
55fed8e3e0156f0a00044c287b9af499f15b61dd
68321 F20110216_AACDHX reed_s_Page_168.pro
5f2abca32564ef983808413f5d10f30b
be45dc986efed76d6c56b41d133911d48d82283d
56245 F20110216_AACDJA reed_s_Page_067.pro
ffcbd5420a5822e91abd24102b2c0739
e57da78728c5cb19152e76e8f575682702e801c9
116135 F20110216_AACDIM reed_s_Page_087.jp2
42929984dc120335425c98a36133a04b
edafdf8ba856039380d56087c9d3ae37a929d04f
122975 F20110216_AACEMD reed_s_Page_051.jp2
687341677f533dde4f3acec4e4983e58
5b691ab498a7e5b80875ad3f84594371646fba7c
116165 F20110216_AACELP reed_s_Page_030.jp2
08882ef4f63387ee29ac907febec0d36
3ed303efdbd75c74828ad308a29b0000eb6da967
2184 F20110216_AACDHY reed_s_Page_047.txt
7ab71dc20e33846f9597a0414db3c6b7
3a86235cc2720973d6212ecfdae12b210c6b4522
1207 F20110216_AACDJB reed_s_Page_125.txt
d6a29d6e0359ef1bb225083e626f3b8c
e38c1f423ecd1396a776fe94429ddc1f0a3037e7
109603 F20110216_AACDIN reed_s_Page_079.jp2
b09d131887050d96c70d0f387b58128c
2c6efb1258b856c3419902686a939da6eafe2e71
124295 F20110216_AACEME reed_s_Page_052.jp2
5d4ccfb28cbcd9b5541b23527e014b86
064db90b8df0015c5ecc38086c71ecfa3851bf0d
122180 F20110216_AACELQ reed_s_Page_031.jp2
f23f026884bc8436efc41318c099c4b2
3d1d45e92181f20d783a94a2b1fa5ae6fed3b2ea
146649 F20110216_AACDHZ reed_s_Page_167.jp2
8139da04f2e85b9f6b025c81fd073eaa
bed95e0b7c40888e2837c9ee921f6b6fc25eab15
1003 F20110216_AACDJC reed_s_Page_116.txt
453840ffabae97db6f53adab184af53d
ceac8850d3d6b80706ecba7d1ceef3f87b1a3c47
395090 F20110216_AACDIO reed_s_Page_094.jp2
7c8125d29d1b8e8cbd28837377c6d3b8
bd6fd1635bd3ce892c1cf89a24039276b27b88d3
123739 F20110216_AACEMF reed_s_Page_053.jp2
d53850f9a552ca90ed1cf28a1e9492e0
dc3e64fd81b44ba2b6dd935d2ff5b9c8896aaf29
113922 F20110216_AACELR reed_s_Page_035.jp2
a150f0d7282703ffad19c7da0ec0d5d0
6785091900ae7bc3cd7796187792a6079c7346d0
2691 F20110216_AACDJD reed_s_Page_149.txt
f2232f2a72e8b53da69c586644cbc552
057335e12910df069f741afb7e44cc013f5237fe
F20110216_AACDIP reed_s_Page_079.tif
0c92866ea227f8ebdfc50fdfd3349de4
0a83fffccc88d47f81efab6d88a5ba661dc6150a
78735 F20110216_AACEMG reed_s_Page_054.jp2
c6e566373c041c40c81ad14d4153d657
c3f48efdf67cbd2147d531b0b40ef530324d8e22
118179 F20110216_AACELS reed_s_Page_036.jp2
bb24d230d12bf9a6cf28e001044c6f93
ab0cebf2631f6efcbd89026a27e4d3f4b438e867
3464 F20110216_AACDJE reed_s_Page_075thm.jpg
27e2ae076d3c8bbbe1354f920a7a16a1
1ef9a92d52d64c277a7aa2cedaa4fa3d16d40d32
F20110216_AACDIQ reed_s_Page_130.tif
76ffd6354ba67b59872c1716a5f0fba6
1c561c88137ed1cacd31294a4c21e266b545bd71
99190 F20110216_AACEMH reed_s_Page_055.jp2
e0af5abac2a1f6c17b825a1c6f702b54
33200f969cef25c3bb2820f13446cbef8b548a97
114540 F20110216_AACELT reed_s_Page_037.jp2
2c5e4ad11a3d38bd4c1a97cea61bb36c
50702c644aae957fdb546b5ce2159ba5cee4f87a
115325 F20110216_AACDJF reed_s_Page_110.jp2
0d4d1ce54a8030d79a290ae11213cea9
53a08da6716cfe4a6f20de54bf2d8d918539a90c
96434 F20110216_AACDIR reed_s_Page_171.jp2
274ab97c68e8951cda3f8c1c21cda55d
31bb786649c54981dfbeb38f078257014fad6ed1
114152 F20110216_AACEMI reed_s_Page_057.jp2
4e1a63d217e0deb609cad86884993149
4b6d636405c8c87499abb89bd630c284e5abc363
121446 F20110216_AACELU reed_s_Page_040.jp2
4f9a26db8a116705a845fd0d2f41eb46
d1e900bb7c6514ea454932d758e41ad9d11f9243
113655 F20110216_AACDJG reed_s_Page_046.jpg
bcf67c3cc1185a82501f0a2f8a6e843c
100d5e67168a02c25727b1e6ff7cdca50121bdcf
115570 F20110216_AACDIS reed_s_Page_026.jpg
0332fea0a371ff0d17d0b515d527b7c8
ea8589a10599e8fc1fb5acef279c8f335c153838
121762 F20110216_AACEMJ reed_s_Page_058.jp2
4e70d08695e78d287956cc3733ae24d8
09b658500095fdb834f4cb1613f1189465047c7f
150074 F20110216_AACDJH reed_s_Page_162.jp2
2af9e9b24d379b1187ef1d1bc9bf4296
b5fc8c8e0c0ab3cfe290ba8b7628bfcd44fefb21
1051982 F20110216_AACEMK reed_s_Page_061.jp2
d7eb96145d841c5e615073f9a5b157bf
e96da944ddb7db2d5c08a6f5ed84721deaa40d43
119359 F20110216_AACELV reed_s_Page_041.jp2
3cdcfe7bcdd48ce8ff8daf15d4c9b3a8
4eea5dfb3836fd989af278ba3b6a81f8f2a2df17
F20110216_AACDJI reed_s_Page_094.tif
66ee314bccac57fd2b20b075af595e3c
d7a46fda00971b52be5426a73be6a4eeeb57604e
530 F20110216_AACDIT reed_s_Page_140.txt
98986d852276e6c378ba45ae4ab6f59f
dbf5ec2aff52ea70c04d10af5993e42e2eec4691
105350 F20110216_AACEML reed_s_Page_063.jp2
f732674c101a5865db5fbcd4fed8ba5e
8f0fb7f923bf582487033084b3200f8bb073b879
121571 F20110216_AACELW reed_s_Page_042.jp2
259cbdc101088ddfb364bb67aeb7b9c4
4eacb243de42c2c05a89ceced955b947b581b99c
8947 F20110216_AACDJJ reed_s_Page_110thm.jpg
502e0214de0310826d6efc5b39fc5fa7
569dc0b2651949a6a0bbf2b16a625469dfd4a89d
8439 F20110216_AACDIU reed_s_Page_106thm.jpg
3782e5092cf5829d5ab885278a1b59bc
2272339a0f9fd91564052fff468bf785d70b7918
33255 F20110216_AACENA reed_s_Page_092.jp2
8c17d6ec8b50b53ca4d2866c6e89ec0c
9726b7d96b71f8e6fe058b2b8dacdec588168a14
1051985 F20110216_AACEMM reed_s_Page_064.jp2
70a8a95166e3c3ba722847fedf9f265e
f4f39ac019e354f71584956181339d7ecaa7c992
116163 F20110216_AACELX reed_s_Page_043.jp2
39d671809a2a46b03eed9f8358ba6f05
376494978e2fd1408f3706dc3666ef1d711398e0
8414 F20110216_AACDJK reed_s_Page_062thm.jpg
77b4f3aa63dd544228729003242d697e
f7ff0ef22a56a704f92a2d1fd838ec032d281252
54565 F20110216_AACDIV reed_s_Page_043.pro
73b2343d08761b91dc2092d274e069d8
8670e1d1f10b3cb2128ce272fff7ad286a1af022
61780 F20110216_AACENB reed_s_Page_093.jp2
00dc7a71e922ac0337ff98638ef5e78c
a067bdafcda73c9d9caf75cc0bc667b394ec4150
120346 F20110216_AACEMN reed_s_Page_065.jp2
998a74018bac67ec82f0e1ef21769948
65103022aa1c5c344bcbe2f54e580a5ca9d3b684
1051986 F20110216_AACELY reed_s_Page_044.jp2
4074716b4c98b0d0e0b790774ba77256
c3f4796b0076707b2f97df66aabde874736a0a9a
1855843 F20110216_AACDJL reed_s.pdf
4064de5f3c5eb9382ea0b3280da91d17
14b4d2abde8761eb3eb3279112293bb9db537e19
124919 F20110216_AACDIW reed_s_Page_039.jp2
757181bf0d80e1623ccd7d63995a379f
e3059cb756933e47ee8846e5a008a31d408843b5
349122 F20110216_AACENC reed_s_Page_096.jp2
4cd72f745468785068b5eb9f2623e26f
81f02d92b1d5216601be2f9bbd986ad0111cf5d1
122774 F20110216_AACEMO reed_s_Page_070.jp2
eccdc29a2bac7bfd6bcfc55fbb008158
8c1d5f06b7b099a7f0734162f02b671f4bda69e3
122257 F20110216_AACELZ reed_s_Page_045.jp2
3827b1de0faf9e6a320718ac7a67340d
b0d309e762fbd92d2ea9d2c566280bffe3eb4d8d
2078 F20110216_AACDKA reed_s_Page_064.txt
596730ac3673cda9b2a4aedb325d0173
080c75920749046b830584c95faf8691ccaa4eb9
F20110216_AACDJM reed_s_Page_163.tif
85e0ff45269ce02f492d056beb4d4a26
3efd94551be351068dba2e640a739493af56fb6c
36778 F20110216_AACDIX reed_s_Page_030.QC.jpg
fef3c111decc52b8bca38fa3b8c70b58
e1f677a14f6e5a97284821d0fb79f5e0a9e301a3
306103 F20110216_AACEND reed_s_Page_098.jp2
f70ad43db413bc1cf00984a770bb6385
916a536f1e2c8e4d3b2cfcaf34b1807ff0a66dfd
783916 F20110216_AACEMP reed_s_Page_071.jp2
f0e21012196f82d1f023cf468e4d5807
fc375457229c00f6d4b006efc0d6c82dedfca6c2
116223 F20110216_AACDKB reed_s_Page_034.jp2
e0cbd4a37c33c21f601f312666d19540
2010f48b425400fd18db0e7a0eb5f58d2252f636
107906 F20110216_AACDJN reed_s_Page_062.jp2
f8017def294dcf18cd3b74b78505f2d5
03a1dda2eddf5414519bbb581a3ce9ee223623a1
34067 F20110216_AACDIY reed_s_Page_083.QC.jpg
daca1e60a835273d4ca6aeec4f391a10
dbf06739fd00bae69c6e6e8da8f19cbfecf78ffb
19470 F20110216_AACENE reed_s_Page_099.jp2
c5c935023603f633cafee0176e9ea054
ce63f99ac3b840fede1b64b774a4ed72396dfd08
572812 F20110216_AACEMQ reed_s_Page_074.jp2
97dc07805ce3716dea64022940a4228d
5a6959daf44729f251fbaec934a621d3f2cfcdf1
115698 F20110216_AACDKC reed_s_Page_050.jpg
25863d6f4ebcc4c9dda396b77b716a4e
533989271b567503dd6e511e6cd0def822f88065
F20110216_AACDJO reed_s_Page_025.tif
3e9023661a8c37b5bc9ace204c32cc87
235c2ce5e0e3963a3e83d40ad87db70897fcc284
3087 F20110216_AACDIZ reed_s_Page_155.txt
024dd5b398e059fe40d119f3d4548af1
c2e64dfa53ca494bfee589ebc5486fa81f94ccf7
517562 F20110216_AACENF reed_s_Page_100.jp2
46765883d1963adcbcb05a5650120b47
af7409ffab4de245930201be14c3fb3432bac3cb
733026 F20110216_AACEMR reed_s_Page_076.jp2
7e8e2f1616328331b14e8505bd03f978
89ad076b96306639b0fbd53f0a2ff874d31b43b4
37433 F20110216_AACDKD reed_s_Page_149.QC.jpg
fef6097cd9991cea44af5402c58606da
3fdf3b1f106e089169fc7057ce6a97f26ef8054e
23605 F20110216_AACDJP reed_s_Page_071.QC.jpg
daab62f0a954a9a976d4fa0b3d8e8e89
3b2fe4664a480ba2f16e6a876f65d860dbff6371
120209 F20110216_AACENG reed_s_Page_102.jp2
6e89b84722567550c1dfcc9d6d49d079
f73faa8bec5c96002daa7b108075ceb9e25758d1
479724 F20110216_AACEMS reed_s_Page_077.jp2
7078290f4cae98627bceb25fcbe17d75
2d7da2a7ec481ca8b96ce2c25a7516de6e09549c
55878 F20110216_AACDKE reed_s_Page_047.pro
72b4ab653c7c8824e6d1c23ea24eef87
2b1ffb7fecdcb42901df0fd32ca456227c82abe9
101948 F20110216_AACDJQ reed_s_Page_105.jpg
b8f3536367ad20062e8299585a3499a7
194b970f9ef848de4ba15d7e9e5e1d18001f0e15
111622 F20110216_AACENH reed_s_Page_103.jp2
6d8bfd6356e87bef1df3775b37f93534
15e2afea2f36e16489470f374404215c92755f4d
116230 F20110216_AACEMT reed_s_Page_078.jp2
99e48cf5473b94b2f014e06e4fc7fca9
2ee989b5bfb97fedc32909548e2b75a68579dcc0
11868 F20110216_AACDKF reed_s_Page_090.jp2
67f9d8c421c262a2b86cd16ce0c65fc1
23ec071971e41e966d84a3f2c13b68f54c6b6e22
15657 F20110216_AACDJR reed_s_Page_127.pro
631e2bb43ed9cbbf047f96d9b83a2698
d5254c5e517feea48087707dc17746b721c830f2
106432 F20110216_AACENI reed_s_Page_105.jp2
fd0a5b4be5246b270ab5cf872cc10063
1c3aad5c27a8e5c7e489c3b76995b7683b37d5ce
118136 F20110216_AACEMU reed_s_Page_080.jp2
d5ffe26a4821014fc25ff4b224dda7de
1648507ede352aa0314a5d4af3d52c2c6eea8565
558623 F20110216_AACDKG reed_s_Page_072.jp2
ec8a48a01fb1ad42bda8212bdfd2882f
b951e53dece99e25f94a84a2dc545d8d4b228a1b
1051922 F20110216_AACDJS reed_s_Page_006.jp2
64a65bc0eb3156ea0cd565112b53cd2e
ffcaa5d58633d79a9deeeebc4b3954c7b0bb5b04
107878 F20110216_AACENJ reed_s_Page_106.jp2
a32b8ddc2709fb0aa0f1722631576161
14c8f6a8dcc5541894a0fba6c2564487ab85f5ad
115331 F20110216_AACEMV reed_s_Page_081.jp2
5d5faad609ae14e3965dc3c91a7bd686
b5da8a95a5fb4778ea1fca839f4e887fdd2e5056
42952 F20110216_AACDKH reed_s_Page_125.jpg
6386541b332524b866b5bc7b37db806e
076f852285a21f46228f6e95a0d8db5cf1226f47
19425 F20110216_AACDJT reed_s_Page_095.jp2
c6591ce896c2466450eafff86982b699
7749256f417c24560bad43aae47133634e99cf15
114042 F20110216_AACENK reed_s_Page_107.jp2
1f0bdcee893c400fb77b70ef3a6f436b
b9ac3fcae8b1b58be3bdf74e0b338811ca6a9e34
36665 F20110216_AACDKI reed_s_Page_080.QC.jpg
3c6013bcecc618ee7b252fae9bae6007
70f92aebaed114dd7b3301113d728fcbab4248d9
113828 F20110216_AACENL reed_s_Page_111.jp2
8380cc1c0075cbbf5a9af1df3854c28c
9bcda683146993d050ee77f7207d715d68a5dd74
110766 F20110216_AACEMW reed_s_Page_082.jp2
9c9c43efea2bd5f2ecd5e71afcee0ca2
0cfc2e1d2713d5daec35f1828b0b1d5ee7660e6f
10245 F20110216_AACDKJ reed_s_Page_005.QC.jpg
428df5bd11945f8a90b125833d39bd10
14f8973c8f45b4f2c2d702ca30f05d1702b0482e
102673 F20110216_AACDJU reed_s_Page_059.jp2
c4eecb31481b0c3768a93deb18240941
a43212ce7282ce0b66acec3cd7a3b1106144d901
108021 F20110216_AACEOA reed_s_Page_136.jp2
f73346a4edac08e35ddfac72e7fbd5c1
869b6eecbe5e2ff634c223505dd2e96dbd30fbce
119259 F20110216_AACENM reed_s_Page_113.jp2
7ef9318370f578644d21a793ad65ac32
374a847896f150df04be98713aa6430aeee43dbe
115241 F20110216_AACEMX reed_s_Page_085.jp2
7f9304cb777d39352daa2e357288b544
958ebb7d9d683aa96c6ad5409f9c84d81194b7c0
2035 F20110216_AACDKK reed_s_Page_035.txt
6229a3d7a8c17b5b35a0d8956a49b6d4
4ff2512be327ff6c3e40e51e0cb23e3b1a422017
462081 F20110216_AACDJV reed_s_Page_091.jp2
563b532483c65cd175862f4e003c27cd
9c44d4a0abeb43319658b5ab7d4172c837569018
104860 F20110216_AACEOB reed_s_Page_137.jp2
c88474e17e6f22d9a93622521b1d3ae0
ada4f1de6fb4d609215ef79669165a055b9197ad
121580 F20110216_AACENN reed_s_Page_114.jp2
efc16ffbeb042b317a6cc717d4c354d0
9983c51a9ed4c76649d02fd8f76f4ce9d420d5db
111716 F20110216_AACEMY reed_s_Page_086.jp2
8624da7b239668804f19958d0fc0ad75
717d6ffdfe3d0fa11b96b13f977b0883fd895a6d
F20110216_AACDKL reed_s_Page_047.tif
4651ff535ad38a1e11ad4dcfeda633c7
589cd79f337f0c58f8260261573d23cf9186100f
797 F20110216_AACDJW reed_s_Page_092.txt
fdf72ea00c55461b2917196811c54b48
14783cf18aeb9dc72f130f1a2fa6fb0e0e1028a1
116125 F20110216_AACEOC reed_s_Page_138.jp2
6864990ff528528e63f42e4d31e3d52e
f7697643d034d1102f4938f05c3bc5e062d305bf
50890 F20110216_AACENO reed_s_Page_116.jp2
487501450a5543a7172e3c0d23a88f6b
ac5dd1c912f5bf7cee0d75e1df7e37403001a241
115638 F20110216_AACEMZ reed_s_Page_089.jp2
11096b43cf4a2e24db53ebb55f19a94d
0d5509b1a2c54255aecd620a5134587f35da9a06
F20110216_AACDKM reed_s_Page_122.tif
3e944900ec2a917b69f439023c005f2f
d254e5c6d4212d944156fd618b5451853efa7410
119292 F20110216_AACDJX reed_s_Page_109.jpg
628bb7788c2ab2ee4bf696d58e97d8ed
1242d3e7f38a153644fe8b911be2c6ecc6b5248e
37209 F20110216_AACDLA reed_s_Page_067.QC.jpg
db0a83c438e6f2b4e6fbe005712bf539
8b52fe3289a0a2f075f57ef0d21055a8b9d7c7f9
50293 F20110216_AACEOD reed_s_Page_139.jp2
846bade8ae794db09aa56644ae53a939
4999afaf027e313fff8f616a7c9d3573a71f1336
23516 F20110216_AACENP reed_s_Page_117.jp2
f7e319df49675b1b89acd6062240c24d
ed90c3816e76363639b0d74c0075755dccc250c4
1979 F20110216_AACDKN reed_s_Page_121.txt
8c95f2a3db7430c0cce57daeab1ddd9e
5acc83f5ceb7fc87b892e3f9bf9c4982feea4fe6
37412 F20110216_AACDJY reed_s_Page_070.QC.jpg
41192b7a4e2d1fbc54edb979083575e3
2db8c79a48590b7d516190248fd0d88f2be065dd
37886 F20110216_AACDLB reed_s_Page_047.QC.jpg
7c8063d1e0aedd79b16cbc1f2da23bd1
7cbb07796bb771743089c4ae0c2ce1511bc07c59
516640 F20110216_AACEOE reed_s_Page_140.jp2
c1738de26daaa59013862b98c7ce1bce
b3d02978af6a2b277e79921de15f3644a3894de1
237169 F20110216_AACENQ reed_s_Page_118.jp2
4cfb82b3b4e655b8224dc8546cbbec8e
fd7cbceaff0d351b601d7782a8a6fb506b46e4fe
1878 F20110216_AACDKO reed_s_Page_105.txt
1cc242b0d300291f2cd0b7ee456f4d6f
378c20bad3134ef5b43ebc52a3e164186feb1b4e
40840 F20110216_AACDJZ reed_s_Page_165.QC.jpg
07d7677d43a0313539ceb0f53a4e7924
f6e81417145eb4d9a039684e9e799ad9c049d3c0
36751 F20110216_AACDLC reed_s_Page_024.QC.jpg
be67f6ebba80093c590894d5672fcf55
d34d136773b18058248492d7e902ce4d24fc8fed
482858 F20110216_AACEOF reed_s_Page_141.jp2
bd6c12245d0b74f3a8a689737c5e9541
feaa9810bc679590ec5508ba5ac537fef282f3a6
205266 F20110216_AACENR reed_s_Page_123.jp2
7142564433185d5530b55189cd9abfcb
98f6d666650b6ae73bfbb570446e8bfb9a3243d9
9432 F20110216_AACDKP reed_s_Page_169thm.jpg
78310a0a902581e8f29754a20df0763a
49d8ecbec80e2941a6ba61a7bd774ad8c8f05ff9
455 F20110216_AACDLD reed_s_Page_011.txt
a5d42a537bb35ecbbe9b505a931fff4c
be28b771fcc050152090b4fa83710ce186a7e51e
132078 F20110216_AACEOG reed_s_Page_142.jp2
5afe7afb7865a10d435fdcd77986be89
80e3132ee120ffddb7923e98c29b3e1beceaeb44
713321 F20110216_AACENS reed_s_Page_124.jp2
e674416e43239ce5196fd80dbef9354a
8dbe40be8b8668d76603c69e828533c773fe2cc3
71026 F20110216_AACDKQ reed_s_Page_154.pro
57abe700d022182dc44f1bcbd59bba61
644b2711a33417a2d8241676855f7142de1eaf6f
2181 F20110216_AACDLE reed_s_Page_046.txt
379aa2efe282fe08345890d3b6cf843b
87824b2d7be74387cb2bcd84bd267200b904072c
49235 F20110216_AACEOH reed_s_Page_143.jp2
f820c2540581c45c67cc15bc31de3787
bcba607d6de48efd0767289346722a8ec7930ffa
372908 F20110216_AACENT reed_s_Page_125.jp2
34ec756d88c1b608a823aede81ef03c6
7ab4563dbf7378017966826828087e95e15b0c38
37205 F20110216_AACDKR reed_s_Page_044.QC.jpg
31879c13f2e439b6a25d01a2604f22aa
ee8663ec0c4a1e55f53f02337eaea49d6c3c742e
50430 F20110216_AACDLF reed_s_Page_136.pro
1109ce976848d8342270291a5884fd87
7c23029fa6e3e4db5683630101f931c55d8b34ca
141239 F20110216_AACEOI reed_s_Page_144.jp2
8b5214e1136a972dac79a0beab2d12ec
a25f14b0bceb8aa9ecbc98399485b37e072ecbb1
402456 F20110216_AACENU reed_s_Page_127.jp2
378af769c4c5cc582427fc0e36c54bf5
b19fa29c4470e8e843901d0c181fe5964effdc84
120436 F20110216_AACDKS reed_s_Page_067.jp2
d2d6e0db86a17911b3ac724fa3f65fab
cf24265c56b043684e1b5610316879e8af60958d
38936 F20110216_AACDLG reed_s_Page_146.QC.jpg
683732074b0acde97aba2f8ddda0f1f6
432fbec102a8b38012e0da3aa0f7ec6f13027e13
154812 F20110216_AACEOJ reed_s_Page_145.jp2
5112d24ded3a10446933b230275dc500
c6c0fdcc629ced77b89e6b0e0a62523b082819af
596891 F20110216_AACENV reed_s_Page_128.jp2
1ccbb9007950b48cbdd759de5903f4bd
54ec79d5448e26f4194494398010a82330b9ba01
F20110216_AACDKT reed_s_Page_064.tif
531c681df96d48a507bab9283a3f4762
dc373a6170c42431ad366ce93851ea5a3f5933f2
4764 F20110216_AACDLH reed_s_Page_127thm.jpg
143449edb19a9d8d672bcdbd570c4003
2f889b1314aa77342be707947f39442221339e1e
143632 F20110216_AACEOK reed_s_Page_146.jp2
3d9e97928f3499136bef0cf05eec6083
cb13829fded8ee764a80f32c2559b16ff127f5b0
287246 F20110216_AACENW reed_s_Page_130.jp2
8a72d2236c1a2dbee37475a1af345b1d
e2e05252eb12d485653d094101abc75549a8f0b4
F20110216_AACDKU reed_s_Page_005.tif
2cf2ea6d46d4b24254fcf1b1044ca604
6362126496a4bfb3bf3a2fca07d5809d81f76c4d
72326 F20110216_AACDLI reed_s_Page_148.pro
d874682f288c5fbbfbdabd679109e099
91dede604d72e16a11b1415edc9c1f50a74c298e
155675 F20110216_AACEOL reed_s_Page_147.jp2
62db3de13ffebc35ba5ab6ab7178875f
b1e3b9a80f6b2cdb550553c77d03afc9cf073cef
F20110216_AACDLJ reed_s_Page_148.tif
481d3646fd6f0253a1035b29369eb6d8
6d11e68c8aea970e66fcad29bd2bc26b09d041fd
549 F20110216_AACEPA reed_s_Page_002thm.jpg
59dbd88d4cbabe32001632e7e721218b
ede234d1abe4cd4e438ef929a578c12e709fbb0b
146878 F20110216_AACEOM reed_s_Page_148.jp2
6553c7756e47e615cfcf009421ae1519
801a547e6830fce52a2c7775c522d788e535186e
118340 F20110216_AACENX reed_s_Page_131.jp2
342833bcc2ed0a98da61ae9845512c05
8d79f6210c7a7fb5494dd42d5dca95327b5bbb45
107352 F20110216_AACDKV reed_s_Page_083.jp2
70d9aac734350ebe9d9a328a4efffd87
b81c0f5df2ec753cbd60adbf86c04acf89c22f61
244597 F20110216_AACDLK reed_s_Page_097.jp2
30bf0b5de2deb506447db8db140ad3ac
d0f15155d229968c5a77da82618c5d33f202063e
979 F20110216_AACEPB reed_s_Page_003thm.jpg
66b89e067afc0f35ae901585ae7faca6
bcb02b8cc8c1330d6ac725b0c295e12ad4e5dd28
136946 F20110216_AACEON reed_s_Page_149.jp2
88052a3fd1947858b866359c77cc7cd1
739968b42f5ec5568696d1ec2a79f2ea28c041ab
110402 F20110216_AACENY reed_s_Page_132.jp2
01416bbeaef5e6981e305f49c978055b
f34e76f9ea1d9f3011447940d12850135c22e1dd
35089 F20110216_AACDKW reed_s_Page_098.jpg
b894fafb4587e613234ae6b46d866498
e76e7a8d546de82e490cbad87adc1ec70ca608db
14742 F20110216_AACDLL reed_s_Page_093.QC.jpg
1ffb061126bbb5b7f88fd8838300c498
a7cf84359e0e2043f54636effbb9efb58bbaa3a9
2536 F20110216_AACEPC reed_s_Page_005thm.jpg
eadd685954f2319b22e30440383ebc4e
933915334c46dd1738c9d7a1ac0dd9002ec1d47c
140733 F20110216_AACEOO reed_s_Page_150.jp2
def42f246aa5beb5de16755350649d5a
321bf740fbd03505acacb839ef39c1453ac4d23c
119316 F20110216_AACENZ reed_s_Page_133.jp2
0af0e1cbf702c687a609cdd403e3d741
af838701095b9eb4d102ae7f0724528de3b53c60
108829 F20110216_AACDKX reed_s_Page_038.jpg
a1bcfe937a104b687d90c5fd9ad73b0c
d54ad5e2a0cef6e59f0e81e1991a866ec3fadc3e
47773 F20110216_AACDMA reed_s_Page_083.pro
ab4fb17695aa04f15b9ce843b31a8142
8d30845398f2116d15a253348ceb1f4ab421eab7
120390 F20110216_AACDLM reed_s_Page_068.jp2
ca8c7d72021aca8e182aa904ea3d6e4e
d98e09717612c54e6d14ac5105a741b8ea8c4261
7854 F20110216_AACEPD reed_s_Page_007thm.jpg
2150b94e142df52a2a19c3323a18c0c3
35f8ea16a885e43d69f0823c80a6f9144ae6e2fe
142749 F20110216_AACEOP reed_s_Page_152.jp2
c74ff142e0154b6081d4ee980a0731e7
fcbb979e93d90d0daaa51144e97a15eb71f5ca31
F20110216_AACDKY reed_s_Page_090.tif
1a19e911a9a5cc567c25af82990dc324
baf2056b846c23bc8e10c938e00033c53e5b05c9
108751 F20110216_AACDMB reed_s_Page_030.jpg
30a766ef20bb0da9df7004658d6d8f23
18197c735c999ac52e13e57f309d27987fa66df9
15384 F20110216_AACDLN reed_s_Page_100.pro
8f99d743fb382318332f21c17b35c544
d3c6a82599bcfefc470896bcdd00ec861401cd16
7045 F20110216_AACEPE reed_s_Page_008thm.jpg
b9cb66bea9187d51fde3f0366ee148f1
fd4067a36fbf9797acb6b229b6059d0e5870ae3d
149699 F20110216_AACEOQ reed_s_Page_153.jp2
c1c1315594121deb88bbabf32eb5ceab
4ee48445ee25f8f6149c288ec3555e3dba867219
143967 F20110216_AACDKZ reed_s_Page_148.jpg
03946818995287b2eb1d746547ac6f53
42af27f9efc338f274f3980d8ef58feff60775fd
28740 F20110216_AACDMC reed_s_Page_115.jp2
052d2c72ced54f0308be87033b768a79
ea4d365c260494d046fbae6c509ef710190c8283
F20110216_AACDLO reed_s_Page_156.tif
da8e5c0eeafc4fc279839f9f7a9a45d8
23202639027d0099ac02832d250a4fca554b330c
3568 F20110216_AACEPF reed_s_Page_009thm.jpg
54c28f13a4f4278e6c2b26a3fa7a66bf
225596c2cd242f43c7b064f032db196a3e856077
142608 F20110216_AACEOR reed_s_Page_154.jp2
82313d5decc5b15d0c80d6a90f3310f1
a42bf96a10b2ce221f2d976ab790ace18ffe54d5
F20110216_AACDMD reed_s_Page_040.txt
de55992f19487b8de3e1d4c9083c75a0
279cec881661be2d2827c0b07bd04355687b263c
4821 F20110216_AACDLP reed_s_Page_124thm.jpg
8b02cc9c27320a4fa63f406d19109a49
2ac36f8fbdaed6f92745e6440e448ade94ed0d5e
1981 F20110216_AACEPG reed_s_Page_011thm.jpg
65c477312c8c79aa9c1b91fa6c14ff70
3f8c6af8ee55d85aaacd9168303591ed67b743a6
147902 F20110216_AACEOS reed_s_Page_161.jp2
9f5be7b3d1ccd0f1784189b480c13b33
7679bdad8de2a78682abdba9e617dd2026d12296
F20110216_AACDME reed_s_Page_127.tif
7e3db3616f95bad7e291b5221de6195d
478b74a44c800e56bb1fed99a143448e3bffa75d
9089 F20110216_AACDLQ reed_s_Page_028thm.jpg
7127c2fb45cbc9f8ffdf181e46fda70b
e14cc1b4a43aaba5ec7ce4411604a07078e4b9a4
4021 F20110216_AACEPH reed_s_Page_013thm.jpg
6eb0545533d9b8e5ddf0de85b33c48c1
976b5997b581b6f39d919ecd43e60e699e17f425
149278 F20110216_AACEOT reed_s_Page_163.jp2
98c7013665e2e51efb2f1bd1acedb361
7e4d9cc0f2d801ec5ae9e091acff22bf9e473fbb
101351 F20110216_AACDMF reed_s_Page_061.jpg
0f13dcc32d1fbd5fdec12ffc90dc006b
60437a95f2786ea936e7571936778aba9b9c2bbc
56512 F20110216_AACDLR reed_s_Page_023.pro
f0a5ab76fb2fe917485427faae7beaea
7fb1342e97dba6bdfc17d9c1a5210e611018bc7a
8356 F20110216_AACEPI reed_s_Page_014thm.jpg
157459f63d74f236f1c58eee1e95ae57
33233c850151d6a2c42111bcd30af8f336530e5d
144720 F20110216_AACEOU reed_s_Page_164.jp2
40ae2b4fbdea8dbc588e42961320f98a
dbd9de9c478afb10c1a5cf893c04c067e4a1e5ce
112845 F20110216_AACDMG reed_s_Page_047.jpg
3bcb3cbd63ffacec81fe8ce07fe1ffb3
06bf2e43c38b1357ebf1db0d1950ed64f9458b96
72913 F20110216_AACDLS reed_s_Page_163.pro
a30f2c9f6a5d7a3747267177bd0b3e63
1aa3c705e0e1bce6dbb1b770ad909187a81e9806
8882 F20110216_AACEPJ reed_s_Page_015thm.jpg
dec7cd0d99cee881e5974cb30fe02fd2
c97eb6374b3b9c1600722a35500be6304808a8dc
152768 F20110216_AACEOV reed_s_Page_165.jp2
54f0bbf0c4b70f3bef618d541872b9b6
fdb9f919d851ff942a3ba6489b775e097f0223f3
4118 F20110216_AACDMH reed_s_Page_006.txt
dee803abf10697258a90ce1379cde369
bbc1f356031dacd5e38906e478ea374edeb1dd13
111551 F20110216_AACDLT reed_s_Page_036.jpg
a6bda9bc2483ad7cf3575a110b6003c8
a3559f033e5d2ba25faa0e604fbb8ab5b0e6e5aa
9211 F20110216_AACEPK reed_s_Page_016thm.jpg
ad188494513d1df80666f071bf4726d9
c3cfca04ec3dfb3820dcb3dd34a37cd7f09fd834
153637 F20110216_AACEOW reed_s_Page_166.jp2
f8177b532f47c3f45e1077a471928391
a42d8acf610513f6728cf82844ffc04d2c061ac4
9205 F20110216_AACDMI reed_s_Page_167thm.jpg
f5194b8e341c354197280c2a74e082d8
1a424d9e61a944f0fad9b82102648ce969c9e33d
4338 F20110216_AACDLU reed_s_Page_125thm.jpg
ec98f314ec1ef5ac7494327d5cf0c312
8f5bb856207302f01742daf2d51440b9eafe0270
8741 F20110216_AACEPL reed_s_Page_017thm.jpg
cfd9d6f9152674490e0b4702379dc9f5
82321dafc8f8184d1e65d135faf56e8ff5e879dd
138125 F20110216_AACEOX reed_s_Page_168.jp2
f0bad4ab6270d21151c24bf88ade5231
41900edca907456cf1f39a6e8092cf5b45372e24
15438 F20110216_AACDMJ reed_s_Page_116.QC.jpg
2f1541a42d7aa1f0858c4f327a83b095
fcd7a6d67f61c70a87186b7284fa48637df7d9d4
108857 F20110216_AACDLV reed_s_Page_087.jpg
669ab09a276239ba2713cc8d528d4add
ab974187e7c495a71b3582a508bb1ed033719065
8516 F20110216_AACEQA reed_s_Page_035thm.jpg
65373582994fbfa8a5391da998dffbf9
d71c88e025bd6a86cd6de55a7197aa3881469791
8902 F20110216_AACEPM reed_s_Page_018thm.jpg
e795dced76264791836ab3ac618a93cd
c17287c5af3f3da900bd0729ea30a613c3945b59
52020 F20110216_AACDMK reed_s_Page_037.pro
b375fe9189b9ffb09d15c05f059e893e
7c4d824883e0f5aa1d49e1e61063b3ac42f7d46f
8959 F20110216_AACEQB reed_s_Page_036thm.jpg
126773ecefc656181cc5dd62bc06f0f8
ca6a49e33605f0c15088a49a0fdd26764aa95c9c
8651 F20110216_AACEPN reed_s_Page_019thm.jpg
5a49bdeec3894ec81ec7bddbc02832cc
c142c348e4f46eaa36c9b69b12592657fc105c18
25329 F20110216_AACEOY reed_s_Page_170.jp2
fd287eb6e149da074a0f416504790e1a
8ab0fdf5470afb8d34e7ce04d91af051a721fefb
37426 F20110216_AACDML reed_s_Page_017.QC.jpg
70aee559878f7e6220bd56949f271b28
d182fbf5abc811a4db5b2f5a88943ac183980135
F20110216_AACDLW reed_s_Page_037.tif
f50889a2bfdab8f033a6c15aac2e4f7c
31f9dd3131b240700bb63c4ee3082f85b5d1c5c0
9271 F20110216_AACEQC reed_s_Page_039thm.jpg
eff0e8093088a7d03293d807102e44f2
dc30b67f5f254fce8a83f7ec729490181a165c59
8758 F20110216_AACEPO reed_s_Page_020thm.jpg
fb712530d09a8e82a86afed668b3bf67
7a346b78a837b3003a6f1950376278b3c1852f64
2080 F20110216_AACEOZ reed_s_Page_001thm.jpg
fb9e565aae48d3a38856b2b01191562e
c203d4e0b000bc8ce2da96787353a567babaf730
33609 F20110216_AACDNA reed_s_Page_108.QC.jpg
3340dd17c2d50cd4301ae35695148db6
edabd305473e44a6b686fcd0a347fd9174a9f662
8533 F20110216_AACDMM reed_s_Page_078thm.jpg
4113eb0141b20547065c5aa37548eaeb
c92969e9acce8b0cdf2fbad123bd91969108d608
F20110216_AACDLX reed_s_Page_149.tif
3ae85ad1a99abc9efc1b198501805d8d
5fa9304956019405befbaad083fb4190b60fbb05
8798 F20110216_AACEQD reed_s_Page_040thm.jpg
06416f0d761a1aa9e1b52756ca365f49
a374b19b511e1869987f51f9b62822cc47b15f57
9122 F20110216_AACEPP reed_s_Page_021thm.jpg
670f5bf9bbbd2fe3a75989e3e32fe88f
13f0caf2fc7a532962522358185168a2433882d5
36187 F20110216_AACDMN reed_s_Page_015.QC.jpg
96da10d7101936ae02dc12fbff1fad31
6242b950c685739259a2ed153e15e86d24d74b9e
8835 F20110216_AACDLY reed_s_Page_023thm.jpg
cd6f48f0936997e90593b3607a8c4309
73a0a84da3995c461a4a081f389e59a5f6812a1a
55259 F20110216_AACDNB reed_s_Page_049.pro
fb001309e341922376026c582fa003f3
176fd99cd5b3265a17b0c162a60ff61d7470d061
8995 F20110216_AACEQE reed_s_Page_042thm.jpg
7b2b9da4ec6d71e54b0b8ffc7fa99346
0019f726db8ef6f64230b00749251b07af0d2977
8712 F20110216_AACEPQ reed_s_Page_022thm.jpg
e83ec5a25e7b8f56f3a16094f3828cba
350b50244ae92c0d952e4bb308e719bb7225029e
117891 F20110216_AACDMO reed_s_Page_038.jp2
7bba6fd29480070bbc1e7e5a3238909d
ea7a626283d2ddbf4d91f48bf3b95a416f8cc551
2764 F20110216_AACDLZ reed_s_Page_168.txt
b08fb2eb9b131c11c8c69359fc253dd9
c353a23171998f7b284a76abbcec8dcd20d94f38
96844 F20110216_AACDNC reed_s_Page_121.jp2
c2203f7905fd6201d26cd7ae688a4819
b124157ca909f20b516a2db548f4bc5b3c122dd1
8709 F20110216_AACEQF reed_s_Page_043thm.jpg
9f136eb101343b019109e400bbfe7ee7
795208b6268c858a2348fcb60eb710c23414b934
9116 F20110216_AACEPR reed_s_Page_024thm.jpg
f2c72c3ce02b0aa827c453aac95ea820
2ff46a6acce1d7d9913f03426c3f73d84c01050d
36962 F20110216_AACDMP reed_s_Page_060.QC.jpg
3e50b67caae346ddbfc520897122c65b
80616862b881f555af19024b938f51a1b33d10bf
118625 F20110216_AACDND reed_s_Page_024.jp2
b02049cd54261dd27741824440fcdb59
dbe0dd1e405dda404a7531952cbdbd37c2c02c07
8985 F20110216_AACEQG reed_s_Page_044thm.jpg
ef5af3cdd0b8ef579f439dce6c8f5157
497e9548f81af0a797488c99a107cf50a8d5c304
8481 F20110216_AACEPS reed_s_Page_025thm.jpg
bb63efb327ba13074f6fc936ee14fbe3
bf58b30f923f04b04ac82cbfd778b130e4650b58
8772 F20110216_AACDMQ reed_s_Page_142thm.jpg
f959f919b66252dd05c842ba7c750434
792c8165a1f0d982f746a893f53f8539ea97baf3
36619 F20110216_AACDNE reed_s_Page_038.QC.jpg
765cd5d8de8a03a5fd58bceb965c4daa
77e5e50aaee229a1dd404601c46e4e9a4e171a78
8949 F20110216_AACEQH reed_s_Page_045thm.jpg
2a025d9a4d29c487cc472c764647f8bf
060825cb54d4f9fb48a368d1c5aae7032e547530
9148 F20110216_AACEPT reed_s_Page_026thm.jpg
b4cbf65735369b2ab2f5ada85c052f51
acb1fbca565cb4ee26ac659acdcc05ed402c4a2e
1986 F20110216_AACDMR reed_s_Page_027.txt
3ac388c5c8f719924bbc408746b1723e
0cd9a0ea22a54630cd63804f490cc5304fcc0625
37930 F20110216_AACDNF reed_s_Page_040.QC.jpg
542af01dffd6fb3cb595deb69aee9dfd
ee8c2b68840707b9070a998d0997e29d863f4477
9144 F20110216_AACEQI reed_s_Page_046thm.jpg
441e32d427b7808ba2daa6d353e7e8e6
315bc82cd9285f4f7e4c3b913842b1b9ea830b43
8462 F20110216_AACEPU reed_s_Page_027thm.jpg
6a21bdb6942bdf8b53d3cfa1fe372bcf
361544ff069cb9d26e5d7f21e2479d58160e3983
14354 F20110216_AACDMS reed_s_Page_140.QC.jpg
a639e8e78bbd6dddbe2c365f03e1f34f
eb94da093bc96f649dd9e3d9cb1ea665865e9812
62491 F20110216_AACDNG reed_s_Page_076.jpg
fcb331035ebf0f967cf6a5df30d5f851
0e92120efaad2757423249999845390634ce9fce
9167 F20110216_AACEQJ reed_s_Page_048thm.jpg
2685df1f8a61f18193019811a2dffe3f
ee4d7b1049718b8e512c443c6a31ea8591907606
8992 F20110216_AACEPV reed_s_Page_029thm.jpg
1af1ad709561e844428ab0f1d64bbf2b
62aff0bf227ab2d1aef0f4a9262fcd488c9b415e
F20110216_AACDMT reed_s_Page_060.tif
8155629ae209586cf9cd27a00a223820
c3b018750b2c83ce82c11461a24b4d636156843c
F20110216_AACDNH reed_s_Page_164.txt
337a11cd34fea1371abace9c7850c48c
227819332ce6c7bd4a75cfcfbf75b5533238353b
8908 F20110216_AACEQK reed_s_Page_049thm.jpg
42a74f232c53b79fbadb8939afa53d30
a8fee5671e634c8e1c3fc823a173928066324c22
8988 F20110216_AACEPW reed_s_Page_031thm.jpg
cc3af04d38c55b030a8b6a345d07f987
96e64872c5b708ffcf1be106f75f5fa90b9ee759
F20110216_AACDMU reed_s_Page_123.tif
127110a29a6bd66e489438fa1c3e98ea
5791a7f168304146dd7906bfe81cb22d14d95f10
8617 F20110216_AACDNI reed_s_Page_134thm.jpg
353d797fbd657800a021f3de41a23747
51b858577828249ad471670c4572677c5547f724
9340 F20110216_AACEQL reed_s_Page_050thm.jpg
2f34325bd7741092169fd56355ba33e5
1c9023176a7202e5957fff7b724eb5573d0c785a
8530 F20110216_AACEPX reed_s_Page_032thm.jpg
0966cadb145a85855ccd096e9c8a3f9d
6e4bc4c3a054b1fc9c9f38b0e7e69bbb2fbb83f6
F20110216_AACDMV reed_s_Page_145.tif
2e45251222e47646277d3707b1e7a799
d967c97adb1432ca6765e8ea7d0147adb92a058e
134980 F20110216_AACDNJ reed_s_Page_169.jpg
4293bc728993989128dce63eae0edb62
6ac005cbc150820f1347c2706ebf1544437f93f2
4097 F20110216_AACERA reed_s_Page_073thm.jpg
6a8346472898078ef151da16e36da192
fadeb2fdabe1249c43aa5df13fa7b588533f9d1e
8953 F20110216_AACEQM reed_s_Page_053thm.jpg
0354db8efbdbf765c84b04a1bc280970
aad46dbd38db1235e8c8cce82068414914cdaaf7
8276 F20110216_AACEPY reed_s_Page_033thm.jpg
4ba859cadea99fc62021c51403a23d76
fda18d545ffaf69f7ee961fc7d0d3d82bb4baee4
8764 F20110216_AACDMW reed_s_Page_004thm.jpg
8b3901f7cf7420968a44fe68a8c4473a
7220e9160ed3f9ec85b0564d7fa7b059fdc505ba
420956 F20110216_AACDNK reed_s_Page_011.jp2
b1521da4396f9ba04a95c9c353e8d31a
32004a2b4b52e7f11e5f1a63af87c8bc86fa1dc9
4462 F20110216_AACERB reed_s_Page_074thm.jpg
430e157a9920a1783a3656bca4cd2de3
db44ca4534e4d3eb97cfb6d11185b83408bf76fe
6126 F20110216_AACEQN reed_s_Page_054thm.jpg
c94307e5de810aa5dd874a1b3a07a987
121dc2076a046cb1a1a5a8d72e2b3fe794b74ec0
71409 F20110216_AACDNL reed_s_Page_146.pro
cdb6a13ce62bbe8fc52681254d17c2d4
a29c3a3ea55ae7c814b2ca190e2f3d4886824e93
5206 F20110216_AACERC reed_s_Page_076thm.jpg
cdc1af3c790a09d29e80b18fc3c53d90
714e3af3ff8e1509ec0a9fe52dcda72c7d69f8ea
7525 F20110216_AACEQO reed_s_Page_055thm.jpg
3f4b3f1835ef0bc897ed45041ed64cc4
8fb57712b042df17d91ec0d161f61a0105e41a41
8832 F20110216_AACEPZ reed_s_Page_034thm.jpg
489f6ecb4cb8776058df82ec5007042a
cad5dce6e4737c36611aca875e0d7e23f887ea3c
34321 F20110216_AACDMX reed_s_Page_037.QC.jpg
bd1de6de564e50ce245e72f9764f7744
fd5ee70c5aadd8c85664503819896963cc6f0266
F20110216_AACDOA reed_s_Page_010.tif
57ea5a788d713c5f22a2d36c0e45c3cf
06f2157013e1ed1cbda329a74c0162cd55d35c81
F20110216_AACDNM reed_s_Page_082.tif
da8205e687ee3ff02c889c365095e5fe
67374c21cfd304718f0c1455333f89da8915e5a7
4606 F20110216_AACERD reed_s_Page_077thm.jpg
b24c860cfb079af272246d2e1707630f
4ea1618b174a445a086c7624ee766721acdec997
2685 F20110216_AACEQP reed_s_Page_056thm.jpg
dda65472e621617d4922b50653c2f3cf
cc4d7d322dea8c020e22ee298cb8524a38e2887d
F20110216_AACDMY reed_s_Page_007.tif
daee7476911ebafbd7c21cb3f6e185d9
b665b86eb592f518c3303abdbf73b3d0caf08dc5
F20110216_AACDOB reed_s_Page_011.tif
568bf43a02f9e0fa872d964dd9356bd8
06478977c149fc835703aaf63b40a1a3b8af5e6e
51659 F20110216_AACDNN reed_s_Page_035.pro
c7e22064e708c86e22beb1c22a2ce4d2
a5db454e6622b02960a48c325e02e918e3c111b3
8948 F20110216_AACERE reed_s_Page_080thm.jpg
80059765b6a01c6d71d7970af46974a0
2a0ce283a909a263c4babc1fff0f60648ac1eb40
8544 F20110216_AACEQQ reed_s_Page_057thm.jpg
7fa75cc35d0f4899efe7dcedc8701dd5
2563e5b74311e556cf37e6be5418cf6ab1232090
115894 F20110216_AACDMZ reed_s_Page_104.jp2
68460cb476e8d93153e6766f74654db3
8478eddc10e845b821367a21d5f1db69ad22723e
F20110216_AACDOC reed_s_Page_012.tif
da9ac06bf3e4cf9d5646c3016c6d8bbf
347fe245e558266190ac333b9dba9b3967f88415
152383 F20110216_AACDNO reed_s_Page_156.jp2
9475be7dfb029e6ff0a3e55d9e1a8f0e
066cc01c264ae594a9f796461fe56ca0e739fb69
8378 F20110216_AACERF reed_s_Page_083thm.jpg
c6a1efe0bddc83719eb69ea3636896ee
1116769e89c50e6aae78f1ee21a0ea0b8ee06086
9236 F20110216_AACEQR reed_s_Page_058thm.jpg
5a13745af64aeff7677eb11d6fdce050
616fb208c7745a30391a9c93cb291b813b922fc6
F20110216_AACDOD reed_s_Page_015.tif
48fe57ed36ce0e5ce647a0d166dce8ad
4d1ee7ec60b8f74a606cf82e7fdf4b2be96ca58d
35603 F20110216_AACDNP reed_s_Page_057.QC.jpg
97789ce9a30a34fb241f922bc8a5c9d7
27eae9cb754bf442d20291d6c4c24a8c3c55a192
F20110216_AACERG reed_s_Page_085thm.jpg
693f07d9ede265f14f0ba55da874cb99
f66bc55360b7ef2299de98b4d1da7f701b561206
8067 F20110216_AACEQS reed_s_Page_059thm.jpg
66db4d4c30c187b0c84f533b40423e54
87fbc5a35f96921fe22795f4c1401863832deed6
F20110216_AACDOE reed_s_Page_016.tif
ca17862154d04a5f06149b15624f179b
e17796419444df564bf6533a16ae5b0b333ddaa3
273156 F20110216_AACDNQ UFE0024724_00001.xml FULL
3fe198b1af3e29bf151ae52d6aa118c9
6101e486781a1d841e2d9baa3c5878e759277ea3
8556 F20110216_AACERH reed_s_Page_086thm.jpg
d6a95a22893523c076cbcf9ef3cece58
8a2a1e7cd85a3bd4cc5787a22c49077c2646786b
8122 F20110216_AACEQT reed_s_Page_061thm.jpg
03c1789d6cb81beab8549edc448961f3
c7449d20a16160a93a54e9c11a661ab79ecc4b2f
F20110216_AACDOF reed_s_Page_017.tif
e141548996c1c57d9103924a1077489d
a24fcb8a341cc4d9ab158ed7db0d5cf62847fea2
F20110216_AACERI reed_s_Page_087thm.jpg
615003619726dedcfa31a0d3a5204107
3553efb568fac32bf2151a68f59ecf50210149cd
7881 F20110216_AACEQU reed_s_Page_063thm.jpg
792d89e762e2743612ce059dd8340251
acbb3a3e907256007f0b3473581d3bd9fdfbb038
F20110216_AACDOG reed_s_Page_018.tif
6488341a1af3d1c083f83f4e554d1595
27dec94ab9745843a57ec33a3163a9407f3fdf3b
8899 F20110216_AACERJ reed_s_Page_088thm.jpg
68bcd84961a41e520f0bed047713df0d
4537e9a9a396614f755f508e430fa6b85e61ac08
8648 F20110216_AACEQV reed_s_Page_064thm.jpg
cbff1afd1102d8cb339c1fccf1040aa8
db05571b848db2d707dc441fb63e16b58a496ba6
F20110216_AACDOH reed_s_Page_019.tif
aa95957f293a411cb9e8f8cec48f8d25
14b9333eed67d014f1e67932ea0542b795a7f7e5
F20110216_AACDNT reed_s_Page_001.tif
a2cc27370847fe25db971dc1e4aef29e
3184b073248c26bc4da2111d41936b8696d0ef45
8678 F20110216_AACERK reed_s_Page_089thm.jpg
bb3a374e56c854cdb4e6a767cbea75fe
e488e5436025f68a5466144325089db59a26edf8
8896 F20110216_AACEQW reed_s_Page_066thm.jpg
1fc58f4d5d26bfd277c815d375eea88b
9720d28154ee4f6b219761487bdfead467af5eb0
F20110216_AACDOI reed_s_Page_021.tif
0000269220b999817bc0449c0f5efe18
bfb89e592c997330f9836ca5eb3d863420e83177
F20110216_AACDNU reed_s_Page_002.tif
728aeeca0acf780585f5846c0f822077
a1b3dc2b708edd9bd444ce7bfb2c2e3a1ad7cc42
1082 F20110216_AACERL reed_s_Page_090thm.jpg
cb8464fe7c2b8692ce8be0a72001bf42
48ec0451d98d9eaed589c93b368a793f0649a0ca
9002 F20110216_AACEQX reed_s_Page_068thm.jpg
8129346cb71764d57e46014fb4949629
2dfbff0c057fc694a06f384d3092158965ff3972
F20110216_AACDOJ reed_s_Page_024.tif
18f1d0e24be38c2ceed25a86262353cb
da6313a9da064136a7ae289e6386451e428b4cc4
F20110216_AACDNV reed_s_Page_003.tif
c87fce36bf5d6b537440b5a8a687a64e
7074f1506bb147344268116d9163ae24a3f86f1c
2253 F20110216_AACESA reed_s_Page_115thm.jpg
8201325cc91ad1dd4e7e7663fbfe89d2
4cd9d9fe60598973f98ee93bee5ceabe3d0d4a12
3474 F20110216_AACERM reed_s_Page_091thm.jpg
cc51bddfd20d1241b7f7dd5c19b74b9b
850ca909817fc834808916c47d75e76dc182a978
5833 F20110216_AACEQY reed_s_Page_071thm.jpg
ae6e8e82449027ceb8604c78cf0af847
2dc5734c6ac540e3fa9c31c940b6795c775c5268
F20110216_AACDOK reed_s_Page_026.tif
504cbcf94df4974f4da86b842e0c6b6f
a8777db9ad4af377837a978c7caf79a6a6b11805
F20110216_AACDNW reed_s_Page_004.tif
9f5cebbce8d0b381da97c39d299ad288
a9b2a101fb27a2a884afc88e276c300f6c08e62a
4194 F20110216_AACESB reed_s_Page_116thm.jpg
f35b731e4e9c07daff3e25e9fe56e88e
f9d6fd47b429cfa1eceb3f304d44f4000f10340d
3907 F20110216_AACERN reed_s_Page_093thm.jpg
9c1d0d47f0f1af1150161cbc3b02f5d7
5630c0df66bbc7061b4b783b5fa2d81dd9a704d2
6482 F20110216_AACEQZ reed_s_Page_072thm.jpg
e2edb206c977db32298760aad56097ae
306d02dbae787cbc6324d6ba368c554ad3b6896b
F20110216_AACDOL reed_s_Page_027.tif
68d199c1e70164556390f5e4222524e7
e84dc5d16f654b997b77ab312d750d55c4a4c575
F20110216_AACDNX reed_s_Page_006.tif
34bf3162aba2fb78b58271d5b1f489fb
72fef2eb1b5c8205bbf705d7f06a028489113a2a
2273 F20110216_AACESC reed_s_Page_117thm.jpg
921d4dc260cfd8f3cf5877e835c90e74
1e4295d114121a6289bfb904ef461fa775dd146a
3299 F20110216_AACERO reed_s_Page_094thm.jpg
1a65b71ae63c862f12c3f91ef0a20ef6
4127cb012acb043d14db4fcdcf8048a6ef85fe90
F20110216_AACDPA reed_s_Page_045.tif
91b7c878cb2d5b8836d1c0f313608d9a
aff0ef2e324a2f97291a2bc89cba159477d52f4e
F20110216_AACDOM reed_s_Page_028.tif
f373a5e8e35822a56e7fc55b5ac63fd4
63b7c9967ec2860a9c589285dad97ed90abdeb75
2444 F20110216_AACESD reed_s_Page_118thm.jpg
f85ecc75638251a01881781ca24c72d6
8580dd8524cd384376074d94ab4cd5562d05c05d
1709 F20110216_AACERP reed_s_Page_095thm.jpg
3a9d789538b399fc7fc6751421a30b7c
573a061142c9e0f9f6cf8d85801bb4a8dc8523e4
F20110216_AACDPB reed_s_Page_048.tif
638564dd6976c242b58b85a3bebdcb00
4eedab4ecd12772574a5e55af11e893ba0a0f062
F20110216_AACDON reed_s_Page_029.tif
d875e6b2d61364c1af23ad790276e20a
db39fc9823ba890527cee5be7079f37d51b8db75
F20110216_AACDNY reed_s_Page_008.tif
232374e95a72f9dee3931115b2b3f363
a521b3d8668b3f463f403a456794c8c6c3beced6
4286 F20110216_AACESE reed_s_Page_119thm.jpg
1868a34e35247f930f7b231969bc322d
697c0460a0c2fd6f24bedf59524588ba9c670a99
3701 F20110216_AACERQ reed_s_Page_096thm.jpg
8dc750dbcea710cc59d26ea91b3380cf
c9cf0d3dcbe8fd9a5bda7526b6fa4caf0269f3ac
F20110216_AACDPC reed_s_Page_049.tif
f4955609eb60c2db12336a5ad1adccbe
09ee5d50c0233ba84a932d1ab05bce994e7315b5
F20110216_AACDOO reed_s_Page_030.tif
b7ba91f4767ebaec4fd11e2151235226
d16fb7ef61305d532929e67f375ea7e0dc2f4988
F20110216_AACDNZ reed_s_Page_009.tif
275593709deec0c6a52da2076b8a7973
5344bebef573a94ce37452e40a800ad32479254f
7623 F20110216_AACESF reed_s_Page_120thm.jpg
dc7ff1f8c721367a9ee77c8ab06d11fa
878dde21285d788c5ee78461ece718807928adb3
3079 F20110216_AACERR reed_s_Page_097thm.jpg
214abc681c29ae43997ae4ce98f66087
53e372cd3ad27f364736f74a1cbff43584a81b75
F20110216_AACDPD reed_s_Page_050.tif
9e5f036b82f2d2bc49a02b9fc803f6f1
0aec8ecf49e0a3560d9cc804ef2450e54a5fc4c7
F20110216_AACDOP reed_s_Page_031.tif
b877412f4ea9dfd2d707d6318f3e7259
56b751dde2dac246f5d4768c8a42f2c8f0b043f3
7272 F20110216_AACESG reed_s_Page_121thm.jpg
4cc2a624883239be786ed0939080a047
c137fab60f9374d331547cd25e45e14c84186673
8972 F20110216_AACERS reed_s_Page_101thm.jpg
c4c2174d5c7b667f4da095a273348f65
ea7e602c082f865237813a74e1b329e5ba436325
F20110216_AACDPE reed_s_Page_051.tif
4efc21ff59eb2037b43b179004e10d43
db62e6738e40190c3cd327185aba3fdad1fd1c89
F20110216_AACDOQ reed_s_Page_032.tif
f5e1ac97e47f36a3178fe5684a016bc6
c6fddba0d60493ff472cca8df749a2da2e7e2d17
3760 F20110216_AACESH reed_s_Page_122thm.jpg
139aa69f9ecafc0c95adbd2dc309201c
8e794621d243d9c73bd2f2c295b7baa4fc749f9c
9012 F20110216_AACERT reed_s_Page_102thm.jpg
dfd97f6d4f9d11a248048dd3b6f77ee4
9d29f52d19f6538dd23fcb85a45687cfdfe42da3
F20110216_AACDPF reed_s_Page_052.tif
718ec4a9fabfc8360dc1b1df5358fd16
19f36a47fbe45d6db18db15a7616875f282e630e
F20110216_AACDOR reed_s_Page_033.tif
abfc012205cf5a20440071fb42dce7ce
8b3891f48a4dbdfdca2bb8dbbe995e8c726dd633
2277 F20110216_AACESI reed_s_Page_123thm.jpg
0f32c54878a09edafb2b9d35580a63a1
37653f61a713411cf4c9bc29a850f4537aa979d6
8710 F20110216_AACERU reed_s_Page_104thm.jpg
073411aee6d71e7a07d6eb0d068b90fc
7e2193f874f19c00e1a9f2b123b606b40e689948
F20110216_AACDPG reed_s_Page_053.tif
6cc338beea54931e8ca7110fa8e66ea3
aea24284029bcbc965f1b539e41770e75b2a17fa
F20110216_AACDOS reed_s_Page_034.tif
702a3e94187456890f86c8fdee44cefd
1c2e3a836d11a142ad94712312f96258a88e3ec0
5200 F20110216_AACESJ reed_s_Page_126thm.jpg
606772a7e04309013cb2a0ee5c36f8ff
43c4a370829912c4e7e0743556728989756b0a9a
8049 F20110216_AACERV reed_s_Page_105thm.jpg
827d43da45305df0e1865e60e53c71d7
498153cab8a7c0c237a361647aece3144fc6750f
F20110216_AACDPH reed_s_Page_054.tif
40837c07ae08d72d3dc6dc34ec22715e
f7482c5ffb46c05f7b0e1c471c86f08d5424894c
F20110216_AACDOT reed_s_Page_035.tif
87a33227964817d4481508175150c239
ff31bc957e423e814128abb71ec2e60605a971b7
6257 F20110216_AACESK reed_s_Page_128thm.jpg
8a77d801dd63053130ca4fbef7dcff93
407a4d649296cb8ffe401057684ae7e989457811
8429 F20110216_AACERW reed_s_Page_108thm.jpg
2a24d45a293fa616549b8759517c2363
fcd839625fe17eba8d8469b45ee575b8c6e3ca29
F20110216_AACDPI reed_s_Page_055.tif
8af9585b0e4d869d6f8572a52b30a588
306c9ffb61a36440f9199421b1cf3519f40c3cd7
F20110216_AACDOU reed_s_Page_036.tif
b48b5269a84efa1c0af609253be9e8a3
7db3161ac9ad4fddad5e9d2c47c75c6d7c380b19
6553 F20110216_AACESL reed_s_Page_129thm.jpg
2b56a06be8d8e57b81370f1ff116a6fb
9bb15d4ecb3be5747107e13c6870c6b84dd37073
8701 F20110216_AACERX reed_s_Page_111thm.jpg
180da53b0e19a97c870f8bfb02d55f9d
66bb0a35dc2985ca16f3415c1bc73d4a3388b4da
F20110216_AACDPJ reed_s_Page_056.tif
3e8b11004849ccb60bfa2032d634d760
0ff27f0fd73d21e2bed77f7e08940abbb9dc88c7
F20110216_AACDOV reed_s_Page_038.tif
0f638e8433607d1d7745c0c8f8eff165
6ed5556b3698ea727227eb6f8e4cf24d51454c71
9493 F20110216_AACETA reed_s_Page_152thm.jpg
bc901d313fad3dd4189ec220af2fb08b
cd335ce80248ff148d6fd3ebfd6a6c5862f3af75
3925 F20110216_AACESM reed_s_Page_130thm.jpg
254985e35b991bc18b11b24a98ac1656
45dcb4bb9dda23083751269ac2c7aafbdf1c8ecb
8958 F20110216_AACERY reed_s_Page_112thm.jpg
539566353aaee3da1b126ceddf632e6d
f7fae638299d4a219b9481bdb6b135747721035a
F20110216_AACDPK reed_s_Page_058.tif
414f1c1a3f8aa6363752ca0d2191ca8c
519d7f44775e8c67ff43e5cfc214d5b686545f73
F20110216_AACDOW reed_s_Page_041.tif
0573237edf8238c9face584b5dab45ed
fd322afba4df1d46fea76e56108de40b86bd0c1e
9091 F20110216_AACETB reed_s_Page_154thm.jpg
b19ea03ab5d46382baf8a4c9413a61f9
3134bed96276271ed3d56644d7f60ffd5c05fedd
F20110216_AACESN reed_s_Page_131thm.jpg
b2fe8039847f6af861bae2b0b34b2878
81a2d6155e6edfb8d392f4a0f0f58ea906b355b6
8971 F20110216_AACERZ reed_s_Page_113thm.jpg
c59c43b001624c40df6bdf4e67314a80
7cb93aa85ee6b2cdf5980f547d0e0037ba486aa1
F20110216_AACDPL reed_s_Page_059.tif
939d9002b9a3eda4806e8823d09308d7
974dcd485de5afb8b4f6437f04107e911114876a
F20110216_AACDOX reed_s_Page_042.tif
a3dd4755d7079f76315b1bce8b39a15e
f1d036e50f69e6afcc9404891ac7daf1611a718f
9671 F20110216_AACETC reed_s_Page_159thm.jpg
7c742b4884c0c9b2b2d77861500d8970
b407b07aaf53733f9c1ac94c4c1e69eb191e5329
8102 F20110216_AACESO reed_s_Page_136thm.jpg
630bb9c4e0c0d0474fbe68d0c1fc3322
96dd46a31c436548a34a072de60c1e3aefae8d1c
F20110216_AACDPM reed_s_Page_061.tif
31c6fe5cdeb6d3d1237c358004aba55f
fe3d0ab847fd7bda32c5a279882bf9aca6003401
F20110216_AACDOY reed_s_Page_043.tif
8c5ff643a143e234eed4fe30c4ee9be7
c38e611a6672015d483287961add19151f2e5370
F20110216_AACDQA reed_s_Page_077.tif
eee9ef630f8d3d278952f0d020a9da7c
ae66f93e80d2cf10f95c96a7bc66ac25cc88a8ca
9338 F20110216_AACETD reed_s_Page_160thm.jpg
3e491206cb075ef52b4280f1068ae5f9
6ba2e14509dd818ca7f3b9528fc760783a196dc1
8843 F20110216_AACESP reed_s_Page_138thm.jpg
dd5b93ce3cb3313e88aacc9b7ddcdf97
d1a0faa516d7073c2470307d6f6c379902ebf5fb
F20110216_AACDPN reed_s_Page_062.tif
0b999ba159e1cba0355e11aec6655949
2b93c444956cb8d4acee05e1641440ff4d0ec9a3
F20110216_AACDQB reed_s_Page_078.tif
dd041b2719dd637baa24d65e985f5fb7
6ec01f06bbc886da1fdcee1052160b73bfaad5a7
9355 F20110216_AACETE reed_s_Page_161thm.jpg
03aae31b9fb6804afa49bd4862a1d08d
f28f186a045b5fb58566724f3aa875c04a42104c
3977 F20110216_AACESQ reed_s_Page_139thm.jpg
e9db2d7aa5a13d52975d5aafa27e167b
b000f97d198fc2999f1a1f98331946b5943913d9
F20110216_AACDPO reed_s_Page_063.tif
89e9a4b99a0b31272a9de75bcf5199e5
df384c98a24584cd56eb9d65ba086161b758aca3
F20110216_AACDOZ reed_s_Page_044.tif
5319a54cf161b8bb877db5cf04e9152c
6b00a6f12bde7eb2aaf20fe40b7276b6e22535e1
F20110216_AACDQC reed_s_Page_080.tif
c8878ff8a8b14578cccc04de7a8c00b5
da0bd9aef2f0395673492f69dc1b6ae166d172ea
9596 F20110216_AACETF reed_s_Page_162thm.jpg
243632af79601b5aac2ca2178be1140b
81662c9394763373a4fb73a88e509877176463e6
4092 F20110216_AACESR reed_s_Page_140thm.jpg
d364faa4005afbbfc748fcc7d3f6b38b
0eac50879d30726e7fb1c7d50503b92648a800fa
F20110216_AACDPP reed_s_Page_065.tif
dfd7c30a97bbbeadbda506af2fa82284
27c582d2e2caf1a399acc0a221d63f5472ba8089
F20110216_AACDQD reed_s_Page_083.tif
395484a890a34dc16db21ae39a63b42b
ae6b331d5fd1c876d24c952fce5293a57e520912
9522 F20110216_AACETG reed_s_Page_165thm.jpg
9e5802c73809f6ad55e87d34c73d5e80
6283bf85b983323c019412bf768fd6a160764b09
4042 F20110216_AACESS reed_s_Page_141thm.jpg
b5a2866f8386386acce0aff23b2fd86f
4cfc578fe6fc5a2a0691886b2d46a19dc88bd7e0
F20110216_AACDPQ reed_s_Page_066.tif
9187859caf57bb6f8b133467a4c4be52
51df8626fa1616b50270578ad6dbb3aa1441b5e8
F20110216_AACDQE reed_s_Page_084.tif
336d36dc95e6382bf18483dfda25fea0
56971425e72d40d3de6099849cab6bb0033ff7c1
9250 F20110216_AACETH reed_s_Page_168thm.jpg
04213bddcb6eaa3982766cee012ad9f8
2aebbc4a94981a3579f525168c99240b1cd483a1
3803 F20110216_AACEST reed_s_Page_143thm.jpg
2367e8422cc822ec7c962ed8ee2fb819
8e6364ad0fc90880ef3e78ac15e092e74a6621fc
F20110216_AACDPR reed_s_Page_067.tif
a0377318ff85746c183c53ca482625c5
91e3ba8509a08879affdd6a0ee913d87034cea08
F20110216_AACDQF reed_s_Page_087.tif
89fc8da3f3708777a48c7ee84f414533
3dd9d9aae9de0e6b16c385a92516a444ab9569b8
1813 F20110216_AACETI reed_s_Page_170thm.jpg
17e2f94ea46941fd89e6ee37dee79363
699790417e10616d683bb8c46e8c0027071f3c79
9650 F20110216_AACESU reed_s_Page_145thm.jpg
d38d6bd7d912805f9bb34be3c31c3b0e
d2ec6dc579ce04568c79ab54d7330d2b8900a985
F20110216_AACDPS reed_s_Page_068.tif
92390a71834b543f48c86d69c151596c
c85db26a29debaa193c09e71940ca54e8b40d9d5
F20110216_AACDQG reed_s_Page_089.tif
ce0af5efc124b0a0a864ae21f45e75bc
8a40393f2913b80cb0e45e6918bc86c191cfaeb6
7139 F20110216_AACETJ reed_s_Page_171thm.jpg
d24283f648174e35439c8ecf13b6fdac
8ddef35c4eeab9ea96acdb29d12e8a1d7a9c076b
9142 F20110216_AACESV reed_s_Page_146thm.jpg
ab2aeee5eb458c4364daba8ebe4f470e
4e2b4863dbe16ce8f8d051bba52840c6066b3824
F20110216_AACDPT reed_s_Page_069.tif
7512d1c646d71b97cad2ef30120df62d
82786dc2c27622e7607e0a11ca3cdd4b74a4f4e5
F20110216_AACDQH reed_s_Page_091.tif
bbecf5fc478cc5a7261496b1ab6d79a6
6f30267cce3829be3e181c25aec4309b789ec776
199056 F20110216_AACETK UFE0024724_00001.mets
cc57423fcec3a783337003f9cf156b9d
d8fe4b28e35720070c9bb2089d1dddfc913dbdd2
9722 F20110216_AACESW reed_s_Page_147thm.jpg
d51152606503ef8582ba4cf9f848c689
445a2cb8f0cb16ee31d5ba397d201e337e089949
8423998 F20110216_AACDPU reed_s_Page_071.tif
808ef7021b802dfe464fb8ae1201590f
1f18d436ae59e03f638c824f671a1f234dd67adb
F20110216_AACDQI reed_s_Page_092.tif
40f68d95196224cce9c3c6376c2f1ba0
cc2197cf028a6220a395e71848b987053f837565
9237 F20110216_AACESX reed_s_Page_148thm.jpg
d525afde26f173d4c942dcdc74590543
0dd2156f62b1721214f9de834f7893f9a5be350f
F20110216_AACDPV reed_s_Page_072.tif
d70144a05d686f85d3dd54ca094ae075
e3fb8cea9c3da95c0b95e30fe0a050ece3bcaa6b
1054428 F20110216_AACDQJ reed_s_Page_093.tif
b1ecb217a3f57840dea6d07fc95e955b
c3d2ec795328bdad94fd89e0033c1d5d87c11472
F20110216_AACESY reed_s_Page_149thm.jpg
eb42d8e44ed0fd48a3b568d75095e4ff
3a5e5de56e26dc9d6c20ed735f1ed67a86005a52
F20110216_AACDPW reed_s_Page_073.tif
b4ca6e34f16b34dc1bcd182c4ed798d1
5fc7c38d673ac5ece3790147001ef3b5712c8e58
F20110216_AACDQK reed_s_Page_095.tif
99cd8952d33e5c68f0e4c042a8030599
a36fb5c6c049cf3b4ff775f15ec6e102083e2cda
9644 F20110216_AACESZ reed_s_Page_151thm.jpg
ac897bd9f40abd4fd70dfbf21f8d1cb6
8d45a2bfae8d3aafc3351f28b949c2b8c2fbb0d9
F20110216_AACDPX reed_s_Page_074.tif
13c3e60a68488c310d3a8d416e994c1f
db8f8ec9379ea1e235c285dc4c143e4c57c9778d
F20110216_AACDQL reed_s_Page_096.tif
8f263173f5e6115a1796ff62f7304967
906d289e1655f90bf2c24d44b81e73924e335bda
F20110216_AACDPY reed_s_Page_075.tif
8ba40b5765a68e57bb4568fec0eac019
bf17d200128312ac7cf0ce28cd2b0346def30902
F20110216_AACDRA reed_s_Page_115.tif
32d4de1d1ab5f77be69d89bbb5f16f49
fcd8e70d20fee718fcf2bd596580751c1b4684ae
F20110216_AACDQM reed_s_Page_097.tif
13a0f8861072ec9d1eb6dd96fb1780bc
c6e6305c4c71f490fa067cb2527a56e670d6514f
F20110216_AACDPZ reed_s_Page_076.tif
8b940c22906db6f533d887be6e19233d
2074940c8b41cc7ffc3908ed43369e71217ff715
F20110216_AACDRB reed_s_Page_116.tif
4eb69aa883b09611b10bb0d708a4bd5d
c7f69cbef28febbc58b5d84649dff9e0cc895c06
F20110216_AACDQN reed_s_Page_098.tif
30907d406cacf162b2105601955017b3
322414285b2ff900b49919430910e430fdc4f9b2
F20110216_AACDRC reed_s_Page_117.tif
4ec5caaf4fb49478e0aad878b9d3d96d
6f4071611ccd69620185b9ccbbb16f94292429f9
F20110216_AACDQO reed_s_Page_099.tif
492849a375fdd3185e99230cb9da2cae
02fbe780774c7416051c206838909124f968a2e8
F20110216_AACDRD reed_s_Page_118.tif
f00aeb4b55d387b0a6ef0fb9129bafb4
f88a25720da9c7d84a6d880a652d8af51d135aef
F20110216_AACDQP reed_s_Page_100.tif
e519074ad811837b1ab42a7657473d5f
86351697f0416453593ce058e4efdde83d7da8ce
F20110216_AACDRE reed_s_Page_119.tif
fcd1466430f8e54df4d8651d60cd3188
b28c063ac5a1b8cb7f3f07c24827b172c23b22d1
F20110216_AACDQQ reed_s_Page_101.tif
af5ad16f761f2d2e037a76a7e1805567
665343d714720445670d1f7ca6eabb8caabbd62b
F20110216_AACDRF reed_s_Page_121.tif
fa243e1790f17622907f578f515e04a7
8725c2cf0e3e0bdf3ce4d3bb4b30974e2bad6e7f
F20110216_AACDQR reed_s_Page_102.tif
0c589068500f079ec7c160216171c18a
45345448f4db3cb850bd991d5522eab948749c89
F20110216_AACDRG reed_s_Page_124.tif
7de9e71ab891e296f54f05c224229874
c723e639dc4be36b64ebca9e5b472a3c4560e311
F20110216_AACDQS reed_s_Page_103.tif
ad9213ba5c7c1d288ed7b64a96ee3a58
f5b6939ba66827713bc75a6c97b864b9fc4562f6
F20110216_AACDRH reed_s_Page_125.tif
f8444b66e00b4531c98d32d17d5e3450
9483de102404db4474a79092406c4e339a3a7538
F20110216_AACDQT reed_s_Page_104.tif
16a634ee349e8e6cca21522af78c13ce
692cd3e5c2ca84634959282457a09d6b4de118e4
F20110216_AACDRI reed_s_Page_126.tif
656bd7468b1b7524ba454beff84d4d72
08c18e33fdfceb75f8e4fc43ea5e982b00940d54
F20110216_AACDQU reed_s_Page_106.tif
21762372536f6d9f3d082d38e617750e
7a17f6f649ed1b7ca01e5afe9e09fd4db0cf0fda
F20110216_AACDRJ reed_s_Page_133.tif
6a99439cabb1252e250b83fd2ac78fa6
0883e238e21ae2696c47d3b7dccc4e2574bdb55b
F20110216_AACDQV reed_s_Page_107.tif
5b2729b1e46b0065aed39bb0d854ae7a
a93e02d6808f60df825efa70bfb26d03a381bc8c
F20110216_AACDRK reed_s_Page_134.tif
c80377d4c961ae6d2f23897f97c9e603
b72d2c7000e73d7e0b69ea8ec0b4c55489865373
F20110216_AACDQW reed_s_Page_108.tif
be2e00f5b4c581f4a95cea675a28487c
2cb1e1c958e726e037a45a9274e7b59c2a0fc734
F20110216_AACDRL reed_s_Page_137.tif
dffabb9e725200cf793efd3de877dbdf
75687b48925449d9a8f9a501e6fb3cb4e51e7595
F20110216_AACDQX reed_s_Page_109.tif
0f066d34a1a8452526d052822476ea1c
ac50377b5f6d479b1d824b1de1641a8c515c78d8
F20110216_AACDRM reed_s_Page_138.tif
5afde7107ff75d51a78e5a7115460cd6
cf0f3e18a4bb91352565dc8bf83b71868f85ab67
F20110216_AACDQY reed_s_Page_112.tif
1b171b61b3d8e413689dc02813d29217
03e0920e31f95d3079cdf6275b910796bff57fc1
484 F20110216_AACDSA reed_s_Page_001.txt
8571b15e0d0af1f5907620c251dd6a77
e9628ed7a238749045fb6dc198db1122c7d0a0c9
F20110216_AACDRN reed_s_Page_139.tif
b3554bbba8e3506b37079f379ece234e
a65c72094a7f57549cff38db70774461fcae8d60
F20110216_AACDQZ reed_s_Page_114.tif
a13f30f23c053ce42653b142dc4dd946
73358840c452bd2c3a1c7cf61fa2182aa48cd244
90 F20110216_AACDSB reed_s_Page_002.txt
1f83c59ae9d29da93d0782f6746b4bd2
b2801583281cf05b1306241ce746aade11a4f751
F20110216_AACDRO reed_s_Page_141.tif
2ded9f39cbb7c65b5ceee62ed31255d4
da0c1fe5698b0325d2e7096d07595d98d6f96df7
221 F20110216_AACDSC reed_s_Page_003.txt
a07ae4479f67c306231edf945780650c
404e410c206b6db2bd73b34cdf45b9b972fe64d5
F20110216_AACDRP reed_s_Page_142.tif
03f23aa5c92f63d436ee08444980c0d6
0e6aa24ca413da20b7e005d1370c53ee581ff2ad
2159 F20110216_AACDSD reed_s_Page_004.txt
77fa8d2f4f5527f6acbb5d2068fad6b7
4105b95bca2782d0b1c1ca7da16cd7c3034b6537
F20110216_AACDRQ reed_s_Page_146.tif
43d4461b646c71273f8d4829bdb93cb5
9e0a70ba7ce07574a85558ea2db7a56f2471dc07
535 F20110216_AACDSE reed_s_Page_005.txt
131cc922b8c95c6f809334f098ae22b0
c8411fababcee7c4a23601c18bab3327c5341e7e
F20110216_AACDRR reed_s_Page_147.tif
8e23e04f8cfac1e961dba8de1c979add
11d52246f8d5dacd25b67db133bd9a1c26bb4f62
4201 F20110216_AACDSF reed_s_Page_007.txt
e2c57d97bc392d35d8039ace1d71c31e
8287a1a8fd973565f63d7bb893a696b255d719ab
F20110216_AACDRS reed_s_Page_150.tif
0c8d0847caa3f47c0cdfa124b4c48b78
8e5fe71bdfb51c9398534407fa72eadc6d67846b
3597 F20110216_AACDSG reed_s_Page_008.txt
790faa1f3daa214ce3d5cfb3e713826d
2ed03f7dd0b06781661681351cf9a4358efbe4f1
F20110216_AACDRT reed_s_Page_152.tif
463a9913610be2de81b4870a094c6436
b2ab6358daedddaab4de22f101faf86877126880
1013 F20110216_AACDSH reed_s_Page_009.txt
46a36eb3d7ceca57711703d0eb623d18
991223647c9493be6b4895e2169e85417ac75929
F20110216_AACDRU reed_s_Page_153.tif
31c742c5b22e11b3c1afe16c826594cb
5942353bd5114647a0fa21b435b973d38e2e5eed
2822 F20110216_AACDSI reed_s_Page_010.txt
a62bb4ab5c2abc24252374dd10978797
cafca81541f0b3e0f4fdde207d09a69bd2a583a7
F20110216_AACDRV reed_s_Page_161.tif
3ddd9143f7b67c025fc645bc8b606c90
5e213ad55c7509b40ac76560960babd987b4108d
2114 F20110216_AACDSJ reed_s_Page_012.txt
92d2e8d3a2a0987c71ff090b8406476c
aec5dca2dbf6269f5c0f58fd9c15c67cb4a3082d
F20110216_AACDRW reed_s_Page_162.tif
ca896b151502881ef178fcc0a37ad4fb
ee27929e8a01f9b5baedca6a92d997586334625e
893 F20110216_AACDSK reed_s_Page_013.txt
66c44f8c5380de94ed880057436845d0
4d6e874a69a82b17af5041c4139d6c3333c18ec1
F20110216_AACDRX reed_s_Page_164.tif
3cd8f48c8055cbdc06cdb61c08f95177
e3ae3a59d7ff4df0f1302c5d16f0443c42520f85
2180 F20110216_AACDSL reed_s_Page_014.txt
b14521b9a7f6ef7740d68b37fa2aeed3
59f47360b5e1bf853641bc3f12d0ca30496fff68
F20110216_AACDRY reed_s_Page_168.tif
cbbe1b8a6d8222e5b7a975a2c9fdf4ea
6fd508a2b15a147780464be7283161af08772f8e
F20110216_AACDTA reed_s_Page_039.txt
100fabb3f350f0fe2d2d59b5b54f59cf
2af859af5520d77aa2c7a06e1e15c7663f06246e
2172 F20110216_AACDSM reed_s_Page_015.txt
3b1ca7659535d820a26250f9270a2629
b68bcbe39835b14efbfad00a46c0ef583bdf38b8
F20110216_AACDRZ reed_s_Page_170.tif
5a4c52bf05467ee3fa0d7bdd9559aeb9
18453e82db31483e7246a63f38e94bfc869babd7
2091 F20110216_AACDTB reed_s_Page_041.txt
6960fd49236a60086abd0599d82bb6ea
fac4206365f3af38d2372b5e82291309181dcc73
2177 F20110216_AACDSN reed_s_Page_018.txt
64057196784ee4ff39bb18e2a713a0a4
22b305aed7ecf534fec9fdc9f814cd44b48853ba
2209 F20110216_AACDTC reed_s_Page_042.txt
cceb4d941003e1ecf77b394d17bf33ec
c7329a496bb8625a7b1ab97f09902aab90e2539a
2163 F20110216_AACDSO reed_s_Page_019.txt
9febfcc16fef16052d0667dc7da1b802
dd82d23c39cd93e059e530a53ed69a1bd8ab2cb5
2138 F20110216_AACDTD reed_s_Page_043.txt
6ef032dd4431cdf2355d70d9a62ee077
fe25bac1c12adb1e99f15a8ac0f7e90a7b6c0bd6
2187 F20110216_AACDSP reed_s_Page_021.txt
42624db908a9cb3ffe24ad978ecc63a8
7e5cb7723b36216c9d2f6eb7aa325d8eb6756cdb
2119 F20110216_AACDTE reed_s_Page_044.txt
60761aec6ff04af25ae93befcceaa9db
835afb964658dd35846f5ed80c19c51f20e4ee5e
2160 F20110216_AACDSQ reed_s_Page_024.txt
434cd17e2c08a4e10ba050f69468d733
41b4f35b92bfe7bc0eb1009254c66509ce8c4592
F20110216_AACDTF reed_s_Page_045.txt
0a31e0156a3222ff5e729ea535e5af17
857fa8b0dccc75ac77205ec46cffaf458b2d4caa
2076 F20110216_AACDSR reed_s_Page_025.txt
e1d8ed19dfc9117eb3739804812ab8f2
cb500a474180dfd8bf449736d6fd1b14a369b04d
F20110216_AACDTG reed_s_Page_049.txt
42cc2178918c5622f107187c2f7465c8
4ff14213b464c26203ea50b68283ee48de8eafc4
F20110216_AACDSS reed_s_Page_028.txt
4f9f7701b9c88cde829bb8fd75d33ec1
d209127f79274f5069eb73a2fa72920868e652a2
2222 F20110216_AACDTH reed_s_Page_050.txt
e286747fd8156df2be9cf01793fba396
e20e3834d96a3f1960f99dea218d49d5d3978a48
2162 F20110216_AACDST reed_s_Page_029.txt
7391511baee0be41e4b776253898b0a1
18e783551dc35f171e7ee77fa6b78392f2f95d5c
2232 F20110216_AACDTI reed_s_Page_051.txt
d2789d9aa648317216ceeaaf1ef960ac
9e1a785b06528c0b54e21029b2ffa645862f466b
2198 F20110216_AACDSU reed_s_Page_031.txt
9e898218675aef29a7749544d607c34e
b74e230efafdbf5ed16c7c6b40d212080acc7e92
1458 F20110216_AACDTJ reed_s_Page_054.txt
b9841277350e0086dffc8d68e73f4f05
0b9e6e6fe4ec76ee130dc639ee84491e73bec70b
2082 F20110216_AACDSV reed_s_Page_033.txt
462e722bdf3a86643ae4e1e53e6d2dd8
ea82cb10d03c7cac1e4265a015a2e25731d302ea
1915 F20110216_AACDTK reed_s_Page_055.txt
2aa3dab32815d72574ef7756f3408f28
fe906a08216fa78faa8070eb322fbfb2d0781610
2102 F20110216_AACDSW reed_s_Page_034.txt
a82ff59d56b08b152b0ae8f189f1d445
13aa98c6ec529faffabb1ccd5b7fbde013387cd1
528 F20110216_AACDTL reed_s_Page_056.txt
7407311b526dcd3e97d871c2feaaaad2
d1adfd1bf33b1fcd5d6a9d26e8d1d9a56922c0d9
2133 F20110216_AACDSX reed_s_Page_036.txt
20b03bc1a9694d3f84f2bc1180006751
bca057c09cf4be57474296797afd1122b127d87e
839 F20110216_AACDUA reed_s_Page_073.txt
d8c28a4f0828764a0cb4899edcab20db
e57d10fd0712e1e1c979e9f52b6268a74bb8bc93
2145 F20110216_AACDTM reed_s_Page_057.txt
e609957f55f7d15b106e9849d5f65d0c
45098b32fd9e82aba2ef07fde96e5dd882851bf1
2045 F20110216_AACDSY reed_s_Page_037.txt
155eca9e0378eb16acb4e23dd26bdb0e
ca614efa0a142e027ddfbc220e564332733bbcdb
859 F20110216_AACDUB reed_s_Page_074.txt
b87676d810c4d19ae59a5751e6486b81
70f235deca6d6751e197775212dbaa08c21f14e1
2186 F20110216_AACDTN reed_s_Page_058.txt
3b37bd8097aa0ff374af81581f77dc7f
f00d12474fc7aabea4d2fc5d6144f2bcba267501
2136 F20110216_AACDSZ reed_s_Page_038.txt
96876b23adc6785a47ab8a0c2e65e2a4
e3268b9c0f4c1c6982c471ca2175d1f8be42c4bf
766 F20110216_AACDUC reed_s_Page_075.txt
e7ee0da9b506d38b227aaa3f894763f9
4815b3f7d5da446fba85ef5538a6ce752b3607f7
1840 F20110216_AACDTO reed_s_Page_059.txt
7139a61eb7cd907071acfc892555b28d
7be9cb1d7172438f27da93c42f2dd9b91dbf2213
689 F20110216_AACDUD reed_s_Page_076.txt
fbf2a968d73de17e649ec8f586124e2a
dd8a9aaca93cf493b80a677686fd03d9f98085c6
1803 F20110216_AACDTP reed_s_Page_060.txt
e07a43c282383aca16cf66b3872fb117
ab975654c101f799e5e03d37fbadea9e7294310c
F20110216_AACDUE reed_s_Page_077.txt
7632a48be51c4c3b7b611f6b658e98ad
46a96b3a8c6144fba39f2b6a4866bcc213997c06
1863 F20110216_AACDTQ reed_s_Page_061.txt
ae80460718a78cc968698fd749bc70a7
f7a0e090b601d0912c534ae880101876f74b5e4e
2151 F20110216_AACDUF reed_s_Page_078.txt
a4f0c740ef33a01e8f5526960aa195e5
b327a3878d8d1362a517ebedab89f5d9b3abef3d
1885 F20110216_AACDTR reed_s_Page_062.txt
56bb7aede2ee50cc5e540234fae5d91e
5869d60ec8915a0ad2d65a709d92cce0167fe521
56726 F20110216_AACEAA reed_s_Page_114.pro
f292e7d77e082be5f552830a4e8815fd
d98f4bea926d0b2cc064d4e96967ba56148539e2
F20110216_AACDUG reed_s_Page_079.txt
ee85f8f091d5ba08463347812aeccd31
e7658184e5980ace91d309cd537f7564393116d6
1913 F20110216_AACDTS reed_s_Page_063.txt
326906cdaee935611ad07f94b81420b7
460e7e59da5d9b0bdd9f302070335fb92c12f578
11732 F20110216_AACEAB reed_s_Page_115.pro
c39cd1f2e23932fe574fe16196da3e0b
b38af6cbc91b5d0a62be88c7c19215385817b49e
2068 F20110216_AACDUH reed_s_Page_080.txt
8b707d1547eb6a0e043ce01bb35143b0
5893d35763db9c59e395c2938ed9f6b5d0c163ee
2019 F20110216_AACDTT reed_s_Page_066.txt
7357f81c7cdb9226fc1aab19a3115e23
3a68e3acfe3613a6028d7d083b30a377c72d8471
20358 F20110216_AACEAC reed_s_Page_116.pro
184e60d27fe40f7420eac957adf9ab5b
dfb3c4a3016540c8c6e2210519cfa119e6cd382c
1831 F20110216_AACDUI reed_s_Page_081.txt
044c537e8244d8f6f676e64fcdb71301
d9f7191b981af4a58c43226c4cc63c3236bbf1f3
2249 F20110216_AACDTU reed_s_Page_067.txt
b9e025d51796368471f13d789d0efd77
9f07a6dc4252fbcc8e508a553b6821a08d20d6c3
11957 F20110216_AACEAD reed_s_Page_117.pro
6b7361ad1242e8fa3d3d5736709b3eca
a5aa9fdea195093c76c552a22b37d8a87ca1f38d
1822 F20110216_AACDUJ reed_s_Page_082.txt
44d2239f5ea18e9e43f7d8f24aa3cd58
5d2aa8d18ab9cffb609e6cb1fe3f3df5463131a5
2203 F20110216_AACDTV reed_s_Page_068.txt
74ab60368ba6697caeae73a666b05c8e
e8d5460c54f83a6e643de8b60f9879e5ec06cf2e
16624 F20110216_AACEAE reed_s_Page_119.pro
780f1a77942992e21f6c4dbf5cd3ae8d
1648dd1e4b12a3f4ed84ee2380dcc8f8ae729da0
1923 F20110216_AACDUK reed_s_Page_083.txt
dbcc8b41750d96a25e59adfa123bbb90
a0eb0de24f00e61699ce91318e4fe112dda95ad7
2038 F20110216_AACDTW reed_s_Page_069.txt
9a15b8f9977de66d97233b702597ac4b
975e6e53358c18d418829b14eadb72979ecb9a37
44088 F20110216_AACEAF reed_s_Page_120.pro
c1b841262810e8d1787d291661bbaf79
3478fa2d9e090a0b04e860e5f2bf9e28e58e69bc
1990 F20110216_AACDUL reed_s_Page_084.txt
27aa4393ad6e591253e69a420636a3e2
6cbb94aefe25956e035b5e88bcf92e1e3c738e4c
F20110216_AACDTX reed_s_Page_070.txt
4683a0a39c817ca8fa917c0f38fd3208
5392ea2c15c4ac0c77188cfa0c7781dc779056d7
46634 F20110216_AACEAG reed_s_Page_121.pro
cb48b9c1d0ff9a66b3a4aef64941cd62
bd237b79a69f7adbd2b2beb6f322c97a84b78366
2029 F20110216_AACDUM reed_s_Page_086.txt
c3da5f1e1e9b299ee7d007478ebaeb2c
f08c01116916ca962b11ccaffe2ef78d17869d7e
1380 F20110216_AACDTY reed_s_Page_071.txt
5c856e6bf57de74fedcd7a8a76ba1875
8d1c1cc9f37aa95f1d94297c183ad522d5d9792c
14943 F20110216_AACEAH reed_s_Page_122.pro
938bd0e96b26f7beb070e963d2bdb508
cde535e3a9012252ef661db4a1b62fe2c0d7db18
2241 F20110216_AACDVA reed_s_Page_101.txt
3646c1bcc960ab6a90729e1f04397779
b044c663f6a885d6da119609703223498b4e84bf
F20110216_AACDUN reed_s_Page_087.txt
45a121708099825f14c8ff3b6da2a57a
e9c885bbcb782c629c8c7365458200663418bfcf
469 F20110216_AACDTZ reed_s_Page_072.txt
b345c8024a50b717b3468efd38fccaca
562bca3de866bbb0790d231c3b129a559885da66
5959 F20110216_AACEAI reed_s_Page_123.pro
8f6c356da9337b933c4826aa983e8762
6c09d649635a3adbcbd1453b7b06fe50e41f530c
2156 F20110216_AACDVB reed_s_Page_102.txt
e910df8e0323be60dd7ab19ee8402526
af5cfc5150f8e8f4815f5dff6b2884a185493879
F20110216_AACDUO reed_s_Page_088.txt
37126c6d0595625e099198149ff0ef45
e887a7cd3093762bc44c6bd6a8c0f465edc45ebc
12917 F20110216_AACEAJ reed_s_Page_124.pro
587032cbada0cf11052decb29c9894c7
11e2b8076036f4d55f0104f58a129f53c69928fb
1940 F20110216_AACDVC reed_s_Page_106.txt
07631680708aa7f8089ff33b0f3234b7
fd177f2635f13131d32429db0464b66617c2c019
2130 F20110216_AACDUP reed_s_Page_089.txt
2f3dead09051bdf29504b82b53ba7753
6a6e39177a4100bdf052e87e97f1cc30e568f566
2084 F20110216_AACDVD reed_s_Page_107.txt
fed8fcf9fab6ebfe60ebfbc655ef275a
5ba430bc27d22ecf805d46bb3072ea616c2894b3
157 F20110216_AACDUQ reed_s_Page_090.txt
09b97c67765f248f072205e0b8367dbb
2d27aa2cb4c855ea97a3a7d5eb99a44d8c0c9e74
15373 F20110216_AACEAK reed_s_Page_126.pro
1571ca88fb5950db70763bdb2ea01ab4
cb3c69a6ac41b404f3dc3b62a275506ea49d2077
1918 F20110216_AACDVE reed_s_Page_108.txt
b873c429494c1cc7781b81b51f34580b
5efb95186a54505ccfcb5c43d241fd0a62eba5d1
669 F20110216_AACDUR reed_s_Page_091.txt
b3a0a8cd150ba849aceb96b047e97558
c612895f49970c1b1558262a9fcec720c0194c9c
69068 F20110216_AACEBA reed_s_Page_150.pro
0ef052309407c2e9a999d2a205ec78b8
8f2f408ff2d0d249b8946d149251fcdddbf27352
29542 F20110216_AACEAL reed_s_Page_128.pro
2da9b230252e3aa1a117bf701bd7933b
4d82a3108d9c36863e2d546bb47f7a8bf78fc2e0
2205 F20110216_AACDVF reed_s_Page_109.txt
8dd28a3aaec3148c8cb0083c8942b9e4
3bec266acbb13d08b5395974a83a7c6e140dc781
1935 F20110216_AACDUS reed_s_Page_093.txt
8b3ab3e0b2502e734453927a955fdb47
3a8b0348f8115efabf2f6a5ca30c6f556222174e
76442 F20110216_AACEBB reed_s_Page_151.pro
6b3c872e55dc848f5808625361a13075
3ab4ea3d1e1cb5531ee653ea7648b00e4cfbae3f
12041 F20110216_AACEAM reed_s_Page_129.pro
fe48e67950ebbafa5ac1fb95c549c85f
ad07ea988338ed0afeb007741ac235ca75c87ea0
2072 F20110216_AACDVG reed_s_Page_111.txt
632de5a3b102ec3200e1ba779d6404f8
cef9f7781c1d38209dbf342231ed82e8a9545c72
609 F20110216_AACDUT reed_s_Page_094.txt
49ad36525e623f65957190a9bcf7c08b
543c342a1490a7ade3e510df90a3e03f8238768e
70139 F20110216_AACEBC reed_s_Page_152.pro
5271d60e3babf8318ec97d0898da3292
68ac75242d8c115ad60e8492a6d74ba5c14df970
10308 F20110216_AACEAN reed_s_Page_130.pro
4c4397ebb88d53bb29dd72fee7189bbe
ef7498423cd297fb5d7cd7bc1bb31837c989b34a
2191 F20110216_AACDVH reed_s_Page_112.txt
73fe204cabf666f834183cc93afb0885
c44505f02cfe9c130f9b9c0410945e5e8980281c
466 F20110216_AACDUU reed_s_Page_095.txt
b87ec8450957a25053eaf6d09eb99140
41e7869395cfe87ef8d0cbff585fb3b4180584ad
76745 F20110216_AACEBD reed_s_Page_155.pro
725785e044de2d029bec5bfb44d2c6c8
07b1b5b9b4c183dfa7d8ef44d2659d9d0ae289c2
54285 F20110216_AACEAO reed_s_Page_131.pro
c37a43bc9c3a0e623e353c20fc979631
84a46dbdacb6ec51c801f96ac98a50b31720377f
2152 F20110216_AACDVI reed_s_Page_113.txt
2d47b5cd6097595353bf79d2f0339bf0
69d2e49e53c02949b3a114d9f7a60747f87ab5eb
415 F20110216_AACDUV reed_s_Page_096.txt
82fef0fc0759029942747eb9cc90a665
244af958fe4eed34b128ead77c6a3f7747517be7
76070 F20110216_AACEBE reed_s_Page_156.pro
8eb77fda2cf5948c4607a5101bc1da3e
67c97236e19af20758a0842e7255868740f09e58
51612 F20110216_AACEAP reed_s_Page_132.pro
c8d032c797c123eb9fe86422c659d7ee
96370e28dccf76a4f6cded8a49ad3426308a7385
2218 F20110216_AACDVJ reed_s_Page_114.txt
69cb56fca496d6efa9a5fda4f594f802
33bdfa7f4cc7b60b6e213579dba98c8aa2e1c0b5
511 F20110216_AACDUW reed_s_Page_097.txt
649ba2af1c351390834e898a2c130dab
136e1d5a31ca00f4cda57f19ab48de41a4ea6c1b
73266 F20110216_AACEBF reed_s_Page_158.pro
6ad652f618edff08e74a502b524c35ae
161b38f09c1b9dfb0123e3c8d1bddfad70982489
F20110216_AACEAQ reed_s_Page_133.pro
fb77622a6cda19433996b3434c09f547
6ad5a52902ccfddcdb90e9397c20aa479dab8df3
473 F20110216_AACDVK reed_s_Page_115.txt
7632337d104961eefd59d037be13c7c2
f977de4a9e4a0f849cf9f751e2eda7af0c796beb
74163 F20110216_AACEBG reed_s_Page_160.pro
64e2cff7e0ad8b1415f28937015a7808
ecf613c806bd42b595514a35b2db904acb5c4b71
440 F20110216_AACDWA reed_s_Page_141.txt
1faab51a07b9e274d85466ce77dc4ffc
92773bbef1b3aab85ab0517b81d81a90f2e0245f
24641 F20110216_AACEAR reed_s_Page_135.pro
4c268cd87bd5f2b3463f94d1cd1c96ba
286ebfe40c193dfc74f0dc4e3865317636733b77
599 F20110216_AACDVL reed_s_Page_117.txt
ebe3cbae44bf568c37782128cc2d64b0
8ab596788cf67cfa61c95ed6539996c34535e4b9
472 F20110216_AACDUX reed_s_Page_098.txt
ad27f5b04e6782342439026fc4936de6
7fe730c44c062e5443e91e875a05e865122f5478
73585 F20110216_AACEBH reed_s_Page_161.pro
e0301d059ea2f71a846348f1d0e43129
a1c217eb1d94213492400ff35190cb048dea3d54
47537 F20110216_AACEAS reed_s_Page_137.pro
afc20adb7d0ef22322deab03af5c3eb0
244540786b7b73f3aba204e746c1649ddb248ff0
371 F20110216_AACDVM reed_s_Page_118.txt
85d98586df7b02eb86ec418a4f5ed45d
09d85547decdbbf384b6625b07aab939ccb2b2b1
434 F20110216_AACDUY reed_s_Page_099.txt
67c14d20520e59569b1f59442d1c8426
1b83ccd7eee64550a69d0fa2ca01db14923caf0c
73931 F20110216_AACEBI reed_s_Page_162.pro
16537aa6332ec86dbc330ace4396b15f
2a64685c1876b6003d99d42eeec1789ca662404a
F20110216_AACDWB reed_s_Page_142.txt
38b9c6437d713b4454b9e976e0b3480d
d2ce1cfebb2467c3e5120aa39ef0195cc2adb58a
53243 F20110216_AACEAT reed_s_Page_138.pro
0a89546b1ec99660d012cb598ab8b5a8
209f13318a9e7c028cb9bb0d305666a9342cfc44
1825 F20110216_AACDVN reed_s_Page_120.txt
6a3919b6a269a7803ae65d0949b72e38
436c69f101dd1cb3d25cff8a075e9f8f76069380
901 F20110216_AACDUZ reed_s_Page_100.txt
474f346e14c8a674efd862c29065ea4a
afc2a64f73a5cdbeada1f58f112fac5d24f33b5b
69963 F20110216_AACEBJ reed_s_Page_164.pro
4e79c95ee1aa4e492de64d72b9fbc8ac
84063c339a3a82cb78d6949b34ec348f5d97e9cb
852 F20110216_AACDWC reed_s_Page_143.txt
eecb2c22f7b64cdce80c888214a157cf
29813452d8d7d3fd33edcb761b2436de84cdc91b
22353 F20110216_AACEAU reed_s_Page_139.pro
ac8011eaa2457811a9721881135b5542
0a09d06098b759cb5e87c2369f1de636fe9825f2
900 F20110216_AACDVO reed_s_Page_122.txt
c5be15c40096c4366a1b16b4d70a0152
10ce9899276abfee98aa5e761a6bfa498c1b2811
76816 F20110216_AACEBK reed_s_Page_165.pro
8770f8ea2c9a74b9d827036829aadce9
ad7d0e4053723743145ad62f31fc6aa6a0fbba17
2826 F20110216_AACDWD reed_s_Page_144.txt
779dc44f10b1d979fc10bc827d3aa22a
bfe34d2779c344005949205650a9978b4dc23069
11891 F20110216_AACEAV reed_s_Page_140.pro
e5eb5a7d870c6657975ee35526cf2f0a
23b832abc510943026db78b36d6a3fa7dbbb6250
341 F20110216_AACDVP reed_s_Page_123.txt
87cf6479939553734e7c9af4ea542506
6fb3c6a0e2ddf7dccbb7c35bb7e0c39c2420280f
3121 F20110216_AACDWE reed_s_Page_145.txt
eaacb15c6c757c7ec665130ce8c760cd
b99c74075ceb1dabc8be7f30e7120b08c5131c89
9637 F20110216_AACEAW reed_s_Page_141.pro
917c119735fdaaab8bb2f944b3df2705
d3884b23730994ff597f856cf8af98506091cfb2
757 F20110216_AACDVQ reed_s_Page_126.txt
8c597447bd0f3d355fd89cc14631cfb6
285c21a6387a1e75847ddb25116b96a9fd23bc32
75461 F20110216_AACEBL reed_s_Page_166.pro
505178ad99c3606e15c5d8daad858e23
f002eac56b2b359611b5ec37d1583a09caa65b3e
2882 F20110216_AACDWF reed_s_Page_146.txt
6075679334b311a15e1b85d69e5392ea
5c690a9baaab31954fbed843448ca351a4eccced
70113 F20110216_AACEAX reed_s_Page_144.pro
5148996410819f2501a21e003433f8da
efdf39793558019d46af40fce7abc1258a99ac5c
784 F20110216_AACDVR reed_s_Page_127.txt
4ed2330567846f7d935076c4dda4e1b4
0c53a2d5da8eb2648ff1cf0bdc394c9ccfab2499
13490 F20110216_AACECA reed_s_Page_009.QC.jpg
568ff8f1745458d4c7ef179ce040c5f4
2453b83d5fdbc48c16285f2383cc553b44486831
69766 F20110216_AACEBM reed_s_Page_169.pro
5dec169ea46ec75a17798b7c9636b4a3
5748213676eb3c3b91c77af830f68dcbb7e294ae
3133 F20110216_AACDWG reed_s_Page_147.txt
5fa9c66f36f573a787e64f13d6991c78
cec0a803f8eb858847bcca0dec3b7e91051cd138
77817 F20110216_AACEAY reed_s_Page_147.pro
870c76c74b58634d3268a8e0010478fe
43d62b29f0f40476a061b356af72d51768f0b513
1576 F20110216_AACDVS reed_s_Page_128.txt
136c87c7aec5a4dc5686e8a56bd4198b
c335ea1d1afb0cc764e3e21699b36b839987fab9
121934 F20110216_AACECB reed_s_Page_010.jpg
d122813652dff53bf4fd7c09dd0654c4
19777c21734c60312a6ffc7e14a1a870f72a181b
10562 F20110216_AACEBN reed_s_Page_170.pro
b9e139c4402a7c4819a0912c5379b676
2f972610880d2e426ae3004b775bff70e7566899
F20110216_AACDWH reed_s_Page_150.txt
c104c9e08ca3c9fa2e7adc347aee3fad
a6c5bc4577e062f3c6d8e93f00bba389db1d0fa5
66627 F20110216_AACEAZ reed_s_Page_149.pro
ab5c76fdb7a407dc0519e49d238f3c94
1a8a347dbb1de7f05764b41a00000402ed1f682d
514 F20110216_AACDVT reed_s_Page_130.txt
f21f6f339217d4e13ace017bec58a4ec
3d48f20fabb42e9da6765dd557fce782ed75ed4d
35023 F20110216_AACECC reed_s_Page_010.QC.jpg
280cee46db0056745c0ce825c1f87015
e36c1b6c784f66f8a1f98bf8beb27df3ed1313c3
42779 F20110216_AACEBO reed_s_Page_171.pro
0595951ada2c0166d8cfd4ce3f691b76
0ac8d47afbf8ae47317c8fff4931f42adeca7d55
3082 F20110216_AACDWI reed_s_Page_151.txt
1d7807541fd220a99fcbb6be46da3f2a
bd232d577fa846be23e558e1446bf4ecbf89f167
2199 F20110216_AACDVU reed_s_Page_131.txt
57cf9595756c60f89b2ef536b2210af6
bef12eb4a975ebbf97fa130ff667e7ba9808807d
25497 F20110216_AACECD reed_s_Page_011.jpg
e5bc64ed1a5859fafe32431c6fb5b37e
f622b40fecbb8cfe908e2d9b001b1c88f4c09fb7
27015 F20110216_AACEBP reed_s_Page_001.jpg
1d71ae5f2017a8fdba2db7f8d32025da
f07a1fe24a998e7db5f0129dfd649d5981eab1da
2829 F20110216_AACDWJ reed_s_Page_152.txt
cba3ecff00f76cc126feddbd01a4b56f
db23b2908dbcca34a95cefb4ab5c6e85dc20b316
2040 F20110216_AACDVV reed_s_Page_132.txt
b5e4a8e841820e521b89644db348421f
6a3832a5f5b65568e61e21b0c5a880ede9fdaf7a
8078 F20110216_AACECE reed_s_Page_011.QC.jpg
1980559ee4fcda2b24553621597f4664
e25d4a700b07ec2efd33daf8a49b7a04d6edb71b
3918 F20110216_AACEBQ reed_s_Page_002.jpg
64f0bd95ac3cde73925f3b43c173f2b7
14982ec1bd13c2c3839fa8daff5a730267184044
2959 F20110216_AACDWK reed_s_Page_153.txt
ccc09ae4c52d102e85376522264ccd58
bf7a5f7391c70dd5e751aa886dcda4da3ec2fb33
984 F20110216_AACDVW reed_s_Page_135.txt
cd16ca8489e34b84d158708f276f92e4
f370c3b7a36588a3dea710b45f359ee1a44a1e37
102934 F20110216_AACECF reed_s_Page_012.jpg
b5ca58219476845e263b46e8557f841d
d56f2ce18ab95360df070c17938a155f8c933e0d
10021 F20110216_AACEBR reed_s_Page_003.jpg
70b59488a519127f4182fd6d99a2adc4
55cfcea5f3fe899d07d1c24bf1c86202803dd1a1
2874 F20110216_AACDWL reed_s_Page_154.txt
2453b770441d3400d10423bac95a95ae
8a0d919e50a83a8344fce443ed50936bf9fa88d6
F20110216_AACDVX reed_s_Page_136.txt
5bcac78d36913df04438643b1bc7ebdb
090bfa810f367456f27173ca03ecc5ef0b7005a5
33070 F20110216_AACECG reed_s_Page_012.QC.jpg
436691f78a7505289ed2d8a2ccf34213
7518cc38a5674f133752ec0d01bd87550268db8b
86959 F20110216_AACDXA reed_s_Page_008.pro
757877c52a022c87c8abe627d3c2a422
47fede71f58ea99c54cfc7f955541880c81b9276
36072 F20110216_AACEBS reed_s_Page_004.QC.jpg
2ed45b57f825a09056ea85d29c15ce60
3137568b5770ebd9fad8e722870da0c94ce43eec
3065 F20110216_AACDWM reed_s_Page_156.txt
1256dbf3426ab60f86b0a218ed8f5f7a
43b9e0f3d8a0b34e6bb5bc01b59f1a73736b4f70
1908 F20110216_AACDVY reed_s_Page_137.txt
1db4a1776af55c97dad46260e916414d
2a22e3939532a7d92b584339fc5e9d2fd52f96c5
15679 F20110216_AACECH reed_s_Page_013.QC.jpg
31f1ca78e21e135271056a7d415ae68a
075f43d45973429213c2aa406d6034a06ae39b8e
24476 F20110216_AACDXB reed_s_Page_009.pro
47e2784412025e64724346950ac54793
b7b04e339fe38d724e4ed0dedacf3d840e2bdd6f
29496 F20110216_AACEBT reed_s_Page_005.jpg
04340b71b7a62f7e334e6bcc1b81070e
ac579ba64786ab3e468efa1e2e7993ea87e0dc9d
3040 F20110216_AACDWN reed_s_Page_157.txt
17214d85e6550bbbaf068c72e26c9ba2
df14e622d9c3ecd5e5de734af762c9e4c362a2f7
2110 F20110216_AACDVZ reed_s_Page_138.txt
b97cc0b37850d4a347c2ca284253bab3
6bc09b38b8214a72e60b46702c5f2c2e8a1dd8d2
103877 F20110216_AACECI reed_s_Page_014.jpg
1a5e348b6cb0d6d8a70cab64005956f6
fa9f96c74fa1ad882c2ee1660537e83f634f0950
2967 F20110216_AACDWO reed_s_Page_158.txt
f93d6c0d99ae9e0be4440670dfeb56ed
0425daa29ce5538d317fa83f0a11c660ce8c7214
34231 F20110216_AACECJ reed_s_Page_014.QC.jpg
1fa2138b2b74023710855059c913e079
50d1fbda2120a5b0e8b4aed4907c108e729a837b
70579 F20110216_AACDXC reed_s_Page_010.pro
ceb4141f47bf8dceb774918cf70aa18a
23cd1faa1a0ff84ab3ec8129745b5acbf5a82321
25033 F20110216_AACEBU reed_s_Page_006.QC.jpg
fb8940537c8530674924aa938b3d2029
ecc400557f855b59433ca95c8314f20d27942aba
3092 F20110216_AACDWP reed_s_Page_159.txt
62ffc1b43d843a1fd9139186ffd9103b
23989c41ea22922baf35ab0ff11363a1d0758f77
112419 F20110216_AACECK reed_s_Page_015.jpg
c9cde5db767cdc69d6ddcae94f816257
af3c966fac874ee9c0960e7b6a483de49d5ab40d
11365 F20110216_AACDXD reed_s_Page_011.pro
c80aae14f69671ef2412f120594f57b7
ad8506e3fc44b89f720e78221ef8f95be7a7a432
153611 F20110216_AACEBV reed_s_Page_007.jpg
066f95dfad2cf6843b349e33bbc67584
c1451960b89a457eb98e9709344e0f412ff7615f
2995 F20110216_AACDWQ reed_s_Page_160.txt
c2b42842cca71da6815ce8315a1a07d4
4de8fb9a2d93f3be20ae2db871e5054b4b10ab80
114682 F20110216_AACECL reed_s_Page_016.jpg
5072c453950a3ef7b57e676d0e3bd6bc
e3b79deef6d4b2cc5015790154ed8f0bb1be5d4d
48763 F20110216_AACDXE reed_s_Page_012.pro
bad0458403882995c9ce046f1174d40e
a9809217818d17773472980e4ab73dc14f9b18ba
34878 F20110216_AACEBW reed_s_Page_007.QC.jpg
613c51d90d8e87f1ad566ddc54f55350
7439de7e062a27a11cf25d0098d3ac1fa89b6ec5
3042 F20110216_AACDWR reed_s_Page_166.txt
f5c15c979b7c33eaf9bffa5c103c1601
ac33be473f30c59ab106a21b7cc00edc393da17a
112945 F20110216_AACEDA reed_s_Page_028.jpg
1bc115abdca3d52cd10648d607cf699b
046683b6fa8567203a864112b73a39ad184edc65
22556 F20110216_AACDXF reed_s_Page_013.pro
d2d3dabc4ec054bb6371a40c4abae8bb
23f0769c557921069731b7d43355abb294fcab4d
123695 F20110216_AACEBX reed_s_Page_008.jpg
47d67f11cfd22bbe60c5a3a48e1df9de
357bcbbad212f8bc289afe1469983e12886d1ce8
2928 F20110216_AACDWS reed_s_Page_167.txt
7597e9e61010cd824cf10bebf6366e0c
04cdebb53dc6fce068ea6051d5c65709a218d635
36510 F20110216_AACEDB reed_s_Page_028.QC.jpg
ea05bc17cf169b3e6bc66939e860ff35
66a202098e3b556f5acc8c47e558888af5e0fd4e
37069 F20110216_AACECM reed_s_Page_016.QC.jpg
908c0ff4c4a9e9233addffd6fa7e11ef
2166b39e8f2909fa60c95b4ddf77795b0240cd15
52539 F20110216_AACDXG reed_s_Page_014.pro
679640e8f6ee4c66d8123570f81fb780
241e822d5e2043c2d2f148303dcc567730afc6f0
28941 F20110216_AACEBY reed_s_Page_008.QC.jpg
e9acfe154f9555b8ff042bdb49b8210a
2e5cf4049ed0ad9a114caac3112c464d481a0412
431 F20110216_AACDWT reed_s_Page_170.txt
7fc12a77c586977617d8eb9f1ceaee02
4e6343d9092b138ee0b5f3cf3199f5a16db376f9
9761 F20110216_AACDAA reed_s_Page_098.pro
864cc587298acdad5b11546c2301d1c2
30317f8d5f396d8531042e84e9eae04930f58aeb
111576 F20110216_AACEDC reed_s_Page_029.jpg
b7239cfccd091610ab40fa799d7f826a
e7c361d91963c4b8ffb49ec9cdaf4724c903b01b
109870 F20110216_AACECN reed_s_Page_017.jpg
af8fc94ad8c6aa15a038d1a2f117a584
a1b6d184ea65a98cb1ffcb6c8a9f67be69cd20b0
55464 F20110216_AACDXH reed_s_Page_015.pro
090b9cbc07f46b8fb3f31958996bac1e
2a01803771d2ced0ce8ecf231e90f0060c2f43cc
45808 F20110216_AACEBZ reed_s_Page_009.jpg
f851e0463014e2a90066fa678f78208f
9e8f8db629e22ecffe3b90ee86c5321357f9dac2
1732 F20110216_AACDWU reed_s_Page_171.txt
77e05ea409a735fce0148e9bc594fd2f
ce07bfb66e2756a41086dacc65bd6a15b9a70c02
F20110216_AACDAB reed_s_Page_113.tif
dc0bfee91fc241fa24595b346763748b
34b68af7fb8e5550090408bcdede633f95bff15c
36264 F20110216_AACEDD reed_s_Page_029.QC.jpg
7747fd3b9b3619197343c549fc7a8b05
92d0938a0b08986b4425b53f23b67c40b4667529
112719 F20110216_AACECO reed_s_Page_018.jpg
83b5dbb46af62e163f68b556e9d72a28
8d38d0d900719ce88fdedf28a98cae1e4d7bae26
56830 F20110216_AACDXI reed_s_Page_016.pro
21b67087058451110bb109dd1b785bae
bab44e897f2b3f2406705c6f27cd1e54173d3754
8240 F20110216_AACDWV reed_s_Page_001.pro
3de7782b0c6094e16a83c9032a2efc94
ce417d5ad6bc5bb903b1379a3417c1824730892a
8883 F20110216_AACDAC reed_s_Page_038thm.jpg
cb6226f3c52f64c4e30599d003d71d56
31ea31d9697bc6cc596f1b3e7db96a443ac66d20
114291 F20110216_AACEDE reed_s_Page_031.jpg
9f2994edb9d5aff0b9c20b00f67eb772
24ea8de16b03c8f98895a8113a67e95159c45dad
38106 F20110216_AACECP reed_s_Page_018.QC.jpg
5473019028d08a0f39e85c8b544bbae9
cf76c1241c4d4c3a85bfb205ca3c900bdeb3e00b
54556 F20110216_AACDXJ reed_s_Page_017.pro
ff2b0d494f8cc2a29cda073e7e4092f4
5108fc80c267b2ea02ba52a8b86f8793a4cceed9
832 F20110216_AACDWW reed_s_Page_002.pro
9bc08424be7eff89137aa38fa20ef421
9ddc110c88944c62c6c8c7e4a47a5d461f9c03b3
122574 F20110216_AACDAD reed_s_Page_048.jp2
69c465807575778925ea6f87bf0b3240
5482a69d8d7feeeebc3f72cb79c284aa49cb9254
37060 F20110216_AACEDF reed_s_Page_031.QC.jpg
db681c9310bc74732658fe9c4fa31beb
52dd15a1109018a59d446765e1b7b539c02cd9b1
112173 F20110216_AACECQ reed_s_Page_019.jpg
82deb35c3577f7e9b1cddf4ae6c8eafd
b9a28fd35e91a7c657c4019c8776b98c14b4afd4
55691 F20110216_AACDXK reed_s_Page_018.pro
4a4d1b97b6cc87e44cde7da9881174db
8ef569a6b285c4d0fa9e9b6f952020d709a3e558
3445 F20110216_AACDWX reed_s_Page_003.pro
5daf5302a3ce72b31c9f28650e83ebdd
d2c9dba8649203f93a8d3cf1ea1714d3fa830dab
39547 F20110216_AACDAE reed_s_Page_162.QC.jpg
16496017ed85df502e6ba7b8f1cd925d
8ce5adf11d0b3be4d0188ba035dc9ef8be861bcd
108750 F20110216_AACEDG reed_s_Page_032.jpg
68fc28869ae3f6cd8031e05d48735deb
769531250a9816758f24127367e76fa696c22052
53338 F20110216_AACDYA reed_s_Page_041.pro
fc167776588d6ca26e40bc7322fd722f
f535a2e5634690515365186bfa0e9a4c52af2f2f
112816 F20110216_AACECR reed_s_Page_020.jpg
aa3180518390433f468ece0a8d864a11
7ec14ae673b4b4be1653fa6219a1876570c794d2
55338 F20110216_AACDXL reed_s_Page_019.pro
cd43e180f10b99ea7b35b12c9efefb88
964e86d7efead4cbade3f39002fcdd9a0243c722
53811 F20110216_AACDWY reed_s_Page_004.pro
c3581967dc0bb6a7c9fcfc218cc1688e
bdebf2432c54fd7ad099606e13e769fc8f40b1b5
37692 F20110216_AACDAF reed_s_Page_144.QC.jpg
37506a95af9ffb7b6a0fa3885654b09e
fff0ec9f6fd87195d5e7b76c12601e3e9264f6e1
107250 F20110216_AACEDH reed_s_Page_033.jpg
4bfac22e8cb789fde029bd824220c860
af747ed4ff24433aea060a7b78457320ac655e8f
55531 F20110216_AACDYB reed_s_Page_042.pro
a32211160a0abb40d5fd720349996881
b07ac27216a709cfb4a383d21fabe55a2d37a94b
37245 F20110216_AACECS reed_s_Page_020.QC.jpg
9d4202075aec35b20257d8ac578f37f6
2bb73288b3848b4dba72b33952c8be24bf59e30b
55556 F20110216_AACDXM reed_s_Page_020.pro
3cc1f3af35d4c2333c0d1f7a7ea3f822
1f8d5d67237a66a6ee6f368cdebc34326b6cd757
13307 F20110216_AACDWZ reed_s_Page_005.pro
16f681815bfc0b3cd1141461fd8c7332
2f8adc437db26e5309dc8a0b470877df4c542623
F20110216_AACDAG reed_s_Page_128.tif
6ad18cc1d7a1e406a6e45f622f696ea3
74d78b8b631e2db1a0a5c542db2802122d57fdbd
34930 F20110216_AACEDI reed_s_Page_033.QC.jpg
1139ef8ebc9a8e2b96f7fec66b211204
39f65e7729ae0614067acf32f49eae7ccedfdfb9
53792 F20110216_AACDYC reed_s_Page_044.pro
3280d3105a62b12bebdc80f7f25a1704
9256ce666a2b7b80bd93729cd359eb6c10323c1d
112958 F20110216_AACECT reed_s_Page_021.jpg
cf556cd7e461d8bfe644f762cfcd9e9d
d148109a473d18318bbaca1462351addff8b7596
55789 F20110216_AACDXN reed_s_Page_021.pro
4795eb0b76b0e60d9b5f6601b30b8ce1
1be3caeb182abccb92335bd1ab902c528e7e8640
2920 F20110216_AACDAH reed_s_Page_148.txt
d904bb86d2131bf470a906e086b8e81c
b2e7aa59fa0cb2781603e67dfeeac9310f8201f8
36261 F20110216_AACEDJ reed_s_Page_034.QC.jpg
a76e0f8509099b1108e5e74a75356642
50b0ac856143b0df9551f75981a5b96e4a7695bd
109414 F20110216_AACECU reed_s_Page_022.jpg
2d159812ec5e42f4c8957843a69e0986
4fbb0faf1c8f082f10f07ec9b662d3ec5a2074bf
55002 F20110216_AACDXO reed_s_Page_024.pro
ef71898c0dd5a62e9425823f6552c682
4e01ef998d6347aba8f770b56c0f54852f30341b
112441 F20110216_AACDAI reed_s_Page_041.jpg
146e6bbfc67f94f7d7f046e588858b97
5a2e43989d6a71d20731c871c812577b49ff9339
107150 F20110216_AACEDK reed_s_Page_035.jpg
eadcda1881f01c4532f6b7f089d602d2
421b9ece9cb7e26c5715743c0d0ab9092b02a49a
55522 F20110216_AACDYD reed_s_Page_045.pro
6a40948c7a7774562fa5cad98e448d01
262c5b11f89bb832f8b51099a451b2acb1a4c0e9
114846 F20110216_AACECV reed_s_Page_023.jpg
037f555b5bd7f857db60d9817efb82b8
42b469f7b0d13bf4aa9f75c531cb922970010477
51774 F20110216_AACDXP reed_s_Page_025.pro
733817e1a3234a009b7320e680309dec
97606fb75b5f41547b696d62613c9e7b98e7a615
34364 F20110216_AACEDL reed_s_Page_035.QC.jpg
2bc0cbb25ec99bc12fd2ce8138321fba
23d11461df7dcb5d1943fd59228d72ce35a8b2fb
1168 F20110216_AACDAJ reed_s_Page_002.QC.jpg
9ed543e9268519fecf84e0e8033a94e7
88e1a9f99e119cbea65a280259ef43410699817a
55702 F20110216_AACDYE reed_s_Page_046.pro
8ba389c2071964946edde10988e2b088
2484996961a4e3415cb91bd06be982cfac3c6a35
111199 F20110216_AACECW reed_s_Page_024.jpg
2bcc2618293de038026d8c85fe7b6d0a
7445e6097772900a9075be53da554f3d4914a4be
57908 F20110216_AACDXQ reed_s_Page_026.pro
f9a1e27dc2f3c7b316ee1b5960e41fe3
f6d1b9dd0105cf769dffa03b348835526e32bde5
37016 F20110216_AACEEA reed_s_Page_049.QC.jpg
a2d1738fade3927ab97042d3e308c95a
da220e081af9366a6046ef4cdffece2b1b1ba57d
35970 F20110216_AACEDM reed_s_Page_036.QC.jpg
ad23fa494f6450b7da0b573d7ae77b6c
092a83fb66502dc4da8a7ef2eff4fc597204695b
121055 F20110216_AACDAK reed_s_Page_112.jp2
f96672c01e11092b9f8b180c318d937d
67baeebb101cf9bc498e143b2eac84546d341a44
56565 F20110216_AACDYF reed_s_Page_048.pro
ed4bcc21818a59135e2213d645b070ff
15888a0067c1bb9f5bef9b653e0a9a80e0b5b3b3
104976 F20110216_AACECX reed_s_Page_025.jpg
f316651ff040b89e141ae3904dc931f0
f17a93bbd89e5417fadb2503ddd25a528bbefc1e
54999 F20110216_AACDXR reed_s_Page_028.pro
c4736e3d884389d05f3286659c6560cd
d31b8bf6f9f16a516439940ed86eddddf25f9a21
37762 F20110216_AACEEB reed_s_Page_050.QC.jpg
58af7fb99e20a75365b18e44d3d75e0f
00486591a1b0f6d55614587d03832c4eb36a436b
56926 F20110216_AACDYG reed_s_Page_050.pro
8f0ac72b06a1753c3bb9222aa8667e06
95c3af254afc0b5b3541adc576b38abf33cf2a1a
35669 F20110216_AACECY reed_s_Page_025.QC.jpg
087313fd2535da35112a120c2579ebc2
2e4e23ab802d76ba1d194112e50d45d6b562c49c
56014 F20110216_AACDXS reed_s_Page_031.pro
d1f65d7574d7f7e6d3478c878b2513fb
12bc75ff5acdcf26f7c911b4a31c4595297ee0fc
114621 F20110216_AACEEC reed_s_Page_051.jpg
7d68989a9c2ba5a303e47f77e428ee52
aac1a0c75fd25acc25654c51d0720f9c5b1a41e1
106778 F20110216_AACEDN reed_s_Page_037.jpg
571d180732a397a9018e03b0991a99f6
64e6a6c799431423bc5f1f587ce0694b9ff9d49f
8990 F20110216_AACDAL reed_s_Page_144thm.jpg
2f7e3d2125d53e7921f01f978402156d
6580da8d73c494595fd35c011a8135b56fbc745a
57124 F20110216_AACDYH reed_s_Page_051.pro
c5af6007ed453a8b31b9f864dba2575d
b181d75707dca7b14165d9ec250b4095f5009bb5
37706 F20110216_AACECZ reed_s_Page_026.QC.jpg
76021c9f27cbb5843d10d835acca4b2f
7c8692915d5737748d13a0323b7b73c4e5767bb5
52271 F20110216_AACDXT reed_s_Page_032.pro
62fef4e9ee5c95f2867d5fa8f66d9d08
5595f44c2bd40202e3234dad1fc04a6cecebfde4
8604 F20110216_AACDBA reed_s_Page_037thm.jpg
7cb8a2d8f9420fae1fc838a90d8bd807
e1ee3efc35cc724e6a2c5d9fecc8a29e7a321586
38279 F20110216_AACEED reed_s_Page_051.QC.jpg
fb79e1cfe29c2a7db7508fd921c03b7b
49756205bee14bd77a4338f13aa8bf47a91e226e
39064 F20110216_AACEDO reed_s_Page_039.QC.jpg
9cfc266f0831488d901e973d81420ecc
fd7f03c58face362b0053e0161f41f7f45ab2658
54662 F20110216_AACDAM reed_s_Page_135.jp2
49fabb0a883b32c56def698095c19688
1283218c1d5da9e083a55d47c88521475670b5ff
57431 F20110216_AACDYI reed_s_Page_052.pro
2372f0ca33c42ecd7859512b1eaa1915
bd3d7b86ed300a6d0441bb835eb637f7193d853d
52310 F20110216_AACDXU reed_s_Page_033.pro
1612c9775f2c47efca500fd28534284e
26fcc82dc6c036c5412c03e55a30297d77d7546f
114773 F20110216_AACDBB reed_s_Page_033.jp2
1c99b7068bb99acef038e9db7ce61bc7
436df0bed093a92ff72ebfc3b874e10400be8448
116878 F20110216_AACEEE reed_s_Page_052.jpg
ecd80f7bf4fb784fe62afa7709229e3e
191796e5b99abb0bdfab416929d77754be7e1e01
37058 F20110216_AACEDP reed_s_Page_041.QC.jpg
77dcb8cc3bbc090a5cf0747a1dca485a
ae1218759acd794c71722060222316706dbb332d
112898 F20110216_AACDAN reed_s_Page_067.jpg
2bbeeee8d6c5b0b4bdbfeed954911453
0721bf19107ad8bff9736edea78303add68aaa94
56922 F20110216_AACDYJ reed_s_Page_053.pro
230b62caef36055e6b26945ec3b23409
c33940ebdba9a995300ba4a01fc030530c3d4d9d
53540 F20110216_AACDXV reed_s_Page_034.pro
5869eb189f13027fbcd26971cbef5c57
22963457166fcf92ccfb68b367309ba4529bc3eb
9172 F20110216_AACDBC reed_s_Page_070thm.jpg
a1115a9b2c27e3ee043735b90879d0fa
6cfe120a9a01573abdb4d9748c1ade29ddd5f9b5
37812 F20110216_AACEEF reed_s_Page_052.QC.jpg
f4f755b1ced9772fca77b984d87ecd6e
556a5fccaf745de3964cc4c6c81a58b3f7d8532c
115177 F20110216_AACEDQ reed_s_Page_042.jpg
bc06c7a6a8581f9edaddd1c21f900155
6c3962cbcd499d5ca69e04e7f444e57651c052b6
F20110216_AACDAO reed_s_Page_111.tif
048d365bde2949769cb9aef747e9a4f1
989984509e48d0797c45f914380520b640863d42
35610 F20110216_AACDYK reed_s_Page_054.pro
41f9a06ca588970211a4b691fdd645d8
f4acb76f7e4668e3d9acb8122f5a615979ffd39d
54388 F20110216_AACDXW reed_s_Page_036.pro
02c6686fb7649f22fdaf55d4dc108fbc
2d6ee05ffd7a25e256b0a93886b6fba82faca164
10094 F20110216_AACDBD reed_s_Page_077.pro
87c658e374460cf4a88aae08d1a8627d
b4c532bd026c40a403f702b7e9c28f4919fc65a7
116078 F20110216_AACEEG reed_s_Page_053.jpg
11402e68643fd17a6abe9c4c049a1e00
e511ff3702c6a7731576eeababa3a1e1553862ae
38375 F20110216_AACEDR reed_s_Page_042.QC.jpg
787346a559497fa4a008da4cbbf0efcd
a7233e370b32c9d92177bbe1cf27c0c7d73c16e4
1051952 F20110216_AACDAP reed_s_Page_007.jp2
89e2623964dded7bebffedc184373b86
f5fbb594e791f2814c0c631bbe716f3980cae391
52790 F20110216_AACDZA reed_s_Page_080.pro
0442b3e8897f08977f2d77f9bc41f6fb
e9b768f64d0615d1e366db1faa733718ba7fd912
51784 F20110216_AACDYL reed_s_Page_057.pro
3d30fa7e19a030f169f8fd68f1a464d6
e0077906ec37b514efb5012c823d74c098a7031c
53510 F20110216_AACDXX reed_s_Page_038.pro
3e71603df256d78f2ee49228eafc1541
1d67adb8848ee9bfdcdb3f8b52f568e646dd8599
138466 F20110216_AACDBE reed_s_Page_164.jpg
d37e6f6d395e8baa23491f2c17918d57
c0cd466ac3cfb5909213124428cf43551a5f7844
73521 F20110216_AACEEH reed_s_Page_054.jpg
813452b79fabc7515820ae06e4f02936
c66e77dc84639a5774a1e1c07c786f88fece3edd
108703 F20110216_AACEDS reed_s_Page_043.jpg
ed49746a461a4a82cbf8957dd4228fd6
6fdd55fd9d4fc265093dd23fe9998f372742f297
75318 F20110216_AACDAQ reed_s_Page_157.pro
8bb1654e02f94e973ec34ccc58120328
815ec1a098816cdb7cf392d93625e669407dbe3b
46230 F20110216_AACDZB reed_s_Page_081.pro
eb0fa0911dd729a1461375167455282a
d6c3be55c0fed28970a5754f202d5cfb3fea1b57
55867 F20110216_AACDYM reed_s_Page_058.pro
3a34870163ace60159d3bb6c533c6832
20b4d4bdcf713eeb17ce691033214dccf5df6f38
57677 F20110216_AACDXY reed_s_Page_039.pro
0b336caf16c6310ed21301f022889caa
a4c62e15b9c86d01dc3334494d406978bee5335a
F20110216_AACDBF reed_s_Page_144.tif
7d9735e8ff39c5632f166d50165db6c7
c10145a94882f7ccf3f806f3f206b2297bff788c
25423 F20110216_AACEEI reed_s_Page_054.QC.jpg
f9b7f26604eed01d738e3e3892354783
56b9065f35346342a8889e4372ab45bd443141f9
111481 F20110216_AACEDT reed_s_Page_044.jpg
6a8dff04885624cff9376b78f9d1d783
d4aa5408033f2c2325beaee6b5df136bdadd78e7
F20110216_AACDAR reed_s_Page_065.txt
13242038fb8f00f7a2fd8a7e4fd151d8
c32e4acf9098f19bd42b23186524e01472134e4e
46101 F20110216_AACDZC reed_s_Page_082.pro
d6069f3e4aea10e0f2fa344cb75f6bab
2302182792d7318cc017836988488eb21ace8112
45504 F20110216_AACDYN reed_s_Page_059.pro
9f58a4f5569c04fd3664b8b0de19a8d3
2b364b30848b747041dcc6bca227450e850c465f
55764 F20110216_AACDXZ reed_s_Page_040.pro
097e2fc9fce52bbf8befa1655aaaa137
aad6ac839f908b3a6638d6e4e1400ec21f5714b8
F20110216_AACDBG reed_s_Page_110.tif
5910facf0f3fa2f509edaf2b1e2a3f1e
6965a656d8d9799b6eea74e645fd0b8024631741
94202 F20110216_AACEEJ reed_s_Page_055.jpg
5ace945f6cf25ee119dbd59fb4d74ec1
06f33d98049647ad016f9a396ac785d74e6eea25
112626 F20110216_AACEDU reed_s_Page_045.jpg
7eee31d2e28b726ee3af0cd3e19d7394
bd16a135f64e42186300e320d12b39d6da03504a
F20110216_AACDAS reed_s_Page_053.txt
328482c17e068806fa937c3a15ffa78c
34685c937c70d238c5cfed345fa0d91f84e56ce3
52115 F20110216_AACDZD reed_s_Page_085.pro
2c5bd2c25fb1b5164ccaf1215bdc97e3
e132e622a3578e82fa5222b17fe236a67182b137
45778 F20110216_AACDYO reed_s_Page_060.pro
c7268b0d2c24f36734b997cbfeed024c
97f91850d168f40822bb5a960861b46c4cbd84dc
53751 F20110216_AACDBH reed_s_Page_030.pro
5709c431199b6b4283766d727230ea7a
79fa29ebc46e998840d27ffc071b00832358787d
30327 F20110216_AACEEK reed_s_Page_056.jpg
0fe2e35c6949d7ce2b7450ef643d1abc
b9663e56c0ac162cc02e54c9c896a5addc32f65f
36986 F20110216_AACEDV reed_s_Page_045.QC.jpg
946529d7d84bbe17cd402b14132ab634
353b261773751b17222fbb9a54852fce59fd4892
2539 F20110216_AACDAT reed_s_Page_003.QC.jpg
d1d156554acc7ea4abfb5396d49f4290
ec2e67396c425ffad0a2da2de7850ca47469f770
47184 F20110216_AACDYP reed_s_Page_061.pro
ab70d8e8539298a5b79288d8c0be2a4d
da19e14d03251f565ee6edfecf77048a0b48671a
354487 F20110216_AACDBI reed_s_Page_122.jp2
bbf58a28c7663fd9b0e34681ab746b37
bd679eaff6f7067728499422289b5902d7c58333
10590 F20110216_AACEEL reed_s_Page_056.QC.jpg
cebe8b4518b94e2cd75e4d95bb0fd5eb
a630f0d0a9ecd73cc110d6ae1f3a800805e00c90
36755 F20110216_AACEDW reed_s_Page_046.QC.jpg
8d71e1c63f0943e11c5b887b47cb2c48
bfbddda68010e0c02e587bfd7f63cd724394f321
103910 F20110216_AACDAU reed_s_Page_027.jpg
ac463c04a398d644739c15304ba1ff20
c89efdd7aa3df603831cb0785198f72e3856149d
54154 F20110216_AACDZE reed_s_Page_087.pro
fd00fdcb08079cd4d6ff62452863b33d
8a35b14f8f6643c1e76fde168a7da9097df93bcd
47734 F20110216_AACDYQ reed_s_Page_062.pro
b3a1d0411b6f6f61814383c184697006
637587837a9c276f5d3ac4749a793a49d9d1779d
447653 F20110216_AACDBJ reed_s_Page_126.jp2
666de21507d38313401c2094da4cca7b
eb85d89b8c85c8a7b1750d1a2863e8ec6b25f340
36864 F20110216_AACEFA reed_s_Page_068.QC.jpg
6ae182c54665c0970d89ce76c309d617
eba650d69e8a8a1450870d9a4e7e362ab0361eb7
109256 F20110216_AACEEM reed_s_Page_057.jpg
275c621659705013ecabcf064d6b23c2
d8f49cb388b2f34523ed620de6f8dab6ba8d7546
113940 F20110216_AACEDX reed_s_Page_048.jpg
06cd48dfef83c704bdaa6a7dfb6e0db2
17a4f1fcfb829d1bb46c647167c2b653cda4bb2b
7831 F20110216_AACDAV reed_s_Page_012thm.jpg
d46f6afdd7c702edca159135ca5e1641
586958db5a96ee20db6978d5afe091a71d183a09
54009 F20110216_AACDZF reed_s_Page_088.pro
e01f1da8c2cbf69775e973f5cff3f6f8
15e26716376c6251fc25484736016cfdc672dd0f
47358 F20110216_AACDYR reed_s_Page_063.pro
a295e00c7d8a678a709be7d848135874
5ba31ceef8bc733b367d36a70e5dd95631d307ec
9769 F20110216_AACDBK reed_s_Page_155thm.jpg
4a75af8769b46ab9b4847535177473fd
a9a0ce37403f3d15db9b923f0176683e0f5858da
105863 F20110216_AACEFB reed_s_Page_069.jpg
5c0618a5243f9d7a776c458d5678503c
e3a5d8aab23cfa2e9a59ad5acbcfbdcd324549a8
114829 F20110216_AACEEN reed_s_Page_058.jpg
bdd73f3428d4c0747f7d1fa4e1e17b47
30674b49ea59e78612d1db3c14f90e8dfcddb37a
37397 F20110216_AACEDY reed_s_Page_048.QC.jpg
492ad8a2401d5873d31078b296513339
80abff54a027b0f38f8d0311ef9245d13acbb42f
9523 F20110216_AACDAW reed_s_Page_153thm.jpg
8bf4578a332cba971a3382938619de9b
f7c5e2857eefd94c595d038c28e82baac5c12379
54279 F20110216_AACDZG reed_s_Page_089.pro
9e29c655824004b633ecd4dd9af97fb0
094da0f3d5d1eb1775dd67f971f790597d652320
52810 F20110216_AACDYS reed_s_Page_064.pro
5b5d9a8e778f44ed7036cb9f5d36d8b1
a34dbaafdfc0860353fd7f4e1d3aa64e0b25960c
8264 F20110216_AACDBL reed_s_Page_001.QC.jpg
f6beb3e5309653a47397da703a0c784f
a100b2a5a7816a2513772d7488ddf1f36d2a351b
34679 F20110216_AACEFC reed_s_Page_069.QC.jpg
bbd940bc63cb609f735d9d187afc3edb
bbb4894936b53b6ac890dc954e1e95d22f0785b7
111404 F20110216_AACEDZ reed_s_Page_049.jpg
bc58819c16b6de3d11f893aa53d14074
d6b76c8e05d65ea306fde969a2108f3c0d8a9273
7919 F20110216_AACDAX reed_s_Page_117.QC.jpg
64da84ef42b0bfb82cc90cd648c9d178
a834bfd17b21c216b5134ced280bb7bbb7379050
14841 F20110216_AACDZH reed_s_Page_091.pro
fcc61cea2f8b693140d1d0816bbe86d7
6b4b3aadf5421d7d39d71af880e74507fc1a8240
55761 F20110216_AACDYT reed_s_Page_065.pro
1740fafc21fdabf612df5d4f37475134
3272b0f7c12a19242eb862e8dbb05bf433b66231
8715 F20110216_AACDCA reed_s_Page_067thm.jpg
a0a3a7533deac8f4db77f84a1844a5c0
ffc7cea06505190f68c49ead624aab6271b96a2a
72339 F20110216_AACEFD reed_s_Page_071.jpg
178033419020503d06e32535584ffc5f
7a9e408c134e445337311d4b34a4b4820aa679da
37592 F20110216_AACEEO reed_s_Page_058.QC.jpg
5d4728a771810ab01570e6f69db94fe5
5bc175eec7ce1238eddd643211ab34daa20878d7
8299 F20110216_AACDAY reed_s_Page_069thm.jpg
5023d1455965e68480be8e84064e5d76
c12ed650686d5f9034d303300701c4d7f8dd8d6b
16720 F20110216_AACDZI reed_s_Page_092.pro
65efe6b697283522df5d2b6b68852a90
71baba187eb0e96bfa60b90855fa6c584930e69e
56308 F20110216_AACDYU reed_s_Page_068.pro
41922bc6f13762dc6f9f929fe82cd7a3
3a1f86fdb1c2683cde420351002ae6d3c8131106
9175 F20110216_AACDCB reed_s_Page_109thm.jpg
27245e68dc3d914ed8b9d077c1603a20
05747d3d05a52c71698776b6ed10f8ac37981bb7
F20110216_AACDBM reed_s_Page_166.tif
bc58ab593893fe263f004dcde2d07099
71030767cc6aa360a0178ae99f7077595a513a04
51027 F20110216_AACEFE reed_s_Page_072.jpg
3928e00b92c7da0db538736f746aafc9
fbf57ecfbd2f0acf3bd72859c9e0519e1c3e335a
96580 F20110216_AACEEP reed_s_Page_059.jpg
f52b89a2fb1d5d6b85d52385803aa785
474953949ad453500b90592ce6d924328d15bf41
F20110216_AACDAZ reed_s_Page_157.tif
5b0a5d96b58c4c5e7b2356826fd692e8
01e4dbbf6c0fed613eb3042b9c3a3d1566607acf
35460 F20110216_AACDZJ reed_s_Page_093.pro
9b3fc7c347401e8c67f1423059a92f6e
a57782361bd6eb2012de94517f4f4dad3d86df1a
15834 F20110216_AACDYV reed_s_Page_073.pro
0ae195d9693265e0369477f5a1aa5eb0
a9717a04fdac74cc8008e4e04645d98c3d2dfb7a
2077 F20110216_AACDCC reed_s_Page_134.txt
3322bca35dfc2db416864a44c96132b4
b400e1bc35fe244fb43cc1d0604bf7fc78582127
52914 F20110216_AACDBN reed_s_Page_134.pro
7f958716fe08697fc0918c0fdecd3897
3557e1d5adbb985d655ece7f76ad7f0f57863a41
18023 F20110216_AACEFF reed_s_Page_072.QC.jpg
392f9e566e21728ed3d5071910fb2647
d1f24701a69ef82ab9c113779e092032d9390701
32033 F20110216_AACEEQ reed_s_Page_059.QC.jpg
f94b9350dd02f13dfa0967c2dda7e74e
f8a164bbde0b1a13f64f37f06d78ed276810f43d
13193 F20110216_AACDZK reed_s_Page_094.pro
b6e37804bdbcedb3b29f740f641c434f
416e29f53b4dfc0403ccf31c5597d4c9328a201d
13012 F20110216_AACDYW reed_s_Page_075.pro
886d2150dd4b922faf0630641c13dbee
32c668f482543117ffd52b1f6a4e32b9df963aec
150147 F20110216_AACDCD reed_s_Page_145.jpg
8ca77179f7f32c5f0d57f61c8aa8c23b
18fb63ccc4db287d5f60592d35c94b9f2ab1a635
102569 F20110216_AACDBO reed_s_Page_120.jp2
ce98db39bfced522d06894279881c18f
3262b594575ae274ae90cb8504d3d0dfe2591beb
13614 F20110216_AACEFG reed_s_Page_073.QC.jpg
883c09ee56370bdad5b341693baa863f
4ef266d588b2d2115e4e5fb0ed9761d02d5bde8e
112017 F20110216_AACEER reed_s_Page_060.jpg
62086a8fdaeaa5c3f2deb75112145997
5769f4ddccfe2563616da8eb2947a44bd92db62b
8403 F20110216_AACDZL reed_s_Page_095.pro
d7adc089fec835f2f190620ad4d2fb50
a25c8dc916c66eb712b46e33b26d008735721f39
15946 F20110216_AACDYX reed_s_Page_076.pro
86542059c7887deb93cc46a1570f3ed8
01311b306b4b2d9d856ca6fb0d758e7ce5f3bbca
38792 F20110216_AACDCE reed_s_Page_122.jpg
be8f1728c307ac930a4140c82b2be470
db39b09e23694f374b34648bb41d8d6fe57988a0
F20110216_AACDBP reed_s_Page_085.tif
1cefa23c091f3b2ebca0e4fc1f8c622d
f8012a635e0f3bf2e78fb1497ee1420476b026b2
15734 F20110216_AACEFH reed_s_Page_074.QC.jpg
9e481b872e068a3f242f4fa63bae3bb5
4341c3b80ad9ff5e91196bb1f083300bca3ffd07
34094 F20110216_AACEES reed_s_Page_061.QC.jpg
55613be0aba153002f213c3de84e466d
fa9691c5234ecfcf4e5308e59376faaa0b42f9a4
8363 F20110216_AACDZM reed_s_Page_096.pro
84a0824b0f7a326dcd10bf3cd2852aad
b49e504481502a22b41194f42e88d86cf69b9ba0
52371 F20110216_AACDYY reed_s_Page_078.pro
9eb2afcb187674a8e5542522ed8961e4
d9af74f85b8fa58b120d27aac0871827785aa43d
3861 F20110216_AACDCF reed_s_Page_090.pro
3f2382cb71d613fa13e0693d82ee774f
9403a143caa7ff0827916b1d177307fda4c30031
118029 F20110216_AACDBQ reed_s_Page_088.jp2
264c40661d9c92fa3160832b5cd22e78
5bd4c58bbb7be12854410a5b3112df25260d48e0
42561 F20110216_AACEFI reed_s_Page_075.jpg
d4777b62e96f527da57171b1f9352583
d03a73f7585b5c6c91b611a7eaac1e9edbef947f
101130 F20110216_AACEET reed_s_Page_062.jpg
e1ea7203131ced2f0eaf4876e8c1278a
115746bddf85b35b848c7b337fd83f1b509c6f59
9377 F20110216_AACDZN reed_s_Page_097.pro
72049a6faad2e00e876a0bfd363f2e19
e0cfcc6707c5a1972f1482697aacec3292f6d75d
49526 F20110216_AACDYZ reed_s_Page_079.pro
c1042a9af8c5914de2a5808642dfba00
fd2ec642d2caedcdedf0a7a40c12583b4bd032cd
152272 F20110216_AACDCG reed_s_Page_155.jp2
636796a7f3200b60d1f94dd4c96426de
b471dc77fb7cb0f68ed764e4708e848fac6b0992
18705 F20110216_AACDBR reed_s_Page_074.pro
3d2ca65850889c71c8f9bc35ad97f95a
45086b382ee87b32820d9556c55b7c334584e770







ISOLATION AND CHARACTERIZATION OF EQUINE UMBILICAL CORD BLOOD
DERIVED STEM CELLS




















By

SARAH ANN REED


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2009


































2009 Sarah Ann Reed


































To Jake, who taught me what it meant to be a true horsewoman; Aja, who relit the fire; and Jared
who was there for it all









ACKNOWLEDGMENTS

There are so many people whom have helped me throughout this process that it would be

impossible to thank you all. First and foremost, I am thankful to my advisor, Dr. Sally Johnson.

Sally gave me the chance to work in her lab as an unproven technician and then invited me to

join her lab as a student. Over the past five years, she has coaxed, encouraged, motivated and

made me into a better scientist and a better person. She pushed me beyond what I thought were

my limits because, in the end, she knew I could do more.

My committee has been supportive throughout my tenure at UF. Dr. Moore was

instrumental in teaching me valuable ES culture techniques. Dr. Brown provided a wonderful

outside perspective of my project from a clinician's point of view. Dr. Ealy was a great

sounding board for ideas and was extremely helpful with statistical analysis.

My lab mates have been wonderful at providing friendship and support. Sophia, Dane, Juli,

Sara, John Michael, Lulu and Dillon Thank you. I am forever indebted to my friends who have

been there for me throughout the last five years. Sara, Beth, and Ella have all been the greatest

friends to have, whether I needed a shoulder to cry on or to just go out and have fun. John

Michael has been my lab best friend and the person that I could always gripe to when I had a

frustration with anything. I couldn't have gotten through all of the real-time without him.

My family has provided constant support and understanding, even when attending graduate

school meant moving 1100 miles away from home, missing Christmases, birthdays and all of the

little things in family life. My Mom and Dad, Lisa and Howard Grove, have provided endless

encouragement and faith that I could do this. My grandparents have always let me know how

much I am loved and that they believe I can do anything I set my mind to do. My in-laws, Don

and Barb Reed, have also provided much support and encouragement along the way, and I thank

them for accepting me into their family.









Finally, I am supremely thankful to my husband, Jared, who has been there through all of

the tears, successes, late night blood collections and long work hours. He had faith that I would

succeed even when I lost mine. Even when he didn't understand what, he understood why and

stood behind me the whole way. His unfailing support is the only reason I stand where I do

today. He is the love of my life, my partner, my other half, my husband and I am the luckiest

girl in the world to have found him.









TABLE OF CONTENTS

page

A C K N O W L E D G M E N T S ..............................................................................................................4

L IS T O F T A B L E S ................................................................................. 9

LIST OF FIGURES .................................. .. .... ..... ................... 10

ABSTRAC T ................................................. ............... 12

CHAPTER

1 INTRODUCTION .................. .................. ............................................ 14

S elf R en ew al ..............14...............................................
Stem Cell Plasticity............................................... 17
Transcriptional Regulation of Plasticity................................................... ............... 17
O ct4. ..................................................................18
S o x 2 ...................................................................................1 9
N anog .....................................................................20
Epigenetic R regulation of Plasticity ..................................................... .......................21
Role of Fibroblast Growth Factors in Stem Cell Maintenance and Differentiation ..............23
Embryonic Stem Cells ..................................... .. .......... ............... 25
C h a ra cte ristic s ........................................................................................................... 2 5
D differentiation .............................................30
Um biblical Cord Blood D erived Stem Cells ........................................ ........................ 33
C collection and P processing ....................................................................... ..................33
D iffe re n tiatio n ........................................................................................................... 3 4
A du lt Stem C ells.................... .. ....... ........................ ............... 3 8
Bone Marrow Derived Mesenchymal Stem Cells.........................................................38
Peripheral Blood Derived Progenitor Cells ............................................ ...............39
Umbilical Cord Vein Derived Stem Cells.....................................................................40
A dipose D erived Stem C ells ........................................ ............................................4 1
T therapeutic U ses of Stem C ells...................................................................... ..................42
Spinal C ord Injuries........... ...... ...................................................................... ... ....... 43
V e rte b ra e ................................................................................................................... 4 4
Cardiovascular Repair ......................... ........................ ..... ..... 45
T endon and L igam ent Injuries.............................................................. .....................47
B o n e Inju rie s .............................................................................4 9
C artilag e Inju ries ....................................................... 5 1
M muscular D ystrophies ......................................... ...... .... .... .............. .. 53
C o n clu sio n ................... ...................5...................4..........

2 C EN TR A L H Y P O TH E SIS .......................................................................... ....................55




6









3 EQUINE UMBILICAL CORD BLOOD CONTAINS A POPULATION OF STEM
CELLS THAT EXPRESS OCT4 AND DIFFERENTIATE INTO MESODERMAL
AN D EN D ODERM AL CELL TYPES ....................................................... .....................57

Introdu action ................... ......................................................... ................. 57
M materials and M methods ............................... .... .. ...................................... ............... 59
Umbilical Cord Blood (UCB) Collection and Stem Cell Isolation ..............................59
Equine UCB and Adipose-Derived (AD) Stem Cell Culture.................................... 59
RNA Isolation, Reverse Transcription (RT), and Polymerase Chain Reaction (PCR)...60
O steogenic D differentiation ...................................................................... .................. 60
C hondrogenic D differentiation ............................................................... .....................6 1
A dipogenic D differentiation ...................................................................... ..................6 1
H epatogenic D ifferentiation ........................................ .............................................6 1
M yogenic D differentiation .......................................................................... 62
H isto lo g y ............................................................................. 6 2
Im m unocytochem istry .............................................................................. ............ 62
Results ......................... ......... ............. .......... ............... 63
Foal Umbilical Cord Blood Contains an Oct4-Expressing Cell Population .................63
UCB Stem Cells Form Chondrocytes............................................. 64
Differentiation of UCB Stem Cells into Osteocytes........................ ...................64
Foal UCB Stem Cells can Differentiate into Endodermal-Derived Cell Types .............65
Inefficient Formation of Myocytes and Adipocytes by UCB Cells .............................65
AdMSC do not Express the Same Complement of Stem Cell Markers........................66
D iscu ssion .......... ............................... ................................................67

4 REFINEMENT OF CULTURE CONDITIONS TO PROMOTE THE
MAINTENANCE OF EQUINE UMBILICAL CORD BLOOD DERIVED STEM
C E L L S .......................................................... ..................................... 7 8

Introduction ............. ........ ............. ............. ............. ................. 78
M materials and M methods ..................... .......... ...................................................... .... .... .... 79
U CB Collection and Stem Cell Isolation.................................... ......................... 79
Stem C ell C culture ........................................ ..... ... ..... .... .... ................ 80
RNA Isolation, Reverse Transcription (RT) and Polymerase Chain Reaction (PCR) ....81
Statistical A analysis ........................................................................82
R results ............... ........ _.. ...... ..... ..... ...................... 83
UCB Express Markers of Pluripotent Stem Cells ....................... ........................ 83
GM and GM+FGF Maintain UCB Proliferation...... ........ ............. 83
Protein Surface M atrixes Promote UCB Growth.................................... .................84
Oct4 is M maintained Throughout UCB Culture ........................................ ............... 84
N otch Signaling in U CB Stem Cells ........................................ .......................... 85
D iscu ssion .......... ............................... ................................................87










5 CULTURE OF EQUINE UMBILICAL CORD BLOOD AND ADIPOSE DERIVED
STEM CELLS TO PROMOTE TENOCYTIC DIFFERENTIATION ................................101

In tro d u ctio n ................... ...................1............................1
M materials and M methods ............................................................................. ......................103
S tem C ell C u ltu re ................................................................. .................................10 3
P lasm ids and T ransfections ............................................. ........................................ 104
Confocal Microscopy ............................... ................ ..............104
Protein Isolation and Evaluation ............................................................................105
A ssessm ent of Proliferation..................................... ......... ............... ............ 105
RNA Isolation, Reverse Transcription, and Polymerase Chain Reaction.....................106
Quantitative PCR....................... .................... ............ 106
Results ........................ ......... ........ ..... .................. .................. 106
AdMSC and UCB Express Markers of Tenocytic Cells ........................................106
Scleraxis M inim al Prom other A ctivity....................................................... ............... 107
AdMSC and UCB Survive on Various Matrices........................... ........................108
Culture in Matrigel Increases Tenocyte Gene Expression ...........................................108
Fibroblast Growth Factors Elicit Differing ERK1/2 Responses in UCB and AdMSC.109
Effect of FGF5 Supplementation on Actin Structure ................................................... 110
Response of the PI3K Pathway to FGF2 and FGF5 Supplementation......................111
D is c u s sio n ............................................................................................................................. 1 1 1

6 SUMMARY AND CONCLUSIONS ............ ..... ........ .... ............... 131

APPENDIX

A SUPPLEM EN TARY DATA ................................................................... ............... 136

Mouse Embryonic Stem Cell Culture and Differentiation ................................................136
Alternative UCB Differentiation Protocols ........................................ ....... ............... 137
M yogenic D differentiation ............................................................................ .. 137
N eural D differentiation .......................................... .. .. .... .......... ....... 137
A dipogenic D ifferentiation................................ ................................................... 137
Quantification of Oct4, nanog, and Sox2 Across Time in Culture................. .......... 138

B TABLE OF PRIMER SEQUENCES ............................................................................142

L IST O F R E FE R E N C E S ................................................................................................... 144

B IO G R A PH ICA L SK ETCH ........... ................................................................ ............... 171










8









LIST OF TABLES


Table page

4-1 Effect of substrata on equine UCB1 derived stem cell population doubling time ............92

4-2 Effect of substrata and media on equine UCB1 derived stem cell doubling time..............93

4-3 Effects of horse, passage, media and substrata on mRNA expression ............................95

4-4 Delta Ct values for hes realtim e PCR. ........................................ ......................... 99

5-1 R eal-tim e PCR prim ers .......................................................... .. ............... 116

5-2 Cycle threshold ranges .................. ...................................... .. ........ .. .. 117

5-3 Putative transcription factor binding sites on the mouse scleraxis minimal promoter ...120

B -l Prim er sequences and sources ........... .................. ........................... ............... 142









LIST OF FIGURES


Figure pae

3-1 Foal UCB cells express stem cell marker proteins ................................. ................72

3-2 Induction of chondrogenesis in foal UCB stem cells............................................. 73

3-3 U CB stem cells form osteocytes. .............................................. .............................. 74

3-4 Foal UCB stem cells form hepatocytes.......................................... 75

3-5 Incomplete initiation of adipogenesis and myogenesis in foal UCB stem cells and
A dM S C s ................................................................................................7 6

3-6 AdM SC fail to express embryonic stem cell markers ....................................... .......... 77

4-1 GM and GM+FGF support equine UCB stem cell propagation.................... ........ 91

4-2 Equine UCB stem cells express markers of embryonic stem cell pluripotency ...............94

4-3 UCB and AdMSC express a limited number of molecules in the Notch signaling
p ath w ay ........ ........ ...................................................................... 9 6

4-4 Inhibition of the Notch signaling pathway does not affect proliferation...........................97

4-5 UCB and 23A2 myoblasts express hes. ........................................ ........................ 98

4-6 BMP6 inhibits myoblast differentiation in a Notch dependent manner ........................100

5-1 AdM SC and UCB express markers of tenocytic cells.................................................... 118

5-2 Mouse scleraxis promoter with putative transcription factor binding sites .....................119

5-3 Scleraxis promoter activity is not increased by growth factor supplementation in
U C B stem cells. ..........................................................................122

5-4 UCB stem cells express Erm, Pea3, and Scleraxis........................................................ 123

5-5 UCB and AdMSC attach to various culture surfaces...........................................124

5-6 Culture in matrigel increases tenocyte gene expression ..............................................125

5-7 UCB and AdMSC respond uniquely to FGF stimulation.........................................126

5-8 Fibroblast growth factors stimulate proliferation of AdMSC and UCB stem cells in a
M A PK dependent m anner................ ......................... ........................... ............... 127

5-9 Culture conditions affect tenocyte gene expression in AdMSC and UCB .....................128









5-10 FGF5 supplementation does not affect UCB actin structure .......................................129

5-11 FGF2 and FGF5 do no activate Akt in UCB (A) or AdMSC (B) ............... ................130

A -1 Stages of m ES colony differentiation. ......................... ...................... ....... ...........140

A-2 mES embroid bodies differentiate into a variety of cell types..................... ........ 141









Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

ISOLATION AND CHARACTERIZATION OF EQUINE UMBILICAL CORD BLOOD
DERIVED STEM CELLS

By

Sarah Ann Reed

August 2009

Chair: Sally E Johnson
Major: Animal Molecular and Cellular Biology

Musculoskeletal injuries are responsible for a large portion of wastage in sport horses.

Mesenchymal stem cells (MSCs) offer promise as therapeutic aids in the repair of tendon,

ligament, and bone damage suffered by these horses. The objective of these studies was to

identify and characterize stem-like cells from newborn foal umbilical cord blood (UCB). UCB

was collected and MSC isolated using human reagents. The cells exhibit a fibroblast-like

morphology and express the stem cell markers Oct4, SSEA-1, Tral-60 and Tral-81. UCB

express transcripts implicated in embryonic stem (ES) cell pluripotency, namely Oct4, nanog,

Sox2, Klf4 and c-myc. Culture of the cells in tissue-specific differentiation media leads to the

formation of cell types characteristic of mesodermal and endodermal origins including

chondrocytes, osteocytes, and hepatocytes. Limited adipogenic and myogenic differentiation

occurred. Population doubling time and the presence of Oct4, nanog and Sox2 transcripts were

used to determine culture conditions that promoted the proliferation of a stem cell population.

Culture on a protein matrix (gelatin, collagen or fibronectin) shortened population doubling time

compared to growth on uncoated plasticware. Inclusion of fibroblast growth factor 2 (FGF2) in

the growth media slowed proliferation. The persistence of Oct4, nanog and Sox2 expression was

monitored over time in culture in UCB stem cells. Oct4 was detected throughout the duration of









the experiment. Sox2 and nanog expression declined with time in culture. Finally, the effect of

culture conditions on expression of tendon markers was assessed. Initial stem cell populations

express scleraxis, an early marker of tenocytic differentiation. Culture on collagen coated beads

did not affect scleraxis levels; however culture in 30% Matrigel significantly increased levels of

the transcript. This change was accompanied by differences in morphology. Cells grown in

Matrigel formed tight colonies reminiscent of ES cell colonies while those on collagen coated

beads maintained a fibroblast-like morphology. In conclusion, we have isolated a population of

stem cells from equine umbilical cord blood that possess a number of stem cell markers, can be

expanded in culture, and can differentiate into a variety of potentially useful cell types.









CHAPTER 1
INTRODUCTION

The millions of cells that compose an organism stem from a small population of cells of

the inner cell mass (ICM) in the developing embryo. During development, these cells give rise

to more committed cells which form the three germ layers: endoderm, mesoderm, and ectoderm.

With increasing numbers of divisions, the cells become more committed until the majority of the

organism is composed of fully differentiated adult cell types. However, in most tissues a

population of cells remains that is capable of recapitulating at least some of the cell types

specific to that tissue. These stem cells maintain homeostasis throughout aging and insult. Stem

cells have several characteristic properties that define the global stem cell population self

renewal and differentiation into a variety of more mature cell types. Self renewal is an essential

property that allows repopulation of the stem cell community. One daughter cell is destined to

become a more committed cell type, while the other remains a malleable stem cell. Plasticity, or

the ability to differentiate, is a property that is unique to the type of stem cell. Different

populations have varied amounts of plasticity thus, while one cell type may be capable of

differentiation into two committed cell types, another such as an embryonic stem cell can

contribute to every tissue of the adult organism.

Self Renewal

The process of self renewal allows stem cells to contribute to a population of committed

cells while maintaining a stable population of stem cells. This can occur through a variety of

mechanisms including asymmetric cell division, polarization initiated by external factors, fate

determination by cell:cell contact, and stochastic regulation of intrinsic processes. It is most

likely a complex combination of all four mechanisms that creates a permissive and instructive

environment for stem cell self-renewal. During development, the axis of polarity is established









and coordinated with the body plan. Cell fate determinants are localized asymmetrically along

this axis. During mitosis, the mitotic spindle is oriented along the axis such that cytokinesis

creates two daughter cells containing different concentrations of these determinants. In

Drosophila germ line stem cells, differential positioning of the mother and daughter centrosomes

during mitosis determines the fate of each resulting cell. The mother centrosome is anchored to

the niche by astral microtubules. The cell containing the daughter centrosome migrates away

from the niche following cytokinesis and differentiates (Yamashita et al., 2003; Spradling and

Zheng, 2007; Yamashita et al., 2007). In neural stem cells, asymmetrical localization of cellular

proteins influences cell fate. Numb, a negative regulator of Notch signaling is localized

asymmetrically at one pole of mitotic spindle in the sensory organ precursor cell of the

Drosophila peripheral nervous system such that only one daughter cell inherits the protein (Rhyu

et al., 1994). In this system, Numb influences cell fate by repressing Notch signaling. The

primary function appears to be the creation of two daughter cells that can respond differently to

external cues rather than to specify a specific cell fate (Rhyu et al., 1994). Using

videomicroscopy, Li et al report that 30-40% of mouse neuroepithelial cells segregate Numb to

one daughter cell during division (Li et al., 2003). This is correlated with asymmetric division to

one neuroepithelial cell and one neuron. In addition, 18% of cortical precursor cells divided and

expressed Notchl asymmetrically. Notchl was associated with the basal cell of the dividing pair

(Chenn and McConnell, 1995).

Hematopoietic stem cells (HSC) provided the first indication that stem cells were capable

of self renewal through asymmetric division. Colony formation assays of HSC demonstrated

that approximately 20% of progenitors divide asymmetrically (Suda et al., 1984a; Suda et al.,

1984b). In a population of CD34+ HSC, one daughter remained quiescent or divided very









slowly while the other multiplied quickly and yielded committed progenitors (Huang et al.,

1999). Slow dividing fractions of HSC are associated with primitive function and self renewal

while the fast dividing fraction proceeds to differentiation (Huang et al., 1999; Cheng et al.,

2000; Punzel et al., 2002). Using time lapse microscopy, Wu et al showed that hematopoietic

precursor cells are capable of symmetric commitment, symmetric self renewal, and asymmetric

division (Wu et al., 2007c). Additionally, overexpression of Numb in these cells resulted in fewer

lineage negative cells. In addition, HSC self renewal is mediated at least in part by the stem cell

niche. Long term repopulating cells (LTRC; CD34+CD38-) are located in the HSC niche (the

endosteal region associated with bone lining osteoblasts or endothelial cells) in a quiescent state

(Yahata et al., 2008). Approx 75% of the most primitive long term repopulating hematopoietic

stem cells are resting in GO (Cheshier et al., 1999). Following isolation, these cells were capable

of successful engraftment and reconstitution of hematopoiesis (Yahata et al., 2008). Clonally

distinct LTRC controlled hematopoietic homeostasis and created a stem cell pool hierarchy by

asymmetric self renewing division that produced both lineage restricted, short term repopulating

cells and LTRCs (Yahata et al., 2008). Quiescent LTRC clones can expand to reconstitute the

hematopoiesis of the secondary recipient (Yahata et al., 2008).

More restricted adult stem cells are also capable of self renewal. Muscle satellite cells that

are Pax7+/Myf5- can give rise to Myf5+ cells when dividing in the basal/apical orientation

(Kuang et al., 2007). Myf5 expressing cells lay next to fiber in a position to differentiate and fuse

while null cells remain next to basal lamina in a position to remain as a precursor cell.

Committed cells expressed Delta], while the more naive progenitor cells did not. Conversely,

Notch3 was highly expressed in the progenitor but not committed cells. Notch 1, 2 and Numb

levels were equal in both populations. Using videomicroscopy, Shinin et al examined the









segregation of Numb-GFP in dividing satellite cells (Shinin et al., 2006). Both symmetric and

asymmetric segregation was observed; approximately 34% of primary myogenic cells in culture

displayed asymmetric Numb localization following division. Numb segregated to the mother

cell. Slow dividing, label retaining satellite cells contain the template DNA strand during

division and maintain Pax7 expression. In cells in which both the DNA and Numb were

segregated asymmetrically, 90% retained the Numb and template DNA in the same (mother)

cell. Furthermore, these cells expressed Pax7 and did not differentiate.

Stem Cell Plasticity

As mentioned above, different populations of stem cells have different levels of plasticity.

Totipotent cells are those capable of recapitulating the entire organism including the

extraembryonic materials. Pluripotent cells, such as ES cells, contribute to the three germ layers.

Cells with limited abilities that can only differentiate into a few cell types (generally of the same

germ layer) are termed multipotent. Pluripotency of ES cells has only been shown conclusively

in the mouse, where ES cells completely integrated into a developing embryo and produced a

highly chimeric fetus (Evans and Kaufman, 1981). The mechanisms that regulate plasticity must

be pliable enough to allow differentiation under appropriate stimuli but rigorous enough to

override the developmental program when needed.

Transcriptional Regulation of Plasticity

In ES cells, there are several well characterized pathways of transcriptional regulation of

pluripotency. Leukemia inhibitory factor (LIF) is essential for the maintenance of mES cells in

vitro. LIF binds to the LIF receptor-gpl30 heterodimer to activate STAT3 signaling in mES

cells (Niwa et al., 1998). Inhibition of STAT3 phosphorylation results in loss of DNA-binding

ability and morphological changes to ES cells resembling differentiation (Boeuf et al., 1997). In

contrast, activation of STAT3 is sufficient to maintain mES cells in an undifferentiated state in









the absence of LIF (Matsuda et al., 1999). These cells were capable of forming chimeric mice

when injected into blastocysts. However, LIF is not required for embryonic development null

embryos develop to a stage beyond that of ES cell isolation. It is important to remember that the

presence of the pluripotent ICM in the developing embryo is a transient state, thus the lack of

requirement of LIF is not surprising. A notable difference between hES and mES cells is the

lack of requirement for LIF signaling in hES cells. When maintained on a feeder layer in the

presence of serum, human ES cells do not require LIF signaling to prevent differentiation. Bone

morphogenic protein 4 (BMP4) is an anti-neurogenesis factor that has been shown to contribute

to LIF cascade, enhancing self renewal and pluripotency by activating SMADs which, in turn,

promote transcription of the Id gene family (inhibitors of differentiation, (Ying et al., 2003)). In

the absence of LIF, BMP4 promotes differentiation. Like LIF, this factor is not required for the

initial "creation" of the ES cell population null embryos develop past the stage of ES cell

derivation. However, ES cells can be derived in the absence of serum with media supplemented

with LIF and BMP4 (Ying et al., 2003). Wnt activation helps maintain the undifferentiated

phenotype in mouse and human ES cells by sustaining the expression of Oct4, Rex], and nanog

(Sato et al., 2004).

Oct4.

Oct4 is a Pou domain transcription factor expressed by all pluripotent cells during mouse

embryogenesis as well as undifferentiated mouse ES cells and embryonic carcinoma cell lines

(Scholer etal., 1989a; Scholer et al., 1989b; Okamoto etal., 1990; Rosner etal., 1990).

Upregulated during the 4 cell stage of embryo development, Oct4 later becomes restricted to

pluripotent stem cells. Expression of Oct4 is downregulated with differentiation (Brandenberger

et al., 2004). In addition, embryos lacking Oct4 expression develop to a stage resembling a

blastocyst and have a mass of cells designated to the location of the ICM, but do not contain









pluripotent cells, only trophectodermal cells which cannot be used to produce ES cells (Nichols

et al., 1998). Decreased expression of Oct4 by siRNA resulted in the downregulation of

pluripotency related genes such as nanog and Sox2, markers of undifferentiated stem cells such

as Lefty], Lefty2, and Thyl, and chromatin modifying factors such as DNMT3B (Babaie et al.,

2007). Relative amounts of Oct4 protein effects cell fate; overexpression of Oct4 results in

differentiation into primitive endoderm and mesoderm, while loss of the protein results in

spontaneous differentiation into trophectodermal cells (Yeom et al., 1996; Niwa et al., 2000;

Niwa, 2001). Thus, Pou5fl must be strictly regulated to maintain ES cell fate. The Oct4

pathway appears to be independent from LIF/STAT3 signaling, as disruptions to either pathway

have no direct effect on the other. However, the two transcription factors may cooperate to

regulate target genes, as many target genes contain both Oct and STAT binding sites (Tanaka et

al., 2002; Ginis et al., 2004).

Sox2.

Sox2 is a high mobility group (HMG) domain DNA binding protein that regulates

transcription and chromatin architecture (Pevny and Lovell-Badge, 1997). Sox2 forms a ternary

complex with Oct4 on the FGF4 enhancer as well as other genes involved in maintaining ES cell

pluripotency (Yuan et al., 1995; Boyer et al., 2005). Expression of Sox2 in the developing

embryo is similar to that of Oct4 (Avilion et al., 2003). Null embryos are incapable of giving

rise to pluripotent cells from the ICM, instead producing trophectoderm-like cells (Avilion et al.,

2003; Masui et al., 2007). Microarray screening indicates that Sox2 null cells express greater

levels of genes that negatively regulate Oct4 and downregulate factors that positively regulate

Oct4. Introduction of exogenous Oct4 into Sox2 null cells restored their proliferation and

pluripotency, indicating that Sox2 may upregulate the positive regulators of Oct4 while

downregulating factors that negatively affect Oct4 transcription (Masui et al., 2007). In human









ES cells, treatment with Sox2 siRNA significantly reduced Sox2, Oct4 and nanog expression

levels (Fong et al., 2008). Decreased Sox2 expression also resulted in significantly reduced

populations of SSEA3, SSEA4, Tral-60 and Tral-81 expressing cells. Expression levels of

chromatin remodeling factors and transcription factors known to regulate pluripotency were also

downregulated in Sox2 knockdown cells.

Nanog

The homeobox domain containing transcription factor Nanog is expressed by

undifferentiated ES cells, however it is not capable of preventing differentiation after the

withdrawal of LIF (Chambers et al., 2003; Mitsui et al., 2003). Additionally, Oct4 is required for

Nanog mediated self renewal in ES cells (Chambers et al., 2003). Null embryos lack a primitive

ectoderm and consist almost entirely of disorganized extraembryonic tissues (Mitsui et al., 2003;

Hyslop et al., 2005). ES cells lacking nanog differentiate slowly into extra-embryonic lineages

(Mitsui et al., 2003). Nanog transcriptionally represses genes involved in differentiation.

Overexpression of nanog in ES cells allows the cells to remain pluripotent in the absence of LIF,

although the ability to self renew is reduced (Chambers et al., 2003; Mitsui et al., 2003). This

ability is abrogated if nanog is mutated to be dimerization incompetent (Wang et al., 2008). In

cooperation with Sall4, a spalt-like zinc finger protein, nanog occupies target genes important for

pluripotency, including Pou5fl, Sox2, and nanog (Wu et al., 2006; Zhang et al., 2006).

Transcription of Nanog itself is suppressed by p53 binding of the nanog promoter (Lin et al.,

2005). Oct4, Sox2 and Nanog map to promoters of a large population of genes that are both

active in defining ES cell identity (the undifferentiated phenotype) and repressing

developmental/differentiation genes. These factors also participate in autoregulatory and feed-

forward loops (Boyer et al., 2005; Loh et al., 2006). Nanog contains a 15 base pair Oct-Sox

composite element in the proximal promoter (Rodda et al., 2005). Sox2 and Oct4 bind this









module both in vitro and in viable mouse and human ES cells. Expression of constitutively active

nanog maintains mES cells in the undifferentiated state in the absence of LIF (Mitsui et al.,

2003).

Recent work has suggested that Oct4, nanog and Sox2 cooperate in regulating self renewal

and plasticity. Numerous target genes have been identified to be bound by the three factors.

Target genes of Oct4 have a Sox binding element 0 or 3 base pairs from the octamer binding

element (Rodda et al., 2005). Significantly, a complex containing both Oct4 and Sox2 regulates

the expression of nanog (Kuroda et al., 2005; Rodda et al., 2005). Oct4 and Sox2 recognize and

bind elements in the regulatory regions of their own genes (Chew et al., 2005). Large numbers

of target genes of Oct4 are also bound by nanog in ES cells, suggesting that these pathways work

in cooperation rather than independently of one another (Boyer et al., 2005; Loh et al., 2006).

The gene targets identified represent a variety of products required for pluripotency but also

those required for differentiation, suggesting that these transcription factors not only promote the

maintenance of the naive state but also block the progression of differentiation. Klf4 binds the

regulatory regions of Pou5fl and nanog and is also found in many complexes of these proteins at

transcriptional regulatory sites on other genes. Nanog and Oct4 may interact directly with each

other and chromatin remodeling proteins (Liang et al., 2008). A transient reduction in Pou5fl

and nanog induced differentiation in mES cells (Hough et al., 2006).

Epigenetic Regulation of Plasticity

Another mechanism by which plasticity is maintained is the epigenetic regulation of

chromatin structure. Epigenetic marks (including methylated DNA and possibly modified

histones) are propagated at S phase, thus epigenetic information can be transmitted through

sequential rounds of cell division (Jaenisch and Bird, 2003; Henikoff et al., 2004). Chromatin is

subjected to various forms of epigenetic regulation that modulate the transcriptional activity of









specific genomic regions including chromatin remodeling, histone modifications, histone

variants, and DNA methylation. For example, trimethylation oflysine 9 and lysine 27 on histone

3 (H3K9 and H2K27, respectively) correlate with inactive regions of chromatin. However,

trimethylation of H3K4 and acetylation of histones three and four are associated with active

areas of transcription (Jenuwein and Allis, 2001). Generally, methylation is considered a

repressive mark (Santos and Dean, 2004). Polycomb group proteins (PcG) also silence

developmental regulators, aiding in the maintenance of a plastic state (Boyer et al., 2006; Lee et

al., 2006). PcG proteins form two repressor complexes, PRC1 and PRC2. PRC2 inhibits

initiation of transcription, while PRC1 maintains the repressed state (Boyer et al., 2006). Genes

that are co-occupied by PRC 1 and PRC2 also exhibit H3K27 trimethylation which is catalyzed

by PcG proteins (Cao et al., 2002; Ringrose et al., 2004). Recently, a configuration of epigenetic

modification has been described on target genes poised for transcription but not yet active.

These bivalent histones contain both repressive and active histone markers, with large regions of

H3K27 trimethylation interrupted by a smaller region of H3K4 trimethylation. This

configuration is frequently associated with developmentally regulated factors that may be

expressed at low levels in stem cells. Upon differentiation, most bivalent domains become H3K4

or H3K27 methylated (Azuara et al., 2006; Bernstein et al., 2006).

BAF, a member of the SWI/SNF family of ATP dependent chromatin remodeling

complexes, is expressed abundantly in ES cells. BAF250a is a member of the BAF complex

which can target and antagonize PcG proteins. Absence of BAF250a results in embryos that fail

to undergo gastrulation and proper germ layer development (Gao et al., 2008). Null ES cells

differentiate into cells with endoderm-like morphology. These cells express a marked reduction









in Oct4 and Sox2. Loss of BAF250a resulted in the inability to specify some lineage-specific

differentiation.

Overall, the stem cell must maintain a highly dynamic and transcriptionally permissive

state to be poised to respond to appropriate stimuli. These cells exhibit fewer heterochromatin

foci that are more diffuse than in differentiated cells. Using fluorescent recovery after

photobleaching, Meshorer et al demonstrated the presence of an increased fraction of loosely

bound or soluble architectural chromatin proteins (Meshorer et al., 2006). With this method,

higher recovery rates reflect loose binding of these proteins to chromatin, rendering it more

accessible to transcription factors and chromatin modifiers. Overall, the chromatin of stem cells

exists in a more permissive transcriptional state than that of differentiated cells.

Role of Fibroblast Growth Factors in Stem Cell Maintenance and Differentiation

The fibroblast growth factors (FGF) were first discovered as a family of growth factors

that promoted proliferation. There are now over twenty FGFs identified in the human with

different temporal and spatial expression patterns. FGFs function in proliferation, differentiation

and migration during development and adult life. Most FGFs share a conserved internal region

of residues responsible for receptor binding (Baird et al., 1988; Plotnikov et al., 1999). Two of

the twelve B-strands in the core region of the protein are thought to contain the heparin binding

domain which is separate from the domain which binds the receptor. Most FGFs have amino-

terminal signal peptides and are readily secreted. However, FGF1 and FGF2 lack this sequence

and may be released via exocytosis (Mignatti et al., 1992). Extracellular FGFs bind four high

affinity transmembrane receptor tyrosine kinases which propagate signal transduction

intracellularly. Stable interaction between the FGF and FGF receptor (FGFR) requires the

presence of heparin sulfate proteoglycans which protect the complex from proteolysis and

thermal degradation. Heparin sulfate may also limit the amount of FGF diffusion into the









interstitial spaces. FGFs bind FGFR in a 2:2:2 fashion where each fully active complex consists

of two each ofFGF, FGFR, and heparin sulfate. FGF receptors contain two or three

immunoglobulin-like domains, a short, conserved area of acidic residues which contains separate

ligand and heparin binding domains, a transmembrane region and two intracellular tyrosine

kinase domains. To achieve downstream signaling, binding of the ligand to the FGFR and

heparin sulfate must occur. The resulting tyrosine phosphorylation of FRS2, a docking protein,

allows the recruitment of Grb2 molecules which, in turn, recruit the nucleotide exchange factor

SOS. The formation of the FRS2-Grb2-SOS complex activates the Ras-Raf-MAPK pathway,

resulting in changes in gene transcription. Phosphorylation of the FGFRs can also activate the

PLCy-PKC pathway. Alternatively, Grb2 can recruit Gab1 to activate PI3K/Akt signaling. This

diversity allows a single set of receptors to influence a wide variety of cellular events.

Receptor diversity is controlled by alternative splicing and results in differential ligand

binding characteristics as well as varying temporal and spatial expression patterns (Lee et al.,

1989; Johnson et al., 1990). Alternative splicing specifies the sequence of the immunoglobulin

domain III determining the receptor isoform (i.e. IIIb, IIIc). Splicing occurs in a tissue specific

manner and dramatically affects ligand specificity (Miki et al., 1992; Orr-Urtreger et al., 1993;

Scotet and Houssaint, 1995).

Identified as potent mitogens, FGFs play a major role in stem cell biology that ranges from

self-renewal to differentiation to cell attachment and migration. Importantly, FGF2 is required

by human ES cells to sustain self-renewal and plasticity (Amit et al., 2000; Xu et al., 2001).

Inhibition of FGFRs in hES cells suppressed activation of downstream signaling, led to the

downregulation of Oct4 and stimulated rapid differentiation (Dvorak et al., 2005).

Supplementation of FGF2 at levels greater than 5 ng/ml decreased the outgrowth of hES colonies









while not affecting proliferation suggesting a role in cell attachment and spreading. Exogenous

FGF2 enhances growth of bone marrow mesenchymal stem cells (Solchaga et al., 2005). It

prolongs the life span of bone marrow stromal cells by stimulating telomere elongation (Bianchi

et al., 2003). Murine bone marrow derived Scal-positive stem cells proliferated in response to

FGF4 and FGF2 under low serum conditions and exhibited a simultaneous phosphorylation of

ERK1/2 and Akt. Changes in proliferation were abrogated by the inclusion of MEK and PI3K

inhibitors. The up-regulation of the immediate early gene c-jun was also apparent following

ERK1/2 activity (Choi et al., 2008).

FGF4 is secreted from undifferentiated hES cells and promoted self-renewal. Not only did

expression of FGF4 decline with differentiation, but knockdown of the growth factor with

siRNA resulted in differentiation, indicating a role for FGF4 in the maintenance of the

undifferentiated state in human ES cells (Mayshar et al., 2008). Accordingly, Sox2 and Oct4 can

transactivate the FGF4 enhancer in F9 embryonal carcinoma cells suggesting a circular feedback

mechanism (Yuan et al., 1995). Alternatively, Fgf4-/- mES cells do not undergo differentiation

upon removal of LIF, but will differentiate along the neural lineage if further supplemented with

exogenous FGF4. Cells null for FGF4 exhibit a reduced ability to enter neuronal and

mesodermal lineages which does not stem from a lack of proliferation or death of precursor cells.

Null cells do not select alternative commitment programs, rather they remain in an

undifferentiated state (Kunath et al., 2007).

Embryonic Stem Cells

Characteristics

Embryonic stem cells were first derived from the inner cell mass of a mouse blastocyst in

1981 (Evans and Kaufman, 1981). Established human lines followed in the late 1990's

(Thomson et al., 1998). The immortal cells derived from the inner cell mass are an in vitro









phenomenon, existing only transiently in vivo. Much work has been done to characterize these

cells in hopes of obtaining a population of stem cells useful for regeneration and repair of human

tissue. The chromatin of ES cells exists in an open state, allowing transcription of genes for

maintenance and eventual differentiation. Epigenetic modifications of chromatin structure or

DNA methylation may lead to more restricted lineage-specific gene transcription (Arney and

Fisher, 2004). High levels oftelomerase activity are associated with ES cells and their ability to

be cultured indefinitely (Zeng and Rao, 2007). While murine and human ES cells exhibit similar

morphologies, there are several distinct characteristics of each species. Embryonic stem cells

derived from the mouse can be cultured in feeder-free culture systems in the presence of

leukemia inhibitory factor (LIF). Conversely, human ES cells do not require LIF and can be

cultured off of feeder layers if supplemented with fibroblast growth factor 2 (Xu et al., 2005).

Cells from both species grow in tightly packed colonies and appear to be inherently

heterogeneous, as a portion of the outer layer of cells will differentiate. Whether this is truly a

heterogeneous population or an artifact of inefficient culture is unknown at this point in time.

The deletion of both copies of lifin mES did not completely abolish the ability of these cells to

self renew. Instead, these cells produced a soluble factor that allowed the propagation of a small

number of colonies despite the presence of a differentiation permissive environment. This

factor, termed ES cell renewal factor (ESRF), works independently of the STAT3 signaling

pathway and can sustain the undifferentiated phenotype of ES cells in vitro (Dani et al., 1998).

In culture, ES cells possess a very short cell cycle (11-16 hr) mainly due to a reduction in G1

phase. Early G1 is omitted by the constitutive presence of cyclin E CDK2 activity (Savatier et

al., 1994; White et al., 2005). LIF withdrawal from the culture media brings cyclin E expression

under control of pocket proteins, requiring cyclin D complexes and the obtainment of the early









phase of G1 (White et al., 2005). By eliminating the requirement for cyclin D expression

(MAPK induced), ES cells uncouple cell cycle traverse from differentiation, allowing for self

renewal.

ES cells isolated from cynomolgus monkey require a feeder layer to maintain pluripotency

and cannot rely on LIF supplementation as do murine ES cells. LIF treatment induces

phosphorylation of tyrosine 705 but does not affect the phosphorylation status of serine 727 of

STAT3 (Sumi et al., 2004). Serine phosphorylation of STAT3 is required for full transcriptional

activity (Wen et al., 1995).

Interestingly, down-regulation of connexin 43, a protein responsible for formation of gap

junctions, results in the rapid differentiation of mES cells (Todorova et al., 2008). This included

loss of Oct4 expression, morphological changes, and up regulation of differentiation markers

such as glial fibrillar associate protein (GFAP). Formation of embroid bodies was hindered by

treatment with gap junction intercellular communication (GJIC) blockers. Recovery of GJIC

allowed the restoration of the differentiation program.

Research with ES cells is not limited to humans and mice. ES cells were successfully

isolated from the ICM of bovine embryos (created by IVF or nuclear transfer) and cultured on

mitomycin-c treated MEFs (Wang et al., 2005b). They assumed the typical morphology of ES

cells: multicellular colonies with a smooth surface and distinct colony boundary. Bovine ES

cells react positively with SSEA4 and Oct4 but not SSEA1 antibodies. No Tral expression was

found. In the absence of a feeder layer and LIF, bES cells spontaneously differentiated into EBs

and gave rise to cells from three germ layers. Ectodermal cells expressed the neurofilament

marker TUBB3, mesodermal cells expressed smooth muscle ACTA2, and cuboidal and net-like

epithelial structures expressed creatine kinase.









Likewise, equine embryos have also yielded ES-like cells. Several groups have isolated

ES-like cells from frozen and freshly collected equine blastocysts (Saito et al., 2002; Li et al.,

2006; Guest and Allen, 2007). Equine ES-like cells exhibit morphology similar to mES cells

with underrun cell borders, a small cytoplasmic to nuclear ratio, and prominent nucleoli (Li et

al., 2006). These cells express Oct4, alkaline phosphatase, SSEA1, SSEA4, Tral-60 and Tral-81

(Saito et al., 2002; Li et al., 2006; Guest and Allen, 2007). No SSEA3 was apparent in ES-like

cells, although it was detected in equine blastocysts (Guest and Allen, 2007). Equine ES-like

cells were capable of differentiation into all three germ layers in vitro but did not form teratomas

when injected subcutaneously into SCID/beige immunoincompetent mice (Li et al., 2006).

Despite the similarities in marker expression, reports of the culture conditions required differ

among reports. In the absence of LIF, eES-like cells lost expression of all markers of

pluripotency and exhibited morphological properties identical to differentiated cells (Li et al.,

2006; Guest and Allen, 2007). However, other reports indicate that a feeder layer, but not LIF, is

necessary for the maintenance of eES-like cells (Saito et al., 2002). The difference between the

reports is unclear but may result from differences in isolation protocols or source of the equine

embryos.

Embryos from rats and dogs have also yielded ES-like cells. Rat ES-like cells cultured on

a feeder layer in the presence of LIF express Oct4, SSEA1, and alkaline phosphatase (Vassilieva

et al., 2000). Canine ES-like cells were isolated from inner cell masses collected from

blastocysts (Hatoya et al., 2006). Unlike mouse and human ES cells, this population is limited in

life span, entering replicative senescence after nine passages. Domed colonies with tightly

packed cells and an apparent border were present during early passages when cultured on a

feeder layer. Cells expressed alkaline phosphatase, SSEA1, and Oct4, but no SSEA4.









Aggregation into EBs produced cells with morphologies that represented cells from all three

germ layers.

In an effort to avoid the ethical controversies surrounding embryonic stem cells and to

make pluripotent stem cells that matched the unique identity of each individual, Takahashi and

Yamanaka sought to find a set of factors that would induce a pluripotent state in a somatic cell

(Takahashi and Yamanaka, 2006). They identified four factors which, when transduced into

mouse embryonic fibroblasts, elicited a naive state with ES cell morphology and the ability to

produce teratomas in nude mice that contained cell types from all three germ layers. Oct4, Sox2,

Klf4, and c-Myc induced the expression ofnanog and other pluripotency factors. The induced

pluripotent stem cells (iPS) showed increased acetylation of histone H3 of the Pou5fl and nanog

promoters as well as decreased methylation of lysine 9 of histone H3, indicating a permissive

state for Pou5fl and nanog transcription. However, the CpG dinucleotides remained partially

methylated. Additionally, iPS cells exhibited higher telomerase activity at levels similar to ES

cells. Human embryonic fibroblasts respond similarly to induction with Oct4, Sox2, Klf4 and c-

Myc, expressing ES cell markers at both the protein and mRNA level (Park et al., 2008).

However, recovery of iPS from postnatal human cells was successful only when hTERT and

SV40 large T were included in the retroviral cocktail. The authors speculate that these factors

are required to act on supportive cells in the culture to enhance the efficiency with which the

reprogrammed colonies can be selected (Park et al., 2008). Further work has indicated that only

two factors, Oct4 and Sox2 may be necessary for induction of iPS cells from human fibroblasts

when coupled with valproic acid (Huangfu et al., 2008). These cells are morphologically similar

to hES cells and express nanog, Oct4, Sox2, SSEA4, Tral-60 and Tral-81. iPS cells have been

postulated to be functionally equivalent to mouse ES cells in that they express the same markers,









possess similar gene expression profiles, form teratomas, and contribute to cells of chimeric

animals, including the germ line (Takahashi and Yamanaka, 2006; Maherali et al., 2007; Okita et

al., 2007; Wemig et al., 2007).

Differentiation

Differentiation of ES cells can be obtained by removing LIF from the culture media and

allowing the formation of embroid bodies (EBs). These masses of cells will differentiate and,

upon dispersal onto a culture plate, produce cells of the three germ layers. Differentiating EBs

mimic the genetic changes of early development the downregulation of pluripotency and self

renewal genes coupled with the upregulation of genes responsible for the development of the

three germ layers making this system useful for studying the mechanisms of early development

(Gerecht-Nir et al., 2005).

Directed differentiation of ES cells is much more difficult than the spontaneous

differentiation found in EBs. Zheng et al were successful in creating a pre-myoblast line from

hES cells but the differentiated cells did not fully differentiate in vitro (Zheng et al., 2006).

However, placing these preconditioned cells into an injured muscle resulted in moderate

incorporation into host fibers (approximately 7%). Irradiation following cardiotoxin treatment

resulted in a higher degree of incorporation (approximately 29%).

Transducing CGR8 ES cells with Ptfla and Mistl prior to differentiation resulted in

increased pancreatic differentiation (Rovira et al., 2008). Acinar genes including CPA and Elal

were upregulated in a manner similar to early exocrine cells. Pancreatic signaling mediators and

gap junction protein mRNAs were expressed in transduced cells. Additionally, differentiated

cells contained zymogen granule-like vesicles filled with Amyl which was released in response

to carbachol, indicating functional properties similar to exocrine cells. Phillips et al cultured hES

cells in a three dimensional environment followed by stimulation by a series of growth factors to









induce pancreatic differentiation (Phillips et al., 2007). Embroid bodies were cultured with

activin A and BMP4 to induce endodermal cell types. Pancreatic progenitor cells were formed

following supplementation with HGF, exendin-4, and P-cellulin. These cells expressed Pdx-1 as

well as the early pancreatic epithelial marker Ptfla and endocrine progenitor marker Ngn3.

Following further differentiation, cells expressed insulin and released c-peptide when stimulated

with forskolin and glucose. When transplanted into the intraperitoneal cavity of SCID mice,

differentiated cells maintain the endocrine identity and show modest glucose responsiveness.

Multiple ES cells lines were tested for their ability to differentiate into mature cartilage

(Kramer et al., 2005). Embroid bodies contained regions deeply stained with Alcian blue

representing cartilage nodules. Nodules consisted of dense groups of rounded cells surrounded

by a rigid membranous structure of extracellular matrix proteins containing type II collagen. In

particular, the BLC6 line of ES cells had markedly high numbers of cartilage nodules (60 fold

that of other lines tested) and a distinct increase in the expression of the adult splice variant B of

type II collagen, a marker of mature chondrocytes.

Osteogenic differentiation was achieved in hES cells when cultured as embroid bodies in

media supplemented with the dexamethasone, ascorbic acid and P-glycerophosphate (Sottile et

al., 2003). Culture in osteogenic induction media generated mineralized cultures that stained

positive for calcium deposits with Alizarin Red and von Kossa. Expression of osteogenic genes

such as osteocalcin, type I collagen, Cbfal, and osteopontin were increased while Pou5fl

expression decreased during differentiation. The x-ray diffraction pattern of mineralized nodules

was characteristic of hydroxyapatite, the primary component of mineralized bone. Osteogenesis

was also achieved without the use of dexamethasone, ascorbic acid or P-glycerophosphate by

transiently suppressing PPARy with small interfering RNA (siRNA) (Yamashita et al., 2006).









PPARy induces adipogenesis and when suppressed increases the proportion of ES cells that

differentiate into osteogenic cells. Osteogenic transcripts Cbfal, type I collagen, and osteocalcin

were increased throughout culture with PPARy siRNA, however osteocalcin and type II collagen

were expressed later in siRNA treated cells than those treated with osteogenic induction medium.

After twenty days of culture, cells induced with PPARy siRNA contained matrix that stained

positively with Alizarin Red and produced an equivalent amount of calcium as cells induced with

osteogenic medium.

Neural inductive signals provided by co-culture of mES cells on the PA6 stromal cell line

generated Soxl/TuJ1 expressing neurons (Wichterle et al., 2002). Retinoic acid was also

capable of generating post mitotic neurons expressing Soxl, NeuN and TuJ1. Combination of

retinoic acid and an agonist of the Sonic hedge hog signaling pathway generated spinal motor

neurons. Similar to the gradient produced during embryogenesis, a small variation in the level of

sonic hedge hog signaling led to the generation of ventral interneurons rather than spinal motor

neurons. Pre-differentiated cells introduced into the embryonic chick spinal cord engrafted and

differentiated into motor neurons in vivo. Post mitotic neurons also survived engraftment.

ES cells are capable of undergoing hematopoiesis when cultured in serum free media and

activated sequentially with a number of growth factors (Pearson et al., 2008). Addition of bone

morphogenic protein 4 (BMP4) promoted efficient formation of mesodermal cells. Subsequent

stimulation with activin A and fibroblast growth factor 2 (FGF2) induced the formation of

hemangioblast precursors. Finally, supplementing the media with VEGF was required for the

progression to a committed hematopoietic precursor. Sequential addition of these factors to mES

cells resulted in a significant increase of CD41 expressing hematopoietic precursor cells.









Umbilical Cord Blood Derived Stem Cells

Identified as a population of cells from blood that are adherent in plastic cultureware,

umbilical cord blood derived stem cells (UCB) are further purified by centrifugation through a

density gradient such as Ficoll. These cells exhibit a fibroblast like appearance and proliferate,

though they are contact inhibited. UCB have been successfully isolated from humans, sheep,

pigs, dogs, and horses and appear to maintain the same basic characteristics across species

(Bieback et al., 2004; Lee et al., 2004b; Fuchs et al., 2005; Zhao et al., 2006; Koch et al., 2007;

Kumar et al., 2007).

While the explicit protein markers of UCB remain elusive, most reports agree that this

population is CD34, CD45 and major histocompatibility complex (MHC) class II negative and

only weakly positive for MHC class I (Lee et al., 2004a). The minor expression of MHC classes

I and II indicate the lack of immunogenicity of this cell type. Additionally, a mixed lymphocyte

reaction indicated that human UCB did not stimulate lymphocyte proliferation, consistent with

low levels of immunogenicity (Zhao et al., 2006). The absence of CD34 and CD45 suggests a

non-hematopoietic lineage. Additionally, cell surface markers commonly found on MSC, CD29,

CD44, CD73, and CD90 (Thy-1) are found in the majority of UCB (Bieback et al., 2004; Lee et

al., 2004b; Fuchs et al., 2005; Zhao et al., 2006; Kumar et al., 2007). The presence of Oct4,

nanog, SSEA3 and SSEA4 by some researchers suggests a naive phenotype for UCB (Baal et al.,

2004).

Collection and Processing

Aspiration of blood via syringe or through a canula into a sterile container containing anti-

coagulant (EDTA, citrate phosphate dextrose, or other citrate based anticoagulant) at the time of

parturition or caesarean section yields the highest number of UCB (Sparrow et al., 2002;

McGuckin et al., 2003; Bieback et al., 2004; Chang et al., 2006; Kern et al., 2006). Processing









is performed as soon as possible after collection, generally within 15 hours (Bieback et al.,

2004). Prolonged time from collection to processing may decrease the number of cells obtained.

Blood is diluted in a buffered saline solution prior to separation of the mononuclear layer by

density gradient centrifugation (Sparrow et al., 2002; McGuckin et al., 2003; Romanov et al.,

2003; Bieback et al., 2004; Gang et al., 2004a; Lee et al., 2004a; Chang et al., 2006; Kern et al.,

2006). The buffy coat, containing the mononuclear cells, is collected and subjected to at least

two further washes in saline solution or medium. Lysing of the red blood cells may be

performed at this time. Cells are then plated in expansion medium which is typically composed

of Dulbecco's modified eagle medium (DMEM), 10-20% fetal bovine serum (FBS), and

penicillin/streptomycin. Some researchers suggest the addition of various growth factors and

supplements (Sparrow et al., 2002; Romanov et al., 2003; Bieback et al., 2004; Gang et al.,

2004a; Lee et al., 2004a; Kang et al., 2005; Wagner et al., 2005; Chang et al., 2006; Kern et al.,

2006). Fibroblast like colonies can be seen two to four weeks after plating (Bieback et al., 2004;

Kern et al., 2006). Upon confluency, UCB can be detached with trypsin-EDTA and subcultured.

In contrast to stem cells derived from bone marrow, most UCB populations show an increased

(but not indefinite) potential for proliferation (Bieback et al., 2004).

Differentiation

In an effort to prove the plasticity of umbilical cord blood derived stem cells in relation to

other stem cell populations, in vitro and in vivo differentiation protocols have been performed.

UCB have been successfully differentiated into cells from all three germ layers. Mesodermal

cell types, such as osteoblasts, chondrocytes, and adipocytes, are most commonly used to

identify a stem cell's ability to differentiate. However, differentiation into cells of the

ectodermal or endodermal layer tends to be more difficult.









Maturation of UCB into bone and cartilage is routinely achieved. Both human and equine

UCB have been differentiated into cells capable of producing calcium deposits stained by von

Kossa and Alizarin Red (Kogler et al., 2004; Koch et al., 2007). Transcription of osteopontin,

osteocalcin, and type I collagen has been reported in these cells (Kogler et al., 2004). Culture of

human UCB in media containing dexamethasone and bone morphogenic protein 2 (BMP2)

resulted in morphological changes from spindle shaped cells to cuboidal cells in twenty days

coupled with increased alkaline phosphatase and type I collagen expression (Hildebrandt et al.,

2009). However, it has been noted by some researchers that UCB which differentiate into

osteoblasts do not take on the cuboidal appearance typical of bone marrow derived osteoblasts

(Goodwin et al., 2001).

Chondrogenesis is commonly achieved by culture in a three-dimensional micromass

environment in the presence of transforming growth factor 0 (TGFP). These masses react

positively with Alcian Blue and Safranin O, indicating the presence of glycosaminoglycans

typical of cartilage (Kogler et al., 2004; Koch et al., 2007). Further analysis of these cells

reveals transcription of cart-], Col2al and chondroadherin (Kogler et al., 2004). Ovine UCB

from blood collected at 80-120 days of gestation formed tissue reminiscent of hyaline cartilage

when placed on a construct of biodegradable polyglycolic acid polymer treated with poly-L-

lactic acid solution and coated with collagen. This was placed in a bioreactor in permissive

medium for 12 weeks. Marked chondrogenic differentiation was apparent, presenting

characteristics of hyaline cartilage and staining positively for Safranin O and Toluidine Blue.

Type II collagen was primarily expressed with little type I collagen present and no type X

collagen (Fuchs et al., 2005). Inclusion of insulin-like growth factor 1 (IGF-1) after the initial









three week culture period with TGFP increased hydroxyproline content in hUCB (Wang and

Detamore, 2009).

UCB treated with insulin and 3-isobutyl-1-methyl-xanthine, a phosphodiesterase inhibitor,

will obtain lipid vacuoles identified by Oil Red O (Goodwin et al., 2001; Kogler et al., 2004;

Koch et al., 2007). It has been noted that UCB present much less obvious adipogenic

differentiation than do bone marrow or adipose derived MSC (Wagner et al., 2005; Rebelatto et

al., 2008). Other researchers have struggled to form adipocytes from UCB. Biebeck et al could

not obtain adipocytes after culture of UCB in induction medium containing dexamethasone,

IBMX, insulin, indomethacin and fetal calf serum (Bieback et al., 2004). No lipid vacuoles were

formed in UCB despite the appearance of lipid vacuoles in BM MSC treated in a parallel culture.

However, continuous culture in induction medium for 5 weeks did result in some adipocytic

differentiation. Kern et al also reported a failure to induce differentiation into adipocytes, even

following 5 weeks of culture (Kern et al., 2006). Lee et al achieved adipocytic differentiation

but only after the addition of rabbit serum to the induction medium (Lee et al., 2004b).

Less frequently, UCB have been shown capable of limited myogenic conversion in vitro.

Human UCB cultured in myogenic medium resulted in an increase in MyoD and myogenin

transcription. These cells also expressed myosin, but no fusion of cells was reported (Gang et al.,

2004b). When co-cultured on murine fetal cardiomyocytes, human UCB began synchronized

beating in culture after seven days (Nishiyama et al., 2007). Immunocytochemistry indicated

expression of human cardiac troponin 1, a-actinin, and connexin 43 on these cells. Transcripts

for GATA4, cardiac actin, cardiac troponin T, cardiac troponin I, and Nkx-2.5 were also

amplified. Cells successfully engrafted into the atria, ventricles and septum when transplanted

into fetal sheep hearts (Kogler et al., 2004). No cell fusion was apparent between host and donor









cells. Myosin heavy chain, dystrophin, and ryanodine receptor were all identified in engrafted

UCB.

Treatment of human UCB with VEGF stimulated the expression of endothelial markers

Fltl, Flkl, von Willebrand Factor, and the transmembrane glycoprotein CD146 as well as a

change in morphology to broad endothelial like cells with spontaneous formation of chain like

structures (Zhao et al., 2006).

Elongated or branched morphologies forming neuronal-like networks were formed

following treatment of human UCB with neural growth factor. These cells expressed the

neuronal markers microtubule-associated protein 1B, synaptophysin, neuronal transmitter

gamma-aminobutyric acid (GABA), and glutamic acid decarboxylase (GAD) (Zhao et al., 2006).

Formation of neural precursors in vitro was achieved in approximately 90% of human UCB as

evidenced by the presence of neurofilament, synaptophysin and GABA protein after 4 weeks of

culture. When these cells were labeled and transplanted into the hippocampus region of adult

rat brain, three months after grafting cells were detected throughout the brain with a neuronal-

like highly differentiated morphology (Kogler et al., 2004). Additionally, Jeong et al report that

human UCB exhibit morphological changes including a narrowing and thickening of the area

around the nucleus while remainder of the cytoplasm elongated to give rise to multiple cellular

processes (Jeong et al., 2004). These cells further progressed to yield network like structures and

express glial fibrillar acidic protein (GFAP), Tuj 1, TrkA and CNPase, markers of mature

neuroglia. Neural differentiation can also be obtained following cryopreservation of UCB.

Under permissive conditions, previously cryopreserved human UCB differentiated into neuronal

cell types and expressed neurofilament, GAD, acetylcholinesterase, and GFAP (Lee et al., 2007).

Neural stem cells derived from hUCB cultured on biodegradable human keratin-associated









protein scaffolds differentiated into more mature phenotypes connected by gap and tight

junctions (Jurga et al., 2009). Cells migrated away from aggregates and formed neural networks

that were capable of generating spontaneous electrical activity, indicating the presence of a

functional action potential.

Hepatogenic differentiation has also been shown in a number of studies. Treatment of

UCB with fibroblast growth factor (FGF) and hepatocyte growth factor (HGF) stimulated the

expression of hepatogenic markers alpha-fetoprotein and cytokeratin 18 (Kang et al., 2005; Tang

et al., 2006). These cells were capable of producing urea, storing glycogen, and LDL

endocytosis, functional measures of liver cells (Hong et al., 2005; Kang et al., 2005; Tang et al.,

2006). Additionally, to determine if these cells were capable of producing insulin in an in vivo

environment, xenograft transplantation was performed by Zhao et al. Human UCB were

transplanted into Balb/c nude mice with induced diabetes. Mice were then evaluated for their

ability to correct hyperglycemia. Mice receiving the UCB transplantation displayed significantly

lower blood glucose levels than the untransplanted controls (Zhao et al., 2006).

Adult Stem Cells

Bone Marrow Derived Mesenchymal Stem Cells

Isolation of bone marrow derived mesenchymal stem cells (or mesenchymal stromal cells;

BMSC) has been occurring in research and medical practice for a number of years. In vivo these

cells support the formation of hematopoietic cells. BMSC derived from humans, mice and

horses attach to culture plates and exhibit a fibroblast like morphology when cultured in vitro.

They represent a very small portion of the total cell population of the bone marrow; reported

numbers vary from 0.001-0.01% (Pittenger et al., 1999). BMSC are positive for cell surface

markers SH2, SH3, CD29, CD44, CD71, CD106, CD120a, and CD124 but negative for CD14,

CD34 and CD45 (Pittenger et al., 1999). Common differentiation protocols can be used to elicit









osteogenic, adipogenic and chondrogenic differentiation of BMSC. Adipogenic differentiation

resulted in the accumulation of lipid rich vacuoles, expression of PPARy2, and lipoprotein lipase

(Pittenger et al., 1999; Meirelles Lda and Nardi, 2003; Tropel et al., 2004; Vidal et al., 2006).

Culture with TGFP in a micromass resulted in initiation of the chondrogenic program and

expression of type II collagen, aggrecan, and the formation of a proteoglycan rich extracellular

matrix (Pittenger et al., 1999; Tropel et al., 2004). Furthermore, culture in osteogenic induction

medium resulted in rapid mineralization and nodule formation as well as runx2, type I collagen,

osteopontin, and osteonectin expression (Pittenger et al., 1999; Meirelles Lda and Nardi, 2003;

Tropel et al., 2004; Vidal et al., 2006). Mouse, rat, and human BMSC differentiated into

hepatocyte like cells in presence of HGF and/or FGF4, expressing markers HNF3B, Gata4,

HNFla, albumin and CK18 by day 21. These cells produced urea and albumin at levels similar to

monolayer cultures of primary rat hepatocytes and were also capable of endocytosing LDL and

storing glycogen (Schwartz et al., 2002). Culture of hBMSC in enhanced DMEM further

supplemented with TGFP resulted in the upregulation of smooth muscle actin and calponin

(Gong et al., 2008). TGFP increased the expression of cardiac markers GATA-4, Nkx2.5,

troponin-T, troponin-I, and connexin43 in murine BMSC (Li et al., 2008). Cells exhibited

morphological but not functional differentiation no spontaneous beating was observed.

Peripheral Blood Derived Progenitor Cells

In addition to cells derived from bone marrow, other sources of blood related stem cells

have been explored. Peripheral blood derived progenitor cells (PBPC) have been isolated from

human, swine, and equine with limited success. Reports range from 35-75% of collections that

give rise to an adherent cell population (Koemer et al., 2006; Giovannini et al., 2008). These

mononuclear cells exhibit fibroblast like morphology and proliferate rapidly (Chan et al., 2006;

Koerner et al., 2006; Porat et al., 2006; Giovannini et al., 2008). PBPC can give rise to a









number of differentiated or pre-cursor cell types. In permissive medium, human PBPC

underwent differentiation into neural precursor cells, evidenced by changes in morphology and

expression of nestin, 33 tubulin, and NeuN, a nuclear protein present in neurons (Porat et al.,

2006). These cells also underwent limited myogenic differentiation in vitro. PBPC cultured

with galectin 1 expressed desmin and subsequently formed multinucleated fibers over the

following week of culture (Chan et al., 2006). In vivo transplantation into an injury model (c-/y-

/RAG2- mouse) resulted in more muscle fibers expressing human spectrin in galectin 1

stimulated PBPCs than control PBPCs (
the rat striatum, where they migrated and maintained neurogenic morphology (Price et al., 2006).

Adipogenic, chondrogenic, and osteogenic conversions are also commonly completed with

PBPCs (Koerner et al., 2006; Price et al., 2006; Giovannini et al., 2008). Stem cells derived

from peripheral blood are easily obtained, but are more limited in plasticity and self-renewal than

other sources of adult stem cells.

Umbilical Cord Vein Derived Stem Cells

An alternative to umbilical cord blood, a population of stem cells has also been isolated

from the human, equine and porcine umbilical cord veins (UCV) (Kim et al., 2004; Kestendjieva

et al., 2008). The umbilicus itself is digested with collagenase; cells isolated from this procedure

form a confluent monolayer with cobblestone or spindle-shaped fibroblast like morphology

(Kestendjieva et al., 2008). These cells express oct4, sox2,and nanog as well as the cell surface

markers CD29, CD73, and CD90. However, they lacked expression of CD45, CD14, CD3,

CD19, CD16, CD34 and HLA-DR. UCV are capable of differentiation into adipogenic,

osteogenic, and endothelial cell types. Lipid droplets and Oil Red O staining were present in

UCV treated with adipogenic induction medium. Adipsin, lipoprotein lipase and PPARy2 mRNA

are also expressed in treated cells (Kim et al., 2004; Kestendjieva et al., 2008). Osteogenic









differentiation is visualized by von Kossa staining of calcium deposits and osteopontin and

Runx2 expression (Kim et al., 2004; Kestendjieva et al., 2008).

Adipose Derived Stem Cells

A population of stem cells can be derived from adipose tissue by obtaining fat from

subcutaneous surgery. The tissue undergoes enzymatic digestion followed by filtration and

centrifugation. Adherence to plastic and subsequent expansion produces a relatively

homogenous population. Morphologically similar to bone marrow and umbilical cord blood

derived stem cells, adipose derived stem cells are spindle shaped. Adipose derived

mesenchymal stem cells (AdMSC) express similar cell surface markers to bone marrow derived

MSC, including CD13, CD44, CD73, CD90, CD105, CD106, CD166, CD29, CD49e, and HLA-

ABC (Gronthos et al., 2001; Katz et al., 2005; Wagner et al., 2005; Yanez et al., 2006). While

HLA-ABC surface markers are expressed on these cells, they lack expression of HLA-DR.

Additionally, AdMSC did not stimulate lymphocyte proliferation (Yanez et al., 2006). In fact,

AdMSC inhibited the proliferation of T cells stimulated with peripheral blood mononuclear cells.

When co-cultured in a transwell, soluble factors secreted by AdMSC exerted immunosuppressive

effects on responder T cells but only when AdMSC could interact with responder lymphocytes.

Furthermore, AdMSC infusion decreased the severity of graft v. host disease in mice when used

in the first two weeks.

Adipose derived stem cells have been induced to differentiate into osteogenic,

chondrogenic, adipogenic, cardiomyogenic and neurogenic cell types (Gronthos et al., 2001;

Katz et al., 2005; Wagner et al., 2005; Guilak et al., 2006; Oedayraj singh-Varma et al., 2006;

Liu et al., 2007; Yoshimura et al., 2007; Zhu et al., 2008; Mehlhom et al., 2009). Cells induced

to osteogenic differentiation express RunX2 and Collal after 7 days of culture, with

mineralization after 3 weeks (Oedayrajsingh-Varma et al., 2006). Comparison of AdMSC and









BMSC indicates that AdMSC are less efficient at osteogenic differentiation, despite considerable

similarity in gene expression throughout the differentiation process (Liu et al., 2007).

Adipogenic differentiation was observed following treatment with insulin and IBMX (Gronthos

et al., 2001; Katz et al., 2005; Guilak et al., 2006; Liu et al., 2007). Cells formed lipid vacuoles

and secreted leptin. Culture in chondrogenic differentiation media containing TGFP led to the

expression of proteoglycans and type II collagen (Guilak et al., 2006; Liu et al., 2007;

Yoshimura et al., 2007). Culture on a poly-lactide-co-glycolide scaffold in the presence of TGFP

resulted in the expression of Col2a] and a homogenous distribution of proteoglycans (Mehlhom

et al., 2009). However, the AdMSC are again less efficient at chondrogenesis producing less

Col2al, chondroitin sulfate, and hyaluronan (Yoshimura et al., 2007). Neural differentiation has

also been reported by several labs (Katz et al., 2005; Guilak et al., 2006). In instructive media,

AdMSC gain elongated cytoplasmic processes and express NeuN, GFAP, and p3-tubulin.

Injection of murine AdMSC into ischemia induced angiogenesis resulted in a greater degree of

perfusion in the implanted limbs (Kondo et al., 2009). Injection of mature adipocytes resulted in

weaker recovery of perfusion than saline injected controls. Additionally, AdMSC recruited

endothelial precursor cells and stimulated the secretion of SDF 1 and VEGF in ischemic hind

limbs. Human AdMSC co-cultured with neonatal rat cardiomyocytes resulted in elongation of

AdMSC and formation of myotube-like structures (Zhu et al., 2008). After two weeks of co-

culture, AdMSC stained positively for myosin heavy chain, troponin-I and connexin 43. At this

time, the AdMSC and cardiomyocytes contracted synchronously. Rarely, binucleate AdMSC

were found in co-cultures.

Therapeutic Uses of Stem Cells

Stem cells have been widely accepted as a potential therapeutic aid in disease and injury

states in both humans and animals. Diseases ranging from metabolic inefficiencies to









musculoskeletal defects and neurological disorders could benefit from the use of a naive cell type

which promotes repair or production of healthy tissue. The potential of stem cells lies in not only

their ability to contribute healthy, differentiated cells to the "unhealthy" region, but in the

production of beneficial growth promoting factors and recruitment of additional reparative cells.

The precise effects of stem cells in each disease state remain to be determined as do the

mechanisms by which they may help.

Spinal Cord Injuries

A number of stem cell populations have been used to treat spinal cord injuries in hope of

improving neural regeneration and recovery of locomotion. Embryonic stem cells differentiated

into neural precursors were transplanted into a spinal cord injury (SCI) model in the rat

(McDonald et al., 1999). Transplanted cells were found at the injury site and at distances up to 8

mm from the injury. Engrafted ES cells expressed markers of oligodendrocytes, neurons, and

astrocytes with no evidence of tumor formation. Rats receiving UCB transplants demonstrated

partial hind limb weight bearing and improved coordination compared to a complete lack thereof

in sham operated rats. Engraftment of fetal neural stem cells into immunodeficient mice after a

traumatic spinal cord injury showed locomotory recovery (Cummings et al., 2005). Cells had

migrated extensively from the injection site at 17 weeks post injury. Transplantation resulted in a

higher degree of locomotor recovery with greater coordinated forelimb-hind limb function after

16 weeks. Ablation of the stem cells after transplantation by diphtheria toxin resulted in similar

coordination to animals with no stem cell transplantation, indicating that the improvement is due

to the presence of these cells. Engrafted cells differentiated into neurons and oligodendrocytes.

Transplantation of neurospheres into a contusion model of SCI by Ogawa et al resulted in

engrafted cells differentiating into neurons, oligodendrocytes, and astrocytes (Ogawa et al.,









2002). Cells underwent mitotic neurogenesis. Additionally, some donor axons were myelinated

and formed pre-synaptic structures.

Infusion of UCB into a rat model of stroke ameliorated many of the physical and

behavioral deficits associated with the injury (Chen et al., 2001). hUCB engrafted into the brain

of rats that suffered a stroke with the majority of cells localized to the boundary of the ischemic

region. Engrafted cells were reactive with neuronal and astrocyte markers. Treatment within 24

hours of injury significantly improved functional recovery measured by the motor rotarod test

and neurological severity scores (NSS), however later treatment resulted only in improved NSS.

Transplantation of hUCB into either the femoral artery or the brain of induced stroke rats

resulted in higher levels of spontaneous activity compared to non-transplanted controls (Willing

et al., 2003). The recovery of motor asymmetry was shown to be dose dependent in animals

treated with varying numbers of UCB (Vendrame et al., 2004). Transplantation also decreased

the area of infarction, ischemic volume, and inflammatory cytokines TNF-a and IL-6 compared

to non-transplanted rats in a stroke model (Vendrame et al., 2004; Vendrame et al., 2005;

Vendrame et al., 2006). When hUCB were injected into rats via the saphenous vein 24 hours

after transient middle cerebral artery occlusion, an improvement in neurological severity scores

was apparent in transplanted rats by day 14 (Xiao et al., 2005). Transplanted rats showed

improvement in the stepping test measuring asymmetric movement. Smaller lesion sizes were

measured in transplanted animals, although very few cells engrafted into the brain. However,

implants of hUCB into the cortex resulted in neuronal outgrowth from the contralateral side and

improvement in NSS scores.

Vertebrae

In addition to examining the effect of stem cells on neurogenesis, stem cells have also been

used to aid the repair of the vertebrae surrounding the spinal cord which is also likely to be









injured in traumatic spinal cord injuries. Using a porous scaffold of PTCP, autologous bone

marrow derived MSC and autografts from the iliac crest fused the L4 and L5 vertebrae similarly

in the Cynomolgus monkey (Orii et al., 2005). However, bone formation assessed by micro

computed tomography showed greater new bone formation at 12 weeks in BMSC engrafted

vertebrae than those receiving autografts. Likewise, in an ovine model of vertebrae injury,

higher fusion was apparent in implants of BMSC on a PTCP scaffold than autografts (Gupta et

al., 2007). Newly formed woven and lamellar bone trabeculae in a cancellous organization with

evidence of remodeling was observed in BMSC/PTCP grafts. Formation of hematopoietic and

fatty marrow tissue was also apparent. Using a canine cancellous bone matrix transplanted with

BMSC, superior fusion volume and fusion area for mineralized and demineralized matrix was

observed over graft alone (Muschler et al., 2003). In a clinical trial, bone grafts saturated with

uncultured autologous BMSC were implanted into acute thoracolumbar fractures (Faundez et al.,

2006). The resorbable matrix was replaced with new bone containing several active foci of

membranous and/or endochondral ossification.

Cardiovascular Repair

In rabbits with surgical myocardial infarctions, hBMSC were injected into the border area

of myocardial ischemia (Wang et al., 2005a). Lower mortality was reported in the cell transplant

group compared to controls. Surviving patients had higher ejection fractions. Engrafted cells

differentiated into cardiac troponin I expressing cells. In a canine model of cardiovascular

disease, labeled canine BMSC were injected into a chronically infarcted myocardium due to a

permanently ligated coronary (Bartunek et al., 2007). Labeled cells expressed cardiac specific

myosin or troponin I by four and twelve weeks after injection. Newly differentiated

cardiomyocyte-like cells were observed within the fibrotic area of infarction. Transplanted

BMSC expressed connexin43, consistent with the integration into the host tissue. No









calcification or osteogenic formation was noted. Pre-differentiated BMSC injected into heart

resulted in increased shortening and regional wall thickening suggesting a higher degree of

functional recovery. Eight weeks after transplantation of hBMSC into rats with acute myocardial

infarcts, engrafted cells expressed connexin43 and cardiac troponin T (Chang et al., 2008b).

Functional aspects of the heart were improved, with reduced left ventricular end diastolic

diameter and end systolic dimension as well as improvement of fractional shortening. Comparing

hBMSC and hUCB in a mouse model of cryoinjury to the left ventricle, Ma et al determined that

the presence of both cell types increased capillary density (Ma et al., 2006). However, hUCB

had no effect on the shortening fraction while BMSC alleviated the decrease in contractility

caused by cryoinjury. Additionally, while both BMSC and UCB could be identified in the

myocardium, no neo-cardiomyocyte like cells were found.

Stem cells from umbilical cord blood have also been used as a therapeutic tool in the

treatment of cardiovascular diseases. hUCB implantation into Sprague-Dawley rats with acute

myocardial infarction present engrafted cells that express cardiac troponin T, von Willebrand

factor, and smooth muscle actin indicating that these cells contributed to cardiac, endothelial and

smooth muscle cell types (Wu et al., 2007b). Left ventricular ejection fraction was increased

within two weeks of transplantation. Rats transplanted with hUCB also demonstrated an

increase in arteriole vessels and capillary density. hUCB implantation into a hind limb model of

ischemia in nude mice resulted in marked improvement of perfusion as well as a time dependent

increase in blood flow following the injection of hUCB (Wu et al., 2007a). Genetically modified

hUCB were used by Chen et al to treat a murine model of acute myocardial infarction (Chen et

al., 2005). hUCB transfected with vascular endothelial growth factor (VEGF) or Angiopoietinl

were implanted into the damaged myocardium. Transplanted cells incorporated into the









myocardium and expressed VEGF or Angl. Treatment with untransfected hUCB decreased the

infarct size, however cells expressing VEGF reduced infarct size further. Transplantation of cells

expressing VEGF or Angl also increased capillary density and improved fractional shortening

and ventricular ejection fraction.

Tendon and Ligament Injuries

Current treatments for tendon injury are inefficient at best, including immobilization or

surgery to reattach partially severed tendons. Re-injury is a common problem due to the

replacement of tendon tissue with scar tissue. These changes in the tendon's capacity to store

energy and recoil affect the ability of the tendon to adapt and equally disperse the load,

potentially creating microdamage leading to re-injury. In some animals, bone marrow derived

stem cells (BMSC) have been used to treat tendon lesions with some success. Several reports

suggest improved results using BMSC injections compared to traditional treatment programs

(Smith et al., 2003; Crovace et al., 2007; Pacini et al., 2007; Guest et al., 2008). No negative

immune response was reported using autologous or allogeneic BMSC injections into core

superficial digital flexor tendon (SDFT) lesions (Smith et al., 2003; Guest et al., 2008). The

labeled cells integrated into tendon, assuming tenocyte-like morphology (Guest et al., 2008).

However, a low efficiency (0.001%) of engraftment was reported. Autologous BMSC

transplanted into collagenase induced SDFT lesions decreased the lesion size as a percent of total

tendon cross sectional area (Crovace et al., 2007). Racehorses with typical core SDFT lesions

receiving stem cells suffered no adverse reactions (Pacini et al., 2007). One month following

injection, greater tendon density was apparent in horses injected with BMSC compared to

uninjected control horses. Tendons appeared almost completely repaired after six months. All

returned to racing with no further reinjury more than two years after diagnosis. Control horses

showed fibrosis during the healing process and all were reinjured within twelve months after the









initial diagnosis. Autologous rat BMSC successfully engrafted into injured MCL (Watanabe et

al., 2002). These cells became spindle shaped with elongated nuclei and aligned with parallel

collagen bundles within 14 days of treatment. Biomechanical properties including stiffness,

maximum force, maximum stress, and modulus were all improved in tendons receiving a gel

sponge seeded with autologous BMSC (Juncosa-Melvin et al., 2006). In a patellar tendon defect,

BMSC seeded collagen composite implants strengthened tendons over natural repair (Awad et

al., 2003). However, 28% of these grafts showed formation of ectopic bone. Bone-free tendons

exhibited improved biomechanics, with increased maximum force, stiffness and strain energy

after 26 weeks of recovery. Values reported for cell seeded grafts were intermediate to naturally

repaired tissue and normal, healthy tissue indicating an improvement but not return to completely

native state. Twenty days after implantation of hBMSC into a patellar tendon defect in rats

treated tendons exhibited spindle shaped cells among collagen fibers aligned in parallel

(Hankemeier et al., 2007). The improvement in biomechanical properties was also reported by

Young et al, who implanted autologous BMSC into a gap defect model in the gastrocnemius

tendon of the rabbit (Young et al., 1998). Treated repairs were stiffer, withstood more force and

energy than control repairs but were still weaker than normal tissue. The area of the treated

repair declined at a significantly faster rate than control repairs.

An alternate source of autologous stem cells derived from adipose tissue (adipose derived

stem cells; ADSC) has recently become commercially available for use in the horse (VetStem,

CA). This putative population of cells has been used to treat tendon, ligament and joint injuries.

However, no data is available regarding the true identity of these cells or their capability for

differentiation into various types of tissue. A recent report indicates that use of adipose derived

mononuclear cell fractions for repair of collagenase induced lesions in the horse results in









improvements in overall tendon fiber architecture after six weeks of recovery (Nixon et al.,

2008). These cells may be more mature in nature than BMSC, as Kisiday et al report indicates

they are less efficient at chondrogenesis than BMSC, secreting and accumulating less

extracellular matrix (Kisiday et al., 2008).

Bone Injuries

Union at the host-implant interface was apparent by eight weeks in dogs implanted with

allogeneic BMSC on a hydroxyapatite-tricalcium phosphate scaffold (Arinzeh et al., 2003). A

callus was also present around the periphery of the implant and host bone at this time. Newly

formed bone and connective tissue were apparent; in some cases a marrow cavity was

reestablished. Similar results were obtained with autologous BMSC, however cell free matrices

formed little to no callus or new bone. No adverse host response to allogenic BMSC was

observed. On hydroxyapatite ceramic (HAC), culture expanded BMSC osteoprogenitor cells

were implanted into a critical sized defect in ewes and allowed to recover for sixty days (Kon et

al., 2000). Callus formation was observed between the bone and scaffold, regardless of the

presence of cells. Transplants including cells had more substantial callus formation and earlier

presence of bone than cell free transplants. In another study using sheep, Viateau et al

transplanted BMSC on coral constructs into a bone defect (Viateau et al., 2007). In ewes

implanted with scaffold only grafts, no union formed but some bone deposition was present.

Grafts with BMSC exhibited significant new bone formation and complete resorption of the

scaffold as early as one month after implant. Notably, the same amount of new bone formation

was present in the coral/BMSC grafts as autogenic corticocancellous grafts. In bone marrow

derived osteogenic progenitor cells cultured on a matrix consisting of demineralized bone and

cancellous chips and subsequently transplanted into a critical sized defect in the canine femur,

autografted and stem cell grafts resulted in 100% healing compared to 50% healing in graft only









transplants and 67% in bone marrow grafts (Brodke et al., 2006). Goats with tibial bone defects

that received autologous BMSC on a beta-tricalcium phosphate scaffold achieved full union by

32 weeks post surgery (Liu et al., 2008). At this point, the ceramic scaffold was almost

completely resorbed and the engrafted bone had reached similar biomechanical properties as a

normal tibia. Little callus was observed at 16 or 32 weeks in acellular grafts, which were not

resorbed and did not heal during the 32 week trial. hBMSC implanted into a rat femur defect on

hydroxyapatite/pTCP cubes exhibited more bone formation than grafts alone (Bruder et al.,

1998). By eight weeks, the BMSC seeded graft had significant bone formation within the pores

of the scaffold and were integrating into the ends of the host bone. Union was complete by

twelve weeks. New woven and lamellar bone were detected in close contact with the edges of the

defect and were directly contiguous. Defects corrected with cell seeded grafts exhibited

increased strength and stiffness in biomechanical testing compared to grafts alone. Pores of the

acellular grafts were primarily filled with fibrous tissue at twelve weeks. Following lunate

arthroplasty, autologous rabbit BMSC were seeded on a scaffold of hyaluronan and gelatin prior

to transplantation into the surgical defect (Huang et al., 2006). Removal of the entire lunate

resulted in carpal collapse. However, rabbits receiving the implant presented evidence of new

bone formation twelve weeks after surgery. Scaffold only implants showed no bone formation.

Repaired tissue contained intensely stained metachromatic matrix and islands of ossicles within

the lunate space. Endochondral ossification had occurred in central areas of the scaffold seeded

with BMSC by twelve weeks with chondrocytes being replaced by woven bone. In a clinical

trial, Marcacci et al report that patients injected with autologous BMSC into bone defects

resulting from trauma exhibit callus formation between the host bone and hydroxyapatite

cylinder implant after one to two months (Marcacci et al., 2007). Complete resorption occurred









five to seven months after surgery; this integration was maintained in three patients six to seven

years after surgery (the longest follow-up available).

Cartilage Injuries

Swine BMSC labeled with green fluorescent protein were seeded on polyglycolic acid

fibers (PGA) and polylactic acid (PLA) scaffolds prior to implantation into an osteochondral

defect in the femur trochlea of both knees (Zhou et al., 2006). Transplantation of scaffolds with

cells predifferentiated to cartilage resulted in relatively regular surfaces and newly formed

cartilage like tissue after three months. Non-induced BMSC on scaffolds had inferior results,

with irregular surfaces and visible tissue deficits with defects filled mostly with fibrotic tissue.

Six months post surgery, nearly normal osteochondral tissue and relatively smooth articular

surfaces were apparent in induced BMSC seeded grafts with strong metachromatic matrix

production. Green fluorescent protein positive cells remained present in the graft site up to seven

months post operation. Mrugala et al transplanted ovine BMSC with chitosan in fibrin glue in the

absence or presence of TGFP into a partial thickness defect in the cartilaginous tissue of the

patella (Mrugala et al., 2008). BMSC implanted in the absence of chitosan (fibrin glue only)

formed poorly integrated tissue with no glycosaminoglycan, proteoglycan, or type II collagen

expression. However, when chitosan was included, tissue resembling cartilage with lacunae and

associated cells was observed but integration remained poor. The combination of chitosan,

BMSC and TGFP resulted in the best repaired tissue in terms of integration with host cartilage,

presence of chondrocyte-like cells surrounded by a matrix that stained positive for Safranin O,

type II collagen, and aggrecan. However, some fibrous tissue remained and overlapped the

neocartilage in some areas. Autologous uncultured rabbit BMSC transplanted into a full

thickness cartilage defect on a fibrin gel carrier resulted in the regeneration of cartilage that

stained intensely with Safranin O but remained inferior to normal cartilage (Chang et al., 2008a).









Implants containing gel alone had much less area of regeneration coupled with the presence of

fibrous tissue and less intense staining of extracellular matrix for Safranin O. BMSC injected

directly into a full thickness defect of the articular cartilage of the left distal femur in 16 New

Zealand white rabbits showed smooth, consistent white tissue resembling articular cartilage in

the regenerating area (Im etal., 2001). In contrast, control animals exhibited red, irregular

tissue with the margin of the defect sharply differentiated from the surrounding normal cartilage.

Defects in the group receiving BMSC had relatively normal surfaces with adjacent normal

cartilage showing little degenerative change. Control animals showed degenerative changes in

adjacent cartilage, thin and undifferentiated defects, and decreased cellularity. Collagen matrices

containing type I, type II and type III collagen seeded with ovine BMSC were used to fill

surgical defects in the medial condyle of the femur (Dorotka et al., 2005). Defects treated with

cell seeded matrices appeared more filled than control defects and had the largest quantity of

hyaline cartilage. Autologous BMSC were implanted into full thickness cartilage lesions in the

femoropatellar articulation in mature horses (Wilke et al., 2007). After thirty days, defects

repaired with BMSC appeared more completely filled with more homogenous tissue.

Arthroscopic scores were significantly higher in the BMSC seeded defects. No consistent

differences between control and cell seeded scaffolds could be determined eight months after

surgery. The authors concluded that early repair was improved by the presence of BMSC but no

long term benefits were apparent. Yan and Yu compared the effects of chondrocytes, BMSC,

fibroblasts and hUCB seeded on a polylactic acid scaffold on a full thickness cartilage defect in

rabbits (Yan and Yu, 2007). While no apparent visible difference in the defects were found after

twelve weeks, the fibroblast and control scaffolds were filled with non-cartilaginous tissue while

hUCB and BMSC seeded scaffolds housed tissue indistinguishable from host hyaline cartilage.









Areas of union between the host and graft were indiscernible in defects implanted with hUCB

seeded PLA scaffolds. However, the junction between the repaired tissue and subchondral bone

was irregular in grafts seeded with BMSC. Fibroblast seeded scaffolds exhibited irregular

borders with some degeneration of surrounding cartilage. Poly-lactide-co-glycolide scaffolds

seeded with human adipose derived stem cells supplemented with TGFP were implanted

subcutaneously into scid mice (Mehlhorn et al., 2009). After eight weeks, histological

examination demonstrated the presence of proteoglycans throughout the implant. Cells were

round in shape and distributed homogenously throughout the scaffold. The presence of type II

collagen was determined by immunohistochemistry, however some implants also expressed type

I collagen. Fewer explants seeded with TGFP treated AdMSC expressed type I collagen than

control implants. In a clinical study, autologous BMSC were injected into patella-femoral

lesions (Wakitani et al., 2007). A cartilaginous matrix formed at the site of injection. Patients

reported clinical improvement in lessening pain and range of motion with no adverse reactions.

Muscular Dystrophies

The use of stem cells in muscle disease generally involves muscular dystrophies. When

human UCB were transplanted into the sjl mouse, a model of limb girdle muscular dystrophies,

the cells engrafted into host muscle (Kong et al., 2004). A small number of fibers were capable

of expressing dysferlin, the missing protein, twelve weeks after transplantation. Additionally,

when injected into the adductor muscle of an ischemic mouse limb, human UCB engrafted into

the injured muscle (Pesce et al., 2003). Some donor cells expressed desmin, a marker of

myogenic differentiation. Transplantation increased the number of regenerating controls at an

earlier time point, suggesting that the presence of UCB initiated an earlier healing process.

Transplantation of human circulating AC133+ cells into scid/mdx mouse tibialis anterior resulted

in cells engrafting into the regenerating muscle (Torrente et al., 2004). Some cells took up









residence in the satellite cell position while others produced human dystrophin and myosin heavy

chain. Additionally, muscle injected with ACC133+ cells possessed fewer regenerating fibers

with less central nuclei than controls. Human fetal BMSC were transplanted intraperitoneally

into mdx murine fetuses (Chan et al., 2007). Engraftment of human cells was apparent in a

number of tissues including the brain, lung, liver and spleen. Skeletal, diaphragmatic and cardiac

muscle expressed human specific myosin heavy chain transcripts. Human nuclei were present in

regenerating muscle of transplanted animals and some human dystrophin was expressed.

Conclusion

The scientific community has access to a widely varied population of stem cells with

which to investigate the biology and potential application of the stem cell. Undoubtedly, certain

cell types are more suited for use in different situations. ES cells likely recapitulate early

embryonic development; while adult bone marrow derived cells are more suited for the study of

hematopoiesis in the adult animal. Investigations focus not only the stem cells themselves, but

the environment in which they exist in the organism. The effects of the stem cell niche on not

only the stem cell but the surrounding cells and tissues provide a huge area of potential research

for therapeutic application.









CHAPTER 2
CENTRAL HYPOTHESIS

Stem cells exist in a wide array of plasticity and self-renewing abilities. From embryonic

stem cells which can divide indefinitely and recapitulate the entire organism to adult stem cells

which are limited to a few cell divisions and differentiation into a small number of cell types,

each stem cell has its niche both in the life of the animal and in the world of therapeutic

medicine. Umbilical cord blood is a widely available, often discarded source of stem cells. This

population of stem cells has the potential to be an intermediate population between the naive

embryonic stem cell and the less plastic adult stem cell. Owing to its immature source, umbilical

cord blood derived stem cells may be a more malleable population of stem cells with less of the

inherent risk of tumor formation found in embryonic stem cells.

Using the horse as a model animal, we sought to identify stem cells from umbilical cord

blood that may be useful in treating tendon injuries. Horses provide a large animal model that is

easily accessible, easy to work with, and provides large volumes of umbilical cord blood at birth.

Most foalings are attended by farm hands who can collect the blood with minimal training.

Moreover, large animal models may be more appropriate to evaluate possible human therapies

owing to greater similarities in anatomy and physiology than available in rodent models.

Our hypothesis is that equine umbilical cord blood contains a population of stem cells that

can be isolated, cultured, and differentiated into a variety of cell types. Specifically, the ability

of these cells to differentiate into an early tendon precursor cell was examined. The following

objectives were designed to test the hypothesis:









Aim 1: Stem cells can be isolated from equine umbilical cord blood and cultured using methods

currently used in human medicine and research. Equine UCB stem cells express markers and

morphology similar to other mesenchymal stem cells.

Aim 2: Equine UCB have the potential to contribute to tendon injury and repair. Stem cells were

examined for expression of early tenocytes. Tenocytic differentiation was promoted by culture

on a variety of protein matrices and in growth factor containing media.









CHAPTER 3
EQUINE UMBILICAL CORD BLOOD CONTAINS A POPULATION OF STEM CELLS
THAT EXPRESS OCT4 AND DIFFERENTIATE INTO MESODERMAL AND
ENDODERMAL CELL TYPES

Introduction

Bone marrow (BM) derived mesenchymal stem cells (MSCs) are the conventional model

of choice for adult stem cell based therapeutics in humans due to their multi-lineage

differentiation capabilities. Their relative ease of expansion in vitro without loss of plasticity

makes MSCs an attractive repair aid for damaged or diseased heart, bone and vascular tissues

[for review see (Giordano et al., 2007)]. However, enthusiasm for the use of MSCs as

cytotherapeutics is tempered by their age-dependent decline in absolute numbers and the

invasive nature of their harvest (Stenderup et al., 2003). To counter these problems, umbilical

cord blood (UCB) MSCs may represent a viable alternative. Several reports define a clonogenic

population of cells from the umbilicus that differentiate into both mesenchymal and non-

mesenchymal tissue derivatives (McGuckin et al., 2003; Aoki et al., 2004; Baal et al., 2004;

Bonanno et al., 2004; Peled et al., 2004; Ruzicka et al., 2004; He et al., 2005; Holm et al., 2006;

Martin-Rendon et al., 2007; Guest et al., 2008). The identity of these cells as circulating stem-

like progenitors versus endothelial progenitors detached from the umbilicus remains debatable

(Kogler et al., 2004).

A hierarchy in stem cell plasticity exists such that embryonic stem (ES) cells are

pluripotent and adult MSCs are more limited in their differentiation capacity (Feinberg, 2007).

UCB stem cells likely fall in the area between the two. The three classes of stem cells

demonstrate variable stage specific embryonic antigen (SSEA) and tumor rejection antigen (Tra)

surface marker protein expression patterns, as well as differences in transcriptional circuitry.

SSEA-3 and SSEA-4 are prevalent on the surface of human ES cells; these undifferentiated cells









do not express SSEA-1 (Thomson et al., 1998; Reubinoff et al., 2000; Henderson et al., 2002).

By contrast, mouse blastocyst inner cell mass cells and ES cells express SSEA-1 but not SSEA-3

or SSEA-4 (Henderson et al., 2002; Tielens et al., 2006). The keratan sulfate proteoglycan

markers, Tral-60 and Tral-81, are localized within the extracellular matrix of human ES cells

(Henderson et al., 2002; Stojkovic et al., 2004). Key to the establishment and maintenance of the

undifferentiated state of ES cells are the coordinated activities of Oct4, nanog, and Sox2 (Boyer

et al., 2005). This combination of surface markers and plasticity genes represent the minimal

defining components of a naive ES cell. By comparison, human BM derived MSCs are more

limited in their expression of the central ES indicators likely owing to the heterogeneity of the

population. SSEA4 is present on the surface of BM-MSC; the cells lack Oct4 but can be induced

to form multiple lineages (Gang et al., 2007). Culture of BM-MSC in FGF2 supplemented media

results in Oct4 and nanog transcription suggesting that a premature phenotype reminiscent of ES

cells can be established (Battula et al., 2007). UCB stem cells are unique in that they possess an

intermediate phenotype that more closely resembles ES cells. SSEA-3, SSEA-4, Tral-60, Tral-

81, Oct4, and Nanog are present in this population (McGuckin et al., 2003; Zhao et al., 2006;

Markov et al., 2007; Sun et al., 2007).

BM-MSC isolated from adult horses differentiate along the chondrogenic and osteogenic

lineages comparable to their human counterparts (Fortier et al., 1998; Worster et al., 2001;

Koerner et al., 2006). However, a reduced level of success exists for the formation of adipocytes

from BM aspirates (Koerner et al., 2006; Vidal et al., 2006). Because human UCB stem cells

exhibit a heightened degree of plasticity, we chose to identify a comparable cell entity in

newborn foal cord blood as an alternative to BM-MSC. Using conventional human purification

methods, culture conditions and differentiation protocols, an equine UCB cell population was









discovered that possesses stem cell-like markers and multilineage differentiation capabilities.

The isolation and characterization of these cells represent a first-step toward their application in

cytotherapeutic repair of sport horse injuries.

Materials and Methods

Umbilical Cord Blood (UCB) Collection and Stem Cell Isolation

Cord blood (n = 25) was collected from the intact umbilicus at foaling into a sterile 50 ml

centrifuge tube containing ethylenediamine tetraacetic acid (EDTA) as an anti-coagulant. Blood

was stored at 40C and further processed within 12 h of collection. Samples were incubated for 20

min with RosetteSep Human Cord Blood Progenitor Enrichment Cocktail (50 pl/ml blood; Stem

Cell Technologies, Seattle, WA), a commercially available product for negative selection of

human UCB stem cells. An equal volume of phosphate-buffered saline (PBS) containing 2%

fetal bovine serum (FBS, Invitrogen, Carlsbad, CA) was added. The cell suspension was layered

atop a Ficoll-Paque Plus (Stem Cell Technologies) cushion and centrifuged at 1,200g for 20 min.

The cell interface was collected and cultured.

Equine UCB and Adipose-Derived (AD) Stem Cell Culture

MSCs isolated from equine adipose tissue were purchased from Sciencell Research

Laboratories (San Diego, CA). Cells were cultured in Mesenchymal Stem Cell Medium

(Sciencell Research Laboratories) on standard tissue plasticware, according to manufacturer's

recommendations. UCB stem cells were cultured in Dulbecco's modified Eagle media (DMEM,

Invitrogen) supplemented with 10% FBS and 5 tg/ml Plasmocin (Invitrogen). Culture medium

was exchanged every three days. Cells were passage at 70% confluency using 0.025% trypsin-

EDTA (Invitrogen).









RNA Isolation, Reverse Transcription (RT), and Polymerase Chain Reaction (PCR)

Total RNA was isolated by lysis in STAT60 (Iso-Tex Diagnostics, Friendswood, TX) and

ethanol precipitation. The RNA was digested with DNase (Ambion, Austin, TX) to remove

genomic DNA contaminants. One microgram of total RNA was reverse transcribed (Superscript

III, Invitrogen) in 20 il reaction volume. Two microliters of first strand cDNA was amplified

with gene-specific primers and AccuPrime DNA polymerase (Invitrogen). Primer sequences

included glyceraldehyde 3-phosphate dehydrogenase (F-

GATTCCACCCATGGCAAGTTCCATGGCAC, R-

GCATCGAAGGTGGAAGAGTGGGTGTCACT), collagen 2al (F-

CAGCTATGGAGATGACAACCTGGC, R-CGTGCAGCCATCCTTCAGGACAG), Sox9 (F-

GCTCCCAGCCCCACCATGTCCG, R-CGCCTGCGCCCACACCATGAAG), osteonectin (F-

CCCATCAATGGGGTGCTGGTCC, R-GTGAAAAAGATGCACGAGAATGAG), Runx2 (F-

CGTGCTGCCATTCGAGGTGGTGG, R-CCTCAGAACTGGGCCCTTTTTCAG), albumin (F-

AACTCTTCGTGCAACCTACGGTGA, R-AATTTCTGGCTCAGGCGAGCTACT) and

cytokeratinl8 (F-GGATGCCCCCAAATCTCAGGACC, R-

GGGCCAGCTCAGACTCCAGGTGC). PCR products were visualized following

electrophoresis through 2% agarose gels containing ethidium bromide. Representative images

were captured with a Kodak ImageDoc system and inverted in Adobe Photoshop CS.

Osteogenic Differentiation

Cells were plated at a density 1,300 cells/cm2 and allowed to attach overnight in normal

growth medium. The following day, cells were washed twice with PBS and placed in an

osteogenic differentiation medium composed of alpha modified Eagle medium (a-MEM), 10

mM P-glycerophosphate, 0.1 |M dexamethasone, 0.1 mM ascorbic acid (Tondreau et al., 2005;

Wagner et al., 2005). Media was changed twice weekly. Cells were fixed in 4%









paraformaldehyde in PBS for 15 min on days 7, 14, and 21. Total RNA was isolated from

parallel plates.

Chondrogenic Differentiation

UCB stem cells were pelleted to a micromass, promoting chondrogenic differentiation in a

three-dimensional environment. Cells (4 x 105) were pelleted at 1,000g for 5 min. The medium

was removed and 0.5 ml chondrogenic medium was added (Worster et al., 2000; Tondreau et al.,

2005). Chondrogenic medium consisted of DMEM, 1.0 g/L insulin, 0.55 g/L transferring, 0.67

mg/L sodium selenite (ITS-X, Invitrogen), 10 ng/ml transforming growth factor beta-1 (TGF P1,

R&D Systems, Minneapolis, MN), 35 pg/ml ascorbic acid and 100 nM dexamethasone (Sigma,

St. Louis, MO). Media was changed twice weekly. After 7, 14, and 21 days, the micromass was

embedded and frozen in OCT freezing compound. Alternately, micromasses were washed with

PBS and used for RNA isolation.

Adipogenic Differentiation

UCB stem cells were plated at a density of 3,000 cells/cm2 in growth medium. Adipogenic

differentiation was induced with Iscove's modified Dulbecco's media (IMDM) supplemented

with 10% FBS, 1 iM dexamethasone, 10 pg/ml recombinant human insulin, 0.25 mM 3-

isobutyl-1-methylxanthine (IBMX) and 100 iM indomethacin (Wagner et al., 2005). Medium

was replaced every three days. Cells were fixed with 4% paraformaldehyde in PBS after 7, 14,

and 21 days in culture.

Hepatogenic Differentiation

UCB stem cells were plated at a density of 5,000 cells/cm2 and allowed to attach overnight

in normal growth medium. The following day, cells were washed twice with PBS and placed in

hepatogenic medium [1% FBS, 20 ng/ml recombinant human hepatocyte growth factor (HGF,

R&D Systems), 10 ng/ml recombinant human fibroblast growth factor 4 (FGF4, R&D Systems)









in IMDM], as described (Kang et al., 2005). Medium was replaced twice weekly. On days 7 and

14 cells were fixed in 4% paraformaldehyde in PBS for 15 min. Total RNA was isolated from

parallel plates.

Myogenic Differentiation

UCB stem cells were plated at 3,000 cell/cm2 on gelatin-coated tissue cultureware.

Differentiation was initiated by incubation in low glucose DMEM supplemented with 200 pg/ml

galectin-1 (R&D Systems) essentially as described (Chan et al., 2006). After 14 days, cells were

fixed with 4% paraformaldehyde or lysed for RNA isolation.

Histology

Alkaline phosphatase enzymatic activity was detected colorimetrically using Nitro-Blue

Tetrazolium Chloride (NBT) and 5-Bromo-4-Chloro-3'-Indolyphosphate p-Toluidine (BCIP;

Pierce, Rockford, IL) following fixation with 4% paraformaldehyde. Oil Red O (0.1% in 60%

isopropanol) was used to visualize lipid droplets. Alcian Blue (1% in 3% acetic acid) staining

was used to detect glycosaminoglycans. Safranin O (0.1% in water) was used for the

visualization of proteoglycans and cartilage. Alizarin Red (2% in water, pH 4.2) was used for the

detection of mineral deposits. Calcium deposits were detected by the method of von Kossa using

1% silver nitrate and 5% sodium thiosulfate.

Immunocytochemistry

Cells were fixed in 4% paraformaldehyde for 10 min at room temperature and

permeabilized with 0.1% Triton X-100 in PBS. Non-specific antigen sites were blocked with 5%

horse serum. For the detection of stem cell markers, anti-Oct4 (1:50, Santa Cruz, Santa Cruz,

CA), anti-SSEA-1, anti-SSEA-3, anti-SSEA-4 (1:50, R&D Systems), anti-Tral-60 (1:50,

Abcam, Cambridge, MA) and anti-Tral-81 (1:50, Abcam) were used. Myogenic cells were

incubated with anti-desmin (1:200, DE-U-10, Sigma Aldrich, St. Louis, MO) and Texas Red









conjugated Phalloidin (Invitrogen). All antibodies were diluted in PBS containing 1% horse

serum and incubated with fixed cells for 1 h at room temperature. Immune complexes were

visualized with goat anti-mouse AlexaFluor488 (1:200), goat anti-rabbit AlexaFluor488 (1:200),

or goat anti-rabbit AlexaFluor568 (1:200) on a Nikon T200 microscope equipped with

epifluorescence. Images were captured with NIS Elements (Nikon Instruments, Melville, NY)

software and compiled with Adobe PhotoShop CS.

Results

Foal Umbilical Cord Blood Contains an Oct4-Expressing Cell Population

Multipotent stem cells are routinely isolated from fresh cord blood at birth from humans by

density gradient centrifugation. Initial Ficoll gradient separation of equine UCBs yielded a

heterogeneous population with poor recovery of adherent cells. As such, a negative selection

procedure (RosetteSep) was employed with the potential to remove extraneous natural killer

cells, macrophages, lymphocytes, and B-cells. Significantly fewer cells were present in the buffy

coat following centrifugation through Ficoll that attached readily to plastic cultureware. To

ascertain their identity, cells were fixed and evaluated by immunocytochemistry for the stem cell

markers, SSEA-1, Oct4, Tral-60 and Tral-81. Results demonstrated the presence of Oct4 in the

nuclei of greater than 90% of the cells (Figure 3-1). A similar percentage of the cells contained

Tral-60 and Tral-81, as well as SSEA-1. In data not shown, alkaline phosphatase enzymatic

activity was readily detected and minor amounts of SSEA-4 were noted by

immunocytochemistry. Thus, newborn foal cord blood contains a cell population that can be

isolated with conventional human reagents and protocols and that express characteristic ES cell

marker proteins.









UCB Stem Cells Form Chondrocytes

The plasticity of UCB stem cells was evaluated by differentiation into cartilage precursors.

Adherent stem cells were pelleted and cultured as a micromass in a defined media supplemented

with ascorbic acid, dexamethasone and TGF-P 1. At the end of 3 weeks in chondrogenic media,

the cell pellet was cryopreserved or lysed for RNA isolation. Alcian blue histology revealed the

presence of proteoglycans, a matrix component of mature chondrocytes (Figure 3-2A). The

extracellular constituents of the micromass were rich in glycosaminoglycans, as indicated by

Safranin staining. Sox9 is a transcription factor that positively regulates the expression of

collagen and extracellular matrix genes in chondrocytes (Ng et al., 1997; Bi et al., 1999;

Lefebvre et al., 2001). Expression levels of Sox9 and collagen 2al were evaluated by RT-PCR

after 7 and 21 days in chondrogenic differentiation media. Gene transcripts for Sox9 are evident

after 7 days but absent by 21 days in differentiation permissive media (Figure 3-2B). Abundant

amounts of collagen 2al mRNA was evident at both time frames. These results demonstrate

temporal and specific activation of the chondrogenic gene program.

Differentiation of UCB Stem Cells into Osteocytes

Young thoroughbred racehorses are prone to debilitating bone fractures whose repair may

be aided by stem cell-based therapeutics. Therefore, UCB stem cells were cultured on

plasticware in a defined media capable of inducing osteocytes from human UCB stem cells

(Tondreau et al., 2005). After 3 weeks, cells were fixed with paraformaldehyde or harvested for

RNA isolation. Alizarin Red histology indicated that the putative bone cells were capable of

calcium deposition (Figure 3-3A). In a similar manner, Von Kossa staining detected calcium

aggregates. RT-PCR confirmed the osteogenic program in these cells. Primers specific for

osteonectin and Runx2 amplified products of the correct size (Figure 3-3B). These results









demonstrate that UCB stem cells are a source of osteocytes under appropriate in vitro cultivation

conditions.

Foal UCB Stem Cells can Differentiate into Endodermal-Derived Cell Types

A key feature of ES cells is their potential to contribute to any tissue type in the body.

Adult stem cells possess a more limited plasticity than their embryonic counterparts. The ability

of foal UCB stem cells to differentiate into hepatocytes, a cell type that originates from the

endoderm, was examined. In brief, UCB stem cells were cultured for 2 weeks in media that

supports hepatocyte formation in human UCB stem cells (Kang et al., 2005). Subsequently, cells

were fixed with paraformaldehyde or lysed for RNA isolation. As shown in Figure 3-4A, a

change from an elongated, spindle-shaped morphology to one exhibiting a larger cytoplasmic

volume with an elliptical shape occurs in response to the treatment media. These cells express

mRNA for both albumin and cytokeratin 18, definitive markers of hepatocytes (Figure 3-4B).

Equine UCBs maintained in the absence of induction media failed to express the liver marker

genes (data not shown). The ability to respond in a manner similar to ES cells and form

hepatocytes suggests that our UCB cell population may be more plastic than other adult MSC.

Inefficient Formation of Myocytes and Adipocytes by UCB Cells

Koerner et al. (Koerner et al., 2006) reported limited formation of adipocytes from adult

horse BM-derived MSCs. Thus, we compared the adipogenic differentiation capabilities of foal

UCB stem cells and adult horse adipocyte-derived MSCs (AdMSC). In brief, both cell types

were incubated for 21 days in adipocyte induction media. Cells were fixed and evaluated by Oil

Red O histology for the presence of lipid droplets. In our hands, neither UCB nor AdMSC

efficiently formed adipocytes. Sporadic fat cells containing limited amounts of lipid droplets

were evident in foal UCB cell cultures; no Oil Red O positive cells were found in the AD-MSCs.

This restricted differentiation profile by the two forms of stem cell was further exemplified









following their incubation in myocyte induction media. UCB stem cells and AD-MSCs were

incubated for 7 days in media supplemented with galectin-1, a glycoprotein that promotes

myogenesis in human fetal MSCs (Chan et al., 2006). Subsequently, cells were fixed and

immunostained for the skeletal muscle marker protein, desmin. UCB stem cell cultures contained

several multinucleated, spindle-shaped cells that are reminiscent of myocytes. Anti-desmin

immunofluorescent detection reveals that these structures express the intermediate filament

protein (Figure 3-5B). No desmin expressing muscle cells were present in the AD-MCSs treated

in a similar manner (data not shown). The presence of organized actin filaments was examined

using Texas Red conjugated phalloidin. Equine UCB-derived myoblasts contained organized

actin structures throughout their cytoplasm (Figure 3-5C). By contrast, AdMSC cells contained

fewer phalloidin-reactive filaments. The cytoskeletal structures pointed to distinct differences in

overall cellular morphology between the differentiated AdMSC and UCB myoblasts. UCB

myoblasts were thin, elongated and cylindrical in shape whereas the AdMSC cells were

fibroblast-like with an enlarged cytoplasmic space. Our results demonstrate differences between

the two types of stem cells and suggest that foal UCB cells are more plastic than adult horse

MSCs.

AdMSC do not Express the Same Complement of Stem Cell Markers

The inability of AdMSC to form adipocytes was surprising given that they originate from

the fat depot. To ensure that the cells were naive and undifferentiated, subconfluent cultures of

AdMSC were immunostained for stem cell markers. Similar to UCB stem cells, AD-MSCs

express Oct4, Tral-60 and Tral-81 (Figure 3-6). However, SSEA-1 and SSEA-4 were

undetectable. These results indicate that AdMSC retain markers of adult stem cells but do not

express those more closely associated with ES cells.









Discussion

There is widespread interest in tendon, ligament and cartilage repair in horses through the

use of directed stem cell transplantation methods. To date, published reports of multipotent cells

isolated from BM, peripheral blood, and UCB exist (Fortier et al., 1998; Saito et al., 2002;

Koerner et al., 2006; Li et al., 2006). Cells from each of these sources display limited

differentiation into mesodermal cell types with predominant induction of chondrogenic and

osteogenic precursors. Beyond these two cell types, vast differences in differentiation

efficiencies and alternate cellular identities exist. The disparities may be attributed to tissue

source or suboptimal culture conditions; both possibilities necessitate further study.

Alternatively, the transcriptional regulators that govern pluripotency may be absent or inactive

thereby, limiting plasticity. Key to the ES cell-like nature is expression of Oct4, Sox2, nanog, c-

myc, and Klf4 (Takahashi and Yamanaka, 2006). Foal UCB stem cells maintained in a growth

factor rich medium expressed Oct4, SSEA-1, Tral-60 and Tral-81, all stem cell marker proteins.

However, repeated attempts to detect nanog and Sox2 mRNA were unsuccessful. The absence of

these transcription factors may contribute to the restricted types of cells generated and their

incomplete differentiation (myoblasts). Interestingly, the ability of UCB stem cells to express

these embryonic markers sets them apart from adult MSCs. Surface expression of SSEA-1 and

SSEA-4 were not evident in equine AD-MSCs. The lack of SSEA markers points to a hierarchy

in plasticity that may account for some of the differences in differentiation capabilities. Efforts to

define culture media that support nanog, Sox2, and Klf4 expression may lead to an increased

range of differentiated lineages from UCB stem cells.

Stem cells isolated from the umbilical cord matrix of pigs develop a morphology that

resembles that reported by others for equine UCB stem cells (Carlin et al., 2006; Koch et al.,

2007). In both examples, the majority of the cells attached to the cultureware surface and









possessed a flat, spindle-shaped, fibroblast-like morphology. A lesser population formed light-

refractile colonies that grew upward from the substratum surface in a manner consistent with

transformed fibroblast foci. These colonies of small cells with a high nuclear to cytoplasmic

volume were evident in our cultures of newborn foal UCB stem cells only after reaching

confluency. Our UCB stem cells were maintained as a monolayer and passage at approximately

60% confluency thereby, selecting against the development of these cell clusters that appear to

grow independent of contact inhibition. While the identity of this cell population remains less

clear, it is possible that these colonies represent a more primitive progenitor cell. Indeed, these

cell clusters resemble those found in cultures of mouse ES cells. As such, one would predict that

confluent equine UCB cultures that contain both the fibroblast-like and light-refractile cell

colonies would express the plasticity genes, nanog and Sox2. However, expression of SSEA-1,

Tral-60, Tral-81 and alkaline phosphatase, in a manner consistent with equine inner cell mass-

derived ES cells, provides encouraging evidence that our monolayer cells are naive and

undifferentiated (Takahashi and Yamanaka, 2006).

Equine UCB stem cells, in our hands, are not direct equivalents to human UCB stem cells

but do possess many similarities. Human UCB stem cells can be isolated directly from the blood

and frozen without expansion (Lee et al., 2005). This aspect of enrichment and storage remains

elusive in our equine UCB cells. Partial purification by negative immunoselection and density

gradient centrifugation produces a cell population that survives immediate cryopreservation very

poorly. This may be due to the small numbers of stem cells and/or heightened sensitivity of these

cells to plasma membrane perturbation. Culture of the fresh isolates for 3-5 days allows for the

removal of contaminating lymphocytes and cellular debris and expansion of the putative stem

cell population, which can be stored in liquid nitrogen and subsequently recovered. Direct









enrichment of the UCB stem cell population by affinity purification with CD133 antibodies may

provide an alternative to both cell heterogeneity and cryopreservation issues.

The capacity of foal UCB stem cells to initiate hepatocyte-specific gene transcription

demonstrates an endodermal developmental potential. Reports exist demonstrating hepatocyte

formation from human UCB stem cells and MSC isolates from BM (Hong et al., 2005; Talens-

Visconti et al., 2006). However, this is the first report of hepatocyte formation using equine

multipotential cells. Putative stem cells from the inner cell mass of equine blastocysts undergo

spontaneous differentiation in vitro to yield cell derivatives of the three germ layers with

endoderm defined by RT-PCR detection of a-fetoprotein (Li et al., 2006). The ability of

newborn foal UCB stem cells to form liver cells is encouraging as it provides additional evidence

for a population with plasticity characteristics that more closely resemble an ES cell than an

adult stem cell. Additional endoderm-derived cell types of clinical importance include pancreatic

and cardiogenic. Human UCB stem cells can be induced to form heart cells following a two-step

differentiation protocol that involves 5-azacytidine treatment (Kadivar et al., 2006). Culture with

the hypomethylating agent suggests that UCB stem cells are more restricted in their

differentiation capabilities than ES cells and require chemical-induced reprogramming. In our

hands, treatment of foal UCB stem cells with 5-azacytidine did not induce the expression of

myosin immunopositive cells. Because our antibody (MF20) recognizes all forms of sarcomeric

myosin, this result provides indirect evidence that a full-fledged cardiocyte is not created in

response to epigenetic modification. However, a more comprehensive analysis of growth factor,

morphogen and substratum requirements for UCB stem cell differentiation into cardiocytes is

warranted.









Induction of the myogenic gene program has proven difficult in MSC originating from

multiple animal and tissue sources. Exposure of rat BM-derived MSCs to 5-azacytidine caused

differentiation into elongated, multinucleated myofibers (Wakitani et al., 1995). However,

reprogramming the equine UCB transcriptome with this chemical did not induce the myogenic

gene program (data not shown). A similar result was noted by others (Chan et al., 2006). Others

reported that human UCB stem cells formed limited numbers of desmin immunopositive cells

following in vitro differentiation (Nunes et al., 2007). These cells were devoid of the myogenic

regulatory factors (MRFs) as measured by RT-PCR. Interestingly, injection of the putative stem

cells into mdx mice resulted in engraftment suggesting that components within the muscle niche

are essential for myogenic progression. One of those proteins is likely galectin-1, a glycoprotein

of the basal lamina. Chan et al. (Chan et al., 2006) demonstrated that culture of human fetal

MSC in media containing galectin-1 initiated both biochemical and morphological differentiation

into myocytes. These cells formed large, multinucleated fibers that expressed contractile proteins

and the MRFs. We used a similar approach with some degree of success. Supplementation of

foal UCB cell culture medium with purified galectin-1 caused myogenic lineage establishment as

determined by desmin immunocytochemistry. However, a large percentage of the myoblasts

were fusion-defective. In addition, we were unable to detect gene transcripts for MyoD, an early

MRF, or myogenin, an MRF required for fusion and contractile gene expression. In accordance

with our failure to amplify members of the MRFs, we did not detect myosin heavy chain or

troponin T by immunocytochemical methods. The constraints to full activation of the myogenic

program may be attributed to the absence of complementary soluble proteins. The source of

galectin-1 used by Chan was spent media from COS cells that produce and secrete the

glycoprotein. Thus, additional proteins within the galectin-1 supplement may have aided









induction of myogenesis. Alternatively, specie-specific differences may underlie the discrepant

results.

Given the relative ease of adipocyte formation by human and rodent MSC, the inefficiency

of adipogenesis in equine UCB stem cells was surprising. Less than 1% of cells contained Oil

Red O reactive lipid droplets following application of conventional adipogenic induction

protocols. Koerner reported a similar result using BM-derived and peripheral blood-derived

MSC isolated from adult horses (Koerner et al., 2006). A very small number of adipocytes were

found and the cytoplasmic lipid droplets within said cells were miniscule. By contrast, robust

lipid formation is evident by Oil Red O histology in equine UBCs cultured in a similar adipocyte

induction media (Koch et al., 2007). The discrepancy between these various reports may be

attributed to the heterogeneity of the starting population and/or culture conditions. Koch reported

the presence of dome-like, clusters of small cells as well as a fibroblast-like cell type (Koch et

al., 2007). While we observe the same morphologies, care was taken to maintain the adherent

monolayer exclusive of the foci-like colonies. Future efforts will concentrate on resolving the

identity of these divergent cellular phenotypes and their contribution to plasticity.














--U
















Figure 3-1. Foal UCB cells express stem cell marker proteins. UCB stem cells (passage 5) were
fixed and incubated with antibodies directed against Oct4, SSEA-1, Tral-60 or Tral-
81. Immunoreactivity was detected with goat anti-mouse AlexaFluor 488 or anti-
rabbit AlexaFluor 568 (Oct4). Nuclei were counterstained with Hoechst 33245. Scale
bar= 10 tm.
























B





603 bp -
310bp -

Day 7 Day 21



Figure 3-2. Induction of chondrogenesis in foal UCB stem cells. Micromass cultures were
established as described. Cell pellets were embedded in OCT freezing medium and 10
um cryosections were collected. Alcian Blue and Safranin O histology indicated the
presence of glycosaminoglycans and proteoglycans (A). Total RNA was isolated
from cells treated in an analogous manner. RT-PCR using gene-specific primers
indicated Sox9 and collagen 2A1 expression after 7 days in chondrogenic medium
(B). Sox 9 mRNA was not detected at d21. RT, reverse transcriptase.












a

a .







e.6


U


0


-


- -I T


1300 bp
603 bp
310 bp


Figure 3-3. UCB stem cells form osteocytes. UCB stem cells were maintained for 21 days in
media containing P-glycerophosphate, dexamethasone, and ascorbic acid. Cells were
fixed and stained for calcium and mineral deposition with Alizarin Red and von
Kossa. Representative brightfield images (left part) and corresponding phase contrast
fields (right part) at 200x are shown (A). Total RNA was isolated after 21 days in
osteogenic induction medium. RT-PCR using gene-specific primers for osteonectin
and RunX2 was performed. Products were separated through agarose gels and
visualized with ethidium bromide (B). RT, reverse transcriptase.































B 4 T

+ -+ +RT

1300 bp- [
603 bp -
310bp -






Figure 3-4. Foal UCB stem cells form hepatocytes. UCB stem cells were cultured for 14 days in
absence or presence of HGF and FGF4. Cells were fixed with 4% paraformaldehyde
and representative phase-contrast images were captured at 200x (A). Separate
cultures were analyzed by RT-PCR for cytokeratin 18 (CK18), albumin and
glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene expression (B). RT,
reverse transcriptase.









A
Oil Red 0O


PharD


Figure 3-5. Incomplete initiation of adipogenesis and myogenesis in foal UCB stem cells and
AdMSCs. Foal UCB and AdMSC cells were cultured in adipogenic induction media
for 21 days prior to fixation. Oil Red O histology demonstrates very few adipocytes
in foal UCB cells (A). UCB stem cells were cultured for 7 days in myogenic
induction media prior to fixation and desmin immunostaining. Arrow indicates
multinucleated cell (B). Actin filaments were detected by incubation with Texas Red-
phalloidin (C). Total nuclei were visualized with Hoechst 33245. Scale bar = 25 rim.



































Figure 3-6. AdMSC fail to express embryonic stem cell markers. AD-MSCs were fixed and
incubated with antibodies directed against Oct4, SSEA-1, SSEA-4, Tral-60 or Tral-
81. Immunoreactivity was detected with goat anti-mouse AlexaFluor 488 or anti-
rabbit AlexaFluor 568 (Oct4). Nuclei were visualized with Hoechst 33245. SSEA-1
and SSEA-4 were not detected. Scale bar = 10 im.









CHAPTER 4
REFINEMENT OF CULTURE CONDITIONS TO PROMOTE THE MAINTENANCE OF
EQUINE UMBILICAL CORD BLOOD DERIVED STEM CELLS

Introduction

Cytotherapeutic repair in horses is a proposed means of decreasing the prescribed stall

confinement period. Current strategies involve isolation of mesenchymal stem cells (MSCs)

from bone marrow (BM) aspirates or adipose tissue coupled with autologous engraftment into

the site of damage (Richardson et al., 2007; Taylor et al., 2007). Tendon lesions in horses

treated with BM MSC retained a portion of the cells at the lesion site, exhibited properly oriented

collagen fibrils and returned to exercise sooner (Pacini et al., 2007). Injection ofBM-MSCs into

damaged superficial digital flexor tendons (SDFT) demonstrates that a portion of the cells is

retained at the lesion site indicating that the improved healing is likely a product of the engrafted

MSCs (Guest et al., 2008).

MSC from equine adipose, bone marrow and umbilical cord blood efficiently differentiate

into chondrocytes and osteocytes in vitro (Fortier et al., 1998; Arnhold et al., 2007; Koch et al.,

2007; Stewart et al., 2007; Kisiday et al., 2008; Reed and Johnson, 2008). Their ability to

transform into cell types of additional lineages is limited. Under the appropriate conditions,

UCB stem cells differentiate into adipocytes (Koch et al., 2007). A limited set of hepatogenic

and myogenic markers was reported following UCB stem cell differentiation (Reed and Johnson,

2008). The reason for the restricted plasticity is unknown, but may be associated with

suboptimal culture conditions.

Implicit to the pluripotent nature of human and rodent embryonic stem (ES) cells is

expression of Oct4 and nanog (Chambers et al., 2003; Yates and Chambers, 2005; Wang et al.,

2006; Babaie et al., 2007). Loss of either factor is associated with differentiation of the

pluripotent cell. Recent evidence demonstrates that ectopic expression of Oct4, Sox2, Klf4 and c-









myc is sufficient to reprogram somatic cells into ES-like cells (Takahashi and Yamanaka, 2006;

Takahashi et al., 2007; Aoi et al., 2008; Lowry et al., 2008). Oct4 mRNA is present in MSCs

isolated from multiple tissue sources suggesting that the transcription factor participates in the

global inhibition of stem cell differentiation (Tondreau et al., 2005; Ren et al., 2006; Greco et

al., 2007). Undifferentiated equine UCB stem cells express Oct4 in the nucleus, which is lost

upon introduction of lineage decisions (Reed and Johnson, 2008).

The objective of the experiment was to refine culture conditions of equine UCB stem cells

and examine the effects of continuous culture on genetic markers of ES cell identity. Results

indicate improved UCB stem cell population doubling times (PDTs) with cultivation on matrix-

associated protein surfaces. UCB stem cells express Oct4, nanog and Sox2 immediately upon

establishment in vitro. Serial passage is associated with decreased expression of both nanog and

Sox2.

Materials and Methods

UCB Collection and Stem Cell Isolation

Cord blood was collected from the intact umbilicus of Thoroughbred foals (N= 4) at

foaling into a sterile 50 ml centrifuge tube containing EDTA (1 mg/ml) as an anti-coagulant.

UCB was stored at 40 C and putative stem cells isolated within 12 hours of collection. Samples

were incubated for 20 minutes with RosetteSep Human Cord Blood Progenitor Enrichment

Cocktail (50 pl/ml blood; Stem Cell Technologies, Seattle, WA). An equal volume of

phosphate-buffered saline (PBS) containing 2% FBS was added and the mixture was layered on

a bed of Ficoll-Paque (Sigma, St. Louis, MO). Cell aggregates were sedimented through the

density gradient by centrifugation at 1,200 X G for 20 minutes. Mononuclear cells at the

gradient interface were collected, washed with PBS and placed into culture.









Stem Cell Culture

All media, serum and supplements were purchased from Invitrogen (Carlsbad, CA) unless

otherwise noted. Murine ES cells (E14TG2a; (Thompson et al., 1989)) were cultured using a

modified procedure of that previously described (Piedrahita et al., 1992) and served as positive

controls. Briefly, ES cells were cultured in Dulbecco's modified Eagle medium (DMEM)

supplemented with 15% fetal bovine serum (FBS), 1000 units/ml leukemia inhibitory factor

(LIF), 2mM L-glutamine, 0.1 mM 2-mercaptoethanol on 0.1% gelatin coated plasticware. Cells

were passage at 70% confluence using 0.025% trypsin- ethylenediamine tetraacetic acid

(EDTA). UCB stem cells were cultured on 0.1% gelatin (Fisher Scientific, Pittsburgh, PA),

0.01% fibronectin (Sigma-Aldrich, St. Louis, MO), rat tail collagen I (5 [tg/cm2) or uncoated

tissue cultureware. Conventional UCB stem cell growth media (GM) is DMEM supplemented

with 10% FBS and 5 pg/ml plasmocin (InVivogen, San Diego, CA). Test media included GM

supplemented withl0 ng/ml FGF2 (R&D Systems, Minneapolis, MN), 1% non-essential amino

acids, 1% insulin-transferrin-selenium (GM+FGF), Iscove's modified Dulbecco's media

(IMDM) supplemented with 10% FBS, 50 ng/ml Flt3, 10 ng/ml thrombopoietin and 20 ng/ml c-

kit [GM+Flt/Tpo/Kit; (McGuckin et al., 2003)] or conditioned media (CM). CM was collected

from confluent UCB stem cells cultured in growth medium and centrifuged at 1500 x g for 10

minutes. The supernatant was retained and supplemented with 3% FBS and 5 pg/ml plasmocin.

Culture medium was exchanged every three days and cells were passage at 70% confluency

using 0.025% trypsin-EDTA. Additionally, cell number was determined daily for 4 days on

subpopulations of UCB for the calculation of PDT according to the formula N=No2(t/pdt) where N

= final cell number, No = initial cell number, t=time, and pdt= population doubling time. Phase

photographs were captured by a Nikon T200 microscope with NIS Elements software (Nikon









Instruments, Melville, NY) and converted to grayscale in Adobe Photoshop CS. Cell number was

determined by manually counting the number of attached cells in six random photographed

fields. Manual counting was employed to minimize the disruption of cell growth.

For extended passaging, UCB cells at passages three, six, and nine were plated at a density

of 2000 cells/cm2 on the appropriate substrata in either FBS or Modified FBS media. Cell

number was determined on days 0 through 4 and population doubling time was determined as

above. Cells were harvested for RNA isolation on day 4 for subsequent RT-PCR analysis. All

samples were evaluated in duplicate.

RNA Isolation, Reverse Transcription (RT) and Polymerase Chain Reaction (PCR)

Total RNA was isolated by lysis in STAT60 (Iso-Tex Diagnostics, Friendswood, TX) and

ethanol precipitation. The RNA was digested with DNase (Ambion, Austin, TX) to remove

genomic DNA contaminants. One microgram of total RNA was reverse transcribed (Superscript

III, Invitrogen, Carlsbad, CA) in 20 [tl reaction volume. Two microliters of first strand cDNA

was amplified with gene-specific primers and AccuPrime DNA polymerase (Invitrogen,

Carlsbad, CA). Primer sequences are glyceraldehyde 3-phosphate dehydrogenase (F-

GAGATCCCGCCAACATC, R- CTGACAATCTTCAGGGAATTGTC), Oct4 (F-

GCTGCAGAAGTGGGTGGAGGAAGC, R- GCCTGGGGTACCAAAATGGGGCCC), Nanog

(F- GTCTCTCCTCTGCCTTCCTCCATGG, R- CCTGTTTGTAGCTAAGGTTCAGGATG),

Sox2 (F- AACGGCAGCTACAGCATGA, R- TGGAGTGGGAGGAAGAGGTA), Klf4 (F-

TGGGCAAGTTTGTGTTGAAG, R- TGACAGTCCCTGTTGCTCAG), c-myc (F-

GACGGTAGCTCGCCCAAG, R- ACCCCGATTCTGACCTTTTG), Jagged-1 (F-

GCCTGGTGACAGCCTTCTAC, R-GGGGCTTCTCCTCTCTGTCT), Jagged-2 (F-

CATGATCAACCCCGAGGAC, R-CGTACTGGTCGCAGGTGTAG), Notch-1 (F-









GAGGACCTGGAGACCAAGAAGGTTC, R-AGATGAAGTCGGAGATGACGGC), Notch-2

(F-GCAGGAGCAGGAGGTGATAG, R-GCGTTTCTTGGACTCTCCAG), Notch-3 (F-

GTCCAGAGGCCAAGAGACTG, R-CAGAAGGAGGCCAGCATAAG), Dll-1 (F-

ACCTTCTTTCGCGTATGCCTCAAG, R-AGAGTCTGTATGGAGGGCTTC), and Dll-4 (F-

CGAGAGCAGGGAAGCCATGA, R-CCTGCCTTATACCTCTGTGG). cDNA was amplified

with the gene specific primers listed below using the following protocol: 5 minutes at 940C for

the initial denaturation followed by 40 cycles of 940C for 30 seconds, 530C for 30 seconds, and

680C for 30 seconds. Amplicons then underwent a final elongation period at 680C for 10

minutes. PCR products were visualized following electrophoresis through 2% agarose-TAE (40

mM Tris, pH 8.0, 2 mM EDTA) gels impregnated with ethidium bromide. Representative

images were captured with a Kodak ImageDoc system and inverted in Adobe Photoshop CS. All

products were verified by sequencing.

Statistical Analysis

Transcript expression was analyzed by logistic regression using the LOGISTIC procedure

in SAS (SAS Institute, Inc., Cary NC). Reference values for substrata, media, and passage were

set at uncoated, growth media, and passage three, respectively. Probability values from the

logistics procedure were obtained using WALD Chi-square statistics derived from type III

analyses of effects. Initial models included all main effects and interactions. Data were

reanalyzed after removing nonsignificant effects from the model. Chi-square probability is

reported.

Doubling time data was analyzed by ANOVA using the GLM procedure of SAS. Initial

models included all main effects and interactions. Subsequent reanalysis removed all

nonsignificant effects from the model. Passage, substrata, media and horse were tested as main









effects. Comparisons of least squares means were examined by the PDIFF option of the

LSMEANS statement. Statistical significance for all experiments was set at p<0.05.

Results

UCB Express Markers of Pluripotent Stem Cells

Equine UCB stem cells are cultured routinely in basal media supplemented with 10% fetal

bovine serum [GM; (Koch et al., 2007; Reed and Johnson, 2008)]. Under these conditions, the

majority of cells grew in a monolayer with fibroblast-like morphology (Figure 4-1A). However,

a small portion of cells formed colonies reminiscent of embryonic stem cell colonies (Figure

1B). Oct4, nanog, Sox2, Klf4 and c-myc are involved in somatic cell reprogramming to ES-like

cells and the gene products are implicated in pluripotency (Takahashi and Yamanaka, 2006;

Takahashi et al., 2007). Total RNA was isolated from mouse ES cells and equine UCB stem

cells and analyzed by RT-PCR for expression of the aforementioned gene products. As

expected, transcripts for the reprogramming genes were detected in mouse ES cells (Figure 4-

1C). In a similar manner, Oct4, nanog, Sox2, Klf4 and c-myc amplicons were present in UCB

stem cell RNA isolates. No DNA products were evident in RT-PCR reactions in the absence of

reverse transcriptase.

GM and GM+FGF Maintain UCB Proliferation

To determine the effects of culture conditions on UCB stem cell proliferation and

stemness, cells were supplemented with a number of growth factor combinations.

Supplementation of GM with FGF2 did not disrupt morphology (Figure 4-2). However, a

combination of Tpo, Flt3 and c-kit, or CM resulted in a morphology resembling cells in

replicative senescence. Cell number change over a four-day culture period was measured and

population doubling times (PDT) determined. GM and GM+FGF maintained shorter doubling









times than other cultures. GM+Tpo/Flt/Kit and CM were discontinued due to morphological

changes and a prolonged PDT and cell death.

Protein Surface Matrixes Promote UCB Growth

UCB stem cells were seeded at equal cell densities on gelatin, fibronectin, collagen and

uncoated surfaces. Cell population doubling times were calculated following four days of

culture (Table 4-1). UCB stem cells on coated surfaces demonstrated faster PDTs than controls

maintained on uncoated tissue plasticware. Changes in PDT were independent of the type of

matrix used.

Additionally, PDT was increased in cells cultured in GM+FGF (35.681.25 hr) compared

to growth media controls (27.650.74 hr; p<0.0001). The interaction of media and substrata

types demonstrated that cells cultured on any type of matrix in control media have significantly

faster doubling times than their respective cultures in media supplemented with FGF2 (Table 4-

2). Cells cultured on collagen, fibronectin, and gelatin matrices in control media exhibit no

differences in growth kinetics.

Few stem cell populations are immortal in vitro, most enter replicative senescence over

time in culture. Thus, population doubling times during continuous culture were determined at

passages three, six, and nine. Time in culture significantly increases PDT from passage three

through passage nine (21.090. 3 hr, 34.841.28 hr, and 39.061.0 hr, respectively; p<0.0001 for

all interactions). While there was no significant effect of media at passage three (p=0.1361),

later passages showed significantly shorter doubling times when cultured in control growth

media compared to GM+FGF (p<0.0001, data not shown).

Oct4 is Maintained Throughout UCB Culture

Having determined appropriate culture conditions to maintain proliferation, markers of

stemness were measured by RT-PCR. Oct4 expression is maintained over time in culture









regardless of substrata or media (Table 4-3). However, nanog and Sox2 mRNA decline with

serial passage. Expression of both genes is affected by substrata, maintaining expression longer

on a protein matrix (particularly collagen) than on uncoated plasticware. Media containing

FGF2 does not affect the maintenance of either nanog or Sox2 mRNA. The presence of nanog

transcripts was significantly different among horses, suggesting an innate heterogeneity among

animals.

Notch Signaling in UCB Stem Cells

Notch signaling plays a crucial role in cell:cell communication among mature and naive

cells. In human ES cells, constitutive Notch signaling promotes differentiation, particularly to

neural cell lineages (Lowell et al., 2006). In hematopoietic stem cells (HSCs), constitutive

activation of the Notch pathway including downstream target Hes led to an increased self-

renewal capacity of long term in vivo repopulating HSCs (Stier et al., 2002; Kunisato et al.,

2003). The Notch signaling pathway consists of a transmembrane receptor, Notch, which is

cleaved upon the binding of an extracellular ligand. The ligands for Notch are generally also

membrane bound to adjacent cells. There are three Jagged proteins and two Delta-like ligand

(Dll) proteins that serve to activate Notch signaling. Upon ligand binding, Notch undergoes a

series of proteolytic cleavages, resulting in the release of the Notch intracellular domain (NICD)

which relocates to the nucleus and acts as a transcriptional regulator.

To determine what members of the Notch pathway were present in UCB and AdMSC, and

to compare that expression with the pathway present in mES, RT-PCR was performed for

jagged-], jagged-2, notch-], notch-2, notch-2, Dll-1, and Dll-2. Mouse ES exhibited amplicons

for all transcripts examined (Figure 4-3). Notch-], Notch-3 and Jagged-] were present in UCB

stem cells, indicating the possibility for a functional pathway in these cells. However, only the









ligand Jagged-1 is found in AdMSC. This suggests that adipose derived stem cells may not be

fully capable of Notch signaling but could contribute to signaling to surrounding cells.

To identify the effects of the Notch pathway on UCB proliferation, cells were cultured for

three days in media with or without the Notch inhibitor L685,458. Cell number was determined

daily by visual inspection and manual counting. Inclusion of the Notch inhibitor had no

significant effect on cell number over the three day period (Figure 4-4). Furthermore, UCB

culture in the presence of the Notch inhibitor had no effect on the presence of Oct4, nanog, or

Sox2 as determined by RT-PCR (data not shown).

Notch signaling is mediated by the transcription factors hes and hey. The presence of hes

and hey in UCB was determined. 23A2 myoblasts were used as a positive control. No

transcript was amplified for hey, however hes transcripts were present in both cell types.

Furthermore, there appeared to be no difference in cells treated with L685,458 and control cells

of either type (Figure 4-5). To further verify this, real-time PCR was performed following three

days of treatment with the Notch inhibitor. Delta Ct values are reported in Table 4-4. No

difference in expression levels was apparent in either cell type.

To verify the efficacy of the Notch inhibitor, 23A2 myoblasts were stimulated to

differentiate. The presence of BMP6 abrogates differentiation however, this can be inhibited by

the inclusion ofL685,458. Control cells formed myotubes within 48 hours in differentiation

medium (Figure 4-6). At this time, 76% of nuclei were included in myosin heavy chain (MyHC)

expressing cells. The presence of BMP6 in differentiation media inhibited myotube formation,

with fewer than 10% of cells expressing MyHC. However, inhibition of the Notch pathway in

the BMP6 stimulated cells abrogated the effects of BMP6 and allowed a partial recovery of









differentiation. Greater than 30% of cells immunostained positive for MyHC. Supplementation

of the differentiation media with L685,458 alone had no effect on differentiation.

We conclude from these experiments that while the Notch pathway may play an important

role in differentiation of specific stem cell types, it is not crucial for the proliferation of UCB

stem cells. Furthermore, we have been unable to demonstrate that UCB stem cells have an active

Notch signaling network.

Discussion

Initial culture strategies for equine UCB stem cells involved growth on uncoated tissue

plasticware surfaces (Koch et al., 2007; Reed and Johnson, 2008) but no work has assessed the

effects of various substrata or media on the prolonged culture of these cells. Use of UCB stem

cells as injury repair aids likely will require an initial expansion in culture to provide sufficient

numbers of cells. Several media supplements were assessed for their ability to extend the

timeframe that UCB stem cells can be maintained in vitro. Expansion of human UCB stem cells

in media supplemented with thrombopoietin, Flt3 and c-kit ligand results in a population that

expresses ES-like surface markers, morphology and importantly, a delay in replicative

senescence (McGuckin et al., 2003). Passage of equine UCB stem cells in this media did not

duplicate the events and phenotypes reported for the human counterparts. Equine UCB stem

cells proliferated slowly and exhibited large nuclei with pronounced nucleoli, characteristics of

senescent fibroblasts. Close examination of the cultures indicated an absence of any cell clusters

with ES-like morphology. Because Tpo, Flt3 and c-kit were supplemented into a basal media

that supports equine UCB stem cell growth, we conclude that the growth factors are detrimental

to the routine culture and passage of these cells in vitro.

Equine UCB stem cells grown at higher densities proliferate more readily than those at

lower cell concentrations. Thus, we postulated that secreted factors may play a role in









maintaining growth kinetics in this population. Culture in conditioned media proved deleterious

to UCB stem cells, evidenced by poor growth kinetics and morphology suggestive of replicative

senescence. This suggests that the improvement seen in growth kinetics at higher cell densities

may be a reflection of cell:cell and extracellular matrix interactions rather than the paracrine

action of secreted factors.

Similar to conditioned media, FGF2 appears to be a hindrance to UCB stem cell

proliferation. FGF2 is mitogenic for MSCs isolated from adipose and bone marrow tissues

(Baddoo et al., 2003; Benavente et al., 2003; Rider et al., 2008). Treatment of mouse BM-MSC

with FGF2 causes an increase in proliferation without induction of differentiation (Baddoo et al.,

2003). Indeed, FGF2 reversibly inhibited MSC differentiation toward the adipogenic and

chondrogenic lineages. However, treatment of equine UCB stem cells with FGF2 resulted in

longer PDTs but no negative effects on the ES marker profile. The contrasting results may

represent specie and tissue source differences.

Nanog, Oct4, and Sox2 are key factors in maintaining ES cell pluripotency in addition to

being capable of inducing pluripotency in somatic cells (Takahashi and Yamanaka, 2006). In the

absence of nanog, mouse ES cells differentiate into presumptive endoderm lineages (Mitsui et

al., 2003). Oct4 is required to maintain pluripotency of the inner cell mass; loss of function

results in differentiation to trophectodermal lineages (Zaehres et al., 2005). The requirement of

Sox2 to maintain the expression of Oct4 has been demonstrated (Masui et al., 2007). These

transcripts, along with c-myc, are capable of inducing a pluripotent, ES-like state in somatic cells

(Takahashi and Yamanaka, 2006). Notably, the more differentiated adipose derived stem cells

lack expression of Nanog and Sox2 (data not shown). Expression of this panel of transcripts, as

well as population doubling time was used to monitor the stemness of UCB in different culture









conditions and over time in culture. Cells maintained Oct4 expression throughout the duration of

culture, regardless of media or substrata used. In contrast, the presence of both Nanog and Sox2

decreased with time in culture. The presence of a protein matrix prolonged expression of both

nanog and Sox2 transcripts. This was not unexpected, as most stem cells reside in a very specific

niche, a large part of which is composed of extracellular matrix. Extracellular matrix in the stem

cell niche provides not only support for adhesion, but instructive signals to maintain the naive

state (Bi et al., 1999; Chen et al., 2007). Additionally, UCB cultured on various substrata had

decreased population doubling times compared to those on uncoated plasticware. As stem cells

divide, one daughter cell may proliferate rapidly to expand the progenitor cell population while

the other divides much more slowly or not at all to maintain the stem cell population. Thus,

slowly dividing stem cells are considered to be the more naive population. However, when

cultured for use as a therapeutic aid, cultivation of UCB on a protein substrate decreased

population doubling time. This is a beneficial property when considering the expansion of these

cells in culture prior to use as a therapeutic aid. The loss of Nanog and Sox2 during extended

culture highlights the need for short expansion periods prior to use as a cytotherapeutic tool.

Interestingly, despite the increase in population doubling time of cells cultured in media

containing FGF2, there was no effect of FGF2 on the transcript profile of UCB. While FGF2

appears dispensable for the maintenance of pluripotency markers, its negative effects on

population doubling time preclude its use in media for UCB expansion.

In summary, we defined culture conditions sufficient to ensure ES-like gene expression

patterns for early passage equine UCB stem cells. These include maintenance on matrix protein

coated surfaces and cultivation in fetal bovine serum. Genetic markers of pluripotency declined









with serial passage suggesting that expansion of UCB stem cells for therapeutic purposes is

limited under the current culture conditions.














GMI GM\I + FGF


GM +
Flt/Tpo/Kit


CM


Figure 4-1. GM and GM+FGF support equine UCB stem cell propagation. UCB stem cells
cultured in GM and GM+FGF have faster doubling times than those grown in GM
containing thrombopoietin(tpo), Flt3, and c-kit, or UCB conditioned media.
Population doubling times are presented below their respective phase photograph in
hours SEM. Scale bar = 10 tm. GM = growth media; GM + FGF = growth media
containing FGF2; GM + Tpo/Flt/kit = growth media containing thrombopoietin, Flt3,
and c-kit; CM = conditioned media.










Table 4-1. Effect of substrata on equine UCB1 derived stem cell population doubling time


Substrata2 PDT3 SEM4 Con Gel
Con 35.91 1.89 --- <0.000
Gel 30.67 1.38 -
Fib 29.72 1.34 -
Col 30.36 1.44 --- --
UCB = umbilical cord blood
2 Con= uncoated, Gel = gelatin, Fib = fibronectin, Col = collagen
3 PDT= population doubling time in hours, N=No2(t/pdt) where N
initial cell number, t=time, and pdt= population doubling time
4 SEM = Standard error of the mean


P-value
Fib Col
1 <0.0001 <0.0001
0.3633 0.7634
--- 0.5427
--- ---


final cell number, No









Table 4-2. Effect of substrata and media on equine UCB1 derived stem cell doubling time
P-value
Con Gel Fib Col
Substrata 3 4 5 COn
2 Media3 PDT4 SEM5 GM+FG Gel GM GM+FG Fib GM GM+FG Col GM GM+FG
GM
F F F F
Con GM 30.07 1.59 --- <0.0001 0.0628 0.0079 0.0370 0.1055 0.0091 0.0029
GM+FG
Con GM+FG 41.74 3.01 --- --- <0.0001 <0.0001 <0.0001 <0.0001 <0.0001 <0.0001
F
Gel GM 27.32 1.50 --- --- --- <0.0001 0.8187 0.0006 0.4463 <0.0001
GM+FG
Gel GM+FG 34.01 2.14 --- --- --- --- <0.0001 0.2908 <0.0001 0.7366
F
Fib GM 26.99 1.57 --- --- --- --- --- 0.0003 0.5941 <0.0001
GM+FG
Fib GM+FG 32.46 2.05 --- --- --- --- --- --- <0.0001 0.1643
F
Col GM 26.21 1.18 --- --- --- --- --- --- --- <0.0001
GM+FG
Col GMFG 34.50 2.38 --- --- --- --- --- ---
F


1 UCB=umbilical cord blood
2 Con= uncoated, Gel = gelatin, Fib = fibronectin, Col = collagen
3 GM = growth media, GM+FGF = growth media + FGF2
4 PDT= population doubling time in hours, N=No2(t/pdt) where N
population doubling time
SEM = Standard error of the mean


= final cell number, No = initial cell number, t=time, and pdt=



















(+ ~F4


500bp.


200bp.





500bp-


200bp.


Figure 4-2. Equine UCB stem cells express markers of embryonic stem cell pluripotency. RT-
PCR was performed on mouse embryonic (n=l, in triplicate) and UCB stem cell
(n=4, in duplicate) total RNA using primers specific for Oct4, nanog, Sox2, KLF4
and c-myc transcripts. Both populations of stem cells express transcripts for the
reprogramming genes. UCB = umbilical cord blood stem cells; mES = mouse
embryonic stem cells. Representative photo shown.









Table 4-3. Effects of horse, passage, media and substrata on mRNA expression
P-value
mRNA Horse Passage Media Substrata
Oct4 0.3535 0.6441 1.0000 0.4272
Nanog 0.0004 0.0001 0.3018 0.0001
Sox2 0.0823 <0.0001 0.5343 0.0574





















603bp-
310 bp





603bp-
310 bp


I



...





g em:


Figure 4-3. UCB and AdMSC express a limited number of molecules in the Notch signaling
pathway. RT-PCR was performed for the transcripts listed. mES = mouse embryonic
stem cells, UCB = umbilical cord blood derived stem cells, AdMSC = adipose
derived stem cells









1200- cTL
1000- ANI
800-
2l 600-
( 400
200

Oh 24 h 48 h 72 h

Figure 4-4. Inhibition of the Notch signaling pathway does not affect proliferation. UCB stem
cells were cultured in the presence or absence of L685,458 for three days. Cell
number was counted daily. CTL = control cells, NI = cells supplemented with
L685,458









UCB


23A2


Con NI Con NI
N C
c~'~I c~-2~ R


500bp
300bp-


Figure 4-5. UCB and 23A2 myoblasts express hes. RT-PCR for the transcripts listed was
performed on RNA isolated from cells treated with the Notch inhibitor, L685,458.
UCB = umbilical cord blood derived stem cells, Con = control, no inhibitor, NI =
cells supplemented with L685,458.









Table 4-4. Delta Ct values for hes realtime PCR.
Cell Type Treatment dCt 2

23A2 CTL 6.54 0.8
23A2 NI 7.56 0.24
UCB CTL 12.36 0.08
UCB NI 11.11 0 15
1 CTL = control, NI = cells supplemented with L685,458
2 dCt = Delta cycle threshold value standard error of the mean









Control


BMP6 L685,458 BMP6 + L685,458


SMyHC


E Hoechst


76% 7.9% 86% 35% %MyH
(+)nuclei

Figure 4-6. BMP6 inhibits myoblast differentiation in a Notch dependent manner. 23A2
myoblasts were placed in differentiation media in the presence or absence of 50 ng/ml
BMP6 and/or the Notch inhibitor L685,458. Cells were fixed after 48 hours and
immunostained for myosin heavy chain. Images were captured at 200x. The percent
of cells expressing myosin heavy chain was determined and is reported below its
respective panel. MyHC = myosin heavy chain









CHAPTER 5
CULTURE OF EQUINE UMBILICAL CORD BLOOD AND ADIPOSE DERIVED STEM
CELLS TO PROMOTE TENOCYTIC DIFFERENTIATION

Introduction

Tendons are the elastic structures that connect muscle to bone. These fibrous structures

provide tensile strength during normal movement as well as during strenuous exercise. Tendon

damage is a significant problem in the horse race industry. In the United Kingdom, nearly one

half of all injuries are related to failed tendon and ligament function (Pinchbeck et al., 2004).

The superficial digital flexor tendon (SDFT) is the anatomical and functional equivalent of the

Achilles tendon in humans (Dowling et al., 2000). Historical approaches to SDFT repair are

based upon rest and gradual reintroduction to work (Goodship et al., 1994). Recovery times

typically are greater than 6 months and the animals are prone to reinjury due to fibrocartilage

scar tissue formation (Clegg et al., 2007). Current efforts to improve repair rates and strengthen

regenerated tendons include injection of bone marrow and adipose derived MSCs (Taylor etal.,

2007). Anecdotal evidence suggests that these reagents are beneficial but no conclusive data

exists. Mononuclear cells isolated from adipose tissue improved tendon architecture when

implanted into collagenase induced lesions but resulted in no differences in the rate or quality of

repair (Nixon et al., 2008).

Scleraxis is a class II basic helix-loop-helix transcription factor expressed early during

mouse embryogenesis in the syndetome, a derivative of the somitic sclerotome compartment

(Cserjesi et al., 1995; Brent et al., 2003). Expression is associated with connective tissue and

skeleton structures during prenatal development and with periodontal ligaments, force generating

tendons, brain, lung and Sertoli cells in adult rodents (Liu et al., 1996; Perez et al., 2003; Muir et

al., 2005; Murchison et al., 2007; Pryce et al., 2007). Genetic ablation ofscleraxis is embryonic

lethal prior to gastrulation with an absence of mesoderm (Brown et al., 1999). Using transgenic









reporter-scleraxis mice, expression of the transcription factor is largely confined to tendons early

in postnatal development and absent in the structures as they become acellular (Pryce et al.,

2007). Conditional ablation of scleraxis in the developing limb of mice produces an animal

with missing tendons in the limb; a few tendons are present but small in size (Murchison et al.,

2007). Of importance, scleraxis null animals contain no flexor tendons. In vitro work in tendon

fibroblasts suggests that scleraxis and NFATc cooperatively regulate the activity of the Collal

proximal promoter (Lejard et al., 2007). Overexpression of scleraxis in primary cardiac

fibroblasts significantly increased the production of Colla2 through direct binding with the

Colla2 promoter region (Espira et al., 2009). These data suggest a directive role of scleraxis in

the formation of mature tenocytes.

Members of fibroblast growth factor (FGF) family regulate transcription of scleraxis.

FGFs produced by the myotome supply a paracrine signal that allows formation of the

sclerotome and syndetome (Brent and Tabin, 2004). Exogenous FGF4 induces scleraxis and

tenascin C mRNA in the developing chick limb (Edom-Vovard et al., 2002). FGF8 can

substitute partially for myotome suggesting that this FGF is important for tendon progenitor

formation. Ectopic expression of RCAS-FGF8 resulted in an upregulation of scx, tnmd and type

1 collagen in the intermuscular tendons associated with visceral smooth muscle cells (Le Guen et

al., 2009). Signals transmitted in response to FGF4 and FGF8 include increased activity of

MEK1, a requisite kinase for scleraxis expression (Smith et al., 2005). Ectopic expression of

FGF5 in the developing chick inhibited muscle enlargement and promoted proliferation of

tenasin expressing fibroblasts in the hind limb (Clase et al., 2000). Ectopic expression of kinase

defective FGF receptor or constitutive active mitogen activated protein kinase phosphatase 3

(MKP3) inhibits scleraxis transcription in chick embryos. The downstream target of elevated









extracellular regulated kinase 1 and 2 (ERK1/2) may be the Ets transcription factor, PEA3 (Brent

and Tabin, 2004). Retroviral mis-expression of PEA3 in chick embryos causes transcription of

scleraxis; ectopic dominant inhibitory PEA3 represses scleraxis expression.

The objective of this experiment was to examine scleraxis and tenascin C mRNA

expression in equine umbilical cord blood (UCB) stem cells and equine adipose-derived

mesenchymal stem cells (AdMSCs) in response to FGF treatment. Results demonstrate that

UCB stem cells and AdMSCs express scleraxis and tenascin C. Culture in matrigel upregulated

expression of both transcripts. UCB stem cells treated with FGF2 or FGF5 causes an increase in

MEK-dependent phosphoERKl/2, although with different activation kinetics. Scleraxis mRNA

content was measured following 48 hours of treatment with either FGF2 or FGF5. Neither

caused an increase in sex over that seen on matrigel alone. However, TnC expression was

increased in AdMSC cultured with FGF2 or FGF5.

Materials and Methods

Stem Cell Culture

Umbilical cord blood stem cells (UCB) were cultured on plastic tissue culture plates coated

with 0.1% gelatin (Fisher Scientific, Pittsburgh, PA) in Dulbecco's Modified Eagle Medium

supplemented with 10% fetal bovine serum (FBS; Invitrogen, Carlsbad, CA) and 5 tg/ml

Plasmocin (InVivogen, San Diego, CA). Equine adipose derived cells (AdMSC) were purchased

from ScienCell (Carlsbad, CA). Cells were cultured on 0.1% gelatin coated tissue culture plates

in Mesenchymal Stem Cell Medium (ScienCell) according to manufacturer's recommendations.

Cells were passage at 70% confluency using 0.025% trypsin-EDTA. Three dimensional

cultures were achieved by growing cells on Cytodex3 collagen coated beads (Invitrogen) or

allowing cells to embed into 30% Matrigel (BD Biosciences, San Jose, CA).









Plasmids and Transfections

The 500 base pair minimal promoter of the mouse scleraxis gene was amplified from

C2C12 myoblasts with specific primers (F:CACACGGCCTGGCACAAAAGACCC

R:TTCGGACTGGAGTGGGGCCGCCAGC). Following sequencing to verify the identity of

the product, the promoter was cloned into the TOPO Zero Blunt vector prior to subcloning into

the pGL3 basic vector such that promoter activity would drive the expression of luciferase (Scx-

luc). C2C12 mesenchymal cells and UCB stem cells in 12 well plates were transiently

transfected with 250 ng Scx-luc and 25 ng pRL-tk, a Renilla luciferase plasmid, as a monitor of

transfection efficiency using FuGene 6.0. Media was replaced after 6 hours to include 50 ng/ml

BMP6, 10 ng/ml FGF4, or 10 ng/ml FGF5. Cells were passively lysed in luciferase lysis buffer

after 24 hours of culture and luciferase activities measured (Dual-Luciferase Reporter kit,

Promega, Madison, WI). Scx-luc activity was corrected for pRLtk activity. The mouse minimal

Scleraxis promoter was sequence verified. Analysis of the sequence by the Transcription

Element Search System (TESS, http://www.cbil.upenn.edu/cgi-bin/tess) revealed the presence of

several putative transcription factor binding sites.

Confocal Microscopy

UCB and AdMSC cultured on gelatin, matrigel, and collagen beads were fixed in 4%

paraformaldehyde for 15 minutes. Cells were permeabilized with 0.1% TritonX100 in phosphate

buffered saline (PBS) supplemented with 5% FBS. Actin filaments were visualized using

fluorescein conjugated phalloidin (Invitrogen) and nuclei were stained with Hoechst 33342. All

immunofluorescence work was completed on glass bottom plates to aid microscopy. Confocal

microscopy was performed on a Leica TCS SP5 Laser Scanning Confocal Microscope running

Leica LAS-AF software for instrument control and image analysis. Images were adjusted for

brightness and contrast in Adobe Photoshop CS.









Protein Isolation and Evaluation

Equine UCB and AdMSC were treated with 10 pg/ml protamine sulfate for 10 minutes to

remove signaling molecules from the extracellular matrix. Cells were placed in serum free

media for one hour prior to stimulation with FGF2, FGF4, or FGF5 in the presence or absence of

the MEK inhibitor PD98059. Cells were lysed directly into SDS PAGE sample buffer. Protein

was loaded based on equal cell number and electrophoresed across a 10% polyacrylamide gel.

ERK1/2 activity was assessed using phospho- and total-ERK1/2 antibodies (Cell Signaling

Technologies, Danvers, MA). Briefly, proteins were transferred to nitrocellulose and non-

specific binding sites were blocked with 10% non-fat dry milk in TRIS-buffered saline

supplemented with 0.1% Tween20 (TBS-T). Blots were incubated overnight at 4 OC with

primary antibody (1:1000) in blocking solution. Following extensive washing, blots were

incubated with secondary antibody (1:2000). Equal protein loading was ensured by probing

membranes with anti-tubulin (Abcam, Cambridge, MA) for one hour (1:2000) followed by

incubation in secondary antibody for one hour (1:5000) prior to visualization. Immune

complexes were visualized by chemiluminescence (ECL; GE Life Sciences, Piscataway, NJ) and

autoradiography.

Assessment of Proliferation

Cells were seeded at equal density and cultured in low serum medium (2% FBS)

supplemented with FGF2, FGF4 or FGF5 in the presence or absence of PD98059 for 48 hours.

Prior to fixation, cells were pulsed with 10 [iM bromodeoxyuridine (BrdU) for two hours.

Proliferation index was determined as the proportion of cells expressing BrdU:total cell number.

All experiments were performed on UCB collections from four horses in duplicate wells with

two replicate experiments.









RNA Isolation, Reverse Transcription, and Polymerase Chain Reaction

Total RNA was isolated by lysis in STAT60 (Iso-Tex Diagnostics, Friendswood, TX) and

passed over RNeasy Mini columns (Qiagen, Valencia, CA). The RNA was digested with DNase

(Ambion, Austin, TX) to remove genomic DNA contaminants. One microgram of total RNA

was reverse transcribed (SuperScript III, Invitrogen) in 20 pl reaction volume. Two microliters

of first strand cDNA was amplified with gene-specific primers and AccuPrime DNA polymerase

(Invitrogen). Primer sequences are listed in Table 5-1. PCR products were visualized following

electrophoresis through 2% agarose gels impregnated with ethidium bromide. Representative

images were captured with a Kodak ImageDoc system and inverted in Adobe Photoshop CS.

Quantitative PCR

Complementary DNA reverse transcribed from 1 [g of total RNA was amplified with

SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA) and the appropriate

forward and reverse primers (Table 5-1; 20 pM) in an ABI 7300 Real-Time PCR System

(Applied Biosystems). Thermal cycling parameters included a denature step of 95C for 10 min

and 50 cycles of 15 s at 95.00C and 1 min at 60.00C. A final dissociation step included 95C for

15 s, 55C for 30 s, and 95C for 15 s. Serial dilutions of pooled samples were used to generate

standard curves to ensure generation of cycle threshold values that were within the linear range of

amplification (Castellani et al., 2004). Cycle threshold value ranges for each transcript are

reported in Table 5-2.



Results

AdMSC and UCB Express Markers of Tenocytic Cells

Immature tenocytes express the transcription factor scleraxis prior to the upregulation of

more mature markers such as tenascin C and collagen 1A2. To evaluate adipose and umbilical









cord blood derived stem cells for tenocytic markers, RT-PCR was performed using gene specific

primers for scleraxis and tenascin C. Messenger RNA for both transcripts were present in both

adipose and umbilical cord blood derived stem cells (Figure 5-1). Transcripts were sequenced to

verify identity.

Scleraxis Minimal Promoter Activity

The mouse minimal scleraxis promoter was sequence verified. Analysis of the sequence

by the Transcription Element Search System (TESS, http://www.cbil.upenn.edu/cgi-bin/tess)

revealed the presence of several putative transcription factor binding sites. The list of binding

sites with p-values less than or equal to 0.01 is presented in Table 5-3. Figure 5-2 shows a

schematic of the promoter highlighting potentially important regulatory sites. Of particular

interest is the presence of POU factor, Hes, SP1, and API binding sites. A Klf4 binding site is

present at base pair 35, but is not included on the list as the p-value was given as 0.011.

However, there were multiple sites strongly recognized in a small region lending strength to this

prediction and its inclusion on the figure.

UCB stem cells show much lower basal levels of scleraxis promoter activity than do

C2C12s (Figure 5-3). Supplementation of C2C12 cells with BMP6 reduced luciferase

expression driven by the scleraxis promoter. FGF4 and FGF5 had no effect on the scleraxis

promoter in these cells. Scleraxis promoter activity in UCB stem cells appears to be unaffected

by supplementation with BMP6, FGF4 or FGF5. This may be due to the low basal level of the

minimal promoter's activity. Other transcription factor binding sites may be required for full

activity of this promoter in this environment.

Downstream effectors of FGF signaling include the transcription factors Pea3 and Erm.

Activation of Pea3 and Erm is required for scleraxis expression in the developing somite (Brent

& Tabin). Thus, we examined the presence of these factors by RT-PCR in UCB stem cells. RT-









PCR was performed as previously described. UCB stem cells express Pea3 and Erm in addition

to scleraxis (Figure 5-4).

AdMSC and UCB Survive on Various Matrices

The three dimensional environment of a tissue results in different mechanical stresses and

cell contacts which can signal for specific cell identities. To investigate the effects of various

matrices, UCB and AdMSC were cultivated on gelatin coated plasticware, collagen coated

beads, or allowed to embed into 30% Matrigel for 48 hours (Figure 5-5). Cells were fixed in 4%

paraformaldehyde and stained with fluorescein conjugated phalloidin to visualize actin structures

and Hoechst 33342 to label nuclei. Stem cells grown on gelatin existed in a monolayer and

exhibited morphology typical of fibroblasts and MSC with visible actin filaments. Incorporation

into a 30% Matrigel resulted in the formation of colonies with compact structure. Cells show

fewer stress fibers but maintain filopodia that extend into the surrounding matrix. Culture on

collagen beads results in cells which resemble those on gelatin, albeit with apparently smaller

amounts of cytoplasmic volume. No differences in morphology were noted between cells

derived from adipose or umbilical cord blood.

Culture in Matrigel Increases Tenocyte Gene Expression

To evaluate the effects of different culture matrices on tenocyte gene expression, AdMSC

and UCB were cultured for 48 hours on gelatin, collagen coated beads, or matrigel prior to RNA

extraction. Realtime PCR revealed increases in scleraxis mRNA in both AdMSC and UCB

when cultured on matrigel (39.48 and 6.73 fold, respectively, p<0.0001; Figure 5-6). Scleraxis

transcripts were decreased in AdMSC grown on collagen coated beads (p<0.0001). Culture on

matrigel increased tenascin C expression 12.32 fold in AdMSC but not in UCB (p<0.0001).









Fibroblast Growth Factors Elicit Differing ERK1/2 Responses in UCB and AdMSC

Not only can FGF stimulation promote mitogenesis in stem cells, but FGF signaling

through the MAPK pathway can lead to downstream regulation of scleraxis and tenascin C.

Thus, the ERK1/2 response was examined in UCB and AdMSC following stimulation by FGF2,

FGF4, or FGF5. FGF2 elicited ERK1/2 phosphorylation in both cell types, albeit with differing

activation kinetics (Figure 5-7). FGF4 did not activate pERK1/2 in UCB, however was

responsible for a slight activation in AdMSC. Further experiments with FGF4 were discontinued

due to lack of a MAPK response in UCB. Stimulation with FGF5 elicited a transient response in

both AdMSC and UCB with similar kinetics. These results indicated that both UCB and AdMSC

are capable of downstream signaling elicited by the fibroblast growth factors.

The mitogenic effects of the fibroblast growth factors have been shown in adipose and

bone marrow derived stem cells. To clarify the effect of the fibroblast growth factors on UCB

and AdMSC proliferation, cells were cultured for 48 hours in media supplemented with FGF2 or

FGF5 in the presence or absence of the MEK inhibitor PD98059 (Figure 5-8). Cells were pulsed

with BrdU prior to fixation and quantification. Similar to bone marrow derived stem cells,

AdMSC increased proliferation when cultured in the presence of FGF2. This effect was

abrogated by the presence of PD98059. In contrast, supplementation of FGF2 to UCB retarded

BrdU incorporation in a MAPK dependent manner. Supplementation of AdMSC with FGF5

inhibited proliferation, contrasting with the increased proliferation of UCB. Inclusion of the

MEK inhibitor PD98059 reversed the effects of FGF5 in both cell types.

To determine the combined effects of three dimensional culture and stimulation of the

fibroblast growth factors on stem cell identity, UCB and AdMSC were cultured on gelatin,

collagen beads and matrigel and stimulated with FGF2 or FGF5 for 48 hours. Real-time PCR

was used to quantify changes in sex and TnC expression. UCB cultured on matrigel express









higher levels of sex (p<0.0001; Figure 5-9A). However, Sex tended to be decreased by

supplementation with FGF2. Levels of TnC mRNA are unaffected by culture on different

matrices or the inclusion of FGF2 or FGF5 (Figure 5-9B).

In AdMSC, sex expression was increased by culture in matrigel but decreased by culture

on collagen beads (p<0.0001; Figure 5-9C). When cultured on gelatin or matrigel, FGF5

supplementation increased TnC transcription in AdMSC (p<0.0001). Inclusion of FGF2 in the

culture media of cells grown in matrigel increased TnC transcription but to a lesser extent than

caused by FGF5 (Figure 5-9D). Inhibition of the MAPK signaling pathway by PD98059 did not

reverse the changes in scleraxis or tenascin C mRNA caused by FGF2 or FGF5 stimulation in

adipose or umbilical cord blood derived stem cells (data not shown).

Effect of FGF5 Supplementation on Actin Structure

To determine if FGF5 supplementation resulted in changes in cell morphology and actin

structure, UCB were stripped of extracellular signaling molecules using 10 [tg/ml protamine

sulfate for 10 minutes. Cells were placed in serum free media for one hour prior to the addition

of 10ng/ml rhFGF5 or growth media. Those cells receiving neither growth media nor FGF5

were used as controls. UCB stem cells were fixed in 4% paraformaldehyde at times 0, 10, and

30 minutes of treatment prior to permeabilization with 0.1% TritonX100 in phosphate buffered

saline (PBS) supplemented with 5% FBS. Actin filaments were immunostained with fluorescein

conjugated phalloidin and Hoechst 33342. Morphology was visualized using a Nikon T200

microscope equipped with epifluorescence. Images were captured with NIS Elements (Nikon

Instruments, Melville, NY) software and compiled with Adobe PhotoShop CS.

No appreciable differences were visible in UCB receiving any treatment (Figure 5-10). All

cells maintained similar sizes. No treatment resulted in the formation of extensive filopodia or









stress fibers. Thus, we conclude that FGF5 supplementation does not have an immediate effect

on UCB actin structure.

Response of the PI3K Pathway to FGF2 and FGF5 Supplementation

To determine if FGF2 or FGF5 may be signaling through the phosphoinositol-3 kinase

pathway, an alternative to ERK1/2, we examined the expression of phosphorylated and total Akt

following stimulation with 10 ng/ml of either FGF2 or FGF5. Akt is a downstream effector of

PI3K signaling which requires phosphorylation on threonine 308 and serine 473. Western blots

were performed as previously described following treatment with FGF2 or FGF5. No

phosphorylated Akt was present at any time point following FGF2 or FGF5 supplementation

(Figure 5-11). Total Akt was maintained at similar levels throughout the experiment. This

suggests that FGF2 and FGF5 are not activating the PI3K pathway.

In conclusion, we demonstrate that AdMSC and UCB react differently to various matrices

and growth factors. To maintain an immature tenocyte-like cell, the appropriate culture

conditions for UCB appear to be culture on matrigel in the absence of any FGF supplementation.

Culture of adipose derived stem cells on matrigel in culture medium supplemented with FGF2

promotes proliferation of an early tenocyte-like phenotype.

Discussion

This work highlights the differences between adipose and umbilical cord blood derived

stem cells. Previously, we have shown that equine AdMSC express fewer stem cell markers and

possess a more limited ability to differentiate compared to UCB (Reed and Johnson, 2008).

AdMSC proliferate more rapidly than UCB regardless of the surface substrate (Reed and

Johnson, unpublished data). This suggests a difference in regenerative capabilities as more naive

stem cells often have longer population doubling times than more differentiated cells. Few

studies have directly compared the two populations in vitro and to date, none have compared









their in vivo ability to assist regeneration. Adipose derived mononuclear cells were capable of

improving tendon architecture but not biomechanical properties in a collagenase induced lesion

of the SDFT (Nixon et al., 2008). No studies have been completed at this time identifying the

contribution of UCB to tendon injury. Transplantation of bone marrow derived stem cells into

tendon lesions results in decreased lesion size and greater tendon density (Crovace et al., 2007;

Pacini et al., 2007). Because of the innate expression of both scleraxis and the stem cell markers

Oct4, nanog, and Sox2, UCB stem cells may provide a better source of regenerative stimulus

than adipose derived cells.

The beneficial effects of stem cells in tendon injury may be due to the population of cells

expressing scleraxis. Bone marrow, adipose and umbilical cord blood derived stem cells express

this transcription factor prior to any in vitro manipulation ((Kuo and Tuan, 2008), Figure 1). In

AdMSC and UCB, upregulation of scleraxis occurred in response to culture on matrigel. Culture

in a three dimensional gelatin environment also upregulated sex in BMSC (Kuo and Tuan, 2008).

Expression of scleraxis precedes that of tenascin c and collagen la2 in the developing embryo

(Kardon, 1998; Schweitzer et al., 2001). Overexpression of scleraxis increased the transcription

of colla2 inNIH-3T3 fibroblasts (Lejard etal., 2007; Espira etal., 2009). Scleraxis appears to

bind to the proximal promoter region of colla2 as a heterodimer with E47 (Lejard et al., 2007).

Expression of Colla2 increases in AdMSC and UCB grown on matrigel (data not shown). These

data suggest that the upregulation of scleraxis is consistent with the induction of an early tendon-

like cell which expresses tenascin c and collagenla2 as it matures. Scleraxis may, in fact, drive

the expression of the more mature markers of tendon development. The population of cells that

initially express scleraxis may give rise to daughter cells which express scleraxis and further

differentiate to more mature tenocytic cells under appropriate conditions.









Fibroblast growth factors are required for proper syndetome formation and induction of

tenocytic lineage. As such, the response of adipose and UCB derived stem cells to FGFs was

investigated. In this work, we show that AdMSC and UCB respond very differently to

stimulation by the FGFs. Interestingly, stimulation of AdMSC and UCB with FGF2 or FGF5

resulted in opposing effects on proliferation but similar ERK1/2 activation kinetics. Changes in

proliferation were dependent upon ERK1/2, as inclusion of PD98059 abrogates all differences.

These differences are likely due to different cellular contexts and possibly different FGF receptor

expression. FGF2 can signal through a number of FGF receptor isoforms, however FGF5 is more

limited and can only signal through FGFR1c and FGFR2 (Reviewed in Clements et al., 1993;

Eswarakumar et al., 2005). It is possible that the differences in response to the fibroblast growth

factors may also occur because of variations in ERK1 and ERK2 ratios, priming the cells toward

proliferation or differentiation. AdMSC tended to express lower amounts of ERK1 relative to

ERK2 than UCB stem cells. It is tempting to speculate that the ratio of ERK1 :ERK2 is related to

the stemness of the population and the subsequent ability to respond to external signals. AdMSC

may express more ERK2 in order to respond to factors signaling for terminal differentiation.

Alternatively, UCB may have higher levels of ERK1 to retain the ability to respond to both

proliferation and differentiation signals to allow self-renewal of the stem cell population as well

as creation of daughter cells primed to differentiate. As might be expected, activation of ERK1

was also reduced compared to ERK2 phosphorylation following FGF stimulation in both cell

types. This may be a preferential response of the cells to growth factors or simply due to kinase

availability.

When cultured on matrigel, sex expression increases drastically in both UCB and AdMSC.

Matrigel is composed of a mixture of growth factors (including IGF-1, PDGF, TGF-P, and EGF)









and extracellular matrix components laminin, collagen IV and entactin, which form a complex

three dimensional matrix at 37 C. Entactin enables the binding of laminin to collagen IV and

the formation of a complex structural matrix. Both AdMSC and UCB embedded into the

matrigel and formed colonies with distinct cellular morphology compared to cells on gelatin or

collagen coated beads. The differences in cell:cell contact or contact with a complex ECM may

be responsible for the upregulation of tenocytic genes. Integrin signaling activated by changes in

ECM can result in differentiation of a number of stem cell types. Integrin signaling was activated

by culture of hES cells on laminin and was related to an increase in ERK1/2 activation and

subsequent decrease in Nanog and SSEA1 expression (Hayashi et al., 2007). Laminin signaling

through alpha6/betal integrin may direct neural differentiation of hES cells (Ma et al., 2008).

Additionally, in the kidney alpha3/betal integrin signaling in coordination with c-Met regulates

Wnt expression, which is responsible for epithelial cell survival in the developing kidney (Liu et

al., 2009). Activation of integrin mediated RhoA and Rho-dependent kinase (ROCK) via cyclic

strain resulted in the upregulation of tenascin C in primary skin fibroblasts (Chiquet et al., 2004).

While no strain was applied to either AdMSC or UCB, the change in tension from a flat to a

three dimensional surface may have been significant enough to activate the integrin signaling

system. The ability of UCB to upregulate scleraxis in a complex environment supports the use

of these cells as a therapeutic aid. Tendons are composed primarily of type I collagen as well as

other minor collagen and non-collagen components. Initial tendon injuries are poorly organized

but gain structure during the healing process. UCB implanted into tendon injuries should be

capable of attachment to the tendon matrix and production of collagen and other matrix proteins.

The additional strain that occurs with movement may provide additional direction for UCB to

produce the required matrix proteins for proper healing.









In conclusion, we have further delineated the differences between adipose and umbilical

cord blood derived stem cells. While both cell types upregulate scleraxis expression in response

to culture on matrigel, they respond very differently to stimulation with fibroblast growth factors.

We have established culture conditions appropriate to induce an early tenocytic lineage. Further

work should clarify the mechanisms behind such changes.










Table 5-1. Real-time PCR primers
Expected Standard Primer
Product Curve Efficiency,
Primer Sequence Size, bp Slope %
CollA2 F GCACATGCCGTGACTTGAGA 127 -3.39 97.24
R-CATCCATAGTGCATCCTTGATTAGG
TnC1 F GGGCGGCCTGGAAATG 70 -3.34 99.25
R CAGGCTCTAACTCCTGGATGATG
ScxB1 F TCTGCCTCAGCAACCAGAGA 59 -3.35 98.84
R TCCGAATCGCCGTCTTTC
Scx2 F AGGACCGCGACAGAAAGAC 261 n/a n/a
R CAGCACGTAGTGACCAGAAGAA
18S1 F GTAACCCGTTGAACCCCATT 151 -3.35 98.84
R -CCATCCAATCGGTAGTAGCG
Pea32 F GTGGCAGTTTCTGGTGGCCCTG n/a n/a
R GACTGGCCGGTCAAACTCAGCC
Erm2 F GAGAGACTGGAAGGCAAAGTC n/a n/a
R CCCAGCCACCTTCTGCATGATGC
(Taylor et al., 2009)
2 Used for endpoint PCR only.









Table 5-2. Cycle threshold ranges
Cell Type Transcript Mean SEM Min Max Median
UCB 18S 13.72 0.06 13.15 15.59 13.59
UCB Scx 30.72 0.21 27.13 33.77 30.71
UCB TnC 21.89 0.29 18.67 28.20 21.27
AdMSC 18S 13.59 0.06 13.13 14.18 13.57
AdMSC Scx 31.19 0.55 27.10 34.31 31.54
AdMSC TnC 22.33 0.64 18.44 25.65 23.10












UCB

^ ^ %P


AdMlSC

4A


1000 bp-
500 bp-


100 bp-


Figure 5-1. AdMSC and UCB express markers oftenocytic cells. Total RNA was isolated from
AdMSC and UCB prior to PCR with gene-specific primers. Scleraxis and Tenasin C
mRNA are present in AdMSC and UCB stem cells. Scx, scleraxis; TnC, Tenascin C.















SP1 Klf4
5'AGCAGTCAGC TCCTOCCCCG CGCCTGGCCT CCGCCTCCCTTTCTGGCCTG
Hesl
GAGGAGTTTA CTCAGAGCTC GTGCGTGCAC CTTTTCCCTT TTAATAGCCG

TGCCTAGAGG GCCCCCGAGC ATCTTTCTGG TTGGAGCGTT TCTGGGGTGC

TACTAGTGCC CCAAGACAAT GGTGCCCATC CCACCCATTC TACAGGGCAG
POUlfla
AAGAGAATAAATCAAGAATC AAGAGGCTTT CTCTCCTGGC ATGCCTAAGT
AP-1
TCACCCAGCT GCCCTGGCCC TGAGTGCCTG GCCACACCCT GTCTGACTCT

CCTTCCATGT GCACTTGGGT CTTTTGTGCC AG 3'


Figure 5-2. Mouse scleraxis promoter with putative transcription factor binding sites. The
minimal promoter is shown with putative transcription factor binding sites
highlighted in bold.









Table 5-3. Putative transcription factor binding sites on the mouse scleraxis minimal promoter1.


Factor
Spl
EGR2
Spl
Spl
Spl
Spl
Spl
Spl
Spl
POU1Fla
GAGA factor
Spl
Spl
Spl
CACCC-binding factor
Sn
Spl
HNF-3B
AP-2alpha
AP-2alpha
TEF-2
HNF-4alpha
AREB6
AP-2
AP-2alpha
AP-1
PuF
AP-1 c-Jun
CP2
Nkx6-1
MEF-2
myogenin
En-1
AP-1 c-Fos c-Jun
GATA-1 Spl
GCN4
ZF5
CACCC-binding factor
FACB
POU3F2
GR
USF1 HES-1
Spl
RAPID


Beg2
288
286
283
330
289
289
37
270
289
92
169
270
17
37
16
222
288
87
278
24
18
53
223
284
284
243
121
7
170
210
210
26
114
7
121
299
283
121
30
95
54
234
107
317


Sns3
N
R
R
N
N
N
N
R
R
R
N
R
N
R
R
R
N
N
R
R
N
R
R
R
R
N
N
N
N
N
R
R
N
R
R
R
N
N
R
R
N
N
R
R


Len4
11
10
10
10
10
10
10
9
10
10
16
10
10
10
10
11
10
12
8
8
8
12
8
7
10
7
7
7
11
7
10
7
7
7
7
6
6
6
17
7
6
6
6
10


Sequence
GtGGGAGGAGC
GCGGGGGcGG
GGgGCGGGGG
GCCCCACcCC
GGGGcGGAGC
tGGGAGGAGC
GGGgCAGGGC
GAGGCGGAG
GGGGcGGAGC
TTGATTaATT
CGCTCNNNNNNGAgAG
GAGGCGGAGc
AGGGcGTGGC
GGGgCAGGGC
CAGGGTGgGG
RAcAGGTGYAC
GGGGGAGGgG
VAWTrTTKRYTY
GGCCAGGC
GGCCAGGC
GGGTGTGG
RTGRMCYTWGcM
AAAGGTGC
GCGCGGG
SSSNKGGGGA
TGAGTAA
GGGTGGG
AGAGTCA
GCNMNANCMAG
CTATTAA
YTATTtWWAR
CCAGGCA
GTAGAAT
AGAGTCA
GGGTGGG
TGACTG
GGCGCG
GGGTGG
GCANNNNNNNNNNNGGC
ATTWATK
TGAACT
CACGAG
CTGCCC
TGNNNGGNTG


La5
20
18
18
18
18
18
18
18
18
18
18
18
18
18
18
18
18
16.58
16
16
16
16
16
14
14
14
14
14
14
14
14
14
14
14
14
12
12
12
12
12
12
12
12
12


Lpv6
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0









Table 5-3 Continued.


Factor
Spl
TTF-1
GCN4
GCN4 TGAla
NFAT-1 A96
c-Myb
Zeste
FACB
AP-1
c-Myb
Spl
GCN4
abaA
GCN4
AP-4 E12
TTF-1
CAC-binding protein
Spl
Spl
Spl
AP-4 E12
TBP
Spl
GR
Spl
Zeste
NFAT-1
GCN4
abaA
MBF-I


Beg2 Sns3 Len
329 R 6
109 N 9
8 R 6
8 N 6
220 N 6
166 R 6
31 N 6
157 N 15
243 N 7
55 N 6
43 N 6
31 R 6
116 R 6
86 N 6
46 R 6
195 N 9
158 R 6
121 R 6
122 N 6
270 N 9
46 N 6
306 N 6
192 N 6
103 N 6
271 N 6
334 N 6
220 R 6
244 R 6
116 N 6
228 N 7


Sequence
GGCCCC
GCNCTNNAG
GAGTCA
GAGTCA
GGAAAA
AAACGC
CACTCA
GCANNNNNNNNNCGC
TGASTMA
GAACTT
GGGCAG
CACTCA
AGAATG
TGATTC
CAGCTG
GCNCTNNAG
CACCCC
GGGTGG
GGTGGG
KRGGCKRRK
CAGCTG
TATAAA
GGGGCC
TCTTCT
AGGCGG
CACTCC
GGAAAA
GAGTAA
AGAATG
TGCRCRC


La5
12
12
12
12
12
12
12
12


Lpv6
0
0
0
0
0
0
0
0
0


EGR-2 286 N 10 GCGGGGGAGG 17 0.0019
CAC-BF 17 R 9 AGGGTGTGG 15.18 0.0025
v-Jun 8 R 12 GAGTCAGACAGG 15.69 0.0037
EGR-1 286 R 9 GCGGGGGAG 14.64 0.0051
V$GC 01 287 N 14 CGGGGGAGGAGCTG 14.14 0.0065
HAP3 168 N 16 ACGCTCCAACCAGAAA 14.29 0.0092
HNF-4 53 N 12 GTGAACTTAGGC 12.81 0.0093
TEF2 18 N 8 GGGTGTGG 15.72 0.01
SBF 63 R 11 GCATGCCAGGA 14.1 0.01
'Identified using Transcription Element Search System (http://www.cbil.upenn.edu/cgi-bin/tess)
2 Beginning nucleotide
3 Sense, N = normal, R = reverse
4 Length of motif, in base pairs
5 Log-likelihood score, higher is stronger
6 Approximate p-value for La score


















3000- C2C12

2500-

2000-

1500

1000

PT 5 0 0 -

0
Scx-luc Scx-luc Scx-luc Scx-luc
+BMP6 +FGF4 +FGF5

Figure 5-3. Scleraxis promoter activity is not increased by growth factor supplementation in
UCB stem cells. C2C12 mesenchymal cells and UCB stem cells were transiently
transfected with Scx-luc and supplemented with 50 ng/ml BMP6, 10 ng/ml FGF4 or
10 ng/ml FGF5 for 24 hours. Luciferase activity was measured from cell lysates.
Relative luciferase units were calculated by dividing luciferase activity by renilla
expression.
























500 bp
300 bp




Figure 5-4. UCB stem cells express Erm, Pea3, and Scleraxis. RT-PCR was performed on UCB
stem cells with gene specific primers as shown. 18S was included as an internal
control. Scx = scleraxis.


,~d
















Collagen Bead


Figure 5-5. UCB and AdMSC attach to various culture surfaces. UCB and AdMSC were
cultured on gelatin coated plasticware, 30% Matrigel, or on collagen coated beads for
48 hours prior to fixation. Actin structures were stained with fluorescein conjugated
phalloidin and nuclei were identified with Hoechst 33342 dye. Immunofluorescence
was visualized using a TCS SP5 Laser Scanning Confocal Microscope running Leica
LAS-AF. Scale bar = 10 [m


Gelatin


30% Matrigel














10= 70


L 6o 40
60




aj 1
i c 0 >
0- 0I1



Gelatin Beads Matrigel Gelatin Beads Matrigel
8- 16-

S6- 12
8


0 O 0
Gelatin Beads Matngel Gelatin Beads Matrigel




Figure 5-6. Culture in matrigel increases tenocyte gene expression. AdMSC and UCB stem cells
were cultured on gelatin coated plasticware, collagen coated beads, or 30% matrigel
for 48 hours prior to RNA isolation and real-time PCR with gene-specific primers.
Culture on matrigel increased scleraxis expression in AdMSC and UCB. Tenascin C
mRNA was also increased by culture on matrigel. Asterisk indicates p<0.05.








UCB
0 5 10 20 30 60
m ---


-


AdMSC
0 5 10 20 30 60 min
- a-pERKl/2

1 oa-ERKl/2

W1m a-tubulin

Sa-pERK1/2

-- ca-ERKl/2


[- c-tuAlbulin


IIiL


I l a-pERKl/2

I- MW I -ERK1/2


1 "-O OW W, *I .-tubulin


Figure 5-7. UCB and AdMSC respond uniquely to FGF stimulation. UCB and AdMSC were
stimulated with 10 ng/ml FGF2, FGF4, or FGF5 for the times shown. Protein
extracts were probed with antibodies specific to phosphorylated and total ERK1/2.
Tubulin antibodies were used as a loading control.























FGF2


FGF5


60-

v 50-

S40-
*o


20 1-

O
0


FGF5+
PD98059


Figure 5-8. Fibroblast growth factors stimulate proliferation of AdMSC and UCB stem cells in a
MAPK dependent manner. AdMSC and UCB stem cells were cultured in low serum
media supplemented with 10 ng/ml FGF2 or FGF5 in the presence or absence of
PD98059. Prior to fixation, cells were pulsed with BrdU. FGF2 inhibited
proliferation of UCB but stimulated AdMSC division. FGF5 increased proliferation
of UCB stem cells.


~I -


EMSCAd
SUCB










FGF2+
PD98059

EMSCAd
*UCB
T


40-


. 30-
o
20-

O 10-

o-


CTL


CTL











A B
0 CTL 0 CTL
S8 FGF2 W 8 FGF2
I FGF5 I FGF5




0 0
Gelatin Beads Matrigel Gelatin Beads Matrigel

C D
45 g CTL 45 0 CTL
5 FGF2 FGF2
35 bo 3 M FGF5
35 g FGF53 FGF5

75
5k

3 4
0 0n
Gelatin Beads Matrigel Gelatin Beads Matrigel


Figure 5-9. Culture conditions affect tenocyte gene expression in AdMSC and UCB. AdMSC
and UCB stem cells were cultured for 48 hours in low serum media containing 10
ng/ml FGF2 or FGF5. Total RNA was isolated and subjected to real-time PCR with
gene specific primers for scleraxis and tenascin C. Matrigel increased expression of
scleraxis in UCB stem cells (A). There was no effect of matrix or FGF stimulation on
TnC in UCB (B). Scleraxis expression in AdMSC was increased by culture on
matrigel (C). Matrigel increased Tenascin C mRNA in AdMSC (D). This was further
increased by supplementation with FGF2 or FGF5.









0 min 10min 30 min
































Figure 5-10. FGF5 supplementation does not affect UCB actin structure. UCB stem cells were
serum starved for one hour prior to treatment with FGF5 or growth media. Cells were
fixed at 0, 10 and 30 minutes prior to visualizing actin structures with fluorescein
conjugated phalloidin. Nuclei were stained with Hoechst 33342. SF = serum free
media, FGF5 = FGF5 containing media, GM = growth media. Scale bar = 10 im









FGF2
0 5 10 20 30 60





FGF2
0 5 10 20 30 60


FGF5
0 5 10 20 30 60 miin
I -pAkt

- --- -Akt


FGF5
0 5 10 20 30 60 min
7 la-pAkt


WO -Il III (t- Akt


Figure 5-11. FGF2 and FGF5 do no activate Akt in UCB (A) or AdMSC (B). Cells were treated
with 10 ng/ml of FGF2 or FGF5 and lysed at the time points shown. Blots were
probed for phosphorylated and total Akt.









CHAPTER 6
SUMMARY AND CONCLUSIONS

A hierarchy exists such that embryonic stem cells retain the most plasticity while bone

marrow and adult stem cells are much more limited in their potential. Umbilical cord blood

derived stem cells retain characteristics of naive ES cells in that they express Oct4, nanog, Sox2,

Klf4 and c-myc transcripts. Surface markers Tral-60, Tral-81, SSEA1 and minor amounts of

SSEA4 are also present in UCB. This population of equine stem cells can be isolated using

conventional human protocols and reagents. Proper culture conditions result in cells that can be

maintained in a proliferative state for up to fifteen passages or approximately 22 population

doublings. When cultured in appropriate media, UCB differentiate into proteoglcyan expressing

chondrocytes or calcium producing osteocytes. UCB can also enter the hepatic pathway and

form albumin producing hepatocytes. However, these cells possess limited ability to form

adipocytes and myocytes. In comparison, equine adipose derived mesenchymal stem cells

express fewer markers of stemness, lacking SSEA1, SSEA4, nanog, Sox2, and Klf4. AdMSC

lack the ability to differentiate into the immature myocytes or adipocytes formed by UCB.

Early cultures of UCB possess small colonies reminiscent of ES colonies that are lost with

time in culture. Alternate culture conditions were assessed to determine more optimal conditions

to maintain stem cell proliferation as well as maintenance of stemness. Culture in a combination

of thrombopoietin, Flt3, and c-kit or media conditioned by confluent UCB resulted in

morphology reminiscent of replicative senescence. Growth in conventional growth media (GM)

or growth media supplemented with bFGF (GM+FGF) supported cell proliferation and

morphology typical of MSC. Population doubling times were shorter in cells that did not receive

FGF supplementation. Further culture on a protein matrix (collagen, fibronectin, or laminin)

increased proliferation rates in cells cultured in GM or GM+FGF. Expression of stem cell









markers nanog and Sox2 were gradually lost with time in culture, however Oct4 expression

remained.

Unmanipulated UCB and AdMSC express the bHLH transcription factor scleraxis, which

is crucial to the development of flexor tendons. Culture on the complex protein matrix Matrigel

resulted in the upregulation of scleraxis in both AdMSC and UCB stem cells. In Matrigel cells

form tight colonies while they retain their fibroblast-like morphology when grown on gelatin or

collagen coated surfaces. Supplementation of FGF2 or FGF5 resulted in changes in proliferation

of both cell types, but had limited effects on scleraxis or tenascin c mRNA expression compared

to culture on matrigel alone.

Overall, this work highlights the potential of equine umbilical cord blood derived stem

cells as not only a therapeutic aid for horses but as a model system for human medicine. The

cells appear to be more naive than either bone marrow or adipose derived stem cells yet do not

retain the tumorigenicity of embryonic stem cells. The ability to form immature myocytes as

well as hepatocytes suggests that UCB have greater plasticity than other adult stem cells. This

may be a result of a less restrictive epigenetic status than adipose derived stem cells. This open

genome structure likely allows for greater plasticity and naivete. The apparent inability of UCB

and AdMSC to efficiently differentiate into adipose tissue was surprising but reflects other work

in the literature. In truth, the inefficiency of adipocyte formation is a positive aspect from a

clinical aspect as these cells may be less likely to precociously differentiate into that cell type if

used in vivo.

While initial populations express all of the common markers of a naive stem cell (Oct4,

nanog, Sox2, and Klf4), the majority of these markers are lost with time in culture. This may

reflect one of several possibilities: (1) UCB stem cells may be differentiating to a more mature









cell type, (2) a small population of naive stem cells express these markers and this cell type is

essentially diluted out in culture due to slower proliferation, (3) a small population of naive stem

cells exist but are not maintained due to inappropriate culture conditions. High density, early

passage cultures contain a small number of dense colonies with morphology reminiscent of ES

cell colonies. These colonies may contain cells that are more naive than those that grow in

monolayer culture. It is tempting to speculate that the cells which form these colonies are those

that contain the stem cell markers found in early cultures, but with passage are greatly

outnumbered by other cell types. This is further supported by the notion that generally more

naive stem cells proliferate slowly and thus would not be expected to create as many daughter

cells as the cells which grow on a monolayer. Thus, the colony forming cells may be the true

stem cells while those which grow in a monolayer are more limited precursor cells. Further

work should evaluate the subpopulations within UCB stem cells to identify cells that may be

more or less useful in various therapeutic settings or as a model for human medicine.

The differential response of AdMSC and UCB to stimulation by fibroblast growth factors

further highlights the differences between the two cell types. It is interesting to note that while

both respond to FGF2 and FGF5 stimulation by phosphorylating ERK1/2 and activating the

MAPK pathway, there are some significant differences in the type of response. In general,

AdMSC appear to have less total ERK1 than UCB, resulting in a different ratio of the two

kinases. This may be a reflection of cells poised either for terminal differentiation or for

proliferation prior to differentiation. In other cell types, strong phosphorylation of ERK2 occurs

in response to differentiation signals, while ERK1 responses are associated with proliferation.

The response of ERK1 to stimulation by FGFs was weak in both cell types; ERK2

phosphorylation in response to FGF was predominant. However, UCB retain higher amounts of









ERK1 than AdMSC which may allow them to better respond to other mitogenic factors. This

may suggest that a more naive stem cell may have a higher ratio of ERK1 :ERK2 than more

differentiated cell types. These cells may be poised to respond to extracellular factors differently

than AdMSC.

The expression of low levels of scleraxis in immature cells is not surprising, as many stem

cells exist in a state poised for differentiation and transcribe low levels of mRNAs required for

that transformation. Not only is scleraxis upregulated in cells grown on Matrigel, but the

morphology of the cells changes drastically. The response of UCB to Matrigel is exciting and

presents many possibilities for future research. The changes in gene transcription may or may

not be directly related to the change in morphology. Integrin signaling and interaction with other

ECM components likely result in changes that may allow differentiation. The growth factor

concentrations and/or combinations present in Matrigel may signal for transcriptional changes

independent of the structure of the extracellular matrix. Alternatively, the changes may result

from changes in tensional stress, ligand:receptor interactions with the extracellular matrix, or

differences in cell:cell contact. Likely, a combination of stimuli allow for the formation of a

cluster of cells similar to tendon precursor cells. Complete differentiation is not recorded at this

stage, likely for a variety of reasons. The combination of growth factors that initiates early

tendon precursor development is likely not sufficient for complete maturation. Another

combination or different ratios of growth factors could help complete the transition. In vivo,

tendon cells are subjected to a high degree of strain on a daily basis as a result of movement.

Many cell types require cyclic or tensional stress to completely differentiate and it would be

extremely surprising were it not also true for tendon cells. Adding strain to UCB cultured in









Matrigel may stimulate the production and secretion of matrix proteins required for tendon repair

and/or maintenance.

Equine UCB provide more than a potential therapeutic aid for injuries in the horse. The

horse provides an excellent model of athletic tendon injury in the human, as injuries to the SDFT

correlate extremely well to injuries of the Achilles tendon, a frequent spot of injury in human

athletes. Horses are treated as athletes and undergo similar training programs as human athletes.

Overtraining and overuse injuries result in setbacks in training and competition in both species.

Equine umbilical cord blood derived stem cells are readily available and possess characteristics

of human UCB stem cells, making them an attractive choice for a model of human medicine.

The horse provides a useful model of injury and can be used to determine the usefulness of UCB

in treating tendon and other musculoskeletal injuries.









APPENDIX A
SUPPLEMENTARY DATA

Mouse Embryonic Stem Cell Culture and Differentiation

Mouse embryonic stem cells (mES) are commonly used to study the developmental

processes that occur in an ordered manner in the developing embryo. Under proper conditions,

mES cells can be maintained in a proliferative, pluripotent state. However, mES cells can also

undergo spontaneous or directed differentiation to form cells from all three germ layers. In

culture medium containing leukemia inhibitory factor (LIF), mES cells maintain a pluripotent

phenotype. Cells grow in colonies with light refractile edges (Figure A-1A). Individual cells

can rarely be distinguished from the colony. As colonies grow in an unrestricted manner (i.e.

without fresh media or appropriate passaging), the cells will begin differentiating into a wide

variety of cell type. Initially, colonies develop a ring of epithelial cells that surround the colony

(Figure A-1B). Cells remaining in the inner portion during this stage may retain greater levels of

pluripotency. However, with continuing differentiation, cells migrate away from the colony,

forming a monolayer with cells of a wide variety of phenotypes (Figure A-1C).

Formation of embroid bodies (EBs) allows for a more synchronous protocol for

differentiation. This process allows an individual cell to form a colony which can then be treated

and compared with other colonies (also from a single cell). Naive mES colonies are washed off

the tissue culture plate and placed in suspension culture in media lacking LIF. The EBs cannot

easily attach and are forced to grow into larger spherical colonies. Individual EBs can then be

placed back onto tissue culture dishes and allowed to fully differentiate in media lacking LIF.

Spontaneous differentiation results in the formation of a wide variety of cell types, including

neural, myogenic, and hepatogenic cells (Figure A-2).









Alternative UCB Differentiation Protocols

Following is a brief description of differentiation protocols that were tested on UCB stem

cells but were not reported in earlier work due to the lack of success.

Myogenic Differentiation

UCB stem cells were plated on gelatin coated plasticware and cultured in DMEM

containing 10% FBS and 10 [iM azacytidine for 24 hours. The media was subsequently replaced

with low glucose DMEM containing 5% FBS. Cells were continuously cultured in this media for

up to three weeks. No evidence of myogenic differentiation was found. RT-PCR for the

myogenic regulatory factors MyoD and Myf5 was negative. No immunostaining of desmin or

myosin heavy chain could be detected.

Neural Differentiation

To initiate neural differentiation, three protocols were attempted. The first two protocols

contain the same basic components but included either low or high amounts of FBS (2% and

10%, respectively). This medium was based on aMEM and contained 10 ng/ml PDGF, 10 ng/ml

bFGF and 10 ng/ml EGF in addition to serum. The third media was DMEM supplemented with

15% FBS, 20 ng/ml bFGF, 50 ng/ml neural growth factor (NGF) and 0.5 mM IBMX. Cells were

maintained in these media for up to three weeks. Following culture time, cells were

immunostained for nestin, glial fibrillary acidic protein (GFAP), and beta-3-tubulin. No

immunoreactivity was apparent at any time.

Adipogenic Differentiation

Three protocols for adipogenic differentiation were attempted during this study. The

previously described protocol gave the greatest level of success and is thus the protocol of choice

for UCB. However, it should be noted that the efficiency of differentiation remained extremely

low. A low glucose DMEM based media containing 10% FBS, 1 [iM dexamethasone, 0.5 mM









IBMX, 100 [iM indomethacin, and 10 ng/ml insulin was used to culture cells for up to three

weeks. The second protocol used aMEM supplemented with 10% FBS, 1 iM dexamethasone,

0.5mM IBMX, 50 iM indomethacin, and 5 ng/ml insulin. As rabbit serum has been shown to

increase the efficiency of adipogenic differentiation, it was substituted for FBS in all media as an

additional set of media concoctions. Neither media presented here (whether supplemented with

FBS or rabbit serum) produced cells that stained positive for Oil Red O or contained lipid

vacuoles. Only limited success was noted with the previously described protocol, which was not

enhanced by the inclusion of rabbit serum.

Quantification of Oct4, nanog, and Sox2 Across Time in Culture

To quantify expression of Oct4, nanog, and Sox2 in UCB stem cells across time in culture,

real time PCR was performed. Multiple primer sets were tested by end point PCR for Oct4.

Those primer sets that produced a single band of the appropriate size were then tested by real

time PCR, using a standard curve method. While a number of primer sets provided a product

after end point PCR, real time PCR results were inconsistent. The dissociation curves for Oct4

had multiple peaks, indicating the presence of multiple products. Dissociation curves for the

positive control samples (mES) contained a single peak. The single peak found in curves from

mES samples overlapped one of the peaks found in the dissociation curve for UCB samples,

indicating the presence of the correct transcript. It is important to note that the magnitude of the

peak was much higher in mES samples than UCB samples.

Standard curves were performed to ensure that the values obtained were within a linear

range. The curves obtained for the internal control (18S) had a slope of -3.325 and R2 value of

0.994 indicating nearly 100% primer efficiency and an appropriate standard curve on which to

base quantifications. However, Oct4, nanog and Sox2 lacked standard curves that were









consistent across multiple plates. Moreover, these curves had slopes indicating less than 75%

primer efficiency.

Multiple primer sets were tested to ensure the results obtained were not simply due to

inefficient primers. All primers resulted in inefficient standard curves and poor dissociation

curves with multiple peaks. Increasing the annealing temperature also had no effect on the

multiple peaks of the dissociation curve.

Importantly, reactions that lacked reverse transcriptase in the cDNA amplification process

contained no product in either end point or real time PCR. It should also be noted that internal

controls amplified a single band in end point that reflects the single peak in the dissociation

curve in UCB as well as mES. Further work on these transcripts was discontinued, as they were

not the primary focus of the project.









B C


Figure A-1. Stages of mES colony differentiation. Naive mES colonies maintain a compact
shape with no discernable individual cells (A, day one). More differentiated colonies
often have a ring of epithelial cells surrounding a more densely packed core (B, day
two). Fully differentiating cells adopt the morphology of their mature cell type and
are commonly found in monolayers on the culture surface (C, day 5). Scale bar = 10
tm






















a-MyHC


a-nestin


a-CK18


Figure A-2. mES embroid bodies differentiate into a variety of cell types. mES stem cells were
allowed to spontaneously differentiate. Following differentiation cells were fixed in
4% paraformaldehyde and immunostained for myosin heavy chain (A), nestin (B),
and cytokeratin 18 (C). Hoechst 33342 was used to visualize nuclei.









APPENDIX B
TABLE OF PRIMER SEQUENCES

Table B-1. Primer sequences and sources.


c-myc


Size,
bp


127


Source


Taylor et al., 2009


Primer
CollA2 F
R-
TnC F
R
ScxB F
R
Scx F
R
18S F
R
Pea3 F
R
Erm F
R
GAPDH F
R
Col2A] F
R
Sox9 F
R
Osteonectin F
R
RunX2 F
R
Albumin F
R
Cytokeratin F
18 R
GAPDH, F
realtime R
Oct4 F
R
Nanog F
R
Sox2 F
R
Klf4 F


Sequence
-GCACATGCCGTGACTTGAGA
-CATCCATAGTGCATCCTTGATTAGG
- GGGCGGCCTGGAAATG
-CAGGCTCTAACTCCTGGATGATG
-TCTGCCTCAGCAACCAGAGA
- TCCGAATCGCCGTCTTTC
- AGGACCGCGACAGAAAGAC
-CAGCACGTAGTGACCAGAAGAA
- GTAACCCGTTGAACCCCATT
-CCATCCAATCGGTAGTAGCG
- GTGGCAGTTTCTGGTGGCCCTG
- GACTGGCCGGTCAAACTCAGCC
-GAGAGACTGGAAGGCAAAGTC
- CCCAGCCACCTTCTGCATGATGC
-GATTCCACCCATGGCAAGTTCCATGGCAC
- GCATCGAAGGTGGAAGAGTGGGTGTCACT
-CAGCTATGGAGATGACAACCTGGC
- CGTGCAGCCATCCTTCAGGACAG
-GCTCCCAGCCCCACCATGTCCG
-CGCCTGCGCCCACACCATGAAG
-CCCATCAATGGGGTGCTGGTCC
- GTGAAAAAGATGCACGAGAATGAG
-CGTGCTGCCATTCGAGGTGGTGG
- CCTCAGAACTGGGCCCTTTTTCAG
- AACTCTTCGTGCAACCTACGGTGA
- AATTTCTGGCTCAGGCGAGCTACT
- GGATGCCCCCAAATCTCAGGACC
- GGGCCAGCTCAGACTCCAGGTGC
-GAGATCCCGCCAACATC
- CTGACAATCTTCAGGGAATTGTC
- GCTGCAGAAGTGGGTGGAGGAAGC
-GCCTGGGGTACCAAAATGGGGCCC
- GTCTCTCCTCTGCCTTCCTCCATGG
- CCTGTTTGTAGCTAAGGTTCAGGATG
- AACGGCAGCTACAGCATGA
- TGGAGTGGGAGGAAGAGGTA
-TGGGCAAGTTTGTGTTGAAG
- TGACAGTCCCTGTTGCTCAG
-GACGGTAGCTCGCCCAAG
- ACCCCGATTCTGACCTTTTG


70 Taylor et al., 2009

59 Taylor et al., 2009

261 NM 001105150.1

151 Taylor et al., 2009

315 XM 001917508.1

293 XM 001499099.1

688 XM 001496020

240 NM 001081764.1

293 XM 001498424.2

149 NM 001143953.1

350 XM 001502519.2

431 NM 001082503.1

340 XM_001490377.1

207 XM 001496020.1

363 XM 001490108.2

267 XM_001498808.1

282 NM 001143799.1

336 XM_001492956.2

240 XM 001497991.2









Table B-l Continued.
Size,
Primer Sequence bp Source
Jagged-1 F GCCTGGTGACAGCCTTCTAC 305 XM_001495238.2
R- GGGGCTTCTCCTCTCTGTCT
Jagged-2 F CATGATCAACCCCGAGGAC 169 XM_001494763.2
R- CGTACTGGTCGCAGGTGTAG
Notch-1 F GAGGACCTGGAGACCAAGAAGGTTC 297 XM 001498582.2
R AGATGAAGTCGGAGATGACGGC
Notch-2 F GCAGGAGCAGGAGGTGATAG 188 NM 010928.2
R GCGTTTCTTGGACTCTCCAG
Notch-3 F GTCCAGAGGCCAAGAGACTG 219 NM 008716.2
R CAGAAGGAGGCCAGCATAAG
Dll-1 F ACCTTCTTTCGCGTATGCCTCAAG 221 NM 007865.3
R AGAGTCTGTATGGAGGGCTTC
Dll-4 F CGAGAGCAGGGAAGCCATGA 378 NM 019454.2
R- CCTGCCTTATACCTCTGTGG









LIST OF REFERENCES


Amit, M., Carpenter, M.K., Inokuma, M.S., Chiu, C.P., Harris, C.P., Waknitz, M.A., Itskovitz-
Eldor, J., and Thomson, J.A. (2000). Clonally derived human embryonic stem cell lines
maintain pluripotency and proliferative potential for prolonged periods of culture.
Developmental biology 227, 271-278.

Aoi, T., Yae, K., Nakagawa, M., Ichisaka, T., Okita, K., Takahashi, K., Chiba, T., and
Yamanaka, S. (2008). Generation of pluripotent stem cells from adult mouse liver and
stomach cells. Science (New York, N.Y 321, 699-702.

Aoki, M., Yasutake, M., and Murohara, T. (2004). Derivation of functional endothelial
progenitor cells from human umbilical cord blood mononuclear cells isolated by a novel
cell filtration device. Stem cells (Dayton, Ohio) 22, 994-1002.

Arinzeh, T.L., Peter, S.J., Archambault, M.P., van den Bos, C., Gordon, S., Kraus, K., Smith, A.,
and Kadiyala, S. (2003). Allogeneic mesenchymal stem cells regenerate bone in a critical-
sized canine segmental defect. The Journal of bone and joint surgery 85-A, 1927-1935.

Arney, K.L., and Fisher, A.G. (2004). Epigenetic aspects of differentiation. Journal of cell
science 117, 4355-4363.

Amhold, S.J., Goletz, I., Klein, H., Stumpf, G., Beluche, L.A., Rohde, C., Addicks, K., and
Litzke, L.F. (2007). Isolation and characterization of bone marrow-derived equine
mesenchymal stem cells. American journal of veterinary research 68, 1095-1105.

Avilion, A.A., Nicolis, S.K., Pevny, L.H., Perez, L., Vivian, N., and Lovell-Badge, R. (2003).
Multipotent cell lineages in early mouse development depend on SOX2 function. Genes &
development 17, 126-140.

Awad, H.A., Boivin, G.P., Dressier, M.R., Smith, F.N., Young, R.G., and Butler, D.L. (2003).
Repair of patellar tendon injuries using a cell-collagen composite. J Orthop Res 21, 420-
431.

Azuara, V., Perry, P., Sauer, S., Spivakov, M., Jorgensen, H.F., John, R.M., Gouti, M.,
Casanova, M., Warnes, G., Merkenschlager, M., and Fisher, A.G. (2006). Chromatin
signatures of pluripotent cell lines. Nature cell biology 8, 532-538.

Baal, N., Reisinger, K., Jahr, H., Bohle, R.M., Liang, O., Munstedt, K., Rao, C.V., Preissner,
K.T., and Zygmunt, M.T. (2004). Expression of transcription factor Oct-4 and other
embryonic genes in CD133 positive cells from human umbilical cord blood. Thrombosis
and haemostasis 92, 767-775.

Babaie, Y., Herwig, R., Greber, B., Brink, T.C., Wruck, W., Groth, D., Lehrach, H., Burdon, T.,
and Adjaye, J. (2007). Analysis of Oct4-dependent transcriptional networks regulating
self-renewal and pluripotency in human embryonic stem cells. Stem cells (Dayton, Ohio)
25, 500-510.









Baddoo, M., Hill, K., Wilkinson, R., Gaupp, D., Hughes, C., Kopen, G.C., and Phinney, D.G.
(2003). Characterization of mesenchymal stem cells isolated from murine bone marrow by
negative selection. Journal of cellular biochemistry 89, 1235-1249.

Baird, A., Schubert, D., Ling, N., and Guillemin, R. (1988). Receptor- and heparin-binding
domains of basic fibroblast growth factor. Proceedings of the National Academy of
Sciences of the United States of America 85, 2324-2328.

Bartunek, J., Croissant, J.D., Wijns, W., Gofflot, S., de Lavareille, A., Vanderheyden, M.,
Kaluzhny, Y., Mazouz, N., Willemsen, P., Penicka, M., Mathieu, M., Homsy, C., De
Bruyne, B., McEntee, K., Lee, I.W., and Heyndrickx, G.R. (2007). Pretreatment of adult
bone marrow mesenchymal stem cells with cardiomyogenic growth factors and repair of
the chronically infarcted myocardium. American journal of physiology 292, H1095-1104.

Battula, V.L., Bareiss, P.M., Treml, S., Conrad, S., Albert, I., Hojak, S., Abele, H., Schewe, B.,
Just, L., Skutella, T., and Buhring, H.J. (2007). Human placenta and bone marrow derived
MSC cultured in serum-free, b-FGF-containing medium express cell surface frizzled-9 and
SSEA-4 and give rise to multilineage differentiation. Differentiation; research in biological
diversity 75, 279-291.

Benavente, C.A., Sierralta, W.D., Conget, P.A., and Minguell, J.J. (2003). Subcellular
distribution and mitogenic effect of basic fibroblast growth factor in mesenchymal
uncommitted stem cells. Growth factors (Chur, Switzerland) 21, 87-94.

Bernstein, B.E., Mikkelsen, T.S., Xie, X., Kamal, M., Huebert, D.J., Cuff, J., Fry, B., Meissner,
A., Wernig, M., Plath, K., Jaenisch, R., Wagschal, A., Feil, R., Schreiber, S.L., and
Lander, E.S. (2006). A bivalent chromatin structure marks key developmental genes in
embryonic stem cells. Cell 125, 315-326.

Bi, W., Deng, J.M., Zhang, Z., Behringer, R.R., and de Crombrugghe, B. (1999). Sox9 is
required for cartilage formation. Nature genetics 22, 85-89.

Bianchi, G., Banfi, A., Mastrogiacomo, M., Notaro, R., Luzzatto, L., Cancedda, R., and Quarto,
R. (2003). Ex vivo enrichment of mesenchymal cell progenitors by fibroblast growth factor
2. Experimental cell research 287, 98-105.

Bieback, K., Kern, S., Kluter, H., and Eichler, H. (2004). Critical parameters for the isolation of
mesenchymal stem cells from umbilical cord blood. Stem cells (Dayton, Ohio) 22, 625-
634.

Boeuf, H., Hauss, C., Graeve, F.D., Baran, N., and Kedinger, C. (1997). Leukemia inhibitory
factor-dependent transcriptional activation in embryonic stem cells. The Journal of cell
biology 138, 1207-1217.

Bonanno, G., Perillo, A., Rutella, S., De Ritis, D.G., Mariotti, A., Marone, M., Meoni, F.,
Scambia, G., Leone, G., Mancuso, S., and Pierelli, L. (2004). Clinical isolation and
functional characterization of cord blood CD133+ hematopoietic progenitor cells.
Transfusion 44, 1087-1097.









Boyer, L.A., Lee, T.I., Cole, M.F., Johnstone, S.E., Levine, S.S., Zucker, J.P., Guenther, M.G.,
Kumar, R.M., Murray, H.L., Jenner, R.G., Gifford, D.K., Melton, D.A., Jaenisch, R., and
Young, R.A. (2005). Core transcriptional regulatory circuitry in human embryonic stem
cells. Cell 122, 947-956.

Boyer, L.A., Plath, K., Zeitlinger, J., Brambrink, T., Medeiros, L.A., Lee, T.I., Levine, S.S.,
Wemig, M., Tajonar, A., Ray, M.K., Bell, G.W., Otte, A.P., Vidal, M., Gifford, D.K.,
Young, R.A., and Jaenisch, R. (2006). Polycomb complexes repress developmental
regulators in murine embryonic stem cells. Nature 441, 349-353.

Brandenberger, R., Wei, H., Zhang, S., Lei, S., Murage, J., Fisk, G.J., Li, Y., Xu, C., Fang, R.,
Guegler, K., Rao, M.S., Mandalam, R., Lebkowski, J., and Stanton, L.W. (2004).
Transcriptome characterization elucidates signaling networks that control human ES cell
growth and differentiation. Nature biotechnology 22, 707-716.

Brent, A.E., Schweitzer, R., and Tabin, C.J. (2003). A somitic compartment of tendon
progenitors. Cell 113, 235-248.

Brent, A.E., and Tabin, C.J. (2004). FGF acts directly on the somitic tendon progenitors through
the Ets transcription factors Pea3 and Erm to regulate scleraxis expression. Development
(Cambridge, England) 131, 3885-3896.

Brodke, D., Pedrozo, H.A., Kapur, T.A., Attawia, M., Kraus, K.H., Holy, C.E., Kadiyala, S., and
Bruder, S.P. (2006). Bone grafts prepared with selective cell retention technology heal
canine segmental defects as effectively as autograft. J Orthop Res 24, 857-866.

Brown, D., Wagner, D., Li, X., Richardson, J.A., and Olson, E.N. (1999). Dual role of the basic
helix-loop-helix transcription factor scleraxis in mesoderm formation and chondrogenesis
during mouse embryogenesis. Development (Cambridge, England) 126, 4317-4329.

Bruder, S.P., Kurth, A.A., Shea, M., Hayes, W.C., Jaiswal, N., and Kadiyala, S. (1998). Bone
regeneration by implantation of purified, culture-expanded human mesenchymal stem
cells. J Orthop Res 16, 155-162.

Cao, R., Wang, L., Wang, H., Xia, L., Erdjument-Bromage, H., Tempst, P., Jones, R.S., and
Zhang, Y. (2002). Role of histone H3 lysine 27 methylation in Polycomb-group silencing.
Science (New York, N.Y 298, 1039-1043.

Carlin, R., Davis, D., Weiss, M., Schultz, B., and Troyer, D. (2006). Expression of early
transcription factors Oct-4, Sox-2 and Nanog by porcine umbilical cord (PUC) matrix
cells. Reprod Biol Endocrinol 4, 8.

Castellani, L.W., Gargalovic, P., Febbraio, M., Charugundla, S., Jien, M.L., and Lusis, A.J.
(2004). Mechanisms mediating insulin resistance in transgenic mice overexpressing mouse
apolipoprotein A-II. Journal of lipid research 45, 2377-2387.









Chambers, I., Colby, D., Robertson, M., Nichols, J., Lee, S., Tweedie, S., and Smith, A. (2003).
Functional expression cloning ofNanog, a pluripotency sustaining factor in embryonic
stem cells. Cell 113, 643-655.

Chan, J., O'Donoghue, K., Gavina, M., Torrente, Y., Kennea, N., Mehmet, H., Stewart, H., Watt,
D.J., Morgan, J.E., and Fisk, N.M. (2006). Galectin-1 induces skeletal muscle
differentiation in human fetal mesenchymal stem cells and increases muscle regeneration.
Stem cells (Dayton, Ohio) 24, 1879-1891.

Chan, J., Waddington, S.N., O'Donoghue, K., Kurata, H., Guillot, P.V., Gotherstrom, C.,
Themis, M., Morgan, J.E., and Fisk, N.M. (2007). Widespread distribution and muscle
differentiation of human fetal mesenchymal stem cells after intrauterine transplantation in
dystrophic mdx mouse. Stem cells (Dayton, Ohio) 25, 875-884.

Chang, F., Ishii, T., Yanai, T., Mishima, H., Akaogi, H., Ogawa, T., and Ochiai, N. (2008a).
Repair of large full-thickness articular cartilage defects by transplantation of autologous
uncultured bone-marrow-derived mononuclear cells. J Orthop Res 26, 18-26.

Chang, S.A., Lee, E.J., Kang, H.J., Zhang, S.Y., Kim, J.H., Li, L., Youn, S.W., Lee, C.S., Kim,
K.H., Won, J.Y., Sohn, J.W., Park, K.W., Cho, H.J., Yang, S.E., Oh, W.I., Yang, Y.S., Ho,
W.K., Park, Y.B., and Kim, H.S. (2008b). Impact of myocardial infarct proteins and
oscillating pressure on the differentiation of mesenchymal stem cells: effect of acute
myocardial infarction on stem cell differentiation. Stem cells (Dayton, Ohio) 26, 1901-
1912.

Chang, Y.J., Tseng, C.P., Hsu, L.F., Hsieh, T.B., and Hwang, S.M. (2006). Characterization of
two populations of mesenchymal progenitor cells in umbilical cord blood. Cell biology
international 30, 495-499.

Chen, H.K., Hung, H.F., Shyu, K.G., Wang, B.W., Sheu, J.R., Liang, Y.J., Chang, C.C., and
Kuan, P. (2005). Combined cord blood stem cells and gene therapy enhances angiogenesis
and improves cardiac performance in mouse after acute myocardial infarction. European
journal of clinical investigation 35, 677-686.

Chen, J., Sanberg, P.R., Li, Y., Wang, L., Lu, M., Willing, A.E., Sanchez-Ramos, J., and Chopp,
M. (2001). Intravenous administration of human umbilical cord blood reduces behavioral
deficits after stroke in rats. Stroke; a journal of cerebral circulation 32, 2682-2688.

Chen, S.S., Fitzgerald, W., Zimmerberg, J., Kleinman, H.K., and Margolis, L. (2007). Cell-cell
and cell-extracellular matrix interactions regulate embryonic stem cell differentiation. Stem
cells (Dayton, Ohio) 25, 553-561.

Cheng, T., Rodrigues, N., Shen, H., Yang, Y., Dombkowski, D., Sykes, M., and Scadden, D.T.
(2000). Hematopoietic stem cell quiescence maintained by p21cipl/wafl. Science (New
York, N.Y 287, 1804-1808.

Chenn, A., and McConnell, S.K. (1995). Cleavage orientation and the asymmetric inheritance of
Notchl immunoreactivity in mammalian neurogenesis. Cell 82, 631-641.









Cheshier, S.H., Morrison, S.J., Liao, X., and Weissman, I.L. (1999). In vivo proliferation and
cell cycle kinetics of long-term self-renewing hematopoietic stem cells. Proceedings of the
National Academy of Sciences of the United States of America 96, 3120-3125.

Chew, J.L., Loh, Y.H., Zhang, W., Chen, X., Tam, W.L., Yeap, L.S., Li, P., Ang, Y.S., Lim, B.,
Robson, P., and Ng, H.H. (2005). Reciprocal transcriptional regulation ofPou5fl and Sox2
via the Oct4/Sox2 complex in embryonic stem cells. Molecular and cellular biology 25,
6031-6046.

Chiquet, M., Sarasa-Renedo, A., and Tunc-Civelek, V. (2004). Induction oftenascin-C by cyclic
tensile strain versus growth factors: distinct contributions by Rho/ROCK and MAPK
signaling pathways. Biochimica et biophysica acta 1693, 193-204.

Choi, S.C., Kim, S.J., Choi, J.H., Park, C.Y., Shim, W.J., and Lim, D.S. (2008). Fibroblast
growth factor-2 and -4 promote the proliferation of bone marrow mesenchymal stem cells
by the activation of the PI3K-Akt and ERK1/2 signaling pathways. Stem cells and
development 17, 725-736.

Clase, K.L., Mitchell, P.J., Ward, P.J., Dorman, C.M., Johnson, S.E., and Hannon, K. (2000).
FGF5 stimulates expansion of connective tissue fibroblasts and inhibits skeletal muscle
development in the limb. Dev Dyn 219, 368-380.

Clegg, P.D., Strassburg, S., and Smith, R.K. (2007). Cell phenotypic variation in normal and
damaged tendons. International journal of experimental pathology 88, 227-235.

Clements, D.A., Wang, J.K., Dionne, C.A., and Goldfarb, M. (1993). Activation of fibroblast
growth factor (FGF) receptors by recombinant human FGF-5. Oncogene 8, 1311-1316.

Crovace, A., Lacitignola, L., De Siena, R., Rossi, G., and Francioso, E. (2007). Cell therapy for
tendon repair in horses: an experimental study. Veterinary research communications 31
Supply 1, 281-283.

Cserjesi, P., Brown, D., Ligon, K.L., Lyons, G.E., Copeland, N.G., Gilbert, D.J., Jenkins, N.A.,
and Olson, E.N. (1995). Scleraxis: a basic helix-loop-helix protein that prefigures skeletal
formation during mouse embryogenesis. Development (Cambridge, England) 121, 1099-
1110.

Cummings, B.J., Uchida, N., Tamaki, S.J., Salazar, D.L., Hooshmand, M., Summers, R., Gage,
F.H., and Anderson, A.J. (2005). Human neural stem cells differentiate and promote
locomotor recovery in spinal cord-injured mice. Proceedings of the National Academy of
Sciences of the United States of America 102, 14069-14074.

Dani, C., Chambers, I., Johnstone, S., Robertson, M., Ebrahimi, B., Saito, M., Taga, T., Li, M.,
Burdon, T., Nichols, J., and Smith, A. (1998). Paracrine induction of stem cell renewal by
LIF-deficient cells: a new ES cell regulatory pathway. Developmental biology 203, 149-
162.









Dorotka, R., Windberger, U., Macfelda, K., Bindreiter, U., Toma, C., and Nehrer, S. (2005).
Repair of articular cartilage defects treated by microfracture and a three-dimensional
collagen matrix. Biomaterials 26, 3617-3629.

Dowling, B.A., Dart, A.J., Hodgson, D.R., and Smith, R.K. (2000). Superficial digital flexor
tendonitis in the horse. Equine veterinary journal 32, 369-378.

Dvorak, P., Dvorakova, D., Koskova, S., Vodinska, M., Najvirtova, M., Krekac, D., and Hampl,
A. (2005). Expression and potential role of fibroblast growth factor 2 and its receptors in
human embryonic stem cells. Stem cells (Dayton, Ohio) 23, 1200-1211.

Edom-Vovard, F., Schuler, B., Bonnin, M.A., Teillet, M.A., and Duprez, D. (2002). Fgf4
positively regulates scleraxis and tenascin expression in chick limb tendons.
Developmental biology 247, 351-366.

Espira, L., Lamoureux, L., Jones, S.C., Gerard, R.D., Dixon, I.M., and Czubryt, M.P. (2009).
The basic helix-loop-helix transcription factor scleraxis regulates fibroblast collagen
synthesis. Journal of molecular and cellular cardiology.

Eswarakumar, V.P., Lax, I., and Schlessinger, J. (2005). Cellular signaling by fibroblast growth
factor receptors. Cytokine & growth factor reviews 16, 139-149.

Evans, M.J., and Kaufman, M.H. (1981). Establishment in culture of pluripotential cells from
mouse embryos. Nature 292, 154-156.

Faundez, A.A., Taylor, S., and Kaelin, A.J. (2006). Instrumented fusion ofthoracolumbar
fracture with type I mineralized collagen matrix combined with autogenous bone marrow
as a bone graft substitute: a four-case report. Eur Spine J 15 Suppl 5, 630-635.

Feinberg, A.P. (2007). Phenotypic plasticity and the epigenetics of human disease. Nature 447,
433-440.

Fong, H., Hohenstein, K.A., and Donovan, P.J. (2008). Regulation of self-renewal and
pluripotency by Sox2 in human embryonic stem cells. Stem cells (Dayton, Ohio) 26, 1931-
1938.

Fortier, L.A., Nixon, A.J., Williams, J., and Cable, C.S. (1998). Isolation and chondrocytic
differentiation of equine bone marrow-derived mesenchymal stem cells. American journal
of veterinary research 59, 1182-1187.

Fuchs, J.R., Hannouche, D., Terada, S., Zand, S., Vacanti, J.P., and Fauza, D.O. (2005).
Cartilage engineering from ovine umbilical cord blood mesenchymal progenitor cells.
Stem cells (Dayton, Ohio) 23, 958-964.

Gang, E.J., Bosnakovski, D., Figueiredo, C.A., Visser, J.W., and Perlingeiro, R.C. (2007).
SSEA-4 identifies mesenchymal stem cells from bone marrow. Blood 109, 1743-1751.









Gang, E.J., Hong, S.H., Jeong, J.A., Hwang, S.H., Kim, S.W., Yang, I.H., Ahn, C., Han, H., and
Kim, H. (2004a). In vitro mesengenic potential of human umbilical cord blood-derived
mesenchymal stem cells. Biochemical and biophysical research communications 321, 102-
108.

Gang, E.J., Jeong, J.A., Hong, S.H., Hwang, S.H., Kim, S.W., Yang, I.H., Ahn, C., Han, H., and
Kim, H. (2004b). Skeletal myogenic differentiation of mesenchymal stem cells isolated
from human umbilical cord blood. Stem cells (Dayton, Ohio) 22, 617-624.

Gao, X., Tate, P., Hu, P., Tjian, R., Skarnes, W.C., and Wang, Z. (2008). ES cell pluripotency
and germ-layer formation require the SWI/SNF chromatin remodeling component
BAF250a. Proceedings of the National Academy of Sciences of the United States of
America 105, 6656-6661.

Gerecht-Nir, S., Dazard, J.E., Golan-Mashiach, M., Osenberg, S., Botvinnik, A., Amariglio, N.,
Domany, E., Rechavi, G., Givol, D., and Itskovitz-Eldor, J. (2005). Vascular gene
expression and phenotypic correlation during differentiation of human embryonic stem
cells. Dev Dyn 232, 487-497.

Ginis, I., Luo, Y., Miura, T., Thies, S., Brandenberger, R., Gerecht-Nir, S., Amit, M., Hoke, A.,
Carpenter, M.K., Itskovitz-Eldor, J., and Rao, M.S. (2004). Differences between human
and mouse embryonic stem cells. Developmental biology 269, 360-380.

Giordano, A., Galderisi, U., and Marino, I.R. (2007). From the laboratory bench to the patient's
bedside: an update on clinical trials with mesenchymal stem cells. Journal of cellular
physiology 211, 27-35.

Giovannini, S., Brehm, W., Mainil-Varlet, P., and Nesic, D. (2008). Multilineage differentiation
potential of equine blood-derived fibroblast-like cells. Differentiation; research in
biological diversity 76, 118-129.

Gong, Z., Calkins, G., Cheng, E.C., Krause, D., and Niklason, L.E. (2008). Influence of Culture
Medium on Smooth Muscle Cell Differentiation from Human Bone Marrow-Derived
Mesenchymal Stem Cells. Tissue Eng Part A.

Goodship, A.E., Birch, H.L., and Wilson, A.M. (1994). The pathobiology and repair of tendon
and ligament injury. The Veterinary clinics of North America 10, 323-349.

Goodwin, H.S., Bicknese, A.R., Chien, S.N., Bogucki, B.D., Quinn, C.O., and Wall, D.A.
(2001). Multilineage differentiation activity by cells isolated from umbilical cord blood:
expression of bone, fat, and neural markers. Biol Blood Marrow Transplant 7, 581-588.

Greco, S.J., Liu, K., and Rameshwar, P. (2007). Functional similarities among genes regulated
by OCT4 in human mesenchymal and embryonic stem cells. Stem cells (Dayton, Ohio) 25,
3143-3154.









Gronthos, S., Franklin, D.M., Leddy, H.A., Robey, P.G., Storms, R.W., and Gimble, J.M. (2001).
Surface protein characterization of human adipose tissue-derived stromal cells. Journal of
cellular physiology 189, 54-63.

Guest, D.J., and Allen, W.R. (2007). Expression of cell-surface antigens and embryonic stem cell
pluripotency genes in equine blastocysts. Stem cells and development 16, 789-796.

Guest, D.J., Smith, M.R., and Allen, W.R. (2008). Monitoring the fate of autologous and
allogeneic mesenchymal progenitor cells injected into the superficial digital flexor tendon
of horses: preliminary study. Equine veterinary journal 40, 178-181.

Guilak, F., Lott, K.E., Awad, H.A., Cao, Q., Hicok, K.C., Fermor, B., and Gimble, J.M. (2006).
Clonal analysis of the differentiation potential of human adipose-derived adult stem cells.
Journal of cellular physiology 206, 229-237.

Gupta, M.C., Theerajunyaporn, T., Maitra, S., Schmidt, M.B., Holy, C.E., Kadiyala, S., and
Bruder, S.P. (2007). Efficacy of mesenchymal stem cell enriched grafts in an ovine
posterolateral lumbar spine model. Spine 32, 720-726; discussion 727.

Hankemeier, S., van Griensven, M., Ezechieli, M., Barkhausen, T., Austin, M., Jagodzinski, M.,
Meller, R., Bosch, U., Krettek, C., and Zeichen, J. (2007). Tissue engineering of tendons
and ligaments by human bone marrow stromal cells in a liquid fibrin matrix in
immunodeficient rats: results of a histologic study. Archives of orthopaedic and trauma
surgery 127, 815-821.

Hatoya, S., Torii, R., Kondo, Y., Okuno, T., Kobayashi, K., Wijewardana, V., Kawate, N.,
Tamada, H., Sawada, T., Kumagai, D., Sugiura, K., and Inaba, T. (2006). Isolation and
characterization of embryonic stem-like cells from canine blastocysts. Molecular
reproduction and development 73, 298-305.

Hayashi, Y., Furue, M.K., Okamoto, T., Ohnuma, K., Myoishi, Y., Fukuhara, Y., Abe, T., Sato,
J.D., Hata, R., and Asashima, M. (2007). Integrins regulate mouse embryonic stem cell
self-renewal. Stem cells (Dayton, Ohio) 25, 3005-3015.

He, X., Gonzalez, V., Tsang, A., Thompson, J., Tsang, T.C., and Harris, D.T. (2005).
Differential gene expression profiling of CD34+ CD133+ umbilical cord blood
hematopoietic stem progenitor cells. Stem cells and development 14, 188-198.

Henderson, J.K., Draper, J.S., Baillie, H.S., Fishel, S., Thomson, J.A., Moore, H., and Andrews,
P.W. (2002). Preimplantation human embryos and embryonic stem cells show comparable
expression of stage-specific embryonic antigens. Stem cells (Dayton, Ohio) 20, 329-337.

Henikoff, S., Furuyama, T., and Ahmad, K. (2004). Histone variants, nucleosome assembly and
epigenetic inheritance. Trends Genet 20, 320-326.

Hildebrandt, C., Buth, H., and Thielecke, H. (2009). Influence of cell culture media conditions
on the osteogenic differentiation of cord blood-derived mesenchymal stem cells. Ann Anat
191, 23-32.









Holm, M., Kvistgaard, H., Dahl, C., Andersen, H.B., Hansen, T.K., Schiotz, P.O., and Junker, S.
(2006). Modulation of chemokine gene expression in CD133+ cord blood-derived human
mast cells by cyclosporin A and dexamethasone. Scandinavian journal of immunology 64,
571-579.

Hong, S.H., Gang, E.J., Jeong, J.A., Ahn, C., Hwang, S.H., Yang, I.H., Park, H.K., Han, H., and
Kim, H. (2005). In vitro differentiation of human umbilical cord blood-derived
mesenchymal stem cells into hepatocyte-like cells. Biochemical and biophysical research
communications 330, 1153-1161.

Hough, S.R., Clements, I., Welch, P.J., and Wiederholt, K.A. (2006). Differentiation of mouse
embryonic stem cells after RNA interference-mediated silencing of OCT4 and Nanog.
Stem cells (Dayton, Ohio) 24, 1467-1475.

Huang, J.I., Durbhakula, M.M., Angele, P., Johnstone, B., and Yoo, J.U. (2006). Lunate
arthroplasty with autologous mesenchymal stem cells in a rabbit model. The Journal of
bone and joint surgery 88, 744-752.

Huang, S., Law, P., Francis, K., Palsson, B.O., and Ho, A.D. (1999). Symmetry of initial cell
divisions among primitive hematopoietic progenitors is independent of ontogenic age and
regulatory molecules. Blood 94, 2595-2604.

Huangfu, D., Osafune, K., Maehr, R., Guo, W., Eijkelenboom, A., Chen, S., Muhlestein, W., and
Melton, D.A. (2008). Induction of pluripotent stem cells from primary human fibroblasts
with only Oct4 and Sox2. Nature biotechnology 26, 1269-1275.

Hyslop, L., Stojkovic, M., Armstrong, L., Walter, T., Stojkovic, P., Przyborski, S., Herbert, M.,
Murdoch, A., Strachan, T., and Lako, M. (2005). Downregulation of NANOG induces
differentiation of human embryonic stem cells to extraembryonic lineages. Stem cells
(Dayton, Ohio) 23, 1035-1043.

Im, G.I., Kim, D.Y., Shin, J.H., Hyun, C.W., and Cho, W.H. (2001). Repair of cartilage defect in
the rabbit with cultured mesenchymal stem cells from bone marrow. J Bone Joint Surg Br
83, 289-294.

Jaenisch, R., and Bird, A. (2003). Epigenetic regulation of gene expression: how the genome
integrates intrinsic and environmental signals. Nature genetics 33 Suppl, 245-254.

Jenuwein, T., and Allis, C.D. (2001). Translating the histone code. Science (New York, N.Y 293,
1074-1080.

Jeong, J.A., Gang, E.J., Hong, S.H., Hwang, S.H., Kim, S.W., Yang, I.H., Ahn, C., Han, H., and
Kim, H. (2004). Rapid neural differentiation of human cord blood-derived mesenchymal
stem cells. Neuroreport 15, 1731-1734.

Johnson, D.E., Lee, P.L., Lu, J., and Williams, L.T. (1990). Diverse forms of a receptor for
acidic and basic fibroblast growth factors. Molecular and cellular biology 10, 4728-4736.









Juncosa-Melvin, N., Shearn, J.T., Boivin, G.P., Gooch, C., Galloway, M.T., West, J.R.,
Nirmalanandhan, V.S., Bradica, G., and Butler, D.L. (2006). Effects of mechanical
stimulation on the biomechanics and histology of stem cell-collagen sponge constructs for
rabbit patellar tendon repair. Tissue engineering 12, 2291-2300.

Jurga, M., Lipkowski, A.W., Lukomska, B., Buzanska, L., Kurzepa, K., Sobanski, T., Habich,
A., Coecke, S., Gajkowska, B., and Domanska-Janik, K. (2009). Generation of Functional
Neural Artificial Tissue from Human Umbilical Cord Blood Stem Cells. Tissue Eng Part
A.

Kadivar, M., Khatami, S., Mortazavi, Y., Shokrgozar, M.A., Taghikhani, M., and Soleimani, M.
(2006). In vitro cardiomyogenic potential of human umbilical vein-derived mesenchymal
stem cells. Biochemical and biophysical research communications 340, 639-647.

Kang, X.Q., Zang, W.J., Bao, L.J., Li, D.L., Song, T.S., Xu, X.L., and Yu, X.J. (2005).
Fibroblast growth factor-4 and hepatocyte growth factor induce differentiation of human
umbilical cord blood-derived mesenchymal stem cells into hepatocytes. World J
Gastroenterol 11, 7461-7465.

Kardon, G. (1998). Muscle and tendon morphogenesis in the avian hind limb. Development
(Cambridge, England) 125, 4019-4032.

Katz, A.J., Tholpady, A., Tholpady, S.S., Shang, H., and Ogle, R.C. (2005). Cell surface and
transcriptional characterization of human adipose-derived adherent stromal (hADAS) cells.
Stem cells (Dayton, Ohio) 23, 412-423.

Kern, S., Eichler, H., Stoeve, J., Kluter, H., and Bieback, K. (2006). Comparative analysis of
mesenchymal stem cells from bone marrow, umbilical cord blood, or adipose tissue. Stem
cells (Dayton, Ohio) 24, 1294-1301.

Kestendjieva, S., Kyurkchiev, D., Tsvetkova, G., Mehandjiev, T., Dimitrov, A., Nikolov, A., and
Kyurkchiev, S. (2008). Characterization of mesenchymal stem cells isolated from the
human umbilical cord. Cell biology international 32, 724-732.

Kim, J.W., Kim, S.Y., Park, S.Y., Kim, Y.M., Kim, J.M., Lee, M.H., and Ryu, H.M. (2004).
Mesenchymal progenitor cells in the human umbilical cord. Annals of hematology 83,
733-738.

Kisiday, J.D., Kopesky, P.W., Evans, C.H., Grodzinsky, A.J., McIlwraith, C.W., and Frisbie,
D.D. (2008). Evaluation of adult equine bone marrow- and adipose-derived progenitor cell
chondrogenesis in hydrogel cultures. J Orthop Res 26, 322-331.

Koch, T.G., Heerkens, T., Thomsen, P.D., and Betts, D.H. (2007). Isolation of mesenchymal
stem cells from equine umbilical cord blood. BMC biotechnology 7, 26.

Koerner, J., Nesic, D., Romero, J.D., Brehm, W., Mainil-Varlet, P., and Grogan, S.P. (2006).
Equine peripheral blood-derived progenitors in comparison to bone marrow-derived
mesenchymal stem cells. Stem cells (Dayton, Ohio) 24, 1613-1619.









Kogler, G., Sensken, S., Airey, J.A., Trapp, T., Muschen, M., Feldhahn, N., Liedtke, S., Sorg,
R.V., Fischer, J., Rosenbaum, C., Greschat, S., Knipper, A., Bender, J., Degistirici, O.,
Gao, J., Caplan, A.I., Colletti, E.J., Almeida-Porada, G., Muller, H.W., Zanjani, E., and
Wernet, P. (2004). A new human somatic stem cell from placental cord blood with
intrinsic pluripotent differentiation potential. The Journal of experimental medicine 200,
123-135.

Kon, E., Muraglia, A., Corsi, A., Bianco, P., Marcacci, M., Martin, I., Boyde, A., Ruspantini, I.,
Chistolini, P., Rocca, M., Giardino, R., Cancedda, R., and Quarto, R. (2000). Autologous
bone marrow stromal cells loaded onto porous hydroxyapatite ceramic accelerate bone
repair in critical-size defects of sheep long bones. Journal of biomedical materials research
49, 328-337.

Kondo, K., Shintani, S., Shibata, R., Murakami, H., Murakami, R., Imaizumi, M., Kitagawa, Y.,
and Murohara, T. (2009). Implantation of adipose-derived regenerative cells enhances
ischemia-induced angiogenesis. Arteriosclerosis, thrombosis, and vascular biology 29, 61-
66.

Kong, K.Y., Ren, J., Kraus, M., Finklestein, S.P., and Brown, R.H., Jr. (2004). Human umbilical
cord blood cells differentiate into muscle in sjl muscular dystrophy mice. Stem cells
(Dayton, Ohio) 22, 981-993.

Kramer, J., Hegert, C., Hargus, G., and Rohwedel, J. (2005). Mouse ES cell lines show a variable
degree of chondrogenic differentiation in vitro. Cell biology international 29, 139-146.

Kuang, S., Kuroda, K., Le Grand, F., and Rudnicki, M.A. (2007). Asymmetric self-renewal and
commitment of satellite stem cells in muscle. Cell 129, 999-1010.

Kumar, B.M., Yoo, J.G., Ock, S.A., Kim, J.G., Song, H.J., Kang, E.J., Cho, S.K., Lee, S.L., Cho,
J.H., Balasubramanian, S., and Rho, G.J. (2007). In vitro differentiation of mesenchymal
progenitor cells derived from porcine umbilical cord blood. Molecules and cells 24, 343-
350.

Kunath, T., Saba-El-Leil, M.K., Almousailleakh, M., Wray, J., Meloche, S., and Smith, A.
(2007). FGF stimulation of the Erkl/2 signalling cascade triggers transition of pluripotent
embryonic stem cells from self-renewal to lineage commitment. Development (Cambridge,
England) 134, 2895-2902.

Kunisato, A., Chiba, S., Nakagami-Yamaguchi, E., Kumano, K., Saito, T., Masuda, S.,
Yamaguchi, T., Osawa, M., Kageyama, R., Nakauchi, H., Nishikawa, M., and Hirai, H.
(2003). HES-1 preserves purified hematopoietic stem cells ex vivo and accumulates side
population cells in vivo. Blood 101, 1777-1783.

Kuo, C.K., and Tuan, R.S. (2008). Mechanoactive tenogenic differentiation of human
mesenchymal stem cells. Tissue Eng Part A 14, 1615-1627.









Kuroda, T., Tada, M., Kubota, H., Kimura, H., Hatano, S.Y., Suemori, H., Nakatsuji, N., and
Tada, T. (2005). Octamer and Sox elements are required for transcriptional cis regulation
ofNanog gene expression. Molecular and cellular biology 25, 2475-2485.

Le Guen, L., Notamicola, C., and de Santa Barbara, P. (2009). Intermuscular tendons are
essential for the development of vertebrate stomach. Development (Cambridge, England)
136, 791-801.

Lee, M.W., Choi, J., Yang, M.S., Moon, Y.J., Park, J.S., Kim, H.C., and Kim, Y.J. (2004a).
Mesenchymal stem cells from cryopreserved human umbilical cord blood. Biochemical
and biophysical research communications 320, 273-278.

Lee, M.W., Moon, Y.J., Yang, M.S., Kim, S.K., Jang, I.K., Eom, Y.W., Park, J.S., Kim, H.C.,
Song, K.Y., Park, S.C., Lim, H.S., and Kim, Y.J. (2007). Neural differentiation of novel
multipotent progenitor cells from cryopreserved human umbilical cord blood. Biochemical
and biophysical research communications 358, 637-643.

Lee, M.W., Yang, M.S., Park, J.S., Kim, H.C., Kim, Y.J., and Choi, J. (2005). Isolation of
mesenchymal stem cells from cryopreserved human umbilical cord blood. International
journal of hematology 81, 126-130.

Lee, O.K., Kuo, T.K., Chen, W.M., Lee, K.D., Hsieh, S.L., and Chen, T.H. (2004b). Isolation of
multipotent mesenchymal stem cells from umbilical cord blood. Blood 103, 1669-1675.

Lee, P.L., Johnson, D.E., Cousens, L.S., Fried, V.A., and Williams, L.T. (1989). Purification and
complementary DNA cloning of a receptor for basic fibroblast growth factor. Science
(New York, N.Y 245, 57-60.

Lee, T.I., Jenner, R.G., Boyer, L.A., Guenther, M.G., Levine, S.S., Kumar, R.M., Chevalier, B.,
Johnstone, S.E., Cole, M.F., Isono, K., Koseki, H., Fuchikami, T., Abe, K., Murray, H.L.,
Zucker, J.P., Yuan, B., Bell, G.W., Herbolsheimer, E., Hannett, N.M., Sun, K., Odom,
D.T., Otte, A.P., Volkert, T.L., Bartel, D.P., Melton, D.A., Gifford, D.K., Jaenisch, R., and
Young, R.A. (2006). Control of developmental regulators by Polycomb in human
embryonic stem cells. Cell 125, 301-313.

Lefebvre, V., Behringer, R.R., and de Crombrugghe, B. (2001). L-Sox5, Sox6 and Sox9 control
essential steps of the chondrocyte differentiation pathway. Osteoarthritis and cartilage /
OARS, Osteoarthritis Research Society 9 SupplA, S69-75.

Lejard, V., Brideau, G., Blais, F., Salingcarnboriboon, R., Wagner, G., Roehrl, M.H., Noda, M.,
Duprez, D., Houillier, P., and Rossert, J. (2007). Scleraxis and NFATc regulate the
expression of the pro-alphal(I) collagen gene in tendon fibroblasts. The Journal of
biological chemistry 282, 17665-17675.

Li, H.S., Wang, D., Shen, Q., Schonemann, M.D., Gorski, J.A., Jones, K.R., Temple, S., Jan,
L.Y., and Jan, Y.N. (2003). Inactivation of Numb and Numblike in embryonic dorsal
forebrain impairs neurogenesis and disrupts cortical morphogenesis. Neuron 40, 1105-
1118.









Li, T.S., Komota, T., Ohshima, M., Qin, S.L., Kubo, M., Ueda, K., and Hamano, K. (2008).
TGF-beta induces the differentiation of bone marrow stem cells into immature
cardiomyocytes. Biochemical and biophysical research communications 366, 1074-1080.

Li, X., Zhou, S.G., Imreh, M.P., Ahrlund-Richter, L., and Allen, W.R. (2006). Horse embryonic
stem cell lines from the proliferation of inner cell mass cells. Stem cells and development
15, 523-531.

Liang, J., Wan, M., Zhang, Y., Gu, P., Xin, H., Jung, S.Y., Qin, J., Wong, J., Cooney, A.J., Liu,
D., and Songyang, Z. (2008). Nanog and Oct4 associate with unique transcriptional
repression complexes in embryonic stem cells. Nature cell biology 10, 731-739.

Lin, T., Chao, C., Saito, S., Mazur, S.J., Murphy, M.E., Appella, E., and Xu, Y. (2005). p53
induces differentiation of mouse embryonic stem cells by suppressing Nanog expression.
Nature cell biology 7, 165-171.

Liu, G., Zhao, L., Zhang, W., Cui, L., Liu, W., and Cao, Y. (2008). Repair of goat tibial defects
with bone marrow stromal cells and beta-tricalcium phosphate. Journal of materials science
19, 2367-2376.

Liu, T.M., Martina, M., Hutmacher, D.W., Hui, J.H., Lee, E.H., and Lim, B. (2007).
Identification of common pathways mediating differentiation of bone marrow- and adipose
tissue-derived human mesenchymal stem cells into three mesenchymal lineages. Stem cells
(Dayton, Ohio) 25, 750-760.

Liu, Y., Chattopadhyay, N., Qin, S., Szekeres, C., Vasylyeva, T., Mahoney, Z.X., Taglienti, M.,
Bates, C.M., Chapman, H.A., Miner, J.H., and Kreidberg, J.A. (2009). Coordinate integrin
and c-Met signaling regulate Wnt gene expression during epithelial morphogenesis.
Development (Cambridge, England) 136, 843-853.

Liu, Y., Cserjesi, P., Nifuji, A., Olson, E.N., and Noda, M. (1996). Sclerotome-related helix-
loop-helix type transcription factor (scleraxis) mRNA is expressed in osteoblasts and its
level is enhanced by type-beta transforming growth factor. The Journal of endocrinology
151, 491-499.

Loh, Y.H., Wu, Q., Chew, J.L., Vega, V.B., Zhang, W., Chen, X., Bourque, G., George, J.,
Leong, B., Liu, J., Wong, K.Y., Sung, K.W., Lee, C.W., Zhao, X.D., Chiu, K.P., Lipovich,
L., Kuznetsov, V.A., Robson, P., Stanton, L.W., Wei, C.L., Ruan, Y., Lim, B., and Ng,
H.H. (2006). The Oct4 and Nanog transcription network regulates pluripotency in mouse
embryonic stem cells. Nature genetics 38, 431-440.

Lowell, S., Benchoua, A., Heavey, B., and Smith, A.G. (2006). Notch promotes neural lineage
entry by pluripotent embryonic stem cells. PLoS biology 4, el21.

Lowry, W.E., Richter, L., Yachechko, R., Pyle, A.D., Tchieu, J., Sridharan, R., Clark, A.T., and
Plath, K. (2008). Generation of human induced pluripotent stem cells from dermal
fibroblasts. Proceedings of the National Academy of Sciences of the United States of
America 105, 2883-2888.









Ma, N., Ladilov, Y., Moebius, J.M., Ong, L., Piechaczek, C., David, A., Kaminski, A., Choi,
Y.H., Li, W., Egger, D., Stamm, C., and Steinhoff, G. (2006). Intramyocardial delivery of
human CD133+ cells in a SCID mouse cryoinjury model: Bone marrow vs. cord blood-
derived cells. Cardiovascular research 71, 158-169.

Ma, W., Tavakoli, T., Derby, E., Serebryakova, Y., Rao, M.S., and Mattson, M.P. (2008). Cell-
extracellular matrix interactions regulate neural differentiation of human embryonic stem
cells. BMC developmental biology 8, 90.

Maherali, N., Sridharan, R., Xie, W., Utikal, J., Eminli, S., Arnold, K., Stadtfeld, M., Yachechko,
R., Tchieu, J., Jaenisch, R., Plath, K., and Hochedlinger, K. (2007). Directly
reprogrammed fibroblasts show global epigenetic remodeling and widespread tissue
contribution. Cell stem cell 1, 55-70.

Marcacci, M., Kon, E., Moukhachev, V., Lavroukov, A., Kutepov, S., Quarto, R.,
Mastrogiacomo, M., and Cancedda, R. (2007). Stem cells associated with macroporous
bioceramics for long bone repair: 6- to 7-year outcome of a pilot clinical study. Tissue
engineering 13, 947-955.

Markov, V., Kusumi, K., Tadesse, M.G., William, D.A., Hall, D.M., Lounev, V., Carlton, A.,
Leonard, J., Cohen, R.I., Rappaport, E.F., and Saitta, B. (2007). Identification of cord
blood-derived mesenchymal stem/stromal cell populations with distinct growth kinetics,
differentiation potentials, and gene expression profiles. Stem cells and development 16,
53-73.

Martin-Rendon, E., Hale, S.J., Ryan, D., Baban, D., Forde, S.P., Roubelakis, M., Sweeney, D.,
Moukayed, M., Harris, A.L., Davies, K., and Watt, S.M. (2007). Transcriptional profiling
of human cord blood CD133+ and cultured bone marrow mesenchymal stem cells in
response to hypoxia. Stem cells (Dayton, Ohio) 25, 1003-1012.

Masui, S., Nakatake, Y., Toyooka, Y., Shimosato, D., Yagi, R., Takahashi, K., Okochi, H.,
Okuda, A., Matoba, R., Sharov, A.A., Ko, M.S., and Niwa, H. (2007). Pluripotency
governed by Sox2 via regulation of Oct3/4 expression in mouse embryonic stem cells.
Nature cell biology 9, 625-635.

Matsuda, T., Nakamura, T., Nakao, K., Arai, T., Katsuki, M., Heike, T., and Yokota, T. (1999).
STAT3 activation is sufficient to maintain an undifferentiated state of mouse embryonic
stem cells. The EMBO journal 18, 4261-4269.

Mayshar, Y., Rom, E., Chumakov, I., Kronman, A., Yayon, A., and Benvenisty, N. (2008).
Fibroblast growth factor 4 and its novel splice isoform have opposing effects on the
maintenance of human embryonic stem cell self-renewal. Stem cells (Dayton, Ohio) 26,
767-774.

McDonald, J.W., Liu, X.Z., Qu, Y., Liu, S., Mickey, S.K., Turetsky, D., Gottlieb, D.I., and Choi,
D.W. (1999). Transplanted embryonic stem cells survive, differentiate and promote
recovery in injured rat spinal cord. Nature medicine 5, 1410-1412.









McGuckin, C.P., Pearce, D., Forraz, N., Tooze, J.A., Watt, S.M., and Pettengell, R. (2003).
Multiparametric analysis of immature cell populations in umbilical cord blood and bone
marrow. European journal of haematology 71, 341-350.

Mehlhorn, A.T., Zwingmann, J., Finkenzeller, G., Niemeyer, P., Dauner, M., Stark, B.,
Sudkamp, N.P., and Schmal, H. (2009). Chondrogenesis of Adipose-Derived Adult Stem
Cells in a Poly-Lactide-Co-Glycolide Scaffold. Tissue Eng Part A.

Meirelles Lda, S., and Nardi, N.B. (2003). Murine marrow-derived mesenchymal stem cell:
isolation, in vitro expansion, and characterization. British journal of haematology 123,
702-711.

Meshorer, E., Yellajoshula, D., George, E., Scambler, P.J., Brown, D.T., and Misteli, T. (2006).
Hyperdynamic plasticity of chromatin proteins in pluripotent embryonic stem cells.
Developmental cell 10, 105-116.

Mignatti, P., Morimoto, T., and Rifkin, D.B. (1992). Basic fibroblast growth factor, a protein
devoid of secretary signal sequence, is released by cells via a pathway independent of the
endoplasmic reticulum-Golgi complex. Journal of cellular physiology 151, 81-93.

Miki, T., Bottaro, D.P., Fleming, T.P., Smith, C.L., Burgess, W.H., Chan, A.M., and Aaronson,
S.A. (1992). Determination of ligand-binding specificity by alternative splicing: two
distinct growth factor receptors encoded by a single gene. Proceedings of the National
Academy of Sciences of the United States of America 89, 246-250.

Mitsui, K., Tokuzawa, Y., Itoh, H., Segawa, K., Murakami, M., Takahashi, K., Maruyama, M.,
Maeda, M., and Yamanaka, S. (2003). The homeoprotein Nanog is required for
maintenance of pluripotency in mouse epiblast and ES cells. Cell 113, 631-642.

Mrugala, D., Bony, C., Neves, N., Caillot, L., Fabre, S., Moukoko, D., Jorgensen, C., and Noel,
D. (2008). Phenotypic and functional characterisation of ovine mesenchymal stem cells:
application to a cartilage defect model. Annals of the rheumatic diseases 67, 288-295.

Muir, T., Sadler-Riggleman, I., and Skinner, M.K. (2005). Role of the basic helix-loop-helix
transcription factor, scleraxis, in the regulation of Sertoli cell function and differentiation.
Molecular endocrinology (Baltimore, Md 19, 2164-2174.

Murchison, N.D., Price, B.A., Conner, D.A., Keene, D.R., Olson, E.N., Tabin, C.J., and
Schweitzer, R. (2007). Regulation of tendon differentiation by scleraxis distinguishes
force-transmitting tendons from muscle-anchoring tendons. Development (Cambridge,
England) 134, 2697-2708.

Muschler, G.F., Nitto, H., Matsukura, Y., Boehm, C., Valdevit, A., Kambic, H., Davros, W.,
Powell, K., and Easley, K. (2003). Spine fusion using cell matrix composites enriched in
bone marrow-derived cells. Clinical orthopaedics and related research, 102-118.









Ng, L.J., Wheatley, S., Muscat, G.E., Conway-Campbell, J., Bowles, J., Wright, E., Bell, D.M.,
Tam, P.P., Cheah, K.S., and Koopman, P. (1997). SOX9 binds DNA, activates
transcription, and coexpresses with type II collagen during chondrogenesis in the mouse.
Developmental biology 183, 108-121.

Nichols, J., Zevnik, B., Anastassiadis, K., Niwa, H., Klewe-Nebenius, D., Chambers, I., Scholer,
H., and Smith, A. (1998). Formation ofpluripotent stem cells in the mammalian embryo
depends on the POU transcription factor Oct4. Cell 95, 379-391.

Nishiyama, N., Miyoshi, S., Hida, N., Uyama, T., Okamoto, K., Ikegami, Y., Miyado, K.,
Segawa, K., Terai, M., Sakamoto, M., Ogawa, S., and Umezawa, A. (2007). The
significant cardiomyogenic potential of human umbilical cord blood-derived mesenchymal
stem cells in vitro. Stem cells (Dayton, Ohio) 25, 2017-2024.

Niwa, H. (2001). Molecular mechanism to maintain stem cell renewal of ES cells. Cell structure
and function 26, 137-148.

Niwa, H., Burdon, T., Chambers, I., and Smith, A. (1998). Self-renewal of pluripotent embryonic
stem cells is mediated via activation of STAT3. Genes & development 12, 2048-2060.

Niwa, H., Miyazaki, J., and Smith, A.G. (2000). Quantitative expression of Oct-3/4 defines
differentiation, dedifferentiation or self-renewal of ES cells. Nature genetics 24, 372-376.

Nixon, A.J., Dahlgren, L.A., Haupt, J.L., Yeager, A.E., and Ward, D.L. (2008). Effect of
adipose-derived nucleated cell fractions on tendon repair in horses with collagenase-
induced tendinitis. American journal of veterinary research 69, 928-937.

Nunes, V.A., Cavacana, N., Canovas, M., Strauss, B.E., and Zatz, M. (2007). Stem cells from
umbilical cord blood differentiate into myotubes and express dystrophin in vitro only after
exposure to in vivo muscle environment. Biology of the cell / under the auspices of the
European Cell Biology Organization 99, 185-196.

Oedayrajsingh-Varma, M.J., Ham, S.M.v., Knippenberg, M., Helder, M.N., Klein Nulend, J.,
Schouten, T.E., Ritt, M.J.P.F., and Milligen, F.J.v. (2006). Adipose tissue-derived
mesenchymal stem cell yield and growth characteristics are affected by the tissue-
harvesting procedure.

Ogawa, Y., Sawamoto, K., Miyata, T., Miyao, S., Watanabe, M., Nakamura, M., Bregman, B.S.,
Koike, M., Uchiyama, Y., Toyama, Y., and Okano, H. (2002). Transplantation of in vitro-
expanded fetal neural progenitor cells results in neurogenesis and functional recovery after
spinal cord contusion injury in adult rats. Journal of neuroscience research 69, 925-933.

Okamoto, K., Okazawa, H., Okuda, A., Sakai, M., Muramatsu, M., and Hamada, H. (1990). A
novel octamer binding transcription factor is differentially expressed in mouse embryonic
cells. Cell 60, 461-472.

Okita, K., Ichisaka, T., and Yamanaka, S. (2007). Generation of germline-competent induced
pluripotent stem cells. Nature 448, 313-317.









Orii, H., Sotome, S., Chen, J., Wang, J., and Shinomiya, K. (2005). Beta-tricalcium phosphate
(beta-TCP) graft combined with bone marrow stromal cells (MSCs) for posterolateral
spine fusion. Journal of medical and dental sciences 52, 51-57.

Orr-Urtreger, A., Bedford, M.T., Burakova, T., Arman, E., Zimmer, Y., Yayon, A., Givol, D.,
and Lonai, P. (1993). Developmental localization of the splicing alternatives of fibroblast
growth factor receptor-2 (FGFR2). Developmental biology 158, 475-486.

Pacini, S., Spinabella, S., Trombi, L., Fazzi, R., Galimberti, S., Dini, F., Carlucci, F., and Petrini,
M. (2007). Suspension of bone marrow-derived undifferentiated mesenchymal stromal
cells for repair of superficial digital flexor tendon in race horses. Tissue engineering 13,
2949-2955.

Park, I.H., Zhao, R., West, J.A., Yabuuchi, A., Huo, H., Ince, T.A., Lerou, P.H., Lensch, M.W.,
and Daley, G.Q. (2008). Reprogramming of human somatic cells to pluripotency with
defined factors. Nature 451, 141-146.

Pearson, S., Sroczynska, P., Lacaud, G., and Kouskoff, V. (2008). The stepwise specification of
embryonic stem cells to hematopoietic fate is driven by sequential exposure to Bmp4,
activin A, bFGF and VEGF. Development (Cambridge, England) 135, 1525-1535.

Peled, T., Mandel, J., Goudsmid, R.N., Landor, C., Hasson, N., Harati, D., Austin, M., Hasson,
A., Fibach, E., Shpall, E.J., and Nagler, A. (2004). Pre-clinical development of cord blood-
derived progenitor cell graft expanded ex vivo with cytokines and the polyamine copper
chelator tetraethylenepentamine. Cytotherapy 6, 344-355.

Perez, A.V., Perrine, M., Brainard, N., and Vogel, K.G. (2003). Scleraxis (Scx) directs lacZ
expression in tendon of transgenic mice. Mechanisms of development 120, 1153-1163.

Pesce, M., Orlandi, A., lachininoto, M.G., Straino, S., Torella, A.R., Rizzuti, V., Pompilio, G.,
Bonanno, G., Scambia, G., and Capogrossi, M.C. (2003). Myoendothelial differentiation of
human umbilical cord blood-derived stem cells in ischemic limb tissues. Circulation
research 93, e51-62.

Pevny, L.H., and Lovell-Badge, R. (1997). Sox genes find their feet. Current opinion in genetics
& development 7, 338-344.

Phillips, B.W., Hentze, H., Rust, W.L., Chen, Q.P., Chipperfield, H., Tan, E.K., Abraham, S.,
Sadasivam, A., Soong, P.L., Wang, S.T., Lim, R., Sun, W., Colman, A., and Dunn, N.R.
(2007). Directed differentiation of human embryonic stem cells into the pancreatic
endocrine lineage. Stem cells and development 16, 561-578.

Piedrahita, J.A., Zhang, S.H., Hagaman, J.R., Oliver, P.M., and Maeda, N. (1992). Generation of
mice carrying a mutant apolipoprotein E gene inactivated by gene targeting in embryonic
stem cells. Proceedings of the National Academy of Sciences of the United States of
America 89, 4471-4475.









Pinchbeck, G.L., Clegg, P.D., Proudman, C.J., Stirk, A., Morgan, K.L., and French, N.P. (2004).
Horse injuries and racing practices in National Hunt racehorses in the UK: the results of a
prospective cohort study. Vet J 167, 45-52.

Pittenger, M.F., Mackay, A.M., Beck, S.C., Jaiswal, R.K., Douglas, R., Mosca, J.D., Moorman,
M.A., Simonetti, D.W., Craig, S., and Marshak, D.R. (1999). Multilineage potential of
adult human mesenchymal stem cells. Science (New York, N.Y 284, 143-147.

Plotnikov, A.N., Schlessinger, J., Hubbard, S.R., and Mohammadi, M. (1999). Structural basis
for FGF receptor dimerization and activation. Cell 98, 641-650.

Porat, Y., Porozov, S., Belkin, D., Shimoni, D., Fisher, Y., Belleli, A., Czeiger, D., Silverman,
W.F., Belkin, M., Battler, A., Fulga, V., and Savion, N. (2006). Isolation of an adult blood-
derived progenitor cell population capable of differentiation into angiogenic, myocardial
and neural lineages. British journal of haematology 135, 703-714.

Price, E.M., Prather, R.S., and Foley, C.M. (2006). Multipotent adult progenitor cell lines
originating from the peripheral blood of green fluorescent protein transgenic swine. Stem
cells and development 15, 507-522.

Pryce, B.A., Brent, A.E., Murchison, N.D., Tabin, C.J., and Schweitzer, R. (2007). Generation of
transgenic tendon reporters, ScxGFP and ScxAP, using regulatory elements of the scleraxis
gene. Dev Dyn 236, 1677-1682.

Punzel, M., Zhang, T., Liu, D., Eckstein, V., and Ho, A.D. (2002). Functional analysis of initial
cell divisions defines the subsequent fate of individual human CD34(+)CD38(-) cells.
Experimental hematology 30, 464-472.

Rebelatto, C.K., Aguiar, A.M., Moretao, M.P., Senegaglia, A.C., Hansen, P., Barchiki, F.,
Oliveira, J., Martins, J., Kuligovski, C., Mansur, F., Christofis, A., Amaral, V.F., Brofman,
P.S., Goldenberg, S., Nakao, L.S., and Correa, A. (2008). Dissimilar differentiation of
mesenchymal stem cells from bone marrow, umbilical cord blood, and adipose tissue.
Experimental biology and medicine (Maywood, N.J 233, 901-913.

Reed, S.A., and Johnson, S.E. (2008). Equine umbilical cord blood contains a population of stem
cells that express Oct4 and differentiate into mesodermal and endodermal cell types.
Journal of cellular physiology 215, 329-336.

Ren, H., Cao, Y., Zhao, Q., Li, J., Zhou, C., Liao, L., Jia, M., Zhao, Q., Cai, H., Han, Z.C., Yang,
R., Chen, G., and Zhao, R.C. (2006). Proliferation and differentiation of bone marrow
stromal cells under hypoxic conditions. Biochemical and biophysical research
communications 347, 12-21.

Reubinoff, B.E., Pera, M.F., Fong, C.Y., Trounson, A., and Bongso, A. (2000). Embryonic stem
cell lines from human blastocysts: somatic differentiation in vitro. Nature biotechnology
18, 399-404.









Rhyu, M.S., Jan, L.Y., and Jan, Y.N. (1994). Asymmetric distribution of numb protein during
division of the sensory organ precursor cell confers distinct fates to daughter cells. Cell 76,
477-491.

Richardson, L.E., Dudhia, J., Clegg, P.D., and Smith, R. (2007). Stem cells in veterinary
medicine--attempts at regenerating equine tendon after injury. Trends in biotechnology 25,
409-416.

Rider, D.A., Dombrowski, C., Sawyer, A.A., Ng, G.H., Leong, D., Hutmacher, D.W.,
Nurcombe, V., and Cool, S.M. (2008). Autocrine fibroblast growth factor 2 increases the
multipotentiality of human adipose-derived mesenchymal stem cells. Stem cells (Dayton,
Ohio) 26, 1598-1608.

Ringrose, L., Ehret, H., and Paro, R. (2004). Distinct contributions of histone H3 lysine 9 and 27
methylation to locus-specific stability of polycomb complexes. Molecular cell 16, 641-653.

Rodda, D.J., Chew, J.L., Lim, L.H., Loh, Y.H., Wang, B., Ng, H.H., and Robson, P. (2005).
Transcriptional regulation of nanog by OCT4 and SOX2. The Journal of biological
chemistry 280, 24731-24737.

Romanov, Y.A., Svintsitskaya, V.A., and Smirnov, V.N. (2003). Searching for alternative
sources of postnatal human mesenchymal stem cells: candidate MSC-like cells from
umbilical cord. Stem cells (Dayton, Ohio) 21, 105-110.

Rosner, M.H., Vigano, M.A., Ozato, K., Timmons, P.M., Poirier, F., Rigby, P.W., and Staudt,
L.M. (1990). A POU-domain transcription factor in early stem cells and germ cells of the
mammalian embryo. Nature 345, 686-692.

Rovira, M., Delaspre, F., Massumi, M., Serra, S.A., Valverde, M.A., Lloreta, J., Dufresne, M.,
Payre, B., Konieczny, S.F., Savatier, P., Real, F.X., and Skoudy, A. (2008). Murine
embryonic stem cell-derived pancreatic acinar cells recapitulate features of early pancreatic
differentiation. Gastroenterology 135, 1301-1310, 1310 e1301-1305.

Ruzicka, K., Grskovic, B., Pavlovic, V., Qujeq, D., Karimi, A., and Mueller, M.M. (2004).
Differentiation of human umbilical cord blood CD133+ stem cells towards myelo-
monocytic lineage. Clinica chimica acta; international journal of clinical chemistry 343,
85-92.

Saito, S., Ugai, H., Sawai, K., Yamamoto, Y., Minamihashi, A., Kurosaka, K., Kobayashi, Y.,
Murata, T., Obata, Y., and Yokoyama, K. (2002). Isolation of embryonic stem-like cells
from equine blastocysts and their differentiation in vitro. FEBS letters 531, 389-396.

Santos, F., and Dean, W. (2004). Epigenetic reprogramming during early development in
mammals. Reproduction (Cambridge, England) 127, 643-651.

Sato, N., Meijer, L., Skaltsounis, L., Greengard, P., and Brivanlou, A.H. (2004). Maintenance of
pluripotency in human and mouse embryonic stem cells through activation of Wnt
signaling by a pharmacological GSK-3-specific inhibitor. Nature medicine 10, 55-63.









Savatier, P., Huang, S., Szekely, L., Wiman, K.G., and Samarut, J. (1994). Contrasting patterns
of retinoblastoma protein expression in mouse embryonic stem cells and embryonic
fibroblasts. Oncogene 9, 809-818.

Scholer, H.R., Balling, R., Hatzopoulos, A.K., Suzuki, N., and Gruss, P. (1989a). Octamer
binding proteins confer transcriptional activity in early mouse embryogenesis. The EMBO
journal 8, 2551-2557.

Scholer, H.R., Hatzopoulos, A.K., Balling, R., Suzuki, N., and Gruss, P. (1989b). A family of
octamer-specific proteins present during mouse embryogenesis: evidence for germline-
specific expression of an Oct factor. The EMBO journal 8, 2543-2550.

Schwartz, R.E., Reyes, M., Koodie, L., Jiang, Y., Blackstad, M., Lund, T., Lenvik, T., Johnson,
S., Hu, W.S., and Verfaillie, C.M. (2002). Multipotent adult progenitor cells from bone
marrow differentiate into functional hepatocyte-like cells. The Journal of clinical
investigation 109, 1291-1302.

Schweitzer, R., Chyung, J.H., Murtaugh, L.C., Brent, A.E., Rosen, V., Olson, E.N., Lassar, A.,
and Tabin, C.J. (2001). Analysis of the tendon cell fate using Scleraxis, a specific marker
for tendons and ligaments. Development (Cambridge, England) 128, 3855-3866.

Scotet, E., and Houssaint, E. (1995). The choice between alternative IIIb and IIIc exons of the
FGFR-3 gene is not strictly tissue-specific. Biochimica et biophysica acta 1264, 238-242.

Shinin, V., Gayraud-Morel, B., Gomes, D., and Tajbakhsh, S. (2006). Asymmetric division and
cosegregation of template DNA strands in adult muscle satellite cells. Nature cell biology
8, 677-687.

Smith, R.K., Korda, M., Blunn, G.W., and Goodship, A.E. (2003). Isolation and implantation of
autologous equine mesenchymal stem cells from bone marrow into the superficial digital
flexor tendon as a potential novel treatment. Equine veterinary journal 35, 99-102.

Smith, T.G., Sweetman, D., Patterson, M., Keyse, S.M., and Munsterberg, A. (2005). Feedback
interactions between MKP3 and ERK MAP kinase control scleraxis expression and the
specification of rib progenitors in the developing chick somite. Development (Cambridge,
England) 132, 1305-1314.

Solchaga, L.A., Penick, K., Porter, J.D., Goldberg, V.M., Caplan, A.I., and Welter, J.F. (2005).
FGF-2 enhances the mitotic and chondrogenic potentials of human adult bone marrow-
derived mesenchymal stem cells. Journal of cellular physiology 203, 398-409.

Sottile, V., Thomson, A., and McWhir, J. (2003). In vitro osteogenic differentiation of human ES
cells. Cloning and stem cells 5, 149-155.

Sparrow, R.L., Cauchi, J.A., Ramadi, L.T., Waugh, C.M., and Kirkland, M.A. (2002). Influence
of mode of birth and collection on WBC yields of umbilical cord blood units. Transfusion
42, 210-215.









Spradling, A.C., and Zheng, Y. (2007). Developmental biology. The mother of all stem cells?
Science (New York, N.Y 315, 469-470.

Stenderup, K., Justesen, J., Clausen, C., and Kassem, M. (2003). Aging is associated with
decreased maximal life span and accelerated senescence of bone marrow stromal cells.
Bone 33, 919-926.

Stewart, A.A., Byron, C.R., Pondenis, H., and Stewart, M.C. (2007). Effect of fibroblast growth
factor-2 on equine mesenchymal stem cell monolayer expansion and chondrogenesis.
American journal of veterinary research 68, 941-945.

Stier, S., Cheng, T., Dombkowski, D., Carlesso, N., and Scadden, D.T. (2002). Notchl activation
increases hematopoietic stem cell self-renewal in vivo and favors lymphoid over myeloid
lineage outcome. Blood 99, 2369-2378.

Stojkovic, M., Lako, M., Stojkovic, P., Stewart, R., Przyborski, S., Armstrong, L., Evans, J.,
Herbert, M., Hyslop, L., Ahmad, S., Murdoch, A., and Strachan, T. (2004). Derivation of
human embryonic stem cells from day-8 blastocysts recovered after three-step in vitro
culture. Stem cells (Dayton, Ohio) 22, 790-797.

Suda, J., Suda, T., and Ogawa, M. (1984a). Analysis of differentiation of mouse hemopoietic
stem cells in culture by sequential replating of paired progenitors. Blood 64, 393-399.

Suda, T., Suda, J., and Ogawa, M. (1984b). Disparate differentiation in mouse hemopoietic
colonies derived from paired progenitors. Proceedings of the National Academy of
Sciences of the United States of America 81, 2520-2524.

Sumi, T., Fujimoto, Y., Nakatsuji, N., and Suemori, H. (2004). STAT3 is dispensable for
maintenance of self-renewal in nonhuman primate embryonic stem cells. Stem cells
(Dayton, Ohio) 22, 861-872.

Sun, B., Roh, K.H., Lee, S.R., Lee, Y.S., and Kang, K.S. (2007). Induction of human umbilical
cord blood-derived stem cells with embryonic stem cell phenotypes into insulin producing
islet-like structure. Biochemical and biophysical research communications 354, 919-923.

Takahashi, K., Tanabe, K., Ohnuki, M., Narita, M., Ichisaka, T., Tomoda, K., and Yamanaka, S.
(2007). Induction of pluripotent stem cells from adult human fibroblasts by defined factors.
Cell 131, 861-872.

Takahashi, K., and Yamanaka, S. (2006). Induction of pluripotent stem cells from mouse
embryonic and adult fibroblast cultures by defined factors. Cell 126, 663-676.

Talens-Visconti, R., Bonora, A., Jover, R., Mirabet, V., Carbonell, F., Castell, J.V., and Gomez-
Lechon, M.J. (2006). Hepatogenic differentiation of human mesenchymal stem cells from
adipose tissue in comparison with bone marrow mesenchymal stem cells. World J
Gastroenterol 12, 5834-5845.









Tanaka, T.S., Kunath, T., Kimber, W.L., Jaradat, S.A., Stagg, C.A., Usuda, M., Yokota, T.,
Niwa, H., Rossant, J., and Ko, M.S. (2002). Gene expression profiling of embryo-derived
stem cells reveals candidate genes associated with pluripotency and lineage specificity.
Genome research 12, 1921-1928.

Tang, X.P., Zhang, M., Yang, X., Chen, L.M., and Zeng, Y. (2006). Differentiation of human
umbilical cord blood stem cells into hepatocytes in vivo and in vitro. World J
Gastroenterol 12, 4014-4019.

Taylor, S.E., Smith, R.K., and Clegg, P.D. (2007). Mesenchymal stem cell therapy in equine
musculoskeletal disease: scientific fact or clinical fiction? Equine veterinary journal 39,
172-180.

Taylor, S.E., Vaughan-Thomas, A., Clements, D.N., Pinchbeck, G., Macrory, L.C., Smith, R.K.,
and Clegg, P.D. (2009). Gene expression markers of tendon fibroblasts in normal and
diseased tissue compared to monolayer and three dimensional culture systems. BMC
musculoskeletal disorders 10, 27.

Thompson, S., Clarke, A.R., Pow, A.M., Hooper, M.L., and Melton, D.W. (1989). Germ line
transmission and expression of a corrected HPRT gene produced by gene targeting in
embryonic stem cells. Cell 56, 313-321.

Thomson, J.A., Itskovitz-Eldor, J., Shapiro, S.S., Waknitz, M.A., Swiergiel, J.J., Marshall, V.S.,
and Jones, J.M. (1998). Embryonic stem cell lines derived from human blastocysts.
Science (New York, N.Y 282, 1145-1147.

Tielens, S., Verhasselt, B., Liu, J., Dhont, M., Van Der Elst, J., and Cornelissen, M. (2006).
Generation of embryonic stem cell lines from mouse blastocysts developed in vivo and in
vitro: relation to Oct-4 expression. Reproduction (Cambridge, England) 132, 59-66.

Todorova, M.G., Soria, B., and Quesada, I. (2008). Gap junctional intercellular communication
is required to maintain embryonic stem cells in a non-differentiated and proliferative state.
Journal of cellular physiology 214, 354-362.

Tondreau, T., Meuleman, N., Delforge, A., Dejeneffe, M., Leroy, R., Massy, M., Mortier, C.,
Bron, D., and Lagneaux, L. (2005). Mesenchymal stem cells derived from CD133-positive
cells in mobilized peripheral blood and cord blood: proliferation, Oct4 expression, and
plasticity. Stem cells (Dayton, Ohio) 23, 1105-1112.

Torrente, Y., Belicchi, M., Sampaolesi, M., Pisati, F., Meregalli, M., D'Antona, G., Tonlorenzi,
R., Porretti, L., Gavina, M., Mamchaoui, K., Pellegrino, M.A., Furling, D., Mouly, V.,
Butler-Browne, G.S., Bottinelli, R., Cossu, G., and Bresolin, N. (2004). Human circulating
AC133(+) stem cells restore dystrophin expression and ameliorate function in dystrophic
skeletal muscle. The Journal of clinical investigation 114, 182-195.

Tropel, P., Noel, D., Platet, N., Legrand, P., Benabid, A.L., and Berger, F. (2004). Isolation and
characterisation of mesenchymal stem cells from adult mouse bone marrow. Experimental
cell research 295, 395-406.









Vassilieva, S., Guan, K., Pich, U., and Wobus, A.M. (2000). Establishment of SSEA-1- and Oct-
4-expressing rat embryonic stem-like cell lines and effects of cytokines of the IL-6 family
on clonal growth. Experimental cell research 258, 361-373.

Vendrame, M., Cassady, J., Newcomb, J., Butler, T., Pennypacker, K.R., Zigova, T., Sanberg,
C.D., Sanberg, P.R., and Willing, A.E. (2004). Infusion of human umbilical cord blood
cells in a rat model of stroke dose-dependently rescues behavioral deficits and reduces
infarct volume. Stroke; a journal of cerebral circulation 35, 2390-2395.

Vendrame, M., Gemma, C., de Mesquita, D., Collier, L., Bickford, P.C., Sanberg, C.D., Sanberg,
P.R., Pennypacker, K.R., and Willing, A.E. (2005). Anti-inflammatory effects of human
cord blood cells in a rat model of stroke. Stem cells and development 14, 595-604.

Vendrame, M., Gemma, C., Pennypacker, K.R., Bickford, P.C., Davis Sanberg, C., Sanberg,
P.R., and Willing, A.E. (2006). Cord blood rescues stroke-induced changes in splenocyte
phenotype and function. Experimental neurology 199, 191-200.

Viateau, V., Guillemin, G., Bousson, V., Oudina, K., Hannouche, D., Sedel, L., Logeart-
Avramoglou, D., and Petite, H. (2007). Long-bone critical-size defects treated with tissue-
engineered grafts: a study on sheep. J Orthop Res 25, 741-749.

Vidal, M.A., Kilroy, G.E., Johnson, J.R., Lopez, M.J., Moore, R.M., and Gimble, J.M. (2006).
Cell growth characteristics and differentiation frequency of adherent equine bone marrow-
derived mesenchymal stromal cells: adipogenic and osteogenic capacity. Vet Surg 35, 601-
610.

Wagner, W., Wein, F., Seckinger, A., Frankhauser, M., Wirkner, U., Krause, U., Blake, J.,
Schwager, C., Eckstein, V., Ansorge, W., and Ho, A.D. (2005). Comparative
characteristics of mesenchymal stem cells from human bone marrow, adipose tissue, and
umbilical cord blood. Experimental hematology 33, 1402-1416.

Wakitani, S., Nawata, M., Tensho, K., Okabe, T., Machida, H., and Ohgushi, H. (2007). Repair
of articular cartilage defects in the patello-femoral joint with autologous bone marrow
mesenchymal cell transplantation: three case reports involving nine defects in five knees.
Journal of tissue engineering and regenerative medicine 1, 74-79.

Wakitani, S., Saito, T., and Caplan, A.I. (1995). Myogenic cells derived from rat bone marrow
mesenchymal stem cells exposed to 5-azacytidine. Muscle & nerve 18, 1417-1426.

Wang, J., Levasseur, D.N., and Orkin, S.H. (2008). Requirement ofNanog dimerization for stem
cell self-renewal and pluripotency. Proceedings of the National Academy of Sciences of
the United States of America 105, 6326-6331.

Wang, J., Rao, S., Chu, J., Shen, X., Levasseur, D.N., Theunissen, T.W., and Orkin, S.H. (2006).
A protein interaction network for pluripotency of embryonic stem cells. Nature 444, 364-
368.









Wang, J.A., Fan, Y.Q., Li, C.L., He, H., Sun, Y., and Lv, B.J. (2005a). Human bone marrow-
derived mesenchymal stem cells transplanted into damaged rabbit heart to improve heart
function. Journal of Zhejiang University. Science 6, 242-248.

Wang, L., and Detamore, M.S. (2009). Insulin-like growth factor-I improves chondrogenesis of
predifferentiated human umbilical cord mesenchymal stromal cells. J Orthop Res.

Wang, L., Duan, E., Sung, L.Y., Jeong, B.S., Yang, X., and Tian, X.C. (2005b). Generation and
characterization of pluripotent stem cells from cloned bovine embryos. Biology of
reproduction 73, 149-155.

Watanabe, N., Woo, S.L., Papageorgiou, C., Celechovsky, C., and Takai, S. (2002). Fate of
donor bone marrow cells in medial collateral ligament after simulated autologous
transplantation. Microscopy research and technique 58, 39-44.

Wen, Z., Zhong, Z., and Damell, J.E., Jr. (1995). Maximal activation of transcription by Statl
and Stat3 requires both tyrosine and serine phosphorylation. Cell 82, 241-250.

Wemig, M., Meissner, A., Foreman, R., Brambrink, T., Ku, M., Hochedlinger, K., Bernstein,
B.E., and Jaenisch, R. (2007). In vitro reprogramming of fibroblasts into a pluripotent ES-
cell-like state. Nature 448, 318-324.

White, J., Stead, E., Faast, R., Conn, S., Cartwright, P., and Dalton, S. (2005). Developmental
activation of the Rb-E2F pathway and establishment of cell cycle-regulated cyclin-
dependent kinase activity during embryonic stem cell differentiation. Molecular biology of
the cell 16, 2018-2027.

Wichterle, H., Lieberam, I., Porter, J.A., and Jessell, T.M. (2002). Directed differentiation of
embryonic stem cells into motor neurons. Cell 110, 385-397.

Wilke, M.M., Nydam, D.V., and Nixon, A.J. (2007). Enhanced early chondrogenesis in articular
defects following arthroscopic mesenchymal stem cell implantation in an equine model. J
Orthop Res 25, 913-925.

Willing, A.E., Lixian, J., Milliken, M., Poulos, S., Zigova, T., Song, S., Hart, C., Sanchez-
Ramos, J., and Sanberg, P.R. (2003). Intravenous versus intrastriatal cord blood
administration in a rodent model of stroke. Journal of neuroscience research 73, 296-307.

Worster, A.A., Brower-Toland, B.D., Fortier, L.A., Bent, S.J., Williams, J., and Nixon, A.J.
(2001). Chondrocytic differentiation of mesenchymal stem cells sequentially exposed to
transforming growth factor-betal in monolayer and insulin-like growth factor-I in a three-
dimensional matrix. J Orthop Res 19, 738-749.

Worster, A.A., Nixon, A.J., Brower-Toland, B.D., and Williams, J. (2000). Effect of
transforming growth factor betal on chondrogenic differentiation of cultured equine
mesenchymal stem cells. American journal of veterinary research 61, 1003-1010.









Wu, K.H., Zhou, B., Mo, X.M., Cui, B., Yu, C.T., Lu, S.H., Han, Z.C., and Liu, Y.L. (2007a).
Therapeutic potential of human umbilical cord-derived stem cells in ischemic diseases.
Transplantation proceedings 39, 1620-1622.

Wu, K.H., Zhou, B., Yu, C.T., Cui, B., Lu, S.H., Han, Z.C., and Liu, Y.L. (2007b). Therapeutic
potential of human umbilical cord derived stem cells in a rat myocardial infarction model.
The Annals of thoracic surgery 83, 1491-1498.

Wu, M., Kwon, H.Y., Rattis, F., Blum, J., Zhao, C., Ashkenazi, R., Jackson, T.L., Gaiano, N.,
Oliver, T., and Reya, T. (2007c). Imaging hematopoietic precursor division in real time.
Cell stem cell 1, 541-554.

Wu, Q., Chen, X., Zhang, J., Loh, Y.H., Low, T.Y., Zhang, W., Zhang, W., Sze, S.K., Lim, B.,
and Ng, H.H. (2006). Sall4 interacts with Nanog and co-occupies Nanog genomic sites in
embryonic stem cells. The Journal of biological chemistry 281, 24090-24094.

Xiao, J., Nan, Z., Motooka, Y., and Low, W.C. (2005). Transplantation of a novel cell line
population of umbilical cord blood stem cells ameliorates neurological deficits associated
with ischemic brain injury. Stem cells and development 14, 722-733.

Xu, C., Inokuma, M.S., Denham, J., Golds, K., Kundu, P., Gold, J.D., and Carpenter, M.K.
(2001). Feeder-free growth of undifferentiated human embryonic stem cells. Nature
biotechnology 19, 971-974.

Xu, R.H., Peck, R.M., Li, D.S., Feng, X., Ludwig, T., and Thomson, J.A. (2005). Basic FGF and
suppression of BMP signaling sustain undifferentiated proliferation of human ES cells.
Nature methods 2, 185-190.

Yahata, T., Muguruma, Y., Yumino, S., Sheng, Y., Uno, T., Matsuzawa, H., Ito, M., Kato, S.,
Hotta, T., and Ando, K. (2008). Quiescent human hematopoietic stem cells in the bone
marrow niches organize the hierarchical structure of hematopoiesis. Stem cells (Dayton,
Ohio) 26, 3228-3236.

Yamashita, A., Takada, T., Nemoto, K., Yamamoto, G., and Torii, R. (2006). Transient
suppression of PPARgamma directed ES cells into an osteoblastic lineage. FEBS letters
580, 4121-4125.

Yamashita, Y.M., Jones, D.L., and Fuller, M.T. (2003). Orientation of asymmetric stem cell
division by the APC tumor suppressor and centrosome. Science (New York, N.Y 301,
1547-1550.

Yamashita, Y.M., Mahowald, A.P., Perlin, J.R., and Fuller, M.T. (2007). Asymmetric
inheritance of mother versus daughter centrosome in stem cell division. Science (New
York, N.Y 315, 518-521.

Yan, H., and Yu, C. (2007). Repair of full-thickness cartilage defects with cells of different
origin in a rabbit model. Arthroscopy 23, 178-187.









Yanez, R., Lamana, M.L., Garcia-Castro, J., Colmenero, I., Ramirez, M., and Bueren, J.A.
(2006). Adipose tissue-derived mesenchymal stem cells have in vivo immunosuppressive
properties applicable for the control of the graft-versus-host disease. Stem cells (Dayton,
Ohio) 24, 2582-2591.

Yates, A., and Chambers, I. (2005). The homeodomain protein Nanog and pluripotency in mouse
embryonic stem cells. Biochemical Society transactions 33, 1518-1521.

Yeom, Y.I., Fuhrmann, G., Ovitt, C.E., Brehm, A., Ohbo, K., Gross, M., Hubner, K., and
Scholer, H.R. (1996). Germline regulatory element of Oct-4 specific for the totipotent
cycle of embryonal cells. Development (Cambridge, England) 122, 881-894.

Ying, Q.L., Nichols, J., Chambers, I., and Smith, A. (2003). BMP induction of Id proteins
suppresses differentiation and sustains embryonic stem cell self-renewal in collaboration
with STAT3. Cell 115, 281-292.

Yoshimura, H., Muneta, T., Nimura, A., Yokoyama, A., Koga, H., and Sekiya, I. (2007).
Comparison of rat mesenchymal stem cells derived from bone marrow, synovium,
periosteum, adipose tissue, and muscle. Cell and tissue research 327, 449-462.

Young, R.G., Butler, D.L., Weber, W., Caplan, A.I., Gordon, S.L., and Fink, D.J. (1998). Use of
mesenchymal stem cells in a collagen matrix for Achilles tendon repair. J Orthop Res 16,
406-413.

Yuan, H., Corbi, N., Basilico, C., and Dailey, L. (1995). Developmental-specific activity of the
FGF-4 enhancer requires the synergistic action of Sox2 and Oct-3. Genes & development
9, 2635-2645.

Zaehres, H., Lensch, M.W., Daheron, L., Stewart, S.A., Itskovitz-Eldor, J., and Daley, G.Q.
(2005). High-efficiency RNA interference in human embryonic stem cells. Stem cells
(Dayton, Ohio) 23, 299-305.

Zeng, X., and Rao, M.S. (2007). Human embryonic stem cells: long term stability, absence of
senescence and a potential cell source for neural replacement. Neuroscience 145, 1348-
1358.

Zhang, J., Tam, W.L., Tong, G.Q., Wu, Q., Chan, H.Y., Soh, B.S., Lou, Y., Yang, J., Ma, Y.,
Chai, L., Ng, H.H., Lufkin, T., Robson, P., and Lim, B. (2006). Sall4 modulates embryonic
stem cell pluripotency and early embryonic development by the transcriptional regulation
ofPou5fl. Nature cell biology 8, 1114-1123.

Zhao, Y., Wang, H., and Mazzone, T. (2006). Identification of stem cells from human umbilical
cord blood with embryonic and hematopoietic characteristics. Experimental cell research
312, 2454-2464.

Zheng, J.K., Wang, Y., Karandikar, A., Wang, Q., Gai, H., Liu, A.L., Peng, C., and Sheng, H.Z.
(2006). Skeletal myogenesis by human embryonic stem cells. Cell research 16, 713-722.









Zhou, G., Liu, W., Cui, L., Wang, X., Liu, T., and Cao, Y. (2006). Repair of porcine articular
osteochondral defects in non-weightbearing areas with autologous bone marrow stromal
cells. Tissue engineering 12, 3209-3221.

Zhu, Y., Liu, T., Song, K., Ning, R., Ma, X., and Cui, Z. (2008). ADSCs differentiated into
cardiomyocytes in cardiac microenvironment. Molecular and cellular biochemistry.









BIOGRAPHICAL SKETCH

Sarah Reed was born in Bellefonte, Pennsylvania, to Lisa and Howard Grove, Jr. She

grew up riding and showing Quarter Horses and was a member of 4-H and the American Quarter

Horse Youth Association. Sarah graduated as valedictorian from Bellefonte Area High School in

Bellefonte, Pennsylvania in 2000. Following high school, Sarah pursued a bachelor's degree in

equine science at Delaware Valley College where she graduated summa cum laude in December

2003. While at DVC, Sarah was involved in the Equine Science Organization and the

agricultural honor society, Delta Tau Alpha. Following graduation, she worked as a laboratory

technician for Dr. Sally E. Johnson at the Pennsylvania State University. In July 2004, Sarah

married Jared Reed. Upon Dr. Johnson's move to the University of Florida, Sarah enrolled as a

master's student and completed her degree in Dr. Johnson's laboratory. The title of her master's

thesis was Identification ofDifferentially Expressed Proteins as a Result ofRafKinase Activity.

Sarah continued her education with Dr. Johnson, pursuing her doctoral degree in the Animal

Molecular and Cellular Biology program. While working on her degree, Sarah stayed involved

with the horse industry by working at Sundaram Farms in Newberry, Florida and taking show

jumping lessons from Beth Stelzleni and Ella Rukin. Sarah currently resides in Alachua, Florida,

with her husband, Jared, and their two dogs, Annie and Bella. She and Jared are active members

of Grace United Methodist Church at Fort Clarke. Sarah enjoys photography, horseback riding,

and reading fiction in her spare time.





PAGE 1

1 ISOLATION AND CHARACTERIZATION OF EQUINE UMBILICAL CORD BLOOD DERIVED STEM CELLS By SARAH ANN REED A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FO R THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2009

PAGE 2

2 2009 Sarah Ann Reed

PAGE 3

3 To Jake, who taught me what i t meant to be a true horsewoman; Aja, who relit the fire; and Jared who was there for it all

PAGE 4

4 ACKNOWLEDGMENTS There are so many people whom have helped me throughout this process that it would be impossible to thank you all. First and foremost, I am thankful to my advisor, Dr. Sally Johnson. Sally gave me the chance to work in her lab as an unproven technician and then invited me to join her lab as a student. Over the past five years, she has coaxed, encouraged, motivated and made me into a better scientist and a better person. She pushed me beyond what I thought were my limits because, in the end, she knew I could do more. My committee has been supportive throughout my tenure at UF. Dr. Moore was instrumental in teaching me valuable ES culture techniques. Dr. Brown provided a wonderful outside perspective of my project from a clinician s point of view. Dr. Ealy was a great sounding board for ideas and was extremely helpful with statistical analysis. My lab mates have been wonderful at providing friendship and support. Sophia, Dane, Juli, Sara, John Michael, Lulu and Dillon Thank you. I am forever indebted to my friends who have been there for me throughout the last five years. Sara, Beth, and Ella have all been the greatest friends to have, whether I needed a shoulder to cry on or to just go out and have fun. John Michael has been my lab best friend and the person that I could always gripe to when I had a frustration with anything. I couldnt have gotten through all of the real time without him. My family has provided constant support and understanding, even when attending graduate school meant moving 1100 miles away from home, missing Christmas es, birthdays and all of the little things in family life. My Mom and Dad, Lisa and Howard Grove, have provided endless encouragement and faith that I could do this. My grandparents have always let me know how much I am loved and that they believe I can do anything I set my mind to do. My inlaws, Don and Barb Reed, have also provided much support and encouragement along the way, and I thank them for accepting me into their family.

PAGE 5

5 Fin ally, I am supremely thankful to my husband, Jared, who has been there through all of the tears, successes, late night blood collections and long work hours. He had faith that I would succeed even when I lost mine. Even when he didnt understand what, he understood why and stood behind me the whole way. His unfailing support is the only reason I stand where I do today. He is the love of my life, my partner, my other half, my husband and I am the luckiest girl in the world to have found him.

PAGE 6

6 TABLE OF C ONTENTS page ACKNOWLEDGMENTS ...............................................................................................................4 LIST OF TABLES ...........................................................................................................................9 LIST OF FIGURES .......................................................................................................................10 ABSTRACT ...................................................................................................................................12 CHAPTER 1 INTRODUCTION ..................................................................................................................14 Self Renewal ...........................................................................................................................14 Stem Cell Plasticity .................................................................................................................17 Transcriptional Regulation of Plasticity ..........................................................................17 Oct4. .........................................................................................................................18 Sox2. .........................................................................................................................19 Nanog .......................................................................................................................20 Epigenetic Regulation of Plasticity .................................................................................21 Role of Fibroblast Growth Factors in Stem Cell Maintenance and Differentiation ...............23 Embryonic Stem Cells ............................................................................................................25 Characteristics .................................................................................................................25 Differentiation .................................................................................................................30 Umbilical Cord Blood Derived Stem Cells ............................................................................33 Collection and Processing ...............................................................................................33 Differentiation .................................................................................................................34 Adult Stem Cells .....................................................................................................................38 Bone Marrow Derived Mesenchymal Stem Cells ...........................................................38 Peripheral Blood Derived Progenitor Cells .....................................................................39 Umbilical Cord Vein Derived Stem Cells .......................................................................40 Adipose Derived Stem Cells ...........................................................................................41 Therapeutic Uses of Stem Cells ..............................................................................................42 Spinal Cord Injuries .........................................................................................................43 Vertebrae .........................................................................................................................44 Cardiovascular Repair .....................................................................................................45 Tendon and Ligament Injuries .........................................................................................47 Bone Injuries ...................................................................................................................49 Cartilage Injuries .............................................................................................................51 Muscular Dystrophies ......................................................................................................53 Conclusion ..............................................................................................................................54 2 CENTRAL HYPOTHESIS ....................................................................................................55

PAGE 7

7 3 E QUINE UMBILICAL CORD BLOOD CONTAINS A POPULATION OF STEM CELLS THAT EXPRESS OCT4 AND DIFFERENTIATE INTO MESODERMAL AND ENDODERMAL CELL TYPES ..................................................................................57 Introduction .............................................................................................................................57 Materials and Methods ...........................................................................................................59 Umbilical Cord Blood (UCB) Coll ection and Stem Cell Isolation .................................59 Equine UCB and Adipose Derived (AD) Stem Cell Culture ..........................................59 RNA Isolation, Reverse Transcription (RT), and Polymerase Chain Reaction (PCR) ...60 Osteogenic Differentiation ..............................................................................................60 Chondrogenic Differentiation ..........................................................................................61 Adipogenic Differentiation ..............................................................................................61 Hepatogenic Differentiation ............................................................................................61 Myogenic Differentiation ................................................................................................62 Histology .........................................................................................................................62 Immunocytochemistry .....................................................................................................62 Results .....................................................................................................................................63 Foal Umbilical Cord Blood Contains an Oct4Expressing Cell Population ...................63 UCB Stem Cells Form Chondrocytes ..............................................................................64 Differentiation of UCB Stem Cells into Osteocytes ........................................................64 Foal UCB Stem Cells can Differentiate into EndodermalDerived Cell Ty pes ..............65 Inefficient Formation of Myocytes and Adipocytes by UCB Cells ................................65 AdMSC do not Express the Same Complement of Stem Cell Markers ..........................66 Discussion ...............................................................................................................................67 4 REFINEMENT OF CULTURE CONDITIONS TO PROMOTE THE MAINTENANCE OF EQUINE UMBILICAL CORD BLOOD DERIVED STEM CEL LS ....................................................................................................................................78 Introduction .............................................................................................................................78 Materials and Methods ...........................................................................................................79 UCB Collection and Stem Cell I solation .........................................................................79 Stem Cell Culture ............................................................................................................80 RNA Isolation, Reverse Transcription (RT) and Polymerase Chain Reaction (PCR) ....81 Statistical Analysis ..........................................................................................................82 Results .....................................................................................................................................83 UCB Express Markers of Pluripotent Stem Cells ...........................................................83 GM and GM+FGF Maintain UCB Proliferation .............................................................83 Protein Surface Matrixes Promote UCB Growth ............................................................84 Oct4 is Maintained Throughout UCB Culture ................................................................84 Notch Signa ling in UCB Stem Cells ...............................................................................85 Discussion ...............................................................................................................................87

PAGE 8

8 5 CULTURE OF EQUINE UMBILICAL CORD BLOOD AND ADIPOSE DERIVED STEM CELLS TO PROMOTE TENOCYTIC DIFFERENTIATION ................................101 Introduction ...........................................................................................................................101 Materials and Methods .........................................................................................................103 Stem Cell Culture ..........................................................................................................103 Plasmids and Transfections ...........................................................................................104 Confocal Microscopy ....................................................................................................104 Protein Isolation and Evaluation ...................................................................................105 Assessment of Prolife ration ...........................................................................................105 RNA Isolation, Reverse Transcription, and Polymerase Chain Reaction .....................106 Quantitative PCR ...........................................................................................................106 Results ...................................................................................................................................106 AdMSC and UCB Express Markers of Tenocytic Ce lls ...............................................106 Scleraxis Minimal Promoter Activity ............................................................................107 AdMSC and UCB Survive on Various Matrices ...........................................................108 Culture in Matrigel Increases Tenocyte Gene Expression ............................................108 Fibroblast Growth Factors Elicit Differing ERK1/2 Responses in UCB and AdMSC .109 Effect of FGF5 Supplementation on Actin Structure ....................................................110 Response of the PI3K Pathway to FGF2 and FGF5 Supplementation ..........................111 Discussion .............................................................................................................................111 6 SUMMARY AND CONCLUSIONS ...................................................................................131 APPENDIX A SUPPLEMENTARY DATA ................................................................................................136 Mouse Embryonic Stem Cell Culture and Differentiation ...................................................136 Alternative UCB Differentiation Protocols ..........................................................................137 Myogenic Differentiation ..............................................................................................137 Neural Differentiation ...................................................................................................137 Adipogenic Differentiation ............................................................................................137 Quantification of Oct4, nanog, and Sox2 Across Time in Culture .......................................138 B TABLE OF PRIMER SEQUENCES ...................................................................................142 LIST OF REFERENCES .............................................................................................................144 BIOGRAPHICAL SKETCH .......................................................................................................171

PAGE 9

9 LIST OF TABLES Table page 41 Effect of substrata on equine UCB1 derived stem cell population doubling time .............92 42 Effect of substrata and media on equine UCB1 derived s tem cell doubling time ..............93 43 Effects of horse, passage, media and substrata on mRNA expression ..............................95 44 Delta Ct values for hes realtime PCR. ...............................................................................99 51 Real time PCR primers ....................................................................................................116 52 Cycle threshold ranges .....................................................................................................117 53 Putative transcription factor binding sites on the mouse scleraxis minimal promoter1. ..120 B 1 Primer sequences and sources. .........................................................................................142

PAGE 10

10 LIST OF FIGURES Figure page 31 Foal UCB cells ex press stem cell marker proteins ............................................................72 32 Induction of chondr ogenesis in foal UCB stem cells .........................................................73 33 UCB stem cells form osteocytes .......................................................................................74 34 Foal UCB stem cells form hepatocytes ..............................................................................75 35 Incomplete initiation of adipogenesis and myogenesis in foal UCB stem cells and AdMSCs .............................................................................................................................76 36 AdMSC fail to expr ess embryonic stem cell markers .......................................................77 41 GM and GM+FGF support e quine UCB stem cell propagation ........................................91 42 Equine UCB stem cells express markers of em bryonic stem cell pl uripotency ................94 43 UCB and AdMSC express a limited number of molecules in the Notch signaling pathway. .............................................................................................................................96 44 Inhibition of the Notch signaling pathwa y does not affect proliferation ...........................97 45 UCB and 23A2 myoblasts express hes .............................................................................98 46 BMP6 inhibits myoblas t differentiatio n in a Notch dependent manner ..........................100 51 AdMSC and UCB express markers of tenocytic cells ....................................................118 52 Mouse scleraxi s promoter with putative tra nscription factor binding sites .....................119 53 Scleraxis promoter activity is not increased by growth factor supplementation in UCB stem cells. ...............................................................................................................122 54 UCB stem cells express Erm Pea3 and Scleraxis .........................................................123 55 UCB and AdMSC att ach to various culture surfaces .......................................................124 56 Culture in matrigel inc reases tenocyte gene expression ..................................................125 57 UCB and AdMSC respond uniquely to FGF stimulation. ...............................................126 58 Fibroblast growth factors stimulate proliferation of AdMSC and UCB stem cel ls in a MAPK dependent manner ................................................................................................127 59 Culture conditions affect tenocyte gene expr ession in AdMSC and UCB. .....................128

PAGE 11

11 510 FGF5 supplementation does not affect UCB actin structure ...........................................129 511 FGF2 and FGF5 do no activat e Akt in UCB (A) or AdMSC (B). ...................................130 A 1 Stages of mES colony differentiation. .............................................................................140 A 2 mES embroid bodies differentiate into a variety of cell types.. .......................................141

PAGE 12

12 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy ISOLATION AND CHARACT ERIZATION OF EQUINE UMBILICAL CORD BLOOD DERIVED STEM CELLS By Sarah Ann Reed August 2009 Chair: Sally E Johnson Major: Animal Molecular and Cellular Biology Musculoskeletal injuries are responsible for a large portion of wastage in sport horses. Mesenc hymal stem cells (MSCs) offer promise as therapeutic aids in the repair of tendon, ligament, and bone damage suffered by these horses. The objective of thes e studies was to identify and characterize stem like cells from newborn foal umbilical cord blood (U CB). UCB was collected and MSC isolated using human reagents. The cells exhibit a fibroblast like morphology and express the stem cell markers Oct4, SSEA 1, Tra160 and Tra181. UCB express transcripts implicated in embryonic stem (ES) cell pluripotency, namely Oct4, nanog, Sox2, Klf4 and c myc Culture of the cells in tissue specific differentiation media leads to the formation of cell types characteristic of mesodermal and endodermal origins including chondrocytes, osteocytes, and hepatocytes Limited a dipogenic and myogenic differentiation occurred. Population doubling time and the presence of Oct4, nanog and Sox2 transcripts were used to determine culture conditions that promoted the proliferation of a stem cell population. Culture on a protein matrix (gelatin, collagen or fibronectin) shortened population doubling time compared to growth on uncoated plasticware. Inclusion of fibroblast growth factor 2 (FGF2) in the growth media slowed proliferation. The persistence of Oct4 nanog and Sox2 expression was monitored over time in culture in UCB stem cells. Oct4 was detected throughout the duration of

PAGE 13

13 the experiment. Sox2 and nanog expression declined with time in culture. Finally, the effect of culture conditions on expression of tendon markers was as sessed. Initial stem cell populations express scleraxis an early marker of tenocytic differentiation. Culture on collagen coated beads did not affect scleraxis levels; however culture in 30% Matrigel significantly increased levels of the transcript. This change was accompanied by differences in morphology. Cells grown in Matrigel formed tight colonies reminiscent of ES cell colonies while those on collagen coated beads maintained a fibroblast like morphology. In conclusion, we have isolated a population of stem cells from equine umbilical cord blood that possess a number of stem cell markers, can be expanded in culture, and can differentiate into a variety of potentially useful cell types.

PAGE 14

14 CHAPTER 1 INTRODUCTION The millions of cells that compose an o rganism stem from a small population of cells of the inner cell mass (ICM) in the developing embryo. During development, these cells give rise to more committed cells which form the three germ layers: endoderm mesoderm, and ectoderm. With increasing num bers of divisions, the cells become more committed until the majority of the organism is composed of fully differentiated adult cell types. However, in most tissues a population of cells remains that is capable of recapitulating at least some of the cell types specific to that tissue. These stem cells maintain homeostasis throughout aging and insult. Stem cells have several characteristic properties that define the global stem cell population self renewal and differentiation into a variety of more matur e cell types. Self renewal is an essential property that allows repopulation of the stem cell community. One daughter cell is destined to become a more committed cell type, while the other remains a malleable stem cell. Plasticity, or the ability to dif ferentiate, is a property that is unique to the type of stem cell. Different populations have varied amounts of plasticity thus, while one cell type may be capable of differentiation into two committed cell types, another such as an embryonic stem cell can contribute to every tissue of the adult organism. Self Renewal The process of self renewal allows stem cells to contribute to a population of committed cells while maintaining a stable population of stem cells. This can occur through a variety of me chanisms including asymmetric cell division, polarization initiated by external factors, fate determination by cell:cell contact, and stochastic regulation of intrinsic processes. It is most likely a complex combination of all four mechanisms that creates a permissive and instructive environment for stem cell self renewal. During development, the axis of polarity is established

PAGE 15

15 and coordinated with the body plan. Cell fate determinants are localized asymmetrically along this axis. During mitosis, the mitotic spindle is oriented along the axis such that cytokinesis creates two daughter cells containing different concentrations of these determinants. In Drosophila germ line stem cells, differential positioning of the mother and daughter centrosomes during mitosis determines the fate of each resulting cell. The mother centrosome is anchored to the niche by astral microtubules. The cell containing the daughter centrosome migrates away from the niche following cytokinesis and differentiates (Yamashita et al. 2003; Spradling and Zheng, 2007; Yamashita et al. 2007) In neural stem cells, asymmetrical localization of cellular proteins influences cell fate. Numb, a negative regulator of Notch signaling is localized asymmetrically at one pole of mitotic spindle in the sensory organ precursor cell of the Drosophila peripheral nervous system such that only one daughter cell inherits the protein (Rhyu et al. 1994) In this system, Numb influences cell fate by repressing Notch signalin g. The primary function appears to be the creation of two daughter cells that can respond differently to external cues rather than to specify a specific cell fate (Rhyu et al. 1994) Using videomicroscopy, Li et al report that 3040% of mouse neuroepithelial cells segregate Numb to one daughter cell during division (Li et al. 2003) This is correlated wi th asymmetric division to one neuroepithelial cell and one neuron. In addition, 18% of cortical precursor cells divided and expressed Notch1 asymmetrically. Notch1 was associated with the basal cell of the dividing pair (Chenn and McConnell, 1995) Hematopoietic stem cells (HSC) provided the first indication that stem cells were capable of s elf renewal through asymmetric division. Colony formation assays of HSC demonstrated that approximately 20% of progenitors divide asymmetrically ( Suda et al. 1984a; Suda et al. 1984b) In a population of CD34+ HSC, one daughter remained quiescent or divided very

PAGE 16

16 slowly while the other multiplied quickly and yielded committed progenitors (Huang et al. 1999) Slow dividing fractions of HSC are associated with primitive function and self renewal while the fast dividing fraction proceeds to differentiation (Huang et al. 1999; Cheng et al. 2000; Punzel et al. 2002) Using time lapse microscopy, Wu et al showed that hematopoietic precursor cells are capable of symmetric commitment, symmetric self renewal, and asymmetric division (Wu et al. 2007c) Additionally, overexpression of Numb in these cells resulted in fewer lineage ne gative cells. In addition, HSC self renewal is mediated at least in part by the stem cell niche. Long term repopulating cells (LTRC; CD34+CD38) are located in the HSC niche (the endosteal region associated with bone lining osteoblasts or endothelial cel ls) in a quiescent state (Yahata et al. 2008) Approx 75% of the most primitive long term repopulating hematopoietic stem cells are resting in G0 (Cheshier et al. 1999) Following isolation, these cells were capable of successful engraftment and reconstitution of hematopoiesis (Yahata et al. 2008) Clonally distinct LTRC controlled hematopoietic homeostasis and created a stem cell pool hierarchy by asymmetric self renewing division that produced both lineage restricted, short term repopulating cells and LTRC s (Yahata et a l. 2008) Quiescent LTRC clones can expand to reconstitute the hematopoiesis of the secondary recipient (Yahata et al. 2008) More restricted adult stem cells are also capable of self renewal. Muscle satellite cells that are Pax7+/Myf5 can give rise to Myf5+ cel ls when dividing in the basal/apical orientation (Kuang et al. 2007) Myf5 expressing cells lay next to fiber in a position to differentiate and fuse while null cells remain next to basal lamina in a position to remain as a precursor cell. Committed cells expressed Delta1 while the more nave progenitor cells did not. Conversely, Notch3 was highly expressed in the progenitor but not committed cells. Notch 1, 2 and Numb levels were equal in both populations. Using videomic roscopy, Shinin et al examined the

PAGE 17

17 segregation of NumbGFP in dividing satellite cells (Shinin et al. 2006) Both symmetric and asymmetric segregation was observed; approximately 34% of primary m yogenic cells in culture displayed asymmetric Numb localization following division. Numb segregated to the mother cell. Slow dividing, label retaining satellite cells contain the template DNA strand during division and maintain Pax7 expression. In cells in which both the DNA and Numb were segregated asymmetrically, 90% retained the Numb and template DNA in the same (mother) cell. Furthermore, these cells expressed Pax7 and did not differentiate. Stem Cell Plasticity As mentioned above, different populat ions of stem cells have different levels of plasticity. Totipotent cells are those capable of recapitulating the entire organism including the extraembryonic materials. Pluripotent cells, such as ES cells, contribute to the three germ layers. Cells with limited abilities that can only differentiate into a few cell types (generally of the same germ layer) are termed multipotent. Pluripotency of ES cells has only been shown conclusively in the mouse, where ES cells completely integrated into a developing embryo and produced a highly chimeric fetus (Evans and Kaufman, 1981) The mechanisms that regulate plasticity must be pliable enough to allow differentiation under appropriate stimuli but rigorous enough to override the developmental program when needed. Transcriptional Regulation of Plasticity In ES cells, there are several well characterized pathways of transcriptional regulation of pluripotency. Leukemia inhibitory factor (LIF) is essential for the maintenance of mES cells in vitro LIF binds to the LIF receptor gp130 heterodimer to activate STAT3 signaling in mES cells (Niwa et al. 1998) Inhibition of STAT3 phosphorylation results in loss of DNA binding ability and morphological changes to ES cells resembling differentiation (Boeuf et al. 1997) In contrast, activation of STAT3 is sufficient to maintain mES cells in an undifferentiated state in

PAGE 18

18 the absence of LIF (Matsuda et al. 1999) These cells were capable of forming chimeric mice when injected into blastocysts. However, LIF is not required for embryonic development null embryos develop to a stage beyond that of ES cell isolation. It is important to remember that the presence of the pluripotent ICM in the developing embr yo is a transient state, thus the lack of requirement of LIF is not surprising. A notable difference between hES and mES cells is the lack of requirement for LIF signaling in hES cells. When maintained on a feeder layer in the presence of serum, human ES cells do not require LIF signaling to prevent differentiation. Bone morphogenic protein 4 (BMP4) is an anti neurogenesis factor that has been shown to contribute to LIF cascade, enhancing self renewal and pluripotency by activating SMADs which, in turn, pr omote transcription of the Id gene family (inhibitors of differentiation, (Ying et al. 2003) ). In the absence of LIF, BMP4 promotes differentiation. Like LIF, this factor is not required for the initial creation of the ES cell population null embryos develop past the stage of ES cell derivation. However, ES c ells can be derived in the absence of serum with media supplemented with LIF and BMP4 (Ying et al. 2003) Wnt activation helps maintain the undifferentiated phenotype in mouse and human ES cells by sustaining the expression of Oct4, Rex1 and nanog (Sato et al. 2004) Oct4. Oct4 is a Pou domain trans cription factor expressed by all pluripotent cells during mouse embryogenesis as well as undifferentiated mouse ES cells and embryonic carcinoma cell lines (Scholer et al. 1989a; Scholer et al. 1989b; Okamoto et al. 1990; Rosner et al. 1990) Up regulated during the 4 cell stage of embryo development, Oct4 later becomes restricted to pluripotent stem cells. Expression of Oct4 is downregulated with differentiation (Brandenberger e t al. 2004) In addition, embryos lacking Oct4 expression develop to a stage resembling a blastocyst and have a mass of cells designated to the location of the ICM, but do not contain

PAGE 19

19 pluripotent cells, only trophectodermal cells which cannot be used to produce ES cells (Nichols et al. 1998) Decreased expression of Oct4 by si RNA resulted in the downregulation of pluripotency related genes such as nanog and Sox2, markers of undifferentiated stem cells such as Lefty1, Lefty2, and Thy1, and chromatin modifying factors such as DNMT3B (Babaie et al. 2007) Relativ e amounts of Oct4 protein effects cell fate; overexpression of Oct4 results in differentiation into primitive endoderm and mesoderm, while loss of the protein results in spontaneous differentiation into trophectodermal cells (Yeom et al., 1996; Niwa et al. 2000; Niwa, 2001) Thus, Pou5f1 must be strictly regulated to maintain ES cell fate. The Oct4 pathway appears to be independent from LIF/STAT3 signaling, as disruptions to either pathway have no direct effect on the other. Howeve r, the two transcription factors may cooperate to regulate target genes, as many target genes contain both Oct and STAT binding sites (Tanak a et al., 2002; Ginis et al. 2004) Sox2. Sox2 is a high mobility group (HMG) domain DNA binding protein that regulates transcription and chromatin architecture (Pevny and Lovell Badge, 1997) Sox2 forms a ternary complex with Oct4 on the FGF4 enhancer as well as other genes involved in maintaining ES cell pluripotency (Yuan et al. 1995; Boyer et al. 2005) Expression of Sox2 in the developing embryo is similar to that of Oct4 (Avilion et al. 2003) Null embryos are incapable of giving rise to pluripotent cells from the ICM, instead producing trophectoderm like cells (Av ilion et al. 2003; Masui et al. 2007) Microarray screening indicates that Sox2 null cells express greater levels of genes that negatively regulate Oct4 and downregulate factors that positively regulate Oct4. Introduction of exogenous Oct4 into Sox2 null cells restored their proliferation and pluripotency, indicating that Sox2 may upregulate the positive regulators of Oct4 while downregulating factors that negatively affect Oct4 transcription (Masui et al. 2007) In human

PAGE 20

20 ES cells, treatment with Sox2 siRNA significantly reduced Sox2 Oct4 and nanog expression levels (Fong et al. 2008) Decreased Sox2 expression also resulted in significantly reduced populations of SSEA3, SSEA4, Tra160 and Tra1 81 expressing cells. Expression levels of chromatin remodeling factors and transcript ion factors known to regulate pluripotency were also downregulated in Sox2 knockdown cells. Nanog The homeobox domain containing transcription factor Nanog is expressed by undifferentiated ES cells, however it is not capable of preventing differentiatio n after the withdrawal of LIF (Chambers et al. 2003; Mitsui et al. 2003) Additionally, Oct4 is required for Nanog mediated self renewal in ES cells (Chambers et al. 2003) Null embryos lack a primitive ect oderm and consist almost entirely of disorganized extraembryonic tissues (Mitsui et al. 2003; Hyslop et al. 2005) ES cells lacking nanog differentiate slowly into extra embryonic lineages (Mitsui et al. 2003) Nanog transcriptionally represses gene s involved in differentiation. Overexpression of nanog in ES cells allows the cells to remain pluripotent in the absence of LIF, although the ability to self renew is reduced (Chambers et al. 2003; Mitsui et al. 2003) This ability is abrogated if nanog is mutated to be dimerization incompetent (Wang et al. 2008) In cooperation with Sall4, a spalt like zinc finger protein, nanog occupies target genes important for pluripotency, including Pou5f1, Sox2, and nanog (Wu et al. 2006; Zhang et al. 2006) Transcription of Nanog itself is suppressed by p53 binding of the nanog promoter (Lin et al. 2005) Oct4, Sox2 and Nanog map to promoters of a large population of genes that are both active in defining ES cell identity (the undifferentiated phenotype) and r epressing developmental/differentiation genes. These factors also participate in autoregulatory and feed forward loops (Boyer et al. 2005; Loh et al. 2006) Nanog contains a 15 base pair Oct Sox composite element in the proximal promoter (Rodda et al. 2005) Sox2 and Oct4 bind this

PAGE 21

21 module both in vitro and in viable mouse and human ES cells. Expression of constitutively active nanog maintains mES cells in the undif ferentiated state in the absence of LIF (Mitsui et al. 2003) Recent work has suggested that Oct4, nanog and Sox2 cooperate in regulating self renewal and plasticity. Numerous target genes have been identified to be bound by the three factors. Target genes of Oct4 have a Sox binding element 0 or 3 base pairs from the octamer binding element (Rodda et al. 2005) Significantly, a complex containing both Oct4 and Sox2 regulates the expression of nanog (Kuroda et al. 2005; Rodda et al. 2005) Oct4 and Sox2 recognize and bind elements in the regulatory regions of their own genes (Chew et al. 2005) Large n umbers of target genes of Oct4 are also bound by nanog in ES cells, suggesting that these pathways work in cooperation rather than independently of one another (Boyer et al. 2005; Loh et al. 2006) The gene targets identified represent a variety of products required for pluripotency but also those required for differentiation, suggesting that these transcription factors not only promote the maintenance of the nave state but also block the progression of differentiation. Klf4 binds the regulatory regions of Pou5f1 and nanog and is also found in many complexes of these proteins at transcriptional regulatory sites on ot her genes. Nanog and Oct4 may interact directly with each other and chromatin remodeling proteins (Liang et al. 2008) A transient reduction in Pou5f1 and nanog induced differentiation in mES cells (Hough et al. 2006) Epigenetic R egulation of P lasticity Another mechanism by which plasticity is maintained is the epigenetic regulation of chromatin structure. Epig enetic marks (including methylated DNA and possibly modified histones) are propagated at S phase, thus epigenetic information can be transmitted through sequential rounds of cell division (Jaenisch and Bird, 2003; Henikoff et al. 2004) Chromatin is subjected to various forms of epigenetic regulation that modulat e the transcriptional activity of

PAGE 22

22 specific genomic regions including chromatin remodeling, histone modifications, histone variants, and DNA methylation. For example, trimethylation of lysine 9 and lysine 27 on histone 3 (H3K9 and H2K27, respectively) corr elate with inactive regions of chromatin. However, trimethylation of H3K4 and acetylation of histones three and four are associated with active areas of transcription (Jenuwein and Allis, 2001) Generally, methylation is considered a repressive mark (Santos and Dean, 2004) Polycomb group proteins (PcG) also silence developmental regulators, aiding in the maintenance of a plastic state (Boyer et al. 2006; Lee et al., 2006) PcG proteins form two repre ssor complexes, PRC1 and PRC2. PRC2 inhibits initiation of transcription, while PRC1 maintains the repressed state (Boyer et al. 2006) Genes that are co occupied by PRC1 and PRC2 also exhibit H3K27 trimethylation which is catalyzed by PcG proteins (Cao et al. 2002; Ringrose et al. 2004) Recently, a configuration of epigenetic modification has been described on target genes poised for transcription but not yet active. These bivalent histones contain both repressive and active histone markers, with large regions of H3K27 trimethylation interrupted by a smaller region of H3K4 trimethylation. This configuration is frequently associated with developmentally regulated factors that may be expressed at low levels in stem cells. Upo n differentiation, most bivalent domains become H3K4 or H3K27 methylated (Azuara et al. 2006; Bernstein et al. 2006) BAF, a member of the SWI/SNF family of ATP dependent chromatin remodeling complexes, is expressed abundantly in ES cells. BAF250a is a member of the BAF complex which can target and antagonize PcG proteins. Absence of BAF250a results in embryos that fail to undergo gastrulation and proper germ layer development (Gao et al. 2008) Null ES cells differentiate into cells with endoderm like morp hology. These cells express a marked reduction

PAGE 23

23 in Oct4 and Sox2. Loss of BAF250a resulted in the inability to specify some lineage specific differentiation. Overall, the stem cell must maintain a highly dynamic and transcriptionally permissive state to b e poised to respond to appropriate stimuli. These cells exhibit fewer heterochromatin foci that are more diffuse than in differentiated cells. Using fluorescent recovery after photobleaching, Meshorer et al demonstrated the presence of an increased fract ion of loosely bound or soluble architectural chromatin proteins (Meshorer et al. 2006) With this method, higher recove ry rates reflect loose binding of these proteins to chromatin, rendering it more accessible to transcription factors and chromatin modifiers. Overall, the chromatin of stem cells exists in a more permissive transcriptional state than that of differentiated cells. Role of Fibroblast Growth Factors in Stem Cell Maintenance and Differentiation The fibroblast growth factors (FGF) were first discovered as a family of growth factors that promoted proliferation. There are now over twenty FGFs identified in the human with different temporal and spatial expression patterns. FGFs function in proliferation, differentiation and migration during development and adult life. Most FGFs share a conserved internal region of residues responsible for receptor binding (Baird et al. 1988; Plotnikov et al. 1999) Two of the twelve B strands in the core region of the protein are thoug ht to contain the heparin binding domain which is separate from the domain which binds the receptor. Most FGFs have aminoterminal signal peptides and are readily secreted. However, FGF1 and FGF2 lack this sequence and may be released via exocytosis (Mignatti et al. 1992) Extracellular FGFs bind four high affinity transmembrane r eceptor tyrosine kinases which propagate signal transduction intracellularly. Stable interaction between the FGF and FGF receptor (FGFR) requires the presence of heparin sulfate proteoglycans which protect the complex from proteolysis and thermal degradat ion. Heparin sulfate may also limit the amount of FGF diffusion into the

PAGE 24

24 interstitial spaces. FGFs bind FGFR in a 2:2:2 fashion where each fully active complex consists of two each of FGF, FGFR, and heparin sulfate. FGF receptors contain two or three immunoglobulinlike domains, a short, conserved area of acidic residues which contains separate ligand and heparin binding domains, a transmembrane region and two intracellular tyrosine kinase domains. To achieve downstream signaling, binding of the ligand to the FGFR and heparin sulfate must occur. The resulting tyrosine phosphorylation of FRS2, a docking protein, allows the recruitment of Grb2 molecules which, in turn, recruit the nucleotide exchange factor SOS. The formation of the FRS2Grb2 SOS complex activates the Ras Raf MAPK pathway, resulting in changes in gene transcription. Phosphorylation of the FGFRs can also activate the PKC pathway. Alternatively, Grb2 can recruit Gab1 to activate PI3K/Akt signaling. This diversity allows a single set of receptors to influence a wide variety of cellular events. Receptor diversity is controlled by alternative splicing and results in differential ligand binding characteristics as well as varying temporal and spatial expression patterns (Lee et al. 1989; Johnson et al. 1990) Alternative splicing specifies the sequence of the immunoglobulin domain III determining the rec eptor isoform (i.e. IIIb, IIIc). Splicing occurs in a tissue specific manner and dramatically affects ligand specificity (Miki et al. 1992; Orr Urtreger et al. 1993; Scotet and Houssaint, 1995) Identified as potent mitogens, FGFs play a major role in ste m cell biology that ranges from self renewal to differentiation to cell attachment and migration. Importantly, FGF2 is required by human ES cells to sustain self renewal and plasticity (Amit et al. 2000; Xu et al. 2001) Inhibition of FGFRs in hES cells suppressed activation of downstream signaling, led to the downregulation of Oct4 and stimulated rapid differentiation (Dvorak et al. 2005) Supplementation of FGF2 at levels greater than 5 ng/ml decreased the outgrowth of hES colonies

PAGE 25

25 while not affecting proliferation suggesting a role in cell attachment and spreading. Exogenous FGF2 enhances growth of bone marrow mesenchymal stem cells (Solchaga et al. 2005) It prolongs the life span of bone marrow stromal cells by stimulating telomere elongation (Bianchi et al. 2003) Murine bone marrow derived Sca1positive stem cells proliferated in response to FGF4 and FGF2 under low serum conditions and exhibited a simultaneous phosphorylation of ERK1/2 and Akt. Changes in proliferation were abrogated by the inclusion of MEK and PI3K inhibitors. The upregulation of the immediate early gene c jun was also apparent following ERK1/2 activity (Choi et al. 2008) FGF4 is secreted from undifferentiated hES cells and promoted self renewal. Not only did expression of FGF4 decline with differentiation, but knockdown of the growth factor with siRNA resulted in differentiation, indicating a role for FGF4 in the maintenance o f the undifferentiated state in human ES cells (Mayshar et al. 2008) Accordingly, Sox2 and Oct4 can transactivate the FGF4 enhancer in F9 embryonal carcinoma cells suggesting a circular feedback mechanism (Yuan et al. 1995) Alternatively, Fgf4 / mES cells do not undergo differentiation upon removal of LIF, but will differ entiate along the neural lineage if further supplemented with exogenous FGF4. Cells null for FGF4 exhibit a reduced ability to enter neuronal and mesodermal lineages which does not stem from a lack of proliferation or death of precursor cells. Null cells d o not select alternative commitment programs, rather they remain in an undifferentiated state (Kunath et al. 2007) Embryonic Stem Cells Characteristics Embryonic stem cells were first derived from the i nner cell mass of a mouse blastocyst in 1981 (Evans and Kaufman, 1981) Established human lines followed in the late 1990s (Thomson et al. 1998) The immortal cells derived from the inner cell mass are an in vitro

PAGE 26

26 phenomenon, existing only transiently in vivo Much work has been done to characterize these cells in hopes of obtaining a population of stem cells us eful for regeneration and repair of human tissue. The chromatin of ES cells exists in an open state, allowing transcription of genes for maintenance and eventual differentiation. Epigenetic modifications of chromatin structure or DNA methylation may lead to more restricted lineage specific gene transcription (Arney and Fisher, 2004) High levels of telomerase activity are associated with ES cells and their ability to be cultured indefinitely (Zeng and Rao, 2007) While murine and human ES cells exhibit similar morphologies, there are several distinct characteristics of each species. Embryonic stem cells derived from the mouse can be cultured in feeder free culture sy stems in the presence of leukemia inhibitory factor (LIF). Conversely, human ES cells do not require LIF and can be cultured off of feeder layers if supplemented with fibroblast growth factor 2 (Xu et al. 2005) Cells from both species grow in tightly packed colonies and appear to be inherently heterogeneous, as a portion of the outer layer of cells will differentiate. Whether this is truly a heterogeneous population or an artifact of inefficient culture is unknown at this point in time. The deletion of both copies of lif in mES did not completely abolish the ability of these cells to self renew. Instead, these cells produced a soluble factor that allowed the propagation of a small number of colonies despite the presence of a differentiation permissive environment. This factor, termed ES cell renewal factor (ESRF), works independently of the STAT3 signaling pathway and can sustain the undifferentiated phenotype of ES cells in vitro (Dani et al. 1998) In culture, ES cells possess a very short cell cycle (1116 hr) mainly due to a reduction in G1 phase. Early G1 is omitted by the constitutive presence of cyclin E CDK2 activity (Savatier et al., 1994; White et al. 2005) LIF withdrawal from the culture med ia brings cyclin E expression under control of pocket proteins, requiring cyclin D complexes and the obtainment of the early

PAGE 27

27 phase of G1 (White et al. 2005) By eliminating the requirement for cyclin D expression (MAPK induced), ES cells uncouple cell cycle traverse from differentiation, allowi ng for self renewal. ES cells isolated from cynomolgus monkey require a feeder layer to maintain pluripotency and cannot rely on LIF supplementation as do murine ES cells. LIF treatment induces phosphorylation of tyrosine 705 but does not affect the phosphorylation status of serine 727 of STAT3 (Sumi et al. 2004) Serine phosphorylation of STAT3 is required for full transcriptional activity (Wen et al. 1995) Interestingly, downregulation of connexin 43, a protein responsible for formation of gap junctions, results in the rapid differentiation of mES cells (Todorova et al. 2008) This included loss of Oct4 expressio n, morphological changes, and up regulation of differentiation markers such as glial fibrillar associate protein (GFAP). Formation of embroid bodies was hindered by treatment with gap junction intercellular communication (GJIC) blockers. Recovery of GJIC allowed the restoration of the differentiation program. Research with ES cells is not limited to humans and mice. ES cells were successfully isolated from the ICM of bovine embryos (created by IVF or nuclear transfer) and cultured on mitomycin c treated MEFs (Wang et al. 2005b) They assumed the typical morphology of ES cells: multicellular colonies with a smooth surface and distinct colony boundary. Bovine ES cells react positively with SSEA4 and Oct4 but not SSEA1 antibodies. No Tra1 expression was found. In the absence of a feeder layer and LIF, bES cells spontaneously differentiated into EBs and gave rise to cells from three germ layers. Ectodermal cells expressed the neurofilament marker TUBB3, mesoderm al cells expressed smooth muscle ACTA2, and cuboidal and net like epithelial structures expressed creatine kinase.

PAGE 28

28 Likewise, equine embryos have also yielded ES like cells. Several groups have isolated ES like cells from frozen and freshly collected equi ne blastocysts (Saito et al. 2002; Li et al. 2006; Guest and Allen, 2007) Equine ES like cells exhibit morphology similar to mES cells with underrun cell borders, a small cytoplasmic to nuclear ratio, and prominent nucleoli (Li et al., 2006) These cells express Oct4, alkaline phosphatase, SSEA1, SSEA4, Tra160 and Tra1 81 (Saito et al. 2002; Li et al. 2006; Guest and Allen, 2007) No SSEA3 was apparent in ES like cells, although it was detected in equine blastocysts (Guest and Allen, 2007) Equine ES like cells were capable of differentiation into all three germ layers in vitro but did not form teratomas when injected subcutaneously into SCID/beige immunoincompetent mice (Li et al. 2006) Despite the similarities in marker expression, reports of the culture conditions required differ among reports. In the absence of LIF, eES like cells lost expression of all markers of pluripotency and exhibited morphological properties identical to differentiated cells (Li et al. 2006; Guest and Allen, 2007) However, other report s indicate that a feed er layer, but not LIF, is necessary for the maintenance of eES like cells (Saito et al. 2002) The difference between the reports is unclear but may result from differences in isolation protocols or source of the equine embryos. Embryos from rats and dogs have also yielded ES like cells. Rat ES like cells cultured on a feeder layer in the presence of LIF express Oct4, SSEA1, and alkaline ph osphatase (Vassilieva et al. 2000) Canine ES like cells were isolated from inner cell masses collected from blastocysts (Hatoya et al. 2006) Unlike mouse and human ES cells, this population i s limited in life span, entering replicative senescence after nine passages. Domed colonies with tightly packed cells and an apparent border were present during early passages when cultured on a feeder layer. Cells expressed alkaline phosphatase, SSEA1, and Oct4, but no SSEA4.

PAGE 29

29 Aggregation into EBs produced cells with morphologies that represented cells from all three germ layers. In an effort to avoid the ethical controversies surrounding embryonic stem cells and to make pluripotent stem cells that matche d the unique identity of each individual, Takahashi and Yamanaka sought to find a set of factors that would induce a pluripotent state in a somatic cell (Takahashi and Yamanaka, 2006) They identified four factors which, when transduced into mouse embryonic fibroblasts, elicited a nave state with ES cell morphology and the ability to produce teratoma s in nude mice that contained cell types from all three germ layers. Oct4, Sox2, Klf4 and c Myc induced the expression of nanog and other pluripotency factors. The induced pluripotent stem cells (iPS) showed increased acetylation of histone H3 of the Po u5f1 and nanog promoters as well as decreased methylation of lysine 9 of histone H3, indicating a permissive state for Pou5f1 and nanog transcription. However, the CpG dinucleotides remained partially methylated. Additionally, iPS cells exhibited higher telomerase activity at levels similar to ES cells. Human embryonic fibroblasts respond similarly to induction with Oct4, Sox2, Klf4 and c Myc, expressing ES cell markers at both the protein and mRNA level (Park et al. 2008) However, recovery of iPS from postnatal human cells was successful only when hTERT and SV40 large T were included in the retroviral cocktail. The authors speculate that these factors are required to act on supportive cells in the culture to enhance the efficiency with which the reprogra mmed colonies can be selected (Park et al. 2008) Further work has indicated that only two factors, Oct4 and Sox2 may be necessary for induction of iPS cells from human fibroblasts when coupled with valproic acid (Huangfu et al. 2008) These cells are morphologically similar to hES cells and express nanog, Oct4, Sox2, SSEA4, Tra160 and Tra181. iPS cells have been postulated to be functionally equivalent to mouse ES cells in that they express the same markers,

PAGE 30

30 possess similar gene expression profiles, form teratomas, and contribute to cells of chimeric animals, including the germ line (Takahashi and Yamanaka, 2006; Maherali et al. 2007; Okita et al., 2007; Wernig et al. 2007) Differentiation Differentiation of ES cells can be obtained by removing LIF from the culture media and allowing the formation of embroid bodies (EBs). These masses of cells will differentiate and, upon dispersal onto a culture pl ate, produce cells of the three germ layers. Differentiating EBs mimic the genetic changes of early development the downregulation of pluripotency and self renewal genes coupled with the upregulation of genes responsible for the development of the three germ layers making this system useful for studying the mechanisms of early development (Gerecht Nir et al. 2005) Directed differentiation of ES cells is much more difficult than the spontaneous differentiation found in EBs. Zheng et al were successful in creating a pre myoblast line from hES cells but the differentiated cells did not fully differentiate in vi tro (Zheng et al. 2006) However, placing these preconditioned cells into an injured muscle resulted in moderate incorporation into host fibers (approximately 7%). Irradiati on following cardiotoxin treatment resulted in a higher degree of incorporation (approximately 29%). Transducing CGR8 ES cells with Ptf1a and Mist1 prior to differentiation resulted in increased pancreatic differentiation (Rovira et al. 2008) Acinar genes including CPA and Ela1 were upregulated in a manner similar to early exocrine cells. Pancreatic signaling mediators and gap junction protein mRNAs were expressed in transduced cells. Additionally, differentiated cells contained zymogen granule like vesicles filled with Amyl which was released in response to carbachol, indicating functional properties similar to exocrine cells. Phillips et al cultured hES cells in a three dimensional environment followed by stimulation by a series of growth factors to

PAGE 31

31 induce pancreatic differentiation (Phillips et al. 2007) Embroid bodies were cultured with activin A and BMP4 to induce endodermal cell types. Pancreatic progenitor cells were formed following supplementation with HGF, exendin4, and cellulin. These cells expressed Pdx 1 as well as the early pancreatic epithelial marker Ptf1a and endocrine progenitor marker Ngn3. Following further differentiation, cells expressed insulin and released cpeptide when stimulated with forskolin and glucose. When transplanted into the intraperitoneal cavity of SCID mice, differentiated cells maintain the endocrine identity and show modest glucose responsiveness. Multiple ES cells lines were tested for their ability to differentiate into mature cartilage (Kramer et al. 2005) Embroid bodies contained regions deeply stained with Alcian blue representing cartilage nodules. Nodules consisted of dense groups of rounded cells surrounded by a rigid membranous structure of extracellular matrix proteins containing type II collage n. In particular, the BLC6 line of ES cells had markedly high numbers of cartilage nodules (60 fold that of other lines tested) and a distinct increase in the expression of the adult splice variant B of type II collagen, a marker of mature chondrocytes. Osteogenic differentiation was achieved in hES cells when cultured as embroid bodies in glycerophosphate (Sottile et al., 2003) Culture in osteogenic induction media generated mineralized cultures that stained positive for calci um deposits with Alizarin Red and von Kossa. Expression of osteogenic genes such as osteocalcin, type I collagen, Cbfa1, and osteopontin were increased while Pou5f1 expression decreased during differentiation. The x ray diffraction pattern of mineralized nodules was characteristic of hydroxyapatite, the primary component of mineralized bone. Osteogenesis glycerophosphate by NA) (Yamashita et al. 2006)

PAGE 32

32 es the proportion of ES cells that differentiate into osteogenic cells. Osteogenic transcripts Cbfa1, type I collagen, and osteocalcin were expressed later in siR NA treated cells than those treated with osteogenic induction medium. positively with Alizarin Red and produced an equivalent amount of calcium as cells induced wit h osteogenic medium. Neural inductive signals provided by coculture of mES cells on the PA6 stromal cell line generated Sox1/TuJ1 expressing neurons (Wichterle et al. 2002) Reti noic acid was also capable of generating post mitotic neurons expressing Sox1, NeuN and TuJ1. Combination of retinoic acid and an agonist of the Sonic hedge hog signaling pathway generated spinal motor neurons. Similar to the gradient produced during embr yogenesis, a small variation in the level of sonic hedge hog signaling led to the generation of ventral interneurons rather than spinal motor neurons. Pre differentiated cells introduced into the embryonic chick spinal cord engrafted and differentiated in to motor neurons in vivo Post mitotic neurons also survived engraftment. ES cells are capable of undergoing hematopoiesis when cultured in serum free media and activated sequentially with a number of growth factors (Pearson et al. 2008) Addition of bone morphogenic protein 4 (BMP4) promoted efficient formation of mesodermal cells. Subsequent stimulation with activin A and fibroblast growth factor 2 (FGF2) induced the formation of hemangioblast precursors. Finally, supplementing the media with VEGF was required for the progression to a committed hematopoietic precursor. Sequential addition of these factors to mES cells resulted in a significant increase of CD41 expressing hemat opoietic precursor cells.

PAGE 33

33 Umbilical Cord Blood Derived Stem Cells Identified as a population of cells from blood that are adherent in plastic cultureware, umbilical cord blood derived stem cells (UCB) are further purified by centrifugation through a densit y gradient such as Ficoll. These cells exhibit a fibroblast like appearance and proliferate, though they are contact inhibited. UCB have been successfully isolated from humans, sheep, pigs, dogs, and horses and appear to maintain the same basic characteri stics across species (Bieback et al. 2004; Lee et al. 2004b; Fuchs et al. 2005; Zhao et al. 2006; Koch et al. 2007; Kumar et al. 2007) While the explicit protein markers of UCB remain elusive, most reports agree that this population is CD34, CD45 and major histocompatibility complex (MHC) class II negative and only weakly positive for MHC class I (Lee et al. 2004a) The minor expression of MHC classes I and II indicate the lack of immunogenicity of this cell type. Additionally, a mixed lymphocyte reaction indicated that h uman UCB did not stimulate lymphocyte proliferation, consistent with low levels of immunogenicity (Zhao et al. 2006) The absence of CD34 and CD45 suggests a nonhematopoietic lineage. Additionally, cell surface markers commonly found on MSC, CD29, CD44, CD73, and CD90 (Thy 1) are found in the majority of UCB (Bieback et al. 2004; Lee et al., 2004b; Fuchs et al. 2005; Zhao et al. 2006; Kumar et al. 2007) The presence of Oct4, nanog, SSEA3 and SSEA4 by some researchers suggests a nave phenotype for UCB (Baal et al. 2004) Collection and Processing Aspiration of blood via syringe or through a canula into a sterile container containing anti coagulant (EDTA, citrate phosphate dextrose, or other citrate based anticoagulant) at the time of parturition or caesarean section yields the highest number of UCB (Sparrow et al. 2002; McGuckin et al. 2003; Bieback et al. 2004; Chang et al. 2006; Kern et al. 2006) Proc essing

PAGE 34

34 is performed as soon as possible after collection, generally within 15 hours (Bieback et al. 2004) Prolonged time from collection to process ing may decrease the number of cells obtained. Blood is diluted in a buffered saline solution prior to separation of the mononuclear layer by density gradient centrifugation (Sparrow et al. 2002; McGuckin et al. 2003; Romanov et al. 2003; Bieback et al. 2004; Gang et al. 2004a; Lee et al. 2004a; Chang et al. 2006; Kern et al. 2006) The buffy coat, containing the mononuclear cells, is collected and subjected to at least two further washes in saline solution or medium. Lysing of the red blood cells may be performed at this time. Cells are then plated in expansion medium which is typically composed of Dulbeccos modified eagle medium (DMEM), 1020% fetal bovine serum (FBS), and penicillin/streptomycin. Some researchers suggest the addition of various growth factors and supplements (Sparrow et al. 2002; Romanov et al. 2003; Bieback et al. 2004; Gang et al. 2004a; Lee et al. 2004a; Kang et al. 2005; Wagner et al. 2005; Chang et al. 2006; Kern et al. 2006) Fibroblast like colonies can be seen two to four weeks after plating (Bieback et al ., 2004; Kern et al. 2006) Upon confluency, UCB can be detached with trypsinEDTA and subcultured. In contrast to stem cells derived from bone marrow, most UCB populations show an increased (but not indefinite) potential for proliferation (Bieback et al. 2004) Differentiation In an effort to prove the plasticity of umbilical cord blood derived stem cells in relation to other stem cell population s, in vitro and in vivo differentiation protocols have been performed. UCB have been successfully differentiated into cells from all three germ layers. Mesodermal cell types, such as osteoblasts, chondrocytes, and adipocytes, are most commonly used to id entify a stem cells ability to differentiate. However, differentiation into cells of the ectodermal or endodermal layer tends to be more difficult.

PAGE 35

35 Maturation of UCB into bone and cartilage is routinely achieved. Both human and equine UCB have been dif ferentiated into cells capable of producing calcium deposits stained by von Kossa and Alizarin Red (Kogler et al. 2004; Koch et al. 2007) Transcription of osteopontin, osteocalcin, and type I collagen has been reported in these cells (Kogler et al. 2004) Culture of human UCB in media containing dexamethasone and bone m orphogenic protein 2 (BMP2) resulted in morphological changes from spindle shaped cells to cuboidal cells in twenty days coupled with increased alkaline phosphatase and type I collagen expression (Hildebrandt et al. 2009) However, it has been noted by some researchers that UCB which differentiate into osteoblasts do not take on the cuboidal appearance typical of bone marrow derived osteoblasts (Goodwin et al. 2001) Chondrogenesis is commonly achieved by culture in a threedimensional micromass positively with Alcian Blue and Safranin O, indicating the presence of glyco s aminoglycans typical of cartilage (Kogler et al. 2004; Koch et al. 2007) Further analysis of these c ells reveals transcription of cart 1, Col2a1 and chondroadherin (Kogler et al. 2004) Ovine UCB from blood collected at 80120 days of gestation formed tissue reminiscent of hyaline cartilage when placed on a construct of biodegradable polyglycolic acid polymer treat ed with poly L lactic acid solution and coated with collagen. This was placed in a bioreactor in permissive medium for 12 weeks. Marked chondrogenic differentiation was apparent, presenting characteristics of hyaline cartilage and staining positively for S afranin O and Toluidine Blue. Type II collagen was primarily expressed with little type I collagen present and no type X collagen (Fuchs et al. 2005) Inclusion of insulinlike growth factor 1 (IGF 1) after the initial

PAGE 36

36 (Wang and Detamore, 2009) UCB treated with insulin and 3isobutyl 1 methyl xanthine, a phosphodiesterase inhibitor, will obtain lipid vacuoles identified by Oil Red O (Goodwin et al., 2001; Kogler et al. 2004; Koch et al. 2007) It has been noted that UCB present much less obvious adipogenic differentiation than do bone marrow or adipose derived MSC (Wagner et al. 2005; Rebelatto et al., 2008) Other researchers have struggled to form adipocytes from UCB. Biebeck et al could not obtain adipocytes after culture of UCB in induction medium containing dexamethasone, IBMX, insulin, indomethacin and fetal calf serum (Bieback et al. 2004) No lipid vacuoles were formed in UCB despite the appearance of lipid vacuoles in BM MSC treated in a parallel culture. However, continuous culture in induction medium for 5 weeks did result in some adipocy tic differentiation. Kern et al also reported a failure to induce differentiation into adipocytes, even following 5 weeks of culture (Kern et al. 2006) Lee et al achieved adipocytic differentiation but only after the addition of rabbit serum to the induction medium (Lee et al. 2004b) Less frequently, UCB have been shown capable of limited myogenic conversion in vitro Human UCB cultured in myogenic medium resulted in an increase in MyoD and myogenin transcription. These cells also expressed myosin, but no fusion of cells was reported (Gang et al. 2004b) When cocultured on murine fetal cardiomyocytes, human UCB began synchronized beating in culture after seven days (Nishiyama et al. 2007) Immunocytochemistry indicated actinin, and connexin 43 on these ce lls. Transcripts for GATA4, cardiac actin, cardiac troponin T, cardiac troponin I, and Nkx 2.5 were also amplified. Cells successfully engrafted into the atria, ventricles and septum when transplanted into fetal sheep hearts (Kogler et al. 2004) No cell fusion was apparent between host and donor

PAGE 37

37 cells. Myosin heavy chain, dystrophin, and ryanodine receptor were all identified in engrafted UCB. Treatment of human UCB with VEGF stimulated the expression of endothelial markers Flt1, Flk1, von Willebrand Factor, and t he transmembrane glycoprotein CD146 as well as a change in morphology to broad endothelial like cells with spontaneous formation of chain like structures (Zhao et al. 2006) Elongated or branched morphologies forming neuronal like networks were formed following treatment of human UCB with neural growth factor. These cells expressed the neuronal markers microtubule associated protein 1B, synaptophysin, neuronal transmitter gamma aminobutyric acid (GABA), and glutamic acid decarboxylase (GAD) (Zhao et al. 2006) Formation of neural pre cursors in vitro was achieved in approximately 90% of human UCB as evidenced by the presence of neurofilament, synaptophysin and GABA protein after 4 weeks of culture. When these cells were labeled and transplanted into the hippocampus region of adult ra t brain, three months after grafting cells were detected throughout the brain with a neuronal like highly differentiated morphology (Kogler et al. 2004) Additionally, Jeong et al report that human UCB exhibit morphological changes including a narrowing and thickenin g of the area around the nucleus while remainder of the cytoplasm elongated to give rise to multiple cellular processes (Jeong et al. 2004) These cells further progressed to yield network like structures and express glial fibrillar acidic protein (GFAP), Tuj1, TrkA and CNPase, markers of mature neuroglia. Neural differentiation can also be obtai ned following cryopreservation of UCB. Under permissive conditions, previously cryopreserved human UCB differentiated into neuronal cell types and expressed neurofilament, GAD, acety l cholinesterase, and GFAP (Lee et al. 2007) Neural stem cells derived from hUCB cultured on biodegradable human keratinassociated

PAGE 38

38 protein scaffolds differentiated into more mature phenotypes connected by gap and tight junctions (Jurga et al. 2009) Cells migrated away from aggregates and formed neural networks that were capable of generating spontaneous electrical activity, indicating the presence of a functional action potential. Hepatogenic differentiation has also been shown in a number of studies. Treatment of UCB with fibroblast growth factor (FGF) and hepatocyte growth factor (HGF) stimulated the expression of hepatogenic markers alphafetoprotein and cytokeratin 18 (Kang et al. 2005; Tang et al. 2006) These cells were capable of producing urea, storing glycogen, and LDL endocytosis, functional measures of liver cells (Hong et al. 2005; Kang et al. 2005; Tang et al. 2006) Additionally to determine if these cells were capable of producing insulin in an in vivo environment, xenograft transplantation was performed by Zhao et al. Human UCB were transplanted into Balb/c nude mice with induced diabetes. Mice were then evaluated for their ability to correct hyperglycemia. Mice receiving the UCB transplantation displayed significantly lower blood glucose levels than the untransplanted controls (Zhao et al. 2006) Adult Stem Cells Bone Marrow Derived Mesenchymal Stem Cells Isolation of bone marrow derived mesenchymal stem cells (or mesenchymal stromal cells; BMSC) has been occurring in research and medical practice for a number of years. In vivo these cells support the formation of hematopoietic cells. BMSC derived from humans, mice and horses attach to culture plates and exhibit a fibroblast like morphology when cultured in vitro They represent a very small portion of the total cell population of the bone marrow; reported numbers vary from 0.001 0.01% (Pittenger et al. 1999) BMSC are positive for cell surface markers SH2, SH3, CD29, CD44, CD71, CD106, CD120a, and CD124 but negative f or CD14, CD34 and CD45 (Pittenger et al. 1999) Common differentiation protocols can be used to elicit

PAGE 39

39 osteogenic, adipogenic and chondrogenic differentiation of BMSC. Adipogenic differentiation resulted in the (Pittenger et al. 1999; Meirelles Lda and Nardi, 2003; Tropel et al. 2004; Vidal et al. 2006) expression of type II collagen, aggrecan, and the formation of a proteoglycan rich extracellular matrix (Pittenger et al. 1999; Tropel et al. 2004) Furthermore, culture in osteogenic induction me dium resulted in rapid mineralization and nodule formation as well as runx2, type I collagen, osteopontin, and osteonectin expression (Pittenger et al. 1999; Meirelles Lda and Nardi, 2003; Tropel et al. 2004; Vidal et al. 2006) Mouse, rat, and human BMSC differentiated into hepatocyte like cells in presence of HGF and/or FGF4, expressing markers HNF3B, Gata4, HNF1a, albumin and CK18 by day 21. These cells produced urea and albumin at levels similar to monolayer cultures of primary rat hepatocytes and were also capable of endocytosing LDL and storing glycogen (Schwartz et al. 2002) Culture of hBMSC in enhanced DMEM further (Gong et al. 2008) 4, Nkx2.5, troponinT, troponinI, and connexin43 in murine BMSC (Li et al., 2008) Cells exhibited morphological but not functional differentiation no spontaneous beating was observed. Peripheral B lood D erived P rogenitor C ells In addition to cells derived from bone marrow, other sources of blood related stem cells have be en explored. Peripheral blood derived progenitor cells (PBPC) have been isolated from human, swine, and equine with limited success. Reports range from 3575% of collections that give rise to an adherent cell population (Koerner et al. 2006; Giovannini et al. 2008) These mononuclear cells exhibit fibroblast like morphology and proliferate rapidly (Chan et al. 2006; Koerner et al. 2006; Porat et al. 2006; Giovannini et al. 2008) PBPC ca n give rise to a

PAGE 40

40 number of differentiated or pre cursor cell types. In permissive medium, human PBPC underwent differentiati on into neural precursor cells, evidenced by changes in morphology and (Porat et al. 2006) These cells also underwent limited myogenic differentiation in vitro PBPC cultured with galectin 1 expressed desmin and subsequently formed multinucleated fibers over the following w eek of culture (Chan et al. 2006) In vivo transplantation into an injury model (c /y /RAG2 mouse) resulted in more muscle fibers expressing human spectrin in galectin 1 stimulated PBPCs than control PBPCs (
PAGE 41

41 differentiation is visualized by von Kossa staining of calcium deposits and osteopontin and Runx2 expression (Kim et al. 2004; Kestendjieva et al. 2008) Adipose Derived Stem Cells A population of stem cells can be derived from adipose tissue by obtaining fat from subcutaneous surgery. The tissue undergoes enzymatic digestion followed by filtration and centrifugation. Adherence to plastic and subsequent expansion produces a relatively homogenous population. Morphologically similar to bone marrow and umbilical cord blood derived stem cells, adipose derived stem cells are spindle shaped. Adipose derived mesenchymal stem cells (AdMSC) express similar cell surface markers to bone marrow derived MSC, including CD13, CD44, CD73, CD90, CD105, CD106, CD166, CD29, CD49e, and HLA ABC (Gronthos et al. 2001; Katz et al. 2005; Wagner et al. 2005; Yanez et al. 2006) While HLA ABC surface markers are expressed on these cells, they lack expression of HLA DR. Additionally, AdMSC did not stimulate lymphocyte proliferation (Yanez et al. 2006) In fact, AdMSC inhibited the proliferation of T cells stimulated with peripheral blood mononuclear cells. When co cultured in a transwell, soluble factors secreted by AdMSC exerted immunosuppressive effects on responder T cells but only when AdMSC could interact with responder lymphocytes. Furthermo re, AdMSC infusion decreased the severity of graft v. host disease in mice when used in the first two weeks. Adipose derived stem cells have been induced to differentiate into osteogenic, chondrogenic, adipogenic, cardiomyogenic and neurogenic cell types (Gronthos et al. 2001; Katz et al. 2005; Wagner et al. 2005; Guilak et al. 2006; OedayrajsinghVarma et al. 2006; Liu et al. 2007; Yoshimura et al ., 2007; Zhu et al. 2008; Mehlhorn et al. 2009) Cells induced to osteogenic differentiation express RunX2 and Col1a1 after 7 days of culture, with mineralization after 3 weeks (Oedayrajsingh Varma et al. 2006) Comparison of AdMSC and

PAGE 42

42 BMSC indicates that AdMSC are less efficient at osteogenic differentiation, despite considerable similarity in gene expression throughout the differentiation process (Liu et al. 2007) Adipogenic differentiation was observed following treatment with insulin and IBMX (Gronthos et al. 2001; Katz et al. 2005; Guilak et al. 2006; Liu et al. 2007) Cells formed lipid vacuoles expression of proteoglycans and type II collagen (Guilak et al. 2006; Liu et al. 2007; Yoshimura et al. 2007) Culture on a poly lactide co glycolide scaffold resulted in the expression of Col2a1 and a homogenous distribution of proteoglycans (Mehlhorn et al. 2009) However, the AdMSC are again less efficient at chondrogenesis producing less Col2a1, chondroitin sulfate, and hyaluronan (Yoshimura et al. 2007) Neural differentiation has also been reported by several labs (Katz et al. 2005; Guilak et al. 2006) In instructive media, AdMSC gain elongated cytoplasmic processes and express NeuN, GFAP, and tubulin. Injection of murine AdMSC into ischemia induced angiogenesis resulted in a greater degree of perfusion in the implanted limbs (Kondo et al. 2009) Injection of mature adipocytes resulted in weaker recover y of perfusion than saline injected controls. Additionally, AdMSC recruited endothelial precursor cells and stimulated the secretion of SDF1 and VEGF in ischemic hind limbs. Human AdMSC cocultured with neonatal rat cardiomyocytes resulted in elongation of AdMSC and formation of myotube like structures (Zhu et al. 2008) After two weeks of coculture, AdMSC stained positively for myosin heavy chain, troponinI and connexin 43. At this time, the AdMSC and cardiomyocytes contracted synchronously. Rarely, binucleate AdMSC were found in cocultures. Therapeutic Uses of Stem Cells Stem cells have been widely accepted as a potential therapeutic aid in disease and injury states in both humans and animals. Diseases ranging from metabolic inefficiencies to

PAGE 43

43 musculoskeletal defects and neurological disorders could benefit from the use of a nave cell type which promotes repair or production of healthy tissue. The potential of stem cells lies in not only their ability to contribute healthy, differentiated cells to the unhealthy region, but in the production of beneficial growth promoting factors and recruitment of additional reparative cells. The precise effects of stem cells in each diseas e state remain to be determined as do the mechanisms by which they may help. Spinal Cord Injuries A number of stem cell populations have been used to treat spinal cord injuries in hope of improving neural regeneration and recovery of locomotion. Embryonic stem cells differentiated into neural precursors were transplanted into a spinal cord injury (SCI) model in the rat (McDonald et al. 1999) Transplanted cells were found at the injury site and at distances up to 8 mm from the injury. Engrafte d ES cells expressed markers of oligodendrocytes, neurons, and astrocytes with no evidence of tumor formation. Rats receiving UCB transplants demonstrated partial hind limb weight bearing and improved coordination compared to a complete lack thereof in sha m operated rats. Engraftment of fetal neural stem cells into immun o deficient mice after a traumatic spinal cord injury showed locomotory recovery (Cummings et al. 2005) Cells had migrated extensively from the injection site at 17 weeks post injury. Transplantation resulted in a higher degree of locomotor recovery with greater coordinated forelimb hind limb function after 16 weeks. Ablation of the stem cells after transplantation by diphtheria toxin resulted in similar coordination to animals with no stem cell transplantation, indicatin g that the improvement is due to the presence of these cells. Engrafted cells differentiated into neurons and oligodendrocytes. Transplantation of neurospheres into a contusion model of SCI by Ogawa et al resulted in engrafted cells differentiating into n eurons, oligodendrocytes, and astrocytes (Ogawa et al.

PAGE 44

44 2002) Cells underwent mitotic neurogenesis. Additionally, some donor axons were myelinated and formed pre synaptic structures. Infusion of UCB into a rat model of stroke ameliorated many of the physical and behavioral deficits associated with the injury (Chen et al. 2001) hUCB engrafted into the brain of rats that suffered a stroke with the majority of cells localized to the boundary of the ischemic region. Engrafted cells were reactive with neuronal and astrocyte markers. Treatment within 24 hours of injury significantly improved functional recovery measured by the motor rotarod test and neurological se verity scores (NSS), however later treatment resulted only in improved NSS. Transplantation of hUCB into either the femoral artery or the brain of induced stroke rats resulted in higher levels of spontaneous activity compared to nontransplanted controls (Willing et al. 2003) The recovery of motor asymmetry was shown to be dose dependent in animals treated with varying numbers of UCB (Vendrame et al. 2004) Transplantation also decreased the area of infarction, ischemic volume, and inflammatory cytokines TNF 6 compared to nontransplanted rats in a stroke model (Vendrame et al. 2004; Vendrame et al. 2005; Vendrame et al. 2006) When hUCB were injected into rats via the saphenous vein 24 hours after transient middle cerebral artery occlusion, an improvement in neurological severity scores was apparent in transplanted rats by day 14 (Xiao et al. 2005) Transplanted rats s howed improvement in the stepping test measuring asymmetric movement. Smaller lesion sizes were measured in transplanted animals, although very few cells engrafted into the brain. However, implants of hUCB into the cortex resulted in neuronal outgrowth fr om the contralateral side and improvement in NSS scores. Vertebrae In addition to examining the effect of stem cells on neurogenesis, stem cells have also been used to aid the repair of the vertebrae surrounding the spinal cord which is also likely to be

PAGE 45

45 marrow derived MSC and autografts from the iliac crest fused the L4 and L5 vertebrae similarly in the Cynomolgus monkey (Orii et al. 2005) However, bone formation assessed by micro computed tomography showed grea ter new bone formation at 12 weeks in BMSC engrafted vertebrae than those receiving autografts. Likewise, in an ovine model of vertebrae injury, higher fusion was apparent in implants of BMSC on a TCP scaffold than autografts (Gupta et al., 2007) Newly formed woven and lamellar bone trabeculae in a cancellous organization with evidence of remodeling was observed in BMSC/ TCP grafts. Formation of hematopoietic and fatty marrow tissue was also apparent. Using a canine cancellous bone matrix transplanted with BMSC, superior fusion volume and fusion area for mineralized and demineralized matrix was observed over graft alone (Muschler et al. 2003) In a clinical trial, bone grafts saturated with uncultured autologous BMSC were implanted into acute thoracolumbar fractures (Faundez et al. 2006) The resorbable matrix was replaced with new bone containing several active foci of membranous and/or endochondral ossification. Cardiovascular Repair In rabbits with surgical myocardial infarctions, hBMSC were injected into the border area of myocardial ischemia (Wang et al. 2005a) Lower mortality was reported in the cel l transplant group compared to controls. Surviving patients had higher ejection fractions. Engrafted cells differentiated into cardiac troponin I expressing cells. In a canine model of cardiovascular disease, labeled canine BMSC were injected into a chron ically infarcted myocardium due to a permanently ligated coronary (Bartunek et al. 2007) Labeled cells expressed cardiac specific myosin or troponin I by four and twelve weeks after injection. Newly differentiated cardiomyocyte like cells were observed within the fibrotic area of infarction. Transplanted BMSC expressed connexin43, consistent with the integration into the host tissue. No

PAGE 46

46 calcification or osteogenic formation was noted. Pre differentiated BMSC injected into heart resulted in increased shortening and regional wall thickening suggesting a higher degree of functional recovery. Eight weeks after transplantation of hBMSC into rats with acute myocardial infarcts, engrafted cells expressed connexin43 and cardiac troponin T (Chang et al. 2008b) Functional aspects of the heart were improved, with reduced left ventricular end diastolic diameter and end systolic dimension as well as improvement of fractional shortening. Comparing hBMSC and hUCB in a mouse model of cryoinjur y to the left ventricle, Ma et al determined that the presence of both cell types increased capillary density (Ma et al. 2006) How ever, hUCB had no effect on the shortening fraction while BMSC alleviated the decrease in contractility caused by cryoinjury. Additionally, while both BMSC and UCB could be identified in the myocardium, no neocardiomyocyte like cells were found. Stem cell s from umbilical cord blood have also been used as a therapeutic tool in the treatment of cardiovascular diseases. hUCB implantation into Sprague Dawley rats with acute myocardial infarction present engrafted cells that express cardiac troponin T, von Wil lebrand factor, and smooth muscle actin indicating that these cells contributed to cardiac, endothelial and smooth muscle cell types (Wu et al. 2007b) Left ventricular ejection fraction was increased within two weeks of transplantation. Rats transplanted with hU CB also demonstrated an increase in arteriole vessels and capillary density. hUCB implantation into a hind limb model of ischemia in nude mice resulted in marked improvement of perfusion as well as a time dependent increase in blood flow following the inj ection of hUCB (Wu et al. 2007a) Genetically modified hUCB were used by Chen et al to treat a murine model of acute myocardial infarction (Chen et al., 2005) hUCB transfected with vascular endothelial growth factor (VEGF) or Angiopoietin1 were imp lanted into the damaged myocardium. Transplanted cells incorporated into the

PAGE 47

47 myocardium and expressed VEGF or Ang1. Treatment with untransfected hUCB decreased the infarct size, however cells expressing VEGF reduced infarct size further. Transplantation of cells expressing VEGF or Ang1 also increased capillary density and improved fractional shortening and ventricular ejection fraction. Tendon and Ligament Injuries Current treatments for tendon injury are inefficient at best, including immobilization or s urgery to reattach partially severed tendons. Re injury is a common problem due to the replacement of tendon tissue with scar tissue. These changes in the tendons capacity to store energy and recoil affect the ability of the tendon to adapt and equally di sperse the load, potentially creating microdamage leading to re injury. In some animals, bone marrow derived stem cells (BMSC) have been used to treat tendon lesions with some success. Several reports suggest improved results using BMSC injections compare d to traditional treatment programs (Smith et al. 2003; Crovace et al. 2007; Pacini et al. 2007; Guest et al. 2008) No negative immune response was reported using autologous or allogeneic BMSC injections into core superficial digital flexor tendon (SDFT) lesions (Smith et al. 2003; Guest et al. 2008) The labeled cells integrated into tendon, assuming tenocyte like morphology (Guest et al. 2008) However, a low efficiency (0.001%) of engraftment was reported. Autologous BMSC transplanted into collagenase induced SDFT lesions decreased the lesion size as a percent of total tendon cross sectional area (Crovace et al. 2007) Racehorses with typical core SDFT lesions receiving stem cells suffered no adverse reactions (Pacini et al. 2007) One month following injection, greater tendon density was apparent in horses injected with BMSC compared to uninjected control horses. Tendons appeared almost completely repaired after six months. All returned to racing with no further reinjury more than two years after diagnosis. Control horses showed fibrosis during the healing process and all were reinjured within twelve months after the

PAGE 48

48 initial diagnosis. Autologous rat BMSC successfully eng rafted into injured MCL (Watanabe et al., 2002) These cells became spindle shaped with elongated nuclei and aligned with parallel collagen bundles within 14 days of treatment. Biomechanical properties including stiffness, maximum force, maximum stress, and modulus were all improved in tendons receiving a gel sponge seeded with autologous BMSC (Juncosa Melvin et al. 2006) In a patellar tendon defect, BMSC seeded collagen composite implants str engthened tendons over natural repair (Awad et al., 2003) However, 28% of these grafts showed formation of ectopic bone. Bone free tendons exhibited improved biomechanics, with increased maximum force, stiffness and strain energy after 26 weeks of recovery. Values reported for cell seeded grafts were interm ediate to naturally repaired tissue and normal, healthy tissue indicating an improvement but not return to completely native state. Twenty days after implantation of hBMSC into a patellar tendon defect in rats treated tendons exhibited spindle shaped cells among collagen fibers aligned in parallel (Hankemeier et al. 2007) The improvement in biomechanical properties was also reported by Young et al, who implanted autologous BMSC into a gap defect model in the gastrocnemius tendon of the rabbit (Young et al. 1998) Treated repairs were stiffer, withstood more force and energy than control repairs but were still weaker than normal tissue. The area of the treated repair declined at a significantly fast er rate than control repairs. An alternate source of autologous stem cells derived from adipose tissue (adipose derived stem cells; ADSC) has recently become commercially available for use in the horse (VetStem, CA). This putative population of cells ha s been used to treat tendon, ligament and joint injuries. However, no data is available regarding the true identity of these cells or their capability for differentiation into various types of tissue. A recent report indicates that use of adipose derived mononuclear cell fractions for repair of collagenase induced lesions in the horse results in

PAGE 49

49 improvements in overall tendon fiber architecture after six weeks of recovery (Nixon et al. 2008) These cells may be more mature in nature than BMSC, as Kisiday et al report indicates they are less efficient at chondrogenesis than BMSC, secreting and accumulating less extracellular matrix (Kisiday et al. 2008) Bon e Injuries Union at the host implant interface was apparent by eight weeks in dogs implanted with allogeneic BMSC on a hydroxyapatitetricalcium phosphate scaffold (Arinzeh et al. 2003) A callus was also present around the periphery of the implant and host bone at this time. Newly formed bone and connective tissue were apparent; in some cases a marrow cavity was reestablished. Similar results were obtained with autologous BMSC, however cell free matrices formed little to no callus or new bone. No adverse host response to allogenic BMSC was observed. On hydroxyapatite ceramic (HAC), culture expanded BMSC osteo progenitor cells were implanted into a critical sized defect in ewes and allowed to recover for sixty days (Kon et al., 2000) Callus formation was observed between the bone and scaffold, regardless of the presence of cells. Transplants including cells had more substantial callus formation and earlier presence of bone than cell free trans plants. In another study using sheep, Viateau et al transplanted BMSC on coral constructs into a bone defect (Viateau et al. 2007) In ewes implanted with scaffold only grafts, no union formed but some bone deposition was present. Grafts with BMSC exhibited significant new bone formation and complete resorption of the scaffold as early as one month after implant. Notably, the same amount of new bone formation was present in the coral/BMSC grafts as autogenic corticocancellous grafts. In bone m arrow derived osteogenic progenitor cells cultured on a matrix consisting of demineralized bone and cancellous chips and subsequently transplanted into a critical sized defect in the canine femur, autografted and stem cell grafts resulted in 100% healing c ompared to 50% healing in graft only

PAGE 50

50 transplants and 67% in bone marrow grafts (Brodke et al. 2006) Goats with tibial bone defects that received autologous BMSC on a beta tricalcium phosphate scaf fold achieved full union by 32 weeks post surgery (Liu et al., 2008) At this point, the ceramic scaffold was almost completely resorbed and the engrafted bone had reached similar biomechanical properties as a normal tibia. Little callus was observed at 16 or 32 weeks in acellular grafts, which were not resor bed and did not heal during the 32 week trial. hBMSC implanted into a rat femur defect on (Bruder et al. 1998) By eight weeks, the BMSC seeded graft had significant bone formation within the pores of the scaffo ld and were integrating into the ends of the host bone. Union was complete by twelve weeks. New woven and lamellar bone were detected in close contact with the edges of the defect and were directly contiguous. Defects corrected with cell seeded grafts exhi bited increased strength and stiffness in biomechanical testing compared to grafts alone. Pores of the acellular grafts were primarily filled with fibrous tissue at twelve weeks. Following lunate arthroplasty, autologous rabbit BMSC were seeded on a scaff old of hyaluronan and gelatin prior to transplantation into the surgical defect (Huang et al. 2006) Removal of the entire lunate resulted in carpal collapse. However, rabbits receiving the implant presented evidence of new bone formation twelve weeks after surgery. Scaffold only implants showed no bone f ormation. Repaired tissue contained intensely stained metachromatic matrix and islands of ossicles within the lunate space. Endochondral ossification had occurred in central areas of the scaffold seeded with BMSC by twelve weeks with chondrocytes being replaced by woven bone. In a clinical trial, Marcacci et al report that patients injected with autologous BMSC into bone defects resulting from trauma exhibit callus formation between the host bone and hydroxyapatite cylinder implant after one to two months (Marcacci et al. 2007) Complete resorption occurred

PAGE 51

51 five to seven months after surgery; this integration was maintained in three patients six to seven years after surgery (the longest follow up available). Cartilage Injuries Swine BMSC label ed with green fluorescent protein were seeded on polyglycolic acid fibers (PGA) and polylactic acid (PLA) scaffolds prior to implantation into an osteochondral defect in the femur trochlea of both knees (Zhou et al. 2006) Transplantation of scaffolds with cells predifferentiated to cartilage resulted in relatively regular surfaces and newly formed cartilage like tissue a fter three months. Noninduced BMSC on scaffolds had inferior results, with irregular surfaces and visible tissue deficits with defects filled mostly with fibrotic tissue. Six months post surgery, nearly normal osteochondral tissue and relatively smooth a rticular surfaces were apparent in induced BMSC seeded grafts with strong metachromatic matrix production. Green fluorescent protein positive cells remained present in the graft site up to seven months post operation. Mrugala et al transplanted ovine BMSC with chitosan in fibrin glue in the patella (Mrugala et al. 2008) BMSC implanted in the absence of chitosan (fibrin glue only) formed poorly integrated tissue with no glyco s aminoglycan proteoglycan, or type II collagen expression. However, when chitosan was included, tissue resembling cartilage with lacunae and associated cells was observe d but integration remained poor. The combination of chitosan, presence of chondrocyte like cells surrounded by a matrix that stained positive for Safranin O, type II collagen, and aggrecan. However, some fibrous tissue remained and overlapped the neocartilage in some areas. Autologous uncultured rabbit BMSC transplanted into a full thickness cartilage defect on a fibrin gel carrier resulted in the regeneration of cartilage that stained intensely with Safranin O but remained inferior to normal cartilage (Chang et al. 2008a)

PAGE 52

52 Implants containing gel alone had much less area of regeneration coupled with the presence of fibrous tissue and less intense staining of extracellular matrix for Safranin O. BMSC injected directly into a full thickness defect of the articular cartilage of the left distal femur in 16 New Zealand white rabbits showed smooth, consistent white tissue resembling articular cartilage in the regenerating area (Im et al. 2001) In contrast, control animals exhibited red, irregular tissue with the margin of the defect sharply differentiated from the surrounding normal cartilage. Defects in the group receiving BMSC had relatively normal surfaces with adjacent normal cartilage showing little degen erative change. Control animals showed degenerative changes in adjacent cartilage, thin and undifferentiated defects, and decreased cellularity. Collagen matrices containing type I, type II and type III collagen seeded with ovine BMSC were used to fill s urgical defects in the medial condyle of the femur (Dorotka et al. 2005) Defects treated with cell seeded matrices appeared more filled than control de fects and had the largest quantity of hyaline cartilage. Autologous BMSC were implanted into full thickness cartilage lesions in the femoropatellar articulation in mature horses (Wilke et al. 2007) After thirty days, defects repaired with BMSC appeared more completely filled with more homogenous tissue. Arthroscopic scores were significantly higher in the BMSC seeded def ects. No consistent differences between control and cell seeded scaffolds could be determined eight months after surgery. The authors concluded that early repair was improved by the presence of BMSC but no long term benefits were apparent. Yan and Yu compared the effects of chondrocytes, BMSC, fibroblasts and hUCB seeded on a polylactic acid scaffold on a full thickness cartilage defect in rabbits (Yan and Yu, 2007) While no apparent visible difference in the defects were found after twelve weeks, the fibroblast and control scaffolds were filled with noncartilaginous tissue while hUCB and BMSC seeded scaffolds housed tissue indistinguishable from host hyaline cartilage.

PAGE 53

53 Areas of union between the host and graft were indiscernible in defects implanted with hUCB seeded PLA scaffolds. However, the junction between the repaired tissue and subchondral bone was irregular in grafts seeded with BMSC. Fibroblast seeded scaffolds exhibited irregular borders with some degeneration of surrounding cartilage. Poly lactide co glycolide scaffolds seeded with hum subcutaneously into scid mice (Mehlhorn et al. 2009) After eight weeks, histological examination demonstrated the presence of proteoglycans throughout the implant. Cells were round in shape and distributed homogenously throughout the scaff old. The presence of type II collagen was determined by immunohistochemistry, however some implants also expressed type control implants. In a clinical study, autolo gous BMSC were injected into patella femoral lesions (Wakitani et al. 2007) A cartilaginous matrix formed at the site of injection. Patients reported clinical improvement in lessening pain and range of motion wit h no adverse reactions. Muscular Dystrophies The use of stem cells in muscle disease generally involves muscular dystrophies. When human UCB were transplanted into the sjl mouse, a model of limb girdle muscular dystrophies, the cells engrafted into host muscle (Kong et al. 2004) A small number of fibers were capable of expressing dysferlin, the missing protein, twelve weeks after transplantation. Addit ionally, when injected into the adductor muscle of an ischemic mouse limb, human UCB engrafted into the injured muscle (Pesce et al. 2003) Some donor cells expressed desmin, a marker of myogenic differentiation. Transplantation increased the number of regenerating cont rols at an earlier time point, suggesting that the presence of UCB initiated an earlier healing process. Transplantation of human circulating AC133+ cells into scid/mdx mouse tibialis anterior resulted in cells engrafting into the regenerating muscle (Torrente et al. 2004) Some cells took up

PAGE 54

54 residence in the satellite cell position while others produced human dystrophin and myosin heavy chain. Additionally, muscle injected with ACC133+ cells possessed fewer regenerating fibers with less central nuclei than controls. Human fetal BMSC were transplanted intraperitone ally into mdx murine fetuses (Chan et al. 2007) Engraftment of human cells wa s apparent in a number of tissues including the brain, lung, liver and spleen. Skeletal, diaphragmatic and cardiac muscle expressed human specific myosin heavy chain transcripts. Human nuclei were present in regenerating muscle of transplanted animals an d some human dystrophin was expressed. Conclusion The scientific community has access to a widely varied population of stem cells with which to investigate the biology and potential application of the stem cell. Undoubtedly, certain cell types are more su ited for use in different situations. ES cells likely recapitulate early embryonic development; while adult bone marrow derived cells are more suited for the study of hematopoiesis in the adult animal. Investigations focus not only the stem cells themselves, but the environment in which they exist in the organism. The effects of the stem cell niche on not only the stem cell but the surrounding cells and tissues provide a huge area of potential research for therapeutic application.

PAGE 55

55 CHAPTER 2 CENTRAL HYP OTHESIS Stem cells exist in a wide array of plasticity and self renewing abilities. From embryonic stem cells which can divide indefinitely and recapitulate the entire organism to adult stem cells which are limited to a few cell divisions and differentia tion into a small number of cell types, each stem cell has its niche both in the life of the animal and in the world of therapeutic medicine. Umbilical cord blood is a widely available, often discarded source of stem cells. This population of stem cells has the potential to be an intermediate population between the nave embryonic stem cell and the less plastic adult stem cell. Owing to its immature source, umbilical cord blood derived stem cells may be a more malleable population of stem cells with less of the inherent risk of tumor formation found in embryonic stem cells. Using the horse as a model animal, we sought to identify stem cells from umbilical cord blood that may be useful in treating tendon injuries. Horses provide a large animal model tha t is easily accessible, easy to work with, and provides large volumes of umbilical cord blood at birth. Most foalings are attended by farm hands who can collect the blood with minimal training. Moreover, large animal models may be more appropriate to evaluate possible human therapies owing to greater similarities in anatomy and physiology than available in rodent models. Our hypothesis is that equine umbilical cord blood contains a population of stem cells that can be isolated, cultured, and differentiat ed into a variety of cell types. Specifically, the ability of these cells to differentiate into an early tendon precursor cell was examined. The following objectives were designed to test the hypothesis:

PAGE 56

56 Aim 1: Stem cells can be isolated from equine umb ilical cord blood and cultured using methods currently used in human medicine and research. Equine UCB stem cells express markers and morphology similar to other mese n chymal stem cells. Aim 2: Equine UCB have the potential to contribute to tendon injury and repair. Stem cells were examined for expression of early tenocytes. Tenocytic differentiation was promoted by culture on a variety of protein matrices and in growth factor containing media.

PAGE 57

57 CHAPTER 3 EQUINE UMBILICAL COR D BLOOD CONTAINS A P OPULA TION OF STEM CELLS THAT EXPRESS OCT4 AND DIFFERENTIATE INTO MESODERMAL AND ENDODERMAL CELL TYPE S Introduction Bone marrow (BM) derived mesenchymal stem cells (MSCs) are the conventional model of choice for adult stem cell based therapeutics in humans due t o their mu l tilineage differentiation capabilities. Their relative ease of expansion in vitro without loss of plasticity makes MSCs an attractive repair aid for damaged or diseased heart, bone and vascular tissues [for review see (Giordano et al. 2007) ]. However, enthusiasm for the use of MSCs as cytotherapeutics is tempered by their age dependent decline in absolute numbers and the invasive nature of their harvest (Stend erup et al. 2003) To counter these problems, umbilical cord blood (UCB) MSCs may represent a viable alternative. Several reports define a clonogenic population of cells from the umbilicus that differentiate into both mesenchymal and non mesenchymal tiss ue derivatives (McGuckin et al. 2003; Aoki et al. 2004; Baal et al. 2004; Bonanno et al. 2004; Peled et al. 2004; Ruzicka et al. 2004; He et al. 2005; Holm et al. 2006; Martin Rendon et al. 2007; Guest et al ., 2008) The identity of these cells as circulating stemlike progenitors versus endothelial progenitors detached from the umbilicus remains debatable (Kogler et al. 2004) A hierarchy in stem cell plasticity exists such that embryonic stem (ES) cells are pluripotent and adult MSCs are more limited in their differentiation capacity (Feinberg, 2007) UCB stem cells likely fall in the area between the two. The three classes of stem cells demonstrate variable stage specific embryonic antigen (SSEA) and tumor re jection antigen (Tra) surface marker protein expression patterns as well as differences in transcriptional circuitry. SSEA 3 and SSEA 4 are prevalent on the surface of human ES cells; these undifferentiated cells

PAGE 58

58 do not express SSEA 1 (Thomson et al. 1998; Reubinoff et al. 2000; Henderson et al. 2002) By contrast, mouse blastocyst inner cell mass cells and ES cells express SSEA 1 but not SSEA 3 or SSEA 4 (Henderson et al. 2002; Tielens et al. 2006) The keratan sulfate proteoglycan markers, Tra1 60 and Tra181, are localized within the extracellular matrix of human ES cells (Henderson et al. 2002; Stojkovic et al. 2004) Key to the establishment and maintenance of the undifferen tiated state of ES cells are the coordinated activities of Oct4, nanog, and Sox2 (Boyer et al. 2005) This combination of surface markers and plasticity genes represent the minimal defining components of a nave ES cell. By comparison, human BM derived MSCs are more limited in their expression of the central ES indicators likely owing to the heterogeneity of the population. SSEA4 is present on the surface of BM MSC; the cells lack Oct4 but can be induced to form multiple lineages (Gang et al. 2007) Culture of BM MSC i n FGF2 supplemented media results in Oct4 and nanog transcription suggesting that a premature phenotype reminiscent of ES cells can be established (Battula et al. 2007) UCB stem cells are unique in that they possess an intermediate phenotype that more clos ely resembles ES cells. SSEA 3, SSEA 4, Tra1 60, Tra181, Oct4, and Nanog are present in this population (McGuckin et al. 2003; Zhao et al. 2006; Markov et al. 2007; Sun et al. 2007) BM MSC isolated from adult horses differentiate along the chondrogenic and osteogenic lineages comparable to their human counterparts (Fortier et al. 1998; Worster et al. 2001; Koerner et al. 2006) However, a reduced level of success exists for the formation of adipocytes from BM aspirates (Koe rner et al. 2006; Vidal et al. 2006) Because human UCB stem cells exhibit a heightened degree of plasticity, we chose to identify a comparable cell entity in newborn foal cord blood as an alternative to BM MSC. Using conventional human purification met hods, culture conditions and differentiation protocols, an equine UCB cell population was

PAGE 59

59 discovered that possesses stem cell like markers and multilineage differentiation capabilities. The isolation and characterization of these cells represent a first st ep toward their application in cytotherapeutic repair of sport horse injuries. Materials and Methods U mbilical C ord B lood (UCB) C ollection and S tem C ell I solation Cord blood (n = 25) was collected from the intact umbilicus at foaling into a sterile 50 ml c entrifuge tube containing ethylenediamine tetraacetic acid (EDTA) as an anti coagulant. Blood was stored at 4C and further processed within 12 h of collection. Samples were incubated for 20 min with RosetteSep Human Cord Blood Progenitor Enrichment Cockta il (50 l/ml blood; Stem Cell Technologies, Seattle, WA), a commercially available product for negative selection of human UCB stem cells. An equal volume of phosphate buffered saline (PBS) containing 2% fetal bovine serum (FBS, Invitrogen, Carlsbad, CA) w as added. The cell suspension was layered atop a Ficoll Paque Plus (Stem Cell Technologies) cushion and centrifuged at 1,200g for 20 min. The cell interface was collected and cultured. Equine UCB and Adipose D erived (AD) Stem C ell C ulture MSCs isolated fro m equine adipose tissue were purchased from Sciencell Research Laboratories (San Diego, CA). Cells were cultured in Mesenchymal Stem Cell Medium (Sciencell Research Laboratories) on standard tissue plasticware, according to manufacturer's recommendations. UCB stem cells were cultured in Dulbecco's modified Eagle media (DMEM, Invitrogen) supplemented with 10% FBS and 5 g/ml Plasmocin (Invitrogen). Culture medium was exchanged every three days. Cells were passaged at 70% confluency using 0.025% trypsinEDTA (Invitrogen).

PAGE 60

60 RNA Isolation, R everse T ranscription (RT), and P olymerase C hain R eaction (PCR) Total RNA was isolated by lysis in STAT60 (Iso Tex Diagnostics, Friendswood, TX) and ethanol precipitation. The RNA was digested with DNase (Ambion, Austin, TX) to remove genomic DNA contaminants. One microgram of total RNA was reverse transcribed (Superscript III, Invitrogen) in 20 l reaction volume. Two microliters of first strand cDNA was amplified with gene specific primers and AccuPrime DNA polymerase (Invitrogen). Primer sequences included glyceraldehyde 3 phosphate dehydrogenase (F GATTCCACCCATGGCAAGTTCCATGGCAC, R GCATCGAAGGTGGAAGAGTGGGTGTCACT), collagen 2a1 (F CAGCTATGGAGATGACAACCTGGC, R CGTGCAGCCATCCTTCAGGACAG), Sox9 (F GCTCCCAGCCCCACCATGTCCG, R CGCCTGCGCCCACACCATGAAG), osteonectin (F CCCATCAATGGGGTGCTGGTCC, R GTGAAAAAGATGCACGAGAATGAG), Runx2 (F CGTGCTGCCATTCGAGGTGGTGG, R CCTCAGAACTGGGCCCTTTTTCAG), albumin (F AACTCTTCGTGCAACCTACGGTGA, R AATTTCTGGCTCAGGCGAGCTACT) and cytokeratin18 (F GGATGCCCCCAAATCTCAGGACC, R GGGCCAGCTCAGACTCCAGGTGC). PCR products were visualized following electrophoresis through 2% agarose gels containing ethidium bromide. Representative images were captured with a Kodak ImageDoc system and inverted in Adobe Photoshop CS. Osteogenic D ifferen tiation Cells were plated at a density 1,300 cells/cm2 and allowed to attach overnight in normal growth medium. The following day, cells were washed twice with PBS and placed in an osteogenic differentiation medium composed of alpha modified Eagle medium ( MEM), 10 mM glycerophosphate, 0.1 M dexamethasone, 0.1 mM ascorbic acid (Tondreau et al. 2005; Wagner et al. 2005) Media was changed twice weekly. Cells were fixed in 4%

PAGE 61

61 paraformaldehyde in PBS for 15 min on days 7, 14, and 21. Total RNA was isolated from parallel plates. Chondrogenic D ifferentiation UCB stem cells were pelleted to a micromass, promoting chondrogenic differentiation in a threedimensional environment. Cells (4 105) were pelleted at 1,000 g for 5 min. T he medium was removed and 0.5 ml chondrogenic medium was added (Worster et al. 2000; Tondreau et al. 2005) Chondrogenic medium consisted of DMEM, 1.0 g/L insulin, 0.55 g/L transferrin, 0.67 mg/L sodium selenite (ITS X, Invitrogen), 10 ng/ml transforming growth factor beta 1 (TGF 1, R&D Systems, Minneapoli s, MN), 35 g/ml ascorbic acid and 100 nM dexamethasone (Sigma, St. Louis, MO). Media was changed twice weekly. After 7, 14, and 21 days, the micromass was embedded and frozen in OCT freezing compound. Alternately, micromasses were washed with PBS and used for RNA isolation. Adipogenic D ifferentiation UCB stem cells were plated at a density of 3,000 cells/cm2 in growth medium. Adipogenic differentiation was induced with Iscove's modified Dulbecco's media (IMDM) supplemented with 10% FBS, 1 M dexamethasone, 10 g/ml recombinant human insulin, 0.25 mM 3isobutyl 1methylxanthine (IBMX) and 100 M indomethacin (Wagner et al. 2005) Medium was replaced every three days. Cells were fixed with 4% paraformaldehyde in PBS after 7, 14, and 21 days in culture. Hepatogenic D ifferentia tion UCB stem cells were plated at a density of 5,000 cells/cm2 and allowed to attach overnight in normal growth medium. The following day, cells were washed twice with PBS and placed in hepatogenic medium [1% FBS, 20 ng/ml recombinant human hepatocyte gro wth factor (HGF, R&D Systems), 10 ng/ml recombinant human fibroblast growth factor 4 (FGF4, R&D Systems)

PAGE 62

62 in IMDM], as described (Kang et al. 2005) Medium was replaced twice weekly. On days 7 and 14 cells were fixed in 4% paraformaldehyde in PBS for 15 min. Total RNA was isolated from parallel plates. Myogenic D ifferentiation UCB stem cells were plated at 3,000 cell/cm2 on gelatincoated tissue cultureware. Differentiation was initiated by incubation in low glucose DMEM supplemented with 200 g/ml galectin 1 (R&D Systems) essentially as described (Chan et al. 2006) After 14 days, cells were fixed with 4% paraformaldehyde or lysed for RNA isolation. Histology Alkaline phosphatase enzymatic activity was detected colorimetrically using Nitro Blue Tetrazolium Chloride (NBT) and 5Bromo 4Chloro3' Indolyphosphate p Toluidine (BCIP; Pierce, Rockford, IL) following fixation with 4% paraformaldehyde. Oil Red O (0.1% in 60% isopropanol) was used to visualize lipid droplets. Alcian Blue (1% in 3% acetic acid) staining was used to detect glycosaminoglycans. Safranin O (0.1% in water) was used for the visualization of proteoglycans and cartilage. Alizarin Red (2% in water, pH 4.2) was used for the detection of mineral deposits. Calcium deposits were detected by the method of von Kossa using 1% silver nitrate and 5% sodium thiosulfate. Immunocytochemistry Cells wer e fixed in 4% paraformaldehyde for 10 min at room temperature and permeabilized with 0.1% Triton X 100 in PBS. Nonspecific antigen sites were blocked with 5% horse serum. For the detection of stem cell markers, anti Oct4 (1:50, Santa Cruz, Santa Cruz, CA) anti SSEA 1, anti SSEA 3, anti SSEA 4 (1:50, R&D Systems), anti Tra1 60 (1:50, Abcam, Cambridge, MA) and anti Tra1 81 (1:50, Abcam) were used. Myogenic cells were incubated with anti desmin (1:200, DE U 10, Sigma Aldrich, St. Louis, MO) and Texas Red

PAGE 63

63 con jugated Phalloidin (Invitrogen). All antibodies were diluted in PBS containing 1% horse serum and incubated with fixed cells for 1 h at room temperature. Immune complexes were visualized with goat antimouse AlexaFluor488 (1:200), goat anti rabbit AlexaFlu or488 (1:200), or goat anti rabbit AlexaFluor568 (1:200) on a Nikon T200 microscope equipped with epifluorescence. Images were captured with NIS Elements (Nikon Instruments, Melville, NY) software and compiled with Adobe PhotoShop CS. Results Foal U mbilica l C ord Blood Contains an Oct4 E xpressing Cell P opulation Multipotent stem cells are routinely isolated from fresh cord blood at birth from humans by density gradient centrifugation. Initial Ficoll gradient separation of equine UCBs yielded a heterogeneous population with poor recovery of adherent cells. As such, a negative selection procedure (RosetteSep) was employed with the potential to remove extraneous natural killer cells, macrophages, lymphocytes, and B cells. Significantly fewer cells were present i n the buffy coat following centrifugation through Ficoll that attached readily to plastic cultureware. To ascertain their identity, cells were fixed and evaluated by immunocytochemistry for the stem cell markers, SSEA 1, Oct4, Tra160 and Tra1 81. Results demonstrated the presence of Oct4 in the nuclei of greater than 90% of the cells (Fig ure 3 1). A similar percentage of the cells contained Tra1 60 and Tra1 81, as well as SSEA 1. In data not shown, alkaline phosphatase enzymatic activity was readily detect ed and minor amounts of SSEA 4 were noted by immunocytochemistry. Thus, newborn foal cord blood contains a cell population that can be isolated with conventional human reagents and protocols and that express characteristic ES cell marker proteins.

PAGE 64

64 UCB S tem C ells F orm C hondrocytes The plasticity of UCB stem cells was evaluated by differentiation into cartilage precursors. Adherent stem cells were pelleted and cultured as a micromass in a defined media supplemented with ascorbic acid, dexamethasone and TGF 1. At the end of 3 weeks in chondrogenic media, the cell pellet was cryopreserved or lysed for RNA isolation. Alcian blue histology revealed the presence of proteoglycans, a matrix component of mature chondrocytes (Fig ure 3 2A ). The extracellular constituen ts of the micromass were rich in glycosaminoglycans, as indicated by Safranin staining. Sox9 is a transcription factor that positively regulates the expression of collagen and extracellular matrix genes in chondrocytes (Ng et al. 1997; Bi et al. 1999; Lefebvre et al. 2001) Expression levels of Sox9 and collagen 2a1 were evaluated by RT PCR after 7 and 21 days in chondrogenic differentiation media. Gene transcripts for Sox9 are evident after 7 days but absent by 21 days in differentiation permissive media (Figure 3 2 B). Abundant amounts of collagen 2a1 mRNA was evident at both time frames. T hese results demonstrate temporal and specific activation of the chondrogenic gene program. Differentiation of UCB S tem C ells into O steocytes Young thoroughbred racehorses are prone to debilitating bone fractures whose repair may be aided by stem cell based therapeutics. Therefore, UCB stem cells were cultured on plasticware in a defined media capable of inducing osteocytes from human UCB stem cells (Tondreau et al. 2005) After 3 weeks, cells were fixed with paraformaldehyde or harvested for RNA isolation. Alizarin Red histology indicated that the putative bone cells were capable of calcium deposition (Fig ure 3 3A). In a similar manner, Von Kossa staining detected calcium aggregates. RT PCR confirmed the osteogenic program in these cells. Primers specific for osteonectin and Runx2 amplified products of the correct size (Fig ure 3 3B). These results

PAGE 65

65 demonstrate that UCB stem cells are a source of osteocytes under appropriate in vitro cultivation conditions. Foal UCB S tem C ells can Differentiate into Endodermal D erived C ell T ypes A key feature of ES cells is their potential to contribute to any tissue type in the body. Adult stem cells possess a more limited plasticity than th eir embryonic counterparts. The ability of foal UCB stem cells to differentiate into hepatocytes, a cell type that originates from the endoderm, was examined. In brief, UCB stem cells were cultured for 2 weeks in media that supports hepatocyte formation in human UCB stem cells (Kang et al. 2005) Subsequently, cells were fixed with paraformaldehyde or lysed for RNA isolation. As shown in Figure 34 A, a change from an elongated, spindle shaped morphology to one exhibiting a larger cytoplasmic volume with an elliptical shape occurs in response to the treatment media. These cells express mRNA fo r both albumin and cytokeratin 18, definiti ve markers of hepatocytes (Figure 3 4 B). Equine UCBs maintained in the absence of induction media failed to express the liver marker genes (data not shown). The ability to respond in a manner similar to ES cells a nd form hepatocytes suggests that our UCB cell population may be more plastic than other adult MSC. Inefficient Formation of M yocytes and A dipocytes by UCB C ells Koerner et al. (Koerner et al. 2006) reported limited formation of adip ocytes from adult horse BM derived MSCs. Thus, we compared the adipogenic differentiation capabilities of foal UCB stem cells and adult horse adipocyte derived MSCs (A dMSC). In brief, both cell types were incubated for 21 days in adipocyte induction media. Cells were fixed and evaluated by Oil Red O histology for the presence of lipid droplets. In our hands, neither UCB nor AdMSC efficiently formed adipocytes. Sporadic fat cells containing limited amounts of lipid droplets were evident in foal UCB cell cult ures; no Oil Red O positive cells were found in the AD MSCs. This restricted differentiation profile by the two forms of stem cell was further exemplified

PAGE 66

66 following their incubation in myocyte induction media. UCB stem cells and AD MSCs were incubated for 7 days in media supplemented with galectin 1, a glycoprotein that promotes myogenesis in human fetal MSCs (Chan et al. 2006) Subsequently, cells were fixed and immunostained for the skeletal muscle marker protein, desmin. UCB stem cell cultures contained several m ultinucleated, spindle shaped cells that are reminiscent of myocytes. Anti desmin immunofluorescent detection reveals that these structures express the intermediate filament protein (Fig ure 3 5 B). No desmin expressing muscle cells were present in the AD MC Ss treated in a similar manner (data not shown). The presence of organized actin filaments was examined using Texas Red conjugated phalloidin. Equine UCB derived myoblasts contained organized actin structures throughout their cytoplasm (Fig ure 3 5C). By co ntrast, AdMSC cells contained fewer phalloidinreactive filaments. The cytoskeletal structures pointed to distinct differences in overall cellular morphology between the differentiated AdMSC and UCB myoblasts. UCB myoblasts were thin, elongated and cylindr ical in shape whereas the AdMSC cells were fibroblast like with an enlarged cytoplasmic space. Our results demonstrate differences between the two types of stem cells and suggest that foal UCB cells are more plastic than adult horse MSCs. AdMSC do not Expr ess the S ame C omplement of Stem C ell M arkers The inability of AdMSC to form adipocytes was surprising given that they originate from the fat depot. To ensure that the cells were nave and undifferentiated, subconfluent cultures of AdMSC were immunostained for stem cell markers. Similar to UCB stem cells, AD MSCs express Oct4, Tra1 60 and Tra181 (Fig ure 3 6). However, SSEA 1 and SSEA 4 were undetectable. These results indicate that AdMSC retain markers of adult stem cells but do not express those more close ly associated with ES cells.

PAGE 67

67 Discussion There is widespread interest in tendon, ligament and cartilage repair in horses through the use of directed stem cell transplantation methods. To date, published reports of multipotent cells isolated from BM, periphe ral blood, and UCB exist (Fortier et al. 1998; Saito et al. 2002; Koerner et al. 2006; Li et al. 2006) Cells from each of these sources display limited differentia tion into mesodermal cell types with predominant induction of chondrogenic and osteogenic precursors. Beyond these two cell types, vast differences in differentiation efficiencies and alternate cellular identities exist. The disparities may be attributed t o tissue source or suboptimal culture conditions; both possibilities necessitate further study. Alternatively, the transcriptional regulators that govern pluripotency may be absent or inactive thereby, limiting plasticity. Key to the ES celllike nature is expression of Oct4, Sox2, nanog, c myc, and Klf4 (Takahashi and Yamanaka, 2006) Foal UCB stem cells maintained in a growth factor rich medium expressed Oct4, SSEA 1, Tra1 60 and Tra1 81, all stem cell marker proteins. However, repeated attempts to detect nanog and Sox2 mRNA were unsuccessful. The absence of these transcription factors may contribute to the restricted types of cells generated and their incomplete differentiation (myoblasts). Interestingly, the ability of UCB stem cells to express these embryonic markers sets them apart from adult MSCs. Surface expression of SSEA 1 and SSEA 4 were not evident in equine AD MSCs. The lack of SSEA markers points to a hierarchy in plasticity that may account for some of the differences in differentiation capabilities. Efforts to define culture media that support nanog, Sox2, and Klf4 expression may lead to an increased range of differentiated lineages from UCB stem cells. Stem cells isolated from the umbilical cord matrix of pigs develop a morphology that resembles that reported by others for equine UCB stem cells (Carlin et al. 2006; Koch et al. 2007) In both examples, the majority of the cells attached to the cultureware surface and

PAGE 68

68 possessed a flat, spindle shaped, fibroblast like morphology. A lesser population formed light refractile colonies that grew upward from the substratum surface in a manner consistent with transformed fibroblas t foci. These colonies of small cells with a high nuclear to cytoplasmic volume were evident in our cultures of newborn foal UCB stem cells only after reaching confluency. Our UCB stem cells were maintained as a monolayer and passaged at approximately 60% confluency thereby, selecting against the development of these cell clusters that appear to grow independent of contact inhibition. While the identity of this cell population remains less clear, it is possible that these colonies represent a more primitive progenitor cell. Indeed, these cell clusters resemble those found in cultures of mouse ES cells. As such, one would predict that confluent equine UCB cultures that contain both the fibroblast like and light refractile cell colonies would express the plast icity genes, nanog and Sox2. However, expression of SSEA 1, Tra1 60, Tra181 and alkaline phosphatase, in a manner consistent with equine inner cell mass derived ES cells, provides encouraging evidence that our monolayer cells are naive and undifferentiate d (Takahashi and Yamanaka, 2006) Equine UCB stem cells, in our hands, are not direct equivalents to human UCB stem cells but do possess many similarities. Human UCB stem cells can be isolated directly from the blood and frozen without expansion (Lee et al. 2005) This aspect of enrichment and storage remains elusive in our equine UCB cells. Partial purification by negative immunoselection and density gradient centrifugation produces a cell population that survives immediate cryopreservation very poorly. This may be due to the small numbers of stem cells and/or heightened sensitivity of these cells to plasma membrane perturbation. Culture of the fresh isolates for 3 5 days allows for the removal of contaminating lymphocytes and cellular debris and expansion of the putative stem cell population, which can be stored in liquid nitrogen and subsequently recovered. Direct

PAGE 69

69 enrichment of the UCB stem cell population by affinity purification with CD133 antibodies may provide an alterna tive to both cell heterogeneity and cryopreservation issues. The capacity of foal UCB stem cells to initiate hepatocyte specific gene transcription demonstrates an endodermal developmental potential. Reports exist demonstrating hepatocyte formation from human UCB stem cells and MSC isolates from BM (Hong et al. 2005; Talens Visconti et al. 2006) However, this is the first report of hepatocyte formation using equine multipotential cells. Putative stem cells fro m the inner cell mass of equine blastocysts undergo spontaneous differentiation in vitro to yield cell derivatives of the three germ layers with endoderm defined by RT PCR detection of fetoprotein (Li et al. 2006) The ability of newborn foal UCB stem cells to form liver cells is encouraging as it provides additional evidence for a population with plasticity characteristics that more closely resemble an ES cell than an adult stem cell. A dditional endoderm derived cell types of clinical importance include pancreatic and cardiogenic. Human UCB stem cells can be induced to form heart cells following a two step differentiation protocol that involves 5azacytidine treatment (Kadivar et al. 2006) Culture with the hypomethylating agent suggests that UCB stem cells are more restricted in their differentiation capabilities than ES cells and requ ire chemical induced reprogramming. In our hands, treatment of foal UCB stem cells with 5 azacytidine did not induce the expression of myosin immunopositive cells. Because our antibody (MF20) recognizes all forms of sarcomeric myosin, this result provides indirect evidence that a full fledged cardiocyte is not created in response to epigenetic modification. However, a more comprehensive analysis of growth factor, morphogen and substratum requirements for UCB stem cell differentiation into cardiocytes is war ranted.

PAGE 70

70 Induction of the myogenic gene program has proven difficult in MSC originating from multiple animal and tissue sources. Exposure of rat BM derived MSCs to 5azacytidine caused differentiation into elongated, multinucleated myofibers (Wakitani et al. 1995) However, reprogramming the equine UCB transcriptome with this chemical did not induce the myogenic gene program (data not shown). A similar result was noted by others (Chan et al. 2006) Others reported that human UCB stem cells formed limited numbers of desmin immunopositive cells following in vitro differentiation (Nunes et al. 2007) These cells were devoid of the myogenic regulatory factors (MRFs) as measured by RT PCR. Interestingly, injection of the putative stem cells into mdx mice resulted in engraftment suggesting that compon ents within the muscle niche are essential for myogenic progression. One of those proteins is likely galectin 1, a glycoprotein of the basal lamina. Chan et al. (Chan et al. 2006) demonstrated that culture of human fetal MSC in media containing galectin 1 initiated both biochemical and morphological differentiation into myocytes. These cells formed large, multinucleated fibers that expressed contractile proteins and the MRFs. We used a similar approach with some degree of success. Supplementation of foal UCB cell cu lture medium with purified galectin 1 caused myogenic lineage establishment as determined by desmin immunocytochemistry. However, a large percentage of the myoblasts were fusion defective. In addition, we were unable to detect gene transcripts for MyoD, an early MRF, or myogenin, an MRF required for fusion and contractile gene expression. In accordance with our failure to amplify members of the MRFs, we did not detect myosin heavy chain or troponin T by immunocytochemical methods. The constraints to full ac tivation of the myogenic program may be attributed to the absence of complementary soluble proteins. The source of galectin 1 used by Chan was spent media from COS cells that produce and secrete the glycoprotein. Thus, additional proteins within the galect in 1 supplement may have aided

PAGE 71

71 induction of myogenesis. Alternatively, specie specific differences may underlie the discrepant results. Given the relative ease of adipocyte formation by human and rodent MSC, the inefficiency of adipogenesis in equine UCB s tem cells was surprising. Less than 1% of cells contained Oil Red O reactive lipid droplets following application of conventional adipogenic induction protocols. Koerner reported a similar result using BM derived and peripheral bloodderived MSC isolated f rom adult horses (Koerner et al. 2006) A very small number of adipocytes were found and the cytoplasmic lipid droplets within said cells were miniscule. By contrast, robust lipid formation is evident by Oil Red O histology in equine UBCs cultured in a similar adipocyte induction media (Koch et al. 2007) The discrepancy between these various reports may be attributed to the heterogeneity of the starting population and/or culture conditions. Koch reported the presence of dome like, clusters o f small cells as well as a fibroblastlike cell type (Koch et al., 2007) While we observe the same morphologies, care was taken to maintain the adherent monolayer exclusive of the foci like colonies. Future efforts will concentrate on resolving the identity of th ese divergent cellular phenotypes and their contribution to plasticity.

PAGE 72

72 Figure 3 1. Foal UCB cells express stem cell marker proteins. UCB stem cells (passage 5) were fixed and incubated with antibodies directed against Oct4, SSEA 1, Tra160 or T ra1 81. Immunoreactivity was detected with goat anti mouse AlexaFluor 488 or anti rabbit AlexaFluor 568 (Oct4). Nuclei were counterstained with Hoechst 33245. Scale

PAGE 73

73 Figure 3 2. Induction of chondrogenesis in foal UCB stem cells. Micr omass cultures were established as described. Cell pellets were embedded in OCT freezing medium and 10 um cryosections were collected. Alcian Blue and Safranin O histology indicated the presence of glycosaminoglycans and proteoglycans (A). Total RNA was i solated from cells treated in an analogous manner. RT PCR using gene specific primers indicated Sox9 and collagen 2A1 expression after 7 days in chondrogenic medium (B). Sox 9 mRNA was not detected at d21. RT, reverse transcriptase.

PAGE 74

74 Figure 3 3. U CB stem cells form osteocytes. UCB stem cells were maintained for 21 days in media containing glycerophosphate, dexamethasone, and ascorbic acid. Cells were fixed and stained for calcium and mineral deposition with Alizarin Red and von Kossa. Representat ive brightfield images (left part) and corresponding phase contrast fields (right part) at 200 are shown (A). Total RNA was isolated after 21 days in osteogenic induction medium. RT PCR using gene specific primers for osteonectin and RunX2 was performed. Products were separated through agarose gels and visualized with ethidium bromide (B). RT, reverse transcriptase.

PAGE 75

75 Figure 3 4. Foal UCB stem cells form hepatocytes. UCB stem cells were cultured for 14 days in absence or presence of HGF and FGF 4. Cells were fixed with 4% paraformaldehyde and representative phasecontrast images were captured at 200 (A). Separate cultures were analyzed by RT PCR for cytokeratin 18 ( CK18 ), albumin and glyceraldehyde 3 phosphate dehydrogenase ( GAPDH) gene expressi on (B). RT, reverse transcriptase.

PAGE 76

76 Figure 35. Incomplete initiation of adipogenesis and myogenesi s in foal UCB stem cells and Ad MSCs. Foal UCB and AdMSC cells were cultured in adipogenic induction media for 21 days prior to fixation. Oil Red O histol ogy demonstrates very few adipocytes in foal UCB cells (A). UCB stem cells were cultured for 7 days in myogenic induction media prior to fixation and desmin immunostaining. Arrow indicates multinucleated cell (B). Actin filaments were detected by incubatio n with Texas Red phalloidin (C). Total nuclei were visualized with Hoechst 33245. Scale bar = 25 m.

PAGE 77

77 Figure 36. AdMSC fail to express embryonic stem cell markers. AD MSCs were fixed and incubated with antibodies directed against Oct4, SSEA 1, SSEA 4, Tra1 60 or Tra1 81. Immunoreactivity was detected with goat anti mouse AlexaFluor 488 or anti rabbit AlexaFluor 568 (Oct4). Nuclei were visualized with Hoechst 33245. SSEA 1 and SSEA 4 were not detected. Scale bar = 10 m.

PAGE 78

78 CHAPTER 4 REFINEMENT OF CULTUR E CONDITIONS TO PROMOT E THE MAINTENANCE OF EQUINE UMBILICAL COR D BLOOD DERIVED STEM CELLS Introduction Cytotherapeutic repair in horses is a proposed means of decreasing the prescribed stall confinement period. Current strategies involve isolation of mes enchymal stem cells (MSCs) from bone marrow (BM) aspirates or adipose tissue coupled with autologous engraftment into the site of damage (Richardson et al. 2007; Taylor et al. 2007) Tendon lesions in horses treated with BM MSC retained a portion of the cells at the lesion site, exhibited properly oriented collagen fibrils and returned to exercise sooner (Pacini et al. 2007) Injection of BM MSCs into damaged superficial digital flexor tendons (SDFT) demonstrates that a portion of the cells is retained at the lesion site indicating that the improved healing is likely a product of the engrafted MSCs (Guest et al. 2008) MSC from equine adipose, bone marrow and umbilical cord blood efficiently differentiate into chondrocytes and osteocytes in vitro (Fortier et al. 1998; Arnhold et al. 2007; Koch et a l. 2007; Stewart et al. 2007; Kisiday et al. 2008; Reed and Johnson, 2008) Their ability to transform into cell types of additional lineages is limited. Under the appropriate conditions, UCB stem cells differentiate into adipocytes (Koch et al. 2007) A limited set of hepatogenic and myogenic markers was reported following UCB stem cell differentiation (Reed and Johns on, 2008) The reason for the restricted plasticity is unknown but may be associated with suboptimal culture conditions. Implicit to the pluripotent nature of human and rodent embryonic stem (ES) cells is expression of Oct4 and nanog (Chambers et al. 2003; Yates and Chambers, 2005; Wang et al. 2006; Babaie et al. 2007) Loss of either factor is associated with differentiation of the pluripotent cell Recent evidence demonstrates that e ctopic expression of Oct4 Sox2, Klf4 and c -

PAGE 79

79 myc is sufficient to reprogram somatic cells into ES like cells (Takahashi and Yamanaka, 2006; Takahashi et al. 2007; Aoi et al. 2008; Lowry et al. 2008) Oct4 mRNA is present in MSCs isolated from multiple tissue sources sugges ting that the transcription factor participates in the global inhibition of stem cell differentiation (Tondreau et al. 2005; Ren et al. 2006; Greco et al., 2007) Undifferentiated equine UCB stem cells express Oct4 in the nucleus, which is lost upon introduction of lineage decisions (Reed and Johnson, 2008) The objective of the experiment was to refine culture conditions of equine UCB stem cells and examine the effects of continuous culture on genetic markers of ES cell identity. Results indicate i mproved UCB stem cell population doubling times (PDTs) with cultivation on matrix associated protein surfaces. UCB stem cells express Oct4 nanog and Sox2 immediately upon establishment in vitro Serial passage is associated with decreased expression of both nanog and Sox2. Materials and Methods UCB Collection and Stem Cell I solation Cord blood was collected from the intact umbilicus of Thoroughbred foals (N= 4) at foaling into a sterile 50 ml centrifuge tube containing EDTA (1 mg/ml) as an anticoagulan t. UCB was stored at 4 C and putative stem cells isolated within 12 hours of collection. Samples were incubated for 20 minutes with RosetteSep Human Cord Blood Progenitor Enrichment Cocktail (50 l/ml blood; Stem Cell Technologies, Seattle, WA). An equ al volume of phosphate buffered saline (PBS) containing 2% FBS was added and the mixture was layered on a bed of Ficoll Paque ( Sigma, St. Louis, MO ). Cell aggregates were sedimented through the density gradient by centrifugation at 1,200 X G for 20 minute s. Mononuclear cells at the gradient interface were collected, washed with PBS and placed into culture.

PAGE 80

80 Stem Cell C ulture All media, serum and supplements were purchased from Invitrogen (Carlsbad, CA) unless otherwise noted. Murine ES cells (E14TG2a; (Thompson et al. 1989) ) were cultured using a modified procedure of that previously described (Piedrahita et al. 1992) and served as positive controls. Briefly, ES cells were cultured in Dulbeccos modified Eagle medium (DMEM) supplemented with 15% fetal bovine serum (FBS), 1000 units/ml leukemia inhibitory fact or (LIF), 2mM L glutamine, 0.1 mM 2mercaptoethanol on 0.1% gelatin coated plasticware. Cells were passaged at 70% confluence using 0.025% trypsinethylenediamine tetraacetic acid (EDTA). UCB stem cells were cultured on 0.1% gelatin (Fisher Scientific, Pittsburgh, PA), 0.01% fibronectin (Sigma Aldrich, St. Louis, MO), rat tail collagen I (5 g/ cm2) or uncoated tissue cultureware. Conventional UCB stem cell growth media (GM) is DMEM supplemented with 10% FBS and 5 g/ml plasmocin (InVivogen, San Diego, C A). Test media included GM supplemented with10 ng/ml FGF2 (R&D Systems, Minneapolis, MN), 1% nonessential amino acids, 1% insulintransferrin selenium (GM+FGF), Iscoves modified Dulbeccos media (IMDM) supplemented with 10% FBS, 50 ng/ml Flt3, 10 ng/ml thrombopoietin and 20 ng/ml c kit [GM+Flt/Tpo/Kit; (McGuckin et al. 2003) ] or conditioned media (CM). CM was coll ected from confluent UCB stem cells cultured in growth medium and centrifuged at 1500 x g for 10 minutes. The supernatant was retained and supplemented with 3% FBS and 5 g/ml plasmocin. Culture medium was exchanged every three days and cells were passaged at 70% confluency using 0.025% trypsinEDTA. Additionally, c ell number was determined daily for 4 days on subpopulations of UCB for the calculation of PDT according to the formula N=N02(t/pdt) where N = final cell number, N0 = initial cell number, t=time, and pdt= population doubling time. Phase photographs were captured by a Nikon T200 microscope with NIS Elements software (Nikon

PAGE 81

81 Instruments, Melville, NY) and converted to grayscale in Adobe Photoshop CS. Cell number was determined by manually counting the number of attached cells in six random photographed fields. Manual counting was employed to minimize the disruption of cell growth. For extended passaging, UCB cells at passages three, six, and nine were plated at a density of 2000 cells/cm2 on the a ppropriate substrata in either FBS or Modified FBS media. Cell number was determined on days 0 through 4 and population doubling time was determined as above. Cells were harvested for RNA isolation on day 4 for subsequent RT PCR analysis. All samples were evaluated in duplicate. RNA Isolation, Reverse Transcription (RT) and P olymerase C hain R eaction (PCR) Total RNA was isolated by lysis in STAT60 (Iso Tex Diagnostics, Friendswood, TX) and ethanol precipitation. The RNA was digested with DNase (Ambion, A ustin, TX) to remove genomic DNA contaminants. One microgram of total RNA was reverse transcribed (Superscript III, Invitrogen, Carlsbad, CA) in 20 l reaction volume. Two microliters of first strand cDNA was amplified with gene specific primers and AccuPrime DNA polymerase (Invitrogen, Carlsbad, CA). Primer sequences are glyceraldehyde 3phosphate dehydrogenase (F GAGATCCCGCCAACATC, R CTGACAATCTT CAGGGAATTGTC), Oct4 (F GCTGCAGAAGTGGGTGGAGGAAGC, R GCCTGGGGTACCAAAATGGGGCCC), Nanog (F GTCTCTCCTCTGCCTTCCTCCATGG, R CCTGTTTGTAGCTAAGGTTCAGGATG), Sox2 (F AACGGCAGCTACAGCATGA, R TGGAGTGGGAGGAAGAGGTA), Klf4 (F TGGGCAAGTTTGTGTTGAAG, R TGACAGTCCCTGTTGCT CAG), c myc (F GACGGTAGCTCGCCCAAG, R ACCCCGATTCTGACCTTTTG) Jagged 1 ( F GCCTGGTGACAGCCTTCTAC R GGGGCTTCTCCTCTCTGTCT), Jagged2 ( F CATGATCAACCCCGAGGAC R CGTACTGGTCGCAGGTGTAG ), Notch 1 ( F -

PAGE 82

82 GAGGACCTGGAGACCAAGAAGGTTC R AGATGAAGTCGGAGATGACGGC ), Notch 2 (F GCAGGAGCAGGAGGTGATAG, R GCGTTTCTTGGACTCTCCAG), Notch 3 (F GTCCAGAGGCCAAGAGACTG, R C AGAAGGAGGCCAGCATAAG ), Dll 1 ( F ACCTTCTTTCGCGTATGCCTCAAG R AGAGTCTGTATGGAGGGCTTC ), and Dll 4 ( F CGAGAGCAGGGAAGCCATGA, R CCTGCCTTATACCTCTGTGG ) cDNA was amplified with the gene specific primers listed below using the following protocol: 5 minutes at 94C for the initial denaturation followed by 40 cycles of 94C for 30 seconds, 53C for 30 seconds, and 68C for 30 seconds. Amplicons then underwent a final elongation period a t 68C for 10 minutes. PCR products were visualized following electrophoresis through 2% agarose TAE (40 mM Tris, pH 8.0, 2 mM EDTA) gels impregnated with ethidium bromide. Representative images were captured with a Kodak ImageDoc system and inverted in Adobe Photoshop CS. All products were verified by sequencing. Statistical Analysis Transcript expression was analyzed by logistic regression using the LOGISTIC procedure in SAS (SAS Institute, Inc., Cary NC) Reference values for substrata, media, and p assage were set at uncoated, growth media, and passage three, respectively. Probability values from the logistics procedure were obtained using WALD Chi square statistics derived from type III analyses of effects. Initial models included all main effects and interactions. Data were reanalyzed after removing nonsignificant effects from the model. Chi square probability is reported. Doubling time data was analyzed by ANOVA using the GLM procedure of SAS. Initial models included all main effects and interac tions. Subsequent reanalysis removed all nonsignificant effects from the model. Passage, substrata, media and horse were tested as main

PAGE 83

83 effects. Comparisons of least squares means were examined by the PDIFF option of the LSMEANS statement. Statistical significance for all experiments was set at p<0.05. Results UCB Express Markers of Pluripotent Stem Cells Equine UCB stem cells are cultured routinely in basal media supplemented with 10% fetal bovine serum [GM; (Koch et al. 2007; Reed and Johnson, 2008) ]. Under these conditions, the majority of cells grew in a monolayer with fibroblast like morphology (Figure 41A). However, a small portion of cells formed colonies reminiscent of embryonic stem cell colonies (Fig ure 1B). Oct4 nanog, Sox2, Klf4 and c myc are involved in somatic cell reprogramming to ES like cells and the gene products are implicated in pluripotency (Takahashi and Yamanaka, 2006; Takahashi et al. 2007) Total RNA was isolated from mouse ES cells and equine UCB stem cells and analyzed by RT PCR for expression of the aforementioned gene products. As expected, transcripts for the reprogramming genes were detected in mo use ES cells (Fig ure 4 1C ). In a similar manner, Oct4, nanog, Sox2, Klf4 and c myc amplicons were present in UCB stem cell RNA isolates. No DNA products were evident in RT PCR reactions in the absence of reverse transcriptase. GM and GM+FGF Maintain UCB Proliferation To determine the effects of culture conditions on UCB stem cell proliferation and stemness, cells were supplemented with a number of growth factor combinations. Supplementation of GM with FGF2 did not disrupt morphology (Figure 42 ). How ever, a combination of Tpo, Flt3 and c kit, or CM resulted in a morphology resembling cells in replicative senescence. Cell number change over a four day culture period was measured and population doubling times (PDT) determined. GM and GM+FGF maintained shorter doubling

PAGE 84

84 times than other cultures GM+Tpo/Flt/Kit and CM were discontinued due to morphological changes and a prolonged PDT and cell death. Protein Surface Matrixes Promote UCB Growth UCB stem cells were seeded at equal cell densities on gelati n, fibronectin, collagen and uncoated surfaces. Cell population doubling times were calculated following four days of culture (Table 41). UCB stem cells on coated surfaces demonstrated fas ter PDTs than controls maintained on uncoated tissue plasticware Changes in PDT were independent of the type of matrix used. Additionally, PDT was increased in cells cultured in GM+FGF (35.681.25 hr) compared to growth media controls (27.650.74 hr; p<0.0001). The interaction of media and substrata types demonstra ted that cells cultured on any type of matrix in control media have significantly faster doubling times than their respective cultures in media supplemented with FGF2 (Table 4 2). Cells cultured on collagen, fibronectin, and gelatin matrices in control me dia exhibit no differences in growth kinetics. Few stem cell populations are immortal in vitro most enter replicative senescence over time in culture. Thus, population doubling times during continuous culture were determined at passages three, six, and ni ne. Time in culture significantly increases PDT from passage three through passage nine (21.090. 3 hr, 34.841.28 hr, and 39.061.0 hr, respectively; p<0.0001 for all interactions). While there was no significant effect of media at passage three (p=0.136 1), later passages showed significantly shorter doubling times when cultured in control growth media compared to GM+FGF (p<0.0001, data not shown). Oct4 is Maintained Throughout UCB Culture Having determined appropriate culture conditions to maintain prol iferation, markers of stemness were measured by RT PCR. Oct4 expression is maintained over time in culture

PAGE 85

85 regardless of substrata or media (Table 4 3). However, nanog and Sox2 mRNA decline with serial passage. Expression of both genes is affected by substrata, maintaining expression longer on a protein matrix (particularly collagen) than on uncoated plasticware. Media containing FGF2 does not affect the maintenance of either nanog or Sox2 mRNA. The presence of nanog transcripts was significantly differ ent among horses, suggesting an innate heterogeneity among animals. Notch Signaling in UCB Stem Cells Notch signaling plays a crucial role in cell:cell communication among mature and naive cells. In human ES cells, constitutive Notch signaling promotes dif ferentiation, particularly to neural cell lineages (Lowell et al. 2006) In hematopoietic stem cells (HSCs), constitutive activation of the Notch pathway including downstream target Hes1 led to an increased self renewal capacity of long term in vivo repopulating HSCs (Stier et al. 2002; Kunisato et al. 2003) The Notch signaling pathway consists of a transmembrane receptor, Notch, which is cleaved upon the binding of an extracellular ligand. The ligands for Notch are generally also membrane bound to adjacent cells. There are three Jagged proteins and two Delta like ligand (Dll) proteins that serve to activate Notch signaling. Upon ligand binding, Notch undergoes a series of proteolytic cleavages, resulting in the release of the Notch intracellular domain (NICD) which relocates to the nucleus and acts as a transcriptional regulator. To determine what members of the Notch pathway were present in UCB and AdMSC, and to compare that expression with the pathway present in mES, RT PCR was performed for jagged1, jagged2, notch1, notch2, notch2, Dll 1, and Dll 2. Mouse ES exhibited amplicons for all transcripts examined (Fig ure 4 3). Notch 1, Notch3 and Jagged 1 were present in UCB stem cells, indicating the possibility for a functional pathway in these cells. However, only the

PAGE 86

86 ligand Jagged 1 is found in AdMSC. This suggests that adipose derived stem cells may not be full y capable of Notch signaling but could contribute to signaling to surrounding cells. To identify the effects of the Notch pathway on UCB proliferation, cells were cultured for three days in media with or without the Notch inhibitor L685,458. Cell number was determined daily by visual inspection and manual counting. Inclusion of the Notch inhibitor had no significant effect on cell number over the three day period (Figure 44). Furthermore, UCB culture in the presence of the Notch inhibitor had no effe ct on the presence of Oct4, nanog, or Sox2 as determined by RT PCR (data not shown). Notch signaling is mediated by the transcription factors hes and hey. The presence of hes and hey in UCB was determined. 23A2 myoblasts were used as a positive control. No transcript was amplified for hey, however hes transcripts were present in both cell types. Furthermore, there appeared to be no difference in cells treated with L685,458 and control cells of either type (Figure 4 5). To further verify this, real time PCR was performed following three days of treatment with the Notch inhibitor. Delta Ct values are reported in Table 4 4. No difference in expression levels was apparent in either cell type. To verify the efficacy of the Notch inhibitor, 23A2 myoblasts were stimulated to differentiate. The presence of BMP6 abrogates differentiation however, this can be inhibited by the inclusion of L685,458. Control cells formed myotubes within 48 hours in differentiation medium (Figure 4 6). At this time, 76% of nuc lei were included in myosin heavy chain (MyHC) expressing cells. The presence of BMP6 in differentiation media inhibited myotube formation, with fewer than 10% of cells expressing MyHC. However, inhibition of the Notch pathway in the BMP6 stimulated cells abrogated the effects of BMP6 and allowed a partial recovery of

PAGE 87

87 differentiation. Greater than 30% of cells immunostained positive for MyHC. Supplementation of the differentiation media with L685,458 alone had no effect on differentiation. We conclud e from these experiments that while the Notch pathway may play an important role in differentiation of specific stem cell types, it is not crucial for the proliferation of UCB stem cells. Furthermore, we have been unable to demonstrate that UCB stem cells have an active Notch signaling network. Discussion Initial culture strategies for equine UCB stem cells involved growth on uncoated tissue plasticware surfaces (Koch et al. 2007; Reed and Johnson, 2008) but no work has assessed the effects of various substrata or media on the prolonged culture of these cells. Use of UCB stem cells as injury repair aids likely will require an initial expansion in culture to pr ovide sufficient numbers of cells. Several media supplements were assessed for their ability to extend the timeframe that UCB stem cells can be maintained in vitro Expansion of human UCB stem cells in media supplemented with thrombopoietin, Flt3 and c kit ligand results in a population that expresses ES like surface markers, morphology and importantly, a delay in replicative senescence (McGuckin et al. 2003) Passage of equine UCB stem cells in this media did not duplicate the events and phenotypes reported for the human counterparts. Equine UCB stem cells proliferated slowly and exhibited large nuclei with pronounced nucleoli, characteristics of senescent fibroblasts. Close examination of the cultures indicated an absence of any cell clusters with ES like morphology. Because Tpo, Flt3 and c kit were supplemented into a basal media that supports equine UCB stem cell growth, we conclude that the growth factors are detrimental to the routine culture and passage of these cells in vitro Equine UCB stem cells grown at higher densities proliferate more readily than those at lower cell concentrations. Thus, we postulated that secreted factors may play a role in

PAGE 88

88 maintaining growth kinetics in this population. Culture in conditioned media proved deleterious to UCB stem cells, evidenced by poor growth kinetics and morphology suggestive of replicative senescence. This suggests that the improvement seen in growth kinetics at higher cell densities may be a reflection of cell:cell and extracellular matrix interactions rather than the paracrine action of secreted factors. Similar to conditioned media FGF2 appears to be a hindrance to UCB stem cell proliferation. FGF2 is mitogenic for MSCs isolated from adipose and bone marrow tissues (Baddoo et al. 2003; Benavente et al. 2003; Rider et al. 2008) Treatment of mouse BM MSC with FGF2 causes an increase in proliferation without induction of differentia tion (Baddoo et al., 2003) Indeed, FGF2 reversibly inhibited MSC differentiation toward the adipogenic and chondrogenic lineages. However, t reatment of equine UCB stem cells with FGF2 resulted in longer PDTs but no negative effects on the ES marker profile The co ntrasting results may represent specie and tissue source differences. Nanog, Oct4, and Sox2 are key factors in maintaining ES cell pluripotency in addition to being capable of inducing pluripotency in somatic cells (Takahashi and Yamanaka, 2006) In the absence of nanog, mouse ES cells differentiate into presumptive endoderm lineages (Mitsui et al., 2003) Oct4 is required to maintain pluripotency of the inner cell mass; loss of function results in differentiation to trophectodermal lineages (Zaehres et al. 2005) The r equirement of Sox2 to maintain the expression of Oct4 has been demonstrated (Masui et al. 2007) These transcripts, along with c myc, are capable of inducing a pluripotent, ES like state in s omatic cells (Takahashi and Yamanaka, 2006) Notably, the more differentiated adipose derived ste m cells lack expression of N anog and Sox2 (data not shown). Expression of this panel of transcripts, as well as population doubling time was used to monitor the stemness of UCB in different culture

PAGE 89

89 conditions and over time in culture. Cells maintained Oct 4 expression throughout the duration of culture, regardless of media or substrata used. In contrast, the presence of both Nanog and Sox2 decreased with time in culture. The presence of a protein matrix prolonged expression of both nanog and Sox2 transcri pts. This was not unexpected, as most stem cells reside in a very specific niche, a large part of which is composed of extracellular matrix. Extracellular matrix in the stem cell niche provides not only support for adhesion, but instructive signals to ma intain the nave state (Bi et al. 1999; Chen et al. 2007) Additionally, UCB cultured on various substrata had decreased population doubling times compared to those on uncoated plastic ware. As stem cells divide, one daughter cell may proliferate rapidly to expand the progenitor cell population while the other divides much more slowly or not at all to maintain the stem cell population. Thus, slowly dividing stem cells are considered to be the more nave population. However, when cultured for use as a therapeutic aid, cultivation of UCB on a protein substrate decreased population doubling time. This is a beneficial property when considering the expansion of these cells in culture prior to use as a therapeutic aid. The loss of Nanog and Sox2 during extended culture highlights the need for short expansion periods prior to use as a cytotherapeutic tool. Interestingly, despite the increase in population doubling time of cells cultured in medi a containing FGF2, there was no effect of FGF2 on the transcript profile of UCB While FGF2 appears dispensable for the maintenance of pluripotency markers, its negative effects on population doubling time preclude its use in media for UCB expansion. In s ummary, we define d culture conditions sufficient to ensure ES like gene expression patterns for early passage equine UCB stem cells. These include maintenance on matrix protein coated surfaces and cultivation in fetal bovine serum. Genetic markers of plu ripotency decline d

PAGE 90

90 with serial passage suggesting that expansion of UCB stem cells for therapeutic purposes is limited under the current culture conditions

PAGE 91

91 Figure 4 1. GM and GM+FGF support equine UCB stem cell propagation. UCB stem cells cultured i n GM and GM+FGF have faster doubling times than those grown in GM containing thrombopoietin(tpo) Flt3, and c kit, or UCB conditioned media. Population doubling times are presented below their respective phase photograph in hours SEM. Scale bar = 10 GM = growth media; GM + FGF = growth media containing FGF2; GM + Tpo/Flt/kit = growth media containing thrombopoietin, Flt3, and c kit; CM = conditioned media.

PAGE 92

92 Table 4 1. Effect of s ubstrata on e quine UCB1 derived s tem c ell population doubling t ime P value Substrata 2 PDT 3 SEM 4 Con Gel Fib Col Con 35.91 1.89 --<0.0001 <0.0001 <0.0001 Gel 30.67 1.38 ----0.3633 0.7634 Fib 29.72 1.34 ------0.5427 Col 30.36 1.44 --------1 UCB = umbilical cord blood 2 Con= uncoated, Gel = gelatin, Fib = fibronectin, Col = collagen 3 PDT= population doubling time in hours, N=N02(t/ pdt) where N = final cell number, N0 = initial cell number, t=time, and pdt= population doubling time 4 SEM = Standard error of the mean

PAGE 93

93 Table 42. Effect of s ubst rata and m edia on e quine UCB1 derived s tem c ell doubling t ime P value Substrata2 Media3 PDT4 SEM5 Con GM Con G M+FG F Gel GM Gel G M+FG F Fib GM Fib G M+FG F Col GM Col G M+FG F Con GM 30.07 1.59 --<0.0001 0.0628 0.0079 0.0370 0.1055 0.0091 0.0029 Con G M+ FG F 41.74 3.01 ----<0.0001 <0.0001 <0.0001 <0.0001 <0.0001 <0.0001 Gel GM 27.32 1.50 ------<0.0001 0.8187 0.0006 0.4463 <0.0001 Gel G M+FG F 34.01 2.14 --------<0.0001 0.2908 <0.0001 0.7366 Fib GM 26.99 1.57 ----------0.0003 0. 5941 <0.0001 Fib G M+FG F 32.46 2.05 ------------<0.0001 0.1643 Col GM 26.21 1.18 --------------<0.0001 Col G M+FG F 34.50 2.38 ----------------1 UCB=umbilical cord blood 2 Con= uncoated, Gel = gelatin, Fib = fibr onectin, Col = collagen 3 GM = growth media, G M+FGF = growth media + FGF2 4 PDT= population doubling time in hours, N=N02(t/ pdt) where N = final cell number, N0 = initial cell number, t=time, and pdt= population doubling time 5 SEM = Standard error of the mean

PAGE 94

94 Figure 42. Equine UCB stem cells express markers of embryonic stem cell pluripotency. RT PCR was performed on mouse embryonic (n=1, in triplicate) and UCB stem cell (n=4, in duplicate) total RNA using primers specific for Oct4, nanog, Sox2, KL F4 and c myc transcripts Both populations of stem cells express transcripts for the reprogramming genes. UCB = umbilical cord blood stem cells; mES = mouse embryonic stem cells. Representative photo shown.

PAGE 95

95 Table 43. Effects of h orse, passage, m edia and s ubstrata on mRNA e xpression P value mRNA Horse Passage Media Substrata Oct4 0.3535 0.6441 1.0000 0.4272 Nanog 0.0004 0.0001 0.3018 0.0001 Sox2 0.0823 <0.0001 0.5343 0.0574

PAGE 96

96 Figure 4 3. UCB and AdMSC express a limited number of molecules in the N otch signaling pathway. RT PCR was performed for the transcripts listed. mES = mouse embryonic stem cells, UCB = umbilical cord blood derived stem cells, AdMSC = adipose derived stem cells

PAGE 97

97 Figure 4 4. Inhibition of the Notch signaling pathway does not a ffect proliferation. UCB stem cells were cultured in the presence or absence of L685,458 for three days. Cell number was counted daily. CTL = control cells, NI = cells supplemented with L685,458

PAGE 98

98 Figure 4 5. UCB and 23A2 myoblasts express hes R T PCR for the transcripts listed was performed on RNA isolated from cells treated with the Notch inhibitor, L685,458. UCB = umbilical cord blood derived stem cells, Con = control, no inhibitor, NI = cells supplemented with L685,458.

PAGE 99

99 Tabl e 44. Delta Ct v alues for hes r ealtime PCR. Cell Type Treatment 1 dCt 2 23A2 CTL 6.54 0.8 23A2 NI 7.56 0.24 UCB CTL 12.36 0.08 UCB NI 11.11 0 15 1 CTL = control, NI = cells supplemented with L685,458 2 dCt = Delta cycle threshold value standard error of the mean

PAGE 100

100 Figure 4 6. BMP6 inhibits myoblast differentiation in a Notch dependent manner. 23A2 myoblasts were placed in differentiation media in the presence or absence of 50 ng/ml BMP6 and/or the Notch inhibitor L685,458. Cells were fixed after 48 hours and immunostained for myosin heavy chain. Images were captured at 200x. The percent of cells expressing myosin heavy chain was determined and is reported below its respective panel. MyHC = myosin heavy chain

PAGE 101

101 CH APTER 5 CULTURE OF EQUINE UM BILICAL CORD BLOOD A ND ADIPOSE DERIVED S TEM CELLS TO PROMOTE TEN OCYTIC DIFFERENTIATI ON Introduction Tendons are the elastic structures that connect muscle to bone. These fibrous structures provide tensile strength during normal movement as well as during strenuous exercise. Tendon damage is a significant problem in the horse race industry. In the United Kingdom, nearly one half of all injuries are related to failed tendon and ligament function (Pinchbeck et al. 2004) The superficial digital flexor tendon (SDFT) is the anatomical and functional equivalent of the Achilles tendon in humans (Dowling et al. 2000) Historical approaches to SDFT repair are based upon rest and gradual reintroduction to work (Goodship et al. 1994) Recovery times typically are greater than 6 months and the animals are prone to reinjury due to fibrocartilage scar tissue formation (Clegg et al. 2007) Current efforts to improve repair rates and strengthen regenerated tendons include injection of bone marr ow and adipose derived MSCs (Taylor et al. 2007) Anecdotal evidence suggests that these reagents are beneficial but no conclusive data exists. Mononuclear cells isolated from adipose tissue impr oved tendon architecture when implanted into collagenase induced lesions but resulted in no differences in the rate or quality of repair (Nixon et al. 2008) Scleraxis is a class II basic helix loophelix transcription factor expressed early during mouse embryogenesis in the syndetome, a derivative of the somitic sclerotome compartment (Cserjesi et al. 1995; Brent et al. 2003) Expression is associated with connective tissue and skeleton structures during prenatal development and with periodontal ligaments, force generating tendons, brain, lung and Sertoli cells in adult rodent s (Liu et al. 1996; Perez et al. 2003; Muir et al., 2005; Murc hison et al. 2007; Pryce et al. 2007) Genetic ablation of scleraxis is embryonic lethal prior to gastrulation with an absence of mesoderm (Brown et al. 1999) Using transgenic

PAGE 102

102 reporter scleraxis mice, expression of the transcripti on factor is largely confined to tendons early in postnatal development and absent in the structures as they become acellular (Pryce et al ., 2007) Conditional ablation of scleraxis in the developing limb of mice produces an animal with missing tendons in the limb; a few tendons are present but small in size (Murchison et al. 2007) Of importance, scleraxis null animals contain no flexor tendons. In vitro work in tendon fibroblasts suggests that s cleraxis and NFATc cooperatively regulate the activity of the Col1a1 proximal promoter (Lejard et al. 2007) Overexpression of scleraxis in primary cardiac fibroblasts significantly increased the production of Col1a2 through direct binding with the Col1a2 promoter region (Espira et al. 2009) These data suggest a dir ective role of scleraxis in the formation of mature tenocytes. Members of fibroblast growth factor (FGF) family regulate transcription of scleraxis FGFs produced by the myotome supply a paracrine signal that allows formation of the sclerotome and syndetome (Brent and Tabin, 2004) Exogenous FGF4 induces scleraxis and tenascin C mRNA in the developing chick limb (Edom Vovard et al. 2002) FGF8 can substitute partially for myotome suggesting that this FGF is important for tendon progenitor formation. Ectopic expression of RCAS FGF8 resulted in an upre gulation of scx, tnmd and type 1 collagen in the intermuscular tendons associated with visceral smooth muscle cells (Le Guen et al., 2009) Signals transmitted in response to FGF4 and FGF8 include increased activity of MEK1, a requisite kinase for scleraxis expression (Smith et al. 2005) Ectopic expression of FGF5 in the d eveloping chick inhibited muscle enlargement and promoted proliferation of tenasin expressing fibroblasts in the hind limb (Clase et al. 2000) Ectopic expression of kinase defective FGF receptor or constitutive active mitogen activated protein kinase phosphatase 3 (MKP3) inhibits scleraxis transcription in chick embryos. The downstream target of elevated

PAGE 103

103 ex tracellular regulated kinase 1 and 2 (ERK1/2) may be the Ets transcription factor, PEA3 (Brent and Tabin, 2004) Retroviral mis expression of PEA3 in chick embryos causes transcription of scleraxis ; ectopic dominant inhibitory PEA3 represses scleraxis expression. The objective of this experiment was to examine scleraxis and tenascin C mRNA expression in equine umbilical cord blood (UCB) stem cells and equine adipose derived mesenchymal stem cells (AdMSCs) in respo nse to FGF treatment. Results demonstrate that UCB stem cells and AdMSCs express scleraxis and tenascin C Culture in matrigel upregulated expression of both transcripts. UCB stem cells treated with FGF2 or FGF5 causes an increase in MEK dependent phosphoERK1/2, although with different activation kinetics. Scl eraxis mRNA content was measured following 48 hours of treatment with either FGF2 or FGF5. Neither caused an increase in scx over that seen on matrigel alone. However, TnC expression was increased in AdMSC cultured with FGF2 or FGF5. Materials and Methods Stem Cell Culture Umbilical cord blood stem cells ( UCB ) were cultured on plastic tissue culture plates coated with 0.1% gelatin (Fisher Scientific, Pittsburgh, PA) in Dulbeccos Modified Eagle M edium supplemented with 10% fetal bovine serum (FBS; Invitrogen, Carlsbad, CA) and 5 g/ml Plasmocin (InVivogen, San Diego, CA). Equine adipose derived cells (AdMSC) were purchased from ScienCell (Carlsbad, CA). Cells were cultured on 0.1% gelatin coated tissue culture plates in Mesenchymal Stem Cell Medium (ScienCell) according to manufacturers recommendations. Cells were passaged at 70% confluency using 0.025% trypsinEDTA. Three dimensional cultures were achieved by growing cells on Cytodex3 collagen coated beads (Invitrogen) or allowing cells to embed into 30% Matrigel (BD Biosciences, San Jose, CA).

PAGE 104

104 Plasmids and Transfections The 500 base pair minimal promoter of the mouse scleraxis gene was amplified from C2C12 myoblasts with specific primers (F:CAC ACGGCCTGGCACAAAAGACCC R:TTCGGACTGGAGTGGGGCCGCCAGC). Following sequencing to verify the identity of the product, the promoter was cloned into the TOPO Zero Blunt vector prior to subcloning into the pGL3 basic vector such that promoter activity would drive the expression of luciferase (Scx luc). C2C12 mesenchymal cells and UCB stem cells in 12 well plates were transiently transfected with 250 ng Scx luc and 25 ng pRL tk, a Renilla luciferase plasmid, as a monitor of transfection efficiency using FuGene 6.0. Media was replaced after 6 hours to include 50 ng/ml BMP6, 10 ng/ml FGF4, or 10 ng/ml FGF5. Cells were passively lysed in luciferase lysis buffer after 24 hours of cultur e and l uciferase activities measured (Dual Luciferase Reporter kit, Promega, Madison, WI). Scx l uc activity was corrected for pRLtk activity. The mouse minimal Scleraxis promoter was sequence verified. Analysis of the sequence by the Transcription Element Search System (TESS, http://www.cbil.upenn.edu/cgi bin/tess) revealed the presence o f several putative transcription factor binding sites. Confocal Microscopy UCB and AdMSC cultured on gelatin, matrigel, and collagen beads were fixed in 4% paraformaldehyde for 15 minutes. Cells were permeabilized with 0.1% TritonX100 in phosphate buffere d saline (PBS) supplemented with 5% FBS. Actin filaments were visualized using fluorescein conjugated phalloidin (Invitrogen) and nuclei were stained with Hoechst 33342. All immunofluorescence work was completed on glass bottom plates to aid microscopy. Confocal microscopy was performed on a Leica TCS SP5 Laser Scanning Confocal Microscope running Leica LAS AF software for instrument control and image analysis. Images were adjusted for brightness and contrast in Adobe Photoshop CS.

PAGE 105

105 Protein Isolation an d Evaluation Equine UCB and AdMSC were treated with 10 g/ml protamine sulfate for 10 minutes to remove signaling molecules from the extracellular matrix Cells were placed in serum free media for one hour prior to stimulation with FGF2, FGF4, or FGF5 in the presence or absence of the MEK inhibitor PD98059. Cells were lysed directly into SDS PAGE sample buffer. Protein was loaded based on equal cell number and electrophoresed across a 10% polyacrylamide gel. ERK1/2 activity was assessed using phospho a nd total ERK1/2 antibodies (Cell Signaling Technologies, Danvers, MA). Briefly, proteins were transferred to nitrocellulose and nonspecific binding sites were blocked with 10% nonfat dry milk in TRIS buffered saline supplemented with 0.1% Tween20 (TBS T ). Blots were incubated overnight at 4 C with primary antibody (1:1000) in blocking solution. Following extensive washing, blots were incubated with secondary antibody (1:2000). Equal protein loading was ensured by probing membranes with antitubulin (A bcam, Cambridge, MA) for one hour (1:2000) followed by incubation in secondary antibody for one hour (1:5000) prior to visualization. Immune complexes were visualized by chemiluminescence (ECL; GE Life Sciences, Piscataway, NJ) and autoradiography. Assess ment of Proliferation Cells were seeded at equal density and cultured in low serum medium (2% FBS) supplemented with FGF2, FGF4 or FGF5 in the presence or absence of PD98059 for 48 hours. Prior to fixation, cells were pulsed with 10 M bromodeoxyuridine ( BrdU) for two hours. Proliferation index was determined as the proportion of cells expressing BrdU:total cell number. All experiments were performed on UCB collections from four horses in duplicate wells with two replicate experiments.

PAGE 106

106 RNA Isolation, Reve rse Transcription, and Polymerase Chain Reaction Total RNA was isolated by lysis in STAT60 (Iso Tex Diagnostics, Friendswood, TX) and passed over RNeasy Mini columns (Qiagen, Valencia, CA). The RNA was digested with DNase (Ambion, Austin, TX) to remove ge nomic DNA contaminants. One microgram of total RNA was reverse transcribed (SuperScript III, Invitrogen) in 20 l reaction volume. Two microliters of first strand cDNA was amplified with gene specific primers and AccuPrime DNA polymerase (Invitrogen). P rimer sequences are listed in Table 51. PCR products were visualized following electrophoresis through 2% agarose gels impregnated with ethidium bromide. Representative images were captured with a Kodak ImageDoc system and inverted in Adobe Photoshop CS Quantitative PCR Complementary DNA reverse transcribed from 1 g of total RNA was amplified with SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA) and the appropriate forward and reverse primers (Table 51; 20 pM) in an ABI 7300 Real Time PCR System (Applied Biosystems). Thermal cycling parameters included a denature step of 95C for 10 min and 50 cycles of 15 s at 95.0C and 1 min at 60.0C. A final dissociation step included 95C for 15 s, 55C for 30 s, and 95C for 15 s. Serial dilutions of pooled samples were used to generate standard curves to ensure generation of cycle threshold values that were within the linear range of amplification (Castellani et al. 2004) Cycle threshold value ranges for each transcript are reported in Table 52. Results AdMSC and UCB E xpress Markers of Tenocytic C ells Immature tenocytes express the transcription factor scleraxis prior to the upregulation of m ore mature markers such as tenascin C and collagen 1A2. To evaluate adipose and umbilical

PAGE 107

107 cord blood derived stem cells for tenocytic markers, RT PCR was performed using gene specific primers for scleraxis and tenascin C Messenger RNA for both transcripts were present in both adipose and umbilical cord blood derived stem cells (Figure 51). Transcripts were sequenced to verify identity. Scleraxis Minimal Promoter Activity The mouse minimal s cleraxis promoter was sequence verified. Analysis of the sequence by the Transcription Element Search System (TESS, http://www.cbil.upenn.edu/cgi bin/tess) revealed the presence of several putative transcription factor binding sites. The list of binding sites with p values less than or equal to 0.01 is presented in Ta ble 5 3. Figure 5 2 shows a schematic of the promoter highlighting potentially important regulatory sites. Of particular interest is the presence of POU factor, Hes, SP1, and AP1 binding sites. A Klf4 binding site is present at base pair 35, but is not included on the list as the pvalue was given as 0.011. However, there were multiple sites strongly recognized in a small region lending strength to this prediction and its inclusion on the figure. UCB stem cells show much lower basal levels of scleraxis promoter activity than do C2C12s (Figure 53). Supplementation of C2C12 cells with BMP6 reduced luciferase expression driven by the scleraxis promoter. FGF4 and FGF5 had no effect on the scleraxis promoter in these cells. Scleraxis promoter activity in U CB stem cells appears to be unaffected by supplementation with BMP6, FGF4 or FGF5. This may be due to the low basal level of the minimal promoters activity. Other transcription factor binding sites may be required for full activity of this promoter in t his environment. Downstream effectors of FGF signaling include the transcription factors Pea3 and Erm. Activation of Pea3 and Erm is required for scleraxis expression in the developing somite (Brent & Tabin). Thus, we examined the presence of these facto rs by RT PCR in UCB stem cells. RT -

PAGE 108

108 PCR was performed as previously described. UCB stem cells express Pea3 and Erm in addition to scleraxis (Figure 54). AdMSC and UCB S urvive on V arious M atrices The three dimensional environment of a tissue results in dif ferent mechanical stresses and cell contacts which can signal for specific cell identities. To investigate the effects of various matrices, UCB and AdMSC were cultivated on gelatin coated plasticware, collagen coated beads, or allowed to embed into 30% Ma trigel for 48 hours (Figure 55). Cells were fixed in 4% paraformaldehyde and stained with fluorescein conjugated phalloidin to visualize actin structures and Hoechst 33342 to label nuclei. Stem cells grown on gelatin existed in a monolayer and exhibited morphology typical of fibroblasts and MSC with visible actin filaments. Incorporation into a 30% Matrigel resulted in the formation of colonies with compact structure. Cells show fewer stress fibers but maintain filopodia that extend into the surrounding matrix. Culture on collagen beads results in cells which resemble those on gelatin, albeit with apparently smaller amounts of cytoplasmic volume. No differences in morphology were noted between cells derived from adipose or umbilical cord blood. Culture in M atrigel I ncreases T enocyte Gene E xpression To evaluate the effects of different culture matrices on tenocyte gene expression, AdMSC and UCB were cultured for 48 hours on gelatin, collagen coated beads, or matrigel prior to RNA extraction. Realtime PCR revealed increases in scleraxis mRNA in both AdMSC and UCB when cultured on matrigel ( 39.48 and 6.73 fold, respectively, p<0.0001; Figure 56). Scleraxis transcripts were decreased in AdMSC grown on collagen coated beads (p<0.0001). Culture on matrigel increased tenascin C expression 12.32 fold in AdMSC but not in UCB (p<0.0001)

PAGE 109

109 Fibrobl ast Growth Factors Elicit Differing ERK1/2 R esponses in UCB and AdMSC Not only can FGF stimulation promote mitogenesis in stem cells, but FGF signaling through the MAPK pathway can lead to downstream regulation of scleraxis and tenascin C Thus, the ERK1/2 response was examined in UCB and AdMSC following stimulation by FGF2, FGF4, or FGF5. FGF2 elicited ERK1/2 phosphorylation in both cell types, albeit with differing act ivation kinetics (Figure 57). FGF4 did not activate pERK1/2 in UCB, however was responsible for a slight activation in AdMSC. Further experiments with FGF4 were discontinued due to lack of a MAPK response in UCB. Stimulation with FGF5 elicited a transient response in both AdMSC and UCB with similar kinetics. These results indicated that both UCB and AdMSC are capable of downstream signaling elicited by the fibroblast growth factors. The mitogenic effects of the fibroblast growth factors have been shown i n adipose and bone marrow derived stem cells. To clarify the effect of the fibroblast growth factors on UCB and AdMSC proliferation, cells were cultured for 48 hours in media supplemented with FGF2 or FGF5 in the presence or absence of the MEK inhibitor P D98059 (Figure 58). Cells were pulsed with BrdU prior to fixation and quantification. Similar to bone marrow derived stem cells, AdMSC increased proliferation when cultured in the presence of FGF2. This effect was abrogated by the presence of PD98059. In contrast, supplementation of FGF2 to UCB retarded BrdU incorporation in a MAPK dependent manner. Supplementation of AdMSC with FGF5 inhibited proliferation, contrasting with the increased proliferation of UCB. Inclusion of the MEK inhibitor PD98059 reversed the effects of FGF5 in both cell types. To determine the combined effects of three dimensional culture and stimulation of the fibroblast growth factors on stem cell identity, UCB and AdMSC were cultured on gelatin, collagen beads and matrigel and sti mulated with FGF2 or FGF5 for 48 hours. Real time PCR was used to quantify changes in scx and TnC expression. UCB cultured on matrigel express

PAGE 110

110 higher levels of scx ( p<0.0001; Figure 59A). However, Scx tended to be decreased by supplementation with FGF 2. Levels of TnC mRNA are unaffected by culture on different matrices or the inclusion of FGF2 or FGF5 (Figure 59B). In AdMSC, scx expression was increased by culture in matrigel but decreased by culture on collagen beads ( p<0.0001; Figure 59C). When cultured on gelatin or matrigel, FGF5 supplementation increased TnC transcription in AdMSC (p<0.0001) Inclusion of FGF2 in the culture media of cells grown in matrigel increased TnC transcription but to a lesser exte nt than caused by FGF5 (Figure 59D). Inhibition of the MAPK signaling pathway by PD98059 did not reverse the changes in scleraxis or tenascin C mRNA caused by FGF2 or FGF5 stimulation in adipose or umbilical cord blood derived stem cells (data not shown). Effect of FGF5 Supplementation on Ac tin Structure To determine if FGF5 supplementation resulted in changes in cell morphology and actin structure, UCB were stripped of extracellular signaling molecules using 10 g/ml protamine sulfate for 10 minutes. Cells were placed in serum free media fo r one hour prior to the addition of 10ng/ml rhFGF5 or growth media. Those cells receiving neither growth media nor FGF5 were used as controls. UCB stem cells were fixed in 4% paraformaldehyde at times 0, 10, and 30 minutes of treatment prior to permeabil iz ation with 0.1% TritonX100 in phosphate buffered saline (PBS) supplemented with 5% FBS. Actin filaments were immunostained with fluorescein conjugated phalloidin and Hoechst 33342. Morphology was visualized using a Nikon T200 microscope equipped with e pifluorescence. Images were captured with NIS Elements (Nikon Instruments, Melville, NY) software and compiled with Adobe PhotoShop CS. No appreciable differences were visible in UCB receiving any treatment (Figure 510 ). All cells maintained similar size s. No treatment resulted in the formation of extensive filopodia or

PAGE 111

111 stress fibers. Thus, we conclude that FGF5 supplementation does not have an immediate effect on UCB actin structure. Response of the PI3K Pathway to FGF2 and FGF5 Supplementation To det ermine if FGF2 or FGF5 may be signaling through the phosphoinositol 3 kinase pathway, an alternative to ERK1/2, we examined the expression of phosphorylated and total Akt following stimulation with 10 ng/ml of either FGF2 or FGF5. Akt is a downstream effe ctor of PI3K signaling which requires phosphorylation on threonine 308 and serine 473. Western blots were performed as previously described following treatment with FGF2 or FGF5. No phosphorylated Akt was present at any time point following FGF2 or FGF5 s upplementation (Figure 5 11). Total Akt was maintained at similar levels throughout the experiment. This suggests that FGF2 and FGF5 are not activating the PI3K pathway. In conclusion, we demonstrate that AdMSC and UCB react differently to various matr ices and growth factors. To maintain an immature tenocyte like cell, the appropriate culture conditions for UCB appear to be culture on matrigel in the absence of any FGF supplementation. Culture of adipose derived stem cells on matrigel in culture mediu m supplemented with FGF2 promotes proliferation of an early tenocyte like phenotype. Discussion This work highlights the differences between adipose and umbilical cord blood derived stem cells. Previously, we have shown that equine AdMSC express fewer st em cell markers and possess a more limited ability to differentiate compared to UCB (Reed and Johnson, 2008) AdMSC proliferate more rapidly than UCB regardless of the surface substrate (Reed and Johnson, unpublished data). This suggests a difference in regenerative capabilities as more nave stem cells often have longer population doubling times than more differentia ted cells. Few studies have directly compared the two populations in vitro and to date, none have compared

PAGE 112

112 their in vivo ability to assist regeneration. Adipose derived mononuclear cells were capable of improving tendon architecture but not biomechanical properties in a collagenase induced lesion of the SDFT (Nixon et al. 2008) No studies have been completed at this time identifyi ng the contribution of UCB to tendon injury. Transplantation of bone marrow derived stem cells into tendon lesions results in decreased lesion size and greater tendon density (Crovace et al. 2007; Pacini et al. 2007) Because of the innate expression of both scleraxis and the stem cell markers Oct4, nanog, and Sox2, UCB stem cells may provide a better source of regenerative stimulus than adipose der ived cells. The beneficial effects of stem cells in tendon injury may be due to the population of cells expressing scleraxis. Bone marrow, adipose and umbilical cord blood derived stem cells express this transcription factor prior to any in vitro manipul ation ( (Kuo and Tuan, 2008) Figure 1). In AdMSC and UCB, upregulation of scleraxis occurred in response to culture on matrigel. Culture in a three dimensional gelatin environment also upregulated scx in BMSC (Kuo and Tuan, 2008) Expression of scleraxis precedes that of tenascin c and collagen 1a2 in the developing embryo (Kardon, 1998; Schweitzer et al. 2001) Overexpression of scleraxis increased the transcription of col1a2 in NIH 3T3 fibroblasts (Lejard et al. 2007; Espira et al. 2009) Scleraxis appears to bind to the proximal promoter region of col1a2 as a heterodimer with E47 (Lejard et al. 2007) Expression of Col1a2 increases in AdMSC and UCB grown on matrigel (data not shown). These data suggest that the upregulation of scleraxis is consistent with the induction of an early tendonlike cell which expresses t enascin c and collagen1a2 as it matures. Scleraxis may, in fact, drive the expression of the more mature markers of tendon development. The population of cells that initially express scleraxis may give rise to daughter cells which express scleraxis and f urther differentiate to more mature tenocytic cells under appropriate conditions.

PAGE 113

113 Fibroblast growth factors are required for proper syndetome formation and induction of tenocytic lineage. As such, the response of adipose and UCB derived stem cells to FG Fs was investigated. In this work, we show that AdMSC and UCB respond very differently to stimulation by the FGFs. Interestingly, stimulation of AdMSC and UCB with FGF2 or FGF5 resulted in opposing effects on proliferation but similar ERK1/2 activation kinetics. Changes in proliferation were dependent upon ERK1/2, as inclusion of PD98059 abrogates all differences. These differences are likely due to different cellular contexts and possibly different FGF receptor expression. FGF2 can signal through a number of FGF receptor isoforms, however FGF5 is more limited and can only signal through FGFR1c and FGFR2 (Reviewed in Clements et al. 1993; Eswarakumar et al. 2005) It is possible that the differences in response to the fibroblast growth factors may also occur because of variations in ERK1 and ERK2 ratios, priming the cells toward proliferation or differentiation. AdMSC tended to express lower amounts of ERK1 relative to ERK2 than UCB stem cells. It is tempting to speculate that the ratio of ERK1:ERK2 is related to the stemness of the population and the subsequent ability to respond to external signals. AdMSC may express more ERK2 in order to respond to factors signaling for terminal differentiation. Alternatively, UCB may have higher levels of ERK1 to retain the ability to respond to both proliferation and differentiation signals to allow self renewal of the stem cell population as well as creation of daughter cells primed to differentiate. As might be expect ed, activation of ERK1 was also reduced compared to ERK2 phosphorylation following FGF stimulation in both cell types. This may be a preferential response of the cells to growth factors or simply due to kinase availability. When cultured on matrigel, sc x expression increases drastically in both UCB and AdMSC. Matrigel is composed of a mixture of growth factors (including IGF 1, PDGF, TGF

PAGE 114

114 and extracellular matrix components laminin, collagen IV and entactin, which form a complex three dimensio nal matrix at 37 C. Entactin enables the binding of laminin to collagen IV and the formation of a complex structural matrix. Both AdMSC and UCB embedded into the matrigel and formed colonies with distinct cellular morphology compared to cells on gelatin or collagen coated beads. The differences in cell:cell contact or contact with a complex ECM may be responsible for the upregulation of tenocytic genes. Integrin signaling activated by changes in ECM can result in differentiation of a number of stem cell types. Integrin signaling was activated by culture of hES cells on laminin and was related to an increase in ERK1/2 activation and subsequent decrease in Nanog and SSEA1 expression (Hayashi et al., 2007) Laminin signaling through alpha6/beta1 integrin may direct neural differentiation of hES cells (Ma et al. 2008) Additionally in the kidney alpha3/beta1 integrin signaling in coordination with c Met regulates Wnt expression, which is responsible for epithelial cell survival in the developing kidney (Liu et al., 2009) Activation of integrin mediated RhoA and Rhodependent kinase (ROCK) via cyclic strain resulted in the upregulation of tenascin C in primary skin fibroblasts (Chiquet et al. 2004) While no strain was applied to either AdMSC or UCB, the change in tension from a flat to a three dimensional surface may have been significant enough to activate the integrin signa ling system. The ability of UCB to upregulate scleraxis in a complex environment supports the use of these cells as a therapeutic aid. Tendons are composed primarily of type I collagen as well as other minor collagen and noncollagen components. Initia l tendon injuries are poorly organized but gain structure during the healing process. UCB implanted into tendon injuries should be capable of attachment to the tendon matrix and production of collagen and other matrix proteins. The additional strain that occurs with movement may provide additional direction for UCB to produce the required matrix proteins for proper healing.

PAGE 115

115 In conclusion, we have further delineated the differences between adipose and umbilical cord blood derived stem cells. While both c ell types upregulate scleraxis expression in response to culture on matrigel, they respond very differently to stimulation with fibroblast growth factors. We have established culture conditions appropriate to induce an early tenocytic lineage. Further work should clarify the mechanisms behind such changes.

PAGE 116

116 Table 51. Real time PCR p rimers Primer Sequence Expected Product Size, bp Standard Curve Slope Primer Efficiency, % Col1A2 1 F GCACATGCCGTGACTTGAGA R CATCCATAGTGCATCCTTGATTAGG 127 3. 39 97.24 TnC 1 F GGGCGGCCTGGAAATG R CAGGCTCTAACTCCTGGATGATG 70 3.34 99.25 ScxB 1 F TCTGCCTCAGCAACCAGAGA R TCCGAATCGCCGTCTTTC 59 3.35 98.84 Scx 2 F AGGACCGCGACAGAAAGAC R CAGCACGTAGTGACCAGAAGAA 261 n/a n/a 18S 1 F GTAACCCGTTGAACCCCATT R C CATCCAATCGGTAGTAGCG 151 3.35 98.84 Pea3 2 F GTGGCAGTTTCTGGTGGCCCTG R GACTGGCCGGTCAAACTCAGCC n/a n/a Erm 2 F GAGAGACTGGAAGGCAAAGTC R CCCAGCCACCTTCTGCATGATGC n/a n/a 1 (Taylor et al. 2009) 2 Used for endpoint PCR only.

PAGE 117

117 Table 5 2. Cycle t hreshold r anges Cell Type Transcript Mean SEM Min Max Median UCB 18S 13.72 0.06 13.15 15.59 13.59 UCB Scx 30.72 0.21 27.13 33.77 30.71 UCB TnC 21.89 0.29 18.67 28.20 21.27 AdMSC 18S 13.59 0.06 13.13 14.18 13.57 AdM SC Scx 31.19 0.55 27.10 34.31 31.54 AdMSC TnC 22.33 0.64 18.44 25.65 23.10

PAGE 118

118 Figure 5 1. AdMSC and UCB express markers of tenocytic cells. Total RNA was isolated from AdMSC and UCB prior to PCR with gene specific primers. Scleraxis and Tenasin C mRNA are present in AdMSC and UCB stem cells. Scx, scleraxis; TnC, Tenascin C

PAGE 119

119 Figure 5 2. Mouse scleraxis promoter with putative transcription factor binding sites. The minimal promoter is shown with putative transcription factor binding sites highlighted in bold.

PAGE 120

120 Table 5 3. Putative t ranscription fa ctor binding s ites on the m ouse scleraxis m inimal promoter1. Factor Beg 2 Sns 3 Len 4 Sequence L a 5 Lpv 6 Sp1 288 N 11 GtGGGAGGAGC 20 0 EGR2 286 R 10 GCGGGGGcGG 18 0 Sp1 283 R 10 GGgGCGGGGG 18 0 Sp1 330 N 10 GCCCCACcCC 18 0 Sp1 289 N 10 GGGGcGGAGC 18 0 Sp1 289 N 10 tGGGAGGAGC 18 0 Sp1 37 N 10 GGGgCAGGGC 18 0 Sp1 270 R 9 GAGGCGGAG 18 0 Sp1 289 R 10 GGGGcGGAGC 18 0 POU1F1a 92 R 10 TTGATTaATT 18 0 GAGA factor 169 N 16 CGCTCNNNNNNGAgAG 18 0 Sp1 270 R 10 GAGGCGGAGc 18 0 Sp1 17 N 10 AGGGcGTGGC 18 0 Sp1 37 R 10 GGGgCAGGGC 18 0 CACCC binding factor 16 R 10 CAGGGTGgGG 18 0 Sn 222 R 11 RAcAGGTGYAC 18 0 Sp1 288 N 10 GGGGGAGGgG 18 0 HNF 3B 87 N 12 VAWTrTTKRYTY 16.58 0 AP 2alpha 278 R 8 GGCCAGGC 16 0 AP 2alpha 24 R 8 GGCCAGGC 16 0 TEF 2 18 N 8 GGGTGTGG 16 0 HNF 4alpha 53 R 12 RTGRMCYTWGcM 16 0 AREB6 223 R 8 AAAGGTGC 16 0 AP 2 284 R 7 GCGCGGG 14 0 AP 2alpha 284 R 10 SSSNKGGGGA 14 0 AP 1 243 N 7 TGA GTAA 14 0 PuF 121 N 7 GGGTGGG 14 0 AP 1 c Jun 7 N 7 AGAGTCA 14 0 CP2 170 N 11 GCNMNANCMAG 14 0 Nkx6 1 210 N 7 CTATTAA 14 0 MEF 2 210 R 10 YTATTtWWAR 14 0 myogenin 26 R 7 CCAGGCA 14 0 En 1 114 N 7 GTAGAAT 14 0 AP 1 c Fos c Jun 7 R 7 AGAGTC A 14 0 GATA 1 Sp1 121 R 7 GGGTGGG 14 0 GCN4 299 R 6 TGACTG 12 0 ZF5 283 N 6 GGCGCG 12 0 CACCC binding factor 121 N 6 GGGTGG 12 0 FACB 30 R 17 GCANNNNNNNNNNNGGC 12 0 POU3F2 95 R 7 ATTWATK 12 0 GR 54 N 6 TGAACT 12 0 USF1 HES 1 234 N 6 CACGAG 12 0 Sp1 107 R 6 CTGCCC 12 0 RAP1 317 R 10 TGNNNGGNTG 12 0

PAGE 121

121 Table 5 3 Continued. Factor Beg 2 Sns 3 Len 4 Sequence L a 5 Lpv 6 Sp1 329 R 6 GGCCCC 12 0 TTF 1 109 N 9 GCNCTNNAG 12 0 GCN4 8 R 6 GAGTCA 12 0 GCN4 TGA1a 8 N 6 GAGTCA 12 0 NFAT 1 A96 220 N 6 GGAAAA 12 0 c Myb 166 R 6 AAACGC 12 0 Zeste 31 N 6 C ACTCA 12 0 FACB 157 N 15 GCANNNNNNNNNCGC 12 0 AP 1 243 N 7 TGASTMA 12 0 c Myb 55 N 6 GAACTT 12 0 Sp1 43 N 6 GGGCAG 12 0 GCN4 31 R 6 CACTCA 12 0 abaA 116 R 6 AGAATG 12 0 GCN4 86 N 6 TGATTC 12 0 AP 4 E12 46 R 6 CAGCTG 12 0 TTF 1 195 N 9 GCNCTNNAG 12 0 CAC binding protein 158 R 6 CACCCC 12 0 Sp1 121 R 6 GGGTGG 12 0 Sp1 122 N 6 GGTGGG 12 0 Sp1 270 N 9 KRGGCKRRK 12 0 AP 4 E12 46 N 6 CAGCTG 12 0 TBP 306 N 6 TATAAA 12 0 Sp1 192 N 6 GGGGCC 12 0 GR 103 N 6 TCTTCT 12 0 Sp1 2 71 N 6 AGGCGG 12 0 Zeste 334 N 6 CACTCC 12 0 NFAT 1 220 R 6 GGAAAA 12 0 GCN4 244 R 6 GAGTAA 12 0 abaA 116 N 6 AGAATG 12 0 MBF I 228 N 7 TGCRCRC 12 0 EGR 2 286 N 10 GCGGGGGAGG 17 0.0019 CAC BF 17 R 9 AGGGTGTGG 15.18 0.0025 v Jun 8 R 12 GAG TCAGACAGG 15.69 0.0037 EGR 1 286 R 9 GCGGGGGAG 14.64 0.0051 V$GC_01 287 N 14 CGGGGGAGGAGCTG 14.14 0.0065 HAP3 168 N 16 ACGCTCCAACCAGAAA 14.29 0.0092 HNF 4 53 N 12 GTGAACTTAGGC 12.81 0.0093 TEF2 18 N 8 GGGTGTGG 15.72 0.01 SBF 63 R 11 GCATGCCAGG A 14.1 0.01 1Identified using Transcription Element Search System ( http:// www.cbil.upenn.edu/cgi bin/tess) 2 Beginning nucleotide 3 Sense, N = normal, R = reverse 4 Length of motif, in base pairs 5 Log likelihood score, higher is stronger 6 Approximate pvalue for La score

PAGE 122

122 Figure 5 3. Scleraxis promoter activity is not increased by growth factor supplementation in UCB stem cells. C2C12 mesenchymal cells and UCB stem cells were transiently transfected with Scx luc and supplemented with 50 ng/ml BMP 6, 10 ng/ml FGF4 or 10 ng/ml FGF5 for 24 hours. Luciferase activity was measured from cell lysates. Relative luciferase units were calculated by dividing luciferase activity by renilla expression.

PAGE 123

123 Figure 5 4. UCB stem cells express Erm Pe a3, and Scleraxis RT PCR was performed on UCB stem cells with gene specific primers as shown. 18S was included as an internal control. Scx = scleraxis.

PAGE 124

124 30% Matrigel Collagen Bead Gelatin UCB AdMSC Figure 5 5. UCB and AdMSC attach to various culture surfaces. UCB and AdMSC were cultu red on gelatin coated plasticware, 30% Matrigel, or on collagen coated beads for 48 hours prior to fixation. Actin structures were stained with fluorescein conjugated phalloidin and nuclei were identified with Hoechst 33342 dye. Immunofluorescence was vi sualized using a TCS SP5 Laser Scanning Confocal Microscope running Leica LAS AF. Scale bar = 10 m

PAGE 125

125 Figure 5 6. Culture in matrigel increases tenocyte gene expression. AdMSC and UCB stem cells were cultured on gelatin coated plasticware, collagen co ated beads, or 30% matrigel for 48 hours prior to RNA isolation and real time PCR with gene specific primers. Culture on matrigel increased scleraxis expression in AdMSC and UCB. Tenascin C mRNA was also increased by culture on matrigel. Asterisk indicates p<0.05.

PAGE 126

126 Figure 5 7. UCB and AdMSC respond uniquely to FGF stimulation. UCB and AdMSC were stimulated with 10 ng/ml FGF2, FGF4, or FGF5 for the times shown. Protein extracts were probed with antibodies specific to phosphorylated and total E RK1/2. Tubulin antibodies were used as a loading control.

PAGE 127

127 Figure 5 8. Fibroblast growth factors stimulate proliferation of AdMSC and UCB stem cells in a MAPK dependent manner. AdMSC and UCB stem cells were cultured in low serum media supplemented with 10 ng/ml FGF2 or FGF5 in the presence or absence of PD98059. Prior to fixation, cells were pulsed with BrdU. FGF2 inhibited proliferation of UCB but stimulated AdMSC division. FGF5 increased proliferation of UCB stem cells.

PAGE 128

128 Figure 5 9. Culture conditions affect tenocyte gene expression in AdMSC and UCB. AdMSC and UCB stem cells were cultured for 48 hours in low serum media containing 10 ng/ml FGF2 or FGF5. Total RNA was isolated and subjected to real time PCR with gene specific primers for scleraxis and tenascin C Matrigel increased expression of scleraxis in UCB stem cells (A). There was no effect of matrix or FGF stimulation on TnC in UCB (B). Scleraxis expression in AdMSC was increased by culture on matrigel (C). Matrigel increased Tenascin C mRNA in AdMSC (D). This was further increased by supplementation with FGF2 or FGF5.

PAGE 129

129 Figure 5 10. FGF5 supplementation does not affect UCB actin structure. UCB stem cells were serum starved for one hour prior to trea tment with FGF5 or growth media. Cells were fixed at 0, 10 and 30 minutes prior to visualizing actin structures with fluorescein conjugated phalloidin. Nuclei were stained with Hoechst 33342. SF = serum free media, FGF5 = FGF5 containing media, GM = growth media Scale bar = 10 m

PAGE 130

130 Figure 5 11. FGF2 and FGF5 do no activate Akt in UCB (A) or AdMSC (B). Cells were treated with 10 ng/ml of FGF2 or FGF5 and lysed at the time points shown. Blots were probed for phosphorylated and total Akt.

PAGE 131

131 CHAPTER 6 SU MMARY AND CONCLUSIONS A hierarchy exists such that embryonic stem cells retain the most plasticity while bone marrow and adult stem cells are much more limited in their potential. Umbilical cord blood derived stem cells retain characteristics of nave ES cells in that they express Oct4 nanog, Sox2, Klf4 and c myc transcripts. Surface markers Tra1 60, Tra181, SSEA1 and minor amounts of SSEA4 are also present in UCB. This population of equine stem cells can be isolated using conventional human protocols a nd reagents. P roper culture conditions result in cells that can be maintained in a proliferative state for up to fifteen passages or approximately 22 population doublings. When cultured in appropriate media, UCB differentiate into proteoglcyan expressing chondrocytes or calcium producing osteocytes. UCB can also enter the hepatic pathway and form albumin producing hepatocytes. However, these cells possess limited ability to form adipocytes and myocytes. In comparison, equine adipose derived mesenchymal s tem cells express fewer markers of stemness, lacking SSEA1, SSEA4, nanog, Sox2, and Klf4 AdMSC lack the ability to differentiate into the immature myocytes or adipocytes formed by UCB. Early cultures of UCB possess small colonies reminiscent of ES coloni es that are lost with time in culture. Alternate culture conditions were assessed to determine more optimal conditions to maintain stem cell proliferation as well as maintenance of stemness. Culture in a combination of thrombopoietin, Flt3, and c kit or media conditioned by confluent UCB resulted in morphology reminiscent of replicative senescence. Growth in conventional growth media (GM) or growth media supplemented with bFGF (GM+FGF) supported cell prolife ration and morphology typical of MSC. Population doubling times were shorter in cells that did not receive FGF supplementation. Further culture on a protein matrix (collagen, fibronectin, or laminin) increased proliferation rates in cells cultured in GM or GM+FGF. Expression of stem cell

PAGE 132

132 markers nanog and Sox2 were gradually lost with time in culture, however Oct4 expression remained. Unmanipulated UCB and AdMSC express the bHLH transcription factor scleraxis, which is crucial to the development of flexor tendons. Culture on the complex protein matrix M atrigel resulted in the upregulation of scleraxis in both AdMSC and UCB stem cells. In M atrigel cells form tight colonies while they retain their fibroblastlike morphology when grown on gelatin or collagen coated surfaces. Supplementation of FGF2 or F GF5 resulted in changes in proliferation of both cell types, but had limited effects on scleraxis or tenascin c mRNA expression compared to culture on matrigel alone. Overall, this work highlights the potential of equine umbilical cord blood derived stem cells as not only a therapeutic aid for horses but as a model system for human medicine. The cells appear to be more nave than either bone marrow or adipose derived stem cells yet do not retain the tumorigenicity of embryonic stem cells. The ability to form immature myocytes as well as hepatocytes suggests that UCB have greater plasticity than other adult stem cells This m ay be a result of a less restrictive epigenetic status than adipose derived stem cells. This open genome structure likely allows for greater plasticity and naivet. The apparent inability of UCB and AdMSC to efficiently differentiate into adipose tissue was surprising but reflects other work in the literature. In truth, the inefficiency of adipocyte formation is a positive aspect fro m a clinical aspect as these cells may be less likely to precociously differentiate into that cell type if used in vivo While initial populations express all of the common markers of a nave stem cell (Oct4, nanog, Sox2, and Klf4), the majority of these markers are lost with time in culture. This may reflect one of several possibilities: (1) UCB stem cells may be differentiating to a more mature

PAGE 133

133 cell type, (2) a small population of nave stem cells express these markers and this cell type is essentially diluted out in culture due to slower proliferation, (3) a small population of nave stem cells exist but are not maintained due to inappropriate culture conditions. High density, early passage cultures contain a small number of dense colonies with morphol ogy reminiscent of ES cell colonies. These colonies may contain cells that are more nave than those that grow in monolayer culture. It is tempting to speculate that the cells which form these colonies are those that contain the stem cell markers found in early cultures, but with passage are greatly outnumbered by other cell types. This is further supported by the notion that generally more nave stem cells proliferate slowly and thus would not be expected to create as many daughte r cells as the cells whi ch grow on a monolayer. Thus, the colony forming cells may be the true stem cells while those which grow in a monolayer are more limited precursor cells. Further work should evaluate the subpopulations within UCB stem cells to identify cells that may be m ore or less useful in various therapeutic settings or as a model for human medicine The differential response of AdMSC and UCB to stimulation by fibroblast growth factors further highlights the differences between the two cell types. It is interesting to note that while both respond to FGF2 and FGF5 stimulation by phosphorylating ERK1/2 and activating the MAPK pathway, there are some significant differences in the type of response. In general, AdMSC appear to have less total ERK1 than UCB, resulting in a different ratio of the two kinases. This may be a reflection of cells poised either for terminal differentiation or for proliferation prior to differentiation. In other cell types, strong phosphorylation of ERK2 occurs in response to differentiation sig nals, while ERK1 responses are associated with proliferation. The response of ERK1 to stimulation by FGFs was weak in both cell types; ERK2 phosphorylation in response to FGF was predominant. However, UCB retain higher amounts of

PAGE 134

134 ERK1 than AdMSC which may allow them to better respond to other mitogenic factors. This may suggest that a more nave stem cell may have a higher ratio of ERK1:ERK2 than more differentiated cell types. These cells may be poised to respond to extracellular factors differently than AdMSC. The expression of low levels of scleraxis in immature cells is not surprising, as many stem cells exist in a state poised for differentiation and transcribe low levels of mRNAs required for that transformation. Not only is scleraxis upregulated in cells grown on M atrigel, but the morphology of the cells changes drastically. The response of UCB to M atrigel is exciting and presents many possibilities for future research. The changes in gene transcription may or may not be directly related to the change in morphology. Integrin signaling and interaction with other ECM components likely result in changes that may allow differentiation. The growth factor concentrations and/or combinations present in M atrigel may signal for transcriptional changes independent of the structure of the extracellular matrix. Alternatively, the changes may result from changes in tensional stress, ligand:receptor interactions with the extracellular matrix, or differences in cell:cell contact. Likely, a combination of stimul i allow for the formation of a cluster of cells similar to tendon precursor cells. Complete differentiation is not recorded at this stage, likely for a variety of reasons. The combination of growth factors that initiates early tendon precursor development is likely not sufficient for complete maturation. Another combination or different ratios of growth factors could help complete the transition. In vivo tendon cells are subjected to a high degree of strain on a daily basis as a result of movement. Man y cell types require cyclic or tensional stress to completely differentiate and it would be extremely surprising were it not also true for tendon cells. Adding strain to UCB cultured in

PAGE 135

135 Matrigel may stimulate the production and secretion of matrix protein s required for tendon repair and/or maintenance. Equine UCB provide more than a potential therapeutic aid for injuries in the horse. The horse provides an excellent model of athletic tendon injury in the human, as injuries to the SDFT correlate extremely w ell to injuries of the Achilles tendon, a frequent spot of injury in human athletes. Horses are treated as athletes and undergo similar training programs as human athletes. Overtraining and overuse injuries result in setbacks in training and competition in both species. Equine umbilical cord blood derived stem cells are readily available and possess characteristics of human UCB stem cells, making them an attractive choice for a model of human medicine. The horse provides a useful model of injury and can be used to determine the usefulness of UCB in treating tendon and other musculoskeletal injuries.

PAGE 136

136 APPENDIX A SUPPLEMENTARY DATA Mouse E mbryonic S tem C ell C ulture and D ifferentiation Mouse embryonic stem cells (mES) are commonly used to study the developmental processes that occur in an ordered manner in the developing embryo. Under proper conditions, mES cells can be maintained in a proliferative, pluripotent state. However, mES cells can also undergo spontaneous or directed differentiation to form cell s from all three germ layers. In culture medium containing leukemia inhibitory factor ( LIF ) mES cells maintain a pluripotent phenotype. Cells grow in colonies with li ght refractile ed ges (Figure A 1 A). Individual cells can rarely be distinguished from the colony. As colonies grow in an unrestricted manner (i.e. without fresh media or appropriate passaging), the cells will begin differentiating into a wide variety of cell type. Initially, colonies develop a ring of epithelial cells that surround the col ony (Figure A 1 B). Cells remaining in the inner portion during this stage may retain greater levels of pluripotency. However, with continuing differentiation, cells migrate away from the colony, forming a monolayer with cells of a wide v ariety of phenoty pes (Figure A 1C). Formation of embroid bodies (EBs) allows for a more synchronous protocol for differentiation. This process allows an individual cell to form a colony which can then be treated and compared with other colonies (also from a single cell) Nave mES colonies are washed off the tissue culture plate and placed in suspension culture in media lacking LIF. The EBs cannot easily attach and are forced to grow into larger spherical colonies. Individual EBs can then be placed back onto tissue culture dishes and allowed to fully differentiate in media lacking LIF. Spontaneous differentiation results in the formation of a wide variety of cell types, including neural, myogenic, and hepa togenic cells (Figure A 2).

PAGE 137

137 Alternative UCB Differentiation Pro tocols Following is a brief description of differentiation protocols that were tested on UCB stem cells but were not reported in earlier work due to the lack of success. Myogenic Differentiation UCB stem cells were plated on gelatin coated plasticware an d cultured in DMEM containing 10% FBS and 10 M azacytidine for 24 hours. The media was subsequently replaced with low glucose DMEM containing 5% FBS. Cells were continuously cultured in this media for up to three weeks. No evidence of myogenic differenti ation was found. RT PCR for the myogenic regulatory factors MyoD and Myf5 was negative. No immunostaining of desmin or myosin heavy chain could be detected. Neural Differentiation To initiate neural differentiation, three protocols were attempted. The fi rst two protocols contain the same basic components but included either low or high amounts of FBS (2% and 10%, respectively). This medium was based on MEM and contained 10 ng/ml PDGF, 10 ng/ml bFGF and 10 ng/ml EGF in addition to serum. The third media was DMEM supplemented with 15% FBS, 20 ng/ml bFGF, 50 ng/ml neural growth factor (NGF) and 0.5 mM IBMX. Cells were maintained in these media for up to three weeks. Following culture time, cells were immunostained for nestin, glial fibrillary acidic protein (GFAP), and beta 3 tubulin. No immunoreactivity was apparent at any time. Adipogenic Differentiation Three protocols for adipogenic differentiation w ere attempted during this study. The previously described protocol gave the greatest level of success and is thus the protocol of choice for UCB. However, it should be noted that the efficiency of differentiation remained extremely low. A low glucose DM EM based media containing 10% FBS, 1 M dexamethasone, 0.5 mM

PAGE 138

138 IBMX, 100 M indomethacin, and 10 ng/ml insulin was used to culture cells for up to three weeks. The second protocol used dexamethasone, 0.5mM IBMX, 50 M i ndomethacin, and 5 ng/ml insulin. As rabbit serum has been shown to increase the efficiency of adipogenic differentiation, it was substituted for FBS in all media as an additional set of media concoctions. Neither media presented here (whether supplement ed with FBS or rabbit serum) produced cells that stained positive for Oil Red O or contained lipid vacuoles. Only limited success was noted with the previously described protocol, which was not enhanced by the inclusion of rabbit serum. Quantification of Oct4, nanog, and Sox2 Across Time in Culture To quantify expression of Oct4, nanog, and Sox2 in UCB stem cells across time in culture, real time PCR was performed. Multiple primer sets were tested by end point PCR for Oct4. Those primer sets that produced a single band of the appropriate size were then tested by real time PCR, using a standard curve method. While a number of primer sets provided a product after end point PCR, real time PCR results were inconsistent. The dissociation curves for Oct4 had multiple peaks indicating the presence of multiple products Dissociation curves for the positive control samples (mES) contained a single peak. The single peak found in curves from mES samples overlapped one of the peaks found in the dissociation curve f or UCB samples, indicating the presence of the correct transcript. I t is important to note that the magnitude of the peak was much higher in mES samples than UCB samples. Standard curves were performed to ensure that the values obtained were within a li near range. The curves obtained for the internal control (18S) had a slope of 3.325 and R2 value of 0.994 indicating nearly 100% primer efficiency and an appropriate standard curve on which to base quantifications. However, Oct4, nanog and Sox2 lacked st andard curves that were

PAGE 139

139 consistent across multiple plates. Moreover, these curves had slopes indicating less than 75% primer efficiency. Multiple primer sets were tested to ensure the results obtained were not simply due to inefficient primers. All prime rs resulted in inefficient standard curves and poor dissociation curves with multiple peaks Increasing the annealing temperature also had no effect on the multiple peaks of the dissociation curve. Importantly, reactions that lacked reverse transcriptas e in the cDNA amplification process contained no product in either end point or real time PCR. It should also be noted that internal controls amplified a single band in end point that reflects the single peak in the dissociation curve in UCB as well as mE S. Further work on these transcripts was discontinued, as they were not the primary focus of the project.

PAGE 140

140 Figure A 1. Stages of mES colony differentiation. Nave mES colonies maintain a compact shape with no discernable individual cells (A day one ). More differentiated colonies often have a ring of epithelial cells surrounding a more densely packed core (B day two ). Fully differentiating cells adopt the morphology of their mature cell type and are commonly found in monolayers on the culture surface (C day 5). Scale bar = 10 m

PAGE 141

141 Figure A 2. mES embroid bodies differentiate into a variety of cell types. mES stem cells were allowed to spontaneously differentiate. Following differentiation cells were fixed in 4% paraformal dehyde and immunostained for myosin heavy chain (A), nestin (B), and cytokeratin 18 (C). Hoechst 33342 was used to visualize nuclei.

PAGE 142

142 APPENDIX B TABLE OF PRIMER SEQUENCES Table B 1. Primer sequences and sources. Primer Sequence Size, bp Source Co l1A2 F GCACATGCCGTGACTTGAGA R CATCCATAGTGCATCCTTGATTAGG 127 Taylor et al., 2009 TnC F GGGCGGCCTGGAAATG R CAGGCTCTAACTCCTGGATGATG 70 Taylor et al., 2009 ScxB F TCTGCCTCAGCAACCAGAGA R TCCGAATCGCCGTCTTTC 59 Taylor et al., 2009 Scx F AGGACCGCGACAGAAAGAC R CAGCACGTAGTGACCAGAAGAA 26 1 NM_001105150.1 18S F GTAACCCGTTGAACCCCATT R CCATCCAATCGGTAGTAGCG 151 Taylor et al., 2009 Pea3 F GTGGCAGTTTCTGGTGGCCCTG R GACTGGCCGGTCAAACTCAGCC 315 XM_001917508.1 Erm F GAGAGACTGGAAGGCAAAGTC R CCCAGCCACCTTCTGCATGATGC 293 XM_001499099.1 GAPDH F GATTCCACCCATGGCAAGTTCCATGGCAC R GCATCGAAGGTGGAAGAGTGGGTGTCACT 688 XM_001496020 Col2A1 F CA GCTATGGAGATGACAACCTGGC R CGTGCAGCCATCCTTCAGGACAG 240 NM_001081764.1 Sox9 F GCTCCCAGCCCCACCATGTCCG R CGCCTGCGCCCACACCATGAAG 293 XM_001498424.2 Osteonectin F CCCATCAATGGGGTGCTGGTCC R GTGAAAAAGATGCACGAGAATGAG 149 NM_001143953.1 RunX2 F CGTGCTGC CATTCGAGGTGGTGG R CCTCAGAACTGGGCCCTTTTTCAG 350 XM_001502519.2 Albumin F AACTCTTCGTGCAACCTACGGTGA R AATTTCTGGCTCAGGCGAGCTACT 431 NM_001082503.1 Cytokeratin 18 F GGATGCCCCCAAATCTCAGGACC R GGGCCAGCTCAGACTCCAGGTGC 340 XM_001490377.1 GAPDH, real time F GAGATCCCGCCAACATC R CTGACAATCTTCAGGGAATTGTC 207 XM_001496020.1 Oct4 F GCTGCAGAAGTGGGTGGAGGAAGC R GCCTGGGGTACCAAAATGGGGCCC 363 XM_001490108.2 Nanog F GTCTCTCCTCTGCCTTCCTCCATGG R CCTGTTTGTAGCTAAGGTTCAGGATG 267 XM_001498808.1 Sox2 F AACGGCAGCTACAGCATGA R TGGAGTGGGAGGAAGAGGTA 282 NM_001143799.1 Klf4 F TGGGCAAGTTTGTGTTGAAG R TGACAGTCCCTGTTGCTCAG 336 XM_001492956.2 c myc F GACGGTAGCTCGCCCAAG R ACCCCGATTCTGACCTTTTG 240 XM_001497991.2

PAGE 143

143 Table B 1 Continued. Primer Sequence Size, bp Source Jagged 1 F GCCTGGTGACAGCCTTCTAC R GGGGCTTCTCCTCTCTGTCT 305 XM_001495238.2 Jagged 2 F CATGATCAACCCCGAGGAC R CGTACTGGTCGCAGGTGTAG 169 XM_001494763.2 Notch 1 F GAGGACCTGGAGACCAAGAAGGTTC R AGATGAAGTCGGAGATGACGGC 297 XM_001498582.2 Notch 2 F GCAGGAGCAGGAGGTGATAG R GCGTTTCTTGGACTCTCC AG 188 NM_010928.2 Notch 3 F GTCCAGAGGCCAAGAGACTG R CAGAAGGAGGCCAGCATAAG 219 NM_008716.2 Dll 1 F ACCTTCTTTCGCGTATGCCTCAAG R AGAGTCTGTATGGAGGGCTTC 221 NM_007865.3 Dll 4 F CGAGAGCAGGGAAGCCATGA R CCTGCCTTATACCTCTGTGG 378 NM_019454.2

PAGE 144

144 LIST OF REFERENCES Amit, M., Carpenter, M.K., Inokuma, M.S., Chiu, C.P., Harris, C.P., Waknitz, M.A., Itskovitz Eldor, J., and Thomson, J.A. (2000). Clonally derived human embryonic stem cell lines maintain pluripotency and proliferati ve potential for prolonged periods of culture. Developmental biology 227, 271278. Aoi, T., Yae, K., Nakagawa, M., Ichisaka, T., Okita, K., Takahashi, K., Chiba, T., and Yamanaka, S. (2008). Generation of pluripotent stem cells from adult mouse liver and s tomach cells. Science (New York, N.Y 321, 699 702. Aoki, M., Yasutake, M., and Murohara, T. (2004). Derivation of functional endothelial progenitor cells from human umbilical cord blood mononuclear cells isolated by a novel cell filtration device. Stem cells (Dayton, Ohio) 22 9941002. Arinzeh, T.L., Peter, S.J., Archambault, M.P., van den Bos, C., Gordon, S., Kraus, K., Smith, A., and Kadiyala, S. (2003). Allogeneic mesenchymal stem cells regenerate bone in a critical sized canine segmental defect. The Jo urnal of bone and joint surgery 85A 19271935. Arney, K.L., and Fisher, A.G. (2004). Epigenetic aspects of differentiation. Journal of cell science 117, 4355 4363. Arnhold, S.J., Goletz, I., Klein, H., Stumpf, G., Beluche, L.A., Rohde, C., Addicks, K., a nd Litzke, L.F. (2007). Isolation and characterization of bone marrow derived equine mesenchymal stem cells. American journal of veterinary research 68, 10951105. Avilion, A.A., Nicolis, S.K., Pevny, L.H., Perez, L., Vivian, N., and Lovell Badge, R. (2003). Multipotent cell lineages in early mouse development depend on SOX2 function. Genes & development 17, 126140. Awad, H.A., Boivin, G.P., Dressler, M.R., Smith, F.N., Young, R.G., and Butler, D.L. (2003). Repair of patellar tendon injuries using a cell c ollagen composite. J Orthop Res 21, 420431. Azuara, V., Perry, P., Sauer, S., Spivakov, M., Jorgensen, H.F., John, R.M., Gouti, M., Casanova, M., Warnes, G., Merkenschlager, M., and Fisher, A.G. (2006). Chromatin signatures of pluripotent cell lines. Natu re cell biology 8, 532538. Baal, N., Reisinger, K., Jahr, H., Bohle, R.M., Liang, O., Munstedt, K., Rao, C.V., Preissner, K.T., and Zygmunt, M.T. (2004). Expression of transcription factor Oct 4 and other embryonic genes in CD133 positive cells from human umbilical cord blood. Thrombosis and haemostasis 92, 767775. Babaie, Y., Herwig, R., Greber, B., Brink, T.C., Wruck, W., Groth, D., Lehrach, H., Burdon, T., and Adjaye, J. (2007). Analysis of Oct4dependent transcriptional networks regulating self renewal and pluripotency in human embryonic stem cells. Stem cells (Dayton, Ohio) 25, 500510.

PAGE 145

145 Baddoo, M., Hill, K., Wilkinson, R., Gaupp, D., Hughes, C., Kopen, G.C., and Phinney, D.G. (2003). Characterization of mesenchymal stem cells isolated from murine bone marrow by negative selection. Journal of cellular biochemistry 89, 12351249. Baird, A., Schubert, D., Ling, N., and Guillemin, R. (1988). Receptor and heparinbinding domains of basic fibroblast growth factor. Proceedings of the National Academy of Sciences of the United States of America 85, 2324 2328. Bartunek, J., Croissant, J.D., Wijns, W., Gofflot, S., de Lavareille, A., Vanderheyden, M., Kaluzhny, Y., Mazouz, N., Willemsen, P., Penicka, M., Mathieu, M., Homsy, C., De Bruyne, B., McEntee, K., Lee, I .W., and Heyndrickx, G.R. (2007). Pretreatment of adult bone marrow mesenchymal stem cells with cardiomyogenic growth factors and repair of the chronically infarcted myocardium. American journal of physiology 292 H10951104. Battula, V.L., Bareiss, P.M., Treml, S., Conrad, S., Albert, I., Hojak, S., Abele, H., Schewe, B., Just, L., Skutella, T., and Buhring, H.J. (2007). Human placenta and bone marrow derived MSC cultured in serum free, b FGFcontaining medium express cell surface frizzled 9 and SSEA 4 and give rise to multilineage differentiation. Differentiation; research in biological diversity 75, 279291. Benavente, C.A., Sierralta, W.D., Conget, P.A., and Minguell, J.J. (2003). Subcellular distribution and mitogenic effect of basic fibroblast growth f actor in mesenchymal uncommitted stem cells. Growth factors (Chur, Switzerland) 21, 8794. Bernstein, B.E., Mikkelsen, T.S., Xie, X., Kamal, M., Huebert, D.J., Cuff, J., Fry, B., Meissner, A., Wernig, M., Plath, K., Jaenisch, R., Wagschal, A., Feil, R., Sc hreiber, S.L., and Lander, E.S. (2006). A bivalent chromatin structure marks key developmental genes in embryonic stem cells. Cell 125, 315326. Bi, W., Deng, J.M., Zhang, Z., Behringer, R.R., and de Crombrugghe, B. (1999). Sox9 is required for cartilage formation. Nature genetics 22, 8589. Bianchi, G., Banfi, A., Mastrogiacomo, M., Notaro, R., Luzzatto, L., Cancedda, R., and Quarto, R. (2003). Ex vivo enrichment of mesenchymal cell progenitors by fibroblast growth factor 2. Experimental cell research 287, 98105. Bieback, K., Kern, S., Kluter, H., and Eichler, H. (2004). Critical parameters for the isolation of mesenchymal stem cells from umbilical cord blood. Stem cells (Dayton, Ohio) 22, 625634. Boeuf, H., Hauss, C., Graeve, F.D., Baran, N., and Kedinge r, C. (1997). Leukemia inhibitory factor dependent transcriptional activation in embryonic stem cells. The Journal of cell biology 138, 12071217. Bonanno, G., Perillo, A., Rutella, S., De Ritis, D.G., Mariotti, A., Marone, M., Meoni, F., Scambia, G., Leone, G., Mancuso, S., and Pierelli, L. (2004). Clinical isolation and functional characterization of cord blood CD133+ hematopoietic progenitor cells. Transfusion 44, 10871097.

PAGE 146

146 Boyer, L.A., Lee, T.I., Cole, M.F., Johnstone, S.E., Levine, S.S., Zucker, J.P., Guenther, M.G., Kumar, R.M., Murray, H.L., Jenner, R.G., Gifford, D.K., Melton, D.A., Jaenisch, R., and Young, R.A. (2005). Core transcriptional regulatory circuitry in human embryonic stem cells. Cell 122, 947956. Boyer, L.A., Plath, K., Zeitlinger, J., Brambrink, T., Medeiros, L.A., Lee, T.I., Levine, S.S., Wernig, M., Tajonar, A., Ray, M.K., Bell, G.W., Otte, A.P., Vidal, M., Gifford, D.K., Young, R.A., and Jaenisch, R. (2006). Polycomb complexes repress developmental regulators in murine embryonic ste m cells. Nature 441, 349353. Brandenberger, R., Wei, H., Zhang, S., Lei, S., Murage, J., Fisk, G.J., Li, Y., Xu, C., Fang, R., Guegler, K., Rao, M.S., Mandalam, R., Lebkowski, J., and Stanton, L.W. (2004). Transcriptome characterization elucidates signali ng networks that control human ES cell growth and differentiation. Nature biotechnology 22, 707716. Brent, A.E., Schweitzer, R., and Tabin, C.J. (2003). A somitic compartment of tendon progenitors. Cell 113, 235248. Brent, A.E., and Tabin, C.J. (2004). F GF acts directly on the somitic tendon progenitors through the Ets transcription factors Pea3 and Erm to regulate scleraxis expression. Development (Cambridge, England) 131, 38853896. Brodke, D., Pedrozo, H.A., Kapur, T.A., Attawia, M., Kraus, K.H., Holy, C.E., Kadiyala, S., and Bruder, S.P. (2006). Bone grafts prepared with selective cell retention technology heal canine segmental defects as effectively as autograft. J Orthop Res 24, 857866. Brown, D., Wagner, D., Li, X., Richardson, J.A., and Olson, E.N (1999). Dual role of the basic helix loophelix transcription factor scleraxis in mesoderm formation and chondrogenesis during mouse embryogenesis. Development (Cambridge, England) 126, 43174329. Bruder, S.P., Kurth, A.A., Shea, M., Hayes, W.C., Jaiswal N., and Kadiyala, S. (1998). Bone regeneration by implantation of purified, culture expanded human mesenchymal stem cells. J Orthop Res 16, 155162. Cao, R., Wang, L., Wang, H., Xia, L., Erdjument Bromage, H., Tempst, P., Jones, R.S., and Zhang, Y. (2002). Role of histone H3 lysine 27 methylation in Polycombgroup silencing. Science (New York, N.Y 298, 10391043. Carlin, R., Davis, D., Weiss, M., Schultz, B., and Troyer, D. (2006). Expression of early transcription factors Oct 4, Sox 2 and Nanog by porcine umbilical cord (PUC) matrix cells. Reprod Biol Endocrinol 4, 8. Castellani, L.W., Gargalovic, P., Febbraio, M., Charugundla, S., Jien, M.L., and Lusis, A.J. (2004). Mechanisms mediating insulin resistance in transgenic mice overexpressing mouse apolipopr otein A II. Journal of lipid research 45, 23772387.

PAGE 147

147 Chambers, I., Colby, D., Robertson, M., Nichols, J., Lee, S., Tweedie, S., and Smith, A. (2003). Functional expression cloning of Nanog, a pluripotency sustaining factor in embryonic stem cells. Cell 113, 643655. Chan, J., O'Donoghue, K., Gavina, M., Torrente, Y., Kennea, N., Mehmet, H., Stewart, H., Watt, D.J., Morgan, J.E., and Fisk, N.M. (2006). Galectin1 induces skeletal muscle differentiation in human fetal mesenchymal stem cells and increases muscle regeneration. Stem cells (Dayton, Ohio) 24, 18791891. Chan, J., Waddington, S.N., O'Donoghue, K., Kurata, H., Guillot, P.V., Gotherstrom, C., Themis, M., Morgan, J.E., and Fisk, N.M. (2007). Widespread distribution and muscle differentiation of human f etal mesenchymal stem cells after intrauterine transplantation in dystrophic mdx mouse. Stem cells (Dayton, Ohio) 25, 875884. Chang, F., Ishii, T., Yanai, T., Mishima, H., Akaogi, H., Ogawa, T., and Ochiai, N. (2008a). Repair of large full thickness artic ular cartilage defects by transplantation of autologous uncultured bone marrow derived mononuclear cells. J Orthop Res 26, 1826. Chang, S.A., Lee, E.J., Kang, H.J., Zhang, S.Y., Kim, J.H., Li, L., Youn, S.W., Lee, C.S., Kim, K.H., Won, J.Y., Sohn, J.W., P ark, K.W., Cho, H.J., Yang, S.E., Oh, W.I., Yang, Y.S., Ho, W.K., Park, Y.B., and Kim, H.S. (2008b). Impact of myocardial infarct proteins and oscillating pressure on the differentiation of mesenchymal stem cells: effect of acute myocardial infarction on s tem cell differentiation. Stem cells (Dayton, Ohio) 26, 19011912. Chang, Y.J., Tseng, C.P., Hsu, L.F., Hsieh, T.B., and Hwang, S.M. (2006). Characterization of two populations of mesenchymal progenitor cells in umbilical cord blood. Cell biology international 30, 495499. Chen, H.K., Hung, H.F., Shyu, K.G., Wang, B.W., Sheu, J.R., Liang, Y.J., Chang, C.C., and Kuan, P. (2005). Combined cord blood stem cells and gene therapy enhances angiogenesis and improves cardiac performance in mouse after acute myocard ial infarction. European journal of clinical investigation 35, 677686. Chen, J., Sanberg, P.R., Li, Y., Wang, L., Lu, M., Willing, A.E., Sanchez Ramos, J., and Chopp, M. (2001). Intravenous administration of human umbilical cord blood reduces behavioral deficits after stroke in rats. Stroke; a journal of cerebral circulation 32, 26822688. Chen, S.S., Fitzgerald, W., Zimmerberg, J., Kleinman, H.K., and Margolis, L. (2007). Cell cell and cell extracellular matrix interactions regulate embryonic stem cell di fferentiation. Stem cells (Dayton, Ohio) 25, 553561. Cheng, T., Rodrigues, N., Shen, H., Yang, Y., Dombkowski, D., Sykes, M., and Scadden, D.T. (2000). Hematopoietic stem cell quiescence maintained by p21cip1/waf1. Science (New York, N.Y 287, 18041808. C henn, A., and McConnell, S.K. (1995). Cleavage orientation and the asymmetric inheritance of Notch1 immunoreactivity in mammalian neurogenesis. Cell 82, 631641.

PAGE 148

148 Cheshier, S.H., Morrison, S.J., Liao, X., and Weissman, I.L. (1999). In vivo proliferation and cell cycle kinetics of long term self renewing hematopoietic stem cells. Proceedings of the National Academy of Sciences of the United States of America 96, 31203125. Chew, J.L., Loh, Y.H., Zhang, W., Chen, X., Tam, W.L., Yeap, L.S., Li, P., Ang, Y.S., L im, B., Robson, P., and Ng, H.H. (2005). Reciprocal transcriptional regulation of Pou5f1 and Sox2 via the Oct4/Sox2 complex in embryonic stem cells. Molecular and cellular biology 25, 60316046. Chiquet, M., Sarasa Renedo, A., and Tunc Civelek, V. (2004). Induction of tenascinC by cyclic tensile strain versus growth factors: distinct contributions by Rho/ROCK and MAPK signaling pathways. Biochimica et biophysica acta 1693, 193204. Choi, S.C., Kim, S.J., Choi, J.H., Park, C.Y., Shim, W.J., and Lim, D.S. (2008). Fibroblast growth factor 2 and 4 promote the proliferation of bone marrow mesenchymal stem cells by the activation of the PI3K Akt and ERK1/2 signaling pathways. Stem cells and development 17, 725736. Clase, K.L., Mitchell, P.J., Ward, P.J., Dorman, C.M., Johnson, S.E., and Hannon, K. (2000). FGF5 stimulates expansion of connective tissue fibroblasts and inhibits skeletal muscle development in the limb. Dev Dyn 219, 368380. Clegg, P.D., Strassburg, S., and Smith, R.K. (2007). Cell phenotypic variat ion in normal and damaged tendons. International journal of experimental pathology 88, 227 235. Clements, D.A., Wang, J.K., Dionne, C.A., and Goldfarb, M. (1993). Activation of fibroblast growth factor (FGF) receptors by recombinant human FGF 5. Oncogene 8, 13111316. Crovace, A., Lacitignola, L., De Siena, R., Rossi, G., and Francioso, E. (2007). Cell therapy for tendon repair in horses: an experimental study. Veterinary research communications 31 Suppl 1, 281283. Cserjesi, P., Brown, D., Ligon, K.L., Lyo ns, G.E., Copeland, N.G., Gilbert, D.J., Jenkins, N.A., and Olson, E.N. (1995). Scleraxis: a basic helix loophelix protein that prefigures skeletal formation during mouse embryogenesis. Development (Cambridge, England) 121, 10991110. Cummings, B.J., Uchi da, N., Tamaki, S.J., Salazar, D.L., Hooshmand, M., Summers, R., Gage, F.H., and Anderson, A.J. (2005). Human neural stem cells differentiate and promote locomotor recovery in spinal cordinjured mice. Proceedings of the National Academy of Sciences of the United States of America 102, 1406914074. Dani, C., Chambers, I., Johnstone, S., Robertson, M., Ebrahimi, B., Saito, M., Taga, T., Li, M., Burdon, T., Nichols, J., and Smith, A. (1998). Paracrine induction of stem cell renewal by LIF deficient cells: a n ew ES cell regulatory pathway. Developmental biology 203, 149162.

PAGE 149

149 Dorotka, R., Windberger, U., Macfelda, K., Bindreiter, U., Toma, C., and Nehrer, S. (2005). Repair of articular cartilage defects treated by microfracture and a threedimensional collagen m atrix. Biomaterials 26, 36173629. Dowling, B.A., Dart, A.J., Hodgson, D.R., and Smith, R.K. (2000). Superficial digital flexor tendonitis in the horse. Equine veterinary journal 32, 369378. Dvorak, P., Dvorakova, D., Koskova, S., Vodinska, M., Najvirtova M., Krekac, D., and Hampl, A. (2005). Expression and potential role of fibroblast growth factor 2 and its receptors in human embryonic stem cells. Stem cells (Dayton, Ohio) 23, 12001211. Edom Vovard, F., Schuler, B., Bonnin, M.A., Teillet, M.A., and Duprez, D. (2002). Fgf4 positively regulates scleraxis and tenascin expression in chick limb tendons. Developmental biology 247, 351366. Espira, L., Lamoureux, L., Jones, S.C., Gerard, R.D., Dixon, I.M., and Czubryt, M.P. (2009). The basic helix loophelix transcription factor scleraxis regulates fibroblast collagen synthesis. Journal of molecular and cellular cardiology. Eswarakumar, V.P., Lax, I., and Schlessinger, J. (2005). Cellular signaling by fibroblast growth factor receptors. Cytokine & growth factor reviews 16, 139149. Evans, M.J., and Kaufman, M.H. (1981). Establishment in culture of pluripotential cells from mouse embryos. Nature 292, 154156. Faundez, A.A., Taylor, S., and Kaelin, A.J. (2006). Instrumented fusion of thoracolumbar fracture with ty pe I mineralized collagen matrix combined with autogenous bone marrow as a bone graft substitute: a four case report. Eur Spine J 15 Suppl 5, 630635. Feinberg, A.P. (2007). Phenotypic plasticity and the epigenetics of human disease. Nature 447, 433440. F ong, H., Hohenstein, K.A., and Donovan, P.J. (2008). Regulation of self renewal and pluripotency by Sox2 in human embryonic stem cells. Stem cells (Dayton, Ohio) 26, 19311938. Fortier, L.A., Nixon, A.J., Williams, J., and Cable, C.S. (1998). Isolation and chondrocytic differentiation of equine bone marrow derived mesenchymal stem cells. American journal of veterinary research 59, 11821187. Fuchs, J.R., Hannouche, D., Terada, S., Zand, S., Vacanti, J.P., and Fauza, D.O. (2005). Cartilage engineering from o vine umbilical cord blood mesenchymal progenitor cells. Stem cells (Dayton, Ohio) 23, 958964. Gang, E.J., Bosnakovski, D., Figueiredo, C.A., Visser, J.W., and Perlingeiro, R.C. (2007). SSEA 4 identifies mesenchymal stem cells from bone marrow. Blood 109, 17431751.

PAGE 150

150 Gang, E.J., Hong, S.H., Jeong, J.A., Hwang, S.H., Kim, S.W., Yang, I.H., Ahn, C., Han, H., and Kim, H. (2004a). In vitro mesengenic potential of human umbilical cord bloodderived mesenchymal stem cells. Biochemical and biophysical research comm unications 321, 102108. Gang, E.J., Jeong, J.A., Hong, S.H., Hwang, S.H., Kim, S.W., Yang, I.H., Ahn, C., Han, H., and Kim, H. (2004b). Skeletal myogenic differentiation of mesenchymal stem cells isolated from human umbilical cord blood. Stem cells (Dayton, Ohio) 22, 617624. Gao, X., Tate, P., Hu, P., Tjian, R., Skarnes, W.C., and Wang, Z. (2008). ES cell pluripotency and germ layer formation require the SWI/SNF chromatin remodeling component BAF250a. Proceedings of the National Academy of Sciences of the United States of America 105, 6656 6661. Gerecht Nir, S., Dazard, J.E., GolanMashiach, M., Osenberg, S., Botvinnik, A., Amariglio, N., Domany, E., Rechavi, G., Givol, D., and Itskovitz Eldor, J. (2005). Vascular gene expression and phenotypic correlation during differentiation of human embryonic stem cells. Dev Dyn 232, 487497. Ginis, I., Luo, Y., Miura, T., Thies, S., Brandenberger, R., Gerecht Nir, S., Amit, M., Hoke, A., Carpenter, M.K., Itskovitz Eldor, J., and Rao, M.S. (2004). Differences between human and mouse embryonic stem cells. Developmental biology 269, 360380. Giordano, A., Galderisi, U., and Marino, I.R. (2007). From the laboratory bench to the patient's bedside: an update on clinical trials with mesenchymal stem cells. Journal of cellular physiology 211, 2735. Giovannini, S., Brehm, W., Mainil Varlet, P., and Nesic, D. (2008). Multilineage differentiation potential of equine blood derived fibroblast like cells. Differentiation; research in biological diversity 76, 118129. Gong, Z., Calki ns, G., Cheng, E.C., Krause, D., and Niklason, L.E. (2008). Influence of Culture Medium on Smooth Muscle Cell Differentiation from Human Bone Marrow Derived Mesenchymal Stem Cells. Tissue Eng Part A. Goodship, A.E., Birch, H.L., and Wilson, A.M. (1994). The pathobiology and repair of tendon and ligament injury. The Veterinary clinics of North America 10, 323349. Goodwin, H.S., Bicknese, A.R., Chien, S.N., Bogucki, B.D., Quinn, C.O., and Wall, D.A. (2001). Multilineage differentiation activity by cells isol ated from umbilical cord blood: expression of bone, fat, and neural markers. Biol Blood Marrow Transplant 7, 581588. Greco, S.J., Liu, K., and Rameshwar, P. (2007). Functional similarities among genes regulated by OCT4 in human mesenchymal and embryonic s tem cells. Stem cells (Dayton, Ohio) 25, 31433154.

PAGE 151

151 Gronthos, S., Franklin, D.M., Leddy, H.A., Robey, P.G., Storms, R.W., and Gimble, J.M. (2001). Surface protein characterization of human adipose tissue derived stromal cells. Journal of cellular physiolog y 189, 5463. Guest, D.J., and Allen, W.R. (2007). Expression of cell surface antigens and embryonic stem cell pluripotency genes in equine blastocysts. Stem cells and development 16, 789796. Guest, D.J., Smith, M.R., and Allen, W.R. (2008). Monitoring the fate of autologous and allogeneic mesenchymal progenitor cells injected into the superficial digital flexor tendon of horses: preliminary study. Equine veterinary journal 40, 178181. Guilak, F., Lott, K.E., Awad, H.A., Cao, Q., Hicok, K.C., Fermor, B., and Gimble, J.M. (2006). Clonal analysis of the differentiation potential of human adipose derived adult stem cells. Journal of cellular physiology 206, 229237. Gupta, M.C., Theerajunyaporn, T., Maitra, S., Schmidt, M.B., Holy, C.E., Kadiyala, S., and Bru der, S.P. (2007). Efficacy of mesenchymal stem cell enriched grafts in an ovine posterolateral lumbar spine model. Spine 32, 720726; discussion 727. Hankemeier, S., van Griensven, M., Ezechieli, M., Barkhausen, T., Austin, M., Jagodzinski, M., Meller, R., Bosch, U., Krettek, C., and Zeichen, J. (2007). Tissue engineering of tendons and ligaments by human bone marrow stromal cells in a liquid fibrin matrix in immunodeficient rats: results of a histologic study. Archives of orthopaedic and trauma surgery 127, 815821. Hatoya, S., Torii, R., Kondo, Y., Okuno, T., Kobayashi, K., Wijewardana, V., Kawate, N., Tamada, H., Sawada, T., Kumagai, D., Sugiura, K., and Inaba, T. (2006). Isolation and characterization of embryonic stem like cells from canine blastocysts. Molecular reproduction and development 73, 298305. Hayashi, Y., Furue, M.K., Okamoto, T., Ohnuma, K., Myoishi, Y., Fukuhara, Y., Abe, T., Sato, J.D., Hata, R., and Asashima, M. (2007). Integrins regulate mouse embryonic stem cell self renewal. Stem cells (Dayton, Ohio) 25, 30053015. He, X., Gonzalez, V., Tsang, A., Thompson, J., Tsang, T.C., and Harris, D.T. (2005). Differential gene expression profiling of CD34+ CD133+ umbilical cord blood hematopoietic stem progenitor cells. Stem cells and development 14, 188198. Henderson, J.K., Draper, J.S., Baillie, H.S., Fishel, S., Thomson, J.A., Moore, H., and Andrews, P.W. (2002). Preimplantation human embryos and embryonic stem cells show comparable expression of stage specific embryonic antigens. Stem cells (D ayton, Ohio) 20, 329337. Henikoff, S., Furuyama, T., and Ahmad, K. (2004). Histone variants, nucleosome assembly and epigenetic inheritance. Trends Genet 20, 320326. Hildebrandt, C., Buth, H., and Thielecke, H. (2009). Influence of cell culture media conditions on the osteogenic differentiation of cord bloodderived mesenchymal stem cells. Ann Anat 191, 2332.

PAGE 152

152 Holm, M., Kvistgaard, H., Dahl, C., Andersen, H.B., Hansen, T.K., Schiotz, P.O., and Junker, S. (2006). Modulation of chemokine gene expression in CD133+ cord bloodderived human mast cells by cyclosporin A and dexamethasone. Scandinavian journal of immunology 64, 571579. Hong, S.H., Gang, E.J., Jeong, J.A., Ahn, C., Hwang, S.H., Yang, I.H., Park, H.K., Han, H., and Kim, H. (2005). In vitro differentiation of human umbilical cord bloodderived mesenchymal stem cells into hepatocyte like cells. Biochemical and biophysical research communications 330, 11531161. Hough, S.R., Clements, I., Welch, P.J., and Wiederholt, K.A. (2006). Differentiation of mouse embryonic stem cells after RNA interference mediated silencing of OCT4 and Nanog. Stem cells (Dayton, Ohio) 24, 14671475. Huang, J.I., Durbhakula, M.M., Angele, P., Johnstone, B., and Yoo, J.U. (2006). Lunate arthroplasty with autologous mesenchymal st em cells in a rabbit model. The Journal of bone and joint surgery 88 744752. Huang, S., Law, P., Francis, K., Palsson, B.O., and Ho, A.D. (1999). Symmetry of initial cell divisions among primitive hematopoietic progenitors is independent of ontogenic age and regulatory molecules. Blood 94, 25952604. Huangfu, D., Osafune, K., Maehr, R., Guo, W., Eijkelenboom, A., Chen, S., Muhlestein, W., and Melton, D.A. (2008). Induction of pluripotent stem cells from primary human fibroblasts with only Oct4 and Sox2. N ature biotechnology 26 12691275. Hyslop, L., Stojkovic, M., Armstrong, L., Walter, T., Stojkovic, P., Przyborski, S., Herbert, M., Murdoch, A., Strachan, T., and Lako, M. (2005). Downregulation of NANOG induces differentiation of human embryonic stem cel ls to extraembryonic lineages. Stem cells (Dayton, Ohio) 23, 10351043. Im, G.I., Kim, D.Y., Shin, J.H., Hyun, C.W., and Cho, W.H. (2001). Repair of cartilage defect in the rabbit with cultured mesenchymal stem cells from bone marrow. J Bone Joint Surg Br 83, 289294. Jaenisch, R., and Bird, A. (2003). Epigenetic regulation of gene expression: how the genome integrates intrinsic and environmental signals. Nature genetics 33 Suppl 245254. Jenuwein, T., and Allis, C.D. (2001). Translating the histone code. Science (New York, N.Y 293, 10741080. Jeong, J.A., Gang, E.J., Hong, S.H., Hwang, S.H., Kim, S.W., Yang, I.H., Ahn, C., Han, H., and Kim, H. (2004). Rapid neural differentiation of human cord bloodderived mesenchymal stem cells. Neuroreport 15 17311734. Johnson, D.E., Lee, P.L., Lu, J., and Williams, L.T. (1990). Diverse forms of a receptor for acidic and basic fibroblast growth factors. Molecular and cellular biology 10 47284736.

PAGE 153

153 Juncosa Melvin, N., Shearn, J.T., Boivin, G.P., Gooch, C., Galloway, M.T., West, J.R., Nirmalanandhan, V.S., Bradica, G., and Butler, D.L. (2006). Effects of mechanical stimulation on the biomechanics and histology of stem cellcollagen sponge constructs for rabbit patellar tendon repair. Tissue engineering 12 22912300. Jur ga, M., Lipkowski, A.W., Lukomska, B., Buzanska, L., Kurzepa, K., Sobanski, T., Habich, A., Coecke, S., Gajkowska, B., and Domanska Janik, K. (2009). Generation of Functional Neural Artificial Tissue from Human Umbilical Cord Blood Stem Cells. Tissue Eng P art A. Kadivar, M., Khatami, S., Mortazavi, Y., Shokrgozar, M.A., Taghikhani, M., and Soleimani, M. (2006). In vitro cardiomyogenic potential of human umbilical veinderived mesenchymal stem cells. Biochemical and biophysical research communications 340, 639647. Kang, X.Q., Zang, W.J., Bao, L.J., Li, D.L., Song, T.S., Xu, X.L., and Yu, X.J. (2005). Fibroblast growth factor 4 and hepatocyte growth factor induce differentiation of human umbilical cord bloodderived mesenchymal stem cells into hepatocytes. Wo rld J Gastroenterol 11, 7461 7465. Kardon, G. (1998). Muscle and tendon morphogenesis in the avian hind limb. Development (Cambridge, England) 125, 40194032. Katz, A.J., Tholpady, A., Tholpady, S.S., Shang, H., and Ogle, R.C. (2005). Cell surface and tran scriptional characterization of human adipose derived adherent stromal (hADAS) cells. Stem cells (Dayton, Ohio) 23, 412423. Kern, S., Eichler, H., Stoeve, J., Kluter, H., and Bieback, K. (2006). Comparative analysis of mesenchymal stem cells from bone mar row, umbilical cord blood, or adipose tissue. Stem cells (Dayton, Ohio) 24, 12941301. Kestendjieva, S., Kyurkchiev, D., Tsvetkova, G., Mehandjiev, T., Dimitrov, A., Nikolov, A., and Kyurkchiev, S. (2008). Characterization of mesenchymal stem cells isolate d from the human umbilical cord. Cell biology international 32, 724732. Kim, J.W., Kim, S.Y., Park, S.Y., Kim, Y.M., Kim, J.M., Lee, M.H., and Ryu, H.M. (2004). Mesenchymal progenitor cells in the human umbilical cord. Annals of hematology 83, 733738. Ki siday, J.D., Kopesky, P.W., Evans, C.H., Grodzinsky, A.J., McIlwraith, C.W., and Frisbie, D.D. (2008). Evaluation of adult equine bone marrow and adipose derived progenitor cell chondrogenesis in hydrogel cultures. J Orthop Res 26, 322331. Koch, T.G., He erkens, T., Thomsen, P.D., and Betts, D.H. (2007). Isolation of mesenchymal stem cells from equine umbilical cord blood. BMC biotechnology 7, 26. Koerner, J., Nesic, D., Romero, J.D., Brehm, W., Mainil Varlet, P., and Grogan, S.P. (2006). Equine peripheral bloodderived progenitors in comparison to bone marrow derived mesenchymal stem cells. Stem cells (Dayton, Ohio) 24, 16131619.

PAGE 154

154 Kogler, G., Sensken, S., Airey, J.A., Trapp, T., Muschen, M., Feldhahn, N., Liedtke, S., Sorg, R.V., Fischer, J., Rosenbaum, C., Greschat, S., Knipper, A., Bender, J., Degistirici, O., Gao, J., Caplan, A.I., Colletti, E.J., Almeida Porada, G., Muller, H.W., Zanjani, E., and Wernet, P. (2004). A new human somatic stem cell from placental cord blood with intrinsic pluripotent differ entiation potential. The Journal of experimental medicine 200, 123135. Kon, E., Muraglia, A., Corsi, A., Bianco, P., Marcacci, M., Martin, I., Boyde, A., Ruspantini, I., Chistolini, P., Rocca, M., Giardino, R., Cancedda, R., and Quarto, R. (2000). Autolog ous bone marrow stromal cells loaded onto porous hydroxyapatite ceramic accelerate bone repair in criticalsize defects of sheep long bones. Journal of biomedical materials research 49, 328337. Kondo, K., Shintani, S., Shibata, R., Murakami, H., Murakami, R., Imaizumi, M., Kitagawa, Y., and Murohara, T. (2009). Implantation of adipose derived regenerative cells enhances ischemia induced angiogenesis. Arteriosclerosis, thrombosis, and vascular biology 29, 6166. Kong, K.Y., Ren, J., Kraus, M., Finklestein, S.P., and Brown, R.H., Jr. (2004). Human umbilical cord blood cells differentiate into muscle in sjl muscular dystrophy mice. Stem cells (Dayton, Ohio) 22, 981993. Kramer, J., Hegert, C., Hargus, G., and Rohwedel, J. (2005). Mouse ES cell lines show a var iable degree of chondrogenic differentiation in vitro. Cell biology international 29 139146. Kuang, S., Kuroda, K., Le Grand, F., and Rudnicki, M.A. (2007). Asymmetric self renewal and commitment of satellite stem cells in muscle. Cell 129, 9991010. Kum ar, B.M., Yoo, J.G., Ock, S.A., Kim, J.G., Song, H.J., Kang, E.J., Cho, S.K., Lee, S.L., Cho, J.H., Balasubramanian, S., and Rho, G.J. (2007). In vitro differentiation of mesenchymal progenitor cells derived from porcine umbilical cord blood. Molecules and cells 24, 343350. Kunath, T., Saba El Leil, M.K., Almousailleakh, M., Wray, J., Meloche, S., and Smith, A. (2007). FGF stimulation of the Erk1/2 signalling cascade triggers transition of pluripotent embryonic stem cells from self renewal to lineage commitment. Development (Cambridge, England) 134, 28952902. Kunisato, A., Chiba, S., Nakagami Yamaguchi, E., Kumano, K., Saito, T., Masuda, S., Yamaguchi, T., Osawa, M., Kageyama, R., Nakauchi, H., Nishikawa, M., and Hirai, H. (2003). HES 1 preserves purified hematopoietic stem cells ex vivo and accumulates side population cells in vivo. Blood 101, 17771783. Kuo, C.K., and Tuan, R.S. (2008). Mechanoactive tenogenic differentiation of human mesenchymal stem cells. Tissue Eng Part A 14, 16151627.

PAGE 155

155 Kuroda, T., Ta da, M., Kubota, H., Kimura, H., Hatano, S.Y., Suemori, H., Nakatsuji, N., and Tada, T. (2005). Octamer and Sox elements are required for transcriptional cis regulation of Nanog gene expression. Molecular and cellular biology 25, 24752485. Le Guen, L., Not arnicola, C., and de Santa Barbara, P. (2009). Intermuscular tendons are essential for the development of vertebrate stomach. Development (Cambridge, England) 136, 791801. Lee, M.W., Choi, J., Yang, M.S., Moon, Y.J., Park, J.S., Kim, H.C., and Kim, Y.J. ( 2004a). Mesenchymal stem cells from cryopreserved human umbilical cord blood. Biochemical and biophysical research communications 320, 273278. Lee, M.W., Moon, Y.J., Yang, M.S., Kim, S.K., Jang, I.K., Eom, Y.W., Park, J.S., Kim, H.C., Song, K.Y., Park, S.C., Lim, H.S., and Kim, Y.J. (2007). Neural differentiation of novel multipotent progenitor cells from cryopreserved human umbilical cord blood. Biochemical and biophysical research communications 358, 637643. Lee, M.W., Yang, M.S., Park, J.S., Kim, H.C., Kim, Y.J., and Choi, J. (2005). Isolation of mesenchymal stem cells from cryopreserved human umbilical cord blood. International journal of hematology 81 126130. Lee, O.K., Kuo, T.K., Chen, W.M., Lee, K.D., Hsieh, S.L., and Chen, T.H. (2004b). Isolation of multipotent mesenchymal stem cells from umbilical cord blood. Blood 103, 16691675. Lee, P.L., Johnson, D.E., Cousens, L.S., Fried, V.A., and Williams, L.T. (1989). Purification and complementary DNA cloning of a receptor for basic fibroblast growth fa ctor. Science (New York, N.Y 245, 57 60. Lee, T.I., Jenner, R.G., Boyer, L.A., Guenther, M.G., Levine, S.S., Kumar, R.M., Chevalier, B., Johnstone, S.E., Cole, M.F., Isono, K., Koseki, H., Fuchikami, T., Abe, K., Murray, H.L., Zucker, J.P., Yuan, B., Bell, G.W., Herbolsheimer, E., Hannett, N.M., Sun, K., Odom, D.T., Otte, A.P., Volkert, T.L., Bartel, D.P., Melton, D.A., Gifford, D.K., Jaenisch, R., and Young, R.A. (2006). Control of developmental regulators by Polycomb in human embryonic stem cells. Cell 125, 301313. Lefebvre, V., Behringer, R.R., and de Crombrugghe, B. (2001). L Sox5, Sox6 and Sox9 control essential steps of the chondrocyte differentiation pathway. Osteoarthritis and cartilage / OARS, Osteoarthritis Research Society 9 Suppl A S6975. Leja rd, V., Brideau, G., Blais, F., Salingcarnboriboon, R., Wagner, G., Roehrl, M.H., Noda, M., Duprez, D., Houillier, P., and Rossert, J. (2007). Scleraxis and NFATc regulate the expression of the proalpha1(I) collagen gene in tendon fibroblasts. The Journal of biological chemistry 282, 1766517675. Li, H.S., Wang, D., Shen, Q., Schonemann, M.D., Gorski, J.A., Jones, K.R., Temple, S., Jan, L.Y., and Jan, Y.N. (2003). Inactivation of Numb and Numblike in embryonic dorsal forebrain impairs neurogenesis and disr upts cortical morphogenesis. Neuron 40, 11051118.

PAGE 156

156 Li, T.S., Komota, T., Ohshima, M., Qin, S.L., Kubo, M., Ueda, K., and Hamano, K. (2008). TGF beta induces the differentiation of bone marrow stem cells into immature cardiomyocytes. Biochemical and biophys ical research communications 366, 10741080. Li, X., Zhou, S.G., Imreh, M.P., AhrlundRichter, L., and Allen, W.R. (2006). Horse embryonic stem cell lines from the proliferation of inner cell mass cells. Stem cells and development 15, 523531. Liang, J., W an, M., Zhang, Y., Gu, P., Xin, H., Jung, S.Y., Qin, J., Wong, J., Cooney, A.J., Liu, D., and Songyang, Z. (2008). Nanog and Oct4 associate with unique transcriptional repression complexes in embryonic stem cells. Nature cell biology 10, 731 739. Lin, T., Chao, C., Saito, S., Mazur, S.J., Murphy, M.E., Appella, E., and Xu, Y. (2005). p53 induces differentiation of mouse embryonic stem cells by suppressing Nanog expression. Nature cell biology 7, 165171. Liu, G., Zhao, L., Zhang, W., Cui, L., Liu, W., and C ao, Y. (2008). Repair of goat tibial defects with bone marrow stromal cells and beta tricalcium phosphate. Journal of materials science 19, 23672376. Liu, T.M., Martina, M., Hutmacher, D.W., Hui, J.H., Lee, E.H., and Lim, B. (2007). Identification of common pathways mediating differentiation of bone marrow and adipose tissue derived human mesenchymal stem cells into three mesenchymal lineages. Stem cells (Dayton, Ohio) 25, 750760. Liu, Y., Chattopadhyay, N., Qin, S., Szekeres, C., Vasylyeva, T., Mahoney, Z.X., Taglienti, M., Bates, C.M., Chapman, H.A., Miner, J.H., and Kreidberg, J.A. (2009). Coordinate integrin and c Met signaling regulate Wnt gene expression during epithelial morphogenesis. Development (Cambridge, England) 136, 843853. Liu, Y., Cserjes i, P., Nifuji, A., Olson, E.N., and Noda, M. (1996). Sclerotome related helix loophelix type transcription factor (scleraxis) mRNA is expressed in osteoblasts and its level is enhanced by type beta transforming growth factor. The Journal of endocrinology 151, 491499. Loh, Y.H., Wu, Q., Chew, J.L., Vega, V.B., Zhang, W., Chen, X., Bourque, G., George, J., Leong, B., Liu, J., Wong, K.Y., Sung, K.W., Lee, C.W., Zhao, X.D., Chiu, K.P., Lipovich, L., Kuznetsov, V.A., Robson, P., Stanton, L.W., Wei, C.L., Ruan, Y., Lim, B., and Ng, H.H. (2006). The Oct4 and Nanog transcription network regulates pluripotency in mouse embryonic stem cells. Nature genetics 38, 431440. Lowell, S., Benchoua, A., Heavey, B., and Smith, A.G. (2006). Notch promotes neural lineage entry by pluripotent embryonic stem cells. PLoS biology 4, e121. Lowry, W.E., Richter, L., Yachechko, R., Pyle, A.D., Tchieu, J., Sridharan, R., Clark, A.T., and Plath, K. (2008). Generation of human induced pluripotent stem cells from dermal fibroblasts. Proce edings of the National Academy of Sciences of the United States of America 105, 2883 2888.

PAGE 157

157 Ma, N., Ladilov, Y., Moebius, J.M., Ong, L., Piechaczek, C., David, A., Kaminski, A., Choi, Y.H., Li, W., Egger, D., Stamm, C., and Steinhoff, G. (2006). Intramyocar dial delivery of human CD133+ cells in a SCID mouse cryoinjury model: Bone marrow vs. cord bloodderived cells. Cardiovascular research 71, 158169. Ma, W., Tavakoli, T., Derby, E., Serebryakova, Y., Rao, M.S., and Mattson, M.P. (2008). Cell extracellular matrix interactions regulate neural differentiation of human embryonic stem cells. BMC developmental biology 8, 90. Maherali, N., Sridharan, R., Xie, W., Utikal, J., Eminli, S., Arnold, K., Stadtfeld, M., Yachechko, R., Tchieu, J., Jaenisch, R., Plath, K., and Hochedlinger, K. (2007). Directly reprogrammed fibroblasts show global epigenetic remodeling and widespread tissue contribution. Cell stem cell 1, 5570. Marcacci, M., Kon, E., Moukhachev, V., Lavroukov, A., Kutepov, S., Quarto, R., Mastrogiacomo, M., and Cancedda, R. (2007). Stem cells associated with macroporous bioceramics for long bone repair: 6 to 7year outcome of a pilot clinical study. Tissue engineering 13, 947955. Markov, V., Kusumi, K., Tadesse, M.G., William, D.A., Hall, D.M., Lounev, V., Carlton, A., Leonard, J., Cohen, R.I., Rappaport, E.F., and Saitta, B. (2007). Identification of cord bloodderived mesenchymal stem/stromal cell populations with distinct growth kinetics, differentiation potentials, and gene expression profiles. Stem cel ls and development 16, 5373. Martin Rendon, E., Hale, S.J., Ryan, D., Baban, D., Forde, S.P., Roubelakis, M., Sweeney, D., Moukayed, M., Harris, A.L., Davies, K., and Watt, S.M. (2007). Transcriptional profiling of human cord blood CD133+ and cultured bon e marrow mesenchymal stem cells in response to hypoxia. Stem cells (Dayton, Ohio) 25 10031012. Masui, S., Nakatake, Y., Toyooka, Y., Shimosato, D., Yagi, R., Takahashi, K., Okochi, H., Okuda, A., Matoba, R., Sharov, A.A., Ko, M.S., and Niwa, H. (2007). P luripotency governed by Sox2 via regulation of Oct3/4 expression in mouse embryonic stem cells. Nature cell biology 9, 625635. Matsuda, T., Nakamura, T., Nakao, K., Arai, T., Katsuki, M., Heike, T., and Yokota, T. (1999). STAT3 activation is sufficient to maintain an undifferentiated state of mouse embryonic stem cells. The EMBO journal 18, 42614269. Mayshar, Y., Rom, E., Chumakov, I., Kronman, A., Yayon, A., and Benvenisty, N. (2008). Fibroblast growth factor 4 and its novel splice isoform have opposing effects on the maintenance of human embryonic stem cell self renewal. Stem cells (Dayton, Ohio) 26, 767774. McDonald, J.W., Liu, X.Z., Qu, Y., Liu, S., Mickey, S.K., Turetsky, D., Gottlieb, D.I., and Choi, D.W. (1999). Transplanted embryonic stem cells survive, differentiate and promote recovery in injured rat spinal cord. Nature medicine 5, 14101412.

PAGE 158

158 McGuckin, C.P., Pearce, D., Forraz, N., Tooze, J.A., Watt, S.M., and Pettengell, R. (2003). Multiparametric analysis of immature cell populations in umbilic al cord blood and bone marrow. European journal of haematology 71, 341350. Mehlhorn, A.T., Zwingmann, J., Finkenzeller, G., Niemeyer, P., Dauner, M., Stark, B., Sudkamp, N.P., and Schmal, H. (2009). Chondrogenesis of Adipose Derived Adult Stem Cells in a Poly Lactide Co Glycolide Scaffold. Tissue Eng Part A. Meirelles Lda, S., and Nardi, N.B. (2003). Murine marrow derived mesenchymal stem cell: isolation, in vitro expansion, and characterization. British journal of haematology 123, 702711. Meshorer, E., Y ellajoshula, D., George, E., Scambler, P.J., Brown, D.T., and Misteli, T. (2006). Hyperdynamic plasticity of chromatin proteins in pluripotent embryonic stem cells. Developmental cell 10, 105116. Mignatti, P., Morimoto, T., and Rifkin, D.B. (1992). Basic fibroblast growth factor, a protein devoid of secretory signal sequence, is released by cells via a pathway independent of the endoplasmic reticulum Golgi complex. Journal of cellular physiology 151, 8193. Miki, T., Bottaro, D.P., Fleming, T.P., Smith, C.L., Burgess, W.H., Chan, A.M., and Aaronson, S.A. (1992). Determination of ligand binding specificity by alternative splicing: two distinct growth factor receptors encoded by a single gene. Proceedings of the National Academy of Sciences of the United Stat es of America 89, 246250. Mitsui, K., Tokuzawa, Y., Itoh, H., Segawa, K., Murakami, M., Takahashi, K., Maruyama, M., Maeda, M., and Yamanaka, S. (2003). The homeoprotein Nanog is required for maintenance of pluripotency in mouse epiblast and ES cells. Cel l 113, 631642. Mrugala, D., Bony, C., Neves, N., Caillot, L., Fabre, S., Moukoko, D., Jorgensen, C., and Noel, D. (2008). Phenotypic and functional characterisation of ovine mesenchymal stem cells: application to a cartilage defect model. Annals of the rh eumatic diseases 67, 288295. Muir, T., Sadler Riggleman, I., and Skinner, M.K. (2005). Role of the basic helix loophelix transcription factor, scleraxis, in the regulation of Sertoli cell function and differentiation. Molecular endocrinology (Baltimore, Md 19, 2164 2174. Murchison, N.D., Price, B.A., Conner, D.A., Keene, D.R., Olson, E.N., Tabin, C.J., and Schweitzer, R. (2007). Regulation of tendon differentiation by scleraxis distinguishes force transmitting tendons from muscle anchoring tendons. Development (Cambridge, England) 134, 26972708. Muschler, G.F., Nitto, H., Matsukura, Y., Boehm, C., Valdevit, A., Kambic, H., Davros, W., Powell, K., and Easley, K. (2003). Spine fusion using cell matrix composites enriched in bone marrow derived cells. Clinic al orthopaedics and related research, 102 118.

PAGE 159

159 Ng, L.J., Wheatley, S., Muscat, G.E., Conway Campbell, J., Bowles, J., Wright, E., Bell, D.M., Tam, P.P., Cheah, K.S., and Koopman, P. (1997). SOX9 binds DNA, activates transcription, and coexpresses with type II collagen during chondrogenesis in the mouse. Developmental biology 183, 108121. Nichols, J., Zevnik, B., Anastassiadis, K., Niwa, H., Klewe Nebenius, D., Chambers, I., Scholer, H., and Smith, A. (1998). Formation of pluripotent stem cells in the mamma lian embryo depends on the POU transcription factor Oct4. Cell 95, 379391. Nishiyama, N., Miyoshi, S., Hida, N., Uyama, T., Okamoto, K., Ikegami, Y., Miyado, K., Segawa, K., Terai, M., Sakamoto, M., Ogawa, S., and Umezawa, A. (2007). The significant cardi omyogenic potential of human umbilical cord bloodderived mesenchymal stem cells in vitro. Stem cells (Dayton, Ohio) 25, 20172024. Niwa, H. (2001). Molecular mechanism to maintain stem cell renewal of ES cells. Cell structure and function 26, 137148. Niwa, H., Burdon, T., Chambers, I., and Smith, A. (1998). Self renewal of pluripotent embryonic stem cells is mediated via activation of STAT3. Genes & development 12, 20482060. Niwa, H., Miyazaki, J., and Smith, A.G. (2000). Quantitative expression of Oct 3/4 defines differentiation, dedifferentiation or self renewal of ES cells. Nature genetics 24, 372376. Nixon, A.J., Dahlgren, L.A., Haupt, J.L., Yeager, A.E., and Ward, D.L. (2008). Effect of adipose derived nucleated cell fractions on tendon repair in horses with collagenase induced tendinitis. American journal of veterinary research 69, 928937. Nunes, V.A., Cavacana, N., Canovas, M., Strauss, B.E., and Zatz, M. (2007). Stem cells from umbilical cord blood differentiate into myotubes and express dystrophin in vitro only after exposure to in vivo muscle environment. Biology of the cell / under the auspices of the European Cell Biology Organization 99, 185196. Oedayrajsingh Varma, M.J., Ham, S.M.v., Knippenberg, M., Helder, M.N., Klein Nulend, J., Schouten, T.E., Ritt, M.J.P.F., and Milligen, F.J.v. (2006). Adipose tissue derived mesenchymal stem cell yield and growth characteristics are affected by the tissue harvesting procedure. Ogawa, Y., Sawamoto, K., Miyata, T., Miyao, S., Watanabe, M., Nakamura, M., Bregman, B.S., Koike, M., Uchiyama, Y., Toyama, Y., and Okano, H. (2002). Transplantation of in vitroexpanded fetal neural progenitor cells results in neurogenesis and functional recovery after spinal cord contusion injury in adult rats. Journal of neuros cience research 69, 925933. Okamoto, K., Okazawa, H., Okuda, A., Sakai, M., Muramatsu, M., and Hamada, H. (1990). A novel octamer binding transcription factor is differentially expressed in mouse embryonic cells. Cell 60, 461472. Okita, K., Ichisaka, T., and Yamanaka, S. (2007). Generation of germline competent induced pluripotent stem cells. Nature 448, 313317.

PAGE 160

160 Orii, H., Sotome, S., Chen, J., Wang, J., and Shinomiya, K. (2005). Beta tricalcium phosphate (betaTCP) graft combined with bone marrow stromal cells (MSCs) for posterolateral spine fusion. Journal of medical and dental sciences 52, 5157. OrrUrtreger, A., Bedford, M.T., Burakova, T., Arman, E., Zimmer, Y., Yayon, A., Givol, D., and Lonai, P. (1993). Developmental localization of the splicing al ternatives of fibroblast growth factor receptor 2 (FGFR2). Developmental biology 158, 475 486. Pacini, S., Spinabella, S., Trombi, L., Fazzi, R., Galimberti, S., Dini, F., Carlucci, F., and Petrini, M. (2007). Suspension of bone marrow derived undifferenti ated mesenchymal stromal cells for repair of superficial digital flexor tendon in race horses. Tissue engineering 13, 29492955. Park, I.H., Zhao, R., West, J.A., Yabuuchi, A., Huo, H., Ince, T.A., Lerou, P.H., Lensch, M.W., and Daley, G.Q. (2008). Reprogr amming of human somatic cells to pluripotency with defined factors. Nature 451, 141146. Pearson, S., Sroczynska, P., Lacaud, G., and Kouskoff, V. (2008). The stepwise specification of embryonic stem cells to hematopoietic fate is driven by sequential expo sure to Bmp4, activin A, bFGF and VEGF. Development (Cambridge, England) 135, 15251535. Peled, T., Mandel, J., Goudsmid, R.N., Landor, C., Hasson, N., Harati, D., Austin, M., Hasson, A., Fibach, E., Shpall, E.J., and Nagler, A. (2004). Pre clinical develo pment of cord bloodderived progenitor cell graft expanded ex vivo with cytokines and the polyamine copper chelator tetraethylenepentamine. Cytotherapy 6, 344355. Perez, A.V., Perrine, M., Brainard, N., and Vogel, K.G. (2003). Scleraxis (Scx) directs lacZ expression in tendon of transgenic mice. Mechanisms of development 120, 11531163. Pesce, M., Orlandi, A., Iachininoto, M.G., Straino, S., Torella, A.R., Rizzuti, V., Pompilio, G., Bonanno, G., Scambia, G., and Capogrossi, M.C. (2003). Myoendothelial diff erentiation of human umbilical cord bloodderived stem cells in ischemic limb tissues. Circulation research 93, e51 62. Pevny, L.H., and Lovell Badge, R. (1997). Sox genes find their feet. Current opinion in genetics & development 7, 338344. Phillips, B.W ., Hentze, H., Rust, W.L., Chen, Q.P., Chipperfield, H., Tan, E.K., Abraham, S., Sadasivam, A., Soong, P.L., Wang, S.T., Lim, R., Sun, W., Colman, A., and Dunn, N.R. (2007). Directed differentiation of human embryonic stem cells into the pancreatic endocri ne lineage. Stem cells and development 16 561578. Piedrahita, J.A., Zhang, S.H., Hagaman, J.R., Oliver, P.M., and Maeda, N. (1992). Generation of mice carrying a mutant apolipoprotein E gene inactivated by gene targeting in embryonic stem cells. Proceedi ngs of the National Academy of Sciences of the United States of America 89, 4471 4475.

PAGE 161

161 Pinchbeck, G.L., Clegg, P.D., Proudman, C.J., Stirk, A., Morgan, K.L., and French, N.P. (2004). Horse injuries and racing practices in National Hunt racehorses in the UK : the results of a prospective cohort study. Vet J 167, 4552. Pittenger, M.F., Mackay, A.M., Beck, S.C., Jaiswal, R.K., Douglas, R., Mosca, J.D., Moorman, M.A., Simonetti, D.W., Craig, S., and Marshak, D.R. (1999). Multilineage potential of adult human me senchymal stem cells. Science (New York, N.Y 284, 143147. Plotnikov, A.N., Schlessinger, J., Hubbard, S.R., and Mohammadi, M. (1999). Structural basis for FGF receptor dimerization and activation. Cell 98, 641650. Porat, Y., Porozov, S., Belkin, D., Shim oni, D., Fisher, Y., Belleli, A., Czeiger, D., Silverman, W.F., Belkin, M., Battler, A., Fulga, V., and Savion, N. (2006). Isolation of an adult bloodderived progenitor cell population capable of differentiation into angiogenic, myocardial and neural line ages. British journal of haematology 135, 703714. Price, E.M., Prather, R.S., and Foley, C.M. (2006). Multipotent adult progenitor cell lines originating from the peripheral blood of green fluorescent protein transgenic swine. Stem cells and development 15 507522. Pryce, B.A., Brent, A.E., Murchison, N.D., Tabin, C.J., and Schweitzer, R. (2007). Generation of transgenic tendon reporters, ScxGFP and ScxAP, using regulatory elements of the scleraxis gene. Dev Dyn 236, 16771682. Punzel, M., Zhang, T., Liu, D., Eckstein, V., and Ho, A.D. (2002). Functional analysis of initial cell divisions defines the subsequent fate of individual human CD34(+)CD38( ) cells. Experimental hematology 30, 464472. Rebelatto, C.K., Aguiar, A.M., Moretao, M.P., Senegaglia, A.C., Hansen, P., Barchiki, F., Oliveira, J., Martins, J., Kuligovski, C., Mansur, F., Christofis, A., Amaral, V.F., Brofman, P.S., Goldenberg, S., Nakao, L.S., and Correa, A. (2008). Dissimilar differentiation of mesenchymal stem cells from bone marrow, umbilical cord blood, and adipose tissue. Experimental biology and medicine (Maywood, N.J 233, 901913. Reed, S.A., and Johnson, S.E. (2008). Equine umbilical cord blood contains a population of stem cells that express Oct4 and differentiate into mesodermal and endodermal cell types. Journal of cellular physiology 215, 329336. Ren, H., Cao, Y., Zhao, Q., Li, J., Zhou, C., Liao, L., Jia, M., Zhao, Q., Cai, H., Han, Z.C., Yang, R., Chen, G., and Zhao, R.C. (2006). Proliferation and differentiation of bone marrow s tromal cells under hypoxic conditions. Biochemical and biophysical research communications 347, 1221. Reubinoff, B.E., Pera, M.F., Fong, C.Y., Trounson, A., and Bongso, A. (2000). Embryonic stem cell lines from human blastocysts: somatic differentiation i n vitro. Nature biotechnology 18, 399404.

PAGE 162

162 Rhyu, M.S., Jan, L.Y., and Jan, Y.N. (1994). Asymmetric distribution of numb protein during division of the sensory organ precursor cell confers distinct fates to daughter cells. Cell 76, 477491. Richardson, L.E., Dudhia, J., Clegg, P.D., and Smith, R. (2007). Stem cells in veterinary medicine -attempts at regenerating equine tendon after injury. Trends in biotechnology 25, 409416. Rider, D.A., Dombrowski, C., Sawyer, A.A., Ng, G.H., Leong, D., Hutmacher, D.W., N urcombe, V., and Cool, S.M. (2008). Autocrine fibroblast growth factor 2 increases the multipotentiality of human adipose derived mesenchymal stem cells. Stem cells (Dayton, Ohio) 26, 15981608. Ringrose, L., Ehret, H., and Paro, R. (2004). Distinct contri butions of histone H3 lysine 9 and 27 methylation to locus specific stability of polycomb complexes. Molecular cell 16, 641653. Rodda, D.J., Chew, J.L., Lim, L.H., Loh, Y.H., Wang, B., Ng, H.H., and Robson, P. (2005). Transcriptional regulation of nanog b y OCT4 and SOX2. The Journal of biological chemistry 280, 24731 24737. Romanov, Y.A., Svintsitskaya, V.A., and Smirnov, V.N. (2003). Searching for alternative sources of postnatal human mesenchymal stem cells: candidate MSC like cells from umbilical cord. Stem cells (Dayton, Ohio) 21, 105 110. Rosner, M.H., Vigano, M.A., Ozato, K., Timmons, P.M., Poirier, F., Rigby, P.W., and Staudt, L.M. (1990). A POU domain transcription factor in early stem cells and germ cells of the mammalian embryo. Nature 345, 686692. Rovira, M., Delaspre, F., Massumi, M., Serra, S.A., Valverde, M.A., Lloreta, J., Dufresne, M., Payre, B., Konieczny, S.F., Savatier, P., Real, F.X., and Skoudy, A. (2008). Murine embryonic stem cell derived pancreatic acinar cells recapitulate features of early pancreatic differentiation. Gastroenterology 135, 13011310, 1310 e13011305. Ruzicka, K., Grskovic, B., Pavlovic, V., Qujeq, D., Karimi, A., and Mueller, M.M. (2004). Differentiation of human umbilical cord blood CD133+ stem cells towards myelom onocytic lineage. Clinica chimica acta; international journal of clinical chemistry 343, 8592. Saito, S., Ugai, H., Sawai, K., Yamamoto, Y., Minamihashi, A., Kurosaka, K., Kobayashi, Y., Murata, T., Obata, Y., and Yokoyama, K. (2002). Isolation of embryonic stem like cells from equine blastocysts and their differentiation in vitro. FEBS letters 531, 389396. Santos, F., and Dean, W. (2004). Epigenetic reprogramming during early development in mammals. Reproduction (Cambridge, England) 127, 643651. Sato, N ., Meijer, L., Skaltsounis, L., Greengard, P., and Brivanlou, A.H. (2004). Maintenance of pluripotency in human and mouse embryonic stem cells through activation of Wnt signaling by a pharmacological GSK 3specific inhibitor. Nature medicine 10, 5563.

PAGE 163

163 Sav atier, P., Huang, S., Szekely, L., Wiman, K.G., and Samarut, J. (1994). Contrasting patterns of retinoblastoma protein expression in mouse embryonic stem cells and embryonic fibroblasts. Oncogene 9, 809818. Scholer, H.R., Balling, R., Hatzopoulos, A.K., S uzuki, N., and Gruss, P. (1989a). Octamer binding proteins confer transcriptional activity in early mouse embryogenesis. The EMBO journal 8, 25512557. Scholer, H.R., Hatzopoulos, A.K., Balling, R., Suzuki, N., and Gruss, P. (1989b). A family of octamer sp ecific proteins present during mouse embryogenesis: evidence for germline specific expression of an Oct factor. The EMBO journal 8, 25432550. Schwartz, R.E., Reyes, M., Koodie, L., Jiang, Y., Blackstad, M., Lund, T., Lenvik, T., Johnson, S., Hu, W.S., and Verfaillie, C.M. (2002). Multipotent adult progenitor cells from bone marrow differentiate into functional hepatocyte like cells. The Journal of clinical investigation 109, 12911302. Schweitzer, R., Chyung, J.H., Murtaugh, L.C., Brent, A.E., Rosen, V., O lson, E.N., Lassar, A., and Tabin, C.J. (2001). Analysis of the tendon cell fate using Scleraxis, a specific marker for tendons and ligaments. Development (Cambridge, England) 128, 38553866. Scotet, E., and Houssaint, E. (1995). The choice between alterna tive IIIb and IIIc exons of the FGFR 3 gene is not strictly tissue specific. Biochimica et biophysica acta 1264, 238242. Shinin, V., GayraudMorel, B., Gomes, D., and Tajbakhsh, S. (2006). Asymmetric division and cosegregation of template DNA strands in a dult muscle satellite cells. Nature cell biology 8, 677687. Smith, R.K., Korda, M., Blunn, G.W., and Goodship, A.E. (2003). Isolation and implantation of autologous equine mesenchymal stem cells from bone marrow into the superficial digital flexor tendon as a potential novel treatment. Equine veterinary journal 35, 99102. Smith, T.G., Sweetman, D., Patterson, M., Keyse, S.M., and Munsterberg, A. (2005). Feedback interactions between MKP3 and ERK MAP kinase control scleraxis expression and the specificatio n of rib progenitors in the developing chick somite. Development (Cambridge, England) 132, 13051314. Solchaga, L.A., Penick, K., Porter, J.D., Goldberg, V.M., Caplan, A.I., and Welter, J.F. (2005). FGF 2 enhances the mitotic and chondrogenic potentials of human adult bone marrow derived mesenchymal stem cells. Journal of cellular physiology 203, 398 409. Sottile, V., Thomson, A., and McWhir, J. (2003). In vitro osteogenic differentiation of human ES cells. Cloning and stem cells 5, 149155. Sparrow, R.L., Cauchi, J.A., Ramadi, L.T., Waugh, C.M., and Kirkland, M.A. (2002). Influence of mode of birth and collection on WBC yields of umbilical cord blood units. Transfusion 42, 210215.

PAGE 164

164 Spradling, A.C., and Zheng, Y. (2007). Developmental biology. The mother of all stem cells? Science (New York, N.Y 315, 469470. Stenderup, K., Justesen, J., Clausen, C., and Kassem, M. (2003). Aging is associated with decreased maximal life span and accelerated senescence of bone marrow stromal cells. Bone 33, 919926. Stewart, A .A., Byron, C.R., Pondenis, H., and Stewart, M.C. (2007). Effect of fibroblast growth factor 2 on equine mesenchymal stem cell monolayer expansion and chondrogenesis. American journal of veterinary research 68, 941945. Stier, S., Cheng, T., Dombkowski, D., Carlesso, N., and Scadden, D.T. (2002). Notch1 activation increases hematopoietic stem cell self renewal in vivo and favors lymphoid over myeloid lineage outcome. Blood 99, 23692378. Stojkovic, M., Lako, M., Stojkovic, P., Stewart, R., Przyborski, S., A rmstrong, L., Evans, J., Herbert, M., Hyslop, L., Ahmad, S., Murdoch, A., and Strachan, T. (2004). Derivation of human embryonic stem cells from day 8 blastocysts recovered after threestep in vitro culture. Stem cells (Dayton, Ohio) 22, 790797. Suda, J., Suda, T., and Ogawa, M. (1984a). Analysis of differentiation of mouse hemopoietic stem cells in culture by sequential replating of paired progenitors. Blood 64 393399. Suda, T., Suda, J., and Ogawa, M. (1984b). Disparate differentiation in mouse hemopoi etic colonies derived from paired progenitors. Proceedings of the National Academy of Sciences of the United States of America 81, 2520 2524. Sumi, T., Fujimoto, Y., Nakatsuji, N., and Suemori, H. (2004). STAT3 is dispensable for maintenance of self renewal in nonhuman primate embryonic stem cells. Stem cells (Dayton, Ohio) 22, 861872. Sun, B., Roh, K.H., Lee, S.R., Lee, Y.S., and Kang, K.S. (2007). Induction of human umbilical cord bloodderived stem cells with embryonic stem cell phenotypes into insulin producing isletlike structure. Biochemical and biophysical research communications 354, 919923. Takahashi, K., Tanabe, K., Ohnuki, M., Narita, M., Ichisaka, T., Tomoda, K., and Yamanaka, S. (2007). Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 131, 861872. Takahashi, K., and Yamanaka, S. (2006). Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126, 663676. Talens Visconti, R., Bonora, A., Jover, R., Mirabet, V., Carbonell, F., Castell, J.V., and Gomez Lechon, M.J. (2006). Hepatogenic differentiation of human mesenchymal stem cells from adipose tissue in comparison with bone marrow mesenchymal stem cells. World J Gastroenterol 12, 5834 5845.

PAGE 165

165 Tanaka, T.S., Kunath, T., Kimber, W.L., Jaradat, S.A., Stagg, C.A., Usuda, M., Yokota, T., Niwa, H., Rossant, J., and Ko, M.S. (2002). Gene expression profiling of embryoderived stem cells reveals candidate genes associated with pluripotency and lineage specifici ty. Genome research 12, 19211928. Tang, X.P., Zhang, M., Yang, X., Chen, L.M., and Zeng, Y. (2006). Differentiation of human umbilical cord blood stem cells into hepatocytes in vivo and in vitro. World J Gastroenterol 12, 4014 4019. Taylor, S.E., Smith, R .K., and Clegg, P.D. (2007). Mesenchymal stem cell therapy in equine musculoskeletal disease: scientific fact or clinical fiction? Equine veterinary journal 39, 172180. Taylor, S.E., Vaughan Thomas, A., Clements, D.N., Pinchbeck, G., Macrory, L.C., Smith, R.K., and Clegg, P.D. (2009). Gene expression markers of tendon fibroblasts in normal and diseased tissue compared to monolayer and three dimensional culture systems. BMC musculoskeletal disorders 10, 27. Thompson, S., Clarke, A.R., Pow, A.M., Hooper, M.L ., and Melton, D.W. (1989). Germ line transmission and expression of a corrected HPRT gene produced by gene targeting in embryonic stem cells. Cell 56, 313321. Thomson, J.A., Itskovitz Eldor, J., Shapiro, S.S., Waknitz, M.A., Swiergiel, J.J., Marshall, V.S., and Jones, J.M. (1998). Embryonic stem cell lines derived from human blastocysts. Science (New York, N.Y 282, 11451147. Tielens, S., Verhasselt, B., Liu, J., Dhont, M., Van Der Elst, J., and Cornelissen, M. (2006). Generation of embryonic stem cell lines from mouse blastocysts developed in vivo and in vitro: relation to Oct4 expression. Reproduction (Cambridge, England) 132, 5966. Todorova, M.G., Soria, B., and Quesada, I. (2008). Gap junctional intercellular communication is required to maintain emb ryonic stem cells in a non differentiated and proliferative state. Journal of cellular physiology 214, 354362. Tondreau, T., Meuleman, N., Delforge, A., Dejeneffe, M., Leroy, R., Massy, M., Mortier, C., Bron, D., and Lagneaux, L. (2005). Mesenchymal stem cells derived from CD133positive cells in mobilized peripheral blood and cord blood: proliferation, Oct4 expression, and plasticity. Stem cells (Dayton, Ohio) 23, 11051112. Torrente, Y., Belicchi, M., Sampaolesi, M., Pisati, F., Meregalli, M., D'Antona, G., Tonlorenzi, R., Porretti, L., Gavina, M., Mamchaoui, K., Pellegrino, M.A., Furling, D., Mouly, V., Butler Browne, G.S., Bottinelli, R., Cossu, G., and Bresolin, N. (2004). Human circulating AC133(+) stem cells restore dystrophin expression and ameliora te function in dystrophic skeletal muscle. The Journal of clinical investigation 114, 182195. Tropel, P., Noel, D., Platet, N., Legrand, P., Benabid, A.L., and Berger, F. (2004). Isolation and characterisation of mesenchymal stem cells from adult mouse bo ne marrow. Experimental cell research 295, 395 406.

PAGE 166

166 Vassilieva, S., Guan, K., Pich, U., and Wobus, A.M. (2000). Establishment of SSEA 1and Oct 4expressing rat embryonic stem like cell lines and effects of cytokines of the IL 6 family on clonal growth. E xperimental cell research 258, 361373. Vendrame, M., Cassady, J., Newcomb, J., Butler, T., Pennypacker, K.R., Zigova, T., Sanberg, C.D., Sanberg, P.R., and Willing, A.E. (2004). Infusion of human umbilical cord blood cells in a rat model of stroke dose de pendently rescues behavioral deficits and reduces infarct volume. Stroke; a journal of cerebral circulation 35, 23902395. Vendrame, M., Gemma, C., de Mesquita, D., Collier, L., Bickford, P.C., Sanberg, C.D., Sanberg, P.R., Pennypacker, K.R., and Willing, A.E. (2005). Anti inflammatory effects of human cord blood cells in a rat model of stroke. Stem cells and development 14, 595604. Vendrame, M., Gemma, C., Pennypacker, K.R., Bickford, P.C., Davis Sanberg, C., Sanberg, P.R., and Willing, A.E. (2006). Cord blood rescues stroke induced changes in splenocyte phenotype and function. Experimental neurology 199, 191200. Viateau, V., Guillemin, G., Bousson, V., Oudina, K., Hannouche, D., Sedel, L., Logeart Avramoglou, D., and Petite, H. (2007). Long bone critical size defects treated with tissue engineered grafts: a study on sheep. J Orthop Res 25, 741749. Vidal, M.A., Kilroy, G.E., Johnson, J.R., Lopez, M.J., Moore, R.M., and Gimble, J.M. (2006). Cell growth characteristics and differentiation frequency of adher ent equine bone marrow derived mesenchymal stromal cells: adipogenic and osteogenic capacity. Vet Surg 35, 601610. Wagner, W., Wein, F., Seckinger, A., Frankhauser, M., Wirkner, U., Krause, U., Blake, J., Schwager, C., Eckstein, V., Ansorge, W., and Ho, A .D. (2005). Comparative characteristics of mesenchymal stem cells from human bone marrow, adipose tissue, and umbilical cord blood. Experimental hematology 33 14021416. Wakitani, S., Nawata, M., Tensho, K., Okabe, T., Machida, H., and Ohgushi, H. (2007). Repair of articular cartilage defects in the patello femoral joint with autologous bone marrow mesenchymal cell transplantation: three case reports involving nine defects in five knees. Journal of tissue engineering and regenerative medicine 1, 7479. Wakitani, S., Saito, T., and Caplan, A.I. (1995). Myogenic cells derived from rat bone marrow mesenchymal stem cells exposed to 5 azacytidine. Muscle & nerve 18, 14171426. W ang, J., Levasseur, D.N., and Orkin, S.H. (2008). Requirement of Nanog dimerization for stem cell self renewal and pluripotency. Proceedings of the National Academy of Sciences of the United States of America 105, 63266331. Wang, J., Rao, S., Chu, J., She n, X., Levasseur, D.N., Theunissen, T.W., and Orkin, S.H. (2006). A protein interaction network for pluripotency of embryonic stem cells. Nature 444, 364368.

PAGE 167

167 Wang, J.A., Fan, Y.Q., Li, C.L., He, H., Sun, Y., and Lv, B.J. (2005a). Human bone marrow derived mesenchymal stem cells transplanted into damaged rabbit heart to improve heart function. Journal of Zhejiang University. Science 6, 242248. Wang, L., and Detamore, M.S. (2009). Insulinlike growth factor I improves chondrogenesis of predifferentiated hum an umbilical cord mesenchymal stromal cells. J Orthop Res. Wang, L., Duan, E., Sung, L.Y., Jeong, B.S., Yang, X., and Tian, X.C. (2005b). Generation and characterization of pluripotent stem cells from cloned bovine embryos. Biology of reproduction 73, 149155. Watanabe, N., Woo, S.L., Papageorgiou, C., Celechovsky, C., and Takai, S. (2002). Fate of donor bone marrow cells in medial collateral ligament after simulated autologous transplantation. Microscopy research and technique 58, 3944. Wen, Z., Zhong, Z., and Darnell, J.E., Jr. (1995). Maximal activation of transcription by Stat1 and Stat3 requires both tyrosine and serine phosphorylation. Cell 82, 241250. Wernig, M., Meissner, A., Foreman, R., Brambrink, T., Ku, M., Hochedlinger, K., Bernstein, B.E., and Jaenisch, R. (2007). In vitro reprogramming of fibroblasts into a pluripotent ES cell like state. Nature 448, 318324. White, J., Stead, E., Faast, R., Conn, S., Cartwright, P., and Dalton, S. (2005). Developmental activation of the RbE2F pathway and es tablishment of cell cycle regulated cyclin dependent kinase activity during embryonic stem cell differentiation. Molecular biology of the cell 16, 20182027. Wichterle, H., Lieberam, I., Porter, J.A., and Jessell, T.M. (2002). Directed differentiation of e mbryonic stem cells into motor neurons. Cell 110, 385397. Wilke, M.M., Nydam, D.V., and Nixon, A.J. (2007). Enhanced early chondrogenesis in articular defects following arthroscopic mesenchymal stem cell implantation in an equine model. J Orthop Res 25, 913925. Willing, A.E., Lixian, J., Milliken, M., Poulos, S., Zigova, T., Song, S., Hart, C., Sanchez Ramos, J., and Sanberg, P.R. (2003). Intravenous versus intrastriatal cord blood administration in a rodent model of stroke. Journal of neuroscience resear ch 73, 296307. Worster, A.A., Brower Toland, B.D., Fortier, L.A., Bent, S.J., Williams, J., and Nixon, A.J. (2001). Chondrocytic differentiation of mesenchymal stem cells sequentially exposed to transforming growth factor beta1 in monolayer and insulinlike growth factor I in a threedimensional matrix. J Orthop Res 19, 738749. Worster, A.A., Nixon, A.J., Brower Toland, B.D., and Williams, J. (2000). Effect of transforming growth factor beta1 on chondrogenic differentiation of cultured equine mesenchymal stem cells. American journal of veterinary research 61, 10031010.

PAGE 168

168 Wu, K.H., Zhou, B., Mo, X.M., Cui, B., Yu, C.T., Lu, S.H., Han, Z.C., and Liu, Y.L. (2007a). Therapeutic potential of human umbilical cordderived stem cells in ischemic diseases. Transplan tation proceedings 39, 16201622. Wu, K.H., Zhou, B., Yu, C.T., Cui, B., Lu, S.H., Han, Z.C., and Liu, Y.L. (2007b). Therapeutic potential of human umbilical cord derived stem cells in a rat myocardial infarction model. The Annals of thoracic surgery 83, 14911498. Wu, M., Kwon, H.Y., Rattis, F., Blum, J., Zhao, C., Ashkenazi, R., Jackson, T.L., Gaiano, N., Oliver, T., and Reya, T. (2007c). Imaging hematopoietic precursor division in real time. Cell stem cell 1, 541554. Wu, Q., Chen, X., Zhang, J., Loh, Y.H., Low, T.Y., Zhang, W., Zhang, W., Sze, S.K., Lim, B., and Ng, H.H. (2006). Sall4 interacts with Nanog and cooccupies Nanog genomic sites in embryonic stem cells. The Journal of biological chemistry 281, 2409024094. Xiao, J., Nan, Z., Motooka, Y., and Low, W.C. (2005). Transplantation of a novel cell line population of umbilical cord blood stem cells ameliorates neurological deficits associated with ischemic brain injury. Stem cells and development 14, 722733. Xu, C., Inokuma, M.S., Denham, J., Golds, K., Kundu, P., Gold, J.D., and Carpenter, M.K. (2001). Feeder free growth of undifferentiated human embryonic stem cells. Nature biotechnology 19, 971974. Xu, R.H., Peck, R.M., Li, D.S., Feng, X., Ludwig, T., and Thomson, J.A. (2005). Basic FGF and suppre ssion of BMP signaling sustain undifferentiated proliferation of human ES cells. Nature methods 2, 185190. Yahata, T., Muguruma, Y., Yumino, S., Sheng, Y., Uno, T., Matsuzawa, H., Ito, M., Kato, S., Hotta, T., and Ando, K. (2008). Quiescent human hematopoietic stem cells in the bone marrow niches organize the hierarchical structure of hematopoiesis. Stem cells (Dayton, Ohio) 26, 32283236. Yamashita, A., Takada, T., Nemoto, K., Yamamoto, G., and Torii, R. (2006). Transient suppression of PPARgamma directed ES cells into an osteoblastic lineage. FEBS letters 580, 41214125. Yamashita, Y.M., Jones, D.L., and Fuller, M.T. (2003). Orientation of asymmetric stem cell division by the APC tumor suppressor and centrosome. Science (New York, N.Y 301, 15471550. Yamashita, Y.M., Mahowald, A.P., Perlin, J.R., and Fuller, M.T. (2007). Asymmetric inheritance of mother versus daughter centrosome in stem cell division. Science (New York, N.Y 315, 518521. Yan, H., and Yu, C. (2007). Repair of full thickness cartilage defec ts with cells of different origin in a rabbit model. Arthroscopy 23, 178187.

PAGE 169

169 Yanez, R., Lamana, M.L., Garcia Castro, J., Colmenero, I., Ramirez, M., and Bueren, J.A. (2006). Adipose tissue derived mesenchymal stem cells have in vivo immunosuppressive properties applicable for the control of the graft versus host disease. Stem cells (Dayton, Ohio) 24, 25822591. Yates, A., and Chambers, I. (2005). The homeodomain protein Nanog and pluripotency in mouse embryonic stem cells. Biochemical Society transactions 33, 15181521. Yeom, Y.I., Fuhrmann, G., Ovitt, C.E., Brehm, A., Ohbo, K., Gross, M., Hubner, K., and Scholer, H.R. (1996). Germline regulatory element of Oct 4 specific for the totipotent cycle of embryonal cells. Development (Cambridge, England) 122, 881894. Ying, Q.L., Nichols, J., Chambers, I., and Smith, A. (2003). BMP induction of Id proteins suppresses differentiation and sustains embryonic stem cell self renewal in collaboration with STAT3. Cell 115, 281292. Yoshimura, H., Muneta, T., Nimura, A., Yokoyama, A., Koga, H., and Sekiya, I. (2007). Comparison of rat mesenchymal stem cells derived from bone marrow, synovium, periosteum, adipose tissue, and muscle. Cell and tissue research 327, 449 462. Young, R.G., Butler, D.L., Weber, W., Caplan, A.I., G ordon, S.L., and Fink, D.J. (1998). Use of mesenchymal stem cells in a collagen matrix for Achilles tendon repair. J Orthop Res 16, 406413. Yuan, H., Corbi, N., Basilico, C., and Dailey, L. (1995). Developmental specific activity of the FGF 4 enhancer req uires the synergistic action of Sox2 and Oct 3. Genes & development 9, 26352645. Zaehres, H., Lensch, M.W., Daheron, L., Stewart, S.A., Itskovitz Eldor, J., and Daley, G.Q. (2005). Highefficiency RNA interference in human embryonic stem cells. Stem cells (Dayton, Ohio) 23, 299305. Zeng, X., and Rao, M.S. (2007). Human embryonic stem cells: long term stability, absence of senescence and a potential cell source for neural replacement. Neuroscience 145, 13481358. Zhang, J., Tam, W.L., Tong, G.Q., Wu, Q., C han, H.Y., Soh, B.S., Lou, Y., Yang, J., Ma, Y., Chai, L., Ng, H.H., Lufkin, T., Robson, P., and Lim, B. (2006). Sall4 modulates embryonic stem cell pluripotency and early embryonic development by the transcriptional regulation of Pou5f1. Nature cell biology 8, 11141123. Zhao, Y., Wang, H., and Mazzone, T. (2006). Identification of stem cells from human umbilical cord blood with embryonic and hematopoietic characteristics. Experimental cell research 312, 24542464. Zheng, J.K., Wang, Y., Karandikar, A., Wa ng, Q., Gai, H., Liu, A.L., Peng, C., and Sheng, H.Z. (2006). Skeletal myogenesis by human embryonic stem cells. Cell research 16, 713722.

PAGE 170

170 Zhou, G., Liu, W., Cui, L., Wang, X., Liu, T., and Cao, Y. (2006). Repair of porcine articular osteochondral defects in nonweightbearing areas with autologous bone marrow stromal cells. Tissue engineering 12, 32093221. Zhu, Y., Liu, T., Song, K., Ning, R., Ma, X., and Cui, Z. (2008). ADSCs differentiated into cardiomyocytes in cardiac microenvironment. Molecular and c ellular biochemistry.

PAGE 171

171 BIOGRAPHICAL SKETCH Sarah Reed was born in Bellefonte, Pennsylvania, to Lisa and Howard Grove, Jr. She grew up riding and showing Quarter Horses and was a member of 4H and the American Quarter Horse Youth Association. Sarah gr aduated as valedictorian from Bellefonte Area High School in Bellefonte, Pennsylvania in 2000. Following high school, Sarah pursued a bachelors degree in equine science at Delaware Valley College where she graduated summa cum laude in December 2003. Whil e at DVC, Sarah was involved in the Equine Science Organization and the agricultural honor society, Delta Tau Alpha. Following graduation, she worked as a laboratory technician for Dr. Sally E. Johnson at the Pennsylvania State University. In July 2004, S arah married Jared Reed. Upon Dr. Johnsons move to the University of Florida, Sarah enrolled as a masters student and completed her degree in Dr. Johnsons laboratory. The title of her masters thesis was Identification of Differentially Expressed Prot eins as a Result of Raf Kinase Activity Sarah continued her education with Dr. Johnson, pursuing her doctoral degree in the Animal Molecular and Cellular Biology program. While working on her degree, Sarah stayed involved with the horse industry by working at Sundaram Farms in Newberry, Florida and taking show jumping lessons from Beth Stelzleni and Ella Rukin. Sarah currently resides in Alachua, Florida, with her husband, Jared, and their two dogs, Annie and Bella. She and Jared are active members of G race United Methodist Church at Fort Clarke. Sarah enjoys photography, horseback riding, and reading fiction in her spare time.