<%BANNER%>

Regulation of Gene Expression for Therapy of Age-Related Macular Degeneration

Permanent Link: http://ufdc.ufl.edu/UFE0024068/00001

Material Information

Title: Regulation of Gene Expression for Therapy of Age-Related Macular Degeneration
Physical Description: 1 online resource (137 p.)
Language: english
Creator: Ferguson, Lee
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: cnv, degeneration, expression, gene, inducibility, macular, riboswitch, sflt, therapy
Genetics (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Drug inducible gene modulation technology allows for an ideal therapy for treating neovascular ocular diseases. The dose-dependent and temporal properties inherent in these drug inducible systems substantiate their suitability for use in clinical applications. A major limitation of this system is 'leaky' gene expression during non-induced states. Recent advances have established better inducible systems that improve upon this concern. My goal is to assess neovascular abatement in a mouse laser CNV model while utilizing the inducible hammerhead ribozyme system (riboswitch) in order to regulate the expression of an antineovascularity gene. HEK 293 cells were transfected with either a construct containing the double riboswitch, which included two inducible ribozymes in tandem-orientation, or a single riboswitch construct regulating GFP and sFlt-01 transgene expression. Cells transfected with the ribozyme constructs were induced with a cocktail of Toyocamycin plus 5-fluorouridine. The single riboswitch construct exhibited a 2.8 fold higher level of GFP expression than the double riboswitch construct. However, leaky expression of the sFlt-01 transgene by the single riboswitch plasmid was 7.3 fold higher than that of the double riboswitch plasmid. Adult C57BL6 mice were intravitreally injected within the right eye with AAV2 virus vectors containing the double riboswitch system regulating the antineovascularity gene sFlt-01 six weeks prior to implementation of the laser CNV model. One day before retinal laser burns, animals were implanted with time release pellets containing the inducer agents. Neovascular growth was determined by the product of the CNV area and the fluorescence intensity. For two of the riboswitch induction experiments, CNV was 2.6 (p = 0.003) and 5.2 (p = 0.03) fold higher in non-injected versus injected eyes. Placebo treated animals did not show a significant difference in CNV development for injected and non-injected eyes (p = 0.6). CNV growth was reduced by 93% in riboswitch injected eyes versus the 87% reduction seen in eyes injected with constructs expression sFlt-01driven by the chicken beta actin promoter. These results indicate that the inducible riboswitch was functional in the retinas of mice and may serve as a prototype of similar regulatory systems for use in human gene therapy.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Lee Ferguson.
Thesis: Thesis (Ph.D.)--University of Florida, 2009.
Local: Adviser: Lewin, Alfred S.
Local: Co-adviser: Hauswirth, William W.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-05-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0024068:00001

Permanent Link: http://ufdc.ufl.edu/UFE0024068/00001

Material Information

Title: Regulation of Gene Expression for Therapy of Age-Related Macular Degeneration
Physical Description: 1 online resource (137 p.)
Language: english
Creator: Ferguson, Lee
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2009

Subjects

Subjects / Keywords: cnv, degeneration, expression, gene, inducibility, macular, riboswitch, sflt, therapy
Genetics (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Drug inducible gene modulation technology allows for an ideal therapy for treating neovascular ocular diseases. The dose-dependent and temporal properties inherent in these drug inducible systems substantiate their suitability for use in clinical applications. A major limitation of this system is 'leaky' gene expression during non-induced states. Recent advances have established better inducible systems that improve upon this concern. My goal is to assess neovascular abatement in a mouse laser CNV model while utilizing the inducible hammerhead ribozyme system (riboswitch) in order to regulate the expression of an antineovascularity gene. HEK 293 cells were transfected with either a construct containing the double riboswitch, which included two inducible ribozymes in tandem-orientation, or a single riboswitch construct regulating GFP and sFlt-01 transgene expression. Cells transfected with the ribozyme constructs were induced with a cocktail of Toyocamycin plus 5-fluorouridine. The single riboswitch construct exhibited a 2.8 fold higher level of GFP expression than the double riboswitch construct. However, leaky expression of the sFlt-01 transgene by the single riboswitch plasmid was 7.3 fold higher than that of the double riboswitch plasmid. Adult C57BL6 mice were intravitreally injected within the right eye with AAV2 virus vectors containing the double riboswitch system regulating the antineovascularity gene sFlt-01 six weeks prior to implementation of the laser CNV model. One day before retinal laser burns, animals were implanted with time release pellets containing the inducer agents. Neovascular growth was determined by the product of the CNV area and the fluorescence intensity. For two of the riboswitch induction experiments, CNV was 2.6 (p = 0.003) and 5.2 (p = 0.03) fold higher in non-injected versus injected eyes. Placebo treated animals did not show a significant difference in CNV development for injected and non-injected eyes (p = 0.6). CNV growth was reduced by 93% in riboswitch injected eyes versus the 87% reduction seen in eyes injected with constructs expression sFlt-01driven by the chicken beta actin promoter. These results indicate that the inducible riboswitch was functional in the retinas of mice and may serve as a prototype of similar regulatory systems for use in human gene therapy.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Lee Ferguson.
Thesis: Thesis (Ph.D.)--University of Florida, 2009.
Local: Adviser: Lewin, Alfred S.
Local: Co-adviser: Hauswirth, William W.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-05-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2009
System ID: UFE0024068:00001


This item has the following downloads:


Full Text

PAGE 1

1 REGULATION OF GENE EXPRESSION FOR THERAPY OF AGE RELATED MACULAR DEGENERATION By LEE RONALD FERGUSON A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2009

PAGE 2

2 2009 Lee Ronald Ferguson

PAGE 3

3 I dedicate this labor of love to my family. To my mother, Marie L. Joseph, you are my diamond. All of my compassion, sincerity and warmth I attribute to you. Without you I would not exist. It was because of your love that I am able to achieve the highe st of heights. All that I do I do for you. To my father, George Renee Ferguson, you have been the living embodiment of manhood and fatherhood. Thank you for raising me into the man that I am. It is because of you that I am able to understand and value the meaning of hard work. Your work ethic and life philosophies have shaped me into what I am now and what I will be in the future. To my brother, Don A. Ferguson, thank you for being there when I needed you. I have always shared a special bond with you that will never be severed. To my twin little sisters, Velma and Vera Ferguson: Velma thank you for being so dependable and caring. I will always be there for you just as you were always there for me. You are beautiful inside and out. You have brought into this world a very special son who will make a huge impact. Vera you have always been so kind, helpful, and loving to me; thank you. Of us all, you are the most sensitive and caring. Continue to reach your heart's desire. To my cousin, Darleen, thank you for being there as well. You are irreplaceable in my life. I will always view you as my third sister. I will be the best uncle to your daughters and my nephew. To my best friend Andrew L. Jones, I think of you as a brother from another mother so you too are included as family. Thanks man for always having my back and being the most dependable friend I have ever have. Few people can say they have a true friend; I know that you are the truest of friends. Thank you everyone!

PAGE 4

4 ACKNOWLEDGMENTS I wo uld like to start off by recognizing and thanking my committee members for their unending support and tutelage. I thank Dr. Kenneth I. Berns, for his learned advice and scientific insight. I've always admired the contributions he made to the world of sci ence and his dedication to the advancement of academia. I thank Dr. Maria Grant, for providing me with helpful critiques and expertise suggestions. Her sincerity and wisdom has always been a valued asset to my training. I thank Dr. Shalesh Kaushal, for being so enthusiastic, captivated and critical of my work. He has been an important role model and in my opinion exemplifies what a true clinician scientist ought to be I thank Dr. William W. Hauswirth, for all that he has done in molding me into a com petent scientist. His contribution to my educational and personal development goes beyond words. He has always made an effort to assist me whenever possible with matters concerning work and life. I thank Dr. Alfred S. Lewin, my PhD journey began in his lab and so I am grateful for his decision to accept and training me. I may not have been the most vocal or gregarious of students to have ever entered his lab, but I have always appreciated our talks and the sound advice he have provided. I did not know where this journey would take me as I embarked on it. However, I felt as if his guidance was always a compass leading me along the right path. For that he has my eternal thanks. I would also like to thank the current and past member of the Lewin and Hau swirth labs. Each person in some way or another has provided assistance to my dissertation project. In this instance, I thank the village for raising this child. I'd also like to recognize the Molecular Genetics & Microbiology faculty, staff, and student s. Thank you all!

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS .................................................................................................................... 4 LIST OF TABLES ................................................................................................................................ 7 LIST OF FIGURES .............................................................................................................................. 8 LIST OF ABBREVIATI ONS ............................................................................................................ 10 ABSTRACT ........................................................................................................................................ 12 CHAPTER 1 INTRODUCTION ....................................................................................................................... 14 Ocular Neo vascularization .......................................................................................................... 14 Retinopathy of Prematurity ................................................................................................. 14 Diabetic Retinopathy ........................................................................................................... 16 Age Related Macular Degeneration ................................................................................... 17 Pathological Ocular Angiogenesis: VEGF ................................................................................ 22 Anti -neovascular Treatment ................................................................................................ 24 Animal Models of AMD ..................................................................................................... 35 Gene Therapy ....................................................................................................................... 38 Adeno-Associated Vir us ............................................................................................................. 42 Drug Inducible Systems .............................................................................................................. 47 2 RIBOSWITCH VECTOR DESIGN AND CONSTRUCTION ............................................... 52 Ribozyme Insert Acquisition and Preparation ........................................................................... 52 Ribozyme Insert Subcloning ...................................................................................................... 56 Intermediate Plasmid Construction ............................................................................................ 60 Single Riboswitch Construction ................................................................................................. 65 Double Riboswitch Construction ............................................................................................... 80 3 EXPERIMENTAL PROCEDURES .......................................................................................... 83 Human Embryonic Kidney (HEK) 293 Tissue Culture Protocol ............................................. 83 Seeding of 6 -well Tissue Culture Plates ............................................................................ 83 Transfection of HEK 293 Cells .......................................................................................... 84 In duction of HEK 293 Cells ................................................................................................ 84 Media Collection from HEK 293 Cells .............................................................................. 85 Sandwich ELISA ................................................................................................................. 85 Fluorescence Microscopy .................................................................................................... 86 In Vivo Procedures ...................................................................................................................... 87 Time Release Drug Formulation and Implantation ........................................................... 87

PAGE 6

6 Laser CNV Treatment ......................................................................................................... 87 Tissue Proce ssing ................................................................................................................. 89 4 EVALUATION OF TRANSGENE EXPRESSION ................................................................. 92 Determination of In vitro Inducer Dosage ................................................................................. 92 Assessment of Single and Double Riboswitch Performance ................................................... 93 rAAV2 Riboswitch Analysis in a Therapeutic Setting ............................................................. 98 5 CONCLUSIONS ....................................................................................................................... 109 Improving Pathological Ocular Neovascular Treatment ........................................................ 109 In vitro Riboswitch Functionality ..................................................................................... 109 In vivo Riboswitch Functionality ...................................................................................... 113 LIST OF REFERENCES ................................................................................................................. 116 BIOGRAPHICAL SKETCH ........................................................................................................... 136

PAGE 7

7 LIST OF TABLES Table page 4 1 Time line for C56BL/6 injection with rAAV2 pTR rN117 II D29Gly (sFlt) and analysis of in vivo expression sFLT 01. ............................................................................... 97 4 2 Time line for riboswitch injection with induction followed by laser CNV treatment and endpoint analysis. ............................................................................................................ 99 4 3 Choroidal neovascularization incidence in rAAV2 pTR rN117 II D29Gly (sFlt) vector injected and non injected eyes following laser photocoagulation ......................... 108

PAGE 8

8 LIST OF FIGURES Figure page 2 1 Diagram of the pFBN117 plasmid. ...................................................................................... 52 2 2 Diagram of the pTR -UF -SB -sFlt 01 plasmid. ...................................................................... 54 2 3 Map of the rN117 inducible hammerhead ribozyme sequence .......................................... 55 2 4 Gel separation of PCR amplified rN117 cDNA ................................................................... 56 2 5 Plasmid map of pCR 4 TOPO containing the rN117 ribozyme ......................................... 57 2 6 Digestion of the pCR 4 TOPO containing the rN117 ribozyme ........................................ 57 2 7 Clone Alignment of pPCR -Script Amp SK plasmid with rN117 insert ............................. 58 2 8 Depiction of the pTR -UF SB -XhoI/NotI plasmid. .............................................................. 60 2 9 Digestion of the pTR -UFSB plasmid ................................................................................... 61 2 10 Diagram of the sequencing primers for the pTR -UFSB plasmid ....................................... 62 2 11 Alignment of clones containing the rN117 ligated to pTR -UFSB plasmid ....................... 64 2 12 Digest and gel extraction of sFlt 01 and pTR -UF -SB -XhoI/NotI fragments .................... 65 2 13 Digest and gel extraction of hGFP and pTR -UF -SB -XhoI/NotI fragments ....................... 66 2 14 Digestion of ligated sFlt 01 transgene and pTR -UF SB -XhoI/NotI vector ........................ 67 2 15 Alignment of sFlt 01 transgene ligated to pTR -UF -SB -XhoI/NotI plasmid ..................... 70 2 16 Digestion of the ligated hGFP transgene to pTR -UF -SB -XhoI/NotI vector ...................... 75 2 17 Alignment of hGFP transgene ligated to pTR -UF SB -XhoI/NotI plasmid ....................... 79 2 18 Double digest of pTR rN117 (II) D29Gly (sFlt) and pTR rN117(II) -GFP. ..................... 81 2 19 Digestion of clones of double riboswitch sFl 01 and hGFP constructs ............................. 82 4 1 Qualitative determination of GFP expression with the single ribosiwitch .......................... 93 4 2 Assessment of hGFP expression between the single and double riboswitch. ..................... 95 4 3 Quantification of sFlt 01 expression in HEK 293 cells ........................................................ 96 4 4 Quantification of sFlt 01 expression in C57BL/6 mice ...................................................... 98

PAGE 9

9 4 5 Fluorescence microscopy of CNV tufts in induced riboswitch injected mice ................. 100 4 6 Evaluation of CNV development in induced riboswitch injected mice ........................... 101 4 7 Sample photomicrographs of CNV development in induced riboswitch mice ................. 102 4 8 Therapeutic evaluation of CNV reduction in induced riboswitch treated mice ................ 103 4 9 Fluorescence microscopy of CNV tufts in non induced riboswitch mice ........................ 103 4 10 Evaluation of CNV development in noninduced riboswitch mice ................................... 104 4 11 Asse ssment CNV growth in CBA sFlt injected mice ........................................................ 105 4 12 Analysis of CNV tuft reduction in drug induced riboswitch sFlt treated mic e ................. 106 4 13 Representative fluorescein angiogram for scoring of laser lesions .................................. 107 4 14 Fluorescein angiograms of drug induced riboswitch inj and non-inj eyes ....................... 108

PAGE 10

10 LIST OF ABBREVIATIONS AAV Adenoassociated virus AMD/ARMD Age r elated m acular d egeneration CBA Chicken beta actin cDNA Coding deoxyribonucleic acid CMV Cytomegalovirus CNV Choroidal neovascularization DR Diabetic retinopathy EDTA Ethylenediaminetetraacetic acid ELISA Enzyme linked immunosorbent assay GFP G reen fluorescent protein hGFP Humanized green fluorescent protein HRP Horseradish peroxidase I.P. Intraperitoneal ITR Inverted terminal repeat mRNA Messenger ribonucleic acid PBS Phosphate buffer saline PDR Proliferative diabetic retinopathy PDT Photodynamic therapy rAAV Recombinant adeno associated virus ROP Retinopathy of Prematurity sFlt 01 Soluble fms -like tyrosine kinase 01 SV40 Simian virus 40 TBE Tris borate EDTA TMB 3,3' ,5,5' tetramethylbenzidine

PAGE 11

11 TR Terminal repeat VEGF Vascular endothelial growth factor VEGFR Vascular endothelial growth factor receptor 5 FUR Fluorouridine

PAGE 12

12 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy REGULATION OF GENE EXPRESSION FOR THERAPY OF AGE RELATED MACULAR DEGENERATION By Lee Ronald Ferguson May 2009 Chair: Alfred S. Lewin Co -chair: William W. Hauswirth Major: Medical Sciences Genetics Drug inducible gene modulation technology allows for an ideal therapy for treating neovascular ocular diseases. The dose dependent and temporal properties inherent in these drug inducible systems substantiate their suit ability for use in clinical applications. A major limitation of this system is "leaky" gene expression during non-induced states. Recent advances have established better inducible systems that improve upon this concern. My goal is to assess neovascular abatement in a mouse laser CNV model while utilizing the inducible hammerhead ribozyme system (riboswitch) in order to regulate the expression of an antineovascularity gene. HEK 293 cells were transfected with either a construct containing the double riboswitch, which included two inducible ribozymes in tandem -orientation, or a single riboswitch construct regulating GFP and sFlt 01 transgene expression. Cells transfected with the ribozyme constructs were induced with a cocktail of Toyocamycin plus 5 -fluo rouridine. The single riboswitch construct exhibited a 2.8 fold higher level of GFP expression than the double riboswitch construct. However, leaky expression of the sFlt 01 transgene by the single riboswitch plasmid was 7.3 fold higher than that of the double riboswitch plasmid. Adult C57BL6 mice were intravitreally injected within the right eye with AAV2 virus vectors containing the double

PAGE 13

13 riboswitch system regulating the antineovascularity gene sFlt 01 six weeks prior to implementation of the laser C NV model. One day before retinal laser burns, animals were implanted with time release pellets containing the inducer agents. Neovascular growth was determined by the product of the CNV area and the fluorescence intensity. For two of the riboswitch induc tion experiments, CNV was 2.6 (p = 0.003) and 5.2 (p = 0.03) fold higher in non injected versus injected eyes. Placebo treated animals did not show a significant difference in CNV development for injected and non injected eyes (p = 0.6). CNV growth was r educed by 93% in riboswitch injected eyes versus the 87% reduction seen in eyes injected with constructs expression sFlt 01driven by the chicken beta actin promoter. These results indicate that the inducible riboswitch was functional in the retinas of mi ce and may serve as a prototype of similar regulatory systems for use in human gene therapy.

PAGE 14

14 CHAPTER 1 INTRODUCTION Ocular Neovascularization Pathological ocular neovascularization is a major cause of vision loss. During normal angiogenesis, new blood vessels sprout from pre -existing vessels in order to extend vascularization to tissues requiring oxygenation and nutrients. This process is tigh tly regulated so that normal physiologic functions such as wound healing, ovulation, and placental maturation can be maintained. Under pathological conditions, angiogenesis becomes unregulated and neovascularization becomes a hindrance rather than a help to an ameliorative function. When such pathological neovascularization occurs in the eye, visual function is greatly impaired. The new burgeoning vessels are structurally weak due to deficits in structural integrity, allowing for leakage of fluid. Ultim ately, hemorrhaging, deposition of exudates and protein plaques, and fibrosis may ensue which can cause tractional detachment of the retina and eventual blindness. Among the retinal vascular diseases that can lead to visual loss secondary to the abnormal growth of retinal and/or choroidal vessels, Retinopathy of Prematurity (ROP), Proliferative Diabetic Retinopathy (PDR), and neovascular Age Related Macular Degeneration (ARMD/AMD) account for the majority of vision loss in afflicted individuals. Retinopathy of Prematurity Retinopathy of Prematurity (ROP) is a disease that affects premature infants. ROP can be classified into two major types. The first is an acute disease, which can spontaneously resolve, and the second is the cicatricial phase, which is more permanent and visually detrimental. Based on the International Classification of Retinopathy of Prematurity, ROP can be divided into five stages1, 2. In Stage 1 o f ROP, a demarcation line separates the posterior avascular region from the anterior non -vascular region within the retina. This demarcation line

PAGE 15

15 becomes a permanent ridge from which tufts of neovascularity arise in Stage 2 ROP. Stage 3, also known as th reshold ROP, involves the growth a fibroneovascular tissue which can encroach into the vitreous from the retina. In Stage 4 of ROP, the fibroneovascular growth causes the retina to partially detach in response to tractional forces. Finally, in Stage 5 RO P, formally known as retrolental fibroplasia, there is total retinal detachment. In the 1940s ROP was established to be a disease that affected newborns prematurely delivered and placed into high oxygen concentration incubators. Since then, modificatio ns to oxygen tension levels have led to a reduction of ROP incidence. However, as a result of increased survival rates among low birth weight and early gestation infants, a resurgence of ROP has occurred. In a retrospective study conducted by Archambault and Gomolin, 157 neonates weighing 2,000 g or less from a neonatal intensive care unit were assessed for ROP incidence. The authors discovered that, of the subjects studied, 15% were afflicted with ROP. Within these ROP cases, 75% weighed less than 1,000 g at birth3. In a review performed by Bossi et al. gestational age was determined to have an inverse relationship to the incidence o f ROP 4. For premature newborns sur viving up to 35 weeks of gestation, 25 35% developed ROP of all stages. Among those that did develop ROP 3 5% acquired stage 3 or higher. Furthermore, blindness occurred in 3 5% of infants who were determined to be very immature4. These results support the idea that low birth weight and gestational age are major risk factors for ROP. Treatment options for ROP are limited. In the past, cryotherapy was shown to be beneficial for patients with threshold ROP58. However, with the advent of laser photocoagulation, cryotherapy has been replaced as the main form of treatment for ROP. Retinal scarring and detachment have been shown to be relatively rare in patients with laser treatment 5 years post -op 9. Unfortunately, laser photocoagulation does not address the underlying

PAGE 16

16 mechanism for ischemic drive or the factors contribu ting to the establishment of retinal neovascularization. Because of this, reoccurrence of retinal neovascularization is inescapable. Diabetic Retinopathy Diabetes Mellitus is a disease characterized by hyperglycemia due to the disruption of blood glucose metabolism. This disruption can be attributed either to a resistance to insulins effects, coupled to abatement to insulin secretion as a compensatory mechanism, or to low levels of the insulin hormone. Diabetes Mellitus can be categorized into two type s. Type I, also known as Juvenile Diabetes or insulin dependent Diabetes Mellitus, is characterized by the loss of -cells of the Islets of Langerhans. This loss eventually leads to an absolute insulin deficiency. Type II, wh ich is called non -insulin dependent Diabetes Mellitus, is cells. Complications associated with Diabetes Mellitus span many organ systems. These effects on multi -organ systems can be grouped into macrovascular and microvascular complications. Macrovascular complications include cerebrovascular disease, coronary artery disease, and peripheral organ disease. Microvascular diseases include diabetic neuropathy, diabetic nephropathy, and diabetic retinopathy. Diabetic retinopathy is the most severe diabetic ocular complication. Diabetic retinopathy can be sorted into two types: non proliferative diabetic retinopathy and proliferative diabetic retinopathy. Non -p roliferative diabetic retinopathy is characterized by venous dilation and beading, retinal hemorrhage, microaneurysms, intraretinal lipid exudates and soft exudates. Proliferative diabetic retinopathy (PDR) is characterized by the growth of abnormal new vessels and/or fibrous tissue development on the surface of the retina that may extend to the vitreous interface. Of the two types, PDR possess the most potential for causing severe vision loss; if left unmanaged PDR can cause tractional retinal detachment and blindness.

PAGE 17

17 For Americans under the age of 65, ocular complications associated with diabetes are the leading cause of vision loss. It has been estimated that 16 million individuals in the United States of America are diabetic. Moreover, 40,000 new p atients per year suffer from its ocular complications. Klein et al. evaluated the prevalence of all retinopathy and PDR in people less than 30 years old at the time of diagnosis of diabetes as well as in those individuals 30 years or older at the time of diagnosis. For the group less than 30 years of age at the time of diagnosis, the prevalence of all retinopathy ranged from 17% in those patients with diabetes less than 5 years to 97.5% for those with diabetes more than 15 years 10. For the 30 years or older group, it was determined that the prevalence of all retinopathy was 28.8% in people with diabetes for 5 years and 77.8% for those having it for 15 or more years. In individuals under the age of 30 at the time of diabetes diagnosis, 1.2% of patients with diabetes for less than 10 years had experienced PDR while more than 67% with diabetes for more than 35 years were affected by PDR10. For individuals who were diagnosed with diabetes at 30 years or more, the prevalence of PDR was 2% when the extent of diabetes lasted 5 years. When the length of the disease was more than 15 years t he prevalence was 15.5%10. Laser photocoagulation has been the choice of treatment for PDR. Laser photocoagulations efficacy is dependent on the obliteration of larg e areas of peripheral retina, thus reducing the ischemic drive. As stated before, this approach does little to address the underlying cause of ischemia or the molecules responsible for initiating and stabilizing retinal neovascularity and clearly destroys some retina. Age Related Macular Degeneration Age related macular degeneration (AMD) is a condition in which the center region of the retina, known as the macula, undergoes thinning, atrophy, and, in some situations, hemorrhaging. These pathological outc omes can result in the loss of central vision, which is required to see fine

PAGE 18

18 detail, read, and recognize faces. Severe vision loss from AMD occurs as a result of choroidal (sub -retinal) neovascularization (CNV). AMD can be divided into two types. The f irst type is known as dry or atrophic/non -neovascular AMD. This form of AMD is strongly associated with the deposition of drusen, small yellowish precipitates, between the RPE and Bruchs membrane, the innermost layer of the choroid. Despite demonstratin g thinning and atrophy of the macula, which can contribute to vision loss, dry AMD is less likely to be associated with severe vision loss. The second form of AMD is called wet or neovascular/exudative AMD. The characteristic pathological feature seen wi th this form of AMD is CNV. Based on fluorescein angiographic images, neovascular AMD can be further classified into several forms according to pattern (classic or occult), boundaries (well defined or poorly defined), composition (e.g., predominantly clas sic, minimally classic, occult with no classic), and location of CNV (extrafoveal, juxtafoveal, or subfoveal) with respect to the foveal center. Severe disabling central vision loss is more probable from this form of AMD as a result of retinal edema, ret inal detachment and scarring1115. AMD has an impact primarily on the elderly. AMD affects 12 15 million Americans over the age of 65 and results in vision loss, due to CNV, in 10 15% of these individuals. Based on a report from the American Acad emy of Ophthalmology, AMD is the leading cause of vision loss for those over the age of fifty16. As the population begins to age within t he next decade, these numbers will continue to escalate. In a report conducted by Klein et al. a 15 year cumulative incidence study was performed to demonstrate the interrelationship of lesions associated with early and late AMD in a large population b ased cohort 17. Particularly, the objective was to examine the natur al history of lesions seen with early AMD and their evolution into late stage AMD. When looking at the 15 -year cumulative incidence for early AMD, age

PAGE 19

19 had a huge effect on the percentage of individuals who had acquired it. For those who were 43 54 yea rs of age at baseline, the incidence for early AMD at the 15 year follow up was 6.9%17. As the age at baseline increased from 55 64 years to 65 74 years the incidence percentage increased as well, 12.7% to 25.3%, respectively. This percentage then plateaus at 24.4% for those 17. Moreover, when evaluating subjects for late AMD the age at baseline was also a factor in the incidence of occurrence at the 15 year follow up. The highest incidence percentage for late AMD was seen in the 75 86 year study group (8%) while the lowest percentage was among the 43 54 year group (0.4%). This same trend was seen when drusen type (soft versus hard and distinct versus indistinct), drusen area size, as well as signs of pigment abnormalities were examined. Specifically, when looking at progression of AMD from early to later stage, the age factor seems to contribute greatly; hig her incident percentages were seen for older individuals than for younger17. Eyes that demonstrated drusen that were soft and indistinct in size as well as pigment abnormalities had a greater likelihood to develop late AMD at the 15 -year follow up compared to eyes that did not display such lesions ( 17.8% vs 1.2% and 12.9% vs 1.7% respectively) 17. When controlling for age, the odds ratio for acquiring late AMD was 32.3 for individuals who possessed large drusen area (> 16877 m2) compared to those who had smaller drusen area ( 2) 17. It is apparent that as the population of individuals the age of 75 increases in America, the incidence of late stage AMD can become a major public health concern. AMD is a complex disease that is influenced by a myriad of heritable and extrinsic factors that leads to an increased deposition of inflammatory particles within the outer retina. With recent advances in understanding these genetic and environmental risk factors the biological processes that contribute to the maculopathy associated with AMD have been

PAGE 20

20 elucidated. Klein et al. described AMD in a family containing 10 affected members spanning 3 generations. In this family AMD segregated as an autosomal domin ant trait that mapped to the chromosome 1q25-q31 region18 The authors, however were unable to further delineate the critical region containing the disease locus due to the small size of the family that was investigated. In a subsequent paper, Schultz et al. was able to narrow the scope of the target disease locus to 14.9 Mb betwee n LAMB2 and D1S3469, a region containing 50 known genes19. A sequence variation of the fibulin 6 gene was then selected as the possible disease -causing variant. However, there has not been any definitive evidence to corroborate this assertion. In a series of studies, all conducted in 2005, the 14.9Mb regio n described by Schultz et al. was found to contain a locus called the Regulation of Complement Activation (RCA) which possessed genetic variations that increased the risk of AMD20 23. In these studies, the RCA association with AMD was made via three genetic methods: a low resolution genome wide scan using single nucleotide polymorphisms (SNPs), repetitive genotyping using gene based SNPs across the ARMD1 locus, and genotyping non-synonymous coding SNPs across the ARMD1 locus. These studies were able to identify the 22,000 bp CFH gene region, which increased the risk of AMD 2 -fold to 7 -fold, within the RCA locus. Within the CFH region, most of the haplotypes associated with greater AMD risk had a tyrosine to histidine variation at amino acid position 402. Despite this finding, there were other variations of the RCA locus that coul d also be associated with AMD20. Another chromosome location associated with increased risk of AMD occurrence was observed with linkage studies in chromosome 10q262429. This locus was later refined, via genetic association studies, to a DNA segment containing genes encoding PLEKHA1, LOC387715, and PRSS1130, 31. The LOC387715 is in close proximity to the promoter region of the PRSS1 gene. Both of these two loci are included into the linkage disequilibrium block that

PAGE 21

21 has been found to be associated with AMD. Within the LOC387715 locus the Ala69Ser polymorphism w as found to be associated with increased AMD risk31. To date there has not yet been a consensus as to where the causative variation at the 10q26 locus might be located. However a great deal of evidence suggests that a region between the LOC387715 and the promoter region of PRSS11 possesses the variant or variants associated with increased AMD risk31 33. In addition to the aforementioned loci regions, there have been several studies to suggest that polymorphisms in factor B and the complement component 2 gene confers some risk for disease development but also some protective effect against AMD34, 35. Extrinsic factors also contribute to the development of AMD. Two important environmental factors that have significant effects on AMD occurrence are alcohol and cigarette smoke exposure. Alcohol presents as a potent contributor to AMD development based on the accumulation of fatty acid ethyl esters (FAEE). These FAEE products are synthesized via FAEE synthase non -oxidative metabolism of alcohol3639. In addition to the eye, the heart, brain, liver, and pancreas all participate in non -oxida tive metabolism of alcohol36, 37. FAEE metabolites have been shown to have pro -mitogenic effects by increasing the expression of cyclin E and increasing cyclin E/CDK2 activity40. Moreover, alcohol consumption has been shown to decrease circulating levels of adiponectin (APN) an antiangiogenic protein41, 42. In a study conducted by Bora et al. a 4 -fold increase of FAEE activity was found in the choroid of Brown Norway rats fed alcohol for 10 weeks compared to control animals43. The authors also discovered a 3 -fold decrease of APN expression in the choroid of alcohol treated animals. They were also able to show that after laser photocoagulation the CNV size in the alcohol treated rats i ncreased by 28% compared to control animals43.

PAGE 22

22 Another important extrinsic factor affecting AMD development is cigarette smoke. Ci garette smoke is considered to be one of the biggest environmental risk factors for dry and wet AMD. There are over 4000 potential toxic and oxidizing substances found in cigarette smoke44, 45. Within the tar of cigarette smoke particulates there are a number of pro -oxidant compounds which belong to the quinone family4649. Hydroquinone (HQ) represents the most abundant quinone compound found in cigarette tar46 50. Through the lung, HQ can enter into the blood circulation and urine. HQ diffuses into cells and interacts with mitochondrial enzymes to eventually create superoxide molecules50. These then are converted to hydroxyl anions and hydroxyl radicals i n the cytoplasm. The production of hydroxyl anions and radicals leads to protein oxidation and lipid peroxidation48, 51, 52. Espinosa Heidmann et al. demonstrated that animals exposed to a high fat diet and whole cigarette smoke or HQ, developed basal laminar deposits and thickened Bruch's membrane53. Moreover, the choriocapillaris endothelium exhibited variable hypertrophy. These a uthors were able to demonstrate that formation of deposits in the sub-RPE and Bruch's membrane as well as thickening of the Bruch's membrane are correlated with cigarette smoke and HQ53. Thus exposure to smoke related oxidants and heavy alcohol consumption may be key environmental irritants that progress the disease onset of early and late stages of AMD. Pathological Ocular Angiogenesis: VEGF Angiogenesis is the process of formation of new vasculature via sprouting from established blood vessels. Under physiological conditions, angiogenesis may be initiated by several angiogenic factors such as basic and acidic fibroblast growth factor (FGF), angiogenin, transforming growth factor, interferon, tumor necrosis factor factor5460. VEGF, which is a hypoxia regulated angiogenic factor61, is one of the major stimulators of angiogenesis. It was initially described in a study of highly vascularized tumors62.

PAGE 23

23 VEGF is secreted as a homodimeric protein that specifically promotes endothelial cell proliferation in blood vessels. This proliferation can be achieved by VEGF through several mechanisms: an endothelial cell mitogen effect63, a mechanism utilizing ch emotactic agents from bone marrow derived precursor cells64, 65, the us e of endothelial cell survival factor against apoptosis66, a mechanism for vascular extravasation vi a the up regulation of matrix metalloproteinase and down regulation of matrix metalloproteinase inhibitors 67, or the infiltration of pro -inflammatory cytokines. As a cytokine, VEGF is important for local up regulation of adhesion molecule 1 thereby causing anchoring of leukocytes and the eventual secretion of more VEGF from these leukocytes68, 69. VEGF is highly conserved and is alternatively spliced into several isoforms in humans 70, 71. Two of the human isoforms, VEGF 165 and VEGF 121, are commonly seen in ischemic retinas72. The angiogenic response due to VEGF is mediated mainly by the activation of two high affinity structurally related homologous tyrosine kinase receptors, VEGFR 1, fms like tyrosine kinase 1(Flt 1) and VEGFR 2, fetal liver kinase 1/kinase insert domain-containing receptor (Flk 1/KDR). Both of these VEGF receptors are expressed on vascular endothelial cells73, 74. In the eye, VEGF is constitutively expressed from the basal surface of the RPE layer75. To some extent, RPE expression of VEGF may be important in the establishment of the highly vascular choriocapillaris which lies adjacent to this area of the RPE. The chor iocapillaris demonstrates an asymmetric vascular structure; the thinly fenestrated inner portion faces the RPE, while the thick non-fenestrated outer portion faces away from the RPE76. Elevated levels of VEGF have been found in anterior chamber, vitreous humor, and ocular tissue samples from patients with diabetic retinopathy and CNV secondary to wet AMD7781.

PAGE 24

24 Anti neovascular Treatment Homeostasis of physiological angiogenesis is maintained by a bala nce in expression of angiogenic and antiangiogenic factors. For most pathological neovascular diseases, this underlying principle is disrupted. Specifically, when this occurs in the eye, such physiological imbalance can lead to serious complications of v isual impairment and possibly irreversible blindness. The retina is one of the most metabolically active tissues in the body and thus requires an intense vascular supply. The mature retina is nourished by two vascular beds: the choriocapillaris, which is posterior to the retina and is supplied by the long and short posterior ciliary arteries, and the retinal vasculature, which is in the region beneath the vitreous, penetrating the retina up to but not into the photoreceptor layer. It is derived from the central retinal artery. Despite the presence of a rich vascular supply in the retina there are other regions in the eye that do not require direct vascular enrichment. These avascular zones include the macula, the sub retinal region, the cornea, and the vitreous. Because of this delicate interplay of vascular and avascular regions, it is likely that a variety of angiogenic and antiangiogenic factors coordinate vascular flow and regeneration to modulate the metabolic demands of the retina. The up -regul ation of potent endogenous antiangiogenic factors or the reduction of angiogenic factors are required to impede the impetus for pathological neovascularity. There are a multitude of growth factors in the eye that have been linked with the onset of ocular disease82. Of these factors, VEGF is the one of most potent angiogenic stimulators and vascular permeability factors. Several known endogenous angiogenic inhibitors have been shown to effectively reduce the progression of ocular pathological neovascularization. Some of the most noteworthy e ndogenous factors which act as broad -spectrum angiogenesis inhibitors, by interfering with the pro angiogenic action of VEGF, include Endostatin, kringles domain 1 3 of angiostatin and pigment epithelial derived factor (PEDF). Endostatin, a fragment of the

PAGE 25

25 basement membrane component collagen XVIII, was shown to inhibit induced CNV growth and vascular leakage 83. Similarly, kringle domains 1 3 of angiostatin has demonstrated the ability to significantly reduc e retinal neovascularity in a mouse model of ischemic retinopathy in mice84. One of the more powerful antiangiogenic factors endogenously produced is PEDF. TombranTink and Johnson discovered PEDF in conditioned medium of cultured human fetal RPE85. In the eye, PEDF is present in vitreous86 and aqueous humor87, and expression has been observed in the corneal and ciliary epithelium. Moreover, expression is localized in the retinal pigmented epithelium (RPE), with secretion occurring into the surrounding inter photoreceptor matrix88, 89. PEDF expression in these regions provides a reasonable explanation for the known avascularity of the cornea, vitreous body and the subretinal space. There are two main ways PEDF exerts biological activi ty: differentiation, neuroprotection and anti angiogenesis. In terms of neuroprotection, PEDF has been shown to prevent apoptosis of photoreceptors induced by H2O2 or light90, 91 systems92. As an antiangiogenic agent, PEDF has the ability to inhibit endothelial cell migration in vitro in a dose -dependent manner and has exhibited greater effectiveness than other inhibitors such as angiostatin, t hrombospondin 1, and endostatin93. Another important anti angiogenic factor that exhibits potent ef fects on VEGF is soluble fms like tyrosine kinase 1 (sFlt 1). This molecule is the soluble form of the extracellular domain of Flt 1 and is a specific endogenous inhibitor of VEGF94. It binds to and sequesters VEGF from the extracellular milieu and thus prevents the activation of the VEGF receptors. Additionally, sFlt 1 exerts a putative dominant negative effect on VEGF rec eptors by directly interacting with the receptors to form an inactive heterodimer, thus blocking activation by VEGF95, 96. In terms of pathological ocular angiogenesis, several studies have demonstrated that

PAGE 26

26 sFlt 1 expression can successfully reduce neovascularity. In a study conducted by Honda et al ., an sFlt 1 Fc fusion protein encoded in Adenovirus (Ad) vector was able to reduce CNV in rats subjected to laser -induced rupture of Bruchs membrane97. In a separate study, intraocular injections of Ad sFlt 1 and Adenoassociated virus (AAV) encoding sFlt 1reduced retinal neovascularization due to oxygen induced ischemic retinopathy by approximately 50%98. In a 2002 study, Lai et al. demonstrated that injection of AAVsFlt 1 into the ante rior chamber of rats with cauterized corneas reduced corneal neovascularization by 36%99. Moreover, the authors were able to show that sub -retinal injections of AAVsFlt 1 diminished CNV in rats exposed to laser rupture of Bruchs membrane by 19%99. In general, there is a pendulum effect associated with the onset or prevention of angiogenesis when the levels of a ntiangiogenic and angiogenic factors are altered. If amelioration of ocular angiogenesis is the goal, then this pendulum must be influenced in a way that favors antiangiogenic effects. There are fundamentally two ways of doing this: one way is to limit the expression of angiogenic factors and the other way is to up-regulate the expression of antiangiogenic factors. PEDF has proven to be very effective as an anti angiogenic agent. However, it can act as a potential angiogenic promoter when expressed at e levated levels100, 101. The alternate approach, the removal of angiogenic stimuli, is the method of action associated with the sFlt1 protein. Thus far sFlt 1 has proven to be a valid and reliable means to curb ocular pathological neovascularity. Current AMD treatment relies on the use of injectable ocular compounds The goals of these treatments are to preserve current eyesight and prevent future vision loss. AMD treatment is dependent on whether the condition is either in the dry or wet form. There are no available FDA approved treatment options for dry AMD. Ho wever, in a study conducted by the Age -

PAGE 27

27 Related Eye Disease Study (AREDS) research group, the use of nutritional/antioxidant intervention has been found to be helpful in limiting the progression of dry AMD to the wet form102. The study found that for individuals between the ages of 55 and 85 who were followed for 6.3 y ears, daily intake of these antioxidants had a significant reduction in the odds of developing advanced AMD compared to individuals given placebo treatment. For wet AMD there are FDA approved treatments that can stop abnormal blood vessel growth and thus halt or improve vision loss. One such treatment is called Lucentis (Ranibizumab). Lucentis was approved by the FDA on June 30, 2006, with the intention to be applied as a local ocular anti angiogenic therapy. Lucentis, which was developed by Genetech in collaboration with Novartis Ophthalmics, is a recombinant humanized Fab fragment of an anti -VEGF antibody. Lucentis was designed to bind to all isoforms of vascular endothelial growth factor (VEGF). Following an intravitreal injection, this molecule is alleged by its manufacturers to filter through the various layers of the retina better than Avastin (Bevacizumab, Genetech/Roche), which is a larger full sized antibody initially designed to treat pathological angiogenesis in tumors. In an in vivo mouse m odel, Lucentis has been shown to effectively reduce retinal neovascularity after a single intravitreal injection103. In a phase I clinical trial study, 0.5 mg was shown to be the maximum tolerated dose for a single intravitreal injection of Lucentis into pat ients with sub -foveal CNV104. Following this study, a subsequent phase I clinical trial examined the toxicity associated with the use of multiple injections of Lucentis at escalating doses. In this repor t, multiple intravitreal injections of Lucentis at doses ranging of 0.3 mg to 2.0 mg were well tolerated and maintained biological activity in CNV eyes for 20 weeks105. In terms of adver se effects the most common severe outcome was post -injection mild transient ocular inflammation105. Further analysis of repeated intravitreal injections of Lucentis was evaluated in a phase I/II clinical trial106. In this

PAGE 28

28 study the repeated intravitreal injections demonstrated improvement in visual acuity and decreased leakage from CNV in patients with wet AMD. Despite some adverse events such as endophthalmitis, increased intraocular pressure, central retinal vein occlusion, or iridocyclitis, which are associated with repeat injections, Lucentis did exhibit a good safety profile106. Clinically Lucentis is administered through monthly inje ctions into the eye until CNV is no longer evident. Clinically Lucentis and Avastin represent the two primary treatment options for individuals diagnosed with the wet form of AMD. According to the September 2006 preferences and trends survey conducted b y the American Society of Retina Specialist, clinicians were evenly divided in prescribing Lucentis or Avastin to treat patients with neovascular complications of AMD. In spite of the equal frequency of prescribed use between the two drugs, only Lucentis has been FDA approved for wet AMD treatment. FDA approval for Avastin has been limited to colorectal cancer use. However, because early clinical trial results for Lucentis proved very promising and FDA approval to Lucentis had not yet been established, of flabeled use of Avastin for wet AMD was initiated. Both Lucentis and Avastin are derived from the same murine antibody to VEGF. Avastin is a full length humanized antibody while Lucentis is the Fab fragment that has been humanized and affinity maturat ed. Lucentis may offer specific advantages of over Avastin such as higher affinity binding and potentially less immunogenicity due to the absence of the Fc portion of the full -length antibody. Despite being used in an off label manner, several studies h ave demonstrated the similarity of Avastin to Lucentis in treating neovascular AMD107113. Pharmacokinetic studies have suggested Avastin possessing more of an advantage due to its increased half life in the retina, vitreous, and choroid114, 115. In clinical applications Avastin is only injected once every six weeks. Lucentis requires much more

PAGE 29

29 frequent applications (i.e. once every four weeks) thus increas ing the potential of adverse events and patient discomfort. However, its longer biologic activity may present a greater potential for Avastin toxicity. This stability could have systemic implications because of unintended systemic exposure. In order to determine the appropriateness of Lucentis or Avastin as treatment for wet AMD, side -by-side comparisons of the two drugs must be performed, and an NEI -sponsored clinical study is presently underway. The Comparisons of Age -Related Macular Degen eration Treatment Trials (CATT), sponsored by the National Institutes of Health (NIH), is the only multicenter randomized clinical study which investigates the safety and efficacy of Lucentis and Avastin in treating the neovascular form of AMD by measuring visual acuity. In addition, this trial investigates how frequently administration should occur in order to have a clinical effect as well as a relative cost analysis for the drugs. According to conservative estimates performed by the Center for Preventa tive Ophthalmology and Biostatistics, there could be an annual price difference of $26,800 per patient for just two treatments. Inquiries into this matter could potentially lead to a reduction in Medicare spending of up to 3 billion per year (8.6 million per day). Another injectable compound used to treat wet AMD is Macugen (pegaptanib sodium, Eyetech Pharmaceuticals/Pfizer). Macugen is an RNA aptamer that is directed against the VEGF 165 isoform. Macugen was approved by the FDA in December 2004, and was the first successfully developed aptamer based therapy for humans. Moreover, it was the first anti angiogenic therapy indicated for the treatment of wet AMD. In vitro analysis has shown that Macugen is effective in inhibiting VEGF 165 binding to cul tured endothelial cells116. In animals studies it was shown that Macugen exhibited favorable pharmacokinetic results, long lasting

PAGE 30

30 vitreous humor biological activity, and an absence of toxicities associated with systemic or ocular administration64, 117, 118. The VEGF Inhibition Study in Ocular Neovascularization, or VISION trials, assessed the safety and efficacy of Macugen in a two year concurrent, multicenter clinical trial for the tre atment of CNV secondary to wet AMD119. In the first year of these trials, participants were either treated with 0.3, 1, or 3 mg of Macugen or with a sham injection every 6 weeks for 48 weeks. Compared to individuals who received sham injections subjects who were apportioned 0.3 mg of Macugen had statistically significant improvements when it came to maintainin g/gaining 0.02), and gaining 119. Additionally, when vision loss was examined, significantly more people in the sham treated group experienced losing 0.001) and exhibited visual acuity of 20/200 or worse (p < 0.001) in contrast to individuals in the 0.3 mg Macugen treatment set119. There was no additional clinical benefit when the treatment regime was higher than 0.3 mg. In the second year of the clinical trials, participants were re randomized into the usual care treatment arm (sham or no treatment) or the 0.3 mg Macugen treatment group. Individuals re randomized to continue the 0.3 mg Macugen displayed a 45% relative benefit in mean change in vision compared to those receiving usual care119. In the 2 years of treatment with 0.3 mg of Macugen 10% gained had only 1 year of treatment at this dose level 119. The adverse events associated with Macugen were transient, mild to moderate in intensity and mainly attributed to the injection procedure rather than the drug119. All study doses of Macugen were well tolerated systemically120. In a study conducted by Klettner et al. Macugen, Lucentis, and Avastin were contrasted in their ability to efficiently neutralize VEGF level in a quantifiable and reproducible manner while in an in vitro milieu121. The in vitro system used for this study was a porcine organ culture

PAGE 31

31 model comprised of retina, RPE and choroidal tissue cultivated in a perfusion chamber. The anti -VEGF drugs used in this study were set at concentrations equivalent to clinical applications. This investigation found that when administered at clinically significant levels, Avastin (0.25mg/mL) and Lucentis (0.125mg/mL) completely neutralizes VEGF for 6 hours121. In terms VEGF levels, western blot analysis also showed that both drugs were able to cause a significant reduction. Moreover, both drugs demonstrated prolonged neutralization of VEGF; VEGF concentrations remained significantly low for 16 hours121. This study establishes an important point. The anti -VEGF drug concentrations were diluted with each successive perfusion. Ultimately, after 14 hours of perfusion, Lucentis levels that were initially at 0.125mg/m L were now at 6ng/mL and Avastin concentrations were lowered from 0.25mg/mL to 12ng/mL. When these lower concentrations levels were administered, there was an absence of VEGF neutralization121. In essence VEGF inhibition was more long -lived than the persistence of adequate VEGF neutralization for both drugs. This result led the authors to conclude that alternate routes of inhibition may be employed by these two drugs. However, Macugen was not effective in altering VEGF concentra tions in this experimental design121. Despite the fact that the two drugs showed no difference in efficiency when used at clinical concentrations Lucentis did demonstrate greater neutralization efficiency when highly diluted. In order to achieve VEGF levels of around 50pg/mL, Lucentis concentrations could be diluted 8 fold lower than that of the Avastin121. This demonstrates that Lucentis exhibits greater VEGF binding capacity than Avastin. Visudyne (ve rteporfin) drug treatment with the combination of laser photocoagulation is a fourth method for wet AMD treatment. This form of treatment is also called photodynamic therapy (PDT). PDT utilizes a nontoxic light sensitive compound known as a photosensiti zer.

PAGE 32

32 This compound is intravenously injected and then activated by light exposure to produce photochemical effects in the targeted area. Chemical photodamage is mainly established by two reaction pathways. The first involves directly generating reactive cytotoxic free radical species. The second or type II is more indirect and leads to the formation of excited state oxygen, singlet oxygen (1O2), which causes photo -sensitive oxidative damage to cellular, and sub -cellular targets. Depending on the chemi cal structure of the photosensitizer, both reactions can occur either simultaneously or exclusively. Visudyne is derived from porphyrin and is a potent second generation photosensitizing agent. Porphyrin is chemically stable and has shown to generate type II chemical photodamage reaction. Visudyne is advised only for patients who have neovascularization under the retina in a well -defined, distinctive pattern known as predominantly classic. This pattern of CNV is thought to affect about 40 to 60 percent of new cases of wet AMD. This procedure requires intravenous injections of Visudyne into the patients arm; afterwards the drug is activated as it passes through the choroidal blood vessels. Activation to photo ablate CNV vessels occurs via irradiation of these vessels with a non thermal laser in the wavelength range of 680 695 nm,. Visudyne is cleared in its less active form, thereby reducing the risk of protracted skin photosensitivity122. Dosimetric preclinical studies involving the primate m odel of experimentally induced CNV demonstrated that the optimal dose of Visudyne was 0.375 mg/kg123, 124. Additionally, the optimal time for irradiation using light at wavelength of 692 nm was 20 50 minutes after commencing intr avenous injection of Visudyne123, 124. In a multicenter phase I and II nonrandomized clinical trial that was conducted on patients with sub -foveal CNV who were ineligible for laser photocoagulation individuals were evaluated for sh ort term safety and maximum tolerated dose of Visudyne125, 126. These studies elucidated the optimal dosimetry and determined if fluorescein leakage from sub-foveal

PAGE 33

33 CNV could be stopped by Visudyne therapy without immediate permanent visual loss, as may be seen with standard laser photocoagulation. In conducting these studies, the effective single treatment dose that would provide the best visual outcome was determined to be 0.375mg/kg infused intravenously over 10 min, and a light intensity of 50J/cm2 delivered over a time span of approximately 83 seconds. The optimal time for irradiation w as 15 min after the start of Visudyne infusion when the laser setting was 690 nm and the intensity was 600mW/cm2. Furthermore, these studies demonstrated that a single treatment with light activated Visudyne was well tolerated and lead to an immediate tre atment effect. Fluorescein leakage from CNV lesions was completely absent 1 week after treatment125, 126. Despite leakage from CNV reappearing after 12 weeks in 70% 80% of treated eyes, the area of leakage was nevertheless smaller than the pre treated state. It was concluded that retreatment of areas showing recurrent leakage would be nee ded in order to maintain long term therapeutic benefits in CNV eyes125, 126. There was n o significant loss of vision during the 12 weeks following of PDT with Visudyne treatment. In terms of those who benefited from the treatment 20% of the participants gained 2 or more lines of vision, 56% gained only 1 line of vision, and 24% experienced a loss of 2 or more lines125. Despite having a multitude of therapeutic options available for the management of neovascular AMD, there has yet to be confirmed one overriding clinical treatment choice. Although Macugen had been hailed as the first FDA approved drug treatment for neovascular AMD it has presented fewer therapeutic benefits than Ava stin or Lucentis. This fact was made clear when clinical trials examined Macugen, Lucentis and PDT, in conjunction with verteporfin, in order to contrast their ability to prevent visual acuity loss. In a critical review conducted by the Colquitt et al., Lucentis and Macugen were evaluated for clinical effectiveness and cost -

PAGE 34

34 effectiveness when treating sub-foveal CNV due to AMD127. This article performs a systematic review and analysis of various randomized control trials (RCT)106, 119, 128, 129. In terms o f visual acuity, the number of individuals losing less than 15 letters of visual acuity when provided Macugen treatment was greater than for patients administered sham injections. In regards to Lucentis, a significant amount of patients lost less than 15 letters of visual acuity at 12 months compared to the sham (62.2%, p<0.0001) or PDT (64.3%, p<0.0001) groups. Moreover, when combined with PDT, Lucentis plus PDT caused significantly far less loss of 15 letters or more compared to sham plus PDT (90.5% ver sus 67.9%, p<0.001) for patients with predominantly or minimally classic neovascular AMD lesions. In addition to the prevention of visual acuity decay, Macugen and Lucentis have also provided improvement in visual acuity (i.e. gain of 15 letters or more) 128, 129. Additionally, patients provided 0.5mg of Lucentis plus PDT experienced more stable visual acuity than patients given PDT plus sham. Regarding adverse events, patients injected with Macugen or Lucentis experienced s ymptoms that were short lived and mild to moderate in intensity. This review also established an increased cost -effectiveness with the use of Macugen and Lucentis over usual ophthalmic care and PDT127. This analysis determined that there was an increased cost for the use of Macugen and Lucentis over conventional care and PDT. The authors created a model to individually determine the cost -effectiveness of Lucentis and Macugen compared to best supporti ve care. Projections made from this model are called incremental cost -effectiveness ratio (ICER) and are based on a short term (2 year) and long term (10 year) time span. In addition to being influenced by time, the ICER is also affected by the patients visual acuity, treatment effects on neovascular AMD, pricing of injections (i.e. outpatient or day care procedure charge), and the uptake of service for visual impairment. ICER

PAGE 35

35 estimations for the two anti -VEGF drugs, Macugen, in comparison to usual care ranged from ,603 for 2 years to ,986 for the 10 year projection. The 2 year ICER for Lucentis has been estimated to be ,464 while the 10 year forecast was ,098. The high ICER between the 2 year and 10 year estimates are primarily due to re latively small cost per quality adjusted life year (QALY), which takes into consideration the gains and losses in visual acuity, and the majority of treatment costs being concentrated in the first 2 years. At the 10-year mark, the QALY becomes larger whil e the incremental costs are reduced due to the reduction in costs of service for visual impairment offsetting the costs for drug treatment. Although current treatment options have produced successful results in maintaining and improving visual acuity, t hese therapeutic benefits are not long-lived and can present increased ophthalmic consequences due to repeated ocular trauma. If a permanent solution is to be considered, then the proposed therapy needs to halt the pathway leading to pathological angiogen esis for a more sustained period. In addition, the treatment should also be presented in a modality that limits patient discomfort and adverse events. Animal M odels of AMD Since the time of Pasteur the use of animal models has helped to obtain valuable in formation on human disease processes. In terms of AMD, animal models have not only provided key insight into the phenotypical presentation, but also advancement in understanding of the molecular factors underlying this disease. Moreover, these models ha ve been instrumental in establishing therapeutic approaches to combat the degenerative affects of AMD. There are numerous models that mimic both the dry and wet forms of AMD. Since the focus of this dissertation project is the wet form of AMD, the follow ing discussion will highlight some of the more notable CNV animal models.

PAGE 36

36 The most widely used CNV model utilizes laser injury, and subsequent rupture, of Bruch's membrane in order to establish sub -retinal infiltration of choroidal vessels. This model h as been implemented on primates, rats, and mice130132. This model does display some limitation such as retinal neovascularization in addition to CNV growth, glial derived sub retinal fibrovascular membranes, and n onspecific local inflammatory reactions secondary to laser treatment133135. Despite these technical artifacts, this model remains as one of the preferred models for analyzing CNV in association with AMD. In a different CNV model, Kiilgaard et al. devised an alternative method whereby porcine RPE is surgical debrided and then Bruch's membrane is disrupted136. In this porcine model the authors conclude that CNV induction is superior to that observed with laser photocoagulation primarily due to the absence of retinal neovascular changes. In another CNV model AAV vector encoding human VEGF 165 is injected into the sub retinal space of rats in order to establish transduction of RPE cells. This subsequently leads to sub-retinal neovascularization photoreceptor degeneration, proliferation of RPE, diminished electroretinogram (ERG) A and B waves amplitudes, and choroidal blood vessels penetrating through the Bruch's membrane137. Transgenic CNV animal models have also provided some awareness into the pathophysiology of wet AMD. In a study conducted by Spilsbury et al., a rat transgenic model was devised whereby over expression of VEGF in RPE cell stimulated sub retinal CNV 138. However this model has been reported to only cause an increase in choroidal density and thickness without any neovascularity133. The VLDLR (Vldlr tm/He) mouse is another transgenic model where a targeted mutation is placed in the low density lipop rotein gene. In this model retinal neovascularization originates from the outer plexiform layer and extends into the sub retinal space139. This vessel distribution is similar to retinal angiomatosis proliferans which

PAGE 37

37 occurs in some patients with AMD140. Despite this retinal neovascular pattern, these animals do not exhibit retinal degeneration and their ERGs have normal to supernormal amplitudes In a study conducted by Chan et al. a transgenic mouse model was created by a double knockout model of the Ccl2 and CX3CR1 genes141. In this model the animals display retinal lesions that are akin to both the dry and wet form of AMD. Tuo et al. developed a transgenic mouse model which incorporated the Ccl2 gene knockout and the loss of function single nucleotide p olymorphism at the Cx3cr1 locus in order to recapitulate AMD pathology due to disturbance of leukocyte transit and immunoregulatory factor homeostasis. This model has produced pathological changes at an earlier age of onset and with increased penetrance t hat mimic the dry and wet variations of AMD142. In a study conducted by Imamura et al., AMD pathogenesis was established by knockout of the Cu, Zn-superoxide dismutase (SOD1) gene in mice. This approach was based on the theory of oxidative stress contributing to the onset of AMD. In this model, senescent SOD1 knockout mice demonstra ted hallmarks of dry and wet AMD such as drusen deposits, thickened Bruch's membrane, and CNV143. In a separate transgenic model devised by the Malek et al. group, the inclusion of multiple AMD risk factors was used to recapitulate AMD pathology. The researchers employed three major risk factors which highly correlate with AMD onset: advanced age, high fat cholesterol rich diet, and apolipoprotein E. Mice in this model had targe ted removal of endogenous mouse ApoE genes with subsequent replacement by the allelic variants of the human ApoE gene. The mice were later fed high fat cholesterol diets once they reached a senescent age range. These animals developed pathological change s consistent with the dry and wet forms of human AMD. This model is considered appealing because of the non invasive approach and the use of multifactorial risk components in order to induce AMD144.

PAGE 38

38 Gene Therapy To effectively address the current threat associated with pathological neovascularity, gene therapy seems to be the best method of defense: Gene therapy offers the advantage of having long and sustainable production of the therapeutic protein. In addition to providing long -term release, gene therapy allows for c ontrol over the spatial parameters of therapeutic gene expression. Instead of having wide ranging effects on multiple organ systems and tissue types, the therapy can be targeted to the specific organ and/or cells that require treatment. Moreover, having spatial control limits the potential adverse effects that can occur with having gene expression at unintended sites. Immune privilege in the eye makes gene therapy even more attractive. Limited immune surveillance would restrict the presence of neutralizing antibodies as well as curtail inflammation. Another important aspect of gene therapy is the reduction in repetitive injections that occur with drug therapies designed to suspend ocular neovascularity. Because there is production of the therapeutic pr otein by the target tissues, gene delivery obviates the problem of protein half -life. Finally, gene therapy can in theory be designed to directly address the pathological mechanism that is at play in angiogenesis. In order to be effective, the delivered gene must impede the pathway of angiogenesis or promote specific degeneration of these new vessels. In this way, there may be less potential for harmful effects if endogenous mechanisms are exploited, especially compared to methods like PDT that focally destroy all blood vessels. There have been many uses for gene therapy in treating acquired and heritable diseases. One example is the use of non1 antitrypsin (AAT) deficiency. In this case a plasmid -cationic liposom e complex and recombinant AAV serotype 2 (rAAV2) were used to deliver the AAT transgene into nasal epithelium and intramuscular sites, respectively145 147. In the Brigham et al. study they were able to demonstrate sustain expression

PAGE 39

39 of the AAT mRNA and protein 5 days after administration, along with a reduction of the proinflammatory cytokine, interleukin 8145. In a phase I clinical trial, Brantly et al. were able to demonstrate good safety profiles with the use of the rAAV -AAT intramuscularly. However there was a humoral immune response to AAV capsid protein, and transient e xpression of AAT in one patient at levels greater than 100 fold below the therapeutic range146. Another disease area that has had beneficial results with the use of gene therapy is with the lysosomal storage disorders. In this case the gene therapy approach was to transplant ex vivo retrovirus modified autologous huma n CD34+ cells into conditioned subjects. There is a clinical protocol in submission to use this ex vivo gene therapeutic method to treat mucopolysaccharidosis type VII disease. The objective in this endeavor is to use lentiviraltransduced autologous hem atopoietic progenitor cells in patients treated with a myeloreductive -conditioning procedure148 There are a variety of gene delivery methods that aid in the establishment of beneficial gene therapy regimens. One of the most notable vector systems is the rAAV. These vectors are of particular utility in ocular tissue due to their abil ity to establish efficient prolonged transduction149151. Further discussion of the rAAV is provided in the "Adeno-Associated Virus" sub -chapter. Lentivirus -based vectors are another source for delivery of gene therapeutic models. These vector systems are particularly attractive because of their ability to stably transduce non -dividing cell population. Due to inherent qualities associated with gene therapy in the eye, such as avoidance of systemic delivery and low vector titer to stably transduce ocular cells, the potential risk of lentivi rus -mediated insertional mutagenesis is significantly lower. Additionally, integrase deficient vectors have shown in vitro sustainability of expression, which can possibly be translated to in vivo applications at levels comparable to lentivirus vectors ca pable of integration152. In a number of studies lentiviral based therapies have demonstra ted

PAGE 40

40 long -lasting therapeutic effects in ocular tissue153 157. However there have been reported challenges with lentivirus transduction in photoreceptors possibly due to anatomic barriers to vector particle penetration158160. The u se of non -viral vectors is another delivery method used to introduce gene therapy into humans. Because of concerns associated with potential virulence reactivation and neoplasia induction non-viral vectors based on cationic polymers (polyplexes) and catio nic liposomes (lipoplexes) are a good alternative to viral vectors. There is one major limitation associated with the intravitreal delivery of these non-viral vectors. The polyplex and lipoplex particles are impeded by the binding of glycosaminoglycans t o these molecules as well as obstruction by dense networks of hyaluronan. This blocks uptake and expression of transgenes161, 162. In order to overcome this barrier shielding with polyethylene gl ycol (PEG) on non -viral vector surfaces has proven to enhance stability and transport163. In a study conducted by Bo chot et at. liposomes complexed with PEG particles possessed greater retention and stability in the vitreous than naked liposomes164. An example of a well known P EGylated particle is Macugen. The two monomethoxyPEG chains shields the 28 -mer oligonucleotide responsible for chelating extracellular VEGF molecules, from rapid degradation after intravitreal injection. Unfortunately, PEGylation has been shown to cau se a reduction in transduction efficiency of lipoplexes165 167. The problem with PEG stabilized lipids is that there could either be decreased cellula r interaction as reported by Deshpande et al. or an interference of endosomal escape of the lipoplexes as discovered by Song et al.165, 167. Several advances in PEGylation such as utilizing PEG -ceramides and pH -sensitive or degrada ble linkers joining PEG particles to lipoplexes have improved problems associated with cellular membrane interaction and endosomal escape respectively168 171.

PAGE 41

41 There have been several attempts of performing gene therapy in the eye. In one gene therapy model, a phase I clinical trial was conducted to evaluate the safety profiles of adenovirus -mediated 'suicide' gene therapy for vitreous tumor seeds in one eye of children with bilateral retinoblastoma refractory to conventional treatment172. This study was able to show that vitreous tumor seeded eyes responded favorably to the gene therapy regimen. However, there was mild to moderate inflammation and eventually all eyes we re enucleated due to progression of the primary tumor. This made assessment of the intervention difficult. In another phase I study, the safety and tolerability of an adenoviral vector expressing PEDF (Ad.PEDF) was examined in order to develop an effecti ve gene therapy approach to AMD173. Despite mild to moderate transient intraocular inflammation in 25% of treated patients, there were no dose limiting toxicities or serious adverse events. Moreover, an unintent ional therapeutic effect was observed; Ad.PEDF demonstrated a dose -dependent antiangiogenic effect. A future clinical trial is in development to probe the therapeutic efficacy of Ad.PEDF in wet AMD patients. Ocular gene therapy is far reaching in its sc ope in terms of disease treatment. In a phase I clinical trial conducted by Hauswirth et al.in association with a study conducted by Cideciyan et al. rAAV2 CBSBh RPE65 was evaluated for its safety profile as a potential treatment of the RPE65 mutant form of Leber congenital amaurosis ( RPE65 -LCA)174, 175. Subretinal injections of the rAAV2 CBSBh RPE65 vector in three patients did not demonstr ate any serious adverse events or systemic toxicities. Despite optical coherence tomography evidence of retinal thinning in the foveal region of one patient, there was no statistically significant change in visual acuity and all patients reported increas ed visual sensitivity in treated eyes. Additionally when evaluated with dark adapted full -field sensitivity testing 30 90 days after vector injection, treated eyes exhibited

PAGE 42

42 greater sensitivity than baseline values (p<0.001). Contra -lateral controls eyes did not change from baseline recordings (p=0.99). Adeno Associated Virus In the world of animal viruses, parvoviruses are among the smallest deoxyribonucleic acid (DNA) viruses. The composition of the virion consists entirely of protein and DNA and has a diameter of 18 to 26 nm. Within Parvoviridae there are two subfamilies: Densovirinae which infects invertebrates, and Parvovirin ae which infects vertebrates and includes the three genera Parvovirus Erythrovirus Amdovirus Bocavirus and Dependovirus176179. AAV is a member of the dependovirus genus that contains viruses requiring co-infection with an unrelated helper virus. Adenoviruses, herpes simplex viruses type I and II, cytomegalovirus, and pseudorabies all have the required helper functions to promote AAV replication180182. In the absence of helper virus, the AAV genome can be integrat ed into a unique chromosome site in humans183185. This integration occurs via non -homologous recombination primarily at chromosome 19q13.3 qter185 188. Super infection with helper viruses rescues the integrated genome and establishes the lytic or infective state183, 189, 190. Parvoviridae encapsulates linear, single stranded DNA molecules191, 192. The genome size of AAV is approximately 4.7 kilobases (kb)193, 194. There is an equal frequency of DNA strand polarities enclosed within the AAV capsid. Contained within the AAV genome, are two open reading frames (ORF)193195. The right half of the genome, which is between 50 to 90 map positions (mp), encodes the ORF for the three capsid proteins, while the left half encodes the non-structural rep proteins (mp = 5 to 40). The three capsid proteins are produced via a combination of alternative splicing as well as alternative start codons196 and include: VP1, with a molecular weight (MW) of 87 kDa; VP2 (MW = 73 kDa); and VP3 (MW = 62 kDa).. They share a common 533 amino acid C terminal region. Moreover, VP1 and VP2 possess additional N terminal sequences of 65 and 202 amino acid,

PAGE 43

43 respectively, in length. The virion capsid proteins, which are synthesized at a molar ratio of 1:1:20, combine to form an icosahedral shell with T = 1 structural organization180, 197. The nonstructural genes Rep78, Rep68, Rep52, and Rep40 encode proteins necessary for replication. During conditions conducive for latency Rep68/78 negatively regulates AAV gene expression and DNA replication. Moreover the Rep68/78 protein is needed for site -specific integration into host cell genome. In the presence of helper virus, Rep68/78 functions as a transactivator of AAV gene expression DNA replication, and liberation of the viral genome from chromosomal latency. During AAV replication the Rep68/78 protein performs a site -specific nicking reaction which is important for terminal resolution. Additionally, Rep 68/78 serves as a DNA DNA, as well as a DNARNA, helicase and ATPase protein. The helicase and ATPase activities are essential for nicking and strand displacement198200. Rep52/40 is important for ensuring that mature single -stranded DNA is encapsulated 201. Flanking the cap and rep ORFs are sequences of DNA 145 bp in length called inverted terminal repeats (ITR). ITRs require cis orientation in the vector genome in order for DNA rep lication and transcription to occur202, 203. Other import ITR functions include: AAV encapsidation190, genome integration during the establishment of latency infection204, as well as genome rescue from chromos omal integration205. AAV is quite versati le in its ability to bind to cellular receptors. AAV2 was discovered as a contaminant in an Adenovirus type 12 viral stock206 and was the first serotype to be cloned into bacterial plasmids207. It is considered to be the prototypical AAV virion because it is the most studied and thus best characterized serotype among all other AAVs. AAV serotype 2 can utilize a wide range of ligands to mediate viral infection. The most commonly used ligands are: heparin sulfate proteoglycan, which permits low affinity attachment208, 209; basic fibroblast growth factor receptor 1210, 211. Furthermore, with the aid of mutations or

PAGE 44

44 insertions within the capsid protein AAV can adapt to a variety of alternative receptors212, 213 214217. Moreover, there are other naturally occurring AAV serotypes that bind to other cell surface receptor a nd exhibit other cell and tissue tropisms. Once recognition occurs via the cellular receptor, AAV is likely enters the cell by endocytosis via clathrin coated pits 218220, 220, 221. Stability of endosomal particles and/or the intracellular trafficking of these particles requires a low intra -endosomal pH if there is to be a successful infection with AAV218, 221223. Following uptake and entry of the AAV into the cytosol, the virus then localizes within the nucleus in the span of 2 hours218. At this point, depending on whether or not super infection with helper virus has occurred, the AAV genome either assumes a lysogenic or lytic infection. During permissive states replication of AAV DNA occurs via a single -strand displacement mechanism224, 225. Recombinant AAV vector technology, which is used in gene transfer experiments, derives from wild type AAV genomes that are devoid of the cap and rep coding regions. These genes are replaced by reporter or therapeutic transgenes with flanking ITRs. For vector production, the cap and rep genes are instead provided in trans This permits the insertion of any transgene into this deleted coding region of the wild type genome, provided that it stays within a size limit of 4.7 kb. AAV is an excellent vector system for gene based therapy due to several features unique to the virus. O ne advantage of AAV is its modest recognition by cytotoxic T lymphocytes in comparison to most other viral vectors226228. This fact may have to do with the exchange of viral genome with nonimmunogenic transgenes or the lack of infection of antigenpresenting cells229. Low recognition by T -cells permits the extended existence of the vector genome without decreased transgene expression. Furthermore, because AAV is relatively unaffected by cellular defense mechanisms that inhibit other vector syste ms, tissue -specific as well as inducible promoters, when placed under appropriate conditions ( i.e., expression in

PAGE 45

45 appropriate cell type and presence/absence of inducer), overall transgene expression can be maintained long term. Moreover, rAAV can transduc e non -dividing and terminally differentiated tissues in an in vivo setting, an advantage compared to retrovirus vectors. The advantage of AAV compared to retroviruses includes the ability of AAV to establish episomal latency. Without the rep genes, inste ad of the genome incorporating itself into chromosome 19 via site -specific integration, rAAV exists as a circular, double stranded DNA episome230 233. In this way, rAAV can presumably persist in terminally differentiated non -proliferating cells because there is no dilut ion of the episome with successive cell divisions. This episomal feature attributed to rAAV may also serve to limit potential cancerous effects by limiting insertional mutagenesis that would otherwise be a concern with random integration of vector DNA int o human chromosomes. Further modification of rAAV tropism by creating hybrid vectors has served to enhance the efficiency of gene transfer by combining desirable qualities from various serotypes. The first example of vector modification involved the ads orption of receptor ligands to the rAAV capsid surface. Retargeting AAV via this method requires the use of antibodies to AAV chemically linked to another antibody that binds specifically to cellular receptors of target tissues212, 234, 235. Another strategy for creating hybrid serotypes involves a technique called transcapsidation. ITRs from one serotype, usually AAV2, is packaged into the capsid of anothe r serotype. This tactic has been quite effective in increasing titers containing cross -packaged vectors when a chimeric rep protein is formed from AAV2 and the serotype -specific capsid236. Mosaic capsid formation is another strategy used to improve retargeting AAV to non -permissive cell types. In this case the AAV virion is composed of a mixture of viral capsid proteins from different serotypes. The process of creating mosaic capsid involves complementation with separate

PAGE 46

46 plasmids and then mixing at varying ratios. At the stage of virion construction, the different serotypes capsid proteins are assembled in stoichiometric ratios similar to the mixing ratios of the complementing plasmids. This approach has proven to be successful in combining the binding properties of more than one serotype237. An additional means for establishing rAAV transduction into non -permissive tissues is through the creation of chimeric capsid virions. This process requires the in sertion of foreign protein sequences, either from a different AAV serotype or an unrelated protein into the ORF of the capsid gene217, 238. This technology demonstrates large versatility in creating different combinatorial hybrids. Chimeric capsid proteins can be used to combine naturally occurring serotypes as templates or fuse an epitope coding sequence to the N or C terminus of the capsid coding sequence. In addition to modifying capsid structure, the rAAV genome has also been altered in order to develop a new class of rAAV vectors so that overall viral transduction efficiency can be improved. Rate limiting steps such as the generation of complementary-s trand DNA and the recruitment of components needed for strand synthesis impedes AAV transduction efficiency following vial uncoating239. The aim with these new vector ty pes is to increase the rate of transduction by developing genome structures that are half the wild type size in order to create self complementary inverted repeat DNA molecules which can be packaged into the AAV virion (scAAV). This has the advantage that since the recombinant genome is now immediately double stranded in the nucleus, host proteins normally needed for conversion of the AAV genome from a single strand to a double strand before transcription would be eliminated 240. In terms of its transducing efficiency scAAV demonstrated a 5 to 140 fold increase compared to the conventional rAAV particle when analyzed in an in vitro setting240. Moreover, when scAAV expression of erythropoietin was compared to conventional r AAV expression, in vivo hematocrit

PAGE 47

47 level rose more rapidly and higher with the scAAV vector than the rAAV vector240. In a 2008 article, Natkunarajah et al. found that when comparing single stranded AAV (ssAAV) vectors of serotypes 2/2, 2/5, and 2/8 to scAAV constructs, the scAAV vectors transduced murine photoreceptor and RPE cells more efficiently241. Additionally, the scAAV vector demonstrated faster onset as well as higher transgene expression levels compared to the ssAAV vectors241. With the my riad of attractive features associated with AAV it continues to serve as one of the best vector system for gene therapy. Drug Inducible Systems One of the major objectives of gene therapy is to deliver genes to tissues and produce natural proteins at the rapeutic levels for an extended period of time. However, what is equally important with such an aim is to control the timing and levels of gene expression in order to maintain safety and efficacy. The dilemma with most therapeutic models is that there is constitutive expression of the transgene. This is problematic because there is enormous potential for causing undesirable side effects if the transgene is over -produced. Notwithstanding the toxicity that is associated with transgene over -production, the re is also the issue of toxicity related to prolonged exposure to the gene product. With a gene therapy model that utilizes a constitutive promoter system the problem of protracted expression beyond the therapeutic needs of the patient becomes inevitable and unavoidable. For these reasons, as well as the need to avoid potential toxicity or side effects, it is necessary to establish an externally regulatable gene expression system that can addresses the issue of transgene protein over -production. Drug inducible systems have the capability to establish quantitative and temporal control of gene expression. In addition to minimizing side effects due to over -production and prolonged exposure, drug inducible systems can also maintain protein product level wit hin the therapeutic window. These systems allow for possible adjustments to therapeutic levels so that treatment

PAGE 48

48 can be set to an individual patient basis. In order for a drug inducible system to meet the needs of a gene therapy application, several impo rtant criteria need to be satisfied. When the systems allow gene expression, the drug inducible system should exhibit highly induced levels of target gene expression, and when shifted to restrict gene expression, the system should show little or no basal expression. There should be specificity built into the system so that there is no response to endogenous molecules, only to the unique drug inducer. Moreover there should be a dose dependent component associated with the system so that therapeutic level s can be adjusted when inducer levels are modulated. There are numerous drug inducible systems available that have some potential of meeting the challenges for gene therapy. Some of the more notable systems include: the dimerizer based rapamycin system242, ecdysone system243, antiprogestin system244, the Tet -on system245, and the drug inducible hammerhead ribozyme ( i.e. riboswitch) method246. Except for the riboswitch, in order for these systems to influence gene expression, formation of c himeric transactivators is necessary. These chimeric activators combine functional domains from bacterial, eukaryotic, and viral proteins. Embedded within these transactivators are functional elements that interact with small -molecule inducing compounds a transactivation domain, and a DNA -binding domain which conveys no cross -reactivity with endogenous cellular sequences. The other core component of these systems is an inducible promoter. This promoter contains a minimal proximal promoter sequence linked downstream to repeat of the transactivator recognition sequence. Therefore, with the presence of an inducer, the chimeric transcription factor specifically binds to its DNA recognition sequence within the inducible promoter thereby transactivating exp ression of the target gene.

PAGE 49

49 The drug -inducible hammerhead ribozyme (riboswitch) method is a fairly new system discovered by the Yen et al. which provides an alternative mechanism for gene regulation246. The system employs a self -cleaving hammerhead ribozyme sequence entrenc hed within the messenger ribonucleic acid (mRNA) of the gene transcript. In the presence of the drug inducer the ribozymes self -cleaving function is inhibited and the mRNA transcript is translated into the protein product. However, in the absence of ind ucer, the ribozyme resumes its self -cleaving function thus digesting the mRNA into two fragments that are eliminated by specific cellular pathways. The original ribozyme in this system was isolated from the genome of Schistosoma mansoni247 and then later modified, via structural alteration as well as sequence positioning, by Yen et al. in order to enhance the ribozyme cleavage properties and maintain functionality in physiological conditions246. The inducibility of this system stems from the ability of nucleoside analogues to inhibit the activity of this ribozyme248. The presence of the nucleoside analogues in the mRNA sequence of the ribozyme may act to either inhibit that catalytic core function or prevent the formation of the secondary hammerhead structure needed for proper functionality. In the absence of inducers, the ribozyme assumes its natural structure and function and self cleavage leads to therapeutic mRNA destruction. The extent of gene expression, when analyzed under in vitro and in vivo settings, has been shown to be comparable to levels achieved with other systems246, 248. Gene modulation is a constantly expanding field with newer generation riboswitch molecules enhancing our ability to engineer therapeutic models necessary for dealing with human health issues. Current research endeavors have sought to generate extensible RNA -based frameworks in order to establish riboswitch systems capable of demonstrating adjustable regu lation, design modularity, and precision targeting249. Investigation into this area helps to

PAGE 50

50 esta blish reliable and modular assembly mechanisms for the creation of synthetic RNA sensor domains as well as improved regulation of ribozyme activity in response to effector molecules249. These new RNA -based platform engineering paradigms seek to address design issues such as scalability, portability, utility, composability, and reliability when constru cting the riboswitch molecule. Successful development of in vivo riboswitch systems will further advance the ability to implement small molecule -mediated regulation of biological systems with a potential benefit of averting disease occurrence. The int ent of this dissertation project is to test the capability of drug inducible systems to regulate expression of an anti -neovascularity gene in order to ameliorate CNV. The major setback for current wet AMD treatment is the short -term alleviation of neovasc ular lesions due to the ephemeral half life of the anti -VEGF drug therapy. The need for frequent ocular injections of anti -VEGF drugs can increase the occurrence of adverse conditions, such as endophthalmitis, causing further detriment to vision. This pr oject addresses the need for a more sustainable treatment option for wet AMD by utilizing a gene therapy approach. The use of gene therapy as a means to deal with wet AMD is not a novel tactic in its individual elements 84, 97, 99, 250. Rather, this project is designed to combine a unique combination of such elements to exploit the drug inducible gene regulation systems in order to diminish CNV. In this situation, drug induci ble regulation adds a new aspect to the temporal control to AAV vectored gene expression. This can improve the availability of the therapeutic gene product during disease onset without the need for multiple ocular injections. The hypothesis of this proje ct is that riboswitch gene expression modulation of the anti -neovascular gene, sFlt 1, will establish comparable CNV reduction when contrasted to regulation by a standard constitutive promoter system, chicken beta actin (CBA). The project goals will be three fold: First, construct the riboswitch plasmids containing the GFP

PAGE 51

51 reporter and sFlt 1 anti -neovascular cassettes. Second, compare the performance of the riboswitch plasmid to the CBA plasmid by evaluating transgene expression via in vitro and in vivo analyses. Third, upon packaging the constructs into rAAV vectors, compare CNV reduction, in a laser CNV murine model, for animals treated with rAAV vectors expressing sFlt 1 regulated either by the riboswitch or the control CBA promoter -driven system.

PAGE 52

52 CHAPTER 2 RIBOSWITCH VECTOR DESIGN AND CONSTRUCTION Ribozyme Insert Acquisition and Preparation Construction of the riboswitch vector regulating sFlt 01 expression was based on the plasmid model developed by the Yen et. al. group246. Specifically, th e N117 hammerhead ribozyme variant (rN117) was chosen because it demonstrated the greatest repression of gene expression246. This is particularly important for assuring tight control over basal gene expression. The inducible hammerhead ribozyme cDNA was amplified from the pFBN 117 vector provided by Dr. Laising Yen (Department of Genetics, Harvard Institute of Human Genetics) and supplied by Dr. Sergei Zolotukhin (Powell Gene Therapy Center, University of Florida (Fig. 2 1). Figure 2 1 Diagram of the pFBN117 plasmid containing the rN117 inducible hammerhead ribozyme sequence. The ribozyme sequence is situated within the multiple cloning site (MCS). The plasmid also contains the SV40 poly adenylation signal, two transposon sequences, be ta lactamase coding region, gentamicin resistance gene and eukaryotic promoter region pFBN1174846 bp bla GM(R) F1 intergenic region rN117 SV40 poly(A) polh promoter Tn7R Tn7L Bam HI (4809) Eco RI (4831) Not I (91) Xho I (120) Sal I (1)

PAGE 53

53 The strategy set out for this cloning project was to insert the ribozyme cDNA into the 5 untranslated region (5UTR) of the sFlt 01 gene in the pTR -UF -SB -sFlt 01 plasmi d (Fig. 2 2). The pTR -UF -SB -sFlt 01 plasmid is a standard plasmid utilized by the Hauswirth research group (Dept. of Ophthalmology, University of Florida) that allows for constitutive expression of the sFlt 01 gene. In this project it also served as the positive control in order to compare the expression profile of the drug inducible systems to that of the CMV -beta actin (CBA) promoter system. Inclusion of a single hammerhead ribozyme in the 5'UTR established the single riboswitch construct while inserti on of two hammerhead ribozymes in tandem orientation created the double riboswitch plasmid. In the pFBN117 plasmid the rN117 ribozyme is situated between several restriction sites. Unfortunately, none of the restriction sites flanking the ribozyme, in the pFBN117 plasmid, were compatible with the restriction sites available in the 5UTR of the sFlt 01 locus in the pTR -UF SB -sFlt 01 plasmid. In order to insert the ribozyme sequences into the 5 UTR position, primers (Integrated DNA Technologies, Inc.) wer e used for PCR amplification in order to place appropriate restriction sites at the 5 and 3 flanking regions of the ribozyme sequence. Two versions of the riboswitch plasmids ( i.e. single and double) were created based on the number of rN117 cassettes p laced in the 5UTR of the transgene. In these two plasmids, the rN117 cassette would have two different flanking restriction sites. For one of the rN117 cassettes the sense primer: 5 CC -CTCGAG CTGAGATGCAGGTACATCCC 3, contained a clamp region consisting of two cytosines, an adjacent sequence encoding the XhoI restriction site, and complementary sequences to the 5 region of the hammerhead ribozyme sequence. The anti -sense primer: 5 AAGCGGCCGC GTGGATAGCA 3 also contained a clamp region of two adenine nucleotides, the Not I restriction site sequence, and the complementary nucleotide to the 3 hammerhead ribozyme sequence. As for the other cassette the sense strand: 5 CC -

PAGE 54

54 ACGCGT CTGAGATGCAGGTACATCCC 3 and the anti -sense primer: 5 AA -CTCGAG GTGGATAGCAGTGGAATCCC both contain similar clamp regions and corresponding complimentary hammerhead ribozyme sequence. The only difference between these two primers is that the sense primer contains the MluI restriction site following the two cytosine clamp nucleotid es while the anti -sense primer contains the XhoI restriction site following the two adenine clamp sequences (Fig. 2 3). Figure 2 2 Plasmid vector possessing the sFlt 01 anti -neovascular gene. Illustrated in this diagram are the inverted terminal repe ats, the immediate early CMV enhancer/Chicken beta actin promoter region, sFlt 01 coding region, ampicillin resistance gene and the ColE1 and f1(+) replication origin sites. pTR-UF-SB-sFlt-016241 bp Amp r sFlt-01 CMV ie enhancer Intron TR TR SV40 poly(A) Chiken b-actin promoter ColE1 ori f1(+) origin Exon1

PAGE 55

55 Figure 2 3 Map of the rN117 inducible hammerhead ribozyme sequence with PCR s ense and antisense primers indicated Top diagram shows the rN117 sequence with XhoI sense and NotI antisense primer sequences. Bottom diagram depicts the rN117 sequence with the MluI sense and XhoI antisense primer sequences. The Advantage HF PCR Kit (BD Biosciences) was used to amplify the rN117 cDNA. The primer oligonucleotides were diluted to a concentration of 1 pmol/L in ddH2O and added to the PCR reaction master mix at 1 L per primer. Five microliters of the pFBN117 plasmid, at a concentratio n of 0.02 g/L, was also added as template DNA to the PCR reaction mix. The PCR reaction began with an initial 3 min of template separation at 95C. Subsequent to this initial denaturing stage, the template DNA was allowed further denaturation at 95C f or 1 min while PCR primers were allowed to anneal to complementary strands at 57C for 1 min. Following annealing, DNA extension was permitted to for 1 min at 72C. The PCR process starting from the 1 min of denaturing to the 1 min of extension cycled 35 times. Afterwards a final extension time of 15 min was permitted. At the conclusion of the process the newly amplified DNA was allowed to incubate at 25C. The rN117 PCR products were analyzed on agarose gel (2%) and found to migrate to the correct band size of approximately 100 bp (Fig. 24). PCR-N117-XhoI/NotI101 bp rN117 SENSE PRM ANTISENSE PRM Not I (94) Xho I (4) PCR-N117-MluI/XhoI99 bp rN117 SENSE PRM ANTISENSE PRM Mlu I (4) Xho I (93)

PAGE 56

56 Figure 2 4 PCR amplified rN117cDNA. Samples were mixed with DNA loading dye and r u n on a 2% agarose gel at 120 volts for 2.5 hours. The running buffer used was Tris -borate EDTA (TBE). Lane 1 represents the 1KB plus DNA ladder from Invitrogen, in which the bottom band is 100 bp Ribozyme Insert Subcloning The rN117 with flanking XhoI and NotI restriction sites was then ligated into the pCR 4 Topo vector (Invitrogen) (Fig.25). Sub-cloning of this PCR product was performed based on the pCR 4 Topo vector kit instructions. TOPO 10 chemically competent Escherichia coli (E. coli) cells w ere used to amplify the sub-cloning vector. The transformed bacteria were serially diluted and plated onto heat sterilized Luria Broth (LB) ampicillin agar selection plates. After an overnight incubation of the selections plates containing the transform ed bacteria, individual colonies were selected and then placed into LB liquid cultures. Vector DNA was extracted via QIAprep Spin Miniprep Kit (Qiagen) after an incubation time of 12 16 h of the liquid cultures. To check for proper insertion of the cDN A, restriction digestion of the sub -cloning vector with EcoRI was performed. EcoRI was selected after realizing that the NotI site was not unique to the rN117XhoI/NotI insert. Moreover, EcoRI sites flank the insert site area in the pCR Blunt vector. Th is facilitated the removal of the rN117 insert with a single restriction enzyme thus 1 KB plus DNA Ladder rN117 MluI/XhoI rN117 XhoI/NotI

PAGE 57

57 avoiding issues of incapatability of restriction enzyme buffers. The digested DNA was evaluated on 2% agarose gel (Fig.2 6). Figure 2 5 S ubcloning vector containing the rN117 ribozyme. The rN117 sequence was cloned into the MCS of the pCR 4 TOPO subcloning vector (Invitrogen). The restriction sites XhoI and NotI are found upstream and downstream at positions 298 and 388 respectively. Figure 2 6 Digestion of the ligated rN117 sequence to the pCR 4 TOPO subcloning vector. The plasmid clones were digested with the EcoRI restriction enzyme Samples were mixed with DNA loading dye and r u n on a 2% agarose gel at 120 volts for 2.5 hours. The running buffer was 1x TBE. pCR-4-TOPO-XhoI/NotI4057 bp Kan Resis Amp Resis SENSE PRM ANTISENSE PRM M13-rev T3 T7 M13-for Plac pUC Ori rN117-XhoI/NotI Xho I (298) Eco RI (284) Eco RI (403) Not I (388) Not I (410) 1 KB plus DNA TOPO rN 117: XhoI, 10 bp DNA L adder TOPO rN117: XhoI, TOPO rN117: XhoI,

PAGE 58

58 The other rN117 PCR product possessing the MluI and XhoI flanking restriction sites was also gel extracted, purified and then inserted into the pPCR Script Amp SK (Stratagene) sub -cloning vector. The DNA was then transformed into chemi cally competent Topo 10 E. coli cells (Invitrogen) and then plated onto LB ampicillin agar plates. Once an overnight incubation of the plates was completed liquid LB cultures were inoculated with single bacterial colonies. Newly formed pPCR -Script Amp SK -MluI/XhoI vectors were purified with a Miniprep kit (Qiagen). Plasmid clones that were obtained were then evaluated for sequence mutation of the rN117 insert. Following sequence analysis (ICBR -BiotechnologyDNA sequencing lab, University of Florida) pl asmid clone sequences were compared with a computer constructed model of the sub-cloning vector containing the rN117 insert. Figure 2 7 shows the clones that demonstrated 100% similarity with the computer generated construct model. Figure 2 7 Alignment of clones containing the rN117 sequence ligated to pPCR -Script Amp SK subcloning vector. The top portion of the diagram depicts the map for the ligated pPCR Script Amp SK rN117MluI/XhoI plasmid. The bottom portion of the diagram shows the p lasmid clone sequences aligned with the pPCR -Script Amp SK rN117MluI/XhoI plasmid. Sequences depicted in yellow represent 100% similarity to the consensus sequence. Blue indicates variations in sequence for one or more clones with the consensus sequence. Highlighted in the diagram are the T7 primer sequence (purple), the MluI and XhoI restriction sites (light green and dark green respectively) and the rN117 ribozyme cDNA (blue). pPCR-Script Amp SK-MluI/XhoI3060 bp lac promoter AMP resist f1 (+) ori rN117-MluI/XhoI T7 promoter T3 pUC ori Bam HI (720) Eco RI (702) Sma I (716) Mlu I (732) Not I (838) Sal I (675) Xho I (669) Xho I (821)

PAGE 59

59 Figure 2 7. Continued 1640 1747 1650 1660 1670 1680 1690 1700 1710 1720 1730 (1640) Ferguson_MX I_T7 (975) A C A C G A C T T A T C G C A C T G G C A G C A G C C A C T G G T A A C A G G A T T A G C A G A G C G A G T A T G T A G C G T G C T A C A G A G T T T C T G A G T T G Ferguson_MX J_T7 (995) A C A C G A C T T A T C G C C A C T G G C A G C A G C C A C T G G T A A C A G G A T T A G C A G A G C G A G G T A T G T A G G C G G T G C T A C A G A G T T C T T G A A G T G G T G G C C T A A C T A C G G C T A C A C pPCR Script Amp SK MluI/XhoI (1640) A C A C G A C T T A T C G C A C T G G C A G C A G C C A C T G G T A A C A G G A T T A G C A G A G C G A G T A T G T A G G T G C T A C A G A G T T T G A T G Consensus (1640) 1540 1647 1550 1560 1570 1580 1590 1600 1610 1620 1630 (1540) A G G T C G T T C G C T C C A A G C T G G G C T G T G T G C A C G A A C C C C C C G T T C A G C C C G A C C G C T G C G C C T T A T C C G G T A A C T A T C G T C T T G A G T C Ferguson_MX I_T7 (887) A G G T C G T T C G C T C C A A G C T G G G C T G T G T G C A C G A A C C C C C C G T T C A G C C C G A C C G C T G C G C C T T A T C C G G T A A C T A T C G T C T T G A G T C C A A C C C G G T A A G A C A C G A C T Ferguson_MX J_T7 (895) A G G T C G T T C G C T C C A A G C T G G G C T G T G T G C A C G A A C C C C C C G T T C A G C C C G A C C G C T G C G C C T T A T C C G G T A A C T A T C G T C T T G A G T C C A A C C C G G T A A G A C A C G A C T pPCR Script Amp SK MluI/XhoI (1540) A G G T C G T T C G C T C C A A G C T G G G C T G T G T G C A C G A A C C C C C C G T T C A G C C C G A C C G C T G C G C C T T A T C C G G T A A C T A T C G T C T T G A G T C C A A C C C G G T A A G A C A C G A C T Consensus (1540) 1440 1547 1450 1460 1470 1480 1490 1500 1510 1520 1530 (1440) G T T C C G A C C C T G C C G C T T A C C G G A T A C C T G T C C G C C T T T C T C C C T T C G G G A A G C G T G G C G C T T T C T C A T A G C T C A C G C T G T A G G T A T C T C A G T T C G G T G T A G G T C G T T Ferguson_MX I_T7 (787) G T T C C G A C C C T G C C G C T T A C C G G A T A C C T G T C C G C C T T T C T C C C T T C G G G A A G C G T G G C G C T T T C T C A T A G C T C A C G C T G T A G G T A T C T C A G T T C G G T G T A G G T C G T T Ferguson_MX J_T7 (795) G T T C C G A C C C T G C C G C T T A C C G G A T A C C T G T C C G C C T T T C T C C C T T C G G G A A G C G T G G C G C T T T C T C A T A G C T C A C G C T G T A G G T A T C T C A G T T C G G T G T A G G T C G T T pPCR Script Amp SK MluI/XhoI (1440) G T T C C G A C C C T G C C G C T T A C C G G A T A C C T G T C C G C C T T T C T C C C T T C G G G A A G C G T G G C G C T T T C T C A T A G C T C A C G C T G T A G G T A T C T C A G T T C G G T G T A G G T C G T T Consensus (1440) 1340 1447 1350 1360 1370 1380 1390 1400 1410 1420 1430 (1340) G C A T C A C A A A A A T C G A C G C T C A A G T C A G A G G T G G C G A A A C C C G A C A G G A C T A T A A A G A T A C C A G G C G T T T C C C C C T G G A A G C T C C C T C G T G C G C T C T C C T G T T C C G A C Ferguson_MX I_T7 (687) G C A T C A C A A A A A T C G A C G C T C A A G T C A G A G G T G G C G A A A C C C G A C A G G A C T A T A A A G A T A C C A G G C G T T T C C C C C T G G A A G C T C C C T C G T G C G C T C T C C T G T T C C G A C Ferguson_MX J_T7 (695) G C A T C A C A A A A A T C G A C G C T C A A G T C A G A G G T G G C G A A A C C C G A C A G G A C T A T A A A G A T A C C A G G C G T T T C C C C C T G G A A G C T C C C T C G T G C G C T C T C C T G T T C C G A C pPCR Script Amp SK MluI/XhoI (1340) G C A T C A C A A A A A T C G A C G C T C A A G T C A G A G G T G G C G A A A C C C G A C A G G A C T A T A A A G A T A C C A G G C G T T T C C C C C T G G A A G C T C C C T C G T G C G C T C T C C T G T T C C G A C Consensus (1340) 1240 1347 1250 1260 1270 1280 1290 1300 1310 1320 1330 (1240) A C G C A G G A A A G A A C A T G T G A G C A A A A G G C C A G C A A A A G G C C A G G A A C C G T A A A A A G G C C G C G T T G C T G G C G T T T T T C C A T A G G C T C C G C C C C C C T G A C G A G C A T C A C A Ferguson_MX I_T7 (587) A C G C A G G A A A G A A C A T G T G A G C A A A A G G C C A G C A A A A G G C C A G G A A C C G T A A A A A G G C C G C G T T G C T G G C G T T T T T C C A T A G G C T C C G C C C C C C T G A C G A G C A T C A C A Ferguson_MX J_T7 (595) A C G C A G G A A A G A A C A T G T G A G C A A A A G G C C A G C A A A A G G C C A G G A A C C G T A A A A A G G C C G C G T T G C T G G C G T T T T T C C A T A G G C T C C G C C C C C C T G A C G A G C A T C A C A pPCR Script Amp SK MluI/XhoI (1240) A C G C A G G A A A G A A C A T G T G A G C A A A A G G C C A G C A A A A G G C C A G G A A C C G T A A A A A G G C C G C G T T G C T G G C G T T T T T C C A T A G G C T C C G C C C C C C T G A C G A G C A T C A C A Consensus (1240) 1140 1247 1150 1160 1170 1180 1190 1200 1210 1220 1230 (1140) T C C T C G C T C A C T G A C T C G C T G C G C T C G G T C G T T C G G C T G C G G C G A G C G G T A T C A G C T C A C T C A A A G G C G G T A A T A C G G T T A T C C A C A G A A T C A G G G G A T A A C G C A G G A Ferguson_MX I_T7 (487) T C C T C G C T C A C T G A C T C G C T G C G C T C G G T C G T T C G G C T G C G G C G A G C G G T A T C A G C T C A C T C A A A G G C G G T A A T A C G G T T A T C C A C A G A A T C A G G G G A T A A C G C A G G A Ferguson_MX J_T7 (495) T C C T C G C T C A C T G A C T C G C T G C G C T C G G T C G T T C G G C T G C G G C G A G C G G T A T C A G C T C A C T C A A A G G C G G T A A T A C G G T T A T C C A C A G A A T C A G G G G A T A A C G C A G G A pPCR Script Amp SK MluI/XhoI (1140) T C C T C G C T C A C T G A C T C G C T G C G C T C G G T C G T T C G G C T G C G G C G A G C G G T A T C A G C T C A C T C A A A G G C G G T A A T A C G G T T A T C C A C A G A A T C A G G G G A T A A C G C A G G A Consensus (1140) 1040 1147 1050 1060 1070 1080 1090 1100 1110 1120 1130 (1040) A C T G C C C G C T T T C C A G T C G G G A A A C C T G T C G T G C C A G C T G C A T T A A T G A A T C G G C C A A C G C G C G G G G A G A G G C G G T T T G C G T A T T G G G C G C T C T T C C G C T T C C T C G C T Ferguson_MX I_T7 (387) A C T G C C C G C T T T C C A G T C G G G A A A C C T G T C G T G C C A G C T G C A T T A A T G A A T C G G C C A A C G C G C G G G G A G A G G C G G T T T G C G T A T T G G G C G C T C T T C C G C T T C C T C G C T Ferguson_MX J_T7 (395) A C T G C C C G C T T T C C A G T C G G G A A A C C T G T C G T G C C A G C T G C A T T A A T G A A T C G G C C A A C G C G C G G G G A G A G G C G G T T T G C G T A T T G G G C G C T C T T C C G C T T C C T C G C T pPCR Script Amp SK MluI/XhoI (1040) A C T G C C C G C T T T C C A G T C G G G A A A C C T G T C G T G C C A G C T G C A T T A A T G A A T C G G C C A A C G C G C G G G G A G A G G C G G T T T G C G T A T T G G G C G C T C T T C C G C T T C C T C G C T Consensus (1040) 940 1047 950 960 970 980 990 1000 1010 1020 1030 (940) A T C C G C T C A C A A T T C C A C A C A A C A T A C G A G C C G G A A G C A T A A A G T G T A A A G C C T G G G G T G C C T A A T G A G T G A G C T A A C T C A C A T T A A T T G C G T T G C G C T C A C T G C C C G Ferguson_MX I_T7 (287) A T C C G C T C A C A A T T C C A C A C A A C A T A C G A G C C G G A A G C A T A A A G T G T A A A G C C T G G G G T G C C T A A T G A G T G A G C T A A C T C A C A T T A A T T G C G T T G C G C T C A C T G C C C G Ferguson_MX J_T7 (295) A T C C G C T C A C A A T T C C A C A C A A C A T A C G A G C C G G A A G C A T A A A G T G T A A A G C C T G G G G T G C C T A A T G A G T G A G C T A A C T C A C A T T A A T T G C G T T G C G C T C A C T G C C C G pPCR Script Amp SK MluI/XhoI (940) A T C C G C T C A C A A T T C C A C A C A A C A T A C G A G C C G G A A G C A T A A A G T G T A A A G C C T G G G G T G C C T A A T G A G T G A G C T A A C T C A C A T T A A T T G C G T T G C G C T C A C T G C C C G Consensus (940) 740 847 750 760 770 780 790 800 810 820 830 (740) A G A T G C A G G T A C A T C C C A C T G A T G A G T C C C A A A T A G G A C G A A A C G C G C T T C G G T G C G T C T G G G A T T C C A C T G C T A T C C A C C T C G A G T T G G G C T A G A G C G G C C G C C A C C Ferguson_MX I_T7 (87) A G A T G C A G G T A C A T C C C A C T G A T G A G T C C C A A A T A G G A C G A A A C G C G C T T C G G T G C G T C T G G G A T T C C A C T G C T A T C C A C C T C G A G T T G G G C T A G A G C G G C C G C C A C C Ferguson_MX J_T7 (95) A G A T G C A G G T A C A T C C C A C T G A T G A G T C C C A A A T A G G A C G A A A C G C G C T T C G G T G C G T C T G G G A T T C C A C T G C T A T C C A C C T C G A G T T G G G C T A G A G C G G C C G C C A C C pPCR Script Amp SK MluI/XhoI (740) A G A T G C A G G T A C A T C C C A C T G A T G A G T C C C A A A T A G G A C G A A A C G C G C T T C G G T G C G T C T G G G A T T C C A C T G C T A T C C A C C T C G A G T T G G G C T A G A G C G G C C G C C A C C Consensus (740) 639 746 650 660 670 680 690 700 710 720 730 (639) T G G G T C C C G G G C C C C C C T C G A G T C G C G G T A T C G A T A A G C T T G A T A T C G A A T T C C T G C A G C C C G G G G G A T C C G C C C C C A C G C G T C T G A G A T G C A Ferguson_MX I_T7 (1) C G G G A T T G G G C C C C G G G C C C C C C C C T C G G G T C G C G G T A T C G A T A A G C T T G A T A T C G A A T T C C T G C A G C C C G G G G G A T C C G C C C C C A C G C G T C T G A G A T G C A Ferguson_MX J_T7 (1) T A T A G G G C G A A T T G G G T A C C G G G C C C C C C C T C G A G G T C G A C G G T A T C G A T A A G C T T G A T A T C G A A T T C C T G C A G C C C G G G G G A T C C G C C C C C A C G C G T C T G A G A T G C A pPCR Script Amp SK MluI/XhoI (639) G A T T G G G T C C C G G G C C C C C C C T C G G G T C G C G G T A T C G A T A A G C T T G A T A T C G A A T T C C T G C A G C C C G G G G G A T C C G C C C C C A C G C G T C T G A G A T G C A Consensus (639)

PAGE 60

60 Intermediate Plasmid Construction Following rN117 band identification via agarose gel electrophoresis, the ribozyme cDNA fragment containing the X hoI/NotI flanking sites was then excised and purified using the QIAquick Gel Extraction Kit (Qiagen). Instead of directly inserting the ribozyme into the pTR UF SB -sFlt 01 plasmid, the cDNA was placed into the pTR -UF SB construct. The intention behind this cloning procedure was to establish an intermediary plasmid, pTR -UFSB -XN (Fig. 2 8), that would allow for the placement of transgenes downstream of the rN117 sequence. The transgene insert would have NotI sequences at both the 5 and 3 ends, so that insertions could be made in the pTR -UF SB -XhoI/NotI plasmid using NotI digestion. In order to create this intermediary plasmid, the pTR -UF SB plasmid was double digested with the XhoI and NotI restriction enzymes to open up the plasmid for ribozyme ligati on. Afterwards, the digest was analyzed via 1.2 % agarose gel electrophoresis. The plasmid fragment band was removed by gel extraction and then purified (Qiagen) (Fig. 29). Figure 2 8 Depiction of the pTR -UF SB -XhoI/NotI plasmid. The map shows the inverted terminal repeats, the CMV immediate early enhancer/chicken beta actin promoter, rN117 coding region flanked by the multiple restrictions sites including the XhoI (1921) and NotI (2011) sites. Also the f1(+) and ColE1 replication origin sites and ampicillin resistance gene are portrayed in this plasmid map. pTR-UF-SB-XhoI/NotI5233 bp Amp r CMV ie enhancer Intron TR TR SV40 poly(A) Chiken b-actin promoter ColE1 ori f1(+) origin rN117-XhoI/NotI Exon1 Bam HI (2020) Mlu I (1915) Not I (2011) Xho I (1921) Sal I (2218) Eco RI (173) Eco RI (1893) Sma I (88) Sma I (99) Sma I (2303) Sma I (2314)

PAGE 61

61 Figure 2 9 Digestion of the pTR -UFSB plasmid. Represented in lane 2 of this gel is the uncut pTR -UFSB plasmid and in Lanes 4 and 6 the pTR -UFSB plasmid digested with XhoI and NotI restrictions enzymes. Samples were mixed with DNA loading dye and ran on a 1.2% agarose gel at 120 volts for 1.5 hours. The running buffer was TBE. For ligation 10x ligation buffer (Promega), T4 DNA ligase (Promega), and a three to one ratio of ribozyme insert to plasmid vector was used. The mixture was allowed to incubate over night at 16C. The next day the ligation mixture was cleaned of the ligation reagents using the DNA Clean & Concent ratorTM 5 (Zymo Research). Following ligation, electroporation competent E. coli SURE cells (Stratagene) were transformed with a 1 to 10 dilution of the newly ligated clean and concentrated plasmid DNA via electroporation. The transformed bacteria were s erially diluted and plated onto heat sterilized Luria Broth (LB) ampicillin agar selection plates. In this ligation scenario, the chances of pTR -UF -SB self ligation are low because of the incompatibility of the digested plasmid ends. This particular clon ing project is considered directional because ligation can only occur in one orientation. Plasmid proliferation can only occur if vector and insert are properly ligated. Thus, once bacterial colonies are identified plasmid screening for proper insert or ientation or plasmid auto ligation is not necessary. Multiple colonies were selected at random and used to make several large scale liquid bacterial 1 KB plus DNA Ladder pTR UFSB: uncut pTR UFSB: XhoI, NotI

PAGE 62

62 cultures in LB medium including ampicillin. These large bacterial culture preps were allowed to incubate overnight at 37C. Plasmid DNA was then extracted from 3 mL of the culture media via the Qiagen Miniprep Kit (Qiagen). The plasmid DNA clones were then sent out for sequencing (ICBR -BiotechnologyDNA sequencing lab, University of Florida). Primer olig onucleotides (Integrated DNA Technologies, Inc.) intended for sequencing, were designed to flank the multiple cloning sight of the pTR -UF SB plasmid where the rN117 fragment, containing the XhoI and NotI sites, was inserted (Fig. 2 10). The sequence resul ts showed that the rN117 insert did not contain any mutations (Fig. 211). The plasmid clone sequence was compared to a computer generated pTR -UF -SB -XhoI/NotI construct via the Vector NTI AlignX program (Invitrogen). Figure 2 10 Diagram of the sequencing primers for the pTR -UFSB plasmid. Depicted in this diagram are the sense and antisense primers as well as the pTR -UFSB plasmid containing the MCS region. pCR-UF-SB223 bp UFSB Antisense UFSB Sense Bam HI (128) Eco RI (84) Mlu I (106) Not I (119) Xho I (112)

PAGE 63

63 pTR-UF-SB-XhoI/NotI5233 bp Amp r CMV ie enhancer Intron TR TR SV40 poly(A) Chiken b-actin promoter ColE1 ori f1(+) origin rN117-XhoI/NotI Exon1 Mlu I (1915) Not I (2011) Xho I (1921) Eco RI (173) Eco RI (1893) Sma I (88) Sma I (99) Sma I (2303) Sma I (2314) 1886 2024 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 (1886) G G C A A A G A A T T C C T C G A A G A T C T A G G C A A C G C G T C T C G A G C T G A G A T G C A G G T A C A T C C C A C T G A T G A G T C C C A A A T A G G A C G A A A C G C G C T T C G G T G C G T C T G G G A T T C C A C T G C T A T C C A C G C G G C C G C G C G G A T C C pTR UF SB XhoI/NotI (1886) G G C A A A G A A T T C C T C G A A G A T C T A G G C A A C G C G T C T C G A G C T G A G A T G C A G G T A C A T C C C A C T G A T G A G T C C C A A A T A G G A C G A A A C G C G C T T C G G T G C G T C T G G G A T T C C A C T G C T A T C C A C G C G G C C G C G C G G A T C C UFSB XN 3 (674) G G C A A A G A A T T C C T C G A A G A T C T A G G C A A C G C G T C T C G A G C T G A G A T G C A G G T A C A T C C C A C T G A T G A G T C C C A A A T A G G A C G A A A C G C G C T T C G G T G C G T C T G G G A T T C C A C T G C T A T C C A C G C G G C C G C G C G G A T C C Consensus (1886) 1614 1752 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 (1614) G C G G G C G C G G G G C G A A G C G G T G C G G C G C C G G C A G G A A G G A A A T G G G C G G G G A G G G C C T T C G T G C G T C G C C G C G C C G C C G T C C C C T T C T C C C T C T C C A G C C T C G G G G C T G T C C G C G G G G G G A C G G C T G C C T T C G G G G G G G pTR UF SB XhoI/NotI (1614) G C G G G C G C G G G G C G A A G C G G T G C G G C G C C G G C A G G A A G G A A A T G G G C G G G G A G G G C C T T C G T G C G T C G C C G C G C C G C C G T C C C C T T C T C C C T C T C C A G C C T C G G G G C T G T C C G C G G G G G G A C G G C T G C C T T C G G G G G G G UFSB XN 3 (402) G C G G G C G C G G G G C G A A G C G G T G C G G C G C C G G C A G G A A G G A A A T G G G C G G G G A G G G C C T T C G T G C G T C G C C G C G C C G C C G T C C C C T T C T C C C T C T C C A G C C T C G G G G C T G T C C G C G G G G G G A C G G C T G C C T T C G G G G G G G Consensus (1614) 1478 1616 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 (1478) A G C G C C G G C G G C T G T C G A G G C G C G G C G A G C C G C A G C C A T T G C C T T T T A T G G T A A T C G T G C G A G A G G G C G C A G G G A C T T C C T T T G T C C C A A A T C T G T G C G G A G C C G A A A T C T G G G A G G C G C C G C C G C A C C C C C T C T A G C G pTR UF SB XhoI/NotI (1478) A G C G C C G G C G G C T G T C G A G G C G C G G C G A G C C G C A G C C A T T G C C T T T T A T G G T A A T C G T G C G A G A G G G C G C A G G G A C T T C C T T T G T C C C A A A T C T G T G C G G A G C C G A A A T C T G G G A G G C G C C G C C G C A C C C C C T C T A G C G UFSB XN 3 (266) A G C G C C G G C G G C T G T C G A G G C G C G G C G A G C C G C A G C C A T T G C C T T T T A T G G T A A T C G T G C G A G A G G G C G C A G G G A C T T C C T T T G T C C C A A A T C T G T G C G G A G C C G A A A T C T G G G A G G C G C C G C C G C A C C C C C T C T A G C G Consensus (1478) 1342 1480 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 (1342) G G G T G C G G G G C T C C G T A C G G G G C G T G G C G C G G G G C T C G C C G T G C C G G G C G G G G G G T G G C G G C A G G T G G G G G T G C C G G G C G G G G C G G G G C C G C C T C G G G C C G G G G A G G G C T C G G G G G A G G G G C G C G G C G G C C C C C G G A G C pTR UF SB XhoI/NotI (1342) G G G T G C G G G G C T C C G T A C G G G G C G T G G C G C G G G G C T C G C C G T G C C G G G C G G G G G G T G G C G G C A G G T G G G G G T G C C G G G C G G G G C G G G G C C G C C T C G G G C C G G G G A G G G C T C G G G G G A G G G G C G C G G C G G C C C C C G G A G C UFSB XN 3 (130) G G G T G C G G G G C T C C G T A C G G G G C G T G G C G C G G G G C T C G C C G T G C C G G G C G G G G G G T G G C G G C A G G T G G G G G T G C C G G G C G G G G C G G G G C C G C C T C G G G C C G G G G A G G G C T C G G G G G A G G G G C G C G G C G G C C C C C G G A G C Consensus (1342) 1206 1344 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 (1206) G G G G G G G C T G C G A G G G G A A C A A A G G C T G C G T G C G G G G T G T G T G C G T G G G G G G G T G A G C A G G G G G T G T G G G C G C G T C G G T C G G G C T G C A A C C C C C C C T G C A C C C C C C T C C C C G A G T T G C T G A G C A C G G C C C G G C T T C G G G pTR UF SB XhoI/NotI (1206) C T G C G A G G G G A A C A A A G G C T G C G T G C G G G G T G T G T G C G T G G G G G G G T G A G C A G G G G G T G T G G G C G C G T C G G T C G G G C T G C A A C C C C C C C T G C A C C C C C C T C C C C G A G T T G C T G A G C A C G G C C C G G C T T C G G G UFSB XN 3 (1) C T G C G A G G G G A A C A A A G G C T G C G T G C G G G G T G T G T G C G T G G G G G G G T G A G C A G G G G G T G T G G G C G C G T C G G T C G G G C T G C A A C C C C C C C T G C A C C C C C C T C C C C G A G T T G C T G A G C A C G G C C C G G C T T C G G G Consensus (1206)

PAGE 64

64 Figure 2 11 Alignment of clones containing the rN117 sequence ligated to pTR -UFSB plasmid. The top portion of the diagram depicts the map for the ligated pTR -UF SB -XhoI/NotI plasmid. The map also illustrate s the terminal repeat sequences, CMV immediate early enhanc er/Chicken beta actin promoter regions, the rN117 ribozyme coding region, ColE1 and f1(+) replication origin sites and the ampicillin resistance gene. The bottom portion of the diagram shows the plasmid clone sequence aligned with the pTR -UF -SB -XhoI/NotI plasmid. Sequences depicted in yellow represent 100% similarity to the consensus sequence. Blue indicates variations in sequence for one or more clones with the consensus sequence. Highlighted in the diagram are the UFSB sense and antisense primer sequen ces (red and tan respectively), the XhoI and NotI restriction sites (purple and light green respectively and the rN117 ribozyme cDNA (blue). 2294 2432 2300 2310 2320 2330 2340 2350 2360 2370 2380 2390 2400 2410 2420 (2294) A G G C C G C C C G G G C A A A G C C C G G G C G T C G G G C G A C C T T T G G T C G C C C G G C C T C A G T G A G C G A G C G A G C G C G C A G A G A G G G A G T G G C C A A C C C C C C C C C C C C C C C C C C T G C A G C C C T G C A T T A A T G A A T C G G C C A A C G C G C pTR UF SB XhoI/NotI (2294) A G G C C G UFSB XN 3 (1082) A G G C C G Consensus (2294) 2158 2296 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 (2158) A A C A A C A A T T G C A T T C A T T T T A T G T T T C A G G T T C A G G G G G A G G T G T G G G A G G T T T T T T A G T C G A C T G G G G A G A G A T C T G A G G A A C C C C T A G T G A T G G A G T T G G C C A C T C C C T C T C T G C G C G C T C G C T C G C T C A C T G A G G pTR UF SB XhoI/NotI (2158) A A C A A C A A T T G C A T T C A T T T T A T G T T T C A G G T T C A G G G G G A G G T G T G G G A G G T T T T T T A G T C G A C T G G G G A G A G A T C T G A G G A A C C C C T A G T G A T G G A G T T G G C C A C T C C C T C T C T G C G C G C T C G C T C G C T C A C T G A G G UFSB XN 3 (946) A A C A A C A A T T G C A T T C A T T T T A T G T T T C A G G T T C A G G G G G A G G T G T G G G A G G T T T T T T A G T C G A C T G G G G A G A G A T C T G A G G A A C C C C T A G T G A T G G A G T T G G C C A C T C C C T C T C T G C G C G C T C G C T C G C T C A C T G A G G Consensus (2158) 2022 2160 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 (2022) T C C A G A C A T G A T A A G A T A C A T T G A T G A G T T T G G A C A A A C C A C A A C T A G A A T G C A G T G A A A A A A A T G C T T T A T T T G T G A A A T T T G T G A T G C T A T T G C T T T A T T T G T A A C C A T T A T A A G C T G C A A T A A A C A A G T T A A C A A C pTR UF SB XhoI/NotI (2022) T C C A G A C A T G A T A A G A T A C A T T G A T G A G T T T G G A C A A A C C A C A A C T A G A A T G C A G T G A A A A A A A T G C T T T A T T T G T G A A A T T T G T G A T G C T A T T G C T T T A T T T G T A A C C A T T A T A A G C T G C A A T A A A C A A G T T A A C A A C UFSB XN 3 (810) T C C A G A C A T G A T A A G A T A C A T T G A T G A G T T T G G A C A A A C C A C A A C T A G A A T G C A G T G A A A A A A A T G C T T T A T T T G T G A A A T T T G T G A T G C T A T T G C T T T A T T T G T A A C C A T T A T A A G C T G C A A T A A A C A A G T T A A C A A C Consensus (2022)

PAGE 65

65 Single Riboswitch Construction Following sequence confirmation of the plasmid clone, this vetted plasmid clone as well as the pTR -UF -SB -sFlt 01 were digested with the NotI restriction enzyme. After NotI digestion, the pTR -UF -SB -XhoI/NotI was then treated with alkaline phosphatase in order to reduce the potential for self -ligation of the plasmid. The rationale behind this cloning project was to ligate the sFlt 01 transgene into the pTR -UF -SB -XhoI/NotI vector in ord er to have the rN117 sequence placed in the sFlt 01 5UTR region. In addition to isolating sFlt 01, the hGFP transgene was also digested with the NotI restriction enzyme from the pTR TetRe -hGFP wPRE plasmid. The goal was to create single and double ribos witch vectors regulating the expression of the hGFP reporter gene. The digested and phosphatase treated pTR -UF -SB -XhoI/NotI, along with the digested sFlt 01 and hGFP inserts, were analyzed by gel electrophoresis in 1.2% agarose (Fig. 2 12, 213). Figure 2 12 Digest and gel extraction of sFlt 01 and pTR -UF SB -XhoI/NotI fragments. The left diagram shows the digested pTR -UF SB -XhoI/NotI and pTR -UFSB -sFlt 01 plasmids. The right diagram conveys fragment extraction of the NotI digested pTR UF SB -Xh oI/NotI plasmid and the NotI digested sFlt 01 cDNA. Samples were mixed with DNA loading dye and run on a 1.2% agarose gel at 120 volts for 1.5 hours. The running buffer was TBE. 1 KB plus DNA 1 KB plus DNA pTR UFSB sFlt 01: pTR UFS B XhoI/NotI: pTR UFSB XhoI/NotI: pTR UFSB sFlt 01:

PAGE 66

66 Figure 2 13 Digest and gel extraction of hGFP and pTR -UF -SB -XhoI/NotI fragments. The left diagram shows the digested pTR -UF SB -XhoI/NotI and pTR TetRe -hGFP wPRE plasmids. The right diagram conveys fragment extraction of the NotI digested pTR UF SB -XhoI/NotI plasmids and the NotI digested hGFP cDNA. Samples were mixed with DNA loading dye and run on a 1.2% agarose gel at 120 volts for 1.5 hours. The running buffer was TBE. After gel extraction and purification the pTR -UF -SB -XN plasmid was ligated with either the sFlt 01 or hGFP transgene at a vector to insert ratio of one to five. The ligation mixtures were incubated at 16C overnight. The newly construc ted pTR rN117-XN -D29Gly (sFlt) and pTR rN117-XN -hGFP plasmids were purified of the ligation reagents, transformed into E. coli SURE cells (Stratagene) and then plated onto LB ampicillin selection plates. After 12 16 hours of plate incubation at 37C, individual colonies were picked and then added to large LB liquid culture preps. Following plasmid amplification, the DNA constructs were obtained by Miniprep kit processing (Qiagen). 1 KB plus DNA Ladder 1 KB plus DNA Ladder pTR TetRe hGFP wPRE: NotI pTR TetRe hGFP wPRE: NotI pTR UFSB XhoI/NotI: NotI pTR UFSB XhoI/NotI: NotI

PAGE 67

67 The next step was to check for proper insert orientation into the plasm id vector. Because of the presence of NotI overhangs at the 5 and 3ends of the inserts it was important to ensure that neither transgene was ligated in the reverse orientation. Figure 2 14 Digestion of the ligation product between the sFlt 01 t ransgene and the pTR -UF SB -XhoI/NotI vector. The top two maps convey the pTR rN117-XN D29Gly (sFlt) plasmid with SmaI restriction sites. The maps also depict the sFlt 01 transgene in either the correct (top) or reverse orientation (bottom), the termina l repeat sequences, CMV immediate early enhancer/Chicken beta actin promoter regions, the rN117 ribozyme coding region, ColE1 and f1(+) replication origin sites and the ampicillin resistance gene. The bottom picture displays uncut plasmid vector and plasm id clones that were digested with the SmaI restriction enzyme. Samples were mixed with DNA loading dye and run on a 1% agarose gel at 120 volts for 1 hour. The running buffer was TBE. pTR-rN117-XN-D29Gly (Sflt)6324 bp Amp r Flt-1 D(2)/9G?Fc (#334) CMV ie enhancer Intron TR TR SV40 poly(A) Chiken b-actin promoter ColE1 ori f1(+) origin rN117 Exon1 Sma I (87) Sma I (98) Sma I (2818) Sma I (3393) Sma I (3404) pTR-rN117-XN-D29Gly (sFlt) wr orient6322 bp Amp r Flt-1 D(2)/9G?Fc (#334) CMV ie enhancer Intron TR TR SV40 poly(A) Chiken b-actin promoter f1(+) origin ColE1 ori N117 Exon1 Sma I (88) Sma I (99) Sma I (2298) Sma I (3392) Sma I (3403)

PAGE 68

68 Figure 2 14 Continued Figure 2 14 shows pTR rN117-XN D29Gly (sFlt) clones that were assessed for proper sFlt 01 transgene insertion. Computer generated images of the sFlt 01 placed into the pTR -UF SB -XN plasmid conveys the two possible scenarios that could have occurred follow ing ligation. In order to evaluate insert orientation a unique restriction enzyme site was needed so that digestion would create an unbalanced cut into the transgene as well as bisect the plasmid backbone in a standard location independent of transgene pl acement. The restriction enzyme which best accomplished these goals was SmaI. As displayed in the computer images of the pTR rN117-XN D29Gly (sFlt) (Fig. 2 14), the SmaI enzyme exclusively cuts the plasmid backbone for both the right and wrong orientati on constructs at sites found in the terminal repeat section. The SmaI enzyme specifically cleaves the sFlt 01 transgene closer to the 5end than the midsection of the gene. If plasmid clones contain the insert in the correct orientation then 1 KB plus DNA Ladder pTR rN117 XN D29Gly (sFlt): SmaI pTR rN117 XN D29ly uncut

PAGE 69

69 digestion wi th SmaI will produce plasmid fragment on agarose gel at a band length of 575bp. Plasmid clones containing the insert in the wrong orientation will create fragment a band length of 1094bp. This was further verified by sequencing (ICBR Biotechnology -DNA s equencing lab, University of Florida). For sequencing, primer oligonucleotides (Integrated DNA Technologies, Inc.) intended for sequencing the multiple cloning sight of the pTR -UF -SB plasmid where used to analyze these clones. The sequence results demons trate that the sFlt 01 transgene did insert correctly into the vector backbone (Fig. 2 15). In the Align X analysis (Vector NTI, Invitrogen) the plasmid clone sequences were contrasted against the computer generated pTR rN117-XN D29Gly (sFlt) (Fig. 2 15).

PAGE 70

70 Figure 2 15 Alignment of clones containing the sFlt 01 transgene ligated to pTR -UF -SB -XhoI/NotI plasmid. The top portion of the diagram depicts the map for the ligated pTR rN117-XN D29Gly (sFlt) plasmid. The map also illustrates the terminal repeat s equences, CMV immediate early enhancer/Chicken beta actin promoter regions, the rN117 ribozyme coding region, sFlt 01 transgene cassette, ColE1 and f1(+) replication origin sites and the ampicillin resistance gene. The bottom portion of the diagram shows the plasmid clone sequence aligned with the pTR rN117-XN D29Gly (sFlt) plasmid. Sequences depicted in yellow represent 100% similarity to the consensus sequence. Blue indicates variations in sequence for one or more clones with the consensus sequence. Hi ghlighted in the diagram are the UFSB sense and antisense primer sequences (violet and brown respectively), the XhoI and NotI restriction sites (dark green and red respectively, the rN117 ribozyme cDNA and the sFlt 01 transgene (purple). pTR-rN117-XN-D29Gly (Sflt)6324 bp Amp r Flt-1 D(2)/9G?Fc (#334) CMV ie enhancer Intron TR TR SV40 poly(A) Chiken b-actin promoter ColE1 ori f1(+) origin rN117 Exon1

PAGE 71

71 sFlt 01 Figure 2 15 Continued 2122 2227 2130 2140 2150 2160 2170 2180 2190 2200 2210 (2122) T C C C C G A A A T T A T A C A C A T G A C T G A A G G A A G G G A G C T C G T C A T T C C C T G C C G G G T T A C G T C A C C T A A C A T C A C T G T T A C T T T A A A A A A G T T T C C A C T T G A C A C T T T pTR rN117 D29Gly (Sflt) (2122) T C C C C G A A A T T A T A C A C A T G A C T G A A G G A A G G G A G C T C G T C A T T C C C T G C C G G G T T A C G T C A C C T A A C A T C A C T G T T A C T T T A A A A A A G T T T C C A C T T G A C A C T T T rN117 XNS L1 (268) T C C C C G A A A T T A T A C A C A T G A C T G A A G G A A G G G A G C T C G T C A T T C C C T G C C G G G T T A C G T C A C C T A A C A T C A C T G T T A C T T T A A A A A A G T T T C C A C T T G A C A C T T T rN11 XNS L2 (268) T C C C C G A A A T T A T A C A C A T G A C T G A A G G A A G G G A G C T C G T C A T T C C C T G C C G G G T T A C G T C A C C T A A C A T C A C T G T T A C T T T A A A A A A G T T T C C A C T T G A C A C T T T rN117XNS L3 (268) T C C C C G A A A T T A T A C A C A T G A C T G A A G G A A G G G A G C T C G T C A T T C C C T G C C G G G T T A C G T C A C C T A A C A T C A C T G T T A C T T T A A A A A A G T T T C C A C T T G A C A C T T T rN117 XNS L4 (266) T C C C C G A A A T T A T A C A C A T G A C T G A A G G A A G G G A G C T C G T C A T T C C C T G C C G G G T T A C G T C A C C T A A C A T C A C T G T T A C T T T A A A A A A G T T T C C A C T T G A C A C T T T rN117 XNS N1 (268) T C C C C G A A A T T A T A C A C A T G A C T G A A G G A A G G G A G C T C G T C A T T C C C T G C C G G G T T A C G T C A C C T A A C A T C A C T G T T A C T T T A A A A A A G T T T C C A C T T G A C A C T T T rN117 XNS N4 (266) T C C C C G A A A T T A T A C A C A T G A C T G A A G G A A G G G A G C T C G T C A T T C C C T G C C G G G T T A C G T C A C C T A A C A T C A C T G T T A C T T T A A A A A A G T T T C C A C T T G A C A C T T T Consensus (2122) 2020 2125 2030 2040 2050 2060 2070 2080 2090 2100 2110 (2020) C C A T G G T C A G C T A C T G G G A C A C C G G G G T C C T G C T G T G C G C G C T G C T C A G C T G T C T G C T T C T C A C A G G A T C T G G T A G A C C T T T C G T A G A G A T G T A C A G T G A A A T C C C pTR rN117 D29Gly (Sflt) (2020) C C A T G G T C A G C T A C T G G G A C A C C G G G G T C C T G C T G T G C G C G C T G C T C A G C T G T C T G C T T C T C A C A G G A T C T G G T A G A C C T T T C G T A G A G A T G T A C A G T G A A A T C C C rN117 XNS L1 (166) C C A T G G T C A G C T A C T G G G A C A C C G G G G T C C T G C T G T G C G C G C T G C T C A G C T G T C T G C T T C T C A C A G G A T C T G G T A G A C C T T T C G T A G A G A T G T A C A G T G A A A T C C C rN11 XNS L2 (166) C C A T G G T C A G C T A C T G G G A C A C C G G G G T C C T G C T G T G C G C G C T G C T C A G C T G T C T G C T T C T C A C A G G A T C T G G T A G A C C T T T C G T A G A G A T G T A C A G T G A A A T C C C rN117 XNS L3 (166) C C A T G G T C A G C T A C T G G G A C A C C G G G G T C C T G C T G T G C G C G C T G C T C A G C T G T C T G C T T C T C A C A G G A T C T G G T A G A C C T T T C G T A G A G A T G T A C A G T G A A A T C C C rN117 XNS L4 (164) C C A T G G T C A G C T A C T G G G A C A C C G G G G T C C T G C T G T G C G C G C T G C T C A G C T G T C T G C T T C T C A C A G G A T C T G G T A G A C C T T T C G T A G A G A T G T A C A G T G A A A T C C C rN117 XNS N1 (166) C C A T G G T C A G C T A C T G G G A C A C C G G G G T C C T G C T G T G C G C G C T G C T C A G C T G T C T G C T T C T C A C A G G A T C T G G T A G A C C T T T C G T A G A G A T G T A C A G T G A A A T C C C rN117XNS N4 (164) C C A T G G T C A G C T A C T G G G A C A C C G G G G T C C T G C T G T G C G C G C T G C T C A G C T G T C T G C T T C T C A C A G G A T C T G G T A G A C C T T T C G T A G A G A T G T A C A G T G A A A T C C C Consensus (2020) 1915 2020 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 (1915) A C G C G T C T C G A G C T G A G A T G C A G G T A C A T C C C A C T G A T G A G T C C C A A A T A G G A C G A A A C G C G C T T C G G T G C G T C T G G G A T T C C A C T G C T A T C C A C G C G G C C G C C A C pTR rN117 D29Gly (Sflt) (1915) A C G C G T C T C G A G C T G A G A T G C A G G T A C A T C C C A C T G A T G A G T C C C A A A T A G G A C G A A A C G C G C T T C G G T G C G T C T G G G A T T C C A C T G C T A T C C A C G C G G C C G C C A C rN117XNS L1 (61) A C G C G T C T C G A G C T G A G A T G C A G G T A C A T C C C A C T G A T G A G T C C C A A A T A G G A C G A A A C G C G C T T C G G T G C G T C T G G G A T T C C A C T G C T A T C C A C G C G G C C G C C A C rN11 XNS L2 (61) A C G C G T C T C G A G C T G A G A T G C A G G T A C A T C C C A C T G A T G A G T C C C A A A T A G G A C G A A A C G C G C T T C G G T G C G T C T G G G A T T C C A C T G C T A T C C A C G C G G C C G C C A C rN117 XNS L3 (61) A C G C G T C T C G A G C T G A G A T G C A G G T A C A T C C C A C T G A T G A G T C C C A A A T A G G A C G A A A C G C G C T T C G G T G C G T C T G G G A T T C C A C T G C T A T C C A C G C G G C C G C C A C rN117 XNS L4 (59) A C G C G T C T C G A G C T G A G A T G C A G G T A C A T C C C A C T G A T G A G T C C C A A A T A G G A C G A A A C G C G C T T C G G T G C G T C T G G G A T T C C A C T G C T A T C C A C G C G G C C G C C A C rN117 XNS N1 (61) A C G C G T C T C G A G C T G A G A T G C A G G T A C A T C C C A C T G A T G A G T C C C A A A T A G G A C G A A A C G C G C T T C G G T G C G T C T G G G A T T C C A C T G C T A T C C A C G C G G C C G C C A C rN117 XNS N4 (59) A C G C G T C T C G A G C T G A G A T G C A G G T A C A T C C C A C T G A T G A G T C C C A A A T A G G A C G A A A C G C G C T T C G G T G C G T C T G G G A T T C C A C T G C T A T C C A C G C G G C C G C C A C Consensus (1915) 1810 1915 1820 1830 1840 1850 1860 1870 1880 1890 1900 (1810) C T A A C C A T G T T C A T G C C T T C T T C T T T T T C C T A C A G C T C C T G G G C A A C G T G C T G G T T A T T G T G C T G T C T C A T C A T T T T G G C A A A G A A T T C C T C G A A G A T C T A G G C A A pTR rN117 D29Gly (Sflt) (1810) A C G T G C T G G T T A T T G T G C T G T C T C A T C A T T T T G G C A A A G A A T T C C T C G A A G A T C T A G G C A A rN117 XNS L1 (1) A C G T G C T G G T T A T T G T G C T G T C T C A T C A T T T T G G C A A A G A A T T C C T C G A A G A T C T A G G C A A rN11 XNS L2 (1) A C G T G C T G G T T A T T G T G C T G T C T C A T C A T T T T G G C A A A G A A T T C C T C G A A G A T C T A G G C A A rN117 XNS L3 (1) G T G C T G G T T A T T G T G C T G T C T C A T C A T T T T G G C A A A G A A T T C C T C G A A G A T C T A G G C A A rN117 XNS L4 (1) A C G T G C T G G T T A T T G T G C T G T C T C A T C A T T T T G G C A A A G A A T T C C T C G A A G A T C T A G G C A A rN117 XNS N1 (1) G T G C T G G T T A T T G T G C T G T C T C A T C A T T T T G G C A A A G A A T T C C T C G A A G A T C T A G G C A A rN117 XNS N4 (1) A C G T G C T G G T T A T T G T G C T G T C T C A T C A T T T T G G C A A A G A A T T C C T C G A A G A T C T A G G C A A Consensus (1810)

PAGE 72

72 Figure 2 15 Continued 2533 2638 2540 2550 2560 2570 2580 2590 2600 2610 2620 (2533) C A T G C G T G G T G G T G G A C G T G A G C C A C G A A G A C C C T G A G G T C A A G T T C A A C T G G T A C G T G G A C G G C G T G G A G G T G C A T A A T G C C A A G A C A A A G C C G C G G G A G G A G C A pTR rN117 D29Gly (Sflt) (2533) C A T G C G T G G T G G T G G A C G T G A G C C A C G A A G A C C C T G A G G T C A A G T T C A A C T G G T A C G T G G A C G G C G T G G A G G T G C A T A A T G C C A A G A C A A A G C C G C G G G A G G A G C A rN117 XNS L1 (679) C A T G C G T G G T G G T G G A C G T G A G C C A C G A A G A C C C T G A G G T C A A G T T C A A C T G G T A C G T G G A C G G C G T G G A G G T G C A T A A T G C C A A G A C A A A G C C G C G G G A G G A G C A rN11 XNS L2 (679) C A T G C G T G G T G G T G G A C G T G A G C C A C G A A G A C C C T G A G G T C A A G T T C A A C T G G T A C G T G G A C G G C G T G G A G G T G C A T A A T G C C A A G A C A A A G C C G C G G G A G G A G C A rN117 XNS L3 (679) C A T G C G T G G T G G T G G A C G T G A G C C A C G A A G A C C C T G A G G T C A A G T T C A A C T G G T A C G T G G A C G G C G T G G A G G T G C A T A A T G C C A A G A C A A A G C C G C G G G A G G A G C A rN117 XNS L4 (677) C A T G C G T G G T G G T G G A C G T G A G C C A C G A A G A C C C T G A G G T C A A G T T C A A C T G G T A C G T G G A C G G C G T G G A G G T G C A T A A T G C C A A G A C A A A G C C G C G G G A G G A G C A rN117 XNS N1 (679) C A T G C G T G G T G G T G G A C G T G A G C C A C G A A G A C C C T G A G G T C A A G T T C A A C T G G T A C G T G G A C G G C G T G G A G G T G C A T A A T G C C A A G A C A A A G C C G C G G G A G G A G C A rN117 XNS N4 (677) C A T G C G T G G T G G T G G A C G T G A G C C A C G A A G A C C C T G A G G T C A A G T T C A A C T G G T A C G T G G A C G G C G T G G A G G T G C A T A A T G C C A A G A C A A A G C C G C G G G A G G A G C A Consensus (2533) 2430 2535 2440 2450 2460 2470 2480 2490 2500 2510 2520 (2430) T G C C C A C C G T G C C C A G C A C C T G A A C T C C T G G G G G G A C C G T C A G T C T T C C T C T T C C C C C C A A A A C C C A A G G A C A C C C T C A T G A T C T C C C G G A C C C C T G A G G T C A C A T pTR rN117 D29Gly (Sflt) (2430) T G C C C A C C G T G C C C A G C A C C T G A A C T C C T G G G G G G A C C G T C A G T C T T C C T C T T C C C C C C A A A A C C C A A G G A C A C C C T C A T G A T C T C C C G G A C C C C T G A G G T C A C A T rN117 XNS L1 (576) T G C C C A C C G T G C C C A G C A C C T G A A C T C C T G G G G G G A C C G T C A G T C T T C C T C T T C C C C C C A A A A C C C A A G G A C A C C C T C A T G A T C T C C C G G A C C C C T G A G G T C A C A T rN11 XNS L2 (576) T G C C C A C C G T G C C C A G C A C C T G A A C T C C T G G G G G G A C C G T C A G T C T T C C T C T T C C C C C C A A A A C C C A A G G A C A C C C T C A T G A T C T C C C G G A C C C C T G A G G T C A C A T rN117XNS L3 (576) T G C C C A C C G T G C C C A G C A C C T G A A C T C C T G G G G G G A C C G T C A G T C T T C C T C T T C C C C C C A A A A C C C A A G G A C A C C C T C A T G A T C T C C C G G A C C C C T G A G G T C A C A T rN117 XNS L4 (574) T G C C C A C C G T G C C C A G C A C C T G A A C T C C T G G G G G G A C C G T C A G T C T T C C T C T T C C C C C C A A A A C C C A A G G A C A C C C T C A T G A T C T C C C G G A C C C C T G A G G T C A C A T rN117 XNS N1 (576) T G C C C A C C G T G C C C A G C A C C T G A A C T C C T G G G G G G A C C G T C A G T C T T C C T C T T C C C C C C A A A A C C C A A G G A C A C C C T C A T G A T C T C C C G G A C C C C T G A G G T C A C A T rN117 XNS N4 (574) T G C C C A C C G T G C C C A G C A C C T G A A C T C C T G G G G G G A C C G T C A G T C T T C C T C T T C C C C C C A A A A C C C A A G G A C A C C C T C A T G A T C T C C C G G A C C C C T G A G G T C A C A T Consensus (2430) 2327 2432 2340 2350 2360 2370 2380 2390 2400 2410 2420 (2327) A G T C A A T G G G C A T T T G T A T A A G A C A A A C T A T C T C A C A C A T C G A C A A A C C G G T G G A G G T G G A G G T G G A G G T G G A G G T C C T A A A T C T T G T G A C A A A A C T C A C A C A T G C pTR rN117D29Gly (Sflt) (2327) A G T C A A T G G G C A T T T G T A T A A G A C A A A C T A T C T C A C A C A T C G A C A A A C C G G T G G A G G T G G A G G T G G A G G T G G A G G T C C T A A A T C T T G T G A C A A A A C T C A C A C A T G C rN117 XNS L1 (473) A G T C A A T G G G C A T T T G T A T A A G A C A A A C T A T C T C A C A C A T C G A C A A A C C G G T G G A G G T G G A G G T G G A G G T G G A G G T C C T A A A T C T T G T G A C A A A A C T C A C A C A T G C rN11 XNS L2 (473) A G T C A A T G G G C A T T T G T A T A A G A C A A A C T A T C T C A C A C A T C G A C A A A C C G G T G G A G G T G G A G G T G G A G G T G G A G G T C C T A A A T C T T G T G A C A A A A C T C A C A C A T G C rN117 XNS L3 (473) A G T C A A T G G G C A T T T G T A T A A G A C A A A C T A T C T C A C A C A T C G A C A A A C C G G T G G A G G T G G A G G T G G A G G T G G A G G T C C T A A A T C T T G T G A C A A A A C T C A C A C A T G C rN117 XNS L4 (471) A G T C A A T G G G C A T T T G T A T A A G A C A A A C T A T C T C A C A C A T C G A C A A A C C G G T G G A G G T G G A G G T G G A G G T G G A G G T C C T A A A T C T T G T G A C A A A A C T C A C A C A T G C rN117 XNS N1 (473) A G T C A A T G G G C A T T T G T A T A A G A C A A A C T A T C T C A C A C A T C G A C A A A C C G G T G G A G G T G G A G G T G G A G G T G G A G G T C C T A A A T C T T G T G A C A A A A C T C A C A C A T G C rN117 XNS N4 (471) A G T C A A T G G G C A T T T G T A T A A G A C A A A C T A T C T C A C A C A T C G A C A A A C C G G T G G A G G T G G A G G T G G A G G T G G A G G T C C T A A A T C T T G T G A C A A A A C T C A C A C A T G C Consensus (2327) 2224 2329 2230 2240 2250 2260 2270 2280 2290 2300 2310 (2224) C T T T G A T C C C T G A T G G A A A A C G C A T A A T C T G G G A C A G T A G A A A G G G C T T C A T C A T A T C A A A T G C A A C G T A C A A A G A A A T A G G G C T T C T G A C C T G T G A A G C A A C A G T pTR rN117 D29Gly (Sflt) (2224) C T T T G A T C C C T G A T G G A A A A C G C A T A A T C T G G G A C A G T A G A A A G G G C T T C A T C A T A T C A A A T G C A A C G T A C A A A G A A A T A G G G C T T C T G A C C T G T G A A G C A A C A G T rN117 XNS L1 (370) C T T T G A T C C C T G A T G G A A A A C G C A T A A T C T G G G A C A G T A G A A A G G G C T T C A T C A T A T C A A A T G C A A C G T A C A A A G A A A T A G G G C T T C T G A C C T G T G A A G C A A C A G T rN11 XNS L2 (370) C T T T G A T C C C T G A T G G A A A A C G C A T A A T C T G G G A C A G T A G A A A G G G C T T C A T C A T A T C A A A T G C A A C G T A C A A A G A A A T A G G G C T T C T G A C C T G T G A A G C A A C A G T rN117 XNS L3 (370) C T T T G A T C C C T G A T G G A A A A C G C A T A A T C T G G G A C A G T A G A A A G G G C T T C A T C A T A T C A A A T G C A A C G T A C A A A G A A A T A G G G C T T C T G A C C T G T G A A G C A A C A G T rN117 XNS L4 (368) C T T T G A T C C C T G A T G G A A A A C G C A T A A T C T G G G A C A G T A G A A A G G G C T T C A T C A T A T C A A A T G C A A C G T A C A A A G A A A T A G G G C T T C T G A C C T G T G A A G C A A C A G T rN117 XNS N1 (370) C T T T G A T C C C T G A T G G A A A A C G C A T A A T C T G G G A C A G T A G A A A G G G C T T C A T C A T A T C A A A T G C A A C G T A C A A A G A A A T A G G G C T T C T G A C C T G T G A A G C A A C A G T rN117 XNS N4 (368) C T T T G A T C C C T G A T G G A A A A C G C A T A A T C T G G G A C A G T A G A A A G G G C T T C A T C A T A T C A A A T G C A A C G T A C A A A G A A A T A G G G C T T C T G A C C T G T G A A G C A A C A G T Consensus (2224)

PAGE 73

73 Figure 2 15 Continued 2945 3050 2950 2960 2970 2980 2990 3000 3010 3020 3030 3040 (2945) G C T G G A C T C C G A C G G C T C C T T C T T C C T C T A C A G C A A G C T C A C C G T G G A C A A G A G C A G G T G G C A G C A G G G G A A C G T C T T C T C A T G C T C C G T G A T G C A T G A G G C T C T G pTR rN117 D29Gly (Sflt) (2945) G C T G G A C T C C G A C G G C T C C T T C T T C C T C T A C A G C A A G C T C A C C G T G G A C A A G A G C A G G T G G C A G C A G G G G A A C G T C T T C T C A T G C T C C G T G A T G C A T G A G G C T C T G rN117 XNS L1 (1091) G C T G G A C T C C G A C G G C T C C T T C T T C C T C T A C A G C A A G C T C A C C G T G G A C A A G A G C A G G T G G C A G C A G G G G A A C G T C T T C T C A T G C T C C G T G A T G C A T G A G G C T C T G rN11 XNS L2 (1091) G C T G G A C T C C G A C G G C T C C T T C T T C C T C T A C A G C A A G C T C A C C G T G G A C A A G A G C A G G T G G C A G C A G G G G A A C G T C T T C T C A T G C T C C G T G A T G C A T G A G G C T C T G rN117 XNS L3 (1091) G C T G G A C T C C G A C G G C T C C T T C T T C C T C T A C A G C A A G C T C A C C G T G G A C A A G A G C A G G T G G C A G C A G G G G A A C G T C T T C T C A T G C T C C G T G A T G C A T G A G G C T C T G rN117 XNS L4 (1089) G C T G G A C T C C G A C G G C T C C T T C T T C C T C T A C A G C A A G C T C A C C G T G G A C A A G A G C A G G T G G C A G C A G G G G A A C G T C T T C T C A T G C T C C G T G A T G C A T G A G G C T C T G rN117 XNS N1 (1091) G C T G G A C T C C G A C G G C T C C T T C T T C C T C T A C A G C A A G C T C A C C G T G G A C A A G A G C A G G T G G C A G C A G G G G A A C G T C T T C T C A T G C T C C G T G A T G C A T G A G G C T C T G rN117 XNS N4 (1089) G C T G G A C T C C G A C G G C T C C T T C T T C C T C T A C A G C A A G C T C A C C G T G G A C A A G A G C A G G T G G C A G C A G G G G A A C G T C T T C T C A T G C T C C G T G A T G C A T G A G G C T C T G Consensus (2945) 2842 2947 2850 2860 2870 2880 2890 2900 2910 2920 2930 (2842) T C A G C C T G A C C T G C C T G G T C A A A G G C T T C T A T C C C A G C G A C A T C G C C G T G G A G T G G G A G A G C A A T G G G C A G C C G G A G A A C A A C T A C A A G A C C A C G C C T C C C G T G C T pTR rN117 D29Gly (Sflt) (2842) T C A G C C T G A C C T G C C T G G T C A A A G G C T T C T A T C C C A G C G A C A T C G C C G T G G A G T G G G A G A G C A A T G G G C A G C C G G A G A A C A A C T A C A A G A C C A C G C C T C C C G T G C T rN117 XNS L1 (988) T C A G C C T G A C C T G C C T G G T C A A A G G C T T C T A T C C C A G C G A C A T C G C C G T G G A G T G G G A G A G C A A T G G G C A G C C G G A G A A C A A C T A C A A G A C C A C G C C T C C C G T G C T rN11 XNS L2 (988) T C A G C C T G A C C T G C C T G G T C A A A G G C T T C T A T C C C A G C G A C A T C G C C G T G G A G T G G G A G A G C A A T G G G C A G C C G G A G A A C A A C T A C A A G A C C A C G C C T C C C G T G C T rN117 XNS L3 (988) T C A G C C T G A C C T G C C T G G T C A A A G G C T T C T A T C C C A G C G A C A T C G C C G T G G A G T G G G A G A G C A A T G G G C A G C C G G A G A A C A A C T A C A A G A C C A C G C C T C C C G T G C T rN117 XNS L4 (986) T C A G C C T G A C C T G C C T G G T C A A A G G C T T C T A T C C C A G C G A C A T C G C C G T G G A G T G G G A G A G C A A T G G G C A G C C G G A G A A C A A C T A C A A G A C C A C G C C T C C C G T G C T rN117 XNS N1 (988) T C A G C C T G A C C T G C C T G G T C A A A G G C T T C T A T C C C A G C G A C A T C G C C G T G G A G T G G G A G A G C A A T G G G C A G C C G G A G A A C A A C T A C A A G A C C A C G C C T C C C G T G C T rN117 XNS N4 (986) T C A G C C T G A C C T G C C T G G T C A A A G G C T T C T A T C C C A G C G A C A T C G C C G T G G A G T G G G A G A G C A A T G G G C A G C C G G A G A A C A A C T A C A A G A C C A C G C C T C C C G T G C T Consensus (2842) 2739 2844 2750 2760 2770 2780 2790 2800 2810 2820 2830 (2739) C C A G C C C C C A T C G A G A A A A C C A T C T C C A A A G C C A A A G G G C A G C C C C G A G A A C C A C A G G T G T A C A C C C T G C C C C C A T C C C G G G A T G A G C T G A C C A A G A A C C A G G T C A pTR rN117 D29Gly (Sflt) (2739) C C A G C C C C C A T C G A G A A A A C C A T C T C C A A A G C C A A A G G G C A G C C C C G A G A A C C A C A G G T G T A C A C C C T G C C C C C A T C C C G G G A T G A G C T G A C C A A G A A C C A G G T C A rN117XNS L1 (885) C C A G C C C C C A T C G A G A A A A C C A T C T C C A A A G C C A A A G G G C A G C C C C G A G A A C C A C A G G T G T A C A C C C T G C C C C C A T C C C G G G A T G A G C T G A C C A A G A A C C A G G T C A rN11 XNS L2 (885) C C A G C C C C C A T C G A G A A A A C C A T C T C C A A A G C C A A A G G G C A G C C C C G A G A A C C A C A G G T G T A C A C C C T G C C C C C A T C C C G G G A T G A G C T G A C C A A G A A C C A G G T C A rN117 XNS L3 (885) C C A G C C C C C A T C G A G A A A A C C A T C T C C A A A G C C A A A G G G C A G C C C C G A G A A C C A C A G G T G T A C A C C C T G C C C C C A T C C C G G G A T G A G C T G A C C A A G A A C C A G G T C A (883) C C A G C C C C C A T C G A G A A A A C C A T C T C C A A A G C C A A A G G G C A G C C C C G A G A A C C A C A G G T G T A C A C C C T G C C C C C A T C C C G G G A T G A G C T G A C C A A G A A C C A G G T C A rN117 XNS N1 (885) C C A G C C C C C A T C G A G A A A A C C A T C T C C A A A G C C A A A G G G C A G C C C C G A G A A C C A C A G G T G T A C A C C C T G C C C C C A T C C C G G G A T G A G C T G A C C A A G A A C C A G G T C A rN117 XNS N4 (883) C C A G C C C C C A T C G A G A A A A C C A T C T C C A A A G C C A A A G G G C A G C C C C G A G A A C C A C A G G T G T A C A C C C T G C C C C C A T C C C G G G A T G A G C T G A C C A A G A A C C A G G T C A Consensus (2739) 2636 2741 2650 2660 2670 2680 2690 2700 2710 2720 2730 (2636) G C A G T A C A A C A G C A C G T A C C G T G T G G T C A G C G T C C T C A C C G T C C T G C A C C A G G A C T G G C T G A A T G G C A A G G A G T A C A A G T G C A A G G T C T C C A A C A A A G C C C T C C C A pTR rN117 D29Gly (Sflt) (2636) G C A G T A C A A C A G C A C G T A C C G T G T G G T C A G C G T C C T C A C C G T C C T G C A C C A G G A C T G G C T G A A T G G C A A G G A G T A C A A G T G C A A G G T C T C C A A C A A A G C C C T C C C A rN117 XNS L1 (782) G C A G T A C A A C A G C A C G T A C C G T G T G G T C A G C G T C C T C A C C G T C C T G C A C C A G G A C T G G C T G A A T G G C A A G G A G T A C A A G T G C A A G G T C T C C A A C A A A G C C C T C C C A rN11 XNS L2 (782) G C A G T A C A A C A G C A C G T A C C G T G T G G T C A G C G T C C T C A C C G T C C T G C A C C A G G A C T G G C T G A A T G G C A A G G A G T A C A A G T G C A A G G T C T C C A A C A A A G C C C T C C C A rN117 XNS L3 (782) G C A G T A C A A C A G C A C G T A C C G T G T G G T C A G C G T C C T C A C C G T C C T G C A C C A G G A C T G G C T G A A T G G C A A G G A G T A C A A G T G C A A G G T C T C C A A C A A A G C C C T C C C A rN117 XNS L4 (780) G C A G T A C A A C A G C A C G T A C C G T G T G G T C A G C G T C C T C A C C G T C C T G C A C C A G G A C T G G C T G A A T G G C A A G G A G T A C A A G T G C A A G G T C T C C A A C A A A G C C C T C C C A rN117 XNS N1 (782) G C A G T A C A A C A G C A C G T A C C G T G T G G T C A G C G T C C T C A C C G T C C T G C A C C A G G A C T G G C T G A A T G G C A A G G A G T A C A A G T G C A A G G T C T C C A A C A A A G C C C T C C C A rN117 XNS N4 (780) G C A G T A C A A C A G C A C G T A C C G T G T G G T C A G C G T C C T C A C C G T C C T G C A C C A G G A C T G G C T G A A T G G C A A G G A G T A C A A G T G C A A G G T C T C C A A C A A A G C C C T C C C A Consensus (2636)

PAGE 74

74 Figure 2 15 Continued 3150 3240 3160 3170 3180 3190 3200 3210 3220 3230 (3150) C C A C A A C T A G A A T G C A G T G A A A A A A A T G C T T T A T T T G T G A A A T T T G T G A T G C T A T T G C T T T A T T T G T A A C C A T T A T A A G C T G C A A T A A A C A pTR rN117 D29Gly (Sflt) (3150) C C A C A A C T A G A A rN117 XNS L1 (1296) rN11 XNS L2 (1266) C C A C A A C T A G A A rN117 XNS L3 (1296) rN117 XNS L4 (1284) C C A C A A C T A G A A rN117 XNS N1 (1296) C C A C A A C T A G A A rN117 XNS N4 (1294) C C A C A A C T A G A A Consensus (3150) 3048 3153 3060 3070 3080 3090 3100 3110 3120 3130 3140 (3048) C T G C A C A A C C A C T A C A C G C A G A A G A G C C T C T C C C T G T C T C C G G G T A A A T A G G C G G C C G C G C G G A T C C A G A C A T G A T A A G A T A C A T T G A T G A G T T T G G A C A A A C C A C pTR rN117 D29Gly (Sflt) (3048) C T G C A C A A C C A C T A C A C G C A G A A G A G C C T C T C C C T G T C T C C G G G T A A A T A G G C G G C C G C G C G G A T C C A G A C A T G A T A A G A T A C A T T G A T G A G T T T G G A C A A A C C A C rN117 XNS L1 (1194) C T G C A C A A C C A C T A C A C G C A G A A G A G C C T C T C C C T G T C T C C G G G T A A A T A G G C G G C C G C G C G G A T C C A G A C A rN11 XNS L2 (1194) C T G C A C A A C C A C T A C A C G C A G A A G A G C C T C T C C C T G T C T C C G G G T A A A T A G G C G G C C G C G C G G A T C C A G A C A T G A T A A G A T A C A T T G A T G A G T T T G G A C A A A C C A C rN117 XNS L3 (1194) C T G C A C A A C C A C T A C A C G C A G A A G A G C C T C T C C C T G T C T C C G G G T A A A T A G G C G G C C G C G C G G A T C C A G A C A T G A T A A G A T A C A T T G A T G A G rN117 XNS L4 (1192) C T G C A C A A C C A C T A C A C G C A G A A G A G C C T C T C C C T G T C T C C G G G T A A A T A G G C G G C C G C G C G G A T C C A G A C A T G A T A A G A T A C A T T G A T G A G T T T G G A C A A A C C A C rN117XNS N1 (1194) C T G C A C A A C C A C T A C A C G C A G A A G A G C C T C T C C C T G T C T C C G G G T A A A T A G G C G G C C G C G C G G A T C C A G A C A T G A T A A G A T A C A T T G A T G A G T T T G G A C A A A C C A C rN117 XNS N4 (1192) C T G C A C A A C C A C T A C A C G C A G A A G A G C C T C T C C C T G T C T C C G G G T A A A T A G G C G G C C G C G C G G A T C C A G A C A T G A T A A G A T A C A T T G A T G A G T T T G G A C A A A C C A C Consensus (3048)

PAGE 75

75 Figure 2 16 Digestion of the ligation product between the hGFP transgene and the pTR -UF SB XhoI/NotI vector. The top two maps convey the pTR rN117-XN GFP plasmid with NcoI restriction sites. The maps also depict the hGFP transgene in either the correct or reverse orientation, the terminal repeat sequences, CMV immediate early enhan cer/Chicken beta actin promoter regions, the rN117 ribozyme coding region, ColE1 and f1(+) replication origin sites and the ampicillin resistance gene. The bottom picture displays the pTR rN117-XN GFP plasmid clones that were digested with the NcoI restri ction enzyme. Red arrows indicate clone containing fragment size of 1646bps. Samples were mixed with DNA loading dye and run on a 1% agarose gel at 120 volts for 1 hour. The running buffer was TBE. pTR-rN117-XN-GFP5965 bp Amp r GFPh CMV ie enhancer Intron TR TR SV40 poly(A) Chiken b-actin promoter ColE1 ori f1(+) origin rN117 Exon1 Nco I (544) Nco I (2190) pTR-rN117-XN-GFP wr ori.5965 bp Amp r GFPh CMV ie enhancer Intron TR TR SV40 poly(A) Chiken b-actin promoter ColE1 ori f1(+) origin N117 Exon1 Nco I (544) Nco I (2564) 1 KB plus DNA Ladder pTR rN117 XN GFP : NcoI

PAGE 76

76 In Figure 2 16 a construct depiction as well as restriction enzyme digest of the pTR rN117XN -GFP is shown. As illustrated in the two computer generated constructs the NcoI restriction enzyme establishes a digest set up so that the pTR -UF -SB -XN backbone and the GFP transgene would be cleaved at distinctive sites. Digestion with NcoI divides the GFP transgene unevenly, while it provides a specific cleavage site in the CBA promoter region. NcoI digestion creates specific incision so that when insertion of the GFP transgene occurs in the correct orientation the fragment size would be smaller than that of the fragment created when placed in the reverse orientation. The agarose gel picture conveys the results from the NcoI digest of several potential clones. The only clone that demons trated the proper insert orientation is identified with the red arrow. Following plasmid verification via digest and agarose gel electrophoresis, sequence validation (ICBR Biotechnology DNA sequencing lab, University of Florida) of the identified clone wa s performed. This plasmid clone was further vetted when it was aligned against the virtual plasmid created in the Vector NTI program (Invitrogen) (Fig. 2 17).

PAGE 77

77 Figure 2 17 Alignment of clones containing the hGFP transgene ligated to pTR -UF -SB -XhoI/NotI plasmid. The top portion of the diagram depicts the map for the ligated pTR rN117-XN GFP plasmid. The map also illustrates the terminal repeat sequences, CMV immediate early enhancer/Chicken beta actin promoter regions, the rN117 ribozyme coding region, ColE1 and f1(+) replication origin sites and the ampicillin resistance gene. The bottom portion of the diagram shows the plasmid clone sequence aligned with the pTR rN117 -XN GFP plasmid. Sequences depicted in yellow represent 100% similarity to the conse nsus sequence. Blue indicates variations in sequence for one or more clones with the consensus sequence. Highlighted in the diagram are the UFSB sense and antisense primer sequences (purple and brown respectively), the XhoI and NotI restriction sites (dar k green and red respectively), the rN117 ribozyme cDNA and the hGFP reporter transgene (turquoise) pTR-rN117(X-N)-GFP5965 bp Amp r GFPh CMV ie enhancer Intron TR TR SV40 poly(A) Chiken b-actin promoter ColE1 ori f1(+) origin N117 Exon1 Mlu I (1915) Xho I (1921) Eco RI (173) Eco RI (1893) Not I (2011) Not I (2743) 1810 1916 1820 1830 1840 1850 1860 1870 1880 1890 1900 (1810) T A A C C A T G T T C A T G C C T T C T T C T T T T T C C T A C A G C T C C T G G G C A A C G T G C T G G T T A T T G T G C T G T C T C A T C A T T T T G G C A A A G A A T T C C T C G A A G A T C T A G G C A A C G pTR rN117(X N) GFP (1810) G T G C T G G T T A T T G T G C T G T C T C A T C A T T T T G G C A A A G A A T T C C T C G A A G A T C T A G G C A A C G rN117 XNG N2 (1) G T G C T G G T T A T T G T G C T G T C T C A T C A T T T T G G C A A A G A A T T C C T C G A A G A T C T A G G C A A C G Consensus (1810)

PAGE 78

78 NotI Figure 2 17. Continued 2746 2852 2760 2770 2780 2790 2800 2810 2820 2830 2840 (2746) C G C G C G G A T C C A G A C A T G A T A A G A T A C A T T G A T G A G T T T G G A C A A A C C A C A A C T A G A A T G C A G T G A A A A A A A T G C T T T A T T T G T G A A A T T T G T G A T G C T A T T G C T T T pTR rN117(X N) GFP (2746) C G C G C G G A T C C A G A C A T G A T A A G A T A C A T T G A T G A G T T T G G A C A A A C C A C A A C T A G A A T G C A G T G A A A A A A A T G C T T T A T T T G T G A A A T T T G T G A T G C T A T T G C T T T rN117 XNG N2 (891) C G C G C G G A T C C A G A C A T G A T A A G A T A C A T T G A T G A G T T T G G A C A A A C C A C A A C T A G A A T G C A G T G A A A A A A A T G C T T T A T T T G T G A A A T T T G T G A T G C T A T T G C T T T Consensus (2746) 2642 2748 2650 2660 2670 2680 2690 2700 2710 2720 2730 (2642) C T G T C T A A A G A T C C C A A C G A A A A G A G A G A C C A C A T G G T C C T G C T G G A G T T T G T G A C C G C T G C T G G G A T C A C A C A T G G C A T G G A C G A G C T G T A C A A G T G A G C G G C C G C pTR rN117(X N) GFP (2642) C T G T C T A A A G A T C C C A A C G A A A A G A G A G A C C A C A T G G T C C T G C T G G A G T T T G T G A C C G C T G C T G G G A T C A C A C A T G G C A T G G A C G A G C T G T A C A A G T G A G C G G C C G C rN117XNG N2 (787) C T G T C T A A A G A T C C C A A C G A A A A G A G A G A C C A C A T G G T C C T G C T G G A G T T T G T G A C C G C T G C T G G G A T C A C A C A T G G C A T G G A C G A G C T G T A C A A G T G A G C G G C C G C Consensus (2642) 2538 2644 2550 2560 2570 2580 2590 2600 2610 2620 2630 (2538) A G G A T G G A T C C G T G C A G C T G G C C G A C C A T T A T C A A C A G A A C A C T C C A A T C G G C G A C G G C C C T G T G C T C C T C C C A G A C A A C C A T T A C C T G T C C A C C C A G T C T G C C C T G pTR rN117(X N) GFP (2538) A G G A T G G A T C C G T G C A G C T G G C C G A C C A T T A T C A A C A G A A C A C T C C A A T C G G C G A C G G C C C T G T G C T C C T C C C A G A C A A C C A T T A C C T G T C C A C C C A G T C T G C C C T G rN117 XNG N2 (683) A G G A T G G A T C C G T G C A G C T G G C C G A C C A T T A T C A A C A G A A C A C T C C A A T C G G C G A C G G C C C T G T G C T C C T C C C A G A C A A C C A T T A C C T G T C C A C C C A G T C T G C C C T G Consensus (2538) 2434 2540 2440 2450 2460 2470 2480 2490 2500 2510 2520 2530 (2434) C G G C C A C A A G C T G G A A T A C A A C T A T A A C T C C C A C A A T G T G T A C A T C A T G G C C G A C A A G C A A A A G A A T G G C A T C A A G G T C A A C T T C A A G A T C A G A C A C A A C A T T G A G G pTR rN117(X N) GFP (2434) C G G C C A C A A G C T G G A A T A C A A C T A T A A C T C C C A C A A T G T G T A C A T C A T G G C C G A C A A G C A A A A G A A T G G C A T C A A G G T C A A C T T C A A G A T C A G A C A C A A C A T T G A G G rN117 XNG N2 (579) C G G C C A C A A G C T G G A A T A C A A C T A T A A C T C C C A C A A T G T G T A C A T C A T G G C C G A C A A G C A A A A G A A T G G C A T C A A G G T C A A C T T C A A G A T C A G A C A C A A C A T T G A G G Consensus (2434) 2330 2436 2340 2350 2360 2370 2380 2390 2400 2410 2420 (2330) G A C G G G A A C T A C A A G A C C C G C G C T G A A G T C A A G T T C G A A G G T G A C A C C C T G G T G A A T A G A A T C G A G C T G A A G G G C A T T G A C T T T A A G G A G G A T G G A A A C A T T C T C G G pTR rN117(X N) GFP (2330) G A C G G G A A C T A C A A G A C C C G C G C T G A A G T C A A G T T C G A A G G T G A C A C C C T G G T G A A T A G A A T C G A G C T G A A G G G C A T T G A C T T T A A G G A G G A T G G A A A C A T T C T C G G rN117 XNG N2 (475) G A C G G G A A C T A C A A G A C C C G C G C T G A A G T C A A G T T C G A A G G T G A C A C C C T G G T G A A T A G A A T C G A G C T G A A G G G C A T T G A C T T T A A G G A G G A T G G A A A C A T T C T C G G Consensus (2330) 2226 2332 2240 2250 2260 2270 2280 2290 2300 2310 2320 (2226) T G C A G T G C T T T T C C A G A T A C C C A G A C C A T A T G A A G C A G C A T G A C T T T T T C A A G A G C G C C A T G C C C G A G G G C T A T G T G C A G G A G A G A A C C A T C T T T T T C A A A G A T G A C pTR rN117(X N) GFP (2226) T G C A G T G C T T T T C C A G A T A C C C A G A C C A T A T G A A G C A G C A T G A C T T T T T C A A G A G C G C C A T G C C C G A G G G C T A T G T G C A G G A G A G A A C C A T C T T T T T C A A A G A T G A C rN117 XNG N2 (371) T G C A G T G C T T T T C C A G A T A C C C A G A C C A T A T G A A G C A G C A T G A C T T T T T C A A G A G C G C C A T G C C C G A G G G C T A T G T G C A G G A G A G A A C C A T C T T T T T C A A A G A T G A C Consensus (2226) 2122 2228 2130 2140 2150 2160 2170 2180 2190 2200 2210 (2122) T G A A G G T G A T G C C A C A T A C G G A A A G C T C A C C C T G A A A T T C A T C T G C A C C A C T G G A A A G C T C C C T G T G C C A T G G C C A A C A C T G G T C A C T A C C C T G A C C T A T G G C G T G C pTR rN117(X N) GFP (2122) T G A A G G T G A T G C C A C A T A C G G A A A G C T C A C C C T G A A A T T C A T C T G C A C C A C T G G A A A G C T C C C T G T G C C A T G G C C A A C A C T G G T C A C T A C C C T G A C C T A T G G C G T G C rN117 XNG N2 (267) T G A A G G T G A T G C C A C A T A C G G A A A G C T C A C C C T G A A A T T C A T C T G C A C C A C T G G A A A G C T C C C T G T G C C A T G G C C A A C A C T G G T C A C T A C C C T G A C C T A T G G C G T G C Consensus (2122) 2018 2124 2030 2040 2050 2060 2070 2080 2090 2100 2110 (2018) G C C A C C A T G A G C A A G G G C G A G G A A C T G T T C A C T G G C G T G G T C C C A A T T C T C G T G G A A C T G G A T G G C G A T G T G A A T G G G C A C A A A T T T T C T G T C A G C G G A G A G G G T G A pTR rN117(X N) GFP (2018) G C C A C C A T G A G C A A G G G C G A G G A A C T G T T C A C T G G C G T G G T C C C A A T T C T C G T G G A A C T G G A T G G C G A T G T G A A T G G G C A C A A A T T T T C T G T C A G C G G A G A G G G T G A rN117 XNG N2 (163) G C C A C C A T G A G C A A G G G C G A G G A A C T G T T C A C T G G C G T G G T C C C A A T T C T C G T G G A A C T G G A T G G C G A T G T G A A T G G G C A C A A A T T T T C T G T C A G C G G A G A G G G T G A Consensus (2018) 1914 2020 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 (1914) A C G C G T C T C G A G C T G A G A T G C A G G T A C A T C C C A C T G A T G A G T C C C A A A T A G G A C G A A A C G C G C T T C G G T G C G T C T G G G A T T C C A C T G C T A T C C A C G C G G C C G C C G C C pTR rN117(X N) GFP (1914) A C G C G T C T C G A G C T G A G A T G C A G G T A C A T C C C A C T G A T G A G T C C C A A A T A G G A C G A A A C G C G C T T C G G T G C G T C T G G G A T T C C A C T G C T A T C C A C G C G G C C G C C G C C rN117 XNG N2 (59) A C G C G T C T C G A G C T G A G A T G C A G G T A C A T C C C A C T G A T G A G T C C C A A A T A G G A C G A A A C G C G C T T C G G T G C G T C T G G G A T T C C A C T G C T A T C C A C G C G G C C G C C G C C Consensus (1914)

PAGE 79

79 Figure 2 17. Continued 2850 2956 2860 2870 2880 2890 2900 2910 2920 2930 2940 (2850) T T T A T T T G T A A C C A T T A T A A G C T G C A A T A A A C A A G T T A A C A A C A A C A A T T G C A T T C A T T T T A T G T T T C A G G T T C A G G G G G A G G T G T G G G A G G T T T T T T A G T C G A C T G pTR rN117(X N) GFP (2850) T T T A T T T G T A A C C A T T A T A A G C T G C A A T rN117 XNG N2 (995) T T T A T T T G T A A C C A T T A T A A G C T G C A A T Consensus (2850)

PAGE 80

80 Double Riboswitch Construction The next cloning endeavor was to establish the double riboswitch constructs regulating the sFlt 01 and GFP transgenes. The first objective was to perform a double digest with the MluI and XhoI restriction enzymes of the pPCR -Script Amp SK -MluI/XhoI rN117, pTR rN117-XN D29Gly (sFlt) and the pTR rN117-XN GFP plasmids in order to isolate the ribozyme insert conta ining the MluI and XhoI restriction site ends as well as establish open and linear vectors for ligation. The vector to insert ratio for the ligation was set at one to seventy. The ligation mixtures were allowed overnight incubation followed by DNA cleans ing and concentration from ligation reagents (DNA Clean & ConcentratorTM 5, Zymo Research). Plasmid DNA acquired from the ligation reactions were then transformed into the SURE electro competent E. coli cells (Stratagene). Following overnight incubatio n there were no bacterial colonies present on the ampicillin selection plates. Plating of the transformed SURE cells was repeated. Moreover varying amounts of plasmid DNA, ranging from 0.1ng to 50ng, was transformed into these cells in an attempt to impr ove transformation efficiency. After several efforts, a suggestion was made by Dr. Laising Yen (Department of Genetics, Harvard Institute of Human Genetics), to use E.coli cells instead of the SURE E.coli cells. Transformation of these cells result ed in successful establishment of bacterial colonies. Afterwards colonies were picked and then amplified with liquid LB cultures. Plasmid DNA was extricated with the Miniprep kit (Qiagen). It is possible that the SURE strain of cells were not permissiv e to the low yield of ligated plasmids containing the tandem oriented ribozyme sequences. As a result of modifications to the SURE strain genome, E. coli genes that are responsible for rearrangement and deletion of DNA irregularities were removed. This allows for efficient transformation as well as cloning of irregular structures such as inverted repeats and secondary

PAGE 81

81 unconventional structures. Transformat ion within SURE cells was reattempted after the newly ligated plasmids were amplified with the large culture prep. Following an overnight incubation on the ampicillin selection plates colonies did appear. Large LB cultures were inoculated with the SURE cell colonies and the plasmid DNA was obtained. In order to evaluate proper plasmid structure for the pTR rN117II D29Gly (sFlt) and the pTR rN117-II GFP constructs a virtual digest and gel electrophoresis was performed with the Vector NTI program (Invitr ogen). Based on the virtual digest, the MluI/NotI double digest of the pTR rN117-II D29Gly (sFlt) and the pTR rN117II GFP plasmids produced fragment bands around 1.1 kb and 700 bp, respectively, in size. The plasmids extracted from the large culture preps were then digested with the MluI and NotI enzymes and then run on a 1.2% agarose gel (Fig. 219). Figure 2 18 Depiction of the pTR rN117(II) D29Gly (sFlt) and pTR rN117 (II) GFP constructs The plasmid maps convey the pTR rN117(II) -D29Gly (sFlt) and pTR rN117(II) GFP with the MluI and NotI restriction sites indicated. The maps also illustrate the terminal repeat sequences, CMV immediate early enhancer/Chicken beta actin promoter regions, two tandem oriented rN11 7 ribozyme coding regions, transgene cassette (i.e. sFlt 01 or hGFP), ColE1 and f1(+) replication origin sites and the ampicillin resistance gene. pTR-rN117-(II)-GFP6048 bp Amp r GFPh CMV ie enhancer Intron TR TR SV40 poly(A) Chiken b-actin promoter ColE1 ori f1(+) origin rN117 rN117 Exon1 Mlu I (1915) Not I (2094) Not I (2826) pTR-rN117(II)-D29Gly (Sflt)6407 bp Amp r Flt-1 D(2)/9G?Fc (#334) CMV ie enhancer Intron TR TR SV40 poly(A) Chiken b-actin promoter ColE1 ori f1(+) origin rN117 rN117 Exon1 Mlu I (1916) Not I (2095) Not I (3184)

PAGE 82

82 Figure 2 19 Digestion of plasmid clones expressing the double riboswitch sFl 01 and hGFP constructs. The picture displays the pTR rN117(II) GFP clones outlined by the red arrow brackets and the pTR rN117 (II) D29Gly (sFlt) plasmid clones highlighted by the blue arrow brackets. Plasmid clones were double digested with the MluI and NotI restriction enzymes. Samples were mixed with DNA loading dye and run on a 1.2% agarose gel at 120 volts for 1.5 hours. The running buffer was TBE. 1 KB plus DNA Ladder

PAGE 83

83 CHAPTER 3 EXPERIMENTAL PROCEDURES Human Embryonic Kidney (HEK) 293 Tissue Culture Protocol Thre e important issues were to be addressed in this experiment. First, a comparison of protein level produced by the plasmid system containing a constitutive promoter (i.e. CMV/CBA) to that of the drug inducible system (i.e. hammerhead riboswitch). Second, t he concentration of drug inducer required to provide optimal protein production needed to be established. Finally, the issue of whether or not transcriptional leakiness occurs with the riboswitch druginducible system had to be examined. Seeding of 6 w ell Tissue Culture Plate s For each of the six wells in the tissue culture plate (Corning) 1.5x105 cells/mL was added. Two milliliters of tissue culture growth medium [Dulbeccos modified eagles medium (Hyclone), 10% fetal bovine serum (FBS), L -glute, PennSt rep] was added to each well. In total, 3x105 cells in 2 mL of media was added to each well and 18x105 cells in 12 mL for each six well plate. Approximately 15mL of HEK 293 cells was provided by the Hauswirth lab in two 15mL conical tubes. Within the tis sue culture hood, each 15mL tube of cells was mixed and 0.02 mL of solution from each tube was pipetted into two separate 1.5mL microcentrifuge tubes. Afterwards the microcentrifuge tubes were removed from the hood and 0.02 mL of trypan blue dye was added to each 1.5mL tube of cell suspension. The solution was then thoroughly mixed and 0.01 mL of dye plus cell suspension was placed into a hemacytometer for cell counting. The total amount of cells needed, which is estimated by the number of plates needed, was divided by the amount of cells per mL for the individual 15mL conical tube. This calculation established the amount of solution from the 15mL conical tube that would be needed in order to acquire the desired 1.5x105 cells/mL per well. Tissue culture medium was added to the cell suspension in

PAGE 84

84 order to obtain the final desired volume. In the tissue culture hood, 2 mL of the mixture of HEK 293 cells and media was then added to each well and then placed into the 37oC incubator for one day. Transfectio n of HEK 293 Cells Twenty -four hours after seeding of tissue culture plates the HEK 293 cell were transfected using the Fugene HD transfection reagent (Roche). For single plasmid transfections the ratio of Fugene HD (in microliters) to plasmid DNA (in mic rograms) was 3 to 1; for two plasmid co -transfections the ratio should be 6:1:1. DNA plasmids were diluted with 100 L of tissue culture media lacking antibiotics and serum. Following dilution of the DNA plasmid, Fugene HD reagent was added in order to c reate the transfection complex. The solution was then allowed to incubate at room temperatures for 30 minutes. Afterwards, 0.1 mL was added to each well of the six well tissue culture plates and then placed into the 37oC incubator for one day. Induction of HEK 293 Cells HEK 293 cells were induced immediately after plasmid transfection. Toyocamycin (Berry & Assoc.) was solubilized in 20% DMSO (Sigma) in order to create a 10mM stock. From this stock solution the Toyocamycin was then diluted with the tiss ue culture growth media to create 0.1 M 0.5M, 0.75 M 1M, and 1.5M working concentrations used for in vitro induction. Afterwards, 5 -fluorouridine (5-FUR, Sigma) was diluted in water to create a 200M stock. 5 -FUR was further diluted with tissue culture growth media and added to in vitro working concentrations of Toyocamycin in order to establish varying conc entration ratios of 5 -FU R to Toyocamycin. For the 0.1M, 0.5M, 0.75M 1M, and 1.5M inducer concentrations, the concentration ratio of 5 FUR to Toyocamycin was either 50:1, 100:1, or 150:1. This final mixture of 5 FUR and Toyocamycin was used to inhibit the riboswitch system. This was

PAGE 85

85 considered the point at which gene expression was induced. Then 0.9 mL of inducer solution was added to wells designated to receive induction. Wells anticipated to be non induced received 0.9mL of the growth medium. A t this point, total volume in each well was 3 mL. The plates were placed back into the 37oC incubator and allowed 48h of incubation. Media C ollection from HEK 293 Cells At the conclusion of 48h of induction, tissue culture medium was extracted. The six well plates were removed from the 37oC incubator and placed in a sterile flow laminar tissue culture hood. Afterwards, individual plates were uncovered and then tilted in a 45 angle in order to siphon tissue culture medium using a sterile pipette. The medium was then placed in chilled 15mL tubes labeled according to the experimental condition of the wells. The tubes were then centrifuged at 1000 rpm for 5 minutes. The supernatant was then decanted and saved on ice. Sandwich ELISA One 96-well Immulon flat bottom microtiter plate (Dynex Technologies) was coated with 0.1 mL (per well) of 1g/mL of anti human VEGF R1 (Flt 1) antibody (R&D systems) in 1xPBS plus 0.1M NaHCO3 pH 8.2. Afterwards the plate was covered with micro test film and incubate d overnight in a 4oC refrigerator. The next day the plate was washed with a 1 liter solution of 1xPBS pH 7.2 plus 0.5mL of Tween 20 using an automatic plate washer. After washing, the plate was inverted and gently tapped against a paper towel on the benc h top to remove any excess liquid from the plate. Following this the plate was blocked with 0.1mL (per well) of 10% FBS/PBS for one hour in a 37oC incubator. The plate was sealed with a micro test film. Subsequently, the plate went through another washin g. Following the washing, a two fold serial dilutions of recombinant human VEGF R1/Flt 1/Fc chimera standard (R&D systems) was performed. Twelve microcentrifuge tubes, numbered 1 12, were filled with 0.5 mL of 10% FBS/PBS.

PAGE 86

86 Tube 1 had 100 L of the recom binant human VEGF R1/Flt 1/Fc chimera standard diluted in 700 L of 10% FBS/PBS in order to establish a concentration of 62.5ng/mL. The solution was mixed and then 0.5mL from tube one was transferred to tube 2. The final concentration of Tube 2 was 31.3ng/mL. A new pipette tip was used to mix Tube 2 and transfer 0.5 mL to tube 3. This pattern was followed for tubes 4 11; tube 12 only contained 10% FBS/PBS. The twelve diluted VEGFR1 standards were added (0.1mL) to the 96-well plate in duplicates. Sup ernatant samples collected from either tissue culture media or ocular homogenate were allowed to thaw on ice and then diluted two fold with the 10% FBS/PBS. These diluted samples were also added to the 96 -well plate. The plate was then covered with film and placed in the 37oC incubator for one hour. Following the incubation, the plate was washed five times and 0.1 mL of the anti human VEGFR1 (Flt 1) biotinylated capture antibody (polyclonal) was diluted in 10% FBS/PBS and added to the plate. The plate was then placed in the 37oC incubator. The plate was washed three times following the hour of incubation. Streptavidin diluted in 10% FBS/PBS was added to the plates (0.1mL) and allowed one hour incubation at 37oC. After incubation the plate was washed t hree times and 0.1mL of a 1:1 mixture of TMB (3,3,5,5 tetramethylbenzidine) peroxidase substrate and peroxidase solution (Kirkegaard & Perry Laboratories) was added. The color reaction was allowed to occur for 15 minutes; afterwards, 0.1mL of stop buffe r (1M H3PO4) was applied. Plate analysis was performed by reading the absorbance at 450nm in an automated microplate reader. Fluorescence Microscopy After 48h of HEK 293 cell induction, the plates were removed from the 37oC incubator and then analyzed us ing the Axioplot Z microscope (Zeiss) equipped with color camera. The GFP images were captured at 20 X magnification using the FITC fluorescence filter. The Axiovision digital image processing software (Zeiss) was used to analyze the images.

PAGE 87

87 Quantificat ion of GFP expression was measured by counting GFP cells using Photoshop software. In Vivo Procedures Time R elease Drug Formulation and Implantation The Toyocamycin / 5 -FUR inducer cocktail was delivered to mice by means of a time release drug pellet ( Innovative Research of America). Inducer cocktail release is based on the matrix -driven delivery (MDD) system which works by the double process of erosion of the drug pellet and diffusion of the active ingredients ( i.e., Toyocamycin/5 FUR). The inducer c ocktail is released immediately upon pellet implantation, and release follows zero order kinetics. The time release pellets were prepared based on the formulation of a previous report248. In that experiment the inducer cocktail contained 20uM of Toyocamycin and 12mM of 5 -FUR. This established a 5 FUR to Toyocamycin concentration ratio of 600 to 1. The pellets formulated for this project contained 110g of 5 FUR and 204ng of Toyocamycin which established a concentration ratio of 539 to 1. The pellets were formulated to release a steady dose of 7.9g of 5 -FUR and 0.15ng of Toyocamycin per day for 14 days. The time release pellets are composed of the active drug ingredients fused with a matrix consisting of cholesterol, cellulose, lactose, phosphates and stearates. The pellets are considered biologi cally inert and do not have an e ffect on the animal immune system. The pellets are implanted with the aid of a reusable stainless steel 10 gauge needle called a trochar. The trochar also contains an obturator that can be used for easy pellet implantation. The pellets are subcutaneously implanted on the l ateral side of the neck between the ear and shoulder. Laser CNV T reatment Twenty four hours before subjecting C57BL/6 mice to laser treatment the animals were implanted with either the Toyocamycin/5 FUR or placebo time release drug pellets. Each animal

PAGE 88

88 was placed into a chamber containing 2 mL of isoflurane inhalation anesthetic (Abbott). The animal remained in the chamber for 30 45 seconds. Afterwards the animal was removed from the container and placed onto a surgical bed with their snout inserted into a nozzle connected to a gas line from an Isotec vaporator (SurgiVet). The Isotec vaporator administers isoflurane mixed with compressed medical grade oxygen (Airgas). A gas vacuum line was also placed adjacent to the Isotec vaporator gas line in orde r to remove any isoflurane/oxygen gas that escapes into the atmosphere. Once the animal was fully anesthetized, the trochar was placed into the Germinator 500 dry sterilizer (CellPoint Scientific) and incubated within the sterilizer for 15 seconds at a te mperature of 500 F. Following sterilization, the trochar was cooled at room temp for 20 seconds and wiped with a sterile alcohol pad. The drug pellet was inserted into the bevel of the trochar and then subcutaneously implanted. Afterwards the Isotec va porator was turned off and the animal is disconnected from the Isotec vaporator gas line and returned to its containment cage. One day after drug pellet implantation, the mice were prepared for ocular laser treatment surgery. Pupils were dilated with on e drop per eye of 2.5% phenylephrine hydrochloride ophthalmic solution (Akorn) and 1% atropine sulfate ophthalmic solution (Akorn). Mice received a series of three applications of the eye drops separated by 30 minute intervals. After dilation, animals we re weighed and then injected with a 0.1mL/20g dose of Ketamine/Xylazine, i.p. The anesthesia mixture was created by adding 100 L of 100mg/mL of Ketamine HCl (Phoenix), 20 L of 100mg/mL of Xylazine (Phoenix), and 580 L of sterile phosphate buffered sa line (PBS) respectively. The PBS solution was created by dissolving the following in 800mL distilled H2O: 8g of NaCl, 0.2g of KCl, 1.44g of Na2HPO4, and 0.24g of KH2PO4. Afterwards, the solution was adjusted to a pH of 7.4. The solution was then adjusted to 1L with distilled

PAGE 89

89 water. Afterwards the animals were given one drop per eye of 2.5% phenylephrine hydrochloride and were allowed 3 5 minutes to become fully anest hetized. Once the mouse was fully under, it was placed into a tubular chamber allowing exposure the animals head. After the animal was secured into the chamber, the whiskers were clipped and then a drop of 2.5% of hypromellose ophthalmic demulcent soluti on (Gonak, Akorn) was placed in each eye. Afterwards, circular microscope cover glass slips (Fisherbrand) were placed on top of the eyes. The Gonak solution plus the cover glass slip allowed for better visualization of the fundus as well as focus the l aser beam delivery. The animals were situated onto an indirect ophthalmoscope apparatus reconfigured for fundoscopic view in mice. In addition a 532nm laser (Iridex Medical Oculight GL, Iridex Corporation) was attached to the indirect ophthalmoscope appa ratus and directed onto the fundus of the animal. The laser intensity was set at 300mW with a pulse duration of 100ms and a laser size of 50M. Five laser burns were placed around the optic nerve at about 2 optic disc diameters radially outwards while av oiding major vessels. This procedure was performed in each eye. Afterwards, the animal was removed from the indirect ophthalmic/532nm laser apparatus as well as the tubular containment chamber, and then bacitracin -neomycin-polymyxin veterinary ophthalmic ointment (Vetropolycin, Pharmaderm) was applied to each eye. Animals were then placed into cages for post -op recovery. Tissue Processing Fourteen days after laser burn treatment the pupils of mice were dilated with three applications of the 2.5% pheny lephrine hydrochloride and 1% of atropine sulfate ophthalmic solution eye drops. Following dilation mice were injected I.P. with the Ketamine/Xylazine anesthesia at a dose of 0.1mL/20g. Once animals were deemed fully anesthetized they were then injected with 50mg/mL mixture containing 2000SD FITC -dextran molecule (250mg, Sigma), heparin ammonium salt (2.75mg, Sigma), sodium nitrate (250mg, Sigma) and sterile PBS (5mL)

PAGE 90

90 that had been filtered through a 1m polyether sulfone membrane with polypropylene housi ng (Whatman). One hundred microliters of this mixture was injected into the retro -orbital venous sinus of each eye with a cc U 100 Insulin Syringe 28G (Becton Dickinson). Afterwards fundoscopic pictures are taken with Genesis Kowa hand held fundus ca mera and power unit (Kowa Company Ltd.). After acquiring fundoscopic pictures, mice were euthanized via carbon dioxide inhalation followed by cervical dislocation. Mice were individually placed into a clear fiberglass chamber. Afterwards 100% carbon dio xide was pumped into the chamber. Animals remained in the chamber for 2 5 min after unconsciousness was observed in order to ensure death. Lastly the carcass were removed from the chamber and then subjected to cervical dislocation to confirm death. Ocul ar tissue was then later extracted. The extracted eyes were placed into 4% paraformaldehyde for at least 1hr at room temperature and then placed into PBS. Extraocular tissue was then dissected away from the bulb of the eye. Afterwards, the cornea was cu t away at the limbus cornea interface ( i.e., the ora serrata). Once the cornea was removed, the iris and lens were also extracted. At this point, the retina was lightly teased away from the posterior portion of the eye with forceps. Four radial cuts wer e then made in remaining ocular tissue (i.e. RPE, choroid, sclera) in order to flatly mount this tissue onto Superfrost/Plus microscope slides (Fisherbrand). One drop of Vectashield Hard Set Mounting Medium with DAPI H 1500 (Vector) was added to tissue. These steps were repeated so that both the left and right eyes were placed on to the glass slide and were mounted with the mounting media. Finally the slide was covered with Fisherfinest Premium cover glass slips (Fisherbrand). The slides were allowe d to dry overnight and then were visualized with the Axiovert 200 microscope (Zeiss) and AxioCam MRc5 camera (Zeiss). The images were gathered and organized with the Axiovision version 4.6.1.0 Zeiss imaging solution software ( Zeiss). Once images were ta ken,

PAGE 91

91 Image J software (NIH) was used to calculate the fluorescence intensity and area of the neovascular tufts found within the individual burn holes. These numbers were multiplied and the data were organized with the Excel program (Microsoft). Students t test was used to calculate the p values for each experiment. After data acquisition and analysis the information was then presented in graph form with the aid of the Sigma Plot graphing software (Systat).

PAGE 92

92 CHAPTER 4 EVALUATION OF TRANSGENE EXPRESSION Determination of In vitro Inducer D osage There were three inducer cocktail treatment groups with six arms per group. The treatment groups represented the different concentration ratios of 5 -FUR to Toyocamycin. The ratios for the three groups were 50:1 100:1 and 150:1 of 5-FUR to Toyocamycin, and each treatment arm is a single concentration of Toyocamycin. Each Toyocamycin concentration within the treatment arm was mixed at the stated ratio of 5 -FUR for that treatment group. Treatment arms were 0M, 0 .1M, 0.25M, 0.5M, 0.75M, and 1M. Figure 41 depicts tissue culture wells exhibiting GFP expression from HEK 293 cells transfected with the pTR rN117XN -hGFP plasmid and induced with the various concentrations of the 5 FUR/Toyocamycin cocktail. In th e absence of inducer cocktail, GFP expression persisted despite the influence of riboswitch repression. The level of repression could be indirectly assessed by comparing the length of camera exposure time given to induced cells with non induced cells. I n this case when examining the 0 and 0.1M groups, it took a 4.2 fold longer camera exposure time in the non induced state to visualize GFP expression. During induced conditions, greater GFP expression was seen when the Toyocamycin/5 -FUR inducer cocktail concentrations were elevated. In addition to visualizing greater GFP fluorescence between treatment arms due to escalating Toyocamycin concentrations, GFP fluorescence intensity also increased between treatment groups as the cocktail ratio increased from 50:1 to 150:1.

PAGE 93

93 0M, (2.36s) 0.1M, (562ms) 0.25M, (562ms) 0.5M, (562ms) 0.75M, (562ms) 1M, (562ms) Toy Con. 5FUR Toy ratio 50:1 100:1 150:1 Figure 4 1 Qualitative determination of inducible expression with the pTR -rN117XN -hGFP plasmid. Each panel represents fluorescent microscopic images of HEK 293 cells transfected with the pTR -rN117-XN -hGFP plasmid and induced with varying concentrations of the 5 FUR / Toyocamycin cocktail. The column s of panels are differentiated based on the concentration of Toyocamycin added to the inducer cocktail. The camera exposure time needed to observe fluorescence for each condition is indicated in parenthesis. The row s of panels indicate the concentration ratio of 5 -FUR to Toyocamycin drug cocktail used for induction. HEK 293 cells were either non -induced (i.e. 0M) or received a specific amount of the inducer cocktail (i.e. 0.1, 0.25, 0.5 0.75 and 1M). One panel 5FUR/Toy) is absent because of complete cell death likely due to drug toxicity. The panels above are representative of experimental results performed in triplicate. Assessment of Single and Double Riboswitch Performance The next endeavor was to compare the level of GFP expression for the pTR -rN117XN hGFP (single ribozyme) construct to that of the pTR rN117II -GFP (double ribozyme) construct (Fig. 1 2). In this experiment the cocktail concentration ratio was set at 150:1 despite the increasing concentrations of Toyocamycin added to the tissue culture well. For both the pTR

PAGE 94

94 rN117XN -hGFP and pTR -rN117II GFP constructs GFP induction was increased as inducer cocktail amount increased. Unfortunately, tissue toxicity was ev ident for some levels of Toyocamycin/5 -FUR cocktail administered to the HEK 293 cells. Cell death due to drug toxicity was noticed under the 0.75 and 1M inducer conditions. For both riboswitch constructs, the atest amount of GFP expression. The increase in cell death diminished the amount of GFP expression seen at the 0.75 and 1M inducer conditions compared to the 0.5M inducer condition. Thus in order to limit the amount of inducer related toxicity but still maximize gene inducibility it was decided to employ the inducer condition that had a 5 FUR to Toyocamycin concentration ratio of 150:1 and only use a 0.5M Toyocamycin. The double ribozyme construct, pTR rN117II -h GFP exhibited greater inhibition in the non induced state than the single ribozyme construct, pTR -rN117-XN -hGFP In Fig.4 2, row A, the noninduced state for the pTR rN117-XN -hGFP construct demonstrated measurable expression of GFP in spite of ribozyme repression. This was similarly seen under non-induced conditions for HEK 293 cells transfected with the pTR -rN117II -h GFP construct (Fig. 4 2 row B). In order to visualize GFP signal t he noninduced condition for the pTR -rN117II hGFP required 2.8 fold longer camera exposure than cells transduced with the pTR rN117-XN -hGFP plasmid (Fig. 4 2). Despite a 39 fold increase in GFP fluorescence during induction with pTR rN117XN -hGFP plasmid, in contrast to the pTR rN117II -hGFP plasmid the difference in exposure time during the noninduced st ate indicates that the pTR -rN117-XN-hGFP plasmid was far less efficient when controlling basal "leaky" expression than the pTR rN117II-hGFP construct

PAGE 95

95 0M 764ms 0.5M 28ms 0.75M 28ms 1M 28ms A 0m 2.15s 0.5M 1.09s 0.75M 1.09s 1M 1.09s B Figure 4 2 Qualitative assessment of inducible gene expression between the pTR rN117-XN hGFP and pTR rN117II -h GFP vectors. Each panel represents fluorescent microscopic images of HEK 293 cells induced with varying concentrations of the Toyocamycin/5 -FUR cocktail. These conditions are based on the concentration of Toyocamycin added to the inducer cocktail. The came ra exposure time needed to observe fluorescence for each condition is indicated in parenthesis. The row of panels designates the plasmid used for transducing the HEK 293 cells. Samples in row A were transfected with the Single Riboswitch pTR rN117-XN -hGF P plasmid HEK 293 cells in row B were transfected with the Double Riboswitch pTR rN117IIh GFP plasmid. HEK 293 cells were either non -induced (i.e. 0M) or received a specific amount of the inducer cocktail (i.e. 0.1, 0.25, 0.5 0.75 and 1M). The panels above are representative of experimental results performed in triplicate. Following analysis of riboswitch regulation of GFP, the next objective was to evaluate sFlt 01 transgene regulation with the single and double riboswitch vectors. Figure 4 3 demonstrates HEK 293 expression of sFlt 01 while under the regulation of the pTR rN117-XN D29Gly (sFlt) and pTR rN117IID29Gly (sFlt) constructs. As seen with the GFP expression analysis, experiments with the pTR rN117-XN D29Gly (sFlt) construct exhibit ed 7.3 fold more leaky expression than the [ pTR rN117II D29Gly (sFlt) vector. Under induced conditions, the

PAGE 96

96 pTR -UF -SB -sFlt 01 plasmid (Positive Control) produced 1.2 and 2.2 fold more expression of sFlt 01 than the pTR rN117-XN D29Gly (sFlt) (Single Ribo zyme) and pTR rN117IID29Gly (sFlt) (Double Ribozyme) vectors, respectively. Comparing pTR rN117-XND29Gly (sFlt) to the pTR rN117II D29Gly (sFlt) the former produced 1.8 fold more expression than the latter. The sFlt 01 and GFP expression profiles dem onstrated that the double riboswitch vectors were less leaky than their single riboswitch counterparts. Therefore, further experiments employed the double riboswitch. Figure 4 3 Quantification of sFlt 01 expression in HEK 293 cells. sFLT 01 levels wer e determined by ELISA from supernatant tissue culture media extracted from individual wells within a six well tissue culture plate. The experimental conditions were performed in triplicates. Double ribozyme is pTR rN117IID29Gly (sFlt) ; single ribozyme i s pTR rN117IID29Gly (sFlt) ; positive control is pTR -UF -SB -sFlt 01. Error bars represent standard error of mean (SEM)

PAGE 97

97 After demonstrating in vitro transgene regulation, the next task was to analyze riboswitch control of transgene expression in the mo use retina. Six weeks after intravitreal injection of adult C57BL/6 mice with the rAAV2 pTR rN117II D29Gly (sFlt) vector ocular homogenates were analyzed via sandwich ELISA in order to quantify levels of the sFlt 01 protein. The animals had been implan ted with time release pellets containing either the Toyocamycin/5 FUR inducer drug cocktail or a placebo formulation two weeks after injection (Table 4 1). Based on sFLT 1 ELISA analysis the riboswitch system provided inducible regulation of the sFlt 01 t ransgene (Fig. 4 4). For those animals receiving the inducer drug implant, virus injected eyes demonstrated a 1.7 fold greater expression than the non -injected eyes (Fig. 4 4). Additionally, animals that were implanted with the placebo pellet showed no difference between vector injected and non -injected eyes (Fig. 4 4). For those eyes that received vector injection, there was 2.2 fold more expression for drug cocktail implanted animals than placebo treated animals. This in vivo expression profile furth er demonstrates the inducibility and tightness of the double riboswitch vector when regulating sFlt 01 expression. Table 4 1 Time line for C56BL/6 injection with rAAV2 pTR -rN117II D29Gly (sFlt) and analysis of in vivo expression sFLT 01. Time Day 42 Day 0 Day 14 Procedure: Intravitreal Injection : rAAV2 pTR rN117 II D29Gly (sFlt) Subcutaneous Implants : Drug: Toy/5 FUR (150:1) Placebo Enucleation/ELISA Animals received vector injections within the right eyes, while left eyes remained non -injected. Pellets were implanted into the dorsal lateral region of neck. Animals were euthanized, enucleated and an ELISA analysis of retinal homogenates was subsequen tly performed.

PAGE 98

98 Figure 4 4 Quantification of sFlt 01 expression in C57BL/6 mice. Each experimental animal was intravitreally injected in one eye with either the rAAV2 pTR rN117 II -D29Gly (sFlt) vector or the rAAV2 -pTR -UF -SB -sFlt 01 vector. Retinal homogenates were collected six weeks post viral vector injection. Error bars represent SEM. rAAV2 -Riboswitch Analysis in a Therapeutic Setting With the successful demonstration of in vitro as well as in vivo regulation of the sFlt 01 transgene with the hammerhead riboswitch system, the next step was to test the inducible system in a mouse model for human macular degeneration. By using the laser CNV mouse model, the functionality of the hammerhead riboswitch system as a gene therapy option can be evaluated. The laser CNV model is one of the most familiar models for wet AMD and is a gold standard model for preclinical drug testing for subretinal CNV. This model utilizes a 532nm laser attached to an indirect ophthalmosco pe. The laser is focused on the fundus of the animal and burns of varying sizes and power intensities are created. This procedure is highly reproducible, Un-Induced Induced CBA-sFlt sFlt-1 (pg/ml) 0 50 100 150 200 250 Un-Injected eyes Injected eyes N = 2 N = 3 N = 5

PAGE 99

99 and it mimics many features associated with wet AMD. These features include: rupture and subsequent infiltration of choroidal vessels, subretinal accumulation of fluid, leukocyte recruitment, fibrovascular scarring, and increased VEGF up regulation within RPE cells. As illustrated in Table 4 2, 6 8 week old C57BL/6 mice were intraocularly injected with the rAAV2 pTR rN117II D29Gly (sFlt) vector. Six weeks post intraocular injection these mice were implanted with either drug pellets containing the inducer cocktail or a placebo formulation. Twenty -four hours later, these animals were subjected to laser CNV treatment. Fourteen days post laser treatment, animals were ocularly perfused with a high molecular weight FITC -dextran molecule and enucleated. Table 4 2 Time line for riboswitch injection with induction followed by laser CNV treatment and endpoint analysis. Time Day 42 Day 1 Day 0 Day 14 Procedure Intravitreal Injection : rAAV2 pTR rN117 II D29Gly (sFlt) Subcutaneous Implants : Drug: Toy/5 FUR (150:1) Placebo Laser treatment Enucleation/Tissue processing Animals received vector injections within the right eyes, while left eyes were non injected. Pellets were implanted into the dorsal lateral region of neck. Both eyes received approximately 5 laser lesions. Animals were euthanized and then perfused with retro orbital injections of FITC -dextran and 1xPBS. Subsequently mice were enucleated and posterior eye cups were flat mounted. Figure 4 5 illustrates the enface appearance of retinal laser burns delivered to two separate C57BL/6 animals eight weeks post intravitreal virus injections and fourteen days post laser operation. CNV growth in eyes that were intravitreally injected with the rAAV2 pTR rN117II D29Gly (sFlt) vector demonstrated a stati stically significant (p = 0.003) reduction in neovascular growth compared to non -injected eyes while induced with the drug cocktail (Fig. 4 6 ).

PAGE 100

100 Figure 4 5 FITC visualization of CNV tufts following laser injury in C57BL/6 mice. The horizontal bar separates eyes from sample animals. Photomicrographs above and below the bar: top row of panels demonstrates individual burns placed in the left eye (L), which received no viral injection, while the bottom panels represent burns for the corresponding right eye (R), which was treated with ribozyme regulated sFlt 01. Mice were implanted with pellets containing the inducer cocktail. Eyes were enucleated and inner eye cups minus retinal tissue were flat -mounted 2 weeks following laser CNV operation. Images (20x) were captured via fluorescence microscopy. Retro orbi tal injections of a high molecular weight FITC dextran molecule were used to highlight the vasculature. An average of 5 burns was placed in each eye. N=4.

PAGE 101

1 01 Figure 4 6 Evaluation of CNV development in animals injected with the rAAV2 pTR rN117IID29Gly (sFlt) vector. Animals received intravitreal vector in right eyes while left eyes remained un -injected. FITC perfused animals were enucleated and flat -mounts of inner eye cups devoid of retinal tissue were performed 2 weeks post lase r CNV operations and drug pellet implantation. Neovascular growth was determined by the product of the CNV area and the fluorescence intensity (m2*FI) for the average of 20 laser burns ( avg 5 burn per eye). N=4, P=0.003. Error bars represent SEM. Th is experiment was later repeated, but this time animals were divided into two treatment arms: placebo and inducer cocktail treated. Figure 4 7 shows laser burns to retinas from two animals within the inducer treated group. As seen in the previous experim ent, eyes injected with the rAAV2 pTR rN117II D29Gly (sFlt) vector demonstrated statistically significantly less neovascularity (p = 0.03) than corresponding eyes that did not receive viral vector injection (Fig 4 8). For animals that received placebo t reatment pellet ( i.e ., no inducer) and subsequent laser CNV surgery (Fig. 4 9), there was no significant difference (p = 0.6) found between viral vector injected eyes to that of the corresponding noninjected eyes (Fig. 4 10). 0 200000 400000 600000 800000 1000000 1200000 1400000 Left RightCNV Area (m2*FI) Inj Eye Non Inj Eye

PAGE 102

102 Figure 4 7 FITC visualize d CNV tufts following laser injury in C57BL/6 mice. The horizontal bar separates each sample animal. Photomicrographs above and below the bar: top row of panels demonstrates individual burns placed in the left eye (L), which received no viral injection, while the bottom panels represent burns for the corresponding right eye (R), which received ribozyme regulated sFlt. Mice were implanted with pellets containing the inducer cocktail. After FITC perfusion, eyes were enucleated and the inner eye cup minus retinal tissue was flat -mounted 2 weeks following laser CNV operation. Images (20x) were captured via fluorescence microscopy. Retro -orbital injections of a high molecular weight FITC dextran molecule were used to highlight vasculature. Red 20 m scale bars were placed in each panel. N=6.

PAGE 103

103 Figure 4 8 Therapeutic evaluation of CNV tuft reduction in animals injected with the rAAV2 pTR rN117II D29Gly (sFlt) vector. Animals received intravitreal vector injection in right eyes while left eyes remained un-injected. Animals were enucleated and flat mounts of inner eye cups devoid of retinal tissue were performed 2 weeks post laser CNV operations and drug pelle t implantation. Neovascular growth was determined by the product of the CNV area and the fluorescence intensity (m2*FI) for the average of 30 laser burns ( avg. 5 burn per eye). N =6, P=0.03. Error bars represent SEM. Figure 4 9 FITC visualization of CNV tufts following laser injury of C57BL/6 mice. Photomicrographs demonstrates individual burns placed in the left eye (L), while the bottom panels represent burns for the corresponding right eye (R). Animals received therapeutic vector injection in righ t eyes and were implanted with pellets containing the placebo drug. Eyes were enucleated and the inner eye cup minus retinal tissue was flat -mounted 2 weeks following laser CNV operation. Images (10x) were captured via fluorescence microscopy. Retro -orbital injections of a high molecular weight FITC -dextran molecule were used to highlight vasculature. N=3. 0 1000000 2000000 3000000 4000000 5000000 6000000 Left RightCNV Area (m2*FI) Inj Eye

PAGE 104

104 Figure 4 10 Analysis of CNV tuft development in animals injected with the rAAV2 pTR rN117II D29Gly (sFlt) vector while induced with time releas e placebo pellets. Animals received intravitreal vector injection in right eyes while left eyes remained un -injected. Placebo pellets were subcutaneously implanted roughly six weeks following vector injection. Animals were enucleated and flat -mounts of inner eye cups devoid of retinal tissue were performed 2 weeks post laser CNV operations and drug pellet implantation. Neovascular growth was determined by the product of the CNV area and the fluorescence intensity (m2*FI) for the average of 15 laser bur ns (avg. 5 burn per eye). N =3, P=0.6 Error bars represent SEM. The next goal for this project was to demonstrate comparable levels of therapeutic benefit with the riboswitch method as seen with the CBA -promoter system. Figure 4 11 presents the result of an experiment in which mice were subjected to the laser CNV model and intraocularly injected with the CBA vector driving sFlt01 expression. In this experiment vector injected eyes demonstrated an 87% reduction of neovascular growth in contrast to noninjected con tra lateral control eyes (p=0.04). In order to compare CNV reduction resulting from the positive control sFlt 01 injections, the riboswitch sFlt 01 vector were injected into similar animal cohorts. Animals treated with riboswitch vector were subjected to the same experimental protocol 0 500000 1000000 1500000 2000000 2500000 Left RightCNV Area (m2*FI) Inj Eye Non Inj Eye

PAGE 105

105 identified in Table 4 2. For those animals relegated to the riboswitch vector treatment group a significant reduction (p=0.003) of CNV was achieved for injected eyes compared to noninjected eyes (Fig. 4 12). In this case, there was a 93% reduction of gr owth exhibited. This experiment replicates findings expressed in earlier experiments conducted with the riboswitch sFlt 01 vector (Fig. 4 7, 4 8). The difference in this instance was based on the need to distinguish therapeutic efficacy for CNV reductio n seen with riboswitch vector versus reduction produced by the CBA promoter construct. The degree of CNV reduction in riboswitch treated eyes was analogous to the percentage of reduction generated with the constitutive expressing CBA promoter construct. Figure 4 11 Evaluations of CNV tuft reduction with the rAAV2 pTR CBA D29Gly (sFlt) vector (positive control). Animals received intravitreal vector injection in right eyes while left eyes remained un -injected. Animals were enucleated and flat -mounts of inner eye cups devoid of retinal tissue were performed 2 weeks post laser CNV operations and drug pellet implantation. Neovascular growth was determined by the product of the CNV area and the fluorescence intensity (m2*FI) for the average of 10 laser bur ns (avg. 5 burn per eye). N=2, P=0.04. Error bars represent SEM. 0 500000 1000000 1500000 2000000 2500000 3000000 3500000 Left RightCNV Area (m2*FI) Inj Eye Non Inj Eye

PAGE 106

106 Figure 4 12 Analysis of CNV tuft reduction for drug induced animals injected with the rAAV2pTR rN117II D29Gly (sFlt) vector (riboswitch treatment). Animals received intravitreal vecto r injection in right eyes while left eyes remained un -injected. Time release inducer pellets were implanted one day prior to laser CNV application. Animals were enucleated and flat -mounts of inner eye cups devoid of retinal tissue were performed 2 weeks post laser CNV operations and drug pellet implantation. Neovascular growth was determined by the product of the CNV area and the fluorescence intensity (m2*FI) for the average of 15 laser burns (avg 5 burn per eye). N =3, P=0.003. Error bars represent SEM. In addition to assessment via fluorescence microscopy, CNV development was also monitored with fluorescein angiography. In this case, the intensity of fluorescein leakage from each laser lesion was used as indirect measure of new vessel growth. Flu orescein leakage intensity from each lesion spot was based on a 0 3 scoring scale (Fig 4 13). Two weeks post laser CNV treatment, there was an overall improvement seen in vector treated eyes (Fig 4 14). The mean percentage of fluorescein leakage and me an score were calculated from laser lesions established in injected and non injected eyes (Fig 4 14). Riboswitch vector treated eyes 0 500000 1000000 1500000 2000000 2500000 3000000 Left Right CNV Area (m2*FI) Inj Eye Non Inj Eye

PAGE 107

107 exhibited approximately 34% reduction of fluorescein leakage in laser burns compared to non injected eyes. (Fig. 4 15). Additionally the mean score for fluorescein leakage in treated eyes was 36% lower than nontreated eyes (Fig 4 15). Figure 4 13 Representative fluorescein angiogram of leakage within laser lesions. Grading of fluorescein leakage in laser induced lesions was based on scoring from the following panels: (a) score 0, no leakage; (b) score 1, slight leakage; (c) score 2, moderate le akage; (d) score 3; robust leakage. The arrows highlight the area of fluorescein leakage. b a d c

PAGE 108

108 Figure 4 14 Representative fluorescein angiograms of rAAV2 pTR rN117-IID29Gly (sFlt) vector injected and non injected eyes following laser induced CNV treatment. Fluorescein angiograms were taken fourteen days following laser CNV treatment in (a) non -injected and (b) injected eyes. Vector injected eyes demonstrated less leakage than noninjected eyes. An average of 5 laser lesions was placed in e ach eye. N=8. Table 4 3 Choroidal neovascularization incidence in rAAV2 pTR rN117II D29Gly (sFlt) vector injected and non injected eyes following laser photocoagulation Injection Group % of leaky lesions (n=8) Mean score (n=8) Treated Eyes 25 16. 4 0.7 0.5 Un treated Eyes 72.9 14.1 1.9 0. 2 P 0.04 0.03 The mean percentage of leakage and mean score per eye was acquired 2 weeks following laser photocoagulation. Lesions that scored greater than 1 were calculated into the mean percentage of leaky lesion per eye. Displayed are the mean and standard error of mean for 8 animals with an average of 5 lesions per eye. Error bars represent SEM. a b

PAGE 109

109 CHAPTER 5 CONCLUSIONS Improving Pathological Ocular Neovascular Treatment Path ological ocular neovascularity is a serious condition which can lead to vision loss even with proper medical management. Newer treatment options that focus on the biological mechanisms promoting neovascular growth during disease states provide greater cur ative effects than past standards of treatment. Despite these advancements, there are still challenges in long term and sustainable treatment for patients with deteriorating conditions such as Age Related Macular Degeneration. This dissertation project a ttempted to address this issue by utilizing a drug inducible gene expression modulation system. The intention for such an approach was to provide gene product delivery at a specific period of time during disease onset without the limitations associated with over production of therapeutic proteins, the need for repeated ocular injections or the potential dangers inherent in long term therapeutic gene expression. In vitro Riboswitch F unctionality In addressing the challenge for improving disease treatment an appropriate drug inducible system had to be identified. Based on reports from the Yen et. al group, the hammerhead riboswitch system demonstrated properties that made it attractive for gene therapy application246, 248. Thus an investigation of the riboswitch functionality under in vitro conditions was conducted. When a GFP reporter transgene was pl aced under the regulatory control of the hammerhead riboswitch system, expression of the fluorescent GFP protein was properly modulated. The next aim in assessing proper inducibility function of the riboswitch system was to establish the proper dosing reg imen for in vitro application. Yen et al discovered that a synergetic effect could be achieved if the 5 FUR uracil analogue drug was delivered with the Toyocamycin adenosine analogue drug248. Moreover by increasing the ratio of the 5 -FUR to

PAGE 110

110 Toyocamycin successful riboswitch inhibition could be achieved without the tissue toxicity due to Toyocamycin toxicity. This observation from the Yen et al was successfully repeated in this investigation of the riboswitch system. It was discovered that a concentration ratio of 150:1 of 5 FUR to Toyocamycin could sustain sufficient inhibition while still allowing good cell survival. Additionally, by increasing the amount of the drug cocktail, while maintaining the 150:1 ratio, greater inhibition of the riboswitch system was noticed. However, the amount of drug cocktail that could induce gene expression without causing cell toxicity plateaued. Both 5 FUR (uridine analogue) and Toyocamycin (adenosine analogue) display a high potential for tissue toxicity. Once these nucleoside analogues are biologically activated into the triphosphate form, these analogues can enter the ribonucleotide pool for RNA synthesis. This infiltration can block RNA synthesis and ribosome function. For some of the animals studied, the Toyocamycin/5 FUR cocktail time release pellets did cause minor toxicities such as alopecia of animal c oat hair. In most animals, the site of subcutaneous pellet implantation demonstrated protracted wound healing when compared to placebo pellet controls. The most severe adverse event, for a small proportion of animals studied, was death several days following drug cocktail pellet implantation. The placebo control animals exhibited no adverse events. As a result of tissue toxicity associated with biological effects of the drugs on gene expression, the possible use of the drug cocktail as an inducer for a therapeutic model is restricted. As an alternative approach to the Toyocamycin/5-FUR combination, the induction of riboswitch inhibition can be achieved with just 5 FUR. 5 -FUR and derivatives of this drug have clinical relevance in tumor therapy. The us e of 5 FUR as an inducer can be considered for use in humans because of already established toxicity profiles associated with this drug. Improving the design of the riboswitch molecule will permit the use of less potentially hazardous substrates for induc tion of ribozyme

PAGE 111

111 inhibition. Win and Smolke were able to build upon this idea by designing a riboswitch system which utilizes theophylline as an inducer to inhibit aptamer repression of a hammerhead ribozyme249. Once a suitable dosing concentration was established, the focus shifted to examining the differences in gene modulation between riboswitch co nstructs containing either a single inducible ribozyme or a double riboswitch construct containing two identical tandem oriented inducible single ribozyme sequences. As seen in the previous experiment, a plateau in cell survival occurred with administrat ion of increasing levels of inducer cocktail. HEK 293 cells treated with concentrations greater than 75M of 5 FUR and 0.5M of Toyocamycin experienced an appreciable cell death. Based on this observation, it was decided that the optimal concentration of 5 FUR and Toyocamycin to use for in vitro applications would be 75 and 0.5 M respectively. When considering the ability of the system to tightly repress gene expression during non -permissive (i.e. non -induced) states, the pTR -rN117-XN -hGFP construct pro ved to be less efficient than the pTR rN117II -hGFP construct. This conclusion was based on the amount of camera exposure time need to visualize GFP signal under the noninduced conditions for HEK 293 cells transduced with either the pTR rN117-XN -hGFP or pTR rN117IIhGFP construct: there was a greater quantity of GFP protein expression during the noninduced state for the single riboswitch condition than for the double. This relative difference between cells transduced with either the pTR rN117-XN -hGFP ( single ribozyme) or pTR -rN117II hGFP (double ribozyme) plasmid was also noticed for all of the drug induced conditions. One possible explanation for this observation is that steric hindrance may be affecting gene translation. In this case, the presence of the secondary structure tandemly oriented ribozymes may be affecting the assembly of the ribosome complex or obstructing ribosome reading of the mRNA transcript. This does not mean that repression associated with ribozyme self -cleavage is ineffective.

PAGE 112

112 Instead, there might be an additive repressive affect seen with steric hindrance in the double ribozyme. This explanation does have some credence when examining the induced conditions for both the pTR rN117-XN hGFP and pTR rN117II -hGFP constructs. If steric hindrance were not the explanation for decreased expression, one would assume that permissive (i.e. induced) conditions would lead to comparable expression levels between the double and single ribozyme constructs ( pTR rN117II -hGFP and pTR -rN117-XN -h GFP ). This was not the case: the single riboswitch construct displayed greater GFP fluorescence than that of the double riboswitch vector. Analysis of GFP regulation via the riboswitch system helped to establish the necessary working conditions needed for in vitro application; however, quantitative evaluation of gene expression was still needed. In this case the sFlt 01 transgene expression profile during riboswitch regulation was accessed. Similar findings of the results from the GFP experiments were observed for sFlt 01 expression. The pTR rN117-XN D29Gly (sFlt) construct had a greater increase in expression of sFlt 01 than the pTR -rN117II D29Gly (sFlt) construct during the induced state. When total sFlt 01 expression for the induced states for both the single and double riboswitch constructs were compared to constitutive expression of sFlt from the CBA promoter, the induced double riboswitch reached on ly 50% of the level of constitutive expression, while the induced single riboswitch reached 80% of the positive control level. Although these differences may demonstrate a statistical significance this may not mean much in terms of clinical significance. It is possible that the lower sFlt01 levels seen in the double riboswitch expression profile may meet or even surpass the threshold concentration amount needed for neovascular abatement. When considering the level of leaky expression for the two constru cts, the pTR rN117-XN D29Gly (sFlt) plasmid demonstrated a seven-fold increase in

PAGE 113

113 expression compared to the pTR rN117 II D29Gly (sFlt) construct. Again, this may not be of clinical importance. However, when trying to establish a suitable gene therapy model with a drug inducible systems, it is imperative that the nonpermissive state of expression demonstrate tight control over basal expression. This feature is one of the caveats for having gene regulation by a drug inducible system. So from this prospe ctive, it was decided that the double riboswitch plasmid was superior to the single riboswitch construct. In vivo Riboswitch F unctionality In order to determine the therapeutic benefits of the riboswitch system an in vivo analysis was conducted. As an initial experiment under in vivo conditions the pTR rN117II-D29Gly (sFlt) construct as well as the time release pellet system had to be evaluated for inducible expression of the sFlt 01 transgene. Animals that received the placebo pellet demonstrated no difference between rAAV2 pTR rN117II D29Gly (sFlt) vector injected and non injected eyes. Conversely, animals that received the Toyocamycin/5 -FUR drug cocktail pellet showed significantly more sFlt01 expression in rAAV2 pTR -rN117II D29Gly (sFlt) vect or injected eyes. This experiment was able to show that intravitreal injection of rAAV2 riboswitch vector could be successfully induced with the time release drug pellets within an animal system. At this point, the riboswitch construct has shown succes sful induction of the sFlt 01 transgene during in vitro and in vivo conditions; the next step in evaluating this system's potential therapeutic role is to determine functionality within a disease model of pathological ocular neovascularity. The riboswitch system was scrutinized for functionality with the use of the laser CNV mouse model. The first cohort of animals that received rAAV2 pTR -rN117II D29Gly (sFlt) vector injections, pellet implants and laser CNV surgery demonstrated a statistically signific ant difference between vector injected and non injected eyes. In this first experiment, all animals were implanted with the inducer pellet. In this case, non -injected eyes displayed a 2.6

PAGE 114

114 fold increased in the amount of CNV within laser burns compared to the corresponding injected eye. Despite demonstrating a reduction of CNV with treatment with the rAAV2 pTR rN117II D29Gly (sFlt) construct, drug inducibility was not demonstrated. Thus, in a later experiment, animals were divided into two drug treatme nt arms: placebo and inducer drug treatment. During the course of the two weeks post laser operation because of excessive grooming practices by some animals, the subcutaneous implanted time release pellets were infiltrated. As a result, an a priori decis ion was made to remove animals that demonstrated pellet tampering. This reduced the sample size for both treatment groups. Despite the reduced sample size animals within the inducer drug treatment group demonstrated statistically significant reduction of CNV in rAAV2 pTR rN117II D29Gly (sFlt) vector injected eyes compared to non injected eyes. As for the placebo treatment group, there was not a statistically significant difference between rAAV2 pTR rN117II D29Gly (sFlt) vector injected and non injected eyes. In this instance, drug inducible therapeutic effect has been achieved with riboswitch regulation of sFlt expression. As a final attempt to demonstrate the effectiveness the riboswitch system a side by side comparison was made against the CBA c onstitutive promoter. Animals injected with the CBA promoter driving sFlt 01 expression displayed an 87% reduction in CNV growth. Despite reduced power due to low sample size (i.e. N=2), the CNV reduction was consistent with findings from a previous repo rt99. The riboswitch gene modulation system was also ab le to establish a significant drop in CNV growth. This system produced an average reduction of 93% in CNV development. This demonstrates the capacity of the riboswitch gene modulating system to provide functional abatement of neovascular growth, in a mou se model of laser CNV, without any diminution of therapeutic effect. This system does possess inherent limitation as a potential gene therapy model. Specifically the toxicity associated with the inducer agents present a

PAGE 115

115 serious concern for use in larger animal systems. Further study and manipulation of the riboswitch framework must be made in order to produce an inducible system that can control expression of specific gene targets in response to a nontoxic effector molecule. In summary, the double ri boswitch system has successfully demonstrated in vitro and in vivo regulation of the sFlt 01 anti -neovascularity gene. Moreover therapeutic levels of the sFlt 01 were produced while under the regulation of the riboswitch system within an animal model of A ge Related Macular Degeneration. Theoretically, this indu cible system could prove to be useful for therapeutic purposes. However, the use of nucleoside an alogues as inducer agents severely limit the systems utility. If the ribozyme response could be al tered so that instead of responding to harsh drugs an innocuous agent could be used, there would be a promising role for the hammerhead riboswitch system in gene therapy application.

PAGE 116

116 L IST OF REFERENCES 1. An international classification of retinopathy of prematurity. The Committee for the Classification of Retinopathy of Prematurity. Arch Ophthalmol 102, 11301134 (1984). 2. An international classification of retinopathy of prematurity. II. The clas sification of retinal detachment. The International Committee for the Classification of the Late Stages of Retinopathy of Prematurity. Arch Ophthalmol 105, 906912 (1987). 3. Archambault,P. & Gomolin,J.E. Incidence of retinopathy of prematurity among infants weighing 2000 g or less at birth. Can. J. Ophthalmol 22, 218220 (1987). 4. Bossi,E. & Koerner,F. Retinopathy of prematurity. Intensive Care Med. 21, 241246 (1995). 5. Gilbert,C. & Foster,A. Childhood blindness in the context of VISIO N 2020--the right to sight. Bull. World Health Organ 79, 227232 (2001). 6. Gilbert,C., Rahi,J., Eckstein,M., O'Sullivan,J., & Foster,A. Retinopathy of prematurity in middle income countries. Lancet 350, 12 14 (1997). 7. Kello,A.B. & Gilbert,C. Causes of severe visual impairment and blindness in children in schools for the blind in Ethiopia. Br. J. Ophthalmol 87, 526530 (2003). 8. O'Sullivan,J., Gilbert,C., & Foster,A. The causes of childhood blindness in South Africa. S. Afr. Med. J. 87, 16911695 (1997). 9. Ospina,L.H., Lyons,C.J., Matsuba,C., Jan,J., & McCormick,A.Q. Argon laser photocoagulation for retinopathy of prematurity: long -term outcome. Eye 19, 12131218 (2005). 10. Klein,R., Klein,B.E., Moss,S.E., Davis,M.D., & DeM ets,D.L. The Wisconsin epidemiologic study of diabetic retinopathy. II. Prevalence and risk of diabetic retinopathy when age at diagnosis is less than 30 years. Arch Ophthalmol 102, 520526 (1984). 11. Ferris,F.L., III, Fine,S.L., & Hyman,L. Age -rela ted macular degeneration and blindness due to neovascular maculopathy. Arch Ophthalmol 102, 16401642 (1984). 12. Fine,S.L., Berger,J.W., Maguire,M.G., & Ho,A.C. Age related macular degeneration. N. Engl. J. Med. 342, 483492 (2000). 13. Campoc hiaro,P.A. Retinal and choroidal neovascularization. J. Cell Physiol 184, 301310 (2000). 14. Smith,W. et al. Risk factors for age related macular degeneration: Pooled findings from three continents. Ophthalmology 108 697704 (2001).

PAGE 117

117 15. Chang,B. et al. Choroidal neovascularization in second eyes of patients with unilateral exudative age -related macular degeneration. Ophthalmology 102, 13801386 (1995). 16. de Jong,P.T. Age -related macular degeneration. N. Engl. J. Med. 355, 14741485 (2006). 17. Klein,R. et al. Fifteen year cumulative incidence of age related macular degeneration: the Beaver Dam Eye Study. Ophthalmology 114, 253262 (2007). 18. Klein,M.L. et al. Age related macular degeneration. Clinical features in a large family and linkage to chromosome 1q. Arch. Ophthalmol. 116, 10821088 (1998). 19. Schultz,D.W. et al. Analysis of the ARMD1 locus: evidence that a mutation in HEMICENTIN 1 is associated with age related macular degeneration in a large fami ly. Hum. Mol. Genet. 12, 33153323 (2003). 20. Klein,R.J. et al. Complement factor H polymorphism in age related macular degeneration. Science 308, 385389 (2005). 21. Edwards,A.O. et al. Complement factor H polymorphism and age -related macular degeneration. Science 308, 421424 (2005). 22. Haines,J.L. et al. Complement factor H variant increases the risk of agerelated macular degeneration. Science 308, 419421 (2005). 23. Hageman,G.S. et al. A common haplotype in the complement regulatory gene factor H (HF1/CFH) predisposes individuals to age related macular degeneration. Proc. Natl. Acad. Sci. U. S. A 102, 72277232 (2005). 24. Fisher,S.A. et al. Meta analysis of genome scans of age related macular degeneration. Hum. Mol. Gen et. 14, 22572264 (2005). 25. Weeks,D.E. et al. Age related maculopathy: a genomewide scan with continued evidence of susceptibility loci within the 1q31, 10q26, and 17q25 regions. Am. J. Hum. Genet. 75, 174189 (2004). 26. Seddon,J.M., Santang elo,S.L., Book,K., Chong,S., & Cote,J. A genomewide scan for age -related macular degeneration provides evidence for linkage to several chromosomal regions. Am. J. Hum. Genet. 73, 780790 (2003). 27. Schick,J.H. et al. A whole -genome screen of a quantitative trait of age-related maculopathy in sibships from the Beaver Dam Eye Study. Am. J. Hum. Genet. 72, 14121424 (2003). 28. Majewski,J. et al. Age related macular degeneration -a genome scan in extended families. Am. J. Hum. Genet. 73, 540550 (2003).

PAGE 118

118 29. Weeks,D.E. et al. A full genome scan for age related maculopathy. Hum. Mol. Genet. 9 13291349 (2000). 30. Jakobsdottir,J. et al. Susceptibility genes for age related maculopathy on chromosome 10q26. Am. J. Hum. Genet. 77, 389407 (2005). 31. Rivera,A. et al. Hypothetical LOC387715 is a second major susceptibility gene for age -related macular degeneration, contributing independently of complement factor H to disease risk. Hum. Mol. Genet. 14, 32 273236 (2005). 32. Schmidt,S. et al. Cigarette smoking strongly modifies the association of LOC387715 and age related macular degeneration. Am. J. Hum. Genet. 78, 852864 (2006). 33. Yang,Z. et al. A variant of the HTRA1 gene increases suscept ibility to age related macular degeneration. Science 314, 992993 (2006). 34. Gold,B. et al. Variation in factor B (BF) and complement component 2 (C2) genes is associated with agerelated macular degeneration. Nat. Genet. 38, 458 462 (2006). 35. Maller,J. et al. Common variation in three genes, including a noncoding variant in CFH, strongly influences risk of age related macular degeneration. Nat. Genet. 38, 10551059 (2006). 36. Bora,P.S., Guruge,B.L., & Bora,N.S. Molecular characterizat ion of human eye and heart fatty acid ethyl ester synthase/carboxylesterase by site -directed mutagenesis. Biochem. Biophys. Res. Commun. 312, 10941098 (2003). 37. Bora,P.S., Bora,N.S., Wu,X., Kaplan,H.J., & Lange,L.G. Molecular cloning, sequencing, and characterization of smooth muscle myosin alkali light chain from human eye cDNA: homology with myocardial fatty acid ethyl ester synthase III cDNA. Genomics 19, 186188 (1994). 38. Bora,P.S. et al. Immunotherapy for choroidal neovascularization in a laser induced mouse model simulating exudative (wet) macular degeneration. Proc. Natl. Acad. Sci. U. S. A 100, 26792684 (2003). 39. Lange,L.G. & Sobel,B.E. Myocardial metabolites of ethanol. Circ. Res. 52, 479482 (1983). 40. Shankland,S.J. et al. Changes in cell -cycle protein expression during experimental mesangial proliferative glomerulonephritis. Kidney Int. 50, 12301239 (1996). 41. Brakenhielm,E. et al. Adiponectin -induced antiang iogenesis and antitumor activity involve caspase -mediated endothelial cell apoptosis. Proc. Natl. Acad. Sci. U. S. A 101, 24762481 (2004).

PAGE 119

119 42. Xu,A. et al. The fat -derived hormone adiponectin alleviates alcoholic and nonalcoholic fatty liver diseases in mice. J. Clin. Invest 112, 91 100 (2003). 43. Bora,P.S. et al. Alcohol linked to enhanced angiogenesis in rat model of choroidal neovascularization. FE BS J. 273, 14031414 (2006). 44. Smith,C.J. & Hansch,C. The relative toxicity of compounds in mainstream cigarette smoke condensate. Food Chem. Toxicol. 38, 637646 (2000). 45. Solberg,Y., Rosner,M., & Belkin,M. The association between cigarett e smoking and ocular diseases. Surv. Ophthalmol. 42, 535547 (1998). 46. Pryor,W.A. Cigarette smoke radicals and the role of free radicals in chemical carcinogenicity. Environ. Health Perspect. 105 Suppl 4, 875882 (1997). 47. Halliwell,B. Ciga rette smoking and health: a radical view. J. R. Soc. Health 113, 9196 (1993). 48. Winston,G.W., Church,D.F., Cueto,R., & Pryor,W.A. Oxygen consumption and oxyradical production from microsomal reduction of aqueous extracts of cigarette tar. Arch. Biochem. Biophys. 304, 371378 (1993). 49. Niki,E., Minamisawa,S., Oikawa,M., & Komuro,E. Membrane damage from lipid oxidation induced by free radicals and cigarette smoke. Ann. N. Y. Acad. Sci. 686, 29 37 (1993). 50. Lenaz,G. Quinone specificity of complex I. Biochim. Biophys. Acta 1364, 207221 (1998). 51. McCue,J.M., Link,K.L., Eaton,S.S., & Freed,B.M. Exposure to cigarette tar inhibits ribonucleotide reductase and blocks lymphocyte proliferation. J. Immunol. 165, 67716775 (2000). 52. Kari,F.W., Bucher,J., Eustis,S.L., Haseman,J.K., & Huff,J.E. Toxicity and carcinogenicity of hydroquinone in F344/N rats and B6C3F1 mice. Food Chem. Toxicol. 30, 737747 (1992). 53. Espinosa -Heidmann,D.G. et al. Cigarette smoke related oxida nts and the development of subRPE deposits in an experimental animal model of dry AMD. Invest Ophthalmol. Vis. Sci. 47, 729 737 (2006). 54. Antonelli Orlidge,A., Saunders,K.B., Smith,S.R., & D'Amore,P.A. An activated form of transforming growth fact or beta is produced by cocultures of endothelial cells and pericytes. Proc. Natl. Acad. Sci. U. S. A 86, 45444548 (1989). 55. Beutler,B. & Cerami,A. Cachectin and tumour necrosis factor as two sides of the same biological coin. Nature 320, 584588 ( 1986).

PAGE 120

120 56. Brem,H., Gresser,I., Grosfeld,J., & Folkman,J. The combination of antiangiogenic agents to inhibit primary tumor growth and metastasis. J. Pediatr. Surg. 28, 12531257 (1993). 57. Derynck,R. Transforming growth factor alpha. Mol. Rep rod. Dev. 27, 3 9 (1990). 58. Fett,J.W. et al. Isolation and characterization of angiogenin, an angiogenic protein from human carcinoma cells. Biochemistry 24, 54805486 (1985). 59. Folkman,J. & Shing,Y. Angiogenesis. J. Biol. Chem. 267, 1093110934 (1992). 60. Ishikawa,F. et al. Identification of angiogenic activity and the cloning and expression of platelet -derived endothelial cell growth factor. Nature 338, 557 562 (1989). 61. Shweiki,D., Itin,A., Soffer,D., & Keshet,E. Vascular e ndothelial growth factor induced by hypoxia may mediate hypoxia initiated angiogenesis. Nature 359, 843845 (1992). 62. Senger,D.R. et al. Tumor cells secrete a vascular permeability factor that promotes accumulation of ascites fluid. Science 219, 98 3 985 (1983). 63. Leung,D.W., Cachianes,G., Kuang,W.J., Goeddel,D.V., & Ferrara,N. Vascular endothelial growth factor is a secreted angiogenic mitogen. Science 246, 13061309 (1989). 64. Asahara,T. et al. VEGF contributes to postnatal neovascul arization by mobilizing bone marrow -derived endothelial progenitor cells. EMBO J. 18, 39643972 (1999). 65. Csaky,K.G. et al. Recruitment of marrow -derived endothelial cells to experimental choroidal neovascularization by local expression of vascular endothelial growth factor. Exp. Eye Res. 78, 11071116 (2004). 66. Alon,T. et al. Vascular endothelial growth factor acts as a survival factor for newly formed retinal vessels and has implications for retinopathy of prematurity. Nat. Med. 1 10241028 (1995). 67. Lamoreaux,W.J., Fitzgerald,M.E., Reiner,A., Hasty,K.A., & Charles,S.T. Vascular endothelial growth factor incr eases release of gelatinase A and decreases release of tissue inhibitor of metalloproteinases by microvascular endothelial cells in vitro. Microvasc. Res. 55, 29 42 (1998). 68. Miyamoto,K. et al. Vascular endothelial growth factor (VEGF) induced reti nal vascular permeability is mediated by intercellular adhesion molecule 1 (ICAM 1). Am. J. Pathol. 156, 17331739 (2000). 69. Ishida,S. et al. VEGF164 is proinflammatory in the diabetic retina. Invest Ophthalmol Vis. Sci. 44, 21552162 (2003).

PAGE 121

121 70. Houck,K.A. et al. The vascular endothelial growth factor family: identification of a fourth molecular species and characterization of alternative splicing of RNA. Mol. Endocrinol. 5 18061814 (1991). 71. Tischer,E. et al. The human gene for vascular endothelial growth factor. Multiple protein forms are encoded through alternative exon splicing. J. Biol. Chem. 266, 1194711954 (1991). 72. Shima,D.T. et al. Cloning and mRNA expression of vascular endothelial growth factor in ischemic ret inas of Macaca fascicularis. Invest Ophthalmol Vis. Sci. 37, 13341340 (1996). 73. de Vries,C. et al. The fms -like tyrosine kinase, a receptor for vascular endothelial growth factor. Science 255, 989991 (1992). 74. Terman,B.I. et al. Identific ation of the KDR tyrosine kinase as a receptor for vascular endothelial cell growth factor. Biochem. Biophys. Res. Commun. 187, 15791586 (1992). 75. Blaauwgeers,H.G. et al. Polarized vascular endothelial growth factor secretion by human retinal pigm ent epithelium and localization of vascular endothelial growth factor receptors on the inner choriocapillaris. Evidence for a trophic paracrine relation. Am. J. Pathol. 155, 421428 (1999). 76. Mancini,M.A., Frank,R.N., Keirn,R.J., Kennedy,A., & Khoury,J.K. Does the retinal pigment epithelium polarize the choriocapillaris? Invest Ophthalmol Vis. Sci. 27, 336345 (1986). 77. Aiello,L.P. et al. Vascular endothelial growth factor in ocular fluid of patients with diabetic retinopathy and other retinal disorders. N. Engl. J. Med. 331, 14801487 (1994). 78. Wells,J.A. et al. Levels of vascular endothelial growth factor are elevated in the vitreous of patients with subretinal neovascularisation. Br. J. Ophthalmol 80, 363366 (1996). 79. Mitamura,Y. et al. Vitreous levels of placenta growth factor and vascular endothelial growth factor in patients with proliferative diabetic retinopathy. Diabetes Care 25, 2352 (2002). 80. Ogata,N., Nishikawa,M., Nishimura,T., Mitsuma,Y., & Matsumura ,M. Unbalanced vitreous levels of pigment epithelium -derived factor and vascular endothelial growth factor in diabetic retinopathy. Am. J. Ophthalmol 134, 348353 (2002). 81. Adamis,A.P. et al. Increased vascular endothelial growth factor levels in t he vitreous of eyes with proliferative diabetic retinopathy. Am. J. Ophthalmol 118, 445450 (1994).

PAGE 122

122 82. Casey,R. & Li,W.W. Factors controlling ocular angiogenesis. Am. J. Ophthalmol 124, 521529 (1997). 83. Marneros,A.G. et al. Endogenous endos tatin inhibits choroidal neovascularization. FASEB J. 21, 38093818 (2007). 84. Raisler,B.J., Berns,K.I., Grant,M.B., Beliaev,D., & Hauswirth,W.W. Adeno associated virus type 2 expression of pigmented epithelium -derived factor or Kringles 1 3 of angi ostatin reduce retinal neovascularization. Proc. Natl. Acad. Sci. U. S. A 99, 89098914 (2002). 85. Tombran Tink,J. & Johnson,L.V. Neuronal differentiation of retinoblastoma cells induced by medium conditioned by human RPE cells. Invest Ophthalmol Vi s. Sci. 30, 17001707 (1989). 86. Renno,R.Z., Youssri,A.I., Michaud,N., Gragoudas,E.S., & Miller,J.W. Expression of pigment epithelium -derived factor in experimental choroidal neovascularization. Invest Ophthalmol Vis. Sci. 43, 15741580 (2002). 87. Ogata,N., Matsuoka,M., Imaizumi,M., Arichi,M., & Matsumura,M. Decrease of pigment epithelium -derived factor in aqueous humor with increasing age. Am. J. Ophthalmol 137, 935 936 (2004). 88. Tombran Tink,J. & Barnstable,C.J. PEDF: a multifaceted neurotrophic factor. Nat. Rev. Neurosci. 4 628636 (2003). 89. Tombran Tink,J., Shivaram,S.M., Chader,G.J., Johnson,L.V., & Bok,D. Expression, secretion, and age -related downregulation of pigment epithelium -derived factor, a serpin with neurotrophic activity. J. Neurosci. 15, 49925003 (1995). 90. Imai,D., Yoneya,S., Gehlbach,P.L., Wei,L.L., & Mori,K. Intraocular gene tr ansfer of pigment epithelium -derived factor rescues photoreceptors from light induced cell death. J. Cell Physiol 202, 570578 (2005). 91. Jablonski,M.M., TombranTink,J., Mrazek,D.A., & Iannaccone,A. Pigment epithelium derived factor supports normal development of photoreceptor neurons and opsin expression after retinal pigment epithelium removal. J. Neurosci. 20, 71497157 (2000). 92. Jablonski,M.M., TombranTink,J., Mrazek,D.A., & Iannaccone,A. Pigment epithelium derived factor supports norma l Muller cell development and glutamine synthetase expression after removal of the retinal pigment epithelium. Glia 35, 14 25 (2001). 93. Dawson,D.W. et al. Pigment epithelium -derived factor: a potent inhibitor of angiogenesis. Science 285, 245248 ( 1999).

PAGE 123

123 94. Kendall,R.L. & Thomas,K.A. Inhibition of vascular endothelial cell growth factor activity by an endogenously encoded soluble receptor. Proc. Natl. Acad. Sci. U. S. A 90, 1070510709 (1993). 95. Smith,L.E. Pathogenesis of retinopathy of prematurity. Growth Horm. IGF. Res. 14 Suppl A S140S144 (2004). 96. Kong,H.L. et al. Regional suppression of tumor growth by in vivo transfer of a cDNA encoding a secreted form of the extracellular domain of the flt 1 vascular endothelial growth factor receptor. Hum. Gene Ther. 9 823833 (1998). 97. Honda,M., Sakamoto,T., Ishibashi ,T., Inomata,H., & Ueno,H. Experimental subretinal neovascularization is inhibited by adenovirus -mediated soluble VEGF/flt 1 receptor gene transfection: a role of VEGF and possible treatment for SRN in age related macular degeneration. Gene Ther. 7 978985 (2000). 98. Bainbridge,J.W. et al. Inhibition of retinal neovascularisation by gene transfer of soluble VEGF receptor sFlt 1. Gene Ther. 9 320326 (2002). 99. Lai,Y.K. et al. Potential long term inhibition of ocular neovascularisation by rec ombinant adeno associated virus -mediated secretion gene therapy. Gene Ther. 9 804813 (2002). 100. Apte,R.S., Barreiro,R.A., Duh,E., Volpert,O., & Ferguson,T.A. Stimulation of neovascularization by the anti angiogenic factor PEDF. Invest Ophthalmol Vis. Sci. 45, 44914497 (2004). 101. Saint Geniez,M. & D'Amore,P.A. Development and pathology of the hyaloid, choroidal and retinal vasculature. Int. J. Dev. Biol. 48, 10451058 (2004). 102. A randomized, placebo -controlled, clinical trial of high -dose supplementation with vitamins C and E, beta carotene, and zinc for age related macular degeneration and vision loss: AREDS report no. 8. Arch Ophthalmol 119, 14171436 (2001). 103. Aiello ,L.P. et al. Suppression of retinal neovascularization in vivo by inhibition of vascular endothelial growth factor (VEGF) using soluble VEGF -receptor chimeric proteins. Proc. Natl. Acad. Sci. U. S. A 92, 1045710461 (1995). 104. Rosenfeld,P.J. et al. Maximum tolerated dose of a humanized anti -vascular endothelial growth factor antibody fragment for treating neovascular age related macular degeneration. Ophthalmology 112, 10481053 (2005). 105. Rosenfeld,P.J., Heier,J.S., Hantsbarger,G., & Shams,N. Tolerability and efficacy of multiple escalating doses of ranibizumab (Lucentis) for neovascular age related macular degeneration. Ophthalmology 113, 632 (2006).

PAGE 124

124 106. Heier,J.S. et al. Ranibizumab for treatment of neovascular age related macular d egeneration: a phase I/II multicenter, controlled, multidose study. Ophthalmology 113, 642644 (2006). 107. Avery,R.L. et al. Intravitreal bevacizumab (Avastin) for neovascular age related macular degeneration. Ophthalmology 113, 363372 (2006). 108. Spaide,R.F. et al. Intravitreal bevacizumab treatment of choroidal neovascularization secondary to age related macular degeneration. Retina 26 383390 (2006). 109. Rich,R.M. et al. Short -term safety and efficacy of intravitreal bevacizumab (A vastin) for neovascular age related macular degeneration. Retina 26, 495-511 (2006). 110. Ladewig,M.S. et al. [Intravitreal bevacizumab for neovascular agerelated macular degeneration]. Ophthalmologe 103 463470 (2006). 111. Bashshur,Z.F. et al. Intravitreal bevacizumab for the management of choroidal neovascularization in age related macular degeneration. Am. J. Ophthalmol 142, 1 9 (2006). 112. Costa,R.A. et al. Intravitreal bevacizumab for choroidal neovascularization caused by AMD (IB eNA Study): results of a phase 1 dose -escalation study. Invest Ophthalmol Vis. Sci. 47, 45694578 (2006). 113. Abraham -Marin,M.L. et al. Intravitreal bevacizumab therapy for neovascular age related macular degeneration: a pilot study. Graefes Arch Clin. Exp. Ophthalmol 245, 651655 (2007). 114. Bakri,S.J. et al. Pharmacokinetics of intravitreal ranibizumab (Lucentis). Ophthalmology 114, 21792182 (2007). 115. Bakri,S.J., Snyder,M.R., Reid,J.M., Pulido,J.S., & Singh,R.J. Pharmacokinetics of intravitreal bevacizumab (Avastin). Ophthalmology 114, 855859 (2007). 116. Bell,C., Lynam,E., Landfair,D.J., Janjic,N., & Wiles,M.E. Oligonucleotide NX1838 inhibits VEGF165 -mediated cellular responses in vitro. In Vitro Cell Dev. Biol. Anim 35, 5 33542 (1999). 117. Drolet,D.W. et al. Pharmacokinetics and safety of an anti -vascular endothelial growth factor aptamer (NX1838) following injection into the vitreous humor of rhesus monkeys. Pharm. Res. 17, 15031510 (2000). 118. Tucker,C.E. et al. Detection and plasma pharmacokinetics of an anti vascular endothelial growth factor oligonucleotide aptamer (NX1838) in rhesus monkeys. J. Chromatogr. B Biomed. Sci. Appl. 732, 203212 (1999).

PAGE 125

125 119. Gragoudas,E.S., Adamis,A.P., Cunningham,E.T., Jr., Feinsod,M., & Guyer,D.R. Pegaptanib for neovascular age -related macular degeneration. N. Engl. J. Med. 351, 28052816 (2004). 120. D'Amico,D.J. et al. Pegaptanib sodium for neovascular age related macular degeneration: two year safety results o f the two prospective, multicenter, controlled clinical trials. Ophthalmology 113 9921001 (2006). 121. Klettner,A.K. & Roider,J. Comparison of Bevacizumab, Ranibizumab and Pegaptanib in vitro: efficiency and possible additional pathways. Invest Oph thalmol Vis. Sci. (2008). 122. Henderson,B.W. & Dougherty,T.J. How does photodynamic therapy work? Photochem. Photobiol. 55, 145157 (1992). 123. Kramer,M. et al. Liposomal benzoporphyrin derivative verteporfin photodynamic therapy. Selective treatment of choroidal neovascularization in monkeys. Ophthalmology 103, 427 438 (1996). 124. Miller,J.W. et al. Photodynamic therapy of experimental choroidal neovascul arization using lipoprotein -delivered benzoporphyrin. Arch Ophthalmol 113, 810818 (1995). 125. Miller,J.W. et al. Photodynamic therapy with verteporfin for choroidal neovascularization caused by age related macular degeneration: results of a single treatment in a phase 1 and 2 study. Arch Ophthalmol 117, 11611173 (1999). 126. Schmidt -Erfurth,U. et al. Photodynamic therapy of subfoveal choroidal neovascularization: clinical and angiographic examples. Graefes Arch Clin. Exp. Ophthalmol 236, 365 374 (1998). 127. Colquitt,J.L. et al. Ranibizumab and pegaptanib for the treatment of age related macular degeneration: a systematic review and economic evaluation. Health Technol. Assess. 12, 1 222 (2008). 128. Rosenfeld,P.J. et al. Ranibi zumab for neovascular age related macular degeneration. N. Engl. J. Med. 355, 14191431 (2006). 129. Brown,D.M. et al. Ranibizumab versus verteporfin for neovascular age related macular degeneration. N. Engl. J. Med. 355, 14321444 (2006). 130. Miller,H., Miller,B., & Ryan,S.J. The role of retinal pigment epithelium in the involution of subretinal neovascularization. Invest Ophthalmol. Vis. Sci. 27, 16441652 (1986). 131. Dobi,E.T., Puliafito,C.A., & Destro,M. A new model of experimental c horoidal neovascularization in the rat. Arch. Ophthalmol. 107, 264269 (1989).

PAGE 126

126 132. Frank,R.N., Das,A., & Weber,M.L. A model of subretinal neovascularization in the pigmented rat. Curr. Eye Res. 8 239247 (1989). 133. Schwesinger,C. et al. Int rachoroidal neovascularization in transgenic mice overexpressing vascular endothelial growth factor in the retinal pigment epithelium. Am. J. Pathol. 158, 11611172 (2001). 134. Pollack,A., Korte,G.E., Heriot,W.J., & Henkind,P. Ultrastructure of Bruc h's membrane after krypton laser photocoagulation. II. Repair of Bruch's membrane and the role of macrophages. Arch. Ophthalmol. 104, 13771382 (1986). 135. Pollack,A., Korte,G.E., Weitzner,A.L., & Henkind,P. Ultrastructure of Bruch's membrane after krypton laser photocoagulation. I. Breakdown of Bruch's membrane. Arch. Ophthalmol. 104, 13721376 (1986). 136. Kiilgaard,J.F. et al. A new animal model of choroidal neovascularization. Acta Ophthalmol. Scand. 83, 697704 (2005). 137. Wang,F. e t al. AAV-mediated expression of vascular endothelial growth factor induces choroidal neovascularization in rat. Invest Ophthalmol. Vis. Sci. 44, 781790 (2003). 138. Spilsbury,K., Garrett,K.L., Shen,W.Y., Constable,I.J., & Rakoczy,P.E. Overexpressio n of vascular endothelial growth factor (VEGF) in the retinal pigment epithelium leads to the development of choroidal neovascularization. Am. J. Pathol. 157, 135144 (2000). 139. Heckenlively,J.R. et al. Mouse model of subretinal neovascularization with choroidal anastomosis. Retina 23, 518522 (2003). 140. Yannuzzi,L.A. et al. Retinal angiomatous proliferation in age related macular degeneration. Retina 21, 416434 (2001). 141. Chan,C.C. et a l. Ccl2/Cx3cr1 deficient mice: an animal model for age related macular degeneration. Ophthalmic Res. 40, 124128 (2008). 142. Tuo,J. et al. Murine ccl2/cx3cr1 deficiency results in retinal lesions mimicking human age related macular degeneration. Inv est Ophthalmol. Vis. Sci. 48, 38273836 (2007). 143. Imamura,Y. et al. Drusen, choroidal neovascularization, and retinal pigment epithelium dysfunction in SOD1 -deficient mice: a model of age related macular degeneration. Proc. Natl. Acad. Sci. U. S. A 103, 1128211287 (2006). 144. Malek,G. et al. Apolipoprotein E allele -dependent pathogenesis: a model for age related retinal degeneration. Proc. Natl. Acad. Sci. U. S. A 102, 1190011905 (2005).

PAGE 127

127 145. Brigham,K.L. et al. Transfection of nasal mucosa with a normal alpha1 antitrypsin gene in alpha1 antitrypsin -deficient subjects: comparison with protein therapy. Hum. Gene Ther. 11, 10231032 (2000). 146. Brantly,M.L. et al. Phase I trial of intramuscular injection of a recombinant adeno as sociated virus serotype 2 alphal antitrypsin (AAT) vector in AAT -deficient adults. Hum. Gene Ther. 17, 11771186 (2006). 147. Song,S. et al. Sustained secretion of human alpha 1 antitrypsin from murine muscle transduced with adeno associated virus ve ctors. Proc. Natl. Acad. Sci. U. S. A 95, 1438414388 (1998). 148. Hofling,A.A., Devine,S., Vogler,C., & Sands,M.S. Human CD34+ hematopoietic progenitor cell -directed lentiviral -mediated gene therapy in a xenotransplantation model of lysosomal storag e disease. Mol. Ther. 9 856865 (2004). 149. Bainbridge,J.W. et al. Stable rAAV-mediated transduction of rod and cone photoreceptors in the canine retina. Gene Ther. 10, 13361344 (2003). 150. Lotery,A.J. et al. Adenoassociated virus type 5: transduction efficiency and cell type specificity in the primate retina. Hum. Gene Ther. 14, 16631671 (2003). 151. Weber,M. et al. Recombinant adenoassociated virus serotype 4 mediates unique and exclusive long term transduction of retinal pigmented epithelium in rat, dog, and nonhuman primate after subretinal delivery. Mol. Ther. 7 774 781 (2003). 152. Saenz,D.T. et al. Unintegrated lentivirus DNA persistence and accessibility to expression in nondividing cell s: analysis with class I integrase mutants. J. Virol. 78, 29062920 (2004). 153. Challa,P. et al. Lentiviral mediated gene delivery to the anterior chamber of rodent eyes. Mol. Vis. 11, 425430 (2005). 154. Loewen,N. et al. Longterm retinal tr ansgene expression with FIV versus adenoviral vectors. Mol. Vis. 10, 272 280 (2004). 155. Cheng,L. et al. Efficient gene transfer to retinal pigment epithelium cells with long -term expression. Retina 25, 193201 (2005). 156. Tschernutter,M. et al. Long -term preservation of retinal function in the RCS rat model of retinitis pigmentosa following lentivirus -mediated gene therapy. Gene Ther. 12, 694701 (2005). 157. Miyazaki,M. et al. Simian lentiviral vector -mediated retinal gene transfer of pigment epithelium -derived factor protects retinal degeneration and electrical defect in Royal College of Surgeons rats. Gene Ther. 10, 15031511 (2003).

PAGE 128

128 158. Kostic,C. et al. Activity analysis of housekeeping promoters using self inactivating lentiv iral vector delivery into the mouse retina. Gene Ther. 10, 818821 (2003). 159. Bainbridge,J.W. et al. In vivo gene transfer to the mouse eye using an HIV -based lentiviral vector; efficient long term transduction of corneal endothelium and retinal pi gment epithelium. Gene Ther. 8 16651668 (2001). 160. Gruter,O. et al. Lentiviral vector -mediated gene transfer in adult mouse photoreceptors is impaired by the presence of a physical barrier. Gene Ther. 12, 942947 (2005). 161. Pitkanen,L., Ruponen,M., Nieminen,J., & Urtti,A. Vitreous is a barrier in nonviral gene transfer by cationic lipids and polymers. Pharm. Res. 20, 576583 (2003). 162. Peeters,L. et al. Vitreous: a barrier to nonviral ocular gene therapy. Invest Ophthalmol. Vis. Sci. 46, 35533561 (2005). 163. Allen,C. et al. Controlling the physical behavior and biological performance of liposome formulations through use of surface grafted poly(ethylene glycol). Biosci. Rep. 22, 225250 (2002). 164. Bochot ,A. et al. Intravitreal delivery of oligonucleotides by sterically stabilized liposomes. Invest Ophthalmol. Vis. Sci. 43, 253259 (2002). 165. Deshpande,M.C. et al. The effect of poly(ethylene glycol) molecular architecture on cellular interaction an d uptake of DNA complexes. J. Control Release 97, 143156 (2004). 166. Mishra,S., Webster,P., & Davis,M.E. PEGylation significantly affects cellular uptake and intracellular trafficking of non-viral gene delivery particles. Eur. J. Cell Biol. 83, 97 111 (2004). 167. Song,L.Y. et al. Characterization of the inhibitory effect of PEG lipid conjugates on the intracellular delivery of plasmid and antisense DNA mediated by cationic lipid liposomes. Biochim. Biophys. Acta 1558, 1 13 (2002). 168. Shi,F. et al. Interference of poly(ethylene glycol) -lipid analogues with cationic lipid -mediated delivery of oligonucleotides; role of lipid exchangeability and non lamellar transitions. Biochem. J. 366, 333341 (2002). 169. Wheeler,J.J. et al. Stabi lized plasmid -lipid particles: construction and characterization. Gene Ther. 6 271281 (1999). 170. Li,W., Huang,Z., MacKay,J.A., Grube,S., & Szoka,F.C., Jr. Low -pH -sensitive poly(ethylene glycol) (PEG) -stabilized plasmid nanolipoparticles: effects of PEG chain length, lipid composition and assembly conditions on gene delivery. J. Gene Med. 7 67 79 (2005).

PAGE 129

129 171. Masson,C. et al. pH -sensitive PEG lipids containing orthoester linkers: new potential tools for nonviral gene delivery. J. Control Release 99, 423434 (2004). 172. Chevez Barrios,P. et al. Response of retinoblastoma with vitreous tumor seeding to adenovirus -mediated delivery of thymidine kinase followed by ganciclovir. J. Clin. Oncol. 23, 79277935 (2005). 173. Campochiaro,P.A. et al. Adenoviral vector -delivered pigment epithelium -derived factor for neovascular age related macular degeneration: results of a phase I clinical trial. Hum. Gene Ther. 17, 167176 (2006). 174. Hauswirth,W. et al. Phase I Trial of Leber Congenital Amaurosis due to RPE65 Mutations by Ocular Subretinal Injection of Adeno-Associated Virus Gene Vector: Short Term Results. Hum. Gene Ther. (2008). 175. Cideciyan,A.V. et al. Human gene therapy for RPE65 isomerase deficiency activates the retinoid cycle of vision but with slow rod kinetics. Proc. Natl. Acad. Sci. U. S. A 105, 1511215117 (2008). 176. Fauquet,C.M. & Mayo,M.A. The 7th ICTV report. Arch Virol. 146, 189194 (2001). 177. Muzyczka,N.&.B.K.I. Parvoviridae : the viruses and their replication in Fields virology (ed. D.M.Knipe,P.M.H.D.E.G.R.A.L.M.A.M.B.R.a.S.E.S.) 2327 2359 (Lippincott Williams and Wilkins, Philadelphia, Pa., 2001). 178. Best,S.M. & Bloom,M.E. Pathogenesis of aleutian mink disease parvovirus and similarities to b19 infection. J. Vet. Med. B Infect. Dis. Vet. Public Health 52 331334 (2005). 179. Lindner,J. & Modrow,S. Human bocavirus -a novel parvovirus to infect humans. Intervirology 51, 116 122 (2008). 180. Muzyczka,N. Use of adenoassociated virus as a general transduction vector for mammalian cells. Curr. Top. Microbiol. Immunol. 158, 97 129 (1992). 181. ATCHISON,R.W., CASTO,B.C., & HAMMON,W.M. ADENOVIRUS ASSOCIATED DEFECTIVE VIRUS PARTICLES. Science 149, 754756 (1965). 182. Buller,R.M., Janik,J.E., Sebring,E.D., & Rose,J.A. Herpes simplex virus types 1 and 2 completely help adenovirus associated virus replication. J. Virol. 40, 241247 (1981). 183. Cheung,A.K., Hoggan,M.D., Hauswirth,W.W., & Berns,K.I. I ntegration of the adeno associated virus genome into cellular DNA in latently infected human Detroit 6 cells. J. Virol. 33, 739748 (1980).

PAGE 130

130 184. Kotin,R.M. & Berns,K.I. Organization of adeno associated virus DNA in latently infected Detroit 6 cells. Virology 170, 460467 (1989). 185. Samulski,R.J. et al. Targeted integration of adeno associated virus (AAV) into human chromosome 19. EMBO J. 10, 39413950 (1991). 186. Kotin,R.M., Linden,R.M., & Berns,K.I. Characterization of a preferred site on human chromosome 19q for integration of adenoassociated virus DNA by nonhomologous recombination. EMBO J. 11, 50715078 (1992). 187. Kotin,R.M., Menninger,J.C., Ward,D.C., & Berns,K.I. Mapping and direct visualization of a region-specific viral DNA integration site on chromosome 19q13qter. Genomics 10, 831834 (1991). 188. Kotin,R.M. et al. Site -specific integration by adeno associated virus. Proc. Natl. Acad. Sci. U. S. A 87, 22112215 (1990). 189. Laughlin,C.A., Cardellichio,C.B., & Coon,H.C. Latent infection of KB cells with adeno associated virus type 2. J. Virol. 60, 515524 (1986). 190. McLaughlin,S.K., Collis,P., Hermonat,P.L., & Muzyczka,N. Adeno associated virus general t ransduction vectors: analysis of proviral structures. J. Virol. 62, 19631973 (1988). 191. Crawford,L.V., Follett,E.A., Burdon,M.G., & McGeoch,D.J. The DNA of a minute virus of mice. J. Gen. Virol. 4 3746 (1969). 192. Rose,J.A., Berns,K.I., H oggan,M.D., & Koczot,F.J. Evidence for a single stranded adenovirus associated virus genome: formation of a DNA density hybrid on release of viral DNA. Proc. Natl. Acad. Sci. U. S. A 64, 863869 (1969). 193. Astell,C.R., Thomson,M., Merchlinsky,M., & Ward,D.C. The complete DNA sequence of minute virus of mice, an autonomous parvovirus. Nucleic Acids Res. 11, 9991018 (1983). 194. Srivastava,A., Lusby,E.W., & Berns,K.I. Nucleotide sequence and organization of the adenoassociated virus 2 genome. J. Virol. 45, 555564 (1983). 195. Rhode,S.L., III & Paradiso,P.R. Parvovirus genome: nucleotide sequence of H 1 and mapping of its genes by hybrid arrested translation. J. Virol. 45, 173184 (1983). 196. Muralidhar,S., Becerra,S.P., & Rose,J.A Site -directed mutagenesis of adeno associated virus type 2 structural protein initiation codons: effects on regulation of synthesis and biological activity. J. Virol. 68, 170176 (1994). 197. Rose,J.A., Maizel,J.V., Jr., Inman,J.K., & Shatkin,A.J. Structural proteins of adenovirus associated viruses. J. Virol. 8 766770 (1971).

PAGE 131

131 198. Im,D.S. & Muzyczka,N. The AAV origin binding protein Rep68 is an ATP dependent site -specific endonuclease with DNA helicase activity. Cell 61, 447457 (1990). 199. Snyder,R.O., Samulski,R.J., & Muzyczka,N. In vitro resolution of covalently joined AAV chromosome ends. Cell 60, 105113 (1990). 200. Wonderling,R.S., Kyostio,S.R., & Owens,R.A. A maltose -binding protein/adeno associated virus Rep68 fusion pr otein has DNA RNA helicase and ATPase activities. J. Virol. 69, 35423548 (1995). 201. Chejanovsky,N. & Carter,B.J. Mutagenesis of an AUG codon in the adenoassociated virus rep gene: effects on viral DNA replication. Virology 173, 120128 (1989). 202. Beaton,A., Palumbo,P., & Berns,K.I. Expression from the adenoassociated virus p5 and p19 promoters is negatively regulated in trans by the rep protein. J. Virol. 63, 44504454 (1989). 203. Senapathy,P., Tratschin,J.D., & Carter,B.J. Replic ation of adenoassociated virus DNA. Complementation of naturally occurring repmutants by a wild type genome or an ori mutant and correction of terminal palindrome deletions. J. Mol. Biol. 179, 1 20 (1984). 204. Yang,C.C. et al. Cellular recombination pathways and viral terminal repeat hairpin structures are sufficient for adeno associated virus integration in vivo and in vitro. J. Virol. 71, 92319247 (1997). 205. Samulski,R.J., Srivastava,A., Berns,K.I., & Muzyczka,N. Res cue of adenoassociated virus from recombinant plasmids: gene correction within the terminal repeats of AAV. Cell 33, 135143 (1983). 206. Hoggan,M.D., Blacklow,N.R., & Rowe,W.P. Studies of small DNA viruses found in various adenovirus preparations: physical, biological, and immunological characteristics. Proc. Natl. Acad. Sci. U. S. A 55, 14671474 (1966). 207. Samulski,R.J., Berns,K.I., Tan,M., & Muzyczka,N. Cloning of adeno associated virus into pBR322: rescue of intact virus from the recombi nant plasmid in human cells. Proc. Natl. Acad. Sci. U. S. A 79, 20772081 (1982). 208. Qiu,J., Handa,A., Kirby,M., & Brown,K.E. The interaction of heparin sulfate and adeno associated virus 2. Virology 269, 137147 (2000). 209. Summerford,C. & Samulski,R.J. Membrane associated heparan sulfate proteoglycan is a receptor for adeno associated virus type 2 virions. J. Virol. 72, 14381445 (1998).

PAGE 132

132 210. Summerford,C., Bartlett,J.S., & Samulski,R.J. AlphaVbeta5 integrin: a co receptor for adeno a ssociated virus type 2 infection. Nat. Med. 5 78 82 (1999). 211. Qing,K. et al. Human fibroblast growth factor receptor 1 is a co receptor for infection by adenoassociated virus 2. Nat. Med. 5 7177 (1999). 212. Bartlett,J.S., Kleinschmidt,J ., Boucher,R.C., & Samulski,R.J. Targeted adenoassociated virus vector transduction of nonpermissive cells mediated by a bispecific F(ab'gamma)2 antibody. Nat. Biotechnol. 17, 181186 (1999). 213. Girod,A. et al. Genetic capsid modifications allow e fficient re -targeting of adenoassociated virus type 2. Nat. Med. 5 10521056 (1999). 214. Ried,M.U., Girod,A., Leike,K., Buning,H., & Hallek,M. Adenoassociated virus capsids displaying immunoglobulin-binding domains permit antibody -mediated vector retargeting to specific cell surface receptors. J. Virol. 76, 45594566 (2002). 215. Shi,W. & Bartlett,J.S. RGD inclusion in VP3 provi des adeno associated virus type 2 (AAV2) -based vectors with a heparan sulfate independent cell entry mechanism. Mol. Ther. 7 515525 (2003). 216. Wu,P. et al. Mutational analysis of the adenoassociated virus type 2 (AAV2) capsid gene and constructi on of AAV2 vectors with altered tropism. J. Virol. 74, 86358647 (2000). 217. Yang,Q. et al. Development of novel cell surface CD34-targeted recombinant adenoassociated virus vectors for gene therapy. Hum. Gene Ther. 9 19291937 (1998). 218. Bartlett,J.S., Wilcher,R., & Samulski,R.J. Infectious entry pathway of adeno associated virus and adeno associated virus vectors. J. Virol. 74, 27772785 (2000). 219. Duan,D. et al. Dynamin is required for recombinant adeno associated virus type 2 inf ection. J. Virol. 73, 1037110376 (1999). 220. Linser,P., Bruning,H., & Armentrout,R.W. Uptake of minute virus of mice into cultured rodent cells. J. Virol. 31, 537545 (1979). 221. Parker,J.S. & Parrish,C.R. Cellular uptake and infection by ca nine parvovirus involves rapid dynamin regulated clathrin -mediated endocytosis, followed by slower intracellular trafficking. J. Virol. 74, 19191930 (2000). 222. Basak,S. & Turner,H. Infectious entry pathway for canine parvovirus. Virology 186, 368376 (1992). 223. Hansen,J., Qing,K., & Srivastava,A. Adeno associated virus type 2 -mediated gene transfer: altered endocytic processing enhances transduction efficiency in murine fibroblasts. J. Virol. 75, 40804090 (2001).

PAGE 133

133 224. Straus,S.E., Se bring,E.D., & Rose,J.A. Concatemers of alternating plus and minus strands are intermediates in adenovirus associated virus DNA synthesis. Proc. Natl. Acad. Sci. U. S. A 73, 742746 (1976). 225. Hauswirth,W.W. & Berns,K.I. Origin and termination of ad eno associated virus DNA replication. Virology 78, 488499 (1977). 226. Beck,S.E. et al. Repeated delivery of adeno associated virus vectors to the rabbit airway. J. Virol. 73, 94469455 (1999). 227. Chirmule,N. et al. Humoral immunity to adenoassociated virus type 2 vectors following administration to murine and nonhuman primate muscle. J. Virol. 74, 24202425 (2000). 228. Hernandez,Y.J. et al. Latent adeno associated virus infection elicits humoral but not cell -mediated immune responses in a nonhuman primate model. J. Virol. 73, 85498558 (1999). 229. Jooss,K., Yang,Y., Fisher,K.J., & Wilson,J.M. Transduction of dendritic cells by DNA viral vectors directs the immune response to transgene products in muscl e fibers. J. Virol. 72, 42124223 (1998). 230. Kearns,W.G. et al. Recombinant adeno associated virus (AAV-CFTR) vectors do not integrate in a site -specific fashion in an immortalized epithelial cell line. Gene Ther. 3 748755 (1996). 231. Afione,S.A. et al. In vivo model of adenoassociated virus vector persistence and rescue. J. Virol. 70, 32353241 (1996). 232. Flotte,T.R., Afione,S.A., & Zeitlin,P.L. Adeno associated virus vector gene expression occurs in nondividing cells in the a bsence of vector DNA integration. Am. J. Respir. Cell Mol. Biol. 11, 517521 (1994). 233. Vincent Lacaze,N. et al. Structure of adenoassociated virus vector DNA following transduction of the skeletal muscle. J. Virol. 73, 19491955 (1999). 234. Wistuba,A., Weger,S., Kern,A., & Kleinschmidt,J.A. Intermediates of adeno associated virus type 2 assembly: identification of soluble complexes containing Rep and Cap proteins. J. Virol. 69, 53115319 (1995). 235. Ponnazhagan,S. et al. Differential expression in human cells from the p6 promoter of human parvovirus B19 following plasmid transfection and recombinant adenoassociated virus 2 (AAV) infection: human megakaryocytic leukaemia cells are nonpermissive for AAV infection. J. Gen. Virol. 77 ( Pt 6) 11111122 (1996). 236. Rabinowitz,J.E. et al. Cross -packaging of a single adeno associated virus (AAV) type 2 vector genome into multiple AAV serotypes enables transduction with broad specificity. J. Virol. 76, 791801 (2002).

PAGE 134

134 237. Hauck ,B., Chen,L., & Xiao,W. Generation and characterization of chimeric recombinant AAV vectors. Mol. Ther. 7 419425 (2003). 238. Bowles,D.E., Rabinowitz,J.E., & Samulski,R.J. Marker rescue of adenoassociated virus (AAV) capsid mutants: a novel approa ch for chimeric AAV production. J. Virol. 77, 423432 (2003). 239. McCarty,D.M. et al. Adeno associated virus terminal repeat (TR) mutant generates self -complementary vectors to overcome the rate limiting step to transduction in vivo. Gene Ther. 10, 21122118 (2003). 240. McCarty,D.M., Monahan,P.E., & Samulski,R.J. Self -complementary recombinant adeno associated virus (scAAV) vectors promote efficient transduction independently of DNA synthesis. Gene Ther. 8 12481254 (2001). 241. Natkuna rajah,M. et al. Assessment of ocular transduction using single -stranded and self -complementary recombinant adeno associated virus serotype 2/8. Gene Ther. 15, 463467 (2008). 242. Rivera,V.M. et al. A humanized system for pharmacologic control of gene expression. Nat. Med. 2 10281032 (1996). 243. Christopherson,K.S., Mark,M.R., Bajaj,V., & Godowski,P.J. Ecdysteroiddependent regulation of genes in mammalian cells by a Drosophila ecdysone receptor and chimeric transactivators. Proc. Natl. Acad. Sci. U. S. A 89, 63146318 (1992). 244. Wang,Y., O'Malley,B.W., Jr., Tsai,S.Y., & O'Malley,B.W. A regulatory system for use in gene transfer. Proc. Natl. Acad. Sci. U. S. A 91, 81808184 (1994). 245. Gossen,M. et al. Transcriptional activation by tetracyclines in mammalian cells. Science 268 17661769 (1995). 246. Yen,L. et al. Exogenous control of mammalian gene expression through modulation of RNA self -cleavage. Nature 431, 471476 (2004). 247. Ferbeyre,G., Smith,J.M., & Cedergre n,R. Schistosome satellite DNA encodes active hammerhead ribozymes. Mol. Cell Biol. 18, 38803888 (1998). 248. Yen,L., Magnier,M., Weissleder,R., Stockwell,B.R., & Mulligan,R.C. Identification of inhibitors of ribozyme self -cleavage in mammalian cell s via high throughput screening of chemical libraries. RNA. 12, 797806 (2006). 249. Win,M.N. & Smolke,C.D. A modular and extensible RNA -based gene -regulatory platform for engineering cellular function. Proc. Natl. Acad. Sci. U. S. A 104, 1428314288 (2007).

PAGE 135

135 250. Mori,K. et al. AAV-mediated gene transfer of pigment epithelium -derived factor inhibits choroidal neovascularization. Invest Ophthalmol Vis. Sci. 43, 1994-2000 (2002).

PAGE 136

136 BIOGRAPHICAL SKETCH Lee R. Ferguson was born and raised in Miami Florida His elementary school education was conducted at Biscayne Gardens Elementary School. Afterwards he attended Thomas Jefferson Middle school and upon graduation there entered into the medical magnet program at Miami Northw estern High School. There Lee was introduced to careers in medicine and participated in the Siemens Westinghouse Science and Technology competition. This was his first venture into scientific research. Under the mentorship of Dr. Thomas J. Sick (Dept of Neurology at the Leonard M. Miller School of Medicine at the University of Miami) Lee conducted a research study of the effects of hypoxia on long-term potentiation in mouse hippocampal cells. Following graduation from high school, Lee attended the Univer sity of Miami. While at the University of Miami, Lee was accepted as a Howard Huges scholar and was able to participate in a curriculum designed to foster future researchers in the biological sciences. Lee then undertook a college senior thesis project at the Miami Project to Cure Paralysis under the auspices of Dr. Blair Calancie. There Lee embarked on research in neurosurgical sciences. Lee studied somatosensory and motor evoked potentials in ferrets. The goal was to establish a method to provide monitoring of somatosensory and motor evoked potentials in the spinal cord. This would help surgeons better observe the effects of operative procedures to spinal cord functionality. He later graduated as a cum laude Howard Huges scholar with a double major in Psychology and Biology and minor in Chemistry. Additionally, he was awarded with Departmental Honors in Biology for successfully completing a senior thesis project. Lee then entered into the MD/PhD program at the University of Florida College of Medic ine. After completing the first half of the medical school 4 -year curriculum, he then matriculated into the University of Florida IDP program. Lee entered into the laboratory of Dr. Alfred S. Lewin to begin his stent as a graduate student. He was later introduced to Dr. William

PAGE 137

137 W. Hauswirth in order to learn about and conduct research in vision science. Since then he has been mentored by the combined efforts of Dr. William W. Hauswirth and Dr. Alfred S. Lewin. Lee has gained great insight into basic sc ience and clinical research fields. He has amassed skills and experiences that will further his career as a physician scientist in the years to c ome. Upon graduation, Lee reentered medical school to complete the last half of the 4 -year curriculum at the University of Florida College of Medicine.