<%BANNER%>

Protein Interactions at the Inner Nuclear Membrane

Permanent Link: http://ufdc.ufl.edu/UFE0023960/00001

Material Information

Title: Protein Interactions at the Inner Nuclear Membrane
Physical Description: 1 online resource (125 p.)
Language: english
Creator: Liu, Qian
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: envelope, inner, lamin, linc, membrane, nuclear
Molecular Cell Biology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Physical connections between the nucleoskeleton and cytoskeleton were recently uncovered, which we have previously defined as LINC (linker of nucleoskeleton and cytoskeleton) complex. They form through interactions between the lumenal domains of two families of transmembrane proteins of the nuclear envelope (NE): Sun proteins and Nesprins. Mammalian cells are known to contain at least five Sun proteins, within which, Sun1 and Sun2 are ubiquitously expressed in mice and human. Though functionally similar, we discovered that Sun1 and 2 are segregated within the plane of the NE in both interphase and early telophase. Immunofluorescence and immunoelectric microscopy further revealed that Sun1, but not Sun2 is intimately associated with nuclear pore complexes (NPCs). Though interaction with A type lamins has been confirmed, localization of Sun proteins is not lamin dependent. Topological analyses indicate that Sun1 is a type II integral protein of the inner nuclear membrane (INM). Localization of Sun1 to the INM is defined by at least two discrete regions within its nucleoplasmic domain. However, association with NPCs is dependent on the synergy of both nucleoplasmic and lumenal domains. Cells that are either depleted of Sun1 by RNA interference (RNAi) or that overexpress dominant-negative Sun1 fragments exhibit clustering of NPCs. Monitored by beta-galactosidase-glucocorticoid receptor fusion protein, the major transport function of NPCs is not affected. Thus, Sun1 represents an important determinant of NPCs distribution across the nuclear surface. The nuclear lamina is a condensed intermediate filament network lining the INM. One of the major components of the nuclear lamina, laminA (LaA) undergoes multistep posttranslational processing involving farnesylation, carboxymethylation and cleavage by ZmpSte24. By using HIV protease inhibitor Lopivinair (Lop), which is known to inhibit the function of ZmpSte24, we accumulated a considerable level of farnesylated preA on the NE with concomitant nuclear structural abnormalities. Release from the Lop block resulted in rapid LaA processing, with a slightly slower reversion of normal nuclear morphology. On the other hand, farnesyl-transferase inhibitor FTI-277 in combination of geranylgeranyl-transferase inhibitor GGTI-2147 effectively blocked LaA maturation and accumulated non-farnesylated preA on the NE in Saos2 cells. The aberrant cellular phenotypes caused by Lop can be corrected by a combinatorial treatment of FTI-277 and GGTI-2147. Release both drugs led to a quick rebound phenomenon. In Hutchinson-Gilford progeria syndrome (HGPS) cells, however, prenylation of LaA and LaA-delta50 was largely blocked by FTI-277 alone. Both protein maturation and nuclear phenotype returned slowly after drug washout, suggesting a role of cell proliferation in the rate of recovery. Our observations indicate a more dynamic nature of the nuclear lamina, with implications for design of therapies for HIV patients and the ongoing clinical trial for children with HGPS. Our study has characterized the topology, localization and interaction of Sun1, a major role player in coupling nucleus and cytoplasm. Furthermore it provides new insight into the role of Sun1 in NPCs distribution and lays the foundation of future investigations for nuclear pore membrane (NPM) curvature, interphase NPCs assembly and heterochromatin organization. What is more, our study has charactered the dynamics of the nuclear lamina by using inhibitors for processing enzymes of LaA. This discovery has important implications in the clinical uses of Lop and FTI in the treatment of HIV and progeria.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Qian Liu.
Thesis: Thesis (Ph.D.)--University of Florida, 2008.
Local: Adviser: Burke, Brian E.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0023960:00001

Permanent Link: http://ufdc.ufl.edu/UFE0023960/00001

Material Information

Title: Protein Interactions at the Inner Nuclear Membrane
Physical Description: 1 online resource (125 p.)
Language: english
Creator: Liu, Qian
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2008

Subjects

Subjects / Keywords: envelope, inner, lamin, linc, membrane, nuclear
Molecular Cell Biology (IDP) -- Dissertations, Academic -- UF
Genre: Medical Sciences thesis, Ph.D.
bibliography   ( marcgt )
theses   ( marcgt )
government publication (state, provincial, terriorial, dependent)   ( marcgt )
born-digital   ( sobekcm )
Electronic Thesis or Dissertation

Notes

Abstract: Physical connections between the nucleoskeleton and cytoskeleton were recently uncovered, which we have previously defined as LINC (linker of nucleoskeleton and cytoskeleton) complex. They form through interactions between the lumenal domains of two families of transmembrane proteins of the nuclear envelope (NE): Sun proteins and Nesprins. Mammalian cells are known to contain at least five Sun proteins, within which, Sun1 and Sun2 are ubiquitously expressed in mice and human. Though functionally similar, we discovered that Sun1 and 2 are segregated within the plane of the NE in both interphase and early telophase. Immunofluorescence and immunoelectric microscopy further revealed that Sun1, but not Sun2 is intimately associated with nuclear pore complexes (NPCs). Though interaction with A type lamins has been confirmed, localization of Sun proteins is not lamin dependent. Topological analyses indicate that Sun1 is a type II integral protein of the inner nuclear membrane (INM). Localization of Sun1 to the INM is defined by at least two discrete regions within its nucleoplasmic domain. However, association with NPCs is dependent on the synergy of both nucleoplasmic and lumenal domains. Cells that are either depleted of Sun1 by RNA interference (RNAi) or that overexpress dominant-negative Sun1 fragments exhibit clustering of NPCs. Monitored by beta-galactosidase-glucocorticoid receptor fusion protein, the major transport function of NPCs is not affected. Thus, Sun1 represents an important determinant of NPCs distribution across the nuclear surface. The nuclear lamina is a condensed intermediate filament network lining the INM. One of the major components of the nuclear lamina, laminA (LaA) undergoes multistep posttranslational processing involving farnesylation, carboxymethylation and cleavage by ZmpSte24. By using HIV protease inhibitor Lopivinair (Lop), which is known to inhibit the function of ZmpSte24, we accumulated a considerable level of farnesylated preA on the NE with concomitant nuclear structural abnormalities. Release from the Lop block resulted in rapid LaA processing, with a slightly slower reversion of normal nuclear morphology. On the other hand, farnesyl-transferase inhibitor FTI-277 in combination of geranylgeranyl-transferase inhibitor GGTI-2147 effectively blocked LaA maturation and accumulated non-farnesylated preA on the NE in Saos2 cells. The aberrant cellular phenotypes caused by Lop can be corrected by a combinatorial treatment of FTI-277 and GGTI-2147. Release both drugs led to a quick rebound phenomenon. In Hutchinson-Gilford progeria syndrome (HGPS) cells, however, prenylation of LaA and LaA-delta50 was largely blocked by FTI-277 alone. Both protein maturation and nuclear phenotype returned slowly after drug washout, suggesting a role of cell proliferation in the rate of recovery. Our observations indicate a more dynamic nature of the nuclear lamina, with implications for design of therapies for HIV patients and the ongoing clinical trial for children with HGPS. Our study has characterized the topology, localization and interaction of Sun1, a major role player in coupling nucleus and cytoplasm. Furthermore it provides new insight into the role of Sun1 in NPCs distribution and lays the foundation of future investigations for nuclear pore membrane (NPM) curvature, interphase NPCs assembly and heterochromatin organization. What is more, our study has charactered the dynamics of the nuclear lamina by using inhibitors for processing enzymes of LaA. This discovery has important implications in the clinical uses of Lop and FTI in the treatment of HIV and progeria.
General Note: In the series University of Florida Digital Collections.
General Note: Includes vita.
Bibliography: Includes bibliographical references.
Source of Description: Description based on online resource; title from PDF title page.
Source of Description: This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Statement of Responsibility: by Qian Liu.
Thesis: Thesis (Ph.D.)--University of Florida, 2008.
Local: Adviser: Burke, Brian E.
Electronic Access: RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2010-12-31

Record Information

Source Institution: UFRGP
Rights Management: Applicable rights reserved.
Classification: lcc - LD1780 2008
System ID: UFE0023960:00001


This item has the following downloads:


Full Text

PAGE 1

1 PROTEIN INTERACTIONS AT TH E INNER NUCLEAR MEMBRANE By QIAN LIU A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2008

PAGE 2

2 2008 Qian Liu

PAGE 3

3 To my parents, for their unconditional love and support th roughout the years

PAGE 4

4 ACKNOWLEDGMENTS First and foremost, I would like to thank my mentor, Dr. Brian Burke, who has provided me with an unforgettable graduate experience. I have come to respect Brians brilliance as a scientist as well as hi s knowledge and understanding of thin gs beyond. He also carries with him a great sense of humor, which makes my graduate life much enjoyable. I especially appreciate the immense patience he has exer cised with me through the years and the support he has offered as an advisor. I would like to thank Kyle, for whom I ha ve gained a great deal of respect and appreciation. He has been a remarkable teacher leader and motivator in my graduate study. Moreover, he taught me a lot about knowledge of lif e and American culture. It is always fun to talk with him and I have learned so much. I would also like to thank my committee members (Steve Sugrue, John Aris and Jorg Bungert) for offering their expertise, suggestions and support through my gr aduate experience. I would especially like to acknowledge to Dr. Sugrue, who has served as an exceptional chair to our department and challenged each of us through his vision and leadership. I would like to thank the Sugr ue, LuValle and Sarosi labs fo r constant exchange and use of equipment and reagents as well as many hours of valuable disc ussion. I am grateful for all the support and guidance I have received from everyone in the open lab, especially Daein (for being a good friend and coworker), Janet (for teachi ng me American culture and pushing my limit for better), Cuc (for being a consider ate and inspiring friend who offers generous help), Caitlin (for constant encouragement and support), Connie (for o ffering me help scientif ically and socially), Mo (for being a good friend in a nd out of the lab), Gus (for his wonderful friendship), Johnny (for his help and constant vocal entertainment in the lab), Deby (for always being helpful in my

PAGE 5

5 research), Lora, Jeff, Dustin Yong, Julie, Todd (for his computer assistance), Lynda (for always keeping things in order), Kim, Ma ry, PJ and also Susan Gardner. Final thanks go to my close friends and family. I thank Rui, for her undying support and friendship from the other other end of the eart h. I thank Qiong, for always being there for me, listening and giving me suggestions. I thank Shangli, Xiaolei, Zhiqun, for their amazing friendship. To Qing, Jian, Wei, Yao, Xin, Ye, for making my life warmer and more fun. Most importantly, I cannot express gratitude enough for my parents, for always being there. I could never have co me this far without them.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS ............................................................................................................... 4LIST OF TABLES ...........................................................................................................................8LIST OF FIGURES .........................................................................................................................9LIST OF ABBREVIATIONS ........................................................................................................ 10ABSTRACT ...................................................................................................................... .............14CHAPTER 1 INTRODUCTION .................................................................................................................. 17Introduction .................................................................................................................. ...........17The Nuclear Envelope ............................................................................................................17The Nuclear Pore Complexes .................................................................................................19The Nuclear Lamina ...............................................................................................................20Laminopathies ................................................................................................................. ........23Hutchinson-Gilford Progeria Syndrome (HGPS) ...................................................................27Inner Nuclear Membrane Proteins .......................................................................................... 31Nesprin Targeting and S UN Domain Proteins .......................................................................322 FUNCTIONAL ASSOCIATION OF SUN1 W ITH NUCLEAR PORE COMPLEXES ....... 43Abstract ...................................................................................................................... .............43Introduction .................................................................................................................. ...........43Results .....................................................................................................................................47Discussion .................................................................................................................... ...........56Materials and Methods ...........................................................................................................613 DYNAMICS OF LAMINA PROCESSING: IMPLICATIONS OF L OPINAVIR AND FTI-277 IN THE TREATMENT OF HIV AND PROGERIA ............................................... 77Abstract ...................................................................................................................... .............77Introduction .................................................................................................................. ...........77Results .....................................................................................................................................80Discussion .................................................................................................................... ...........85Materials and Methods ...........................................................................................................88

PAGE 7

7 4 CONCLUSION .................................................................................................................... ...98Overview of Findings .............................................................................................................98Significance .................................................................................................................. ........100Sun1 Can Be Involved in Nuclear Pore Membrane (NPM) Curvature, de Novo NPC Assembly and Defining Distinct Regions of Nuclear Periphery ...............................100The Mechanisms of Nuclear Lamina Assemb ly Has Implications in the Clinical Use of both HIV Protease Inhibitors a nd Farnesyltransferase Inhibitors .................. 101Future Work ..........................................................................................................................102Functional Investigation of Sun1 ...................................................................................102Withdrawl of Lop and FTI-277 on Animal Models ...................................................... 103LIST OF REFERENCES .............................................................................................................105BIOGRAPHICAL SKETCH .......................................................................................................125

PAGE 8

8 LIST OF TABLES Table page 1-1 Properties of representative i nner nuclear m embrane proteins ..........................................42

PAGE 9

9 LIST OF FIGURES Figure page 1-1 Overview of nuclear envelope organiza tion in a eukaryotic interphase cell. .................... 39 1-2 LaA Processing.. .......................................................................................................... ......40 1-3 Model for the LINC complex. ........................................................................................... 41 2-1 Mammalian SUN protein family.. .....................................................................................67 2-2 Sun1 and Sun2 are segregated within the plan e of the NE. ...............................................68 2-3 Sun1, but not Sun2, is closely associated with N PCs as revealed by immuno-electron microscopy.. .................................................................................................................. .....69 2-4 Sun1 contains a single transm embrane domain.. ............................................................... 70 2-5 The Sun1 nucleoplasmic domain has overlapping NE localization m otifs. ......................72 2-6 Sun1 forms homotypic oligomers in vivo .. ........................................................................ 73 2-7 Sun1 association with NPCs requires both the nucleoplasm ic and lumenal domains. ...... 74 2-8 Perturbation of Sun1 a ffects NPC distribution.. ................................................................ 75 2-9 Sun1 topology and interactions.. ........................................................................................76 3-1 HIV PIs block LaA maturation, which is reversed rapidly following PI removal. ...........91 3-2 Aberrant cellular phenotypes are rec overed by 15 hours following Lop washout. ........... 92 3-3 Recovery of nuclear morphology follow ing Lop washout requires m itosis.. ....................94 3-4 Lovastatin and FTI-277 lead to ac cumulation of nf-PreA on the NE, which undergoes gradual m aturation followi ng washout of Lov and FTI-277. ........................... 95 3-5 Release from FTI-277 block leads to gradual m aturation of nf-PreA and nf-LaA 50 and slow recovery of nuclear morphology in HGPS cells. ................................................96 3-6 Correction of cellular phe notypes in Saos2 cells caused by L op with a combinatorial treatment of both FTI-277 and GGTI-2147 is reversed quickly upon washout of FTI277 and GGTI-2147 ...........................................................................................................97

PAGE 10

10 LIST OF ABBREVIATIONS ABD Actin binding domain AD-EDMD Autsomal dominant EDMD ANC-1 Abnormal nuclear anchorage BAF Barrier-to-autointegration factor BMP Bone morphogenic protein bp Base pairs C. `elegans Caenorhabditis elegans CMT2B1 Charcot-Marie-To oth type 2B1 disorder D. melanogaster Drosophila melanogaster DCM-CD1 Dilated cardiomyopat hy with conduction defects DMSO Dimethylsulfoxide DNA Deoxyribonucleic acid DSB Double strand breaks DTT 1,4-dithiothreitol EDMD Emery-Dreifuss Muscular Dystrophy EM Electronic microscope f-PreA Farnesylat ed/carboxynethylated-PreA FBS Fetal Bovine Serum FPLD2 Dunnigan-type familial partial lipodystrophy FRAP Fluorescence recovery after photobleaching FTI Farnesyl transferase inhibitor GCL Germ cell-less GGTI Geranylgeranyltr ansferase inhibitor

PAGE 11

11 GFP Green fluorescence protein HAART Highly active anti-retroviral therapy HGPS Hutchinson-Gilfor d progeria syndrome HIV PIs Human immunodeficiency virus protease inhibitors HP1 Heterochromatin protein 1 HRP Horse radish peroxidase ICMT isoprenyl cysteine carboxymethyl transferase IF Intermediate filament INM Inner nuclear membrane Kap Karyopherin KASH Klarsicht, ANC-1, Syne homology kD Kilodalton LaA LaminA LaC LaminC LAP Lamin A polypeptide LBR Lamin B receptor LEM LAP, emerin, MAN1 LGMD1B Limb-girdle musc ular dystrophy type 1B LINC Linker of nucleoskeleton and cytoskeleton Lop Lopinavir Lov Lovastatin MAD Mandibuloacral dysplasia MDa Megadalton

PAGE 12

12 MEF Mouse embryonic fibroblasts MT Microtubules MuSK Muscle specific tyrosine kinase NE Nuclear envelope Nesp Nesprin NespG Nesprin giant Nesprin Nuclear envel ope spectrin repeat NET Nuclear envelope transmembrane protein NLS Nuclear localization signal NMJ Neuromuscular junction NPC Nuclear pore complex NPM Nuclear pore membrane NUANCE Nucleus and actin connecting element Nup Nucleoporin ONM Outer nuclear membrane PAGE Polyacrylamide gel electrophoresis PBS Phosphate buffered saline PCNA Proliferating cell nuclear antigen PCR Polymerase chain reaction PFA Paraformaldehyde PIs Protease inhibitors PNS Perinuclear space PPAR Nuclear peroxisome proliferators-activated receptor

PAGE 13

13 PRD Plakin repeat domain P-sites Phosphoacceptor sites Rb Retinoblastoma protein RD Restrictive dermopathy rER Rough endoplasmic reticulum RNA Ribonucleic acid RNAi RNA interference SDS Sodium dodecyl sulphate SPAG Sperm associated antigen SPAG4L Spag4-like SR Spectrin repeat SREBP1 Sterol response element binding protein 1 SUN Sad1p,Unc-84 SUNC Sad1 and UNC-84 domain containing Syne Synaptic nuclear envelope TM Transmembrane Tris Tris-(hydroxymethyl) aminomethane TX-100 Triton X-100 WS Werner's syndrome WT Wild type X-EDMD X-linked EDMD ZmpSte24 Zinc Metalloproteinase STE24

PAGE 14

14 Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy PROTEIN INTERACTIONS AT TH E INNER NUCLEAR MEMBRANE By Qian Liu December 2008 Chair: Brian Burke Major: Medical Sciences--Molecular Cell Biology Physical connections between the nucleosk eleton and cytoskeleton were recently uncovered, which we have previously define d as LINC (linker of nucleoskeleton and cytoskeleton) complex. They form through inter actions between the luminal domains of two families of transmembrane proteins of the nuclear envelope (NE): Sun proteins and Nesprins. Mammalian cells are known to contain at leas t five Sun proteins, within which, Sun1 and Sun2 are ubiquitously expressed in mice and hum an. Though functionally similar, we discovered that Sun1 and 2 are segregated with in the plane of the NE in both interphase and early telophase. Immunofluorescence and immunoelect ric microscopy further revealed that Sun1, but not Sun2 is intimately associated with nuclear pore comp lexes (NPCs). Though interaction with A type lamins has been confirmed, localization of Sun proteins is not lamin dependent. Topological analyses indicate that Sun1 is a type II integral protein of the INM. Localization of Sun1 to the INM is defined by at least two discrete regions within its nucleoplasmic domain. However, association with NPCs is dependent on the s ynergy of both nucleoplasmic and lumenal domains. Cells that are either depleted of Sun1 by RNA interference (RNAi ) or that overexpress dominantnegative Sun1 fragments exhibit cl ustering of NPCs. Monitored by -galactosidase-

PAGE 15

15 glucocorticoid receptor fusion protein, the major transport function of NPCs is not affected. Thus, Sun1 represents an important determinant of NPC distribution across the nuclear surface. The nuclear lamina is a condensed intermedia te filament network lining the INM. One of the major components of the nuclear lamina, la minA (LaA) undergoes multistep posttranslational processing involving farnesylation, car boxymethylation and cleavage by ZmpSte24. By using HIV protease inhibitor Lopivinair (L op), which is known to inhibit the function of ZmpSte24, we accumulated a considerable leve l of farnesylated preA on the NE with concomitant nuclear structural abnormalities. Rel ease from the Lop block resulted in rapid LaA processing, with a slightly slow er reversion of normal nucl ear morphology. On the other hand, farnesyl-transferase inhibitor FTI-277 in combin ation of geranylgeranyl -transferase inhibitor GGTI-2147 effectively blocked LaA maturation and accumulated non-farnesylated preA on the NE in Saos2 cells. The aberrant cellular pheno types caused by Lop can be corrected by a combinatorial treatment of FTI-277 and GGTI2147. Release both drugs led to a quick rebound phenomenon. In Hutchinson-Gilford progeria syndr ome (HGPS) cells, however, prenylation of LaA and LaA 50 was largely blocked by FTI-277 alone. Both protein maturation and nuclear phenotype returned slowly after drug washout, sugges ting a role of cell pro liferation in the rate of recovery. Our observations indicate a more dynamic nature of the nuclear lamina, with implications for design of therapies for HIV patients and the ongoing clin ical trial for children with HGPS. Our study has characterized the topology, localization and intera ction of Sun1, a major role player in coupling nucleus and cytoplasm. Furthe rmore it provides new insi ght into the role of Sun1 in NPCs distribution and lays the foundatio n of future investigations for nuclear pore membrane (NPM) curvature, interphase NPCs assembly and heterochromatin organization.

PAGE 16

16 Whats more, our study has charactered the dynamics of the nuclear lamina by using inhibitors for processing enzymes of LaA. This discovery has important implications in the clinical uses of Lopinivir and FTIs in the tr eatment of HIV and progeria.

PAGE 17

17 CHAPTER 1 INTRODUCTION Introduction By def inition, the eukaryotic cell partitions its genetic material into a separate compartment, the nucleus. It has become increas ingly obvious that the nu cleus has an elaborate organization that is key to maintaining many of its major functions. Several dynamic domains or subnuclear bodies serve as sites of pre-mRNA splicing and transcription while the nucleolus is involved in ribosome biosynthesis (Handwerger a nd Gall, 2006; Raska et al., 2006a; Raska et al., 2006b). The most obvious architectural component of the nucleus is the nuclear envelope (NE) (Figure 1-1). The NE comprises a double membrane that delineates the nucleus and serves as a selective barrier between nuclear and cytoplas mic compartments. Protein components of the nuclear membranes and the underlying scaffold, wh ich is an intermediate filament network called nuclear lamina, appear to be important in the regulation of ge ne expression by providing anchoring sites for chromosome territories. Ce rtain nuclear membrane proteins that are components of nuclear pore complexes (NPCs) ar e involved in the control of nucleo-cytoplasmic transport of macromolecules. So far, 80 integral nuclear membrane proteins have been identified or characterized, within which, members of the newly identified nesprin and SUN protein families are now shown to be involved in the connection of cytoskeleton and nu clear lamina. This finding has implicated the NE in more global functions, including influence in cytoplasmic mechanics and participation in nuclear positioning. The Nuclear Envelope In the 1950s, the application of the electron m icr oscope to investigate the fine structure of isolated interphase nuclei revealed that the NE is composed of two concen tric lipid bilayers, the

PAGE 18

18 inner and outer nuclear membranes (INM and ONM, respectively) (Callan and Tomlin, 1950; Hartmann, 1953). The INM and ONM are separated by a fairly uniform lumen, between 20-40 nm wide, known as the perinuclear space (PNS) (Watson, 1955). Periodic annular junctions between the INM and ONM create aqueous channels that traverse the NE and are occupied by NPCs, which are massive (~60 MDa) multi-protein complexes that dictate the bidirectional passage of macromolecules across the NE (Burke, 2006; Watson, 1955). Despite their connections at the periphe ry of each NPC, the INM and ONM are biochemically distinct. The INM contains its own unique repertoire of integral membrane proteins, is ribosome free and maintains clos e contacts with chromatin (Wiese and Wilson, 1993). The ONM, the cytoplasmically opposed me mbrane, is continuous with the rough endoplasmic reticulum (rER) and, like the rER, is c overed with ribosomes. In effect, the cisternal space of the ER communicates directly with the PNS. Only in recent years has it been established that proteins, some as big as 1000kD, reside in the ONM, but not in the peripherial ER (Padmakumar et al., 2004; Zhen et al., 2002). Beneath the INM is an intermediate filament network called nuclear lamina. In addition to acting as a mechanical support for the interphase NE, the lamina also plays a role in chromatin organization and gene regulation. Mutations in lamins and lamin-binding proteins can cause a wide range of heritable or sporadic human diseases, wh ich are collectively known as laminopathies. Reduced nuclear resilience and in ability to activate mechanosensitive genes (Broers et al., 2004; Lammerding et al., 2006; Lammerding et al., 2005; Lammerding et al., 2004b) in all kinds of laminopathies has highlight ed another function of NE components in influencing cytoskeletal orga nization and mechanotransduction (Tzur et al., 2006; Worman and Gundersen, 2006).

PAGE 19

19 The Nuclear Pore Complexes The NPCs a re octagonal multiprotein assemblies with their 8-fold axes perpendicular to the plane of nuclear membranes (Akey and Radermacher, 1993; Hinshaw et al., 1992). Each NPC consists of a massive central framework embracing a central channel with diameters of ~30-40nm (Dworetzky et al., 1988; Feldherr et al ., 1984). On the cytoplasmic face, there are eight flexible filaments that adopt a highly kinked conf ormation, yielding a length of approximately 35nm (Stoffler et al., 1999). The nucleoplasmic face of NPCs, on the other hand, features a dynamic basket-like structure composed of eight 100nm filament s joined at their tips by a distal ring approximately 30-50 nm in diameter (Jarnik and Aebi, 1991). Approximately 30 proteins are found within NPCs, collectively called nucleoporins (Nups) (Cronshaw et al., 2002; Rout et al., 2000). Three of them, POM121, gp210 and NDC1, contain transmembrane helices, and POM121 and NDC1 have been shown to play a role in NPC and NE assembly (Antonin et al., 2005; Mansfeld et al., 2 006; Rasala et al., 2008). Another characteristic structure of some Nups is repeti tive stretches of Phe-Gly residues the so-called FG repeats. Most of FG repeat Nups line the surface of aqueous channel and are involved in cargo transport (Rout and Wente, 1994). Numbering between 1,000 and 10,000 in a vert ebrate somatic cell, the density and distribution of NPCs are not random. Detergent and salt fractiona tion of rat liver nuclei isolated a nuclear matrix containing NPCs attached to the nuclear lamina (Aaronson and Blobel, 1975; Dwyer and Blobel, 1976). Mapping various green fluorescent protein (GFP) tagged Nups also showed the static and immobile nature of NPCs, confirming th eir physical interaction with intranuclear structures (Daigle et al., 2001; Rabut et al., 2004). On the other hand, there is a highly dynamic aspect of nuclear pores. Several earl ier reports demonstrated that the number of NPCs increases during the cell cycle (Maul et al., 1971). Maeshima et al. also reported large

PAGE 20

20 distinct LaA/C rich subdomains lacking nuclear pores on the nuclear surface in early cell cycle stages and that they gradually become disper sed in G1-S phase. Notably, either static or dynamic, all these observations suggest a role fo r the nuclear lamina in NPCs distribution. However, it is unknown whether th e interaction between NPCs a nd various lamin proteins is direct or through other protein mediators. The clarification of this question will enlarge our understanding of molecular in teractions within the NE. The major function of NPCs is cargo transpor t between nucleus and cytoplasm. Molecules smaller than 25-40 kDa can passively diffuse across the NPC; however, highly efficient localization and all macromolecula r transport require facilitate d, energy dependent transport, which are imposed largely by solu ble receptors such as member s of karyopherin (Kap)/importin family. The directionality of Kap-mediated tr ansport is exquisitely controlled by the small GTPase Ran, whose nucleotide-bound state di ctates cargo binding and release in a compartmentalized manner (Fried and Kutay, 2003; Pemberton and Kay, 2005). Several models have been proposed specula ting on the mechanism for movement through NPCs. All invoke facilitated diffusion controlled by association and disassociation of transport receptors with FG Nups. However, different Kaps require different subsets of FG domains, which allow the existence of multiple, nonequivale nt transport pathways within each NPC. The Nuclear Lamina Underlying the INM is the nuclear lam ina, a majo r structural element of the NE. It plays a critical role in main taining interphase nuclear morphology by providing mechanical stability and determining the spatial arrangeme nt of NPCs in the NE (Aebi et al., 1986a; Gerace and Burke, 1988; Liu et al., 2000; Mounkes et al., 2003; Ris, 1997; Schirmer and Gerace, 2004; Stuurman et al., 1998a). The nuclear lamina has also been shown to be an important determinant in DNA replication, transcription, chromatin organiza tion and apoptosis (Burke, 2001; Glass et al.,

PAGE 21

21 1993a; Goldman et al., 2002; Gruenbaum et al., 2000; Lazebnik et al., 199 5; Liu et al., 2000; Starr and Han, 2002; Starr et al ., 2001; Zastrow et al., 2004). Many functions of the lamina involve interactions with INM pr oteins and a provision for anc horing chromatin at the nuclear periphery (Gerace and Burke, 1988). The major components of nuclear lamina are me mbers of the intermediate filament protein family known as nuclear lamins (Stuurman et al., 1998b). Two classes of lamins have been described in mammalian somatic cells, type A and type B. Alternate splicing of a single LMNA transcript yields at least f our variants in type A lamins: lamins A (LaA), C, A 10 and C2 (Goldman et al., 2002; Lin and Worman, 1993; M ounkes et al., 2001). Type B includes lamin B1 and B2, which, in contrast, are encoded by sepa rate genes, LMNB1 and LMNB2 (Fisher et al., 1986; McKeon et al., 1986). Lamin B3 is expres sed as a minor splice variant of LMNB2 and, similar to lamin C3, was found to be germ cell specific (Goldman et al., 2002; Mounkes et al., 2003). Like all intermediate filament proteins, nuclear lamins feature a central coiled-coil domain flanked by a non-helical Nand Cterminal domains. The coile d-coil region contributes to the formation of parallel dimers (Stuurman et al., 1998b). Additional h ead-to-tail and lateral interactions result in the forma tion of higher-order structures such as filaments and paracrystals (Aebi et al., 1986b; Heitlinger et al., 1991; Heitlinger et al., 1992). Distinguished from other intermediate filaments, however lamin proteins possess a nuclear localization signal (NLS) and highly conserved phosphoacceptor sites (P-sites) in the head and tail domains (Kalderon et al., 1984; Loewinger and McKeon, 1988). P-sites act as substrates for a protein kinase Cdk1 which phosphorylates lamins at the end of prophase a nd promotes nuclear lamina disassembly in mitosis (Dessev et al., 1990; Gerace and Blobel, 1980).

PAGE 22

22 Additionally, LaA, B1 and B2 contain a special CaaX motif tail where C=cysteine, a=any amino acid with an aliphatic side chain, X=any amino acid (Hanco ck et al., 1989). Shortly after synthesis, all Caax motif lamins are farnesylated on the cysteine residue, proteolytically cleaved to remove the aaX sequence and then carboxymethyl ated on the farnesylated cysteine (Kitten and Nigg, 1991). While B type lamins remain permanently farnesylated, LaA is unique in that it undergoes proteolytic cleavage 15 re sidues upstream from the farnesyl ated cysteine (Figure 1-2). This cleavage is believed to occur soon after the incorporation of LaA into nuclear lamina (Gerace et al., 1984). According to the previous reports, the release of aaX is the function of either ZmpSte24 or Rce1 (Bergo et al., 2002; Corrigan et al., 2005). However, the second cleavage is carried out solely by ZmpSte24 (Cor rigan et al., 2005). Like the yeast homolog Ste24p, ZmpSte24 is a zinc-dependent metallopr oteases and is an ER -localized integral membrane protein (Kumagai et al., 1999). Disr uption of ZmpSte24 in fibroblasts can cause a striking accumulation of Pre-la min A (PreA) on the NE (Leung et al., 2001). Lately, the saquinavir family of HIV aspartyl protease inhibitors, a component of highly active antiretroviral therapy (HAART), has been found to inhibit the function of ZmpSte24 (Coffinier et al., 2007). Abnormal processing of lamin A might account for some side effects of this treatment (Caron et al ., 2007; Clarke, 2007). Lamins are classified by biochemical properties, expression pattern and sequence homology (Broers et al., 1997; Gr uenbaum et al., 2000). A-type lamins have a neutral isoelectric point and their expression is developemetly regul ated. In the mouse, they are absent from early embryonic cells with expression commencing midw ay through gestation (Mattout-Drubezki and Gruenbaum, 2003; Rober et al., 1989; Zastrow et al ., 2004). In certain cell types, LaA/C appear only after birth and some adult cells, most not ably those of the immune and hematopoietic

PAGE 23

23 system, never express these protei ns (Rober et al., 1990; Rober et al., 1989). Lamina enriched in lamin A (an A-type variant) are the most stable and require harsh conditions to be solubilized (Schirmer and Gerace, 2004). However, The presence of lamins in the interior of the nucleus has also been well documented (Goldman et al., 199 2; Jagatheesan et al., 1999; Kumaran et al., 2002; Neri et al., 1999). B-type lamins are characterized by an acidic isoelectri c point and are ubiquitously expressed at all stag es of differentiation in mammalian somatic cells (Burke et al., 2001; Gerace and Burke, 1988; Mounkes et al., 2003; Nigg, 1989). Moreover B-type lamins are crucial for cell survival at the organismal leve l (Sullivan et al., 1999), whereas A-type lamins have been identified as non-e ssential in mouse embryos and in HeLa cells which have been depleted of LaA by RNAi (Harborth et al., 2001; Sullivan et al., 1999). Laminopathies To date, at least 18 hum an diseases and s yndromes with wide-ranging phenotypes have been linked to a plet hora of inherited or de novo defects in proteins of the NE. The first of these to be demonstrated was Emery-Dreifuss Muscular Dystrophy (EDMD). In 1994, Bione et al showed that defects in a near ly ubiquitous INM protein, emer in, was responsible for X-linked EDMD (Bione et al., 1994). The disease is ch aracterized by muscle atrophy, flexion deformities of the elbows, and cardiac conduction defects (Emery, 1987). Interestingly, a phenotypically indistinguishable autosomal dominant form of EDMD (AD-EDMD) was later mapped to mutations in the LMNA gene (Bonne et al., 1999). Multiple diseases caused by defects in the genes that encode A type lamins and associat ed proteins, specifically referred to as laminopathies, have since been described. These include dilated cardiomyopathy with conduction defects (DCM-CD1) (Fatkin et al., 1 999), limb-girdle muscular dystrophy type 1B (LGMD1B) (Muchir et al., 2000), Dunnigan-type familial partial li podystrophy (FPLD2) (Cao and Hegele, 2000a; Shackleton et al., 2000a; Spec kman et al., 2000), mandibuloacral dysplasia

PAGE 24

24 (MAD) (Novelli et al., 2002), autosomal recessi ve Charcot-Marie-Tooth type 2B1 disorder (CMT2B1) (De Sandre-Giovannoli et al., 2002), Hutchinson-Gilford progeria syndrome (HGPS) (De Sandre-Giovannoli et al., 2003; Eriksson et al., 2003), restrictive dermopathy (RD) (Navarro et al., 2004) and atypical Werners syndrome (WS) (Chen et al., 2003). The wide variety of clinical presentation of LMNA-associated diseases has raised the question of how multiple mutations in a single gene can generate such a diverse range of diseases. Equally perplexing is that LMNA is e xpressed in most somatic cells, but frequently yields tissue-specific pathologies. This seemi ngly multi-faceted paradox has been addressed by two major theories, which are not necessarily mutually exclusive (Worman and Courvalin, 2004). The Structural Hypothesis: One mechanism highlights the lamina and nuclear envelope as an architectural unit. Given that skeletal and car diac muscle are especially subject to mechanical stress, disrupted nuclear struct ure support caused by LaA mutations is likely to be the pathology in EDMD, DCM and LGMD1B (Broers et al., 2004). Mutations in the LMNA gene are frequently manifested as defects in nuclear morphology, including irregular shape and lobulations. Fibroblasts derived from Lmna-/mice exhibit herniations in which INM protei ns, B-type lamins, NPCs and chromatin are withdrawn from one pole of the nucleus (Roux and Burke, 2006; Sulliv an et al., 1999). Studies using biomechanical techniques demonstrated that these fibroblasts show increased nuclear deformation, decreased mechanical stiffness, impaired mechanotransdu ction and increased susceptibility to nuclear rupturing when subjected to mechanical load s (Broers et al., 2004; La mmerding et al., 2004a). On a molecular level, most mutations that cause neuromuscular phenotypes tend to affect the

PAGE 25

25 structure of the hydrophobic core, potentially destabilizing or comp letely deleting the entire Cterminal tail of LaA/C (Dhe-Paganon et al., 2002; Ostlund and Worman, 2003). Beyond the nuclear boundaries, disruption of the lamina leads to diso rganization of the cytoskeleton and deformation of the cell as a whole (Broers et al ., 2004). Lmna -/cells display abnormal actin networks and vimentin organization, which are important for cellular resilience (Broers et al., 2004). Members of the newly identified nesprin and SUN protein family members on the NE are likely to be involved in the integration of the nuclear and cytoplasmic compartments of the cell (Crisp et al., 2006). Desmin, an intermediate filament protein specific to muscle cells, is disorganized and detached from the nucleus in cardiomyocytes of Lmna-/mice (Piercy et al., 2007). The disrupted cytoskel etal tension might impa ir force transmission and result in systolic contractile dysfunction. The Gene Expression Model: Mutations in lami na proteins are also proposed to affect chromatin organization and alter cell-type specific gene expre ssion patterns. The alpha-helical rod domains of LaA/ C contain chromatin binding sites. LaC, B1 and B2 also bind chromatin at their tail domains (G lass et al., 1993b). In vivo evidence has shown that approximately 500 genes interact with B-type lamins in Drosophila melanogaster. These genes were transcriptionally silent, late replicating, lacking in active histone marks and ha d a tendency to cluster in the genome, indicating a dynamic role for the lamina in chromatin organization and transcriptional regulation (Pickersgill et al., 2006). Indeed, altered heterochromatin distribution has been identified in emerin associated X-EDMD as well as LMNA-linked laminopathies, including ADEDMD, LGMD1B, FPLD, MAD and HGPS (Maraldi et al., 2006). LaA and C also bind to RNA pol ymerase II, RNA splicing factor s and a steadily increasing number of known transcription factors such as autointegration factor (BAF), retinoblastoma

PAGE 26

26 transcriptional regulato r (RB) and sterol response elemen t binding protein (SREBP1). BAF has two binding sites for dsDNA, and potentially regulate higher-order chromatin structure (Bengtsson and Wilson, 2006). RB, on the othe r hand, after activated by dephosphorylation, induces transcriptional silencing at E2F-regulated loci, ultimately leading to reversible cell-cycle arrest (Flemington et al., 1993; Melcon et al., 2006). In lipodystrophic cells from MAD, FPLD and atypical Wemer syndrome, prelamin A accumulates at the NE colocalized with SREBP1. This decreases the pool of SREBP1 to activate pe roxisome proliferator activated receptor gamma (PPAR ), and may impair pre-adipocyte differentiation (Capanni et al., 2005). With its involvement in such diverse processes as chromatin organization and gene transcription, the lamina is intimately coupl ed to DNA replication and DNA damage repair. Lmna/fibroblasts replicate their DNA at a slower rate, which can be rescued by overexpression of GFP-LaA (Johnson et al., 2004). In a recent study, Shumaker et al. have showed that the C-terminal non-helical domains of all lamins bind di rectly to proliferating cell nuclear antigen (PCNA), which is necessary fo r the processivity of DNA polymerase during the chain elongation phase of DNA replication (Lee a nd Hurwitz, 1990; Shum aker et al., 2008). Accordingly, impaired DNA repair has also be en reported in many progeroid syndromes (Lans and Hoeijmakers, 2006; Liu et al., 2005). Liu an d colleagues has provided direct evidence of genomic instability in ZmpSte24-/mice and in HG PS fibroblasts such as increased sensitivity to DNA-damaging agents, increased numbers of chro mosomal aberrations and a delayed response in the recruitment of DNA repa ir factors (Liu et al., 2005). As mentioned previously, th e structural hypothesis and ge ne expression model are not mutually exclusive. Lammerding et al. demonstr ated that expression of the mechanosensitive genes egr-1and iex-1 was impaired in Lmna / fibroblasts (Lammerding et al., 2004b).

PAGE 27

27 Additionally, the activity of NFB, a transcription factor that normally protects the cell from stress by responding to mechanical or cytokine stimulation, is reduced in Lmna-/mouse fibroblasts, and thus contributes to the cells susceptibility to m echanical strain (Lammerding et al., 2004b). The ambiguities on the etiology and tissue spec ificity of various laminopathies may be explained by the functional intera ctions between proteins concentr ated within the NE. It is striking that mutations in two ge nes, encoding NE components known to interact, separately give rise to virtually the same dis ease. EDMD can be linked to mutations in both emerin and lamin A; defects in Lap2 and lamin A lead to DCM (Bione et al., 1994; Bonne et al ., 1999; Fatkin et al., 1999; Taylor et al., 2005). On the other hand, some diseases result from a combination of several protein defects. In C.elegans, depleti on of emerin yielded no detectable phenotype, but was found to be synthetic lethal with the depletion of MAN1 (Brachner et al., 2005; Liu et al., 2003). MAN1 and emerin bind directly to lami n A and to each other and are partially mislocalized from the NE when lamin A is lost from the NE (Clements et al., 2000; Liu et al., 2003; Mansharamani and Wilson, 2005; Ostlund et al., 2006). Taken togeth er, evidence gleaned from human diseases and animal models suggests there are complex inter actions at the nuclear periphery involving nuclear a nd NE proteins as well as cytoplasmic components. Hutchinson-Gilford Pr ogeria Syndrome (HGPS) Clinically recapitulating norm al aging, one of the laminopathies, HGPS, has gained much recent attention. Several ageing-related features such as alopecia, loss of subcutaneous fat and premature atherosclerosis characterize this extr emely rare and uniformly fatal disease. Patients usually die at a mean age of 12 years due to m yocardial infarction or cer ebrovascular accident (Capell and Collins, 2006; DeBusk, 1972; Sark ar et al., 2001). Although several recessive

PAGE 28

28 mutations have been reported to cause HGPS (Cao and Hegele, 2003; Fukuchi et al., 2004; Kirschner et al., 2005; Plasilova et al., 2004; Verstraeten et al., 2006), the most common one is a de novo heterozygous silent substitution at codon 608 (G608G: GGC GGT) of LMNA. This dominant mutation activates a cryptic splice don or site, ultimately crea ting a truncated PreA (progerin or LaA 50), lacking the ZmpSte24 cleavage site at protein 647 but retaining the Caax box (De Sandre-Giovannoli et al., 2003; Eriksson et al., 2003; Sevenants et al., 2005). Thus, progerin is permanently farnesylated and b ecomes irreversibly anchored in the NE. HGPS cells are associated with significant changes in nuclear shape, including lobulation of the NE, thickening of the nuclear lamina, loss of peripheral heterochro matin, and clustering of nuclear pores. Compared to wild type (WT) LaA, progerin displays delayed targeting to the NE after mitosis and imposes a deleterious, stabil izing effect on the nuclear lamina. Additionally, LaB1 is quantitatively reduced and mislocali zed from the NE. Fluorescence resonance energy transfer (FRET) analysis indica ted that an altered homopolymer segregation pattern of progerin and LaB1 (Delbarre et al., 2006; Goldman et al., 2004). Fibroblasts from patients with HGPS usually show a passage-dependent reduction in growth rate and lifespan in culture. They are hypersensitive to heat stress and exhibit broad epig enetic changes in histone methylation patterns that predate any nuclear shape changes (Par adisi et al., 2005; Shum aker et al., 2006). In terms of disease mechanism, some author s hypothesized that alterations in nuclear structure, as well as the severi ty could be correlated to the toxic accumulation of farnesylated PreA (Fong et al., 2004; Navarro et al., 2004). In such a case, a concentration-dependent dominant-negative effect of prelamin A would lead to disruption of lamin-related functions ranging from the maintenance of nuclear shap e to regulation of ge ne expression and DNA replication.

PAGE 29

29 Recent studies have shown that double-strand breaks (DSBs) typically accumulate in HGPS cells and the resultant genome instability mi ght contribute to premat ure aging (Liu et al., 2005; Manju et al., 2006). DNA repa ir pathway defects were also observed. Liu et al. reported impaired recruitment of DNA repair factors to damage sites and abnormal colocalization of xeroderma pigmentosum group A (X PA) protein with DSBs in HGPS fibroblasts (Liu et al., 2005; Liu et al., 2008). Furthermore, the associat ion of progerin with NE membrane causes the impairment of mitosis and delays the progres sion of cell cycle (Dechat et al., 2007). Other evidences also show up such as alterations of epig enetic control, failure of stem cell growth, and altered regulation of gene expression (Dorner et al., 2006; Galderisi et al., 2006; Johnson et al., 2004; Nitta et al., 2006; Sh umaker et al., 2006). Considering the pathophysiology of progeria mi ght be the accumulation of farnesylated PreA, several potential therapeutic st rategies have emerged to target either the splicing defect or the toxic farnesyl moiety of PreA. Scaffidi and Misteli used antisense morpholino oligonucleotides sp ecifically directed against the aberrant exon 11exon 12 junction contained in mutated pre-mRNAs to lower progerin production (Scaffidi and Misteli, 2005). Alternatively, Hu ang and colleagues were able to decrease mutated LMNA mRNAs expression leve ls by small interference RNA (Huang et al., 2005). Notably, in both cases, nuclear blebbing was substantially am eliorated, indicating that the reduction of progerin levels suffi ces to revert the abnormal nuclear morphology. However, at the moment, these techniques seem to be difficult to apply to whole organisms. On the other hand, based on the hypothesis that maintenance of the farnesyl moiety is one of the major mediators of progerin toxicity, farnes yltransferase inhibitors (FTIs) have been used as a potential strategy for HGPS. Since the early 1 990s, FTIs have been in development for their

PAGE 30

30 antineoplastic effects through inhibiting the fa rnesylation, and therefore activation of the oncoprotein Ras (Basso et al., 2006). It was not long before FTIs were shown by several laboratories to have a dramatically benefici al effect in HGPS cells, preventing and even reversing the dysmorphic nuclear shapes and mislocalizing prelamin A away from the NE (Capell et al., 2005; Glynn and Glover, 2005; Mallamp alli et al., 2005; Toth et al., 2005; Yang et al., 2005). Further successes were also achieved in mouse models. Placing FTI in the drinking water of ZmpSte24-/mice and Lmna HG/+ mice partially ameliorated the progeroid phenotype, resulting in reduced rib fractures, improved grip strength and decreased wei ght loss (Fong et al., 2006; Yong and Hart, 1994). However, the unique use of FTIs as a treatmen t for Progeria and relate d disorders is still a matter of controversy. The first question concerns other farnesylated prot eins such as LaB and Ras proteins and downstream effects when their fa rnesylation is inhibite d by FTIs (Rusinol and Sinensky, 2006). The second concern comes from a possible alternative prenylation of PreA and progerin, i.e. geranyl-geranylat ion, bypassing the treatment with FTIs (Basso et al., 2006; Rusinol and Sinensky, 2006). Furthermore, it has been shown that in HGPS and RD fibroblasts, DNA damage checkpoints are persistently activated and that treatment of patients cells with a FTI did not result in a reduc tion of DNA double-strand breaks a nd damage checkpoint signaling, although the treatment significantly reversed the ab errant nuclear shape (Liu et al., 2006). Even recently, Yang and his colleagues presented evidence that knocking mice expressing nonfarnesylatable progerin (Lmna(nHG/+) devel oped the same disease phenotypes observed in Lmna(HG/+) mice, although the phenotypes were milder, which further suggests that the approach of farnesylation i nhibition in treating HGPS may be limited (Yang et al., 2008).

PAGE 31

31 On the other hand, several other molecules invol ved in cholesterol biosynthesis/prenylation pathways also have therapeutic potentials. St atins inhibit the HMG-Co A reductase, the ratelimiting enzyme of the mevalonate pathway of c holesterol synthesis and are known to induce an inhibition of LaA maturation (Baker, 2005; Lu tz et al., 1992; Sinensky et al., 1990). Aminobiphosphonates (N-BPs) act as inhi bitors of farnesyl-pyrophosphate synthase, thus reducing the synthesis of both geranyl-geranyl and farnesyl groups (Amin et al., 1992 ; Keller and Fliesler, 1999). Treatment with both statins and ami nobisphosphonates has been shown to extend longevity in a mouse model of HGPS and they are currently under clinical study in France (Varela et al., 2005) Inner Nuclear Membrane Proteins Until recently, only abou t a dozen integral membra ne proteins were known to reside in the NE. In 2005, a subtractive proteomics study of pur ified NE uncovered a cata logue of at least 50 additional putative NE transmembrane proteins (NETs) (Schirmer et al., 2005), the bulk of which appear to be enriched within the INM. The prop erties of many integral membrane proteins are summarized in Table 1-1. Most of those INM proteins in teract with lamins and/or chromatin, which is generally agreed to contribute to the structural stabilit y of the NE and higher order organization of the nucleus. Among those INM proteins that have al ready been characterized are the LEM domain proteins: lamina associated polypeptide 2(LAP2), emerin and MAN1. This class of proteins shares a common 43 amino acid domain that binds barrier to autointegration factor (BAF), a DNA bridging protein nonspecific to sequence (Cai et al., 20 01; Shumaker et al., 2001). Moreover, LEM domain proteins have extensiv e interactions with regulator proteins; for example, LAP2 and emerin interact with a transcription repressor, germ cell less (gcl) and

PAGE 32

32 MAN1 binds Receptor-Smads 2/3, downstream effectors of the TGF and bone morphogenic protein (BMP) signaling cascade (Holaska et al., 2003; Lin et al., 2005). Lamin B receptor (LBR), on the other hand, provides an additional link to chromatin via its association with heterochromatin protein 1 (HP1 ), histones H3/H4 and epigenetically marked heterochromatin (Makatsori et al., 2004; Poli oudaki et al., 2001; Ye et al., 1997; Ye and Worman, 1996). Remarkably, vertebrate LBR po ssesses sterol C14 reductase activity and can restore such activity to mutant yeast (Wagner et al., 2004). Em erin, LAP1 and LAP2 family members, and LBR also exhibit an additional indirect attachment to chromatin via their interactions with nuclear lami ns (Burke and Stewart, 2002). The targeting of INM proteins is considered to involve a proce ss of selective retention that depends on the interconnected nature of ER, ONM and INM (Gerace and Burke, 1988; Newport and Forbes, 1987). Newly synthesize d integral proteins move into the ONM by lateral diffusion and gain access to the INM via membrane continuiti es of the NPCs. Only those proteins that are capable of binding to stable nucl ear components such as lamins or chromatin are subsequently concentrated within the INM. Quantitative fluo rescence recovery after photobleaching (FRAP) analyses indicate that GFP-LBR and GFP-emerin diffused with unrestricted mobility in the ER while the large fraction localized to the IN M was virtually immobilized (Ellenberg and Lippincott-Schwartz, 1999; Ostl und et al., 1999). In addition, emerin and MAN1 experienced increases in mobility at the NE of Lmna-/ce lls, indicating at least a partial dependence of MAN1 and emerin on lamin A for retent ion at the INM (Ost lund et al., 2006). Nesprin Targeting and SUN Domain Proteins Recently, O NM-specific KASH doma in proteins have been identified. KASH derives from K larsicht (Drosophila melanogaster), A NC-1 (C. elegans) and S yne-1 (mammal) h omology

PAGE 33

33 domain, which contains a transm embrane region and C-terminal residues lying within the PNS. Other proteins, such as C. elegans Unc83, ZYG-12 and Drosophila Msp-300/nesprin also contain KASH domains. The large NH2-terminal domains of ONM localized KASH proteins are central in bridging the communication gap between the nucleus and cytoskeletal components, namely actin, microtubules (MT) and intermediate filaments (I F), and play an important role in nuclear anchorage and positioning. ANC-1 is named after anchorage defective-1 and it contains two Nterminal calponin homology motifs, which comprise an actin-binding domain (ABD). Nuclei that are normally spaced apart float freely and aggregat e in clusters in anc-1 mutants (Starr and Han, 2002). Similarly, Msp-300/nesprin has been found associated with actin filaments. Developing oocytes in germ-line Msp-300 null flies have a strong dumping phenotype caused by a lack of nurse cell nuclear anchor age (Yu et al., 2006). Both the Drosophila Klarsicht and C. elegan s ZYG-12 are known to link the nucleus and centrosome. Mutation of Klarsicht resulted in th e failure of nuclear migration in photoreceptors, probably by interrupting the association between Klarsicht and MTs (F ischer et al., 2004; Fischer-Vize and Mosley, 1994; Patterson et al., 2004). ZYG-12, on the other hand, is anchored at the NE via dimers of splice variants B and C. Their links to the centrosome are mediated by ZYG-A (Malone et al., 2003). In ZYG-12 mutant worms, the centrosome detachment defect in the developing embryo resulted in death as a c onsequence of chromosome segregation defects (Wilhelmsen et al., 2006). Mammalian orthologs of ANC-1 and Msp-300 are two giant actin-binding proteins, recently identified as type II integral membra ne proteins of the ONM Because they were discovered in independent laboratories, th ey are variously termed nesprin 1 giant

PAGE 34

34 (Nesp1G)/Enaptin/Syne-1/Myne-1 and nespri n 2 giant (Nesp2G)/NUANCE/Syne-2, with predicted sizes of 1.1 MDa and 796 kD. (Apel et al., 2000; Mislow et al., 2002a; Padmakumar et al., 2004; Zhang et al., 2001; Zhen et al., 2002). The giant nesprin (n uclear e nvelope sp ectrin r epeat) proteins feature a paired calponin homology (CH) actin binding domain (ABD), a large cytoplasmic domain containing multiple dystroph in related spectrin repeats, and a COOHterminal KASH domain. Spectrin repeats (S R) are composed of a bundle of three -helices and may govern the length of the SR containing domain or confer el astic properties to the protein (Djinovic-Carugo et al., 2002; Grum et al., 1999; Lenne et al., 2000). They are also found to help forming homoand heterotypic dimers or regul ating interactions with multiple proteins (Djinovic-Carugo et al., 2002). The giant nesprins arise from the nesprin 1 and nesprin 2 genes that encode a vast array of isoforms brought about by alternative splicing (S tarr and Han, 2002; Zhang et al., 2001; Zhen et al., 2002). About 20 isoforms have been identif ied, ranging in size from 40kD to 1.1 MDa. Immunogold EM has given us indica tions that nesprins are locali zed to both the INM and ONM (Zhang et al., 2005; Zhang et al., 2001). Some of the smaller isoforms, such as nesprin 1 nesprin 2 and nesprin 2 likely localize to the INM, give n that they are known to bind to emerin and lamin A/C (Mislow et al., 2002a; Misl ow et al., 2002b; Zhang et al., 2005). Both nesprins 1 and 2 are ubiquitously expressed, although some transcri pts are more highly expressed in cardiac, skeletal and smooth mu scle (Zhang et al., 2005; Zhang et al., 2001; Zhen et al., 2002). Nesprin 1 (originally named syne-1 for sy naptic n uclear e nvelope) was first identified in a yeast two-hybrid screen as a bind ing partner for muscle-specific ty rosine kinase (MuSK), a core component of the post-synaptic membrane at th e neuromuscular junction (NMJ) (Apel et al., 2000). Meanwhile, the concentration of nesprin 1 on the envelopes of synaptic myonuclei is

PAGE 35

35 significantly higher than in non-s ynaptic myonuclei, suggesting a ro le for nesprin 1 in anchorage of synaptic nuclei (Apel et al ., 2000). Grady et al. created transgenic mice overexpressing a dominant-negative form of nesprin 1 consisti ng of only the conserved KASH domain (Grady et al., 2005). The dominant negative approach resulted in a substantial decrea se in nuclei beneath the NMJ in transgenic muscles with no effect on extrasynaptic nuclei. Overexpression of the nesprin 2 KASH domain displayed a similar e ffect (Zhang et al., 2007). Furthermore, total depletion of nesprin 1 abolished nuclei cluste ring under the NMJ and disrupted the organization of non-synaptic nuclei in skeletal muscle and do uble depletion of nespri n 1 and 2 proved lethal within 20 minutes of birth due apparently to re spiratory failure (Starr, 2007; Zhang et al., 2007). Recently, two more nesprin families have b een discovered. Nesprin-3, which is smaller with the size of ~110 kDa, localizes only to the ONM. Nesprin-3 has two splice isoforms: and The N terminus of nesprin-3 binds to the ABDs of plectin, a member of the plakin family, which interacts with in termediate filament system (Leung et al., 2002; Wilhelmsen et al., 2005). Nesprin 4, on the other hand, is found only in the secretary epithelia cell s. It interacts with kinesin1 and might play a role in attaching nucleus to the basal membrane of the cell (Roux et al, submitted manuscript). The identification of ONM-specific integral membrane proteins has raised the question of how these proteins are anchored in the NE (Padmakumar et al., 2004; Zhang et al., 2001; Zhen et al., 2002). Given that the ONM and ER membrane s are contiguous, the problem remains what prevents ONM proteins from drifting into the pe ripheral ER. This issue wa s originally addressed in C. elegans when an INM protein, UNC-84 wa s required to recruit bo th ONM proteins ANC-1 and UNC-83 to the NE (Starr and Han, 2002; Starr et al., 2001). One of the defining feature of UNC-84 is its C-terminal ~200 residues, with similarity to the Schizosaccharomyces pombe (S.

PAGE 36

36 pombe) protein Sad1. This region is known as the SUN domain (S ad1p and UN C-84), which is conserved over the course of evolution. Additio nally, UNC-84 is predicted to have as many as nine hydrophobic domains, but how many actually span the INM is unknown (Tzur et al., 2006). Though there is no proof of direct interac tion between UNC-84 and Ce-Lamin, the NE localization of UNC-84 is Ce-Lamin-dependent (Lee et al., 2002). Mutation of UNC-84 affected nuclear migration and anchorage during developm ent, which suggests that UNC-84 functions in the same pathway as ANC-1 and UNC-83 (Malone et al., 1999; Starr and Ha n, 2002; Starr et al., 2001). A second NE SUN domain protein in C. el egans, known as both SUN-1 and matefin, was necessary for NE attachment of ZYG-12 in ge rm line cells. Distinguished from UNC-83, the localization of SUN-1 to the NE was not depende nt upon Ce-Lamin (Fridkin et al., 2004; Malone et al., 2003). Based upon the above findings, the giant nesprins in mammalian cells could be anchored at the ONM in a manner analogous to ANC-1 in the C. elegans model. Thus, a role for a mammalian homolog to UNC-84 would be in order. Mammalian cells are known to contain at leas t five SUN domain prot eins: Suns 1-2, Sunc1 (Sun3), Spag4 (Sun4) and Spag4-like (Sun5). S uns 3-5, of which little are known, are testis specific (Shao et al., 1999; Xi ng et al., 2003). Suns 1 and 2, on the other hand, show ubiquitous gene expression patterns in both mouse and human (Ding et al., 2007). Each of the SUN proteins conforms to the same basic structure featuri ng an N-terminal domain followed by a block of hydrophobic amino acid residues, likely representing a transmembrane domain, and a C-terminal SUN domain. Among those, Sun1 transcripts are present in multiple, alternatively spliced isoforms (Crisp et al., 2006).

PAGE 37

37 The N-terminal domains of Sun1 and Sun2, whic h reside in the nucleoplasm, are sufficient to target them to the NE and also confer di rect binding to A-type lamins. However, Sun1 and Sun2 localization does not seem to be lamin A de pendent (Crisp et al., 2006; Haque et al., 2006; Hasan et al., 2006; Hodzic et al., 2004; Padmakumar et al., 2005). The C-terminal domains of Sun1 and Sun2, which contains a coil-coil and SUN domain, on the other hand, reside in the PNS, where they interact with KASH domain pr oteins, nesprin 1 and 2. The coil-coil region may play a role in dimerization of SUN protei ns (Crisp et al., 200 6; Haque et al., 2006). Dominant-negative mutants as well as knockdown of Sun1 and 2 destroyed NE localization of nesprin 1 and 2 (Crisp et al., 2006; Padmakumar et al., 2005). In this way, Sun1 and 2 function as links in a molecular chain th at connects actin cytoskeleton via nesprins to lamins and other nuclear components. We have termed this assembly the LINC (linker of nucleoskeleton and cytoskeleton) complex (Crisp et al., 2006) (Figure1-3). As alluded to previously, cells from laminopa thy patients exhibited reduced cytoplasmic resilience and an inability to activate mechanosensitive genes. Given their role in nucleocytoplasmic coupling, Sun1 and 2 might be the mediators of these effects. It is intriguing to fu rther explore the extent and nature of the interactions of LINC comp lex components. Furthermore, considering the functional redundancy between Sun1 and 2, we wonder why nature re quires two proteins to play the same role. Identification of their differen ces will expand our understa nding as to the LINC complex. In addition to mechanical linker, the LINC co mplex bridges the NE. According to Crisp et al., double knockdown of Sun1 and 2 led to freq uent expansion of the PNS and increased separation of the INM and ONM. Meanwhile, ot her, non-mechanical roles of SUN domain proteins are also emerging. For instance, Sun1 has been found to be involved in centrosome

PAGE 38

38 association (Wang et al., 2006), decondensation of mitotic chromosomes (Chi et al., 2007), telomere attachment to the NE and gametogenesis in mice (Ding et al., 2007). There are two major aims for this dissertation. The first goal is to determine the extent and nature of the interactions of LINC complex components and how these might affect LINC complex function. Our second objective is to inves tigate LaA processing as it relates to the basic biology of the NE, as well as ongoing therapeu tic modalities for HIV-infected patients and children with HGPS.

PAGE 39

39 (Stewart CL, Roux KJ and Burke B. Science. 2007; 318:1408-12) Figure 1-1. Overview of nuclear envelope organization in a euka ryotic interphase cell. Some selected INM proteins, including lamina-a ssociated polypeptides 1 and 2 (LAP1 and LAP2) and LBR, are shown; these proteins interact with HP1 and BAF and provide links to chromatin. The nuclear lamina, com posed of A-type and B-type lamins, is thought to provide a structural framework for the NE. The INM and ONM are joined at the periphery of each NPC with the ONM being continuous with the ER, forming a continuous membrane system. Consequentl y, the PNS and ER lumen are continuous. The ONM is characterized by cytoskeleton -associated nesprin proteins that are tethered by SUN domain proteins in the INM.

PAGE 40

40 Figure 1-2. LaA Processing. LaA is synthesized as the precursor protein prelamin A. PreA contains a C-terminal CaaX motif that accep ts a farnesyl group added by the action of the enzyme, protein farnesyltransferase. Fo llowing farnesylation, the last three amino acids (-AAX) of PreA are cleaved by the endoprotease ZmpSte24 and the newly exposed cysteine is carboxyl-methylated. S ubsequently, the terminal 15 amino acids of the maturing LaA are cleaved by ZmpSte 24 and degraded, releasing the mature LaA. Arrows indicate cleavage sites.

PAGE 41

41 Figure 1-3. Model for the LINC complex. Nuclea r components, including lamins, bind to the INM SUN domain proteins. They, in tur n, bind to the KASH domain of the ONM protein nesprins Giant Nesp rin1, 2 interact with actin and Nesprin3, on the other hand, associate with plectin wh ich links to intermediate filaments. Thus, the LINC complex establishes a physical connec tion between the nucleoskeleton and the cytoskeleton.

PAGE 42

42Table 1-1 Properties of representative inner nuclear membrane proteins Name Size Lamin binding Chromatin interactionsOther properties LAP1A 75kD A/B-type lamins LAP1B 68kD A/B-type lamins Splice variant of LAP1A LAP1C 57kD A/B-type lamins ? Type 2 membrane protein. 173 residue lumenal domain, 311 residue nucleoplasmic domain. Splice variant of LAP1A LAP2 50kD B-type lamins BAF, HA95 Type 2 membrane protein. Large 410 residue nucleoplas mic domain. LEM domain. LAP2 38,43,46 kD Most likely B-type lamins Probable chromatin binding via BAF Type 2 membrane proteins. Splice variants of LAP2. Two other splice variants, LAP2 are soluble proteins. LBR 71kD B-type lamins HP1, HA95 Multi-spanni ng protein. Sterol C-14 reductase activity. Emerin 29kD A-type lamins lamin B1 BAF Defects in emerin linked to Emery-Dreifuss muscular dystrophy. LEM domain. Nurim 29kD Multi-spanning membrane protein MAN1 82kD A/B type lamins Probable chromatin binding via BAF LEM domain; attenuates TGF signaling Otefin 47kD Drosophila Dm lamin YA LEM domain LUMA 45kD Multi-spanning Lem2 56kD A/B-type lamins BAF LEM domain

PAGE 43

43 CHAPTER 2 FUNCTIONAL ASSOCIATION OF SUN1 W ITH NUCLEAR PORE COMPLEXES Abstract Sun1 and Sun2 are A-type lam in-binding proteins that in association with nesprins form a link between the inner and out er nuclear membranes (INM and ONM) of mammalian nuclear envelopes (NEs). Both immuno fluorescence and immuno-electron microscopy reveal that Sun1, but not Sun2, is intimately associated with nuc lear pore complexes (NPC s). Topological analyses indicate that Sun1 is a type II integral protein of the INM. Lo calization of Sun1 to the INM is defined by at least two discrete regions within its nucleoplasmic domain However, association with NPCs is dependent on the synergy of bot h nucleoplasmic and lumenal domains. Cells that are either depleted of Sun1 by RNAi or whic h overexpress dominant-negative Sun1 fragments exhibit clustering of NPCs. The im plication is that Sun1 represents an important determinant of NPC distribution across the nuclear surface. Introduction The nuclear envelope (NE) is th e selective barrier that defines the interface between the nucleus and the cytoplasm (Burke and Stewar t, 2002; Gruenbaum et al., 2005). Because it mediates molecular trafficking between these two compartments it plays an essential role in the maintenance of their biochemical identities. In ad dition to its transport f unction, the NE is also a key determinant of nuclear architecture, providi ng anchoring sites at th e nuclear periphery for chromatin domains as well as for a variety of structural and re gulatory molecules. A corresponding contribution to cyt oplasmic structure has been described in which NE components may also influence cytoskeletal organizati on and mechanotransducti on (Tzur et al., 2006; Worman and Gundersen, 2006).

PAGE 44

44 The NE is composed of several structural el ements, the most prominent of which are the inner and outer nuclear membranes (INM and ONM ). These are separated by the perinuclear space (PNS), a gap of 30-50nm. Annular juncti ons between the INM and ONM create aqueous channels that traverse the NE and which are oc cupied by nuclear pore complexes (NPCs). It is the NPCs that endow the NE with its selectiv e transport properties (Tran and Wente, 2006). The final major feature of the NE is the nuclear lamina, a thin (20-50nm) protein layer that is associated with both the INM and chromatin. Th e lamina is composed primarily of Aand Btype lamins, members of the intermediate filame nt (IF) protein family (Gerace et al., 1978). The lamins interact with components of the INM and NPCs as well as with chromatin proteins and DNA (Zastrow et al., 2004). In this way, the lamina plays an important structural and organizational role at the nuclear periphery. Despite their continuities, the INM and ONM are biochemically distinct. The ONM features numerous junctions with the peripheral ER to which it is functionally and compositionally similar. In contrast, the INM c ontains its own unique selection of integral proteins. Clearly, the INM, ONM and ER represen t discrete domains with in a single continuous membrane system. Accordingly, the PNS is a perinuclear extension of the ER lumen. Localization of integral protei ns to the INM involves a process of selective retention (Ellenberg et al., 1997; Powell and Burke, 1990; Soullam and Worman, 1995). While, proteins that are mobile within the ER and ONM may gain access to the INM via the continuities at each NPC, only proteins that interact with nucle ar or other NE components are retained and concentrated. Recent reports suggest additional mechanisms may overlie this basic scheme. (Ohba et al., 2004) showed that movement of integral proteins through the NPC membrane domain is energy dependent. Other studies sugge st a role for the nuclear transport receptor

PAGE 45

45 adaptor, karyopherin/importin-a in the transit of proteins to the INM (King et al., 2006; Saksena et al., 2006). Recognition of ONM-specific membrane proteins raises the question of what prevents these proteins from escaping to the peripheral ER ? In C. elegans, localization of Anc-1, an ONM protein involved in actin-based nuclear posi tioning, requires Unc-84, an INM protein whose retention is lamin-dependent (L ee et al., 2002; Starr and Han, 2002) These observations led to a model in which Unc-84 and Anc-1 interact acro ss the PNS via their lumenal domains, providing a mechanism for the tethering of ONM proteins. In mammals two large actin binding protei ns, nesprin 1 Giant (nesp1G, 1,000kDa) and nesprin 2 Giant (nesp2G, 800kDa), reside in th e ONM (Apel et al., 2000; Mislow et al., 2002b; Zhang et al., 2001; Zhen et al., 2002). The nesprins (also known as Syne 1 and 2) are related to both Anc-1, and a Drosophila ONM protein, Klarsicht (Mosley-Bishop et al., 1999; Welte et al., 1998), in that they contain a ~50 amino acid C-terminal KASH domain (K larsicht, A nc-1, S yne H omology) consisting of a single transmembrane anchor and a short segment of about 30-40 residues that resides within the PNS. A thir d ONM KASH-domain-containing protein, nesprin 3, interacts with plectin, a large (466kDa) cytolinker (Wilhelmsen et al., 2005). Unc-84 contains a ~200 amino acid C-termin al region that shares homology with Sad1p, an S. pombe spindle pole body protein (Hagan and Yanagida, 1995). This sequence, known as the SUN domain (for S ad1p, UN c-84) resides within the PNS. The human genome encodes five SUN domain proteins. Two of these, Sun1 and Sun2, are lamin A-interacting proteins of the INM with topologies similar to th at of Unc-84 (Crisp et al., 2006; Haque et al., 2006; Hodzic et al., 2004).

PAGE 46

46 Both Sun1 and Sun2 cooperate in tethering ne sp2G in the ONM (Crisp et al., 2006; Haque et al., 2006; Hasan et al., 2006; Padmakumar et al., 2005). This te thering involves interactions that span the PNS (Crisp et al ., 2006), similar to that suggested for Unc84 and Anc-1. Unc84 also tethers Unc-83, another ONM KASH domain protein (McGee et al., 2006). Competition between nesprin 1 and 2 KASH domains (Zhang et al., 2007), suggests that nesp1G is similarly tethered. In this way, Sun1 and 2 function as links in a molecular chain th at connects the actin cytoskeleton, via nesprins, to lamins and othe r nuclear components. We have termed this assembly the LINC complex (for LI nker of N ucleoskeleton and C ytoskeleton, (Crisp et al., 2006). The fact that nesprin 3 binds plectin, a diverse cytolinker (Wilhelmsen et al., 2005), indicates that there may be multiple isoforms of the LINC complex responsible for integrating the nucleus with different components of the cytoskeleton. As alluded to above, the NE can influence cytoplasmic mechanics and the responses of cells to mechanical stress. Cells depleted of e ither A-type lamins or emerin, an INM protein, exhibit reduced cytoplasmic resilience and an inability to activate mechanosensitive genes (Broers et al., 2004; Lammerding et al., 2006; Lammerding et al., 2005; Lammerding et al., 2004b). In humans, loss or mutation of either A-type lamins or emerin is associated with several diseases (Muchir and Worman, 2004), including Emery-Dreifuss muscular dystrophy. It is not hard to imagine that the LINC complex might be the mediator of these effects given its proposed role in nucleocytoplasmic coupling. Less clear is the extent and nature of the interactions of LINC complex components and how these might affect LINC complex function. In the case of nesprins 1 and 2 versus nesprin 3 there are obvious differences in terms of actin versus plecti n association. At the INM, the situation with the Sun proteins is more am biguous. We know that there is some degree of

PAGE 47

47 functional redundancy between Sun1 and Sun2 with respect to nesp rin 2 tethering. Furthermore, we know that Sun1 and 2 can associate with lamin A but that this interaction is not required for their localization. In this paper we further explore interactions of SUN proteins at the nuclear periphery. In so doing we have be en able to describe discrete regions within Sun1 that function both in localization to the INM and in oligomerization. Mo st significantly, we are able to demonstrate that Sun1 and Sun2 are segregated within the INM. While Sun2 displays a roughly uniform distribution across the NE, Sun1 is conc entrated at NPCs. Elimination of Sun1 or overexpression of Sun1 mutants le ads to NPC clustering. The infe rence is that Sun1, but not Sun2, functions in the maintenance of the uniform distribution of NPCs. It also follows that certain LINC complex isoforms may mediate the di fferential association of cytoskeletal elements with NPCs versus NPC-free regions of the NE. Results Mamm alian SUN proteins are encoded by at least five genes (Figure 2-1). Of these, only Sun1 and Sun2 are widely expressed in somatic cells. Sun3 (Crisp et al., 2006; Haque et al., 2006; Tzur et al., 2006), Sun4 (SPAG4) (Hasan et al., 2006; Shao et al., 1999) and Sun5 (SPAG4Like, unpublished observations) seem to be re stricted largely to th e testis. Each of the SUN proteins conforms to the same basic struct ure featuring an N-terminal domain followed by a block of hydrophobic amino acid residues, likel y representing a transmembrane (TM) domain, and a C-terminal SUN domain. Th e relationships between these pr oteins are displayed in Figure 2-1. In the case of Sun1, the largest of the mamm alian SUN proteins, the nucleoplasmic Nterminal domain is composed of 350-400 amino acid residues (Crisp et al., 2006). All of the sequence variants of Sun1 that arise through altern ative splicing involve changes in this segment of the molecule (Figure 2-1).

PAGE 48

48 A prominent feature of Sun1 is the presen ce of four hydrophobic sequences, H1-H4, any one of which could potentially function as a TM domain. Previously, we showed that H1, at least, does not span the INM (Crisp et al., 2006). This conclusion was based upon a naturally occurring splice isoform that is missing sequences encoded by exons 6, 7 and 8 (Sun1D221-344 (Dexons6-8)). This isoform lacks H1 yet displays appropriate NE localization and has the same topology within the INM as full length Sun1. Nevertheless, as will be expanded upon, while not a TM domain, H1 may still contribute to membra ne association. Mouse Sun1 also contains a predicted C2H2 zinc finger. Since this is absent from primate Sun1, its significance remains unclear. The C-terminal region of Sun1, like that of Sun2, consists of roughly 450 amino acid residues and resides within the PNS. It contains a membrane proximal predicted coiled-coil and a conserved distal SUN domain. The junction betw een these two features contains the KASH binding site and is therefore essentia l for the tethering of ONM nesprins. While Sun1 and Sun2 have obvious similarities in terms of domain organization and topology, we noticed differences in their localizations within the NEs of multiple cell types. In particular the distribution of Sun1 appears more punctate than that of Sun2 (Figure 2-2A). This was evident by both immunofluorescence micr oscopy employing antibodies against the endogenous proteins as well as by observat ions on exogenous Sun1 or Sun2 carrying a Cterminal green fluorescent protein (GFP) tag. A di rect comparison of the two proteins indicates that they are largely segregated within the pl ane of the NE. Double label experiments employing an antibody against Nup153, a NPC component, revealed that Sun1 but not Sun2 was concentrated at NPCs. This localization was c onfirmed by immunoelectron microscopy of HeLa cells expressing either Sun1-GFP or Sun2-GFP (Fi gure 2-3A-C). Quantitative analysis revealed

PAGE 49

49 that in the case of Sun1, gold particles were all clustered within 120nm of the NPC eight-fold axis with a peak at 66nm +/-20nm (standard deviation; Figure 2-3D). Sun2, displayed a far broader distribution with a median distance fr om the NPC eight-fold axis of 240nm +/-120nm (Figure 2-3E). Only 8% of gold particles were within 120nm, and none within 66nm. Of necessity, the scale in Figure 2-3E is five times that in Figure 2-3D. Differential localization of Sun1 versus Sun2 is reflected in th eir behavior during mitosis. Following NE breakdown, both proteins are disperse d throughout the cytopl asm, most likely in ER membranes. During late anaphase/early te lophase, as NE reassembly commences, resegregation of Sun1 and Sun2 occu rs. Sun2 concentrates at a re gion of each newly separated chromatin mass adjacent to one of the spindle poles. This core re gion (Figure 2-2B) of chromatin is typically deficien t in NPC reformation. The behavior of Sun2 mirrors that of another INM protein, emerin, which also concentrates at the chromatin core at roughly the same time (Maeshima et al., 2006). Sun1, in contrast, te nds to be excluded from the core region and instead concentrates on the lateral margins of the chromatid masses where NPC assembly is initiated. Localization of Sun1 to the INM involves dete rminants in both Nand C-terminal domains (Crisp et al., 2006; Haque et al., 2006; Hasan et al., 2006; Padmakumar et al., 2005; Wang et al., 2006), although the relative contri butions of these and how they might affect association with NPCs is still unknown. In addition, while previous studies (Crisp et al., 2006; Haque et al., 2006; Hasan et al., 2006; Padmakumar et al., 2005; Wang et al., 2006) have demonstrated that the TM domain(s) of Sun1 is contained within the H2-4 region, they provide an ambiguous view of the targeting properties of this segment of the mo lecule. We and others (Crisp et al., 2006; Padmakumar et al., 2005) had proposed that Sun1 might be a multi-spanning protein with three

PAGE 50

50 TM sequences corresponding to H2, H3 and H4. However, direct evidence to support such a model is lacking. To better define Sun1 topology, we prepared a series of mutants containing different combinations of the H2, H3 and H4 hydrophobic se quences, all of which were found to confer some degree of membrane association. These muta nts contained all or pa rt of the N-terminal domain (residues 1-355) followed by one or mo re hydrophobic sequences and terminating with GFP (Figure 2-4). At the Nand Ctermini of certain of these chimeras we placed HA and Myc epitope tags respectively. These constructs were expressed by tr ansfection in HeLa cells, which were subsequently treated with low concentrations of digitonin. Under these conditions the plasma membrane is permeabilized but the ER and nuclear membranes remain intact. The permeabilized cells were then incubated with prot einase K. During the course of this incubation, Western blot analysis revealed that cytoplasmic (tubulin) a nd nuclear (lamin A/C, Nup153) proteins were degraded (proteinase K may enter the nucleus by degrading NPC proteins) while ER lumenal and PNS proteins such as PDI were protected (Figure 2-4A ). Triton X-100 (TX-100) permeabilization permitted digestion of all these pr oteins. In the case of the Sun1 chimeras, we determined the latency of the HA and Myc ep itope tags by both SDS-PAGE analysis of immunoprecipitated, radiolabeled proteins and immunofluores cence microscopy (the latter on permeabilized but not proteinase treated cells) (Figure 2-4A and B, respectively). In some experiments we employed specific antibodies to monitor the latenc y of the GFP moiety (Figure 2-4C). The results reveal that the N-terminal HA tag is always exposed to the cytoplasm or nucleoplasm. In contrast the My c tag or GFP becomes latent, i. e. it resides within the ER lumen/PNS, whenever the H4 sequence is present within the chimera. No combination of H2 and H3 (either singly or together) would confer such latency. Conversely, ne ither H2 nor H3 could

PAGE 51

51 affect the orientation of H4 and therefore the late ncy of the Myc tag or GF P. The only reasonable conclusion is that while H2 and to a lesser ex tent, H3 may confer membrane association (see Figure 2-4C), they do not cross the bilayer. Ther efore, rather than being a multi-spanning protein as previously suggested, Sun1 woul d appear to be a type II memb rane protein with a single TM domain represented by H4 (Figure 2-9). With a better understanding of Sun1 topology, we next wished to identify NE and NPC retention domains. To this end, we generated an extensive family of chimeric Sun1 proteins. Since H4 appears to represents the sole TM dom ain, we sought to clarify the role of the other hydrophobic sequences. Sun1N355, which contains th e H1 sequence but lacks H2 and H3, was found to localize to the NE (Ha que et al., 2006). This is in contrast to the nucleoplasmic localization of Sun1N355D221-343 (this corresponds to the exon 68 deletion) (Figure 2-5A) or of Sun1N220 (Crisp et al., 2006), both of which lack any hydrophobic motif. When Sun1N355D221-343 was extended to include the H2 domain (Sun1N380D221-343), NE association was rescued (Figure 2-5A ). Taking all of this data toge ther, we can conclude that H1, H2 and to a certain extent H3, are each suffici ent to confer membrane association. However, since the Sun1N220 region itself will accumulate r eadily within the nucleoplasm (Crisp et al., 2006), these experiments do not reveal whethe r any of the hydrophobic sequences themselves have intrinsic INM targeting activity. To address this question we next examined the behavior of two additional H2 containing fusion proteins, both tagged at the N-terminus wi th the Myc epitope (Figur e 2-5A). The first of these represented an N-terminal truncation l acking the initial 220 Sun1 residues but containing H1 and H2 (Myc-Sun1 221-380) whereas the s econd was missing H1 in addition to the Nterminal 220 residues (Myc-Sun1 261-380). The form er localized to the NE, and to a lesser

PAGE 52

52 extent to the peripheral ER. The latter, in co ntrast, was primarily ER-associated with little concentration in the NE. The implication of thes e results is that a NE localization motif is encoded by Sun1 residues 221-380. This region of the molecule must therefor e share interactions with other nuclear or NE components. We next examined whether the H2-H4 region alone has a role in NE targeting. When this sequence was fused to the N-terminus of GFP, it localized predominantly to the Golgi apparatus and cell surface, with little if any associated w ith the NE (Figure 2-5B). In contrast, a Sun1 Nterminal truncation consisti ng of the H2-H4 region followed by Sun1 lumenal domain (H234Sun1L-GFP) localized efficiently to the NE (Padmakumar et al., 2005). We already know, however, that a soluble form of the Sun1 lumenal domain that is appropriately localized to the ER lumen and PNS is itself insufficient for NE ta rgeting (Crisp et al., 20 06). There are at least two explanations for these results. The first is that the lumenal domain does contain targeting information but that it is only functional when the do main is appropriately oriented or tethered to the ER or nuclear membranes. The second is that the H2-H4 hydrophobi c region can direct localization to the INM but that this only occurs in the context of the Sun1 lumenal domain. In other words, the Sun1 lumenal domain can modify the behavior of the H2-H4 sequences. What we can rule out, however, is any suggestion th at localization of H 234Sun1L-GFP to the INM occurs by virtue of oligomerization with endogenous Sun1. Overexpression of H234Sun1L-GFP leads to displacement of endogenous Sun1 from th e NE while itself concentrating in the NE (Padmakumar et al., 2005)Roux, Liu and Burk e, unpublished observations). Additionally, depletion of Sun1 by RNAi has no effect on H234Sun1L-GFP localization (Roux, Liu and Burke, unpublished observations).

PAGE 53

53 To further address these issues we repl aced the H2-H4 hydrophobic region of both full length Sun1 and H234Sun1L-GFP with the unrelated TM domain of Sun3 (to yield HASun1(S3TM) and S3TMSun1L-GFP respectively) (F igure 2-5B). As shown in Fig S2A, HAtagged Sun3 when expressed in HeLa cells loca lizes to the NE, but does not associate with NPCs. Sun3 contains a single pr edicted TM domain that reside s between residues 46 and 65. As will become evident below, this sequence contai ns no intrinsic NE-targeting activity. Translation of Sun3 in vitro in the presence of microsomes confirms that this sequence must function as a TM domain with a type II orientation (data not shown). HA-Sun1 (S3TM) behaved exactly like full length Sun1 in that it concentrated in the NE (Figure 2-5B) in association with NPCs. S3TMS un1L-GFP in contrast, displayed little or no NE localization and instead was found in the Golgi apparatus and at the cell surface (Figure 2-5B). Evidently it is not retained in the nuclear membrane/ER system. De letion of H2-H3 from H234Sun1L (H4Sun1L-GFP) also resulted in loss of NE-association (Figure 2-5B). The implication then is that H2-H3 encodes a NE lo calization function. If this is the case, then attaching H2-H3 to the N-terminus of S3TMSu n1L-GFP should lead to its accumulation at the NE. Indeed we do observe a partial restor ation of NE localization (Figure 2-5B). It is evident from these results that while the H2-H3 sequence promotes localization to the NE, its activity is strongl y influenced by the Sun1 lumenal domain. This is despite the fact that these regions of Sun1 reside on opposite sides of the INM. A possible explanation for this result is that the targeting activity of H2-3 may be activated or enhan ced by dimerization (or oligomerization), perhaps leadi ng to increased avidity for nuclear or INM-associated binding partners. A prediction here is that the lumena l domain of Sun1 should mediate dimerization (or oligomerization). This is borne out in transfection experiment s where full length Sun1 was co-

PAGE 54

54 expressed in HeLa cells with a variety of epitope tagged Sun1 deletion mutants (Figure 2-6). Immunoprecipation analyses resulted in efficient co-precipitation of full length and mutant Sun1 only when the mutant form contained an intact lumenal domain. Further compelling evidence for lumenal domain mediated oligomerization was provided by immunofluorescen ce observations of SS-HA-Sun1L-KDEL and S3TMSun1L. As described a bove, neither of thes e chimeric proteins concentrates to any great extent in the NE. However, overexpression of full length Sun1 will recruit both of these pr oteins to the NE. Taken together, thes e data clearly demonstrate that Sun1 homo-oligomerizes via lumenal domain interac tions, most likely involving the predicted membrane proximal coiled-coil. Which Sun1 sequence elements are required for a ssociation with NPCs? Analysis of all of the Sun1 constructs that we have prepared re vealed that apart from wild type Sun1, only Sun1D221-343 and Sun1 (S3TM) associated with NPCs (Figure 2-7A). Evidently association with NPCs does not involve the H1 and H234 hydrophobic sequences acting in concert. To take these analyses further, we prepared a pair of chimeras in which we swapped the Sun1 and Sun2 lumenal domains. In neither case could we obser ve NPC association (data not shown). Instead, both recombinant proteins behaved like S un2. Evidently both nucleoplasmic and lumenal domains of Sun1 cooperate in conferring NPC-association. So far we have shown that there are multiple determinants within the Sun1 nucleoplasmic domain that can confer localization to the INM. Hasan et al. (2006) used FRAP analysis to show that wild type Sun1 is relatively immobile with in the INM. We performed similar analyses on a subset of our Sun1 deletion mutants that localize to the NE (Figure 2-7B). In all cases these mutants display enhanced mobility relative to wild type Sun1. Even deletion of the lumenal domain, which appears to contain no intr insic targeting function but does promote

PAGE 55

55 oligomerization, leads to increa sed mobility within the INM. Thus while Sun1 does contain multiple autonomous features involved in localiza tion, stable localization to the NE requires that all be present. These findings are reminiscent of our conclusion that multiple features within the Sun1 molecule are required for NPC association. What is the significance of S un1 association with NPCs? Pr oteomic studies provide no evidence that Sun1 is an intrin sic component of the NPC (Cronshaw et al., 2002). However, in order to determine whether Sun1 might contribut e to NPC functionality we examined nuclear transport in HeLa cells that ha d either been depleted of Sun1 by RNAi or which expressed Sun1 fragments, some of which resulted in a loss of endogenous NE-associated Sun1 (data not shown). To accomplish this we took advantage of a GFP fusion protein bearing nuclear import and export signals (NLS-GFP-NES) and which shuttles betw een the nucleus and cytoplasm (Stade et al., 1997). We also employed a hormone inducible nuclear import substrate consisting of betagalactosidase fused to the glucoc orticoid receptor (grb) (Bastos et al., 1996). Our results indicate that Sun1 has no significant role in the nuclear transport of prot eins, either import or export. Similarly, distribution of poly A (+) RNA reveal ed by in situ hybridizat ion suggests that Sun1 makes little or no contribution to mRNA export (data not shown). Sun1 depletion was not, however, without affect on pore complexes. We noticed that loss of Sun1 was always associated with an altered distribution of NPCs (Figure 2-8A) as well as altered nuclear shape (Figure 2-8C ). In wild type cells, NPCs te nd to be uniformly distributed across the nuclear surface. Following Sun1 depl etion, NPC aggregates or clusters could be observed leaving NPC-free areas of varying sizes. This effect wa s Sun1-specific since depletion of Sun2 left NPC distribution unchanged.

PAGE 56

56 This effect of Sun1 depletion on NPC aggregation could be emulated by overexpression of nucleoplasmic Sun1 deletion mutants in HeLa cells. Expression of these mutants often leads to a diminution in the amount of full length Sun1 at the NE (and hence at NPCs). A quantitative analysis of NPC aggregation induced by both Sun1 depletion and Sun1 mutant expression is displayed in Figure 2-8B. Since Sun1 may act as a tether for ONM nesprins, it is possible that NPC aggregation is a function of loss of nesprins rather than a loss of Sun1. To determine whether this might be the case, we overexpressed a protein consisting of GFP fused to the KASH domain of either nesprin1 or 2 (GFP-KASH1, 2) in HeLa cells. Overexpression of GFP-KASH1 or 2 leads to displacement of nesprins 1 and 2 from the NE (Z hang et al., 2007). Treatment of cells in this way was found to have no discernible effect on NP C distribution (data no t shown). These data suggest that Sun1 has a nesprin-i ndependent role in the maintenance of the uniform distribution of NPCs across the NE. Discussion Sun1 and Sun2 are of a pair of ubiquitous INM proteins that tether nesprins within the ONM. Nesp1G and nesp2G contain N-term inal actin binding domains (P admakumar et al., 2004; Zhen et al., 2002), whereas nesprin 3 binds plectin, a versatile cytolinker (Wilhelmsen et al., 2005). Thus, the SUN proteins repres ent links in a molecular chain that connects elements of the cytoskeleton to components within the nucleus. We have previous ly referred to translumenal Sun-nesprin pairs as LINC complexes (Crisp et al., 2006). Multiple LINC complex isoforms likely exist given the apparent redundancy of Sun1 and Sun2 in te thering nesprins. In addition we can identify at least four or five splice isoforms of Sun1 alone, further increasing the LINC complex repertoire. The nesprins themselves (including nesprin 3) ar e also represented by

PAGE 57

57 dozens of splice isoforms. Aside from nesp1G and nesp2G, the number of these that may be tethered by Sun proteins at the ONM remains unknown. Previous studies indicated that KASH domain pr oteins play an important role in nuclear positioning in certain cell types (Grady et al., 2005; Malone et al., 2003; Mosley-Bishop et al., 1999; Starr and Han, 2002; Starr et al., 2001; Yu et al., 2006). However, the existence of links spanning the NE have far broader implications than mere nuclear location, and pres ent us with a mode (or modes) of nucleocytoplasmic c oupling that may bypass NPCs. This notion is highlighted by biomechanical studies on Lmna -null fibroblasts which exhibit impaired mechanotransduction and decreased viability under mechanical strain (Broers et al., 2004; Lammerding et al., 2006; Lammerding et al., 20 05; Lammerding et al., 2004b). Induction of the mechanosensitive genes, iex-1 and egr-1, is attenu ated, as is NF-kB-regulated transcription in response to either cytokine or mechanical stim ulation. While nuclei in Lmna-null cells are both mechanically fragile and highly deformable a surprising finding of La mmerding and colleagues is that these cells also feature reduced cytoplasmic resilience. Given that both Sun1 and 2 interact with A-type lamins, it is possible that the LINC complex might mediate mechanotransduction and the lamin-dependent changes in cytoplasmic organization. Retention of Sun1 and 2 in the INM is independent of A-type lamins in some cell types (Crisp et al., 2006; Haque et al., 2006; Hasa n et al., 2006; Padmakumar et al., 2005). This implies that there have to be other nuclear or NE components that interact with and retain the SUN proteins. Logically, based upon our studies here, there have to be at least two discrete regions within Sun1 sufficient for INM localizat ion. Evidence for this can be seen in the differential effect of exogenous Suns 1 and 2 on each other. Sun2 will not significantly displace Sun1 in HeLa cells. However, Sun1 can efficien tly displace Sun2 from the INM (Crisp et al.,

PAGE 58

58 2006), presumably by competition for a common bi nding partner or anchor Therefore Sun1 likely has an additional binding partner(s) not shar ed with Sun2. This is perhaps most obvious when considering that both of these proteins ar e segregated within the plane of the NE. While Sun2 predominates in NPC-free regions, Sun1 is c oncentrated in the vicinity of NPCs, possibly forming a halo around each NPC. The mechanisms of interaction with NPCs remains unknown. However, it clearly requires contributions from both the nucleoplasmic and lumenal domains. Our analyses suggest that there are at least two separate INM-targe ting regions within the Sun1 nucleoplasmic domain. The first lies between residues 1-260 and includes the H1 hydrophobic sequence. The second is immediately downstream of the H1 sequence and includes the H2 and H3 hydrophobic sequences. The bulk of this second targeting regi on is absent in the Sun1D221-343 (i.e. the Dexon 6-8) splice isofor m, although the H2 and H3 sequences are retained. Since Sun1D221-343 still colocalizes with NPCs, the bulk of this second targeting region cannot have an essential ro le in NPC association. The same is also true of the entire H234 region, which can be substituted by the Sun3 transmembrane domain without affecting NPC association. While the H2-H3 hydrophobic sequence exhibits INM targeting act ivity, it is only functional in the contex t of molecules containing the lume nal domain. The lumenal domain has no intrinsic targeting properties but does promote oligomerization, most likely based upon coiled-coil homodimers. We would suggest that manifestation of the INM localization function of H2-H3 requires dimerization/o ligomerization, perhaps leading to increased avidity for an NE or nuclear binding partner. The Sun1 TM domain is contained within the region of the molecule defined by the H2-4 hydrophobic sequences. We and others had suggest ed that these might represent three TM

PAGE 59

59 domains (Crisp et al., 2006; Padmakumar et al ., 2005). Our current studie s suggest that H2 and H3 do not in fact span the INM leaving H4 as the only TM sequence within the Sun1 molecule (Figure 2-9A). This view is reinforced by th e existence of an appa rent human Sun1 splice isoform (NM_25154) lacking sequences encoded by exons 6-9, and which is missing H2. Our conclusion is that Sun1 has the topol ogy of a type II membrane protein. While Sun1 has only a single membrane-spa nning domain (H4) the three other hydrophobic sequences H1, H2 and H3 can conf er membrane association. Nucleoplasmic domain constructs that contain at least one of the three, all be come associated with the INM, whereas their absence leads to nucleoplasmic localization. It remains unclear whether these hydrophobic sequences interact directly with the INM lipid bilayer, or if associati on is mediated by other INM proteins. The former would appear th e more likely since regardless of expression level, H1-, H2or H3-containing proteins always appear membra ne associated. The interaction of extended hydrophobic sequences such as H2-H3 with the lipid bila yer is not without precedent. For instance the tubular ER protei n, reticulon 4, contains a 30-40 residue hydrophobic sequence that forms a hairpin, which dips into the cytoplasmic face of the ER lipid bilayer without crossing it (V oeltz et al., 2006). The segregation of Sun1 and 2 within the plane of the NE and the association of Sun1 with NPCs is quite striking. Could then Sun1 be an NPC component? The complement of mammalian NPC subunits identified by Mat unis and colleagues employing pr oteomic approaches does not include Sun1 (Cronshaw et al., 2002). However, the same is also true of the authentic vertebrate NPC membrane protein, Ndc1 (Stavru et al., 2006) Perhaps Sun1s additional associations with the nuclear lamina, and possibly chromatin, lim its its co-extraction with NPC proteins. Regardless, we can find no evidence that Sun1 co ntributes to nucleocytop lasmic transport and

PAGE 60

60 consequently we feel that Sun1 is unlikely to represent an intrinsic NPC component. Instead, a more reasonable scenario is that Sun1 is asso ciated with the NPC periphery and may define a novel microdomain within the nuclear membrane s, which in turn could blur the boundary between NPCs and the bulk of the NE (Figure 2-9B). The presence of Sun1, and by implication nesprins, at NPCs could provide a basis for older ultr astructural observations that cytoskeletal elements, particularly IFs frequently seem to contact pore complexes (Goldman et al., 1985). The distribution of NPCs across the NE is not random. Rath er, they are arrayed in a uniform (although not regular) fashio n that is constrained by a mi nimum NPC separation (Maul, 1977). We have observed that depletion of Sun1 (but not Sun2) or overexpression of truncated forms of Sun1 lead to the formation of NPC aggregates or cluste rs. This suggests that Sun1 has a role in the maintenance of uniform NPC distribution across the nuclear surface. In mammalian cells, NPCs are largely immobile and maintain their relative positions over many hours (Daigle et al., 2001; Rabut et al., 2004). Th e implication is that NPC cluste rs in Sun1-depleted cells may arise during de novo NPC assembly as well as during post mitotic reassembly. A-type lamins are also determinants of NPC distribution, since Lmna-null MEFs frequently feature clustered or aggregated NPCs (Sullivan et al., 1999). Furthemore, (Maeshima et al., 2006) have shown that A-type lamins st rongly influence the distribution of NPCs and pore-free regions of the NE. It is important to bear in mind, however, that cells which normally lack A-type lamins, early embryonic cells for instance, do not display obviously clustered NPCs. It follows that there must be additional mechanis ms to define NPC distribution that predominate in certain cell types. Such mechanisms might poten tially involve B-type lamins (Maeshima et al., 2006).

PAGE 61

61 Because Sun1 interacts with lamin A via the N220 region of its N-terminal domain (Crisp et al., 2006), it could function as an adaptor be tween the nuclear lamina and the NPC (Figure 29). Of more significance is our observation that Sun1 has a preference for farnesylated pre-lamin A. Given that pre-lamin A exists only transiently in normal cells, this raises the possibility that Sun1 might function in the targeting and assembly of newly synthesized lamin A at the nuclear face of the INM. If this is the case, then given the localization of Sun1, NPCs could actually function as nucleation sites of A-type lamina assembly. Ultimately this may help define the distribution of NPCs. Our next goal will be to te st this notion by determining whether there is a spatial relationship between A-type lamina asse mbly and NPCs. Regardless of the outcome of these studies, it is becoming increas ingly clear that there are comple x networks of interactions at the nuclear periphery involving NPCs, INM a nd ONM proteins and nuclear lamins. These interactions appear to define not only the organization of the NE but also determine cytoskeletal mechanics and perhaps mediate signali ng between the nucleus and cytoplasm. Materials and Methods Cell Cultur e and Transfections : HeLa cells and mouse em bryonic fibroblasts (MEFs), both Lmna +/+ and Lmna / (Sullivan et al., 1999), were maintained in 7.5% CO2 and at 37C in DME (GIBCO BRL) plus 10% FBS (Hyclone), 10% penicillin/streptomycin (GIBCO BRL), and 2 mM glutamine. Plasmid DNA was introdu ced into HeLa cells and MEFs by using the Polyfect reagent as described previously (C risp et al., 2005) or w ith the Lipofectamine2000 reagent (Invitrogen). To transfect a 3.5cm2 tissue culture dish of cells with Lipofectamine2000, 6l transfection reagent or 2 g plasmid DNA were each added to separate 100l volumes of Optimem (Invitrogen) then combined and incuba ted at RT for 20 min. Subsequently the cell medium was replaced with serum-free DMEM and then the 200l transfection mix added

PAGE 62

62 dropwise and incubated at 37C for 1 h after which time the medium was replaced with DMEM/10% FCS. Cells were an alyzed 1-2 days later. Generation of Tetracycline Inducible Stable Cell Lines : A HeLa cell line stably expressing a tetracycline repressor protein from a pcDNA6/TR plasmid (TRex-HeLa, Invitrogen) was transiently transfected with pcDNA4/TO pl asmid (Invitrogen) containing murine Sun1GFP or human Sun2GFP. Following transfection cells were selected with zeocin (200 g/ml) and stably expressing subclones were isolated. Stab le cells were analyzed 24h after addition of tetracycline (1g/ml). Antibodies: The following antibodies were used in this study: The monoclonal antibodies 9E10 and 12CA5 against the myc, HA and GFP ep itope tags were obtained from the American Type Culture Collection, Covance and AbCam, re spectively. Rabbit antibodies against the same epitopes were obtained from AbCam. Rabbit an tibodies against Sun1 and 2 were previously described (Hodzic et al., 2004). Mouse monoc lonal anti-nup153 (clone SA1) and antinucleoporin (clone QE5) were described prev iously (Bodoor et al., 1999; Pante et al., 1994). Rabbit anti-emerin was a generous gift from Glenn Morris. Mouse anti-beta-galactosidase was from Promega (z3788). Mouse anti-PDI (ab2792) a nd anti-tubulin (ab7750) were from AbCam. Goat anti-lamin A/C was obtained from Santa Cruz (sc6215). Secondary antibodies conjugated with AlexaFluor dyes were obtained from Invitrogen. Peroxidase-conjugated secondary antibodies were obtained from Biosource International. Immunofluorescence Microscopy : For immunofluorescence microscopy cells were grown on glass coverslips and fixed in 3% formaldehyde (prepared in PBS from paraformaldehyde powder) for 10 min followed by a 5-min permeabilization with 0.2% TX-100. Cells labeled with anti-Sun1 were fixed for 6 min in 3% formaldehyde and permeabilized for 15

PAGE 63

63 min in 0.4% TX-100 in PBS. The cells were then labeled with the appropri ate antibodies plus the DNA-specific Hchst dye 33258. For experiments i nvolving selective perm eabilization, the cells were first fixed in 3% formaldehyde. This was followed by permeabilization in 0.001% digitonin in PBS on ice for 15 min (Adam et al., 1990). The cells were then labeled with appropriate primary and secondary antibodies. Specimens were observed using a Leica DMRB fluorescence microscope. Images were collected using a CDC camera (CoolSNAP HQ; Roper Scientific) linked to a Macintosh G4 com puter running IPLab Spectrum so ftware (Scanalytics). Image quantification was performed using IPLab software. FRAP analysis : Fluorescence recovery after photobl eaching experiments (FRAP) were performed on a Zeiss LSM 510 confocal microscope with a 63 x/ 1.4 N.A. oil objective. GFP was excited with the 488nm line of Ar lase r and GFP emission monitored using a 505 nm longpath filter. Cells were maintained at 37 C using a Nevtek ASI Air Stream incubator. In transfected cells a rectangular re gion typically 2-4um in height wa s bleached in three iterations using 488nm laser line at 100 % la ser power. Cells were monitored at 5 second intervals for up to 300s. Data was normalized as described (Dundr et al., 2002; Phair et al., 2004) to take into account bleaching during the imaging phase. Recovery values are averages S.D from at least 5 cells from at least 2 independent experiments. Immuno-electron Microscopy : Immuno-electron microscopy of Sun1 was performed by pre-embedding and labeling of the tetracycline-inducible cell line expr essing Sun1-GFP. After fluorescence examination to verify GFP expre ssion, cells were trypsinized and pelleted by centrifugation. The pellet was perm eabilized with 0.1% TX-100 for 1 min in PBS, fixed with 3% paraformaldehyde in PBS for 10 min, followed by th ree washes with PBS. The fixed cells were then incubated with 2% BSA in PBS for 10 min, followed by incubation with the primary

PAGE 64

64 polyclonal anti-GFP antibody ab290 (Abcam Inc.) fo r 1 h. After three times washing with 0.1 % BSA in PBS, the cells were incubated with a secondary anti-rabbit IgG antibody conjugated to 10 nm gold particles (Ted Pella Inc) for 1 h, followed by three times washing in PBS. Cells were then fixed and prepared for embedding/thin section electron microcopy (Rollenhagen et al., 2003). In Situ Proteinase K Digestions : HeLa cells were transfected in triplicate for each construct. After transfection (24h) the cells were incubate d in Met/Cys-free media for 45 minutes, followed by incubation in medium containing 50Ci 35S Met/Cys (MP Biomedical) for 1 h. After two rinses with ice cold PBS, one we ll was incubated in 4g/ ml proteinase K (PK) (Sigma) in KHM buffer (110mM KOAc, 20mM Hepes, pH 7.4, 2mM MgCl2) for 45 minutes. Another well was permeabilized with 24M ice cold digitonin in KHM for 15 min followed by 4g/ml PK digestion in KHM fo r 45 minutes. The third well was incubated with 4g/ml PK for 45 min in 0.5% TX-100/KHM. Subsequently, PMSF was added to all wells to a final concentration of 40g/ml. The first two wells we re gently washed in KHM buffer with 40g/ml PMSF again to remove excess PK. Cells were lysed in 0.4% SDS, 2% TX-100, 400mM NaCl, 50mM Tris-HCL pH 7.4, 40g/ml PMSF, 1mM DTT plus 2g/ml pepstatin A and 1g/ml leupeptin and passed through a 23 gauge needle 5 times prior to centrifugation for 10 min at 16,000Xg. Soluble proteins were immunoprecipitate d with rabbit antimyc or GFP by proteinA-sepharose. Following 3 washes, pr oteins were incubated with sa mple buffer prior to separation by SDS-PAGE. Gels were stained with Cooma ssie brilliant blue, in cubated with Amplify (Amersham Biosciences) for 20 min prior to drying. Autoradiographs were obtained from dried gels. In parallel, a nontransfected cell lysate was analyzed by Western blot to validate the permeabilization and digestion conditions.

PAGE 65

65 In vitro Translations : In vitro translations and pr oteinase K digestions were performed as described previously (Crisp et al., 2006). Nuclear Transport Assays: To observe nuclear export a NES-GFP-NLS (NESMGNELALKLAGLDI and NLS-PKKKRKV, respectivel y) construct was transfected into HeLa cells, either alone or with other expressi on vectors. CRM1-depende nt nuclear export was inhibited by a 2h incubation with 10ng/ml leptomycin B. To assay nuclear import, HeLa cells were transfected with a glucocorticoid receptor-beta-galactosidase fusion protein (grb) 24 h prior to a 30-min incubation with 10g/ml dexameth asone, to induce nuclear import of the fusion protein (Bastos et al., 1996). Plasmids : Full length murine Sun1 and human Sun2 were cloned as previously described (Hodzic et al., 2004; Crisp et al., 2006) and used as a template fo r PCR mutagenesis to generate Sun1 constructs described in this manuscript. Sun1-GFP and Sun2-GFP were cloned into the tetracycline responsive pcDNA4/TO (Invitrogen). All other GFP-tagged Sun1 constructs were cloned into pEGFP-N1 (BD Biosciences ). HA-Sun1, HA-Sun1(S un3TM), HA-Sun1(1-221), myc-Sun1(221-380), myc-Sun1(261-380), were all generated in pcDNA3.1(-). NES-GFP-NLS was created by PCR mutagenesis and inserted into pEGFP-N 1. Sun2-RNAi plasmids were obtained from OpenBiosystems. Sun1 RNAi was accomplished by cloning the following sequences into pSilencer 3.1-H1 neo (Ambion) 5GATCCGACCGGGATGGTGGACTTTCTCAAG AGAAAAGTCCACCATCCCGGTCTTTT TTGGAAA3 and 5AGCTTTTCCAAAAAAGACCGGGATGGTGGA CTTTTCTCTTGAGAAAGTCCACCATC CCGGTCG3 derived from open read ing frame of human Sun1 using the pSilencer expression vectors insert design tool (Ambion).

PAGE 66

66 We would like to thank Dr. David Wilson (Dep artment of Mathematics, University of Florida) for advice on quantific ation of NPC clustering, and Dr Manfred Lohka for insightful discussions at the Southern Alberta Nuclear Envelope meet ing. This work was supported by grants from the NIH (to BB) and the Muscular Dystrophy As sociation (to DH).

PAGE 67

67 Figure 2-1. Mammalian SUN prot ein family. Sun1 features four hydrophobic sequences H1-H4, each of roughly 20 amino acid residues. It s membrane-spanning domain is contained within the H2-H4 region. The Sun1 N-term inus, including H1, is nucleoplasmic. The C-terminal SUN domain reside s in the PNS. Murine, but not primate, Sun1 contains a predicted C2H2 zinc finger. Several sp lice isoforms of m ouse Sun1 have been identified which feature loss of sequen ces encoded by exons 6-8, including H1. Corresponding accession numbers are BAB29445 (Sun1 6-8), AAT90501 (Sun1 6), BAC29339 (Sun1 8). Four other mammalian SUN proteins are known. Sun2 is ubiquitously expressed, and localizes to the INM. Sun3 (SUNC1), Sun4 (SPAG4) and Sun5 (SPAG4L, accession number NP_542406) app ear to be expressed primarily in testis (B. Burke, C. Stewart, M. Cris p and K. Roux, unpublished observations) When expressed in HeLa cells, Sun3 localizes to the NE while S un4 (Hasan et al., 2006) and Sun5 (M. Crisp and B. Burke unpublished observations) localize primarily to the ER.

PAGE 68

68 Figure 2-2. Sun1 and Sun2 are segregated within the plane of the NE. Immunofluorescence microscopy of HeLa cells stably expr essing mouse Sun1-GFP or human Sun2-GFP employing anti-nucleoporin and anti-SUN protein antibodies. (A) Images of the nuclear surface reveal Sun1-GFP colocaliza tion with Nup153. In contrast, the more diffuse Sun2-GFP is found in NPC-fr ee regions. Endogenous Sun2 displays no colocalization with either NPCs, labeled w ith the anti-nucleopor in antibody QE5, or with with Sun1-GFP. Bar = 5m. (B) At la te anaphase to earl y telophase reforming nuclei exhibit a distinct di stribution of NPC and NE co mponents. Sun1-GFP localizes with Nup153 at the lateral margins of the ma ss of newly segregated chromatids and is absent from the Sun2 positive core region. Bar = 4m. These data suggest that Sun1 is closely associated with NPCs, a pattern which is established early in NE formation.

PAGE 69

69 Figure 2-3 Sun1, but not Sun2, is cl osely associated with NPCs as revealed by immuno-electron microscopy. (A) Views of NPC cross-secti ons from tetracycline-induced HeLa cells expressing Sun1-GFP and which reveal gold particles close to NPCs. Sections of uninduced cells (B) display litt le or no gold labeling. (C) Imag es of NE cross-sections from HeLa cells expressing Sun2-GFP reveal gold particles in th e perinuclear space but with no preferential association with NPCs. Immuno-gold labeling was performed using a polyclonal anti-GFP antibody a nd a secondary anti-rabbit IgG antibody conjugated to 10nm gold particles. Bars = 100 nm. c, cytoplasm; n, nucleus; arrowheads indicate gold particles. (D, E) Quantitative analysis of the distribution of gold particles from nuclear envelope cro ss-sections of HeLa cells expressing (D) Sun1-GFP or (E) Sun2-GFP. The position of gold particles, which is defined by horizontal distance (from the NPC eight fold axis) and vertical distance (from the central plane of the NE) was measured in cross-sectioned NEs (as in A and C) and plotted in a single dot graphic. Micrographs are provided as a visual reference for the position of the gold particles. Histograms for the distribution of gold particles for horizontal and vertical distances are show n on adjacent panels. A total of 88 and 92 gold particles were scored for D and E respectively. Because of the far broader distribution of Sun2-GFP, the scale in E is five times that in D.

PAGE 70

70 Figure 2-4. Sun1 contains a single transmembr ane domain. (A) Three Sun1 mutants containing the N-terminal domain followed by H2 H2 -3 and H2-4 respectively were tagged with HA at the N-terminus and GFP followed by a Myc epitope at the C-terminus. HeLa cells transfected with these constructs were labeled with 35S-Met/Cys, permeabilized with digitonin and incubated with proteinase K. After SDS lysis, immunoprecipitation with anti-Myc a nd SDS-PAGE analysis, only Sun1N455 retained a protected fragment of th e predicted size for the GFP (~30kDa). Permeabilization with TX-100 resulted in complete protein degradation. Nontransfected cells served as a negative control while Sun1-GFP provided a positive control, with a 65-70kDa protected fragment. Western blot analysis was used to confirm the effectiveness of the digitoni n permeabilization. Tubulin and lamins A/C were degraded following either digitonin or TX-100 permeabilization. In contrast, the ER lumenal protein, PDI, remained intact following digitonin permeabilization but was degraded after TX-100 treatment. (B) To further establish the orientation of these Sun1 constructs, 24h after transfection the HeLa cells were fixed and permeabilized with either digitonin or TX-100. Analyses focused on cells ex pressing sufficiently high levels of recombinant protein such th at GFP fluorescence could be observed in both the NE and ER/cytoplasmic membrane s. With digitonin permeabilization both Myc and HA epitopes were readily de tected for HA-Sun1N380-GFP-Myc and HASun1N415-GFP-Myc. In contrast, the HA but not C-terminal Myc epitope tag was accessible for HA-Sun1N455-GFP-Myc. In all cases both myc and HA tags were accessible after TX-100 permeabilization. (C ) Three more C-terminal GFP tagged Sun1 constructs containing the first 220 resi dues of Sun1 fused to H3 or H3-4 as well as full length Sun1 lacking H2-3 (Sun1N220H3-GFP, Sun1N220H34-GFP, and Sun1DH23-GFP, respectively) were permeab ilized as described above and labeled with anti-GFP antibodies. With digitionin permeabilization the presence of the H4 domain rendered the GFP moiety inaccessible to an tibody. Taken together these results indicate that H4 serves as Sun1s sole TM domain. Bars = 4 m.

PAGE 71

71

PAGE 72

72 Figure 2-5. The Sun1 nucleoplasmic domain has overlapping NE localization motifs. Immunofluorescence microscopy of HeLa cells transiently expre ssing Sun1 deletion constructs. (A) Sun1N355, a region prev iously identified as conferring NE localization, was further mutated based upon a natural splice isoform of Sun1 (Sun1N355 221-343-GFP). This protein, whic h lacks the H1 domain, is predominantly nucleoplasmic. Upon the inclusion of H2 (Sun1N380 221-343-GFP), it becomes NE associated. Deletion of the N-terminal 220 residues from the NE localized Sun1N380 (Myc-Sun1 221-380) fails to eliminate NE localization. However, extension of the deletion to in clude H1 (Myc-Sun1-261-380) results in an ER localization with little concentration in the NE. Bar = 5m. (B) To examine the role of H2-H4 in localization of Sun1, H 234-GFP was expressed in HeLa cells where it concentrates in the Golgi apparatus. This region (H2-4) of Sun1 was replaced with the TM domain of Sun3 (HA-Sun1(S3 TM)) resulting in localization indistinguishable from full length Sun1. Ho wever, upon deletion of the nucleoplasmic domain (S3TMSun1L-GFP) the protein was found largely in the Golgi apparatus. Similarly, deletion of the H2 and H3 do main from H234Sun1L (H4Sun1L-GFP) led to loss of NE association with a predomin antly ER localization. NE localization of Golgi-associated S3TMSun1L-GFP could be partially rescued by the addition of the H2-H3 sequence (H23(S3TM)Sun1L-GFP) to the N-terminus. Bar = 5m. These data identify two overlapping regions of the S un1 nucleoplasmic domain sufficient for NE targeting, H1-H2 and H2-H3. However, the latt er is only functional in the context of a transmembrane sequence and the Sun1 lumenal domain.

PAGE 73

73 Figure 2-6. Sun1 forms homotypic oligomers in vivo To define the oligomerization state of Sun1 HA-Sun1 was co-transfected into HeLa cells with Sun1-GFP, Sun1N455-GFP, H234Sun1L-GFP and S3TMSun1L-GFP (A). All samples were labeled with 35SMet/Cys and immunoprecipitate d with anti-GFP antibodies. Full length HA-Sun1 was most efficiently co-precipitated with Sun1-GFP, followed by the lumenal then nucleoplasmic domain containing fusion proteins. (B) In vivo evidence of Sun1 oligomerization mediated by the lumenal domain was provided by co-transfection of Sun1-GFP or HA-Sun1 with SS-HA-Sun1L-KDEL or S3TMSun1L-GFP, respectively. Alone, these proteins local ize predominantly to the ER or Golgi apparatus, respectively. Co-expression of fu ll length Sun1 recruited both proteins to the NE. Thus Sun1 forms homotypic oligom ers that independently involve the lumenal and to a lesser extent the nucleoplasmic domains. Bar = 6mm.

PAGE 74

74 Figure 2-7. Sun1 association with NPCs requires both the nucleoplasmic and lumenal domains. To define regions of Sun1 involved in NPC association, Sun1 mutants lacking either the lumenal (Sun1N455-GFP) or nucleoplasmic domains (H234Sun1L-GFP) were transiently expressed in He La cells (A). Neither Sun1 deletion mutant displayed obvious colocalization with Nup153. Bar = 1mm. (B) To further an alyze the roles of various domains in Sun1 targeting and retention, FRAP analysis was performed on Sun1, Sun1N455, Sun1N380, Sun1N380D221-343, Sun1N380D221-355 and H234Sun1L, each bearing a GFP tag at the C-terminus. In contrast to full length Sun1-GFP, which is relativel y immobile in the NE, fluorescence recovery occurred for all deletion proteins within a span of about 1min. Togeth er these data indicate that it is the combination of the nucleoplasmic and lumenal doma in that stabilizes Sun1 in the NE, potentially involving association with NPCs).

PAGE 75

75 Figure 2-8. Perturbation of S un1 affects NPC distribution. I mmunofluorescence microscopy of HeLa cells 48h after SUN protein depletion by RNAi (A). Cells were double labeled with antibodies against Sun1 or Sun2 and Nup153. Loss of Sun1 was associated with altered nuclear morphology and changes in th e distribution of NP Cs. Magnification of the nuclear surface reveals large pore-free tracts in between clusters of NPCs. Nontransfected cells (Control) or Sun2 RNAi had no such effect. Expression of Sun1N455-GFP altered NPC distribution in a manner similar to Sun1 RNAi. Bar = 5mm. (B) To quantify the obs erved changes in NPC distri bution, the relative standard deviation (stdev) of binned pixel intens ity of anti-Nup153 fluorescence intensity across the projected nuclear surface, was calculated. All measurements were standardized relative to the nontransfected control, which was set at 0%. Sun1 RNAi and Sun1N455-GFP were most effective at inducing NPC clustering followed by H234Sun1L-GFP, myc-Sun1N220 and myc-Sun1 220-380. SS-HA-Sun1L-KDEL and Sun1-GFP had a minimal effect on NP C distribution. Lamin C served as a transfection control and i nduced no significant NPC clustering. N=7-18.(C) To quantify the altered nuclear morphology i nduced by Sun1 RNAi, ratio of projected nuclear area to perimeter was measured. RNAi of Sun1 led to a 35% reduction in this ratio over control cells, whic h were set to 100%. N=10-11.

PAGE 76

76 Figure 2-9. Sun1 topology and interactions. Sun1 is envisaged as forming homodimers via interactions involving the membrane proxi mal coiled-coil within its C-terminal lumenal domain (A). Nucleoplasmic domain interactions may also contribute to homodimer formation. Sun1 functions as a te ther for ONM nesprin proteins. Nesprins 1 and 2 provide links to the actin cyto skeleton while nesprin 3 binds plectin, a versatile cytolinker. Sun1 is associated w ith NPCs and in addition, its nucleoplasmic domain displays preferential binding to newly synthesized pre-lamin A (B). Sun1 may therefore provide a link between NPCs and the A-type lamins. In this way, Sun1mediated nucleation of A-type lamina assembly may occur at NPCs.

PAGE 77

77 CHAPTER 3 DYNAMICS OF LAMINA PROCESSING: IMPL ICATIONS OF L OPINAVIR AND FTI-277 IN THE TREATMENT OF HIV AND PROGERIA Abstract The nuclear lam ina is a condensed intermedia te filament network lin ing the inner nuclear membrane (INM). One of the major components of the nuclear lamina, laminA (LaA) undergoes multistep posttranslational processing involving farnesylation, carboxymet hylation and cleavage by ZmpSte24. By using the HIV protease inhibito r Lopinavir (Lop), which is known to inhibit ZmpSte24, we accumulated a considerable level of farnesylated prelaminA (PreA) on the nuclear envelope (NE) with concomitant nuclear structural abnormalitie s. Release from the ZmpSte24 inhibition resulted in rapid LaA processing, with a more gradua l reversion of normal nuclear morphology. On the other hand, farnesyl-transfera se inhibitor FTI-277 in combination with geranylgeranyl-transferase i nhibitor GGTI-2147 effectively blocked LaA maturation and accumulated non-farnesylated preA on the NE in Saos-2 cells. The aberrant cellular phenotypes caused by Lop can be corrected by a combin atorial treatment of FTI-277 and GGTI-2147; however, washout of both the FTI and GGTI led to a phenotypic rebound. In Hutchinson-Gilford progeria syndrome (HGPS) cells prenylation of LaA and LaA 50 was largely blocked by FTI277 alone. Both protein maturation and nuclear ph enotype returned slowly after drug washout, suggesting a role of cell prolifera tion in the rate of recovery. Ov erall, our observations suggest a highly dynamic nature of the nuclear lamina, with implications for the desi gn of clinical therapy for HIV patients and the ongoing clinical trial for children with HGPS. Introduction The nuclear envelope (N E) is an extensi on of the endoplasmic reticulum (ER) that surrounds the nuclear contents. A nu clear lamina made of intermediate filaments called lamins is

PAGE 78

78 situated beneath the inner nuclear membrane (IN M) in close association with the peripheral heterochromatin. Several diseases, with di verse phenotypes including progeria, lipodystrophy, muscular dystrophy and peripheral neuropathy, have all been associated with mutations of LMNA, the gene encoding the A-type lamins (Burke and Stewart, 2002). Two common splice isoforms of LMNA encode the proteins laminA (LaA) and lamin-C (LaC) (Lin and Worman, 1993). Unlike LaC, LaA undergoes multistep posttranslational processing involving 3-4 enzymes at the unique C-terminal CaaX box. First a farnesyltransferase adds a farnesyl moiety to the cysteine followed by cleavage of the last th ree amino acids (-aaXing) by either Rce1 or ZmpSte24. Then the newly created C-terminus is carboxymethylated by isoprenylcysteine carboxymethyl transferase (ICMT) to generate farnesylated/carboxymethyl ated-PreA (f-PreA) that has a half-life of approxi mately 90 min prior to the final maturation step (Kitten and Nigg, 1991). ZmpSte24, a multipass membrane protein cleaves f-PreA 14 amino acids upstream of the C-terminus, releasing the modified peptide to generate mature LaA (m-LaA) (Sinensky et al., 1994). The processing of LaA appears to be sole function of ZmpSte24 (Corrigan et al., 2005). Aberrant LaA processing has been implicated in at least two seemingly separate disorders, lipodystrophy and Hutchinson-Gilf ord progeria syndrome (HGPS). A-type lamins have been implicated in both familial and acquired forms of lipodystrophy. Mutations in LaA that predominantly alter charge d residues on the surface of the Ig-fold region are associated with FPLD (Cao and Hegele, 200 0b; Shackleton et al., 2000b). Characterized by peri-pubertal onset of subcutaneous fat loss from the extremities and trunk, FPLD patients also suffer metabolic disorders including hypercholesterolemia and type-II diabetes (Dunnigan et al., 1974; Kobberling et al., 1975). Curi ously, there have been reports of PreA accumulation in

PAGE 79

79 fibroblast from FPLD patients desp ite the lack of an obvious mechanism (Capanni et al., 2005). There have also been reports of PreA accumula tion in cells from HIV-infected patients with acquired lipodystrophy from highly active antiretr oviral therapy (HAART) (Caron et al., 2007). In support of these claims, it has been shown that certain HIV protease inhibitors (PIs) used in HAART can inhibit the activity of ZmpSte24, leading to f-PreA accumulation (Coffinier et al., 2007). Furthermore, exogenous progerin has been reported to attenuate adipogenesis in human mesynchymal stem cells (Scaffidi and Misteli, 20 05). However, conclusive evidence for a direct involvement of f-PreA accumulation in HAART-associated lipodystrophy has yet to be shown. Incomplete LaA processing is most convinc ingly associated with the extremely rare HGPS. Born seemingly healthy, HGPS patients exhibit a phenocopy of premature ageing around 1-2 years of age and die of cardiovascular-related illness by ar ound 13 years of age (Capell and Collins, 2006; DeBusk, 1972; Sarkar et al., 2001 ). Most HGPS mutations promote alternative splicing of LaA that results in deletion of 50 aa near the C-terminus. This form of lamin, called progerin, has lost the second cleavage site fo r ZmpSte24, causing abnormal retention of the farnesylated and carboxymethylat ed C-terminus (De Sandre-Giova nnoli et al., 2003; Eriksson et al., 2003; Sevenants et al., 2005). The predominant hypothesis has been that the permanently modified C-terminus is the toxic etiology of HGPS pathology (Fong et al ., 2004; Navarro et al., 2004). This concept is bolstered by the seve re progeroid-like phenotype of restrictive dermopathy (RD) that results from mutations in ZmpSte24 leading to accumulation of f-PreA (Navarro et al., 2005; Navarro et al., 2004). This hypothesis led to the ther apeutic application of farnesyl-transferase-inhibitors (FTIs) to ameliorate the disease phenotype by inhibiting farnesylation of LaA, along with the approxima tely 100 genes predicted to encode CaaX-box proteins. In experiments with cells in vitro and mouse models, FTIs exhibited promising results,

PAGE 80

80 with improved nuclear morphology, with weight ga in and improved viability in mouse models (Capell et al., 2005; Glynn and Glover, 2005; Mallampalli et al., 2005; Toth et al., 2005; Yang et al., 2005). This led to the rapid es tablishment of a clin ical trial for HGPS patients with the FTI, lonafarnib. The outcome of th is trial remains unreported. The present situation led us to realize a de ficit in the understanding of lamin processing as it relates to the basic biology of the NE, as well as ongoing therapies for HIV-infected patients and children with HGPS. In this study, we inve stigated the recovery rate for LaA processing following accumulation of f-PreA by HIV-PI or nf-PreA by FTI-277 and lovastatin. We discovered that accumulations of either form of f-PreA were rapidly processed within a few hours suggesting a dynamic nuclear lamina with ample access to ZmpSte24 within the INM. In contrast, nf-PreA accumulated by FTI treatment app eared resistant to processing in part due to slow drug clearance and partially due to the re quirement of cell division. These results may change our view of the dynamic nature of the nu clear lamina, with implications for design of therapies for HAART and the ongoing clin ical trial for children with HGPS. Results To investigate the rate of LaA processing fo llowing release of proteo lytic inhibitors, we first examined the efficacy of these inhibito rs in accumulating f-PreA. Various HIV-PIs were tested for their ability to accumulate f-PreA by western blot (Figure 3-1A ). Lopinavir (Lop) and Nelfinavir are most effective, followed by Ataza navir. As compared to controls, there was no evidence of considerable PreA accumulation with Indinavir or Tipranavir treatment. We exclusively utilized Lop for th e rest of our studies as it provided the best balance between cellular toxicity and f-PreA accumulation. In order to ascertain the rela tive processivity of PreA accumu lated at the NE, Saos2 cells were treated for 48 hours with Lop. As detect ed by anti-LaA/C immunoblots, 3 hours following

PAGE 81

81 Lop washout approximately half of the accumula ted PreA was processed to maturity and by 7 hours the levels approach that of the contro l (Figure 3-1B). Identical experiments were performed by anti-LaA/C immunoprecipitati on from cells labeled overnight with 35S Cys/Met until 1 hour prior to lysis or Lop washout. These labeled lamins are predominantly NEassociated (Figure 3-1C). The rate of processi ng of the labeled LaA is similar to the total unlabeled LaA. As a final confirmation that our re sults to do not reflect turnover of accumulated LaA in combination with de novo synthesis, protein synthesis wa s inhibited with cyclohexamide 1 hour prior to Lop washout. If anything, pro cessing of LaA appears enhanced, presumable resulting from less newly synthesized PreA to compete for access to ZmpSte24 (data not shown). Considering the half-time of LaA processing for newly made lamin A is 1.5-2 hrs, we consider this recovery remarkable for a stable filamentous network. By indirect immunofluorescen ce, we observed the accumulation of PreA following Lop treatment and its disappearance following Lop washout (Figure 3-1C). After PI treatment, cells with accumulated PreA exhibited altered nuclear morphology characterized by irregular nuclear profiles with quantifiably decreased circularity (Figure 3-2A-C). In order to determine if accumulated LaA was responsible for the PI-indu ced irregular nuclear shape, we knocked out LaA/C by RNAi. In cells with considerable loss of LaA/C we observed a more circular nuclear profile despite PI-treatment (Fig ure 3-2D, E), thus implicating f-PreA as the mediator of this aberrant nuclear morphology. Another consequence of PI-treatment is th e considerable accumulation of cytoplasmic LaA/C observed adjacent to the spindles during metaphase and extranuclear in early G1, locations previously described for LaA 50 (Cao et al., 2007; Dechat et al., 2007). Interestingly, we observed a range of other NE proteins, incl uding emerin, LaB1 (Figure 3-2G, J), sun-2 and

PAGE 82

82 nesprin-3 (data not shown) were retained w ith the aberrant LaA/C aggregates well into metaphase and G1. Would these abnormal phenotype s recover as rapidly as the processing of PreA? By 7hour after drug removal normal nuclear circularity had partially recovered and by 15hour completely returned to pre-treatment levels (Figure 3-2C). The abnormal PreA aggregates in metaphase and early G1 resolve in a similar time-course (Figure 3-2H, K). These data suggest that time is needed for a structural reorganization of the nucleus and/or that the levels of f-PreA at th e time of washout are in excess of those required to induce these cellular changes. To resolve this uncertainty, we first determined Lop was required to accumulate a similar level of PreA to that observed 7hour following Lop washout (Figure 3-3A). We then compared the nuclear circularity and aberrant accumulations of LaA/C during metaphase and early G1 from cells treated with 5 M or 20 M Lop (Figure 3-3B). Clearly, 5 M Lop was unable to induce a significant change in the nuclear circularity or LaA/C localization. This left us with the possibil ity that cell division enhances recovery of a normal cellular phenotype following PI-washout. To test this hypothe sis, cells were treated with mitomycin prior to PI-washout to prevent cell division. In these arrested cells, we observed no difference in the maturation rate of f-PreA (Figure 3-3C). However, we observed a significant delay in recovery of nuclear circularity 15hour after washout (Fig ure 3-3D), suggesting that postmitotic nuclear reassembly contributes to th e recovery of circularity. Having observed the rather rapid processivity of f-PreA accumulated at the NE, we next asked whether a lamina containing nf-PreA would be readily processed once farnesylated. To investigate the rate of LaA processing following release of farnesylati on inhibitors, we first examined the efficacy of lovastatin (Lov) and FTI-277 in accumulating nf-PreA in cells. Both drugs were capable of accumulating PreA at the NE of Saos-2 cells treated for 48 hours (Figure

PAGE 83

83 3-4A). Lovastatin is an HMG-CoA inhibitor th at prevents, among other things, synthesis of prenylation precursors. Following Lov washout the half-time of mature LaA recovery was ~7 hours as determined by pulse-chase analysis (Figure 3-4B). Similar studies with FTI-277, a farnesyltranserase inhibitor, revealed a consider ably slower recovery in LaA processing with a recovery half-time of ~12 hours (F igure 3-4C). With either treat ment, inhibition of new protein synthesis with cyclohexamide added at drug wa shout increased recovery of mature LaA. Analysis of HDJ-2, another farnesylated protein, reveals that washout of Lov is rapid whereas the processing of LaA is delayed. However, in the case of FTI-277 washout, recovery of HDJ-2 farnesylation is slowed, but not as markedly so as the maturation of LaA. This suggests that that FTI-277 is difficult to wash out and/or is irrevers ibly inhibiting farnesyltransferase. We repeated the same experiments with other peptidomic FTIs such as manumycinA, L-744, 832, and observed the same eff ect (data not shown). Both of these inhibitors led to significant accumulation of the slower migrating nf-PreA, however lovastatin was considerably more effective than FTI-277. Recent evidence suggested that this may occur from considerable geranylg eranylation of LaA in the presence of FTI-277 (Varela et al., 2008). To explore th is possibility, Saos-2 cells were treated with geranylgeranyl transferase inhibitor (GGTI)-2147 alone or in co mbination with FTI-277 (Figure 3-4D). Whereas the GGTI-alone was unable to inhibit maturati on of LaA, and the FTI-alone was partially effective, only the combination of FTI and GGTI inhibited LaA maturation similar to Lov treatment. These results support the concept that farnesyltransferase inhibition can lead to considerable geranylgeranlyation and thus maturation of LaA. As the recovery of mature LaA occurred larg ely within one cell cycle following washout of FTI-277, we hypothesized that HGPS cells may suffer a phenotypic rebound following washout

PAGE 84

84 of FTI. A lamina containing nonfarnesylated PreA and LaA 50 would be susceptible to rapid farnesylation, potentially causi ng a phenotype more deleterious than evident prior to FTI treatment. Skin fibroblasts from HGPS patients were treated with 10 M FTI-277 for 4 days, during which time the farnesylation of LaA and LaA 50 was almost completely inhibited. We confirmed that the slower migrating band, observed just below mature LaA, was nonfarnesylated LaA 50 with an exogenous epitope tagged LaA 50. Following washout of the drug, both lamin A and LaA 50 exhibited a protracted return to a processed state that was not yet complete after three days. However, the reco very of HDJ-2 processing was much more rapid with a half-time less than 24 hours (Figure 3-5A). Phenotypically, the irregul ar circularity of the HGPS nuclei that was corrected by FTI treatment did return following by the third day following drug washout (Figure 3-5B C). We attribute this prolonge d recovery to the extremely slow proliferation we observed with these cells. These results suggest that the recovery of toxic LaA 50 following FTI washout is relatively slow in slowly dividing cells; however, rapidly divi ding cells may be much more susceptible. To investigate this possibility, we utilized Saos-2 cells treated for 48 hours with 20 M Lop to accumulate toxic PreA, which causes ir regular nuclear profiles. The combinatorial treatment of Lop and FTI-277 was unable to comple tely inhibit the aberra nt nuclear profiles, metaphase or cytoplasmic LaA aggregates; however this might be expected, as we know that FTI-277 allows considerable LaA geranylgeranylation. To ensure a lack of prenylated LaA, we treated Saos-2 cells for 48 hours with L op, FTI-277 and GGTI-2147. Indeed, this treatment largely inhibited the aberrant nuclear profiles caused by Lop tr eatment alone. Upon washout of both the FTI and GGTI while maintaining Lop treatment, the irregular nuclea r profiles (Figure 36A), metaphase and cytoplasmic aggregates (Figure 3-6B) increas e dramatically, returning to

PAGE 85

85 Lop-alone levels by 15 hours and rebounding pa st Lop-alone by 24 hours. In support of a geranylgeranylated LaA population in these cells, washout of FTI, with maintenance of GGTI and Lop treatment, exhibited a much more gradua l return to the aberra nt phenotype caused by Lop-alone. Discussion In this study we have ascertained that a lam ina containing considerable levels of farnesylated PreA can be rapidly processe d upon enzyme activation. The abnormal nuclear phenotype resulting from accumulated PreA is slow er to resolve. However, reversion occurs more rapidly in proliferative cells suggesting a need for structur al reorganization of the lamina. In the case of non-farnesylated PreA, FTI-277 wa shout is considerably slower than Lov and requires the addition of a GGTI to prevent consid erable geranylgeranylation of PreA. However, when slowly dividing HGPS fibroblasts were treated with FTI-277, prenylation of LaA and LaA 50 was largely blocked. After washout of FTI-277 these cells required 3 days to reacquire their normally misshapened nuclear profiles and cytoplasmic lamin aggregates. When the rapidly diving Saos-2 cells were treated with Lop, FTI-27 and GGTI-2147 the prenylation inhibitors blocked the aberrant cellular phenotype from Lop treatmentalone. However, upon washout of the FTI and GGTI the cells rapidly rebounded to a mo re severely affected phenotype than occurs with Lop-alone. We attribute this to the accu mulated nonprenylated PreA within the lamina rapidly shifting to a tox ic prenylated population. Our observations suggest that the nuclear lamina is read ily accessible to processing enzymes such as the soluble farnesyltransferas e and the integral membrane ZmpSte24, Rce1 and ICMT. Thus, the lamina may in fact be quite dynamic. Previous studies utilizing FRAP analysis have described nuclear lamins as relatively im mobile (Janicki and Spector, 2003). However, in

PAGE 86

86 addition to relying on exogenous lamins with larg e N-terminal fusion proteins, this technique only accounts for rather large-scal e movement of lamins within the nucleus. If lamins do form structures similar to other intermediate filame nts, then it is hard to imagine how a lamina consisting of unprocessed PreA could be entirely accessible to the integral membrane processing enzymes such as ZmpSte24. If all of the C-term inal tails that follow the Ig-like fold are assumed to be exposed on the surf ace of the filament then one could imagine it must be adjacent to the surface of the INM and capable of dynamic rolling to allow complete association with the processing enzymes. Or there could be focal asse mbly and disassembly of the lamin dimers that constitute the filaments. An alternative explanat ion would be the lack of a filamentous lamina, something not entirely impossible as the organi zation of the somatic nuclear lamina has never been observed or characterized. The mechanism by which farnesylated PreA leads to HGPS or RD remains unknown, however there is considerable evidence that a shift in the ratio of farnesylated A-type lamins is pathological (Fong et al., 2004; Navarro et al., 2004). Previous ly, aberrant mitotic and postmitotic aggregates of LaA 50 have been described with a sugge sted role in pathology (Cao et al., 2007; Dechat et al., 2007). We have observed identical results in ZmpSte24 null cells (our unpublished results). In this st udy, these findings have been e xpanded by identification of not only A-type in these aggregates, but also B-t ype lamins along with INM and ONM constituents such as sun-2, nesprin-2 and emerin. This s uggests a possible mechanism by which aberrantly farnesylated lamins may be toxic, the displa cement of NE constituents from the newly forming post-mitotic NE. This could perturb the organiza tion of nuclear structures such as chromatin, NPCs or how the nucleus organizes the cytoskeleton via the LINC-complexes.

PAGE 87

87 A role for farnesylated PreA in the acqui red lipodystrophy observed in many HIV patients receiving HAART treatment has not been conclusive ly proven. However, there is considerable circumstantial evidence that inhibition of ZmpSte 24 by certain PIs may indeed contribute to this lipodystophy (Caron et al., 2007; Ca ron et al., 2003). And although it is unclear when or how PreA might induce lipodystrophy, its expression has been reported to inhibit adipogenesis in human mesenchymal stem cells (S caffidi and Misteli, 2005). The re markably rapid recovery of mature LaA following washout of Lop suggests that an alternative dosing strategy, allowing short periods of PI withdrawal to permit LaA maturation, might reduce side effects. We observed a slower recovery of LaA ma turation following washout of FTI-277 or Lov than for Lop. This may not be surprising as our readout of LaA maturation requires only ZmpSte24 cleavage for Lop inhibition, whereas farnesylation, aaXing, ca rboxylmethylation and ZmpSte24 cleavage all must occur following FTI-277 or Lov treatment. Furthermore, in the case of ZmpSte24 there are no known substrates ot her than LaA, but there are ~30-100 other substrates to compete for limited farnesylat ion, aaXing and carboxylmethylation enzymes. Despite this obstacle, the rapidly dividing Saos-2 cells exhibi t a marked negative rebound when significant levels of nonfarnesylated PreA accumulated by treatment with FTI-277 and GGTI2147 were permitted to mature in the presence of Lop. Thus, we suggest that the reversibility of lonafarnib, currently in a clinical trial for HG PS, be ascertained immedi ately. Furthermore, we suggest that patients be informed of the potenti al risks associated with missing doses or rapid termination of the treatment. Al ong these lines, gradually weaning patients from the drug at the end of the trial should be considered. Otherwise these patients might suffer negative consequences from a rapid accumulation of toxic prenylated PreA and LaA 50.

PAGE 88

88 Materials and Methods Reagents and Treatment : All HIV proteas e inhibitors were obtained from the National Institutes of Health (NIH) AIDS Research and Reference Reagent Program ( www.aidsreagent.org/Index.cfm). Nelfinavir, Lopina vir, Atazanavir sulfate were prepared at a stock solution at 20 m M in DMSO Indinavir sulfate was prepared at 20 mM in water, and Tipranavir (Aptivus) was prepar ed at 20 mM in ethyl acetate. The FTI-277 (Sigma, St. Louis, MO) was prepared as a stock solution at 10 mM, L ov (Sigma, St. Louis, MO) was prepared at 10 mM and GGTI-2147 (Calbiochem, Gibbstown, NJ ) was prepared at 20 mM. Unless otherwise noted, Saos2 cells were treated with HI V PIs, Lov and GGTI-2147 at a dose of 20 M, and with FTI-277 at a dose of 10 M for 48 hours. Control cells were incubated with the vehicle DMSO or ethyl acetate. HGPS fibroblasts were treated with FTI-277 at a dose of 10 M for 4 days. Cell Culture : Saos2 cells were maintained in 6% CO2 and at 37oC in DMEM (GIBCO BRL) plus 10% FBS (Hyclone), and 10% penicillin/streptomy cin (GIBCO BRL). Human HGPS fibroblasts were obtained from the Coriell Cell Repository (repository nos. AG01972, with the G608G mutation) ( http://locus.umdnj.edu/ccr) and maintained in 6% CO2 and at 37oC in DMEM (GIBCO BRL) plus 15% FBS (Hyclone), 10% penicillin/streptomycin (GIBCO BRL) and 2x concentration of essential and non-essential amino acids. After re moval of the reagents, cells were washed with PBS quickly for three times a nd original culture media three times, 10 minutes each. Antibodies: The following antibodies were used in this study: the monoclonal antibody against lamins A and C (XB10) has been desc ribed previously (Rah arjo et al., 2001). The monoclonal antibody SA1 against Nup153 was obtai ned from the American Type Culture Collection, Covance. Rabbit antiemerin was a gift from G. Morris (Robert Jones and Agnes

PAGE 89

89 Hunt Orthopaedic Hospital, Oswestry, UK). Ra bbit antilamins A and C (2032) was obtained from Cell Signaling. Rabbit anti-laminB1 (ab16048) was purchased from Abcam. Goat anti lamin A and C (SC621), rabbit anti-lamin A (SC20680) and goat anti-lam inA (SC6214) were obtained from Santa Cruz Biotechnology, Inc. M ouse anti-HDJ 2 (MS-225) was obtained from Thermo Scientific. Secondary antibodies conjuga ted with AlexaFluor dyes were obtained from Invitrogen. Peroxidase-conjuga ted secondary antibodies were obtained from Biosource International. Immunofluorescence Microscopy : For immunofluorescence microscopy, cells were grown on glass coverslips and fixed in 3% paraformaldehyde (prepared in PBS from PFA powder) for 10 min followed by a 15-min permeab ilization with 0.4% TX-100. Cells labeled with anti-Lamin A (SC6214, Santa Cruz) were fixed and permeabilized for 4 min in methanol at 4oC. The cells were then labele d with the appropriat e antibodies plus the DNA-specific Hoechst dye 33258. Specimens were observed using a fluor escence microscope (DMRB; Leica). Images were collected using a CCD camera (CoolSNAP HQ; Roper Scientific) linked to a computer (G4; Macintosh) running IPLab Spectrum software (Scanalytics). Image quantification was performed using IPLab software. Immunoblots and Gel Electrophoresis : Cells grown in 35-mm tissue culture dishes were washed once in PBS and lysed in SDS-PAGE sample buffer (0.2 M Tris pH 8.8, 5 mM EDTA pH 8.0 and 1 M sucrose). Protein samples we re resuspended by sonication, fractionated on polyacrylamide gels (6 or 7%) and transferred onto nitrocellulose fi lters (usually BA85; Schleicher and Schuell) using a semidry blotting apparatus manuf actured by Hoeffer Scientific Instruments Inc. Filters were blocked and la beled with primary antibodies and peroxidase-

PAGE 90

90 conjugated secondary antibodies exactly as prev iously described (Burnette, 1981). Blots were developed using ECL and exposed to X-OMAT fi lm (Kodak) for appropriate periods of time. Pulse-chase and Immunoprecipitation : Subconfluent 35-mm dishes of Saos2 cells, either untreated or treated with DMSO Lopinavir, Lovastatin, or FT I-277 for 48 hours, were incubated in 90% DMEM (GIBCO BRL) plus 9% FBS (Hyc lone), and 10% L-cystine and L-methionine free media (MP Biolabs) with 25 Ci 35S Transl abel (MP Biolabs). After 18 hours, Saos2 cells were washed once with PBS and overlaid with non-radioactive DMEM (G IBCO BRL) plus 10% FBS (Hyclone) and original treated reagents. Afte r one hour, Saos2 cells we re washed twice with PBS and either incubated in DMEM with 10% FBS for an additional 1 to 24 hours or lysed immediately. For cell lysis, cells were washed th ree times in PBS and incubated in 800 l lysis buffer (50 mM Tris-HCl, pH 9, 500 mM sodium ch loride, 0.4% sodium dodecyl sulfate (SDS), 2% Triton X-100) with 1:1,000 CLAP (10 mg/ml in DMSO each of chymostatin, leupeptin, antipain, and pepstatin) on ice for 5 minutes. The cells were then scraped off with a rubber policeman and sheared eight times through a 26-gauge needle. After centrifugation for 10 minutes at 10,000 g, the supernatant was incubate d overnight at 4C with 5 l Goat antilaminA/C (Santa Cruz) and protei n GSepharose beads. At the end of this period, the beads were collected by brief centrifugation and washed three times in lysis buffer and once in wash buffer (50 mM Tris-HCl, pH 7.4, 50 mM sodium chloride ). Finally, the beads were suspended in SDSPAGE sample buffer, heated to 95C for 5 min, and analyzed by SDS-polyacrylamide gel electrophoresis (PAGE). The gels were stained with Coomassie blue R-250, impregnated with Amplify (GE Healthcare), dried, and exposed to X-OMAT film (Kodak).

PAGE 91

91 Figure 3-1. HIV PIs block LaA ma turation, which is reversed rapidly following PI removal. (A) Probed with PreA specific and LaA/C antibod ies, immunoblot of extracts from Saos2 cells treated with vehicle (D MSO), Tip, Nel, Ata, Ind and Lop reveals different levels of f-PreA accumulation. (B) Immunoblot of extracts from Saos2 cells treated with Lop followed by washout indicates that half time of LaA maturation is approximately 3 hours. The processing rate of the overnight 35S Cys/Met labeled LaA following Lop washout is similar. (C) Immunofluorescence microscopy of Saos2 cells double labeled with the antibodies again PreA and Nup153. PreA is accumulated on the NE after Lop treatment and disappears following Lop washout. All images are taken at the same exposure time and in the merged images, DNA, revealed by staining with Hoechst dye, is shown in blue. Bar, 15 m

PAGE 92

92 Figure 3-2. Aberrant cellular phenotypes are re covered by 15 hours following Lop washout. (A) Immunofluorescence microscopy of Saos2 cells. Altered inte rphase nuclear morphology and abnormal accumulation of LaA/C and emerin in the cytoplasm are exhibited after Lop treatment and recove red by 15 hours following Lop washout. (B) The aberrant cytoplasmic aggregates after Lop treatment contain LaB1, partially if not all colocalized with LaA/C. (C) Nucl ear circularity following Lop washout is measured and quantified in ImageJ. (D) Double labeled with antibodies against LaA/C and LaB1, Saos2 cells exhibit norma l nuclear morphology after Lop treatment following LaA/C RNAi. (E) Nuclear circul arity in both mock and LaA/C RNAi treated cells is shown. (F) Nu clear components such as LaA/C, emerin and LaB1 are diffusive in metaphase. (G) Lop treatment leads to aberrant aggregation of LaA/C around metaphase chromosomes. Emerin and LaB1 are also retained in these aggregates. (H) Measurements of percenta ge of cells with metaphase aggregates indicate that mitotic abno rmality recovers by 15 hours af ter Lop washout. (I) LaA/C, emerin and LaB1 localize on the NE in early G1. (J) Lop treatment leads to aberrant aggregation of LaA/C in the cytoplasm in early G1. These aggregates also contain emerin and LaB1. (K) Measurements of percen tage of cells with early G1 aggregates indicate that recovery of cytoplasmic abnormality is approximately 15 hours after Lop washout. Bar, 5 m

PAGE 93

93

PAGE 94

94 Figure 3-3. Recovery of nuclear morphology foll owing Lop washout requires mitosis. (A) Probed with LaA/C antibody, i mmunoblot of Saos2 cells treated with increased concentrations of Lop from 0 to 40 M reveals increased PreA accumulation in parallel. (B) Measurements of interphase nuclear circularit y, percentage of cells with metaphase and early G1 aggregates reveal that the effects of 5 M Lop differs significantly from 20 M Lop, with similar level to vehicle (DMSO) control. (C) Accumulated PreA in Lop tr eated cells complete its maturation by 7 hours following drug washout. Mitomycin treatment prior to Lop removal does not affect PreA processing rate. (D) Measurement of nuclear circularity indicates that mitomycin delays recovery of aberrant nuclear shape at 15 hours following Lop washout.

PAGE 95

95 Figure 3-4. Lovastatin and FTI277 lead to accumulation of nf-PreA on the NE, which undergoes gradual maturation following washout of Lov and FTI-277. (A) Immunofluorescence microscopy of Saos2 cells reveals signifi cant accumulation of nf-PreA on the NE after a treatment of Lov or FTI-277. DNA, revealed by staining with Hoechst dye, is shown at bottom column. Bar, 5 m (B) Immunoblot of extracts from Saos2 cells treated with Lov followed by washout indicates that half time of PreA maturation is approximately 7 hours. Cyclohexamide chas e upon release from Lov block exhibites a faster maturation. Accumulated nonfarnesylated HDJ-2 gains complete farnesylation by 2 hours following Lov wa shout. Processing rate of overnight 35S Cys/Met labeled LaA following Lov removal is similar to unlabeled total population. (C) Similar experiments are conducted with FTI-277 instead of Lov. Half time of PreA maturation following FTI-277 washout is approximately 20 hours in total population, 7 hours with cyclohexamide chase and 12 hours in overnight 35S Cys/Met labeled population. HDJ-2 is farnesylated wi th a faster rate th an LaA processing upon FTI-277 washout. (D) Immunoblot of extr acts of Saos cells probed with LaA antibody. In contrast to the ha lf block of FTI-277 treatment, a combinatorial treatment of FTI-277 and GGTI-2147 as well as Lov alone lead to complete accumulation of non-prenylated PreA.

PAGE 96

96 Figure 3-5. Release from FTI-277 block leads to gradual maturation of nf-PreA and nf-LaA 50 and slow recovery of nuclear morphology in HGPS cells. (A) FTI-277 treatment for 96 hours completely block LaA and LaA 50 processing. Accumulated PreA and LaA 50 reach maturation over 72 hours following FTI-277 washout. SCJO cells transfected with HA tagged LaA 50 reveal size shift between fLaA 50 in control cells and nfLaA 50 in FTI-277 treated cells. HDJ-2 e xhibits faster processing rate upon FTI-277 washout with a complete farnesylation at 48 hours. (B) Immunofluorescence microscopy of HGPS cells indicates that remedy of nuclear shape by FTI-277 is reversed by 72 hours following FTI-277 removal. Bar 10 m (C) Measurement of nuclear circularity in HGPS cells following FTI-277 washout is shown.

PAGE 97

97 Figure 3-6. Correction of cellular phenotypes in Saos2 cells cause d by Lop with a combinatorial treatment of both FTI-277 and GGTI-2147 is reversed quickly upon washout of FTI277 and GGTI-2147. (A) Labeled with LaA/C antibody, immunofluorescence microscopy of Saos2 cells reveals th at combination of FTI-277 and GGTI-2147 instead of FTI alone rectify abe rrant nulclear morphology and abnormal nucleoplasmic aggregation caused by Lop. Release of FTI and GGTI leads to a rapid phenotypic rebound. (B) Measurements of nuclear circularity and percentage of cells with metaphase and early G1 aggregat es reveal that corresponding cellular phenotypes are reversed by 24 hours fo llowing FTI-277 washout and 15 hours following FTI-277 and GGTI-2147 washout.

PAGE 98

98 CHAPTER 4 CONCLUSION Overview of Findings Physical con nections between the nucleo skeleton and cytoskeleton were recently uncovered, which we have previous ly defined as LINC complex (C risp et al., 2006). They form through interactions between the luminal domains of two families of transmembrane proteins of the NE: Sun proteins and Nesprins (Starr and Han, 2002; Starr et al., 2001). Multiple LINC complex isoforms likely exist given the presence of dozens of nesprin sp lice isoforms and the apparent redundancy of Sun1 and 2 in tethering nesprins. In addition, we can identify at least four or five splice isoforms of Sun1 alone, further increasing the LINC complex repertoire. According to the selective retention model, INM proteins are concentrated at the NE through interactions with nuclear component s such as lamins and chromatin. Though the association with A type lamins has been confir med, localization of SUN proteins is not lamin dependent (Crisp et al ., 2006; Haque et al., 2006; Hasan et al., 2006; Padmakumar et al., 2005). Interestingly, Sun1 can efficiently displace Sun2 fr om the INM, not vice versa. Therefore, Sun1 likely has an additional binding partner(s) that is not shared with Sun2. Furthermore, we have identified two separate INM-targeting regions within the Sun1 nucleoplas mic domain. In terms of the four known hydrophobic sequ ences within Sun1, only one of these functions as a membrane-spanning domain. In contrast to its nucleoplasmic domain, the lumenal domain of Sun1 has no intrinsic targeting properties. Howeve r, it does promote oligomerization, most likely based upon coiled-coil homodimers. Although functionally redundant, Sun1 and 2 are se gregated within the plane of the NE. Sun2 predominates in NPC-free regions. In contra st, Sun1 is concentrated in the vicinity of NPCs, possibly forming a halo around each NPC. The complement of mammalian NPC subunits

PAGE 99

99 identified by proteomic approaches does not include Sun1 (Cronshaw et al., 2002). Perhaps Sun1's additional associations with the nucle ar lamina and possibly chromatin limit its coextraction with NPC proteins. Regardless, we can find no evidence that Sun1 contributes to nucleocytoplasmic transport. However, depletio n of Sun1 (but not Sun2) or overexpression of truncated forms of Sun1 lead to the formation of NPC aggregates or clusters. This suggests that Sun1 has a role in the maintenance of the unifo rm NPC distribution across the nuclear surface. The nucleoplasmic end of the LINC comple x connects the nuclear lamina, which is a condensed intermediate filament network lini ng the INM. Previous st udies utilizing FRAP analysis have demonstrated that the nuclear lami na is highly stable dur ing interphase (Janicki and Spector, 2003). However, our observations through laminA processing suggest that the nuclear lamina may in fact be more dynamic than is currently appreciated. By using the HIV protease i nhibitor Lop, which is known to block LaA maturation through inhibition of ZmpSte24, we accumulated a considerab le level of farnesylated PreA on the NE with concommittant nuclear structural abnormaliti es. Release from Lop block resulted in rapid LaA processing, with a slightly slower reversion of normal nuclear morphology. We also used a variety of drugs to block prenylation of newly synthesized LaA. Inhibition of LaA farnesyltion in Saos-2 cells using the farnesyl-transferase inhibitor FTI-277 was only slowly reversible upon washout. A significant per centage of LaA in FTI treated cells became geranylgeranylated. Thus complete inhibition of LaA prenylation required the additional inclusion of a GGTI. Inhibition of LaA pre nylation could also be accomplished employing lovastatin, an inhibitor of isopr enoid biosynthesis. In contrast to FTI-227, lovastatin treatment was rapidly reversible. Combinatorial treatment of cells with FTI-277 and GGTI-2147 were able to correct the aberrant cellula r phenotype caused by Lop. Removal of both drugs led to a rapid

PAGE 100

100 rebound phenomenon. In HGPS cells, however prenylation of LaA and LaA 50 was largely blocked by FTI-277 alone. Both protein maturati on and nuclear phenotype re turned slowly after drug washout, suggesting a role of cell pr oliferation in the rate of recovery. Significance The discovery of close association between S un1 and NPCs is striking, however, we feel that Sun1 is unlikely to represent an intrinsic NPC com ponent. Instead, a more reasonable scenario is that Sun1 is associated with th e NPC periphery and may define a novel microdomain within the nuclear membranes, which, in tur n, could blur the boundary between NPCs and the bulk of the NE. On the other hand, our observations that the nuclear lamina is fully accessible to processing enzymes suggests a more dynamic nature of lamina organization than had previously been thought. This discovery has important implicati ons in the clinical uses of lopinavir and FTIs in the treatment of HIV and progeria. Sun1 Can Be Involved in Nuclear Pore Membrane (NPM) Curvature, de Novo NP C Assembly and Defining Distinct Regions of Nuclear Periphery Previous observation in our la b revealed that breakage of LINC complexes by co-depletion of Sun1 and Sun2 causes frequent expansion of the PNS (Crisp et al., 2006). Therefore, LINC complex does maintain the separation between in ner and outer nuclear membranes. Considering the adjacent location of Sun1 to NPCs, Sun1 and asso ciated nesprin family might play a role in stabilizing the curvature of the NPM as well. Additional evidence for this comes from Sun1 topology. According to the previous study, retic ulon4A/NogoA maintains ER curvature through hydrophobic hairpins inserted into loosely packed lipids (Voeltz et al., 2006). Similarly, Sun1 contains three non-transmembr ane hydrophobic domains. These bul ky amphipathic helices could account for the formation and/or main tenance of highly curved NPM.

PAGE 101

101 Mammalian cells amplify the number of NPCs in interphase to prepare for a new cell division. A likely hypothesis is that a convergence and fusion of the outer and inner nuclear membrane would form a hole into which the NP C would assemble. However, the factors that could mediate the approximation of the two membranes are currently unknown. Similar to vesicle or viral fusion, transmembr ane proteins residing on either one or both membrane sides of the NE could be involved. Sun1-nesprin pairs are the only known protein c onnections that cross the PNS. Therefore they can be considered as prime candidates to fulfill this function. As we mentioned previously, the lumenal domain of Sun1 has a complex organization. Conformational changes resulting from related regulatory signa ls could trigger conve rgence of the INM and ONM. The nuclear periphery has been regarded as a site of transcri ptional repression and silencing, with heterochromatin lo calizing adjacent to the INM (C remer et al., 2003; Croft et al., 1999). However, more evidence has emerged sugges ting a role for NPCs in gene regulation. For instance, Casolari and colleagues showed that several actively transcribed genes involved in essential cell processes such as ribosomal biogenesis and glycolysis were associated with NPCs (Casolari et al., 2004). In this ca se, we might wonder how the NE organizes those repressive and active regions. In addition, NPCs are responsible for molecular traffick ing between the nucleus and cytoplasm, which requires re latively loose environment. Thus, it is necessary to keep condensed heterochromatin from the openning of NPCs. Sun1, with its distinct localization, might act as the boundary between NPCs and the bulk of the NE. The Mechanisms of Nuclear Lamina Assembly Has Implications in the Clinical Use of both HIV Protease Inhibitors and Fa rnesyltrans ferase Inhibitors Our observations that the nucle ar lamina is readily acces sible to processing enzymes suggest a more dynamic nature of lamina orga nization. Though it is unclear how farnesylated

PAGE 102

102 PreA induces lipodystrophy, there is considerable circumstantial ev idence that the side effects associated with HIV patients receiving HAART treatment result from Zmpste24 inhibition. Considering remarkably rapid preA processi ng following Lopinavir washout, switching to an alternative cocktail containing PI s that do not inhibit Zmpte24, or allowing short periods of PI withdrawal to permit PreA maturation is recommended. In terms of FTI-277+GGTI-2147/FTI-277 removal, th ere is a significant discrepancy in the recovery rates of Saos2 versus HGPS cells. Cons idering the dramatic growth difference between these two cell lines, it is possi ble that release from FTI-277 bl ock requires cell proliferation. Other explanations can be that Saos2 and HGPS cells have different farnesyltransferase levels or different numbers of substrates for farnesyltran sferase, which affects the reversibility of the enzymes. Other FTIs such as manumycin-A and L-744, 832 gave us similar results. As we all know, lonafarnib is in use in a current clinical trial for progeria. It s suggested that the reversibility of lonafarnib s hould be ascertained. If the release is rapid, gradually weaning patients from the drug at the end of the trial should be considered. Otherwise these patients might suffer negative consequences from a quick accu mulation of toxic prenylated PreA and LaA 50. Future Work Functional Investigation of Sun1 Ding and colleagues have shown that disrupt ion of Sun1 in m ice prevents telomere attachment to the NE, efficient homolog pairing, a nd synapsis formation in meiosis (Ding et al., 2007). Thus, MEFs from those homozygous or he terozygous Sun1 knockout mice can be used as an efficient tool to analyze the possi ble functions of Sun1 mentioned above. Our previous study revealed the expansi on of the PNS following Sun1/2 double RNAi, which, however, did not occur upon Sun1 RNAi alone (Crisp et al ., 2006). Given the functional redundancy between Sun1 and Sun2, Sun2 might comp ensate for Sun1 in this case. Another

PAGE 103

103 explanation is that RNAi can only lead to partia l knockdown of the protein. In terms of the role of Sun1 in shaping the NPM, we can observe Sun1/MEFs by thin section electron microscopy (EM) and measure the curvature of NPM. Over expression of a truncated Sun1 protein excluding the three non-transmembrane hydr ophobic domains will in turn suggest if these domains are involved in this function. Dendra2 is an irreversible green-to-red phot oswitchable fluorescent protein with a fast maturation and brighter fluorescence than GFP/RFP. To address the role of Sun1 in interphase NPC assembly, we can knockout S un1 through RNAi in Hela cells stably expressing Dendra2POM121 or introduce Dendra-POM121 into Sun1 -/MEFs. Photoswitching the pre-existing NPCs to red will permit us to track the de novo assembly of NPCs through live cell imaging since they will exhibit green fluorescence. To explore the function of Sun1 in the orga nization of heterochromatin, we can take advantage of indirect immunofluorescence mi croscopy by using the antibody again HP1 or watch the struction of heterochromatin directly under EM in Sun1-/MEFs. Withdrawl of Lop and FT I-277 on Animal Models The fact that Lop washout leads to a quick reversion of LaA m a turation and cellular phenotypes stimulates my interest in testing this effect in mi ce. According to Prot and his colleagues, lopinavir-ritonavirtreated mice rapidly developed symptoms of lipodystrophy such as hypertriglyceridemic and loss of white adipose tissue (Prot et al., 2006). We can remove those mice from Lop treatment and inves tigate any deleterious effects. On the other hand, we observed a significant di screpancy in the rec overy rate of Saos2 versus HGPS cells upon washout of prenylation inhibitors. This may be due to the dramatic growth difference between thes e two cell lines. As we know, within a mammalian organism cell from different organs exhibit wildly different pr oliferation rates, making it necessary to test the

PAGE 104

104 effect of FTI washout in a mouse model for HGPS. Previous studies have shown that FTItreatment improves the survival of progeroid mice, benefiting body weight with reduction of spontaneous rib fractures (Yang et al., 2008). We can remove these mice from FTI-treatment to investigate any deleterious phenotypic rebound.

PAGE 105

105 LIST OF REFERENCES Aaronson, R., and G. Blobel. 1975. Isolation of nuclear pore com plexes in association with a lamina. Proc. Natl. Acad. Sci. USA 72:1007-1011. Aebi, U., J. Cohn, L. Buhle, and L. Gerace. 1986. The nuclear lamina is a meshwork of intermediate-type filaments. Nature. 323:560-4. Akey, C.W., and M. Radermacher. 1993. Archite cture of the Xenopus nuclear pore complex revealed by three dimensi onal cryo-electron microscopy. J. Cell Biol. 122:1-20. Amin, D., S.A. Cornell, S.K. Gustafson, S.J. Needle, J.W. Ullrich, G.E. Bilder, and M.H. Perrone. 1992. Bisphosphonates used for the treatm ent of bone disorders inhibit squalene synthase and cholesterol biosynthesis. J Lipid Res 33:1657-63. Antonin, W., C. Franz, U. Haselmann, C. Antony, and I.W. Mattaj. 2005. The integral membrane nucleoporin pom121 functionally links nuclear pore complex assembly and nuclear envelope formation. Mol Cell 17:83-92. Apel, E.D., R.M. Lewis, R.M. Grady, and J.R. Sanes. 2000. Syne-1, a dystrophinand Klarsichtrelated protein associated with synap tic nuclei at the neuromuscular junction. J Biol Chem 275:31986-95. Baker, S.K. 2005. Molecular clues into the pathog enesis of statin-media ted muscle toxicity. Muscle Nerve 31:572-80. Basso, A.D., P. Kirschmeier, and W.R. Bis hop. 2006. Lipid posttranslational modifications. Farnesyl transferase inhibitors. J Lipid Res 47:15-31. Bastos, R., A. Lin, M. Enarson, and B. Burke. 1996. Targeting and function in mRNA export of nuclear pore complex protein Nup153. J. Cell Biol. 134:1141-1156. Bengtsson, L., and K.L. Wilson. 2006. Barrier-to-au tointegration factor phosphorylation on Ser4 regulates emerin binding to lamin A in vitro and emerin localization in vivo. Mol Biol Cell 17:1154-63. Bergo, M.O., P. Ambroziak, C. Gregory, A. George J.C. Otto, E. Kim, H. Nagase, P.J. Casey, A. Balmain, and S.G. Young. 2002. Absence of the CAAX endoprotease Rce1: effects on cell growth and transformation. Mol Cell Biol 22:171-81. Bione, S., E. Maestrini, S. Rivella, M. Manc ini, S. Regis, G. Romeo, and D. Toniolo. 1994. Identification of a novel X-linked gene re sponsible for Emery-Dreifuss muscular dystrophy. Nat Genet. 8:323-7. Bodoor, K., S. Shaikh, D. Salina, W.H. Raharjo, R. Bastos, M. Lohka, and B. Burke. 1999. Sequential recruitment of NPC proteins to th e nuclear periphery at the end of mitosis. J Cell Sci 112:2253-64.

PAGE 106

106 Bonne, G., M.R. Di Barletta, S. Varnous, H.M. Becane, E.H. Hammouda, L. Merlini, F. Muntoni, C.R. Greenberg, F. Gary, J.A. Urtizberea, D. Duboc, M. Fardeau, D. Toniolo, and K. Schwartz. 1999. Mutations in the gene encoding lamin A/C cause autosomal dominant Emery-Dreifuss muscular dystrophy. Nat Genet. 21:285-8. Brachner, A., S. Reipert, R. Foisner, a nd J. Gotzmann. 2005. LEM2 is a novel MAN1-related inner nuclear membrane protein a ssociated with A-type lamins. J Cell Sci. 118:5797-810. Broers, J.L., B.M. Machiels, H.J. Kuijpers, F. Smedts, R. van den Kieboom, Y. Raymond, and F.C. Ramaekers. 1997. Aand B-type lamins are differentially expressed in normal human tissues. Histochem Cell Biol 107:505-17. Broers, J.L., E.A. Peeters, H.J. Kuijpers, J. Endert, C.V. Bouten, C.W. Oomens, F.P. Baaijens, and F.C. Ramaekers. 2004. Decreased mechanical stiffness in LMNA-/cells is caused by defective nucleo-cytoskeletal integrity: implications for the development of laminopathies. Hum Mol Genet 13:2567-80. Burke, B. 2001. Lamins and apoptosis: a two-way street? J Cell Biol 153:F5-7. Burke, B. 2006. Cell biology. Nuclear pore complex models gel. Science. 314:766-7. Burke, B., L.C. Mounkes, and C.L. Stewart. 2001. The nuclear envelope in muscular dystrophy and cardiovascular diseases. Traffic 2:675-83. Burke, B., and C.L. Stewart. 2002. Life at the edge: the nuclear envelope and human disease. Nat Rev Mol Cell Biol 3:575-85. Cai, M., Y. Huang, R. Ghirlando, K.L. Wilson, R. Craigie, and G.M. Clore. 2001. Solution structure of the constant region of nuclear envelope protein LA P2 reveals two LEMdomain structures: one binds BAF and the other binds DNA. Embo J 20:4399-407. Callan, H.G., and S.G. Tomlin. 1950. Experimental studies on amphibian oocyte nuclei. I. Investigation of the struct ure of the nuclear membrane by means of the electron microscope. Proc R Soc Lond B Biol Sci 137:367-78. Cao, H., and R. Hegele. 2000. Nuclear lamin A/C R482Q mutation in cana dian kindreds with Dunnigan-type familial partial lipodystrophy. Hum Mol Genet 9 109-12. Cao, H., and R.A. Hegele. 2003. LMNA is muta ted in Hutchinson-Gilford progeria (MIM 176670) but not in Wiedemann-Rautenstra uch progeroid syndrome (MIM 264090). J Hum Genet 48:271-4. Cao, K., B.C. Capell, M.R. Erdos, K. Djabali, and F.S. Collins. 2007. A lamin A protein isoform overexpressed in Hutchinson-Gilford progeria s yndrome interferes with mitosis in progeria and normal cells. Proc Natl Acad Sci U S A 104:4949-54.

PAGE 107

107 Capanni, C., E. Mattioli, M. Columbaro, E. Lucarel li, V.K. Parnaik, G. Novelli, M. Wehnert, V. Cenni, N.M. Maraldi, S. Squarzoni, and G. Lattanzi. 2005. Altered pre-lamin A processing is a common mechanism leading to lipodystrophy. Hum Mol Genet 14:1489-502. Capell, B.C., and F.S. Collins. 2006. Human laminopathies: nuclei gone genetically awry. Nat Rev Genet. 7:940-52. Capell, B.C., M.R. Erdos, J.P. Madigan, J.J. Fi ordalisi, R. Varga, K.N. Conneely, L.B. Gordon, C.J. Der, A.D. Cox, and F.S. Collins. 2005. Inhibiting farnesylation of progerin prevents the characteristic nuclear blebbing of Hutchinson-Gilford progeria syndrome. Proc Natl Acad Sci U S A 102:12879-84. Caron, M., M. Auclair, B. Donadille, V. Berezi at, B. Guerci, M. Laville, H. Narbonne, C. Bodemer, O. Lascols, J. Capeau, and C. Vigouroux. 2007. Human lipodystrophies linked to mutations in A-type lamins and to HIV pr otease inhibitor therapy are both associated with prelamin A accumulation, oxidative st ress and premature cellular senescence. Cell Death Differ 14:1759-67. Caron, M., M. Auclair, H. Sterlingot, M. Kornprobst, and J. Capeau. 2003. Some HIV protease inhibitors alter lamin A/C maturation and stability, SREBP-1 nucle ar localization and adipocyte differentiation. Aids. 17:2437-44. Casolari, J.M., C.R. Brown, S. Komili, J. West H. Hieronymus, and P.A. Silver. 2004. Genomewide localization of the nucle ar transport machinery couples transcriptiona l status and nuclear organization. Cell 117:427-39. Chen, L., L. Lee, B.A. Kudlow, H.G. Dos Santos, O. Sletvold, Y. Shafeghati, E.G. Botha, A. Garg, N.B. Hanson, G.M. Martin, I.S. Mi an, B.K. Kennedy, and J. Oshima. 2003. LMNA mutations in atypical Werner's syndrome. Lancet 362:440-5. Chi, Y.H., K. Haller, J.M. Peloponese, Jr., a nd K.T. Jeang. 2007. Histone acetyltransferase hALP and nuclear membrane protein hsSUN1 function in de-condensation of mitotic chromosomes. J Biol Chem 282:27447-58. Clarke, S.G. 2007. HIV protease inhibitors and nucl ear lamin processing: getting the right bells and whistles. Proc Natl Acad Sci U S A 104:13857-8. Clements, L., S. Manilal, D.R. Love, and G.E. Morris. 2000. Direct inte raction between emerin and lamin A. Biochem Biophys Res Commun 267:709-14. Coffinier, C., S.E. Hudon, E.A. Farber, S.Y. Chang, C.A. Hrycyna, S.G. Young, and L.G. Fong. 2007. HIV protease inhibitors block the zinc me talloproteinase ZMPSTE24 and lead to an accumulation of prelamin A in cells. Proc Natl Acad Sci U S A 104:13432-7. Corrigan, D.P., D. Kuszczak, A.E. Rusinol, D.P. Th ewke, C.A. Hrycyna, S. Michaelis, and M.S. Sinensky. 2005. Prelamin A endoproteolytic pr ocessing in vitro by recombinant Zmpste24. Biochem J 387:129-38.

PAGE 108

108 Cremer, M., K. Kupper, B. Wagler, L. Wizelman, J. von Hase, Y. Weiland, L. Kreja, J. Diebold, M.R. Speicher, and T. Cremer. 2003. Inherita nce of gene density-related higher order chromatin arrangements in normal and tumor cell nuclei. J Cell Biol. 162:809-20. Crisp, M., Q. Liu, K. Roux, J.B. Rattner, C. Shanahan, B. Burke, P.D. Stahl, and D. Hodzic. 2006. Coupling of the nucleus and cytopl asm: role of the LINC complex. J Cell Biol 172:41-53. Croft, J.A., J.M. Bridger, S. Boyle, P. Perry, P. Teague, and W.A. Bickmore. 1999. Differences in the localization and morphology of chromosomes in the human nucleus. J Cell Biol 145:1119-31. Cronshaw, J.M., A.N. Krutchinsky, W. Zhang, B. T. Chait, and M.J. Matunis. 2002. Proteomic analysis of the mammalian nuclear pore complex. J Cell Biol 158:915-27. Daigle, N., J. Beaudouin, L. Hartnell, G. Imreh, E. Hallberg, J. Lippincott-Schwartz, and J. Ellenberg. 2001. Nuclear pore complexes form immobile networks and have a very low turnover in live mammalian cells. J Cell Biol 154:71-84. De Sandre-Giovannoli, A., R. Bernard, P. Cau, C. Navarro, J. Amiel, I. Boccaccio, S. Lyonnet, C.L. Stewart, A. Munnich, M. Le Merre r, and N. Levy. 2003. Lamin a truncation in Hutchinson-Gilford progeria. Science 300:2055. De Sandre-Giovannoli, A., M. Chaouch, S. Kozlov, J.M. Vallat, M. Tazir, N. Kassouri, P. Szepetowski, T. Hammadouche, A. Vandenberghe, C.L. Stewart, D. Grid, and N. Levy. 2002. Homozygous defects in LMNA, encoding lamin A/C nuclear-envelope proteins, cause autosomal recessive axonal neuropathy in human (Charcot-Marie-Tooth disorder type 2) and mouse. Am J Hum Genet 70:726-36. DeBusk, F.L. 1972. The Hutchinson-Gilford progeria syndrome. Report of 4 cases and review of the literature. J Pediatr 80:697-724. Dechat, T., T. Shimi, S.A. Adam, A.E. Rusinol D.A. Andres, H.P. Spielmann, M.S. Sinensky, and R.D. Goldman. 2007. Alterations in mitosis and cell cycle progression caused by a mutant lamin A known to accelerate human aging. Proc Natl Acad Sci U S A 104:495560. Delbarre, E., M. Tramier, M. Coppey-Moisan, C. Gaillard, J.C. Courvalin, and B. Buendia. 2006. The truncated prelamin A in Hutchinson-Gilf ord progeria syndrome alters segregation of A-type and B-type lamin homopolymers. Hum Mol Genet 15:1113-22. Dessev, G.N., C. Iovcheva-Dessev, and R.D. Goldman. 1990. Lamin dimers. Presence in the nuclear lamina of surf clam oocytes a nd release during nuclear envelope breakdown. J Biol Chem 265:12636-41. Dhe-Paganon, S., E.D. Werner, Y.I. Chi, and S. E. Shoelson. 2002. Structure of the globular tail of nuclear lamin. J Biol Chem 277:17381-4.

PAGE 109

109 Ding, X., R. Xu, J. Yu, T. Xu, Y. Zhuang, a nd M. Han. 2007. SUN1 is required for telomere attachment to nuclear envelope and gametogenesis in mice. Dev Cell 12:863-72. Djinovic-Carugo, K., M. Gautel, J. Ylanne, and P. Young. 2002. The spectrin repeat: a structural platform for cytoskelet al protein assemblies. FEBS Lett 513:119-23. Dorner, D., S. Vlcek, N. Foeger, A. Gajewski, C. Makolm, J. Gotzmann, C.J. Hutchison, and R. Foisner. 2006. Lamina-associated polypeptide 2alpha regulates cell cycle progression and differentiation via the re tinoblastoma-E2F pathway. J Cell Biol 173:83-93. Dundr, M., U. Hoffmann-Rohrer, Q. Hu, I. Grummt, L.I. Rothblum, R.D. Phair, and T. Misteli. 2002. A kinetic framework for a mammalian RNA polymerase in vivo. Science 298:16236. Dunnigan, M.G., M.A. Cochrane, A. Kelly, and J. W. Scott. 1974. Familial lipoatrophic diabetes with dominant transmission. A new syndrome. Q J Med 43:33-48. Dworetzky, S.I., R.E. Lanford, and C.M. Feldherr. 1988. The effects of vari ations in the number and sequence of of targeti ng signals on nuclear uptake. J. Cell Biol. 107:1279-1287. Dwyer, N., and G. Blobel. 1976. A modified pro cedure for the isolation of a pore complex lamina fraction from rat liver nuclei. J. Cell Biol. 70:581-591. Ellenberg, J., and J. Lippincott-Schwartz. 1999. Dynamics and mobility of nuclear envelope proteins in interphase and m itotic cells revealed by green fluorescent protein chimeras. Methods. 19:362-72. Ellenberg, J., E.D. Siggia, J.E. Moreira, C. L. Smith, J.F. Presley, H.J. Worman, and J. Lippincott-Schwartz. 1997. Nuclear membrane dynamics and reassembly in living cells: targeting of an inner Nucl ear membrane protein in interphase and mitosis. J. Cell Biol. 138:1193-1206. Emery, A.E. 1987. X-linked muscular dystrophy with early contractures and cardiomyopathy (Emery-Dreifuss type). Clin Genet 32:360-7. Eriksson, M., W.T. Brown, L.B. Gordon, M.W. Glynn, J. Singer, L. Scott, M.R. Erdos, C.M. Robbins, T.Y. Moses, P. Berglund, A. Dutra, E. Pak, S. Durkin, A.B. Csoka, M. Boehnke, T.W. Glover, and F.S. Collins. 2003. Recurrent de novo point mutations in lamin A cause Hutchinson-Gilford pr ogeria syndrome. Nature. 423:293-8. Fatkin, D., C. MacRae, T. Sasaki, M.R. Wolff, M. Porcu, M. Frenneaux, J. Atherton, H.J. Vidaillet, Jr., S. Spudich, U. De Girolami J.G. Seidman, C. Seidman, F. Muntoni, G. Muehle, W. Johnson, and B. McDonough. 1999. Misse nse mutations in the rod domain of the lamin A/C gene as causes of dilated cardiomyopathy and conduction-system disease. N Engl J Med 341:1715-24. Feldherr, C., E. Kallenbach, and N. Schultz. 1984. Movement of a karyophilic protein through the nuclear pores of oocytes. J. Cell Biol. 99:2216-2222.

PAGE 110

110 Fischer, J.A., S. Acosta, A. Kenny, C. Cater, C. Robinson, and J. Hook. 2004. Drosophila klarsicht has distinct subcellular localiz ation domains for nuclear envelope and microtubule localiza tion in the eye. Genetics 168:1385-93. Fischer-Vize, J.A., and K.L. Mosley. 1994. Marb les mutants: uncoupling cell determination and nuclear migration in the developing Drosophila eye. Development 120:2609-18. Fisher, D.Z., N. Chaudhary, and G. Blobel. 1986. cDNA sequencing of nuclear lamins A and C reveals primary and secondary structural homology to intermediate filament proteins. Proc. Natl. Acad. Sci. USA 83:6450-6454. Flemington, E.K., S.H. Speck, and W.G. Kaeli n, Jr. 1993. E2F-1-mediated transactivation is inhibited by complex formation with the re tinoblastoma susceptibility gene product. Proc Natl Acad Sci U S A 90:6914-8. Fong, L.G., J.K. Ng, J. Lammerding, T.A. Vickers, M. Meta, N. Cote, B. Gavino, X. Qiao, S.Y. Chang, S.R. Young, S.H. Yang, C.L. Stewart, R.T. Lee, C.F. Bennett, M.O. Bergo, and S.G. Young. 2006. Prelamin A and lamin A appear to be dispensable in the nuclear lamina. J Clin Invest 116:743-52. Fong, L.G., J.K. Ng, M. Meta, N. Cote, S.H. Yang, C.L. Stewart, T. Sullivan, A. Burghardt, S. Majumdar, K. Reue, M.O. Bergo, and S. G. Young. 2004. Heterozygosity for Lmna deficiency eliminates the progeria-like phenotypes in Zmpste24-deficient mice. Proc Natl Acad Sci U S A 101:18111-6. Fridkin, A., E. Mills, A. Margalit, E. Neufeld, K.K. Lee, N. Feinstein, M. Cohen, K.L. Wilson, and Y. Gruenbaum. 2004. Matefin, a Caenor habditis elegans germ line-specific SUNdomain nuclear membrane protein, is essential for early embryonic and germ cell development. Proc Natl Acad Sci U S A 101:6987-92. Fried, H., and U. Kutay. 2003. Nucleocytoplasmic transport: taking an inventory. Cell Mol Life Sci 60:1659-88. Fukuchi, K., T. Katsuya, K. Sugimoto, M. Kure mura, H.D. Kim, L. Li, and T. Ogihara. 2004. LMNA mutation in a 45 year old Japanese subject with Hutchi nson-Gilford progeria syndrome. J Med Genet 41:e67. Galderisi, U., M. Cipollaro, and A. Giordano. 2006. The retinoblastoma gene is involved in multiple aspects of stem cell biology. Oncogene 25:5250-6. Gerace, L., and G. Blobel. 1980. The nuclear enve lope lamina is reversibly depolymerized during mitosis. Cell 19:277-87. Gerace, L., A. Blum, and G. Blobel. 1978. Im munocytochemical localization of the major polypeptides of the nuclear complex-lamina fraction: interphase and mitotic distribution. J. Cell Biol. 79:546-566.

PAGE 111

111 Gerace, L., and B. Burke. 1988. Functional organization of the nuclear envelope. Annu Rev Cell Biol 4:335-74. Gerace, L., C. Comeau, and M. Benson. 1984. Orga nization and modulation of nuclear lamina structure. J. Cell Sci. Suppl. 1:137-160. Glass, C.A., J.R. Glass, H. Ta niura, K.W. Hasel, J.M. Blevit t, and L. Gerace. 1993. The alphahelical rod domain of human lamins A and C contains a chromatin binding site. Embo J 12:4413-24. Glynn, M.W., and T.W. Glover. 2005. Incomplete pr ocessing of mutant la min A in HutchinsonGilford progeria leads to nuclear abnormalitie s, which are reversed by farnesyltransferase inhibition. Hum Mol Genet 14:2959-69. Goldman, A.E., R.D. Moir, M. Montag-Lowy, M. Stewart, and R.D. Go ldman. 1992. Pathway of incorporation of microi njected lamin A into the nuclear envelope. J Cell Biol 119:725-35. Goldman, R., A. Goldman, K. Green, J. Jones, N. Lieska, and H.Y. Yang. 1985. Intermediate filaments: possible functions as cytoskeletal connecting links between the nucleus and the cell surface. Ann N Y Acad Sci 455:1-17. Goldman, R.D., Y. Gruenbaum, R.D. Moir, D. K. Shumaker, and T.P. Spann. 2002. Nuclear lamins: building blocks of nuclear architecture. Genes Dev. 16:533-47. Goldman, R.D., D.K. Shumaker, M.R. Erdos, M. Eriksson, A.E. Goldman, L.B. Gordon, Y. Gruenbaum, S. Khuon, M. Mendez, R. Varga, and F.S. Collins. 2004. Accumulation of mutant lamin A causes progressive changes in nuclear architecture in Hutchinson-Gilford progeria syndrome. Proc Natl Acad Sci U S A 101:8963-8. Grady, R.M., D.A. Starr, G.L. Ackerman, J.R. Sanes, and M. Han. 2005. Syne proteins anchor muscle nuclei at the neuromuscular junction. Proc Natl Acad Sci U S A 102:4359-64. Gruenbaum, Y., A. Margalit, R.D. Goldman, D.K. Shumaker, and K.L. Wilson. 2005. The nuclear lamina comes of age. Nat Rev Mol Cell Biol 6:21-31. Gruenbaum, Y., K.L. Wilson, A. Harel, M. Goldberg, and M. Cohen. 2000. Review: nuclear lamins--structural proteins with fundamental functions. J Struct Biol 129:313-23. Grum, V.L., D. Li, R.I. MacDonald, and A. Mondragon. 1999. Structures of two repeats of spectrin suggest models of flexibility. Cell 98:523-35. Hagan, I., and M. Yanagida. 1995. The product of th e spindle formation gene sad1+ associates with the fission yeast spindle pole body and is essential for viability. J Cell Biol 129:103347. Hancock, J.F., A.I. Magee, J.E. Childs, and C.J. Marshall. 1989. All ras proteins are polyisoprenylated but only some are palmitoylated. Cell 57:1167-1177.

PAGE 112

112 Handwerger, K.E., and J.G. Gall. 2006. Subnuclear organelles: new insights into form and function. Trends Cell Biol. 16:19-26. Haque, F., D.J. Lloyd, D.T. Smallwood, C.L. Dent C.M. Shanahan, A.M. Fry, R.C. Trembath, and S. Shackleton. 2006. SUN1 interacts with nu clear lamin A and cytoplasmic nesprins to provide a physical connection between th e nuclear lamina and the cytoskeleton. Mol Cell Biol 26:3738-51. Harborth, J., S.M. Elbashir, K. Bechert, T. Tuschl, and K. Weber. 2001. Identification of essential genes in cultured mammalian cells using small interfering RNAs. J Cell Sci. 114:4557-65. Hartmann, J.F. 1953. An electron optical study of sections of central nervous system. J Comp Neurol 99:201-49. Hasan, S., S. Guttinger, P. Muhlhausser, F. Anderegg, S. Burgler, and U. Kutay. 2006. Nuclear envelope localization of human UNC84A does not require nuclear lamins. FEBS Lett 580:1263-8. Heitlinger, E., M. Peter, M. Hner, A. Lus tig, U. Aebi, and E.A. Nigg. 1991. Expression of chicken lamin B2 in Eschericia coli: charac terization of its stru cture, assembly and molecular interactions. J. Cell Biol. 113:485-495. Heitlinger, E., M. Peter, A. Lustig, W. Villig er, E.A. Nigg, and U. Aebi. 1992. The role of the head and tail domain in lamin structure and assembly: analysis of bacterially expressed chicken lamin A and truncated B2 lamins. J Struct Biol 108:74-89. Hinshaw, J.E., B.O. Carragher, and R.A. Milligan. 1992. Architecture and design of the nuclear pore complex. Cell 69:1133-1141. Hodzic, D.M., D.B. Yeater, L. Bengtsson, H. Otto, and P.D. Stahl. 2004. Sun2 is a novel mammalian inner nuclear membrane protein. J Biol Chem 279:25805-12. Holaska, J.M., K.K. Lee, A.K. Kowalski, and K.L. Wilson. 2003. Transcriptional repressor germ cell-less (GCL) and barrier to autointegration factor (BAF) compete for binding to emerin in vitro. J Biol Chem 278:6969-75. Huang, S., L. Chen, N. Libina, J. Janes, G. M. Martin, J. Campisi, and J. Oshima. 2005. Correction of cellular phenotypes of Hu tchinson-Gilford Progeria cells by RNA interference. Hum Genet 118:444-50. Jagatheesan, G., S. Thanumalayan, B. Muralikrishna, N. Rangaraj, A.A. Karande, and V.K. Parnaik. 1999. Colocalization of intranuclear lamin foci with RNA splicing factors. J Cell Sci 112 ( Pt 24):4651-61. Janicki, S.M., and D.L. Spector. 2003. Nuclear ch oreography: interpretations from living cells. Curr Opin Cell Biol. 15:149-57.

PAGE 113

113 Jarnik, M., and U. Aebi. 1991. Toward a more co mplete 3-D structure of the nuclear pore complex. J. Struct. Biol. 107:291-308. Johnson, B.R., R.T. Nitta, R.L. Frock, L. Mounkes, D.A. Barbie, C.L. Stewart, E. Harlow, and B.K. Kennedy. 2004. A-type lamins regulate re tinoblastoma protein function by promoting subnuclear localization and preven ting proteasomal degradation. Proc Natl Acad Sci U S A 101:9677-82. Kalderon, D., B.L. Roberts, W.D. Richar dson, and A.E. Smith. 1984. A short amino acid sequence able to speci fy nuclear location. Cell 39:499-509. Keller, R.K., and S.J. Fliesler. 1999. M echanism of aminobisphosphonate action: characterization of alendronate in hibition of the isoprenoid pathway. Biochem Biophys Res Commun 266:560-3. King, M.C., C.P. Lusk, and G. Blobel. 2006. Kar yopherin-mediated import of integral inner nuclear membrane proteins. Nature 442:1003-7. Kirschner, J., T. Brune, M. Wehnert, J. Denecke, C. Wasner, A. Feuer, T. Marquardt, U.P. Ketelsen, P. Wieacker, C.G. Bonnemann, a nd R. Korinthenberg. 2005. p.S143F mutation in lamin A/C: a new phenotype co mbining myopathy and progeria. Ann Neurol 57:148-51. Kitten, G.T., and E.A. Nigg. 1991. The CaaX mo tif is required for isoprenylation, carboxy methylation and nuclear membra ne association of lamin B2. J. Cell Biol. 113:13-24. Kobberling, J., B. Willms, R. Kattermann, a nd W. Creutzfeldt. 1975. Lipodystrophy of the extremities. A dominantly inherited syndrom e associated with lipatrophic diabetes. Humangenetik 29:111-20. Kumagai, H., Y. Kawamura, K. Yanagisawa, and H. Komano. 1999. Identification of a human cDNA encoding a novel protein structurally re lated to the yeast membrane-associated metalloprotease, Ste24p. Biochim Biophys Acta 1426:468-74. Kumaran, R.I., B. Muralikrishna, and V.K. Parnaik. 2002. Lamin A/C speckles mediate spatial organization of splicing factor compartm ents and RNA polymer ase II transcription. J Cell Biol 159:783-93. Lammerding, J., L.G. Fong, J.Y. Ji, K. Reue, C. L. Stewart, S.G. Young, and R.T. Lee. 2006. Lamins A and C but not lamin B1 regulate nuclear mechanics. J Biol Chem 281:25768-80. Lammerding, J., J. Hsiao, P.C. Schulze, S. Kozlov, C.L. Stewart, and R.T. Lee. 2005. Abnormal nuclear shape and impaired mechanotra nsduction in emerin-deficient cells. J Cell Biol 170:781-91. Lammerding, J., R.D. Kamm, and R.T. Lee. 2004a. Mechanotransduction in cardiac myocytes. Ann N Y Acad Sci 1015:53-70.

PAGE 114

114 Lammerding, J., P.C. Schulze, T. Takahashi, S. Kozlov, T. Sullivan, R.D. Kamm, C.L. Stewart, and R.T. Lee. 2004b. Lamin A/C deficiency causes defective nuclear mechanics and mechanotransduction. J Clin Invest 113:370-8. Lans, H., and J.H. Hoeijmakers. 2006. Cell bi ology: ageing nucleus gets out of shape. Nature. 440:32-4. Lazebnik, Y.A., A. Takahashi, R.D. Moir, R.D. Goldman, G.G. Poirier, S.H. Kaufmann, and W.C. Earnshaw. 1995. Studies of the lamin protei nase reveal multiple parallel biochemical pathways during apoptotic execution. Proc Natl Acad Sci U S A 92:9042-6. Lee, K.K., D. Starr, M. Cohen, J. Liu, M. Han, K.L. Wilson, and Y. Gruenbaum. 2002. Lamindependent localization of UNC-84, a protein required for nuclear migration in Caenorhabditis elegans. Mol Biol Cell 13:892-901. Lee, S.H., and J. Hurwitz. 1990. Mechanism of elongation of primed DNA by DNA polymerase delta, proliferating cell nucl ear antigen, and activator 1. Proc Natl Acad Sci U S A. 87:5672-6. Lenne, P.F., A.J. Raae, S.M. Altmann, M. Saraste, and J.K. Horber. 2000. States and transitions during forced unfolding of a single spectrin repeat. FEBS Lett 476:124-8. Leung, C.L., K.J. Green, and R.K. Liem. 2002. Plakins: a family of versatil e cytolinker proteins. Trends Cell Biol. 12:37-45. Leung, G.K., W.K. Schmidt, M.O. Bergo, B. Gavino, D.H. Wong, A. Tam, M.N. Ashby, S. Michaelis, and S.G. Young. 2001. Biochemical studies of Zmpste24-deficient mice. J Biol Chem 276:29051-8. Lin, F., J.M. Morrison, W. Wu, and H.J. Worma n. 2005. MAN1, an integral protein of the inner nuclear membrane, binds Smad2 and Smad3 and antagonizes transforming growth factorbeta signaling. Hum Mol Genet 14:437-45. Lin, F., and H.J. Worman. 1993. Structural orga nization of the human gene encoding nuclear lamin A and nuclear lamin C. J Biol Chem 268:16321-6. Liu, B., J. Wang, K.M. Chan, W.M. Tjia, W. De ng, X. Guan, J.D. Huang, K.M. Li, P.Y. Chau, D.J. Chen, D. Pei, A.M. Pendas, J. Cadinanos C. Lopez-Otin, H.F. Tse, C. Hutchison, J. Chen, Y. Cao, K.S. Cheah, K. Tryggvason, and Z. Zhou. 2005. Genomic instability in laminopathy-based premature aging. Nat Med 11:780-5. Liu, J., K.K. Lee, M. Segura-Totten, E. Neuf eld, K.L. Wilson, and Y. Gruenbaum. 2003. MAN1 and emerin have overlapping function(s) esse ntial for chromosome segregation and cell division in Caenorhabditis elegans. Proc Natl Acad Sci U S A 100:4598-603.

PAGE 115

115 Liu, J., T. Rolef Ben-Shahar, D. Riemer, M. Tr einin, P. Spann, K. Weber, A. Fire, and Y. Gruenbaum. 2000. Essential roles for Caenorhabditis elegans lamin gene in nuclear organization, cell cycle progression, and spatia l organization of nuclear pore complexes. Mol Biol Cell 11:3937-47. Liu, Y., A. Rusinol, M. Sine nsky, Y. Wang, and Y. Zou. 2006. DNA damage responses in progeroid syndromes arise from def ective maturation of prelamin A. J Cell Sci 119:46449. Liu, Y., Y. Wang, A.E. Rusinol, M.S. Sinens ky, J. Liu, S.M. Shell, and Y. Zou. 2008. Involvement of xeroderma pigmentosum group A (XPA) in progeria aris ing from defective maturation of prelamin A. Faseb J 22:603-11. Loewinger, L., and F. McKeon. 1988. Mutations in the nuclear lamin proteins resulting intheir aberrant assembly in the cytoplasm. EMBOJ 7:2301-2309. Lutz, R.J., M.A. Trujillo, K.S. Denham, L. Wenger, and M. Sinensky. 1992. Nucleoplasmic localization of prelamin A: im plications for prenylation-depe ndent lamin A assembly into the nuclear lamina. Proc Natl Acad Sci U S A 89:3000-4. Maeshima, K., K. Yahata, Y. Sasaki, R. Nakatomi, T. Tachibana, T. Hashikawa, F. Imamoto, and N. Imamoto. 2006. Cell-cycle-dependent dyna mics of nuclear pores: pore-free islands and lamins. J Cell Sci 119:4442-51. Makatsori, D., N. Kourmouli, H. Polioudaki, L.D. Shultz, K. McLean, P.A. Theodoropoulos, P.B. Singh, and S.D. Georgatos. 2004. The inner nuclear membrane protein lamin B receptor forms distinct microdomains and links epigenetically marked chromatin to the nuclear envelope. J Biol Chem 279:25567-73. Mallampalli, M.P., G. Huyer, P. Bendale, M.H. Gelb, and S. Michaelis. 2005. Inhibiting farnesylation reverses the nuclear morphology defect in a HeLa cell model for HutchinsonGilford progeria syndrome. Proc Natl Acad Sci U S A 102:14416-21. Malone, C.J., W.D. Fixsen, H.R. Horvitz, a nd M. Han. 1999. UNC-84 localizes to the nuclear envelope and is required for nuclear mi gration and anchoring during C. elegans development. Development 126:3171-81. Malone, C.J., L. Misner, N. Le Bot, M.C. Tsai J.M. Campbell, J. Ahringer, and J.G. White. 2003. The C. elegans hook protein, ZYG-12, mediates the essential attachment between the centrosome and nucleus. Cell 115:825-36. Manju, K., B. Muralikrishna, and V.K. Parnai k. 2006. Expression of dise ase-causing lamin A mutants impairs the formation of DNA repair foci. J Cell Sci 119:2704-14. Mansfeld, J., S. Guttinger, L.A. Hawryluk-Gara, N. Pante, M. Ma ll, V. Galy, U. Haselmann, P. Muhlhausser, R.W. Wozniak, I.W. Matt aj, U. Kutay, and W. Antonin. 2006. The conserved transmembrane nucleoporin NDC1 is required for nuclear pore complex assembly in vertebrate cells. Mol Cell. 22:93-103.

PAGE 116

116 Mansharamani, M., and K.L. Wilson. 2005. Direct binding of nuclear membrane protein MAN1 to emerin in vitro and two modes of bi nding to barrier-to-autointegration factor. J Biol Chem 280:13863-70. Maraldi, N.M., G. Lattanzi, C. Capanni, M. Colu mbaro, E. Mattioli, P. Sabatelli, S. Squarzoni, and F.A. Manzoli. 2006. Laminopathies: a chromatin affair. Adv Enzyme Regul. 46:33-49. Mattout-Drubezki, A., and Y. Gruenbaum. 2003. Dynamic interactions of nuclear lamina proteins with chromatin and transcriptional machinery. Cell Mol Life Sci 60:2053-63. Maul, G. 1977. Nuclear pore complexes: elimin ation and reconstruction during mitosis. J. Cell Biol. 74:492-500. Maul, G.G., J.W. Price, and M.W. Lieberman. 1971. Formation and distribution of nuclear pore complexes in interphase. J. Cell Biol. 51:405-418. McGee, M.D., R. Rillo, A.S. Anderson, and D.A. Starr. 2006. UNC-83 IS a KASH protein required for nuclear migration a nd is recruited to the outer nuclear membrane by a physical interaction with the SUN protein UNC-84. Mol Biol Cell 17:1790-801. McKeon, F.D., M.W. Kirschner, and D. Caput. 1986. Homologies in both primary and secondary structure between nuclear envelope a nd intermediate filament proteins. Nature. 319:463468. Melcon, G., S. Kozlov, D.A. Cutler, T. Sullivan, L. Hernandez, P. Zhao, S. Mitchell, G. Nader, M. Bakay, J.N. Rottman, E.P. Hoffman, and C.L. Stewart. 2006. Loss of emerin at the nuclear envelope disrupts the Rb1/E2F and MyoD pathways during muscle regeneration. Hum Mol Genet 15:637-51. Mislow, J.M., J.M. Holaska, M.S. Kim, K.K. Lee, M. Segura-Totten, K.L. Wilson, and E.M. McNally. 2002a. Nesprin-1alpha self-associates and binds directly to emerin and lamin A in vitro. FEBS Lett 525:135-40. Mislow, J.M., M.S. Kim, D.B. Davis, and E.M. McNally. 2002b. Myne-1, a spectrin repeat transmembrane protein of the myocyte inner nu clear membrane, interacts with lamin A/C. J Cell Sci 115:61-70. Mosley-Bishop, K.L., Q. Li, L. Patterson, and J. A. Fischer. 1999. Molecu lar analysis of the klarsicht gene and its role in nuclear migration within differentiating cells of the Drosophila eye. Curr Biol 9:1211-20. Mounkes, L., S. Kozlov, B. Burke, and C.L. St ewart. 2003. The laminopathies: nuclear structure meets disease. Curr Opin Genet Dev 13:223-30. Mounkes, L.C., B. Burke, and C.L. Stewart. 2001. The A-type lamins: nuclear structural proteins as a focus for muscular dystrophy and cardiovascular diseases. Trends Cardiovasc Med 11:280-5.

PAGE 117

117 Muchir, A., G. Bonne, A.J. van der Kooi, M. van Meegen, F. Baas, P.A. Bolhuis, M. de Visser, and K. Schwartz. 2000. Identification of muta tions in the gene encoding lamins A/C in autosomal dominant limb girdle muscular dystrophy with atri oventricular conduction disturbances (LGMD1B). Hum Mol Genet 9:1453-9. Muchir, A., and H.J. Worman. 2004. The nuc lear envelope and human disease. Physiology (Bethesda) 19:309-14. Navarro, C.L., J. Cadinanos, A. De Sandre-Giovanno li, R. Bernard, S. Courrier, I. Boccaccio, A. Boyer, W.J. Kleijer, A. Wagner, F. Giulia no, F.A. Beemer, J.M. Freije, P. Cau, R.C. Hennekam, C. Lopez-Otin, C. Badens, a nd N. Levy. 2005. Loss of ZMPSTE24 (FACE-1) causes autosomal recessive restrictive dermopathy and accumulation of Lamin A precursors. Hum Mol Genet 14:1503-13. Navarro, C.L., A. De Sandre-Giovannoli, R. Bern ard, I. Boccaccio, A. Boyer, D. Genevieve, S. Hadj-Rabia, C. Gaudy-Marqueste, H.S. Smitt, P. Vabres, L. Faivre, A. Verloes, T. Van Essen, E. Flori, R. Hennekam, F.A. Beemer, N. Laurent, M. Le Merrer, P. Cau, and N. Levy. 2004. Lamin A and ZMPSTE24 (FACE-1) def ects cause nuclear disorganization and identify restrictive dermopathy as a lethal neonatal laminopathy. Hum Mol Genet 13:2493503. Neri, L.M., Y. Raymond, A. Giordano, S. Capitani and A.M. Martelli. 1999. Lamin A is part of the internal nucleoskeleton of human erythroleukemia cells. J Cell Physiol 178:284-95. Newport, J.W., and D.J. Forbes. 1987. The nucleus: structure, function, and dynamics. Annu Rev Biochem 56:535-65. Nigg, E.A. 1989. The nuclear envelope. Curr Opin Cell Biol. 1:435-40. Nitta, R.T., S.A. Jameson, B.A. Kudlow, L.A. Conlan, and B.K. Kennedy. 2006. Stabilization of the retinoblastoma protein by Atype nuclear lamins is requ ired for INK4A-mediated cell cycle arrest. Mol Cell Biol 26:5360-72. Novelli, G., A. Muchir, F. Sangiuolo, A. Helblin g-Leclerc, M.R. D'Apice, C. Massart, F. Capon, P. Sbraccia, M. Federici, R. Lauro, C. Tudisco, R. Pallotta, G. Scarano, B. Dallapiccola, L. Merlini, and G. Bonne. 2002. Mandibuloacral dysplasia is caused by a mutation in LMNAencoding lamin A/C. Am J Hum Genet 71:426-31. Ohba, T., E.C. Schirmer, T. Nishimoto, a nd L. Gerace. 2004. Energyand temperaturedependent transport of integral proteins to the inner nuclear membrane via the nuclear pore. J Cell Biol. 167:1051-62. Ostlund, C., J. Ellenberg, E. Hallberg, J. Lippincott-Schwartz, and H.J. Worman. 1999. Intracellular trafficking of emerin, the Emery-Dreifuss muscular dystrophy protein. J Cell Sci 112 ( Pt 11):1709-19.

PAGE 118

118 Ostlund, C., T. Sullivan, C.L. Stewart, and H. J. Worman. 2006. Dependence of diffusional mobility of integral inner nuclear membrane proteins on A-type lamins. Biochemistry 45:1374-82. Ostlund, C., and H.J. Worman. 2003. Nuclear envel ope proteins and neuromuscular diseases. Muscle Nerve 27:393-406. Padmakumar, V.C., S. Abraham, S. Braune, A.A. Noegel, B. Tunggal, I. Karakesisoglou, and E. Korenbaum. 2004. Enaptin, a giant actin-binding protein, is an element of the nuclear membrane and the actin cytoskeleton. Exp Cell Res 295:330-9. Padmakumar, V.C., T. Libotte, W. Lu, H. Zaim, S. Abraham, A.A. Noegel, J. Gotzmann, R. Foisner, and I. Karakesisoglou. 2005. The inne r nuclear membrane protein Sun1 mediates the anchorage of Nesprin-2 to the nuclear envelope. J Cell Sci 118:3419-30. Pante, N., R. Bastos, I. McMorrow, B. Burk e, and U. Aebi. 1994. Interactions and threedimensional localization of a group of nuclear pore complex proteins. J Cell Biol 126:60317. Paradisi, M., D. McClintock, R.L. Boguslavsky, C. Pedicelli, H.J. Worman, and K. Djabali. 2005. Dermal fibroblasts in Hutchinson-Gilf ord progeria syndrome with the lamin A G608G mutation have dysmorphic nuclei a nd are hypersensitive to heat stress. BMC Cell Biol 6:27. Patterson, K., A.B. Molofsky, C. Robinson, S. Acosta, C. Cater, and J.A. Fischer. 2004. The functions of Klarsicht and nucle ar lamin in developmentally regulated nuclear migrations of photoreceptor cells in the Drosophila eye. Mol Biol Cell 15:600-10. Pemberton, T.J., and J.E. Kay. 2005. The cyclop hilin repertoire of the fission yeast Schizosaccharomyces pombe. Yeast 22:927-45. Phair, R.D., P. Scaffidi, C. Elbi, J. Vecerova, A. Dey, K. Ozato, D.T. Brown, G. Hager, M. Bustin, and T. Misteli. 2004. Global nature of dynamic protein-chroma tin interactions in vivo: three-dimensional genome scanning and dynamic interaction networks of chromatin proteins. Mol Cell Biol 24:6393-402. Pickersgill, H., B. Kalverda, E. de Wit, W. Talhout, M. Fornerod, and B. van Steensel. 2006. Characterization of the Drosophila mela nogaster genome at the nuclear lamina. Nat Genet 38:1005-14. Piercy, R.J., H. Zhou, L. Feng, A. Pombo, F. Muntoni, and S.C. Brown. 2007. Desmin immunolocalisation in autosomal domin ant Emery-Dreifuss muscular dystrophy. Neuromuscul Disord 17:297-305. Plasilova, M., C. Chattopadhyay, P. Pal, N.A. Sc haub, S.A. Buechner, H. Mueller, P. Miny, A. Ghosh, and K. Heinimann. 2004. Homozygous mi ssense mutation in the lamin A/C gene causes autosomal recessive Hutchinson-Gilford progeria syndrome. J Med Genet 41:60914.

PAGE 119

119 Polioudaki, H., N. Kourmouli, V. Drosou, A. Bakou, P.A. Theodoropoulos, P.B. Singh, T. Giannakouros, and S.D. Georgatos. 2001. Histones H3/H4 form a tight complex with the inner nuclear membrane protein L BR and heterochromatin protein 1. EMBO Rep 2:920-5. Powell, L., and B. Burke. 1990. Internuclear exhc hange of an inner nuclear membrane protein (p55) in heterokaryons: in vivo evidence for th e association of p55 with the nuclear lamina. J. Cell Biol. 111:2225-2234. Prot, M., L. Heripret, N. Car dot-Leccia, C. Perrin, M. Aouadi, T. Lavrut, R. Garraffo, P. Dellamonica, J. Durant, Y. Le Marchand-Brustel, and B. Binetruy. 2006. Long-term treatment with lopinavir-ritonavir induces a re duction in peripheral ad ipose depots in mice. Antimicrob Agents Chemother 50:3998-4004. Rabut, G., V. Doye, and J. Ellenberg. 2004. Ma pping the dynamic organization of the nuclear pore complex inside single living cells. Nat Cell Biol 6:1114-21. Rasala, B.A., C. Ramos, A. Harel, and D.J. Forbes. 2008. Capture of AT-rich chromatin by ELYS recruits POM121 and NDC1 to initiate nuclear pore assembly. Mol Biol Cell 19:3982-96. Raska, I., P.J. Shaw, and D. Cmarko. 2006a. Ne w insights into nucleol ar architecture and activity. Int Rev Cytol 255:177-235. Raska, I., P.J. Shaw, and D. Cmarko. 2006b. Stru cture and function of the nucleolus in the spotlight. Curr Opin Cell Biol. 18:325-34. Ris, H. 1997. High-resolution field-emission s canning electron microscopy of nuclear pore complex. Scanning. 19:368-75. Rober, R.A., H. Sauter, K. Weber, and M. Osborn. 1990. Cells of the cellular immune and hemopoietic system of the mouse lack lamins A/C: distinction versus other somatic cells. J Cell Sci 95 ( Pt 4):587-98. Rober, R.A., K. Weber, and M. Osborn. 1989. Differential timing of nuclear lamin A/C expression in the various organs of the mouse embryo and the young animal: a developmental study. Development 105:365-78. Rollenhagen, C., P. Muhlhausser, U. Kutay, and N. Pante. 2003. Importin beta-depending nuclear import pathways: role of the adapter proteins in the docking and releasing steps. Mol Biol Cell 14:2104-15. Rout, M.P., J.D. Aitchison, A. Suprapto, K. Hjertaas, Y. Zhao, and B.T. Chait. 2000. The yeast nuclear pore complex: composition, arch itecture, and transport mechanism. J Cell Biol 148:635-51. Rout, M.P., and S.R. Wente. 1994. Pores fo r thought: nuclear pore complex proteins. Trends Cell Biol. 4:357-365.

PAGE 120

120 Roux, K.J., and B. Burke. 2006. From pore to kinetochore and back: regulating envelope assembly. Dev Cell 11:276-8. Rusinol, A.E., and M.S. Sinensky. 2006. Farnesylat ed lamins, progeroid syndromes and farnesyl transferase inhibitors. J Cell Sci 119:3265-72. Saksena, S., M.D. Summers, J.K. Burks, A.E. Johnson, and S.C. Braunagel. 2006. Importinalpha-16 is a translocon-associat ed protein involved in sorting membrane proteins to the nuclear envelope. Nat Struct Mol Biol 13:500-8. Sarkar, P.K., C. D'Souza, and S. Ballantyne 2001. Treatment of aneurysmal subarachnoid haemorrhage in elderly patients. J Clin Pharm Ther 26:247-56. Scaffidi, P., and T. Misteli. 2005. Reversal of the cellular phenotype in the premature aging disease Hutchinson-Gilford progeria syndrome. Nat Med 11:440-5. Schirmer, E.C., L. Florens, T. Guan, J.R. Yate s, 3rd, and L. Gerace. 2005. Identification of novel integral membrane proteins of the nuclear envelope with potential disease links using subtractive proteomics. Novartis Found Symp 264:63-76; discussion 76-80, 227-30. Schirmer, E.C., and L. Gerace. 2004. The stability of the nuclear lamina polymer changes with the composition of lamin subtypes according to their individual binding strengths. J Biol Chem 279:42811-7. Sevenants, L., C. Wouters, A. De Sandre-Giovannoli, H. Devlieger, K. Devriendt, J.J. van den Oord, K. Marien, N. Levy, and M.A. Morren. 2005. Tight skin and limited joint movements as early presentation of HutchinsonGilford progeria in a 7-week-old infant. Eur J Pediatr 164:283-6. Shackleton, S., D.J. Lloyd, S.N. Jackson, R. Evans, M.F. Niermeijer, B.M. Singh, H. Schmidt, G. Brabant, S. Kumar, P.N. Du rrington, S. Gregory, S. O'Rahilly, and R.C. Trembath. 2000. LMNA, encoding lamin A/C, is mutated in partial lipodystrophy. Nat Genet. 24:153-6. Shao, X., H.A. Tarnasky, J.P. Lee, R. Oko, and F.A. van der Hoorn. 1999. Spag4, a novel sperm protein, binds outer dense-fiber protein Odf1 and localizes to microtubules of manchette and axoneme. Dev Biol. 211:109-23. Shumaker, D.K., T. Dechat, A. Kohlmaier, S.A. Adam, M.R. Bozovsky, M.R. Erdos, M. Eriksson, A.E. Goldman, S. Khuon, F.S. Collins, T. Jenuwein, and R.D. Goldman. 2006. Mutant nuclear lamin A leads to progressive al terations of epigenetic control in premature aging. Proc Natl Acad Sci U S A. 103:8703-8. Shumaker, D.K., K.K. Lee, Y.C. Tanhehco, R. Craigie, and K.L. Wilson. 2001. LAP2 binds to BAF.DNA complexes: requirement for the LEM domain and modulation by variable regions. Embo J 20:1754-64.

PAGE 121

121 Shumaker, D.K., L. Solimando, K. Sengupta, T. Sh imi, S.A. Adam, A. Grunwald, S.V. Strelkov, U. Aebi, M.C. Cardoso, and R.D. Goldman. 2008. The highly conserved nuclear lamin Igfold binds to PCNA: its role in DNA replication. J Cell Biol 181:269-80. Sinensky, M., L.A. Beck, S. Leonard, and R. Ev ans. 1990. Differential in hibitory effects of lovastatin on protein isoprenylation and sterol synthesis. J Biol Chem 265:19937-41. Sinensky, M., K. Fantle, M. Trujillo, T. McLain, A. Kupfer, and M. Dalton. 1994. The processing pathway of prelamin A. J. Cell Sci. 107:61-67. Soullam, B., and H.J. Worman. 1995. Signals and structural features i nvolved in integral membrane protein targeting to the inner nuclear membrane. J. Cell Biol. 130:15-27. Speckman, R.A., A. Garg, F. Du, L. Bennett, R. Veile, E. Arioglu, S.I. Taylor, M. Lovett, and A.M. Bowcock. 2000. Mutational and haplotype an alyses of families with familial partial lipodystrophy (Dunnigan variety) reveal recurrent missense mu tations in the globular Cterminal domain of lamin A/C. Am J Hum Genet 66:1192-8. Stade, K., C.S. Ford, C. Guthrie, and K. Weis 1997. Exportin 1 (Crm1p) is an essential nuclear export factor. Cell 90:1041-50. Starr, D.A. 2007. Communication between the cytosk eleton and the nuclear envelope to position the nucleus. Mol Biosyst 3:583-9. Starr, D.A., and M. Han. 2002. Role of ANC-1 in tethering nuclei to the actin cytoskeleton. Science 298:406-9. Starr, D.A., G.J. Hermann, C.J. Malone, W. Fi xsen, J.R. Priess, H.R. Horvitz, and M. Han. 2001. unc-83 encodes a novel component of the nuclear envelope and is essential for proper nuclear migration. Development 128:5039-50. Stavru, F., B.B. Hulsmann, A. Spang, E. Hartma nn, V.C. Cordes, and D. Gorlich. 2006. NDC1: a crucial membrane-integral nucleoporin of metazoan nuclear pore complexes. J Cell Biol 173:509-19. Stoffler, D., B. Fahrenkrog, and U. Aebi. 1999. The nuclear pore complex: from molecular architecture to functional dynamics. Curr Opin Cell Biol. 11:391-401. Stuurman, N., S. Heins, and U. Aebi. 1998. Nuclear lamins: their structure, assembly, and interactions. J Struct Biol 122:42-66. Sullivan, T., D. Escalante-Alcalde, H. Bhatt, M. Anver, N. Bhat, K. Nagashima, C.L. Stewart, and B. Burke. 1999. Loss of A-type lamin expression compromises nuclear envelope integrity leading to muscular dystrophy. J Cell Biol 147:913-20.

PAGE 122

122 Taylor, M.R., D. Slavov, A. Gajewski, S. Vlcek, L. Ku, P.R. Fain, E. Carniel, A. Di Lenarda, G. Sinagra, M.M. Boucek, J. Cavanaugh, S.L. Graw, P. Ruegg, J. Feiger, X. Zhu, D.A. Ferguson, M.R. Bristow, J. Gotzmann, R. Foisner, and L. Mestroni. 2005. Thymopoietin (lamina-associated polypeptide 2) gene mutation associated with dilated cardiomyopathy. Hum Mutat 26:566-74. Toth, J.I., S.H. Yang, X. Qiao, A.P. Beigneux, M.H. Gelb, C.L. Moulson, J.H. Miner, S.G. Young, and L.G. Fong. 2005. Blocking protein farn esyltransferase improves nuclear shape in fibroblasts from humans with progeroid syndromes. Proc Natl Acad Sci U S A 102:12873-8. Tran, E.J., and S.R. Wente. 2006. Dynamic nuclear pore complexes: life on the edge. Cell 125:1041-53. Tzur, Y.B., K.L. Wilson, and Y. Gruenbaum. 2006. S UN-domain proteins: 'Velcro' that links the nucleoskeleton to the cytoskeleton. Nat Rev Mol Cell Biol 7:782-8. Varela, I., J. Cadinanos, A.M. Pendas, A. Gutierr ez-Fernandez, A.R. Folgueras, L.M. Sanchez, Z. Zhou, F.J. Rodriguez, C.L. Stewart, J.A. Vega, K. Tryggvason, J.M. Freije, and C. Lopez-Otin. 2005. Accelerated ageing in mice de ficient in Zmpste24 protease is linked to p53 signalling activation. Nature. 437:564-8. Varela, I., S. Pereira, A.P. Ugalde, C.L. Na varro, M.F. Suarez, P. Cau, J. Cadinanos, F.G. Osorio, N. Foray, J. Cobo, F. de Carlos, N. Levy, J.M. Freije, and C. Lopez-Otin. 2008. Combined treatment with statins and ami nobisphosphonates extends longevity in a mouse model of human premature aging. Nat Med 14:767-72. Verstraeten, V.L., J.L. Broers, M.A. van Steensel, S. Zinn-Justin, F.C. Ramaekers, P.M. Steijlen, M. Kamps, H.J. Kuijpers, D. Merckx, H.J. Sm eets, R.C. Hennekam, C.L. Marcelis, and A. van den Wijngaard. 2006. Compound heterozy gosity for mutations in LMNA causes a progeria syndrome without prelamin A accumulation. Hum Mol Genet 15:2509-22. Voeltz, G.K., W.A. Prinz, Y. Shibata, J.M. Ri st, and T.A. Rapoport. 2006. A class of membrane proteins shaping the tubular endoplasmic reticulum. Cell 124:573-86. Wagner, N., D. Weber, S. Seitz, and G. Krohne. 2004. The lamin B receptor of Drosophila melanogaster. J Cell Sci 117:2015-28. Wang, Q., X. Du, Z. Cai, and M.I. Greene. 2006. Characterization of the structures involved in localization of the SUN proteins to th e nuclear envelope and the centrosome. DNA Cell Biol 25:554-62. Watson, M.L. 1955. The nuclear envelope: its struct ure in relation to cy toplasmic membranes. J Biophys Biochem Cytol. 1:257-70. Welte, M.A., S.P. Gross, M. Postner, S.M. Block, and E.F. Wieschaus. 1998. Developmental regulation of vesicle transport in Dr osophila embryos: forces and kinetics. Cell 92:547-57.

PAGE 123

123 Wiese, C., and K.L. Wilson. 1993. Nuclear membrane dynamics. Curr Opin Cell Biol 5:387-94. Wilhelmsen, K., M. Ketema, H. Truong, and A. Sonnenberg. 2006. KASH-do main proteins in nuclear migration, anchorage and other processes. J Cell Sci 119:5021-9. Wilhelmsen, K., S.H. Litjens, I. Kuikman, N. Tshimbalanga, H. Janssen, I. van den Bout, K. Raymond, and A. Sonnenberg. 2005. Nesprin-3, a novel outer nuclear membrane protein, associates with the cytoskeletal linker protein plectin. J Cell Biol 171:799-810. Worman, H.J., and J.C. Courvalin. 2004. How do mutations in lamins A and C cause disease? J Clin Invest 113:349-51. Worman, H.J., and G.G. Gundersen. 2006. Here come the SUNs: a nucleocytoskeletal missing link. Trends Cell Biol 16:67-9. Xing, X.W., L.Y. Li, J.J. Fu, W. B. Zhu, G. Liu, S.F. Liu, and G. X. Lu. 2003. [Cloning of cDNA of TSARG4, a human spermatogenesis related gene]. Sheng Wu Hua Xue Yu Sheng Wu Wu Li Xue Bao (Shanghai) 35:283-8. Yang, S.H., M.O. Bergo, J.I. Toth, X. Qiao, Y. Hu, S. Sandoval, M. Meta, P. Bendale, M.H. Gelb, S.G. Young, and L.G. Fong. 2005. Blocking protein farnesyltransferase improves nuclear blebbing in mouse fibroblasts with a targeted Hutchinson-Gilford progeria syndrome mutation. Proc Natl Acad Sci U S A 102:10291-6. Yang, S.H., X. Qiao, L.G. Fong, and S.G. Youn g. 2008. Treatment with a farnesyltransferase inhibitor improves survival in mice with a Hutchinson-Gilford progeria syndrome mutation. Biochim Biophys Acta 1781:36-9. Ye, Q., I. Callebaut, A. Pezhman, J.C. Courvalin, and H.J. Worman. 1997. Domain-specific interactions of human HP1-t ype chromodomain proteins and inner nuclear membrane protein LBR. J Biol Chem 272:14983-9. Ye, Q., and H.J. Worman. 1996. Interaction between an integral protein of the nuclear envelope inner membrane and human chromodomain proteins homologous to Drosophila HP1. J Biol Chem 271:14653-6. Yong, D.L.-Y., and G.W. Hart. 1994. Purification and characterization of an O-glcNAc selective N-acetyl-D-glucosaminidase from rat spleen cytosol. J. Biol. Chem. 269:19321-19330. Yu, J., D.A. Starr, X. Wu, S.M. Parkhurst, Y. Zhuang, T. Xu, R. Xu, and M. Han. 2006. The KASH domain protein MSP-300 plays an essential role in nuclear anchoring during Drosophila oogenesis. Dev Biol. 289:336-45. Zastrow, M.S., S. Vlcek, and K.L. Wilson. 2004. Pr oteins that bind A-type lamins: integrating isolated clues. J Cell Sci 117:979-87.

PAGE 124

124 Zhang, Q., C.D. Ragnauth, J.N. Skepper, N.F. Worth, D.T. Warren, R.G. Roberts, P.L. Weissberg, J.A. Ellis, and C.M. Shanahan. 2005. Nesprin-2 is a multi-isomeric protein that binds lamin and emerin at the nuclear envelope and forms a subcellula r network in skeletal muscle. J Cell Sci 118:673-87. Zhang, Q., J.N. Skepper, F. Yang, J.D. Davies, L. Hegyi, R.G. Roberts, P.L. Weissberg, J.A. Ellis, and C.M. Shanahan. 2001. Nesprins: a nov el family of spectrin-repeat-containing proteins that localize to the nucle ar membrane in multiple tissues. J Cell Sci 114:4485-98. Zhang, X., R. Xu, B. Zhu, X. Yang, X. Ding, S. Duan, T. Xu, Y. Zhuang, and M. Han. 2007. Syne-1 and Syne-2 play crucial roles in myonuclear anchorage and motor neuron innervation. Development. 134:901-8. Zhen, Y.Y., T. Libotte, M. Munck, A.A. Noeg el, and E. Korenbaum. 2002. NUANCE, a giant protein connecting the nucl eus and actin cytoskeleton. J Cell Sci 115:3207-22.

PAGE 125

125 BIOGRAPHICAL SKETCH Born and raised in Shandong Jinan, China, Qian L iu is the dau ghter of Xiaoquan Wang and Zhaoxiang Liu. She graduated from Experimental High School (Jinan, China). She then went on to study medicine in Shandong University, College of Medicine (China) where she received a Bachelor of Medicine degree in 2002. After graduating, she continued her medi cal education in a master program in the Department of Cardiol ogy, Internal medicine. In the fall of 2003, Qian entered the Interdisciplinary Program for Biomedical Sciences at the University of Florida where she later joined the lab of Brian Burke in the Department of Anatomy and Cell Biology to pursue her doctoral degree.