<%BANNER%>

Distinct Functions of C/EBP Isoforms in the Regulation of Manganese Superoxide Dismutase during IL-1B Stimulation

Permanent Link: http://ufdc.ufl.edu/UFE0023994/00001

Material Information

Title: Distinct Functions of C/EBP Isoforms in the Regulation of Manganese Superoxide Dismutase during IL-1B Stimulation
Physical Description: 1 online resource (136 p.)
Language: english
Creator: Qiu, Xiaolei
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: aare, assemble, atf4, cebpb, cebpd, chromatin, enhancer, foxo3a, gtf, inflammation, interleukin, isoform, mnsod, mutagenesis, peptide, pic, polymerase, preinitiation, transcription
Biochemistry and Molecular Biology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: The mitochondrial anti-oxidant enzyme manganese superoxide dismutase (MnSOD) is crucial in maintaining cellular and organismal homeostasis. MnSOD expression is tightly regulated to exert its cytoprotective functions during inflammatory challenges. Induction of MnSOD gene expression by the proinflammatory cytokine, interleukin 1? (IL-1?), is mediated through an intronic enhancer element. Yeast one-hybrid assay was utilized and two CCAAT-enhancer binding protein (C/EBP) members, C/EBP? and C/EBP? were identified. These two transcription factors respond to IL-1? treatment with distinct expression profiles, different temporal yet inducible interactions with the endogenous MnSOD enhancer, as well as distinct effects on MnSOD transcription. C/EBP? is expressed as three protein isoforms, LAP* (liver activating protein), LAP and LIP (liver inhibitory protein). My functional analysis demonstrated that only the full length C/EBP?/LAP* served as a transcriptional activator for MnSOD, while LAP, LIP and C/EBP? functioned as potential repressors. Finally, my systematic mutagenesis of the unique N-terminal 21 amino acids further solidified the importance of LAP* in the induction of MnSOD, and emphasized the crucial role of this isoform. During essential amino acid deprivation, MnSOD expression is induced by the transcription factor Forkhead box O3a (FOXO3a) through a dauer binding element (DBE) like sequence in the distal promoter. FOXO3a expression was then demonstrated to be upregulated by amino acid deprivation as well and requires the activating transcription factor 4 (ATF4) which probably functions through the amino acid response element (AARE2) region. Histidine limitation triggers the specific recruitment of RNA polymerase II to the FOXO3a AARE2 region in an ATF4-dependent manner. General transcription factors (GTFs) enrichment was also observed on the AARE2 region, suggesting the AARE2 region of FOXO3a may function as a nucleation center for pre-initiation complex (PIC) assembly.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Xiaolei Qiu.
Thesis: Thesis (Ph.D.)--University of Florida, 2008.
Local: Adviser: Nick, Harry S.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0023994:00001

Permanent Link: http://ufdc.ufl.edu/UFE0023994/00001

Material Information

Title: Distinct Functions of C/EBP Isoforms in the Regulation of Manganese Superoxide Dismutase during IL-1B Stimulation
Physical Description: 1 online resource (136 p.)
Language: english
Creator: Qiu, Xiaolei
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: aare, assemble, atf4, cebpb, cebpd, chromatin, enhancer, foxo3a, gtf, inflammation, interleukin, isoform, mnsod, mutagenesis, peptide, pic, polymerase, preinitiation, transcription
Biochemistry and Molecular Biology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: The mitochondrial anti-oxidant enzyme manganese superoxide dismutase (MnSOD) is crucial in maintaining cellular and organismal homeostasis. MnSOD expression is tightly regulated to exert its cytoprotective functions during inflammatory challenges. Induction of MnSOD gene expression by the proinflammatory cytokine, interleukin 1? (IL-1?), is mediated through an intronic enhancer element. Yeast one-hybrid assay was utilized and two CCAAT-enhancer binding protein (C/EBP) members, C/EBP? and C/EBP? were identified. These two transcription factors respond to IL-1? treatment with distinct expression profiles, different temporal yet inducible interactions with the endogenous MnSOD enhancer, as well as distinct effects on MnSOD transcription. C/EBP? is expressed as three protein isoforms, LAP* (liver activating protein), LAP and LIP (liver inhibitory protein). My functional analysis demonstrated that only the full length C/EBP?/LAP* served as a transcriptional activator for MnSOD, while LAP, LIP and C/EBP? functioned as potential repressors. Finally, my systematic mutagenesis of the unique N-terminal 21 amino acids further solidified the importance of LAP* in the induction of MnSOD, and emphasized the crucial role of this isoform. During essential amino acid deprivation, MnSOD expression is induced by the transcription factor Forkhead box O3a (FOXO3a) through a dauer binding element (DBE) like sequence in the distal promoter. FOXO3a expression was then demonstrated to be upregulated by amino acid deprivation as well and requires the activating transcription factor 4 (ATF4) which probably functions through the amino acid response element (AARE2) region. Histidine limitation triggers the specific recruitment of RNA polymerase II to the FOXO3a AARE2 region in an ATF4-dependent manner. General transcription factors (GTFs) enrichment was also observed on the AARE2 region, suggesting the AARE2 region of FOXO3a may function as a nucleation center for pre-initiation complex (PIC) assembly.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Xiaolei Qiu.
Thesis: Thesis (Ph.D.)--University of Florida, 2008.
Local: Adviser: Nick, Harry S.

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0023994:00001


This item has the following downloads:


Full Text

PAGE 1

DISTINCT FUNCTIONS OF C/EBP ISOFOR MS IN THE REGULATION OF MANGANESE SUPEROXIDE DISMUTASE DURING IL-1 STIMULATION By XIAOLEI QIU A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2008 1

PAGE 2

2008 Xiaolei Qiu 2

PAGE 3

To my parents and grandparents. 3

PAGE 4

ACKNOWLEDGMENTS Many people helped me and supported me during my pursuit of the Ph.D degree. First, I would like to thank my mentor, Dr Harry Nick. He has been a great teacher and a father to me. I am grateful for all the help and support he provided and for the opportunity to work in his lab. I would also like thank all of my comm ittee members (Drs. Bungert, Kilberg, Robertson and Swanson). They always raise insightful ques tions, provide great solutions and have been instrumental during my Ph.D training. I would like to thank all my lab mates: curren t post-doc (Kim), gra duate students (Jewell and Justin), technician (Dawn) and previous lab members (Ann, JD, Jiang, Molly and Amy) for giving me suggestions, sharing laug hter and making my life in the la b so colorful. I would also like to thank the members in the Dr. Kilbergs la b who are always very friendly and helpful. I have enjoyed meeting my IDP classmates and I highly appreciate the help from the IDP, BMB and Neuroscience Departments. I would also like to thank my parents. They are always supportive, though they really dont like the fact that their only daughter is in a foreign country and so far away from them. I would like to than k my baby Veronica for all the joys she brings to me. Finally, special thanks go to my husband Na n for encouraging me and helping me to keep my sanity when I was down and discouraged. 4

PAGE 5

TABLE OF CONTENTS page ACKNOWLEDGMENTS ............................................................................................................... 4LIST OF TABLES ...........................................................................................................................8LIST OF FIGURES .........................................................................................................................9LIST OF ABBREVIATIONS ........................................................................................................1 1ABSTRACT ...................................................................................................................... .............12 CHAPTER 1 INTRODUCTION ................................................................................................................ ..14Reactive Oxygen Species, Oxidative Stress and Antioxidant Enzymes .................................14Superoxide Dismutases ......................................................................................................... ..15Manganese Superoxide Dismutase (MnSOD) ........................................................................15Physiological Importance of MnSOD .............................................................................16Transcriptional Regulation of MnSOD ...........................................................................17Chromatin architecture of MnSOD ..........................................................................18Transcription factors regulating MnSOD .................................................................20The CCAAT Enhancer Binding Protein (C/EBP) Family ......................................................21CCAAT Enhancer Binding Protein (C/EBP ) and (C/EBP ) ..........................................22Forkhead Box O (FOXO) .......................................................................................................24Forkhead Box O3a (FOXO3a) ................................................................................................262 MATERIALS AND METHODS ...........................................................................................33Materials ..................................................................................................................... ............33Methods ..................................................................................................................................34Cell Culture .....................................................................................................................34Recombinant Plasmid Construction ................................................................................34Site-Directed Mutagenesis ...............................................................................................35RNA Isolation, Northern Analysis and Statistical Analysis ............................................35Generation of cDNA from RNA .....................................................................................37Real-Time PCR ...............................................................................................................37Total Protein Isolation .....................................................................................................38Immunoprecipitation .......................................................................................................38Nuclear Extraction ...........................................................................................................39Immunoblot Analysis ......................................................................................................39Transient Transfection .....................................................................................................40Short Interfering RNA (siRNA) Transfection .................................................................41Transcription Rate Determination ...................................................................................41Chromatin Immunoprecipitation (ChIP) .........................................................................41 5

PAGE 6

Peptide Delivery .............................................................................................................. 43His-Tagged Protein Purification ......................................................................................433 DISTINCT FUNCTIONS OF C/EBP PROTEIN ISOFORMS IN THE REGULATION OF MNSOD DURING IL-1 STIMULATION ....................................................................46Introduction .................................................................................................................. ...........46Results .....................................................................................................................................47Effects of IL-1 on C/EBP and ..................................................................................47Effect of C/EBP Knockout and Knockdown on IL-1 Dependent Induction of MnSOD ........................................................................................................................4 9MnSOD Transcription Rates ...........................................................................................50Interaction of C/EBP and C/EBP with the MnSOD Enhancer Element ......................50Functional Importance of C/EBP and C/EBP in MnSOD Transcriptional Regulation .................................................................................................................... 51Binding of LAP* to the MnSOD Enhancer .....................................................................53Discussion .................................................................................................................... ...........544 IMPORTANCE OF LAP*: THE RELEVAN CE OF THE FIRST 21 AMINO ACIDS ........71Introduction .................................................................................................................. ...........71Results .....................................................................................................................................72Identities of the Amino Terminal 21 Amino Acids among Mammalian Species ...........72General Mutagenesis Study of the Conserve d Residues in the First 21 Amino Acids ...72Evaluation of D8 mutants ................................................................................................74Analysis of R3 Mutants ...................................................................................................74Functional Study of W7 Mutants ....................................................................................75Discussion .................................................................................................................... ...........765 IDENTIFICATION OF AN AMINO ACID RESPONSE ELEMEN T CONTROLLING FOXO3A GENE EXPRESSION AND THE ROLE OF THIS INTERNAL REGUALTORY ELEMENT IN THE RECRUI TMENT OF RNA POLYMERASE II .......86Introduction .................................................................................................................. ...........86Results .....................................................................................................................................90Identification of the FOXO3a Amino Acid Response Element ......................................90Binding Profile of Pol II to FOXO3a ..............................................................................91Function of AARE2 in the Recruitment of Pol II ............................................................92Discussion .................................................................................................................... ...........936 CONCLUSIONS AND FUTURE DIRECTIONS ...............................................................103Conclusions ...........................................................................................................................103Future Directions ..................................................................................................................105 6

PAGE 7

APPENDIX USE OF THE FIRST 21 AMINO AC IDS OF THE FULL LENGTH C/EBP AS A PEPTIDE COMPETITOR ....................................................................................................110Introduction .................................................................................................................. .........110Results ...................................................................................................................................111Transfection by Traditional DNA Delivery Reagents ...................................................111Transfection by a Peptide Delivery Reagent .................................................................112Purification of His-tagged GFP Protein from Bacter ial Expression System .................113LIST OF REFERENCES .............................................................................................................121BIOGRAPHICAL SKETCH .......................................................................................................136 7

PAGE 8

LIST OF TABLES Table page 1-1 Comparison of eukaryotic superoxide dismutases .............................................................282-1 Primers used for ChIP analysis. .........................................................................................45 8

PAGE 9

LIST OF FIGURES Figure page 1-1 Rat MnSOD genomic clone characterization ....................................................................291-2 Alignment of MnSOD Intron 2 from Rat, Human, Chimpanzee and Mouse ....................301-3 Schematics of C/EBP and C/EBP genomic/mRNA and protein structures ...................311-4 Regulation of FOXO lo calization an d activity ..................................................................323-1 Effect of IL-1 on C/EBP and C/EBP mRNA levels ....................................................573-2 Effect of IL-1 on C/EBP and C/EBP cellular protein levels ........................................583-3 Effect of IL-1 on endogenous LAP* protein ...................................................................593-4 Effect of C/EBP knockout on IL-1 -dependent MnSOD induction ................................603-5 Effect of C/EBP knockdown on IL-1 -dependent MnSOD induction ............................613-6 Analysis of MnSOD expression rate after IL-1 treatment ...............................................623-7 Association of C/EBP and C/EBP with MnSOD. ..........................................................633-8 Functional analysis of constructs carrying LAP*, LAP or LIP cDNA ..............................643-9 Expression patterns of each C/EBP construct ..................................................................653-10 Effects of methionine to alanine mutations. ......................................................................663-11 Transcriptional regulation of MnSOD by LAP*, LAP, LIP and C/EBP .........................673-12 Functional analysis of HA-LAP* versus non-tagged LAP* ..............................................683-13 Association of LAP* with the endogenous MnSOD gene .................................................693-14 Model of the functions of C/ EBP isoforms on MnSOD following IL-1 induction .........704-1 Sequence alignment of LAP* N-terminal amino acids ......................................................794-2 Protein overexpression of the LAP* mutants ....................................................................804-3 Functional evaluation of the N-te rminal peptide unique to LAP* .....................................814-4 Densitometry analysis of norther n analysis data in Figure 4-3 ..........................................824-5 Evaluation of D8 mutants .................................................................................................. 83 9

PAGE 10

4-6 Analysis of R3 mutants .................................................................................................... ..844-7 Examination of W7 mutants ..............................................................................................855-1 Schematics of FOXO3a genomic structure........................................................................975-2 Association of ATF4 with FOXO 3a promoter and AARE1-4 regions ..............................985-3 Association of Pol II with FOXO 3a promoter and AARE1-4 regions ..............................995-4 Association of Pol II with FOXO3a prom oter, AARE2 and the intervening regions .....1005-5 Association of TBP and TFIIA with FO XO3a promoter, AARE2 and the intervening regions ....................................................................................................................... .......1015-6 Association of Ser5 phosphorylated Pol II to FOXO3a promoter, FOXO3a AARE2 and ASNS promoter .........................................................................................................102A-1 Schematic of GFP constructs ...........................................................................................115A-2 Localization of GFP constructs ........................................................................................116A-3 Effect of synthetic peptide on MnSOD expression ..........................................................117A-4 Expression of His tagged GFP c onstructs in bacterial system .........................................118A-5 Purification profile s of GFP proteins ...............................................................................119A-6 Examination of refold ing product by SDS-PAGE ...........................................................120 10

PAGE 11

LIST OF ABBREVIATIONS AARE Amino acid response element ATF4 Activating transcription factor 4 bZIP Basic region/leucine zipper C/EBP CCAAT-enhancer binding protein CTD Carboxyl terminal domain EMSA Electrophoretic mobility shift assay FOXO3a Forkhead box O3a GTF General transcription factor hGH Human growth hormone hnRNA Heteronuclear RNA HS Hypersensitive sites IL-1 Interleukin-1 LAP Liver activating protein LIP Liver inhibitory protein LPS Lipopolysaccharide MEF Mouse embryonic fibroblasts MnSOD Manganese superoxide dismutase PIC Pre-initiation complex Pol II RNA polymerase II ROS Reactive oxygen species TEF Transcription enhancing factor TK Thymidine kinase TNF Tumor necrosis factor 11

PAGE 12

Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy DISTINCT FUNCTIONS OF C/EBP ISOFOR MS IN THE REGULATION OF MANGANESE SUPEROXIDE DISMUTASE DURING IL-1 STIMULATION By Xiaolei Qiu December 2008 Chair: Harry S. Nick Major: Medical Sciences--Biochemistry and Molecular Biology The mitochondrial anti-oxidant enzyme manganese superoxi de dismutase (MnSOD) is crucial in maintaining cellular and organismal homeostasis. MnSOD expression is tightly regulated to exert its cytoprotective functions during inflammatory challenges. Induction of MnSOD gene expression by the proinf lammatory cytokine, interleukin 1 (IL-1 ), is mediated through an intronic enhancer element. Yeast one-hybrid assay was utilized and two CCAATenhancer binding protein (C/EBP) members, C/EBP and C/EBP were identified. These two transcription factors respond to IL-1 treatment with distinct e xpression profiles, different temporal yet inducible interactions with the endogenous MnSOD enhancer, as well as distinct effects on MnSOD transcription. C/EBP is expressed as three protein isoforms, LAP* (liver activating protein), LAP and LIP (l iver inhibitory protein). My functional analysis demonstrated that only the full length C/EBP /LAP* served as a transcriptional activator for MnSOD, while LAP, LIP and C/EBP functioned as potential re pressors. Finally, my systematic mutagenesis of the unique N-terminal 21 amino acids further solid ified the importance of LAP* in the induction of MnSOD, and emphasized the cruc ial role of this isoform. During essential amino acid deprivation, MnSOD expression is induced by the transcription factor Forkhead box O3a (FOXO3a) through a dauer binding element (DBE) like 12

PAGE 13

13 sequence in the distal promoter FOXO3a expression was then demonstrated to be upregulated by amino acid deprivation as well and requires the activating transc ription factor 4 (ATF4) which probably functions through the amino acid re sponse element (AARE2) region. Histidine limitation triggers the specific recruitment of RNA polymerase II to the FOXO3a AARE2 region in an ATF4-dependent manner. General transc ription factors (GTFs) enrichment was also observed on the AARE2 region, suggesting the AARE2 region of FOXO3a may function as a nucleation center for pre-ini tiation complex (PIC) assembly.

PAGE 14

CHAPTER 1 INTRODUCTION Reactive Oxygen Species, Oxidativ e Stress and Antioxidant Enzymes Reactive oxygen species (ROS) such as superoxide (O2 ), hydroxyl radical (OH), nitric oxide (NO) and hydrogen peroxide (H2O2) are generated by a variety of processes in cells. The main source of endogenous ROS is mitochondri a converting 0.1% of consumed oxygen into superoxide anion (O2 ) (Fridovich, 2004), which is a very significant amount. ROS are also produced in large amounts by activated phagocyt es during oxidative burst to eliminate environmental pathogens. A range of external stimuli, including UV li ght, ionizing radiation, environmental toxins, inflammatory response, hyperthermia and chemotherapeutic drugs, contribute to the formati on of oxidants as well. ROS have dual roles as both beneficial a nd deleterious in cellular physiology. When produced at low levels, ROS are be neficial for their participati ons in cellular defense against infectious agents and their func tions in a number of cellular signaling systems. The deleterious effect, termed oxidative stress, occurs when there is an overproduction of ROS, because the excessive ROS can damage DNA, lipids and prot eins (Clark and Lambertsen, 1971; Halliwell and Chirico, 1993; Stadtman, 1995), which has been implicated in a number of human diseases and the aging process. Thus, it is extremely im portant for the organism s to achieve a delicate balance between the beneficial and harmful effects of ROS. Exposure to ROS from a variety of sources led organisms to develop a series of defense mechanisms to detoxify ROS, which belong to two major categories: enzymatic and nonenzymatic. Enzymatic antioxidant defenses in clude superoxide dismut ase (SOD), glutathione peroxidase (GPx), and catalase (CAT). Non-en zymatic antioxidants are represented by ascorbic acid (Vitamin C), -tocopherol (Vitamin E), glutathione (GSH), carotenoids, flavonoids, and 14

PAGE 15

other antioxidants. They are cap able of neutralizing or transfor ming particular ROS species and altogether maintained redox home ostasis in living organisms. Superoxide Dismutases Superoxide is produced mainly in mitochondria but also in microsomes and nuclei (Aust et al., 1972; Patton et al., 1980); in addition, superoxide is produced during auto-oxidation of many biological compounds by NADPH oxidase at the plasma membrane of inflammatory cells (Jackson et al., 2004; Mi sra and Fridovich, 1972). Superoxide has been implicated in the pathophysiology of a variety of diseases. Superoxide dismutases (SODs) reduce oxidative stress by converting superoxide radical to hydrogen peroxide and oxygen: 2O2 + 2H+ H2O2 + O2. Catalase in peroxisomes and glutathione peroxidase (GPx) in mitochondria and cytosol then detoxify the hydrogen peroxide into water and oxygen (del Rio et al., 1992; Drin gen et al., 2005). Eukaryotic SODs fall into three types based on the metal co-factor in the enzymes active centers and their locations, the cytoplasmic copper/zinc SOD (CuZnSOD) (M cCord and Fridovich, 1969), the mitochondriallocalized manganese SOD (MnSOD), and the extracellular CuZnSOD (ECSOD) (Marklund, 1982), as shown in Table 1-1. Manganese Superoxide Dismutase (MnSOD) The mitochondrial electron transport chain is one of the predominant sources of superoxide radical in mammalian cells under normal conditions. The main sites of O2 formation are complex I (NADH dehydrogenase) and III (ubi quinone-cytochrome c reductase) of the respiratory chain (Turrens, 1997). Superoxide levels [O2 ] in cells are estimated at an approximate concentration of 1.0 10-11 M (Korshunov et al., 1997). As a consequence of its mitochondrial localization, MnSOD is considered to be extremely important in the defense against the damaging effects of superoxide radicals. 15

PAGE 16

Physiological Importance of MnSOD MnSOD has been proven to be essential for surv ival from oxygen toxicity. Inactivation of MnSOD in E. coli promotes mutation rates under aerobic conditions (Farr et al., 1986); MnSOD inactivation in Saccharomyces cerevisiae causes growth inhibition following exposure to oxygen (van Loon et al., 1986); and in mice, pre-expos ure to a sublethal dose of oxygen leads to increased MnSOD activity, which makes mice survive longer in 100% oxygen (Crapo and Tierney, 1974). Moreover, transgenic mice w ith human MnSOD overexpression in lung show increased protection from lung injury and surv ive longer than nontransgenic littermates when exposed to hyperoxia (Wispe et al., 1992). MnSOD has also been shown to protect cells against agents and conditions that cause oxidative stress and/or apoptosis. Overexpre ssion of MnSOD in a human embryonic kidney cell line (HEK 293) confers increased resistance to ap optosis induced by tumor necrosis factor alpha (TNF) in the presence of cycloheximide (Wong et al., 1989); MnSOD overexpression in a mouse fibroblast cell line endows these cells with increased re sistance to paraquat-induced cytotoxicity (St Clair et al., 1991); overexpression of MnSOD in insulinoma cells prevents IL1 -induced cytotoxicity and reduces nitric oxide production (Hohmeie r et al., 1998); MnSOD overexpression in neuronal cells protects neuron s from NMDA and nitric oxide mediated cell toxicity (Gonzalez-Zulueta et al., 1998); in addition, numerous st udies have demonstrated that elevated levels of MnSOD are able to protec t cells from radiation damage (reviewed in Greenberger and Epperly, 2007). These findings reinforce the cytoprotective activity of MnSOD in models of inflammatory responses where cy tokines are over-produce d and ROS levels are elevated. MnSOD enzymatic activity confers tu mor suppression as well (reviewed in Oberley, 2005), and decreases in MnSOD le vels are related to aging a nd neurodegenerative diseases. 16

PAGE 17

The most striking and convincing evidence for the importance of MnSOD in health and survival came out from several MnSOD knockout mouse models. Sod2tm1csf (Li et al., 1995) homozygous MnSOD knockout mice on CD1 background died within 8 days of birth due to dilated cardiomyopathy. These mice also showed the symptoms of lipid accumulation in liver and skeletal muscle, and metabolic acidos is. Another homozygous knockout mouse model Sod2tm1BCM (Lebovitz et al., 1996) is on the B6 background, and those mice die at about 18 days, associated with: an injury to mitochondria; dege neration of neurons in ganglia and brainstem; damage to cardiac myocytes; severe anemia ; and progressive motor disturbance. The heterozygous MnSOD knockout mice showed increased oxidative stress a nd cancer incidence, but have normal life span unless stressed. However, homozygous knockout mice for the cytosolic or extracellular CuZnSOD devel op and survive normally without apparent abnormalities unless they are stressed (Carlsson et al., 1995; Reaume et al., 1996). For quite a while after its di scovery, MnSOD appeared to be an enzyme that could not possibly have a bad side, then, research came out that in mammalian cells, overexpression of MnSOD was very protective up to a point, beyond wh ich protection was lost and injury was even exacerbated, and overexpression of SOD beyond six fold may even be lethal due to improper lipid peroxidation (Nelson et al., 1994; Omar and McCord, 1990). Transcriptional Regulation of MnSOD MnSOD is encoded by nuclear DNA, and the ma ture protein localized at mitochondrial matrix. The genomic structure of MnSOD is essentially conserved among mammalian species. The rat, mouse and human MnSOD genes all cont ain 5 exons separated by 4 introns (DiSilvestre et al., 1995; Wang et al., 1994). Alternative polyadenylation of MnSOD mRNA occurs in all these three species, and in rat leads to five si zes of mRNA (Hurt et al., 1992) (Figure 1-1). MnSOD proteins share a greater than 89% identity with each other at the protein level (Jones et 17

PAGE 18

al., 1995), and a more divergent mitochondrial lead er sequence targets th e precursor MnSOD to the mitochondrial matrix (Ho and Crapo, 1988) Passage through the outer and inner mitochondrial membranes in conjuction with the cl eavage of the leader se quence result in the maturation of this matrix localized enzyme. MnSOD is highly regulated at the transcriptiona l level to exert its cytoprotective role, and is induced in a variety of mammalian cells by lipopolysaccharide (LPS), tumor necrosis factor alpha (TNF ), interleukins 1 alpha and beta, interleukin-6 (IL-1 IL-1 IL-6), and interferon gamma (IFN), as has been shown by multiple laborator ies (Kifle et al., 1996; Rogers et al., 2000; Rogers et al., 2001; Valentine and Nick, 1992; Visner et al., 1991; Visner et al., 1990; Wong and Goeddel, 1988; Wong et al., 1991). When treated with actinom ycin, a transcription inhibitor, the induction of MnSOD by pr o-inflammatory mediators LPS, TNF and IL-1 could be blocked indicating de novo transcription. Nuclear run-on assa ys further confirmed that this stimulus-dependent increase in MnSOD expression was due in major part to de novo transcription (Hsu, 1993). The transcription of MnSOD is also upregul ated in human hepatoma cell line (HepG2) by the deprivation of a single essential amino aci d, histidine (Aiken et al., 2008), where the induction of MnSOD requires signals dependent on the tricarboxylic acid cycle and the electron transport chain and is mediated through a func tional mitochondrial membrane potential but not ATP levels. In addition, the activ ation of MEK/ERK and mTOR kina se is also required for the induction of MnSOD by essentia l amino acid deprivation. Chromatin architecture of MnSOD Though MnSOD promoters from different mammalian species show great divergence in sequences (Meyrick and Magnuson, 1994), they do sh are some characteristics. For example, they do not possess TATA or CAAT boxes, and th ey are GC-rich regions containing multiple 18

PAGE 19

specificity protein 1 (Sp1)-binding sites which are essential for basal tran scription of MnSOD. Throughout the rat MnSOD gene (F igure 1-1), 7 DNase I hypersensi tive (HS) sites have been identified, with one in the promoter region and the other six within the MnSOD gene. With a high resolution DNase I HS analysis of the first si te, Dr. Hsu in our laboratory identified five HS subsites, among which, one HS subsite only appear ed after exposure to proinflammatory stimuli (LPS, TNFand IL-1 ) (Hsu, 1993). The minimum promoter was further characterized by in vivo footprinting, which identified 10 putative constitutive protein binding sites as well as two stimulus enhanced guanine residues (Kuo et al ., 1999). Moreover, these 2 guanine nucleotides are in the center of a N F-IL6 like sequence (Kuo, 1998), ba sed on the NF-IL6 consensus sequence identified by Akira et al. (Akira et al., 1990) By utilizing a series of human growth horm one (hGH) reporter constructs coupled with transient transfection in L2 cells, Dr. Rogers in our laboratory identified the enhancer element responsible for MnSOD induction by proinflammatory stimuli to be in the second intron, and he narrowed it down to a 260-base-pai r region (Rogers et al., 2000). A longer enhancer fragment containing the minimal 260bp can also function with a heterologous promoter, the herpes-virus thymidine kinase (TK) promoter, in an orientat ion independent manner. The importance of this intronic enhancer is further supported by its high identity am ong mammalian species (Figure 12). In vivo footprinting has also been performed in the mouse (Jones et al., 1997) and rat (Rogers et al., 2000) enhancer region, a nd several guanine and adenine residues exhibit altered DMS reactivity, indicating multiple putative inducible protein binding sites. However, this intronic enhancer does not cont ribute to the response elicited by amino acid limitation (Aiken et al., 2008). And by couplin g mutagenesis with growth hormone reporter assay, Dr. Aiken in our laboratory determined that a FOXO-regulatory element in the promoter 19

PAGE 20

region, instead of the cytokine responsive enhancer in the second intr on, is associated with histidine deprivation-dependent MnSOD induction. Transcription factors regulating MnSOD The MnSOD promoter and enhancer regions ha ve been demonstrated to contain both constitutive protein bind ing sites and inducible protein cont act sites. Efforts were made by different groups to identify the proteins necessa ry for cytokine induction of the MnSOD gene. A new technique, Pin Point was applied by Dr. Kuo (Kuo et al., 2003) in our laboratory to the promoter region of MnSOD, and verified 3 Sp1 binding sites out of 10 put ative sites identified by in vivo footprinting. Through site-dir ected mutagenesis, 2 of them were determined to be functionally important. The Boss laboratory also reported the involvement of Sp1 by studies in mouse embryonic fibroblast cells from Sp1 knoc kout mice (Guo et al., 1999). Computer-based sequence analysis together with electrophoretic mobility shift assay (EMSA) have indicated the potential involvement of transc ription factors CCAAT enhancer binding protein beta (C/EBP ) and nuclear factor kappa B (NFk B) through the intronic enhancer during the stimulus-dependent up-regulation of MnSOD transcription (Jones et al., 1997; Maehara et al., 2000; Maehara et al., 1999), and later confirmed respectively by C/EBP and p65/Rel A knockout mouse embryonic fibroblasts (MEF); however, the mechanis ms have not been studied in detail. By utilizing Site 1 in Figure 1-2 to perform a yeast One-Hybrid (Inouye et al., 1994; Lin et al., 1993) to screen a human brai n library, Dr. Chokas in our la boratory identified p65/Rel A, transcription enhancing factor 1 and 3 ( TEF-1 and TEF-3) (Chokas, 2004). Her study demonstrated that only p65/Rel A subunit but no t the p50 subunit of NFkB was responsible for IL-1 -dependent induction of MnSOD. Overexpre ssion of p65 alone slightly enhanced MnSOD expression and cotransfection with TEF led to a significant increase in MnSOD expression. She also determined that TEF is a binding partner of p65. However, TEF-dependent up-regulation of 20

PAGE 21

MnSOD was not related to proinflammatory stimu li, instead, TEF may f unction in coordinate with p65 to induce MnSOD expression during embryo development. Site 2 in Figure 1-2 was also utilized to perform yeast One-Hybrid analysis where three copies of this region were employed as bait to screen a rat lung cDNA library originally obtained from Clontech and subsequently amplified for the screening (Inouye et al., 1994). Positive clones for the transcription factors p65, C/EBP and C/EBP were identified, and the mechanism of the regulation of MnSOD by C/EBP and C/EBP during cytokine response is the main focus of this dissertation. When starved for glucose or essential amino acid, MnSOD is upregulated by another set of cis-regulatory element and transc ription factors to protect cells from nutrient limitation-induced apoptosis (Aiken et al., 2008; K ops et al., 2002). FOXO protein, probably FOXO3a is one of the key factors in this process. The CCAAT Enhancer Binding Protein (C/EBP) Family C/EBP proteins are a subfamily of the la rger bZIP (basic region/leucine zipper) transcription factor family. To date, six C/EBP members have been identified and cloned from several species in different labs with different names, and a systematic nomenclature was proposed by Cao and co-workers (Cao et al., 199 1) in which members are designated as C/EBP followed by a Greek letter indicating the chr onological order of their discovery (C/EBP , and ). Among these C/EBP genes, C/EBP and contain no intron, whereas C/EBP and contain two and four exons, respectively (Ramji and Foka, 2002). The C/EBP subfamily members share noteworthy sequence identity in th e C-terminal bZIP domain, which consists of basic-amino-acid-rich DNA bindi ng region (basic region) followed by a dimerization motif termed the leucine zipper, which is characteri zed by a heptad repeat of four or five leucine residues that pack toge ther in a parallel -helical coiled coil. Because of the high conservation in 21

PAGE 22

the bZIP domain, different C/EBP proteins ar e capable of forming heterodimers with all intrafamilial combinations with the exception of C/EBP (Ron and Habener, 1992), at least in vitro. These family members are believed to bind to an identical canonical RTTGCGYAAY sequence (Osada et al., 1996), wher e R is A or G, and Y is C or T. In addition, the C/EBPs can form proteinprotein interactions with other bZIP and non-bZIP factors. For example, C/EBP has been shown to interact with p50 and p65 subunits of NFkB, CREB/ATF, AP-1, and the glucocorticoid receptor. Such he terodimers often have different transactivation potential and/or DNA binding specificity or affinity compared with the corresponding homodimer (Hsu et al., 1994; LeClair et al., 1992; Lekstrom-Himes and Xanthopoulos, 1998; Ray et al., 1995; Vallejo et al., 1993). Different C/EB P members function specifically thr ough collaboration, but some level of redundancy is also believed to exist (reviewe d in Nerlov, 2007). The C/EBPs perform critical roles in a variety of physiological and pathophysiological processes, such as cell differentiation, metabolic regulation, cell prolif eration and inflammation (Lekstrom-Himes and Xanthopoulos, 1998; Nerlov, 2007; Ramji and Foka, 2002). CCAAT Enhancer Binding Protein (C/EBP ) and (C/EBP ) C/EBP is expressed in various tissues and its constitutive expression is particularly high in the liver, intestine, lung, ad ipose tissue, spleen, kidney and my elomonocytic cells (Akira et al., 1990; Cao et al., 1991; Chang et al., 1990; Descombes et al., 1990; Poli et al., 1990). Despite the fact that the C/EBP gene contains no introns, it can pr oduce three protein is oforms, full-length LAP* (liver activating protein) medium-length LAP and a short form, LIP (liver inhibitory protein), mainly by translation from three in-f rame AUGs within the same mRNA (Descombes and Schibler, 1991). In addition, C/EBP contains an internal out-of-frame AUG (Timchenko et al., 1999), which can be bound by CUG triplet rep eat binding protein 1 (CUGBP1) (Timchenko et al., 2005; Timchenko et al., 1999) and calreticulin (CRT) (Iakova et al., 2004) to enhance or 22

PAGE 23

block the translation of LIP re spectively. These two RNA binding proteins compete to interact with C/EBP mRNA and thereby regulate the ratio of LAP to LIP. In addition, it was reported that LIP can be produced via C/EBP dependent proteolytic cleava ge of LAP* as well (BurgessBeusse et al., 1999; Timchenko et al., 1999). C/EBP doesnt contain any introns and has one protein form (Figure 1-3), which is different from C/EBP C/EBP is highly expressed in adipose tis sue, lung and intestine, as well as in osteoblasts, where its transcription has been shown to be induced by Runt domain factor 2 (Runx2) (McCarthy et al., 2000). The activity and/or expression of C/EBP and C/EBP are regulated by a number of inflammatory agents including lipopolysaccharide (L PS) and a range of cytokines. For example, IL-1, IL-6 and LPS induce C/EBP and C/EBP expression (Akira et al., 1990; Alam et al., 1992). TNF promotes nuclear localization of C/EBP and C/EBP in response to inflammatory stress in hepatocytes (Yin et al., 1996). Cytokine stimulation further increases C/EBP transcriptional activity by enhanced DNA binding (P oli et al., 1990) and increased transcriptional activity contributed by post-trans criptional modifications, mainly phosphorylation (Akira et al., 1990; Trautwein et al., 1993) and a cetylation (Cesena et al., 2007). Several lines of evidence suggest that C/EBP is regulated by phosphorylation as well and, in conjunction with C/EBP is one of the major proteins responsible for the increased transcription of the serum amyloid A (SAA) gene in response to inflammatory stimuli (Ray and Ray, 1994). Among the papers dealing with C/EBP transcriptional activities more than 99% percent of reports treat LAP* and LAP as a unit, and only a few papers touched upon the difference between these two isoforms of C/EBP For example, it has been re ported that the N-terminal region unique to LAP* is essential for SWI/SN F complex recruitment (Kowenz-Leutz and Leutz, 23

PAGE 24

1999), LAP* sumoylation (Eaton and Sealy, 2003) interactions with Homer 3 (Ishiguro and Xavier, 2004),and formations of a distinct internal di sulfide bonds (Su et al ., 2003). All of these circumstances may endow LAP* w ith a divergent transcriptional activity compared to LAP thus affecting the ultimate regulation of specific genes, unique to each isoform. Forkhead Box O (FOXO) The forkhead superfamily of transcription fact ors ranging from class A to class S, shares a highly conserved DNA binding or FOX (F orkhead box ) domain. The class O subfamily (FOXO) members are conserved from worms to mammals. Until now, only one FOXO gene (termed DAF-16 in C. elegans and dFOXO in Drosophila) (Lin et al., 1997) has been identified in invertebrates, whereas mammals have four FOXO family members: FOXO1 (FKHR) (Galili et al., 1993), FOXO3a (FKHRL1) (Hillion et al., 19 97), FOXO4 (AFX) (Corral et al., 1993) and FOXO6 (Jacobs et al., 2003). The C. elegans ortholog of FOXO, DAF-16, was identified as a controlling factor in the entrance to the reversible daue r status (Kenyon et al., 1993), which is characterized by the formation of impermeable cuticl es and a reduction in metabolic rate. When there are abundant nutrients, DAF-2, a homolog of mammalian insu lin/ insulin-like grow th factor-1 (IGF-1) receptor is activated which in turn triggers targeted phosphorylation of DAF-16, leading to its sequestration in the cytoplasm, and inability to activate its nuclear targ et genes (Murakami and Johnson, 1996; Ogg et al., 1997). On the contra ry, limitation of nutrients leads to DAF-16 dephosphorylation and subsequent shuttling into the nucleus where target genes become activated. The activation of DAF-16 regulated genes then facil itates dauer formation, endowing the worm with resistance to stress and extension in life span. Such func tions are abolished when DAF-16 is mutated (Lin et al., 1997). In Drosophila, overexpression of dFOXO caused 24

PAGE 25

decreases in cell size and cell number (Kramer et al., 2003), which is very similar to starvation, suggesting that dFOXO plays a ro le in nutrient sensing, simi lar to that observed in C. elegans In mammalian species, the FOXO family proteins have distinct expression patterns with certain overlaps in mouse development and adul t tissues. During mouse development, FOXO1 is dominantly expressed in adipose tissues, FOXO3 a mostly in the liver, FOXO4 in the skeletal muscle, and FOXO6 in the central nervous system (Furuyama et al., 2000; Hoekman et al., 2006; van der Heide et al., 2005). In adult mice, the highest level of FOXO1 is detected in adipose tissue, uterus and ovaries. FOXO3a is more ubiqu itously expressed with pa rticularly high levels in brain, spleen, heart and ovaries. FOXO4 is highly expressed in skeletal muscle, cardiac muscle and adipose tissues. FOXO6 is expressed almost exclusively in the adult brain (Hoekman et al., 2006; Jacobs et al., 2003). FOXO proteins participate in regulation of the cell cycle, apoptosis, DNA repair, and detoxification. The primary and most char acterized regulation of FOXO1, O3a and O4 localization and transcripti onal activity is Akt/PKB-dependent phosphorylation. Newly synthesized or when growth signa ls are absent, FOXO travels into the nucleus via its NLS, binds to its cognate sites in target ge nes, and modulates gene expression. In response to growth factors or insulin stimulation, FOXO (Thr32, Ser253 and Ser315 for human FOXO3a) is phosphorylated by activated Akt/PKB followed by binding to 14-33 proteins facilitating nuclear export (Figure 1-4). This results in the releas e of the FOXO protein from its ta rget genes and the loss of its transcriptional activity (Brunet et al., 1999; Brunet et al., 2002; Brunet et al., 2001; Kops and Burgering, 1999; Kops et al., 1999). In additi on, FOXO proteins can be monoubiquinated (van der Horst et al., 2006), acetylated by CBP, p300 a nd/or PCAF (Daitoku et al., 2004; Fukuoka et 25

PAGE 26

al., 2003), and/or deacetylated by th e Sir2/Sirt family deacetylases (Brunet et al., 2004; Motta et al., 2004; Wang et al., 2007) to regulate its lo calization and function under various conditions. Altering FOXO protein levels, which is mainly regulated at the transcription level, also has dramatic effects. It has been reported that FOXO1/3a mRNA levels was increased in rat muscle and liver after fasted or caloric ally restricted for 48 h (Furuyama et al., 2002; Imae et al., 2003), suggesting that nutrient depriva tion may elicit the transcriptiona l induction of FOXO genes. However, the mechanisms have not been identified yet. Forkhead Box O3a (FOXO3a) Dr. Aiken in our lab previous ly identified a FOXO-binding site in the MnSOD promoter responsible for gene induction following histid ine deprivation for the MnSOD in HepG2 cells (Aiken et al., 2008). We therefore hypothesized that this family of transc ription factors may also be regulated by essential amino acid deprivation. A closer examination determined that among the FOXO subfamily members, only FOXO3a is induced at the mRNA level by histidine depletion. The functional importance of Foxo3a is clearly demonstrated by a series of mouse models. Castrillon et al. reported that mice with Foxo3a gene ablated develope d without incidence and displayed similar weight gain comparable to their littermates. However, Foxo3a-/female mice experienced global premature ovarian follicle acti vation leading to early follicle depletion and oocyte death (Castrillon et al., 2003). Add itional work by Liu et al (Liu et al., 2007) demonstrated that overexpression of Foxo3a cause d retardation in oocyte growth and follicular development, as well as anovulation. These two reports coordinately suggested the specific role of Foxo3a in oocyte and follicular development. Human FOXO3a is localized to chromosome 6q21 and is a large gene, covering a region of more than 130 kb. Most studies on FOXO3a ar e related to its post-tr anslational modification, 26

PAGE 27

while the molecular mechanisms controlling the regulation of FOXO3a gene expression are totally unknown. Ever since th e observation of the transcriptional upregulation of FOXO3a by histidine deprivation in our lab, we have been investing our effo rts in the study of the molecular mechanism during this process. By an siRNA a pproach, Dr. Aiken in our lab demonstrated that the induction of FOXO3a transcription is depend ent on a transcription factor called activating transcription factor 4 (ATF4). This factor is best known for its involvement in stress responses, such as amino acid response (AAR) through an AAR element (AARE) with the consensus sequence of 5-TGATGXAAX-3 as the core (revi ewed byKilberg et al., 2005). Computer based sequence analysis identified 4 potential AARE within or near the FOXO3a gene (Refer to Chapter 5, Figure 5-1). The observations above altogether led to our efforts in the identification of the response element contro lling FOXO3A gene expression duri ng histidine limitation and the study of the role of this internal regulatory element in the recruitment of RNA polymerase II, which is presented Chapter 5. 27

PAGE 28

Table 1-1. Comparison of eukar yotic superoxide dismutases SOD MW (kDa) No. of subunits Metal in active centers Cellular localization CuZnSOD 32.5 2 2 Cu2+ 2 Zn2+ Cytoplasm, nucleus lysosomes, peroxisomes, mitochondrial intermembrane space MnSOD 88 4 4 Mn2+ Mitochondrial matrix ECSOD 135 4 4 Cu2+ 4 Zn2+ Extracellular matrix (ECM) and cell surfaces 28

PAGE 29

Figure 1-1. Rat MnSOD genomic clone characte rization (adapted from Chokas, 2004). Five exons are depicted by black boxes, and the fi ve rat transcripts shown in the northern insert on the right are due to alternativ e polyadenylation as depicted by the black arrows. Seven DNase I hypersensitive sites are depicted by asterisks throughout the gene. 29

PAGE 30

Site 1 Site 2 Figure 1-2. Alignment of MnSOD Intron 2 from Rat, Human, Chimpanzee and Mouse. Shaded nucleotides illustrate identity across species, and underlined sequences, namely Site 1 and Site2 were utilized for Y east One-Hybrid analysis. 30

PAGE 31

Figure 1-3. Schematics of C/EBP and C/EBP genomic/mRNA and protein structures. Translation start sites (M1, M22 and M153) are indicated by arrows. The activation domains (AD) and negative regulatory dom ains (RD) are shown in hatched and meshed boxes respectively and the black box depicts the domain of importance to the present studies. The bipartite basic leuc ine zipper domain (bZIP) is depicted by boxes with vertical lines. 31

PAGE 32

32 Figure 1-4. Regulation of FOXO localization and activity (Adapted from Birkenkamp and Coffer, 2003). Addition of grow th/survival signals result s in activation of PKB by PI3K, which then translocates into the nucleus. Phosphorylation of FOXO by PKB results in release from DNA, and binding to 14-3-3 proteins. This complex is then transported out of the nucleus, where it remains inactive in the cytoplasm. Upon removal of growth/survival signals, F OXO is dephosphorylated, 14-3-3 is released, and FOXO is transported back into the nucle us where it is transc riptionally active.

PAGE 33

CHAPTER 2 MATERIALS AND METHODS Materials Restriction endonucleases, T4 DNA Ligase, Klenow (the large fragment of E. coli DNA Polymerase), T4 Polymerase and Pfu Polymerase were purchased from New England Biolabs. Zeta-Probe blotting membrane (126-0159) TransBlot Transfer Medium (162-0115), Criterion 10.5-14% precast Tris-HCl gel (345-9949), and iTaq SYBER Green Supermix with ROX (170-8851) were purchased from Bio-Rad. Normal rabbit a nd mouse IgG (sc-2027, sc-2025), antibodies against C/EBP C-terminus (sc-150, recognize s LAP*, LAP and LIP), C/EBP (sc151), HA tag (sc-7392) and TFIIB (sc-225) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). LAP* antibody (ab18327) was pur chased from Abcam Inc (Abcam Inc, MA). Pol II CTD-Ser5-P antibody (H14, MMS-134R) was purchased from Covance (Covance, CA). QIAquick Nucleotide Removal kit (28304), QIAquick Gel Extraction kit (12162), QIAquick PCR purification kit (28106), QIAprep Spin Mini prep kit (27106), Qiagen Plasmid Midi kit (12144), and Qiagen Plasmid Maxi kit (12162), RN easy mini kit (74106), and Ni-NTA spin kit (31314) were purchased from Qiagen. Protei n A Sepharose CL-4B (17-0780-01), Protein G Sepharose (17-0618-02), Hybond-ECL Nitrocellulo se membrane (RPN68D), Hyperfilm MP (RNP 1677K, RNP30H), and ECL Western Bl otting Analysis System (RPN2108) were purchased from Amersham Biosciences (GE H ealthcare, UK). 1 Kb Plus DNA Ladder (10787018), Random Primers DNA Labeling System (18187-013), TOPO XL PCR Cloning Kit (K4750-10) and SuperScript first strand synt hesis kit (12371-019) were purchased from Invitrogen Technologies. Fugene6 transfec tion reagent (1-815-091), Interleukin 1 (IL-1 ) and complete protease inhibitor cocktail (1-697-498) were purchased from Roche technologies. The rat C/EBP siRNA (M-092218-00), cyclophilin B si RNA (D-001136-01), and DharmaFECT 1 33

PAGE 34

transfection reagent (T-2 001-01) were purchased from Dharm acon, Inc. (Lafayette, CO). QuikChange Site-Directed Muta genesis Kit with XL-10 compet ent cells (200518) was purchased from Stratagene. Methods Cell Culture L2 cells, a rat pulmonary epithelial-like ce ll line (A.T.C.C. CCL 149), were grown in Ham's modified F12K medium (Sigma, MO) with 10% (v/v) fetal bovine serum (FBS) (Gibco, NY), 1X ABAM [penicillin G (100 units/mL), st reptomycin (0.1nmg/mL), amphotericin B (0.25 g/mL)] (Gibco, NY) and 4 mM glutamine at 37C in incubators supplied with 5% CO2. Wild type and C/EBP -deficient ( -/-) mouse embryonic fibroblasts (M EF), were provided by Dr P. Johnson, NIH via Dr. Michael Kilberg. Both MEF cell lines were grown in DMEM media (Sigma, MO) supplemented with 4 mM glutamine, 1X ABAM and 10% (v/v) FBS. 2 ng/mL of IL-1 (R&D Systems Inc, NM) was used to treat cells for indicated times. HepG2, a human hepatoma cell line was cultured in Eagles MEM (minimal essential medium) (Mediatech, Herndon, VA), supplemented with 4 mM glutamin e, 1X ABAM and 10% (v/v) FBS. Cell cultures were replenished with fr esh medium and serum 12 h prior to all treatments to ensure that the cells were in the basal (fed) state. 2 mM HisOH (histidinol) was used to treat HepG2 cells mimicking histidine deprivation. Recombinant Plasmid Construction Coding sequence for each C/EBP isoform was cloned into pcDNA3.1 (Invitrogen) using the EcoR V and Hind III sites. C/EBP cDNA was originally obt ained from the One hybrid library screening of the Clontech rat lung cDNA library and subcloned from the pACT2 vector (Clontech) into pcDNA3.1 Hind III and Xbal I s ites. The rat reporter construct (MnSOD promoter/enhancer-hGH) (Rogers et al., 2000) contains a 919 bp MnSOD enhancer fragment 34

PAGE 35

(+1278 +2196) and a 2.5 kb MnSOD promoter fr agment (-2489 +42) in the otherwise promoter less, pUC12-based hGH expr ession vector (Selden et al., 1986). Site-Directed Mutagenesis Mutagenesis was performed with a Quik change Site-Directed Mutagenesis Kit (Stratagene). Briefly, 25 ng of the C/EBP construct was used as th e template. 125 ng of each mutagenesis primer, 5 L 10X reaction buffer, 1 L dNTP mixture, 3 L dimethyl sulfoxide (DMSO) and 1 L Pfu enzyme were added, and H2O was used to bring the final volume to 50 L. A PTC 100 peltier thermal cycler was use with the following parameters: Cycle 1 (95 oC for 30 sec) X 1 cycle. Cycle 2 (95 oC for 45 sec, 60oC for 45 sec, 68oC for 14 min) X 18 cycles. The reaction was quenched by incubating on ice for 2 min and 1 L of Dpn I was added to remove the parental strand, leaving only the mu tated desired product which was subsequently transformed into XL-10 gold competent cells and incubated on a plate with ampicillin. From the resulting colonies, the plasmids were isolated and sequenced for verification. The insertion of HA tag to the pLAP* C-terminus was also done by Quikchange site-directed mutagenesis kit using primers 5-CTCGGCGGGTCACTGCTACCCATACGACGTCCCAGACTACGCTTAGA AGCTTAAGTTTAAACCGC-3, and 5-GCGG TTTAAACTTAAGCTTCTAAGCGTAGTCTG GGACGTCGTATGGGTAGC AGTGACCCGCCGAG-3. RNA Isolation, Northern Analysis and Statistical Analysis Total cellular RNA was isolated by the acid guanidinium thiocyanate (GTC) extraction method described by Chomczynski and Sacchi (Chomczynski and Sacchi, 1987)with modifications (Visner et al., 1990) Briefly, cells were grown to desired confluency or after indicated treatment, washed once with room temperature PBS, followed by the addition of 0.5 mL of GTC solution (4 M GTC, 25 mM sodium citrate pH 7.0, 0.5% sarcosyl, and 0.1 M 2mercaptoethanol) per 100 mm plate, and 0.1 vol ume of 2 M sodium acetate pH 4.0, an equal 35

PAGE 36

volume of water saturated phenol and 0.2 volumes of chloroform: isoamyl alcohol (49:1) was added to the homogenate. The final mixture was centrifuged at 14,000 rpm for 20 min at 4C. The aqueous phase was then removed to a set of new tubes, followed by the addition of an equal amount of isopropanol and incubation at -20C fo r 30 min. The lysate was then centrifuged at 14,000 rpm for 10 min at 4oC and the RNA pellet was resuspended in 75 L diethyl pyrocarbonate (DEPC) treated double distilled water. 25 L of 8 M lithium chloride (LiCl) was then added, mixed and incubated at -20 C for 30 min. The RNA was precipitated by centrifugation at 14,000 rpm for 20 min at 4C, wash ed once with 70% ethanol, dried in a Savant speed-vacuum centrifuge and resuspended in 100 L DEPC water. RNA concentrations were determined by the absorbance at 260 nm with a Beckman DU-64 Spectrophotometer (Beckman Instruments, Inc.). A total amount of 10-15 g RNA was denatured and frac tionated on 1% agarose, 6% formaldehyde gels, electro-transferred to a Zeta-Probe nylon blotting membrane from BioRAD (162-0159) and UV cross-linked. Membra nes were then incubated for 1 h in a prehybridization buffer consisting of 0.45 M s odium phosphate, 6% sodium dodecacyl sulfate (SDS), 1 mM EDTA, and 1% bovine serum al bumin (BSA). The membranes were then incubated overnight at 61C in the same hybridization buffer with a 32P radio-labeled gene specific probe for MnSOD, C/EBP C/EBP human growth hormone (hGH), or Cathepsin B (Cath B), generated by random primer extension. The membrane was then washed three times for 10 min at 66C in a high stringency buffer composed of 0.04 M sodium phosphate, 2 mM EDTA, and 1% SDS and then exposed to film (Amersham, Piscataway). Densitometry was performed by direct scanni ng of the original autoradiograph with a Microtek scan maker 9600XL and analyzed with the UN-SCAN-IT program (Silk Scientific 36

PAGE 37

Corporation, version 5.1). Growth hormone expr ession levels were normalized to the internal control, Cathepsin B (Cath B), and the hGH/Cath B ratio derived from the control transfection without treatment was set to 1. Statistical analysis was derived from a minimum of 3 independent experiments. The errors are presente d as the standard error of the means (SEM) and comparisons were performed using a Students t Test. An asterisk or a cross denotes the significance as determined by a Stude nts t Test to a value of p 0.05. Generation of cDNA from RNA To generate cDNA for real-time PCR analysis, SuperScript first strand synthesis kit from Invitrogen (12371-019) was used. 1 g of total RNA isolated was used as the template to which the following components were added: 1 L of a 10 mM dNTP mix, 0.5 g of Oligo(dT), and water to bring up to 8 L. This reaction was incubated at 65C for 5 min then placed on ice for 2 min. To this reaction the following was added, 2 L of 10X RT buffer, 4 L of 25 mM MgCl2, 2 L of 0.1 M DTT, and 1 L of RNAseOUT recombinant RNAase inhibitor. The mixture was then incubated for 2 min at 42C, a nd 50 units of SuperScript II RT was added to each reaction and then incubated for an additi onal 50 min at 42C. The reaction was then terminated by incubation at 70C for 15 min and th en incubated on ice for at least 5 min. 2 units of RNase H was then added and in cubated at 37C for 20 min. The sample was then diluted with 79 L of water and stored at -20C. Real-Time PCR For real-time PCR, 2 L of cDNA generated from first strand synthesis (as described above) was used as the template. 0.3 M of each primer, 12.5 L of iTaq SYBER Green Supermix with ROX (Bio Rad, Hercules, CA #170-8851) were added, and water was added to a final volume of 25 L. The Applied Biosystems, Fost er City, CA 7000 sequence detection system was used with the following parameters : Cycle 1 (95C for 10 min) X 1, Cycle 2 (95C 37

PAGE 38

for 15 sec, 60C for 1 min) X 40 cycles. The CT method was used to determine the relative fold changes, normalized to the cyclophilin A gene, and is described by Livak et al (Livak and Schmittgen, 2001). Real-time PCR primers for MnSOD mRNA : sense primer, 5CCGCCTGCTCTAATCA GGA -3, and antisense primer, 5TCCA AATGGCTTTCAGATAGTCA -3; real-time PCR primers for Cyclophilin A mRNA: sense primer, 5GGTGGCAAGTCCATCTACGG-3; and antisense primer, 5-TCACCTTCCCAAAGACCACAT3. Each individual real-time PCR was performed in triplicate with statistics derived from samples of at least three independent experiments. The errors are presented as th e SEM and comparisons were performed using a Students t Test. Total Protein Isolation Total protein lysates were isolated from L2 cells 48 h after transfection with the indicated plasmid. Cells were washed twice wi th ice cold PBS, followed by adding 500 L of RIPA lysis buffer (50 mM Tris-Cl pH 7.4, 150 mM NaCl 1% NP40, 0.25% sodium deoxycholate, 1X Roche complete mini protease inhibitor cocktail). Cells were then incubated at 4C for 30 min with rocking to ensure cellula r lysis, followed by centrifugatio n at 14,000 X g for 15 min at 4C to remove cellular debris. The supernatant was then transferred to pre-chilled 1.5 mL Eppendorf tubes, and either used for immunoblot anal ysis or for immunopr ecipitation. Protein concentrations were determined by the bicinchoni nic acid (BCA) assay in triplicate (Pierce, Rockford, IL). Immunoprecipitation Total cell extracts were prepared in RIPA ly sis buffer at the time points indicated and precleared by incubation with 200 L of Protein A Sepharose beads (50% slurry) at 4 C for 2 h. Then 2 g of C/EBP antibody from Santa Cruz was a dded followed by incubation at 4 C 38

PAGE 39

overnight. Complex capture was completed by in cubating with Protein A Sepharose beads at 4C for 2 h. Complexes were washed 4X with RIPA buffer followed by immunoblot analysis with the antibody specifi cally against LAP*. Nuclear Extraction After IL-1 treatment for the indicate d times, two 150 mm dishes of L2 cells per condition were placed on ice and rinsed tw ice with ice cold PBS. 5 mL of PBS was then added to each plate and cells were scraped into a 15 mL tube The cells were then centrifuged at 514g for 10 min. The PBS was aspirated and th e pellet was resuspended in 900 L of lysis buffer (20 mM HEPES, pH 7.6, 10 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 20% gl ycerol, 0.1 M DTT and 1X protease inhibitor tablet) by pipetting up and down until there were no clumps and transferred to a pre-chilled 1.5 mL Eppe ndorf tube followed by incubation on ice for 15 min. 100 L of a 10% Triton X-100 solution (final concentration was 1%) was a dded, vortexed briefly and the cells were centrifuged at 5200 rpm for 10 min at 4 C. The cytosolic fraction was removed to new 1.5 mL Eppendorf tube to store at -80 C for later use. To each pellet, 500 L of nuclear extraction buffer containing 20 mM HE PES, pH 7.6, 400 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 20% glycerol, 0.1 M DTT and 1X protease inhibitor tablet. The samples were then gently rocked for 2 h at 4 C and then centrifuged for 10 min at 14,000 rpm. The supernatant containing the nuclear extract wa s collected and stored at 4 C for later use. Immunoblot Analysis 10 g of total protein soluti on after transfection or 30 g of nuclear extract or the immunoprecipitate was fractionated on a 10.5-14 % SDS/polyacrylamide gel (Bio-Rad) and transferred to a nitrocellulose Trans-Blot Tran sfer membrane (Bio-Rad). The membrane was then blocked for 1 h with 8% non-fat milk disso lved in a TBST buffer containing 0.1 M NaCl, 39

PAGE 40

10 mM Tris-HCl (pH 7.5), and 0.1% Tween 20 (v/v). The membranes were then incubated with the indicated antibody (LAP* 1:200; C/EBP 1:250; C/EBP 1:250; TFIIB 1:250; HA 1:250) diluted in TBTS with 5% non-fat milk at 4 C overnight, washed 3X with TBST, incubated with secondary antibody (mouse 1:3,000; rabbit 1:15,000) in 5% non-fat milk for 1 h, washed 3X with TBST, and finally subjected to ECL chemiluminescence (Amersham). Transient Transfection L2 cells were cultured as described previ ously and transfected at approximately 60% confluency using a FUGENE 6 transfection reagen t. For protein overexp ression analysis, 5g of indicated plasmid was transfected in 100 mm dishes, and total cell extract was collected 48 h after transfection and subjected to immunoblot analysis. For repor ter assay analysis, 0.2 g of reporter plasmid (MnSOD promoter/enhancer-hGH) 0.5 g of indicated transcription factor construct was used, and empty vector pcDNA 3.1 was used to br ing the total DNA amount to 4 g. 24 h post transfection, the cells were sp lit 1:2, and incubated for another 16 h. IL-1 (R&D Systems Inc, NM) was added to one set of the plat es to a final concentrat ion of 2 ng/mL. After 8 h, total RNA was isolated for northern blot anal ysis. For ChIP analysis, 15 g of pHA-LAP* plasmid was transfected in 150 mm dishes, and cells were fixed with 1% formaldehyde 48 h after transfection. Transfections we re processed as follows: calcu lated amount of FuGENE (FuGENE Reagent: DNA ratio of 3:1, in which L for FuGENE and g for DNA) was diluted in 600 L serum free media for 100 mm dishes or 1 mL for 150 mm dishes, and incubated for 10 min. DNA was then added and the mixture was incubated at room temperature for 20 min and then added to L2 cells. 3 h later, the cells were washed twice with PBS and replenished with fresh media. 40

PAGE 41

Short Interfering RNA (siRNA) Transfection Transfection of L2 cells was done in 35 mm pl ates with 90% confluen cy, and according to the manual (provided by Dharmacon), 6 L of DharmaFECT-1 and a final siRNA concentration of 100 nM was used. L2 cells were treated with transfection reagent for 48 h. One set of plates were then treated with 2 ng/mL of IL-1 for 4 h. Total RNA and protein extracts were isolated and analyzed by reverse transcription followe d by real time PCR or immunoblot analysis, respectively. Transcription Rate Determination Total RNA was isolated from L2 cells at indicated time points after IL-1 treatment using the Qiagen RNeasy kit (Qiagen), including DNase I treatment before final elution to eliminate any DNA contamination. To measure the transc ription rate from the MnSOD gene, primers derived from MnSOD Exon 2 and Intron 2 were us ed for real-time PCR after first-strand cDNA synthesis to measure the unspliced transcript s (pre-mRNA or hnRNA). The primers for MnSOD hnRNA amplification were: sense primer 5TCCCTGACCTGCCTTACGACTA-3; and antisense primer, 5TGCAAACCAACCGAGATA TTCC-3. This procedure for measuring transcription rate is based on what described by Lipson and Base rga (Lipson and Baserga, 1989). Equal amount of RNA before reverse transcription was used as a negative c ontrol to rule out any amplification from any residual genomic DNA, which was always negative. Chromatin Immunoprecipitation (ChIP) L2 cells were grown to 90% confluency on 150 mm plates and cross-linked with 1% formaldehyde for 10 min at room temperature and quenched with 125 mM glycine for 5 min. Cells were then scraped into 50 mL conical tubes, and centrifuged at 3000 rpm for 15 min at 4C. After washed 2X with PBS, cells were resuspen ded in cold swelling buffer (5 mM PIPES pH 8.0, 85 mM KCl, 0.5% NP-40 plus 1X protease inhibitors) and incuba ted on ice for 10 min. Swelled 41

PAGE 42

cells were centrifuged at 5,000 rpm for 5 min at 4C, and the cellular pellet was gently resuspended in 1 mL lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris pH 8.1, and 1X protease inhibitors). The lysates were then sonicated to ~500bp fragments using a Branson Model 500 dismembrator (purchased from Fisher Scientific ) at 40% amplitude for 5X 30 sec bursts with 2 min rest on ice between each burst. Sonicated samples were transferred to 1.5 mL tubes and centrifuged at 13,000 rpm for 5 min at 4C to clear cellular debris. Supernatants were diluted 1:10 in ChIP dilution buffer (0.1% SDS, 1.1% Triton X-100, 1.2 mM ED TA, 16.7 mM Tris pH 8.1, and 167 mM NaCl), and pre-cleared with 500 L of Protein A sepharose beads for 2 h at 4C. Pre-cleared supernatants were th en split to 1 mL aliquots, and 2 g of indicated antibodies were added. After ove rnight incubation, 60 L protein A or G sepharose beads blocked with 30% BSA were added to each tube to capture the complex. After incubation at 4C for 2 h, the complexes were isolated by centrifugation at 1,000 rpm for 2 min and followed by washes once with low salt (0.1% SDS, 1% Triton X-100 (v/v), 20 mM Tris pH 8.1, 2 mM EDTA, and 150 mM NaCl), high salt (0.1% SDS, 1% Trit on X-100, 20 mM Tris pH 8.1, 2 mM EDTA, and 500 mM NaCl), LiCl (250 mM LiCl 1% NP-40, 1% sodium deoxyc holate (DOC), 10 mM Tris pH 8.1, and 1 mM EDTA) and three times with TE ( 10 mM Tris pH 8.0 and 1 mM EDTA pH 8.0). Samples were then eluted with 500 L of elution buffer (1% SDS and 100 mM NaHCO3) with rocking at 37C for 30 min. Eluted samples were centrifuged at 2,000 rp m for 2 min at room temperature, and supernatants were transferred to 1.5 mL tubes. Prior to washing of complexes above, 500 L of IgG control samples was kept aside as INPUT controls. Proteinase treatment of eluted samples and INPUT controls was accomplished by the addition of following solutions to reach the final concentrations of 200 mM NaCl, 11 mM EDTA, 42

PAGE 43

and 44 mM Tris pH 7.0. 2 l of proteinase K (20 mg/mL) was a dded as well to digest protein for 1 h at 45C, followed by reverse cross-link at 65C for 4 h. Samples were then purified with the Qiagen PCR kit and subjected to real-time PCR analysis. The primers for ChIP analysis are listed in Table 2-1. Peptide Delivery Peptide delivery was done with ChariotTM (Active Motif, #30025) in Human fetal lung fibroblast (HFL) cells in 35 mm dishes with 5060% confluency. Indicated amount of synthetic peptide was diluted in 100 L of PBS, and mixed with 1.2 g Chariot which is also diluted in 100 L of PBS. The mixture was incubated at room temperature for 30 min to allow the chariotpeptide complex to form. Then the 200 L of Chariot-peptide complex was added to HFL cells after being washed once with PBS. Cells were overlaid by the complex and 400 L of serumfree media was added to the plates. After 2 h incubation, cells were washed with PBS followed by the addition of regular fresh media and treatment with 2 ng/mL of IL-1 for 2 h. His-Tagged Protein Purification 6 X His-tagged protein constructs were ma de by subcloning indicated cDNAs into the pQE-2 vector from Qiagen in frame with the 6 X His sequence. XL-10 gold cells transformed with pQE-2 His-tagged protein expression vectors were incubate d in 5 mL YT media with 100 g/mL of ampicillin at 37C with sh aking. The lactose analogue isopropyl -D-thiogalactoside (IPTG) was added with a final concentration of 1mM to the bacteria when an A600 reading of 0.60.8 was achieved. After shaking at 37C for a nother 3 h, bacterial cells were harvested by centrifugation at 4000 g for 15 min. Cell pellet was resuspended in 700 L buffer B (7 M urea; 0.1 M NaH2PO4; 0.01 M TrisCl; pH 8.0) with 15 units of benzonase nuclease. Cells were then incubated with agitation for 15 min at room temperature followed by centrifuging at 12,000 g for 15 min at room 43

PAGE 44

temperature to pellet the cellular debris. Ni-NTA spin column was equilibrated with 600 L Buffer B and centrifuged for 2 min at 890 g. The cleared lysate supernat ant containing the 6 X His-tagged protein was loaded onto a pre-equilibrated Ni-NTA sp in column and centrifuged at 270 g for 5 min. The Ni-NTA spin column was then washed 2 X with 600 L Buffer C (8 M urea; 0.1 M NaH2PO4; 0.01 M Tris-HCl; pH 6.3) followed by centrifuging for 2 min at 890 g. Finally, the protein was eluted twice with 200 L Buffer E (8 M urea; 0.1 M NaH2PO4; 0.01 M Tris-HCl; pH 4.5) and centrifuged for 2 min at 890 g. 44

PAGE 45

Table 2-1. Primers used for ChIP analysis Primer Pairs Gene Regions Primer Sequence Rat MnSOD Promoter -249~ +66 FP 5-CTGAGGGTGGAGCATAGCCA-3 RP 5-CCGCTGCTCTCCTCAGAACA-3 Rat MnSOD Enhancer +1716~+1940 FP 5-AAGTGTGGTATTTTAGCATAGTTGTGTA-3 RP 5-AGAGGAAAGTTGTCAGATGTCACC-3 Rat Intergenic Region FP 5-GCAGGCTCCCAATCAATACAT-3 RP 5-TGGAATAGCAGGCAGCGTG-3 Human FOXO3a Site 1 -4339~-4170 FP 5-GGGAAAGAGA GAGGACAGGAGC-3 RP 5-TCTGACACCCTCATTAGACCCTT-3 Human FOXO3a Site 2 +2910~+3139 FP 5-CTCTACCGTTCCTTATCATCCTCTT-3 RP 5-GAGATGTATATCTCCAATCGCACAG-3 Human FOXO3a Site 3 +55386~+55621 FP 5TCATTCCCCGCTCTTCATTC-3 RP 5CAGAGACTATGTGAGACAATGGAGG-3 Human FOXO3a Site 4 +116869~+117085 FP 5-AACCCATGAAACTTGTACCCAA-3 RP 5-GCTTATCTGATTCAATCAAGGACAG-3 Human FOXO3a Promoter -39~+197 FP 5-TGCGTGTGTCTATAACTTTGTGCT-3 RP 5-CTACCTCGCTTCCTTCCCTTC-3 Human FOXO3a Intervening Region +1587~+1865 FP 5-GAGGACGATGAAGACGACGAG-3 RP 5-AGGTTTCCCCAGGCGTTC-3 45

PAGE 46

CHAPTER 3 DISTINCT FUNCTIONS OF C/EBP PROTEI N ISOFORMS IN THE REGULATION OF MNSOD DURING IL-1 STIMULATION Introduction The regulation of MnSOD gene expression is important to cellular and organismal homeostasis with postnatal death observed in gene ablation mouse models at 10 days to 3 weeks after birth (Lebovitz et al., 1996; Li et al., 1995). For the past 30 years, extensive studies have convinced the research community that MnSOD e xpression levels are lower in primary tumors and in cancer cell lines (Izutani et al., 1998; Oberley and Buettner, 1979; Zhong et al., 1999), and overexpression of MnSOD and its catalytic mutants can inhibit cancer cell gr owth (Amstad et al., 1997; Church et al., 1993; Davis et al., 2004; Li u et al., 1997; Liu et al., 2005) and tumors in vivo (Church et al., 1993; Davis et al ., 2004; Li et al., 1998; Weydert et al., 2003). Furthermore, numerous studies have demonstrated that elevat ed levels of MnSOD are able to protect cells against radiation damage (reviewed in Greenberger and Epperly, 2007), NMDA initiated neurotoxicity (Gonzalez-Zulueta et al., 1998), and TNFmediated apoptosis (Manna et al., 1998). Other studies have also demonstrated that cardiac overexpression of MnSOD can confer protection of cardiac mitochondria, reducing di abetic cardiomyopathy (Shen et al., 2006). Therefore, it is clear that an understanding of the underlying mechanisms controlling cellular regulation of MnSOD could be of central importa nce to a variety of di sease pathologies along with the aging process. MnSOD induction is highly regulated when exposed to proinflammatory stimuli such as lipopolysaccharide (LPS), tumor necrosis factor (TNF ), interleukin-1 and-6 (IL-1 and IL6), and interferon (IFN ) to confer potent cytoprotectiv e functions (Dougall and Nick, 1991; Jones et al., 1995; Lin et al., 1993; Masuda et al., 1988; Visner et al., 1991; Visner et al., 1990; Wong et al., 1989). Previous inve stigations from this (Visner et al., 1991) and other laboratories 46

PAGE 47

(White and Tsan, 1994) have demonstrated the stimulus-dependent elevation in MnSOD mRNA level is due to increased de novo transcription, and maximum induction of the gene requires an enhancer region which is located in intron 2 in both rodent and human MnSOD genes (Jones et al., 1997; Kiningham et al., 2001; Roge rs et al., 2000; Xu et al., 1999) This enhancer is highly conserved over a 200-500 bp region depending on the species, even though it resides in an intron in all the species studied. Sequence analysis t ogether with EMSA have indicated the potential involvement of various transcription factors with the intr onic enhancer during the stimulusdependent up-regulation of MnS OD transcription (Jones et al., 1997; Maehara et al., 2000; Maehara et al., 1999; Ranjan and Boss, 2006) ; however, the mechanisms have not been studied in detail. By using a yeast One-Hybrid strategy to id entify the cognate regulat ory factors which bind to the conserved enhancer sequences, we have identified C/EBP and as candidate factors (Chokas, 2004) involved in MnSOD gene induction. Both C/EBP and C/EBP have been shown to be involved in the inflammatory res ponse (Cardinaux et al., 2000; Fukuoka et al., 1999; Magalini et al ., 1995). C/EBP mRNA is intronless and gives ri se to three di fferent protein isoforms, LAP*, LAP and LIP (Fig ure 1-3), through altern ative use of three inherent translation start codons (Ossipow et al., 1993). C/EBP contains no intron as well, and only has one protein form (Figure 1-3). Results Effects of IL-1 on C/EBP and The potent anti-oxidant enzyme, MnSOD, is highly inducible by a number of proinflammatory stimuli including IL-1 (Valentine and Nick, 1992; Visner et al., 1990), TNF(Lin et al., 1993; Wong and Goeddel, 1988), and LPS (Gibbs et al., 1992 ; Valentine and Nick, 1992) as well as IL-6 (Dougall a nd Nick, 1991). We (Rogers et al., 2000) and others (Jones et 47

PAGE 48

al., 1997; Maehara et al., 1999) have shown that the induction of MnSOD by IL-1 TNF and LPS is in fact mediated through the conserved intronic enhancer el ement. To determine whether the cytokine, IL-1 had any effect on C/EBP and C/EBP total RNA was isolated from a rat pulmonary epithelial-like cell line, L2, following stimulation with IL-1 (2ng/mL) for 8 hours. Northern analysis was performed (Figure 31) and the membrane was hybridized with radiolabelled probes for MnSOD, C/EBP C/EBP and the loading control, cathepsin B (Cath B). These data illustrate the docum ented induction of MnSOD mRNA by IL-1 treatment (Visner et al., 1990) along w ith the induction of C/EBP mRNA levels(Cardinaux et al., 2000; Fukuoka et al., 1999; Magalini et al., 1995). In contrast, our repeated attempts found IL-1 had no obvious effect on C/EBP mRNA level. To investigate the effect of IL-1 treatment on C/EBP or C/EBP cellular protein levels or localization, we isolated cyto solic and nuclear fracti ons from L2 cells at times after exposure to 2 ng/mL of IL-1 and both fractions were subjected to immunoblot analysis. Neither C/EBP nor C/EBP was detectable in the cytosolic fraction (data not shown). In the nuclear fraction, C/EBP protein induction was first dete ctable at 1h, peaking at ~2-3h, with a gradual decline to a level at 24h still significantly higher than the un treated control. Immunob lot analysis of TFIIB was used as the loading contro l (Figure 3-2, top panel). As illustrated in Figure 1-3, the translation of the C/EBP mRNA can lead to 3 protein isoforms, designated LAP*, LAP and LIP. In the nucleus, when uti lizing an antibody which recognizes all three protein isoforms, we observed the induction by IL-1 of each of the three isoforms, w ith a time course unique to each protein (Figure 3-2, bottom panel) These data, therefore, dem onstrated that LAP* and LAP proteins were both detectable in untreated cells, showing a gradual increase with a plateau after about 3 h. LIP, on the other hand, was extremely low in control cells showing an induction at ~1 48

PAGE 49

h and reaching a plateau at about 5 h. Unfortuna tely, our attempts to utilize a commercially available mono-clonal antibody specific to the N-terminal 21 amino acids of LAP* in conventional immunoblot analysis were unsuccessful on whole cell or nuclear extracts (data not shown). In order to further demonstrate that LAP* was indeed present in these cells and inducible, and verify that the top band in Figure 3-2 bottom panel was indeed LAP*, we collected total cell extracts at increasing time points after IL-1 treatment, and performed an immunoprecipitation with the antibody that recognizes all three C/EBP isoforms. The precipitate was fractionated by SDS-PAGE, and immunoblot analysis was performed with the antibody specific to LAP* (Figure 3-3), conf irming the presence of endogenous LAP* and the induction of this isoform by IL-1 Effect of C/EBP Knockout and Knockdown on IL-1 Dependent Induction of MnSOD To demonstrate the functional role of C/EBP in the IL-1 -dependent induction of MnSOD, we evaluated the cytokine response in C/EBP -/mouse embryonic fibroblast (MEF) cells (Sterneck et al., 1997). RNA wa s isolated from both wild type ( +/+) and C/EBP knockout ( -/-) MEF cells with or without 8h of IL-1 treatment followed by northern analysis (Figure 3-4). IL-1 exposure caused the expected induc tion of MnSOD mRNA levels in wild type MEF cells, however the levels of MnSOD mRNA were unchanged in the C/EBP knockout ( -/-) MEF cells, implicating the relevance of C/EBP in the IL-1 induction of MnSOD. To further verify the importance of C/EBP in the MnSOD induction by IL-1 we also utilized siRNA specific to C/EBP to knock down endogenous C/EBP protein levels. Immunoblot analysis (Figure 3-5A) of cells exposed to the transfection reagen t alone or an unrelated siRNA showed no effect on the levels of the endogenous C/EBP isoforms whereas the siRNA specific to C/EBP knocked down all C/EBP isoform levels by ~80%. The C/EBP specific siRNA 49

PAGE 50

treated cells was subjected to IL-1 treatment and real-time RT-PCR data from three independent experiments were analyzed in of Figure 3-5B. Untreate d levels of MnSOD mRNA were unaffected by any of the conditi ons, while specific knock down of C/EBP blocked the IL1 induction of MnSOD by more than 60%. MnSOD Transcription Rates We have previously demonstrated that the induction of steady-stat e MnSOD mRNA levels by IL-1 treatment requires de novo transcription and reaches the maximal level at ~8 h (Valentine and Nick, 1992; Visner et al., 1990). To expand these original studies from a timedependent standpoint and to better correlate the induction of C/EBP and C/EBP protein levels by IL-1 with MnSOD expression, we examined the re lative levels of unspliced heteronuclear RNA (hnRNA), which directly reflects the endoge nous transcription rates (Lipson and Baserga, 1989). The quantitation of hnRNA by real-time RT-PCR provides a mechanism for direct analysis of the relative transc ription rates analogous to a nuc lear run on study. Figure 3-6 demonstrated that IL-1 caused a dramatic increase in MnSOD hnRNA levels within 15 min, with a maximal induction reached at 30 min. Th e transcription rate was reduced by 1h with further gradual decline over the next 24 h, wh ere a ~10 fold induction was still maintained relative to control cells. Interaction of C/EBP and C/EBP with the MnSOD Enhancer Element To investigate the direct interactions of C/EBP and C/EBP with the MnSOD gene in intact cells following IL-1 treatment, chromatin immunoprecipitation (ChIP) was performed with L2 cells collected at sp ecific time points after IL-1 treatment. A non-specific IgG antibody gave minimal background signals (data not shown). Antibodies against C/EBP (Figure 3-7A) or C/EBP (Figure 3-7B) showed significant induci ble interactions with the MnSOD intronic enhancer following IL-1 treatment with minimal binding observed at the promoter, as well as, 50

PAGE 51

at an intergenic control region. The differences between these two transcription factors were more obvious when considering the ti me dependence of the binding. C/EBP showed a ~7.4 fold increase in the occupancy of the intronic enhancer af ter 15 min of IL-1 exposure with sustained binding up to ~11.4 fold at 5 h (Figure 37A). This is consis tent with the initial induction of LAP* and LAP protein levels (Figur e 3-2 and 3-3) and the MnSOD transcriptional induction (Figure 3-6). The binding of C/EBP on the other hand, showed only a ~2.6 fold increase in occupancy at 15 min but a ~10.3 fold increase at 2 h (Figure 3-7B) which coincided with the significant increase in protein levels at 2 h (Figure 3-2). Functional Importance of C/EBP and C/EBP in MnSOD Transcriptional Regulation Classically, the LAP* and LAP isoforms have been identified as activators (MartinezJimenez et al., 2005; Pomerance et al., 2005; Zuo et al., 2006) whereas LIP has been considered as a repressor (Descombes and Schibler, 1991; Hsu et al., 1994). However, our data suggested a more distinct role for these isoforms. Given the existence and inducibili ty of all three C/EBP isoforms in L2 cells, it was logical to assume that the C/EBP protein isoforms functioned differently to coordinately regulate MnSOD expression during the induction by IL-1 To test this hypothesis, we cloned the cDNAs that would in itiate at each of the three methionine residues into the mammalian expression vector, pcDNA 3.1 (Figure 3-8A), with the designations pLAP*/LAP/LIP indicating the production of all three proteins, LAP*, LAP, and LIP; pLAP/LIP referring to the synthesis of only LAP and LIP; and pLIP, the designation for the production of LIP alone. We tested the functional importan ce of these three constructs on MnSOD gene regulation following transient co-t ransfection of L2 cells with a human growth hormone (hGH) reporter driven by the MnSOD promoter couple d to its cognate intr onic enhancer (MnSOD promoter/enhancer-hGH). We found that co -transfection of the expression vector 51

PAGE 52

pLAP*/LAP/LIP increased hGH expression (Figure 3-8B, Lane 2 versus Lane 1) whereas cotransfection with pLAP/LIP or pLIP had no effect on the ba sal expression of the MnSOD promoter/enhancer (Lane 3 and 4 versus Lane 1). As previously reported (Rogers et al., 2000), when cells were co-transfected with MnSOD promoter/enhancer-hGH and the empty expression vector, pcDNA3.1, exposure to 2 ng/mL of IL-1 for 8 h induced hGH expression (Lane 5 versus Lane 1), demonstrating th e responsiveness of the in tronic enhancer to IL-1 Co-transfection with pLAP/LIP or pL IP blocked the IL-1 dependent induction (Lane 7 and 8 versus Lane 5) whereas co-transfection w ith pLAP*/LAP/LIP in IL-1 treated cells showed a slight additive response compared to IL-1 alone (Lane 6 versus Lane 5). In order to systematically study the role of each protein isoform separately and with all possible combinations, we selectively mutated meth ionine 22 and/or methionine 153 to alanine, generating four possible combinations, pLAP*/LIP, pLAP*/LAP, pLAP* and pLAP (Figure 39A). As described for the constr ucts in Figure 3-8, the designati ons for each construct reflect the protein isoforms that can be synthesized. The an ticipated results were verified by isolating total protein extracts from L2 cells transfected with the respective mutant e xpression vectors followed by immunoblot analysis with antibodies specif ically against LAP* or all three C/EBP protein isoforms (Figure 3-9B). The bottom right pane l in Figure 3-9B shows an overexposed film to illustrate that LIP was also expressed as expect ed by the construct designation, albeit at lower levels relative to pLIP. To determine whether methionine to alanine mutations would affect the transcriptional activity of the respective isoforms, the indicated expression vectors were co-transfected with the MnSOD promoter/enhancer-hGH report er construct. Total RNA colle cted with or without 8 h of IL-1 treatment was subjected to northern analysis (Figure 3-10). Those c onstructs that express 52

PAGE 53

LAP* (Figure 3-10, Lane 2-5), significantly enhan ced hGH expression (comparing to Lane 1) in the absence of IL-1 Most relevantly, the induction obser ved for the pLAP* construct (Lane5), expressing only LAP*, was very efficient at inducing MnSOD promoter/enhancer function. However, when transfected cells were exposed to IL-1 a slight additive response was observed (Lane 9-12 versus Lane 8). Additionally, Lane 6 and 7 confirm that in the absence of LAP*, GH expression is not increased. Furthermore, Lane 13 and 14 demonstrate that pLAP and pLAP/LIP strongly repress GH expressi on when exposed to IL-1 To further demonstrate the roles of LAP*, LAP, LIP and C/EBP during IL-1 induced MnSOD expression, empty pcDNA3.1 or vectors expressing only LAP*, LAP, LIP or C/EBP were co-transfected with the MnSOD prom oter/enhancer-hGH reporter plasmid, and hGH mRNA levels were examined by northern analysis (Figure 3-11A). A densitometry analysis of three independent experiments is shown in Figure 3-11B. As demonstrated in Figure 3-11, LAP* caused a ~2.5 fold induction of hGH expression in the absence of IL-1 whereas overexpression of LAP, LIP, or C/EBP had no effect on basal expr ession. Overexpression of LAP* in conjunction with IL-1 treatment further added to the IL-1 enhanced hGH expression whereas overexpression of LAP, LIP or C/EBP significantly repressed MnSOD promoter/enhancer driven hGH expression. Binding of LAP* to the MnSOD Enhancer With the unique role that LAP* played as a potent transcriptional ac tivator of MnSOD, we felt it necessary to demonstrate that LAP* c ould specifically interact with the endogenous MnSOD enhancer element. Given that the antibody against C/EBP used in the ChIP analysis in Figure 3-7A recognizes all three C/EBP protein isoforms and that the antibody specifically against LAP* did not possess adequate affinity for immunoprecipitation in our hands, we generated a vector expressing Cterminally HA-tagged LAP*. Imm unoblot analysis of protein 53

PAGE 54

from cells transfected with HA-LAP* vector w ith antibodies either to the HA tag or C/EBP demonstrated that the construct produced the expected protein (F igure 3-12A). Furthermore, cotransfection of cells with the pHA-LAP* and the MnSOD promoter/enhancer-hGH reporter plasmid demonstrated that the HA-tagged protein behaved identically to the untagged LAP* in its ability to induce hGH expression (Figure 3-12B) With these results, we then transfected L2 cells with the vector expressing HA-LAP*, and ev aluated its binding by ChIP analysis with the HA specific antibody. The data in Figure 3-13 clearly demonstrates that HA-LAP* is specifically bound to the MnSOD enhancer, whereas no actual binding was observed with the MnSOD promoter, an intergenic region or samples using nonspecific mouse IgG. Discussion C/EBP and C/EBP were identified by yeast one-hybrid assay when screening a rat lung cDNA library using three copies of an enhancer fragment as bait. In this study, I established the expression profiles of C/EBP and C/EBP in both mRNA level and protein level in response to IL-1 treatment, including the effect of IL-1 on LAP* protein level. I confirmed the importance of C/EBP in IL-1 -dependent induction of MnSOD by gene knockout and knockdown approaches. I verified the de novo synthesis of MnSOD mRNA induced by IL-1 and showed its time-dependence. I also demonstrated that C/EBP and C/EBP could be induced to bind to MnSOD enhancer region in a time-dependent manner, indicating a direct relationship between these two tr anscription factors and MnSOD gene expression. In addition, by mutating the methionines for corresponding inte rnal start codons to alanines, I created constructs only expressing one of C/EBP protein isoform, namely LAP*, LAP and LIP, and confirmed the point mutations did not affect the tr anscriptional activities of the proteins. With these constructs, I utilized a human growth hormone reporter driven by the MnSOD intronic enhance coupled with its cognate promoter (M nSOD promoter/enhancer-hGH) to determine that 54

PAGE 55

LAP* is the only transcriptional activator and it can act with IL-1 in an additive way to induce MnSOD expression, whereas LAP, LIP, and C/EBP function as transcription repressors to block IL-1 -dependent induction of MnSOD. Finally, I confirmed that LAP* could specifically interact with MnS OD enhancer region. In the literature, it has been documented that C/EBP and C/EBP both belong to the same C/EBP subfamily and both factors are reported to be involved in the inflammatory response. Sharing over 90% identity in the C-terminal bZIP domain, these two transcription factors possess the ability to bind a canonical RTTGCGYAAY se quence (R = A/G, Y = C/T). In this study, I found that despite those shared attr ibutes, these two factors displaye d distinct profiles in L2 cells when exposed to IL-1 C/EBP was induced in both mRNA and protein levels, and its induction in protein was transien t in that it peaked at around 2-3 h with a gradual decline thereafter. In contrast, C/EBP was not induced at the mRNA le vel, however all three of its protein isoforms were induced, and maintained a plateau from 2 h up to 24 h. ChIP analysis demonstrated that C/EBP was dramatically induced as earl y as 15 min to bind MnSOD with a further increase up to 5 h, which is consistent with the initial induction of LAP* and LAP protein levels. In contrast, the maximum binding of C/EBP to MnSOD occurred at 2 h, which also correlated well with the induction in its protein level. These different binding patterns further indicated a disparity in the regulation of IL-1 -dependent MnSOD expression by these two transcription factors. This is not surprising, because these two factors function differently yet coordinately to regulate Mn SOD expression, which is charac terized by the reporter assay. Furthermore, LAP* and LAP together, in th e literature, are usually considered as transcription activators. Kowenz -Leutz et al (Kowenz-Leutz and Leutz, 1999) for the first time demonstrated the LAP* was different from LAP in that it could recruit the SWI/SNF complex 55

PAGE 56

through the extra N-terminal region. However, in this study, I used a plasmid-based reporter system, which lacks a proper chromatin structure, to show that only LAP* is a transcriptional activator for MnSOD, indicating that this extr a region may serve as an other transactivation domain. Unfortunately, the C/EBP antibody used in ChIP analysis recognized all three isoforms, and the LAP* specific antibody didnt possess adequate affinity to allow for use in a ChIP assay; overexpression, on the other hand, has ar tificial effects due to the lack of proper post-translational modification and potential sequestration of other interactive factors, and can not reflect the proper changes in the intact cells. Thus, we coul dnt dissect the ChIP result to show the binding profile of each C/EBP isoform with MnSOD. C/EBP family members are ready to form intrafamilial dimers, thus, based on the ChIP analysis and reporter assay, we propose that upon exposure to IL-1 (Figure 3-14), LAP* binds first to activate MnSOD induction, and it is then either forms heterodimers or completely displaced by LAP, LIP and/or C/EBP which causes a decline in the transcription rate. Most interestingly, the differe nce between LAP* and LAP is that LAP* contains extra 21 amino acids in the N terminus, which may serve as another activation domain. Thus I invested my efforts in characterizing of the electrostatic a nd chemical property of this region as stated in Chapter 4. 56

PAGE 57

Figure 3-1. Effect of IL-1 on C/EBP and C/EBP mRNA levels. Total RNA extracted from L2 cells with or without exposure to 2 ng/mL of IL-1 for 8 h was examined by northern blot analysis. The membrane was hybridized with radi olabelled probes for MnSOD, C/EBP C/EBP and Cathepsin B (catch B, an internal loading control). 57

PAGE 58

Figure 3-2. Effect of IL-1 on C/EBP and C/EBP cellular protein levels. Immunoblot analysis was performed on nuclear extracts from L2 cells treated with IL-1 for the indicated periods of time. The membranes were probed with antibodies against C/EBP (recognizing LAP*, LAP and LIP), C/EBP or TFIIB as a nuclear extract loading control. 58

PAGE 59

Figure 3-3. Effect of IL-1 on endogenous LAP* protein. Whol e cell extracts were collected from L2 cells after trea ted with 2 ng/mL of IL-1 for indicated periods of time. Immunoprecipitation was conducted with mock antibody or antibody against all three isoforms of C/EBP and the immunoblot was pr obed with antibody specifically against LAP*. 59

PAGE 60

Figure 3-4. Effect of C/EBP knockout on IL-1 -dependent MnSOD induc tion. Northern blot analysis was performed to determine the MnSOD mRNA levels from wild type ( +/+) or C/EBP knockout ( -/-) mouse embryonic fibrobl ast (MEF) cells with or without 8 h of IL-1 (2 ng/mL) treatment. Cathepsin B (Cath B) serves as the loading control. 60

PAGE 61

A B Figure 3-5. Effect of C/EBP knockdown on IL-1 -dependent MnSOD induction. A), 10 g of whole-cell extracts from nontransfected, mock-transfect ed L2 cells (Dharmafect alone) or L2 cells transfected with unrelated cyclophilin B siRNA or C/EBP siRNA were subjected to immunoblot anal ysis with an antibody against C/EBP B), total RNA from untransfected, mock-transfect ed (Dharmafect alone) or L2 cells transfected with siRNA agai nst cyclophilin B or C/EBP before or after 4 h of IL-1 treatment were subjected to real-time RT-PCR to determine MnSOD and cyclophilin A mRNA levels. The MnSOD/cyclophilin A ra tio of untransfected cells under no treatment was set to 1. This is a summary of three independent experiments, in which data are depicted as the means SEM (s tandard error of the mean) values. The asterisk indicates statis tical significance with p 0.05 compared with IL-1 treated no transfection samples. 61

PAGE 62

Figure 3-6. Analysis of MnS OD expression rate after IL-1 treatment. L2 cells were treated with 2 ng/mL of IL-1 and at the times indicated, total RNA was isolated and analyzed by real-time RT-PCR using primers specific to MnSOD hnRNA. The data were presented as ratios of MnSOD hnRNA le vels to cyclophilin A mRNA levels. The ratio at time 0 was set to 1. This is a summ ary of three independent experiments, in which data are depicted as the means SEM values. Asterisks indicate statistical significance with p 0.05 compared with the samples without IL-1 treatment. 62

PAGE 63

A B Figure 3-7. Association of C/EBP and C/EBP with MnSOD. L2 cells were treated with 2 ng/mL of IL-1 for indicated times, and chromatin immunoprecipitation (ChIP) assays were performed with antibodies against C/EBP (A) or C/EBP (B). Data were plotted as the ratio to the value of total DNA input for immunoprecipitation. The graphs are summaries of three indepe ndent experiments, in which data are depicted as the means SEM values. Asteri sks indicate statistical significance with p 0.05 compared with the corresponding un-stimulated samples. 63

PAGE 64

A B Figure 3-8. Functional analysis of constructs carrying LAP*, LA P or LIP cDNA. A) Top panel is schematics of the C/EBP expression plasmid constructs, pLAP*/LAP/LIP, pLAP/LIP and pLIP, whose names reflect the protein isoforms expressed by each construct. Black box indicates the domain we focus on in the pres ent study, activation domains and regulatory domains are de picted by hatched and meshed boxes respectively, and bZIP domains are presented as boxes with vertical lines. B) L2 cells were co-transfected with a human growth hormone (hGH) reporter plasmid driven by the MnSOD promoter and enhancer (MnS OD promoter/enhancer-hGH) along with an empty pcDNA3.1 plasmid or the indicated C/EBP constructs. 40 h post transfection, cells were either untreated or stim ulated by exposure to 2 ng/mL of IL-1 for 8 h. Total RNA was then extracted and followed by a northern analysis 64

PAGE 65

A B Figure 3-9. Expression pa tterns of each C/EBP construct. A) Schematic depiction of sitedirected mutagenesis of methionine residues 22 and 153 to alanines. Black box indicates the domain I focused on; hatched and meshed boxes depict activation domains and regulatory domains respectively; and boxes with vertic al lines represent bZIP domains. The mutated s ites are highlighted by grey shading in each construct and the protein isoforms expressed from each construct are indicated by the construct names on the right. B) Whole cell extracts were obtained from L2 cells 48 h after transiently transfected with 5 g of indicated constructs. Immunoblot analysis was conducted with antibodies specifically against LAP* or C/EBP (recognizes all three isoforms). The right bottom panel depicts a darker exposure of a similar experiment performed with an antibody against C/EBP to illustrate the presence of LIP in the appropriate lanes. 65

PAGE 66

Figure 3-10. Effects of methioni ne to alanine mutations. L2 cells were co-transfected with the MnSOD promoter/enhancer-hGH reporter pl asmid together with an empty pcDNA3.1 plasmid or the indicated expression vect ors. 48 h post transf ection, total RNA was collected with or without 8 h of IL-1 treatment, and subjecte d to northern analysis. As described above, the name of each e xpression vector denotes the proteins produced from the respective construct. 66

PAGE 67

A B Figure 3-11. Transcriptional regulation of MnSOD by LAP*, LAP, LIP and C/EBP A) L2 cells were co-transfected with MnS OD promoter/enhancer-hGH reporter plasmid along with an empty pcDNA 3.1 vector or th e expression vectors for LAP*, LAP, LIP or C/EBP 40 h post transfection, cells were ei ther untreated or stimulated by exposure to 2 ng/mL of IL-1 for 8 h. Total RNA was then collected and subjected to northern analysis with cath B as the loading control. B) Densitometry was derived from 5 independent experiments, and data are presented as means SEM. Asterisks indicate statistical significance of transcri ptional activitie s in unstimulated conditions compared with the empty vector, pcDNA 3.1 with p 0.05. Crosses indicate statistical significance in enhanc ing or impeding IL-1 induction of MnSOD promoter/enhancer-hGH compared with empty vector pcDNA 3.1 with p 0.05. 67

PAGE 68

A B Figure 3-12. Functional analys is of HA-LAP* versus non-tagged LAP*. A) L2 cells were transfected with 5 g of empty vector pcDNA 3.1 or expression vectors for HAtagged LAP*, and total cell ex tracts were investigated by immunoblot analysis with antibodies against HA or C/EBP B) L2 cells were co-transfected with MnSOD promoter/enhancer-hGH reporter plasmid t ogether with either an empty pcDNA 3.1 plasmid or vectors expressing non-tagged or HA-tagged LAP*. 48 h post transfection total RNA was collected and s ubjected to northern blot anal ysis. L2 cells transfected with MnSOD promoter/enhancer-hGH and pcDNA 3.1 were also exposed to 2 ng/mL of IL-1 for 8 h to illustrate normal induction by IL-1 Three independent plates were transfected with each construct. 68

PAGE 69

Figure 3-13. Association of LA P* with the endogenous MnSOD ge ne. L2 cells were transfected with 10 g of expression vector for HA-tagged LAP* in 150 mm plates, and a ChIP assay was conducted 48 h post transfecti on using a nonspecific mouse IgG or an antibody specifically against HA. Data were plotted as the ratio to the total DNA input for immunoprecipitation. 69

PAGE 70

Figure 3-14. Model of the functions of C/EBP isoforms on MnSOD following IL-1 induction. After IL-1 treatment, LAP* (orange) homodime rs bind to the MnSOD enhancer, recruit transcription machinery to the promoter, which lead to active MnSOD expression. Then LAP* forms hetero dimer with LAP, LIP or C/EBP (blue), or completely displaced, resulting in the reduction of Mn SOD expression. 70

PAGE 71

CHAPTER 4 IMPORTANCE OF LAP*: THE RELEVAN CE OF THE FIRST 21 AMINO ACIDS Introduction C/EBP also referred to as NF-IL6, IL-6DB P, LAP, CRP2, NF-M, AGP/EBP and ApC/EBP, is an intronless gene constitutively expressed highly in the liver, intestine, lung, adipose tissue, spleen, kidney and my elomonocytic cells. It is firs t identified as a factor binding to the IL-1 response element on IL-6 promoter (Akira et al., 1990). After its discovery, numerous studies have indicated its involvement in various p hysiological and pathological processes, including cell differentiation, proliferation, a poptosis and inflammation. Due to the leaky scanning of the ribosome, the unique C/EBP mRNA can be translated into three protein isoforms, namely full-length LAP* (or LAP1), medium length LAP (or LAP2) and a short form LIP. The difference between LAP* and LAP is that LAP* possess an extra stretch of 21 or so amino acids, depending on the species. Traditionally, LAP* and LAP together are considered as tran scriptional activators, whereas LI P is recognized as a dominant negative form as a result of its lacking of any transcriptional activation domain. Up till now, there have been less than a dozen papers report ing the detailed differences between LAP* and LAP. For example, Kowenz-Leutz et al. (Kowen z-Leutz and Leutz, 1999) demonstrated that the first 20 or so amino acids serve as an interaction domain to recruit the SWI/SNF complex. Eaton et al (Eaton et al., 2001) f ound that LAP* (termed C/EBP -1 in their paper) is present in all normal cells and tissues but absent in all th e breast cancer cell lines whereas LAP (termed C/EBP -2 in their paper) is upregulated in pr imary breast tumors. The same group later proposed that LAP* but not LAP was subjecte d to post-translational modification through sumoylations, leading to the distinct functions of these two isoforms (Eaton and Sealy, 2003). Su et al. (Su et al., 2003) reported that the extr a cysteine in the first 21 amino acid of LAP* 71

PAGE 72

caused the formation of different internal disu lfide bonds. In addition, there is evidence that Homer 3, a member of the Homer family of posts ynaptic density scaffold ing proteins found in excitatory neuronal synapses, specifically bi nds to LAP* but not LAP, and regulates the transcriptional activatiy of LAP* (Ishiguro and Xavier, 2004). The data in the previous chapter clearly dem onstrated the functional disparity of these two protein isoforms, and showed that the 21 amino acids comprise a new transcriptional activation domain, which is essential for the IL-1 -dependent induction of Mn SOD. On the other hand, lack of this domain leads to the loss of transc riptional activity and the acquisition of repressive function during this physiological process. Most importantly, a re view of the literature further suggests the necessity to study the intrinsic na ture of this potential transactivation domain consisting of the N-terminal 21 or so amino acids. Results Identities of the Amino Terminal 21 Amino Acids among Mammalian Species Given that there are only crystal structures of the C-terminal domain (Johnson, 1993; Podust et al., 2001), which is even smaller than LI P, in the literature, an d the structure of the entire protein is not available, the most efficien t way to predict the inhe rent relevance of this sequence is to perform a sequence alignment amo ng a variety of mammalian species. Figure 4-1 is a sequence alignment of the N-terminal do main of LAP* from human, chimpanzee, bovine, mouse and rat. This comparison illustrates the high level of conservation across species with 13 amino acids being identical. General Mutagenesis Study of the Conserv ed Residues in the First 21 Amino Acids To evaluate the functional importance of the conserved amino acids relative to the transcriptional activity of LAP*, each conserve d residue was mutated to alanine with the exception that Ala18 was substituted with valine. The consecutive proline residues, prolines 1372

PAGE 73

16, which in this dissertation are termed 4P were colle ctively mutated to alanines in a single vector (4P-A). The relative expression level of e ach mutant construct was evaluated relative to the pLAP* vector which expresses only LAP* as the start codons encoding M22 and M153 were both mutated to alanines. As a point of functional comparison for th ese newly described mu tations, the protein derived from the overexpression vector pLAP* will be referred to as the wild type protein given that its transactivation activity is indistinguishable from the tr ue wild type sequence (Figure 310). Whole cell extracts were collected from L2 cells transfected with indicated expression vectors, and immunoblot an alysis was performed with an antibody against C/EBP (Figure 4-2). The LAP* specific antibody was not used because the epitope of this antibody is less than 20 amino acids, and it is therefore possible that the a ffinity for each mutant may vary. For example, the substitution of 4 prolines w ith alanines may greatly reduce the binding of the antibody, thus providing a false level for the re lative protein abundance in the cel l if LAP* specific antibody is used. As shown in Figure 4-2, the expression levels of most mutants were comparable to pLAP*. Only mutants R3A, W7A and D8A exhibited lowe r expression levels, indicating that R3A, W7A and D8A mutations could result in reduced protein stability. All mutant LAP* vectors were then co-tra nsfected with the MnSOD promoter/enhancerhGH reporter to evaluate the effect on transcripti onal activity. A representative northern analysis is shown for untreated and IL-1 treated cells (Figur e 4-3). We separated the mutants to two groups based on the changes in the transcriptional activity, and densitome try analysis was done on three independent experiments (Figure 4-4). One group consisted of those mutants that had no effects, namely mutants L4A, C11A, L12A, A 18V and F19A (Figure 4-4A). The other group comprised mutants R3A, W7A, D8A, and 4P-A that resulted in a significant reduction in LAP*73

PAGE 74

dependent transcriptional activation as well as the loss of the ability to act additively with IL-1 (Figure 4-4B). Of particular in terest, two mutants, LAP*D8A, wh ich was expressed at even at a lower level compared to LAP* (Figure 4-2), a nd LAP*4P-A caused a stat istically significant inhibition of IL-1 -dependent induction. Evaluation of D8 mutants The result in Figure 4-3 and 4-4 demonstrated that substitution of the aspartate residue at position 8 with an alanine residue not only cause d the protein to lose its LAP*-dependent transcriptional activity but also caused a repr essive effect on MnSOD promoter/enhancer hGH expression when exposed to IL-1 additionally demonstrating the importance of this amino acid residue. To further evaluate the chemical and/or structural importance of D8, we substituted the aspartate residue with either aspa ragine to eliminate the charge yet maintain a similar structure, or with glutamate to maintain the charge. Overex pression levels of these mutants were similar to pLAP* (Figure 4-5A). Northern analysis of h GH (Figure 4-5B) showed substitution of D8 with alanine or asparagine caused a significant reducti on in LAP*-dependent transcriptional activation activity in untreated cells, whereas substitution with glutamate maintained high transcriptional activation analogous to LAP*. When treated with IL-1 for 8 h, the D8A mutant possessed statistically significant repressive activity, as confirmed by densitometry analysis based on three independent experiments (Figure 4-5C). These results clearly emphasized the importance of the positive charge at position 8. Analysis of R3 Mutants Though when arginine 3 was repl aced by alanine, the mutant did not possess the ability to block IL-1 -dependent induction of MnS OD promoter/enhancer hGH (Fi gure 4-4), it is clear that this point mutation abolished the LAP*-dependent transcriptional activity, demonstrating the importance of this residue. To further examine the importance of residue R3, we generated two 74

PAGE 75

additional mutant constructs, pLAP*R3Q and pL AP*R3K, which either abolished the charge while partially maintaining the inherent structure or replaced the arginine w ith lysine to maintain the charge, respectively. Unexpectedly, all thr ee substitutions caused a significant decrease in the expression level as well as transcriptional activity (data not shown). To eliminate the possibility that reduced transcriptional activity was caused by overall decreased protein levels, a titration of the three mutants was performed (Fi gure 4-6A). The shaded co-transfections in Figure 4-6A were chosen for hGH expression anal ysis (Figure 4-6B). Densitometry analysis derived from three independent experiments (Figur e 4-6C) showed that a ll three mutations R3A, R3Q, R3K resulted in a dramatic reduction of LA P* transcriptional activit y. It appears, in the autoradiograph of the northern blot analysis that R3A and R3Q mu tants can block IL-1 dependent MnSOD induction, however the statistical calculation yield a p value slightly greater than 0.05. These results would imply that the ar ginine residue at posi tion 3 is important for LAP* function because of both its inherent structure and positive charge. Functional Study of W7 Mutants Similar to the R3A mutant, substitution of tr yptophan at position 7 with alanine caused a decrease in the transcriptional activity, but the W7 A mutant was not able to repress the induction elicited by IL-1 treatment. To evaluate the functional relevance of the aromatic nature of residue W7, we constructed another mutant, wh ere tryptophan was replaced by another aromatic amino acid residue, phenylalanine. We took a sim ilar approach as the R3 mutants to perform analysis for W7 mutants. We transfected L2 ce lls with increasing concen trations of pLAP*W7A plasmid to equalize its expression level with that of wild type LAP* (Figure 4-7A). Guided by these data, we studied the hGH expression levels with the co-t ransfections of 1.0 g of pLAP*W7A, and 0.5 g of pLAP*W7F with or without 8 h of IL-1 treatment as compared to 0.5 g of LAP*. As illustrated in the represen tative autoradiograph (Figure 4-7B) and the 75

PAGE 76

corresponding densitometry analys is (Figure 4-7C), the W7A mu tant is unable to elicit an induction of the MnSOD enhancer/promoter driv en hGH expression in untreated cells and moreover definitively lost the abil ity to act additively with IL-1 Substitution of W7 with phenylalanine displayed functional characteristic s essentially identical to tryptophan at this position. These results clearly delin eate the critical importance of an aroma tic residue at this position. Discussion In this study, guided by the sequence conservation across mammalian species, a series of mutants were constructed. L4A, C11A, L12A, A18V and F19A ma intained similar levels of protein as well as full transcriptional activity whereas R3A, W7A and D8A displayed lower protein expression levels with a loss of transcri ptional activity. The 4P-A substitution displayed a similar level of protein to LAP*, however this mutation caused a complete loss of function. More interestingly, D8A and 4P-A acqui red the ability to repress the IL-1 -dependent-induction of hGH driven by MnSOD promoter coupled with its cognate enhancer. Further mutagenesis was performed with sites R3, W7 and D8 to study the chemical and/or structural importance of these residues. LAP* and LAP are translated from the same mRNA, with LAP* 21 amino acids longer at the amino terminus. After their discovery, most of the reports considered both of them as transcription activators without making a distinction on which isoform is responsible for the documented regulatory signals (Martinez-Jimenez et al., 2005; Park et al., 2008; Yarwood et al., 2008), and in many cases, it is confusing as to which isoform the researchers us ed in their studies. From the studies of Chapter 3 and the current ch apter, it is increasingly clear that full-length C/EBP /LAP* plays a central role in the IL-1 -dependent induction of MnSOD, and the Nterminal amino acid extension of LAP* is critical for its transcriptional activity. 76

PAGE 77

The importance of LAP* in the induction of MnSOD is further solidified by the systematic mutagenesis of the N-terminal 21 amino acids unique to LAP*. There has been only one other previous mutagenesis study that addresses the impor tance of the cysteine at position 11 (Su et al., 2003). These researchers implicated Cys11 as a potential site for disulfide bond formation with another internal cysteine. However, our results indicate that this posit ion is not required for LAP* transcriptional activity in our system. Instead, three other indi vidual conserved amino acids, W7, D8 and R3 along with a set of 4 cons ecutive proline residues were identified to be critical when substituted with alanines were either unable to induce MnSOD promoter/enhancer driven hGH expression or could beha ve as a repressor, inhibiting IL-1 induction. Furthermore, the mutagenesis studies in this chapter have illustrated that the chemical and/or structural characteristics of each individua l amino acid can be critically important to the protein function. For example, these data demons trated that the aromatic nature of W7 was necessary for LAP* activity since the protein substituted with another aromatic amino acid (W7F) retained wild type function, as a transcriptional activ ator, whereas alanine substitution was not tolerated. Similarly, the conserved substitution at position D8 with another negatively charged amino acid (D8E) maintained the transcriptiona l activity, illustrating the importance of the positive charge at this position. Unlike the D8A mutant, mutant D8N did not exert a repressive effect, indicating the stereo stru cture of D8 may also be import ant though not as crucial as the negative charge. Finally, for the site R3, any s ubstitution led to the loss of LAP* transcriptional activity. This occurred even when R3 was repl aced with a similarly charged amino acid (R3K), indicating that the positive charge of the residue is important and possibly the size/volume as well. In addition, it is also possible that the R3K substitution a ffects the modification status of 77

PAGE 78

the protein, even though both residues can be phosphorylated and acetylated, different enzymes may be required. Of particular note is the importance of the stretch of 4-5 proline residues given that substitution of these 4 prolines to alanines abo lished the transcriptional activity without affecting the protein expression level. Proline-rich seque nces tend to form a polyproline II (PPII) helix, an extended structure with 3 residues per turn. The PPII helix is rigi d and of great advantage in the rapid recruitment of interchangeab le protein partners. Proline-ri ch regions are frequently found either at the amino or carboxyl termini of enzy mes that are involved in signal transduction and also some transcription factors (reviewed in Kay et al., 2000). It was reported that Homer3, a dendritic proteins, could speci fically bind LAP* via its EVH1 domain to down-regulate the transcriptional activity of LAP*. It is know that the binding part ner of the EVH1 domain is a proline-rich region, though that group did not characte rize the N-terminal do main of LAP* to show what specific amino acid residues were important. It is therefore highly possible that the LPPPP amino acid sequence in LAP* served as the interface in this protein-protein interaction. In our system, it could possibly be another EVH1 contai ning protein/coactivat or that specifically interacts with LAP*, thus making it a str onger transcription ac tivator than LAP. 78

PAGE 79

Figure 4-1. Sequence alignment of LAP* N-te rminal amino acids. Sequence comparison was performed among human, chimpanzee, bovine, mouse and rat, and the numbering refers to the rat sequence. Arrows () repr esent translation start sites (methionines, M1and M22), shaded amino acids illustrate identity across species, and vertical triangles indicate the amino acids that were subjected to site-directed mutagenesis with the substitution of alanine residues except at position A18 where valine was the substitution. Underlined triangles (prolin e residues 13-16 or 4P) were mutated to alanines within a single vector. 79

PAGE 80

Figure 4-2. Protein over expression of the LAP* mutants. L2 cells were co-transfected with MnSOD promoter/enhancer-hGH reporter plas mid together with indicated expression vectors. 48h post-transfection, whole cell ex tracts were collected and subjected to immunoblot analysis with an antibody against C/EBP 80

PAGE 81

A B Figure 4-3. Functional evaluation of the N-terminal peptide unique to LAP*. L2 cells were cotransfected with MnSOD promoter/enhan cer-hGH reporter plasmid together with indicated expression vectors. Total RNA was collected with (B) or without (A) 8h of IL-1 treatment and then subjecte d to northern analysis. 81

PAGE 82

A B Figure 4-4. Densitometry analysis of northern analysis data in Fi gure 4-3. A) Densitometry from 3 independent experiments for mutants th at show no obvious changes compared to the pLAP* construct. B) Densitometry fr om 6 independent experiments showing those mutants that displayed an a ffect either in untreated or IL-1 exposed cells. Data are presented as the ratio of hGH to Cath B. Asterisks indicate statistical significance of changes in transcriptional activities in unstimulated conditions compared with LAP* with p 0.05, double stars present p 0.01. Crosses indicate statistical significance in enhanc ing or impeding IL-1 induction of MnSOD promoter/enhancer-hGH compared with empty vector pcDNA 3.1 with p 0.05. 82

PAGE 83

A B C Figure 4-5. Evaluation of D8 mutants. A) L2 cells were co-transfected with the MnSOD promoter/enhancer-hGH reporter construct together with empty pcDNA3.1 (pcDNA) or vectors expressing LAP* or LAP*D8 mutants. 48 h post transfection total cell extracts were collected followed by imm unoblot analysis with antibody against C/EBP B) RNA was collected with or without 8 h of IL-1 treatment, and subjected to northern blot an alysis with Cath B serving as the loading control. C) Densitometry was performed on 3 independent experiments. Data are presented as the fold induction derived from the hGH to Cath B ratios relative to the control (pcDNA). Asterisks indicate statistical significance of changes in transcri ptional activities in unstimulated conditions compared with LAP* with p 0.05, double stars represent p 0.01. Crosses indicate statistical signifi cance in enhancing or inhibiting IL-1 induction of MnSOD promoter/enhancer-hGH compared with empty vector pcDNA 3.1 with p 0.05. 83

PAGE 84

A B C Figure 4-6. Analysis of R3 mutants. A) L2 cells were co-transfected with the MnSOD promoter/enhancer-hGH reporter construct and the indicated amounts of LAP* or LAP*R3 mutants. pcDNA 3.1 was used to br ing the total amount of DNA transfected to 4 g. 48 h post transfection total cell ex tracts were collected, followed by immunoblot analysis with antibodies against C/EBP and actin. Shaded concentrations denote the tr ansfection conditions used in northern analysis. B) RNA was collected from cells either left untreated or exposed to IL-1 for 8 h, followed by northern analysis with Cath B serving as the loading control. C) Densitometry was performed on 3 independent experiments. Data are presented as the fold induction derived from the hGH to Cath B ratios relative to the control (pcDNA). Asterisks indicate statistical significance of changes in transcriptional activities in unstimulated conditions compared with LAP* with p 0.05, double stars represent p 0.01. Crosses indicate statistical significance in enhancing IL-1 induction of MnSOD promoter/enhancer-hGH compared with empty vector pcDNA 3.1 with p 0.05. 84

PAGE 85

A B C Figure 4-7. Examination of W7 mutants. A) L2 cells were co-transfected with the MnSOD promoter/enhancer-hGH reporter construct and the indicated amounts of LAP* or LAP*W7 mutants. pcDNA 3.1 was used to bring the total amount of DNA transfected to 4 g. 48 h post transfection to tal cell extracts were collected, followed by immunoblot analysis with antibodies against C/EBP and actin. Shaded concentrations denote the tr ansfection conditions used in northern analysis. B) RNA was collected from cells either left untreated or exposed to IL-1 for 8 h, followed by northern analysis with Cath B serving as the loading control. C) Densitometry was performed on 3 independent experiments. Data are presented as the fold induction derived from the hGH to Cath B ratios relative to the control (pcDNA). Asterisks indicate statistical significance of changes in transcriptional activities in unstimulated conditions compared with LAP* with p 0.05. Crosses indicate st atistical significance in enhancing IL-1 induction of MnSOD promoter/enhancer-hGH compared with empty vector pcDNA 3.1 with p 0.05. 85

PAGE 86

CHAPTER 5 IDENTIFICATION OF AN AMINO ACID RESPONSE ELEMEN T CONTROLLING FOXO3A GENE EXPRESSION AND THE ROLE OF THIS INTERNAL REGUALTORY ELEMENT IN THE RECRUITMENT OF RNA POLYMERASE II Introduction We became interested in the transcription factor FOXO3a based on its association with regulation of the human MnSOD gene through a dauer binding element (DBE) like sequence in the distal promoter (Kops et al., 2002). We then hypothesized that this tr anscription factor might also be regulated by amino acid availability, especially given its c onnection with insulin regulation. FOXO3a is a human analog of C. elegans protein DAF-16. It has been shown that when C. elegans is surrounded by a nutrient depleted envir onment, DAF-16 functions to mediate the entry into the dauer stage, where metabolic rate is reduced and life-span can be significantly enhanced (Ogg et al., 1997). Such effects can be disrupted by a daf-16 muta nt (Lin et al., 1997). The activity of DAF-16/FOXO3a is regulated by the Akt/PKB-dependent phosphorylation pathway. When nutrition is scarce, FOXO3a is unphosphorylated and actively binds to target genes exerting its function. When nutrient s become abundant, FOXO3a is phosphorylated by Akt and shuffled out of nucleus thus is no longer able to activate its target genes (Brunet et al., 1999; Brunet et al., 2002; Brunet et al., 2001; K ops and Burgering, 1999; Kops et al., 1999). This aspect of FOXO3a regulation has been ex tensively characterized. However, there is evidence that FOXO3a is regulated at the transc ription level as well during nutrition starvation, such as caloric restriction (Furuyama et al., 2002; Imae et al., 2003), and essential amino acid deprivation (Aiken et al, unpublished data), and the mechanisms are largely unknown. The studies in this chapter are de signed to define the amino acid response element (AARE) of the 86

PAGE 87

human FOXO3a gene, and study the role of this AARE in histidine deprivation elicited upregulation of FOXO3a. Detection of Amino Acid Deprivat ion and RNA Synthesis Regulation Organisms have developed various mechanisms to detect and cope with an unfavorable environment such as the cases of nutrient deficiency. Amino acid limitation leads to an increase in uncharged tRNAs, which subseque ntly interact and activate the protein kinase general control non-derepressible 2 (GCN2) prot ein. Activated GCN2 then phosphorylates and inactivates eukaryotic initiation factor 2 (eIF2 ), resulting in the sequestrati on of eIF2B. eIF2B functions as a guanine nucleotide-exchange fact ors to convert the inactive GDP-eIF2 to the active form GTP-eIF2 which is necessary for the binding of the Met-tRNAi Met to the ribosome. As a consequence of the scarcity of active eIF2 the concentration of tern ary complex decreases and global protein synthesis slows down (reviewed in Pain, 1994). As a positive response, the translation of sel ected amino acid biosynthetic enzymes such as GCN4 in yeast increases (Wek and Cavener, 200 7). GCN4 contains four short upstream open reading frames (uORF) and when GCN2 is activated, the low abundance of tRNAi Met results in a slow association with the S40 co mplex, allowing the proper translati onal initiation to occur at the GCN4 ORF, and the production of full le ngth GCN4 (Hinnebusch, 2005; Pain, 1994). Mammalian cells do not have a GCN4 homolog; instead, they possess a GCN4 ortholog termed activating transcription factor 4 (ATF4), which helps to mainta in a cellular homeostasis during essential amino acid limitation (rev iewed by Kilberg et al., 2005). ATF4 is upregulated through the same mechanism as the GCN4 in the yeast, an d ATF4 has been reported to regulate a number of genes including membrane transporters, transcription factors, growth factors, and metabolic enzymes through a consensus amino acid response element (AARE) whose core sequence is 5TGATGXAAX-3 (reviewed by Kilb erg et al., 2005). The AARE sequence is responsible for 87

PAGE 88

the maximum induction of RNA synthesis by ami no acid deprivation, and it has been identified in a number of genes, such as asparagine synthe tase (ASNS) (Pan et al., 2003), systems N and A transporters 2 (SNAT2) (Palii et al., 2004), cationic amino acid tr ansporter 1 (CAT1) (Lopez et al., 2007), C/EBP homology protein (CHOP) (Bruhat et al., 2000), Va scular endothelial growth factor (VEGF) (Roybal et al., 2005) and human homolog of the Drosophila tribble 3 protein (TRB3) (Ohoka et al., 2005). This sequence functi ons as an enhancer element in that it is position and orientation indepe ndent and can convey its am ino acid limitation-dependent responsiveness to a heterologous promoter. In conjunction with Dr. Aiken in our laborat ory, we have demonstr ated that FOXO3a is indeed upregulated by essential ami no acid deprivation and that this gene is an ATF4 target. The involvement of ATF4 was confirmed by the phe nomena that knockdown of ATF4 abolished the induction of FOXO3a by histidinol, which is a histidine analog and mimics histidine deprivation by sequestering the histid inyl-tRNA synthetase. Regulation of RNA Transcript ion Initiation and the Function of Enhancer Element The initiation stage is a key point of eukaryotic RNA synthesis. It is catalyzed by RNA polymerase II (Pol II) and requires a minimal set of general transcripti on factors (GTF) including TFIIA, TFIIB, TFIID, TFIIE, TFIIF and TFIIH. During the last a few decades, our knowledge of how gene expression is regulated by the cellular network of cis -acting elements and trans acting factors has evolved substantially. Major e fforts have invested in the study of two aspects of the transcription initiation: (i) the assembly of the pre-in itiation complex (PIC) at gene promoters and (ii) the contributi on of proximal and distal regulator y elements to the recruitment of GTFs to the core promoter. There has been a great deal of discussion concerning the mechanism by which a distant enhancer sends a signal or communi cates with its cognate gene promoter when the two elements 88

PAGE 89

can exist hundreds of kilo base pairs apart. To date, four different bu t not mutually exclusive hypotheses have been put forward: (i) The chromatin looping between the enhancer and promoters is a simple and attractive model (P tashne and Gann, 1997; Rippe et al., 1995; Wang and Giaever, 1988). (ii) The tracking or scanni ng model hypothesized th at the transcription machinery was recruited by an enhancer and tracks along the DNA until it reached its cognate promoter(Tuan et al., 1992). (iii) The linking model proposed the existence of facilitator proteins between the enhancer and its cognate pr omoter regions to convey the signal and activate transcription (Bulger and Groudine, 1999). (iv) The facilitated tracking model incorporated the looping and tracking models (Bl ackwood and Kadonaga, 1998; Traver s, 1999). This model also proposed that the transcript ional activating complex moved along the DNA dragging the enhancer element to meet the cognate promot er, and the intervening chromatin between the enhancer and the promoter thus progressively reels out through the enhancer complex and forms a loop. Recent studies have shown that enha ncers that are tens or hundreds of kilo base pairs away can be located close to the active gene promoters, suggesting that a chromatin loop forms between these two cis -acting elements, though current molecular assays cannot monitor the looping process. Given the belief of loop formation, the following model has become well accepted. Genespecific activator proteins first bind to the regulatory element such as enhancer, and then recruit GTFs to the promoter through mediator complexes (Bjorklund and Gustafsson, 2005; Orphanides and Reinberg, 2002). Ho wever, there were also reports stating that the GTFs could be recruited to the regulatory element to assemble the PIC. The best example is the human and mouse -globin gene in which TBP, TFIIB and Pol II bind to the locus control region (LCR) upstream of the -globin genes (Johnson et al., 2003; Routle dge and Proudfoot, 2002; Vieira et 89

PAGE 90

al., 2004). Another example comes from the T-cell receptor (TCR)locus. The activation of the pD 1 gene depends on an enhancer element, where associations of Pol II and the HAT CREB-binding protein have also be en observed (Spicuglia et al ., 2002). The enhancer element of androgen-responsive prostate-specific antigen (PSA) gene is also able to recruit Pol II in a hormone-dependent manner (Louie et al., 2003). Th is group further demonstrated that inhibition of the Pol II CTD phosphorylation bl ocked Pol II transfer from the enhancer to the promoter. However, the above and a few other exampl es all based on the situations that the regulatory elements are located upstream of the tran scriptional initiation site, and there are barely few convincing reports illustrati ng whether an internal enhanc er could also function as a nucleation center for PIC assembly and how an internal enhancer can contribute to transcriptional control of its c ognate gene. Most importantly, no studies have really addressed how an internal enhancer can, through a proposed looping model or facilitated tracking model, cope with a moving Pol II complex. In this st udy, the identification of the amino acid response element of FOXO3a provided an opport unity to study such mechanisms. Results Identification of the FOXO3a Amino Acid Response Element FOXO3a consists of 4 exons separated by 3 introns (Figure 5-1). The second intron is quite large, spanning approximately 101 kb. Until now no gene has been identified within this large intron, and computer programs such as VISTA does not recognize any region within this intron could be a potential exon for another gene. Furthermore, a blast of the EST (expressed sequence tag) database did not reveal any reasonable exons or open reading frames. How and why did FOXO3a acquire such a huge intron yet main tain extremely high identity in the protein sequence is currently a mystery. 90

PAGE 91

FOXO3a transcription has been determined in our laboratory to be upregulated by essential amino acid limitation, and knockdown of ATF4 by siR NA is able to effectively block such an induction. ATF4 exerts its function through an amino acid response element (AARE) with the core sequence of 5-TGATGXAAX-3. By a computer based sequence analysis, we identified 4 potential AAREs within or near the FOXO3a ge ne, which we designated as AARE1-4 (Figure 51). AARE1 is upstream of the first exon, AAR E2 and AARE3 are both located in the second intron and AARE4 is part of the third intron. Given that regulatory elements convey their signals to their cognate promoters by sequence-specific DNA binding factors, namely transc ription factors, and th e direct interaction between the DNA element and transcription factors is a premise, I first evaluated the binding of ATF4 to the potential FOXO3a AAREs. As shown in Figure 5-2, 2 mM of histidinol (HisOH) treatment, which mimics histid ine limitation, dramatically incr eased ATF4 occupancy in AARE2 region, but not in the promoter region or a ny other potential AAREs, indicating AARE2 is the functional AARE responsible for the FOXO3a induction by histidine deprivation. Knockdown of ATF4 abolished the histid inol elicited interactions be tween ATF4 and AARE2, further indicating the involvement of ATF4. The Binding Profile of Pol II to FOXO3a The binding of RNA Pol II within the coding region of the target gene is considered as a way to measure transcription in itiation and elongation (Sandoval et al., 2004). High levels of binding associate with ac tive transcription, and low levels of binding indicate low transcription rate. We thus evaluated the interactions betw een Pol II and the FOXO3a gene regions (Figure 53), and found that histidinol treatment elicited an increase in the binding of Pol II to AARE2, and this induction was disrupted by the knockdown of ATF4, indi cating the induction of Pol II binding to the FOXO3a AARE2 was AT F4 dependent. However, we were surprised to find that 91

PAGE 92

the binding of Pol II to the promoter region was constitutively high even when there was no histidinol treatment and the transcription rate is relatively low. In addition, ATF4 knockdown did not affect the association of Pol II and the FOXO3a promoter. On the contrary, the interactions between Pol II and AARE1, AARE3 and AARE4 were always low. AARE1 is 4 kb upstream of the +1 site, and does not reside in any other genes to our knowledge, so it is very likely that Pol II does not travel through this region. However, AARE3 is located in the second intron, and AARE4 is part of third intron. Acco rding to current knowledg e of transcription, Pol II needs to transcribe through thes e two regions, and histidinol tr eatment in theory should result in an increased binding of Pol II with a ChIP analysis. One possible explanation of high levels of pol II binding at AARE2 versus low levels at AARE3 and AARE4 is that the second intron of FOXO3a is such a large region that some portion of the translocating Pol II complexes fall off during the transcription elongation process, leading to low occupancy of Pol II observed in AA RE3 and AARE4. To test this hypothesis, we examined the binding of Pol II to the intervening region betw een the FOXO3a promoter and AARE2. As shown in Figure 5-4, only minimal level of Pol II binding to this region was observed, indicating that the high occupancy of Pol II on AARE2 region is not a result of multiple Pol II complexes either sliding through this region or falling off. The Function of AARE2 in the Recruitment of Pol II To test whether Pol II was recruited to AARE2 or just paused there, we evaluated the interaction between AARE2 and a few general tran scription factors (GTFs) that are known not to accompany a translocating Pol II complex as it tr avels through the gene during elongation. As shown in Figure 5-5, TBP and TFIIA are both indu ced to bind AARE2, with constitutive binding to the promoter and no interaction with the intervening region observed. These data demonstrated that the general transcription fa ctors TBP and TFIIA had a similar binding profile 92

PAGE 93

to that of Pol II, further i ndicating that the AARE2 region of FOXO3a may function as the nucleation center for PIC assembly. Phosphorylation of the Pol II C-terminal domai n (CTD) Ser 5 residues has been implicated in the transition from pre-ini tiation to elongation (reviewed in Phatnani and Greenleaf, 2006). We proposed that the Pol II recruited to the AARE2 region is activat ed by phosphorylation and then transferred to the promoter to enhance the transcription of FOXO3a. However, ChIP assays with an antibody recognizing the phosphorylated form of Pol II CTD Ser5 (CTD-Ser5-P) were not successful in detecting the signals from the FOXO3a promoter or the AARE2 region (Figure 5-6), probably due to the combination of low anti body affinity and low transcription rate. As a control to see whether th e antibody could be used for ChIP anal ysis, I also evalua ted the ratio of ASNS promoter, which was pulled down by the CTD-Ser5-P antibody, to the input, and found that histidinol treatment indu ced the CTD Ser5 phosphorylation on the ASNS promoter. Thus, I believe, demonstrates that this antibody is capable of a positive ChIP result. Discussion In this study, I demonstrated that histidine deprivation/his tidinol treatment induced the binding of ATF4 to the AARE2 region, and this binding was blocked wh en ATF4 is knocked down by siRNA. Pol II constitutively binds to the FOXO3a promoter, wh ereas the interaction with the AARE2 region is induced by histidine limitation, and this indu ction requires ATF4. Interestingly, Pol II is only weakly associated with the intervening region between the promoter and AARE2. Several general tran scription factors including TBP and TFIIA were also recruited to the AARE2 region after histidinol treatment. These observations led to my hypothesis that Pol II is constitutively associated with FOXO3a promoter but is hypophosphorylated and inactive. During essential amino acid deprivation, Pol II is recruited to AARE2 and is activated by phosphorylation. These events would presumably be followed by loop formation at which time 93

PAGE 94

the active hyperphosphorylated Pol II is transferred to the promoter to accelerate transcription. My attempts to use CTD-Ser5-P antibody to dete ct the Pol II CTD phosphor ylation status on the promoter and/or AARE2 were not successful, possibly due to the low affinity of the antibody. Alternatively, antibody against th e CDK7 subunit of TFIIH could be used to indicate the phosphorylation of Pol II CTD at serine 5, because Ser5 phosphorylation depends principally on the kinase activity of CDK7. If the antibody possesses enough affinity for ChIP analysis, by examining the timing of the CDK7 occupancy, one could verify my hypothes is that the active hyperphosphorylated Pol II is tran sferred from the FOXO3a enhancer (AARE2) to the promoter during the active expr ession of FOXO3a. The assembly of PIC was once considered to be specific to the transcription initiation sites because TFIID recognizes consensus sequence motifs that characterize core promoters, such as the TATA box, Initiator (Inr) and downstream promoter elem ent (DPE)(Butler and Kadonaga, 2002). However, analysis of the genomic seque nces from various species (for example, Drosophila, yeast and man) has provided eviden ce that many promoters lack the consensus TATA-box or DPE motifs (FitzGera ld et al., 2004; Kutach and Kadonaga, 2000; Suzuki et al., 2001). In addition, there is increasing amount of evidence that Pol II can also be recruited to distal regulatory elements (Louie et al., 2003; Spicuglia et al., 2002; Vieira et al., 2004; Ward et al., 1988). Based on these observati ons, Szutorisz et al. (Szutori sz et al., 2005) proposed a new model that after the binding of sequence-specific activators to the enhancer elements, chromatinmodifying complexes, GTFs, and Pol II are sequen tially recruited to the same region. The Pol II recruitment then leads to the intergenic transcri ption from the enhancer and the approaching of chromatin-modifying factors towards the cognate pr omoter, which facilitates the loop formation. Looping out of the intervening region results in co-localization of enhancer and the core 94

PAGE 95

promoter, and the GTFs and Pol II would then bind to the core promoter leading to the initiation of gene transcription. This model could par tially explain our observa tion with the following exceptions. (i) Is the Pol II recru ited by an intronic enhancer able to transcribe the reverse strand to reach the promoter? (ii) Why are there always high levels of Pol II binding on the promoter if the active Pol II is transferred from the enhancer? Although the odds were small, we could not rule out the possibility that Pol II and/or GTFs do not directly bind to the enhancer region per se and their association with the enhancer region, as observed in the ChIP analysis, was due to indi rect interaction resulted from loop formation. The cross-link reagent was form aldehyde, which generates crosslinks spanning approximately 2 though commercially available formaldehyde is polymerized and the actual cross-linking distance is unknown (Orlando et al ., 1997). There is no report about how close the Pol II and/or GTFs can reach to the distant chromatin region during loop formation, a circumstance that could also be gene and/or stimulus specific. Ther efore, it is possible that the Pol II and GTFs associated with promoter was so close to th e enhancer region that they are cross-linked by formaldehyde. On the other hand, the transcript ion factor ATF4 is too far away from the promoter to be cross-linked. Thus, although ATF4 was only associated with AARE2 but not the promoter region, it is still possi ble that the transcri ption machinery on the promoter region was cross-linked to the AARE2 region during his tidine limitation induced loop formation. Even with any negative or alternative interpre tations, the results demonstrate that the ATF4 binding to AARE2 is inducible and that withou t the presence of ATF4, Pol II binding to AARE2 is blocked. These results therefore implicate an apparently logical series of events where Pol II is recruited to an internal enhancer element, and this recruitment depe nds on the binding of a 95

PAGE 96

stimulus-dependent transcription factor. It is clear that the development of better methodology is required so that a clearer understanding of su ch complex events can be better achieved. 96

PAGE 97

Figure 5-1. Schematics of FOXO3a genomic struct ure. Exons (E1, E2, E3 and E4) are depicted by hatched boxes and potential AAREs (AARE1, AARE2, AARE3, and AARE4) are represented by vertical lines. 97

PAGE 98

* Figure 5-2. Association of ATF4 with FOXO3a promoter and AARE1-4 regions. HepG2 with/without transfection of AFT4 siRNA was treated with 2 mM of Histidinol (HisOH) for 4 h. ChIP assays were performed with an antibody against ATF4. Data were plotted as the ratio to the value of total DNA input for immunoprecipitation. The graphs are summary of three independent expe riments, in which data are depicted as the means SEM values. The asterisk i ndicates statistical significance with p 0.05 compared with the association with the AARE2 region with full media (Mock MEM); the cross indicates statistical significance with p 0.05 in blocking HisOH induced ATF4 interaction with the AARE2 region. 98

PAGE 99

* Figure 5-3. Association of Pol II with FO XO3a promoter and AARE1-4 regions. HepG2 with/without transfection of AFT4 siRNA was treated with 2 mM of Histidinol (HisOH) for 4 h. ChIP assays were performed with an antibody against Pol II. Data were plotted as the ratio to the value of total input for immunoprecipitation. The graphs are summary of three independent expe riments, in which data are depicted as the means SEM values. Asterisk indi cates statistical significance with p 0.05 compared with binding to the AARE2 region with full media and no siRNA treatment (Mock MEM); Cross indicates statistical significance with p 0.05 in blocking HisOH induced Pol II interac tion with the AARE2 region. 99

PAGE 100

*Figure 5-4. Association of Pol II with FOXO3a promoter, AARE2 and the intervening regions. HepG2 with/without 2 mM of Histidinol (H isOH) treatment was subjected to ChIP analysis with antibody against Pol II. Data we re plotted as the ratio to the value of total input for immunoprecip itation. The graphs are summ ary of three independent experiments, in which data are depicted as the means SEM values. Asterisk indicates statistical significance with p 0.05 compared with binding to the AARE2 region with full media (MEM). 100

PAGE 101

A B Figure 5-5. Association of TBP and TFIIA with FOXO3a promot er, AARE2 and the intervening regions. HepG2 with/without 2 mM of Histid inol treatment was subjected to ChIP analysis with antibodies against TBP (A) a nd TFIIA (B). Data were plotted as the ratio to the value of total input for immunoprecipitation. 101

PAGE 102

Figure 5-6. Association of Ser5 phosphorylated Pol II to FOXO3a promoter, FOXO3a AARE2 and ASNS promoter. HepG2 with/without 2 mM of Histidinol (HisOH) treatment was subjected to ChIP analysis with antibodies re cognizing Ser5 phosphorylated CTD. Data were plotted as the ratio to the value of total input fo r immunoprecipitation. 102

PAGE 103

CHAPTER 6 CONCLUSIONS AND FUTURE DIRECTIONS Conclusions MnSOD is a major defense against oxidative da mage in the mitochondria. Reduced levels of antioxidant enzymes compared with their normal counterpart, especially MnSOD, are found in a variety of cancer cells. Furthermore, th e overexpression of MnSOD has been found to suppress cancer cell growth (Amstad et al., 1997; Church et al., 1993; Davis et al., 2004; Liu et al., 1997; Liu et al., 2005) and tumors in vivo (C hurch et al., 1993; Davis et al., 2004; Li et al., 1998; Weydert et al., 2003). The work from our and other laboratories demonstrated that MnSOD transcription is highly regul ated via an intronic enhancer by a series of proinflammatory stimuli (Dougall and Nick, 1991; Jones et al., 1995; Lin et al., 1993; Masuda et al., 1988; Visner et al., 1991; Visner et al., 1990; Wong et al., 1989). This enha ncer is highly conserved among mammalian species, and since its discovery, lots of efforts have been made to uncover the mechanisms by which the MnSOD transcription is regulated. In our laboratory, the study of MnSOD gene regulation by cytokines is mostly done in L2 cells, which is a rat lung epithelia l like cell line. Dr. Chokas in our laboratory performed yeast One-hybrid assay to identify tran scription factors regulating MnS OD expression. When she used Site 2 sequence defined by Dr. Rogers as bait, she identified TEF-1, TEF -3 and p65; when she used Site 4 sequence as bait, she got positive clones of p65, C/EBP and C/EBP (Chokas, 2004). Dr. Chokas was studying how p65 and TEF acted coordinately to regulate MnSOD expression, and I started to fo cus on the functions of C/EBP and C/EBP Prior to my study, computer-based sequence analysis and EMSA indicated that C/EBP might be a potential trans-acti ng factor in the regulation of MnSOD expression, but there was no functional data. By utilizing C/EBP knockout MEF cells and siR NA knockdown approaches, I 103

PAGE 104

confirmed the involvement of C/EBP in the IL-1 -dependent MnSOD induction. I further verified that C/EBP and C/EBP were induced by IL-1 possibly to serve their own regulatory functions. A review of the l iterature indicated that C/EBP has three protein isoforms, and the majority of reports treated LAP* and LAP as transcription activators, while LIP was considered as a naturally occurring dominant negative form However, there were also a few studies showing the existence of great differences betw een LAP* and LAP. Guided by these findings, I cloned the cDNA for each isoform into the mammalian expression vector pCDNA3.1, and performed functional analysis utilizing an hGH reporter dr iven by the MnSOD enhancer conjugated with its cognate promoter. Only the vector containing LAP* cDNA could enhance hGH expression. Meanwhile, I found this construc t was leaky and that a small amount of LAP and LIP was also expressed. Fortunately, I was ab le to obtain constructs that only express one functional C/EBP protein isoform by mutating the star t codons (methionine) for LAP and/or LIP to alanines. This made the study of the f unctional relevance of the first 21 amino acids more valid and convincing. My functio nal analysis determined that only the LAP* isoform was the transcriptional activator in the IL-1 dependent-induction of MnSOD, while it appeared that LAP, LIP and C/EBP functioned as potential repressors Finally, I conducted systematic mutagenesis on the conserved amino acids in the amino terminal region of LAP*, and demonstrated that the R3, W7 and D8 and a stre tch of proline residues were critical for the transcriptional activity of LAP*. To further test the relevance of these first 21 amino acids, I then tried to treat cells with a peptide consisting of the first 21 amino acids of LAP*, as a potential peptide competitor to inhibit MnSOD induction by IL-1 However, it wasnt successf ul due to the lack of proper reagents (either a transfection reagent that is able to deliver the peptide in to the nucleus or a cell 104

PAGE 105

line possessing the following two attributes at the same time (i) MnSOD in this cell line responses to IL-1 treatment and (ii) it can be easily transfected). As a side project in the study of the transcriptional regulati on of MnSOD in our laboratory, Dr. Aiken investigated the re lationship between amino acid li mitation and MnSOD expression (Aiken et al., 2008). She found that essential am ino acid limitation and/or histidine deprivation led to MnSOD induction, and established the nutrient-dependent regulation pathway for MnSOD. Most relevantly, she demonstr ated that the upregulation of MnSOD is conferred by a FOXO binding site on the MnSOD promoter. Additional research done by her led to the discovery of FOXO3a as a target gene of ATF4 during amino acid deprivation. In collaboration with her, I found that histidine deprivation which was achie ved by histidinol treatment caused a specific enrichment of ATF4 in the AARE2 region, which was abolished when ATF4 was knocked down. Pol II is also induced by histidinol treatm ent to interact with th e AARE2 region, and this interaction is ATF4-dependent. On the c ontrary, the occupancy of Pol II on the FOXO3a promoter was constitutively hi gh and independent of ATF4, wher eas the interactions between Pol II and other potential AAREs were really low. Most interesti ngly, only trace levels of pol II binding to the intervening regi on between the FOXO3a promoter and AARE2 were observed. Additional ChIP analysis depict ed the phenomena that GTFs such as TBP and TFIIA were also recruited to the AARE2 region after histidinol treatment, indicating the assembly of PIC on the AARE2 region. Future Directions C/EBP is a master regulator of a wide vari ety of biological processes, such as inflammation, cell differentiation an d cell proliferation. In many cases, no distinction between LAP* and LAP was made. In this study, I cl early demonstrate that LAP* is the only transcription activator for MnSOD induction by IL-1 and my systematic mutagenesis identified 105

PAGE 106

R3, W7, D8 and P13-P16 as functionally important residue s, however, we dont know why and/or how. Identification of the interacting protein partners of LA P* is one direction to go. To this end, the first 21 amino acids can be utilized as bait to perform yeast Two-hybrid screening. Alternatively, LAP* and LAP could be separately transfected into cells, antibody against C/EBP can be then used to do immunoprecipitation. Separation of the preci pitate with an SDSPAGE followed by silver staining will theoretically show different protei n partners that are pulled down (most likely, the extra domain of LAP* confers the capability to interact with an additional set of protein partners). The dist inct bands could be cut out and sent for mass spectrometry. After the identificat ion of the new partners, the next step is to study whether the expression of this partner is also regulated by IL-1 Depending on the potential function of the partners, experiments could be designed to study whether these partners are able to modify LAP*/LAP, through what domain they interact with LAP*/LAP, and how they contribute to the LAP*-dependent transcription activation of MnSOD. Although primary efforts to use the first 21 am ino acid peptide as a competitor to block LAP* activity (appendix), were not successful, it is still promising to pursue this aim. In order to achieve this goal, one or more improvements as stated below may be considered. (i) The reagent Chariot is only able to deliver the peptide/ protein into the cytoplasm where the cargo gets released. So if we can engineer a short NLS to the 21 amino acid-peptide, the new peptide will be able to enter the nucleus to exert its function upon its entrance into the cytoplasm with the assistance of Chariot. (ii) Othe r peptide delivery reagents such as Penetratin 1, which is claimed to be able to deliver a peptid e to the cytoplasm and nucleus, can be used. Having a free thiol group is the prerequisite of car gos for Penetratin 1, and the 21 amino-acid peptide happens to contain a cysteine residue which is not important for the MnSOD induction by IL-1 (iii) The 106

PAGE 107

vector expressing GFP-25 amino aci ds fusion protein contains a blasticidine resistance gene; and the apparent transfection efficiency can be in creased by blasticidine selection if it works properly. (iv) A retro-viral vector can be used to achieve high tr ansfection efficiency to deliver the peptide competitor. Additionally, RNA isolated from cells transfec ted with one of the following constructs: LAP*, LAP and LAP*4PA could be analyzed with microarray to get a global view of other genes differently regulated by LAP* and LAP (for this purpose, easily transfected cells such as HEK293 can be used). Most relevantly, this approach can clearly demonstrate whether LAP*4PA could be used as a dominant negative form for those genes that are specifically regulated by LAP*. The advantage of using LA P*4PA over LIP is that LAP*4PA will not affect the expression of those genes that are sp ecifically regulated by LAP. As C/EBP is a master regulator of numerous genes and is involved in a variety of biol ogical processes, this could be beneficial in blocking certain physiological or pathological processes, such as B cell differentiation and adipogenesis. As another avenue, neither LAP* nor LAP has ev er been crystallized, and it will be a great contribution to the knowledge of this transcription factor if the structure could be solved. The structure will provide information about whethe r the extra domain of LAP* functions as an interface for the recruitmen t of binding partners, or whether it can help LAP* to form a tertiary structure different from LAP. The structure will also help a lot in understanding how LAP*/LAP exert their transcriptional activity. Another area of future studies lies in furt her understanding the regul ations of the FOXO3a target genes under nutrient deprivat ion. FOXO3a has been linked to a variety of cellular events including regulations of cell cycles; cell proliferation, cell differentiation and glucose 107

PAGE 108

homeostasis. The fact that it is induced by amino acid deprivation raises two questions. (i) Is FOXO3a involved in the regula tion of other amino acid respons ive genes? To address this question, an siRNA approach can be employe d to knock down the endogenous FOXO3a level, and then the expression pattern of those genes that are induced by amino acid deprivation, such as MnSOD, ASNS, the sodium coupled amino aci d transporter (SNAT2), and vascular epithelial growth factor (VEGF) should be evaluated. (ii) Are the known FOXO3a target genes, such as Bcl-2-interacting mediator of cell death (Bim) (Dijkers et al ., 2000) B cell translocation gene (BTG1) (Bakker et al., 2004) Cited2 (sCBP/p300-interacting transactivator with a Glu/Asp-rich C-terminal domain) (Bakker et al., 2007) also induced by amino acid deprivation? This can be addressed by investigating the e xpression pattern of those genes in different amino acid starved cell lines. Another area of interest is to investigate whether and how amino aci d deprivation leads to FOXO3a post-translational modifica tion. It has been reported that in response to insulin, insulinlike growth factors, growth fact ors and neurotrophic f actors, FOXO3a is phos phorylated at three conserved sites (Thr32, Ser253 and Ser315 for hu man FOXO3a) by protein kinase Akt and SGK causing its sequestration in the cytoplasm. (Br unet et al., 1999; Lin et al., 1997; Ogg et al., 1997; Shen et al., 2006; Yellaturu et al ., 2002) It is interesting to know whether amino acid deprivation can reverse this process to reloca te the FOXO3a back to the nucleus to active its target genes. In addition, acetylation of FOXO proteins by prot ein acetylases such as CBP (CREB-binding protein), p300 and PCAF (p300/CBP-associated f actor) (Daitoku et al., 2004; Fukuoka et al., 2003; Matsuzaki et al., 2005), and deacetylati on by members of the SIR2/SIRT family of deacetylases is also reported to regulate FOXO protein cellular location and activity (Brunet et 108

PAGE 109

al., 2004; Motta et al., 2004), and it is interes ting to characterize whether such modifications occur and through what pathways they occur under amino acid deprivation. 109

PAGE 110

APPENDIX USE OF THE FIRST 21 AMINO AC IDS OF THE FULL LENGTH C/EBP AS A PEPTIDE COMPETITOR Introduction C/EBP mRNA can be translated into three diff erent protein isoforms, namely LAP*, LAP and LIP. As demonstrated in Chapter 3, the full-length C/EBP /LAP* is functionally divergent from LAP in regulating certain genes, such as MnSOD. This difference was conferred by the extra N-terminal domain of LAP* that is comp osed of 21 or so amino acids. As stated in Chapter 4, this unique domain of LAP* is hi ghly conserved among mammalian species and is critical for the transcriptional ac tivity of LAP*. It may serve as another transcriptional activation domain to interact with one or more compone nts of the transcription machinery, or it may function as a protein-protein in teraction domain to recruit chromatin modifying enzymes, coactivators or the mediator complex. If we could deliver a large amount of free peptide with the same sequence as the first 21 amino acid of LAP* into the nucleus, or express a fusion protein consisting of this peptide and a non-DNA binding nuclear protein, we may be able to compete with the acting interface of LAP* or sequester the LAP* binding partner, thus block LAP*specific transcriptional activity. To this end, there are two major approaches that could be chosen. (i) Delivering an overexpression vector into the target cell. This is usually carried out by transient transfection. However, the common problem associated with this approach is low transfection efficiency, which sometimes can be overcome by drug sele ction based on the drug resistance gene integrated in the plasmid. Delivery of overe xpression vectors can be performed with viral vectors as well, such as retro-vira l vector, and the infection by viru s is usually more efficient than transient transfection. 110

PAGE 111

(ii) Using a protein/peptide deliv ery reagent, such as ChariotTM (Active Motif). As claimed by the manufacturer, Chariot is a 2843 Dalton pe ptide and forms a non-covalent complex with the protein/peptide for transfecti on. Chariot stabilizes and delivers the cargo into cells with high efficiency, low cellular toxicity, and only needs a couple of hours. This event is independent of the endosomal pathway, which could possibly m odify macromolecules du ring internalization. After delivery, the complex dissociates, leaving the macromolecule biologically active and free to proceed to its target organelle. Theoretically it is a fast way to examine the effect of the peptide competitor. In addition, this approach ha s little side effect give n that the samples are collected within a couple of hours, and there is not enough time fo r the cells to elicit cellular response to the treatment. Results Transfection by Traditional DNA Delivery Reagents The first 25 amino acids of rat LAP* was fu sed to GFP, and to insure the nuclear localization of the fusion protein, 2 X SV40 T-an tigen nuclear localiza tion sequence (NLS) was cloned to the C terminus of the GFP sequence, and this construct was designated as 25aa-GFP2NLS. As a functional control, GFP with 2X NLS (termed as GFP-2NLS) was also constructed (Figure A-1). A PEF6 vector wi th a blasticidin resistance gene was used as the overexpression system. Transfection was conducted with Lipofectamine LTX (Invitrogen), and 24 h post transfection, cellular localization as well as transfection efficiency was evaluated with fluorescent microscopy. As shown in Figure A-2, without the NLS (Figure A-2B), GFP dispersed in both cytoplasm and nucleus. By comparing the amount of GFP fluorescent cells (Figure A-2B) with total cell number (Figure A2A), we determined that the transfection efficiency was about 30-40%. By fusing 2X NL S into the C terminus, GFP fusion protein was 111

PAGE 112

successfully transported into the nuclei, regardless of the extra 25 amino acids in the N terminus. RNA was collected with or without 2 h of IL-1 treatment, and tested for the relative MnSOD mRNA level. Cells transfected with GFP-2NLS or 25aa-GFP-2NLS showed little difference (data not shown). This is possibly due to the low transfection efficiency. To achieve higher apparent transfection efficiency, blasticidin was us ed to select for transf ected cells. Typically, mammalian cells are sensitive to 1-10 g/mL of blasticidin. Unexpectedly, L2 cells were resistant to a concentration of 200 g/mL or ev en higher. The same experiment was also performed in human fetal lung fibroblast (H FL) cells, which is sensitive to 5 g/mL of blasticidin. However, when examined under the fl uorescent microscope after selection, an even smaller fraction of cells showed GFP expression (Data not shown). Transfection by a Peptide Delivery Reagent The peptide delivery reagent, Chariot, is clai med to have a transfection efficiency of 6590%. As Dr. Kilberg kindly provided the N-te rminal domain of human LAP* as a synthetic peptide, I conducted the transfection with Chariot in a human fetal lung fibrobl ast (HFL) cell line (Figure A-3). A titration of the peptide was pe rformed, and at 3 h post transfection, Chariot was washed off with PBS, and HFL cells were treated with 2 ng/mL of IL-1 for 2 h. Total RNA was collected and subjected to real-t ime RT PCR analysis. As show n in Figure A-3, transfection of the peptide did not affect the IL-1 mediated MnSOD induction, a nd this unresponsiveness could be attributed to the characteristics of the Char iot delivering system. Chariot can only transport its cargo across the cell membrane. Once in the cytoplasm, Chariot will release the cargo, whose location will be determined by its own characteristics. It is possible that the peptide was retained in the cytoplasm and we could not prove whethe r/where the polypeptide was delivered, neither were we able to prove whethe r the polypeptide was degraded. 112

PAGE 113

Purification of His-tagged GFP Protei n from Bacterial Expression System To insure that the transfected protein goes into the nucleus, and to monitor its cellular localization, I tried to isolate pure 25aa-GFP-2NLS protein from bacterial expression system. To this end, I subcloned GFP-2NLS and 25aa-GFP-2N LS into a bacterial expression vector pQE2 (Qiagen), which contains an N-terminal 6X Hi s tag (Figure A-4A). Great induction by IPTG was achieved in the bacterial expression system (Figure A-4B). However, both proteins aggregated in the inclusion bodies, presumably due to the massive production inside the bacterial cells. Therefore, purification was performe d under denaturing conditions. Following the protocol described in Chapter 2, I eluted the purified protein w ith an elution buffer containing 8M of urea. For the delivery of proteins into mammalian ce lls by Chariot, the purif ied proteins need to be refolded and finally dissolved in PBS. To th is end, a stepwise dialysis protocol (Tsumoto et al., 1998) was conducted to refold the denatured protein. And the final product was examined by SDS-PAGE followed by Coommassie Brilliant Blue staining. Unfortunately, the yield of dialysis was only ~5%, and when the final refo lded product was delivered by Chariot into the cells, no fluorescence was detected. Discussion C/EBP is a master transcription regulator and it is involved in a variety of physiological and pathological pathways. There are numerous references to the fact that the short C/EBP protein isoform/LIP contains no transactivati on domain, therefore functions as a naturally occurring dominant negative form. However, th e functional disparity be tween the full-length C/EBP /LAP* and medium length LAP has not been extensively studied. The results in Chapter 3 showed that LAP* and LAP function in the opposite ways in regulating MnSOD during IL-1 dependent response. And studies presented in Chapter 4 113

PAGE 114

demonstrated that the chemical and structural properties of th e first 21 or so amino acids is critical for the transcriptional activity of LA P*. The unique extra domain of LAP* probably functions as an interaction domain to recruit co factors or to interact with the transcription machinery. Therefore, blocking the interaction be tween this domain and its binding partner will lead to repression of the genes that are actively regulated by LA P* without affecting the genes that are positively regulated by LAP. Improvements can be made for both of the approaches I undertook. For example, viral vectors can be used to overexpress fusion protei ns consisting of GFP and the N terminal domain of LAP*. Other peptide delivery reagents can also be used, su ch as Penetratin 1, which is claimed to be able to deliver a peptide to th e cytoplasm and nucleus. The requirement of the peptide cargo for Penetratin 1 is that it must ha ve a free thiol group to be directly coupled to Penetratin 1. This unique tran sactivation domain of LAP* does contain a cysteine group which was determined to be unimportant in IL-1 -dependent induction of MnSOD. Once the system is established in tissue culture, it c ould also be applied to animal models to control the expression of MnSOD and other LAP* target genes in vivo 114

PAGE 115

Figure A-1. Schematic of GFP constructs. 2X nuc lear localization signal (NLS) was fused to the C-terminus to create chimeric proteins GFP-2NLS and 25aa-GFP-2NLS. The latter construct also contains the N-terminal 25 amino acids from rat LAP*. 115

PAGE 116

A B C D Figure A-2. Localization of GFP constructs. (A) Phase contrast photograph of L2 cells for the same field of (B). GFP (B), GFP-2NLS (C) and 25aa-GFP-2NLS (D) overexpression vectors were transfected into L2 cells by Lipofectamine LTX. Photos were taken at 24 h post transfection. The bottom left square of (B, C, and D) is a single cell with a higher magnitude. 116

PAGE 117

Figure A-3. Effect of synthetic peptide on MnSOD expressio n. HFL cells were transfected with indicated amount of synthetic peptide with Chariot transfection r eagent. At 3 h post transfection, cells were washed and subjec ted to the treatment of 2 ng/mL of IL-1 for 2 h. RNA was then collected and the relative MnSOD mRNA level is examined by real-time RT PCR. The data are presen ted as ratios of MnSOD mRNA levels to cyclophilin A mRNA levels. The ratio of no tran sfection without treatment is set to 1. 117

PAGE 118

A B Figure A-4. Expression of His tagged GFP constructs in bacterial system. A) Schematics of the bacterial expressed GFP fusion proteins B) XL-10gold was transformed with expression vectors for His-GFP-2NLS (G FP) or His-25aa-GFP-2NLS (25aa-GFP) and incubated at 37C to reach an A600 reading of 0.8, and then IPTG was added to a final concentration of 1 mM. 3 h later, 100 L of bacteria with or without IPTG induction was collected and subjected to SDS-PAGE followed by Coommassie Brilliant Blue staining. 118

PAGE 119

Figure A-5. Purification profiles of GFP proteins. Indicated frac tions of His-GFP-2NLS (GFP) or His-25aa-GFP-2NLS (25 aa-GFP) were analyzed by SDS-PAGE coupled with Coommassie Brilliant Blue staining. S, supernatant; FT, flow-through of supernatant; W, flow-through of first wash; E, elution from the Ni-NTA column. 119

PAGE 120

Figure A-6. Examination of refolding product by SDS-PAGE. After refolded with a sequential dialysis approach, the final product was evaluated by SDS-PAGE followed by Coommassie Brilliant Blue staining. Increasing amounts of BSA protein served as concentration standards. 120

PAGE 121

LIST OF REFERENCES Aiken, K. J., Bickford, J. S., Kilberg, M. S., and Nick, H. S. (2008). Metabolic regulation of manganese superoxide dismutase expression vi a essential amino acid deprivation. J Biol Chem 283, 10252-10263. Akira, S., Isshiki, H., Sugita, T., Tanabe, O., Kinoshita, S., Nishio, Y., Nakajima, T., Hirano, T., and Kishimoto, T. (1990). A nuclear factor for IL-6 expression (NF-IL6) is a member of a C/EBP family. Embo J 9 1897-1906. Alam, T., An, M. R., and Papaconstantinou, J. (1992). Differential expression of three C/EBP isoforms in multiple tissues during th e acute phase response. J Biol Chem 267, 5021-5024. Amstad, P. A., Liu, H., Ichimiya, M., Berezesky I. K., and Trump, B. F. (1997). Manganese superoxide dismutase expression inhibits soft agar growth in JB6 clone41 mouse epidermal cells. Carcinogenesis 18, 479-484. Aust, S. D., Roerig, D. L., and Pederson, T. C. (1972). Evidence for superoxide generation by NADPH-cytochrome c reductase of rat live r microsomes. Biochem Biophys Res Commun 47, 1133-1137. Bakker, W. J., Blazquez-Domingo, M., Kolbus, A ., Besooyen, J., Steinlein, P., Beug, H., Coffer, P. J., Lowenberg, B., von Lindern, M., and va n Dijk, T. B. (2004). FoxO3a regulates erythroid differentiation and i nduces BTG1, an activator of protein arginine methyl transferase 1. J Cell Biol 164 175-184. Bakker, W. J., van Dijk, T. B., Parren-van Amelsvoort, M., Kolbus, A., Yamamoto, K., Steinlein, P., Verhaak, R. G., Mak, T. W., Beug, H., Lowenberg, B., and von Lindern, M. (2007). Differential regulation of Foxo3a targ et genes in erythropoiesis. Mol Cell Biol 27, 3839-3854. Birkenkamp, K. U., and Coffer, P. J. (2003). Regu lation of cell survival and proliferation by the FOXO (Forkhead box, class O) subfamily of Fo rkhead transcription factors. Biochem Soc Trans 31, 292-297. Bjorklund, S., and Gustafsson, C. M. (2005). The yeast Mediator complex and its regulation. Trends Biochem Sci 30, 240-244. Blackwood, E. M., and Kadonaga, J. T. (1998). Goi ng the distance: a current view of enhancer action. Science 281, 60-63. Bruhat, A., Jousse, C., Carraro, V., Reimold, A. M., Ferrara, M., and Fafournoux, P. (2000). Amino acids control mammalian gene transcription: activating transc ription factor 2 is essential for the amino acid responsivene ss of the CHOP prom oter. Mol Cell Biol 20, 7192-7204. 121

PAGE 122

Brunet, A., Bonni, A., Zigmond, M. J., Lin, M. Z., Juo, P., Hu, L. S., Anderson, M. J., Arden, K. C., Blenis, J., and Greenberg, M. E. (1999). Akt promotes cell survival by phosphorylating and inhibiting a Forkhead transcription factor. Cell 96, 857-868. Brunet, A., Kanai, F., Stehn, J., Xu, J., Sarbassova, D., Frangioni, J. V., Dalal, S. N., DeCaprio, J. A., Greenberg, M. E., and Yaffe, M. B. (2002). 14-3-3 transits to the nucleus and participates in dynamic nucleocytop lasmic transport. J Cell Biol 156, 817-828. Brunet, A., Park, J., Tran, H., Hu, L. S., Hemmin gs, B. A., and Greenberg, M. E. (2001). Protein kinase SGK mediates survival signals by phosphor ylating the forkhead transcription factor FKHRL1 (FOXO3a). Mol Cell Biol 21 952-965. Brunet, A., Sweeney, L. B., Sturgill, J. F., Chua, K. F., Greer, P. L., Lin, Y., Tran, H., Ross, S. E., Mostoslavsky, R., Cohen, H. Y. et al. (2004). Stress-depende nt regulation of FOXO transcription factors by the SIRT1 deacetylase. Science 303, 2011-2015. Bulger, M., and Groudine, M. (1999). Looping versus linking: toward a model for long-distance gene activation. Genes Dev 13, 2465-2477. Burgess-Beusse, B. L., Timchenko, N. A., a nd Darlington, G. J. (1999). CCAAT/enhancer binding protein alpha (C/EBPalpha) is an impor tant mediator of mouse C/EBPbeta protein isoform production. Hepatology 29, 597-601. Butler, J. E., and Kadonaga, J. T. (2002). The RNA polymerase II core promoter: a key component in the regulation of gene expression. Genes Dev 16, 2583-2592. Cao, Z., Umek, R. M., and McKnight, S. L. (1991). Regulated expression of three C/EBP isoforms during adipose conversion of 3T3-L1 cells. Genes Dev 5, 1538-1552. Cardinaux, J. R., Allaman, I., and Magistretti, P. J. (2000). Pro-inflam matory cytokines induce the transcription factors C/EBPbeta and C/EBPdelta in astrocytes. Glia 29 91-97. Carlsson, L. M., Jonsson, J., Edlund, T., and Ma rklund, S. L. (1995). Mice lacking extracellular superoxide dismutase are more sensitive to hyperoxia. Proc Natl Acad Sci U S A 92, 62646268. Castrillon, D. H., Miao, L., Kollipara, R., Horner J. W., and DePinho, R. A. (2003). Suppression of ovarian follicle activation in mice by the transcription factor Foxo3a. Science 301, 215218. Cesena, T. I., Cardinaux, J. R., Kwok, R., and Schwartz, J. (2007). CCAAT/enhancer-binding protein (C/EBP) beta is acetylated at multiple lysines: acetylation of C/EBPbeta at lysine 39 modulates its ability to activ ate transcription. J Biol Chem 282, 956-967. Chang, C. J., Chen, T. T., Lei, H. Y., Chen, D. S., and Lee, S. C. (1990). Molecular cloning of a transcription factor, AGP/EBP, that belongs to members of the C/EBP family. Mol Cell Biol 10, 6642-6653. 122

PAGE 123

Chokas, A. L. (2004). The identification of tr ans-acting factors that mediate the manganese superoxide dismutase enhancer function. PhD thesis, University of FLorida. Chomczynski, P., and Sacchi, N. (1987). Singl e-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162, 156-159. Church, S. L., Grant, J. W., Ridnour, L. A., Ober ley, L. W., Swanson, P. E., Meltzer, P. S., and Trent, J. M. (1993). Increased manganese s uperoxide dismutase expression suppresses the malignant phenotype of human melanoma cells. Proc Natl Acad Sci U S A 90, 3113-3117. Clark, J. M., and Lambertsen, C. J. (1971). Pu lmonary oxygen toxicity: a review. Pharmacol Rev 23, 37-133. Corral, J., Forster, A., Thompson, S., Lampert, F ., Kaneko, Y., Slater, R., Kroes, W. G., van der Schoot, C. E., Ludwig, W. D., Karpas, A., and et al. (1993). Acute leukemias of different lineages have similar MLL gene fusions encoding related chimeric prot eins resulting from chromosomal translocation. Proc Natl Acad Sci U S A 90, 8538-8542. Crapo, J. D., and Tierney, D. F. (1974). Supe roxide dismutase and pulmonary oxygen toxicity. Am J Physiol 226, 1401-1407. Daitoku, H., Hatta, M., Matsuzaki, H., Aratani, S., Ohshima, T., Miyagishi, M., Nakajima, T., and Fukamizu, A. (2004). Silent information regulator 2 potentiates Foxo1-mediated transcription through its deacetylase activity. Proc Natl Acad Sci U S A 101, 10042-10047. Davis, C. A., Hearn, A. S., Fletcher, B., Bickfor d, J., Garcia, J. E., Leveque, V., Melendez, J. A., Silverman, D. N., Zucali, J., Agarwal, A., and Nick, H. S. (2004). Potent anti-tumor effects of an active site mutant of human manga nese-superoxide dismutase. Evolutionary conservation of product inhibition. J Biol Chem 279, 12769-12776. del Rio, L. A., Sandalio, L. M., Palma, J. M., Bueno, P., and Corpas, F. J. (1992). Metabolism of oxygen radicals in peroxisomes and cellular implications. Free Radic Biol Med 13, 557580. Descombes, P., Chojkier, M., Lichtsteiner, S., Falvey, E., and Schibler, U. (1990). LAP, a novel member of the C/EBP gene family, encodes a liver-enriched transcriptional activator protein. Genes Dev 4, 1541-1551. Descombes, P., and Schibler, U. (1991). A liver-e nriched transcriptional activator protein, LAP, and a transcriptional inhibitory protein, LIP, are translated from the same mRNA. Cell 67, 569-579. Dijkers, P. F., Medema, R. H., Lammers, J. W., Koenderman, L., and Coffer, P. J. (2000). Expression of the pro-apoptotic Bcl-2 family member Bim is regulated by the forkhead transcription factor FKHR-L1. Curr Biol 10, 1201-1204. DiSilvestre, D., Kleeberger, S. R., Johns, J ., and Levitt, R. C. (1995). Structure and DNA sequence of the mouse MnSOD gene. Mamm Genome 6, 281-284. 123

PAGE 124

Dougall, W. C., and Nick, H. S. (1991). Manganese superoxide dismutase: a hepatic acute phase protein regulated by interleukin-6 and glucocorticoids. Endocrinology 129, 2376-2384. Dringen, R., Pawlowski, P. G., and Hirrlinger, J. (2005). Peroxide detoxification by brain cells. J Neurosci Res 79, 157-165. Eaton, E. M., Hanlon, M., Bundy, L., and Sealy, L. (2001). Characterization of C/EBPbeta isoforms in normal versus neoplastic ma mmary epithelial cells. J Cell Physiol 189, 91-105. Eaton, E. M., and Sealy, L. ( 2003). Modification of CCAAT/enha ncer-binding protein-beta by the small ubiquitin-like modifier (SUMO) fam ily members, SUMO-2 and SUMO-3. J Biol Chem 278, 33416-33421. Farr, S. B., D'Ari, R., and Touati, D. (1986). Oxygen-dependent mutagene sis in Escherichia coli lacking superoxide dismutase. Proc Natl Acad Sci U S A 83, 8268-8272. FitzGerald, P. C., Shlyakhtenko, A., Mir, A. A., and Vinson, C. (2004). Clustering of DNA sequences in human pr omoters. Genome Res 14, 1562-1574. Fridovich, I. (2004). Mitochondria: are they the seat of senescence? Aging Cell 3, 13-16. Fukuoka, M., Daitoku, H., Hatta, M., Matsuzaki, H., Umemura, S., and Fukamizu, A. (2003). Negative regulation of forkhead transc ription factor AFX (Foxo4) by CBP-induced acetylation. Int J Mol Med 12, 503-508. Fukuoka, T., Kitami, Y., Okura, T., and Hiwada, K. (1999). Transcriptional regulation of the platelet-derived growth fact or alpha receptor gene via CCAAT/enhancer-binding proteindelta in vascular smooth muscle cells. J Biol Chem 274, 25576-25582. Furuyama, T., Nakazawa, T., Nakano, I., and Mori, N. (2000). Identification of the differential distribution patterns of mRNAs and cons ensus binding sequences for mouse DAF-16 homologues. Biochem J 349 629-634. Furuyama, T., Yamashita, H., Kitayama, K., Hi gami, Y., Shimokawa, I., and Mori, N. (2002). Effects of aging and caloric restriction on the gene expres sion of Foxo1, 3, and 4 (FKHR, FKHRL1, and AFX) in the rat skeletal muscles. Microsc Res Tech 59, 331-334. Galili, N., Davis, R. J., Fredericks, W. J., Mukhopadhyay, S., Rauscher, F. J., 3rd, Emanuel, B. S., Rovera, G., and Barr, F. G. (1993). Fusion of a fork head domain gene to PAX3 in the solid tumour alveolar rhabdomyosarcoma. Nat Genet 5, 230-235. Gibbs, L. S., Del Vecchio, P. J., and Shaffer, J. B. (1992). Mn and Cu/Zn SOD expression in cells from LPS-sensitive and LPS-re sistant mice. Free Radic Biol Med 12 107-111. Gonzalez-Zulueta, M., Ensz, L. M., Mukhina, G., Lebovitz, R. M., Zwacka, R. M., Engelhardt, J. F., Oberley, L. W., Dawson, V. L., and Da wson, T. M. (1998). Manganese superoxide dismutase protects nNOS neurons from NMDA and nitric oxide-mediated neurotoxicity. J Neurosci 18, 2040-2055. 124

PAGE 125

Greenberger, J. S., and Epperly, M. W. (2007). Re view. Antioxidant gene therapeutic approaches to normal tissue radioprotection a nd tumor radiosensitization. In Vivo 21, 141-146. Guo, S., Rena, G., Cichy, S., He, X., Cohen, P ., and Unterman, T. (1999). Phosphorylation of serine 256 by protein kinase B disrupts tran sactivation by FKHR and mediates effects of insulin on insulin-lik e growth factor-binding protei n-1 promoter activity through a conserved insulin response sequence. J Biol Chem 274, 17184-17192. Halliwell, B., and Chirico, S. (1993). Lipid pero xidation: its mechanism, measurement, and significance. Am J Clin Nutr 57, 715S-724S; discussion 724S-725S. Hillion, J., Le Coniat, M., Jonveaux, P., Berger R., and Bernard, O. A. (1997). AF6q21, a novel partner of the MLL gene in t(6;11)(q21;q23), defines a forkh ead transcriptional factor subfamily. Blood 90, 3714-3719. Hinnebusch, A. G. (2005). Translat ional regulation of GCN4 and the general amino acid control of yeast. Annu Rev Microbiol 59, 407-450. Ho, Y. S., and Crapo, J. D. (1988). Isolati on and characterization of complementary DNAs encoding human manganese-containing superoxide dismutase. FEBS Lett 229, 256-260. Hoekman, M. F., Jacobs, F. M., Smidt, M. P., and Burbach, J. P. (2006). Spatial and temporal expression of FoxO transcription factors in the developing and adult murine brain. Gene Expr Patterns 6, 134-140. Hohmeier, H. E., Thigpen, A., Tran, V. V., Davis, R., and Newgard, C. B. (1998). Stable expression of manganese super oxide dismutase (MnSOD) in insulinoma cells prevents IL1betainduced cytotoxicity and reduces nitric oxid e production. J Clin Invest 101, 18111820. Hsu, J. L. (1993). The characte rization of rat Cu/ZnSOD and Mn SOD genes. University of Florida. Hsu, W., Kerppola, T. K., Chen, P. L., Curran, T., and Chen-Kiang, S. (1994). Fos and Jun repress transcription activati on by NF-IL6 through association at the basic zipper region. Mol Cell Biol 14, 268-276. Hurt, J., Hsu, J. L., Dougall, W. C., Visner, G. A., Burr, I. M., and Nick, H. S. (1992). Multiple mRNA species generated by alternate polyadeny lation from the rat manganese superoxide dismutase gene. Nucleic Acids Res 20, 2985-2990. Iakova, P., Wang, G. L., Timchenko L., Michalak, M., Pereira-Smith, O. M., Smith, J. R., and Timchenko, N. A. (2004). Compe tition of CUGBP1 and calreticu lin for the regulation of p21 translation determines cell fate. Embo J 23, 406-417. Imae, M., Fu, Z., Yoshida, A., Noguchi, T., and Kato, H. (2003). Nutritional and hormonal factors control the gene expression of F oxOs, the mammalian homologues of DAF-16. J Mol Endocrinol 30, 253-262. 125

PAGE 126

Inouye, C., Remondelli, P., Karin, M., and Elledge, S. (1994). Isolation of a cDNA encoding a metal response element binding protein using a novel expression clon ing procedure: the one hybrid system. DNA Cell Biol 13 731-742. Ishiguro, K., and Xavier, R. (2004) Homer-3 regulates activation of serum response element in T cells via its EVH1 domain. Blood 103, 2248-2256. Izutani, R., Asano, S., Imano, M., Kuroda, D., Ka to, M., and Ohyanagi, H. (1998). Expression of manganese superoxide dismutase in esophag eal and gastric cancers. J Gastroenterol 33, 816-822. Jackson, S. H., Devadas, S., Kwon, J., Pinto, L. A., and Williams, M. S. (2004). T cells express a phagocyte-type NADPH oxidase th at is activated after T cel l receptor stimulation. Nat Immunol 5, 818-827. Jacobs, F. M., van der Heide, L. P., Wijchers, P. J., Burbach, J. P., Hoekman, M. F., and Smidt, M. P. (2003). FoxO6, a novel member of the F oxO class of transcription factors with distinct shuttling dynamics. J Biol Chem 278, 35959-35967. Johnson, K. D., Grass, J. A., Park, C., Im, H., Choi, K., and Bresnic k, E. H. (2003). Highly restricted localization of RNA polymerase II within a locus contro l region of a tissuespecific chromatin domain. Mol Cell Biol 23, 6484-6493. Johnson, P. F. (1993). Identifica tion of C/EBP basic region resi dues involved in DNA sequence recognition and half-site spaci ng preference. Mol Cell Biol 13 6919-6930. Jones, P. L., Kucera, G., Gordon, H., and Boss, J. M. (1995). Cloning and characterization of the murine manganous superoxide dismutase-encoding gene. Gene 153, 155-161. Jones, P. L., Ping, D., and Boss, J. M. (1997). Tumor necrosis factor alpha and interleukin-1beta regulate the murine manganese superoxide dismutase gene through a complex intronic enhancer involving C/EBP-beta and NF-kappaB. Mol Cell Biol 17, 6970-6981. Kay, B. K., Williamson, M. P., and Sudol, M. (2000). The importance of being proline: the interaction of proline-rich mo tifs in signaling proteins with their cognate domains. Faseb J 14, 231-241. Kenyon, C., Chang, J., Gensch, E., Rudner, A., a nd Tabtiang, R. (1993). A C. elegans mutant that lives twice as l ong as wild type. Nature 366, 461-464. Kifle, Y., Monnier, J., Chesrown, S. E., Raizada, M. K., and Nick, H. S. (1996). Regulation of the manganese superoxide dismutase and induc ible nitric oxide synthase gene in rat neuronal and glial cells. J Neurochem 66, 2128-2135. Kilberg, M. S., Pan, Y. X., Chen, H., and Leung-Pi neda, V. (2005). Nutritional control of gene expression: how mammalian cells respond to amino acid limitation. Annu Rev Nutr 25, 5985. 126

PAGE 127

Kiningham, K. K., Xu, Y., Daosukho, C., Popova, B., and St Clair, D. K. (2001). Nuclear factor kappaB-dependent mechanisms coordinate the synergistic effect of PMA and cytokines on the induction of superoxide dismutase 2. Biochem J 353, 147-156. Kops, G. J., and Burgering, B. M. (1999). Forkh ead transcription factors: new insights into protein kinase B (c-akt) signaling. J Mol Med 77 656-665. Kops, G. J., Dansen, T. B., Polderman, P. E., Saar loos, I., Wirtz, K. W., Coffer, P. J., Huang, T. T., Bos, J. L., Medema, R. H., and Burgering, B. M. (2002). Forkhead transcription factor FOXO3a protects quiescent cells from oxidative stress. Nature 419, 316-321. Kops, G. J., de Ruiter, N. D., De Vries-Smits, A. M., Powell, D. R., Bos, J. L., and Burgering, B. M. (1999). Direct control of the Forkhead tr anscription factor AFX by protein kinase B. Nature 398, 630-634. Korshunov, S. S., Skulachev, V. P., and Starkov, A. A. (1997). High protonic potential actuates a mechanism of production of reactive oxygen species in mitochondria. FEBS Lett 416, 1518. Kowenz-Leutz, E., and Leutz, A. (1999). A C/EB P beta isoform recruits the SWI/SNF complex to activate myeloid genes. Mol Cell 4, 735-743. Kramer, J. M., Davidge, J. T., Lockyer, J. M ., and Staveley, B. E. (2003). Expression of Drosophila FOXO regulates growth a nd can phenocopy starvation. BMC Dev Biol 3, 5. Kuo, S. (1998). The regulation of rat manganese superoxide dismutase gene: detection and characterization of trans -acting factors. PhD disserta tion, University of Florida. Kuo, S., Chesrown, S. E., Mellott, J. K., Rogers, R. J., Hsu, J. L., and Nick, H. S. (1999). In vivo architecture of the manganese super oxide dismutase promoter. J Biol Chem 274, 33453354. Kuo, S., Chokas, A. L., Rogers, R. J., and Ni ck, H. S. (2003). PIN*POINT analysis on the endogenous MnSOD promoter: specific dem onstration of Sp1 binding in vivo. Am J Physiol Cell Physiol 284 C528-534. Kutach, A. K., and Kadonaga, J. T. (2000). The downstream promoter element DPE appears to be as widely used as the TATA box in Drosophila core promoters. Mol Cell Biol 20, 47544764. Lebovitz, R. M., Zhang, H., Vogel, H., Cartwrig ht, J., Jr., Dionne, L., Lu, N., Huang, S., and Matzuk, M. M. (1996). Neurodegeneration, myo cardial injury, and perinatal death in mitochondrial superoxide dismutase-defici ent mice. Proc Natl Acad Sci U S A 93, 97829787. LeClair, K. P., Blanar, M. A., and Sharp, P. A. (1992). The p50 subunit of NF-kappa B associates with the NF-IL6 transcrip tion factor. Proc Natl Acad Sci U S A 89, 8145-8149. 127

PAGE 128

Lekstrom-Himes, J., and Xanthopoulos, K. G. ( 1998). Biological role of the CCAAT/enhancerbinding protein family of transc ription factors. J Biol Chem 273, 28545-28548. Li, N., Oberley, T. D., Oberley, L. W., and Zhong, W. (1998). Overexpression of manganese superoxide dismutase in DU145 human prosta te carcinoma cells has multiple effects on cell phenotype. Prostate 35 221-233. Li, Y., Huang, T. T., Carlson, E. J., Melov, S., Ursell, P. C., Olson, J. L., Noble, L. J., Yoshimura, M. P., Berger, C., Chan, P. H. et al. (1995). Dilated cardiomyopathy and neonatal lethality in mutant mice lacking manganese superoxide dismutase. Nat Genet 11, 376-381. Lin, K., Dorman, J. B., Rodan, A., and Kenyon, C. (1997). daf-16: An HNF-3/forkhead family member that can function to double the lifespan of Caenorhabditis elegans. Science 278, 1319-1322. Lin, P. S., Ho, K. C., Sung, S. J., and Tsai, S. (1993). Cytotoxicity and manganese superoxide dismutase induction by tumor necrosis factor -alpha and ionizing radiation in MCF-7 human breast carcinoma cells. Lymphokine Cytokine Res 12, 303-308. Lipson, K. E., and Baserga, R. (1989). Transcriptional activity of the human thymidine kinase gene determined by a method using the polymerase chain reaction and an intron-specific probe. Proc Natl Acad Sci U S A 86, 9774-9777. Liu, L., Rajareddy, S., Reddy, P., Du, C., Jagarlam udi, K., Shen, Y., Gunnarsson, D., Selstam, G., Boman, K., and Liu, K. (2007). Infertil ity caused by retardation of follicular development in mice with oocyte-specif ic expression of Foxo3a. Development 134, 199209. Liu, R., Oberley, T. D., and Oberley, L. W. (1997). Transfection and expression of MnSOD cDNA decreases tumor malignancy of human oral squamous carcinoma SCC-25 cells. Hum Gene Ther 8, 585-595. Liu, Y., Borchert, G. L., Donald, S. P., Surazynski, A., Hu, C. A., Weydert, C. J., Oberley, L. W., and Phang, J. M. (2005). MnSOD inhibits proline oxidase-i nduced apoptosis in colorectal cancer cells. Carcinogenesis 26, 1335-1342. Livak, K. J., and Schmittgen, T. D. (2001). Analysis of relative gene expression data using realtime quantitative PCR and the 2(-D elta Delta C(T)) Method. Methods 25 402-408. Lopez, A. B., Wang, C., Huang, C. C., Yaman, I., Li, Y., Chakravarty, K., Johnson, P. F., Chiang, C. M., Snider, M. D., Wek, R. C., and Hatzoglou, M. (2007). A feedback transcriptional mechanism controls the level of the arginine/lysine tr ansporter cat-1 during amino acid starvation. Biochem J 402 163-173. Louie, M. C., Yang, H. Q., Ma, A. H., Xu, W., Zou, J. X., Kung, H. J., and Chen, H. W. (2003). Androgen-induced recruitment of RNA pol ymerase II to a nuclear receptor-p160 coactivator complex. Proc Natl Acad Sci U S A 100 2226-2230. 128

PAGE 129

Maehara, K., Hasegawa, T., and Isobe, K. I. (2000). A NF-kappaB p65 subunit is indispensable for activating manganese superoxide: dismut ase gene transcription mediated by tumor necrosis factor-alpha. J Cell Biochem 77, 474-486. Maehara, K., Hasegawa, T., Xiao, H., Takeuchi, A., Abe, R., and Isobe, K. (1999). Cooperative interaction of NF-kappaB and C/EBP binding s ites is necessary for manganese superoxide dismutase gene transcription mediated by li popolysaccharide and interferon-gamma. FEBS Lett 449, 115-119. Magalini, A., Savoldi, G., Ferrari, F., Garnier, M. Ghezzi, P., Albertini, A., and Di Lorenzo, D. (1995). Role of IL-1 beta and corticosteroids in the regulation of th e C/EBP-alpha, beta and delta genes in vivo. Cytokine 7, 753-758. Manna, S. K., Zhang, H. J., Yan, T., Ober ley, L. W., and Aggarwal, B. B. (1998). Overexpression of manganese superoxide dism utase suppresses tumor necrosis factorinduced apoptosis and activation of nuclear transcription factor-kappaB and activated protein-1. J Biol Chem 273, 13245-13254. Marklund, S. L. (1982). Human copper-containi ng superoxide dismutase of high molecular weight. Proc Natl Acad Sci U S A 79 7634-7638. Martinez-Jimenez, C. P., Gomez-Lechon, M. J ., Castell, J. V., and Jover, R. (2005). Transcriptional regulation of the human hepa tic CYP3A4: identification of a new distal enhancer region responsive to CCAAT/enhance r-binding protein beta isoforms (liver activating protein and liver inhi bitory protein). Mol Pharmacol 67, 2088-2101. Masuda, A., Longo, D. L., Kobayashi, Y., Appella E., Oppenheim, J. J., and Matsushima, K. (1988). Induction of mitochondrial manganese superoxide dismutase by interleukin 1. Faseb J 2, 3087-3091. Matsuzaki, H., Daitoku, H., Hatta, M., Aoyama, H., Yoshimochi, K., and Fukamizu, A. (2005). Acetylation of Foxo1 alters its DNA-binding ability and sensitiv ity to phosphorylation. Proc Natl Acad Sci U S A 102, 11278-11283. McCarthy, T. L., Ji, C., Chen, Y., Kim, K. K., Imagawa, M., Ito, Y., and Centrella, M. (2000). Runt domain factor (Runx)-dependent eff ects on CCAAT/ enhancer-binding protein delta expression and activity in osteoblasts. J Biol Chem 275, 21746-21753. McCord, J. M., and Fridovich, I. (1969). Supe roxide dismutase. An enzymic function for erythrocuprein (hemoc uprein). J Biol Chem 244, 6049-6055. Meyrick, B., and Magnuson, M. A. (1994). Identifi cation and functional characterization of the bovine manganous superoxide dismutase promoter. Am J Respir Cell Mol Biol 10, 113121. Misra, H. P., and Fridovich, I. (1972). The generation of superoxide radical during the autoxidation of hemoglobin. J Biol Chem 247, 6960-6962. 129

PAGE 130

Motta, M. C., Divecha, N., Lemieux, M., Kamel, C., Chen, D., Gu, W., Bultsma, Y., McBurney, M., and Guarente, L. (2004). Mammalian SIRT1 represses forkhead tr anscription factors. Cell 116, 551-563. Murakami, S., and Johnson, T. E. (1996). A gene tic pathway conferring life extension and resistance to UV stress in Caenorhabditis elegans. Genetics 143, 1207-1218. Nelson, S. K., Bose, S. K., and McCord, J. M. (1994). The toxicity of high-dose superoxide dismutase suggests that superoxi de can both initiate and terminate lipid peroxidation in the reperfused heart. Free Radic Biol Med 16, 195-200. Nerlov, C. (2007). The C/EBP family of transcripti on factors: a paradigm for interaction between gene expression and prolifera tion control. Trends Cell Biol 17 318-324. Oberley, L. W. (2005). Mechanism of the tumo r suppressive effect of MnSOD overexpression. Biomed Pharmacother 59, 143-148. Oberley, L. W., and Buettner, G. R. (1979). Role of superoxide dismutase in cancer: a review. Cancer Res 39 1141-1149. Ogg, S., Paradis, S., Gottlieb, S., Patterson, G. I., Lee, L., Tissenbaum, H. A., and Ruvkun, G. (1997). The Fork head transcription factor DAF-16 transduces insu lin-like metabolic and longevity signals in C. elegans. Nature 389, 994-999. Ohoka, N., Yoshii, S., Hattori, T., Onozaki, K., and Hayashi, H. (2005). TRB3, a novel ER stress-inducible gene, is induced via ATF4-C HOP pathway and is i nvolved in cell death. Embo J 24, 1243-1255. Omar, B. A., and McCord, J. M. (1990). The car dioprotective effect of Mn-superoxide dismutase is lost at high doses in the postischemic isolated rabbit heart. Free Radic Biol Med 9, 473478. Orlando, V., Strutt, H., and Paro, R. (1997). An alysis of chromatin structure by in vivo formaldehyde cross-linking. Methods 11, 205-214. Orphanides, G., and Reinber g, D. (2002). A unified theory of gene expression. Cell 108, 439451. Osada, S., Yamamoto, H., Nishihara, T., and Imagawa, M. (1996). DNA binding specificity of the CCAAT/enhancer-binding protein transc ription factor family. J Biol Chem 271, 38913896. Ossipow, V., Descombes, P., and Schibler, U. (1993). CCAAT/enhancer-binding protein mRNA is translated into multiple proteins with diffe rent transcription activation potentials. Proc Natl Acad Sci U S A 90, 8219-8223. Pain, V. M. (1994). Translational contro l during amino acid starvation. Biochimie 76, 718-728. 130

PAGE 131

Palii, S. S., Chen, H., and Kilberg, M. S. (2004) Transcriptional control of the human sodiumcoupled neutral amino acid transporter syst em A gene by amino acid availability is mediated by an intronic element. J Biol Chem 279, 3463-3471. Pan, Y., Chen, H., Siu, F., and Kilberg, M. S. (2003). Amino acid deprivation and endoplasmic reticulum stress induce expression of multiple activating transcription factor-3 mRNA species that, when overexpre ssed in HepG2 cells, modulate transcription by the human asparagine synthetase promoter. J Biol Chem 278, 38402-38412. Park, M. H., Park, S. Y., and Kim, Y. (2008). In duction of proline-rich tyrosine kinase2 (Pyk2) through C/EBPbeta is involved in PMA-indu ced monocyte differen tiation. FEBS Lett. Patton, S. E., Rosen, G. M., and Rauckman, E. J. (1980). Superoxide production by purified hamster hepatic nuclei. Mol Pharmacol 18, 588-593. Phatnani, H. P., and Greenleaf, A. L. (2006) Phosphorylation and functions of the RNA polymerase II CTD. Genes Dev 20, 2922-2936. Podust, L. M., Krezel, A. M., and Kim, Y. (2001). Crystal structure of the CCAAT box/enhancer-binding protein beta activating transcription factor-4 basic leucine zipper heterodimer in the absence of DNA. J Biol Chem 276, 505-513. Poli, V., Mancini, F. P., and Cortese, R. (1990). IL-6DBP, a nuclear protein involved in interleukin-6 signal transduction, defines a new family of leucin e zipper proteins related to C/EBP. Cell 63, 643-653. Pomerance, M., Mockey, M., Young, J., Quillard, J., and Blondeau, J. P. (2005). Expression, hormonal regulation, and subcel lular localization of CCAAT/enhancer -binding proteinbeta in rat and huma n thyrocytes. Thyroid 15, 197-204. Ptashne, M., and Gann, A. (1997). Transcriptional activation by recruitment. Nature 386 569577. Ramji, D. P., and Foka, P. (2002). CCAAT/enhancer-binding proteins: st ructure, function and regulation. Biochem J 365, 561-575. Ranjan, P., and Boss, J. M. (2006). C/EBPbet a regulates TNF induced MnSOD expression and protection against apoptosis. Apoptosis 11, 1837-1849. Ray, A., Hannink, M., and Ray, B. K. (1995). Concerted participation of NF-kappa B and C/EBP heteromer in lipopolysac charide induction of serum amyloi d A gene expression in liver. J Biol Chem 270, 7365-7374. Ray, A., and Ray, B. K. (1994). Serum amyloid A gene expression under acute-phase conditions involves participation of induc ible C/EBP-beta and C/EBP-delta and their activation by phosphorylation. Mol Cell Biol 14, 4324-4332. 131

PAGE 132

Reaume, A. G., Elliott, J. L., Hoffman, E. K., Kowall, N. W., Ferrante, R. J., Siwek, D. F., Wilcox, H. M., Flood, D. G., Beal, M. F., Brown, R. H., Jr. et al. (1996). Motor neurons in Cu/Zn superoxide dismutase-deficient mice de velop normally but exhibit enhanced cell death after axonal injury. Nat Genet 13 43-47. Rippe, K., von Hippel, P. H., and Langowski, J. (1995). Action at a distance: DNA-looping and initiation of transcription. Trends Biochem Sci 20 500-506. Rogers, R. J., Chesrown, S. E., Kuo, S., Monni er, J. M., and Nick, H. S. (2000). Cytokineinducible enhancer with pr omoter activity in both the rat and human manganesesuperoxide dismutase genes. Biochem J 347 Pt 1, 233-242. Rogers, R. J., Monnier, J. M., and Nick, H. S. (2001). Tumor necrosis factor-alpha selectively induces MnSOD expression via mitochondria-t o-nucleus signaling, whereas interleukin1beta utilizes an alternative pathway. J Biol Chem 276, 20419-20427. Ron, D., and Habener, J. F. (1992). CHOP, a nov el developmentally regu lated nuclear protein that dimerizes with transcription factors C/EBP and LAP and functions as a dominantnegative inhibitor of gene transcription. Genes Dev 6, 439-453. Routledge, S. J., and Proudfoot, N. J. (2002). De finition of transcriptional promoters in the human beta globin locus control region. J Mol Biol 323, 601-611. Roybal, C. N., Hunsaker, L. A., Barbash, O., Va nder Jagt, D. L., and Abcouwer, S. F. (2005). The oxidative stressor arsenite activates vascular endothelial growth factor mRNA transcription by an ATF4-depe ndent mechanism. J Biol Chem 280, 20331-20339. Sandoval, J., Rodriguez, J. L., Tur, G., Serviddio, G., Pereda, J., Boukaba, A., Sastre, J., Torres, L., Franco, L., and Lopez-Rodas, G. ( 2004). RNAPol-ChIP: a novel application of chromatin immunoprecipitation to the analysis of real-time gene transcription. Nucleic Acids Res 32, e88. Selden, R. F., Howie, K. B., Rowe, M. E., G oodman, H. M., and Moore, D. D. (1986). Human growth hormone as a reporter gene in re gulation studies employing transient gene expression. Mol Cell Biol 6, 3173-3179. Shen, X., Zheng, S., Metreveli, N. S., and Ep stein, P. N. (2006). Protection of cardiac mitochondria by overexpression of MnSOD re duces diabetic cardiomyopathy. Diabetes 55, 798-805. Spicuglia, S., Kumar, S., Yeh, J. H., Vachez, E., Chasson, L., Gorbatch, S., Cautres, J., and Ferrier, P. (2002). Promoter activation by enha ncer-dependent and -independent loading of activator and coactivator complexes. Mol Cell 10 1479-1487. St Clair, D. K., Oberley, T. D., and Ho, Y. S. (1991). Overproduction of human Mn-superoxide dismutase modulates paraquat-mediated to xicity in mammalian cells. FEBS Lett 293, 199203. 132

PAGE 133

Stadtman, E. R. (1995). Role of oxidized am ino acids in protein breakdown and stability. Methods Enzymol 258, 379-393. Sterneck, E., Tessarollo, L., and Johnson, P. F. (1997) An essential role for C/EBPbeta in female reproduction. Genes Dev 11, 2153-2162. Su, W. C., Chou, H. Y., Chang, C. J., Lee, Y. M ., Chen, W. H., Huang, K. H., Lee, M. Y., and Lee, S. C. (2003). Differential activation of a C/EBP beta isofor m by a novel redox switch may confer the lipopolysaccharid e-inducible expression of inte rleukin-6 gene. J Biol Chem 278, 51150-51158. Suzuki, Y., Tsunoda, T., Sese, J., Taira, H., Mizu shima-Sugano, J., Hata, H., Ota, T., Isogai, T., Tanaka, T., Nakamura, Y. et al. (2001). Identification and ch aracterization of the potential promoter regions of 1031 kinds of human genes. Genome Res 11, 677-684. Szutorisz, H., Dillon, N., and Tora, L. (2005). Th e role of enhancers as centres for general transcription factor recru itment. Trends Biochem Sci 30, 593-599. Timchenko, N. A., Wang, G. L., and Timche nko, L. T. (2005). RNA CUG-binding protein 1 increases translation of 20-kDa isoform of CCAAT/enhancer-binding protein beta by interacting with the alpha and beta subunits of eukaryotic initiation translation factor 2. J Biol Chem 280, 20549-20557. Timchenko, N. A., Welm, A. L., Lu, X., and Timchenko, L. T. (1999) CUG repeat binding protein (CUGBP1) interacts with the 5' region of C/EBPbeta mRNA and regulates translation of C/EBPbeta isoforms. Nucleic Acids Res 27, 4517-4525. Trautwein, C., Caelles, C., van der Geer, P., Hunter, T., Kari n, M., and Chojkier, M. (1993). Transactivation by NF-IL6/LAP is enhanced by phosphorylation of its activation domain. Nature 364, 544-547. Travers, A. (1999). Chromatin modification by DNA tracking. Proc Natl Acad Sci U S A 96, 13634-13637. Tsumoto, K., Shinoki, K., Kondo, H., Uchikawa, M ., Juji, T., and Kumagai, I. (1998). Highly efficient recovery of functional single-c hain Fv fragments from inclusion bodies overexpressed in Escherichia coli by cont rolled introduction of oxidizing reagent-application to a human single-chain Fv fragment. J Immunol Methods 219, 119-129. Tuan, D., Kong, S., and Hu, K. (1992). Transcripti on of the hypersensitive site HS2 enhancer in erythroid cells. Proc Natl Acad Sci U S A 89, 11219-11223. Turrens, J. F. (1997). Superoxide production by the mitochondrial respiratory chain. Biosci Rep 17, 3-8. Valentine, J. F., and Nick, H. S. (1992). Ac ute-phase induction of manganese superoxide dismutase in intestinal epithelial cell lines. Gastroenterology 103, 905-912. 133

PAGE 134

Vallejo, M., Ron, D., Miller, C. P., and Habener, J. F. (1993). C/ATF, a member of the activating transcription factor family of DNA-bindi ng proteins, dimerizes with CAAT/enhancerbinding proteins and directs th eir binding to cAMP response elements. Proc Natl Acad Sci U S A 90, 4679-4683. van der Heide, L. P., Jacobs, F. M., Burbach, J. P., Hoekman, M. F., and Smidt, M. P. (2005). FoxO6 transcriptional activity is regulated by Thr26 and Ser184, independent of nucleocytoplasmic shuttling. Biochem J 391 623-629. van der Horst, A., de Vries-Smits, A. M., Brenkm an, A. B., van Triest, M. H., van den Broek, N., Colland, F., Maurice, M. M., and Burgering, B. M. (2006). FOXO4 transcriptional activity is regulated by monoubiquitination and USP7/HAUSP. Nat Cell Biol 8, 1064-1073. van Loon, A. P., Pesold-Hurt, B., and Schatz, G. (1986). A yeast mutant lacking mitochondrial manganese-superoxide dismutase is hypersen sitive to oxygen. Proc Natl Acad Sci U S A 83, 3820-3824. Vieira, K. F., Levings, P. P., Hill, M. A., Crussell e, V. J., Kang, S. H., Engel, J. D., and Bungert, J. (2004). Recruitment of transcription complexe s to the beta-globin gene locus in vivo and in vitro. J Biol Chem 279, 50350-50357. Visner, G. A., Block, E. R., Burr, I. M., and Nick, H. S. (1991). Regulation of manganese superoxide dismutase in porcine pulmonary artery endothelial cells. Am J Physiol 260, L444-449. Visner, G. A., Dougall, W. C., Wilson, J. M., Burr, I. A., and Nick, H. S. (1990). Regulation of manganese superoxide dismutase by lipopolysaccharide, interleukin-1, and tumor necrosis factor. Role in the acute infl ammatory response. J Biol Chem 265, 2856-2864. Wang, F., Nguyen, M., Qin, F. X., and Tong, Q. (2007). SIRT2 deacetylates FOXO3a in response to oxidative stress and caloric restric tion. Aging Cell 6, 505-514. Wang, J. C., and Giaever, G. N. (1988). Action at a distance along a DNA. Science 240, 300304. Wang, L., Luo, H., Chen, H., and Xu e, Z. (1994). [The effects of superoxide dismutase on acute myocardial ischemia and lipid peroxidation in rabbits]. Hua Xi Yi Ke Da Xue Xue Bao 25, 62-65. Ward, P. A., Warren, J. S., and Johnson, K. J. (1988). Oxygen radicals, inflammation, and tissue injury. Free Radic Biol Med 5, 403-408. Wek, R. C., and Cavener, D. R. (2007). Transla tional control and the unfolded protein response. Antioxid Redox Signal 9 2357-2371. Weydert, C., Roling, B., Liu, J., Hinkhouse, M. M., R itchie, J. M., Oberley, L. W., and Cullen, J. J. (2003). Suppression of the malignant phenotype in human pancreatic cancer cells by the overexpression of manganese superoxi de dismutase. Mol Cancer Ther 2, 361-369. 134

PAGE 135

White, J. E., and Tsan, M. F. (1994). Induction of pulmonary Mn superoxide dismutase mRNA by interleukin-1. Am J Physiol 266, L664-671. Wispe, J. R., Warner, B. B., Clark, J. C., Dey, C. R., Neuman, J., Glasser, S. W., Crapo, J. D., Chang, L. Y., and Whitsett, J. A. (1992). Human Mn-superoxide dismutase in pulmonary epithelial cells of transgenic mice confers protection from oxygen injury. J Biol Chem 267, 23937-23941. Wong, G. H., Elwell, J. H., Oberley, L. W., a nd Goeddel, D. V. (1989). Manganous superoxide dismutase is essential for cellular resistance to cytotoxicity of tumor necrosis factor. Cell 58, 923-931. Wong, G. H., and Goeddel, D. V. (1988). I nduction of manganous superoxide dismutase by tumor necrosis factor: possible protective mechanism. Science 242, 941-944. Wong, G. H., McHugh, T., Weber, R., and Goeddel, D. V. (1991). Tumor necrosis factor alpha selectively sensitizes human immunodeficiency virus-infected cells to heat and radiation. Proc Natl Acad Sci U S A 88, 4372-4376. Xu, Y., Kiningham, K. K., Devalara ja, M. N., Yeh, C. C., Majima, H., Kasarskis, E. J., and St Clair, D. K. (1999). An intronic NF-kappaB element is essential for induction of the human manganese superoxide dismutase gene by tumor necrosis factor-alpha and interleukin-1beta. DNA Cell Biol 18 709-722. Yarwood, S. J., Borland, G., Sands, W. A., and Palmer, T. M. (2008). Identification of C/EBPS as EPAC-activated transcription factors that mediate the induction of the SOCS-3 gene. J Biol Chem. Yellaturu, C. R., Bhanoori, M., Neeli, I., a nd Rao, G. N. (2002). N-Ethylmaleimide inhibits platelet-derived growth factor BB-stimulate d Akt phosphorylation via activation of protein phosphatase 2A. J Biol Chem 277, 40148-40155. Yin, M., Yang, S. Q., Lin, H. Z., Lane, M. D., Ch atterjee, S., and Diehl, A. M. (1996). Tumor necrosis factor alpha promotes nucle ar localization of cytokine-inducible CCAAT/enhancer binding protein isofor ms in hepatocytes. J Biol Chem 271, 1797417978. Zhong, W., Yan, T., Lim, R., and Oberley, L. W. (1999). Expression of superoxide dismutases, catalase, and glutathione peroxidase in glioma cells. Free Radic Biol Med 27 1334-1345. Zuo, Y., Qiang, L., and Farmer, S. R. (2006). Activation of CCAAT/enhancer-binding protein (C/EBP) alpha expression by C/EBP beta during adipogenesis requires a peroxisome proliferator-activated receptor-gamma-associat ed repression of HDAC1 at the C/ebp alpha gene promoter. J Biol Chem 281, 7960-7967. 135

PAGE 136

136 BIOGRAPHICAL SKETCH Xiaolei Qiu was born in a small town called Chro ngren in southeast China. She lived there until 1999 when she graduated from Shengzhou No.1 High School. In the same year, she went to Beijing and started her undergraduate education at Tsinghua University. During her undergraduate studies, she volunteered in Dr. Ze ngyi Changs lab, where she learned about and gained great interest in reactive oxygen species, and decided to continue her study in this field. After she received her b achelors degree in biological scie nces and technologies in July 2003, she continued her education by joining the Interdisciplinary Doctoral Program (IDP) in University of Florida in 2003, and join ed Dr. Harry Nicks lab in May 2004.