<%BANNER%>

Molecular Improvement for Fall Armyworm Resistance in Sugarcane, Tifeagle and Tifton 85

Permanent Link: http://ufdc.ufl.edu/UFE0024296/00001

Material Information

Title: Molecular Improvement for Fall Armyworm Resistance in Sugarcane, Tifeagle and Tifton 85
Physical Description: 1 online resource (105 p.)
Language: english
Creator: Joshi, Sunil
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: Agronomy -- Dissertations, Academic -- UF
Genre: Agronomy thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Sugarcane (Saccharum spp. hybrids) is a tropical grass native to Asia. Florida is the largest producer of sugarcane in the U.S. followed by Louisiana, Hawaii, and Texas. TifEagle Cynodon dactylon (L.) Pers. X C. transvaalensis Burtt Davy is a warm season, triploid bermudagrass cultivar that provides high quality turf and is an ideal grass for golf course putting greens. Tifton 85 Cynodon dactylon (L.) Pers. X C. transvaalensis Burtt Davy is a warm season perennial forage grass with high yield and superior quality. All of these grasses are susceptible to the insect pest, fall armyworm (FAW) Spodoptera frugiperda (J.E. Smith) (Lepidoptera: Noctuidae). Therefore, the goal of the present research was to incorporate resistance against the rice strain of FAW through the introduction and expression of a Bacillus thuringiensis (Bt) endotoxin gene via genetic engineering. This approach was chosen because traditional breeding is laborious and difficult for sugarcane, a highly aneu-polyploid crop, and impossible for TifEagle and Tifton 85 due to sterility. A long-term goal is to produce transgenic sugarcane in a relatively short period of time by bypassing a callus phase. Therefore, an initail study was conducted to evaluate a direct regeneration tissue culture system using three cultivars, CP84-1198, CP88-1762 and CP89-2143. Such as system has advantages over callus-based methods in that less time is required to produce transgenic plants and there is less of a dependency on tissue culture, thereby potentially reducing somaclonal variation. The importance of explant distance from the meristem and orientation of the explants was examined for induction of shoots and roots. The greatest number of shoots was produced by CP88-1762, followed by CP89-2143 and CP84-1198 from explants closest to the meristem that were oriented vertically on the medium. The most roots were produced by CP84-1198, followed by CP88-1762 and CP89-2143. Overall, CP88-1762 was the best cultivar among the three for the production of plantlets via direct organogenesis followed by CP89-2143 and CP84-1198. Therefore, CP88-1762 will be used in future experiments to optimize this tissue culture system in conjunction with an Agrobacterium-mediated transformation protocol. To produce sugarcane transgenics with resistance to the rice strain of FAW, biolistics was used to introduce the Bt cry1Fa gene encoding a ?-endotoxin that has been effective in protecting against lepidopteran pests. Sugarcane embryogenic callus was co-bombarded with a cry1Fa gene cassette and an nptII gene cassette as the selectable marker. Four independent sugarcane transgenic lines of CP84-1198 were obtained showing stable integration of multiple copies of the cry1Fa gene. A qualitative immuno-chromatographic assay indicated that two of the four transgenic lines had Cry1Fa levels above the detection level of the assay. A semi-quantitative immunoassay, based on the QualiPlateTM kit for Cry1F (EnviroLogixTM), showed that the same two lines had Cry1Fa levels equal to or more than the Cry1F levels found in Herculex Iregistered trademark corn or WideStrikeregistered trademark cotton , while the remaining two lines had lower levels of Cry1Fa. These transgenics were subjected to FAW laboratory bioassays over a 5-day period. Rice strain larvae showed intense feeding on wild type leaves along with high weight gains, while those fed leaves from the four transgenic lines showed significantly limited feeding and weight gain. Additionally, the FAW larvae showed high mortality rates when fed the transgenic leaves particularly for the two lines that expressed the higher levels of Cry1Fa. This is the first report of transgenic Bt sugarcane conferring resistance to FAW, and future work will test their efficacy in the field. For Tifton 85 and TifEagle, a successful direct regeneration protocol using stolon node explants was developed. This tissue culture system was used with Agrobacterium infection in transformation experiments. One transgenic TifEagle line containing cry1Fa was obtained using Agrobacterium tumefaciens strain AGLO, but this approach was unsuccessful for obtaining transgenic Tifton 85. The transgenic cry1Fa TifEagle line was subjected to FAW bioassays. However, no differences in FAW larval weight gain or mortality were found suggesting that the level of expression of cry1Fa in this line was insufficient to provide resistance to the rice strain of FAW.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Sunil Joshi.
Thesis: Thesis (Ph.D.)--University of Florida, 2009.
Local: Adviser: Gallo, Maria.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-06-30

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0024296:00001

Permanent Link: http://ufdc.ufl.edu/UFE0024296/00001

Material Information

Title: Molecular Improvement for Fall Armyworm Resistance in Sugarcane, Tifeagle and Tifton 85
Physical Description: 1 online resource (105 p.)
Language: english
Creator: Joshi, Sunil
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: Agronomy -- Dissertations, Academic -- UF
Genre: Agronomy thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Sugarcane (Saccharum spp. hybrids) is a tropical grass native to Asia. Florida is the largest producer of sugarcane in the U.S. followed by Louisiana, Hawaii, and Texas. TifEagle Cynodon dactylon (L.) Pers. X C. transvaalensis Burtt Davy is a warm season, triploid bermudagrass cultivar that provides high quality turf and is an ideal grass for golf course putting greens. Tifton 85 Cynodon dactylon (L.) Pers. X C. transvaalensis Burtt Davy is a warm season perennial forage grass with high yield and superior quality. All of these grasses are susceptible to the insect pest, fall armyworm (FAW) Spodoptera frugiperda (J.E. Smith) (Lepidoptera: Noctuidae). Therefore, the goal of the present research was to incorporate resistance against the rice strain of FAW through the introduction and expression of a Bacillus thuringiensis (Bt) endotoxin gene via genetic engineering. This approach was chosen because traditional breeding is laborious and difficult for sugarcane, a highly aneu-polyploid crop, and impossible for TifEagle and Tifton 85 due to sterility. A long-term goal is to produce transgenic sugarcane in a relatively short period of time by bypassing a callus phase. Therefore, an initail study was conducted to evaluate a direct regeneration tissue culture system using three cultivars, CP84-1198, CP88-1762 and CP89-2143. Such as system has advantages over callus-based methods in that less time is required to produce transgenic plants and there is less of a dependency on tissue culture, thereby potentially reducing somaclonal variation. The importance of explant distance from the meristem and orientation of the explants was examined for induction of shoots and roots. The greatest number of shoots was produced by CP88-1762, followed by CP89-2143 and CP84-1198 from explants closest to the meristem that were oriented vertically on the medium. The most roots were produced by CP84-1198, followed by CP88-1762 and CP89-2143. Overall, CP88-1762 was the best cultivar among the three for the production of plantlets via direct organogenesis followed by CP89-2143 and CP84-1198. Therefore, CP88-1762 will be used in future experiments to optimize this tissue culture system in conjunction with an Agrobacterium-mediated transformation protocol. To produce sugarcane transgenics with resistance to the rice strain of FAW, biolistics was used to introduce the Bt cry1Fa gene encoding a ?-endotoxin that has been effective in protecting against lepidopteran pests. Sugarcane embryogenic callus was co-bombarded with a cry1Fa gene cassette and an nptII gene cassette as the selectable marker. Four independent sugarcane transgenic lines of CP84-1198 were obtained showing stable integration of multiple copies of the cry1Fa gene. A qualitative immuno-chromatographic assay indicated that two of the four transgenic lines had Cry1Fa levels above the detection level of the assay. A semi-quantitative immunoassay, based on the QualiPlateTM kit for Cry1F (EnviroLogixTM), showed that the same two lines had Cry1Fa levels equal to or more than the Cry1F levels found in Herculex Iregistered trademark corn or WideStrikeregistered trademark cotton , while the remaining two lines had lower levels of Cry1Fa. These transgenics were subjected to FAW laboratory bioassays over a 5-day period. Rice strain larvae showed intense feeding on wild type leaves along with high weight gains, while those fed leaves from the four transgenic lines showed significantly limited feeding and weight gain. Additionally, the FAW larvae showed high mortality rates when fed the transgenic leaves particularly for the two lines that expressed the higher levels of Cry1Fa. This is the first report of transgenic Bt sugarcane conferring resistance to FAW, and future work will test their efficacy in the field. For Tifton 85 and TifEagle, a successful direct regeneration protocol using stolon node explants was developed. This tissue culture system was used with Agrobacterium infection in transformation experiments. One transgenic TifEagle line containing cry1Fa was obtained using Agrobacterium tumefaciens strain AGLO, but this approach was unsuccessful for obtaining transgenic Tifton 85. The transgenic cry1Fa TifEagle line was subjected to FAW bioassays. However, no differences in FAW larval weight gain or mortality were found suggesting that the level of expression of cry1Fa in this line was insufficient to provide resistance to the rice strain of FAW.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Sunil Joshi.
Thesis: Thesis (Ph.D.)--University of Florida, 2009.
Local: Adviser: Gallo, Maria.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-06-30

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0024296:00001


This item has the following downloads:


Full Text

PAGE 1

1 MOLECULAR IMPROVEMENT FOR FALL ARMYWORM RESISTANCE IN SUGARCANE TIFEAGLE AND TIFTON 85 By SUNIL JOSHI A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENT S FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2009

PAGE 2

2 2009 Sunil Joshi

PAGE 3

3 In memory of my parents Dr D V Joshi and Sunita Joshi

PAGE 4

4 ACKNOWLEDGMENTS I would like to express my sincere app reciation to Dr. Maria Gallo, the chairperson of my graduate supervisory committee, for her scientific guidance encouragement during my graduate study, and financial support. I would also like to extend my gratitude to Dr. Fredy Altpeter Dr. Robert L. Meagher, Jr. Dr. D avid S. Wofford, Dr. Paul Mislevy and Dr. Kevin Kenworthy for their academic support, valuable discussions and constructive criticism as members of my advisory committee. Special thanks to Dr. Barry Tillman for providing his expert opinion and guidance in statistical analysis of the data. I wish to ac knowledge my laboratory m embers including postdoctoral research associates graduate students, biological scientist, and OPS students. I thank Dr. M ukesh Jain, Dr. Victoria James, Dr. Yolanda Lopez and Jeff Se i b, for their technical training and guidance in the laboratory. I thank my fellow graduate students Dr. S ivananda (Siva) V. Tirumalaraju, Bhuvan Pathak, Fanchao Yi Scott Burns, Michael Petefish and Sharon Tan for their daily support and friendship. I would also like to thank my friends Dr. Gurjit Dhatt, Dr. Preeti Dhatt, Dr. Pulkit Arora, Maninder Singh, Kuljinder Deol, Namita Deol, and Harsimran (Rosie) Gill for great food and friendship. Words are not enough to thank my mother Sunita Joshi, my wife Gungeet Joshi, my sister Dr. Neelam Joshi, my brother -in -law Dr. Ashwani Sharma, my f ather -in -law Dr. Kamal Mahindra, my mother in law Dr. Rabinder jit Mahindra, my daughter Tvisha and my niece Vridhi for being supportive and staying with m e during my difficult times

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS .................................................................................................................... 4 LIST OF TABLES ................................................................................................................................ 7 LIST OF FIGURES .............................................................................................................................. 8 ABSTRACT .......................................................................................................................................... 9 CH A P T E R 1 INTRODUCTION ....................................................................................................................... 12 2 LITERATURE REVIEW ........................................................................................................... 15 Sugarcane ( Saccharum spp. hybrids) ......................................................................................... 15 Bermudagrass ( Cynodon spp.) .................................................................................................... 16 Fall Armyworm, Spodoptera frugiperda (J.E. Smith) .............................................................. 18 Bacillus thuringiensis Berliner (Bt) ........................................................................................... 19 Cry Proteins ................................................................................................................................. 20 Tissue Culture Systems for Sugarcane and Bermudagrasses ................................................... 21 Biolistics and Agrobacterim -mediated Transformation ........................................................... 24 3 COMPARATIVE ANALYSIS OF DIRECT PLANT REGENERATION FROM YOUNG LEAF SEGMENTS OF THREE DIFFERENT SUGARCANE CULTIVARS ..... 30 Introduction ................................................................................................................................. 30 Materials and Methods ................................................................................................................ 32 Preparation of Explants and Culture Conditions ............................................................... 32 Shoot Production .................................................................................................................. 33 Shoot Elongation.................................................................................................................. 34 Root Indu ction ..................................................................................................................... 35 Discussion .................................................................................................................................... 35 4 EXPRESSION OF CRY1Fa TO ENHANCE FALL ARMYWORM RESISTANCE IN SUGARCANE ............................................................................................................................. 42 Materials and Methods ................................................................................................................ 44 Plant Material ....................................................................................................................... 44 Transgene Expression Constructs ....................................................................................... 44 Tissue culture, Transformation and Regeneration of Sugarcane ...................................... 45 Polymerase Chain Reaction, Southern Blot Analysis, and RT PCR ................................ 46 Immunological Assays ........................................................................................................ 47 Insect Bioassays ................................................................................................................... 48 Results .......................................................................................................................................... 48

PAGE 6

6 Generation of Transgenic Sugarcane Lines and Molecular Characterization .................. 48 Immunological Assays ........................................................................................................ 49 Insect Bioassays ................................................................................................................... 50 Discussion .................................................................................................................................... 50 5 EVALUATING AGROBACTERIUM VACUUM INFILTRATION OF STOLON NODES FOR THE PRODUCTION OF TRANSGENIC BERMUDAGRASS ..................... 58 Introduction ................................................................................................................................. 58 Materials and Method ................................................................................................................. 60 Plant Material ....................................................................................................................... 60 Plantlet Regeneration ........................................................................................................... 60 Infection and Co-cultivation of Stolon Nodes with Agrobacterium tumefaciens ............ 60 Selection and Recovery of Transgenic Plants .................................................................... 61 Molecular Characterization of Transgenic Plants .............................................................. 62 Immunological Assays ........................................................................................................ 63 Insect Bioassays ................................................................................................................... 63 Results .......................................................................................................................................... 64 Discussion .................................................................................................................................... 65 6 SUMMARY AND CONCLUSIONS ........................................................................................ 72 Comparative Analysis of Direct Plant Regeneration of Three Sugarcane Cultivars .............. 72 Expressio n of cry1Fa to Enhance FAW Resistance in Sugarcane using Biolistics ................ 72 Evaluating Agrobacterium Vacuum Infiltration of Stolon Nodes for the Production of Transgenic Bermudagrass ....................................................................................................... 73 7 LABORATORY PROTOCOLS ................................................................................................ 74 Molecular Techniques ................................................................................................................. 74 Genomic DNA Extraction (modified from Dellaporta et al., 1983) ................................. 74 Genomic RNA Extraction Method (RNeasy Plant Mini Kit,Qiagen) .............................. 75 iScript cDNA Synthesis Reaction ....................................................................................... 76 SuperScript TM III First -Strand Synthesis System for RT -PCR ........................................ 76 Protocol for Biolistic Gene Tra nsfer (Altpeter and James, 2005) .................................... 77 Southern Blotting ................................................................................................................. 77 Protocol for Immunochromatography strip test for cry1F gene (QuickstixTM kit for cry1F EnviroLogix) ........................................................................................................ 80 Quick startTM Bradford Protein Assay ................................................................................ 81 High sensitivity Protocol for Enzyme Linked Immunadsorbent -Assay for the cry1F gene ................................................................................................................................... 83 (QualiPlate Kit for Cry1F, EnviroLogix) ....................................................................... 83 Stocks and solutions ............................................................................................................ 85 LIST OF REFERENCES ................................................................................................................... 88 BIOGRAPHICAL SKETCH ........................................................................................................... 105

PAGE 7

7 LIST OF TABLES Table page 3 1 Number of shoots, number of shoots > 1cm, ........................................................................ 39 3 2 Number of shoots per explant analyzed for each sugarcane cultivar. ................................. 39 3 3 Number of shoots > 1cm per explant analyzed for each sugarcane cultivar. ..................... 40 3 4 Number of roots per explants analyzed for each sugarcane cultivar. ................................. 40 4 1 Summary of biolistic gene transfer experiments with three different cultivars,. ............... 57 4 2 Fall armyworm bioassays with 2nd instar rice strain larvae ................................................ 57 5 1 Summary of Agrobacterium -mediated transformation experiments .................................. 71 5 2 Fall armyworm bioassays with neonate rice strain larvae feeding on leaves ..................... 71

PAGE 8

8 LIST OF FIGURES Figure page 3 1 Sugarcane explants used for direct regeneration. ................................................................. 38 3 2 Direct organogenesis from sugarcane leaf roll explants.. .................................................... 41 4 1 Expression cassettes used for sugarcane bombardment ..................................................... 53 4 2 Sugarcane tissue culture and regeneration following bombardment.. ................................ 54 4 3 Polymerase chain reaction and Southern blot analysis of cry1Fa in sugarcane.. .............. 55 4 4 Cry1Fa levels in leaves of transgenic sugarcane lines and wild type ................................. 56 5 1 Gene cassette used in Agrobacterium vacuum infiltrati on of stolon explants of Tifton 85 and TifEagle ...................................................................................................................... 67 5 2 Tifton 85 and TifEagle tissue culture and regeneration following Agrobacterium mediated transformation ....................................................................................................... 68 5 3 Molecular analysis of TifEagle and Tifton 85 following Agrobacterium vacuum infiltration of stolon nodes.. ................................................................................................... 69 5 4 Cry1Fa levels in leaves of regenerated TifEagle and Tifton 85 .......................................... 70

PAGE 9

9 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy MOLECULAR IMPROVEMENT FOR FAL L ARMYWORM RESISTANCE IN SUGARCANE, TIFEAGLE AND TIFTON 85 By Sunil Joshi December 2009 Chair: Maria Gallo Major: Agronomy Sugarcane ( Saccharum spp. hybrids ) is a tropical grass native to Asia. Florida is the largest producer of sugarcane in the U.S. followed by Louisiana, Hawaii, and Texas. TifEagle [Cynodon dactylon (L.) Pers. X C. transvaalensis Burtt Davy] is a warm season, triploid bermudagrass cultivar that provides high quality turf and is an ideal grass for gol f course putting greens. Tifton 85 [Cynodon dactylon (L.) Pers. X C. transvaalensis Burtt Davy] is a warm season perennial forage grass with high yield and superior quality. All of these grasses are susceptible to the insect pest, fall armyworm (FAW) Spodoptera frugiperda (J.E. Smith) (Le pidoptera: Noctuidae) Therefore, the goal of the present research was to incorporate resistance against the rice strain of FAW through the introduction and expression of a Bacillus thuringiensis (Bt) endotoxin gene via genetic engineering. This approach w as chosen because traditional breeding is laborious and difficult for sugarcane, a highly aneu polyploid crop, and imp ossible for TifEagle and Tifton 85 due to sterility. A long term goal is to produce transgenic sugarcane in a relatively short period of t ime by bypassing a callus phase. Therefore, an initail study was conducted to evaluate a direct regeneration tissue culture system using three cultivars, CP84 1198, CP88 1762 and CP892143.

PAGE 10

10 Such as system has advantages over callus -based methods in that less time is required to produce transgenic plants and there is less of a dependency on tissue culture, thereby potentially reducing somaclonal variation. The importance of explant distance from the meristem and orientation of the explants was examined for induction of shoots and roots. The greatest number of shoots was produced by CP88 1762, followed by CP892143 and CP84 1198 from explants closest to the meristem that were oriented vertically on the medium. The most roots were produced by CP841198, followed by CP88 1762 and CP89 2143. Overall, CP88 1762 was the best cultivar among the three for the production of plantlets via direct organogenesis followed by CP89 2143 and CP84 1198. Therefore CP88 1762 will be used in future experiments to optimize this tissue culture system in conjunction with a n Agrobacterium -mediated transformation protocol. To produce sugarcane transgenics with resistance to the rice strain of FAW, biolistics was used to introduce the Bt cry1Fa gene encoding a -endotoxin that has been effective in protecting against lepidopteran pests. Sugarcane embryogenic callus was co-bombarded with a cry1Fa gene cassette and a n nptII gene cassette as the selectable marker. Four independent sugarcane transgenic lines of CP8 4 1198 were obtained showing stable integration of multiple copies of the cry1Fa gene. A qualitative immuno -chromatographic assay indicated that two of the four transgenic lines had Cry1F a levels above the detect ion level of the assay A semi -quantitative immunoassay, based on the QualiPlateTM kit for Cry1F (EnviroLogixTM), showed that the same two lines had Cry1Fa levels equal to or more than the Cry1F levels found in Herculex I corn or WideStrike cotton while the remaining two lines had low er levels of Cry1Fa These transgenics were subjected to FAW laboratory bioassays over a 5 -day period. Rice strain larvae showed intense feeding on wild type leaves along with high weight gains, while those fed leaves from the four transgenic lines showed significan tly limited feeding a nd weight gain.

PAGE 11

11 Additionally, the FAW larvae showed high mortality rate s when fed the transgenic leaves particularly for the two lines that expressed the higher levels of Cry1Fa. This is the first report of transgenic Bt sugarcane con ferring resistance to FAW, and future work will test their efficacy in the field. For Tifton 85 and TifEagle a successful direct regeneration protocol using stolon node explants was developed This tissue culture system was used with Agrobacterium infecti on in transformation experiments One transgenic TifEagle line containing cry1Fa was obtained using Agrobacterium tumefaciens strain AGLO, but this approach was unsuccessful for obtaining transgenic Tifton 85. The transgenic cry1Fa TifEagle line was subjected to FAW bioassays However, no differences in FAW larval weight gain or mortality were found suggesting that the level of expression of cry1Fa in this line was insufficient to provide resistance to the rice strain of FAW

PAGE 12

12 CHAPTER 1 INTRODUCTION Sug arcane (Saccharum spp. hybrids) is a tropical grass native to Asia. In Florida, sugarcane is grown near the southern and eastern shores of Lake Okeechobee. Palm Beach County accounts for approximately 70% of the acreage and 75% of the total harvested tonna ge (Glaz et al., 200 4 ). The remainder is grown in the adjacent counties of Hendry, Glades, and Martin. Florida is the largest producer of sugarcane in the U S followed by Louisiana, Hawaii and Texas. TifEagle [ Cynodon dactylon (L ) Pers. X C. transvaale nsis Burtt Davy] is a warm season bermudagrass grown in tropical regions of the world normally providing high quality turf for golf course putting greens (Bunnell et al. 2005). It has a distinct genetic background, turf density, and an ability to tolerate extremely low cutting heights. TifEagle is grown throughout Florida on numerous golf courses (Bunnell et al. 2005). There are approximately 3.5 million acres of improved perennial pasture grasses in Florida. Bermudagrass is the most important pasture gra ss in southern U.S. (Mitich, 1989; Burton and Hanna, 1995) cover ing an area of 12 million ha for grazing and hay production (Taliaferro et al., 2004). Tifton 85 [ Cynodon dactylon (L ) Pers. X C. transvaalensis Burtt Davy] is a high quality forage grass p roducinghigh yields of hay and pasture s resulting in large live weight gains in cattle. It was ranked first in forage production in 1992 (Burton et al. 1993 ). It has 34% higher dry matter yield, 47% higher digestible yield, and superior animal performance with growing steers compared to coastal bermudagrass (Cynodon dactylon), (Mandebvu et al., 1999). It has become the standard by which other bermudagrass varieties are compared (Hill et al., 2001; Evers et al., 2004).

PAGE 13

13 All of the above grasses are susceptib le to fall armyworm (FAW) Spodoptera frugiperda (J.E.Smith) (Lepidoptera: Noctuidae) Fall armyworm is one of the most devastating insect pests in the southeastern U S causing seasonal economic losses (Sparks, 1979; Meagher and Nagoshi, 2004). It prefers more than 60 host plants including corn (Zea mays L. ), sorghum (Sorghum bicolor L. ), and grasses such as common bermudagrass [Cynodon dactylon ( L ) Pers ] (Luginbill, 1928). Fall armyworm consists of two morphologically i ndistinguishable strains, a corn strain that prefers corn, cotton ( Gossypium hirsutum L.) and sorghum, and a rice strain that prefers rice (Ory za sativa L.) and bermudagrass (Pashley, 1986; Pash ley, 1988; Pashley et al., 1995). The rice strain is more specialized to preferred plant host s than the corn strain Previous research has also shown that rice strain larvae complete larval development and gain weight more rapidly on bermudagrass than on other grasses ( Pashley et al., 1995). The main goal of this research was to incorporate resistan ce against FAW into sugarcane, TifEagle and Tifton 85 through genetic engineering. Developing FAW resistance through traditional breeding in sugarcane is time consuming and laborious due to its high ploidy level (2n = 36 170), low fertility and high geno type by environment interaction (Gallo Meagher and Irvine, 1996). Developing resistance against FAW in TifEagle and Tifton 85 is not possible through traditional breeding because both grasses are sterile. F ield trials with corn hybrids expressing a full le ngth cry1F a gene (Hercule x I), isolated from Bacillus thuringeinsis aizawai indicated that this gene provides protection against FAW The expressed Cry1F a protein also effectively controls other lepidopteran insect larvae including European corn borer (E CB; Ostrinia nubilalis Hubner ), southwestern corn borer (SWCB; Diatraea grandiosella Dyar) and black cutworm ( Agrostis ipsilon Hufnagel ) (EPA, 2001).

PAGE 14

14 However, this gene has not been used to develop insect resistance in sugarcane, TifEa gle, or Tifton 85. T herefore genetic engineering of cry1Fa into these grasses offers a viable and attractive approach for incorporating FAW resistance in to these grasses. Specific objectives of the research were to : develop rapid and efficient tissue culture regeneration sys tems for sug arcane, TifEagle, and Tifton 85, introduce cry1Fa into the three grasses using biolistic or Agrobacterium -mediated transformation methods, and characterize transgenics at the molecular level and determine their resistance to the rice strain of FAW in laboratory bioassays.

PAGE 15

15 CHAPTER 2 LITERATURE REVIEW Sugarcane ( Saccharum spp. hybrids ) Sugarcane records date back to 510 BC At that time, r eeds which produce honey without bees was reported by Emperor Darius soldiers near the river Indus. Suga rcane then spread westward with the conquest of India by Alexander the Great in 327 BC (Purseglove, 1972). Sugarcane was brought to Europe along with the Crusades in the 11th century, and in 1319 the first large shipment of sugar reached England. Sugar can e spread quickly in the 1400s and in 1420 it reached the Canary Islands, and from there it was introduced to the New World by Columbus in 1493 (Cordeiro et al., 2007). Currently, s ugarcane is the main sugar producing crop in the tropical and subtropical r egions of the world (James, 2004). Sugarcane belongs to the genus Saccharum L., first established by Linnaeus in Species P lantarum in 1753 with two species: S. officinarum and S. spicalum The genus is in the tribe Andropogoneae in the grass family Poace ae. The tribe includes other tropical grasses such as s orghum and corn (Cordeiro et al., 2007). Very closely related to Saccharum are another four genera that readily interbreed, forming what is now commonly referred to as the Saccharum complex (Daniels and Roach, 1987). The other four genera are Erianthus section Ripidum Miscanthus section Diandra, Narenga and Sclerostachya All have a high level of polyploidy, and aneuploidy creating a challenge for taxonomist s (Daniels and Roach, 1987; Sreenivasan et al 1987). There are now six species of Saccharum that have been revised from the original classification of Linnaeus: S. officinarum known as noble cane; S. spontaneum S. robustum and S. edule classified as wild species; and S. sinense and S. barberi classified as ancient hybrids (Buzacott 1965; Daniels and Roach, 1987; DHont and Layssac 1998). Saccharum officinarum is

PAGE 16

16 high in sucrose content and is primarily used for sugar production. It is characterized as being moderately tall, of various colors with thick stalks and low fiber. It has a chromosome number of 2n = 80 with a basic chromosome number (x) of 10 (DHont et al., 1998). As mentioned above, S. spontaneum is a wild species. It has thinner canes, high variability in morphology, high fiber a nd relatively little sugar. Its chromosome number varies from 2n = 40 to 128 with x = 8 (DHont et al., 1998). It can be weedy and in countries such as Thailand, India, the Philippines and Indonesia it is considered a serious weed that compet es with othe r crops (Holm et al., 1997). In the early 19th century, clones of S. officinarum were crossed with S. spontaneum and backcrossed twice with S. officinarum as the recurrent parent to produce interspecific hybrids. S accharum officinarum transmitted its soma tic chromosome number during the first hybridization and the first backcross in contrast to the S. spontaneum clones. The chromosome number after the second backcross bec a me normal (Bremer 1961). This process, referred to as nobilisation, has resulted in modern varieties with genomes that comprise multiple sets of homologous chromosomes derived from a single species (autopolyploid), as well as possessing two or more unlike sets of chromosomes (allopolyp loid) (Sreenivasan et al. 1987), and having a high t otal chromosome number (2n = 36 to 1 70) with about 80% of the genome derived from S. officinarum and the remainder from S. spontaneum Bermudagrass ( Cynodon spp.) Bermudagrass ( Cynodon spp.) is an important warm -season perennial grass that grows in the temperate and tropical regions of the world Bermudagrass has a rhizomatous and stoloniferous growth habit ( McCarty and Miller, 2002). It can grow in diverse soil and moisture conditions withstanding drought well and also tending to eliminate other plant s. Bermudagrass is a good grass to use for soil conservation because it has long runners that root at the node (Hu et al., 2005). Its origin can be t raced back to sub -humid rangelands around the Indian Ocean from eastern Africa to

PAGE 17

17 the East Indies. Bermuda grass was believed to have been imported to the U.S. around 1751 from Africa (McCarty and Miller, 2002). Common bermudagrass [Cynodon dactylon (L. ) Pers. ] has 36 chromosomes and is adapted to most soils due to its fast growing habit. It is a coarse texture d, dense grass that is favored for its tolerance of low mowing heights, soil salinity, traffic, drought tolerance and rapid recovery from damage. However, it has very poor shade tolerance, a high nitrogen requirement, produces many seed heads and it will go dormant (brown) when temperatures fall below 10 C (McCarty and Miller, 2002). Hybrid bermudagrass, the result of an interspecific cross [C. dactylon (L. ) Pers. X C. transvaalensis Burt t Davy ], has 2n = 3x = 27 chromosomes (McCarty and Miller, 2002). T hese grasses have finer leaf textures, low growth habits and higher shoot densities. Hybrid cultivars are sterile, produce stolons and rhizomes and have good winter color as compared to other grasses. These triploid grasses can be mowed at lower heights w hich recover quickly and provide a uniform consistent playing surface for golf. The first hybrid released in the U.S. was Tiffine in 1953. Since then there have been numerous releases and today nearly all golf courses and sports fields use hybrids (McCar ty and Miller, 2002; Unruh and Elliott, 1999). Another hybrid Tifdwarf was released in 1965 and quickly became a favorite among superintendents in the south (Burton, 1966). Tifdwarf is still used today to some extent and is a standard to which other putt ing green grasses are compared. In recent years several cultivars, including Champion, FloraDwarf, MiniVerde, MS Supreme and TifEagle, have been released and they have shorter internode lengths, smaller leaf blades and denser stands compared to Tifdwarf (Gray and White, 1999). These cultivars are referred to as ultradwarfs.

PAGE 18

18 The ultradwarf TifEagle was cooperatively released by the USDA -ARS and the University of Georgia Coastal Plain Experiment Station in 1997 (Hanna and Elsner, 1999). TifEagle has a dark green color, a prostrate growth habit, and can be maintained at very low mowing heights (0.30 cm) for short periods of time. TifEagle is a high maintenance grass that is prone to thatch development and require s full sun for at least six to eight hours for optimum growth. U ltradwarfs like TifEagle are best maintained on golf courses with sufficient labor and maintenance budgets (Gray and White, 1999; McCarty and Miller, 2002). Bermudagrasses are superior pasture and fodder grass es and they stay green during hot weather ( Hu et al., 2005). Tifton 85 is a pentaploid hybrid forage bermudagrass (Burton et al. 1993). It is the most popular warm -season perennial grass for hay production and pastures in the southern U S (Taliaferro et al., 2004). It has thicker stem s, broader leaves and is sterile. It is taller than other bermudagrass cultivars, with a darker green color and very large, fast growing stolons (Burton et al 1993). It has a higher nutritive content and is more drought resistant than c oastal bermudagrass but it is not more cold resistant. It produces best in deep, droughty sands and although it can grow in clay and backlands, they are not optimum sites. It out performs c oastal bermudagrass and bahiagrass ( Paspalum notatum F lu e gge ) in t erms of dry matter yields (Burton et al. 1993) Fall Armyworm Spodoptera frugiperda (J.E. Smith ) Fall a rmyworm (FAW), Spodoptera frugiperda (J.E. Smith) is a significant economic pest in most of the continental U S. It can cause substantial losses i n ma ize ( Zea mays ), sorghum (Sorghum bicolor ), forage grass, turf grass rice (Oryza sativa ), cotton (Gossypium hirsutum L.) and peanut (Arachis hypogaea) production (Luginbill, 1928; Sparks, 1979). Because it cannot survive prolonged freezing temperatures, i t overwinters in southern Florida and southern Texas and then migrates annually to cause infestations in the continental U S (Barfield et al. 1980).

PAGE 19

19 Knipling (1980) stated that if overwintering populations in Florida were the primary source of the infesta tions, a rigid suppression program in the overwintering areas would have a great impact on the FAW population throughout the southeastern and Atlantic coast regions. Fall armyworm consists of two host -strains: the corn strain that feeds predominantly on c orn (Zea mays L.), and the rice strain that feeds on smaller grasses such as rice ( Oryza sativa L.) and bermudagrass (Pashley et al., 1985; Pashley, 1986). In Florida, insects collected throughout overwintering areas consist of both strains (Meagher and G allo -Meagher 2003, Meagher and Nagoshi 2004, Nagoshi and Meagher 2004). These t wo strains exhibit polymorphism at five allozyme loci ( Pashley, 1986), in their mitochondrial DNA (mtDNA) ( Pashley 1989; Lu and Adang, 1996) and in their nuclear DNA ( Lu et al. 1992). Recently, s everal restriction sites in the cytochrome oxidase 1 gene have been identified by sequenc e analysis and may potentially be specific to one of the two FAW host strains (Nagoshi et al., 2006). Rice strain larvae appear to be more susceptible to transgenic Bacillus thuringiensis Berliner (Bt) cotton than corn strain larvae ( Pashley et al. 1987; Adamczyk et al. 1997). Additionally, there have been distinct differences in feeding of bermudagrass genotypes in laboratory and field studies with rice strain larvae generally gaining more weight and consuming more plant material than corn strain larvae ( Pashley et al. 1987; Quisenberry and Whitford 1988; Meagher et al., 2007). Bacillus thuringiensis Berliner ( Bt ) Bacillus thuringiensis Berliner (Bt) is a naturally occurring gram positive rod shaped bacterium with pesticidal properties due to the production of toxic proteins (Glare and OCallaghan 2000). There are more than 60 serotypes and hundreds of different subspecies that have been described for Bt out of which kurstaki ( Btk ) is effective against l epidoptera and i sraelensis (Bti) is effective against Diptera. Some other species of Bacillus such as popilliae and sphaericus are effective against Coleoptera and Diptera, respectively (Nester et al., 200 2 ).

PAGE 20

20 During sporulation, Bt produces parasporal crystals that are comprised of one or more related i nsecticidal crystal proteins (ICPs) encoded by crystal (cry ) and cytolytic (cyt ) genes (Nester et al., 2002 ). Insec t larvae feeding on plant surfaces ingest these parasporal crystals which are then dissolved in the juices of the midgut T he proteins are activated then by enzyme proteases in the juices which typically are alkaline. These activated proteins also known a s -endotoxins (or Cry p roteins ), bind to specific receptors on the insect midgut epithelium (Hofmann et al., 1988) causing a disruption in membrane integrity and ultimately death (H fte et al., 1986) .These specific receptors are responsible for the narrow h ost specificity (Hfte et al., 1986) T he -endotoxins produced in Bt are packaged into parasporal inclusions in the ir tertiary conformation. This tertiary structure consists of three different domains, I, II and III. Domain I is -helices, d that are folded into loops de Maagd et al., 2003) D omain I due to is capabl e of forming pores in the cell membranes of the larval midgut. Domain II basically determines the insecticidal specificity of the toxin as it is hyper variable in nature and domain III is involved in a variety of functions like structural stability, ion c hannel gating, binding to the brush border membrane vesicles and also insecticidal specificity (Li et al., 1991). These three domains interact closely to bring about insecticidal activity of the protein. Cry Proteins The Cry proteins disrupt the ion regulation of the insect midgut by increasing the potassium permeability and the toxins may also form non-specific pores. These non -specific pores are permeable to small ions and molecules and these pores will enlarge forming osmotic swelling and eventually ce ll death (Sacchi et al., 1986)

PAGE 21

21 Different Cry proteins have different levels of toxicity for different insects. This may be due to a different three -dimensional structure of the Cry protein and therefore different binding sites and binding specificities de pending upon the receptor proteins However, binding of a Cry protein does not always indicate its toxicity. Some Cry proteins may have common binding sites due to similar structure s and some may have different sites. D ifferent cry genes encode different Cry proteins. There are four different classes of cry genes which have retained the names they received under the system of H fte and Whit e ley (1989), but with a substitution of Arabic for roman numerals. The cry 1 genes encode proteins toxic to lepidoptera ns; cry2 genes encode proteins toxic to both lepidopterans and dipterans; cry 3 genes encode proteins toxic to coleopterans; and cry4 genes encode proteins toxic to dipterans. Under the revised system, there are curren tly Cry1 through Cry22 proteins (Crickm ore et al., 1998). For the Cry1 toxins, the C terminal portion of the 133kDa protoxin is removed by proteolysis, leaving an active toxin of ca. 65 kDa. The active toxin, located in the N terminal half of the protoxin, binds to the insect receptors (Knight et al., 1994; Sangadala et al., 1994). In corn Herculex I was developed in collaboration between Dow Agro Sciences LLC and Pioneer Hi Bred International, Inc. and it contains the cry1F trans gene. The cry1F gene expresses an insecticidal protein (Cry1F) derived from B acillus thuriengenesis aizawai Expression of the cry1Fa gene has been shown recently to enhance resistance against FAW in bahiagrass ( Paspalum notatum Flu e gge ) (Luciani et al., 2007). Tissue Culture Systems for Sugarcane and Bermudagrasses Generally, t issue culture protocols are a pre requisite for successful plant transformation. Plant tissue culture and regeneration systems have been extended from dicot crop plants to many monocot species. Substantial progress in tissue culture with previously recalcitrant grasses has been made through the examination of important factors like genotype (Maddock et al. 1983;

PAGE 22

22 Krumbiegel -Schroeren et al. 1984), donor plant quality (Lu et al. 1984; Zimmy and Lrz 1989), explant type, and media composition ( Eapen and Rao 1982; Lu et al. 1984). Vasil ( 1987) reviewed and generalized the key strategies to establish regenerable cell culture s for grass species. They are as follows: (i) choose explants that have meristematic tissues and undifferentiated cells suc h as immature embryos or seeds, leaf base meristems, and meristematic segments of young inflorescences (ii) use culture medium supplemented with high concentrations of strong auxins, such as 2,4-dichlorophenoxyacetic acid (2,4 D) and 3,6 dichloro o anisic acid (dicamba) for inducing embryogenic calli and (iii) use embryogenic calli -derived cell suspensions for protoplast isolation. These strategies have led to the development of successful regeneration systems for sugarcane and all major turfgrass species Among monocotyledonous crops s ugarcane was one of the first to be successfully used in tissue culture (Barba and Nickell 1969), plant regeneration (Heinz andMee, 1969), and protoplast isolation (Nickell and Heinz, 1973). R egeneration through somatic e mbryogenesis or organogenesis has been well characterized (Ho and Vasil 1983; Guiderdoni and Demarly, 1988; Taylor et al., 1995 ). Studies have been conducted to assess the extent of variability arising from in vitro regeneration and its transmission into successive generations via vegetative propagation (Lourens and Martin, 1987; Burner and Grisham, 1995). These investigations demonstrated that large amount s of somaclonal variability occur in in vitro derived propagules, irrespective of the method of regeneration. For small grass species, Dale (1980) did a pioneer study in plant regeneration with the establishment of an embryogenic culture of Italian ryegrass ( Lolium multiflorum Lain.) from immature embryos. Even though direct somatic embryogenesis was achi eved in orchardgrass (Dactylis glomerata L.) from mesophyll cells (Harming and Conger, 1982; Conger et al., 1983)

PAGE 23

23 plant regeneration from embryogenic callus is the single most important path for turfgrass, as many major bermudagrass species have been regen erated in this way. Bermudagrasses have similar culture medium requirements as those for other grass species. Generally high salt nutrient solutions such as the Murashige and Skoog (MS) medium, the most frequently used medium for bermudagrass, and modified CC -medium with 3 to 12% sucrose as well as high concentrations of strong auxins such as 2, 4 D and dicamba have been used (Murashige and Skoog, 1962; Potrykus et al., 1979; Nielsen and Knudsen, 1993). To promote callus initiation in turf grass species c ytokinins such as 6 benzylaminopurine (6 BA) and N (2 furanylmethyl) lH -purin 6 amine (kinetin), at low concentration, in combination with auxins is used. Addition of casein hydrolysate to the culture medium was found to be beneficial for embryogenic ca llus initiation (Artunduaga et al., 1988). Shetty and Asano, (1991) showed that proline and glutamine have stimulatory effects on callus induction among the organic N compounds tested in Agrostis alba L. Callus induction and plant regeneration from young inflorescences of common and hybrid bermudagrass was first reported by Ahn et al. (1985). Although calli have been readily induced from vegetative tissues such as nodal segments of some turf type bermudagrass varieties (Chaudhury and Qu, 2000) regenerable callu s mostly has been obtained from immature inflorescence culture (Ahn et al., 1985, 1987; Artunduaga et al., 1988, 1989; Chaudhury and Qu, 2000; Li and Qu, 2002). Albinism has also been encountered during plant regeneration (Artunduaga et al. 1988). A rtunduaga et al. (1989) reported an improved tissue culture response of the common bermudagrass cultivar Zebra by using a combination of 13.6 M 2, 4 D and 200 mg l 1 casein hydrolysate in the culture medium. Chaudhury and Qu (2000) substantially improved green plantlet regeneration of turf type bermudagrass by lowering the level of 2, 4 D (4.5 M) and

PAGE 24

24 adding BAP (0.04 M) to the MS (Murashige and Skoog 1962) callus induction medium. Li and Qu,(2002) showed that somatic embryo formation of the hybrid bermudagrass variety Tifgreen can be further improved by including ABA in the callus induction medium and the germination/regeneration of somatic embryos was accelerated by supplementing Gibberellic acid in the regeneration medium. They also observed repetitive somatic embryogenesis in tissue culture of common bermudagrass var iety Savannah and showed that somatic embryogenesis is a major route for plant regeneration in bermudagrass revealed through scanning electron microscopic studies. A callus -free method for t he production of transgenic plants from bermudagrass ( Cynodon spp.) and creeping bentgrass ( Agrostis stolonifera ) was developed by Wang and Ge (2005). They used stolon nodes as explants and successfully bypassed the callus formation phase by direct infecti on of stolon nodes with Agrobacterium followed by rapid regeneration of transgenic plants. Also in Zoysia grass ( Zoysia japonica steud.) direct shoot formation from stolons was used to develop an efficient transformation method using Agrobacterium (Ge et a l., 2006). Biolistics and Agrobacterim -mediated Transformation To develop transgenic crops, a foreign gene(s) must stably be integrated into the genome. In order to do that, usually an efficient protocol for plant regeneration has to be established, as men tioned above, as well as effective DNA delivery, transgenic tissue selection and recovery of normal, fertile phenotypes. T hese protocols should be highly reproducible so that they can be used on a large scale and in a short time frame. In monocot transfor mation, the genes encoding hygromycin phosphotransferase ( hpt ), phosphinothricin acetyltransferase ( pat or bar ), and neomycin phosphotransferase ( npt II ) are the most commonly used as selectable markers These genes driven by constitutive promoters such as the cauliflower mosaic virus (CaMV) 35S promoter or the maize ubiquitin promoter work

PAGE 25

25 effectively for selection of transformed cells (Cheng et al., 2004 ). Currently, two DNA delivery methods are the most widely employed: biolistic transformation, and Agr obacterium mediated transformation. Biolistic or micro projectile bombardment technology involves propelling high velocity micron sized tungsten or gold particles coated with foreign DNA into target plant tissues. These microprojectiles pass through the pl ant cell wall and nuclear envelope by simple diffusion mechanism to release and integrate the foreign DNA into the plant genome. The original observation was by Klein et al. (1987) indicating that tungsten particles could be used to introduce macromolecule s into epidermal cells of onion ( Allium cepa ) with subsequent transient expression of enzymes encoded by these compounds. Shortly thereafter, Christou et al. (1988) demonstrated that this process could be used to deliver biologically active DNA into living cells and produce stable transformants. The f oreign DNA used in biolistic experiments consists of a plant expression cassette inserted in to a vector such as a high copy number bacterial cloning plasmid. Either the entire plasmid or the minimal expression cassette without vector backbone can be delivered to the target tissues. DNA integration is in two stages: DNA transfer followed by DNA integration into the genome. DNA integration is less efficient than DNA transfer because DNA may enter the cell and be express ed for a short tim e (transient expression) but never integrate in to th e host genome and eventually it will be degrade d by nucleases. So transient expression following micro projectile bombardment with a reporter gene such as gusA or gfp often is use d to optimize gene transfer parameters or compare different expression constructs (Altpeter et al., 2005). Micro projectile bombardment has several advantages over Agrobacterium mediated gene transfer. It provides a wide range of transformation strategies and no vector sequences are

PAGE 26

26 required for efficient delivery of foreign DNA (Altpeter et al., 2005) Also, d ue to its physical nature, micro projectile bombardment is not limited by a pathogen -host interaction that characterizes Agrobacterium mediated tran sformation. Therefore, it is used on a broad range of targets including not only those plants considered as recalcitrant such as cereals and grasses, but also other living organisms such as bacteria, fungi, algae, insects and mammals (Hansen and Wright, 1999; Newell, 2000; Taylor and Fauquet, 2002, Altpeter et al., 2005). Addtionally, different cell types can be targetted by microprojectile bombardment and multiple gene constructs can be delivered simultaneously. According to a re view by Dafny -Yelin and Tzf ira (2007) 12 different plasmids were used to deliver 12 d ifferent gene constructs in soy bean ( Glycine max L. ) embryogenic suspension culture s (Hadi et al., 1996), a nd t here has been successful integration of 1 1 different transgenes with a mixture of 14 d ifferent plasmids in rice embryogenic cultures (Chen et al., 1998). Investigations of microprojectile -mediated transformation by Franks and Birch (1991) in Australia led to the development of the first transgenic sugarcane plants from a commercial cultiva r in 1992 (Bower and Birch, 1992). Subsequently, micro projectile -mediated transformation of several commercially cultivated sugarcane genotypes has been reported from a number of laboratories worldwide ( e.g. Birch and Maretzki, 1993; Gallo -Meagher and Irvi ne, 1996; Bower et al., 1996; Birch, 1997; Irvine and Mirkov, 1997; Joyce et al., 1998a, b; Nutt et al., 1999; Jain et al., 2007). Among the different explants used embryogenic callus appears to be the preferred target due to its high transformability and regenerability. Additionally, immature leaf whorls and inflorescences have b een successfully used for micro projectile -mediated sugarcane transformation (Elliott et al., 2002; Lakshmanan et al., 2003)

PAGE 27

27 The production of stable transgenic forage and turf grasses through microprojectile bombardment has also been achieved and include tall fescue ( Festuca arundinacea Schreb.) (Takamizo et al., 1995; Ha et al., 1992 ), red fescue ( Festuca rubra L.) (Spagenberg et al., 1995) ryegrass ( Lolium perenne L.) (Ye et a l., 1997) bermudagrass [ Cynodon dactylon (L.) Pers.] (Zhang et al., 2003) and creeping bentgrass ( Agrostis palustris ) (Xiao and Ha, 1997) Specifically, earlier studies indicated the successful transformation and regeneration of fescue using tall fescue p rotoplasts (Ha et al., 1992) and tall and red fescue embryogenic cell suspensions (Spagenberg et al., 1995). Altpeter and Xu (2000) developed robust protocols with efficient selection systems to generate large numbers of red fescue plants using the nptII gene and paromomycin as the selective agent. Altpeter et al. (2000) reported a rapid and efficient protocol for generating perennial ryegrass plants by using an expression cassette with the ubiquitin promoter and the nptII gene and obtained the highest tra nsformation efficiencies (4 11%) using calli derived from immature inflorescences and embryos in nine to 12 weeks. Production of transgenic common an d triploid bermudagrass via biolistics has met with variable success probably due to rather in efficient tr ansformation, regeneration and selection protocols (Li and Qu, 2004). A successful transformation system for TifEagle was established using embryogenic callus as recipient material producing homogenously transgenic plants showing stable transcription of th e hpt gene following biolistics (Zhang et al., 2003). A h erbicide resistance protocol was also developed for biolistic transformation of TifEagle using the bar gene producing 89 transgenic plants (Goldman et al., 2004b ). Agrobacterium tumefaciens is a gram -negative, soil phytopathogen that produces a crown gall disease and naturally infects different dicotyledonous plants. This disease is characterized by the tum o rous growth of plant tissue s in the stem due to the transfer of the T -DNA region of the

PAGE 28

28 tumor i nducing ( Ti ) plasmid T he T DNA contains genes encoding enzymes involved in the synthesis of growth regulators that induc e plant cell growth and tumor formation, and the production of opines that support bacterial growth (Zupan et al., 200 0 ). The first ac hievement in Agrobacterium transformation was the removal of wild type T DNA from Ti plasmids to generate disarmed strains (Hoe kema et al., 1983). Initially Agrobacterium mediated transformation was only successful in dicots because they are the natura l host s for the bacterium. Therefore, t o overcome the host plant specificity, Agrobacterium mediated transformation was optimized through the use of hypervirulent strains v irulence gene inducing agents ( i.e. acetosyringone), effective elimination of Agrobacterium after cocultivation, and antioxidants and cysteine in the co -culture medium (Hiei et al. 1994; Ishida et al. 1996; Tingay et al. 1997; Frame et al. 2002). Additionally, t o improve transformation efficiency, specific protocols for bacterial infecti on, inoculation, co-cultivation plant selection and regeneration were developed according to the specific requirements of the bacterial strain used and the plant host to be transformed. Consequently, the Agrobacterium host range has been extended to impor tant crop plant s such as corn, rice, wheat (Triticum a e stivum ), barley (Hordeum vulgare ), sugarcane and other grasses (Hansen and Wright, 1999; Newell, 2000; Gelvin, 2003). Although efforts were made initially by Birch and Maretzki (1993) to produce transgenic sugarcane plants using A grobacterium Arencibia et al. (1998) were the first to regenerate normal transgenic sugarcane plants from co -cultivation of calluses with LBA 4404 and EHA 101 strains Their success was based on the use of young regenerable ca llus as target tissue and pre induction of organogenesis and somatic embryogenesis to increase the T DNA transfer process. Enriquez Obregon et al. (1998) reported the production of transgenic sugarcane plants resistant to phosphinothricine (PPT), the active compound of the herbicide BASTA using the meristematic

PAGE 29

29 region of sugarcane treated with antinecrotic compounds such as silver nitrate and abscorbic acid. More recently transgenic plants carrying bar and gus under control of the CaMV 35S promoter and npt II driven by the nos (nopaline synthase) promoter were generated with a high efficiency (~50%) using axillary meristems of sugarcane inoculated with either Agrobacterium LBA 4404 or EHA 105 strains (Manickavasagam et al., 2004). A tumefaciens also has be en used successfully to transform perennial grasses like creeping bentgrass (Yu et al. 2000), switchgrass ( Panicum virgatum L. ; Somleva et al. 2002), zoysiagrass (Toyama et al. 2003; Ge et al., 2006 ), tall fescue (Bettany et al., 2003), perennial ryegrass (Altpeter 2006; Bajaj et al., 2006 ), bermudagrass (Ge and Wang 2005 ; Hu et al., 2005) and orchardgrass (Lee et al. 2006). Wang and Ge (2005) made substantial improvements in the Agrobacterium mediated transformation of bermudagrass and creeping bentgra ss ( Agrostis stolonifera ) by using stolon nodes to produce transgenic green shoots. This method bypassed the callus formation phase thereby saving time, and resulted in transgenic plantlets within seven weeks with a transformation efficiency of 4.8 % 6.1 % for bermudagrass and 6.3 % 11.3 % for creeping bentgrass. Ge et al. (2006) also used stolon node explants to produce transgenic zoysiagrass ( Zoysia japonica Steud.) plants within 10 12 weeks with a transformation efficiency of 6.8 %. Other Agrobacteri um mediated transformation protocols that bypass tissue culture by using in vivo inoculations have been developed in the model species Arabidopsis thaliana using the floral dip method (Clough and Bent, 1998), Medicago truncatula via infiltration of seed lings (Wang et al., 1996), and Nicotiana tabacum (Dasgupta et al., 2001). All of these method s have the added advantage that generally transgene integration patterns are simpler compared with those transgene integration patterns produced following tissue c ulture and transformation.

PAGE 30

30 CHAPTER 3 COMPARATIVE ANALYSIS OF DIRECT PLANT REGENERATION FROM YOUNG LEAF SEGMENTS OF THREE DIFFERENT SUGARCANE CULTIVARS Introduction Sugarcane ( Saccharum spp. hybrid) is a complex aneu polyploid hybrid of noble sugarcane S officinarum (2n = 70122) and S. spontaneum (2n = 36128). Due to its adaptability to both tropical and subtropical conditions, sugarcane is considered one of the most efficacious biomass crops and is now being targeted for use in biofuel production alon g with its traditional use as a sugar crop (Nonato et al., 2001; McQualter et al. 2004 Lakshmanan et al. 2005). The complex ploidy level and low fertility of sugarcane make breeding for improved cultivars difficult; therefore it is a superior candidate f or improvement through genetic engineering. M uch research has been done to develop efficient genetic transformation systems for sugarcane ( e.g. Chen et al., 1987; Bower and Birch, 1992; Rathus and Birch, 1992; Birch and Maretzki, 1993; Gambley et al., 1993, 1994; Birch, 1997; Arencibia et al., 1998; Enriquez Obregon et al., 1998). Different transformation techniques using electroporation (Rathus and Birch, 1992), polyethylene glycol (PEG) treatment (Chen et al., 1987), microprojectile bombardment ( e.g. Fr anks and Birch, 1991) and Agrobacterium -mediated transformation (Arencibia et al., 1998; Elliott et al., 1998 ; Manickavasagam et al., 2004; Santosa et al., 2004; Zhangsun et al., 2007) have been used to introduce trans genes in to sugarcane cells and callus. However to -date, most transgenic sugarcane has been produced using microprojectile bombardment with traits such as herbicide resistance (Chowdhury and Vasil, 1992; Gallo-Meagher and Irvine, 1996; Falco et al., 2000; Leibbrandt and Snyman, 2003) and insect resistance (S tamou et al., 2002; Falco and Silva -Filho, 2003; Weng et al., 2006; Christy et al., 2009). For most grasses like sugarcane callus induction and plant regeneration from the induced callus is not only time consuming but can cause somaclonal variation (Spangenberg et al., 1998;

PAGE 31

31 Choi et al., 2000; Goldman et al., 2004b ). As discussed in Lakshmanan et al. (2006 ), the first report of large variations in both chromosome number and morphological traits in sugarcane plants regenerated from callus w as by Heinz and Mee (1971) Since then, there have been frequent reports of g enetic variability in tissue -cultured sugarcane ( Lourens and Martin, 1987; Burner and Grisham, 1995; Taylor e t al., 1995; Hoy et al., 2003), and numerous s tudies t o assess the ext ent of variability arising from in vitro regeneration and its transmission into successive generations via vegetative propagation (Lourens and Martin, 1987; Burner and Grisham, 1995). These investigations demonstrated that large amount s of somaclonal variability occur in in vitro -derived propagules, irrespective of the method of regeneration. Gilbert et al. (2009) reported the first successful gene transfer of sugarcane yellow leaf virus resistance in sugarcane and also the first report of variations in mic rosatellite repeat number associated with regeneration from embryogenic callus Consequently, i n sugarcane there is a need to develop a genotype -independent explant source that can be used for Agrobacterium mediated transformation and form shoots directly in a manner similar to that reported in Lakshmanan et al (2006). Such a system has been used successfully for grasses other than sugarcane thereby saving time while also increasing transformation efficiency and decreasing somaclonal variation (Ge et al., 2006; Wang and Ge, 2005) In this study, three sugarcane cultivars, CP84 1198, CP88 1762 and CP89 2143, were compared for their ability to undergo direct shoot and root regeneration T he efficiency of t heir direct regeneration response was examined relativ e to the explant source and its orientation on the culture medium

PAGE 32

32 Materials and Methods Preparation of Explants and Culture Conditions Shoot tops of four to eight -month -old, field grown sugarcane cultivars CP841198, CP881762 and CP89 2143, were obtai ned from the U.S. S ugarcane Field S tation ( USDA -ARS, Canal Point, Florida). After removing the outer mature leaves, the shoot tops were cut just below the first node and a 9 cm segment was treated with absolute ethanol for 1 min followed by immersion in 20% Clorox solution ( 6% sodium hypochlorite as active ingredient) containing two drops of Tween 20 for 20 min followed by four to five washes in sterile distilled water for 10 min each. From a single top five different explants numbered 1 to 5, with 1 being the explant closest to the first node and 5 being the farthest from the meristem were examined for direct regeneration (Figure 3 1 A ). Each explant was 0.5 cm in length and 1 cm in diameter. The five explants were placed on the same P etri plate (100 mm 25 mm) containing a medium reported in Gill et al. (2006) that consisted of Murashige -Skoog (MS) b asal salts (Sigma St. Louis, MO ) supplemented with 5 mg L1 naphthalene acetic acid and 0.5 mg L1 kinetin along with 2% (w/v) sucrose plus 5.6 mg L1 Agargel TM (Sigma, St. Louis, MO) The pH of the medium was adjusted to 5.8 before autoclaving. All plates were incubated at 26 C under a 16 hr photoperiod provided by cool white florescent tubes with a photon flux density of 5170 lux. For each experiment 24 sh oot tops per cultivar were sectioned into 120 explants with 60 placed vertically and 60 placed horizontally (Figure 3 1B) onto the medium (Figure 3 1 C) The effect of explant orientation was examined as well as the direct regeneration response of explants 1 5. V isual observations were taken every week and r egeneration rates were determined At the end of four weeks the number of shoots per explant, the number of shoots greater than 1 cm per explant and the number of roots per explant were obtained. The co mplete experiment was repeated three times on different starting dates Data were analyzed with the SAS PROC MIXED

PAGE 33

33 procedure using the LSMeans statement modified with Tukeys adjusted t test to separate treatment means of main effects (Littell et al., 19 96; SAS Institute, 2002). Unless otherwise specified, a probability of 1% was used to determine statistical differences. Results Shoot Production There were significant differences in shoot production among the three cultivars ( P < 0.0001; Table 3 1). CP 88 1762 produced the most shoots (50; Table 3 1; Figure 32A), followed by CP89 2143 (18; Table 3 1; Figure 3 2B), and CP841198 (9; Table 3 1). With regard to position of the explants from the first node, all cultivars displayed a similar linear trend wit h explant 1 (closest to the meristematic region) producing the most shoots (34), and explant 5 (19 ) producing the fewest shoots (Table 3 1). However, there was a significant interaction between explant orientation and cultivar ( P < 0.0015), and explant pos ition and cultivar ( P < 0.0001) with regard to the number of shoots produced. Because of these interactions, separate analyses for each cultivar was done for the number of shoots produced by explant orientation and position. In terms of explant orientatio n for the least responsive cultivar CP84 1198, the horizontal orientation (10) produced more shoots per explant than the vertical orientation (8; Table 3 2). Likewise for CP89 2143, the horizontal orientation (20) was better at producing shoots than the v ertical orientation (16; Table 3 2). Conversely, for the most responsive cultivar CP881762, the vertical orientation produced more shoots (56) than the horizontal orientation (45; Table 3 2). In terms of explant position, all cultivars produced more shoot s from explant 1 than from explant 5. However, CP881762 produced 26 more shoots from explant 1 versus explant 5 compared to only 8 more for CP84 1198 and 13 more for CP892143 (Table 32). This indicates that CP88 1762 is more responsive to explant dist ance from the shoot than other cultivars.

PAGE 34

34 Shoot Elongation The results for shoot elongation paralleled the results for shoot induction with significant differences among the three cultivars ( P < 0.001; Table 3 1). CP88 1762 produced the most shoots greater than 1 cm (36) followed by CP892143 (12) and CP84 1198 (6; Table3 1). With regard to the position of the explants, explant 1 produced the most elongated shoots (24), while explant 5 produced the least number of elongated shoots (12; Table3 1). However th ere was a significant interaction between the orientation and the cultivar ( P < 0.0001) and the explant position and the cultivar for the number of shoots greater than 1cm produced per explant ( P < 0.0001). Consequently, analys i s for each cultivar was done for the number of shoots greater than 1cm per explant. These two -way interactions are described in the next two paragraphs. The horizontal explant orientation, produced more shoots greater than 1 cm (7) than the vertical orientation in CP84 1198 (5; Tabl e 3 3) but only slightly. Conversely the vertical orientation produced 11 more elongated shoots (42) than horizontal orientation (31) in CP881762. Explant orientation made no difference in the number of elongated shoots produced from CP89 2143, Regarding explant position, the results were similar for all three cultivars with explants at position 1 producing more elongated shoots than the explants at position 5 (Table 3 3). However, the magnitude of the difference between the number of elongated shoots prod uced from explant 1 versus explant 5 varied among the cultivars indicating a difference in response to explant position among cultivars. CP881762 produced more than 46 elongated shoots from explant 1 and only 26 shoots from explant 5, a difference of 20 shoots (Table 3 3). In contrast, CP892143 produced only 10 more shoots greater than 1 cm at position 1 (18) than at position 5 (8; Table 3 3). Similarly, CP84 1198 produced only 4 more elongated shoots at position 1 (8) compared to position 5 (4; Table 3 3).

PAGE 35

35 Root Induction There were dramatic differences in root production among the three cultivars. CP84 1198 produced the most roots (41; Figure 3 2C), followed by CP88 1762 (28) and CP89 2143 (9; Table 3 1). With regard to explant position, explant 1 prod uced the most roots (30) as compared to explant 5 (21) which produced the fewest roots per explant (Table3 1). However, there was a significant interaction between explant orientation and cultivar ( P < 0.0001) and explant position and cultivar on the numbe r of roots produced per explant ( P < 0.0001). Due to this, analysis by cultivar was done for the number of roots per explant. For all three cultivars, the vertical orientation produced more roots than the horizontal orientation (Table 3 4). However, vertic ally oriented explants of CP84 1198 produced 52, more roots than horizontally oriented explants whereas CP88 1762 produced only 12 more and CP892143 produced only 2 more than the vertical position (Table 3 2). Regarding the effect of explant position on root production, the results were similar for CP94 1198 and CP88 1762 with explants at position 1 producing more roots than explants at position 5 in a general trend of decreasing root production as the distance from the meristem increased. However, CP89 2143 produced almost the same number of roots regardless of explant position (Table 3 4). Discussion Sugarcane biotechno logy research began in the 1960s and it was one of the first plant species to be successfully cultured and regenerated in vitro (Barb a and Nickell, 1969; Heinz and Mee, 1969) It has been studied extensively with regard to the development of efficient procedures for both micro propagation and transformation ( e.g. Ho and Vasil, 1983; Lee, 1987; Burner and Grisham, 1995; Chengalrayan and Ga llo Meagher, 2001) Previous research has shown that i t takes eight weeks to produce regenerable callus (Burner and Grisham, 1995) and 10 weeks to

PAGE 36

36 produce shoots from sugarcane callus on medium containing thidiazuron ( Chengalrayan and Gallo Meagher, 2001). Also a great deal of time and effort is required to maintain the callus (Lee, 1987; Burner and Grisham, 1995; Garcia et al., 2006 ). Consequently, t here has been considerable effort to develop direct plant regeneration methods for sugarcane. Successful a ttempt s have been made using a transverse thin cell layer culture system to produce plantlets that bypass the callus phase (Lakshmanan et al., 2006) In their study, explants that were 1cm in diameter and 1 2 mm in length produced more shoots compared to e xplants that were 5 mm in length Their results showed that the potential of leaf tissue to form shoots is greatly influenced not only by the size of the explants, but also by tissue polarity. The basal end which is closer to the shoot apical meristem w as significantly more prolific than the middle and the distal segment s Similar results were found in the present study as the explants closer to the meristem or the first node produced more shoots than those farthest from the first node Lakshmanan et al. (2 006) also showed that shoot regeneration was significantly reduced when the explants were cultured with their proximal sides in direct contact with the medium due to possible oxygen tension developing in the meristematic cells at th e explant -medium interfa ce. Due to their r esults, we maintained our explants with their distal ends in contact with the medium. Lakshmanan et al. (2006) also found that NAA was the best among a number of auxins tested for sugarcane shoot production. In the present work, 5 mg L1 NAA along with 0.5 mg L1 of kinetin was used and these hormone concentrations were previously shown to produce large numbers of shoots and roots for different sugarcane cultivars (Gill et al., 2006) Among the three cultivars used i n this study CP88 1762 was the most responsive to the tissue culture system (Table 3 1). It produce d the highest number of shoots and the most elongated shoots, along with a sufficient number of roots to produce viable plantlets that were easily

PAGE 37

37 transferred to small pots within eight weeks Therefore, of the three cultivars tested CP88 1762 is the best candidate for an Agrobacterium mediated transformation system using this direct regeneration approach. Although CP89 2143 took longer to regenerate and produced fewer shoots a nd roots it did make viable plantlets and could also be used for transformation However, under the conditions used in this study, CP84 1198 could produce roots but directly from the explants and not from any shoots that formed therefore viable plantlets were difficult to obtain (Table 3 1). There was production of phenolics by all cultivars but CP841198 produced more phenolics than the other two cultivars and that may have contributed to its poor shoot induction. Phenolics are intermediates of phenyl propanoid metabolism (Cvikrova et al., 199 8 ) and precursors of lignin (Lewis and Yamamoto, 1990). Their deposition in cell walls is an important defense mechanism after pathogen infection (Bolwell et al., 1985) Although CP84 1198 is prolific at producing embryogenic callus under different media formulations ( e.g. Chengalrayan and Gallo Meagher, 2001) it is not effective at direct regeneration under the culture conditions used in this study From this work, a general recommendation for direct regeneration of sugarcane, when using the culture conditions described, would be to select shoot explants that are close to the meristem orient them vertically with their distal ends in contact with the medium However cultivars should be independently evaluated be cause there can be significant genotype effects. Future work will employ CP88 1762 for Agrobacterium -mediated transformation using this direct regeneration protocol

PAGE 38

38 Figure 3 1. Sugarcane explants used for direct regeneration. A) Shoot secti on indicating the position of explants 1 5, B) Vertical orientation ( left, 1 cm diameter ) and horizontal orientation (right 0.5 cm length ), and C) Explants 1 5 placed in a vertical, left) or a horizontal (right) orientation.

PAGE 39

39 Table 3 1. Number of shoots number of shoots > 1cm, and number of roots per explant for three different sugarcane cultivars, five explants and two explant orientations. Number of Shoots Number of Shoots > 1 cm Number of Roots Cultivar CP84 1198 9 c 6 c 41 a CP88 1762 50 a 36 a 28 b CP89 2143 18 b 12 b 9 c Explant Position 1 34 a 24 a 30 a 2 29 b 21 b 28 b 3 25 c 17 c 26 c 4 22 d 15 d 25 c 5 19 e 12 e 21 d Orientation Horizontal 25 b 17 a 15 b Vertical 26 a 19 a 37 a Same letters in a column within a c ategory are not significant at P = 0.05 using the Tukey-Kramer adjusted t test. Table 3 2. Number of shoots per explant analyzed for each sugarcane cultivar. CP84 1198 CP88 1762 CP89 2143 Orientation Horizontal 10 a 45 b 20 a Vertical 8 b 56 a 16 b Explant Position 1 13 a 64 a 26 a 2 11 b 56 b 19 b 3 9 bc 49 c 16 bc 4 8 c 44 c 15 c 5 5 d 38 d 13 c Same letters in a column within a category are not significant at P = 0.05 using Tukey-Kramer adjusted t test.

PAGE 40

40 Table 3 3. Number of s hoots > 1cm per explant analyzed for each sugarcane cultivar. CP84 1198 CP88 1762 CP89 2143 Orientation Horizontal 7 a 31 b 13 a Vertical 5 b 42 a 12 a Explant Position 1 8 a 47 a 18 a 2 7 ab 42 a 13 b 3 6 bc 36 b 10 bc 4 5 c 30 c 11 bc 5 4 d 26 d 8 c Same letters in a column within a category are not significant at P = 0.05 using the Tukey-Kramer adjusted t test. Table 3 4. Number of roots per explants analyzed for each sugarcane cultivar. CP84 1198 CP88 1762 CP89 2143 Orientat ion Horizontal 15 b 22 b 8 b Vertical 67 a 34 a 10 a Explant Position 1 48 a 33 a 10 a 2 44 b 31 ab 10 a 3 41 bc 29 b 7 c 4 38 c 26 c 11 a 5 33 d 23 cd 8 abc Same letters in a column within a category are not significant at P = 0.05 us ing the Tukey-Kramer adjusted t test.

PAGE 41

41 Figure 3 2 Direct organogenesis from sugarcane leaf roll explants A ) CP88 1762 with a large number of shoots, B ) CP89 2143 show ing direct shoot organogenesis, and C ) CP84 1198 displaying both shoot and root organogenesis

PAGE 42

42 CHAPTER 4 EXPRESSION OF CRY1F a TO ENHANCE FALL ARMYWORM RESISTANCE IN SUGARCANE Sugarcane ( Saccharum spp. hybrid) is one of the most photosynthetically efficient plants cultivated in over 120 countries in both the tropics and s ubtropics and covers a land area of more than 32 million acres (Cordeiro et al. 2001 ). It is also one of the oldest crops known to mankind and provides over 70% of the sugar produced in the world. In 2008, sugarcane in the U.S. was grown and harvested o n approximately 869,000 acres with a production of 29,855,000 tons Florida produced the most sugarcane (15,600,000 tons ), followed by Louisiana, Hawaii and Texas (http://www.nass.usda.gov /QuickStats/PullData_US.jsp ). Both sugar production and consumption in the U.S. have increased steadily by about 2.3% annually since 1994 (Haley and Bolling, 2005). Currently sugarcane in the U.S. is being considered as a promising biofuel crop. In order to maintain high yields, sugarcane must be resist ant to a number of insect pests. One of these i s the noctuid moth f all a rmyworm (FAW), Spodoptera frugiperda (J.E. Smith) (Lepidoptera: Noctuidae) a significant economic pest in most of the continental U S Because it cannot survive prolonged freezes, FAW over winters in southern Florida and southern Texas and then migrates annually to cause infestations in the continental U S (Barfield, 1980). There are two host -strains of FAW the corn strain that feeds p redominantly on corn ( Zea mays L.), and the rice strain that feeds on smaller grasses such as rice ( Oryza sativa L.) and bermudagrass ( Cynodon dactylon L.) (Pashley et al., 1986; Pashley et al. 1988 ). In Florida, insects collected throughout the overwinte ring areas are of southern Florida are of both strains (Meagher and Gallo -Meagher, 2003; Nagoshi and Meagher, 2004). Conventionally, integrated pest management st rategies that are used to control insect pests such as FAW do so through the combined use of biological control agents that include predators, parasitoids and pathogens along with pesticides and resistant varieties B iological control agents

PAGE 43

43 kill or debilitate their host and are relatively specific to certain insect groups. On the other hand, the extensive use of pesticides produces adverse effects on human health as well as the surrounding environment including the development of insect resistance and eradication of other beneficial insects (Ranjekar et al., 2003; Ferry et al., 2006). Another man agement strategy for controlling pests such as FAW is by producing transgenic plant s expressing a Bacillus thuringenesis (Bt) -endotoxin. These Bt -endotoxins are also known as insecticidal crystal protein s or the Bt crysta l protein (Cry) (Dulmage, 1981) On the basis of amino acid sequence homologies and p hylogenetic relationships, the Cr y prot ei ns are classified in to four groups providing protection against three insect orders: Cry1 (Lepidoptera), Cry2 (Lepidoptera and Diptera), Cry3 (Coleoptera) and Cr y4 (Diptera). Crops such as corn cotton (Gossypium hirsutum L.) and soybean (Glycine max L. ) expressing Bt endotoxin genes (cry ) have been extensively released in the U S and other countries (James, 2005). Commercially available Bt corn contains cry1Ab, cry1Ac or cry3 Bb1 and stacked cry 1Ab and cry3B1 genes for controlling European corn borer [ Ostrinia nu bilalis H bner], southwestern corn borer [ Diatraea grandiosella Dyar] and corn rootworm [ Diabrotica barberi Smith & Lawrence] Bt cotton contain s cry1Ac, stacked cry1Ac and cry2Ab2 and stacked cry1Ac or cry1F for controlling tobacco budworm [ Heliothis vir escens (Fabricius )], cotto n bollworm [ Helicoverpa zea (Boddie )], and pink bollworm [ Pectinophora gossypiella (Saunders )] (Castle et al., 2006). Cry1F has also been reported to control FAW in cotton (Adamczyk and Gore, 2004). Transgenic FAW resistant plants expressing Cry prot eins in forage and turf grasses also have been reported to reduce larval weights in the diploid bahiagrass cultivar Pensacola, (Paspalum notatum var. saurae) (Luciani et al., 2007) and seashore paspalum (Altpeter et al., 2009)

PAGE 44

44 Th e o bjective of this research was to introduce cry1Fa in to sugarcane to characterize transgenics at the molecular level and to determine their resistance to the rice strain of FAW Consequently, t ransgenic s produced were evaluated for transgene integration a nd expression, as well as resistance to FAW in laboratory bioassays under controlled environmental conditions Materials and Methods Plant Material Shoot tops of four to eight -month -old, field grown sugarcane cultivars CP84 1198, CP881762 and CP89 2143 were obtained from the U.S. Sugarcane Field Station ( USDA -ARS, Canal Point, Florida). After removing the outer mature leaves, shoot tops were cut slightly below the first node and a 9 cm segment was treated with absolute ethanol for 1 min to remove outer contamination followed by immersion in 20% Clorox (sodium hypochlorite 6% as an active in gredient) containing two drops of Tween 20 for 20 min with continous stirring. Following sterilization, explants were washed four to five times in st erile distilled wa ter for 10 min each. Transgene Expression Constructs The selectable marker cassette in pHZ35SNPTII contains the neomycin phosphotransferase II (nptII ) coding sequence (Be ck et al. 1982 ) under the transcriptional control of the CaMV 35S promoter (Odell et al. 1985) along with the heat shock protein 70 ( hsp 70) intron (Rochester et al., 1986), and the CaMV 35S polyadenyla tion signal (Dixon et al., 1986; Figure 4 1 A ). Based on the cry1Fa sequence available in the NCBI database (M73254), a codon optimized seq endotoxin was generated. The synthetic cry1Fa (1863 bp) was made and subcloned into a pPCR -Script vector by Geneart (Regensburg, Germany). BamHI and HindIII sites were introduced 5 and 3 to the cry1F a coding sequence respectively to f acilitate sub -cloning of cry1F a into pHZCRY under the transcriptional control of the maize ubiquitin I promoter and 1st

PAGE 45

45 intron (Christensen etal. 1992) and the nos 3 untranslated region (Fraley et al., 1983; Figure 4 1 B). Tissue c ulture, Transformation and Regeneration o f S ugarcane From each top 0.5 cm explants were taken and placed on to a Petri plate (100 mm x 20 mm) containing Murashige and Skoog (MS) basal medium supplemented with 20 gL1 sucrose and 13.6 d ichlorophenoxy acetic acid (2,4-D) with the pH adjusted to 5.6 5.8 ( CI3 medi um; Chengalrayan and Gallo -Meagher, 2001). E xplants were subcultured every two weeks. Callus induction occurred between two to four weeks and embryogenic callus was formed on the same medium after four to six weeks (Figure 4 2 A ). The embryogenic calli were placed on CI3 medi um supplemented with 0.4 M sorbitol for four to six hr prior to bombardment (Figure 4 2 B). The nptII and cry1F a plasmids were used in a 1:2 molar ratio and co-precipitated on to 1.0 m diameter gold particles (Altpeter and James, 2005). The BioRad PDS 1000 / He device (BioRad laboratories Inc., Hercules, CA) was used for biolistic gene transfer at 1100 psi and 28 mm Hg. Bombarded calli w ere transferred on to fresh CI3 medi um and kept at 28 oC under a 16 h r /8h r light/dark photoperiod provided by cool white florescent tubes with a photon flux density of 5170 lux for one week. The calli were then transferred on to CI3 selection medium containi ng 25 mg L1 genetici n (Tadesse et al., 2003). Optimal antibiotic concentration for calli growth and inhibition of plant regeneration from nontransformed material was determined previously (data not shown). After two weeks, the geneticin concentration was increased to 50 mg L1. After three to four weeks, the surviving calli were transferred on to shoot initiation medi um containing MS medium supplemented with 2.5 M thidiazuron (TDZ) ( Chengalrayan et al., 2005) with the same concentration of selection agent (Figure 4 2 C) Following two to four weeks on shooting medi um regenerated shoots were transferred on to rooting medi um supplemented with 19 .7 M indole 3 butyric acid (IBA) (Gallo Meagher et al., 2000) with the same concentration of geneticin (Figure

PAGE 46

46 4 2 D ). After four to six weeks, the regenerated plantlets were transplanted into Fafard 2 mix 9 (Fafard Inc., Apopka, F L ) and acclimatized in growth chambers with a 16h r /8 rh light/dark photoperiod, at a light intensity of 5170 lux, and a 29 oC /20 oC day/nigh t cycle (Figure 4 2 E ). Plantlets were fertilized bi -weekly with Miracle Grow Lawn Food (Scotts Miracle Gro, Marysville, OH) at the manufacturer s recommended rate. Polymerase C hain R eaction Southern Blot A nalysis and RT -PCR Genomic DNA was extracted from leaves as described by Dellaporta et al. (1983). A forward primer 5ATGGTTTCAACAGGGCTGAG3 and a reverse primer 5CCTTCACCAAGGGAATCTGA3 were designed to amplify a 570 bp fragment internal to the coding sequence of cry1F a as described by Luciani et al. (2 007). Approximately 100 ng genomic DNA was used as a template for PCR using the Mastercycler Gradient (Eppendorf Laboratories Inc., Hamburg Germany ). PCR was performed using the HotStart PCR kit (Qiagen, Valencia, CA). The cycling conditions were 95 C for 15 min initial denaturation, 35 cycles of 95 C for 1 min, 57 C for 1 min, 72 C for 1 min and 72 C for 15 min final extension. PCR products were analyzed by electrophores is on a 0.8% agarose gel. A transgenic bahiagrass line containing cry1Fa was used as a positive control ( Luciani et al., 2007). For Southern blot hybridization, genomic DNA was extracted from putative sugarcane transformants the cry1Fa transgenic bahiagr ass, and wild type sugarcane plants as described above. Approximately 10 g of DNA was digested with EcoR V and fractionated on 0.8% agarose gels. DNA was transferred onto Hybond N membranes (Amersham BioSciences, Piscataway, NJ) using the al kaline transfer protocol, as well as, prehybridization and hybridization reactions acc or ding to standard procedures (Sambrook and Russel, 2001). The complete cry1F a coding sequence (1.8 kb) was used as a probe and labeled with -(32P) -dCTP using the Prime a Gene Labelling System (Promega Madison WI ).

PAGE 47

47 Total RNA was isolated from young leaves using the RNeasy plant mini kit (Qiagen, Valencia, CA). Total RNA (100 ng) was used for cDNA synthesis via reverse transcription using the Superscript III First Strand cDNA synthesis kit (Invitrogen, Carlsbad,CA) in a reaction volume of 30 l. cDNA (8l) was used as a template to detect transcripts of cry1F a by RT PCR with the same primer pair as described above. RT PCR products were analyzed by electrophoresis on a 0.8% agarose gel. Immunological A ssays Qualitative expression of Cry1Fa in leaf tissue of the regenerated plants was evaluated using the QuickStixTM kit for Cry1F (EnviroLogixTM, Portland, ME), originally developed for Herculex I corn, and following the recommendations of the manufacturer. Relative levels of expression of Cry1Fa in leaf tissue were estimated by using the ELISA QualiPlateTM kit for Cry1F (EnviroLogix) also originally developed for Herculex I corn. Following six to seven months of vegetative propagation of the primary transformants, protein extracts were obtained from wild type and four putative transgenic sugarcane lines. Cry1F that came with the kit was used as a positive control. Protein concentrations of the extracts were determined using the Bradford assay (Bradford, 1976) and absorbance was measured at a wavelength of 595 nm. B ovine serum albumin was used to prepare a standard curve (R2 value of 98%) according to the manufacturers instructions. Reaction kinetics were recorded at 450 nm using an ELISA microplate reader (Biotek Laboratories Inc., Model 680). Optical density (OD) values for each line were compared within the linear range of the reaction kinetics after addition of the ELISA substrate. OD data fr om the tested plants were analyzed by Proc ANOVA and means were separated according to Duncans multiple range test (Litte ll et al., 1996, SAS Institute, 2002).

PAGE 48

48 Insect Bioassays Fall armyworm rice strain adults were placed in cylindrical screen cages (28 cm height, 21 cm diameter) and supplied with distilled water and a 2% sugar -honey solution for nourishment. Paper towe ls were stretched at the tops of the cages as an oviposition substrate. Emerging neonates (first instar larvae) were placed in rearing tubs (Rubbermaid No. 4025, 9.1 l, Fairlawn, OH) that had plastic grids (29 x 17.5 cm) on the bottom. Larvae were raised on a pinto bean ( Phaseolus vulgaris L. ) artificial diet according to the procedures of Guy et al. (1985). After appriximately 23 days, pupae were removed from the tubs, sexed, and emerged adults were placed in the screen cages. Larvae and adults were rear ed in incubators or large rearing units at ~ 23 C, 70% RH, and 14:10 photoperiod. Bioassays were conducted over a five d ay period. O n day 1, two blades of sugarcane (fifth leaf down from the shoot tip) were placed with 0.3 ml distilled water on a 42.5 mm filter paper (Whatman, Maidstone, England) within a tight -fitting petri dish (50 x 9 mm, Falcon 1006, Becton Dickinson, Franklin Lakes, NJ). Three day old r ice strain 2nd instar larvae (Meagher and Gallo -Meagher 2003; Nagoshi et al. 2006) were placed s ingly into the petri dishe s. Larval weights were taken on day five. Five replications of five larvae each ( n = 25) were tested per line. Data were subjected to an ANOVA (PROC Mixed, SAS 9.1), where replication was the random variable (Littell et al. 1996) If the treatment variable produced a significant F value, treatment means were separated using simple effect differences of the least square means Results Generation of Transgenic Sugarcane Lines and Molecular Characterization Co -bombardment of 1660 sug arcane calli (956 of CP841198, 484 of CP88-1762, and 220 of CP89 2143) with the pHZCRY expression cassette harboring the cry1Fa gene and the pHZ35SNPTII expression cassette harboring the nptII gene followed by geneticin selection,

PAGE 49

49 resulted in the regener ation of 246 plantlets with a total regeneration efficiency of 14.81% (131 of CP84 1198, 77 of CP881762, and 38 of CP892143) in approximately six months following tissue culture and transformation (Table 4 1). PCR analysis for the presence of cry 1 Fa was used for the initial screening of the se plantlets. O f the 246 regenerated plantlets only four of CP84 1198 amplified the expected 570 bp internal cry1Fa fragment Th is fragment was correctly amplified from pHZCRY and the transgenic bahiagrass positive co ntrol line, but was not amplified from the negative control which was wild type sugarcane (Figure 4 3 A ). T hese four putative cry1Fa transgenic s were initially transferred to soil and then placed under controlled growth conditions and later moved to greenho use conditions S outhern blot analyses of EcoR V digested genomic DNA showed independent and complex transgene integration patterns for the four transgenic line s ( Figure 4 3 B) Line 3 showed the most hybridization bands with 5, followed by lines 1 and 2 tha t displayed four hybridization bands, and line 4 with only 3 hybridization bands. Sizes ranged from 23130 bp to 310 bp. RT -PCR was done on the se four lines and cry1F a transcript s were detected in all of them Lines 1 and 2 in this non quantitative experime nt appeared to have less cry1F a expression compared to lines 3 and 4 (Figure 4 3 C). Immunological Assays A qualitative immuno -chromatographic assay indicated that transgenic lines 3 and 4 had Cry1F a levels above the detect ion level of the kit. However, Cry 1Fa was not detected in protein extracts from lines 1 and 2 (Figure 4 4 A ). A semi -quantitative immunoassay based on the QualiPlateTM kit for Cry1F (EnviroLogixTM) showed that line s 1 and 2 had low levels of Cry1Fa as compared to the Cry1F levels found in t he positive control provided with the kit ( Herculex I corn or WideStrike cotton), while lines 3 and 4 had Cry1Fa levels equal to or greater than the Cry1F levels found in Herculex I corn or WideStrike cotton (Figure 4 4 B). These observations

PAGE 50

50 correlate d with the OD450 values obtained for the transgenic lines The four transgenic lines had OD450 values significantly different from each other ( P < 0.0001; Figure 4 4 C). The level of Cry1Fa in line 1 was not significantly different from wild type sugarcane Lines 2, 3, and 4 displayed levels of Cry1Fa that w ere approximately 3 11 and 8 -fold higher than those measured for line 1, respectively (Figure 44 C). The Cry1Fa levels found in lines 3 and 4 were almost double that of the Cry1F positive control ( P = 0.05). Insect Bioassays Fall armyworm larvae fed leaves from the transgenic lines showed higher mortality rate s than feeding on wild type leaves with the highest levels of mortality occurring for lines 3 and 4 (80% and 90%, respectively ; Table 4 2) Lar vae showed intense feeding on the w ild type lines along with high weight gains, while larvae on lines 1, 2, 3 and 4 showed significantly reduced weight gain s ( P < 0.0001; Table 4 2) Discussion T he transformation protocol used in this study was only succe ssful in producing transgenic s from one of the cultivars tested CP84 1198. This cultivar is known for a high degree of embryogenic callus formation and regeneration (Chengalrayan and Gallo -Meagher, 2001, Chengalrayan et al., 2005). A differential response of sugarcane cultivars to tissue culture has also been noted by Lourens and Martin (1987), Hoy et al. (2003), and Gilbert et al. (2005). Compared to the other two cultivars, CP84 1198 produced more embryogenic callus in a shorter period of time and conseq uently the number of CP84 1198 calli bombarded was 2x and 4x higher than for CP88 1762 and CP89 2143, respectively (Table 4 1) Obtaining four transgenic CP84 1198 plants from 956 bombarded calli reflects a transformation frequency of only 0.4%. Given tha t same frequency only two transgenics would have been expected for CP88 1762 and none would have been expected for CP89 2143. Additionally, recovering a total of 131 plants of CP84 1198

PAGE 51

51 following bombardment and selection represents a 97% escape rate A ll of the 115 plants regenerated from CP892143 a nd CP88 1762 were escapes. A major reason for these large number of escapes could be low or insufficient selection pressure. In this study, selection with 25 mgL1 geneticin was initiated one week after bomb ardment and lasted for two weeks followed by an increase to 50 mgL1. This selection regime was similar to that used by Tadesse et al. ( 2003) for the production of transgenic sorghum. However, in a recent report by Wang et al. (2009), 50 mgL1 geneticin wa s used immediately after bombardment to produce transgenic sugarcane plants Consequently, a higher selection pressure initiated soon after a short resting period may have decreased the number of escapes and possibly increased the transformation rate Als o, various bombardment parameters such as microprojectile size rupture pressure, rupture disc to macroca rrier distance, stopping screen to target cell distance, and chamber evacuation are critical in determining the efficiency of transformation via biolis tics (Lerche and Hallmann, 2009). Additionally, target quality is a major factor in transformation efficiency and as mentioned above, CP84 1198 produced higher quality embryogenic callus compared to the other cultivars F all armyworm is the most important insect pest of grasses and other crops in the southeastern U.S. C orn expressing the cry1F gene (Herculex I) was commercial ly released by Pioneer Hi -Bred I nternational and Dow Agrosciences (Events TC 1507 and DAS 062758). Field trials showed that these transgenic corn lines effecti vely controlled multiple insects including FAW (EPA, 2001). In cotton, FAW bioassays indicated that neonate mortality was significantly higher when larvae were fed leaves expressing cry1F (80%) compared with nontransgenic leave s (48%) or leaves expressing cry1Ac (45%) (Adamczyk and Gore, 2004). However, in these studies the FAW populations tested were probably corn strain (most studies do not identify st rain, but use colonies collected from corn ). Although, previous research has shown that strain -specific

PAGE 52

52 physiological differences in Bt susceptibility can occur between strains (Adamczyk et al. 1997), little is known about the response of rice strain to most Bt endotoxins. Additionally, Meagher and Gallo -Meagher (2003) showed that rice strain adults were more predominant on grasses in south Florida including in sugarcane in the Everglades Agriculture Area. Consequently i n the current work, bioassays were conducted with the rice strain of FAW. Two of the four transgenic lines obta ined expressed the cry1Fa transgene at a high enough level to significantly affect mortality and larval weight in insect bioassays. This is the first report of transgenic Bt sugarcane conferring resistance to the difficult to control, and important insect pest, FAW Future work will focus on evaluating FAW resistance using this transgenic strategy in sugarcane under field conditions.

PAGE 53

53 Figure 4 1. Expression cassettes used for sugarcane bombardment A) portion of pHZ35SNPTII containing the nptII selectabl e marker gene, and B) portion of pHZCRY containing the cry1F a gene.

PAGE 54

54 Figure 4 2. Sugarcane tissue culture and regeneration following bombardment of CP84 1198. A) embryogenic callus B) c allus arranged in a circle on 0.4 M sorbito l containing medium ready for bombardment C ) sugarcane callus producing shoots under genet i cin selection, D ) regenerated sugarcane plantlet in a jar containing 19.7 M IBA medium and E ) regenerated sugarcane pla n tlets in small square pots (3.5'') with soil. A B B E WT 1 2 3 4 D E A C

PAGE 55

55 Figure 4 3. Molecular analyses of transgenic sugarcane containing cry1Fa A) A 570 bp pair cry1Fa fragment amplified from genomic DNA of transgenic sugarcane lines (1, 2, 3 and 4) in comparison to wild type sugarcane (NC), a cry1Fa transgenic bahiagrass line (PC), and pHZCRY (Pl) using forward 5ATGGTTTCAACAGGGCTGAG3 and reverse 5CCTTCACCAAGGGAATCTGA3 primers r. B) Southern blot of genomic DNA digested with EcoRV from independent transgenic lines (1, 2, 3 and 4) in comparison to a cry1Fa transgenic bahiagrass line (PC) and wild type sugarcane (WT) following hybridization with a 32P -labeled cry1Fa coding sequenc e probe and C) Presence of cry1Fa transcripts following RT PCR of sugarcane lines (1, 2, 3 and 4 ) along with wild type sugarcane (WT) a cry1Fa transgenic bahiagrass line (PC) and 1kb ladder (L) The lane designated BL is the negative control, water only sample. B A C

PAGE 56

56 Figure 4 4. Cry1Fa levels in leaves of transgenic sugarcane lines and wild type. A) Immuno chromatographic (Cry1Fa QuickStix TM, EnviroLogix TM) screening of protein extracts of transgenic sugarcane lines (1, 2, 3 and 4), a cry1Fa transg enic bahiagrass line (+ve), and wild type sugarcane (WT), B) An ELISA Qualiplate TM kit for the Cry1F a (Environlogix TM) with blank (BL) pure Cry 1F protein (cry 1F) a cry1Fa transgenic bahiagrass line (PC), wild type sugarcane (NC), and the four transge nic sugarcane lines (1,2,3,and 4), and C) Optical densitometry at 450 nm (OD450) of Cry1Fa ELISA of protein extracts from wild type sugarcane (WT) and transgenic sugarcane lines (1, 2, 3 and 4). Bars represent standard error. Different l etters indicate dif ferences by Duncans multiple range test ( P < 0.0001) A B C

PAGE 57

57 Table 4 1. Summary of biolistic gene transfer experiments with three different cultivars, CP84 1198, CP89 2143 and CP881762. Experiment Number Cultivar Number of Bombarded P lates Number of Calli Bom barded Number of P lantlets Regenerated Regeneration E fficiency (%) 1 CP84 1198 24 280 25 8.92 2 CP89 2143 24 220 38 17.27 3 CP88 1762 24 265 27 10.18 4 CP84 1198 30 381 52 13.64 5 CP88 1762 24 219 50 22.83 6 CP84 1198 24 295 54 18.3 Total 150 1660 246 14.81 Table 4 2. Fall armyworm bioassays with 2nd instar rice strain larvae feeding on leaves of wild type and transgenic sugarcane lines showing mortality rates and percent weight increases1. Line Mortality (%) % Weight Increase SE WT1 0 1921.01 12.3 a WT2 0 1983.3141.6 a 1 30 62.07.5 b 2 40 164.5 85.0 b 3 80 25.2 4.2 b 4 90 80.0 0 b 1Data were obtained after five days of feeding. WT1 and WT2 are wild type sugarcane plants. 1 4 are transgenic sugarcane lines; means with the same let ter are not significantly different. ( P < 0.0001)

PAGE 58

58 CHAPTER 5 EVALUATING AGROBACTERIUM VACUUM INFILTRATION OF STOLON NODES FOR THE PRODUCTION OF TRANSGENIC BERMUDAGRASS Introduction Bermudagrass is widely used as a warm -season turf and forage grass i n the tropical and lower parts of the temperate regions of the world. It is the most important pasture grass in the southern U.S (Mitich, 1989; Burton and Hanna, 1995), and it covers an area of 12 million ha for livestock grazing and hay production (Talia ferro et al., 2004). Tifton 85 [Cynodon dactylon (L ) Pers. X C. transvaalensis Burtt Davy ] is a high quality forage bermudagrass. It is one of the higher yielding hybrid s available for hay and pasture production and produces high weight gains in cattle It has 34% higher dry matter yield, 47% higher digestible yield, and superior animal performance with growing steers compared with coastal bermudagrass (Mandebvu et al., 1999). It has become a new standard for comparing bermudagrass varieties, due to its superior production and quality (Hill et al., 2001; Evers et al., 2004). Tifton 85 is completely male and female sterile and therefore genetic improvement through classical breeding is impossible. Tif Eagle [Cynodon dactylon (L ) Pers. X C. transvaalensi s Burtt Davy] is a warm season turf grass and normally provides high quality turf for golf course putting greens in the subtropical and tropical regions of the world (Bunnell, 2005). It has a distinct genetic background, turf density, and an ability to tol erate extremely low heights. TifEagle is grown on golf courses throughout Florida (Bunnell, 2005). Like Tifton 85, it is sterile. Some b ermudagrasses have been genetically engineered by either biolistics or Agrobacterium mediated transformation. TifEagle h as been transformed via biolistic s with the hpt gene (Zhang et al., 2003) and the bar gene (Goldman et al., 2004b ) and via Agrobacterium to produce resistantance to the herbicide Liberty (glufosinate ammonium) (Hu et al., 2005)

PAGE 59

59 Transgenic turf type common bermudagrass with resistance to the herbicide glufosinate has been obtained through biolistics (Li and Qu, 2003), and Li et al. (2005) successfully transformed common bermudagrass variety J1124 with Agrobacterium -mediated transformation showing stable e xpression of the hph gene Agrobacterium mediated transformation is generally preferred over bioloistics because it usually allows for the stable integration of a defined segment of DNA into the plant genome and results in lower copy number, fewer rearran gements and improved stability of expression over generations (Smith and Hood, 1995; Dai et al., 2001). In transformation experiments, even with Agrobacterium callus cultures have been an unavoidable step (Vasil et al., 1992; Hartman et al., 1994; Wan and Lemaux 1994; Spangenberg et al., 1995; Cho et al., 2001; Sallaud et al., 2003; Li and Qu, 2004; Wang et al., 2004; Wang and Ge, 2005). But callus induction and plant regeneration is not only time consuming and laborious, but can cause somaclonal variatio n. Consequently, callus -free methods of transformation have been exp l ored (Wang and Ge, 2005; Spangenberg et al., 1998; Choi et al., 2000; Goldman et al., 2004 a ). In this study, a callus -free method similar to that used by Wang and Ge (2005) was evaluated for the incorporation of cry1Fa into Tifton 85 and TifEagle The objectives of the study were to : (1) p roduce an efficient r egeneration protocol for Tifton 85 and TifEagle from stolon nodes, (2) i ntroduce the c ry1Fa gene into their genomes via Agrobacter ium -mediated vacuum infiltration of stolon nodes, followed by molecular characterization and (3) determine resistance to the rice strain of FAW in laboratory bioassays under controlled environmental conditions

PAGE 60

60 Materials and Method Plant Material Bermudag rass cultivars Tifton 85 and TifEagle were grown in the greenhouse with 16h/8h light /dark photoperiod provided by cool white florescent lights with a photon flux density of 5170 lux Stolon segements 2 3 cm in length containing one node were sterilized wi th 100% ethanol for 1 min and 50% bleach with two drops of Tween20 for 20 min and then rinsed with sterile water 4 5 times for10 min each. The segments were cut in half (0.5 1cm) and contained a cut node, these were directly used for Agrobacterium -mediated transformation. Plantlet Regeneration A preliminary experiment was carried out to determine the level of 2,4 D and kinetin that produced the most plantlets from stolon explants of TifEagle and Tifton 85 based on the BG -A2 medium used by Wang and Ge (2005). Five different levels of 2, 4 D ranging from 1 M to 1.8 M, and kinetin ranging from 3.0 M to 5.0 M were used in the matrix experiment with 25 different treatments and 3 replications each. Each treatment consisted of 2 Petri plates (100 mm X 25 mm) w ith 5 explants each of Tifton 85 and TifEagle for a total of 10 explants per cultivar. The plates were kept under a 16 h r/8h r light/dark photoperiod provided by cool white florescent tubes with a photon flux density of 5170 lux at 28 oC The explants began producing shoots within 1 2 weeks of culture initiation and roots appeared in 3 4 weeks. Data were collected after 4 weeks of the culture period. For both TifEagle and Tifton 85, the most plantlets were produced on medium containing 1.8 M 2, 4-D and 4.5 M kinetin (data not shown ). Infection and Co -cultivation of Stolon Nodes with Agrobacterium tumefaciens The Agrobacterium tumefaciens strains GV3101 and AGLO were used for transformation. Both strains harbored pWBVec10aCry1Fa (Figure 5 1). p WBVec10aCry1F a contains the hpt selectable marker gene under the control of the CaMV 35S promoter and the synthetic cry1Fa

PAGE 61

61 gene und er the control of maize ubiquitin promoter and first intron (Altpeter et al., 2009). Agrobacterium cultures were grown at 28 oC in liquid YEP medium overnight with shaking at 175 rpm until an OD600 of 1.0 1.2 was reached The cells were pelleted by centrifugation at 2400 g for 15 min and resuspended in liquid B G -A1 medium (Wang and Ge, 2005) containing half strength MS medium (Murashige and Skoog, 1962) supplemented with 1. 8 M 2,4 D, 4.5 M kinetin, 3.3 mM L -cysteine, 1 mM dithiothreitol, 1 mM Na thiosulphate and 2% ( w/v) sucrose The OD600 of the resuspended Agrobacterium was adjusted to approximately 1.0, and 100 M acetosyringone was added to 20 ml of the Agrobacterium suspension. The stolon nodes were immersed in the Agrobacterium suspension and a vacuum was drawn for 10 min. After the vacuum was released, the stolon nodes were incubated with Agrobacterium for 50 min with gentle shaking at 120 rpm. Excess bacteria were removed from the stolons after incubation under sterile conditions and the stolon nodes were transferred onto agar -solidified BG -A1 medium and placed in the dark at 25 oC for co cultivation for two days. Selection and Recov ery of Transgenic Plants Two days after co -cultivation, the infected stolon nodes were transferred onto selection medium (MS medium supplemented with 1.8 M 2, 4 D, 4.5 M kinetin, 2% (w/v) sucrose, 250 mgL1 cefotaxime and 75 mgL1 hygromycin). Regenerate d green shoots following selection (Figure 5 2A and B) were transferred to P etri plates containing hormone -free half -strength MS medium for rooting (Figure 5 2 C and D ). All the regenerating cultures were kept at 25 oC in fluorescent light at a photoperiod of 16h in a growth chamber provided by cool white florescent tubes with a photon flux density of 5170 lux Plantlets with well developed roots were transferred to soil in small plastic pots (3.5'') and grown in the greenhouse with a 16h r/8 rh light/dark photoperiod at a light intensity of 5170 lux, and a 29 oC /20 oC day/night cycle

PAGE 62

62 Plantlets were fertilized bi -weekly with Miracle Grow Lawn Food (Scotts Miracle Gro, Marysville, OH) at the manufacturer s recommended rate (Figure 5 2 E ). Molecular Characteriz ation of Transgenic Plants Total genomic DNA was isolated from leaves using the method described by Dellaporta et al. (1983). A forward primer 5ATGGTTTCAACAGGGCTGAG3 and a reverse primer 5CCTTCACCAAGGGAATCTGA3 were designed for amplifying a 570 bp frag ment internal to the coding sequence of the cry1Fa gene. Approximately 100 ng genomic DNA was used as a template for PCR using the Mastercycler Gradient (Eppendorf Laboratories Inc., Hamburg Germany ). PCR was performed using the HotStart PCR kit with a 25 l reaction (Qiagen, Valencia, CA). The cycling conditions were 95 C for 15 min initial denaturation, 35 cycles of 95 C for 1 min, 57 C for 1 min, 72 C for 1 min and 72 C for 15 min final extension. PCR products were analyzed by electrophoresis on a 0.8% agarose gel. For Southern blot analysis, genomic DNA was isolated using the same extraction method referenced above and 10 was digested with Eco RI fractionated on a 0.8 % agarose gel, transferred onto a nitrocellulose membrane (Hybond, Amersham BioSciences, Piscataway, NJ) and hybridized using the complete cry1F a coding sequence (1.8kb) as a probe, as described in the prev ious chapter Total RNA was isolated from young leaves using the RNeasy plant mini kit (Qiagen, Valencia, CA). Total RNA ( 1 00 ng) was used for cDNA synthesis via reverse transcription using the iScript cDNA synthesis kit (Bio Rad laboratories Inc., Hercul es, CA) in a reaction volume of 20 l. cDNA (2l) was used as a template to detect the transcript of cry1F a gene by RT PCR with the same primer pair as described above. RT PCR products were analyzed by electrophoresis on a 0.8% agarose gel.

PAGE 63

63 Immunological A ssays Qualitative expression of Cry1Fa in leaf tissue of the regenerated plants was evaluated using the QuickStixTM kit for Cry1F (EnviroLogixTM, Portland, ME), originally developed for Herculex I corn, and following the recommendations of the manufacture r. Following six to seven months of growth, l eaf tissue was taken from the fifth leaf from the top of each plant and sandwiched between the cap and the body of the extractor tube and pushed down with a tooth pick extraction buffer (0.5 ml ) was added and the tissue was gr ound with the help of small plastic pestles and the test strip was placed into the tube for 5 min Insect Bioassays Fall armyworm [ Spodoptera frugiperda (J. E. Smith)] rice strain adults were placed in cylindrical screen cages (28 cm heig ht, 21 cm diameter) and supplied with distilled water and a 2% sugar -honey solution for nourishment. Paper towels were stretched at the top of the cages as an oviposition substrate. Emerging neonates (first instar larvae) were placed in rearing tubs (Rubb ermaid No. 4025, 9.1 l, Fairlawn, OH) that had plastic grids (29 x 17.5 cm) on the bottom. Larvae were raised on a pinto bean ( Phaseolus vulgaris ) artificial diet according to the procedures of Guy et al. (1985). After about 23 days, pupae were removed f rom the tubs, sexed, and emerged adults were placed in the screen cages. Larvae and adults were reared in incubators or large rearing units at ~ 23 C, 70% RH, and 14:10 photoperiod. Bioassays were conducted over a 9 -day period. On day 1, two small blades of grass (fifth leaf down from the shoot tip) were placed with 0.3 ml distilled water on to a 42.5 mm filter paper (Whatman, Maidstone, England) within a tight -fitting petri dish (50 x 9 mm, Falcon 1006, Becton Dickinson, Franklin Lakes, NJ). Rice strain neonates (Meagher and Gallo -Meagher 2003; Nagoshi et al. 2006) were placed singly into the petri dishes. On day 5 more tissue was added. Larval weights were taken on day 9 Five replications of five larvae each ( n = 25) were

PAGE 64

64 tested per grass line. Data w ere subjected to an ANOVA (PROC Mixed, SAS 9.1), where replication was the random varia ble (Littell et al. 1996). Results Green shoots were directly obtained from infected stolons after four to five weeks of selection on hygromycin. Rooted in vitro plantl ets were obtained after two weeks. Soilgrown bermudagrass cultivars were established in the greenhouse within nine weeks of initiating the Agrobacterium mediated transformation experiments For Tifton 85, 370 explants infected with GV3101 resulted in 13 plants for a regeneration frquency of 3.5%, and 480 explants infected with AGLO resulted in 23 plants for a regenerati on frequency of 4.7% (Table 51 ). For TifEagle, 580 explants infected with GV3101 resulted in 28 plants for a regeneration frequency of 4. 8%, and 680 explants infected with AGLO resulted in 48 plants for a regeneration frequency of 7.0% (Table 5 1 ). To determine whether the 112 regenerated plants were stably transformed each was first screened by PCR for the presence of cry1Fa Only three o f the 36 Tifton 85 plants (8%) and three of the 76 TifEagle plants (4%) amplified cry1Fa (Figure 5 3). Based on these results, Southern blot analysis was performed on these six putative transformants However, only one TifEagle plant from an AGLO transfor mation experiment showed integration of the cry1F a gene into the host genome (Figure 5 3 ). As expected expression analysis using RT PCR showed that only that TifEagle transgenic plant expressed cry1Fa transcript s (Figure 5 3). Qualitative expression of Cry1Fa in leaf tissue of the six plants was evaluated using the QuickstixTM kit for Cry1F (EnviroLogixTM, Portland, ME), originally dev eloped for Herculex I corn, following the reco mmendations of the manufacturer None of the plants including the TifEagle transfomant, had discernable Cry1Fa levels (Figure 5 4).

PAGE 65

6 5 Fall armyworm bioassays were conducted over a 9 day period for the one transgenic TifEagle plant and the two nontransformed TifEagle plants There was no significant difference between the larval w eights and mortality of the rice strain FAW fed on these plants as compared to wild type TifEagle confirming that the level of Cry1Fa in the transgenic TifEagle plant was too low to a ffect feeding and cause mortality (Table5 2 ). Discussion D irect regenera tion from stolon explants can significantly reduce the time required to regenerate plantlets In previous biolistic transformation studies of bermudagrass, c allus induction and maintenance took six weeks and resistant calli were recovered after eight weeks (Zhang et al., 2003; Li and Qu, 2004) Additionally, the total time from callus initiation to plantlets for bermu dagrass transformation experime nts was at least 20 weeks. The method reported here is based on a protocol originally developed by Wang and Ge (2005) for TifEagl e. It produced rooted plantlets of both Tifton 85 and TifEagle in only approximately seven weeks which was the same timeframe that Wang and Ge (2005) reported. However, the transformation protocol used in the present study was only suc cessful in producing one TifEagle transgenic. This single transgenic TifEagle line expressed cry1FA transcripts, as determined by RT -PCR (Figure 5 3), but had low levels of expressed protein, as indicated by immunochromatography (Figure 5 4). This low Cry 1Fa expression also had no affect on FAW rice strain mortality. Low levels of expression are not unusual in transgenics and could be due to a number of factors including transgene silencing (Matzke and Matzke, 1998). Transgene silencing may be due to DNA m ethylation, position effects, gene interactions and recognition of foreign DNA due to imcompatabilities in base composition. Obtaining one transgenic TifEagle from 1260 infected stolon nodes is a transformation frequency of only a mere 0.08%, which is in stark contrast to the 4.8% 6.1% reported by Wang

PAGE 66

66 and Ge (2005) No transgenic Tifton 85 plants were recovered. As reviewed by Jian et al. (2009) T DNA delivery into plant cells is a complex process which is influenced by many parameters such as explant type (Chen et al., 2008) Agrobacterium strain (Crane et al., 2006) preculture duration (Chen et al., 2008) temperature (Kereszt et al., 2007; Baron et al., 2001) and co -cultivation duration (Chen et al., 2008). Therefore, what parameters could have be en altered in this study to improved transformation? Bot h co cultivation temperature (25 oC) and period (two days) were most likely not factors for TifEagle transformation since higher temperatures would probably have resulted in decreased T DNA transfer ( Kereszt et al., 2007), and Wang and Ge (2005) used those exact parameters successfully in transform ing TifEagle stolon explants However, it is unclear whether those parameters were optimal for the transformation of Tifton 85 stolons. The Agrobacterium strains used in this study (GV3101 and AGLO) probably had a major affect on transformation frequency. It is well known that different strains have varying virulence for different genotypes. Preliminary, transient expression assays were not conducted with these two strains to see if they could efficiently infect TifEagle and Tifton 85 stolons. In the two reports where transgenic TifEagle were produced, EHA105 (Hu et al., 2005; Wang and Ge, 2005) and LBA4404 were used (Wang and Ge, 2005). T hese strains ca rrying plasmids conta in ing cry1Fa should be examined to obtain more TifEagle transgenic plants and to develop an effective Agrobacterium transformation method for Tifton 85 Only with the production of an adequate number of cry1Fa bermudagrass transgenic s can the effectiveness of this strategy be evaluated as a control measure for FAW.

PAGE 67

67 Figure 5 1. The gene cassette between the left (LB) and the right border (RB) in pWBVec10aCry1Fa used in A grobacterium vacuum infiltration of stolon explants of Ti fton 85 and TifEagle.

PAGE 68

68 Figure 5 2 Tifton 85 and TifEagle tissue culture and regeneration following Agrobacterium mediated transformation A) A shoot emerging from a Tifton 85 stolon explant following hygromycin selection, B) S hoots emer ging from Ti fEagle stolon explants following hygromycin selection, C) A regenerated Tifton 85 plantlet, D) A regenerated TifEagle plantlet, and E) TifEagle plants following selection, regeneration and transfer into pots.

PAGE 69

69 Figure 5 3. Molecular analyse s of T ifEagle and Tifton 85 plants obtained following Agrobacterium vacuum infiltration of stolon nodes. A 570 bp cry1Fa fragment amplified from genomic DNA of A) putative transgenic TifEagle plants ( 2,5 and 6), in comparison to wild type TifEagle (WT), non -tra nsformed TifEagle plants (1,3,4, and 7 11), water (NC), a cry1Fa transgenic bahiagrass line (PC), and a 1kb ladder (L), and B) putative transgenic Tifton 85 plants ( 1,2, and 3) in comparison to wild type Tifton 85 (WT), water (NC), a cry1Fa transgenic bahia grass line (PC), non transformed Tifton 85 plants (46), and a 1 kb ladder (L). C) Presence of cry1Fa transcripts following RT PCR of the cry1Fa transgenic TifEagle plant (1), and a cry1Fa transgenic bahiagrass line (PC) in comparison to nontransformed T ifEagle plants (2 and 3), water (NC) and wild type TifEagle (WT). D) Southern blot of genomic DNA digested with Eco RI of a cry1Fa transgenic bahiagrass line (PC) and the cry1Fa transgenic TifEagle plant in comparison to wild type TifEagle (WT) following hybridization with a 32P -labeled cry1Fa coding sequence probe A C D

PAGE 70

70 Figure 5 4 Cry1Fa levels in leaves of regenerated TifEagle and Tifton 85. The immunochromatographic (Cry1Fa QuickstixTM, Envirologix TM) screening of protein extracts of TifEagle ( 1, 2, an d 3), Tifton 85 ( 4, 5, and 6), a c ry1Fa transgenic bahiagrass line (+ve), and wild type TifEagle (WT).

PAGE 71

71 Table5 1 Summary of Agrobacterium -mediated transformation experiments using pWBVec10aCry1Fa with stolon nodes of Tifton 85 and TifEagle Cultivar Agro bacterium S train Number of Stolon N odes Infected Number of Plantlets Regenerated Regeneration E fficiency (%) Tifton 85 GV3101 370 13 3.5 Tifton 85 AGLO 480 23 4.7 Total 850 36 4.2 TifEagle AGLO 580 28 4.8 TifEagle GV3101 680 48 7.0 Total 1260 76 6. 0 Table5 2 Fall armyworm bioassays with neonate rice strain larvae feeding on leaves of TifEagle plants following Agrobacterim -mediated transformation experiments and wild type showing larval weight and percent mortality1. TifEagle Line Larval W eight Percent M ortality 1 18.4 1.0 a 20.04 6.0 a 2 18.1 1.8 a 20.0 9.0 a 3 15.4 2.1 a 0.0 0 a w ild t ype 13.4 1.6 a 16.0 4 a P = 0.1684 P = 0.0951 1 Data were obtained after nine days. Plants 1, 2 and 3 were positive for cry1Fa by PCR and line 2 was positive for the transgene on S outhern blots as well as RT PCR ; means with the same letter are not significantly different.

PAGE 72

72 CHAPTER 6 SUMMARY AND CONCLUSIONS Comparative A nalysis of D irect Plant R egeneration of Three S ugarcane C ultivars T here has been considerable effort to produce direct plant regeneration methods for monocots e specially sugarcane The objective of this study was to compare three different cultivars CP84 1198, CP89 2143 and CP881762 for rapid and efficient direct regene ration The cultivars responded differently to the same culture conditions. CP88 1762 was the most responsive to the tissue culture system tested with explants producing the most shoots and the most elongated shoots, along with a sufficient number of root s to produce viable plantlets that were easily transferred to small pots. Therefore, of the three cultivars tested CP88 1762 is the best candidate for future Agrobacterium -mediated transformation using this direct regeneration approach. Additionally, t hi s study will help to inf orm future work on rapid callus -free regeneration of sugarcane that also may be useful fo r reducing somaclonal variation. Expression of cry1F a to Enhance FAW R esistance in Sugarcane using B iolistics Bacillus thuringenesis (Bt) -end otoxin s are also known as insecticidal crystal protein (ICPs) or the Bt crystal protein (Cry) (Dulmage, 1981). These Bt crystal proteins have been used in spore formulations for over 40 years (Tabashnik et al., 1997), however their limited field stability, lack of capacity to reach cryptic insects, and narrow spectrum of activity Bt sprays represent only a minor proportion of the insecticide market (Ferre and Van Rie, 2002). Therefore, one of the best approach es to control insect pests such as FAW is the u se of transgenic plants expressing a Bt -endotoxin (Schnepf et al., 1998; Ferre and Van Rie, 2002; Griffits and Aroian, 2005). Hence the objective of the present work was to produce transgenic sugarcane lines expressing the cry1F a gene and to evaluate the ir ability to confer resistance to FAW

PAGE 73

73 Four transgenic sugarcane lines were generated and molecular analyses confirmed the presence and integration of cry1F a into the genome Transgene integration varied from simple to more complex, and RT -PCR and immunoa ssays showed that the transgene was expressed in all four lines The expression of the cry1 F a gene increased resistance to the rice strain of FAW in laboratory bioassays i ndicating that these transgenics may be suitable candidates for future field studies and provide another strategy that can be implement in an integrated pest management program Evaluating Agrobacterium Vacuum Infiltration of Stolon Nodes for the Production of Transgenic B ermudagrass Bermud agrass cultivars such as Tifton 85 and TifEagle a re commonly used as warm season forage and turf grasses respectively, in temperate and tropical parts of the world. Bo th cultivars are susceptible to FAW and are sterile, so the main objective of the study was to produce a rapid regeneration protocol that bypassed the callus phase in order to introduce cry1F a via Agrobacterium vac uum infiltration of stolon nodes S outhern blot analysis confirmed the integration of cry1Fa in only one TifEagle plant and no Tifton 85 plants Although cry1Fa transcript s could be detected in RT PCR analysis of the TifEagle transgenic it did not express it at a high enough level in leaf tissue to affect FAW weight gain or mortality Further transformation experiments must be conducted to generate more transgenic TifEagle and Tif ton 85 lines to properly evaluate this approach for FAW resistance

PAGE 74

74 APPENDIX A LABORATORY PROTOCOLS Molecular T echniques Genomic DNA Extraction ( modified from Dellaporta et al., 1983) 1. Harvest one eppendorf tube length of leaf material. Extraction Buffer D and grind with micropestle until the buffer is green. 4. Incubate at 65 C, 10 minutes. 6. Incubate on ice (or 20 C ), 20 minutes. 7. Centrifuge at ma ximum speed, 20 minutes and transfer supernatant to new tube. 9. Incubate on ice (or 20 C ), 30 minutes. 10. Centrifuge at maximum speed, 15 minutes, pour off the supernatant, air -dry the pellet. E. e thanol for 10 minutes 14. Centrifuge at maximum speed, 10 minutes, pour off the supernatant, air -dr y pellet for 10 minutes 16. Store at 4 C. 20% SDS (500 ml) 100 g SDS in 450 ml DD H20 Ad just to pH 7.2 with conc entrated HCl Bring up to 500 ml 0.5 M EDTA (pH 8) (50 ml ) 9.35 g EDTA disodium salt d issolved in 40 ml dd H2O Adjust to pH 8 with NaOH pellets. (ED TA will not dissolve at the wrong pH ) Bring up to 50 ml 5 M Potassium Acetate (100 ml) 29.44 g in up to 60 ml d d H2O 11.5 ml glacial acetic acid Bring up to 100 ml. Extraction Buffer D (500 ml) 4.44 g Tris -HCl 2.65 g Tris base

PAGE 75

75 9.3 g EDTA 7.3 g NaCl 3 M Sodium Acetate (10 ml) 0.82 g NaOAc in 10 ml d d H2O Adjust to pH 5.2 with glacial acetic acid 1 M Tris -HCl (pH 8) (200 ml) 24.22 g Tris base dissolved in 160 ml d d H2O Adjust to pH 8 w ith concentrated HCl. Bring up to 200 ml. TE (pH 8) (50 ml) 500 l 1 M Tris HCl, 100 l 0.5 M EDTA. Bring up to 50 ml with sterile d d H2O Genomic RNA Extraction Method (RNeasy Plant Mini Kit,Qiagen) Mercaptoethanol (Sigma) per 1 ml of buffer. 2. Add 44 ml of 100% ethanol to the RPE buffer concentrate to prepare the working solution. 3. Harvest 100 mg young leaves and freeze immediately using liquid nitrogen. 4. Grind the sample to a fin e powder using a sterile (autoclave for 30 min) mortar and pestle. Transfer the ground sample to a sterile, liquid-nitrogen cooled 2 ml micro centrifuge tube. 6. Pipet the lysate onto a QIAshredder spin column placed in a 2 ml collection tube and centrifuge for 2 min at maximum speed (13,200 rpm). Transfer the supernatant of the fl ow through to a new sterile microcentrifuge tube taking care not to disturb the pellet of cell debris. Estimate the approximate volume of the supernatant. immedi ately by pipetting. 8. Immediately transfer sample, including any precipita nt formed, to an RNeasy mini c olumn placed in a 2 ml collection tube. Close the tube gently and centrifuge for 15 s at 10,000 rpm. Discard the flow through. 9. Perform D Nase treatment using the RNase Free DNase Set (Qiagen). 10. Transfer the RNeasy column to a new 2 ml collection tube. Wash the column by p flow through. 11. To dry the RNeasy silica column and centrifuge for 2 min at 10,000 rpm. Discard the flow through. 12. Transfer the column to a new sterile 1.5 ml collection tube supplied with the kit. To e -free water directly onto the RNeasy silica membrane in the center of the column. Close the tube gently and centrifuge for 1 min at 10,000 rpm.

PAGE 76

76 14. Store remaining RNA at 80 C iScript cDNA Synthesis Reaction Component Volume per reaction Water 14 l 5x iScript reaction mix 4 l Rev erse transcriptase 1 l RNA template 1 l Total 20 l Incubate complete reaction mix 5 min at 25 oC 30 min at 42 oC 5 minutes at 85 oC Hold at 4 oC (optional) SuperScript TM III First -Strand Synthesis System for RT -PCR The following procedure is designed to convert 1 pg to 5 g of total RNA or 1 pg to 500 ng of poly(A) + RNA into first -strand cDNA: 1. Mix and briefly centrifuge each component before use. 2. Combine the following in a 0.2or 0.5 -ml tube: Component Amount Upto 5 g total RNA n l Oligo dt 1 l 10 mM dNTP mix 1 l DEPC treated water to 10 l 3. Incubate at 65C for 5 min, then place on ice for at least 1 min. 4. Prepare the following cDNA Synthesis Mix, adding each component in the indicated order. Componenet 1 Rxn 10 X RT buffer 2 l 25 mM MgCl 2 4 l 0.1 m DTT 2 l

PAGE 77

77 RNase OUT TM (40 u/ l) 1 l Superscript TM III RT (200 u/ l) 1 l 5. Add 10 l of cDNA Synthesis Mix to each RNA/primer mixture, mix gently, and collect by brief centrifugation. Incubate as follows. Ol igo(dT)20 or GSP primed: 50 min at 50C Random hexamer primed: 10 min at 25C, followed by 50 min at 50C 6. Terminate the reactions at 85C for 5 min. Chill on ice. 7. Collect the reactions by brief centrifugation. Add 1 l of RNase H to eac h tube and incubate for 20 min at 37C. 8. cDNA synthesis reaction can be stored at 20C or used for PCR Protocol for Biolistic Gene Transfer (Altpeter and James, 2005) 1 Gold stocks (60 mg/ml): Weigh 12mg gold into an eppendorf tube. Wash several times in Absolute EtOH by vortexing and centrifuging briefly. Resuspend in 200l ddH2O. 2 Gold preparation: Mix 15 l 0.75 m gold, 15 l 1 m gold and 30 l DNA by vortexing 1 min. Add 20 l 0.1 M spermidine and 50 l 2.5 M CaCl2 while vortexing. Keep vortexing for 1 min. Centrifuge briefly to settle gold. Wash in 250 l Absolute EtOH by vortexing. Spin and remove supernatant. Resuspend gold in 180 l Absolute EtOH. (or resuspend in 90l for more gold per shot). Use 5 l per shot to deliver 50g gold. Enough for 25 shots. 3 Sterilization of gun components: Autoclave 5 macrocarrier holders, stopping screens and macrocarriers. Lay out in laminar flow hood to dry. Sterilize 1100psi rupture discs by dipping in Absolute EtOH and allowing to dry in flow hood. Place all ster ile components in sealed petri dishes. Clean gun chamber, assembly and flow hood thoroughly with EtOH and allow to dry half and hour before use. 4 Bombardment: Turn on gun, vacuum pump and helium. Place macrocarriers into holders. Spread 5 l gold prep evenly onto macrocarriers and allow to dry briefly. Place rupture disc into holder and screw tightly into place. Place stopping screen into shelf assembly and put inverted macrocarrier assembly on top. Place shelf at highest level. Place tissu e culture plate on shelf 2 levels below gold. Close door and switch on vacuum to reach 27 in Hg. Press fire button and check that disc ruptures at 1100psi. Vent vacuum and remove sample. Dismantle assembly and set up for next shot. Use stopping screen 4 -5 times. Southern Blotting 10 x nucleic acid loading dye mix To 40 mg bromophenol blue 40 mg xylene cyanol and 2.5 g Ficoll 400, a dd approximately 8 ml of distilled water. Mix to dissolve. Make up to a final volume of 10 ml. Store at room temperature for up to three months 50 x TAE (DNA electro -phoresis buffer)

PAGE 78

78 242 g Trizma base 18.6 g e thylenediaminetetra acetic acid (ED TA), sodium salt Add approximately 800 ml of distilled water. Mix to dissolve. Adjust to pH 8 with glacial acetic acid (~57 ml/l). Make up to a final volume of 1000 ml. Store at room temperature for up to 3 months. Depurination solution 11 ml HCl 989 ml d istilled water Mix. Store at room temperature for up to 1 month. Denaturation buffer 87.66 g NaCl 20 g NaOH, Add approximately 800 ml of distilled water. Mix to dissolve. Make up to a final volume of 1000 ml. Store at room temperature for upto 3 months Neutralization buffer 87.66 g NaCl 60.5 g Trizma base Add approximately 800 ml of distilled water. Mix to dissolve. Adjust to pH 7.5 with concentrated hydrochloric acid. Make up to a final volume of 1000 ml. Store at room temperature for up to 3 months Nucleic acid transfer buffer (20 x SSC) 88.23 g Tri -sodium Citrate, 175.32 g NaCl, Add approximately 800 ml of distilled water. Mix to dissolve. Check the pH is 7 8. Make up to a final volume of 1000 ml. Store at room temperature for up to 3 months. TE buffer 1.21 g Trizma base 0.372 g EDTA, sodium salt Add approximately 800 ml of distilled water. Mix to dissolve. Adjust to pH 8 with concentrated hydrochloric a cid. Make up to a final volume of 1000 ml. Store at room temperature for up to 3 months Pr otocol for capillary blotting 1 Cut a sheet of membrane to an appropriate size. 2 Half fill a tray or glass dish of a suitable size with the transfer buffer. Make a platform and cover with a wick made from three sheets of Hybond blotting paper saturated in tr ansfer buffer. 3 Place the treated gel on the wick platform. Avoid trapping any air bubbles between the gel and the wick. Surround the gel with cling film to prevent the transfer buffer being absorbed directly into the paper towels. 4 Place the membrane on top of the gel. Avoid trapping any air bubbles. 5 Place three sheets of Hybond blotting paper cut to size and saturated in transfer buffer, on top of the membrane. Avoid trapping any air bubbles. 6 Place a stack of absorbent towels on top of the Hybond blotting p aper at least 5 cm high. 7 Finally, place a glass plate and a weight on top of the paper stack. Allow the transfer to proceed overnight. The weight should not exceed 750 g for a 20 x 20 cm gel. 8 After blotting, carefully dismantle the transfer apparatus. Befo re separating the gel and membrane, mark the membrane to allow identification of the tracks with a pencil or chinagraph pen. 9 Fix the nucleic acid to the membrane by baking at 80C for 2 hours or by using an optimized UV crosslinking procedure. 10. Blots may be used immediately. Blots must be thoroughly dried if storage is required.

PAGE 79

79 Sothern blotting Gel treatment 1 Separate the DNA samples on a suitable neutral agarose gel 2 Following electrophoresis visualize the DNA samples in the gel with UV light and phot ograph. 3 Process the gel for blotting, between each step rinse the gel in distilled water. 4 Depurination Place in 0.125 M HCl so that the gel is completely covered in the solution. Agitate gently for 10 20 minutes. During this time the bromophenol blue dye present in the samples will change colour. 5 Denaturation Submerge the gel in sufficient denaturation buffer. Incubate for 30 minutes with gentle agitation. During this time the bromophenol blue dye will return to its original colour. 6 Neutralization Place the gel in sufficient neutralization buffer to submerge the gel. Incubate for 30 minutes with gentle agitation General procedure for radioactive hybridizations ( Prime a -gene Labelling system, Promega). 1 All radioactive work must be done behind the shie ld and all users must have a film badge to handle any isotope. 2 Early in the day, prior to beginning, turn on the incubator and 65 C water bath, remove P32 and salmon sperm DNA needed from freezer. Place closed P32 container behind the plastic shield to thaw. Take hybridization buffer solution out of refrigerator and place in 65 C water bath. 3 Assemble large hyb tubes needed in rack, place blots in tubes, wrap top with Teflon tape, and pre -wet with 5X SSC solution. Heat 1 liter or larger beaker with wa ter to boiling outside of shield area. 4 Thaw Prime a gene kit components except keep Klenow enzyme on ice. Thaw probe DNA, prepare dNTP mixture, and use screw cap Eppendorf tubes for probes. 5 Write out Hybridization solution reaction components and add wate r and probe DNA amount needed to screw cap tubes. Place the tubes in boiling water and heat to denature for 5 minutes. Also place a screw cap tube of Salmon sperm DNA to denature at the rate of 500 ul for each Hybridization tube. After boiling, place the tubes on ice for 5 minutes. 6 After the 5 minutes on ice, drain the 5X SSC from large Hyb tubes into sink, add 20 ml of fully heated 65 C Hybridization solution to each tube, add 500 ul of de natured Salmon sperm DNA to each tube, cap tightly, but not too tight, and place into rack inside fully heated incubator, balancing tubes across from one another. Close door, turn on rotator and check for leaky lids and proper rotation. 7 Add buffer, BSA, dNTPs, and Klenow to probe DNA tubes on ice outside of shield. Place tubes on ice behind shield to add P32. Cap tightly, mix lightly, and place in rack behind shield at room temperature for 3 4 hours. 8 After 4 hours, start boiling water in beaker behind shield.

PAGE 80

80 9 When water is boiling, incubation is over so place Hyb probe screw cap tube along with 500ul per tube of Salmon sperm into tube float and boil to denature for 5 minutes. 10. After four minutes boiling, remove large Hyb tubes from incubator, drain pre -hyb solution into sink and place in rack. 11. Right before five minu tes add 10ml hot Hyb solution to each tube, turn off burner, and add the probe/Salmon sperm mixture to the Hyb solution at the bottom of each tube, taking care to be sure the pipette dispenses radioactively hot probe solution directly into Hyb solution a nd not onto blots in tube. 12. Work quickly to recap tubes and place back into incubator. Turn on rotator and check for leaky caps. 13. Allow to incubate overnight. 14. The next day pour off the probes into rad waste container and wash blots in the tubes with 0.1X S SC, 0.1% SDS solution heated to 65 C one quick rinse pouring waste into rad containers, then for 20 minutes two additional washes. 15. Remove blots from tubes behind shield and wrap with Saran wrap. 16. Check for activity with Geiger counter and place into film c assette. 17. In da rkroom, add number of X ray films needed, close cassette. 18. Place in 80o freezer for number of days needed. 19. Develop film in darkroom. Protocol for Immunochromatography strip test for cry1F gene (QuickstixTM kit for cry1F EnviroLogix) Samp le Preparation 1 Prepare leaf samples from the fifth fully emerged leaf: Take two leaf segments of length equivalent to that of a 1.5ml eppendorf tube. Mash the leaf tissue with a pestle. Sample identification should be marked on the tube with a waterproof m arker. 2 Insert the pestle into the tube and grind the tissue by rotating the pestle against the sides of the tube with twisting motions. Continue this process for 20 to 30 seconds or until the leaf tissue is well ground. 3 Add 0.25 mL of extraction Buffer int o the tube. Repeat the grinding step to mix tissue with Extraction Buffer. Dispose of the pestle (do not re use pestles on more than one sample to avoid cross -contamination). QuickStix Strip Test 1 Allow refrigerated canisters to come to room temperature be fore opening. Remove the 2 QuickStix Strips to be used. Avoid bending the strips. Reseal the canister immediately. 3 Place the strip into the extraction tube. The sample will travel up the strip. Use a rack to support multiple tubes if needed. 4 Allow the strip to develop for 10 minutes before making final assay interpretations. Positive sample results may become obvious much more quickly. 5 To retain the strip, cut off the bottom section of the strip covered by the arrow tape. 6 Development of the Control Line withi n 10 minutes indicates that the strip has functioned properly. Any strip that does not develop a Control Line should be discarded and the sample re tested using another strip.

PAGE 81

81 7 If the sample extract contained Cry1F endotoxin, a second line (Test Line) will develop on the membrane strip between the Control Line and the protective tape, within 10 minutes of sample addition. The results should be interpreted as positive for Cry1F endotoxin expression. Any clearly discernible pink Test Line is considered positiv e. 8 If no Test Line is observed after 10 minutes have elapsed, the results should be interpreted as negative, meaning that the sample contained less Cry1F endotoxin than is typically expressed in the tissues of Bt -modified plants. Quick startTM Bradford P rotein Assay 1x Dye Reagent: 1 L of dye solution containing methanol and phosphoric acid. One bottle of dye reagent is sufficient for 200 assays using the standard 5 ml procedure or 4,000 assays using the microplate procedure. BSA standard: Provided in 2 ml tubes. Standard Protocol 1 The standard protocol can be performed in three different formats, 5 ml and a 1 ml cuvette assay, and a 250 l microplate assay. 2 The linear range of these assays for BSA is 125 1,000 g/ml, whereas with gamma globulin the linear range is 125 1,500 g/ml. 3 Remove the 1x dye reagent from 4 C storage and let it warm to ambient temperature. Invert the 1x dye reagent a few times before use. 4 If 2 mg/ml BSA or 2 mg/ml gamma globulin standard is used, refer to the tables in theappend ix as a guide for diluting the protein standard. (The dilutions in the tables are enough for performing triplicate measure -ments of the standards.) For the diluent, use the same buffer as in the samples 5 Protein solutions are normally assayed in duplicate or triplicate. For convenience, the BSA or gamma -globulin standard setscan be used, but blank samples (0 g/ml) should be made using water and dyereagent. 6 Pipet each standard and unknown sample solution into separate clean test tubes or microplate wells (the 1 ml assay may be performed in disposable cuvettes). Add the 1x dye reagent to each tube (or cuvette) and vortex (or invert). For microplates, mix the samples using a microplate mixer. Alter -natively, use a multichannel pipet to dispense the 1x dye r eagent. Depress the plunger repeatedly to mix the sample and reagent in the wells. Replace with clean tips and add reagent to the next set of wells. 7 Incubate at room temperature for at least 5 min. Samples should not be incubated longer than 1 hr at room t emperature. 8 Set the spectrophotometer to 595 nm. Zero the i nstrument with the blank sample. 9 Measure the absorbance of the standards and unknown samples.

PAGE 82

82 Assay Volume of Standard and Sample Volume of 1x Dye Reagent 5 ml 100 l 5 ml 1 ml 20 l 1 ml Micr oplate 5 l 250 l Data analysis 1 If the spectrophotometer or microplate reader was not zeroed with the blank, then average the blank values and subtract the average blank value from the standard and unknown sample values. 2 Create a standard curve by plotting the 595 nm values (yaxis) versus their concentra tion in g/ml (x axis). Determine the unknown sample concentration using the standardcurve. If the samples were diluted, adjust thefinal concentration of the unknown samples by multiplying by the dilution factor used. 5 ml Standard Assay Tube # Standard Volume (l) Source of Standard Dilutent Volume (l) Final Protein (g/ml) 1 300 2 mg/ml stock 0 2000 2 375 2 mg/ml stock 125 1500 3 325 2 mg/ml stock 325 1000 4 175 Tube 2 175 750 5 325 Tube 3 325 500 6 325 Tube 5 325 250 7 325 Tube 6 325 125 8 (Blank) 325 0

PAGE 83

83 High sensitivity Protocol for Enzyme Linked Immunadsorbent Assay for the cry1F gene (QualiPlate Kit for Cry1F, EnviroLogix) Wash Buffer : Add the contents of the packet of Buffer Salts (phosphate buffered saline, pH 7.4 Tween 20) to 1 liter of distilled or deionized water and stir to dissolve. Extraction Buffer : Add 0.5 mL Tween 20 to 100 mL of prepared Wash Buffer, and stir to dissolve Store r e frigerated when not in use; warm to room temperature prior to assay. Cry1F Positive Control: The Positive Control is used as provided in the Rapid Protocol, but must be diluted 1:4 for us e in the High Sensitivity Protocol. Prepare this dilution just prior to running the assay: mix 50 L Cry1F Positive Control with 150 L extraction Buffer for each set of duplicate wells to be filled. HIGH SENSITIVITY PROTOCOL The High Sensitivity Pro tocol will detect 0.17% Herculex I corn or WideStrike cotton in ground grain/seed, and requires two hours of total assay incubation time. Dilute the Cry1F Positive Control 1:4 in Extraction Buffer for this protocol. 1. Add 50 L of Extraction Buffer Blank (BL), 50 L of diluted Positive Control (PC), and 50 L of each sample and user -prepared control extract (S) to their respective wells, as shown in the Example Plate Layout NOTE: In order to minimize setup time it is strongly recommended that a multi -channel pipette be used in steps 1, 5, 8, and 10. 2. Thoroughly mix the contents of the wells by moving the plate in a rapid circular motion on the benchtop for a full 2030 seconds. Be careful not to spill the contents! 3. Cover the wells with tape or Parafilm to prevent evaporation and incubate at ambient temperature for 30 minutes. If an orbital plate shaker is available, shake plate at 200 rpm. 4. After incubation, carefully remove the covering and vigorously shake the contents o f the wells into a sink or other suitable container. Flood the wells completely with Wash Buffer, then shake to empty. Repeat this wash step three times. Alternatively, perform these four washes (300 L/well) with a microtiter plate or strip washer. Slap the inverted plate on a paper towel to remove as much liquid as possible. 5. -enzyme Conjugate to each well. Thoroughly mix the contents of the wells, as in step 2. 6. Cover the wells with tape or Parafilm to prevent evaporation and incubate

PAGE 84

84 at ambient temperature for 1 hour. If an orbital plate shaker is avail able, shake plate at 200 rpm. 7. Wash the plate as described in step 4. 8. Add 100 L of Substrate to each well. 9. Thoroughly mix the contents of the wells, as in step 2. Cover the wells with new tape or Parafilm and incubate for 30 minutes a t ambient temperature. Use orbital shaker if available. Caution: Stop Solution is 1.0 N h ydrochloric acid. Handle carefully. 10. Add 100 L of Stop Solution to each well and mix thoroughly. This will turn the well contents yellow. NOTE: Read th e plate within 30 minutes of the addition of Stop Solution. Calculate the P ositive C ontrol R atio : Divide the OD of each sample extract by the mean OD of the Positive Control wells. This number is the Positive Control Ratio Interpretation of Qualita tive results (Leaf samples) If the Positive Control Ratio calculated for a sample is less than 1.0, the sample does not contain Cry1F at the levels normally found in Herculex I corn or WideStrike cotton. If the Positive Control Ratio of a sample is great er than or equal to 1.0, the sample is Herculex I corn or WideStrike cotton. R1 R2 R3 BL 0.038 0.035 0.038 0.037 1 0.492 0.493 0.471 0.485333 Cry1f positive 2 0.686 0.678 0.61 0.658 plant positive 3 0.041 0.043 0.041 0.041667 Wild type 4 0.077 0.08 0.079 0.078667 1 5 0.322 0.315 0.305 0.314 2 6 1.122 1.098 1.109 1.109667 3 7 0.801 0.821 0.834 0.818667 4 PCR reaction components (25 l reaction) Water 16.3l Buffer 2.5 l MgCl 2 1.0 l dNTP 1.0 l Forward Primer 1. 0 l Reverse Primer 1.0 l Taq 0.2 l DNA 2.0 l

PAGE 85

85 Total 25 l Hot Start PCR reaction components (25 l reaction) Water 17.25 l Buffer 2.5 l dNTP 1.0 l cry forward primer 1.0 l Cry reverse primer 1.0 l Hot start Taq 0.25 l DNA 2.0 l Total 25 Stocks and solutions Acetosyrignone Stock (10 mg/ml) Put 50 mg acetosyrignone in a tube, add 1 ml of 70% ethanol and mix (vortex) then Make the volume to 5 ml. Filter sterilize. Hygromycin stock (10 mg/ml) Dissolve 500 mg in 20 ml distilled water Bring up to 50 ml. Na -thiosulphate stock (10 mg/ml) D issolve 400 mg in 1 ml distilled water, mix and vortex and add up to 40 ml water. Filter sterilize and store at 4 oC. DL -dithiothreitol stock (10 mg/ml) Add 400 mg in a tube and dissolve in 1 2 ml di stilled water while shaking on vortex Make up to 40 ml and filter sterilize. Cefotaxime (10 mg/ml) Dissolve 500 mg cefotaxime in 5 ml of distilled water. Mix while vortexing. Bring up to 50 ml. IBA stock (1 mg/ml) Dissolve 50 mg in 2 3 ml of 1 N Koh and then complete the volume to 50 ml with distilled water. Filter sterilize. Geneticin Stock (50 mg/ml) Add 750 mg in 1 ml distilled water and dissolve it and add 14 ml water. Bring up to 15 ml. Filter sterilize and store at 4 oC. YEP medium (1 liter) 10 g peptone, 10 g yeast extract, 5 g NaCl, pH 7.07.2, autoclave and store at 4 oC.

PAGE 86

86 10 X TBE /l Add in order, Tris Base 108 g, boric acid 55 g, and 40 ml 0.5 M EDTA. 0.1M Spermidine Add 986 l of distilled water and to it add 14 l spermidine. CaCl2 (2. 5 M) 36.75 g dissolved in 100 ml distilled water. Autoclave to sterilize. BAP (1 mg/ml) 0.025 g powder dissolved in 500 l 1N KoH. Make up to 25 ml with distilled water. Filter sterilize and store at 20 oC. 2, 4 -D (2 mg/ml) 0.1 g dissolved in very littl e 1N KoH. Make up the volume with 50 ml distilled water Filter sterilize and store in aliquots at 20oC. Gold Stock (60 mg/ml) Weigh 12 mg gold. Weigh eppendorf tube, put tube on balance, make it zero, add gold to tube. Wash three times with absolute al cohol by vortexing and centrifuging briefly. Resuspend in 200 l distilled water. L-Cysteine (10mg/l) Mix 500 mg L -cysteine in 1 ml water, mix and add 49 ml water. Kanamycin stock (10 mg/ m l) Dissolve 500 mg kanamycin monosulphate in 20 ml water, bring u p to 50ml with distilled water. Store at 20oC. Spectinomycin stock (10 mg/ml) Dissolve 500 mg in 20 ml distilled water. Bring up to 50 ml with distilled water. Store at 20 oC. BG A1 Media (1 liter) so lid. 1 Half strength MS media 2.2g 2 Kinetin (4.5 M) 1ml/l (1mg/ml stock). 3 2,4D (1.8 M) 39 l/l (10mg/ml stock) 4 L -cysteine (3.3mM) 400 mg/l 5 Dithiothreitol (1mM) 15. 4 mg/l 6 Na thiosulphate (1mM) 15. 8 mg/l 7 Sucrose 20 g /l 8 Agar gel 5.6 g/l 9 pH 5.8 to 5.85 Autoclave for 20 minutes

PAGE 87

87 BG A2 Media (1 Liter) Selection Media 1 MS Basal Medium 4.4 g/l 2 Kinetin (4.5 M) 1 ml/l (1 mg/ml stock) 3 2,4D (0.2 M) 4 l/l (10 mg/ml stock) 4 PPM 750 l 5 Sucrose 20 g/l 6 Hygromycin 75 mg/l 7 Cefotaxime 250 mg/l 7 pH 5.8 to 5.85 8 Agar gel 5.6g/l DRG Media (1 liter) 1 MS Basal salts 4.4 g 2 Sucrose 20 g 3 PPM 750 l 4 pH 5.8 to 5.85 5 Agar gel 5.6 g Autoclave 6 Filter sterilized NAA (5 mg/l) 500 l (10 mg/ml) 7 Filter sterilized Kinetin (0.5 mg/l) 500 l (1 mg/ml) Rooting Media (IBA) (500 ml) 1 MS Basal Mediu m 2.2 g 2 PPM 350 l 3 Sucrose 10 g 4 pH 5.8 to 5.85 5 Agar gel 2.3g Autoclave 6 Filter sterilized (IBA) 2 ml (1mg/ml) TDZ Media (Shoot initiation media) (1 liter) 1 MS Basal salts 4.4 g/l 2 Sucrose 20 g/l 3 PPM 750 l 4 pH 5.8 to 5.85 5 Agargel 5.6 g Autoclave 6 Filter sterilized TDZ 550 l (1mg/ml)

PAGE 88

88 LIST OF REFERENCES Adamczyk Jr JJ and Gore J (2004) Laboratory and field performance of cotton containing cry1Ac, cry 1F and both cry1Ac and cry1F (WideStrike) against beet armyworm and fall armyworm larvae (Lepidoptera: Noctuidae). Fl orida Entomol 87: 427432. Adamczyk Jr JJ Holloway JW Leonard BR and Graves JB (1997) Susceptibility of fall armyworm collected fro m different plant hosts to selected insecticides and transgenic Bt cotton. J Cotton Sci 1: 21 28. Ahn BJ, Huang FH, and King JW (1985) Plant regeneration through somatic embryogenesis in common bermudagrass tissue culture. Crop Sci 25: 1107 1109. Ahn BJ, Huang FH, and King JW (1987) Regeneration of bermudagrass cultivars and evidence of somatic embryogenesis. Crop Sci 27: 594 597. Altpeter F (2006) Rye ( Secale cereale L.) Methods Mol Biol 343: 223231. Altpeter F, Baisakh N, Beachy R Bock R, Capell T, Christou P, Daniell H, Datta K, Datta S, Dix PJ, Fauquet C, Huang N, Kohli A, Mooibroek H, Nicholson L, Nguyen TT, Nugent G, Raemakers K, Romano A, Somers DA, Stoger E, Taylor N and Visser R (2005) Particle bombardment and the genetic enhancement of crop s: myths and realities. Mol Breeding 15: 305327. Altpeter F and James V (2005) Genetic transformation of turf type bahiagrass ( Paspalum notatum Flugge) by biolistic gene transfer. Inter Turfgrass Soc Res J 10: 485489. Altpeter F, Neibaur I, Zhang H, Meagher RL, and Gallo M (2009) Expression of synthetic Bt cry gene in s eashore paspalum confers fall armyworm resistance. Soc In Vitro Biol Confer p.2047 (In Press) Altpeter F and Xu J (2000) Rapid production of transgenic turfgrass ( Festuca rubra L.) plant s. J Plant Physiol 157: 441448. Arencibia A, Carmona ER, Tellez P, Chan MT, Yu SM, Trujillo LE, and Ormas P (1998) An efficient protocol for sugarcane ( Saccharum spp. L.) transformation mediated by Agrobacterium tumefaciens Transgenic Res 7: 213 222. A rtunduaga IR, Taliaferro CM, and Johnson BL (1988) Effects of auxin concentration on induction and growth of embryogenic callus from young inflorescence explants of Old World bluestem ( Bothriochloa spp.) and bermuda (Cynodon spp.) grasses. Plant Cell Tissu e Organ Cult 12:13 17. Artunduaga IR, Taliaferro CM, and Johnson BL (1989) Induction and growth of callus from immature inflorescences of Zebra bermudagrass as affected by casein hydrolysate and 2, 4 D concentration. In Vitro Cell Dev Biol 25: 753 756.

PAGE 89

89 Bajaj S, Ran Y, Phillips J, Kularajathevan G, Pal S, Cohen D, Elborough K, and Puthigae S (2006) A high throughput Agrobacterium tumefaciens mediated transformation method for functional genomics of perennial ryegrass ( Lolium perenne L.). Plant Cell Rep 2 5 : 651659. Barba R and Nickell LG (1969) Nutrition and organ differentiation in tissue culture of sugarcanea monocotyledon. Planta 89: 299 30. Barfield CS, Stimac JL, and Keller MA (1980) State -of the art for predicting damaging infestations of fall ar myworm. Fl orida Entomol 63: 364375 Baron C, Domke N, Beinhofer M, and Hapfelmeier S (2001) Elevated temperature differentially affects virulence, VirB protein accumulation, and T pilus formation in different Agrobacterium tumefaciens and Agrobacterium v itis strains. J Bacteriol 183: 6852 6861. Beck E, Ludwig EA, Auerswald B, Reiss B, and Schaller H (1982) Nucleotide sequence and exact localization of the neomycin phosphotransferase gene from transposon Tn 5 Gene 19: 327336. Bettany AJE, Dalton SJ, Ti mms E, Manderyck B, Dhanoa MS, and Morris P (2003) Agrobacterium tumefaciens mediated transformation of Festuca arundinacea (Schreb.) and Lolium multiflorum (Lam.). Plant Cell Rep 21: 437 444. Birch RG (1997) Plant transformation: problems and strategies for practical application. Annu Rev Plant Physiol Plant Mol Biol 48: 297 326. Birch RG and Maretzki A (1993) Transformation of sugarcane. In : Bajaj, Y. P. S., ed. Plant protoplasts and genetic engineering IV. Biotechnology in agriculture and forestry. Hei delberg: Springer -Verlag 23: 348360. Bolwell GP, Bell JN, Cramer CL, Schuch W, Lamb CJ, and Dixon RA (1985) L Phenylalanine ammonia lyase from Phaseolus vulgaris : Characterization and differential induction of multiple forms from elicitor treated cell su spension cultures. Eur J Biochem 149: 411419. Bower R and Birch RG (1992) Transgenic sugarcane plants via microprojectile bombardment The Plant J 2: 409416. Bower R, Elliott AR, Potier BAM, and Birch RG (1996) High efficiency, microprojectile mediated cotransformation of sugarcane using visible or selectable markers. Mol Breeding 2: 239 249. Bradford MM (1976) Rapid and sensitive method for quantification of microgram quantities of protein utilizing principle of protein-dye binding. Ann Biochem 72: 24 8 254. Bremer G (1961) Problems in breeding and cytology of sugarcane. Euphytica 10:59 78.

PAGE 90

90 Bunnell BT, McCarty LB and Bridges Jr. WC (2005) TifEagle bermudagrass response to growth factors and mowing height when grown at various hours of sunlight. Crop Sci 45: 575581. Burner DM and Grisham MP (1995) Induction and stability of phenotypic variation in sugarcane as affected by propgation procedure. Crop Sci 35: 875 880. Burton GW (1966) Tifdwarf bermudagrass. Crop Sci 6: 94. Burton GW and Hanna WW (19 95) Bermudagrass. In : Barnes RF, Miller DA, and Nelson CJ (ed s ) Forages An introduction to grassland agriculture. Iowa State University Press, Ames Vol 1. pp 421429. Burton GW, Gates RN and Hill GM (1993) Registration of Tifton 85 bermudagrass. Cro p Sci 33:644 645. Buzacott JH (1965) Cane varieties and breeding. In : Ki m NJ, Mungomery RW, Hughes CG (eds.) Manual of Cane Growing. Angus & Robertson, Sydney, Australia, pp 220 253. Castle LA, Wu G, and McElroy D (2006) Agricultural input traits: Past, present and future. Current Opin Biotech 17: 105112. Chaudhury A and Qu R (2000) Somatic embryogenesis and plant regeneration of turf type bermudagrass: effect of 6 benzyladenine in callus induction medium. Plant Cell Tissue Org Cult 60:113 120. Chen L, Marmey P, Taylor NJ, Brizard J, Espinoza C, DCruz P, Huet H, Zhang S, de Kochko A, Beachy RN, and Fauquet CM (1998) Expression and inheritance of multiple transgenes in rice plants. Nature Biotechnol 16: 1060 1064. Chen L, Zhang B, and Xu Z (2008) Salt tolerance conferred by over expression of Arabidopsis vacuolar Na(+)/H(+) antiporter gene AtNHX1 in common buckwheat ( Fagopyrum esculentum ). Trans Res 17: 121 132. Chen WH, Gartland KMA, Davey MR, Sotak R, Gartland JS, Mulligan BJ, Power JB, and Cocking E C (1987) Transformation of sugarcane protoplasts by direct uptake of a selectable chimaeric gene. Plant Cell Rep 6: 297 301. Cheng M, Lowe B, Spencer M, Ye X, and. Armstrong C (2004) Invited review: factors influencing Agrobacterium -mediated transformatio n of monocotyledonous species. In Vitro Cell Dev Biol Plant 40: 31 45. Chengalrayan K and Gallo -Meagher M (2001) Effect of various growth regulators on shoot regeneration of sugarcane. In Vitro Cell Dev Biol Plant 37: 434 439.

PAGE 91

91 Chengalrayan K, Abouzid A, and Gallo -Meacher M (2005) In vitro regeneration of plants sugarcane seed -derived callus. In Vitro Cell Dev Biol Plant 41: 477 482. Chengalrayan K, Gallo -Meagher M, English RG (2001) Novel selection agents for sugarcane transformation. Soil Crop Sci Soc F l Proc 60: 81 87. Cho MJ, Choi HW, and Lemaux PG (2001) Transformed T0 orchardgrass ( Dactylis glomerata L.) plants produced from highly regenerative tissues derived from mature seeds. Plant Cell Rep 20:318 324. Chowdhury MKU and Vasil IK (1992) Stabe ly t ransformed herbicide resistance callus of sugarcane via microprojectile bombardment of cell suspension cultures and electroporation of protoplasts. Plant Cell Rep 11: 494 498. Christensen AH, Sharrock RA, and Quail PH (1992) Maize polyubiquitin genes: str ucture, thermal perturbation of expression and transcript splicing, and promoter activity following transfer to protoplasts by electroporation. Plant Mol Biol 18: 675-689. Choi HW, Lemaux PG, and Cho MJ (2000) Increased chromosomal variation in transgenic versus nontransgenic barley ( Hordeum vulgare L.) plants. Crop Sci 40:524 533. Christou P, McCabe DE, and Swain WF (1988) Stable transformation of soybean callus by DNA-coated gold particles. Plant Physiol 87: 671674. Christy LA, Arvinth S, Saravanakuma r M, Kanchana M, Mukunthan N, Srikanth J, Thomas G, and Subramonian N (2009) Engineering sugarcane cultivars with bovine pancreatic trypsin inhibitor (aprotinin) gene for protection against top borer ( Scirpophaga excerptalis Walker). Plant Cell Rep 28: 175 184. Clough SJ and Bent AF (1998) Floral dip: a simplified method for Agrobacterium mediated transformation of Arabidopsis thaliana. Plant J 16: 735 743. Conger BV, Hanning GE, Gray DJ, and McDaniel (1983) Direct e mbryogenesis from m esophyll c ells of o r chardgrass. Science 26: 850851. Cordeiro G, Amouyal O, Eliott F, and Henry R (2007) Genome Mapping and Molecular Breeding in Plants, Pulses, Sugar and Tuber Crops (ed.) Springer -Verlag Heidelberg Germany 3:175204. Cordeiro GM, Casu R, McIntyre CL, Mann ers JM, and Henry RJ (2001) Microsatellite markers from sugarcane ( Saccharum spp.) ESTs crosstransferable to e rianthus and sorghum. Plant Sci 160: 1115 1123. Crane C, Wright E, Dixon RA, and Wang ZY (2006) Transgenic Medicago truncatula plants obtained fr om Agrobacterium tumefaciens transformed roots and Agrobacterium rhizogenes transformed hairy roots. Planta 223: 1344 1354.

PAGE 92

92 Crickmore N, Zeigler DR Feitelson J Schnepf E Van Rie J Lereclus D Baum J and Dean DH (1998) Revision of the nomenclature for the Bacillus thuringiensis pesticidal crystal proteins. Microbiol Mol Biol Rev 62: 807 813. Cvikrova M, Mala J, Eder J, Hrubcova M, and Vagner M (1998) Abscisic acid, polyamines and phenolic acids in sessile oak somatic embryos in relation to their conver sion potential. Plant Physiol Biochem 36: 247255. Dafny Yelin M and Tzfira T (2007) Delivery of Multiple Transgenes to Plant Cells. Plant Physiol 145: 1118 1128. Dai S, Zhang P, Marmey P, Zhang S, Tian W Chen S, Beachy R, and Fauquet C (2001) Comparati ve analysis of transgenic plants obtained by Agrobacterium mediated transformation and particle bombardment. Mol Breed 7: 25 33. Dale PJ (1980) Embryoids from cultured immature embryos of Lolium multiflorum Z Pflanzenphysiol 100: 7377. Daniels J and Roach BT (1987) Taxonomy and evolution. In: Heinz DJ (ed.) Sugarcane improvement through breeding. Elsevier, Amsterdam, Netherlands Vol II pp 7 84. Dasgupta R, Bradley H, Garcia H, and Goodman RM (2001) Systemic spread of an RNA insect virus in plants expr essing plant viral movement protein genes. Proc N atl Acad Sci USA 98: 49104915. Dellaporta SL, Wood J, and Hicks JB (1983) A plant DNA minipreparation: version II. Plant Mol Biol Rep 1 : 19 21. de Maagd RA, Bravo A, Berry C, Crickmore N, and Schnepf HE ( 2003) Structure, diversity, and evolution of protein toxins from spore -forming entomopathogenic bacteria. Annu Rev Genet 37: 409 433. DHont A and Layssac M (1998) Analysis of cultivars genome structure by molecular cytogenetics and the study of introgres sion mechanisms. Centre de coopration international en recherche agronomique pour le dveloppement. Annual Crops Department CIRAD CA, pp 9 10. DHont A, Ison D, Alix K, Roux C, and Glaszmann JC (1998) Determination of basic chromosome numbers in the gen us Saccharum by physical mapping of ribosomal RNA genes. Genome 41: 221 225. Dixon L, Nyffenegger T, Delley G, Martinez Izquierdo J, and Hohn T (1986) Evidence for replicative recombination in Cauliflower Mosaic -Virus. Virology 150: 463-468.

PAGE 93

93 Dulmage HT ( 1981) Insecticidal activity of isolates of Bacillus thuringiensis and their potential for pest control. In : Microbial Control of Pests and Plant Dis 19701980 (ed.) Burges, H.D. pp. 193222. London: Academic Press. Eapen S and Rao PS (1982) Callus inducti on and plant regeneration from immature embryos of rye and triticale. Plant Cell Tissue Organ Cult 1:221 227. Elliott AR, Campbell JA, Brettell RIS, and Grof CPL (1998) Agrobacterium -mediated transformation of sugarcane using GFP as a screenable marker. Aust J Plant Physiol 25: 739 743. Elliott AR, Geijskes RJ, Lakshmanan P, McKeon MG, Wang LF, Berding N, Grof CPL, and Smith GR (2002) Direct regeneration of transgenic sugarcane following microprojectile transformation of regenerable cells in thin transve rse section explants. In : Vasil IK, ed Proc Xth Int Assoc Plant Tissue Cult Biotechnol Orlando, June 23 28; 2002. Enriquez Obregon GA, Vazquez Padron RI, Pieto -Samsonov DL, Dela Riva GA, and Selman Housein G (1998) Herbicide -resistant sugarcane ( Saccharum officinarum L.) plants by Agrobacterium mediated transformation. Planta 206:20 27. EPA (2001) Biopesticide Registration Action Document: Bacillus thuringiensis Cry1F Corn.Office of Pesticide Programs, Biopesticides and Pollution Prevention Division. U.S. Environmental Protection Agency, Washington, DC. Updated August, 2005 (last accessed May 6, 2007). http://www.epa.gov/pesticides/biopesticides/ingredients/tec h_docs/brad_006481.pdf Evers GW, Parsons MJ, and Rodgers CA (2004) Developing a seeded bermudagrass comparable to Tifton 85. p. 290 294. In Proc. Am. Forage Grassl. Conf., Vol. 13, Roanoke, VA. 12 16 June 2004. Am Forage and Grassl Counc Georgetown, T X. Falco MC and Silva Filho MC (2003) Expression of soybean proteinase inhibitors in transgenic sug arcane plants: effects on natural defense against Diatraea saccharalis Plant Physiol Biochem 41: 761 766. Falco MC, Tulmann A, and Ulian EC (2000) Transf ormation and expression of a gene for herbicide resistance in a Brazilian sugarcane. Plant Cell Rep19: 1188 1194. Ferre J and Van Rie J (2002) Biochemistry and genetics of insect resistance to Bacillus thuringiensis Annu Rev Entomol 47: 501 33. Ferry N, Edwards MG, Gatehouse J, Capell T, Christou P, and Gatehouse AMR (2006) Transgenic plants for insect pest control: a forward looking scientific perspective. Trans Res 15: 13 19.

PAGE 94

94 Fraley RT, Rogers SG, Horsch RB, Sanders PR, Flick JS, Adams SP, Bittner ML, Brand LA, Fink CL, Fry JS, Galluppi GR, Goldberg SB, Hoffmann NL, and Woo SC (1983) Expression of bacterial genes in plant cells. Proc Natl Acad Sci U S A 80: 48034807. Frame BR, Shou H, Chikwamba RK, Zhang Z, Xiang C, Fonger TM, Pegg SEK, Li B, Nettleton DS, Pei D, and Wang K (2002) Agrobacterium tumefaciens mediated transformation of maize embryos using a standard binary vector system. Plant Physiol 129:13 22. Franks T and Birch R (1991) Gene transfer into intact sugarcane cells using microprojectile b ombardment. Aust J Plant Physiol 18: 471480. Gallo -Meagher M and Irvine, JE (1996) Herbicide resistant transgenic sugarcane plants containing the bar gene. Crop Sci 36: 1367 1374. Gallo -Meagher M, English RG, and Abouzid A (2000) Thidiazuron stimulates shoot regeneration of sugarcane embryogenic callus. In Vitro Cell Dev Biol Plant 36: 37 40. Gambley RL, Bryant JD, Masel NP, and Smith GR (1994) Cytokinin enhanced regeneration of plants from microprojectile bombarded sugarcane meristematic tissue. Aust J Plant Physiol 21: 603612. Gambley RL, Ford R, and Smith GR (1993) Microprojectile transformation of sugarcane meristems and regeneration of shoots expressing -glucuronidase. Plant Cell Rep 12: 343346. Garcia AAF, Kido EA, Meza AN, Souza HMB, Pinto LR, Pastina MM, Leite CS, da Silva JAG, Ulian EC, Figueira A, and Souza A (2006) Development of an integrated genetic map of a sugarcane (Saccharum spp.) commercia l cross, based on a maximum -likeli -hood approach for estimation of linkage and linkage phases. Theor Appl Genet 112: 298 314. Ge Y, Norton T, and Wang Z -Y (2006) Transgenic zoysiagrass ( Zoysia japonica) plants obtained by Agrobacterium mediated transforma tion. Plant Cell Rep 25: 792798. Gelvin SB (2003) Agrobacterium mediated plant transformation: the biology behind the genejockeying tool. Microbiol Mol Biol Rev 67: 16 37. Gilbert RA, Gallo Meagher M, Comstock JC, Miller JD, Jain M, and Abouzid A (2005) Agronomic evaluation of sugarcane lines transformed for resistance to sugarcane mosaic virus strain E. Crop Sci 45: 2060 2067. Gilbert RA, Glynn NC, Comstock JC, and Davis MJ (2009) Agronomic performance and genetic characterization of sugarcane transf ormed for resistance to sugarcane yellow leaf virus. Field Crop Res 111: 3946. Gill R, Malhotra PK, and Gosal SS (2006) Direct plant regeneration from cultured young leaf segments of sugarcane. Plant Cell Tissue and Organ Cult 84: 227231.

PAGE 95

95 Glare TR and OCallaghan M (2000) Bacillus thuringiensis : Biology, Ecology, and Safety. John Wiley & Sons Chichester, UK. Glaz B, Morris DR, and Daroub SH (2004) Sugarcane photosynthesis, transpiration and stomatal conductance due to i 44: 1633 1641. Goldman JJ, Hanna WW, Fleming GH, and Ozias -Akins P (2004a) Fertile transgenic pearl millet [Pennisetum glaucum (L.) R. Br.] plants recovered through microprojectile bombardment and phosphinothricin selection of apical meristem -, inflores cence and immature embryoderived embryogenic tissues. Plant Cell Rep 21: 9991009. Goldman JJ, HannaWW, Fleming GH, Ozias-Akins P (2004b) Ploidy variation among herbicide resistant bermudagrass plants of cv. TifEagle transformed with the bar gene. Plant Cell Rep 22:553 560. Gray JL and White RH (1999) Maintaining the new dwarf greens type bermudagrasses. Golf Course Manage 67: 52 55. Griffits JS, and Aroian RV (2005) Many roads to resistance: how invertebrates adapt to Bt toxins. BioEssays 27: 614 624. Guiderdoni E and Demarly Y (1988) Histology of somatic embryogenesis in cultured leaf segments of sugarcane plantlets. Plant Cell Tiss Organ Cult 14: 71 88. Guy RN, Leppla NC, Rye JR, Green CW, Barette SL, and Hollien KA (1985) Trichoplusiani pp. 4874 94. In P. Sing & R. F. Moore (eds.), Handbook of insect rearing, vol. 2. Elsevier, Amsterdam. Ha SB, Wu FS and Thorne TK (1992) Transgenic turf type tall fescue ( Festuca arundinacea Schreb.) obtained by direct gene transfer to protoplasts. Plant Cell Rep 11: 601604. Hadi MZ, McMullen MD, Finer JJ (1996) Transformation of 12 different plasmids into soybean via particle bombardment.Plant Cell Rep 15: 500505. Haley S and Bolling C (2005) USDA projects steady beet sugar production but lower cane sugar production. ElectronicOutlookReport fromtheEconomicResearch Service (www.ers.usda.gov). Sugar and Sweeteners Outlook sss242, Economic Research Service, USDA Washington, DC. Hanna WW and Elsner JE (1999) Registration of TifEagle bermudagrass. Crop Sci 39:1258. Hansen G and Wright MS (1999) Recent advances in the transformation of plants. Trends Plant Sci 4 : 226231. Harming GE and Conger BV (1982) Embryoid and plantlet formation from leaf segments of Dactylis glomerata L Theor Appl Genet 63: 155159.

PAGE 96

96 Ha rtman CL, Lee L, Day PR, and Tumer NE (1994) Herbicide resistant turfgrass ( Agrostis palustris Huds.) by biolistic transformation. Bio/Technology 12: 919 923. Heinz DJ and Mee GWP (1969) Plant differentiation from callus tissue of Saccharum species. Crop Sci. 9:346 348. Heinz DJ and Mee G W P (1971) Morphologic, cytogenetic, and enzymatic variation in Saccharum species hybrid clones derived from callus tissue. Am J Bot 58: 257262. Hiei Y, Ohta S, Komari T, and Kumashiro T (1994) Efficient transformation of rice ( Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T DNA. Plant J 6: 271 282. Hill, GM, Gates RN, and West JW (2001) Advances in bermudagrass research involving new cultivars for beef and dairy production. J. Anim. Sci. 79: E48 E58 Ho WJ and Vasil IK (1983) Somatic embryogenesis in sugarcane ( Saccharum offcinarum L.). The morphology and ontogeny of somatic embryos. Protoplasma 118:169 180. Hoekema A, Hirsch PR, Hooykaas PJJ, and Schilperoort RA (1983) A binary vector strategy based on separation of vir and T region of the Agrobacterium tumefaciens Ti plasmid. Nature 303: 179180. Hofmann C, Luthy P, Hutter R and Pliska V (1988) Binding of the delta -endotoxin from Bacillus thuringiensis to brushborder memb rane vesicles of the cabbage butterfly ( Pieris brassicae ). Euro J Biochem 173: 85J91. H fte H, De Greve H, Seurinck J, Jansens S, Mahillon J, Ampe C, Vandekerckhove J, Vanderbruggen H, Van Montagu M, Zabeau M and Vaeck M (1986) Bt endotoxins Eur J Biochem161: 273280. Hfte H and Whiteley HR (1989) Insecticidal crystal proteins of Bacillus thuringiensis Microbiol Rev 53: 242 255. Holm L, Doll J, Holm E, Pancho J, and Herberger J (1997) World weeds. Natural Histories and Distri bution. John Wiley & Sons Inc. New York. Hoy JW, Bischoff KP, Milligan SB, and Gravois KA (2003) Effect of tissue culture explant source on sugarcane yield components. Euphytica 129: 237 240. Hu F, Zhang L, Wang X, Ding J, and Wu D (2005) Agrobacterium m ediated transformed transgenic triploid bermudagrass ( Cynodon dactylon x c. transvaalensis ) plants are highly resistant to the glufosinate herbicide Liberty. Plant Cell Tissue Organ Cult 83: 13 19.

PAGE 97

97 Irvine JE and Mirkov TE (1997) The development of geneti c transformation of sugarcane in Texas. Sugar J. 60: 25 29. Ishida Y, Saito H, Ohta S, Hiei Y, Komari T, and Kumashiro T (1996) High -efficiency transformation of maize ( Zea mays L.) mediatedby Agrobacterium tumefaciens Nat Biotechnol 14: 745 750. Jain M, Chengalrayan K, Abouzid A, Gallo M (2007) Prospecting the utility of a PMI/mannose selection system for the recovery of transgenic sugar cane ( Saccharum spp. hybrid) plants. Plant Cell Rep 26: 581 590. James C (2005) Global status of commercialized bio tech/GM crops: 2005. ISAAA BRIEFS NO. 342005. 2007 (last accessed May 6, 2007). http://www.isaaa.org James GL (2004) An introduction to sugarcane In : James G (ed.) Sugarcane. 2nd edition Blackwell Publishing Ltd A mes IA p. 1 18. Jian B, Hou W, Wu C, Liu B, Liu W, Song S, Bi Y, and Han T (2009) Agrobacterium rhizogenes mediated transformation of Superroot -derived lotus corniculatus plants: a valuable tool for functional genomics. BMC Plant Biol 9: 7891. Joyce PA, McQualter RB, Bernad MJ, and Smith GR (1998a) Engineering for resistance to SCMV in sugarcane. Acta Hort 461: 385 391. Joyce PA, McQualter RB, Handley JA, Dale JL, Harding RM, and Smith GR (1998b) Transgenic sugarcane resistant to sugarcane mosaic vir us. In : Hogarth, D. M., (ed.). Proc Aust Soc Sugarcane Technol 20: 204 210. Kereszt A, Li D, Indrasumunar A, Nguyen CD, Nontachaiyapoom S, Kinkema M, and Gresshoff PM (2007) Agrobacterium rhizogenes mediated transformation of soybean to study root biology. Nature Protocols 2 : 948 952. Klein TM; Wolf ED, and Wu R (1987) High-velocity microprojectiles for delivering nucleic acids into living cells. Nature 327: 7073. Knight PJK, Crickmore N, and Ellar DJ (1994) The receptor for Bacillus thuringiensis Cry I A(c) delta -endotoxin in the brush border membrane of the lepidopteran Manduca sexta is amino peptidase N. Mol Microbiol 11: 429 436. Knipling EF (1980) Regional management of the fall armyworm : A realistic approach? Fl orida Entomol 63: 4684 80. Krumbiege l -Schroeren G, Finger J, Schroeren V, and Binding H (1984) Embryoid formation and plant regeneration from callus of Secale cereal. Z Pflanzenz cht 92: 89 94.

PAGE 98

98 Lakshmanan P, Geijskes RJ, Aitken KS, Grof CPL, Bonnett GD, and Smith GR (2005) Sugarcane biotech nology: the challenges and opportunities. In Vitro Cell Dev Biol Plant 41: 345 363. Lakshmanan P, Geijskes RJ, Elliott AR, Wang LF, McKeon MG, Swain RS, Borg Z, Berding N, Grof CPL, and Smith GR (2003) Direct regeneration tissue culture and transformation systems for sugarcane and other monocot species. Proc Int Soc Sugar Cane Technol Mol Biol Workshop, Montpellier 4: 25. Lakshmanan P, Geijskes RJ, Wang LF, Elliott A, Grof CPL, Berding N and Smith GR (2006) Developmental and hormonal regulation of direct shoot organogenesis and somatic embryogenesis in sugarcane ( Saccharum spp. Interspecific hybrids) leaf culture. Plant Cell Rep 25 (10): 10071015. Lee SH, Lee DG, Woo HS, Lee KW, Kim DH and Kwak SS (2006) Production of transgenic orchardgrass via Agrobact erium mediated transformation of seed -derived callus tissues. Plant Sci 171: 408 414. Lee TSG (1987) Micropropagation of sugarcane ( Saccharum spp.). Plant Cell Tissue Organ Cult 10: 47 55. Leibbrandt NB and Snyman SJ (2003) Stability of gene expression a nd agronomic performance of a transgenic herbicide -resistant sugarcane line in South Africa. Crop Sci 43: 671 677. Lerche K and Hallmann A (2009) Stable nuclear transformation of Gonium pectoral. BMC Biotech 9: 64 84. Lewis NG and Yamamoto E (1990) Lignin : occurrence, biogenesis and biodegradation. Ann Rev Plant Physiol Plant Mol Biol 41: 455496. Li L and Qu R (2002) In vitro somatic embryogenesis in turf type bermudagrass roles of ABA and GA, and occurrence of repetitive somatic embryogenesis. Plant Bre ed 121: 155 158. Li J; Carroll J, and Ellar DJ ( 1991) Crystal s tructure of i nsecticidal e ndotoxin from Bacillus thuringiensis at 2.5 resolution. Nature 353: 815821. Li L, Li R, Fei S, and Qu R (2005) Agrobacterium mediated transformation of common bermudagrass ( Cynodon dactylon). Plant Cell Tissue and Organ Cult 83: 223 229. Littell RC Milliken GA, Stroup WW, and Wolfinger RD (1996) SAS system for mixed models. SAS Institute, Cary, NC. Lourens AG and Martin FA (1987) Evaluation of in vitro propagated sugarcane hybrids for somaclonal variation. Crop Sci 27: 793 796.

PAGE 99

99 Lu C Y, Chandler S F, and Vasil IK (1984) Somatic embryogenesis and plant regeneration from cultured immature embryos of rye ( Secale cereale L.) J Plant Physiol 115: 237244. Lu Y J and Adang MJ ( 1996) Distinguishing fall armyworm (Lepidoptera: Noctuidae) strains using a diagnostic mitochondrial DNA marker. Fl orida Entomol 79: 48 55. Lu Y J Adang MJ Isenhour DJ, and Kochert GD ( 1992) RFLP analysis of genetic variation in North American populations of the fall armyworm moth Spodoptera frugiperda (Lepidoptera: Noctuid ae). Molecular Ecol 1: 199 208. Luciani G, Altpeter F Yactayo Chang J, Zhang H, Gallo M, Meagher RL and Wofford D (2007) Expression of cry1Fa in b ahiagrass enhances resistance to fall armyworm Crop Sci 47: 24302436. Luginbill P (1928) The fall armywo rm. US Dep Agric Tech Bull 34: 1 91. Maddock SE, Lancaster VA, Risiott R, and Franklin J (1983) Plant regeneration from cultured immature embryos and inflorescences of 25 cultivars of wheat ( Triticum aestivum ). J Exp Bot 3 4: 915926. Mandebvu P, West JW, Hill GM, Gates RN, Hatfield RD, Mullinix BG, Parks AH, and Caudle AB (1999) Comparison of Tifton 85 and c oastal bermudagrasses for yield, nutrient traits, intake, and digestion by growing beef steers. J. Anim. Sci. 77: 1572 1586. Manickavasagam M, Ganapa thi A, Anbazhagan VR, Sudhakar B, Selvaraj N, Vasudevan A and Kasthurirengan S (2004 ) Agrobacterium mediated genetic transformation and development of herbicide resistant sugarcane ( Saccharum species hybrids) using axillary buds. Plant Cell Rep 23: 134 143. Matzke MA and Matzke AJ (1998) Epigenetic silencing of plant transgenes as a consequence of diverse cellular defence responses. Cell Mol Life Sci 54(1): 94 103. McCarty LB and Miller GL ( 2002) Managing Bermudagrass Turf: Selection, Construction, Cultu ral Practices and Pest Management Strategies. Chelsea, MI: Sleeping Bear Press McQualter RB, Dale JL, Harding RM, McMahon JA, and Smith GR (2004) Production and evaluation of transgenic sugarcane containing a Fiji disease virus (FDV) genome segment S9 de rived synthetic resistance gene. Aust J Agric Res 55: 139 145. Meagher RL Jr and Gallo Meagher M (2003) Identifying host strains of fall armyworm (Lepidoptera: Noctuidae) in Florida using molecular makers Fl orida Entomol 86: 450455. Meagher RL Jr, Misl evy P, and Nagoshi RN (2007) Caterpillar ( L epidoptera: N octuidae) feeding on pasture grasses in central Florida. Fl orida Ent omol 90: 295303.

PAGE 100

100 Meagher RL Jr and Nagoshi RN (2004) Population dynamics and occurrence of Spodoptera frugiperda host strains in s outhern Florida. Eco l Entomol 29: 614620. Mitich LW (1989) Bermudagrass, intriguing world of weeds. Weed Technol 3: 433 435. Murashige T and Skoog F (1962) A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol Plant 15: 473497. Nagoshi RN and Meagher RL (2004) Behavior and distribution of the two fall armyworm host strains in Florida. Florida Entomol 87: 440449. Nagoshi RN, Meagher RL, Adamczyk JJ, Braman SK, Brandenburg RL and Nuessly G (2006) New r estriction f ra gment l ength p olymorphisms in the c ytochrome o xidase I g ene f acilitate h ost s train i dentification of f all a rmyworm (Lepidoptera: Noctuidae) p opulations in the s outheastern United States. J Econ Entomol 99: 671677 Nester EW, Thomashow L, Metz M, and Gordon M (2002 ) 100 years of Bacillus thuringenesis : a critical scientific assessment. American academy of microbiology. Washington, D.C. Newell CA (2000) Plant transformation technology: Developments and applications. Mol Biotechnol 16: 5365. Nickell LG, an d Heinz DJ (1973) Potential of cell and tissue culture techniques as aids in economic plant improvement. In : Seb AM, (ed.) Genes, enzymes and population. Plenum, New York, pp 109128. Nielsen KA, and Knudsen E (1993) Regeneration of green plants from embr yogenic suspension cultures of Kentucky bluegrass ( Poa pratensis L.). J Plant Physiol 141: 589598. Nonato RV, Mantelatto PE, and Rossell CEV (2001) Integrated production of biodegradable plastic, sugar and ethanol. Appl Microbiol Biotechnol 57: 1 5. Nut t KA, Allsopp PG, McGhie T K, Shepherd KM, Joyce PA, Taylor GO, McQualter RB, and Smith GR (1999) Transgenic sugarcane with increased resistance to canegrubs. In: Hogarth DM (ed.) Proc Aust Soc Sugarcane Technol 21: 171 176. Odell JT, Nagy F, and Chua NH (1985) Identification of DNA -sequences required for activity of the cauliflower mosaic virus 35S promoter. Nature 313: 810812. Pashley DP (1986) Host associated genetic differentiation in fall armyworm (Lepidoptera: Noctuidae): a sibling species complex ? Ann Entomol Soc Am 79: 898904. Pashley DP ( 1989) Host associated differentiation in armyworms (Lepidoptera: Noctuidae): an allozymic and mitochondrial DNA perspective. In Loxdale HD and Hollander JD (ed.), Electrophoretic studies on agricultural pests Systematics Association Special Vol No. 39 pp. 103114. Clarendon Press Oxford.

PAGE 101

101 Pashley DP (1988) T he Current status of fall armyworm host strains. Fl orida Entomol 71: 227234. Pashley DP, Hardy TN, and Hammond AM (1995) Host effects on developmental and reproductive traits in fall armyworm strains (Lepidoptera: Noctuidae). Ann Entomol Soc Am 88: 748 755. Pashley DP, Johnson SJ, and Sparks AN (1985) Genetic population structure of migratory moths: the fall armyworm (Lepidoptera: Noctuidae). Ann Entomol Soc America 78: 756762. Pashley DP Sparks TC Quisenberry SS Jamjanya T and Dowd PF ( 1987) Two fall armyworm strains feed on corn, rice and bermudagrass. Louisiana Ag 30: 8 9 Potrykus I, Harms CT, and Linneus H (1979) Callus formation from c e ll c ulture p rotoplasts of c orn (Zea mays L.). Theor Appl Genet 54: 209214. Purseglove JW (1972) Tropical crops: M onocotyledons. Longman, London Quisenberry SS and Whitford F ( 1988) Evaluation of bermudagrass resistance to fall armyworm (Lepidoptera: Noctuidae) : influence of host strain and dietary conditioning. J Econ Entomol 81: 1463 1468. Ranjekar PK, Patankar A, Gupta V, Bhatnagar R, Bentur J, and Kumar PA (2003) Genetic engineering of crop plants for insect resistance. Curr Sci 84: 321329. Rat hus C and Birch RG (1992) Stable transformation of callus from electroporated sugarcane protoplasts. Plant Sci 82: 81 89. Rochester DE, Winer JA, and Shah DM (1986) The structure and expression of maize genes encoding the major heat shock protein, hsp70. EMBO J 5 : 451458. Sacchi VF Parenti P Hanozet GM Giordana B, Lthy P, and Wolfersberger MG (1986) Bacillus thuringiensis toxin inhibits -K+-gradient -dependent amino acid transport across the brush border membrane of Pieris brassicae midgut cells FEBS L ett 204: 213 218. Sallaud C, Meynard D, Boxtel JV, Gay C, BAO` s M, Brizard JP, Larmande P, Ortega D, Raynal M, Portefaix M, Ouwerkerk PBF, Rueb S, Delseny M, and Guiderdoni E (2003) Highly efficient production and characterization of T DNA plants for ric e ( Oryza sativa L.) functional genomics. Theor Appl Genet 106: 1396 1408. Sambrook J and Russell DW (2001) Molecular cloning a laboratory manual. Cold Spring Harbor, NY. Cold Spring Harbor Laboratory Press.

PAGE 102

102 Sangadala S, Walters FS, English LH, and Adang MJ (1994) A mixture of Manduca sexta aminopeptidase and phosphatase enhances Bacillus thuringiensis insecticidal Cry I A(c) toxin binding and 86 Rb+-K+ ef in vitro J Biol Chem 269: 10088 10092. Santosa DA, Hendroko R, Farouk A, and Greiner R (2004) A rapid and highly efficient method for transformation of sugarcane callus. Molecular biotech 28: 113119. SAS Institute (2002) Propietary Software Rele ase 9.0, Cary, NC. Stamou M, Bernal JS, Legaspi JC, Mirkov TE, and Legaspi BC (2002) Evaluation of lectin expressing transgenic sugarcane against stalkborers (Lepidoptera: Pyralidae): effects on life history parameters. J Econ Entomol 95: 469 477. Schne pf E, Crickmore N, Van Rie J, Lereclus D, Baum J, Feitelson J, Zeigler DR and Dean DH (1998) Bacillus thuringiensis and its pesticidal crystal proteins. Microbiol Mol Biol Rev 62: 775806. Shetty K and Asano Y (1991) The influence of organic nitrogen sour ces on the induction of embryogenic callus in Agrostis alba L. J Plant Physiol 139: 82 85. Smith RH and Hood EH (1995) Agrobacterium tumefaciens transformation of monocotyledons. Crop Sci 35: 301 309. Somleva MN, Tomaszewski Z, and Conger BV (2002) Agrobacterium mediated genetic transformation of switchgrass. Crop Sci 42: 2080 2087. Spangenberg G, Wang ZY, Nagel J, Iglesias VA, and Potrykus I (1995) Transgenic tall fescue (Festuca arundinacea) and red fescue ( F. rubra ) plants from microprojectile bombard ment of embryogenic suspension cells. J Plant Physiol 145: 693701. Sparks AN (1979) A review of the biology of the fall armyworm. Fl orida Entomol 62: 82 87. Sreenivasan TV, Ahloowalia BS and Heinz DJ (1987) Cytogenetics. In : Heinz DJ (ed.) Sugarcane i mp rovement t hrough b reeding. Elsevier Press Amsterdam, Netherlands. p p 211 253. Tabashnik BE, Liu YB, Finson N, Masson L, and Heckel DG (1997) One gene in diamondback moth confers resistance to four Bacillus thuringiensis toxins. PNAS 94: 16401644. Tadess e Y, Sagi L, Swennen R, and Jacobs M (2003) Optimisation of transformation conditions and production of transgenic sorghum ( Sorghum bicolor ) via microprojectile bombardment. Plant Cell Tissue Organ Cult 75: 1 18. Takamizo T, Hagio T, Fugimori M, Ugaki M, and Hirabayashi T (1995) Direct gene transfer to tall fescue ( Festuca arundinacea) by particle bombardment. Acta Hort 392: 187 192.

PAGE 103

103 Taliaferro CM, Rouquette Jr FM, and Mislevy P (2004) Bermudagrass and stargrass. In Moser LE, Burson BL and Sollenberger LE (ed s .) Warm -season (C4) grasses. Monogr. 45. A merican S ociety of A gronomy, Madison, WI. pp. 417 438. Taylor PWJ, Geijskes JR, Ko HL, Fraser TA, Henry RJ, and Birch RG (1995) Sensitivity of random amplified polymorphic DNA analysis to detect genetic ch ange in sugarcane during tissue culture. Theor Appl Genet 90: 1169 1173. Taylor NJ and Fauquet CM (2002) Microparticle bombardment as a tool in plant science and agricultural biotechnology. DNA Cell Biol 21: 963977. Tingay S, McElroy D, Kalla R, Fieg S, Wang M, Thornton S, and Brettell R (1997) Agrobacterium mediated barley transformation. Plant J 11: 1369 1376. Toyama K, Bae C H, Kang J G, Lim Y P, Adachi T, Rui K -Z, Song P S, and Lee H -Y(2003) Production of herbicide tolerant zoysiagrass by Agrobacter ium mediated transformation. Mol Cells 16: 19 27. Unruh JB and Elliot ML (1999) Best Management Practices for Florida Golf Courses. 2nd (ed.) UF/IFAS, Gainesville FL. Vasil IK (1987) Developing cell and tissue culture systems for the improvement of cereal and grass crops. J Plant Physiol 128: 193 218. Vasil V, Catillo A, Fromm M, and Vasil I (1992) Herbicide resistant fertile transgenic wh eat plants obtained by microprojectile bombardment of regenerable embryogenic callus. Biotechnology 10: 667 673. WanYC and Lemaux PG (1994) Generation of large numbers of independently transformed fertile barley plants. Plant Physiol 104: 37 48. Wang AQ, Dong WQ, Wei YW, Huang CM, He LF, Yang LT, and Li YR (2009) Transformation of sugarcane with ACC oxidase antisense gene. Sugar Tech 11: 3943. Wang JH, Rose RJ, Donaldson BI (1996) Agrobacterium mediated transformation and expression of foreign genes in Medicago truncatula. Aust J Plant Physiol 23: 265 270. Wang ZY, Bell J, and Lehmann D (2004) Transgenic Russian wildrye ( Psathyrostachys juncea) plants obtained by biolistic transformation of embryogenic suspension cells. Plant Cell Rep 22: 903 909. Wang Z Y and Ge Y (2005) Rapid and efficient production of transgenic bermudagrass and creeping bentgrass bypassing the callus formation phase. Funct Plant Biol 32: 769 776.

PAGE 104

104 Weng LX, Deng HH, Xu JL, Li Q, Wang LH, Jiang ZD, Zhang HB, Li QW, and Zhang LH (2006) Re -generation of sugarcane elite breeding lines and engineering of strong stemborer resistance. Pest Manag Sci 62: 178 187. Xiao L and Ha SB (1997) Efficient selection and regeneration of creeping bentgrass transformants following particle bombardment. Plant Cell Rep 16: 874 878. Ye X, Wang Z Y, Wu X, Potrykus I, and Spangenberg G (1997) Transgenic Italian ryegrass (Lolium multiflorum ) plants from microprojectile bombardment of embryogenic suspension cells. Plant Cell Rep 16: 379384. Yu TT, Skinner DZ Liang GH, Trick HN, Huang B, Muthukrishnan S (2000) Agrobacterium mediated transformation of creeping bentgrass using GFP as a reporter gene. Hereditas 133: 229 233. Zhang G, Lu S, Chen TA, Funk CR, and Meyer WA (2003) Transformation of triploid bermuda grass ( Cynodon dactylon x C. transvaalensis cv. TifEagle) by means of biolistic bombardment. Plant Cell Rep 21: 860864. Zhangsun D, Luo S, Chen R and Tang K (2007) Improved Agrobacterium -mediated genetic transformation of GNA transgenic sugarcane. Biologia Bratislava 62: 386 393. Zimmy J and Lrz H (1989) High frequency of somatic embryogenesis and plant regeneration of rye ( Secale cereal L.). Plant Breed 102: 89 100. Zupan J, Muth TR, Draper O, and Zambryski P (2000) The transfer of DNA from Agrobacter ium tumefaciens into plants: a feast of fundamental insights Plant J 23: 11 28.

PAGE 105

105 BIOGRAPHICAL SKETCH Sunil Joshi, the youngest and only son of Dr. D.V. Joshi was born in Ludhiana, Punjab, India on January 6th, 1976. In 1995, Sunil started his college st udies in Agriculture at Punjab Agricultural University, Ludhiana; Punjab where he received his four years honors bachelors degree in Agriculture in 1999 with an elective in crop science. After that he joined Masters Degree in 1999 in Plant Breeding with research focusing on Genetic studies on leaf blight resistance in durum wheat ( Triti c um turgidum ) L. var. Durum. After his M.S. in 2002, he joined as Senior Research Fellow working on projects Development of hybrid rapeseed and mustard and Breeding de signer Brassica in rapeseed and mustard till December 2004. After that he moved to Gainesville, Florida to begin his Ph.D. program at the Agronomy Department, University of Florida in 2005.