<%BANNER%>

Investigating Tissue Destruction Caused by Alterations in Diabetogenic Gingival Epithelial Cells in the Context of Perio...

Permanent Link: http://ufdc.ufl.edu/UFE0024520/00001

Material Information

Title: Investigating Tissue Destruction Caused by Alterations in Diabetogenic Gingival Epithelial Cells in the Context of Periodontal Disease
Physical Description: 1 online resource (103 p.)
Language: english
Creator: Tobler, Jeffrey
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: Medicine -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Research has established the relationship between periodontal disease and diabetes. The development of type 1 diabetes is caused by the activation of the immune system and inflammation. The inflammatory process may be critical in the development of secondary diabetic complications. Periodontal disease is one such complication and is an inflammatory process that affects the supportive tissues around the teeth. Receptors located on the surface and on the inside of cells can bind bacteria resulting in activation of genes that have been implicated in the causes of diabetic complications and inflammatory conditions. We hypothesize that diabetic cells in the mouth have alterations in the expression of these receptors. We found that the activation of receptors under high sugar conditions results in an increase in pro-inflammatory conditions and inhibits anti-inflammatory responses indicating an involvement of these receptors in the induction/progression of periodontal disease in type 1 diabetics.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Jeffrey Tobler.
Thesis: Thesis (M.S.)--University of Florida, 2009.
Local: Adviser: Wallet, Shannon.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0024520:00001

Permanent Link: http://ufdc.ufl.edu/UFE0024520/00001

Material Information

Title: Investigating Tissue Destruction Caused by Alterations in Diabetogenic Gingival Epithelial Cells in the Context of Periodontal Disease
Physical Description: 1 online resource (103 p.)
Language: english
Creator: Tobler, Jeffrey
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: Medicine -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Research has established the relationship between periodontal disease and diabetes. The development of type 1 diabetes is caused by the activation of the immune system and inflammation. The inflammatory process may be critical in the development of secondary diabetic complications. Periodontal disease is one such complication and is an inflammatory process that affects the supportive tissues around the teeth. Receptors located on the surface and on the inside of cells can bind bacteria resulting in activation of genes that have been implicated in the causes of diabetic complications and inflammatory conditions. We hypothesize that diabetic cells in the mouth have alterations in the expression of these receptors. We found that the activation of receptors under high sugar conditions results in an increase in pro-inflammatory conditions and inhibits anti-inflammatory responses indicating an involvement of these receptors in the induction/progression of periodontal disease in type 1 diabetics.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Jeffrey Tobler.
Thesis: Thesis (M.S.)--University of Florida, 2009.
Local: Adviser: Wallet, Shannon.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0024520:00001


This item has the following downloads:


Full Text

PAGE 1

INVESTIGATING TISSUE DESTRUCTIO N CAUSED BY ALTERATIONS IN DIABETOGENIC GINGIVAL EPITHELIAL CELLS IN THE CONTEXT OF PERIODONTAL DISEASE By JEFFREY W. TOBLER A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2009 1

PAGE 2

2009 Jeffrey W. Tobler 2

PAGE 3

To my wife, Amy Tobler 3

PAGE 4

ACKNOWLEDGMENTS I would like to thank the many i ndividuals that have contribut ed to make this project a success and my education experien ce enjoyable. Specifically, I would like to thank Dr. Shannon Wallet, my mentor and committee chair, for her continual support, guidance, and patience during my time in her lab. I would also like to thank the other members of my supervisory committee, Dr. Clay Walker, Dr. Lucianna Shaddox, and Dr. Ammon Peck, for their willingness to support the project. My time as a masters student has been a great learning experience, largely due to the outstanding intelligence and friend liness of my supervisory committee. Special thanks also to the ot her students in Dr. Wallets lab who contributed their time and scientific expertise to my project. I would like to thank my parents, who have never wavered in their love and support for me. They laid the foundation for ever ything I have achieved and become today. Finally, I would like to thank my wife, Amy, who has always supported me in my educational endeavors. She has always showed faith in me throughout my successes and failures and has inspired me to never give up on my goals and aspirations. 4

PAGE 5

TABLE OF CONTENTS page ACKNOWLEDGMENTS...............................................................................................................4LIST OF FIGURES.........................................................................................................................7ABSTRACT...................................................................................................................................11 CHAPTER 1 INTRODUCTION................................................................................................................. .132 BACKGROUND................................................................................................................... .16Type 1 Diabetes................................................................................................................ ......16Innate and Adaptive Immune Response in Auto-Immunity...................................................17Periodontal Diseases........................................................................................................... ....18Relationship between Diabetes Me llitus and Periodontal Disease.........................................20Gingival Epithelial Cells (GEC).............................................................................................22Toll-like Receptor (TLR)....................................................................................................... .23Advanced Glycated End Product (AGE)/A dvanced Glycated End Product Receptor (RAGE)...............................................................................................................................25Murine Model System............................................................................................................ 273 MATERIALS AND METHODS...........................................................................................30Harvesting Gingival Epithelial Tissue....................................................................................30Primary Culture of Human Oral Keratinocytes (HOK)..........................................................30HOK Stimulation Assay.........................................................................................................3 1Purification of RNA............................................................................................................ ....32Reverse Transcription.......................................................................................................... ...32Real-Time Quantitative Polymerase Chain Reaction (qPCR)................................................33Flow Cytometry (FACS)........................................................................................................34Luminex..................................................................................................................................354 RESULTS...................................................................................................................... .........37C57BL6 and NOD mice exhibit diffe rent TLR protein expression.......................................37TLR Gene Expression in C57BL6 Mice Increase over Time, Whereas TLR Gene Expression in NOD Mice Decreases over Time.................................................................39TLR Ligation Promotes and/or Inhib its Cytokine/Chemokine Secretion..............................39Stimulation with TLR Ligands In creases TLR Gene Expression..........................................41RAGE Gene Expression in C57BL6 Mice In creases over Time, Whereas RAGE Gene Expression in NOD Mice Decreases over Time.................................................................42RAGE Ligation Promotes a nd/or Inhibits Cytokine/Chemokine Secretion...........................43RAGE Gene Expression Increases af ter Stimulation with TLR Ligands...............................44 5

PAGE 6

5 DISCUSSION................................................................................................................... ......85LIST OF REFERENCES...............................................................................................................92BIOGRAPHICAL SKETCH.......................................................................................................103 6

PAGE 7

LIST OF FIGURES Figure page 4-1 TLR2 protein expression is significantly increased in NOD mice at 16 weeks of age (*p = 0.0058)......................................................................................................................454-2 TLR4 protein expression was significantly decreased in NOD mice at 16 weeks of age (*p = 0.0003)...............................................................................................................464-3 TLR2/4 double positive protei n expression is significantly increased in NOD at 16 weeks of age (*p = 0.0063)................................................................................................474-4 TLR1/2 double positive protein expressi on was significantly increased in NOD mice at both 8 and 16 weeks of age (*all p < 0.0061)................................................................484-5 TLR2 gene expression in C57BL/6 mice increase over time and decreases in NOD mice overtime (*p = 0.0093)..............................................................................................494-6 TLR4 gene expression in C57BL/6 mice increase over time and decreases in NOD mice overtime (all p < 0.0047)...........................................................................................504-7 TLR1 gene expression in C57BL/6 mice increase over time and decreases in NOD mice overtime (all p < 0.00208).........................................................................................514-8 TLR6 gene expression in C57BL/6 mice increase over time and decreases in NOD mice overtime (all p < 0.0246)...........................................................................................524-9 TLR9 gene expression in C57BL/6 mice increase over time and decreases in NOD mice overtime (*p = 0.0048)..............................................................................................534-10 RAGE gene expression in C57BL/6 mi ce increase over time and decreases in NOD mice overtime (all p = 0.0026)...........................................................................................544-11 Hyperglycemic conditions induce GMCSF pr o-inflammatory cytokine secretion in response to TLR ligation....................................................................................................554-12 Hyperglycemic conditions induce IL-1 pro-inflammatory cytokine secretion in response to TLR ligation .(*a ll p<0.0274; ^p = 0.0218)...................................................564-13 Hyperglycemic conditions induce IL-6 pr o-inflammatory cytokine secretion in response to TLR ligation (*al l p< 0.363; ^p = 0.0045).....................................................574-14 Hyperglycemic conditions induce IL-8 pr o-inflammatory cytokine secretion in response to TLR ligatio n (*all p< 0.0222).........................................................................584-15 Hyperglycemic conditions inhibit IL-10 anti-inflammatory cytokine secretion in response to TLR ligation (*p = 0.0117).............................................................................59 7

PAGE 8

4-16 Hyperglycemic conditions induce pro-inflammatory cytokine and chemokine secretion in response to TLR ligatio n (*p = 0.0118). Luminex 100 System analyzed HOK secretion levels of IP-10 pr o-inflammatory chemokine in response to TLR ligation and HOK section levels of IP-10 in response to non-stimulated TLR in both hyperglycemic and normoglycemic conditions.........................................................604-17 Hyperglycemic conditions induce pro-inflammatory cytokine and chemokine secretion in response to TLR ligatio n. Luminex 100 System analyzed HOK secretion levels of MCP-1 pro-inflammato ry chemokine in response to TLR ligation and HOK section levels of MCP-1 in re sponse to non-stimulated TLR in both hyperglycemic and normoglycemic conditions.................................................................614-18 Hyperglycemic conditions induce pro-inflammatory cytokine and chemokine secretion in response to TLR ligatio n. Luminex 100 System analyzed HOK secretion levels of MIP-1 pro-inflammatory cytokine in response to TLR ligation and HOK section levels of MIP-1 in response to non-stimulated TLR in both hyperglycemic and normoglycemic conditions.................................................................624-19 Hyperglycemic conditions induce pro-inflammatory cytokine and chemokine secretion in response to TLR ligatio n (*p = 0.0075). Luminex 100 System analyzed HOK secretion levels of TNFpro-inflammatory cytokine in response to TLR ligation and HOK sect ion levels of TNFin response to non-stimulated TLR in both hyperglycemic and normoglycemic conditions.....................................................634-20 Hyperglycemic conditions induce pro-inflammatory cytokine and chemokine secretion in response to RAGE ligati on. Luminex 100 System analyzed HOK secretion levels of GMCSF pro-inflammatory cytokine in response to RAGE ligation and HOK section levels of GMCSF in response to non-stimulated RAGE and RAGE blocking with sRAGE in both hyperglycemic and normoglycemic conditions................644-21 Hyperglycemic conditions induce pro-inflammatory cytokine and chemokine secretion in response to RAGE ligation (*all p< 0.0218). Luminex 100 System analyzed HOK secretion levels of IL-1 pro-inflammatory cytokine in response to RAGE ligation and HOK section levels of IL-1 in response to non-stimulated RAGE and RAGE blocking with sRAGE in both hyperglycemic and normoglycemic conditions...........................................................................................................................654-22 Hyperglycemic conditions induce pro-inflammatory cytokine and chemokine secretion in response to RAGE ligation (*all p< 0.0058). Luminex 100 System analyzed HOK secretion levels of IL-6 pr o-inflammatory cytokine in response to RAGE ligation and HOK section levels of IL-6 in response to non-stimulated RAGE and RAGE blocking with sRAGE in both hyperglycemic and normoglycemic conditions...........................................................................................................................66 8

PAGE 9

4-23 Hyperglycemic conditions induce pro-inflammatory cytokine and chemokine secretion in response to RAGE ligation (*all p< 0.0097). Luminex 100 System analyzed HOK secretion levels of IL-8 pr o-inflammatory cytokine in response to RAGE ligation and HOK section levels of IL-8 in response to non-stimulated RAGE and RAGE blocking with sRAGE in both hyperglycemic and normoglycemic conditions...........................................................................................................................674-24 Hyperglycemic conditions induce pro-inflammatory cytokine and chemokine secretion in response to RAGE ligation (* all p< 0.0186). Luminex 100 System analyzed HOK secretion levels of IL-10 anti-inflammatory cytokine in response to RAGE ligation and HOK section levels of IL-10 in response to non-stimulated RAGE and RAGE blocking with sRAGE in both hyperglycemic and normoglycemic conditions...........................................................................................................................684-25 Hyperglycemic conditions induce pro-inflammatory cytokine and chemokine secretion in response to RAGE ligation (*all p< 0.0274). Luminex 100 System analyzed HOK secretion levels of MCP-1 pro-inflammatory chemokine in response to RAGE ligation and HOK section levels of MCP-1 in response to non-stimulated RAGE and RAGE blocking with sRAGE in both hyperglycemic and normoglycemic conditions...........................................................................................................................694-26 Hyperglycemic conditions induce pro-inflammatory cytokine and chemokine secretion in response to RAGE ligation (*all p< 0.0137). Luminex 100 System analyzed HOK secretion levels of MIP-1 pro-inflammatory chemokine in response to RAGE ligation and HOK section levels of MIP-1 in response to non-stimulated RAGE and RAGE blocking with sRAGE in both hyperglycemic and normoglycemic conditions...........................................................................................................................704-27 Hyperglycemic conditions induce pro-inflammatory cytokine and chemokine secretion in response to RAGE ligation (*all p< 0.0122). Luminex 100 System analyzed HOK secretion levels of TNFpro-inflammatory cytokine in response to RAGE ligation and HOK section levels of TNFin response to non-stimulated RAGE and RAGE blocking with sRAGE in both hyperglycemic and normoglycemic conditions...........................................................................................................................714-28 Stimulation with TLR li gands increases TLR2 gene expression (*all p< 0.0251). qPCR analyzed relative gene expres sion of TLR2 on HOK in response to TLR ligation and non-stimulation..............................................................................................724-29 Stimulation with TLR li gands increases TLR4 gene expression (*all p< 0.0180). qPCR analyzed relative gene expres sion of TLR4 on HOK in response to TLR ligation and non-stimulation..............................................................................................734-30 Stimulation with TLR li gands increases TLR1 gene expression (*all p< 0.0228). qPCR analyzed relative gene expres sion of TLR1 on HOK in response to TLR ligation and non-stimulation..............................................................................................74 9

PAGE 10

4-31 Stimulation with TLR li gands increases TLR gene expression (*p = 0.0081). qPCR analyzed relative gene expression of TLR 6 on HOK in response to TLR ligation and non-stimulation................................................................................................................ ..754-32 Stimulation with TLR li gands increases TLR gene expression. qPCR analyzed relative gene expression of TLR9 on HOK in response to TLR ligation and nonstimulation.................................................................................................................... ......764-33 Stimulation with TLR li gands increases RAGE gene expression (*all p< 0.0061). qPCR analyzed relative gene expressi on of RAGE on HOK in response to TLR ligation and non-stimulation..............................................................................................774-34 Stimulation with RAGE ligands incr eases TLR2 gene expression (*p = 0.034). qPCR analyzed relative gene expressi on of TLR2 on HOK in response to RAGE ligation, blocking with sRAGE and non-stimulation.........................................................784-35 Stimulation with RAGE ligands incr eases TLR4 gene expression (*p = 0.0135). qPCR analyzed relative gene expressi on of TLR4 on HOK in response to RAGE ligation, blocking with sRAGE and non-stimulation.........................................................794-36 Stimulation with RAGE ligands incr eases TLR1 gene expression (*p = 0.0228). qPCR analyzed relative gene expressi on of TLR1 on HOK in response to RAGE ligation, blocking with sRAGE and non-stimulation.........................................................803-37 Stimulation with RAGE ligands increas es TLR gene expression. qPCR analyzed relative gene expression of TLR6 on HOK in response to RAGE ligation, blocking with sRAGE and non-stimulation......................................................................................814-38 Stimulation with RAGE ligands increas es TLR gene expression. qPCR analyzed relative gene expression of TLR9 on HOK in response to RAGE ligation, blocking with sRAGE and non-stimulation......................................................................................824-39 Stimulation with RAGE ligands increas es RAGE gene expression (*p = 0.0063). qPCR analyzed relative gene expressi on of RAGE on HOK in response to RAGE ligation, blocking with sRAGE and non-stimulation.........................................................834-40 TLR2 and TLR4 single positive protein e xpression on a single GEC in both C57BL6 and NOD mice. FACS analyzed relativ e protein expressi on of TLR2 and TLR4 single positive GECs in both C57BL6 and NOD mice at 4, 8, 12, and 16 weeks of age......................................................................................................................................84 10

PAGE 11

Abstract of Thesis Presen ted to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science INVESTIGATING TISSUE DESTRUCTION C AUSED BY DEFECTS IN DIABETOGENIC GINGIVAL EPITHELIAL CELLS IN THE CONTEXT OF PERIODONTAL DISEASE By Jeffrey W. Tobler May 2009 Chair: Shannon Wallet Major: Medical Sciences Background: Research has established the relati onship between periodontal disease and diabetes. The pathogenesis of autoimmune diab etes mellitus is mediated by activated innate immunity and inflammation. The inflammatory process, comprised of cytokines and chemokines, may be critical factors in the deve lopment of secondary di abetic complications. Periodontal disease is one secondary diabetic complication and is an inflammatory process that affects the supportive tissues ar ound the teeth. Toll-like recept ors (TLR) are receptors for microbial pathogen associated mol ecular patterns (PAMPs). TLR ligation result in activation of genes relevant to inflammatory and innate immu ne related cytokines. Advanced glycated end product receptor (RAGE) signaling has also been implicated in th e pathogenesis of diabetic complication and inflammatory conditions. We hypothesize that diabetogenic gingival epithelial cells have alterations in their TLR and/or RAGE innate immune pathways. Materials and Methods: Gingival epithelial cells (GECs) were harvested from C57BL6 (non-diabetogenic) and non-obese diabetic (NOD) mouse strain s at 4, 8, 12, and 16 weeks of age, after which the TLR and RAGE phenotype wa s evaluated using qPCR and flow cytometric analysis. In addition, Human Or al Keratinocytes (HOKs) were cultured and stimulated with 11

PAGE 12

12 TLR ligands and RAGE ligand in the presence and absence of hyperglycemic conditions. Afterwhich cytokine responses and TLR/RAGE phenotypes were de termined using luminex and qPCR respectively. Results : Taking into consideration the multiple comparisons made, there is no statistical significant difference in protein expression of TLR 1, 2, and 4 between NOD and C57BL6, although TLR and RAGE gene expression in C5 7BL6 GEC increased over time, whereas NOD GEC gene expression decreased over time. TLR and/or RAGE ligation promoted proinflammatory cytokine and chemokine responses with the exception of TLR2 ligation which promoted anti-inflammatory cytokine response. Interestingly, hyperglycemic conditions contributed to increased pro-in flammatory cytokine and chemokine responses, while inhibiting TLR2 induced anti-inflammatory responses. Gene e xpression analysis revealed that TLR and/or RAGE ligation increased gene expression of all TLRs with the excepti on of TLR9. Here TLR9 expression was not induced nor did its ligation induce the expr ession of other innate immune receptors. In addition, while RAGE ligation induced TLR and RAGE gene expression, TLR ligation did not induce RAGE gene expression. Finally, all ligand induced gene expression was significantly up-regulated in the presence of hyperglycemic conditions. Conclusions : TLR and RAGE ligation under hyperglycemic conditions results in an increase in pro-inflammatory responses and inhibits anti-inflammatory responses indicating an involvement of these receptors in the inducti on/progression of periodontal disease of type 1 diabetics.

PAGE 13

CHAPTER 1 INTRODUCTION The pathogenesis of autoimmune diabetes mellitus is mediated by activated innate immunity and inflammation. Diabetics are known to have prolonged inflammation as a result of abnormal immunological responses which can lead to tissue and organ destruction. Inflammation is an immune response in periodo ntal disease responsible for its severity. Periodontal disease results from an inflammatory process, which is initiated by bacterial colonization causing the production of soluble mediators, which damage the supportive tissues that surround the teeth. Periodont al disease is the foremost cause tooth loss and has been associated as a complication of diabetes. Diab etics not only have a grea ter risk of developing periodontal disease, but are more likely to develop a more severe form periodontal disease than non-diabetics. Toll-like receptors (TLR) are receptors for microbial pathogen associated molecular patterns (PAMPs). TLRs result in activation of genes relevant to inflammatory and innate immune related cytokines. Advanced glycat ed end product (AGE) are involved in initiating, maintaining, and exacerbating inflammatory responses. Higher levels of periodontal AGE accumulation are found in diabetics than in non-di abetics. Advanced glycated end product receptor (RAGE) signaling has been implicated in the pathogenesis of diabetic complication and inflammatory conditions. Both TLRs and RAGE are expressed within gi ngival epithelial cells (GEC). This studys aims were to investigate the i nnate immune function of gingival epithelial cells (GEC) in the context of diabetes me llitus. Specifically, we used molecular and immunohistochemical techniques to examine GEC and human oral keratinocytes (HOK) for the protein and gene expres sion patterns to identify altered TLR and RAGE expression levels under 13

PAGE 14

various diabetogenic conditions. In addition, we were able to decipher cytokine and chemokine responses of diabetogenic GEC to determine if type 1diabetics development of periodontal disease is due to intrinsic de fects within their GEC and/or if hyperglycemic conditions are responsible. To accomplish these aims, gingival epithelial tiss ue was harvested from non-obese diabetic (NOD) strain of mouse and from C57BL6 (non-diabetic) strain of mouse at 4, 8, 12, and 16 weeks of age. Real-time quantitative polymeras e chain reaction (qPCR) was used to compare the expression of RAGE and TLR 1, 2, 4, 6, and 9. In addition, flow cytometric analysis (FACS) was used to determine the amount of a give n protein expressed on a single cell. Here comparisons in protein expression were measur ed between GECs from NOD and C57BL6 mice at ages 4, 8, 12, 16 weeks. In order to demonstrate a potential model of how RAGE, and TLR 1, 2, 4, 6, 9 can be affected by hyperglycemic condition, an in vitro stimulation assay using human oral keratinocyte (HOK) along with sources of TLR ligand, sol uble RAGE (sRAGE), N-(carboxymethyl) lysine (CML), performed under both hyperglycemic and normoglycemic conditions. Supernatant from the in vitro stimulation assay was used to measure expression levels of pro-inflammatory cytokines, anti-inflammatory cytokines, and chemokines. In addition, gene expression of TLR 1, 2, 4, 6, 9 and RAGE were evaluated using qPCR. We found that there was no difference in certain TLR protein expression between NOD and C57BL6 mice. However, our findings show ed inverse TLR and/or RAGE gene expression, with C57BL6 mice increasing gene expression and NOD mice decreasing gene expression with age. Furthermore, we found that TLR and RAGE ligation under hyperglycemic conditions results in an increase in pro-inflammatory re sponses and inhibits anti-inflammatory responses. 14

PAGE 15

15 Hypothesis: Diabetogenic epithelial cel ls have alterations in their TLR and/or RAGE innate immune pathways.

PAGE 16

CHAPTER 2 BACKGROUND Type 1 Diabetes Type 1 diabetes (T1D) is characterized as a chronic cellular mediated autoimmune disease in which insulin producing pancreatic -cells of the Islets of Lange rhans are gradually destroyed by auto-reactive T cells resulting in life-long dependence on exogenous insulin (1,2). During the onset of T1D the islets of Langerhans are infi ltrated with mononuclear cells and when roughly 80% of islets no longer functional, symptoms begin to occur (3). While the cause of T1D has been linked to environmental factors that elicit the induction of an autoimmune response (4), multiple aberra nt immune responses can be implicated in the gradual destruction of pancreatic -cells resulting in the development of T1D (5). Here the mononuclear infiltrate can be identified as macrophages, T lymphocytes, CD4 and CD8 positive T cells (6, 7). In addition, auto-antibodies to insulin (IAA), glutamic acid decarboxylase (GAD), and insulinoma-associated antigen (IA-2) can be found in the peripheral blood before the onset of T1D (8). Here, the presence of IAA, GA D, and IA-2 in the peripheral blood causes a prolonged immune response that persists until th e onset of T1D has been diagnosed (9). Hyperglycemia is a consequence of diabetes resulting from abnormal fat, sugar, and protein metabolism. Hyperglycemic conditions found in diabetic patients is due to exaggerated oxidative stress caused by increase d oxidation of sugars, non-saturated fats and glycated proteins leading to glucose auto-oxidati on and decreased antioxidant levels (10). Hyperglycemia is a strong risk factor in the devel opment of secondary diabetic complications including the potential to alter the periodontal environment (11). Second ary complications are consequences of indirect and direct cellular damage caused by prolonged peri ods of high glucose concentrations (12). Hyperglycemia affects cells indirectly due to the production of advance glycated end products 16

PAGE 17

(AGE) (13), which are discussed below. Studies have shown that hyperglycemia causes impaired host defense against pathogens, prol onged inflammatory response, microvascular alterations, impaired bone formation and repair, and impaired wound healing in the periodontium (14-19). Hyperglycemia, caused by diabetes, in creases glucose concentration in the gingival crevicular fluid altering the sali vary environment in the periodont al pockets (20-23) leading to cellular and molecular alteration in the periodontium (24). Innate and Adaptive Immune Response in Auto-Immunity The adaptive immune system consists of T and B cells that display antigen specific receptors. During cell development cells somatical ly generated structurally unique receptors. This aspect of the adaptive immune system allows the B and T cells to response to largely diverse number of pathogens and immune insults. Interactions with self-ligands in the thymus allow for the generation of the receptors found on na ve B and T cell, resulting in the signaling of B and T cells to mature and survive. The abil ity of the adaptive imm une system to recognize self-molecules indicates under ce rtain inflammatory conditions an inappropriate adaptive immune response can be elicited and therefor e be responsible for the development of an autoimmune disease. The innate immune systems response to environmental infection is a main factor in activating an aggressive adaptiv e immune response that can induce autoimmune disease. An innate immune response is the initial immune response resu lting from any form of an environmental antigen. Microbial antigens can cause an innate immune response and under the right conditions can induce auto immunity through mo lecular mimicry, poly clonal activation, the release of previously sequestered antigen, or bystander activation. For instance, self-antigens released by damaged tissues are taken up by innate immune effect or cells such as macrophages and dendritic cells. If these cells have b een activated by lipopolysaccharide (LPS), double 17

PAGE 18

stranded RNA or activated T cell secreted factors, this bystander activation can result in dendritic cells presenting antigen and eliciting an inappr opriate adaptive immune response through which autoimmune disease may develop. Thus, a cells threshold for activation can be lowered by the up-regulation of co-stimulatory molecules on an tigen-presenting cells during an infection resulting in increased chances of developing autoimmune disease if in the presence of autoantigen (25). Periodontal Diseases Periodontal diseases are a group of diseases consisting of two main levels of infection: gingivitis followed by periodontitis, with periodontitis being the most severe and destructive. Gingivitis is the inflammation of the soft tissue surrounding the toot h, caused by microbial plaque that induces an immune response. Gingi vitis progresses into pe riodontitis, resulting in the destruction of periodontal ligament, bone, and soft tissue and the supp orting structure of the tooth resulting in tooth loss. Periodontitis does not affect all teeth evenly, indicating the relation to the retention plaque in ar eas absent of oral hygiene, l eading to calculus accumulation. Interaction of genetic, envir onmental, host and microbial f actors are correlated to the development of periodontal disease (26). The pr ogression of periodontal dise ase is linked to risk factors which include genetics, age, sex, smoking socioeconomic factors and systemic diseases. Gingivitis is a result of inflammation in res ponse to the accumulation of microbial plaque on the tooth surface (27-31), which results in the alteration of blood vessel network and capillary beds within the gingival tissue. An increase of inflammatory cells in the gingival tissue is caused by proteins from the blood entering through open capil lary beds that under healthy circumstances would be closed. Lymphocytes, macrophages, and neutrophils are the inflammatory cells that migrate to the gingival tissue in response to micr obial plaque. Bacteria are engulf and digested 18

PAGE 19

by the phagocytic macrophages and neutrophils, during which an immune response against microbes is initiated by lymphocytes. Roughly ten to twenty days of accumulation of microbial plaque leads to neutrophils and the barrier of epithelial cells being overwhelmed resulting in inflammation of gingival tissue and the development of gingivitis (32). Redness, swelling, and gingival bleeding are distinctiv e of gingivitis; however rem oving plaque from the gingival crevicular area can eliminate the inflammation of the gingival tissue ( 33). Neutrophils are attracted to the gingival crevicul ar area by chemotactic peptides that are released by bacteria present in the gingival crevicul ar pocket (34, 35), while other le ukocytes migrate to the gingival crevicular pocket in response to the release of cytokines by epithelia l cells being damaged by bacteria. In addition, gingival tissue can be damaged by toxic enzymes released by neutrophils degranulating in response to being overloaded with phagocytosed bacteria. Gingivitis can progress into periodontitis in about six or more months (34). The irreversible damage characterized as periodontitis is the result of the host immune response to the initial destruction of ti ssue induced by microbial plaque. In response to tissue damage caused by microbes the host immune responses by producing enzymes such as metallomatrix proteases (MMP), that are responsible for breaking down tissue. The tissue destroying enzymes are necessary in order to remove infected and non-infected yet damaged tissue from the areas of infection. The host response to re move tissue from the bacteria in fected areas is a process used by the immune system to stop inflammation. Th is tissue destruction continues to occur and therefore periodontitis is char acterized by bone loss and apical migration of the epithelial attachment eventually resulting in tooth loss. As a result of tooth loss, microbial plaque no longer has a tooth site to accumulate, a nd the inflammatory response subsides. 19

PAGE 20

The destructive organisms involved in periodontal disease are mainly Porphyromonas gingivalis, Actinobacilllus actinomycetemcomitans, Treponema denticola, Bacteroides forsythus, and Prevotella intermedia (36). Microbial plaq ue contains periodontal pathogens that produce enzymes and toxins that initiate inflammati on and damage gingival tissue (37). Host cell membranes and collagen are broken down by periodontal pathogen produced enzymes in order to produce nutrients necessary for pathogen grow th. As the host immune and inflammatory processes are initiated in response to periodontal pathogens, inflammatory molecules such as proteases, cytokines, and prosta glandins are released by leukocytes and fibroblasts (38, 39). Tissues collagen structure is destroyed by prot eases, creating openings for leukocyte infiltration to progress (40). Prolonged inflammation of the periodontal tissue causes connective tissue attachment to the tooth to be destroyed resulti ng in the epithelial cells to proliferate apically toward the root of the tooth in creasing the depth of the sulcus or periodontal pocket (41). Inflammatory molecules migrating into the period ontal tissue continue to increase as the pocket depth of the sulcus increases. As the density of microbial plaque and pocket depth increase, a more destructive and chronic hos t response is generated until conn ective tissues fibers anchoring the root to gingival connective tissue are destroye d, alveolar bone loss, apical migration of the epithelial attachment, resu lting tooth loss (42, 43). Relationship between Diabetes Me llitus and Periodontal Disease Many studies have demonstrated the close correlation betw een diabetes mellitus and periodontal disease (44-50). A meta -analysis using diabetic adults concluded that the majority of past studies found more severe periodontal disease in diabetic pa tients than in adults without diabetes, confirming a significant association between periodontal disease and diabetes (51). Also a two-year longitudinal st udy demonstrated that diabetic subjects had a significantly increased risk for alveolar bone loss compared to non-diabetic indi viduals, with an odds ratio of 20

PAGE 21

4.2. Among those patients, poorly controlled diab etics had an odds ratio of 11.4 compared to 2.2 of well controlled diabetics (49). The strength of evidence on the relati onship between diabetes and periodontal disease have led some to suggest that periodontal diseas e should be listed among the classic complications of diabetes (50). Just as diabetes contributes to increased in cidences and severity of periodontal disease, periodontal disease can have a sign ificant impact on the metabolic state of diabetics (52). For instance, in a two-year longitudina l trial, diabetic subjects with severe periodontitis at baseline had a six-fold increase risk of worsening glycemic control compared to di abetic subjects without periodontitis (53). In addition eighty-two percent of diabetic patients with severe periodontitis experienced the onset of one or more diabetic complications such as major cardiovascular, cerebrovascular, or peripheral vasc ular events compared to only twenty-one percent of diabetic subjects without periodontitis (5 4). The pathology associated with chronic disease processes such as periodontitis have been implicated in th e increased susceptibility to infection which is more inflammatory in nature and associated with an exaggerated secretion of innate inflammatory mediators and systemic marker s of inflammation. Abnormal inflammatory responses, known as hyper-inflammat ory trait have been linked to diabetes (55, 56). These and other studies support the notion that the presence of periodontal dis ease in diabetic patients may increase insulin resistance and contribute to wo rsening of the diabetic state and diabetic complications (53-62), although the mechanism of how this occurs is still unclear. Importantly, studies have demonstrated that mechanical periodontal treatment can improve the level of metabolic control in patients with diabetes (63-65). 21

PAGE 22

Gingival Epithelial Cells (GEC) In the periodontal ti ssue gingival epithelial cells (GEC) are a centr al component of the barrier between oral microflora and internal tissues and exhibit innate immune cell function. Research has shown that the oral epithelium play a key role in the innate immune response by producing anti-microbial peptides and chemokine s which recruit neutrophils (66, 67). In addition, GEC are capable of phagoc ytosing and digesting extracellu lar debris, erythrocytes, and microorganisms such as Candida albicans, Mycobacterium leprae, and Actinobacillus actinomycetemcomitans (68-72). Research has shown that GEC express the class II major histocompatibility complex (MHC) HLA-DR, signi fying antigen presentation capability, T cell stimulation and resultant adaptive immunity (67) Co-stimulatory signals through engagement of CD28 on the T cell and B7 co-stimulatory molecules, B7-1 (CD80) and B7-2 (CD86), on the antigen presenting cell (APC) are required for antig en specific T-cell activation my MHC class II engagement. It neither has yet to be estab lished whether GEC generally express the B7 costimulatory molecules (67) nor has whether th ey can contribute to an tigen presentation. GEC use innate immune receptors such as Toll-like receptors (TLRs), which are discussed below, to fight pathogenic infection and to prevent breaching of the epithelial barrier by pathogens (73). Indeed, GEC have demonstrated many of the same innate immune receptors for bacterial components also expres sed on monocytes, macrophages, and dendritic cells (74-76). It is has been demonstrated that GEC express i nnate immunes Toll-like re ceptors (TLR) 2, 4 and 6 in healthy oral epithelial ti ssue allowing GEC to recognized th e different range of pathogen associated molecular patterns th at are encountered (75, 77). It has been found that GEC respond differently to TLR stimulation than other mu cosal epithelium indica ting significantly higher expression of TLR in diseased gi ngival epithelial tissue (75). 22

PAGE 23

A hyper-responsive trait displayed in diabetic patients has primarily been identified in monocytes and macrophages of th e innate immune system and exhibits the monocytic hyperresponsiveness to bacterial antig ens resulting in increased production of pro-inflammatory cytokines and mediators which i nduce tissue destructi on, attachment loss and bone loss (40-42). Innate immune cells are known to be responsible for hyper-responsiveness in diabetic patients; however the role of GEC in the hyper-responsiv eness trait has yet to be established. Toll-like Receptor (TLR) Toll-like receptors (TLRs) are specific recogn ition receptors located both intracellular and on the cell surface that responds to pathogen as sociated molecular patterns (PAMP). TLR signaling in response to microbial infections can directly initiate an innate immune response and can control the activation and ba lance of an adaptive immune re sponse with the possibility of altering the adaptive immune re sponse (78). Host defense responses use TLR to detect infectious microorganism and in turn elicit strong inflammatory response in order to destroy any invading pathogens. Bacterial li popolysaccharides, peptidoglycan, lipoproteins, bacterial DNA, and double stranded RNA are all pathogen associat ed molecular patterns. The extracellular domains of TLR contain structural areas leucine-rich repeats, in which the consistency leucinerich repeats responds to specific pathogen associated molecular pa ttern responsible for microbial infection (79, 80). The ligands recognized by TLR that have been identified are as follows: TLR 1 binds triacyl lipopeptides, TLR 2 binds peptid oglycan (81), TLR 3 binds viral double-stranded RNA (82), TLR 4 binds lipopolysac charide (83, 84), TLR 5 binds flagellin (85), TLR 6 binds peptidoglycans and lipoteichoic acid (84), TLR 7 binds Imidazoqui noline (86), TLR 8 binds viral single-stranded RNA (87), and TLR 9 binds ba cterial DNA (88). Generally, recognition of pathogen associated molecular patterns is re quired by a combination of TLR (79, 80). An example of combination recognition is TLR 2 forms heterophilic diamers with TLR 1 which 23

PAGE 24

recognize triacyl lipopeptides and heterodiameriz ation of TLR 2 with TLR 6 which recognize diacyl (89). TLR 1, 2, 4, 5, and 6 are cell surface receptors an d generally recognize microbial molecules whereas TLR 3, 7, 8, and 9 are intrace llular receptors where TLR 3 recognizes double stranded RNA, TLR 7 and 8 recognizes si ngle stranded RNA, and TLR 9 recognizes unmethylated CpG DNA (73). Cytoplasmic adaptor molecules are a main component of TLR signaling pathway and interact with TLR domain at th e initiation of TLR ligation. The cytoplasmic adaptor molecules identified for TLR signaling cascades are myeloid differentiation primary-response protein 88 (MyD88), Toll/interleukin-1 receptor domain-containing ad aptor-inducing interferonTRIF, TIR domain containing protein (TIRAP), TRAM, and SARM, with MyD88 being a key adapter molecule responsible in most TLR signaling path ways (90). In the MyD88-dependent pathway, TLR signaling activates MyD88 wh ich is in turn mediates the activation of interleukin 1receptor-associated kinase (IRAK), IRAK then activates tumor-nec rosis-factor-receptorassociated factor 6 (TRAF6), which leads to the activation of two different pathways. One pathway activates a mitogen-activated pr otein (MAPKKK) called TAK1 and TAK1 phosphorylates and activates the IKK complex. IKK liberates NF B from its inhibitor I B so that it can translocate to the nucleus. The s econd pathway initiates the transforming growth factor -activated kinase leading to th e transforming of growth factor -activated kinase-1binding protein complex, the activity of the inhibitor of nuclear factor B kinase (IkK) complex is then enhanced, which induces expression of cytokines and chemokines after translocation of NFkB into the nucleus (91). On the othe r hand, MyD88-independent pathway activates interferon-regulatory factor-3 which then induces type I in terferon (82, 92). 24

PAGE 25

Different TLR are expressed on neutrophils, mo nocytes, macrophages, and dendritic cells, allowing these innate immune cells to induce a large variety of immune responses on specific pathogens. Neutrophils, found pre dominately in the blood, are the innate immunes systems first cells to migrate to the site of infection, expres sing TLR 1, 2, and 4, uses these specific receptors to recognize and bind specific microbial pathogens (93). Also involved in the innate immunes systems response are monocytes and macrophages, which recognized, engulf, and kill microorganisms by expressing TLR 1, 2,4, and 8 (94). TLR expressed on immature dendritic cells recognized pathogen associated molecu lar patterns from pathogens and through their signaling pathway activate the dendritic cell using co-stimulatory molecule and results in the production of cytokines and chemokines when e ngaging in T-cell priming and differentiation (95). TLR 2, 6, and 9 are expressed on gingival epithelial cells, allowing expressed TLR to recognize and bind pathogen associated molecular pa tterns that invade th e oral cavity (77). Gingival epithelial cells have al so been found to express TLR 4 in low levels however the level of expression was found to in crease when trea ted by interferon(96). Advanced Glycated End Product (AGE)/Ad vanced Glycated End Product Receptor (RAGE) AGEs are complex, heterogeneous molecules ge nerated by glycation and oxidation caused by a reaction between carbohydrates and free amino groups of proteins in the environment of oxidant stress and hyperglycemia (97-99). AGEs ar e formed by the non-enzymatic interaction of reducing sugars with amino groups in proteins, lipids, and nucleic acids forming Schiff bases which rearrange to form a stable and irreversible Amadori product, that further reacts with dicarbonyl intermediates (100, 101). Under conditi ons of hyperglycemia the concentration of intracellular glucose, fructose, and fructose-3phosphate is increased allowing for glycation 25

PAGE 26

reactions to occur by the reduction of sugars leading to the formation of AGE in the cell matrix which can migrate in th e body fluids (102). AGE chemical characteristics found in human s are pentsidine (103) and cayboxyl methyl lysine (CML) (4). AGE formation, also known as the Maillard reaction, affects long-lived proteins and therefore requires weeks to occur during which condensation between an amino group and a carboxyl group, form a Schiff base. Molecular rearrangement of the Schiff base forms an N-substituted glycosylamine whic h result in Amadori products. Non-oxidative rearrangement and hydrolysis of Amadori produc ts forms 3-deoxyglucosone which reacts with free amino groups leading to cross-linked proteins (10). AGE i nduced formation of cross-linked proteins has been implicated in the increased stiffness of the protein matrix consequentially obstructing function and damaging the process of tissue remodeling which also occurs in advancing age and diabetes (100). A normal physiological process of aging is the accumulation of AGEs; however, AGE accumulation is accelerated and occurs at an earli er age in individual w ith diabetes mellitus (103, 104-106). The severity of complications caused by diabetes has been associated to the accumulation of AGE deposits (107). Formation and accumulation of AGEs has been linked between high plasma glucose levels and tissue da mage related to capillary basement membrane thickening and hypertrophy of extravascular matrix which are common diabetic microvascular complications (108). Renal failure in diabetic patients has been observe d due to the increased levels of AGEs in serum and tissue causing kidneys the reduced ability of remove AGEs (109111). Research has demonstrated irreversible cro ss-linking of matrix struct ural proteins such as collagen, laminin, and fibronectin leading to basement membrane th ickening through the reduction of susceptibility to proteolytic degradati on of these proteins dire ctly correlated to the 26

PAGE 27

accumulation of AGEs (112). The thickening of the basement membrane impedes the membranes functionality associated with filtration and permeability properties (113). Proteins such as albumin, hemoglobin, lens crystalline, an d LDL cholesterol has been identified as AGE carriers (100). Research has shown that the activation of oxidative st ress and the stimulated production and release of cytokines is due to th e interaction of AGE and AGE receptor (RAGE) resulting in increased tissue damage (114). RAGE is a multiligand receptor of the imm unoglobulin superfamily and serves as a receptor not only of AGE but also for non-glyc ated endogenous peptide ligands, such as amyloid-protien, amphoterin (HMGB1), and S100/ calgranulin (115, 116). RAGE recognizes and binds the multiple -sheets and three-dimensional st ructure of these ligands. The extracellular ligand-bind module of RAGE contains two N-linked glycosylation sites and an Nterminal portion with three Ig domains which co nsist of two C-type domains and one V-type domain. In addition, RAGE is anchored to the cellular plasma membrane by a single transmembrane domain (117). Interestingly, research has demonstrated that the interaction of RAGE with AGEs and ligands leads to NFB activation, however the signaling pathway from RAGE to NFB has yet to be established. Yet it is known that the ligation of RAGE on monocytes, macrophages, smooth muscle cells, e ndothelial cells, and astrocytes results in prolonged inflammation caused by th e production and release of pr o-inflammatory cytokines and chemokines (99). In addition, act ivation of MAP-kinases and NFB mediated by AGE-RAGE interactions leads to amplifie d production of vascular cell adhesion molecule (VCAM-1) by which AGEs use to increase adhesion to pro-infla mmatory cells at the cell surface. Murine Model System The non-obese diabetic (NOD) st rain of mouse is a main mo del of autoimmune type 1 diabetes (T1D). The NOD strain of mice was de veloped in Japan and de rived from the outbred 27

PAGE 28

Jc1:ICR line of mice during sel ection of a cataract-prone st rain of mice (118, 119). Through repetitive brother-sister mati ng of the cataract-prone strain, the NOD stain was developed as a strain that spontaneously deve loped diabetes (118-120). The NOD strains spontaneous onset of diabetes usually begins between 12 to 14 weeks of age in female mice and later in male mice with the incidence of spontaneous diabetes occu rring in 60% to 80% of female mice and 20% to 30% in male mice (119, 121). Incidences of s pontaneous diabetes in NOD mice occur at a higher rate when the NOD mice are housed in a ge rm-free facility sugges ting that in a dirty environment the NOD mouse immune system is e ngaged in protecting agai nst foreign proteins and protecting against autoimmunity, allergy, and other disease leading to decreased incidences of spontaneous diabetes (121, 122). The decrea sed incidence of spontaneous diabetes in NOD mice as result of a dirty e nvironment is still unclear. NOD strain possesses an immune defect lead ing to autoimmune destruction of the pancreas resembling the development of T1D in human. Female NOD mice develop permanent hyperglycemia at sixteen to twenty weeks of ag e. At three to four weeks of age NOD mice demonstrate immune cell infiltrates that surround th e islet, after which thes e infiltrates continue to invade the islets leading to insulitis and ev entual at ten weeks of age demonstrate severe insulitis (120). The mononuclear in filtrates that invade the islets consist mainly of CD4+ T cells, although CD8+ T cells, B cells, dendritic cells, natural killer (NK) cells, and macrophages are also present in the lesions (118, 119). Research suggests that the pa thogenesis of T1D in NOD mice is primarily due to both CD4+ and CD8+ T cells (121, 123, and 124). CD4+ T cells directly mediat e destruction of islet cells in response to prior destruction of islet ce lls by CD8+ T cells (125). The pancreatic islets insulin, insulinoma-associated pr otein 2 (IA-2), GAD, and heat shock protein 60 (Hsp60) have 28

PAGE 29

been identified as specific an tigens recognized by CD+4 and CD +8 T cells in diabetogenic NOD mice (126). The combination of antigen mi micry, nonspecific inflammation, and defective tolerogenic processes may promote multiple T cell reactivities to islet expressing autoantigens in initiating the pathogenic process of T1D (120). A number of other immune def ects associated with multiple subsets of leukocytes which include defective macrophage maturation and func tion (127), low levels of NK cell activity (128, 129), defects in NKT cells (130, 131), deficien cies in their regulat ory CD4+ CD25+ T cell population (132), and the absence of C5a and hemolytic complement (133) contribute to the development of autoimmunity in NOD mice. T1D progression in NOD mice can be contributed to intrinsic defects leading to an acquired ly mphopenia that evolves with age and allows homeostatic proliferation of nave T cells (134). 29

PAGE 30

CHAPTER 3 MATERIALS AND METHODS Harvesting Gingival Epithelial Tissue Gingival epithelial tissu e was harvest from CO2 euthanized female mice by using scissors to cut the temporalis, condyle, and masseter areas of the mandibl e, allowing for the mandible to be removed. Cuts were also made on the ventra l surface to allow removal of the tongue and on the lower labial frenum to allow separation of skin and tissue from the outside area of the mandible. Using a dissection microscope (Zei ss), a 3.0 mm depth ROBO Z microsurgical blade was used to make incisions above and below the gingiva located around the molars of the mandible. Dissection tweezers were then used to remove the excised gingival tissue. Tissues were either placed in RLT buffer (Qiagen) or flow cytometric staining buffer for RNA purification and FACS an alysis respectively. Primary Culture of Human Oral Keratinocytes (HOK) The vial containing frozen Hu man Oral Keratinocytes was pl aced in 37 water bath and rotated until the contents was co mpletely thawed, after which th e contents were plated onto a poly-L-lysine coated culture vessel (T75 flask) filled with 19mL of oral keratinocyte growth media (500mL Basal media, 5mL Oral keratinocyte growth supplement (OKGS), and 5mL Penicillin/Streptomycin (P/S)). The T75 flask was gently rotated to distribute the cells evenly and then allowed to incubate for 37C with 5% CO2 for sixteen hours. After which, the growth media was then removed and replaced and re peated every other day following until the cell culture reached 50% conf luence. At 50% confluence the growth media was changed every day until the cell culture reached 80% confluence. At 80% confluence the cell culture was then split. Here, media was removed and cells were washed w ith sterile PBS and 10mL of cell stripper for 10-15 minutes at 37 5% CO2. Cells were then removed and washed by centrifugation at 1200 30

PAGE 31

rpm and 4 for 10 minutes. Resultant cells were counted and plated for the appropriate assays and frozen for later use. HOK Stimulation Assay HOK cells were isolated from an established primary HOK cell culture. 1x10^5 cells/mL (1mL of growth media) were added to eighteen we lls of poly-L-lysine coat ed six-well plates. An additional 1mL of oral keratinoc yte growth media (500mL Basal media, 5mL Oral keratinocyte growth supplement (OKGS), and 5mL Penicillin/Streptomycin (P/S )) was added to each of the eighteen wells. The six-well plates were gently rotated to distribu te the cells evenly and allowed to incubate at 37C 5%CO2 for sixteen hours. The growth media was then change the following day and then changed every other day following until the cell culture reached 50% confluence. At 50% confluence the growth media was change d every day until the cell culture reached 80% confluence. At 80% confluence, 15mMol glucose was added to some of the wells to establish hyperglycemic environments allowed to incubate at 37C 5%CO2 for twenty-four hours. After which some cultures of both hyperg lycemic and normoglycemic wells were either treated with 1g/mL of the following stim ulants: ultra-pure LPS from P.gingivalis ultra-pure LPS from E.coli ODN 2395 type C CpG oligonucleotide, Pam2CS K4 synthetic bacter ial lipoprotein, FSL1 synthetic diacylated lipoprotei n, N-(carboxy methyl) lysine (CML), CML and soluble RAGE (sRAGE),or were left untreate d. All cultures were allowed to incubate at 37C 5%CO2 for twenty-four hours. The resultant supernatants were t used in the Beadlyte Human 22-Plex Multi-Cytokine Detection System. In addition, RNA from the cu ltures was also isolated using an RNeasy kit (Qiagen) as previously described. The HOK cell stimulation was performed three times for both normoglycemic and hyperglycemic conditions. 31

PAGE 32

Purification of RNA A Qiagen RNeasy Mini Kit was used for RNA purification. The excise d gingival tissue or HOK cell cultures were disrupted, homogenized a nd/or lysed in 600L of RLT lysis buffer in preparation for disruption and hom ogenization. The lysate was cen trifuged for three minutes at full speed. The supernatant was carefully re moved by pipetting and transferred to a new microcentrifuge tube. Only the supernatant (lysate) was used from this point. One volume of 70% ethanol was added to the clear lysate, and was immediately mixed by pipetting. The sample and any precipitate was transfe rred to an RNeasy spin column placed in a 2mL collection tube and then centrifuged for fifteen seconds at 8000 x g (10000 rpm). After which the flow-through was discarded. 700L of RW1 buffer was added to the RNeasy spin column and then centrifuged for fifteen seconds at 8000 x g to wa sh the spin column membrane. Again the flowthrough was discarded. 500L of RPE buffer wa s added to the RNeasy spin column and centrifuged for fifteen seconds at 8000 x g to wa sh the spin column me mbrane after which the flow-through was discarded. Another 500L of RPE buffer was added to the RNeasy spin column and then centrifuged for two minutes at 8000 x g to wash the spin column. The longer centrifugation dries the spin column membrane, en suring that no ethanol is carried over during RNA elution. After centrifugation the RNeasy spin column was car efully removed so that the column did not contact the flow-though and placed into a new 1.5mL collection tube. Lastly, 50L of RNase-free water was added directly to the spin column membrane and then centrifuged for one minute at 8000 x g to elute the RNA. Reverse Transcription 5L/reaction of 5x buffers, 1L/reaction of 10mM DTTs, 2L/reaction of dNTPs, 0.25L/reaction of reverse transc riptase, and 1L/reaction of random oligonucleotide were added to 1.5mL eppendorf to tube to make a ma ster mix. The tube was then mixed by vortex 32

PAGE 33

and quick spin centrifugation. 9.25 L of master mix was added to the appropriate number of 0.5L eppendorf tubes (i.e. the number of reactions being performed at a given). 15.75L of RNA (from either GEC or HOK cells) and Rnase/Dn ase free water (if less than 15.75L of RNA was being used) were added to the appropriate 0.5L eppendorf tube containing aliquots of master mix. The thermocycler conditions were set to the following: 40 minutes at 40; 15 minutes at 70; then hold at 4. Real-Time Quantitative Polym erase Chain Reaction (qPCR) 12.5 L/reaction of 2x Syber Green Master Mix, 1L/reaction of both 10M Forward primer and 10M Reverse primer, and 9.5L/reaction of Rnase/Dnase free water were all add to an 1.5 eppendorf tube to make a master mi x. Primers used included: Integrated DNA Technologies mRAGE (mouse), TTG GAG AGC CAC TTG TGC TA (forward) and CCC TCA TCG ACA ATT CCA GT (reverse); SA Bioscience SYBR Green Mouse TLR 1 TTGCCC ATCACAATCT CT; SA Biosci ence SYBR Green Mouse TLR 2 TGAA AAACCTGACC TCTCT; SA Bioscience SYBR Green Mouse TLR 4 TCAAC TGAACTGAAC GGTTT; SA Bioscience SYBR Green Mouse TLR 6 CCTGATAT CAGCTTTCTG TC; SA Bioscience SYBR Green Mouse TLR 9 GCC ACACCAACAT CCTGGTT; SA Bioscience SYBR Green Human TLR 1 CTTGGA TTTGTCCCAC AACA; SA Bioscience SY BR Green Human TLR 2 C AGAG GTGTGTGAAC CTCCA; SA Bioscience SYBR Green Human TLR 4 C TGTGTGTATT TGAAAGTGTG; SA Bioscience SYBR Green Human TLR 6 TCT GCTTTCCCAA ATGGATT; SA Bioscience SYBR Green Human TLR 9 CCTGAGG GTGGAAGTGT CCT; Integrated DNA Technologies mRAGE (human), GAC TCT TAG CTG GCA CTT GGA T (forward) and GGA CTT CAC AGG TCA GGG TTA C (reverse). Gl yceraldehyde 3-phosphate dehydrogenase is constitutively expressed in all cells and therefore allows for normalization of 33

PAGE 34

the total DNA isolated from the PCR reaction. The primers for G3PDH were, ACCACAGTCCATGCCATCAC (forward) a nd TCCACCACCCTGTTGCTGTA (reverse). The tube was then mixed by vortex and quick spin centrifugation. 20L of the master mix were then added to appropriate number of well of a 96 well thermocycler plate. 1L of cDNA was then added to the appropriate wells of the 96 well themocycler plate containing aliquots of master mix. The 96 well plate is then place in the qPCR thermocycler set the following run cycles: 95 for 10 minutes; 95 for 15 seconds; 60 for 60 seconds for 40 cycles; then hold at 4. Standard curves that were generated from serial dilutions of each gene used to measure mRNA transcript copy number. Each ge ne was detected in independent real-time PCR reactions using 10 l of a 50 l total cDNA mixture. Data are ex pressed as a copy number normalized GAPDH content. The normalized mRNA copy number for a gene was determined by: [raw transcript copy number derived from standard curve] [GAPDH corrective ratio]. The GAPDH corrective ratio was calculated as [lowest GAPDH copy number within sample set]/ [GAPDH copy number for cell of interest]. Flow Cytometry (FACS) The excised gingival tissue was ground between two frosted ends of microscope slides to create single cell suspension while in 15L of PBS to prevent the tissue and cell from drying out. The single cell suspension/PBS was placed into a 50L tube and centrifuged at 1200 rpm for ten minutes at 4C. After discarding the supernatant, the pellet was resuspended in PBS, filtered, and aliquots of 200L of cells we re added to a 96 well plate. The 96 well plate was centrifuged at 1200 rpm for ten minutes at 4C after which the supernatant was discarded. The cells were resuspened in 100L of primar y antibody master mix (1:200 dilu tion of antibody in FACS buffer (1% FBS in PBS)) and incubated in dark for thir ty minutes at 4C. An tibodies used included: 34

PAGE 35

eBioscience Biotin anti-mouse TLR 1, clone: eBioTR23; eBiosc ience anti-mouse TLR 2, clone: T2.5; eBioscience Biotin an ti-mouse TLR 4, clone: UT41. The 96 well plate was then centrifuged at1200 rpm was ten minutes at 4C and the supernatant was discarded. The cells were resuspended in 200L of FACS buffe r followed by centrifugation and removal of supernatant. 100L of the secondary antibody master mix (if needed) was added to cells followed by incubation in the dark for thirty minutes at 4C. The 96 well plate was then centrifuged and supernatant was removed. The cells were resuspended in 200L FACS buffer followed by centrifugation and remova l of supernatant. The cells were resuspended in 200L of FACS buffer and transferred to FACS tubes. 200L more of FACS buffer was added to the FACS tubes. Then BD bioscience FACS Calibur system with BD bioscience Cell quest software was used for data collection. Luminex Supernatant, taken afte r HOK cells had been stimulated for twenty-four hours, was used in the Beadlyte Human 22-Plex Multi-Cytokine Detection System. The human 26-plex MultiCytokine Standard were resuspended in 1mL of tissue culture media (TCM), after which was serial diluted 1:3 to make eight standards. 50 L of the standards and sample were added to a well of a primed filter bottom 96 well plate. The Beadlyte Human 22plex Multi-Cytokine Beads were vortexed at high speed for fifteen seconds and then sonicated for fifteen seconds using a microbead sonicator bath after which 25L of the bead solution was added to each well. The filter plate wells were then covered and mixed by vortex, followed by two hours of incubation in a dark room at room temperature on a plate shaker. The vacuum manifold was applied to the bottom of the filter plate a nd the liquid was remove d, after which, 50L of Beadlyte Cytokine Assay Buffer was used to wash the well content two times. 75L of Beadlyte Cytokine Assay Buffer was used to su spend the wells contents, after which 25L of 35

PAGE 36

Beadlyte Human 22-plex Multi-Cy tokine biotin was then added to each well and the filter plate was incubated for 1.5 hours in at the dark at room temperature on a plate shaker. Beadlyte Streptavidin-Phycoerythrin was diluted 1:12.5 in Beadlyte Cytokine Assay Buffer. 25L of Beadlyte Streptavidin-Phycoerythrin dilution wa s added to each well. The filter plate was covered and mixed by vortex at a low speed follo wed by thirty minutes of incubation in a dark room at room temperature on a plate shaker. 25L of Beadlyte Stop solution was added after which the filter plate was vortexe d gently and incubated for five minutes at room temperature in the dark. Vacuum manifold was then applied to the bottom of the filter plate and liquid was removed. 125L of sheath fluid was then add to each well then mixed by vortex at a low speed and placed on a plate shaker for one minute. The Luminex 100 System was used to acquire the results and Milliplex Analyst Software (V igeneTech) was used to analyze the results. 36

PAGE 37

CHAPTER 4 RESULTS C57BL6 and NOD mice exhibit di fferent TLR protein expression Flow cytometry (FACS) was used in order to determine the amount of TLR2 protein expression on the surface of GECs. To accomplish this, GECs were harvested from both C57BL6 and NOD mice at 4, 8, 12, and 16 weeks of ag e. The harvested GECs were stained with antibodies specific for TLR2 protein. TLR2 pr otein expression of levels of C57BL6 and NOD were than analyzed and compared using Gra phPad Prism 4 analysis software. Fig. 4-1 demonstrates that TLR2 protei n expression decreases in both C57BL6 and NOD mice at 16 weeks of age with a significantly different percentage of TLR2 protein expression between C57BL6 and NOD mice at 16 weeks of age (p = 0.0058) with the higher expression level displayed in NOD mice. TLR4 protein expression on the surface of GECs, harvested from both C57BL6 and NOD mice at 4, 8, 12, and 16 weeks of age, was evaluated using FACS. To accomplish this, GECs were stained with TLR4 specific antibodies. Fig. 4-2 demonstrates that TLR4 single positive GECs displayed a significantly different pe rcentage of TLR4 prot ein expression between C57BL6 mice and NOD mice at 16 weeks of age (p = 0.0003) TLR4 protein expression increases in C57BL6 mice at 16 weeks of ag e, whereas TLR4 protein expression remains constant in NOD mice (fig. 4-2). TLR2/4 double positive protein expression on the surface of GECs harvested from C57BL6 and NOD mice at 4, 8, 12, 16 weeks of ag e was determined using FACS. GECs were stained with antibodies specific for TLR2/4 protein. Fig. 4-3 dem onstrates that NOD and C57BL6 mice express a significan tly different percentage of TLR2/4 double positive protein expression at 16 weeks of age (p = 0.0063) with the higher expression level displayed in NOD 37

PAGE 38

mice. TLR2/4 double positive protein expression decreases in both C57BL6 and NOD mice at 16 weeks of age. TLR1/2 double positive protein expression on th e surface of GECs harvested from NOD and C57BL6 mice at 4, 8, 12, and 16 weeks of ag e was evaluated using FACS. To accomplish this, GECs were stained with TLR1/2 protein sp ecific antibodies. Fig. 4-4 demonstrates TLR1/2 double positive protein expression was significantly higher in NOD mice at both 8 and 16 weeks of age as compared to C57BL6 mice (p = 0.0061 8wks; p = 0.0055 16 wks). TLR1/2 double positive protein expression decreases in both C57B L6 and NOD mice at 16 weeks of age (fig. 44). TLR1, 2, 1/2, and 4/2 protein expression on the surface of GECs harvested from NOD and C57BL6 mice at 4, 8, 12, and 16 weeks of age was determined using FACS. GECs were stained with TLR protein specific antibod ies after which FACs was utili zed in order to determine TLR protein expression. The only statis tically significant finding is th at both NOD and C57BL6 mice seem to decrease their innate immune TLR prot ein expression by 16 weeks of age, with the exception of TLR4 (all p < 0.0058) (fig. 4-3). When multiple comparisons were made, applying TLR protein expression at 4, 8, 12, and 16 weeks of age, there was no statistically significant difference in the protein expr ession of TLR1, 2, and 4 between NOD and C57BL6 mice. This demonstrates that with age TLR protein expression on the surface of GECs cannot be attributed to the different innate immune responses be tween NOD and C57BL6 mice. Therefore TLR protein expression cannot be employed as re asoning when comparing immune responses between type 1 diabetics and non-diabetics in regards to the triggering of prolonged inflammation resulting in tissue destruction. 38

PAGE 39

Fig. 4-40 demonstrates that our data showed no difference in TLR protein expression on a single GEC between C57BL6 and NOD mice at ages 4, 8, 12, and 16 weeks. TLR Gene Expression in C57BL6 Mice Increase over Time, Whereas TLR Gene Expression in NOD Mice Decreases over Time Real-time quantitative polymera se chain reaction (qPCR) was used to evaluate the relative gene expression of TLR1, 2, 4, 6, and 9 on the surface of GECs harvested from C57BL6 and NOD mice at 4, 8, 12, and 16 weeks of age. DNA content of TLR1, 2, 4, 6, and 9 was normalized to G3PDH after which copy numbers of TLR1, 2, 4, 6, and 9 were determined. TLR gene expression was analyzed and compared using GraphPad Prism 4 analysis software. Figures 4-5 thru 4-8 demonstrates that the relative gene expression of TLR1, 2, 4, 6, and 9 in C57BL6 mice increase over time, whereas TLR gene e xpression in NOD mice decreases over time. These data demonstrates that TLR gene expression in NOD and C57BL6 is contrary to our TLR protein expression data. This suggests that a change is occurring in the signaling pathway between TLR protein and TLR gene expressi on at the transcriptional level. C57BL6 and NOD mice display significantly di fferent TLR gene expression. Figures 4-5 and 4-8 demonstrates that C57BL6 and NOD mice display significantly different TLR4 and TLR6 gene expression at 12-16 weeks of age (p = 0.0015 at 12 wks; p = 0.0047 at 16 wks). Fig. 4-7 demonstrates significantly different TLR1 gene expres sion between C557BL6 and NOD mice at 8-16 weeks of age (p = 0.0208 at 8 wk s; p = 0.0003 at 12 wks; p = 0.008 at 16 wks). C57BL6 and NOD mice both displa y significantly different TLR2 a nd 9 gene expressions at 16 weeks of age (p = 0.0048). TLR Ligation Promotes a nd/or Inhibits Cytokine /Chemokine Secretion Luminex was used to decipher cytokine/chem okine responses of HOK when stimulated with TLR ligands. HOK cells cultures were established after which the HOK cells were 39

PAGE 40

stimulated with TLR ligands for 24 hours. Following stimulation supernatant was taken from all stimulation samples. Luminex results were an alyzed and compared using GraphPad Prism 4 analysis software. Fig. 4-13 de monstrates that TLR4 and TLR9 lig ation promotes the secretion of IL-6 pro-inflammatory cytokine when comp ared to IL-6 secretion level of non-stimulated HOK cells (all p < 0.0048 TLR4). We also see this same trend in the following proinflammatory cytokines and chemokines: GM-CSF, IL-8, TNF, IL-1 MIP1 MCP-1, and IP10. These data demonstrate that TLR ligati on exhibit the basis be hind the triggering of prolonged inflammation leadi ng to tissue destruction. Fig. 4-15 demonstrates that TLR2 ligation pr omotes IL-10 anti-inflammatory chemokine secretion when compared to IL-10 secretion resulting from both non-stimulated HOK cells and TLR4 ligation (p = 0.0039). Fig. 4-13 demonstrat es this anti-inflammatory promoting trend when comparing similar levels of IL-6 pro-inflammatory cytokine secretion resulting from TLR2 ligation and non-stimulated HOK cells. We also s ee these affects with ot her pro-inflammatory cytokines and chemokines (CSF, IL-8, TNF, IL-1 MIP1 MCP-1, and IP-10). The antiinflammatory response generated by TLR2 ligati on demonstrated the innate immune systems internal control of inflammatory responses and was unknown prior to this investigation. Fig. 4-13 demonstrates that TLR1 and/or TLR 6 diamerization to TLR2 and subsequent ligation results in the promotion of IL-6 pro-inflammatory cytokine secretion when compared to IL-6 secretion from non-stimulated HOK cells (all p < 0.0039). This trend was also seen with other pro-inflammatory cytokine s and chemokines (CSF, IL-8, TNF, IL-1 MIP1 MCP-1, and IP-10). This demonstrates that the diamerization of TLR 1 and/or TLR6 to TLR2 alters TLR2 ligation from resulting in an anti-inflammatory response to a pro-inflammatory response. 40

PAGE 41

This pro-inflammatory response can lead to prolonged inflammation resulting in tissue destruction. Luminex was also used to decipher cyt okine/chemokine responses of HOK when stimulated with TLR ligands in hyperglycemic conditions. HOK ce lls cultures were established after which half of the HOK cells were stimulat ed with 15mMol glucose for 24 hours to establish both hyperglycemic and normoglycemic conditions. The HOK cells under both conditions were stimulated with TLR ligands for 24 hours. Following stimulation supernatant was taken from all stimulation samples. Luminex results were an alyzed and compared using GraphPad Prism 4 analysis software. TLR ligation under hyperglycemi c conditions results in an increase in proinflammatory responses and inhi bits anti-inflammatory responses Fig. 4-13 demonstrates that under hyperglycemic conditions TLR4, 9, and 6/2 ligation result in an increased IL-6 proinflammatory responses when compared IL-6 secretion resulting from TLR ligation under normoglycemic conditions (all p < 0.0363). Fig.4-15 demonstrates that hyperglycemic conditions decrease IL-10 anti -inflammatory response resulti ng from TLR2 ligation when compared to IL-10 secretion resulting from TLR 2 ligation under normoglycemic conditions (p = 0.0117). Stimulation with TLR Ligands Increases TLR Gene Expression Real-time quantitative polymera se chain reaction (qPCR) was used to evaluate the relative gene expression of TLR1, 2, 4, 6, and 9 on HOK cells after stimulation with TLR ligands. To accomplish this HOK cells cultures were establis hed after which the HOK cells were stimulated with TLR ligands for 24 hours. qPCR was utilized with TLR primers. DNA content of TLR was normalized to G3PDH after which total copy numbe rs of TLR were determined. qPCR results were analyzed and compared using GraphPad Pris m 4 analysis software. TLR ligation results in increased transcription of TLR genes. Fig. 428 demonstrates that HOKs stimulated with TLR4, 41

PAGE 42

2, 1/2, and 6/2 ligands displayed significantly different TLR2 gene expression than HOK cells stimulated with TLR9 ligand and non-stimulated HOK cells (all p < 0.0251). We also saw this trend in TLR1 and TLR4 gene expression (fig. 4-29 and 4-30). Fig. 4-31 shows that HOK cells display significantly different TLR6 gene expression after stimu lation with TLR2/6 ligand when compared to TLR6 gene expression by nonstimulated HOK cells (p = 0.0018). Fig. 4-28 demonstrates that HOKs stimulat ed with TLR9 ligand displayed TLR2 gene expression levels similar to non-stimulated HOK TLR 2 gene expression levels. We also saw this same trend with TLR1, 4, 6, and 9 gene expressions (fig. 4-28 thru 4-32). RAGE Gene Expression in C57BL6 Mice Increases over Time, Whereas RAGE Gene Expression in NOD Mice Decreases over Time In order to determine RAGE gene expression on the surface of GEC, GECs were harvested from both NOD and C57BL6 mice at 4, 8, 12, and 16 weeks of age after which qPCR were used. DNA content of RAGE was normalized to G3PDH after which total copy numbers of RAGE were determined. qPCR results were analyzed and compared using GraphPad Prism 4 analysis software. Fig. 4-9 demonstrates that within C57BL6 mice RAGE gene expression increases over time whereas in NOD mice, RAGE gene expression decreases over time. Fig. 4-9 demonstrates that C57BL6 and NOD mice display significantl y different RAGE gene expression at 8-12 weeks of age (p = 0.0026; p = 0.0008 at 12 wks; p < 0.0001 at 16 wks). RAGE gene expression exhibits the same trend as TLR gene expressi on in NOD and C57BL6 mice. This data suggest that in RAGE gene expression cannot be assu med to be a primary reason behind overacting innate immune responses in type 1 diabetics resulting in prolonged inflammation leading to tissue destruction. 42

PAGE 43

RAGE Ligation Promotes and/or Inhibits Cytokine/Chemokine Secretion Luminex was used to decipher cytokine/chem okine responses of HOK when stimulated with RAGE ligands. HOK cells cultures were established after which the HOK cells were stimulated with RAGE ligands for 24 hours. Following stimulation supernatant was taken from all stimulation samples. Luminex results were analyzed and compared using GraphPad Prism 4 analysis software. Fig. 4-22 dem onstrates that RAGE ligation pr omotes the secretion of IL-6 pro-inflammatory cytokine when compared to IL-6 secretion level of non-stimulated HOK cells (p = 0.0045). We also see this same trend in the following pro-inflammatory cytokines and chemokines: GM-CSF, IL-8, TNF, IL-1 MIP1 MCP-1, and IP-10. This data demonstrate that RAGE ligation exhibit the basis behind the triggering of prolonged inflammation leading to tissue destruction. Luminex was used to decipher cytokine/chem okine responses of HOK when stimulated with RAGE ligands in hyperglycemic conditions HOK cells cultures were established after which half of the HOK cells were stimulated with 15mMol glucose for 24 hours to establish both hyperglycemic and normoglycemic conditions. The HOK cells under both conditions were stimulated with RAGE ligands for 24 hours. Following stimulation supernatant was taken from all stimulation samples. Luminex results were analyzed and compared using GraphPad Prism 4 analysis software. RAGE ligation under hyperglycem ic conditions results in an increase in proinflammatory responses and inhi bits anti-inflammatory responses Fig. 4-22 demonstrate that under hyperglycemic conditions RAGE ligation result in an increased IL-6 pro-inflammatory responses when compared IL-6 secretion resu lting from TLR ligation under normoglycemic conditions (p = 0.0275). Also in hyperglycemic conditions ther e is an inhibiting and/or lack of IL-10 anti-inflammatory response resulting fr om RAGE ligation when compared to IL-10 43

PAGE 44

secretion resulting from RAGE ligation under normoglycemic conditions (p = 0.0186) (fig. 424). RAGE Gene Expression Increases aft er Stimulation with TLR Ligands Real-time quantitative polymera se chain reaction (qPCR) was used to evaluate the relative gene expression of RAGE on HOK cells after st imulation with RAGE ligands. To accomplish this HOK cells cultures were established after wh ich the HOK cells were stimulated with RAGE ligands for 24 hours. qPCR was utilized with RAGE primers. DNA content of TLR was normalized to G3PDH after which total copy numbe rs of TLR were determined. qPCR results were analyzed and compared using GraphPad Prism 4 analysis software. Stimulation with RAGE ligand results in increased RAGE gene transcription. Fig. 3-33 demonstrates that HOK cells stimulated with TLR 4, 2, 1/2, and 6/2 display significantly different RAGE gene expression than HOK cells stimulated with TLR 9 ligand and non-stimulated HOK cells (all p < 0.061). Fig. 4-39 demonstrates that HOK cells st imulated with RAGE ligand displayed significantly different RAGE gene expression when compared to RAGE gene expression displayed by non-stimulated HOK cells (p = 0.063). 44

PAGE 45

Figure 4-1. TLR2 protein expressi on is significantly increased in NOD mice at 16 weeks of age (*p = 0.0058). FACS analyzed relative pr otein expression of TLR2 single positive GECs in both C57BL6 and NOD mice at 4, 8, 12, and 16 weeks of age. 45

PAGE 46

Figure 4-2. TLR4 protein expres sion was significantly decreased in NOD mice at 16 weeks of age (*p = 0.0003). FACS analyzed relati ve protein expression of TLR4 single positive GECs in both C57BL6 and NOD mi ce at 4, 8, 12, and 16 weeks of age. 46

PAGE 47

Figure 4-3. TLR2/4 double positive protein expression is signifi cantly increased in NOD at 16 weeks of age (*p = 0.0063). FACS analyzed relative protein e xpression of TLR2 and TLR4 double positive GECs in both C57BL6 and NOD mice at 4, 8, 12, and 16 weeks of age. 47

PAGE 48

Figure 4-4. TLR1/2 double positive protein expression was significantly increased in NOD mice at both 8 and 16 weeks of age (*all p < 0.0061). FACS analyzed relative protein expression of both TLR1 and TLR2 double pos itive GECs in both C57BL6 and NOD mice at 4, 8, 12, and 16 weeks of age. 48

PAGE 49

Figure 4-5. TLR2 gene expressi on in C57BL/6 mice increases over time and decreases in NOD mice overtime (*p = 0.0093). qPCR analyzed relative gene e xpression of TLR2 on GECs in both C57BL6 and NOD mice at 4, 8, 12, and 16 weeks of age. 49

PAGE 50

Figure 4-6. TLR4 gene expressi on in C57BL/6 mice increases over time and decreases in NOD mice overtime (all p < 0.0047). qPCR analyzed relative gene expression of TLR4 on GECs in both C57BL6 and NOD mice at 4, 8, 12, and 16 weeks of age. 50

PAGE 51

Figure 4-7. TLR1 gene expression in C57BL/6 mice increases over time and decreases in NOD mice overtime (all p < 0.00208). qPCR analyzed relative gene expression of TLR1 on GECs in both C57BL6 and NOD mice at 4, 8, 12, and 16 weeks of age. 51

PAGE 52

Figure 4-8. TLR6 gene expressi on in C57BL/6 mice increases over time and decreases in NOD mice overtime (all p < 0.0246). qPCR analyzed relative gene expression of TLR6 on GECs in both C57BL6 and NOD mice at 4, 8, 12, and 16 weeks of age. 52

PAGE 53

Figure 4-9. TLR9 gene expressi on in C57BL/6 mice increases over time and decreases in NOD mice overtime (*p = 0.0048). qPCR analyzed relative gene e xpression of TLR9 on GECs in both C57BL6 and NOD mice at 4, 8, 12, and 16 weeks of age. 53

PAGE 54

Figure 4-10. RAGE gene expression in C57BL/6 mice increases over time and decreases in NOD mice overtime (all p = 0.0026). qPCR analyzed relative gene expression of RAGE on GECs in both C57BL6 and NOD mice at 4, 8, 12, and 16 weeks of age. 54

PAGE 55

Figure 4-11. Hyperglycemic conditions induce GM CSF pro-inflammatory cytokine secretion in response to TLR ligation. Luminex 100 System analyzed HOK secretion levels of GMCSF pro-inflammatory cytokine in response to TLR ligation and HOK section levels of GMCSF in response to non-s timulated TLR in both hyperglycemic and normoglycemic conditions (G = 15mM glucose). 55

PAGE 56

Figure 4-12. Hyperglycemic conditions induce IL-1 pro-inflammatory cytokine secretion in response to TLR ligation (* all p<0.0274; ^p = 0.0218). Luminex 100 System analyzed HOK secretion levels of IL-1 pro-inflammatory cytokine in response to TLR ligation and HOK sect ion levels of IL-1 in response to non-stimulated TLR in both hyperglycemic and normoglycemic conditions (G = 15mM glucose). 56

PAGE 57

Figure 4-13. Hyperglycemic conditions induce IL -6 pro-inflammatory cytokine secretion in response to TLR ligation (* all p< 0.363; ^p = 0.0045). Luminex 100 System analyzed HOK secretion levels of IL-6 pr o-inflammatory cytokine in response to TLR ligation and HOK section levels of IL-6 in response to non-stimulated TLR in both hyperglycemic and normoglycemic conditions (G = 15mM glucose). 57

PAGE 58

Figure 4-14. Hyperglycemic conditions induce IL -8 pro-inflammatory cytokine secretion in response to TLR ligation (* all p< 0.0222). Luminex 100 System analyzed HOK secretion levels of IL-8 pro-inflammatory cytokine in response to TLR ligation and HOK section levels of IL-8 in response to non-stimulated TLR in both hyperglycemic and normoglycemic conditions (G = 15mM glucose). 58

PAGE 59

Figure 4-15. Hyperglycemic conditions inhibit IL-10 anti-inflammatory cytokine secretion in response to TLR ligation (*p = 0.0117). Luminex 100 System analyzed HOK secretion levels of IL-10 an ti-inflammatory cytokine in response to TLR ligation and HOK section levels of IL-10 in response to non-stimulated TLR in both hyperglycemic and normoglycemic c onditions (G = 15mM glucose). 59

PAGE 60

Figure 4-16. Hyperglycemic conditions induce IP -10 pro-inflammatory chemokine secretion in response to TLR ligation (*p = 0.0118). Luminex 100 System analyzed HOK secretion levels of IP-10 pro-inflammato ry chemokine in response to TLR ligation and HOK section levels of IP-10 in re sponse to non-stimulated TLR in both hyperglycemic and normoglycemic c onditions (G = 15mM glucose). 60

PAGE 61

Figure 4-17. Hyperglycemic conditions did not induce MCP-1 pro-inflammatory chemokine secretion in response to TLR ligatio n. Luminex 100 System analyzed HOK secretion levels of MCP-1 pro-inflammato ry chemokine in response to TLR ligation and HOK section levels of MCP-1 in re sponse to non-stimulated TLR in both hyperglycemic and normoglycemic c onditions (G = 15mM glucose). 61

PAGE 62

Figure 4-18. Hyperglycemic c onditions did not induce MIP-1 pro-inflammatory cytokine secretion in response to TLR ligatio n. Luminex 100 System analyzed HOK secretion levels of MIP-1 pro-inflammatory cytokine in response to TLR ligation and HOK section levels of MIP-1 in response to non-stimulated TLR in both hyperglycemic and normoglycemic c onditions (G = 15mM glucose). 62

PAGE 63

Figure 4-19. Hyperglycemic conditions induce TNFpro-inflammatory cy tokine secretion in response to TLR ligation (*p = 0.0075). Luminex 100 System analyzed HOK secretion levels of TNFpro-inflammatory cytokine in response to TLR ligation and HOK section levels of TNFin response to non-stimulated TLR in both hyperglycemic and normoglycemic c onditions (G = 15mM glucose). 63

PAGE 64

Figure 4-20. Hyperglycemic conditions induce pro-inflammatory cytokine and chemokine secretion in response to RAGE ligati on. Luminex 100 System analyzed HOK secretion levels of GMCSF pro-inflammatory cytokine in response to RAGE ligation and HOK section levels of GMCSF in response to non-stimulated RAGE and RAGE blocking with sRAGE in both hyperglycemic and normoglycemic conditions (G = 15mM glucose). 64

PAGE 65

Figure 4-21. Hyperglycemic conditions induce pro-inflammatory cytokine and chemokine secretion in response to RAGE ligation (*all p< 0.0218). Luminex 100 System analyzed HOK secretion levels of IL-1 pro-inflammatory cytokine in response to RAGE ligation and HOK section levels of IL-1 in response to non-stimulated RAGE and RAGE blocking with sRAGE in both hyperglycemic and normoglycemic conditions ( G = 15mM glucose). 65

PAGE 66

Figure 4-22. Hyperglycemic conditions induce pro-inflammatory cytokine and chemokine secretion in response to RAGE ligation (*all p< 0.0058). Luminex 100 System analyzed HOK secretion levels of IL-6 pr o-inflammatory cytokine in response to RAGE ligation and HOK section levels of IL-6 in response to non-stimulated RAGE and RAGE blocking with sRAGE in both hyperglycemic and normoglycemic conditions ( G = 15mM glucose). 66

PAGE 67

Figure 4-23. Hyperglycemic conditions induce pro-inflammatory cytokine and chemokine secretion in response to RAGE ligation (*all p< 0.0097). Luminex 100 System analyzed HOK secretion levels of IL-8 pr o-inflammatory cytokine in response to RAGE ligation and HOK section levels of IL-8 in response to non-stimulated RAGE and RAGE blocking with sRAGE in both hyperglycemic and normoglycemic conditions ( G = 15mM glucose). 67

PAGE 68

Figure 4-24. Hyperglycemic conditions induce pro-inflammatory cytokine and chemokine secretion in response to RAGE ligation (* all p< 0.0186). Luminex 100 System analyzed HOK secretion levels of IL-10 anti-inflammatory cytokine in response to RAGE ligation and HOK section levels of IL-10 in response to non-stimulated RAGE and RAGE blocking with sRAGE in both hyperglycemic and normoglycemic conditions ( G = 15mM glucose). 68

PAGE 69

Figure 4-25. Hyperglycemic conditions induce pro-inflammatory cytokine and chemokine secretion in response to RAGE ligation (*all p< 0.0274). Luminex 100 System analyzed HOK secretion levels of MCP-1 pr o-inflammatory chemokine in response to RAGE ligation and HOK section levels of MCP-1 in response to non-stimulated RAGE and RAGE blocking with sRAGE in both hyperglycemic and normoglycemic conditions (G = 15mM glucose). 69

PAGE 70

Figure 4-26. Hyperglycemic conditions induce pro-inflammatory cytokine and chemokine secretion in response to RAGE ligation (*all p< 0.0137). Luminex 100 System analyzed HOK secretion levels of MIP-1 pro-inflammatory chemokine in response to RAGE ligation and HOK section levels of MIP-1 in response to non-stimulated RAGE and RAGE blocking with sRAGE in both hyperglycemic and normoglycemic conditions (G = 15mM glucose). 70

PAGE 71

Figure 4-27. Hyperglycemic conditions induce pro-inflammatory cytokine and chemokine secretion in response to RAGE ligation (*all p< 0.0122). Luminex 100 System analyzed HOK secretion levels of TNFpro-inflammatory cytokine in response to RAGE ligation and HOK section levels of TNFin response to non-stimulated RAGE and RAGE blocking with sRAGE in both hyperglycemic and normoglycemic conditions ( G = 15mM glucose). 71

PAGE 72

Figure 4-28. Stimulation with TLR ligands increases TLR2 ge ne expression (*all p< 0.0251). qPCR analyzed relative gene expres sion of TLR2 on HOK in response to TLR ligation and non-stimulation. 72

PAGE 73

Figure 4-29. Stimulation with TLR ligands increases TLR4 ge ne expression (*all p< 0.0180). qPCR analyzed relative gene expres sion of TLR4 on HOK in response to TLR ligation and non-stimulation. 73

PAGE 74

Figure 4-30. Stimulation with TLR ligands increases TLR1 ge ne expression (*all p< 0.0228). qPCR analyzed relative gene expres sion of TLR1 on HOK in response to TLR ligation and non-stimulation. 74

PAGE 75

Figure 4-31. Stimulation with TLR ligands increases TLR gene expression (*p = 0.0081). qPCR analyzed relative gene expres sion of TLR6 on HOK in response to TLR ligation and non-stimulation. 75

PAGE 76

Figure 4-32. Stimulation with TLR ligands increases TLR gene expression. qPCR analyzed relative gene expression of TLR9 on HOK in response to TLR ligation and nonstimulation. 76

PAGE 77

Figure 4-33. Stimulation with TLR ligands increases RAGE ge ne expression (*all p< 0.0061). qPCR analyzed relative gene expressi on of RAGE on HOK in response to TLR ligation and non-stimulation. 77

PAGE 78

Figure 4-34. Stimulation with RAGE ligands increases TLR2 gene expression (*p = 0.034). qPCR analyzed relative gene expressi on of TLR2 on HOK in response to RAGE ligation, blocking with sRAGE and non-stimulation. 78

PAGE 79

Figure 4-35. Stimulation with RAGE ligands increases TLR4 gene expression (*p = 0.0135). qPCR analyzed relative gene expressi on of TLR4 on HOK in response to RAGE ligation, blocking with sRAGE and non-stimulation. 79

PAGE 80

Figure 4-36. Stimulation with RAGE ligands increases TLR1 gene expression (*p = 0.0228). qPCR analyzed relative gene expressi on of TLR1 on HOK in response to RAGE ligation, blocking with sRAGE and non-stimulation. 80

PAGE 81

Figure 3-37. Stimulation with RAGE ligands increases TLR gene expression. qPCR analyzed relative gene expression of TLR6 on HOK in response to RAGE ligation, blocking with sRAGE and non-stimulation. 81

PAGE 82

Figure 4-38. Stimulation with RAGE ligands increases TLR gene expression. qPCR analyzed relative gene expression of TLR9 on HOK in response to RAGE ligation, blocking with sRAGE and non-stimulation. 82

PAGE 83

Figure 4-39. Stimulation with RAGE ligands increases RAGE gene expression (*p = 0.0063). qPCR analyzed relative gene expressi on of RAGE on HOK in response to RAGE ligation, blocking with sRAGE and non-stimulation. 83

PAGE 84

84 Figure 4-40. TLR2 and TLR4 single positive protein expression on a single GEC in both C57BL6 and NOD mice. FACS analyzed relative protein expr ession of TLR2 and TLR4 single positive GECs in both C57BL6 and NOD mice at 4, 8, 12, and 16 weeks of age

PAGE 85

CHAPTER 5 DISCUSSION Currently there is a lack of evidence to substantiate and cl early demonstrate the cellular and molecular mechanisms responsible for th e innate immune response, protective or destructive, to microbial invasion in the periodontium (135). In this study by using immunohistochemistry, we have de monstrated the levels of expression of TLR1, 2, 4, 6, 9 and RAGE on GECs of mice with and without type 1 diabetes and on HOK cells in hyperglycemic and normoglycemic conditions. We also have demonstrated the HOK secr etion levels of proinflammatory and anti-inflammatory cytokines and chemokines in response to TLR and RAGE stimulation in both hyperglycemic and normoglycemic conditions. The host innate immune systems interacti ons with microbes are determined by TLRs differential expression, specificities and distribution by the hosts ce lls and tissues (135). In our immunochemistry, we did not find statistically significant differen ces in the protein expression of TLR between NOD and C57BL6 mice. Contrary to our TLR protein expression findings, we found that TLR gene expression in C57BL6 mice was found to increase over time, whereas TLR gene expression in NOD mice decreased over time with significant differences in TLR gene expression between C57BL6 and NOD mice at approximately 12 to 16 weeks. The downregulation of TLR gene tran scription in our NOD mice was not caused by hyperglycemic conditions associated with diab etes because the NOD mice used for this assay had failed to developed diabetes by 16 weeks of age. It is plausible that our protein and gene expression results display a critical alteration in the sign aling pathway between TLR protein expression and TLR gene expression at the transc riptional level. Presently, the alternation that occurred in the signaling pathway connecting TLR protein expression to TLR gene expression is unclear. There is a need for further investigation into the mechanism that involves TLR mediated signaling 85

PAGE 86

activities that signal transduction involved in th e pathway between TLR gene expression at the transcriptional level and TLR protein expression. Research shows that microbial pathogens ar e able to inhibit TLR mediated immune responses by impeding TLR signals or by decreasing TLR expression levels (136). Interestingly, our findings show that after s timulation with TLR ligands, HOK cells increased the transcription of TLR genes. Additionally, in the presence of hyperglycemic condition, TLR gene transcription increases were further amplif ied. Amplified TLR gene tran scription under hyperglycemic conditions may indicate the involvem ent of TLR ligation in diabetic individual s susceptibility to bacterial infections leading to strong pro-inflammatory responses subsequently leading to more severe and faster progressing periodontal disease. Comparing our findings of TLR gene expression levels on both HOK and GECs, it is reasonable that diabetics may have diminished endogenous transcription of their TLR genes allowing for infection and hyperglycemic conditions to robustly up-regulate gene transc ription leading to increased and prolonged inflammatory outcomes resulting in se vere gingival tissue pathology. TLR ligation triggers stimulation of a variet y of cytokines, chemokines, and growth factors, mainly from innate immune cells su ch as neutrophils, macrophages, and monocytes, which results in the promotion of inflamma tion and immune cell in filtration leading to destruction of connectiv e tissue and bone (73). In diabetic s an abnormal inflammatory response to bacterial products has been shown to result in an exaggerated s ecretion of such mediators form innate immune cells. We have shown that TLR ligation under hyperglycemic conditions can contribute to the induction of pro-inflamma tory conditions, while inhibiting the antiinflammatory response, leading to prolonged inflammation. 86

PAGE 87

In diabetics it has been demons trated that the monocytic hyp er-responsiveness to bacterial antigens results in increased production of proinflammatory cytokine s and mediators which induce tissue destruction, attachment loss and bone loss (40-42). Interestingly, our results found that TLR4 ligation promotes pro-inflammatory cytokine and chemokine secretion, whereas TLR2 ligation promotes anti-inflammatory cytoki ne and chemokine secretion. Other studies have shown that P. gingivalis and Leptospira have the capability to us e diverse LPS structural moieties in order to only be recognized by TLR2 and not TLR4, therefore triggering an antiinflammatory Th2 response (137, 138) and Darveau et al. showed modifi ed lipid-A components of LPS are used by P. gingivalis to undermine an aggressive TLR4 pro-inflammatory response (139). TLR2 ligation leading to an anti-inflamm atory response is likely the innate immune systems adaptation to balance anti-inflammatory and pro-inflammatory mediators, avoiding overproduction of pro-inflammatory responses by TLR stimulation. Furthermore, signaling ability of TLRs is not equally spread, implicated by potential cross-talks with betw een different TLRs can alter the initial innate respon se generated (140). In parallel, we found that TLR1 a nd/or TLR6 diamerization to TLR2 and subsequent ligation results in the promotion of proinflammatory responses and inhib its anti-inflammatory responses. It is credible that modified components of L PS that result during structural change may be recognized by TLR2/TLR1 and/or TLR2/TLR6 diamerization and consequently promoting a pro-inflammatory response instead of a TLR2 anti-inflammatory response. Moreover, we found hyperglycemic conditions amplify pro-inflammato ry responses and inhibit anti-inflammatory responses. It is reasonable that the innate im mune system uses TLR diameriztion to elicit stronger inflammatory responses and to purposely i nhibit anti-inflammatory responses in order to eliminate microbial infections. 87

PAGE 88

The amplified pro-inflammatory responses and inhibition of anti-inflammatory response in hyperglycemic conditions suggest a mechanism leading to over production of pro-inflammatory cytokines and chemokines. Abnormal pro-in flammatory responses, known as a hyperinflammatory trait, have been linked to diabet es (55, 56). Our result st rengthen the credibility that hyperglycemic conditions increase susceptibi lity to infection which is more conducive to innate inflammatory response, exhibited by ex aggerated secretion of innate inflammatory cytokines and chemokines, connecting TLR ligation in hyperglycemic conditions present in diabetics to exaggerated secreti on innate pro-inflammatory mediat ors associated with periodontal disease. Lalla et al. (2000) demonstrated that the ad ministration of soluble RAGE results in the halting of periodontal disease a nd the markers of cellular activa tion and tissue destruction in diabetic mice, indicating that AGEs were im peded from binding with and activating RAGE (141). Our findings revealed that RAGE gene expression in C57BL6 mi ce was found to increase over time, whereas RAGE gene expression in NOD mice decreased over time with significant differences in RAGE gene expression between C57BL6 and NOD mice at approximately 8 to16 weeks. We recognize th at this down-regulation of RAGE gene transcription in our NOD mice was not due to hyperglycemic conditions due to th e fact that our NOD mice used for this assay had not developed diabetes by 16 weeks of age and showed normal blood glucose levels at the time of gingival epithelial tissue excision. On the contrary, Lalla et al. (1998) successfully showed that diabetic mice models exhibit increased vascular and monocyt e RAGE expression along with elevated levels of AGEs in diabetic gingival compared to non-diabetic controls (142). The conflicting findings may be due to the fact that our NOD mice were still non-dia betic and therefore l acked the hyperglycemic 88

PAGE 89

condition and the subsequent accumulation of AGEs that may be conducive to altering RAGE gene expression. The lack of RAGE interaction with RAGE ligands may be responsible to the down-regulation of RAGE gene tr anscription in GECs. It is also possible that RAGE gene expression being down-regulated in the absen ce of pathogens may demonstrate the innate immune systems inherent regula tion of RAGE and avoiding overproduction of pro-inflammatory responses by RAGE in healthy tissue. Studies have shown that in di abetic tissue RAGE expression increases in correlation with stimulation with RAGE ligands (143) and AGE accumulation leads to functional changes in blood proteins resulting in AGE proteins that amplify the magn itude of macrophage cytokine response leading to poor blood glucose control an d more severe periodontal disease (144). We found that after stimulation with RAGE ligands, HOK cells increas e the transcription of RAGE genes. Additionally, in the pr esence of hyperglycemic condition, th ese RAGE gene transcription increases are further amplified. Amplified RAGE gene transcrip tion under hyperglycemic conditions may indicate the involvem ent of RAGE ligation in diabe tic individuals susceptibility to bacterial infections leading to strong proinflammatory responses subsequently leading to more severe and faster progr essing periodontal disease. Th e pathogenesis of diabetic complications resulting from the accumulati on of AGEs has been linked to prolonged hyperglycemia (143). The mechanism behind the increased amplifi cation of RAGE gene transcription in hyperglycemic conditions is unclear. However, it is entirely plausible that in hyperglycemic conditions the accumulation of AGEs leads to in creased AGERAGE inte raction. Increased RAGE stimulation will l ead to amplified RAGE gene expression and subsequently an increased pro-inflammatory response. We believe that diabetics may have diminished endogenous 89

PAGE 90

transcription of their RAGE genes allowing for infection and hyperglycemic conditions to robustly up-regulate gene transcription leadi ng to increased and prolonged inflammatory outcomes resulting in severe gingival tissue pathology. RAGE is associated with pro-inflammatory response and has been shown to increase expression with aging and has been link as a fundamental receptor in the pathogenesis of periodontal disease (145). We have shown that RAGE ligati on under hyperglycemic conditions results in an increase in pro-inflammatory res ponses and inhibits anti-inflammatory responses. We demonstrated that hyperglycemic conditi ons can contribute to the induction of proinflammatory conditions, while inhibiting the an ti-inflammatory response, leading to prolonged inflammation. Lalla et al. (2000) showed that pro-inflammatory cytokine (TNFand IL-6) levels in gingival tissue extracts from diabetic mice were significantly higher compared to levels in non-diabetic mice. Furthermore, in diabetic mice levels of pro-infla mmatory cytokines (TNFand IL-6) were significantly d ecreased when treated with sRAGE compared diabetic mice not treated with sRAGE (141). We believe that the hyperglycemic condition present in diabetic patients and the ligation of RAGE by bacteria in the oral cavity results in the overproduction of pro-inflammatory cytokines and chemokines le ading to prolonged inflammation resulting in gingival tissue destruction. One limitation of this study was that only 60% to 80% of female NOD mice turn diabetic by 16 weeks of age. This may have confounde d our qPCR data and conclusions regarding relative gene expression of RAGE and TLRs in NOD mice at 16 weeks of age and subsequently any statistical analysis may have erroneous valu es. This limitation proved difficult to address since ordering NOD mice from breeding colonies is limited to age and not diabetic development. Additionally, Our FACs data was li mited due to the fact that we were only able to staining cells 90

PAGE 91

with antibodies specific for TLR 1, 2, and 4 pr oteins on GECs due to the limited resources available to us. Subsequently our FACS data, st atistical analysis, and conclusions are limited to protein expression for only TLR 1, 2, and 4 and not for TLR 6, 9 and RAGE. This limitation has prohibited us from performing a complete investigating and dete rmining conclusions regarding TLR and RAGE protein expression on/in GECs. Important future research should incorporate type 2 diabetic (T2D) murine model system in order to wholly investigate th e correlation between diabetes and periodontal disease. This will permit investigation of whether differences th at exist between T1D and T2D correlates to differences in periodontal disease development. NOR (normoglycemic NOD) Mice should be used as normoglycemic controls allowing for clearer comparison to NOD mice because of similar genetic backgrounds. Th e investigation of the signali ng pathway between TLR protein expression and TLR genetic expression is needed to understand the mechanism responsible for differences in protein and gene expression. Al so, the investigation of the signaling pathway between TLR/RAGE and cytokine/chemokine secret ion will allow for a clear understanding of the signaling pathway that occurs within th e cell after TLR stimulation resulting in cytokine/chemokine secretion. Lastly, murine and human diabetogenic primary gingival epithelial cell line cultures need to be established to allow for in vitro investigations to be performed. This thesis provide s substantial evidence linking type 1 diabetes and periodontal disease, however, additional research should incorpor ate the previously stated in order to further understand the association between di abetes and periodontal disease. 91

PAGE 92

LIST OF REFERENCES 1 Piwerntz K, Piehlmeier W, Landgraf R, Haslbeck M. Diabetes mellitus. Classification, early detection and diagnosis. MMW Fortschr Med 2001: 143 : Suppl: 49-54, 56-60; quiz 61-42. 2 Von Herrath M, Sanda S, Herold K. Type 1 diabetes as a relapsing-remitting disease?. Nature 2007: 7: 988-994. 3 Foulis A, Stewart J. The pancreas in recen t-onset type 1(insulin-dependent) diabetes mellitus: insulin content of islets, insulitis a nd associated changes in the exocrine acinar tissue. Diabetologia 1984: 26: 456-461. 4 Ikeda K, Higashi T, Sano H, el at. N (carboxymethyl) lysine protein adducts is a major immunological epitope in proteins modified with advanced glycation end products of the Maillard reaction. Biochem 1996: 35: 8075-8083. 5 Tisch T, McDevitt H. Insulin-dependent diabetes mellitus. Cell 1996: 85: 291-297. 6 Itoh N, Hanafusa T, Miyazaki A, et al. Mononuc lear cell infiltration a nd its relation to the expression of major histocompatibility co mplex antigens and adhesion molecules in pancreas biopsy specimens from newly diagnosed insulin-dependent diabetes mellitus patients. J Clin Invest 1993: 92: 2313-2322. 7 Conrad B, Weidmann E, Trucco G, et al. Evidence for superantigen involvement in insulin-dependent diabetes mellitus aetiology. Nature 1994: 371 : 351-355. 8 Leslie RDG, Atkinson MA, Notkins AL. Auto antigens IA-2 and GAD in type (insulindependent) diabetes. Diabetologia 1999: 42: 3-14. 9 Tun RYM, Peakman M, Alviggi L, et al. Importance of persistent cellular and humoral immune changes before diabetes develops : prospective study of identical twins. Br Med J 1994: 308: 1063-1068. 10 Wautier J, Guillausseau P. Advanced Gl ycation End Products, Their Receptors and Diabetic Angiopathy. Diabetes Metab (Paris) 2001: 27: 535-542. 11 The Diabetes Control and Complication Tr ial Research Group. The relationship of glycemic exposure (HbA1c) to the risk of de velopmental and processi on of retinopathy in the diabetes control and complication trial. Diabetes 1995: 44 : 968-983. 12 Andersen C, Flyvbjerg A, Buschard K, Ho lmstup P. Relationship between Periodontitis and Diabetes: Lessons from rodent studies. J Periodontol 2007: 78: 1264-1275 13 Schmidt AM, Weidman E, Lalla E, et al. A dvanced glycation endpr oducts (AGEs) induce oxidant stress in the gingiva: A potential mechanism underlying accelerated periodontal disease associated with diabetes. J Periodontal Res 1996: 31: 508-515. 92

PAGE 93

14 Lalla E, Lamster IB, Stern DM, Schmidt AM. Receptor for advance glycation end products, inflammation, and accelerated periodonta l disease in diabetes: Mechanisms and insights into therapeutic modalities. Ann Periodontol 2001: 6 : 113-118. 15 Hayashi A, Shinohara M, Ohura K. Effect of insulin on naturally occurring gingivitis rats with diabetes. J Osaka Dent Univ 1999: 33: 1-7. 16 Inoue H, Shinohara M, Ohura K. The effect of leukocyte function of streptozotocininduced diabetes in naturall y occurring gingivitis rat. J Osaka Dent Univ 1997: 31: 47-54. 17 Ozsoy N, Bostanci H, Ayvali C. The investigation of the ultr astructural neutophil changes in alloxan-induced diabetes in ra ts: Response to a chem otactic challenge. Cell Biochem Funct 2004: 22 : 81-87. 18 Graves DT, Liu R, Alikhani M, Al-Mas hat H, Trackman PC. Diabetes-enhanced inflammation and apoptosis-Impact on periodontal pathology. J Dent Res 2006: 85:15-21. 19 Graves DT, Al-Mashat H, Liu R. Evidence th at diabetes mellitus aggravates periodontal disease and modifies the response to an oral pathogen in animal models. Compend Contin Educ Dent 2004: 25: 38-45. 20 Reuterving CO. Pilocarpine-stimulated sa livary flow rate and salivary glucose concentration in alloxan diabetic rats. Infl uence of severity and duration of diabetes. Act Physiol Scand 1986: 126: 511-515. 21 Oxford GE, Tayari L, Barfoot MD, Peck AB Tanaka Y, Humphreys-Beher MG. Salivary EGF levels reduced in diabetic patients. J Diabbetes Complications 2000: 14: 140-145. 22 Nagy A, Nagashima H, Cha S, et al. Reduced oral wound healing in the NOD mouse model for type 1 autoimmune diabetes and its reversal by epidermal growth factor supplementation. Diabetes 2001: 50: 2100-2104. 23 Ficara AJ, Levin MP, Grower MF Kramer GD. A comparison of the glucose and protein content of gingival fluid from diabetics and nondiabetics. J Periodontal Res 1975: 10: 171-175. 24 American Academy of Periodon tology. Diabetes and peri odontal disease (position paper). J Periodontol 1996: 67: 166-176. 25 Kissler S, Anderton SM, Wraith DC. Antigen -presenting cell activation: a link between infection and autoimmunity?. J Autoimmun 2000: 16: 303-308. 26 Wolff L, Dahlen G, Aeppli D. Bacter ia as risk markers for periodontitis. J Periodontol 1994: 65: 498-510. 27 Brecx M, Gautchi M, Gehr P, Lang N. Variab ility of histologic criteria in clinically healthy human gingiva. J Periodontal Res 1987: 22: 468-472. 93

PAGE 94

28 Payne W, Pafe R, Ogilvie A, Hall W. Histopa thologic features of the initial and early stages of experiment al gingivitis in man. J Periodontal Res 1975: 10: 51. 29 Schroeder H, Munzel-Pedrazzoli S, Page R. Correlated morphometric and biochemical analysis of gingival tissues in early chronic gingivitis in man. Arch Oral Biol 1973: 18 : 899. 30 Shroeder H, Graf-de-Beer M, Atts trom R. Initial gingivitis in dogs. J Periodontal Res 1975: 110: 128. 31 Seymour G, Powell R, Aitken KJ, Experiment al gingivitis in huma ns. A clinical and histologic investigation. J Periodontol 1983: 54: 522-531. 32 Van der Weijden GA, Timmerman MF, Dans er MM, Nijboer A, Saxton CA, Van der Welden U. Effect of pre-experimental ma intenance care duration on the development of gingivitis in a partial mouth e xperimental gingivitis model. J Periodontal Res 1994: 29 : 168-173. 33 Loe H, Theilade E, Jensen S. Experimantal gingivitis in man. J Periodontol 1965: 36: 177-187. 34 Brecx M, Frolicher I, Gehr P, Lang N. Stereological observations on long term experimental gingivitis in man. J Clin Periodontol 1988: 15: 621-627. 35 Seymour G, Powell R, Burns G, et al. Experimental gingivitis in humans. A histochemical and immunological characteri zation of the lymphoid cell subpopulation. J Periodontal Res 1983: 18 : 375-385. 36 Zambon JJ. Periodontal diseas es: microbial factors. Ann Periodontol 1996: 1: 879-925. 37 Darveau RP, Tanner A, Page RC. The microbial challeng e in periodontitis. Periodontol 2000 1997: 14: 12-32. 38 Gemmell E, Marshall RI, Seymour GJ. Cy tokines and prostagl andins in immune homeostatsis and tissue destru ction I periodontal disease. Periodontol 2000 1997: 14: 112-143. 39 Kornman KS, Page RC, Tonetti MS. The host response to the microbial challenge in periodontitis: assembling the players. Periodontol 2000 1997: 14: 33-53. 40 Reynolds JJ, Meikle MC. Mechanism of connective tissue matrix destruction in periodontitis. Periodontol 2000 1997: 14:144-157. 41 Muller-Glauser W, Schroeder H. The pocket epithelium: a light and electron microscopic study. J Periodontol 1982: 53: 133-144. 42 Lindhe J, Liljenberg B, Listgarten M. So me microbiological features of periodontal disease in man. J Periodontol 1980: 51: 264-269. 94

PAGE 95

43 Listgarten M, Hellden L. Re lative distribution of bacteria at clinically healthy and periodontally diseased sites in human. J Clin Periodontol 1978: 5: 115-132. 44 Novaes Jr. A Pereira A, de Moraes N, Nov aes A. Manifestations of insulin-dependent diabetes mellitus in the periodon tium of young Brazilian patients. J Periodontol 1987: 62: 116-122. 45 Ryland H, Ramberg P, Blohme G, Lindhe J. Prevalence of periodont al disease in young diabetics. J Clin Periodontol 1987: 14: 38-43. 46 Seppala B, Seppala M, Ainamo J. A Long itudinal study on insulin-d ependent diabetes mellitus and periodontal disease. J Clin Periodontol 1993: 20: 161-165. 47 Shlossman M, Knowler W, Pettitt D, Genco R. Type 2 diabetes mellitus and periodontal disease. J Am Dent Assoc 1990: 121: 532-536. 48 Emrich L, Shlossman M, Genco R. Periodontal disease in non-insulin -dependent diabetes mellitus. J Periodontol 1991; 62: 123-131. 49 Taylor G, Burt B, Becker M, Genco R, Shlossman M, Knowler W, Pettitt D. Non-insulin dependent diabetes mellitus and alveol ar bone loss progre ssion over 2 years. J Periodontol 1998: 69: 76-83. 50 Loe H, Periodontal disease. The sixth complication of diabetes mellitus. Diabetes Care 1993: 16: 329-334. 51 Papapanou P, Periodontal disease: epidemiology. Ann Periodontol 1996: 1: 1-36. 52 Mealey B, Oates T. Diabetes mellitus and periodontal disease. J Periodontol 2006: 77: 1289-1303. 53 Taylor G, Burt B, Becker M, Genco R, Shlossman M, Knowler W, Pettitt D. Severe periodontitis and risk for poor glycemic cont rol in patients with non-insulin-dependent diabetes mellitus. J Periodontol 1996: 67: 1085-1093. 54 Thorstenss H, Kuylenstierna J, Hugoson A. Medical status and comp lications in relation to periodontal disease experience in insulin-dependent diabetic. J Clin Periodontol 1996: 23: 194-202. 55 Page R, Offenbacher S, Schroder H, Se ymour G, Kornman K. Advances in the pathogenesis of periodontitis. Periodontol 2000 1997: 14: 216-248. 56 Salvi G, Lawrence H, Offenbacher S, Beck J. Influence of risk factors on the pathogenesis of periodontitis. Periodontol 2000 1997: 14: 173-201. 57 Sammalkorpi K. Glucose intole rance in acute infections. J Intern Med 1989: 225: 15-19. 95

PAGE 96

58 Yki-Jarvinen H, Sammalkorpi K, Koivisto V, Nikkila E. Severity, duration, and mechanisms of insulin resist ance during acute infections. J Clin Endocrinol Metab 1989: 69: 317-323. 59 Miller L, Manwell M, Newbold D, Reding M, Rasheed A, Blodgett J, Kornman K. The relationship between reduction in periodontal inflammation a nd diabetes control: a report of 9 cases. J Periodontol 1992: 63: 843-848. 60 Williams Jr. R, Mahan C. Periodontal di sease and diabetes in young adults. Jama 1960: 172: 776-778. 61 Grossi S, Skrepcinski F, DeCaro T, Za mbon J, Cummins D, Genco R. Response to periodontal therapy in diabetics and smokers. J Periodontol 1996: 67: 1094-1102. 62 Grossi S, Skrepcinski F, DeCaro T, Roberts on D, Ho A, Dunford R, Genco R. Treatment of periodontal disease in diabetes reduces glycated hemoglobin. J Periodontol 1997: 68 : 713-719. 63 Faria-Almeida R, Navarro A, Bascones A. Clinical and metabolic changes after conventional treatment of type 2 diabe tic patients with chronic periodontitis. J Periodontol 2006: 77: 591-598. 64 Kiran M, Arpak N, Unsal E, Erdogan M. The effect of improved periodontal health on metabolic control in type 2 diabetes mellitus. J Clin Periodontol 2005: 32 : 266-272. 65 Stewart J, Wager K, Friedlander A, Zadeh H. The effect of periodontal treatment on glycemic control in patients with type 2 diabetes mellitus. J Clin Periodontol 2001: 28 : 306-310. 66 Huang G, Potente A, Kim J, Chugal N, Zha ng X. Increased interl eukin-8 expression in inflamed human dental pulps. Oral surgery, oral medici ne, oral pathology, oral radiology, and endodontics 1999: 88 : 214-220. 67 Matsuyama T, Kawai T, Izumi Y, Taubman M. Expression of major histocompatibility complex class II and CD80 by gingival epithelial cells induces activation of CD4+ Tcells in response to bacterial challenge. Infect Immun 2005: 73: 1044-1051. 68 Brissette C, Fives-Taylor P. Actinobacillus actinomycetemco mitans may utilize either actin-dependent or actin-independ ent mechanisms of invasion. Oral microbiology and immunology 1999: 14: 137-142. 69 Csato M, Bozoky B, Hunyadi J, Dobozy A. Candida albicans phagocytosis by separated human epidermal cells. Archives of dermatological research 1986: 279: 136-139. 70 Meyer D, Rose J, Lippmann J, Fives-Taylor P. Microtubules are associated with intracellular movement and spread of the periodontopathogen Actinobacillus. Infect Immun 1999: 67: 6518-6525. 96

PAGE 97

71 Meyer D, Sreenivasan P, Fives-Taylor P. Evid ence for invasion of a human oral cell line by Actinobacillus actinobycetemcomitans. Infect Immun 1991: 59: 2719-2726. 72 Mutis T, De Bueger M, Bakker A, Ottenho ff T. HLA class II+ human keratinocytes present Mycobacterium leprae an tigens to CD4+ Th1-like cells. Scandinavian journal of immunology 1993: 37: 43-51. 73 Mahanonda R, Pichyangkul S. Toll-like receptors and their role in periodontal health and disease. Periodontol 2000 2007: 43: 41-55. 74 Asai Y, Ohyama Y, Gen K, Ogawa T. Bact erial fimbriae and their peptides activate human gingival epithelial cells through Toll-like receptor 2. Infect Immun 2001: 69: 7387-7395. 75 Sugawara Y, Uehara A, Fujimoto Y, Kusumoto S, Fukase K, Shibata K, Sugawara S, Sasano T, Takada H. Toll-like receptors, NOD1, and NOD2 in oral epithelial cells. J Dent Res 2006: 85: 524-529. 76 Uehara A, Sugawara S, Tamai R, Takada H. Contrasting responses of human gingival and colonic epithelial cells to lipopolysaccharides, lipoteichoic acids and peptidoglycans in the presence of soluble CD14. Medical microbiology and immunology 2001: 189: 185192. 77 Kusumoto Y, Hirano H, Saitoh K, Yamada S, Takedachi M, Nozaki T, Ozawa Y, Nakahira Y, Saho T, Ogo H, Shimabukuru Y, Okada H, Murakami S. Human gingival epithelial cells produce chemot actic factors interleukin-8 and monocyte chemoattractanct protein-1 after stimulation with Porphyr omonas gingivalis via toll-like receptor 2. J Periodontol 2004: 75: 370-379. 78 Janeway C. Approaching the asymptote? Evolution and revolution in immunology. Cold Spring Harb Symp Quant Biol 1989: 54: 1-13. 79 Hajjar A, OMahony D, Ozinsky A, Underhill D, Aderem A, Klebanoff S, Wilson C. Cutting edge: functional interactions between toll-like receptor (TLR) 2 and TLR 1 or TLR 6 in response to phenol-soluble modulin. J Immunol 2001: 166: 15-19. 80 Ozinsky A, Underhill D, Fontenot J, Hajjar A, Smith K, Wilson C, Schroeder L, Aderem A. The repertoire for pattern recognition of pathogens by the innate immune system is defined by cooperation betw een toll-like receptor. Proc Natl Acad Sci U S A 2000: 97: 13766-13771. 81 Schwander R, Dziarski R, Wesche H, Ro the M, Kirschning C. Peptidoglycanand lipoteichoic acid-induced cell activation is mediated by toll-like receptor 2. J Biol Chem 1999: 274: 17406-17409. 82 Alexopoulou L, Holt A, Medzhitov R, Flav ell R. Recognition of double-stranded RNA and activation of NF-kappaB by Toll-like receptor 3. Nature 2001: 413: 732-378. 97

PAGE 98

83 Darveau R, Pham T, Lemley K, Reife R, Ba inbridge B, Coats S, Howald W, Way S, Hajjar A. Porphyromonas gingivalis lipopolysacch aride contains multiple lipid A species that functionally interact with both toll-like receptors 2 and 4. Infect Immun 2004: 72: 5041-5051. 84 Tapping R, Akashi S, Miyake K, Godowski P, Tobias P. Toll-like receptor 4, but not tolllike receptor 2, is a signaling recep tor for Escherichia and Salmonella lipopolysaccharides. J Immunol 2000: 165: 5780-5787. 85 Gewirtz A, Yu Y, Krishna U, Israel D, Lyons S, Peek R Jr. Helicob acter pylori flagellin evades toll-like receptor 5mediated innate immunity. J Infect Dis 2004: 189 : 1914-1920. 86 Hemmi H, Kaisho T, Takeuchi O, Sato S, Sanjo H, Hoshino K, Horiuchi T, Tomizawa H, Tomizawa H, Takeda K, Akira S. Small antiv iral compounds activated immune cells via ther TLR7 MyD88-dependent signaling pathway. Nat Immunol 2002: 3: 196-200. 87 Anderson K, Jurgens G, Nusslein-Volhard C. Establishment of dorsal-ventral polarity in the Drosophila embryo: induction of polarity by the Toll gene product. Cell 1985: 42 : 791-789. 88 Bauer S, Kirschning C, Hacker H, Redecke V, Hausmann S, Akira S, Wagner H, Lipford G. Human TLR9 confers responsiveness to bacterial DNA via species-specific CpG motif recognition. Proc Natl Acad Sci U S A 2001: 98: 9237-9242. 89 Takeuchi O, Sato S, Horiuchi T, Hoshino K, Takeda K, Dong Z, Modlin R, Akira S. Cutting edge: role of Toll-like receptor 1 in mediating immune response to microbial lipoproteins. J Immunol 2002: 169: 10-14. 90 Beutler B, Hoebe K, George P, Tabeta K, Du X. Genetic analysis of innate immunity: TIR adapter proteins in innate and adaptive immune responses. Microbes Infect 2004: 6: 1374-1381. 91 Akira S, Takeda K, Kaisho T. Toll-like recep tors: critical proteins linking innate and acquired immunity. Nat Immunol 2001: 2: 675-680. 92 Doyle S, Vaidya S, OConnell R, Dadgostar H, Dempsey P, Wu T, Rao G, Sun R, Haberland M, Modlin R, Cheng G. IRF3 me diates a TLR3/TLR4-specific antiviral gene program. Immunity 2002: 17: 251-263. 93 Hayashi F, Means T, Luster A. Toll-like receptors stimulate human neutrophil function. Blood 2003: 102: 2660-2669. 94 Iwasaki A, Medzhitov R. Toll-like receptor control of the adaptive immune responses. Nat Immunol 2004: 5: 987-995. 95 Banchereau J, Steinman R. Dendtric cells and the control of immunity. Nature 1998: 392: 245-252. 98

PAGE 99

96 Uehara A, Sugawara S, Takada H. Primi ng of human oral epithelial cells by interongamma to secrete cytokines in response to lipopolysaccharides, lipoteichoic acids and peptidoglycans. J Med Microbiol 2002: 51: 626-634. 97 Fu M, Requena J, Jenkins A, Lyons T, Baynes J, Thorpe S. The advanced glycation end product, carboxymethyl lysine is a product of both lipid peroxidation and glycoxidation reactions. J Biol Chem 1996: 271: 9982-9986. 98 Niwa T, Katsuzachi T, Miyazaki T, et al. Immunohistochemical detection of imidazolone, a novel advanced glycation end prod uct, in kidneys and aortas of diabetic patients. J Clin Invest 1997: 99: 1272-1280. 99 Ahmed N, Ahmed U, Thornalley P, Hager K, Fleisher G, Munch G. Protein glycation, oxidation and nitration adduct residues and free adducts of cerebrospinal fluid in Alzheimers disease and link to cognitive impairment. J Neurochem 2005: 92: 255-263. 100 Singh R, Barden A, Mori T, Beilin L. A dvanced glycation end-products: a review. Diabetologia 2001: 44: 129-146. 101 Lin L. RAGE on the Toll Road?. Cell & Mole Immuno 2006: 3(5) : 351-358. 102 Thornalley P. Glycation free adduct accumu lation in renal disease: the new AGE. Pediatr Nephrol 2005: 20: 1515-1522. 103 Sell D, Monnier V. Structure elucidati on of a senescence cross-link from human extracellular matrix. J Biol Chem 1989: 264: 21597-21602. 104 Schleicher ED, Wagner E, Nerlich AG. In creased accumulation of the glycoxidation product N (carboxymethyl)lysine in human tissues in diabetes and aging. J Clin Invest 1997: 99: 457-468. 105 Frye EB, Degenhardt, Thorpe SR, Baynes JW. Role of the Maillard reaction in aging of tissue proteins. J Biol Chem 1998: 273: 18714-18719. 106 Monnier VM, Kohn RR, Cerami A. Accelerated age-related browning of human collagen in diabetes mellitus. Proc Natl Acad Sci 1984: 81: 583-587. 107 Brownlee M, Cerami A, Vlassara H. Advan ced glycosylation end products in tissue and the biochemical basis of diabetic complications. N Engl J Med 1988: 318 : 1315-1321. 108 Hammes HP, Weiss A, Hess S. Modification of vitronectin by advanc ed glycation alters functional properties in vitr o and the diabetic retina. Diabetologia 1999: 42 : 728-736. 109 Korbet SM, Makita Z, Firanek CA, Vlassara H. Advanced glycosylation end products in continuous ambulatory perit oneal dialysis patients. Am J Kidney Dis 1993: 22: 588-591. 99

PAGE 100

110 Shimoike T, Inoguchi T, Umeda F, Nawata H, Kawano K, Ochi H. The meaning of serum levels of advanced glycosylation end products in diabetic nephropathy. Metabolism 2000: 49: 1030-1035. 111 Makita Z, Radoff S, Rayfield AJ, et al. Adva nced glycosylation end products in patients with diabetic nephropathy. N Engl J Med 1991: 325: 836-842. 112 Kent M, Light ND, Bailey AJ. Evidence for gl ucose-mediated covale nt cross-linking of collagen after glycosylation in vitro Biochem J 1985: 225: 745-752. 113 Shimomura H, Spiro RG. Studies on macrom olecular components of human glomerular basement membrane and alterations in diab etes: decreased levels of heparin sulfate proteoglycan and laminin. Diabetes 1987: 36: 374-381. 114 Wautier JL, Wautier MP, Schmidt AM, et al Advanced glycation end products (AGES) on the surface of diabetic red cells bind to th e vessel wall via a sp ecific receptor inducing oxidant stress in the vasculature: a link between surface-associated AGES and diabetic complications. Proc Natl Acad Sci 1994: 91: 7742-7746. 115 Taguchi A, Blood DC, del Toro G, et al. Blockade of RAGE-amphoterin signaling suppresses tumor growth and metastases. Nature 2000: 405: 354-360. 116 Hori O, Brett J, Slattery T, et al. The receptor for advanced glycation end products (RAGE) is a cellular binding site for amphoter in. Mediation of neurite outgrowth and coexpression of rage and amphoterin in the developing nervous system. J Biol Chem 1995: 270: 25752-25761. 117 Neeper M, Schmidt AM, Brett J, et al. Cloning and expression of a cell surface receptor for advanced glycosylation end products of proteins. J Biol Chem 1992: 267: 1499815004. 118 Makino S, Kunimoto K, Muraoka Y, Mizushim a Y, Katagiri K, et al. Breeding of a nonobese, diabetic strain of mice. Jikken Dobutsu 1980: 29: 1-13. 119 Kikutani H, Makino S. The murine auto immune diabetes model: NOD and related strains. Adv Immunol 1992: 51: 285-322. 120 Anderson MS, Bluestone JA. The NOD Mouse: A Model of Immune Dysregulation. Annu Rev. Immunol 2005: 23: 447-485. 121 Bach JF. Insulin-dependent diabetes mellitus as an autoimmune disease. Endocr Rev 1994: 15: 16-42. 122 Bach JF. The effects of infections on suscepti bility to autoimmune a nd allergic diseases. N Engl J Med 2002: 347: 911-920. 123 Wicker LS, Miller BJ, Mullen Y. Transfer of autoimmune diabetes mellitus with splenocytes from non-obese diabetic (NOD) mice. Diabetes 1986: 35: 855-860. 100

PAGE 101

124 Bendelac A, Carnaud C, Boitard C, Bach JF. Syngeneic transfer of autoimmune diabetes from diabetic NOD mice to healthy neonates. Requirement for both L3T4+ and Lyt-2+ T cells. Exp Med 1987: 166 : 823-832. 125 Wang B, Gonzalez A, Benoist C, Mathis D. The role of CD8+ T cells in the initiation of insulin-dependent diabetes mellitus. Eur J Immunol 1996: 26 : 1726-1769. 126 Lieberman SM, DiLorenzo TP. A comprehensiv e guide to antibody and T-cell responses in type 1 diabetes. Tissue Antigens 2003: 62: 359-377. 127 Serreze DV, Gaedeke JW, Leiter EH. Hematopoietic stem-cell defects underlying abnormal macrophage development and matura tion in NOD/Lt mice: defective regulation of cytokine receptors and protein kinase C. Proc Natl Acad Sci USA 1993: 90: 96259629. 128 Kataoka S, Satoh J, Fujiya H, Toyota T, Su zuki R, et al. Immunological aspects of the non-obese diabetic (NOD) mouse. A bnormalities of cellular immunity. Diabetes 1983: 32: 247-257. 129 Ogasawara K, Hamerman IA, Hsin H, Chikuma S, Bour-Jordan H, et al. Impairment of NK cell function by NKG2D modulation in NOD mice. Immunity 2003: 18: 41-51. 130 Naumov YN, Bahjat KS, Gausling R, Abraham R, Exley MA, et al. Proc Natl Acad Sci USA 2001: 98: 13838-13843. 131 Wang B, Geng YB, Wang CR. CD1-restricted NK T cells protect non-obese diabetic mice from developing diabetes. J Exp Med 2001: 194: 313-320. 132 Salomon B, Lenschow DJ, Rhee L, Ashourian N, Singh B, et al. B7/CD28 costimulation is essential for the homeostasis of the CD4+CD25+ immunoregulatory T cells that control autoimmune diabetes. Immunity 2000: 12 : 431-440. 133 Baxter AG, Cooke A. Complement lytic activ ity has no role in the pathogenesis of autoimmune diabetes in NOD mice. Diabetes 1993: 42: 1574-1578. 134 King C, Ilic A, Koelsch K, Sarvetnick N. Homeostatic expansion of T cells during immune insufficiency generates autoimmunity. Cell 2004: 117 : 265-277. 135 Teng Y. Protective and Destructive Immunity in the Periodontium: Part 1-Innate and Humoral Immunity and the Periodontium. J Dent Res 2006: 85(3) : 198-208. 136 Netea MG, Van der Meer JW, Kullberg BJ. Toll-like receptors as an escape mechanism from the host defense. Trends Microbial 2004: 12 : 484-488. 137 Hirschfield M, Wiess JJ, Toshchakov V, Sa lkowski CA, Cody MJ, Ward DC, et al. Signaling by Toll-like receptor 2 and 4 agonist results in diffe rential gene expression in murine macrophages. Infect Immun 2001: 69: 1477-1482. 101

PAGE 102

138 Werts C, Tapping RI, Mathison JC, Chuang TH, Kravchenko V, Saint Girons I, et al. Liptospiral lipopolysaccharide activates cells through a TLR2-dependent mechanism. Nat Immunol 2001: 2: 346-352. 139 Darveau RP, Pham TT, Lemley K, Reife RA, Bainbridge BW, Coats SR, et al. Porphyromonas gingivalis lipopolysaccharide contains multiple lipid A species that functionally interact with bot h Toll-like receptors 2 and 4. Infect Immun 2004: 72: 50415051. 140 Agrawal S, Agrawal A, Doughty B, Gerwitz A, Blenis J, Van Dyke T, et al. Cutting edge: different Toll-like receptor agonists inst ruct dendritic cells to induce distinct Th responses via differential modulation of ex tracellular signal-regul ated kinase-mitogenactivated protein kinase and c-Fos. J Immunol 2003: 171: 4984-4989. 141 Lalla E, Lamster IB, Feit M, Huang L, Spesso t A, Qu W, Kislinger T, Lu Y, Stern D, Schmidt AM. Blockage of RAGE suppresse s periodontitis-associated bone loss in diabetic mice. J Clin Invest 2000: 105 : 117-124. 142 Lalla E, Lamster IB, Feit M, Huang L, Sc hmidt AM. A murine model of accelerated periodontal disease in diabetes. J Periodontal Res 1998: 33: 387-399. 143 Brownlee M, Cerami A, Vlassara H. Advan ced glycosylation end products in tissue and the biochemical basis of diabetic complication. N Engl J Med 1988: 318: 1315-1321. 144 Grossi SG, Genco RJ. Periodontal disease and diabetes mellitus: a two-way relationship. Annals of Periodontology 1998: 3: 51-61. 145 Schmidt AM, Hori O, Chen JX, Li JF, Cra ndall J, Zhang J. Advanced glycation end products interacting with their endothelial re ceptor induce expression of vascular cell adhesion molecule-1 (VCAM-1) in culture d human endothelial ce lls and in mice. A potential mechanism for the accelerated vasculopathy of diabetes. J Clin Invest 1995: 96: 1395-1403. 102

PAGE 103

103 BIOGRAPHICAL SKETCH Jeffrey Wayne Tobler was born in Richland, Wa shington, to Karl and Jan Tobler. In 1999 he graduated from Pasco Senior High School in Pasco, Washington. In October 1999, Jeff put his academic pursuits on hold and served a two year mission in Fukuoka, Japan for the Church of Jesus Christ of Latter-Day Saints. After retu rning from Japan, Jeff continued his studies, receiving a bachelors degree in East Asian lang uages and literature from the University of Florida in 2006. After graduating, Jeff worked fo r a year in the Periodontal Disease Research Center in the department of Oral Biology in the College of Dentistry at the University of Florida. Jeff began a masters degree in biom edical sciences in the College of Medicine at the University of Florida in 2007. After completing his masters degree, Jeff will continue his career goals and will pursue a D.M.D degree in the College of Dentistr y at the University of Florida in the fall of 2009.