<%BANNER%>

Characterization of Adeno-Associated Virus 2 Site-Specific Integration

Permanent Link: http://ufdc.ufl.edu/UFE0024226/00001

Material Information

Title: Characterization of Adeno-Associated Virus 2 Site-Specific Integration
Physical Description: 1 online resource (107 p.)
Language: english
Creator: Daya, Shyam
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: aav, adeno, associated, cellular, factors, gene, integration, rep, site, specific, therapy, vectors, viral, virus
Genetics (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Adeno-associated virus (AAV) is the only mammalian DNA virus known to be capable of establishing latency by integration into a specific site, called AAVS1, on Chromosome 19q13.4. The AAV cis and trans requirements for this process have been identified, yet, a complete picture has not emerged with regards to the precise mechanism. Specifically, the host protein requirements are not known, as well as how they could be interacting with the AAV genome. This study has focused on two specific research objectives. The first objective was to determine if the AAV Rep protein, shown to be required for targeting site-specific integration, can minimize AAV random integration. The second objective was to study cellular repair proteins for an effect on AAV site specific integration. My data have indicated that even in the presence of Rep, random integrations do take place, but the limited number of identified AAV-cellular junctions precludes any definitive statements as to whether Rep can minimize random integration. In addition, I presented direct evidence that a protein called DNA-dependent protein kinase catalytic subunit (DNAPKcs) inhibits stable site-specific integration of single-stranded AAV Rep positive vectors. Moreover, the presence or absence of DNAPKcs did not affect the specific integration of self-complementary AAV Rep positive vectors, which also displayed more random integration. In addition, cellular repair proteins ligase I and ligase IV are not needed for AAV-AAVS1 junction formation, but the absence of ligase IV greatly reduced the frequency of AAV site-specific integration. These findings contribute to a better understanding of the AAV site-specific integration process, suggesting that components of the non-homologous end joining pathway can modulate AAV site-specific integration. By systematically studying the different cellular repair proteins for an effect on specific integration, future work should be able to elucidate the mechanism. The outcome of such advancements would lead to an increased emphasis for the further development of AAV as a safe and efficient integrating vector for future gene therapy studies.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Shyam Daya.
Thesis: Thesis (Ph.D.)--University of Florida, 2009.
Local: Adviser: Berns, Kenneth I.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0024226:00001

Permanent Link: http://ufdc.ufl.edu/UFE0024226/00001

Material Information

Title: Characterization of Adeno-Associated Virus 2 Site-Specific Integration
Physical Description: 1 online resource (107 p.)
Language: english
Creator: Daya, Shyam
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: aav, adeno, associated, cellular, factors, gene, integration, rep, site, specific, therapy, vectors, viral, virus
Genetics (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Adeno-associated virus (AAV) is the only mammalian DNA virus known to be capable of establishing latency by integration into a specific site, called AAVS1, on Chromosome 19q13.4. The AAV cis and trans requirements for this process have been identified, yet, a complete picture has not emerged with regards to the precise mechanism. Specifically, the host protein requirements are not known, as well as how they could be interacting with the AAV genome. This study has focused on two specific research objectives. The first objective was to determine if the AAV Rep protein, shown to be required for targeting site-specific integration, can minimize AAV random integration. The second objective was to study cellular repair proteins for an effect on AAV site specific integration. My data have indicated that even in the presence of Rep, random integrations do take place, but the limited number of identified AAV-cellular junctions precludes any definitive statements as to whether Rep can minimize random integration. In addition, I presented direct evidence that a protein called DNA-dependent protein kinase catalytic subunit (DNAPKcs) inhibits stable site-specific integration of single-stranded AAV Rep positive vectors. Moreover, the presence or absence of DNAPKcs did not affect the specific integration of self-complementary AAV Rep positive vectors, which also displayed more random integration. In addition, cellular repair proteins ligase I and ligase IV are not needed for AAV-AAVS1 junction formation, but the absence of ligase IV greatly reduced the frequency of AAV site-specific integration. These findings contribute to a better understanding of the AAV site-specific integration process, suggesting that components of the non-homologous end joining pathway can modulate AAV site-specific integration. By systematically studying the different cellular repair proteins for an effect on specific integration, future work should be able to elucidate the mechanism. The outcome of such advancements would lead to an increased emphasis for the further development of AAV as a safe and efficient integrating vector for future gene therapy studies.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Shyam Daya.
Thesis: Thesis (Ph.D.)--University of Florida, 2009.
Local: Adviser: Berns, Kenneth I.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0024226:00001


This item has the following downloads:


Full Text

PAGE 1

1 CHARACTERIZATION OF ADENO ASSOCIATED VIRUS 2 SITE SPECIFIC INTEGRATION By SHYAM DAYA A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE O F DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2009

PAGE 2

2 2009 Shyam Daya

PAGE 3

3 To Almighty and my Parents

PAGE 4

4 ACKNOWLEDGMENTS First of all, I would like to thank Dr. Kenneth Berns for giving me the opportunity to d o research in his laboratory, for his faith in my abilities, and for his complete support throughout my graduate education. Secondly, I want to express my gratitude to all the members of my graduate committee: Dr. Mavis Agbandje McKenna, Dr. Arun Sriva selected a better group of professors. Thirdly, I would also like to thank my laboratory colleagues, Nenita Cortez and Chun ad been a good source of early guidance when I joined the laboratory. Last but not least, I have received great support from my family and the Almighty. I thank my family for their love and thank the Almighty as a constant source of support and inspiratio n.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ ........... 4 LIST OF TABLES ................................ ................................ ................................ ...................... 8 LIST OF FIGURES ................................ ................................ ................................ .................... 9 ABSTRACT ................................ ................................ ................................ ............................. 11 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ ............. 13 Gene Therapy ................................ ................................ ................................ ..................... 13 Gene Therapy Using AAV Vectors ................................ ................................ .................... 15 Purpose and Scope of This Research ................................ ................................ .................. 16 Outline of Ch apters ................................ ................................ ................................ ............ 17 2 LITERATURE REVIEW ................................ ................................ ................................ ... 19 Biological Properties of AAV ................................ ................................ ............................. 19 AAV Structure and Genome ................................ ................................ ........................ 19 AAV Infection ................................ ................................ ................................ ............ 22 Binding to cellular receptors ................................ ................................ ................. 22 Internalization and trafficking ................................ ................................ ............... 23 Nuclear entry ................................ ................................ ................................ ........ 25 AAV Genome Replication and Expression ................................ ................................ .. 26 Presence of helper virus ................................ ................................ ........................ 26 Absence of helper virus ................................ ................................ ........................ 29 Recombinant AAV Vectors for G ene Therapy ................................ ................................ .... 30 General Description of AAV Vectors ................................ ................................ .......... 31 Production and Purification of AAV Vectors ................................ ............................... 31 Production of AAV vectors ................................ ................................ .................. 32 Purification of AAV vectors ................................ ................................ ................. 33 New AAV Vectors ................................ ................................ ................................ ...... 35 Self complementary AAV vectors ................................ ................................ ........ 35 Trans splicing vectors ................................ ................................ .......................... 37 Fate of Recombinan t AAV Vectors ................................ ................................ ............. 38 3 RESEARCH OBJECTIVES ................................ ................................ ............................... 40 Background ................................ ................................ ................................ ........................ 40 AAV Site Specific Integration ................................ ................................ ..................... 40 AAVS1 and Its Characteristics ................................ ................................ .................... 42 Mechanism of Rep mediated integration ................................ .............................. 43

PAGE 6

6 Elements required for integration ................................ ................................ .......... 43 Efficiency of integration ................................ ................................ ....................... 44 Research Objectives ................................ ................................ ................................ ........... 45 Determine the Distribution of Rep mediated AAV Integration ................................ .... 45 Determine the Role of Cellular DNA Repair Proteins on Site Specific In tegration ...... 46 4 DETERMINE THE DISTRIBUTION OF REP MEDIATED INTEGRATION .................. 47 Introduction ................................ ................................ ................................ ........................ 47 Experimental Design and Methods ................................ ................................ ..................... 49 Construction of an AAV Vector, P5 Rep Shuttle. ................................ ........................ 49 Western Blot for R ep Expression from P5RepShuttle Vector ................................ ....... 50 P5 RepShuttle Virus Production ................................ ................................ .................. 50 DNA Walking Speedup PCR ................................ ................................ ....................... 51 Junction Assay: Detecting AAVS1 Integration by PCR Southern. ............................... 52 DIG Labeling of AAVS1 probe ................................ ................................ ................... 53 Hybridization of PCR Products ................................ ................................ ................... 54 Rescue of Integrated Shuttle Vector ................................ ................................ ............. 54 Transformation of Competent Cells ................................ ................................ ............. 56 Cloning of PCR products into TOPO TA Vector ................................ ......................... 56 Results ................................ ................................ ................................ ............................... 56 Limit of Detection for Site Specific Integration Using the Junction Assay. .................. 56 P5Rep Shuttle Vector Mimics Wild Type AAV With Regards to Rep expression. ....... 58 Transfected P5Rep Shuttle Integrates into AAVS1 ................................ ...................... 58 Infected P5Rep Shuttle Integrates into AAVS1 ................................ ............................ 60 Shuttle Vector Rescue Isolates AAV AAVS1 Junctions, But Not Those from Other Sites ................................ ................................ ................................ ......................... 61 AAV Chromosome 3 and AAV Chromosome 6 Junctions Isolated Using DNA Walking PCR ................................ ................................ ................................ ........... 61 Discussion and Limitation of Study ................................ ................................ .................... 63 5 DETERMINE THE ROLE OF CELLULAR DNA REPAIR PROTEINS ON SITE SPECIFIC INTEGRATION ................................ ................................ ............................... 67 Introduction ................................ ................................ ................................ ........................ 67 Experimental Design and Methods ................................ ................................ ..................... 69 Cell Lines ................................ ................................ ................................ .................... 69 Construction of Recombinant AAV Vectors ................................ ................................ 69 Cloning of Infected Cells ................................ ................................ ............................. 71 Southern Blot Analysis ................................ ................................ ................................ 71 Results ................................ ................................ ................................ ............................... 72 More Junction Product Seen in M059K Cells Compared to M059J cells. ..................... 72 Time Course for Junction Formation in M059J and M059K Cells ............................... 72 DNAPKcs is an Inhibitor of Single Stranded DNA Site Specific Integration ............... 74 Self Complementary AAV Vectors Integrate Site Specifically in HeLa Cells .............. 75 Self Complementary Vectors Display Equal Integration in the Presence or Absence of DNAPKcs ................................ ................................ ................................ ............ 79

PAGE 7

7 AAV AAVS1 Junction Formation is Not Inhibited in the Absence of Ligase I and Ligase IV ................................ ................................ ................................ ................. 79 Discussion And Limitation Of Study ................................ ................................ .................. 83 6 CONCLUSION ................................ ................................ ................................ .................. 87 APPENDIX VECTOR MAPS ................................ ................................ ................................ ................ 90 Single Stranded Recombinant AAV Vectors ................................ ................................ ...... 90 Self Complementary AAV Vectors ................................ ................................ .................... 91 Packaging Helper Plasmids ................................ ................................ ................................ 91 REFERENCES ................................ ................................ ................................ ......................... 92 BIOGRAPHICAL SKETCH ................................ ................................ ................................ ... 107

PAGE 8

8 LIST OF TABLES Table page 2 1 Percent capsid homology among AAV serotypes 1 through 13. ................................ ..... 20 2 2 List of AAV serotypes and their identified receptor and co receptor(s) used for cell entry. ................................ ................................ ................................ ............................. 23 4 1 P5Shuttle Vector Chromosome 19 junction sequences isolated through rescue approach. ................................ ................................ ................................ ....................... 61 4 2 AAV2 Chromosomal junction sequences identifie d using the DNA Walking Speed Up PCR kit. ................................ ................................ ................................ ................... 63 5 1 Summary of M059K and M059J single stranded infected clones analyzed by southern hybridizations. ................................ ................................ ................................ 75 5 2 Summary of M059K and M059J self complementary infected clones analyzed by southern hybridizations. ................................ ................................ ................................ 79

PAGE 9

9 LIST OF FIGURES Figure page 2 1 The genetic map of AAV ................................ ................................ ............................... 21 2 2 Elements in the A AV ITR required for replication ................................ ........................ 28 4 1 Map of P5RepShuttle Vector ................................ ................................ ........................ 49 4 2 Nested PCR scheme for DNA Walking PCR. ................................ ................................ 52 4 3 PCR scheme fo r detecting AAV AAVS1 junctions ................................ ........................ 5 3 4 4 Shuttle rescue scheme to isolate provirus as plasmids ................................ .................... 55 4 5 Southern blot to assess de tection limit of junction assay ................................ ................ 57 4 6 Western blot for Rep expression from the P5RepShuttle construct. ................................ 58 4 7 Southern on PCR products generated from HeLa genomic DNA transfected with P5Repshuttle vector at various days post tranfection. ................................ ..................... 59 4 8 Southern blot on PCR products from HeLa cells infected with P5RepShuttle vector at various infection doses. ................................ ................................ .............................. 60 4 9 Southern blot on PCR products generated by DNA walking Speedup PCR system. ....... 62 5 1 Junction product formation in M059J and M059K at different doses of wild ty pe AAV 2 infection. ................................ ................................ ................................ ........... 72 5 2 Time course of junction for mation in M059J and M059K cells ................................ ...... 73 5 3 Junction Assay on M059J and M059K c ells co infected w ith P5UF11 and pSVAV2 at 10^6 vp /cell. ................................ ................................ ................................ .............. 74 5 4 Southern hybridization of M059J clones infected with P5UF11 and pSVAV2 (50:1 ratio, 10^6 vp /cell). ................................ ................................ ................................ ........ 76 5 5 Southern hybridization of M059K clones infected with P5UF11 and pS VAV2 (50:1 ratio, 10^6 vp/cell) ................................ ................................ ................................ ......... 77 5 6 Self Complementary AAV vectors integrate s ite specifically in HeLa cells ................... 78 5 7 Southern hybridization of M059J clones infected with dsP5AAVNeoR and dsAAV SV Rep78 (5:1 ratio, 10^4 vg/cell) ................................ ................................ .................. 80 5 8 Southern hybridization of M059K clones infected with dsP5AAVNeoR and dsAAV SVRep78 (5:1 ratio, 10^4 vg/cell). ................................ ................................ ................. 81

PAGE 10

10 5 9 Time course of junction form ation in Ligase I and Li gase IV ................................ ......... 82 5 10 Southern hybridization of Ligase IV clones infected with P5PGKHygroGFP and pS VAV2 (50:1 ratio, 10^5 vg/cell) ................................ ................................ ................ 82

PAGE 11

11 Abstract of Dissertation Presen ted to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy CHARACTERIZATION OF ADENO ASSOCIATED VIRUS 2 SITE SPECIFIC INTEGRATION By Shyam Daya May 2009 Chai r: Kenneth I. Berns Major: Medical Sciences Adeno associated virus (AAV) is the only mammalian DNA virus known to be capable of establishing latency by integration into a specific site called AAVS1, on Chromosome 19q13.4. The AAV cis and trans requireme nts for this process have been identified, yet, a complete picture has not emerged with regards to the precise mechanism. Specifically, the host protein requirements are not known, as well as how they could be interacting with the AAV genome. This study h as focused on two specific research objectives. The first objective was to determine if the AAV Rep protein, shown to be required for targeting site specific integration, can mi nimize AAV random integration The second objective was to study cellular repai r proteins for an effect on AAV si te specific integration. My data has indicated that even in the presence of Rep, random integrations do take place, but, the limited number of identified AAV cellular junctions precludes any definitive statements as to whe ther Rep can minimize random integration. In addition, I presented direct evidence that a protein called DNA dependent protein kinase catalytic su bunit (DNAP K cs) inhibit s stable site specific integration of single stranded AAV Rep positive vectors Moreov er, the presence or absence of DNAPKcs did not affect the specific integration of self complementary AAV Rep

PAGE 12

12 positive vectors, which also display ed mo re random integration In addition cellular repair proteins ligase I and l igase IV are not needed for AAV AAVS1 junction formation, but the absence of ligase IV greatly reduced the frequency of AAV site specific integration These findings contribute to a better understanding of the AAV site specific integration process suggesting that components of the non homologous end joining pathway can modulate AAV site specific integration By s ystematically studying the different cellular repair proteins for an effect on specif ic integration future work should be able to elucidate the mechanism The outcome of such advancement s would lead to an increase d emphasis for the further development of AAV as a safe and efficient integrating vector for future gene therapy studies.

PAGE 13

13 CHAPTER 1 INTRODUCTION Gene Therapy Gene Therapy proposes the simple concept that the introducti on of specific genetic material (DNA or RNA), can compensate for or modulate the expression of the defective endogenous gene causing the disease, resulting in a therapeutic outcome. This complex field requires that researchers achieve a comprehensive unde rstanding of the genetic disorder to be treated with regards to the nature of the genetic defect, types of tissue or cells that need to be targeted for therapeutic expression, type of expression required (regulated or constitutive), and duration of express ion (short term or long term). Early research in this field has focused largely on developing delivery approaches. As of now, the emphasis has been on improving the delivery approaches to target expression to specific cells and tissues, and understanding the host immune response to gene transfer. In general, two approaches exist that aim to introduce genetic material into target cells and tissues: non viral and viral. In non viral gene therapy, genetic material (i.e. DNA or DNA liposome complexes) is i ntroduced directly into target tissues or cells. In viral mediated gene therapy, human and non human primate viruses are used to deliver genetic material. Viral gene therapy has gained popularity over non viral gene therapy because viruses possess the natu ra l ability to infect cells and tissues. Moreover, the many available viruses, allows for both DNA and RNA to be delivered. Some of the most commonly used RNA based viruses are retrovirus and lentivirus. Herpes simplex virus, adenovirus, and adeno associ ated virus (AAV) are commonly used DNA based viruses. There are two strategies for both these gene therapy approaches: 1) ex vivo where target cells are transduced outside the body and transplanted back into the body, and 2) in vivo where

PAGE 14

14 target cells are directly transduced within the body. Non viral gene transfer suffer s from very low in vivo efficacy, and has benefited greatly from the ex vivo approach for gene therapy In contrast, viral gene therapy can be effectively used in both in vivo and ex vivo strategies. Therefore, gene therapy applications have now focused largely on developing viruses for gene transfer. In 1990, scientists successfully used a retrovirus to treat a form of severe combined immunodeficiency disorder, adenosine deaminase d eficiency (ADA SCID), in a patient. An ex vivo strategy was used to target gene expression of the ADA gene in the bone marrow cells of the patient. This outcome brought great popularity to the field. However, this kind of success was not seen in several o ther gene therapy clinical trials. For example, in 1999, a patient by the name of Jesse Gelsinger, died from a gene therapy trial which was aimed at treating ornithine transcabamylase (OTC) deficiency using adenovirus as a delivery vehicle (Raper et al., 2 002). His death occurred as a result of the immune response towards the adenovirus capsid (Raper et al, 2003). It remains unknown why Gelsinger suffere d these adverse effects, because a second patient tolerated the same treatment dose. Nevertheless, this c linical outcome served as major set back to the gene therapy field. Moreover, resu lts from another clinical trial demonstrated that gene therapy was still in its infancy. Nine of the ten treated patients we re successfully treated for the fatal X linked severe combined immunodef iciency disorder (X SCID) using a retroviral vector carrying the gene encoding the gamma c chain cytokine receptor; ( Cavazzana Calvo et al., 2000) ; however, a follow up revealed that 4 of the 9 treated patients had later developed acute lymphoblastic leukemia ( Hacein Bey Abina et al., 2008).

PAGE 15

15 These examples briefly present the turbulent history for the gene therapy fi eld and highlight the challenge s faced by gene therapy researchers. In order to develop safer and therapeutic gene d elivery, researchers are now studying both non viral and viral approaches in depth to understand their limitations, their biological properties, and their interacti ons with the host immune system. Gene Therapy Using AAV Vectors The development and us e of AAV for gene therapy has been promising to the gene therapy field. AAV is unique when compared to other viruses in that it has not been shown to cause disease. Moreover, it is a naturally defective virus that requires a helper virus co infection for p roductive infection, and it can infect both non dividing and dividing cells, making it useful for both in vitro and ex vivo gene transfer strategies. AAV based viral vectors are being tested for tre atment of cystic fibrosis, h emophilia, alpha 1 antitryps in d eficiency, C s disease, muscular dystrophy, A lzheimers, and P arkinsons to name a few. According to the Jour nal of Gene Medicine, AAV is being used in 60 ongoing clinical trials, accounting for roughly 4% of all clinical trials. Some very recent phase I clinical trial success has been achieved with AAV vectors amaurosis (LCA) ( Bainbridge et al., 2008; Hauswirth et al., 2008 ; Maguire et al., 2008 ). In LCA, a defect exists in the expression of RPE65 protein, wh ich is required for production of rhodopsin. Since rhodopsin is needed for photoreceptor function in sight, patients with LCA suffer from poor vision early d uring childhood that later progress es to blindness. These LCA clinical trials provided evidence for the safety of the delivered AAV viral vector and demonstrated improved visual function in most of the patients that were treated. This outcome represents the first success in the use of AAV as a vector in a human clinical trial, and provides great promis e for the use of AAV for other diseases.

PAGE 16

16 Before the LCA trials, a phase I study was initiated to treat Hemophilia B, using AAV to deliver Factor IX into the livers of seven patients (Manno et al., 2006). Therapeutic levels was observed in several patient s given the highest doses, but these levels were short lived, dropping to baseline (< 1 % serum level of Factor IX) by 10 weeks. One patient, in particular, had an asymptomatic rise in liver transaminase levels, suggestive of liver damage, which returned t o normal levels by 9 we eks. The coincident decline of F actor IX levels and the rise of transaminase levels indicated that transduced cells were being subjected to destruction by the immune system. A subsequent study identified that this response was due to cytotoxic T cell response towards the AAV 2 transduced hepatocytes (Mingozzi et al., 2007). Taken together, these studies highlight the limited success of AAV in clinical trials, and suggest that immune response to wards AAV vector s can present major hur dles to gene transfer. As researchers achieve a deeper understanding of AAV host interactions in humans, better AAV vectors can be developed that have improved safety and efficacy profiles for treatment of many acquired and inherited diseases. Purpose and Scope o f This Research AAV may serve as a successful gene delivery vehicle. However, the advancements in understanding this virus and its development as a viral vector have fallen short in terms of success in clinical trials. A great deal remains unknown about the infection process of AAV and its persistence in different cells, tissues, and organs. There are many different types (i.e serotypes) of AAV. AAV serotype 2 (AAV 2) is the prototypical serotype which has been primarily used in vector development and in most of the clinical trials. The infection process of AAV 2 has been studied both in cell culture and in vivo AAV 2 has two phases to its life cycle: a lytic phase and a latent phase. The lytic phase is characterized by replication of the AAV genom e and the production of newly packaged AAV

PAGE 17

17 particles, in the presence of a helper virus. In the absence of a helper virus, AAV establishes latency. In cell culture, th is latent phase is characterized by th e integration of the AAV genome into a specific chr omosomal site, termed AAVS1. A great deal is known about the role of the helper virus and cellular elements during lytic infection, however, information is lacking about which cellular proteins are involved in AAV latent infection. The purpose of my re sear ch was to understand more about the latent infection process of AAV with regards to the specificity of integration and the cellular requirements. The AAV replication protein (Rep) has been shown to be necessary for targeting latency site specifically. Ver y little is known with regard to the cellular requirements. Many researchers have attempted to identify Rep interacting cellular proteins in hopes of identifying those cellular factors. Recently, Nash et al. identified 188 Rep interaction proteins, and cla ssified them into many categories based on their role in DNA replication, repair, transcription, and splicing to name a few (Nash et al., 2009 ). AAV may be using the cellular DNA repair machinery to help it integrate, but the lack of available methodologie s to study integration has hindered the identification of the precise proteins. It is anticipated that my work could serve as a framework from which future researchers can then start identifying those cellular factors. Moreover, it should provide an empha sis for the development of AAV as novel, site specifically integrating vector for gene therapy applications requiring long term expression of a therapeutic gene. Outline of Chapters Chapter two Literature Review, will describe what is known about the bi ology of AAV. The first part covers important information about the AAV virus, its genome, and its biphasic life cycle of expression and latency. The second part of the chapter briefly covers how recombinant AAV vectors are created and packaged into AAV pa rticles. Moreover, advancements in AAV vector development are described which should improve the utility of AAV vectors. This chapter

PAGE 18

18 ends with a short section on the fate of recombinant AAV vectors in transduc ed t issues and cells. Chapter three Research Objectives, provides a brief background about AAV site specific integration to provide a foundation for understanding the det ails of the research. Chapters four and five cover the first and second aims of my project, respectively. The first specific aim d escribes the studies that were done to determine the specificity of AAV site specific integration, looking at the distribution of AAV integration in the presence of the AAV replication protein (Rep), to determine if Rep can minimize random integration even ts. The second specific aim, describes the studies that were aimed at determining if cellular repair proteins can modulate AAV site specific integration. Specifically, the role of a non homologous repair protein, DNA dependent protein kinase catalytic sub unit (DNAPKcs) was investigated in some detail. This protein functions as a crucial element in the cellular repair of DNA via the non homologous end joining pathway.

PAGE 19

19 CHAPTER 2 LITERATURE REVIEW Biological Properties o f AAV AAV Structure a nd Genome Adeno associated virus is a small, non enveloped, icosahedral virus (25 nm), which was discovered among adenovirus preparations ( Melnick et al., 1965; Atchison et al., 1965; Hoggan et al., 1966). It belongs to the Parvoviridae family and the genus Dependovirus because it requi res a helper virus for productive infection (Hoggan et al., 1968). AAV package s a single stranded DNA genome, and e qual numbers of both positive and negative sense strands are packaged in separate virions with equivalent efficiency (Rose e t al., 1969; Mayor et al., 1969) Thirteen serotypes of AAV (AAV serotype 1 [AAV 1] to AAV 13) have been discovered to date. The prototypical AAV serotype, AAV 2, is the best studied. The structure of AAV 2 has been solved by X ray crystallography (Xie e t al., 2002). Major constituents of the AAV 2 capsid which are arrang ed are connected by loops of variab le lengths, which are exposed on the capsid surface. Interestingly, these loops are not well conse rved among the AAV serotypes and the other parvoviruses account ing for the unique capsid structure and function observed for the different serotypes The prominent features of the AAV capsid surface include a three fold spike a two fold depression and a five fold pore. In addition over 100 AAV variants have been isolated from both primate and human tissues, which have been arranged into different clades (Gao et al., 2004), based on their capsid homology to the other AAV types. A comparison of the caps id homology among AAV serotypes 1 through 13 is shown in Table 2 1. AAV serotypes 1 through 9 have been studied in some detail (Zincarelli et al., 2008) and have clinical applications for humans Interestingly,

PAGE 20

20 AAV serotypes 1 and 6 share significant cap sid homology, as do AAV sero types 3 and 13. Surprisingly, Wu et al found that a single am ino acid difference at residue 531 between AAV 1 and 6 differentially affected heparin binding and live r transduction profiles of these very similar serotypes (Wu et al., 2006). This suggests that functional differences with respect to receptor usage and infection properties of AAV serotypes can be mapped to a single residue or several critical residues, despit e high capsid sequence homology. In addition, it implies th at all these AAV seroty pes can be modified for specific gene therapy applications conditional upon developing a better understanding of the structure function and host interactions of these serotypes Table 2 1. Percent c apsid homology among AAV serotype s 1 through 13 AAV 1 AAV 2 AAV 3 AAV 4 AAV 5 AAV 6 AAV 7 AAV 8 AAV 9 AAV 10 AAV 11 AAV 12 AAV 13 AAV1 100 AAV2 83 100 AAV3 86 87 100 AAV4 63 60 62 100 AAV5 58 57 58 53 100 AAV6 99 83 87 63 58 100 AAV7 85 82 85 63 58 85 100 AAV8 84 83 86 63 58 84 88 100 AAV9 82 82 83 62 57 82 82 85 100 AAV10 85 84 85 63 57 85 88 93 86 100 AAV11 66 63 63 81 53 66 67 65 63 66 100 AAV12 60 60 60 78 52 60 62 62 60 61 84 100 A AV13 87 88 94 65 58 87 85 85 84 86 65 60 100 AAV 2 pa ckages a 4.7 kb genome (Figure 2 1), comprised of t wo genes, rep and c ap, flanked by inverted terminal repeats (ITRs) of 145 nucleotides (Srivastava et al., 1983) The terminal 125 nucleotides of each ITR form a palindrome which folds upon itself via base pairing to create a T shaped hairpin structure. The ITRs are important cis sequences in the biology of AAV, being required for DNA replication, packaging of the AAV genome, transcription, and site spec ific integration. The other 20 nucleotides of each ITR, called the D sequence, although

PAGE 21

21 not part of the hairpi n structure, are also necessary for the replication and packaging of the AAV genome (Wang et al. 1997). Figure 2 1.The genetic m ap of AAV. The AAV genome consists of the rep and cap open reading frames (ORF) flanked by the inverted terminal repeats (ITRs). The six mRNA transcripts are shown bel ow the AAV genome map. The larger rep proteins (Rep78/68) are expressed using the P5 promoter. The small er rep proteins (Rep52/40) use the p19 promoter. The capsid proteins (VP1, VP2, and VP3) are expressed using the P40 promoter. They are produced using alternat iv ely spliced mRNAs. One capsid transcript produces the capsid VP1 subunit. The other transcript produces both VP2 and VP3 subunits : VP2 is translated using a non conventional ACG start codon whereas, VP3 is translated usin g the downstream conventional AU G codon (shown as a star). Four Rep proteins are encoded by the rep gene: Rep 78, 68, 52, and 40. The larger Rep proteins, Rep 78 and its spliced variant Rep 68, are expressed from the P5 promoter. The smaller Rep proteins, Rep 52 and its spliced variant Rep 40, are expressed from the P19 promoter. All four Rep proteins possess ATPase/helicase and DNA binding activity. In addition, Rep78/68 proteins possess strand/sequence specific endonuclease nickase activity. The Rep proteins are involved in all aspects of AAV biology.

PAGE 22

22 The c ap gene encodes three viral proteins, VP1 (87 kDa), VP2 (73 kDa), and VP3 (67 kDa). These particles differ in their N terminus and share most of the C terminal sequences. They come together during viral assembly forming a sixty subunit viral particle at a ratio of 1:1:10 (VP1:VP2:VP3). The viral protein subunits are expressed fr om the cap gene, using the P40 promoter. Both alternative splicing and alternative start codon usage are involved in translation of the subunits: the VP2 and VP3 proteins are expressed from the same mRNA, a spliced transcript of VP1; VP3 is translated usin g a conventional start AUG codon, downstr eam from the non conventional AC G codon used for VP2. AAV Infection AAV infection is a multi step process that includes binding to the cell, endocytosis into cellular vesicles, cytoplasmic trafficking, nuclear ent ry, viral genome unco ating, and genome conversion for transcription Binding to cellular receptors In order to gain entry into target cells, AAV needs to attach to certain cellular receptors and co receptors. Heparin sulfate proteoglycan has been identif ied as the primary receptor used by AAV 2 for cell attachment (Summerford et al., 1998 ). The abundance of heparin sulfate proteoglycan (HSPG) on cellular membranes has accounted for the broad transduction efficiency of AAV 2 observed in vivo and in cell cu lture. A positively charged loop region in the AAV 2 capsid, comprised of residues 585 590 (Opie et al., 2003), has been shown to be necessary for capsid binding to HSPG. For efficient cellular entry, AAV 2 also needs to i nteract with a co receptor. It ma y use one or several of many identified co rin (Summerford et al, 1999), f ibroblast growth factor receptor 1 (Qing et al., 1999), hepatocyte ), and the 37/67 kDa laminin receptor (Akache et al., 2006) for cellular entry.

PAGE 23

23 Receptors and co receptors have been identified for other AAV serotypes as well. To date, 13 serotypes have been identified; however the receptor and co receptor usage has bee n identified for only a subset of them. Many of the AAV serotypes may use the same receptor, but differences in their co receptor usage may account for differences seen in their tissue tropisms. The receptors and/or co receptors have been identified for m any of the other AAV serotypes and are summarized in Table 2 2. Table 2 2. List of AAV serotypes and their identified receptor and co receptor(s) used for cell entry. Serotype Receptor Co receptor References AAV 1 N linked sialic acid Laminin receptor [C hen et al., 2005], [Akache et al., 2006], [Z hijian et al., 2006]. AAV 2 HSPG fibroblast growth factor receptor 1, hepatocyte growth factor receptor, laminin receptor In text AAV 3 HSPG Laminin receptor [Akache et al., 2006], [Handa et al., 2000] AAV 4 O linked 2, 3 sialic acid Unknown [K aludov et al., 2001] AAV 5 N linked sialic acid Platelet derived growth factor receptor [Kaludov et al., 2001], [Pasquale et al., 2003] AAV 6 N linked sialic acid Unknown [Z hijian et al., 2006] AAV 8 Laminin receptor Unknown [Akache et al., 2006] AAV 9 Laminin receptor Unknown [Akache et al., 2006] Internalization and trafficking The cascade of cellular events that mediates AAV trafficking is not completely known. After binding, AAV is endocytosed into clathrin coated vesicles, which is regulated by dynamin ; d ominant negative interference of d ynamin abolished AAV transduction, suggesting that AAV enter s target cells primarily via clathrin mediated endocytosis (Duan et al. 1999). Using fluorescently tagged AAV to monitor the internalization and traffic king of AAV in real time,

PAGE 24

24 Seisenberger et al. identified that AAV endocytosis is remarkable fast, with each clathrin vesicle containing a single AAV parti cle (Seisenberger et al., 2001). AAV has also been observed in non coated pits, possibly representing a minor form of cellular entry (Bantel Schaal et al., 2002). The internalized AAV particles are transported through the cell or are degraded within the endosome lysosome compartments. The clathrin on the internalized vesicle is removed to allow vesicle f usion, forming a larger compartment called the endosome. The early endosomes go through gradual acidification maturing into late endosomes, which can ultimately fuse with lysosomes, where degradation of the cargo occurs. AAV infection of cells in the prese nce of the drug bafilomycin A1, an inhibitor of endosome acidification, decreased AAV expression, suggesting that the low pH in endosomes has some role in AAV escape for nuclear entry (Bartl ett et al., 2000). The acidification of the vesicles may function to partially disassemble or trigg er a conformational change in the AAV 2 capsid while keeping it i ntact, allowing externalization of VP1 phosphoplipase (PLA 2 ) motif which has been shown to be essential for successful infection (Girod et al., 2002). Mutatio nal analysis has revealed that the PLA 2 motif is presented via the 5 fold pore of the AAV capsid during infection (Bleker et al., 2005). Moreover, cathepsin B and L, proteases that reside in the endosomes, can cleave AAV capsids, promoting capsid degradati on and possibly also having a role in exposing the PLA 2 motif (Akache et al., 2007). Studies using the drugs brefeldin A (inhibitor of early to late endosome transition) and MG 132 (proteasome inhibitor) in AAV infection experiments suggest that AAV traffi cking to late endosomes is important for infection, and that proteasome mediated degradation of escaped AAV particles is an obstacle to nuclear entry (Douar e al., 2001). The process of AAV intracellular trafficking seems to be highly regulated by signali ng pathways which are activated upon endocytosis. Inhibiting Notch 1 expression by siRNAs,

PAGE 25

25 prevented AAV internalization in HEK293 cells, whereas, its over expression increased internalization and perinuclear accumulation of AAV (Ren et al., 2007). Moreove r, AAV 2 binding Rac1 protein and the PI3K pathway; inhibition of Rac1 using a dominant negative form decreased PI3K activation and AAV trafficking, supporting a role for Ra c1 sig naling in AAV infection (Sanliog lu S., Benson, P.K., Yang, J., et al., 2000). The same group reported that inhibition of microtubule and microfilament networks using drugs nocodazole and cytochalasin B, respectively, reduced AAV expression by 90 per cent (Sang lioglu, S., Benson, P.K., Yang, J., et al., 2000). The role of microtubules in shuttling AAV has been a bit confounding. In another study, low concentrations of nocadazole treatment had no effect on AAV expression, but at higher levels, it redu ced AAV expression at the expense of toxicity to the cells, suggesting that an intact microtubule network may not be required for successful AAV trafficking (Hirosue et al., 2007). Nuclear entry Once AAV escapes the endosomes, it can enter the nucleus for uncoating and expression. AAV is theoretically small enough (25 nm) to enter through the nuclear pore complex (NPC), yet it remains unclear if it uses the NPC to gain nuclear entry. It has been shown that AAV entry may be partially NPC independent (Hansen et al., 2001; Xiao et al., 2002). In a study by Bartlett et al., C y3 labeled AAV can be seen at the nuclear periphery by 30 minutes and within the nucleus after 2 hours, suggesting that nuclear entry is a slow step in infection (Bartlett et al., 2000). I n another study, coinfection of adenovirus capsids facilitated the nuclear entry of GFP tagged AAV (Lux et al., 2005), supporting previous studies of nuclear entry being rate limiting. D ata from a recent study indicated that mobilization of the AAV parti cles in the nucleus greatly affect s expression; specifically, AAV capsids are sequestered in the nucleol us, and its

PAGE 26

26 movement towards the nucleoplasm, allows uncoating and gene expression to tak e place (Johnson et al., 2009 ). This study indicates that seque stration of AAV capsids in the nucleus upon nuclear entry is an obstacle for expression. Using an in vivo footprinting strategy, Wang et al. (2007) demonstrated that rAAV genomes from AAV 2 and AAV 8 capsids formed similar levels of double stranded DNA up on infection, with the onset of expression being quicker using AAV 8. They concluded that the instability of rAAV genomes caused by degradation accounts for the inefficiency of rAAV expression and that kinetics of uncoating may have a role in stabilizin g r AAV genomes (Wang et al., 2007). Regardless of which process is rate limiting, nuclear entry or the DNA uncoating, the single stranded DNA needs to be converted into double stranded DNA in the nucleus, a process which is inefficient (Ferrari et al., 1996) in the absence of helper virus AAV Genome Replication and Expression Upon successful nuclear entry and uncoating, AAV expression can take place under two situations, either in the presence or absence of helper virus. Presence of helper virus In the p resence of adenovirus (Ad) or herpes virus AAV undergoes productive infection characterized by efficient DNA replication, expression, and assembly (Buller et al., 1981). E1a, E1b, E2a, E4, and VA (viral associated) RNA has been identified to be t he necess ary adenovirus helper genes, and seem to primarily function at the gene regulation level to aid AA V expression (Janik et al., 1981 ). For example, the AAV P5 and P19 promoters are transactivated in the presence of Ad E1a ex pression. In its absence, the expr ession of the AAV genes is negatively regulated in trans by Rep (K y sti et al, 1995 ; Lackner et al., 2002 ). Adenovirus helper genes can also enhance replication of AAV DNA, whic h occurs in discrete foci in the nucleus. Cervelli et al. demonstrated that AA V interacts with the cellular MRN (Mre11 Rad50 NBS1) complex at

PAGE 27

27 these foci which inhibits AAV re plication (Cervelli et al., 2008 ). This inhibition can be relieved by adenoviral E1b55k/E4orf6 expression (Schwartz et al., 2007). The other adenoviral genes (E 2a and VA RNA) may function to increase or stabilize AAV mRNA levels for translation. Herpes virus genes primarily regulate AAV replication. For example, h erpesvirus helicase complex proteins (UL5/8/52) and single stranded DNA binding protein (UL29) have been shown to enhance AAV replication (Mishra et al., 1990; Weindler et al. 1991; and Ward et al., 2001). In addition, HSV1 ICP0 protein, although not necessary as a helper function, enhances the expression of the AAV Rep gene by regulating the Rep p romot e r (Geoffrey et al., 2004). Despite the differences in helper function between adenovirus and herpesvirus, both seem to provide a permissive cellular environment for a productive AAV infection AAV replication is an essential first step for productive inf ection, which occurs in the presence of helper vi rus genes. The ITR serves to provide polymerase synthesizes a second strand to form a linear double stranded DNA, called a replicating form monomer (RfM). A second r ound o f self priming synthesis is initiated using the RfM, forming a linear double stranded dimer DNA now called a replicating form dimer (RfD). These double stranded intermediates are then processed via a strand displacement mechanism, resulting in single stra nded DNA forms, which are used for packaging, and double stranded DNA forms, which are used for transcription and the next round of replication Critical for resolution of the double strand intermediates (RfM and RfD) are cis sequences in th e ITR which in clude (TRS) (Snyder et al., 1993) (Figure 2 2) The larger rep proteins, Rep68/78, form a hexamer on the ITR hairpin (Li et al., 2003), an d through interaction with the RBE elements is fu nctionally

PAGE 28

28 situated to initiate efficient nicking of the TRS be tween the two thymidine bases a process called terminal resolution (Brister et al., 2000). This allows for re initiation of replication allowing Figure 2 2. Elements in the AAV ITR required for replication. The Rep binding element (RBE) resoluti on site (TRS) sequence is GTTGG; n icking occurs between the thymine bases strand displacement. The Rep78/68 proteins necessary f or AAV replication possess ITR binding activity, helicase activity, ATPase activity, and site/strand specific endonuclease activity at the terminal resolution site (TRS) (Chiorini et al., 1994). The smaller Rep proteins, Rep 52 and Rep 40, are important fo r the accumulation of the single stranded AAV genome generated during strand displacement to be used for packaging (Chejanovsky et al., 1989 ). Using nuclear extracts from A d infected cells and an in vitro AAV replication assay, Nash et al. identified repli cating factor c, proliferating cell nuclear antigen, DNA polymerase delta, and the minichromosome complex proteins as necessary cellular factors for AAV replication (Nash et al., 2007; Nash et al., 2008). In addition, AAV replication can be enhanced in th e prese nce of high mobility group 1 which enhances nicking activity (Costello et al., 1997) During pro ductive infection replicated AAV DNA is packaged into newly assembled AAV capsids. The precise mechanism of AAV assembly is not know n. However, some basic discoveries have provided insight into the AAV assembly process. Several groups have

PAGE 29

29 described the interaction of the Rep78/68 proteins with the capsid suggesting that they are involved in a complex that brings the DNA near empty cap sids for packaging (Prasad et al., 1995; Wistuba et al., 1995). The residues important for this interaction are present in all four Rep proteins (Dubielzig et al., 1999). Further studies have identified that Rep 52 and 40 can actively translocate the sing fashion (King et al., 2001). Mutational alteration of the AAV capsid five fold pore affected both packaging and Rep DNA interac tion, providing evidence for a role for the five fold pore as the site of DNA insertion into preformed capsids (Bleker et al., 2006) Grieger et al. identified two basic capsid regions, BR1 (residues 166 172) and BR2 (residues 307 312), as being essential for virus assembly (Grieger et al., 2006). These regions are well conserved among t he AAV serotypes, supporting their significance in the AAV assembly mechanism. Absence of helper virus The process of AAV expression is remarkably different in the absence of helper virus. First of all, the ex pression of Rep is ne g atively autoregulated B oth Rep expression and the presence of the P5 RBE are ne cessary to transactivate the P40 promoter which drives expression of cap, thereby, regulating capsid expression as well. The presence of adenovirus g ene expression relieves thi s repression allowing both rep and cap genes to be expressed Moreover, a cellular transcriptional protein, PC4, has been identified as a rep binding partner. Rep can bind both the transcriptionally active (non phosphorylated form) and inactive forms (pho sphorylated form) of PC4; and in the absence of helper virus genes, PC4 represses transcript ion from all four AAV promoters (Weger et al., 1999). Other cellular factors have also been identified to have a role in AAV transduction and expression. FKBP52, a nuclear protein, was found to bind the D sequence in the AAV ITR (Ashktorab et al., 1989; Qing et al., 2001). The phophorylation state of this protein modulates

PAGE 30

30 the binding to the AAV DNA which can prevent AAV double strand DNA (dsDNA) formation (Qing e t al., 2001). Inhibition of epidermal growth factor receptor protein tyrosine kinase (EGFR PTK) and over expression of T cell protein tyrosine phosphatase (TCPTP) augmented AAV expression by reducing the binding of FKBP52 (Mah et al., 1998 ; Qing et al., 2003). Moreover, protein phosphatase 5 (PP5) can phosphorylate FKBP52 at serine and threonine residues, also regulating the binding state of FKBP52 (Zhao et al., 2006). Taken together, these results indicate that in the absence of helper virus genes, the A AV genome is acted on by cellular proteins that inhibit AAV second strand synthesis and expression. Several groups have provided evidence that second strand synthesis is the primary means for dsDN A formation of rAAV genomes for expression (Zhong et al., 20 08; Zhou et al., 2008). A recent study showed that EGFR PTK can also phosphorylate the AAV 2 capsids, marking them for ubiquitin mediated degradation via the proteasome pathway. This effectively reduces the number of AAV particles that make it into the n ucleus for uncoating and express ion (Zhong et al., 2007). Moreover, the same group reasoned that mutating the tyrosine residues on the AAV capsid surface can reduce proteasomal mediated degradation of AAV capsids thus augment ing AAV nuclear entry for exp ression. Using site directed mutagenesis, th ey were able to create novel AAV tyrosine mutant AAV vectors that showed greater transduction properties both in vitro ( in HeLa cells) and in vivo ( in murine hepatocytes) at a log lower dose, compared to wild typ e AA V capsid vectors (Zhong, L., Li, B., et al. 2008). Recombinant AAV Vectors for Gene Therapy Viruses are pathogens that can cause disease in humans. They have an innate ability to infect human cells and tissues. The use of these viruses as vectors to deli ver therapeutic genes

PAGE 31

31 without the pathogenicity. This is done by removing the viral genes that cause disease, and re taining only those elements required for expression and packaging. General Description of AAV Vectors AAV was first used as a vector in 1984 to transduce cultured cells (Hermonat et al., 1984) Since then, it has achiev ed considerable popularity as a vector because it has not been associate d with disease and is a naturally defective virus. The most common AAV virus used fo r vector development is AAV 2. Recombinant AAV (rAAV) vectors are created by removing the rep and cap genes. The ITRs are maintained since they are required for packaging. rAAV vectors are promising, because they display long term expression in human tissues, where cells are largely post readily integrate into the human genome, like retroviruses, or wild type AA V ( Rep positive). The limitation of rAAV vectors development is the small packaging capacity (4.7 kb) for transgene insertion. AAV based vectors display persistent expression in post mitotic tissues, have no or low immunogenicity, the di fferent AAV seroty pes allow for tissue specific targeting and AAV can infect both dividing and non dividing cells. Production and Purification of AAV Vectors The popularity of rAAV vectors have prompted the demand for increased characterization of production and purificati on approaches. The broad use of rAAV vectors for gene transfer has been hampered by production and purification obstacles that affect its purity and titer. These include, (i) concerns over the dependence on adenovirus for production, and the contamination of final rAAV stocks with infectious adenovirus, (ii) reliance on density gradients for purification which makes large scale purification difficult and (iii) lack of standardized tit ering approaches to determine potency of purified rAAV vectors.

PAGE 32

32 Product ion of AAV v ectors Approaches for vector production that have b een studied include, (i) using st able producer cells expressing rep and c ap genes which requires only the input of the rAAV plasmid and Ad infection for production (Tamayose et al., 1996), and (ii) a transfection approach that removes the requirement for adenovirus infection (Salvetti et al. 1998; Xiao et al., 1998). Some interesting observations have imp roved rAAV production and yield. First of all, the discovery of the Ad genes (E2a, E4, VA I RNA, E1a, E1b) required for AAV replication, allowed the removal of the adenovirus infection from the production process. These essential genes could be incorporated into a plasmid and when used in rAAV production, it improved rAAV yield and the final rAAV stocks were free of infectious adenovirus (Xiao et al., 1998). Moreover, transfecting a 1:1:1 molar ratio of the three plasmids (rAAV plasmid containing the ITRs Ad mini gene plasmid, and AAV helper plasmid containing the rep and c ap genes) provided an o ptimal yield of encapsidated rAAV vectors (Xiao et al., 1998). The second observation was that downregulation of Rep78/68 expression from the AAV helper plasmid increased rAAV yield 10 fold (Li et al., 1997), by improving rAAV DNA replication and expressi on of the cap gene. Last of all, the development of a two plasmid system consisting of the rAAV vector and the Ad AAV plasmid, simplified the transfection process and increased efficiency of rAAV production. For example, Grimm et al. described a two plasmi d system where they constructed different versions of the Ad AAV plasmid, pDG, allowing for cross packaging o f AAV 2 genome into capsids of different serotype s To allow identification of the serotype specific capsid, they incorporated different fluorescen t markers into the plasmids for visual identification (Grimm et al., 2003). Other production methods are being developed that aim to produce higher rAAV virus yields required for clinical applications. These include the use of producer cells that only need helper virus infection (i.e herpesvirus) and the production of r AAV in baculovirus (insect) cells

PAGE 33

33 ( Sollerbrant et al., 2001; Booth et al., 2004; Merten et al., 2005). These methods reduce or eliminate the requirement for transfection and can be scaled u p for clinical production levels, thus improving the production yield of packaged rAAV vectors. P urification of AAV v ectors Currently, on laboratory scale r AAV is packaged in HEK 293 cells using the triple or double transfection approach es described abov e. The cells are typically harvested at 48 72 hours post transfection allowing for maximum rAAV virus production Recombinant virus is retained within the cells, therefore, physical methods are needed to lyse the cells and remove the produced rAAV virus. T his is done by lysing the cells in phosphate buffered saline using three cycles of freeze (15 minute on dry ice) and thaws (15 minutes at 37 C ). The freeze tha w cycle s efficiently release most of the packaged recombinant virus from the cells into the sup ernatant. The cellular debris is removed by centrifugation, and the rAAV containing supernatant is treated for further purification. Specifically, benzonase is used to diges t cellular and non encapsidated DNA and/or detergents are used to prevent cellular protein aggregation to viral particles. Next the recombinant virus in the treated supernatant is purified using cesium chloride gradients, iodixanol centrifugation, and affinity column, or ion exchange column chromatography The t raditional method of r AA V purification involved using multiple rounds of cesium chloride centrifugation. Problems with cesium chloride purification include its toxicity, its inability to remove excess cellular contaminants, difficulty in scaling up the purification process for hu man application, and the high ratio of purified non functional to functional rAAV virus in final stocks The main advantage of cesium chloride purification is it allows for separation of empty capsid s from rAAV packaged capsids. More recent purification a pproaches have been developed such as iodixanol gradient centrifugation, ion exchange columns, and affinity columns. Iodixanol based gradients have been

PAGE 34

34 developed because iodixanol is non toxic and the gradient allows the separation of cellular contaminant s from rAAV particles. For purifying r AAV 2, the virus is pulled from the iodixanol gradient and loaded onto a heparin c olumn. By combining gradient and column purification over 50% of the viruses from the supernatant can be recovered and are over 99% pur e The heparin column can also been used to purify rAAV 3 vectors. AAV 4 and AAV 5 can be purified used mucin columns, based on the affinity of these serotypes for sialic acid. Ion exchange chromatography approaches for AAV purification has been the mos t promising with regards to purity and scalability. All the AAV serotypes can potentially be purified using ion exchange, however, the salt and pH condition s need to be optimized for each serotype, since each one possesses unique capsid surface charges Un der the right conditions the AAV particles can efficiently bind to the column matrix and the weakly interacting contaminants can be washed away. The bound virus can then be eluted off these columns using a salt gradient. The fractions containing most of th e virus are pooled and concentrated. Ion exchange chromatography has been used to purify AAV serotype 2, 4, 5 and 8. Compared to conventional cesium chloride purification and affinity columns ion exchange columns allows maximum recovery of recombinant v irus from supernatants res ults in highly pure rAAV stocks, and it can be easily scaled up for human application. A small aliquot of the purified, concentrated rAAV virus is used to quantitate the amount of virus recovered. The ph ysical amount of virus ( v iral particles per milliliter ) can be determined for AAV 2 only, using a commercially available A2 0 antibody based enzyme linked immunosorbent assay (ELISA). The number of rAAV genome containing particle s per milliliter is determined using PCR or dot blot hybridization using the encapsidated rAAV DNA. The last ti tering method involves determining the number of transducing viral particles per milliliter the

PAGE 35

35 proportion of viral particles that can infect and exp ress in cells. Among these tit ering approaches the last one is the ideal b ecause it determines the amount of fu nctional virus per milliliter of purified rAAV stock. New AAV Vectors Self c omplementary AAV v ectors Self complementary AAV (scAAV) vectors have been developed to bypass the limiting aspe ct of second strand synthesis (McCarty et al., 2001) previously described Generation of rAAV vectors depends on replication and resolution of the replicated forms ( RfM and RfD). Failure to resolve these replicated forms, leads to accumulation of the dim er form (RfD) of the AAV DNA. Therefore, by deleting the terminal resolution site of one ITR, Rep cannot fully resolve the RfD, resulting in greater packaging efficiency of dimeric genomes (McCarty et al., 2003), called self complementary vectors. Upon transduction and uncoating, scAAV vectors can fold upon themselves, immediately forming transcriptionally competent double stranded DNA. These vectors increase the onset of expression by bypassing the need for dsDNA formation. One consequence is that the vector cap acity is reduced but up to 3.3 kb p of DNA can be encapsidated (Wu et al., 2007), limiting the capacity for insertion of regulatory elements in the vector Rapid expression has been observed in many tissues in vivo and in cell cultures. Productio n and purification approaches for scAAV vectors are the same as they are for rAAV vectors. However, the yield of scAAV production can be greatly affected by the expression of Rep : excess production of Rep78/68 reduces the percentage of total particles cont aining scAAV genomes, presumably due to packaging of single stranded DNA (ssDNA) genomes generated by spurious resolution of dimeric genomes into monomeric forms

PAGE 36

36 Self complementary AAV vectors (scAAV) are not recognized within the transduced cells the sa me way as single stranded AAV vectors (ssAAV) by host proteins. But, similar to ssAAV vectors, scAAV vectors can also form episomes. Using different DNA repair deficient cells lines, Ch oi et al. demonstrated that RecQ helicase family membe rs (BLM and WRN), Mre11, NBS1, and ATM are required for scAAV cir cularization. In vivo DNAPK cs and ATM were required for scAAV circularization; however, NBS1 was dispensable (Choi et al., 2006) Moreover, intermolecular recombination between two scAAV vectors occurs at bo th ends with different efficiencies (Choi et al., 2005). It will be important to further characterize the molecular organization of scAAV vectors and their persistence in transduced tissue, to gain a better understanding of how scAAV vectors can be devel oped further for gene therapy applications. M any clinically relevant tissues remain refractory to transduction and expression by AAV 2, even when using scAAV vectors. Some of these tissues have been efficiently transduced using the other available AAV ser otypes. Skeletal slow and fast muscle fibers are transduced efficiently with AAV 2 vectors packaged into AAV 7 (AAV 2/7) and AAV 8 capsids (AAV 2/8) ( Louboutin et al., 2005). Moreover, muscle tissues can also be efficiently transduced with AAV serotype 1, 6, 7, 8, and 9 (Gao et al., 2002; Chao et al., 2000; Blankinship et al., 2004; Wang et al., 2005; and Pacak et al., 2006). Greater g ene expression has been observed in neurons of murine brain using AAV 1, which can also transduce glial and ependymal cells unlike AAV 2 (Wang et al., 2003). AAV 5 has preference for retina (Rabinowitz et al., 2002) and joint cartilage (Apparailly et al., 2005). Compared to AAV serotype 2, AAV vectors based on serotype 8 and 9, display superior transduction in liver (Davidoff et al., 2004; Gao et al., 2002; Nakai et al., 2005;

PAGE 37

37 Inagaki et al., 2006). Hematopoi etic cells, which are refractory to AAV 2 infection, can be efficiently transduced with vectors based on AAV 3 (Handa et al., 2000) The use of the different AAV serotyp es in a pseudotyping approach (the genome of one serotype packaged into a different serotype capsid) to increase the transduction of AAV in different tissues, coupled with use of self complementary AAV vectors (scAAV) has greatly improved expression in ma ny human tissues. Trans splicing v ectors An additional novel AAV vector system has been developed, that takes advantage of the ability of AAV to form multimers, to increase the genome capacity of AAV (Yan et al. 20 00). This system relies on A s abilit y to form head to tail concatemers via ITR recombination. In this approach, the transgene cassette is split between two rAA V vectors containing adequately placed splice donor and acceptor sites. Transcription from recombined r AAV genomes, followed by the c orrect splicing of the mRNA transcript, will result in the expression of a functional gene prod uct. This application is useful for delivering genes up to 9 kb in size. Trans splicing has been successfully used in the retina (Reich et al., 2003) lung (Liu et al., 2005) and muscle (Ghosh et al., 2006 ; Ghosh et al., 2008 ). In terms of efficiency of expression, only a small percentage of input vectors recombine, therefore, trans splicing vectors are less efficient than rAAV vectors. These vectors have been ve ry useful for expressing CFTR transgene (7.2kb), Dystrophin (6kb), and Factor IX cassettes (7kb). T he efficiency of trans splicing vector expression can be increased by using vectors con taining ITRs of different serotypes at each end, respectively These v ectors are less likely to circularize and more likely to form linear concatemers, promoting efficient vector dimerization for expression (Yan et al 2005).

PAGE 38

38 Fate of Recombinant AAV Vectors An early study of rAAV vectors in vivo had concluded that rAAV exi st primarily as e pisomes which could be rescued upon Ad super infection (Afione et al., 1996) It is believed that rAAV random integration occurs at a remarkably low frequency (10^ 7 ). One study failed to find integrated form s of AAV in tran s duc ed muscle tissues ( Schnepp et al., 2003) In addition, skeletal muscle transduction with rAAV vectors resulted in stable expression detected at 2 weeks post injection, which came from rAAV genomes that were in the form of high molecular weight concatemers (Vincent Lacaze et al., 1999). Further studies to characterize the molecular forms of the rAAV in transduced muscle, identified that they were arranged into large (>12 kbp in size) circular head to tail multimers, which were initially monomers that slowly converte d to larger forms via ITR recombination over time (Duan et al., 1998). This circularization of rAAV genomes was shown to be regulated by DNAPKcs in vivo : in the absence of DNAPKcs more linear rAAV genomes were present in muscle tissue c ompared to controls (Duan et al., 2003). Concatemer formation of rAAV genomes may occur via either DNA replication or through intermolecular recombination. The analysis of the episomal structures in the above studies provided strong evidence for the latter mechanism. Often during inter or intra molecular recombination, deletions occur in the ITRs, with the head to tail form predominating, although head to head and tail to tail forms of rAAV recombination have been observed (Yang et al., 1999). In another study, analyses of in jected double stranded circular and linear rAAV genomes containing or missing ITRs from mouse liver s demonstrated that circular genomes are not processed into larger concatemers (Nakai et al., 2003). The fate of rAAV genomes and their concatemers as pre i ntegration intermediates has not b een fully characterized. U sing an AA V 2 based shuttle vector to isolate rAAV cellular sequences in vivo, Inagaki et al. identified that rAAV vectors were able to integrate into the

PAGE 39

39 human genome in post mitotic tissues; and using partial hepatectomy, they estimated that around 0.2 rAAV genomes had integrated per diploid genome in liver s of neonatal mice (Inagakai et al., 2008). A nalysis of integration in post mitotic mice tissues such as skeletal muscle and heart after rAAV gene transfer revealed that palindromic regions in the human genomes are preferential targets for rAAV integration (Inagaki ,K., Lewis, S.M., et al., 2007). T ogether these studies suggest that rAAV genomes like wild type AAV, persist large ly as episomes i n post mitotic human tissues. rAAV and wild type AAV genomes are still capable of random integration in vivo of which the frequency is not known but presumed to be very low

PAGE 40

40 CHAPTER 3 RESEARCH OBJECTIVES Background AAV Site Specific Integration The observ ation that AAV has the ability to establish latency by integrating its genome into the host DNA is of central importance for gen e therapy treatments requiring stable, long term, and safe expression. A better understanding of the mechanism and efficiency of site specifi c integration, and host factors requirements is needed to create novel AAV site specifically integrating recombinant vectors for gene therapy applications. Early experiments in characterizing AAV latency were performed by Berns et al. who reported that Detroit 6 cells infected with 250 infectious units of wild type AAV 2 virus maintained AAV sequences after 50 passages. Moreover, they demonstrated that roughly 30% of clones generated from these infected Detroit 6 cells were able to rescue A AV sequence upon subsequent adenovirus super infection (Berns et al. 1975). The first evidence for AAV establishing latency by integration was provided by Cheung et al. who analyzed the genomic DNA from a latently infected Detroit 6 cell line and found th at wild type AAV was oriented into a head to tail configuration and associated with high molecular weight DNA via junction with the ITRs (Cheung et al., 1980). Further characterization of AAV provirus sequences identified that junctions frequently occurred at or within the terminal repeats with the flanking cellular sequence being amplified, suggesting that some DNA replication takes before or during the integration process (McLaughlin et al., 1988). Several groups later presented direct evidence that AAV establishes latency by integrating into a common site: Chromosome 19q13.4 qter (Kotin et al., 1990; Samulski et al., 1991), a site termed AAVS1. Using an EBV shuttle vector, which can be stably maintained as episomes in

PAGE 41

41 eukaryotic cells and recovered in ba cteria, containing cloned different sized AAVS1 fragments (8.2 kb, 4.4 kb, 3.5 kb, 1.6 kb, and 0.510 kb), Giraud et al. demonstrated that a 510 nucleotide EBV co ntaining AAVS1 vector and the AAV genome, with roughly 0.8 % of rescued EBV plasmids hybridizing to AAV sequences (Giraud et al., 1994). The recombination signal was narrowed down to a 33 nucleotide AAVS1 sequence consisting of a Rep binding element (RBE: GCTCGCTCGCTCGCTG), and a terminal resolution site (TRS: GGTTGG) separated by an eight nucleotide spacer sequence. Mutating the AAVS1 RBE or TRS sequences completely abolished integration (Linden et al., 199 6). The spacer sequence can be altered to some ext ent but removing or mutating a central CTC sequence reduced integration (Meneses et al., 2000) In vitro data by Weitzman et al. demonstrated that Rep68/78 can bind both AAV and AAVS1 RBE sequences in an in vitro system, suggesting a mechanism of integrati on by which Rep can bring these two sites together (Weitzman et al., 1994), a pre requisite for replication based integratio n dependent on Rep68/78 (Urcela y et al., 1995). A PCR hybridization based approach was developed and used by Surosky et al. to demon strate that only the larger Rep proteins (Rep78 and 68) can target site specific integration, which can be enhanced by the presence of the ITRs, although not necessary for integration (Surosky et al., 1997). Interestingly, Rep is flexible in its binding s pecificity. Wonderling et al. identified eighteen new Rep binding sites which are generally loc ated in or near genes, and used electrophoretic mobility shift assay to show that these new sites do bind Rep in vitro (Wonderling et al., 1997). Interestingly, an estimated 200,000 potential binding sites may exi s t in the human genome based on the identified minimum GAGYGAGC R ep binding sequence (Young et al., 2000). These data suggest that there may be alternative integration sites for AAV that may also be R ep m ediated.

PAGE 42

42 But, the AAVS1 locus is the only site that contains both a RBE and TRS, underli ning the importance of both binding and nicking by Rep in the integration process. AAVS1 and Its Characteristics The AAVS1 region is very rich in overall guanine and cytosine content (65% GC), with the first 900 bases fulfilling the criteria of a CpG island (82% GC) (Kotin et al., 1992). AAVS1 itself is a 4.7 kb part of a gene called protein phosphatase 1 regulatory subunit 12C or MBS85 (myosin binding subunit 85) thou ght to be involved in regulation of actin myosin assembly (Tan et al., 2001). A DNAse hypersensitive site (DHS S1) has been identified in the AAVS1 CpG island, suggesting that AAVS1 is open to transcription and Rep protein binding (Lamartina et al., 2000). An insulator has also been identified near the DHS S1 and shown to prevent spread of expression by the enhancer activities of the DHS S1 (Ogata et al., 2003). Several muscle specific genes including TNNT1 (slow skeletal muscle troponin T) and TNNI3 (card iac troponin I) have b een identified near AAVS1 (Duth e i l et al., 2000). Interestingly, AAV specific integration promotes partial duplication of the AAVS1 locus, nea rby muscle specific genes or that of MBS85 (Henckaerts et al. 2009 ). The AAV S1 integration site has been identified in non human primates (Amiss et al., 2003) and a mouse AAVS1 ortholog has been characterized (Duthe i l et al., 2004). The recombination signa ls (RBE, spacer, and TRS sequences) in non human primates have 98% homology to the human site, with the simian RBE sequence being extended by an additional GAGC sequence. Similar to the human site, the mouse ortholog recombination signals can be bound and nicked by Rep, whilst sharing only 74% sequence homology.

PAGE 43

43 Mechanism of Rep mediated integration Analysis of cloned AAV AAVS1 junctions suggests that non homologous recombination is taking place, since only small homologies are seen at the junctions. I n addition, deletions in the ITR suggest that significant DNA processing occurs during integration. Several AAV site specific integration models have been proposed. They all have some common events they share: 1) the AAV genome is brought in close proximit y to AAVS1 via Rep binding to the RBE in both DNA sequences, 2) t end and covalent 5 Rep DNA complex, 3) unwinding of the host duplex DNA, and the initiation of DNA replication that starts on the unwound AAVS1 DNA, and 4) t hrough several rounds of template switching the polymerase incorporates the AAV sequence into AAVS1. Concurrent with this process is the gap filling and DNA processing by other cellular factors. It has been propose d that since the integrated AAV is often arranged in a tandem arrangement, that the AAV genome is circularized before integration. Elements required for integration As stated above, the RBE and TRS sites are essential. A 138 bp P5 sequence, termed the i ntegration efficiency element (P5IEEE) has been shown to enhance integration by 10 100 fold (Philpott et al. 2002). Feng et al. tested a series of constructs containing various lengths of P5IEE and found that the 16 bp RBE was necessary and sufficient for integration and interestingly, noticed that the RBE from the ITR was more effective at integration (Feng et al. 2006). These observations are a bit confounding, as another group identified that the entire P5 sequence is necessary for integration and the I TR RBE did not mediate better integration efficiency (Murphy et al., 2007). Dyall et al. used an in vitro system to generate AAV AAVS1 junctions and found that the junction formation is highly dependent on ATP suggesting that the helicase activity of Rep i s

PAGE 44

44 important (Dyall et al. 1999). Interestingly, HMG1, a DNA binding protein, has been shown to bind Rep and enhance its endonuclease activity (Costello et al., 1997). Whether HMG1 also Isolation of AAV AAVS1 junction from clinically relevant tissues has been difficult. Interestingly, one study f ound evidence of AAV specific integration in human testis tissue, the significance of which is unclear at the moment (Mehrle et al., 2004). Num erous others studies have failed to find AAV specific integration (Schnepp et al., 2005; Schnepp et al., 2009), suggesting that the frequency of specific integration in vivo is very low. E fficiency of i ntegration It has been very difficult to estimate eff iciency of site specific integration because it is highly dependent on the virus multiplicity of infection (MOI) being used for infection, type of cells being infected, and the methods used for integration analysis. A quantitative PCR of AAV AAVS1 junction has been used to compare integration efficiency in total infected cells. Based on this approach around 10 20% of AAV infected cells have AAV integrated in the absence of selection and an estimated 0.1% of infecting viral genomes is capable of integration (Huser et al., 2002). Another approach has been to clone out indi vidual cells after infection for analysis by genomic southern hybridization. Based on this approach, integration efficiencies in the range of 20 to as great as 70%, ha s been observed This br oad range is likely due to difference in cell type used, MOI infection, and cloning efficiency. Consiste nt among many studies, maximal site specific integration is postulated to takes place somewhere between 24 to 48 hours post infection. Interestingly, the stability and expression of site specifically integrated transgene s seems to be dependent on whether R ep is provided in cis or trans In one study site specifically integrated cell lines generated using Rep in cis showed declining transgene expression and loss of transgene DNA; in contrast, cell lines generated when Rep was provided in trans maintained

PAGE 45

45 the transgene DNA and the expression throughout the experimental 18 weeks (Philpott et al., 2004). AAV is a unique mobile genetic element. It possesses site specific integration ability and the integrated genome can be rescued and replicated upon adenovirus super infection. Whether Rep mediate d integration of AAV is ready for clinical applications remains to be evaluated Two approaches for gene therapy can be envisioned: (i) in the absence of Rep how does AAV persist apart from being an episome. Is it able to integrate, where, and at what frequency? and (ii) in the presence of Rep, how does the distribution shift to site specificity?, and are there other integration sites that Rep can target? It has been shown that rAAV vectors, without Rep, do not integrate site specifically (Kearns et al., 1996; Ponnazhagan et al., 1997). Unfortunately, a lot remains to be discovered with regards to the mechanisms of si te specific integration and the host requirement that mediate integration. Research Objectives The two objectives of my thesis will serve to provide some fundamental basis for understanding more about the biology of AAV latency. Determine the Distributio n of Rep mediated AAV Integration The first research objective was to design and test an experimental approach that can be used to determine the specificity of AAV site specific integration. Specifically, the aim looked at the distribution of AAV integrat ion in the presence of the AAV replication protein (Rep), to determine if Rep can minimize random integration events or simply promote more frequent site specific integration An AAV shuttle vector was developed which would allow rescue of integrated seque nces as plasmids in bac teria. In addition, a genome walking kit was used that relies on PCR amplification to isolate integrants with the flanking cellular sequences. It was

PAGE 46

46 anticipated that these approaches would help in answering the question of whether R ep can minimize random integration events. D etermine the Role of Cellular DNA Repair Proteins on Site Specific Integration This research objective describes the studies that were aimed at determining if cellular repair proteins (DNAPKcs, Ligase I, and L igase IV) have an effect on AAV site specific integration. Specifically, an emphasis was placed on studying how DNAPKcs affect site specific integration, since a previous report has indicated that it inhibits recombinant A AV integration (Song et al., 2004 ) The frequency of site specific integration was assessed for both single stranded and self complementary AAV vectors in the absence or presence of DNAPkcs. It is anticipated that an expansion on my initial investigations should shed more light into the b iology of AAV site specific integration and can provide a framework from which to assess the safety of integration and to develop novel site specifically integrating AAV vectors.

PAGE 47

47 CHAPTER 4 DETERMINE THE DISTRI BUTION OF REP MEDIATED INTEGRATION Introducti on Major hurdles to the use of viral vectors for gene transfer have been the host response to the viral vector and the risk of insertional mutagenesis associated with random integration of the delivered viral vector. Several studies have suggested that int egration of recombinant AAV vectors is an important issue to address, since it can have con sequences for safe gene expression The first direct evidence for rAAV integration was presented by Nakai et al., whom infected mouse liver with a rAAV shuttle vect or and analyzed integration in genomic DNA from mouse livers 5 months post injection using a bacterial trapping approach. Analysis of 18 junctions revealed deletions and amplification of both the AAV vector and cellular sequences, with integration occurrin g in several genes (Nakai et al., 1999). Miller et al. performed a large scale in vitro analysis of rAAV integration sit e s in normal human fibroblasts in the absence of selection (Miller et al., 2005). They also used an AAV shuttle vector to rescue provira l sequences containing flanking cellular DNA in bacteria as circular plasmids. Around 977 unique AAV cellular junctions were analyzed with rAAV found integrated into all 23 chromosomes. Similar to the in vivo study by Nakai et al., deletions and amplificat ions were observed. Interestingly, when the distribution of rAAV integration was compared to a randomized control set it became obvious that rAAV vectors have preferences for CpG islands and ribosomal repeats, with a modest preference for transcriptional units. Although none of the integrations sites included known oncogenes, the conclusion was that that rAAV integration is taking place at sites prone to DNA breaks. It seems that rAAV vectors have a broad distribution of integration in human cells. Unlike other integrating vectors, rAAV vector integration seems relatively uncommon, probably no

PAGE 48

48 more efficient than integration of transfected naked DNA. It is important to note that rAAV vectors do not encode viral proteins capable of causing host DNA breaks; therefore, the consensus is that rAAV integration is taking place at site of existing chromosomal breaks. Although this raises concerns over rAAV integration that may cause tumorigenesis, rAAV integration has not been associated with cancer. The most like ly concerns regarding rAAV integration would stem from the chromosomal deletions and amplifications associated with integration and its effect on cellular function. The mechanism of rAAV integration is not known, but it is likely that cellular nuclease pr ocessing of DNA damage sites expose host DNA sequences that can form microhomologies with processed rAAV vector s resulting in integration. The imprecise mechanism and chromosomal changes suggest the involvement of non homologous end joining (NHEJ) protein s. The correction of m any diseases require long term transgene expression, making integrating vectors ideal candidates. However, the risk of insertional mutagenesis and oncogene activation are important considerations. Therefore, the identification of rAAV integration in or near genes suggests that rAAV vectors may present safety issues for gene transfer. However, an alternative does exist: the use of Rep containing AAV vectors which can integrate site specifically. In the presence of the AAV Rep protein th e AAV genome is targeted for integration into chromosome 19 site, AAVS1. Rep possesses an endonuclease function and has been shown to nick the AAVS1 chromosomal DNA at the TRS. Unlike retroviruses that can nick host DNA throughout, Rep mediated nicking may just occur at AAVS1, the only site with a nicking sequence (TRS) in close proximity to a rep biding site (RBE). The distribution of rAAV random integrations in the absence of Rep suggests that site s of integration occur at spontaneous chromosomal breaks.

PAGE 49

49 detail. Of interest would be to see if Rep, which is used to target wild type AAV site specific integration, can minimize random integration or simply promote more frequen t specific i ntegration Therefore, my first aim attempted to identify the distribution of integration of an AAV Rep containing shuttle vector or wild type AAV, using several different molecular techniques. Experimental Design and Methods Construction o f an AAV Vector, P5 Rep Shuttle. An AAV shuttle vector P5Rep Shuttle (4.7 kbp) was constructed to allow direct isolation of AAV integrants. Using standard cloning procedures, a 2.4 kb insert containing the left ITR, P5 promoter, and Rep was cut out from pAV2 (wild type AAV 2 vect or). The insert was ligated to a 4.1 kb backbone isolated from an AAV EF1a GFP.AOSP vector (a kind gift from Dr. Nakai). A 200 bp PCR product (from P5UF11) containing a poly A sequence was inserted at an NdeI site near the Rep gene. Figure 4 1 .Map of P5RepShuttle Vector. The shuttle vector consists of the P5 promoter driving Rep78 expression. Included are the Amp and pUC Ori sequences for bacterial trapping experiments. Flanking all these elements are the inverted terminal repeats.

PAGE 50

50 The key fea tures of this vector (Figure 4 1) are: (i) A P5 promoter containing a 138 bp integration efficient element (IEE) that was demonstrated to increase AAVS1 integration 100 fold (Philpott et al., 2002), (ii) the Rep gene, which is essential for targeted integr ation, (iii) an Ampicillin resistance gene for selection in bacteria, and (iv) a bacterial plasmid origin of replication for amplification in bacteria all enclosed within two inverted terminal repeats ( ITRs ) Western Blot for Rep Expression from P5RepShut tle Vector Whole cell proteins were isolated using Cell Lytic Reagent (Sigma), according to HCL precast SDS Page gel (Bio Rad). The samples were run for 2 hours at 100 volts in running buffer (25 mM Tris, 192 mM Glycine, 0.1% SDS, pH 8.3). The proteins were transferred onto an Immun blot PVDF membrane (Bio Rad) for 2 hours at 4C in transfer buffer (25 mM Tris, 192 mM Glycine, 20% v/v methanol, pH 8.3). The m embranes were blocked for 1 hour with 5 % non fat milk ( Carnation) in 1X Tris buffered s aline/Tween 20 (20 mM Tris, 500 mM NaCl, 0.05% Tween 20). Thereafter, it was incubated with Rep antibody (1F) diluted 1: 5000 in 1X TTBS, washed three times with 1X TTBS for 10 minutes eac h, and t hen incubated with Goat anti mouse HRP conjugated secondary antibody (Biorad) diluted 1:20000 in 1X TTBS for 1 hour. Subsequently, the membrane was washed three times in TTBS for 10 minutes, and incubated in 12 mLs of Immun Star HRP Chemiluminescent reagent (Bio Rad) for 5 minutes. T he membrane was wrapped in cling film and exposed to film for the appropriate time for good signal development. P5 RepShuttle Virus Production Ea streptomycin. The cells were triple transfected with the following constructs (see Appendix A for vector maps) : P5RepShuttle vector, rep cap helper plasmid pAAV RC, an d adenov irus helper

PAGE 51

51 plasmid pAdh elper, using Polyethylen i mine (1 mg/ml). The mixture was vortexed and incubated at room temperature for 5 minutes before being applied to the cells. The transfected cells were incubated at 37C for 72 hours, at which time the y were then harvested and lysed by three freeze/thaw cycles. The crude lysate was clarified by centrifugation and loaded onto two discontinuous iodixanol step gradients by gently underlaying the crude lysate with 15% (9 ml), 25% (6 ml), 40%, and 60% (5 ml) iodixa nol (OptiPrep) The gradients were centrifuged at 70,000 rpm for 1 hour. Five milliliters of the 60 40% interface was removed and dialyzed against PBS or loaded onto a heparin column. An empty B io R ad column was loaded w of heparin agarose (Si g m a H 6508) and washed with 20 mLs of 1xTD (137 mM NaCl, 15 mM KCl, 10 mM Na 2 PO 4 5 mM MgCl 2 2 mM KH 2 PO 4 pH 7.4). The column was loaded with the pulled iodixanol fraction and subsequently washed with 20 mLs of 1xTD. The bound virus was then eluted with 1xTD plus 0.4M NaCl. Aliquots of the virus were stored at 80C for future use. The titer was determined to be 1.6 x 10 12 viral particles per ml. DNA Walking Speedup PCR The DNA Walking Speed Up PCR kit (Seegene) employs a proprietary Anneal Control Primer (AC P) technology, which enhances the specificity of primer binding and PCR product formation. The kit is used to amplify unknown sequences flanking know n sequen ces. The PCR strategy (shown in Figure 4 2) is as follows: One of the four provided ACP primers (AC P1, ACP2, ACP3, ACP4) and the designed target (vector) specific primer 1 (TSP1) are used in the first PCR reaction. The second PCR, the first nested PCR, uses an ACPN primer and second target specific primer (TSP2) to amplify from the 1 st PCR product. The last PCR uses a universal primer and target specific primer 3 (TSP3) to amplify from the second PCR product. The PCR reaction for the 1 st reaction was as follows: 94C (5 min), 42C (1 min), 72C (2 min), 30 cycles of 94C (30 sec), 55 C (30 sec), 72C (1 00 sec), and a final step at 72 C (7 minutes). The

PAGE 52

52 second PCR reaction conditions: 94C (3 min), 30 cycles of 94C (30 sec), 55 60C (30 sec), 72C (100 sec), and a final step at 72C (7 minutes). The last PCR reaction conditions were the same as the seco nd PCR conditions, except the annealing step was 60 65C (30 sec). Five to ten microliters of the final PCR product were loaded on a 1% agarose gel for inspection or southern analysis. In addition, the bands were excised from the gel and individually clone d into a TA cloning vect or for sequencing. The sequence information for the target specific primers are as Figure 4 2. Nested PCR scheme for D NA Walking PCR. The first PCR reaction involved primers TSP1 and ACP1 or ACP2, 3, 4 The second PCR reaction (1 st nested PCR) involves the use of TSP 2 and ACPN primers. The third PCR reaction (2 nd nested PCR) uses TSP 3 and ACP U primers. Note that the TS P1, 2, 3 are primers designed for th e right end of the AAV 2 vector in the Cap sequence as marked. Junction Assay: Detecting AAVS1 I ntegration by PCR Southern A hybrid PCR southern blot approach was used to determine if the vectors used in the experimen ts are capable of integrating into AAVS1. In this approach, PCR was used to amplify AAV AAVS1 junction sequences from genomic DNA isolated from total cells infected or tranfected with the P5RepShuttle vector or wild type AAV 2 vector The AAV ITRs are comm only detected at the AAV AAVS1 junction sites and t here is no well defined break point, but clusters of break points have been identified near the RBS of the ITR. The refore, the following primers were used to allow isolation of junction sequence s by PCR: the forward

PAGE 53

53 primer was specific for the right AAV ITR ( ITR1: aggaacccctagtgatgg ag primer falls on AAVS1 near a BamHI restriction site on the host sequence ( AAVS1dRBS: caccacgtgatgtcctctga The PCR scheme is shown in Figure 4 3 Figure 4 3. PCR scheme for detecting AAV AAVS1 junctions. The figure represents a theoretical integration event of an AAV vector into AAVS1. To detect AAV AAVS1 junctions one primer near the right ITR and a second primer in the target site is used in a PCR reaction. The PCR products are then hybridized with an AAVS1 probe designed to detect those products. Note that this system is only capable of detecting right end AAV AAVS1 junctions. The PCR conditions were set up using HotStarTaq master mix (Qiage n) as follows: an initial heating at 94C for 15 min (hot start) followed by 30 cycles at 94C for 1 min, 57C for 1 min, 72C for 2 min, and a final elongation at 72C for 10 min. The PCR products were separated on a 1% agarose gel and then transferred on to a positive nylon filter membrane (Hybond N+, Amersham). The filter was hybridized with a 441 bp AAVS1 probe generated infected HeLa D NA as the template. DIG Labeling of AAVS1 probe PCR DIG Probe Synthesis Kit (Roche) was used to generate and label a 441 bp AAVS1 fragment 50 100 nanograms of HeLa genomic DNA was mixed with the following reagents:

PAGE 54

54 initial denaturation (95C for 2 minutes), 30 cycles of denaturation (95C for 20 seconds), annealing (55C for 30 seconds), elongation (72C for 2 min), and a final elongation step (72C for 7 minutes). The labeling of the probe was assessed by running a portion of the PCR product on an agarose gel. Both labeled and unlabelled PCR products were assessed this way. Successful labeling results in the PCR product migrating slower, hence higher in size, compared to the unlabelled control. The probe concentrat ion use d hybridization solution. Hybridization of PCR Products Hybridization of the PCR products was performed using DIG Easy Hyb (Roche) overnight at 42C. Post hybridization the nyl on filter was washed twice in 2X SSC (0.3 M sodium chloride, 0.03 M sodium citrate, pH 7.0) 0.1% SDS (sodium dodecyl sulfate) at room temp for 10 minutes each followed by washing in 0.5XSSC, 0.1%SDS at 68C for 30 minutes. After hybridization and stringency washes the blot was incu bated in washing buffer for 2 minutes, blocking solution for 30 minutes, antibody solution for 30 minutes, washed twice for 15 minutes in washing buffer, and finally incubated in detection buffer for 2 minutes. The membrane was incubated with CSPD for a fe w minutes, incubated for 10 minutes at 37C. The membrane was wrapped in saran and exposed to film for the appropriate time period for signal development (5 15 minutes). The wash and block solutions, CSPD, and antibodies were all purchased from Roche. The antibody, Anti Digoxigenin Fab fragments (Roche), was used at a dilution of 1:10,000 in blocking buffer. Rescue of Integrated Shuttle V ector To rescue integrated P5RepS huttle vector, g of genomic DNA from transfected or infected cells, was digested with EcoRV, which cleaves up stream of the Amp/Ori and throughout

PAGE 55

55 the cellular genome. The DNA was extracted with phenol/chloroform and precipitated with ethanol. The pellet was resuspe nded in l of T4 DNA ligase (NEB, 400 U/ul) overnight at 15 C to promote intramolecular circularization. The ligated DNA was pre l of water and transformed into SURE (Stop Unwanted Rearra ngement Events) bacterial cells by electroporation. The transformed b acteria were grown on agar g/ml ampicillin. Figure 4 4. Shuttle rescue scheme to isolate provirus as plasmids. Genomic DNA containing integrated shuttle vector is diges ted with EcoRV which cuts upstream of the Amp and Ori sequences and throughout the cellular genome. The digested fragments are ligated under conditions that promote intramolecular circularization. These circularized fragments are transformed into bacteria and grown as plasmids for sequencing. Note that only those fragments containing both the Amp and Ori will be amplified and selected in bacteria. Bacterial plasmids from the surviving bacterial colonies were isolated and sequenced using a primer in the AAV Ori Sequencing was performed by the Interdisciplinary Center for Biotechnology Research ( ICBR ) f acility (Cancer/Genetics Research Complex, University of Florida). The sequenced information was blasted ag ainst the NCBI human genome database to find matches for t he rescued flanking cellular sequence to identif y where the shuttle vector ha d integrated

PAGE 56

56 Transformation of Competent Cells One shot TOP10 Electrocompetent cells (Invitrogen) were thawed on ice. On e to two microliters of cloned DNA was mixed gently with the bacterial cells. The mixture was transferred to a chilled 0.2 cm electroporation cuvette and transformed according to manufactu r s of each mixture was plated onto pre warmed ampicillin plates and incubated overnight at 37 C. SURE electroporation competent cells (Stratagene) were transformed according to manufa g ement Events. The cells were used to transform AAV vectors which contain the ITRs and for junctio n rescue of the shuttle vector, and because they provide high transformation efficiencies (10^ 10 cfu per microgram) Cloning of PCR products into TOPO TA Vector TOPO TA cloning Kit for sequencing (Invitrogen) was used to clone PCR products for NaCl, 0.06 m MgCl 2 ncubated for 5 minutes at room temperature and then placed on ice. One shot TOP10 electrocompetent cells were transformed with the mixture as previously described. Results Limit of D etection for S ite Specific Integration Using the Junction Assay. A HeLa c ell line latently infected with AAV ( Clone #2 ) was used to demonstrate detection limit s of the assay Decreasing amounts of genomic DNA from clone 2, generated by using 10 fold di lutions in water, was mixed with 640 nanograms of background uni n fected He la DNA for PCR reactions The PCR product s were probed with AAVS1 using S outhern hybridization.

PAGE 57

57 HeLa cells typically contain 6 10 pg of DNA per cell. Assuming a DNA content in HeLa cells of around 8 pg of DNA per cell, 1X10 5 cells of Clone #2 would give aro und 800 ng of DNA (undiluted DNA sample in figure). Figure 4 5 : Southern blot to assess detection limit of junction assay. PCR product of genomic DNA latenly infected with AAV 2 was hybridized using an AAVS1 probe. Decreasing amounts of Clone #2 genomic DNA (using 10 fold dilutions) was used with 640 ng of uninfected HeLa background DNA for the junction PCR. Arrow marks the 0.5 kb size The result (Figure 4 5 ) indicates that the detectable limit for AAV AAVS1 junction sequences is 8 ng, which is equivalen t to approximately 1000 cells in 10 5 cells, or 1%. The control, uninfected HeLa cells, is negative for such AAV AA VS1 junction demonstrating the specificity of the assay. Overall, this information suggests that if 1% of infected cells contain integrated v irus and form AAV AAVS1 junction s within my primer range, I would be able to detect it using the junction assay. Therefore, this approach was used as a preliminary assessment to determine if the constructed shuttle vector was capable of site specific integ ration.

PAGE 58

58 P5Rep Shuttle Vector Mimics Wild Type AAV With Regards to Rep expression. To assess if the shuttle vector was capable of expressing Rep, HeLa cells were either mock tran s fected or tran s s : pAV2, pSVAV2, P5 RepS huttle vector, or P5 RepS type AAV2 genome. pSVAV2 is a construct expressing Rep under a constitutive SV40 promoter. p XX680 is an adenovirus helper plasmid containing the adenovirus genes necessary for AAV replication and expression. Protein was extract from the transfected sample s 48 hours post infection for western blot analysis. The result (Figure 4 6) indicates that the P5RepShuttle vector expressed the Rep78 and 52 proteins, only in the presence of ad helper g enes. Like wild type AAV, Rep is not detectable in the absence of ad helper genes. Although undetectable in the absence of adenovirus genes, enough Rep is presu mably made early on allowing site specific integration to take place. It is important to note that Rep negatively autoregulates its expression by binding to its P5 promoter; the construct pSVAV2 expresses all the Rep proteins without such negative regulati on, serving as a positive control. Figure 4 6 : Western blot for Rep expression from the P5RepShuttle construct Transfected P5Rep Shuttle Integrates into AAVS1 In the absence of Rep expression, the shuttle vector would not be targeted to AASV1. To veri fy whether the P5 Rep shuttle vector is capable of expressing enough Rep and integrating

PAGE 59

59 site specifically, HeLa cells were transfected with 1.5 micrograms of P5RepShuttle plasmid using PolyFect transfection reagent (Qiagen). Forty eight hours post tranfec tion the cells were expanded from a 6 well dish to a T25 flask. A day later, the confluent cells were split 1:10 into 2 T25 flasks. The rest of the cells were harvested (the 3 days post transfection sample point). Every four days, cells from the two T25 fl asks were mixed and split into two new T25 flasks at 1:10. The rest of the cells were collected for junction analysis. The collection days used in the junction PCR are listed in the figure. One microgram of DNA from each sample time point was used in a jun ction PCR. The PC R products were probed for AAVS1 using southern hybridization. Figure 4 7: Southern on PCR products generated from HeLa genomic DNA transfected with P5Repshuttle vector at various days post tranfection. M indicates the DNA ladder marker for size identification. P indicates the positive control sample used to verify success of PCR reaction. The numbers indicate the different samples. The passaging of the cells was used to dilute out the number of transfected plasmids in the cells which could inhibit the PCR reaction by saturating the primer binding sites. The result (Figure 4 7) indicates that the P5 RepShuttle vector was capable of integrating into the

PAGE 60

60 Chromsome 19 target site. Moreover, integration can be detected, as judged by persi stence of AAV AAVS1 junction sequences, even at late passage (approximately 31 days post tranfection). In addition, this suggests that enough Rep is expressed to allow targeting of the plasmid to AAVS1, although undetectable by western blot. Infected P5Rep Shuttle Integrates into AAVS1 The previous data indicated that the trans fected shuttle vector plasmid was capable of integrating, due to sufficient Rep expression. Therefore, the next objective was to pack age the P5 Rep S huttle vect or into AAV particles an d assess whether the P5 Rep Shuttle virus was capable of infecting HeLa cells and site specifically integrating. Figure 4 8: Southern blot on PCR products from HeLa cells infected with P5RepShuttle vector at various infection doses HeLa cells were infect ed with various multiplicities of infecti on (viral particles/cell) of P5 Rep S huttle virus: 10,800 or 21,600 or 108,000 vp/cell. Forty eight hours post i nfection the cells were split at 1:10 into new tissue culture plates The rest of the cells were collect ed for PCR (shown as the 48 hour time point sample ) The other time points included 8 days post infection and 12 days post infection. One microgram of genomic DNA from each sample was used in the junction PCR as described previously. The results (Figure 4 8) indicate that the

PAGE 61

61 shuttle vector virus was capable of infecting HeLa cells and integrating into AAVS1. Moreover, that maximal integration took place eve n at the lowest dose tested, limited only by the intrinsic efficiency of integration. In addition, similar to the transfection experiment, junction product was detectable even at the latest harvesting time point (12 days post infection). Shuttle Vector Re scue Isolates AAV AAVS1 Junctions, But Not Those from Other Sites The previous data indicate d that the shuttle vector was capable of integrating into the targeted site. To determine if the vector also integrated into other sites, genomic DNA from both tran sfected and infected HeLa samples were used for junction rescue. The rescue of the integrated virus isolated only AAV AAVS1 junction s and not other AAV cellular junction s even after numerous attempts. The rescued products were sequenced to identify the pr ecise junction sequences. Three junctions (Table 4 1) were unambiguously mapped to C hromosome 19 site in AAVS1, at different locations (based on UCSC Genome Browser numbering) Table 4 1: P5Shuttle Vector Chromosome 19 junction sequences isolated through r escue approach. AAV Sequence Chr. 19 Sequence Location CGACTCCACCCCTCCAGGAACCCCTAGTGA TGGCCCAGATCCTTCCCTGCCGCCTCCTTCAG.. 60319669 GCTCGCTCGCTCACTGAGGCCGGGCGACCA GCCCCCGAGTGCCCTTGCTG.. 60319887 CCTCTCTGCGCGCTCGCTCGCTCACTGAGGC CGCCTTTCAGGGGGACCCAG GGCACCA GAACTCCC 60298701 AAV Chromosome 3 and AAV Chromosome 6 Junctions Isolated Using DNA Walking PCR Since the P5Shuttle vector experiments failed to isolate other AAV cellular junctions, an alternative strategy was used in hopes of identifying other integ ration sites. To do this, HeLa cells were infected with wild type AAV 2 at 10,000 viral particles per cell. The wild type AAV 2 virus was produced in HEK 293 cells using AAV 2 plasmid pAV2 and helper vector pDG. Wild type AAV virus was used since it is unc lear whether the packaged shuttle virus was fully

PAGE 62

62 functional. The DNA walking PCR system by Seegene was used to isolate cellular sequences flanking AAV. A small aliquot of the final product was used in AAVS1 southern hybridization to see if this system co uld pickup AAV AAVS1 junctions. Hybridization using AAVS1 and AAV probes revealed that the DNA walking PCR kit was able to isolate AAV AAVS1 junction, but it s relative presence is less than the other PCR products based on the intensity of the PCR products (Figure 4 9). Figure 4 9: Southern blot on PCR products generated by DNA walking Speedup PCR system. A gel picture of the PCR products (left) indicate strong signals for HeLa cells infected with wild type AAV2 at 10,000 vp/cell. HeLa (negative) is mock infected DNA used in PCR reactions. Clone (pos) represents sample used as positive control to determine if the PCR system can amplify AAV AAVS1 junction sequences. (Middle) AAVS1 hybrdization on PCR products. (Right) AAV hybridization on PCR produc ts.

PAGE 63

63 To identify what those PCR products represented, they were cloned into the TOPO TA vector (Invitrogen) for sequencing. Two junctions were unambiguously mapped to chromosomes 3 and 6. Another junction mapped to several chromosomal sites due to repetiti ve sequences at the junction making it difficult to identify the precise integration site. Numerous additional attempts to isolate more junctions resulted in failure. The junctions sequences identified are presented below in Table 4 2. Table 4 2: AAV2 Chro mosomal junction sequences identified using the DNA Walking Speed Up PCR kit. AAV Sequence Chromosome Sequence Location ACAGTACTCCACGGGACACGG TCAGTGCT AGAGGACAGCTTCAACTCCC CATAATTTCA TCTCTGACC Chr. 3 CGCGCTCGCTCGCTCACTGAGGCCGGGCGA CCAA A GGT GGTAGAA AAGG TATATCCTCGTAGAAAA ACTAGA Chr. 6 TGGAGTTGGCCACTCCCTCTCTGCGCGCTC GCTCTGGAGA CCTGATGCTG G GGAAGGGCA TGCCTGGCATCACCACACACCTGGGGGGAG ACAGGAGCCTGGGGCCGGTG GGCCCACACA Chr.1 Chr. 1 5, Chr. 16. Discussion and Limitation of Study In an attempt to identify the distribution of AAV integrants in the presence of Rep, two approaches were used: the first approach involved the use of a Rep containing shuttle vector to isolate integrated ve ctors as plasmids in bacteria and the second approach involved the use a c ommercial kit to PCR amplify AAV cellular junctions. was a novel approach which has the potential to identify integration sites. Initially, these experiments were hi ndered by the difficulty in packaging the shuttle vector, because there was significant homology between the shuttle vector and the helper constructs (i.e the Rep, Amp, and Ori sequences were all present in helper vectors) Any recombination among these ve ctors during

PAGE 64

64 the replication and packaging process could have altered the Amp and Ori of the packaged vector, thus affecting the subsequent infection in Hela cells and the corresponding rescue experiments. In an attempt to minimize this, an approach was us ed to reduce this homology, but it resulted in low titers of the shuttle vector, not sufficient for cell culture experiments. Despite these difficulties, several P5RepShuttle AAVS1 junctions were isolated using the rescue approach, suggesting that some o f the virus was functional. The lack of rescue of other junctions can be explained as follows: (i) larger circularized fragment (>8 kb), due to integration of AAV as possible concatemers, may not transform efficiently in bacteria making the isolation of these junctions difficult, (ii) the choice of restriction enzyme greatly limits the efficiency of the approach, since an enzyme must not cut in the Amp and Ori for efficient rescue, (iii) integrant s in chromosome 19 are more likely to integrate largely int act, compared to other random integration sites, resulting in predominantly AAV AAVS1 junction s being isolated, (iv) the large homology (Rep, Amp, Ori) among the shuttle construct and helper vectors may have contributed to packaging of disrupted Amp and O ri sequences affecting integration and rescue, (v) the imprecise nature of integration could have result in many integration events but most of these possibly suffer from partial or complete loss of the necessary Amp and Ori sequences required for rescue making impossible the isolation of these junctions using the rescue approach, and (vi) it is also important to note that the integration of the P5RepShuttle vector was allowed to occur in the absence of selective pres sure, possibly resulting in a limited number of integration events taking place. The DNA Walking PCR kit was used as an alternative approach to try and identify integration sites not possible by the shuttle approach. To simply the interpretation of the results, wild type AAV2 was used. The m anufacturer claims that this approach is superior to many other

PAGE 65

65 complicated methods such as inverse PCR, and ligation mediated PCR, therefore it was used instead of those ot her approaches. Interestingly, S outherns on the PCR products generated using this s ystem were able to identify AAV AAVS1 junctions, along with other PCR products not positive for AAVS1, presumably representing other AAV cellular junctions. However, this system suffers from primer bias and amplification conditions can greatly affect resul ts (data not shown). Sequencing of cloned PCR products unambiguously identified Chromosomes 3 and 6 as AAV integration sites, but chromo somes 1, 15, and 16 may also be other sites of integration. chanism of in tegration, because any significant homology between the vector and the chromosomal site. Other sequenced junctions (not described) were complex and could not be explained as simple AAV chromosomal junctions. Some of these represen ted AAV AAV and AAV Adenovirus plasmid junctions. A potential obstacle in isolating and identifying junctions is that the PCR approaches used in junction detection and sequencing can be a hindered by the difficulty for the DNA polymerase to amplify through the ITRs, since the presence of any secondary structure of the ITRs at the junctions can cause the stalling of the DNA polymerase. In summary, the small scale of the results precludes any statements about whether Rep can minimize random integration. Futu re research should continue these experiments to focus on studying whether Rep can minimize random integration and provide stable, safe integration. The limited results using the described approaches demand innovative approaches for studying AAV integratio n. One suggestion would be to use a novel shuttle vector containing a selection cassette that can be used for selection of both mammalian and bacteria cells This new shuttle vector can then be used in a co infection with a Rep vector to target the integr ation of the shuttle vector to AAVS1. The distribution of integration of the shuttle vector can the n be assessed in the presence or absence of

PAGE 66

66 Rep expression in total selected cells or in individual cell clones. In addition, by providing the Rep as a separ ate vector, the issue of rearrangements of the shuttle vector, due to large regions of homology with helper vectors can be avoided potentially making junction isolation and analysis easier. A recent report has indicated that a great deal of variability e xists with regard to integration events with wild type AAV within 48 hours post inf ection (Drew et al., 2007). This observation remain s to be validated using alternative approaches, and therefore, it is important to characterize the distribution of integr ation for wild type AAV and/or Rep containing AAV vectors, since Rep is an important viral protein required for targeted integration. Elucidating the details would provide renewed interest in the development of AAV as an integrating vector for certain gene therapy applications. Moreover, from a virology perspective, it would greatly contribute to our understanding of how Rep can function to regulate the life cycle of AAV, priming it for integration in the absence of helper virus.

PAGE 67

67 CHAPTER 5 DETERMINE THE ROLE OF CELLULAR DNA REPAIR PROTEINS ON S ITE SPECIFIC INTEGRATION Introduction Very little is known about how cellular proteins interact with the AAV genome, processing it for AAV integration or affecting its tranduction. Many cellular proteins have been i dentified that interact with the AAV Rep protein and were shown to modulate AAV DN A replication (Nash et al., 200 9 ). Interestingly, amongst these identified Rep interaction proteins, several belong to the non homologous recombination or other DNA repair pa thways, including Ku 70/Ku 80, DNA dependent protein kinase, Rad50, and PARP1. These same proteins may have a role in AAV integration, but these studies have not been actively pursued by others. Many studies have indicated that upon AAV infection, the hos t cell detects the AAV single stranded DNA as damaged DNA (Jurvansuu et al., 2005; Cervelli et al., 2008) suggesting that host repair proteins can passively and/or actively compete for AAV binding In addition, Zentilin et al., used quantitative chromati n immunoprecipitation to demonstrate that both Ku86 and Rad52 can bind the AAV ITRs, processing the AAV genome via alternate pathways that can affect transduction expression (Zentilin et al,, 2001) In the absence of Ku86 they observed greater transductio n, whereas, in the absence of Rad52 rAAV transduction was greatly inhibited. This study suggests that there is competition between non homologous (i.e Ku86) and homologous repair proteins (i.e Rad52) in processing AAV expression. It remains to be seen whe ther these proteins have other roles, such as processing wild type AAV infection for site specific integration. There have been only three reports to date that suggest a direct role of the cellular repair machinery in integration. Sanlioglu et al., used A TM deficient and proficient cells to demonstrate that rAAV integration is elevate d in ATM deficient cells, observing a 7 fold increase in the

PAGE 68

68 number of GFP positive clones in ATM deficient cells compared to controls (Sanlioglu S., Benson, P.K., and Engelh ardt, J.F., et al., 2000). More interesti ngly, Song et al. infected both C56 / BL6 and SCID mice hepatocytes with rAAV vectors and used p artial hepatectomy to dilute out the episomal AAV molecules to measure int egration, observing transgene expression in 10% of hepatocytes in C56 / B L 6 mice 8 weeks post hepatectomy, whereas, over 40% of hepatocytes in SCID mice expressed the transgene at the same time point. SCID mice suffer from severe combined immunodeficiency disorder, because they are lacking expression of DNA dependent protein kinase catalytic subunit (DNAPKcs), suggesting that DNAPKcs is an inhibitor of both rAAV and wild type AAV integration, the latter determined in an vitro assay (Song et al., 2004). Last but not least, Yamamoto et al., identified a ne w role for TAR RNA loop binding protein 185 (TRP 185) in AAV 2 site specific integration, suggesting that TRP 185 inhibits wild type AAV integration near the AAVS1 RBE by enhancing integration more downstream into AAVS1 (Yamamoto et al., 2007). They postul ated that TRP activity by serving as a molecular chaperone. Taking in to account these observations, it is a bit confounding how cellular repair proteins act on AAV genome processing for it for integration, whether random or site specific (AAVS1). To contribute knowledge to this area of research, my specific aim was to assess first and foremost, whether non homologous end joining has a direct role in AAV site specific integration. To do this, glioblastoma cells lin es, M059J and M059K, were used in co infection experimen ts and clones were analyzed by S outhern hybridizations to assess site specific integration. The M059J cells lack expression of DNAPKcs and as a result are defective for non homologous repair. The M059 K cells express functional DNAPK cs and are competent for non homologous repair.

PAGE 69

69 Experimental Design and Methods Cell Lines M059J and M059K cell lines were purchased from American Type Culture Collection (Manassas, VA) The M059K cells are resistant to io nizing radiation damage, capable of fixing the damage. The M059J cells are 30 fold more sensitive to ionizing radiation than M059K cells. M059K cells express functional DNA dependent protein kinase catalytic subunit (DNAPKcs), wher eas M059J cells do not ex press DNAPKcs. These cells were maintained in a 1:1 mixture of essential amino acids, 10% fetal bovine serium, and 100 U/mL of penicillin and streptomycin. They were main tained in a 37 C humidified incubator with 5% CO 2 A h uman cervical cell line (HeLa (GIBCO) supplemented with 10% fetal bovine serum and 100 U/mL of penicillin and streptomycin. Cells were maintained in a 37C humidified incubator with 5% CO 2 The Ligase I (GM16097) and Ligase IV (GM16089) cell lines were purchased from the Coriell Institute (Camden NJ ) and maintained in Minimum Essential Medium supplemented with 2 mM L glutamine, 100 U/ml penicillin a nd streptomycin, and 10% fetal bovine serum. The Ligase I cell line is defective for ligase I function. The Ligase IV cell line is defective for ligase IV function. The ligase I enzyme is important in homologous repair and the ligase IV enzyme is importan t for non homologous end joining repair. Construction of Recombinant AAV Vectors P5UF11 was produced by inserting the P5 sequence into a Kpn1 site of UF11 vector (Vector Core, University of Florida). The P5 sequence was PCR amplified from wild type AAV 2 plasmid with primers containing internal Kpn1 sites. The orientation of the inserted P5 was examined by sequencing. P5UF11 contains the P5 sequence, CAG promoter (CMV enhancer and

PAGE 70

70 chicken beta actin promoter), GFP, and the Neomycin cassette flanked by the ITRs. The P5UF11 vector was packaged into AAV 2 capsid in HEK 293 cells via cotransfection with pAAVRC and pADhelper plasmids. P5PGKHygroGFP wa s constructed as follows: pMSCVH yg (Clontech) was digested with XhoI and HindIII to isolate a 1872 bp fragment co ntaining the PGK promoter and hygromycin coding sequence. This fragment was cloned into pdsP5AAV CB EGFP vector backbone isolated by digesting with XhoI and HindIII. This new construct, called dsP5PGKhygo, was digested with XhoI and SacI to isolate the P G K and hygromycin sequences and cloned into P5UF11 digested with XhoI and SacI. The vector was packaged into AAV 2 capsids using HEK 293 cells and helper vector pDG. pSVAV2 was constructed from pAV2 and pSVRep (a gift from Dr. Falck Pedersen). Th e pSVRep was digested with EcoRV and HindIII to isolate a fragment containing the SV40 promoter and Rep78 sequences. This fragment was inserted into pAV2 digested with BmgBI and HindIII. pdsP5 AAV Neo R : This self complementary AAV vector was created by cloning the P 5 and Neomycin sequences into pdsAAV CB EGFP (a kind gift from Dr. Arun Srivastava). The P5 sequence was amplified using P5UF11 and inserted into a Kpn1 site of pdsAAV CB EGFP, to generate a p dsP5AAV CB EGFP construct. The n eomycin cassette was isolated fr om P5UF11 using XhoI and SacII and inserted into the backbone of pdsP5AAV CB EGFP digested with XhoI and SacII. The constructed pdsP5Neo was verified by restriction digestions. The vector was packaged into AAV 2 capsids using helper vector pACG2. pds AAV SV Rep78: Thi s self complementary AAV vector was created by isolating a 1982 bp fragment containing the SV40 and Rep78 sequences from pSVRep and inserting it into the

PAGE 71

71 backbone of pdsAAV CB EGFP digested with Kpn1 and HincII. The constructed vector was ver ifie d by restriction digestions, and packaged into AAV 2 capsids using helper vector pACG2. See Appendix A for vector maps. Cloning of Infected Cells Cells infected with the different viruses were selected for 2 w eeks in the presence of Geneticin (GIBCO ) (HeL a: 600 ug/ml; MO59J, M059K: 100 ug/ml) or Hygromycin B (GIBCO) (Ligase IV: 75 ug/ml) The resistant cells we re counted and seeded at 1 cell per w ell into several 96 well plates, and subsequently expanded until they were confluent into T25 flasks or 100 mm dishes, at which time they were harvested for southern hybridization analysis. Southern Blot Analysis DNA from individual clones resistant to neomycin was isolated using DNAeasy tissue kit (Qiagen). 10 20 ug of DNA was digested with EcoRV and XbaI for 1 2 16 hours, and loaded onto a 0.8% agarose gel. The DNA was transferred from the gel onto a nylon filter membrane and hybridization was carried out at 65 degrees overnight with 32p labelled probes (AAVS1, Neo GFP, or Neo). The DNA probes were radio labele d using RadPrime DNA labeling kit fragme nt generated by digesting an AAVS1 plasmid (pRVK) with EcoRI and Kpn1. The Neo GFP probe (2 kb) was generated by digesting P5U F11 with XbaI and BamHI. The 1 kb Neo probe (for self complementary AAV vectors) was generated by digesting P5UF11 with XhoI and BamHI. The 1.9 kb Hygro probe was generated by digesting P5PGKHygro with XhoI and SacI. Hybridization was performed in Church B uffer (0.5 M sodium phos phate, 7% SDS, 1 mM EDTA) at 65C overnight. The following day, the blots wer e washed in 2XSSC, 0.1% SDS (65C for 15 minutes), 1X SSC, 0.1% SSC( 65 C for 15 minutes), 0.5x SSC, 0.1% SDS (65C for 30 minutes) and final wash in 0.1X S SC, 0.1% SDS (65 C for 15 minutes). The nylon filter

PAGE 72

72 was rinsed in 2XSSC, wrapped in Saran and exposed to film for appropriate times for signal development using autoradiography. Results More Junction Product Seen in M059K Cells Compared to M059J cells. To assess site specific integration in these cells lines, they were infected with wild type AAV2 (pAV2) at different doses AAV AAVS1 junction formation was assessed at 48 hours post infection using the junction assay (Figure 5 1), described in material and methods on page 52 The results demonstrate that increasing t he dose of wild type AAV2 did not increase the intensity of junction product in both J and K cells suggesting that a n intrinsic efficiency of integration is taking place in both cells. In additi on, more junction product was detected in the M059K cells compared to the M059J cells. Time Course for Junction Formation in M059J and M059K Cells To determine the kinetics of junction formation in these cells lines, junction product was assessed at 48 h ours, 1 week, and 2 weeks post wild type AAV 2 infection (10^5 vp/cell). Figure 5 1. Junction product formation in M059J and M059K at different doses of wild type AAV 2 infection. The cell lines were infected with different dose (viral particles per cel l) of wild type AAV2. Genomic DNA from infected cells was isolated 48 hours post infection for junction assay.

PAGE 73

73 The results (Figure 5 2) verified that J cells produce less junction product; however, by 1 week post infection the junction product in J cells i ncreased. Interestingly, in the K cells the junction product also picked up by 1 week, and at all time points it was more intense compared to the J cells. This suggests that in the absence of DNAPkcs, AAV site specific integration is delayed. Figure 5 2: Time course of junction formation in M059J and M059K cells. Both cells were infected with 10^5 vp/cell. Genomic DNA was isolated at 48 hours, 1 week or 2 weeks post infection for junction assay. An alternative infection approach was used to assess integra tion, which would allow for selection and cloning. M059J and M059 K cells were infected with P5UF11 and pSVAV2 at a ratio of 50:1, respectively, at a total dose of 10^6 vp/cell. The 50:1 ratio of these two single stranded virus es was used because we found it provides optimal site specific integration (Zhang et al., 20 0 7). The infected cells were selected with Geneticin ( G 418 ) for 2 weeks in duplicates Thereafter, the resistant colonies from one set were pooled for junction PCR to assess integration. Intere stingly, upon selection, a significantly greater amount of junction product was detected in selected K cells, in contrast to the selected J cells (Figure 5 3). This suggest ed that more stable integration has taken place in K cells compared to J cells in th e presence of selective pressure.

PAGE 74

74 Figure 5 3. Junction Assay on M059J and M059K cells co infected with P5UF11 and pSVAV2 at 10^6 vp/cell. Infected cells were selected for 2 weeks in G418 and surviving cells from each cell line was pooled for junction PC R. (+) represent a sample positive for AAV AAVS1 junctions. The infected samples (J, K) are shown, as well as the ratio of the two viral vectors (50:1, P5UF11 to pSVAV2). DNAPKcs is an Inhibitor of Single Stranded DNA Site Specific Integration To get a mor e quantitat ive assessment, the colonies from the second set of selection were expanded into larger tissue culture dishes and grown in the presence of G418 Genomic DNA was isolated from nineteen individual colonies cloned from both M059J and M059K infected cells for southern analysis Interestingly, the data revealed something completely different than what was suggested by the junction assay: (i) more disruptions of the AAVS1 site occurred in M059J cells and 87.5% of clones had t he n eomycin vector integra ted into AAVS1 (Figure 5 4), and (ii) i n contrast, less disruption of AAVS1 was seen in M059K cells with only 60% of clones having the AAV n eomycin cassette integrated into AAVS1 (Figure 5 5) The data are summarized in Table 5 1. The percentages of rando m and site specific integration may be

PAGE 75

75 slightly overestimated, since 4 M059K and 3 M059J clones did not have detectable n eomycin bands an d presumably in these clones AAV is integrated randomly because these clones were grown in th e presence of G418. There fore, if this assumption is correct, then the M059K cells display 47% AAVS1 specificity, whereas, the M059J cells have 73% specificity. Regardless, in the absence of DNAP Kcs (i.e M059J cells) there is significantly more specificity of integration. Table 5 1. Summary of M059K and M059J single stranded infected clones analyzed by southern hybridizations. M059K Clones M059J Clones Number of clones disrupted for AAVS1: 9 15 Number of clone with detectable Neo: 15 16 Percentage of disrupted clones with Neo co linked 9/9 (100%) 14/15 (93%) AAVS1 specificity: 9/15 (60%) 14/16 (87.5%) Random: 6/15 (40%) 2/16 (12.5%) Self Complementary AAV Vectors Integrate Site Specifically in HeLa Cells DNAPKcs has been shown to have a role in concatemer formation of input linear ssDNA genome and the circularization of input self complementary DNA genome. Of interest would be to determine if self complementary vectors show different integration properties in the absence or presence of DNAPkcs. However, it has not been shown if scAAV vectors are capable of site specific integration. To determine if scAAV vectors are capable of site spec ific integration, HeLa cells were co infected with two self complementary vectors (dsP5 AAV Neo R and ds AAV SVRep78) at different ratios a nd infection doses (viral genomes per cell) The integrating scAAV, d sP5 AAV Neo R was used for target ed integration i to AAVS1, and the helper vector, dsAAV SVRep78, was used to provide the R ep protein for targeting the dsP5Neo vector to AAVS1. Different rat ios of the two vector s were use d to decide which ratio provided optimal integration detectable by the junction assay analyzed 1 week post infection (Figure 5 6 A)

PAGE 76

76 Figure 5 4: Southern hybridization of M059J clones infected with P5UF11 and p S VAV2 (50:1 ratio, 10^6 vp/cell). The left blots show signals for AAVS1 sequences and the right blots show signa ls for n eomycin. The arrows indicate the clones that had both AAVS1 and n eomycin signals co linked. The endogenous AAVS1 band is seen in all clones. The pre sence of additional AAVS1 bands is indicative of rearra n g e ments of the site, which occurs when it targeted. In some cases, the endogenous AAVS1 is co linked with AAVS1, indicative of deletions occurring before integration. If integration occurs with minima l deletions, a higher AAVS1 band is detected. The samples are numbered. N represent s a positive control plasmid which was used t o determine specificity of the n eomycin probe.

PAGE 77

77 Figure 5 5. Southern hybridization of M059K cl ones infected with P5UF11 and p S VAV2 (50:1 ratio, 10^6 vp/cell). The left blots show signals for AAVS1 sequences and the right blots s how signals for n eomycin. The arrows indicate the clones that had both AAVS1 and n eomycin signals co linked. The endogenous AAVS1 band is seen in all clo nes. The presence of additional AAVS1 bands is indicative of rearra n g e ments of the site, which occurs when it targeted. In some cases, the endogenous AAVS1 is co linked with AAVS1, indicative of deletions occurring before integration. If integration occurs with minimal deletions, a higher AAVS1 band is detected. The samples are numbered. N represents a positive control plasmid which was used t o determine specificity of the n eomycin probe.

PAGE 78

78 Figure 5 6: Self Complementary AAV vectors integrate site specif ically in HeLa cells. A) Junction PCR assa y on HeLa cells infected with ds P5 AAV Neo R only or with dsAAV SVRep78 at different ratios and dose (vg/cell: viral genomes per cell) analyzed one week post infection. B) Colony forming assay. 10,000 infected HeLa ce lls were seed into 100 mM dishes and selected with G418 for 2 weeks. Post selection the resistant colonies were stained and counted. The counts are shown only for the lower infected dose (100 vg/cell). Visually more colonies are seen at the 5:1 ratio at bo th doses. In addition, a colony forming assay was used to see if Rep co infection expression increases the nu mber of drug resistant colonies, suggestive of targeted integration (Figure 5 6 B). In agreement, a ratio of 5:1 provide d both an increase in colon y formation and a strong detectable junction product Moreover, increasing the dose of scAAV infection augmented both colony formation and junction formation. It is important to note that the increase in colony formation was not significant, suggesting tha t Rep does not increase the number of colony forming units. Overall, the results indicated that scAAV vectors are capable of integrating in HeLa cells and that the intrinsic integration machinery used to process ssAAV can also proce ss scAAV vector for int egration. The next objective was to quantitate the efficiency of scAAV integration in the M059J and M059K cells.

PAGE 79

79 Self Complementary Vectors Display E qual I ntegration in the P resence or A bsence of DNAPKcs Using the optimal 5:1 ratio M059J and M059K cells were infected with the scAAV vectors (dsP5Neo and dsSVRep78) at a total dose of 10^4 vg/cell to determine if DNAPKcs has a role in processing scAAV vectors for integration Infected cells were sel ected for 2 weeks with G418. Nineteen resistant colonies wer e expanded in the presence of continuous selection and used for genomic DNA isolation and southern hybridizations. Interestingly, more random integratio n took place with scAAV vectors than expected in both cell lines ; t he presence or absence of DNAPkcs did not affect the frequency of site specific integration (Figure 5 7 and Figure 5 8). Roughly 25% of clones, from both J and K cells, had scAAV integrated into AAVS1, with the other 75% ra ndomly integrated (Table 5 2). Again, it is important to note that 10 M059K and 7 M059J clones do not show detectable n eomycin. Since these clones were grown under continuous selection, these clones are presumably randomly integrated. Regardless, only 10 15% of scAAV vectors integrate site specifically in the presence or ab sence of DNAPK cs. Table 5 2. Summary of M059K and M059J self complementary infected clones analyzed by southern hybridizations. M059K Clones M059J Clones Number of clones disrupted for AAVS1: 4 5 Number of clone with detectable Neo: 9 12 Percentage of disrupted clones with Neo co linked 2/4 (50%) 3/5 (60%) AAVS1 specificity: 2/9 (22%) 3/12 (25%) Random: 7/9 (77%) 9/12 (75%) AAV AAVS1 Junction Formation is Not Inhibited in the Absence of Ligase I and Ligase IV An important aspect of integration is the stable joining of the exogenous DNA to the cellular DNA. These linkages are performed by cellular repair proteins called ligases. Two such

PAGE 80

80 Figure 5 7. Southern hybridization of M059J clones infecte d with dsP5 AAV Neo R and ds AAV SVRep78 (5:1 ratio 10^4 vg/cell). The left blots show signals for AAVS1 sequences and the right blots show signals for n eomycin. The arrows indicate the clones that had both AAVS1 and n eomycin signals co linked.

PAGE 81

81 Figure 5 8 Southern hybridization of M059K clones infecte d with dsP5 AAV Neo R and ds AAV SVRep78 (5:1 ratio, 10^4 vg/cell). The left blots show signals for AAVS1 sequences and th e right blots show signals for n eomycin. The arrows indicate the clones that had both AAVS1 and Neomycin signals co linked. band is detect ed. The samples are numbered. N represents a positive control plasmid which was used to determine specifici ty of the n eomycin probe.

PAGE 82

82 Figure 5 9. Time course of junction formation in Ligase I and Ligase IV. Both cells were infected with wild type AAV 2 at 10^5 vp/cell. Genomic DNA was isolated at the indicated time points for junction assay Figure 5 10. Southern hybridization of Ligase IV clones infected with P5 PGK Hygro GFP and pSVAV2 (50:1 ratio, 10^5 vg/cell). The left blots show signals for AAVS1 seq uences and the right blots show signals for hygromycin. The arr ows indicate the clones that have both AAVS1 and hygromycin signals co linked.

PAGE 83

83 ligases have been investigated for an effect on AAV AAVS1 junction formation. l igase I and l igase IV are involve d in repair by single stranded break repair and non homologous end joining respectively (see reviews: Caldecott et al., 2008 and Lieber et al., 2003). The respective ligase cells were infected with wild type AAV2 at 10^5 vp/cell. Junction formation was a ssessed from genomic DNA isolated form these cells 48 hrs, 96 hrs, 1 week and 2 weeks post infection. The results (Figure 5 9) clearly demonstrated that these proteins are not required for the final step of AAV integration the ligation of the AAV DNA to the AAVS1 cellular sequence (Figure 5 9). Interestingly, southern hybridization on Ligase IV clones demonstrated that only 20% of the clones display site specific integration (Figure 5 10). This suggests that in the absence of ligase IV the frequency of si te specific integration is greatly reduced supporting a role for ligase IV in the mechanism of AAV site specific integration. Discussion And Limitation Of S tudy My data seems to suggest a role for DNAPKcs in the stability of specifically integrated single stranded AAV vectors. First of all, a higher fraction M059K clones were not associated with specific integration as compared to M059J clones, suggesting that specific integration is less efficient in the presence of DNAPKcs. Secondly, DNAPKcs is known to be associated with Artemis, a cellular endonuclease, and it has been experimentally demonstrated that the DNAPKcs Artemis complex can cleave hairpin loops, flaps, and gaps (Ma et al., 2005). Therefore, it is likely that either during integration and/or aft er integration, the AAV ITRs are cleaved by DNAPKcs Artemis complex resulting in local chromosomal changes at the site of integration that may lead to integrant instability. This form of instability could explanation the observation by Cheung et al (1980) that more free AAV genomes (not integrated) were detected at late passage of an integrated clone (118 passages) compared to early passages (9 passages). An alternative possibility is that the integrated vector is spontaneously excised by intramolecular

PAGE 84

84 re combination of the vector ITR ends. Last of all, DNAPKcs processing of input AAV genome (i.e. concatemer formation and/or circularization) could limit integration to only a small fraction of input genomes which were not processed. In vivo processing of the AAV ITR hairpins by DNA repair proteins may be tissue and cell cycle dependent. In the absence of DNAPKcs and Artemis, AAV ITR processing is impaired in muscle, heart, and kidney, but not in the liver, where DNAPKcs independent processing took place (I nagaki et al., 2007). Furthermore, Song et al. (2004) noticed a greater percentage of transgene expression 5 weeks post hepatectomy in SCID liver (SCID mice lack DNAPKcs expression) compared to C56/BL6 liver. Together, this suggests that processing by DN AP Kcs affects maintenance of rAAV integration and expression after induction of cell proliferation. Muscle, heart, and kidney likely display different kinetics of processing and integration of rAAV The obser vation that self complementary vectors showed no difference in integration in the presence or absence of DNAPKcs is quite intriguing. It partially addresses the issue of whether the substrate for site specific integration is a single or double stranded mol ecule. Clearly, it suggests that hairpinned AAV vectors are much less efficient than single stranded AAV vectors. Plasmids containing AAV sequences integrate at higher efficiencies compared to scAAV vectors, but this is likely the result of the closed, cir cular nature of the plasmid. Interestingly, studies have failed to detect specific integration using linear double stranded (Dyall and Berns, unpublished) Taking into account these observations, it seems that in the context of AAV infection, double strand ed forms of AAV are inefficient substrates for site specific integration, though scAAV vectors are efficient substrates for random integration, the reason for which is unclear at the moment.

PAGE 85

85 It was also noticed that site specific integration was greatly r educed in the absence of ligase IV. Coupled with the observation that junction formation was not diminished in ligase IV defective cells, several conclusions can be made with regards to analysis of specific integration and the nature of the ligase defect o n integration. First of all, junction PCR is not an accurate assessment of specific integration, but just a qualitative one suggestive of integration into AAVS1; therefore, southern analysis of clones was used since it provided quantitative information wit h regard to frequency and specificity of integration. Secondly, although no difference in junction formation was seen between ligase I and ligase IV experiments, there may be vastly different frequencies of specific integration between the two. It is expec ted that specific integation should o ccur at normal frequency (~70% ) in ligase I defective cells, since ligase I is not involved in NHEJ. Lastly, the ligase IV data strongly indicates that ligase IV is necessary for AAV site specific integration, and ther efore suggests that NHEJ repair pathway is important in AAV specific integration. The observed 20% specific integration in ligase IV defective cells may be the results of the following: (i) residual activity of ligase IV due to the nature of ligase IV muta tion (Girard et al., 2004), and (ii) the ability of other ligases to participate in NHEJ mediated repair in the absence of ligase IV (Lieber et al., 2008). There seems to be a dynamic interaction between the AAV and cellular proteins which can greatly affe ct expression and integration. Future research should look for Rep interaction in the absence of adenovirus using a similar experimental approach as the one performed by Nash et al. (2007). The results from such a study could serve as a source for studying identified cellular proteins for effects on AAV site specific integration. Determining how the viral Rep protein the different AAV vectors and the cellular components interact upon infection or integration will be crucial for developing AAV vectors with the capacity to efficiently target the AAVS1 site and

PAGE 86

86 minimize risks associated with random integrations. These studies have implications for the optimal use of AAV vectors in both ex vivo and in vivo gene therapy modalities.

PAGE 87

87 CHAPTER 6 CONCLUSION Cell ular recombination proteins clearly must have a role in AAV site spe cific integration because AAV is largely dependent on host factors for all aspects of its life cycle. Analysis of AAV cellular junction sequences has revealed that the integration process is error prone, strongly su ggesting the involvement of non homologous end joining proteins and/or a short list of other repair proteins in integration. The viral requirements for targeting site specific integration have been elucidated, with Rep being the only viral trans factor required. The necessary cis components are the ITRs and the P5 integration efficiency element, both of which contain the RBE and TRS sequences. Data from my first research objectives have suggested that more studies are needed to understand how Rep functions to switch AAV towards latency, and to determine if Rep can function to minimize random integration. I have been able to isolate many AAV cellular junctions, but the limitation of the approaches used demands that alternative met hods be devised and exploited to help address this issue. My studies on the role of cellular repair proteins on AAV site specific integration have revealed some interesting features. Firstly, DNAPKcs is not required for specific integration of single stran ded Rep containing AAV vectors. Second of all, in its absence a greater frequency of site specific integration occurred, suggesting that DNAPKcs maybe effecting instability of the provirus after integration This is also partially supported by the observat ion that more AAV AAVS1 junction events were detected in the presence of DNAPKcs early post infection. Lastly, self complementary AAV vectors are capable of integration regardle ss of DNAPK cs, but interestingly, no difference was observed, suggesting that that DNAPKcs may function differentially in processing single stranded versus double stranded vectors. In addition, the

PAGE 88

88 freq uency of site specific integration was greatly reduced in the absence of ligase IV. Overall, these observations suggest that protei ns of the non homologous end joining pathway can modulate AAV site specific integration. Interestingly, pull down assays have identified numerous DNA repair proteins that interact with Rep including Ku70, Ku80, replication protein A, Rad 50, Poly ADP polym erase I, DNA dependent protein kinase (DNAPK), and proliferating cell nuclear antigen (PCNA) (Nash et al., 200 9 ). Ku70 and Ku 80 are important DNA e nd binding proteins in NHEJ which recruit DNAPKcs to phosphorylate other repair proteins. Recruitment and ac tivation of Rad50 as part of the Mre11/Rad50/NBS1 (MRN) complex can then serve to trim the DNA ends. T he interaction of PCNA with cellular polymerases can then fill in the gaps, which are then ligated. Interestingly, PARP 1 does not belong to NHEJ repair pa thway having a main role in single strand break repair (SSBR). Therefore, it remains to be determined if these proteins (i.e Ku70/80, PARP1, Rad50) as well as other repair proteins, which do not interact with Rep, have roles in integration by acting on th e AAV hairpins or the target chromosome 19 site. Whether by missing DNAPKcs means that other repairs pathway can now be engaged in repair mediated specific integration of AAV remains to be studied. Thus, i t is conceivable that the different cellular repa ir pathways are actively competing with each other for binding and processing of the AAV genome. Overall, the emerging picture is that DNA repair proteins may be sh unting the AAV genome towards alternative pathway s which link AAV expression and integration as competing aspects in the AAV life cycle. This is partially supported by the observations that the MRN complex binds to the AAV genomes and that knockdown of these proteins increase transduction (Cervelli et al., 2008; Schwartz et al., 2007) What coul d mediate the switch from expression to integration is unknown. Fragkos et al., have demonstrated that

PAGE 89

89 having the P5 sequence in a recombinant vector was able to trigger DNA damage signaling (Fragkos et al., 2008), suggesting that the P5 sequence signals D NA damage response, thus recruiting a host of cellular repair proteins. By systematically studying different cellular repair proteins for an effect on specific integration future work should be able to elucidate the mechanism AAV site specific integration or at least identify which cellular repair proteins are required. The outcome of such advancements should lead to an increase emphasis for t he development of AAV as an integrating vector that is safe for future gene therapy studies.

PAGE 90

90 APPENDIX VECTOR MAP S Single Stranded Recombinant AAV Vectors

PAGE 91

91 Self Complementary AAV Vectors Packaging Helper Plasmids

PAGE 92

92 REFERENCES Afione, S.A., Conrad, C.K., Kearns, W.G., Chunduru, S., Adams, R., Reynolds, T.C., Guggino, W.B., Cutting, G.R., Carte r, B.J., and Flotte, T.R. (1996). In vivo model of adeno associated virus vector persistence and rescue. J. Virol 70 3235 3241. Akache, B., Grimm, D., Pandey, K., Yant, S.R., Xu, H., and Kay, M.A. (2006). The 37/67 kilodalton laminin receptor is a recept or for adeno associated virus serotypes 8, 2, 3, and 9. J. Virol 80 9831 9836. Akache, B., Grimm, D., Shen, X., Fuess, S., Yant, S.R., Glazer, D.S., Park, J., and Kay, M.A. (2007). A two hybrid screen identifies cathepsins B and L as uncoating factors fo r adeno associated virus 2 and 8. Mol. Ther. 15 330 339. Amiss, T.J., McCarty, D.M., Skulimowski, A., and Samulski, R.J. (2003). Identification and characterization of an adeno associated virus integration site in CV 1 cells from African green monkey. J. Virol. 77 1904 1915. Apparailly, F., Khoury, M., Vervoodeldonk, M.J.B., Adriaansen, J., Gicquel, E., Perez, N., Riviere, C., Louis Plence, P., Noel, D., Danos, O., Douar, A.M., Tak, P.P., and Jorgensen, C. (2005). Adeno associated virus pseudotype 5 vecto r improves gene transfer in arthritic joints. Hum. Gene. Ther 16 426 434. Ashktorab, H., and Srivastava, A. (1989). Identification of a nuclear proteins that specifically interact with the adeno associated virus type 2 inverted terminal repeat hairpin DN A. J. Virol 63 3034 3039. Asokan, A., Hamra, J.B., Govindasamy, L., Agbandje McKenna, M., and Samulski, R.J. (2006). Adeno associated virus type 2 contains an integrin for viral cell entry. J. Virol. 80 8961 8969. Atchison, R.W., Casto, B.C., and Hammon, W.M. (1965). Adenovirus associated defective virus particles. Science 147 754 756. Bainbridge, J.W., Smith, A.J., Barker, S.S., Robbie, S., Henderson, R., Balaggan, K., Viswanathan, A., Holder, G.E., Stockman, A., Tyler, N., Petersen Jones, S., Bhattacharya, S.S., Thrasher, A.J., Fitzke, F.W., Carter, B.J., Rubin, G.S., Moore, A.T., and Ali, R.R. (2008). Effect of gene therapy on visual fu amaurosis. N. Engl. J. Med 358 2231 2239. Bantel Schaal, U., Hub, B., and Kartenbeck, J (2002). Endocytosis of adeno associated virus type 5 leads to accumulation of virus particles in the golgi compartment. J. Virol 76 23 40 2349. Bartlett, J.S., Wilcher, R., and Samulski, R.J. (2000). Infectious entry pathway of adeno associated virus and adeno associated virus vectors. J. Virol 74 2771 2785.

PAGE 93

93 Berns, K.I., Pinkerton, T.C., Thomas, G.F., and Hoggan, M.D. (1975). Detection of adeno associated virus (AAV) specific nucleotide sequences in DNA isolated from latently infected Detroit 6 cells. Virology 68 556 560. Blankinship, M., Gregorevic, P., Allen, J.M., Harper, S.Q., Harper, H., Halbert, C.L.,Miller, D.A., and Chamberlain J.S. (2004). Efficient transduction of skeletal muscle using vectors based on adeno associated virus serotype 6. Mol. Ther 10 671 678. Bleker, S., Pawlita, M., and Kleinschmidt, J.A. (2006). Impact of capsid conformation and rep capsid interactions on adeno associated virus type 2 genome packaging. J. Virol 80 810 820. Bleker, S., Sonntag, F., and Kleinschmidt, J.A. (2005). Mutational analysis of narrow pores at fivefold symmetry axes of adeno associated virus type 2 capsids reveal a dual role in gen ome packaging and activation of phospholipase A2 activity. J. Virol. 79 2528 2540. Booth, M.J., Mistry, A., Li, X., Thrasher, A., and Coffin, R.S. (2004). Transfection free and scalable recombinant AAV vector production using HSV/AAV hybrids. Gene. Ther 11 829 837. Brister, J.R., and Muzyczka, N. (2000). Mechanism of rep mediated adeno associated virus origin nicking. J. Virol 74 7762 7771. Buller, R.M.L., Janik, J.E., Sebring, E.D., and Rose, J.A. ( 1981 ) Herpes simplex virus type 1 and 2 completely h elp adenovirus associated virus replication. J. Virol. 40 241 247. Caldecott, K.W. (2008). Single strand break repair and genetic disease. Nat. Rev. Genet 9 619 631. Cavazzana Calvo, M., Hacein Bey, S., de Saint Basile, G., Gross, F., Yvon, E., Nusbaum, P,, Selz, F,, Hue, C,, Certain, S,, Casanova, J.L., Bousso, P., Deist, F.L., and Fischer, A. ( 2000 ) Gene therapy of human severe combined immunodeficiency (SCID) X1 disease. Science 288 669 672 Cervelli, T., Palacios, J.A., Zentilin, L., Mano, M., Schw artz, R.A., Weitzman, M.D., and Giacca, M. (2008). Processing of recombinant AAV genomes occurs in specific nuclear structures that overlap with foci of DNA damage response proteins. J. Cell Sci 121(Pt3) 349 357. C hao, H., Liu, Y., Rabinowitz, J.,Li, C., Samulski, R.J., and Walsh, C.E. (2000). Several log increases in therapeutic transgene delivery by distinct adeno associated viral serotype vectors. Mol. Ther. 2 619 623. Chen, S., Kapturczak, M., Loiler, S.A., Zolotukhin, S., Glushakova, O.Y., Madsen, K. M., Samulski, R.J., Hauswirth, W.W., Campbell Thompson, M., Berns, K.I., Flotte, T.R., Atkinson, M.A., Tisher, C.C., and Agarwal, A. (2005). Efficient transduction of vascular endothelial cells with recombinant adeno associated virus serotype 1 and 5 vecto rs. Hum Gen. Ther 16 235 247.

PAGE 94

94 Chejanovsky, N., and Carter, B.J. (1989). Mutagenesis of an AUG codon in adeno associated virus rep gene: effects on viral replication. Virology 173 120 128. Cheung, A.K.M., Hoggan, M.D., Hauswirth, W.W., and Berns, K.I. (1980). Integration of the adeno associated virus genome into cellular DNA latently infected human Detroit 6 cells. J. Virol. 33 739 748. Chiorini, J.A., Weitzman, M.D., Owens, R.A., Urecelay, E., Safer, B., and Kotin, R.M. (1994). Biologically active rep proteins of adeno associated virus type 2 produced as fusion proteins in Es cherichia coli J. Virol 68 797 804. Choi, V.W., McCarty, D.M., and Samulski, R.J. (2006). Host cell DNA repair pathways in adeno associated viral genome processing. J. Virol 80 10346 10356. Choi V.W., Samuski, R.J., and McCarty, D.M. (2005). Effects of adeno associated virus DNA hairpin structure on recombination. J. Virol. 79 6801 6807. Costello, E., Saudan, P., Winocour, E., Pizer, L., and Beard, P. (1997). High mobility g roup chromosomal protein 1 binds to the adeno associated virus replication protein (Rep) and promotes rep mediated site specific cleavage of DNA, ATPase activity and transcriptional repression. EMBO J 16 5943 5954. Davidoff, A.M., Gray, J.T., Ng, C.Y., Zhang, Y., Zhou, J., Spence, Y., Bakar, Y., and Nathwani, A.C .(2004). Comparison of the ability of adeno associated viral vectors pseudotyped with serotypes 2, 5, and 8 capsid proteins to mediate efficient transduction of the liver in murine and nonhuman p rimate models. Mol. Ther 11 875 888. Douar, A.M., Poulard, K., Stockholm, D., and Danos, O. (2001). Intracellular trafficking of adeno associated virus vectors: routing of the late endosomal compartment and proteasome degradation. J. Virol. 75 1824 1833 Drew, H.R., Lockett, L.J., and Both, G.W (2007). Increased complexity of wild type adeno associated virus chromosomal junctions as determined by analysis of unselected cellular genomes. J. Gen. Virol 88 1722 1732. Duan, D., Li, Q., Kao, A.W., Yue, Y., Pessin, J.E., and Engelhardt, J.F. (1999). Dynamin is required for recombinant adeno associated virus type 2 infection. J. Virol. 73 10371 10376. Duan, D., Sharma, P., Yang, J., Yue, Y., Dudus, L., Zhang, Y., Fisher K.J., and Engelhardt, J.F (1998). Cir cular intermediates of recombinant adeno associated virus have defined structural characteristics responsible for long term episomal persistence in muscle tissue. J. Virol. 72 8568 8577. Duan, D., Yue, Y., and Engelhardt, J.F. (2003). Consequences of DNA dependent protein kinase catalytic subunit deficiency on recombinant adeno associated virus genome circularization and heterodimerization in muscle tissue. J. Virol. 77, 4751 4759.

PAGE 95

95 Dubielzig, R., King, J.A., Weger, S., Kern, A., and Kleinschmidt, J.A. (199 9). Adeno associated virus type 2 protein interactions: formation of pre encapsidation complexes. J Virol 73 8989 8998. Duthe i l, N., Shi, F., Dupressoir, T., and Linden, R.M (2000). Adeno associated virus site specifically integrates into a muscle spec ific DNA region Proc. Natl. Acad. Sci. USA 97 4862 4866. Dutheil, N., Yoon Roberts, M., Ward, P., Henckaerts, E., Skrabanek, L., Berns, K.I., Campagne, F., and Linden, R.M. (2004). Characterization of the mouse adeno associated virus AAVS1 ortholog. J. Virol 78 8917 8921. Dyall, J., Szabo, P., and Berns, K.I. (1999 ). Adeno associated virus (AAV) site specific integration: formation of AAV AAVS1 junctions in an in vitro system. Proc. Natl. Acad. Sci. USA. 96 12849 12854. Feng, D., Chen, J., Yue, Y., Z hu, H., Xue, J., and Jia, W. W (2006). A 16 bp rep binding element is sufficient for mediating rep dependent integration into AAVS1. J Mol Biol. 358 38 45 Ferrari, F.K., Samulski, T., Shenk, T., and Samulski, R.J. (1996). Second strand synthesis is a rat e limiting step for efficient transduction by recombinant adeno associated virus vectors. J. Virol 70 3227 3234. Fragkos, M., Breuleux, M., Clement, N., and Beard, P. (2008). Recombinant adeno associated viral vectors are deficient in provoking a DNA dam age response. J. Virol. 82 7379 7387. Gao, G.P., Alvira, M.R., Wang, L., Clacedo, R., Johnston, J., and Wilson, J.M. (2002). Novel adeno associated viruses from rhesus monkey as vectors for human gene therapy. Proc. Natl. Acad. Sci. USA 99 11854 11859. Gao, G.P., Vandenberghe, L.H., Alvira, M.R., Lu, Y., Calcedo, R., Xhou, X., and Wilson, J.M. (2004). Clades of adeno associated viruses are widely disseminated in human tissues. J. Virol 78 6381 6388. Geoffrey, M.C., Epstein, A.L., Toublanc, E., Moullier P., and Salvetti, A. (2004). Herpes simplex virus type 1 ICP0 protein mediates activation of adeno associated virus type 2 rep gene expression from a latent integrated from. J. Virol. 78 10977 10986. Ghosh, A., Yue, Y., and Duan D. (2006). Viral seroty pe and transgene sequence overlapping adeno associated virus (AAV) vector mediated gene transfer in skeletal muscle. J. Gen. Med. 8 298 305. Ghosh, A., Yue, Y, and Lai, Y., and Duan, D. (2008). A hybrid vector system expands adeno associated viral vector packaging capacity in a transgene independent manner. Mol. Ther. 16 124 130.

PAGE 96

96 Girard, P M., Kysela, B., Harer, C.J., Doherty, A.J., and Jeggo, P.A. (2004). Analysis of DNA ligase IV mutations found in LIG4 syndrome patients: the impact of two linked polymo rphisms. Hum. Mol. Genet 13 2369 2376. Giraud, C., Winocour, E., and Berns, K.I. (1994). Site specific integration by adeno associated virus is directed by a cellular DNA sequence. Proc. Natl. Acad. Sci. USA. 91 10039 10043. Girod, A., Wobus, C.E., Zado ri, Z., Ried, M., Leike, K., Tijssen, P., Kleinschmidt, J.A., and Hallek, M. (2002). The VP1 capsid protein of adeno associated virus type 2 is carrying a phospholipase A2 domain required for virus infectivity. J. Gen. Virol. 83 973 978. Grieger, J.C., Sn owdy, S., and Samulski, R.J (2006). Separate basic regions motifs within the adeno associated virus capsid proteins are essential for infectivity and assembly. J. Virol 80 5199 5210. Grimm, D., Kay, M.A., and Kleinschmidt, J.A. (2003). Helpervirus free, optically controllable, and two plasmid basedproduction of adeno associated virus vectors of serotypes 1 to 6. Mol Ther 7 839 850. Hacein Bey Abina, S., Garrigue, A., Wang, G.P., Soulier, J., Lim, A., Morillon, E., Clappier, E., Caccavelli, L., Delabess e, E., Beldjord, K., Asnafi, V., MacIntyre, E,, Dal Cortivo, L., Radford, I., Brousse, N., Sigaux, F., Moshous, D., Hauer, J., Borkhardt, A., Belohradsky, B.H., Wintergerst, U., Velez, M.C., Leiva, L., Sorensen, R., Wulffraat, N., Blanche, S., Bushman, F.D ., Fischer, A., and Cavazzana Calvo, M.. (2008). Insertional oncogenesis in 4 patients after retrovirus mediated gene therapy of SCID X1. J. Clin. Invest. 118 3132 3142. Handa, A., Muramatsu, S., Qiu, J., Mizukami, H., and Brown, K.E. (2000). Adeno associ ated virus (AAV) 3 based vectors transducer haematopoietic cells not susceptible to transduction with AAV 2 based vectors. J. Gen. Virol. 81 2077 2084. Hansen, J., Qing, K., and Srivastava, A (2001). Infection of purified nuclei by adeno associated virus 2. Mol. Ther. 4 289 296. Hauswirth, W.W., Aleman, T.S., Kaushal, S., Cideciyan, A.V., Schwartz, S.B., Wang, L., Conlon, T.J., Boye, S.L., Flotte, T.R., Byrne, B.J., and Jacobson, S.G. (2008). Treatment of Leber Congenital Amaurosis Due to RPE65 Mutations by Ocular Subretinal Injectionof Adeno Associated Virus Gene Vector: Short Term Results of a Phase I Trial. Hum. Gene. Ther. 19 979 990. Henckaerts, E., Dutheil, N., Zeltner, N., Kattman, S., Kohlbrenner, E., Ward, P., Clement, N., Rebollo, P., Kennedy, M., Keller, G.M., and Linden, R.M. (2009). Site specific integration of adeno associated virus involves partial duplication of the target locus. (in press).

PAGE 97

97 Hermonat, P.L., and Muzyczka, N. ( 1984 ) .Use of adeno associated virus as a mammalian DNAcloning vec tor: transduction of neomycin resistance into mammalian tissue cultured cells. Proc Natl Acad Sci USA 81 6466 6470. Hirosue, S., Senn, K., Clment, N., Nonnenmacher, M., Gigout, L., Linden, R.M., and Weber, T. (2007). Effect of inhibition of dynein funct ion and microtubule altering drugs on AAV2 transduction. Virology. 367 10 18. Hoggan, M.D., Blacklow, N.R., and Rowe, W.P (1966). Studies of small DNA viruses found in various adenovirus preparations: physical, biological, and immunological characteristi cs. Proc. Natl. Acad Sci, USA 55 1467 1474. Hoggan, M.D., Shatkin, A.J., Blacklow, N. R., Koczot, F., and Rose, J.A. (1968). Helper dependent infectious deoxyribonucleic acid from adenovirus associated virus. J. Virol 2 850 851. Huser, D., Weger, S., a nd Heilbronn, R. (2002). Kinetics and frequency of adeno associated virus site specific integration into human chromosome 19 monitored by quantitative real time PCR. J. Virol. 76 7554 7559. Inagaki, K., Fuess, S., Storm, T.A., Gibson, G.A., McTiernan, C.F ., Kay, M.A., and Nakai, H. (2006). Robust systemic transduction with AAV9 vectors in mice: efficient global cardiac gene transfer superior to that of AAV8. Mol. Ther 14 45 53. Inagaki, K., Lewis, S.M., Wu, X., Ma, C., Munroe, D.J., Fuess, S., Storm, T.A ., Kay, M.A., and Nakai, H. (2007). DNA palindromes with modest arm length of greater, similar 20 base pairs are a significant target for recombinant adeno associated virus vector integration in the liver, muscles, and heart in mice. J. Virol. 81 11290 11 303. Inagaki, K., Ma, C., Storm, T.A., Kay, M.A., and Nakai, H. (2007). The role of DNA PKcs and artemis in opening viral DNA hairpin termini in various tissues in mice. J. Virol. 81 11304 11321. Inagaki, K., Piao, C., Kotchey, N.M., Wu, X., and Nakai, H (2008). Frequency and spectrum of genomic integration of recombinant adeno associated virus serotype 8 vector in neonatal mouse liver. J. Virol. 82 9513 9524. Janik, J.E., Huston, M.M., and Rose, J.A. (1981). Locations of adenovirus genes required for th e replication of adenovirus associated virus. Proc. Natl. Acad. Sci. USA. 78 1925 1929. Johnson, J.S., and Samulski, R.J. (2009). Enhancement of AAV interaction by mobilizing capsids into and out of the nucleolus. J. Virol 83, 2632 2644. Jurvansuu, J., R aj, K., Stasiak, A., and Beard, P. (2005). Viral transport of DNA damage that mimics a stalled replication fork. J. Virol. 79 569 580.

PAGE 98

98 Kaludov, N., Brown, K.E., Walters, R.W., Zabner, J., and Chiorini, J.A. (2001). Adeno associated virus serotype 4 (AAV 4 ) and AAV5 both require sialic acid for hemagglutination and efficient transduction but differ in sialic acid linkage specificity. J. Virol. 75 6884 6893. Kashiwakura, Y., Tamayose, K., Iwabuchi, K., Hirai, Y., Shimada, T., Matsumoto, K., Toshikazu, N., W atanabe, M., Oshimi, K., and Daida, H. (2005). Hepatocyte growth factor receptor is a coreceptor for adeno associated virus type 2 infection. J. Virol. 79 609 614. Kearns, W.G., Afione, S.A., Fulmer, S.B., Pang, M.C., Erickson, D., Egan, M., Landrum, M.J. Flotte, T.R., and Cutting, G.R. (1996). Recombinant adeno associated virus (AAV CFTR) vectors do not integrate in a site specific fashion in an immortalized epithelial cell line. Gene Ther 3 748 755. King, J.A., Dubielzig, R., Grimm, D., and Kleinschmi dt, J.A. (2001). DNA helicase mediated packaging of adeno associated virus type 2 genomes into preformed capsids. Embo J. 20 3282 3291. Kotin, R.M., Linden, R.M., and Berns, K.I. (1992). Characterization of a preferred site on human chromosome 19q for int egration of adeno associated virus DNA by non homologous recombination. Embo J 11 5071 5078. Kotin, R.M., Siniscalco, M., Samulski, R.J., Zhu, X., Hunter, L., Laughlin, C.A., McLaughlin, S., Muzyczka, N., Roccchi, M., and Berns, K.I. (1990). Site specifi c integration by adeno associated virus. Proc. Natl. Acad. Sci. USA. 87 2211 2215. Kysti, S.R.M., Wonderling, R.S., and Owens, R.A. (1995). Negative regulation of the adeno associated virus (AAV) P5 promoter involves both the P5 rep binding site and the consensus ATP binding motif of the AAV Rep68 protein. J. Virol 69 6787 6796. Lackner, D.F., and Muzyczka, N. (2002). Studies of the mechanism of transactivation of the adeno associated virus p19 promoter by Rep protein. J. Virol 76 8225 8235. Lamartin a, S., Sporeno, E., Fattori, E., and Toniatti, C. (2000). Characteristics of the adeno associated virus preintegration site in human chromosome 19: open chromatin conformation and transcription competent environment. J. Virol 74 7671 7677. Lieber, M.R. ( 2008). The mechanism of human nonhomologous DNA end joining. J. Biol. Chem. 283 1 5. Lieber, M.R., Ma, Y., Pannicke, U., and Schwarz, K. (2003). Mechanism and regulation of human non homologous DNA end joining. Nat. Rev. Mol. Cell Biol 4 712 720. Li, J. Samulski, R.J., and Xiao, X. (1997). Role for highly regulated rep gene expression in adeno associated virus vector production. J. Virol. 71 5236 5243.

PAGE 99

99 Li, Z., Brister, J.R., Im, D.S., and Muzyczka, N (2003). Characterization of the adeno associated vi rus rep protein complex formed on the viral origin of replication. Virology 313 364 376. Linden, R.M., Winocour, E., and Berns, K.I. (1996). The recombination signals for adeno associated virus site specific integration. Proc. Natl. Acad. Sci. USA. 93 7 966 7972. Liu, X., Luo, M., Zhang,L.N., Yan, Z., Zak, R., Ding, W., Mansfield, S.G., Mitchell, L.G., and Engelhardt, J.F. (2005). Spliceosome mediated RNA trans splicing with recombinant adeno associated virus partially restores cystic fibrosis transmembra ne conductance regulator function to polarized human cystic fibrosis airway epithelial cells. Hum. Gene Ther. 16 1116 1123. Louboutin, J.P., Wang, L., and Wilson, J.M. (2005). Gene transfer into skeletal muscle using using novel AAV serotypes. J. Gene Med 7 442 451. Lux, K., Goerlitz, N., Schlemminger, S., Perabo, L., Goldnaw, D., Endell, J., Leike, K., Kofler, D.M., Finke, S., Hallek, M., and Bning, H. (2005). Green fluorescent protein tagged adeno associated virus particles allow the study of cytosol ic and nuclear trafficking. J. Virol. 79 11776 11787. Ma, Y., Schwarz, K., and Lieber, M.R. (2005). The Artemis:DNA PKcs endonuclease cleaves DNA loops, flaps, and gaps. DNA Repair (Amst). 4 845 851. Maguire, A.M., Simonelli, F., Pierce, E.A., Pugh, E.N. Jr,, Mingozzi, F., Bennicelli, J., Banfi, S., Marshall, K.A., Testa, F., Surace, E.M., Rossi, S., Lyubarsky, A., Arruda, V.R., Konkle, B., Stone, E., Sun, J., Jacobs, J., Dell'Osso, L., Hertle, R., Ma, J.X., Redmond, T.M., Zhu, X., Hauck, B., Zelenaia, O. Shindler, K.S., Maguire, M.G., Wright, J.F., Volpe, N.J., McDonnell, J.W., Auricchio, A., High, K.A., and Bennett, J. (2008). N Engl J Med. 358 2240 2248. Mah, C., Qing, K., Khuntira t, B., Ponnazhagan, S. Wang, X.S., Kube, D.M., Yoder, M.C., and Srivastava, A. (1998). Adeno associated virus type 2 mediated gene transfer: role of epidermal growth factor receptor protein tyrosine kinase in transgene expression. J. Virol 72 9835 9843. Manno, C.S., Pierce, G.F., Arruda, R., Glader, B., Ragni, M., Rasko, J.J., Ozelo, M.C., Hoots, K., Blatt, P., Konkle, B., Dake, M., Kaye, R., Razavi, M., Zajko, A., Zehnder, J., Rustagi, P.K., Nakai, H., Chew, A., Leonard, D., Wright, J.F., Lessard, R.R., Sommer, J.M., Tigges, M., Sabatino, B., Luk, A., Jiang, H., Mingossi, F., Couto, L., Ertl, H.C., High, K.A., and Kay, M.A. ( 2006 ) Successful transduction of liver in hemophilia by AAV factor IX and limitations imposed by the host immune response. Nat. Med 12 342 347. Mayor, H.D., Torikai, K., Melnick, J.L., and Mandel, M. (1969). Plus and minus single stranded DNA separately encapsidated in adeno associated satellite virions. Science. 166 1280 1282.

PAGE 100

100 McCarty, D.M., Fu, H., Monahan, P.E., Toulson, C.E., N aik, P., and Samulski, R.J. (2003). Adeno associated virus terminal repeat (TR) mutants generate self complementary vectors to overcome the rate limiting step to transduction in vivo. Gene. Ther 10 2112 2118. McCarty, D.M., Monahan, P.E., and Samulski, R .J. (2001). Self complementary recombinant adeno associated virus (scAAV) vectors promote efficient transduction independently of DNA synthesis. Gene Ther 16 1248 1254. McLaughlin, S.K., Collis, P., Hermonat, P.L., and Muzyczka, N. (1988). Adeno associat ed virus general transduction vectors: analysis of proviral structures. J. Virol. 62 1963 1973. Mehrle, S., Rohde, V., and Schlehofer, J.R. (2004). Evidence of chromosomal integration of AAV DNA in human testis tissue. Virus Genes. 28 61 69. Melnick, J.L ., Mayor, H.D., Smith, K.O., and Rapp, F. (1965). Association of 20 millimicron particles with adenovirus. J. Bacteriol 90 271 274. Meneses, P., Berns, K.I., and Winocour, E. (2000). DNA sequence motifs which direct adeno associated virus site specific i ntegration in a model system. J. Virol. 74 6213 6216. Merten, O W., Geny Fiamma, C., and Douar, A.M. (2005). Current issues in adeno associated viral vector production. Gene. Ther 12 S51 S61. Miller, D.G., Trobridge, G.D., Petek, L.M., Jacobs, M.A., Kau l, R., and Russell, D.W. (2005). Large scale analysis of adeno associated virus vector integration sites in normal human cells. J. Virol. 79 11434 11442. Mingozzi, F., Maus, M.V., Hui, D.J., Sabatino, D.E., Murphy, S.L., Rasko, J.E., Ragni, M.V., Manno, C .S., Sommerm J., Jiang, H., Pierce, G.F., Ertl, H.C., and High, K.A. (2007). CD8 (+) T cell responses to adeno associated virus capsids in humans. Nat. Med 13 419 422. Mishra, L., and Rose, J.A. (1990). Adeno associated virus DNA replication is induced b y genes that are essential for HSV 1 DNA synthesis. Virology. 179 632 639. Murphy, M., Gomos Klein, J., Stankic, M., and Falck Pedersen, E. (2007). Adeno associated virus type 2 p5 promoter: a rep regulated DNA switch element functioning in transcription, replication, and site specific integration. J. Virol. 81 3721 3730. Nakai, H., Fuess, S., Storm, T.A., Meuse, L.A., and Kay, M.A. (2003). Free DNA ends are essential for concatemerization of synthetic double stranded adeno associated virus vector genomes transfected into mouse hepatocytes in vivo. Mol. Ther. 7 112 121. Nakai, H., Fuess, S., Storm, T.A, Muramatsu, S., Nara, Y., and Kay, M.A. (2005). Unrestricted hepatocyte transduction with adeno associated virus serotype 8 vectors I mice. J. Virol 79 2 14 224.

PAGE 101

101 Nakai, H., Yuichi, I., Kay, M.A., and Couto, L.B (1999). Isolation of recombinant adeno associated virus vector cellular DNA junctions from mouse liver. J. Virol 73 5438 5447. Nash, K., Chen, W., McDonald, W.F., Zhou, X., and Muzyczka, N. (2007) Purification of host cells enzymes involved in adeno associated virus DNA replication. J. Virol. 81 5777 5787. Nash, K., Chen, W., and Muzyczka, N. (2008). Complete in vitro reconstitution of adeno associated virus DNA replication requires mini chromoso me maintenance complex proteins. J. Virol 82 1458 1464. Nash, K., Chen, W., Salganik, M., and Muzyczka, N (2009). Identification of cellular proteins that interact with the adeno associated virus rep protein. J. Virol 83 454 469. Ogata, T., Kozuka, T. and Kanda, T. (2003). Identification of an insulator in AAVS1, a preferred region for integration of adeno associated virus DNA. J. Virol. 77 9000 9007. Opie, S.R., Warrington Jr., K.H., Agbandje McKenna, M., Zolotukhin, S., and Muzyczka, N (2003). Ide ntification of amino acid residues in the capsid proteins of adeno associated virus type 2 that contribute to heparan sulfate proteoglycan binding. J. Virol 77 6995 7006. Pacak, C.A., Mah, C.S., Thattaliyath, B.D., Conlon, T.J., Lewis, M.A., Cloutier, D. E., Zoltukhin, I., Tarantal, A.F., and Byrne, B.J. (2006). Recombinant adeno associated virus serotype 9 leads to preferential cardiac transduction in vivo. Circ. Res. 99 e3 e9. Pasquale, G.D., Davidson, B.L., Stein, C.S., Martins, I., Scudiero, D., Monks A., and Chiorini, J.A. (2003). Identification of PDGFR as a receptor for AAV 5 transduction. Nat. Med. 9 1306 1312. Philpott, N.J., Gomos, J., Berns, K.I., and Falck Pedersen, E. (2002). A p5 integration efficiency element mediates rep dependent integra tion into AAVS1 at chromosome 19. Proc. Natl. Acad. Sci. USA 99 12381 12385. Philpott, N.J., Gomos, J., and Falck Pedersen, E. (2004). Transgene expression after rep mediated site specific integration into chromosome 19. Hum. Gene. Ther 15 47 61. Ponn az hagan, S., Erikson, D., Kearns, W.G., Zhou, S.Z., Nahreini, P., Wang, X.S., and Srivastava, A. (1997). Lack of site specific integration of the recombinant adeno associated virus 2 genomes in human cells. Hum. Gene. Ther. 8 275 284. Prasad, K.M.R., and Trempe, J.P. (1995). The adeno associated virus Rep78 protein is covalently linked to viral DNA in preformed virions. Virology. 214 360 370. Qing, K., Hansen, J., Weigel Kelley, K.A., Tan, M., Zhou, S., and Srivastava, A. (2001). Adeno associated virus t ype 2 mediated gene transfer: role of cellular FKBP52 protein in transgene expression. J. Virol 75 8968 8976.

PAGE 102

102 Qing, K., Li, W., Zhong, L., Tan, M., Hansen, J., Weigel Kelley, K.A., Chen, L., Yoder, M.C., and Srivastava, A (2003). Adeno associated virus type 2 mediated gene transfer: role of cellular T cell protein tyrosine phosphatase in transgene expression in established cell lines in vitro and and transgenic mice in vivo. J. Virol. 77 2741 2746. Qing, K., Mah, C., Hansen, J., Zhou, S., Dwarki, V., an d Srivastava, A. (1999). Human fibroblast growth factor receptor 1 is a co receptor for infection by adeno associated virus 2. Nat. Med. 5 71 77. Rabinowitz, J.E., Rolling, F., Li, C., Conrath, H., Xiao, W., Xiao, X., and Samulski, R.J. (2002). Cross pack aging of a single adeno associated virus (AAV) type 2 vector genome into multiple AAV serotypes enables transduction with broad specificity. J. Virol 76 791 801. Raper, S.E., Chirmule, N., Lee, F.S., Wivel, N.A., Bagg, A., Gao, G.P., Wilson, J.M., and B atshaw, M.L. (2003). Fatal systemic inflammatory response syndrome in a ornithine transcarbamylase deficient patient following adenoviral gene transfer. Mol Genet Metab 80 148 158. Raper, S.E., Yudkoff, M., Chirmule, N., Gao, G.P., Nunes, F., Haskal, Z.J ., Furth, E.E., Propert, K.J., Robinson, M.B., Magosin, S., Simoes, H., Speicher, L., Hughes, J., Tazelaar, J., Wivel, N.A., Wilson, J.M., and Batshaw, M.L. (2002). A pilot study of in vivo liver directed gene transfer with an adenoviral vector in partial ornithine transcarbamylase deficiency. Hum. Gene Ther. 13 163 175. Reich, S.J., Auricchio, A., Hildinger, M., Glover, E., Maguire, A.M., Wilson, J.M., and Bennett, J. (2003). Efficient trans splicing in the retina expands the utility of adeno associated virus as a vector for gene therapy. Hum. Gene Ther 14 37 44. Ren, C., White, A.F., and Ponnazhagan, S. (2007). Notch1 augments intracellular trafficking of adeno associated virus type 2. J. Virol. 81 2069 2073. Rose, J.A, Berns, K.I., and Hoggan, M.D., and Koczot, F.J. (1969). Evidence for single stranded adenovirus associated virus genome: formation of DNA density hybrid on release of viral DNA. Proc. Natl. Acad. Sci. USA. 64 863 869. Salvetti, A., Oreve, S., Chadeuf, G., Favre, D., Cherel, Y., Champio n Arnaud, P., David Ameline, J., and Moullier, P. (1998). Factors influencing recombinant adeno associated virus production. Hum Gene Ther. 9 695 706. Samulski, R.J., Zhu, X., Xiao, X., Brook, J.D., Housman, D.E., Epstein, N., and Hunter, L.A (1991). Tar geted integration of adeno associated virus (AAV) into human chromosome 19. Embo J. 10 3941 3950. Sanlioglu, S., Benson, P.K., and Engelhardt, J.F. ( 2000). Loss of ATM function enhances recombinant adeno associated virus transduction and integration throu gh pathways similar to UV irradiation. Virology 268 68 78.

PAGE 103

103 Sanlioglu, S., Benson, P.K., Yang, J., Atkinson, E.M., Reynolds, T., and Engelhardt, J.F. (2000). Endocytosis and nuclear trafficking of adeno associated virus type 2 are controlled by Rac1 and p hosphatidylinositol 3 kinase activation. J. Virol. 74 9184 9196. Schnepp, B.C., Clark, K.R., Klemanski, D.L., Pacak, C.A., and Johnson, P.R. (2003). Genetic fate of recombinant adeno associated virus vector genomes in muscle. J. Virol 77 3495 3504. Schn epp, B.C., Jensen, R.L., Chen, C.L., Johnson, P.R., and Clark, K.R. (2005). Characterization of adeno associated virus genomes isolated from human tissues. J. Virol 79 14793 14803. Schnepp, B.C., Jensen, R.L., Clark, K.R., and Johnson, P.R. (2009). Infec tious molecular clones of adeno associated virus isolated directly from human tissues. J. Virol 83 1456 1464. Schwartz, R.A., Palacios, J.A., Cassell, G.D., Adam, S., Giacca, M., and Weitzman, M.D. (2007). The Mre11/Rad50/Nbs1 complex limits adeno associ ated virus transduction and replication. J. Virol. 81 12936 12945. Seisenberger, G., Ried, M.U., Endre, T., Bning, H., Hallek, M., and Bruchle, C. (2001). Real time single molecule imaging of the infectious pathway of an adeno associated virus. Science 294 1929 1932. Snyder, R.O., Im, D.S., Ni, T., Xiao, X., Samulski, R.J., and Muzyczka, N (1993). Features of the adeno associated virus origin involved in substrate recognition by the viral rep protein. J. Virol. 67 6096 6104. Sollerbrant, K., Elmen, J., Wahlestedt, C., Acker, J. Leblois Prehaud, H., Latta Mahieu, M., Yeh, P., and Perricaudet, M. (2001). A novel method using baculovirus mediated gene transfer for production of recombinant adeno associated virus vectors. J. Gen. Virol. 82 2051 2060. So ng, S., Lu, Y., Choi, Y.K., Han, Y., Tang, Q., Zhao, G., Berns, K.I., and Flotte, T.R. (2004). DNA dependent PK inhibits adeno associated virus DNA integration. Proc. Nat. Acad. Sci. USA. 101 2112 2116. Srivastava, A., Lusby, E.W., and Berns, K.I ( 1983 ). Nucleotide sequence and organization of the adeno associated virus 2 genome. J. Virol 45 555 564. Summerford, C., Bartlett, J.S., and Samulski, R.J. (1999). receptor for adeno associated virus type 2 infection. Nat. Med 5 78 82. Su mmerford, C., and Samulski, R.J. (1998). Membrane associated heparan sulfate proteoglycan is a receptor for adeno associated virus type 2 virions. J. Virol. 72 1438 1445.

PAGE 104

104 Surosky, R.T., Urabe, M., Godwin, S.G., McQuiston, S.A., Kurtzman, G.J., Ozawa, K., and Natsoulis, G. (1997). Adeno associated virus rep proteins target DNA sequences to a unique locus in the human genome. J. Virol. 71 7951 7959. Tamayose, K., Hirai, Y., and Shimada, T. (1996). A new strategy for large scale preparation of high titer rec ombinant adeno associated virus vectors by using packaging cell lines and sulfonated cellulose column chromatography. Hum. Gen. Ther. 7 504 513. Tan, I., Ng, C.H., Lim, L., and Leung, T. (2001). Phosphorylation of a novel myosin binding subunit of protein phosphatase 1 reveals a conserved mechanism in the regulation of actin cytoskeleton. J. Biol. Chem. 276 21209 2126. Ur celay, E., Ward, P., Wiener,S.M., Safer, B., and Kotin, R.M. (1995). Asymmetric replication in vitro from a human sequence element is de pendent on adeno associated virus rep protein. J. Virol 69 2038 2046. Vincent Lacaze, N., Snyder, R.O., Gluzman, R., Bohl, D., Lagarde, C., and Danos, O. (1999). Structure of adeno associated virus vector DNA following transduction of the skeletal muscle J. Virol. 73 1949 1955. Wang, C., Wang, C.M., Clark, K.R., and Sferra, T.J. (2003). Recombinant AAV serotype 1 transduction efficiency and tropism in the murine brain. Gene. Ther. 10 1528 1534. Wang, J., Xie, J., Lu, H., Chen, L., Hauck, B., Samulski, R.J., and Xiao, W. (2007). Existence of transient functional double stranded DNA intermediates during recombinant AAV transduction. Proc. Natl. Acad. Sci. USA. 104 13104 13109. Wang, X.S, Qing, K., Ponnazhagan, S., and Srivastava, A (1997). Adeno associ ated virus type 2 DNA replication in vivo: mutation analyses of the D sequence in viral inverted terminal repeats. J. Virol. 71 3077 3082. Wang, Z., Zhu, T., Qiao, C., Zhou, L., Wang, B., Zhang, J., Chen, C., Li, J., and Xiao, X. (2005). Adeno associated virus serotype 8 efficiently delivers genes to muscle and heart. Nat. Biotechnol. 23 321 328. Ward, P., Falkenberg, M., Elias, P., Weitzman, M.D., and Linden, R.M. (2001). Rep dependent initiation of adeno associated virus type 2 DNA replication by a herp es simplex virus type 1 replication complex in a reconstituted system. J. Virol. 75 10250 10258. Weger, S., Wendland, M., Kleinschmidt, J.A, and Heilbronn, R. (1999). The adeno associated virus type 2 regulatory proteins Rep78 and Rep68 interact with the transcriptional coactivator PC4. J. Virol 73 260 269. Weindler, F.W., and Heilbronn, R. (1991). A subset of herpes simplex virus replication genes provides helper functions for productive adeno associated virus replication. J. Virol 65 2476 2483.

PAGE 105

105 Weitz man, M.D., Kysti, S.R.M., Kotin, R.M., and Owens, R.A. (1994). Adeno associated virus (AAV) rep proteins mediate complex formation between AAV DNA and its integration site in human DNA. Proc. Natl. Acad. Sci. USA. 91 5808 5812. Wistuba, A., Weger, S., K ern, A., and Kleinschmidt, J.A. (1995). Intermediates of adeno associated virus type 2 assembly: identification of soluble complexes containing rep and cap proteins. J. Virol 69 5311 5319. Wonderling, R.S., and Owens, R.A. (1997). Binding sites for adeno associated virus Rep proteins within the human genome. J. Virol. 71 2528 2534. Wu, Z., Asokan A., Grieger, J.C., Govindasamy, L., Agbandje McKenna, and Samulski, R.J. (2006). Single amino acid changes can influence titer, heparin binding, and tissue trop ism in different adeno associated virus serotypes. J. Virol 80 11393 11397. Wu, J., Zhao, W., Zhong, L., Han, Z., Li, B., Ma, W., Weigel Kelley, K.A., Warrington, K.H., and Srivastava, A (2007). Self complementary recombinant adeno associated viral vect ors: packaging capacity and the role of the rep proteins in vector purity. Hum. Gene Ther. 18 171 182. Xiao, X., Li, J., and Samulski, R.J. ( 1998 ) Production of high titer recombinant adeno associated virus vectors in the absence of helper adenovirus. J Virol. 72 2224 2232. Xiao, W., Warrington Jr, K.H., Hearing, P., Hughes, J., and Muzyczka, N. (2002). Adenovirus facilitated nuclear translocation of adeno associated virus type 2. J. Virol. 76 11505 11517. Xie, Q., Bu, W., Bhatia, S., Hare, J., Somasun daram, T., Azzi, A., and Chapman, M.S. ( 2 002). The atomic structure of adeno associated virus (AAV 2), a vector for human gene therapy. Proc. Natl. Acad. Sci. USA. 99 10405 10410. Yamamoto, N., Suzuki, M., Kawano, M., Inoue, T., Takahashi, R., Tsukamoto, H. Enomoto, T., Yamaguchi, Y., Wada, T., and Handa, H. (2007). Adeno associated virus site specific integration is regulated by TRP 185. J. Virol 81 1990 2001. Yan, Z., Zak, R., Z hang, Y., and Engelhardt, J.F. ( 2005). Inverted terminal repeat sequences are important for intermolecular recombination and circularization of adeno associated virus genomes. J. Virol. 79 364 379. Yan, Z., Zhang, Y., Duan, D., and Engelhardt, J.F (2000) Trans splicing vectors expand utility of adeno associated virus for gene therapy. Proc. Natl. Acad. Sci. USA 97 6716 6721. Yang, J., Zhou, W., Zhang, Y., Zidon, T., Ritchie, T., and Engelhardt, J.F (1999). Concatamerization of adeno associated virus c ircular genomes occurs through intermolecular recombination. J. Virol. 73 9468 9477.

PAGE 106

106 Young, S.M Jr., McCarty, D.M., Degtyareva, N., and Samulski, R.J. (2000). Roles of adeno associated virus Rep protein and human chromosome 19 in site specific recombinati on. J. Virol. 74 3953 3966. Zentilin, L., Marcello, A., and Giacca, M. (2001). Involvement of cellular double stranded DNA break binding proteins in processing of the recombinant adeno associated virus genome. J. Virol. 75 12279 12287. Zhang, C., Cortez, N.G., and Berns, K.I. (2007). Characterization of a bipartite recombinant adeno associated viral vector for site specific integration. Hum. Gene Ther. 18 787 797. Zhao, W., Wu, J., Zhong, L., and Srivastava, A. (2006). Adeno associated virus 2 mediated g ene transfer: role of a cellular serine/threonine protein phosphatase in augmenting transduction efficiency. Gene. Ther. 14 545 550. Z hijian W., Miller, E., Agbandje McKenna, M., and Samulski, R.J. (2006). Alpha2,3 and alpha2,6 N linked sialic acid faci litate efficient binding and transduction by adeno associated virus type 1 and 6. J. Virol 80 9093 9103. Zhong, L., Li, B., Mah, C.S., Govindasamy, L., Agbandje McKenna, M., Cooper, M., Herzog, R.W., Zolotukhin, I., Warrington Jr, K.H., Weigel Van Aken, K.A., Hobbs, J.A., Zolotukhin, S., Muzyczka, N., and Srivastava, A. (2008). Next generation of adeno associated virus 2 vectors: point mutations in tyrosines lead to high efficiency transduction at lower doses. Proc. Natl. Acad. Sci. USA. 105 7827 7832. Zhong, L., Zhao, W., Wu, J., Zolotukhin, S., Govindasamy, L., Agbandje McKenna, M., and Srivastava, A. (2007). A dual role of EGFR protein tyrosine kinase signaling in ubiquitination of AAV 2 capsids and viral second strand DNA synthesis. Mol. Ther. 15 13 23 1330. Zhong, L., Zhou, X., Li, Y., Qing, F., Xiao, X., Samulski, R.J., and Srivastava, A (2008). Single polarity recombinant adeno associated virus 2 vector mediated transgene expression in vitro and in vivo: mechanisms of transduction. Mol. Ther. 16 290 295. Zhou, X., Zeng, X., Fan, Z., Li, C., McCown, T., Samulski, R.J., and Xiao, X. (2008). Adeno associated virus of a single polarity DNA genome is capable of transduction in vivo. Mol. Ther. 16 494 499. Zincarelli, C., Soltys, S., Rengo, G., and Ra binowitz JE. ( 2008 ) Analysis of AAV serotypes 1 9 mediated gene expression and tropism in mice after systemic injection. Mol. Ther 6 1073 10 80

PAGE 107

107 BIOGRAPHICAL SKETCH Shyam Daya was born in Johannesburg, South Africa at Marymount Catholic Hospital. He r eceived early childhood training at a Montessori School in Lenasia, South Africa. He received elementary school education at Impala Crescent School in Lenasia, South Africa, at St. Francis of Assisi Convent School in Gujarat, India and at Dr. Phillips Elem entary School in Orlando, Florida, USA. He received middle and high school education at Southwest Middle School and Dr. Phillips High School in Orlando respectively. He graduated from the Medical Academy at Dr. Phillips High School with honors and embark ed on a BS in i nterdisciplinary s tudies with concentration in biochemistry and m olecular b iology at the University of Florida in Gainesville. After completing the BS degree in three year s, he continued with the i nte rdisciplinary Ph.D. program in medical sc iences with concentration in g enetics at the UF College of Medicine. He received his first taste of research as an undergraduate in Dr. Mavis Agbandje associated Virus Serotype 1. He continued his research on the biology of AAV under the guidance of Dr. Kenneth I. Berns, a pioneer in AAV research, who is now the Director of Genetics Institute at the University of Florida. He wants to continue his development, and hopes t o complement his research experience with clinical training, to become a p hysician s cientist.