<%BANNER%>

Expression and Action of Selective Fibroblast Growth Factors during Pre-Attachment Bovine Conceptus Development

Permanent Link: http://ufdc.ufl.edu/UFE0024087/00001

Material Information

Title: Expression and Action of Selective Fibroblast Growth Factors during Pre-Attachment Bovine Conceptus Development
Physical Description: 1 online resource (113 p.)
Language: english
Creator: Cooke, Flavia
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: Animal Molecular and Cellular Biology -- Dissertations, Academic -- UF
Genre: Animal Molecular and Cellular Biology thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: The trophectoderm-derived factor interferon tau (IFNT) maintains the uterus in a pregnancy-receptive state during the early stages of pregnancy in cattle and sheep. Fibroblast growth factors (FGFs) are implicated in regulating IFNT expression and potentially other critical events associated with early conceptus development in cattle. Our overall objectives were to identify FGFs and FGF receptors (FGFRs) expressed in elongating, pre-attachment bovine conceptuses and determine if these FGFs regulate conceptus development and mediate IFNT production. In vitro-derived bovine blastocysts and in vivo-derived elongated conceptuses collected at d 17 of pregnancy express at least four FGFR subtypes (FGFR1c, FGFR2b, FGFR3c, and FGFR4). In addition, transcripts for FGF1, FGF2 and FGF10, but not FGF7 are present in elongated bovine conceptuses. The expression pattern of FGF10 most closely resembled that of IFNT, with both transcripts remaining low in d 8 and d 11 conceptuses and increasing substantially in d 14 and d 17 conceptuses. Supplementation with recombinant FGF1, FGF2 or FGF10 increased IFNT mRNA levels in bovine blastocysts. Blastocyst cell numbers were not affected by exposure of blastocysts to any of the FGFs. In summary, at least four FGFRs preside in pre- and peri-attachment bovine conceptuses. Moreover, conceptuses express at least three candidate FGFs during elongation, the time of peak IFNT expression. These findings provide new insight for how conceptus-derived factors such as FGF1, FGF2 and FGF10 may control IFNT production during early pregnancy in cattle.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Flavia Cooke.
Thesis: Thesis (M.S.)--University of Florida, 2008.
Local: Adviser: Ealy, Alan.
Local: Co-adviser: Hansen, Peter J.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0024087:00001

Permanent Link: http://ufdc.ufl.edu/UFE0024087/00001

Material Information

Title: Expression and Action of Selective Fibroblast Growth Factors during Pre-Attachment Bovine Conceptus Development
Physical Description: 1 online resource (113 p.)
Language: english
Creator: Cooke, Flavia
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: Animal Molecular and Cellular Biology -- Dissertations, Academic -- UF
Genre: Animal Molecular and Cellular Biology thesis, M.S.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: The trophectoderm-derived factor interferon tau (IFNT) maintains the uterus in a pregnancy-receptive state during the early stages of pregnancy in cattle and sheep. Fibroblast growth factors (FGFs) are implicated in regulating IFNT expression and potentially other critical events associated with early conceptus development in cattle. Our overall objectives were to identify FGFs and FGF receptors (FGFRs) expressed in elongating, pre-attachment bovine conceptuses and determine if these FGFs regulate conceptus development and mediate IFNT production. In vitro-derived bovine blastocysts and in vivo-derived elongated conceptuses collected at d 17 of pregnancy express at least four FGFR subtypes (FGFR1c, FGFR2b, FGFR3c, and FGFR4). In addition, transcripts for FGF1, FGF2 and FGF10, but not FGF7 are present in elongated bovine conceptuses. The expression pattern of FGF10 most closely resembled that of IFNT, with both transcripts remaining low in d 8 and d 11 conceptuses and increasing substantially in d 14 and d 17 conceptuses. Supplementation with recombinant FGF1, FGF2 or FGF10 increased IFNT mRNA levels in bovine blastocysts. Blastocyst cell numbers were not affected by exposure of blastocysts to any of the FGFs. In summary, at least four FGFRs preside in pre- and peri-attachment bovine conceptuses. Moreover, conceptuses express at least three candidate FGFs during elongation, the time of peak IFNT expression. These findings provide new insight for how conceptus-derived factors such as FGF1, FGF2 and FGF10 may control IFNT production during early pregnancy in cattle.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Flavia Cooke.
Thesis: Thesis (M.S.)--University of Florida, 2008.
Local: Adviser: Ealy, Alan.
Local: Co-adviser: Hansen, Peter J.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0024087:00001


This item has the following downloads:


Full Text

PAGE 1

EXPRESSION AND ACTION OF SELECTI VE FIBROBLAST GROWTH FACTORS DURING PRE-ATTACHMENT BOVINE CONCEPTUS DEVELOPMENT By FLAVIA NESTI TAYAR COOKE A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2008 1

PAGE 2

2008 Flavia Nesti Tayar Cooke 2

PAGE 3

To my husband Reinaldo, for his love and support. 3

PAGE 4

ACKNOWLEDGMENTS First and foremost I thank my advisor Dr. Alan Ealy, for giving me the opportunity of working in his lab. I feel forever grateful for everything he taught me; his guidance, dedication, and support; and in particular, his never-ending patience. I will carry for the rest of my life the experiences I acquired while working with him, which also contributed to my personal growth. I would like to thank Dr. Peter Hansen and Dr Karen Moore for serving on my committee. I am greatly thankful their assistance throughout these years. I thank everyone in Dr. Hansens lab for all the help with IVF whenever I need ed it. I also would like to thank Mr. William Rembert. Without him there would be no means of conducting my research. I cannot forget to acknowledge Dr. John Ar thington and Dr. William Thatcher, who gave me internship opportunities back in 2005 and 2006 at the Department of Animal Sciences. These amazing experiences instigated my passion for research. I thank Idania Alvarez for her precious guida nce, which also helped me in becoming a better scientist. I also thank my lab members, Kathleen Pennington and Qien Yang, as well as former lab members (Teresa Rodina, Claudia Klein, Krista DeRespino, Michelle Eroh and Jessica Van Syoc) for thei r help and friendship. I feel very privileged to have worked at th e Department of Animal Sciences for the past few years. One way or another, their help made the transition to graduate school much more enjoyable. Finally, I want to thank my husband Rein aldo. I do not have words to express my appreciation for everything he ha s done for me. The least I can do is to thank him for being part of my life. I also tha nk all my family and friends in Brazil, especially my parents Roberto and Sonia, and my sister Luiza. I know they wish to be present in this important step in my life, but they are in my heart, and I thank them a ll for their support, encouragement and love. 4

PAGE 5

TABLE OF CONTENTS Page ACKNOWLEDGMENTS ............................................................................................................... 4LIST OF TABLES ...........................................................................................................................7LIST OF FIGURES .........................................................................................................................8ABSTRACT ...................................................................................................................... ...............9CHAPTER 1 INTRODUCTION ................................................................................................................ ..112 LITERATURE REVIEW .......................................................................................................13Early Conceptus Development in Ruminants .........................................................................13Germ Layer Differentiation .............................................................................................14Conceptus Elongation ......................................................................................................15Implantation and Placenta Development .........................................................................16Maternal Recognition of Pr egnancy in Ruminants .................................................................19Discovery of IFNT ..........................................................................................................19Biological Roles of IFNT ................................................................................................20Interferon-tau Gene Expression .......................................................................................24Uterine Factors Affecting Conceptus Development in Mammals ..........................................25Fibroblast Growth Factors ......................................................................................................31Discovery and Identification of FGFs .............................................................................31Fibroblast Growth Factor Receptors ...............................................................................32Roles of FGFs During Early Conceptus Development ...........................................................35Fibroblast Growth Factor 2 .............................................................................................35Fibroblast Growth Factor 1 .............................................................................................37Fibroblast Growth Factors 7 and 10 ................................................................................38Fibroblast Growth Factor 4 .............................................................................................40Synopsis ...................................................................................................................... ............413 SEVERAL FIBROBLAST GROWTH FACTORS ARE EXPRESSED DURING PREATTACHMENT BOVINE CONCEP TUS DEVELOPMENT AND REGULATE IFNT EXPRESSION FROM TROPHECTODERM ........................................................................43Introduction .................................................................................................................. ...........43Results .....................................................................................................................................45Expression of FGFR Subtype in Bovine Conceptuses ....................................................45Expression and Abundance of FGF1, 2, 7 and 10 in Bovine Conceptuses .....................46Biological Activity of FGF1, 2 and 10 on Bovine Trophectoderm and In Vitro Produced Blastocysts ......................................................................................................47Discussion .................................................................................................................... ...........55 5

PAGE 6

Materials and Methods ...........................................................................................................60Animal Use and Tissue Collection ..................................................................................60Bovine in Vitro Embryo Production ................................................................................61End-Point RT-PCR ..........................................................................................................63Quantitative (q), Real-Time RT-PCR ..............................................................................64Statistical Analyses .......................................................................................................... 654 CONCLUSION .................................................................................................................. .....67APPENDIX A QUANTITATIVE REAL TI ME RT-PCR PROTOCOL .......................................................72B RELATIVE STANDARD CURVE MET HOD FOR ANALYZING qRT-PCR DATA .......76LIST OF REFERENCES ...............................................................................................................84BIOGRAPHICAL SKETCH .......................................................................................................113 6

PAGE 7

LIST OF TABLES Table Page 2-1 Specificity of the FGFs ligands for specific FGFRs isoforms ...........................................343-1 Relative concentrations of FGF and IFNT mRNA in bovine conceptus at different stages of development ........................................................................................................5 33-2 End-point RT-PCR primer sets used for discovery of FGFR subtypes and FGFs expressed during early bovine conceptus development .....................................................693-3 Primer sets used for SybrGreen qRT-PCR ........................................................................703-4 Primer/probe sets used for TaqMan qRT-PCR ..................................................................71 7

PAGE 8

LIST OF FIGURES Figure Page 3-1 Expression of FGFR subtypes in d 17 bovine conceptuses and CT-1 cells ......................493-2 Expression of FGFR subtypes in bovine in vitro produced blastocysts. ...........................503-3 Expression of FGF1, 2, 7 and 10 mRNA in d 17 bovine conceptuses ..............................513-4 Expression profiles of FGF1 FGF2 and FGF10 during bovine conceptus development ................................................................................................................... ....523-5 Effect of FGF1, FGF2, or FGF10 supplementation on IFNT mRNA concentrations and blastomere numbers in cu ltured bovine blastocysts ....................................................544-1 Proposed model of expression and action of selective FGF during pre-attachment bovine conceptus development. .........................................................................................68 8

PAGE 9

Abstract of Thesis Presen ted to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science EXPRESSION AND ACTION OF SELECTI VE FIBROBLAST GROWTH FACTORS DURING PRE-ATTACHMENT BOVINE CONCEPTUS DEVELOPMENT By Flavia Nesti Tayar Cooke December 2008 Chair: Alan D. Ealy Major: Animal Molecula r and Cellular Biology The trophectoderm-derived fact or interferon tau (IFNT) maintains the uterus in a pregnancy-receptive state during the early stages of pregnancy in cattle and sheep. Fibroblast growth factors (FGFs) are implicated in regulating IFNT expression and potentially other critical events associated with early conceptus developm ent in cattle. Our overall objectives were to identify FGFs and FGF receptors (FGFRs ) expressed in elongating, pre-attachment bovine conceptuses and determine if these FGFs regul ate conceptus development and mediate IFNT production. In vitro -derived bovine blastocysts and in vivo -derived elongated conceptuses collected at d 17 of pregna ncy express at least four FGFR subtypes (FGFR1c, FGFR2b, FGFR3c, and FGFR4). In addition, transcripts for FGF1, FGF2 and FGF10, but not FGF7 are present in elongated bovine conceptu ses. The expression pattern of FGF10 most closely resembled that of IFNT with both transcripts remaining low in d 8 and d 11 conceptuses and increasing substantially in d 14 and d 17 concep tuses. Supplementation with recombinant FGF1, FGF2 or FGF10 increased IFNT mRNA levels in bovine blastocy sts. Blastocyst cell numbers were not affected by exposure of blastocysts to any of the FGFs. In summary, at least four FGFRs preside in preand peri-attachment bovine conceptuses. Moreover, conceptuses express 9

PAGE 10

10 at least three candidate FGFs during elongation, the time of peak IFNT expression. These findings provide new insight for how conceptus-derived factors such as FGF1, FGF2 and FGF10 may control IFNT production duri ng early pregnancy in cattle.

PAGE 11

CHAPTER 1 INTRODUCTION Several crucial developmental events must occur during the early phases of conceptus growth and proliferation in order for the pregna ncy to survive to term. Embryonic cells begin to divide right after fertilization a nd the continuous prolif eration and differentiation of these cells generates the embryonic and extraembryonic tissues that form the fetus and placenta. During the initial phases of development, the conceptus an nounces its presence to the maternal reproductive system and initiates physiological modifications that maintain a pregnancy-receptive uterus [1]. In cattle and sheep, sustaining a uterine-recepti ve state, which is a progesterone-dominated environment, occurs because of placental producti on of a Type I interferon, termed interferon-tau (IFNT). Ideal development of the initial pl acental tissue lineage (trophectoderm cells) and sufficient production of IFNT are, therefore, essential for pre gnancy success in cattle and presumably other ruminants. Approximately 57% of all failed pregnancies in cattle occur due to early conceptus mortality, which typically happens between d 3 to 21 of gestation [1]. Problems associated with reproduction in beef and dair y cattle result in extended calving intervals, decreased lifetime milk production, and increased nu mber of artificial inse minations required to produce one live calf [2]. These issu es typically result in signifi cant economical loss, especially for dairy producers, which can lose an averag e of $550 in lifetime milk potential with each reproductive cycle that fails to produce a calf [3]. Researchers are beginning to uncover uterineand/or concep tus-derived factors expressed during early conceptus development that may be associated with pre-attachment conceptus development and IFNT production in cattle and other ruminants. The focus of this thesis is to discuss how conceptus development normally occurs in cattle, explain some of the basic concepts of maternal recognition of pregnancy in cattle, descri be how uterine-derived factors 11

PAGE 12

may impact preand peri-attachment conceptus development, and evaluate a group of factors, termed fibroblast growth factors (FGFs), that ap pear to be playing active roles in conceptus development by regulating IFNT expression during early pregnancy in bovids. 12

PAGE 13

CHAPTER 2 LITERATURE REVIEW Early Conceptus Development in Ruminants Conceptus development begins right after fertilization, when embryonic cells start to divide. Fertilization is the process in which male and female pronuclei fuse to result in the creation of a new diploid organi sm [4]. Once syngamy occurs, the zygote undergoes mitosis and these cleavage divisions generate embryonic cell s termed blastomeres. This newly formed structure is generally classified as a conceptus because it contains the ce lls that eventually will form both the embryonic and extraembryonic components of a fetal/placental unit. The first few cell divisions occur within the oviduct and durin g the 8 to 16-cell stage of development, or approximately 96 hour post fertilization, the bovine conceptus enters the uterine body. As the conceptus undergoes further mitotic divisions cells can no longer be visual ized and the resulting mass of cells is classified as morula. The first differentiation step in conceptus de velopment forms a structure that contains both embryonic and extraembryonic cells. This struct ure, referred to as a blastocyst, contains flattened outer trophoblast cells and pluripoten t inner cell mass cells. Fluid accumulation in the center of the conceptus forms a cavity named the blastocoele [5, 6]. Tight -junction formation is a prerequisite for blastocoele formation and expans ion of the blastocyst. Th e timing of blastocoele formation varies among individual conceptuses and depends on the amount of fluid entering the cavity and the rate of tight junction formation among blastomeres [5, 7, 8]. The formation of the blastocoele usually occurs between d 7 and 9 post-fertilization in cattle. The blastocyst is now composed of two distinct cell populations: 1) inner cell mass (ICM) and 2) trophectoderm. The latter will give rise to the out er layer of the placenta, whereas the ICM, also termed embryonic 13

PAGE 14

disc or epiblast [5], will provide the cells that ev entually develop into the three germ layers of the conceptus and extraembryonic membranes [9]. Germ Layer Differentiation During the first mitotic divisions, from 2 to 8-cell stages, blastomeres are considered totipotent, which is a term used to describe cells containing the potential to develop into all the cell and tissue types needed to form an indi vidual [10]. As conceptus development advances, this characteristic rema ins in some blastomeres, but not others. The ICM and trophectoderm are sources of embryonic stem cells and trophoblastic stem cells, respectively; however, some differences exist between these two cell populations. The ICM c ontains factors detected in embryonic stem cells ( OCT4, SOX2 and NANOG [11-13]) that appear to be crucial for totipotency. In contrast, the trophectoderm does not produce these f actors [14]. Rather trophectoderm cells produce their own set of f actors thought to be invol ved with trophectoderm formation and maintenance (examples include CDX2 DLX3 and EOMES [15-17]). Following the first mitotic divisions, subs equent conceptus development depends on shedding of the zona pellucida, which occurs at approximately d 9 to 10 of development. The pressure promoted by the growing and fluid-filled blastocyst induc es a small tear in the zona pellucida, which allows the blastocyst to escape from the zona pellucida in a process termed hatching [18, 19]. Once hatched, the ICM becomes mo re prominent (now termed epiblast) and is overlaid by a thin layer of troph ectoderm cells, referred to as Ra ubers layer [18]. As conceptus development progresses, the trophoblastic cells fo rming the Raubers laye r degenerate [18, 20]. Through this process, the epiblast becomes exposed to the external environment and the embryonic disc is established. During the following several days of development, the growing bovine and ovine conceptus remains free floating in the uter ine lumen, while embryonic and extraembryonic 14

PAGE 15

development continues [5]. Several placental tissu es form during the second week of pregnancy. Extraembryonic endoderm emerges from the ICM between d 8 and 10 and underlies the trophectoderm. These cells will eventually designat e the inner-most layer of the yolk sac. On d 12 to 14 post-fertilization, the outer cells of the ICM begin to polarize and will form the embryonic ectoderm [5]. Between d 14 and 16, an extraembryonic mesoderm migrates from the ICM between the trophectoderm and endoderm and separates the yolk and amniotic sacs. It eventually will form the inner border of the chorion and outer-most layer of the umbilical cord [21]. Gastrulation is a process invol ving complex cellular migrations that occur to form the primitive streak. In cattle, the initial formation of precursor cells for the primitive streak begins on d 14 of development, when the invagination of ce lls from the internal surface of the epiblast takes place. Brachyury, a marker for mesoderm form ation, is expressed in bovine conceptuses at this developmental period [22]. Between days 14 and 21 of development, a series of additional developmental events occurs within the epib last. These events include the completion of gastrulation, neurulation and ev entual formation of somites [20, 22]. A second extraembryonic mesoderm, termed the allantois, also emerges around this period of development [5, 20, 23]. Lastly, the encroachment of mesoderm and inve rsion of the trophectoderm causes the aminiotic cavity to form. Finally, between d 20 and 22 of development, a heartbeat is detectable by ultrasonography [24]. Conceptus Elongation After hatching from the zona pellucida between d 8 and 10 post-fertilization, the conceptus undergoes a dramatic physical transf ormation and progresses from a spherical to a tubular shape over the course of just a few days. This process happens concurrently with the rise of embryonic cell layers, usually between d 14 and 16 of pregnancy in cattle [5, 21]. Around d 15

PAGE 16

12-13 of development, bovine conceptuses usuall y are spherical in shape, measuring about 0.5 mm in diameter, and between d 14 and 16 th e conceptuses become more tubular and filamentous, though a wide range of shapes and lengths have been described [5, 20, 25]. At approximately d 17 to 18 of development, the conceptus may inhabit twothirds of the uterine horn ipsilateral to the ovary c ontaining the corpus luteum, sometimes reaching more than 160 mm [26]. As trophectoderm cell proliferation continues, by d 18 to 21 the conceptus reaches a significant length. Typically, the con ceptus occupies the entire length of the uterine horn, as well as part of the contralateral horn, and most vi able pregnancies usually will be comprised of embryonic disks that are at least 2.86 cm in lengt h and trophectoderm that span 30 cm in length [20]. Implantation and Placenta Development The extensive trophectoderm growth and remo deling that occurs during the second and third weeks of pregnancy are thought to be a prequel for two upcoming events: 1) the communication between conceptus and the maternal system that is commonly referred to as maternal recognition of pregnancy, and 2) apposi tion, adhesion and implantation processes that eventually form the placenta. Maternal recognition of pregnancy will be described later in this review, whereas a discussion on implantation will follow. Implantation is the term used to describe the transitional stage of pregnancy, when the conceptus at taches to the endometrium and begins to exchange substances with the uterus [27, 28]. The timing of implantation varies among species. In mice and humans implantation begins at d 4 and 9 post-fertilization, respectively, but in sheep and cattle, apposition and adhesion events that initiate the implantation process are not initiated until around d 15 and 19, respectively [29]. Apposition of the conceptus involves the trophectoderm becoming closely associated with the endometrial luminal epithelium follo wed by unstable adhesion [30]. The apposition of 16

PAGE 17

the blastocyst is ensured by interdigitation of cytoplasmic projections of the trophectoderm cells and uterine epithelial mi crovilli [31, 32]. In sheep, apposition oc curs first in the surrounding area of the inner cell mass, and spreads toward the ex tremity of the elongated conceptus [30]. On d 16 of development, the trophoblast begins to adhere firmly to the endometrial luminal epithelium. Uterine flushing to recover the conceptus causes s uperficial structural damage at this time [30]. Adhesion of the trophectoderm to the endomet rial luminal epithelium progresses along the uterine horn and appears to be completed around d 22 in the sheep [32]. In ruminants, the uterine glands are also sites of apposition [32, 33]. Be tween the caruncles, the trophoblast develops finger-like papillae, which penetrate into the mouths of the superficial ducts of the uterine glands between d 15 and 18 in sheep [32, 34]. Similar f eatures were described in the cow conceptus from d 15 of pregnancy, but, curiously, the goat conceptus lacked trophob last papillae [30]. Some mechanisms for apposition and adhesion have been described in a number of mammalian uteri. Progesterone receptors (PR) are expressed in the endometrial epithelia and stroma during the early to midluteal phase, but its e xpression decreases immediately before implantation [35, 36]. Therefore, regulation of endometrial epithelial function during the periimplantation period may be dependent on loss of epithelial cell PR and/or be directed by specific factors produced by PR-positive stromal cells [35, 36] The loss of the PR by the endometrial epithelium can be directly correlated with reduced expression of certain genes, such as the antiadhesive protein MUC1. Furthermore, PR loss in the endometrial glandular epithelium appears to be required for the onset of expression of other genes during pregnancy, such as galectin-15, osteopontin and ovine uterine serpins (or uterine milk proteins) [30]. The degree of separation between fetal and maternal blood supplies differs among mammals. In general, placentae can be classified into one of two major groups: superficial or 17

PAGE 18

invasive [37]. In rodents and primates a hemoch orial placentation occurs During this type of invasive implantation, trophoblast cells build a highly conductive st ream bed for maternal blood, which allows for adequate maternal blood flow at low placental blood pressure forms [38]. In ruminants, a superficial implantation occurs, but unlike the superficial placenta formed in other mammals such as the pig, ruminants posses a li mited amount of placental invasion that forms a cotyledonary, synepitheliochoria l placentation [39]. Synepithe liochorial placentation involves the fusion of placental cotyledons with endometri al caruncles to form structures known as placentomes, which serve a primary role in fe talmaternal gas exchange and derivation of nutrients by the placenta [21, 33, 37, 39]. Placentome formation begins approximately at d 21 in cattle and attachment is normally completed by d 40 of pregnancy [40]. Placentomes grow throughout gestation, and the increase in their surface area promotes nutrient, gas and waste exchange between the mother and the fetus, and functions as a barrier by preventing the migration of non-placental cells across the two indi viduals [41]. Cattle have anywhere from 70 to 120 placentomes that are spread across the uter ine surface [39]. These placentomes are found in both uterine horns, but are larger in the horn that contains the fetu s. Towards the end of gestation in cattle, placentomes can reach 10-12 cm of length and 1-3 cm of thickness [21, 39]. An interesting feature of bovine and ovine pl acentae is the presence of binucleate cells (BNC), which represent trophectodermal cells that migrate from the trophoblast to the maternal epithelium and promote endometrial invasion in ruminants [39, 42-44]. The BNC have at least two main functions: 1) to form a hybrid fe to-maternal syncytium essential for successful implantation and subsequent placentomal growth, and 2) to synthesize and secrete protein and steroid hormones, such as placental lactogen and progesterone, that regulate maternal physiology [30, 35, 39, 45]. These cells are derived from mononucleate trophectoderm cells and experience 18

PAGE 19

a process termed acytokinesis, in which nuclear division occurs without cytoplasmic division. Once they become binucleate, the cells migrate to the maternal epithelium and fuse with maternal epithelial cells to form trinucleate hybrid cells. The lyses of these giant placentaluterine cells generate the sync ytium during early pregnancy [39, 43, 44]. In cows, these cells are first detected around d 16 to 17 of pregnancy, an d represent about 20% of all the trophectoderm cells by d 25 of pregnancy. A few days before pa rturition there is a significant decrease in BNC number [39, 46, 47]. The presen ce of BNC throughout gestation likely assists with uterineplacental communication and promotes nutrient and gas exchange [39]. The secretory capacity of BNC is attributed to their large secretory orga nelles, which compose about 50% of their volume [39, 42]. Maternal Recognition of Pregnancy in Ruminants In most mammals, critical biochemical events must take place during early pregnancy in order for the newly formed conceptus to develop beyond the length of a normal estrous or menstrual cycle. In many mammals, a concep tus-derived signal prompts continued corpus luteum (CL) function and its production of progest erone sustains a pregnant-receptive state in the uterus for either a portion or the entire pre gnancy depending on whether placental sources of progesterone eventually take over as the primary progesterone source. If the conceptus fails to initiate this procedure, the mother returns to estr us and the pregnancy is lost. In cattle, sheep and presumably other ruminants, the key factor invo lved with this process is a protein termed interferon-tau (IFNT). Discovery of IFNT The first descriptions of maternal recognition of pregnancy in ruminants were studied in sheep and cattle by Drs. Moor and Rowson. Through conceptus transfer and removal experiments, they determined that the presen ce of a viable embryo on d 12 in ewes and on d 16 19

PAGE 20

in cows was required for maintenance of the CL [48-53]. In related work, they used conceptusderived products to artificially le ngthen the lifespan of the CL [ 48]. In 1979, Martal et al. [53] determined that injections of homogenates or pr otein extracts from d 14 to 16 ovine conceptuses effectively extended the life of the CL beyond the time of a normal estrous cycle, whereas homogenates from d 21 to 23 ovine embryos did not have this effect [53]. This conceptusderived substance was termed trophoblastin. In subse quent work at the University of Florida, a series of low molecular wei ght proteins (19 to 26 kDa) produced by ovine and bovine conceptuses was identified during this time when conceptuses are able to produce a substance to sustain CL function [54-57]. A purified prepara tion of these proteins, termed ovine trophoblast protein-1 (oTP-1), prolonged lute al actions after injection into the uterine lumen of non-pregnant ewes [57]. Soon thereafter, puta tive oTP-1 cDNA was identified from an ovine conceptus cDNA expression library by screening with antiserum di rected against oTP-1. Sequencing determined that the cDNA was structurally similar to Type I IF Ns, a family of proteins that include the alpha ( ), beta ( ), omega ( ), and delta ( ) IFNs [58]. Consequently, oTP-1 and bTP-1 (the bovine counterpart) have since been refe rred to as IFNT to reflect their designation as a trophectodermderived IFN. Biological Roles of IFNT The estrous cycle in ruminants is a uterinedependent system that promotes spontaneous ovulation. The basic events of CL regression are well described [ 59, 60]. In brief, during late diestrus (between d 13 and 15 post-estrus in the sheep and d 17 and 20 post-estrus in the cow), oxytocin-dependent pulses of prostaglandin F2 (PGF2 ) are released from the endometrium and reach the ovaries to induce the functional and st ructural regression of the CL [61]. The CL produces and stores oxytocin, which is then released in response to PGF2 stimulation and causes subsequent pulses of uterine PGF2 release. The luminal and supe rficial glandular epithelium are 20

PAGE 21

primary sources of PGF2 during luteolysis, and oxytocin acts on these target tissues by binding to its plasma membrane-associated receptor, whic h is expressed late in diestrus during the initiation of the regres sion of CL [62, 63]. The primary function of IFNT during early pr egnancy is to extend the lifespan of CL by preventing oxytocin-mediated release of endometrial PGF2 during late diestrus [64-66]. In a pregnant animal, oxytocin receptors are not ex pressed on the luminal a nd glandular epithelial endometrium at the time of normal luteolysis [62, 63], and the amount and frequency of PGF2 pulses is decreased and usually totally abolished. In the sheep, IFNT controls oxytocin receptor expression indirectly by limiting the expression of estrogen receptors [60]. A similar event occurs in cattle, although the ant iluteolytic mechanism seems to be more complex. In pregnant cows, IFNT induces down-regulation of the oxytoc in receptor before any changes in estrogen receptor abundance is noted [67-69]. Therefore, it appears that IFNT is able to affect estrogen receptor activity prior to its down-regulation in the bovine endometrium [70, 71]. The extension of luteal activity and the duration of estrous cycle can be manipulated in non-pregnant sheep and cattle by providing exogenous IFNT into the uterine lumen, and thus creating a pseudopregnancy to assess how IFNT acts to prevent CL regression [57, 72-75]. This approach was also used to describe differences in antiluteolytic activity of specific IFNT isoforms [73, 76]. The suppression of oxytocin-induced PGF2 release may not be the only way IFNT prevents luteolysis. It also appears to modify prostaglandin metabolism in the endometrium early in gestation, and this may represent a second way by which IFNT extends luteal activity in ruminants. The synthesis of endo metrial-derived prostaglandins is mediated by several enzymes. Phospholipase A2 (PLA2) cleaves membrane-bound phospholip ids to generate arachidonic acid 21

PAGE 22

[77]. This acid is then co nverted to prostaglandin-H2 (PGH2) by cyclooxygenase-1 and -2, which are also known as prostaglandin endoperoxide H synthases 1 and 2 (PGHS1 and PGHS2). PGH2 is then converted to several other PGs by specific enzymes, including PGE and PGF synthases (PTGES and PTGFS, respectiv ely), which generate PGE2 and PGF2 respectively. Recombinant bovine IFNT is able to stim ulate the secretion of PGE2, thus enhancing the PGE2/PGF2 ratio [78]. A biphasic prostaglandin response to IF NT treatment has been described by several authors. Lower levels of IFNT similar to leve ls found during early conceptus development at the time of maternal recognition of pregnancy suppress PGHS2 expression in primary bovine endometrial cells or a bovine endometrial cell line (BEND ce lls) [79-81]. Conversely, exposure to high concentrations of IFNT in these cell types, similar to the levels found in the uterus after pregnancy recognition, stimulates PGHS2 expression [79, 81]. In conclusion, IFNT appears to shift prostaglandin sy nthesis away from PGF2 and towards PGE2, consequently allowing the putative luteotrophic activity of this prostaglandin to support CL maintenance [82-85]. Type I IFNs also contain immunosuppressive, antiviral and antiprolif erative activities, and it is possible that these acti ons play a role during pregnancy maintenance in cattle, sheep and other ruminants. IFNT inhibits the prolifera tion of cultured lymphocyt es [86, 87], and reduces the production of mitogen-stimul ated or certain mixed subpopul ation of lymphocytes [86, 8891]. IFNT also increases granulocyte chemotactic protein-2 synthesis in the endometrium, which in turn stimulates natural kill er cells [92, 93]. Moreover, IFNT controls the expression of major histocompatibility complex (MHC) class I molecules in the luminal epithelium during placentation [94]. These activities may be critic al for the newly formed conceptus to not be mistaken as a foreign structure, while in the maternal environment. 22

PAGE 23

It also is evident that IFNT mediates the e xpression of several uterin e-derived factors that may play facilitative roles during early pregnancy. One factor of key interest is ubiquitin cross reactive protein (UCRP), also known as IFN-stimulated gene-15 or -17 ( ISG15 or ISG17) [9597]. Bovine UCRP conjugates to endometrial cytosolic proteins, and it has been proposed that the regulation and/or degradation of endometrial proteins by UCRP support the establishment and maintenance of pregnancy in ruminants [98]. IFNT also induces the expression of granulocyte chemotactic protein-2, also known as chemokine ligand 6 (CXCL6), which plays an important role in chemotaxis and immune responses to stimulants [93]. There are many others IFNTinduced uterine proteins, includ ing MX proteins [99-101], 2-o ligoadenylate synthetase [102], 2-microglobulin [103], signal-transducer and activator of transcript (STAT) -1 and -2, interferon regulatory factors (IRF) -1 and -9 [104], and a member of the 1-8 family known as Leu13 [105]. MX proteins are recognized for th eir part in the antiviral resp onse, but whether they have a critical activity during early pregnancy it is not known [100, 101, 106]. 2-oligoadenylate synthetase activates ribonuclease L (RNAse L) which is a constitutively expressed latent endonuclease. RNAse L cleaves viral and cellu lar RNA and reduces viral replication and initiation of apoptosis in some cell types [ 102, 107, 108]. However, like MX proteins, its role during maternal recognition of pregnancy remains unclear. eta-2-microglobulin recognizes foreign antigens and targets them for eliminati on from the endometrium [94]. The simultaneous induction of STAT-1 and STAT-2 and IRF-1and IRF-9 gene expression by IFNT may regulate endometrial estrogen receptor and, perhaps, oxytocin receptor expres sion during pregnancy recognition in ewes [104]. Leu13, which is known for its involvement in adhesion, wound healing and inflammatory responses, is localized primarily in the glandular epithelium and therefore is proposed to be important during placental adhesion [105, 109-111]. 23

PAGE 24

Interferon-tau Gene Expression Type I IFN are expressed by a variety of cell types, however the expression of the IFNT gene is unique in at l east a few aspects. Firstly, IFNT expression is not induced by viral stimuli. The majority of Type I and Type II (IFN ) IFNs are stimulated during a virus or pathogen challenge, whereas IFNT mRNA expression is not detected under such circumstances [112, 113]. In addition, transcripts for IFNT are localized exclusively in the trophectoderm [56], and IFNT expression is sustained for several days prio r to implantation [114-116] Also, constitutive expression of IFNT is limited to a short period of time that coincides with the timing of maternal recognition of pregnancy. IFNT protein levels can be assessed in conditioned medium as early as the late morula or early blastocyst stage (d 6 and 7 of development) [117, 118]. The abundance of IFNT mRNA peaks at d 13 and 14 post-fertiliza tion in cattle conceptuses, whereas the synthesis of IFNT protein continues to increase between d 13 and 19 of development [54, 73, 115, 119, 120]. The extensive protein production that occurs during this period is due mainly to the significant elongation of the trophectoderm occurri ng at this time [54, 55, 121, 122]. High levels of IFNT mRNA can be detected until approximately d 19 to 21 post-fert ilization in cattle, and only low levels exist by d 25 [73, 115, 119]. It has been proposed that the contact between the trophectoderm and the epithelia l endometrium sets the end of IFNT expression [116]. It is known that trophectoderm cells in direct contac t with endometrium cease to produce IFNT, but the mechanism behind this phenom enon remains speculative [123]. The necessity for IFNs as pregnancy recognition factors likely is limited to cattle, sheep and presumably other ruminants. However, several IFNs are expressed by placental tissues in other mammals. Antiviral activity associated with IFN production is present in the mouse placenta [124]. In the human and mouse, IFN is expressed by the placenta throughout pregnancy, and it is thought that this IFN regulates uterine gene expression and immune 24

PAGE 25

responses to pathogens [125-128]. In the pig, IFN and Type II IFN, or IFN is produced by the trophectoderm during the peri-imp lantation period [129-131]. Ne ither IFN has been found to sustain CL function beyond the length of a norma l estrous cycle when provided into the uterine lumen of non-pregnant gilts [132]. Therefore, it a ppears that a facilitative IFN system present in several mammals was converted into a require d component of pregna ncy recognition in an ancestor to present day ruminants shortly after th ey diverged from other Artiodactyls. It is proposed that the unique IFNT expression pattern likely wa s acquired as the ancestral IFNT gene was created in percoran ruminant ancestors by duplication of the IFN gene, in which the promoter region of the new IFNT gene was substituted by sequences that allowed placentalspecific gene expression [ 114, 133, 134]. Transcripts for IFNT have been identified in the Bovidae, Cervidae and Giraffidae families by Sout hern Blot analysis, but comparable genes could not be found in other mammalian species [133, 135]. To summarize, it is clear that IFNT is critical for the es tablishment and maintenance of pregnancy in sheep, cattle and likely other rumina nts due to its ability to extend the lifespan of CL when the maternal environment is responsive to IFNT. In this scenario, oxytocin-mediated release of endometrial PGF2 during late diestrus is prevented and the conceptus has a chance to survive and the pregnancy be sustained to term. Uterine Factors Affecting Conceptus Development in Mammals The maternal uterus provides a variety of nut rients, enzymes, growth factors, cytokines, lymphokines, hormones, transport proteins, and other substances crucial for conceptus growth [136]. Although early-stage conceptuses can develop in simple culture media in vitro in the absence of exogenous growth factors during the first few days of development, there is increasing evidence that essential autocrine and paracrine factors are required for sustaining blastomere cell survival and differentiation [ 137, 138]. Moreover, histotrophic secretions from 25

PAGE 26

the endometrial epithelia are required for peri-implantation blastocy st survival and elongation in sheep. This hypothesis is supported by results from studies of the ut erine gland knockout (UGKO) ewe [139, 140]. The UGKO ewe model is pr oduced by continuous administration of a synthetic progestin to neonatal ewes from birth to postnatal d 56 [141]. This treatment ablates differentiation and development of the glandular epithelia without alteri ng development of the stromal endometrium, myometrium, and other re productive tract structures. It also does not appear to have any adverse effects on th e hypothalamicpituitaryovarian axis [139, 141]. UGKO ewes experience early pregnancy loss in whic h the blastocyst fails to elongate. Transfer of blastocysts from normal fertile ewes into the uteri of timed recipient UGKO ewes produced the same outcome [139]. Morphologi cally normal blastocysts are pr esent in uterine flushes of bred UGKO ewes on d 6 and 9 after mating, but not on d 14 [139, 140]. On d 14, uterine flushes of mated UGKO ewes contain either no concep tus or a severely gr owth-retarded tubular conceptus. Several hormones have been implicated as embryotrophic, or more precisely as conceptus-tropic agents during pr eand peri-attachment developm ent in cattle and sheep. One of the best studied factors in this regard is insulin-like growth factor 1 (IGF1) [142-145]. It is present in the uterus and placenta of several species, including rats [146], humans [146, 147], pigs [148], sheep [149, 150] and cows [151, 152]. Many studies have associated IGF1 as an embryotrophic factor in porcine murine, human and bovine conceptus development [153, 154]. One apparently important action of IGF1 during in itial cleavage stage development is as a cell survival agent, where it can decr ease the rate of apoptosis during in vitro culture [155, 156]. In addition, IGF1 restricts the detrimental effects of heat shock in bovine conceptus culture [157], and supplementation with IGF1 prior to concep tus transfer increase s pregnancy rates of in vitro 26

PAGE 27

produced bovine conceptus transferred into recipients maintained under heat stress conditions [158, 159]. Several uterine-derived factors are critical for conceptus development in mice. Included among factors that promote early in vitro conceptus development are transforming growth factor beta (TGFB), platelet-derived growth factor (PDGF), insulin growth factor 2 (IGF2), and epithelial growth factor (EGF ) [160-162]. Transcripts for thes e putative embryotrophic factors are detectable throughout pre-implantation develo pment in cattle, sugges ting their potential for facilitating conceptus development in this sp ecies [161, 163, 164]. Certainly a subset of these factors impact early cleavage development in culture. Supplementation with PDGF from the onecell to blastocyst stage increas ed bovine conceptus growth beyond the 16-cell stage, but did not increase blastocyst rate [163, 164]. By contrast transforming growth f actor alpha (TGFA) was able to raise the percentage of blastocyst in this study. The endometrial-derived factor granulocyte-macrophage colony stimulating factor (GMCSF) also is implicated as a regulator of th e growth and development of the pre-implantation embryo. It is secreted into the oviduct and ut erus during the period following conception and promotes blastocyst development in vitro in porcine [165] and bovi ne conceptuses [166-168]. Also, there is some exciting new evidence from work completed at the University of Florida that GM-CSF enhances embryo survival after transfer into recipient cows (Loureiro and Hansen, unpublished observations). Therefore, current findings suggest the use of GM-CSF as an embryotrophic factor during ea rly conceptus development in vitro. Another endometrial-derived f actor associated with conceptus development in some species is leukemia inhibitory fact or (LIF) [169]. Transcripts and/or protein of maternal LIF were found in the uterus of mice [170, 171], human [172, 173], ewes [174] and cows [175] around the 27

PAGE 28

time of implantation and placental attachment. Th e benefits of LIF dur ing later stages of embryogenesis and placental attachment/migratio n are well understood in mice [169, 176]. LIF primarily controls proliferati on in the pre-implantation blasto cyst [177], and enhances preimplantation embryo development including blas tocyst, expanded blas tocyst, and hatching blastocyst stages in mice [169]. In culture, LIF improves blastocyst development and conceptus growth in mice [178, 179]. LIF also is implicated in controlling early conceptus development in sheep and cows. In sheep, LIF increases the percentage of in vitro blastocyst hatching and increases pregnancy rates for in vitro cultured embryos transferred back into recipient ewes [180]. The presence of bovine LIF in the cultur e medium between d 5 and 10 improved hatching rate and increased trophectode rm cell numbers of bovine in vitro produced conceptus [181]. In cattle, embryonic stem-like cells have been cu ltured both with [182] and without [183] LIF added to the culture medium, suggesting th at, like their human counterparts [184-186], differentiation of bovine embryonic stem-like ce lls is not suppressed by LIF [187-189]. More recently, the effects of LIF on in vitro produced bovine embryos and their outgrowth colonies were studied. Addition of LIF to the cultu re medium was not beneficial for bovine in vitro embryonic development based on several measures such as growth kinetics, morphology, cell count, expression of OCT4 and expression of laminin, a matrix protein that plays an important role in hypoblast and epiblast formation [190]. Moreover, LIF had no apparent effect on the subsequent formation of putative embryonic st em-like cell outgrowth colonies from such embryos when added to the culture medium [190 ]. Therefore, it remains unclear whether LIF contains an activity that is essential for early bovine conceptus development. Hormones not normally associated with reproductive processes also may be important for early conceptus development. In rats, the calcium-sequestering hor mone, calcitonin (CT), 28

PAGE 29

represents one such factor [191] Prior the onset of implantation, CT is up-regulated by progesterone in rat and mice uter ine epithelial cells between d 3 and 4 of pregnancy [192-194]. Moreover, limiting CT production wi th RNA-interference restricts blastocyst implantation in rats [195]. In rodents, the tem poral expression pattern of CT mRNA in the pregnant uterus coincides with the appearance of immunoreactive CT in th e uterine glands [192]. Calcitonin appears to accelerate blastocyst differentiation by alteri ng the developmental program of the embryo. Binding of CT to its receptor activates ad enylate cyclase and induces intracellular Ca2+ signaling [196-199]. Therefore, CT may reset the developmental clock through Ca2+ signaling and influence events that occur much later. Ca2+ signaling rapidly alters gene expression at the blastocyst stage [200]. The cell cycle is also influenced by Ca2+ signaling [201], and cell numbers are increased in pre-implantation concep tuses exposed to pharmacological agents that raise the levels of intracellular Ca2+ [202, 203]. To summarize, it is obvious that the mouse conceptus expresses CT and it may play a role during conc eptus development. However, the exact function of CT in promoting embryo-ut erine interactions is not clearly understood. Uterine Factors and IFNT Production The maternal system plays an active role in modulating IFNT production during early gestation, and several uterine-derived factors ha ve been implicated in controlling trophectoderm proliferation and IFNT secretion in cattle and sheep. In vitro produced bovine blastocysts contain IFNT mRNA and protein at d 7 of de velopment [117, 204], indicating that IFNT expression can be initiated during in vitro development. However, up-regulation in IFNT expression around the time of conceptus elongation cannot be replicated in culture either because uterine-derived factors that control this event are absent fr om these cultures or because conceptus gene 29

PAGE 30

expression is globally affected by the lack of uterine-derived factors controlling normal conceptus development. Several uterine factors have been implicated as regulators of IF NT production in ewes and cows. Treatment with a combination of IG F1 and IGF2 in cultured ovine conceptuses increase IFNT production than their control counte rparts and conceptuses treated with IGF1 or IGF2 separately [205]. It remains unclear whether the combinatorial actions of IGF1 and IGF2 are directly affecting IFNT expression or if they are ac ting indirectly by encouraging trophectoderm proliferation and survival in culture. Also, the beneficial e ffects of IGF1 at least are restricted to the ICM since IGF receptors ar e found exclusively in the ICM in cattle [206]. Supplementation with GM-CSF induces bovine c onceptus development [166-168]; however it is unclear whether GM-CSF and/or IL3 have the ability to stimulate both IFNT mRNA and protein synthesis in ruminants. GM-CSF in creases the secretion of IFNT in ovine conceptuses [207] but not in bovine conceptuses [208]. This difference could be related to the concentration of GMCSF tested in those studies. Interestingly, the expression of GM-CSF may be regulated by IFNT. Current evidence suggests that trophectoderm-derived IF NT regulates uterine expression of GM-CSF in the bovine immune and reproductive systems [209, 210]. However, one can speculate that this effect would be indirect because it may be cause d by the IFNT stimulation of PGE2 production in the endometrium. This event in turn stimulates GM-CSF expression in uterine lymphocytes and endometrium [211]. Nevertheless, other reports suggest that, in ruminants, the conceptus has the ability for local modulation of the production of cytokines and growth f actors such as GM-CSF that, in turn, may sustain developmen t and maintain pregnancy [209, 210]. 30

PAGE 31

In conclusion, a select few au tocrine and paracrine factors originally studied for their ability to promote blastomere cell survival and differentiation may also be playing a vital role during conceptus development by mediating IFNT production. Recently, this laboratory discovered a new uterine-deri ved product that controls IFNT expression [212, 213]. This factor, termed fibroblast growth factor 2 (FGF2), is part of a larger family of fibroblast growth factors (FGFs) that have been well studied for their roles in conceptus, fetal and placental development in several species. Fibroblast Growth Factors Fibroblast growth factors (FGFs) are paracrine and autocrine peptide growth factors [214, 215]. There are at least twenty-two FGFs in mamm als, and these FGFs can be sub-divided into seven subfamilies based on phylogenetic analysis [ 216]. The protein products of this diverse gene family contain a variety of biological activities in many ti ssues and organs, such as cell migration, cell differentiation, cell survival, mitogenesis, and tumorigenesis [216-219]. In addition, FGFs are homeostatic factors in adults and function in various capacities, including tissue repair and wound healing, in tumor angiogenesis, and in the control of nervous system development (as neurotr ophic factors) [220, 221]. Discovery and Identification of FGFs In the late 1970s, the first members of th e FGF family were purified from the bovine pituitary [222, 223]. Fibroblast growth factor 1 (FGF1; also known as acidic FGF) and FGF2 (also known as basic FGF) were isolated and characterized for their cap acity to stimulate 3T3 fibroblast proliferation [218, 224, 225]. The highly pur ified preparations of FGFs were submitted for amino acid sequencing, and thus it was possible to clone cDNAs of both FGF1 and FGF2 [226-228]. Subsequently discovere d FGFs were classified with a numeric designation based on the order they were identified [229]. Biological activiti es for many FGFs have been determined 31

PAGE 32

using various techniques, including utilizi ng homologous recombination technology in mice. This technique provided initial evidence that selective FGFs are involved with embryonic, extraembryonic, and fetal development in mamm als [220, 221]. Moreover, these studies showed that certain members of the FGF family have spec ialized biological roles that result in specific phenotypes (i.e., Angora mutant of FGF5 / mice), whereas other FGFs have no apparent phenotype following their loss of activity either because they are not required for specific activities or they can be compensa ted for by other FGFs [221, 230, 231]. Fibroblast Growth Factor Receptors Fibroblast growth factors mediate their cellular function by binding and activating a group of tyrosine kinase receptors known as FGF r eceptors (FGFRs). At least five distinct genes encode FGFRs (designated as FGFR1 to FGFR5) [214, 216, 218, 232-234]. Functional FGFRs are transmembrane proteins composed of an extracellular ligand-binding domain and a cytoplasmic domain containing the catalytic pr otein tyrosine kinase core [226, 234, 235]. Each receptor type contains two to three immunoglobu lin-like (Ig-like) extracellular domains and a single transmembrane spanning region [218]. Intrace llular tyrosine kinase activation domains are present in four receptor types, FGFR1 to FG FR4 [218]. The most recently discovered receptor, FGFR5, differs from other FGFRs because it contains no apparent intracellular activation regions, and its function in the various organs where this receptor is found remains unknown (such as pancreas, liver, kidne y, brain, and lung) [232, 236]. Fibroblast growth factor receptors binding to ligands has an added complexity due to spliced variant modifications in ligand binding domains. Several types of alternative splicing events are observed in various FGFRs, but one of the most well studied splicing events occurs within the Ig-like regions and generates a distinct variety of receptor subtypes for FGFR1, FGFR2 and FGFR3 [218, 237]. FGFR4 does not undergo alternat ive splicing [238]. One critical 32

PAGE 33

splicing event occurs within th e third Ig-like domain (IgIII), where splicing one or two exons from the coding transcript generates two main re ceptor subtypes: IgIIIb and IgIIIc, respectively [218, 239, 240]. Non-spliced IgIII re gions, such as IgIIIa, do not exist as functional receptors because in-frame stop codons generate sol uble proteins [218, 239, 240] These alternative splicing events specify FGF binding. Some FGFs bind to multiple receptor subtypes whereas other FGFs prefer specific receptor subtypes [216, 218]. For ex ample, FGF1 binds all FGFR subtypes whereas FGF7 associates exclusively with a single receptor subtype (FGFR2b). [216, 218]. Table 2-1 summarizes the specificity of the FGFs ligands for specific FGFRs isoforms. Heparin and heparan sulfate glucosaminogl ycans (HSGAGs) function as accessory molecules that regulate FGFbinding and activation of FGFRs [241-244]. More specifically, HSGAG induces FGFR dimerization, an essential step for subsequent receptor activation and stimulation of downstream intracellular si gnaling events [218, 226, 237, 245]. Heparin is required for FGF to activate the FGFR in cells that are deficient or unable to synthesize HSGAGs, or in cells pretreated with hepa rin/heparan sulfate (HS)-degrading enzymes or sulfation inhibitors [242]. Th e addition of HS can increase the activity of specific FGFs depending on the structure of their sulfated domains and the abundance of HS in target cells [246]. 33

PAGE 34

Table 2-1. Specificity of the FGFs lig ands for specific FGFRs isoforms Data collected from [218, 220, 221, 226, 239, 240, 247]. ? Unknown; a Have yet to identify FGFR isoform (IIIb or IIIc). FGF (ligand) Interaction with receptors FGFR1 FGFR2 FGFR3 FGFR4 FGF1 IIIb and IIIc IIIb and IIIc IIIb and IIIc FGFR4 FGF2 IIIb and IIIc IIIc IIIc FGFR4 FGF3 IIIb IIIb FGF4 IIIc IIIc IIIc FGFR4 FGF5 IIIc IIIc FGFR4 FGF6 IIIc IIIc FGF7 IIIb FGFR4 FGF8 FGFR1a IIIc IIIc FGFR4 FGF9 IIIc IIIb and IIIc FGFR4 FGF10 IIIb IIIb FGF11to 14 ? FGF15 ? FGF16, 18 ? FGF17 IIIc IIIc FGFR4 FGF19, 21, 23 IIIc IIIc FGFR4 FGF20, 22, 24, 25 ? 34

PAGE 35

Roles of FGFs during Early Conceptus Development The actions of FGFs are not restricted to the adult animal, where FGFs are homeostatic factors associated with tissue repair, wound heal ing, angiogenesis, and in controlling the nervous system development (as neurotrophic factors) [2 20, 221]. Rather, several FG Fs also play a vital role during conceptus development, not only in regulating cell growth and differentiation, but also in controlling several developmental events in the conceptus, fetus, and placenta [214, 218]. To elucidate these events, the effects and expression patterns of indivi duals FGFs will be discussed in the subsequent sections. Fibroblast Growth Factor 2 There is substantial evidence that FGF2 play s an important role in early conceptus and placental development. Fibroblast growth factor 2 is produced by th e uterus of several species. Transcripts for FGF2 were identified in pigs, rodents, rabbit, primate and human endometrium [248-255]. In these species, FGF2 mRNA is primarily localized in the luminal epithelial layer of the endometrium during diestrus and early pregnancy [248, 255, 256]. Moreover, FGF2 mRNA is localized within the luminal and glandular epithelium of co ws and ewes and FGF2 protein is detected in the uterine lumen throughout the estrou s cycle and early pregnancy in ewes and cows [212, 257]. The localization of FGF2 in the epithelial layer of the endometrium during early gestation in rodents, rabbit, primate and human implicates that FGF2 may play a role during trophoblast invasion and blastocyst implantation [248-254]. In cattle and sheep, the levels of endometrial FGF2 mRNA and protein are not different be tween pregnant and cyclic ewes and cows; however, the amount of FGF2 in the uterine lumen increases between d 12 and 13 postestrus in both pregnant and cycl ic ewes [257]. The occurrence of this event coincides with the timing of IFNT production by the trophectoderm and the maternal recognition of pregnancy in this species [59, 60, 258]. 35

PAGE 36

Several reports propose that the uterine ep ithelium is not the major site of FGF2 production in cattle; rather, the bovine conceptus also expresses FGF2 [257, 259, 260]. Transcripts for FGF2 are detected at the morula a nd blastocyst stages [259, 260], and unpublished observations from this laboratory indicate that FGF2 mRNA abundance increases at the timing of conceptus elongation (between d 14 and 17 of development). In conclusion, the fact that FGF2 is expressed by both the endometrium and the conceptus during early pregnancy implicates that this FGF may play a critical ro le during conceptus development and placentation. One of the best studied activiti es attributed to FGF2 duri ng pregnancy is its role in mediating cell proliferation and differentia tion [261, 262]. Supplementation with FGF2 to cultured rabbit blastocysts promotes gastrulati on, stimulates embryonic development and the formation of all three germ layers [263]. Fibrobl ast growth factor 2 play s a critical role in placentation. Addition of FGF2 to mouse trophect oderm outgrowths enhances their proliferation in vitro [264]. Moreover, FGF2 supplementation si gnificantly promotes the rate of mouse blastocyst attachment and spreading, and significantly increases the surface area of trophectoderm outgrowths [265]. In the presence of transforming gr owth factor beta 1 (TGFB1), addition of FGF2 increases the number of in vitro produced bovine embryos developing past the 8-cell and 16-cell stages when compared to controls [266] Vascular endothelial gr owth factors (VEGF) and FGFs are implicated as two of the most important promoters of angiogenesis that have been identified thus far [267-270]. Fibroblast growth factor 1 and FGF2 are well-known for a ngiogenic effects in vari ous organisms [271], and both FGF1 and FGF2 are potent i nducers of endothelial cell migr ation, proliferation, and tube formation in vitro and are highly angiogenic in a number of tissues in vivo It is thought that FGF1 and FGF2 may participate in angioge nesis in two primary ways: by modulating 36

PAGE 37

endothelial cell activity [272] a nd by regulating VEGF expressi on in proliferative cells [273275]. Moreover, both factors are well-established mitogens and chem o-attractants for endothelial cells [276-278]. Some actions for distinct FGFs have b een proposed for ruminants during conceptus development. Maybe the most exciting one is the ability of FGF2 to control trophectoderm development and IFNT production during peri-a ttachment conceptus development. A bovine trophectoderm cell line, termed CT-1 cells [279], significantly e nhances trophectoderm proliferation, IFNT mRNA abundance and IFNT protein secretion in response to FGF2 supplementation [212]. The mutual ability of FGF2 increasing trophectoderm proliferation and amplifying IFNT production implicates this FGF as a vital factor during the timing of maternal recognition of pregnancy in ruminants. Furtherm ore, blastocysts produce more IFNT in response to FGF2 supplementation than non-supplemented controls [212]. Fibroblast Growth Factor 1 Fibroblast growth factor 1 a ppears to contain biological act ivities that facilitate the establishment and maintenance of pregnancy in some mammals. The uterine and conceptus expression patterns for FGF1 are not as well defi ned as for FGF2. FGF1-like activity can be isolated from porcine uterus [280]. In pigs, FGF1 mRNA is localized to the stromal cells of the uterus, whereas FGF2 mRNA is detected in uterine lu minal and glandular epithelium for pregnant, but not cycling, gilts [255]. The expression of FGF1 and FGF2 during early gestation suggests roles for both factors at the timing of the non-invasive embryo implantation of this species [255], though the localization of FGF1 and FGF2 in different tissue layers implies that different modes of action are utilized [255]. Fi broblast growth factor 1 is also produced by bovine conceptuses, where FGF1 mRNA is detected at the morula and blastocyst stages [259, 260]. Also, at least two of the major receptor partners for FGF1 and FGF2, FGFR1c and 37

PAGE 38

FGFR3c, and an additional recep tor subtype FGFR2b, which is us ed by FGF1 but not FGF2, are present in ovine conceptuses [218, 257, 281, 282]. Fibroblast Growth Factors 7 and 10 Fibroblast growth factor 7 and FGF10 are true mesenchymal factors that are important for establishing and maintaining stromal and epithe lial integrity and functi on in various organs. [283, 284]. Fibroblast growth factor 10 was originally isolated from rat lung mesenchyme and identified as a mesenchymal-derived growth fact or that is essential for patterning the early branching and morphogenic events in rodents, including embryonic lung and limb bud formation [285-290]. Fibroblast growth factor 7 is an established paracrine growth factor of mesenchymal origin unique to epithelial cell proliferation and differentiation [291], and also mediates the effects of progesterone in primate endometrium [292]. Both FGF7 and FGF10 are epithelial cell mitogens [283, 289]. The primary receptor partner for FGF7, FGFR2b, is also the high-affinity receptor for FGF10 [283]. Both FGF10 and FGF7 have the same binding affinity to FGFR2b [289]. Transcripts for FGF10 are localized in the uterus in sheep. Ovine endometrial stromal cells express FGF10 mRNA, whereas its receptor FGFR2b is localized to ep ithelial cells in the uterus of ewes. The particular location of expression s uggests that FGF10 is a paracrine mediator of uterine mesenchymal-epithelial in teractions [281]. Transcripts for FGF10 and its receptor are also found in neonatal ovine uterus during endo metrial gland development [141], and because FGF10 plays an active role in mediating stromal-epit helial borders in various organs it is likely it is plays an active role in pos tnatal uterine gland morphogenesis. Interestingly, it appears that stromal-derived FGF10, but not FGF7, is regu lated by progesterone. Studies inhibiting the effects of progesterone by using a progesteron e-receptor inhibitor RU486 reported a decreased FGF10 mRNA in the endometrium of sheep; however, FGF7 mRNA was relatively unaffected 38

PAGE 39

by RU486 treatment [293]. These results provide evidence that stromal-derived FGF10 is a genuine progestamedin in the endometrium of the ovine uterus. In the pig, FGF7 mRNA is expressed by the endome trial epithelium during a critical period of conceptus development, and FGF7 protei n can be detected in the uterine lumen during early pregnancy [294]. In this species, which presents an epitheliochorial-type placenta, FGF7 plays a role in epithelial-epithelial interactions between the uterus and the conceptus. Transcripts for FGF7 and its primary receptor partner FGFR2b are both found in the endometrial epithelium and the trophectoderm [294, 295]. The endometrial epithelium secretes FGF7 into the lumen, which promotes a rapidly stimulation of trophect oderm proliferation in this species [294]. In contrast, FGF7 expression is much different in other species. In the sheep, FGF7 mRNA is localized to the tunica muscularis of blood vesse ls in neonatal ovine and primate endometrium and myometrium [281, 296]. The restricted expression of FGF7 to the tunica muscularis does not exclude a potential role as a paracrine growth factor for glandular epithelia, given that FGF7 is also expressed near deep in glandular epith elium [281]. The post-attachment placenta is a rich source for FGF7 and 10 in sheep and cattle [257, 281, 297]. FGF7 and FGF10 are both expressed by cells of mesenchymal origin [298], while their common receptor, FGFR2b, is found exclusively in epithe lial cells, which implicates independent roles for both factors [281]. Their ac tions may be restricted to mediate the limited attachment of trophoblast cells [281], and to stimula te the proliferation of epithelial cells [218]. It is unlikely that FGF7 and FGF10 can traverse th e uterine layers and achieve the lumen to be available for the bovine conceptus during early development. Moreover, the specific receptor FGFR2b appears to be responsible for FGF actions on bovine trophectoderm due to its ability of increasing IFNT mRNA levels in CT-1 cells (Ealy a nd Pennington, unpublished observations). 39

PAGE 40

Fibroblast Growth Factor 4 Current evidence implicates that FGF4 plays a critical role in mouse development, but it is still unclear if FGF4 is essential for bovine conceptus development. The FGF4 gene is expressed in the mouse conceptus at several st ages: the morula, the blastocyst (where it is localized to the inner cell mass), and the embryonic ectoderm of the post-implantation egg cylinder [299, 300]. Currently, it is established that FGF4 derived from the inner cell mass at the blastocyst stage and later in th e corresponding epiblast binds to a nd activates its sp ecific receptor FGFR2c to act as a paracrine factor to prev ent neighboring trophectoderm (mural trophoblast) from differentiating whereas trophectoderm not in close proximity to the epiblast (polar trophoblast) undergo terminal diffe rentiation into other placenta l cell types [301304]. Functional loss of FGF4 or its receptor FGFR2c is lethal early in embryogenesis [301, 305]. Trophectoderm formation is complete, but placenta fails to develop properly. It remains uncertain if FGF4 serves an essential function dur ing early conceptus development in ruminant species. Supplementa tion of FGF4 is neces sary to maintain a proliferating population of mouse trophectode rm cells in culture [301, 306], but FGF4 supplementation is not required for bovine trophectoderm development. Cultured bovine trophectoderm proliferate for extended periods w ithout exposure to FGF4 or other epiblastand uterine-derived factors [279, 307-309]. Howe ver, IFNT production from trophectoderm outgrowths fail to reach levels observed in nor mally developing bovine conceptuses, perhaps because they lack critical epibla stand/or uterine-derived factor s that normally influence IFNT production. They continue to pro liferate without differentiating fo r extensive periods in culture [279, 307-309]. 40

PAGE 41

Synopsis Conceptus development in cattle includes a seri es of cell prolifera tion and differentiation that ultimately result, between d 7 and 9 post-fe rtilization, in a blastocyst. The blastocyst is composed of inner cell mass (e mbryonic cells) and trophectoderm (extraembryonic cells). As conceptus development progresses and trophectoder m cells proliferate, th e blastocyst hatches from the zona pellucida, between d 7 and 10 pos t-fertilization, and becomes a filamentous structure between d 14 and 16 of development. Throughout this period, the trophectoderm secretes IFNT, which is the signal for pregnancy maintenance in cattle and other ruminants. In these species, IFNT extends corpus luteum lif espan by preventing oxytocin-mediated release of endometrial PGF2 during late diestrus, and thus sust ains the production of progesterone by luteal cells. In this scenario, a pregnant-receptive state in the uterus is maintained by the corpus luteum, until placental sources of progesterone ev entually take over as the primary progesterone source. If the conceptus fails to initiate this ev ent, or the maternal environment does not respond to this signal, the mother returns to estrus and the pregnancy is lost. Several uterine derived factors are require d during conceptus development, and are presumably essential for the pr oduction of IFNT in cattle and sh eep. This hypothesis is supported by results from studies using a uterine gland knockout (UGKO) ewe. In such animals, early pregnancy loss is observed and the blastocyst fails to elongate. So me endometrial-derived factor implicated as embryotrophic include IGF1 a nd IGF2, GM-CSF, LIF and calcitonin. Recently, this laboratory discovered a new uter ine-derived product that controls IFNT expression. This factor, termed FGF2, is part of a larger family of FGFs that have been well studied for their roles in conceptus, fetal and placental developm ent in many species, including bovine. The endometrial and conceptus localization of FGF1 and FGF2, and the distribution pattern of FGF1 and FGF2 proteins in the lumen indicate that th ese FGFs may play a gene ral role in the bovine 41

PAGE 42

placenta. These include maintenance of placenta l structure and function, angiogenesis, and mitogenic activity for both fetal and maternal co mponents. As mentioned, an exciting attribute of FGF2 is its ability to regulate IFNT producti on in bovine trophectoderm [212]. Other FGFs are also associated with conceptus development in some mammals. Stromal-derived FGF7 and FGF10 functions may be associated specifically w ith the proliferation of epithelial cells [218] and mediation of the limited invasion of trophoblas t giant cells [281] in sows and ewes, given that FGF7 and FGF10 are unlikely able to traver se the endometrial layers and reach the lumen. In addition, FGF4 plays a cri tical role in mouse embryoni c development [301-304], but it remains unclear if this FGF is essential du ring early conceptus development in bovine. 42

PAGE 43

CHAPTER 3 SEVERAL FIBROBLAST GROWTH FACTORS ARE EXPRESSED DURING PREATTACHMENT BOVINE CONCEP TUS DEVELOPMENT AND REGULATE INTERFERON-TAU EXPRESSION FROM TROPHECTODERM Introduction In cattle, sheep and presumably other rumi nants, the trophectoderm-derived factor, interferon-tau (IFNT), is responsib le for sustaining a pregnant st ate by restricting the pulsatile release of prostaglandin F2 from the endometrial epithelium and thereby preventing regression of corpus luteum and return to estrus [59, 60] Interferon-tau also cont rols the expression of several uterine-derived factors th at prepare the uterus for placental attachment, modifies the uterine immune system, and regulates early conceptus developmen t [71, 97, 100, 105, 310-312]. It is not surprising, therefore, that insufficient production of IFNT or failure of the maternal system to recognize this signal leads to pregnancy failures in cattle [1, 313-315]. Bovine embryo production of IFNT begins at the late morula and early blastocyst stage as the trophoblast cell lineage first develops (d 6-7 of pregnancy) [117, 316]. In cattle, IFNT mRNA levels peak around d 14-16 of pregnancy and remain elevated until implantation occurs around d 19-21 of pregnancy [317-319]. A few selec tive uterineand conceptus-derived factors are known regulators of IFNT expression [320, 321]. One of thes e is fibroblast growth factor 2 (FGF2). Transcripts for FGF2 are expressed by the luminal and glandular epithelium and detected in the uterine lumen of cows and ewes throughout the estrous cy cle and early pregnancy [212, 257]. Studies using a bovine tr ophectoderm cell line (CT-1) and in vitro -produced bovine blastocysts reveal that supplementation with FGF2 increases IFNT mRNA and protein levels [212, 213]. Fibroblast growth factor 2, also known as ba sic FGF, was the first identified member of what is now a large family of FGFs. At least twenty-two genes encode multiple FGFs in the 43

PAGE 44

human and mouse, and their protei n products contain a variety of biological activities in tissues and organs [216-218]. These FGFs interact with a group of tyrosine ki nase receptors known as FGF receptors, or FGFRs. Four genes encode these receptors ( FGFR1-FGFR4), and alternative splicing in extracellular regions generate a va riety of receptor isotypes [214, 218, 232, 236]. One of these splicing events occurs within the third immunoglobulin (Ig)-like domains of FGFR1FGFR3, where splicing one or two exons from the coding transcript genera tes receptors subtypes termed IgIIIb and IgIIIc respec tively. These spliced variants recognize different ligands [218, 239, 240]. For example, the IgIIIb form of FGFR2 (R2b) interacts primarily with FGF1, 3, 7, 10 and 22, whereas the IgIIIc form (FGFR2c) in teracts with FGF1, 2, 4, 6 and 9 [216, 218]. Several FGFs and FGFRs are associated with early conceptus development in mammals. Fibroblast growth factor 2 in creases trophectoderm outgrowth size in mice and stimulates gastrulation in rabbit conceptuses [263, 265, 322]. In the pig, uterine-derived FGF7 acting through its receptor, FGFR2b, stimulates trophect oderm proliferation [294]. In mice, FGF4induced activation of its receptor partner, FGFR2c, is critical fo r maintaining a trophoblast stem cell lineage that supports normal placental deve lopment [301, 305]. FGF4 supplementation is required to prevent mouse trophoblast cell diffe rentiation during culture [323, 324]. However, this type of supplementation is not needed to maintain bovine trophectoderm in culture. They continue to proliferate without differentiating for extensive pe riods in culture [279, 307-309]. Bovine and ovine conceptuses produce multiple FGFs. Transcripts for FGF2 and several FGFR spliced variants are detected in elongated ovine conceptuses [257]. Also, transcripts for FGF1, 2, 7 and 10 and several FGFRs exist in post-attachment stage placentae in sheep and cattle [281, 297]. These FGFs likely facilitate placental development in a variety of ways throughout gestation. This laborato ry is specifically interested in uncoveri ng actions of these 44

PAGE 45

FGFs as bovine conceptuses devel op and begin to attach to the uterine lining early in pregnancy. The overall objectives of this work were to id entify the various FGFs and FGFRs expressed in elongating, pre-attachment bovine conceptuses and determine if thes e FGFs have the ability to regulate conceptus development and/or medi ate IFNT production during pre-attachment development. Results Expression of FGFR Subtype in Bovine Conceptuses End-point RT-PCR was used to detect th e FGFR isotypes expressed during early conceptus development in cattle. FGFR1, FGFR2 FGFR3, and FGFR4 mRNA were detected in bovine conceptuses collected at d 17 pos t-insemination (Fig. 3-1 and 3-2) and in vitro produced blastocysts (Fig. 3-2). Each FGFR also was detected in CT-1 cells (Fig. 3-1), a bovine trophectoderm cell line derived from a bovine blastocyst that produces IFNT [212, 279]. Amplified products of the correct size were detect ed in all samples with the exception of one d 17 conceptus sample that consistently lacked an FGFR1 amplicon (see Fig. 3-1). Primers used to amplify each FGFR spanned the sequence encoding their third Ig-like domains, and the specific splice variant forms of FGFR1, FGFR2 and FGFR3 expressed by conceptuses and CT-1 cells were determined by se quencing amplified produc ts [257]. All of the FGFR1 cDNAs derived from blasto cysts and d 17 conceptuses (n=8 clones sequenced) had the same sequence and comparative sequence analys is indicated that this sequence encoded FGFR1c [239, 257] (GeneID: 281768; GenBank #NP_001103677). All blastocystand conceptus-derived FGFR2 cDNAs (n=10 clones sequenced) were identical and their translated product represented FGFR2b, which also is known as keratinocyte gr owth factor (KGF)/FG F7 receptor [239, 257] (GeneID: 404193; GenBank #XP_001789758). For FGFR3, translated products for all cDNAs (n=10 clones sequenced) matched the inferre d amino acid sequence of FGFR3c (GeneID: 45

PAGE 46

281769; GenBank #AAK54132) [257]. FGFR4 amplicons of the correct an ticipated size (n=4 cDNAs sequenced) were identical to FGFR4 (G eneID: 317696). The less abundant amplicons seen in some of the FGFR4 reactions were not sequenced (see Fig. 3-1 and 3-2). DNA sequencing also confirmed that CT-1 cells express FGFR1c, FGFR2b, FGFR3c, and FGFR4. Expression and Abundance of FGF1, 2, 7 and 10 in Bovine Conceptuses End-point RT-PCR also was used to determine if FGF1, 2, 7 and 10 are expressed in d 17 bovine conceptuses (Fig. 3-3). Transcripts for FGF1, 2 and 10 were dete cted in all three d 17 bovine conceptus RNA samples examined. Transcripts for FGF1 and FGF2 but not FGF10 also were detected in CT-1 cell RNA. FGF7 was not amplified in d 17 conceptus and CT-1 samples, but was detected in control samples (endometrium and lung). Bovine endometrium was included as a positive control based on previous work describing endometrial FGF1, 2, 7 and 10 expression in cyclic and pregnant cows and ewes [212, 257, 281, 297]. DNA sequencing verified that each PCR product represented the FGFs of interest (data not shown). Smaller, less intense PCR products were observed in some of the FGF1 reactions (see Fig. 3-3). These products were not sequenced, and this secondary product was not detected when new primers were designed and used for qRT-PCR (see below). The relative abundance of FGF1, 2 and 10 mRNA populations throughout preand periattachment conceptus development was determined with qRT-PCR. The internal RNA loading control, 18S RNA, could not be used to normalize FGF mRNA in this study since its concentrations varied depending on stage of conceptus development (Table 3-1). More specifically, concentrations of 18S RNA in tcRN A increased (P<0.05) as conceptuses progressed from blastocysts to elongated, filamentous concep tuses. Due to this outcome, the amount of tcRNA in each reaction was used to adjust FGF va lues across these developmental stages (Table 3-1). FGF1 mRNA was not detected in in vitro produced blastocysts. Its relative abundance 46

PAGE 47

remained low in conceptuses collected on d 11 a nd 14 of pregnancy and increased (P<0.05) in d 17 conceptuses. FGF2 mRNA was detected at all stages of conceptus development, and concentrations were grea ter (P<0.05) in d 14 and 17 conceptuses than in d 8 in vitro produced blastocysts. Day 11 conceptuses contained intermediate amounts of FGF2 mRNA. FGF10 mRNA was not detected in in vitro produced blastocysts and low le vels were detected in d 11 conceptuses. The relative abundance of FGF10 mRNA was substantially greater (P<0.05) in d 14 and 17 conceptuses. As anticipated, concentrations of IFNT mRNA were low in in vitro produced blastocysts and d 11 conceptuses and th en increased (P<0.05) in d 14 conceptuses and then again in d 17 conceptuses (P<0.05). A separate analysis was used to describe the relative abundance of FGF1 FGF2 and FGF10 mRNA within each stage of bovine concep tus development (Fig. 3-4). Relative abundance of 18S RNA was used to normalize FGF valu es within each stage of pregnancy examined. FGF2 was the only transcript identified in in vitro produced blastocysts. It also was the most abundant FGF transcript in d 11 conceptuses. In d 14 conceptuses, FGF2 and FGF10 mRNA were present at similar levels. By comparison, FGF1 mRNA abundance was low (P<0.05) in d 11 and 14 conceptuses. FGF10 was the most prevalent transcript in d 17 conceptuses, where it represented ~85% of the FGF transcripts among the three specific FGFs examined in these conceptuses. Biological Activity of FGF1, 2 and 10 on Bovine Trophectoderm and in vitro produced Blastocysts The ability of these conceptus-derived FGFs to stimulate IFNT production was examined in in vitro produced bovine conceptuses. A study was co mpleted to determine if FGF1, 2 and 10 supplementation influences development and IFNT expression in bovine blastocysts (Fig. 3-5). 47

PAGE 48

Individual in vitro produced blastocysts were placed in medium drops containing 50 ng/ml of rbFGF1 or rbFGF2, 50 or 500 ng/ml of rhFG F10, or no FGF treatment (control) and IFNT mRNA abundance (Fig 3-5A) and blastomere numbe rs (Fig. 3-5B) were determined after 24 and 48 h, respectively. Incubation with medium containing 50 ng/ml rbFGF1 or -2 increased (P<0.05) IFNT mRNA abundance compared to the cont rol. Blastocysts required 500 ng/ml rhFGF10 to observe this effect. Blastomere numbers, as determined by quantifying numbers of stained nuclei in blastocysts after 48 h exposure to FGF treatment, were not affected by any of the FGF proteins at any of the doses examined. 48

PAGE 49

Figure 3-1. Expression of FGFR subtypes in d 17 bovine conceptuses and CT-1 cells. RT-PCR was completed on tcRNA samples derived from three pools of d 17 bovine conceptuses (n=3-5 conceptuses/pool) and one CT-1 sample using primers specific for the third Ig-like extr acellular domain of bovine FGFR1, FGFR2, FGFR3 and FGFR4 (Table 3-2). Products were electrophor esed and visualized with ethidium bromide and UV light. TcRNA derived from bovine lung was included as a positive tissue control. Primers for -actin ( ACTB) were used as a positive RT-PCR control. TcRNA not exposed to reverse transcriptas e (-RT samples) was included to verify that amplified products did not result from genomic contamination. Amplified products were sequenced to verify th at they represent specific FGFRs. 49

PAGE 50

Figure 3-2. Expression of FG FR subtypes in bovine in vitro produced blastocysts. RT-PCR was completed on tcRNA samples derived from three pools of in vitro produced blastocysts (n=10-18 blastocysts/pool) usi ng primers specific for the third Ig-like extracellular domain of bovine FGFR1, FGFR2, FGFR3, and FGFR4 (Table 3-2). Products were electrophoresed and visuali zed with ethidium bromide and UV light. TcRNA derived from a pooled d 17 bovine conceptus preparation was included as a positive tissue control. Primers for ACTB were used as a positive RT-PCR control. TcRNA not exposed to reverse transcriptas e (-RT samples) was included to verify that amplified products did not resu lt from genomic contamination. 50

PAGE 51

Figure 3-3. Expression of FGF1, 2, 7 and 10 mRNA in d 17 bovine conceptuses. RT-PCR was completed on tcRNA from three pools of d 17 bovine conceptuses (n=3-5 conceptuses/pool) and one CT-1 sample with primers specific for bovine FGF1 FGF2 FGF7 and FGF10 (Table 3-2). Products were electrophoresed and visualized with ethidium bromide and UV light. TcRNA from bovine endometrium and lung were included as positiv e controls. Primers for ACTB were used as a positive RTPCR control. TcRNA not exposed to re verse transcriptase (-RT samples) was included to verify that amplified products did not result from genomic contamination. Amplified products were sequenced to verify specificity of amplification 51

PAGE 52

Figure 3-4. Expression profiles of FGF1 FGF2 and FGF10 during bovine conceptus development. TcRNA was extracted from bovine conceptuses collected on d 11, 14 and 17 post-insemination (n=5 pools/stage of development; 2-5 conceptuses/pool). TaqMan qRT-PCR was completed us ing primers/probes specific for boFGF1 FGF2 and FGF10 (Table 3-4). Abundance of 18S mRNA was used as an internal control to normalize FGF values within each stage of development. CT values were used to analyze the data within each stage of development and data are presented as mean fold-differences SEM from the lowest expression value within each stage. Different superscripts represent treatme nt differences within each stage of development (P<0.05). 52

PAGE 53

Table 3-1. Relative concentrations of FGF and IFNT mRNA in bovine conceptus at different stages of development Conceptus Stage FGF1 FGF2 FGF10 IFNT 18S Blastocyst 0.037 0.024a 0.008 0.009a 0.04 0.02a d11 0.008 0.004a 0.074 0.024a b 0.122 0.054a 0.010 0.005a 0.33 0.15 b d14 0.003 0.001a 0.158 0.055 b 1.02 0.37a b 0.93 0.36 b 3.73 1.32c d17 0.94 0.34 b 0.096 0.023 b 2.61 0.87 b 3.93 1.26c 5.09 1.81c Different superscripts represent differences in relative abundance of mRNA species within each column (P<0.05). 53

PAGE 54

Figure 3-5. Effect of FGF1, FG F2, or FGF10 supplementation on IFNT mRNA concentrations and blastomere numbers in cultur ed bovine blastocysts. Individual in vitro produced blastocysts were placed in 30 l drops of medium containing rbFGF1 (50 ng/ml), rbFGF2 (50 ng/ml), rhFGF10 (50 or 500 ng/ml ), or vehicle only (50 g/ml BSA) and incubated at 38.5C for 24 or 48 h. Panel A: After 24 h, tcRNA was extracted and qRT-PCR was performed to determ ine the relative abundance of IFNT mRNA (n=1422 blastocysts/treatment spread over 4 replicate experiments). Abundance of 18S mRNA was used as an internal control to normalize IFNT mRNA values. CT values were used to analyze the data and mean fold-differences SEM from the lowest expression value are presented. Panel B: After 48 h, number of nuclei per blastocyst was determined after Hoechst 33342 staini ng and epifluorescence microscopy (n=2225 blastocysts/treatment spread over 4 replicate experiment s). Different superscripts represent treatment differences within panels (P<0.05). 54

PAGE 55

Discussion This laboratory previously described a role for FGF2 in stimulating IFNT production in bovine conceptuses [212, 213]. Initi ally, the uterine epithelium wa s proposed as the primary site of FGF2 production in cattle [212], but work contained herein and ot her findings [257, 259, 260] establish that bovine conceptuses al so produce FGF2. Transcripts for FGF2 are detected at the morula/blastocyst stage in this and other stud ies [259, 260], and transcript abundance increases in conceptuses undergoing elongation (d 14 and 17). Also, at least two of the primary receptor partners for FGF2, FGFR1c and FGFR3c, pres ide in ovine conceptuses [218, 257, 282]. An additional receptor subtype, FGFR2b, also is produced by ovine conceptuses [257, 281]. Fibroblast growth factor 2 inte racts with FGFR2b with a lowe r affinity than FGFR1c and FGFR3c [218, 282], thereby suggesting that additional FGFs may impact conceptus development by acting through FGFR2b. Bovine conceptuses contain the same FGFRs as elongating ovine con ceptuses [257]. In addition, this work identified the expression of FGFR4 in bovine in vitro produced blastocysts and elongated conceptuses. Amplifying the IgIII region for each FGFR permitted the identification of specific FGFR splice variants (FGFR1c, FGFR2b, and FGFR3c). It remains possible that additional variant forms fo r FGFR1, FGFR2 and FGFR3 exist in bovine conceptuses and perhaps these subtypes could have been identified if a dditional cloned products were sequenced or if receptor subtype-specific primer sets were employed. That being said, verifying the presence of FGFR 2b throughout early bovine conceptus development provided the impetus for focusing on ligands that interact wi th this receptor subtype. Investigating this receptor isoform was of particular interest because the FGFR2b and FGFR2c subtypes are implicated in regulating trophectoderm deve lopment in other speci es [294, 301, 305]. 55

PAGE 56

The primary ligands for FGFR2b are FGF1, 3, 7, 10 and 22 [218, 282]. In this work, transcripts for FGF1 and FGF10 were detected whereas FGF7 transcripts were absent in bovine conceptuses. Tissue-specific expression of FGF3 and FGF22 is highly restrictive in other species (e.g., cerebellum, retina and inner ear for FGF3 ; cerebellum and skin for FGF22 ) [325327]. Therefore, these FGFs were not examin ed in this work. Transcript levels of FGF1 were low throughout bovine conceptus development whereas FGF10 mRNA concentrations were low or nonexistence on or before d 11, but were readily apparent in d 14 and 17 conceptuses. The relative amount of FGF10 mRNA rivaled that of FGF2 in d 14 conceptuses and represented the predominant FGF transcript in d 17 conceptuse s. Chen et al [281] identified that the extraembryonic mesoderm is the primary site of FGF10 expression in ovine conceptuses. The extraembryonic mesoderm emerges from the ep iblast (i.e. the gastrulating inner cell mass) around d 14 and16 of pregnancy in ca ttle and soon thereafter exte nds between the trophectoderm and endoderm to establish the i nner chorionic layer and the oute r yolk sac layer [5, 20, 22, 317, 328]. Although localization studie s were not completed herein to verify the sources of FGF10 expression during conceptus elongation, our assessment of FGF10 mRNA abundance is supportive of the concept th at the profound rise in FGF10 expression in d 14 and 17 conceptuses stems from the formation and expansion of extraembryonic mesoderm. It is interesting that the ontogeny of conceptus-derived FGF10 expression resembled that of IFNT Relative abundances for both transcripts were low in d 11 conceptuses and increased profoundly at d 14 and 17 of pregnancy. Since mesoderm formation occurs around the same time as conceptus elongation and maximal IFNT expression [317-319], it is possible that a product of this tissue, such as FG F10, could be required for maximal IFNT expression, as well as other aspects of early conceptus development and elongation. Timely epiblast development 56

PAGE 57

certainly is linked to conceptus elongation a nd survival. Bovine embryos derived from in vitro fertilization and nuclear tran sfer (NT) usually have lowe r survival rates than their in vivogenerated counterparts af ter transfer, and fewer in vitro produced and NT embryos contain epiblasts at d 14 of pregnancy [25, 329]. Also, fe wer pregnancies resulted from transfer of d 14 bovine conceptuses containing either non-intact or undetectable epiblast s as compared with transfer of conceptuses containing intact epiblasts [330]. Further wo rk is needed to determine if paracrine-acting factors produced by the epiblast, and more specifically by the newly formed mesoderm, promote trophectoderm prolifer ation and gene expression. Tissue localization studies were not completed in this wor k, but the trophectoderm likely is one site of FGF1 and FGF2 pr oduction in elongating conceptuses. FGF1 and FGF2 mRNA are detected in CT-1 cells and localized to the tro phectoderm of mid-gestation bovine placentae [297]. Likewise, each of the four FGFR subtypes identified in bovine blastocysts and elongating conceptuses probably are expresse d in trophectoderm since they were detected in CT-1 cells. This certainly is the case for the FGFR2b subtype. Its transcri pts localize to ovine and bovine trophectoderm during periand post-attach ment development [281, 297]. In ewes, FGFR2b also is expressed by the uterine epithelium where it appear s to play a central role in regulating uterine activity during pregnancy by interacting with stromal-derived FG F10 [281]. It is possible, but unlikely, that this uterine source for FGF10 is released into the uterine lumen. Most FGFs, including FGF10, contain high affinities for heparan sulfate proteoglycans and remain sequestered within the extr acellular matrix of tissu es rather than being re leased into the blood or luminal cavities [218, 282]. Very little to no FGF10 is produced by luminal and glandular epithelium. Cell lines developed from ovine endometrial epithelium contain FGF10 mRNA [331], but in situ studies did not detect FGF10 transcripts in luminal or glandular epithelium 57

PAGE 58

during diestrus and early pregnancy [281]. By contrast, FGF2 is produced by the endometrial epithelium and can be found in the uterine lume n during early pregnancy [212, 257]. It remains unknown if uterine-derived FGF1 is released into the uterine lumen. FGF1 is produced by bovine luminal epithelium during mid-gestation [ 297] and, therefore, may have a similar uterine expression pattern as FGF2 prior to placental attachment. All of the recombinant FGF preparations were able to stimulate IFNT mRNA in in vitro produced blastocysts. Fibroblast growth factor 1 and FGF2 proteins were similar in their ability to stimulate IFNT mRNA, whereas as much as 10-fold mo re FGF10 was required in some cases to elicit biological responses on blastocysts. It is unclear w hy FGF10 contained slightly lower biological activity than other FG Fs. Perhaps using a human recombinant FGF10 protein that contains a good, but not great sequence identity to its bovine homolog caused this effect (91.6% identical amino acid sequence id entity to bovine FGF10). Alternatively, issues with freeze/thawing the recombinant preparation, post -thawing handling, and/or protein degradation rate during culture could have contributed to this outcome. Regardless of the reason, rhFGF10 did contain biological activity on in vitro produced blastocysts. Th erefore, its bovine homolog probably also is capable of stimulating IFNT expression by the bovine trophectoderm. None of the FGF proteins examined affected trophectoderm and blastomere cell numbers. Previous work consistently obs erved little to no mitogenic eff ect of boFGF2 [212, 213]. One interpretation of these findings is that the FG Fs under investigation lik ely are not serving an active role in regulating cell proliferation rate early in conceptus development. However, the ability of selective FGFs to influe nce early bovine embryo development ( i.e. blastocyst formation, blastocyst quality, and ratio of trophoblast/inner cell ma ss cells) have yet to be fully explored. 58

PAGE 59

It still remains unclear whether one or multiple FGFR subtypes dictate FGF responses in bovine trophectoderm. Fibroblast growth factor 1 a ssociates equally well with each of the FGFR variants expressed in bovine c onceptuses, and FGF2 has a high affinity for FGFR1c and FGFR3c and a moderate affinity for FGFR2b [216, 218, 2 82]. Fibroblast growth factor 10 is more selective in its receptor partne r binding interactions and genera lly acts through either FGFR2b or FGFR1b [218, 289]. The latter receptor subtype was not detected in conceptus and CT-1 screens. Recombinant FGF7 was included in one CT-1 study to determine if its interaction with FGFR2b was sufficient to induce an IFNT mRNA response (Pennington and Ealy, unpublished observations). FGF7 is not expressed in preand pe ri-attachment bovine conceptuses and endometrial sources of FGF7 are localized too deep within the stromal region to permit FGF7 from being secreted into the uterine lumen [281]. However, FGF7 acts exclusively through FGFR2b [218, 289], and its ability to increase IFNT mRNA levels in CT-1 cells implicates FGFR2b as one of the receptor subtypes re sponsible for FGF actions on trophectoderm (Pennington and Ealy, unpublished observations ). This observation does not exclude the possibility that other FGFRs also may participat e in directing the biologi cal activities of other FGFs on bovine trophectoderm, but the relative importance of other FGFRs in regulating IFNT expression and other critical actions during conceptus development remains to be fully explored. In conclusion, current findings provide new insight for how conceptus-derived factors may control IFNT expression during early pregnancy in cattle. Multiple FGFRs are expressed by elongating bovine conceptuses, and at least one of these receptor subtypes, FGFR2b, is involved with mediating FGF induced increases in IFNT mRNA and protein production in bovine trophectoderm. Also, several FGFs are expressed by bovine conceptu ses. Of particular note is FGF10 a ligand for FGFR2b whose expression increases in d 14 and 17 conceptuses coincident 59

PAGE 60

with peak IFNT expression. This and potentially othe r conceptus-derived FGFs, as well as uterine-derived FGFs likely are acting in conc ert to impact IFNT production from bovine trophectoderm. This could well be an essential component for th e establishment and maintenance of pregnancy in cattle and sheep. Materials and Methods Animal Use and Tissue Collection All animal experimentation was completed in accordance with Institutional Animal Care and Use Guidelines and with the approval of the Institutional Animal Ca re and Use Committee at the University of Florida. Healthy, non-lactat ing Holstein cows (n= 21) were housed at the University of Florida Dairy Unit (Hague, FL) a nd fed a maintenance diet. Conceptuses were harvested on d 11, 14 and 17 post-insemination after superovulation. In brief, growth of a new wave of follicles was induced by ablating large follicles (>10 mm diameter) on ovaries with an ultrasound-guided follicle aspiration device [ 332]. A controlled drug intravaginal device containing progesterone (1.38 g; Eazi-BreedTM CIDR; Pfizer Corp.) was inserted after follicle ablation. Cows were provided a 4 day regiment of FSH treatment (Folltropin-V; AgTech; 400 mg total) beginning 2 days after follicle ablation, CIDRs were removed on the third day of FSH treatment and cows were injected with LutalyseTM (25 mg each time; Pfizer Corp.) twice on the third day of FSH treatment [333] Superovulated cows were in seminated with Holstein semen (Genex Cooperative Inc.) at 12 and 24 h af ter first detection of standing estrus. Conceptuses at d 11 and 14 post-inseminati on were collected non-surgically after providing an epidural injecti on of 2% (wt/vol) lidocaine (S parhawk Laboratories, Inc.) by inserting a latex Foley cathet er (Agtech Inc., Manhattan, KS) through the cervix and flushing each horn with 250ml flush solution (Dulbeccos phosphate-buffered saline [DPBS; Invitrogen Corp.] with 0.04% bovine serum al bumin [BSA]). Conceptuses at d 17 post60

PAGE 61

insemination were collected duri ng slaughter at the University of Florida Meats Laboratory by excising reproductive tracts, injec ting flush solution into the anteri or tip of one uterine horn and collecting fluid and conceptuses from an excised an terior portion of the ot her uterine horn. Flush solutions were examined macroscopically and mi croscopically, if needed (d 11) to collect conceptuses. All d 11 conceptuses were ovoid in shape and most could be detected in the petri dish with the naked eye. Appr oximately half of the d 14 conceptuses collected were ovoid, but readily visible in the petri dish with the naked eye. The remain ing d 14 conceptuses were in the initial stages of elongation and ranged from 0.5 to 3 cm in length. All of the d 17 conceptuses were elongated and filamentous, ranging from 5 to 45 cm in length. Conceptuses were pooled together in small groups (n=3-5/pool) and snap-fro zen in liquid nitrogen a nd stored at -80C. Each pool of the d 14 samples contained a mi xture of ovoid and elongating conceptuses. Additional tissues, including endometrium, lung, and brain (hippocampus and cerebrum), were collected from cows during slaught er, snap-frozen in liquid nitrogen and stored at -80C until use as positive control samples. Total cellular (tc) RNA was extracted from d 11 and d 14 conceptus pools using the RNeasy Micro kit (Qiagen Inc). The RNA queous-Midi RNA Isol ation Kit (Applied Biosystems/Ambion) was used to extract tcRNA from d17 conceptu ses. The PureLink Micro-toMidi Total RNA Purification System with Trizol (Invitrogen Corp.) was used to extract tcRNA from other tissues. Concentr ation and quality of isolated tcRNA was assessed by using a NanoDrop spectrophotometer (T hermo Scientific). Bovine in Vitro Embryo Production In vitro maturation, fertilization and culture procedures were used to generate bovine blastocysts [334-336]. Briefly, oocytes from slau ghterhouse ovaries were ma tured and fertilized in vitro with Holstein semen (Genex Cooperative, Inc). After fertilization, presumptive zygotes 61

PAGE 62

were placed in groups of 25-30 and incubated in 5% CO2/5%O2/90%N2 at 38.5C in 50l drops of either Synthetic Oviduct Fl uid (SOF; Chemicon International/M illipore, Billerica, MA) or modified Potassium simplex optimized medium (mKSOM; Caisson Laboratories) [335], depending on the study. Both media were supplem ented with 0.3% [w/v] essentially fatty acid free BSA (Sigma Chemical Co.). In one study, expanded and hatched blastocysts formed on d 8 post-fertilization after cu lture in mKSOM were placed in groups (n=10-18), snap-frozen in liquid nitrogen and stored at -80C. TcRNA was ex tracted using the RNeasy Micro kit (Qiagen Inc.) and quantified by using a NanoDrop spectrophotom eter (Thermo Scientific). In a second set of studies, blastocysts identi fied on d 8 post-fertilization were collected and washed in DPBS containing 1 mg/ml polyvinyl pyrolidone (PVP; Fisher Scientific). Individual blastocysts were placed in 30 l dr ops of Medium 199 (M199) containing 2.5% [v/v] fetal bovine serum (FBS; Invitr ogen Corp.) and 10 M Gentam ycin (Sigma Chemical Co.) [213]. The stage of blastocyst development (non-expanded or e xpanded) was used to balance treatment combinations. Medium was supplemen ted with 50 ng/ml recombinant (r) bovine (b) FGF1 (R&D Systems), 50 ng/ml rbFGF2 (R&D Systems), 50 or 500 ng/ml r human (h) FGF10 (Invitrogen Corp.) or carrier only (M199 containing 1% [w/v] BS A). In one study, blastocysts were incubated at 38.5C in 5% CO2/5%O2/90%N2 for 24 h, then washed once in PBS/PVP, snap-frozen in liquid nitrogen and stored at -8 0C. In a companion study, blastocysts were incubated at the aforementioned condition for 48 h then washed once in PBS/PVP and fixed by incubation in 4% [w/v] paraformaldehyde (Pol ysciences Inc.) for 10 min and processed for determining blastomere numbers with Hoechst 33342 staining and epifluorescence microscopy [213]. Number of Hoechst-positi ve nuclei was quantified with NIS-Elements software (Nikon Instruments Inc.). 62

PAGE 63

End-Point RT-PCR All samples were incubated with RNase-free DNase (Ambion, Inc.) for 30 min at 37C then heat-denatured at 75C for 10 min immediately before reverse transcri ption. The SuperScript III First-Strand Synthesis System Kit (Invitrogen Corp.) and random hexamers were used for reverse transcription of tcRNA. Non-reverse transcribed DNase-treated RNA was included as a negative control for each sample. Gene-specific pr imer sets were used to amplify products for FGFR1, 2, 3 or 4 and FGF1, 2, 7 or 10 (see Table 3-2). A primer pair specific for -actin (ACTB) cDNA was included as a positive control in these reactions (Table 3-2). PCR amplification was performed using either PfuUltra High-Fidelity DNA Polymerase (Stratagene) or ThermalAce DNA Polymerase (Invitrogen Corp.). From 30 to 45 cycles of denaturation (95C for 1 min), annealing (55C for 1 min; depending on the primer set) and DNA synthesis (72 or 74C for 1 min; de pending on the polymerase) followed by a DNA polishing stage (72-74C for 10 min) were comp leted. The presence and approximate size of amplified products were determined by electrophores is in an agarose gel (1.2% [w/v]) containing ethidium bromide (100ng/mL) and visualized on an UV light box. Amplicons of the desired size were excised from gels and ligated into the pCR4-Blunt TOPO vector (Invitrogen Corp.). Ligati on reactions were used to tr ansform chemically competent TOP10 E. coli (Invitrogen Corp.). Selected colonies were propagated and purified clones were sequenced in both directions usi ng vector primer sets at the University of Florida DNA Core Facility. Multiple clones from at least three different conceptuses were sequenced to verify that amplified products represented the transcript of interest. Also, DNA sequencing was used to identify specific splice variant forms of FGFR1 to FGFR3 in bovine conceptuses and CT-1 cells. 63

PAGE 64

Quantitative (q), Real-Time RT-PCR The abundance of FGF and IFNT transcripts in bovine conceptuses was determined by qRT-PCR. All samples were incubated with RNase-free DNase (Ambion Inc.) as described previously before reverse transcription with the High Capacity cDNA Archive Kit and random hexamers (Applied Biosystems Inc.). For one study with in vitro produced blastocysts, primers specific for boIFNT and 18S (internal control) (Table 3-3) were used in combination with a SybrGreen detector system (Applied Biosystems Inc.) and a 7300 Real-Tim e PCR System (Applied Biosystems Inc.) to quantify IFNT mRNA concentrations. After an initial activation/denaturati on step (50C for 2 min; 95C for 10 min), 40 cycles of a two-step amplification prot ocol (60C for 1 min; 95C for 15 sec) were completed. A dissociation curve an alysis (60-95C) was used to verify the amplification of a single product. Each blastocyst sample was run in duplicate reactions and a third reaction lacking exposure to reverse transc riptase was included for each sample to verify they were free of genomic contaminati on. The comparative threshold cycle (CT) method was used to quantify the abundance of IFNT mRNA relative to that of 18S [212]. In brief, the average CT value for each sample was calculated (IFNT CT 18S CT) and used to calculate the fold-change in the relative abundance of IFNT mRNA. A TaqMan-based qRT-PCR approach wa s used to quantify the abundance of FGF1 FGF2 FGF10 IFNT and 18S RNA (internal RNA loading contro l) in other studies. Primers and probes specific for each FGF transcript and IFNT mRNA were synthesized (Applied Biosystems Inc.; Table 3-4) and labeled with a fluorescent 5' 6-FAM reporter dye and 3' TAMRA quencher. The IFNT primer/probe set was developed to recognize every known bovine and ovine IFNT isoform [212]. After an initial activation/dena turation step (50C for 2 min; 95C for 10 min), 50 cycles of a two-step amplif ication protocol (60C for 1 min; 95C for 15 64

PAGE 65

sec) was used with TaqMan reagent (Applie d Biosystems Inc.) and a 7300 Real-Time PCR System to quantify transcri pt levels. Abundance of 18S RNA was determined using the 18S RNA Control Reagent Kit (Applied Biosystems In c.) containing a 5'-VIC-labelled probe with a 3'-6-carboxy-tetramethylrhodamine quencher. Ea ch RNA sample was analyzed in duplicate reactions (10-50 ng tcRNA for blastocysts and d 11 conceptuses; 50 ng tcRNA for d 14 and 17 conceptuses). An additional reaction lacking ex posure to the reverse transcriptase was included for each sample to verify they were free of genomic DNA contamination. The CT method was used to contrast abundance of transcripts for FGFs and IFNT relative to 18S RNA in all but one study. In one study, relative amounts of 18S RNA changed across stages of conceptus development, so a relative standard curve approach was used in combination with the amount of tcRNA used in qRT-PCR reactions to describe relative abundances for individual FGFs and IFNT during conceptus development [337, 338] (ABI Prism Sequence Detection System User Bulletin No. 2; Applied Biosystems Inc.). One of the d 17 conceptus RNA samples was used as a standard sa mple, and four doses of this preparation (2, 10, 50, 250 ng tcRNA/reaction) was included in each real-time run. The slope and intercept for each FGF, IFNT, and 18S curve was used to convert raw CT values into values that represented the ng of control tcRNA required to equal that detect ed in each sample by solving the formula: (10[(C T value-y intercept)/slope] / sample tcRNA). Statistical Analyses All analyses were completed by analysis of variance (ANOVA) using the General Linear Model (GLM) of the Statistical Analysis System (S AS Institute Inc.). Di fferences in individual means were partitioned further by completing pa ir-wise comparisons (probably of difference analysis [PDIFF]). When analyzing qRT-PCR data transformed using the CT method, the CT 65

PAGE 66

values were used for the statistical analyses, bu t data are presented as fold differences from control values. Results are presented as arithmetic means SEMs. 66

PAGE 67

CHAPTER 4 CONCLUSION Various FGFs produced by both the bovine endometrium and conceptus bind to and activate FGFRs expressed by the trophectoderm to stimulate IFNT mRNA and protein production in the bovine trophectoderm during early pregnancy (Figure 4-1). Our findings show FGF2 to be one of them. This FGF is released into the lumen throughout the estrous cycle and early pregnancy and is available to the bovine trophectoderm to stimulate IFNT production [212]. Other uterine-de rived FGF, such as FGF7 and FGF10 are expressed in the stromal endometrium, and it is unlikely they can traverse the uterine layers a nd reach the lumen [298]. Therefore, their actions may be restricted to mediate the att achment of trophoblast cells [281], and to stimulate the prolifera tion of epithelia l cells [218]. Our results also identified various FGFs produced by the bovine conceptus. Fibroblast growth factor 1 and FGF2, as well as their FG FRs isoforms, are produced by the trophectoderm during early pregnancy. Once activ ated, they have an autocrine effect to enhance IFNT production by the trophectoderm. Maybe the most exciting FGF of all, FGF10 represents the primary transcript in d17 conceptus and has similar expression pattern as IFNT Fibroblast growth fact or 10 is localized to the mesoderm, and because is the predominant FGF in peri-attachment conceptuses, it is proposed that FGF10 interacts with its specif ic trophectoderm-derived receptor, FGFR2b, during conceptus elongation to maximize IFNT expression in early pregnancy. 67

PAGE 68

Figure 4-1. Proposed model of expression and ac tion of selective FGF during pre-attachment bovine conceptus development. 68

PAGE 69

Table 3-2. End-point RT-PCR primer sets used for discovery of FGFR subtypes and FGFs expressed during early bovine conceptus development Gene of Interest Primer* Product Size Sequence (5'-3') Annealing Temp (oC) Gene Bank ID FGFR1 Forward Reverse 574 ATCGTGGAGAACGAATACGGC GGATGCTCTTGGCCAGCTTGT 58 281768 FGFR2 Forward Reverse 596 GGTCCCGTCTGACAAAGGAAA GTCAGCTTGTGCACAGCCG 58 404193 FGFR3 Forward Reverse 574 GGCAGAATCCAGCAGACCTAC CAAGGACACCTGTCGCTTGAG 58 281769 FGFR4 Forward Reverse 427 AAGGCAGGTACACGGACATC TAAGCATCTTGACAGCCACG 58 317696 FGF1 Forward Reverse 322 TTCCTGAGAATCCTCCCAGA CTTTCTGGCCGAAGTGAGTC 57 281160 FGF2 Forward Reverse 281 CAAGCGGCTGTACTGCAAGA TCGTTTCAGTGCCACATACCA 57 281161 FGF7 Forward Reverse 432 GCTTGCAATGACATGACTCC TGCCATAGGAAGAAAGTGGG 55 616885 FGF10 Forward Reverse 361 GTTCTTGGTGTCTTCCGTCC CTCCTTTTCCATTCAATGCC 55 326285 ACTB Forward Reverse 362 CTGTCCCTGTATGCCTCTGG AGGAAGGAAGGCTGGAAGAG 57 280979 Forward=sense (5') primer; Reverse=antisense (3') primer. 69

PAGE 70

Table 3-3. Primer sets used for SybrGreen qRT-PCR Gene of Interest Primer* Sequence (5'-3') Gene Bank ID IFNT Forward GATCCTTCTGGAGCTGGYTG 317698 Reverse GCCCGAATGAACAGACTCYC 18S Forward GCCTGAG AAACGGCTACCAC 493779 Reverse CACCAGACTTGCCCTCCAAT *Forward=sense (5') primer; Reverse=antisense (3') primer. Y= insertion of C or T nucleotide 70

PAGE 71

Table 3-4. Primer/probe sets used for TaqMan qRT-PCR Gene of Interest Primer/ Probe* Sequence (5'-3')** Reference/ Gene Bank ID FGF1 Forward Reverse Probe ACAGTGGATGGGACGAAGGA CCCTATGCTTTCCGCACAGA AGCGACCAGCACATTCAGCTGCAG 281160 FGF2 Forward Reverse Probe ACCGGTCAAGGAAATACTCCAG CAGGTCCTGTTTTGGGTCCA TGGTATGTGGCACTGAAACGAACTGGG [212] FGF10 Forward Reverse Probe AGAGGACAGAAAACACGAAGGAAA GGTTATACTGCATCTGCAATCATTG CCTCAGCTCATTTTC TTCCGATGGTGGTAC 326285 IFNT Forward Reverse Probe TGCAGGACAGAAAAGACTTTGGT CCTGATCCTTCTGGAGCTGG TTCCTCAGGAGATGGTGGAGGGCA [212] Forward=sense (5') primer; Reverse=antisense (3') primer. **Each probe was synthesized with a 6FAM reporter dye and TAMRA quencher. 71

PAGE 72

APPENDIX A QUANTITATIVE REAL TIME RT-PCR PROTOCOL A quantitative assay (qRT-PCR) determines the relative amounts of a nucleic acid target as it is being amplified with PCR. The followi ng protocol was used when completing qRT-PCR with either TaqMan Probes or SYBR Green I Dye detectors. RNA Concentration The concentration of RNA should be determ ined by measuring the absorbance at 260 nm (A260) in a spectrophotometer. NanoDrop 8000 (Thermo Scie ntific, Wilmington, DE) 1. With the sample apparatus open, add 1.5 L of RNA sample onto the measurement pedestal. 2. Close the sample apparatus. The spectral meas urement is made based on the path length of 1mm. 3. When the measurement is complete, open the sample apparatus and wipe the sample from both the sample arm and sample pedestal using an ordinary tissue (Kimwipes). DNAse Treatment This step is necessary to eliminate any DNA contamination in the RNA sample. 1. For the actual samples, combine 600 ng of RN A (or use all eluted RNA if the concentration is not enough) +12.5 L of the following DNAse mix in a PCR tube: 2x DNAse mix 1 reaction DNAse 1.0 L DNAse buffer 1.5 L DEPC water 9.0 L TOTAL 12.5 L 2. Spin for 30 sec in a mini centrifuge. Set the program in a PCR thermocycler as following: 72

PAGE 73

a. 37oC/30 min b. 75oC/15 min c. 4oC end Reverse Transcription (RT) The RT reaction, also known as first strand cDNA synthesis, is necessary to convert single-stranded RNA into first strand DNA by a reverse transcriptas e enzyme; the resulting product can be used in RT-PCR reactions. 1. In a 96-well plate, add 10 L of DNAse-treated product and 10 L of RT mix. You must have two wells for the sample and 1 well fo r the negative control (3 wells/sample). 2x RT mix 1 reaction 1 reaction 10x Buffer 2 L 2 L 10x Primer 2 L 2 L 25x dNTPs 0.8 L 0.8 L 20x RTase 1 L -DEPC water 4.2 L 5.2 L TOTAL 10 L 10 L 2. Spin at 4oC for 2 min at 2000 rpm. Set the program in the PCR thermocycler as following: a. 25oC/10 min b. 37oC/60 min 2x c. 85oC/5 sec d. 4oC end Real Time PCR: TaqMan Probe TaqMan probe consists of two fluorescent reporter proteins: a quenc her (at the 3 end) and a reporter (at the 5 end). Due to their pr oximity to each other, the quencher drastically reduces the fluorescence from the reporter. Taq polymerase then removes the TaqMan probe 73

PAGE 74

from the template DNA as it inco rporates nucleotides into a ne w strand of DNA. This event separates the quencher from the reporter, and al lows the reporter to emit its fluorescence, which is then quantified in real time. 1. In a 96-well optical plate combine 5 L of the RT product and 45 L of PCR mix (3 wells/sample). PCR mix 1reaction 2x TaqMan Mix 25 L 10x 2 M Primer For 5 L 10x 2 M Primer Rev 5 L 10x 1 M Probe 5 L 20x 18S Primer/Probe 2.5 L DEPC water 2.5 L TOTAL 45 L 2. Spin at 4oC for 2 min at 2000 rpm. Set the program in the computer by the Real Time PCR machine: Stage 1: 50oC/2 min Stage 2: 95oC/10 min Stage 3: 50 cycles 95oC/15 sec 55oC/1 min Real Time PCR: SYBR Green I Dye Chemistry The SYBR Green I Dye binds to minor gr ooves in the double-stranded DNA and emits light when excited. It eliminates the need fo r complicated probe design and can be used in conjunction with any primers for any target of in terest, although sensitiv ity can be compromised by biding to any dsDNA, incl uding nonspecific products. 1. In a 96-well optical plate combine 5 L of the RT product and 45 L of PCR mix (3 wells/sample). 74

PAGE 75

PCR mix 1 reaction 2x SYBR Green Mix 25 L 10x 2 M Primer For 5 L 10x 2 M Primer Rev 5 L DEPC water 10 L TOTAL 45 L 2. Spin at 4oC for 2min at 2000rpm. Set the program in the computer by the Real Time PCR machine: Stage 1: 50oC/2min Stage 2: 95oC/10min Stage 3: 50 cycles 95oC/15sec 55oC/1min Add Dissociation Stage: Stage 4: 95oC/15 sec 60oC/30 sec 95oC/15 sec 75

PAGE 76

APPENDIX B RELATIVE STANDARD CURVE MET HOD FOR ANALYZING qRT-PCR DATA The relative standard curve method uses a set of samples as internal standards to generate linear regression equations that can be used to normalize data across qRT-PCR runs. Relative standard curves are easy to prepare because quan tity is expressed relative to a sample (the calibrator), which is used for comp aring results across qRT-PCR runs. Standards Prepare a 5-fold dilution of a representative tcRNA sample that contains the transcripts of interest. For example, in the work completed herein, standard samples included d 17 bovine conceptus RNA and lung RNA (250, 50, 10 and 2 ng of each). By using the same stock RNA to prepare standard curves for multiple plates, the re lative quantities can be compared across plates. The standard samples used for this work were: Lung: FGF1 FGF2 (targets) and 18S (endogenous control) d17 conceptus: FGF10 IFNT (targets) and 18S (endogenous control) It is important that stocks of RNA for the standard curve be accurately diluted. Store small aliquots of each dilution at -80oC, and thaw each aliquot only once. Determining the Relative Values Use the slope and intercept for each standard curve in the following formula. Convert raw Ct values into values that repr esent the ng of control tcRNA requi red to equal that detected in each sample. 76

PAGE 77

Another way to determine the relative values when the internal control does not change throughout the samples is to use the slope and intercept from each standard curve in the following formula: 77

PAGE 78

y = -2.6919x + 37.007 R = 0.9883 30 31 32 33 34 35 36 37 0.000.501.001.502.002.503.00Ctlog10 RNA (ng/rxn) Figure B-1. Standard curve create d for FGF1 using a lung sample. 78

PAGE 79

y = -3.1452x + 33.578 R = 0.9874 25 27 29 31 33 35 0.000.501.001.502.002.503.00Ctlog10 RNA (ng/rxn) Figure B-2. Standard curve create d for FGF2 using a lung sample. 79

PAGE 80

y = -3.2823x + 36.75 R = 0.9915 25 27 29 31 33 35 37 0.000.501.001.502.002.503.00Ctlog10 RNA (ng/rxn) Figure B-3. Standard curve created for FGF10 using a d 17 conceptus sample. 80

PAGE 81

y = -3.1336x + 23.344 R = 0.9888 10 12 14 16 18 20 22 24 0.000.501.001.502.002.503.00Ctlog10 RNA (ng/rxn) Figure B-4. Standard curve created for IFNT using a d 17 conceptus sample. 81

PAGE 82

y = -3.145x + 22.57 R = 0.9899 10 12 14 16 18 20 22 24 0.000.501.001.502.002.503.00Ctlog10 RNA (ng/rxn) Figure B-5. Standard curve create d for 18S using a lung sample. 82

PAGE 83

y = -3.0811x + 15.664 R = 0.9876 5 7 9 11 13 15 17 0.000.501.001.502.002.503.00Ctlog10 RNA (ng/rxn) Figure B-6. Standard curve created for 18S using a d 17 conceptus sample. 83

PAGE 84

LIST OF REFERENCES 1. Inskeep EK, Dailey RA. Embryonic death in cattle. Vet Clin North Am Food Anim Pract 2005; 21: 437-461. 2. Roche JF, Bolandl MP, McGeady TA. Reproductive wastage following artificial insemination of heifers. Vet Rec 1981; 109: 401-404. 3. De Vries A. Economic value of pregnancy in dairy cattle. J Dair y Sci 2006; 89: 38763885. 4. Evans JP, Florman HM. The state of the union: the cell biology of fertilization. Nat Cell Biol 2002; 4 Suppl: s57-63. 5. Betteridge KJ, Flechon JE. The anatomy and physiology of pre-attachment bovine embryos. Theriogeno logy 1988; 29: 155-187. 6. Van Soom A, Boerjan M, Ysebaert MT, De Kr uif A. Cell allocation to the inner cell mass and the trophectoderm in bovine embryos cultured in two different media. Mol Reprod Dev 1996; 45: 171-182. 7. Kidder GM, McLachlin JR. Timing of transc ription and protein synthesis underlying morphogenesis in preimplantation mouse embryos. Dev Biol 1985; 112: 265-275. 8. Garbutt CL, Chisholm JC, Johnson MH. The establishment of the embryonicabembryonic axis in the mouse em bryo. Development 1987; 100: 125-134. 9. Gardner RL. Investigation of cell lineag e and differentiation in the extraembryonic endoderm of the mouse embryo. J Embryol Exp Morphol 1982; 68: 175-198. 10. Rossant J. Postimplantation development of blastomeres isolated from 4and 8-cell mouse eggs. J Embryol Exp Morphol 1976; 36: 283-290. 11. Chambers I, Colby D, Robertson M, Nichol s J, Lee S, Tweedie S, Smith A. Functional expression cloning of Nanog, a pluripotency su staining factor in embryonic stem cells. Cell 2003; 113: 643-655. 12. Hansis C, Grifo JA, Krey LC. Oct-4 expr ession in inner cell mass and trophectoderm of human blastocysts. Mol Hu m Reprod 2000; 6: 999-1004. 13. Tanaka TS, Kunath T, Kimber WL, Jaradat SA, Stagg CA, Usuda M, Yokota T, Niwa H, Rossant J, Ko MS. Gene expression profili ng of embryo-derived stem cells reveals 84

PAGE 85

candidate genes associated with pluripoten cy and lineage specific ity. Genome Res 2002; 12: 1921-1928. 14. Yan JL, Tanaka S, Oda M, Makino T, Ohga ne J, Shiota K. Retinoic acid promotes differentiation of trophoblast stem cells to a giant cell fate. Dev Biol 2001; 235: 422-432. 15. Beck F, Erler T, Russell A, James R. E xpression of Cdx-2 in the mouse embryo and placenta: possible role in patterning of th e extra-embryonic membranes. Dev Dyn 1995; 204: 219-227. 16. Hancock SN, Agulnik SI, Silver LM, Papa ioannou VE. Mapping and expression analysis of the mouse ortholog of Xenopus Eo mesodermin. Mech Dev 1999; 81: 205-208. 17. Morasso MI, Grinberg A, Robinson G, Sarg ent TD, Mahon KA. Placental failure in mice lacking the homeobox gene Dlx3. Proc Natl Acad Sci USA 1999; 96: 162-167. 18. Flechon JE, Renard JP. A scanning electron mi croscope study of the hatching of bovine blastocysts in vitro. J Re prod Fertil 1978; 53: 9-12. 19. Perry JS. The mammalian fetal membra nes. J Reprod Fertil 1981; 62: 321-335. 20. Maddox-Hyttel P, Alexopoulos NI, Vajta G, Lewis I, Rogers P, Cann L, Callesen H, Tveden-Nyborg P, Trounson A. Immunohi stochemical and ultrastructural characterization of the initial post-hatching development of bovine embryos. Reproduction 2003; 125: 607-623. 21. Schlafer DH, Fisher PJ, Davies CJ. The bovine placenta before and after birth: placental development and function in health and disease. Anim Repr od Sci 2000; 60-61: 145-160. 22. Hue I, Renard JP, Viebahn C. Brachyury is expressed in gastrulating bovine embryos well ahead of implantation. Dev Genes Evol 2001; 211: 157-159. 23. Winters LM, Green WW, Comstock RE. Prenat al development of th e bovine. Minnesota Technical Bulletin 1942; 151: 3. 24. Curran S, Pierson RA, Ginther OJ. Ultrasonographic appearance of th e bovine conceptus from days 20 through 60. J Am Vet Med Assoc 1986; 189: 1295-1302. 25. Bertolini M, Beam SW, Sh im H, Bertolini LR, Moyer AL, Famula TR, Anderson GB. Growth, development, and gene expression by in vivoand in vitro-produced day 7 and 16 bovine embryos. Mol Re prod Dev 2002; 63: 318-328. 85

PAGE 86

26. Chang MC. Development of bovine blastocy st with a note on implantation. Anat Rec 1952; 113: 143-161. 27. Schlafke S, Enders AC. Cellular basis of interaction between trophoblast and uterus at implantation. Biol Reprod 1975; 12: 41-65. 28. Lee KY, DeMayo FJ. Animal models of implantation. Reproduction 2004; 128: 679-695. 29. Chavatte-Palmer P, Guillomot M. Compara tive implantation and placentation. Gynecol Obstet Invest 2007; 64: 166-174. 30. Spencer TE, Johnson GA, Bazer FW, Burghardt RC. Implantation mechanisms: insights from the sheep. Reproduction 2004; 128: 657-668. 31. Guillomot M, Flechon JE, Leroy E. Blastocy st development and implantation. Paris: Ellipses; 1993. 32. Guillomot M, Flechon JE, Wintenberger-Torres S. Conceptus attachment in the ewe: an ultrastructural study. Pl acenta 1981; 2: 169-182. 33. Guillomot M, Guay P. Ultrastructural feat ures of the cell surfaces of uterine and trophoblastic epithelia during embryo attachme nt in the cow. Anat Rec 1982; 204: 315322. 34. Wooding FB. The role of the binucleate cell in ruminant pl acental structure. J Reprod Fertil Suppl 1982; 31: 31-39. 35. Spencer TE, Johnson GA, Burghardt RC, Bazer FW. Progesterone and placental hormone actions on the uterus: insights from domes tic animals. Biol Reprod 2004; 71: 2-10. 36. Spencer TE, Bazer FW. Biology of progester one action during pregnancy recognition and maintenance of pregnancy. Front Biosci 2002; 7: d1879-1898. 37. Enders AC, Carter AM. What can comparativ e studies of placental structure tell us?--A review. Placenta 2004; 25 Suppl A: S3-9. 38. Moll W. Structure adaptation and blood flow c ontrol in the uterine arterial system after hemochorial placentation. Eur J Obstet G ynecol Reprod Biol 2003; 110 Suppl 1: S19-27. 39. Wooding FB. Current topic: the synepithelioch orial placenta of ruminants: binucleate cell fusions and hormone production. Placenta 1992; 13: 101-113. 86

PAGE 87

40. Wooding FB, Morgan G, Adam CL. Stru cture and function in the ruminant synepitheliochorial placenta: central role of the trophoblas t binucleate cell in deer. Microsc Res Tech 1997; 38: 88-99. 41. Gootwine E. Placental hormones and fetalplacental development. Anim Reprod Sci 2004; 82-83: 551-566. 42. Wooding FB, Chambers SG, Perry JS, George M, Heap RB. Migrati on of binucleate cells in the sheep placenta during normal pregna ncy. Anat Embryol (Berl) 1980; 158: 361-370. 43. Wango EO, Wooding FB, Heap RB. The role of trophoblastic binucleate cells in implantation in the goat: a morphol ogical study. J Anat 1990; 171: 241-257. 44. Wooding FB. Role of binucleate cells in feto maternal cell fusion at implantation in the sheep. Am J Anat 1984; 170: 233-250. 45. Hoffman LH, Wooding FB. Giant and binuc leate trophoblast cells of mammals. J Exp Zool 1993; 266: 559-577. 46. Wooding FB, Flint AP, Heap RB, Morgan G, Buttle HL, Young IR. Control of binucleate cell migration in the placen ta of sheep and goats. J Reprod Fertil 1986; 76: 499-512. 47. Wooding FB. Frequency and localization of binucleate cells in the placentomes of ruminants. Placenta 1983; 4 Spec No: 527-539. 48. Moor RM, Rowson LE. The corpus luteum of the sheep: effect of the removal of embryos on luteal function. J Endocrinol 1966; 34: 497-502. 49. Moor RM, Rowson LE. The corpus luteum of the sheep: functional relationship between the embryo and the corpus lute um. J Endocrinol 1966; 34: 233-239. 50. Moor RM, Rowson LE, Hay MF, Caldwell BV. The corpus luteum of the sheep: effect of the conceptus on luteal functi on at several stages during pregnancy. J Endocrinol 1969; 43: 301-307. 51. Rowson LE, Moor RM, Lawson RA. Fertility foll owing egg transfer in the cow; effect of method, medium and synchronization of oestrus. J Reprod Fertil 1969; 18: 517-523. 52. Rowson LE, Lawson RA, Moor RM, Baker AA. Egg transfer in the cow: synchronization requirements. J Reprod Fertil 1972; 28: 427-431. 87

PAGE 88

53. Martal J, Lacroix MC, Loudes C, Saunier M, Wintenberger-Torres S. Trophoblastin, an antiluteolytic protein present in early pr egnancy in sheep. J Reprod Fertil 1979; 56: 6373. 54. Bartol FF, Roberts RM, Bazer FW, Lewis GS, Godkin JD, Thatcher WW. Characterization of proteins produced in vitro by periattachment bovine conceptuses. Biol Reprod 1985; 32: 681-693. 55. Godkin JD, Bazer FW, Moffatt J, Sessions F, Roberts RM. Purificati on and properties of a major, low molecular weight protein released by the trophoblast of sheep blastocysts at day 13-21. J Reprod Fertil 1982; 65: 141-150. 56. Godkin JD, Bazer FW, Roberts RM. Ovine trophoblast protein 1, an early secreted blastocyst protein, binds sp ecifically to uterine endome trium and affects protein synthesis. Endocrinology 1984; 114: 120-130. 57. Godkin JD, Bazer FW, Thatcher WW, Roberts RM. Proteins released by cultured day 1516 conceptuses prolong luteal maintenance wh en introduced into the uterine lumen of cyclic ewes. J Reprod Fertil 1984; 71: 57-64. 58. Imakawa K, Anthony RV, Kazemi M, Maro tti KR, Polites HG, Roberts RM. Interferonlike sequence of ovine trophoblast protein s ecreted by embryonic trophectoderm. Nature 1987; 330: 377-379. 59. Demmers KJ, Derecka K, Flint A. Trophobl ast interferon and pr egnancy. Reproduction 2001; 121: 41-49. 60. Spencer TE, Burghardt RC, Johnson GA, Bazer FW. Conceptus signals for establishment and maintenance of pregnancy. An im Reprod Sci 2004; 82-83: 537-550. 61. Flint AP, Lamming GE, Stewart HJ, Abayas ekara DR. The role of the endometrial oxytocin receptor in determining the length of the sterile oestr ous cycle and ensuring maintenance of luteal function in early pre gnancy in ruminants. Philos Trans R Soc Lond B Biol Sci 1994; 344: 291-304. 62. Jenner LJ, Parkinson TJ, Lamming GE. Uterine oxytocin receptors in cyclic and pregnant cows. J Reprod Fertil 1991; 91: 49-58. 63. Spencer TE, Becker WC, George P, Mira ndo MA, Ogle TF, Bazer FW. Ovine interferontau regulates expression of endometrial receptors for estrogen and oxytocin but not progesterone. Biol Reprod 1995; 53: 732-745. 88

PAGE 89

64. Bazer FW, Thatcher WW, Hansen PJ, Mira ndo MA, Ott TL, Plante C. Physiological mechanisms of pregnancy recognition in rumi nants. J Reprod Fertil Suppl 1991; 43: 3947. 65. Knickerbocker JJ, Thatcher WW, Bazer FW Drost M, Barron DH, Fincher KB, Roberts RM. Proteins secreted by day-16 to -18 bovine conceptuses extend corpus luteum function in cows. J Reprod Fertil 1986; 77: 381-391. 66. Bazer FW, Vallet JL, Roberts RM, Sharp DC, Thatcher WW. Role of conceptus secretory products in establishment of pregnanc y. J Reprod Fertil 1986; 76: 841-850. 67. Robinson RS, Mann GE, Lamming GE, Wathes DC. The effect of pregnancy on the expression of uterine oxytocin, oestrogen and progesterone receptors during early pregnancy in the cow. J Endocrinol 1999; 160: 21-33. 68. Robinson RS, Mann GE, Lamming GE, Wathes DC. Expression of oxytocin, oestrogen and progesterone receptors in uterine biopsy samples througho ut the oestrous cycle and early pregnancy in cows. Reproduction 2001; 122: 965-979. 69. Leung ST, Wathes DC. Oestradiol regulation of oxytocin receptor expression in cyclic bovine endometrium. J Re prod Fertil 2000; 119: 287-292. 70. Wathes DC, Hamon M. Localization of oest radiol, progesterone and oxytocin receptors in the uterus during the oestrous cycle and early pregnancy of the ewe. J Endocrinol 1993; 138: 479-492. 71. Spencer TE, Ott TL, Bazer FW. Expression of interferon regulatory factors one and two in the ovine endometrium: effects of pregna ncy and ovine interfer on tau. Biol Reprod 1998; 58: 1154-1162. 72. Ott TL, Van Heeke G, Hostetler CE, Schalue TK, Olmsted JJ, Johnson HM, Bazer FW. Intrauterine injection of recombinant ovine in terferon-t extends the interestous interval in sheep. Theriogenology 1993; 40: 757-769. 73. Ealy AD, Green JA, Alexenko AP, Keisler DH, Roberts RM. Differe nt ovine interferontau genes are not expressed id entically and their protein products display different activities. Biol Reprod 1998; 58: 566-573. 74. Meyer MD, Hansen PJ, Thatcher WW, Drost M, Badinga L, Roberts RM, Li J, Ott TL, Bazer FW. Extension of corpus luteum lifes pan and reduction of uterine secretion of prostaglandin F2 alpha of cows in response to recombinant interferontau. J Dairy Sci 1995; 78: 1921-1931. 89

PAGE 90

75. Niswender KD, Li J, Powell MR, Loos KR, Roberts RM, Keisler DH, Smith MF. Effect of variants of interferon-tau with mutations near the carboxyl terminus on luteal life span in sheep. Biol Reprod 1997; 56: 214-220. 76. Winkelman GL, Roberts RM, James PA, Alex enko AP, Ealy AD. Identification of the expressed forms of ovine interferon-tau in the periimplantation conceptus: sequence relationships and comparative biological activities. Biol Reprod 1999; 61: 1592-1600. 77. Clark JD, Lin LL, Kriz RW, Ramesha CS, Sultzman LA, Lin AY, Milona N, Knopf JL. A novel arachidonic acid-selective cytosoli c PLA2 contains a Ca(2+)-dependent translocation domain with homology to PKC and GAP. Cell 1991; 65: 1043-1051. 78. Xiao CW, Liu JM, Sirois J, Goff AK. Regul ation of cyclooxygenase-2 and prostaglandin F synthase gene expression by steroid hormone s and interferon-tau in bovine endometrial cells. Endocrinology 1998; 139: 2293-2299. 79. Parent J, Villeneuve C, Alexenko AP, Ea ly AD, Fortier MA. Influence of different isoforms of recombinant trophobl astic interferons on prostagl andin production in cultured bovine endometrial cells. Biol Reprod 2003; 68: 1035-1043. 80. Binelli M, Subramaniam P, Diaz T, Johnson GA, Hansen TR, Badinga L, Thatcher WW. Bovine interferon-tau stimulates the janus ki nase-signal transducer and activator of transcription pathway in bovine endometrial epithelial cells. Biol Reprod 2001; 64: 654665. 81. Guzeloglu A, Michel F, Thatcher WW. Di fferential effects of interferon-tau on the prostaglandin synthetic pathway in bovine e ndometrial cells treated with phorbol ester. J Dairy Sci 2004; 87: 2032-2041. 82. Asselin E, Drolet P, Fortier MA. In vitr o response to oxytocin and interferon-tau in bovine endometrial cells from caruncular a nd inter-caruncular areas. Biol Reprod 1998; 59: 241-247. 83. Asselin E, Bazer FW, Fortier MA. Recombinant ovine and bovine interferons tau regulate prostaglandin production and oxytocin response in cultured bovine endometrial cells. Biol Reprod 1997; 56: 402-408. 84. Asselin E, Lacroix D, Fortier MA. Interf eron-tau increases PGE2 production and COX-2 gene expression in the bovine endometr ium in vitro. Mol Cell Endocrinol 1997; 132: 117-126. 85. Smith WL, Marnett LJ, DeWitt DL. Prosta glandin and thromboxane biosynthesis. Pharmacol Ther 1991; 49: 153-179. 90

PAGE 91

86. Skopets B, Li J, Thatcher WW, Roberts RM, Hansen PJ. Inhibition of lymphocyte proliferation by bovine trophoblast protein-1 (type I trophoblast in terferon) and bovine interferon-alpha 1. Vet Immunol Immunopathol 1992; 34: 81-96. 87. Thatcher WW. Antiluteolytic signals between the conceptus and endometrium. Theriogenology 1997; 47: 131-140. 88. Niwano Y, Hansen TR, Kazemi M, Malat hy PV, Johnson HD, Roberts RM, Imakawa K. Suppression of T-lymphocyte blastogenesis by ovine trophoblast protein-1 and human interferon-alpha may be independent of in terleukin-2 production. Am J Reprod Immunol 1989; 20: 21-26. 89. Fillion C, Chaouat G, Reinaud P, Charpigny JC, Martal J. Immunor egulatory effects of ovine trophoblastin protein (o TP): all five isoforms s uppress PHA-induced lymphocyte proliferation. J Reprod Immunol 1991; 19: 237-249. 90. Roberts RM, Imakawa K, Niwano Y, Kazemi M, Malathy PV, Hansen TR, Glass AA, Kronenberg LH. Interferon production by the preimplantation sheep embryo. J Interferon Res 1989; 9: 175-187. 91. Newton GR, Vallet JL, Hansen PJ, Bazer FW Inhibition of lymphocyte proliferation by ovine trophoblast protein-1 a nd a high molecular weight glycoprotein produced by the peri-implantation sheep conceptus. Am J Reprod Immunol 1989; 19: 99-107. 92. Tuo W, Ott TL, Bazer FW. Natural killer ce ll activity of lymphocytes exposed to ovine, type I, trophoblast interferon. Am J Reprod Immunol 1993; 29: 26-34. 93. Proost P, Wuyts A, Conings R, Lenaerts JP, Billiau A, Opdenakker G, Van Damme J. Human and bovine granulocyte chemotactic protein-2: co mplete amino acid sequence and functional characteriza tion as chemokines. Bioc hemistry 1993; 32: 10170-10177. 94. Choi Y, Johnson GA, Spencer TE, Bazer FW Pregnancy and interferon tau regulate major histocompatibility complex class I and beta2-microglobulin expression in the ovine uterus. Biol Re prod 2003; 68: 1703-1710. 95. Naivar KA, Ward SK, Austin KJ, Moore DW, Hansen TR. Secretion of bovine uterine proteins in response to type I in terferons. Biol Reprod 1995; 52: 848-854. 96. Staggs KL, Austin KJ, Johnson GA, Teixeira MG, Talbott CT, Dooley VA, Hansen TR. Complex induction of bovine uterine proteins by interferon-tau. Biol Reprod 1998; 59: 293-297. 91

PAGE 92

97. Teixeira MG, Austin KJ, Perry DJ, Dool ey VD, Johnson GA, Francis BR, Hansen TR. Bovine granulocyte chemotactic protein-2 is secreted by th e endometrium in response to interferon-tau Endocrine 1997; 6: 31-37. 98. Johnson GA, Austin KJ, Van Kirk EA, Hansen TR. Pregnancy and interferon-tau induce conjugation of bovine ubiquitin cross-reactive protein to cytosolic uterine proteins. Biol Reprod 1998; 58: 898-904. 99. Johnson GA, Joyce MM, Yankey SJ, Hansen TR, Ott TL. The Interferon Stimulated Genes (ISG) 17 and Mx have different temporal and spatial expression in the ovine uterus suggesting more complex regulation of th e Mx gene. J Endocrinol 2002; 174: 7-11. 100. Ott TL, Yin J, Wiley AA, Kim HT, Gerami-N aini B, Spencer TE, Bartol FF, Burghardt RC, Bazer FW. Effects of the estrous cycle a nd early pregnancy on uterine expression of Mx protein in sheep (Ovis arie s). Biol Reprod 1998; 59: 784-794. 101. Charleston B, Stewart HJ. An interferoninduced Mx protein: cDNA sequence and highlevel expression in the endometrium of pregnant sheep. Gene 1993; 137: 327-331. 102. Johnson GA, Stewart MD, Gray CA, Choi Y, Burghardt RC, Yu-Lee LY, Bazer FW, Spencer TE. Effects of the estrous cycle, pregnancy, and interferon tau on 2',5'oligoadenylate synthetase expression in the ovine uterus. Biol Reprod 2001; 64: 13921399. 103. Vallet JL, Barker PJ, Lamming GE, Skinner N, Huskisson NS. A low molecular weight endometrial secretory protein which is increased by ovine tr ophoblast protein-1 is a beta 2-microglobulin-like protein. J Endocrinol 1991; 130: 1-4. 104. Choi Y, Johnson GA, Burghardt RC, Ber ghman LR, Joyce MM, Taylor KM, Stewart MD, Bazer FW, Spencer TE. Interferon regulat ory factor-two restricts expression of interferonstimulated genes to the endometrial stroma a nd glandular epithelium of the ovine uterus. Biol Reprod 2001; 65: 1038-1049. 105. Pru JK, Austin KJ, Haas AL, Hansen TR. Pregnancy and interferon-tau upregulate gene expression of members of the 1-8 family in the bovine uterus. Biol Reprod 2001; 65: 1471-1480. 106. Hicks BA, Etter SJ, Carnahan KG, Joyce MM, Assiri AA, Carling SJ, Kodali K, Johnson GA, Hansen TR, Mirando MA, Woods GL, Va nderwall DK, Ott TL. Expression of the uterine Mx protein in cyclic and pregnant cows, gilts, and mares. J Anim Sci 2003; 81: 1552-1561. 92

PAGE 93

107. Horisberger MA, Staeheli P, Haller O. Interferon induces a unique protein in mouse cells bearing a gene for resistance to influenza virus. Proc Natl Acad Sci USA 1983; 80: 19101914. 108. Horisberger MA, Gunst MC. Inte rferon-induced proteins: identif ication of Mx proteins in various mammalian species. Virology 1991; 180: 185-190. 109. Evans SS, Collea RP, Leasure JA, Lee DB. IFN-alpha induces ho motypic adhesion and Leu-13 expression in human B lymphoi d cells. J Immunol 1993; 150: 736-747. 110. Deblandre GA, Marinx OP, Evans SS, Majjaj S, Leo O, Caput D, Huez GA, Wathelet MG. Expression cloning of an interferon-indu cible 17-kDa membrane protein implicated in the control of cell growt h. J Biol Chem 1995; 270: 23860-23866. 111. Chen YX, Welte K, Gebhard DH, Evans RL Induction of T cell aggregation by antibody to a 16kd human leukocyte surface antigen. J Immunol 1984; 133: 2496-2501. 112. Cross JC, Roberts RM. Constitutive and trophob last-specific expression of a class of bovine interferon genes. Proc Natl Acad Sci USA 1991; 88: 3817-3821. 113. Leaman DW, Cross JC, Roberts RM. Multiple regulatory elements are required to direct trophoblast interferon gene expression in c horiocarcinoma cells and trophectoderm. Mol Endocrinol 1994; 8: 456-468. 114. Roberts RM, Liu L, Alexenko A. New and at ypical families of type I interferons in mammals: comparative functions, structures and evolutionary relationships. Prog Nucleic Acid Res Mol Biol 1997; 56: 287-325. 115. Farin CE, Imakawa K, Hansen TR, McD onnell JJ, Murphy CN, Farin PW, Roberts RM. Expression of trophoblastic interferon genes in sheep and cattle. Biol Reprod 1990; 43: 210-218. 116. Roberts RM, Cross JC, Leaman DW. Interf erons as hormones of pregnancy. Endocr Rev 1992; 13: 432-452. 117. Hernandez-Ledezma JJ, Sikes JD, Murphy CN, Watson AJ, Schultz GA, Roberts RM. Expression of bovine trophoblast in terferon in conceptuses derived by in vitro techniques. Biol Reprod 1992; 47: 374-380. 118. Hernandez-Ledezma JJ, Mathialagan N, Villanueva C, Sikes JD, Roberts RM. Expression of bovine trophoblast in terferons by in vitro-derived blastocysts is correlated with their morphological quality and stage of development. Mol Reprod Dev 1993; 36: 16. 93

PAGE 94

119. Ealy AD, Larson SF, Liu L, Alexenko AP, Winkelman GL, K ubisch HM, Bixby JA, Roberts RM. Polymorphic forms of expresse d bovine interferon-tau genes: relative transcript abundance during early placental development, pr omoter sequences of genes and biological activity of protein pr oducts. Endocrinology 2001; 142: 2906-2915. 120. Stewart HJ, McCann SH, Northrop AJ, Lamm ing GE, Flint AP. Sheep antiluteolytic interferon: cDNA sequence and analysis of mRNA levels. J Mol Endocrinol 1989; 2: 6570. 121. Roberts RM. Conceptus interf erons and maternal recogniti on of pregnancy. Biol Reprod 1989; 40: 449-452. 122. Roberts RM, Cross JC, Leaman DW. Unique features of the trophoblast interferons. Pharmacol Ther 1991; 51: 329-345. 123. Lifsey BJ, Jr., Baumbach GA, Godkin JD. Isolation, characterization and immunocytochemical localization of bovine trophoblast protein-1. Biol Reprod 1989; 40: 343-352. 124. Fowler AK, Reed CD, Giron DJ. Identifica tion of an interferon in murine placentas. Nature 1980; 286: 266-267. 125. Bennett WA, LagooDeenadayalan S, Brackin MN, Hale E, Cowan BD. Cytokine expression by models of human trophoblast as assessed by a semiquantitative reverse transcription-polymerase chain reaction tec hnique. Am J Reprod Immunol 1996; 36: 285294. 126. Duc-Goiran P, Robert B, Navarro S, Civas A, Cerutti I, Rudant C, Maury M, Conamine H, Doly J. Developmental control of IFN-alpha expression in murine embryos. Exp Cell Res 1994; 214: 570-583. 127. Fink T, Zachar V, Ebbesen P. Biological ch aracterization of three novel variants of IFNalpha 13 produced by human placental trophoblast. Placenta 2001; 22: 673-680. 128. Jokhi PP, King A, Loke YW. Cytokine production and cytokine r eceptor expression by cells of the human first trimester placentaluterine interface. Cytokine 1997; 9: 126-137. 129. Lefevre F, Boulay V. A novel and atypical type one interferon gene expressed by trophoblast during early pregnancy. J Biol Chem 1993; 268: 19760-19768. 130. Lefevre F, Martinat-Botte F, Guillomot M, Zouari K, Charley B, La Bonnardiere C. Interferon-gamma gene and protein are spontaneously expressed by the porcine trophectoderm early in gestati on. Eur J Immunol 1990; 20: 2485-2490. 94

PAGE 95

131. Niu PD, Lefevre F, Mege D, La Bonnardi ere C. Atypical porcine type I interferon. Biochemical and biological characterization of the recombinant protein expressed in insect cells. Eur J Biochem 1995; 230: 200-206. 132. Lefevre F, Martinat-Botte F, Locatelli A, De Niu P, Terqui M, La Bonnardiere C. Intrauterine infusion of high doses of pig trophoblast interferons has no antiluteolytic effect in cyclic gilts. Biol Reprod 1998; 58: 1026-1031. 133. Roberts RM, Ezashi T, Rosenfeld CS, Ealy AD, Kubisch HM. Evolution of the interferon-tau genes and their pr omoters, and maternal-trophoblast interactions in control of their expression. Reprod Suppl 2003; 61: 239-251. 134. Roberts RM, Liu L, Guo Q, Leaman D, Bixby J. The evolution of the type I interferons. J Interferon Cytokine Res 1998; 18: 805-816. 135. Leaman DW, Roberts RM. Genes for the troph oblast interferons in sheep, goat, and musk ox and distribution of related genes among mammals. J Interferon Res 1992; 12: 1-11. 136. Roberts RM, Bazer FW. The functions of ut erine secretions. J Reprod Fertil 1988; 82: 875-892. 137. Hardy K, Spanos S. Growth factor expression and function in the human and mouse preimplantation embryo. J Endocrinol 2002; 172: 221-236. 138. Kaye PL. Preimplantation growth factor physiology. Rev Reprod 1997; 2: 121-127. 139. Gray CA, Taylor KM, Ramsey WS, Hill JR, Bazer FW, Bartol FF, Spencer TE. Endometrial glands are required for preimp lantation conceptus el ongation and survival. Biol Reprod 2001; 64: 1608-1613. 140. Gray CA, Burghardt RC, Johnson GA, Bazer FW, Spencer TE. Evidence that absence of endometrial gland secretions in uterine gland knockout ewes compromises conceptus survival and elongation. Reproduction 2002; 124: 289-300. 141. Gray CA, Bartol FF, Taylor KM, Wiley AA, Ramsey WS, Ott TL, Bazer FW, Spencer TE. Ovine Uterine Gland Knock-Out Model: Effects of Gland Ablation on the Estrous Cycle. Biol Reprod 2000; 62: 448-456. 142. Herrler A, Krusche CA, Beier HM. Insulin and insulin-like grow th factor-I promote rabbit blastocyst development and preven t apoptosis. Biol Reprod 1998; 59: 1302-1310. 95

PAGE 96

143. Matsui M, Takahashi Y, Hishinuma M, Ka nagawa H. Insulin and insulin-like growth factor-I (IGF-I) stimulate the development of bovine embryos fertilized in vitro. J Vet Med Sci 1995; 57: 1109-1111. 144. Mihalik J, Rehak P, Koppel J. The influen ce of insulin on the in vitro development of mouse and bovine embryos. Physiol Res 2000; 49: 347-354. 145. Xia P, Tekpetey FR, Armstrong DT. Effect of IGF-I on pig oocyte maturation, fertilization, and early em bryonic development in vitro, and on granulosa and cumulus cell biosynthetic activity. Mol Reprod Dev 1994; 38: 373-379. 146. Zhou J, Bondy C. Insulin-like growth factor -II and its binding proteins in placental development. Endocrinology 1992; 131: 1230-1240. 147. Han VK, Bassett N, Walton J, Challis JR. The expression of insulin-like growth factor (IGF) and IGF-binding protein (IGFBP) genes in the human placenta and membranes: evidence for IGF-IGFBP interact ions at the feto-maternal interface. J Clin Endocrinol Metab 1996; 81: 2680-2693. 148. Letcher R, Simmen RC, Bazer FW, Simmen FA Insulin-like growth factor-I expression during early conceptus development in the pig. Biol Reprod 1989; 41: 1143-1151. 149. Reynolds TS, Stevenson KR, Wathes DC. Pregnancy-specific alterations in the expression of the insulin-like growth factor system during early plac ental development in the ewe. Endocrino logy 1997; 138: 886-897. 150. Stevenson KR, Gilmour RS, Wathes DC. Loca lization of insulin-lik e growth factor-I (IGF-I) and -II messenger ribonucleic acid and type 1 IGF receptors in the ovine uterus during the estrous cycle and early pr egnancy. Endocrinology 1994; 134: 1655-1664. 151. Bilby TR, Guzeloglu A, Kamimura S, Pancar ci SM, Michel F, Head HH, Thatcher WW. Pregnancy and bovine somatotropin in nonlactating dairy cows: I. Ovarian, conceptus, and insulin-like growth factor system responses. J Dairy Sci 2004; 87: 3256-3267. 152. Guzeloglu A, Bilby TR, Meikle A, Kamimura S, Kowalski A, Michel F, MacLaren LA, Thatcher WW. Pregnancy and bovine somatotropin in nonlactating dairy cows: II. Endometrial gene expression related to maintenance of pregnancy. J Dairy Sci 2004; 87: 3268-3279. 153. Nancarrow CD, Hill JL. Co-culture, oviduc t secretion and the function of oviductspecific glycoproteins. Cell Biol Int 1994; 18: 1105-1114. 96

PAGE 97

154. Bavister BD. Culture of preimplantati on embryos: facts and artifacts. Hum Reprod Update 1995; 1: 91-148. 155. Makarevich AV, Markkula M. Apoptosis a nd cell proliferation potential of bovine embryos stimulated with insu lin-like growth factor I du ring in vitro maturation and culture. Biol Reprod 2002; 66: 386-392. 156. Spanos S, Becker DL, Winston RM, Har dy K. Anti-apoptotic ac tion of insulin-like growth factor-I during human preimplantat ion embryo development. Biol Reprod 2000; 63: 1413-1420. 157. Jousan FD, Hansen PJ. Insulin-like growth factor-I as a survival factor for the bovine preimplantation embryo exposed to heat shock. Biol Reprod 2004; 71: 1665-1670. 158. Block J, Hansen PJ. Interaction between season and culture with insulin-like growth factor-1 on survival of in vitro produced embryos following transfer to lactating dairy cows. Theriogenology 2007; 67: 1518-1529. 159. Block J, Drost M, Monson RL, Rutledge JJ, Rivera RM, Paula-Lopes FF, Ocon OM, Krininger CE, 3rd, Liu J, Hansen PJ. Use of insulin-like growth factor-I during embryo culture and treatment of recipients with gonadotropin-releasing hormone to increase pregnancy rates following the transfer of in vitro-produced embryos to heat-stressed, lactating cows. J Anim Sci 2003; 81: 1590-1602. 160. Watson AJ, Hogan A, Hahnel A, Wiemer KE, Schultz GA. Expression of growth factor ligand and receptor genes in the preimpla ntation bovine embryo. Mol Reprod Dev 1992; 31: 87-95. 161. Paria BC, Dey SK. Preimplantation embr yo development in vitro: cooperative interactions among embryos and role of grow th factors. Proc Natl Acad Sci USA 1990; 87: 4756-4760. 162. Rappolee DA, Sturm KS, Behrendtsen O, Schul tz GA, Pedersen RA, Werb Z. Insulinlike growth factor II acts through an endoge nous growth pathway regulated by imprinting in early mouse embryos. Genes Dev 1992; 6: 939-952. 163. Larson RC, Ignotz GG, Currie WB. Transforming growth factor beta and basic fibroblast growth factor synergistically promote early bovine embryo development during the fourth cell cycle. Mol Reprod Dev 1992; 33: 432-435. 164. Larson RC, Ignotz GG, Currie WB. Platelet derived growth factor (PDGF) stimulates development of bovine embryos during the fourth cell cycle. Development 1992; 115: 821-826. 97

PAGE 98

165. Cui XS, Lee JY, Choi SH, Kwon MS, Kim T, Kim NH. Mouse gr anulocyte-macrophage colony-stimulating factor enhances viability of porcine embryos in defined culture conditions. Anim Repr od Sci 2004; 84: 169-177. 166. Robertson SA, Sjoblom C, Jasper MJ Norman RJ, Seamark RF. Granulocytemacrophage colony-stimulating factor prom otes glucose transport and blastomere viability in murine preimplantation embryos. Biol Reprod 2001; 64: 1206-1215. 167. de Moraes AA, Hansen PJ. Granulocyte-macrophage colony -stimulating factor promotes development of in vitro produced bovi ne embryos. Biol Reprod 1997; 57: 1060-1065. 168. Sjoblom C, Roberts CT, Wikland M, Robe rtson SA. Granulocyte-macrophage colonystimulating factor alleviates adverse cons equences of embryo culture on fetal growth trajectory and placental morphogene sis. Endocrinology 2005; 146: 2142-2153. 169. Tsai HD, Chang CC, Hsieh YY, Lo HY, Hsu LW, Chang SC. Recombinant human leukemia inhibitory factor enhances the de velopment of preimplantation mouse embryo in vitro. Fertil Steril 1999; 71: 722-725. 170. Bhatt H, Brunet LJ, Stewart CL. Uterine e xpression of leukemia inhibitory factor coincides with the onset of blastocyst im plantation. Proc Natl Acad Sci USA 1991; 88: 11408-11412. 171. Sawai K, Matsuzaki N, Okada T, Shimoya K, Koyama M, Azuma C, Saji F, Murata Y. Human decidual cell biosynthesis of leukemia inhibitory factor: regulation by decidual cytokines and steroid hormone s. Biol Reprod 1997; 56: 1274-1280. 172. Polan ML, Simon C, Frances A, Lee BY, Pr ichard LE. Role of embryonic factors in human implantation. Hum Reprod 1995; 10 Suppl 2: 22-29. 173. Charnock-Jones DS, Sharkey AM, Fenwick P, Smith SK. Leukaemia inhibitory factor mRNA concentration peaks in human endomet rium at the time of implantation and the blastocyst contains mRNA for the receptor at this time. J Reprod Fertil 1994; 101: 421426. 174. Vogiagis D, Fry RC, Sandeman RM, Salam onsen LA. Leukaemia inhibitory factor in endometrium during the oestrous cycle, early pregnancy an d in ovariectomized steroidtreated ewes. J Reprod Fertil 1997; 109: 279-288. 175. Oshima K, Watanabe H, Yoshihara K, Koji ma T, Dochi O, Takenouchi N, Fukushima M, Komatsu M. Gene expression of leukemia i nhibitory factor (LIF) and macrophage colony stimulating factor (M-CSF) in bovine endometrium during early pregnancy. Theriogenology 2003; 60: 1217-1226. 98

PAGE 99

176. Kurzrock R, Estrov Z, Wetzler M, Gutterm an JU, Talpaz M. LIF: not just a leukemia inhibitory factor. Endocr Rev 1991; 12: 208-217. 177. Stewart CL. The role of leukemia inhibito ry factor (LIF) and other cytokines in regulating implantation in mammals. Ann N Y Acad Sci 1994; 734: 157-165. 178. Mitchell MH, Swanson RJ, Hodgen GD, Oehning er S. Enhancement of in vitro murine embryo development by recombinant leukemia i nhibitory factor. J Soc Gynecol Investig 1994; 1: 215-219. 179. Stewart CL, Kaspar P, Brunet LJ, Bha tt H, Gadi I, Kontgen F, Abbondanzo SJ. Blastocyst implantation depends on maternal expression of leukaemia inhibitory factor. Nature 1992; 359: 76-79. 180. Fry RC, Batt PA, Fairclough RJ, Parr RA. Huma n leukemia inhibitory factor improves the viability of cultured ovine embryos. Biol Reprod 1992; 46: 470-474. 181. Yamanaka T, Amano T, Kudo T. Effect of the presence period of bovine leukemia inhibitory factor in culture medium on th e development of in v itro fertilized bovine embryos. J Anim Sci 2001; 72: 285-290. 182. Saito S, Sawai K, Ugai H, Moriyasu S, Minamihashi A, Yamamoto Y, Hirayama H, Kageyama S, Pan J, Murata T, Kobayash i Y, Obata Y, Yokoyama KK. Generation of cloned calves and transgenic chimeric embryos from bovine embryonic stem-like cells. Biochem Biophys Res Co mmun 2003; 309: 104-113. 183. Mitalipova M, Beyhan Z, First NL. Pluripot ency of bovine embryoni c cell line derived from precompacting embryos. Cloning 2001; 3: 59-67. 184. Thomson JA, Itskovitz-Eldor J, Shapiro SS, Waknitz MA, Swiergiel JJ, Marshall VS, Jones JM. Embryonic stem cell lines derived from human blastocysts. Science 1998; 282: 1145-1147. 185. Amit M, Carpenter MK, Inokuma MS, Chiu CP Harris CP, Waknitz MA, Itskovitz-Eldor J, Thomson JA. Clonally derived human embryoni c stem cell lines maintain pluripotency and proliferative potential for prolonged pe riods of culture. Dev Biol 2000; 227: 271-278. 186. Reubinoff BE, Pera MF, Fong CY, Trounson A, Bongso A. Embryonic stem cell lines from human blastocysts: somatic differenti ation in vitro. Nat Bi otechnol 2000; 18: 399404. 187. First NL, Sims MM, Park SP, Kent-First MJ. Systems for production of calves from cultured bovine embryonic cells. Reprod Fertil Dev 1994; 6: 553-562. 99

PAGE 100

188. Talbot NC, Powell AM, Rexroad CE, Jr. In vi tro pluripotency of epiblasts derived from bovine blastocysts. Mol Reprod Dev 1995; 42: 35-52. 189. Van Stekelenburg-Hamers AE, Van Achter berg TA, Rebel HG, Flechon JE, Campbell KH, Weima SM, Mummery CL. Isolation and characterization of permanent cell lines from inner cell mass cells of bovine blas tocysts. Mol Reprod Dev 1995; 40: 444-454. 190. Vejlsted M, Avery B, Gjorret JO, Maddox-Hyttel P. Effect of leukemia inhibitory factor (LIF) on in vitro produced bovine embryos a nd their outgrowth colonies. Mol Reprod Dev 2005; 70: 445-454. 191. Foster GV, Baghdiantz A, Kumar MA, Slack E, Soliman HA, Macintyre I. Thyroid Origin of Calcitonin. Nature 1964; 202: 1303-1305. 192. Ding YQ, Zhu LJ, Bagchi MK, Bagchi IC. Progesterone stimulates calcitonin gene expression in the uterus during impl antation. Endocrinology 1994; 135: 2265-2274. 193. Ding YQ, Bagchi MK, Bardin CW, Bagchi IC. Calcitonin gene expression in the rat uterus during pregnancy. Recen t Prog Horm Res 1995; 50: 373-378. 194. Wang J, Rout UK, Bagchi IC, Armant DR. Expression of calcitonin receptors in mouse preimplantation embryos and their function in the regulation of blas tocyst differentiation by calcitonin. Development 1998; 125: 4293-4302. 195. Zhu LJ, Bagchi MK, Bagchi IC. Attenuation of calcitonin gene expre ssion in pregnant rat uterus leads to a block in embryonic implantation. Endocrinology 1998; 139: 330-339. 196. Force T, Bonventre JV, Flannery MR, Gorn AH, Yamin M, Goldring SR. A cloned porcine renal calcitonin receptor couples to adenylyl cyclase and phospholipase C. Am J Physiol 1992; 262: F1110-1115. 197. Albrandt K, Mull E, Brady EM, Herich J, Moore CX, Beaumont K. Molecular cloning of two receptors from rat brain with high affinity for salmon calcitonin. FEBS Lett 1993; 325: 225-232. 198. Sexton PM, Houssami S, Hilton JM, O'Keeffe LM, Center RJ, Gillespie MT, Darcy P, Findlay DM. Identification of brain isofor ms of the rat calcitonin receptor. Mol Endocrinol 1993; 7: 815-821. 199. Houssami S, Findlay DM, Brady CL, Myers DE, Martin TJ, Sexton PM. Isoforms of the rat calcitonin receptor: consequences for ligand binding and signal transduction. Endocrinology 1994; 135: 183-190. 100

PAGE 101

200. Rout UK, Krawetz SA, Armant DR. Ethanol -induced intracellular calcium mobilization rapidly alters gene expression in the mous e blastocyst. Cell Ca lcium 1997; 22: 463-474. 201. Lu KP, Means AR. Regulation of the cell cycle by calcium and calmodulin. Endocr Rev 1993; 14: 40-58. 202. Leach RE, Stachecki JJ, Armant DR. Development of in vitro fertilized mouse embryos exposed to ethanol during the preimplant ation period: accelerated embryogenesis at subtoxic levels. Teratology 1993; 47: 57-64. 203. Stachecki JJ, Armant DR. Transient release of calcium from inositol 1,4,5-trisphosphatespecific stores regulates m ouse preimplantation developm ent. Development 1996; 122: 2485-2496. 204. Stojkovic M, Wolf E, Buttner M, Berg U, Charpigny G, Schmitt A, Brem G. Secretion of biologically active interferon tau by in vitro-derived bovine trophoblastic tissue. Biol Reprod 1995; 53: 1500-1507. 205. Ko Y, Lee CY, Ott TL, Davis MA, Simme n RC, Bazer FW, Simmen FA. Insulin-like growth factors in sheep uterine fluids: concentrations and relationship to ovine trophoblast protein-1 production during early pregnancy. Biol Reprod 1991; 45: 135-142. 206. Smith RM, Garside WT, Aghayan M, Shi CZ, Shah N, Jarett L, Heyner S. Mouse preimplantation embryos exhibit receptor-media ted binding and transcyt osis of maternal insulin-like growth factor I. Biol Reprod 1993; 49: 1-12. 207. Imakawa K, Helmer SD, Nephew KP, Meka CS, Christenson RK. A novel role for GMCSF: enhancement of pregnancy specific interferon productio n, ovine trophoblast protein-1. Endocrinology 1993; 132: 1869-1871. 208. de Moraes AA, Davidson JA, Fleming JG, B azer FW, Edwards JL, Betts JG, Hansen PJ. Lack of effect of granulocyte-macrophage colony-stimulating factor on secretion of interferon-tau, other proteins, and prostagla ndin E2 by the bovine and ovine conceptus. Domest Anim Endoc rinol 1997; 14: 193-197. 209. Emond V, Fortier MA, Murphy BD, Lamber t RD. Prostaglandin E2 regulates both interleukin-2 and granulocyte-macrophage colo ny-stimulating factor gene expression in bovine lymphocytes. Biol Reprod 1998; 58: 143-151. 210. Emond V, Asselin E, Fortier MA, Murphy BD Lambert RD. Interferon-tau stimulates granulocyte-macrophage colony-stimulati ng factor gene expression in bovine lymphocytes and endometrial stroma l cells. Biol Reprod 2000; 62: 1728-1737. 101

PAGE 102

211. Fortin M, Ouellette MJ, Lambert RD. TGF-be ta 2 and PGE2 in rabbit blastocoelic fluid can modulate GM-CSF production by human ly mphocytes. Am J Reprod Immunol 1997; 38: 129-139. 212. Michael DD, Alvarez IM, Ocon OM, Powe ll AM, Talbot NC, Johnson SE, Ealy AD. Fibroblast growth factor-2 is expressed by the bovine uterus and stimulates interferon-tau production in bovine trophectode rm. Endocrinology 2006; 147: 3571-3579. 213. Rodina TM, Cooke FN, Hansen PJ, Ealy AD. Oxygen tension and medium type actions on blastocyst development and interferon-tau secretion in cattle. Anim Reprod Sci 2008; doi:10.1016/j.anireprosci.2008.02.014. 214. Bottcher RT, Niehrs C. Fibroblast growth factor signaling during early vertebrate development. Endocr Rev 2005; 26: 63-77. 215. Burgess WH, Maciag T. The heparin-binding (fibroblast) growth factor family of proteins. Annu Rev Biochem 1989; 58: 575-606. 216. Itoh N, Ornitz DM. Evolution of the Fgf a nd Fgfr gene families. Trends Genet 2004; 20: 563-569. 217. Itoh N, Ornitz DM. Functional evolutionary history of the mouse Fgf gene family. Dev Dyn 2008; 237: 18-27. 218. Powers CJ, McLeskey SW, Wellstein A. Fibr oblast growth factors, their receptors and signaling. Endocr Relat Cancer 2000; 7: 165-197. 219. Goldfarb M. Functions of fibroblast growth factors in vertebrate development. Cytokine Growth Factor Rev 1996; 7: 311-325. 220. Ornitz DM, Itoh N. Fibroblast growth f actors. Genome Biol. 2001; 2: REVIEWS3005. 221. Eswarakumar VP, Lax I, Schlessinger J. Ce llular signaling by fibroblast growth factor receptors. Cytokine Growth Factor Rev 2005; 16: 139-149. 222. Gospodarowicz D. Purification of a fibroblast growth factor from bovi ne pituitary. J Biol Chem 1975; 250: 2515-2520. 223. Gospodarowicz D, Bialecki H, Greenburg G. Pu rification of the fibr oblast growth factor activity from bovine brain. J Biol Chem 1978; 253: 3736-3743. 224. Gospodarowicz D. Localisation of a fibroblast growth factor and its effect alone and with hydrocortisone on 3T3 cell grow th. Nature 1974; 249: 123-127. 102

PAGE 103

225. Armelin HA. Pituitary extracts and steroid hormones in the contro l of 3T3 cell growth. Proc Natl Acad Sci USA 1973; 70: 2702-2706. 226. Johnson DE, Williams LT. Structural and functional diversity in the FGF receptor multigene family. Adv Cancer Res 1993; 60: 1-41. 227. Esch F, Baird A, Ling N, Ueno N, Hill F, Denoroy L, Klepper R, Gospodarowicz D, Bohlen P, Guillemin R. Primary structure of bovine pituitary basi c fibroblast growth factor (FGF) and comparison with the aminoterminal sequence of bovine brain acidic FGF. Proc Natl Acad Sci USA 1985; 82: 6507-6511. 228. Gimenez-Gallego G, Rodkey J, Bennett C, Ri os-Candelore M, DiSalvo J, Thomas K. Brain-derived acidic fibroblast growth f actor: complete amino acid sequence and homologies. Science 1985; 230: 1385-1388. 229. Mignatti P, Morimoto T, Rifkin DB. Basic fibroblast growth factor, a protein devoid of secretory signal sequence, is released by cells via a pathway independent of the endoplasmic reticulum-Golgi comple x. J Cell Physiol 1992; 151: 81-93. 230. Miller DL, Ortega S, Bashayan O, Basc h R, Basilico C. Compensation by fibroblast growth factor 1 (FGF1) does not account for the mild phenotypic defects observed in FGF2 null mice. Mol Cell Biol 2000; 20: 2260-2268. 231. Hebert JM, Rosenquist T, Gotz J, Martin GR FGF5 as a regulator of the hair growth cycle: evidence from targeted and spontaneous mutations. Cell 1994; 78: 1017-1025. 232. Sleeman M, Fraser J, McDonald M, Yuan S, White D, Grandison P, Kumble K, Watson JD, Murison JG. Identification of a new fibr oblast growth factor receptor, FGFR5. Gene 2001; 271: 171-182. 233. Lee PL, Johnson DE, Cousens LS, Fried VA, Williams LT. Purification and complementary DNA cloning of a receptor for ba sic fibroblast growth factor. Science 1989; 245: 57-60. 234. Schlessinger J. Cell signa ling by receptor tyrosine ki nases. Cell 2000; 103: 211-225. 235. Hunter T. Signaling--2000 and beyond. Cell 2000; 100: 113-127. 236. Kim I, Moon S, Yu K, Kim U, Koh GY. A novel fibroblast growth factor receptor-5 preferentially expressed in the pancreas (1). Biochim Biophys Acta 2001; 1518: 152-156. 103

PAGE 104

237. Ornitz, DM, Xu J, Colvin JS, McEwen DG, MacArthur CA, Coulier F, Gao, G, Goldfarb, M. Receptor Specificity of the Fibroblast Gr owth Factor Family. J Biol Chem 1996; 271: 15292-15297. 238. Vainikka S, Partanen J, Bellosta P, Coulier F, Birnbaum D, Basilico C, Jaye M, Alitalo K. Fibroblast growth factor receptor-4 show s novel features in genomic structure, ligand binding and signal transducti on. EMBO J 1992; 11: 4273-4280. 239. Johnson DE, Lu J, Chen H, Werner S, Willia ms LT. The human fibroblast growth factor receptor genes: a common structural arrangement underlies the mechanisms for generating receptor forms that differ in their third immunoglobulin domain. Mol Cell Biol 1991; 11: 4627-4634. 240. Werner S, Duan DS, de Vries C, Peters KG, Johnson DE, Williams LT. Differential splicing in the extracellular region of fibroblast growth factor receptor 1 generates receptor variants with different ligand-bindi ng specificities. Mol Cell Biol 1992; 12: 8288. 241. Lin X, Buff EM, Perrimon N, Michels on AM. Heparan sulfate proteoglycans are essential for FGF receptor signaling duri ng Drosophila embryonic development. Development 1999; 126: 3715-3723. 242. Ornitz DM, Yayon A, Flanagan JG, Svahn CM, Levi E, Leder P. Heparin is required for cell-free binding of basic fibroblast growth factor to a soluble receptor and for mitogenesis in whole cells. Mol Cell Biol 1992; 12: 240-247. 243. Yayon A, Klagsbrun M, Esko JD, Leder P, Ornitz DM. Cell surface, heparin-like molecules are required for binding of basic fibroblast growth factor to its high affinity receptor. Cell 1991; 64: 841-848. 244. Spivak-Kroizman T, Lemmon MA, Dikic I, La dbury JE, Pinchasi D, Huang J, Jaye M, Crumley G, Schlessinger J, Lax I. Heparininduced oligomerization of FGF molecules is responsible for FGF receptor dimerization, act ivation, and cell proliferation. Cell 1994; 79: 1015-1024. 245. Robinson ML, MacMillan-Crow LA, Thom pson JA, Overbeek PA. Expression of a truncated FGF receptor results in defective lens development in transgenic mice. Development 1995; 121: 3959-3967. 246. Ostrovsky O, Berman B, Gallagher J, Mull oy B, Fernig DG, Delehedde M, Ron D. Differential effects of heparin saccharides on the formation of specific fibroblast growth factor (FGF) and FGF receptor comp lexes. J Biol Chem 2002; 277: 2444-2453. 104

PAGE 105

247. Chellaiah AT, McEwen DG, Werner S, Xu J, Ornitz DM. Fibroblast growth factor receptor (FGFR) 3. Alternative splicing in immunoglobulin-like domain III creates a receptor highly specific for acidic FG F/FGF-1. J Biol Chem 1994; 269: 11620-11627. 248. Grundker C, Kirchner C. Uterine fibroblast growth factor-2 and embryonic fibroblast growth factor receptor-1 at the beginning of gastrulation in the rabbit. Anat Embryol (Berl) 1996; 194: 169-175. 249. Yeh J, Osathanondh R, Villa-Komaroff L. Expr ession of messenger ribonucleic acid for epidermal growth factor receptor and its ligands, epidermal growth factor and transforming growth factor-alpha, in human firstand sec ond-trimester fetal ovary and uterus. Am J Obstet Gynecol 1993; 168: 1569-1573. 250. Eberwine J, Yeh H, Miyashiro K, Cao YX, Nair S, Finnell R, Zettel M, Coleman P. Analysis of Gene-Expression in Single Live Neurons. Proc Natl Acad Sci USA 1992; 89: 3010-3014. 251. Fujimoto J, Hori M, Ichigo S, Tamaya T. E xpression of basic fibroblast growth factor and its mRNA in uterine endometrium during the menstrual cycle. Gynecol Endocrinol 1996; 10: 193-197. 252. Rusnati M, Casarotti G, Pecore lli S, Ragnotti G, Presta M. Ba sic fibroblast growth factor in ovulatory cycle and postmenopausal human endometrium. Growth Factors 1990; 3: 299-307. 253. Cordon-Cardo C, Vlodavsky I, Haimovitz-Friedman A, Hicklin D, Fuks Z. Expression of basic fibroblast growth factor in norma l human tissues. Lab I nvest 1990; 63: 832-840. 254. Samathanam CA, Adesanya OO, Zhou J, Wa ng J, Bondy CA. Fibroblast growth factors 1 and 2 in the primate uterus Biol Reprod 1998; 59: 491-496. 255. Gupta A, Bazer FW, Jaeger LA. Immunolo calization of acidic and basic fibroblast growth factors in porcine uterine and conceptus tissues. Biol Reprod 1997; 56: 15271536. 256. Carlone DL, Rider V. Embryonic modulation of basic fibroblast growth factor in the rat uterus. Biol Repr od 1993; 49: 653-665. 257. Ocon-Grove OM, Cooke FN, Alvarez IM Johnson SE, Ott TL, Ealy AD. Ovine endometrial expression of fibr oblast growth factor (FGF) 2 and conceptus expression of FGF receptors during early pregnancy. Do mest Anim Endocrinol 2008; 34: 135-145. 105

PAGE 106

258. Roberts RM, Ealy AD, Alexenko AP, Ha n CS, Ezashi T. Trophoblast interferons. Placenta 1999; 20: 259-264. 259. Daniels R, Hall V, Trounson AO. Analysis of gene transcription in bovine nuclear transfer embryos reconstructed with granul osa cell nuclei. Biol Reprod 2000; 63: 10341040. 260. Lazzari G, Wrenzycki C, Herrmann D, Duchi R, Kruip T, Niemann H, Galli C. Cellular and molecular deviations in bovine in vitroproduced embryos are related to the large offspring syndrome. Biol Reprod 2002; 67: 767-775. 261. Gospodarowicz D, Ferrara N, Schweigerer L, Neufeld G. Structural characterization and biological functions of fibroblast gr owth factor. Endocr Rev 1987; 8: 95-114. 262. Baird A, Walicke PA. Fibroblast growth factors. Br Med Bull 1989; 45: 438-452. 263. Hrabe dA, Grundker C, Herrmann BG, Kispert A, Kirchner C. Promotion of gastrulation by maternal growth factor in cultured rabbit blastocysts. Cell Ti ssue Res 1995; 282: 147154. 264. Haimovici F, Anderson DJ. Effects of growth factors and growth factor-extracellular matrix interactions on mouse trophoblast outg rowth in vitro. Biol Reprod 1993; 49: 124130. 265. Taniguchi F, Harada T, Yoshida S, Iwabe T, Onohara Y, Tanikawa M, Terakawa N. Paracrine effects of bFGF and KGF on the pro cess of mouse blastocy st implantation. Mol Reprod Dev 1998; 50: 54-62. 266. Lim JM, Hansel W. Roles of growth factors in the development of bovine embryos fertilized in vitro and cult ured singly in a defined medium. Reprod Fertil Dev 1996; 8: 1199-1205. 267. Gospodarowicz D, Thakral KK. Production a corpus luteum angiogenic factor responsible for proliferation of capillaries and neovascularization of the corpus luteum. Proc Natl Acad Sci USA 1978; 75: 847-851. 268. Berisha B, Sinowatz F, Schams D. Expression and localization of fibr oblast growth factor (FGF) family members during the final growth of bovine ovarian follicles. Mol Reprod Dev 2004; 67: 162-171. 269. Grazul-Bilska AT, Navanukraw C, Johnson ML, Vonnahme KA, Ford SP, Reynolds LP, Redmer DA. Vascularity and expression of angiogenic factors in bovine dominant follicles of the first follicular wave. J Anim Sci 2007; 85: 1914-1922. 106

PAGE 107

270. Seghezzi G, Patel S, Ren CJ, Gualandris A, Pintucci G, Robbins ES, Shapiro RL, Galloway AC, Rifkin DB, Mignatti P. Fibr oblast growth factor-2 (FGF-2) induces vascular endothelial growth factor (VEGF) e xpression in the endotheli al cells of forming capillaries: an autocrine mech anism contributing to angiogene sis. J Cell Biol 1998; 141: 1659-1673. 271. Weylie B, Zhu J, Singh U, Ambrus S, Fo rough R. Phosphatidylinositide 3-kinase is important in late-stage fibroblast growth f actor-1-mediated angiogenesis in vivo. J Vasc Res 2006; 43: 61-69. 272. Connolly DT, Stoddard BL, Harakas NK, Fe der J. Human fibroblast-derived growth factor is a mitogen and chemoattractant for endothelial cells. Biochem Biophys Res Commun 1987; 144: 705-712. 273. Neufeld G, Cohen T, Gengrinovitch S, Poltora k Z. Vascular endothe lial growth factor (VEGF) and its receptors. FASEB J 1999; 13: 9-22. 274. Dvorak HF, Nagy JA, Feng D, Brown LF, Dvorak AM. Vascular permeability factor/vascular endothelial growth fact or and the significance of microvascular hyperpermeability in angiogenesis. Curr Top Microbiol Immunol 1999; 237: 97-132. 275. Ferrara N. Vascular endothelial growth f actor: molecular and biological aspects. Curr Top Microbiol Immunol 1999; 237: 1-30. 276. Folkman J, Klagsbrun M. Angiogeni c factors. Science 1987; 235: 442-447. 277. Thomas KA. Fibroblast growth factors. FASEB J 1987; 1: 434-440. 278. Thomas KA, Gimenez-Gallego G. Fibroblast gr owth factors: broad spectrum mitogens with potent angiogenic activity. Trends Biochem Sci 1986; 11: 4. 279. Talbot NC, Caperna TJ, Edwards JL, Garrett W, Wells KD, Ealy AD. Bovine blastocystderived trophectoderm and endoderm cell cu ltures: interferon tau and transferrin expression as respective in vitro markers. Biol Reprod 2000; 62: 235-247. 280. Brigstock DR, Heap RB, Brown KD. Polypep tide growth factors in uterine tissues and secretions. J Reprod Fertil 1989; 85: 747-758. 281. Chen C, Spencer TE, Bazer FW. Fibroblast growth factor-10: a stromal mediator of epithelial function in the ovine uterus. Biol Reprod 2000; 63: 959-966. 282. Ornitz DM. FGFs, heparan sulfate and FG FRs: complex interactions essential for development. BioEssays 2000; 22: 108-112. 107

PAGE 108

283. Igarashi M, Finch PW, Aaronson SA. Charact erization of recombinant human fibroblast growth factor (FGF)-10 reveals functional si milarities with keratinocyte growth factor (FGF-7). J Biol Chem 1998; 273: 13230-13235. 284. Emoto H, Tagashira S, Mattei MG, Yamasaki M, Hashimoto G, Katsumata T, Negoro T, Nakatsuka M, Birnbaum D, Coulier F, It oh N. Structure and e xpression of human fibroblast growth factor-10. J Biol Chem 1997; 272: 23191-23194. 285. Sekine K, Ohuchi H, Fujiwara M, Yamasaki M, Yoshizawa T, Sato T, Yagishita N, Matsui D, Koga Y, Itoh N, Kato S. Fibroblas t growth factor-10 is essential for limb and lung formation. Nat Genet 1999; 21: 138-141. 286. Yamasaki M, Miyake A, Tagashira S, Itoh N. Structure and expression of the rat mRNA encoding a novel member of the fibroblast gr owth factor family. J Biol Chem 1996; 271: 15918-15921. 287. Metzger RJ, Krasnow MA. Genetic control of branching morphogenesis. Science 1999; 284: 1635-1639. 288. Beer HD, Florence C, Dammeier J, McGuire L, Werner S, Duan DR. Mouse fibroblast growth factor 10: cDNA cloning, protein characterization, and regulation of mRNA expression. Oncogene 1997; 15: 2211-2218. 289. Lu W, Luo Y, Kan M, McKeehan WL. Fibroblast growth factor-10. A second candidate stromal to epithelial cell andromedin in prostate. J Biol Chem 1999; 274: 12827-12834. 290. Bellusci S, Grindley J, Emoto H, Itoh N, Hogan BL. Fibroblast growth factor 10 (FGF10) and branching morphogenesis in the em bryonic mouse lung. Development 1997; 124: 4867-4878. 291. Rubin JS, Bottaro DP, Chedid M, Miki T, Ron D, Cheon G, Taylor WG, Fortney E, Sakata H, Finch PW, et al. Keratinocyte gr owth factor. Cell Biol Int 1995; 19: 399-411. 292. Koji T, Chedid M, Rubin JS, Slayden OD, Csaky KG, Aaronson SA, Brenner RM. Progesterone-dependent expressi on of keratinocyte growth fact or mRNA in stromal cells of the primate endometrium: keratinocyte grow th factor as a progestomedin. J Cell Biol 1994; 125: 393-401. 293. Satterfield MC, Hayashi K, Song G, Black SG, Bazer FW, Spencer TE. Progesterone Regulates FGF10, MET, IGFBP1, and IGFBP3 in the Endometrium of the Ovine Uterus. Biol Reprod 2008; doi:10.1095/biolreprod.108.071787. 108

PAGE 109

294. Ka H, Jaeger LA, Johnson GA, Spencer TE, Bazer FW. Keratinocyte growth factor is upregulated by estrogen in the porcine uterine endometrium a nd functions in trophectoderm cell proliferation and differentia tion. Endocrinology 2001; 142: 2303-2310. 295. Ka H, Spencer TE, Johnson GA, Bazer FW. Keratinocyte growth factor: expression by endometrial epithelia of the porcine uterus. Biol Re prod 2000; 62: 1772-1778. 296. Brenner R, Slaydon O, Koji T, Izumi M, Chedid M, Csaky K, Rubin J. Hormonal regulation of the paracrine growth factor s HGF and KGF in the endometrium of the rhesus macaque In: Stock G, Habenicht UF (eds) The Endometrium as a Target for Contraception. Berlin: Springer-Verlag 1997: 21. 297. Pfarrer C, Weise S, Berisha B, Schams D, Leiser R, Hoffmann B, Schuler G. Fibroblast Growth Factor (FGF)-1, FGF2, FGF7 and FG F receptors are uniformly expressed in trophoblast giant cells during restricted trophobl ast invasion in cows. Placenta 2006; 27: 758-770. 298. Winkles JA, Alberts GF, Chedid M, Taylor WG, DeMartino S, Rubin JS. Differential expression of the keratinocyte growth factor (KGF) and KGF receptor genes in human vascular smooth muscle cells and ar teries. J Cell Physiol 1997; 173: 380-386. 299. Niswander L, Martin GR. Fgf-4 expressi on during gastrulation, myogenesis, limb and tooth development in the mous e. Development 1992; 114: 755-768. 300. Rappolee DA, Basilico C, Patel Y, Werb Z. Expression and function of FGF-4 in periimplantation development in mouse embryos. Development 1994; 120: 2259-2269. 301. Feldman B, Poueymirou W, Papaioannou VE, DeChiara TM, Goldfarb M. Requirement of FGF-4 for postimplantation mouse de velopment. Science 1995; 267: 246-249. 302. Avilion AA, Nicolis SK, Pevny LH, Perez L, Vi vian N, Lovell-Badge R. Multipotent cell lineages in early mouse development de pend on SOX2 function. Genes Dev 2003; 17: 126-140. 303. Ralston A, Rossant J. How signaling promotes stem cell survival: trophoblast stem cells and Shp2. Dev Cell 2006; 10: 275-276. 304. Kunath T, Strumpf D, Rossant J. Earl y trophoblast determination and stem cell maintenance in the mouse--a review Placenta 2004; 25 Suppl A: S32-S38. 305. Arman E, Haffner-Krausz R, Chen Y, Heath JK, Lonai P. Targeted disruption of fibroblast growth factor (FGF) receptor 2 suggests a role for FGF signaling in pregastrulation mammalian development. Proc Natl Acad Sci USA 1998; 95: 5082-5087. 109

PAGE 110

306. Hughes M, Dobric N, Scott IC, Su L, Star ovic M, St Pierre B, Egan SE, Kingdom JC, Cross JC. The Hand1, Stra13 and Gcm1 transc ription factors override FGF signaling to promote terminal differentiation of trophoblas t stem cells. Dev Biol 2004; 271: 26-37. 307. Kubisch HM, Larson MA, Kiesling DO. Contro l of interferon-tau se cretion by in vitroderived bovine blastocysts during extended cu lture and outgrowth formation. Mol Reprod Dev 2001; 58: 390-397. 308. Shimada A, Nakano H, Takahashi T, Imai K, Hashizume K. Isolation and characterization of a bovine bl astocyst-derived trophoblastic cell line, BT-1: development of a culture system in the absence of feeder cell. Placenta 2001; 22: 652-662. 309. Talbot NC, Powell AM, Camp M, Ealy AD. Es tablishment of a bovine blastocyst-derived cell line collection for the comparative analys is of embryos created in vivo and by in vitro fertilization, somatic ce ll nuclear transfer, or parthe nogenetic activation. In Vitro Cell Dev Biol An 2007; 43: 59-71. 310. Gifford CA, Assiri AM, Sa tterfield MC, Spencer TE, O tt TL. Receptor transporter protein 4 (RTP4) in endometrium, ovary, and peripheral blood leukocytes of pregnant and cyclic ewes. Biol Reprod 2008; 79: 518-524. 311. Wang BT, Goff AK. Interferon-tau stimul ates secretion of macrophage migration inhibitory factor from bovine endometrial epithelial cell s. Biol Reprod 2002; 66: 118119. 312. Austin KJ, Ward SK, Teixeira MG, Dean VC, Moore DW, Hansen TR. Ubiquitin crossreactive protein is released by the bovine uterus in res ponse to interferon during early pregnancy. Biol Repr od 1996; 54: 600-606. 313. Roberts RM. Embryonic loss and conceptus in terferon production. In : Strauss JF, III, Lyttle CR (eds) Uterine and Embryonic F actors in Early Pregnancy. New York, NY Plenum Press; 1991: 21-31. 314. Thatcher WW, Staples CR, Danet-Desnoyers G. Embryo health and mortality in sheep and cattle. J An Sci 1994; 72: 16-30. 315. Thatcher WW, Guzeloglu A, Mattos R, Binelli M, Hansen TR, Pru JK. Uterine-conceptus interactions and reproductive failure in cattle. Theriogenology 2001; 56: 1435-1450. 316. Kubisch HM, Larson MA, Roberts RM. Re lationship between age of blastocyst formation and interferon-tau secretion by in vitro-derived bovine embryos. Mol Reprod Dev 1998; 49: 254-260. 110

PAGE 111

317. Robinson RS, Fray MD, Wathes DC, La mming GE, Mann GE. In vivo expression of interferon tau mRNA by the embryonic tr ophoblast and uterine concentrations of interferon tau protein during early pregnancy in the cow. Mol Reprod Dev 2006; 73: 470474. 318. Mann GE, Fray MD, Lamming GE. Effects of time of progesterone supplementation on embryo development and interferon-tau pr oduction in the cow. Vet J 2006; 171: 500-503. 319. Ealy AD, Larson SF, Liu L, Alexenko AP, Winkelman GL, K ubisch HM, Bixby JA, Roberts RM. Polymorphic forms of expresse d bovine interferon-tau genes: relative transcript abundance during early placental development, pr omoter sequences of genes and biological activity of protein pr oducts. Endocrinology 2001; 142: 2906-2915. 320. Roberts RM, Ezashi T, Das P. Trophoblast gene expression: transcri ption factors in the specification of early trophoblast. Re prod Biol Endocrinol 2004; 2: 47. 321. Roberts RM, Ezashi T, Rosenfeld CS, Ealy AD, Kubisch HM. Evolu tion of the interferon tau genes and their promoters, and maternal-trophoblast inter actions in control of their expression. Reprod S uppl 2003; 61: 239-251. 322. Haimovici F, Hill JA, Anderson DJ. The e ffects of soluble products of activated lymphocytes and macrophages on blastocyst im plantation events in vitro. Biol Reprod 1991; 44: 69-75. 323. Tanaka S, Kunath T, Hadjantonakis AK, Nagy A, Rossant J. Promotion of trophoblast stem cell proliferation by FG F4. Science 1998; 282: 2072-2075. 324. Hughes M, Dobric N, Scott IC, Su L, St arovic M, St-Pierre B, Egan SE, Kingdom JC, Cross JC. The Hand1, Stra13 and Gcm1 transc ription factors override FGF signaling to promote terminal differentiation of trophoblas t stem cells. Dev Biol 2004; 271: 26-37. 325. Wilkinson DG, Bhatt S, McMahon AP. Expr ession pattern of the FGF-related protooncogene int-2 suggests multiple roles in fetal development. Development 1989; 105: 131-136. 326. Komi-Kuramochi A, Kawano M, Oda Y, As ada M, Suzuki M, Oki J, Imamura T. Expression of fibroblast growth factors and their receptors during full-thickness skin wound healing in young and aged mice. J Endocrinol 2005; 186: 273-289. 327. Umemori H, Linhoff MW, Ornitz DM, Sanes JR. FGF22 and its close relatives are presynaptic organizing molecules in th e mammalian brain. Cell 2004; 118: 257-270. 111

PAGE 112

328. Degrelle SA, Campion E, Cabau C, Piumi F, Reinaud P, Richard C, Renard JP, Hue I. Molecular evidence for a cri tical period in mural trophoblast development in bovine blastocysts. Dev Bi ol 2005; 288: 448-460. 329. Alexopoulos N, Maddox-Hyttel P, Tveden-Nybor g P, D'Cruz N, Tecirlioglu T, Cooney M, Schauser K, Holland M, French A. De velopmental disparity between in vitro produced and somatic cell nuclear transfer bovine days 14 and 21 embryos: implications for embryonic loss. Reproduction 2008; doi: 10.1530/REP-07-0392. 330. Fischer-Brown AE, Lindsey BR, Ireland FA, Northey DL, Monson RL, Clark SG, Wheeler MB, Kesler DJ, Lane SJ, Weigel KA, Rutledge JJ. Embryonic disc development and subsequent viability of cattle embryos following culture in two media under two oxygen concentrations. Reprod Fertil Dev 2004; 16: 787-793. 331. Chen Y, Antoniou E, Liu Z, Hearne LB, Roberts RM. A microarray analysis for genes regulated by interferon-{ta u} in ovine luminal epithelia l cells. Reproduction 2007; 134: 123-135. 332. Bilby TR, Block J, do Amaral BC, Sa Fil ho O, Silvestre FT, Hansen PJ, Staples CR, Thatcher WW. Effects of dietary unsaturated fatty acids on oocyte quality and follicular development in lactating dairy cows in summer. J Dairy Sci 2006; 89: 3891-3903. 333. Sartori R, Souza AH, Guenther JN, Caravi ello DZ, Geiger LN, Schenk JL, Wiltbank MC. Fertilization rate and embryo quality in s uperovulated Holstein heifers artificially inseminated with X-sorted or unsorte d sperm. Anim Reprod 2004; 1: 86-90. 334. Rivera RM, Hansen PJ. Development of cu ltured bovine embryos after exposure to high temperatures in the physiological range. Reproduction 2001; 121: 107-115. 335. Moreira F, Paula-Lopes FF, Hansen PJ, Ba dinga L, Thatcher WW. Effects of growth hormone and insulin-like growth factor-I on development of in vitro derived bovine embryos. Theriogeno logy 2002; 57: 895-907. 336. Paula-Lopes FF, Hansen PJ. Apoptosis is an adaptive response in bovine preimplantation embryos that facilitates survival after heat shock. Biochem Bi ophys Res Commun 2002; 295: 37-42. 337. Cikos S, Bukovska A, Koppel J. Relativ e quantification of mRNA: comparison of methods currently used for real-time PCR data analysis. BMC Mol Biol 2007; 8: 113. 338. Larionov A, Krause A, Miller W. A standa rd curve based method for relative real time PCR data processing. BMC Bioinformatics 2005; 6: 62. 112

PAGE 113

113 BIOGRAPHICAL SKETCH Flavia Nesti Tayar Cooke was born and raised in Campinas, Sao Paulo, Brazil, where she grew up with sisters Luiza and Patricia ( in memoriam ), and parents Roberto and Sonia. Since childhood she developed a passionate interest for an imals and wish one day she would be able to work with them. Flavia moved to Botucatu, Sa o Paulo in 2002 to start her Animal Sciences undergraduate program at the Sao Paulo State Un iversity (UNESP), which is ranked, as of 2008, the Top 1 program in the nation. Her focus has always been on dairy cattle. Flavia moved to Gainesville, FL in Janua ry 2006 to complete the internship program required in order to receive her B.S. in Animal Sciences, which happened in July 2006, working with Dr. William Thatcher and Dr. Alan Ealy. After graduation, she accepted a position to continue her work with Dr. Alan Ealy as a grad uate research assistant at the University of Florida, pursuing her Master of Science in Animal Mo lecular and Cellular Biology. Flavia is married to Dr. Re inaldo Cooke, who is now applying for Assistant Professor positions in several universities in the US. They are expecting their first child due in May 2009.