<%BANNER%>

Role of Periplasmic Nitrate Reductase on Diauxic Lag in Denitrifying Bacteria

Permanent Link: http://ufdc.ufl.edu/UFE0024030/00001

Material Information

Title: Role of Periplasmic Nitrate Reductase on Diauxic Lag in Denitrifying Bacteria
Physical Description: 1 online resource (110 p.)
Language: english
Creator: Durvasula, Kiranmai
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: adaptation, anoxic, diauxic, fish, mutant, paracoccus, periplasmic, transition
Chemical Engineering -- Dissertations, Academic -- UF
Genre: Chemical Engineering thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Biological processes are preferred means of removing nitrogen from wastewater. It is achieved through alternating oxic and anoxic conditions. The period of little or no growth observed when switching from oxygen as terminal electron acceptor to nitrate as terminal electron acceptor is called diauxic lag. Lag periods reduce overall rate of nitrogen removal hence must be reduced. All denitrifiers have membrane bound nitrate reductase (Nar). However, some gram negative bacteria also express periplasmic nitrate reductase (Nap). The present research was carried out to investigate the effect of Nap on diauxic lag. Growth experiments were done with four denitrifiers, two of which had Nap and Nar (Paracoccus pantotrophus and Alcaligenes eutrophus) and two had only Nar (Pseudomonas denitrificans and Pseudomonas fluorescens) to determine diauxic lag. It was found that the diauxic lag was shorter for the bacteria which had Nap. To conclusively prove that Nap is responsible for shorter diauxic lag, the gene napEDABC that encodes for Nap was deleted from P. pantotrophus. Simultaneous growth experiments along with enzyme activity measurements were carried out for the wild strain and mutant of P. pantotrophus to study diauxic lag. It was found that diauxic lag has increased significantly for the mutant strain as compared to the wild strain. The presence of Nap is usually determined by conducting enzyme assay measurements which is tedious and time consuming. To facilitate easy identification of bacteria containing Nap, we conducted a FISH (Fluorescence In-Situ Hybridization) probe that binds to Nap. The probe successfully tested against two nap+ bacteria (P. pantotrophus and A. eutrophus) and two nap- bacteria (P. denitrificans and P. fluorescens). A model is presented in which the growth kinetics and nitrate uptake where linked to the synthesis of Nar and Nap. The model assumes the existence of a nitrate respiration operon and links the activity of Nar to the nitrate uptake rate into the cell. It also assumes that Nap contributes to growth during transition from aerobic to anoxic phase. This model successfully matched the experimental data for growth and captured the shorter lag displayed by wild-type P. pantotrophus which has both Nap and Nar.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Kiranmai Durvasula.
Thesis: Thesis (Ph.D.)--University of Florida, 2008.
Local: Adviser: Svoronos, Spyros.
Local: Co-adviser: Koopman, Ben L.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0024030:00001

Permanent Link: http://ufdc.ufl.edu/UFE0024030/00001

Material Information

Title: Role of Periplasmic Nitrate Reductase on Diauxic Lag in Denitrifying Bacteria
Physical Description: 1 online resource (110 p.)
Language: english
Creator: Durvasula, Kiranmai
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: adaptation, anoxic, diauxic, fish, mutant, paracoccus, periplasmic, transition
Chemical Engineering -- Dissertations, Academic -- UF
Genre: Chemical Engineering thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Biological processes are preferred means of removing nitrogen from wastewater. It is achieved through alternating oxic and anoxic conditions. The period of little or no growth observed when switching from oxygen as terminal electron acceptor to nitrate as terminal electron acceptor is called diauxic lag. Lag periods reduce overall rate of nitrogen removal hence must be reduced. All denitrifiers have membrane bound nitrate reductase (Nar). However, some gram negative bacteria also express periplasmic nitrate reductase (Nap). The present research was carried out to investigate the effect of Nap on diauxic lag. Growth experiments were done with four denitrifiers, two of which had Nap and Nar (Paracoccus pantotrophus and Alcaligenes eutrophus) and two had only Nar (Pseudomonas denitrificans and Pseudomonas fluorescens) to determine diauxic lag. It was found that the diauxic lag was shorter for the bacteria which had Nap. To conclusively prove that Nap is responsible for shorter diauxic lag, the gene napEDABC that encodes for Nap was deleted from P. pantotrophus. Simultaneous growth experiments along with enzyme activity measurements were carried out for the wild strain and mutant of P. pantotrophus to study diauxic lag. It was found that diauxic lag has increased significantly for the mutant strain as compared to the wild strain. The presence of Nap is usually determined by conducting enzyme assay measurements which is tedious and time consuming. To facilitate easy identification of bacteria containing Nap, we conducted a FISH (Fluorescence In-Situ Hybridization) probe that binds to Nap. The probe successfully tested against two nap+ bacteria (P. pantotrophus and A. eutrophus) and two nap- bacteria (P. denitrificans and P. fluorescens). A model is presented in which the growth kinetics and nitrate uptake where linked to the synthesis of Nar and Nap. The model assumes the existence of a nitrate respiration operon and links the activity of Nar to the nitrate uptake rate into the cell. It also assumes that Nap contributes to growth during transition from aerobic to anoxic phase. This model successfully matched the experimental data for growth and captured the shorter lag displayed by wild-type P. pantotrophus which has both Nap and Nar.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Kiranmai Durvasula.
Thesis: Thesis (Ph.D.)--University of Florida, 2008.
Local: Adviser: Svoronos, Spyros.
Local: Co-adviser: Koopman, Ben L.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0024030:00001


This item has the following downloads:


Full Text

PAGE 1

1 ROLE OF PERIPLASMIC NITRATE REDUCTASE ON DIAUXIC LAG IN DENITRIFYING BACTERIA By KIRANMAI DURVASULA A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2008

PAGE 2

2 2008 Kiranmai Durvasula

PAGE 3

3 To my mom, Usha Sree,and my dad, Somayajulu.

PAGE 4

4 ACKNOWLEDGMENTS I thank my advisor, Dr. Spyros Svoronos and my co-advisor, Dr. Ben Koopman,for their support and guidance throughout my research. I thank my committee members (Dr. Yiider Tseng and Dr. Nemat O. Keyhani)for their advice and help. I also thank Dr. Madeleine Rasche and Dr. Yiider Tseng for allowing the use of their laboratory facilities. I would like to acknowledge the alumni of our research lab (Ryan Hamilton, Anna Casass-Zambrana and Dong-Uk Lee)for the initial training they provided. I also thank my fellow research members of my group (Kyle Fischer, Adrian Vega, Eric Stauntonand Shourie Kapadi)for their help and friendship. Special thanksgo to Kaemwich Jantama for all his advice. Finally, I thank my mom, dad, and my husband for all their love and support and for just being there for me.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS...............................................................................................................4 LIST OF TABLES...........................................................................................................................8 LIST OF FIGURES.........................................................................................................................9 LIST OF ABBREVIATIONS........................................................................................................11 ABSTRACT...................................................................................................................................13 CHAPTER 1 INTRODUCTION..................................................................................................................15 2 EFFECT OF PERIPLASMIC NITRATE REDUCTASE (NAP) ON DIAUXIC LAG OF PARACOCCUS PANTOTROPHUS...............................................................................26 Introduction.............................................................................................................................26 Materials and Methods...........................................................................................................27 Growth Experiments........................................................................................................27 Nitrate Reductase Assays................................................................................................31 Construction of a Nap-Deficient Mutant.........................................................................32 Bacterial Strains and Plasmids........................................................................................32 Nucleotide Sequence Accession Number........................................................................32 Genetic Techniques.........................................................................................................32 Primer Design and PCR Conditions................................................................................35 Construction of pKD100.................................................................................................37 Deletion of napEDABC ...................................................................................................38 PCR Verification of the Mutant......................................................................................39 Results and Discussion...........................................................................................................41 Conclusions.............................................................................................................................47 2 USE OF FLUORESCENCE IN SITU HYBRIDIZATION AS A TECHNIQUE FOR IDENTIFYING NAP + DENITRIFYING BACTERIA..........................................................48 Introduction.............................................................................................................................48 Materials and Methods...........................................................................................................49 Probe Design...................................................................................................................49 Chemicals........................................................................................................................52 Bacterial Culture..............................................................................................................52 Bacterial Isolates.............................................................................................................53 Bacterial Fixation............................................................................................................53 The FISH Protocol...........................................................................................................54 Results and Discussion...........................................................................................................55

PAGE 6

6 3 DIAUXIC GROWTH MODEL BASED ON NAP AND NAR SYNTHESIS KINETICS FOR DENITRIFYING BACTERIA .....................................................................................60 Introduction.............................................................................................................................60 Model......................................................................................................................................61 Rate of Synthesis of Nar..................................................................................................62 Rate of Synthesis of Nap.................................................................................................62 Oxic Growth....................................................................................................................63 Specific Rate of Nitrate Uptake.......................................................................................63 Anoxic Growth................................................................................................................63 Materials and Methods...........................................................................................................65 Growth Experiments........................................................................................................65 Optimization...........................................................................................................................66 Results and Discussion...........................................................................................................67 4 FUTURE WORK....................................................................................................................71 Introduction of nap Gene in a Nap-Deficient Pseudomonas denitrificans.............................71 Construction of Nar Probe using FISH...................................................................................72 Colony Hybridization.............................................................................................................73 Effect of the Carbon Substrate Reduction State on the Length of the Diauxic Lag...............73 APPENDIX A GENE DELETION STRATEGY...........................................................................................75 Step 1: Culture E coli Containing Helper Plasmid.................................................................75 Materials..........................................................................................................................75 Procedure.........................................................................................................................75 Step 2: PCR Amplification Kanamycin Resistance Gene from pACYC177 using Primers with EcoR I/ Sph IRestriction Sites........................................................................75 Materials..........................................................................................................................75 Procedure.........................................................................................................................75 Step 3: Clone PCR Fragment in pRVS1.................................................................................77 Materials..........................................................................................................................77 Procedure.........................................................................................................................77 Step 4: Transformation of Donor Plasmid into Donor E. coli ................................................78 Materials..........................................................................................................................78 Procedure.........................................................................................................................78 Step 5: Triparental Mating......................................................................................................80 Materials..........................................................................................................................80 Procedure.........................................................................................................................80 Step 6: Confirmation of the Mutant........................................................................................80 B DIFFERENTIAL EVOLUTION............................................................................................83 Initialization............................................................................................................................83 Mutation..................................................................................................................................84

PAGE 7

7 Crossover/Recombination.......................................................................................................84 Selection.................................................................................................................................85 C DIAUXIC GROWTH MODEL SOURCE CODE.................................................................86 LIST OF REFERENCES.............................................................................................................106 BIOGRAPHICAL SKETCH.......................................................................................................110

PAGE 8

8 LIST OF TABLES Table page 1-1 Enzymes of denitrification................................................................................................20 2-2 Bacterial strains and plasmids used in this work..............................................................34 2-3 Primers used in PCR.........................................................................................................36 2-4 Enzyme activities of the wild-type and mutant.................................................................46 3-1 Percent homology of napA and napB subunits in four micro-organisms.........................49 3-2 Bacteria with a highly similar sequence to at least one candidate probe..........................50 3-2 Continued..........................................................................................................................51 3-3 Performance of candidate probes against the test set of 71 bacteria.................................52 3-4 Percent correct identification for nap containing bacteria................................................52 3-5 Enzyme activity data and diauxic lag lengths compared to probe results........................58 4-1 Parameter values obtained after fitting.............................................................................70 A-1 PCR reaction ingredients..................................................................................................76 A-2 Double digest reaction set up............................................................................................78 A-3 Ligation reaction...............................................................................................................78

PAGE 9

9 LIST OF FIGURES Figure page 1-1 Nitrogen cycle...................................................................................................................15 1-2 Organization of denitrification enzymes in the cell..........................................................19 1-3 Fluorescence in situ hybridization technique....................................................................23 2-1 Flowsheet for constructing Nap-deficient mutant KD102................................................33 2-2 Amplification of kanamycin cassette from pACYC177...................................................37 2-3 Plasmid pKD100 ( napE-Kan-napC cloned into pRVS1) constructed in the present work...................................................................................................................................38 2-4 Verification of the mutant.................................................................................................40 2-5 Growth curves of four different denitrifiers......................................................................43 2-6 Comparison of lag lengths................................................................................................44 2-7 Comparison of growth between wild-type and mutant.....................................................45 3-1 Paracoccus pantotrophus viewed at 600x magnification under incandescent light.........56 3-2 Paracoccus pantotrophus viewed at 600x magnification under UV light after being treated with fluorescent probe that targets napA ................................................................56 3-3 Pseudomonas denitrificans viewed at 600x magnification under incandescent light.....57 3-4 Pseudomonas denitrificans viewed at 600x magnification under UV light after being treated with fluorescent probe............................................................................................57 3-5 Bacteria isolated from the University of Florida Waste Water treatment plant viewed at 600x magnification under incandescent light................................................................59 3-6 Bacteria isolated from the University of Florida Water Reclamation Facility viewed at 600x magnification under UV light after being treated with fluorescent probe that targets napA .......................................................................................................................59 4-1 Model fit to the fermentor growth data of P. pantotrophus ..............................................68 4-2 Model fit to the fermentor growth data of the mutant......................................................69 A-1 The PCR temperature profile used....................................................................................76 A-2 Gel picture: desired fragment size....................................................................................77

PAGE 10

10 A-3 Blue colonies of E. coli ring plasmid pKD100.............................................79 A-4 Triparental mating.............................................................................................................81

PAGE 11

11 LIST OF ABBREVIATIONS a N, Nar Maxiumum specific Nar synthesis rate a N, Nap Maximum specific Nap synthesis rate b Specific biomass decay rate b NO Specific nitrate reductase decay rate CR Crossover factor D Dimensions, Number of parameters to be optimized e nap Specific Nap activity e nap,av Average Nap activity e nap,max Maximum Nap activity e nap,measured Measured Nap activity e nap,max Maximum Nap activity e nap,predicted Predicted Nar activity from the optimization e nar Specific Nar activity e nar,av Average Nar activity e nar,max Maximum Nar activity e nar,measured Measured Nar activity e nar,predicted Predicted Nar activity from the optimization F Scaling factor F (g) Objective function g Vector ofD 1 decision parameters K 1 Equilibrium constant for repressor/ inducer binding K 2 Constitutive enzyme expression level K Noi Half saturation co-efficient for internal nitrate K OH Half saturation co-efficient for oxygen for aerobic growth

PAGE 12

12 K Oi Half saturation co-efficient for oxygen inhibition for nitrate uptake K s,an Half saturation co-efficient for carbon source for anoxic growth K s,ox Half saturationco-efficient for carbon source for aerobic growth n Noisy random vector NP Number in the population r anox Specific biomass growth rate under anoxic conditions r ox Specific biomass growth rate under aerobic conditions r en,nar Specific Nar synthesis rate r en,nap Specific Nap synthesis rate rnd( ) Uniform random number generator r sni Specific nitrate uptake rate S s Organic substrate concentration S N Nitrate concentration s ni Internal nitrate concentration S O Dissolved oxygen concentration t Trial vector V sni Maximum specific nitrate uptake rate X B Biomass concentration X B,av Average biomass concentration X B,predicted Calculated values of biomass from the optimization X B,measured Measured values of biomass Y c,an Yield under anoxic conditions Y c,ox Yield under aerobic conditions Ratio of maximum growth on Nap to maximum growth on Nar N,an Nitrate consumed per unit biomass growth

PAGE 13

13 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy ROLE OF PERIPLASMIC NITRATE REDUCTASE ON DIAUXIC LAG IN DENITRIFYING BACTERIA By Kiranmai Durvasula December 2008 Chair: Spyros A. Svoronos Cochair: Ben Koopman Major: Chemical Engineering Biological processes are preferred means of removing nitrogen from wastewater. It is achieved through alternating oxic and anoxic conditions. The period of little or no growth observed when switching from oxygen as terminal electron acceptor to nitrate as terminal electron acceptor is called diauxic lag. Lag periods reduce overall rate of nitrogen removal hence must be reduced. All denitrifiers have membrane bound nitrate reductase (Nar). However, some gram negative bacteria also express periplasmic nitrate reductase (Nap). The present research was carried out to investigate the effect of Nap on diauxic lag. Growth experiments were done with four denitrifiers, two of which had Nap and Nar ( Paracoccus pantotrophus and Alcaligenes eutrophus ) and two had only Nar ( Pseudomonas denitrificans and Pseudomonas fluorescens )to determine diauxic lag. It was found that the diauxic lag was shorter for the bacteria which had Nap. To conclusively prove that Nap is responsible for shorter diauxic lag, the gene napEDABC that encodes for Nap was deleted from P. pantotrophus Simultaneous growth experiments along with enzyme activity measurements were carried out for the wild strain and mutant of P. pantotrophus to study diauxic lag. It was

PAGE 14

14 found that diauxic lag has increased significantly for the mutant strain as compared to the wild strain. The presence of Nap is usually determined by conducting enzyme assay measurements which is tedious and time consuming. To facilitate easy identification of bacteria containing Nap, we conducted a FISH (Fluorescence In-Situ Hybridization) probe that binds to Nap. The probe successfully tested against two nap + bacteria ( P. pantotrophus and A.eutrophus) and two nap bacteria ( P.denitrificansand P.fluorescens). A model is presented in which thegrowth kinetics and nitrate uptake where linked to the synthesis of Nar and Nap. The model assumes the existence of a nitrate respiration operon and links the activity of Nar to the nitrate uptake rate into the cell. It also assumes that Nap contributes to growth during transition from aerobic to anoxic phase. This model successfully matched the experimental data for growth and captured the shorter lag displayed by wild-typeP. pantotrophus which has both Nap and Nar.

PAGE 15

15 CHAPTER 1 INTRODUCTION Nitrogen removal is an important component of wastewater treatment plants. Excess nitrogen in wastewater leads to eutrophication of receiving water bodies, and can cause harmful effects on aquatic life due to oxygen depletion. It is also toxic in some forms ( Ramalho, 1983 ) and has adverse health effects. Nitrogen is commonly removed by biological means because they are both efficient and cost effective ( Grady et al., 1999 ). Biological nitrogen removal consists of the processes of nitrification, oxidation of ammonia to nitrate, and denitrification, reduction of nitrate to dinitrogen (Figure 1-1). Figure 1-1. Nitrogen cycle

PAGE 16

16 Although denitrification under aerobic conditions has been reported, the rate of denitrification is maximized under anoxic (dissolved oxygen absent, nitrate present) conditions ( Tiedje, 1988 ). Therefore, to achieve nitrogen removal in a single-sludge system, a mixed population of nitrifying and denitrifying bacteria must be exposed to alternating aerobic and anoxic conditions ( Ramalho, 1983 ). The biological nitrate reduction to dinitrogen is carried out by heterotrophic, facultative bacteria(Paracoccus pantotrophus Pseudomonas denitrificans Pseudomonas fluorescens Pseudomonas stutzeri Alcaligenes eutrophus etc).Denitrification has several intermediates such as 2 NO, NO, N2 O. Many investigators ( Waki et al., 1980 ; Liu et al., 1998a, 1998b ; Gouw et al., 2001 ) have shown that when bacteria change from dissolved oxygen to nitrate as terminal electron acceptor, there maybe a period of little orno growth. This period, when it occurs between two periods of exponential growth, was termed as diauxic lag by Monod (1942) The diauxic lag corresponds to the time necessary for bacteria to synthesize and activate the enzymes necessary to metabolize the less preferred substrate. Lag periods reduce overall rate of nitrogen removal,hence must be reduced. The characteristic feature of gram negative bacteria isthepresence of anextra outer membrane layer. The space between the outer membrane and the plasma membrane is the periplasmic space. The function of the outer membrane is to regulate the flow of the nutrients into the cell and waste products out of the cell. The outer membrane is basically a bilayer of lipids and contains channel forming proteins called porins. These porin proteins control the permeability of polar solutes across the outer membrane of gram-negative bacteria( Nikaido, 2003 ). There are at least two general pathways for the diffusion of small molecules across the outer membrane: one for hydrophobic and one for hydrophilic compounds. Porins create a water-filled pore through which ions and some small hydrophilic molecules can pass by

PAGE 17

17 diffusion. The channels can be opened (or closed) according to the needs of the cell. The permeability of hydrophobic molecules dependson its partition co-efficient. Nitrate from the environment is transported into the periplasmicspace through porins. Different enzymes catalyze the different reduction reactions of denitrification (Table 1-1). Their location in the cell is mapped in Figure 1-2. Two types are dissimilatory nitrate reductases are found in bacteria: Membrane bound nitrate reductase (Nar) and Periplasmic nitrate reductase (Nap). All denitrifiers are believed to have membrane bound nitrate reductase (Nar). However, some gram negative bacteria also express periplasmic nitrate reductase (Nap) ( Moreno-Vivin et al., 1999 ). Membrane bound nitrate reductase, which is anchored to the cytoplasm side of the membrane, allows ATP synthesis by using nitrate as the terminal electron acceptor under anoxic conditions. Nar gets the electrons from ubiquinol which generates proton motive force (PMF) and allows ATP synthesis. Ubiquinol is oxidized at the periplasmic side of the cytoplasmic membrane. These electrons are transported into the cytoplasm through the transmembrane protein and are utilized in the reduction of nitrate ( Berks et. al., 1995 ).The Nar system is generally induced by nitrate and repressed by oxygen,but is insensitive to ammonium. Due to the cytoplasmic location of Nar, nitrate has to be transported into the cell before it can be reduced. Oxygen inhibits nitrate transport, thereby inhibiting nitrate reduction by Nar. The location of nitrite reductase makes it necessary for the nitrite produced inside the cell to be transported out to continue further reduction ( Moreno-Vivin et al.,1999 ). The mechanism of nitrate uptake is not well understood. However, Woodet al.(2002) discuss the presence of two homologues of NarK transport protein NarK1 and NarK2.They suggest that NarK1 is nitrate/proton symporter and NarK2 is a nitrate/nitrite antiporter. Nar is inhibited by azide ( Bell et al., 1990 ) and chlorate in Paracoccus pantotrophus ( Rusmana, 2004 ). The inhibition by azide

PAGE 18

18 is achieved indirectly by controlling the movement of nitrate across the cytoplasmic membrane to the active site of its reductase (Bell et al., 1990 ). Chlorate inhibits Nar activity by blockingthe nitrate transporters. Periplasmic nitrate reductase which is on the periplasmic side of the membrane is not repressed by either nitrateor ammonium and maximally expressed under aerobic conditions ( Moreno-Vivin et al., 1999 ).Chlorate and azide can be selectively used as inhibitors to distinguish between Nar and Nap activity in the bacteria.

PAGE 19

19 Figure 1-2. Organization of denitrification enzymes in the cell

PAGE 20

20 Table 1-1. Enzymes of denitrification Enzyme Designation Location Reaction catalyzed Nitrate reductase Membrane bound Periplasmic Nar Nap Cytoplasm side of plasma membrane Periplasm side of plasma membrane 2 3 NO NO 2 3 NO NO Nitrite reductase Nir Periplasmic space NO NO 2 Nitric oxide reductase Nor Cytoplasmic membrane O N NO 2 Nitrous oxide reductase Nos Periplasmic space 2 2 N O N The function of periplasmic nitrate reductase is poorly understood. Proposed roles for periplasmic nitrate reductase are that it is usedfor redox balancing and adaptation to metabolism under anoxic conditions after transition from aerobic conditions (Moreno-Vivin et al.,1999 ). Several authors have suggestedthat Nap is used to shunt excess electrons to nitrate for redox balancing ( Richardson and Ferguson, 1992 ; Sears et al., 2000 ). Redox balancing can be necessary for optimal bacterial growth under some physiological conditions, such as oxidative metabolism of highly reduced carbon substrates in aerobic heterotrophs ( Moreno-Vivin et al., 1999 ). The level of Nap activity during aerobic growth has been shown to increase with the extent of reduction of the carbon substrate in cultures of Paracoccus pantotrophus (Sears et al., 2000 ).The transcription ofnap operon is dependent on the reduction state of the carbon substrate used. The carbon substrate preference for growth is in the order succinate, acetate and butyrate. That is, the least preferred carbon substrate is the one which causes the greatest activation of nap operon( Ellington et al., 2002 ). With the increase in the reduction state of carbon, more electrons are available for transfer. This increases the yield of ATP and lower concentration of ADP in the

PAGE 21

21 cell. Since phosphorylation of ADP is associated with the respiration, the lower concentration of ADP puts a constraint on the respiration rate of the cell ( Ellington et al., 2002 ). Diauxic lag has been studied by several researchers. The occurrence of lag when the terminal electron acceptor changes from oxygen to nitrate has been reported by Waki et al .in 1980. In 1998, Liu et al .found that the length of the diauxic lagin P. denitrificans is dependent on the length of the aerobic phase. Longer lags resulted from longer aerobic growth phases. They also found that the presence of nitrateduring the aerobic phasehas no effect on the length of the diauxic lag. The composition of the preculture had a significant effect on the diauxic growth. Here, preculture refers to the growth phase before the start of the diauxic growth experiment and the biomass from the preculture is used to initiate growth in the experiment. When bacteria were precultured under oxic conditions with nitrate absent, diauxic lags were longer than when bacteria were precultured in the presence of both oxygen and nitrate. Presence of nitrate during long aerobic phases somewhat compensated for the absence of nitrate during preculture phase. In experiments with anoxic preculture, short lags were usually observed when nitrate was absent from the aerobic phase. Even shorter lagsor no lags at all, were observed when nitrate was present during the aerobic phase ( Gouw et al., 2001 ). Casass et al(2007) tested a Nap deficient denitrifier ( P. denitrificans ) and a Nap containing denitrifier ( P. pantotrophus ) with different carbon substratesand observed that the Nap containing strain had either no lag or very short lag whereas the Nap deficient strain experienced lags of at least 5 hours. The possible explanation is that Nap is responsible for shorter lag and it aids in transition from aerobic to anoxic phase. If presence of Nap is the reason for shorter lags, it would be advantageous to promote the growth of Nap containing bacteria in a biological nitrogen removal processes as this would increase the overall efficiency.

PAGE 22

22 In a wastewater treatment plant, we have bacterial populations employed in biological nutrient removal. Not all of the microorganisms in the population are complete denitrifiers; some are incomplete denitrifiers where nitrate doesnt fully get reduced to dinitrogen. One way to detect the presence of Nap in this population is to use a technique called Fluorescencein situ hybridization (FISH). FISH is a relatively new cytogenetic technique which can be used to detect the presence or absence of a specific DNA sequence. FISH requires a fluorescent probe which has sequences highly similar to the DNA sequence in question. Therefore, the efficacy of the FISH technique depends on a lot on the probe design. A probe has to be large enoughto specifically bind to the target region but not large enough that it obstructs the hybridization process.Theprobe usually has a fluorescent molecule on one end (like fluorophore) which is bound to the quencher on the other end. In the native state, the probe doesnt fluoresce because of this binding. FISH is carried out on a microscopic slide(Figure 1-3). The sample cells are first fixed on the slide. Then they aredenatured,a process that separates the complimentary strands within the DNA double helix structure, and a fluorescently labeled probe of interest is added to the denatured sample mixture. The probe hybridizes with the sample DNA at the target site as it reannealsback into a double helix. Once the probe hybridizes to the target, the fluorophore andthe quencher come apart and the resultingfluorescence can be detected under UV light. Thissignal can then be observed through a fluorescent microscope. Presence of fluorescent signal indicates the presence of the gene targeted by the probe in the sample DNA ( Wilderer et al., 2002 ).

PAGE 23

23 Figure 1-3. Fluorescencein situ hybridization technique

PAGE 24

24 A great number of models have been proposed for biological denitrification. In most traditional models used in the industry, the role of diauxic lag has gone unrecognized on the overall kinetics of denitrification. Therefore the widely used Activated Sludge Models(ASM)1, 2, 2d and 3 ( Henze et al., 2000 ) do not portray the phenomenon of diauxic lag. Liu et al (1998a) used a cybernetic approach of Kompala et al (1986) where they modified ASM 1 to portray diauxic lag when the terminal electron acceptor switches from oxygen tonitrate. In this model they extended ASM-1 to incorporate nitrate reductase and oxygenase, the enzymes which catalyze growth under anoxic and aerobic conditions, respectively. In this model both enzyme concentration and relative activity affected growth rates, and a cybernetic term controlled enzyme synthesis. This model successfully predictedlag in activated sludge, but could not capture the much longer lags in pure cultures. This model was later modified to show the dependence of diauxic lag on the length of the aerobic phase and it was able to predict the typically longer lags obtained in case of Pseudomonas denitrificans( Liu et al., 1998b ). A significant feature of this revised cybernetic approach was that the enzyme synthesis rate was an increasing function of enzyme concentration, implying that as enzyme was created, more cellular machinery and energy was available to facilitate further synthesis. A second alteration to the cybernetic approach was that a logistic function was used for the enzyme activity, instead of the term created by Kompala et al (1986) This modified model was able to portray the lag observed in pure cultures. The model presented by Liu et al. (1998b) does not include the effect of substrate limitation when growth switches from anoxic to aerobic conditions. A further modification of this model was done to account for the enzyme specific level and the inhibitory effect of dissolved oxygen on nitrate reductase activity. This model also made sure thatthe metabolic

PAGE 25

25 resources are not preferentially allocated to anoxic growthin the presence of oxygen ( Casass et al., 2001 ). Hamilton et al (2005) considered the intracellular variables as well as the substrate concentrations in the solution. They discussed an approach which is based on the regulation of enzyme synthesis and active transport of nitrate into the cell of P. denitrificans which contains only the membrane bound nitrate reductase (Nar). They assumed the presence of nitrate respiration operon and that nitrate reductase and the nitrate transport protein are synthesized together and proportional to the amount of free operator. According to the model the rate of nitrate uptake into the cell is dependent on the concentration of nitrate reductase in the cell. The cellular nitrate levels induce the expression of Nar, which leads to anoxic growth and further uptake of nitrate from the environment.In this model, the diauxic lag was modeled solely on nitrate transport limitation. All the models discussed this far, have not taken into consideration the presence of periplasmic nitrate reductase (Nap) and the effectof Nap ondiauxic lag.

PAGE 26

26 CHAPTER 2 EFFECT OF PERIPLASMIC NITRATE REDUCTASE (NAP) ON DIAUXIC LAGOF PARACOCCUS PANTOTROPHUS Introduction Excess nitrogen leads to eutrophication of water bodies, disruption of aquatic life and is also toxic in some forms. Biological processes are preferred means of nitrate removal from wastewater because they are both efficient and cost effective ( Grady et al., 1999 ). Biological nitrogen removal consists of the processes of nitrification (oxidation of ammonia to nitrate) and denitrification (reduction of nitrate to dinitrogen). This is typically achieved in wastewater treatment plants by operating biological reactors alternately under aerobic (nitrifying) and anoxic (denitrifying) conditions.When the bacteria switch from oxygen to nitrate as the terminal electron acceptor, there may be aperiod of little or no growth called the diauxic lag ( Monod, 1942 ; Liu et al., 1998a, b ; Gouw et al., 2001 ). Lag periods decrease the overall rate of nitrogen removal. In denitrifying bacteria, there are two kinds of dissimilatory nitrate reductases membrane bound nitrate reductase (Nar) located in the cytoplasm sideof the plasma membrane and periplasmic nitrate reductase (Nap) located in the periplasm side of the plasma membrane. All denitrifiers have Nar, however some gram negative bacteria also express Nap. The nap operon is well characterized in some gram negative bacteria such as P.pantotrophus( Berks et al., 1995 ) and A.eutrophus( Siddiqui et al., 1993 ). nap operon is composed of different subunits in different organisms. The napEDABC operon of P. pantotrophus encodes for periplasmic membrane reductase with all its electron transfer components and proteins needed for the synthesis of fully functional enzyme.In A. eutrophus, it is napAB that encodes for periplasmic membrane reductase. Nap is predominantly expressed when cells are grown aerobically, but can operate in either the presence or absence of oxygen ( Bell et al., 1990 ). The function of Nap in

PAGE 27

27 denitrification is poorly understood. Suggested roles of Nap are that it isused for redox balancing ( Richardson and Ferguson, 1992 ; Sears et al., 2000 ) and adaptation to metabolism under anoxic conditions after transition from aerobic conditions ( Moreno-Vivin et al., 1999 ). In Pseudomonas sp. strain G-179, it was proposed that Nap catalyzes the first step in denitrification ( Bedzyket al.,1999 ). Casass et al (2007) tested a Nap deficient denitrifier ( P. denitrificans ) and a Nap containing denitrifier ( P. pantotrophus ) with different carbon substratesand observed that the Nap containing strain had either no lag or very short lag whereas the Nap deficient strain experienced lags of at least 5 hours. Based on the above information, we hypothesized that the presence of Nap in denitrifying bacteria substantially shortens or eliminates diauxic lag. In order to test this hypothesis, we formulated two objectives. The first objective was toscreen Nap deficient and Nap positive pure cultures of denitrifying bacteria for the length of the diauxic lag. The second objective was to construct a Nap deficient mutant of a pure culture of denitrifying bacteria and then to characterize both the mutant and the wild-typefor the length of diauxic lag. Materials and Methods Growth Experiments Two Nap-deficientdenitrifiers (P.denitrificans, P.fluorescens)andtwo Nap-positive denitrifiers(A. eutrophus, P. pantotrophus )were grown in minimal media asspecified in Table 2-1. P. denitrificans was grown in a 1L fermentor (MultiGenmodel F-1000, New Brunswick Scientific, New Brunswick, NJ). The fermentor was stirred at120rpm and maintained at 37 C. It was inoculated from an overnight culture to an absorbance of 0.1-0.11 at 550nm. The aeration was stopped and sparging of the reactor with nitrogen gas was initiated after at least one doubling of culture absorbance within the exponential phase under aerobic conditions. Two runs were performed. The otherthree species were grown in triplicate flasks containing 125mLof

PAGE 28

28 minimal medium and were inoculated from an overnight culture to an initial absorbance of 0.10.15 at 550nm ( P. pantotrophus and P. fluorescens ) and at 436nm ( A. eutrophus ) ( Siddiqui et al., 1993 ). The flasks were placed in a shaking incubator at 37 C and 200 rpm. After at least one doubling of culture absorbance within the exponential phase under aerobic conditions, the flasks were removed from the shaker, sparged with nitrogen gas for 4 minutes, and then placed on a shaker within an anaerobic chamber (Coy Laboratory Type A, MI) held at 37 C. Absorbance in all growth experiments was monitored using aThermo-Spectronic Genesys 10UV spectrophotometer. Furthergrowth experiments with P. pantotrophus and Nap-deficient mutant (construction procedure described in the following section) of this species were carried out in triplicate 125 ml flasks as described above as well as in a 1L fermentor (Bio Flo 2000, New Brunswick Scientific New Brunswick, NJ). The growth experiment in the fermentor was stirred at 200 rpm and held at 37 C. Aeration was provided at a rate of 3.0 L/min. The air was sterilized by passage through -Vent Glass microfiber filters in series and was humidified by bubbling through autoclaved deionized water. At the anoxic switch, nitrogengas was substituted for the air. Since Casass et al (2007) showed that the length of the diauxic lag was dependent on the carbon substrate used, a complex medium (Luria-Bertani) supplemented with 400mg 3 NO N/L was used to avoid the possibility that an observed prolonged lag for the mutant was due to its inability to immediately utilize a particular carbon substrate under anoxic conditions. Two growth runs were carried out for the mutant in the fermentor. Kanamycin was added to a final in the growth medium for the triplicate flask runs and the first fermentorgrowth run. To ensure that kanamycin had no adverse effect on the growth, the second fermentor run was carried out with no kanamycin in the growth medium. Nitrate reductase

PAGE 29

29 assays were carried out on biomass samples taken before the switch from aerobic to anoxic conditions and after the resumption of exponential growth in the anoxic phase. Lengths of diauxic lags exhibited during growth of the bacteria were calculated according to Lee et al (2008, in press)

PAGE 30

30 Table 2-1.Minimal media recipe. Chemicals Concentration (g/L) P. pantotrophus* P. denitrificans** A. eutrophus* P. fluorescens** Sodium acetate trihydrate 1.36 4.00 Glutamic acid 5.00 Malic Acid 4.00 Sodium phosphate dibasic 4.20 Potassium phosphate dibasic 5.00 5.00 5.00 Potassium phosphate monobasic 1.50 1.50 1.50 1.50 Sodium chloride 1.00 1.00 2.00 Ammonium chloride 0.30 1.00 0.30 1.00 Magnesium sulfate heptahydrate 0.10 0.20 0.10 0.20 Potassium nitrate 2.88 2.88 2.88 2.88 Trace metals 4 drops a 1 drop b 4 drops a 1 drop b -pH adjusted to 8.0-8.2, **-pH adjusted to 7.0 7.2, a) Vishniacand Santer trace element solution ( Vishniac and Santer, 1957 ),b) 0.5% of CuSO 4 FeCl 3 MnCl 2 and Na 2 MoO 4 2H 2 O.

PAGE 31

31 Nitrate Reductase Assays Nitrate reductase activity in intact cells was based on the rate of decolorization of reduced benzyl viologen (BV), which is proportional to the rateof electron transfer to nitrate ( Jones et al., 1976 ). Centrifugation (11,300 RCF for 10 minutes at 4 was used to harvest cells, followed by rinsingwith 20 mM Tris buffer (pH 7). Cells were then suspended in 2 mL of the buffer. The reaction was carried inside an anaerobic chamber (Coy Laboratory Type A, MI)in two 4.5 mL disposable cuvettes of 1 cm optical path. To each cuvette was added the following: 2 mL of a solution of benzylviologen and Tris buffer (0.3 mM BV, 20 mM TrisHCl), 200 Lof resuspended bacteria, 3 to 5 3-mm glass beads to facilitate mixing, and 25 Lof a 25 mM dithionite solution. A volume of 25 Lof 100 M azide was added to one of the cuvettes as azide inhibits the activity of Nar. Additional benzyl viologen/Tris buffer was added to the cuvettes to completely fill the headspace and the cuvettes were then fitted with stoppers to maintain anaerobic conditions. The absorbance was monitored at 550 nm in a spectrophotometer (Thermo-Spectronic Genesys 10UV)programmed to take measurements every 15 seconds automatically. After 3 minutes, 35 Lof nitrate was injected into the cuvettes and the cuvettes were inverted twice before being returned to the spectrophotometer. At the end of seven minutes, air was allowed into the cuvette by removing the stopper for complete oxidation of benzyl viologen. The absorbance of biomass alone was measured. The total enzyme activity (Nap + Nar) is the difference betweenthe negative slope of absorbance after addition of nitrate and before addition of nitrate in the cuvette with no azide addedper unit absorbance. The analogous measurement from the cuvette with azide provides the Nap activity. Nar activity is obtained by subtracting Nap activity from total enzyme activity.

PAGE 32

32 Construction of a Nap-Deficient Mutant An outline of the procedure used for constructing the Nap deficient mutant of P. pantotrophus is presented in Figure 2-1. The strategy was to construct a plasmid containing the gene for kanamycin resistance (kanamycin cassette) flanked by sequences homologous to the start and end of the nap operon, as wellas lacZ as a selection marker. Introduction of this plasmid into the wild-type strainshould result in the phenomenon of double crossover, in which the napEDABC gene is deleted throughareplacement by the kanamycin resistance gene. Bacterial Strains and Plasmids All the bacterial strains and plasmids used in the experiments are as listed in Table2-2.Nucleotide Sequence Accession Number The operon napEDABC encodes for periplasmic nitrate reductase in P. pantotrophus and can be can be retrieved from the NCBI website withthe accession number Z36773. Genetic Techniques Standard techniques were usedas described by Sambrook et al(1989) unless otherwise mentioned.

PAGE 33

33 Figure 2-1. Flowsheet for constructing Nap-deficient mutant KD102

PAGE 34

34 Table 2-2. Bacterial strains and plasmids used in this work. Strain/ Plasmid R elevant Characteristic(s) Reference/ Source P. pantotrophus strains GB 17 Wild-type ATCC, VA KD102 napEDABC :: Kan Present Work E. coli strains F -argF)U169 deoR, recA1 endA1 hsdR17(rk m k + thi-1 gyrA96 relA1 Zymo Research, CA Plasmids pACYC177 Kan r Amp r New England Biolabs, MA pRVS1 Amp r Sm r oriV (ColE1) oriT Tn 5placZ Van Spanning RJM et al., 1991 pRK2073 Mobilization helper plasmid(Tm r ) ATCC, VA pKD100 Amp r Kan r ; napE-Kan-napC cloned into pRVS1 Present work

PAGE 35

35 Primer Design and PCR Conditions Kanamycin cassette from pACYC177 was amplified (Figure 2-2) using the primers listed in Table2-3. The forward and the reverse primers included 20-nt sequences homologous to the plasmid regions upstream and downstream of the target gene (Kanamycin), appropriate restriction sites ( EcoR I and Sph I) with required extra bases, and 40-nt overhangs homologous to the start and end of napEDABC ( Datsenko et al., 2000 ). The reverse primer also included a set of stop codons in all six reading frames to ensure that the genes downstream of napEDABC were not affected by the ensuingdeletion of this gene. PCR was carried out using the Taq polymerase (Qiagen, CA) and the product of length 1094bps was verified using agarose gel electrophoresis. PCR product was then precipitated by the ethanol precipitation method.

PAGE 36

36 Table 2-3. Primers used in PCR. Description Sequence 5 to 3 Forward AGACGGAATTCATGATCGATTCCGCGAAAGAAACCGATCGTCCCAAGCACC R f Of ACAAAGCCACGTTGTGTCTC O f K f Reverse AGCAGCGCATGCATTAATTAATTACTAGCGCGTCTCGACGGTGGCGAGATAGCGGTGGACGGCC R r S O r CCGTCAAGTCAGCGTAATGC K r R) Restrictionsite with extra nucleotides. O)Overhang homologous to nap ; K) Sequence to amplify kanamycin. S) Stop codons in all sixreading frames. Subscripts: f) forward r) reverse.

PAGE 37

37 Construction of pKD100 PCR product containing kanamycin geneand pRVS1 ( Van Spanning et al., 1991 )were centrifuge tubes with EcoR and Sph restriction enzymes, respectively, for an hour at 37 C. The digestates were combined, allowing ligation of EcoR I/ Sph I restricted PCRproductinto EcoR I/Sph I restricted pRVS1 to generate a new plasmid (pKD100) (Figure 2-3) with sequences homologous to the start and end of napEDABC and with the gene for kanamycin resistance. Figure 2-2. Amplification of kanamycin cassette from pACYC177. R) Restriction site with extra nucleotides. O)Overhang homologous to nap.K) Sequence to amplify kanamycin. S) Stop codons in all sixreading frames. Subscripts: f) forward r) reverse.

PAGE 38

38 Figure 2-3. Plasmid pKD100 ( napE-Kan-napC cloned into pRVS1) constructed in the present work Deletion of napEDABC The plasmid pKD100 was transformed into E. coli seconds, followed by cooling on ice for 5 minutes. The transformants were selected from LB agar plates supplemented with kanamycin ) and XmL). A triparental mating ( Goldberg and Ohman, 1984 ) was carried out to introduce pKD100 into the wild-type P. pantotrophus. The plasmid pRK2073 in E. coli DF1020 served as the helper plasmid. E. coli E. coli /pRK2073 and P. pantotrophus wild-type were added in a 1:1:3 ratioto 5mLLuria-Bertani (LB) solution. After 2 hours of growth, the mixture was filtered through a 0.45 MI) and was placed cell side up on LBagar plate. After incubating the plate for 24 hours, the filter paper with the bacteria on it was resuspended in 2 mL LB. Several 10-fold serial dilution aliquot of each dilution

PAGE 39

39 was plated on LB agar supplemented with kana ) and the plates were incubated at 37 C. The resulting ex-conjugants were white colonies,kanamycin resistant, and trimethoprim sensitive. PCR Verification of the Mutant The deletion of napEDABC in wild-type P. pantotrophus was verified by performing PCR controls. First, PCR was performed with the same primersused for amplification of the kanamycin cassette from pACYC177. The plasmid pKD100 was used as the positive control and wild-type P. pantotrophus as the negativecontrol.Both the mutant and the plasmid pKD100 have a band at about 1000bps indicating the presence of the kanamycin cassette (1094 bps), whereas the wild-type P. pantotrophus does not exhibit a band in this region (Figure 2-4A). Then to ensure a correctdouble crossover, PCR was carried out with the wild type and the mutant using sequences upstream and downstream of nap as primers. As seen in Figure 2-4B, the wildtype has a faint band at approximately 4,300 bps, which corresponds to the nap operon (4,293 bps), whereas the mutant has no band at this position and a strong band at 1000 bps, which corresponds to the kanamycin cassette. Finally, one PCR was carried out with the wild-type and the mutant using a forward primer upstream of nap and reverse primertowards the end of kanamycin, and another PCR was carried out with the wild-type and the mutant using a forward primer at the start of kanamycin and reverse primer downstream of nap In both cases, we see no amplification with the wild-type and a band at approximately 1000 bps which corresponds to the kanamycin cassette with the mutant (Figure 2-4C).

PAGE 40

40 Figure2-4. Verification of the mutant. A) With same primers used for the amplification of kanamycin cassette from pACYC177 (Lane 1 Hind III marker, Lane 2 -pKD100, Lane 3 -P. pantotrophus Lane 4 -Mutant), B) With primers upstream and downstream of nap (Lane 1 P. pantotrophus Lanes 2 and3 -Mutant, Lane 4 Hind III marker, C)With forward primer upstream of nap and reverse primer towards the end of kanamycin (Lane 1 Hind III marker, Lane 2 -P. pantotrophus Lane 3-Mutant) and forward primer at the start of kanamycin and reverse primer downstream of nap (Lane 3 P. pantotrophus Lane 4 -Mutant).

PAGE 41

41 Results and Discussion Growth curves for the four denitrifying bacteria (wild-types) are shown in Figure 2-5. The Nap-deficient bacteria P. denitrificans and P. fluorescens (Figures 2-5A and 2-5B)exhibited noticeably longer lags than the Nap-positive bacteria A. eutrophus and P. pantotrophus (Figures 2-5C and 2-5D). The lag lengths (Figure 2-6) were in the range of 9.6to 11.1 hr for Napdeficient bacteria, whereas the Nap-positivebacteria had lags ranging from 0 to 1.3 hr. One-way ANOVA indicated a significant effect of bacterial species on diauxic lag ( = 0.001). Comparison of the lengths of the diauxic lags using Tukeys post-hoc test ( Mendenhall and Sincich, 2007 ) at a significance level of 0.001 indicates that the lags of the Nap-positive bacteria ( P. pantotrophus and A. eutrophus ) are significantly shorter than those of the Nap-deficient bacteria ( P. denitrificans and P. fluorescens ).

PAGE 42

42 Figure 2-5. Continued. A B

PAGE 43

43 Figure 2-5. Growth curves of four different denitrifiers. A) Pseudomonas denitrificans B) Pseudomonas fluorescens C) Alcaligenes eutrophus D) Paracoccus pantotrophus. The vertical dashed line indicates the switch to anoxic phase from aerobic phase.A) Tworuns in the fermentor. B, C, D)Resultsof triplicate flasks with error bars denoting 1.0 standard deviation. C D

PAGE 44

44 Figure 2-6. Comparison of lag lengths.Pp)P. pantotrophus, Ae) A. eutrophus Pf ) P. fluorescens Pd) P. denitrificans. Means with same letterare not significantly differentat = 0.001, as determined by Tukeys post-hoc test. To further test thehypothesisthat Nap shortens diauxic lag, we engineered a mutant of P. pantotrophus (named KD102) in which the nap operon was replaced by a kanamycin-resistance gene. A PCR of the mutant's genomic DNA with the same primers used to amplify the kanamycin gene from the plasmid, pACYC177, yielded the same band in the agarose gel electrophoresis as the plasmid, pKD100, indicating the presence of the kanamycin resistance gene, and hence a successful replacement of the nap operon in the mutant. Figure 2-7A shows the result forone run in triplicate growth flasks for the wild-typeand two runs in triplicate growth flasks for the mutant strain. The wild-type(Nap-positive)had short lags of 0.3 0.1 hr.In contrast, themutant (Nap-deficient)exhibited long lags (18.0 1.0hr and

PAGE 45

45 Figure2-7. Comparison of growthbetween wild-type and mutant. A) Runs carried out in triplicate flasks, B)Runs carried out in fermentors. B A

PAGE 46

46 12.4 1.3hr). Measurements of enzyme activity (Nap and Nar) before the anoxic switch and after exponential growth under anoxic conditions was established were taken for the triplicate wild-type flask run and one of the two triplicate mutant flask runs. The results are shown in Table 2-4. As expected, the mutant shows no measurable Nap activity, while the wild-type did exhibit Nap activity. The flask runs showed Nar activity before the anoxic switch and higher activity after anoxic exponential growth was established. Pre-diauxie Nar levels were not equivalent, however, complicating interpretation of the results. Table 2-4. Enzyme activities of the wild-type and mutant. Run Species Before anoxic switch During anoxic exponential phase Nar Nap Nar Nap Flasks Wild-type 2.91 1.45 0.33 0.17 5.02 2.76 0.60 0.12 Mutant 0.41 0.27 0.03 0.06 0.83 0.15 0.00 0.00 Fermentor Wild-type 0.03 0.03 0.19 0.06 1.54 0.20 0.13 0.11 Mutant 0.04 0.02 0.01 0.01 0.39 0.24 0.02 0.02 Mutant ( No kanamycin in the growth medium) 0.04 0.04 0.04 0.06 0.89 0.33 0.00 0.00 + oxidized L -1 s -1 per unit absorbance The Nar activity exhibited at the end of the aerobic phase was attributed to insufficient aeration in the flask experiments. To suppress pre-diauxie Nar activity, we repeated the experiments in a fermentor, which allowed a higher aeration rate. Figure 2-7Bdepicts the results of the experiments in the fermentor. The wild-type (Nap-positive)had short lag of 0.4 hr while the mutant (Nap-deficient) exhibited a long lag of 11.5 hr (with kanamycin in the medium) and 9.3 hr (with no kanamycin in the medium). As can be seen from Table 2-4, Nar activity before the anoxic switch was near zero for both the mutant and the wild-type. As expected, Nar activity increased substantially when anoxic exponential anoxic growth was achieved. Nap was absent in the mutant and present in the wild-type. Given the nearly identical pre-diauxie Nar activities and

PAGE 47

47 the difference in Nap activities, it can be concluded from the data that deletion of the nap operon (and thus elimination of Nap activity) was the cause of the significantly increased diauxic lag. The information gained in this studyopens the door to significant improvement in nitrogen removing wastewater treatment plants. Understanding the influences of design, plant operation, and wastewater characteristics on populations of Nap + bacteria can ultimately lead to strategies for enrichment of these denitrifiers. The resulting decrease of diauxic lag would lead to higher overall denitrification rates. Conclusions Up to now, the role of Nap in diauxic lag observed when denitrifiers switch from aerobic to anoxic growth was unknown. Wehave shown that presence of Nap is associated with shorter lags and that deletion of the nap operon in one denitrifier greatly increases its diauxic lag. Further work should be carried out to determine the proportions of denitrifiers in different types of nitrogen removing wastewater treatment plants that are Nap-positive. This information could lead to design and operational strategies to enrich the Nap-positive population and thus reduce diauxic lag.

PAGE 48

48 CHAPTER 3 USE OF FLUORESCENCE IN SITU HYBRIDIZATION AS A TECHNIQUEFOR IDENTIFYING NAP + DENITRIFYING Introduction Excess nitrogen discharged in wastewater can cause toxicity and algal blooms in receiving waters. Biological nitrification and denitrification in a single sludge, suspended growth process is a popular method of nitrogen removal from wastewater. In this process, bacteria cycle through oxic and anoxic (no dissolved oxygen, nitrate present) phases. When denitrifying bacteria are transferred from an oxic environment to an anoxic environment, there can be a period of little or no growth (diauxic lag) while denitrifying enzymes are resynthesized. We have observed that denitrifying bacteria containing periplasmic nitrate reductase (NAP) in addition to membrane-bound nitrate reductase (Nar) have either short or no diauxic lags, whereas those containing only Nar tend to have longer diauxic lags ( Casass et al., 2007 ). Bacteria can be characterized with regard to presence or absence of NAP using enzyme activity assays. However, these assays are cumbersome and involve hazardous reagents (benzyl-viologen and sodium azide). Alternatively, bacteria can be characterized with regard to the presence of the gene that encodes for NAP ( nap ) by DNA sequencing, which is expensive. Wehave constructed a FISH probe for nap in order to facilitate identification of bacteria that containperiplasmic nitrate reductase. The probe was tested against two nap + pure cultures ( Paracoccus pantotrophus ATCC 35512andAlcaligenes eutrophus ATCC 17699) and two nap pure cultures ( Pseudomonas denitrificans ATCC 13867 and Pseudomonas fluorescens ATCC 17582). Further testing against four isolates of denitrifying bacteria from the University of Florida Water Reclamation Facility was also carried out. The isolates were characterized with regard to presence or absence of NAP using enzyme activity assays and growth studies.

PAGE 49

49 Materials and Methods Probe Design The nap sequences of four nap + bacteria ( Paracoccus pantotrophus (NCBI accession number Z36773; Berks et al., 1995 ), Alcaligenes eutrophus (X71385; Siddiqui etal., 1993 ), Pseudomonas G-179 (AF083948; Bedzyk et al., 1999 ), and Rhodobacter sphaeroides (AF069545; Bedzyk et al., 1999 )) were used to assess the homology of nap subunits. The napA and napB subunits are common to the four bacteria. As the napA subunitsare longer and have higher complementarity than the napB subunits (Table 3-1), we based our probe design on nap A. Table 3-1. Percent homology of napA and napB subunits in four micro-organisms Bacterium nap operon Number of base pairs in napA %Match* Number of base pairs in napB %Match* P. pantotrophus nap EDABC 2496 486 A. eutrophus nap AB 2496 73 510 58 Pseudomonas G-179 nap EFDABC 2505 77 492 64 R. sphaeroides nap EFDABC 2496 77 465 65 In a pairwise comparison to P. pantotrophus using Clone Manager Professional Suite Version 8 and the NCBI database. We searched for homologous regions that met the following criteria: percent G/C content between 50 and 60, a melting temperature between 32 and 100C, no hairpins, and few repeats (<3), runs(<4) and dimers (<5 adjacent homologous bases). The four longest homologous regions contained 24, 23, 22, and 21 base pairs. For each of these probe candidates, we BLAST searched the NCBI database ( http://www.ncbi.nlm.nih.gov/ ) using the search option "optimized for highly similar sequences (megablast)". The union of the results of the searches was 71 bacteria, out of which 52 contained at least one nap subunit (Table 3-2). The ability of the four candidate probes to bind to the set of 71 bacteria (test set) was evaluated using Clone Manager withthe NCBI database. Table 3-3 shows the percent identified

PAGE 50

50 Table 3-2.Bacteria with a highly similar sequence to at least one candidate probe Organism Accession number Subunits of nap operon Cytophaga hutchinsonii ATCC 33406 NC_008255 A SaccharophagusdegradansNC_007912 ABC Bordetella parapertussis 12822 NC_002928 CBAD Bradyrhizobium sp. BTAi1 NC_009485 CBADE Pseudomonas stutzeri A1501 NC_009434 CBADE Ralstonia metallidurans CH34 NC_007974 CBADE Azoarcus sp. BH72 NC_008702 CBADE/CBHGA DF Psychromonas ingrahamii 37 NC_008709 CBADF Pseudomonas aeruginosa PAO1 NC_002516 CBADFE Sinorhizobium meliloti 1021 plasmid pSymA NC_003037 CBADFE Escherichia coli 536 NC_008253 CBHGA Escherichia coli O157:H7 str. Sakai NC_002695 CBHGAD Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01 NC_009429 CBHGAD Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67 NC_006905 CBHGAD Shigella flexneri 5 str. 8401 NC_008258 CBHGAD Actinobacillus succinogenes 130Z NC_009655 CBHGADF Erwinia carotovora subsp. atroseptica SCRI1043 NC_004547 CBHGADF Escherichia coli APEC O1 NC_008563 CBHGADF Escherichia coli CFT073 NC_004431 CBHGADF Escherichia coli O157:H7 EDL933 NC_002655 CBHGADF Escherichia coli UTI89 NC_007946 CBHGADF Salmonella enterica subsp. enterica serovar Typhi str. CT18 NC_003198 CBHGADF Salmonella typhimurium LT2 NC_003197 CBHGADF Shigella flexneri 2a str. 2457T NC_004741 CBHGADF Shigella flexneri 2a str. 301 NC_004337 CBHGADF Shigella sonnei Ss046 NC_007384 CBHGADF Hahella chejuensis KCTC 2396 NC_007645 DABC Bordetella bronchiseptica RB50 NC_002927 EDABC Bradyrhizobium japonicum USDA 110 NC_004463 EDABC Bradyrhizobium sp. ORS278 NC_009445 EDABC Burkholderia xenovorans LB400 Chromosome 3 NC_007953 EDABC Paracoccus denitrificans NC_008688 EDABC Ralstonia eutropha H16 NC_005241 EDABC Ralstonia eutropha JMP134 chromosome 2 NC_007348 EDABC Rhodopseudomonas palustris BisB18 NC_007925 EDABC Shewanella baltica OS185 NC_009665 EDABC Shewanella loihica PV-4 NC_009092 EDABC Shewanella baltica OS155 NC_009052 EDABC/DAB

PAGE 51

51 Table 3-2. Continued. Organism Accession number Subunits of nap operon Shewanella amazonensis SB2B NC_008700 EDABCFDGHB Agrobacterium tumefaciens str. C58 NC_003063 EFDABC Pseudomonas aeruginosa PA7 NC_009656 EFDABC Pseudomonas aeruginosa UCBPP-PA14 NC_008463 EFDABC Rhodobacter sphaeroides NC_007489 EFDABC Sinorhizobium medicae WSM419 NC_009621 EFDABC Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150 NC_006511 FAGHBC Salmonella enterica subsp. enterica serovar Typhi Ty2 NC_004631 FAGHBC Aeromonas hydrophila subsp. hydrophila ATCC 7966 NC_008570 FDAB Vibrio cholerae O395 NC_009456 FDABC Yersinia pseudotuberculosis IP 31758 NC_009708 FDABC Shigella boydii Sb227 NC_007613 FDAGHBC Magnetospirillum magneticum AMB-1 NC_007626 HG Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA02 NC_009430 KEFDABC Acidobacteria bacterium Ellin345 NC_008009 Aeromonas salmonicida subsp. salmonicida A449 NC_009350 Anaeromyxobacter sp. Fw109-5 NC_009675 Brucella melitensis 16M Chromosome I NC_003317 Burkholderia xenovorans LB400 Chromosome 2 NC_007952 Caldicellulosiruptor sacharolyticus NC_009437 Frankia alni ACN14a NC_008278 Halorhodospira halophila SL1 NC_008789 Maricaulis maris NC_008347 Mycobacterium gilvum NC_009338 Pelobacter propionicus DSM 2379 NC_008609 Pseudoalteromonas atlantica T6c NC_008228 Pseudomonas mendocina ymp NC_009469 Psychrobacter cryohalolentis K5 NC_007969 Rhodoferax ferrireducens T118 NC_007908 Rubrobacter xylanophilus DSM 9941 NC_008148 Sphingomonas wittichii RW1 NC_009507 Streptoccus suis 05ZYH33 NC_009442 Streptoccus suis 98HAH33 NC_009443 Shewanella amazonensis SB2B NC_008700 EDABCFDGHB Agrobacterium tumefaciens str. C58 NC_003063 EFDABC Pseudomonas aeruginosa PA7 NC_009656 EFDABC Pseudomonas aeruginosa UCBPP-PA14 NC_008463 EFDABC Rhodobacter sphaeroides NC_007489 EFDABC

PAGE 52

52 Table 3-3. Performance of candidate probes against the test set of 71 bacteria Probe candidate 1 2 3 4 Probe length 24 23 22 21 Correct binding 29 (41%) 24 (34%) 60 (85%) 25 (35%) False positives 1 (1%) 4 (6%) 1 (1%) 0 (0%) False negatives 41 (58%) 43 (61%) 10 (14%) 46 (65%) correctly, the percent of false positives and the percent of false negatives. Probe candidates 1, 2, and 4 were considered to be unsuitable because of low percentages of correct identifications and high percentages of false negatives. Probe 3 had low percentages of both false positives and false negatives. Table 3-4 shows the success of each candidate probe in identifying nap + bacteria. Candidate 3 correctly identified 43 of the 52 nap + bacteria. Our probe design consisted of the sequence of probe candidate 3 with a marker/quencher combination of Fluorescein and DABCYL ( Lighton and Fiandaca, 2005 ). The probe sequence is Fluorescein-5`-GCTCGAACATGGCGGAGATGCA-3`-DABCYL. Table 3-4. Percent correct identification for nap containing bacteria Probe candidate Probe length nap + correctly identified (52 total) 1 24 7 (21%) 2 23 11 (13%) 3 22 43 (83%) 4 21 7 (13%) Chemicals All reagents were purchased from Fisher Scientific, Pittsburg PA, unless otherwise specified. Bacterial Culture A flask containing125 mL of sterile nutrient broth (Sigma-Aldrich, St. Louis, MO) was inoculated with Paracoccuspantotrophusor Pseudomonas denitrificans using a sterile inoculating loop. The flask was held at 30 P.

PAGE 53

53 denitrificans ) or two days ( P. pantotrophus ). All other strains of bacteria ( Alcaligenes eutrophus Pseudomonas fluorescens and four isolates from the University of Florida Water Reclamation Facility) were grown for one day at 37 Luria-Bertanibroth with continuous shaking.Bacterial Isolates Triplicate samples were taken from the primary anoxic reactor of the University of Florida Biodenipho processand placed in 1-L sterile containers that werepre-incubated in an anaerobic chamber. The samples werekept on ice during transfer to the lab. Samples werecentrifuged in 50 mL tubes and the supernatants discarded. Glass beads (20-30) werecombined with the pellets and the mixtures vortexed to break up flocs. The deflocculated suspensionswerefiltered with course sterile filter paper (Whatman Grade 1, pore size 11 m) and the filtrateswereserially diluted with sterile deionizedwater (10-1 to 10 -8 ). To select denitrifying bacteria, 100 Lof each sample dilution wasplated in triplicate on PBS-based minimal agar supplemented with nitrate and succinate. The plates wereincubated in anaerobic jars at room temperature (20-25 C) for 7 days. A total of 72 isolates were obtained, of which four have been characterized with regard to presence or absence of nap Bacterial Fixation Fixation of bacteria to glass slides was generally carried out according to Henegariu et al (2000) .A 25 mL volume of bacterial suspension was centrifuged at 13000 x g for 10 minutes at 25 repared 3:1 (v/v) methanol:glacial acetic acid and vortexed until dissolution was complete then transfered to a 1.5 mL micro-centrifuge tube. Cells were washed with the methanol:glacial acetic acid mixture a total of three times-with intermediate centrifugations at 5200 x g for one minute. A volume of 30 L of treated cell suspension was spread on a sterile glass slide by holding a pipette tip parallel to the surface of the slide while spreading the liquid. As the surface began to

PAGE 54

54 dry and become grainy,the slide was passed face down though a steam bath for 1-2 sec, and then placed directly on a hot plate (near maximum heat) for 10 seconds to dry. The FISH Protocol The FISH protocol was carried out according to Cancer Genetics Inc (2004) .A 70% formamide solution was preheated to 75 was placed in a freezer at -20 cells were dehydrated by passing the slide though the room temperature ethanol series; one minute per concentration. The slide was then air-dried for 5 minutes. The dehydrated bacterial cells were denatured by placing the slide in the warm formamide solution for 2 minutes. It was then immediately passed through thecold ethanol series; one minute per concentration, followed by complete air-drying. Probe was dissolved in TE buffer to give a concentration of 20 mol/ L. A volume of 10 L of probe solution was placed in a 1.5 mL microcentrifuge tube and held in a 80 melting temperature =75.5 was then incubated at 37 10,600 x g. A volume of 10 L of denatured probe solution was then applied to fixed bacteria on the slide and covered with a coverslip. The slide was stored overnight (16-18 hours) at 37 After overnight storage, the coverslip was removed and the slide was immersed for 5 minutes in a 45 x sodium saline citrate/0.1% w/v SDS solution. The slide was transferred to a second 0.5x SSC/0.1% SDS solution for another 5 minutes at the same temperature. The slide was next rinsed with DI water and allowed to air-dry. Finally, the slide was covered with a second coverslip and viewed under an epifluorescent microscope using 10x ocular and a 100x or 60x objective lens.

PAGE 55

55 Nitrate reductase assays ( Casass et al., 2007 and Hamilton et al., 2005 ) were carried out on biomass samples taken before the switch from aerobic to anoxic conditions and after the resumption of exponential growth in the anoxic phase. Parallel enzyme assays were carried out with and without sodium azide, which is an inhibitor of Nar. The activity in the presence of azide was subtracted from the activity in the absence in the azide to obtain the Nar activity. The NAP activity is represented by the activity measured in the presence of azide. Lengths of diauxic lags exhibited during growth of the bacteria were calculated according to Lee et al (2008, in press) Results and Discussion The fixed nap + pure cultures fluoresced under UV light, whereas the nap pure cultures showed no fluorescence. For example, Figures 3-1 and 3-2show P. pantrotrophus (a nap + bacterium) under incandescent and epifluorescent light respectively. The bacteria visible under incandescent illumination are also visible under epifluorescent illumination, indicating that the probe hybridized with these bacteria. In contrast, the nap P. denitrificans are not visible under epifluorescent illumination (Figure 3-4) but are visible under incandescent illumination (Figure 3-3) indicating the prode did not hybridize. The other two pure cultures,the nap + A.eutrophusand the nap P.fluorescensalso tested correctly with the probe, with only A. eutrophus fluorescing. To further test the probe, we obtained isolates from the University of Florida Water Reclamation Facility and determined whether or not they were nap + using enzyme assays. The assay results measured during anoxic growth, after an initial aerobic growth period,are shown in Table 3-5. Isolates KJ13and KJ72exhibited significant NAP activity, whereas isolates KJ14 and

PAGE 56

56 Figure 3-1. Paracoccus pantotrophus viewed at 600x magnification under incandescent light Figure 3-2. Paracoccus pantotrophus viewed at 600x magnification under UV light after being treated with fluorescent probe that targets napA

PAGE 57

57 Figure 3-3. Pseudomonas denitrificans viewed at 600x magnification under incandescent light. Figure 3-4. Pseudomonas denitrificans viewed at 600x magnification under UV light after being treated with fluorescent probe.

PAGE 58

58 Table 3-5.Enzyme activity data and diauxic lag lengths compared to probe results Isolate Diauxic lag (hr) Before anoxic switch Presence of Nap Nar Nap KJ013 2.17 0.27 0.10 0.25 0.10 Yes KJ014 > 14 0.65 0.10 0.08 0.04 No KJ070 >10 4.04 1.55 0.35 0.37 No KJ072 1.38 0.33 0.17 0.56 0.05 Yes KJ70 had near zero levels of NAP activity. Measurements of diauxic lag (Table 3-5) show short lags for the first two isolates, compared to long lags for the second pair of isolates. Based on these results, we conclude that the first pair of isolates are nap + and the second pair of isolates are nap The probe assays show the first two isolates as fluorescing while the second pair of isolates did not fluoresce. After establishing probe efficacy we used it to characterize a sample of activated sludge taken from the primary anoxic reactor of the University of Florida Water Reclamation Facility. Figure 3-6shows that a significant portion of bacteria in the sample studied contained nap To our knowledge, this is the first time a DNA probe has been developed for identifying nap + bacteria. The probe successfully identified four pure cultures and four isolates. Application of the probe to a waste water microbial population indicated a significant proportion of nap containing bacteria. Use of this probe in conjunction with population sampling and pilot plant studies can lead to better understanding of the role of nap + bacteria in wastewater denitrification.

PAGE 59

59 Figure 3-5. Bacteria isolated from the University of Florida Waste Water treatment plant viewed at 600x magnification under incandescent light. Figure 3-6.Bacteria isolated from the University of Florida Water Reclamation Facility viewed at 600x magnification under UV light after being treated with fluorescent probe that targets napA.

PAGE 60

60 CHAPTER 4 DIAUXIC GROWTH MODEL BASED ON NAP AND NAR SYNTHESIS KINETICS FOR DENITRIFYING BACTERIA Introduction Nitrate removal is an important component of advanced wastewater treatments plants. Nitrogenis commonly removed by biological means because they are both efficient and cost effective ( Grady et al., 1999 ). Bacteria mediatednitrogen removal in wastewater treatment plants occurs through oxidation of ammonia to nitrate (nitrification) and reduction of nitrate tonitrogen gas (denitrification).Sinceoxygen respiration is more energetically favored than denitrification, facultativebacteria usually utilize nitrogen oxides only in the absence of oxygen ( Oh and Silverstein, 1999b ). In a typical biological nitrogen removal system, biomass is exposed to alternating cycles of aerobic and anoxic phases to maximize the removal of nitrate ( Ramalho, 1983 ). This may result in a diauxic lag. Diauxie or biphasic growthis characterized by a period of little or no growth in between two exponential growth phases. This occurs when bacteria switch from oxygen to nitrate as electron acceptors and it corresponds to the period during which the cell has to produce the necessary enzymes to respire on the less preferred substrate. Monod (1942) was first to characterize diauxic lag due to change in electron donors. Biphasic growth due to a change in electron acceptors (nitrate to nitrite) was first studied by Kodama et al(1969) Later many investigators ( Waki et al., 1980 ; Liu et al., 1998a, 1998b ; Gouw et al., 2001 ; Lisbonet al., 2002 ; Casass et al., 2007 ) have shown that when bacteria change from dissolved oxygen to nitrate as terminal electron acceptor, there can beencountered by the phenomenon of diauxic lag. Diauxic lags are undesirable as they reduce the overall rate of nitrate removal. Commonly used Activated Sludge Models (ASM) 1, 2, 2d and 3( Henze et al., 2000 ) do not capture diauxic lag. Liu et al (1996 1998a ) extended ASM-1 so that it canportray diauxic

PAGE 61

61 lag in activated sludge systems when theterminal electron acceptor switchesfrom oxygen to nitrate. Later Liu et al. (1998b) modifiedtheir model so that it can predict the extension of lag phase that was observedwhen the length of the preceding aerobic phase was increased. Hamilton et al (2005) modeled diauxic lag observed in Pseudomonas denitrificans by considering the intracellular variables as well as the substrate concentrations in the solution. They assumed the presence ofanitrate respiration operon and that nitrate reductase and the nitrate transport protein are synthesized together.They linked the nitrate reductase enzyme synthesis to the active nitrate transport into the cell and considered the effect of overall enzyme synthesis kinetics on anoxic growth. Dissimilatory nitrate reduction is carried out by membrane bound nitrate reductase (Nar) under anoxic condions. Nar is believed to be present in all denitrifies. However some denitrifiers also have the second dissimilatory nitrate reductase periplasmic nitrate reductase (Nap). It has been suggested that Nap may be utilized in the adaptation to metabolism in the absence of oxygen after transition from aerobic conditions ( Moreno-Vivin et al.,1999 ). It has been observed that bacteria that have both Nap and Nar have shorter diauxic lags when compared to bacteria that have only Nar ( Casass et al., 2007 ; Durvasula et al., in print ). Durvasula et al (in print) attribute shorter diauxic lags to the presence of Nap. In this work, we extend Hamilton et al. (2005) modeltobacteria that have both of the nitrate reductase enzymes. Model The enzyme synthesis model described by Hamilton et al (2005) is adapted to include periplasmic nitrate reductase (Nap) synthesis kinetics.

PAGE 62

62 Rate of Synthesis of Nar The cell takes up nitrate from the environment under anoxic conditions. The internal nitrate induces the synthesis of Nar. This allows growth anoxically and promotes furthernitrate uptake. The rate of synthesisof Nar is denoted by ren_nar The model used is that of a single effector molecule binding to a single repressor molecule( Yagil and Yagil, 1977 ; Hamilton et al., 2005 ). K 1 is the equilibrium constant for the binding of repressor to internal nitrate (inducer molecule) and K 2 is the constitutive rate of enzyme synthesis which isafunction of equilibrium constant for the binding of repressor to operator. The organic substrate dependence of Nar is captured by the Monod term. s an ,s s ni 1 2 ni 1 nar ,N nar en S K S s K K s K 1 a r (4-1) Here s ni denotes the concentration of nitrate inside the cell, S s is the carbon substrate concentration. Rate of Synthesis of Nap Periplasmic nitrate reductase(Nap)is synthesized under aerobic conditions, but can operate in either the presence or absence of oxygen. Synthesis of Nap is unaffected by the presence of nitrateor ammonia ( Moreno-Vivinet al., 1999 ). The fact that the periplasmic enzyme is present in anaerobically grown cells accounts for their capacityfor aerobic nitrate reduction ( Bell et al., 1990 ).The effect of oxygenand of carbonsubstrate on the synthesis of Nap areportrayed by Monod terms. The rate of synthesis of Nap, ren_nap is described byEquation (4-2). s ox ,s s OH O O nap N nap en S K S K S S a r (4-2)

PAGE 63

63 Oxic Growth The rate of oxic growth is based on the kinetic expression of Hamilton et al(2005). s ox ,s s OH O O ox max, ox S K S K S S r (4-3) Specific Rate of Nitrate Uptake The rate of nitrate uptake is proportional to the concentration of membrane bound nitrate reductase (e nar )similar to the approach adopted by Shoemaker et al (2003) for modeling diauxic lag when switching carbonsources. Oxygen represses the synthesis of the membrane-bound dissimilatory nitrate reductase ( Warnecke-Eberz and Friedrich, 1993 ; Moreno-Vivian et al., 1999 ) at the level of nitrate transport ( Berks et al., 1994 ). A Monod term for the substrate is included to explain the energy dependence of nitrate uptake. N NOi N s an ,s s Oi Oi Oi max nar nar sni sni S K S S K S K S K e e V r (4-4) Anoxic Growth Anoxic growth is proportionalto concentration of membrane bound nitrate reductase (e nar ). The rate of nitrate uptake influences the synthesis of Nar, thereby affecting anoxic growth. Like Hamilton et al (2005) we have not included a term for oxygen inhibition of nitrate transport as the inhibitory termis includedin the nitrate uptake kinetics. Due to the periplasmic location of Nap, some denitrifiers carry out aerobic denitrification ( Bell et al., 1990 ). Since no transport of nitrate is required, nitrate from the environment can beutilized by Nap.In Pseudomonas G 179, Nap was found to catalyze the first step of denitrification ( Bedzyk et al., 1999 ). Weassume that at the onset of anoxic growth, the Nap that was synthesized aerobicallyinitiates denitrification thereby contributing to anoxic growth and short diauxic lag.Denitrification due to Nap is dependent on concentration of periplasmic nitrate reductase (e nap ) and the nitrate in the

PAGE 64

64 environment. As Nar builds up inside the cell, denitrification due to Nar is more energetically preferred to that of Nap. the growth on both Nap andNar. N N N max nap nap max ni ni max nar nar s an ,s s anox max, anox K S S e e s s e e 1 S K S r (4-5) For the model, the specific biomass decay rate (b) is assumed to be constant. The same specific enzyme decay rate (b NO ) is asuumed forboth nitrate reductases (Nap and Nar. It is also assumed to be constant.The mass balance on the reactor using the above rates yields the equations. B anox ox B X b r r dt dX (4-6) B anox an ,c ox ox ,c s X r Y 1 r Y 1 dt dS (4-7) B sni N X r dt dS (4-8) nar B B NO nar en nar e dt dX X 1 b b r dt de (4-9) nap B B NO nap en nap e dt dX X 1 b b r dt de (4-10) ni B B anox an N sni ni s dt dX X 1 b r r dt ds (4-11) In Equations4-9, 4-10and 4-11the last term represents dilution due to growth and cell decay ( Hamilton et al.,2005 ). The theoretical maximum values of s ni e nar and e nap, are found by

PAGE 65

65 setting their respective derivatives to zero and assuming non-limiting concentrations of substrate and nitrate. an N anox max, sni max ni V s (4-12) max ni 1 2 max ni 1 NO nar ,N max nar s K K s K 1 b b a e (4-13) NO nap N max nap b b a e (4-14) Theintracellular variables sni (mg/gdw), e nar (mol BV/gdw.hr) and e nap (mol BV/gdw.hr) are expressed per gram dry weight. The extracellular components X B (gdw/L), S s (mg/L) and S N (mg/L) are expressed in volumetric concentrations.The dissolved oxygen concentration (SO ) was assumed to near saturation under aerobic conditions and zero under anoxicconditions. Materials and Methods Paracoccus pantotrophus (ATCC 35512) was chosen for the experiments since it has both nitrate reductase enzymes Nap and Nar. A mutant of P. pantotrophus ( Durvasula et al., in print ) lacking in Nap wasalso cultured and the fitted model was testedagainst the experimental values of biomass and enzyme acitivityfor both organisms.Growth Experiments The preculture of P. pantotrophus (ATCC 35512) and the mutant of P. pantotrophus deficient in Nap were cultured in LB(Luria-Bertani)broth supplemented with 400 mg L / N NO 3 for 12-18 hrat 37Cin a shaking incubator. The biomass from the preculture was used to inoculate a 1 L fresh, autoclaved solution of LB supplemented with nitrate (400 mg L / N NO 3 ) in a fermentor (Bio Flo 2000, New Brunswick Scientific New Brunswick, NJ)at

PAGE 66

66 an absorbance of 0.1-0.11 (34 37.4 gdw/L) at 550nm. The fermentor was stirred at 200 rpm and temperature was maintained at 37C. During the aerobic phase, air was supplied to the fermentorat a rate of 3 L/min. Air was humidified by a bubblingthrough a flask of autoclaved, deionized water and filtered by passing through 0 -Vent Glass microfiber filtersin series. The growth of the bacteria in the fermentor was monitored by absorbance measurements taken every 30 -45 minutes at 550nm in Thermo-Spectronic Genesys 10UV spectrophotometer.Aerobic growth was carried out till the biomass reached exponential phase. Then the fermentor was switched to anoxic growthby replacing air by nitrogen gas. The experiment was continued anoxically till the culture reached exponential phase. Enzyme assays were done just before switch to the anoxic phase and once during the anoxic exponential growth phase. The assays were carried out as described by Hamilton et al (2005) and Casass et al (2007) for calculation of periplasmic and membrane bound nitrate reductase activities. Optimization The optimization technique called Differential Evolution ( Price and Storn, 1997 ) was used for optimizing the model parameters to fit the simulation resultsto the experimental values. The objective functionwas formulated so as tominimizethe squared relative errorbetween the measured concentration of biomass and concentration ofbiomass predicted by the model as well as squared relative error of the enzyme activity measurements at those time points where data was available.

PAGE 67

67 2 measured av nap 2 anoxic measured nap predicted nap 2 aerobic measured nap predicted nap 2 measured av nar 2 anoxic measured nar predicted nar 2 aerobic measured nar predicted nar 2 measured av ,B N 1 i 2 measured ,B predicted ,Be e e e e e e e e e X X X C (4-15) Allthe reaction kinetic equations, rate equations and objective function for the optimization mentioned in equation 4-15 are for the P. pantotrophus which has both the nitrate reductases, Nap and Nar. In case of the mutant which lacks Nap, the equations written for Nap and the terms for Nap in all the other equations mentioned thus far were set to zero. The parameters estimated are max,ox max,anox K s,ox K s,an K OH K Oi K NOi K N b, b NO Y c,ox Y c,an n,an K 1 K 2 a N,nap a N,nar V sni The initial enzyme activities were also fitted. The value of S O was taken to be 8mg/L under aerobic conditions and zero once the biomass was switched to anoxic phase. Resultsand DiscussionThe model was first fit to the experimental data of Paracoccus pantotrophus (wild-type) since it has both nitrate reductases. The model captured the exponential phases in both aerobic and anoxic phases and the short diauxic lag exhibited by the wild-type (Figure 4-1). The parameters obtained afterfitting are listed in Table 4-1.

PAGE 68

68 Figure 4-1. Model fit to the fermentor growth data of P. pantotrophus

PAGE 69

69 Good model fits were obtained for the mutant. This model captured the long diauxic lag exhibited by the mutant. Figure 4-2. Model fit to the fermentor growth data of the mutant

PAGE 70

70 Table 4-1. Parameter values obtained after fitting. Parameter Units Wild-type Mutant K s,ox mg substrate/L 0.080 0.080 K s,anox mg substrate/L 1.596 1.596 K OH mg oxygen/L 2.509 2.509 K Oi Mg oxygen/L 5.985 5.985 K NOi mg nitrate/L 2.155 2.155 K N mg nitrate/L 0.863 b 1/hr 0.002 0.002 b NO 1/hr 1.561 1.561 Y c,ox mg biomass/mg substrate 0.919 0.919 Y c,anox mg biomass/mgsubstrate 0.953 0.953 an ,N mg nitrate/gdw biomass 0.226 0.226 K 1 gdw biomass/mg nitrate 9.980E+24 9.980E+24 K 2 9.630E+23 9.630E+23 a N,nap mol BV/gdw biomass.hr 2 6.710E-06 a N,nar mol BV/gdw biomass.hr 2 2.020E-05 2.020E-05 V sni mg nitrate/gdw biomass.hr 0.065 0.065 0.460 max,ox 1/hr 0.714 0.875 max,anox 1.hr 0.149 0.099 e nar,initial mol BV/gdw biomass.hr 7.000E-08 3.050E-07 e nap,initial mol BV/gdw biomass.hr 6.410E-08

PAGE 71

71 CHAPTER 5 FUTURE WORK Introduction of nap Gene in a Nap-Deficient Pseudomonas denitrificans In the present work, we showed that presence of periplasmic nitrate reductase (Nap) is a determining factor in shortening the length of the diauxic lag(Chapter 2).It will be interesting to check if the converse would be true if we followed the opposite approach to what we didin Chapter 2. That isto introduce a plasmid containing the nap gene into an organism, like Pseudomonas denitrificans ,whichdoesnt have this gene. To accomplish this objective we need to first select a suitable plasmid that is compatible with the host P. denitrificans .The plasmid should be able to replicate in the host. nap gene along with the nap promoter from Paracoccus pantotrophus should becloned to the plasmidwith selectable markersand should be transformed into P. denitrificans If the host polymerase doesnt recognize the nap promoter of P. pantotrophus we need to construct another plasmid with a different promoter like lac Growth experiments described in Chapter 2 should be carried out for both the wild-type and the new organism harboring the plasmid. Enzyme assay measurements should be carried out in aerobic and anoxic exponential phases to determine the nitrate reductase activities for both species. It is important to know if the levels are in accordance with the trends usually observed. This will confirm the proper regulation of Nap. If the resulting lag has decreased for the new organism, this will further strengthen our theory about the effect of Nap on diauxic lag. This will also give us evidencethat nap can form a functional protein even in a Nap-deficient bacterium. It will be interesting to check if the location of Nap in the newer organism is same as in a Nap-positive bacterium, which is in the periplasmic space. The increase in reduction state of carbon substrate increases the activity of Nap ( Ellingtonet al., 2002 ). Casass et al (2007) reported that with the increase in reduction state of the carbon, the length of the lag decreases.Growth experiments

PAGE 72

72 with different carbon substrates should be carried out and should be tested for the activity of Nap.If the results match with the reported values, it will further provide evidence for proper functioning of Nap. Construction of Nar Probeusing FISHThe ability of facultative bacteria to respire on nitrate is attributed to the function of membrane bound nitrate reductase (Nar). Nar takes electrons from the quinol pool to reduce nitrate to nitrite. In a nitrate removing wastewater treatment plant, it will be beneficial to know what proportion of the bacteria in the activated sludge are denitrifiers. Since all denitrifiers have the membrane bound nitrate reductase, Nar( Moreno-Vivinet al., 1999 ), the presence of Nar can be used as a tool for their identification. The subunit composition of Nar may vary from organism to organism. The first step towards construction of the probe is to find the subunit that is common to most organisms. The percent homogeneity of that subunit amongst the different organisms should be checked as this will determine if a probe construction is possibleor not. Probes of different lengthsshould be BLAST searched against the NCBI website, to determine thenumber of false positivesand false negatives. The probe with the highest percentage of correct identification of Nar should be selected as the probe for Nar. The protocol for FISH (Fluorescencein situ hybridization) explained in Chapter 3 should be carried out for the Nar probe.First pure cultures of the denitrifiers (Paracoccus pantotrophus, Pseudomonas denitrificans, Alcaligenes eutrophus, Pseudomonas fluorescens) must be tested to check the efficiency of the probe. The detection of a signal under the light confirms the presence of Nar. The use of the probe on a sample from the denitrification unit of the wastewater treatment plant will give us idea about the percentage of denitrifiers. This knowledge can help in

PAGE 73

73 increasing the plants nitrate reduction rate by devising strategies that increasethe proportion of denitrifiers. Colony Hybridization Fluorescence in situ hybridization (FISH) is very useful detectiontechnique in determining the presence or absence of a particular trait. We have isolated 72 species from the denitrifying unit of Water Reclamation facility of University of Florida, Gainesville. We need to find which of these isolated have the periplasmic nitrate reductase (Nap). FISH should be carried out separately for each one of these isolates which makes it cumbersome and very time consuming. In cases such as these, colony hybridization may be the answer. In colony hybridization, a large number of colonies can be screened simultaneously to determine the presence of a particular DNA sequence or a gene. The colonies tobe screened are first culturedon a suitable agar medium. They are then transferred onto a nitrocellulose membrane after marking the reference point on both the agar plate andmembrane. The cells on the membrane are lysed and the DNA is denatured. Afluorophore labeled probe for the gene of interest is added to the denatured DNA. After allowing for hybridization, the membrane is washed to rinse out the unbound probe. A UV light is shinedon the membrane containing the colonies. The colonies that glow are those which have the gene of interest. By comparing the location of those colonies which glowed under UV to those on the master plate, we will know which isolate has the gene ( Grunstein and Hogness, 1975 ). Effect of the Carbon Substrate Reduction State on the Length of the Diauxic Lag The length of the diauxic lag depends on the reduction state of the carbon substrate ( Casass et al., 2007 ). Better mathematical models must be developed which not only takes into

PAGE 74

74 consideration enzyme synthesis but also the dependence of it on the reduction state of the carbon. This will give us a better insight into the denitrification process and also aid in predicting lag lengths.

PAGE 75

75 APPENDIX A GENE DELETION STRATEGY Step 1:Culture E coli Containing Helper Plasmid Materials pRK2073 in E. coli DF 1020 LB broth and LB agar plates Procedure pRK2073 in E. coli was cultured in LB medium for a 24 hrs at 37 C aerobically and plated out on LB agar medium. A colonywas picked out from the plates and again cultured in LB medium for 24 hrs at 37 C aerobically and again plated out on LB agar medium. A colony out of these plates was used in triparental mating. Step 2: PCR Amplification Kanamycin Resistance Gene from pACYC177usingPrimers with EcoR I/ Sph IRestriction Sites Materials Taq PCR mastermix Forward and reverse primers pACYC177 PCR tubes Thermal Cycler Bromophenol blue dye with 40% sucrose Hind III marker Procedure The reaction for PCR was set up in 0.2 mLPCRtube (Table A-1). The tube was then placed in a thermal cycler. The annealing temperature was set to be 5 C less than the melting temperature of the primers and the extension time was based on 1kb/1min calculation. Gel electrophoresis was used forconfirming the PCR product. 0.8% agarose stained with ethidium bromide was charged with PCR product ( of PCR product and 5. of 1X dye) in one well and Hind III marker in the other well. DNA was precipitatedusing the standard procedure. Sodiumacetate (pH 5.2) was added to a final concentration of 0.3M from a 3M stock and mixed well. 2 volumes of 95% ethanol was added and incubated at 0 C for 1 hourbefore centrifuging down for 15 min at

PAGE 76

76 15,000g. The supernatant was removed and DNA was washedwith 0.5mLof 70% alcohol. The contents were centrifuged for 15 min, the supernatant was removed and ethanol was blot dried. The pellet was air dried for 10 min. The DNA was dissolved in 25 of deionized H 2 O and was stored at -20 C for further use. Table A-1. PCR reaction ingredients Reaction Mixture Volume( PCR Mastermix 25 Water 22 1.0 1.0 Template DNA (pACYC177) 1.0 Total Volume 50 Figure A-1. The PCR temperature profile used.

PAGE 77

77 Figure A-2. Gel picture: desired fragment size Step 3:Clone PCR Fragment in pRVS1 Materials PCR fragment EcoR Iand Sph I restriction enzymes pRVS1 10XNEBuffer EcoRI DNA ligase (T4) Procedure PCR amplified DNA and pRVS1 was digested with EcoR Iand Sph I restriction enzymes (Table A-2)for an hour at 37 C (Table A-2). The reaction mixture was incubated at 16 C for 2 hours. The resulting plasmid was the donor plasmid (Table A-3).

PAGE 78

78 Table A-2. Double digest reaction set up Reaction Mixture Volume( Buffer (10X) 1.5 DNA (PCR fragment or pRVS1) 2.0 EcoR I 0.5 Sph I 0.5 Water 10.5 Total Volume 15.0 Table A-3. Ligation reaction Reaction Mixture Volume( 10X ligation buffer 3.0 Insert DNA (PCR fragment) 15.0 Vector DNA (from pRVS1) 12.0 DNA ligase 0.5 Total Volume 30.5 Step 4:Transformation of Donor Plasmid into Donor E. coli Materials Donor plasmid LB + kKanamycin E.coli SOC Medium Procedure A tube of competent E. coli cells was thawed on ice for 10 minutes. containing of pKD100 was added to the cell mixture. The tube was flicked 4-5 times to mix cells and DNA. The mixture was placed on ice for 30 minutes. It was heat shocked at exactly 42C for exactly 30 seconds. It was placed on ice for 5 minutes. 250 of room temperature SOC was added into the mixture. It was placed in a shaking incubator at 37C, 250 rpm for 60 minutes. The cells were thoroughly mixed by flicking the tube and inverting. Several 10-fold serial dilutions were performed in SOC. of each dilution was plated onto warm selection plates(LB + kanamycin)and incubated overnight at 37C.

PAGE 79

79 Figure A-3. Blue colonies of E. coli 0

PAGE 80

80 Step 5:Triparental Mating Materials LB broth LB agar + kanamycin + X-gal Colonies from Step 1(helper strain) and Step 4(donor strain)Paracoccus pantotrophus (recipient) Procedure Three flasks, each containing 5mLof LB, wereinoculated with, respectively, donor, helper and recipient strains from overnight cultures (5% inoculum)and wereincubated in a shaker at 37 C for two hours.Kanamycin to a final concentration of 25 g/mLwas added in the growth medium of donor strain. Each culture is pelleted and resuspended in 2 mLLB to wash away the antibiotics. 150 donor strain and 150 helper strain was added to 450 5.0 mLof LB in a culture tube. The culture was incubated at 37C for two hours in a shaker. The mixture was filtered through a 0.45 MI) and was placed cell side up on LB agar plate. The filter paper with the bacteria on it was resuspended in 5 mLLB and was put in the shaker at 37 Cfor an hour. Several 10-fold serial dilutions were performed in LB. 100 of each dilution was plated on LB+kanamycin+Xgal agar and the plates wereincubated at 37 C. Ex-conjugants were kanamycin resistant, trimethoprim sensitiveand the colonies were white on X-gal. Exconjugants were picked and streaked independently to get single colonies on the selective medium (LBagar+kanamycin+X-gal). The plates were incubated at 37 C for a day. Step 6:Confirmation of the Mutant PCR was carried out on genomic DNA of P. pantotrophus (negative control) and pKD100 (positive control) with same primers and same conditions used in Step 2. The PCR product was confirmed with Gel electroph

PAGE 81

81 Figure A-4. Triparental mating

PAGE 82

82 Figure A-5. Confirmation of the mutant(Lanes1and 8 / Hind III marker, Lane 3Mutant, Lanes 4 and 5 P. pantotrophus (negative control),Lane 6 pKD100 (positive control)

PAGE 83

83 APPENDIX B DIFFERENTIAL EVOLUTION Differential Evolution (DE) belongs to the class of evolution strategy optimizers which has a high probability of finding a global minimum of a multi-dimensional system. It is a stochastic, population based optimization algorithm introduced by Kenneth Price and Rainer Storn in 1996. Theobjective function (cost function) that drives the optimization procedure was defined asEquation B-1, where g is a vector of D decision parameters (dimensions) and n is the numberof data sets. The objective is to find a vector gin the given search space, for which the cost function is a minimum. The search space is defined by providing the lower and upper bounds for each of the D dimensions of g, i.e., max ming g g 2 n cal m X X )g F( Min (B-1) The different steps in a DE algorithm are as follows Initialization Mutation Crossover/Recombination Selection Initialization The population (NP) to be sampled is usually taken as the 10 times the number of dimensions to be optimized. The population is randomly initialized. The result is an array of NP rows with D number of columns. In DE, the parameters are encoded as floating point numbers. min max min m i g g () rnd g g (B-2) withi=1,2,3NP and m=1Dand rnd() denotes a uniform random number generator.

PAGE 84

84 Mutation Three distinct random numbers (say a, b, c) are selected within the range, 1 to NP. The weighted difference of m b m a g g is used to perturb m c g to generate a noisy random vector, m i n : m b m a m c m i g g F g n (B-3) where i = 1. NP and m = 1. .D. Fis calledthe scaling factor and it is user-supplied within the range 0.2. This mutation ensures an efficient search of the solution space in each dimension. Crossover/Recombination Each primary population vectoris recombined with a noisy random vector, i n to generate a trial vector, i t Each trial vector parameter ( m i t where i=1. .NP and m=1. .D), is determined by a binomial experiment whose success or failure is determined by the user supplied crossover factor, CR [0,1]. otherwise g t D m or CR rnd() if n t m i m i m i m i (B-4) where i = 1, NP and m = 1, D Therefore, trial vector, i t is the child of two parent vectors: noisy random vector, i n and target vector, i g DE performs a non-uniform crossover, by virtue of which, the child vector can take more parameters from one parent than the other.

PAGE 85

85 Selection The trial vector competes with one of its parent vectors, target vector,and the fitter of the two (one with the lower cost value) proceeds to the next generation.The end of NP competitions will leave us with a new population.The procedure continues until the termination condition is reached, i.e. when the objective function attains a prescribed minimum or a specified number of generations are completed, whichever is earlier.

PAGE 86

86 APPENDIX C DIAUXIC GROWTH MODELSOURCE CODE # include # include # include #define D 17 #define NP 170 #define gen_max 3000 #define CR 0.9 #define SF 0.8 #define IA 16807 #define IM 2147483647 #define AM (1.0/IM) #define IQ 127773 #define IR 2836 #define NTAB 32 #define NDIV (1+ (IM-1)/NTAB) #define EPS 1.2E-7 #define RNMX (1.0-EPS) double obj1(double *g); /* sub-routine that calculates the cost of the objective function*/ double rnd(int *idum); /* Uniform random number generator */ void result1(double *g); /* sub-routine that prints out the result */ main( ) { double score,var,r; int i,j,k,l,idum,count=0; double x2[NP][D],cost[NP],trial[NP],x1[NP][D],g[D]; int x,y,z,p; /* Parameters to be estimated are in the order: K s,ox K s,an K OH K Oi K NOi b, b NO Y c,ox Y c,an n,an K 1

PAGE 87

87 K 2 a N,nar V sni, max,ox max,anox e nar,initial */ /* Upper and lower bounds of the parametersto be estimated */ double ll[ ]={0,0,0,0,0,0,0,0,0,0,0,0,0,0,0.5,0.01,1E-20}; double ul[ ]={.1,10,10,10,10,1,10,1,1,1,1E25,1E25,1E-3,1,1,0.1,1E-6}; idum=-22200; for(p=0;p
PAGE 88

88 trial[k]=ll[k]+(ll[k]-trial[k])*(ul[k]-ll[k])/(ul[k]trial[k]); if(trial[k]>ul[k]) trial[k]=ul[k]-(trial[k]-ul[k])*(ul[k]-ll[k])/(trial[k]ll[k]); g[k]=trial[k]; } else { trial[k]=x1[p][k]; g[k]=trial[k]; } } score=obj1(g); if(score<=cost[p]) { for(j=0;j
PAGE 89

89 { if(!(var<=cost[i])) { l=i; var=cost[i]; } } for(j=0;j
PAGE 90

90 /* Sub-routine to calculate the cost of the objective function using the parameters generated in Differential evolution */ double obj1(double *g) { int k=0; double time[ ]={0.0,1.7,2.2,3.6,4.0,6.1,9.3,24.1,25.7,27.4}; double cod[ ] = {18.360,42.840,81.260,209.440,226.440,278.120,302.260, 351.220,406.640,461.040}; int flag=1; double Ss=10000,Sn=400,en_nap,en_nar,So=8; double rate_ox,rate_an,rate_en_nar,rate_sni,fxb,fss,fsn,fen_nar,fsni, code[10],en_nar_max,sni_max; double Xe=0.0,Xb=18.36,sni=0; double i=0.0,deltai=0.01,anar,annar,Xa,Xan; en_nar=g[16]; double mumax_ox=g[14],mumax_an=g[15]; for(i=0.0;i<27.41;i+=0.01) { if((i >= 4.10)&&(flag == 1)) { So=0.0; anar=en_nar; flag=0; } sni_max=g[13]/mumax_an-g[9]; en_nar_max=g[12]/(g[5]+g[6])*((1+g[10]*sni_max)/(g[11]+g[10]*sni_max)); if(Ss==0) { rate_ox=0; rate_an=0; rate_sni=0; rate_en_nar=0; } else { rate_ox=mumax_ox*(Ss/(g[0]+Ss))*(So/(g[2]+So)); if(sni_max==0) rate_an=0; else rate_an=mumax_an*(Ss/(g[1]+Ss))*(en_nar/en_nar_max)*(sni/sni_max); rate_en_nar=g[12]*((1+g[10]*sni)/(g[11]+g[10]*sni))*(Ss/(Ss+g[1]));

PAGE 91

91 rate_sni=g[13]*(en_nar/en_nar_max)*(Sn/(Sn+g[4])) *(g[3]/(g[3]+So))*(Ss/(Ss+g[1])); } fxb=(rate_ox+rate_an-g[5])*Xb; fss=(-(1/g[7])*rate_ox-(1/g[8])*rate_an)*Xb; fsn=-1*rate_sni*Xb; if(Xb==0) { fen_nar=0; fsni=0; } else { fen_nar=rate_en_nar-(g[5]+g[6]+fxb/Xb)*en_nar; fsni=rate_sni-g[9]*rate_an-(g[5]+fxb/Xb)*sni; } if(i==0.0) { code[k]=Xb; k=k+1; } Xb=Xb+fxb*deltai; Ss=Ss+fss*deltai; en_nar=en_nar+fen_nar*deltai; if (Ss<0) Ss=0; Sn=Sn+fsn*deltai; if (Sn<0) Sn=0; sni=sni+fsni*deltai; if(fabs(time[k]-(i+0.01))<0.000001) { code[k]=Xb; k=k+1; } } annar=en_nar;

PAGE 92

92 for(k=0;k<10;k++) { Xe=Xe+pow((cod[k]-code[k]),2); } Xa=pow((anar-0.42E-6),2); Xan=pow((annar-9.42E-6),2); Xe=Xe/pow(237.762,2)+(Xa+Xan)/pow(4.92E-6,2); return Xe; }

PAGE 93

93 /* Sub-routine result generates the predicted values after the parameters have been optimized by Differential evolution */ void result2(double *g) { int k=0; double time[ ]={0.00,1.7,2.2,3.6,4.0,6.1,9.3,24.1,25.7,27.4}; double cod[ ] = {18.360,42.840,81.260,209.440,226.440,278.120, 302.260,351.220,406.640,461.040}; int flag=1; double Ss=10000,Sn=400,en_nap,en_nar,So=8; double rate_ox,rate_an,rate_en_nar,rate_sni,fxb,fss,fsn,fen_nar,fsni, code[10],en_nar_max,sni_max; double Xe=0.0,Xb=18.36,sni=0; double i=0.0,deltai=0.01; en_nar=g[16]; double mumax_ox=g[14],mumax_an=g[15]; FILE *fpt; fpt=fopen("resultskdnokanc.doc","w"); for(i=0.0;i<27.41;i+=0.01) { fprintf(fpt,"\n%lf \t %e \t %lf \t %lf",i,en_nar,sni,Xb); if((i >= 4.10)&&(flag == 1)) { So=0; flag=0; } sni_max=(g[13]/mumax_an-g[9]); en_nar_max=g[12]/(g[5]+g[6])*((1+g[10]*sni_max)/(g[11]+g[10]*sni_max)); if(Ss==0) { rate_ox=0; rate_an=0; rate_sni=0; rate_en_nar=0; } else { rate_ox=mumax_ox*(Ss/(g[0]+Ss))*(So/(g[2]+So)); if(sni_max==0)

PAGE 94

94 rate_an=0; else rate_an=mumax_an*(Ss/(g[1]+Ss))*(en_nar/en_nar_max)*(sni/sni_max); rate_en_nar=g[12]*((1+g[10]*sni)/(g[11]+g[10]*sni))*(Ss/(Ss+g[1])); rate_sni=g[13]*(en_nar/en_nar_max)*(Sn/(Sn+g[4]))*(g[3]/(g[3]+So))*(Ss/(Ss+g [1])); } fxb=(rate_ox+rate_an-g[5])*Xb; fss=(-(1/g[7])*rate_ox-(1/g[8])*rate_an)*Xb; fsn=-1*rate_sni*Xb; if(Xb==0) { fen_nar=0; fsni=0; } else { fen_nar=rate_en_nar-(g[5]+g[6]+fxb/Xb)*en_nar; fsni=rate_sni-g[9]*rate_an-(g[5]+fxb/Xb)*sni; } if(i==0.0) { code[k]=Xb; k=k+1; } Xb=Xb+fxb*deltai; Ss=Ss+fss*deltai; en_nar=en_nar+fen_nar*deltai; if (Ss<0) Ss=0; Sn=Sn+fsn*deltai; if (Sn<0) Sn=0; sni=sni+fsni*deltai; if(fabs(time[k]-(i+0.01))<0.000001) { code[k]=Xb; k=k+1;

PAGE 95

95 } } for(k=0;k<10;k++) { Xe=Xe+pow(cod[k]-code[k],2); } fprintf(fpt,"\nOptimum cost=%e",Xe); fprintf(fpt,"\ne_nar=%e",en_nar); printf("\nOptimum cost=%e",Xe); getchar(); for(k=0;k
PAGE 96

96 /* Uniform random number generator */ double rnd(int *idum) { int j; long k; static long iy=0; static long iv[NTAB]; double temp; if(*idum <= 0 || !iy) { if(-(*idum) < 1) *idum=1; else *idum=-(*idum); for(j=NTAB+7;j>=0;j--) { k=(*idum)/IQ; *idum=IA*(*idum-k*IQ)-IR*k; if(*idum <0) *idum += IM; if(j RNMX) return RNMX; else return temp; }

PAGE 97

97 /* Model prediction for the wild-type*/ # include # include # include #define D 7 #define NP 70 #define gen_max 1000 #define CR 0.9 #define SF 0.8 #define IA 16807 #define IM 2147483647 #define AM (1.0/IM) #define IQ 127773 #define IR 2836 #define NTAB 32 #define NDIV (1+(IM-1)/NTAB) #define EPS 1.2E-7 #define RNMX (1.0-EPS) double obj1(double *g); double rnd(int *idum); void result1(double *g); main( ) { double score,var,r; int i,j,k,l,idum,count=0; double x2[NP][D],cost[NP],trial[NP],x1[NP][D],g[D]; int x,y,z,p; /* Parameters to be estimated are in the order: K N a N,nap e nar,initial e nap,initial max,ox max,anox (rest of the parameters are same as that of the mutant*/ double ll[ ]={0,0,0,1E-15,1E-15,0,0}; double ul[ ]={5,1E-3,0.1,1E-8,1E-8,1,0.5}; idum=-22200;

PAGE 98

98 for(p=0;pul[k]) trial[k]=ul[k]-(trial[k]-ul[k])*(ul[k]-ll[k])/(trial[k]ll[k]); g[k]=trial[k]; } else { trial[k]=x1[p][k]; g[k]=trial[k]; } } score=obj1(g); if(score<=cost[p])

PAGE 99

99 { for(j=0;j
PAGE 100

100 /* Sub-routine to calculate the cost of the objective function using the parameters generated in Differential evolution */ double obj1(double *g) { int k=0; double time[ ] = {0.0,1.3,1.8,2.4,3.4,3.8,4.4,5.1,5.9,6.9}; double cod[ ] = {24.48,36.72,44.2,75.14,172.72,204.68,221.34,282.2,345.44,524.28}; double h[ ] = {8.03E-02,1.60E+00,2.51E+00,5.98E+00,2.15E+00,1.74E-03,1.56E+00, 9.19E-01,9.53E-01,2.26E-01,9.98E+24,9.63E+23,2.02E-05,6.53E-02}; int flag=1; double Ss=1380,Sn=400,en_nap,en_nar,So=8; double rate_ox,rate_an,rate_en_nap,rate_en_nar,rate_sni,fxb,fss,fsn,fen_nar, fen_nap,fsni,code[10],en_nap_max,en_nar_max,sni_max; double Xe=0.0,Xb=24.48,sni=0,anar,anap,annap,annar,Xa,Xan; double i=0.0,deltai=0.01; en_nap=g[3]; en_nar=g[4]; double mumax_ox=g[5],mumax_an=g[6]; for(i=0.0;i<6.9;i+=0.01) { if((i >= 3.8)&&(flag == 1)) { So=0.0; anar=en_nar; anap=en_nap; flag=0; } sni_max=(h[13]/mumax_an-h[9]); en_nap_max=g[1]/(h[5]+h[6]); en_nar_max=h[12]/(h[5]+h[6])*((1+h[10]*sni_max)/(h[11]+h[10]*sni_max)); if(Ss==0) { rate_ox=0; rate_an=0; rate_sni=0; rate_en_nap=0; rate_en_nar=0; } else { rate_ox=mumax_ox*(Ss/(h[0]+Ss))*(So/(h[2]+So)); if(sni_max==0) rate_an=0;

PAGE 101

101 else rate_an=mumax_an*(Ss/(h[1]+Ss))*((1-g[2])*(en_nar/en_nar_max)* (sni/sni_max)+g[2]*(en_nap/en_nap_max)*Sn/(g[0]+Sn)); rate_en_nap=g[1]*(So/(So+h[2]))*(Sn/(Sn+g[0])); rate_en_nar=h[12]*((1+h[10]*sni)/(h[11]+h[10]*sni))*(Ss/(Ss+h[1])); rate_sni=h[13]*(en_nar/en_nar_max)*(Sn/(Sn+h[4]))*(h[3]/(h[3]+So))*(Ss/(Ss+h[1])); } fxb=(rate_ox+rate_an-h[5])*Xb; fss=(-(1/h[7])*rate_ox-(1/h[8])*rate_an)*Xb; fsn=-1*rate_sni*Xb; if(Xb==0) { fen_nar=0; fen_nap=0; fsni=0; } else { fen_nar=rate_en_nar-(h[5]+h[6]+fxb/Xb)*en_nar; fen_nap=rate_en_nap-(h[5]+h[6]+fxb/Xb)*en_nap; fsni=rate_sni-h[9]*rate_an-(h[5]+fxb/Xb)*sni; } if(i==0.0) { code[k]=Xb; k=k+1; } Xb=Xb+fxb*deltai; Ss=Ss+fss*deltai; en_nap=en_nap+fen_nap*deltai; en_nar=en_nar+fen_nar*deltai; if (Ss<0) Ss=0; Sn=Sn+fsn*deltai; if (Sn<0) Sn=0; sni=sni+fsni*deltai; if(fabs(time[k]-(i+0.01))<0.000001) {

PAGE 102

102 code[k]=Xb; k=k+1; } } annar=en_nar; annap=en_nap; for(k=0;k<10;k++) { Xe=Xe+pow((cod[k]-code[k]),2); } Xa=pow((anar-0.31E-6),2)+pow((annar-16.3E-6),2); Xan=pow((annap-1.33E-6),2)+pow((anap-2E-6),2); Xe=Xe/pow(193.12,2)+Xa/pow(8.31E-6,2)+Xan/pow(1.67E-6,2); return Xe; }

PAGE 103

103 /* Sub-routine result generates the predicted values after the parameters have been optimized by Differential evolution */ void result1(double *g) { int k=0; double time[ ]={0.0,1.3,1.8,2.4,3.4,3.8,4.4,5.1,5.9,6.9}; double cod[ ] = {24.48,36.72,44.2,75.14,172.72,204.68,221.34,282.2,345.44,524.28}; int flag=1; double Ss=1380,Sn=400,en_nap,en_nar,So=8; double rate_ox,rate_an,rate_en_nap,rate_en_nar,rate_sni,fxb,fss,fsn, fen_nar,fen_nap,fsni,code[10],en_nap_max,en_nar_max,sni_max; double Xe=0.0,Xb=24.48,sni=0; double i=0.0,deltai=0.01; double h[ ] = {8.03E-02,1.60E+00,2.51E+00,5.98E+00,2.15E+00,1.74E-03,1.56E+00, 9.19E-01,9.53E-01,2.26E-01,9.98E+24,9.63E+23,2.02E-05,6.53E-02}; en_nap=g[3]; en_nar=g[4]; double mumax_ox=g[5],mumax_an=g[6]; FILE *fpt; fpt=fopen("resultsppfopt.doc","w"); for(i=0.0;i<6.9;i+=0.01) { fprintf(fpt,"\n%lf \t %e \t %e \t %lf \t %lf",i,en_nar,en_nap,sni,Xb); if((i >= 3.8)&&(flag == 1)) { So=0.0; flag=0; } sni_max=(h[13]/mumax_an-h[9]); en_nap_max=g[1]/(h[5]+h[6]); en_nar_max=h[12]/(h[5]+h[6])*((1+h[10]*sni_max)/(h[11]+h[10]*sni_max)); if(Ss==0) { rate_ox=0; rate_an=0; rate_sni=0; rate_en_nap=0; rate_en_nar=0; } else {

PAGE 104

104 rate_ox=mumax_ox*(Ss/(h[0]+Ss))*(So/(h[2]+So)); if(sni_max==0) rate_an=0; else rate_an=mumax_an*(Ss/(h[1]+Ss))*((1-g[2])*(en_nar/en_nar_max)* (sni/sni_max)+g[2]*(en_nap/en_nap_max)*Sn/(g[0]+Sn)); rate_en_nap=g[1]*(So/(So+h[2]))*(Sn/(Sn+g[0])); rate_en_nar=h[12]*((1+h[10]*sni)/(h[11]+h[10]*sni))*(Ss/(Ss+h[1])); rate_sni=h[13]*(en_nar/en_nar_max)*(Sn/(Sn+h[4]))*(h[3]/(h[3]+So))*(Ss/(Ss+h[1])); } fxb=(rate_ox+rate_an-h[5])*Xb; fss=(-(1/h[7])*rate_ox-(1/h[8])*rate_an)*Xb; fsn=-1*rate_sni*Xb; if(Xb==0) { fen_nar=0; fen_nap=0; fsni=0; } else { fen_nar=rate_en_nar-(h[5]+h[6]+fxb/Xb)*en_nar; fen_nap=rate_en_nap-(h[5]+h[6]+fxb/Xb)*en_nap; fsni=rate_sni-h[9]*rate_an-(h[5]+fxb/Xb)*sni; } if(i==0.0) { code[k]=Xb; k=k+1; } Xb=Xb+fxb*deltai; Ss=Ss+fss*deltai; en_nap=en_nap+fen_nap*deltai; en_nar=en_nar+fen_nar*deltai; if (Ss<0) Ss=0; Sn=Sn+fsn*deltai; if (Sn<0) Sn=0; sni=sni+fsni*deltai;

PAGE 105

105 if(fabs(time[k]-(i+0.01))<0.000001) { code[k]=Xb; k=k+1; } } for(k=0;k<10;k++) { Xe=Xe+pow(cod[k]-code[k],2); } fprintf(fpt,"\nOptimum cost=%e",Xe); fprintf(fpt,"\ne_nar=%e\ten_nap=%e",en_nar,en_nap); printf("\nOptimum cost=%e",Xe); getchar(); for(k=0;k
PAGE 106

106 LIST OF REFERENCES Bedzyk L, Wang T, Ye RW. 1999. The periplasmic nitrate reductase in Pseudomonas sp. strain G-179 catalyzes the first step of denitrification. J Bacteriol 181: 2802-2806. Bell LC, Richardson DJ, Ferguson SJ. 1990. Periplasmic and membrane-bound respiratory nitrate reductases in Thiosphaera pantotropha : the periplasmic enzyme catalyzes the first step in aerobic denitrification.FEBS Letters265: 85-87. Berks BC,Ferguson SJ, Moir JWB, Richardson DJ. 1995. Enzymes and associated electron transport systems that catalyse the respiratory reduction of nitrogen oxides and oxyanions. Biochimica et BiophysicaActa 1232: 97-173. Berks BC, Richardson DJ, Reilly A, Willis AC and Ferguson SJ. 1995. The napEDABC cluster encoding the periplasmic nitrate reductase system of Thiosphaera pantotropha. Biochem J 309: 983-992. Berks BC, Richardson DJ, Robinson C, Reilly A, Aplin RT, Ferguson SJ. 1994. Purification nd characterization of the periplasmic nitrate reductase from Thiosphaera pantotropha. Eur J Biochem 220: 117-124. Cancer Genetics, Inc. 2004. Fluorescent in situ hybridization (FISH) protocol. Retrieved May 16, 2007, from Cancer Genetics, Inc: www.cancergenetics.com Casass IA. 2001. Effect of exposure to oxygen on the diauxic lag. Masters Thesis. University of Florida, Gainesville, Florida. Casass IA, Lee D, Hamilton R, Svoronos SA, Koopman B. 2007. Effect of carbon substrate on electron acceptor diauxic lag and anoxic maximum specific growth rate in species with and without periplasmic enzyme. J Environ Sci Health A Tox Hazard Subst Environ Eng42: 103-108. Datsenko KA, Wanner BL. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. PNAS 97: 6640-6645. DurvasulaK, JantamaK, FischerK,VegaA, KoopmanB,SvoronosSA. Effect of periplasmic nitrate reductase(Nap) on diauxic lag of Paracoccus pantotrophus (submitted to Biotechnology Progress, AICHE). Ellington MJK, Bhakoo KK, Sawers G, Richardson DJ, Ferguson SJ. 2002. Hierarchy in Carbon Source Selection in Paracoccus pantotrophus between Reduction State of the Carbon Substrate and Aerobic Expression of the nap Operon.Journal of Bacteriology 184: 47674774. Goldberg JB, Ohman DE. 1984. Cloning and expression in P. aeruginosa of a gene involved in the production of alginate.J Bacteriol 158:1115-1121.

PAGE 107

107 Gouw M, Bozic R, Koopman B, Svoronos SA. 2001. Effect of nitrate exposure history on the oxygen/nitrate diauxic growth of Pseudomonas denitrificans Water Res 35: 2794-2798. Grady L, Daigger GT, Lim HC. 1999. Biological Wastewater Treatment. New York: Marcel Dekker, Inc. Grunstein M, Hogness DS. 1975. Colony hybridization: a method for the isolation of cloned DNAs that contain a specific gene. PNAS 72: 3961-3965. Hamilton R, Casasu model for denitrifier diauxic growth. BiotechnolBioeng 90: 501-508. Henegariu O, Heerema N, Wright LL, Bray-Ward P, Ward D C, Vance GH. 2000. Improvements in Cytogenetic Slide Preparation: Controlled Chromosome Spreading, Chemical Aging and Gradual Denaturing. Cytometry43:101-109. Henze M, Gujer W, Mino T, Loosdrecht MV. 2000. Activated sludge models ASM1, ASM2, ASM2d and ASM3. Number 9 in Scientific and Technical Report, International Water Association, London. JonesRW, GrayTA, GarlandPB.1976.A study of the permeability of the cytoplasmic membrane of Escherichia coli to reduced and oxidized benzyl viologen and methyl viologen cations: complications in the use of viologens as redox mediators for membranebound enzymes. Biochem Soc Trans4:671-673. KodamaT, Shimada K, MoriT. 1969.Studies on anaerobic biphasic growth of a denitrifying bacterium, Pseudomonas stutzeri Plant and Cell Physiology10:855-865. Kompala DS, Ramkrishna D, Jansen NB, Tsao GT. 1986.Investigation of bacterial growth on mixed substrates: Experimental evaluation of cybernetic models. Biotechnology and Bioengineering28:1044-1055. Lee DU,WooSH, Svoronos SA, KoopmanB. 2008. Determination of diauxic lag in continuous culture. Biotechnol Bioeng. doi: 10.1002/bit. 21925. Lighton K, FiandacaMJ. 2005. Fluorescence measurement of hybridization between quencher (DABCYL) labelled PNA probes and a fluoresceine labelled DNA using the Fluorescence BioMelt Package. VarianInc. Lisbon K, McKean M, Shekar S, Svoronos SA, Koopman B. 2002. Effect of DO on oxic/anoxic diauxic lag of Pseudomonas denitrificans Journal of Environmental Engineering128: 391394. Liu PH, Svoronos SA, Koopman B. 1998b. Experimental and modeling study of diauxic lag of Pseudomonas denitrificans switching from oxic and anoxic conditions. BiotechnolBioeng 60: 649-655.

PAGE 108

108 LiuPH, Zhan G, Svoronos, SA,Koopman B.1996. Cybernetic Approach to Modeling Denitrification in Activated Sludge. Presented at 1996 AIChE National Meeting, Chicago. Liu PH, Zhan G, Svoronos SA, Koopman B. 1998a. Diauxic lag from changing electron acceptors in activated sludge treatment. Water Res 32: 3452-3460. Mendenhall W and Sincich T. 2007. Statistics for engineering and sciences, 5 th Ed. Pearson Prentice Hall Upper saddle river New Jersey. Monod J. 1942. The growth of bacterial cultures. Annu Rev Micobiol 3: 371-394. Moreno-Vivin C,Cabello P, Martnez-Luque M, Blasco R, Castillo F. 1999. MiniReviewProkaryotic nitrate reduction: Molecular properties and functional distinction among bacterial nitrate reductases. J Bacteriol181: 6573-6584. Nikaido H. 2003. Molecular Basis of Bacterial Outer Membrane Permeability Revisited. Microbiol Mol Biol Rev 67: 593-656. Oh J, Silverstein J. 1999b.Effect of air on-off cycles on activated-sludge denitrification. Water Environment Research71: 1276-1282. Ramalho, R S. 1983.Introduction to Wastewater Treatment Processes. San Diego, California: AcademicPress. Richardson DJ, Ferguson SJ. 1992. The influence of carbon substrate on the activity of the periplasmic nitrate reductase in aerobically grown Thiosphaera pantotropha Arch Microbiol 157: 535-537. Rusmana I, Nedwell BD. 2004. Use of chlorate as a selective inhibitor to distinguish membranebound nitrate reductase (Nar) and periplasmic nitrate reductase (Nap) of dissimilative nitrate reducing bacteria in sediment. FEMS Microbiology Ecology 48:379-386. Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular Cloning: a Laboratory Manual. 2nd Ed. New York:Cold Spring Harbor, Cold Spring Harbor Laboratory. Sear HJ, Sawers G, Berks BC, Ferguson SJ, Richardson DJ. 2000. Control of periplasmic nitrate reductase gene expression ( napEDABC ) from Paracoccus pantotrophus in response to oxygen and carbon substrates. Microbiol146: 2977-2985. Shoemaker J, Reeves GT, Gupta S, Pilyugin SS, Egli T, Narang A. 2003. The dynamics of single-substrate continuous cultures: the role of transport enzymes. J Theor Biol 222: 307322. Siddiqui RA, Warnecke-Eberz U, Hengsberger A, Schneider B, Kostka S, Friedrich B. 1993. Structure and function of a periplasmic nitrate reductase in Alcaligenes eutrophus H16. J Bacteriol 175: 5867-5876.

PAGE 109

109 Storn R, Price K. 1997.Differential Evolution A simple evolution strategy for fast optimization. Dr. Dobb's Journal 22:18. Tiedje JM. 1988. Ecology of denitrification and dissimilatory nitrate reduction to ammonium. In Biology of Anaerobic Microorganisms New York : Wiley and Sons. Van Spanning RJM, Wansell CW, Reijnders WN, Harms N, Ras J, Oltmann LF, Stouthamer AH. 1991. A method for introduction of unmarked mutations in the genome of Paracoccus pantotrophus: Construction of strains with multiple mutations in the genes encoding periplasmic cytochromes c550, c551i, and c553i.J Bacteriol 173: 6962-6970. Vishniac W, Santer M. 1957. The thiobacilli. Bacteriol Rev.21(3): 195-213. Waki T, Murayama K, Kawato Y, Ichikawa K. 1980. Transient characteristics of Paracoccus denitrificans with changes between aerobic and anaerobic conditions. Journal of Fermentation Technology58:243-249. Warnecke-Eberz U,Friedrich B. 1993.Three nitrate reductase activities in Alcaligenes eutrophus. Archives of Microbiology159:405-409. Wilderer AP, Bungartz Joachim-Hans, Lemmer H, Wagner M, Keller J,Wuertz S. 2002. Modern Scientific methods and their potential in wasterwater science and technology. Water Research36: 370-393. Wood JN, Alizadeh T, Richardson DJ, Ferguson SJ, Moir JWB. 2002. Two domains of a dualfunction NarK protein are required for nitrate uptake, the first step of denitrification of Paracoccus pantotrophus Molecular Microbiology 44: 157-170. Yagil G, Yagil E. 1971. On the relation between effector concentration and the rate of induced enzyme synthesis. Biophys J 11: 11-27.

PAGE 110

110 BIOGRAPHICAL SKETCH Kiranmai Durvasula (Kiran) was born in1982 in Visakhapatnam, India. She received her Bachelor of Engineering (hons.) degree in chemical engineering in 2003 from Birla Institute of Technology, Pilani (BITS, Pilani), India. In 2004, shebegan her doctoral study in the Department of Chemical Engineering at University of Florida, Gainesville and receivedher doctorate in 2008. She was a recipient of Alumni fellowship during her graduate studies. Her research interests include biological nitrate removal, modeling biological systems and genetic engineering.