<%BANNER%>

Expression of the Iron Exporter Ferroportin in Response to Copper Deficiency and Iron Loading

Permanent Link: http://ufdc.ufl.edu/UFE0024530/00001

Material Information

Title: Expression of the Iron Exporter Ferroportin in Response to Copper Deficiency and Iron Loading
Physical Description: 1 online resource (73 p.)
Language: english
Creator: Jenkitkasemwong, Supak
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: copper, ferroportin, iron
Food Science and Human Nutrition -- Dissertations, Academic -- UF
Genre: Food Science and Human Nutrition thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Copper and iron are metabolically interrelated. In mammals, copper deficiency impairs normal iron homeostasis and often results in microcytic hypochromic anemia. The anemia likely results from a defect in iron release from the site of absorption/storage. Iron release is mediated by ferroportin, a transmembrane iron-export protein that plays a central role in dietary iron absorption and iron recycling from senescent red blood cells. Ferroportin expression increases with iron loading but decreases in response to hepcidin, the iron-regulatory hormone that binds to ferroportin, causing its internalization and degradation. Hepcidin acts as a circulatory iron sensor, where its expression increases with iron loading and decreases with iron depletion and anemia. A recent study reported that copper deficiency has no effect on ferroportin expression in mice despite hepatic iron loading and anemia (7). More recent studies demonstrated that copper-deficient (CuD) rats, but not mice, have decreased plasma iron concentrations (8, 9), thus indicating species-specific responses in iron/copper metabolism. We therefore examined ferroportin expression in rats that were made CuD. We found that CuD rats exhibit increased ferroportin protein expression in liver and spleen relative to copper-adequate (CuA) control rats (P < 0.05; n=4/group). Hepatic hepcidin mRNA levels were dramatically lower in CuD than CuA rats, despite their hepatic iron accumulation. Western analysis of CuD mouse liver indicated no change in ferroportin protein expression, similar to the previous study in mice (7). Furthermore, we observed no change in hepatic hepcidin mRNA levels in CuD mice, despite their anemia. The CuD rats display low plasma iron concentrations whereas the CuD mice do not. We conclude that tissue ferroportin levels increase in anemic CuD rats, but not mice, because only rats display low plasma iron concentrations and diminished hepcidin expression. These data suggest that serum iron, rather than anemia per se, is the signal for hepcidin during copper deficiency. In the absence of hepcidin, ferroportin is mainly regulated posttranscriptionally through the iron-responsive element (IRE)/iron regulatory proteins (IRPs) system. However, ferroportin mRNA levels also increase markedly with iron loading. A recent study showed iron loading increases both ferroportin mRNA and heterogeneous nuclear RNA (hnRNA) levels in mouse J774 macrophages, suggesting transcriptional regulation (14). To investigate the cis-acting elements that may play a role in the transcriptional activation of ferroportin gene by iron, we performed an analysis of ferroportin promoter regions from mouse, rat and human species. We found a perfectly conserved metal response element (MRE), which may serve as a binding site for the metal transcription factor 1 (MTF1). We further demonstrated that Mtf-1 silencing in J774 macrophages significantly increases ferroportin mRNA transcript levels (P < 0.01) both in the presence or absence of iron, suggesting that Mtf-1 suppresses ferroportin gene expression. These data suggest that Mtf-1 may be a transcriptional repressor, and that it may be required for normal transcription process of ferroportin gene.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Supak Jenkitkasemwong.
Thesis: Thesis (M.S.)--University of Florida, 2009.
Local: Adviser: Knutson, Mitchell D.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0024530:00001

Permanent Link: http://ufdc.ufl.edu/UFE0024530/00001

Material Information

Title: Expression of the Iron Exporter Ferroportin in Response to Copper Deficiency and Iron Loading
Physical Description: 1 online resource (73 p.)
Language: english
Creator: Jenkitkasemwong, Supak
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: copper, ferroportin, iron
Food Science and Human Nutrition -- Dissertations, Academic -- UF
Genre: Food Science and Human Nutrition thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Copper and iron are metabolically interrelated. In mammals, copper deficiency impairs normal iron homeostasis and often results in microcytic hypochromic anemia. The anemia likely results from a defect in iron release from the site of absorption/storage. Iron release is mediated by ferroportin, a transmembrane iron-export protein that plays a central role in dietary iron absorption and iron recycling from senescent red blood cells. Ferroportin expression increases with iron loading but decreases in response to hepcidin, the iron-regulatory hormone that binds to ferroportin, causing its internalization and degradation. Hepcidin acts as a circulatory iron sensor, where its expression increases with iron loading and decreases with iron depletion and anemia. A recent study reported that copper deficiency has no effect on ferroportin expression in mice despite hepatic iron loading and anemia (7). More recent studies demonstrated that copper-deficient (CuD) rats, but not mice, have decreased plasma iron concentrations (8, 9), thus indicating species-specific responses in iron/copper metabolism. We therefore examined ferroportin expression in rats that were made CuD. We found that CuD rats exhibit increased ferroportin protein expression in liver and spleen relative to copper-adequate (CuA) control rats (P < 0.05; n=4/group). Hepatic hepcidin mRNA levels were dramatically lower in CuD than CuA rats, despite their hepatic iron accumulation. Western analysis of CuD mouse liver indicated no change in ferroportin protein expression, similar to the previous study in mice (7). Furthermore, we observed no change in hepatic hepcidin mRNA levels in CuD mice, despite their anemia. The CuD rats display low plasma iron concentrations whereas the CuD mice do not. We conclude that tissue ferroportin levels increase in anemic CuD rats, but not mice, because only rats display low plasma iron concentrations and diminished hepcidin expression. These data suggest that serum iron, rather than anemia per se, is the signal for hepcidin during copper deficiency. In the absence of hepcidin, ferroportin is mainly regulated posttranscriptionally through the iron-responsive element (IRE)/iron regulatory proteins (IRPs) system. However, ferroportin mRNA levels also increase markedly with iron loading. A recent study showed iron loading increases both ferroportin mRNA and heterogeneous nuclear RNA (hnRNA) levels in mouse J774 macrophages, suggesting transcriptional regulation (14). To investigate the cis-acting elements that may play a role in the transcriptional activation of ferroportin gene by iron, we performed an analysis of ferroportin promoter regions from mouse, rat and human species. We found a perfectly conserved metal response element (MRE), which may serve as a binding site for the metal transcription factor 1 (MTF1). We further demonstrated that Mtf-1 silencing in J774 macrophages significantly increases ferroportin mRNA transcript levels (P < 0.01) both in the presence or absence of iron, suggesting that Mtf-1 suppresses ferroportin gene expression. These data suggest that Mtf-1 may be a transcriptional repressor, and that it may be required for normal transcription process of ferroportin gene.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Supak Jenkitkasemwong.
Thesis: Thesis (M.S.)--University of Florida, 2009.
Local: Adviser: Knutson, Mitchell D.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0024530:00001


This item has the following downloads:


Full Text

PAGE 1

1 EXPRESSION OF THE IRON EXPORTER FERROPORTIN IN RESPONSE TO COPPER DEFICIENCY AND IRON LOADING By SUPAK JENKITKASEMWONG A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2009

PAGE 2

2 2009 Supak Jenkitkasemwong

PAGE 3

3 To my wonderful family, with their great love and support, making this milestone possible

PAGE 4

4 ACKNOWLEDGMENTS I first would like to acknowledge my major advisor Dr.Mitchell Knutson who gave me this fantastic opportunity to gain research experience in the nutrition field in his laboratory. It is because of his constant support and advice that ma de this project possible. I will never be able to convey my full gratitude to him for being such a great mentor both academically and socially. I truly thank Dr. Joseph Prohaska for his collaboration through providing tremendous resources for the current research. I thank my committee members (Dr. Jesse Gregory and Dr. Thomas Yang) for their advice and their making this thesis a success. I thank my lab members (Hyeyoung Nam, Ning Ning Zhao, Sukru Gulec, Chia Yu Wang, Joeva Hepburn and others) for their assistance, suggestions, and good times. I would also like to thank all my previous mentors who, I believe, contribute to my accomplishment one way or another. I thank Adulphan Youngmod and Siraporn Treerattanaphan who are always there supporting me throughout the good and bad times. Last but not least, I gratefully thank my parents, my brother, and my lovely aunt for their love and being my constant source of inspirations.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGEMENTS .............................................................................................................4 LIST OF TABLES ................................................................................................................ ...........7 LIST OF FIGURES ............................................................................................................... ..........8 ABSTRACT ...................................................................................................................... ...............9 CHAPTER 1 INTRODUCTION ................................................................................................................ ..11 2 LITERATURE REVIEW .......................................................................................................13 Introduction to Copper ........................................................................................................ ....13 Copper Homeostasis ............................................................................................................ ...13 Copper Absorption ..........................................................................................................13 Copper Transport and Cellular Uptake ............................................................................16 Copper Excretion .............................................................................................................1 8 Copper Intake and Requirement.......................................................................................19 Copper Imbalance: Deficiency and Overload ..................................................................19 Effect of Copper Deficiency on Iron Metabolism ..................................................................20 Ferroportin: the only Known Iron Transporter in Mammals ..................................................23 Discovery and Proposed Funtion .....................................................................................23 Ferroportin Regulation ....................................................................................................24 Hormonal regulation of ferroportin by hepcidin ......................................................24 Regulation of ferroportin by IRE/IRP system and cellular iron status ....................26 Mechanism of Cellular Iron Export .................................................................................27 Current Biomarkers for Copper Status ...................................................................................28 Specific Aims ................................................................................................................. .........30 3 MATERIALS AND METHODS ...........................................................................................36 Study Designs for Specific Aims I and II ...............................................................................36 Cell Culture and Treatments ................................................................................................... 37 Ferroportin Gene and Promoter Analysis ...............................................................................37 Suppression of MRE-binding Transcription Factor (Mtf-1) Expression ................................37 Gene Expression by Quantitative RT-P CR Analysis .......... ................ ............. ............. .........38 Sample Preparation for Western Blot Analysis ......................................................................38 Western Blotting .............................................................................................................. .......39 Non-heme Iron Assay ........................................................................................................... ..39

PAGE 6

6 Statistical Analysis .......................................................................................................... ........40 4 RESULTS ..................................................................................................................... ..........42 Copper Deficiency Increases Ferroportin Expression in Rat Liver ........................................42 Copper Deficiency Increases Ferroportin Expression in Rat Spleen ......................................43 Ferroportin Expression is not Affected by Copper Deficiency in Mice ................................44 Ferroportin Promoter Analysis ..............................................................................................44 Suppression of MTF-1 Expression Increases Ferroportin mRNA Levels .............................45 5 DISCUSSION .................................................................................................................. .......60 Specific Aim I ............................................................................................................... .........60 Specific Aim II .............................................................................................................. ........63 LIST OF REFERENCES ............................................................................................................ ...66 BIOGRAPHICAL SKETCH .........................................................................................................73

PAGE 7

7 LIST OF TABLES Table page 2-1 Examples of copper (Cu)-related proteins/enzym es and their functions ...........................312-2 Recommended Dietary Allowances for copper .................................................................323-1 Characteristics of various rodent copper deficiency studies analyzed in the current project ....................................................................................................................... .........41 3-2 Primers sequences chosen for the quantification of gene transcripts of interest ...............41 4-1 Analysis of the mouse ferroportin promoter region within 500 bp upstream of the annotated transcription start site ........................................................................................57

PAGE 8

8 LIST OF FIGURES Figure page 2-1 An overview of cellular and systemic copper me tabolism ................................................332-2 Ferroportin regulation by IRE/IRP system. .......................................................................342-3 Mechanism of iron export by ferroportin...........................................................................354-1 Copper deficiency after weaning increases ferroportin expression in liver. ......................464-2 Postweaning copper deficiency (Rat60) increases hepatic ferroportin expression ..........474-3 Perinatal copper deficiency increases ferroportin expression in liver .............................484-4 Copper deficiency after weaning increases ferroportin expression in spleen ..................494-5 Perinatal copper deficiency increases ferroportin expression in spleen ..........................504-6 Copper deficiency does not increase ferroporti n expression in mice. ...............................514-7 The ferroportin promoter region contains a highly conserved metal response element (MRE) consensus sequence .............................................................................................524-8 Supression of MTF-1 expression increases steady-state ferroportin mRNA levels. .........524-9 Sequence alignment of mouse, rat and human ferroportin promoter regions ....................53

PAGE 9

9 Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science EXPRESSION OF THE IRON EXPORTER FERROPORTIN IN RESPONSE TO COPPER DEFICIENCY AND IRON LOADING By Supak Jenkitkasemwong May 2009 Chair: Mitchell D. Knutson Major: Food Science and Human Nutrition Copper and iron are metabolically interrelated. In mammals, copper deficiency impairs normal iron homeostasis and often results in microcytic hypochromic anemia. The anemia likely results from a defect in iron release from the site of absorption/storage. Iron release is mediated by ferroportin, a transmembrane iron-export protein that plays a central role in dietary iron absorption and iron recycling from senescent red blood cells. Ferroportin expression increases with iron loading but decreases in response to hepcidin, the iron-regulatory hormone that binds to ferroportin, causing its internalization and degradation. Hepcidin acts as a circulatory iron sensor, where its expression increases with iron loading and decreases with iron depletion and anemia. A recent study reported that copper deficiency has no effect on ferroportin expression in mice despite hepatic iron loading and anemia (7). More recent studies demonstrated that copperdeficient (CuD) rats, but not mice, have decreased plasma iron concentrations (8, 9), thus indicating species-specific responses in iron/ copper metabolism. We therefore examined ferroportin expression in rats that were made CuD. We found that CuD rats exhibit increased ferroportin protein expression in liver and spleen relative to copper-adequate (CuA) control rats ( P <0.05; n=4/group). Hepatic hepcidin mRNA leve ls were dramatically lower in CuD than CuA rats, despite their hepatic iron accumulation. Western analysis of CuD mouse liver indicated no

PAGE 10

10 change in ferroportin protein expression, similar to the previous study in mice (7). Furthermore, we observed no change in hepatic hepcidin mRNA levels in CuD mice, despite their anemia. The CuD rats display low plasma iron concentrations whereas the CuD mice do not. We conclude that tissue ferroportin levels increase in anemic CuD rats, but not mice, because only rats display low plasma iron concentrations and diminished hepcidin expression. These data suggest that serum iron, rather than anemia per se, is the signal for hepcidin during copper deficiency. In the absence of hepcidin, ferroportin is ma inly regulated posttranscriptionally through the iron-responsive element (IRE)/iron regulatory proteins (IRPs) system. However, ferroportin mRNA levels also increase markedly with iron loading. A recent study showed iron loading increases both ferroportin mRNA and heterogeneous nuclear RNA (hnRNA) levels in mouse J774 macrophages, suggesting transcriptional regulation (14). To investigate the cis -acting elements that may play a role in the transcriptional activation of ferroportin gene by iron, we performed an analysis of ferroportin promoter regions from mouse, rat and human species. We found a perfectly conserved metal response element (MRE), which may serve as a binding site for the metal transcription factor 1 (MTF1). We further demonstrated that Mtf-1 silencing in J774 macrophages significantly increases ferroportin mRNA transcript levels ( P <0.01) both in the presence or absence of iron, suggesting that Mtf-1 suppresses ferroportin gene expression. These data suggest that Mtf-1 may be a transcriptional repressor, and that it may be required for normal transcription process of ferroportin gene.

PAGE 11

11 CHAPTER 1 INTRODUCTION Copper and iron are metabolically interrelated. In mammals, copper deficiency impairs normal iron homeostasis, resulting in microcytic hypochromic amemia, decreased transferrinbound iron in plasma, and iron loading in the liver (1). The exact mech anisms underlying the copper deficiency-induced abnormal iron metabolism are not known. It seems likely that transporters involved in iron metabolism may act, directly or indirectly, in response to copper status. One possibility relates to a defect in iron release from smal l intestine, liver, and macrophage stores into the circulation (1). Ferroportin is a transmembrane iron-export protein that plays a central role in dietary iron absorption and iron recycling from senescent red blood cells (2-4). Ferroportin expression increases with iron loading but decreases in response to hepcidin, the iron-regulatory hormone that binds to ferroportin, causing its internalization and degradation (5). Hepcidin acts as a circulatory iron sensor, increasing with iron loading and decreasing in iron deficiency (6). Recently, ferroportin expression in response to copper deficiency was investigated in mice (7). It was found that ferroportin levels were not altered in copper-deficient (CuD) mice, despite hepatic iron loading and iron-deficiency anemia. More recent studies have shown that CuD rats, but not mice, have decreased plasma iron concentrations (8, 9). These data indicate species-specific responses in iron/copper metabolism. Because of the difference in plasma iron levels between mice and rats, it is possible that ferroportin, the iron exporter that supplies iron to the circulation, may respond differently between these two species. Therefore, the present study aimed to determine the effects of copper deficiency on ferroportin expression in rats. We measured steady-state levels of ferroportin mRNA and protein in liver and spleen of CuD and copper-adequate (CuA) rats.

PAGE 12

12 Ferroportin is regulated primarily by systemic hepcidin. However, in the absence of hepcidin, ferroportin is regulated mainly by iron regulatory proteins (IRPs), cytosolic proteins that bind to IREs on ferroportin mRNAs. Ferroportin mRNA contains an IRE in its 5’ untranslated region (5’UTR) (10). Under low cellular iron concentrations, the cytosolic IRPs bind to the 5’IRE stem loop structure in ferroportin n mRNA, preventing it from being translated. Once cellular iron levels are elevated, IRPs are either degraded or fail to bind IREs, resulting in freely transl ated ferroportin mRNA. Cell culture studies indicate that ferroportin transcript levels fluctuate significantly with cellular iron status, increasing in iron loading and decreasing upon iron deficiency (11-13). A recent study provides strong evidence for transcriptional control of ferroportin, at least in macrophages (14). Using heterogeneous nuclear RNA (hnRNA) as an indirect measure for ferroportin transcriptiona l activity, Aydemir et al (14) demonstrated that iron loading in mouse J774 macrophages increases both ferroportin hnR NA and mRNA transcript abundance. The irondependent increase in ferroportin mRNA and hnRNA levels was abrogated by the transcriptional inhibitor Actinomycin D, indicating that iron lo ading does not stabilize ferroportin transcripts. However, the transcription factors that underlie the ferroportin transcrip tional control by iron have not been identified. Therefore, the present study analyzed the promoter region 2 kb upstream of the ferroportin genes of mouse, rat and human in an effort to find cis -acting elements that may play a role in the ferrop ortin transcriptional activation by iron.

PAGE 13

13 CHAPTER 2 LITERATURE REVIEW Introduction to Copper Copper is a trace element essential to all livi ng organisms. As copper is able to switch between two transition states, oxidized cupric ion (Cu2+) and reduced cuprous ion (Cu1+), it can serve as an important cofactor in a number of biological single-electron transfer reactions. In physiological settings, copper is bound to specific amino acid residues of many cuproproteins (1). However, copper can become potentially toxic when in excess. Excessive copper can lead to the presence of free cuprous ions that readily react with hydrogen peroxide, forming the deleterious hydroxyl radical chemistry which can damage DNA and other cellular biomolecules (15). As a result, whole body copper homeostasis is tightly to obtain adeq uate but not excessive amount of this transition metal. In mammals, copper serves as a catalytic cofactor for numerous enzymes (cuproenzymes) that are involved in fundamental processes including energy production, cellular antioxidant defense, iron mobilization, and neurotransmitter synthesis. In addition, copper is a component of proteins associated with copper transport and cellular trafficking (copper chaperones) (1). Table 2-1 lists the main copper-dependent enzymes and proteins, and other protein involved in copper metabolism along with their biological functions. Copper Homeostasis Copper Absorption Foods contribute virtually all the copper consumed (1). Most copper in foods from plant and animal origins are bound to specific protein residues, particularly by sulfur-containing amino acids such as histidine. Ingested food and digestive secretory fluids including saliva, pancreatic juices, and bile also contribute to the copper poo l present in the intestinal lumen. In mammals,

PAGE 14

14 the absorption of copper takes place mostly (or exclusively) in the small intestine where copper atoms are dissociated from the food component after gastric digestion. In adult humans, about 0.5-1 mg of copper is absorbed daily. Copper transport across the brush border membrane can occur through both passive diffusion and a saturabl e carrier-mediated process (1). In the latter, it has been proposed that the saturable pathway probably involves a specific high-affinity cuprous ion transporter, CTR1, or non-specific divalent metal transporters located on the brush border membrane. CTR1 is a homotrimeric plasma membrane protein that was first discovered in yeast Saccharomyces cerevisiae and later characterized in mammals (16, 17). The human form of CTR1 (hCTR1) was identified by functional complementation of the respiratory defect in yeast cells defective in copper transport due to inactivation of CTR1 gene (17). hCTR1 mediates the monovalent copper (Cu1+) uptake in an ATP-independent manner with high specificity and affinity. The role of CTR1 in the apical absorption of copper was confirmed by using conditional knockout mouse lacking CTR1 in intestinal epithelial cells (18). The homozygous knockout mice exhibited severe growth and peripheral copper absorption abnormalities and neonatal lethality. Although heterozygous knockout mi ce had no apparent defects in growth or development, they displayed tissue specific reduction in copper accumulation and copperdependent enzyme activity in brain and spleen. Ho wever, copper absorption into the intestinal epithelial cells (IEC) was not inhibited in intestine-specific Ctr1-/-. Instread, copper accumulated in the IEC to levels eight to ten times that of the wild-type mice. Moreover, copper trafficking to the basolateral membrane for export into portal circulation did not occur (18). Although it is not known why copper loads in the IEC, these data show that CTR1 is essential for the transport of copper into the portal blood system. CTR1 is also essential for life since the CTR1 null mutation is embryonically lethal (19). CTR1 pr imarily mediates the transport of Cu1+. As the major form

PAGE 15

15 of dietary copper is the divalent cupric ion (Cu2+), it is necessary that copper must be reduced prior to apical absorption via CTR1. How the reduction process is carried out in the intestinal lumen is not currently understood. Recently, the six transmembrane endothelial antigen of the prostate (STEAP) proteins, a family of metalloredu ctases have been identified. Steap proteins are localized to both the plasma membrane and intracellular membranes (i.e. endosomes), suggesting the possibility that they may function in concert with hCTR1 for Cu1+ transport across membranes (20, 21). Alternatively, the duoden al cytochrome b (Dcytb) ferrireductase, which localizes to the apical membrane, ma y be involved in CTR1-mediated Cu1+ uptake (22). The other potential candidate for apical copper absorption is divalent metal transporter 1 (DMT1). DMT1 is known to play a central role in iron transport across the brush border membrane of the intestinal enterocytes (23, 24). Cell culture studies reveal that DMT1 can also transport other divalent cations including Mn2+, Cu2+, Co2+, Ni2+, and Pb2+ (23). Recent studies in Caco-2 cells, a colonic adenocarcinoma cell line, suggest that intestinal cells can take up copper partially through DMT1 (25, 26). Transfection with antisense oligonucleotide to DMT1 transcripts to decrease DMT1 protein expression in Caco-2 cells has been shown to result in a significant reduction in both iron and copper transport (26). In the same study, the cells incorporated considerable amounts of copper as Cu1+, whereas Cu2+ transport was about 10-fold lower, thus indicating that the preferred substrate for DMT1 is actually not Cu2+ but Cu1+. Moreover, the reduced forms of these two metals (Cu1+ and Fe2+) can compete for their apical uptake (26). These data suggest that DMT1 serves as a potential transporter for intestinal copper absorption as well.

PAGE 16

16 Copper Transport and Cellular Uptake Once inside the enterocyte, copper is bound by chaperones that deliver copper to several cuproenzymes, copper binding proteins, or a copper export protein ATP7A. Around 80% of newly absorbed copper remains in the cytosol bound chiefly to metallothioneins, a major copper storage protein (1). ATP7A, also known as Menkes protein, is a membrane-associated Cu1+transporting P-type ATPase found in all tiss ues except in the liver (27). ATP7A is normally localized to the cellular secretory compartment trans-Golgi network. Under basal copper concentrations, ATP7A pumps copper into the Go lgi apparatus for incorporation into copperbinding proteins. When copper levels are elevated, ATP7A traffics to the basolateral membrane of the enterocyte where it actively exports copper into the portal circulation (28). Mutations in the gene encoding for ATP7A result in Menkes disease, an X-linked recessive disorder characterized by copper hyperaccumulation in the enterocytes, and severe systemic copper deficiency due to the functional defect in copper exporter ATP7A (29). The pathophysiology of Menkes disease manifests with abno rmal hair structure, connective tissue abnormalities, anemia, mental retardation, and severe neurodegeneration which are all symptoms attributed to the dysfunction of copper-dependent enzymes (30, 31). After release into the portal blood stream by intestinal cells, copper is mainly transported to the liver, either for storage, mobilization into peripheral circulation, or excretion into bile. Copper is delivered to the hepatic organ in association with its several carrier proteins, predominantly albumin and transcuprein, in the portal blood and general circulation (32, 33). Once inside the hepatocyte, copper is normally pumped into the trans-Golgi network by ATP7B copper transporter for incorpora tion into apo-ceruloplasmin prior to secretion into the peripheral blood system. ATP7B, also known as Wilson protein, has sequence homology and functional

PAGE 17

17 similarity to ATP7A, but is abundantly expresse d in the kidney, brain and especially liver (34), accentuating its role in the trans port of copper from the liver to other peripheral tissues. Genetic defects in the ATP7B gene lead to Wilson’s disease, an autosomal recessive disorder of copper metabolism characterized by severe copper loading in the liver, brain and kidney, which finally result in liver cirrhosis, and neuropsychologic al abnormalities (35). The copper loading in the liver is due to the inability in copper mobilization through incor poration into ceruloplasmin, and copper excretion into the biliary canaliculi as a result of the impaired function of ATP7B. Once copper is pumped into the lumen of the secretory compartment of the Golgi apparatus by ATP7A or ATP7B, copper is incorporated into copper-binding proteins, primarily ceruloplasmin before release into plasma. Ceruloplasmin (Cp) is a multicopper oxidase containing 6 atoms of copper in its structure. It binds up to 95% of circulating copper and is believed to function as a copper transporter deli vering the metal to tissues where it is needed (36). However, the role of the Cp in copper transport is not clear because the Cp knockout mouse exhibit normal copper metabolism, indicating that Cp is not required for copper transport in the circulation (37). It is possible that other copper carrier proteins including albumin and transcuprein can efficiently transport copper to the periphery in the absence of Cp. Nevertheless, the exact role of Cp in copper homeostasis yet ha s to be elucidated. The function of Cp in iron homeostasis, on the contrary, is better understood. Cp contains a ferroxidase activity and is responsible for the oxidation of ferrous iron (Fe2+) to ferric iron (Fe3+), which is loaded onto transferrin and circulated throughout the body (10, 38). Mutations in the Cp gene result in a rare autosomal recessive iron overload disorder aceruloplasminemia (38). Individuals with aceruloplasminemia are characterized by low serum iron, elevated serum ferritin, and excessive iron deposition in liver, brain, and pancreas (38).

PAGE 18

18 Cells of the periphereal tissues take up copper from the circulating copper transfer proteins albumin, transcuprein, and ceruloplas min most likely through the copper transporter CTR1 (39). It remains unclear, however, how copper is liberated from its carrier proteins into Cu1+ prior to transport across the plasma membrane by CTR1. Once inside the cytosol, copper becomes bound to their chaperones such as Atox1, CCS, and Cox17, which shuttle the metal to various target proteins located in different intracellular compartments for storage and utilization (1, 39). Atox1 is a cytosolic copper chaperone that carries copper from CTR1 to ATP7A and ATP7B. The copper chaperone for superoxide dismutase, referred to as CCS, transports copper to the enzyme Cu,Zn-superoxide distmutase (SOD ), which functions to protect the cell from free radical damage. Cox17 is essential in the assembly of mitochondrial cytochrome c oxidase (CCO). The excess intracellular copper is stored in metallothioneins with high affinity (1). Figure 2-1 illustrates an overview of cellular and systemic copper metabolism. Copper Excretion Copper homeostasis is regulated primarily through excretion. Hepatocytes of the liver play a central role in copper removal by transferring excess copper into the bile. During copper loading, ATP7B translocates to the biliary canalicular membrane and transports surplus copper into the biliary fluid, which is further secreted back into the intestinal lumen and removed from the body via feces (1). Even though it is known th at intestinal secretions including bile are efficiently reabsorbable, biliary copper appears to be unique in the way that makes it incapable of reabsorption by the gut (1). Other body fluids in cluding gastrointestinal secretions, saliva, and urine along with hair, nails and sloughed epithelial cells also contribute, but insignificantly, to copper losses from the body.

PAGE 19

19 Copper Intake and Requirement Shellfish, nuts, legumes, organ meats, wheat bran cereals, whole grains, and cocoa products are rich sources of copper (1). It is no t surprising that vegetarian diets provide generous amount of copper because plant foods are generally good sources of this trace mineral. Although copper appears to be absorbed less efficiently from vegetarian diets, more total copper can be absorbed because of the greater copper content of a vegetarian diet, compared with a nonvegetarian diet (40). Poor sources of copper are cow’s milk and dairy products, chicken, and fish as well as fruits and vegetables other than those not listed above. The current Recommended Daily Allowance (RDA) for copper for both men and women is set at 0.9 mg/day, based on the Dietary Reference Intake (DRI) established in 2001 (41). Pregnant and lactating women are recommende d to consume an additional 0.1 and 0.4 mg copper/day, respectively. Dail y intake recommendations for children vary with age. The adequate intake (AI) for infants from 0 to 6 months of age is 0.2 mg/day. For infants from 7 through 12 months, the AI is calculated at around 0.22 mg/day. Table 2-2 shows the recommended dietary allowances for copper for hu mans (41). Too much copper can be toxic and cause a variety of symptoms including diarrhea, nausea, hemolytic anemia, kidney and liver diseases, and neurological abnormalities. The Tole rable Upper Limit (UL) for copper for adult humans is 10 mg daily, based on the no reported signs of liver damage associated with intake. Copper Imbalance: Deficiency and Overload Improper copper status can result in copper deficiency or overload. However, these conditions are uncommon because the human body can efficiently take up copper from various food sources and excretes it when in excess amounts. Although copper status is undoubtedly influenced by dietary copper bioavailability, the imbalance of this trace mineral usually only

PAGE 20

20 becomes a problem in people with genetic defects in copper-related genes, malabsorption syndromes or with liver diseases (e.g. hepatitis, alcoholic liver cirrhosis), all of which impair copper metabolism. Symptoms of copper deficiency in humans manifest as hypochromic anemia, neutropenia, skeletal defects, cardiac enlargement, altered pigmentation, reproductive failure and functional abnormalities in the immune system (1 62, 69). Copper defici ency in human adults usually only occurs in conditions that affect copper metabolism or uptake such as Menkes disease and chronic gastrointestinal diseases. Consumption of high amounts of dietary iron or zinc over a long period of time has been shown to inhibit copper absorption and leads to copper deficiency (69). Infants fed with cow’s milk are also at high risk of developing copper deficiency as cow’s milk often contains less copper than human milk (69). Pregnant and lactating females, and the elderly are at high risk of becoming copper deficient. Copper overload is much less common than copper deficiency. Copper overload often results from high copper intake, usually from oversupplementation, or impaired copper excretion due to renal problems or Wilson’s disease. Clinical symptoms of copper toxicity include severe anemia, nausea, vomiting, abdominal pain, diarrhea, and hepatic copper accumulation (1, 63). Treatment for copper toxicity is often through zinc or iron supplementation, which has been shown to be effective. Effect of Copper Deficiency on Iron Metabolism Copper and iron are metabolically linked. In mammals, copper deficiency impairs normal iron homeostasis, resulting in microcytic hypochromic amemia, decreased transferrin-bound iron in plasma, and pathophysiology of iron loading in key tissues such as liver (1, 57). The exact mechanisms underlying such circumstance are not known. However, it is probably due to a

PAGE 21

21 defect in iron release from small intestine, liver, and macrophage stores into the circulation. The multicopper ferroxidases, ceruloplasmin and hephaestin are essential in assisting cellular iron export in concert with the iron exporter ferroporti n (36, 42). Both of the ferroxidases catalyze the oxidation of Fe2+ to Fe3+, making iron available for binding to transferrin, the protein that carries iron in the circulation (10). Therefore, one possible hypothesis that may contribute to impaired iron metabolism is the reduction in ferroxidase activity of the enzymes during copper deprivation. Consistent with this hypothes is, ceruloplasmin knockout mice display iron deposition in the liver and RES macrophages (37, 43). Similarly, copper-deficient rats and mice developed signs of systemic iron insufficiency with marked decreases in multicopper ferroxidase activity and protein levels (8, 42, 43). However, the ferroxidase theory cannot fully explain the result of copper deficiency in impaired iron metabolism, because not all experimental animals develop anemia in response to copper deple tion. Indeed, ceruloplasmin knockout mice are not anemic and have normal plasma iron levels (44, 45). Likewise, some patients with aceruloplasminemia characterized by loss-of-function mutations in the ceruloplasmin gene have only mild iron-deficiency anemia (38). It is also noteworthy that the mechanisms for copper deficiency-induced perturbations in iron homeostasis appear to be speciesand agespecific. One study demonstrated that perinatal copper defi ciency in rats and mice is associated with severe anemia, but only rats developed low plasma and brain iron concentrations (8). Another study in a different age and strain of mice reported conflicting results in that copper deficiency leads to anemia but decreases plasma iron levels (42). Other proposed mechanisms that may be responsible for anemia as a result of copper deficiency include impaired heme production, reduction in the copper-dependent mitochondrial enzyme cytochrome c oxidase activity, and decreased antioxidant capability in the blood due to low plasma ceruloplasmin concentrations

PAGE 22

22 (1). The impaired heme production during low copper conditions is postulated to result from the deficient iron delivery to the mitochondria, whereas the observed reduction in cytochrome c oxidase activity, resulting in a net decrease in energy production, may affect the rate of hemoglobin synthesis by erythrocytes. Lower plasma concentrations of ceruloplasmin during copper deficiency may shorten the life span of erythrocytes as they become more vulnerable to oxidative damage (1). Further research will be needed to better explain the mechanisms by which copper deprivation results in anemia. One common characteristic often found in copper-deficient animals is iron loading in liver and macrophages of the RES (7-9, 42, 43). How this happens is not completely understood. It is likely that transporters involved in iron metabolism may act, directly or indirectly, in response to copper status. A recent study investigated ferroportin expression in response to copper deficiency in mice (7). Although the copper-deficient mice exhibited iron deficiency anemia with liver iron loadin g, ferroportin protein expression in the liver was not changed compared to controls. The study also reported no change in ferroportin mRNA levels in other tissues including liver, spleen, kidney and duodenum. Chung et al (7) concluded that tissue copper deficiency does not alter ferroportin expression but that copper adequacy may be required for appropriate regulation of ferroportin by iron status. The response of ferroportin to copper deficiency in rats has not been reported. Since the outcomes for copper insufficiency appear to be species-specific, it seems possible that the iron exporter may respond differently in the rat than in the mouse. We, therefore, investigated the effect of copper deficiency on the expression of ferroportin in rats.

PAGE 23

23 Ferroportin: The Only Known Iron Exporter in Mammals Discovery and Proposed Function Ferroportin is a member of the solute carrier protein family 40, also referred to as Slc40a1, IREG1 and MTP1 (2-4). The protein has a molecular weight of 62 kDa with 9 or 10 predicted transmembrane domains (2). Ferroportin is so far the only known iron exporter characterized in vertebrates. Ferroportin’s role in iron export was discovered by 3 independent labs. Firstly, zebrafish embryo harboring mutations in a ferroportin otholog displayed a defect in iron transfer from yolk sac to embryo which resulted in severe iron-deficiency anemia. The defect could be rescued by intravenous injection of iron into mutant embryos suggesting that the anemia was caused by inadequate circul ating iron (2). Secondly, by using a Xenopus oocyte expression system, iron loading resulted in a si gnificant increase in iron efflux from oocytes expressing ferroportin compared to control oocyt es not expressing the protein (2, 3). Lastly, overexpression of ferroportin in cultured ma mmalian HEK293T cells re sulted in intracellular iron depletion (4). The role of ferroportin in iron metabolism was further accentuated in a ferroportin knockout study. The ferroportin-null mice exhibited embryonic lethality, suggesting that the protein is crucial in an early stage of embryonic development (47). Northern blot analysis of human and mouse tissues demonstrates that the highest levels of ferroportin expression are in liver, spleen, kidney, duodenum and placenta (2-4). In duodenum, ferroportin is highly expressed in the basolateral surface of the enterocytes. As most intestinal iron absorption occurs in the proximal duodenum, the observed high ferroportin expression here seems to be physiologically appropriate. Anothe r site for high ferroportin expression is in macrophages of the liver (Kupffer cells), spleen and bone marrow, collectively called the reitculoendothelial system. Reticuloendothelial macrophages ingest and degrade senescent red

PAGE 24

24 blood cells and recycle the iron in hemoglobin (48). In the placenta, ferroportin is primarily expressed in a basal location within the syncytiotr ophoblasts serving as a site for iron transfer from the mother to the embryo (2). Consistent with its proposed role in iron export, ferroportindeficient animals accumulate iron in enterocytes, macrophages and hepatocytes (47). All these findings support the critical role of ferroportin in iron transport in mammals. Although the mechanisms for iron uptake may vary in the intestinal enterocytes, RES macrophages and placental trophoblasts, these cell types seem to use the same iron export protein (i.e., ferroportin). Ferroportin Regulation Hormonal regulation of ferroportin by hepcidin Cellular iron efflux is modulated by a number of stimuli including changes in body iron stores, hypoxia, erythropoietic activity, and inflammation. A small circulating peptide hormone, hepcidin, appears to be a key regulator of iron export from the small intestine and macrophages into the circulation, through modulation of ferroportin protein levels (6). Hepcidin, also known as LEAP-1 (liver-expressed antimicrobial peptide), was recently discovered by two independent labs as an isolated peptide present in human urine and plasma (49, 50). Its name “hepcidin” was derived from the term “hep-”, which indicates the site of synthesis in the liver, and “-cidin” according to its antibacterial properties in vitro. Human hepcidin is predominantly produced by hepatocytes in the form of 84-amino acid prepropeptide and released into the plasma as a smaller 25-amino acid peptide (6). Hepcidin genes have also been identified in other vertebrates including mice, rats, pigs and some species of fish (6). The essential role of hepcidin in iron metabolism was established in mouse models lacking hepcidin or having excessive hepcidin production. Mice lacking hepcidin develop iron overload with massive iron deposition in the

PAGE 25

25 liver and pancreas, as well as iron depletion in macrophages of the spleen (51). Transgenic mice that overexpress hepcidin develop severe iron-deficiency anemia, suggesting that hepcidin inhibits iron absorption/transport (52). The essential role of hepcidin in iron homeostasis has further been confirmed in humans. A number of patients with juvenile hemochromatosis, the most severe type of hereditary iron overload di seases, were found to carry mutations in hepcidin gene (53). Hepcidin expression can be regulated by various stimuli such as cellular and systemic iron status, anemia, hypoxia, inflammation, and erythropoietic rate. As in the case of regulation by iron status, iron loading by oral or parenteral feedings increases hepcidin production by the liver (6). The increase in circulating hepcidin would inhibit intestinal iron absorption and iron efflux from stores. However, the mechanisms fo r iron regulation of hepc idin expression are still unclear. Hepcidin expression is also homeostatically regulated by anemia (6). During anemia, oxygen delivery is insufficient, which in turn results in the increased requirement for erythropoiesis. In response to the increase in er ythropoietic rate, the liver downregulates hepcidin production to make iron available for red cell sy nthesis, thereby increasing ferroportin-mediated iron efflux from the sites of absorption and storage. Hepcidin regulates iron metabolism by binding to ferroportin that localizes to the plasma membrane, causing the complex to be internalized and degraded in lysoso mes (5). The loss of ferroportin from the cell membrane consequent ly ablates cellular iron export (5, 56). This interaction appears to be sufficient to explain the regulation of iron absorption in the duodenum, as well as iron release from macrophages and hepatocytes. When iron stores are adequate or high, the liver synthesizes hepcidin which circulates to the small intestine. By acting at the basolateral membrane of the duodenal enterocytes, downregulation of ferroportin by hepcidin

PAGE 26

26 blocks the transfer of dietary iron into the plasma. When iron stores are low, the liver downregulates hepcidin production, thus allowing ferroportin to export iron into the portal circulation. Likewise, in RES macrophages where iron from senescent erythrocytes is recycled, binding of hepcidin to ferroportin results in iron trapping inside these cells (6). The mechanistic role of hepcidin in RES macrophages may be beneficial during inflammatory states when hepcidin expression appears to be elevated. As a result, plasma iron is maintained within a low concentration range, thereby preventing microbial growth in the body. Regulation of ferroportin by IRE/IRP system and cellular iron status In addition to hormonal regulation by hepcidin, ferroportin has also been shown to be regulated posttranscriptionally through the IRE/IRP system. Iron regulatory elements (IREs) are conserved iron regulated protein (IRP) binding sites found in a number of mRNA products of genes involved in iron metabolism including the iron importer DMT1, iron-storage protein ferritin, and the receptor for iron circulatory protein transferrin receptor 1 (TfR1) (54). The ferroportin transcript contains an IRE in its 5’ untran slated region (5’UTR) (54). In the absence of hepcidin, cytoplasmic iron levels appear to be a major determinant in controlling ferroportin expression by catalyzing the interaction be tween IRE and IRPs. Under low cellular iron concentrations, the cytosolic IRPs bind to the 5 ’IRE stem loop in ferroportin mRNA, preventing it from being translated. In contrast, when cellular iron levels are high, IRPs are either degraded or fail to bind to the IRE, resulting in freely translated ferroportin mRNA. Figure 2-2 illustrates the regulation of ferroportin by IRE/IRP system. Furthermore, cell culture studies have show n that ferroportin transcript level fluctuates significantly with cellular iron status, increasing in iron loading and decreasing upon iron deficiency (11, 13, 55). In vivo, iron levels in RES macrophages are normally high, because

PAGE 27

27 these cells regularly ingest senescent erythrocyt es. Under these high iron conditions, IRPs are degraded and no longer exert posttranscriptio nal control through the IRE/IRP interaction. A more important determinant of macrophage ferroportin expression in this state, therefore, would be the pool of ferroportin mRNA available for translation. Although a number of studies show that ferroportin mRNA levels increase with iron lo ading, it is unknown if this change is due to decreased ferroportin mRNA degradation or to increased ferroportin transcription. A recent study used heterogeneous nuclear RNA (hnRNA) as an indirect measure for ferroportin transcriptional activity (14). Upon iron loading, murine J774 macrophages displayed a marked increase in both ferroportin mRNA and hnRNA levels, suggesting th at the iron exporter is regulated at the transcription level. However, the transcription factors that promote ferroportin gene expression by iron remain to be identified. The current project proposes to identify transcription factor(s) involved in the transcriptio nal activation of ferroportin by iron. Mechanism of Cellular Iron Export Ferroportin transports Fe2+ across the plasma membrane. The major circulating form of iron is, however, Fe3+ which is tightly bound to the plasma protein transferrin. Thus, the complete transfer of iron from intracellular to extracellular fluid presumably requires not only the act of ferroportin, but also another player that oxidizes ferrous to ferric ion that is readily loaded onto transferrin. Multicopper oxidases, which ca talyze the oxidation of Fe2+ to Fe3+, have essential roles in iron metabolism in all eukaryotes. In mammals, this oxidation step is catalyzed by ferroxidase enzymes known as ceruloplasmin and hephaestin (10, 36, 42). As mentioned earlier, ceruloplasmin is a multicopper oxidase containing 6 atoms of copper in its structure (36). It is primarily synthesized by hepatocytes of the liver in the form of apoceruloplasmin, and secreted into plasma after copper is incorporated. The glycoprotein

PAGE 28

28 facilitates iron release from storage and recycling pools by oxidizing Fe2+ to Fe3+, enabling delivery of iron to developing erythrocytes and other tissues (36). Hephaestin is a transmembrane copper-dependent protein predicted to bind 6 atoms of copper (58). It possesses a similar ferroxidase function to ceruloplasmin. However, its expression appears to be tissue-specific. Hephaestin is highly expressed in the small intestine, suggesting the possible role of the protein in transporting dietary iron in concert with ferroportin across the basolateral membrane of enterocytes to the portal circulation (58, 59). Both enzymes strictly require copper as a cofactor to exert their ferroxidase activity Therefore, copper deficiency likely affects the normal function of these enzymes, leading to perturbations in iron homeostasis. Figure 2-3 shows the mechanism of cellular iron export in mammals. Current Biomarkers for Copper Status Copper deficiency and excess can be detrimental. It is therefore important to have effective copper status indicators. These indica tors will also allow the early detection of abnormal copper status in populations who are at risk such as infants, pregnant or lactating females, individuals with metabolic syndromes or genetic predispositions before any adverse outcome takes place. There is currently no gold standard method to assess copper status in mammals. In many laboratories, serum or plasma copper and ceruloplasmin concentrations are usually selected as biomarkers for copper status (60, 61). Both ceruloplasmin ferroxidase enzyme activity and immunoreactive protein can be used to estimate its levels in plasma (60). Copper deficiency often results in low plasma and liver copper concentrations and decreased plasma ceruloplasmin enzymatic activity. However, during normal circ umstances these indicators appear to be suitable only in determining severe long-term copper deficiency as copper homeostasis is tightly

PAGE 29

29 controlled (62). Moreover, they can fluctuate with age, sex, and other noncopper-relevant factors, which may mask the true copper status of an individual (63). Infection, inflammation, pregnancy, estrogen status, and some cancers increase serum copper and ceruloplasmin levels (61, 63). Some diseases such as Wilson disease and nephrosis exhibit a reduction in copper and ceruloplasmin concentrations in the blood (64). The measurement of other cuproenzymes is increasingly being used to assess copper status in animals and humans. For example, erythrocyte copper-zinc superoxide dismutase (SOD) actfivity was often found to decrease in copper deficiency and increase upon copper repletion (61). SOD does not seem to be affected by age, gender, and hormone status (63), and may serve as a better copper biomarker over plasma copper and ceruloplasmin levels. Nevertheless, the use of SOD has not been proven reliable or sensitive enough to monitor copper status, in part due to the lack of a standard assay and the unestablished reference ranges for laboratory and clinical analysis. Most recently, the protein known as copper chaperone for SOD (CCS) has been studied for its potential possibility to become a good biomarker for copper. CCS is a copper chaperone that shuttles copper to SOD for incorporation into its structure (1). A number of rodent studies have documented changes in CCS expression levels in response to various copper concentrations (7, 65-67). In contrast to ceruloplasmin and SOD, CCS levels vary inversely with copper status. In rats fed with diet containing either marginal or deficient copper amounts, liver and erythrocyte CCS protein expression was found to increase mark ely (65-67), indicating that CCS is highly responsive to low copper status. Mild copper deficiency induced by moderately high zinc intake in rats also resulted in increased CCS protein expression in the liver, erythrocytes and white blood cells (68). Collectively, these data sugges t that CCS is a sensitive indicator of copper

PAGE 30

30 deficiency. For assessing copper overload, the measurement of liver copper concentrations is the current standard method. Specific Aims Aim I: Investigate the effect of copper deficiency on ferroportin expression in rats. A previous study in mice has shown that copper deficiency does not alter ferroportin expression despite their anemia and a 2-3 fold elevation in liver iron concentrations (7). Since more recent studies revealed differences in iron metabolism between CuD mice and rats, we propose to study the effect of copper deficiency on ferroportin expression in rats. Liver and spleen tissue samples from various rat studies will be measured fo r ferroportin protein and mRNA expression in response to copper deprivation. Aim II: Identify transcription factors involved in the transcriptional activation of ferroportin by iron. Ferroportin is an iron export protein that plays a key role in iron metabolism. We have recently determined that iron induces the transcri ptional activity of the ferroportin gene (14). In effort to identify cis -acting elements that may play a role in the transcriptional activation of ferroportin by iron, the putative ferroportin promoter region of the mouse, rat and human genes will be analyzed. Potential transcription factor bi nding sites found in this region will be selected as candidates to design specific siRNAs to knock down the target mRNA coding for transcription factors that bind to these site s. After specific knockdown, ferropor tin transcript levels will be measured.

PAGE 31

31 Table 2-1. Examples of copper(Cu)-related proteins/enzymes and their functions Protein/Enzyme Function Albumin Plasma protein that carries Cu to the liver Atox1 Cu chaperone that delivers Cu to ATP7A and ATP7B Cu1+ transporters ATP7A Cu1+-transporting P-type ATPase expressed in most tissues except liver ATP7B Cu1+-transporting P-type ATPase expressed in the liver Ceruloplasmin Plasma multi-Cu ferroxida se responsible for the oxidation of Fe2+ to Fe3+ for loading onto transferrin CCS Cu chaperone that shuttles copper to Cu/Zn superoxide dismutase (SOD1) Cox17 Cu chaperone that transfers Cu to Sco1 and Cox11 for cytochrome c oxidase in mitochondria Ctr1 High-affinity Cu1+ transporter involved in Cu apical absorption and cellular uptake Cytochrome c oxidase Terminal Cu-dependent enzyme in the electron transport chain that catalyzes the production of water from molecular oxygen Dopamine -hydroxylase Cuproenzyme that converts dopamine to norepinephrine Hephaestin Transmembrane multi-Cu ferroxidase localized to the basolateral surface of enterocytes, involved in iron efflux from enterocytes Lysyl oxidase Cuproenzyme that catalyzes formation of aldehydes from lysine in collagen and elastin precursors for connective tissue maturation Metallothionein Metal-binding/Cu storage protein Peptidylglycine-amidating mono-oxygenase (PAM) Cuproenzyme that catalyzes conversion of peptidylglycine substrates into -amidated products necessary for neuropeptide maturation Steap proteins Metallore ductases involved in Fe3+ and Cu2+ reduction Transcuprein High-affinity Cu2+ transport protein in the plasma, carries Cu to the liver Tyrosinase Cuproenzyme responsible for melanin synthesis

PAGE 32

32 Table 2-2. Recommended dietary allowances for copper (mg/day) (ref) Age RDA (mg/d) Infants <6 months 0.2 (30 g/kg) 6-12 months 0.2-0.3 (24 g/kg) Children 1-3 years 0.34 4-8 years 0.44 9-13 years 0.7 14-18 years 0.89 Adult 19+ years 0.9 Pregnant women 1 Lactating women 1.3

PAGE 33

33 Figure 2-1. An overview of cellular and systemic copper me tabolism. 1). Apical copper (Cu) uptake. CTR1 mediates Cu1+, while DMT1 may pa rtially take up Cu2+ transport across the brush border membra ne of the enterocyte. Coppe r is incorpor ated into metallothionein (MT) or bound to other copper chaperones. The copper chaperone Atox1 carries copp er to ATP7A for secretory pathways via the transGolgi network or for release into the portal circulation, where albumin and transcuprein transfer copper to the liver and peripheral tissues. 2) Copper import, intracellular trafficking and ex cretion in the liver. Copper is taken up into the hepatocyte through CTR1 and trafficked to Cu-Zn SOD by CC S, or to ATP7B for incorporation into ceruloplasmin (holo-Cp ) and for biliary excretion. 3) Copper transport in the pe riphery. Copper import occurs mainly thr ough CTR1. Once inside the cytosol, c opper chaperones tr ansfer copper to their target proteins (i.e. Atox1 transfers copp er to ATP7A for secretory pa thways by the Golgi, Cox17 transfers copper to the mitochondri a for further insertion in to CCO, CCS transfers copper to Cu-Z n SOD). Albumin Transcuprein

PAGE 34

34 Figure 2-2. Ferroportin regu lation by IRE/IR P system. Under low cellular iron concentrations, th e cytosolic IRP binds to 5’IRE stem loop in ferroportin mRNA, preventing it from being translated. When cellular iron levels are high, IRP is either degraded or fail to bi nd to the IRE, resulting in freely translated ferroportin mRNA. Ferro p ortin Made No Ferro p ortin Made Ferroportin mRNA

PAGE 35

35 Figure 2-3. Machanism of iron export by ferropor tin. 1) Ferroportin me diates cellular iron (Fe) discharge in concert with the cuproenzyme hephaestin. Hephaestin oxidizes Fe2+ to Fe 3+, which is loaded onto transferrin, the iron circulating protein. 2) Hepatocyte produces hepcidin during iron loading/anemia. Hepcidin binds to ferroportin that lo calizes to the basola teral membrane of en terocyte, macrophage and hepatocyte, resulting in ferroportin internalizat ion and degradation. 3) Ferroportin exports Fe2+ into the circulation in conc ert with ceruloplasmin, which oxidizes Fe2+ to Fe 3+ prior to binding to transferrin.

PAGE 36

36 CHAPTER 3 MATERIALS AND METHODS Study Designs for Specific Aims I and II For specific aim I, rat and mouse tissue samples were kindly provided by Dr. Joseph R. Prohaska (University of Minnesota, Medical School-Duluth). Pregnant Holtzman (Rattus norvegicus) rats and pregnant Hsd:ICR (CD-1) outbred albino mice (Mus musculus) were purchased commercially (Harlan Sprgue Dawley, Indianapolis, IN, USA). Rodents were offered a copper-deficient diet (Teklad Laboratories, Madison, WI, USA) similar to the AIN-76A diet but modified by omitting cupric carbonate from the AIN-76A mineral mix (8). This diet contained 0.36 mg copper/kg and 53 mg iron/kg by chemical analysis. Copper-adequate (CuA) rodents were given deionized water with copper sulfate (20mg Cu/L) to drink. Copper-deficient (CuD) rodents drank copper-free deionized wa ter. Two nutritional paradigms of copper limitation were used in these studies: a postweaning and perinatal model. In the postweaning rat model, male rats were given the treatment diet at postnatal day 19 (P19) for 30 days in Rat50 study and P26 for 27 days in Rat60 study. Rats were sacrificed at P49 and P53 in Rat50 and Rat60 study, respectively, and liver and spleen were harvested. In the perinatal rat model (Rat69), dams were given on the treatment diet at embryonic day 7 (E7). At P25, male offsprings were sacrificed and liver and spleen were harvested. In the perinatal mouse model (Mouse21), dams were given on the treatment diet at E17. At P29, male pups were sacrificed and organs were harvested. All animal protocols are referenced in (8). Table 3-1 outlines the various rodent studies analyzed in the current project. Liver and spleen are key tissues in iron metabolism as they play a central role in iron storage and iron recycling from senescent erythrocytes (48). Ferroportin is most abuntdantly expressed in the macrophages of the RES, where iron metabolism is highly active (48). Therefore, in specific aim II, we chose a murine J774

PAGE 37

37 macrophage cell line as a model for our in vitro study of the regulation of ferroportin gene transcription by iron. Cell culture and treatments J774 cells, a murine macrophage cell line, were cultured in alpha-minimum essential medium (Mediatech) supplemented with 10% fetal bovine serum (C ambrex), penicillin, and streptomycin and incubated at 37C in 5% CO2. Cells were incubated in medium supplemented or not with 200 mol/L ferric nitrilotriacetic acid (Fe-NTA) for 24 h. Fe-NTA (molar ratio of 1:4) was prepared as a 20 mmol/L stock from NTA (Sigma-Aldrich) and ferric chloride hexahydrate. Ferroportin gene and promoter analysis DNA sequences within 2-kb upstream of the annotated transcription start site for mouse, rat, and human ferroportin genes were obtained from the Cold Spring Harbor Mammalian Promoter Database (70). Promoter sequences were aligned by using the CLC Sequence Viewer 6.0.2 free software program. These putative promoter regions were analyzed by using Genomatix MatInspector ( http://www.genomatix.de/products/MatInspector/index.html ). Suppression of MRE-binding transcri ption factor-1 (Mtf-1) expression Mtf-1 expression was suppressed by using Mtf-1-targeting siRNA, 5’ to 3’ CGUA140 UUUUCUUUACUCGUAtt (sense) and 5’ to 3’ UACGAGUAAAGAAAA-UACGtc (antisense) (Ambion, Silencer Pre-designed siRNA). Silencer Negative Control siRNA #1 (Ambion) was used as a control. J774 cells were transfected with 100 nmol/L Mtf-1 siRNA or negative control siRNA by using HiPerFect Transfection Reagent (Qiagen) per the manufacturer’s protocol for transfecting macrophage cells. Forty-eight hours af ter transfection, levels of Mtf-1 mRNA were determined by using qRT-PCR.

PAGE 38

38 Gene Expression by Quantitative RT-PCR Analysis Relative abundances of specific RNA were quantified by using quantitative reverse transcriptase PCR (qRT-PCR) analysis. Briefly, total RNA was isolated either from liver and spleen tissues (specific aim I) or cultured J774 cells (specific aim II) by using RNABee (TelTest). Isolated RNA was treated with DNaseI (Turbo DNA-free kit, Ambion) to remove any contaminating genomic DNA. First-strand cDNA was synthesized from the isolated RNA by using either the High-Capacity cDNA Archive kit (Applied Biosystems) or the iScript cDNA synthesis kit (Bio-Rad). QRT-PCR was performed using iQ SYBRGreen Supermix (Bio-Rad) and an Applied Biosystems 7300 real-time PCR system. Quantitation of mRNA was determined by comparison to standard curves generated by four, 10-fold serial dilutions of standard cDNA. Levels of mRNA were normalized to that of 18S rRNA. The primer sequences used to measure specific mRNAs are shown in Table 3-2. Sample Preparation for Western Blot Analysis Total lysates were isolated by dounce homo genization of the tissue samples in ice-cold HEM buffer and protease inhibitor cocktail (Roche). Lysates then were centrifuged at 10,000 x g for 10 min at 4 oC to pellet nuclei and insoluble debris. Fractionation for crude membrane extracts was further done by centri fuging the supernatant at 100,000 x g for 30 min at 4 oC to pellet membranes, which were subsequently suspended in HEM buffer and stored at -80 oC until analysis. Protein concentrations were anal yzed colorimetrically by using either the RC-DC (BioRad) or the BCA (Pierce) Protein Assay Kits.

PAGE 39

39 Western Blotting For ferroportin protein analysis, crude membrane samples were mixed with Laemmli buffer, incubated for 15 min at 37oC, and loaded onto a separate 7.5% SDS/polyacrylamide gel. For CCS and Cp protein expression analyses, total tissue lysates were mixed with Laemmli buffer and boiled for 5 min, and separated electrophoretically on a 15% SDS/polyacrylamide gel. Seperated proteins on the gel were then transferred to nitrocellulose membrane (Optitran; Schleicher & Schuell). Equivalent protein loading and transfer were verified by Ponceau staining. Blots were blocked for 1 h in blocking buffer [BB; 5% nonfat dried milk in Trisbuffered saline, pH 7.4, and 0.01% Tween-20 (TBST)], and incubated overnight at 4 oC in BB either rabbit anti-ferroportin (2.5 g/ 1 mL BB), rabbit anti-CCS (1: 1000; Santa Cruz Biotechnology), mouse anti-Cp (1: 500; BD Transduction Laboratories). Following primary incubation, blots were washed several times with TBST before incubating in BB with a 1:2,000 dilution of peroxidase-conjugated donkey anti-rabbit IgG (Amersham Biosciences) or goat antimouse (Jackson ImmunoResearch) secondary antibody for 40 min. As a control, each blot was stripped and reprobed for scavenger receptor B1 (SR-B1) (1:2000; Novus Biologicals), -tubulin (1:5000; Sigma), or Na+/K+-ATPase 1 (1:2000; Santa Cruz Biotechnology) where appropriate. Cross-reactivity was visualized by using enhanced chemiluminescence (SuperSignal WestPico, Pierce) and x-ray film. Non-heme Iron Assay Tissue non-heme iron concentrations were measured by using the standard method of Torrance and Bothwell (71). A sample of frozen tissue (~50 mg) was weighed and acid-digested in acid solution [3M hydrochloric acid and 10% (w/v) trichloroacetic acid]. After incubating for 20 h at 65oC, an aliquot of the supernatant was mixed with a working chromogen reagent

PAGE 40

40 (chromogen reagent [0.1% (w/v) bathophenanthroline sulfphonate; BPS, 1% (v/v) thioglycolic acid] in iron-free water and satura ted sodium acetate at 1:5:5 ratio). The absorbance (OD) then was read at 535nm. ODs were compared to th ose obtained from a certified iron reference solution (Fisher Scientific). Statistical Analyses Data are expressed as means SEM where indicated. Statistical analyses were performed by using Prism 4.03 (GraphPad) software. Data from specific aim I were analyzed by Student’s unpaired t -test, whereas data from specific aim II were analyzed by one-way ANOVA and Tukey’s post-hoc test. Data shown in the specific aim II are results from a single experiment and are representative of those obtained on three separate occasions. Differences with P < 0.05 were considered significant.

PAGE 41

41 Table 3-1. Characteristics of various rodent copper deficiency studies analyzed in the current project. Study Model Day of Sacrifice N/group Rat50 Postweaning copper deficiency P49 4 Rat60 Postweaning copper deficiency P53 4 Rat69 Perinatal copper deficiency P25 4 Mouse21 Perinatal copper deficiency P29 CuD = 2 CuA = 3 Table 3-2. Primer sequences chosen for the quantification of gene transcripts of interest Gene Forward primers (5' 3') Reverse primers (5' 3') rFpn ccgtgaacttgaatgtgaacaag cggaagggttctgcgatct mFpn ctaccattagaaggattgaccagcta actggagaaccaaatgtcataatctg rHepcidin ggcagaaagcaagactgatgac acaggaataaataatggggcg mHepcidin gcctgagcagcaccacctat ttcttccccgtgcaaagg MTF1 tcgccagggaatgaccttag ggcttaatcgacttgccagaa Metallothionein1 gctgtgcctgatgtgacgaa tgggttggtccgatactatttaca 18S cgaggaattcccagtaagtgc ccatccaatcggtagtagcg

PAGE 42

42 CHAPTER 4 RESULTS Copper Deficiency Increases Ferroportin Expression in Rat Liver A previous study in mice demonstrated no change in ferroportin expression in the liver in copper deficiency, despite anemia and a hepatic iron loading (7). In a subsequent study, both copper-deficient (CuD) rats and mice developed anemia but only rats had lower plasma iron concentrations (8). These data indicate that rat and mouse respond differently to copper deprivation. To investigate the effect of copper deficiency on ferroportin expression in rats, tissue samples from CuD and copper-adequate (CuA) control rats were analyzed (n=4/group) by Western blot analysis of rat liver membrane fractions. Densitometric quantification of immunoreactive band intensities revealed a 5-fold increase ( P <0.02) in ferroportin protein levels in CuD rats compared to CuA controls in a po stweaning model (Rat50) of copper deficiency (Figure 4-1A). To evaluate lane loading in crude membrane fractions, we reprobed the blot for scavenger receptor-B1 (SR-B1), an integral membrane protein. Since ferroportin expression responds to iron status, we measured non-heme ir on concentrations in these samples. CuD rats accumulated 3-fold more hepatic iron when compar ed with CuA rats (Figure 4-1A). To confirm tissue copper status, we measured CCS protein levels, which increase with copper depletion (Figure 4-1B). Since ceruloplasmin responds to copper deficiency, we measured hepatic ceruloplasmin protein levels in Rat50 study. We found that CuD rat liver exhibited markedly lower ceruloplasmin protein levels relative to CuA liver (Figure 4-1C). Increased ferroportin expression in CuD rat liver was associated wi th a 50% increase in ferroportin transcript abundance ( P <0.05), as measured by qRT PCR (Figure 4-1D). Hepatic hepcidin mRNA levels were dramatically lower ( P <0.0001) in CuD rats than in CuA rats despite a doubling of liver iron (Figure 4-1E). An increase in liver ferroportin protein levels in CuD from Rat50 was also

PAGE 43

43 observed in another set of live r samples obtained from a similar study (Rat60) (Figure4-2). Hepatic hepcidin mRNA expression in Rat60 study was also lower ( P <0.05) in the CuD group compared with CuA group (data not shown). Consistent with the observations from Rat50 and Rat60 studies, we observed in a perinatal model (Rat69) a ~2-fold increase ( P <0.03) in liver ferroportin protein levels in CuD rats compared with CuA controls (Figure 4-3A). These CuD animals displayed an ~8-fold increase in iron in the liver compared to CuA co ntrols (Figure 4-3A). CCS protein levels were higher in CuD rats than in CuA rats, which confirmed the copper-deficient status in these rat pups (Figure 4-3B). Liver hepcidin mRNA levels were dramatically lower ( P <0.05) in CuD rats relative to CuA controls (Figure 4-3C). Howeve r, we did not observe a parallel increase in hepatic ferroportin mRNA levels in th is perinatal study (Figure 4-3D). Copper Deficiency Increases Ferroportin Expression in Rat Spleen We also measured spleen ferroportin expres sion levels in response to copper deficiency. The spleen plays a central role in iron metabolism by recycling iron from effete erythrocytes. Accordingly, ferroportin expression is very high in this tissue (48). Our western blot analyses for Rat50 study demonstrated that splenic ferroportin protein levels were ~1.6-fold higher ( P <0.02) in CuD rats than in CuA controls (Figure 4-4A). Non-heme iron concentrations in these tissues did not differ between groups (Figure 4-4A). As the lane loading control SR-B1 appeared to differ between groups, we reprobed the blot with Na+/K+-ATPase 1, another membrane protein that is commonly used as a lane-loading control (Figure 4-4A). The induction in ferroportin protein levels was associated with a 120% increase ( P <0.05) in ferroportin mRNA abundance, as measured by qRT-PCR (Figure 4-4C). Similarly, in the Rat69 study, ferroportin protein levels were elevated by ~ 2 fold ( P <0.05) in CuD rat spleen relative to CuA spleen, although more

PAGE 44

44 variability among animals was noted (Figure 4-5A). Non-heme iron concentrations did not differ between groups (Figure 4-5A). We were unable to measure ferroportin transcript abundance in the remaining spleen samples from Rat69 becaus e the RNA was degraded. Copper depletion was verified by the observed induction of splenic CCS protein levels in CuD rats compared to CuA controls in both studies (Figure 4-4B and 4-5B). Ferroportin Expression is Not Affected by Copper Deficiency in Mice Consistent with a previous study (7), we found that ferroportin levels did not differ between CuD and CuA mouse livers (Figure 4-6A). We further document that ferroportin protein levels are not affected by copper deprivation in the mouse spleen (Figure 4-6B). Hepatic hepcidin transcript abundances were also not decreased in CuD mice compared with CuA controls, as measured by qRT-PCR (Figure 4-6C). Ferroportin Promoter Analysis In effort to identify cis -acting elements that may play a role in the transcriptional activation of ferroportin gene by iron, the putative ferroportin promoter regions of the mouse, rat, and human genes were analyzed. By comparing the 5’ upstream DNA regions within 2 kb from the transcriptional start site (TSS) of ferroportin gene from the different species, we identified a consensus sequence encoding a perfectly conserved putative metal response element (MRE) core sequence (TGCACCC), flanked by a less-well conserved GC-rich region (72) (Figure 4-7). MREs serve as binding sites for MRE-binding transcription factor-1, Mtf-1 (73). Treatment of cells with heavy metals, such as zinc and copper, has been shown to activate Mtf-1, which in turn can increase the transcription of MRE-containing genes such as metallothionein-1 ( Mt1 ) (74).

PAGE 45

45 Suppression of MTF-1 Expression In creases Feroportin mRNA levels To explore the possibility that the transcription factor Mtf-1 plays a role in the transcriptional activation of ferroportin by iron, steady-state levels of ferroportin mRNA were determined after suppressing Mtf-1 expression. Unexpectedly, we found that decreased Mtf-1 expression was associated with increased ferroportin mRNA levels in the presence or absence of iron treatment (Figure 4-8). In three independent experiments, Mtf-1 silencing increased ferroportin mRNA levels by an average of 61 9% in Fe-treated cells and by 110 33% in cells not treated with iron ( P <0.01). To confirm that Mtf-1 suppression diminished Mtf-1 activity, we measured steady state mRNA levels of metalloth ionein-1 (Mt1), a gene that requires Mtf-1 for basal expression (74). We found that Mtf-1 suppression resulted in a 63 16.5% decrease in Mt1 mRNA levels (data not shown).

PAGE 46

Figure 4 4 -1. Coppe r Weste r Liver m gel, th e Fpn p r lane-l o sampl e Liver p then t r the bl o with a n separa t memb r stripp e Total R levels levels comp a r deficienc y r n blot anal m embrane p e n transfer r r imary anti b o ading cont r e were dete r p rotein ext r r ansferred t o o t was prob e n ti-tubuli t ed on a 7. 5 r ane, and p r e d and repr o R NA was i s were quant i of 18S rR N a red to cop p y after wea n ysis of me m p roteins (1 0 r ed to a nitr o b ody, then s r ol. Non-h e r mined by c r acts (50 g o a nitrocel l e d with ant i n as a lane 5 % SDS/po l r obed with a o bed with a n s olated fro m i fied by usi n N A. Asteris k p er adequat e 46 n ing increas m brane frac t 0 0 g) wer e o cellulose m s tripped an d e me iron (F e c olorimetri c ) were sep a l ulose mem b i -CCS prim loading co n l yacrylami d a nti-cerulo p n ti-SR-B1 a m liver sam p n g qRT-P C k s represen t e control. V es ferropor t t ions from l e separated o m embrane. T d reprobed w e ) concentr a c analysis a f a rated on a 1 b rane. To d ary antibo d n trol. C) Li v d e gel, tran s p lasmin (C p a ntibody as p les, and re l C R. Transcr i t the signifi c V alues are m t in (Fpn) e x l iver sampl e o n a 7.5% S T he blot w a w ith anti-S R a tions (g/ g f ter acid di g 1 5% SDS/p d etermine C u d y, then stri p v er protein e s ferred to a n p ) primary a a lane-loa d l ative Fpn a i pt abunda n c ant differe n m eans SE M x pression in e s of Rat50 S DS/polyac r a s probed w R -B1 antib o g ) for each t g estion of ti olyacryla m u status in e p ped and re p e xtracts (5 0 n itrocellul o a ntibody. T h d ing control a nd hepcidi n n ce was nor m n ce ( P < 0. 0 M n=4 per g liver. A) study. r ylamide w ith antio dy as a t issue ssue. B) m ide gel, e ach group, p robed 0 g) were o se h e blot was D and E) n mRNA m alized to 0 5) g roup.

PAGE 47

47 Figure 4-2. Postweaning copper deficiency (Rat60) increases hepatic Fpn protein expression. Western blot analysis of membrane fractions from liver samples of Rat60 study. Liver membrane proteins (75 g) were separated on a 7.5% SDS/polyacrylamide gel, then transferred to a nitrocellulose membrane. The blot was probed with anti-Fpn primary antibody, then stripped and reprobed with anti-SR-B1 antibody as a lane-loading control.

PAGE 48

48 Figure 4-3. Perinatal copper deficiency increa ses Fpn expression in liver. A) Western blot analysis of membrane fractions from liver samples of Rat69 study. Liver membrane proteins (50 g) were separated on a 7.5% SDS/polyacrylamide gel, then transferred to a nitrocellulose membrane. The blots were probed with anti-Fpn primary antibody, then stripped and reprobed with anti-SR-B1 as a lane-loading control. Non-heme iron concentrations (g/g) for each tissue sa mple were determined by colorimetric analysis after acid digestion of tissue. B) Liver protein extracts (50 g) were separated on a 15% SDS/polyacrylamide gel, then transferred to a nitrocellulose membrane. To determine Cu status in each group, the blot was probed with anti-CCS primary antibody, then stripped and reprobed with anti-tubulin as a lane-loading control. C and D) Total RNA was isolated from liver samples, and relative fpn and hepcidn mRNA levels were quantified by using qRT-PCR. Transcript abundance was normalized to levels of 18S rRNA. Asterisks represent the significant difference ( P < 0.05) compared to copper adequate control. Values are means SEM, n=4 per group.

PAGE 49

49 Figure 4-4. Copper deficiency after weaning increases Fpn expression in spleen. A) Western blot analysis of membrane fractions from spleen samples of Rat50 study. Spleen membrane protein (50 g) were separated on a 7.5% SDS/polyacrylamide gel, then transferred to a nitrocellulose membrane. The blot was probed with anti-Fpn primary antibody, then stripped and reprobed with anti-SR-B1 and anti-Na+/K+-ATPase 1 antibodies as lane-loading controls. Non-heme iron concentrations (g/g) for each tissue sample were determined by colorimetric analysis after acid digestion of tissue. B) Spleen protein extracts (50 g) were separated on a 15% SDS/polyacrylamide gel, then transferred to a nitrocellulose membrane. To determine Cu status in each group, the blot was probed with anti-CCS primary antibody, then stripped and reprobed with anti-tubulin as a lane-loading control. C) Total RNA was isolated from spleen samples, and relative Fpn mRNA levels were quantified by using qRT-PCR. Transcript abundance was normalized to levels of 18S rRNA. Asterisks represent the significant difference ( P < 0.05) compared to copper adequate control. Values are means SEM, n=4 per group. --35

PAGE 50

Figure 4 4 -5. Perina t analysi s membr a transfe r antibo d heme i r colori m were s e membr a primar y control t al copper d s of membr a a ne protein s r red to a nit r d y, then stri p r on concent r m etric analy s e parated on a ne. To det e y antibody, d eficiency i n a ne fractio n s (50 g) w r ocellulose p ped and re r ations (g / s is after aci d a 15% SD S e rmine Cu s then stripp e 50 n creases Fp n n s from spl e ere separat e membrane probed wit h / g) for each d digestion S /polyacryl a s tatus in ea c e d and repr o n expressio e en sample s e d on a 7.5 % The blot w h anti-SRB tissue sam p of tissue. B am ide gel, t h c h group, t h o bed with a n n in spleen s of Rat69 s % SDS/pol y w as probed w B 1 as a lane p le were d e B ) Spleen p r h en transfe r h e blot was p n ti-tubul i A) Weste r tudy. Sple e y acrylamid e w ith anti-F p loading co n e termined b y r otein extra c r red to a ni t p robed wit h i n as a lane r n blot e n e gel, then p n primary n trol. Nony c ts (50 g) t rocellulose h anti-CCS loading

PAGE 51

51 Figure 4-6. Copper deficiency does not increase ferroportin expression in mice. A and B) Western blots of membrane fractions from liver and spleen samples, respectively, from Mouse21 study. Liver and spleen membrane proteins were separated on a 7.5% SDS/polyacrylamide gel, then transferred to a nitrocellulose membrane. The blots ware probed with anti-Fpn primary antib ody, then stripped and reprobed with antiSR-B1 as a lane-loading control. C) Total RNA was isolated from liver samples, and relative fpn and hepcidn mRNA levels were quantified by using qRT-PCR. Transcript abundance was normalized to levels of 18S rRNA.

PAGE 52

52 Figure 4-7. The Fpn promoter region contains a highly conserved metal-response element (MRE) consensus sequence. DNA sequences 2 kb upstream of the annotated transcription start site were analyzed by using Genomatix MatInspector. The MRE consists of a highly conserved 7-base pair core motif flanked by a less well conserved GC-rich domain. Numbers at right indicate the position of the MRE relative to the transcription start site. Figure 4-8. Suppression of Mtf-1 expression increases steady-state ferroportin mRNA levels. To decrease Mtf-1 expression, J774 cells were transfected with Mtf-1 siRNA or negative control siRNA. Twenty-four hours later, the cell culture medium was replaced with medium with or without 200 mmol/L Fe -NTA. After another 24 h, cells were harvested and mRNA levels of Mtf-1 A) and Fpn B) were determined by qRT-PCR. Data represent mean SEM, n=3. Asterisk indicates P <0.01 compared to respective control using Student’s t -test for unpaired samples. Shown are results from a single experiment and are representative of those obtained on three separate occasions.

PAGE 53

53 Figure 4-9. Sequence alignment of mouse, rat and human ferroportin promoter regions (2000 bp upstream of the annotated transcription start site; TSS). The sequences shown here start from position -2000 and end with position +1 (TSS).

PAGE 54

54 Figure 4-9. Continued

PAGE 55

55 Figure 4-9. Continued

PAGE 56

56 Figure 4-9. Continued

PAGE 57

57 Table 4-1. Analysis of the mouse ferroportin promoter region within 500 bp upstream of the annotated transcription start site reveals numerous transcription factor (TF) binding sites. Region was analyzed by using the Genomatix MatInspector software. Sequence letter in capitals indicate the core TF binding domain. TF Family Detailed Information Position Sequence Start End ZFIA Zinc finger with interaction do main factors -499 -487 agGCTCaaagatc ETSF Human and murine ETS1 factor s -493 -473 aaagctCAGGaagcaggctca NR2F Nuclear receptor subfamily 2 factors -486 -462 gctgcggaaTCAAagctcaggaagc RXRF RXR heterodimer binding sites 484 -460 aagctgcggaatcaaaGCTCaggaa PERO Peroxisome proliferator-activated r eceptor -483 -461 agctgcggaatcAAAGctcagga LEFF LEF1/TCF -481 -465 gcggaatCAAAgctcag GFI1 Growth factor independence transcriptional repressor -480 -466 cggAATCaaagctca BARB Barbiturate-inducible element box from pro+eukaryotic genes -469 -455 ctcaAAAGctgcgga STAT Signal transducer and activator of transcription -442 -424 ttccTTCTccgaactatag STAT Signal transducer and activator of transcription -440 -422 atagTTCGgagaaggaaaa CTCF CTCF and BORIS gene family, transcriptional regulators with 11 highly conserved zinc finger domains -420 -394 attctgcgccgcaggcaGGCCggacat AP2F Activator protein 2 -416 -402 cctGCCTgcggcgca SP1F GC-Box factors SP1/GC -408 -394 aggcaggccGGACat P53F p53 tumor suppressor -400 -378 taagtaaatacaagtCATGtccg ATBF AT-binding transcription fact or -396 -380 catgacttgtATTTact FKHD Fork head domain factors -392 -376 gctaagTAAAtacaagt NKXH NKX homeodomain factors -391 -373 gtagctAAGTaaatacaag VTBP Vertebrate TATA binding protein factor -387 -371 aggtagcTAAGtaaata TEAF TEA/ATTS DNA binding domain factors -372 -360 ctgCATTccgaag EGRF EGR/nerve growth factor induced protein C & related factors-355 -339 gctaGGGTgggaggctc EGRF EGR/nerve growth factor induced protein C & related factors-353 -337 tagggTGGGaggctcct RBPF RBPJ kappa -352 -338 agggTGGGaggctcc NFKB Nuclear factor kappa B/c-rel -349 -337 gtGGGAggctcct NFAT Nuclear factor of activated T-cells -344 -326 cgcGGAAaaaaaggagcct CIZF CAS interating zinc finger protein -339 -329 ggAAAAaaagg

PAGE 58

58 Table 4-1. Continued TF Family D etailed Information Position Sequence Start End E2FF E2F-myc activator/cell cycle regulator -338 -322 ctggcgcggAAAAaaag E2FF E2F-myc activator/cell cycle regulator -336 -320 agctgGCGCggaaaaaa E2FF E2F-myc activator/cell cycle regulator -335 -319 tttttcCGCGccagctc E2FF E2F-myc activator/cell cycle regulator -333 -317 tttccGCGCcagctccc TF2D General transcription factor IID, GTF2D -332 -294 acagtccctaggcaaagctcagcgggagctGG CGcggaa NRF1 Nuclear respiratory factor 1 -332 -316 cggGAGCtggcgcggaa NRF1 Nuclear respiratory factor 1 -331 -315 tccGCGCcagctcccgc TF2B RNA polymerase II transcriptio n factor II B -330 -324 ccgCGCC XCPE Activator-, mediatorand TBP-dependent core promoter element for RNA polymerase II transcription from TATAless promoters -323 -313 caGCGGgagct NR2F Nuclear receptor subfamily 2 factors -320 -296 agtccctaggCAAAgctcagcggga PERO Peroxisome proliferator-activated receptor -317 -295 cagtccctaggcAAAGctcagcg NRSF Neuron-restrictive silencer factor -309 -279 ccaccagattgcCGGAcagtccctaggcaaa NFKBNuclear factor kappa B/c-rel-303 -291taGGGActgtccg ETSF Human and murine ETS1 factors -273 -253 tgctagaAGGAagctcttctc HAND Twist subfamily of class B bHLH transcri ption factors -262 -242 cgtttggCAGGtgctagaagg HOXH HOX MEIS1 heterodimers -260 -246 TGGCaggtgctagaa MYOD Myoblast determining factor s -259 -243 gtttggcaGGTGctaga TALE TALE homeodomain class recognizing TG motifs -257 -241 tagcacctGCCAaacga HOMF Homeodomain transcription factors -254 -236 cacctgccAAACgactttg HZIP Homeodomain-leucine zipper transcription factors -249 -235 acaaaGTCGtttggc HOMF Homeodomain transcription factors -239 -221 tttgtgcaAAATgtttctg HOMF Homeodomain transcription fa ctors -234 -216 cactacagAAACattttgc ZFHX Two-handed zinc finger homeodomain transcription factors -232 -220 aaaatGTTTctgt XBBF X-box binding factors -230 -212 gggacactacaGAAAcatt MZF1 Myeloid zinc finger 1 factors -219 -209 gaGGGGacact

PAGE 59

59 Table 4-1. Continued TF Family Detailed Informatio n Position Sequence Start End XBBF X-box binding factors -219 -201 cggacCCCGaggggacact PLZF C2H2 zinc finger protein PLZF -201 -187 gcaTACAgtccccgt KLFS Krueppel like transcription fa ctors -175 -157 gagaagccaAGGGgtgacc NR2F Nuclear receptor subfamily 2 factor s -151 -127 gtagcccagcCAAAgcgcaggttgt FKHD Fork head domain factors -134 -118 gaggcgcAAACaacctg NOLF Neuron-specific-olfactory factor -128 -106 ccgcccTCCCaggaggcgcaaac CTCF CTCF and BORIS gene family, transcriptional regulators with 11 highly conserved zinc finger domains -121 -95 cctcctgggagggcggtGGGAgcgtag GLIF GLI zinc finger family -120 -106 ccgcCCTCccaggag EGRF EGR/nerve growth factor induced protein C & related factors -119 -103 tcctGGGAgggcggtgg ZBPF Zinc binding protein factors -118 -96 tacgctCCCAccgccctcccagg SP1F GC-Box factors SP1/GC -115 -101 gggaGGGCggtggga RBPF RBPJ kappa -109 -95 gcggTGGGagcgtag E2FF E2F-myc activator/cell cycle regulator -96 -80 agctgGCGCggacctgg PAX5 PAX-5 B-cell-specific activator protein -96 -68 agctgGCGCggacctggacgtccagccgc TF2B RNA polymerase II transcription factor II B -92 -86 ccgCGCC PAX6 PAX-4/PAX-6 paired domain binding sites -89 -71 gctggacgtCCAGgtccgc TF2D General transcription factor IID, GTF2 D -83 -45 tgagagagcagggaccgcccttcgcggctgGAC Gtccag PAX8 PAX-2/5/8 binding sites -50 -38 ctcTCAAgctccg ZBPF Zinc binding protein factors -47 -25 tcaagctccgCCCCcggctccct SP1F GC-Box factors SP1/GC -45 -31 ccgggGGCGgagctt ZBPF Zinc binding protein factors -44 -22 agctccgCCCCcggctccctata EGRF EGR/nerve growth factor induced protein C & related factors -43 -27 ggagccggGGGCggagc AP2F Activator protein 2 -41 -27 ggaGCCGggggcgga SRFF Serum response element binding factor -33 -15 agcggctTATAgggagccg VTBP Vertebrate TATA binding protei n factor -28 -12 cccTATAagccgctgcc

PAGE 60

60 CHAPTER 5 DISCUSSION Specific Aim I The most striking result from the present st udy is that ferroportin expression increases with copper deficiency in rat liver and spleen, major sites of ferroportin expression. In both the postweanling and the perinatal models of copper deficiency, CuD rats exhibited a marked increase in ferroportin protein expression in th e liver and spleen relative to CuA rats. These CuD rats were severely anemic, as indicated by low hemoglobin levels (data from Dr.Joseph R. Prohaska, University of Minnesota, Medical School-Duluth). The upregulation of ferroportin expression correlates well with the decrease in he patic hepcidin levels in both copper deficiency models. The peptide hormone hepcidin is the dominant negative regulator of in vivo ferroportin protein levels. Thus the increase in tissue ferroportin protein expression in CuD rats most likely results from the reduced circulating hepcidin. A recent study by Aigner et al. (77) reported that feeding rats a CuD diet (2 ppm Cu) for 8 wk re sulted in decreased liver ferroportin levels. Although this finding appears opposite to ours, Aigner et al (77) did not present data on liver Cu or Fe levels or liver hepcidin mRNA expression. The upregulation in ferroportin protein is associated with the observed increase in ferroport in transcript abundance in liver and spleen as demonstrated in Rat50 study. The concomitant increase in ferroportin mRNA levels in our study was unexpected because lack of hepcidin would be thought to increase ferroportin protein levels posttranslationally by attenuating protein degradation. We are unaware of studies showing that hepcidin affects ferroportin mRNA levels. It is possible that copper depletion increases ferroportin mRNA levels, though this is opposite to cell culture studies showing elevated ferroportin mRNA levels after copper supplement ation (78). Interestingly, we did not see an induction in liver ferroportin mRNA expression in the perinatal rat model despite a 2-fold

PAGE 61

61 increase in ferroportin protein levels in the CuD liver relative to the CuA controls. These observations suggest that young suckling rats and old rats may respond to copper deficiency differently, and that the posttranscriptional control appears to be chiefly responsible for the increased ferroportin protein expression during the suckling period. Unfortunately, we were unable to measure ferroportin mRNA expression in the spleen from this perinatal rat study because the RNA was degraded. It has been shown that ferroportin can be transcriptionally regulated by iron (14). In CuD rats from the postweaning Rat50 study, non-heme iron levels in liver were remarkably elevated, which may also contribute to the increased ferroportin mRNA levels in this tissue. It is important to note that CuD rats from the perinatal study loaded iron in their liver as well, but to a much lesser extent. The fact that these young rats do not exhibit change in mRNA expression in response to copper deficiency is possibly due to the low liver iron concentrations that may be insufficient to trigger ferroportin expression at the transcription. Why splenic mRNA levels increased in CuD rats from the postweaning study remains to be investigated. The present analyses in CuD mouse tissues confirmed the previous observations by Chung et al (7) in that copper deficiency does not affect ferroportin expression in mice. Ferroportin levels do not change in the mouse most likely because copper deficiency does not decrease serum iron concentrations and hepatic hepcidin levels as it does in the rat (8). It will be useful in future studies to determine if copper defi ciency in the rat results in an upregulation of ferroportin expression in the intest ine as it does in spleen and liver. Ceruloplasmin (Cp) is a plasma multicopper ferroxidase that plays a key role in the cellular iron release and loading onto transferrin. It is primarily synthesized in the hepatocytes as apo-Cp (36). During normal copper status, copper is incorporated into apo-Cp, becoming holoCp and is secreted from the cell by the secretory pathway of trans-Golgi network (36). Here, we

PAGE 62

62 found that Cp protein expression decreased in copper deficiency as shown in the Rat50 study. This result agre es with the study by Viatte et al (77) where they observed a downregulation of Cp protein in hepcidin knockout mice relative to wild-type littermates. According to these data, it seems possible that the reduction or absence of hepcidin may signal Cp regulation, at least in part, through its degradation. Indeed, decreased hepcidin levels alter iron mobilization by allowing iron efflux via ferroportin from cytosol into extracellular fluids. One would therefore expect a higher expression of Cp in order to facilitate iron release via ferroportin. Copper deficiency has been shown to reduce plasma Cp activity likely as a result of the malfunction of apo-Cp, which is much less stable than holo-Cp and rapidly cleared from the circulation (78). Half life of apo-Cp is also much shorter, about 5 hours compared to 5.5 days that of holo-Cp (36). The observed decrease in Cp protein levels, therefore, seems to be consistent with the reduction in plasma Cp activity reported by others. Nevertheless, our Cp observation appears to contradict to a study by Gitlin and collegues (79), which demonstrated no effect copper deficiency in Cp protein biosynthesis in primary rat hepatocytes. Moreover, they suggested that hepatocyte copper content has no effect on hepatic Cp-gene expression and that the incorporation of copper into newly synthesized Cp is not a rate-limiting step in the biosynthesis or secretion of the apo-Cp from the rat hepatocytes. Thus, it remains to be elucidated how liver Cp protein expression responds to copper defi ciency in rats and mice, and whether the relationship between hepcidin and Cp does exist. We conclude that ferroportin regulation in re sponse to copper deficiency differs between rats and mice; copper deficiency upregulates ferroportin expression in the rats whereas it does not in the mice. Tissue ferroportin levels increase in anemic CuD rats, but not mice, because only rats display low serum iron concentrations and diminished hepcidin expression. Taken together,

PAGE 63

63 these data suggest that serum iron, rather than anemia per se, is the signal for hepcidin during copper deficiency. Specific Aim II It has been widely accepted that, at the cellular level, ferroportin is mainly postranscriptionally regulated through the iron-responsive element (IRE)/ iron regulatory proteins (IRP) system (54). When cellular iron is depleted, IRP bind to the 5’ IRE in ferroportin mRNA and inhibit its translation. During high cellular iron concentrations, IRP are either degraded or fail to bind IRE with high affinity, which allows translation to take place. However, many studies demonstrate an increase in ferroportin mRNA abundance upon iron treatment, suggesting transcriptional regulation of the ferroportin gene (11, 13, 55). However, one may argue that such increase can also be due to th e higher stability and/or decreased degradation of the mRNA. In fact, in iron-rich macrophages, the interaction between IRE and IRP is expected to be low, and increased ferroportin mRNA expression would likely depend more on the transcription itself (14). To confirm that the ferr oportin regulation also occurs at transcriptional level, a recent study in J774 macrophages measured ferroportin mRNA along with heterogeneous nuclear RNA (hnRNA, pre-mRNA) as an indirect indicator of transcription rate upon iron loading (14). Aydemir et al (14) demonstrated the induction in both ferroportin mRNA and hnRNA after iron treatment, which was abrogated when the transcriptional inhibitor Actinomycin D was added. These results suggest that ferroportin can be regulated at the transcription step, and that its mRNA is not stabilized by iron (14). Eukaryotic gene transcription is regulated through interactions between trans-acting molecules, which include general and gene-specific transcription factors (TFs), and cis-acting elements (target DNA sequences). To further investigate the gene-specific transcription factors that play a role in the

PAGE 64

64 ferroportin transcriptional activation by iron, we have analyzed the promoter region of the iron exporter gene in an attempt to find a potential TF binding site. By comparing the 5’ upstream DNA sequences within 2 kb from the transcription start site (TSS) of the mouse, rat, and human ferroportin gene, we identified a highly conserved MRE consensus sequence. MREs were first described in the promoter region of metallothionein ( Mt ) (73), a small, cysteine-rich protein that binds zinc and copper (Ref). MREs serve as binding sites for Mtf-1, which increases the transcription of the Mt gene in response to zinc (73). Since iron loading has been shown to increase Mt mRNA levels (82), we reasoned that the increase in ferroporti n transcription in irontreated J774 cells may be mediated, at least in part, through its MRE and Mtf-1. Such a possibility seemed even more likely because loading J774 cells with copper, a known activator of Mtf-1 and Mt transcription (83), increases ferroportin mRNA levels (76). As a first step to examine a role for Mtf-1 in ferroportin expression, we used siRNA to silence Mtf-1 in J774 cells and then measured ferroportin mRNA abundance. Unexpectedly, we found that Mtf-1 suppression did not inhibit the iron-induced incr ease in ferroportin mRNA expression; instead, it increased steady-state mRNA levels of ferroportin both in the presence and absence of added iron. These observations suggest that Mtf-1 repr esses ferroportin expression, in contrast to its role as transcriptional activator for Mt1. The ab ility of Mtf-1 to repress target gene expression has recently been revealed by transcriptional pr ofiling of Mtf1 condition al knockout mice (84). Livers of mice lacking Mtf1 have elevated transcript levels of Slc39a10 (Zip10), a member of the ZIP family of metal ion transporters. Mouse Slc39a10 contains an MRE core consensus sequence immediately upstream of the TSS (-21 bp), along with another MRE directly downstream (+17 bp). Wimmer et al (84) proposed that Mtf-1 binding to these proximal MREs may repress transcription by interfering with the access of RNA polymerase II and/or other general

PAGE 65

65 transcription factors. Such a possibility seem s less likely for the apparent repression of ferroportin expression by Mtf-1, because ferroportin contains only one putative MRE relatively far from the TSS (-1015 bp in the murine gene). More research will be needed to determine how changes in Mtf-1 levels, and possibly other TF s modulate ferroportin gene expression.

PAGE 66

66 LIST OF REFERENCES 1. Linder, M.C. & Hazegh-Azam, M. Copper biochemistry and molecular biology. Am J Clin Nutr 63 797S-811S (1996). 2. Donovan, A. et al. Positional cloning of zebrafish ferroportin1 identifies a conserved vertebrate iron exporter. Nature 403 776-81 (2000). 3. McKie, A.T. et al. A novel duodenal iron-regulated transporter, IREG1, implicated in the basolateral transfer of iron to the circulation. Mol Cell 5 299-309 (2000). 4. Abboud, S. & Haile, D.J. A novel mammalian iron-regulated protein involved in intracellular iron metabolism. J Biol Chem 275 19906-12 (2000). 5. Nemeth, E. et al. Hepcidin regulates cellular iron efflux by binding to ferroportin and inducing its internalization. Science 306 2090-3 (2004). 6. Nemeth, E. & Ganz, T. Regulation of iron metabolism by hepcidin. Annu Rev Nutr 26 323-42 (2006). 7. Chung, J., Prohaska, J.R. & Wessling-Resnick M. Ferroportin-1 is not upregulated in copper-deficient mice. J Nutr 134 517-21 (2004). 8. Pyatskowit, J.W. & Prohaska, J.R. Copper deficient rats and mice both develop anemia but only rats have lower plasma and brain iron levels. Comp Biochem Physiol C Toxicol Pharmacol 147 316-23 (2008). 9. Pyatskowit, J.W. & Prohaska, J.R. Multiple mechanisms account for lower plasma iron in young copper deficient rats. Biometals 21 343-52 (2008). 10. Chung, J. & Wessling-Resnick, M. Molecula r mechanisms and regulation of iron transport. Crit Rev Clin Lab Sci 40 151-82 (2003). 11. Knutson, M.D., Vafa, M.R., Haile, D.J. & Wessling-Resnick, M. Iron loading and erythrophagocytosis increase ferroportin 1 (FPN1) expression in J774 macrophages. Blood 102 4191-7 (2003). 12. Delaby, C. et al. A physiological model to study iron recycling in macrophages. Exp Cell Res 310 43-53 (2005). 13. Yang, F., Wang, X., Haile, D.J., Piantadosi, C.A. & Ghio, A.J. Iron increases expression of iron-export protein MTP1 in lung cells. Am J Physiol Lung Cell Mol Physiol 283 L932-9 (2002).

PAGE 67

67 14. Aydemir, F., Jenkitkasemwong, S., Gulec, S. & Knutson, M.D. Iron loading increases ferroportin heterogeneous nuclear RNA and mRNA levels in murine J774 macrophages. J Nutr 139 434-8 (2009). 15. Gaetke, L.M. & Chow, C.K. Copper toxicity, oxidative stress, and antioxidant nutrients. Toxicology 189 147-63 (2003). 16. Dancis, A. et al. Molecular characterizatio n of a copper transport protein in S. cerevisiae: an unexpected role for copper in iron transport. Cell 76 393-402 (1994). 17. Zhou, B. & Gitschier, J. hCTR1: a human gene for copper uptake identified by complementation in yeast. Proc Natl Acad Sci U S A 94 7481-6 (1997). 18. Nose, Y., Kim, B.E. & Thiele, D.J. Ctr1 drives intestinal copper absorption and is essential for growth, iron metabolis m, and neonatal cardiac function. Cell Metab 4 235-44 (2006). 19. Lee, J., Prohaska, J.R. & Thiele, D.J. Esse ntial role for mammalian copper transporter Ctr1 in copper homeostasis and embryonic development. Proc Natl Acad Sci U S A 98 6842-7 (2001). 20. Knutson, M.D. Steap proteins: implications for iron and copper metabolism. Nutr Rev 65 335-40 (2007). 21. Ohgami, R.S., Campagna, D.R., McDonald, A. & Fleming, M.D. The Steap proteins are metalloreductases. Blood 108 1388-94 (2006). 22. McKie, A.T. et al. An iron-regulated ferric reductase associated with the absorption of dietary iron. Science 291 1755-9 (2001). 23. Gunshin, H. et al. Cloning and characterization of a mammalian proton-coupled metal-ion transporter. Nature 388 482-8 (1997). 24. Gunshin, H. et al. Slc11a2 is required for intestinal iron absorption and erythropoiesis but dispensable in placenta and liver. J Clin Invest 115 1258-66 (2005). 25. Arredondo, M., Munoz, P., Mura, C.V. & Nunez, M.T. DMT1, a physiologically relevant apical Cu1+ transporter of intestinal cells. Am J Physiol Cell Physiol 284 C1525-30 (2003). 26. Tennant, J., Stansfield, M., Yamaji, S., Srai, S.K. & Sharp, P. Effects of copper on the expression of metal transporters in human intestinal Caco-2 cells. FEBS Lett 527 239-44 (2002).

PAGE 68

68 27. Yamaguchi, Y., Heiny, M.E., Suzuki, M. & Gi tlin, J.D. Biochemical characterization and intracellular localization of the Menkes disease protein. Proc Natl Acad Sci U S A 93 14030-5 (1996). 28. La Fontaine, S. & Mercer, J.F. Trafficking of the copper-ATPases, ATP7A and ATP7B: role in copper homeostasis. Arch Biochem Biophys 463 149-67 (2007). 29. Vulpe, C., Levinson, B., Whitney, S., Packman, S. & Gitschier, J. Isolation of a candidate gene for Menkes disease and evidence that it encodes a copper-transporting ATPase. Nat Genet 3 7-13 (1993). 30. Menkes, J.H., Alter, M., Steigleder, G.K., Weakley, D.R. & Sung, J.H. A sex-linked recessive disorder with retardation of growth, peculiar hair, and focal cerebral and cerebellar degeneration. Pediatrics 29 764-79 (1962). 31. Shim, H. & Harris, Z.L. Genetic defects in copper metabolism. J Nutr 133 1527S31S (2003). 32. Gordon, D.T., Leinart, A.S. & Cousins, R. J. Portal copper transport in rats by albumin. Am J Physiol 252 E327-33 (1987). 33. Linder, M.C. et al. Copper transport. Am J Clin Nutr 67 965S-971S (1998). 34. Yamaguchi, Y., Heiny, M.E. & Gitlin, J.D. Isolation and characterization of a human liver cDNA as a candidate gene for Wilson disease. Biochem Biophys Res Commun 197 271-7 (1993). 35. Thomas, G.R., Forbes, J.R., Roberts, E.A., Walshe, J.M. & Cox, D.W. The Wilson disease gene: spectrum of mutations and their consequences. Nat Genet 9 210-7 (1995). 36. Hellman, N.E. & Gitlin, J.D. Ceruloplasmin metabolism and function. Annu Rev Nutr 22 439-58 (2002). 37. Meyer, L.A., Durley, A.P., Prohaska, J.R. & Harris, Z.L. Copper transport and metabolism are normal in aceruloplasminemic mice. J Biol Chem 276 36857-61 (2001). 38. Harris, Z.L., Klomp, L.W. & Gitlin, J.D. Aceruloplasminemia: an inherited neurodegenerative disease with impairment of iron homeostasis. Am J Clin Nutr 67 972S-977S (1998). 39. Puig, S. & Thiele, D.J. Molecular mechanisms of copper uptake and distribution. Curr Opin Chem Biol 6 171-80 (2002).

PAGE 69

69 40. Hunt, J.R. Bioavailability of iron, zinc, and other trace minerals from vegetarian diets. Am J Clin Nutr 78 633S-639S (2003). 41. DRI Tables: Dietary Reference Intake(DRI): Macronutrients. National Academy of Sciences. Institute of Medicine. Food and Nutrition Board. Available from USDA website (http://www.usda.gov/) 42. Chen, H. et al. Decreased hephaestin activity in the intestine of copper-deficient mice causes systemic iron deficiency. J Nutr 136 1236-41 (2006). 43. Reeves, P.G. & Demars, L.C. Repletion of copper-deficient rats with dietary copper restores duodenal hephaestin protein and iron absorption. Exp Biol Med (Maywood) 230 320-5 (2005). 44. Harris, Z.L., Durley, A.P., Man, T.K. & Gitlin, J.D. Targeted gene disruption reveals an essential role for ceruloplasmin in cellular iron efflux. Proc Natl Acad Sci U S A 96 10812-7 (1999). 45. Cherukuri, S. et al. Unexpected role of ceruloplasmin in intestinal iron absorption. Cell Metab 2 309-19 (2005). 46. Healy, J. & Tipton, K. Ceruloplasmin and what it might do. J Neural Transm 114 777-81 (2007). 47. Donovan, A. et al. The iron exporter ferroportin/Slc40a1 is essential for iron homeostasis. Cell Metab 1 191-200 (2005). 48. Knutson, M. & Wessling-Resnick, M. Iro n metabolism in the reticuloendothelial system. Crit Rev Biochem Mol Biol 38 61-88 (2003). 49. Krause, A. et al. LEAP-1, a novel highly disulfide-bonded human peptide, exhibits antimicrobial activity. FEBS Lett 480 147-50 (2000). 50. Park, C.H., Valore, E.V., Waring, A.J. & Ga nz, T. Hepcidin, a urinary antimicrobial peptide synthesized in the liver. J Biol Chem 276 7806-10 (2001). 51. Nicolas, G. et al. Lack of hepcidin gene ex pression and severe tissue iron overload in upstream stimulatory factor 2 (USF2) knockout mice. Proc Natl Acad Sci U S A 98 8780-5 (2001). 52. Nicolas, G. et al. Severe iron deficiency anemia in transgenic mice expressing liver hepcidin. Proc Natl Acad Sci U S A 99 4596-601 (2002).

PAGE 70

70 53. Roetto, A. & Camaschella, C. New insights into iron homeostasis through the study of non-HFE hereditary haemochromatosis. Best Pract Res Clin Haematol 18 235-50 (2005). 54. Muckenthaler, M.U., Galy, B. & Hentze, M.W. Systemic iron homeostasis and the iron-responsive element/iron-re gulatory protein (IRE/IRP ) regulatory network. Annu Rev Nutr 28 197-213 (2008). 55. Delaby, C., Pilard, N., Puy, H. & Canonne-Hergaux, F. Sequential regulation of ferroportin expression after erythrophagocytosis in murine macrophages: early mRNA induction by haem, followed by iron-dependent protein expression. Biochem J 411 123-31 (2008). 56. Knutson, M.D., Oukka, M., Koss, L.M., Aydemir, F. & Wessling-Resnick, M. Iron release from macrophages after erythrophagocy tosis is up-regulated by ferroportin 1 overexpression and down-regulated by hepcidin. Proc Natl Acad Sci U S A 102 1324-8 (2005). 57. Lahey, M.E., Gubler, C.J., Chase, M.S., Cartwright, G.E. & Wintrobe, M.M. Studies on copper metabolism. II. Hematologic manifestations of copper deficiency in swine. Blood 7 1053-74 (1952). 58. Vulpe, C.D. et al. Hephaestin, a ceruloplasmin homologue implicated in intestinal iron transport, is defe ctive in the sla mouse. Nat Genet 21 195-9 (1999). 59. Chen, H. et al. Systemic regulation of Hephaestin and Ireg1 revealed in studies of genetic and nutritional iron deficiency. Blood 102 1893-9 (2003). 60. Hambidge, M. Biomarkers of trace mineral intake and status. J Nutr 133 Suppl 3 948S-955S (2003). 61. Danzeisen, R. et al. How reliable and robust are current biomarkers for copper status? Br J Nutr 98 676-83 (2007). 62. Harvey, L.J. & McArdle, H.J. Biomarkers of copper status: a brief update. Br J Nutr 99 Suppl 3 S10-3 (2008). 63. Milne, D.B. Copper intake and assessment of copper status. Am J Clin Nutr 67 1041S-1045S (1998). 64. Olivares, M., Mendez, M.A., Astudillo, P.A. & Pizarro, F. Present situation of biomarkers for copper status. Am J Clin Nutr 88 859S-62S (2008).

PAGE 71

71 65. Bertinato, J., Iskandar, M. & L'Abbe, M.R. Copper deficiency induces the upregulation of the copper chaperone for Cu/Zn superoxide dismutase in weanling male rats. J Nutr 133 28-31 (2003). 66. Prohaska, J.R., Broderius, M. & Brokate, B. Metallochaperone for Cu,Zn-superoxide dismutase (CCS) protein but not mRNA is higher in organs from copper-deficient mice and rats. Arch Biochem Biophys 417 227-34 (2003). 67. West, E.C. & Prohaska, J.R. Cu,Zn-superoxide dismutase is lower and copper chaperone CCS is higher in erythrocytes of copper-deficient rats and mice. Exp Biol Med (Maywood) 229 756-64 (2004). 68. Iskandar, M. et al. Copper chaperone for Cu/Zn superoxide dismutase is a sensitive biomarker of mild copper deficiency induced by moderately high intakes of zinc. Nutr J 4 35 (2005). 69. Babara A. Bowman, R.M.R. Present Knowledge in Nutrition (ILIS Press, Washington, 2006) 70. Xuan, Z., Zhao, F., Wang, J., Chen, G. & Zhang, M.Q. Genome-wide promoter extraction and analysis in human, mouse, and rat. Genome Biol 6 R72 (2005). 71. Torrance, J.D. & Bothwell, T.H. A simple technique for measuring storage iron concentrations in formalinised liver samples. S Afr J Med Sci 33 9-11 (1968). 72. Giedroc, D.P., Chen, X. & Apuy, J.L. Metal response element (MRE)-binding transcription factor-1 (MTF-1): structure, function, and regulation. Antioxid Redox Signal 3 577-96 (2001). 73. Westin, G. & Schaffner, W. A zinc-responsive factor interacts with a metal-regulated enhancer element (MRE) of the mouse metallothionein-I gene. Embo J 7 3763-70 (1988). 74. Heuchel, R. et al. The transcription factor MTF-1 is essential for basal and heavy metal-induced metallothio nein gene expression. Embo J 13 2870-5 (1994). 75. Aigner, E. et al. Copper av ailability contributes to iron perturbations in human nonalcoholic fatty liver disease. Gastroenterology 135 680-8 (2008). 76. Chung, J., Haile, D.J. & Wessling-Resnic k, M. Copper-induced ferroportin-1 expression in J774 macrophages is associated with increased iron efflux. Proc Natl Acad Sci U S A 101 2700-5 (2004). 77. Viatte, L. et al. Deregulation of proteins involved in iron metabolism in hepcidindeficient mice. Blood 105 4861-4 (2005).

PAGE 72

72 78. Holtzman, N.A. & Gaumnitz, B.M. Studies on the rate of release and turnover of ceruloplasmin and apoceruloplasmin in rat plasma. J Biol Chem 245 2354-8 (1970). 79. Gitlin, J.D., Schroeder, J.J., Lee-Ambrose, L.M. & Cousins, R.J. Mechanisms of caeruloplasmin biosynthesis in normal and copper-deficient rats. Biochem J 282 ( Pt 3) 835-9 (1992). 80. Paukkeri, E.L. et al. PPARalpha agonists in hibit nitric oxide production by enhancing iNOS degradation in LPS-treated macrophages. Br J Pharmacol 152 1081-91 (2007). 81. Drakesmith, H. et al. Resistance to hepcidin is conferred by hemochromatosisassociated mutations of ferroportin. Blood 106 1092-7 (2005). 82. Brown, K.E., Broadhurst, K.A., Mathahs, M.M. & Weydert, J. Differential expression of stress-inducible proteins in chronic hepatic iron overload. Toxicol Appl Pharmacol 223 180-6 (2007). 83. Mattie, M.D. & Freedman, J.H. Copper-induc ible transcription: regulation by metaland oxidative stress-responsive pathways. Am J Physiol Cell Physiol 286 C293-301 (2004). 84. Wimmer, U., Wang, Y., Georgiev, O. & Schaffner, W. Two major branches of anticadmium defense in the mouse: MTF-1/metallothioneins and glutathione. Nucleic Acids Res 33 5715-27 (2005). 85. Davis, S.R., Cousins, R.J. Metallothionein expression in animals: a physiological perspective on function. J Nutr 130 1085-8 (2000).

PAGE 73

73 BIOGRAPHICAL SKETCH Supak Jenkitkasemwong was born in Bangkok, Thailand in 1983. Supak completed her B.S. in Biology at the Chulalongkorn University in 2005. She started to gain an interest in nutrition while she was an undergraduate student, and decide to pursue a grad uate degree in this area. In 2007, Supak was accepted into the M.S. pr ogram in nutritional sciences at the University of Florida where she formally began to explore the science of nutrients especially in human health aspects. She joined Dr. Mitchell Knuston Laboratory in Summer 2007 and has done research on the cellular and molecular iron meta bolism in mammals until present. Supak is currently working on evaluating the effect of copper deficiency on iron homeostasis in rats, specifically at the step of iron release from cells via the iron exporter ferroportin. After graduation, Supak will pursue her Ph.D. degree in human nutrition at the University of Florida and continue her work in the iron field with Dr. Mitchell Knutson.