<%BANNER%>

The Role Of Ectopic Lymphoid Tissue in the Pathogenesis of Humoral Autoimmunity

Permanent Link: http://ufdc.ufl.edu/UFE0024342/00001

Material Information

Title: The Role Of Ectopic Lymphoid Tissue in the Pathogenesis of Humoral Autoimmunity
Physical Description: 1 online resource (133 p.)
Language: english
Creator: Weinstein, Jason
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: b, ectopic, pristane
Immunology and Microbiology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Intraperitoneal administration of tetramethylpecadentane (TMPD) causes chronic inflammation that result in a lupus-like disease including autoantibody production and lipogranuloma formation, a form of ectopic lymphoid tissue. Although ectopic lymphoid tissue formation is associated with many humoral autoimmune diseases, it remains unclear whether this tissue has a functional role in autoimmune responses. We examined whether an immune response to NP-KLH develops within lipogranulomas. Following primary immunization, NP-specific B cells bearing V186.2 and related heavy chains as well as lambda-light chains accumulated within lipogranulomas. Remarkably, the H-chain sequences isolated from individual lipogranulomas from these mice had unique oligoclonal populations of NP-specific B cells. In mice adoptively transferred with transgenic CD4 T cells, there was a striking accumulation of transgenic-specific T cells in lipogranulomas after immunization. The selective co-localization of proliferating, antigen-specific T and B lymphocytes in lipogranulomas undergoing primary immunization implicates ectopic lymphoid tissue as a site where antigen-specific humoral immune responses can develop. We demonstrated that lipogranulomas induced by TMPD not only resembles secondary lymphoid tissue morphologically, but also displays characteristics of germinal center reactions. Proliferating T and B lymphocytes, activation-induced cytidine deaminase expression, and class switched B cells were present within lipogranulomas. Class-switched anti-RNP autoantibody producing cells were also found in the lipogranulomas. Somatic hypermutation in the lipogranulomas was T cell dependent, as was the production of isotype-switched anti-Sm/RNP autoantibodies. A novel transplantation model was developed to show that lipogranulomas not only continues to retain its lymphoid cell components but also the ability to produce autoantibodies, without further TMPD treatment of recipient mice. The donor derived anti-U1A IgG production in recipient mice remains elevated for up to two months post transplant. We identified plasma cells from transplanted lipogranulomas as the source of secreted autoantibodies in recipients, even in the absence of CD4 T cells. Our model provides direct evidence that lipogranulomas are not only capable of transplantable autoimmunity, but identifying long lived plasma cells within ectopic lymphoid tissue as the cells responsible for autoantibody production. This has implications for understanding the strong association of humoral autoimmunity with lymphoid neogenesis, which may be associated with deficient censoring of autoreactive cells
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Jason Weinstein.
Thesis: Thesis (Ph.D.)--University of Florida, 2009.
Local: Adviser: Reeves, Westley H.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-05-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0024342:00001

Permanent Link: http://ufdc.ufl.edu/UFE0024342/00001

Material Information

Title: The Role Of Ectopic Lymphoid Tissue in the Pathogenesis of Humoral Autoimmunity
Physical Description: 1 online resource (133 p.)
Language: english
Creator: Weinstein, Jason
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: b, ectopic, pristane
Immunology and Microbiology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Intraperitoneal administration of tetramethylpecadentane (TMPD) causes chronic inflammation that result in a lupus-like disease including autoantibody production and lipogranuloma formation, a form of ectopic lymphoid tissue. Although ectopic lymphoid tissue formation is associated with many humoral autoimmune diseases, it remains unclear whether this tissue has a functional role in autoimmune responses. We examined whether an immune response to NP-KLH develops within lipogranulomas. Following primary immunization, NP-specific B cells bearing V186.2 and related heavy chains as well as lambda-light chains accumulated within lipogranulomas. Remarkably, the H-chain sequences isolated from individual lipogranulomas from these mice had unique oligoclonal populations of NP-specific B cells. In mice adoptively transferred with transgenic CD4 T cells, there was a striking accumulation of transgenic-specific T cells in lipogranulomas after immunization. The selective co-localization of proliferating, antigen-specific T and B lymphocytes in lipogranulomas undergoing primary immunization implicates ectopic lymphoid tissue as a site where antigen-specific humoral immune responses can develop. We demonstrated that lipogranulomas induced by TMPD not only resembles secondary lymphoid tissue morphologically, but also displays characteristics of germinal center reactions. Proliferating T and B lymphocytes, activation-induced cytidine deaminase expression, and class switched B cells were present within lipogranulomas. Class-switched anti-RNP autoantibody producing cells were also found in the lipogranulomas. Somatic hypermutation in the lipogranulomas was T cell dependent, as was the production of isotype-switched anti-Sm/RNP autoantibodies. A novel transplantation model was developed to show that lipogranulomas not only continues to retain its lymphoid cell components but also the ability to produce autoantibodies, without further TMPD treatment of recipient mice. The donor derived anti-U1A IgG production in recipient mice remains elevated for up to two months post transplant. We identified plasma cells from transplanted lipogranulomas as the source of secreted autoantibodies in recipients, even in the absence of CD4 T cells. Our model provides direct evidence that lipogranulomas are not only capable of transplantable autoimmunity, but identifying long lived plasma cells within ectopic lymphoid tissue as the cells responsible for autoantibody production. This has implications for understanding the strong association of humoral autoimmunity with lymphoid neogenesis, which may be associated with deficient censoring of autoreactive cells
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Jason Weinstein.
Thesis: Thesis (Ph.D.)--University of Florida, 2009.
Local: Adviser: Reeves, Westley H.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2011-05-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0024342:00001


This item has the following downloads:


Full Text

PAGE 1

1 THE ROLE OF ECTOPIC LYMPHOID TISSUE IN THE PATHOGENESIS OF HUMORAL AUTOIMMUNITY By JASON SCOTT WEINSTEIN A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2009

PAGE 2

2 Jason Scott Weinstein

PAGE 3

3 To my wife, who has always been there for me.

PAGE 4

4 ACKNOWLEDGMENTS I would like to acknowledge the following people that have helped shape m e as a person and scientist that I am today, w ithout whom I would not have been able to accomplish the goals and aspirations I had set forth for me. I would like to thank my mentor Dr. Westley for continuing to inspire me to be a well rounded scientist. He taught me to focus not only on the specifics of my projects but to understand it in relation to the different facet s of immunology. I want to thank my committee members Drs. John Petitto, Minoru Satoh, and Er ic Sobel for their t houghtful guidance and always leaving their doors open to me throughout my graduate caree r. I would like to thank our collaborators at the University of Florida, in cluding Drs. Lyle Moldawer and Matt Delano for giving me a chance to explore B ce lls in other avenues of inflamma tion. I also want to thank Dr. Laurence Morel for her insightful discussions on lymphocytes. I am grateful for the collaboration and cam araderie from member of the Reevess laboratory. In particular I would like to thank Dina Nacionales who always unselfishly helped me with experiments and provided a guiding for ce through any problems that arose in lab. Dr. Pui Lee for teaching me about the other side of the immune response and participating in our many scientific debates. Yi Li for allowing me to possess a sense of humor in lab. Tolga Barker and Rob Lyons for joining me in the daily trenches of the lab. I also would like to thank Drs. Kindra and Phil Scumpia for always being there a nd especially for their brutally honest opinions about all of my scientific endeavors. I would like to extend my appreciation to Dr. Theresa OKeefe who provided a young nave undergrad with a role model of what a scientis t should be. I want to thank all my friends in the IDP program that helped me enjoy my time outside of lab. I especially want to thank my wife Cara for all her support and understanding th rough the long days in lab. Lastly I would like

PAGE 5

5 to thank my parents and siblings who without thei r conditional love I would have not made it this far.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS ............................................................................................................... 4LIST OF TABLES ...........................................................................................................................9LIST OF FIGURES .......................................................................................................................10LIST OF ABBREVATIONS ......................................................................................................... 11ABSTRACT ...................................................................................................................... .............13CHAPTER 1 INTRODUCTION .................................................................................................................. 15Chemical, Inflammatory, and Carcinogeni c Properties of Hydrocarbon Oils ........................15Adjuvant Properties of Hydrocarbon Oils .......................................................................15Inflammatory Effects of H ydrocarbons in Humans ........................................................16Autoantibodies and Other Humoral Immune Abnormalities in TMPD-Treated Mice ... 16Polyclonal Hypergammaglobulinemia ............................................................................ 17Induction of Autoantibodies by TMPD ...........................................................................18T Cell Requirement for Autoantibody Production in TMPD-Treated Mice ................... 19Effects of IL-6, IFN IL-4, and Il-12 on Autoantibody Production ............................... 19Efficacy of Other Hydrocarbons at Inducing Autoantibodies ......................................... 20Autoimmune Disease in TMPD-Treated Mice ....................................................................... 21Immune Complex-Mediated Glomerulonephritis ...........................................................21Relevance of TMPD-Induced Lupus to SLE ...................................................................23Abnormal Production of IFN-I TMPD-Induced Lupus ................................................... 24Immature Monocytes are a Major Source of IFN-I in TMPD-Lupus ............................. 25Mechanism of IFN-I Production in TMPD Lupus .......................................................... 26Lymphoid Neogenesis In TMPD Treated Mice .....................................................................29Association of Lymphoid Neogenesis with Autoimmunity. ........................................... 29Pristane Induces Ectopic Lymphoid Tissue ....................................................................31Antigen Specific B Cell Responses in TMPD-Induced Ectopic Lymphoid Tissue ........ 31Anti-RNP Autoantibody Production in Ectopic Lymphoid Tissue ................................. 332 CO-LOCALIZATION OF ANTIGEN-SPE CIFIC B AND T CELLS W ITHIN ECTOPIC LYMPHOID TISSUE FO LLOWING IMMUNIZATION WITH EXOGENOUS ANTIGEN .....................................................................................................35Introduction .................................................................................................................. ...........35Materials and Methods ...........................................................................................................37Mice .................................................................................................................................37Anti-4-hydroxy-3-nitrophenyl (NP) IgM and IgG ELISA ..............................................37Bromodeoxyuridine (BrdU) Labeling of B and T Cells .................................................. 38Kappa/Lambda Light Chain Staining ..............................................................................38

PAGE 7

7 Anti-4-Hydroxy-3-Nitrophenyl (NP) ELISPOT Assay ................................................... 39Variable Heavy Chain Gene Sequences ..........................................................................39Transfer of Antigen-Specific T Cells ..............................................................................39T Cell Proliferation Assay ...............................................................................................40Polymerase Chain Reaction Analysis of T Cell Cytokines ............................................. 40Results .....................................................................................................................................41Antigen-Specific B Cell Responses in Ectopic Lymphoid Tissue .................................. 41Ovalbumin-Specific T Cells Localize a nd Expand in Ectopic Lymphoid Tissue ........... 424-Hydroxy-3-Nitrophenyl NP-Specific B Cells and Anti-NP Antibody Production in Ectopic Lymphoid Tissue ........................................................................................44Heavy-Chain Sequences from Spleen a nd Ectopic Lymphoid Tissue of NP-KLH Immunized Mice ..........................................................................................................44Discussion .................................................................................................................... ...........463 B CELL PROLIFERATION, SOMATIC HYPERMUTATION, CLASS SW ITCH RECOMBINATION, AND AUTOANTIB ODY PRODUCTION IN ECTOPIC LYMPHOID TISSUE IN MURINE LUPUS ......................................................................... 57Introduction .................................................................................................................. ...........57Materials and Methods ...........................................................................................................59Mice .................................................................................................................................59Immunohistochemistry a nd Immunofluorescence ..........................................................59Bromodeoxyuridine (BrdU) Labeling of B and T Cells .................................................. 60Ki-67 Staining of B and T Cells ...................................................................................... 61Real Time-PCR Analysis of Aid and Class Switched H-Chain Transcripts ................... 61Class Switch Recombination Assay ................................................................................62Immunoglobulin V-D-J Sequence Analysis .................................................................... 62Enzyme Linked Immunosorbent Assay ........................................................................... 63Quantification of Plasmablasts ........................................................................................63ELISPOT Assay for Total Immunoglobulin ................................................................... 63ELISPOT Assay for Anti-RNP Autoantibodies .............................................................. 64Results .....................................................................................................................................65Lymphocyte Proliferation in TMPD-Induced Ectopic Lymphoid Tissue ....................... 65Expression of AID and CSR in TMPD -Induced Ectopic Lymphoid Tissue ................... 66Individual Lipogranulomas from a Single Mouse Contain Different Populations of B Cells ..........................................................................................................................67Somatic Hyper Mutation in TMPD-Treat ed Mice is T Cell-Dependent. ........................ 69Pristane-Induced Hypergammaglobulinemia and Autoantibody Production are also T Cell Dependent .........................................................................................................70Discussion .................................................................................................................... ...........734 MAINTENANCE OF ANTI-SM/RNP AU TOANTIBODY PRODUCTI ON IN EXPERIMENTAL LUPUS BY PLASMA CELLS RESIDING IN ECTOPIC LYMPHOID TISSUE AND MEMORY B CE LLS RESIDING IN THE BONE MARROW ........................................................................................................................ ......87Introduction .................................................................................................................. ...........87

PAGE 8

8 Methods and Materials ...........................................................................................................88Mice .................................................................................................................................88Lipogranuloma Transplantation ......................................................................................89Flow Cytometry ...............................................................................................................89Anti-U1A (RNP) ELISA .................................................................................................90Detection of Autoantibodies by Immunoprecipitation ....................................................90Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR) ...................................... 90Quantitative PCR .............................................................................................................91ELISPOT Assay for Anti-RNP Autoantibody Secreting Cells ....................................... 91Statistical Analysis. .........................................................................................................91Results .....................................................................................................................................92Discussion .................................................................................................................... ...........99Ectopic Lymphoid Tissue is a Major Site of Autoantibody Production in TMPDLupus..........................................................................................................................101Regulation of Autoantibody Production in Tr ansplanted Ectopic Lymphoid Tissue ... 101Altered Bone Marrow Plasma Cell Home ostasis in TMPD-Treated Mice ...................1035 FUTURE DIRECTIONS ......................................................................................................113B Cells in the TMPD Model .................................................................................................113T Cells in the TMPD Model ................................................................................................. 113Bone Marrow in the TMPD Model ......................................................................................114Conclusion .................................................................................................................... ........114REFERENCES .................................................................................................................... ........117BIOGRAPHICAL SKECTH .......................................................................................................133

PAGE 9

9 LIST OF TABLES Table page 2-1 V186.2 sequences from mice undergoi ng prim ary NP-KLH immunization .....................563-1 Somatic hypermutation of H-chains from ectopic lymphoid tissue ................................... 853-2 Somatic hypermutation in ectopic lym phoid tissue from TcR deficient mice ................... 86

PAGE 10

10 LIST OF FIGURES Figure page 2-1 Serum anti-NP response after immunization with NP-KLH. ............................................ 512-2 OVA-specific T cells in lipogranulomas. .......................................................................... 522-3 Anti-NP B cells in ectopic lymphoid tissue. ...................................................................... 532 4 VH segment usage in lipogranulomas and spleen ............................................................. 542-5 Oligoclonal VH sequences from lipogranulomas of immunized mice. ............................. 552-6 CDR1 and CDR2 sequences from H-ch ains isolated from lipogranulomas.. .................... 563-1 B and T cell proliferation in lipogranulomas. .................................................................... 773-2 TMPD lipogranulomas cont ain class switched B cells. ..................................................... 783-3 Individual TMPD-induced lipogranulomas contain distinct ive populations of B cells. .... 803-4 VH sequences from TMPD -induced lipogranulomas. ....................................................... 813-5 IgG1 and IgG2a induced hypergammaglobul inemia in TMPD-treated mice is T cell dependent.. .........................................................................................................................823-6 Ig G anti-nRNP/Sm autoantibody produc tion in TMPD-treated mice is T cell dependent. ..........................................................................................................................834-1 Transplanted lipogranuloma become vascularized. ......................................................... 1054-2 Serum levels of anti-U1A an tibodies in recipient mice. .................................................. 1064-3 Recipient T cells repopulate transplanted lipogranulomas .............................................. 1074-4 Anti-U1A antibodies are made exclusively from donor lipogranulomas. ....................... 1084-5 Serum anti-U1A antibodies in transplant ed mice persist after T cell depletion.. ............ 1094-6 IgG anti-U1A antibody levels are decreased but not abolished afte r T cell depletion. ... 1104-7 TMPD treatment depletes plasma cells from the bone marrow. ...................................... 1114-8 The effect of IFN-I on lymphocyte activation. ................................................................ 1125-1 Lipogranulomas contain an increased IgM-IgD+ B cell population. .............................. 1155-2 TMPD drives an increase in CD11b+ cells in the bone marrow ..................................... 116

PAGE 11

11 LIST OF ABBREVATIONS AID Activation-induced cytidine deaminase ANA antinuclear antibodies BLC B lymphocyte chemoattractant CSR Class switch recombination DNA Deoxyribonucleic acid dsDNA double-stranded DNA ELC EBI1 ligand chemokine Fc R Fc receptor IFN interferon IFN-I type-I interferons IFNAR Interferon alpha receptor IPS-1 interferonpromoter stimulator-1 ISG Interferon stimulated gene MCP monocyte chemoattractant protein MyD88 myeloid differentiation factor 88 NZB/W (New Zealand Black X New Zealand White) F1 NP-KLH 4-hydroxy-3-nitrophenyl acetyl-conj ugated keyhole limpet hemocyanin OVA ovalbumin PDCs Plasmacytoid dendritic cells RA Rheumatoid arthritis SHM somatic hypermutation SLC secondary lymphoid-tissue chemokine

PAGE 12

12 SLE systemic lupus erythematosus snRNP small nuclear ribonucleoprotein TCR T cell receptor TMPD tetramethylpentadecane TLR Toll-like receptor TRIF TIR domain-containi ng adaptor inducing IFN-I

PAGE 13

13 Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy THE ROLE OF ECTOPIC LYMPHOID TISSUE IN THE PATHOGENISIS OF HUMORAL AUTOIMMUNITY By Jason Scott Weinstein May 2009 Chair: Westly Hubbard Reeves Major: Medical Sciences--Immunology and Microbiology Intraperitoneal administration of tetram ethylpecadentane (TMPD) causes chronic inflammation that result in a lupus-like disease includi ng autoantibody production and lipogranuloma formation, a form of ectopic lym phoid tissue. Although ec topic lymphoid tissue formation is associated with many humoral autoimmune diseases, it remains unclear whether this tissue has a functional role in autoimmune responses. We examined whether an immune response to NP-KLH develops within lipogranulomas. Follo wing primary immunization, NPspecific B cells bearing V186.2 and related heav y chains as well as lambda-light chains accumulated within lipogranulomas. Remarkab ly, the H-chain sequences isolated from individual lipogranulomas from these mice had unique oligoclonal populati ons of NP-specific B cells. In mice adoptively transferred with tr ansgenic CD4 T cells, there was a striking accumulation of transgenic-specific T cells in lipogranulomas after immunization. The selective co-localization of proliferating, antigen-spec ific T and B lymphocyt es in lipogranulomas undergoing primary immunization implicates ectopic lymphoid tissu e as a site where antigenspecific humoral immune responses can develop.

PAGE 14

14 We demonstrated that lipogranulomas indu ced by TMPD not only resembles secondary lymphoid tissue morphologically, but also displays ch aracteristics of germin al center reactions. Proliferating T and B lymphocytes activation-induced cytidine d eaminase expression, and class switched B cells were present within lipogra nulomas. Class-switched anti-RNP autoantibody producing cells were also found in the lipogranulomas. Somatic hypermutation in the lipogranulomas was T cell dependent, as was th e production of isotype-s witched anti-Sm/RNP autoantibodies. A novel transplantation model was develope d to show that lipogranulomas not only continues to retain its lymphoi d cell components but also the ab ility to produce autoantibodies, without further TMPD treatment of recipient mice. The donor derived anti-U1A IgG production in recipient mice remains elevated for up to two months post transplant. We identified plasma cells from transplanted lipogranulomas as the so urce of secreted autoan tibodies in recipients, even in the absence of CD4 T cells. Our model provides direct evidence that lipogranulomas are not only capable of transplantab le autoimmunity, but identifying long lived plasma cells within ectopic lymphoid tissue as the cells respons ible for autoantibody production. This has implications for understanding the strong associat ion of humoral autoi mmunity with lymphoid neogenesis, which may be associated with deficient censoring of autoreactive cells

PAGE 15

15 CHAPTER 1 INTRODUCTION Chemical, Inflammatory, and Carcinogenic Properties of Hydrocarbon Oils Mineral oil is a byproduct of the fractional dist illation of petroleum It is a complex mixture of straightand branched-chain paraffini c, naphthenic, and aromatic hydrocarbons with 15 or more carbons and boiling points between 30 0-600 C. Medicinal (pharmaceutical or food grade) mineral oils, which are free of aromatic and unsaturated compounds, are used widely as laxatives, protective coatings for foods, and in cosmetics. Estimates of dietary exposure to mineral oil in western countries range from 9-45 gr ams per year(1). Some of this is absorbed through the intestine and can be detected in lymph nodes, spleen, liver, kidneys, and brain (2, 3) In 1962, Potter and associates re ported that mineral oil can in duce plasmacytomas in BALB/c mice when injected into the per itoneal cavity(4). S ubsequently, it was found that the component most potent in inducing plasmacytomas was pr istane (2,6,10,14-tetramethylpentadecane, TMPD) (5). The development of plasmacytomas followi ng three intraperitoneal (i.p.) TMPD injections requires 10 months or more, is hi ghly strain dependent (the BALB/c AnPt substrain is particularly susceptible), and requires IL-6 (6). The plas macytomas arise from plasma cells found within structures termed lipogranulomas, which repr esent a chronic inflammatory response to the hydrocarbon oil. TMPD-induced plasmacytomas have been studied extensively as a model of multiple myeloma(7). However, so far, there is little evidence that TMPD or other hydrocarbons can induce plasma cell neoplasms in humans. Adjuvant Properties of Hydrocarbon Oils Hydrocarbons such as turpentine and certain al kanes have been used to study inflamm atory responses in experimental models (8-10). So me, such as the mineral oil Bayol F (Freunds adjuvant), squalene (MF59), and TMPD, have ad juvant effects. Stra ight chain hydrocarbons

PAGE 16

16 (C15-20) can substitute for the mineral oil (a complex mixture of hydrocarbons) in Freund's adjuvant, allowing induction of experimental autoimmune encephalomyelitis, whereas longer and shorter carbon chains are ine ffective(9). The optimum chain length for adjuvanticity is 12 carbons(11). Although the mechanism of this adj uvant effect is incompletely understood (12), squalene is internalized by macrophages, which are transported to regional lymph nodes where they undergo apoptosis and are engulfed by dendrit ic cells(12, 13). This may promote the T and B cell activation seen in hydr ocarbon-treated mice. Inflammatory Effects of Hydrocarbons in Humans Hydrocarbons are potent inducer s of inflamm ation in humans as well as mice. Inadvertent injection of hydrocarbon oils into the skin, even through a minute wound (e.g. grease gun or paint spray gun injuries) leads to rapid subcut aneous spreading of th e oil and an intense inflammatory reaction usually resulting in swelling, pain, and edema within 6 hours and followed by permanent loss of function(14). Simila rly, the ingestion of mi neral oil as a laxative may lead to aspiration, resulting in a pulmona ry inflammatory response known as lipoid pneumonia(15, 16). This causes abnormalities on chest radiographs and the formation of inflammatory lesions called lipogranulomas, which can be shown to contain mineral oil droplets using oil red staining or other histopathological techniques. The mechanism(s) responsible for this intense inflammatory response remain unknown. Autoantibodies and Other Humoral Immune Abnormalit ies in TMPD-Treated Mice It was noted as early as 1981 that BALB/c mice injected i.p. with TMPD into the peritoneal cavity can develop an erosive arthritis resembling rheumatoid arthritis (RA)(17). In 1994, it was found that TMPD treatment induces au toantibodies associated with SLE along with clinical manifestations of the disease, such as glomerulonephritis, arthritis, and pulmonary hemorrhage(18). Susceptibility to TMPD-induced lupus among non-autoimmune prone mice is

PAGE 17

17 widespread, although there are st rain-to-strain differences in autoantibodies and clinical manifestations(19). The autoantibodies induced by TMPD are primarily isotype switched IgGs and include anti-double-stranded (ds) DNA, single-stranded (ss) DNA, chromatin, Sm, RNP, Su, and ribosomal P, all of which are associated with SLE. TMPD treatment also leads to polyclonal hypergammaglobulinemia, another common imm unological feature of human SLE. Polyclonal Hypergammaglobulinemia One of effects of intraperit oneal exposure to TMP D is IL-6 production, which promotes plasmacytoma development in BALB/cAnPt mice(6). IL-6 is a pleiotropic cytokine with effects on T cells and the late phase of B cell deve lopment(20). In SLE patients, polyclonal hypergammaglobulinemia may reflect both the over-e xpression of IL-6 r eceptors on B cells (21, 22) and increased IL-6 production(23). In the murine lupus model MRL/lpr, IL-6 is derived from an expanded macrophage subset. IL-6 overproduction by atri al myxomas and in Castlemans disease, also is associated with hypergammaglobulinemia and autoimmunity (20, 24, 25). In TMPD-induced lupus, one of the earliest abnormalities is a stri king increase in total serum IgM at ~ 2 weeks, which is followed by increased IgG1, IgG2a, and IgG2b (26, 27). IgG2a is increased out of proportion to IgG1. Une xpectedly, IL-6 deficiency has relatively little effect on IgM and IgG polyclonal hypergammaglobulinemia, suggesting that other factors may contribute to hypergammaglobulinemia and/or compensate for the lack of IL-6(28). In contrast, a substantial reduction in polyclonal IgG2a following TMPD treatment is seen in IFN -/mice and polyclonal IgG1 is reduced in IL-4 -/mice( 29). This is not surprising in view of the dependence of IgG2a and IgG1 on IFN and IL-4, respectively. Thus, polyclonal

PAGE 18

18 hypergammaglobulinemia induced by TMPD appear s to be at least partially a response to sustained cytokine producti on in response to the oil. Induction of Autoantibodies by TMPD In early studies of arthritis, TMPD was re ported to induce autoanti bodies against type II collag en as well as low levels of rheumatoid factor. Subsequent studies indicated that autoantibodies associated with SLE may be more prominent(18). Strikingly, the autoantibodies induced by TMPD are highly restricted. Lupus autoantibodies commonly seen in TMPD-treated mice include anti-Sm, RNP, dsDNA, chromatin, ri bosomal P, and Su/argonaute 2. Interestingly, although there are differences among strains, the auto antibody response in all strains tested so is limited to combinations of anti-Sm/RNP, Su, ribosomal P, and/or DNA/chromatin. Other specificities are unusual. Intrap eritoneal injection of TMPD (in contrast to the induction of plasmacytomas, only a single dose is necessary ) induces an autoantibody response against the RNP/Sm and Su autoantigens in 60-90% of BALB/c mice over 4-6 months and against dsDNA at 6-10 months (18, 26). C57BL/6 and SJL mice injected with TMPD frequently develop antiribosomal P autoantibodies, but have a lower rate of anti-RNP/Sm and anti-dsDNA autoantibody induction(30). TMPD-induced lupus autoantibodi es are primarily IgG2a isotype and their high affinity allows for selective immunoprecipitation of target autoantigens from radiolabeled cell extracts(18). The titers of anti-RNP and anti-Sm are as high as 1:106 or more(31). Incomplete Freunds adjuvant and squalene induce a similar spectrum of auto antibodies, but less efficiently than TMPD(32). In contrast, medicinal mineral oil does not induce any of these autoantibodies(33). The ability to induce autoan tibodies is independent of exogenous infectious agents, as germ-free mice produce the same spectrum of autoantibodies(34). Autoantibodies against the U1, U2, U4-6, and U5 small nuclear ribonucleoproteins (snRNPs) are strongly associated with SLE, and anti-Sm antibodies (r ecognizing the Sm core

PAGE 19

19 proteins B/B, D, E, F, and G, components of U1-U6 snRNPs) are used as a diagnostic marker. Anti-nRNP antibodies, which are associated with lupus but less specific than anti-Sm, recognize the U1-A, U1-C, and U1-70K components of U1 snRNPs. AntidsDNA antibodies and autoantibodies against the ribosomal P0, P1, and P2 proteins, like anti-Sm, ar e specific for SLE. The Su autoantigen is identical to the micr o-RNA associated protei n argonaute 2(35). Autoantibodies against this antigen are associated with lupus, but also are seen in other systemic autoimmune disorders(36). T Cell Requirement for Autoantibody Production in TMPD-Treated Mice The production of anti-S m/RNP and other lupus autoantibodies requires T cells. IgG antiSm/RNP autoantibodies do not deve lop in BALB/c nu/nu (nude) mice or T cell receptor deficient (C57BL6 TcR -/-, TcR -/-) mice following TMPD(37). Similarly, nude mice do not develop TMPD-induced arthritis(38), but a lthough the depletion of CD4+ T ce lls reduces the incidence of arthritis, it has no effect on IgM rheumatoid factor(39). For IgG anti-Sm/RNP autoantibodies, CD4+ T cells appear to be required continuously, and not just in the induction phase, since depletion of CD4+ T cells from mice with established anti-Sm/RNP autoantibody production leads to a significant decline in serum anti-Sm/RNP autoantibody levels (J Weinstein, et al., unpublished data). Effects of IL-6, IFN IL-4, and Il-12 on Autoantibody Production Along with IFN/ IL-6, IFN and IL-12 promote autoantibody production in TMP Dtreated mice. IL-6 deficiency abrogates the induction of IgG anti-ssDNA, anti-dsDNA, and antichromatin autoantibodies by TMPD(28). Interestingly, the mild age-dependent increase in antichromatin antibodies that develops in wild type mice also is abolished by IL-6 deficiency. In contrast, induction of anti-nRNP/Sm and anti-Su autoantibodies is unaffected by IL-6 deficiency, although their levels are lower consistent with the effect of IL-6 on plasma cell differentiation.

PAGE 20

20 IFN deficient mice are resistant to the induc tion of IgG anti-chromatin autoantibodies by TMPD, whereas the effect on anti-Sm/RNP and anti -Su is less clear(29). In some, but not all, experiments, the frequency of these autoantibodies is reduced. However, there is little or no effect on the levels of autoantibodies in t hose mice that develop anti-Sm/RNP or anti-Su [(29)and J Weinstein, unpublished data]. Rema rkably, although switchi ng to IgG2a is IFN dependent, anti-Sm/RNP autoantibodies induced in IFN -/mice are primarily IgG2a, indicating the existence of compensatory mechanisms. IFN / signaling, which is essential for antiSm/RNP and anti-Su autoantibodie s (40), also promotes switch ing to IgG2a(41). There is considerable cross-talk between the IFN /, IFN and IL-6 signaling pathways (42). Since IFN / deficient mice do not exhibit increased IL-12 levels following TMPD treatment(40), IL12 and IFN may be downstream of IFN / signaling. This possibility is consistent with the fact that although TMPD treatment profoundly increase s IL-12 production, IL-12 deficiency has little effect on autoantibody production(43). In contrast, IL-12 or IFN deficiency greatly diminishes the severity of renal disease in TMPD-treated mice. In contrast to IL-6 and the interferons, IL-4 deficiency has no effect or perhaps a stim ulatory effect on autoantibody production(29), suggesting that it may play a suppressive role. NKT cells produce IL-4 (44, 45) and also have a suppressive effect on auto antibody production(46). Efficacy of Other Hydrocarbons at Inducing Autoantibodies Other hydrocarbons besides TMPD can induce a sim ilar spectrum of autoantibodies, including hexadecane, squalene, and the adjuva nt mineral oil Bayol F (Freunds incomplete adjuvant) (38, 47, 48). However, they are not as potent as TMPD. In contrast, medicinal mineral oil does not stimulate the production of lupus autoantibodies such as anti-dsDNA, anti-Sm/RNP, anti-Su, or anti-RNP, although an tinuclear antibodies of other (non-disease associated) specificities may develop(33). In general, a hydro carbons ability to promote lupus

PAGE 21

21 relates to its ability to act as an adjuvant (see above) and it s ability to stimulate the release of IFN-I producing cells from the bone marrow. Li ke TMPD, medicinal mineral oil promotes ectopic lymphoid tissue formation in the peritoneum, making it a useful control for TMPD. Autoimmune Disease in TMPD-Treated Mice Besides developing serum autoantibodies closel y resem bling those in SLE patients, TMPD treated mice develop clinical manifestations of lupus, including arthritis, immune complexmediated glomerulonephritis, and pulmonary capill aritis. Inflammation of the serosal surfaces, including those of the he art (pericardium) and lungs (pleura) is present, but it is unclear whether this is autoimmune or due to chemical inflamma tion from infiltration of the oil. SLE patients develop similar manifestations al ong with other disease manifestati ons not seen in TMPD-treated mice, such as cutaneous, hematological, and ne urological manifestations. SLE is a syndrome classified using a set of 11 criteria(49). TMPD -treated mice would fulfill the criteria used to classify SLE in humans. In humans, the dis ease is primarily a diseas e of women (female to male ratio ~ 9:1). The same is true in murine lupus i nduced by TMPD(50). Immune Complex-Mediated Glomerulonephritis TMPD injec tion leads to immune complexmediated glomerulonephritis manifested by glomerular IgG and complement associated with cellular proliferation and proteinuria in BALB/c and SJL mice, whereas C57BL/6 mice develop glomerular immune deposits either without proliferative changes/proteinuria or with milder glomerular changes (W HO Class II lesions) (26, 31, 51). Immune-mediated renal injury can be the re sult of antibody deposition with complement activation or the local release of proinflammato ry cytokines from infiltrating or resident cells(52). Local activation of the membrane attack complex (C5b-9) causes non-inflammatory renal lesions distinct from the inflammatory lesions of lupus nephritis(52). In contrast, the

PAGE 22

22 interaction of the immune complexes with Fc RI (CD64) or Fc RIII (CD16) on phagocytic cells results in the production of produc tion of proinflammatory cytokines(53). Significantly, renal disease is abolished in (NZB X NZW)F1 (NZB/W) mice deficient in the common chain shared by Fc RI and Fc RIII, although they still develop glom erular immune complexes(54). TMPD-treated BALB/c and SJL mice develop mesangial immune complex deposits early in the disease course, but la ter develop subendothe lial lesions consistent with diffuse proliferative lupus nephritis(26). Epithelial cres cents, a manifestation that may be related to IFN production, sometimes develop(55). Prominent mesangial expansion is frequent (26, 30). IL-6 stimulates mesangial cell proliferation (56, 57) and IL-6 deficient mice are highly resistant to the induction of renal disease by TMPD(28). Thus IL-6 may play a direct or indirect role in the pathogenesis of the immune complex-mediated glomerulonephritis. The proteinuria (often 3+) and histopathological changes induced by TMPD in wild type BALB/c mice also are nearly abolished by IFN deficiency. There is a reduction in glomerular immune complex deposition (especially IgG2a and complement) in IFN -/mice(28). In contrast, IL-4 deficiency has little effect on renal disease in TMPD-treated mice. Not surprisingly, IL-12 p35 -/mice also develop only mild renal disease(43). Mice deficient in the type I interferon receptor (IFNAR -/-) have greatly decreased proteinuria following TMPD treatment, although glomerular immune complex deposition is unchanged(40). Interestingly, the numbers of infiltra ting cells are similar to those in untreated wild type controls suggesting that the absence of IFNAR signaling diminishes the recruitment of phagocytic cells, such as monocytes into the renal glomerul i. These infiltrating monocytes are thought to play a ma jor role in the pathogenesis of lupus nephritis(58). As several key chemokines involved in monocyte recruitmen t, notably CCL2 (MCP-1), are the products of IFN /-inducible (e.g. CCL2/MCP-1) and/or IFN -inducible (e.g. IP-10) genes, it is plausible

PAGE 23

23 that decreased production of in terferon-inducible chemokines by in trinsic glomerular cells in response to immune complexes is partly responsible for the greatly diminished severity of renal disease in IFNAR-/or IFN -/mice. Relevance of TMPD-Induced Lupus to SLE The TMPD model has b een criti cized by some as being not re levant to lupus, whereas the NZB/W model is widely accepted as relevant. However, this view may be overly simplistic. Animal models are useful if they reproduce all or some of the clinical features of a disease. Unfortunately, SLE is not a disease but a syndrome defined clinically as a constellation of 4 or more of 11 classification cr iteria(49). NZB/W mice meet three of these criteria: glomerulonephritis, antinuclear antibodies (ANA), and anti-dsDNA antibodies. NZB mice develop autoimmune hemolytic anemia but this is not a major feature in (N ZB X NZW) F1 mice. In contrast, TMPD treated BALB/c mice have less severe glomerulonephritis, with 3-4+ proteinuria and diffuse proliferative changes(26) late onset arthritis( 17), a positive ANA, and a more diverse spectrum of lupus associated autoantibodies, including anti-dsDNA and antiSm(19). Thus, in terms of the lupus criteria (49), the TMPD-induced model is as good as or better than the NZB/W model. There is eviden ce that both models are associated with abnormalities of IFN / production, a cytokine abnormality thought to contribute to SLE As SLE has a strong genetic component, th e fact that NZB/W mice have genetically mediated disease is an advantag e. In contrast, TMPD induces lupus in BALB/c and other mice that are not genetically prone to the disease. Thus, TMPD-lupus is not a good model for spontaneous (genetic) lupus in humans. However, if one supposes that IFN-I over-production is one of the key contributing factors to lupus, as suggested by the induction of lupus by IFN therapy in humans (59-61) or its exacerbation by IFN in mice(62), the complexity of lupus

PAGE 24

24 genetics takes on a new perspective. Complex signaling pathways regulate IFN production (see below), raising the possibility that multiple genetic defects could pr omote IFN production and the induction of SLE. TMPD lupus has the advant age that the role of these pathways can be examined by gene targeting and gene expression techniques. TMPD induced lupus appears to be a good model for lupus associated with high IFN production that may be more amenable than NZB/W for defining the critical pathways involved in disease pa thogenesis. Once the relevant pathways are identified, studies of patients a nd mice with genetic forms of lupus may define which of the multiple genes in these pathways contribute to disease. Neither the NZB/W nor the TMPD model completely reproduces human SLE, but both are relevant in the sense that they exhibit important similarities to SLE. Although the TMPD mode l is not appropriate for studying the lupus genetics, it is well suited for examini ng the role of chronic inflammation and defining pathways leading to lupus Abnormal Production of IFN-I TMPD-Induced Lupus Initial evidence for excess IFN-I production in TMPD-treated mi ce arose in the analysis of ectopic lymphoid tissue. In a ddition to the expression of ch emokines relevant to lymphoid neogenesis, ectopic lymphoid tissue induced by TM PD displays increased expression of many ISGs including Mx-1, IRF7, ISG15, and IP-10(63). This pattern was not observed in ectopic lymphoid tissue from mice treated with medici nal mineral oil, whic h does not induce lupus autoantibodies or glomerulonephritis. Subsequently this IFN signature was identified in the peripheral blood of TMPD-treated mice(40). Upregulation of ISGs was specifically induced by IFN-I as deficiency of the IFNAR fully abroga ted the IFN signature. Although IFN-I has been implicated in spontaneous murine lupus (62, 64, 65), the TMPD model is the first shown to recapitulate the IFN signature, which is found in more than half of SLE patients.

PAGE 25

25 IFN-I has a profound effect on the pathogenesis of TMPD-indu ced lupus. In the absence of IFN-I signaling (IFNAR -/mice), the de velopment of autoanti bodies against dsDNA, chromatin, ssDNA, chromatin, RNP/Sm, and Su is abolished(40). The lack of autoantibodies was accompanied by a marked reduction in the severi ty of glomerulonephritis and proteinuria. Similar findings were reported recently in mice deficient in IRF9 or STAT1, two key signaling molecules downstream of IFNAR(66). This st udy further found that IgG antibodies against ribosomal P and histones were dependent on inta ct IFN-I signaling. Curiously, TMPD-treated IFNAR-/mice still develop low titer ANA of unknown specificity(40). These IFN-Iindependent ANA may be analogous to the ANA in a subset of healthy humans who have neither IFN-I dysregulation nor manifestati ons of lupus(67). It is also interesting that IFNAR-/mice develop glomerular immune comp lex deposits despite the absence of nephritis. Perhaps the recruitment of inflammatory monocyte/macr ophages mediated by IFN-I-inducible chemokines (e.g. MCP-1) is an essential step in the development of lupus nephritis(68). Although lipogranulomas and autoantibodies develop 3-4 months after TMPD injection, IFN-I is an early event. IFN-I and ISGs are up-regulated in peritoneal exudate cells (PECs) within two weeks of TMPD treatment(69). At this time, circulating B and T lymphocytes (in C57BL/6 and 129/Sv strains) also display incr eased surface expression of the ISG stem cell antigen-1 (Sca-1), consistent with a systemic increase in IFN-I( 70). In contrast, these early markers of IFN-I dysregulation are not observed in mice treated with mineral oil or squalene Immature Monocytes are a Major Source of IFN-I in TMPD-Lupus Analysis of the early inflammatory response to T MPD also shed light on the source of IFN-I. Plasmacytoid dendritic cells (PDCs) are thought to be the primary source of IFN-I in human lupus due to their ability to secrete the cy tokine in response to vi ral infection and nucleic acid-containing immune complexes (71-73). However, the role of these potent IFN-I producing

PAGE 26

26 cells may be limited in the TMPD model as deple tion of dendritic cells ha s no appreciable effect on the expression of IFN-I or IS Gs(69). Instead, inflammatory monocytes with intense surface expression of Ly6C are a major source of IFN-I Normally absent in the peritoneal cavity, Ly6hi monocytes are attracted to the peritoneum by the chemokine MCP-1 (CCL2), and comprise about 30% of PECs two weeks after TMPD inje ction. Their depletion by clodronate-containing liposomes rapidly eliminates th e IFN signature(69). These cells also persist in the ectopic lymphoid tissue induced by TMPD. Ly6Chi monocytes do not accumulate in mice treated with mineral oil or squalene. In cont rast to TMPD-treatment, mineral oil treatment leads to an influx of Ly6Chi monocytes into the perito neal cavity followed by their rapid maturation into Ly6C-, F4/80+ monocyte/macrophages with more abundant cytoplasm and prominent phagosomes(69). These more mature monocytes are nearly absent in TMPD-treated mice. Mineral oil-treated animals display neither the IFN signature no r significant autoanti body production. It is noteworthy that other populations of peritoneal cells express lo wer levels of IFN-I, including within the peritoneal cavity (e .g. mesothelial cells) is sufficient to induce the manifestations of lupus remains to be determined. Mechanism of IFN-I Production in TMPD Lupus The m echanism(s) of IFN-I over-production in SLE is a topic of ongoing research. Mammalian cells utilize several innate receptors to initiate IFN-I production in response to pathogen-associated molecular patterns (PAMPs ) found in different cellular compartments (74, 75) Toll-like receptors (TLR)7 and -8, wh ich recognize viral ssRNA, and TLR9, the innate sensor for unmethylated CpG DNA, have received considerable at tention due to their ability to recognize endogenous nucleic acids(76-78). These endosomal TLRs trigger IFN-I secretion via the adaptor myeloid differentiation factor-88 (MyD88)(79, 80). In contrast, TLR3 and TLR4 mediate IFN-I production through TIR do main-containing adaptor inducing IFN (TRIF) upon

PAGE 27

27 encountering dsRNA or lipopolysaccha ride, respectively(81). In th e cytoplasm, viral RNA binds to the RIG-like helicases (RLH) retinoic ac id inducible gene-I (RIG-I) or melanoma differentiation associated gene-5 (MDA-5) to trigger IFN-I activation via IFN promoter stimulator-1 (IPS-1)(82-84), whereas cytopl asmic DNA activates a TANK-binding kinase-1 (TBK-1)-dependent pathway(85, 86). Using mice deficient in components of these four major pathways of IFN-I production, it can be shown that TMPD elicits IFN-I producti on and ISG upregulation exclusively through the TLR7-MyD88 pathway(70). The accumulation of Ly6Chi monocytes and pr oduction of antinRNP/Sm and anti-Su autoantibodies are abolishe d in the absence of MyD88 or TLR7. Similar to their IFNAR-/counterparts, TLR7-/mice are protected from the development of glomerulonephritis(87). Ly6Chi monocytes recruited to the perit oneal cavity express high levels of TLR7, consistent with their role as major IFN-I producing ce lls. The effects of TMPD are augmented further by TLR7 gene duplication in Y-linked autoimmune accelerated (Yaa) mutant mice(70). Conversely, other TLRs and cytoplasmi c nucleic acid sensors are dispensable for IFN-I production in this model, as deficiency of TRIF, IPS-1, or TBK-1 has no effect on the induction of lupus by TMPD. It has been hypothesized that aberrant clearance of apoptotic or necrotic cells in SLE results in the formation if immune complexes consisting of autoantibodi es and RNAor DNAcontaining autoantigens(88, 89). In vitro, Fc receptors (Fc R) on PDCs mediate the transport of DNAor RNA-containing immune complexes in to endosomes, allowing the activation of TLR7/8 or TLR9 by the internalized endogenous nuc leic acids(90, 91). This hypothesis implies that generation of lupus autoantibodies is a prer equisite to chronic IF N-I production. In TMPDlupus, however, the production of IF N-I occurs within 1-2 weeks, long before the appearance of

PAGE 28

28 anti-dsDNA or anti-nRNP/Sm autoantibodies. Moreover, intact pr oduction of IFN-I and autoantibodies in Fc R-deficient animals excludes a major role of immune complexes in the initial generation of interferon responses(70, 92) Together with the absence of autoantibody production in IFNAR-/mice, these data indicate an ups tream effect of IFN-I on autoantibody production. This view is supported by the develo pment of autoantibodies in patients following therapeutic administrati on of recombinant IFN (61). The dependence of lupus autoantibodies on intact IFN-I signaling also has been s hown in other lupus models(64, 65). The exact mechanism of TMPD-induced TLR 7 activation remains to be defined. The chemical structure of TMPD is di stinct from known TLR7 ligands and i n vitro studies suggest that TMPD is not a TLR7 ligand(70). Instea d, pretreatment with TMPD enhances the stimulatory effects of TLR7 liga nds such as R848. This property is not observed with mineral oil or squalene, consistent with the inability of thes e hydrocarbons to induce IFN-I in vivo It is possible that TMPD augments the response to endogenous TLR7 ligands such as the U1 RNA component of the Sm/RNP antigen, although how th ese ligands gain access to endosomes in the absence of immune complexes is un clear. Alternatively, the incor poration of TMPD into the cell membrane may disturb the endosomal location of TLR7 and provide access to endogenous ligands(93). TMPD also might interfere with the normal degradation of cellular debris, increasing the availability of endogenous nucleic acids. Thus far these hypotheses are not supported by in vitro data, as neither TLR7 localization no r cellular endocytosis/phagocytosis is affected by TMPD treatment(70). Moreover, TMPD treatment does not seem to up-regulate TLR7, as its expression (protein and mRNA) is unaff ected. Interestingly, the ability of TMPD to promote autoantibody production is dependent on intact Fas-Fas ligand signaling(94). Although C57BL/6 (B6) mice are susceptibl e to TMPD-induced lupus, both B6lpr/lpr and B6gld/gld

PAGE 29

29 mice are highly resistant. Although the mechanism of the protective effect remains uncertain, it is possible that Fas-mediated apoptosis is involved in the generation of endogenous TLR7 ligands responsible for the chronic IFN-I produc tion characteristic of TMPD-lupus. Further studies are needed to better define both the mechanism of TLR7 activation and the role of FasFas ligand interactions in this model. In summary, TMPD-induced lupus uniquely reca pitulates the interferon signature seen in more than half of lupus patients. IFN-I is essential to disease deve lopment and is elicited through a TLR7 and MyD88-dependent, but Fc R-independent pathway. These recent advances in understanding the etiology of lupus in TMPD-t reated mice place this inducible lupus model in a new light. Although not suitable for genetic st udies of SLE, the inducible nature of TMPDinduced lupus offers an advantage over the gene tic models as it allows temporal assessment of upstream and downstream effects of IFN-I dysre gulation. In addition to the potential for yielding valuable new insights in to the pathogenesis of SLE, this model is well adapted to examining the efficacy of therapies targeting components of the TLR7/My D88/IFN-I pathway. Lymphoid Neogenesis In TMPD Treated Mice Association of Lymphoid Neogenesis with Autoimmunity. Lym phoid neogenesis, defined as the forma tion of ectopic lymphoid tissue at sites of inflammation(95), is strongly a ssociated with autoantibody produc tion(96). Ectopic lymphoid tissue bears a close resemblance to lymph nodes and other secondary lymphoid tissue and arises by a similar developmental pathway(97). A frequent characteristic of ectopic lymphoid tissue is the compartmentalization of B lymphocytes and T lymphocytes/dendritic cells into discrete Bcell and T-cell areas comparable to those in secondary lymphoid tissue. The T cell areas are vascularized by specialized high endothelial venu les (HEV) allowing cells to migrate into the tissue(98). HEV also express chemokines, enzyme s, and scaffolding proteins essential for the

PAGE 30

30 function of lymphoid tissue (87, 96, 98-100). In particular, the lymphoid chemokines CCchemokine ligand 19 (CCL19, ELC), CCL21 (SLC), CXC-chemokine ligand 12 (CXCL12, CXCL12), and CXCL13 (BLC) play an im portant role in lymphocyte homing and compartmentalization in lymphoid tissue(101-104 ). It is not fully understood how ectopic lymphoid tissue is derived. One hypothesis is that during chronic inflammation there is constitutive chemokine/cytokine expression that promotes the formation of lymphoid tissue, sometimes exhibiting well-formed B cell fo llicles and germinal centers(105). Ectopic lymphoid tissue forms when the immune response fa ils to eliminate certain pathogens, such as hepatitis C (106) or Helicobacter pylori(107). It also is common in autoimmune diseases such as autoimmune (Has himotos) thyroiditis (a utoantibodies against thyroid peroxidase and thyroglobulin), Sjogrens syndrome (anti-Ro/La autoantibodies), and RA (autoantibodies against citrullinated prot eins and rheumatoid factor)(108-111). An important issue is whether ectopic lymphoi d tissue is a site of class switching, somatic hypermutation, and/or the generatio n of autoantibody secreting plasma cells. Lymphocytic foci in rheumatoid synovium contain restricted -light chain rearrangements and there is evidence of extensive somatic hypermutation(110, 112). Ectopic lymphoid tissue could represent a milieu deficient in the censoring mechanisms that remove self-reactive B cells arising during the germinal center reaction(113). B cel ls specific for Ro/La antigens ca n be detected in the salivary glands of patients with Sjogrens syndrome, rheu matoid factor specific B cells in rheumatoid synovium(111, 114), and anti-nRNP specific B cells in ectopic lymphoid tissue in TMPD lupus. IFN-I produced in ectopic lymphoid tissue (40) may play a role in autoantibody production, since IFN / and IL-6 act sequentially to ge nerate plasma cells, with IFN / generating non-Igsecreting plasma blasts and IL-6 promoting their differentiation into Ig-secreting plasma

PAGE 31

31 cells(115). Although it was previously assumed that autoantibody production is maintained by the continuous activation of autoreactive T a nd B cells and generation of short-lived plasma cells, it is now apparent that a subset of plasma cells can survive in the bone marrow for years(116). These long-lived plasma cells maintain antibody levels after immunization and depend on survival factors produced by bone marr ow stromal cells, including IL-6, IL-5, TNF BAFF, CXCL12 (SDF-1), and CD44 ligands( 116). Importantly, many (40%) of the autoantibody secreting plasma cells in NZB/W lupus mice are long-lived(117). Pristane Induces Ectopic Lymphoid Tissue Ectopic lymphoid tissue for ms in the peritoneum of mice tr eated with TMPD and this chronic inflammatory tissue is a site of subs tantial IFN-I production (40) The chronic inflammatory response to TMPD was original ly described as lipogranuloma formation(118, 119). However, lipogranulomas are not true granul omas, but rather are more akin to secondary lymphoid tissue morphologically, since they contai n Band T-cell/dendritic cell zones as well as blood vessels expressing periphe ral lymph node addressin (PNAd ), a high endothelial venule marker (31). Expression of the lymphoid chemokines CXCL13 (BLC), CCL19 (ELC), and CCL21 (SLC) is found within th e lipogranulomas (31). Antigen Specific B Cell Responses in TMPD-Induced Ectopic Lymphoid Tissue Although associated with hum oral autoimmunity, it is not known whether antibody responses develop within ectopic lymphoid tissue or if B cells onl y secondarily migrate there. The formation of lipogranulomas affords an oppor tunity to explore this question. Following primary immunization with NP-KLH, NP-specifi c B cells bearing V186.2 and related heavy chains as well as -light chains accumulate within the lipogranulomas(120). The number of antiNP secreting B cells in the lipogranuloma is greatly enhanced by imm unization with NP-KLH. In contrast to the relatively diverse heavy chain sequences found in individual lipogranulomas

PAGE 32

32 from unimmunized mice, immunoglobulin h eavy-chain sequences from individual lipogranulomas isolated 12 days after primary i mmunization are derived fr om unique oligoor monoclonal populations of NP-sp ecific B cells. Heavy-chain complementarity determining region sequences recovered from lipogranulom as have numerous replacement mutations, suggesting that they are a site of ongoing antigen-driven and T cel l-mediated immune responses. Consistent with that possibili ty, lipogranulomas from TMPD-tre ated mice adoptively transferred with OT-II or DO11.10 (ovalbumin-specific) transg enic T cells accumulate transgenic T cells after subcutaneous immunization with OVA. Th e selective co-localizat ion of proliferating, antigen-specific T and B lymphocytes in lipogranulomas during primary immunization implicates ectopic lymphoid tissue as a site wh ere antigen-specific cognate T-B cell interaction may occur(120). Germinal centers are the morphological feat ure most closely asso ciated with T cell dependent expansion of antigen-specific B cells(121). The germinal center reaction regulates antigen-specific clonal evolution during the development of the humoral response. Lipogranulomas display many characteristics of germ inal center reactions such as proliferating T and B lymphocytes, activation-induced cytidine deaminase (AID) expression, and the presence of class switched B cells(37). Circular DNA intermediates, a hallmark of active class switch recombination, are found in the lipogranulomas, sugge sting that class switching occurs locally. After immunization with exogenous antigen, T ce lls from the lipogranulomas secrete IL-21, which has been shown to play a role in plas ma cell differentiation a nd class switching(122). Analysis of immunoglobulin heavy and light chain gene sequences from different lipogranulomas of the same mouse revealed that after primary immunizat ion with an exogenous test antigen (NP-KLH or NP-OVA), each lipogr anuloma contains a unique and, in general

PAGE 33

33 oligoclonal or monoclonal, B cell repertoire, co nsistent with local cl onal expansion(120). Moreover, antigen-specific DO11.10 transgenic T cells accumulate in the lipogranulomas after NP-OVA immunization(120), sugges ting that the ectopic lymphoid tissue is a site of cognate T cell-B cell interactions. Anti-RNP Autoantibody Production in Ectopic Lymphoid Tissue The striking association betw een ectopic lym phoid tissue formation, autoimmunity, and B cell neoplasia in Sjogrens syndrome, RA, hepatit is C and H. pylori infection (96) raises the question of what role the li pogranulomas play in TMPD-indu ced lupus. Both IgM and IgG antibody forming cells (AFCs) producing autoan tibodies to recombinant U1-A protein, a component of U1 snRNPs, are found at a higher frequency in the ectopic lymphoid tissue of TMPD-treated mice than in the spleen(37). The presence of IgM anti-U1-A AFCs in the ectopic lymphoid tissue suggests that, consistent with the data in the immunization model(120), lipogranulomas may be a site where autoan tibody producing B cells become activated. Moreover, the prominence of IgG anti-U1-A secr eting cells and the absence of anti-Sm/RNP responses in TMPD-treated BALB/c nu/nu (nude ) mice (123) or T cell receptor deficient (C57BL6 TcR -/-, TcR -/-) mice (37) raises the possibili ty that post-germinal center B cells (memory B cells) specific for U1-A might be st imulated to undergo plasma cell differentiation within the lipogranulomas, either by autoantigen specific T cells or independently of T cells through the engagement of Toll-like receptors (123). Indeed, the Sm/RNP antigens are associated with U1, U2, U4-U6, and/or U5 sm all RNAs which are endogenous TLR 7 ligands (43), suggesting that the autoan tibody production might be driv en by TLR7 signaling. However, stimulation of TLR7 by endogenous TLR7 ligands in TMPD-induced ectopic lymphoid tissue appears to be insufficient to stimulate IgM or IgG anti-Sm/RNP au toantibody production T cell receptor deficient mice. Another possibility is that the IgG antiU1-A AFCs represent long-lived

PAGE 34

34 plasma cells, which accumulate at sites of chr onic inflammation, such as the nephritic kidneys and spleens of NZB/W mice (25, 26). However, the relative paucity of CD138+ cells in the lipogranulomas vs. spleen of TMPD-treated mice (37)and the fact that the number of anti-U1-A AFCs can be suppressed by administering cytotoxi c anti-CD4 antibodies to TMPD-treated mice (J Weinstein, et al., unpublished data) may argue in favor of a model involving the activation of anti-U1-A memory B cells. Lupus induced by hydrocarbons such as TMPD is a valuable m odel of human SLE associated with the over-expression of IFN-I. The pathogenesis of lupus autoantibodies (antiDNA, anti-Sm/RNP, and others) and glomerulonephrit is in this model is strictly dependent on signaling through the IFNAR. Most of the inte rferon is produced by immature monocytes instead of PDCs, and its production is mediated exclusively by the TLR7-MyD88 pathway. It is likely that endogenous TLR7 ligands such as U1 RNA are involved, as germ-free mice remain susceptible to disease induction. However, immune complex uptake via Fc receptors is dispensable. Autoantibody production is concen trated in ectopic lym phoid tissue found in the peritoneum following TMPD treatment. In many respects, this chronic inflammatory tissue mimics secondary lymphoid tissue, and most data so far suggest that cognate T-B interactions take place within the ectopic lym phoid tissue. However, the precise nature of the inciting TLR ligand(s), how they are generated, and the mechan isms responsible for th e escape of autoreactive B cells from censoring mechanisms remain areas of active investigation. In light of the strong association between lymphoid neogenesis a nd humoral autoimmunity, elucidating the mechanisms of lupus induction in TMPD treated mice may have broader implications for the pathogenesis of other autoimmune disorders, including RA, Sjogrens syndrome, myasthenia gravis, and chronic hepatitis C-induced autoimm une syndromes, such as mixed cryoglobulinemia

PAGE 35

35 CHAPTER 21 CO-LOCALIZATION OF ANTIGEN-SPECIFI C B AND T CELLS W ITHIN ECTOPIC LYMPHOID TISSUE FOLLOWING IMMUNIZA TION WITH EXOGENOUS ANTIGEN Introduction Lym phoid neogenesis, the formation of ectopic (tertiary) lymphoid tis sue in response to inflammation (95, 105), is associat ed with the production of auto antibodies in several diseases including Sjogrens syndrome, rheumatoid arthritis, and myasthenia gravis (96). Whether ectopic lymphoid tissue participates directly in generating autore active B cells (e.g. by allowing the autoreactive cells to escape self-tolerance) or indirectly as a site where mature antibodysecreting cells can persist(124) is unknown. Intraperitoneal inj ection of non-autoimmune-prone mice such as BALB/c with the hydrocarbon oil 2, 6, 10, 14-tetramethylpentadecane (TMPD) triggers the formation of ect opic lymphoid tissue (lipogranulom as) and the development of lupus-like autoimmune disease with autoanti bodies against small nuc lear ribonucleoproteins (snRNPs) and dsDNA, immune complex-mediated glomerulonephritis, arthritis, and vasculitis(18, 26, 63). Within the ectopic lymphoid tissue induced by TMPD are CD11c+ dendritic cells (DCs) expressing the co-stimulat ory molecule CD86. Expression of the lymphoid chemokines CXCL13 (BLC), CCL19 (ELC), and CCL 21 (SLC) is likely to play a role in the accumulation of B cells, T cells, and DCs in TM PD-induced tertiary lymphoid tissue (125). Although individual TMPD-i nduced lipogranulomas bear some resemblance histologically to germinal centers, there are differences, including the ab sence of peanut agglutinin+ B cells and FDC-M1+ follicular dendritic ce lls(126). Nevertheless, proliferating (Ki-67+) lymphocytes can be demonstrated in these structures Moreover, the B cells bear somatically mutated and isotype1 Reprinted with permission from The Association of American Immunologists, Inc. Copyright 2008 Weinstein JS et. al.. Colocalization of Antigen-Specific B and T Cells Within Ectopic Lymphoid Tissue Following Immunization With Exogenous Antigen. J Immunol. 2008 Sep 1;181(5):3259-67.

PAGE 36

36 switched immunoglobulin heavy chains, suggesti ng that lipogranulomas may support antigenspecific immune responses and may be a loca tion where tolerance to autoantigens can be overcome. The germinal center reaction regulates an tigen-specific clonal evolution during the development of B cell memory (126). B cells in newly formed germinal centers may be oligoclonal (127), whereas those in TMPD-induced lipogranulomas are usually more diverse (D. Nacionales, et al., Submitted). The existe nce in TMPD-treated mice of occasional lipogranulomas containing oligoclonal B cells is currently unexplained. Previous studies have shown that following immunization with NP-K LH, two anatomically and phenotypically distinct populati ons of antibody-forming cells arise in the spleen. As early as 2 days after immunization, primar y foci consisting of antigen-b inding B cells are seen along the periphery of the periarteriolar lymphoid sheath s (128). Initially these foci expand, but by day 14, they disappear, giving rise to a second respondi ng population in the follicle, germinal center B cells, which appear on day 8-10 and persist at least until day 30 postimmunization. The primary foci are sites of interclonal competiti on for antigen among unmutated B cells, whereas germinal centers are sites of in traclonal competition between mu tated sister lymphocytes (128) as well as interclonal competition between pre-ex isting germinal center B cells and follicular visitors that can join the germinal center re action if they have a sufficiently high antigenbinding affinity (129). In the present study, we analyzed antigen-sp ecific B and T cells in TMPD-induced ectopic lymphoid tissue at 12 days after primary subcut aneous immunization with a test antigen, NPKLH. We show that oligoclonal populations of NP-specific B cells develop in TMPD-induced ectopic lymphoid tissue and may displace or ove rgrow more diverse populations of non-NP

PAGE 37

37 specific B cells present prior to immunization. Along with th e hapten-specific B cells, the TMPD-induced lipogranulomas contain carrier-speci fic T cells, strongly s uggesting that ectopic lymphoid tissue can participate di rectly in the generation of an tigen-specific B cell responses. Materials and Methods Mice Six-week-old fem ale C57BL/6, BALBC/J, T cell transgenic C.Cg-Tg(DO11.10)10Dlo/J (DO11.10), and C57BL/6-Tg(TcraTcrb)425Cbn/J (O T-II) mice were purchased from Jackson Laboratory (Bar Harbor, ME) and housed in barrier cages. At 2 months of age, C57BL/6 and DO11.10 mice received 0.5 ml of 2, 6, 10, 14 tetr amethylpentadecane (TMPD, Sigma-Aldrich, St. Louis, MO) i.p. or left untreated. Three mont hs later, the mice were injected subcutaneously in the lower abdomen with 100 g of 4-hydroxy-3-nitrophenyl acetyl (NP)17-19-conjugated keyhole limpet hemocyanin (KLH) (NP-KL H, Biosearch Technologies, Novato, CA) precipitated in alum (Pierce, Ro ckford, IL). Lipogranulomas, sp leen, and blood were harvested 4 to12 days later. These studies were approve d by the Institutional Animal Care and Use Committee. Anti-4-hydroxy-3-nitrophenyl (NP) IgM and IgG ELISA Pre-imm une sera and sera obt ained at the time of euthanasia were tested for IgM and IgG anti-NP antibodies (ELISA). Microt iter plates were coated with NP19-, NP30-, or NP3conjugated BSA (Biosearch Technologies). Seri ally diluted serum samples were added for 1 hour at room temperature. Anti-NP IgM and IgG antibodies were detected using alkaline phosphatase conjugated goat anti-mouse IgM or IgG antibodies (1:1000 dilution, Southern Biotechnology, Birmingham, AL) followed by phospha tase substrate (Sigma-Aldrich). Optical density was converted to concentration based on st andard curves with sera from C57BL/6 mice

PAGE 38

38 immunized with NP-KLH using a four-parameter logistic equation (Softmax Pro 3.1 software, Molecular Devices Corporation, Sunnyvale, CA). Bromodeoxyuridine (BrdU) Labeling of B and T Cells BrdU was adm inistered to BALB/cJ mice ( 0.2 mg BrdU i.p. every 4 hours for 3 doses) and again one day before euthanasia. Single ce ll suspensions of lipogranuloma or spleen tissue were made by collagenase treatment (95). The isolated cells were incubated with APCconjugated anti-BrdU antibodies plus anti-CD3-FITC and anti-CD19-PE antibodies (BD Biosciences) and analyzed by flow cytometry. Isotype controls were employed to evaluate background fluorescence. Isolated lipogranuloma cells were washed in staining buffer (PBS supplemented with 0.1% NaN3 and 1% bovine serum albumin) and pre-incubated for 20 minutes with 1 g of anti-CD16 (BD Biosciences) a nd 0.5 l rat serum (Sigma Aldrich) at 4 C in 20 l of staining buffer to block Fc binding. Primar y antibodies were then added at pre-titrated amounts and incubated for 20 minutes at 4 C, followed by washing in staining buffer. Intracellular BrdU labeling was performed using the APC BrdU flow kit following the manufacturers instructions (BD Biosciences) Data were acquired on a CyAn ADP flow cytometer (Dako, Fort Collins, Colorado) and analyzed with FCS Express Version 3 (DeNovo Software, Thornhill, Ontario, Canada). At le ast 50,000 events per sample were acquired and analyzed using size gating to exclude dead cells. Kappa/Lambda Light Chain Staining Lipogranulom as and spleen were fixed a nd embedded as previously described(63). Sections (4 m) were stained with horse radish pe roxidase (HRP)-conjugated goat anti-mouse or light chain antibodies (Southern Biotechnology), developed with DAB (Vector Laboratories, Burlingame, CA), a nd viewed under a light microscope.

PAGE 39

39 Anti-4-Hydroxy-3-Nitrophenyl (NP) ELISPOT Assay Lipogranulom as and spleen (104 cells/well) from NP-KLH/T MPD treated mice were collagenase treated as described (63) and single cell suspensions were plated on Multiscreen HTS plates (Millipore, Billerica, MA) coated with NP19-BSA. Lipogranuloma and spleen cells from non-immunized TMPD treated mice were used as the negative control. The cells were incubated overnight before adding alkaline phosphatase-c onjugated goat anti-mouse IgM antibodies. Spots were devel oped with BCIP/NBT (Pierce) a nd incubated overnight before counting using a dissecting microscope. Variable Heavy Chain Gene Sequences Lipogranulomas and spleen were harveste d at day 12 and mRNA was isolated using TRIzol reagent (Invitrogen Life Technologies, Ca rlsbad, California). Th e pellets were washed with cold 75% (v/v) ethanol and resuspended in diethyl pyrocarbonate (DEPC)-treated water. One g of RNA was treated with DNase I (Invitr ogen) to remove genomic DNA and reverse transcribed to cDNA using Superscript First-Stra nd Synthesis System for RT-PCR (Invitrogen). PCR amplification of immunoglobulin H-chain cDNA was performed using a mixture of 8 forward primers (VHF1-8) and a consensus reverse primer (VHR2) as described (130) (D Nacionales, et al. Submitted). The PCR products were cloned into a TOPO vector (pCR4, Invitrogen) and the VDJ heavy chain sequences were determined by dideoxy sequencing and analyzed using the MacVector V 7.2.3 program (Accelrys Inc., San Diego CA). Transfer of Antigen-Specific T Cells 5 x 106 CD4+ T cells from OT-II or DO11.10 mice were transferred i.v. to C57BL/6J or BALB/cJ TMPD-treated recipients. Three days after T cell transfer, th e mice were immunized s.c. with 200 g NP17-OVA precipitated in alum. Seven da ys after immunization single cell suspensions of the draining lymph nodes, splee n, and lipogranulomas were prepared as above.

PAGE 40

40 Lipogranuloma cell suspensions from C57BL/6J r ecipients of OT-II T cells were analyzed by FACS using anti-CD3-FITC, anti-CD4-APC, anti-V 2-PE, and anti-V 5-Biotin-Av/Pac Blue antibodies (BD Biosciences). BALB/cJ recipients of DO11.10 T cells were analyzed using antiDO11.10 (KJI-26)-APC antibodies (Invitrogen, Caltag Labo ratories, Carlsbad, CA). T Cell Proliferation Assay Three months after TMPD or saline trea tment, DO11.10 mice were immunized with 50 g of specific peptide corresponding to amino acids 323-339 of ovalbumin (Ova323-339; Genscript Corporation, Piscataway, NJ) in alum. Five days later, CD4+ T cells were sorted using MACS anti-CD4 beads (Miltenyi Biotec, Auburn, CA ) 2.5 X 104 CD4+ T cells were cultured with irradiated (3000 R), CD4depleted APCs (2.5 X 105 cells/well) in quadruplicate. 2.5 g/ml of soluble anti-CD3 or 10 g/ml of OVA323-339 was added for 48-72 hours in a total volume of 200 l of complete RPMI medium. One Ci [3H]-thymidine (Amersham Biosciences, Piscataway, NJ) was added for the final 16 h of culture a nd proliferation was determined using a liquid scintillation counter. Polymerase Chain Reaction An alysis of T Cell Cytokines Lipogranulom as and spleen were harvested 10 days after immunization with NP-KLH followed by isolation of mRNA and cDNA synthesi s as described above. PCR amplification of -actin, IL-4, IFN and IL-21 was performed using the following primers: -actin forward: (TGGAATCCTGTGGCATCCATGAAAC); -actin reverse (TAAAACGCAGCTCAGTAACAGTCCG); (IL-4 forward: (CGAAGAACACCACAGA GAGTGAGCT); IL-4 reverse: (GACTCATTCATGGTGCAGCTTATCG); IFN forward: (AGCGGCTGACTGAACTCAGATTGTAG); IFN reverse:

PAGE 41

41 (GTCACAGTTTTCAGCTGTATAGGG); IL-21 forward: (ATGGAGAGGACCCTTGTCTG); IL-21 reverse: (GCTTGAGTTTGGCCTTCTGA). One l of cDNA was added to a mixture containing 1X PCR buffer, 2.5 mM MgCl2, 400 M dNTPs, 0.025 U of Taq DNA polymerase (Invitrogen), 1 M each of forward and reverse primers, and DEPC-water in a 20 l volume. Amplification was carried out for 5 min at 94 C, followed by 35 cycles of denaturation at 94 C for 2 min, annealing at 55 C for 30 sec, extension at 72C for 45 sec and a final extension of 72C for 10 min in a PTC-100 Programmable Therma l Controller (MJ Research, Inc., Waltham, MA). PCR products were visu alized on 1% agarose gel. Results Antigen-Specific B Cell Response s in Ectopic Lymphoid Tissue Intraperitoneal in jection of TMPD lead s to the for mation of ectopic lymphoid tissue containing B and T lymphocytes as well as activated DCs (40). We asked whether lipogranulomas are a site where specific T cel l-dependent antibody responses develop. TMPDtreated B6 mice were immunized s.c. with NP -KLH, which induces a highly restricted antibody response dominated by B cells bearing V186.2 H-chains and 1 light chain specific for the NP hapten (127, 131). Compared with controls, NP-KLH immunized mice displayed significantly higher levels of serum anti-NP IgM and IgG 12 days post-immunization (Fig. 2-1A-B). Both TMPD-treated and untreated mice developed a typical IgG1-dominat ed response following immunization with NP-KLH in alum (Fig. 2-1C). NP-specific IgG1, IgG2a, and total IgG levels were unaffected by TMPD treatment (Fig. 2-1C). To evaluate the affinity of the antibody responses, reactivity with NP30-BSA and NP3BSA was determined by ELISA. Interestingly, although the total serum levels of antibodies reactive with NP30-BSA in mice pretreated with TMPD were similar to those in untreated mice,

PAGE 42

42 reactivity of sera from the TMPD-pre-treated mice with NP3-BSA was significantly less than the reactivity of sera from untreated mice (Fig. 2-1D). Thus, the affinity of the anti-NP antibodies induced by immunization with NP-KLH was lo wer in mice with TMPD-induced ectopic lymphoid tissue than in controls. Because one of the characteri stics of secondary lymphoid tis sue is the proliferation of antigen-specific B and T lymphocytes, it was of inte rest to examine T and B cell proliferation in the ectopic lymphoid tissue indu ced by TMPD. Mice were fed Br dU in the drinking water and immunized with NP-KLH. Following immunizati on, there was a progressive increase in the number of B220+ cells and CD3+ cells labeled w ith anti-BrdU antibodies both in the spleen and in the lipogranulomas, which was apparent as ea rly as day 4-8 after immunization and peaked around day 10 (Fig. 2-1E). These data indicate that primary immunization with an exogenous antigen stimulated lymphocyte proliferation within ectopic lymphoid tissue and that the magnitude of this proliferative response was co mparable to that in a secondary lymphoid organ, the spleen. Ovalbumin-Specific T Cells Localize a nd Ex pand in Ectopic Lymphoid Tissue To further address whether ectopic tissue facilitates the development of de novo immune responses, we analyzed antigen-specific CD4+ T cell responses within the lipogranulomas following immunization. CD4+ ovalbumin ( OVA) 323-339 peptide-specific T cells were transferred from either OT-II or DO11.10 mice into TMPD treated recipients. Either PBS or CD4+ OVA-specific T cells from OT-II mice were injected into TMPD-treated B6 mice, followed by immunization with NP-OVA 3 days later. Seven days after immunization, we identified the OVA transgenic T cells (V 2+V 5+CD4+ cells) (132) in various lymphoid tissues using flow cytometry. There was a significant increase of V 2+V 5+CD4+ T cells in the draining lymph nodes and lipogranulomas from mice in jected with OT-II T cells compared to the

PAGE 43

43 control PBS injection (Fi g. 2-2A). As expected, the DO11.10 antigen-specific T cells also were present at increased frequency in the lipogranulomas of BALB/c mice after immunization (Fig. 2-2B). Transfer of DO11.10 T ce lls to non-immunized mice verified that the increased numbers of antigen-specific T cells in the lipogranulomas we re not merely related to the transfer of CD4+ T cells (Fig. 2-2B). We al so treated DO11.10 mice with TMPD and 3 months later immunized with OVA323-339. Seven days after immunizat ion, the lipogranulomas contained almost exclusively antigen-specific KJI-26+ CD4+ T ce lls, whereas both spleen and draining lymph nodes contained a population of KJI-26CD4+ T cells (Fig. 2-2C). In contrast, lipogranulomas from non-immunized mice contained a population of non-transgenic (KJI-26-) T cells. We further assessed the presence of OVA-specific T cells in the lipogranulomas by isolating CD4+ T cells from TMPD treated DO11.0 mice and stim ulating in vitro with OVA323-339. Antigenspecific CD4+ T cells from lipogranulomas, spl een, and draining lymph nodes all proliferated similarly (Fig. 2-2D). The expansion of antig en-specific CD4+ T cells in the lipogranulomas upon immunization coupled with their ability to proliferate when s timulated in vitro provides the first evidence that ectopic lymphoid tissue is a site of antigen-speci fic T cell activation and proliferation. To further demonstrate that the T cells in the lipogranuloma are activ e participants in an antigen-specific immune response, we looked at the production of T cell inflammatory cytokines in lipogranulomas and spleen af ter immunization with the test an tigen NP-KLH. Compared to the spleen, lipogranulomas from the same mouse expressed higher levels of IFN mRNA but lower levels of IL-4 and IL-21 (Fig. 2-2E). Thus, following immunization, T cells in the lipogranulomas were proliferating (Fig. 2-1E), there was an increa sed number of an tigen-specific

PAGE 44

44 CD4+ cells (Fig. 2B-C), and there was producti on of T cell cytokines, particularly IFN (Fig. 22E), consistent with the pres ence of effector T cells. 4-Hydroxy-3-Nitrophenyl NP-Specific B Cells and Anti-NP Antibody Production in Ectopic Lymphoid Tissue In view of the pr eferential pairing o f 1 L-chains with V186.2 H chains, paraffinembedded tissue was stained for and light chains (Fig. 2-3A). Lipogranulomas from both immunized and non-immunized mice contained large numbers light chain bearing B cells, showing that immunization does not substantially affect the total number of B cells in the lipogranulomas. The lipogranulomas from mice im munized with NP-KLH had discrete areas of strong light chain staining, whereas nonimmunized mice had very weak staining (Fig. 2-3A). Immunized mice had significantly more light chain bearing cells in the lipogranulomas than controls, an expected response to NP-KLH (Fig. 2-3B). To determine whether these B cells secreted anti-NP antibodies, ELISPOT assays we re performed using NP-BSA as antigen. The lipogranuloma cells from NP-KLH immunized, TM PD-treated mice displayed more spots than those from TMPD-treated, non-immunized mice (Fi g. 2-3C). Interestingly the spots from the spleen, although less numerous than those from lipogranulomas, were larger (Fig. 2-3D), suggesting that the antigen-specific cells in th e spleen secreted more immunoglobulin per cell than those from lipogranulomas and/or th at the antibody affinity was lower in the lipogranulomas, as suggeste d earlier (Fig. 2-1D). Heavy-Chain Sequences from Spleen and Ectopic Lymphoid Tissue of NP-KLH Immuniz ed Mice To further verify that the lipogranulomas c ontained NP-specific B cells, we amplified and sequenced VH genes from lipogranulomas and sp leens. A preponderance of V186.2 and other VH genes (CH10, V303, V102) implicated in the formation of anti-NP antibodies (131) was found in the lipogranulomas and spleens of im munized mice (Fig. 2-4). B cells from the

PAGE 45

45 lipogranulomas expressed almost exclusively V186.2 or other VH genes implicated in the antiNP response, representing >90% of the total sequences (including 20% V186.2). In comparison, 60% of VH sequences from the spleen were V186.2, CH10, V303, or V102 (7% V186.2). V186.2 and other genes encoding presumptive NP-s pecific antibodies were infrequent in the lipogranulomas from un-immunized mice. The higher percentage of likely NP-specific VH genes in lipogranulomas vs. spleen from immunized mice is consistent with the possibility that T cell-dependent clonal expansi on of antigen-specific B cells may be ongoing within the lipogranulomas. To assess the clonality of B cells in ectopic lymphoid tissue induced by TMPD following immunization with the test an tigen, we sequenced the VH ge nes expressed by B cells in individual lipogranulomas and spleen. As s hown in Fig. 2-5A, diverse VH sequences were recovered from the spleens of TMPD-treated mice immunized with NP-KLH. In some instances the same VH-D-JH combination was obtained from two individual clones from the same spleen. Interestingly, the combination CH10-DSP2.X-JH1 (CH10 is implicated in the formation of antiNP antibodies) was recovered in duplicate clones from two different mice (Fig. 2-5A). In striking contrast to spleen, i ndividual lipogranulomas from TM PD-treated mice, immunized 12 days earlier with NP-KLH, contained highly ol igoclonal populations of B cells expressing VH sequences associated with an ti-NP reactivity (V186.2 and related sequences) (Fig. 2-5A, Mouse #1 and #2, lipogranulomas 1 and 2). The lipogr anulomas from immunized mice displayed almost exclusively (95%) V186.2 and analogous VH sequences vs. 50% of the VH genes recovered from the spleens of NP-KLH immuni zed mice (Fig. 2-5B). Lipogranulomas from TMPD-treated mice that were not immunized with NP-KLH contained more diverse populations of B cells with few V186.2 and related sequen ces (Fig. 2-5A-B). The anti-NP sequences

PAGE 46

46 found in individual lipogranulomas were distinct from those isolated in spleen and other lipogranulomas from the same mouse. Analysis of somatic mutation frequencies in V186.2 sequences revealed that 8/9 (88%) of the lipogranuloma V186.2 sequences were somatica lly mutated (Table 2-1). Lipogranuloma and spleen sequences both had R/S ratios > 5.7, suggestive of the o ccurrence of somatic hypermutation during a primary response to NP (133). None of the somatically mutated sequences contained th e prototypical 33 (W L) mutation characteristic of affinity maturation (134), consistent with an early NP-specific respon se in the lipogranulomas from these mice that had received only a pr imary immunization. To help address the issue of whether the li pogranuloma B cells were undergoing a primary anti-NP response locally as opposed to migrating there from othe r sites, such as secondary lymphoid tissue, the CDRs of related sequences isolated from lipogranul omas were compared (Fig. 2-6). Sequences obtained from individual lipogranulomas displayed identical or closely related somatic mutations, as might be expected if they underwent expansion locally (e.g. Mouse #2, lipogranuloma 1, V303-DSP2.8-JH4 sequences) (Fig. 2-6, top). However, although occasional new somatic mutations were found (e .g. sequence VH6-2) exte nsive clonal trees were not seen. In other cases (e.g. Mouse #1, lipogranuloma 2, V303-DSP2.9-JH1) collections of identical germline sequences were found (Fi g. 2-6, bottom). Individual somatic mutations seen in the CDR sequences recovered from lipogr anulomas were not found in the spleen of the same mouse, providing further evidence that th e splenic and lipogranuloma anti-NP responses developed independently of each other. Discussion There are many exam ples of structures rese mbling secondary lymphoid tissue arising at sites of chronic inflammation ( 105), but it remains unclear whet her this ectopic lymphoid tissue

PAGE 47

47 is a site of cognate T-B interactions. Speci fically, although autoantigen-specific B cells have been reported in ectopic lymphoid tissue (112, 13 5), it is not known whether immune responses actually develop there or whether antigen-specific B cells arising in secondary lymphoid tissues subsequently colonize the ectopic lymphoid tissu e. Here, we addressed this question by active subcutaneous immunization coupled with trackin g of antigen-specific B and T lymphocytes to peritoneal ectopic lymphoid tissue induced by TMPD To our knowledge, th is is the first study to show that both hapten-specific B cells and proliferating, carrier-specific, T effector cells are present within ectopic lymphoid tissue. Our data strongly suggest that cognate antige n-specific T-B interactions occur in ectopic lymphoid tissue. Following subcutaneous immuni zation with antigens such as NP-OVA, T and B-cell proliferation was seen in the TMPD-induced ectopic lym phoid tissue (Fig. 2-1E) and both OVA-specific T cells and NP hapten-specific B cells accumulated there (Figs. 2-2-2-3). T cells in the ectopic lymphoid tissue also produced IFN and other cytokines (Fig. 2-2E). Heavy chain sequences isolated from ectopi c lymphoid tissue were highly en riched for V186.2 and other Hchains known to generate NP-specific antibodie s (Figs. 2-4-2-5) and the proportion of such sequences was higher than in the splee n. Lipogranulomas also exhibited strong light chain staining consistent with an anti-NP response (F ig. 2-3). Moreover, anti-NP antibody secreting cells were enriched in ectopic lymphoid tissue in comparison with the spleen. Taken together, these data suggest that antigen-specific B cell and T cell responses may preferentially develop within the ectopic lymphoid tissue. Individual lipogranulomas from pre-immune mice contain rela tively diverse populations of B cells (Fig. 2-5;(37). In cont rast, following subcutaneous immunization, the B cells present in individual lipogranulomas were highly oligoclonal or even monoclona l (Fig. 2-5-2-6) and

PAGE 48

48 preferentially utilized H-chains previously reported in anti-NP responses. Oligoclonal B cell expansions also are seen in individual germinal centers microdissected form secondary lymphoid tissues (127), suggesting that i ndividual lipogranulomas from TM PD-treated mice are in some respects analogous to single germinal centers. The oligoclonal B cell pro liferation apparent in TMPD-induced ectopic lymphoid tis sue is consistent with prev ious observations in ectopic lymphoid tissues from rheumatoid arthritis, Sjog rens syndrome, and myasth enia gravis patients (108, 110, 135). A key question is whether the B cells in ectopic lym phoid tissue develop in situ or migrate into the ectopic lymphoid tissue from secondary lymphoid organs, such as the lymph nodes or spleen. In view of the timing of immunization and the VH sequences obtained, it is unlikely that the B cells found in lipogranulomas 10-12 days afte r immunization originated from the germinal centers of secondary lymphoid tissues followed by migration to the tertiary lymphoid tissues. The fact that individual lipogranulomas contai ned non-overlapping and unrelated sets of clonal B cells also suggests they were not seeded with the products of previous germinal center reactions in the lymph nodes or sp leen. Moreover, the sequences recovered from spleen did not overlap with the lipogranuloma sequences. We did not find the extensive clonal trees reported previous ly from spleen of MRL mice (136). However, extensive clonal trees were not seen in individual germinal centers, either (127) and the sequences illustrated in Fig. 2-6 (Mouse #2, Granuloma #1) are not that dissimilar from those reported previously from i ndividual germinal centers. The l ack of clonal trees could reflect the relatively small number of sequences analyzed per lipogranuloma or a lower rate of somatic hypermutation in ectopic lymphoid tissue vs. secondary lymphoid tissues.

PAGE 49

49 There are other important differences betw een the ectopic lymphoid tissue induced by TMPD and authentic germinal center reactions notably the absence of well-developed FDC networks and PNA+ B cells (63). ELISPOTs were larger using spleen ce lls vs. cells from the ectopic lymphoid tissue, suggesting that the splenic anti-NP B cells secrete more antibody than those from ectopic lymphoid tissue or that affinity maturation of B cells in the lipogranuloma is less efficient than in the spleen, an interpretati on consistent with the lower affinity of anti-NP antibodies in the sera of TMPD-treated mice vs. controls (Fig. 2-1D) an d the paucity of clonal trees. Together, these data suggest that 1) a si gnificant portion of the low affinity serum anti-NP response in TMPD-treated mice may derive from the ectopic lymphoid tissue and 2) affinity maturation may be defective in the ectopic lymphoi d tissuei.e. high affinity B cells may enjoy less of a competitive advantage over lower affinity cells in ectopic lymphoid tissue than in authentic secondary lymphoid tissues. We specula te that reduced affinity maturation in the lipogranulomas might reflect an absence of follicu lar dendritic cells in view of the lack of FDCM1+ staining (63). Further studies will be ne cessary, however, to determine whether the low affinity of serum anti-NP antibodies in TMPD-tre ated mice is due to their production in ectopic lymphoid tissue or is a systemic effect of TMPD treatment. The presence of oligoclonal B cell populations in individual lipogranulomas, lack of shared H-chain sequences between lipogranulomas and spleen and between individual lipogranulomas from the same mouse, expression of AID a nd the presence of circular DNA intermediates generated during active class switch recombination(37), as well as the presence of proliferating B and T cells in these structures lead us to conc lude that TMPD-induced ec topic lymphoid tissue is a site of germinal center-like cognate T-B intera ctions. However, the lipogranulomas may not be true germinal centers and instead could be analogo us to the previously reported extrafollicular

PAGE 50

50 sites of antigen-driven somatic hypermutation of rheumatoid factor B cells (137). Recently, ectopic lymphoid tissue also was f ound to express AID in the saliv ary glands of patients with Sjogrens syndrome (138), supporting the idea th at this may be a gene ral feature of ectopic lymphoid tissue in a variety of locations. The formation of ectopic lymphoid tissue is st rongly associated with autoimmunity and autoantibody production in a variety of disord ers (105), including the rheumatoid synovium, salivary glands in Sjogrens syndrome (110, 139), thymus in myasthenia gravis (135), and the thyroid in Hashimotos thyroiditis (99). In several examples of organ-specific autoimmune disease, autoreactive B cells have been found within ectopic lymphoi d tissue in the ta rget tissues. We have shown recently that anti-RNP autoan tibody-producing B cells are enriched in ectopic lymphoid tissue of TMPD-treated mice, strongly suggesting that this may be a site where autoreactivity may develop preferentially (37). It will be of interest to determine where the antigen presenting cells responsible for activating autoreactive T cel ls acquire self-antigens, as the present data indicate that APCs from remo te (e.g. subcutaneous) locations are capable of homing to ectopic lymphoid tissue located within th e peritoneum. The role of chemokines, such as CXCL19, CXCL21, and CXCL13, expressed at high levels in the ectopic lymphoid tissue (63) in establishing autoantibody production in ectopic si tes remains to be determined. Finally, it will be of interest to see if therapy aimed at disr upting the formation of ectopic lymphoid tissue will prevent the development of l upus in TMPD-treated mice.

PAGE 51

51 Figure 2-1. Serum anti-NP response after immu nization with NP-KLH. A and B, B6 mice injected with TMPD 3 months earlier we re immunized with NP-KLH. At day 12, sera were tested for IgM (A) and IgG (B) anti-NP antibodies by ELISA using NPBSA. There was a significant increase in both IgM and IgG anti-NP from preimmune sera to day 12 immune sera. C, Is otypes of anti-NP antibodies (ELISA) from mice either pre-treated or not pre-treated with TMPD prior to immunization with NPKLH. D, Affinity of anti-NP antibod ies developing in TMPD-treated mice vs. controls (no Rx) immunized with NP-KLH Serum binding activity (measured in arbitrary units using a standa rd curve) was measured using NP30-BSA (low and high avidity/affinity antibodies) and NP3-BSA (h igh avidity/affinity antibodies). E, In vivo BrdU labeling of T and B cells in the lipogranulomas and spleens of TMPDtreated and NP-KLH immunized mice (n = 3) Single cell suspen sions were stained with anti-CD45R (B220) and anti-CD3 an tibodies and with an anti-BrdU antibody. Data are expressed as the % of BrdU+ B ce lls or T cells, respec tively, at 4, 8, 10, or 14 days after immuni zation with NP-KLH.

PAGE 52

52 Figure 2-2. OVA-specific T cells in lipogranulomas. A, Single ce ll suspensions from spleen, lymph nodes, or lipogranulomas of mice inj ected i.v. with OT-II T cells (n = 6) or PBS (n = 5) were analyzed by flow cyto metry 7 days after immunization with NPOVA. The V 2+V 5+ values represent the total pe rcentage of CD3+CD4+ T cells. (* Lymph nodes, P = 0.009; Lipogranuloma, P = 0.02, Mann Whitney test) B, Mice were injected i.v. with DO11.10 T cells (n = 12) or PBS (n = 5) were analyzed by flow cytometry. Some mice that receive d DO11.10 T cells were immunized with NPOVA (n = 7) and others were not (n = 5). (* Spleen, P = 0.0006; Lymph node, P = 0.01, Lipogranuloma, P = 0.02, Mann Whitney te st) C, Single cell suspensions of lipogranulomas, spleen and draining lymph nodes from immunized or nonimmunized mice were gated on live CD3+CD4+ cells (cytox blue) and then the % of KJI-26+ (DO11.10 T cells) was determined from CD3+ CD4+ cells (representative of three independent experiments). D, Isolat ed CD4+ T cells were cultured with or without OVA323-339 for 72 h. T cell proliferation was measured by [3H] incorporation (representativ e of three independent experiments). E, cDNA was synthesized from two lipogranulomas (Lipo) or spleen from a TMPD treated mice immunized with NP-KLH. IL-4, IFN and IL-21 expression was determined by RTPCR and normalized to -actin expression (representative of four different mice)

PAGE 53

53 Figure 2-3. Anti-NP B cells in ectopic lymphoid tissue. A, Light chain staining of B cells in lipogranulomas from B6 mice treated with TMPD alone or trea ted with TMPD and then immunized with NP-KLH. Paraformal dehyde-fixed tissue was analyzed 12 days after NP-KLH immunization. Paraffin sections were stained with antiand antilight chain antibodies. B, Number of and positive cells per high power field in mice treated with TMPD + NP-KLH immunization or w ith TMPD alone (* P = 0.02, Mann Whitney test; representative of five independent experiments). C, ELISPOT assay for anti-NP B cells. MultiScreen HTS IP plates containing a 0.45 m Immobilon-P membrane were coated w ith 1 g/mL NP-BSA. Lipogranuloma and spleen cells from TMPD treated mice (n = 2) or TMPD-treated and NP-KLH immunized mice (n = 2) were added to triplicate wells for 24 h before adding biotinylated goat anti-mouse IgM antibodies streptavidin-peroxidase, and BCIP-NBT substrate. Number of spots per well wa s determined (* P = 0.03 for both mouse A and mouse B, Mann Whitney test; representati ve of three independent experiments). D, Relative sizes of individual spots in ELISPOT assays using lipogranuloma (Lipo) or spleen (Spl) cells from TMPD treated mice either with or without NP-KLH immunization.

PAGE 54

54 Figure 2 4. VH segment usage in lipogranulomas and spleen. Lipogranulomas from a TMPDtreated mouse immunized with NP-KLH were pooled at day 12 and RNA was isolated. Immunoglobulin VH sequences were determined from lipogranulomas (n = 50) and spleen (n = 50) from the same mouse. All of the sequences recovered from lipogranulomas bore V186.2, CH10, V303, V102, or V124 vs. 62.6% of the sequences recovered from the spleen (representative of three independent experiments).

PAGE 55

55 Figure 2-5. Oligoclonal VH seque nces from lipogranulomas of immunized mice. Heavy chain sequences are shown from spleen and lipogr anulomas of two mi ce immunized with NP-KLH (day 12) and two pre-immune ( not immunized) mice. V-D-J sequences were amplified from cDNA by PCR and se quenced to determine VH, D, and JH usage. Boxed sequences utilize VH sequences associated with anti-NP reactivity. Related sequences are shown in the same format.

PAGE 56

56 Figure 2-6. CDR1 and CDR2 sequences from H-chains isolated from lipogranulomas. Sequences of H-chains from Mouse #1, lipogranuloma 2 (V303-DSP2.9-JH1) and Mouse #2, Lipogranuloma 1 (V303-DSP2.8-JH4) are aligned. Somatic mutations are indicated. Replacement mutations capitalized, silent mutations lower case. Table 2-1. V186.2 sequences from mice undergoing primary NP-KLH immunization Total number of seq No. of V186.2 No. of mutated V186.2 Position 33 W L mutation Affinity matured V186.2 R/S FR R/S CDR Lipogran 35 9 8 0 0.72 6 Spleen 35 7 5 0 1.3 7.5

PAGE 57

57 CHAPTER 32 B CELL PROLIFERATION, SOMATIC HYPERMUTATION, CLASS SW ITCH RECOMBINATION, AND AUTOANTIBODY PRODUCTION IN ECTOPIC LYMPHOID TISSUE IN MURINE LUPUS Introduction Secondary lym phoid tissue, which includes ly mph nodes, mucosal-associated lymphoid tissues, and the spleen, is organized to concentrat e foreign antigens, placing the cells responsible for mounting an antigen-specific immune response to these antig ens (T and B lymphocytes and dendritic cells) in close proxi mity (105, 140). The tissue is organized into discrete zones containing T cells and dendritic cells (the pe riarteriolar lymphoid sheath) and B cells and follicular dendritic cells (the primary follicles). The chemokines CCL19 (ELC) and CCL21 (SLC), which attract T lymphoc ytes and dendritic cells, and CXCL13 (BLC), which attracts B lymphocytes, play an important role in esta blishing the compartmenta lization of secondary lymphoid tissues into discrete T and B cell zones ( 141). Antigen-specific B cells appear initially at the periphery of the periarte riolar lymphoid sheath forming pr imary foci, which are sites of interclonal competition for antigen among unmutate d B cells (128). Subsequently, these give rise to a second responding population in the follic le, germinal center B cells. Germinal centers are sites of intraclonal competition for antigen and survival signals between mutated sister lymphocytes (128). The germinal center reac tion regulates antigen-specific clonal evolution during the development of B cell memory (142). It is characterized by somatic hypermutation (SHM) of immunoglobulin complementarity de termining regions (CDRs), class switch recombination (CSR), clonal expansion (prolifera tion), and antigen-driven affinity maturation of 2 Reprinted with permission from The Association of American Immunologists, Inc. Copyright 2009 Nacionales DC and Weinstein JS et. al B Cell Proliferation, Somatic Hypermut ation, Class Switch Recombination, And Autoantibody Production In Ectopic Lymphoid Tissue In Murine Lupus.. J Immunol. 2009 Apr 1;182(7):4226-36.

PAGE 58

58 B cells, expression of activation induced cytidi ne deaminase (AID), and a requirement for CD40L+ T cells (142). B cells in newly formed germinal centers ge nerally are often oligoclonal, consisting of 1-3 clones (127). The formation of ectopic (tertiary) lymphoid tis sue in response to inflammation has been termed lymphoid neogenesis because it recap itulates many aspects of secondary lymphoid tissue development (95, 105). Like secondary lymphoid tissue, the organization of ectopic lymphoid tissue is dependent on CCL19 (ELC), CCL21 (SLC), and CXCL13 (BLC) (1). Interestingly, lymphoid neogenesis is strongly associated with autoimmunity and the formation of autoantibodies (96). Autoimmune disorder s associated with the formation of ectopic lymphoid tissue include Hashimoto s thyroiditis, Sjogren s syndrome, rheumatoid arthritis, and myasthenia gravis (105). We have shown that the intraperitoneal injection of the hydrocarbon pristane (2, 6, 10, 14 tetramethylpentadecane, TM PD) gives rise to the formation of ectopic lymphoid tissue and a chronic immune reaction culminating in the development of lupus (63). In contrast, other hydrocarbon oils, such as medici nal mineral oil, induce the formation of ectopic lymphoid tissue but not lupus (32). Inflammatory tissue generated in response to TMPD consists of dendritic cells, monocytes, T cells, and B ce lls, often organized into discrete zones reminiscent of lymph node architecture, which is vascularized by MECA -79+ high endothelial venules (63) The ectopic lymphoid tissue is or ganized into discrete nodular lipogranulomas (118). CCL19, CCL21, and CXCL13 all are expresse d in the lipogranulomas and likely play a role in recruiting immune cells into them (63). In this study we show that the lipogra nulomas not only morphologically resemble lymphoid organs but also display some of the characteristics of germ inal center reactions, namely proliferation of T and B lymphocyt es, T cell dependent SHM of immunoglobulin

PAGE 59

59 variable regions, expression of AID, and CSR. IgG1 and IgG2a hypergammaglobulinemia induced by TMPD as well as the production of isotype-switched autoan tibodies required the presence of T cells. Moreover, autoantibody secreting cells were present in the lipogranulomas, consistent with the possibility that they can be generated within the ec topic (tertiary) lymphoid tissue. Materials and Methods Mice Four-week -old female BALB/cJ mice were purchased from Jackson Laboratory (Bar Harbor, ME) and housed in barrier cages. At 3 months of age, they received a single intraperitoneal (i.p.) injection (0.5 ml) of either TMPD (Sigma-Aldrich, St. Louis, MO) or medicinal mineral oil (Harris T eeter, Mathews, NC). Peritone al cells, lipogranulomas, and blood were harvested 12-20 weeks later. In some experiments female T cell receptor deficient (B6.129P2-Tcrbtm1MomTcrdTm1Mom, backcro ss generation N12) and C57BL/6J mice (Jackson) were used. These studies were approved by the Institutional Animal Care and Use Committee. Immunohistochemistry and Immunofluorescence Lipogranulom as were excised from the peritone al wall after peritoneal lavage, fixed with 4% paraformaldehyde, and embedded in paraffin. Immunohistochemistry was carried out by the Molecular Pathology and Immunology Core at University of Florida using the DAKO Autostainer protocol. Briefly, 4 m serial sections were deparaffinized and then blocked with Sniper (Biocare Medical, Walnut Creek, CA). Sections were incubated with rat anti-mouse CD45R (B220) (BD Biosciences, San Jose, CA), CD3 (Serotec, Raleigh, NC), or Ki-67 (Dako Cytomation, Carpinteria, CA) for 1 hour follo wed by incubation with non-biotinylated rabbit anti-rat immunoglobulin antibodie s (Vector, Burlingame, CA) for 30 minutes. Staining was

PAGE 60

60 visualized using Mach Gt x Rb HRP polymer (Biocare Medical, Walnut Creek, CA), the chromagen Cardassian DAB (Biocare Medical, Walnut Creek, CA) and Mayers hematoxylin counterstain. Tissue sections al so were stained with antibodies against follicular dendritic cells (FDC-M1, BD Biosciences) and processed for immunohistochemistry as above. To detect IgM and IgG in the lipogranulomas, de-paraffinized sections were stained with either FITC-conjugated goat anti-mouse IgG or IgM (Southern Biotechnology, Birmingham, AL), mounted using Vectashield mounting me dium with DAPI (Vector) and examined by fluorescence microscopy. Bromodeoxyuridine (BrdU) Labeling of B and T Cells BrdU was adm inistered to BALB/cJ mice ( 0.2 mg BrdU i.p. every 4 hours for 3 doses) and again one day before euthanasia. Periton eal lipogranulomas from each mouse were excised and pooled. Single cell suspensions were made by collagenase treatment (63). Spleen cells were also prepared using collagenase treatment. The isolated cells were incubated with APCconjugated anti-BrdU antibodies, plus anti-CD3-FITC and anti-CD19-PE antibodies (BD Biosciences) and analyzed by flow cytometry. Appropriate isotype cont rols were used to evaluate background fluorescence. Isolated lipog ranuloma cells were washed in staining buffer (PBS supplemented with 0.1% NaN3 and 1% bov ine serum albumin) and pre-incubated for 20 minutes with 1 g of anti-CD16 (BD Biosciences) and 0.5 l rat serum (Sigma Aldrich) at 4 C in 20 l of staining buffer to block Fc binding. Primary antibodies were then added at pretitrated amounts and incuba ted for 20 minutes at 4 C, followed by washing in staining buffer. Intracellular BrdU labeling was performed after permeabilization with BD Cytoperm plus using the APC BrdU flow kit following the manufacturers instructions (BD Biosciences). After gating on B220+ or CD4+ lymphocytes, the percen tage of BrdU+ cells was determined by flow

PAGE 61

61 cytometry as above. Data were acquired on a CyAn ADP flow cytometer (Dako, Fort Collins, Colorado) and analyzed with FCS Express Ve rsion 3 (DeNovo Software, Thornhill, Ontario, Canada). At least 50,000 events per sample we re acquired and analyzed using size gating to exclude dead cells. Ki-67 Staining of B and T Cells Single-cell suspensions were m ade from li pogranulomas and spleen, and proliferating cells were surface-stained with anti-B220 and an ti-CD4, followed by permeabilization with cold 70% ethanol at -20 for 3 hours. Cells were then analyzed for in tracellular staining with anti-Ki67 antibodies (BD Biosciences) using the manufacturers protocol. After gating on B220+ or CD4+ lymphocytes, the percentage of Ki-67+ cells was determined by flow cytometry as above. Real Time-PCR Analysis of Aid and Class Sw itched H-Chain Transcripts Total RNA from individual lipogranulomas excised from TMPDor mineral oil-treated mice was isolated using Trizol (Invitrogen Life Technologies Carlsbad, California) and precipitated with isoprop anol. The pellets were washed with cold 75% (v/v) ethanol and resuspended in diethyl pyrocarbonate (DEPC)-treated water. One g of RNA was treated with DNase I (Invitrogen) to remove genomic DNA and reverse transcribed to cDNA using Superscript First-Strand Synthesis System for RT-PCR (Invitrogen). Conventional PCR amplification was carried out in a PTC-100 Pr ogrammable Thermal Controller (MJ Research, Inc., Waltham, MA) using primers for AID (forwardGAG GGA GTC AAG AAA GTC ACG CTG GA ; reverseGGC TGA GG T TAG GGT TCC ATC TCA ) and -actin (143). Real-time PCR was performed using SYBR Green core reag ents (Applied Biosystems, Foster City, CA) and a DNA Engine Opticon 2 continuous fluorescen ce detector (MJ Research). PCR primers were as follows: AID forward-CCT CCT GCT CAC TGG ACT CC; AID reverse-AGG CTG AGG TTA GGG TTC CA; 18S forward-AGG CTA CCA CAT CCA AGG AA; 18S reverse-

PAGE 62

62 GCT GGA ATT ACC GCG GCT. AID expression was normalized to the expression of an endogenous control (18s RNA) using the comparative (2 Ct) method (144). Data are expressed relative to the sample with the lowest expression level. For detecting IgM and IgG1 transcripts, a mixture of 8 consensus forw ard primers (VHF1-8) and isotype specific C and C 1 reverse primers were used (130). Primers were synthesized by Invitrogen. PCR products were analyzed on 1% agarose gels and st ained with ethidium bromide. Class Switch Recombination Assay The occurrence of active CSR in ectopic lym phoid tissue (TMPD or m ineral oil induced lipogranulomas) was evaluate d by detecting looped out circul ar DNAs as described (145). Briefly, total RNA was isolated from individual lipogranulom as, treated with DNase I and reverse transcribed to cDNA as above. Circle tr anscripts were amplified as follows: initial denaturation 95C for 9 min followed by 35 cycles of PCR (94C for 30 sec, 58C for 60 sec) using 0.025 U of Taq DNA polymerase (Invitrogen), 2.0 mM MgCl2, and 1 M each of isotypespecific I-region primers (I 1F or I 2aF) and a C reverse primer (15). PCR products were separated on a 1% agarose gel and stained with ethidium bromide. Immunoglobulin V-D-J Sequence Analysis To determ ine VDJ gene usage, 1 l cDNA was amplified using pooled forward (VHF1-8) and reverse (VHR2) primers (Fig. 3A) (130). The reaction was carried out in a 20 l volume using 1.25 nM pooled VHF and 2.5 nM VHR2 pr imers containing 1X PCR buffer, 1.5 mM MgCl2, 200 M dNTPs, and 0.05 U of Taq DNA pol ymerase (Invitrogen), in a PTC-100 Programmable Thermal Controller (MJ Research) as follows: denaturation at 94C for 30 sec, annealing at 52C for 30 sec, and extension at 72 C for 1 min. After 30 cycles, extension was continued at 72C for an additional 10 min. The PCR product was cloned into a TA vector (pCR4, Invitrogen) and sequenced using an Applied Biosystems Model 373 Stretch DNA

PAGE 63

63 Sequencer, 377 DNA Sequencer, or 3100 Genetic Anal yzer using a T7 sequencing primer. The determined sequences were verified by seque ncing in the reverse direction using a T3 sequencing primer. VH, D, and JH sequences were identified by searching the Ig-BLAST and IMGT/V-Quest databases using MacVector soft ware (Accelrys Inc., San Diego, CA). Enzyme Linked Immunosorbent Assay Anti-nRNP/Sm antigen-capture ELISAs were performed as described (94). Antigencoated wells were incubated with 100 l mouse sera diluted 1:500 in blocking buffer for 1 hr at 22C, washed three times with TBS/Tween 20, and incubated with 100 l alkaline phosphataselabeled goat anti-mouse IgG or IgM (1:1000 dilution) for 1 hr at 22C. After washing, the plates were developed with p-nitrophe nyl phosphate substrate (Sigma). Optical density at 405 nm (OD405) was read using a VERSAmax micropl ate reader (Molecular Devices Corporation, Sunnyvale, CA). ). Standard curves were generated using serial dilutions of a murine anti-U170K monoclonal antibody (2.73). Concentratio ns of anti-Sm/RNP autoantibodies were calculated using a four-parameter logistic equa tion as part of the Softmax Pro 3.0 ELISA plate reader software. Total levels of IgG1, IgG2 a, IgG3, and IgM were measured by ELISA as described (27). Quantification of Plasmablasts Single-cell suspensions were m ade using sp leen and lipogranuloma tissue from five TMPD-treated BALB/c mice. Cells were stained with APC-conjugated anti-B220 and PEconjugated anti-CD138 antibodies (BD Pharmingen) and analyzed by flow cytometry as above. ELISPOT Assay for Total Immunoglobulin Lipogranulom as and splenocytes from TMPD treated mice were harvested, analyzed by flow cytometry to determine B cell numbers (a nti-CD19), and plated (3 X 105 cells/well) in quadruplicate on Multiscreen HTS plates (Millipor e, Billerica, MA) coated with rat IgG anti-

PAGE 64

64 mouse light chain antibodies ( and chain specific, 3 g/ml each, from BD Pharmingen). The cells were incubated overnight before adding a combination of alkaline phosphatase-conjugated rat anti-mouse IgG1, IgG2a, IgG2b antibodies (1:1000 diluti on). Spots were developed overnight with BCIP/NBT (Pierce Chemical Co., Rockford, IL). The number of antibody secreting lipogranuloma cells and splenocytes per 100,000 B cells was determined by counting the spots using a dissecting microscope. ELISPOT Assay for Anti-RNP Autoantibodies The production of anti-U1A (a subset of anti-RNP) autoantibodies in the ectopic lym phoid tissue also was examined by ELISPOT assay. A human full-length U1A cDNA was obtained by RT-PCR (PTC-100 Pr ogrammable Thermal Controller (MJ Research, Inc., Waltham, MA) from normal human PBMC cDNA The forward primer was GCG GAT CCG CAG TTC CCG AGA CCC GCC CTA ACC AC Bam HI and reverse primer was GCA AGC TTC TAC TTC TTG GCA AAG GAG ATG TTC Hind III. The amplified fragment was inserted between the BamHI and HindIII sites of pET28A (Invitrogen) in-frame with the 6His sequence. The vector was used to transform E. coli BL21 DE3 and recombinant protein was expressed by growing in LB medium containing 10 g/ml kanamycin and 2 mM IPTG. Four hours later, the bacteria were lysed using 6 M guanidine HCl + 0.5 mM phenylmethylsulfonyl fluoride and 0.3 TIU/ml aprotinin. Recombinan t protein was purified using Ni-NTA resin columns (Sigma). The protei n was eluted with 6 M urea. Reactivity with serum anti-RNP autoantibodie s from TMPD-treated mice was verified by ELISA. The microtiter plate wells (Immobolizer Amino; Nunc, Nape ville, IL) were coated with 1 g/ml purified recombinant antigen in BBS overni ght at 4 C. The re mainder of the ELISA was carried out as described a bove. Sera from 20 anti-Sm/RN P positive TMPD-treated mice and 20 untreated controls were tested at a 1:500 dilution followed by 1:1000 alkaline phosphatase-

PAGE 65

65 conjugated goat anti-mouse IgG antibodies (Sout hern Biotechnology). Using the SoftMax Pro 3.0 software, OD405 values were converted to units with a standard curv e based on a serially diluted prototype serum. For the ELISPOT assays, lipogranuloma cells from TMPD treated BALB/cJ mice were harvested and plated on Multiscreen HTS plates (M illipore) coated overnight at 4C with either recombinant U1A protein (5 g/ml) or BSA followed by alkalin e phosphatase-conjugated goat anti-mouse IgG or IgM antibodies (1:1000 dilution, Southern Biotechnol ogy). Spots were developed overnight with BCIP/NBT (Pierce) and counted as above. Results Lipogranulom as developing in the peritoneum of TMPDor mineral oil-treated mice are a form of ectopic lymphoid tissue (63). We invest igated whether these st ructures also exhibit functional characteristics consistent with germ inal center reactions, su ch as SHM, CSR, and antigen-driven, T cell-dependent pr oliferation of B lymphocytes. Lymphocyte Proliferation in TMPD-Induced Ectopic Lymphoid Tissue As shown previously (63), se rial sections of lipogranulom as from TMPD-treated mice revealed contiguous aggregates of B220+ and CD3+ cells (Fig. 3-1A). Ki-67+ cells were found in the same region, consistent with the presen ce of proliferating lym phocytes (Fig. 3-1A). However, it was difficult to determine from these sections whether T cells, B cells, or both were proliferating. To address this question, pooled lipogranulomas were analyzed by flow cytometry using anti-B220, CD4, and Ki-67 antibodies. A sm all percentage of B220+ (4.91%) and CD4+ lymphocytes (3.85%) was Ki-67+ (Fig. 3-1B). To confirm the presence of proliferating B and T lymphocytes in the ectopic lymphoid tissue, TMPD -treated mice were injected with BrdU (0.2 mg every 4 hours for 3 doses) and euthanized th e following day. Incorporation of BrdU by B and T cells in the lipogranulomas and spleen was determined by flow cytometry using anti-BrdU

PAGE 66

66 antibodies. BrdU+ B (B220+) and T (CD3+) cells were present in both the lipogranulomas and the spleen (Fig. 3-1C). There was a significantly higher percentage of BrdU+ B and T cells in the lipogranulomas compared with spleen (p = 0.028), indicating that B and T cell proliferation was greater in the ectopic lymphoid tissue than in secondary lymphoid tissue (spleen). Follicular dendritic cells could not be identified in the ectopic lymphoid tissue afte r staining with FDC-M1 antibodies (Fig. 3-1A), whereas strong staini ng of follicular dendritic cells could be demonstrated in the spleen (not shown). Expression of AID and CSR in TMPD-Induced Ectopic Lymphoid Tissue As B cell p roliferation in lymphoid follic les is linked to SHM and Ig repertoire diversification (99), we examined the expression of AID, a marker of CSR and SHM, in TMPD and mineral oil lipogranulomas. By RT-PCR, expression of AID was demonstrated in both TMPD and mineral oil induced lipogranulomas but not in peritoneal exudat e cells (Fig. 3-2A). However, the expression appeared lower than in the spleen. Quantitative PCR confirmed that AID expression was lower in lipogranulomas than spleen from TMPD-treated mice, whereas the levels were comparable in lipogranulomas vs. spleen of mineral oil treated mice (Fig. 3-2A, right). The expression of AID was higher in TMPD or minera l oil lipogranulomas than in peritoneal exudate cells. Since AID expression is re quired for immunoglobulin class switching, we examined whether IgG-producing B cells were present in th e ectopic lymphoid tissue. Class switching to IgG1 and IgG2a, which requires T cells and is ch aracteristic of germin al center reactions, was detected using conventional RT-PCR. Variable levels of H-chain mRNA could be detected in nearly all lipogranulomas from either TMPDor mineral oil-treated mice and high levels were also found in the spleen (Fig. 3-2B). In contrast, 1 H-chain mRNA was more abundant in the ectopic lymphoid tissue from TMPD-t reated mice in comparison with mineral oil treated mice.

PAGE 67

67 At least low levels of 1 H-chain were detectable by RT -PCR in 11/12 TMPD lipogranulomas vs. 1/12 mineral oil lipogranul omas (Fig. 3-2B, right). CSR is accompanied by the looping out of a DNA segment containing C and other CH genes generating closed circular DNAs with isotype-specific I-C transcripts. In vitro, these circle transcripts are complete ly removed within 48 hours and detection of circle transcripts by PCR is indicative of active CSR (145). We used the presence of circle transcripts to evaluate whether the lipogranulomas were a site of active CSR. Consistent with the data shown in Fig. 32B, 2a or 1 (not shown) circle tran scripts were detected in some of the TMPD-induced lipogranulomas (5 out of 31 total), but were rarely detected in mineral oil lipogranulomas (1 out of 17) (Fig. 3-2C). As a further confirmation, lipogranulomas from mineral oil or TMPD-treated mice were stained with FITC-conjuga ted anti-immunoglobulin antibodies ( or chain specific) and examined by fluorescence microscopy (Fig. 3-2D). Mineral oil and TMPD lipogranulomas both contained cells expressing H-chain, whereas H-chain was detected only in TMPD lipogranulomas. Individual Lipogranulomas from a Single Mouse Contain Diffe rent Populations of B Cells Germ inal center reactions are characterized by oligoclonal expansions of antigen-specific B cells with somatically mutated immunoglobulin H and L chains. We therefore examined the B cell repertoire in single lipogran ulomas (ectopic lymphoid tissue) induced by TMPD or mineral oil treatment. Figure 3-3A shows the prim ers used to analyze immunoglobulin VH gene expression in the ectopic lymphoid tissue. A to tal of 78 sequences isolated from 7 individual lipogranulomas from three TMPD-treated mice and 22 sequences isolated from 4 individual lipogranulomas from two minera l oil treated mice were analy zed. Figure 3-3B depicts the distribution of V-D-J segment us age in individual lipogranulomas from three representative mice. Lipogranulomas #137, 139, and 140 were isol ated from a single TMPD-treated mouse,

PAGE 68

68 lipogranulomas #190 and 193 from another mous e, and lipogranulomas #201 and 204 from a third mouse. Diverse H-chain sequences were obtained from each individual lipogranuloma. In some cases, several identical or closely related sequences were obtained from the same lipogranuloma. For example, si x identical, somatically mutated rearrangements comprised of VH36-60-DFL16.1-JH4 were obtained from lipogranuloma #137 and 4 of 7 clones obtained from lipogranuloma #139 used J558.45-DFL16.1-JH1 segments (Figs. 3-3B and 3-4A). One sequence from lipogranuloma #139 and six fr om lipogranuloma #137 bore a VH36-60-DFL16.1JH4 rearrangement (Fig. 3-3B, indicated by *). However, sequence analysis showed that the somatic mutations found in the sequence from lipogranuloma #139 differed substantially from those in lipogranuloma #137, indicating that thes e sequences were clona lly unrelated (Fig. 34A). Four sequences from granuloma #139 a nd two from #140 did have identical germline J558.45-DFL16.1-JH1 sequences (indicated by ). Ho wever, as all sequences were in a germline configuration, it could not be determined whether they were clonally relate d or derived from two clones that independently rearra nged the same V-D-J segments. Sequences from the remaining five granulomas from TMPD-treated mice cont ained no shared sequences. VH36-60 sequences were isolated frequently from TMPD-, but not mineral oil-induced lipogranulomas (9 out of 78 vs. 0 out of 22 sequences). The sequences recovered from mineral oil lipog ranulomas were also diverse (Fig. 3-3C). As in the TMPD lipogranulomas, there were occasional examples of the same V-D-J combination being found in more than one lipogranuloma (Fig. 3-3C, indicated by **). In this case, the sequences were identical (Fig. 3-4B). Ho wever, as was true of the shared sequences in granulomas #139 and 140 (above), th e sequences were germline, ma king it difficult to evaluate

PAGE 69

69 whether they were derived from a single clone or two independent clones with the same V-D-J segments. As suggested by the representative sequences shown in Fig. 3-4B, the H-chain sequences from ectopic lymphoid tissue in mineral oil treate d mice contained fewer somatic mutations than those from TMPD-treated mice. The total soma tic mutation frequency in the heavy chain of mice treated with TMPD was 4.9% (607 mutatio ns/12466 bases) in contrast to 0.8% (37 mutations/4336 bases) in mineral oil treated mice. As shown in Table 3-1, the somatic mutations were found predominantly in the CDR regions of sequences obtained from both TMPDand mineral oilinduced ectopic lymphoid tissue (replacement/silent mutation ratios of 7.2 and 8, respectively, for the CDR regions of TMPD a nd mineral oil-treated mice vs. 1.7 and 2.0 for the framework regions), suggesting that in both case s, somatic mutations were generated through a process of antigen-selected affinity maturation. Taken together, these data indicate that th e B cells from ectopic lymphoid tissue induced by TMPD or mineral oil in non-immunized mice were clonally diverse, although there was a suggestion that certain clones may predominate within individual lipogranulomas and that VH36-60, an H-chain that is utilized preferenti ally by B cells with rheumatoid factor or rheumatoid factor-anti-DNA dual reactivity (146, 147) is used considerably more frequently in TMPDvs. mineral oil-induced ectopic lymphoid ti ssue. We found little evidence for sharing of B cell clones between individual lipogranulomas, as might be expected if the ectopic lymphoid tissue was populated by B cells arising from another location, such as the spleen or lymph nodes. Somatic Hyper Mutation in TMPD-T reated Mice is T Cell-Dependent. SHM of i mmunoglobulin genes occurring duri ng the germinal center reaction usually requires CD40L+ T cells (148). However, both in side and outside of germinal centers, SHM sometimes may be T cell-independent (113, 149, 150) To investigate the role of T cells in

PAGE 70

70 generating the somatic mutations in H-chain se quences from B cells in TMPD-induced ectopic lymphoid tissue, we treated B6.129P2-Tcrbtm1MomTcrdTm1Mom (T cell receptor -chain and -chain deficient) and wild type C57BL/6J mi ce with TMPD and analyzed H-chain sequences from the lipogranulomas 3 months later. V-DJ sequences from TcR deficient mice had a very low rate of SHM (1 mutation/3252 total bases, 0 .03%), whereas sequences from C57BL/6J mice had a more than 20-fold higher rate (12 muta tions/1626 bases, 0.7%). Significantly, these mutations were found mainly in the CDR regions (T able 3-2). The greatl y increased number of somatic mutations in wild type vs. TcR deficient mice, clustering of mutations in the CDRs, and the relatively low error rate reported for Taq pol ymerase (~ 1 error per 10,000 bases) argue that the observed base changes represent true so matic hypermutation and not merely polymerase errors. These data provide further evidence that the SHM seen in ectopic lymphoid tissue from TMPD-treated mice was generated through a germinal center-like reaction. Pristane-Induced Hypergammaglobulinemia and Autoant ibody Production are also T Cell Dependent Two of the characteristic i mmune abnormalities induced by TMPD treatment are induction of polyclonal hypergammaglobulinemia and the development of IgM and IgG autoantibodies, such as anti-RNP/Sm, associat ed with SLE. Since CSR to 1 and 2a H-chain occurs in TMPDinduced ectopic lymphoid tissue (F ig. 3-2C), we investigated whether the increased production of polyclonal serum IgG and IgG autoantibodie s requires the presence of T cells. Total immunoglobulin levels were determined (ELISA) in sera from TcR deficient and wild type mice treated with TMPD 3 months earlier Levels of IgM and IgG3 were comparable in wild type vs. knockout mice (Fig. 3-5A) consistent with the f act that IgM and IgG3 antibody production is largely T cell independent. However, IgG1 a nd IgG2a levels were si gnificantly higher in the

PAGE 71

71 wild type mice (Mann Whitney p = 0.008 and p = 0.03, respectively), indi cating that the TMPDinduced polyclonal increase in these isotypes was T cell mediated. To determine whether some of the T cel l-dependent immunoglobulin production was derived from B cells present in the lipogran ulomas, ELISPOT assays were performed using isolated lipogranuloma cells a nd splenocytes. As shown in Fi gure 3-5B, pooled lipogranuloma B cells from TMPD-treated mice secreted imm unoglobulin of T cell dependent isotypes (IgG1, IgG2a, IgG2b) at a frequency similar to that in the spleen. Although the percentage of B220+CD138+ plasmablasts was lo wer in the lipogranulomas compared to spleen (Fig. 3-5C), the frequency and size of the spots produced by lipogranuloma and splenic B cells was similar suggesting that individual cells from the tw o locations secreted comparable amounts of polyclonal immunoglobulin. We previously show ed that after immunization with exogenous antigen, T cells from the lipogranulomas secrete IL -21, which has been shown to play a role in plasma cell differentiation (120). These data in dicate that lipogranuloma cells actively secrete antibodies of T-cell dependent isotypes. Finally, we examined the role of ectopi c lymphoid tissue induced by TMPD in the pathogenesis of lupus-associated autoantibodies ag ainst the U1 small ribonucleoprotein (anti-Sm and anti-RNP antibodies). IgM anti-RNP/Sm autoantibodies (ELISA ) were detected at low, but comparable, levels in the sera of wild type a nd TcR knockout mice (Fig. 3-6A). In contrast, IgG anti-nRNP/Sm autoantibodies were produced by wild type animals but the levels in TcR deficient mice were not statistically different than those in untreated controls (Fig. 3-6B). These experiments suggested that not only was the induction of polyc lonal IgG1 and IgG2a by TMPD T cell dependent (Fig. 3-5), but also the app earance of class-switched serum autoantibodies required T cells, a characteristic of autoantibodies generated during germinal center reactions.

PAGE 72

72 The presence in ectopic lymphoid tissu e of B cells producing class-switched autoantibodies against the U1 small ribonucleopro tein was investigated using an ELISPOT for anti-U1A (anti-RNP) autoanti bodies. The purified recombinant U1A antigen used for ELISPOT assays was reactive with sera from 19/20 an ti-RNP and/or anti-Sm positive TMPD-treated BALB/c mice, but not with 20 normal mouse sera (Fig. 3-6C). As shown in Fig. 3-6D, left panel, large numbers of IgM anti-U1A autoan tibody secreting cells were detected in cells obtained from TMPD-induced ectopic lymphoid tissue, but not in ec topic lymphoid tissue induced by medicinal mineral oil, which does not induce serum anti-RNP or anti-Sm autoantibodies. Similarly, IgG anti-U1A autoanti body secreting cells were detected in TMPDinduced ectopic lymphoid tissue, but not in mineral oil-induce d ectopic lymphoid tissue (Fig. 36D, right panel). We next compared the frequencies of anti-U1A secreting B cells in the lipogranulomas vs. spleen of mice that were positive for serum anti-RNP autoantibodies (Fig. 36E). A substantial difference in the freque ncy of anti-U1A secr eting B cells in the lipogranulomas vs. the spleen was observed (p = 0.01, Mann Whitney test). There also was a significant difference in the frequencies of ce lls in the lipogranulomas secreting anti-U1A autoantibodies vs. antibodies against a control fo reign antigen, bovine serum albumin (BSA) (p = 0.03), suggesting that autoantibody producing cells may preferentially localize to or develop within the ectopic lymphoid tissue. These experiments indicate that class-switc hed autoantibody producing cells were present within the ectopic lymphoid tissu e and were secreting autoantibodi es. Taken together, the data in Figures 3-5 and 3-6 suggest that the increased polyclonal IgG as well as the IgG anti-RNP autoantibodies in the sera of TMPD-treated mice are likely to be at least partially derived from B cells/plasma cells in the ect opic lymphoid tissue.

PAGE 73

73 Discussion Structures m orphologically and developmenta lly resembling secondary lymphoid organs (ectopic lymphoid tissue) form at the site s of chronic inflammation, a process known as lymphoid neogenesis (95, 98, 103). There is a st rong association of lymphoid neogenesis with humoral autoimmunity (98). However, the role of ectopic lymphoid tissue in initiating immune/autoimmune responses, as opposed to serving as a reservoi r for B lymphocytes previously activated elsewhere, has not been fu lly defined. In NZB/W lupus mice, plasma cells are activated in the spleen and secondarily migrat e to inflamed tissues, such as the kidney (117, 124), whereas in patients with rheumatoid arthritis or Sjogrens syndrome ectopic lymphoid tissue may represent a site of antigen-dependent B cell differentiation consistent with a true germinal center reaction (110, 111, 138). Intraperitoneal exposure to TMPD induces lupus in mice (18, 26) with formation of ectopic lymphoid tissue (63) consisting of lipogranulomas, discrete nodules attached to the mesothelial lining of the peritoneal cavity (118). In certain strains of mice, notably BALB/cAnPt, plasma cell neoplasm s develop in the lipogranulomas after several months (151). Closer examination shows that the lipogran ulomas morphologically resemble secondary lymphoid tissue, with discrete B cell and T cel l-dendritic cell rich zones, MECA-79+ high endothelial venules, and the expression of an a rray of lymphoid chemoki nes characteristic of developing lymphoid tissue (63). Following im munization, T cells and B cells specific for exogenous test antigens (NP-KLH and NP-OVA) are enriched in TMPD-lipogranulomas and individual lipogranulomas frequently contain monoclonal popul ations of proliferating NPspecific B cells along with prolifera ting carrier specifi c T cells (120). The objective of the current st udy was to see if autoimmune responses can develop within foci of chronic inflammation in lupus. T and B cell proliferation and AID expression as well as

PAGE 74

74 SHM and CSR of immunoglobulin genes were found in TMPD-induced lipogranulomas. In addition, we report that B cells actively secreting a prototypi cal lupus autoantibody, anti-U1A, are enriched in the ectopic lymphoid tissue (Fi g. 3-6E). A key question is whether the local production of these autoantibodies is stimulated by cognate T-B interactio ns within the ectopic lymphoid tissue (consistent with a germinal center reaction) or by antigen-independent mechanisms, such as TLR signaling. Although un like germinal centers, TMPD-induced ectopic lymphoid tissue did not contain FDC-M1+ follicular dendritic cells (FDCs) (Fig. 3-1A), FDCM1FDCs have been described (152). In humans, FDCs have been reported in lymphoid neogenesis arising in the stomach, rheumatoid synovium, salivary glands, and other locations (100, 107, 153), ra ising the possibility that the germinal center-like structures found in these sites are sites of cognate T-B interaction involved in autoantibody pr oduction. Conversely, autoantibodies can be produced extrafollicularly by B cells located at the border between the T ce ll zone and the red pulp of the spleen (113, 154, 155). This is a site where T cell-independent responses to foreign antigens occur and it has been shown that in AM14 rheumato id factor transgenic mice, the activation of autoantibody production requires TLR signaling but not T cells (156). The presence of AID and circle intermedia tes in TMPD-induced ectopic lymphoid tissue (Fig. 3-2) strongly suggests that B cell activation occurs locally. AID, an enzyme required for CSR and SHM (157, 158), is expressed in germinal centers (159). In a ddition, the presence of circle transcripts (Fig. 3-2C), transient intermediates of CSR, that at least in vitro disappear within 48 hours of being generate d (145) strongly suggests that the ectopic lymphoid tissue is a site of CSR, arguing against the possibility that isotype switch ed B cells secondarily migrate there. However, although the pres ence of circle transcripts is s uggestive of local CSR, we cannot

PAGE 75

75 at present exclude the po ssibility that circle tr anscripts are degraded more slowly under in vivo conditions. In addition, although characterist ic of germinal center reac tions, AID expression and CSR can be induced in B cells by TLR signaling ( 160-162). Thus, even though B cell activation occurs locally, since the U1 small ribonucleoprotein carries an endogenous TLR7 ligand (163), we cannot completely exclude the possibility that anti-Sm/RNP auto antibody production in the ectopic lymphoid tissue is antige n-independent and driven by TLR7 signaling, as has been reported for other autoantibodies. For instance, when injected with an IgG2a anti-chromatin antibody, AM14 transgenic mice deficient in T cell receptors generate AM14 (rheumatoid factor) antibody forming cells at frequencies comparable to those in TcR sufficient controls (156). The T cell independent activation of these autoantibody producing cells is mediated by dual engagement of the B cell receptor and Toll-like receptors. However, TLR signaling in TMPDinduced ectopic lymphoid tissue was insufficient to drive significant IgM or class-switched (IgG1, IgG2a) anti-Sm/RNP autoantibody producti on or SHM in TcR deficient mice (Fig. 3-6, Table 3-2), consistent with the possibility that cognate interactions be tween anti-Sm/RNP B and T cells take place in the ectopi c lymphoid tissue, as also ap pears to be the case following immunization with exogenous antigens (120). Examination of the immunoglobulin repertoire s in individual li pogranulomas provides further evidence for the local act ivation of antigen-specific B cel ls within the ectopic lymphoid tissue. If B cells activated elsewhere secondari ly populate the ectopic ly mphoid tissue, different lipogranulomas might exhibit part ially overlapping B cell repertoire s, whereas if local expansion occurs (as suggested by B cell proliferation in the lipog ranulomas, Fig. 3-1), the B cell repertoire should differ from lipogranuloma to lipogranuloma. In most cases, different B cell repertoires

PAGE 76

76 were found in the individual lipogranulomas fr om the same mouse. We did not identify immunoglobulin VH-D-JH sequences that were unequivocally shared by more than one lipogranuloma. In two cases (one from a TMPD treated mouse and one from a mineral oil treated mouse) identical V-D-J sequences were ob tained from two different granulomas (Figs. 33-3-4). However, due to the germline confi guration of these sequences, it could not be determined whether they were derived from i ndividual B cell clones or from two B cells that independently rearranged the same V-D-J. Si milarly, the L-chain sequ ences from individual lipogranulomas did not overlap (data not shown). Strikingly, the B cell repertoire in individual lipogranulomas becomes highly oligoclonal following immunizati on with a foreign antigen (NPKLH or NP-OVA) concomitant with the appearance of proliferating carrier-specific T cells in the same location (120). We conclude that autoantibody-secreting B cells most likely are activated locally within the ectopic lymphoid tissue. This activation may be dependent on cognate interactions with local antigen-speci fic T cells, although the possibility of T cellindependent, TLR-mediated B cell activation cannot be completely excluded. Further studies of the relative importance of T cells and TLR7 si gnaling for activating an ti-Sm/RNP B cells in ectopic lymphoid tissue may help elucidate why ectopic lymphoid tis sue is associated with a wide variety of humoral autoimmune disord ers, including Hashimotos thyroiditis (99), myasthenia gravis (135), multiple sclerosis (164) rheumatoid arthritis (110, 111), and Sjogrens syndrome(100, 108). Ectopic lymphoid tissue in TMPD lupus is a site of exuberant chronic Type I interferon production (63), which is re quired for the development of anti-Sm/RNP autoantibodies (40). The enrichment of anti-Sm/RNP B cells in the ectopic lymphoid tissue vs. spleen (Fig. 3-6E) highlights the potential importance of chronic inflammation in the pathogenesis of lupus autoantibodies, raising the possibility that ectopic lymphoid tissue

PAGE 77

77 formation (165, 166) or other forms of chroni c inflammation (167) may be involved in the production of autoantibodies in human SLE as well in TMPD-lupus. Figure 3-1. B and T cell prolifer ation in lipogranulomas. A, Immunohistochemistry of a TMPDinduced lipogranuloma (serial sections) de monstrating the presence of contiguous B cell (B220+) and T cell (CD3+) zones as well as cellular proliferation, as demonstrated by Ki-67 staining. Bottom right panel shows the absence of cells staining with the follicular dendritic cell ma rker FDC-M1 (FDC). B, Flow cytometry of lipogranuloma cells. Gates were set on either the B cells anti-CD45R (B220) or T cells (anti-CD4) and the percentage of ce lls staining with anti-Ki67 antibodies was determined. C, In vivo BrdU labeling of T and B cells in the lipogranulomas and spleens of TMPD-treated mice. Single cell suspensions were stained with antiCD45R (B220), anti-CD3, and anti-BrdU antibod ies. Data are expressed as the % of BrdU+ B cells or T cells, respectively.

PAGE 78

78 Figure 3-2. TMPD lipogranulomas contain class switched B cells A, Lipogranulomas express AID. Left, cDNA from TMPD or mineral oil lipogranulom as, spleen, or peritoneal cells was amplified using primers specific for AID or -actin and analyzed by agarose gel electrophoresis. Right, AID mRNA wa s quantified by real-time PCR normalized to 18S RNA. B, and H-chain transcripts. Lipogr anuloma and spleen cDNA from mineral oil or TMPD treated mice was test ed for expression of IgM and IgG1 by PCR using VHF1-8 and C or C 1 reverse primers, respectively. Left, agarose gel of amplified PCR products from lipogranulomas or spleen. 1 transcripts are seen strongly in two TMPD lipogranulomas (TMPD, lanes 1 and 4) and weakly in another (TMPD, lane 3). Right, frequencies of IgM and IgG1 production in TMPD vs. mineral oil lipogranulomas (4 individual lipogranulomas/mouse, 3 mice/group). C, Circle transcripts. Presence of isotype specific I promoter-C 2a transcripts in lipogranulomas from TMPD-treated but not in mineral oil treated mice. Circle transcripts were detected using I 2aF forward primer and C R reverse primer. PCR product sizes closely approximated the expected sizes of 458 and 318 bp (15) (arrows). PCR using -actin primers was used as a loading control. D, Direct immunofluorescence for Ig M (top) and IgG (bottom) producing cells in lipogranulomas from mineral oil or TMPD -treated mice. Both IgM and IgG producing cells were detected in ectopic lymphoid tissue from TMPD-treated mice, but only IgM producing cells in tissue from mineral oil-treated mice.

PAGE 79

79 Figure 3-2. Continued

PAGE 80

80 Figure 3-3. Individual TMPD-induc ed lipogranulomas contain distin ctive populations of B cells. A, pooled forward primers (VHF1-8) and consensus reverse primer (VHR2) used for amplifying cDNA from lipogranulomas. B, H-chains recovered from lipogranulomas obtained from TMPD-treated BALB/c mice. Lipogranulomas #137, 139, and 140 were isolated from the same mouse. Lipogranulomas #190 and 193 were from a second mouse and lipogranulomas #201 and 204 from a third mouse. C, H-chains recovered from two lipogranulomas (#149 a nd 150) obtained from a mineral oiltreated BALB/c mouse.

PAGE 81

81 Figure 3-4. VH sequences from TMPD-induced lipogranulomas. A, Sequence alignments of VH36-60-DFL16.1-JH4 H-chains isolated from lipogranulomas #137 and 139 (two individual lipogranulomas from a single TM PD-treated mouse). Sequences obtained from the two different granulomas were unrelated, whereas the 6 sequences in granuloma #137 were identical. B, Seque nce alignments of J558.f-DSP2.9-JH2 Hchains isolated from two different lipogr anulomas (#149 and 150) from a mineral oiltreated mouse.

PAGE 82

82 Figure 3-5. IgG1 and IgG2a induced hypergammagl obulinemia in TMPD-treated mice is T cell dependent. A, Serum samples were obtained from wild t ype C57BL/6J (WT, n = 5) or B6.129P2-Tcrbtm1MomTcrdTm1Mom (n = 6) mice treated 3 months earlier with TMPD. IgG1, IgG2a, IgG3, and IgM leve ls were measured by ELISA and means were compared by the Mann-Whitney test. B, IgG production in lipogranulomas. Lipogranuloma cells and splenocytes from tw o mice were tested in quadruplicate for T cell dependent immunoglobulin secret ion (IgG1+ IgG2a+IgG2b) by ELISPOT assay. C, Quantification of plasmablasts in spleen and lipogranulomas. Pooled lipogranuloma and spleen cells from four TMPD-treated BALBc/J mice were stained with anti-B220 and anti-CD138 antibodi es and analyzed by flow cytometry.

PAGE 83

83 Figure 3-6. Ig G anti-nRNP/Sm autoantibody pr oduction in TMPD-treated mice is T cell dependent. A and B, Serum samples were obt ained from wild type C57BL/6J (WT, n = 5) or B6.129P2-Tcrbtm1Mo mTcrdTm1Mom (n = 6) mice treated 3 months earlier with TMPD. IgM (A) and IgG (B) anti-nRNP/Sm antibody levels were measured by ELISA at a 1:500 serum dilution. Means we re compared by the Mann-Whitney test. C, Reactivity of sera with recombinant U1 -A protein (ELISA). Recombinant 6Histagged U1-A protein was expressed in E. coli and purified on a Ni-NTA affinity column. Sera from 20 TMPD-treated BALB/c mice positive for anti-Sm/RNP autoantibodies and 20 normal BALB/c mouse se ra were tested for reactivity with the recombinant antigen at a 1:100 dilution ( ELISA). D, IgM and IgG ELISPOT assay with purified U1-A antigen using cells is olated from collagenase treated ectopic lymphoid tissue from an anti-RNP positiv e TMPD-treated mouse or an anti-RNP negative mouse treated with medicinal mineral oil. Representative of 3 experiments. E, IgG ELISPOT assay with purified U1-A or bovine serum albumin (BSA) antigens, using cells isolated from lipogranulomas (Lipogran) or spleens of anti-U1-A positive mice (n = 5). The frequencies of antig en-specific spots are expressed per 50,000 B cells. The frequency of anti-U1-A spots was higher in lipogranulom as than in spleen (P = 0.01, Mann-Whitney test) and the freque ncy of anti-U1-A spots was higher than the frequency of anti-BSA spots (P = 0.03, Mann-Whitney test).

PAGE 84

84 Figure 3-6. Continued.

PAGE 85

85 Table 3-1. Somatic hypermutation of H-chains from ectopic lymphoid tissue Treatment # of sequences # of mice # of lipogranulomas FR R FR S CDR R CDR S R/S FR R/S CDR TMPD 20 2 4 66 39 72 10 1.7 7.2 Mineral oil 20 2 4 23 11 16 2 2 8

PAGE 86

86 Table 3-2. Somatic hypermutation in ectopic lymphoid tissue from TcR deficient mice Framework CDRs R/S ratio Strain # of lipogranulomas # of sequences R (%) S (%) R (%) S (%) FR CDR WT* 2 6 0.08 0.32 1.30 0.50 0.25 2.5 TcR KO 4 12 0 0 0.13 0 0 ***

PAGE 87

87 CHAPTER 4 MAINTENANCE OF ANTI-SM/RNP AU TOANTIBODY PRODUCTI ON IN EXPERIMENTAL LUPUS BY PLASMA CELLS RESIDING IN ECTOPIC LYMPHOID TISSUE AND MEMORY B CELLS RESI DING IN THE BONE MARROW Introduction Lym phoid neogenesis, the formation of ectopic (tertiary) lymphoid tis sue in response to inflammation (103), is associated with the production of autoan tibodies in several diseases including Sjogrens syndrome, rheumatoid arthritis, and myasthenia gravis (112, 135, 168). It remains unclear whether ectopic lymphoid tissue part icipates directly in generating autoreactive B cells or indirectly as a reservoir for antibody-secreting cells. Lymphoid neogenesis recapitulates many aspects of secondary lymphoi d tissue development (95). Approximately 3 months after intraperitoneal exposure of non-lupus prone mice to 2, 6, 10, 14 tetramethylpentadecane (TMPD), ectopic lymphoid tissue (lipogranulomas) form and the mice develop lupus (63). Autoantibodies are produ ced against the U1, U2, U4-U6, and U5 small nuclear ribonucleoproteins (snRNPs) (anti-Sm and anti-RNP) as well as proteins associated with micro RNAs (anti-Su) and dsDNA (18). Ec topic lymphoid tissue induced by TMPD is organized in to T and B cell zones, is vascul arized by high endothelial venules, and expresses high levels of chemokines that attract T cells and dendritic ce lls (CCL19, CCL21), as well as B cells (CXCL13) (18). B cells in this ectopic lymphoi d tissue exhibit many of features reminiscent of a germinal center response, including class switch recomb ination and expression of activation-induced cytidine deaminase(37). After primary immuniza tion with exogenous antig en, antigen-specific B and T lymphocytes home to the ectopic lymphoid tissue and there activel y secretes of classswitched, antigen-specific immunoglobulin (120). Interestingly, IgG anti-RNP (U1-A) autoantibody-secreting cells also are enriched in the ectopic lymphoid tissue (37) The

PAGE 88

88 relationship between these cells a nd the persistent anti-U1A auto antibody levels in the serum is at present unknown. Long-term serological memory can be mainta ined by several mechan isms: 1) long-lived plasma cells, normally found in the bone marrow, may continue to secrete antibodies for many years (169); 2) memory B cells may be continuo usly stimulated by antigen-specific T cells to undergo differentiation into short-lived plasma ce lls, which secrete antibodies and then undergo apoptosis after ~ 1-2 weeks ( 126, 170); or 3) memory B cells may be driven polyclonally through Toll-like receptor stimulation to develop into short-lived plasma cells (171, 172). The objective of this study was to examine how auto antibody responses to th e Sm/RNP autoantigen (anti-U1A autoantibodies) are maintained in TM PD-induced lupus and to evaluate the role played by chronic inflammation and ectopic lym phoid tissue in the pers istence of autoantibody formation. The data suggest that ectopic lymphoi d tissue is enriched in both longand shortlived plasma cells producing anti-U1A autoantibodi es, but nearly devoid of anti-U1A memory B cells. Unexpectedly, the bone marrow of TMPD-tre ated mice proved to be a major reservoir of anti-U1A memory B cells and contai ned very few anti-U1A plasma cells. Methods and Materials Mice Six-week-old fem ale C57BL/6, BALBC/J, CB.17, and T cell transgenic C.Cg-Tg (DO11.10)10Dlo/J (DO11.10) mice were purchased from Jackson Laboratory (Bar Harbor, ME) and housed in barrier cages. At 2 months of age, C57BL/6, BALBC/J, CB.17, and DO11.10 mice received 0.5 ml of TMPD (Sig ma-Aldrich, St. Louis, MO) or mineral oil (Harris Teeter) i.p. or left untreated. Three m onths later, lipogranulomas were harvested for transplantation. These studies were approved by the Institutional Animal Care and Use Committee.

PAGE 89

89 Lipogranuloma Transplantation For transplantation, TMPD-indu ced lipogranulom as were harvested from mice confirmed by ELISA to be producing anti-U 1A antibodies. Recipient mice underwent an upper midline laparotomy beginning at the mid-abdominal regi on and terminating superiorly at the xiphoid process. The harvested donor lipog ranulomas were then transplant ed onto the lateral aspect of the peritoneal surface of the right and left costo-diaphramatic junctions using a 6-0 polypropylene monofilament suture. The midline laparotomy was re-approximated with interrupted subcutaneous monofilament sutures and the overl ying skin secured with surgical wound clips. Mice received 1 mL of physiolo gical saline for resuscitation at transplant completion. When indicated, mice also receiv ed lipogranuloma tissue subcutaneously or intraperitoneally without any suture to hold it in place. Sham pro cedures were carried out with a midline laparotomy and placement of a 6-0 pol ypropylene monofilament suture on the lateral aspect of the peritoneal surface of the right and left costo-diaphramatic junctions. Shamtransplanted mice also received at the termination of the procedure. Flow Cytometry Cell suspensions from transplanted lipogranul oma or recipients sp leens were analyzed using annexin 5-7AAD staining (apoptotic cell kit, BD). T cells were analyzed with anti-CD3, anti-CD4, anti-B220, anti-CD11b, anti-CD25, antiIgMa and anti-IgMb antibodies (BD Biosciences, San Jose, CA) and anti-Foxp3 antib odies (eBioscience, San Diego, CA). DO11.10 T cells were identified using anti-DO11.10 (KJI-26)-APC antibodies (Invitrogen, Caltag Laboratories, Carlsbad, CA). Data were acqui red on a CyAn ADP flow cytometer (Dako, Fort Collins, Colorado) and analyzed with FCS E xpress Version 3 (DeNovo Software, Thornhill, Ontario, Canada). At least 50,000 events per sa mple were acquired and analyzed using size gating and Sytox blue (Invitrogen ) to exclude dead cells.

PAGE 90

90 Anti-U1A (RNP) ELISA The ELISA was carried out as described prev iously, using 6-His tagged recom binant U1A protein expressed in E. coli (5 g/ml) as antigen(37). Serum samples were tested at a 1:250 dilution followed by incubation with alkaline phosphatase-labeled goa t anti-mouse IgG (1:1000 dilution) or biotinylated IgG2aa, IgG2ab, IgMa, or IgMb (BD Biosciences, 1 hr at 22C), a 45 minute incubation with neutralite-avidin (S outhern Biotechnology, Birmingham, AL), and development with p-nitrophenyl phosphate substrat e (Sigma-Aldrich). Optical density at 405 nm (OD405) was read using a VERSAmax microplat e reader (Molecular Devices Corporation, Sunnyvale, CA). Detection of Autoantibodies by Immunoprecipitation The presence of anti-Sm/RNP autoantibodies was confirm ed by i mmunoprecipitation of [35S]-labeled cellular proteins and analyzed on a 12.5% SDS-pol yacrylamide gel as described (18). Reverse Transcriptase-Polymera se Chain Reaction (RT-PCR) Total RNA was precipitated with isopropanol an d the pellet washed with cold 75% (v/v) ethanol and resuspended in diet hyl pyrocarbonate-treated water. One g of RNA was reverse transcribed to cDNA using Superscript First-Stra nd Synthesis System for RT-PCR (Invitrogen). One l of cDNA was added to the PCR mixtur e containing PCR buffer, 2.5 mmol/L MgCl2, 400 mol/L dNTPs, 0.025 U of TaqDNA polymerase (Invitrogen), and 1 mol/L each of forward and reverse primers in a 20-l volume. Primer s were as follows: CXCL21 forward 5'-ATG ATG ACT CTG AGC CTC C-3' and reverse 5' -GAG CCC TTT CCT TTC TTT CC-3'; CXCL13 forward 5'-ATG AGG CTC AGC ACA GCA AC -3' and reverse 5'-CCA TTT GGC ACG AGG ATT CAC-3'. 18s forward 5'-CGGCTACCACATCCAAGGAA-3' and reverse 5'GCTGGAATTACCGCGGCT-3'. Amplification was for 5 min at 94C, followed by 35 cycles

PAGE 91

91 of denaturation at 94C for 1 min, annealing at 60C for 1 min, extension at 72C for 1 min, and a final extension of 72C for 10 min in a PTC-100 programmable thermal controller (MJ Research, Inc., Waltham, MA). PCR pr imers were synthesized by Invitrogen. Quantitative PCR Gene expression was quantifie d by real-tim e PCR. One l of cDNA was added to a mixture containing 3.75 mmol/L MgCl2, 1.25 mmol/L dNTP mixture, 0.025 U of Amplitaq Gold, SYBR Green dye (Applied Biosystems, Foster City, CA), and optimized concentrations of specific forward and reverse primers an a final volume of 20 l. CXCL12 primers were as follows: forward 5'-TGC TCT CTG CTT GCC TCC A-3' and re verse 5'-GGT CCG TCA GGC TAC AGA GGT-3' and 18s (see above). Amplifi cation conditions were 95C (10 min), followed by 45 cycles of 94C (15 sec), 60C (25 sec), 72C (25 sec), and a final ex tension at 72C for 8 minutes using a DNA Engine Opticon 2 continuo us fluorescence detector (MJ Research). Transcripts were quantified using the comparative (2Ct) method. ELISPOT Assay for Anti-RNP Autoantibody Secreting Cells The production of anti-U1A (a subset of anti -RNP) autoantibodies in the ectopic lymphoid tissue was examined by ELISPOT assay as previously described (37). Statistical Analysis. For quantitative variables, differences be tween groups were analyzed by the unpaired Student's t test. Survival curves were an alyzed using the log-rank test. ANA titers and autoantibody levels were compared using the Mann-Whitney U test. Data are presented as means SD. All tests were two-sided, and P < 0.05 was cons idered significant. Sta tistical analyses were performed using Prism 4.0 software (GraphPad Software, Inc.).

PAGE 92

92 Results Antigen-specific B and T lym phocytes, incl uding autoantibody-producing cells, home to TMPD-induced lipogranulomas (120). We asked whether this ectopic lymphoid tissue continues to be functional outside of a chronically inflamed milieu by transplanting lipogranulomas into non-TMPD treated mice. Lipogranulomas were excised from TMPD-treated mice that were seropositive for anti-U1-A auto antibodies (ELISA) and transpla nted into non-TMPD-treated (anti-U1-A negative) recipients After 35 days, the transplanted lipogranulomas had a similar appearance to that of pre-transplant ectopic lymphoid tissue when stained with hematoxylin & eosin (Fig. 4-1A). The transplanted ectopic lymphoid tissue was tight ly adherent to the mesothelial surface of the peritoneum overlying the abdominal musculature. The transplants were vascularized, as determined by the distribut ion of intravenously injected Evans Blue dye (EBD), an intravascular marker, in the lipogra nulomas (Fig. 4-1B). Blue staining of the transplanted lipogranulomas conf irmed that the high endothelial venules in the transplanted ectopic lymphoid tissue (reference) became connected to the hosts circulation. To verify that the cells in the transplanted lipogranuloma remained viable, a single cell suspension was stained with markers of apoptosis and necrosis (annexi n 5 and 7AAD, respectively) and the total cell population was analyzed by flow cytometry (Fig. 4-1C). Although only 50% of the total cells isolated from transplanted lipogranulomas were annexin 57AAD-, this was similar to the percentage of live cells found in pre-transplant lipogranulomas (57% annexin 57AAD-). The percentage of living cells is also comparable to mineral oil-induced lipogranulomas (54% annexin 57AAD-). Thus, not only were the lipogranulom as re-vascularized after transplantation, but they also contained similar numbers of viable cells to those found in pretransplant lipogranulomas.

PAGE 93

93 By flow cytometry, the cellula r composition of transplanted lipogranulomas was similar to that of pre-transplant lipogranulomas. Lymphocyt es in the transplanted lipogranulomas (35 days post-transplant) consisted of 28% CD4+ T cells and 46% B cells vs. 24% and 51%, respectively in non-transplanted lipogranulomas (Fig. 4-1D). The percentages in lipogranulomas and spleen were similar. Similarly, the percentages of CD 11b+B220cells (monocytes) in the transplanted and pre-transplant lipogranulomas were similar (11% and 10%, re spectively), but less than the percentage in the spleen (3.4%). These data suggest that the compos ition of preand posttransplant ectopic lymphoid tissue is similar. Lipogranulomas contain autoantibody-secreting cells that can be detected using ELISPOT assays (37). To evaluate the functionality and ultimate fate of these cells following transplantation of lipogranulomas from antiU1A positive TMPD-treated mice, sera were collected from transplant recipients at days 0, 7, 14, and 28 days and the secretion of IgG antiU1A was analyzed by ELISA. Serum anti-U1 A activity was detectable by ELISA and immunoprecipitation in mice receiving TMPD li pogranulomas starting at day 7-14 posttransplant and increased up to 28 days post-transplant (Fig. 4-2A ). These autoantibodies also could be detected by immunoprecipi tation (Fig. 4-2B). In cont rast, mice transplanted with mineral oil (anti-U1A negative) lipogranulomas or mice transplanted subcutaneously with TMPD lipogranulomas did not develop detectable levels of anti-U1A by 28 days (Fig. 4-2A). Likewise, sham transplanted mice did not develop anti-U1A autoantibodies. To determine if autoantibody production by th e transplanted ectopic lymphoid tissue is affected by the chronic inflammatory response, mi ce were pre-treated with TMPD or mineral oil 2 weeks prior to transplantation with lipogranulomas from anti-U1-A positive donors (Fig. 42C). In comparison with untreated controls, the strong inflammatory response induced 2 weeks

PAGE 94

94 after TMPD treatment (69) did not increase serum auto antibody levels in the recipient mice, nor did mineral oil pre-treatment. To verify that pre-treatment with TMPD or mineral oil did not induce anti-U1-A autoantibody pro duction independently of the tr ansplanted ectopic lymphoid tissue sham-transplanted mice also were pre-treate d with TMPD or minera l oil. These control mice did not produce anti-U1-A auto antibodies. Anti-U1-A remained detectable in the serum of the mice transplanted with lipogranulomas from TMPD-treated donors up to 60 days afterward (Fig. 4-2C). In contrast, th e TMPD pre-treated sham mice be gan to produce anti-U1A by day 60 post-transplant (80 days after TMPD pre-treatmen t), consistent with previous observations that TMPD treated mice develop an anti-Sm/RNP re sponse at ~ 3 months post-treatment (18). Despite the production of Sm/RNP autoantibodi es, recipient mice failed to develop kidney disease, as indicated by measurem ent of proteinuria (Fig 4-2D). These data suggest that the transplanted ectopic lym phoid tissue contains long-lived pl asma cells producing anti-U1A autoantibodies or else that it is capable of generating new short-lived plasma cells capable of secreting anti-U1A autoantibodies. To examine the role of T cells in the production of autoantibodies in the transplanted mice, we transplanted U1A+ lipogranulomas from BALB/c mice into BALB/c CD4 T cell transgenic DO11.10 mice. Surprisingly, serum anti-U1A autoantibody levels were higher in DO11.10 recipients than in wild type controls (P = 0.02, Mann-Whitney; Fig. 4-3A). Using an antibody against the transgenic T cells (KJI-26), we found that by 35 days after transplantation, donor lipogranulomas were repopulated with large numbers of recipient T cells (Fig. 4-3B, C). Approximately 75-80% of the CD4+ T cells in the transplanted lipogra nulomas were of donor (transgenic) origin, a percentage similar to that seen in the spleen. The transplanted lipogranulomas expressed the T cell attractive chemokine CXCL21 (Fig. 4-3D), which may

PAGE 95

95 mediate the influx of recipient T cells into the tr ansplant. These data suggest that nave T cells may transit through the transplanted ectopic lym phoid tissue in a manner analogous to that in authentic secondary lymphoid tissue. The increased levels of serum anti-U1A auto antibodies in OVA-specific TcR transgenic DO11.10 recipients raised the possibility that re cipient regulatory T ce lls might down-modulate anti-U1A autoantibody production. CD4+CD25+FoxP3+ regulatory T ce lls are thought to down-regulate autoantibody production in some circ umstances (173), and the numbers of these cells in the lipogranulomas increased following transplantation (Fig. 4-3E). The percentage of CD4+CD25+FoxP3+ T cells in the lipogranulomas, pr esumably of recipient origin (Fig. 4-3E), increased in 4 out of 4 mice tested before tr ansplantation and again 28 days later (mean 11.12% pre-transplant vs. 21.4% post-tran splant, P = 0.02, Mann Whitney). However, at least at 28 days post-transplantation, the presence of these cell s did not turn off autoantibody production (Fig. 42A). We next examined whether the recipients B lymphocytes also could enter the transplanted ectopic lymphoid tissue. To examine the B cell populations in th e transplanted lipogranulomas, anti-U1A+ lipogranulomas were transplanted from the a llotype congenic CB.17 (Ighb) donors into BALB/c (Igha) recipients. We took advant age of the fact that anti-U1A autoantibodies induced by TMPD are predominantly IgG2a in BALB/c mice (29). Instead of IgG2aa, the CB.17 strain expresses IgG2ab (also termed IgG2c). An IgG2a allotype -specific anti-U1A ELISA, we found that all of the serum anti-U1A autoantibodies in BALB/c mice transplanted with CB.17 lipogranulomas were of donor (CB.17) origin (Fig. 4-4A). Th e level of serum IgG2aa (BALB/c origin) anti-U1A autoantibodies was no different from that of sham transplanted mice. In contrast, IgG2ab

PAGE 96

96 (CB.17 origin) anti-U1A autoantibody levels increased significantly following transplantation, indicating that the anti -U1A autoantibodies were derived ex clusively from the donor B cells. The presence of donor and recipient surf ace IgM+ B cells in the transplanted lipogranulomas was examined 35 days post-transplant (Fig. 4-4B). Pr e-transplantation, the lipogranulomas contained exclusively IgMb (CB .17 donor) B cells. In contrast, by 28 days posttransplantation, these cells were entirely replaced by B cells of recipient origin (BALB/c, IgMa). Post-transplantation, the lipogranulomas containe d significantly more recipient (IgMb) than donor (IgMb) B cells (Fig 4C, P=0.002 Mann-Whitney). Similar to the expression of the T cell attractive chemokine CXCL21 (Fig. 4-3D), the B cell chemokine CXCL13 was expressed in the transplanted lipogranulomas (Fig. 4-4D). Th ese data suggest that within 1 month of transplantation, the donor B and T lymphocytes in the lipogranulom as were largely replaced by lymphocytes of recipient origin. Neverthe less, the serum anti-U 1A autoantibody levels continued to increase over that time and ar e exclusively of donor origin. The simplest interpretation of these data is that the anti-U1A autoanti bodies were produced by long-lived plasma cells or perhaps memory B cells from the transplanted lipogranulomas. To examine the importance of long-lived plas ma cells vs. memory cells in the production of anti-U1A autoantibodies, CD4+ T cells were de pleted in the donors as well as the recipient mice using the CD4-depleting monoclonal an tibody GK1.5. By treating the anti-U1A+ donor mice with GK1.5 four days prior to surgery nearly all CD4 T cells could be eliminated from the donor lipogranulomas (Fig. 4-5A). Recipient mice were treated with GK1.5 or an irrelevant control antibody at the ti me of surgery and continued to re ceive treatments up to 35 days post surgery. CD4+ T cells remained depleted in the peripheral blood of the recipient mice throughout the 35-day duration of this study, whereas the control antibody had no effect (Fig. 4-

PAGE 97

97 5B). After 35 days, lipogranulomas and spleens were excised from mice that received GK1.5 or control antibody and the numbers of viable (CD4+, Sytox blue-) cells were determined by flow cytometry. As shown in Fig. 4-5C, CD4+ T cells were undetectable in the GK1.5 treated mice. Interestingly, there was a signi ficant decrease in the numbers of CD138+CD44+ plasma cells in the spleen and lipogranulomas of the GK1.5 treated mice (Fig. 4-5D, P = 0.016, Mann Whitney test, for both spleen and lipogranul omas), consistent with the presen ce of short-lived plasma cells in both locations. In contrast, depletion of CD4+ cells had little effect on the levels of serum IgG anti-U1A autoantibodies in transplanted mice (F ig. 4-5E), suggesting th at the serum anti-U1A autoantibodies in the transplanted mice were derived from a population of long-lived plasma cells. It has been demonstrated that the half -life of IgG antibodies in an adult mouse is 3 weeks(174). Thus, if the antibody was generate d by a plasma cell prio r to transplantation, antibody levels would be reduced by at least half 35 days post transplant. We next examined whether depleting CD4+ T cells had any effect on anti-Sm/RNP autoantibody production in non-transplanted TM PD-treated mice. Induction of anti-Sm/RNP and anti-U1A autoantibodies by TMPD is abolished in nude mice and in T cell receptor deficient mice (37, 123). However, the role of T cells in maintaining autoantibody production once it has been established has not been examined. We therefore administered GK1.5 monoclonal antibodies weekly to U1A+ TMPD treated mice. Peripheral blood CD4 counts were monitored every 7 days to verify depletion of all CD4+ cells (data not shown). After 35 days of GK1.5 treatment, lipogranuloma and spleen were harves ted and the presence of live CD4 T cells was determined by flow cytometry. As shown in Fig. 4-6A, the lipogranulomas and spleen did not contain any CD4 T cells. Followi ng GK1.5 treatment there was a re duction in the percentage of CD44+CD138+ plasma cells in th e spleen, but in contrast to the transplanted lipogranulomas,

PAGE 98

98 this was not seen in non-transpla nted lipogranulomas (Fig. 4-6B). Depletion of CD4+ T cells resulted in a substantial decrease in the levels of serum IgG anti-U1A autoantibodies at 35 days (Fig. 4-6C). Serum levels of IgG anti-U1A were compared between day 0 and day 35 from individual mice treated with GK1.5 or control an tibody. Despite the significant decrease after T cell depletion, serum IgG anti-U1A was still detectable (Fig. 4-6C). Anti-U1A activity remained significantly higher than background leve ls in non-TMPD-treated mice. This may be partly because the half-life of murine IgG in adult mice is 3 weeks (174). Since it remained unclear how much anti-U1A autoantibody could be produced de novo in the absence of CD4+ T cells, we examined the numbers of anti-U1A autoantibody producing cells in TMPD-treated mice receiving GK1.5 antibodies. Memory B cells, bu t not plasma cells, can be stimulated to secrete antibody in vitro in th e presence of LPS (171, 172). Th erefore, B cells from the lipogranulomas, spleen, or bone marrow of TM PD-treated, anti-U1A+, mice cultured in the presence or absence of LPS (5 g/mL) followed by assessment of the numbers of anti-U1A secreting cells by ELISPOT (Fig. 4-6E). In both the spleen and bone marrow, the number of IgG anti-U1A spots increased significan tly in the presence of LPS, consistent with the presence of a memory B cell population. In contrast, the number of spots in the lipogranulomas was unaffected by LPS, suggesting that memory B cells in the ectopic lympho id tissue could not be activated by TLR4 ligand to become AFCs. However, when T cells were depleted using GK1.5 antibodies, the number of anti-U1A spots in lipogranulomas was decreased (P = 0.007 vs. treatment with control antibody, Mann Whitney test Fig 4-6D). Thes e data suggest that the antiU1A autoantibody response in the ectopic lymphoid tissue was partly T cell dependent and partly T cell independent. The T cell dependent fractio n apparently was not derived from a population of B cells/plasma cells capable of being stimulat ed by LPS. In contrast, the T cell independent

PAGE 99

99 production of anti-U1A autoantibodies could be enhanced by TLR stimulation. The situation was similar in the spleen, there was an increase in the number of anti-U1A spots following LPS treatment. In contrast to the lipogranulomas and spleen, very few spontaneous anti-U1A secreting cells were detected in the bone marrow. However, following stimulation with LPS, large numbers of anti-U1A secreting B cells were found. Their numbers were unaffected by GK1.5 antibody treatment (Fig. 4-6D). A striking and unexpected obser vation of the ELISPOT experi ment (Fig. 4-6D) was the absence of anti-U1A secreting cells in the bone marrow, a major site for the accumulation of long-lived plasma cells (175). To examine whethe r the absence of plasma cells was unique to autoantibody producing cells or a more genera l phenomenon, we determined the number of CD138+sIgMplasma cells in the bone marrow of TMPD-treated vs. untreated mice or TMPDtreated IFNAR -/mice which do not develop au toantibodies. As shown in Fig. 4-7A, the number of plasma cells was substantially lower in the two TMPD-treated groups. The expression of CXCL12 (real-time PCR) also wa s much lower in the bone marrow of TMPD treated mice vs. untreated controls (Fig. 4-7B ). Expression of CXCL12 was seen in the lipogranulomas from TMPD-treated mice, although it was lower than that seen in untreated bone marrow. These data suggest that TMPD treatment may lead to the depletion of mature plasma cells from the bone marrow by reducing the expr ession of CXCL12. Additionally, expression of CXCL12 in the ectopic lymphoid tissue may promote the recruitm ent/retention of long-lived plasma cells in the lipogranulomas. Discussion Ectopic lymphoid tissue (lipogranulom as) indu ced by i.p. injection of TMPD is a site where antigen-specific B and T lymphocytes accumulate and auto antibody secreting cells (ASC) can be detected readily (120). Here, we show that when this ectopic lymphoid tissue was

PAGE 100

100 transplanted into a non-TMP D treated recipient, autoan tibody production by donor ASC continued for up to 2 months but there was no ge neration of autoantibody-producing host B cells. At the same time, the activated (CD69+) donor B cells within the ectopic lymphoid tissue were replaced by host B and T lymphocytes exhibiting a resting (CD69-) phenotype (Fig 4-8B). Using CD4 depletion and LPS stimulation, whic h respectively decrease or increase plasma cell differentiation of switched memory B cells while having little effect on mature plasma cells (170), we found that plasma cells were the main ACSs in the ectopic lym phoid tissue (Figs. 4-5E and 4-6E-4-6F). T cell depletion had little eff ect on serum anti-U1A antibody levels (Fig. 4-5D), but reduced the numbers of CD138+CD44+ plasma cells (Fig. 4-5D), consistent with the presence of both long-lived plasma cells (una ffected by GK1.5 mAb treatment) and short-lived plasma cells, which require T cell help to be ge nerated from precursor memory cells (170). TMPD treatment induced remarkable cha nges in the distribution of autoantibodyproducing plasma cells and memory B cells, some of which (activated CD69+ B cells in the ectopic lymphoid tissue) were IFN-I dependent a nd some (redistribution of long-lived plasma cells) IFN-I independent. In addition, we iden tified the bone marrow of TMPD-treated mice as an important reservoir of autoreactive memory B cells. TMPD-stimulated ectopic lymphoid tissue formation may promote autoantibody produc tion through the persis tent recruitment of IFN-I secreting monocytes promoting lymphocyt e activation and by providing survival niches for autoantibody-secreting plasma cells. However, the data also raise the possibility that activated B cells from the ectopic lymphoid tissue may generate memory B cells that either home to, or persist in, the bone marrow. Unlike the bo ne marrow plasma cells, which are substantially depleted following TMPD treatment, autoreactiv e memory cells persist in the bone marrow and

PAGE 101

101 may be a renewable pool of switched-memory ce lls capable of developing into autoantibody secreting cells that are attracted/retained in the ectopic lymphoid tissue by CXCL12. Ectopic Lymphoid Tissue is a Major Site of A utoantibody Production in TMPD-Lupus Ectopic lymphoid tissue is asso ciated with autoantibody produc tion in several autoimmune disorders (105). Using the transplant model, ectopic lymphoid tissue can be studied outside of a chronic inflammatory environment, although with the caveat that the immunoglobulin repertoire may vary from lipogranuloma to lipogranuloma ( 120), leading to variability in the anti-U1A levels of different recipient mice. The ectopic lymphoid tissue of TMPD-treated mice was a significant reservoir for plasma cells secreting IgG anti-U1A (anti-RNP) autoan tibodies, with nearly double the number of U1A specific ASC per 100,000 B cells as the spleen (Fig. 4-6). Most of these cells apparently were short-lived plasmablasts/plasma cells derived from the T cell-mediated activation of memory B cells, since they could be depleted with GK1.5 mA b. Consistent with previous reports that longlived plasma cells home to the inflamed kidneys and spleen of NZB/W mice (117), the chronic inflammatory process in TMPD-induced lipogranu lomas also attracted substantial numbers of presumptive long lived plasma cells (unaff ected by 28 days of GK1.5 mAb treatment). However, they were less numerous than shor t-lived plasma cells/pla smablasts (Fig. 4-6). Increased numbers of autoantibody producing plasma cells also have been reported in ectopic lymphoid tissue in Sjogrens syndrome, rheumato id arthritis, and myasthenia gravis (108, 135, 176) Regulation of Autoantibody Production in Transplanted Ectopic Lymphoid Tissue Transplantation of lipogranulom as from an ti-U1A+ mice allowed us to examine the regulation of autoantibody production from ect opic lymphoid tissue in a non-inflammatory/nonautoimmune milieu. The ASCs continued to secr ete autoantibodies exclusively of donor origin

PAGE 102

102 that were detectable in the serum for up to 2 months after transplant ation. Serum autoantibody (anti-Sm/RNP) levels peaked ~1 month after transplant ation, and were then maintained for an additional month (Fig. 4-2C). Since the half-life of murine IgG is less than 3 weeks (174), the data suggest but do not prove that they we re produced by long-lived plasma cells. To further address the origin of anti-U1A autoantibodies we treated TMPD-treated U1A+ mice with GK1.5 and found that serum anti-U1A an tibodies decreased ~60-70%. Nevertheless, some serum autoantibodies remained detectable (Fig. 4-6C-D), suggesting a portion of the IgG anti-U1A activity was maintained by mechanisms that were independent of T cells. These autoantibodies may be derived from long-lived plas ma cells or memory B cells driven to undergo terminal differentiation by TLR ligands (156). In the absence of T cells memory B cells, and not plasma cells, can be stimulated with LPS in vitr o (171). LPS treatment revealed the presence of anti-U1A B cells in the spleen and, unexpected ly, the bone marrow (Fig. 4-6E). However, the number of ASCs in lipogranulomas did not chan ge with LPS stimulation, suggesting that the ectopic lymphoid tissue contained few memory cells. Thus, T cell dependent autoantibody responses in the lipogranulomas resemble ex trafollicular germinal center-like responses developing in the spleen of mice with spontaneous lupus (137, 177). Transplanted lipogranulomas maintained popul ations of T and B lymphocytes strongly resembling those in the spleen and pre-transplant lipogranulomas (Fig. 4-1D ). In contrast, the numbers of monocytes in preand posttransp lant lipogranulomas was approximately 3-fold higher than in the spleen. Before transpla ntation, many of these monocytes are immature (Ly6Chi) cells producing Type I interferon (IFN-I)(69). The activ ation marker CD69 is IFN-I inducible, suggesting that th e IFN-I producing Ly6Chi monoc ytes in lipogranulomas may promote B and T cell activation in the ectopic lym phoid tissue (Fig. 4-8A). This is likely to

PAGE 103

103 represent local, rather than sy stemic, IFN-I production, since the splenic B cells of TMPDtreated mice were CD69(Fig. 4-8A). As Ly6Chi monocytes in TMPD-treated mice have a lifespan of ~3 days and are continuously re placed by Ly6Chi monocytes exiting the bone marrow (69), the loss of CD69+ B cells in the transplanted lipogranulomas (Fig. 4-8B) may reflect diminished recruitment of Ly6Chi IF N-I producing cells from bone marrow precursors due to the absence of peritoneal inflammation in the recipient mice. Production of anti-Sm/RNP autoantibodies in TMPD-lupus is strictly depende nt on IFN-I production that is stimulated by a TLR7 and MyD88-dependent pathway (70). Th e generation of new (recipient-derived) autoreactive B cells in the transplanted ect opic lymphoid tissue may cease because they are starved of IFN-I (Fig 4-8C). Altered Bone Marrow Plasma Cell Homeostasis in TMPD-Treated Mice Chronic inflammation causes profound alterati ons in the bone m arrow, with a marked decrease in lymphopoiesis and a corresponding increase in myeloid precursors (178). The present data suggest that besi des altering lymphopoiesis/myelopoiesis, TMPD treatment also substantially alters the plasma cell compartment. The bone marrow is the major site of survival niches for long-lived plasma cells (179). Howeve r, in contrast to the large number of anti-U1A ASCs inhabiting ectopic lymphoid tissue, they we re nearly quantitatively absent in the bone marrow (Fig. 4-6). There was a similar, but less profound, depletion of total class-switched (IgM-CD138+) plasma cells in the bone marrow. Remarkably, although plasma cells were absent, the bone marrow contained presumptive switched memory B cells that did not secrete IgG anti-U1A autoantibodies spontaneously but could be stimulated to become ASCs by TLR4 ligand (Fig. 4-6). This population is reminiscent of the bone marrow memory s ubset identified previously by Cooper, et al. (180). The functional significance of this subset is at present unknown. Retention of this population of

PAGE 104

104 autoreactive B cells in the bone marrow is unlik ely to involve CXCL12 (181), which is greatly decreased in the bone marrow of TMPD-treated mice (Fig. 4-7B). Consistent with that possibility, we failed to detect these cells in the ectopic lymphoid tissue of TMPD-treated mice (Fig. 4-6D), which expresses larg e amounts of CXCL12 (Fig. 4-7B). We hypothesize that in the presence of T ce lls, memory B cells may migrate into the lipogranuloma from either spleen or the bone marrow and develop extrafollicularly into plasmablasts/plasma cells. After transplanta tion a reservoir of bone marrow/splenic memory cells is no longer present and serum anti-U1A antibodies in the recipients are derived entirely from plasma cells (both longand short-lived ) transplanted along with the ectopic lymphoid tissue. The possibility that ec topic lymphoid tissue is populated by plasma cells derived from a novel subset of autoreactive bone marrow memo ry B cells warrants further investigation.

PAGE 105

105 Figure 4-1. Transplanted lipogranuloma beco me vascularized. (A) Endogenous TMPD-induced or surgically implanted lipogranulomas were removed from BALB/c mice, and 5 m paraffin embedded sections were stained with hematoxylin & eosin. (B) Transplanted recipient mice were injected i.v. with 0.5% Evans blue dye (EBD, n = 5) or left uninjected (n = 3). (C) Transplanted li pogranulomas (n = 6) were removed from recipient mice and analyzed by flow cytome try for dead/dying cells using annexin-5 and 7-AAD staining. (D) Cellular compositi on of spleen and lipogranulomas was evaluated by gating on livi ng cells (annexin-5 and 7-AAD staining). Upper panel, percentages of B cells (B220) T cells (CD4) in the transplanted lipogranulomas compared to pre-transplanted lipogranulomas and spleen. Lower panel, percentages of monocytes (CD11b+, B220-).

PAGE 106

106 Figure 4-2. Serum levels of anti-U1A antibodi es in recipient mice. Serum samples were collected at 7, 14, 28, and 35 days from mi ce either transplanted i.p with U1A+ TMPD-induced lipogranulomas (n = 7), U1 A mineral oil-induc ed lipogranulomas (n = 5), s.c. with U1A+ TMPD-induced lipogranulomas (n = 4), or sham transplanted (n = 4). (A) Sera were tested for IgG anti-U1A antibodies by ELISA. (B) Anti-U1A antibodies in the sera of mice transp lanted i.p with U1A+ TMPD-induced lipogranulomas were detected by immunoprecipitation of [S35 ]labeled cell extract. (C) Mice were injected i.p. two weeks prior to surgery with either TMPD (n = 7) mineral oil (n = 7) or left un-injected (n = 7). Sera collected at days 0, 7, 14, 28, and 60 were tested for IgG anti-U1A antibodies as in (A). (D) Urine was collected from mice and tested by dipstick on days 0, 7, 14, 28, and 55 following surgery. Data are representative of two experiments.

PAGE 107

107 Figure 4-3. Recipient T cells repopulate transplanted li pogranulomas. (A) D011.10 mice received U1A+ lipogranulomas from TMPD treated BALB/c (n = 6). Sera were collected at days 0, 7, 14, 28, 35 following surgery and IgG anti-U1A was assessed by ELISA. (B) Lipogranulomas and spl een were harvested from DO11.10 mice 35 days after transplant and th e percentage of recipient transgenic (CD4+KJI-26+) T cells was detected in each tissue by flow cytometry (gated on lymphocytes and CD4+ cells). (C) Percentages of recipient transgenic T cells (KJI-26+) found in lipogranulomas 35 days after transplant compared with pre-transplant lipogranulomas (P = 0.007, Mann-Whitney test). (D) cDNA from transplanted lipogranulomas (Lipogran) and the spleen or recipien t BALB/c mice was tested for CXCL21 expression by RT-PCR and normalized to 18S rRNA expression (representative of four experiments). (E) Regulatory T cells were analyzed from harvested lipogranulomas pre-transplant and 35 days post-transplant by staining for surface markers CD4+ CD25+ and the intracellular marker FoxP3+ (flow cytometry, n = 4).

PAGE 108

108 Figure 4-4. Anti-U1A antibodies are made excl usively from donor lipogranulomas. (A) U1A+ lipogranulomas from CB.17 (Ighb) mice were transplanted into BALB/c (Igha) recipients (n = 6). Sera were collected at days 0, 7, 14, 28, 35 and IgG2ab (IgG2c) or IgG2aa anti-U1A antibodies were assessed by ELISA. (B and C) Transplanted lipogranulomas or un-transplanted lipogra nulomas from CB.17 mice was harvested at day 35 and the B cells (B220+) were staine d for recipient (IgMa) or donor (IgMb) allotypes (flow cytometry). A representative plot shows the percentage of allotypespecific B cells in transplanted lipogranuloma. Data are representative of two experiments (P = 0.02, Mann-Whitney test). (D) cDNA from a BALB/c transplanted lipogranuloma (Lipogran) or spleen from a recipient mouse was tested for CXCL13 expression (RT-PCR) normalized to 18S rRNA (representative of four experiments).

PAGE 109

109 Figure 4-5. Serum anti-U1A antibodi es in transplanted mice persis t after T cell de pletion. (A) U1A+ lipogranuloma from TMPD treated mi ce were treated with T cell depleting mAb GK1.5 (n = 5, left) or control (Ctl, n = 4, right) antibody. (B) Recipient mice were bled every 7 days and CD4+ T cell de pletion was analyzed by flow cytometry. (C) Lipogranuloma and spleen were exci sed from recipient mice 35 days after transplant and CD4 T cells were examined by flow cytometry GK1.5mAb (shaded) control mAb (open). (D) Plasma cells (C D44+ CD138+) from recipient spleen and transplanted lipogranulomas were analyzed af ter treatment with GK1.5 or control antibody (p = 0.01, Mann-Whitney test). (E) Sera were collected from either GK1.5 or control antibody treated mice at day 0, 7, 14, 28 and 35 post-transplant. Serum IgG anti-U1A levels were assessed by ELISA (data representative of two experiments).

PAGE 110

110 Figure 4-6. IgG anti-U1A antibody le vels are decreased but not abolished after T cell depletion. TMPD treated mice were administered GK 1.5 or control antibody for 35 days. (A) Spleen and lipogranulomas were devoid of CD4+ T cells after GK1.5 treatment (shaded) whereas CD4+ T cells were still present after treating with control antibody (open). (B) Plasma cells (CD44+ CD138+) from GK1.5 and control antibody-treated lipogranulomas and spleen were analyzed by flow cytometry. (C) Serum IgG antiU1A antibodies from TMPD-treated mice pre-GK1.5 or control antibody treatment vs. 35 days post-treatment. The % decrease of IgG anti-U1A post-treatment is shown (p = 0.03, Mann-Whitney test). (D) IgG anti-U1A serum levels from TMPD mice treated with GK1.5 vs. cont rol antibody (p = 0.06, Mann-Wh itney test) or from nonTMPD-treated BALB/c mice (NSC) (p = 0.02, Mann-Whitney test). (E) Lipogranuloma, spleen, and bone marrow we re harvested from TMPD treated mice treated with either GK1.5 or control antibody. B cells we re negatively selected and cultured in the presence or absence of LPS (5 g/ml) for 5 days. IgG anti-U1A antibody production from cultured B ce lls was measured by ELISPOT (* P 0.02; ** P 0.04 Mann-Whitney test).

PAGE 111

111 Figure 4-7. TMPD treatment depletes plasma ce lls from the bone marrow. (A) Bone marrow from TMPD treated BALB/c, IFNAR-/or untreated BALB/c was harvested. The presence of CD138+IgMplasma cells was detected by flow cytmotery (left panel). The percentages of bone marrow plasma ce lls is compared between each group of mice (right panel) ( P 0.02 Mann-Whitney test). (B) Using real-time PCR the amount of CXCL12 was quantified from bone marrow cDNA of each group (P = 0.02; P = 0.03 Mann-Whitney test)

PAGE 112

112 Figure 4-8. The effect of IFN-I on lymphocyte activation. (A) Lipogranuloma and spleen from TMPD-treated were harvested and the act ivated B cells (CD19+CD69+) and T cells (CD4+CD69+) were stained by flow cytometry. (B) Activated B cells (CD19+CD69+) from lipogranuloma pre and post transplant as well as spleen from TMPD-treated or recipient mice was analy zed by flow cytometry. (C) To determine the effect IFN-I has on the production of autoantibodies post transplant, U1A+ lipogranulomas were transplanted into IFNAR -/mice. Sera were collected from at day 0, 7, 14, and 35 post-transplant. Seru m IgG anti-U1A levels were assessed by ELISA (data representative of two experiments).

PAGE 113

113 CHAPTER 5 FUTURE DIRECTIONS B Cells in the TMPD Model Although I have been able to dem onstrate that autoantibodies are secr eted from long lived plasma cells in the lipogranuloma, the generation of these autoantibodies still remains unanswered. It is still uncl ear how tolerance is broken in many autoimmune diseases and specifically in the TMPD model. I have identif ied a subset of B cells (IgM-IgD+) in the TMPDinduced lipogranulomas that differs from both sp leen and mineral oil lipogranulomas (Fig 5-1). Despite having similar number of antibody secret ing B cells (Fig 3-5), the lipogranulomas tend to secrete a smaller amount of antibody (Fig 2-3D) on a per B ce ll basis compared to spleen. Taken together with the finding of fewer CD138+ plasma cells, this IgM-IgD+ B cell subset may have a role in the class switc hed antibody production in the lipogranuloma. A study showed that in the absence of IgM, there is a population (Ig M-IgD+) that is able to secrete class switched antibodies (182). The role and develo pment of this B cell subset needs to be investigated further. I have data showing that only TMPD-indu ced lipogranulomas and not mineral oil lipogranulomas contains activated (CD69+) B ce lls. In addition I demonstrated that after transplant the B cell that repopul ate the lipogranuloma express th e activation marker CD69 (Fig 4-8B ). Follicular dendritic cells (FDC), invol ved in germinal center cen soring of B cells is not found in the lipogranuloma(183). Potentially, the activated B cells in the lipogranulomas are able to expand in the absence of a proper censoring mechanism and may be the cause of the break in tolerance leading to au toimmunity in this model. T Cells in the TMPD Model I have show n that the initial generation a nd persistence of autoantibody production is T cell dependent (chapter 3 and 4). Previous work has shown that in the absence of Th1 cytokines,

PAGE 114

114 the autoantibody response is diminished but not abolished (29). In contrast, deletion of Th2 cytokines resulted in a slight in crease in the Th1 dominated autoantibody response (43). I have some preliminary evidence that TMPD actually dr ives a Th1 response in the lipogranulomas and not in the spleen, sugges ting that the dominant autoreactive IgG2a respons e is possibly generated in the lipogranuloma. Similar to lipogranuloma B cells, there is evidence that T cells in lipogranulomas express higher levels of the activ ation marker CD69 compared to spleen(Fig 48A). In combination with the activated B ce lls this may account for the break in tolerance leading to the generation of autoantibodies. Despite that th e autoantibody response is T cell dependent, it still remains uncerta in if a T cell breaks tolerance first then activates a B cell or vice versa. Bone Marrow in the TMPD Model It has been dem onstrated that in acute in flammatory responses, the bone marrow undergoes extensive myelopoiesis and lymphpoiesis(178). Bone marrow of TMPD treated mice behave similarly to the bone marrow of mice undergoing this acute response. Four months after TMPD injection, the bone marrow still exhi bits an increase in the number of CD11b monocytes in an IFN-I independent manner(Fig 5-2A-5-2B). TMPD increases the inflammatory cytokine IL-1 which expands the bone marrow granulocyte (CD 11b) compartment (184, 185). Conversely, the number of IgM+ B cells and CD138 plasma cells in the bone marrow is decreased compared to control bone marrow. It remains to be investigated if this disr uption of bone marrow architecture is contributing to the pathogenesis of TMPD-induced autoimmunity. Conclusion The work presented revealed a po tential role for ectopic lymphoid tissue in the development of autoimmunity. The B and T ly mphocytes present in th is tissue are not only antigen-specific but capable of generating a de novo immune response le ading to the production

PAGE 115

115 of class switched antibodies. In addition, we have developed a novel transplant model that allows ectopic lymphoid tissue to be studied fu rther in various immunol ogical environments. These studies greatly enhance the understanding of the pathogenesis of the TMPD-induced lupus mouse model. Although ectopic ly mphoid tissue has not been doc umented in human SLE, the TMPD-induced ectopic lymphoid tissue is a us eful model to examine the mechanism of production of autoantibodies in many other autoimmune diseases. Figure 5-1. Lipogranulomas cont ain an increased IgM-IgD+ B cell population. Spleen and lipogranuloma from either TMPD treated or mineral oil were harvested and made into single cell suspensions. Cells were gate d on lymphocytes and the staining for IgM and IgD was analyzed by flow cytometry.

PAGE 116

116 Figure 5-2. TMPD drives an increase in CD11b+ cells in the bone marrow. (A) Bone marrow was harvested from untreated Sv129, TMPD treated Sv129 or IFNRA-/mice. The percentage of CD11b+ myeloid cells in the bone marrow was analyzed by flow cytometry. (B) The total myeloid cell c ount from bone marrow of treated mice.

PAGE 117

117 REFERENCES 1. Heimbach, J. T., A. R. Bodor, J. S. Douglass, L. M. Barraj, S. C. C ohen, R. W. Biles, and H. R. Faust. 2002. Dietary exposures to mine ral hydrocarbons from food-use applications in the United States. Food Chem Toxicol 40:555-571. 2. Stryker, W. A. 1941. bsorbtion of liquid petrolatum ("mineral oil") from the intestine. Arch. Pathol. 31:670-692. 3. Wanless, I. R., and W. R. Geddie. 1985. Mineral oil lipogranulomata in liver and spleen. A study of 465 autopsies. Arch Pathol Lab Med 109:283-286. 4. Potter, M., and C. R. Boyce. 1962. I nduction of plasma-cell neoplasms in 5. Anderson, P. N., and M. Potter. 1969. Inducti on of plasma cell tumours in BALB-c mice with 2,6,10,14-tetramethylpent adecane (pristane). Nature 222:994-995. 6. Nordan, R. P., and M. Potter. 1986. A macrophage-derived factor required by plasmacytomas for survival and proliferation in vitro. Science 233:566-569. 7. Potter, M., and F. Wiener. 1992. Plasmacyto magenesis in mice: model of neoplastic development dependent upon chromosomal translocations. Carcinogenesis 13:16811697. 8. Fattori, E., M. Cappelletti, P. Costa, C. Sellit to, L. Cantoni, M. Care lli, R. Faggioni, G. Fantuzzi, P. Ghezzi, and V. Poli. 1994. Def 9. Shaw, C. M., E. C. Alvord, Jr., and M. W. Kies. 1964. Straight Chain Hydrocarbons as Substitutes for the Oil in Freund's Adjuva nts in the Production of Experimental "Allergic" Encephalomyelitis in the Guinea Pig. J Immunol 92:24-27. 10. Crowle, A. J., and C. C. Hu. 1966. A comp arison of n-hexadecane and mineral oil 11. Whitehouse, M. W., K. J. Orr, F. W. Beck, and C. M. Pearson. 1974. Freund's adjuvants: relationship of arthritogeni city and adjuvanticity in rats to vehicle composition. Immunology 27:311-330. 12. Dupuis, M., K. Denis-Mize, A. LaBarbara, W. Peters, I. F. Charo, D. M. McDonald, and G. Ott. 2001. Immunization with the adju 13. Dupuis, M., T. J. Murphy, D. Higgins, M. Ugozzoli, G. van Nest, G. Ott, and D. M. McDonald. 1998. Dendritic cells in 14. Valentino, M., V. Rapisarda, and C. Fe nga. 2003. Hand injuries due to high-pressure injection devices for painting in shipyards: circumstances, management, and outcome in twelve patients. Am J Ind Med 43:539-542.

PAGE 118

118 15. Spickard, A., 3rd, and J. V. Hi rschmann. 1994. Exogenous lipoid pneumonia. Arch Intern Med 154:686-692. 16. Sharif, F., E. Crushell, K. O'Driscoll, a nd B. Bourke. 2001. Liquid paraffin: a reappraisal of its role in the treatment of constipation. Arch Dis Child 85:121-124. 17. Potter, M., and J. S. Wax. 1981. Genetic s of susceptibility to pristane-induced plasmacytomas in BALB/cAn: reduced susceptib ility in BALB/cJ with a brief description of pristane-induced arthritis. J Immunol 127:1591-1595. 18. Satoh, M., and W. H. Reeves. 1994. Inducti on of lupus-associated autoantibodies in BALB/c mice by intraperitoneal injection of pristane. J Exp Med 180:2341-2346. 19. Satoh, M., H. B. Richards, V. M. Shaheen, H. Yoshida, M. Shaw, J. O. Naim, P. H. Wooley, and W. H. Reeves. 2000. Widespread susceptibility among i nbred mouse strains to the induction of lupus autoantibodies by pristane. Clin Exp Immunol 121:399-405. 20. Hirano, T., T. Taga, K. Yasukawa, K. Nakajima, N. Nakano, F. Takatsuki, M. Shimizu, A. Murashima, S. Tsunasawa, F. Sakiyama, and et al. 1987. Human B-cell differentiation factor defined by an anti-peptide anti body and its possible role in autoantibody production. Proc Natl Acad Sci U S A 84:228-231. 21. Nagafuchi, H., N. Suzuki, Y. Mizushima, and T. Sakane. 1993. Constitutive expression of IL-6 receptors and th eir role in the excessive B cell f unction in patients with systemic lupus erythematosus. J Immunol 151:6525-6534. 22. Kobayashi, I., T. Matsuda, T. Saito, K. Ya sukawa, H. Kikutani, T. Hirano, T. Taga, and T. Kishimoto. 1992. Abnormal distribution of IL-6 receptor in aged MRL/lpr mice: elevated expression on B cells and absence on CD4+ cells. Int Immunol 4:1407-1412. 23. Tang, B., T. Matsuda, S. Akira, N. Nagata S. Ikehara, T. Hirano, and T. Kishimoto. 1991. Age-associated increase in interleukin 6 in MRL/lpr mice. Int Immunol 3:273-278. 24. Jourdan, M., R. Bataille, J. Seguin, X. G. Zhang, P. A. Chaptal, and B. Klein. 1990. Constitutive production of interleukin-6 and i mmunologic features in cardiac myxomas. Arthritis Rheum 33:398-402. 25. Yoshizaki, K., T. Matsuda, N. Nishimoto, T. Kuritani, L. Taeho, K. Aozasa, T. Nakahata, H. Kawai, H. Tagoh, T. Komori, and et al. 1989. Pathogenic significance of interleukin-6 (IL-6/BSF-2) in Castleman's disease. Blood 74:1360-1367 26. Satoh, M., A. Kumar, Y. S. Kanwar, a nd W. H. Reeves. 1995. Anti-nuclear antibody production and immune-complex glomerulone phritis in BALB/c mice treated with pristane. Proc Natl Acad Sci U S A 92:10934-10938.

PAGE 119

119 27. Hamilton, K. J., M. Satoh, J. Swartz, H. B. Richards, and W. H. Reeves. 1998. Influence of microbial stimulation on hypergammagl obulinemia and autoantibody production in pristane-induced lupus. Clin Immunol Immunopathol 86:271-279. 28. Richards, H. B., M. Satoh, M. Shaw, C. Libert, V. Poli, and W. H. Reeves. 1998. Interleukin 6 dependence of anti-DNA anti body production: evidence for two pathways of autoantibody formation in pristane-induced lupus. J Exp Med 188:985-990. 29. Richards, H. B., M. Satoh, J. C. Jennette, B. P. Croker, H. Yoshida, and W. H. Reeves. 2001. Interferon-gamma is required for lupus nephritis in mice treated with the hydrocarbon oil pristane. Kidney Int 60:2173-2180. 30. Satoh, M., K. J. Hamilton, A. K. Ajmani, X. Dong, J. Wang, Y. S. Kanwar, and W. H. Reeves. 1996. Autoantibodies to riboso mal P antigens with immune complex glomerulonephritis in SJL mi ce treated with pristane. J Immunol 157:3200-3206. 31. Satoh, M., E. L. Treadwell, and W. H. Reeves. 1995. Pristane induces high titers of antiSu and anti-nRNP/Sm autoantibodies in BA LB/c mice. Quantitation by antigen capture ELISAs based on monospecific human autoimmune sera. J Immunol Methods 182:51-62. 32. Satoh, M., Y. Kuroda, H. Yoshida, K. M. Behney, A. Mizutani, J. Akaogi, D. C. Nacionales, T. D. Lorenson, R. J. Rosenbauer, and W. H. 33. Kuroda, Y., J. Akaogi, D. C. Nacionales, S. C. Wasdo, N. J. Szabo, W. H. Reeves, and M. Satoh. 2004. Distinctive Patterns of Au toimmune Response Induced by Different Types of Mineral Oil. Toxicol Sci 78(2):222-8 34. Mizutani, A., V. M. Shaheen, H. Yoshida, J. Akaogi, Y. Kuroda, D. C. Nacionales, Y. Yamasaki, M. Hirakata, N. Ono, W. H. Reeves, and M. Satoh. 2005. Pristane-induced autoimmunity in germ-free mice. Clin Immunol 114:110-118. 35. Jakymiw, A., K. Ikeda, M. J. Fritzler, W. H. Reeves, M. Satoh, and E. K. Chan. 2006. Autoimmune targeting of key co mponents of RNA interference. Arthritis Res Ther 8:R87. 36. Satoh, M., J. J. Langdon, C. H. Chou, D. P. McCauliffe, E. L. Treadwell, T. Ogasawara, M. Hirakata, A. Suwa, P. L. Cohen, R. A. Eisenberg, and et al. 1994. Characterization of the Su antigen, a macromolecular complex of 100/102 and 200-kDa proteins recognized by autoantibodies in systemic rheumatic diseases. Clin Immunol Immunopathol 73:132141. 37. Nacionales, D. C., J. S. Weinstein, X. J. Yan, E. Albesiano, P. Y. Lee, K. M. KellyScumpia, R. Lyons, M. Satoh, N. Chiorazzi, and W. H. Reeves. 2009. B cell proliferation, somatic hypermutation, cl ass switch recombination, and autoantibody production in ectopic lymphoid tissue in murine lupus. J Immunol 182:4226-4236.

PAGE 120

120 38. Wooley, P. H., J. R. Seibold, J. D. Whal en, and J. M. Chapdelaine. 1989. Pristaneinduced arthritis. The immunologic and genetic features of an experimental murine model of autoimmune disease. Arthritis Rheum 32:1022-1030. 39. Levitt, N. G., F. Fernandez-Madrid, and P. H. Wooley. 1992. Pristane induced arthritis in mice. IV. Immunotherapy with monoclonal antibodies directed against lymphocyte subsets. J Rheumatol 19:1342-1347. 40. Nacionales, D. C., K. M. Kelly-Scumpia, P. Y. Lee, J. S. Weinstein, R. Lyons, E. Sobel, M. Satoh, and W. H. Reeves. 2007. Deficiency of the type I interfer on receptor protects mice from experimental lupus. Arthritis Rheum 56:3770-3783. 41. Finkelman, F. D., A. Svetic, I. Gresser, C. Sn apper, J. Holmes, P. P. Trotta, I. M. Katona, and W. C. Gause. 1991. Regulation by inte rferon alpha of immunoglobulin isotype selection and lymphokine production in mice. J Exp Med 174:1179-1188. 42. Taniguchi, T., and A. Takaoka. 2002. The in terferon-alpha/beta system in antiviral responses: a multimodal machinery of gene regul ation by the IRF family of transcription factors. Curr Opin Immunol 14:111-116. 43. Calvani, N., M. Satoh, B. P. Croker, W. H. Reeves, and H. B. Richards. 2003. Nephritogenic autoantibodies but absence of nephritis in Il-12p35-deficient mice with pristane-induced lupus. Kidney Int 64:897-905 44. Mendiratta, S. K., W. D. Martin, S. Hong, A. Boesteanu, S. Joyce, and L. Van Kaer. 1997. CD1d1 mutant mice are deficient in natu ral T cells that promptly produce IL-4. Immunity 6:469-477. 45. Asea, A., and J. Stein-Streilein. 1998. Signalling through NK1.1 triggers N 46. Yang, J. Q., A. K. Singh, M. T. Wilson, M. Sato h, A. K. Stanic, J. J. Park, S. Hong, S. D. Gadola, A. Mizutani, S. R. Kakumanu, W. H. Reeves, V. Cerundolo, S. Joyce, L. Van Kaer, and R. R. Singh. 2003. Immunoregulator y role of CD1d in the hydrocarbon oilinduced model of lupus nephritis. J Immunol 171:2142-2153. 47. Kuroda, Y., D. C. Nacionales, J. Ak aogi, W. H. Reeves, and M. Satoh. 2004. Autoimmunity induced by adjuvant hydrocarbon oil components of vaccine. Biomed Pharmacother 58:325-337. 48. Kuroda, Y., N. Ono, J. Akaogi, D. C. Nacionales, Y. Yamasaki, T. T. Barker, W. H. Reeves, and M. Satoh. 2006. Induction of lupus -related specific autoantibodies by nonspecific inflammation caused by an intraperitone al injection of n-he xadecane in BALB/c mice. Toxicology 218:186-196.

PAGE 121

121 49. Tan, E. M., A. S. Cohen, J. F. Fries, A. T. Masi, D. J. McShane, N. F. Rothfield, J. G. Schaller, N. Talal, and R. J. Winchester. 1982. The 1982 revised criteria for the classification of systemic lupus erythematosus. Arthritis Rheum 25:1271-1277. 50. Smith, D. L., X. Dong, S. Du, M. Oh, R. R. Singh, and R. R. Voskuhl. 2007. A female 51. Chowdhary, V. R., J. P. Grande, H. S. Lu thra, and C. S. David. 2007. Characterization of haemorrhagic pulmonary capillaritis: anothe r manifestation of Pristane-induced lupus. Rheumatology (Oxford) 46:1405-1410. 53. Ravetch, J. V., and S. Bolland. 2001. IgG Fc receptors. Annu Rev Immunol 19:275-290. 54. Clynes, R., C. Dumitru, and J. V. Ra vetch. 1998. Uncoupling of immune complex formation and kidney damage in autoimmune glomerulonephritis. Science 279:10521054. 55. Kitching, A. R., P. G. Tipping, J. R. Timoshanko, and S. R. Holdsworth. 2000. Endogenous interleukin-10 regulates Th1 responses that induce crescentic glomerulonephritis. Kidney Int 57:518-525. 56. Horii, Y., A. Muraguchi, M. Iwano, T. Mats uda, T. Hirayama, H. Yamada, Y. Fujii, K. Dohi, H. Ishikawa, Y. Ohmoto, and et al 1989. Involvement of IL-6 in mesangial proliferative glomerulonephritis. J Immunol 143:3949-3955. 57. Ruef, C., K. Budde, J. Lacy, W. Northema nn, M. Baumann, R. B. Sterzel, and D. L. Coleman. 19 58. Naito, T., H. Yokoyama, K. J. Moore, G. Dranoff, R. C. Mulligan, and V. R. Kelley. 1996. Macrophage growth factors introduced into the kidney initiate renal injury. Mol Med 2:297-312. 59. Ioannou, Y., and D. A. Isenberg. 2000. Current evidence for the induction of autoimmune rheumatic manifestations by cytokine therapy. Arthritis Rheum 43:1431-1442. 60. Kalkner, K. M., L. Ronnblom, A. K. Karl sson Parra, M. Bengtsson, Y. Olsson, and K. Oberg. 1998. Antibodies against double-strand ed DNA and development of polymyositis during treatment with interferon. Qjm 91:393-399. 61. Ronnblom, L. E., G. V. Alm, and K. E. Oberg. 1991. Autoimmunity after alphainterferon therapy for malignant carcinoid tumors. Ann Intern Med 115:178-183. 62. Mathian, A., A. Weinberg, M. Gallegos, J. Banchereau, and S. Koutouzov. 2005. IFN{alpha} Induces Early Lethal Lupus in Preautoimmune (New Zealand Black x New Zealand White)F1 but Not in BALB/c Mice. J Immunol 174:2499-2506.

PAGE 122

122 63. Nacionales, D. C., K. M. Kelly, P. Y. Lee, H. Zhuang, Y. Li, J. S. Weinstein, E. Sobel, Y. Kuroda, J. Akaogi, M. Satoh, and W. H. Reeves. 2006. Type I interferon production by tertiary lymphoid tissu e developing in re 64. Santiago-Raber, M. L., R. Baccala, K. M. Haraldsson, D. Choubey, T. A. Stewart, D. H. Kono, and A. N. Theofilopoulos. 2003. Type-I interferon receptor deficiency reduces lupus-like disease in NZB mice. J Exp Med 197:777-788. 65. Jorgensen, T. N., E. Roper, J. M. Thurman, P. Marrack, and B. L. Kotzin. 2007. Type I interferon signaling is involved in the spontaneous developmen t of lupus-like disease in B6.Nba2 and (B6.Nba2 x NZW)F(1) mice. Genes Immun. 66. Thibault, D. L., A. D. Chu, K. L. Graham I. Balboni, L. Y. Lee, C. Kohlmoos, A. Landrigan, J. P. Higgins, R. Tibshirani, and P. J. Utz. 2008. IRF9 and STAT1 are required for IgG autoantibody production and B cell expression of TLR7 in mice. J Clin Invest 118:1417-1426. 67. Zhuang, H., S. Narain, E. Sobel, P. Y. Lee, D. C. Nacionales, K. M. Kelly, H. B. Richards, M. Segal, C. Stewart, M. Satoh, and W. H. Reeves. 2005. Association of antinucleoprotein autoantibodies with upregulation of Type I interferon-inducible gene transcripts and dendritic cell maturation in systemic lupus erythematosus. Clin Immunol 117(3):238-50 68. Hasegawa, H., M. Kohno, M. Sasaki, A. Inoue, M. R. Ito, M. Terada, K. Hieshima, H. Maruyama, J. Miyazaki, O. Yoshie, M. Nose, and S. Fujita. 2003. Antagonist of monocyte chemoattractant protein 1 ameliorate s the initiation and progression of lupus nephritis and renal vasculitis in MRL/lpr mice. Arthritis Rheum 48:2555-2566. 69. Lee, P. Y., J. S. Weinstein, D. C. Nacionales, P. O. Scumpia, Y. Li, E. Butfiloski, N. van Rooijen, L. Moldawer, M. Satoh, and W. H. Reeves. 2008. A novel Type I IFNproducing cell subset in murine lupus. J Immunol 180:5101-5108. 70. Lee, P. Y., Y. Kumagai, Y. Li, O. Takeuchi H. Yoshida, J. Weinstein, E. S. Kellner, D. Nacionales, T. Barker, K. Kelly-Scumpia, N. van Rooijen, H. Kumar, T. Kawai, M. Satoh, S. Akira, and W. H. Reeves. 2008. TLR7-dependent and FcgammaR-independent production of type I interferon in experimental mouse lupus. J Exp Med 205:2995-3006. 71. Bave, U., M. Magnusson, M. L. Eloranta, A. Perers, G. V. Alm, and L. Ronnblom. 2003. Fc gamma RIIa is expressed on natural IFN-alpha-producing cells (plasmacytoid dendritic cells) and is required for the IF N-alpha production induced by apoptotic cells combined with lupus IgG. J Immunol 171:3296-3302. 72. Cella, M., D. Jarrossay, F. Facchetti, O. Al ebardi, H. Nakajima, A. Lanzavecchia, and M. Colonna. 1999. Plasmacytoid monocytes migrate to inflamed lymph nodes and produce large amounts of type I interferon. Nat Med 5:919-923.

PAGE 123

123 73. Coccia, E. M., M. Severa, E. Giacomini, D. Monneron, M. E. Remoli, I. Julkunen, M. Cella, R. Lande, and G. Uze. 2004. Viral inf ection and Toll-like receptor agonists induce a differential expression of type I and lam bda interferons in human plasmacytoid and monocyte-derived dendritic cells. Eur J Immunol 34:796-805. 74. Baccala, R., K. Hoebe, D. H. Kono, B. Beutler, and A. N. Theofilopoulos. 2007. TLRdependent and TLR-independent pathways of type I interferon induction in systemic autoimmunity. Nat Med 13:543-551 75. Kawai, T., and S. Akira. 2006. Innate immune recognition of viral infection. Nat Immunol 7:131-137. 76. Means, T. K., E. Latz, F. Hayashi, M. R. Murali, D. T. Golenbock, and A. D. Luster. 2005. Human lupus autoantibody-DNA complexe s activate DCs thr ough cooperation of CD32 and TLR9. J Clin Invest 115:407-417 77. Savarese, E., O. W. Chae, S. Trowitzsch, G. Weber, B. Kastner, S. Akira, H. Wagner, R. M. Schmid, S. Bauer, and A. Krug. 2006. U1 small nuclear ribonucleoprotein immune complexes induce type I interferon in pl asmacytoid dendritic cells through TLR7. Blood 107:3229-3234. 78. Vollmer, J., S. Tluk, C. Schmitz, S. Hamm, M. Jurk, A. Forsbach, S. Akira, K. M. Kelly, W. H. Reeves, S. Bauer, and A. M. Krieg. 2005. Immune stimulation mediated by autoantigen binding sites within small nuclear RNAs involves Toll-like receptors 7 and 8. J Exp Med 202:1575-1585. 79. Hemmi, H., T. Kaisho, K. Takeda, and S. Akira. 2003. The roles of Toll-like receptor 9, MyD88, and DNA-dependent protein kinase ca talytic subunit in the effects of two distinct CpG DNAs on dendr itic cell subsets. J Immunol 170:3059-3064. 80. Hemmi, H., T. Kaisho, O. Takeuchi, S. Sa to, H. Sanjo, K. Hoshino, T. Horiuchi, H. Tomizawa, K. Takeda, and S. Akira. 2002. Small anti-viral com pounds activate immune cells via the TLR7 MyD88-de pendent signaling pathway. Nat Immunol 3:196-200. 81. Yamamoto, M., S. Sato, H. Hemmi, K. Hoshino, T. Kaisho, H. Sanjo, O. Takeuchi, M. Sugiyama, M. Okabe, K. Takeda, and S. Akira. 2003. Role of adaptor TRIF in the MyD88-independent toll-lik e receptor signaling pathway. Science 301:640-643. 82. Yoneyama, M., M. Kikuchi, T. Natsukawa, N. Shinobu, T. Imaizumi, M. Miyagishi, K. Taira, S. Akira, and T. Fujita. 2004. The RNA helicase RIG-I has an essential function in double-stranded RNA-induced innate antiviral responses. Nat Immunol 5:730-737. 83. Kawai, T., K. Takahashi, S. Sato, C. Coban, H. Kumar, H. Kato, K. J. Ishii, O. Takeuchi, and S. Akira. 2005. IPS-1, an adaptor tri ggering RIG-Iand Mda5-mediated type I interferon induction. Nat Immunol 6:981-988.

PAGE 124

124 84. Kato, H., O. Takeuchi, S. Sato, M. Yoneya ma, M. Yamamoto, K. Matsui, S. Uematsu, A. Jung, T. Kawai, K. J. Ishii, O. Yamaguchi, K. Otsu, T. Tsujimura, C. S. Koh, E. S. C. Reis, Y. Matsuura, T. Fujita, and S. Akir a. 2006. Differential roles of MDA5 and RIG-I helicases in the recogni tion of RNA viruses. Nature. 441(7089):101-5 85. Stockinger, S., B. Reutterer, B. Schaljo, C. Schellack, S. Brunner, T. Materna, M. Yamamoto, S. Akira, T. Taniguchi, P. J. Murray, M. Muller, and T. Decker. 2004. IFN regulatory factor 3-dependent induction of type I IFNs by intracellular bacteria is mediated by a TLRand Nod2-independent mechanism. J Immunol 173:7416-7425. 86. Stetson, D. B., and R. Medzhitov. 2006. Recognition of cytosolic DNA activates an IRF3-dependent innate immune response. Immunity 24:93-103. 87. Savarese, E., C. Steinberg, R. D. Pawar, W. Reindl, S. Akira, H. J. Anders, and A. Krug. 2008. Requirement of Toll-like receptor 7 for pristane-induced production of autoantibodies and development of murine lupus nephritis. Arthritis Rheum 58:11071115. 88. Ronnblom, L., M. L. Eloranta, and G. V. Alm. 2006. The type I in terferon system in systemic lupus erythematosus. Arthritis Rheum 54:408-420. 89. Herrmann, M., R. E. Voll, O. M. Zoller, M. Hagenhofer, B. B. Ponner, and J. R. Kalden. 1998. Impaired phagocytosis of apoptoti c cell material by monocyte-derived macrophages from patients with systemic lupus erythematosus. Arthritis Rheum 41:12411250. 90. Vallin, H., A. Perers, G. V. Alm, and L. Ronnblom. 1999. Anti-double-stranded DNA antibodies and immunostimulatory plasmid DNA in combination mimic the endogenous IFN-alpha inducer in systemic lupus erythematosus. J Immunol 163:6306-6313. 91. Barrat, F. J., T. Meeker, J. Gregorio, J. H. Chan, S. Uematsu, S. Akira, B. Chang, O. Duramad, and R. L. Coffman. 2005. Nucleic acids of mammalian origin can act as endogenous ligands for Toll-like receptors 92. Clynes, R., N. Calvani, B. P. Croker, and H. B. Richards. 2005. Modulation of the immune response in pristane-induced lupus by expression of activati on and inhibitory Fc receptors. Clin Exp Immunol 141:230-237. 93. Bly, J. E., L. R. Garrett, and M. A. Cuch ens. 1990. Pristane induced changes in rat lymphocyte membrane fluidity. Cancer Biochem Biophys 11:145-154. 94. Satoh, M., J. P. Weintraub, H. Yoshida, V. M. Shaheen, H. B. Richards, M. Shaw, and W. H. Reeves. 2000. Fas and Fas ligand mutations i 95. Kratz, A., A. Campos-Neto, M. S. Hanson, and N. H. Ruddle. 1996. Chronic inflammation caused by lymphotoxin is lymphoid neogenesis. J Exp Med 183:1461-1472.

PAGE 125

125 96. Hjelmstrom, P. 2001. Lymphoid neogenesis: de novo formation of lymphoid tissue in chronic inflammation through expr ession of homing chemokines. J Leukoc Biol 69:331339. 97. Mebius, R. E. 2003. Organoge nesis of lymphoid tissues. Nat Rev Immunol 3:292-303. 98. Drayton, D. L., X. Ying, J. Lee, W. Lessl auer, and N. H. Ruddle. 2003. Ectopic LT alpha beta directs lymphoid organ neogenesis with concomitant expression of peripheral node addressin and a HEV-restri cted sulfotransferase. J Exp Med 197:1153-1163. 99. Armengol, M. P., M. Juan, A. Lucas-Martin, M. T. Fernandez-Figueras, D. Jaraquemada, T. Gallart, and R. Pujol-Borrell. 2001. Thyroid autoimmune disease: demonstration of thyroid antigen-specific B cells and recombination-activ ating gene expression in chemokine-containing active intrat hyroidal germinal centers. Am J Pathol 159:861-873. 100. Salomonsson, S., M. V. Jonsson, K. Skarstein, K. A. Brokstad, P. Hjelmstrom, M. Wahren-Herlenius, and R. Jonsson. 2003. Ce llular basis of ectopic germinal center formation and autoantibody production in the target organ of patients with Sjogren's syndrome. Arthritis Rheum 48:3187-3201. 101. Luther, S. A., K. M. Ansel, and J. G. Cyster. 2003. Overlapping roles of CXCL13, interleukin 7 receptor alpha, and CCR7 ligands in lymph node development. J Exp Med 197:1191-1198. 102. Ngo, V. N., H. Korner, M. D. Gunn, K. N. Schmidt, D. S. Riminton, M. D. Cooper, J. L. Browning, J. D. Sedgwick, and J. G. Cyst er. 1999. Lymphotoxin alpha/beta and tumor necrosis factor are required for stromal cell expression of homing chemokines in B and T cell areas of the spleen. J Exp Med 189:403-412. 103. Aloisi, F., and R. Pujol-Borrell. 2006. Ly mphoid neogenesis in chronic inflammatory diseases. Nat Rev Immunol 6:205-217. 104. Aust, G., D. Sittig, L. Becherer, U. Anderegg, A. Schutz, P. Lamesch, and E. Schmucking. 2004. The role of CXCR5 and its ligand CXCL13 in the compartmentalization of lymphocytes in t hyroids affected by autoimmune thyroid diseases. Eur J Endocrinol 150:225-234. 105. Drayton, D. L., S. Liao, R. H. Mounzer, and N. H. Ruddle. 2006. Lymphoid organ development: from ontogeny to neogenesis. Nat Immunol 7:344-353. 106. Murakami, J., Y. Shimizu, Y. Kashii, T. Kato, M. Minemura, K. Okada, S. Nambu, T. Takahara, K. Higuchi, Y. Maeda, T. Kuma da, and A. Watanabe. 1999. Functional B-cell response in intrahepatic lymphoid follicles in chronic hepatitis C. Hepatology 30:143150.

PAGE 126

126 107. Mazzucchelli, L., A. Blaser, A. Kappeler, P. Scharli, J. A. Laissue, M. Baggiolini, and M. Uguccioni. 1999. BCA-1 is highly expressed in Helicobacter pylori-induced mucosaassociated lymphoid tissu e and gastric lymphoma. J Clin Invest 104:R49-54. 108. Stott, D. I., F. Hiepe, M. Hummel, G. Steinhauser, and C. Berek. 1998. Antigen-driven clonal proliferation of B cells within the ta rget tissue of an autoimmune disease. The salivary glands of patients with Sjogren's syndrome. J Clin Invest 102:938-946. 109. Xanthou, G., M. Polihronis, A. G. Tziouf as, S. Paikos, P. Sideras, and H. M. Moutsopoulos. 2001. "Lymphoid" chemokine me ssenger RNA expression by epithelial cells in the chronic inflammatory lesion of the salivary glands of Sjogren's syndrome patients: possible participation in lymphoid structure formation. Arthritis Rheum 44:408418. 110. Schroder, A. E., A. Greiner, C. Seyfert, and C. Berek. 1996. Differentiation of B cells in the nonlymphoid tissue of the synovial membrane of patients with rheumatoid arthritis. Proc Natl Acad Sci U S A 93:221-225. 111. Randen, I., O. J. Mellbye, O. Forre, and J. B. Natvig. 1995. The identification of germinal centres and follicular d 112. Gause, A., K. Gundlach, M. Zdichavsky, G. Jacobs, B. Koch, T. Hopf, and M. Pfreundschuh. 1995. The B lymphocyte in rheumatoid arthritis: analysis of rearranged V kappa genes from B cells infilt rating the synovial membrane. Eur J Immunol 25:27752782. 113. William, J., C. Euler, S. Christensen, and M. J. Shlomchik. 2002. Evolution of autoantibody responses via somatic hypermut ation outside of germinal centers. Science 297:2066-2070. 114. Horsfall, A. C., L. M. Rose, and R. N. Maini. 1989. Autoantibody synthesis in salivary glands of Sjogren's syndrome patients. J Autoimmun 2:559-568. 115. Jego, G., A. K. Palucka, J. P. Blanck, C. Chalouni, V. Pascual, and J. Banchereau. 2003. Plasmacytoid dendritic cells induce plasma ce ll differentiation through type I interferon and interleukin 6. Immunity 19:225-234. 116. Shapiro-Shelef, M., and K. Calame. 2005. Regulation of plasma-cell development. Nat Rev Immunol 5:230-242. 117. Hoyer, B. F., K. Moser, A. E. Hauser, A. Peddinghaus, C. Voigt, D. Eilat, A. Radbruch, F. Hiepe, and R. A. Manz. 2004. Short-lived plasmablasts and long-lived plasma cells contribute to chronic humoral autoimmunity in NZB/W mice. J Exp Med 199:1577-1584. 118. Potter, M., and R. C. MacCardle. 1964. Hi stology of developing plasma cell neoplasia induced by mineral oil in BALB/c mice. J Natl Cancer Inst 33:497-515.

PAGE 127

127 119. Leak, L. V., M. Potter, and W. J. Ma yfield. 1985. Response of the peritoneal mesothelium to the mineral oil, pristane. Curr Top Microbiol Immunol 122:221-233. 120. Weinstein, J. S., D. C. Nacionales, P. Y. Lee, K. M. Kelly-Scumpia, X. J. Yan, P. O. Scumpia, D. S. Vale-Cruz, E. Sobel, M. Satoh, N. Chiorazzi, and W. H. Reeves. 2008. Colocalization of antigen-specific B and T cel ls within ectopic lymphoid tissue following immunization with exogenous antigen. J Immunol 181:3259-3267. 121. Klein, U., and R. Dalla-Favera. 2008. Germin al centres: role in B-cell physiology and malignancy. Nat Rev Immunol 8:22-33. 122. Ettinger, R., G. P. Sims, R. Robbins, D. W ithers, R. T. Fischer, A. C. Grammer, S. Kuchen, and P. E. Lipsky. 2007. IL-21 and BAFF/BLyS synergize in stimulating plasma cell differentiation from a unique populati on of human splenic memory B cells. J Immunol 178:2872-2882. 123. Richards, H. B., M. Satoh, J. C. Jennette, T. Okano, Y. S. Kanwar, and W. H. Reeves. 1999. Disparate T cell requirements of two subs ets of lupus-specifi c autoantibodies in pristane-treated mice. Clin Exp Immunol 115:547-553. 124. Cassese, G., S. Lindenau, B. de Boer, S. Ar ce, A. Hauser, G. Riemekasten, C. Berek, F. Hiepe, V. Krenn, A. Radbruch, and R. A. Manz. 2001. Inflamed kidneys of NZB / W mice are a major site for the homeostasis of plasma cells. Eur J Immunol 31:2726-2732. 125. Okada, T., V. N. Ngo, E. H. Ekland, R. Forster, M. Lipp, D. R. Littman, and J. G. Cyster. 2002. Chemokine requirements for B cell entr y to lymph nodes and Peyer's patches. J Exp Med 196:65-75. 126. McHeyzer-Williams, L. J., and M. G. McHeyzer-Williams. 2005. Antigen-specific memory B cell development. Annu Rev Immunol 23:487-513. 127. Jacob, J., and G. Kelsoe. 1992. In situ studi es of the primary immune response to (4hydroxy-3-nitrophenyl)acetyl. II. A common clonal origin fo r periarteriolar lymphoid sheath-associated foci and germinal centers. J Exp Med 176:679-687. 128. Jacob, J., R. Kassir, and G. Kelsoe. 1991. In situ studies of the primary immune response to (4-hydroxy-3-nitrophenyl)acetyl. I. The architecture and dynamics of responding cell populations. J Exp Med 173:1165-1175. 129. Schwickert, T. A., R. L. Lindquist, G. Sha khar, G. Livshits, D. Skokos, M. H. KoscoVilbois, M. L. Dustin, and M. C. Nusse nzweig. 2007. In vivo imaging of germinal centres reveals a dynamic open structure. Nature 446:83-87. 130. White, H. N. 1998. Restriction-PCR fingerpri nting of the immunoglobulin VH repertoire: direct detection of an immune response and global analysis of B cell clonality. Eur J Immunol 28:3268-3279.

PAGE 128

128 131. Han, S., B. Zheng, J. Dal Porto, and G. Ke lsoe. 1995. In situ studies of the primary immune response to (4-hydroxy-3-nitrophenyl)acetyl. IV. Af finity-dependent, antigendriven B cell apoptosis in germinal cente rs as a mechanism for maintaining selftolerance. J Exp Med 182:1635-1644. 132. Barnden, M. J., J. Allison, W. R. H eath, and F. R. Carbone. 1998. Defective TCR expression in transgenic mice constructed us ing cDNA-based alphaan d beta-chain genes under the control of heterol ogous regulatory elements. Immunol Cell Biol 76:34-40. 133. Siekevitz, M., C. Kocks, K. Rajewsky, and R. Dildrop. 1987. Analysis of somatic mutation and class switching in naive and memory B cells generating adoptive primary and secondary responses. Cell 48:757-770. 134. Allen, D., T. Simon, F. Sablitzky, K. Rajewsky, and A. Cumano. 1988. Antibody engineering for the analysis of affinity maturation of an anti-hapten response. Embo J 7:1995-2001. 135. Sims, G. P., H. Shiono, N. Willcox, and D. I. Stott. 2001. Somatic hypermutation and selection of B cells in thymic germinal centers responding to acetylcholine receptor in myasthenia gravis. J Immunol 167:1935-1944. 136. Shlomchik, M. J., A. H. Aucoin, D. S. Pi setsky, and M. G. Weigert. 1987. Structure and function of anti-DNA autoantibodies derived from a single autoimmune mouse. Proc Natl Acad Sci U S A 84:9150-9154. 137. Herlands, R. A., J. William, U. Hershberg, and M. J. Shlomchik. 2007. Anti-chromatin antibodies drive in vivo antigen-specific activation and somatic hypermutation of rheumatoid factor B cells at extrafollicular sites. Eur J Immunol 37:3339-3351. 138. Bombardieri, M., F. Barone, F. Hum by, S. Kelly, M. McGurk, P. Morgan, S. Challacombe, S. De Vita, G. Valesini, J. Spencer, and C. Pitzalis. 2007. Activationinduced cytidine deaminase expression in follicular dendritic cell networks and interfollicular large B cells supports functionality of ectopic lymphoid neogenesis in autoimmune sialoadenitis and MALT lymphoma in Sjogren's syndrome. J Immunol 179:4929-4938. 139. Natvig, J. B., I. Randen, K. Thompson, O. Forre, R. A. Mageed, R. Jefferis, D. A. Carson, H. Tighe, V. Pascual, K. D. Victor and et al. 1990. Probing of the rheumatoid factor (RF) V gene repertoi re in rheumatoid arthriti s (RA) by hybridoma clones. Clin Exp Rheumatol 8 Suppl 5:75-80. 140. von Andrian, U. H., and T. R. Mempel. 2003. Homing and cellular traffic in lymph nodes. Nat Rev Immunol 3:867-878. 141. Cyster, J. G. 1999. Chemokines and cell mi gration in secondary lymphoid organs. Science 286:2098-2102.

PAGE 129

129 142. McHeyzer-Williams, L. J., M. Cool, and M. G. McHeyzer-Williams. 2000. Antigenspecific B cell memory: expression and replen ishment of a novel b220(-) memory b cell compartment. J Exp Med 191:1149-1166. 143. Ulett, G. C., N. Ketheesan, and R. G. Hirst. 2000. Cytokine gene expression in innately susceptible BALB/c mice and relatively resi stant C57BL/6 mice during infection with virulent Burkholderia pseudomallei. Infect Immun 68:2034-2042. 144. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25:402-408. 145. Kinoshita, K., M. Harigai, S. Fagarasan, M. Muramatsu, and T. Honjo. 2001. A hallmark of active class switch recombination: transc ripts directed by I pr omoters on looped-out circular DNAs. Proc Natl Acad Sci U S A 98:12620-12623. 146. Arant, S. E., J. A. Griffin, and W. J. Koop man. 1986. VH gene expression is restricted in anti-IgG antibodies from MRL autoimmune mice. J Exp Med 164:1284-1300. 147. Barnes, J. L., F. Goni, H. Heyermann, B. Frangione, and V. Agnello. 1990. Human rheumatoid factor cross-idiotypes. III. Bla monoclonal rheumatoid factor, prototype of the BLA cross-idiotype group, has distinct kappa chains related to the V kappa III subgroup and VH4 heavy chains. Arthritis Rheum 33:1710-1715. 148. Liu, Y. J., G. D. Johnson, J. Gordon, and I. C. MacLennan. 1992. Germinal centres in Tcell-dependent antibody responses. Immunol Today 13:17-21. 149. Wang, D., S. M. Wells, A. M. Stall, and E. A. Kabat. 1994. Reaction of germinal centers in the T-cell-independent res ponse to the bacterial polysaccharide alpha(1-->6)dextran. Proc Natl Acad Sci U S A 91:2502-2506. 150. Mao, C., L. Jiang, M. Melo-Jorge, M. Puthenveetil, X. Zhang, M. C. Carroll, and T. Imanishi-Kari. 2004. T cell-independent somatic hypermutation in murine B cells with an immature phenotype. Immunity 20:133-144. 151. Potter, M., J. S. Wax, and E. Blankenhorn. 1985. BALB/c subline differences in susceptibility to plasmacytoma induction. Curr Top Microbiol Immunol 122:234-241. 152. Allen, C. D., and J. G. Cyster. 2008. Follic ular dendritic cell networks of primary follicles and germinal centers: phenotype and function. Semin Immunol 20:14-25. 153. Takemura, S., A. Braun, C. Crowson, P. J. Kurtin, R. H. Cofield, W. M. O'Fallon, J. J. Goronzy, and C. M. Weyand. 2001. Lymphoid neogenesis in rheumatoid synovitis. J Immunol 167:1072-1080. 154. Shlomchik, M. J. 2008. Sites and stages of autoreactive B cell activ ation and regulation. Immunity 28:18-28.

PAGE 130

130 155. Jacobson, B. A., D. J. Panka, K. A. Nguyen, J. Erikson, A. K. Abbas, and A. MarshakRothstein. 1995. Anatomy of autoantibody pr oduction: dominant localization of antibody-producing cells to T cell zones in Fas-deficient mice. Immunity 3:509-519. 156. Herlands, R. A., S. R. Christensen, R. A. Sweet, U. Hershberg, and M. J. Shlomchik. 2008. T Cell-Independent and Toll-like Recep tor-Dependent Antigen-Driven Activation of Autoreactive B Cells. Immunity 29:249-260. 157. Muramatsu, M., K. Kinoshita, S. Fagarasan, S. Yamada, Y. Shinkai, and T. Honjo. 2000. Class switch recombination and hypermutation require activati on-induced cytidine deaminase (AID), a potential RNA editing enzyme. Cell 102:553-563. 158. Honjo, T., K. Kinoshita, and M. Muramatsu. 2002. Molecular mechanism of class switch recombination: linkage with somatic hypermutation. Annu Rev Immunol 20:165-196. 159. Muramatsu, M., V. S. Sankaranand, S. Anant, M. Sugai, K. Kinoshita, N. O. Davidson, and T. Honjo. 1999. Specific expression of activ ation-induced cytidin e deaminase (AID), a novel member of the RNA-editing deaminase family in germinal center B cells. J Biol Chem 274:18470-18476. 160. He, B., X. Qiao, and A. Cerutti. 200 4. CpG DNA induces IgG class switch DNA recombination by activating human B cells throu gh an innate pathway that requires TLR9 and cooperates with IL-10. J Immunol 173:4479-4491. 161. Capolunghi, F., S. Cascioli, E. Giorda, M. M. Rosado, A. Plebani, C. Auriti, G. Seganti, R. Zuntini, S. Ferrari, M. Cagliuso, I. Qu inti, and R. Carsetti. 2008. CpG drives human transitional B cells to term inal differentiation and production of natural antibodies. J Immunol 180:800-808. 162. Jegerlehner, A., P. Maurer, J. Bessa, H. J. Hinton, M. Kopf, and M. F. Bachmann. 2007. TLR9 signaling in B cells determines cl ass switch recombination to IgG2a. J Immunol 178:2415-2420. 163. Kelly, K. M., H. Zhuang, D. C. Nacionales, P. O. Scumpia, R. Lyons, J. Akaogi, P. Lee, B. Williams, M. Yamamoto, S. Akira, M. Satoh, and W. H. Reeves. 2006. "Endogenous adjuvant" activity of the RNA components of lupus autoantigens Sm/RNP and Ro 60. Arthritis Rheum 54:1557-1567. 164. Corcione, A., S. Casazza, E. Ferretti, D. Giunti, E. Zappia, A. Pistorio, C. Gambini, G. L. Mancardi, A. Uccelli, and V. Pistoia. 2004. R ecapitulation of B cell differentiation in the central nervous system of patients with multiple sclerosis. Proc Natl Acad Sci U S A 101:11064-11069. 165. Massone, C., K. Kodama, W. Salmhofer, R. Abe, H. Shimizu, A. Parodi, H. Kerl, and L. Cerroni. 2005. Lupus erythematosus panni culitis (lupus prof undus): clinical, histopathological, and molecular analysis of nine cases. J Cutan Pathol 32:396-404.

PAGE 131

131 166. Omokawa, A., H. Wakui, S. Okuyama, M. Togashi, H. Ohtani, A. Komatsuda, R. Ichinohasama, and K. Sawada. 2008. Predominant tubulointerstitial nephritis in a patient with systemic lupus erythematosus: phenotype of infiltrating cells. Clin Nephrol 69:436444. 167. Alarcon-Riquelme, M. E. 2006. Nucleic ac id by-products and chronic inflammation. Nat Genet 38:866-867. 168. Barone, F., M. Bombardieri, A. Manzo, M. C. Blades, P. R. Morgan, S. J. Challacombe, G. Valesini, and C. Pitzalis. 2005. Association of CXCL13 and CCL21 expression with the progressive organization of lymphoid-li ke structures in Sjogren's syndrome. Arthritis Rheum 52:1773-1784. 169. Slifka, M. K., R. Antia, J. K. Whitmire and R. Ahmed. 1998. Humoral immunity due to long-lived plasma cells. Immunity 8:363-372. 170. Ochsenbein, A. F., D. D. Pinschewer, S. Si erro, E. Horvath, H. Hengartner, and R. M. Zinkernagel. 2000. Protective long-term anti body memory by antigen-driven and T helpdependent differentiation of long-lived memo ry B cells to short-lived plasma cells independent of secondary lymphoid organs. Proc Natl Acad Sci U S A 97:13263-13268. 171. Richard, K., S. K. Pierce, and W. Song. 2008. The agonists of TLR4 and 9 are sufficient to activate memory B cells to differentiate into plasma cells in vitro but not in vivo. J Immunol 181:1746-1752. 172. Bernasconi, N. L., N. Onai, and A. Lanzavecchia. 2003. A role for Toll-like receptors in acquired immunity: up-regulation of TLR9 by BCR triggering in naive B cells and constitutive expression in memory B cells. Blood 101:4500-4504. 173. O'Garra, A., and P. Vieira. 2004. Regulatory T cells and mechanisms of immune system control. Nat Med 10:801-805. 174. Vieira, P., and K. Rajewsky. 1988. The half -lives of serum immunoglobulins in adult mice. Eur J Immunol 18:313-316. 175. Manz, R. A., A. Thiel, and A. Radbruch. 1997. Lifetime of plasma cells in the bone marrow. Nature 388:133-134. 176. Humby, F., M. Bombardieri, A. Manzo, S. Kelly M. C. Blades, B. Kirkham, J. Spencer, and C. Pitzalis. 2009. Ectopic lymphoid stru ctures support ongoing production of classswitched autoantibodies in rheumatoid synovium. PLoS Med 6:e1. 177. Odegard, J. M., B. R. Marks, L. D. DiPl acido, A. C. Poholek, D. H. Kono, C. Dong, R. A. Flavell, and J. Craft. 2008. ICOS-dependent extrafollicular help er T cells elicit IgG production via IL-21 in systemic autoimmunity. J Exp Med 205:2873-2886.

PAGE 132

132 178. Ueda, Y., M. Kondo, and G. Kelsoe. 2005. Infl ammation and the recipr ocal production of granulocytes and lymphocytes in bone marrow. J Exp Med 201:1771-1780. 179. Moser, K., K. Tokoyoda, A. Radbruch, I. MacLennan, and R. A. Manz. 2006. Stromal niches, plasma cell differentiation and survival. Curr Opin Immunol 18:265-270. 180. Paramithiotis, E., and M. D. Cooper. 1997. Memory B lymphocytes migrate to bone marrow in humans. Proc Natl Acad Sci U S A 94:208-212. 181. Muehlinghaus, G., L. Cigliano, S. Huehn, A. Peddinghaus, H. Leyendeckers, A. E. Hauser, F. Hiepe, A. Radbruch, S. Arce, and R. A. Manz. 2005. Regulation of CXCR3 and CXCR4 expression during terminal differentiation of memory B cells into plasma cells. Blood 105:3965-3971. 182. Lutz, C., B. Ledermann, M. H. Kosco-Vilbois, A. F. Ochsenbein, R. M. Zinkernagel, G. Kohler, and F. Brombacher. 1998. IgD can largely substitute for loss of IgM function in B cells. Nature 393:797-801. 183. Fearon, D. T., and M. C. Carroll. 2000. Regul ation of B lymphocyte responses to foreign and self-antigens by the CD19/CD21 complex. Annu Rev Immunol 18:393-422. 184. Patten, C., K. Bush, I. Rioja, R. Morga n, P. Wooley, J. Trill, and P. Life. 2004. Characterization of pristane-i nduced arthritis, a murine model of chronic disease: response to antirheumatic agents, expressi on of joint cytokines, and immunopathology. Arthritis Rheum 50:3334-3345. 185. Ueda, Y., K. Yang, S. J. Foster, M. Kondo, and G. Kelsoe. 2004. Inflammation Controls B Lymphopoiesis by Regulating Chemokine CXCL12 Expression. J Exp Med 199:47-58.

PAGE 133

133 BIOGRAPHICAL SKECTH Jason Scott Weinstein w as born in 1979 in Natick, Massachusetts. He attended Northeastern University in Boston, Massachusetts, where he graduated with a B.S. in biology in 2003. In the fall of 2003, he started graduate sc hool in the Interdisciplinary Program in Biomedical Sciences at the University of Florida. Jason began his research career in 2000 at Millennium Pharmaceuticals as a CO-OP student in the Antibody Engineer ing group under the guidance of Dr. Theresa OKeefe. In 2002 he joined Dr. OKeefe in a start-up company, Cr itical Therapeutics, where he worked in the Molecular Immunology group. In 2004 he joined the Reevess la boratory to begi n is Ph.D work studying the role of lymphocytes in pristane-induced ectopic lymphoid tissue. Upon completion of his Ph.D in 2009, he plans to continue his ca reer in scientific res earch as a postdoctoral research associate in the laboratory of Dr. Joseph Craft at Yale University.