<%BANNER%>

Basis of Gene-Specific Activation by the EBV SM Protein

Permanent Link: http://ufdc.ufl.edu/UFE0024094/00001

Material Information

Title: Basis of Gene-Specific Activation by the EBV SM Protein
Physical Description: 1 online resource (45 p.)
Language: english
Creator: Han, Zhao
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: Medicine -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Epstein-Barr virus (EBV) is a human herpes virus that infects and persists in approximately 90% of the adult human population and is associated with a number of human malignancies such as Burkitt?s lymphoma, Hodgkins?s lymphoma and nasopharyngeal carcinoma. The EBV SM protein is a posttranscriptional regulatory protein expressed early during lytic replication and is essential for virus production. SM is an RNA binding protein which enhances accumulation of its target mRNAs but its exact mechanism of action remains to be determined. We had previously shown that SM enhances accumulation of some EBV transcripts over others. However the basis of such specificity has not been investigated. Understanding the basis of gene specific activation by SM should provide insights into the regulation of lytic EBV replication and possibly opportunities for specific therapeutic interventions. This study is aimed at determining the basis of specific RNA recognition by SM. To ask whether SM associates more efficiently with specific EBV transcripts, we employed an RNA immunoprecipitation/RT-QPCR assay. We used cell lines derived from lymphoma infected with EBV that have been modified to permit high level lytic EBV replication in an inducible manner. Induced cells were lysed, and SM/RNA complexes were immunoprecipitated with SM antibody. RNA was isolated from each immunoprecipitation and analyzed by RT-QPCR microarray for all EBV open reading frames (ORF). We found that there is general enrichment of EBV RNA in SM-immunoprecipitates, suggesting that SM has some non-specific RNA binding capability. However, there were several RNAs which were highly enriched by SM, suggesting that SM does bind preferentially to specific RNAs. In order to map high affinity SM-binding sites on BFRF3 RNA, protein-RNA crosslinking assays were employed to compare the affinity of SM for various portions of the BFRF3 RNA. SM bound to the full-length BFRF3 transcript but not to the anti-sense sequence of BFRF3. Furthermore, SM bound preferentially to the first 189 bases of the BFRF3 transcript suggesting that there may be some specific sequence or structural motif in this region of the BFRF3 RNA which allows for preferential binding by SM.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Zhao Han.
Thesis: Thesis (M.S.)--University of Florida, 2008.
Local: Adviser: Swaminathan, Sankar.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0024094:00001

Permanent Link: http://ufdc.ufl.edu/UFE0024094/00001

Material Information

Title: Basis of Gene-Specific Activation by the EBV SM Protein
Physical Description: 1 online resource (45 p.)
Language: english
Creator: Han, Zhao
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: Medicine -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Epstein-Barr virus (EBV) is a human herpes virus that infects and persists in approximately 90% of the adult human population and is associated with a number of human malignancies such as Burkitt?s lymphoma, Hodgkins?s lymphoma and nasopharyngeal carcinoma. The EBV SM protein is a posttranscriptional regulatory protein expressed early during lytic replication and is essential for virus production. SM is an RNA binding protein which enhances accumulation of its target mRNAs but its exact mechanism of action remains to be determined. We had previously shown that SM enhances accumulation of some EBV transcripts over others. However the basis of such specificity has not been investigated. Understanding the basis of gene specific activation by SM should provide insights into the regulation of lytic EBV replication and possibly opportunities for specific therapeutic interventions. This study is aimed at determining the basis of specific RNA recognition by SM. To ask whether SM associates more efficiently with specific EBV transcripts, we employed an RNA immunoprecipitation/RT-QPCR assay. We used cell lines derived from lymphoma infected with EBV that have been modified to permit high level lytic EBV replication in an inducible manner. Induced cells were lysed, and SM/RNA complexes were immunoprecipitated with SM antibody. RNA was isolated from each immunoprecipitation and analyzed by RT-QPCR microarray for all EBV open reading frames (ORF). We found that there is general enrichment of EBV RNA in SM-immunoprecipitates, suggesting that SM has some non-specific RNA binding capability. However, there were several RNAs which were highly enriched by SM, suggesting that SM does bind preferentially to specific RNAs. In order to map high affinity SM-binding sites on BFRF3 RNA, protein-RNA crosslinking assays were employed to compare the affinity of SM for various portions of the BFRF3 RNA. SM bound to the full-length BFRF3 transcript but not to the anti-sense sequence of BFRF3. Furthermore, SM bound preferentially to the first 189 bases of the BFRF3 transcript suggesting that there may be some specific sequence or structural motif in this region of the BFRF3 RNA which allows for preferential binding by SM.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Zhao Han.
Thesis: Thesis (M.S.)--University of Florida, 2008.
Local: Adviser: Swaminathan, Sankar.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0024094:00001


This item has the following downloads:


Full Text

PAGE 1

1 BASIS OF GENE SPECIFIC ACTIVATION BY EBV SM PROTEIN By ZHAO HAN A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2008

PAGE 2

2 2008 Zhao Han

PAGE 3

3 To Liping and Yichun; my parent s, my anchor and my sea a nd to Ben; my love, my life

PAGE 4

4 ACKNOWLEDGMENTS I would like to express my deepest appreci ation and gratitude to all who helped and supported me emotionally, academically, and struct urally. My family and friends who always believed in me and stood behind the choices I made. I thank my mentor, Dr. Sankar Swaminathan, for giving me this exciting pr oject, providing me out standing intellectual guidance, and presenting me with endless opportunities to learn and explore science. I would also like to thank the past and present member s of the Swaminathan Lab, particularly Dinesh Verma, Dorit Muller, Bindhu Monica, Nagaraja Tirumuru, Melusine Gaillard and Mike Nekorchuk, for all the stimulating discussions, captiva ting memories and technical advice. I also extend a special thanks to Dr. Eric Johannsen for the kind gift of p3HR1-ZHT and B958-ZHT cell lines and Dr. Dirk Dittmer and the Dittmer Lab for processing and performing the RT-PCR microarray described in this thesis. In a ddition, I want to thank Joyce Conners and Sony Kuruppacherry for their administrative support a nd relieving much of my concerns regarding class registrations, semester deadlines, and graduation requi rements among countless other things. Finally, I would like to thank my committee members, Dr. David Bloom and Rolf Renne, both Principal Investigator s with their own productive labs, for their generous guidance and invaluable assistance for which I owe a debt of gratitude.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ............................................................................................................... 4LIST OF TABLES ...........................................................................................................................7LIST OF FIGURES .........................................................................................................................8LIST OF ABBREVIATIONS ......................................................................................................... .9ABSTRACT ...................................................................................................................... .............11CHAPTER 1 INTRODUCTION .................................................................................................................. 13Basic Overview .......................................................................................................................13Epstein Barr virus .......................................................................................................... .......13Virus Structure and Genome ...........................................................................................13EBV Life Cycle ............................................................................................................... 14EBV Gene Expression dur ing Lytic Infection ................................................................. 14The EBV SM Protein ..............................................................................................................15Gene and Protein Structure ..............................................................................................15Regulation of Gene Expression ................................................................................ 16RNA Binding ............................................................................................................ 16Purpose and Significance ................................................................................................172 MATERIALS AND METHODS ...........................................................................................19BFRF3, BFRF3 subsets, and -BFRF3 Plasmids ..................................................................19Cell Lines ................................................................................................................................19Transfection Assays ................................................................................................................20Immunoprecipitation an d RNA Isolation ............................................................................... 20Complementary DNA Microarray and Analysis .................................................................... 21Northern Blotting ............................................................................................................. .......21In vitro Photocrosslinking .......................................................................................................223 RESULTS ....................................................................................................................... ........25Isolation of SM Target RNA .................................................................................................. 25Characterization of In Vivo Tran script Specificity of SM ..................................................... 25Analysis of SMs RNA Binding Partners ............................................................................... 27Mapping of SM-binding on BF RF3 RNA Transcripts ........................................................... 28

PAGE 6

6 4 DISCUSSION AND FUTURE AIMS .................................................................................... 39Discussion .................................................................................................................... ...........39Future Aims ............................................................................................................................41LIST OF REFERENCES ...............................................................................................................42BIOGRAPHICAL SKETCH .........................................................................................................45

PAGE 7

7 LIST OF TABLES Table page 2-1 List of Primers....................................................................................................................243-1 The RNA enrichment by SM in P3HR1-ZHT cells ........................................................... 303-2 The RNA enrichment by SM in B958-ZHT cells .............................................................. 313-3 The RNA recovery by immunoprecipitation .....................................................................32

PAGE 8

8 LIST OF FIGURES Figure page 3-1 Semi-quantitative inter-gene com parison using fold induction .........................................333-2 Inter-gene comparison of fold enrichment based on mean CT .......................................... 343-3 Enrichment of RNAs by SM in P3HR1-ZHT cells ........................................................... 353-4 The BFRF3 and BBRF3 enrichment by SM in B958-ZHT cells....................................... 363-5 Enrichment of BALF2 by SM in B958-ZHT cells ............................................................ 373-6 Crosslinking of SM protein to BFRF3 RNA .....................................................................38

PAGE 9

9 LIST OF ABBREVIATIONS 4-HT 4-hydroxytamoxifen -BFRF3 anti-BFRF3 aa amino acid ARM arginine rich region CAT chloramphenicol acetyl transferase cDNA complementary deoxyribonucleic acid CR2 complement receptor 2 CT cycle number EBV Epstein-Barr virus GST glutathione-S-transferase hCMV Human cytomegalovirus HHV-4 Human herpesvirus 4 HHV-8 Human herpesvirus 8 HSV herpes simplex virus IE immediate early IM infectious mononucleosis IP immunoprecipitation IR Internal direct repeats kb kilo-base kbp kilo-basepairs kDa kilo Dalton KSHV Kaposis sarcoma associated herpesvirus mM millimolar ORF open reading frame

PAGE 10

10 PAGE polyacrylamide gel electrophoresis PCR polymerase chain reaction PI pre-immune QPCR quantitative polymerase chain reaction R BRLF1 RNA ribonucleic acid RT reverse transcription TE Tris EDTA TR terminal direct repeats UL unique long US unique short UTR untranslated region VCA viral capsid antigen VZV varicella-zoster virus Z BZLF1

PAGE 11

11 Abstract of Thesis Presen ted to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science BASIS OF GENE SPECIFIC ACTIVATION BY EBV SM PROTEIN By Zhao Han December 2008 Chair: Sankar Swaminathan Major: Medical Sciences Epstein-Barr virus (EBV) is a human herp es virus that infects and persists in approximately 90% of the adult human population and is associated with a number of human malignancies such as Burkitts lymphoma, Hodgkinss lymphoma and nasopharyngeal carcinoma. The EBV SM protein is a posttrans criptional regulatory pr otein expressed early during lytic replication and is essential for virus production. SM is an RNA binding protein which enhances accumulation of its target mRNAs but its exact mechanism of action remains to be determined. We had previously shown that SM enhances accumulation of some EBV transcripts over others. However the basis of such specificity has not been investigated. Understanding the basis of gene specific activation by SM s hould provide insights into the regulation of lytic EBV replication and po ssibly opportunities for specific therapeutic interventions. This study is aimed at determining the basi s of specific RNA recognition by SM. To ask whether SM associates more efficiently with specific EBV transcripts, we employed an RNA immunoprecipitation/RT-QPCR assay. We used cell lines derived from lymphoma infected with EBV that have been modified to permit high level lytic EBV replication in an inducible manner. Induced cells were lysed, and SM/RNA complexes were immunoprecipitated with SM antibody.

PAGE 12

12 RNA was isolated from each immunoprecipitatio n and analyzed by RT-QPCR microarray for all EBV open reading frames (ORF). We found that there is general enrich ment of EBV RNA in SM-immunoprecipitates, sugges ting that SM has some non-sp ecific RNA binding capability. However, there were several RNAs which were highly enriched by SM, suggesting that SM does bind preferentially to specific RNAs. In order to map high affinity SM-binding sites on BFRF3 RNA, protein-RNA crosslinking assa ys were employed to compare the affinity of SM for various portions of the BFRF3 RNA. SM bound to the fu ll-length BFRF3 transcript but not to the antisense sequence of BFRF3. Furthermore, SM bound preferentially to the first 189 bases of the BFRF3 transcript suggesting that there may be some specific sequen ce or structural motif in this region of the BFRF3 RNA which allows for preferential binding by SM.

PAGE 13

13 CHAPTER 1 INTRODUCTION Basic Overview Epstein Barr virus (EB V) is a member of the virus family Herpesviridae and the herpesvirus subfamily. It is a human herpes virus (HHV-4) that infects and persists in approximately 90% of the adult population a nd is associated with a number of human malignancies such as Burkitts lymphoma, Hodgkins lymphoma and nasopharyngeal carcinoma. Primary infection of EBV can occur early during childhood and is us ually asymptomatic or later during adolescence or adulthood, when it can cause infectious m ononucleosis (IM). Transmission of EBV generally occurs through the exchange of saliva in which the virions infect the epithelial cells of the oropharynx. EBV can also infect primary B-lymphocytes where it establishes latent infection and maintains a persistent infection. Although EBV is usually latent, it can become permissive for lytic viru s replication and virus production. Two types of EBV infect humans; EBV type 1 and 2 (also called type A and type B). Differences between the two types are primarily in the sequences that code for latent proteins. While type 1 is prevalent in the United States, Europe, and Southeast Asia, both type 1 and 2 are widespread throughout equatorial Af rica and New Guinea (9). Epstein Barr virus Virus Structure and Genome Like other herpesviruses, EBV contains a toroidal DNA core surrounded by an icosahedral nucleocapsid and further surrounded by a lipid bilayer envelope w ith a tegum ent in between the nucleocapsid and the envelope (9 ). The EBV virion contains a single copy of the linear doublestranded DNA (dsDNA) genome that is 184 kilobase pairs (kbp) and encodes over 90 proteins. Many of the genes are named after the BamHI re striction fragment on wh ich they are encoded

PAGE 14

14 from (2). The genome is comprised of two unique segments; the unique short (US) and the unique long (UL), which are flanked by repeated sequences; termin al direct repeats (TR) and internal direct repeats (IR) (9). EBV Life Cycle Entry of EBV into B lymphocytes is m ediated by binding of the most abundantly expressed viral glycoprotein, gp350/220, to the host cell receptor, CD21 (also know as CR2) (27). Upon attachment, the vi rion enters through the endocytic pathway and fuses with the cellular vesicle membrane allowing the release of the viral capsid into the cytoplasm (16). EBV capsids are then transported to the nuclear pore along microtubules (9). Disassembly of the capsid is required for the release of the genomic DNA into the nucleus, where it circularizes and persists as an episome (9). Infection of a B lymphocyte usually results in la tent (quiescent) infec tion in which the viral episome is replicated once per cell cycle by th e host DNA polymerase, a few latent genes are expressed but no viral proteins or new virus proge ny are produced (1,9). Latently infected cells can also be induced into lytic (productive) inf ection in which all viral genes are expressed, viral DNA is replicated through a rolling circle replication by a vira lly encoded polymerase, and new virions are produced (28, 29). EBV Gene Expression during Lytic Infection Upon reactivation o r induction of EBV, gene expression shifts from latent genes to expression of lytic genes. EBV lytic gene expr ession occurs in a temporally regulated manner such that the transcription and translation of ly tic genes are classified into three main periods; immediate early (IE), early (E) and late (L). IE genes are involved in tr anscriptional activation of early genes (9). These genes do not require viral proteins for their transcription and translation. The principal IE genes are BZLF1 (Z) and BRLF1 (R), which are both

PAGE 15

15 transactivators of early EBV genes (7, 18, 19, 31). Early genes are mostly genes that code for viral proteins involved in DNA re plication and late genes are mostly those that code for structural proteins and proteins required for ne w virion formation (9). The EBV SM Protein The EBV SM protein, also known as EB2, Mta, and BMLF1 is one of the first early genes to be expressed during lytic EBV replication (26). SM is essen tial for viral DNA replication and the production of infectious virions (12, 24). It has hom ologs in other herpesviruses including ORF57 of Kaposis sarcoma associated herpes virus (KSHV, HHV-8) (3), ICP27 of herpes simplex virus (HSV) (23), ORF4 of varicellazoster virus (VZV) (8 ), and UL69 of human cytomegalovirus (hCMV) (30). Although these ge nes are functionally and structurally related, there are significant differences including when dur ing lytic replication they are expressed, their sequences, their abilities to rescue mutant reco mbinant viruses and other modes of action (3, 8, 11, 23, 25, 30). Gene and Protein Structure SM is a 55 kilo Dalton (kDa) nuclear pr otein encoded by an 1.7 kb m RNA transcript spliced from the Bam S and Bam M regions of the EBV genome (BSLF2 and BMLF1 exons) giving it a total size of 479 amino acids (aa) in length (15). The functional regions of SM have been under much investigation. SM amino aci ds 60-140 and 218-237 are nuc lear export signals which may mediate nuclear to cytoplasmic shuttli ng of RNAs (4, 6). Studies have shown that the RXP (Arg-X-Pro) RNA binding domain lo cated at amino acids 152-172 binds RNA in vitro however, its role in SM function have been show n to be non-essential (5, 20). Amino acids 470474 contain a highly conserved motif, GLFF motif (g ly-leu-phe-phe), which is required for SM function and proper folding (21).

PAGE 16

16 Regulation of Gene Expression SM is a post-tran scriptional regulator of cellula r and viral gene expression. Earlier studies showed that when co-transfected with certain repo rter constructs, such as chloramphenicol acetyl transferase (CAT), SM greatly increases th e expression of CAT without increasing the transcription initiation rate (22) Furthermore, the activation of CAT by SM is independent of the promoter used further indicating that SMs main mechanism of action is post-transcriptional (22). The properties of SM-mediated activation we re further studied using various reporter genes in co-transfection assays of BJAB cells. Activation by SM of CAT was greatly enhanced whereas there were no effects by SM on firefly lu ciferase and the human growth hormone gene expression (20,22). These data suggests that eff ects of SM on target genes are gene specific. This conclusion is supported by cDNA microarray studies using a SM-deleted recombinant EBV strain which demonstrate that only half of the EBV lytic genes are SM-dependent and that expression of some EBV gene s were more dependent on SM than others (12). RNA Binding In initia l studies looking at the RNA binding capability of SM, bacterially derived SMglutathione-S-transferase (GST) fusion proteins were made a nd shown to bind radioactively labeled RNA in vitro indicating that SM is a RNA binding protein (22). Later studies suggested that the RXP domain of SM was essential for RNA binding in vitro When made with a mutated or deleted RXP domain, SM lo ses its ability to bind RNA in vitro as indicated by Northwestern assays (5, 20). However, deletion of the RXP region does not elimin ate or alter normal localization of SM and function of gene activation which prompted further research to explore the necessity of the RXP motifs for RNA binding in vivo Co-transfection assays of RXP-deleted SM with target CAT gene were performed and co-immunoprecipiation of CAT mRNAs were

PAGE 17

17 demonstrated with SM immunoprecipitates confirming that the RXP region is not required for RNA binding in vivo (20). In attempt to identify the RNA binding regi on of SM, one study found that when various bacterially synthesized GST-SM fu sion peptides were incubated w ith radioactively labled RNAs, that an arginine-rich region (ARM) located at aa 190-223 of SM bound RNA nonspecifically (13). However, this lack of binding specificity does not explain the sele ctive effects of SM on mRNA accumulation. Furthermore, the basic proper ties of any arginine-rich region might allow binding of negatively charged groups such as RNA and not necessarily be reflective of the SM domains actually binding RNA targets in vivo Although the RNA binding domain of SM is still poorly defined, the specificity of SMs effects on target mRNAs suggest s that a sequence or structure-specific interaction between SM and its target RN As exists. Purpose and Significance Although much has been reported concerning th e functions and m ech anisms of the EBV SM protein, there are several impor tant aspects yet to be explaine d such as the actions of SM on specific mRNA transcripts and whether there are specific sequence or structural elements in RNA molecules that allows for binding of SM. Identification of specific SM-RNA interactions and specific SM binding sites on its target RNAs will help determine the basis of specific RNA recognition by SM and perhaps provide a better understanding of the nature of protein-RNA interactions. Understanding the nature of SM specificity will allow to predict which genes, both cellular and viral, SM might a ffect and which cellular RNA-bindi ng proteins SM might compete with, thus providing new insights into the mechanisms by which SM post-transcriptionally regulates cellular and viral gene expression and ultimately a better understanding of how infection of EBV alters host cell functions. Finally, because SM is required for DNA replication of EBV and there are no cellular homologs of SM makes SM an attractive target for antiviral

PAGE 18

18 compounds. By increasing our knowledge on the molecular mechanisms by which the EBV SM protein functions inside the cell, more opportu nities and better strategies for therapeutic developments can be created.

PAGE 19

19 CHAPTER 2 MATERIALS AND METHODS BFRF3, BFRF3 subsets, and -BFRF3 Plasmids BFRF3 (the gene encoding a com ponent of th e small viral capsid an tigen of EBVs VCA) containing its 5UTR and cleavage a nd polyadenylation signal and the -BFRF3 (antisense of the entire BFRF3 sequence) were constructe d by high fidelity PCR amplification using AccuPrime Pfx DNA Polymerase (Invitrogen). The BFRF3 clone was generated from B95-8 EBV genome positions 49056 to 49806 (accession number NC00705) using primers (Table 2-1) flanking the entire BFRF3 gene including 5 a nd 3 UTRs. PCR products were directionally cloned into the HindIII to EcoRV sites of pcDNA3 (Invitrogen) in opposite orientations. The orientation of the inserts was determined by re striction enzyme diges tion and confirmed by DNA sequencing. Subclones of BFRF3 encompassing approximately one-fourth of the gene extending from the 5UTR to 20bps downstream of the cleavage a nd polyadenylation signal of BFRF3 were also constructed by PCR amplification. PCR was performed using different 5 and 3 primers (Table 2-1) and PCR products represen ting the different subsets of BFRF3 ranged between 186 to 196 bps in length. Each cloned PCR product was scr eened by restriction dige stion and confirmed by DNA sequencing. Cell Lines P3HR1-ZHT is a Burkitts lym phoma cell line infected with the type 2 EBV and B958ZHT is a marmoset B cell line transformed by t ype 1 EBV (14), kind gift of Eric Johannsen, Harvard Medical School. Both cell lines stably express a fusion protein containing the BZLF1 transactivator of early lytic cycle replication fused to the hormone domain of the estrogen receptor protein in which during the presence of 4-hydroxytamoxifen allows the release of

PAGE 20

20 BZLF1, inducing lytic EBV replication. P3HR1ZHT and B958-ZHT cell lin es were propagated in RPMI supplemented with 10% fetal bovine serum (HyCLone ), 0.8mg/ml G418 (AG Scientific), and L-glutamine (Invitrogen). Cos7 cells are African green monkey kidney fibroblast cells transformed with a mutant simian virus 40 (SV40) (Gluzman). These cells were maintained in Dulbeccos modified Eagle medium supplemented with 10% fetal bovine serum and L-glutamine. All cells were grown at 37oC in 5% CO2. Transfection Assays Cos7 cells were transfected with empty vector plasmid (pcDNA3, Invitrogen) or SM expression vector (EW63, 22) DNA using Lipofectamine Plus (Invitrogen) in 100 mm plates with 6 ug of DNA per transfection plate, accord ing to manufacturers pr otocol. Cells were harvested 48 hours af ter transfection. Immunoprecipitation and RNA Isolation Lytic replication was induced in 180 x 106 P3HR1-ZHT or B958-ZHT cells at 5 x 105 cells/ml by adding 100nM 4-hydroxytamoxifen to the cell growth medium. Cells were harvested 48 hours after treatment by 4-HT and lysed in ice-cold immunoprecipita tion (IP) lysis buffer (Tris-buffered saline [pH 7.4], 1% Triton X 100 and protease inhib itor cocktail [Sig ma, P2714]). Cells were incubated in lysis buffer for 10 minutes on ice with frequent mixing and sonicated to ensure maximum lysis. The lysed cell suspension was centrifuged at 4oC for 10 min at 105 x g. Supernatant was transferred to fresh tubes and cleared with normal rabbit IgG (Bethyl) and protein A-conjugated agarose beads (Sigma) followed by immunoprecipitation with either preimmune serum or anti-SM antibody and protei n A agarose beads and washed four times in immunoprecipitation wash buffer (500 mM NaCl, 25mM Tris, 27 mM KCl, 1% NP40 [pH 7.4]). Co-immunoprecipitated RNA was isolated from the immuno precipitates using RNA-bee

PAGE 21

21 (Teltest) and RNeasy columns (Qiagen) containi ng an on-column DNAse treatment (Qiagen) and eluted with RNAse-free Tris-EDTA (TE) buffer. Complementary DNA Microarray and Analysis Real-time quantitative PCR arrays containing PCR primers targeting all ORF of the EBV genome were designed and performed by our collabor ators at the University of North Carolina, Lineberger Comprehensive Can cer Center. RNA used in the microarray analysis was coimmunoprecipitated and purified as described above. Revers e transcription of RNA was performed with reverse transc riptase (Invitrogen), 2 mM de oxyribonucleoside triphophates, 2.5 mM MgCl2, RNAsin (Applied Biosystems Inc.) and ra ndom hexamers. Cycling conditions for RT are 42oC for 45 min, 52oC for 30 min, and 70oC for 10 min. Following RT, the removal of excess RNA was done by incubation of each RT reaction with 1 U of RNAse H at 37oC in order to prepare the samples for PCR amplification. Real-time PCR was performed in triplicates for each sample with SYBR Green PCR mix (Applied Biosystems) using universal cycling conditions (17). Raw cycle number (CT) values were determined and used directly to compare fold-differences. Northern Blotting P3HR1-ZHT and B958-ZHT cells were induced into lytic replica tion by incubating the cells at 5 x 105 cells/ml in 100 nM 4-HT. 107 cells were harvested for total RNA at 0 and 48 hours after induction and co-immun oprecipitated RNA was harveste d as described above. RNA samples were loaded and electrophoresed in a 1% denaturing formaldehyde agarose gel, transferred to Zeta probe membrane, and UV-cr osslinked to membrane. Gene specific probes were generated by PCR amplifi cation, gel purification and [ -32P]dCTP labeling. The probes were hybridized to blots overnight at 65oC, washed and exposed to film and a phosphorimager screen for quantification by ImageQuant software.

PAGE 22

22 In vitro Photocrosslinking Cos7 cells w ere transfected with empty vect or or SM as describe d above. Cells were washed with fresh warm complete DME and ge ntly scrapped off and pelleted by centrifugation at 20oC for 5 min at 900 x g. Cells were lysed by re-suspending the pellets in twice the pellet volume of ice-cold lysis buffer (20mM HEPE S [pH 7.9], 10 mM NaCl, 10% glycerol, 3 mM MgCl2, 0.2 mM EDTA, 1 mM dithioth reitol, and protease inhib itor cocktail [Sigma]) and incubating at 4oC for 15 min with frequent gentle mi xing. The lysed cell suspensions were centrifuged at 4oC for 5 min at 700 x g. Cleared supernatants were transferred to a fresh tube and high salt buffer (20 mM HEPE S [pH 7.9], 400 mM KCl, 20% gl ycerol, 0.2 mM EDTA, 0.4 mM phenylmethlysulfonyl fluoride, 1 mM dithiothreitol, and protease inhibitor cocktail [Sigma]) was added at one-third the volume of the supernatant. Aliquots of pr otein extracts were snap-frozen and stored at -80oC. RNAs were synthesized using BFRF3, subsets of BFRF3 and -BFRF3 plasmid DNA, previously linearized with EcoRV, in the presence of [ -32P]rUTP (Perkin Elmer) and T7 RNA Polymerase (NEB). Radioactively labeled RNA transcripts were ran on denaturing ureapolyacrylamide gels and full length transcripts were excised out and purified. Crosslinking was performed by incubating 2 x 106 cpm of purified radiolabeled RNA with 8 ul of whole cell extract, 2 ul of 20 mM magnesium acetate, 2 ul of 10 mM ATP, 2 ul of 2000 mM potassium glutamate, 2 ul of 50 mM creatine phosphate, 1 ul of tRNA (1 ug/ul), and 1 ul of RNAsin (Promega) in a total volume of 20 ul Reactions were incubated at 30oC for 30 min and RNAprotein complexes were UV-crosslin ked on ice in a Stratalinker (S tratagene) for a total of 0.6 J/cm2. Samples were digested with R NAse A at 100 ug/ul for 1 hour at 37oC and immunopurified using anti-SM antibody and protein A agarose beads. Purified proteins were

PAGE 23

23 separated on 10% SDS-PAGE gels followed by autoradiography exposure on a phosphorimager screen and film.

PAGE 24

24 Table 2-1. List of Primers Primer Name Primer Sequence BFRF3 5#7HindIII 5ctgaaag ctttatttaactttgcggacagagg3 BFRF3 3#7EcoRV 5tcaggata tcgttgggcttgggcagccggcgtg3 BFRF3 5#8HindIII 5ct gaaagcttcaagcccaccctccag3 BFRF3 3#8EcoRV 5tcaggata tcggcaccccaaaagtcctctgcac3 BFRF3 5#9HindIII 5ctgaaagc tttcggcgccaacgcgccatagacaag3 BFRF3 3#9EcoRV 5tcagga tatcgatgaaga aacagagggggtc3 BFRF3 5#10HindIII 5ctga aagctttcatctattagcagcctc3 BFRF3 3#10EcoRV 5tcaggatatcagtttttgtatctgtaattg3 BFRF3 5#11EcoRV 5tcaggg atatctatttaactttgcggacagag3 BFRF3 3#11HindIII 5ctgaaagcttagtttttgtatctgtaattg3

PAGE 25

25 CHAPTER 3 RESULTS Isolation of SM Target RNA The EBV SM protein is known to bind RNA, howe ver m any aspects of its interaction with RNA remain to be elucidated. In this study, we wished to determine whether SM preferentially binds EBV RNA. In order to isolate SM/RNA complexes that form in vivo we treated P3HR1ZHT and B958-ZHT cells with 4-hydroxytamoxife n to permit lytic EBV replication. By employing an immunoprecipitaion assay with anti -SM antibody under conditions that preserve protein/RNA complexes, we were able to isolate specific EBV RNAs bound by SM. Characterization of In Vivo Tr anscript Specificity of SM To identify specific EBV RNA targets bound by SM, we took induced P 3HR1-ZHT and B958-ZHT cell lysates and immunoprecipitated with either anti-SM antibody ( SM) or preimmune serum (PI, control). By immunopreci pitating SM, we were able to specifically isolate SM and any RNA molecules bound by SM. To determine which RNAs were present in each immunoprecipitate, we isolated SM or PI co-immunoprecipiated RNAs and prepared cDNA for qPCR microarray analysis using primers for all EBV ORFs as previo usly described (17). Raw CT values representing the relative abundan ce of transcripts bound by SM versus PI were determined. The amount of RNA in the SM IP was compared to that in the pre-immune IP for each ORF, and the relative enrichment by SM for each RNA target was determined. Our data indicated that there was a general enrichment in the SM-IP versus control (PI-IP) suggesting that SM bound more RNA than the control. In P3HR 1-ZHT cells, approximately seven times more RNA was immunoprecipitated by SM than the control. In B958-ZHT, around fifty-five times more RNA was associated with SM than in the c ontrol IP. This overall enrichment of RNA (the majority of EBV RNAs) in the SM IPs in both induced cell lines suggested that SM has some

PAGE 26

26 non-specific RNA binding capability. From the ra w CT values generated by the PI-IP and SMIP microarray data, we calculated the mean en richment values for each target using a linear regression model. Interestingl y, we found that in addition to the general enrichment by SM, there were several RNAs that were particular ly enriched by SM in both the P3HR1-ZHT and B958-ZHT cells (Table 3-1 and Table 3-2), with CT values 2-5 times greater than the mean enrichment. These highly enriched RNAs included the BFRF3, BGLF5, BDLF3, BTRF1, BCRF1, BBRF3, BBRF2, BLRF1, and BLRF3 from the P3HR1-ZHT microarray. In B958ZHT, the RNAs most highly enriched by SM included BDLF 3, BNLF2b, BBRF3, BFRF3, BGLF2, BTRF1, BBRF2, BLRF2, and BXLF2. Among the highly enriched RNAs, BFRF3, BDLF3, BBRF3, and BTRF1 were highly bound by SM in both P3HR1-ZHT and B958-ZHT cells. This disproportionate bind ing of RNAs by SM indicated th at SM selectively bound certain RNAs more avidly than it bound other RNAs. To rule out the possibility that the greater enrichment by SM was due to increased fold induction of certain RNAs (Figure 3-1) or the greater abundance of part icular RNAs (Figure 32), we isolated total RNA from uninduced and induced P3HR1-ZHT and B958-ZHT cells and compared the relative amounts of each RNA and the fold induction in the input RNA to the amounts present of each RNA in the SM immunopr ecipitate. By taking the difference in CT values from total uninduced and i nduced RNA samples, we determined the fold induction as well as the relative abundance of each RNA target. We saw no correlation between the enrichment of each RNA target by SM to its relative fold induc tion and relative input abundance. There were highly induced as well as less hi ghly induced RNA targets associ ated with SM (Figure 3-1). Similarly, RNA targets were enriched by SM indepe ndent of their relative abundance in the input sample (Figure 3-2). These data suggested th at the binding of SM to its targets are RNA-

PAGE 27

27 specific and not merely a consequence of th e greater abundance of certain target RNA molecules. Analysis of SMs RNA Binding Partners In order to confirm preferential binding by SM as indicated by the array data, we analyzed the RNAs used in QPCR microarray analyses from both P3HR1-ZHT (Figure 3-3) and B958ZHT (Figure 3-4 and Figure 3-5) by Northern blotting. By analyzing equal amounts of total RNA from induced and uninduced cells, we verified that induction into lytic EBV replication by 4-HT enhances the expression of the genes of inte rest. The data from our Northern blots were also consistent with the micr oarray data which showed that SM co-immunoprecipitated more RNA than control (PI or IgG) in both P3HR1-ZH T and B958-ZHT cells and that SM has some non-specific binding to RNA in general. To compare the binding of SM for specific RNA targets, we ran equal percentage s of the total SM co-immunoprecip itated and control (PI or IgG) co-immunoprecipitated RNAs and hybridized blots with gene-specific 32P-labeled probes. These gene-specific probes represented the RNAs in both P3HR1-ZHT and B958-ZHT cells that were highly enriched by SM, such as BFRF3 and BBRF 3, and RNAs that were less enriched in SM IPs, such as BALF2. Although induction of BFRF3, BBRF3 and BALF2 in P3HR1-ZHT cells was comparable, SM co-immunoprecipitated 68.6 times more BFRF3 and 27.4 time more BBRF3 but only 3.6 times more BALF2 than control (Figure 3-3). Similarly in B958-ZHT cell, SM co-immunoprecipitated BFRF3 38 times more and BBRF3 58.9 times more than control while BALF2 was co-immunoprecipitated only 3.5 times more than control (Figure 3-4 and Figure 3-5). To further verify that BFRF3, BBRF3 but not BALF2 were highly enriched by SM, we calculated the percentage of total input RNAs that were co-immunoprecipitated by SM (Table 34). We showed that 10.2 % of input BFRF3 and 8.4 % of input BBRF3 transcripts from P3HR1-

PAGE 28

28 ZHT cells were brought down by SM. As expected only 0.54% of BALF2 were coimmunoprecipitated by SM. Similarly in B958-ZHT cells, 38.8% of BFRF3 and 23.7% of BBRF3 were co-immunoprecipitated while only 1% of BALF2 were brought down in the SM-IP. These data confirm our hypothesi s that SM does exhibit some pr eferential binding to its target RNA molecules. Interestingly, we also notic ed that the SM co-immunoprecipitated RNAs contained a disproportionate amount of 18S ribosom al RNA compared to the 28S suggesting that SM may have higher preference for the 18S ribosomal RNA (data not shown). Mapping of SM-binding on BFRF 3 RNA Transcripts To ask whether SM exhibited sequence or st ructure specific binding, we performed an in vitro cross-linking assay by incubati ng SM-containing cell extracts with radioactively labeled transcripts (Figure 3-6A) consisti ng of the entire sense or anti -sense BFRF3 sequences (Figure 3.6B). SM/RNA complexes were cross-linke d by UV irradiation. Unbound RNAs were hydrolyzed by RNase treatment and SM was i mmunoprecipitated using SM-specific antibody. This procedure renders those proteins that were in physical cont act with the target transcript radiolabeled by virtue of covalent crosslinki ng to radiolabled uridine residues. The immunopurified RNA-labeled SM samples were visual ized by SDS-PAGE and autoradiography. If binding of SM to RNA were sequen ce or structure-specific, then th e binding affinity of SM for BFRF3 and -BFRF3 should be different since the -BFRF3 RNA would be predicted to process a different sequence and secondary struct ure than BFRF3 despite having an identical GC content. As shown in Figure 3-6B, a 55 kDa ba nd corresponding to the size of SM was detected only in the sample containing SM and th e sense strand of BFRF3, and not in the -BFRF3/SM sample indicating that the SM pr otein was labeled by covalent-li nkage of radiolabeled uridine from the sense strand and not by -BFRF3 (Figure 3-6B). A 55kDa band was not detected in

PAGE 29

29 the lanes containing empty vector (pcDNA3) a nd BFRF3 RNA immunoprecipitated with antiSM antibody or SM and BFRF3 RNA imm unoprecipitated with PI serum. To map potential high affinity SM-binding site on BFRF3 RNA, different subclones of BFRF3 were constructed. Each subclone was de signed to encompass one-fourth of the entire BFRF3 which included the 5 and 3 UTRs. The subclones were similar in length and were all directionally cloned in to the HindIII and EcoRV sites of pcDNA3 (Invitrogen). The RNA transcripts representing each region of BF RF3 were synthesized and labeled with 32P-UTP in vitro (Figure 3-6A). Protein-RNA cross-linking assays were employe d to compare the affinity of SM for the various portions of the BFRF3. The more a specific RNA transcript binds SM, the more SM will be labeled with that radioactive R NA transcript and therefore a stronger signal will be generated. The cross-linki ng results obtained for the differe nt regions of BFRF3 indicated that SM showed much greater affinity for th e first 189 nucleotide sequence (the 5UTR region) of the BFRF3 RNA (Figure 3-6C). Interestingly, the 2nd quarter of BFRF3 also demonstrated some cross-linking activity and almost no binding by SM was shown in the 3rd and 4th quarter regions of BFRF3. Overall, these studies indica te that SM specifically binds to BFRF3 around the 5UTR.

PAGE 30

30 Table 3-1. The RNA enrichment by SM in P3HR1-ZHT cells Sample CT Pre-immune Sample CT SM Difference in CT Enrichment over mean (CT) Fold enrichment over mean BFRF3 29.79 24.15 5.64 3.4 10.6 BGLF5 32.05 26.78 5.27 3.3 9.8 BDLF3 34.51 29.67 4.84 3.1 8.6 BTRF1 32.84 28.20 4.64 2.7 6.5 BCRF1 36.88 32.87 4.01 2.6 6.1 BBRF3 27.79 23.04 4.75 2.3 4.9 BBRF2 36.58 33.05 3.53 2.1 4.3 BLRF1 27.63 23.32 4.31 1.8 3.5 BLRF3 30.19 26.42 3.77 1.6 3.0 BALF2 29.10 27.69 1.41 -0.8 0.6

PAGE 31

31 Table 3-2. The RNA enrichme nt by SM in B958-ZHT cells Sample CT Pre-immune Sample CT SM Difference in CT Enrichment over mean (CT) Fold enrichment over mean BDLF3 40 30.04 >9.96 5.23 37.5 BNLF2b 40 30.13 >9.87 5.14 35.3 BBRF3 34.44 27.51 6.93 1.95 3.9 BFRF3 32.66 25.2 7.46 1.88 3.7 BGLF2 33.98 26.69 7.29 1.86 3.6 BTRF1 35.76 28.93 6.83 1.61 3.1 BBRF2 34.44 27.51 6.93 1.55 2.9 BLRF2 31.13 23.86 7.27 1.51 2.8 BXLF2 33.59 26.8 6.79 1.31 2.5 BALF2 31.66 30.26 1.4 -4.30 0.05

PAGE 32

32 Table 3-3. The RNA rec overy by immunoprecipitation P3HR1-ZHT B958-ZHT IgG (%) SM (%) PI (%) SM (%) BFRF3 0.15 10.2 1.0 38.8 BBRF3 0.30 8.4 0.39 23.7 BALF2 0.15 0.54 0.92 3.2

PAGE 33

33 Figure 3-1. Semi-quantitative inter-gene comparis on using fold induction. The fold enrichment of each EBV ORF was plotted against the fold induction. Each circle represents an EBV gene. The region of SM enrich ment are highlighted in red. -4 -3 -2 -1 0 1 2 3 4 1101001000Relative EnrichmentLog(fold induction after 48 hours) Enriched in SM IP

PAGE 34

34 Figure 3-2. Inter-gene comparison of fold enri chment based on mean CT. The fold enrichment of each EBV ORF was plotted against the mean CT. Each circle represents an EBV gene. The region of SM enrichment are highlighted in red. -4 -3 -2 -1 0 1 2 3 4 2025303540Relative Enrichmentmean CT Enriched in SM IP

PAGE 35

35 Figure 3-3. Enrichment of RNAs by SM in P3 HR1-ZHT cells. Total RNA from induced and uninduced P3HR1-ZHT cells were prep ared. IgG (control) or SM coimmunoprecipitated RNAs were isolate d. Enrichment of BFRF3, BBRF3, and BALF2 RNAs were measured by Northe rn blotting. Fold Induction and SMenrichment of RNAs were determ ined by phosphorimaging detection.

PAGE 36

36 Figure 3-4. The BFRF3 and BBRF 3 enrichment by SM in B958-ZHT cells. Total RNA from B958-ZHT cells were harvested at 0 and 48 hours after induction. Coimmunoprecipitated RNA from PI-IP (preimmune serum, control) and SM-IP were isolated. BFRF3 and BBRF3 were detected by Northern blotting using gene-specific probes. Fold induction and SM-enrichmen t of BFRF3 and BBRF2 were determined by phosphorimaging detection.

PAGE 37

37 Figure 3-5. Enrichment of BALF2 by SM in B958-ZHT cells. Total RNA from induced and uninduced B958-ZHT cells were prepared. Preimmune serum (control) or SM coimmunoprecipitated RNAs were isolated. Enrichment of BALF2 was measured by Northern blotting. Fold induction and SM -enrichment of BALF2 was determined by phosphorimaging detection.

PAGE 38

38 Figure 3-6. Crosslinking of SM protein to BFRF3 RNA. A) RNA transcripts of BFRF3, BFRF3 and regions representing one-fourth portions of BFRF3 were generated using 32P-UTP. B) Lysates from cells transfected with pcDNA3 (control, C) or SM were incubated with the entire BFRF3 transcript or -BFRF3 and UV crosslinked. Samples were treated with RNAse to hydrolyze unbound RNA and SM was immunoprecipitated with SM-specific anti body (Ab) or preimmune serum (PI). Samples were visualized by SDS-PAGE a nd autoradiography. SM was visualized only when covalent linkage of RNA was dete cted. C) Crosslinking of SM to various regions of BFRF3. Subclones of BFRF3 were constructed. Each subclone represents one-fourth of the entire BFRF3. S

PAGE 39

39 CHAPTER 4 DISCUSSION AND FUTURE AIMS Discussion The EBV SM protein is a post-transcriptional regulator of gene expression. Although a num ber of studies have demonstrated that SM directly binds RNA, the basis for SM/RNA interactions have not been completely characte rized, and the nature of SMs specificity for binding RNA, such as any RNA sequence or struct ural motifs and binding factors have yet to be identified. Several studies have shown that SM increases expression of certain reporter and EBV lytic genes and exhibits gene sp ecificity (12, 20, 22). For exampl e, SM enhances the expression of CAT while little to no effects on firefly luci ferase and human growth hormone were reported (20, 22). Possible explanations of specificity in gene expression by SM could be the existence of high affinity RNA sequence motifs or secondary stru ctures that act as SM binding sites. Since SM does demonstrate preference for activation of intronless mRNAs in vitro, other determinants in gene-specific activation by SM could include th e stability of the transcript and other cellular export factors which may compete with SM for bi nding of target RNAs. In this study, we have demonstrated that SM associates with many EBV RNAs. This co rrelates with previous data which showed that expression of approximately 50% of the EBV ORFs was dependent on SM (12). However, in addition to the overall en richment of RNA in SM IPs, which suggests a nonspecific RNA binding capability, preferenti al association with several RNAs was demonstrated. This hierarchy of affinities for SM suggests the presen ce of specific SM binding sites. Interestingly, among the bound RNAs, we found se veral transcripts in both types of EBV infected cell lines examined, which were highl y associated with SM. Regardless of their abundance in the EBV infected cells, SM e xhibited a higher preference for these RNAs

PAGE 40

40 suggesting that these transcripts may contain specific SM-binding elements. During our analysis we noticed that many of the highly enriched RNAs were expressed from late genes. For example BFRF3 codes for a component of the minor capsid antigen, BBRF3 codes for the envelope glycoprotein gM, BTRF1 codes for the tegument protein and BDLF3 codes for the glycoprotein gp150. These RNAs were highly enriched in both EBV infected cell lines, while the RNA expressed by BALF2, an early gene which was less highly enriched in both cell lines, codes for the single-stranded DNA binding prot ein. This preference of SM to bind late gene RNAs may be an indication that a specific time in RNA pro cessing could also be an important factor for binding specificity of SM. For example, SM may bind nascent RNAs shortly after transcription. In order to address this issue, repeat IP/RT-qPCR experiments would need to be employed at different time points after induc tion of lytic replication. Although several studies have shown binding of SM to RNA in vitro and in vivo relatively little is known about the specificity of its targets. No speci fic RNA sequence motif or structural element has been identified to be required for SM binding. In our study, we showed that SM specifically binds the BFRF3 RNA sequence containi ng the 5 and 3 UTR but not its anti-sense sequence, although the anti-sense contains the same GC content. Therefore, it is likely that a specific sequence or structural element exists in RNAs to which SM binds. To further delineate the SM binding site of BFRF3, we constructed four different RNA tran scripts representing onefourth regions of BFRF3 and performed an in vitro cross-linking/IP assa y. We found that SM specifically bound the first 189 nucleotides of BFRF3 (the 5UTR) mo st highly and some binding were also detected in the second 186 nucle otides. Little binding was seen in the third quarter region of BFRF3 and no bi nding was found in the last qua rter region of BFRF3. This

PAGE 41

41 data suggests that there may be a specific sequence or structural mo tif in the first quarter of the BFRF3 sequence that is re quired for SM to bind. Future Aims Although we have identified a 189 nt re gion in which SM specifically binds in vitro further verification is needed. The BFRF3 subclones used in the in v itro cross-linking assay may not represent the actual secondary structures of those BFRF3 regions. In order to test whether the first 189 nts of BFRF3 is re quired for SM binding, it should be possible to construct a plasmid containing the SM-binding portion of BFRF3 fused to a non SM-binding sequence, such as the anti-sense BFRF3 sequence, to determine if in fact the incorpor ation of our SM-binding region will allow SM to bind to the anti-sense BFRF 3. If in fact the 5 UTR region of BFRF3 is required for SM binding, one coul d continue to further map down the region by repeating the crosslinking/IP assay using RNA targets representing various smaller regions of the 5UTR. Further research such as repeating the in vitro crosslinking/IP assay with other highly enriched sequences such as BDLF3 and BBRF3 and mapping down their binding sites would also be helpful in identifying specific sequ ence binding motifs. Finally, an in vivo study looking for SM binding sites on RNAs should yield further insight into SM binding specificity and correlate the data presented here with in vivo SM response elements.

PAGE 42

42 LIST OF REFERENCES 1. Adams, A. 1987. Replication of latent Epstein-B arr vi rus genomes in Raji cells. J. Virol. 61: 1743-1746. 2. Baer R., Bankier A.T., and Biggin M.D. 1984. DNA sequence and expression of the B95-8 Epstein-Barr virus genome. Nature 310: 207-211. 3. Bello, L. J., A. J. Davison, M. A. Glenn, A. Whitehouse, N. Rethmeier, T. F. Schulz, and J. Barklie Clements. 1999. The human herpesvirus-8 ORF 57 gene and its properties. J. Gen. Virol. 80 ( Pt 12): 3207-3215. 4. Boyle, S. M., V. Ruvolo, A. K. Gupta, and S. Swaminathan. 1999. Association with the cellular export receptor CRM 1 mediates function and intracellu lar localization of Epstein-Barr virus SM protein, a regulator of gene expression. J. Virol. 73: 6872-6881. 5. Buisson, M., F. Hans, I. Kusters, N. Duran, and A. Sergeant. 1998. The C-terminal region bu not the Arg-X-Pro repeat of Epstei n-Barr virus protein EB2 is required for its effect on RNA splicing and transport. J. Virol. 73: 4090-4100. 6. Chen, L., G. Liao, M. Fujimuro, O. J. Semmes, and S. D. Hayward. 2001. Properties of two EBV Mta nuclear expor t signal sequences. Virology 288: 119-128. 7. Chevallier-Greco, A., E. Manet, P. Chavrier, C. Mosnier, J. Daillie, and A. Sergeant. 1986. Both Epstein-Barr virus (EBV)-encoded trans-acting factors, EB1 and EB2, are required to activate transcription from an EBV early promoter. EMBO J. 5: 3243-3249. 8. Defechereux, P., L. Melen, L. Baudoux, M. P. Merville-Louis, B. Rentier, and J. Piette. 1993. Characterization of the regulatory f unctions of varicella-zoster virus open reading frame 4 gene product. J. Virol. 67: 4379-4385. 9. Fields, B. N., D. M. Knipe, and P. M. Howley. 2007. Fields' virology. Wolters Kluwer Health/Lippincott Williams & Wilkins, Philadelphia. 10. Gluzman, Y. 1981. SV40-transformed simian cells s upport the replicati on of early SV40 mutants. Cell 23: 175-182. 11. Gupta, A. K., V. Ruvolo, C. Patterson, and S. Swaminathan. 2000. The human herpesvirus 8 homolog of Epstein-Barr virus SM protein (KS-SM) is a posttranscriptional activator of gene e xpression. J. Virol. 74: 1038-1044. 12. Han, Z., E. Marendy, Y. D. Wang, J. Yuan J. T. Sample, and S. Swaminathan. 2007. Multiple roles of Epstein-Barr virus SM protein in lytic replication. J. Virol. 81: 4058-4069.

PAGE 43

43 13. Hiriart, E., L. Bardouillet, E. Manet, H. Gr uffat, F. Penin, R. Montserret, G. Farjot, and A. Sergeant. 2003. A region of the Epstein-Barr vi rus (EBV) mRNA export factor EB2 containing an arginine-rich motif mediates direct binding to RNA. J. Biol. Chem. 278: 37790-37798. 14. Johannsen, E., M. Luftig, M. R. Chase, S. We icksel, E. Cahir-McFarland, D. Illanes, D. Sarracino, and E. Kieff. 2004. Proteins of purified Epstein-Barr virus. Proc. Natl. Acad. Sci. U. S. A. 101: 16286-16291. 15. Marshall, M., U. Leser, R. Seibl, and H. Wolf. 1989. Identification of proteins encoded by Epstein-Barr virus trans-activator gene. J. Virol. 63: 938-942. 16. Nemerow, G. R. and N. R. Cooper. 1984. Early events in the infection of human B lymphocytes by Epstein-Barr virus: th e internalization process. Virology 132: 186-198. 17. Papin, J., Vahrson, W., Hines-Boykin, R., Dittmer, D.P. 2004. Real-Time Quantitative PCR Analysis of Viral Transc ription. Methods in Molecular Biology 292:449-480. 18. Ragoczy, T., L. Heston, and G. Miller. 1998. The Epstein-Barr virus Rta protein activates lytic cycle genes and can disrupt latency in B lymphocytes. J. Virol. 72: 79787984. 19. Rooney, C. M., D. T. Rowe, T. Ragot, and P. J. Farrell. 1989. The spliced BZLF1 gene of Epstein-Barr virus (EBV) transactiv ates an early EBV promoter and induces the virus productive cy cle. J. Virol. 63: 3109-3116. 20. Ruvolo, V., A. K. Gupta, and S. Swaminathan. 2001. Epstein-Barr virus SM protein interacts with mRNA in vivo and mediates a gene-specific increase in cytoplasmic mRNA. J. Virol. 75: 6033-6041. 21. Ruvolo, V., L. Sun, K. Howard, S. Sung, H. J. Delecluse, W. Hammerschmidt, and S. Swaminathan. 2004. Functional analysis of Epst ein-Barr virus SM protein: identification of amino acids essential for st ructure, transactiva tion, splicing inhibition, and virion production. J. Virol. 78: 340-352. 22. Ruvolo, V., E. Wang, S. Boyle, and S. Swaminathan. 1998. The Epstein-Barr virus nuclear protein SM is both a post-transcri ptional inhibi tor and activator of gene expression. Proc. Natl. Acad. Sci. U. S. A. 95: 8852-8857. 23. Sandri-Goldin, R. M. 2008. The many roles of the regulatory protein ICP27 during herpes simplex virus infection. Front. Biosci. 13: 5241-5256. 24. Sergeant, A., H. Gruffat, and E. Manet. 2008. The Epstein-Barr virus (EBV) protein EB is an mRNA export factor essent ial for virus produc tion. Front. Biosci. 13: 3798-3813.

PAGE 44

44 25. Swaminathan, S. 2005. Post-transcriptional gene regula tion by gamma herpesviruses. J. Cell. Biochem. 95: 698-711. 26. Takada, K. and Y. Ono. 1989. Synchronous and sequential activation of latently infected Epstein-Barr virus genomes. J. Virol. 63: 445-449. 27. Tanner J, Weis J, Fearon D, Whang Y, Kieff E. 1987. Epstein-Barr virus gp350/220 binding to the B lymphocyte C3d receptor me diates adsorption, capping, and endocytosis. Cell 50: 203-213. 28. Tsurumi, T. 1997. Molecular mechanism of lytic phase of Epstein-Barr virus DNA replication. Nippon Rinsho 55: 321-327. 29. Tsurumi, T. 1991. Primer terminus recognition and highly processive replication by Epstein-Barr virus DNA polymerase. Biochem. J. 280 ( Pt 3): 703-708. 30. Winkler, M., S. A. Rice, and T. Stamminger. 1994. UL69 of human cytomegalovirus, an open reading frame with homology to IC P27 of herpes simplex virus, encodes a transactivator of gene expression. J. Virol. 68: 3943-3954. 31. Zalani, S., E. Holley-Guthrie, and S. Kenney. 1996. Epstein-Barr viral latency is disrupted by the immediate-early BRLF1 protein through a cell-specific mechanism. Proc. Natl. Acad. Sci. U. S. A. 93: 9194-9199.

PAGE 45

45 BIOGRAPHICAL SKETCH Zhao Han was born in D alian, China and is the only child of Liping Zhang and Yichun Han. Zhao attended the University of Florid a from 1999 to 2004 where she pursued a Bachelor of Science degree in microbiology and cell sc ience with minors in chemistry and piano performance. During that time, Zhao was part of the University Scholars Program where she performed research measuring th e ratios of phospholamban and serca levels in hypertensive rats under the guidance of Dr. Harm Knot. In A ugust 2007, Zhao began her Master of Science degree in medical sciences under the supervision of Dr. Sankar Swaminathan. She completed her masters work and thesis in December 2008 a nd plans to continue he r education in medical school.